U.S. patent application number 11/830610 was filed with the patent office on 2009-03-12 for defensin- specific antibodies.
This patent application is currently assigned to HEXIMA LIMITED. Invention is credited to MARILYN ANNE ANDERSON, ROBYN LOUISE HEATH, FUNG TSO LAY.
Application Number | 20090069545 11/830610 |
Document ID | / |
Family ID | 23018064 |
Filed Date | 2009-03-12 |
United States Patent
Application |
20090069545 |
Kind Code |
A1 |
ANDERSON; MARILYN ANNE ; et
al. |
March 12, 2009 |
Defensin- specific antibodies
Abstract
The present invention provides nucleic acid molecules derived
from Nicotiana alata, which encode defensin-like molecules. The
present invention contemplates the use of such nucleic acid
molecules in the generation of transgenic plants having resistance
or at least reduced sensitivity to plant pests including insects,
microorganisms, fungi and/or viruses. The transgenic plants
provided by the present invention include monocotyledonous and
dicotyledonous plants, and particularly include crop plants and
ornamental flowering plants.
Inventors: |
ANDERSON; MARILYN ANNE;
(KEILOR, AU) ; LAY; FUNG TSO; (RESERVOIR, AU)
; HEATH; ROBYN LOUISE; (CLIFTON HILL, AU) |
Correspondence
Address: |
GREENLEE WINNER AND SULLIVAN P C
4875 PEARL EAST CIRCLE, SUITE 200
BOULDER
CO
80301
US
|
Assignee: |
HEXIMA LIMITED
MELBOURNE
AU
|
Family ID: |
23018064 |
Appl. No.: |
11/830610 |
Filed: |
July 30, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11062999 |
Feb 22, 2005 |
7297840 |
|
|
11830610 |
|
|
|
|
10072809 |
Feb 8, 2002 |
7041877 |
|
|
11062999 |
|
|
|
|
11372761 |
Mar 10, 2006 |
|
|
|
10072809 |
|
|
|
|
11372771 |
Mar 10, 2006 |
|
|
|
11372761 |
|
|
|
|
60267271 |
Feb 8, 2001 |
|
|
|
Current U.S.
Class: |
530/387.9 ;
530/391.3 |
Current CPC
Class: |
C12N 15/8281 20130101;
C12N 15/8282 20130101; C12N 15/8283 20130101; A01N 65/38 20130101;
C12N 15/8286 20130101; Y02A 40/146 20180101; A01N 37/46 20130101;
A01N 65/20 20130101; Y02A 40/162 20180101; C12N 15/8279 20130101;
C07K 14/415 20130101 |
Class at
Publication: |
530/387.9 ;
530/391.3 |
International
Class: |
C07K 16/18 20060101
C07K016/18 |
Claims
1. An isolated antibody which specifically binds a peptide
comprising the sequence of amino acids set forth in SEQ ID NO:8,
wherein said peptide has activity against a plant pest.
2. An isolated antibody of claim 1 wherein the antibody is a
polyclonal antibody.
3. An isolated antibody of claim 2 wherein the antibody is an IgG
fraction antibody.
4. An isolated antibody of claim 1 reactive to a defensin molecule
having a C-terminus amino acid sequence as set forth in SEQ ID
NO:12.
5. An isolated antibody of claim 1 reactive to a defensin molecule
having an N-terminus sequence as set forth in SEQ ID NO:10.
6. An isolated antibody of claim 1 reactive to a defensin molecule
having an N-terminus amino acid sequence as set forth in SEQ ID
NO:18.
7. An isolated antibody of claim 1 labeled with a reporter
molecule.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S. patent
application Ser. No. 11/062,999, filed Feb. 22, 2005; which is a
continuation application of U.S. patent application Ser. No.
10/072,809, filed Feb. 8, 2002, issued as U.S. Pat. No. 7,041,877;
which claims benefit of U.S. Provisional Application No.
60/267,271, filed Feb. 8, 2001; and this application also claims
benefit of U.S. patent application Ser. No. 11/372,761, filed Mar.
10, 2006, and U.S. patent application Ser. No. 11/372,771, filed
Mar. 10, 2006; all of which are incorporated herein in their
entirety to the extent not inconsistent herewith.
FIELD OF INVENTION
[0002] The present invention provides genetic molecules encoding
plant floral defensin-like molecules and their use in generating
transgenic plants having resistance or at least reduced sensitivity
to plant pests including insects, microorganisms, fungi and/or
viruses. The present invention further provides for the use of
floral- and seed-derived defensins in the generation of insect
resistance in plants. The plants may be monocotyledonous or
dicotyledonous plants and are in particular, crop plants and
ornamental flowering plants. The genetic molecules are also useful
in generating recombinant defensin-like molecules for use in the
topical application of compositions to prevent or otherwise retard
pest-infestation of plants. The floral defensin-like molecules or
genetic molecules encoding same of the present invention may be
used alone or in combination with other agents such as a proteinase
inhibitor precursor or a nucleic acid molecule encoding same or
other molecules or their encoding nucleotide sequences.
BACKGROUND OF THE INVENTION
[0003] Reference to any prior art in this specification is not, and
should not be taken as, an acknowledgment or any form of suggestion
that this prior art forms part of the common general knowledge in
Australia or any other country.
[0004] The increasing sophistication of recombinant DNA techniques
is greatly facilitating research and development in the
agricultural industry. This is particularly the case in the
horticultural area including the area of crop research. Of
particular importance are the development of herbicide resistant
plants and the development of pathogen resistant plants.
[0005] A number of approaches have been adopted to induce herbicide
resistance in plants. For example, genes encoding enzymes, which
deactivate or neutralize the active components of herbicides, have
been expressed in plants. Whilst there has been some success in
this approach, it is one component of a multi-disciplined and
multi-strategy approach to maximizing yields of crops and products
of crops and for maximizing returns from other activities within
the agricultural and horticultural industries.
[0006] One of the major difficulties facing the agricultural and
horticultural industries is the control of insect and other
pathogen infestation of plants. Insects and other pathogens account
for millions of tonnes of lost production on an annual basis.
Although insecticides and other anti-pathogenic chemical agents
have been successfully employed, there is a range of environmental
and regulatory concerns with the continued use of chemical agents
to control plant pests. Furthermore, the increasing use of chemical
pesticides is providing selective pressure for the emergence of
resistance in populations of pests. There is clearly a need to
further investigate alternative mechanisms of inducing resistance
in plants to pathogens such as insects, microorganisms, fungi,
arachnid and viruses.
[0007] A range of genetic measures has been adopted in test trials.
Whilst some success has been achieved, it is important for new and
alternative genetic approaches to be developed to combat the
difficulties of resistance.
[0008] One approach which has been suggested is the use of a group
of proteins collectively known as "defensins". The defensins have
previously been known as .gamma.-thionins and are structurally
distinct from the .alpha.- and .beta.-thionin families. Most
defensins isolated and studied to date have been derived from
seeds, especially those from Raphanus sativus and other members of
the Brassicaceae family. Seed defensins are small (.about.5 kDa)
basic, cysteine-rich proteins and many have anti-fungal
activity.
[0009] Over the last few years several cDNA clones have been
isolated from the floral organs of solanaceous plants and
Arabidopsis that encode proteins that are related to seed
defensins. Unlike seed defensins, floral defensins are produced
from precursor proteins that have an acidic C-terminal domain in
addition to the defensin domain. The role of this acidic domain is
unknown.
[0010] The defensin domain has little sequence in common with
seed-derived defensins apart from eight cysteine residues that are
strongly conserved. Although several cDNAs, which encode floral
defensins, have been isolated, the corresponding proteins have not
been isolated and their biological function has not been examined.
The inventors have isolated both the cDNA and the corresponding
floral defensin from the ornamental tobacco Nicotiana alata. They
have determined that the defensin precursor is processed
proteolytically to release mature defensin from the acidic
C-terminal domain.
[0011] In accordance with the present invention, the inventors have
determined that floral defensins have useful properties in
inhibiting plant pest attack or infestation. Furthermore, a floral
defensin from Nicotiana alata is shown to be particularly effective
in controlling insect attack. The present invention also provides a
new use of seed and known floral defensins in the control of insect
infestation of plants.
SUMMARY OF THE INVENTION
[0012] Throughout this specification, unless the context requires
otherwise, the word comprise, or variations such as "comprises" or
"comprising", will be understood to imply the inclusion of a stated
element or integer or group of elements or integers but not the
exclusion of any other element or integer or group of elements or
integers.
[0013] Nucleotide and amino acid sequences are referred to by a
sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond
numerically to the sequence identifiers <400>1, <400>2,
etc. A sequence listing is provided after the claims.
[0014] The present invention relates generally to genetic molecules
alone or in combination with other genetic molecules and their use
to induce resistance in plants or parts of plants to pathogen
infestation such as but not limited to insect infestation. More
particularly, the present invention provides genetic molecules
encoding defensin-like molecules alone or in combination with
genetic molecules encoding a proteinase inhibitor or precursor
thereof or other active molecule to inhibit insect, microbial,
fungal, arachnid or viral attack or other form of infestation in
plants. The present invention further encompasses compositions
comprising the defensin-like molecules alone or in combination with
a proteinase inhibitor or precursor thereof or other active
molecule for topical application to plants or parts of plants to
assist in the control of insect, microbial, fungal, arachnid or
viral infestation of plants. The present invention further
contemplates the use of the subject genetic molecules in the
manufacture of transgenic plants with resistance or at least
reduced susceptibility to insect, microbial, fungal, arachnid or
viral attack or other form of infestation. The defensin molecules
may also be used as molecular frameworks to carry heterologous
amino acid sequences where the folding of the molecule is altered
to a more active form. The present invention further encompasses
genetic constructs comprising a promoter and/or other regulatory
sequence naturally associated with the gene encoding the
defensin-like molecule. The promoter and/or other regulatory
sequence may be operably linked to a cDNA molecule encoding the
defensin-like protein or may be operably linked to another gene or
nucleotide sequence of interest such as but not limited to a gene
encoding a proteinase inhibitor precursor. The present invention
still further extends to transgenic plants or parts of transgenic
plants with resistance or at least reduced sensitivity to attack or
other form of infestation by insects, microorganisms, fungi and/or
viruses. Particularly preferred plants are food and non-food crops
such as cotton plants.
[0015] Accordingly, one aspect of the present invention provides an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding or complementary to a sequence encoding a polypeptide
comprising, in its precursor form, an N-terminal signal domain, a
mature domain and an acidic C-terminal domain wherein said
polypeptide is produced during flower development and its mature
domain has activity against one or more plant pests.
[0016] Another aspect of the present invention is directed to an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding or complementary to a sequence encoding a polypeptide
comprising, in its precursor form, an N-terminal signal domain, a
mature domain and an acidic C-terminal domain wherein said
polypeptide is produced during flower development and its mature
domain comprises the structure:
TABLE-US-00001 (SEQ ID NO;62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.22C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39C.sub.VIII
[0017] wherein "a" may be the same or different and represents any
amino acid residue, the numerical subscript on each "a" represents
its position in the amino acid sequence and "C" represents a
cysteine residue at a position indicated by its Roman numeral and
wherein the mature domain has activity against one or more plant
pests with the proviso that the polypeptide is not FST or TPP3.
[0018] A further aspect of the present invention contemplates an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding or complementary to a sequence encoding a polypeptide
comprising, in its precursor form, an N-terminal signal domain, a
mature domain and an acidic C-terminal domain wherein said
polypeptide is produced in the epidermal layers of petals and
sepals, the cortical cells of the style and the connective tissue
of the anthers and its mature domain comprises the structure:
TABLE-US-00002 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
[0019] wherein "a" may be the same or different and represents any
amino acid residue, the numerical subscript on each "a" represents
its position in the amino acid sequence and "C" represents a
cysteine residue at a position indicated by its Roman numeral and
wherein the mature domain has activity against one or more plant
pests with the proviso that the polypeptide is not FST or TPP3.
[0020] Still another aspect of the present invention provides an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding or complementary to a sequence encoding a polypeptide
comprising, in its precursor form, an N-terminal signal domain, a
mature domain and an acidic C-terminal domain wherein said mature
domain comprises the amino acid sequence set forth in SEQ ID NO:8
or an amino acid sequence having at least about 70% similarity
thereto or is encoded by a nucleotide sequence set forth in SEQ ID
NO:7 or a nucleotide sequence having at least about 70% similarity
thereto or a nucleotide sequence capable of hybridizing to SEQ ID
NO:7 or its complementary form under low stringency conditions at
42.degree. C.
[0021] Still a further aspect of the present invention provides a
genetic construct comprising a promoter or functional equivalent
thereof operably linked to a nucleotide sequence encoding a
floral-derived, defensin-like molecule having a mature domain
comprising the amino acid sequence:
TABLE-US-00003 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
[0022] wherein "a" may be the same or different and represents any
amino acid residue, the numerical subscript on each "a" represents
its position in the amino acid sequence and "C" represents a
cysteine residue at a position indicated by its Roman numeral and
wherein said mature domain exhibits inhibitory activity against
plant pests such as insect pests with the proviso that the
defensin-like molecule is not FST or TPP3.
[0023] Yet another aspect of the present invention is directed to
the amino acid sequence of the mature domain comprising the amino
acid sequence [SEQ ID NO:58]:
TABLE-US-00004
X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34SX.sub.35X.sub.36FX.sub.37GX.sub-
.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.43
CX.sub.44X.sub.45X.sub.46CX.sub.47X.sub.48EX.sub.49FX.sub.50X.sub.51GX.sub-
.52CX.sub.53X.sub.54X.sub.55X.sub.56X.sub.57
X.sub.58CX.sub.59CTX.sub.60X.sub.61C
wherein
[0024] X.sub.30=R or Q
[0025] X.sub.31=E, I or T
[0026] X.sub.32=K or E
[0027] X.sub.33=T, A or S
[0028] X.sub.34=E, P or Q
[0029] X.sub.35=N, Q or H
[0030] X.sub.36=T or R
[0031] X.sub.37=P, K or H
[0032] X.sub.38=I, L, P or T
[0033] X.sub.39=I, F, S or V
[0034] X.sub.40=T, M, R or S
[0035] X.sub.41=K, D, E or A
[0036] X.sub.42=P or S
[0037] X.sub.43=P, S or N
[0038] X.sub.44=R or A
[0039] X.sub.45=K, T, S or N
[0040] X.sub.46=A, Y or V
[0041] X.sub.47=I, L, Q or H
[0042] X.sub.48=S, K, T or N
[0043] X.sub.49=K or G
[0044] X.sub.50=T, S, I, or V
[0045] X.sub.51=D or G
[0046] X.sub.52=H, R, or N
[0047] X.sub.53=S, P or R
[0048] X.sub.54=K, W, A or G
[0049] X.sub.55=I, L or F
[0050] X.sub.56=L, Q, P or R
[0051] X.sub.57=R or P
[0052] X.sub.58=R or K
[0053] X.sub.59=L or F
[0054] X.sub.60=K, S or R
[0055] X.sub.61=P, N or H
[0056] Yet a further aspect of the present invention is directed to
the mature domain-encoding sequence operably linked to a signal
domain comprising the amino acid sequence [SEQ ID NO:59]:
TABLE-US-00005
MX.sub.1X.sub.2SX.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9X.sub.10-
X.sub.11X.sub.12X.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18
X.sub.19X.sub.20X.sub.21X.sub.22X.sub.23X.sub.24X.sub.25X.sub.26X.sub.27X.-
sub.28AX.sub.29
wherein
[0057] X.sub.1=A, G or K
[0058] X.sub.2=R, N, or L
[0059] X.sub.3=L, I or M
[0060] X.sub.4=C, F or R
[0061] X.sub.5=F or L
[0062] X.sub.6=M, F or I
[0063] X.sub.7=A or S
[0064] X.sub.8=F, T or A
[0065] X.sub.9=A, L, V or F
[0066] X.sub.10=I, V, L or F
[0067] X.sub.11=L or I
[0068] X.sub.12=A, or M
[0069] X.sub.13=M, A or F
[0070] X.sub.14=M or L
[0071] X.sub.15=L or I
[0072] X.sub.16=F or V
[0073] X.sub.17=V, T or L
[0074] X.sub.18=A, T or S
[0075] X.sub.19=Y or T
[0076] X.sub.20=E or G
[0077] X.sub.21=V or M
[0078] X.sub.22=no amino acid or G
[0079] X.sub.23=no amino acid or P
[0080] X.sub.24=no amino acid, M or V
[0081] X.sub.25=no amino acid or T
[0082] X.sub.26=no amino acid, I or S
[0083] X.sub.27=no amino acid, A or V
[0084] X.sub.28=Q or E
[0085] X.sub.29=no amino acid or Q
[0086] Even still another aspect of the present invention is
directed to the mature domain-encoding sequence operably linked to
an acidic C-terminal domain comprising the sequence [SEQ ID
NO:60]:
TABLE-US-00006
X.sub.62X.sub.63X.sub.64X.sub.65X.sub.66X.sub.67X.sub.68X.sub.69X.sub.70X-
.sub.71X.sub.72X.sub.73X.sub.74X.sub.75X.sub.76X.sub.77
X.sub.78X.sub.80X.sub.81X.sub.82X.sub.83X.sub.84X.sub.85X.sub.86X.sub.87X.-
sub.88X.sub.89X.sub.90X.sub.91X.sub.92X.sub.93X.sub.94 X.sub.95
wherein
[0087] X.sub.62=no amino acid or V
[0088] X.sub.63=no amino acid or F
[0089] X.sub.64=no amino acid or D
[0090] X.sub.65=no amino acid or E or K
[0091] X.sub.66=no amino acid or K or I
[0092] X.sub.67=no amino acid or M or S
[0093] X.sub.68=no amino acid or T, I or S
[0094] X.sub.69=no amino acid or K or E
[0095] X.sub.70=no amino acid or T or V
[0096] X.sub.71=no amino acid or G or K
[0097] X.sub.72=no amino acid or A
[0098] X.sub.73=no amino acid or E
[0099] X.sub.74=no amino acid or I or T
[0100] X.sub.75=no amino acid or L
[0101] X.sub.76=no amino acid or A, V or G
[0102] X.sub.77=no amino acid or E
[0103] X.sub.78=no amino acid or E
[0104] X.sub.79=no amino acid or A
[0105] X.sub.80=no amino acid or K
[0106] X.sub.81=no amino acid or T
[0107] X.sub.82=no amino acid or L
[0108] X.sub.83=no amino acid or A or S
[0109] X.sub.84=no amino acid or A or E
[0110] X.sub.85=no amino acid or A or V
[0111] X.sub.86=no amino acid or L or V
[0112] X.sub.87=no amino acid or L
[0113] X.sub.88=no amino acid or E
[0114] X.sub.89=no amino acid or E
[0115] X.sub.90=no amino acid or E
[0116] X.sub.91=no amino acid or I
[0117] X.sub.92=no amino acid or M
[0118] X.sub.93=no amino acid or D or M
[0119] X.sub.94=no amino acid or N or E
[0120] Even yet another aspect of the present invention is directed
to the defensin-like molecule comprising the sequence [SEQ ID
NO:61]:
TABLE-US-00007
MX.sub.1X.sub.2SX.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9X.sub.10-
X.sub.11X.sub.12X.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18X.sub.19
X.sub.20X.sub.21X.sub.22X.sub.23X.sub.24X.sub.25X.sub.26X.sub.27X.sub.28AX-
.sub.29X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34S
X.sub.35X.sub.36FX.sub.37GX.sub.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.4-
3CX.sub.44X.sub.45X.sub.46CX.sub.47X.sub.48E
X.sub.49FX.sub.50X.sub.51GX.sub.52CX.sub.53X.sub.54X.sub.55X.sub.56X.sub.5-
7X.sub.58CX.sub.59CTX.sub.60X.sub.61CX.sub.62
X.sub.63X.sub.64X.sub.65X.sub.66X.sub.67X.sub.68X.sub.69X.sub.70X.sub.71X.-
sub.72X.sub.73X.sub.74X.sub.75X.sub.76X.sub.77X.sub.78
X.sub.79X.sub.80X.sub.81X.sub.82X.sub.83X.sub.84X.sub.85X.sub.86X.sub.87X.-
sub.88X.sub.89X.sub.90X.sub.91X.sub.92X.sub.93X.sub.94
wherein
[0121] X.sub.1=A, G or K
[0122] X.sub.2=R, N, or L
[0123] X.sub.3=L, I or M
[0124] X.sub.4=C, For R
[0125] X.sub.5=F or L
[0126] X.sub.6=M, F or I
[0127] X.sub.7=A or S
[0128] X.sub.8=F, T or A
[0129] X.sub.9=A, L, V or F
[0130] X.sub.10=I, V, L or F
[0131] X.sub.11=L or I
[0132] X.sub.12=A, I or M
[0133] X.sub.13=M, A or F
[0134] X.sub.14=M or L
[0135] X.sub.15=L or I
[0136] X.sub.16=F or V
[0137] X.sub.17=V, T or L
[0138] X.sub.18=A, T or S
[0139] X.sub.19=Y or T
[0140] X.sub.20=E or G
[0141] X.sub.21=V or M
[0142] X.sub.22=no amino acid or G
[0143] X.sub.23=no amino acid or P
[0144] X.sub.24=no amino acid, M or V
[0145] X.sub.25=no amino acid or T
[0146] X.sub.26=no amino acid, I or S
[0147] X.sub.27=no amino acid or A or V
[0148] X.sub.28=Q or E
[0149] X.sub.29=no amino acid or Q
[0150] X.sub.30=R or Q
[0151] X.sub.31=E, or T
[0152] X.sub.32=K or E
[0153] X.sub.33=I, A or S
[0154] X.sub.34=E, P or Q
[0155] X.sub.35=N, Q or H
[0156] X.sub.36=T or R
[0157] X.sub.37=P, K or H
[0158] X.sub.38=I, L, P or T
[0159] X.sub.39=I, F, S or V
[0160] X.sub.40=T, M, R or S
[0161] X.sub.41=K, D, E or A
[0162] X.sub.42=P or S
[0163] X.sub.43=P, S or N
[0164] X.sub.44=R or A
[0165] X.sub.45=K, T, S or N
[0166] X.sub.46=A, Y or V
[0167] X.sub.47=I, L, Q or H
[0168] X.sub.48=S, K, T or N
[0169] X.sub.49=K or G
[0170] X.sub.50=T, S, I, or V
[0171] X.sub.51=D or G
[0172] X.sub.52=H, R, or N
[0173] X.sub.53=S, P or R
[0174] X.sub.54=K, W, A or G
[0175] X.sub.55=I, L or F
[0176] X.sub.56=L, Q, P or R
[0177] X.sub.57=R or P
[0178] X.sub.58=R or K
[0179] X.sub.59=L or F
[0180] X.sub.60=K, S or R
[0181] X.sub.61=P, N or H
[0182] X.sub.62=no amino acid or V
[0183] X.sub.63=no amino acid or F
[0184] X.sub.64=no amino acid or D
[0185] X.sub.65=no amino acid or E or K
[0186] X.sub.66=no amino acid or K or I
[0187] X.sub.67=no amino acid or M or S
[0188] X.sub.68=no amino acid or T, I or S
[0189] X.sub.69=no amino acid or K or E
[0190] X.sub.70=no amino acid or T or V
[0191] X.sub.71=no amino acid or G or K
[0192] X.sub.72=no amino acid or A
[0193] X.sub.73=no amino acid or E
[0194] X.sub.74=no amino acid or I or T
[0195] X.sub.75=no amino acid or L
[0196] X.sub.76=no amino acid or A, V or G
[0197] X.sub.77=no amino acid or E
[0198] X.sub.78=no amino acid or E
[0199] X.sub.79=no amino acid or A
[0200] X.sub.80=no amino acid or K
[0201] X.sub.81=no amino acid or T
[0202] X.sub.82=no amino acid or L
[0203] X.sub.83=no amino acid or A or S
[0204] X.sub.84=no amino acid or A or E
[0205] X.sub.85=no amino acid or A or V
[0206] X.sub.86=no amino acid or L or V
[0207] X.sub.87=no amino acid or L
[0208] X.sub.88=no amino acid or E
[0209] X.sub.89=no amino acid or E
[0210] X.sub.90=no amino acid or E
[0211] X.sub.91=no amino acid or I
[0212] X.sub.92=no amino acid or M
[0213] X.sub.93=no amino acid or D or M
[0214] X.sub.94=no amino acid or N or E
[0215] Another aspect of the present invention is directed to the
genetic construct comprising a nucleotide sequence selected from
SEQ ID NO:7, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17 or a
nucleotide sequence having at least 70% similarity to one or more
of SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18 or a
nucleotide sequence capable of hybridizing to SEQ ID NO:7, SEQ ID
NO:13, SEQ ID NO:15 and SEQ ID NO:17 or a complementary form
thereof.
[0216] A further aspect of the present invention provides a genetic
construct for use in generating insect-resistant transgenic plants,
said transgenic plants producing a defensin or defensin-like
molecule selected from SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:16 and
SEQ ID NO:18 as well as SEQ ID NO:20 to SEQ ID NO:49 or an amino
acid sequence having at least 70% similarity to any one of SEQ ID
NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18.
[0217] Still another aspect of the present invention further
contemplates a method for generating a plant with increased or
enhanced resistance to a plant pest, said method comprising
introducing into the genome of a plant cell or genome of a group of
plant cells a genetic construct comprising a promoter or functional
equivalent thereof operably linked to a nucleotide sequence
encoding a floral-derived, defensin-like molecule having a mature
domain comprising the amino acid sequence:
TABLE-US-00008
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.s-
ub.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39C.sub.VIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
said mature domain exhibits inhibitory activity against plant pests
such as insect pests and regenerating a plant from said cell or
group of cells.
[0218] Still a further aspect of the present invention is directed
to the defensin-like molecule comprising a mature domain having the
amino acid sequence [SEQ ID NO:58]:
TABLE-US-00009
X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34SX.sub.35X.sub.36FX.sub.37GX.sub-
.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.43
CX.sub.44X.sub.45X.sub.46CX.sub.47X.sub.48EX.sub.49FX.sub.50X.sub.51GX.sub-
.52CX.sub.53X.sub.54X.sub.55X.sub.56RX.sub.57
CX.sub.59CTX.sub.60X.sub.61C
wherein
[0219] X.sub.30=R or Q
[0220] X.sub.31=E, I or T
[0221] X.sub.32=K or E
[0222] X.sub.33=T, A or S
[0223] X.sub.34=E, P or Q
[0224] X.sub.35=N, Q or H
[0225] X.sub.36=T or R
[0226] X.sub.37=P, K or H
[0227] X.sub.38=I, L, P or T
[0228] X.sub.39=I, F, S or V
[0229] X.sub.40=T, M, R or S
[0230] X.sub.41=K, D, E or A
[0231] X.sub.42=P or S
[0232] X.sub.43=P, S or N
[0233] X.sub.44=R or A
[0234] X.sub.45=K, T, S or N
[0235] X.sub.46=A, Y or V
[0236] X.sub.47=I, L, Q or H
[0237] X.sub.48=S, K, T or N
[0238] X.sub.49=K or G
[0239] X.sub.50=T, S, I, or V
[0240] X.sub.51=D or G
[0241] X.sub.52=H, R, or N
[0242] X.sub.53=S, P or R
[0243] X.sub.54=K, W, A or G
[0244] X.sub.55=I, L or F
[0245] X.sub.56=L, Q, P or R
[0246] X.sub.57=R or P
[0247] X.sub.58=R or K
[0248] X.sub.59=L or F
[0249] X.sub.60=K, S or R
[0250] X.sub.61=P, N or H
[0251] Yet another aspect of the present invention provides a
method for generating a plant with increased or enhanced resistance
to an insect, said method comprising introducing into the genome of
a plant cell or genome of a group of plant cells a genetic
construct comprising a promoter or functional equivalent thereof
operably linked to a nucleotide sequence encoding a defensin-like
molecule having a mature domain comprising the amino acid
sequence:
TABLE-US-00010 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
said mature domain exhibits inhibitory activity against plant pests
such as insect pests and regenerating a plant from said cell or
group of cells.
[0252] Yet a further aspect of the present invention provides a
transfected or transformed cell, tissue or organ from a plant or a
transformed microbial cell, said cell, tissue or organ comprising a
nucleic acid molecule comprising a sequence of nucleotides encoding
or complementary to a sequence encoding a polypeptide comprising,
in its precursor form, an N-terminal signal domain, a mature domain
and an acidic C-terminal domain wherein said polypeptide is
produced during flower development and its mature domain has
activity against one or more plant pests.
[0253] Even still another aspect of the present invention is
directed to the nucleic acid molecule comprising a sequence of
nucleotides encoding or complementary to a sequence encoding a
polypeptide comprising, in its precursor form, an N-terminal signal
domain, a mature domain and an acidic C-terminal domain wherein
said polypeptide is produced during flower development and its
mature domain comprises the structure:--
TABLE-US-00011 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
the mature domain has activity against one or more plant pests.
[0254] Even yet another aspect of the present invention, insofar as
it relates to plants, further extends to progeny of the plants
engineered to express the nucleic acid molecule encoding the
defensin-like molecule or a variant or homologue thereof as well as
vegetative, propagative and reproductive parts of the plants, such
as flowers (including cut or severed flowers), parts of plants,
fibrous material from plants (for example, cotton) and reproductive
portions including cuttings, pollen, seeds and callus.
[0255] Another aspect of the present invention provides a
genetically modified plant cell or multicellular plant or progeny
thereof or parts of a genetically modified plant capable of
producing a heterologous defensin-like molecule as herein described
wherein said transgenic plant is resistant or has reduced
sensitivity to plant pests such as insects.
[0256] A further aspect of the present invention comprises one or
more genetic constructs alone or in combination comprising a first
promoter operably linked to a first nucleotide sequence wherein
said first nucleotide sequence encodes a defensin-like molecule
capable of inhibiting a plant pest such as an insect, said
construct further comprising a second promoter operably linked to a
second nucleotide sequence wherein said second nucleotide sequence
encodes a proteinase inhibitor or precursor thereof.
BRIEF DESCRIPTION OF THE FIGURES
[0257] FIG. 1 is a representation of the nucleotide sequence (SEQ
ID NO:17) and the predicted amino acid sequence (SEQ ID NO:18) of
NaPdf1 (Nicotiana alata plant defensin 1), the cDNA encoding the
floral defensin from Nicotiana alata. Only one strand with the
polarity of the mRNA is shown and the nucleotides are numbered
above. The amino acid sequence, shown in single letter code, is
given below the nucleotide sequence and is numbered beginning with
1 for the first amino acid of the mature protein. The putative
signal peptide is indicated by negative numbers and is underlined.
The mature protein is boxed and arrows depict the predicted
cleavage sites of the signal peptide and the end of the mature
protein. The first stop codon is marked with an asterisk (*) and
the two polyadenylation sites are in bold. For further detail,
refer to Example 7.
[0258] FIG. 2 is a diagrammatic representation of an RNA gel blot
analysis of NaPdf1 expression in various tissues of Nicotiana
alata. Total RNA was isolated from anthers at stages I (5-10 mm
buds), II (20-30 mm buds) and III (50-70 mm buds) of development,
from pollen grains, and from mature pistil, ovary, petal, leaf and
root tissues of N. alata (self-incompatibility genotype,
S.sub.2S.sub.2), as shown in panel A. Panel B shows the same RNA
samples following staining with ethidium bromide.
[0259] FIG. 3 is a representation of an autoradiograph showing in
situ localization of NaPdf1 RNA. (A) A transverse section of a 1 cm
long flower bud, after hybridization with a .sup.35S-labelled
NaPdf1 anti-sense RNA probe. Heavy labelling of the epidermal cells
of the petal (Pe) and sepal (Se), the cortical cells of the pistil
(Pi) and the connective tissue of the anther (A) can be detected.
(B) The same section as in A, under higher magnification. (C) A
similar section as in B, after hybridization with a
.sup.35S-labelled NaPdf1 sense RNA probe. No labelling is seen in
any of the cells of the pistil (Pi), anther (A), petal (Pe) or
sepal (Se).
[0260] FIG. 4A is a representation showing bacterial expression of
N-terminal hexahistidine-tagged pro-defensin (6H.NaproPdf1) encoded
by the NaPdf1 cDNA. Lane 1: total protein extracted 6 h
post-induction with 1 mM IPTG in 1.times.SDS sample loading buffer.
Lane 2: soluble proteins in the 8 M urea lysate. Lane 3: induced
protein purified by IMAC. The proteins were separated on a 15% w/v
SDS-polyacrylamide gel and were stained with Coomassie Blue.
Molecular size markers are the Broad Range standards from Bio-Rad.
The induced .about.12 kDa protein (arrowed) was substantially pure
after immobilized metal affinity chromatography (IMAC).
[0261] FIG. 4B shows a reverse-phase HPLC chromatogram of a sample
of the metal affinity purified 6H.NaproPdf1 protein (IMAC from A),
eluted as described in Example
[0262] FIG. 5 is a representation showing immunoblot analysis of
plant extracts with the antibodies raised to the bacterially
expressed pro-defensin (6H.NaproPdf1) encoded by the NaPdf1 cDNA
clone. (A) A diagrammatic representation of the five stages of
developing. N. alata flowers. (B) A representation of an immunoblot
of buffer soluble proteins (60 .mu.g) from flowers at the stages of
development shown in (A). Proteins were separated on a 15% w/v
SDS-polyacrylamide gel prior to transfer to nitrocellulose (0.22
.mu.m) and immunoblotting with antibodies (1:2500) raised against
bacterially expressed 6H.NaproPdf1 (see FIG. 4). The antibodies
bound specifically to three proteins. The smallest is the predicted
size of mature defensin (.about.5 kDa) while the two larger species
are probably the precursor and a processing intermediate. For
details, see Examples 4 and 5.
[0263] FIG. 6 shows the purification of mature N. alata defensin
from flower buds. (A) Reverse-phase HPLC on an Aquapore RP-300 C8
column (4.6 mm.times.100 mm, Brownlee). Proteins were extracted
from flower buds and partially purified by gel filtration
chromatography (see Example 5) before RP-HPLC. Proteins were
applied in 0.1% v/v TFA and eluted with 60% v/v acetonitrile in
0.089% v/v TFA (buffer B) according to the gradient 0-100% buffer B
over 40 min at a flow rate of 1 mL/min. Eluted proteins were
detected by absorbance at 215 nm. (Inset) Protein in Peak A
separated by 15% w/v SDS-PAGE and immunoblotted with
anti-6H.NaproPdf1 antibodies (Example 4). (B) N-terminal sequencing
and mass spectrometry confirmed the identity of Peak A as the
mature defensin domain encoded by the NaPdf1 cDNA clone. "x"
corresponds to an unassigned amino acid that is probably a cysteine
as predicted from the cDNA sequence
[0264] FIG. 7 is a series of electron micrographs showing the
location of the N. alata defensin in anthers and ovaries from 10 mm
flower buds. (A) Overview of the anther showing the cells of the
connective tissue with electron dense deposits (arrowed) in the
vacuole. (B) Immunogold localization of the defensin in the cells
of the connective tissue of the anther. The antibody bound to the
electron dense deposits in the vacuole (v) and did not bind to the
cytoplasm (ct) or the cell wall (cw). (C) Immunogold localization
of the defensin in the cortical cells of the ovary. The antibody
bound specifically to electron dense deposits in the vacuole and no
binding was observed in the cytoplasm or cell walls.
[0265] FIG. 8 is a schematic representation of the precursor
proteins predicted from cDNA clones that encode floral and seed
defensins. (A) Some floral defensins are produced as precursor
proteins with three distinct domains: an ER signal sequence (left
section of the diagram), a central basic domain (middle of the
diagram) and a C-terminal domain rich in acidic amino acids (right
section of the diagram). The predicted sizes of each of these
domains for the N. alata defensin are shown below the diagram. The
mature floral defensin is released after proteolytic cleavage
(arrowed). (B) cDNAs for seed derived defensins encode proteins
with an ER signal sequence and a basic defensin domain, but no
C-terminal acidic domain.
[0266] FIG. 9 is an alignment of the amino acid sequence of NaPdf1
(SEQ ID NO:18) with the predicted amino acid sequences encoded from
five other flower-derived cDNA clones, as follows: [0267] FST (SEQ
ID NO:20) [0268] (flower specific thionin): Gu et al., Mol. Gen.
Genet. 234: 89-96, 1992; [0269] TPP3: (SEQ ID NO:21) Milligan and
Gasser, Plant Mol. Biol. 28: 691-711, 1995; [0270] NTS13: (SEQ ID
NO:22) Li and Gray, Plant Physiology 120: 633, 1999; [0271] PPT:
(SEQ ID NO:23) Karunanandaa et al., Plant Mol. Biol., 26: 459-464,
1994; [0272] ATPIIIa: (SEQ ID NO:24) Yu et al., Direct Submission,
Accession No. S30578, 1999. Some, but not all floral defensins have
a C-terminal acidic domain of 32-33 amino acids.
[0273] FIG. 10 is an alignment of the amino acid sequence of the
mature domain of NaPdf1 with the amino acid sequences of the mature
domain of other members of the plant defensin family. The
N-terminal amino acid in the Rs-AFP1, Rs-AFP2, M1, M2A and M2B
sequence which is represented by "pQ" is a pyroglutamic acid. The
sequences are derived from the following sources:-- [0274] FST: Gu
et al. (1992; supra) (SEQ ID NO:25); [0275] TPP3: Milligan and
Gasser (1995; supra) (SEQ ID NO:26); [0276] p322: Steikema et al.,
Plant Mol. Biol. 11: 255-269, 1988 (SEQ ID NO:27); [0277] PPT:
Karunanandaa et al. (1994; supra) (SEQ ID NO:28); [0278] SE60: Choi
et al., Plant Physiology 101: 699-700, 1993; Choi et al., Mol. Gen.
Genet. 246: 266-268, 1995 (SEQ ID NO:29); [0279] .gamma.1-H: Mendez
et al., Eur. J. Biochem. 194: 533-539, 1990 (SEQ ID NO:30); [0280]
M2A, M1 and M2B: Neumann et al., Int. J. Protein & Peptide
Research 47: 437-446, 1996 (SEQ ID NO:31, SEQ ID NO:35 and SEQ ID
NO:36, respectively); [0281] Pth-St1: Moreno et al., Eur. J.
Biochem. 223: 135-139, 1995 (SEQ ID NO:32); [0282] Rs-AFP1 and
Rs-AFP2: Terras et al., J. Biological Chemistry 267: 15301-15309,
1992; Terras et al., FEBS Letters 316: 233-240, 1993; Terras et
al., Plant Cell 7: 573-588, 1995; and Fant et al., The solution
structure by .sup.1H-NMR of Rs-AFP1, a plant antifungal protein
from radish seeds. In: LP Ingman, J Jokissaari, J Lounila (eds),
Abstracts of the 12th European Experimental NMR Conference, p 247,
1994 (SEQ ID NO:33 and SEQ ID NO:34, respectively); [0283]
.gamma.1-P: Collila et al., FEBS Letters 270: 191-194, 1990 (SEQ ID
NO:37); [0284] .gamma.2-P: Collila et al., (1990; supra) (SEQ ID
NO:38); [0285] 10 kDa: Ishibashi et al., Plant Mol. Biol. 15:
59-64, 1990 (SEQ ID NO:39); [0286] SI.alpha.2, SI.alpha.3 and
SI.alpha.1: Bloch and Richardson, FEBS Letters 279: 101-104, 1991
and Nitti et al., Eur. J. Biochem. 228: 250-256, 1995 (SEQ ID
NO:40, SEQ ID NO:41 and SEQ ID NO:43, respectively); [0287]
Dm-AMP2, Ah-AMP1, [0288] Hs-AFP1, Dm-AMP1 and [0289] Ct-AMP1:
Osborn et al., FEBS Letters 368: 257-262, 1995 (SEQ ID NO:42, SEQ
ID NO:45, SEQ ID NO:46, SEQ ID NO:47 and SEQ ID NO:49,
respectively); [0290] pI230 and P139: Chiang and Hagwiger, Mol.
Plant-Microbe Interact. 4: 324-331, 1991 (SEQ ID NO:44 and SEQ ID
NO:48, respectively); [0291] NeThio1 and NeThio2: Yamada et al.,
Plant Physiology 115: 314, 1997; (SEQ ID NO:50 and SEQ ID NO:51);
and [0292] NpThio1: Komori et al., Plant Physiology 115: 314, 1997
(SEQ ID NO:52).
[0293] FIG. 11 shows growth inhibition curves of various agents
against Botrytis cinerea, as monitored by absorbance at 595 nm.
Each treatment was performed in quadruplicate. Purified NaPdf1
protein at 20 .mu.g/ml was assayed. Water and ovalbumin (20
.mu.g/ml) served as negative controls and a mixture of the
antifungal proteins .alpha.- and .beta.-purothionin (20 .mu.g/ml)
was used as a positive control.
[0294] FIGS. 12A-12C show growth inhibition curves of various
agents against Fusarium oxysporum f. sp. dianthi (12A) and F.
oxysporum f. sp. vasinfectum (12B and 12C), as monitored by
absorbance at 595 nm. Each treatment was performed in
quadruplicate. Purified NaPdf1 protein at 20 .mu.g/ml (12A and 12B)
and 10 .mu.g/ml (12C) were assayed. Water and ovalbumin (20
.mu.g/ml, 12A and 12B; 10 .mu.g/ml, 12C) served as negative
controls, and a mixture of the antifungal proteins .alpha.- and
.beta.-purothionin (20 .mu.g/ml, A and B; 10 .mu.g/ml, C) was used
as a positive control.
[0295] FIG. 13 is a schematic of plant transformation constructs
pFL1 and pHEX3, used for the transformation of tobacco and cotton.
Both constructs contain the N. alata defensin, NaPdf1, under the
control of the CaMV35S promoter/terminator. The region designated
"surB" codes for resistance to the herbicide glean, and that
designated "nptII" codes for resistance against the antibiotic
kanamycin.
[0296] FIG. 14 shows representations of protein blots indicating
expression of (A) N. alata proteinase inhibitor (NaPI) protein and
(B) NaPdf1 protein in transgenic tobacco plants. In A, lane 1: 25
ng NaPI; lane 2: 100 ng NaPI; lane 3: pHEX3.4; lane 4:
untransformed W38 and lane 5: pFL1/W19. In B, lane 1: pHEX3.4; lane
2: pFL1/W19; lane 3: untransformed W38 and lane 4: N. alata bud
extract. (C) indicates expression of NaPdf1 protein in a transgenic
cotton plant. Lane 1: 25 ng purified NaPdf1; lane 2: plant
CT28.14.1 (transformed with unrelated plasmid) and lane 3: plant
CT35.9.1 (transformed with pHEX3).
[0297] FIGS. 15A-15D show growth curves for H. punctigera and H.
armigera fed on transgenic N. tabacum leaves (lines pHEX3.4 and
pFL1/W19) transformed with the NaPdf1 gene and an untransformed W38
parent plant. (15A) Survival of H. punctigera larvae, measured
between days 2 and 18, (15B) the average mean weight of H.
punctigera larvae measured between days 7 and 18, (15C) survival of
H. armigera larvae measured between days 3 and 23, (15D) the
average mean weight of H. armigera larvae measured between days 6
and 23.
[0298] FIG. 16 shows the average mean weight of H. armigera larvae
fed on artificial diet containing either 0.03% NaPdf1, 0.3% NaPdf1,
0.3% NaPI or casein in place of the test protein (control). Weight
of larvae was measured after 6, 9, 12 and 14 days of feeding.
[0299] FIG. 17 shows the average mean weight of H. armigera larvae
fed on transgenic cotton (lines CT35.9.4 and CT35.125.1)
transformed with NaPdf1 and non-transformed parent Coker 315 at day
8.
[0300] Table 1 is a summary of amino acid and nucleotide sequence
identifiers. Table 2 Artificial diet ingredients used in the
feeding trial of H. armigera
TABLE-US-00012 TABLE 1 SEQUENCE ID NO: DESCRIPTION SEQ ID NO: 1
Primer FST1 SEQ ID NO: 2 Primer FST2 SEQ ID NO: 3 Primer PDF1 SEQ
ID NO: 4 Primer PDF2 SEQ ID NO: 5 Primer FLOR1 SEQ ID NO: 6 Primer
FLOR2 SEQ ID NO: 7 cDNA encoding mature domain (NaPdf1) SEQ ID NO:
8 Amino acid sequence corresponding to SEQ ID NO: 7 SEQ ID NO: 9
cDNA encoding N-terminal domain (NaPdf1) SEQ ID NO: 10 Amino acid
sequence corresponding to SEQ ID NO: 9 SEQ ID NO: 11 cDNA encoding
C-terminal acidic tail (NaPdf1) SEQ ID NO: 12 Amino acid sequence
corresponding to SEQ ID NO: 11) SEQ ID NO: 13 cDNA encoding
N-terminal + mature domain (NaPdf1) SEQ ID NO: 14 Amino acid
sequence corresponding to SEQ ID NO: 13 SEQ ID NO: 15 cDNA encoding
mature + acidic C-terminal domain (NaPdf1) SEQ ID NO: 16 Amino acid
sequence corresponding to SEQ ID NO: 15 SEQ ID NO: 17 cDNA encoding
NaPdf1 SEQ ID NO: 18 Amino acid sequence corresponding to SEQ ID
NO: 17 SEQ ID NO: 19 cDNA corresponding to 3' end of NaPdf1 SEQ ID
NO: 20 Amino acid sequence of full FST SEQ ID NO: 21 Amino acid
sequence of full TPP3 SEQ ID NO: 22 Amino acid sequence of full
NTS13 SEQ ID NO: 23 Amino acid sequence of full PPT SEQ ID NO: 24
Amino acid sequence of full ATPIIIa SEQ ID NO: 25 Amino acid
sequence of mature domain of FST SEQ ID NO: 26 Amino acid sequence
of mature domain of TPP3 SEQ ID NO: 27 Amino acid sequence of
mature domain of P322 SEQ ID NO: 28 Amino acid sequence of mature
domain of PPT SEQ ID NO: 29 Amino acid sequence of mature domain of
SE60 SEQ ID NO: 30 Amino acid sequence of mature domain of
.gamma.1-H SEQ ID NO: 31 Amino acid sequence of mature domain of
M2A SEQ ID NO: 32 Amino acid sequence of mature domain of PTH-St1
SEQ ID NO: 33 Amino acid sequence of mature domain of Rs-AFP1 SEQ
ID NO: 34 Amino acid sequence of mature domain of Rs-AFP2 SEQ ID
NO: 35 Amino acid sequence of mature domain of M1 SEQ ID NO: 36
Amino acid sequence of mature domain of M2B SEQ ID NO: 37 Amino
acid sequence of mature domain of .gamma.1-P SEQ ID NO: 38 Amino
acid sequence of mature domain of .gamma.2-P SEQ ID NO: 39 Amino
acid sequence of mature domain of 10 kDa SEQ ID NO: 40 Amino acid
sequence of mature domain of SI.alpha.2 SEQ ID NO: 41 Amino acid
sequence of mature domain of SI.alpha.3 SEQ ID NO: 42 Amino acid
sequence of mature domain of Dm-AMP2 SEQ ID NO: 43 Amino acid
sequence of mature domain of SI.alpha.1 SEQ ID NO: 44 Amino acid
sequence of mature domain of P1230 SEQ ID NO: 45 Amino acid
sequence of mature domain of Ah-AMP1 SEQ ID NO: 46 Amino acid
sequence of mature domain of Hs-AFP1 SEQ ID NO: 47 Amino acid
sequence of mature domain of Dm-AMP1 SEQ ID NO: 48 Amino acid
sequence of mature domain of P139 SEQ ID NO: 49 Amino acid sequence
of mature domain of Ct-AMP1 SEQ ID NO: 50 Amino acid sequence of
mature domain of NeThio1 SEQ ID NO: 51 Amino acid sequence of
mature domain of NeThio2 SEQ ID NO: 52 Amino acid sequence of
mature domain of NpThio1 SEQ ID NO: 53 Amino acid sequence of
mature domain of NTS13 SEQ ID NO: 54 Amino acid sequence of mature
domain of PPT SEQ ID NO: 55 Amino acid sequence of mature domain of
ATPIIIa SEQ ID NO: 56 cDNA encoding mature domain of NaPI SEQ ID
NO: 57 Amino acid sequence corresponding to SEQ ID NO: 56 SEQ ID
NO: 58 Consensus sequence of mature domain of defensin SEQ ID NO:
59 Consensus sequence of internal domain of defensin SEQ ID NO: 60
Consensus sequence of C-terminal domain of defensin SEQ ID NO: 61
Consensus amino acid sequence of defensin
TABLE-US-00013 TABLE 2 0.3% 0.03% 0.3% Control NaPdf1 NaPdf1 NaPI
Reagent (10 g) (3 g) (3 g) (3 g) Powdered 300 mg 90 mg 90 mg 90 mg
cotton leaf Yeast 200 mg 60 mg 60 mg 60 mg Wheatgerm 240 mg 72 mg
72 mg 72 mg Ascorbic acid 320 mg 96 mg 96 mg 96 mg Sorbic acid 8 mg
2.4 mg 2.4 mg 2.4 mg Paraben 16 mg 4.8 mg 4.8 mg 4.8 mg Linseed oil
8 .mu.l 2.4 .mu.l 2.4 .mu.l 2.4 .mu.l Wheatgerm oil 16 .mu.l 4.8
.mu.l 4.8 .mu.l 4.8 .mu.l Casein 26.5 mg -- 7.155 mg -- Inhibitor
protein -- 530 .mu.l 53 .mu.l 600 .mu.l (15 mg/ml) Distilled water
1.66 ml -- 444 .mu.l -- The above reagents were mixed and then
added to melted agar Agar 320 mg 96 mg 96 mg 96 mg Distilled water
6 ml 1.77 ml 1.8 ml 1.7 ml Add and mix Ampicillin 14 .mu.l 4.2
.mu.l 4.2 .mu.l 4.2 .mu.l (200 mg/ml) Streptomycin 14 .mu.l 4.2
.mu.l 4.2 .mu.l 4.2 .mu.l (200 mg/ml)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0301] The present invention is predicated in part on the
determination of the biological properties of floral-derived,
defensin-like molecules from plants and the elucidation of new
properties in seed-derived defensins and previously known
floral-derived defensins. Importantly, a novel floral-derived,
defensin-like molecule is described which exhibits activity against
plant pathogens and in particular plant pests such as insects and
fungi. Other defensin molecules are described which are
contemplated to exhibit anti-insect activity.
[0302] Accordingly, one aspect of the present invention provides an
isolated nucleic acid molecule comprising a sequence of nucleotides
encoding or complementary to a sequence encoding a polypeptide
comprising, in its precursor form, an N-terminal signal domain, a
mature domain and an acidic C-terminal domain wherein said
polypeptide is produced during flower development and its mature
domain has activity against one or more plant pests.
[0303] This aspect of the present invention does not extend to the
defensins FST [flower specific thionin] (Gu et al., {1992; supra})
or TPP3 (Milligan and Gasser, {1995; supra}).
[0304] Reference herein to a "polypeptide" includes reference to a
peptide or protein. Generally, the polypeptide comprises cysteine
residues, the location of which is conserved within members of
floral and non-floral-derived defensin molecules. The location of
the eight cysteine residues may be defined as follows:
TABLE-US-00014 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral.
[0305] Accordingly, another aspect of the present invention is
directed to an isolated nucleic acid molecule comprising a sequence
of nucleotides encoding or complementary to a sequence encoding a
polypeptide comprising, in its precursor form, an N-terminal signal
domain, a mature domain and an acidic C-terminal domain wherein
said polypeptide is produced during flower development and its
mature domain comprises the structure:
TABLE-US-00015 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
the mature domain has activity against one or more plant pests with
the proviso that the polypeptide is not FST or TPP3.
[0306] The term "isolated" means that the nucleic acid molecule has
undergone at least one step towards being isolated or concentrated
or enriched from a more complex solution or source. For example,
the term "isolated" includes nucleic acid molecules concentrated or
enriched from a biological or chemical sample by precipitation,
centrifugation, electrophoresis, micro-filtration, electroporation
or chromatography. The term "isolated", however, is in no way
intended to limit the nucleic acid molecule to a particular
location or state and the present invention extends to the nucleic
acid molecule when introduced into the genome of a cell or when it
is resident in progeny of cells into which the nucleic acid
molecule has been introduced into its genome.
[0307] Reference herein to a "nucleic acid molecule" includes
reference to DNA or RNA (e.g. mRNA) or DNA/RNA hybrids. A nucleic
acid molecule may be regarded inter alia as a genetic molecule,
nucleotide sequence or polynucleotide sequence. Preferably, the
nucleic acid molecule is a cDNA molecule although the present
invention extends to genomic forms of the nucleic acid molecule.
The nucleic acid molecule of the present invention may also encode
separately the N-terminal signal domain, the mature domain and/or
the acidic C-terminal domain or combinations thereof. For example,
the nucleic acid molecule may encode for the N-terminal signal
domain operably linked to the mature domain. Alternatively, it may
encode for the mature domain operably linked to the acidic
C-terminal domain. The nucleic acid molecule may also encode all
three domains or comprise heterologous domains from other defensin
or defensin-like molecules. The development of heterologous
defensin-like molecules is encompassed in the present invention and
provides a means of broadening the anti-insect or anti-pest
spectrum. A heterologous molecule may also comprise multiple mature
domains and random repeats of mature domains or other domains
required for activity.
[0308] Reference herein to production of the polypeptide during
"flower development" includes reference to production in flowering
parts such as but not limited to production in the pistils,
anthers, ovaries, sepals and petals of the flowering region.
Preferably, the polypeptide is produced in the epidermal layers of
the petals and sepals, the cortical cells of the style and the
connective tissue of the anthers.
[0309] Accordingly, another aspect of the present invention
contemplates an isolated nucleic acid molecule comprising a
sequence of nucleotides encoding or complementary to a sequence
encoding a polypeptide comprising, in its precursor form, an
N-terminal signal domain, a mature domain and an acidic C-terminal
domain wherein said polypeptide is produced in the epidermal layers
of petals and sepals, the cortical cells of the style and
connective tissue of the anthers and its mature domain comprises
the structure:
TABLE-US-00016 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
the mature domain has activity against one or more plant pests with
the proviso that the polypeptide is not FST or TPP3.
[0310] In an alternative embodiment, the present invention provides
an isolated nucleic acid molecule comprising a sequence of
nucleotides encoding or complementary to a sequence encoding a
polypeptide comprising two or more mature domains having activity
against one or more plant pests and optionally an N-terminal signal
domain and optionally an acidic C-terminal domain. The polypeptide
according to the latter embodiment would be regarded as a fusion
polypeptide.
[0311] The location of production of the subject polypeptide may be
altered depending on the genetic construct employed to express the
nucleic acid molecule. For example, a developmentally regulated
and/or tissue-specific promoter may be employed to direct
expression of the nucleic acid molecule in any tissue. However, the
naturally occurring polypeptide is produced during flower
development and more particularly in the tissues of flowers
outlined above.
[0312] The term "plant pests" is not to confer any limitation as to
the type of organism targeted by the subject defensin-like
molecule. A plant pest includes an insect, arachnid, microorganism,
fungus or virus. In a particularly preferred embodiment, the plant
pest is an insect.
[0313] In a most preferred embodiment, the defensin-like molecule
or its encoding nucleic acid molecule is isolatable from N. alata
and related species or varieties or strains thereof. The amino acid
sequence of the mature domain of the N. alata defensin is as
follows (in single letter code):
TABLE-US-00017 [SEQ ID NO:8] RECKTESNTF PGICITKPPC RKACISEKFT
DGHCSKILRR CLCTKPC.
[0314] The nucleotide sequence encoding SEQ ID NO:8 is set forth in
SEQ ID NO:7.
[0315] The present invention extends to novel variants of SEQ ID
NO:8 such as variants with an amino acid sequence having at least
70% similarity to the sequence set forth in SEQ ID NO:8 or variants
encoded by a nucleotide sequence capable of hybridizing to the
nucleotide sequence encoding SEQ ID NO:8 (i.e. SEQ ID NO:7) under
low stringency conditions at 42.degree. C.
[0316] Accordingly, another aspect of the present invention
provides an isolated nucleic acid molecule comprising a sequence of
nucleotides encoding or complementary to a sequence encoding a
polypeptide comprising, in its precursor form, an N-terminal signal
domain, a mature domain and an acidic C-terminal domain wherein
said mature domain comprises the amino acid sequence set forth in
SEQ ID NO:8 or an amino acid sequence having at least about 70%
similarity thereto or is encoded by a nucleotide sequence set forth
in SEQ ID NO:7 or a nucleotide sequence having at least about 70%
similarity thereto or a nucleotide sequence capable of hybridizing
to SEQ ID NO:7 or its complementary form under low stringency
conditions at 42.degree. C.
[0317] The term "similarity" as used herein includes exact identity
between compared sequences at the nucleotide or amino acid level.
Where there is non-identity at the nucleotide level, "similarity"
includes differences between sequences which result in different
amino acids that are nevertheless related to each other at the
structural, functional, biochemical and/or conformational levels.
Where there is non-identity at the amino acid level, "similarity"
includes amino acids that are nevertheless related to each other at
the structural, functional, biochemical and/or conformational
levels. In a particularly preferred embodiment, nucleotide and
sequence comparisons are made at the level of identity rather than
similarity.
[0318] Terms used to describe sequence relationships between two or
more polynucleotides or polypeptides include "reference sequence",
"comparison window", "sequence similarity", "sequence identity",
"percentage of sequence similarity", "percentage of sequence
identity", "substantially similar" and "substantial identity". A
"reference sequence" is at least 12 but frequently 15 to 18 and
often at least 25 or above, such as 30 monomer units, inclusive of
nucleotides and amino acid residues, in length. Because two
polynucleotides may each comprise (1) a sequence (i.e. only a
portion of the complete polynucleotide sequence) that is similar
between the two polynucleotides, and (2) a sequence that is
divergent between the two polynucleotides, sequence comparisons
between two (or more) polynucleotides are typically performed by
comparing sequences of the two polynucleotides over a "comparison
window" to identify and compare local regions of sequence
similarity. A "comparison window" refers to a conceptual segment of
typically 12 contiguous residues that is compared to a reference
sequence. The comparison window may comprise additions or deletions
(i.e. gaps) of about 20% or less as compared to the reference
sequence (which does not comprise additions or deletions) for
optimal alignment of the two sequences. Optimal alignment of
sequences for aligning a comparison window may be conducted by
computerised implementations of algorithms (GAP, BESTFIT, FASTA,
and TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or
by inspection and the best alignment (i.e. resulting in the highest
percentage homology over the comparison window) generated by any of
the various methods selected. Reference also may be made to the
BLAST family of programs as, for example, disclosed by Altschul et
al. (Nucl. Acids Res. 25: 3389, 1997). A detailed discussion of
sequence analysis can be found in Unit 19.3 of Ausubel et al.
("Current Protocols in Molecular Biology" John Wiley & Sons
Inc, 1994-1998, Chapter 15).
[0319] The terms "sequence similarity" and "sequence identity" as
used herein refers to the extent that sequences are identical or
functionally or structurally similar on a nucleotide-by-nucleotide
basis or an amino acid-by-amino acid basis over a window of
comparison. Thus, a "percentage of sequence identity", for example,
is calculated by comparing two optimally aligned sequences over the
window of comparison, determining the number of positions at which
the identical nucleic acid base (e.g. A, T, C, G, I) or the
identical amino acid residue (e.g. Ala, Pro, Ser, Thr, Gly, Val,
Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and
Met) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity. For the purposes of the present invention,
"sequence identity" will be understood to mean the "match
percentage" calculated by the DNASIS computer program (Version 2.5
for windows; available from Hitachi Software engineering Co., Ltd.,
South San Francisco, Calif., USA) using standard defaults as used
in the reference manual accompanying the software. Similar comments
apply in relation to sequence similarity.
[0320] Reference herein to a "low stringency" includes and
encompasses from at least about 0 to at least about 15% v/v
formamide and from at least about 1 M to at least about 2 M salt
for hybridization, and at least about 1 M to at least about 2 M
salt for washing conditions. Generally, low stringency is from
about 25-30.degree. C. to about 42.degree. C. The temperature may
be altered and higher temperatures used to replace formamide and/or
to give alternative stringency conditions. Alternative stringency
conditions may be applied where necessary, such as medium
stringency, which includes and encompasses from at least about 16%
v/v to at least about 30% v/v formamide and from at least about 0.5
M to at least about 0.9 M salt for hybridization, and at least
about 0.5 M to at least about 0.9 M salt for washing conditions, or
high stringency, which includes and encompasses from at least about
31% v/v to at least about 50% v/v formamide and from at least about
0.01 M to at least about 0.15 M salt for hybridization, and at
least about 0.01 M to at least about 0.15 M salt for washing
conditions. In general, washing is carried out T.sub.m=69.3+0.41
(G+C) % (Marmur and Doty, J. Mol. Biol. 5: 109, 1962). However, the
T.sub.m of a duplex DNA decreases by 1.degree. C. with every
increase of 1% in the number of mismatch base pairs (Bonner and
Laskey, Eur. J. Biochem. 46: 83, 1974). Formamide is optional in
these hybridization conditions. Accordingly, particularly preferred
levels of stringency are defined as follows: low stringency is
6.times.SSC buffer, 0.1% w/v SDS at 25-42.degree. C.; a moderate
stringency is 2.times.SSC buffer, 0.1% w/v SDS at a temperature in
the range 20.degree. C. to 65.degree. C.; high stringency is
0.1.times.SSC buffer, 0.1% w/v SDS at a temperature of at least
65.degree. C.
[0321] The present invention is exemplified herein in relation to
the defensin-like molecules from N. alata. However, this is done
with the understanding that the present invention extends to any
novel floral-derived, defensin-like molecule from any plant
provided the molecule has activity against plant pests and in
particular insects. The present invention extends to derivatives of
defensin-like molecules including heterologous molecules as well as
the use of known defensins as anti-insect molecules.
[0322] Reference to a "defensin-like molecule" is made to highlight
the fact that the present invention extends to homologues of
defensin molecules.
[0323] The present invention further provides genetic constructs
for use in expressing defensin-like molecule-encoding nucleotide
sequences in plants for the purposes of protecting the plant from
plant pests.
[0324] Accordingly, another aspect of the present invention
provides a genetic construct comprising a promoter or functional
equivalent thereof operably linked to a nucleotide sequence
encoding a floral-derived, defensin-like molecule having a mature
domain comprising the amino acid sequence:
TABLE-US-00018 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
said mature domain exhibits inhibitory activity against plant pests
such as insect pests with the proviso that the defensin-like
molecule is not FST or TPP3.
[0325] In a preferred embodiment, the amino acid sequence of the
mature domain comprises the amino acid sequence [SEQ ID NO:58]:
TABLE-US-00019
X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34SX.sub.35X.sub.36FX.sub.37GX.sub-
.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.43
CX.sub.44X.sub.45X.sub.46CX.sub.47X.sub.48EX.sub.49FX.sub.50X.sub.51GX.sub-
.52CX.sub.53X.sub.54X.sub.55X.sub.56X.sub.57
X.sub.58CX.sub.59CTX.sub.60X.sub.61C
wherein
[0326] X.sub.30=R or Q
[0327] X.sub.31=E, I or T
[0328] X.sub.32=K or E
[0329] X.sub.33=T, A or S
[0330] X.sub.34=E, P or Q
[0331] X.sub.35=N, Q or H
[0332] X.sub.36=T or R
[0333] X.sub.37=P, K or H
[0334] X.sub.38=I, L, P or T
[0335] X.sub.39=I, F, S or V
[0336] X.sub.40=T, M, R or S
[0337] X.sub.41=K, D, E or A
[0338] X.sub.42=P or S
[0339] X.sub.43=P, S or N
[0340] X.sub.44=R or A
[0341] X.sub.45=K, T, S or N
[0342] X.sub.46=A, Y or V
[0343] X.sub.47=I, L, Q or H
[0344] X.sub.48=S, K, T or N
[0345] X.sub.49=K or G
[0346] X.sub.50=T, S, I, or V
[0347] X.sub.51=D or G
[0348] X.sub.52=H, R, or N
[0349] X.sub.53=S, P or R
[0350] X.sub.54=K, W, A or G
[0351] X.sub.55=I, L or F
[0352] X.sub.56=L, Q, P or R
[0353] X.sub.57=R or P
[0354] X.sub.58=R or K
[0355] X.sub.59=L or F
[0356] X.sub.60=K, S or R
[0357] X.sub.61=P, N or H
[0358] The mature domain-encoding sequence may be operably linked
to a signal domain comprising the amino acid sequence [SEQ ID
NO:59]:
TABLE-US-00020
MX.sub.1X.sub.2SX.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9X.sub.10-
X.sub.11X.sub.12X.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18
X.sub.19X.sub.20X.sub.21X.sub.22X.sub.23X.sub.24X.sub.25X.sub.26X.sub.27X.-
sub.28AX.sub.29
wherein
[0359] X.sub.1=A, G or K
[0360] X.sub.2=R, N, or L
[0361] X.sub.3=L, I or M
[0362] X.sub.4=C, F or R
[0363] X.sub.5=F or L
[0364] X.sub.6=M, F or I
[0365] X.sub.7=A or S
[0366] X.sub.8=F, T or A
[0367] X.sub.9=A, L, V or F
[0368] X.sub.10=I, V, L or F
[0369] X.sub.11=L or I
[0370] X.sub.12=A, or M
[0371] X.sub.13=M, A or F
[0372] X.sub.14=M or L
[0373] X.sub.15=L or I
[0374] X.sub.16=F or V
[0375] X.sub.17=V, T or L
[0376] X.sub.18=A, T or S
[0377] X.sub.19=Y or T
[0378] X.sub.20=E or G
[0379] X.sub.21=V or M
[0380] X.sub.22=no amino acid or G
[0381] X.sub.23=no amino acid or P
[0382] X.sub.24=no amino acid, M or V
[0383] X.sub.25=no amino acid or T
[0384] X.sub.26=no amino acid or S
[0385] X.sub.27=no amino acid, A or V
[0386] X.sub.28=Q or E
[0387] X.sub.29=no amino acid or Q
[0388] In some cases, the mature domain-encoding sequence may be
operably linked to an acidic C-terminal domain comprising the
sequence [SEQ ID NO:60]:
TABLE-US-00021
X.sub.62X.sub.63X.sub.64X.sub.65X.sub.66X.sub.67X.sub.68X.sub.69X.sub.70X-
.sub.71X.sub.72X.sub.73X.sub.74X.sub.75X.sub.76X.sub.77
X.sub.78X.sub.79X.sub.80X.sub.81X.sub.82X.sub.83X.sub.84X.sub.85X.sub.86X.-
sub.87X.sub.88X.sub.89X.sub.90X.sub.91X.sub.92X.sub.93 X.sub.94
wherein
[0389] X.sub.62=no amino acid or V
[0390] X.sub.63=no amino acid or F
[0391] X.sub.64=no amino acid or D
[0392] X.sub.65=no amino acid or E or K
[0393] X.sub.66=no amino acid or K or I
[0394] X.sub.67=no amino acid or M or S
[0395] X.sub.68=no amino acid or T, I or S
[0396] X.sub.69=no amino acid or K or E
[0397] X.sub.70=no amino acid or T or V
[0398] X.sub.71=no amino acid or G or K
[0399] X.sub.72=no amino acid or A
[0400] X.sub.73=no amino acid or E
[0401] X.sub.74=no amino acid or I or T
[0402] X.sub.75=no amino acid or L
[0403] X.sub.76=no amino acid or A, V or G
[0404] X.sub.77=no amino acid or E
[0405] X.sub.78=no amino acid or E
[0406] X.sub.79=no amino acid or A
[0407] X.sub.80=no amino acid or K
[0408] X.sub.81=no amino acid or T
[0409] X.sub.82=no amino acid or L
[0410] X.sub.83=no amino acid or A or S
[0411] X.sub.84=no amino acid or A or E
[0412] X.sub.85=no amino acid or A or V
[0413] X.sub.86=no amino acid or L or V
[0414] X.sub.87=no amino acid or L
[0415] X.sub.88=no amino acid or E
[0416] X.sub.89=no amino acid or E
[0417] X.sub.90=no amino acid or E
[0418] X.sub.91=no amino acid or I
[0419] X.sub.92=no amino acid or M
[0420] X.sub.93=no amino acid or D or M
[0421] X.sub.94=no amino acid or N or E
[0422] In yet another embodiment, the defensin-like molecule
comprises the sequence [SEQ ID NO:61]:
TABLE-US-00022
MX.sub.1X.sub.2SX.sub.3X.sub.4X.sub.5X.sub.6X.sub.7X.sub.8X.sub.9X.sub.10-
X.sub.11X.sub.12X.sub.13X.sub.14X.sub.15X.sub.16X.sub.17X.sub.18X.sub.19
X.sub.20X.sub.21X.sub.22X.sub.23X.sub.24X.sub.25X.sub.26X.sub.2X.sub.28AX.-
sub.29X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34SX.sub.35
X.sub.36FX.sub.37GX.sub.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.43CX.sub.-
44X.sub.45X.sub.46CX.sub.47X.sub.48EX.sub.49F
X.sub.50X.sub.51GX.sub.52CX.sub.53X.sub.54X.sub.55X.sub.56X.sub.57X.sub.58-
X.sub.59CTX.sub.60X.sub.61CX.sub.62X.sub.63X.sub.64
X.sub.65X.sub.66X.sub.67X.sub.68X.sub.69X.sub.70X.sub.71X.sub.72X.sub.73X.-
sub.74X.sub.75X.sub.76X.sub.77X.sub.78X.sub.79X.sub.80
X.sub.82X.sub.83X.sub.84X.sub.85X.sub.86X.sub.87X.sub.88X.sub.89X.sub.90X.-
sub.91X.sub.92X.sub.93X.sub.94
wherein
[0423] X.sub.1=A, G or K
[0424] X.sub.2=R, N, or L
[0425] X.sub.3=L, I or M
[0426] X.sub.4=C, F or R
[0427] X.sub.5=F or L
[0428] X.sub.6=M, F or I
[0429] X.sub.7=A or S
[0430] X.sub.8=F, T or A
[0431] X.sub.9=A, L, V or F
[0432] X.sub.10=I, V, L or F
[0433] X.sub.11=L or I
[0434] X.sub.12=A, I or M
[0435] X.sub.13=M, A or F
[0436] X.sub.14=M or L
[0437] X.sub.15=L or I
[0438] X.sub.16=F or V
[0439] X.sub.17=V, T or L
[0440] X.sub.18=A, T or S
[0441] X.sub.19=Y or T
[0442] X.sub.20=E or G
[0443] X.sub.21=V or M
[0444] X.sub.22=no amino acid or G
[0445] X.sub.23=no amino acid or P
[0446] X.sub.24=no amino acid, M or V
[0447] X.sub.25=no amino acid or T
[0448] X.sub.26=no amino acid, I or S
[0449] X.sub.27=no amino acid or A or V
[0450] X.sub.28=Q or E
[0451] X.sub.29=no amino acid or Q
[0452] X.sub.30=R or Q
[0453] X.sub.31=E, I or T
[0454] X.sub.32=K or E
[0455] X.sub.33=T, A or S
[0456] X.sub.34=E, P or Q
[0457] X.sub.35=N, Q or H
[0458] X.sub.36=I or R
[0459] X.sub.37=P, K or H
[0460] X.sub.38=I, L, P or T
[0461] X.sub.39=I, F, S or V
[0462] X.sub.40=T, M, R or S
[0463] X.sub.41=K, D, E or A
[0464] X.sub.42=P or S
[0465] X.sub.43=P, S or N
[0466] X.sub.44=R or A
[0467] X.sub.45=K, T, S or N
[0468] X.sub.46=A, Y or V
[0469] X.sub.47=I, L, Q or H
[0470] X.sub.48=S, K, T or N
[0471] X.sub.49=K or G
[0472] X.sub.50=T, S, I, or V
[0473] X.sub.51=D or G
[0474] X.sub.52=H, R, or N
[0475] X.sub.53=S, P or R
[0476] X.sub.54=K, W, A or G
[0477] X.sub.55=I, L or F
[0478] X.sub.56=L, Q, P or R
[0479] X.sub.57=R or P
[0480] X.sub.58=R or K
[0481] X.sub.59=L or F
[0482] X.sub.60=K, S or R
[0483] X.sub.61=P, N or H
[0484] X.sub.62=no amino acid or V
[0485] X.sub.63=no amino acid or F
[0486] X.sub.64=no amino acid or D
[0487] X.sub.65=no amino acid or E or K
[0488] X.sub.66=no amino acid or K or I
[0489] X.sub.67=no amino acid or M or S
[0490] X.sub.68=no amino acid or T, I or S
[0491] X.sub.69=no amino acid or K or E
[0492] X.sub.70=no amino acid or T or V
[0493] X.sub.71=no amino acid or G or K
[0494] X.sub.72=no amino acid or A
[0495] X.sub.73=no amino acid or E
[0496] X.sub.74=no amino acid or I or T
[0497] X.sub.75=no amino acid or L
[0498] X.sub.76=no amino acid or A, V or G
[0499] X.sub.77=no amino acid or E
[0500] X.sub.78=no amino acid or E
[0501] X.sub.79=no amino acid or A
[0502] X.sub.80=no amino acid or K
[0503] X.sub.81=no amino acid or T
[0504] X.sub.82=no amino acid or L
[0505] X.sub.83=no amino acid or A or S
[0506] X.sub.84=no amino acid or A or E
[0507] X.sub.85=no amino acid or A or V
[0508] X.sub.86=no amino acid or L OR v
[0509] X.sub.87=no amino acid or L
[0510] X.sub.88=no amino acid or E
[0511] X.sub.89=no amino acid or E
[0512] X.sub.90=no amino acid or E
[0513] X.sub.91=no amino acid or I
[0514] X.sub.92=no amino acid or M
[0515] X.sub.93=no amino acid or D or M
[0516] X.sub.94=no amino acid or N or E
[0517] In a preferred embodiment, the genetic construct comprises a
nucleotide sequence encoding an amino acid sequence selected from
SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18.
[0518] In a particularly preferred embodiment, the genetic
construct comprises a nucleotide sequence selected from SEQ ID
NO:7, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17 or a nucleotide
sequence having at least 70% similarity to one or more of SEQ ID
NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18 or a nucleotide
sequence capable of hybridizing to SEQ ID NO:7, SEQ ID NO:13, SEQ
ID NO:15 and SEQ ID NO:17 or a complementary form thereof.
[0519] Most preferably, the amino acid sequence corresponds to the
mature domain and comprises the amino acid sequence set forth in
SEQ ID NO:8.
[0520] Reference to SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ
ID NO:18 includes reference to novel variants having at least about
70% similarity to any one of SEQ ID NO:8, SEQ ID NO:14, SEQ ID
NO:16 and SEQ ID NO:18. These sequences may also be used to
generate multimeric or heterologous molecules.
[0521] In accordance with this aspect of the present invention, the
construct is for use in generating transgenic plants with increased
or enhanced resistance to plant pests (e.g. insect), attack or
infestation. Preferably, the construct is used solely for this
purpose. The construct may, however, be used for generating
recombinant defensin-like molecules in microorganisms such as
bacteria. The present invention extends to generic constructs
encoding any defensin or defensin-like molecule for use in
combating insect infestation. For example, such constructs may be
used to generate transgenic plants resistant to insects.
[0522] Accordingly, the present invention provides a genetic
construct for use in generating insect-resistant transgenic plants,
said transgenic plants producing a defensin or defensin-like
molecule selected from SEQ ID NO:8, SEQ ID NO:14, SEQ ID NO:16 and
SEQ ID NO:18 as well as SEQ ID NO:20 to SEQ ID NO:49 or an amino
acid sequence having at least 70% similarity to any one of SEQ ID
NO:8, SEQ ID NO:14, SEQ ID NO:16 and SEQ ID NO:18.
[0523] As stated above, a plant includes either a monocotyledonous
plant or dicotyledonous plant. Particularly, useful plants are food
crops such as wheat, rice, barley, soybean and sugarcane.
Particularly useful non-food common crops include cotton. Flower
and ornamental crops include rose, carnation, petunia, lisianthus,
lily, iris, tulip, freesia, delphinium, limonium and
pelargonium.
[0524] The present invention further contemplates a method for
generating a plant with increased or enhanced resistance to a plant
pest, said method comprising introducing into the genome of a plant
cell or genome of a group of plant cells a genetic construct
comprising a promoter or functional equivalent thereof operably
linked to a nucleotide sequence encoding a floral-derived,
defensin-like molecule having a mature domain comprising the amino
acid sequence:
TABLE-US-00023 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
said mature domain exhibits inhibitory activity against plant pests
such as insect pests and regenerating a plant from said cell or
group of cells. In one aspect, this embodiment does not extend to
defensin-like molecules FST and TPP3.
[0525] The preferred plant pest is an insect.
[0526] Preferably, the defensin-like molecule comprises a mature
domain having the amino acid sequence [SEQ ID NO:58]:
TABLE-US-00024
X.sub.30X.sub.31CX.sub.32X.sub.33X.sub.34SX.sub.35X.sub.36FX.sub.37GX.sub-
.38CX.sub.39X.sub.40X.sub.41X.sub.42X.sub.43
CX.sub.44X.sub.45X.sub.46CX.sub.47X.sub.48EX.sub.49FX.sub.50X.sub.51GX.sub-
.52CX.sub.53X.sub.54X.sub.55X.sub.56X.sub.57
X.sub.58CX.sub.59CTX.sub.60X.sub.61C
wherein
[0527] X.sub.30=R or Q
[0528] X.sub.31=E, I or T
[0529] X.sub.32=K or E
[0530] X.sub.33=T, A or S
[0531] X.sub.34=E, P or Q
[0532] X.sub.35=N, Q or H
[0533] X.sub.36=T or R
[0534] X.sub.37=P, K or H
[0535] X.sub.38=I, L, P or T
[0536] X.sub.39=I, F, S or V
[0537] X.sub.40=T, M, R or S
[0538] X.sub.41=K, D, E or A
[0539] X.sub.42=P or S
[0540] X.sub.43=P, S or N
[0541] X.sub.44=R or A
[0542] X.sub.45=K, T, S or N
[0543] X.sub.46=A, Y or V
[0544] X.sub.47=I, L, Q or H
[0545] X.sub.48=S, K, T or N
[0546] X.sub.49=K or G
[0547] X.sub.50=T, S, I, or V
[0548] X.sub.51=D or G
[0549] X.sub.52=H, R, or N
[0550] X.sub.53=S, P or R
[0551] X.sub.54=K, W, A or G
[0552] X.sub.55=I, L or F
[0553] X.sub.56=L, Q, P or R
[0554] X.sub.57=R or P
[0555] X.sub.58=R or K
[0556] X.sub.59=L or F
[0557] X.sub.60=K, S or R
[0558] X.sub.61=P, N or H
[0559] More preferably, the mature domain is selected from the
amino acid sequences set forth in SEQ ID NO:2, SEQ ID NO:3, SEQ ID
NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:8.
[0560] Most preferably, the mature domain comprises an amino acid
sequence set forth in SEQ ID NO:8.
[0561] Yet another aspect of the present invention provides a
method for generating a plant with increased or enhanced resistance
to an insect, said method comprising introducing into the genome of
a plant cell or genome of a group of plant cells a genetic
construct comprising a promoter or functional equivalent thereof
operably linked to a nucleotide sequence encoding a defensin-like
molecule having a mature domain comprising the amino acid
sequence:
TABLE-US-00025 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
said mature domain exhibits inhibitory activity against plant pests
such as insect pests and regenerating a plant from said cell or
group of cells.
[0562] Preferred defensins are selected from SEQ ID NO:8, SEQ ID
NO:18 and SEQ ID NO:20 to SEQ ID NO:49.
[0563] The mature domains referred to above include fragments and
derivatives of these domains.
[0564] The term "fragment" as used herein means a portion or a part
of the mature domain parent which preferably retains the activity
of the parent mature domain. The term "fragment" includes
deletions, mutants and small peptides, for example, of at least 5,
preferably at least about 10 and more preferably at least about 20
contiguous amino acids, which comprise the above anti-plant pest
activity. Peptides of this type may be obtained through the
application of standard recombinant nucleic acid techniques or
synthesized using conventional liquid or solid phase synthesis as
described, for example, in Chapter 9 entitled "Peptide Synthesis"
by Atherton and Shephard which is included in a publication
entitled "Synthetic Vaccines" edited by Nicholson and published by
Blackwell Scientific Publications. Alternatively, peptides can be
produced by digestion of an amino acid sequence of the invention
with proteinases such as endoLys-C, endoArg-C, endoGlu-C and
Staphylococcus V8-protease. The digested fragments can be purified,
for example, by high performance liquid chromatographic (HPLC)
techniques.
[0565] By "derivative" is meant a polypeptide that has been derived
from the basic sequence by modification, for example, by
conjugation or complexing with other chemical moieties or by
post-translational modification techniques as would be understood
in the art. The term "derivative" also includes within its scope
alterations that have been made to a parent sequence including
additions or deletions that provide for functionally-equivalent
molecules. Accordingly, the term "derivative" encompasses molecules
that affect a plant's phenotype in the same way as does the parent
amino acid sequence from which it was generated. Also encompassed
are polypeptides in which one or more amino acids have been
replaced by different amino acids. It is well understood in the art
that some amino acids may be changed to others with broadly similar
properties without changing the nature of the activity of the
polypeptide (conservative substitutions) as described hereinafter.
These terms also encompass polypeptides in which one or more amino
acids have been added or deleted or replaced with different amino
acids.
[0566] The terms "protein", "polypeptide", "peptide" and "an amino
acid sequence" are used interchangeably herein to refer to a
polymer of amino acid residues and to variants and synthetic
analogues thereof. Thus, these terms apply to amino acid polymers
in which one or more amino acid residues is a synthetic
non-naturally occurring amino acid, such as a chemical analogue of
a corresponding naturally occurring amino acid as well as to
naturally occurring amino acid polymers.
[0567] The terms "variant" and "homologue" refer to nucleotide
sequences displaying substantial sequence identity with reference
nucleotide sequences or polynucleotides that hybridize with a
reference sequence under stringency conditions that are herein
defined. The terms "nucleic acid molecule", "nucleotide sequence",
"polynucleotide" and "nucleic acid molecule" may be used herein
interchangeably and encompass polynucleotides in which one or more
nucleotides have been added or deleted or replaced with different
nucleotides. In this regard, it is well understood in the art that
certain alterations inclusive of mutations, additions, deletions
and substitutions can be made to a reference nucleotide sequence
whereby the altered polynucleotide retains the biological function
or activity of the reference polynucleotide. Such variant
polypeptide sequences may encode polypeptides comprising some
differences in their amino acid composition but nevertheless
encoding a protein having the same or similar activity. The
resulting variant polypeptide sequences are encompassed herein. The
term "variant" also includes naturally occurring nucleotide allelic
variants.
[0568] The term "expression" is used in its broadest sense and
includes transient, semi-permanent and stable expression, as well
as inducible, tissue-specific, constitutive and/or
developmentally-regulated expression. Stable, tissue-specific
expression is preferred.
[0569] To effect expression of the nucleotide sequence of the
present invention, it may conveniently be incorporated into a
chimeric genetic construct comprising inter alia one or more of the
following: a promoter sequence, a 5' non-coding region, a
cis-regulatory region such as a functional binding site for
transcriptional regulatory protein or translational regulatory
protein, an upstream activator sequence, an enhancer element, a
silencer element, a TATA box motif, a CCAAT box motif, an upstream
open reading frame, transcriptional start site, translational start
site, and/or nucleotide sequence which encodes a leader sequence,
termination codon, translational stop site and a 3' non-translated
region. Preferably, the chimeric genetic construct is designed for
transformation of plants as hereinafter described.
[0570] The term "5' non-coding region" is used herein in its
broadest context to include all nucleotide sequences which are
derived from the upstream region of an expressible gene, other than
those sequences which encode amino acid residues which comprise the
polypeptide product of said gene, wherein 5' non-coding region
confers or activates or otherwise facilitates, at least in part,
expression of the gene.
[0571] The term "gene" is used in its broadest context to include
both a genomic DNA region corresponding to the gene as well as a
cDNA sequence corresponding to exons or a recombinant molecule
engineered to encode a functional form of a product.
[0572] As used herein, the term "cis-acting sequence" or
"cis-regulatory region" or similar term shall be taken to mean any
sequence of nucleotides which is derived from an expressible
genetic sequence wherein the expression of the first genetic
sequence is regulated, at least in part, by said sequence of
nucleotides. Those skilled in the art will be aware that a
cis-regulatory region may be capable of activating, silencing,
enhancing, repressing or otherwise altering the level of expression
and/or cell-type-specificity and/or developmental specificity of
any structural gene sequence.
[0573] Reference herein to a "promoter" is to be taken in its
broadest context and includes the transcriptional regulatory
sequences of a classical genomic gene, including the TATA box which
is required for accurate transcription initiation, with or without
a CCAAT box sequence and additional regulatory elements (i.e.
upstream activating sequences, enhancers and silencers) which alter
gene expression in response to developmental and/or environmental
stimuli, or in a tissue-specific or cell-type-specific manner. A
promoter is usually, but not necessarily, positioned upstream or
5', of a structural gene, the expression of which it regulates.
Furthermore, the regulatory elements comprising a promoter are
usually positioned within 2 kb of the start site of transcription
of the gene.
[0574] In the present context, the term "promoter" is also used to
describe a synthetic or fusion molecule, or derivative which
confers, activates or enhances expression of a structural gene or
other nucleic acid molecule, in a plant cell. Preferred promoters
according to the invention may contain additional copies of one or
more specific regulatory elements to further enhance expression in
a cell, and/or to alter the timing of expression of a structural
gene to which it is operably connected.
[0575] The term "operably connected" or "operably linked" in the
present context means placing a structural gene under the
regulatory control of a promoter, which then controls the
transcription and optionally translation of the gene. In the
construction of heterologous promoter/structural gene combinations,
it is generally preferred to position the genetic sequence or
promoter at a distance from the gene transcription start site that
is approximately the same as the distance between that genetic
sequence or promoter and the gene it controls in its natural
setting, i.e. the gene from which the genetic sequence or promoter
is derived. As is known in the art, some variation in this distance
can be accommodated without loss of function. Similarly, the
preferred positioning of a regulatory sequence element with respect
to a heterologous gene to be placed under its control is defined by
the positioning of the element in its natural setting, i.e. the
genes from which it is derived.
[0576] Promoter sequences contemplated by the present invention may
be native to the host plant to be transformed or may be derived
from an alternative source, where the region is functional in the
host plant. Other sources include the Agrobacterium T-DNA genes,
such as the promoters for the biosynthesis of nopaline, octapine,
mannopine, or other opine promoters; promoters from plants, such as
the ubiquitin promoter; tissue specific promoters (see, e.g. U.S.
Pat. No. 5,459,252 to Conkling et al.; WO 91/13992 to Advanced
Technologies); promoters from viruses (including host specific
viruses), or partially or wholly synthetic promoters. Numerous
promoters that are functional in mono- and dicotyledonous plants
are well known in the art (see, for example, Greve, J. Mol. Appl.
Genet. 1: 499-511, 1983; Salomon et al., EMBO J. 3: 1984; Garfinkel
et al., Cell 27: 143-513, 1983; Barker et al., Plant Mol. Biol. 2:
235-350, 1983) including various promoters isolated from plants
(such as the Ubi promoter from the maize ubi-1 gene) (see, e.g.
U.S. Pat. No. 4,962,028) and viruses (such as the cauliflower
mosaic virus promoter, CaMV 35S).
[0577] The promoter sequences may include regions which regulate
transcription, where the regulation involves, for example, chemical
or physical repression or induction (e.g. regulation based on
metabolites, light, or other physicochemical factors; see, e.g. WO
93/06710 disclosing a nematode responsive promoter) or regulation
based on cell differentiation (such as associated with leaves,
roots, seed, or the like in plants; see, e.g. U.S. Pat. No.
5,459,252 disclosing a root-specific promoter). Thus, the promoter
region, or the regulatory portion of such region, is obtained from
an appropriate gene that is so regulated. For example, the
1,5-ribulose bisphosphate carboxylase gene is light-induced and may
be used for transcriptional initiation. Other genes are known which
are induced by stress, temperature, wounding, pathogen effects,
etc.
[0578] The chimeric genetic construct of the present invention may
also comprise a 3' non-translated sequence. A 3' non-translated
sequence refers to that portion of a gene comprising a DNA segment
that contains a polyadenylation signal and any other regulatory
signals capable of effecting mRNA processing or gene expression.
The polyadenylation signal is characterized by effecting the
addition of polyadenylic acid tracts to the 3' end of the mRNA
precursor. Polyadenylation signals are commonly recognized by the
presence of homology to the canonical form 5' AATAAA-3' although
variations are not uncommon.
[0579] The 3' non-translated regulatory DNA sequence preferably
includes from about 50 to 1,000 nucleotide base pairs and may
contain plant transcriptional and translational termination
sequences in addition to a polyadenylation signal and any other
regulatory signals capable of effecting mRNA processing or gene
expression. Examples of suitable 3' non-translated sequences are
the 3' transcribed non-translated regions containing a
polyadenylation signal from the nopaline synthase (nos) gene of
Agrobacterium tumefaciens (Bevan et al., Nucl. Acid Res. 11: 369,
1983) and the terminator for the T7 transcript from the octopine
synthase gene of Agrobacterium tumefaciens. Alternatively, suitable
3' non-translated sequences may be derived from plant genes such as
the 3' end of the protease inhibitor I or II genes from potato or
tomato, the soybean storage protein genes and the pea E9 small
subunit of the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO)
gene, although other 3' elements known to those of skill in the art
can also be employed. Alternatively, 3' non-translated regulatory
sequences can be obtained de novo as, for example, described by An
(Methods in Enzymology 153: 292, 1987), which is incorporated
herein by reference.
[0580] A chimeric genetic construct can also be introduced into a
vector, such as a plasmid. Plasmid vectors include additional DNA
sequences that provide for easy selection, amplification and
transformation of the expression cassette in prokaryotic and
eukaryotic cells, e.g. pUC-derived vectors, pSK-derived vectors,
pGEM-derived vectors, pSP-derived vectors, or pBS-derived vectors.
Additional DNA sequences include origins of replication to provide
for autonomous replication of the vector, selectable marker genes,
preferably encoding antibiotic or herbicide resistance, unique
multiple cloning sites providing for multiple sites to insert DNA
sequences or genes encoded in the chimeric genetic construct, and
sequences that enhance transformation of prokaryotic and eukaryotic
cells.
[0581] The vector preferably contains an element(s) that permits
either stable integration of the vector or a chimeric genetic
construct contained therein into the host cell genome, or
autonomous replication of the vector in the cell independent of the
genome of the cell. The vector, or a construct contained therein,
may be integrated into the host cell genome when introduced into a
host cell. For integration, the vector may rely on a foreign or
endogenous DNA sequence present therein or any other element of the
vector for stable integration of the vector into the genome by
homologous recombination. Alternatively, the vector may contain
additional nucleic acid sequences for directing integration by
homologous recombination into the genome of the host cell. The
additional nucleic acid sequences enable the vector or a construct
contained therein to be integrated into the host cell genome at a
precise location in the chromosome. To increase the likelihood of
integration at a precise location, the integrational elements
should preferably contain a sufficient number of nucleic acids,
such as 100 to 1,500 base pairs, preferably 400 to 1,500 base
pairs, and most preferably 800 to 1,500 base pairs, which are
highly homologous with the corresponding target sequence to enhance
the probability of homologous recombination. The integrational
elements may be any sequence that is homologous with the target
sequence in the genome of the host cell. Furthermore, the
integrational elements may be non-encoding or encoding nucleic acid
sequences.
[0582] For cloning and sub-cloning purposes, the vector may further
comprise an origin of replication enabling the vector to replicate
autonomously in a host cell such as a bacterial cell. Examples of
bacterial origins of replication are the origins of replication of
plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting
replication in E. coli, and pUB110, pE194, pTA1060, and pAMP1
permitting replication in Bacillus. The origin of replication may
be one having a mutation to make its function temperature-sensitive
in a Bacillus cell (see, e.g. Ehrlich, Proc. Natl. Acad. Sci. USA
75: 1433, 1978).
[0583] To facilitate identification of transformed cells, the
vector desirably comprises a further genetic construct comprising a
selectable or screenable marker gene. The actual choice of a marker
is not crucial as long as it is functional (i.e. selective) in
combination with the plant cells of choice. The marker gene and the
nucleotide sequence of interest do not have to be linked, since
co-transformation of unlinked genes as, for example, described in
U.S. Pat. No. 4,399,216 is also an efficient process in plant
transformation.
[0584] Included within the terms selectable or screenable marker
genes are genes that encode a "secretable marker" whose secretion
can be detected as a means of identifying or selecting for
transformed cells. Examples include markers that encode a
secretable antigen that can be identified by antibody interaction,
or secretable enzymes that can be detected by their catalytic
activity. Secretable proteins include, but are not restricted to,
proteins that are inserted or trapped in the cell wall (e.g.
proteins that include a leader sequence such as that found in the
expression unit of extensin or tobacco PR-S); small, diffusible
proteins detectable, for example, by ELISA; and small active
enzymes detectable in extracellular solution such as, for example,
.alpha.-amylase, .beta.-lactamase, phosphinothricin
acetyltransferase).
[0585] Examples of bacterial selectable markers are the dal genes
from Bacillus subtilis or Bacillus licheniformis, or markers that
confer antibiotic resistance such as ampicillin, kanamycin,
erythromycin, chloramphenicol or tetracycline resistance. Exemplary
selectable markers for selection of plant transformants include,
but are not limited to, a hyg gene which encodes hygromycin B
resistance; a neomycin phosphotransferase (neo) gene conferring
resistance to kanamycin, paromomycin, G418 and the like as, for
example, described by Potrykus et al. (Mol. Gen. Genet, 199: 183,
1985); a glutathione-S-transferase gene from rat liver conferring
resistance to glutathione derived herbicides as, for example,
described in EP-A 256 223; a glutamine synthetase gene conferring,
upon overexpression, resistance to glutamine synthetase inhibitors
such as phosphinothricin as, for example, described WO 87/05327, an
acetyl transferase gene from Streptomyces viridochromogenes
conferring resistance to the selective agent phosphinothricin as,
for example, described in EP-A 275 957, a gene encoding a
5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance
to N-phosphonomethylglycine as, for example, described by Hinchee
et al. (Biotech. 6: 915, 1988), a bar gene conferring resistance
against bialaphos as, for example, described in WO 91/02071; a
nitrilase gene such as bxn from Klebsiella ozaenae which confers
resistance to bromoxynil (Stalker et al., Science 242: 419, 1988);
a dihydrofolate reductase (DHFR) gene conferring resistance to
methotrexate (Thillet et al., J. Biol. Chem. 263: 12500, 1988); a
mutant acetolactate synthase gene (ALS), which confers resistance
to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals
(EP-A-154 204); a mutated anthranilate synthase gene that confers
resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene
that confers herbicide resistance.
[0586] Preferred screenable markers include, but are not limited
to, a uidA gene encoding a .beta.-glucuronidase (GUS) enzyme for
which various chromogenic substrates are known; a
.beta.-galactosidase gene encoding an enzyme for which chromogenic
substrates are known; an aequorin gene (Prasher et al., Biochem.
Biophys. Res. Comm. 126: 1259, 1985), which may be employed in
calcium-sensitive bioluminescence detection; a green fluorescent
protein gene (Niedz et al., Plant Cell Reports 14: 403, 1995); a
luciferase (luc) gene (Ow et al., Science 234: 856, 1986), which
allows for bioluminescence detection; a .beta.-lactamase gene
(Sutcliffe, Proc. Natl. Acad. Sci. USA 75: 3737, 1978), which
encodes an enzyme for which various chromogenic substrates are
known (e.g. PADAC, a chromogenic cephalosporin); an R-locus gene,
encoding a product that regulates the production of anthocyanin
pigments (red colour) in plant tissues (Dellaporta et al.,
Chromosome Structure and Function, pp. 263-282, 1988); an
.alpha.-amylase gene (Ikuta et al., Biotech. 8: 241, 1990); a
yrosinase gene (Katz et al., J. Gen. Microbiol. 129: 2703, 1983)
which encodes an enzyme capable of oxidizing tyrosine to dopa and
dopaquinone which in turn condenses to form the easily detectable
compound melanin; or a xylE gene (Zukowsky et al., Proc. Natl.
Acad. Sci. USA 80: 1101, 1983), which encodes a catechol
dioxygenase that can convert chromogenic catechols.
[0587] The selectable marker gene construct may also comprise any
one or more of 5' and 3' non-coding regions, cis-regulatory
regions, enhancers, activators and the like, as hereinbefore
described.
[0588] A further aspect of the present invention provides a
transfected or transformed cell, tissue or organ from a plant or a
transformed microbial cell, said cell, tissue or organ comprising a
nucleic acid molecule comprising a sequence of nucleotides encoding
or complementary to a sequence encoding a polypeptide comprising,
in its precursor form, an N-terminal signal domain, a mature domain
and an acidic C-terminal domain wherein said polypeptide is
produced during flower development and its mature domain has
activity against one or more plant pests.
[0589] Preferably, the nucleic acid molecule comprises a sequence
of nucleotides encoding or complementary to a sequence encoding a
polypeptide comprising, in its precursor form, an N-terminal signal
domain, a mature domain and an acidic C-terminal domain wherein
said polypeptide is produced during flower development and its
mature domain comprises the structure:
TABLE-US-00026 (SEQ ID NO:62)
a.sub.1a.sub.2C.sub.Ia.sub.3a.sub.4a.sub.5a.sub.6a.sub.7a.sub.8a.sub.9a.su-
b.10a.sub.11a.sub.12C.sub.IIa.sub.13a.sub.14a.sub.15a.sub.16a.sub.17
C.sub.IIIa.sub.18a.sub.19a.sub.20C.sub.IVa.sub.21a.sub.22a.sub.23a.sub.24a-
.sub.25a.sub.26a.sub.27a.sub.28a.sub.29C.sub.Va.sub.30
a.sub.31a.sub.32a.sub.33a.sub.34a.sub.35C.sub.VIa.sub.36C.sub.VIIa.sub.37a-
.sub.38a.sub.39CVIII
wherein "a" may be the same or different and represents any amino
acid residue, the numerical subscript on each "a" represents its
position in the amino acid sequence and "C" represents a cysteine
residue at a position indicated by its Roman numeral and wherein
the mature domain has activity against one or more plant pests.
[0590] The vectors and chimeric genetic construct(s) of the present
invention may be introduced into a cell by various techniques known
to those skilled in the art. The technique used may vary depending
on the known successful techniques for that particular
organism.
[0591] Techniques for introducing vectors, chimeric genetic
constructs and the like into cells include, but are not limited to,
transformation using CaCl.sub.2 and variations thereof, direct DNA
uptake into protoplasts, PEG-mediated uptake to protoplasts,
microparticle bombardment, electroporation, microinjection of DNA,
microparticle bombardment of tissue explants or cells,
vacuum-infiltration of tissue with nucleic acid, and T-DNA-mediated
transfer from Agrobacterium to the plant tissue.
[0592] For microparticle bombardment of cells, a microparticle is
propelled into a cell to produce a transformed cell. Any suitable
ballistic cell transformation methodology and apparatus can be used
in performing the present invention. Exemplary procedures are
disclosed in Sanford and Wolf (U.S. Pat. Nos. 4,945,050, 5,036,006,
5,100,792, 5,371,015). When using ballistic transformation
procedures, the genetic construct may incorporate a plasmid capable
of replicating in the cell to be transformed.
[0593] Examples of microparticles suitable for use in such systems
include 0.1 to 10 .mu.m and more particularly 10.5 to 5 .mu.m
tungsten or gold spheres. The DNA construct may be deposited on the
microparticle by any suitable technique, such as by
precipitation.
[0594] Plant tissue capable of subsequent clonal propagation,
whether by organogenesis or embryogenesis, may be transformed with
a chimeric genetic construct of the present invention and a whole
plant generated therefrom. The particular tissue chosen will vary
depending on the clonal propagation systems available for, and best
suited to, the particular species being transformed. Exemplary
tissue targets include leaf disks, pollen, embryos, cotyledons,
hypocotyls, megagametophytes, callus tissue, existing meristematic
tissue (e.g. apical meristem, axillary buds, and root meristems),
and induced meristem tissue (e.g. cotyledon meristem and hypocotyl
meristem).
[0595] The regenerated transformed plants may be propagated by a
variety of means, such as by clonal propagation or classical
breeding techniques. For example, a first generation (or T1)
transformed plant may be selfed to give a homozygous second
generation (or T2) transformant and the T2 plants further
propagated through classical breeding techniques.
[0596] Accordingly, this aspect of the present invention, insofar
as it relates to plants, further extends to progeny of the plants
engineered to express the nucleic acid molecule encoding the
defensin-like molecule or a variant or homologue thereof as well as
vegetative, propagative and reproductive parts of the plants, such
as flowers (including cut or severed flowers), parts of plants,
fibrous material from plants (for example, cotton) and reproductive
portions including cuttings, pollen, seeds and callus.
[0597] Another aspect of the present invention provides a
genetically modified plant cell or multicellular plant or progeny
thereof or parts of a genetically modified plant capable of
producing a heterologous defensin-like molecule as herein described
wherein said transgenic plant is resistant or has reduced
sensitivity to plant pests such as insects.
[0598] More particularly, the present invention provides a
genetically modified plant cell or multi-cellular plant or progeny
or parts thereof comprising the amino acid sequence set forth in
SEQ ID NO:8 or a fragment or derivative.
[0599] The term "genetically modified" is used in its broadest
sense and includes introducing gene(s) into cells, mutating gene(s)
in cells and altering or modulating the regulation of gene(s) in
cells.
[0600] The genetic construct may be a single molecule or multiple
molecules such as a set of molecules such that a combination may
comprise nucleotide sequences capable of encoding other anti-plant
pathogen molecules such as but not limited to a proteinase
inhibitor or precursor thereof. Proteinase inhibitors such as
serine proteinase inhibitors frequently accumulate in storage
organs and in leaves in response to wounding. The inhibitory
activities of the proteins are directed against a wide range of
proteinases of microbial and animal origin.
[0601] Accordingly, another aspect of the present invention
comprises one or more genetic constructs alone or in combination
comprising a first promoter operably linked to a first nucleotide
sequence wherein said first nucleotide sequence encodes a
defensin-like molecule or part thereof capable of inhibiting a
plant pest such as an insect, said construct further comprising a
second promoter operably linked to a second nucleotide sequence
wherein said second nucleotide sequence encodes a proteinase
inhibitor or precursor thereof.
[0602] In one embodiment, the defensin-like molecule and/or its
encoding DNA sequence is selected from SEQ ID NO:7 to SEQ ID NO:18.
In another embodiment, the defensin-like molecule and/or its
encoding DNA sequence is selected from SEQ ID NO:7 to SEQ ID NO:18
or SEQ ID NO:20 to SEQ ID NO:24. The defensin-like molecule and/or
its encoding DNA sequence defined by SEQ ID NO:7 or SEQ ID NO:8 is
particularly preferred. In yet another embodiment, the
defensin-like molecule and/or its encoding DNA sequence is selected
from SEQ ID NO:7 or SEQ ID NO:8, SEQ ID NO:17 or SEQ ID NO:18 or
SEQ ID NO:20 to SEQ ID NO:55.
[0603] In another embodiment, the proteinase inhibitor is a serine
proteinase inhibitor of type I or type II. A particularly useful
proteinase inhibitor comprises the amino acid sequence encoding the
nucleotide sequence set forth in SEQ ID NO:57 and SEQ ID NO:56,
respectively. This molecule is also described in International
Patent Application No. PCT/AU93/00659 (WO 94/13810).
[0604] The present invention extends to plants and plant parts
including reproductive parts of plants which carry all or part of a
genetic construct which confers on the plant or plant parts
resistance or reduced sensitivity to plant pests including insects
and optionally a second genetic construct as described above.
[0605] The present invention further contemplates a composition
comprising a defensin or defensin-like molecule alone or in
combination with another agent such as a proteinase inhibitor. The
composition is particularly useful for topical application to
plants such as cotton plants, to assist in controlling insect
infestation.
[0606] The present invention further contemplates a promoter
associated with the genomic form of the nucleotide sequence set
forth in SEQ ID NO:7. According to this aspect of the present
invention, there is provided an isolated nucleic acid molecule
having promoter activity and corresponding to the genomic region in
a plant genome which is operably linked to a nucleotide sequence
corresponding to all or part of SEQ ID NO:7 or a nucleotide
sequence having 70% similarity thereof or a nucleotide sequence
capable of hybridizing to SEQ ID NO:7 or its complementary
form.
[0607] The present invention is further described by the following
non-limiting Examples.
Example 1
Preparation of Plant Material
[0608] Nicotiana alata (Link et Otto) plants of mixed
self-incompatibility genotype were maintained under glasshouse
conditions as described by Anderson et al. (Plant Cell 1: 483-491,
1989). Flowers and floral buds were harvested and within two hours,
pistils, ovaries and anthers were removed with forceps and a
scalpel blade, while petals were separated by hand. Pollen grains
from dehisced anthers and whole flowers at various stages of
development were also collected. The tissues were frozen in liquid
nitrogen and stored at -70.degree. C. until use.
Example 2
Cloning of cDNA from N. alata
(a) Isolation of RNA
[0609] Total RNA was prepared by grinding 70 pistils (1.3 g) from
N. alata flowers at the petal coloration stage of development to a
fine powder with a sterile mortar and pestle in the presence of
liquid nitrogen. The RNA was extracted with TRIzol (trademark)
Reagent (Gibco BRL) according to the manufacturer's instructions
(see Gibco BRL form #3796, TRIzol (trademark) Reagent Total RNA
isolation reagent).
(b) cDNA Synthesis and Amplification of Floral Defensin Sequence by
PCR
[0610] First strand cDNA was prepared from total pistil RNA using
the Superscript Preamplification System (Gibco BRL).
Oligonucleotide primers used for PCR were specific to the DNA
sequence published for the Flower Specific Thionin (FST, Gu et al.
[1992; supra] from N. tabacum.
TABLE-US-00027 [SEQ ID NO:1] Primer FST1: 5'
GGAATTCCATATGGCTCGCTCCTTGTGC 3' [SEQ ID NO:2] Primer FST2: 5'
GCGGATCCTCAGTTATCCATTATCTCTTC 3'
[0611] Primer FST1 and primer FST2 matched the sequence of FST
between nucleotides 49-66, and 346-363 respectively. A cDNA clone
encoding the N. alata floral defensin precursor (NaPdf1) was
obtained by PCR amplification using the single-stranded cDNA as a
template. The NaPdf1 product was cloned into the pBluescript SK+ II
(Stratagene) vector (pBS-NaPdf1) for sequencing. The product is 318
bp in length and encodes the complete coding sequence without the
5' and 3' untranslated regions.
[0612] The NaPdf1 PCR product was subsequently used to screen a
previously constructed N. alata pistil cDNA library (Schultz et
al., Plant Mol Biol 35: 833-845, 1997). The membranes were probed
with NaPdf1 cDNA labelled with [.alpha..sup.32P]dCTP using random
nonamer priming (Megaprime (trademark) DNA labelling kit, Amersham
Life Technologies). Unincorporated [.alpha..sup.32P]dCTP was
removed using a Bio-Rad Bio-Spin column 30 as described in the
manufacturer's instructions. The blot was hybridized with the probe
in a solution of 50% v/v formamide, 5.times.SSPE, 5.times.
Denhardt's solution and 200 .mu.g/ml herring sperm DNA at
42.degree. C. for 16 h before unbound probe was removed by washing
twice with 2.times.SSPE and 0.1% w/v SDS at room temperature for 10
min. Hybridized probe was visualized by exposing the blot to x-ray
film. Positive clones from the screen were excised and
sequenced.
Example 3
NaPdf1 Gene Expression
(a) RNA Gel Blot Analysis
[0613] Total RNA was isolated from anthers at stages I (5-10 mm
buds), II (20-30 mm buds) and III (50-70 mm buds) of development,
from pollen grains and from mature pistil, ovary, petal, leaf and
root tissues of N. alata (self-incompatibility genotype,
S.sub.2S.sub.2). The RNA samples (12.5 .mu.g) were fractionated on
a denaturing 1% w/v agarose-formaldehyde gel and transferred to
Hybond-N (Amersham Life Sciences) membrane. Production of a
radio-labelled NaPdf1 cDNA probe and hybridization conditions were
as described for the screening of the cDNA library, in Example
2(b), above. Stringency washes were in 0.2.times.SSPE, 0.1% SDS at
45.degree. C. and 55.degree. C. for 30 min, respectively. Results
are shown in FIG. 2. Hybridized probe was visualized by exposing
the blot to a storage phosphor screen for 24 h. The results were
read in a Molecular Dynamics 400B phosphorimager, using the
ImageQuant software.
(b) In Situ Hybridization
[0614] In situ hybridization was performed essentially as described
by Drews et al. (Cell 65: 991-1002, 1991) and Cox and Goldberg (In:
Analysis of plant genes expression In Plant Molecular Biology: A
Practical Approach. C. H. Shaw (ed), pp. 1-34, IRL Press, Oxford,
United Kingdom, 1988). .sup.35S-labelled sense and antisense RNA
probes were produced by linearising the pBS-NaPdf1 DNA with EcoRI
and BamHI and transcribing with T7 and T3 RNA polymerases
respectively (Ausubel et al. [1994; supra]; Drews et al. [1991;
supra]) Ten mm flower buds were excised from the plant and fixed in
50% v/v ethanol, 5% v/v acetic acid and 3.7% v/v formaldehyde. The
fixed tissues were dehydrated and embedded in paraffin (Sigma). The
tissues were then sliced into 10 .mu.m sections and attached to
Superfrost*/plus slides (Menzel-Glaser, Germany). The sections were
treated with xylene followed by hydration, proteinase K treatment,
acetylation and dehydration. The .sup.35S-labelled sense and
antisense riboprobes were hydrolyzed to about 100 nucleotides in
length and hybridized to the sections at 42.degree. C. for 17 h.
The sections were then treated with ribonuclease A and washed,
before the slides were coated with film emulsion. The sections were
developed after a 1 week exposure.
[0615] Results indicated that NaPdf1 transcript accumulated in the
connective tissue of the anthers, the cortical cells of the style
and in the epidermal cells of the petals and sepals (refer to FIG.
3). This accumulation pattern is consistent with the encoded
protein playing a role in the defense of the reproductive
organs.
Example 4
Protein Expression for Antibody Production
(a) Molecular Cloning and Bacterial Protein Expression
[0616] The pBS-NaPdf1 (see Example 2(b)) was used to PCR amplify a
DNA fragment encoding the proprotein domains (NaproPdf1, precursor
minus the N-terminal ER signal domain). For a schematic
representation of the structure, see FIG. 8. The NaproPdf1 DNA
fragment was obtained using oligonucleotide primers PDF1 and PDF2
which incorporated a BamHI and SacI restriction site for subsequent
cloning, respectively.
TABLE-US-00028 [SEQ ID NO:3] Primer PDF1: 5'
CCGGATCCAGAGAATGCAAAACAG 3' [SEQ ID NO:4] Primer PDF2: 5'
GGGAGCTCTTAGTTATCCATTATCTC 3'
[0617] The NaproPdf1 DNA fragment was cloned directly from PCR into
the pGEM-T vector (Promega) according to the manufacturer's
instructions and subcloned into the pQE30 (Qiagen) vector for
protein expression in E. coli strain M15 bacteria (Qiagen).
[0618] The NaproPdf1 protein was expressed in bacteria, as a fusion
with an N-terminal hexahistidine tag. Transformed E. coli cells
were grown in LB broth containing ampicillin (100 .mu.g/ml) and
kanamycin (12.5 .mu.g/ml) to an absorbance reading of .about.0.8 at
595 nm before induction with isopropyl
.beta.-D-thiogalactopyranoside (IPTG, 1 mM) for 6 h. Cells were
pelleted by centrifugation and resuspended in lysis buffer (10 mM
Tris-HCl pH 8.0, 100 mM sodium phosphate buffer pH 8.0, 8 M urea;
30 ml of lysis buffer/litre of culture) before incubation for 30
min on ice. The lysate was then passed through an 18-gauge needle
before the supernatant was collected by centrifugation (25,000 g,
15 min, 4.degree. C.). The hexahistidine-tagged proteins
(6H.NaproPdf1) were purified from lysed bacterial cells using the
denaturing protein purification protocol outlined in the Clontech
TALON (trademark) Metal Affinity Resin User Manual (PT1320-1).
Bound proteins were eluted from the resin in 100 mM EDTA, pH 8.0.
The eluted proteins were lyophilized. Protein extracts
corresponding to various steps in the purification procedure were
analyzed by SDS-PAGE (15% w/v polyacrylamide) and visualized by
staining with Coomassie Blue (see FIG. 4A). A sample of the metal
affinity purified 6H.NaproPdf1 protein was applied to an Aquapore
RP300 reverse-phase C8 analytical column (4.6.times.100 mm,
Brownlee) using a Waters model 510 pump and a Waters model 481 UV
detector. Protein was eluted with a gradient of 0-100% buffer B
(60% v/v acetonitrile in 0.089% v/v trifluoroacetic acid), over 30
min. The protein eluted in a single peak (FIG. 4B) and N-terminal
sequence and mass spectrometry confirmed that it was
6H.NaproPdf1.
(b) Production of a Polyclonal Antiserum
[0619] The bacterially-expressed 6H.NaproPdf1 protein (1.3 mg) was
conjugated to keyhole limpet hemocyanin (KLH, 0.3 mg, Sigma) with
glutaraldehyde as described by Harlow and Lane (Antibodies: A
Laboratory Manual. Cold Springs Harbor Laboratory Press, Cold
Springs Harbor, N.Y., 1988), prior to injection into a rabbit. The
conjugated protein was then dialyzed against PBS overnight. The
protein conjugate (100 .mu.g, in 1 mL PBS) was mixed with an equal
volume of Freund's complete adjuvant (Sigma). The primary
immunization consisted of 4.times.400 .mu.L subcutaneous
injections. Booster immunizations were administered 5 and 9 weeks
later and contained the protein conjugate (100 .mu.g, in 1 mL PBS)
mixed with Freund's incomplete adjuvant (Sigma). Pre-immune serum
was collected prior to injection while immune serum was collected 9
days after the second immunization.
(c) Protein A Purification of IgGs from whole Sera
[0620] The IgG fraction in the pre-immune serum and immune serum
were purified using a Protein-A Sepharose CL-4B column (2.5 mL,
Pharmacia) according to the manufacturer's instructions. The
pre-immune serum (2 mL) was diluted in an equal volume of 0.1 M
Tris-HCl (pH 7.5) and loaded onto the column which had been
equilibrated in 0.1 M Tris-HCl (pH 7.5). The eluent was collected
and re-applied three times. The column was washed with 80 mL of 0.1
M Tris-HCl (pH 7.5), followed by 80 mL of 0.01 M Tris-HCl (pH 7.5)
to remove any unbound material. The IgGs were eluted with 100 mM
glycine (pH 2.5) and 500 .mu.L fractions were collected into
microfuge tubes containing 50 .mu.L of 1 M Tris-HCl (pH 8.8).
Fractions containing the IgGs were pooled and dialysed extensively
with PBS at 4.degree. C. The Protein-A Sepharose column was
regenerated by washing with 0.1 M Tris-HCl (pH 7.5). When the pH
reached 7.5, the immune serum (3 mL, second bleed) was applied and
purified as described for the pre-immune serum.
(d) SDS-Polyacrylamide Gel Electrophoresis
[0621] Buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 0.5 M NaCl)
soluble protein samples (60 .mu.g), from the stages of N. alata
flower development shown in FIG. 5(A), were subjected to
SDS-polyacrylamide gel electrophoresis (SDS-PAGE, with 4% w/v
stacking and 15% resolving w/v polyacrylamide gels) (Laemmli,
Nature 227: 680-685, 1970) using a Mini Protean II Electrophoresis
apparatus (Bio-Rad). The proteins were visualized by coomassie blue
staining and compared to Broad Range molecular weight markers
(6.5-200 kDa) from Bio-Rad.
(e) Immunoblot Analysis
[0622] Proteins separated by SDS-PAGE were transferred to a
nitrocellulose membrane (Micron Separations Inc., 0.22 .mu.m pore
size) using a Mini-Protean II Trans-Blot apparatus (Bio-Rad) in
transfer buffer (48 mM Tris (hydroxymethyl) aminomethane, 192 mM
glycine, 20% v/v methanol). After transfer at 100 V for 1 h, the
membrane was fixed in isopropanol for 1 min followed by a 5 min
wash in TBS (20 mM Tris-HCl, 150 mM NaCl, pH 8.0). Molecular weight
markers were visualized by amido black staining (1:50 dilution of
0.1% w/v amido black in 40% v/v methanol and 10% v/v acetic
acid).
[0623] The membrane was blocked for 1 h in 5% w/v skim milk
followed by incubation with anti-6H.NaproPdf1 antibodies for 1.5 h
(1:2500 dilution in TBS). The membrane was washed 3.times.10 min in
TBST (0.1% v/v Tween 20 in TBS) before incubation with donkey
anti-rabbit IgG conjugated to horseradish peroxidase for 1.5 h
(Amersham Pharmacia Biotech; 1:5000 dilution in TBS). Three further
10 min washes were performed before the immunoblot was treated with
Enhanced Chemi-Luminescence (ECL) detection reagents (Amersham
Pharmacia Biotech) according to the manufacturer's instructions.
Immunoblots were exposed to ECL Hyperfilm (Amersham Pharmacia
Biotech). Three proteins reacted specifically with the antibodies
and the levels of protein were most abundant during the early
stages of development (refer to FIG. 5B).
[0624] The lower molecular weight species was confirmed as the
mature defensin by mass spectrometry (5.3 kDa) and N-terminal amino
acid sequencing; refer to Example 5(c), below.
Example 5
Purification from Floral Buds
(a) Protein Extraction
[0625] Mature NaPdf1 protein was extracted from flowers using a
modification of a procedure for extraction of thionins from barley
flour (Ozaki et al., J. Biochem. 87: 549-555, 1980). Whole N. alata
flowers up to the petal coloration stage of flower development
(5-50 mm, 650 g wet weight) were ground to a fine powder with
liquid nitrogen using a mortar and pestle and processed further in
an Ultra-Turrax homogenizer (Janke & Kunkel, Germany) in 50 mM
sulfuric acid (3 mL/g weight). After stirring for 1 h at 4.degree.
C., insoluble material was removed by filtration through Miracloth
(Calbiochem) followed by centrifugation (25,000.times.g, 15 min,
4.degree. C.). The slurry was adjusted to pH 7.8 by the slow
addition of 10 M NaOH and stirred for 1 h at 4.degree. C. before
removal of precipitated material by centrifugation (25,000.times.g,
15 min, 4.degree. C.). Solid ammonium sulfate was added to 80%
(w/v) saturation and the mixture was stirred for 4 h or overnight
at 4.degree. C. to precipitate the defensin protein. The
precipitate was collected by centrifugation and was dissolved in 50
mL of gel filtration buffer (150 mM KCl, 10 mM Tris-HCl, pH 8.0)
prior to heating at 90.degree. C. for 10 min. Following
centrifugation, the supernatant was loaded onto a Sephadex G-50 gel
filtration column (85.times.2.54 cm, Pharmacia). Fractions (50 mL)
were collected and analyzed by immunoblotting with
anti-6H.NaproPdf1 antibodies. Fractions containing NaPdf1 were
pooled, concentrated by rotary evaporation at 45.degree. C. and
filtered through a 0.22 .mu.m syringe filter (Millipore) before
further purification by RP-HPLC.
(b) Reverse-Phase High Performance Liquid Chromatography
[0626] RP-HPLC was performed on a Beckman System Gold HPLC coupled
to a Beckmann 166 detector. Analytical RP-HPLC was conducted on an
Aquapore RP300 reverse-phase C8 column (4.6.times.100 mm, Brownlee)
while preparative runs were performed using a Vydac C8
reverse-phase column (22.times.250 mm). The protein was eluted with
a linear gradient of 0-100% buffer B (60% v/v acetonitrile in
0.089% v/v trifluoroacetic acid) at a flow-rate of 1 mL/min or 10
mL/min over 40 min, respectively. Results from the analytical
column are shown in FIG. 6A. The identity of the major peak was
confirmed by N-terminal sequencing and mass spectrometry, as
described below.
(c) Electrospray Ionisation Mass Spectrometry
[0627] Prior to electrospray ionization mass spectrometry (ESI-MS),
protein fractions from RP-HPLC were concentrated under vacuum in a
freeze drier and reconstituted in milli-Q water. ESI-MS was carried
out using 1-100 pmol protein in 2-4 .mu.L of 50% v/v acetonitrile
containing 0.1% w/v formic acid. Samples were infused at a flow
rate of 0.2 .mu.L/min into a Perkin-Elmer Sciex API-300 triple
quadruple fitted with a micro-ionspray ion source. The mass scale
was calibrated using singly-charged poly(propylene glycol) ions to
a mass accuracy equivalent to .+-.1%. Mass spectra were recorded in
the first quadruple (Q1) scan mode over the mass range m/z 200 to
3000 daltons per charge using a constant peak width (full width at
half peak maximum) of 0.6 daltons per unit charge. Perkin-Elmer
Sciex Bio-Multiview software was employed for signal averaging of
30-100 scans, manual mass determination and transformation of
mass-to-charge ratio spectra to a true mass scale. Uncertainties
were calculated at 95% confidence limits using small sample
statistics and include calibration uncertainty.
[0628] Results indicated that the protein in Peak A in FIG. 6A, and
the lower molecular weight species shown in FIG. 5B (.about.5 kDa),
corresponded to the mature defensin domain encoded by the NaPdf1
cDNA clone (see FIG. 6B).
(d) Amino Acid Sequencing
[0629] Amino acid sequencing by Edman degradation was carried out
on an Applied Biosystems 470A gas-phase peptide sequenator coupled
to an Applied Biosystems 130A separation system for automatic
on-line PTH amino acid analysis. The eight amino acids of
N-terminal sequence obtained from the protein in Peak A matched the
sequence predicted from the NaPdf1 cDNA clone (see FIG. 6B).
Example 6
Immunogold Localization
Fixation and Immunogold Labelling for Electron Microscopy
[0630] Anthers and ovaries were removed from N. alata flowers at
the immature bud stage (10 mm) and were fixed for 2 h at room
temperature and then overnight at 4.degree. C. in 4% (w/v)
formaldehyde and 0.5% (w/v) glutaraldehyde in 60 mM PIPES/KOH, pH
7.2. After fixation, the tissues were washed in 60 mM PIPES/KOH, pH
7.2 and dehydrated for 3 h at room temperature in acidified
dimethoxypropane (concentrated hydrochloric acid:dimethoxypropane,
1:2000 [v/v]). The dehydrated segments were embedded in LR Gold
containing Benzil (London Resin Co. Ltd.) by polymerization under a
Phillips TUV 15-W UV lamp at a distance of 10 cm for 12 h at
25.degree. C. Immunogold labelling of ultrathin sections was
performed as described in Anderson et al. (Planta 171: 438-442,
1987). The protein A purified anti-6H.NaproPdf1 antibodies were
incubated with anther and ovary sections at a final concentration
of 64 .mu.g IgG/mL and 21 .mu.g IgG/mL, respectively. Specificity
of labeling was tested by replacing the primary antibody with
antibodies purified from pre-immune serum at the same
concentration. For visualization of ultrastructure, the sections
were stained for 15 min in 3% (w/v) aqueous uranyl acetate and 2
min with Sato triple lead stain (Sato, J. Electron Microsc. 17:
158-159, 1968) before being viewed on a Joel 1200 electron
microscope.
Example 7
Sequences and Sequence Comparisons
[0631] The nucleotide and predicted amino acid sequences of N.
alata defensin are set forth in FIG. 1. The gene that the cDNA
clone represents is designated NaPdf1 (N. alata plant defensin 1).
The DNA sequence shown is a composite sequence from an overlapping
cDNA clone and a primer extension product as follows: 1-49, primer
extension product clone; 50-541, cDNA clone NaPdf1. The protein
predicted by this composite cDNA sequence is shown below the
nucleotide sequence. The cDNA clone contains a single open reading
frame of 318 nucleotides, encoding for 105 amino acids. The PCR
amplified sequence in the original pBS-NaPdf1 clone (see Example 2)
corresponds to nucleotides 1-318 in the NaPdf1 clone shown in FIG.
1.
[0632] In FIG. 9, the 105-amino acid sequence of NaPdf1 (SEQ ID
NO:18) is shown aligned with the predicted amino acid sequences
encoded by five other flower-derived cDNA clones. The sequences, in
order, are as follows: flower specific thionin (FST), sourced from
Gu et al. [1992; supra] (SEQ ID NO: 20), derived from tobacco
flowers; TPP3, sourced from Milligan and Gasser [1995; supra] (SEQ
ID NO: 21), derived from tomato pistil; NTS13, sourced from Li and
Gray [1999; supra] (SEQ ID NO: 22), derived from tobacco styles;
PPT, sourced from Karunanandaa et al. [1994; supra] (SEQ ID NO:
23), derived from petunia pistil, and ATPIIIa, sourced from Yu et
al. [1999; supra], Direct Submission, Accession No. S30578 (SEQ ID
NO: 24), derived from Arabidopsis.
[0633] The 47 amino acids constituting the mature central domain of
the NaPdf1 protein (SEQ ID NO:8) were also aligned with the
corresponding amino acid sequences of the mature domains of other
members of the plant defensin family (SEQ ID NO:25 to SEQ ID
NO:49). Alignment was carried out using the computerized algorithm
of ClustalW. The results are set forth in FIG. 10. For details of
the relevant references from which each sequence was obtained, and
for their individual sequence identifiers, refer to the figure
legend.
Example 8
Fungal Growth Inhibition Assays
[0634] The 96-well microtitre plate assay of Broekaert et al. (EMS
Microbiology Letters 69: 55-60, 1990) was used to test the effect
of the purified NaPdf1 protein on the growth of Botrytis cinerea
(isolated from rosemary, Brunswick, Victoria), Fusarium oxysporum
(f. sp. dianthi, Race 2; isolated from carnation by Florigene
Limited, Collingwood, Victoria) and Fusarium oxysporum (f. sp.
vasinfectum, isolate VCG 01111 from cotton; provided by the
Department of Primary Industries, Queensland). Fungal spores were
isolated from sporulating cultures growing on half strength potato
dextrose agar (PDA, Difco) or gamma-irradiated carnation leaves in
water agar by the addition of sterile water and the use of a
spreader. The suspension was filtered through two layers of
autoclaved muslin and the spore concentration in the filtrate
determined using a haemocytometer. The spores were used directly or
after storage in sterile 20% v/v glycerol solution at -20.degree.
C.
[0635] Antifungal assays were performed in 96-well flat-bottomed
microtitre plates (Greiner) under aseptic conditions. The spore
concentration was adjusted to about 2.times.10.sup.4 spores/mL in
PDB and 80 .mu.L of this suspension was added to each well to which
20 .mu.L of filter sterilised (0.22 .mu.m syringe filter,
Millipore) test protein (10, 50 or 100 .mu.g/mL) or water was
added. The purity and concentration of each protein was confirmed
before use by RP-HPLC analysis. Sterile water and ovalbumin (Sigma)
were added to other wells as negative controls, and a mixture of
the antifungal proteins .alpha.- and .beta.-purothionin (Sigma) was
used as a positive control. The plates were shaken on an orbital
shaker for a few seconds to mix the spores and the test proteins.
The plates were allowed to stand for 30 min to allow the spores to
sediment before the optical density of the plates were determined
using a Spectra Max Pro 250 microplate reader (Molecular Devices)
at 595 nm absorbance. The plates were incubated in the dark at
22.degree. C. and measurements were taken over the course of 100 h.
An increase in absorbance relative to the initial reading was
correlated with the growth of fungal hyphae and this was plotted
against time. All assays were performed in quadruplicate.
[0636] Growth inhibition curves, set out in FIGS. 11 and 12A-12C,
show the effect of purified NaPdf1 defensin protein against B.
cinerea (FIG. 11), F. oxysporum (f. sp. dianthi, FIG. 12A) and F.
oxysporum (f. sp. vasinfectum, FIGS. 12B and 12C), respectively.
The results clearly indicate the effectiveness of 20 .mu.g/mL of
NaPdf1 against all three fungal pathogens.
Example 9
Production of Transgenic Tobacco Plants
(a) Construction of the Binary Plasmid
[0637] Primers FLOR1 and FLOR2, as shown below, were used to
amplify the full DNA coding sequence of NaPdf1 by conventional PCR,
in order to incorporate a 5' EcoRI and a 3' XbaI restriction enzyme
site for subsequent cloning steps.
TABLE-US-00029 Primer FLOR1 (EcoRI-spacer-ATG-seq, 31 mer): [SEQ ID
NO:5] 5' GGAATTCTAAACAATGGCTCGCTCCTTGTGC 3' Primer FLOR2
(XbaI-stop-seq, 29 mer): [SEQ ID NO:6] 5'
GCTCTAGATCAGTTATCCATTATCTCTTC 3'
[0638] The resultant PCR product was directly sub-cloned into a TA
vector (pCR2.1-TOPO, Invitrogen) and the sequence was verified by
nucleotide sequencing. The NaPdf1 DNA was excised from the TA
vector with EcoRI and XbaI restriction enzymes, gel purified and
subcloned into the pFB98/06 vector (obtained from Florigene
Limited, Collingwood, Australia), previously treated with
compatible restriction enzymes to create p35-PDF1. This construct
(p35-PDF1) contains the defensin cDNA flanked by the 35S
cauliflower mosaic virus promoter (CaMV35S) and terminator
sequences. Construct p35-PDF1 was further digested with SphI
restriction enzyme, to remove the promoter-gene-terminator
cassette, and gel purified. The 3' overhangs produced by SphI were
blunt ended with T4 DNA polymerase and gel purified. At this stage,
the cassette was inserted into a binary vector, pGCP1988
(Florigene) or pBIN19 (Bevan et al. [1983; supra]), which had
previously been treated with the blunt end cutter SmaI restriction
enzyme. The resultant constructs were designated (i) pFL1
(contained in pCGP1988), which has a glean (surB) selectable marker
gene under the control of the CaMV35S promoter/terminator, and (ii)
pHEX3 (contained in pBIN19) which has a kanamycin (nptII)
selectable marker gene under the control of the nos
promoter/terminator. Constructs pFL1 and pHEX3 have the defensin
gene cassette in the convergent and tandem orientation relative to
their selectable marker genes, respectively. Schematics of
constructs pFL1 and pHEX3 are shown in FIG. 13.
(b) Transformation of Agrobacterium tumefaciens LBA4404
[0639] Electro-competent Agrobacterium tumefaciens (LBA4404) were
prepared and transformed with either pFL1 or pHEX3 by conventional
electroporation in a Gene Pulser (registered trademark)/E. coli
cuvettes with a 0.2 cm electrode gap (Bio-Rad) and exposed to 1.8
kV, a capacitance of 25 .mu.FD and a resistance of 600 ohms in a
Gene Pulser (Bio-Rad). The electroporated cells were combined with
1 mL SOC medium and incubated with shaking at 28.degree. C. for 3 h
before 150 .mu.L was withdrawn and plated out on LB agar
supplemented with 20 .mu.g/mL rifampicin for pFL1 transformants or
20 .mu.g/mL rifampicin and 50 .mu.g/mL kanamycin for pHEX3
transformants. The plates were incubated overnight at 28.degree.
C.
[0640] Transformants were selected by preparing plasmid DNA from
randomly chosen colonies, performing diagnostic restriction digests
and analysing for inserts by agarose gel electrophoresis.
(c) Agrobacterium-Mediated Transformation of Tobacco
[0641] Seeds of N. tabacum cultivar Wisconscin 38 (W38) were
surface sterilized in 1% v/v sodium hypochlorite for 60 min
followed by several washes in sterile water. The sterilized seeds
were sown onto MS medium (MS; 0.44% w/v Murashige and Skoog medium
(ICN Biomedicals) [Plant Physiology 15: 73-97, 1962], 3% w/v
sucrose and 0.8% w/v Bacto agar, pH 5.8) and incubated in a
temperature control cabinet for 5 weeks. A. tumefaciens (LBA4404)
transformed with either the pFL1 or pHEX3 constructs were grown for
2-3 days in 10 ml LB medium supplemented with the antibiotics
rifampicin (20 .mu.g/ml) or kanamycin (50 .mu.g/ml) and rifampicin
at 28.degree. C., respectively. The cells were collected by
centrifugation (5 min, 3,500.times.g), resuspended in 20 ml MS and
incubated with freshly cut leaf disks (1 cm.sup.2 squares) briefly.
The disks were blotted onto sterile 3MM paper before being
transferred onto SIM agar (0.44% w/v Murashige and Skoog medium
(ICN Biomedicals) [1962; supra], 3% w/v sucrose, 1.0 mg/L BAP, 0.5
mg/L indole acetic acid (IAA) and 0.8% w/v Bacto agar, pH 5.8) and
incubated for 3 days at 25.degree. C. in light. Control leaf disks
were treated similarly with MS alone. Following co-cultivation,
calli were transferred onto selective media to induce shoot
formation. pFL1 transformed calli were transferred to SIM agar
supplemented with 1.5 mg/L glean and 250 mg/L cefotaxamine while
the pHEX3 transformed calli were selected with 100 mg/L kanamycin
and 250 mg/L cefotaxamine. The regenerated shoots were dissected
from the calli, briefly dipped in IBA (1 mg/mL) solution, and
transferred onto root-inducing medium (RIM; 0.44% w/v Murashige and
Skoog medium [1962; supra], 3% w/v sucrose, 150 mg/L timentin and
0.8% w/v Bacto agar), supplemented with either 1.5 mg/L glean or
100 mg/L kanamycin for pFLI or pHEX3, respectively and incubated as
described previously. When adequate root growth was established,
plantlets were potted into soil and grown under standard glasshouse
conditions.
(d) Detection of NaPdf1 in Transgenic Tobacco Leaves
[0642] Leaves (4.sup.th or 5.sup.th position) were cut at the
petiole from glasshouse grown plants. The tissue was frozen in
liquid nitrogen and ground to a fine powder with a mortar and
pestle. The tissue was added to extraction buffer: 50 mM Tris-HCl
pH 8.0, 10 mM EDTA and 0.5 M NaCl (1 mL/g of fresh wet weight). The
mixture was allowed to stand on ice for 15 min before clarification
by centrifugation at 13,500.times.g for 15 min, 4EC. Protein
concentrations were estimated by the method of Bradford (1976),
reagents were from Bio-Rad and BSA was used as a standard. Total
soluble leaf proteins (100 .mu.g) were separated by SDS-PAGE using
either 15% w/v or preformed 4-12% w/v polyacrylamide gradient gels
(Novex) as described in Example 4(d), above. Following
electrophoresis, proteins were either stained using coomassie blue
or transferred to nitrocellulose for immunodetection of NaPdf1 as
described in Example 4(e), above. Comparative results are shown in
FIGS. 14A and B.
Example 10
Insect Feeding Trials
(a) Source of Insects
[0643] Helicoverpa punctigera larvae came from a colony collected
in Victoria, Australia and maintained in culture at La Trobe
University, Melbourne and H. armigera were obtained from a colonies
maintained at La Trobe University, Melbourne or the Australian
Cotton Research Institute, at the Entomology Department of the
Commonwealth Scientific and Industrial Research Organisation in
Narrabri, NSW.
(b) Bioassays with Transgenic Tobacco Leaves
[0644] Three experiments were conducted with clonal material from
transgenic plant, pFL1/W19 (transformed with the pFL1 construct)
and transgenic plant, pHEX3.4 (transformed with the pHEX3
construct). An untransformed W38 plant was used as negative
control.
[0645] In experiments 1 and 2, 31 and 40 newly hatched Helicoverpa
punctigera larvae were selected for each treatment, respectively.
The larvae were reared in individual plastic cups with lids (Solo
(registered trademark) plastic portion cups, 28 mL) containing 1.5%
w/v Bacto agar and were fed leaf segments that were replaced either
every 2-3 days or when more than 75% had been consumed. The amount
of leaf material was increased as the larvae reached 5.sup.th
instar. Young leaves from non-flowering plants were used in all
bioassays. To avoid a wounding response, the leaves were freshly
excised from the petiole with a clean scalpel blade and were
divided into sections (2.times.2 cm) by careful dissection between
the major veins to minimize any wound response in the leaf
sections. The larvae were kept in a controlled temperature room of
24.+-.1EC, under light. The weights of the larvae were measured
every 2-3 days until day 23 and the mean weight calculated. In
experiment 3, 40 H. armigera larvae were used under the same
conditions described for the H. punctigera bioassays. Results are
shown in FIGS. 15A-15D.
(c) Bioassays with Artificial Diet
[0646] To confirm that the insecticidal activity was due to the
defensin and not to upregulation of other endogenous defence
molecules, a feeding trial using artificial cotton leaf diet
containing purified defensin from floral buds was performed. The 6
kDa cysteine rich proteinase inhibitors (NaPI) from N. alata
(Atkinson et al., Plant Cell 5: 203-213, 1993) were used as
positive control and casein was used as a negative control. Feeding
trials were conducted as described in Heath et al. (J. Insect
Physiology 43: 833-842, 1997 except that the artificial diet was
based on cotton leaves (Table 2). Thirty milligram of defensin was
purified from floral buds of N. alata and used in artificial diets
at two concentrations. H. armigera larvae fed on defensin at 0.3%
(w/v) were 40% smaller than controls (FIG. 16) while larvae fed on
NaPI at the same concentration were about 60% smaller than
controls.
Example 11
Production of Transgenic Cotton Plants
(a) Agrobacterium-Mediated Transformation of Cotton
[0647] Seeds of Gossypium hirsutum cultivar Coker 315 were surface
sterilized in 2% v/v sodium hypochlorite for 60 min followed by
several washes in sterile water. The sterilized seed were sown onto
half-strength MS medium (MS; 0.22% w/v Murashige and Skoog salt
mixture (Gibco BRL) [1962; supra], 0.2% Gelrite (Phyto Technology
Laboratories), pH 5.8) and incubated at 30.degree. C. in the dark
for 7 days. A. tumefaciens (LBA4404) transformed with the pHEX3
construct was grown overnight in 25 ml LB medium supplemented with
the antibiotic kanamycin (50 .mu.g/mL) at 28.degree. C. The
absorbance at 550 nm was measured and the cells were diluted to
2.times.10.sup.8 cells per ml in MS liquid media (0.43% w/v
Murashige and Skoog salts [1962; supra], pH 5.8). Cotton hypocotyls
were cut into 1.5-2 cm pieces and mixed briefly (0.5-3 min) in the
diluted Agrobacterium culture. The explants were blotted dry on
sterile 3MM paper and transferred to medium 1 (0.43% w/v Murashige
and Skoog salt mixture (GibcoBRL) [1962; supra], 0.1% v/v Gamborg's
B5 vitamin solution (Sigma), 0.1 g/L myo-inositol, 0.9 g/L
MgCl.sub.2, (hexahydrate), 1.9 g/L potassium nitrate, 0.2% w/v
Gelrite, 3% w/v glucose, pH 5.8) overlayed with sterile filter
paper and incubated for 3 days at 26.degree. C. under lights
[0648] Following co-cultivation, explants were transferred to
medium 2 (medium 1 plus 0.1 mg/L kinetin, 0.1 mg/L 2,4-D, 500 mg/L
carbenicillin, 35 mg/L kanamycin) and maintained at 30.degree. C.
under low light. After 4 weeks explants were transferred to medium
3 (medium 1 plus 500 mg/L carbenicillin, 35 mg/L kanamycin) and
maintained at 30.degree. C. under low light. Explants and callus
were sub-cultured every 4 weeks on medium 3 and maintained at
30.degree. C. under low light. Embryos were excised from the tissue
and germinated in medium 4 (1.2 mM CaCl.sub.22H.sub.2O, 5.0 mM
KNO.sub.3, 2.0 mM MgSO.sub.47H.sub.2O, 3.0 mM NH.sub.4NO.sub.3, 0.2
mM KH.sub.2PO.sub.4, 4 .mu.M nicotinic acid, 4 .mu.M pyridoxine
HCl, 4 .mu.M thiamine HCl, 30 .mu.M H.sub.3BO.sub.3, 30 .mu.M
MnSO.sub.4H.sub.2O, 9 .mu.M ZnSO.sub.47H.sub.2O, 1.5 .mu.M KI, 0.9
.mu.M Na.sub.2MOO.sub.42H.sub.2O, 0.03 .mu.M CuSO.sub.45H.sub.2O,
0.03 .mu.M COCl.sub.26H.sub.2O, 0.5% w/v glucose, 0.3% w/v Gelrite,
pH 5.5) and maintained at 30.degree. C. under high light.
[0649] Germinated embryos were then transferred to Magenta boxes
containing medium 5 (1.2 mM CaCl.sub.22H.sub.2O, 40.0 mM KNO.sub.3,
2.0 mM MgSO.sub.47H.sub.2O, 15 mM NH.sub.4Cl, 0.2 mM
KH.sub.2PO.sub.4, 4 .mu.M nicotinic acid, 4 .mu.1M pyridoxine HCl,
4 .mu.M thiamine HCl, 30 .mu.M H.sub.3BO.sub.3, 30 .mu.M
MnSO.sub.4H.sub.2O, 9 .mu.M ZnSO.sub.47H.sub.2O, 1.5 .mu.M KI, 0.9
.mu.M Na.sub.2MOO.sub.42H.sub.2O, 0.03 .mu.M CuSO.sub.45H.sub.2O,
0.03 .mu.M COCl.sub.26H.sub.2O, 2.0% w/v sucrose, 0.2% w/v Gelrite,
pH 5.5) and maintained at 30.degree. C. under high light. Once a
plant has formed a good root system and produced several new leaves
it was transferred to soil in pots and acclimatised in a growth
cabinet at 28.degree. C. and then grown in a glasshouse at
(27-29.degree. C. day, 20-24.degree. C. night).
(b) Detection of NaPdf1 in Transgenic Cotton
[0650] Leaves (first position, 3-4 cm in diameter) were excised
from plants grown either in the growth cabinet or in the
glasshouse. The tissue (100 mg) was frozen in liquid nitrogen and
ground to a fine powder with a mortar and pestle. The powder was
added to 2.times. sample buffer (300 .mu.l, Novex NuPAGE LDS sample
buffer, 10% v/v .beta.-mercaptoethanol), vortexed for 30 sec,
boiled for 5 min and then centrifuged at 14,000 rpm for 10 min and
the supernatant retained. Total soluble leaf extracts were
separated by SDS-PAGE on preformed 4-12% w/v polyacrylamide
gradient gels (Novex, NuPAGE bis-tris, MES buffer) for 35 min at
200V in a Novex X Cell II mini-cell electrophoresis apparatus.
Prestained molecular weight markers (Novex SeeBlue) were included
as a standard. Proteins were transferred to nitrocellulose membrane
(Micron Separations Inc. 0.22 micron pore size) for 60 min at 30V
using the Novex X Cell II mini-cell electrophoresis apparatus in
NuPAGE transfer buffer with 10% v/v methanol. After transfer,
membranes were incubated for 1 min in isopropanol, followed by a 5
min wash in TBS.
[0651] The membrane was blocked for 1 h in 3% w/v BSA at RT
followed by incubation with primary antibody overnight at RT
(1:2500 dilution in TBS). The membrane was washed 5.times.10 min in
TBST before incubation with goat anti-rabbit IgG conjugated to
horseradish peroxidase for 60 min at RT (Pierce, 1:100,000 dilution
in TBS). Five further 10 min TBST washes were performed before the
membrane was incubated with the SuperSignal West Pico
Chemiluminescent substrate (Pierce) according to the Manufacturer's
instructions. Membranes were exposed to ECL Hyperfilm (Amersham
Pharmacia Biotech). Results are shown in FIG. 14C.
Example 12
Insect Feeding Trial with Transgenic Cotton
[0652] One experiment was conducted with two independently
transformed T2 generation transgenic cotton lines. The plants were
produced by selfing the primary transgenic lines CT35.9.4 and
CT35.125.1 (both transformed with the pHEX3 construct) and
consisted of a mixture of homozygous and hemizygous plants. Parent
untransformed Coker 315 plants were used as a negative control.
[0653] Twenty newly hatched H. armigera larvae were selected. The
larvae were reared in individual plastic cups with lids (Solo
(registered trademark) plastic portion cups, 28 ml) containing 1.5%
Bacto agar and were fed leaf segments that were replaced either
every 2-3 days or when more than 75% had been consumed. Young
leaves from non-flowering plants were used in the bioassay. The
larvae were kept in a controlled temperature room at
25.+-.1.degree. C., under light. The number of dead larvae was
recorded on days 4, 6 and 8. The weight of each surviving larvae
was measured at day 8 and the mean weight calculated. Results are
shown in FIG. 17.
Example 13
Production of Insect-Resistant Plants
[0654] (a) Molecular Cloning of Genes from a Range of Species
[0655] Amino acid sequences of any one of the sequences set forth
in FIG. 10 (SEQ ID NO:25 to SEQ ID NO:49) are used to design
suitable oligonucleotide primers for use in screening cDNA or
genomic DNA libraries, as appropriate. Using, for example PCR,
corresponding full nucleotide coding sequences are cloned as, for
example, described in Examples 4(a) and 9(a), above. Expression
cassettes are then inserted into desired vectors such as, for
example, pBIN19 or pCGP1988, use of which is described in Example
9(a).
(b) Transformation and Regeneration of Insect-Resistant Plants
[0656] Using standard techniques known and available to those
skilled in the art, selected plant material of target plant species
is transformed with one or more vectors comprising the expression
cassettes carrying the anti-insect sequences from the corresponding
species. Suitable transformation methods include, but are not
limited to, the Agrobacterium-mediated transformation protocol set
forth in Example 9(b), 9(c) and 9(d), modified as necessary for
particular plant species. Other means of transformation of
particular plant species are well known and include, for example,
biolistic transformation procedures.
[0657] Following regeneration, plants are assayed for resistance to
attack by common plant pests including insects.
[0658] Those skilled in the art will appreciate that the invention
described herein is susceptible to variations and modifications
other than those specifically described. It is to be understood
that the invention includes all such variations and modifications.
The invention also includes all of the steps, features,
compositions and compounds referred to or indicated in this
specification, individually or collectively, and any and all
combinations of any two or more of said steps or features.
Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID
NOS: 62 <210> SEQ ID NO 1 <211> LENGTH: 28 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Description of Artificial
sequence: Synthetic construct: primer <400> SEQUENCE: 1
ggaattccat atggctcgct ccttgtgc 28 <210> SEQ ID NO 2
<211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Description of Artificial sequence: Synthetic
construct: primer <400> SEQUENCE: 2 gcggatcctc agttatccat
tatctcttc 29 <210> SEQ ID NO 3 <211> LENGTH: 24
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial sequence: Synthetic construct: primer <400>
SEQUENCE: 3 ccggatccag agaatgcaaa acag 24 <210> SEQ ID NO 4
<211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM:
Artificial sequence <220> FEATURE: <223> OTHER
INFORMATION: Description of Artificial sequence: Synthetic
construct: primer <400> SEQUENCE: 4 gggagctctt agttatccat
tatctc 26 <210> SEQ ID NO 5 <211> LENGTH: 31
<212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial sequence: Synthetic construct: <primer <400>
SEQUENCE: 5 ggaattctaa acaatggctc gctccttgtg c 31 <210> SEQ
ID NO 6 <211> LENGTH: 29 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial sequence: Synthetic
construct: primer <400> SEQUENCE: 6 gctctagatc agttatccat
tatctcttc 29 <210> SEQ ID NO 7 <211> LENGTH: 141
<212> TYPE: DNA <213> ORGANISM: Nicotiana alata
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(141) <400> SEQUENCE: 7 aga gaa tgc aaa aca
gaa agc aac aca ttt cct gga ata tgc att acc 48 Arg Glu Cys Lys Thr
Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15 aaa cca cca
tgc aga aaa gct tgt atc agt gag aaa ttt act gat ggt 96 Lys Pro Pro
Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 cat
tgt agc aaa atc ctc aga agg tgc cta tgt act aag cca tgt 141 His Cys
Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 8 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 8
Arg Glu Cys Lys Thr Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5
10 15 Lys Pro Pro Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp
Gly 20 25 30 His Cys Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys
Pro Cys 35 40 45 <210> SEQ ID NO 9 <211> LENGTH: 75
<212> TYPE: DNA <213> ORGANISM: Nicotiana alata
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(75) <400> SEQUENCE: 9 atg gct cgc tcc ttg tgc
ttc atg gca ttt gct atc ttg gca agg atg 48 Met Ala Arg Ser Leu Cys
Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10 15 ctc ttt gtt gcc
tat gag gtg caa gct 75 Leu Phe Val Ala Tyr Glu Val Gln Ala 20 25
<210> SEQ ID NO 10 <211> LENGTH: 25 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 10
Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5
10 15 Leu Phe Val Ala Tyr Glu Val Gln Ala 20 25 <210> SEQ ID
NO 11 <211> LENGTH: 99 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(99) <400> SEQUENCE:
11 gtg ttt gat gag aag atg act aaa aca gga gct gaa att ttg gct gag
48 Val Phe Asp Glu Lys Met Thr Lys Thr Gly Ala Glu Ile Leu Ala Glu
1 5 10 15 gaa gca aaa act ttg gct gca gct ttg ctt gaa gaa gag ata
atg gat 96 Glu Ala Lys Thr Leu Ala Ala Ala Leu Leu Glu Glu Glu Ile
Met Asp 20 25 30 aac 99 Asn <210> SEQ ID NO 12 <211>
LENGTH: 33 <212> TYPE: PRT <213> ORGANISM: Nicotiana
alata <400> SEQUENCE: 12 Val Phe Asp Glu Lys Met Thr Lys Thr
Gly Ala Glu Ile Leu Ala Glu 1 5 10 15 Glu Ala Lys Thr Leu Ala Ala
Ala Leu Leu Glu Glu Glu Ile Met Asp 20 25 30 Asn <210> SEQ ID
NO 13 <211> LENGTH: 216 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(216) <400>
SEQUENCE: 13 atg gct cgc tcc ttg tgc ttc atg gca ttt gct atc ttg
gca agg atg 48 Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu
Ala Arg Met 1 5 10 15 ctc ttt gtt gcc tat gag gtg caa gct aga gaa
tgc aaa aca gaa agc 96 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu
Cys Lys Thr Glu Ser 20 25 30 aac aca ttt cct gga ata tgc att acc
aaa cca cca tgc aga aaa gct 144 Asn Thr Phe Pro Gly Ile Cys Ile Thr
Lys Pro Pro Cys Arg Lys Ala 35 40 45 tgt atc agt gag aaa ttt act
gat ggt cat tgt agc aaa atc ctc aga 192 Cys Ile Ser Glu Lys Phe Thr
Asp Gly His Cys Ser Lys Ile Leu Arg 50 55 60 agg tgc cta tgt act
aag cca tgt 216 Arg Cys Leu Cys Thr Lys Pro Cys 65 70 <210>
SEQ ID NO 14 <211> LENGTH: 72 <212> TYPE: PRT
<213> ORGANISM: Nicotiana alata <400> SEQUENCE: 14 Met
Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10
15 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu Ser
20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys Arg
Lys Ala 35 40 45 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys Ser
Lys Ile Leu Arg 50 55 60 Arg Cys Leu Cys Thr Lys Pro Cys 65 70
<210> SEQ ID NO 15 <211> LENGTH: 240 <212> TYPE:
DNA <213> ORGANISM: Nicotiana alata <220> FEATURE:
<221> NAME/KEY: CDS <222> LOCATION: (1)..(240)
<400> SEQUENCE: 15 aga gaa tgc aaa aca gaa agc aac aca ttt
cct gga ata tgc att acc 48 Arg Glu Cys Lys Thr Glu Ser Asn Thr Phe
Pro Gly Ile Cys Ile Thr 1 5 10 15 aaa cca cca tgc aga aaa gct tgt
atc agt gag aaa ttt act gat ggt 96 Lys Pro Pro Cys Arg Lys Ala Cys
Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 cat tgt agc aaa atc ctc
aga agg tgc cta tgt act aag cca tgt gtg 144 His Cys Ser Lys Ile Leu
Arg Arg Cys Leu Cys Thr Lys Pro Cys Val 35 40 45 ttt gat gag aag
atg act aaa aca gga gct gaa att ttg gct gag gaa 192 Phe Asp Glu Lys
Met Thr Lys Thr Gly Ala Glu Ile Leu Ala Glu Glu 50 55 60 gca aaa
act ttg gct gca gct ttg ctt gaa gaa gag ata atg gat aac 240 Ala Lys
Thr Leu Ala Ala Ala Leu Leu Glu Glu Glu Ile Met Asp Asn 65 70 75 80
<210> SEQ ID NO 16 <211> LENGTH: 80 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 16
Arg Glu Cys Lys Thr Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5
10 15 Lys Pro Pro Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp
Gly 20 25 30 His Cys Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys
Pro Cys Val 35 40 45 Phe Asp Glu Lys Met Thr Lys Thr Gly Ala Glu
Ile Leu Ala Glu Glu 50 55 60 Ala Lys Thr Leu Ala Ala Ala Leu Leu
Glu Glu Glu Ile Met Asp Asn 65 70 75 80 <210> SEQ ID NO 17
<211> LENGTH: 541 <212> TYPE: DNA <213> ORGANISM:
Nicotiana alata <220> FEATURE: <221> NAME/KEY: CDS
<222> LOCATION: (1)..(318) <400> SEQUENCE: 17 atg gct
cgc tcc ttg tgc ttc atg gca ttt gct atc ttg gca agg atg 48 Met Ala
Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10 15
ctc ttt gtt gcc tat gag gtg caa gct aga gaa tgc aaa aca gaa agc 96
Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu Ser 20
25 30 aac aca ttt cct gga ata tgc att acc aaa cca cca tgc aga aaa
gct 144 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys Arg Lys
Ala 35 40 45 tgt atc agt gag aaa ttt act gat ggt cat tgt agc aaa
atc ctc aga 192 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys Ser Lys
Ile Leu Arg 50 55 60 agg tgc cta tgt act aag cca tgt gtg ttt gat
gag aag atg act aaa 240 Arg Cys Leu Cys Thr Lys Pro Cys Val Phe Asp
Glu Lys Met Thr Lys 65 70 75 80 aca gga gct gaa att ttg gct gag gaa
gca aaa act ttg gct gca gct 288 Thr Gly Ala Glu Ile Leu Ala Glu Glu
Ala Lys Thr Leu Ala Ala Ala 85 90 95 ttg ctt gaa gaa gag ata atg
gat aac taa ttagagatta gaagaaatta 338 Leu Leu Glu Glu Glu Ile Met
Asp Asn 100 105 aggatgcagt atcacacata ataaagtttc tacctttctt
aaaagtgtag ctaatgttgt 398 gttttaattg gcttttagta gccttttatt
acactttaaa taagtgtggc acttcaatcc 458 tttgtgcaat cttgcactaa
gtttatttgt gtacttttaa tgaaaatgac cttctatggt 518 ctttggttaa
aaaaaaaaaa aaa 541 <210> SEQ ID NO 18 <211> LENGTH: 105
<212> TYPE: PRT <213> ORGANISM: Nicotiana alata
<400> SEQUENCE: 18 Met Ala Arg Ser Leu Cys Phe Met Ala Phe
Ala Ile Leu Ala Arg Met 1 5 10 15 Leu Phe Val Ala Tyr Glu Val Gln
Ala Arg Glu Cys Lys Thr Glu Ser 20 25 30 Asn Thr Phe Pro Gly Ile
Cys Ile Thr Lys Pro Pro Cys Arg Lys Ala 35 40 45 Cys Ile Ser Glu
Lys Phe Thr Asp Gly His Cys Ser Lys Ile Leu Arg 50 55 60 Arg Cys
Leu Cys Thr Lys Pro Cys Val Phe Asp Glu Lys Met Thr Lys 65 70 75 80
Thr Gly Ala Glu Ile Leu Ala Glu Glu Ala Lys Thr Leu Ala Ala Ala 85
90 95 Leu Leu Glu Glu Glu Ile Met Asp Asn 100 105 <210> SEQ
ID NO 19 <211> LENGTH: 223 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <400> SEQUENCE: 19 ttagagatta
gaagaaatta aggatgcagt atcacacata ataaagtttc tacctttctt 60
aaaagtgtag ctaatgttgt gttttaattg gcttttagta gccttttatt acactttaaa
120 taagtgtggc acttcaatcc tttgtgcaat cttgcactaa gtttatttgt
gtacttttaa 180 tgaaaatgac cttctatggt ctttggttaa aaaaaaaaaa aaa 223
<210> SEQ ID NO 20 <211> LENGTH: 105 <212> TYPE:
PRT <213> ORGANISM: Nicotiana tabacum <400> SEQUENCE:
20 Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Met Met
1 5 10 15 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr
Glu Ser 20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro
Cys Arg Lys Ala 35 40 45 Cys Ile Ser Glu Lys Phe Thr Asp Gly His
Cys Ser Lys Leu Leu Arg 50 55 60 Arg Cys Leu Cys Thr Lys Pro Cys
Val Phe Asp Glu Lys Met Ile Lys 65 70 75 80 Thr Gly Ala Glu Thr Leu
Val Glu Glu Ala Lys Thr Leu Ala Ala Ala 85 90 95 Leu Leu Glu Glu
Glu Ile Met Asp Asn 100 105 <210> SEQ ID NO 21 <211>
LENGTH: 105 <212> TYPE: PRT <213> ORGANISM: Arabidopsis
thaliana <400> SEQUENCE: 21 Met Ala Arg Ser Ile Phe Phe Met
Ala Phe Leu Val Leu Ala Met Met 1 5 10 15 Leu Phe Val Thr Tyr Glu
Val Glu Ala Gln Gln Ile Cys Lys Ala Pro 20 25 30 Ser Gln Thr Phe
Pro Gly Leu Cys Phe Met Asp Ser Ser Cys Arg Lys 35 40 45 Tyr Cys
Ile Lys Glu Lys Phe Thr Gly Gly His Cys Ser Lys Leu Gln 50 55 60
Arg Lys Cys Leu Cys Thr Lys Pro Cys Val Phe Asp Lys Ile Ser Ser 65
70 75 80 Glu Val Lys Ala Thr Leu Gly Glu Glu Ala Lys Thr Leu Ser
Glu Val 85 90 95 Val Leu Glu Glu Glu Ile Met Met Glu 100 105
<210> SEQ ID NO 22 <211> LENGTH: 78 <212> TYPE:
PRT <213> ORGANISM: Nicotiana tabacum <400> SEQUENCE:
22 Met Ala Asn Ser Met Arg Phe Phe Ala Thr Val Leu Leu Ile Ala Leu
1 5 10 15 Leu Val Thr Ala Thr Glu Met Gly Pro Met Thr Ile Ala Glu
Ala Arg 20 25 30 Thr Cys Glu Ser Gln Ser His Arg Phe Lys Gly Pro
Cys Ser Arg Asp 35 40 45 Ser Asn Cys Ala Thr Val Cys Leu Thr Glu
Gly Phe Ser Gly Gly Arg 50 55 60 Cys Pro Trp Ile Pro Pro Arg Cys
Phe Cys Thr Ser Pro Cys 65 70 75 <210> SEQ ID NO 23
<211> LENGTH: 78 <212> TYPE: PRT <213> ORGANISM:
Petunia inflata <400> SEQUENCE: 23 Met Gly Arg Ser Ile Arg
Leu Phe Ala Thr Phe Phe Leu Ile Ala Met 1 5 10 15 Leu Phe Leu Ser
Thr Glu Met Gly Pro Met Thr Ser Ala Glu Ala Arg 20 25 30 Thr Cys
Glu Ser Gln Ser His Arg Phe His Gly Thr Cys Val Arg Glu 35 40 45
Ser Asn Cys Ala Ser Val Cys Gln Thr Glu Gly Phe Ile Gly Gly Asn 50
55 60 Cys Arg Ala Phe Arg Arg Arg Cys Phe Cys Thr Arg Asn Cys 65 70
75 <210> SEQ ID NO 24 <211> LENGTH: 77 <212>
TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400>
SEQUENCE: 24 Met Lys Leu Ser Met Arg Leu Ile Ser Ala Val Leu Ile
Met Phe Met 1 5 10 15 Ile Phe Val Ala Thr Gly Met Gly Pro Val Thr
Val Glu Ala Arg Thr 20 25 30 Cys Glu Ser Gln Ser His Arg Phe Lys
Gly Thr Cys Val Ser Ala Ser 35 40 45 Asn Cys Ala Asn Val Cys His
Asn Glu Gly Phe Val Gly Gly Asn Cys 50 55 60 Arg Gly Phe Arg Arg
Arg Cys Phe Cys Thr Arg His Cys 65 70 75 <210> SEQ ID NO 25
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Nicotiana tabacum <400> SEQUENCE: 25 Arg Glu Cys Lys Thr Glu
Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15 Lys Pro Pro Cys
Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 His Cys
Ser Lys Leu Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 26 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Lycopersicon esculentum <400>
SEQUENCE: 26 Gln Ile Cys Lys Ala Pro Ser Gln Thr Phe Pro Gly Leu
Cys Phe Met 1 5 10 15 Asp Ser Ser Cys Arg Lys Tyr Cys Ile Lys Glu
Lys Phe Thr Gly Gly 20 25 30 His Cys Ser Lys Leu Gln Arg Lys Cys
Leu Cys Thr Lys Pro Cys 35 40 45 <210> SEQ ID NO 27
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Solanum tuberosum <400> SEQUENCE: 27 Arg His Cys Glu Ser Leu
Ser His Arg Phe Lys Gly Pro Cys Thr Arg 1 5 10 15 Asp Ser Asn Cys
Ala Ser Val Cys Glu Thr Glu Arg Phe Ser Gly Gly 20 25 30 Asn Cys
His Gly Phe Arg Arg Arg Cys Phe Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 28 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Petunia inflata <400> SEQUENCE: 28
Arg Val Cys Glu Ser Gln Ser His Gly Phe His Gly Leu Cys Asn Arg 1 5
10 15 Asp His Asn Cys Ala Leu Val Cys Arg Asn Glu Gly Phe Ser Gly
Gly 20 25 30 Arg Cys Lys Gly Phe Arg Arg Arg Cys Phe Cys Thr Arg
Ile Cys 35 40 45 <210> SEQ ID NO 29 <211> LENGTH: 47
<212> TYPE: PRT <213> ORGANISM: Glycine max <400>
SEQUENCE: 29 Arg Thr Cys Glu Ser Gln Ser His Arg Phe His Gly Thr
Cys Val Arg 1 5 10 15 Glu Ser Asn Cys Ala Ser Val Cys Gln Thr Glu
Gly Phe Ile Gly Gly 20 25 30 Asn Cys Arg Ala Phe Arg Arg Arg Cys
Phe Cys Thr Arg Asn Cys 35 40 45 <210> SEQ ID NO 30
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Hordeum vulgare <400> SEQUENCE: 30 Arg Ile Cys Arg Arg Arg
Ser Ala Gly Phe Lys Gly Pro Cys Val Ser 1 5 10 15 Asn Lys Asn Cys
Ala Gln Val Cys Met Gln Glu Trp Gly Glu Gly Gly 20 25 30 Asn Cys
Asp Gly Pro Leu Arg Arg Cys Lys Cys Met Arg Arg Cys 35 40 45
<210> SEQ ID NO 31 <211> LENGTH: 51 <212> TYPE:
PRT <213> ORGANISM: Sinapis alba <400> SEQUENCE: 31 Gln
Lys Leu Cys Gln Arg Pro Ser Gly Thr Trp Ser Gly Val Cys Gly 1 5 10
15 Asn Asn Asn Ala Cys Arg Asn Gln Cys Ile Asn Leu Glu Lys Ala Arg
20 25 30 His Gly Ser Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile
Cys Tyr 35 40 45 Phe Pro Cys 50 <210> SEQ ID NO 32
<211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM:
Solanum tuberosum <400> SEQUENCE: 32 Arg Asn Cys Glu Ser Leu
Ser His Arg Phe Lys Gly Pro Cys Thr Arg 1 5 10 15 Asp Ser Asn Cys
20 <210> SEQ ID NO 33 <211> LENGTH: 51 <212>
TYPE: PRT <213> ORGANISM: Raphanus sativus <400>
SEQUENCE: 33 Gln Lys Leu Cys Glu Arg Pro Ser Gly Thr Trp Ser Gly
Val Cys Gly 1 5 10 15 Asn Asn Asn Ala Cys Lys Asn Gln Cys Ile Asn
Leu Glu Lys Ala Arg 20 25 30 His Gly Ser Cys Asn Tyr Val Phe Pro
Ala His Lys Cys Ile Cys Tyr 35 40 45 Phe Pro Cys 50 <210> SEQ
ID NO 34 <211> LENGTH: 51 <212> TYPE: PRT <213>
ORGANISM: Raphanus sativus <400> SEQUENCE: 34 Gln Lys Leu Cys
Gln Arg Pro Ser Gly Thr Trp Ser Gly Val Cys Gly 1 5 10 15 Asn Asn
Asn Ala Cys Lys Asn Gln Cys Ile Arg Leu Glu Lys Ala Arg 20 25 30
His Gly Ser Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile Cys Tyr 35
40 45 Phe Pro Cys 50 <210> SEQ ID NO 35 <211> LENGTH:
51 <212> TYPE: PRT <213> ORGANISM: Sinapis alba
<400> SEQUENCE: 35 Gln Lys Leu Cys Glu Arg Pro Ser Gly Thr
Trp Ser Gly Val Cys Gly 1 5 10 15 Asn Asn Asn Ala Cys Lys Asn Gln
Cys Ile Asn Leu Glu Lys Ala Arg 20 25 30 His Gly Ser Cys Asn Tyr
Val Phe Pro Ala His Lys Cys Ile Cys Tyr 35 40 45 Phe Pro Cys 50
<210> SEQ ID NO 36 <211> LENGTH: 52 <212> TYPE:
PRT <213> ORGANISM: Sinapis alba <400> SEQUENCE: 36 Gln
Lys Leu Cys Ala Arg Pro Ser Gly Thr Trp Ser Ser Gly Asn Cys 1 5 10
15 Arg Asn Asn Asn Ala Cys Arg Asn Phe Cys Ile Lys Leu Glu Lys Ser
20 25 30 Arg His Gly Ser Cys Asn Ile Pro Phe Pro Ser Asn Lys Cys
Ile Cys 35 40 45 Tyr Phe Pro Cys 50 <210> SEQ ID NO 37
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Triticum turgidium <400> SEQUENCE: 37 Lys Ile Cys Arg Arg Arg
Ser Ala Gly Phe Lys Gly Pro Cys Met Ser 1 5 10 15 Asn Lys Asn Cys
Ala Gln Val Cys Gln Gln Glu Gly Trp Gly Gly Gly 20 25 30 Asn Cys
Asp Gly Pro Phe Arg Arg Cys Lys Cys Ile Arg Gln Cys 35 40 45
<210> SEQ ID NO 38 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Triticum turgidium <400> SEQUENCE:
38 Lys Val Cys Arg Gln Arg Ser Ala Gly Phe Lys Gly Pro Cys Val Ser
1 5 10 15 Asp Lys Asn Cys Ala Gln Val Cys Leu Gln Glu Gly Trp Gly
Gly Gly 20 25 30 Asn Cys Asp Gly Pro Phe Arg Arg Cys Lys Cys Ile
Arg Gln Cys 35 40 45 <210> SEQ ID NO 39 <211> LENGTH:
47 <212> TYPE: PRT <213> ORGANISM: Vigna unguiculata
<400> SEQUENCE: 39 Lys Thr Cys Glu Asn Leu Val Asp Thr Tyr
Arg Gly Pro Cys Phe Thr 1 5 10 15 Thr Gly Ser Cys Asp Asp His Cys
Lys Asn Lys Glu His Leu Leu Ser 20 25 30 Gly Arg Cys Arg Asp Asp
Val Arg Cys Trp Cys Thr Arg Asn Cys 35 40 45 <210> SEQ ID NO
40 <211> LENGTH: 48 <212> TYPE: PRT <213>
ORGANISM: Sorghum bicolor <400> SEQUENCE: 40 Arg Val Cys Met
Gly Lys Ser Ala Gly Phe Lys Gly Leu Cys Met Arg 1 5 10 15 Asp Gln
Asn Cys Ala Gln Val Cys Leu Gln Glu Gly Trp Gly Gly Gly 20 25 30
Asn Cys Asp Gly Val Met Arg Gln Cys Lys Cys Ile Arg Gln Cys Trp 35
40 45 <210> SEQ ID NO 41 <211> LENGTH: 48 <212>
TYPE: PRT <213> ORGANISM: Sorghum bicolor <400>
SEQUENCE: 41 Arg Val Cys Arg Arg Arg Ser Ala Gly Phe Lys Gly Leu
Cys Met Ser 1 5 10 15 Asp His Asn Cys Ala Gln Val Cys Leu Gln Glu
Gly Trp Gly Gly Gly 20 25 30 Asn Cys Asp Gly Val Ile Arg Gln Cys
Lys Cys Ile Arg Gln Cys Trp 35 40 45 <210> SEQ ID NO 42
<211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM:
Dahlia merckii <400> SEQUENCE: 42 Glu Val Cys Glu Lys Ala Ser
Lys Thr Trp Ser Gly Asn Cys Gly Asn 1 5 10 15 Thr Gly His Cys 20
<210> SEQ ID NO 43 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Sorghum bicolor <400> SEQUENCE: 43
Arg Val Cys Met Lys Gly Ser Gln His His Ser Phe Pro Cys Ile Ser 1 5
10 15 Asp Arg Leu Cys Ser Asn Glu Cys Val Lys Glu Glu Gly Gly Trp
Thr 20 25 30 Ala Gly Tyr Cys His Leu Arg Tyr Cys Arg Cys Gln Lys
Ala Cys 35 40 45 <210> SEQ ID NO 44 <211> LENGTH: 45
<212> TYPE: PRT <213> ORGANISM: Pisum sativum
<400> SEQUENCE: 44 Asn Thr Cys Glu Asn Leu Ala Gly Ser Tyr
Lys Gly Val Cys Phe Gly 1 5 10 15 Gly Cys Asp Arg His Cys Arg Thr
Gln Glu Gly Ala Ile Ser Gly Arg 20 25 30 Cys Arg Asp Asp Phe Arg
Cys Trp Cys Thr Lys Asn Cys 35 40 45 <210> SEQ ID NO 45
<211> LENGTH: 50 <212> TYPE: PRT <213> ORGANISM:
Aesculus hippocastanum <400> SEQUENCE: 45 Leu Cys Asn Glu Arg
Pro Ser Gln Thr Trp Ser Gly Asn Cys Gly Asn 1 5 10 15 Thr Ala His
Cys Asp Lys Gln Cys Gln Asp Trp Glu Lys Ala Ser His 20 25 30 Gly
Ala Cys His Lys Arg Glu Asn His Trp Lys Cys Phe Cys Tyr Phe 35 40
45 Asn Cys 50 <210> SEQ ID NO 46 <211> LENGTH: 51
<212> TYPE: PRT <213> ORGANISM: Heuchera sanguinea
<400> SEQUENCE: 46 Lys Leu Cys Asp Val Pro Ser Gly Thr Trp
Ser Gly His Cys Gly Ser 1 5 10 15 Ser Ser Lys Cys Ser Gln Gln Cys
Lys Asp Arg Glu His Phe Ala Tyr 20 25 30 Gly Gly Ala Cys His Tyr
Gln Phe Pro Ser Val Lys Cys Phe Cys Lys 35 40 45 Arg Gln Cys 50
<210> SEQ ID NO 47 <211> LENGTH: 50 <212> TYPE:
PRT <213> ORGANISM: Dahlia merckii <400> SEQUENCE: 47
Glu Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn 1 5
10 15 Thr Gly His Cys Asp Asn Gln Cys Lys Ser Trp Glu Gly Ala Ala
His 20 25 30 Gly Ala Cys His Val Arg Asn Gly Lys His Met Cys Phe
Cys Tyr Phe 35 40 45 Asn Cys 50 <210> SEQ ID NO 48
<211> LENGTH: 46 <212> TYPE: PRT <213> ORGANISM:
Pisum sativum <400> SEQUENCE: 48 Asn Thr Cys Glu His Leu Ala
Asp Thr Tyr Arg Gly Val Cys Phe Thr 1 5 10 15 Asn Ala Ser Cys Asp
Asp His Cys Lys Asn Lys Ala His Leu Ile Ser 20 25 30 Gly Thr Cys
His Asp Trp Lys Cys Phe Cys Thr Gln Asn Cys 35 40 45 <210>
SEQ ID NO 49 <211> LENGTH: 49 <212> TYPE: PRT
<213> ORGANISM: Clitoria terneata <400> SEQUENCE: 49
Asn Leu Cys Glu Arg Ala Ser Leu Thr Trp Thr Gly Asn Cys Gly Asn 1 5
10 15 Thr Gly His Cys Asp Thr Gln Cys Arg Asn Trp Glu Ser Ala Lys
His 20 25 30 Gly Ala Cys His Lys Arg Gly Asn Trp Lys Cys Phe Cys
Tyr Phe Asn 35 40 45 Cys <210> SEQ ID NO 50 <211>
LENGTH: 79 <212> TYPE: PRT <213> ORGANISM: Nicotiana
excelsior <400> SEQUENCE: 50 Leu Phe Val Ala Tyr Glu Val Gln
Ala Arg Glu Cys Ala Arg Glu Ile 1 5 10 15 Phe Thr Gly Leu Cys Ile
Thr Asn Pro Gln Cys Arg Lys Ala Cys Ile 20 25 30 Lys Glu Lys Phe
Thr Asp Gly His Cys Ser Lys Ile Leu Arg Arg Cys 35 40 45 Leu Cys
Thr Lys Pro Cys Thr Gly Ala Glu Thr Leu Ala Glu Glu Ala 50 55 60
Thr Thr Leu Ala Ala Ala Leu Leu Glu Glu Glu Ile Met Asp Asn 65 70
75 <210> SEQ ID NO 51 <211> LENGTH: 105 <212>
TYPE: PRT <213> ORGANISM: Nicotiana excelsior <400>
SEQUENCE: 51 Met Ala Arg Ser Val Cys Phe Met Ala Phe Ala Ile Leu
Ala Val Met 1 5 10 15 Leu Phe Val Ala Tyr Asp Val Glu Ala Lys Asp
Cys Lys Thr Glu Ser 20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr
Lys Pro Pro Cys Arg Lys Ala 35 40 45 Cys Ile Lys Glu Lys Phe Thr
Asp Gly His Cys Ser Lys Ile Leu Arg 50 55 60 Arg Cys Leu Cys Thr
Lys Pro Cys Val Phe Asp Glu Lys Met Ile Lys 65 70 75 80 Thr Gly Ala
Glu Thr Leu Ala Glu Glu Ala Thr Thr Leu Ala Ala Ala 85 90 95 Leu
Leu Glu Glu Glu Ile Met Asp Asn 100 105 <210> SEQ ID NO 52
<211> LENGTH: 106 <212> TYPE: PRT <213> ORGANISM:
Nicotiana paniculata <400> SEQUENCE: 52 Met Ala Arg Ser Leu
Cys Phe Met Ala Phe Ala Val Leu Ala Met Met 1 5 10 15 Leu Phe Val
Ala Tyr Glu Val Gln Ala Lys Ser Thr Cys Lys Ala Glu 20 25 30 Ser
Asn Thr Phe Pro Gly Leu Cys Ile Thr Lys Pro Pro Cys Arg Lys 35 40
45 Ala Cys Leu Ser Glu Lys Phe Thr Asp Gly Lys Cys Ser Lys Ile Leu
50 55 60 Arg Arg Cys Ile Cys Tyr Lys Pro Cys Val Phe Asp Gly Lys
Met Ile 65 70 75 80 Gln Thr Gly Ala Glu Asn Leu Ala Glu Glu Ala Glu
Thr Leu Ala Ala 85 90 95 Ala Leu Leu Glu Glu Glu Met Met Asp Asn
100 105 <210> SEQ ID NO 53 <211> LENGTH: 47 <212>
TYPE: PRT <213> ORGANISM: Nicotiana tabacum <400>
SEQUENCE: 53 Arg Thr Cys Glu Ser Gln Ser His Arg Phe Lys Gly Pro
Cys Ser Arg 1 5 10 15 Asp Ser Asn Cys Ala Thr Val Cys Leu Thr Glu
Gly Phe Ser Gly Gly 20 25 30 Arg Cys Pro Trp Ile Pro Pro Arg Cys
Phe Cys Thr Ser Pro Cys 35 40 45 <210> SEQ ID NO 54
<211> LENGTH: 19 <212> TYPE: PRT <213> ORGANISM:
Petunia inflata <400> SEQUENCE: 54 Arg Thr Cys Glu Ser Gln
Ser His Arg Phe His Gly Thr Cys Val Arg 1 5 10 15 Glu Ser Asn
<210> SEQ ID NO 55 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Arabidopsis thaliana <400>
SEQUENCE: 55 Arg Thr Cys Glu Ser Gln Ser His Arg Phe Lys Gly Thr
Cys Val Ser 1 5 10 15 Ala Ser Asn Cys Ala Asn Val Cys His Asn Glu
Gly Phe Val Gly Gly 20 25 30 Asn Cys Arg Gly Phe Arg Arg Arg Cys
Phe Cys Thr Arg His Cys 35 40 45 <210> SEQ ID NO 56
<211> LENGTH: 1104 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(1104) <400>
SEQUENCE: 56 aag gct tgt acc tta aac tgt gat cca aga att gcc tat
gga gtt tgc 48 Lys Ala Cys Thr Leu Asn Cys Asp Pro Arg Ile Ala Tyr
Gly Val Cys 1 5 10 15 ccg cgt tca gaa gaa aag aag aat gat cgg ata
tgc acc aac tgt tgc 96 Pro Arg Ser Glu Glu Lys Lys Asn Asp Arg Ile
Cys Thr Asn Cys Cys 20 25 30 gca ggc acg aag ggt tgt aag tac ttc
agt gat gat gga act ttt gtt 144 Ala Gly Thr Lys Gly Cys Lys Tyr Phe
Ser Asp Asp Gly Thr Phe Val 35 40 45 tgt gaa gga gag tct gat cct
aga aat cca aag gct tgt acc tta aac 192 Cys Glu Gly Glu Ser Asp Pro
Arg Asn Pro Lys Ala Cys Thr Leu Asn 50 55 60 tgt gat cca aga att
gcc tat gga gtt tgc ccg cgt tca gaa gaa aag 240 Cys Asp Pro Arg Ile
Ala Tyr Gly Val Cys Pro Arg Ser Glu Glu Lys 65 70 75 80 aag aat gat
cgg ata tgc acc aac tgt tgc gca ggc acg aag ggt tgt 288 Lys Asn Asp
Arg Ile Cys Thr Asn Cys Cys Ala Gly Thr Lys Gly Cys 85 90 95 aag
tac ttc agt gat gat gga act ttt gtt tgt gaa gga gag tct gat 336 Lys
Tyr Phe Ser Asp Asp Gly Thr Phe Val Cys Glu Gly Glu Ser Asp 100 105
110 cct aga aat cca aag gct tgt cct cgg aat tgc gat cca aga att gcc
384 Pro Arg Asn Pro Lys Ala Cys Pro Arg Asn Cys Asp Pro Arg Ile Ala
115 120 125 tat ggg att tgc cca ctt gca gaa gaa aag aag aat gat cgg
ata tgc 432 Tyr Gly Ile Cys Pro Leu Ala Glu Glu Lys Lys Asn Asp Arg
Ile Cys 130 135 140 acc aac tgt tgc gca ggc aaa aag ggt tgt aag tac
ttt agt gat gat 480 Thr Asn Cys Cys Ala Gly Lys Lys Gly Cys Lys Tyr
Phe Ser Asp Asp 145 150 155 160 gga act ttt gtt tgt gaa gga gag tct
gat cct aaa aat cca aag gcc 528 Gly Thr Phe Val Cys Glu Gly Glu Ser
Asp Pro Lys Asn Pro Lys Ala 165 170 175 tgt cct cgg aat tgt gat gga
aga att gcc tat ggg att tgc cca ctt 576 Cys Pro Arg Asn Cys Asp Gly
Arg Ile Ala Tyr Gly Ile Cys Pro Leu 180 185 190 tca gaa gaa aag aag
aat gat cgg ata tgc acc aac tgc tgc gca ggc 624 Ser Glu Glu Lys Lys
Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly 195 200 205 aaa aag ggt
tgt aag tac ttt agt gat gat gga act ttt gtt tgt gaa 672 Lys Lys Gly
Cys Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val Cys Glu 210 215 220 gga
gag tct gat cct aaa aat cca aag gct tgt cct cgg aat tgt gat 720 Gly
Glu Ser Asp Pro Lys Asn Pro Lys Ala Cys Pro Arg Asn Cys Asp 225 230
235 240 gga aga att gcc tat ggg att tgc cca ctt tca gaa gaa aag aag
aat 768 Gly Arg Ile Ala Tyr Gly Ile Cys Pro Leu Ser Glu Glu Lys Lys
Asn 245 250 255 gat cgg ata tgc aca aac tgt tgc gca ggc aaa aag ggc
tgt aag tac 816 Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly Lys Lys Gly
Cys Lys Tyr 260 265 270 ttt agt gat gat gga act ttt gtt tgt gaa gga
gag tct gat cct aga 864 Phe Ser Asp Asp Gly Thr Phe Val Cys Glu Gly
Glu Ser Asp Pro Arg 275 280 285 aat cca aag gcc tgt cct cgg aat tgt
gat gga aga att gcc tat gga 912 Asn Pro Lys Ala Cys Pro Arg Asn Cys
Asp Gly Arg Ile Ala Tyr Gly 290 295 300 att tgc cca ctt tca gaa gaa
aag aag aat gat cgg ata tgc acc aat 960 Ile Cys Pro Leu Ser Glu Glu
Lys Lys Asn Asp Arg Ile Cys Thr Asn 305 310 315 320 tgt tgc gca ggc
aag aag ggc tgt aag tac ttt agt gat gat gga act 1008 Cys Cys Ala
Gly Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr 325 330 335 ttt
att tgt gaa gga gaa tct gaa tat gcc agc aaa gtg gat gaa tat 1056
Phe Ile Cys Glu Gly Glu Ser Glu Tyr Ala Ser Lys Val Asp Glu Tyr 340
345 350 gtt ggt gaa gtg gag aat gat ctc cag aag tct aag gtt gct gtt
tcc 1104 Val Gly Glu Val Glu Asn Asp Leu Gln Lys Ser Lys Val Ala
Val Ser 355 360 365 <210> SEQ ID NO 57 <211> LENGTH:
368 <212> TYPE: PRT <213> ORGANISM: Nicotiana alata
<400> SEQUENCE: 57 Lys Ala Cys Thr Leu Asn Cys Asp Pro Arg
Ile Ala Tyr Gly Val Cys 1 5 10 15 Pro Arg Ser Glu Glu Lys Lys Asn
Asp Arg Ile Cys Thr Asn Cys Cys 20 25 30 Ala Gly Thr Lys Gly Cys
Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val 35 40 45 Cys Glu Gly Glu
Ser Asp Pro Arg Asn Pro Lys Ala Cys Thr Leu Asn 50 55 60 Cys Asp
Pro Arg Ile Ala Tyr Gly Val Cys Pro Arg Ser Glu Glu Lys 65 70 75 80
Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly Thr Lys Gly Cys 85
90 95 Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val Cys Glu Gly Glu Ser
Asp 100 105 110 Pro Arg Asn Pro Lys Ala Cys Pro Arg Asn Cys Asp Pro
Arg Ile Ala 115 120 125 Tyr Gly Ile Cys Pro Leu Ala Glu Glu Lys Lys
Asn Asp Arg Ile Cys 130 135 140 Thr Asn Cys Cys Ala Gly Lys Lys Gly
Cys Lys Tyr Phe Ser Asp Asp 145 150 155 160 Gly Thr Phe Val Cys Glu
Gly Glu Ser Asp Pro Lys Asn Pro Lys Ala 165 170 175 Cys Pro Arg Asn
Cys Asp Gly Arg Ile Ala Tyr Gly Ile Cys Pro Leu 180 185 190 Ser Glu
Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly 195 200 205
Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val Cys Glu 210
215 220 Gly Glu Ser Asp Pro Lys Asn Pro Lys Ala Cys Pro Arg Asn Cys
Asp 225 230 235 240 Gly Arg Ile Ala Tyr Gly Ile Cys Pro Leu Ser Glu
Glu Lys Lys Asn 245 250 255 Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly
Lys Lys Gly Cys Lys Tyr 260 265 270 Phe Ser Asp Asp Gly Thr Phe Val
Cys Glu Gly Glu Ser Asp Pro Arg 275 280 285 Asn Pro Lys Ala Cys Pro
Arg Asn Cys Asp Gly Arg Ile Ala Tyr Gly 290 295 300 Ile Cys Pro Leu
Ser Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn 305 310 315 320 Cys
Cys Ala Gly Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr 325 330
335 Phe Ile Cys Glu Gly Glu Ser Glu Tyr Ala Ser Lys Val Asp Glu Tyr
340 345 350 Val Gly Glu Val Glu Asn Asp Leu Gln Lys Ser Lys Val Ala
Val Ser 355 360 365 <210> SEQ ID NO 58 <211> LENGTH: 47
<212> TYPE: PRT <213> ORGANISM: Artificial sequence:
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
construct: consensus sequence for mature domain of defensin
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: X = R or Q
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(2) <223> OTHER INFORMATION: X = E or I or T
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (4)..(4) <223> OTHER INFORMATION: X = K or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (5)..(5) <223> OTHER INFORMATION: X = T or A or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(6) <223> OTHER INFORMATION: X = E or P or Q
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)..(8) <223> OTHER INFORMATION: X = N or Q or H
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: X = T or R
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: X = P or K or H
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: X = I or L or P
or T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (15)..(15) <223> OTHER INFORMATION: X =
I or F or S or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (16)..(16) <223> OTHER
INFORMATION: X = T or M or R or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (17)..(17) <223>
OTHER INFORMATION: X = K or D or E or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (18)..(18)
<223> OTHER INFORMATION: X = P or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (19)..(19)
<223> OTHER INFORMATION: X = P or S or N <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: X = R or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (22)..(22)
<223> OTHER INFORMATION: X = K or T or S or N <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(23)..(23) <223> OTHER INFORMATION: X = A or Y or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (25)..(25) <223> OTHER INFORMATION: X = I or L or Q
or H <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (26)..(26) <223> OTHER INFORMATION: X =
S or K or T or N <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (28)..(28) <223> OTHER
INFORMATION: X = K or G <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (30)..(30) <223> OTHER
INFORMATION: X = T or S or I or V <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (31)..(31) <223>
OTHER INFORMATION: X = D or G <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (33)..(33) <223>
OTHER INFORMATION: X = H or R or N <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (35)..(35) <223>
OTHER INFORMATION: X = S or P or R <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (36)..(36) <223>
OTHER INFORMATION: X = K or W or A or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (37)..(37)
<223> OTHER INFORMATION: X = I or L or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (38)..(38)
<223> OTHER INFORMATION: X = L or Q or P or R <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(39)..(39) <223> OTHER INFORMATION: X = R or P <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(40)..(40) <223> OTHER INFORMATION: X = R or K <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(42)..(42) <223> OTHER INFORMATION: X = L or F <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(45)..(45) <223> OTHER INFORMATION: X = K or S or R
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (46)..(46) <223> OTHER INFORMATION: X = A or Y or V
<400> SEQUENCE: 58 Xaa Xaa Cys Xaa Xaa Xaa Ser Xaa Xaa Phe
Xaa Gly Xaa Cys Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys
Xaa Xaa Glu Xaa Phe Xaa Xaa Gly 20 25 30 Xaa Cys Xaa Xaa Xaa Xaa
Xaa Xaa Cys Xaa Cys Thr Xaa Xaa Cys 35 40 45 <210> SEQ ID NO
59 <211> LENGTH: 32 <212> TYPE: PRT <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic construct: consensus sequence of
internal domain of defensin <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (2)..(2) <223>
OTHER INFORMATION: X = A or G or K <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (3)..(3) <223>
OTHER INFORMATION: X = R or N or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (5)..(5) <223>
OTHER INFORMATION: X = L or I or M <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (6)..(6) <223>
OTHER INFORMATION: X = C or F or R <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (7)..(7) <223>
OTHER INFORMATION: X = F or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)..(8) <223>
OTHER INFORMATION: X = M or F or I <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (9)..(9) <223>
OTHER INFORMATION: X = A or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223>
OTHER INFORMATION: X = F or T or A <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (11)..(11) <223>
OTHER INFORMATION: X = A or L or V or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: X = I or V or L or F <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(13)..(13) <223> OTHER INFORMATION: X = L or I <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(14)..(14) <223> OTHER INFORMATION: X = A or I or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (15)..(15) <223> OTHER INFORMATION: X = M or A or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (16)..(16) <223> OTHER INFORMATION: X = M or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: X = L or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (18)..(18) <223> OTHER INFORMATION: X = F or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (19)..(19) <223> OTHER INFORMATION: X = V or T or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)..(20) <223> OTHER INFORMATION: X = A or T or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (21)..(21) <223> OTHER INFORMATION: X = Y or T
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (22)..(22) <223> OTHER INFORMATION: X = E or G
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (23)..(23) <223> OTHER INFORMATION: X = V or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (24)..(24) <223> OTHER INFORMATION: X = no amino
acid or G <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (25)..(25) <223> OTHER INFORMATION: X =
no amino acid or P <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (26)..(26) <223> OTHER
INFORMATION: X = no amino acid or M or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (27)..(27)
<223> OTHER INFORMATION: X = no amino acid or T <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(28)..(28) <223> OTHER INFORMATION: X = no amino acid or I or
S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (29)..(29) <223> OTHER INFORMATION: X =
no amino acid or A or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (30)..(30) <223> OTHER
INFORMATION: X = Q or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: X = no amino acid or Q <400> SEQUENCE: 59 Met
Xaa Xaa Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10
15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ala Xaa
20 25 30 <210> SEQ ID NO 60 <211> LENGTH: 33
<212> TYPE: PRT <213> ORGANISM: Artificial sequence:
Synthetic construct: consensus sequence of C-terminal domain of
defensin <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (1)..(1) <223> OTHER INFORMATION: X =
no amino acid or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (2)..(2) <223> OTHER
INFORMATION: X = no amino acid or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: X = no amino acid or D <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(4)..(4) <223> OTHER INFORMATION: X = no amino acid or E or K
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (5)..(5) <223> OTHER INFORMATION: X = no amino acid
or K or I <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (6)..(6) <223> OTHER INFORMATION: X =
no amino acid or M or S <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: X = no amino acid or T or I or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: X = no amino acid or K or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: X = no amino acid
or T or V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (10)..(10) <223> OTHER INFORMATION: X =
no amino acid or G or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: X = no amino acid or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(13)..(13) <223> OTHER INFORMATION: X = no amino acid or I or
T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (14)..(14) <223> OTHER INFORMATION: X =
no amino acid or L <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (15)..(15) <223> OTHER
INFORMATION: X = no amino acid or A or V or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (16)..(16)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(17)..(17) <223> OTHER INFORMATION: X = no amino acid or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (18)..(18) <223> OTHER INFORMATION: X = no amino
acid or A <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (19)..(19) <223> OTHER INFORMATION: X =
no amino acid or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (20)..(20) <223> OTHER
INFORMATION: X = no amino acid or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: X = no amino acid or L <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(22)..(22) <223> OTHER INFORMATION: X = no amino acid or A or
S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (23)..(23) <223> OTHER INFORMATION: X =
no amino acid or A or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (24)..(24) <223> OTHER
INFORMATION: X = no amino acid or A or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (25)..(25)
<223> OTHER INFORMATION: X = no amino acid or L or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (26)..(26) <223> OTHER INFORMATION: X = no amino
acid or L <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (27)..(27) <223> OTHER INFORMATION: X =
no amino acid or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (28)..(28) <223> OTHER
INFORMATION: X = no amino acid or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (29)..(29)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(30)..(30) <223> OTHER INFORMATION: X = no amino acid or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (31)..(31) <223> OTHER INFORMATION: X = no amino
acid or M <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (32)..(32) <223> OTHER INFORMATION: X =
no amino acid or D or M <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (33)..(33) <223> OTHER
INFORMATION: X = no amino acid or N or E <400> SEQUENCE: 60
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5
10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 20 25 30 Xaa <210> SEQ ID NO 61 <211> LENGTH: 112
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
construct: consensus sequence of defensin <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(2)
<223> OTHER INFORMATION: X = A or G or K <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: X = R or N or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(5)
<223> OTHER INFORMATION: X = L or I or M <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: X = C or F or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: X = F or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: X = M or F or I <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: X = A or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10)
<223> OTHER INFORMATION: X = F or T or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (11)..(11)
<223> OTHER INFORMATION: X = A or L or V or F <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(12)..(12) <223> OTHER INFORMATION: X = I or V or L or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: X = L or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (14)..(14) <223> OTHER INFORMATION: X = A or I or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (15)..(15) <223> OTHER INFORMATION: X = M or A or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (16)..(16) <223> OTHER INFORMATION: X = M or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: X = L or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (18)..(18) <223> OTHER INFORMATION: X = F or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (19)..(19) <223> OTHER INFORMATION: X = V or T or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (20)..(20) <223> OTHER INFORMATION: X = A or T or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (21)..(21) <223> OTHER INFORMATION: X = Y or T
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (22)..(22) <223> OTHER INFORMATION: X = E or G
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (23)..(23) <223> OTHER INFORMATION: X = V or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (24)..(24) <223> OTHER INFORMATION: X = no amino
acid or G <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (25)..(25) <223> OTHER INFORMATION: X =
no amino acid or P <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (26)..(26) <223> OTHER
INFORMATION: X = no amino acid or M or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (27)..(27)
<223> OTHER INFORMATION: X = no amino acid or T <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(28)..(28) <223> OTHER INFORMATION: X = no amino acid or I or
S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (29)..(29) <223> OTHER INFORMATION: X =
no amino acid or A or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (30)..(30) <223> OTHER
INFORMATION: X = Q or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: X = no amino acid or Q <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (33)..(33)
<223> OTHER INFORMATION: X = R or Q <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (34)..(34)
<223> OTHER INFORMATION: X = E or I or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (36)..(36)
<223> OTHER INFORMATION: X = K or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (37)..(37)
<223> OTHER INFORMATION: X = T or A or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (38)..(38)
<223> OTHER INFORMATION: X = E or P or Q <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (40)..(40)
<223> OTHER INFORMATION: X = N or Q or H <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (41)..(41)
<223> OTHER INFORMATION: X = T or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (43)..(43)
<223> OTHER INFORMATION: X = P or K or H <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (45)..(45)
<223> OTHER INFORMATION: X = I or L or P or T <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(47)..(47) <223> OTHER INFORMATION: X = I or F or S or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (48)..(48) <223> OTHER INFORMATION: X = T or M or R
or S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (49)..(49) <223> OTHER INFORMATION: X =
K or D or E or A <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (50)..(50) <223> OTHER
INFORMATION: X = P or S <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (51)..(51) <223> OTHER
INFORMATION: X = P or S or N <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (53)..(53) <223>
OTHER INFORMATION: X = R or A <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (54)..(54) <223>
OTHER INFORMATION: X = K or T or S or N <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (55)..(55)
<223> OTHER INFORMATION: X = A or Y or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (57)..(57)
<223> OTHER INFORMATION: X = I or L or Q or H <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(58)..(58) <223> OTHER INFORMATION: X = S or K or T or N
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (60)..(60) <223> OTHER INFORMATION: X = K or G
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (62)..(62) <223> OTHER INFORMATION: X = T or S or I
or V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (63)..(63) <223> OTHER INFORMATION: X =
D or G <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (65)..(65) <223> OTHER INFORMATION: X =
H or R or N <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (67)..(67) <223> OTHER INFORMATION: X =
S or P or R <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (68)..(68) <223> OTHER INFORMATION: X =
K or W or A or G <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (69)..(69) <223> OTHER
INFORMATION: X = I or L or F <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (70)..(70) <223>
OTHER INFORMATION: X = L or Q or P or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (71)..(71)
<223> OTHER INFORMATION: X = R or P <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (72)..(72)
<223> OTHER INFORMATION: X = R or K <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (74)..(74)
<223> OTHER INFORMATION: X = L or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (77)..(77)
<223> OTHER INFORMATION: X = K or S or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (78)..(78)
<223> OTHER INFORMATION: X = P or N or H <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (80)..(80)
<223> OTHER INFORMATION: X = no amino acid or V <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(81)..(81) <223> OTHER INFORMATION: X = no amino acid or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (82)..(82) <223> OTHER INFORMATION: X = no amino
acid or D <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (83)..(83) <223> OTHER INFORMATION: X =
no amino acid or E or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (84)..(84) <223> OTHER
INFORMATION: X = no amino acid or K or I <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (85)..(85)
<223> OTHER INFORMATION: X = no amino acid or M or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (86)..(86) <223> OTHER INFORMATION: X = no amino
acid or T or I or S <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (87)..(87) <223> OTHER
INFORMATION: X = no amino acid or K or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (88)..(88)
<223> OTHER INFORMATION: X = no amino acid or T or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (89)..(89) <223> OTHER INFORMATION: X = no amino
acid or G or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (90)..(90) <223> OTHER
INFORMATION: X = no amino acid or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (91)..(91)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(92)..(92) <223> OTHER INFORMATION: X = no amino acid or I or
T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (93)..(93) <223> OTHER INFORMATION: X =
no amino acid or L <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (94)..(94) <223> OTHER
INFORMATION: X = no amino acid or A or V or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (95)..(95)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(96)..(96) <223> OTHER INFORMATION: X = no amino acid or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (97)..(97) <223> OTHER INFORMATION: X = no amino
acid or A <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (98)..(98) <223> OTHER INFORMATION: X =
no amino acid or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (99)..(99) <223> OTHER
INFORMATION: X = no amino acid or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(100)..(100) <223> OTHER INFORMATION: X = no amino acid or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (101)..(101) <223> OTHER INFORMATION: X = no amino
acid or A or S <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (102)..(102) <223> OTHER
INFORMATION: X = no amino acid or A or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(103)..(103) <223> OTHER INFORMATION: X = no amino acid or A
or V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (104)..(104) <223> OTHER INFORMATION: X
= no amino acid or L or V <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (105)..(105)
<223> OTHER INFORMATION: X = no amino acid or L <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(106)..(106) <223> OTHER INFORMATION: X = no amino acid or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (107)..(107) <223> OTHER INFORMATION: X = no amino
acid or E <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (108)..(108) <223> OTHER INFORMATION: X
= no amino acid or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (109)..(109) <223> OTHER
INFORMATION: X = no amino acid or I <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(110)..(110) <223> OTHER INFORMATION: X = no amino acid or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (111)..(111) <223> OTHER INFORMATION: X = no amino
acid or D or M <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (112)..(112) <223> OTHER
INFORMATION: X = no amino acid or N or E <400> SEQUENCE: 61
Met Xaa Xaa Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5
10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ala
Xaa 20 25 30 Xaa Xaa Cys Xaa Xaa Xaa Ser Xaa Xaa Phe Xaa Gly Xaa
Cys Xaa Xaa 35 40 45 Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys Xaa Xaa Glu
Xaa Phe Xaa Xaa Gly 50 55 60 Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Cys
Xaa Cys Thr Xaa Xaa Cys Xaa 65 70 75 80 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95 Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 100 105 110 <210>
SEQ ID NO 62 <211> LENGTH: 47 <212> TYPE: PRT
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Synthetic construct: consensus
sequence of defensin <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (1)..(46) <223> OTHER
INFORMATION: X is any amino acid. X is depicted as a in the text.
<400> SEQUENCE: 62 Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Cys Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Xaa Cys Xaa Xaa Xaa Xaa
Xaa Xaa Cys Xaa Cys Xaa Xaa Xaa Cys 35 40 45
1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 62 <210>
SEQ ID NO 1 <211> LENGTH: 28 <212> TYPE: DNA
<213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial sequence:
Synthetic construct: primer <400> SEQUENCE: 1 ggaattccat
atggctcgct ccttgtgc 28 <210> SEQ ID NO 2 <211> LENGTH:
29 <212> TYPE: DNA <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Description of
Artificial sequence: Synthetic construct: primer <400>
SEQUENCE: 2 gcggatcctc agttatccat tatctcttc 29 <210> SEQ ID
NO 3 <211> LENGTH: 24 <212> TYPE: DNA <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Description of Artificial sequence: Synthetic
construct: primer <400> SEQUENCE: 3 ccggatccag agaatgcaaa
acag 24 <210> SEQ ID NO 4 <211> LENGTH: 26 <212>
TYPE: DNA <213> ORGANISM: Artificial sequence <220>
FEATURE: <223> OTHER INFORMATION: Description of Artificial
sequence: Synthetic construct: primer <400> SEQUENCE: 4
gggagctctt agttatccat tatctc 26 <210> SEQ ID NO 5 <211>
LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial
sequence <220> FEATURE: <223> OTHER INFORMATION:
Description of Artificial sequence: Synthetic construct: <primer
<400> SEQUENCE: 5 ggaattctaa acaatggctc gctccttgtg c 31
<210> SEQ ID NO 6 <211> LENGTH: 29 <212> TYPE:
DNA <213> ORGANISM: Artificial sequence <220> FEATURE:
<223> OTHER INFORMATION: Description of Artificial sequence:
Synthetic construct: primer <400> SEQUENCE: 6 gctctagatc
agttatccat tatctcttc 29 <210> SEQ ID NO 7 <211> LENGTH:
141 <212> TYPE: DNA <213> ORGANISM: Nicotiana alata
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(141) <400> SEQUENCE: 7 aga gaa tgc aaa aca
gaa agc aac aca ttt cct gga ata tgc att acc 48 Arg Glu Cys Lys Thr
Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15 aaa cca cca
tgc aga aaa gct tgt atc agt gag aaa ttt act gat ggt 96 Lys Pro Pro
Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 cat
tgt agc aaa atc ctc aga agg tgc cta tgt act aag cca tgt 141 His Cys
Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 8 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 8
Arg Glu Cys Lys Thr Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5
10 15 Lys Pro Pro Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp
Gly 20 25 30 His Cys Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys
Pro Cys 35 40 45 <210> SEQ ID NO 9 <211> LENGTH: 75
<212> TYPE: DNA <213> ORGANISM: Nicotiana alata
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(75) <400> SEQUENCE: 9 atg gct cgc tcc ttg tgc
ttc atg gca ttt gct atc ttg gca agg atg 48 Met Ala Arg Ser Leu Cys
Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10 15 ctc ttt gtt gcc
tat gag gtg caa gct 75 Leu Phe Val Ala Tyr Glu Val Gln Ala 20 25
<210> SEQ ID NO 10 <211> LENGTH: 25 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 10
Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5
10 15 Leu Phe Val Ala Tyr Glu Val Gln Ala 20 25 <210> SEQ ID
NO 11 <211> LENGTH: 99 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(99) <400> SEQUENCE:
11 gtg ttt gat gag aag atg act aaa aca gga gct gaa att ttg gct gag
48 Val Phe Asp Glu Lys Met Thr Lys Thr Gly Ala Glu Ile Leu Ala Glu
1 5 10 15 gaa gca aaa act ttg gct gca gct ttg ctt gaa gaa gag ata
atg gat 96 Glu Ala Lys Thr Leu Ala Ala Ala Leu Leu Glu Glu Glu Ile
Met Asp 20 25 30 aac 99 Asn <210> SEQ ID NO 12 <211>
LENGTH: 33 <212> TYPE: PRT <213> ORGANISM: Nicotiana
alata <400> SEQUENCE: 12 Val Phe Asp Glu Lys Met Thr Lys Thr
Gly Ala Glu Ile Leu Ala Glu 1 5 10 15 Glu Ala Lys Thr Leu Ala Ala
Ala Leu Leu Glu Glu Glu Ile Met Asp 20 25 30 Asn <210> SEQ ID
NO 13 <211> LENGTH: 216 <212> TYPE: DNA <213>
ORGANISM: Nicotiana alata <220> FEATURE: <221>
NAME/KEY: CDS <222> LOCATION: (1)..(216) <400>
SEQUENCE: 13 atg gct cgc tcc ttg tgc ttc atg gca ttt gct atc ttg
gca agg atg 48 Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu
Ala Arg Met 1 5 10 15 ctc ttt gtt gcc tat gag gtg caa gct aga gaa
tgc aaa aca gaa agc 96 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu
Cys Lys Thr Glu Ser 20 25 30 aac aca ttt cct gga ata tgc att acc
aaa cca cca tgc aga aaa gct 144 Asn Thr Phe Pro Gly Ile Cys Ile Thr
Lys Pro Pro Cys Arg Lys Ala 35 40 45 tgt atc agt gag aaa ttt act
gat ggt cat tgt agc aaa atc ctc aga 192 Cys Ile Ser Glu Lys Phe Thr
Asp Gly His Cys Ser Lys Ile Leu Arg 50 55 60 agg tgc cta tgt act
aag cca tgt 216 Arg Cys Leu Cys Thr Lys Pro Cys 65 70 <210>
SEQ ID NO 14 <211> LENGTH: 72 <212> TYPE: PRT
<213> ORGANISM: Nicotiana alata <400> SEQUENCE: 14 Met
Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10
15 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu Ser
20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys Arg
Lys Ala 35 40 45 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys Ser
Lys Ile Leu Arg 50 55 60
Arg Cys Leu Cys Thr Lys Pro Cys 65 70 <210> SEQ ID NO 15
<211> LENGTH: 240 <212> TYPE: DNA <213> ORGANISM:
Nicotiana alata <220> FEATURE: <221> NAME/KEY: CDS
<222> LOCATION: (1)..(240) <400> SEQUENCE: 15 aga gaa
tgc aaa aca gaa agc aac aca ttt cct gga ata tgc att acc 48 Arg Glu
Cys Lys Thr Glu Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15
aaa cca cca tgc aga aaa gct tgt atc agt gag aaa ttt act gat ggt 96
Lys Pro Pro Cys Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20
25 30 cat tgt agc aaa atc ctc aga agg tgc cta tgt act aag cca tgt
gtg 144 His Cys Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys
Val 35 40 45 ttt gat gag aag atg act aaa aca gga gct gaa att ttg
gct gag gaa 192 Phe Asp Glu Lys Met Thr Lys Thr Gly Ala Glu Ile Leu
Ala Glu Glu 50 55 60 gca aaa act ttg gct gca gct ttg ctt gaa gaa
gag ata atg gat aac 240 Ala Lys Thr Leu Ala Ala Ala Leu Leu Glu Glu
Glu Ile Met Asp Asn 65 70 75 80 <210> SEQ ID NO 16
<211> LENGTH: 80 <212> TYPE: PRT <213> ORGANISM:
Nicotiana alata <400> SEQUENCE: 16 Arg Glu Cys Lys Thr Glu
Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15 Lys Pro Pro Cys
Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 His Cys
Ser Lys Ile Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys Val 35 40 45
Phe Asp Glu Lys Met Thr Lys Thr Gly Ala Glu Ile Leu Ala Glu Glu 50
55 60 Ala Lys Thr Leu Ala Ala Ala Leu Leu Glu Glu Glu Ile Met Asp
Asn 65 70 75 80 <210> SEQ ID NO 17 <211> LENGTH: 541
<212> TYPE: DNA <213> ORGANISM: Nicotiana alata
<220> FEATURE: <221> NAME/KEY: CDS <222>
LOCATION: (1)..(318) <400> SEQUENCE: 17 atg gct cgc tcc ttg
tgc ttc atg gca ttt gct atc ttg gca agg atg 48 Met Ala Arg Ser Leu
Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5 10 15 ctc ttt gtt
gcc tat gag gtg caa gct aga gaa tgc aaa aca gaa agc 96 Leu Phe Val
Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu Ser 20 25 30 aac
aca ttt cct gga ata tgc att acc aaa cca cca tgc aga aaa gct 144 Asn
Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys Arg Lys Ala 35 40
45 tgt atc agt gag aaa ttt act gat ggt cat tgt agc aaa atc ctc aga
192 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys Ser Lys Ile Leu Arg
50 55 60 agg tgc cta tgt act aag cca tgt gtg ttt gat gag aag atg
act aaa 240 Arg Cys Leu Cys Thr Lys Pro Cys Val Phe Asp Glu Lys Met
Thr Lys 65 70 75 80 aca gga gct gaa att ttg gct gag gaa gca aaa act
ttg gct gca gct 288 Thr Gly Ala Glu Ile Leu Ala Glu Glu Ala Lys Thr
Leu Ala Ala Ala 85 90 95 ttg ctt gaa gaa gag ata atg gat aac taa
ttagagatta gaagaaatta 338 Leu Leu Glu Glu Glu Ile Met Asp Asn 100
105 aggatgcagt atcacacata ataaagtttc tacctttctt aaaagtgtag
ctaatgttgt 398 gttttaattg gcttttagta gccttttatt acactttaaa
taagtgtggc acttcaatcc 458 tttgtgcaat cttgcactaa gtttatttgt
gtacttttaa tgaaaatgac cttctatggt 518 ctttggttaa aaaaaaaaaa aaa 541
<210> SEQ ID NO 18 <211> LENGTH: 105 <212> TYPE:
PRT <213> ORGANISM: Nicotiana alata <400> SEQUENCE: 18
Met Ala Arg Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Arg Met 1 5
10 15 Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu
Ser 20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys
Arg Lys Ala 35 40 45 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys
Ser Lys Ile Leu Arg 50 55 60 Arg Cys Leu Cys Thr Lys Pro Cys Val
Phe Asp Glu Lys Met Thr Lys 65 70 75 80 Thr Gly Ala Glu Ile Leu Ala
Glu Glu Ala Lys Thr Leu Ala Ala Ala 85 90 95 Leu Leu Glu Glu Glu
Ile Met Asp Asn 100 105 <210> SEQ ID NO 19 <211>
LENGTH: 223 <212> TYPE: DNA <213> ORGANISM: Nicotiana
alata <400> SEQUENCE: 19 ttagagatta gaagaaatta aggatgcagt
atcacacata ataaagtttc tacctttctt 60 aaaagtgtag ctaatgttgt
gttttaattg gcttttagta gccttttatt acactttaaa 120 taagtgtggc
acttcaatcc tttgtgcaat cttgcactaa gtttatttgt gtacttttaa 180
tgaaaatgac cttctatggt ctttggttaa aaaaaaaaaa aaa 223 <210> SEQ
ID NO 20 <211> LENGTH: 105 <212> TYPE: PRT <213>
ORGANISM: Nicotiana tabacum <400> SEQUENCE: 20 Met Ala Arg
Ser Leu Cys Phe Met Ala Phe Ala Ile Leu Ala Met Met 1 5 10 15 Leu
Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Lys Thr Glu Ser 20 25
30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys Arg Lys Ala
35 40 45 Cys Ile Ser Glu Lys Phe Thr Asp Gly His Cys Ser Lys Leu
Leu Arg 50 55 60 Arg Cys Leu Cys Thr Lys Pro Cys Val Phe Asp Glu
Lys Met Ile Lys 65 70 75 80 Thr Gly Ala Glu Thr Leu Val Glu Glu Ala
Lys Thr Leu Ala Ala Ala 85 90 95 Leu Leu Glu Glu Glu Ile Met Asp
Asn 100 105 <210> SEQ ID NO 21 <211> LENGTH: 105
<212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana
<400> SEQUENCE: 21 Met Ala Arg Ser Ile Phe Phe Met Ala Phe
Leu Val Leu Ala Met Met 1 5 10 15 Leu Phe Val Thr Tyr Glu Val Glu
Ala Gln Gln Ile Cys Lys Ala Pro 20 25 30 Ser Gln Thr Phe Pro Gly
Leu Cys Phe Met Asp Ser Ser Cys Arg Lys 35 40 45 Tyr Cys Ile Lys
Glu Lys Phe Thr Gly Gly His Cys Ser Lys Leu Gln 50 55 60 Arg Lys
Cys Leu Cys Thr Lys Pro Cys Val Phe Asp Lys Ile Ser Ser 65 70 75 80
Glu Val Lys Ala Thr Leu Gly Glu Glu Ala Lys Thr Leu Ser Glu Val 85
90 95 Val Leu Glu Glu Glu Ile Met Met Glu 100 105 <210> SEQ
ID NO 22 <211> LENGTH: 78 <212> TYPE: PRT <213>
ORGANISM: Nicotiana tabacum <400> SEQUENCE: 22 Met Ala Asn
Ser Met Arg Phe Phe Ala Thr Val Leu Leu Ile Ala Leu 1 5 10 15 Leu
Val Thr Ala Thr Glu Met Gly Pro Met Thr Ile Ala Glu Ala Arg 20 25
30 Thr Cys Glu Ser Gln Ser His Arg Phe Lys Gly Pro Cys Ser Arg Asp
35 40 45 Ser Asn Cys Ala Thr Val Cys Leu Thr Glu Gly Phe Ser Gly
Gly Arg 50 55 60 Cys Pro Trp Ile Pro Pro Arg Cys Phe Cys Thr Ser
Pro Cys 65 70 75 <210> SEQ ID NO 23 <211> LENGTH: 78
<212> TYPE: PRT <213> ORGANISM: Petunia inflata
<400> SEQUENCE: 23 Met Gly Arg Ser Ile Arg Leu Phe Ala Thr
Phe Phe Leu Ile Ala Met 1 5 10 15 Leu Phe Leu Ser Thr Glu Met Gly
Pro Met Thr Ser Ala Glu Ala Arg 20 25 30 Thr Cys Glu Ser Gln Ser
His Arg Phe His Gly Thr Cys Val Arg Glu 35 40 45 Ser Asn Cys Ala
Ser Val Cys Gln Thr Glu Gly Phe Ile Gly Gly Asn 50 55 60
Cys Arg Ala Phe Arg Arg Arg Cys Phe Cys Thr Arg Asn Cys 65 70 75
<210> SEQ ID NO 24 <211> LENGTH: 77 <212> TYPE:
PRT <213> ORGANISM: Arabidopsis thaliana <400>
SEQUENCE: 24 Met Lys Leu Ser Met Arg Leu Ile Ser Ala Val Leu Ile
Met Phe Met 1 5 10 15 Ile Phe Val Ala Thr Gly Met Gly Pro Val Thr
Val Glu Ala Arg Thr 20 25 30 Cys Glu Ser Gln Ser His Arg Phe Lys
Gly Thr Cys Val Ser Ala Ser 35 40 45 Asn Cys Ala Asn Val Cys His
Asn Glu Gly Phe Val Gly Gly Asn Cys 50 55 60 Arg Gly Phe Arg Arg
Arg Cys Phe Cys Thr Arg His Cys 65 70 75 <210> SEQ ID NO 25
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Nicotiana tabacum <400> SEQUENCE: 25 Arg Glu Cys Lys Thr Glu
Ser Asn Thr Phe Pro Gly Ile Cys Ile Thr 1 5 10 15 Lys Pro Pro Cys
Arg Lys Ala Cys Ile Ser Glu Lys Phe Thr Asp Gly 20 25 30 His Cys
Ser Lys Leu Leu Arg Arg Cys Leu Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 26 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Lycopersicon esculentum <400>
SEQUENCE: 26 Gln Ile Cys Lys Ala Pro Ser Gln Thr Phe Pro Gly Leu
Cys Phe Met 1 5 10 15 Asp Ser Ser Cys Arg Lys Tyr Cys Ile Lys Glu
Lys Phe Thr Gly Gly 20 25 30 His Cys Ser Lys Leu Gln Arg Lys Cys
Leu Cys Thr Lys Pro Cys 35 40 45 <210> SEQ ID NO 27
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Solanum tuberosum <400> SEQUENCE: 27 Arg His Cys Glu Ser Leu
Ser His Arg Phe Lys Gly Pro Cys Thr Arg 1 5 10 15 Asp Ser Asn Cys
Ala Ser Val Cys Glu Thr Glu Arg Phe Ser Gly Gly 20 25 30 Asn Cys
His Gly Phe Arg Arg Arg Cys Phe Cys Thr Lys Pro Cys 35 40 45
<210> SEQ ID NO 28 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Petunia inflata <400> SEQUENCE: 28
Arg Val Cys Glu Ser Gln Ser His Gly Phe His Gly Leu Cys Asn Arg 1 5
10 15 Asp His Asn Cys Ala Leu Val Cys Arg Asn Glu Gly Phe Ser Gly
Gly 20 25 30 Arg Cys Lys Gly Phe Arg Arg Arg Cys Phe Cys Thr Arg
Ile Cys 35 40 45 <210> SEQ ID NO 29 <211> LENGTH: 47
<212> TYPE: PRT <213> ORGANISM: Glycine max <400>
SEQUENCE: 29 Arg Thr Cys Glu Ser Gln Ser His Arg Phe His Gly Thr
Cys Val Arg 1 5 10 15 Glu Ser Asn Cys Ala Ser Val Cys Gln Thr Glu
Gly Phe Ile Gly Gly 20 25 30 Asn Cys Arg Ala Phe Arg Arg Arg Cys
Phe Cys Thr Arg Asn Cys 35 40 45 <210> SEQ ID NO 30
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Hordeum vulgare <400> SEQUENCE: 30 Arg Ile Cys Arg Arg Arg
Ser Ala Gly Phe Lys Gly Pro Cys Val Ser 1 5 10 15 Asn Lys Asn Cys
Ala Gln Val Cys Met Gln Glu Trp Gly Glu Gly Gly 20 25 30 Asn Cys
Asp Gly Pro Leu Arg Arg Cys Lys Cys Met Arg Arg Cys 35 40 45
<210> SEQ ID NO 31 <211> LENGTH: 51 <212> TYPE:
PRT <213> ORGANISM: Sinapis alba <400> SEQUENCE: 31 Gln
Lys Leu Cys Gln Arg Pro Ser Gly Thr Trp Ser Gly Val Cys Gly 1 5 10
15 Asn Asn Asn Ala Cys Arg Asn Gln Cys Ile Asn Leu Glu Lys Ala Arg
20 25 30 His Gly Ser Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile
Cys Tyr 35 40 45 Phe Pro Cys 50 <210> SEQ ID NO 32
<211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM:
Solanum tuberosum <400> SEQUENCE: 32 Arg Asn Cys Glu Ser Leu
Ser His Arg Phe Lys Gly Pro Cys Thr Arg 1 5 10 15 Asp Ser Asn Cys
20 <210> SEQ ID NO 33 <211> LENGTH: 51 <212>
TYPE: PRT <213> ORGANISM: Raphanus sativus <400>
SEQUENCE: 33 Gln Lys Leu Cys Glu Arg Pro Ser Gly Thr Trp Ser Gly
Val Cys Gly 1 5 10 15 Asn Asn Asn Ala Cys Lys Asn Gln Cys Ile Asn
Leu Glu Lys Ala Arg 20 25 30 His Gly Ser Cys Asn Tyr Val Phe Pro
Ala His Lys Cys Ile Cys Tyr 35 40 45 Phe Pro Cys 50 <210> SEQ
ID NO 34 <211> LENGTH: 51 <212> TYPE: PRT <213>
ORGANISM: Raphanus sativus <400> SEQUENCE: 34 Gln Lys Leu Cys
Gln Arg Pro Ser Gly Thr Trp Ser Gly Val Cys Gly 1 5 10 15 Asn Asn
Asn Ala Cys Lys Asn Gln Cys Ile Arg Leu Glu Lys Ala Arg 20 25 30
His Gly Ser Cys Asn Tyr Val Phe Pro Ala His Lys Cys Ile Cys Tyr 35
40 45 Phe Pro Cys 50 <210> SEQ ID NO 35 <211> LENGTH:
51 <212> TYPE: PRT <213> ORGANISM: Sinapis alba
<400> SEQUENCE: 35 Gln Lys Leu Cys Glu Arg Pro Ser Gly Thr
Trp Ser Gly Val Cys Gly 1 5 10 15 Asn Asn Asn Ala Cys Lys Asn Gln
Cys Ile Asn Leu Glu Lys Ala Arg 20 25 30 His Gly Ser Cys Asn Tyr
Val Phe Pro Ala His Lys Cys Ile Cys Tyr 35 40 45 Phe Pro Cys 50
<210> SEQ ID NO 36 <211> LENGTH: 52 <212> TYPE:
PRT <213> ORGANISM: Sinapis alba <400> SEQUENCE: 36 Gln
Lys Leu Cys Ala Arg Pro Ser Gly Thr Trp Ser Ser Gly Asn Cys 1 5 10
15 Arg Asn Asn Asn Ala Cys Arg Asn Phe Cys Ile Lys Leu Glu Lys Ser
20 25 30 Arg His Gly Ser Cys Asn Ile Pro Phe Pro Ser Asn Lys Cys
Ile Cys 35 40 45 Tyr Phe Pro Cys 50 <210> SEQ ID NO 37
<211> LENGTH: 47 <212> TYPE: PRT <213> ORGANISM:
Triticum turgidium <400> SEQUENCE: 37 Lys Ile Cys Arg Arg Arg
Ser Ala Gly Phe Lys Gly Pro Cys Met Ser
1 5 10 15 Asn Lys Asn Cys Ala Gln Val Cys Gln Gln Glu Gly Trp Gly
Gly Gly 20 25 30 Asn Cys Asp Gly Pro Phe Arg Arg Cys Lys Cys Ile
Arg Gln Cys 35 40 45 <210> SEQ ID NO 38 <211> LENGTH:
47 <212> TYPE: PRT <213> ORGANISM: Triticum turgidium
<400> SEQUENCE: 38 Lys Val Cys Arg Gln Arg Ser Ala Gly Phe
Lys Gly Pro Cys Val Ser 1 5 10 15 Asp Lys Asn Cys Ala Gln Val Cys
Leu Gln Glu Gly Trp Gly Gly Gly 20 25 30 Asn Cys Asp Gly Pro Phe
Arg Arg Cys Lys Cys Ile Arg Gln Cys 35 40 45 <210> SEQ ID NO
39 <211> LENGTH: 47 <212> TYPE: PRT <213>
ORGANISM: Vigna unguiculata <400> SEQUENCE: 39 Lys Thr Cys
Glu Asn Leu Val Asp Thr Tyr Arg Gly Pro Cys Phe Thr 1 5 10 15 Thr
Gly Ser Cys Asp Asp His Cys Lys Asn Lys Glu His Leu Leu Ser 20 25
30 Gly Arg Cys Arg Asp Asp Val Arg Cys Trp Cys Thr Arg Asn Cys 35
40 45 <210> SEQ ID NO 40 <211> LENGTH: 48 <212>
TYPE: PRT <213> ORGANISM: Sorghum bicolor <400>
SEQUENCE: 40 Arg Val Cys Met Gly Lys Ser Ala Gly Phe Lys Gly Leu
Cys Met Arg 1 5 10 15 Asp Gln Asn Cys Ala Gln Val Cys Leu Gln Glu
Gly Trp Gly Gly Gly 20 25 30 Asn Cys Asp Gly Val Met Arg Gln Cys
Lys Cys Ile Arg Gln Cys Trp 35 40 45 <210> SEQ ID NO 41
<211> LENGTH: 48 <212> TYPE: PRT <213> ORGANISM:
Sorghum bicolor <400> SEQUENCE: 41 Arg Val Cys Arg Arg Arg
Ser Ala Gly Phe Lys Gly Leu Cys Met Ser 1 5 10 15 Asp His Asn Cys
Ala Gln Val Cys Leu Gln Glu Gly Trp Gly Gly Gly 20 25 30 Asn Cys
Asp Gly Val Ile Arg Gln Cys Lys Cys Ile Arg Gln Cys Trp 35 40 45
<210> SEQ ID NO 42 <211> LENGTH: 20 <212> TYPE:
PRT <213> ORGANISM: Dahlia merckii <400> SEQUENCE: 42
Glu Val Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn 1 5
10 15 Thr Gly His Cys 20 <210> SEQ ID NO 43 <211>
LENGTH: 47 <212> TYPE: PRT <213> ORGANISM: Sorghum
bicolor <400> SEQUENCE: 43 Arg Val Cys Met Lys Gly Ser Gln
His His Ser Phe Pro Cys Ile Ser 1 5 10 15 Asp Arg Leu Cys Ser Asn
Glu Cys Val Lys Glu Glu Gly Gly Trp Thr 20 25 30 Ala Gly Tyr Cys
His Leu Arg Tyr Cys Arg Cys Gln Lys Ala Cys 35 40 45 <210>
SEQ ID NO 44 <211> LENGTH: 45 <212> TYPE: PRT
<213> ORGANISM: Pisum sativum <400> SEQUENCE: 44 Asn
Thr Cys Glu Asn Leu Ala Gly Ser Tyr Lys Gly Val Cys Phe Gly 1 5 10
15 Gly Cys Asp Arg His Cys Arg Thr Gln Glu Gly Ala Ile Ser Gly Arg
20 25 30 Cys Arg Asp Asp Phe Arg Cys Trp Cys Thr Lys Asn Cys 35 40
45 <210> SEQ ID NO 45 <211> LENGTH: 50 <212>
TYPE: PRT <213> ORGANISM: Aesculus hippocastanum <400>
SEQUENCE: 45 Leu Cys Asn Glu Arg Pro Ser Gln Thr Trp Ser Gly Asn
Cys Gly Asn 1 5 10 15 Thr Ala His Cys Asp Lys Gln Cys Gln Asp Trp
Glu Lys Ala Ser His 20 25 30 Gly Ala Cys His Lys Arg Glu Asn His
Trp Lys Cys Phe Cys Tyr Phe 35 40 45 Asn Cys 50 <210> SEQ ID
NO 46 <211> LENGTH: 51 <212> TYPE: PRT <213>
ORGANISM: Heuchera sanguinea <400> SEQUENCE: 46 Lys Leu Cys
Asp Val Pro Ser Gly Thr Trp Ser Gly His Cys Gly Ser 1 5 10 15 Ser
Ser Lys Cys Ser Gln Gln Cys Lys Asp Arg Glu His Phe Ala Tyr 20 25
30 Gly Gly Ala Cys His Tyr Gln Phe Pro Ser Val Lys Cys Phe Cys Lys
35 40 45 Arg Gln Cys 50 <210> SEQ ID NO 47 <211>
LENGTH: 50 <212> TYPE: PRT <213> ORGANISM: Dahlia
merckii <400> SEQUENCE: 47 Glu Leu Cys Glu Lys Ala Ser Lys
Thr Trp Ser Gly Asn Cys Gly Asn 1 5 10 15 Thr Gly His Cys Asp Asn
Gln Cys Lys Ser Trp Glu Gly Ala Ala His 20 25 30 Gly Ala Cys His
Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe 35 40 45 Asn Cys 50
<210> SEQ ID NO 48 <211> LENGTH: 46 <212> TYPE:
PRT <213> ORGANISM: Pisum sativum <400> SEQUENCE: 48
Asn Thr Cys Glu His Leu Ala Asp Thr Tyr Arg Gly Val Cys Phe Thr 1 5
10 15 Asn Ala Ser Cys Asp Asp His Cys Lys Asn Lys Ala His Leu Ile
Ser 20 25 30 Gly Thr Cys His Asp Trp Lys Cys Phe Cys Thr Gln Asn
Cys 35 40 45 <210> SEQ ID NO 49 <211> LENGTH: 49
<212> TYPE: PRT <213> ORGANISM: Clitoria terneata
<400> SEQUENCE: 49 Asn Leu Cys Glu Arg Ala Ser Leu Thr Trp
Thr Gly Asn Cys Gly Asn 1 5 10 15 Thr Gly His Cys Asp Thr Gln Cys
Arg Asn Trp Glu Ser Ala Lys His 20 25 30 Gly Ala Cys His Lys Arg
Gly Asn Trp Lys Cys Phe Cys Tyr Phe Asn 35 40 45 Cys <210>
SEQ ID NO 50 <211> LENGTH: 79 <212> TYPE: PRT
<213> ORGANISM: Nicotiana excelsior <400> SEQUENCE: 50
Leu Phe Val Ala Tyr Glu Val Gln Ala Arg Glu Cys Ala Arg Glu Ile 1 5
10 15 Phe Thr Gly Leu Cys Ile Thr Asn Pro Gln Cys Arg Lys Ala Cys
Ile 20 25 30 Lys Glu Lys Phe Thr Asp Gly His Cys Ser Lys Ile Leu
Arg Arg Cys 35 40 45 Leu Cys Thr Lys Pro Cys Thr Gly Ala Glu Thr
Leu Ala Glu Glu Ala 50 55 60 Thr Thr Leu Ala Ala Ala Leu Leu Glu
Glu Glu Ile Met Asp Asn 65 70 75 <210> SEQ ID NO 51
<211> LENGTH: 105 <212> TYPE: PRT <213> ORGANISM:
Nicotiana excelsior <400> SEQUENCE: 51
Met Ala Arg Ser Val Cys Phe Met Ala Phe Ala Ile Leu Ala Val Met 1 5
10 15 Leu Phe Val Ala Tyr Asp Val Glu Ala Lys Asp Cys Lys Thr Glu
Ser 20 25 30 Asn Thr Phe Pro Gly Ile Cys Ile Thr Lys Pro Pro Cys
Arg Lys Ala 35 40 45 Cys Ile Lys Glu Lys Phe Thr Asp Gly His Cys
Ser Lys Ile Leu Arg 50 55 60 Arg Cys Leu Cys Thr Lys Pro Cys Val
Phe Asp Glu Lys Met Ile Lys 65 70 75 80 Thr Gly Ala Glu Thr Leu Ala
Glu Glu Ala Thr Thr Leu Ala Ala Ala 85 90 95 Leu Leu Glu Glu Glu
Ile Met Asp Asn 100 105 <210> SEQ ID NO 52 <211>
LENGTH: 106 <212> TYPE: PRT <213> ORGANISM: Nicotiana
paniculata <400> SEQUENCE: 52 Met Ala Arg Ser Leu Cys Phe Met
Ala Phe Ala Val Leu Ala Met Met 1 5 10 15 Leu Phe Val Ala Tyr Glu
Val Gln Ala Lys Ser Thr Cys Lys Ala Glu 20 25 30 Ser Asn Thr Phe
Pro Gly Leu Cys Ile Thr Lys Pro Pro Cys Arg Lys 35 40 45 Ala Cys
Leu Ser Glu Lys Phe Thr Asp Gly Lys Cys Ser Lys Ile Leu 50 55 60
Arg Arg Cys Ile Cys Tyr Lys Pro Cys Val Phe Asp Gly Lys Met Ile 65
70 75 80 Gln Thr Gly Ala Glu Asn Leu Ala Glu Glu Ala Glu Thr Leu
Ala Ala 85 90 95 Ala Leu Leu Glu Glu Glu Met Met Asp Asn 100 105
<210> SEQ ID NO 53 <211> LENGTH: 47 <212> TYPE:
PRT <213> ORGANISM: Nicotiana tabacum <400> SEQUENCE:
53 Arg Thr Cys Glu Ser Gln Ser His Arg Phe Lys Gly Pro Cys Ser Arg
1 5 10 15 Asp Ser Asn Cys Ala Thr Val Cys Leu Thr Glu Gly Phe Ser
Gly Gly 20 25 30 Arg Cys Pro Trp Ile Pro Pro Arg Cys Phe Cys Thr
Ser Pro Cys 35 40 45 <210> SEQ ID NO 54 <211> LENGTH:
19 <212> TYPE: PRT <213> ORGANISM: Petunia inflata
<400> SEQUENCE: 54 Arg Thr Cys Glu Ser Gln Ser His Arg Phe
His Gly Thr Cys Val Arg 1 5 10 15 Glu Ser Asn <210> SEQ ID NO
55 <211> LENGTH: 47 <212> TYPE: PRT <213>
ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 55 Arg Thr Cys
Glu Ser Gln Ser His Arg Phe Lys Gly Thr Cys Val Ser 1 5 10 15 Ala
Ser Asn Cys Ala Asn Val Cys His Asn Glu Gly Phe Val Gly Gly 20 25
30 Asn Cys Arg Gly Phe Arg Arg Arg Cys Phe Cys Thr Arg His Cys 35
40 45 <210> SEQ ID NO 56 <211> LENGTH: 1104 <212>
TYPE: DNA <213> ORGANISM: Nicotiana alata <220>
FEATURE: <221> NAME/KEY: CDS <222> LOCATION:
(1)..(1104) <400> SEQUENCE: 56 aag gct tgt acc tta aac tgt
gat cca aga att gcc tat gga gtt tgc 48 Lys Ala Cys Thr Leu Asn Cys
Asp Pro Arg Ile Ala Tyr Gly Val Cys 1 5 10 15 ccg cgt tca gaa gaa
aag aag aat gat cgg ata tgc acc aac tgt tgc 96 Pro Arg Ser Glu Glu
Lys Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys 20 25 30 gca ggc acg
aag ggt tgt aag tac ttc agt gat gat gga act ttt gtt 144 Ala Gly Thr
Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val 35 40 45 tgt
gaa gga gag tct gat cct aga aat cca aag gct tgt acc tta aac 192 Cys
Glu Gly Glu Ser Asp Pro Arg Asn Pro Lys Ala Cys Thr Leu Asn 50 55
60 tgt gat cca aga att gcc tat gga gtt tgc ccg cgt tca gaa gaa aag
240 Cys Asp Pro Arg Ile Ala Tyr Gly Val Cys Pro Arg Ser Glu Glu Lys
65 70 75 80 aag aat gat cgg ata tgc acc aac tgt tgc gca ggc acg aag
ggt tgt 288 Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly Thr Lys
Gly Cys 85 90 95 aag tac ttc agt gat gat gga act ttt gtt tgt gaa
gga gag tct gat 336 Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val Cys Glu
Gly Glu Ser Asp 100 105 110 cct aga aat cca aag gct tgt cct cgg aat
tgc gat cca aga att gcc 384 Pro Arg Asn Pro Lys Ala Cys Pro Arg Asn
Cys Asp Pro Arg Ile Ala 115 120 125 tat ggg att tgc cca ctt gca gaa
gaa aag aag aat gat cgg ata tgc 432 Tyr Gly Ile Cys Pro Leu Ala Glu
Glu Lys Lys Asn Asp Arg Ile Cys 130 135 140 acc aac tgt tgc gca ggc
aaa aag ggt tgt aag tac ttt agt gat gat 480 Thr Asn Cys Cys Ala Gly
Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp 145 150 155 160 gga act ttt
gtt tgt gaa gga gag tct gat cct aaa aat cca aag gcc 528 Gly Thr Phe
Val Cys Glu Gly Glu Ser Asp Pro Lys Asn Pro Lys Ala 165 170 175 tgt
cct cgg aat tgt gat gga aga att gcc tat ggg att tgc cca ctt 576 Cys
Pro Arg Asn Cys Asp Gly Arg Ile Ala Tyr Gly Ile Cys Pro Leu 180 185
190 tca gaa gaa aag aag aat gat cgg ata tgc acc aac tgc tgc gca ggc
624 Ser Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly
195 200 205 aaa aag ggt tgt aag tac ttt agt gat gat gga act ttt gtt
tgt gaa 672 Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val
Cys Glu 210 215 220 gga gag tct gat cct aaa aat cca aag gct tgt cct
cgg aat tgt gat 720 Gly Glu Ser Asp Pro Lys Asn Pro Lys Ala Cys Pro
Arg Asn Cys Asp 225 230 235 240 gga aga att gcc tat ggg att tgc cca
ctt tca gaa gaa aag aag aat 768 Gly Arg Ile Ala Tyr Gly Ile Cys Pro
Leu Ser Glu Glu Lys Lys Asn 245 250 255 gat cgg ata tgc aca aac tgt
tgc gca ggc aaa aag ggc tgt aag tac 816 Asp Arg Ile Cys Thr Asn Cys
Cys Ala Gly Lys Lys Gly Cys Lys Tyr 260 265 270 ttt agt gat gat gga
act ttt gtt tgt gaa gga gag tct gat cct aga 864 Phe Ser Asp Asp Gly
Thr Phe Val Cys Glu Gly Glu Ser Asp Pro Arg 275 280 285 aat cca aag
gcc tgt cct cgg aat tgt gat gga aga att gcc tat gga 912 Asn Pro Lys
Ala Cys Pro Arg Asn Cys Asp Gly Arg Ile Ala Tyr Gly 290 295 300 att
tgc cca ctt tca gaa gaa aag aag aat gat cgg ata tgc acc aat 960 Ile
Cys Pro Leu Ser Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn 305 310
315 320 tgt tgc gca ggc aag aag ggc tgt aag tac ttt agt gat gat gga
act 1008 Cys Cys Ala Gly Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp
Gly Thr 325 330 335 ttt att tgt gaa gga gaa tct gaa tat gcc agc aaa
gtg gat gaa tat 1056 Phe Ile Cys Glu Gly Glu Ser Glu Tyr Ala Ser
Lys Val Asp Glu Tyr 340 345 350 gtt ggt gaa gtg gag aat gat ctc cag
aag tct aag gtt gct gtt tcc 1104 Val Gly Glu Val Glu Asn Asp Leu
Gln Lys Ser Lys Val Ala Val Ser 355 360 365 <210> SEQ ID NO
57 <211> LENGTH: 368 <212> TYPE: PRT <213>
ORGANISM: Nicotiana alata <400> SEQUENCE: 57 Lys Ala Cys Thr
Leu Asn Cys Asp Pro Arg Ile Ala Tyr Gly Val Cys 1 5 10 15 Pro Arg
Ser Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys 20 25 30
Ala Gly Thr Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr Phe Val 35
40 45 Cys Glu Gly Glu Ser Asp Pro Arg Asn Pro Lys Ala Cys Thr Leu
Asn 50 55 60 Cys Asp Pro Arg Ile Ala Tyr Gly Val Cys Pro Arg Ser
Glu Glu Lys 65 70 75 80 Lys Asn Asp Arg Ile Cys Thr Asn Cys Cys Ala
Gly Thr Lys Gly Cys 85 90 95 Lys Tyr Phe Ser Asp Asp Gly Thr Phe
Val Cys Glu Gly Glu Ser Asp 100 105 110 Pro Arg Asn Pro Lys Ala Cys
Pro Arg Asn Cys Asp Pro Arg Ile Ala 115 120 125 Tyr Gly Ile Cys Pro
Leu Ala Glu Glu Lys Lys Asn Asp Arg Ile Cys 130 135 140 Thr Asn Cys
Cys Ala Gly Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp 145 150 155 160
Gly Thr Phe Val Cys Glu Gly Glu Ser Asp Pro Lys Asn Pro Lys Ala 165
170 175 Cys Pro Arg Asn Cys Asp Gly Arg Ile Ala Tyr Gly Ile Cys Pro
Leu 180 185 190 Ser Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn Cys
Cys Ala Gly 195 200 205 Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly
Thr Phe Val Cys Glu 210 215 220 Gly Glu Ser Asp Pro Lys Asn Pro Lys
Ala Cys Pro Arg Asn Cys Asp
225 230 235 240 Gly Arg Ile Ala Tyr Gly Ile Cys Pro Leu Ser Glu Glu
Lys Lys Asn 245 250 255 Asp Arg Ile Cys Thr Asn Cys Cys Ala Gly Lys
Lys Gly Cys Lys Tyr 260 265 270 Phe Ser Asp Asp Gly Thr Phe Val Cys
Glu Gly Glu Ser Asp Pro Arg 275 280 285 Asn Pro Lys Ala Cys Pro Arg
Asn Cys Asp Gly Arg Ile Ala Tyr Gly 290 295 300 Ile Cys Pro Leu Ser
Glu Glu Lys Lys Asn Asp Arg Ile Cys Thr Asn 305 310 315 320 Cys Cys
Ala Gly Lys Lys Gly Cys Lys Tyr Phe Ser Asp Asp Gly Thr 325 330 335
Phe Ile Cys Glu Gly Glu Ser Glu Tyr Ala Ser Lys Val Asp Glu Tyr 340
345 350 Val Gly Glu Val Glu Asn Asp Leu Gln Lys Ser Lys Val Ala Val
Ser 355 360 365 <210> SEQ ID NO 58 <211> LENGTH: 47
<212> TYPE: PRT <213> ORGANISM: Artificial sequence:
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
construct: consensus sequence for mature domain of defensin
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (1)..(1) <223> OTHER INFORMATION: X = R or Q
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (2)..(2) <223> OTHER INFORMATION: X = E or I or T
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (4)..(4) <223> OTHER INFORMATION: X = K or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (5)..(5) <223> OTHER INFORMATION: X = T or A or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (6)..(6) <223> OTHER INFORMATION: X = E or P or Q
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (8)..(8) <223> OTHER INFORMATION: X = N or Q or H
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: X = T or R
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (11)..(11) <223> OTHER INFORMATION: X = P or K or H
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (13)..(13) <223> OTHER INFORMATION: X = I or L or P
or T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (15)..(15) <223> OTHER INFORMATION: X =
I or F or S or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (16)..(16) <223> OTHER
INFORMATION: X = T or M or R or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (17)..(17) <223>
OTHER INFORMATION: X = K or D or E or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (18)..(18)
<223> OTHER INFORMATION: X = P or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (19)..(19)
<223> OTHER INFORMATION: X = P or S or N <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: X = R or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (22)..(22)
<223> OTHER INFORMATION: X = K or T or S or N <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(23)..(23) <223> OTHER INFORMATION: X = A or Y or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (25)..(25) <223> OTHER INFORMATION: X = I or L or Q
or H <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (26)..(26) <223> OTHER INFORMATION: X =
S or K or T or N <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (28)..(28) <223> OTHER
INFORMATION: X = K or G <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (30)..(30) <223> OTHER
INFORMATION: X = T or S or I or V <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (31)..(31) <223>
OTHER INFORMATION: X = D or G <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (33)..(33) <223>
OTHER INFORMATION: X = H or R or N <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (35)..(35) <223>
OTHER INFORMATION: X = S or P or R <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (36)..(36) <223>
OTHER INFORMATION: X = K or W or A or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (37)..(37)
<223> OTHER INFORMATION: X = I or L or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (38)..(38)
<223> OTHER INFORMATION: X = L or Q or P or R <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(39)..(39) <223> OTHER INFORMATION: X = R or P <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(40)..(40) <223> OTHER INFORMATION: X = R or K <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(42)..(42) <223> OTHER INFORMATION: X = L or F <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(45)..(45) <223> OTHER INFORMATION: X = K or S or R
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (46)..(46) <223> OTHER INFORMATION: X = A or Y or V
<400> SEQUENCE: 58 Xaa Xaa Cys Xaa Xaa Xaa Ser Xaa Xaa Phe
Xaa Gly Xaa Cys Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys
Xaa Xaa Glu Xaa Phe Xaa Xaa Gly 20 25 30 Xaa Cys Xaa Xaa Xaa Xaa
Xaa Xaa Cys Xaa Cys Thr Xaa Xaa Cys 35 40 45 <210> SEQ ID NO
59 <211> LENGTH: 32 <212> TYPE: PRT <213>
ORGANISM: Artificial sequence <220> FEATURE: <223>
OTHER INFORMATION: Synthetic construct: consensus sequence of
internal domain of defensin <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (2)..(2) <223>
OTHER INFORMATION: X = A or G or K <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (3)..(3) <223>
OTHER INFORMATION: X = R or N or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (5)..(5) <223>
OTHER INFORMATION: X = L or I or M <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (6)..(6) <223>
OTHER INFORMATION: X = C or F or R <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (7)..(7) <223>
OTHER INFORMATION: X = F or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (8)..(8) <223>
OTHER INFORMATION: X = M or F or I <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (9)..(9) <223>
OTHER INFORMATION: X = A or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (10)..(10) <223>
OTHER INFORMATION: X = F or T or A <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (11)..(11) <223>
OTHER INFORMATION: X = A or L or V or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: X = I or V or L or F <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(13)..(13) <223> OTHER INFORMATION: X = L or I <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(14)..(14) <223> OTHER INFORMATION: X = A or I or M
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (15)..(15) <223> OTHER INFORMATION: X = M or A or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (16)..(16) <223> OTHER INFORMATION: X = M or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (17)..(17) <223> OTHER INFORMATION: X = L or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (18)..(18) <223> OTHER INFORMATION: X = F or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (19)..(19)
<223> OTHER INFORMATION: X = V or T or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (20)..(20)
<223> OTHER INFORMATION: X = A or T or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: X = Y or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (22)..(22)
<223> OTHER INFORMATION: X = E or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (23)..(23)
<223> OTHER INFORMATION: X = V or M <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (24)..(24)
<223> OTHER INFORMATION: X = no amino acid or G <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(25)..(25) <223> OTHER INFORMATION: X = no amino acid or P
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (26)..(26) <223> OTHER INFORMATION: X = no amino
acid or M or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (27)..(27) <223> OTHER
INFORMATION: X = no amino acid or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (28)..(28)
<223> OTHER INFORMATION: X = no amino acid or I or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (29)..(29) <223> OTHER INFORMATION: X = no amino
acid or A or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (30)..(30) <223> OTHER
INFORMATION: X = Q or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (32)..(32) <223> OTHER
INFORMATION: X = no amino acid or Q <400> SEQUENCE: 59 Met
Xaa Xaa Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10
15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ala Xaa
20 25 30 <210> SEQ ID NO 60 <211> LENGTH: 33
<212> TYPE: PRT <213> ORGANISM: Artificial sequence:
Synthetic construct: consensus sequence of C-terminal domain of
defensin <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (1)..(1) <223> OTHER INFORMATION: X =
no amino acid or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (2)..(2) <223> OTHER
INFORMATION: X = no amino acid or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: X = no amino acid or D <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(4)..(4) <223> OTHER INFORMATION: X = no amino acid or E or K
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (5)..(5) <223> OTHER INFORMATION: X = no amino acid
or K or I <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (6)..(6) <223> OTHER INFORMATION: X =
no amino acid or M or S <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (7)..(7) <223> OTHER
INFORMATION: X = no amino acid or T or I or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: X = no amino acid or K or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (9)..(9) <223> OTHER INFORMATION: X = no amino acid
or T or V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (10)..(10) <223> OTHER INFORMATION: X =
no amino acid or G or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (11)..(11) <223> OTHER
INFORMATION: X = no amino acid or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (12)..(12)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(13)..(13) <223> OTHER INFORMATION: X = no amino acid or I or
T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (14)..(14) <223> OTHER INFORMATION: X =
no amino acid or L <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (15)..(15) <223> OTHER
INFORMATION: X = no amino acid or A or V or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (16)..(16)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(17)..(17) <223> OTHER INFORMATION: X = no amino acid or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (18)..(18) <223> OTHER INFORMATION: X = no amino
acid or A <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (19)..(19) <223> OTHER INFORMATION: X =
no amino acid or K <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (20)..(20) <223> OTHER
INFORMATION: X = no amino acid or T <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (21)..(21)
<223> OTHER INFORMATION: X = no amino acid or L <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(22)..(22) <223> OTHER INFORMATION: X = no amino acid or A or
S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (23)..(23) <223> OTHER INFORMATION: X =
no amino acid or A or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (24)..(24) <223> OTHER
INFORMATION: X = no amino acid or A or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (25)..(25)
<223> OTHER INFORMATION: X = no amino acid or L or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (26)..(26) <223> OTHER INFORMATION: X = no amino
acid or L <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (27)..(27) <223> OTHER INFORMATION: X =
no amino acid or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (28)..(28) <223> OTHER
INFORMATION: X = no amino acid or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (29)..(29)
<223> OTHER INFORMATION: X = no amino acid or E <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(30)..(30) <223> OTHER INFORMATION: X = no amino acid or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (31)..(31) <223> OTHER INFORMATION: X = no amino
acid or M <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (32)..(32) <223> OTHER INFORMATION: X =
no amino acid or D or M <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (33)..(33) <223> OTHER
INFORMATION: X = no amino acid or N or E <400> SEQUENCE: 60
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5
10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 20 25 30 Xaa <210> SEQ ID NO 61 <211> LENGTH: 112
<212> TYPE: PRT <213> ORGANISM: Artificial sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
construct: consensus sequence of defensin <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (2)..(2)
<223> OTHER INFORMATION: X = A or G or K <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (3)..(3)
<223> OTHER INFORMATION: X = R or N or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (5)..(5)
<223> OTHER INFORMATION: X = L or I or M <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (6)..(6)
<223> OTHER INFORMATION: X = C or F or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (7)..(7)
<223> OTHER INFORMATION: X = F or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (8)..(8)
<223> OTHER INFORMATION: X = M or F or I <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (9)..(9)
<223> OTHER INFORMATION: X = A or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (10)..(10)
<223> OTHER INFORMATION: X = F or T or A <220> FEATURE:
<221> NAME/KEY: misc_feature
<222> LOCATION: (11)..(11) <223> OTHER INFORMATION: X =
A or L or V or F <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (12)..(12) <223> OTHER
INFORMATION: X = I or V or L or F <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (13)..(13) <223>
OTHER INFORMATION: X = L or I <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (14)..(14) <223>
OTHER INFORMATION: X = A or I or M <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (15)..(15) <223>
OTHER INFORMATION: X = M or A or F <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (16)..(16) <223>
OTHER INFORMATION: X = M or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (17)..(17) <223>
OTHER INFORMATION: X = L or I <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (18)..(18) <223>
OTHER INFORMATION: X = F or V <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (19)..(19) <223>
OTHER INFORMATION: X = V or T or L <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (20)..(20) <223>
OTHER INFORMATION: X = A or T or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (21)..(21) <223>
OTHER INFORMATION: X = Y or T <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (22)..(22) <223>
OTHER INFORMATION: X = E or G <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (23)..(23) <223>
OTHER INFORMATION: X = V or M <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (24)..(24) <223>
OTHER INFORMATION: X = no amino acid or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (25)..(25)
<223> OTHER INFORMATION: X = no amino acid or P <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(26)..(26) <223> OTHER INFORMATION: X = no amino acid or M or
V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (27)..(27) <223> OTHER INFORMATION: X =
no amino acid or T <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (28)..(28) <223> OTHER
INFORMATION: X = no amino acid or I or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (29)..(29)
<223> OTHER INFORMATION: X = no amino acid or A or V
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (30)..(30) <223> OTHER INFORMATION: X = Q or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (32)..(32) <223> OTHER INFORMATION: X = no amino
acid or Q <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (33)..(33) <223> OTHER INFORMATION: X =
R or Q <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (34)..(34) <223> OTHER INFORMATION: X =
E or I or T <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (36)..(36) <223> OTHER INFORMATION: X =
K or E <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (37)..(37) <223> OTHER INFORMATION: X =
T or A or S <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (38)..(38) <223> OTHER INFORMATION: X =
E or P or Q <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (40)..(40) <223> OTHER INFORMATION: X =
N or Q or H <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (41)..(41) <223> OTHER INFORMATION: X =
T or R <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (43)..(43) <223> OTHER INFORMATION: X =
P or K or H <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (45)..(45) <223> OTHER INFORMATION: X =
I or L or P or T <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (47)..(47) <223> OTHER
INFORMATION: X = I or F or S or V <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (48)..(48) <223>
OTHER INFORMATION: X = T or M or R or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (49)..(49)
<223> OTHER INFORMATION: X = K or D or E or A <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(50)..(50) <223> OTHER INFORMATION: X = P or S <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(51)..(51) <223> OTHER INFORMATION: X = P or S or N
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (53)..(53) <223> OTHER INFORMATION: X = R or A
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (54)..(54) <223> OTHER INFORMATION: X = K or T or S
or N <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (55)..(55) <223> OTHER INFORMATION: X =
A or Y or V <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (57)..(57) <223> OTHER INFORMATION: X =
I or L or Q or H <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (58)..(58) <223> OTHER
INFORMATION: X = S or K or T or N <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (60)..(60) <223>
OTHER INFORMATION: X = K or G <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (62)..(62) <223>
OTHER INFORMATION: X = T or S or I or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (63)..(63)
<223> OTHER INFORMATION: X = D or G <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (65)..(65)
<223> OTHER INFORMATION: X = H or R or N <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (67)..(67)
<223> OTHER INFORMATION: X = S or P or R <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (68)..(68)
<223> OTHER INFORMATION: X = K or W or A or G <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(69)..(69) <223> OTHER INFORMATION: X = I or L or F
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (70)..(70) <223> OTHER INFORMATION: X = L or Q or P
or R <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (71)..(71) <223> OTHER INFORMATION: X =
R or P <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (72)..(72) <223> OTHER INFORMATION: X =
R or K <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (74)..(74) <223> OTHER INFORMATION: X =
L or F <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (77)..(77) <223> OTHER INFORMATION: X =
K or S or R <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (78)..(78) <223> OTHER INFORMATION: X =
P or N or H <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (80)..(80) <223> OTHER INFORMATION: X =
no amino acid or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (81)..(81) <223> OTHER
INFORMATION: X = no amino acid or F <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (82)..(82)
<223> OTHER INFORMATION: X = no amino acid or D <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(83)..(83) <223> OTHER INFORMATION: X = no amino acid or E or
K <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (84)..(84) <223> OTHER INFORMATION: X =
no amino acid or K or I <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (85)..(85) <223> OTHER
INFORMATION: X = no amino acid or M or S <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (86)..(86)
<223> OTHER INFORMATION: X = no amino acid or T or I or S
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (87)..(87) <223> OTHER INFORMATION: X = no amino
acid or K or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (88)..(88) <223> OTHER
INFORMATION: X = no amino acid or T or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (89)..(89)
<223> OTHER INFORMATION: X = no amino acid or G or K
<220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (90)..(90)
<223> OTHER INFORMATION: X = no amino acid or A <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(91)..(91) <223> OTHER INFORMATION: X = no amino acid or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (92)..(92) <223> OTHER INFORMATION: X = no amino
acid or I or T <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (93)..(93) <223> OTHER
INFORMATION: X = no amino acid or L <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (94)..(94)
<223> OTHER INFORMATION: X = no amino acid or A or V or G
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (95)..(95) <223> OTHER INFORMATION: X = no amino
acid or E <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (96)..(96) <223> OTHER INFORMATION: X =
no amino acid or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (97)..(97) <223> OTHER
INFORMATION: X = no amino acid or A <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (98)..(98)
<223> OTHER INFORMATION: X = no amino acid or K <220>
FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION:
(99)..(99) <223> OTHER INFORMATION: X = no amino acid or T
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (100)..(100) <223> OTHER INFORMATION: X = no amino
acid or L <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (101)..(101) <223> OTHER INFORMATION: X
= no amino acid or A or S <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (102)..(102)
<223> OTHER INFORMATION: X = no amino acid or A or E
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (103)..(103) <223> OTHER INFORMATION: X = no amino
acid or A or V <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (104)..(104) <223> OTHER
INFORMATION: X = no amino acid or L or V <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(105)..(105) <223> OTHER INFORMATION: X = no amino acid or L
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (106)..(106) <223> OTHER INFORMATION: X = no amino
acid or E <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (107)..(107) <223> OTHER INFORMATION: X
= no amino acid or E <220> FEATURE: <221> NAME/KEY:
misc_feature <222> LOCATION: (108)..(108) <223> OTHER
INFORMATION: X = no amino acid or E <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION:
(109)..(109) <223> OTHER INFORMATION: X = no amino acid or I
<220> FEATURE: <221> NAME/KEY: misc_feature <222>
LOCATION: (110)..(110) <223> OTHER INFORMATION: X = no amino
acid or M <220> FEATURE: <221> NAME/KEY: misc_feature
<222> LOCATION: (111)..(111) <223> OTHER INFORMATION: X
= no amino acid or D or M <220> FEATURE: <221>
NAME/KEY: misc_feature <222> LOCATION: (112)..(112)
<223> OTHER INFORMATION: X = no amino acid or N or E
<400> SEQUENCE: 61 Met Xaa Xaa Ser Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Ala Xaa 20 25 30 Xaa Xaa Cys Xaa Xaa Xaa
Ser Xaa Xaa Phe Xaa Gly Xaa Cys Xaa Xaa 35 40 45 Xaa Xaa Xaa Cys
Xaa Xaa Xaa Cys Xaa Xaa Glu Xaa Phe Xaa Xaa Gly 50 55 60 Xaa Cys
Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Cys Thr Xaa Xaa Cys Xaa 65 70 75 80
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85
90 95 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 100 105 110 <210> SEQ ID NO 62 <211> LENGTH: 47
<212> TYPE: PRT <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Synthetic
construct: consensus sequence of defensin <220> FEATURE:
<221> NAME/KEY: misc_feature <222> LOCATION: (1)..(46)
<223> OTHER INFORMATION: X is any amino acid. X is depicted
as a in the text. <400> SEQUENCE: 62 Xaa Xaa Cys Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa 1 5 10 15 Xaa Xaa Xaa Cys
Xaa Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Xaa Cys
Xaa Xaa Xaa Xaa Xaa Xaa Cys Xaa Cys Xaa Xaa Xaa Cys 35 40 45
* * * * *