U.S. patent application number 11/872664 was filed with the patent office on 2009-03-12 for compositions and methods for performing reverse gene therapy.
Invention is credited to Denise Y. Burton, Robert J. Levy.
Application Number | 20090068745 11/872664 |
Document ID | / |
Family ID | 32179570 |
Filed Date | 2009-03-12 |
United States Patent
Application |
20090068745 |
Kind Code |
A1 |
Levy; Robert J. ; et
al. |
March 12, 2009 |
COMPOSITIONS AND METHODS FOR PERFORMING REVERSE GENE THERAPY
Abstract
The invention relates to compositions and methods for reverse
gene therapy, wherein a gene therapy vector encoding a gene product
(e.g. a protein) which is usually only expressed in cells of an
abnormal tissue is delivered to a cell of an animal afflicted with
a disease or disorder to alleviate the disease or disorder. In one
embodiment, a plasmid vector encoding HERG (A561V) protein is
delivered to a cell of an animal afflicted with re-entrant atrial
flutter-mediated cardiac arrhythmia.
Inventors: |
Levy; Robert J.; (Merion
Station, PA) ; Burton; Denise Y.; (Bensalem,
PA) |
Correspondence
Address: |
DANN, DORFMAN, HERRELL & SKILLMAN
1601 MARKET STREET, SUITE 2400
PHILADELPHIA
PA
19103-2307
US
|
Family ID: |
32179570 |
Appl. No.: |
11/872664 |
Filed: |
October 15, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10422551 |
Jul 31, 2003 |
7282489 |
|
|
11872664 |
|
|
|
|
09487851 |
Jan 19, 2000 |
6852704 |
|
|
10422551 |
|
|
|
|
60116539 |
Jan 19, 1999 |
|
|
|
Current U.S.
Class: |
435/459 ;
435/320.1; 435/455 |
Current CPC
Class: |
A61K 9/1647 20130101;
A61K 48/005 20130101; A61K 48/00 20130101; A61K 48/0025 20130101;
A61K 9/5153 20130101; A61K 31/7048 20130101; A61K 38/177 20130101;
A61K 48/0041 20130101 |
Class at
Publication: |
435/459 ;
435/455; 435/320.1 |
International
Class: |
C12N 15/87 20060101
C12N015/87; C12N 15/09 20060101 C12N015/09; C12N 15/79 20060101
C12N015/79 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SUPPORTED RESEARCH AND
DEVELOPMENT
[0002] Pursuant to 35 U.S.C. .sctn.202(c) it is acknowledged that
the U.S. Government has certain rights in the invention described
herein, which was made in part with funds from the National Heart,
Lung and Blood Institute, Grant number HL41663.
Claims
1-20. (canceled)
21. A method of alleviating a disease or disorder in an affected
tissue, said method comprising locally delivering to the tissue, a
reverse gene therapy vector, said vector contained within a cell,
said vector comprising a promoter operably linked with a nucleic
acid encoding a therapeutic gene product which is usually only
expressed in cells of an abnormal tissue that is not afflicted with
the disease or disorder, whereby delivery of said cell containing
said reverse gene therapy vector to the affected tissue alleviates
the disease or disorder.
22. The method of claim 21, wherein said therapeutic gene product
is a protein.
23. The method of claim 22, wherein said protein is Q9E-hMirp1.
24. The method of claim 22, wherein said cell is a mesenchymal stem
cell.
25. The method of claim 24, wherein said stem cell is an embryonic
pluripotent stem cell and said protein is selected from the group
consisting of an apoptosis-inducing protein, transcription factor
E2F1, tenascin C, bone morphogenic protein, a protein involved in
synthesis of a glycosaminoglycan, a dominant negative mutant
receptor protein, transcription factor NF-ATc, and a degradation
resistant collagen protein.
26. The method of claim 23, wherein activity of said Q9E-hMirp1 is
modulated via administration of clarithromycin.
27. The method of claim 24, wherein activity of said Q9E-hMirp1 is
modulated via administration of clarithromycin.
28. The method of claim 21, wherein said reverse gene therapy
vector is selected from the group consisting of naked DNA, a
plasmid, a condensed nucleic acid, and a virus vector comprising a
nucleic acid.
29. The method of claim 24, wherein said stem cell is selected from
the group consisting of a hematopoietic stem cells, pluripotent
embryonic stem cells, skin stem cells and mesenchymal stem
cells.
30. The method of claim 28, wherein said condensed nucleic acid
comprises a DNA molecule and a polycationic condensing agent.
31. The method of claim 30, wherein said polycationic condensing
agent is selected from the group consisting of poly-L-lysine and
Ca.sup.2+ ions.
32. The method of claim 21, wherein said reverse gene therapy
vector is delivered to the afflicted tissue in a form selected from
a particle comprising said vector, a microparticle comprising said
particle, a nanoparticle comprising said vector, an implantable
device having a surface coated with a matrix comprising said
vector, and a bulk material comprising said vector.
33. The method of claim 32, wherein said implantable device
comprises an electrode located in close proximity to a myocardial
tissue of the animal.
34. The method of claim 33, wherein the myocardial tissue is right
atrial myocardium.
35. A reverse gene therapy vector as shown in FIG. 10.
Description
[0001] This application is a continuation-in-part application of
U.S. patent application Ser. No. 09/487,851, filed Jan. 19, 1999,
and also claims priority to U.S. Provisional 60/374,840 filed Apr.
24, 2002, the entire disclosures of each being incorporated by
reference herein.
FIELD OF THE INVENTION
[0003] The present invention relates to the fields of medicine and
gene therapy. More specifically, the present invention relates to
an adaptation of gene therapy to the field of tissue engineering.
In particular, the invention concerns the use of cells that can
generate tissue in vivo ("progenitor cells") as the means for
effecting so-called reverse gene therapy (RGT), an approach
generally described in PCT application WO 200041731 A1.
BACKGROUND OF THE INVENTION
[0004] Re-entrant atrial flutter is a disease condition which
affects many individuals. Electrophysiologic mapping techniques
have lead to an enhanced understanding re-entrant atrial
arrhythmias, and these advances have led to attempts to develop
ablation procedures which destructively block conduction in
myocardial regions involved in re-entry (Natale et al., 1996, Am.
J. Cardiol. 78:1431-1433; Frame et al., 1996, Pacing Clin.
Electrophysiol. 19:965-975; Cosio et al., 1996, Arch. Mal. Coeur
Vaiss. 1:75-81; Cox et al., 1995, J. Thorac. Cardiovasc. Surg.
110:485-495; Cox et al., 1993, Ann. Thorac. Surg. 56:814-823; Cox
et al., 1996, J. Thorac. Cardiovasc. Surg. 112:898-907).
[0005] Atrial fibrillation and atrial flutter are emerging as major
clinical and public health problems for a number of reasons. The
high incidence of atrial arrhythmias in the increasingly-aged
population has resulted in the number of patients afflicted with
atrial fibrillation or atrial flutter increasing into the millions
(Prystowsky et al., 1996, Circulation 93:1262-1277; Anderson et
al., 1996, Am. J. Cardiol. 78:17-21; Camm et al., 1996, Am. J.
Cardiol. 78:3-11). In addition, atrial fibrillation and atrial
flutter have been noted to occur very commonly following cardiac
surgery, especially following coronary artery bypass surgery (Cox,
1993, Ann. Thorac. Surg. 56:405-409; Balaji et al., 1994, Am. J.
Cardiol. 73:828-829; Balaji et al., 1994, J. Am. Coll. Cardiol.
23:1209-1215; Gandhi et al., 1996, Ann. Thorac. Surg.
61:1299-1309).
[0006] A number of mechanisms have been investigated to explain
atrial arrhythmias, and are the basis for the conventional
therapeutic approach. Re-entrant phenomena are thought to most
often be the basis for atrial flutter (Gandhi et al., 1996, Ann.
Thorac. Surg. 61:1666-1678; Frame et al., 1986, Circ. Res.
58:495-511; Frame et al., 1987, Circulation 5:1155-1175; Boyden et
al., 1989, Circulation 79:406-416; Cosio et al., 1993, Lancet
341:1189-1193). Medications that slow atrial conduction or block
down conduction through the AV-node have been useful for treatment
of atrial arrhythmias (Waldo, 1994, Clin. Cardiol. 17:1121-1126,
1994; Wells et al., 1979, Circulation 60:665-673; Antman, 1996, Am.
J. Cardiol. 78:67-72; Cochrane et al., 1996, Drug Ther. Bull.
34:41-45; Roden et al., 1996, Annu. Rev. Med. 47:135-48). Atrial
fibrillation is believed often to result from a coalescence of
multiple wavelets of impulse conduction (Moe, 1962, Arch. Int.
Pharmacodyn. 1-2:183-188; Waldo, 1990, Circulation 81:1142-1143),
and recent investigations have suggested that conditioned
fibrillating atrium begets further atrial fibrillation (Salmon et
al., 1985, Circulation 72(Suppl III):111-250; Morillo et al., 1995,
Circulation 91:1588-1595; Wijffels et al., 1995, Circulation
92:1954-1968).
Gene Therapy
[0007] Gene therapy is generally understood to refer to techniques
designed to deliver nucleic acids, including antisense DNA and RNA,
ribozymes, viral fragments and functionally active therapeutic
genes into targeted cells (Culver, 1994, Gene Therapy: A Handbook
for Physicians, Mary Ann Liebert, Inc., New York, N.Y.). Such
nucleic acids may themselves be therapeutic, as for example
antisense DNAs that inhibit mRNA translation, or they may encode,
for example, therapeutic proteins that promote, inhibit, augment,
or replace cellular functions.
[0008] Virus vectors are among the most efficient gene therapy
vectors which have been demonstrated. However, virus vectors
sometimes elicit an immune response in the gene therapy host, which
can inhibit the therapeutic benefit provided by the vector.
Furthermore, use of retrovirus vectors can result in integration of
the nucleic acid of the vector into the genome of the host,
potentially causing harmful mutations. `Naked` nucleic acid
vectors, such as linear DNA vectors and plasmids, do not generally
induce an immune response or integrate into the host genome, but
are taken up and expressed by host cells less effectively than
virus vectors.
[0009] Among the shortcomings of current gene therapy strategies,
including both ex vivo and in vivo gene therapy methods, is a
dearth of appropriate nucleic acids for delivery to diseased or
otherwise abnormal cells. Gene therapy methods have typically
involved delivery of either a nucleic acid which is or which
encodes a normal (i.e. wild type) component of a cell of the type
to which the nucleic acid is delivered, an antisense
oligonucleotide which inhibits or prevents transcription or
translation of a nucleic acid in the diseased or abnormal cells, or
a ribozyme which specifically cleaves a nucleic in the diseased or
abnormal cells. Although these nucleic acids may be effective in
certain instances, a serious need remains for additional nucleic
acids and compositions comprising the same which, when delivered to
diseased or abnormal cells, alleviate, prevent, or reverse the
disease or abnormality.
BRIEF SUMMARY OF THE INVENTION
[0010] The invention relates to a method of alleviating a disease
or disorder in an affected animal cell. The method comprises
locally delivering to the cell a reverse gene therapy vector
comprising a promoter operably linked with a nucleic acid encoding
a therapeutic gene product which is usually only expressed in cells
of an abnormal tissue that is not afflicted with the disease or
disorder. Delivery of the reverse gene therapy vector to the
affected cell alleviates the disease or disorder.
[0011] In one aspect of this method, the therapeutic gene product
is a protein, such as one selected from the group consisting of a
defective HERG protein, a mutated subunit of HERG, Q9E-hMirp1, an
apoptosis-inducing protein, transcription factor E2F1, tenascin C,
bone morphogenic protein, a protein involved in synthesis of a
glycosaminoglycan, a dominant negative mutant receptor protein,
transcription factor NF-ATc, and a degradation resistant collagen
protein. Preferably, the protein is either a defective subunit of
the HERG protein, Q9E-hMirp1, or HERG (A561V) protein.
[0012] In another aspect of the method, the reverse gene therapy
vector is selected from the group consisting of naked DNA, a
plasmid, a condensed nucleic acid, and a virus vector comprising a
nucleic acid. The reverse gene therapy vector may, for example, be
a virus vector, such as an adenovirus vector, or a condensed
nucleic acid. When a condensed nucleic acid reverse gene therapy
vector is used, it may comprise a DNA molecule and a polycationic
condensing agent.
[0013] In still another aspect of the method, the reverse gene
therapy vector is a plasmid.
[0014] The polycationic condensing agent used in the method of the
invention may, for example, be selected from the group consisting
of poly-L-lysine and Ca.sup.2+ ions. The promoter may be any
promoter, including a constitutive promoter such as a CMV promoter
or a tissue-specific promoter such as a cardiac tissue-specific
promoter (e.g. the ANF promoter, the .alpha.-MyHC promoter, or the
wild type HERG promoter).
[0015] The reverse gene therapy vector used in the method of the
invention may further comprise a pharmacological agent-sensitive
enhancer, such as a phorbol ester-sensitive enhancer. The reverse
gene therapy vector may also, or alternatively, further comprise a
Cre-recombinase-sensitive site.
[0016] According to the method of the invention, the reverse gene
therapy vector may be delivered to the cell in a sustained-release
manner. Such delivery methods may, for example, comprise delivering
the reverse gene therapy vector to the cell in a form selected from
a particle comprising the vector, a microparticle comprising the
particle, a nanoparticle comprising the vector, an implantable
device having a surface coated with a matrix comprising the vector,
or a bulk material comprising the vector. The implantable device
may, for example, comprise an electrode located in close proximity
to a myocardial tissue of the animal, such as right atrial
myocardium.
[0017] In one embodiment of the method of the invention, the cell
is located outside the body of the animal. The cell may, for
example, be a cultured cell, such as a cultured cell which is
subsequently returned to the body of the animal from which the cell
was obtained or is subsequently returned to the body of a second
animal other than the animal from which the cell was obtained.
[0018] In another embodiment of the method of the invention, the
cell is located inside the body of the animal. For example, the
cell may be located in a cardiac tissue of the animal, such as a
myocardial cell (e.g. a right atrial myocardium cell). The animal
may be one which is afflicted with re-entry atrial flutter, in
which event the therapeutic gene product is preferably a defective
HERG protein, such as HERG (A561V) protein. Also preferably, the
protein is operably linked with a cardiac tissue-specific promoter,
such as one selected from the group consisting of the ANF promoter
and the .alpha.-MyHC promoter.
[0019] The invention also relates to a reverse gene therapy vector
for alleviating a disease or disorder in an affected cell. The
vector comprises a promoter operably linked with a nucleic acid
encoding a therapeutic gene product which is normally only
expressed in cells of an abnormal tissue that is not afflicted with
the disease or disorder. Delivery of the vector to the affected
cell alleviates the disease or disorder.
[0020] In one aspect, the therapeutic gene product is a protein,
such as one selected from the group consisting of a defective HERG
protein, a subunit of HERG, Q9E-hMirp1, an apoptosis-inducing
protein, transcription factor E2F1, tenascin C, bone morphogenic
protein, a protein involved in synthesis of a glycosaminoglycan, a
dominant negative mutant receptor protein, transcription factor
NF-ATc, and a degradation resistant collagen protein. When the
protein is a defective HERG protein, it is preferably HERG (A561V)
protein or Q9E-hMirp1.
[0021] In another aspect of the reverse gene therapy vector of the
invention, the vector is selected from the group consisting of
naked DNA, a plasmid, a condensed nucleic acid, and a virus vector
comprising a nucleic acid. In one embodiment, the vector is a virus
vector such as an adenovirus vector. In another embodiment, the
vector is a condensed nucleic acid, such as one comprising a DNA
molecule and a polycationic condensing agent. In still another
embodiment, the gene therapy vector is a plasmid.
[0022] The polycationic condensing agent of the reverse gene
therapy vector of the invention may, for example, be selected from
the group consisting of poly-L-lysine and Ca.sup.2+ ions.
[0023] The promoter used in the reverse gene therapy vector of the
invention, may be substantially any promoter, including a
constitutive promoter such as a CMV promoter or a tissue-specific
promoter such as a cardiac tissue-specific promoter (e.g. the ANF
promoter, the .alpha.-MyHC promoter, and the wild type HERG
promoter).
[0024] The reverse gene therapy vector of the invention may further
comprise a pharmacological agent-sensitive enhancer, such as a
phorbol ester-sensitive enhancer. The reverse gene therapy vector
may also, or alternatively, comprising a Cre-recombinase-sensitive
site.
[0025] The invention also includes a particle, a microparticle, or
a nanoparticle comprising the reverse gene therapy vector of the
invention.
[0026] The invention further includes an implantable device
comprising the reverse gene therapy vector of the invention, such
as one having a surface coated with a matrix comprising the reverse
gene therapy vector.
[0027] The present invention expands upon previously described RGT
methods and provides the means for cell-based delivery and tissue
engineering.
[0028] In yet another aspect of the invention, the method involves
providing a plurality of progenitor cells, at least some of which
comprise a disease-related polynucleotide, such that cells of the
plurality express the polynucleotide; and introducing an effective
amount of the plurality at the diseased site.
[0029] In a preferred embodiment, tissue develops at the diseased
site which exhibits a phenotype imparted by the polynucleotide. In
a more preferred embodiment, the phenotype counters or masks an
effect of the disease at the diseased site.
[0030] In another preferred embodiment, the plurality of progenitor
cells is made up of pluripotent embryonic stem cells, neuronal stem
cells, hematopoietic stem cells, or skin stem cells.
[0031] In an even more preferred embodiment, the progenitor cells
are mesenchymal stem cells or cells that have differentiated from
mesenchymal stem cells. Mesenchymal stem cells expressing wt hMirp1
and the Q9E-hMirp1 and methods of use thereof are also encompassed
by the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1 is a bar graph which indicates inducibility of atrial
flutter in dogs implanted with epicardial pacing electrodes, as
described herein.
[0033] FIG. 2 is a graph which indicates the proportion of DNA
released from PLGA copolymer microparticles, as described
herein.
[0034] FIG. 3 is a bar graph which indicates luciferase activity in
type 293 cells transformed using DNA-containing PLGA copolymer
microparticles, as described herein.
[0035] FIG. 4, comprising FIGS. 4A, 4B, and 4C is a trio of graphs
which indicate properties of DNA-containing PLGA copolymer
nanoparticles, as described herein. FIGS. 4A and 4B are graphs
which indicate the amount of DNA released from these nanoparticles
when they were incubated in vitro in TE buffer which did or did not
contain SDS. FIG. 4C is a bar graph which indicates luciferase
activity in type 293 cells transformed using DNA-containing PLGA
copolymer nanoparticles.
[0036] FIG. 5 is a graph which indicates in vitro release of DNA
from a suture coated with a DNA-PLGA emulsion, as described
herein.
[0037] FIG. 6 is a graph which indicates alkaline phosphatase
activity detected in wounded tissue obtained from wound sites
closed using either a DNA-PLGA-coated suture or a non-coated
(control) suture.
[0038] FIG. 7 is a bar graph which indicates alkaline phosphatase
activity detected in atrial tissue obtained from dogs in which an
atriotomy incision was made and repaired using either a
DNA-PLGA-coated suture or a non-coated (control) suture. Individual
dogs are designated `A` and `B` for each suture type. "Blank"
indicates myocardial tissue not injected with DNA.
[0039] FIG. 8 is a diagram which depicts placement of epicardial
electrodes in a dog, as described herein.
[0040] FIG. 9 is a diagram which depicts placement of electrodes in
the vicinity of the tricuspid annulus of a dog, as described
herein.
[0041] FIG. 10: Schematic diagram of pIRES2-EGFP expression vector.
The pIRES2-EGFP expression vector (Clontech) possesses an internal
ribosome entry site (IRES) of the encephalomyocarditis virus (ECMV)
that is located between the multiple cloning site (MCS) and the
enhanced green fluorescent protein (EGFP) coding region. Therefore,
this enables the translation of either hMiRP1 or Q9E-hMiRP1 and
EGFP. The genes of interest, either hMiRP1 or Q9E-hMiRP1, were
subcloned into the multiple cloning site utilizing restriction
endonucleases SACI and BAMHI. A FLAG epitope was attached at the
carboxy terminus of both hMiRP1 and Q9E-hMiRP1 to facilitate
anti-FLAG immunodetection methods.
[0042] FIG. 11: Over-expression of hMiRP1 and Q9E-hMiRP1 in stably
transfected HEK293 and SH-SY5Y cell lines as shown by RT-PCR. (A).
A composite gel stained with ethidium bromide. HEK293 cells results
with: Lane (1) negative control (water) (2) derived from RNA from
untransfected cells, or from (3) hMiRP1 and (4) Q9E-hMiRP1
transfected cells. Lanes (5-7), GAPDH controls for respective
samples. SH-SY5Y cell results: Lane (8) untransfected cells, (9)
negative reagent control, (10) Q9E-hMiRP1 and (11) hMiRP1
transfected cells. Lanes (12-14), GAPDH controls for respective
samples 9-11. (B). Representative LightCycler real time RT-PCR
assays for detection of the hMiRP1 gene with SYBR Green I
Fluorescence (FI). Shown are the results from 4 HEK293 samples,
where Line (b) indicates a Q9E-hMiRP1 DNA preparation with a
relatively high concentration of target DNA, line (c) indicates
hMiRP1, line (a) indicates a positive plasmid control, and line (d)
indicates a negative control. Also shown are the results from 4
SH-SY5Y samples: Where Line (b) indicates a Q9E-hMiRP1 DNA
preparation with a relatively high concentration of target DNA,
line (a) indicates hMiRP1, line (c) indicates a positive plasmid
control using the plasmid containing the (MiRP1 gene), and line (d)
indicates a negative control.
[0043] FIG. 12: Western blot analyses of wild type hMiRP1 and
Q9E-hMiRP1, each with a C-terminus FLAG epitope in transfected (A)
HEK293 cells and SH-SY5Y cells. The arrows indicate the 23 kDa FLAG
tag and the 43 kDa .beta.-actin loading control. (B) Densitometric
analysis of western blots documented hMiRP1 and Q9E-h-MiRP1 in
HEK293 and SH-SY5Y cells. All data were normalized to .beta.-actin
loading control. Results are expressed as the ratio
hMiRP1/.beta.-actin for each cell type (AU: arbitrary units).
Levels of hMiRP1- and Q9E-hMiRP1 FLAG-tagged protein were
significantly elevated compared to control in all cases
(p<0.05).
[0044] FIG. 13: SH-SY5Y and HEK293 cells stably expressing green
fluorescent protein (GFP) and FLAG-tagged hMiRP1 or Q9E-hMiRP1.
Confocal fluorescent microscopy demonstrates GFP expressing cells
with green cytoplasm (green=FITC) with anti-FLAG localization of
wild type hMiRP1 in the cell membrane using rhodamine-labeled
anti-FLAG antibody for both cell types (A) SH-SY5Y and (B) HEK293,
indicating ion channel localization to the cell membrane. Moreover,
in Q9E-hMiRP1 over-expressing cells (C) SH-SY5Y and (D) HEK293
cells anti-FLAG (rhodamine) immunocytofluorescence demonstrates
cell membrane localization comparable to A & B. (original
magnification 400.times.).
[0045] FIG. 14: Electrophysiological properties associated with
stable expression of Q9E-hMiRP1 (mutant) and wild type hMiRP1 in
transfected HEK293 cells. Q9E-hMiRP1 expressing cells show the
hypothetically predicted increased sensitivity to blockade by
clarithromycin compared to hMiRP1 overexpressing cells. (A): Raw
current traces from a typical HEK293 cell overexpressing
Q9E-hMiRP1; (a) Illustrates the protocol, that begins by holding at
-80 mV, and sampling steady-state activation; this is followed by
prepulse increases in voltage for 3 seconds (s) from -80 to 40 mV
in 10 mV steps, followed by a test pulse for 6 s to -100 mV; the
interpulse interval was 5 s (b) Q9E-hMiRP1 in the absence of
clarithromycin produces outward potassium currents (Control);
however, in the presence of clarithromycin (c) there is a
substantial diminution of potassium currents. Scale bars, 50 pA (y)
and 0.5 s (x), (B) Current (I)-dose relationships at equilibrium
with diminished I/I max with increasing doses of clarithromycin
after activation at +20 mV; filled circles: Q9E-hMiRP1 stable
cells; open triangles: hMiRP1 stable cells. (C) Current-voltage
(mV) relationships as determined in (A) for Q9E-hMiRP1 stable
cells, mean.+-.SEM for groups of 4 cells in the absence (filled
circles) or presence (open circles) of 1.0 mM clarithromycin, which
blocked increases in I/I max with increased voltages.
[0046] FIG. 15: Characterization of DNA antibody heteroplexes and
their transfection mechanism: (A) DNA-anti-DNA antibody-cationic
lipid (DAC) heteroplexes had an initial mean particle diameter of
370.+-.10, with a charge of -15.4.+-.4.5 mV. Both parameters
remained stable for at least one week under simulated physiologic
conditions (pH 7.4, 37.degree. C.). (B) DAC heteroplexes contained
significantly more DNA than did DC lipoplexes (p<0.002). (C) A10
cells transfected with DAC heteroplexes containing Alexa Fluor 568
(red fluorescent) labeled anti-DNA antibody, demonstrated
cytoplasmic and nuclear presence of the anti-DNA antibody, (D) DNA
(rhodamine labeled) and cationic lipid (BIODIPY labeled-green) in
DAC heteroplexes, co-localized as indicated by yellow color both in
the cytoplasm and the nucleus of A10 cells; (E) DC lipoplexes in
comparison to D, illustrating a paucity of nuclear entry. C-E;
confocal fluorescent microscopy, original magnification 400.times.,
all shown 48 hours after transfection. (F) FACS analysis of A10
cells 48 hours after transfection. Cells were trypsinized, pooled,
resuspended, and analyzed for comparison of FITC-labeled DNA uptake
between DAC (red), and DC (blue) mediated transfection as compared
to control (black). A10 cells transfected with DAC contained higher
amounts of labeled DNA than those transfected with DC, 88% vs. 21%
respectively. The result shown is one representative
experiment.
[0047] FIG. 16: Increased transfection of rat arterial smooth
muscle cells (A10) in vitro with DNA antibody heteroplexes: GFP
expressing A10 cells after transfection with either DAC
heteroplexes or DC lipoplexes formulated with the same amount of
DNA (10 .mu.g DNA) (A) Significantly greater GFP expression using
DAC heteroplexes than (B) DC lipoplexes in culture after 72 hours
(A and B, fluorescent micrograph, FITC and DAPI filters, original
magnification 100.times.); (C) Percentage of A10 cells transfected
over time, demonstrating significantly higher GFP expression at all
time points with DAC heteroplexes compared to DC lipoplexes
(p<0.001). (D) FACS analysis of GFP-transfected A10 cells. Cells
(80-90% confluent culture) were trypsinized, pooled, resuspended,
and analyzed after 72 hours for comparison of gene transfer
efficiency between DAC (red), and DC (blue) as compared to control
(black). A greater percentage of A10 cells expressed GFP following
transfection by DAC than by DC: 76% vs. 11.2%; respectively. The
result shown is one representative experiment.
[0048] FIG. 17: Increased transfection in vivo (pig atrial
injections) after 7 days with DAC heteroplexes. (A) Greater
percentages of porcine atrial myocytes were transfected in vivo
with DAC heteroplexes, compared to naked DNA (D), DA, or DC
p<0.001 (DAC, vs. other groups); (B) Expression pattern of GFP
in porcine atrial myocardium after transfection with DC compared to
greater expression (C) using DAC. (B and C), FITC/DAPI merged
fluorescent micrographs, original magnification 200.times..
[0049] FIG. 18: Transfection of porcine atrial myocardium with
hMiRP1 and Q9E-hMiRP1 bicistronic plasmids in DAC: Locally diffuse
expression pattern of GFP-hMiRP1 and GFP-Q9E-hMiRP1 in porcine
atrial myocardium 7 days after transfection; (A) GFP-hMiRP1 and (B)
GFP-Q9E-hMiRP1 (A&B, FITC/DAPI fluorescent micrographs,
original magnification 200.times.). Confirmation of GFP-hMiRP1 and
GFP-Q9E-hMiRP1 expression using anti-GFP immunohistochemistry),
where VIP (purple) staining indicates the GFP expression in the
myocardium for (C) GFP-hMiRP1 and (D)GFP-Q9E-hMiRP1; (E)
representative control, non-specific IgG demonstrating a paucity of
immunoperoxidase staining for GFP. (F) Bar graph indicates the
percentage of cells successfully transfected via the DAC method in
vivo using either the hMiRP1 or Q9E-FLAG tagged bicistronic
vectors. (G): In vivo plasma membrane localization of Q9E-hMiRP1 in
porcine atrial myocardium demonstrated using rhodamine-labeled
anti-FLAG antibody in GFP positive (FITC) myocytes (fluorescent
confocal microscopy, original magnification 600.times.).
[0050] FIG. 19 is a graph showing the changes in monophasic action
potential duration following clarithromycin infusion in pigs
treated with wild-type hMirp1 and Q9E-hMirp1.
[0051] FIG. 20 is a series of micrographs showing that hMirp1 and
Q9E-hMirp1 are membrane localized in rat mesenchymal stem cells
(RMSC). Confocal microscopy of RMSC transfected with Q9E-hMirp1:
(A) GFP expression; (B) Q9E-hMirp1-flag-tagged; (C) Confocal merged
image of A and B, blue fluorescence indicates DAPI staining of the
nucleus. Confocal microscopy of RMSC transfected with wt Mirp1: (D)
GFP expression; (E) Mirp1-flag-tagged; (F) Confocal merged image of
A and B, blue fluorescence indicates DAPI staining of the
nucleus.
DETAILED DESCRIPTION OF THE INVENTION
[0052] The invention relates to a new method of gene therapy herein
designated `reverse` gene therapy. Traditional gene therapy methods
involve using a gene vector to deliver a wild type or engineered
gene or a promoter operably linked with a nucleic acid encoding a
wild type or engineered protein or a wild type or engineered RNA
molecule to an cell of an animal afflicted with a disease or
disorder.
[0053] `Reverse` gene therapy, as described herein, refers to
localized delivery of a gene therapy vector or stem cell comprising
said vector to an affected cell or tissue of an animal afflicted
with a disease or disorder. The nucleic acid encodes a therapeutic
gene product which is usually only expressed in cells of an
abnormal tissue which is not afflicted with the same disease or
disorder. Such abnormal tissues include, for example, tissues
afflicted with a different disease or disorder than the one being
alleviated by reverse gene therapy. Because the therapeutic gene
product is expressed in an abnormal tissue, expression of the
therapeutic gene product in tissues other than the tissue afflicted
with the disease or disorder being alleviated is generally
considered by others to be undesirable (despite the `therapeutic`
designation attached to such gene products in the present
disclosure). Hence, it is necessary to minimize or prevent
expression of the therapeutic gene product in normal tissues by
delivering the gene therapy vector or cell comprising the same, in
a localized fashion, and preferably by expressing the therapeutic
gene product in a tissue-specific manner. Also preferably, the gene
therapy vector is administered in a sustained-release fashion in
order to maximize and extend expression of the therapeutic gene
product in the tissue afflicted with the disease or disorder being
treated. The word "reverse" in reverse gene therapy is used to
indicate a nucleic acid construct which would be harmful if
expressed in one physiological setting which is delivered to a
diseased physiological site in order to achieve the reverse (i.e. a
beneficial) effect in a different setting.
[0054] The reverse gene therapy method of the invention is a method
of alleviating a disease or disorder in an affected animal cell.
This method comprises locally delivering to the cell or tissue, a
gene therapy vector or a stem cell comprising said vector. The gene
therapy vector comprises a promoter operably linked with a nucleic
acid encoding a therapeutic gene product which is usually only
expressed in cells of an abnormal tissue that is not afflicted with
the disease or disorder, such as cells of a tissue afflicted with a
different disease or disorder. Delivery of the gene therapy vector
to the affected cell alleviates the disease or disorder in the
cell. By alleviating the disease or disorder in individual affected
cells of an animal afflicted with a disease or disorder, the
symptoms of the disease or disorder are alleviated. In contrast
with alleviation of symptoms effected by administration of
non-nucleic acid-containing pharmaceutical agents, administration
of the gene therapy vector of the invention results in a longer
period of relief from the symptoms. If the gene therapy vector of
the invention comprises a virus vector which is capable of
integrating its nucleic acid into the genome of the cell or into
the genome of an organelle within the cell, very long term relief
may be effected, possibly enduring for the length of the animal's
life.
[0055] In addition, the present inventors have discovered that a
cell-based system for effecting RGT offers numerous advantages that
dovetail with the need of RGT for restricted, localized effects.
The key to achieving these advantages is the use, pursuant to the
present invention, of progenitor cells that, once modified with the
gene program of interest, establish a permanent tissue or organ
having a phenotype that counters the pathological character of a
physiological site to which the tissue or organ is functionally
appurtenant.
[0056] A progenitor cell is essentially a stem cell that is capable
of differentiation into a particular type of cell. There exists,
for example, pluripotent embryonic stem cells, which
can-differentiate into neurons, epithelial cells, fibroblasts and
blood cells; neuronal stem cells that can develop into nerve cells;
hematopoietic stem cells that grow into blood, liver and muscle
cells; and skin stem cells that can differentiate into skin and
nerve cells. The source of stem cells can vary from embryos and,
fetal tissue to umbilical cords and adult tissues. Specifically,
bone marrow, peripheral blood cells or umbilical cord blood are all
sources of progenitor stem cells. Bone marrow contains both
hematopoietic and mesenchymal stem cells. Pluripotent stem cells,
i.e., those from which many cell types may be generated, are
available from embryonal carcinoma, embryonic stem and embryonic
germ cells. A progenitor cell may be a mesenchymal cell,
hematopoietic cell, satellite cell, erthroid cell, neuronal cell,
granulocyte-macrophage, endothelial cell or a retinal cell. All
sources of progenitor cells can be obtained from unaffected or
affected individuals. With respect to the latter,
auto-transplantation involves isolating progenitor cells from the
affected subject, genetically modifying the cells and then
reintroducing either differentiated or undifferentiated transformed
progenitor cells into the diseased tissue of the affected
subject.
[0057] For the invention, the preferred progenitor cells are
mesenchymal stem cells (MSCs) or cells that have differentiated
from MSCs ("MSC-differentiated cells"). Mesenchymal cells are
obtained from the embryonic mesoderm, which consists of loosely
packed, unspecialized cells set in a gelatinous ground substance,
from which connective tissue, bone, cartilage, and the circulatory
and lymphatic systems develop. MSCs are relatively easy to isolate
and can be obtained by known techniques that are illustrated, for
example, by Azizi et al, Proc. Natl. Acad. Sci. USA 95: 3908
(1999). More specifically, bone marrow can be aspirated from the
iliac crest of a donor, who can be the patient to be treated in
accordance with the present invention. The procedures also exist
for producing a homogeneous population of MSCs in culture, see U.S.
Pat. No. 5,486,359, and for modifying the MSCs with an exogenous
polynucleotide, as reported in Prockop, Science 276: 71 (1997).
Also see U.S. Pat. No. 5,591,625. These advantages, combined with
their stem cell-like qualities of in situ migration and
pluripotency, recommend MSCs for use in the present invention.
[0058] It is also well known that MSCs can be manipulated so as to
contain a gene of interest (e.g., the naked DNA, the plasmids and
vectors described further herein). These transformed MSCs can be
distinguished from untransformed MSCs by their ability to survive
exposure to an antibiotic. Antibiotic resistance is conveyed by a
gene sequence carried on the targeting construct that also contains
the gene of interest. The MSCs can then be reintroduced into a host
animal so that the modified cells are incorporated by the host
tissue(s). For example, see U.S. Pat. No. 5,591,625, No. 6,355,239,
and No. 6,238,960.
[0059] Although the prepared MSCs themselves can be administered
therapeutically, according to the present invention, it may be more
practical to administer MSC-differentiated cells in some
circumstances. By exposing MSCs to appropriate culture conditions,
such as to 5-azacytidine, the MSCs can be differentiated into any
one of a range of mesenchymal lineage. That is, a MSC progenitor
cell line expressing the disease-related polynucleotide may be
cultured so as to differentiate into muscle, such as
cardiomyocytes, bone or cartilage. Typically, differentiation is a
multistep cellular process that requires activity of specific
growth factors and/or cytokines. After undergoing several
transitory phases, cell proliferation ends in terminal
differentiation. At that point, the terminally-differentiated cells
synthesize the cell-specific products and then mature to acquire
the functional aspects of the tissue in vivo.
[0060] Other differentiated progenitor lineages include but are not
limited to osteogenic, chondrogenic, tendonogenic, ligamentogenic,
myogenic, marrow stromagenic, adipogenic, and dermogenic lineages.
For a particular lineage, the appropriate culture conditions are
determined empirically by adding and removing various trophic
factors known to effect differentiation, thereby mimicking in vivo
physiological conditions, as described in U.S. Pat. No.
5,942,225.
[0061] A central feature of the present invention is the selection
of a disease-related polynucleotide that imparts a tissue phenotype
inversely correlated, in functional or structural terms, to the
disease phenotype of the subject. "Inversely correlated" means that
the disease-related polynucleotide counters or masks a phenotypic
trait, symptom, or mechanism that underlies the disease state of
the subject.
[0062] Exemplary of such an inverse correlation, for example, is
the matching up of (i) a diseased site characterized by a cellular
receptor that, by virtue of the relevant pathogenesis, is expressed
abnormally, in amount or structure, or is regulated abnormally, in
relation to its cognate ligand, with (ii) genetically modified
tissue, engendered in vivo by progenitor cells of the invention,
that expresses a disease-related polynucleotide responsible, in the
unrelated condition, for a countervailing expression or regulation
of the same receptor or the process(es) affected by that receptor.
Another inverse correlation that is adaptable to the inventive
therapeutic approach would pair (i) a diseased site where the
relevant pathogenesis involves undesired production of a protein, a
glycoprotein, or a carbohydrate molecule (or a structure
incorporating at least one of these) with (ii) genetically modified
tissue that expresses a disease-related polynucleotide responsible,
in the unrelated condition, for production of a species that
effects an elimination of the molecule or otherwise hinders
production of the structure. Conversely, the genetically modified
tissue could express a substance, constitutively or otherwise, that
is counterproductive in the unrelated condition but, in an RGT
context, facilitates the formation of a structure that is deficient
or absent at the diseased site.
[0063] A progenitor cell can be genetically engineered, pursuant to
the invention, via any of a number conventional techniques so as to
incorporate, for example, any one of the above described genes.
Thus, a vector that incorporates a disease-related polynucleotide
("a targeting construct") can be introduced into a progenitor cell
to provide cells capable of producing the protein product encoded
by the desired polynucleotide. Other elements of the targeting
construct may include a promoter, termination sequence,
polyadenylation sequence, antibiotic resistance "marker" and
"selection" sequences, and enhancer elements, such as Kozak and
internal ribosomal entry site (IRES) sequences. The promoter may be
the cytomegalovirus (CMV) promoter or the SV40 early promoter,
which express polynucleotides constitutively. Alternatively, the
promoter may be regulatable, so that the disease-related
polynucleotide is only expressed under certain conditions. For
example, the heparin-binding EGF-like growth factor promoter is
activated upon mechanical stretch of muscles. Alternatively, the
disease-related polynucleotide may be integrated into the host cell
genome such that its expression is controlled by an endogenous
promoter. The targeting construct also may contain signal sequences
that export the disease-related polynucleotide out of the cell.
[0064] In order to produce a progenitor cell line that is stably
engineered, i.e., that can sustain generations of cells, derived
from a parent cell, that do not lose the ability to express the
disease-related polynucleotide, a targeting construct also may
contain sequences to facilitate homologous recombination. The use
of homologous recombination to this end is well known and involves
the exchange of genetic material located between similar, if not
identical, DNA sequences, so as to integrate an exogenous DNA
sequence into a cell genome. For instance, see B. Levin, GENES VII
(Oxford University Press), in Chapter 14, "Recombination and
Repair," at pages 415-17, 538 and 539. See also Dressler &
Potter, "Molecular mechanisms in genetic recombination," Ann. Rev.
Biochem., 51, 727-761, 1982 and West, S.C., "Enzymes and molecular
mechanisms of genetic recombination," Ann. Rev. Biochem., 61,
603-640, 1992.
[0065] As an alternative to homologous recombination, the
disease-related polynucleotide may be introduced into the genome of
a progenitor cell by means of transposition elements, such as
insertion sequences, exemplified by the cre/10.times. and flp/frt
transposition systems Thus, a transposition element can be
incorporated into the targeting construct so as to splice the
disease-related polynucleotide into the genome of a progenitor
cell. See Chapter 15 of GENES VII, supra, and U.S. Pat. No.
6,270,969.
[0066] A targeting construct that includes the disease-related
polynucleotide, as well as the above-mentioned elements, may be
introduced into a progenitor cell in vitro by any of a number of
conventional techniques, such as electroporation, direct injection,
heatshock, penetration with coated solid particles, liposomal
delivery, DNAantibody micellular delivery, or by
microencapsulation. The use of DEAEdextran and polybrene in
electroporation and calcium phosphate coprecipitation can enhance
the efficiency of transfection. Another, often more efficient
technique involves the use of cationic liposomes, e.g.,
Lipofectamine 2000, a product of Invitrogen Corporation (Carlsbad,
Calif.). The negatively charged DNA binds to the positively charged
liposome, which results in the formation of a cationic lipid
complex that delivers the exogenous DNA to the MSCs through
endosomal or lysosomal activity. A DNase inhibitor may also be used
to prevent degradation of the targeting construct after cell
transfection.
[0067] Prior to transfection, the MSCs are seeded at an appropriate
density and incubated overnight. The following day the cells are
transfected via liposomes carrying the appropriate targeting
construct. One day later, the MSC cells are passaged to allow for
cell division. The cells are then trypsinized and replaced in
medium containing an antibiotic, such as geneticin, at a
concentration that is known to kill untransformed cells. This
medium is changed every couple of days and exposure to antibiotic
is maintained for three to four weeks to allow resistant cell
colonies to grow and for non-resistant colonies to die. The
transformed MSC cell colonies can be visualized by the expression
of the enhanced green fluorescent protein (eGFP). Once those
transformed cells have been identified they may be cultured,
harvested and applied therapeutically.
[0068] In this context, the introduced amount of progenitor cells
is therapeutically effective if, upon localized administration of
the cells to the subject, it results in the generation of tissue
that exhibits the phenotype imparted by the disease-related
polynucleotide, countering the disease process of interest.
[0069] To determine how many cells are therapeutically effective,
one may modify the targeting construct so as to include at least
one marker such that its level of expression is indicative to that
of the disease-related polynucleotide when both are operably linked
to a promoter. Thus, a cultured batch of progenitor cells can be
screened for the presence of the marker (i.e., by screening for
fluorescence or enzymatic activity), the abundance of which will be
related to the amount of the disease-related polynucleotide
expressed by that batch of cells. (A batch of cells is also
referred to as a "plurality" of cells.) In such fashion, one can
determine how much of the protein product encoded by the
disease-related polynucleotide is produced from a plurality of
cells of known cell density.
[0070] The amount of protein product expressed from a batch of
cells containing the disease-related polynucleotide also can be
determined directly. For example, Western blotting, immunoblotting,
immunohistochemistry, antibody staining, and
electrophoretic/colormetric densitometry (i.e., determining the
intensity of protein bands on an electrophoresis gel) can all be
used to determine how much of the disease-related protein is
present in a given batch of cultured, transfected cells. An
"effective dose" may comprise differentiated or undifferentiated
progenitor cells, or to a mixture of the two cell types.
[0071] It also is possible to screen for drugs or compounds in
vitro that have an affect upon the phenotype of such transformed
progenitor cells. An animal model of the disease to be countered is
also useful for drug screening, as well as for determining the
effectiveness of a therapeutic dose of transformed progenitor
cells.
[0072] Ideally, an effective dose of progenitor cells should be
introduced near or at the affected site of the recipient tissue in
the affected individual. Delivery of transformed progenitor cells
to a diseased site, in accordance with the present invention, can
be accomplished by localized infusion or by direct injection of a
suspension of transformed cells. Depending on the ultimate,
differentiated cell type desired, the batch of progenitor cells may
or may not have to be expanded prior to delivery to the affected
individual. For example, if cell growth in vivo is typically
required, as is the case for bone marrow transplantation, then in
vitro expansion of cells is less critical. Most likely, however,
cell expansion is required prior to administration of the
transformed cells.
[0073] Alternatively, transformed progenitor cells can be implanted
at or near the desired site as a pellet or tissue-engineered
organoid, such as bio-artificial muscle. For instance, transformed
progenitor cells may be manipulated so as to differentiate into
myoblasts and adhered to a biodegradable polymer scaffold under
conditions permitting growth and further development. This
scaffold, which may also contain growth factors and chemicals need
to facilitate development of the engineered tissue, may then be
implanted into the body.
[0074] Differentiated and mature progenitor cells may be further
developed in vitro to form tissues for grafting onto the disease
site of the particular organ in the affected subject. However, if
the resultant tissue replaces a mostly physical attribute in the
diseased organ, then the graft must not induce a thrombogenic
response and must also be able to withstand arterial pressure.
Alternatively, if the physiological attributes of the graft are
more important that its structural component, then it is necessary
to ensure that those physiological properties are sustained as
required when implanted into the individual.
[0075] In some instances, it may be necessary to injure or damage
the recipient tissue prior to delivery of the transformed
progenitor cells. For instance, to efficiently repopulate a
diseased bone with transformed bone marrow cells, it may be
necessary to first compromise the bone by exposing it or the
affected individual to chemotherapy or other radiation. The
transformed bone marrow cells will migrate to the requisite site,
reestablish themselves and ultimately produce the protein of the
disease-related polynucleotide. See U.S. Pat. No. 5,197,985 for a
description of methodology to enhance the implantation and
differentiation of MSCs obtained from bone marrow.
[0076] Preferred compositions and methods for reverse gene therapy
which are described herein include compositions and methods for
delivering a gene therapy vector or cell to cardiac tissue in an
animal afflicted with a cardiac disease or disorder such as cardiac
arrhythmias. Localized delivery of pharmaceutical agents to cardiac
tissue has been described by others (e.g. Labhasetwar et al., 1998,
J. Cardiovasc. Pharmacol. 31:449-455; Labhasetwar et al., 1997,
Adv. Drug Del. Rev. 24:109-120; Labhasetwar et al., 1997, Adv.
Drug. Del. Rev. 24:63-85; Sintov et al., 1997, Int. J. Pharm.
146:55-62; Gottsauner-Wolf et al., 1997, Am. Heart J. 133:329-334;
Humphrey et al., 1997, Adv. Drug Delivery Rev. 24: 87-108; Desai et
al., 1997, Pharm. Res. 14:1568-1573; Song et al., 1997, J.
Controlled Release 45:177-192).
[0077] Localized delivery of an agent such as a gene therapy vector
or cell comprising the same, advantageously delivers the agent only
or primarily to a particular site, minimizes the amount of agent
which needs to be delivered (i.e. by minimizing delivery to
undesired sites), and minimizes undesirable effects caused by
delivery of the agent systemically or to tissues located at a
distance from the particular site. By way of example, enhanced
efficacy of various anti-arrhythmic agents has been demonstrated
when the agents were locally delivered, relative to the efficacy of
the same agents delivered systemically (Labhasetwar et al., 1997,
Adv. Drug Del. Rev. 24:109-120; Labhasetwar et al., 1997, Adv.
Drug. Del. Rev. 24:63-85; Sintov et al., 1997, Int. J. Pharm.
146:55-62; Gottsauner-Wolf et al., 1997, Am. Heart J. 133:329-334;
Humphrey et al., 1997, Adv. Drug Delivery Rev. 24:87-108; Desai et
al., 1997, Pharm. Res. 14:1568-1573; Song et al., 1997, J.
Controlled Release 45:177-192). Reduction of ventricular
defibrillation thresholds has also been associated with local
cardiac drug delivery (Song et al., 1997, J. Controlled Release
45:177-192).
[0078] A drawback of sustained-release drug delivery of a
conventional pharmaceutical agent is the need to continuously
resupply drug to the drug reservoir because of depletion or
turnover of the drug. Sustained-release delivery of many
anti-arrhythmics is further hindered by the relatively non-specific
effect of such agents and by the fact that local delivery of such
agents fails to change the nature of the underlying pro-arrhythmic
myocardium. Thus, when delivery of anti-arrhythmic agent ceases,
the myocardium remains pro-arrhythmic.
[0079] Traditional gene therapy methods have not been useful for
treating pro-arrhythmic myocardium because of several factors.
First, no reasonable candidate genes have been proposed for
delivery to pro-arrhythmic myocardium. Second, delivery systems for
localizing gene vector delivery to specific arrhythmogenic circuits
within the heart have not been previously described. Third,
numerous gene vectors suggested for gene therapy have exhibited
complications relating to, among other things, systemic
immunogenicity and toxicity. The present invention overcomes these
shortcomings. As described herein, reverse gene therapy may be used
to appropriately alter myocardial sites involved in mechanistic
events leading to re-entrant arrhythmias because use of pathologic
mutants of ion channel proteins defeats tachyarrhythmic conduction
circuits and achieves, in essence, a "biotech ablation" of such
arrhythmias. Perhaps because these mutant proteins are usually only
expressed in cells of an abnormal tissue, their use to treat
alleviate arrhythmias and other cardiac disease and disorders has
not been contemplated by others.
[0080] HERG refers to the human ether agogo gene, which encodes a
potassium channel rectifier protein that modulates myocardial
K.sup.+ re-entrant current. HERG (A561V) refers to a point mutation
(resulting in an alanine-to-valine substitution) in this protein,
which is responsible for one of the forms of the Long QT Syndrome,
a hereditary disorder associated with episodes of ventricular
arrhythmias and a risk of sudden death (Labhasetwar et al., 1995,
Proc. Natl. Acad. Sci. USA 92:2612-2616; Schwendeman et al., 1995,
Pharm. Res. 12:790-795; Labhasetwar et al., 1995, Clin.
Pharmacokinet. 29:1-5; Levy et al., 1995, J. Controlled Release
36:137-147; Gibson et al., 1995, In: Molecular Interventions and
Local Drug Delivery in Cardiovascular Disease, Edelman, Ed., W.B.
Saunders Co., Ltd., London, UK, pp. 327-352; Wood et al., 1995, In:
Molecular Interventions and Local Drug Delivery in Cardiovascular
Disease, Edelman, Ed., W.B. Saunders Co., Ltd, London, UK, pp.
399-471). The HERG gene resides on chromosome 7 (q35-36), and has a
length of about 3.2 kilobases. cDNA encoding HERG (A561V) protein
has been incorporated into a plasmid vector by others, and this
plasmid was used to define the mechanism of its role in the Long QT
Syndrome (Wood et al., 1995, In: Molecular Interventions and Local
Drug Delivery in Cardiovascular Disease, Edelman, Ed., W.B.
Saunders Co., Ltd, London, UK, pp. 399-471). Expression of HERG
(A561V) in Xenopus oocytes depressed the tail current response to
various test pulses of voltage amplitudes, which indicated that
HERG (A561V) becomes associated with the cell membrane following
introduction of exogenous genetic material (Sanguinetti et al.,
1996, Proc. Natl. Acad. Sci. USA. 93:2208).
[0081] The HERG (A561V) gene encodes a defective potassium channel
rectifier. Defective HERG (A561V) protein interacts with the wild
type HERG potassium channel rectifier in a dominant negative
manner, thereby inhibiting K.sup.+ current through the HERG
membrane protein. Expression of the defective HERG (A561V) protein
in the cell membrane of cardiac myocytes results in prolonged
myocardial conduction. Ibutilide, a short acting Class III
antiarrhythmic agent, also blocks cardiac potassium channel
rectifier current and delays myocardial conduction. Ibutilide has
been administered to patients to prevent re-entrant atrial flutter.
Because both ibutilide and defective HERG (A561V) protein inhibit
K.sup.+ current through the HERG membrane protein, administration
of defective HERG (A561V) protein to a patient afflicted with
re-entrant atrial flutter using a reverse gene therapy method as
described herein will relieve this condition. Prior to ethical use
of this reverse gene therapy method on human patients, the method
is tested using dogs. Dogs are utilized in these studies, because
of the extensive prior work by the inventors and many others on dog
models of cardiac arrhythmias and, in particular, atrial flutter
(e.g. Kirshenbaum et al., 1996, Develop. Biol. 179:402-411; Cox et
al., 1995, J. Thorac. Cardiovasc. Surg. 110:485-495). Dog
myocardium is thus an art-recognized model of human myocardium, at
least for the purposes of assessing the effectiveness of
alleviating re-entrant atrial flutter.
[0082] In the another aspect of the invention, vectors and cells
comprising the cardiac potassium channel missense mutation,
Q9E-hMiRP1, are provided for use in gene therapy protocols for
cardiac arrhythmias. This gene abnormality is another cause the
Long QT syndrome (LQTS). However, individuals who carry the
Q9E-hMiRP1 variant are predisposed to developing the (LQTS) only
following clarithromycin administration. Since Q9E-hMiRP1's
electrophysiological mechanism of action, diminished potassium
currents resulting in delayed myocardial repolarization, is
comparable to that of Class III anti-arrhythmic agents, Q9E-hMiRP1
was assessed in gene therapy protocols for site-specific treatment
of re-entrant atrial cardiac arrhythmias. The atrial use of
Q9E-hMiRP1 should prove safe and efficacious, since LQTS
characteristically causes ventricular, but not atrial arrhythmias.
Furthermore, the possible use of clarithromycin to
pharmacologically control the conduction effects of overexpressed
Q9E-hMiRP1 provides a means to control the system. Two bicistronic
plasmid DNA gene vectors with either hMiRP1 or Q9E-MiRP1 and Green
Fluorescent Protein (GFP), plus a C-terminus (of the hMiRP1 or of
the Q9E-hMiRP1) coding region for the FLAG (MDYKDDDDK) peptide were
assessed. We generated two stable cell lines using HEK293 and
SH-SY5Y (human cell lines), over-expressing the genes of interest,
confirmed by real time RT-PCR and Western blots. The expected
plasma membrane localization of each overexpressed transgene was
confirmed by immunofluorescent confocal fluorescent microscopy
using anti-FLAG antibody. Patch clamp studies demonstrated that
cells transfected with Q9E-hMiRP1 plasmid DNA exhibited
significantly reduced potassium currents, but only with
clarithromycin administration. A novel plasmid DNA delivery system
was formulated for use in our animal studies of the hMiRP1 vectors,
which was composed of DNA-anti-DNA antibody cationic lipid (DAC)
heteroplexes. In vitro and in vivo studies, using DAC heteroplexes
containing anti-DNA antibodies with nuclear targeting capability,
demonstrated significantly increased transfection compared to naked
DNA, and DNA-cationic lipid complexes. Pig atrial myocardial
injections of DAC heteroplexes demonstrated 16% of regional cardiac
myocytes transfected using the Q9E-hMiRP1 plasmid, and 15% of cells
with the hMiRP1 vector. It is concluded that the present studies
demonstrate that site-specific gene therapy for atrial arrhythmias
is feasible using plasmid vectors for over-expressing ion channel
mutations that have electrophysiological effects comparable to
class III anti-arrhythmic agents.
[0083] Although the compositions and methods described herein focus
on use of HERG (A561V) and Q9E-hMirp1, one or more of the other
point mutations which have been described in the human ether agogo
gene may be similarly used (e.g. Labhasetwar et al., 1995, Proc.
Natl. Acad. Sci. USA 92:2612-2616; Schwendeman et al., 1995, Pharm.
Res. 12:790-795; Labhasetwar et al., 1995, Clin. Pharmacokinet.
29:1-5; Levy et al., 1995, J. Controlled Release 36:137-147; Gibson
et al., 1995, In: Molecular Interventions and Local Drug Delivery
in Cardiovascular Disease, Edelman, Ed., W.B. Saunders Co., Ltd.,
London, UK, pp. 327-352). Alternatively, re-entrant circuit block
can elicited by localized delivery and expression of the
transcription factor, E2F1, which causes apoptosis in mature
myocytes (Levy 1995, In: Molecular Interventions and Local Drug
Delivery in Cardiovascular Disease, Edelman, Ed., London, UK: W.B.
Saunders Co., Ltd.; Anderson et al., 1995, J. Biomed. Mater. Res.
29:1473-1475), thereby creating a devitalized region (by means of
gene-induced apoptosis) within a re-entry loop.
[0084] Localization of delivery of an agent encoded by a nucleic
acid can be enhanced by use of a tissue-specific or physiologically
responsible promoter operably linked with the nucleic acid encoding
the agent. Numerous tissue-specific and physiologically responsible
promoters have been described. For example, tissue specific
promoters and physiologically responsible promoters include, but
are not limited to the sm22alpha promoter, which specifically
promotes expression of genes in arterial smooth muscle cells
(Solway et al., 1995, J. Biol. Chem. 270:13460-13469) and the
tenascin-C promoter, which specifically promotes expression of
genes in proliferating cells in response to the presence of matrix
metalloproteinase-modified collagens (Chiquet et al., 1996,
Biochem. Cell Biol. 74:737-744; Copertino et al., 1997, Proc. Natl.
Acad. Sci. USA 94:1846-1851).
[0085] A physiologic responsive promoter is a nucleotide sequence
regulating downstream DNA expression in response to a change in the
regional physiology such as, for example, an alteration in the
extracellular matrix (i.e. collagen breakdown or denaturation), an
increase in regional temperature to the febrile range, or a
response to a change in blood pressure or blood flow.
[0086] In the reverse gene therapy compositions and methods of the
invention for treatment of cardiac arrhythmias, the promoter is
preferably a cardiac tissue-specific promoter, such as the
.alpha.-myosin heavy chain promoter (.alpha.-MyHC; Anderson et al.,
1995, Tissue Eng. 1:323-326; VIIIa et al., 1995, Circ. Res.
76:505-513) or the atrial natriuretic factor promoter (ANF; Guzman
et al., 1996, Circulation 94:1441-1448). Of course,
non-tissue-specific promoters (e.g. the wild type HERG promoter)
and constitutive promoters (e.g. a cytomegalovirus {CMV} promoter)
may be used in the gene therapy vector of the invention.
[0087] Localized expression of a therapeutic gene product can be
enhanced in a reverse gene therapy method by delivering a gene
therapy vector having a nucleic acid which comprises a
pharmacological agent-sensitive enhancer element in addition to the
portion of the nucleic acid encoding the therapeutic gene product.
A variety of such pharmacological agent-sensitive enhancer agents
have been described, such as those which enhance gene expression in
response to administration of a phorbol ester to a cell which
comprises a nucleic acid having such an enhancer element (Desai et
al., 1996, Pharm. Res. 13:1838-1845; Levy et al., 1996, Drug
Delivery 3:137-142; Song et al., 1997, J. Controlled Release
43:197-212). Localized enhancement of expression of the therapeutic
gene product can be effected by localized delivery of the gene
therapy vector coupled with systemic delivery of the
pharmacological agent corresponding to the enhancer element, by
systemic delivery of the gene therapy vector coupled with localized
delivery of the pharmacological agent corresponding to the enhancer
element, or, preferably, by localized delivery of both the gene
therapy vector and the pharmacological agent corresponding to the
enhancer element.
[0088] Expression of a gene product encoded by the gene therapy
vector of the invention can be rendered terminable by incorporating
a Cre-recombinase sensitive site in the nucleic acid of the gene
therapy vector of the invention, as described (Hammond et al.,
1997, Analyt. Chem. 69:1192-1196). Expression of the gene product
in a cell transformed using the gene therapy vector of the
invention is terminated by delivering a second vector to the cell,
wherein the second vector encodes Cre-recombinase.
[0089] In an alternate embodiment of the invention, the gene
therapy vector of the invention encodes a protein which, when
expressed in a cell, induces apoptosis of the cell. Such proteins
include, for example the transcription factor E2F1 and
transcription factors normally encoded by viruses (Levy, 1995, In:
Molecular Interventions and Local Drug Delivery in Cardiovascular
Disease, Edelman, Ed., London, UK: W.B. Saunders Co., Ltd.;
Anderson et al., 1995, J. Biomed. Mater. Res. 29:1473-1475; Martin
et al., 1995, Nature 375:691-694).
[0090] Other contemplated embodiments of the invention include, but
are not limited to, the following: [0091] Delivery of a gene
therapy vector encoding a mutant tenascin C protein associated with
a disease state to cardiac or coronary artery tissue, in order to
limit or prevent progression or development of cardiac valve
obstruction or coronary artery obstruction. Tenascin C normally
organizes progressive deposition of extracellular matrix. In
certain disease states, however, expression of mutant tenascin C
proteins lead to repression of extracellular matrix production
(Nakao et al., 1998, Am. J. Pathol. 152:1237-1245). Delivery of a
gene therapy vector encoding a bone morphogenic protein (BMP) under
the transcriptional control of a mutant BMP promoter associated
with a disease state to a bone fracture site or to a bone site at
risk of fracture (e.g. bone non-union sites, sites at which
reconstructive surgery has been performed, and cranio-facial). In
certain disease states, mutant BMP promoters lead to overexpression
of BMP (Kaplan et al., 1998, Biochem. Pharmacol. 55:373-382).
[0092] Delivery of a gene therapy vector comprising at least a
portion of a mutant gene associated with one or more
mucopolysaccharidoses to a glycosaminoglycan-(GAG-) deficient site
or to a biomechanically compromised site (e.g. a joint, tendon, or
heart valve) in the body of an animal. As is well known, various
mutant genes associated with one or more mucopolysaccharidoses
result in overexpression of GAG in the affected tissue (Froissart
et al., 1998, Clin. Gen. 53:362-368). [0093] Delivery of a gene
therapy vector encoding a mutant gene, expression of which mutant
gene is associated with apoptosis in a disease state, to cells or
tissue which contributes to a different disease state (e.g.
delivery of an apoptosis-inducing gene to myocardium cells which
form all or part of conduction pathway associated with arrhythmia).
Numerous mutant genes are known, expression of which mutant gene is
associated with apoptosis in a disease state (e.g. Nishina et al.,
1997, Nature 385:350-353). [0094] Delivery of a gene therapy vector
encoding a mutant gene encoding a dominant negative mutant gene
product associated with a disease state to cells or tissue which is
affected by a disease state associated with the normal (i.e.
non-mutant) form of the gene product. By way of example, dominant
negative mutant variants of numerous cell-surface receptors are
known, such as dominant negative mutants wherein one or more
inoperative receptor subunits ablate the activity of a
multi-subunit receptor (e.g. Kim et al., 1998, J. Clin. Invest.
101:1821-1826). [0095] Delivery of a gene therapy vector encoding
therapeutic gene product which is usually only expressed in cells
of an abnormal tissue to facilitate implantation of engineered
tissue (e.g. cultured organ tissue) into an animal. For example, a
vector comprising a disease-associated gene could be used to
favorably modify a tissue prior to implantation of the tissue. By
way of specific example, a gene that normally encodes a product
which, when expressed induces a skeletal defect (e.g. a gene
described by Kaplan et al., 1998, Biochem. Pharmacol. 55:373-382),
may be delivered to a tissue-engineered heart valve prior to
implantation of the valve in a patient, in order to prevent the
valve from calcifying. [0096] Delivery of a gene therapy vector
encoding an uncontrollable mutant of the transcription factor
NF-ATc to cardiac tissue of a post-natal individual to facilitate
development of a cardiac valve. The role of transcription factor
NF-ATc in abnormal cardiac valve formation has been described
(Ranger et al., 1998, Nature 392:186-190). [0097] Delivery of a
gene therapy vector comprising a pressure- or flow-unresponsive
mutant tenascin C gene (or cDNA) to cardiac tissue to retard or
prevent cardiac valve obstruction. Such mutant tenascin C genes
have been described (e.g. Huang et al., 1995, Nature 378:292-295).
[0098] Delivery of a gene therapy vector encoding a degradation
resistant protein normally associated with a disease state to cells
or tissue affected by a different disease state associated with the
corresponding normal (i.e. degradation sensitive) form of the
protein. For example, a gene therapy vector encoding a mutant
collagen protein which is resistant to degradation by matrix
metalloproteinase (MMP) may be delivered to a cell to block MMP
cascade-integrin signaling (King et al., 1997, J. Biol. Chem.
272:28518-28522). [0099] Delivery of a gene therapy vector
comprising a gene having a deletion therein, relative to the wild
type gene, wherein expression of the gene having the deletion is
normally associated with a disease state, but when the gene therapy
vector is delivered to cells or tissue affected by a different
disease state, expression of the gene having the deletion
alleviates or inhibits the different disease state. For example,
chromosomal deletions such as the chromosome 22 deletions
associated with cardiac defects (e.g. those described by Rauch et
al., 1998, Am. J. Med. Gen. 78:322-331) may be used to inhibit
heart valve calcification through by delivering vectors comprising
antisense constructs corresponding to the deleted regions of
chromosome 22. Delivery of such vectors to heart valve tissue
suppresses differentiation of potentially calcifying cells in
cardiac valves and blood vessels. [0100] Delivery of an effective
dose of progenitor cells comprising any of the constructs or
vectors described above
The Reverse Gene Therapy Vector of the Invention
[0101] The invention includes a reverse gene therapy vector and
cells comprising the same which are useful for alleviating a
disease or disorder. This reverse gene therapy vector of the
invention comprises a promoter operably linked with a nucleic acid
encoding a therapeutic gene product which is normally only
expressed in cells of an abnormal tissue that is not afflicted with
the same disease or disorder. Delivery of the vector to the cell
alleviates the disease or disorder. Optionally, the vector is
provided in plurality of progenitor cells.
[0102] The therapeutic gene product encoded by gene therapy vector
of the invention may, for example, be a protein, a ribozyme, an
antisense RNA molecule, or another molecule which, when expressed
in a normal cell, causes the normal cell to exhibit a symptom
associated with a disease or disorder but which, when expressed in
a cell to which the gene therapy vector of the invention is
delivered, alleviates a symptom of a disease or disorder which
affects the cell. Proteins which may be encoded by the gene therapy
vector of the invention include defective HERG proteins, HERG
(A561V) protein, Q9E-hMirp1, apoptosis-inducing proteins, and
transcription factor E2F1.
[0103] The reverse gene therapy vector of the invention may be
substantially any nucleic acid vector which is now known or
hereafter developed. Exemplary vectors include, but are not limited
to naked DNA vectors, plasmids, condensed nucleic acids, and virus
vectors. In a preferred embodiment of the reverse gene therapy
vector of the invention, the vector is a plasmid, and more
preferably comprises both a plasmid and a condensing agent such as
poly-L-lysine or Ca.sup.2+ ions. When the vector is a virus vector,
the virus vector is preferably an adenovirus vector.
[0104] Plasmid DNA transformation of mammalian cells results in
plasmid DNA residing in the nucleus of the transfected cell,
wherein the plasmid not incorporated into a chromosome. Transient
episomal expression of plasmid DNA generally occurs following
transformation (Dowty et al., 1995, Proc. Natl. Acad. Sci. USA
92:4572-4576; Wolff et al., 1996, Hum. Mol. Genet. 1:363-369; Fritz
et al., 1996, Hum. Gene Ther. 7:1395-404). Plasmid transformation
of cardiac and skeletal striated muscular tissue, either cardiac or
skeletal has been demonstrated following administration of naked
DNA to such tissue, and expression of the DNA in the transformed
cells has been observed to persist for months (Dowty et al., 1995,
Proc. Natl. Acad. Sci. USA 92:4572-4576; Wolff et al., 1996, Hum.
Mol. Genet. 1:363-369; Fritz et al., 1996, Hum. Gene Ther.
7:1395-404). Alternatively, a gene therapy vector, such as certain
virus vectors, may be used, wherein the vector causes the nucleic
acid carried thereby to be integrated into the host cell
genome.
[0105] In one embodiment, the gene therapy vector of the invention
is preferably administered to a cell or tissue of an animal in a
sustained-release manner. Numerous methods have been described for
effecting sustained release of a nucleic acid vector such as a gene
therapy vector, and all known and hereafter-developed methods for
achieving sustained release of a nucleic acid vector can be used in
accordance with the compositions and methods of the invention. The
gene therapy vector of the invention is preferably DNA in the form
of a plasmid, particularly condensed plasmid DNA incorporated into
particles, microparticles, nanoparticles, a bulk material, or a
coating present at a surface of an implantable device. Preferred
nucleic acid vector compositions and methods of using them to
administer a vector, such as the gene therapy vector of the
invention, are described in co-pending U.S. patent applications
having attorney docket numbers 7600-30 (CHOP-0011), 7600-29
(CHOP-0060), and 7600-24 (CHOP-0062), each of which was filed on
the same date as the present disclosure, and each of which is
incorporated herein by reference.
[0106] When the gene therapy vector of the invention comprises a
gene therapy vector for delivering a therapeutic gene product to a
cardiac tissue in order to alleviate a cardiac arrhythmia, the
vector is preferably delivered to myocardial tissue in the animal.
When the cardiac arrhythmia is attributable to re-entrant atrial
flutter, the vector is preferably delivered locally to the right
atrial myocardium of the animal, and is more preferably delivered
in a sustained-release manner. Delivery of the vector to a
myocardial tissue may be effected by implanting a device (e.g. an
implantable device comprising an electrode, such as a cardiac
rhythm modulator or pacemaker) having a surface coated with a
matrix comprising the vector in close proximity to the myocardial
tissue. Preferably, the matrix is biodegradable and thereby
delivers the vector to the tissue in a sustained-release
manner.
[0107] The implantable device may be one which is made and used for
the sole purpose of delivering the reverse gene therapy vector of
the invention to the animal, or the device may be one which is
applied to the surface of or inserted within the body of the animal
for a purpose other than merely delivering the reverse gene therapy
vector of the invention to the animal. By way of example, the
implantable device may be a plurality of microspheres which
comprise the reverse gene therapy vector of the invention and which
are implanted into the body of the animal for the sole purpose of
delivering the vector to the animal. Further by way of example, the
implantable device may be a pacemaker having a surface coated with
a matrix comprising the reverse gene therapy vector of the
invention; the pacemaker is implanted in the vicinity of the
animal's heart, both to modulate the animal's heartbeat when
necessary and to deliver the vector to a cardiac tissue or to
another tissue in close proximity to or in fluid communication with
the coated surface of the pacemaker.
[0108] The reverse gene therapy vector of the invention may be
incorporated into a coating of virtually any medical device. The
coated devices provide a convenient means for local administration
of the vector. For example, the vector may be incorporated into
coatings for degradable and non-degradable sutures, orthopedic
protheses such as supporting rod implants, joint protheses, pins
for stabilizing fractures, bone cements and ceramics, tendon
reconstruction implants, prosthetic implants, cardiovascular
implants such as heart valve prostheses, pacemaker components,
defibrillator components, angioplasty devices, intravascular
stents, acute and in-dwelling catheters, ductus arteriosus closure
devices, implants deliverable by cardiac catheters such as atrial
and ventricular septal defect closure devices, urologic implants
such as urinary catheters and stents, neurosurgical implants such
as neurosurgical shunts, ophthalmologic implants such as lens
prosthesis, thin ophthalmic sutures, and corneal implants, dental
prostheses, internal and external wound dressings such as bandages
and hernia repair meshes, pacemakers and other cardiac rhythm
modulation devices, cardiac electrode leads, and other devices and
implants, as will be readily apparent to the skilled artisan.
[0109] The reverse gene therapy compositions and methods of the
invention can be used to transforms cells located outside the body
of the animal or cells located within the body of an animal.
Following transformation of cells outside the body of the animal,
the cells may be cultured, returned to the body of the same animal,
or administered to the body of another animal of the same or
different species, using substantially any known or subsequently
developed method. In a preferred embodiment, the cells are the MSCs
described above.
[0110] When the reverse gene therapy vector of the invention is
delivered in the form of a particle which comprises the vector, the
particle may be substantially any size. Preferably, the particle is
a microparticle having a diameter less than about 900 micrometers,
and preferably less than about 500 micrometers. Even more
preferably, the particle is a nanoparticle having a diameter less
than about 1 micrometer, and preferably less than about 600
nanometers. The vector may be present only on the surface of the
particles, only at an interior portion of the particles, only in
one or more layers of material in the particle, or throughout the
particle. The particle preferably comprises a biocompatible
material, and more preferably comprises a biodegradable material
such as a polylactate-polyglycolate copolymer. Of course,
substantially any known biocompatible polymeric or non-polymeric
material may be used to form the particles, so long as at least a
portion of the vector in or on the particle can be taken up by a
cell which contacts the particle or is in fluid communication with
the particle.
[0111] Cellular uptake of the gene therapy vector of the invention
may be enhanced by incorporating a specific cell surface receptor
protein into the vector (e.g. fibroblast growth factor (FGF) or
transferring. Intracellular processing of the plasmid DNA within a
lysosomal or endosomal compartment within the cell may be modulated
by incorporating a lysosomotropic agent (e.g. sucrose or
chloroquine) in order to reduce intracellular nuclease-mediated
hydrolysis of the nucleic acid of the vector.
[0112] The reverse gene therapy vector preferably comprises a
condensing agent. Condensation of DNA using polycations such as
polylysine has also been demonstrated to enhance plasmid
transfection by facilitating cell entry, possibly by encouraging
nanoparticulate formation and protecting the DNA from nuclease
mediated hydrolysis both extracellularly and within intracellular
lysosomal or endosomal compartments. A preferred condensing agent
is the polycation, polylysine.
[0113] The chemical identity of the condensing agent is not
critical. The ability of a condensing agent to condense DNA or
another nucleic acid or nucleic analog may be assessed using
numerous methods known in the art. Effective amounts of such
condensing agents may similarly be determined using these methods.
For example, DNA condensation may be measured by comparing the
kinetics in solution of condensed DNA and uncondensed DNA, and then
further comparing the kinetics in the presence of a surfactant such
as a detergent. It may also be measured by changes in the surface
?-potential of the DNA in solution (Wolfert et al., 1996, Human
Gene Therapy 7:2123-33), or by visualizing the DNA using an
electron microscope (Laemmli, 1975, Proc. Natl. Acad. Sci. USA
72:4288-4292) or an atomic force microscope (Wolfert et al., 1996,
Gene Therapy 3:269-273).
[0114] One preferred family of condensing agents is the
polylysines. Polylysines are polypeptides of varying lengths,
comprising lysine residues, which are positively charged at human
physiological blood pH. The lysine residues can be D-lysine
residues, L-lysine residues, or a mixture of the two enantiomers;
poly-L-lysine is preferred. Polylysine has been demonstrated to be
an efficacious DNA condensing agent (Laemmli, 1975, Proc. Natl.
Acad. Sci. USA 72:4288-4292; Wolfert et al., 1996, Gene Therapy
3:269-273). The polylysines which are useful as condensing agents
in the compositions and methods of the invention include all
variants of polylysine, regardless of length, linear, branched, or
cross-linked structure, conformation, isomerization, or chemical
modification, that are capable of condensing DNA or other
polyanionic bioactive agents. Exemplary chemical modifications
include methylation (Bello et al., 1985, J. Biomol. Struct. Dyn.
2:899-913) and glycosylation (Martinez-Fong et al., 1994,
Hepatology 20:1602-1608). Such modifications may be made before or
after synthesis of the polylysine. Other condensing agents which
may be used to condense DNA and other nucleic acids include
elemental cations, particularly divalent cations such as Mg.sup.2+
or Ca.sup.2+. Such cations may, for example, be used in the form of
salts, such as MgCl.sub.2 or CaCl.sub.2. Other suitable elemental
cations include Co.sup.3+ (particularly in the form of cobalt
hexamine, .sup.Co(NH.sub.3).sub.6.sup.3+, or cobalt pentamine),
La.sup.3+, Al.sup.3+, Ba.sup.2+ and Cs.sup.+. These cations are
generally used in the form of a salt, particularly halide salts
such as chloride and bromide salts, but other salts may be used as
well.
[0115] It is understood that the ordinarily skilled physician or
veterinarian will readily determine and prescribe an effective
amount of the compound to alleviate the disease or disorder in the
subject. In so proceeding, the physician or veterinarian may, for
example, prescribe a relatively low dose at first, subsequently
increasing the dose until an appropriate response is obtained. It
is further understood, however, that the specific dose level for
any particular subject will depend upon a variety of factors
including the activity of the specific compound employed, the age,
body weight, general health, gender, and diet of the subject, the
time of administration, the route of administration, the rate of
excretion, any drug combination, and the severity of the disease or
disorder to be alleviated.
[0116] The invention encompasses the preparation and use of
pharmaceutical compositions comprising the reverse gene therapy
vector or cells containing the same as an active ingredient. Such a
pharmaceutical composition may consist of the active ingredient
alone, in a form suitable for administration to a subject, or the
pharmaceutical composition may comprise the active ingredient and
one or more pharmaceutically acceptable carriers, one or more
additional ingredients, or some combination of these.
Administration of one of these pharmaceutical compositions to a
subject is useful for alleviating a disease or disorder in the
subject, as described elsewhere in the present disclosure.
[0117] As used herein, the term "pharmaceutically acceptable
carrier" means a chemical composition with which the active
ingredient may be combined and which, following the combination,
can be used to administer the active ingredient to a subject.
[0118] The formulations of the pharmaceutical compositions
described herein may be prepared by any method known or hereafter
developed in the art of pharmacology. In general, such preparatory
methods include the step of bringing the active ingredient into
association with a carrier or one or more other accessory
ingredients, and then, if necessary or desirable, shaping or
packaging the product into a desired single- or multi-dose
unit.
[0119] Although the descriptions of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for ethical administration to
humans, it will be understood by the skilled artisan that such
compositions are generally suitable for administration to animals
of all sorts. Modification of pharmaceutical compositions suitable
for administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design and
perform such modification with merely ordinary, if any,
experimentation. Subjects to which administration of the
pharmaceutical compositions of the invention is contemplated
include, but are not limited to, humans and other primates, mammals
including commercially relevant mammals such as cattle, pigs,
horses, sheep, cats, and dogs, birds including commercially
relevant birds such as chickens, ducks, geese, and turkeys, fish
including farm-raised fish and aquarium fish, and crustaceans such
as farm-raised shellfish.
[0120] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in bulk, as a single unit dose, or as a
plurality of single unit doses. As used herein, a "unit dose" is
discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the
active ingredient is generally equal to the dosage of the active
ingredient which would be administered to a subject or a convenient
fraction of such a dosage such as, for example, one-half or
one-third of such a dosage.
[0121] The relative amounts of the active ingredient, the
pharmaceutically acceptable carrier, and any additional ingredients
in a pharmaceutical composition of the invention will vary,
depending upon the identity, size, and condition of the subject
treated and further depending upon the route by which the
composition is to be administered. By way of example, the
composition may comprise between 0.1% and 100% (w/w) active
ingredient.
[0122] In addition to the active ingredient, a pharmaceutical
composition of the invention may further comprise one or more
additional pharmaceutically active agents. Particularly
contemplated additional agents include condensing agents such as
polylysine.
[0123] Controlled- or sustained-release formulations of a
pharmaceutical composition of the invention may be made using
conventional technology.
[0124] Liquid suspensions may be prepared using conventional
methods to achieve suspension of the active ingredient in an
aqueous or oily vehicle. Aqueous vehicles include, for example,
water and isotonic saline. Oily vehicles include, for example,
almond oil, oily esters, ethyl alcohol, vegetable oils such as
arachis, olive, sesame, or coconut oil, fractionated vegetable
oils, and mineral oils such as liquid paraffin. Liquid suspensions
may further comprise one or more additional ingredients including,
but not limited to, suspending agents, dispersing or wetting
agents, emulsifying agents, demulcents, preservatives, buffers,
salts, flavorings, coloring agents, and sweetening agents. Oily
suspensions may further comprise a thickening agent. Known
suspending agents include, but are not limited to, sorbitol syrup,
hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone,
gum tragacanth, gum acacia, and cellulose derivatives such as
sodium carboxymethylcellulose, methylcellulose,
hydroxypropylmethylcellulose. Known dispersing or wetting agents
include, but are not limited to, naturally-occurring phosphatides
such as lecithin, condensation products of an alkylene oxide with a
fatty acid, with a long chain aliphatic alcohol, with a partial
ester derived from a fatty acid and a hexitol, or with a partial
ester derived from a fatty acid and a hexitol anhydride (e.g.
polyoxyethylene stearate, heptadecaethyleneoxycetanol,
polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan
monooleate, respectively). Known emulsifying agents include, but
are not limited to, lecithin and acacia. Known preservatives
include, but are not limited to, methyl, ethyl, or
n-propyl-para-hydroxybenzoates, ascorbic acid, and sorbic acid.
Known sweetening agents include, for example, glycerol, propylene
glycol, sorbitol, sucrose, and saccharin. Known thickening agents
for oily suspensions include, for example, beeswax, hard paraffin,
and cetyl alcohol.
[0125] As used herein, "parenteral administration" of a
pharmaceutical composition includes any route of administration
characterized by physical breaching of a tissue of a subject and
administration of the pharmaceutical composition through the breach
in the tissue. Parenteral administration thus includes, but is not
limited to, administration of a pharmaceutical composition by
injection of the composition, by application of the composition
through a surgical incision, by application of the composition
through a tissue-penetrating non-surgical wound, and the like. In
particular, parenteral administration is contemplated to include,
but is not limited to, subcutaneous, intraperitoneal, intravenous,
intraarterial, intramuscular, or intrasternal injection and
intravenous, intraarterial, or kidney dialytic infusion
techniques.
[0126] Formulations of a pharmaceutical composition suitable for
parenteral administration comprise the active ingredient combined
with a pharmaceutically acceptable carrier, such as sterile water
or sterile isotonic saline. Such formulations may be prepared,
packaged, or sold in a form suitable for bolus administration or
for continuous administration. Injectable formulations may be
prepared, packaged, or sold in unit dosage form, such as in ampules
or in multi-dose containers containing a preservative. Formulations
for parenteral administration include, but are not limited to,
suspensions, emulsions in oily or aqueous vehicles, pastes, and
implantable sustained-release or biodegradable formulations. Such
formulations may further comprise one or more additional
ingredients including, but not limited to, suspending, stabilizing,
or dispersing agents. In one embodiment of a formulation for
parenteral administration, the active ingredient is provided in dry
(i.e. powder or granular) form for reconstitution with a suitable
vehicle (e.g. sterile pyrogen-free water) prior to parenteral
administration of the reconstituted composition.
[0127] The pharmaceutical compositions may be prepared, packaged,
or sold in the form of a sterile injectable aqueous or oily
suspension. This suspension may be formulated according to the
known art, and may comprise, in addition to the active ingredient,
additional ingredients such as the dispersing agents, wetting
agents, or suspending agents described herein. Such sterile
injectable formulations may be prepared using a non-toxic
parenterally-acceptable diluent or solvent, such as water or
1,3-butane diol, for example. Other acceptable diluents and
solvents include, but are not limited to, Ringer's solution,
isotonic sodium chloride solution, and fixed oils such as synthetic
mono- or di-glycerides. Other parentally-administrable formulations
which are useful include those which comprise the active ingredient
in microcrystalline form, in a liposomal preparation, or as a
component of a biodegradable polymer systems. Compositions for
sustained release or implantation may comprise pharmaceutically
acceptable polymeric or hydrophobic materials such as an emulsion,
an ion exchange resin, a sparingly soluble polymer, or a sparingly
soluble salt.
DEFINITIONS
[0128] As used herein, each of the following terms has the meaning
associated with it in this section.
[0129] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e. to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0130] By "nucleic acid" is meant any homopolymer or heteropolymer
of deoxyribonucleosides, ribonucleosides, or nucleoside analogs.
The nucleotide analogs may be any compound known in the art to be
or subsequently discovered to be useful as a structural or
functional analog of a ribonucleoside or a deoxyribonucleoside.
Nucleotide analogs include, but are not limited to nucleotides
comprising bases other than the five biologically occurring bases
(adenine, guanine, thymine, cytosine and uracil). The monomers of
the nucleic acid may be connected by phosphodiester linkages or
modified linkages such as phosphotriester, phosphoramidate,
siloxane, carbonate, carboxymethyl ester, acetamidate, carbamate,
thioether, bridged phosphoramidate, bridged methylene phosphonate,
bridged phosphoramidate, bridged phosphoramidate, bridged methylene
phosphonate, phosphorothioate, methylphosphonate,
phosphorodithioate, bridged phosphorothioate or sulfone linkages,
and combinations of such linkages.
[0131] A nucleic acid "encodes" an RNA or protein product if the
RNA or protein product is formed by transcription or by both
transcription and translation, respectively, of the nucleic acid or
of a reverse transcript of the nucleic acid when the nucleic acid
is RNA.
[0132] A nucleic acid "expression construct" is a nucleic acid
which encodes an RNA or protein product which is formed upon
transcription or upon transcription and translation of the nucleic
acid. RNA expression constructs which can be directly translated to
generate a protein product, or which may be reverse transcribed and
either transcribed or transcribed and translated to generate an RNA
or protein product, respectively, are also included within this
definition.
[0133] "Naked" DNA refers to a nucleic acid vector, generally DNA,
but alternatively comprising another nucleic acid, which is
delivered to a cell in a suspension that does not comprise a
matrix, a virus vector, or a similar structure which contains the
nucleic acid. Naked DNA vectors encompass nucleic acid vectors
which comprise agents (e.g. condensing agents or amphipathic
carriers), in addition to the nucleic acid, which promote uptake of
the nucleic acid by cells.
[0134] By describing two polynucleotides as "operably linked" with
one another is meant that a single-stranded or double-stranded
nucleic acid moiety comprises the two polynucleotides arranged
within the nucleic acid moiety in such a manner that at least one
of the two polynucleotides is able to exert a physiological effect
by which it is characterized upon the other. By way of example, a
promoter operably linked with the coding region of a gene is able
to promote transcription of the coding region.
[0135] As used herein, the term "promoter/regulatory sequence"
means a nucleic acid sequence which is required for expression of a
gene product operably linked with the promoter/regulator sequence.
In some instances, this sequence may be the core promoter sequence
and in other instances, this sequence may also include an enhancer
sequence and other regulatory elements which are required for
expression of the gene product. The promoter/regulatory sequence
may, for example, be one which expresses the gene product in a
tissue specific manner.
[0136] A "constitutive" promoter is one which catalyzes initiation
of DNA transcription at approximately the same level, regardless of
the tissue type of the cell within which it is contained.
[0137] A "tissue-specific" promoter is one which catalyzes
initiation of DNA transcription at different rates in different
tissue types. Generally, an `X tissue-specific` promoter initiation
of DNA transcription at a greater rate in cells of tissue type X
than in cells of a different tissue type.
[0138] A "physiologically responsive" promoter is one which
catalyzes initiation of DNA transcription at different rates,
depending on the presence, absence, or degree of a physiological
state, such as the presence of a particular chemical compound or a
particular histological structure.
[0139] A "pharmacological agent-specific enhancer" is a nucleic
acid element which, when present in an expression construct,
increases expression from the expression construct in the presence
of the pharmacological agent, relative to expression from the
expression construct in the absence of the pharmacological
agent.
[0140] A "ribozyme" is an RNA molecule, or a molecule comprising an
RNA molecule and a polypeptide molecule, which is capable of
specifically catalyzing a chemical reaction, in a manner analogous
to enzymatic catalysis.
[0141] As used herein, a "virus vector" is a nucleic
acid-containing composition which comprises a protein which
naturally occurs in a virus, wherein the composition is capable of
transferring its nucleic acid into the interior of at least one
type of cell when the virus vector is contacted with the cell. A
"gene therapy vector" is a composition of matter which comprises an
expression construct and which can be used to deliver the
expression construct to the interior of a cell.
[0142] A "therapeutic gene product" is a protein or RNA molecule
which, when provided to or expressed in a diseased or wounded
tissue, alleviates, prevents, or inhibits the disease, promotes
healing of the wound, or prevents worsening of the wound.
[0143] An "antisense oligonucleotide" is a nucleic acid molecule
(e.g. DNA, RNA, or a polymer comprising one or more nucleotide
analogs), at least a portion of which is complementary to a nucleic
acid which is present in a cell. The antisense oligonucleotides of
the invention preferably comprise between about twelve and about
fifty nucleotides. More preferably, the antisense oligonucleotides
comprise between about fourteen and about thirty nucleotides. Most
preferably, the antisense oligonucleotides comprise between about
sixteen and about twenty-one nucleotides. The antisense
oligonucleotides of the invention include, but are not limited to,
phosphorothioate oligonucleotides and other modifications of
oligonucleotides, as described herein. Methods for synthesizing
oligonucleotides, phosphorothioate oligonucleotides, and otherwise
modified oligonucleotides are well known in the art (U.S. Pat. No.
5,034,506; Nielsen et al., 1991, Science 254: 1497), and each of
these types of modified oligonucleotides in included within the
scope of the invention.
[0144] As used herein, an "apoptosis-inducing protein" means a
protein which, when expressed in a cell, causes the cell to begin,
accelerate, or continue the process of programmed cell death, which
is characterized by the fragmentation of the cell into
membrane-bound particles that are subsequently eliminated by the
process of phagocytosis.
[0145] "Local" or "localized" delivery of an agent to a cell or to
a tissue of an animal refers to delivery of the agent using a
method that does not deliver the agent systemically to the animal,
and which preferably does not deliver any significant proportion of
the agent to cells or tissue other than that to which delivery is
intended. Numerous compositions and methods are known to be
effective for local delivery, as described herein.
[0146] An agent is delivered to a cell or tissue "in a
sustained-release manner" if the agent is administered to the cell
or tissue in a formulation wherein the cell or tissue is contacted
with the agent for a longer period than it would be if the agent
were administered without the formulation. For example, a sustained
release preparation for delivering a nucleic acid releases the
nucleic acid from the preparation over time, and protects
not-yet-released nucleic acid from degradation (e.g.
nuclease-catalyzed degradation).
[0147] "Diseases and disorders," as used herein refer to any
pathological or other undesirable and abnormal physiological
condition of a cell, regardless of whether the condition is
formally recognized as a `disease.`
[0148] Cells or tissue are "affected" by a disease or disorder if
the cells or tissue have an altered phenotype relative to the same
cells or tissue in a subject not afflicted with a disease or
disorder.
[0149] An "abnormal" animal tissue is one which, when obtained from
an animal afflicted with a disease or disorder, has a phenotype
which is different from the phenotype of same tissue in an animal
of the same type which is not afflicted with the disease or
disorder.
[0150] A "defective" protein is a protein which has an altered
amino acid sequence, relative to the wild type protein, and which
does not exhibit the same type or degree of activity or other
property that the wild type protein exhibits.
[0151] As used herein, "alleviating" a disease or disorder means
reducing the frequency or severity with which a symptom of the
disease or disorder is experienced by a patient.
[0152] A "re-entry circuit" is a conduction pathway in heart tissue
that does not follow the normal impulse progression route, but
instead re-enters partially re-polarized tissue in a sustained
abnormal cycle that results in rapid, uncontrollable heart
rhythms.
[0153] The "interior portion" of a matrix is a portion of the
matrix which does not contact a solvent in which the matrix is
suspended or in which a device or particle coated with the matrix
is suspended or immersed, at least until the matrix has at least
partially biodegraded. It is understood that, in instances in which
multiple layers of matrix are present, the "interior portion(s)" of
the matrix can refer only to the innermost portion of the innermost
layer of the matrix (i.e. the first-deposited layer) or to the
inner portion of each layer of the matrix, with respect to the
first-deposited layer. The interior portion of the matrix does not
include the exterior surface of the matrix, but may include any and
all parts of the matrix that are not exposed on the exterior
surface.
[0154] A material is "biocompatible" with respect to an animal if
the presence of the material in the animal is not injurious to the
animal. By way of example, a biocompatible material does not induce
an immune response to the material when the material is implanted
in the body of an animal.
[0155] A material is "biodegradable" if the material undergoes
decomposition when contacted with a biological system such upon
implantation into an animal. The decomposition may be evidenced,
for example, by dissolution, depolymerization, disintegration, or
by another chemical or physical change whereby the bulk of the
material in the biological system is reduced over time. Such
decomposition may be, but is not necessarily, catalyzed by a
component of the biological system (e.g. an enzyme).
[0156] A material is "in fluid communication" with a cell or tissue
if the material is in contact with a fluid which normally contacts
the cell or tissue, either in vitro or in vivo. Examples of
materials in fluid communication with a cell or tissue include a
material deposited, suspended, or dissolved in a tissue culture
medium in which the cell or tissue is maintained, a material
deposited, suspended, or dissolved in a body fluid which normally
contacts the cell or tissue in an animal, and a material which
physically contacts the cell or tissue.
[0157] As used herein, the term "condensing agent" and grammatical
forms thereof generally refers to molecules such as polycationic
polymers and elemental cations that, because of their size or for
some other reason, are able to condense nucleic acids. A
non-limiting list of polycationic condensing agents which are
suitable for condensing nucleic acids such as DNA may be found in
Lasic (1997, In: Gene Delivery, Lipsows, Ed., CRC Press, Boca
Raton, Fla., pp. 33-37 and 56-61).
[0158] A nucleic acid is "condensed" if, when combined with a
condensing agent, the nucleic acid exhibits reduced nuclease
susceptibility, decreased hydrodynamic diameter, a more
geometrically compact conformation, or reduced susceptibility to
oxidation. Condensation of nucleic acids has been described in the
prior art (e.g. using polylysine) and is well known.
[0159] A "particle" or "particulate formulation" means an object,
or plurality of such objects, having geometric dimensions
compatible with injection, cellular ingestion, or mucous membrane
penetration. Thus, such a particulate formulation typically
comprises, or preferably consists essentially of, spherical or
ellipsoid particles having a maximal geometric dimension of about
50 microns, preferably less than about one micron, and more
preferably, from about 100 nanometers to 500 nanometers.
[0160] A "bulk material" or "bulk formulation" means a monolithic
object, having geometric dimensions in excess of those compatible
with injection, cellular ingestion, or mucous membrane penetration.
Such bulk formulations typically have one or more geometric
dimensions in excess of 50 microns in diameter. Bulk materials may,
for example, be provided in the form of spheres, irregular shapes,
sheets, needles, bars, and the like.
[0161] The "hydrodynamic diameter" of an object such as a molecule
or a particle refers to the diameter of an imaginary sphere which
is traced by rotating the object in all directions around its
center of mass. The hydrodyanamic diameter can be thought of
roughly as the `effective size` of an object rotating rapidly in
space or in solution. By way of example, the hydrodyanamic diameter
of a sphere is the actual diameter of the sphere, and the
hydrodynamic diameter of a rigid rod-shaped object is the length of
the object along its longest axis (i.e. the length of the rod). For
rigid objects, the hydrodynamic diameter is equal to the largest
geometric dimension of the object, measured along a straight
line.
[0162] An "implantable device" means a particle or other object
which can be entirely or partially inserted into the body of an
animal. Implantable devices thus include particles which, when
applied topically to a surface of the animal body, are capable of
being taken up by a tissue or cell of the animal. The means by
which the particle or other object is inserted into the animal body
is not critical, and includes, for example, swallowing, inhalation,
injection, topical application, physical penetration, insertion
into an incision made in the animal body, and the like.
[0163] The invention is now described with reference to the
following Examples. These Examples are provided for the purpose of
illustration only and the invention should in no way be construed
as being limited to these Examples, but rather should be construed
to encompass any and all variations which become evident as a
result of the teaching provided herein.
EXAMPLE 1
Ibutilide Controlled Release Matrices for Preventing Re-Entrant
Atrial Flutter in Dogs
[0164] In the experiments described in this Example, the
Y-atriotomy model for re-entrant flutter in dogs, as described
(Labhasetwar et al., 1998, J. Cardiovasc. Pharmacol. 31:449-455)
was used to demonstrate the efficacy of sustained release of
ibutilide from a right atrial epicardial implant for alleviating
re-entrant atrial flutter.
[0165] Ibutilide sustained release matrices were made using a
multi-layer polyurethane solvent evaporation technique to coat an
epicardial pacing electrode. Inducibility of atrial flutter upon
burst atrial pacing was investigated in dogs which had a coated
electrode implanted therein, compared with dogs which had a
non-coated electrode implanted therein. As indicated in FIG. 1,
inducibility of atrial flutter was significantly reduced in dogs
which had a coated electrode implanted therein ("Ibutilide Cont.
Rel" in FIG. 1). The rate of release of ibutilide from the
electrode in these dogs was approximately 2.4 micrograms per hour
per millimeter of electrode length. No significant inhibition of
inducibility of atrial flutter was observed in dogs which had
non-coated electrodes implanted therein or in dogs which were
systemically administered a dose of ibutilide equivalent to that
provided by the polymer. Electrophysiologic studies demonstrated
that atrial ibutilide delivery did not significantly affect
ventricular electrophysiologic parameters.
[0166] The results of the studies described in this Example
demonstrated the site-specific therapy directed at the right atrial
myocardium can be effective to suppress re-entrant atrial
flutter.
EXAMPLE 2
HERG Gene Therapy of Re-Entrant Atrial Flutter in a Dog Model
[0167] The experiments described in this Example demonstrate that
DNA-containing biodegradable polymeric microparticles and
nanoparticles are useful for delivery of nucleic acid vectors to
animal cells.
[0168] A reverse gene therapy method is used to locally deliver a
nucleic acid vector comprising a defective HERG protein to the
right atrium of dogs in order to effect site specific
overexpression of HERG (A561V) at that site.
[0169] The nucleic acid vector is delivered in the form of a
plasmid suspended in nanoparticles of a polylactic-polyglycolic
acid (PLGA) copolymer having poly-L-lysine (PLL) incorporated
therein. The plasmid DNA is in a condensed form. Prior to using the
nucleic acid vector encoding defective HERG, a reporter vector
comprising a nucleic acid encoding a bacterial .beta.-galactosidase
or a luciferase operably linked with a CMV promoter is used to
assess the level and localization of expression effected by
PLGA/PLL nanoparticle delivery of the vector. Nucleic acid vector
bioavailability distribution to distal sites is assessed using PCR.
The dog model of cardiac arrhythmia is based upon re-entrant atrial
flutter which is induced after a Y-atriotomy incision, as described
(Frame, 1996, Cardiol. Clin. 14:471-481).
Formation of DNA-PLGA Particles
[0170] The plasmid described in this Example was formulated for
sustained release by suspending it a biodegradable polymer
microparticle that could be injected into a specific tissue site in
the canine atrial myocardium.
[0171] The microparticles were formed using an oil-in-water
emulsion of a PLGA copolymer. Sonication of the emulsion (e.g. to
control particle size) was avoided to minimize damage to the
plasmid. Instead, a "salting-out" technique was used to control the
particle size. PLGA (3 milligrams per milliliter) was suspended in
chloroform, and a small volume (ca. 100 microliters) of an aqueous
plasmid DNA suspension (comprising about 10 milligrams per
milliliter DNA) was added to this, while vortexing the mixture at
30,000 rotations per minute at 0.degree. C. for one minute, to
generate an initial emulsion.
[0172] The initial emulsion was combined with an aqueous solution
comprising either no or 1 molar CaCl.sub.2 and (0.1-0.5% v/v)
polyvinyl alcohol (PVA) as an emulsifier. This mixture was vortexed
at 0.degree. C. for one minute to generate a second emulsion. The
mixture was ultracentrifuged to separate microparticles, and the
microparticles were repeatedly resuspended and ultracentrifuged to
remove non-incorporated plasmid. Particle size analysis was
performed using a laser light scattering apparatus (NICOMP;
Brookhaven Labs, New York, N.Y.), and particle morphology was
assessed by scanning electron microscopy. Plasmid-containing
microparticles having an average diameter of about 2.7 micrometers
were made when 1 molar CaCl.sub.2 was included in the
PVA-containing phase; microparticles having an average diameter of
about 4.0 micrometers were made when the PVA-containing phase did
not contain CaCl.sub.2.
[0173] The rate of release of DNA from the microparticles was
investigated by incubating the particles in vitro in a solution
comprising 0.1 molar Tris buffer at pH 7.4, 0.01 molar EDTA, and
these data demonstrated that the DNA entrapped within the
microparticles was made available with an initial burst phase of
release, followed by an exponentially declining release rate.
Nearly complete release of DNA from the microparticles was effected
by 30 days incubation, as indicated in FIG. 2. In FIG. 2,
formulation B comprised microparticles initially consisting of
about 2% (w/w) plasmid, formulation D comprised microparticles
initially consisting of 5% (w/w) plasmid, and formulation E
comprised microparticles initially consisting of 11% (w/w) plasmid.
No evidence of plasmid DNA fragmentation was detected by agarose
gel electrophoresis of DNA released from the microparticles.
[0174] Transformation studies using a plasmid encoding a luciferase
protein were performed by contacting type 293 cells with the
plasmid. The plasmid was incorporated into DNA-microparticles as
described herein, using CaCl.sub.2. As indicated in FIG. 3, the
CaCl.sub.2 microparticle synthesis protocol resulted in
significantly enhanced transfection, and a dose-response
relationship was evident, with respect to the amount of DNA loaded
into the microparticles.
Formation of DNA-PLGA Particles
[0175] The plasmid described in this Example was formulated for
sustained release by suspending it a biodegradable polymer
nanoparticle that could be injected into a specific tissue site in
the canine atrial myocardium.
[0176] In these experiments nanoparticles having sub-micrometer
diameters were made, the nanoparticles comprising PLGA and PLL.
Nanoparticle formulations procedures were identical to those
described above for preparation of microparticles, with the
following changes. PLL having a molecular weight of 4000 was added
to the PVA-containing phase at a concentration of 0.5 milligrams
per 500 milligrams PVA in 10 millimolar Tris buffer adjusted to pH
7.4 using HCl and containing 10 micromolar EDTA. The second
emulsion was ultracentrifuged, rinsed, and freeze-dried.
[0177] Analysis of the nanoparticles made by this method revealed
that nanoparticles comprising 3% DNA, by weight, had an mean
diameter of about 500 nanometers, and that more than 86% the DNA
used to make the particles was incorporated into the nanoparticles.
Other characterization procedures indicated that PLL condensed the
plasmid DNA in the microparticles. For example, studies of DNA
release from nanoparticles in the Tris-EDTA buffer indicated very
slow DNA elution, as indicated in FIGS. 4A and 4B. However, if the
0.1% (w/v) sodium dodecyl sulfate was included in the Tris-EDTA
buffer, the rate of DNA release from the nanoparticles was
increased significantly. Further by way of example, incubation of
the nanoparticles in an organic solvent (CHCl.sub.3) followed by
aqueous recovery of the DNA indicated that only after incubating
the nanoparticles with SDS or trypsin could released DNA be
detected. These observations also indicate that the plasmid was
suspended in or on the nanoparticles in the form of a DNA-PLL
condensate. Comparisons with CaCl.sub.2-DNA microparticles prepared
as described herein and DNA-PLL-PLGA nanoparticles are indicated in
Tables I and II.
TABLE-US-00001 TABLE I A comparison of the physical characteristics
of DNA-CaCl.sub.2 microparticle and DNA-PLL-PLGA nanoparticle 48 hr
DNA Mean 48 hr DNA release (in TE DNA capture Particle release (in
Buffer + 0.1% Preparation Efficiency.sup.a Size TE buffer) SDS)
PLGA-CaCl.sub.2 43.3% 2.7 .mu.m 20% NM.sup.b Microparticles
PLGA-PLL 86.3% 476 nm 1.7% 44% Microparticles Notes: .sup.aDNA
capture efficiency means the percentage (by weight) of the DNA used
to make the particles which was incorporated into the particles.
.sup.bNM means not measured.
TABLE-US-00002 TABLE II Size distribution and surface charge (zeta
potential) of DNA-PLL-PLGA nanoparticles (pHOOK-LacZ DNA was used)
Formulation Particle size zeta potential PLGA 496.5 .+-. 6.1 nm
-32.13 .+-. 1.47 mV DNA/PLGA 522.5 .+-. 4.7 nm -35.01 .+-. 2.47 mV
PLGA-PLL 510.6 .+-. 7.4 nm -27.99 .+-. 0.70 mV DNA-PLL-PLGA 507.5
.+-. 8.9 nm -38.45 .+-. 1.27 mV
[0178] As is evident from Table II, incorporation of PLL into PLGA
nanoparticles resulted in a more positively charged nanoparticle.
However, the charge of the DNA-PLL-PLGA was significantly more
negative than the charge of the PLL-PLGA particle, indicating that
the DNA neutralized the charge of PLL.
[0179] PLL-containing PLGA nanoparticles comprising a plasmid which
encoded luciferase were used to transform type 293 cells. As
indicated in FIG. 4C, significant enhancement of transformation
after 48 hours incubation of the cells with the PLL-PLGA-DNA
nanoparticle, relative to the transformation achieved using cells
incubated for 48 hours with PLGA nanoparticles which did not
comprise DNA.
[0180] DNA-PLGA Sustained Release Coatings: Suture-Based Gene
Delivery and Atrial Myocardial Results
[0181] Chromic sutures were coated with a DNA-PLGA emulsion, which
was prepared as described herein. This coated suture was used to
repair subcutaneous wounds made in rats. In vitro release kinetics
of DNA from a suture coated with a DNA-PLGA polymer containing 0.5%
(w/w) DNA are indicated in FIG. 5. These data indicate that,
following a brief burst phase, the rate of release of DNA from the
suture is nearly constant.
[0182] A chromic suture was coated with a PLGA-DNA polymer using
the emulsion technique described herein. The DNA was a plasmid
comprising an expression construct encoding human alkaline
phosphatase. Transformation of skeletal muscle cells was
demonstrated by using this coated suture to close subcutaneous
skeletal muscle wound sites in rats. The amount of suture used per
wound site contained approximately 250 micrograms of plasmid DNA.
Tissue recovered from wound sites was assayed using well known
methods to determine expression of alkaline phosphatase at the
site. As indicated in FIG. 6, significantly greater alkaline
phosphatase activity was detected at wound sites closed using the
DNA-PLGA coated suture than at wound sites closed using a suture
which did not contain DNA.
[0183] This DNA-PLGA coated suture was then used in a series of
atriotomy studies to determine if the coating could be used to
transform cells of the atrial myocardium. In two-dog studies, a
one-centimeter atriotomy incision was made in the right atrial
appendage of each of four dogs. The atriotomy incision was repaired
either with the PLGA-DNA coated chromic suture or with a chromic
suture which did not comprise DNA. Atrial tissue was recovered from
the dogs following euthanasia. As indicated in FIG. 7,
significantly greater alkaline phosphatase activity was detected in
atrial tissue closed using the DNA-PLGA coated suture than in
atrial tissue closed using a suture which did not contain DNA.
EXAMPLE 3
Gene Therapy Using a Cardiac Myocyte Model
[0184] The Experiments described in this Example may be used to
demonstrate that a nucleic acid vector comprising an expression
vector encoding the HERG (A561V) protein may be delivered to atrial
myocardium cells in order to alleviate re-entrant atrial
flutter.
CHO Cell Transformation Studies
[0185] Transformation of Chinese Hamster Ovary (CHO) cells in vitro
is used to investigate the mechanism(s) by which the cells are
transformed using DNA-PLGA-PLL nanoparticles. Transformation of CHO
cells is also used to investigate the effects of nanoparticle
formulation parameters (e.g. the effect of including or omitting
PLL from the particles) on the steps involved in nanoparticle
uptake, endosomal or lysosomal transit of the nanoparticles within
the cells, and nuclear expression of vector DNA. Properties of
transformed CHO cells which are assessed include, but are not
limited to, histological or immunological examination of the
location of vector DNA expression, enzyme activity of an enzyme
encoded by the vector DNA, and assessment cell death or growth
inhibition mediated by PLL or PLGA.
[0186] CHO cells are selected for several reasons. Other
investigators have demonstrated successful transfection of these
cells using vectors comprising mutant genes responsible for the
Long QT Syndrome and CHO cells in culture (Sanguinetti et al.,
1996, Proc. Natl. Acad. Sci. USA. 93:2208-2212; Sanguinetti et al.,
1996, Nature 384:80-83; Sanguinetti et al., 1995, Cell 81:299-307).
CHO transfection experiments are performed using DNA vectors which
comprise a CMV promoter operably linked with a nucleic acid
encoding the HERG (A561V) protein.
[0187] Cardiac Myocyte Transformation Studies
[0188] Primary cardiac myocytes transformation is performed using
either of two candidate promoters having specificity for cardiac
tissue. Transformation efficiency using a DNA vector comprising a
CMV promoter, the .alpha.-myosin heavy chain (.alpha.-MyHC)
promoter (Robbins, 1997, Trends Cardiovasc. Med. 7:185-191; Milano
et al., 1994, Proc. Natl. Acad. Sci. USA 91: 10109-10113), or the
atrial natriuretic factor (ANF) promoter (Field, Science
239:1029-1033), is determined using rat primary cardiac myocytes in
culture. These latter two promoters may be inserted into the vector
DNA using a recombinant methodology, as described (Robbins, 1997,
Trends Cardiovasc. Med. 7:185-191; Milano et al., 1994, Proc. Natl.
Acad. Sci. USA 91: 10109-10113; Field, Science 239:1029-1033). The
vector DNA may further comprise a reporter nucleic acid (e.g. a
cDNA encoding luciferase) or a pathological nucleic acid (e.g. a
nucleic acid encoding HERG (A561V) protein).
[0189] Plasmid DNA Transfection Assays
[0190] CHO cells are used as a model cell culture system to
evaluate the degree of episomal transformation, gene expression,
and enzyme activity of a .beta.-galactosidase expression construct
following delivery of DNA-PLL-PLGA nanoparticles to the cells. Upon
completion of these initial studies, primary rat neonatal cardiac
myocyte cells in culture are used to study the efficacy of
transformation of those cells using a HERG (A561V) protein
expression construct in a DNA-PLL-PLGA nanoparticle.
[0191] Cell cultures in Dulbecco's Modified Eagle Medium containing
1% (v/v) fetal bovine serum and 1% (w/v) penicillin or streptomycin
are approximately 25% confluent for all transfection experiments.
The cell culture media are removed and replaced with fresh media
containing DNA-PLL-PLGA nanoparticles dispersed therein. The
nanoparticle equivalent of 10, 20, 50, or 100 micrograms of DNA is
added to each culture plate in order to determine the operable
range of DNA dose for the cell culture system. For comparison, a
standard calcium phosphate-mediated DNA transformation is performed
as a positive control. At the conclusion of each 48 hour study,
transformed cells are either prepared for immunohistochemistry or
cytochemistry or scraped off the culture dish for enzymatic assay
of gene expression.
[0192] Transformed cells harvested from cultures are fixed for 10
minutes using a 0.5% (v/v) glutaraldehyde solution in phosphate
buffered saline. The cells are rinsed and incubated for 10 minutes
at room temperature (i.e. about 20.degree. C.) with a 1 millimolar
MgCl.sub.2 solution in pH 7.4 phosphate buffered saline. The cells
are then stained for 5 hours using an X-gal staining solution,
comprising 1 milligram of X-gal per milliliter, 5 millimolar
K.sub.3Fe(CN).sub.6, 5 millimolar K.sub.4Fe(CN).sub.6, and 1
millimolar MgCl.sub.2 in pH 7.4 phosphate buffered saline. Samples
are embedded in paraffin and prepared for light microscopy after
post-fixation treatment with a phosphate buffered solution
comprising 4% (v/v) paraformaldehyde and 0.5% (v/v)
glutaraldehyde.
[0193] .beta.-galactosidase activity in cell lysate is detected
using a Galacto-Light Plus" chemiluminescent reporter system, as
described (Jain et al., 1991, Anal. Biochem. 199:119-124). The
amount of .beta.-galactosidase activity in the sample is determined
using a luminometer, and enzyme activity is normalized to account
for protein content.
[0194] Immunohistochemistry is performed to localize protein
expression in tissue or cells. Because reporter assays frequently
underestimate the extent of transfection (Couffinhal et al., 1997,
Hum. Gene Ther. 8: 929-934), immune techniques are also used to
assess the degree of transfection. Fixation is performed using 10%
(v/v) neutral buffered formalin, followed by either cryostat or
paraffin sectioning. Sections mounted on slides are treated first
with ammonium chloride or sodium borohydride to quench extraneous
aldehyde groups, or with hydrogen peroxide to block endogenous
peroxidase activity, and then with 2% (w/v) gelatin in phosphate
buffered saline to block non-specific protein binding. The primary
antibody of interest (which binds specifically with either
.beta.-galactosidase or with FLAG (see below)) is applied, followed
by an appropriate secondary antibody (i.e. which binds specifically
with the primary antibody) conjugated to a marker such as a
fluorescent label (e.g. fluorescein or rhodamine) or an enzyme
(e.g. horseradish peroxidase). Microscopic slides are then assessed
for the immune distribution of the protein of interest, and the
results are compared with the reporter-specific histochemistry and
the level of secreted enzyme activity.
[0195] Myocyte Protocols
[0196] Primary neonatal cardiac myocyte cultures are used to assess
model myocardial formulation parameters and expression conditions
for a nucleic acid vector of interest. An established methodology
is used to create primary cultures of rat neonatal ventricular
myocytes (Parker et al., 1990, J. Clin. Invest. 85:507-514; Thaik
et al., 1995, J. Clin. Invest. 96:1093-1099). Sprague-Dawley rats
are used at two days of age. Hearts are freshly harvested and
cultured as described (Parker et al., 1990, J. Clin. Invest.
85:507-514; Thaik et al., 1995, J. Clin. Invest. 96:1093-1099).
Typically after overnight incubation in medium containing 5% (v/v)
horse serum, the medium is replaced by serum-free medium.
Transfection studies are then performed as described (Parker et
al., 1990, J. Clin. Invest. 85:507-514; Thaik et al., 1995, J.
Clin. Invest. 96:1093-1099), using methodology comparable to that
used for CHO cells, as described herein.
[0197] In order to determine any cytotoxic effects that the PLGA or
polylysine formulation may have, or to detect another unexpected
toxicity, representative cell culture plates are assessed by
microscopy to determine the extent of necrotic cell death, as
described (Subramanian et al., 1995, Cell Growth Differ. 6:
131-137) and apoptosis. Apoptosis is determined using the terminal
transferase-mediated dUTP-biotin nick end-labeling (TUNEL) assay,
as described (Kirshenbaum et al., 1996, Dev. Biol. 179:402-411).
Initial studies are performed using myocytes involve nanoparticles
comprising reporter DNA, and repeat the studies performed using CHO
cells, in order to document any difference(s) between the two cell
lines.
[0198] Once comparable data have been generated, the myocytes are
used to study a nucleic acid vector comprising an expression
construct encoding the candidate therapeutic gene, HERG (A561V).
Because no antibody is available that will distinguish the wild
type HERG protein from the HERG (A561V) protein, an epitope (FLAG)
tag is incorporated at the amino terminal end of the HERG (A561V)
expression construct. HERG (A561V) expression is monitored by
monitoring the presence of the octapeptide FLAG" (Eastman Kodak)
sequence, as described (Chubet et al., 1996, Biotechniques
20:136-141; Shelness et al., 1994, J. Biol. Chem.
269:9310-9318).
[0199] Therapeutic Gene Studies Using a Reverse Gene Therapy
Vector
[0200] A nucleic acid (e.g. a cDNA) encoding the mutant K.sup.+
channel gene HERG (A561V) is operably linked with the CMV promoter,
the .alpha.-MyHC promoter, or the ANF promoter to form a HERG
(A561V) expression construct. Other potentially cardiac-specific
promoters have been described and may optionally be used in the
nucleic acid vector described herein. These promoters include
cardiac .alpha.-actin (Biben et al., 1996, Develop. Biol.
173:200-212) and MCLC2v (Hunter et al., 1995, J. Biol. Chem.
270:173-178). The HERG (A561V) expression construct is incorporated
into the pSP64 transcription vector using standard methods. The
HERG (A561V) expression construct is also inserted into a pFLAGCMV2
plasmid (Eastman-Kodak), as described (Chubet et al., 1996,
Biotechniques 20:136-141; Shelness et al., 1994, J. Biol. Chem.
269:9310-9318). The pFLAGCMV2 plasmid comprises the FLAG sequence,
a polylinker region for recombination, and the CMV promoter.
Following fusion of the FLAG" coding sequence and the HERG (A561V)
coding sequence, the recombinant protein expressed is tagged with
the FLAG" octapeptide sequence to form a fusion protein.
[0201] The FLAG" octapeptide sequence on the HERG(A561V)-(FLAG"
octapeptide) fusion protein can be detected using known
immunohistochemical methods (Chubet et al., 1996, Biotechniques
20:136-141; Shelness et al., 1994, J. Biol. Chem. 269:9310-931)
which involve use of an Anti-FLAG" Monoclonal Antibody (M5). Thus,
the presence of FLAG" octapeptide indicates expression of HERG
(A561V) protein, and this immunohistochemical assay may be used to
localize the HERG (A561V)-FLAG fusion protein in order to determine
transformation efficiency, membrane localization, and tissue
distribution of the fusion protein.
[0202] Animal Model Experiments
[0203] Experiments are performed using dogs as a model of
re-entrant atrial flutter in order to determine an optimal method
of delivery of nanoparticles to atrial myocardium. The spatial
distribution of the nanoparticles within the atrial myocardium and
distal cardiac structures is assessed following delivery, using
fluorescently-labeled particles. Myocardium and other cardiac
tissues transformed using a nucleic acid vector comprising either a
reporter construct or the FLAG-HERG conjugate is examined using
specific reporter assays or immunolocalization assays in order to
determine the distribution and extent of transformation effected
using a given vector. Both sectioned samples and tissue planes cut
en face are used to perform these assays, using established
techniques (e.g. Mondy et al., 1997, Circ. Res. 81:320-327). The
effect of delivery of nanoparticles comprising an expression
construct encoding the HERG (A561V) protein upon induction of
atrial flutter and related ventricular and atrial
electrophysiologic parameters is assessed.
[0204] Short Term (72 Hour) Dog Experiments
[0205] The goals of these acute dog studies are to investigate
DNA-containing nanoparticle delivery techniques and early events
involved in the mechanisms of the distribution of
nanoparticle-mediated transfection in the canine myocardium. These
72 hour studies are used to determine optimal nucleic acid vector
delivery conditions, the acute distribution of nanoparticles in the
re-entry circuit, and the extent of any acute cardiac or systemic
spread of the nucleic acid vector. These studies are also used to
determine whether local delivery of DNA-containing nanoparticles
affects inducibility of atrial flutter or other electrophysiologic
parameters. Using the Frame Y-incision model, a DNA-containing
nanoparticle suspension is injected using a 27 gauge needle into
the atrial myocardium of each dog, just below the subtransverse
incision site. This juncture of the reentry loop is critical, and
conduction block in this region should limit or prevent
inducibility of atrial flutter.
[0206] Non-recovery studies initially involve use of fluorescently
labeled nanoparticles 500 nanometers in diameter Ultrabrite"
(Polysciences, Warrington, Pa.). Histology studies are performed to
determine the distribution of fluorescently labeled nanoparticles
at the site of administration and adjacent myocardial regions. Once
ideal nanoparticle concentration and delivery conditions have been
established, a series of 72 hour studies are performed using
nanoparticles comprising a reporter construct in order to determine
expression of the reporter construct in the atrial myocardium,
expression at remote cardiac sites, and acute bioavailability in
the atrial myocardium using PCR analyses with appropriate primers.
Local and distal myocardium, liver, lung, kidney, and gonads are
sampled for these assays.
[0207] Chronic Dog Studies
[0208] The goals of these chronic dog studies are to examine
expression and effects on atrial flutter effected by administration
of nanoparticle formulations that are judged to be optimal in cell
culture studies and acute dog studies. Initial experiments focus on
reporter studies to determine the extent of expression, examining
both the percentage of nuclei in the region of interest which
express the .beta.-galactosidase reporter protein. The initial
experiments also indicate the effect(s) of nanoparticle delivery on
preventing atrial flutter and related electrophysiologic
parameters. Effects of nanoparticle delivery on distal cardiac
sites, as well as distal organs, are examined both for reporter
protein expression and for the presence of nucleic acid vector, as
determined by PCR.
[0209] Transformation of atrial myocardium using nanoparticles
comprising an expression construct encoding HERG (A561V) protein
operably linked with a CMV promoter or a cardiac tissue specific
promoter is though to cause conduction block and thereby inhibit
atrial flutter. This is confirmed using the methods described
herein. The tricuspid annulus from each chronic dog is explanted at
the time of sacrifice (i.e. 4 weeks post-surgery) and examined to
determine precise regional differences in cardiac conduction
parameters in the reentry circuit, as described (Fei et al., 1997,
Circ. Res. 80:242-252). Transformation effected using nucleic acid
vector-containing nanoparticles is compared with transformation
effected by injection of the nucleic acid vector alone (i.e. not
contained in or on a nanoparticle).
[0210] Animal Model Procedure: "Y"-Shaped Lesion/Atriotomy
Studies
[0211] Atrial flutter is induced in dogs using a modification of
published procedures (Frame, 1986, Circ. Res. 58:495-511; Buchanan
et al., 1993, J. Cardiovasc. Pharmacol. 33:10-14). Male mongrel
dogs weighing 25 to 35 kilograms are used in these model studies.
General anesthesia using sodium pentobarbital is followed by a
right thoracotomy. A "Y"-shaped lesion right atrial incision is at
the inferior board of the atrium along the inferior vena cava as
described (Frame, 1986, Circ. Res. 58:495-511; Frame et al., 1987,
Circulation 5:1155-1175; Boyden et al., 1989, Circulation
79:406-416). The strategy of this approach is to create a permanent
conduction block in the right atrium that results in a re-entry
loop for atrial impulse conduction for inducing atrial flutter. The
"Y"-shaped lesion is closed using 4-0 silk with a continuous
interlocking suture, the spacing between each visible suture not to
exceed 5 millimeters. Burst pacing episodes can be used to create a
reproducible re-entrant circuit involving a pathway around the
tricuspid annulus. This model, which induces physiological
responses which closely parallel those observed for atrial flutter
in humans (Frame, 1996, Cardiol. Clin. 14:471-481), allows atrial
flutter to be induced in both an acute and chronic animal study
setting. Atrial flutter in this model can also be stopped and
reinduced using appropriate pacing protocols as described (Frame et
al., 1986, Circ. Res. 58:495-511; Frame et al., 1987, Circulation
5:1155-1175; Boyden et al., 1989, Circulation 79:406-416).
[0212] Atrial Flutter Induction
[0213] Each experimental atrial flutter induction study comprises
eight or more attempts to inducing atrial flutter using burst
pacing at 3 milliamp or greater (double capture threshold) for 3
seconds at cycle lengths of 150 milliseconds, 140 milliseconds, 130
milliseconds, 120 milliseconds, 110 milliseconds, and 100
milliseconds. Atrial flutter that continues for five minutes or
more is defined as persistent flutter, indicating successful
induction. The frequency of inducibility with respect to the number
of sustained episodes or attempts to induce atrial flutter before
and after placement of a nucleic acid vector delivery system, or a
non-DNA-containing implant, is used as a basis for measuring drug
effects. Atrial flutter episodes are terminated after five minutes
by overdrive pacing as described (Labhasetwar et al., 1994, J.
Cardiovasc. Pharm. 24:826-840; Frame et al., 1986, Circ. Res.
58:495-511; Frame et al., 1987, Circulation 5:1155-1175; Boyden et
al., 1989, Circulation 79:406-416), or if necessary, by
countershock. Animals are allowed at least 5 minutes between
induction to be certain of rhythm and blood pressure stability.
Animals which are not inducible for sustained flutter are excluded
from these studies.
[0214] Arrhythmia and Electrophysiologic Endpoints
[0215] Animals investigated in this model, both in acute and
chronic studies are assessed from the point of view of a number of
parameters affecting atrial arrhythmias. These include the
following: 1. Atrial flutter induction: the frequency of successful
inductions before and after nanoparticle delivery; 2. Atrial
impulse conduction, as assessed by multi-electrode studies, as
described herein; 3. Electrophysiologic parameters: atrial and
ventricular effective refractory periods, sinus node recovery time,
atrial flutter cycle length, ventricular rate response, conduction
time, and AV-node conduction time.
[0216] Epicardial Mapping and Related Electrophysiologic
Assessment
[0217] The non-recovery procedures and the terminal procedure in
chronic dogs characterize the sequence of activation of the reentry
loop in the "Y"-shaped lesion model. The technique for epicardial
mapping utilizes a published methodology (Frame, 1986, Circ. Res.
58:495-511). FIG. 8 illustrates the placement of epicardial
electrodes. Electrodes #1 through #6 in FIG. 8 and a right atrial
appendage recording site (Site #13 in FIG. 8) are used. Bipolar
platinum epicardial electrodes are used, and are connected with a
CODAS analog-to-digital conversion system and computer. The types
of measurements of greatest interest are the sequence of activation
times for impulse spread beginning from the first electrode site as
illustrated in FIG. 8, with respect to changes due to implantation
of a controlled release drug delivery system.
[0218] The general protocol to be used in these epicardial mapping
studies and investigations of the reentry mechanism involves the
following. Inducibility is determined, in terms of whether animals
develop atrial flutter following the creation of a "Y"-shaped
lesion. Next, epicardial electrodes are placed as illustrated in
FIG. 8 and described herein. The sequence of epicardial activation
is determined and recorded. Epicardial ventricular electrodes are
implanted, and the animals are outfitted with a transvenous
monophasic action potential electrode catheter. Pacing is carried
out with a separate right atrial pacing electrode in acute
(non-recovery) studies. Electrophysiological measurements of
interest include comparisons made during pacing of the atrial
effective refractory period before and after drug system placement,
ventricular effective refractory period, changes in cycle length,
and atrial flutter cycle length. The monophasic action potential
duration in the right atrium, and in the right ventricle is also
determined during pacing. All of these measurements, and sequence
of activation studies are performed before and after acute drug
administration. More extensive atrial mapping may be performed if
the electrophysiologic and atrial flutter data indicate this to be
necessary or desirable.
[0219] All chronic studies, at their termination, involve
explanation of the tricuspid ring, and in vitro studies are
performed. Typical preparations involve rapidly excising the heart
at the time of euthanasia, and dissecting it in cold Tyrode"s
solution, equilibrated with 95% oxygen and 5% CO.sub.2. The
tricuspid ring is dissected and mounted with the endocardium upward
in a tissue bath. The tricuspid annulus is instrumented using
electrodes, as illustrated in FIG. 9, focusing on the area of
nucleic acid vector delivery or control nanoparticle injection. The
goal of these studies is to investigate regional differences in
conduction attributable to expression of either reporter constructs
or expression constructs, such as an expression construct encoding
HERG (A561V) protein. Following the end of the electrophysiologic
study period, morphology sampling is performed, and the orientation
of samples for microscopic investigation is noted with respect to
the site of nanoparticle delivery, the site of expression of the
nucleic acid vector, the location of electrophysiologic recording
regions, and the proximity to the transverse incision and the
remainder of the reentry circuit.
[0220] Morphologic techniques are used to image reporter
expression, both with X-gal staining, and immunohistochemistry to
detect .beta.-galactosidase activity. In animals transformed with
HERG (A561V), immunohistochemical studies are performed using a
commercially available monoclonal antibody to the FLAG" octapeptide
fused with HERG (A561V). Routine hematoxylin- and eosin-stained
microscopy are performed for morphologic assessment of any cellular
response to nanoparticle administration or toxicity related to the
polylysine conjugates.
EXAMPLE 4
Incorporation of an Ion Channel Gene Mutation Associated with the
Long QT Syndrome (Q9E-hMiRP1) in a Plasmid Vector for Site Specific
Arrhythmia Gene Therapy
[0221] In the present example, we investigated a plasmid vector
containing a specific mutation in a human cardiac potassium channel
gene that is responsible for one variant of the Long QT syndrome
(LQTS), as a construct for site specific gene therapy of re-entrant
atrial arrhythmias. LQTS presents as either an inherited or
acquired disorder that predisposes to life threatening ventricular
arrhythmias. Recent molecular genetic studies have demonstrated
that LQTS is caused by mutations in genes that encode cardiac ion
channels. Mutations in five ion channels have been linked to
various LQTS's: KvLQT1 for LQTS1, HERG for LQTS2, SCN5A for LQT3,
MinK for LQTS5 and hMiRP1 for LQTS6 (Leenhardt et al., 2000). Other
studies (Abbott et al, 1999) have demonstrated that drug induced
LQTS can occur due to genetic mutations in the MinK-related peptide
1 (hMiRP1) subunit of the I.sub.Kr (HERG) potassium channels. A
patient with a sporadic missense mutation (Q9E-hMiRP1) developed
life threatening ventricular arrhythmias following administration
of the antibiotic, clarithromycin (Abbott et al, 1999). Patch clamp
studies demonstrated Q9E-hMiRP1 channels were 3-fold more sensitive
to clarithromycin induced diminution of potassium inward rectifier
currents than wild type (Abbott et al, 1999). These
clarithromycin-induced electrophysiologic effects closely resemble
those associated with Class III anti-arrhythmic agents, that are
commonly used to treat either atrial or ventricular arrhythmias.
Thus, the present studies sought to investigate whether the site
specific delivery of Q9E-hMiRP1 plasmid DNA vectors could be used
to for regional atrial myocardial treatment of cardiac arrhythmias,
with modulation of electrophysiologic activity via clarithromycin
administration, thereby hypothetically disrupting regional
re-entrant arrhythmia pathways. The rationale for these studies was
also based in part on the hypothetical safety advantage of using a
LQTS-based vector in the atrial myocardium, since LQTS does not
involve atrial rhythm abnormalities. Thus, over-expressing a gene
such as Q9E-hMiRP1 in the atrial myocardium would be unlikely to be
pro-arrhythmic for ventricular arrhythmias.
[0222] We sought to use plasmid DNA vectors in these investigations
rather than viral constructs. However, the efficiency of transgene
expression of plasmid vectors is characteristically far less than
viral vectors. Thus, these investigations also studied a novel
plasmid DNA delivery system using DNA-anti-DNA antibody-cationic
lipid (DAC) heteroplexes, that were hypothesized to increase
plasmid DNA transfection activity compared to DNA-cationic lipid
(DC) complexes or naked DNA, due to the nuclear targeting
characteristics of the anti-DNA antibody that was used. Previous
investigations (Avrameas et al., 2001) had shown nuclear entry of
some, but not all anti-DNA antibodies conjugated with polylysine.
These studies demonstrated enhanced transfection due to the
anti-DNA antibody-polylysine conjugates in vitro, but not in vivo
(Avrameas et al., 1999). In the present example, the following
experiments were performed for validating the feasibility of this
anti-arrhythmia gene therapy approach:
[0223] 1. The creation and characterization of bicistronic plasmid
DNA vectors for overexpressing either wild-type hMiRP1 or the
Q9E-hMiRP1 mutation, each with a C-terminus FLAG peptide to
facilitate hMiRP1 immunodetection, and also encoding the green
fluorescent protein (GFP).
[0224] 2. Establishment of stable cell lines overexpressing either
Q9E-hMiRP1 or hMiRP1 to investigate the membrane localization of
the overexpressed ion channel genes, and to study the associated
electrophysiologic changes, including clarithromycin
responsiveness. We compared HEK293 cells, which do not
constitutively express the HERG subunit hMiRP1, to SH-SY5Y cells
that normally express this channel protein. We also sought to learn
if the multi-functional plasmid vectors used would influence the
expected electrophysiologic characteristics of Q9E-hMiRP1.
[0225] 3. Formulation and mechanistic characterization of DAC
heteroplexes for plasmid DNA delivery in vitro and in vivo.
[0226] 4. Investigation of results from in vivo delivery of both
hMiRP1 and Q9E-hMiRP1 plasmids to pig atrial myocardium, using DAC
heteroplexes.
[0227] The following materials and methods are provided to
facilitate the practice of Example 4.
[0228] Cell Culture: Human embryonic kidney cells (HEK293) stably
expressing HERG (a gift from Dr. Craig T. January; University of
Wisconsin, Madison, WS) were cultured in minimum essential medium
(MEM) supplemented with 10% (v/v) fetal bovine serum (FBS, Hyclone,
Logan, Utah) and 1 mg/ml gentamycin (G418, Life Technologies Inc.,
Gaithersburg, Md.), 1 mM sodium pyruvate, 0.1 mM non-essential
amino acids, and (10 U/10 .mu.g/ml penicillin/streptomycin (P/S)
solution. Human neuroblastoma SH-SY5Y cells (a gift from Dr.
Naohiko Ikegaki; Children's Hospital of Philadelphia, Pa.) were
grown in RPMI 1640 medium containing HEPES buffer and L-Glutamine,
supplemented with 10% FBS, 1% L-Glutamine, 800 .mu.g/ml G418, P/S
solution, and 5 ml OPI. Rat arterial smooth muscle (A10) cell lines
were obtained from American Tissue Type Collection (Gaithersburg,
Md.) and were cultured in M199 containing 10% (v/v) FBS and P/S
solution. Cells were maintained in 5% CO.sub.2 at 37.degree. C. All
cell culture media and related supplies were purchased from Life
Technologies (Gaithersburg, Md.).
[0229] Plasmid Vectors: An expression plasmid encoding for Green
Fluorescent Protein (GFP) under the control of the CMV promoter was
obtained from Clontech (Palo Alto, Calif.). The hMiRP1 and
Q9E-hMiRP1 plasmids were created as follows. The full-length coding
sequence of the hMiRP1 potassium channel and the missense mutation,
Q9E-hMiRP1, (both kindly provided by Dr. S. Goldstein, Yale School
of Medicine, USA) were subcloned into the BAMHI/SACI sites of the
pIRES2-eGFP bicistronic expression vector from Stratagene (LaJolla,
Calif.). This vector (FIG. 1) utilizes the immediate early promoter
of the cytomegalovirus (CMV), which drives both the expression of
the inserted cDNA (hMiRP1) and GFP with an additional
neomycin/kanamycin resistance gene that facilitates the selection
of stably transfected eukaryotic cells with G418. hMiRP1 and
Q9E-hMiRP1 were epitope tagged by replacing the terminal stop codon
in each with nucleotides encoding FLAG residues (DYKKDDDDK) by PCR
(Clontech).
[0230] Stable Cell Lines: HEK293 and SH-SY5Y cells were transfected
with the plasmid constructs described above using
Lipofectamine-2000.RTM. (Life Technologies) per the manufacturer's
directions, and selected using G418. Stably overexpressing cell
lines were isolated by FACS sorting, based on GFP expression, using
a FACS Calibur flow cytometer with Cell Quest software (Becton
Dickinson, Franklin Lakes, N.J.) equipped with a 488-nm argon-ion
laser (15 mW).
[0231] Western Blotting: Parallel plates of confluent cultures of
SH-SY5Y and HEK293 stable cell lines over-expressing hMiRP1 and
Q9E-hMiRP1 were used to isolate the membrane fractions. Cells were
lysed [1M Tris-HCl (pH 7.5), 1% Triton X-100, 5M NaCl, 1 mM NaF,
0.5M EDTA, 1 mM Na.sub.3VO.sub.4, 100 mM PMSF, and a protease
inhibitor cocktail (Boehringer Mannheim)], centrifuged at
14,000.times.g for 5 min, and protein concentration was determined
by the Bio-Rad Protein Assay (Bio-Rad, Hercules, Calif.) (Bradford,
1976). 30 .mu.g of total protein per lane were separated on 10% SDS
polyacrylamide minigels (Laemmli, 1970) and transferred to
polyvinylidene difluoride (PVDF) membranes. Membranes were blocked
in 50 mM Tris-HCl (pH 7.6), 100 mM NaCL, 0.2% Tween-20 and 5%
nonfat dry milk and immunoblotted overnight with monoclonal
anti-FLAG antibody (1:250 dilution; Sigma, St. Louis, Mo.) followed
by horseradish-conjugated secondary antibody (1:10,000) for 1 hr.
Signals were visualized using Renaissance chemiluminescence reagent
(DuPont NEN, Boston, Mass.). The signal in each band was
quantitated as the integrated optical density of the band. Relative
band densities were normalized to protein loads as determined by
the band density of control .beta.-actin in each lane.
Densitometric analysis was performed with the Image Analysis System
MCID/M2, Imaging Research (St. Catherine, Ontario, Canada) by
integrating the stained area of the bands.
[0232] hMiRP1 RNA Isolation and detection by Reverse
Transcriptase-Polymerase Chain Reaction (RT-PCR): Total RNAs from
cultured cells were extracted using Trizol Reagent (Life
Technologies) according to the manufacturer's instructions. cDNA
was synthesized using oligo-dT priming from 5 .mu.g total RNA using
the Gibco-BRL preamplification SuperScript II reverse transcriptase
system (Life Technologies Inc.). Following first strand cDNA
synthesis, PCRs were performed using primer pairs for hMiRP1 gene
and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primers
used for hMiRP1 detection were as follows: 5' sense
oligonucleotide, ACCATGTCTACTTTATCCATT; and 3' antisense
oligonucleotide, CTTATCGTCGTCATCC TTGTAATCGGGGGACATTTTGAACCC. These
primers gave rise to a product that is 405 bp long. The human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as
an internal control, from 2 .mu.l of the same cDNA, under the above
conditions, and using the following primers (the nucleotide residue
number and accession numbers are in parentheses): GAPDH-S, 5'-GGA
CAT TGT TGC CAT CAA CGA C-3' (108-129, M17701); GAPDH-AS, 5'-ATG
AGC CCT TCC ACG ATG CCA AAG-3' (525-548, M17701), which generated a
369-bp fragment. The amplified products were separated on a 2.5%
agarose gel using appropriate standards and visualized with
ethidium bromide staining. The bands were analyzed by BioRad Quant
One software (Biorad). Signals from the hMiRP1 cDNA were normalized
using the values of the corresponding products from the GAPDH
amplification.
[0233] Quantitative RT-PCR: Real-time, one-step, non-nested PCR for
hMiRP1 and Q9E-hMiRP1 mRNA was performed using the Light Cycler
thermal cycler (Roche Diagnostics, Indianapolis, Calif.) according
to the manufacturer's instructions. Total RNA was isolated and
reverse transcribed to cDNA from the SH-SY5Y and HEK293 cell lines
as described in the previous sections. The primer utilized to
detect FLAG epitope tagged hMiRP1 was: (sense)
TTATCCAATTTCACACAGAAC and (anti-sense) CAAAAGACGGCAATATGGT, and to
detect FLAG epitope tagged Q9E-hMiRP1: (sense)
TTATCCAATTTCACAGAGAAC and (anti-sense) CAAAAGACGGCAATATGGT. To
detect endogenous hMiRP1 and Q9E the same forward primers were
used, and the reverse primer was ACACCGGCCTTATTC. The primers for
the housekeeping gene GAPDH were as follows: (sense) ACC ACA GTC
CAT GCC ATC AC and antisense TCC ACC ACC CTG TTG CTG TA. Negative
(water) and positive controls (plasmid constructs containing
wildtype hMiRP1 gene) were run concomitantly to confirm integrity
of the samples. To confirm amplification specificity, the PCR
products were subjected to a melting curve analysis. The standard
curve was generated for SH-SY5Y and for HEK293 cells by using
endogenous hMiRP1 cDNA and plasmid devoid of gene.
[0234] Electrophysiology Methods: HEK293 cells that stably express
HERG, but not hMiRP1 (Zhou, et al., 1999) were also stably
co-transfected with either hMiRP1 or Q9E-hMiRP1 and subsequently
were analyzed for channel function by single cell patch clamping
using voltage clamp conditions. The data were analyzed at a
sampling rate of 4 kHz and filtered at 1 kHz using Pclamp software
version 6.0 (Axon Instruments, Foster City, Calif.). Leak
correction was not performed, and therefore unaltered data are
shown. All experiments were performed at 25.degree. C. Protocols
for steady-state activation and isochronal peak currents, and
clarithromycin incubations were performed as described by Abbott et
al., 1999. Initial studies were performed in buffer containing 95
mM KCl, 5 mM NaCl, 1 mM MgCl.sub.2, 0.3 mM CaCl.sub.2, and 10 mM
HEPES (pH 7.6). For whole cell recordings, pipettes contained 100
mM KCl, 1 mM MgCl.sub.2, 10 mM HEPES, and 2 mM EGTA (pH 7.5). A 50
mM Clarithromycin (American Bioanalytical, Natick, Mass.) stock in
DMSO was diluted in bath solution.
[0235] Immunocytochemistry in vitro: For immunostaining, stably
transfected cell lines were plated on coverslips overnight. Cells
were washed several times in 0.1M PBS, fixed with 4%
paraformaldehyde and permeabilized with 0.1% Triton X-100. After
blocking for 3 hours (5% BSA and 10% normal goat serum in PBS),
cells were incubated overnight at 4.degree. C. with anti-FLAG
antibody (Sigma) in antibody diluent (0.5% Tween-20 and 1% BSA in
PBS) at concentrations appropriate for each cell line: SH-SY5Y
(1:500) and HEK293 (1:300). Cells were subsequently washed several
times, and incubated with the rhodamine-labeled secondary antibody
at 1:600.
[0236] DNA, Cationic Lipid, Anti-DNA Antibody Heteroplexes (DAC)
Formulation: An optimized formulation consisting of 10 .mu.g of GFP
plasmid DNA ("D") was mixed with 10 .mu.g of mouse monoclonal
anti-bovine DNA IgM (U.S. Biological, Swampscott, Mass.) ("A") in a
total volume of 50111 PBS, followed by incubation at 37.degree. C.
for 1 hour. 5 .mu.l of cationic lipid ("C"), composed of a 1:1
(w/w) formulation of
N-[1-(2,3-dioleyloxy)propyl]-n,n,n-triethylammonium chloride
(DOTMA, Sigma Chemical Co., St. Louis, Mo.) and dioleoyl
phosphatidylethanolamine (DOPE, Sigma) was added to DA with
vortexing to form DAC. The heteroplex (DAC) was incubated at room
temperature for 35 minutes or more before use. Control formulations
using nonspecific antibody (mouse IgM, Zymed laboratories, San
Francisco, Calif.), or lacking antibody (lipoplex, DC), were
formulated in parallel. In order to carry out studies of DNA uptake
and cellular processing of DNA antibody heteroplexes, fluorescent
components were included as described in individual experiments.
Rhodamine- or FITC-labeled DNA were prepared according to
manufacturer's instructions using Mirus Label IT.RTM. nucleic acid
labeling kits (Mirus-PanVera, Madison, Wis.), for use in tracking
the uptake and processing of DNA in fluorescent microscopy and flow
cytometry studies. Alexa Fluor 568 (red fluorescence) labeled
anti-DNA IgM was prepared using succinimidyl ester-amine binding
methodology (Alexa Fluor 568, Molecular Probes, Eugene, Oreg.), in
order to investigate processing of DNA-antibody complexes. A
rhodamine-labeled non-specific antibody (mouse IgM, Vector
Laboratorie, Burlingame, Calif.) was employed as an additional
control. BODIPY (4,4-difluoro-3a,4a-diaza-s-indacene)-labeled DOPE
(Molecular Probes) was combined at a 0.5% level with the cationic
lipid formulation (DOPE/DOTMA) for tracking lipid distribution.
[0237] DAC Particle Characterization: For assessing particle size
and Zeta potential, aliquots of DAC or DC were assayed using a
Brookhaven 90Plus Particle Sizer with a ZetaPlus Zeta Potential
Analyzer (Brookhaven Instruments Corp, Brookhaven, N.Y.). The
concentration of DNA entrapped in DAC or DC was determined
spectrophotometrically after phenol/chloroform extraction of
particles separable from suspension by 0.2 .mu.m membrane
filtration (Nalgene Co., Rochester, N.Y.).
[0238] DAC in vitro Transfection: In vitro transfection experiments
were set up using A10 cells in either plastic 6 well tissue culture
dishes, for initial characterization of transfection, or, to avoid
auto-fluorescence in photographic or confocal data collection, in 4
chamber glass slides (Falcon, Franklin Lakes, N.J.). Cells were
plated 18 hours prior to the introduction of DNA complexes. The
cells were incubated at 37.degree. C. in M199 medium, supplemented
with 5% (v/v) FBS and P/S. One hour prior to introduction of DNA
complex, the cells were rinsed once with PBS then P/S-free M199
medium, and the incubation was continued for 1 hour in this
formulation. After 5 hours of transfection, 5% FBS was added to the
cultures, and media replaced to contain 2% FBS the next day.
[0239] Uptake and intensity of fluorescein-labeled DNA in vitro was
quantified by flow cytometry of cells after 48 hours of
transfection, using an Epics Elite flow cytometer (Coulter
Corporation, Hialeah, Fla.), observing 10,000 cells per run of each
sample, and subtracting background fluorescence of untreated
control cells. For determination of transfection efficiency,
complexes were formulated using the GFP plasmid, and the cells were
fixed with 4% paraformaldehyde after various timepoints of
transfection, and 4',6 diamidino-2-phenylindole (DAPI, Vector
Laboratories) mounted for nuclear staining. GFP transfection was
observed using a Nikon Eclipse TE300 inverted fluorescent
microscope (NIKON Inc, Melville, N.Y.; equipped with DAPI, Texas
red and FITC filters) and at least three random 100.times. fields
per culture were recorded as photographic tiff files for
quantification. The number of GFP-expressing cells in each
resulting file was determined by visual count, and the total number
of cells in the same file counted for the nuclear DAPI image using
the Nucleicount macro of NIH image v. 1.62. The results were
expressed as "percent of cells transfected". In some experiments,
extent and intensity of GFP expression was also quantified in cells
72 hours after transfection by flow cytometry. Fluorescent confocal
microscopy of transfected cells was performed with a Nikon Eclipse
E600 microscope (Nikon, Tokyo, Japan) equipped with a BioRad
confocal imaging system 1024ES. Laser excitation was at 488/568 nm,
using a 522DF35 filter for FITC and a 605DF32 filter for
rhodamine/Alexa Fluor 568 visualization.
[0240] Animals: All studies involving the use of animals were
approved by the Institutional Animal Care and Use Committee (IACUC)
of The Children's Hospital of Philadelphia. Adult normal male
Yorkshire swine (Willow Glen Farms, Strousburg, Pa.) of weights
25-35 kg were used for these studies. A right thoracotomy procedure
under general anesthesia was used as previously published (Levy et
al., 2001). Right atrial myocardial sites injected with plasmid
preparations were retrieved after one week following euthanasia
with a barbiturate overdose (Levy et al., 2001).
[0241] In Vivo Vector Injections: DAC heteroplexes were
investigated in pig atrial myocardial injection studies using
either GFP, hMiRP1, or Q9E-hMiRP1 plasmids. The DAC delivery system
was first characterized in vivo. Following a right thoracotomy
under general anesthesia, four separate right atrial epicardial
injection sites in each pig received 100 .mu.g of DNA, as either
DAC, DC, DNA plus antibody (without cationic lipid), or DNA alone.
Six pigs were studied using the reporter gene (GFP only, as above),
and the atrial injection sites were retrieved after one week.
Frozen sections were analyzed for the presence of GFP with
fluorescence microscopy after DAPI mounting. GFP-expressing fields
from treatment sites in each of the animals were recorded as
digital images using both FITC and DAPI filters. Morphometrics were
analyzed with NIH Image software as above (Klugherz, et al., 2000).
The results were expressed as percent cells transfected. Sections
were also routinely examined with hematoxylin staining. Q9E-hMiRP1
and hMiRP1 plasmids were formulated only as DAC, and were injected
as above into the right atrial myocardium of 3 pigs, with sample
retrieval one week post-operation as both frozen and formalin-fixed
specimens. Confirmatory GFP immunohistochemistry was performed on
paraffin-embedded sections using primary antibody from Molecular
Probes, developed with VIP Purple chromogen (Vector Labs), and
counterstained with Methyl Green (Vector Labs).
[0242] In vivo FLAG immunofluorescence: Frozen sections from pig
myocardium from the Q9E/hMiRP1 studies were subjected to
post-fixation by submerging the samples in cold acetone for 30
seconds. The samples were subsequently washed and non-specific
binding was blocked by incubating 1 hour in 10% FBS. The sections
were incubated overnight with primary anti-FLAG antibody at a
concentration of 1:200. The tissues were incubated with
rhodamine-labeled secondary antibody (see above) and DAPI mounted
for confocal microscopy.
[0243] Statistical analyses: Data are expressed as mean.+-.standard
deviation (SD). Statistical significance was assessed using one-way
analysis of variance (ANOVA) or one-sided Student's t test. P
values less than 0.05 were considered significant. The significance
of the differences (P.ltoreq.0.05) between the groups tested by
analysis of variance was assessed by the least-square differences
test, using SPSS software (SPSS Inc., Chicago, Ill.).
[0244] Results
[0245] Over-Expression of hMiRP1 and Q9E-hMiRP1
[0246] By RT-PCR methodology and agarose gel electrophoresis (FIG.
11A), we were able to confirm that the SH-SY5Y cell lines were
stably expressing either hMiRP1 or Q9E-hMiRP1. HEK293 cells, which
do not produce endogenous hMiRP1, demonstrated over-expression of
either hMiRP1 or Q9E-hMiRP1 following respective transfections. In
order to further document and quantify the amounts of wildtype or
Q9E-hMiRP1 mRNA that was being produced per cell, quantitative
RT-PCR was employed with primers including the FLAG epitope (see
Methods). Total RNA extracted from 10.sup.7 cells of transfected
and control HEK293 and SH-SY5Y cells was reverse transcribed to
cDNA. cDNA quality was optimal for all samples, providing crossing
points in less than 23 cycles; thereby indicating a relatively high
concentration and good amplification of the DNA. With 40 cycles of
a single round of quantitative PCR, SH-SY5Y-hMiRP1 and
SH-SY5Y-Q9E-hMiRP1 yielded 0.01.+-.0.0015 and 0.02.+-.0.0017
picograms per cell of mRNA, respectively (FIG. 11B, lower panel).
Moreover, our studies also demonstrated that in the HEK293 cell
lines, hMiRP1 and Q9E-hMiRP1 were over-expressed, yielding
0.05.+-.0.019 and 0.10.+-.0.011 picograms per cell of mRNA,
respectively (FIG. 11B, upper panel).
[0247] Western Blot Analyses of hMiRP1 and Q9E-Transfected
Cells
[0248] Western blot analyses based on FLAG immuno-detection of
over-expressed hMiRP1 and Q9E-hMiRP1 proteins in stably transfected
HEK293 and SH-SY5Y cells are shown in FIGS. 12A and 12B. Antibodies
directed against the FLAG epitope at the carboxy terminus of each
gene were used to probe for hMiRP1 and Q9E-hMiRP1 mutant proteins.
The anti-FLAG antibody recognizes a single band including the FLAG
peptide with an apparent molecular mass of 23 kDa, indicating the
presence of either hMiRP1 or Q9E-hMiRP1 protein in the stably
transfected cells (FIG. 12A); these bands are absent in
untransfected cell extracts. The blots were also probed with a
.beta.-actin (42 kDa) antibody as a loading control. In the four
stable cell lines, densitometry confirmed the significant
(p<0.05) overexpression of transgene versus controls (FIG.
12B).
[0249] Transfection and Immunocytochemistry Studies with hMiRP1 and
Q9E-hMiRP1 Plasmids: Successful Transmembrane Localization of the
Expressed Transgenes
[0250] Transfections with the bicistronic vectors were demonstrated
by the expression pattern of GFP (see vector diagram, FIG. 10),
which was found throughout the cytoplasm of the cells (FIGS.
13A-D). We studied the cellular localization of hMiRP1 protein
tagged at its C terminus with a FLAG epitope in wild type and
Q9E-hMiRP1 by immunostaining of transfected HEK293 and SH-SY5Y
cells followed by fluorescent confocal microscopy. Mock-transfected
cells from each cell line showed no detectable immunofluorescence
staining (data not shown). In both SH-SY5Y and HEK293 cells
transfected with wild type hMiRP1, (FIGS. 13A&13B
respectively), fluorescent confocal microscopy demonstrated that
rhodamine-labeled anti-FLAG fluorescence was predominantly
localized to the plasma membrane, with faint cytoplasmic
expression. In addition, SH-SY5Y and HEK293 cells transfected with
Q9E-hMiRP1 (FIGS. 13C and 13D respectively), also display
comparable anti-FLAG immunofluorescence predominantly in the plasma
membrane.
[0251] Q9E-hMiRP1 and hMiRP1 Electrophysiology Studies: Proof of
Concept
[0252] These experiments were conducted to confirm that plasmid
transfection with our bicistronic FLAG-tagged Q9E-MiRP1 vector
results in electrophysiologic effects comparable to those
previously observed for this channel mutation (Abbott et al, 1999).
HEK293 cells over-expressing Q9E-hMiRP1 demonstrated the
hypothetically predicted reduced peak outward currents (FIG. 14A)
in the presence of clarithromycin in whole cell voltage clamp
studies. The clarithromyin effect was many-fold greater in the
Q9E-hMiRP1 cells than that noted in cells transfected with the wild
type hMiRP1 (FIG. 14B). The dose of clarithromycin causing half
block of the peak outward currents for channels formed with
wild-type hMiRP1 was approximately 2.0 mM (FIG. 14B). However, for
Q9E-hMiRP1 overexpressing cells, the dose leading to half blockade
of peak outward currents was less than 1.0 mM (FIG. 14B).
Furthermore, cells over-expressing Q9E-hMiRP1 demonstrated reduced
I/I.sub.MAX only as the prepulse potential became more positive
(FIG. 14C). This is consistent with the observations of Abbott et
al (1999), and is comparable to the mechanism of action of class
III antiarrhythmic agents (Spector et al., 1996).
[0253] Characterization of DNA-AntiDNA Antibody-Cationic Lipid
Heteroplexes (DAC): Cell Culture and In Vivo Results
[0254] DAC formed stable nanospheres by a self-assembly process
when formulated by first combining plasmid DNA and anti-DNA
antibody, followed by vortexing with cationic lipid. Particle
sizing by differential light scattering revealed DAC heteroplexes
to be 370.+-.10 nm in diameter (FIG. 15A). These DAC demonstrated a
relatively stable size and charge over a one week incubation period
at pH 7.4 in phosphate buffered saline at 37.degree. C. (FIG. 15A).
By comparison, DC lipoplexes also formed detectable nanoparticles,
254.+-.37 nm in diameter, and had a more electropositive zeta
potential (-8.9.+-.5.5 vs.-15.3.+-.4.5 mV for DAC). Extraction of
DNA from DAC accounted for 28.5.+-.1.5% of the total initial DNA in
DAC formulations (FIG. 15B). However, without antibody (DC), only
13.6.+-.0.8% (p=0.002 vs. DAC) of the same amount of DNA was
retained in DC formulations with the identical amount of starting
DNA (FIG. 15B).
[0255] Cell culture transfection experiments were carried out with
A10 cells as a model system. Confocal microscopy studies utilizing
red fluorescent labeled anti-DNA antibody in A10 cell cultures 48
hours after transfection revealed that anti-DNA antibody in DAC was
in both the cytoplasm and nuclei (FIG. 15C). When DNA was omitted
from the formulation, the fluorescent anti-DNA antibody combined
with cationic lipid was also capable of entering nuclei (data not
shown), thus indicating that nuclear entry may be facilitated by
the specific anti-DNA antibody used in these studies. Furthermore,
under the same conditions, rhodamine-labeled nonspecific IgM
remained in the cytoplasm (data not shown). Confocal microscopy,
utilizing rhodamine-labeled DNA and BODIPY-labeled cationic lipid,
demonstrated that DAC were present throughout the cytoplasm and
nuclei of A10 cells at 48 hours, with lipid-DNA co-localization
(FIG. 15D). By comparison, DNA-cationic lipid complexes (DC) had
far less DNA entry into the cytoplasm of A10 cells, and rare
observations of nuclear entry by DNA (FIG. 15E). Flow cytometry
studies of A10 cells exposed to either DAC or DC containing
FITC-labeled DNA (FIG. 15F) demonstrated more than 4 fold greater
uptake with DAC than with DC (88% vs. 21% respectively) with mean
channel intensities of 38.1.+-.1.1 vs. 1.97.+-.0.04
(p<0.001).
[0256] DAC markedly increased the level of trans-gene expression in
A10 cells (FIG. 16A), with more than a five-fold increase in
transfection compared to DC complexes (FIG. 16B) as determined by
cell count (FIG. 16C). Control formulations consisting of GFP DNA
combined with anti-DNA antibody, or GFP DNA and lipid combined with
non-specific IgM, resulted in no enhancement of transfection. Flow
cytometry studies were used to confirm the magnitude of the
differences between DAC and other transfection formulations (FIG.
16D). GFP expression was 6.9-fold higher in DAC-transfected A10
cell cultures compared to DC, with a 6-fold higher intensity of
expression per cell, than observed with DC.
[0257] Pig myocardial injection studies were used to investigate
gene transfer efficiency of DAC compared to control plasmid DNA
formulations, including naked-DNA (D), DNA plus anti-DNA antibody
(DA), and DNA-cationic lipid (DC). As shown in FIG. 17A, DAC
resulted in a three-fold or greater increase in transfection,
compared to other formulations. Fluorescent microscopy studies
demonstrated the pattern of expression of GFP using DAC to be
widespread, and relatively uniform (FIG. 17B), compared to the more
focal and limited expression pattern seen with the various control
formulations (eg. FIG. 17C). Immunohistochemistry studies using an
anti-GFP antibody confirmed the extent of GFP transfection with DAC
(data not shown; see FIG. 18 for GFP-immunohistochemistry).
[0258] In Vivo Expression of hMiRP1 and Q9E
[0259] Using the just described in vivo approach a series of pigs
were subjected to atrial myocardial injections with DAC
preparations using either the Q9E-hMiRP1 or hMiRP1 plasmids with
retrieval after 7 days. Uniform and site-specific localization of
GFP expression within the myocardium was observed for both vector
preparations (FIGS. 18A and 18B), and was confirmed with GFP
immunohistochemistry (FIGS. 18C&D), indicating that in vivo
transfection with both the wild type and Q9E-hMiRP1 bicistronic
plasmids was successful. Morphometry studies revealed that more
than 15% of regional cardiac myocytes were transfected with either
plasmid in the DAC formulations (FIG. 18F), similar to observations
made with GFP-plasmid DNA incorporated into DAC (FIG. 17A).
Anti-FLAG immunohistochemistry with fluorescent confocal microscopy
confirmed the cell membrane localization of the Q9E-hMiRP1
transgene (FIG. 18G), as well as over-expression of the wild type
(hMiRP1) construct (data not shown).
[0260] The constructs were also functional in vivo. FIG. 19 is a
graph showing the changes in monophasic action potential duration
following clarithromycin infusion in pigs treated with Q9E-hMirp1
and wt hMirp1.
[0261] Discussion
[0262] The present studies demonstrate the use of a disease
associated ion channel mutation as a therapeutic gene. The working
hypothesis of these studies was that a Q9E-hMiRP1 vector could be
used to mimic class III anti-arrhythmic effects, limiting these
effects to a specific area of the atrial myocardium to
hypothetically disrupt regional re-entrant arrhythmia pathways.
This hypothesis was supported by the present results demonstrating
the following necessary components: 1) Over-expression of
Q9E-hMiRP1 documented by both RT-PCR and Western analyses; 2)
Membrane localization of the over expressed channels; 3)
Electrophysiologic responsiveness with diminished I.sub.Kr, as
predicted, in response to clarithromycin administration; these
electrophysiologic effects are comparable to those of class III
anti-arrhythmic agents. 4) Furthermore, we demonstrated that our
bicistronic-FLAG tagged Q9E-hMiRP1 vector resulted in comparable
electrophysiologic effects and clarithromycin responsiveness as
observed by others overexpressing Q9E-hMiRP1 using less complex
vector constructs (Abbott et al, 1999), thus indicating the
potential suitability of our vector design for future in vitro and
in vivo electrophysiologic studies. 5) Initial in vivo studies have
also shown both Q9E expression, cell membrane localization and
electrophysical functioning in pig atrial myocardium.
[0263] We also investigated the gene transfer potential of a
complex multi-component formulation (heteroplex) composed of
plasmid DNA, a cationic lipid moiety, and an anti-DNA antibody.
Specifically, our investigations have focused on anti-DNA
antibodies in a plasmid-based gene transfer vehicle, because native
anti-DNA antibodies have been shown to accumulate in the nuclei of
post-mitotic cells (Alarcon-Segovia et al., 1978). Therefore, we
successfully demonstrated that the association of DNA with anti-DNA
antibody prior to the complexation with cationic lipids could
enhance transfection efficacy both in vitro and in vivo, primarily
via preferential cellular and nuclear uptake of the heteroplex in
comparison with the comparable (DC) lipoplex. Several mechanisms
may be responsible for the preferential uptake of DAC. Zack et al.,
(1996) showed that DNA-antibody binding by itself might trigger
anti-DNA antibody internalization either directly, or via the
interaction with an unrecognized membrane determinant. This
mechanism may be operative as well in the case of DAC heteroplexes.
Furthermore, it has been shown that nuclear accumulation of
anti-DNA antibody is a function of the amount of DNA complexed to
the antibody (Avrameas et al., 2001). Thus, we have found variation
in DNA delivery between production lots of antibody (data not
shown), which necessitate re-optimization in each case for full
implementation of the transfection amplification mediated by
anti-DNA antibodies. Once formulated, however, the heteroplexes
demonstrate robust physical characteristics (see FIG. 15A).
[0264] Q9E-MiRP1 transfection plus clarithromycin was the model
therapeutic approach investigated in these studies, because of
comparable mechanisms of action to Class III anti-arrhythmics, that
also result in diminished potassium channel currents (Roden, 1998).
Therefore, the I.sub.Kr response of transgene Q9E-hMiRP1 to
clarithromycin demonstrated in the present studies could
potentially be used to control regional atrial re-entrant
arrhythmia activity. This strategy is also attractive since the
electrophysiologic effects of overexpressed Q9E-hMiRP1 can be
modulated with variable dosing of clarithromycin or its analogues.
Additionally, other potassium channel mutations such as the
dominant negative HERG mutation, A561V (Sanguinetti et al., 1996),
should also yield promising results as candidate gene therapy
constructs.
[0265] We specifically chose to carry out our in vivo transfection
studies using atrial myocardial injections rather than ventricular
for several reasons. Since we selected a LQTS mutation as a
potential therapeutic vector, we were mindful of the potential
occurrence of life threatening ventricular arrhythmias as an
untoward effect, that could occur due to overexpression of a LQTS
gene in the ventricular myocardium (Leenhardt et al., 2000). It is
far less likely that atrial overexpression of a LQTS mutation could
lead to life threatening proarrhythmia activity. Similarly, class
III antiarrhythmia agents are associated with a risk of torsades
des pontes or even more severe ventricular arrhythmias (Roden
1998). Thus, since Q9E-hMiRP1 with clarithromycin mimics class III
effects (Abbott et al., 1999), we were also concerned that
ventricular overexpression of this particular gene could present a
risk of torsades des pontes, and thus this was also part of the
rationale for our initial studies focusing on atrial
transfection.
CONCLUSION
[0266] The present studies have demonstrated the feasibility of
Q9E-hMiRP1 plasmid vectors for site specific anti-arrhythmia gene
therapy studies. We have successfully produced human stable cell
lines overexpressing Q9E-hMiRP1 that demonstrate membrane
localization of the overexpressed mutant channel (Q9E-hMiRP1) with
clarithromycin responsiveness in agreement with Abbott et al.,
(1999). Using an anti-DNA antibody heteroplex gene delivery system,
we have also demonstrated that efficient in vivo delivery of
Q9E-hMiRP1 vectors can be achieved in porcine atrial
myocardium.
EXAMPLE 5
Delivery of RGT Using Mesenchymal Stem Cells
[0267] This Example describes materials and methods for providing a
sustained, and permanent means of treating potentially fatal
cardiac arrhythmias based on Reverse Gene Therapy (RGT) contained
within a stem cell system. While the treatment of arrhythmias is
exemplified herein, delivery of reverse gene therapy constructs
goes far beyond arrhythmia-treatment strategies, and may be used to
advantage in tissue engineering and organ regeneration approaches,
as well as in localized tissue repair and site specific, but
essentially permanent local gene therapy. As set forth herein, RGT
is defined as the therapeutic utilization of a pathological
disease, which manifests a distinctive phenotype as an effective
and beneficial measure for treatment of another pathological
disease. Our previous work describes the use of gene vectors for
reverse gene therapy. The use of stem cells or other appropriate
cells, modified with the gene program of interest to establish a
permanent tissue and/or organ modification with a reverse gene
therapy strategy is proposed herein. As discussed above in the
previous Example, the missense mutation, Q9E-hMiRP1, which is
responsible for one form of long QT syndrome (LQTS), was chosen as
our candidate RGT gene. Q9E-hMirp1 is an ancillary subunit of the
delayed rectifier potassium channel HERG. Upon exposure to the
antibiotic, Clarithromycin (Biaxin), the channel functions
abnormally in regards to a substantial diminution of inward
rectifier currents and therefore functions in a similar manner to
Class III anti-arrhythmia agents such as ibutilide. Our previous
studies have demonstrated that ibutilide is effective in preventing
re-entrant atrial flutters. As a result of the similar mechanism of
action between ibutilide and Q9E-hMirp1, we propose that
over-expression of Q9E-hMirp1 in a site-specific and local delivery
system in the atrium of an animal model will lead to a permanent
treatment for re-entrant atrial flutter. RGT measures will be
executed via the local delivery system of rat mesenchymal stem
cells (RMSC) in a site-specific manner.
[0268] As a local delivery system, genetically modified mesenchymal
stem cells offer several advantages. In vivo studies have shown
that myogenic mesenchymal stem cells that are directly injected
into the myocardium leads to their differentiation into
cardiomyocytes. Extensive studies demonstrating the myogenic
potential of mesenchymal stem cells into cardiomyocytes have been
performed in various animal models, including murine and porcine
models.
[0269] Thus, rat mesenchymal stem cells that have been genetically
modified to over-express the mutant form of wild type Mirp1,
Q9E-hMirp1 were generated. The stable integration of the Q9E mutant
gene within the genome of rat mesenchymal stem cells will provide a
means for constitutive expression of the protein encoded by the
construct. Injection of this stable RMSC-Q9E cell line into the
right atrium of an experimental animal model will stimulate the
cells to differentiate into functioning cardiomyocytes that express
the mutantQ9E. Administration of clarithromycin will stress the
mutant ion channel to alter the underlying pro-arrhythmic nature of
the myocardium. Class III anti-arrhythmic drugs delay cardiac
repolarization, and subsequently refractoriness. As a consequence
of refractoriness being prolonged and conduction unaltered,
reentrant arrhythmias should be highly suppressed by overexpression
of Q9E in RMSC.
[0270] Although Class III anti-arrhythmic drugs and antihistamines
are used to treat atrial fibrillations and allergies, respectively,
they have adverse side affects that can be fatal. These medications
can induce pro-arrhythmic effects in otherwise healthy individuals
by their ability to cause acquired long QT syndrome. Such effects
manifest as excessive delays in repolarization and polymorphic
ventricular tachyarrhythmias, often presenting as torsades de
pointes. I.sub.KR blocking class III agents cause TdP by mimicking
the congenital long QT syndrome caused by mutations in the HERG
gene or its functional regulatory subunit, Mirp1 that encode for
I.sub.KR. Drugs such as antiarrhythmics, antihistamines and certain
antibiotics, prolong the QT interval and cause TdP by blocking
cardiac K.sup.+ channels in general and selectively blocking the
rapidly activating delayed rectifier channel I.sub.KR.
[0271] In addition to being useful for therapeutic intervention,
the development of stable mesenchymal stem cells that express the
Q9E mutation and can differentiate into functioning cardiac
myocytes, provides an excellent screening system for identifying
specific drugs that may prolong the ventricular AP and influence
distinctive polymorphic ventricular tachycardia, termed TdP and
sudden death. Such an approach should effectively limit the
frequency of this important complication by identifying those
patients in which the administration of class III drugs should be
avoided.
[0272] In summary, we describe the novel creation of a myogenic
over-expressing Q9E cell line that can differentiate into cell
lines of various origins including an array of mesodermal tissues
such as bone, and cartilage, and cardiomyocytes.
[0273] Shown in FIG. 20 are confocal micrographs demonstrating
co-imaging of green fluorescent protein and rhodamine
immunofluorescence (anti-FLAG to localize Q9E-hMiRP1) in rat
mesenchymal stem cells. The membrane localization of both
Q91E-hMiRP1 and wild type MiRP1 in the cell membrane of GFP
positive cells is shown by anti-FLAG rhodamine immunofluorescence.
Transgenes were introduced into the RMSC using the methods set
forth in Example 4.
[0274] Site-specific gene therapy with cell-based delivery of the
gene program of interest could be used in virtually all of the
previously described methods for reverse gene therapy. Moreover
this approach is ideally suited for facilitating reverse gene
therapy in a tissue engineering setting. Furthermore,
auto-transplantation with reverse gene therapy provides another
major new dimension, using the patients own progenitor cells as
vehicles to deliver reverse gene therapy. In this approach, stem
cells would be harvested from a patient of interest, cultured in
vitro, modified with a reverse therapy vector, and re-injected or
reimplanted into the patient in a site-specific manner. Methods for
obtaining human stem cells for such purposes are known to the
skilled person and have been previously described. See U.S. Pat.
Nos. 6,387,367 and RE 37,978 which is a reissue of U.S. Pat. No.
6,015,671.
[0275] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety.
[0276] While this invention has been disclosed with reference to
specific embodiments, it is apparent that other embodiments and
variations of this invention may be devised by others skilled in
the art without departing from the true spirit and scope of the
invention. The appended claims are intended to be construed to
include all such embodiments and equivalent variations.
REFERENCES FOR EXAMPLE 4
[0277] ABBOTT, G. W., SESTI, F., SPAWSKI, I., BUCK, M. E, LEHMANN,
M. H., TIMOTHY, K. W., KEATING, M. T., GOLDSTEIN, S. A. N. (1999).
hMiRP1 forms potassium channels with HERG and is associated with
cardiac arrhythmia. Cell. 97: 175-187. [0278] ALARCON-SEGOVIA D.,
RUIZ-ARGUELLES, A., FISHBEIN, E. (1978). Antibody to nuclear
ribonucleoprotein penetrates live human mononuclear cells thru
F.sub.c receptors. Nature. 5 (271): 67-69. [0279] ANTZELEVITCH, C.,
SUN, Z. Q., Yan, G. X. (1996). Cellular and ionic mechanisms
underlying erythromycin-induced long QT intervals and torsades de
pointes. J. Am. Coll. Cardiol. 28: 1836-1848. [0280] AVRAMEAS, A.,
TERNYNCK, T., NATO, F., BUTTIN, G., AVRAMEAS, S. (1998).
Polyreactive anti-DNA monoclonal antibodies and a derived peptide
as vectors for the intracytoplasmic and intranuclear translocation
of macromolecules. Proc. Natl. Acad. Sci. USA. 95:5601-5606. [0281]
AVRAMEAS, A., TERNYNCK, T., NATO, F., BUTTIN, G., AVRAMEAS, S.
(1999). Efficient gene delivery by a peptide derived from a
monoclonal anti-DNA antibody. Bioconj. Chem. 10: 87-93. [0282]
AVRAMEAS, A., GASMI, L., BUTTIN, G. (2001). DNA and heparin alter
the internalization process of anti-DNA monoclonal antibodies
according to patterns typical of both the charged molecule and the
antibody. J. Autoimmun. 11: 383-391. [0283] CARMRLIET, E., (1992).
Voltage- and time-dependent block of the delayed K+ current in
cardiac myocytes by dofetilide. J. Pharmacol. Exp. Ther. 262:
809-817. [0284] CRENSHAW, B. S., WARD, S. R., GRANGER, C. B.,
STEBBINS, A. L., TOPOL, E. J., AND CALIFF, R. M. (1997). Atrial
fibrillation in the setting of acute myocardial infarction: the
GUSTO-I experience. J. of the Amer. Coll. Of Cardiol., 30, 406-413.
[0285] DALEAU, P., LESSARD, E., GROLEAU, M. F., TURGEON, J. (1995).
Erythromycin blocks the rapid component of the delayed rectifier
potassium current and lengthens repolarization of guinea pig
ventricular myocytes. Circulation. 91: 3010-3016. [0286] DONAHUE,
K. J., HELDMAN, A. W., FRASIER, H., MCDONALD, A. D., MILLER, J. M.,
RADE, J. J., ESCHENHAGEN, T., MARBAN, E. (2000). Focal modification
of electrical conduction in the heart by viral gene transfer.
Nature Medicine. 6(12): 1395-1398. [0287] DRICI, M. D., KNOLLMANN,
B. C., WANG, W. X., and Woosley, R. L. (1998). Cardiac actions of
erythromycin: influence of female sex. JAMA. 280: 1774-1776. [0288]
FLAKER, G. C., BLACKSHEAR, J. L., MCBRIDE, R., KRONMAL, R. A.,
HALPERIN, J. G., AND HART, R. G. (1992). Antiarrhythmic drug
therapy and cardiac mortality in atrial fibrillation. J. of the
Amer. Coll. Of Cardiol., 20: 527-532. [0289] FICHER, E.,
OBEJERO-PAZ, C. A., ZHAO, S., BROWN, A. (2002). The binding site
for channel blockers that rescue misprocessed human long QT
syndrome type 2 ether-a-gogo-related gene (HERG) mutations. J.
Biol. Chem. 277(7): 4989-4998. [0290] JURKIEWICZ, N. K.,
SANGUINETTI, M. C. (1993). Rate-dependent prolongation of cardiac
action potentials by a methanesulfonanilide class III
antiarrhythmic agent: specific block of rapidly activating delayed
rectifier K+ current by dofetilide. Circ. Res. 72: 75-83. [0291]
KANNEL, W., CUPPLES, A., D'AGOSTINO, R. (1987). Sudden death risk
in overt coronary heart disease: the Framingham Study. Am. Heart J.
113: 799. [0292] KANNEL, W. B., WOLF, P. A., BENHAMIN, E. J., and
LEVY, D. (1998). Prevalence, incidence, prognosis, and predisposing
conditions for atrial fibrillation-population-based estimates. Am.
J. of Cardiol., 82 (suppl. 8A), N2-N8. [0293] KLUGHERZ, B. D.,
JONES, P. L., CUI, X., CHEN, W., MENEVEAU, N. F., DEFLICE, S.,
CONNOLLY, J., WILENSKY, R. L., LEVY, R. J. (2000). Gene delivery
from a DNA controlled-release stent in porcine coronary arteries.
Nat Biotechnol 18(11):1181-1184. [0294] KRAFFE, D. S., VOLBERG, W.
A. (1994). Voltage-dependence of cardiac delayed rectifier block by
methanesulfonamide class III anti-arrhythmic agents. J. Cardiovasc.
Pharmacol. 349: 602-610. [0295] KREMERS, M. S. (1988). The premise,
promise, and perils of the prevention of lethal ventricular
tachyarrhythmias. Am J. Med. Sci. 296 (3): 202-220. [0296] LEE, K.
L., JIM, M. H., TANG, S. C., and TAI, Y. T., (1998). QT
prolongation and torsades de pointes associated with
clarithromycin. Am. J. Med. 10: 395-396. [0297] LEENHARDT, A.,
DENJOY, I., MAISON-BLANCHE, P., GUICHENEY, P., COUMEL, P. (2000).
Present concepts of congenital long QT syndrome. Arch Mal Coeur
Vaiss. 93: 17-21. [0298] LEES-MILLER, J. P., DUAN, Y., TENG, G. Q.,
THORSTAD, K., AND DUFF, H. J. (2000). Novel gain-of-function
mechanism in K.sup.+ channel-related long-QT syndrome: altered
gating and selectivity in the HERG N629D mutant. Circ. Res. 86:
507-513. [0299] LEVY, R. J., SONG, C., TALLAPRAGADA, DEFELICE, S.,
FINSON, J. T., VYAVAHARE, N., CONNOLLY, J., RYAN, K., LI, Q.
(2001). Tethered adenovirus gene delivery using matrices with
immobilized antiviral IgG. Gene Ther. 8: 659-667. [0300] MARBAN, E.
(2002). Cardiac channelopathies. Nature. 415: 213-218. [0301]
MOUNSEY, P. J., BCH, B. M., DIMARCO, J. P., (2000). Dofetilide.
Circulation. 102: 2665-2670. [0302] NATTEL, S., "Class III Drugs:
Amidarone, Bretylium, Ibutilide, and Sotalol." In: Zipes, D. P.,
Jalife, J. (Eds.), Cardiac Electrophysiology: From Cell to Bedside.
Philadelphia: W.B. Saunders Co., 2000. [0303] RATHORE, S. S.,
BERGER, A. K., WE URT, K. P., SCHULMAN, K. A., OETGEN, W. J.,
GERSH, B. J., AND SOLOMON, A. J. (2000). Acute myocardial
infraction complicated by atrial fibrillation in the elderly.
Prevalence and outcomes. Circulation, 101, 969-974. [0304] REIFFEL,
J. A., REITER, M. J., BLITZER, M. (1998). Antiarrhythmic drugs and
devices for the management of ventricular tachyarrhythmia in
ischemic heart disease. Am. J. of Cardiol. 82 (4A):31I-40I. Review.
[0305] ROCKMAN, H. A., KOCH, W. J., LEFKOWITZ, R. J. (2002).
Seven-transmembrane-spanning receptors and heart function. Nature.
415: 206-12. Review. [0306] RODEN, D. M. (1998). Taking the idio
out of idiosyncratic-predicting torsades de pointes. Pacing Clin.
Electrophysiolol. 21: 1029-1034. [0307] SANGUINETTI, M. C.,
JURKIEWICZ, N. K., SCOTT A., SIEGEL, P. K. (1991). Isoproterenol
antagonizes prolongation of refractory period by the class III
antiarrhythmic agent E-4031 in guinea pig myocytes. Mechanism of
action. Circ Res. 68(1): 77-84. [0308] SANGUINETTI, M. C., CURRAN,
M. E., SPECTOR, P. S., KEATING, M. T. (1996). Spectrum of HERG
K.sup.+ channel dysfunction in an inherited cardiac arrhythmia.
Proc. Natl. Acad. Sci. U.S.A. 93: 2208-2212. [0309] WANG J., FENG,
J., NATTEL, S. (1994). Class III antiarrhythmic drug action in
experimental atrial fibrillation. Differences in reverse use
dependent effectiveness between d-sotalol and the new
antiarrhythmic drug ambasilide. Circulation. 90(4): 2032-2040.
[0310] YANASE, K., SMITH, R. M., PUCCETTI A., JARETT, L., MADAIO,
M. P. (1997). Receptor-mediated cellular entry of nuclear
localizing anti-DNA antibodies via myosin 1. J. Clin. Invest.
100(1): 25-31. [0311] ZACK, D. J., STEMPNIAK, M., WONG, A. L.,
TAYLOR C., WEISBART, R. H. (1996). Mechanisms of cellular
penetration and nuclear localizastion of an anti-double strand DNA
autoantibody. J. Immunol. 157(5): 2082-2088. [0312] ZHOU, Z., GONG,
Q., JANUARY, C. T. (1999). Corrective of defective protein
trafficking of a mutant HERG potassium channel in human long QT
syndrome. Pharmacological and temperature effects. J. Biol. Chem.
1999 274(44): 31123-31126.
Sequence CWU 1
1
1219PRTArtificial SequenceSynthetic Sequence 1Met Asp Tyr Lys Asp
Asp Asp Asp Lys1 529PRTArtificial SequenceSynthetic Sequence 2Asp
Tyr Lys Lys Asp Asp Asp Asp Lys1 5321DNAArtificial SequencePrimer
3accatgtcta ctttatccat t 21442DNAArtificial SequencePrimer
4cttatcgtcg tcatccttgt aatcggggga cattttgaac cc 42522DNAArtificial
SequencePrimer 5ggacattgtt gccatcaacg ac 22624DNAArtificial
SequencePrimer 6atgagccctt ccacgatgcc aaag 24721DNAArtificial
SequencePrimer 7ttatccaatt tcacacagaa c 21819DNAArtificial
SequencePrimer 8caaaagacgg caatatggt 19921DNAArtificial
SequencePrimer 9ttatccaatt tcacagagaa c 211015DNAArtificial
SequencePrimer 10acaccggcct tattc 151120DNAArtificial
SequencePrimer 11accacagtcc atgccatcac 201220DNAArtificial
SequencePrimer 12tccaccaccc tgttgctgta 20
* * * * *