U.S. patent application number 12/063831 was filed with the patent office on 2009-02-26 for genetically modified host cells and use of same for producing isoprenoid compounds.
Invention is credited to Jay D. Keasling, James Kirby, Eric M. Paradise, Yoichiro Shiba.
Application Number | 20090053797 12/063831 |
Document ID | / |
Family ID | 37772222 |
Filed Date | 2009-02-26 |
United States Patent
Application |
20090053797 |
Kind Code |
A1 |
Shiba; Yoichiro ; et
al. |
February 26, 2009 |
GENETICALLY MODIFIED HOST CELLS AND USE OF SAME FOR PRODUCING
ISOPRENOID COMPOUNDS
Abstract
The present invention provides genetically modified eukaryotic
host cells exhibiting increased activity levels of one or more
enzymes that generate precursors to be utilized by the mevalonate
pathway enzymes, increased activity levels of one or more
mevalonate pathway enzymes, prenyl transferase, and/or decreased
levels of squalene synthase activity; such cells are useful for
producing isoprenoid compounds. The present invention provides
genetically modified eukaryotic host cells that produce higher
levels of acetyl-CoA than a control cell; such cells are useful for
producing a variety of products, including isoprenoid compounds.
Methods are provided for the production of an isoprenoid compound
or an isoprenoid precursor in a subject genetically modified
eukaryotic host cell. The methods generally involve culturing a
subject genetically modified host cell under conditions that
promote production of high levels of an isoprenoid or isoprenoid
precursor compound.
Inventors: |
Shiba; Yoichiro; (Fukushima,
JP) ; Kirby; James; (County Louth, IE) ;
Paradise; Eric M.; (Oakland, CA) ; Keasling; Jay
D.; (Berkeley, CA) |
Correspondence
Address: |
UC Berkeley - OTL;Bozicevic, Field & Francis LLP
1900 University Avenue, Suite 200
East Palo Alto
CA
94303
US
|
Family ID: |
37772222 |
Appl. No.: |
12/063831 |
Filed: |
August 17, 2006 |
PCT Filed: |
August 17, 2006 |
PCT NO: |
PCT/US2006/032406 |
371 Date: |
November 4, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60709605 |
Aug 19, 2005 |
|
|
|
60759674 |
Jan 17, 2006 |
|
|
|
60771773 |
Feb 8, 2006 |
|
|
|
Current U.S.
Class: |
435/254.21 |
Current CPC
Class: |
C12P 23/00 20130101 |
Class at
Publication: |
435/254.21 |
International
Class: |
C12N 1/19 20060101
C12N001/19 |
Claims
1-38. (canceled)
39. A genetically modified eukaryotic host cell that produces an
isoprenoid compound or an isoprenoid precursor compound, wherein
said host cell is genetically modified with one or more
heterologous nucleic acids comprising: a) nucleotide sequences
encoding one or more enzymes that convert glucose into acetyl-CoA,
wherein said one or more enzymes comprise an acetaldehyde
dehydrogenase (ALD) or an acetyl-CoA synthetase (ACS); b)
nucleotide sequences encoding one or more enzymes that convert
acetyl-CoA into a prenyl diphosphate; and c) a nucleotide sequence
encoding a terpene synthase, wherein said terpene synthase-encoding
nucleotide sequence is in a plasmid that includes a mutation that
provides for increased stability of the plasmid in the cell,
wherein the isoprenoid or isoprenoid precursor is produced by
action of the terpene synthase.
40. The genetically modified eukaryotic host cell of claim 39,
wherein said one or more enzymes that convert glucose into
acetyl-CoA comprise ALD and ACS.
41. The genetically modified eukaryotic host cell of claim 39,
wherein said one or more enzymes that convert glucose into
acetyl-CoA is ACS that comprises a modification such that
post-translational acetylation of the ACS is reduced.
42. The genetically modified eukaryotic host cell of claim 41,
wherein the ACS comprises an amino acid sequence of SEQ ID NO:24,
modified at amino acid position 707 to include an amino acid other
than leucine.
43. The genetically modified eukaryotic host cell of claim 42,
wherein the ACS comprises the amino acid sequence set forth in SEQ
ID NO:16 or SEQ ID NO:17.
44. The genetically modified eukaryotic host cell of claim 39,
wherein the ACS comprises an amino acid sequence of SEQ ID NO:24,
modified at amino acid position 675 to include an amino acid other
than lysine.
45. The genetically modified eukaryotic host cell of claim 44,
wherein the ACS comprises the amino acid sequence set forth in SEQ
ID NO: 19.
46. The genetically modified eukaryotic host cell of claim 39,
wherein the ACS comprises an amino acid sequence of Salmonella
enterica ACS, modified at amino acid position 641 to include an
amino acid other than leucine.
47. The genetically modified eukaryotic host cell of claim 46,
wherein the amino acid other than leucine is proline.
48. The genetically modified eukaryotic host cell of claim 39,
wherein the ACS comprises an amino acid sequence of Salmonella
enterica ACS, modified at amino acid position 609 to include an
amino acid other than lysine.
49. The genetically modified eukaryotic host cell of claim 39,
wherein the mutation that provides for increased stability of the
plasmid is a mutation in a LEU2 gene.
50. The genetically modified eukaryotic host cell of claim 49,
wherein the mutation is a leu2-d allele.
51. The genetically modified eukaryotic host cell of claim 39,
further comprising a mutation such that an enzyme that
post-translationally modifies ACS is functionally disabled.
52. The genetically modified eukaryotic host cell of claim 39,
wherein one or more of said nucleotide sequences is operably linked
to an inducible promoter.
53. The genetically modified eukaryotic host cell of claim 39,
wherein said heterologous nucleic acid comprising nucleotide
sequences encoding one or more enzymes that convert glucose into
acetyl-CoA is an extrachromosomal nucleic acid.
54. The genetically modified eukaryotic host cell of claim 39,
wherein said heterologous nucleic acid comprising nucleotide
sequences encoding one or more enzymes that convert glucose into
acetyl-CoA is integrated into the genome of the host cell.
55. The genetically modified eukaryotic host cell of claim 39,
wherein said heterologous nucleic acid comprising nucleotide
sequences encoding one or more enzymes that convert acetyl-CoA into
a prenyl diphosphate is an extrachromosomal nucleic acid.
56. The genetically modified eukaryotic host cell of claim 39,
wherein said heterologous nucleic acid comprising nucleotide
sequences encoding one or more enzymes that convert acetyl-CoA into
a prenyl diphosphate is integrated into the genome of the host
cell.
57. The genetically modified eukaryotic host cell of claim 39,
wherein the one or more enzymes that convert acetyl-CoA into a
prenyl diphosphate comprise one or more mevalonate pathway
enzymes.
58. The genetically modified eukaryotic host cell of claim 57,
wherein the one or more enzymes are selected from a
3-hydroxy-3-methylglutaryl coenzyme-A synthase, a
3-hydroxy-3-methylglutaryl coenzyme-A reductase, a truncated
3-hydroxy-3-methylglutaryl coenzyme-A reductase, a mevalonate
kinase, a phosphomevalonate kinase, a mevalonate pyrophosphate
decarboxylase, a geranyl diphosphate synthase, a farnesyl
diphosphate synthase, and a geranylgeranyl diphosphate
synthase.
59. The genetically modified eukaryotic host cell of claim 39,
wherein the terpene synthase is selected from the group consisting
of an amorpha-4,11-diene synthase; a beta-caryophyllene synthase; a
germacrene A synthase; a 8-epicedrol synthase; a valencene
synthase; a (+)-delta-cadinene synthase; a germacrene C synthase; a
(E)-beta-farnesene synthase; a casbene synthase; a vetispiradiene
synthase; a 5-epi-aristolochene synthase; an aristolchene synthase
alpha-humulene synthase; an (E,E)-alpha-farnesene synthase; a
(-)-beta-pinene synthase; a gamma-terpinene synthase; a limonene
cyclase; a linalool synthase; a 1,8-cineole synthase; a
(+)-sabinene synthase; an E-alpha-bisabolene synthase; a (+)-bornyl
diphosphate synthase; a levopimaradiene synthase; an abietadiene
synthase; an isopimaradiene synthase; a (E)-gamma-bisabolene
synthase; a taxadiene synthase; a copalyl pyrophosphate synthase; a
kaurene synthase; a longifolene synthase; a gamma-humulene
synthase; a delta-selinene synthase; a beta-phellandrene synthase;
a limonene synthase; a myrcene synthase; a terpinolene synthase; a
(-)-camphene synthase; a (+)-3-carene synthase; a syn-copalyl
diphosphate synthase; an alpha-terpineol synthase; a
syn-pimara-7,15-diene synthase; an ent-sandaaracopimaradiene
synthase; a stemer-13-ene synthase; a E-beta-ocimene; a S-linalool
synthase; a geraniol synthase; a gamma-terpinene synthase; a
linalool synthasel; a E-beta-ocimene synthase; an epi-cedrol
synthase; an alpha-zingiberene synthase; a guaiadiene synthase; a
cascarilladiene synthase; a cis-muuroladiene synthase; an
aphidicolan-16b-ol synthase; an elizabethatriene synthase; a
sandalol synthase; a patchoulol synthase; a zinzanol synthase; a
cedrol synthase; a scareol synthase, copalol synthase; and a manool
synthase.
60. The genetically modified eukaryotic host cell of claim 39,
wherein the isoprenoid is a monoterpene.
61. The genetically modified eukaryotic host cell of claim 39,
wherein the isoprenoid is a sesquiterpene.
62. The genetically modified eukaryotic host cell of claim 39,
wherein the isoprenoid is a diterpene.
63. The genetically modified eukaryotic host cell of claim 39,
wherein said host cell is a yeast cell.
64. The genetically modified eukaryotic host cell of claim 39,
wherein said host cell is Saccharomyces cerevisiae.
65. A genetically modified yeast cell that produces an isoprenoid
compound or an isoprenoid precursor compound, wherein said
genetically modified yeast cell is genetically modified with one or
more heterologous nucleic acids, wherein the one or more
heterologous nucleic acids comprise: a) a heterologous nucleic acid
comprising nucleotide sequences encoding one or more enzymes that
convert glucose into acetyl-CoA, wherein said one or more enzymes
comprise an acetaldehyde dehydrogenase (ALD) or an acetyl-CoA
synthetase (ACS); b) a heterologous nucleic acid that is integrated
into the yeast cell genome and that comprises nucleotide sequences
encoding one or more enzymes that convert acetyl-CoA into a prenyl
diphosphate; c) a heterologous nucleic acid that is integrated into
the yeast cell genome operably linked to an endogenous nucleotide
sequence encoding a squalene synthase wherein the heterologous
nucleic acid encodes for an heterologous promoter which provides
for a reduced level of transcription of the squalene synthase, and
d) a plasmid comprising a nucleotide sequence encoding a terpene
synthase, wherein said plasmid includes a leu2-d mutation that
provides for increased stability of the plasmid in the cell,
wherein the isoprenoid or isoprenoid precursor is produced by
action of the terpene synthase.
66. The genetically modified yeast cell of claim 65, wherein the
one or more enzymes that convert acetyl-CoA into a prenyl
diphosphate are selected from a 3-hydroxy-3-methylglutaryl
coenzyme-A synthase, a 3-hydroxy-3-methylglutaryl coenzyme-A
reductase, a truncated 3-hydroxy-3-methylglutaryl coenzyme-A
reductase, a mevalonate kinase, a phosphomevalonate kinase, a
mevalonate pyrophosphate decarboxylase, a geranyl diphosphate
synthase, a farnesyl diphosphate synthase, and a geranylgeranyl
diphosphate synthase.
67. The genetically modified yeast cell of claim 65, wherein the
terpene synthase is selected from the group consisting of an
amorpha-4,11-diene synthase; a beta-caryophyllene synthase; a
germacrene A synthase; a 8-epicedrol synthase; a valencene
synthase; a (+)-delta-cadinene synthase; a germacrene C synthase; a
(E)-beta-farnesene synthase; a casbene synthase; a vetispiradiene
synthase; a 5-epi-aristolochene synthase; an aristolchene synthase
alpha-humulene synthase; an (E,E)-alpha-farnesene synthase; a
(-)-beta-pinene synthase; a gamma-terpinene synthase; a limonene
cyclase; a linalool synthase; a 1,8-cineole synthase; a
(+)-sabinene synthase; an E-alpha-bisabolene synthase; a (+)-bornyl
diphosphate synthase; a levopimaradiene synthase; an abietadiene
synthase; an isopimaradiene synthase; a (E)-gamma-bisabolene
synthase; a taxadiene synthase; a copalyl pyrophosphate synthase; a
kaurene synthase; a longifolene synthase; a gamma-humulene
synthase; a delta-selinene synthase; a beta-phellandrene synthase;
a limonene synthase; a myrcene synthase; a terpinolene synthase; a
(-)-camphene synthase; a (+)-3-carene synthase; a syn-copalyl
diphosphate synthase; an alpha-terpineol synthase; a
syn-pimara-7,15-diene synthase; an ent-sandaaracopimaradiene
synthase; a stemer-13-ene synthase; a E-beta-ocimene; a S-linalool
synthase; a geraniol synthase; a gamma-terpinene synthase; a
linalool synthasel; a E-beta-ocimene synthase; an epi-cedrol
synthase; an alpha-zingiberene synthase; a guaiadiene synthase; a
cascarilladiene synthase; a cis-muuroladiene synthase; an
aphidicolan-16b-ol synthase; an elizabethatriene synthase; a
sandalol synthase; a patchoulol synthase; a zinzanol synthase; a
cedrol synthase; a scareol synthase, copalol synthase; and a manool
synthase.
68. The genetically modified yeast cell of claim 65, wherein said
yeast cell is Saccharomyces cerevisiae.
69. The genetically modified yeast cell of claim 65, wherein the
isoprenoid is a monoterpene.
70. The genetically modified yeast cell of claim 65, wherein the
isoprenoid is a sesquiterpene.
71. The genetically modified yeast cell of claim 65, wherein the
isoprenoid is a diterpene.
Description
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional
Patent Application No. 60/709,605, filed Aug. 19, 2005, U.S.
Provisional Patent Application No. 60/759,674, filed Jan. 17, 2006,
and U.S. Provisional Patent Application No. 60/771,773, filed Feb.
8, 2006, which applications are incorporated herein by reference in
their entirety.
FIELD OF THE INVENTION
[0002] The present invention is in the field of production of
isoprenoid compounds, and in particular host cells that are
genetically modified to produce isoprenoid compounds.
BACKGROUND OF THE INVENTION
[0003] Isoprenoids constitute an extremely large and diverse group
of natural products that have a common biosynthetic origin, i.e., a
single metabolic precursor, isopentenyl diphosphate (IPP).
Isoprenoid compounds are also referred to as "terpenes" or
"terpenoids." Over 40,000 isoprenoids have been described. By
definition, isoprenoids are made up of so-called isoprene (C5)
units. The number of C-atoms present in the isoprenoids is
typically divisible by five (C5, C10, C15, C20, C25, C30 and C40),
although irregular isoprenoids and polyterpenes have been reported.
Important members of the isoprenoids include the carotenoids,
sesquiterpenoids, diterpenoids, and hemiterpenes. Carotenoids
include, e.g., lycopene, .beta.-carotene, and the like, many of
which function as antioxidants. Sesquiterpenoids include, e.g.,
artemisinin, a compound having anti-malarial activity. Diterpenoids
include, e.g., taxol, a cancer chemotherapeutic agent.
[0004] Isoprenoids comprise the most numerous and structurally
diverse family of natural products. In this family, terpenoids
isolated from plants and other natural sources are used as
commercial flavor and fragrance compounds as well as antimalarial
and anticancer drugs. A majority of the terpenoid compounds in use
today are natural products or their derivatives. The source
organisms (e.g., trees, marine invertebrates) of many of these
natural products are neither amenable to the large-scale
cultivation necessary to produce commercially viable quantities nor
to genetic manipulation for increased production or derivatization
of these compounds. Therefore, the natural products must be
produced semi-synthetically from analogs or synthetically using
conventional chemical syntheses. Furthermore, many natural products
have complex structures, and, as a result, are currently
uneconomical or impossible to synthesize. Such natural products
must be either extracted from their native sources, such as trees,
sponges, corals and marine microbes; or produced synthetically or
semi-synthetically from more abundant precursors. Extraction of a
natural product from a native source is limited by the availability
of the native source; and synthetic or semi-synthetic production of
natural products can suffer from low yield and/or high cost. Such
production problems and limited availability of the natural source
can restrict the commercial and clinical development of such
products.
[0005] The biosynthesis of isoprenoid natural products in
engineered host cells could tap the unrealized commercial and
therapeutic potential of these natural resources and yield less
expensive and more widely available fine chemicals and
pharmaceuticals. A major obstacle to high level terpenoid
biosynthesis is the production of terpene precursors. In
Saccharomyces cerevisiae, the mevalonate pathway provides for
production of isopentenyl diphosphate (IPP), which can be
isomerized and polymerized into isoprenoids and terpenes of
commercial value. Other valuable precursors are also produced,
including farnesyl diphosphate (FPP) and geranylgeranyl diphosphate
(GPP). However, much of the reaction flux is directed towards the
undesired later steps of the sterol pathway, resulting in the
production of ergosterol.
[0006] There is a need in the art for improved isoprenoid-producing
or isoprenoid precursor-producing host cells that provide for
high-level production of isoprenoid compounds, as well as the
polyprenyl diphosphate precursors of such compounds. The present
invention addresses this need and provides related advantages.
LITERATURE
[0007] U.S. Patent Publication No. 2004/005678; U.S. Patent
Publication No. 2003/0148479; Martin et al. (2003) Nat. Biotech.
21(7):796-802; Polakowski et al. (1998) Appl. Microbiol.
Biotechnol. 49: 67-71; Wilding et al. (2000) J Bacteriol 182(15):
4319-27; U.S. Patent Publication No. 2004/0194162; Donald et al.
(1997) Appl. Env. Microbiol. 63:3341-3344; Jackson et al. (2003)
Organ. Lett. 5:1629-1632; U.S. Patent Publication No. 2004/0072323;
U.S. Patent Publication No. 2004/0029239; U.S. Patent Publication
No. 2004/0110259; U.S. Patent Publication No. 2004/0063182; U.S.
Pat. No. 5,460,949; U.S. Patent Publication No. 2004/0077039; U.S.
Pat. No. 6,531,303; U.S. Pat. No. 6,689,593; Hamano et al. (2001)
Biosci. Biotechnol. Biochem. 65:1627-1635; T. Kuzuyama. (2004)
Biosci. Biotechnol. Biochem. 68(4): 931-934; T. Kazuhiko. (2004)
Biotechnology Letters. 26: 1487-1491; Brock et al. (2004) Eur J.
Biochem. 271: 3227-3241; Choi, et al. (1999) Appl. Environ.
Microbio. 65 4363-4368; Parke et al., (2004) Appl. Environ.
Microbio. 70: 2974-2983; Subrahmanyam et al. (1998) J. Bact. 180:
4596-4602; Murli et al. (2003) J. Ind. Microbiol. Biotechnol. 30:
500-509; Starai et al. (2005) J. Biol. Chem. 280:26200-26205; and
Starai et al. (2004) J. Mol. Biol. 340:1005-1012.
SUMMARY OF THE INVENTION
[0008] The present invention provides genetically modified
eukaryotic host cells that exhibit increased activity levels of one
or more enzymes that generate precursors to be utilized by the
mevalonate pathway enzymes, increased activity levels of one or
more mevalonate pathway enzymes, increased levels of prenyl
transferase activity, and/or decreased levels of squalene synthase
activity; such cells are useful for producing isoprenoid compounds.
In one aspect, the present invention provides genetically modified
eukaryotic host cells that produce higher levels of acetyl-CoA than
a control cell; such cells are useful for producing a variety of
products, including isoprenoid compounds. Methods are provided for
the production of an isoprenoid compound or an isoprenoid precursor
in a subject genetically modified eukaryotic host cell. The methods
generally involve culturing a subject genetically modified host
cell under conditions that promote production of high levels of an
isoprenoid or isoprenoid precursor compound.
FEATURES OF THE INVENTION
[0009] The present invention features a genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
the genetically modified eukaryotic host cell comprising genetic
modifications that provide for: a) an increased level of activity
of acetaldehyde dehydrogenase, and/or b) an increased level of
acetyl-CoA synthetase activity, wherein the genetic modifications
provide for an increased production acetyl-CoA, as compared to a
control cell not comprising the genetic modifications. For example,
in some embodiments, the genetic modifications provide for
production acetyl-CoA at a level that is at least about 10% higher
(e.g., from about 10% higher to 10.sup.3-fold, or more, higher)
than the level of acetyl-CoA produced in a control cell not
comprising the genetic modifications. In some embodiments, the
production of acetyl-CoA is increased by at least about 50%. In
some embodiments, the genetically modified eukaryotic host cell is
genetically modified with a nucleic acid comprising a nucleotide
sequence encoding ALD. In some embodiments, the genetically
modified eukaryotic host cell is genetically modified with a
nucleic acid comprising a nucleotide sequence encoding ACS. In some
embodiments, the ACS is a variant ACS that has reduced
susceptibility to post-translational acetylation. In some
embodiments, the genetically modified eukaryotic host cell is a
yeast cell. In some embodiments, the genetically modified
eukaryotic host cell is Saccharomyces cerevisiae. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0010] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, further comprises one or more genetic
modifications that provide for an increased level of activity of
one or more mevalonate pathway enzymes. In some of these
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Ecm22p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Ecm22p, wherein the level of transcription of one or more
mevalonate pathway enzymes is increased. In some embodiments, the
one or more genetic modifications that provide for an increased
level of activity of one or more mevalonate pathway enzymes result
in an increase in the level of transcription of
hydroxymethylglutaryl coenzyme-A synthase, mevalonate kinase, and
phosphomevalonate kinase. In other embodiments, a subject
genetically modified eukaryotic host cell that produces increased
levels of acetyl-CoA, as described herein, is further genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Upc2p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Upc2p, wherein the level of transcription of one or more mevalonate
pathway enzymes is increased. In some embodiments, the one or more
genetic modifications that provide for an increased level of
activity of one or more mevalonate pathway enzymes result in an
increase in the level of transcription of hydroxymethylglutaryl
coenzyme-A synthase, mevalonate kinase, and phosphomevalonate
kinase. In other embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, is further genetically modified with a nucleic
acid comprising a nucleotide sequence encoding a variant Upc2p
transcription factor, which variant has increased transcriptional
activation activity compared to wild-type Upc2p; and is further
genetically modified with a nucleic acid comprising a nucleotide
sequence encoding a variant Ecm22p transcription factor, which
variant has increased transcriptional activation activity compared
to wild-type Ecm22p; wherein the level of transcription of one or
more mevalonate pathway enzymes is increased. In some embodiments,
the genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0011] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, further comprises one or more genetic
modifications that provide for an increased level of
prenyltransferase activity. In some of these embodiments, the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, wherein the
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding farnesyl pyrophosphate
synthase, wherein the heterologous promoter provides for an
increased level of farnesyl pyrophosphate synthase compared to a
control host cell. In other embodiments, the genetically modified
host cell is genetically modified with a nucleic acid comprising a
heterologous promoter, wherein the promoter replaces an endogenous
promoter operably linked to an endogenous nucleotide sequence
encoding geranyl pyrophosphate synthase, wherein the heterologous
promoter provides for an increased level of geranyl pyrophosphate
synthase compared to a control host cell. In other embodiments, the
genetically modified host cell is genetically modified with a
nucleic acid comprising a heterologous promoter, wherein the
promoter replaces an endogenous promoter operably linked to an
endogenous nucleotide sequence encoding geranylgeranyl
pyrophosphate synthase, wherein the heterologous promoter provides
for an increased level of geranylgeranyl pyrophosphate synthase
compared to a control host cell. In some embodiments, the
heterologous promoter is a GAL1 promoter. In some embodiments, the
genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0012] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, further comprises one or more genetic
modifications that provide for a decreased level of squalene
synthase activity. In some of these embodiments, the genetically
modified host cell is genetically modified with a nucleic acid
comprising a heterologous promoter, which heterologous promoter
replaces an endogenous promoter operably linked to an endogenous
nucleotide sequence encoding squalene synthase, wherein the
heterologous promoter provides for a reduced level of squalene
synthase compared to a control host cell. In some embodiments, the
genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0013] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, further comprises one or more genetic
modifications that provide for: a) an increased level of activity
of one or more mevalonate pathway enzymes; b) one or more genetic
modifications that provide for an increased level of
prenyltransferase activity; and c) one or more genetic
modifications that provide for a decreased level of squalene
synthase activity. In some embodiments, the subject genetically
modified eukaryotic host cell that produces increased levels of
acetyl-CoA, and that comprises one or more genetic modifications
that provide for: a) an increased level of activity of one or more
mevalonate pathway enzymes; b) one or more genetic modifications
that provide for an increased level of prenyltransferase activity;
and c) one or more genetic modifications that provide for a
decreased level of squalene synthase activity, further comprises
one or more genetic modifications that provide for increased
plasmid stability of one or more expression vectors comprising the
one or more genetic modifications. In some embodiments, the
genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0014] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described above, is further genetically modified with a nucleic
acid comprising a nucleotide sequence encoding a truncated
hydroxymethylglutaryl coenzyme-A reductase.
[0015] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, is further genetically modified with a nucleic
acid comprising a nucleotide sequence encoding a terpene
synthase.
[0016] In some embodiments, a subject genetically modified
eukaryotic host cell that produces increased levels of acetyl-CoA,
as described herein, further comprises one or more genetic
modifications that provide for increased plasmid stability of one
or more expression vectors comprising the one or more genetic
modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell further comprises
one or more additional genetic modifications, as described
hereinbelow.
[0017] The present invention features a genetically modified
eukaryotic host cell that produces an isoprenoid or an isoprenoid
precursor compound via a mevalonate pathway, the genetically
modified eukaryotic host cell comprising one or more genetic
modifications that provide for an increased level of activity of
one or more mevalonate pathway enzymes, wherein the genetic
modifications provide for production of an isoprenoid or an
isoprenoid precursor compound at a level that is higher than the
level of the isoprenoid or isoprenoid precursor compound in a
control cell not comprising the genetic modifications. In one
aspect, the genetic modifications provide for production of an
isoprenoid or an isoprenoid precursor compound at a level that is
at least about 10% higher (e.g., from about 10% higher to
10.sup.3-fold, or more, higher) or more, higher than the level of
the isoprenoid or isoprenoid precursor compound in a control cell
not comprising the genetic modifications. In one aspect, the
genetic modifications provide for production of an isoprenoid or an
isoprenoid precursor compound at a level that is at least about 50%
higher than that in the control cell. In another aspect, the
genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Ecm22p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Ecm22p, wherein the level of transcription of one or more
mevalonate pathway enzymes is increased. In some embodiments, the
increase Ecm22p activity results in an increased level of
transcription of hydroxymethylglutaryl coenzyme-A synthase,
mevalonate kinase, and phosphomevalonate kinase. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Upc2p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Upc2p, wherein the level of transcription of one or more mevalonate
pathway enzymes is increased. In some embodiments, the genetically
modified host cell further comprises one or more additional genetic
modifications, as described hereinbelow.
[0018] The present invention features a genetically modified
eukaryotic host cell that produces an isoprenoid or an isoprenoid
precursor compound via a mevalonate pathway, the genetically
modified eukaryotic host cell comprising one or more genetic
modifications that provide for an increased level of
prenyltransferase activity, wherein the genetic modifications
provide for production of an isoprenoid or an isoprenoid precursor
compound at a level that is at least about 10% higher (e.g., from
about 10% higher to 10.sup.3-fold, or more, higher) than the level
of the isoprenoid or isoprenoid precursor compound in a control
cell not comprising the genetic modifications; and wherein the
genetically modified host cell further comprises one or more
genetic modifications that provide for increased plasmid stability
of one or more expression vectors comprising the one or more
genetic modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a heterologous promoter,
wherein the promoter replaces an endogenous promoter operably
linked to an endogenous nucleotide sequence encoding farnesyl
pyrophosphate synthase, wherein the heterologous promoter provides
for an increased level of farnesyl pyrophosphate synthase compared
to a control host cell. In some embodiments, the genetically
modified host cell is genetically modified with a nucleic acid
comprising a heterologous promoter, wherein the promoter replaces
an endogenous promoter operably linked to an endogenous nucleotide
sequence encoding geranyl pyrophosphate synthase, wherein the
heterologous promoter provides for an increased level of geranyl
pyrophosphate synthase compared to a control host cell. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a heterologous promoter,
wherein the promoter replaces an endogenous promoter operably
linked to an endogenous nucleotide sequence encoding geranylgeranyl
pyrophosphate synthase, wherein the heterologous promoter provides
for an increased level of geranylgeranyl pyrophosphate synthase
compared to a control host cell. In some embodiments, the
genetically modified host cell further comprises one or more
additional genetic modifications, as described hereinbelow.
[0019] The present invention features a genetically modified
eukaryotic host cell that produces an isoprenoid or an isoprenoid
precursor compound via a mevalonate pathway, the genetically
modified eukaryotic host cell comprising one or more genetic
modifications that provide for a decreased level of squalene
synthase activity, wherein the genetic modifications provide for
production of an isoprenoid or an isoprenoid precursor compound at
a level that is at least about 10% higher (e.g., from about 10%
higher to 10.sup.3-fold, or more, higher) than the level of the
isoprenoid or isoprenoid precursor compound in a control cell not
comprising the genetic modifications; and wherein the genetically
modified host cell further comprises one or more genetic
modifications that provide for increased plasmid stability of one
or more expression vectors comprising the one or more genetic
modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a truncated hydroxymethylglutaryl coenzyme-A reductase. In
some embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a heterologous promoter,
which heterologous promoter replaces an endogenous promoter
operably linked to an endogenous nucleotide sequence encoding
squalene synthase, wherein the heterologous promoter provides for a
reduced level of squalene synthase compared to a control host cell.
In some embodiments, the genetically modified host cell further
comprises one or more additional genetic modifications, as
described hereinbelow.
[0020] The present invention features a genetically modified
eukaryotic host cell that produces an isoprenoid or an isoprenoid
precursor compound via a mevalonate pathway, the genetically
modified eukaryotic host cell comprising genetic modifications that
provide for: a) an increased level of activity of one or more
mevalonate pathway enzymes, b) an increased level of
prenyltransferase activity, and c) a decreased level of squalene
synthase activity, wherein the genetic modifications provide for
production of an isoprenoid or an isoprenoid precursor compound at
a level that is at least about 10% higher (e.g., from about 10%
higher to 10.sup.3-fold, or more, higher) than the level of the
isoprenoid or isoprenoid precursor compound in a control cell not
comprising the genetic modifications; and wherein the genetically
modified host cell further comprises one or more genetic
modifications that provide for increased plasmid stability of one
or more expression vectors comprising the one or more genetic
modifications. In some embodiments, an expression construct
comprises a leu2-d allele, as described in Example 3. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a truncated hydroxymethylglutaryl coenzyme-A reductase. In
some embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Ecm22p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Ecm22p, wherein the level of transcription of one or more
mevalonate pathway enzymes is increased. In some embodiments, the
increase Ecm22p activity results in an increased level of
transcription of hydroxymethylglutaryl coenzyme-A synthase,
mevalonate kinase, and phosphomevalonate kinase. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding a variant Upc2p transcription factor, which variant has
increased transcriptional activation activity compared to wild-type
Upc2p, wherein the level of transcription of one or more mevalonate
pathway enzymes is increased. In some embodiments, the genetically
modified host cell is genetically modified with a nucleic acid
comprising a heterologous promoter, wherein the promoter replaces
an endogenous promoter operably linked to an endogenous nucleotide
sequence encoding farnesyl pyrophosphate synthase, wherein the
heterologous promoter provides for an increased level of farnesyl
pyrophosphate synthase compared to a control host cell. In some
embodiments, the genetically modified host cell is genetically
modified with a nucleic acid comprising a heterologous promoter,
wherein the promoter replaces an endogenous promoter operably
linked to an endogenous nucleotide sequence encoding geranyl
pyrophosphate synthase, wherein the heterologous promoter provides
for an increased level of geranyl pyrophosphate synthase compared
to a control host cell. In some embodiments, the genetically
modified host cell is genetically modified with a nucleic acid
comprising a heterologous promoter, wherein the promoter replaces
an endogenous promoter operably linked to an endogenous nucleotide
sequence encoding geranylgeranyl pyrophosphate synthase, wherein
the heterologous promoter provides for an increased level of
geranylgeranyl pyrophosphate synthase compared to a control host
cell. In some embodiments, the genetically modified host cell is
genetically modified with a nucleic acid comprising a heterologous
promoter, which heterologous promoter replaces an endogenous
promoter operably linked to an endogenous nucleotide sequence
encoding squalene synthase, wherein the heterologous promoter
provides for a reduced level of squalene synthase compared to a
control host cell. In some embodiments, the genetically modified
host cell further comprises one or more additional genetic
modifications, as described hereinbelow.
[0021] The present invention features methods of producing an
isoprenoid compound or an isoprenoid precursor compound, the
methods generally involving culturing a genetically modified host
cell, as described herein, under suitable conditions such that the
isoprenoid compound or an isoprenoid precursor compound is produced
by the cell. In some embodiments, the isoprenoid compound or an
isoprenoid precursor compound is isolated from the cell and/or the
cell culture supernatant, and will in some embodiments be
purified.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1 is a schematic representation of the mevalonate
pathway in Saccharomyces cerevisiae. The structures of
intermediates and gene names encoding the various enzymes in the
pathway are shown.
[0023] FIG. 2 is a schematic representation of a portion of the
sterol biosynthesis pathway in an organism expressing amorphadiene
synthase (ADS). The structures of intermediates and the names of
genes encoding the various enzymes in the pathway are shown.
[0024] FIGS. 3A and 3B depict production of amorphadiene by S.
cerevisiae over 96 hours of culture expressing amorphadiene
synthase (ADS) (.diamond-solid.); ADS and truncated
3-hydroxy-3-methylglutaryl coenzyme-A reductase (tHMGR) (.cndot.);
ADS and upc2-1 (.box-solid.); and ADS and ecm22-1
(.tangle-solidup.). The data are shown as total production (3A) and
normalized for cell density (3B). The data are means.+-.standard
deviations (n=3).
[0025] FIG. 4 depicts production of amorphadiene in S. cerevisiae
strain EPY212 grown at methionine concentrations of 0, 0.1, 0.3,
0.5 and 1 after 64 and 87 hours of culture. The data are the means
of means from two samples.
[0026] FIG. 5 depicts production of amorphadiene by S. cerevisiae
by various yeast strains over 144 hours of culture expressing. The
data are means.+-.standard deviations (n=3).
[0027] FIG. 6 depicts a nucleotide sequence encoding a truncated
HMGR.
[0028] FIGS. 7A and 7B depict an amino acid sequence of a truncated
HMGR.
[0029] FIG. 8 is a schematic representation of the pyruvate
dehydrogenase bypass in S. cerevisiae. The enzymatic reactions of
pyruvate dehydrogenase bypass are shown by double arrows. The ALD6
gene encodes acetaldehyde dehydrogenase in cytoplasm. The ACS1 and
ACS2 genes encode acetyl-CoA synthetase.
[0030] FIG. 9 depicts expression vectors for amorphadiene synthase
(ADS; e.g., pRS425ADS), acetaldehyde dehydrogenase (ALD), and
acetyl-CoA synthetase (ACS).
[0031] FIGS. 10A-D depict cell growth (OD600; FIG. 10A),
amorphadiene production (FIG. 10B), acetate production (FIG. 10C),
and ethanol production (FIG. 10D) in the parent (control) yeast
strain EPY213, and in two transformants (EPY213/pRS426ALD6 No. 1
and EPY213/pRS426ALD6 No. 2) genetically modified with pRS426ALD6.
Transformants No. 1 and No. 2 overproduce ALD.
[0032] FIGS. 11A-D depict cell growth (OD600; FIG. 11A),
amorphadiene production (FIG. 11B), acetate production (FIG. 11C),
and ethanol production (FIG. 11D) in the parent (control) yeast
strain EPY213, and in two transformants (EPY213/pRS426ACS1 No. 1
and EPY213/pRS426ACS1 No. 2) genetically modified with pRS426ACS1.
Transformants No. 1 and No. 2 overproduce ACS.
[0033] FIGS. 12A-D depict cell growth (OD600; FIG. 12A),
amorphadiene production (FIG. 12B), acetate production (FIG. 12C),
and ethanol production (FIG. 12D) in the parent (control) yeast
strain EPY213, in ALD-overproducing transformant EPY213/pRS426ALD6,
in ACS-overproducing transformant EPY213/pRS426ACS1, and in two
transformants (EPY213/pES-ALD6-ACS1 No. 1 and EPY213/pES-ALD6-ACS1
No. 2) genetically modified with pES-ALD6-ACS1. Transformants
EPY213/pES-ALD6-ACS1 No. 1 and EPY213/pES-ALD6-ACS1 No. 2
overproduce both ALD and ACS.
[0034] FIGS. 13A and 13B depict a comparison of enzyme activity in
strains overexpressing the ALD6 gene (FIG. 13A) or the ACS1 gene
(FIG. 13B). ALD activity (FIG. 13A) and ACS activity (FIG. 13B) in
parent (control) yeast strain EPY213; in EPY213/pRS426/ALD6 and
EPY213/pdeltaALD6 (FIG. 13A); and in EPY213/pRS246ACS1 and
EPY213/pdeltaACS1 (FIG. 13B) are shown.
[0035] FIGS. 14A-C depict ALD activity in EPY213 and
EPY213/pES-ALD6-ACS1 (FIG. 14A); ACS activity in EPY213 and in
EPY213/pES-ALD6-ACS1 (FIG. 14B); and SDS-PAGE analysis of ACS and
ALD protein levels in EPY213 and PEY213/pES-ALD6-ACS1 (FIG. 14C).
FIG. 14C: molecular weight marker (Lane 1); EPY213 (Lane 2); and
EPY213/pES-ALD6-ACS1 (Lane 3).
[0036] FIG. 15 is a schematic representation of post-translational
regulation of ACS activity by the Pat/Sir2 system in Salmonella
enterica. The protein acetyltransferases (Pat) acetylates ACD at
Lys.sup.609, rendering the enzyme inactive. The NAD.sup.+-dependent
Sir2 protein deacetylase (CobB) activates ACS via removal of an
inhibitory acetyl group.
[0037] FIG. 16 depicts an alignment of the C-terminal approximately
50 amino acids of ACS from Salmonella enterica and Saccharomyces
cerevisiae. The location of the acetylation site (Lys-609 in S.
enterica ACS) is shown by an asterisk. The Leu-641 of S. enterica
ACS, which is critical for the acetylation of residue Lys-609, is
shown by the pound (#) symbol.
[0038] FIG. 17 provides an amino acid sequence (SEQ ID NO:22) of S.
cerevisiae acetaldehyde dehydrogenase.
[0039] FIG. 18 provides a nucleotide sequence (SEQ ID NO:23)
encoding S. cerevisiae acetaldehyde dehydrogenase.
[0040] FIG. 19 provides an amino acid sequence (SEQ ID NO:24) of S.
cerevisiae acetyl-CoA synthetase.
[0041] FIG. 20 provides a nucleotide sequence (SEQ ID NO:25)
encoding S. cerevisiae acetyl-CoA synthetase.
[0042] FIG. 21 is a schematic depiction of plasmid
pRS425-Leu2d.
[0043] FIG. 22 is a graph depicting amorphadiene levels over time
in culture.
[0044] FIG. 23 is a graph depicting the percent of cells retaining
plasmid over time.
DEFINITIONS
[0045] The terms "isoprenoid," "isoprenoid compound," "terpene,"
"terpene compound," "terpenoid," and "terpenoid compound" are used
interchangeably herein. Isoprenoid compounds are made up various
numbers of so-called isoprene (C5) units. The number of C-atoms
present in the isoprenoids is typically evenly divisible by five
(e.g., C5, C10, C15, C20, C25, C30 and C40). Irregular isoprenoids
and polyterpenes have been reported, and are also included in the
definition of "isoprenoid." Isoprenoid compounds include, but are
not limited to, monoterpenes, sesquiterpenes, triterpenes,
polyterpenes, and diterpenes.
[0046] As used herein, the term "prenyl diphosphate" is used
interchangeably with "prenyl pyrophosphate," and includes
monoprenyl diphosphates having a single prenyl group (e.g., IPP and
DMAPP), as well as polyprenyl diphosphates that include 2 or more
prenyl groups. Monoprenyl diphosphates include isopentenyl
pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate
(DMAPP).
[0047] As used herein, the term "terpene synthase" refers to any
enzyme that enzymatically modifies IPP, DMAPP, or a polyprenyl
pyrophosphate, such that a terpenoid compound is produced. The term
"terpene synthase" includes enzymes that catalyze the conversion of
a prenyl diphosphate into an isoprenoid.
[0048] The word "pyrophosphate" is used interchangeably herein with
"diphosphate." Thus, e.g., the terms "prenyl diphosphate" and
"prenyl pyrophosphate" are interchangeable; the terms "isopentenyl
pyrophosphate" and "isopentenyl diphosphate" are interchangeable;
the terms farnesyl diphosphate" and farnesyl pyrophosphate" are
interchangeable; etc.
[0049] The term "mevalonate pathway" or "MEV pathway" is used
herein to refer to the biosynthetic pathway that converts
acetyl-CoA to IPP. The mevalonate pathway comprises enzymes that
catalyze the following steps: (a) condensing two molecules of
acetyl-CoA to acetoacetyl-CoA; (b) condensing acetoacetyl-CoA with
acetyl-CoA to form HMG-CoA; (c) converting HMG-CoA to mevalonate;
(d) phosphorylating mevalonate to mevalonate 5-phosphate; (e)
converting mevalonate 5-phosphate to mevalonate 5-pyrophosphate;
and (f) converting mevalonate 5-pyrophosphate to isopentenyl
pyrophosphate. The mevalonate pathway is illustrated schematically
in FIG. 1.
[0050] As used herein, the term "prenyl transferase" is used
interchangeably with the terms "isoprenyl diphosphate synthase" and
"polyprenyl synthase" (e.g., "GPP synthase," "FPP synthase," "OPP
synthase," etc.) to refer to an enzyme that catalyzes the
consecutive 1'-4 condensation of isopentenyl diphosphate with
allylic primer substrates, resulting in the formation of prenyl
diphosphates of various chain lengths.
[0051] The terms "polynucleotide" and "nucleic acid," used
interchangeably herein, refer to a polymeric form of nucleotides of
any length, either ribonucleotides or deoxynucleotides. Thus, this
term includes, but is not limited to, single-, double-, or
multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a
polymer comprising purine and pyrimidine bases or other natural,
chemically or biochemically modified, non-natural, or derivatized
nucleotide bases.
[0052] As used herein, the terms "operon" and "single transcription
unit" are used interchangeably to refer to two or more contiguous
coding regions (nucleotide sequences that encode a gene product
such as an RNA or a protein) that are coordinately regulated by one
or more controlling elements (e.g., a promoter). As used herein,
the term "gene product" refers to RNA encoded by DNA (or vice
versa) or protein that is encoded by an RNA or DNA, where a gene
will typically comprise one or more nucleotide sequences that
encode a protein, and may also include introns and other non-coding
nucleotide sequences.
[0053] The terms "peptide," "polypeptide," and "protein" are used
interchangeably herein, and refer to a polymeric form of amino
acids of any length, which can include coded and non-coded amino
acids, chemically or biochemically modified or derivatized amino
acids, and polypeptides having modified peptide backbones.
[0054] The term "naturally-occurring" as used herein as applied to
a nucleic acid, a cell, or an organism, refers to a nucleic acid,
cell, or organism that is found in nature. For example, a
polypeptide or polynucleotide sequence that is present in an
organism (including viruses) that can be isolated from a source in
nature and which has not been intentionally modified by a human in
the laboratory is naturally occurring.
[0055] The term "heterologous nucleic acid," as used herein, refers
to a nucleic acid wherein at least one of the following is true:
(a) the nucleic acid is foreign ("exogenous") to (i.e., not
naturally found in) a given host microorganism or host cell; (b)
the nucleic acid comprises a nucleotide sequence that is naturally
found in (e.g., is "endogenous to") a given host microorganism or
host cell (e.g., the nucleic acid comprises a nucleotide sequence
endogenous to the host microorganism or host cell); however, in the
context of a heterologous nucleic acid, the same nucleotide
sequence as found endogenously is produced in an unnatural (e.g.,
greater than expected or greater than naturally found) amount in
the cell, or a nucleic acid comprising a nucleotide sequence that
differs in sequence from the endogenous nucleotide sequence but
encodes the same protein (having the same or substantially the same
amino acid sequence) as found endogenously is produced in an
unnatural (e.g., greater than expected or greater than naturally
found) amount in the cell; (c) the nucleic acid comprises two or
more nucleotide sequences that are not found in the same
relationship to each other in nature, e.g., the nucleic acid is
recombinant. An example of a heterologous nucleic acid is a
nucleotide sequence encoding HMGR operably linked to a
transcriptional control element (e.g., a promoter) to which an
endogenous (naturally-occurring) HMGR coding sequence is not
normally operably linked. Another example of a heterologous nucleic
acid a high copy number plasmid comprising a nucleotide sequence
encoding HMGR. Another example of a heterologous nucleic acid is a
nucleic acid encoding HMGR, where a host cell that does not
normally produce HMGR is genetically modified with the nucleic acid
encoding HMGR; because HMGR-encoding nucleic acids are not
naturally found in the host cell, the nucleic acid is heterologous
to the genetically modified host cell.
[0056] "Recombinant," as used herein, means that a particular
nucleic acid (DNA or RNA) is the product of various combinations of
cloning, restriction, and/or ligation steps resulting in a
construct having a structural coding or non-coding sequence
distinguishable from endogenous nucleic acids found in natural
systems. Generally, DNA sequences encoding the structural coding
sequence can be assembled from cDNA fragments and short
oligonucleotide linkers, or from a series of synthetic
oligonucleotides, to provide a synthetic nucleic acid which is
capable of being expressed from a recombinant transcriptional unit
contained in a cell or in a cell-free transcription and translation
system. Such sequences can be provided in the form of an open
reading frame uninterrupted by internal non-translated sequences,
or introns, which are typically present in eukaryotic genes.
Genomic DNA comprising the relevant sequences can also be used in
the formation of a recombinant gene or transcriptional unit.
Sequences of non-translated DNA may be present 5' or 3' from the
open reading frame, where such sequences do not interfere with
manipulation or expression of the coding regions, and may indeed
act to modulate production of a desired product by various
mechanisms (see "DNA regulatory sequences", below).
[0057] Thus, e.g., the term "recombinant" polynucleotide or nucleic
acid refers to one which is not naturally occurring, e.g., is made
by the artificial combination of two otherwise separated segments
of sequence through human intervention. This artificial combination
is often accomplished by either chemical synthesis means, or by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques. Such is usually done to
replace a codon with a redundant codon encoding the same or a
conservative amino acid, while typically introducing or removing a
sequence recognition site. Alternatively, it is performed to join
together nucleic acid segments of desired functions to generate a
desired combination of functions. This artificial combination is
often accomplished by either chemical synthesis means, or by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques.
[0058] By "construct" is meant a recombinant nucleic acid,
generally recombinant DNA, which has been generated for the purpose
of the expression of a specific nucleotide sequence(s), or is to be
used in the construction of other recombinant nucleotide
sequences.
[0059] As used herein, the term "exogenous nucleic acid" refers to
a nucleic acid that is not normally or naturally found in and/or
produced by a given bacterium, organism, or cell in nature. An
exogenous nucleic acid is a nucleic acid that is introduced
exogenously into a host cell. As used herein, the term "endogenous
nucleic acid" refers to a nucleic acid that is normally found in
and/or produced by a given bacterium, organism, or cell in nature.
An "endogenous nucleic acid" is also referred to as a "native
nucleic acid" or a nucleic acid that is "native" to a given
bacterium, organism, or cell. For example, a cDNA generated from
mRNA isolated from a plant and encoding a terpene synthase
represents an exogenous nucleic acid to S. cerevisiae. In S.
cerevisiae, nucleotide sequences encoding HMGS, MK, and PMK on the
chromosome would be "endogenous" nucleic acids.
[0060] The terms "DNA regulatory sequences," "control elements,"
and "regulatory elements," used interchangeably herein, refer to
transcriptional and translational control sequences, such as
promoters, enhancers, polyadenylation signals, terminators, protein
degradation signals, and the like, that provide for and/or regulate
expression of a coding sequence and/or production of an encoded
polypeptide in a host cell.
[0061] The term "transformation" is used interchangeably herein
with "genetic modification" and refers to a permanent or transient
genetic change induced in a cell following introduction of new
nucleic acid (i.e., DNA exogenous to the cell). Genetic change
("modification") can be accomplished either by incorporation of the
new DNA into the genome of the host cell, or by transient or stable
maintenance of the new DNA as an episomal element. Where the cell
is a eukaryotic cell, a permanent genetic change is generally
achieved by introduction of the DNA into the genome of the cell. In
prokaryotic cells, permanent changes can be introduced into the
chromosome or via extrachromosomal elements such as plasmids and
expression vectors, which may contain one or more selectable
markers to aid in their maintenance in the recombinant host
cell.
[0062] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. For instance, a promoter is
operably linked to a coding sequence if the promoter affects its
transcription or expression. As used herein, the terms
"heterologous promoter" and "heterologous control regions" refer to
promoters and other control regions that are not normally
associated with a particular nucleic acid in nature. For example, a
"transcriptional control region heterologous to a coding region" is
a transcriptional control region that is not normally associated
with the coding region in nature.
[0063] A "host cell," as used herein, denotes an in vivo or in
vitro eukaryotic cell or a cell from a multicellular organism
(e.g., a cell line) cultured as a unicellular entity, which
eukaryotic cells can be, or have been, used as recipients for a
nucleic acid (e.g., an expression vector that comprises a
nucleotide sequence encoding one or more gene products such as
mevalonate pathway gene products), and include the progeny of the
original cell which has been genetically modified by the nucleic
acid. It is understood that the progeny of a single cell may not
necessarily be completely identical in morphology or in genomic or
total DNA complement as the original parent, due to natural,
accidental, or deliberate mutation. A "recombinant host cell" (also
referred to as a "genetically modified host cell") is a host cell
into which has been introduced a heterologous nucleic acid, e.g.,
an expression vector. For example, a subject eukaryotic host cell
is a genetically modified eukaryotic host cell, by virtue of
introduction into a suitable eukaryotic host cell a heterologous
nucleic acid, e.g., an exogenous nucleic acid that is foreign to
the eukaryotic host cell, or a recombinant nucleic acid that is not
normally found in the eukaryotic host cell.
[0064] As used herein the term "isolated" is meant to describe a
polynucleotide, a polypeptide, or a cell that is in an environment
different from that in which the polynucleotide, the polypeptide,
or the cell naturally occurs. An isolated genetically modified host
cell may be present in a mixed population of genetically modified
host cells.
[0065] Expression cassettes may be prepared comprising a
transcription initiation or transcriptional control region(s)
(e.g., a promoter), the coding region for the protein of interest,
and a transcriptional termination region. Transcriptional control
regions include those that provide for over-expression of the
protein of interest in the genetically modified host cell; those
that provide for inducible expression, such that when an inducing
agent is added to the culture medium, transcription of the coding
region of the protein of interest is induced or increased to a
higher level than prior to induction.
[0066] A nucleic acid is "hybridizable" to another nucleic acid,
such as a cDNA, genomic DNA, or RNA, when a single stranded form of
the nucleic acid can anneal to the other nucleic acid under the
appropriate conditions of temperature and solution ionic strength.
Hybridization and washing conditions are well known and exemplified
in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning:
A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table
11.1 therein; and Sambrook, J. and Russell, W., Molecular Cloning:
A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor (2001). The conditions of temperature and
ionic strength determine the "stringency" of the hybridization.
Stringency conditions can be adjusted to screen for moderately
similar fragments, such as homologous sequences from distantly
related organisms, to highly similar fragments, such as genes that
duplicate functional enzymes from closely related organisms.
Hybridization conditions and post-hybridization washes are useful
to obtain the desired determine stringency conditions of the
hybridization. One set of illustrative post-hybridization washes is
a series of washes starting with 6.times.SSC (where SSC is 0.15 M
NaCl and 15 mM citrate buffer), 0.5% SDS at room temperature for 15
minutes, then repeated with 2.times.SSC, 0.5% SDS at 45.degree. C.
for 30 minutes, and then repeated twice with 0.2.times.SSC, 0.5%
SDS at 50.degree. C. for 30 minutes. Other stringent conditions are
obtained by using higher temperatures in which the washes are
identical to those above except for the temperature of the final
two 30 minute washes in 0.2.times.SSC, 0.5% SDS, which is increased
to 60.degree. C. Another set of highly stringent conditions uses
two final washes in 0.1.times.SSC, 0.1% SDS at 65.degree. C.
Another example of stringent hybridization conditions is
hybridization at 50.degree. C. or higher and 0.1.times.SSC (15 mM
sodium chloride/1.5 mM sodium citrate). Another example of
stringent hybridization conditions is overnight incubation at
42.degree. C. in a solution: 50% formamide, 5.times.SSC (150 mM
NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate, and 20 .mu.g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters in 0.1.times.SSC at about 65.degree. C. Stringent
hybridization conditions and post-hybridization wash conditions are
hybridization conditions and post-hybridization wash conditions
that are at least as stringent as the above representative
conditions.
[0067] Hybridization requires that the two nucleic acids contain
complementary sequences, although depending on the stringency of
the hybridization, mismatches between bases are possible. The
appropriate stringency for hybridizing nucleic acids depends on the
length of the nucleic acids and the degree of complementation,
variables well known in the art. The greater the degree of
similarity or homology between two nucleotide sequences, the
greater the value of the melting temperature (Tm) for hybrids of
nucleic acids having those sequences. The relative stability
(corresponding to higher Tm) of nucleic acid hybridizations
decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For
hybrids of greater than 100 nucleotides in length, equations for
calculating Tm have been derived (see Sambrook et al., supra,
9.50-9.51). For hybridizations with shorter nucleic acids, i.e.,
oligonucleotides, the position of mismatches becomes more
important, and the length of the oligonucleotide determines its
specificity (see Sambrook et al., supra, 11.7-11.8). Typically, the
length for a hybridizable nucleic acid is at least about 10
nucleotides. Illustrative minimum lengths for a hybridizable
nucleic acid are: at least about 15 nucleotides; at least about 20
nucleotides; and at least about 30 nucleotides. Furthermore, the
skilled artisan will recognize that the temperature and wash
solution salt concentration may be adjusted as necessary according
to factors such as length of the probe.
[0068] The term "conservative amino acid substitution" refers to
the interchangeability in proteins of amino acid residues having
similar side chains. For example, a group of amino acids having
aliphatic side chains consists of glycine, alanine, valine,
leucine, and isoleucine; a group of amino acids having
aliphatic-hydroxyl side chains consists of serine and threonine; a
group of amino acids having amide-containing side chains consists
of asparagine and glutamine; a group of amino acids having aromatic
side chains consists of phenylalanine, tyrosine, and tryptophan; a
group of amino acids having basic side chains consists of lysine,
arginine, and histidine; and a group of amino acids having
sulfur-containing side chains consists of cysteine and methionine.
Exemplary conservative amino acids substitution groups are:
valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine,
alanine-valine, and asparagine-glutamine.
[0069] "Synthetic nucleic acids" can be assembled from
oligonucleotide building blocks that are chemically synthesized
using procedures known to those skilled in the art. These building
blocks are ligated and annealed to form gene segments which are
then enzymatically assembled to construct the entire gene.
"Chemically synthesized," as related to a sequence of DNA, means
that the component nucleotides were assembled in vitro. Manual
chemical synthesis of DNA may be accomplished using
well-established procedures, or automated chemical synthesis can be
performed using one of a number of commercially available machines.
The nucleotide sequence of the nucleic acids can be modified for
optimal expression based on optimization of nucleotide sequence to
reflect the codon bias of the host cell. The skilled artisan
appreciates the likelihood of successful expression if codon usage
is biased towards those codons favored by the host. Determination
of preferred codons can be based on a survey of genes derived from
the host cell where sequence information is available.
[0070] A polynucleotide or polypeptide has a certain percent
"sequence identity" to another polynucleotide or polypeptide,
meaning that, when aligned, that percentage of bases or amino acids
are the same, and in the same relative position, when comparing the
two sequences. Sequence similarity can be determined in a number of
different manners. To determine sequence identity, sequences can be
aligned using the methods and computer programs, including BLAST,
available over the world wide web at ncbi.nlm.nih.gov/BLAST. See,
e.g., Altschul et al. (1990), J. Mol. Biol. 215:403-10. Another
alignment algorithm is FASTA, available in the Genetics Computing
Group (GCG) package, from Madison, Wis., USA, a wholly owned
subsidiary of Oxford Molecular Group, Inc. Other techniques for
alignment are described in Methods in Enzymology, vol. 266:
Computer Methods for Macromolecular Sequence Analysis (1996), ed.
Doolittle, Academic Press, Inc., a division of Harcourt Brace &
Co., San Diego, Calif., USA. Of particular interest are alignment
programs that permit gaps in the sequence. The Smith-Waterman is
one type of algorithm that permits gaps in sequence alignments. See
Meth. Mol. Biol. 70: 173-187 (1997). Also, the GAP program using
the Needleman and Wunsch alignment method can be utilized to align
sequences. See J. Mol. Biol. 48: 443-453 (1970).
[0071] Before the present invention is further described, it is to
be understood that this invention is not limited to particular
embodiments described, as such may, of course, vary. It is also to
be understood that the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting, since the scope of the present invention will be
limited only by the appended claims.
[0072] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the invention.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges, and are also
encompassed within the invention, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the invention.
[0073] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and describe the methods and/or materials in
connection with which the publications are cited.
[0074] It must be noted that as used herein and in the appended
claims, the singular forms "a," "and," and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a genetically modified host cell" includes a
plurality of such genetically modified host cells and reference to
"the isoprenoid compound" includes reference to one or more
isoprenoid compounds and equivalents thereof known to those skilled
in the art, and so forth. It is further noted that the claims may
be drafted to exclude any optional element. As such, this statement
is intended to serve as antecedent basis for use of such exclusive
terminology as "solely," "only" and the like in connection with the
recitation of claim elements, or use of a "negative"
limitation.
[0075] The publications discussed herein are provided solely for
their disclosure prior to the filing date of the present
application. Nothing herein is to be construed as an admission that
the present invention is not entitled to antedate such publication
by virtue of prior invention. Further, the dates of publication
provided may be different from the actual publication dates which
may need to be independently confirmed.
DETAILED DESCRIPTION OF THE INVENTION
[0076] The present invention provides genetically modified
eukaryotic host cells that exhibit increased activity levels of one
or more enzymes that generate precursors to be utilized by the
mevalonate pathway enzymes, increased activity levels of one or
more mevalonate pathway enzymes, increased levels of prenyl
transferase activity, and/or decreased levels of squalene synthase
activity; such cells are useful for producing isoprenoid compounds.
In one aspect, the present invention provides genetically modified
eukaryotic host cells that exhibit increased activity levels of one
or more of mevalonate pathway enzymes, increased levels of prenyl
transferase activity, and decreased levels of squalene synthase
activity; such cells are useful for producing isoprenoid compounds.
The present invention provides genetically modified eukaryotic host
cells that produce higher levels of acetyl-CoA than a control cell;
such cells are useful for producing a variety of products,
including isoprenoid compounds. Methods are provided for the
production of an isoprenoid compound or an isoprenoid precursor in
a subject genetically modified eukaryotic host cell. The methods
generally involve culturing a subject genetically modified host
cell under conditions that promote production of high levels of an
isoprenoid or isoprenoid precursor compound.
[0077] The S. cerevisiae mevalonate and sterol pathways are
depicted schematically in FIG. 1 and FIG. 2 (note that amorphadiene
synthase (ADS) in FIG. 2 is not normally expressed in genetically
unmodified S. cerevisiae.) This pathway is typical of a wide
variety of eukaryotic cells. FPP is converted to squalene by
squalene synthase (ERG9). Squalene is converted to ergosterol in
subsequent steps. In unmodified cells, much of the metabolic flux
directs FPP towards sterol synthesis. In a subject genetically
modified eukaryotic host cell, the metabolic flux is redirected
towards greater production of the isoprenoid precursors IPP and
FPP.
Genetically Modified Host Cells
[0078] The present invention provides genetically modified
eukaryotic host cells that exhibit increased activity levels of one
or more of mevalonate pathway enzymes, increased levels of prenyl
transferase activity, and decreased levels of squalene synthase
activity; such cells are useful for producing isoprenoid compounds.
The present invention provides genetically modified eukaryotic host
cells that produce higher levels of acetyl-CoA than a control cell;
such cells are useful for producing a variety of products,
including isoprenoid compounds.
Genetically Modified Host Cells that Exhibit Increased Activity
Levels of One or More Mevalonate Pathway Enzymes Increased Levels
of Prenyl Transferase Activity, and Decreased Levels of Squalene
Synthase Activity
[0079] The present invention provides genetically modified
eukaryotic host cells, which cells comprise one or more genetic
modifications that provide for increased production of isoprenoid
or isoprenoid precursor compounds. Compared to a control host cell
not genetically modified according to the present invention, a
subject genetically modified host cell exhibits the following
characteristics: increased activity levels of one or more
mevalonate pathway enzymes; increased levels of prenyl transferase
activity; and decreased levels of squalene synthase activity.
[0080] Increased activity levels of one or more mevalonate pathway
enzymes, increased levels of prenyl transferase activity, and
decreased levels of squalene synthase activity increases isoprenoid
or isoprenoid precursor production by a subject genetically
modified host cell. Thus, in some embodiments, a subject
genetically modified host cell exhibits increases in isoprenoid or
isoprenoid precursor production, where isoprenoid or isoprenoid
precursor production is increased by at least about 10%, at least
about 15%, at least about 20%, at least about 25%, at least about
30%, at least about 35%, at least about 40%, at least about 45%, at
least about 50%, at least about 60%, at least about 70%, at least
about 80%, at least about 90%, at least about 2-fold, at least
about 2.5-fold, at least about 5-fold, at least about 10-fold, at
least about 20-fold, at least about 30-fold, at least about
40-fold, at least about 50-fold, at least about 75-fold, at least
about 100-fold, at least about 200-fold, at least about 300-fold,
at least about 400-fold, at least about 500-fold, or at least about
10.sup.3-fold, or more, in the genetically modified host cell,
compared to the level of isoprenoid precursor or isoprenoid
compound produced in a control host cell that is not genetically
modified as described herein. Isoprenoid or isoprenoid precursor
production is readily determined using well-known methods, e.g.,
gas chromatography-mass spectrometry, liquid chromatography-mass
spectrometry, ion chromatography-mass spectrometry, pulsed
amperometric detection, uv-vis spectrometry, and the like.
[0081] In some embodiments, a subject genetically modified host
cell provides for enhanced production of isoprenoid or isoprenoid
precursor per cell, e.g., the amount of isoprenoid or isoprenoid
precursor compound produced using a subject method is at least
about 10%, at least about 15%, at least about 20%, at least about
25%, at least about 30%, at least about 35%, at least about 40%, at
least about 45%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 90%, at least about
2-fold, at least about 2.5-fold, at least about 5-fold, at least
about 10-fold, at least about 20-fold, at least about 30-fold, at
least about 40-fold, at least about 50-fold, at least about
75-fold, at least about 100-fold, at least about 200-fold, at least
about 300-fold, at least about 400-fold, or at least about
500-fold, or 10.sup.3-fold, or more, higher than the amount of the
isoprenoid or isoprenoid precursor compound produced by a host cell
that is not genetically modified by the subject methods, on a per
cell basis. Amount of cells is measured by measuring dry cell
weight or measuring optical density of the cell culture.
[0082] In other embodiments, a subject genetically modified host
cell provides for enhanced production of isoprenoid or isoprenoid
precursor per unit volume of cell culture, e.g., the amount of
isoprenoid or isoprenoid precursor compound produced using a
subject genetically modified host cell is at least about 10%, at
least about 15%, at least about 20%, at least about 25%, at least
about 30%, at least about 35%, at least about 40%, at least about
45%, at least about 50%, at least about 60%, at least about 70%, at
least about 80%, at least about 90%, at least about 2-fold, at
least about 2.5-fold, at least about 5-fold, at least about
10-fold, at least about 20-fold, at least about 30-fold, at least
about 40-fold, at least about 50-fold, at least about 75-fold, at
least about 100-fold, at least about 200-fold, at least about
300-fold, at least about 400-fold, or at least about 500-fold, or
10.sup.3-fold, or more, higher than the amount of the isoprenoid or
isoprenoid precursor compound produced by a host cell that is not
genetically modified by the subject methods, on a per unit volume
of cell culture basis.
[0083] In some embodiments, a subject genetically modified
eukaryotic host produces an isoprenoid or isoprenoid precursor
compound in an amount ranging from 1 .mu.g isoprenoid compound/ml
to 100,000 .mu.g isoprenoid compound/ml, e.g., from about 1
.mu.g/ml to about 10,000 .mu.g/ml of isoprenoid compound, 1
.mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
4500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 4000 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 3500 .mu.g/ml of isoprenoid
compound, 1 .mu.g/ml to 3000 .mu.g/ml of isoprenoid compound, 1
.mu.g/ml to 2500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
2000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 1500 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 1000 .mu.g/ml of isoprenoid
compound, 5 .mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 10
.mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 20 .mu.g/ml to
5000 .mu.g/ml of isoprenoid compound, 30 .mu.g/ml to 1000 .mu.g/ml
of isoprenoid compound, 40 .mu.g/ml to 500 .mu.g/ml of isoprenoid
compound, 50 .mu.g/ml to 300 .mu.g/ml of isoprenoid compound, 60
.mu.g/ml to 100 .mu.g/ml of isoprenoid compound, 70 .mu.g/ml to 80
.mu.g/ml of isoprenoid compound, from about 1 .mu.g/ml to about
1,000 .mu.g/ml, from about 1,000 .mu.g/ml to about 2,000 .mu.g/ml,
from about 2,000 .mu.g/ml to about 3,000 .mu.g/ml, from about 3,000
.mu.g/ml to about 4,000 .mu.g/ml, from about 4,000 .mu.g/ml to
about 5,000 .mu.g/ml, from about 5,000 .mu.g/ml to about 7,500
.mu.g/ml, or from about 7,500 .mu.g/ml to about 10,000 .mu.g/ml, or
greater than 10,000 .mu.g/ml isoprenoid compound, e.g., from about
10 mg isoprenoid compound/ml to about 20 mg isoprenoid compound/ml,
from about 20 mg isoprenoid compound/ml to about 50 mg isoprenoid
compound/ml, from about 50 mg isoprenoid compound/ml to about 100
mg isoprenoid compound/ml, or more.
[0084] The subject methods can be used in a variety of different
kinds of eukaryotic host cells. Host cells are, in many
embodiments, unicellular organisms, or are grown in culture as
single cells. Suitable eukaryotic host cells include, but are not
limited to, yeast cells, insect cells, plant cells, fungal cells,
and algal cells. Suitable eukaryotic host cells include, but are
not limited to, Pichia pastoris, Pichia finlandica, Pichia
trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia
opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia
guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica,
Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula
polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida
albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus
oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium
sp., Fusarium gramineum, Fusarium venenatum, Neurospora crassa,
Chlamydomonas reinhardtii, and the like. In some embodiments, the
host cell is a eukaryotic cell other than a plant cell. In some
embodiments, subject genetically modified host cell is a yeast
cell. In a particular embodiment, the yeast cell is Saccharomyces
cerevisiae.
[0085] In an exemplary embodiment, the metabolic pathway of
Saccharomyces cerevisiae is engineered to produce sesquiterpenes
from farnesyl diphosphate. One such sesquiterpene, amorphadiene, is
a precursor to the antimalarial drug artemisinin. Amorphadiene,
cyclized from farnesyl diphosphate, can be used as an assay for
isoprenoid precursor levels.
[0086] In an exemplary embodiment, activity levels of HMGR, a
prenyl transferase, Ecm22p and Upc2p are increased and activity
levels of squalene synthase are decreased.
3-hydroxy-3-methylglutaryl coenzyme-A reductase (HMGR) and a prenyl
transferase, e.g., farnesyl diphosphate synthase (FPPS), catalyze
bottle neck reactions in an amorphadiene synthesis pathway.
Increasing activity of HMGR and a prenyl transferase, e.g., FPPS,
overcomes these bottlenecks. Two transcription factors, Ecm22p and
Upc2p, are important in sterol synthesis regulation. Each of these
two factors is mutated at a single amino acid near their C-termini,
which mutation increases activity of each factor. Squalene synthase
catalyzes the reaction from farnesyl diphosphate to squalene in the
undesired sterol synthesis pathway. Thus, to maximize precursor
pools and prevent undue flux to sterols, transcription of ERG9 has
been limited.
Increased Level of Activity of One or More Mevalonate Pathway
Enzymes
[0087] The mevalonate pathway comprises enzymes that catalyze the
following steps: (a) condensing two molecules of acetyl-CoA to
acetoacetyl-CoA, typically by action of acetoacetyl-CoA thiolase;
(b) condensing acetoacetyl-CoA with acetyl-CoA to form HMG-CoA,
typically by action of HMG synthase (HMGS); (c) converting HMG-CoA
to mevalonate, typically by action of HMGR; (d) phosphorylating
mevalonate to mevalonate 5-phosphate, typically by action of
mevalonate kinase (MK); (e) converting mevalonate 5-phosphate to
mevalonate 5-pyrophosphate, typically by action of
phosphomevalonate kinase (PMK); and (f) converting mevalonate
5-pyrophosphate to isopentenyl pyrophosphate, typically by action
of mevalonate pyrophosphate decarboxylase (MPD).
[0088] A subject genetically modified eukaryotic host cell
comprises one or more genetic modifications resulting in one or
more of the following: increased level of HMGS activity; increased
level of HMGR activity; increased level of MK activity; increased
level of PMK activity; and increased level of MPD activity.
[0089] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of activity of one
or more mevalonate pathway enzymes is increased. The level of
activity of one or more mevalonate pathway enzymes in a subject
genetically modified host cell can be increased in a number of
ways, including, but not limited to, 1) increasing the promoter
strength of the promoter to which the mevalonate pathway enzyme
coding region is operably linked; 2) increasing the copy number of
the plasmid comprising a nucleotide sequence encoding the
mevalonate pathway enzyme; 3) increasing the stability of a
mevalonate pathway enzyme mRNA (where a "mevalonate pathway enzyme
mRNA" is an mRNA comprising a nucleotide sequence encoding the
mevalonate pathway enzyme); 4) modifying the sequence or the
ribosome binding site of a mevalonate pathway enzyme mRNA such that
the level of translation of the mevalonate pathway enzyme mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of a mevalonate pathway enzyme mRNA and the start codon of the
mevalonate pathway enzyme coding sequence such that the level of
translation of the mevalonate pathway enzyme mRNA is increased; 6)
modifying the entire intercistronic region 5' of the start codon of
the mevalonate pathway enzyme coding region such that translation
of the mevalonate pathway enzyme mRNA is increased; 7) modifying
the codon usage of mevalonate pathway enzyme such that the level of
translation of the mevalonate pathway enzyme mRNA is increased, 8)
expressing rare codon tRNAs used in the mevalonate pathway enzyme
such that the level of translation of the mevalonate pathway enzyme
mRNA is increased; 9) increasing the enzyme stability of mevalonate
pathway enzyme; 10) increasing the specific activity (units
activity per unit protein) of the mevalonate pathway enzyme; 11)
expressing a modified form of a mevalonate pathway enzyme such that
the modified enzyme exhibits increased solubility in the host cell;
or 12) expressing a modified form of a mevalonate pathway enzyme
such that the modified enzyme lacks a domain through which
regulation occurs. The foregoing modifications may be made singly
or in combination; e.g., two or more of the foregoing modifications
may be made to provide for an increased level of mevalonate pathway
enzyme activity.
[0090] The enzyme HMG-CoA reductase (HMGR) catalyzes an
irreversible reaction that reduces 3-hydroxy-3-methylglutaryl
Coenzyme A (HMG-CoA) to mevalonate. This step is the committed step
in the sterol biosynthesis pathway. Thus, HMGR is a major point of
regulation in organisms that naturally utilize the mevalonate
pathway to produce isoprenoids.
[0091] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of HMGR activity
is increased. The level of HMGR activity in the genetically
modified host cell can be increased in a number of ways, including,
but not limited to, 1) increasing the promoter strength of the
promoter to which the HMGR coding region is operably linked; 2)
increasing the copy number of the plasmid comprising a nucleotide
sequence encoding HMGR; 3) increasing the stability of an HMGR mRNA
(where an "HMGR mRNA" is an mRNA comprising a nucleotide sequence
encoding HMGR); 4) modifying the sequence of the ribosome binding
site of an HMGR mRNA such that the level of translation of the HMGR
mRNA is increased; 5) modifying the sequence between the ribosome
binding site of an HMGR mRNA and the start codon of the HMGR coding
sequence such that the level of translation of the HMGR mRNA is
increased; 6) modifying the entire intercistronic region 5' of the
start codon of the HMGR coding region such that translation of the
HMGR mRNA is increased; 7) modifying the codon usage of HMGR such
that the level of translation of the HMGR mRNA is increased, 8)
expressing rare codon tRNAs used in HMGR such that the level of
translation of the HMGR mRNA is increased; 9) increasing the enzyme
stability of HMGR; 10) increasing the specific activity (units
activity per unit protein) of HMGR; or 11) truncating the HMGR to
remove a negative regulatory element. The foregoing modifications
may be made singly or in combination; e.g., two or more of the
foregoing modifications may be made to provide for an increased
level of HMGR activity.
[0092] In many embodiments, the level of HMGR is increased by
genetically modifying a eukaryotic host cell such that it produces
a truncated form of HMGR (tHMGR), which truncated form has
increased enzymatic activity relative to wild-type HMGR. tHMGR
lacks a membrane-spanning domain and is therefore soluble and lacks
the feedback inhibition of HMGR. tHMGR retains its catalytic
C-terminus region, and thus retains the activity of HMGR. In some
embodiments, the truncated HMGR has the amino acid sequence
depicted in FIGS. 7A and 7B (SEQ ID NO:2). In some embodiments, the
truncated HMGR is encoded by a nucleic acid comprising the
nucleotide sequence depicted in FIG. 6 (SEQ ID NO: 1).
[0093] In some embodiments, the level of activity of one or more of
HMGS, MK, and PMK is increased. In S. cerevisiae, the genes
encoding HMGS (ERG13), MK (ERG12), and PMK (ERG8) comprise a sterol
regulatory element that binds the transcription factors Ecm22p and
Upc2p, where, upon binding of Ecm22p and Upc2p, transcription is
activated. In some embodiments, the level of activity of one or
more of HMGS, MK, and PMK is increased by increasing the activity
of Ecm22p and Upc2p. Vik et al. (2001) Mol. Cell. Biol.
19:6395-405.
[0094] Normally S. cerevisiae does not take up sterols from the
environment under aerobic conditions. Lewis et al. ((1988) Yeast
4:93-106) isolated a yeast mutant, upc2-1 (uptake control), which
resulted in aerobic sterol uptake. The upc2-1 allele comprises a
guanine to adenine transition in the open reading frame designated
YDR213W on chromosome IV. Crowley et al. (1998) J. Bacteriol. 16:
4177-4183. The nucleic acid sequence of wild-type Upc2 is known and
can be obtained through GenBank Accession No. Z68194. This
wild-type allele is noted as coordinates 889746-892487 on the S.
cerevisiae chromosome. As previously found by Lewis et al., under
native conditions the level of sterol uptake was 10- to 20-fold
greater than with the isogenic wild type. The mutant resulted in an
increased ergosterol production.
[0095] The single amino acid change near the C-termini of Upc2p and
Ecm22p transcription factors has been shown to increase their
activity. In many embodiments, a subject genetically modified host
cell is genetically modified such that Upc2p comprises a
glycine-to-aspartic acid substitution at amino acid 888; and Ecm22p
comprises a glycine-to-aspartic acid substitution at amino acid
790.
Increased Level of Prenyltransferase Activity
[0096] In some embodiments, a subject genetically modified
eukaryotic host cell is genetically modified such that the level of
geranyl diphosphate synthase (GPPS) and/or farnesyl diphosphate
synthase (FPPS) activity is increased.
[0097] The enzyme farnesyl diphosphate synthase (FPPS) catalyzes a
reaction that converts geranyl diphosphate (GPP) into farnesyl
diphosphate (FPP). This step has also been shown to be rate
limiting in the mevalonate pathway. Thus, FPPS is a point of
regulation in organisms that naturally utilize the mevalonate
pathway to produce isoprenoids. As such, and for ease of further
description, modulating levels of activity of a prenyl transferase
is discussed in terms of modulating the level of activity of a
FPPS.
[0098] In some embodiments, the level of FPPS activity is
increased. The level of FPPS activity in a genetically modified
host cell can be increased in a number of ways, including, but not
limited to, 1) increasing the promoter strength of the promoter to
which the FPPS coding region is operably linked; 2) increasing the
copy number of the plasmid comprising a nucleotide sequence
encoding FPPS; 3) increasing the stability of an FPPS mRNA (where
an "FPPS mRNA" is an mRNA comprising a nucleotide sequence encoding
FPPS); 4) modifying the sequence of the ribosome binding site of an
FPPS mRNA such that the level of translation of the FPPS mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of an FPPS mRNA and the start codon of the FPPS coding
sequence such that the level of translation of the FPPS mRNA is
increased; 6) modifying the entire intercistronic region 5' of the
start codon of the FPPS coding region such that translation of the
FPPS mRNA is increased; 7) modifying the codon usage of FPPS such
that the level of translation of the FPPS mRNA is increased, 8)
expressing rare codon tRNAs used in FPPS such that the level of
translation of the FPPS mRNA is increased; 9) increasing the enzyme
stability of FPPS; or 10) increasing the specific activity (units
activity per unit protein) of FPPS. The foregoing modifications may
be made singly or in combination; e.g., two or more of the
foregoing modifications may be made to provide for an increased
level of FPPS activity.
Decreased Level of Squalene Synthase Activity
[0099] The enzyme squalene synthase catalyzes a reaction that
converts farnesyl diphosphate into squalene. This step is the first
step in the pathway leading from farnesyl diphosphate to
ergosterol. Thus by limiting the action of this enzyme, FPP is
shunted towards terpenoid production pathways utilizing, e.g.,
terpene synthases or GGPP synthase and subsequent terpene
synthases.
[0100] In some embodiments, a subject genetically modified host
cell is genetically modified such that the level of squalene
synthase activity is decreased. The level of squalene synthase
activity in the genetically modified host cell can be decreased in
a number of ways, including, but not limited to, 1) decreasing the
promoter strength of the promoter to which the squalene synthase
coding region is operably linked; 2) decreasing the stability of an
squalene synthase mRNA (where a "squalene synthase mRNA" is an mRNA
comprising a nucleotide sequence encoding squalene synthase); 3)
modifying the sequence of the ribosome binding site of a squalene
synthase mRNA such that the level of translation of the squalene
synthase mRNA is decreased; 4) modifying the sequence between the
ribosome binding site of a squalene synthase mRNA and the start
codon of the squalene synthase coding sequence such that the level
of translation of the squalene synthase mRNA is decreased; 5)
modifying the entire intercistronic region 5' of the start codon of
the squalene synthase coding region such that translation of the
squalene synthase mRNA is decreased; 6) modifying the codon usage
of squalene synthase such that the level of translation of the
squalene synthase mRNA is decreased, 7) decreasing the enzyme
stability of squalene synthase; 8) decreasing the specific activity
(units activity per unit protein) of squalene synthase, or 9) using
a chemically-repressible-promoter and repressing the
chemically-repressible-promoter by adding a chemical to a growth
medium. The foregoing modifications may be made singly or in
combination; e.g., two or more of the foregoing modifications may
be made to provide for a decreased level of squalene synthase
activity.
[0101] In an exemplary embodiment, the activity of squalene
synthase in S. cerevisiae has been reduced or eliminated. Yeast
ERG9 mutants that are unable to convert mevalonate into squalene
have been produced. See, e.g., Karst et al. (1977) Molec. Gen.
Genet. 154:269-277; U.S. Pat. No. 5,589,372; and U.S. Patent
Publication No. 2004/0110257. Genetic modifications include
decreasing the activity of squalene synthase by blocking or
reducing the production of squalene synthase, reducing the activity
of squalene synthase, or by inhibiting the activity of squalene
synthase. Blocking or reducing the production of squalene synthase
can include placing the squalene synthase gene under the control of
a promoter that requires the presence of an inducing compound in
the growth medium. By establishing conditions such that the inducer
becomes depleted from the medium, the expression of squalene
synthase can be turned off. Some promoters are turned off by the
presence of a repressing compound. E.g., the promoters from the
yeast CTR3 or CTR1 genes can be repressed by addition of copper.
Blocking or reducing the activity of squalene synthase can include
excision technology similar to that described in U.S. Pat. No.
4,743,546, incorporated herein by reference. In this approach the
ERG9 gene is cloned between specific genetic sequences that allow
specific, controlled excision of the ERG9 gene from the genome.
Excision could be prompted by, e.g., a shift in the cultivation
temperature of the culture, as in U.S. Pat. No. 4,743,546, or by
some other physical or nutritional signal. Such a genetic
modification includes any type of modification and specifically
includes modifications made by recombinant technology and by
classical mutagenesis. Inhibitors of squalene synthase are known
(see U.S. Pat. No. 4,871,721 and the references cited in U.S. Pat.
No. 5,475,029) and can be added to cell cultures.
[0102] In some embodiments, the codon usage of a squalene synthase
coding sequence is modified such that the level of translation of
the ERG9 mRNA is decreased. Reducing the level of translation of
ERG9 mRNA by modifying codon usage is achieved by modifying the
sequence to include codons that are rare or not commonly used by
the host cell. Codon usage tables for many organisms are available
that summarize the percentage of time a specific organism uses a
specific codon to encode for an amino acid. Certain codons are used
more often than other, "rare" codons. The use of "rare" codons in a
sequence generally decreases its rate of translation. Thus, e.g.,
the coding sequence is modified by introducing one or more rare
codons, which affect the rate of translation, but not the amino
acid sequence of the enzyme translated. For example, there are 6
codons that encode for arginine: CGT, CGC, CGA, CGG, AGA, and AGG.
In E. coli the codons CGT and CGC are used far more often (encoding
approximately 40% of the arginines in E. coli each) than the codon
AGG (encoding approximately 2% of the arginines in E. coli).
Modifying a CGT codon within the sequence of a gene to an AGG codon
would not change the sequence of the enzyme, but would likely
decrease the gene's rate of translation.
Enhanced Plasmid Stability
[0103] In some embodiments, an expression construct (an "expression
vector") or other nucleic acid used to genetically modify a host
cell, to generate a subject genetically modified host cell,
exhibits increased stability in the host cell. Increased stability
enhances the level of an encoded gene product (e.g., a mevalonate
pathway enzyme). In some embodiments, an expression construct
comprises a defective LEU2 gene, wherein the defect in the LEU2
gene confers enhanced stability on the expression construct in the
host cell. In some embodiments, an expression construct comprises a
leu2-d allele, as described in Example 3. "Enhanced plasmid
stability" in the genetically modified host cell refers to an
increase in retention of the plasmid over time in culture, compared
to the same plasmid comprising a wild-type LEU2 gene. The LEU2
gene, and defects of the LEU2 gene that confer enhanced stability,
have been described in the literature. See, e.g., Erhart and C P
Hollenberg (1983) The presence of a defective LEU2 gene on 2 mu DNA
recombinant plasmids of Saccharomyces cerevisiae is responsible for
curing and high copy number. J. Bacteriol. 156(2): 625-635.
Generating a Genetically Modified Host Cell
[0104] A subject genetically modified host cell is generated using
standard methods well known to those skilled in the art. In some
embodiments, a heterologous nucleic acid comprising a nucleotide
sequence encoding a variant mevalonate pathway enzyme and/or a
heterologous nucleic acid comprising a nucleotide sequence encoding
a variant transcription factor that controls transcription of a
mevalonate pathway enzyme(s) is introduced into a host cell and
replaces all or a part of an endogenous gene, e.g., via homologous
recombination. In some embodiments, a heterologous nucleic acid is
introduced into a parent host cell, and the heterologous nucleic
acid recombines with an endogenous nucleic acid encoding a
mevalonate pathway enzyme, a prenyltransferase, a transcription
factor that controls transcription of one or more mevalonate
pathway enzymes, or a squalene synthase, thereby genetically
modifying the parent host cell. In some embodiments, the
heterologous nucleic acid comprises a promoter that has increased
promoter strength compared to the endogenous promoter that controls
transcription of the endogenous prenyltransferase, and the
recombination event results in substitution of the endogenous
promoter with the heterologous promoter. In other embodiments, the
heterologous nucleic acid comprises a nucleotide sequence encoding
a truncated HMGR that exhibits increased enzymatic activity
compared to the endogenous HMGR, and the recombination event
results in substitution of the endogenous HMGR coding sequence with
the heterologous HMGR coding sequence. In some embodiments, the
heterologous nucleic acid comprises a promoter that provides for
regulated transcription of an operably linked squalene synthase
coding sequence and the recombination event results in substitution
of the endogenous squalene synthase promoter with the heterologous
promoter.
Genetically Modified Host Cells that Produce Higher Levels of
Acetyl-CoA
[0105] The present invention provides genetically modified
eukaryotic host cells that produce higher levels of acetyl-CoA than
a control cell; such cells are useful for producing a variety of
products, including, but not limited to isoprenoid compounds,
polyketides, polyhydroxy alkanoates, alkaloids, statins (e.g.,
lovastatin), fatty acids, and acetate. In some embodiments, a
subject genetically modified host cell that produces an elevated
amount of acetyl-CoA produces an isoprenoid compound at a level
that is higher than a control host cell. In many embodiments, the
isoprenoid compound is one that is not normally produced by the
host cell.
[0106] In some embodiments, a subject genetically modified
eukaryotic host cell that produces a level of acetyl-CoA that is at
least about 10%, at least about 25%, at least about 50%, at least
about 2-fold, at least about 5-fold, at least about 10-fold, at
least about 20-fold, at least about 30-fold, at least about
40-fold, at least about 50-fold, at least about 100-fold, at least
about 200-fold, at least about 500-fold, at least about
10.sup.3-fold, or more, higher than the level of acetyl-CoA
produced by a control host cell.
[0107] In some embodiments, a subject genetically modified
eukaryotic host cell that produces a higher level of acetyl-CoA
than a control host cell is genetically modified such that it
exhibits a higher level of acetaldehyde dehydrogenase (ALD)
activity than a control host cell. For example, in some
embodiments, a subject genetically modified eukaryotic host cell
exhibits a level of ALD activity that is at least about 10%, at
least about 25%, at least about 50%, at least about 2-fold, at
least about 5-fold, at least about 10-fold, at least about 20-fold,
at least about 30-fold, at least about 40-fold, at least about
50-fold, at least about 100-fold, at least about 200-fold, at least
about 500-fold, at least about 10.sup.3-fold, or more, higher than
the level of ALD exhibited by a control host cell.
[0108] The level of ALD activity in a subject genetically modified
host cell can be increased in a number of ways, including, but not
limited to, 1) increasing the promoter strength of the promoter to
which the ALD coding region is operably linked; 2) increasing the
copy number of the plasmid comprising a nucleotide sequence
encoding ALD; 3) increasing the stability of an ALD mRNA (where an
"ALD mRNA" is an mRNA comprising a nucleotide sequence encoding
ALD); 4) modifying the sequence of the ribosome binding site of an
ALD mRNA such that the level of translation of the ALD mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of an ALD mRNA and the start codon of the ALD coding sequence
such that the level of translation of the ALD mRNA is increased; 6)
modifying the entire intercistronic region 5' of the start codon of
the ALD coding region such that translation of the ALD mRNA is
increased; 7) modifying the codon usage of ALD such that the level
of translation of the ALD mRNA is increased, 8) expressing rare
codon tRNAs used in ALD such that the level of translation of the
ALD mRNA is increased; 9) increasing the enzyme stability of ALD;
or 10) increasing the specific activity (units activity per unit
protein) of ALD. The foregoing modifications may be made singly or
in combination; e.g., two or more of the foregoing modifications
may be made to provide for an increased level of ALD activity.
[0109] In some embodiments, a eukaryotic host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding ALD, where the nucleic acid provides for an increased
level of ALD in the cell. Nucleotide sequences encoding ALD are
known in the art, and any known nucleotide sequence can be
used.
[0110] In some embodiments, a eukaryotic host cell is genetically
modified with a nucleic acid comprising a nucleotide sequence
encoding ACS, where the nucleic acid provides for an increased
level of ACS in the cell. Nucleotide sequences encoding ACS are
known in the art, and any known nucleotide sequence can be
used.
[0111] In some embodiments, a subject genetically modified
eukaryotic host cell that produces a higher level of acetyl-CoA
than a control host cell is genetically modified such that it
exhibits a higher level of acetyl-CoA synthetase (ACS) activity
than a control host cell. For example, in some embodiments, a
subject genetically modified eukaryotic host cell exhibits a level
of ACS activity that is at least about 10%, at least about 25%, at
least about 50%, at least about 2-fold, at least about 5-fold, at
least about 10-fold, at least about 20-fold, at least about
30-fold, at least about 40-fold, at least about 50-fold, at least
about 100-fold, at least about 200-fold, at least about 500-fold,
at least about 10.sup.3-fold, or more, higher than the level of ACS
exhibited by a control host cell. In one aspect, an increased level
of ACS activity or ALD activity is evidenced by an increased
production of isoprenoid compound by the genetically modified host
cell. Methods for assaying for isoprenoid production will depend on
the specific isoprenoid being tested. A variety of methods are
known in the art and are exemplified herein.
[0112] The level of ACS activity in a subject genetically modified
host cell can be increased in a number of ways, including, but not
limited to, 1) increasing the promoter strength of the promoter to
which the ACS coding region is operably linked; 2) increasing the
copy number of the plasmid comprising a nucleotide sequence
encoding ACS; 3) increasing the stability of an ACS mRNA (where an
"ACS mRNA" is an mRNA comprising a nucleotide sequence encoding
ACS); 4) modifying the sequence of the ribosome binding site of an
ACS mRNA such that the level of translation of the ACS mRNA is
increased; 5) modifying the sequence between the ribosome binding
site of an ACS mRNA and the start codon of the ACS coding sequence
such that the level of translation of the ACS mRNA is increased; 6)
modifying the entire intercistronic region 5' of the start codon of
the ACS coding region such that translation of the ACS mRNA is
increased; 7) modifying the codon usage of ACS such that the level
of translation of the FPPS mRNA is increased, 8) expressing rare
codon tRNAs used in ACS such that the level of translation of the
ACS mRNA is increased; 9) increasing the enzyme stability of ACS;
10) increasing the specific activity (units activity per unit
protein) of ACS; 11) reducing the activity or function of one or
more proteins in a post-translational modification system that
inhibits the activity of ACS; or 12) modifying the amino acid
sequence of ACS such that it is not modified by a
post-translational modification system that inhibits the activity
of ACS. The foregoing modifications may be made singly or in
combination; e.g., two or more of the foregoing modifications may
be made to provide for an increased level of ACS activity.
[0113] In some embodiments, a subject genetically modified host
cell is genetically modified such that it exhibits both a higher
level of ACS activity and a higher level of ALD activity than a
control host cell.
[0114] In some embodiments, a subject genetically modified host
cell is genetically modified with an expression vector that
comprises a nucleotide sequence encoding ACS and/or ALD under the
control of a strong promoter. In some of these embodiments, the
expression vector is a multicopy expression vector.
[0115] In the prokaryote Salmonella enterica, ACS is
posttranslationally regulated via acetylation/deacetylation of
residue Lys-609, as depicted schematically in FIG. 15. Protein
acetyl transferase (Pat) catalyzes the acetylation reaction;
acetylation of ACS renders the enzyme inactive. CobB, encoding
NAD.sup.+-dependent Sir2 protein deactylase catalyzes the
deacetylation of Lys-609 of ACS; removal of the inhibitory acetyl
group activates ACS. The Lue-641 of S. enterica ACS is critical for
the acetylation of residue Lys-609. Although the activity of
ACS.sup.L641P derived from S. enterica is about one third that of
the wild-type ACS, Pat does not acetylate ACS.sup.L641P and does
not inhibit its activity. The amino acid sequences surrounding the
acetylation site is conserved between S. enterica ACS and S.
cerevisiae ACS, as shown in FIG. 16.
[0116] In some embodiments, the nucleotide sequence encoding ACS is
modified such that the ACS is not acetylated by a
post-translational modification system in the host cell. In some
embodiments, the codon encoding amino acid 707 (Leu) is modified
such that it encodes an amino acid other than leucine; e.g., the
amino acid sequence IVRHLIDSVKL (SEQ ID NO:15) in ACS is modified
to IVRHSIDSVKL (SEQ ID NO:16) or IVRHPIDSVKL (SEQ ID NO:17). In
other embodiments, the codon encoding a lysine that is acetylated
by a post-translational modification system in the host (e.g.,
Lys-675) is modified such that it no longer encodes lysine, e.g.,
the amino acid sequence of the ACS is altered from
DLPKTRSGKIMRRILRK (SEQ ID NO:18) to DLPKTRSGSIMRRILRK (SEQ ID
NO:19). In some embodiments, a protein that contributes to the
post-translational acetylation of ACS is functionally disabled. For
example, in some embodiments, a protein corresponding to Pat (as
shown in FIG. 15) is functionally disabled, e.g., by knockout of
the gene encoding Pat. Whether ACS is acetylated is readily
determined using, e.g., GC-mass spectrometry.
[0117] The subject methods can be used in a variety of different
kinds of eukaryotic host cells. Host cells are, in many
embodiments, unicellular organisms, or are grown in culture as
single cells. Suitable eukaryotic host cells include, but are not
limited to, yeast cells, insect cells, plant cells, fungal cells,
and algal cells. Suitable eukaryotic host cells include, but are
not limited to, Pichia pastoris, Pichia finlandica, Pichia
trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia
opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia
guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica,
Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula
polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida
albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus
oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium
sp., Fusarium gramineum, Fusarium venenatum, Neurospora crassa,
Chlamydomonas reinhardtii, and the like. In some embodiments, the
host cell is a eukaryotic cell other than a plant cell. In some
embodiments, subject genetically modified host cell is a yeast
cell. In a particular embodiment, the yeast cell is Saccharomyces
cerevisiae.
[0118] Increased levels of acetyl-CoA in a cell favor production of
higher levels of a selected isoprenoid compound by the cell. Thus,
in some embodiments, a subject genetically modified host cell
exhibits increases in isoprenoid or isoprenoid precursor
production, where isoprenoid or isoprenoid precursor production is
increased by at least about 10%, at least about 15%, at least about
20%, at least about 25%, at least about 30%, at least about 35%, at
least about 40%, at least about 45%, at least about 50%, at least
about 60%, at least about 70%, at least about 80%, at least about
90%, at least about 2-fold, at least about 2.5-fold, at least about
5-fold, at least about 10-fold, at least about 20-fold, at least
about 30-fold, at least about 40-fold, at least about 50-fold, at
least about 75-fold, at least about 100-fold, at least about
200-fold, at least about 300-fold, at least about 400-fold, at
least about 500-fold, or at least about 10.sup.3-fold, or more, in
the genetically modified host cell, compared to the level of
isoprenoid precursor or isoprenoid compound produced in a control
host cell that is not genetically modified as described herein.
Isoprenoid or isoprenoid precursor production is readily determined
using well-known methods, e.g., gas chromatography-mass
spectrometry, liquid chromatography-mass spectrometry, ion
chromatography-mass spectrometry, pulsed amperometric detection,
uv-vis spectrometry, and the like.
[0119] In some embodiments, a subject genetically modified
eukaryotic host produces an isoprenoid or isoprenoid precursor
compound in an amount ranging from 1 .mu.g isoprenoid compound/ml
to 100,000 .mu.g isoprenoid compound/ml, e.g., from about 1
.mu.g/ml to about 10,000 .mu.g/ml of isoprenoid compound, 1
.mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
4500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 4000 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 3500 .mu.g/ml of isoprenoid
compound, 1 .mu.g/ml to 3000 .mu.g/ml of isoprenoid compound, 1
.mu.g/ml to 2500 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to
2000 .mu.g/ml of isoprenoid compound, 1 .mu.g/ml to 1500 .mu.g/ml
of isoprenoid compound, 1 .mu.g/ml to 1000 .mu.g/ml of isoprenoid
compound, 5 .mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 10
.mu.g/ml to 5000 .mu.g/ml of isoprenoid compound, 20 .mu.g/ml to
5000 .mu.g/ml of isoprenoid compound, 30 .mu.g/ml to 1000 .mu.g/ml
of isoprenoid compound, 40 .mu.g/ml to 500 .mu.g/ml of isoprenoid
compound, 50 .mu.g/ml to 300 .mu.g/ml of isoprenoid compound, 60
.mu.g/ml to 100 .mu.g/ml of isoprenoid compound, 70 .mu.g/ml to 80
.mu.g/ml of isoprenoid compound, from about 1 .mu.g/ml to about
1,000 .mu.g/ml, from about 1,000 .mu.g/ml to about 2,000 .mu.g/ml,
from about 2,000 .mu.g/ml to about 3,000 .mu.g/ml, from about 3,000
.mu.g/ml to about 4,000 .mu.g/ml, from about 4,000 .mu.g/ml to
about 5,000 .mu.g/ml, from about 5,000 .mu.g/ml to about 7,500
.mu.g/ml, or from about 7,500 .mu.g/ml to about 10,000 .mu.g/ml, or
greater than 10,000 .mu.g/ml isoprenoid compound, e.g., from about
10 mg isoprenoid compound/ml to about 20 mg isoprenoid compound/ml,
from about 20 mg isoprenoid compound/ml to about 50 mg isoprenoid
compound/ml, from about 50 mg isoprenoid compound/ml to about 100
mg isoprenoid compound/ml, or more.
Generating a Genetically Modified Host Cell
[0120] A subject genetically modified host cell is generated using
standard methods well known to those skilled in the art. For
example, in some embodiments, an expression vector comprising a
nucleotide sequence encoding ACS and/or ALD is introduced into a
host cell.
Further Genetic Modifications
[0121] In some embodiments, a subject genetically modified host
cell that exhibits enhanced production of acetyl-CoA, as described
above, is further genetically modified such that it exhibits one or
more of: 1) increased activity levels of one or more mevalonate
pathway enzymes; 2) increased levels of prenyl transferase
activity; and 3) decreased levels of squalene synthase activity.
Genetic modifications that lead to 1) increased activity levels of
one or more mevalonate pathway enzymes; 2) increased levels of
prenyl transferase activity; and 3) decreased levels of squalene
synthase activity are described above.
[0122] In some embodiments, a subject genetically modified host
cell that exhibits enhanced production of acetyl-CoA, as described
above, is further genetically modified to include one or more
nucleic acids encoding a polyprenyl transferase and/or a terpene
synthase, as described in more detail below.
Further Genetic Modifications
[0123] In some embodiments, a subject genetically modified host
cell comprises one or more genetic modifications in addition to
those discussed above. For example, in some embodiments, a subject
genetically modified host cell is further genetically modified with
one or more nucleic acids comprising nucleotide sequences encoding
one or more of a prenyltransferase (e.g., a prenyltransferase other
than FPP and GPP); a terpene synthase; and the like.
Codon Usage
[0124] In some embodiments, the nucleotide sequence encoding a gene
product (e.g., a prenyltransferase, a terpene synthase, etc.) is
modified such that the nucleotide sequence reflects the codon
preference for the particular host cell. For example, the
nucleotide sequence will in some embodiments be modified for yeast
codon preference. See, e.g., Bennetzen and Hall (1982) J. Biol.
Chem. 257(6): 3026-3031.
[0125] As noted above, in some embodiments, the codon usage of a
squalene synthase coding sequence is modified such that the level
of translation of the ERG9 mRNA is decreased. Reducing the level of
translation of ERG9 mRNA by modifying codon usage is achieved by
modifying the sequence to include codons that are rare or not
commonly used by the host cell. Codon usage tables for many
organisms are available that summarize the percentage of time a
specific organism uses a specific codon to encode for an amino
acid. Certain codons are used more often than other, "rare" codons.
The use of "rare" codons in a sequence generally decreases its rate
of translation. Thus, e.g., the coding sequence is modified by
introducing one or more rare codons, which affect the rate of
translation, but not the amino acid sequence of the enzyme
translated. For example, there are 6 codons that encode for
arginine: CGT, CGC, CGA, CGG, AGA, and AGG. In E. coli the codons
CGT and CGC are used far more often (encoding approximately 40% of
the arginines in E. coli each) than the codon AGG (encoding
approximately 2% of the arginines in E. coli). Modifying a CGT
codon within the sequence of a gene to an AGG codon would not
change the sequence of the enzyme, but would likely decrease the
gene's rate of translation.
Increased Acetyl-CoA Supply
[0126] Since acetyl-CoA is a reactant used by both acetoacetyl-CoA
thiolase and HMGS in the MEV pathway, in some host cells, increases
in the intracellular pool of acetyl-CoA could lead to increases in
isoprenoid and isoprenoid precursors. Modifications that would
increase the levels of intracellular acetyl-CoA include, but are
not limited to, modifications that would decrease the total
activity of lactate dehydrogenase within the cell, modifications
that would decrease the total activity of acetate kinase within the
cell, modifications that would decrease the total activity of
alcohol dehydrogenase within the cell, modifications that would
interrupt the tricarboxylic acid cycle, such as those that would
decrease the total activity of 2-ketoglutarate dehydrogenase, or
modifications that would interrupt oxidative phosphorylation, such
as those that would decrease the total activity of the (F1F0)H+-ATP
synthase, or combinations thereof.
Prenyltransferases
[0127] Prenyltransferases constitute a broad group of enzymes
catalyzing the consecutive condensation of IPP resulting in the
formation of prenyl diphosphates of various chain lengths. Suitable
prenyltransferases include enzymes that catalyze the condensation
of IPP with allylic primer substrates to form isoprenoid compounds
with from about 5 isoprene units to about 6000 isoprene units or
more, e.g., from about 5 isoprene units to about 10 isoprene units,
from about 10 isoprene units to about 15 isoprene units, from about
15 isoprene units to about 20 isoprene units, from about 20
isoprene units to about 25 isoprene units, from about 25 isoprene
units to about 30 isoprene units, from about 30 isoprene units to
about 40 isoprene units, from about 40 isoprene units to about 50
isoprene units, from about 50 isoprene units to about 100 isoprene
units, from about 100 isoprene units to about 250 isoprene units,
from about 250 isoprene units to about 500 isoprene units, from
about 500 isoprene units to about 1000 isoprene units, from about
1000 isoprene units to about 2000 isoprene units, from about 2000
isoprene units to about 3000 isoprene units, from about 3000
isoprene units to about 4000 isoprene units, from about 4000
isoprene units to about 5000 isoprene units, or from about 5000
isoprene units to about 6000 isoprene units or more.
[0128] Suitable prenyltransferases include, but are not limited to,
an E-isoprenyl diphosphate synthase, including, but not limited to,
geranyl diphosphate synthase, farnesyl diphosphate synthase,
geranylgeranyl diphosphate (GGPP) synthase, hexaprenyl diphosphate
(HexPP) synthase, heptaprenyl diphosphate (HepPP) synthase,
octaprenyl (OPP) diphosphate synthase, solanesyl diphosphate (SPP)
synthase, decaprenyl diphosphate (DPP) synthase, chicle synthase,
and gutta-percha synthase; and a Z-isoprenyl diphosphate synthase,
including, but not limited to, nonaprenyl diphosphate (NPP)
synthase, undecaprenyl diphosphate (UPP) synthase, dehydrodolichyl
diphosphate synthase, eicosaprenyl diphosphate synthase, natural
rubber synthase, and other Z-isoprenyl diphosphate synthases.
[0129] The nucleotide sequences of numerous prenyltransferases from
a variety of species are known, and can be used or modified for use
in generating a subject genetically modified eukaryotic host cell.
Nucleotide sequences encoding prenyltransferases are known in the
art. See, e.g., Human farnesyl pyrophosphate synthetase mRNA
(GenBank Accession No. J05262; Homo sapiens); farnesyl diphosphate
synthetase (FPP) gene (GenBank Accession No. J05091; Saccharomyces
cerevisiae); isopentenyl diphosphate:dimethylallyl diphosphate
isomerase gene (J05090; Saccharomyces cerevisiae); Wang and Ohnuma
(2000) Biochim. Biophys. Acta 1529:33-48; U.S. Pat. No. 6,645,747;
Arabidopsis thaliana farnesyl pyrophosphate synthetase 2 (FPS2)/FPP
synthetase 2/farnesyl diphosphate synthase 2 (At4g17190) mRNA
(GenBank Accession No. NM.sub.--202836); Ginkgo biloba
geranylgeranyl diphosphate synthase (ggpps) mRNA (GenBank Accession
No. AY371321); Arabidopsis thaliana geranylgeranyl pyrophosphate
synthase (GGPS1)/GGPP synthetase/farnesyltranstransferase
(At4g36810) mRNA (GenBank Accession No. NM.sub.--119845);
Synechococcus elongatus gene for farnesyl, geranylgeranyl,
geranylfarnesyl, hexaprenyl, heptaprenyl diphosphate synthase
(SelF-HepPS) (GenBank Accession No. AB016095); etc.
[0130] In many embodiments, a eukaryotic host cell is genetically
modified with a nucleic acid comprising a prenyltransferase. For
example, in many embodiments, a host cell is genetically modified
with a nucleic acid comprising nucleotide sequences encoding a
prenyltransferase selected from a GGPP synthase, a GFPP synthase, a
HexPP synthase, a HepPP synthase, an OPP synthase, an SPP synthase,
a DPP synthase, an NPP synthase, and a UPP synthase.
Terpene Synthases
[0131] Terpene synthases catalyze the production of isoprenoid
compounds via one of the most complex reactions known in chemistry
or biology. In general, terpene synthases are moderately sized
enzymes having molecular weights of about 40 to 100 kD. As an
enzyme, terpene synthases can be classified as having low to
moderate turnover rates coupled with exquisite reaction specificity
and preservation of chirality. Turnover comprises binding of
substrate to the enzyme, establishment of substrate conformation,
conversion of substrate to product and product release. Reactions
can be performed in vitro in aqueous solvents, typically require
magnesium ions as cofactors, and the resulting products, which are
often highly hydrophobic, can be recovered by partitioning into an
organic solvent. U.S. Pat. No. 6,890,752.
[0132] In some embodiments, a subject genetically modified host
cell is further genetically modified with a nucleic acid comprising
a nucleotide sequence encoding a terpene synthase. In some
embodiments, a nucleic acid with which a host cell is genetically
modified comprises a nucleotide sequence encoding a terpene
synthase that differs in amino acid sequence by one or more amino
acids from a naturally-occurring terpene synthase or other parent
terpene synthase, e.g., a variant terpene synthase. A "parent
terpene synthase" is a terpene synthase that serves as a reference
point for comparison. Variant terpene synthases include consensus
terpene synthases and hybrid terpene synthases. In some
embodiments, the synthetic nucleic acid comprises a nucleotide
sequence encoding a consensus terpene synthase. In other
embodiments, the synthetic nucleic acid comprises a nucleotide
sequence encoding a hybrid terpene synthase.
[0133] A nucleic acid comprising a nucleotide sequence encoding any
known terpene synthase can be used. Suitable terpene synthases
include, but are not limited to, amorpha-4,11-diene synthase (ADS),
beta-caryophyllene synthase, germacrene A synthase, 8-epicedrol
synthase, valencene synthase, (+)-delta-cadinene synthase,
germacrene C synthase, (E)-beta-farnesene synthase, Casbene
synthase, vetispiradiene synthase, 5-epi-aristolochene synthase,
Aristolchene synthase, beta-caryophyllene, alpha-humulene,
(E,E)-alpha-farnesene synthase, (-)-beta-pinene synthase,
Gamma-terpinene synthase, limonene cyclase, Linalool synthase,
1,8-cineole synthase, (+)-sabinene synthase, E-alpha-bisabolene
synthase, (+)-bornyl diphosphate synthase, levopimaradiene
synthase, Abietadiene synthase, isopimaradiene synthase,
(E)-gamma-bisabolene synthase, taxadiene synthase, copalyl
pyrophosphate synthase, kaurene synthase, longifolene synthase,
gamma-humulene synthase, Delta-selinene synthase, beta-phellandrene
synthase, limonene synthase, myrcene synthase, terpinolene
synthase, (-)-camphene synthase, (+)-3-carene synthase, syn-copalyl
diphosphate synthase, alpha-terpineol synthase,
syn-pimara-7,15-diene synthase, ent-sandaaracopimaradiene synthase,
stemer-13-ene synthase, E-beta-ocimene, S-linalool synthase,
geraniol synthase, gamma-terpinene synthase, linalool synthase,
E-beta-ocimene synthase, epi-cedrol synthase, alpha-zingiberene
synthase, guaiadiene synthase, cascarilladiene synthase,
cis-muuroladiene synthase, aphidicolan-16b-ol synthase,
elizabethatriene synthase, sandalol synthase, patchoulol synthase,
Zinzanol synthase, cedrol synthase, scareol synthase, copalol
synthase, manool synthase, and the like.
[0134] Nucleotide sequences encoding terpene synthases are known in
the art, and any known terpene synthase-encoding nucleotide
sequence can used to genetically modify a host cell. For example,
the following terpene synthase-encoding nucleotide sequences,
followed by their GenBank accession numbers and the organisms in
which they were identified, are known and can be used:
(-)-germacrene D synthase mRNA (AY438099; Populus balsamifera
subsp. trichocarpa.times.Populus deltoids); E,E-alpha-farnesene
synthase mRNA (AY640154; Cucumis sativus); 1,8-cineole synthase
mRNA (AY691947; Arabidopsis thaliana); terpene synthase 5 (TPS5)
mRNA (AY518314; Zea mays); terpene synthase 4 (TPS4) mRNA
(AY518312; Zea mays); myrcene/ocimene synthase (TPS10) (At2g24210)
mRNA (NM.sub.--127982; Arabidopsis thaliana); geraniol synthase
(GES) mRNA (AY362553; Ocimum basilicum); pinene synthase mRNA
(AY237645; Picea sitchensis); myrcene synthase 1e20 mRNA (AY195609;
Antirrhinum majus); (E)-.beta.-ocimene synthase (0e23) mRNA
(AY195607; Antirrhinum majus); E-.beta.-ocimene synthase mRNA
(AY151086; Antirrhinum majus); terpene synthase mRNA (AF497492;
Arabidopsis thaliana); (-)-camphene synthase (AG6.5) mRNA (U87910;
Abies grandis); (-)-4S-limonene synthase gene (e.g., genomic
sequence) (AF326518; Abies grandis); delta-selinene synthase gene
(AF326513; Abies grandis); amorpha-4,11-diene synthase mRNA
(AJ251751; Artemisia annua); E-.alpha.-bisabolene synthase mRNA
(AF006195; Abies grandis); gamma-humulene synthase mRNA (U92267;
Abies grandis); .delta.-selinene synthase mRNA (U92266; Abies
grandis); pinene synthase (AG3.18) mRNA (U87909; Abies grandis);
myrcene synthase (AG2.2) mRNA (U87908; Abies grandis); etc.
[0135] Amino acid sequences of the following terpene synthases are
found under the GenBank Accession numbers shown in parentheses,
along with the organism in which each was identified, following
each terpene synthase: (-)-germacrene D synthase (AAR99061; Populus
balsamifera subsp. trichocarpa.times.Populus deltoids); D-cadinene
synthase (P93665; Gossypium hirsutum); 5-epi-aristolochene synthase
(Q40577; Nicotiana tabacum); E,E-alpha-farnesene synthase
(AAU05951; Cucumis sativus); 1,8-cineole synthase (AAU01970;
Arabidopsis thaliana); (R)-limonene synthase 1 (Q8L5K3; Citrus
limon); syn-copalyl diphosphate synthase (AAS98158; Oryza sativa);
a taxadiene synthase (Q9FT37; Taxus chinensis; Q93YA3; Taxus bacca;
Q41594; Taxus brevifolia); a D-cadinene synthase (Q43714; Gossypium
arboretum); terpene synthase 5 (AAS88575; Zea mays); terpene
synthase 4 (AAS88573; Zea mays); terpenoid synthase (AAS79352;
Vitis vinzifera); geraniol synthase (AAR11765; Ocimum basilicum);
myrcene synthase 1e20 (AA041727; Antirrhinum majus);
5-epi-aristolochene synthase 37 (AAP05762; Nicotiana attenuata);
(+)-3-carene synthase (AAO73863; Picea abies); (-)-camphene
synthase (AAB70707; Abies grandis); abietadiene synthase (AAK83563;
Abies grandis); amorpha-4,11-diene synthase (CAB94691; Artemisia
annua); trichodiene synthase (AAC49957; Myrothiecium roridum);
gamma-humulene synthase (AAC05728; Abies grandis); .delta.-selinene
synthase (AAC05727; Abies grandis); etc.
Nucleic Acids, Vectors, Promoters
[0136] To generate a genetically modified host cell, one or more
nucleic acids comprising nucleotide sequences encoding one or more
gene products is introduced stably or transiently into a host cell,
using established techniques, including, but not limited to,
electroporation, calcium phosphate precipitation, DEAE-dextran
mediated transfection, liposome-mediated transfection, heat shock
in the presence of lithium acetate, and the like. For stable
transformation, a nucleic acid will generally further include a
selectable marker, e.g., any of several well-known selectable
markers such as neomycin resistance, ampicillin resistance,
tetracycline resistance, chloramphenicol resistance, kanamycin
resistance, and the like.
[0137] In many embodiments, the nucleic acid with which the host
cell is genetically modified is an expression vector that includes
a nucleic acid comprising a nucleotide sequence that encodes a gene
product, e.g., a mevalonate pathway enzyme, a transcription factor,
a prenyltransferase, a terpene synthase, etc. Suitable expression
vectors include, but are not limited to, baculovirus vectors,
bacteriophage vectors, plasmids, phagemids, cosmids, fosmids,
bacterial artificial chromosomes, viral vectors (e.g. viral vectors
based on vaccinia virus, poliovirus, adenovirus, adeno-associated
virus, SV40, herpes simplex virus, and the like), P1-based
artificial chromosomes, yeast plasmids, yeast artificial
chromosomes, and any other vectors specific for specific hosts of
interest (such as yeast). Thus, for example, a nucleic acid
encoding a gene product(s) is included in any one of a variety of
expression vectors for expressing the gene product(s). Such vectors
include chromosomal, nonchromosomal and synthetic DNA
sequences.
[0138] Numerous suitable expression vectors are known to those of
skill in the art, and many are commercially available. The
following vectors are provided by way of example; for eukaryotic
host cells: pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG, and
pSVLSV40 (Pharmacia). However, any other plasmid or other vector
may be used so long as it is compatible with the host cell.
[0139] The nucleotide sequence in the expression vector is operably
linked to an appropriate expression control sequence(s) (promoter)
to direct synthesis of the encoded gene product. Depending on the
host/vector system utilized, any of a number of suitable
transcription and translation control elements, including
constitutive and inducible promoters, transcription enhancer
elements, transcription terminators, etc. may be used in the
expression vector (see, e.g., Bitter et al. (1987) Methods in
Enzymology, 153:516-544).
[0140] Non-limiting examples of suitable eukaryotic promoters
(promoters that are functional in eukaryotic cells) include CMV
immediate early, HSV thymidine kinase, early and late SV40, LTRs
from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art. The expression vector may also contain a
ribosome binding site for translation initiation and a
transcription terminator. The expression vector may also include
appropriate sequences for amplifying expression.
[0141] In addition, the expression vectors will in many embodiments
contain one or more selectable marker genes to provide a phenotypic
trait for selection of transformed host cells such as dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture.
[0142] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the S. cerevisiae TRP1 gene,
etc.; and a promoter derived from a highly-expressed gene to direct
transcription of the gene product-encoding sequence. Such promoters
can be derived from operons encoding glycolytic enzymes such as
3-phosphoglycerate kinase (PGK), .alpha.-factor, acid phosphatase,
or heat shock proteins, among others.
[0143] In many embodiments, a genetically modified host cell is
genetically modified with a nucleic acid that includes a nucleotide
sequence encoding a gene product, where the nucleotide sequence
encoding the gene product is operably linked to an inducible
promoter. Inducible promoters are well known in the art. Suitable
inducible promoters include, but are not limited to, the pL of
bacteriophage .lamda.; Plac; Ptrp; Ptac (Ptrp-lac hybrid promoter);
an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible
promoter, e.g., a lacZ promoter; a tetracycline-inducible promoter;
an arabinose inducible promoter, e.g., PBAD (see, e.g., Guzman et
al. (1995) J. Bacteriol. 177:4121-4130); a xylose-inducible
promoter, e.g., Pxy1 (see, e.g., Kim et al. (1996) Gene 181:71-76);
a GAL1 promoter; a tryptophan promoter; a lac promoter; an
alcohol-inducible promoter, e.g., a methanol-inducible promoter, an
ethanol-inducible promoter; a raffinose-inducible promoter; a
heat-inducible promoter, e.g., heat inducible lambda PL promoter, a
promoter controlled by a heat-sensitive repressor (e.g.,
CI857-repressed lambda-based expression vectors; see, e.g.,
Hoffmann et al. (1999) FEMS Microbiol Lett. 177(2):327-34); and the
like.
[0144] In many embodiments, a genetically modified host cell is
genetically modified with a nucleic acid that includes a nucleotide
sequence encoding a gene product, where the nucleotide sequence
encoding the gene product is operably linked to a constitutive
promoter. In yeast, a number of vectors containing constitutive or
inducible promoters may be used. For a review see, Current
Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel, et al.,
Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant, et
al., 1987, Expression and Secretion Vectors for Yeast, in Methods
in Enzymology, Eds. Wu & Grossman, 31987, Acad. Press, N.Y.,
Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL
Press, Wash., D.C., Ch. 3; Bitter, 1987, Heterologous Gene
Expression in Yeast, Methods in Enzymology, Eds. Berger &
Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular
Biology of the Yeast Saccharomyces, 1982, Eds. Strathem et al.,
Cold Spring Harbor Press, Vols. I and II. A constitutive yeast
promoter such as ADH or LEU2 or an inducible promoter such as GAL
may be used (Cloning in Yeast, Ch. 3, R. Rothstein in: DNA Cloning
Vol. 11, A Practical Approach, Ed. D M Glover, 1986, IRL Press,
Wash., D.C.). Alternatively, vectors may be used which promote
integration of foreign DNA sequences into the yeast chromosome.
Compositions Comprising a Subject Genetically Modified Eukaryotic
Host Cell
[0145] The present invention further provides compositions
comprising a subject genetically modified eukaryotic host cell. A
subject composition comprises a subject genetically modified
eukaryotic host cell, and will in some embodiments comprise one or
more further components, which components are selected based in
part on the intended use of the genetically modified eukaryotic
host cell. Suitable components include, but are not limited to,
salts; buffers; stabilizers; protease-inhibiting agents; cell
membrane- and/or cell wall-preserving compounds, e.g., glycerol,
dimethylsulfoxide, etc.; nutritional media appropriate to the cell;
and the like.
Methods for Producing Isoprenoid Compounds
[0146] The present invention provides methods of producing an
isoprenoid or an isoprenoid precursor compound. The methods
generally involve culturing a subject genetically modified host
cell in a suitable medium.
[0147] Isoprenoid precursor compounds that can be produced using a
subject method include any isoprenyl diphosphate compound.
Isoprenoid compounds that can be produced using the method of the
invention include, but are not limited to, monoterpenes, including
but not limited to, limonene, citranellol, geraniol, menthol,
perillyl alcohol, linalool, thujone; sesquiterpenes, including but
not limited to, periplanone B, gingkolide B, amorphadiene,
artemisinin, artemisinic acid, valencene, nootkatone, epi-cedrol,
epi-aristolochene, farnesol, gossypol, sanonin, periplanone, and
forskolin; diterpenes, including but not limited to, casbene,
eleutherobin, paclitaxel, prostratin, and pseudopterosin; and
triterpenes, including but not limited to, arbrusideE, bruceantin,
testosterone, progesterone, cortisone, digitoxin. Isoprenoids also
include, but are not limited to, carotenoids such as lycopene,
.alpha.- and .beta.-carotene, .alpha.- and .beta.-cryptoxanthin,
bixin, zeaxanthin, astaxanthin, and lutein. Isoprenoids also
include, but are not limited to, triterpenes, steroid compounds,
and compounds that are composed of isoprenoids modified by other
chemical groups, such as mixed terpene-alkaloids, and coenzyme
Q-10.
[0148] In some embodiments, a subject method further comprises
isolating the isoprenoid compound from the cell and/or from the
culture medium.
[0149] In general, a subject genetically modified host cell is
cultured in a suitable medium (e.g., Luria-Bertoni broth,
optionally supplemented with one or more additional agents, such as
an inducer (e.g., where one or more nucleotide sequences encoding a
gene product is under the control of an inducible promoter), etc.).
In some embodiments, a subject genetically modified host cell is
cultured in a suitable medium; and the culture medium is overlaid
with an organic solvent, e.g., dodecane, forming an organic layer.
The isoprenoid compound produced by the genetically modified host
cell partitions into the organic layer, from which it can be
purified. In some embodiments, where one or more gene
product-encoding nucleotide sequence is operably linked to an
inducible promoter, an inducer is added to the culture medium; and,
after a suitable time, the isoprenoid compound is isolated from the
organic layer overlaid on the culture medium.
[0150] In some embodiments, the isoprenoid compound will be
separated from other products which may be present in the organic
layer. Separation of the isoprenoid compound from other products
that may be present in the organic layer is readily achieved using,
e.g., standard chromatographic techniques.
[0151] In some embodiments, the isoprenoid compound is pure, e.g.,
at least about 40% pure, at least about 50% pure, at least about
60% pure, at least about 70% pure, at least about 80% pure, at
least about 90% pure, at least about 95% pure, at least about 98%
pure, or more than 98% pure, where "pure" in the context of an
isoprenoid compound refers to an isoprenoid compound that is free
from other isoprenoid compounds, contaminants, non-isoprenoid
macromolecules, etc.
EXAMPLES
[0152] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention, nor are they intended to represent that the
experiments below are all or the only experiments performed.
Efforts have been made to ensure accuracy with respect to numbers
used (e.g., amounts, temperature, etc.) but some experimental
errors and deviations should be accounted for. Unless indicated
otherwise, parts are parts by weight, molecular weight is weight
average molecular weight, temperature is in degrees Celsius, and
pressure is at or near atmospheric. Standard abbreviations may be
used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s
or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino
acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s);
i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c.,
subcutaneous(ly); and the like.
Example 1
Producing High Levels of an Isoprenoid Compound in a Genetically
Modified Yeast Cell
Materials and Methods
[0153] Chemicals. Dodecane and caryophyllene were purchased from
Sigma-Aldrich (St. Louis, Mo.). 5-fluoortic acid (5-FOA) was
purchased from Zymo Research (Orange, Calif.). Complete Supplement
Mixtures for formulation of Synthetic Defined media were purchased
from Qbiogene (Irvine, Calif.). All other media components were
purchased from either Sigma-Aldrich or Becton, Dickinson (Franklin
Lakes, N.J.).
[0154] Strains and media. Escherichia coli strains DH10B and
DH5.alpha. were used for bacterial transformation and plasmid
amplification in the construction of the expression plasmids used
in this study. The strains were cultivated at 37.degree. C. in
Luria-Bertani medium with 100 mg liter.sup.-1 ampicillin with the
exception of p.delta.-UB based plasmids which were cultivated with
50 mg liter.sup.-1 ampicillin.
[0155] Saccharomyces cerevisiae strain BY4742 (Baker Brachmann et
al. (1998) Yeast 14(2):115-132), a derivative of S288C, was used as
the parent strain for all yeast strains. This strain was grown in
rich YPD medium. Burke et al. Methods in yeast genetics: a Cold
Spring Harbor laboratory course manual. 2000, Plainview, N.Y.: Cold
Spring Harbor Laboratory Press. Engineered yeast strains were grown
in Synthetic Defined medium (SD) (Burke et al. (2000) supra) with
leucine, uracil, histidine, and/or methionine dropped out where
appropriate. For induction of genes expressed from the GAL1
promoter, S. cerevisiae strains were grown in 2% galactose as the
sole carbon source.
[0156] Plasmid construction. To create plasmid pRS425ADS for
expression of ADS with the GAL1 promoter, ADS was amplified by
polymerase chain reaction (PCR) from pADS (Martin et al. (2003)
Nat. Biotechnol. 21(7): p. 796-802) using primer pair
ADS-SpeI-F/ADS-HindIII-R (Table 1). Using these primers, the
nucleotide sequence 5'-AAAACA-3' was cloned immediately upstream of
the start codon of ADS. This consensus sequence was used for
efficient translation (Looman et al. (1993) Nucleic Acids Research.
21(18):4268-71; Yun et al. (1996) Molecular Microbiol.
19(6):1225-39.) of ADS and the other galactose-inducible genes used
in this study. The amplified product was cleaved with SpeI and
HindIII and cloned into SpeI and HindIII digested pRS425GAL1
(Mumberg et al. (1995) Gene 156(1):119-122).
TABLE-US-00001 TABLE 1 Primer Sequence (5' to 3') ADS-SpeI-F
GGACTAGTAAAACAATGGCCCTGACCGAAGAG (SEQ ID NO:3) ADS-HindIII-R
CCAAGCTTTCAGATGGACATCGGGTAAAC (SEQ ID NO:4) HMGR-BamHI-F
CGGGATCCAAAACAATGGCTGCAGACCAATTGGTG (SEQ ID NO:5) HMGR-SalI-R
GCGTCGACTTAGGATTTAATGCAGGTGACG (SEQ ID NO:6) pRS42X-
CTGCCGCGGGGCCGCAAATTAAAGCCTTC PvuIISacII-F (SEQ ID NO:7) pRS42X-
CTGCCGCGGTAGTACGGATTAGAAGCCGC PvuIISacII-R (SEQ ID NO:8)
UPC2-BamHI-F CGGGATCCAAAACAATGAGCGAAGTCGGTATACAG (SEQ ID NO:9)
UPC2-SalI-R GCGTCGACTCATAACGAAAAATCAGAGAAATTTG (SEQ ID NO:10)
ECM22-BamHI-R CGGGATCCAAAACAATGACATCGGATGATGGGAATG (SEQ ID NO:11)
ECM22-SalI-R GCGTCGACTTACATAAAAGCTGAAAAGTTTGTAG (SEQ ID NO:12)
ERG20-SpeI-R GGACTAGTAAAACAATGGCTTCAGAAAAAGAAATTAG (SEQ ID NO:13)
ERG20-SmaI-R TCCCCCGGGCTATTTGCTTCTCTTGTAAAC (SEQ ID NO:14)
Restriction sites are underlined and bold indicates a start or stop
codon.
[0157] For expression of tHMGR, plasmid pRS-HMGR was constructed.
First SacII restriction sites were introduced into pRS426GAL1
(Mumberg et al. (1995) Gene 156(1):119-122) at the 5' end of the
GAL1 promoter and 3' end of the CYC1 terminator. The
promoter-multiple cloning site-terminator cassette of pRS426GAL1
was PCR amplified using primer pair
pRS42X-PvuIISacII-F/pRS42X-PvuIISacII-R (Table 1). The amplified
product was cloned directly into PvuII digested pRS426GAL1 to
construct vector pRS426-SacII. The catalytic domain of HMG1 was PCR
amplified from plasmid pRH127-3 (Donald et al. (1997) Appl.
Environ. Microbiol. 63(9):3341-44) with primer pair
HMGR-BamHI-F/HMGR-SalI-R. The amplified product was cleaved with
BamHI and SalI and cloned into BamHI and XhoI digested
pRS426-SacII.
[0158] The upc2-1 allele of UPC2 was PCR amplified from plasmid
pBD33 using primer pair UPC2-BamHI-F/UPC2-SalI-R. The amplified
product was cleaved with BamHI and SalI and cloned into BamHI and
XhoI digested pRS426-SacII to create plasmid pRS-UPC2. Likewise the
ECM22 gene containing the upc2-1 like mutation (glycine to
aspartate at residue 790) was PCR amplified from plasmid pBD36
using primer pair ECM22-BamHI-F/UPC2-SalI-R. The amplified product
was cleaved with BamHI and SalI and cloned into BamHI and XhoI
digested pRS426-SacII to create plasmid pRS-ECM22.
[0159] A plasmid was constructed for the integration of the tHMGR
expression cassette of pRS-HMGR into the yeast genome utilizing
plasmid p.delta.-UB (Lee et al. (1997) Biotechnol Prog.
13(4):368-373). pRS-HMGR was cleaved with SacII and the expression
cassette fragment was gel extracted and cloned into SacII digested
p.delta.-UB. For the integration of upc2-1, p.delta.-UPC2 was
created in an identical manner by digesting pRS-UPC2 with SacII and
moving the appropriate fragment to p.delta.-UB.
[0160] To replace the ERG9 promoter with the MET3 promoter, plasmid
pRS-ERG9 was constructed. Plasmid pRH973 (Gardner et al. (1999) J.
Biol. Chem. 274(44):31671-31678) contained a truncated 5' segment
of ERG9 placed behind the MET3 promoter. pRH973 was cleaved with
ApaI and ClaI and cloned into ApaI and ClaI digested pRS403
(Sikorski et al. (1989) Genetics, 122(1):19-27).
[0161] For expression of ERG20, plasmid pRS-ERG20 was constructed.
Plasmid pRS-SacII was first digested with SalI and XhoI which
created compatible cohesive ends. The plasmid was then
self-ligated, eliminating SalI and XhoI sites to create plasmid
pRS-SacII-DX. ERG20 was PCR amplified from the genomic DNA of
BY4742 using primer pair ERG20-SpeI-F/ERG20-SmaI-R. The amplified
product was cleaved with SpeI and SmaI and cloned into SpeI and
SmaI digested pRS-SacII-DX. For the integration of the ERG20
expression cassette, pRS-ERG20 was cleaved with SacII and the
expression cassette fragment was gel extracted and cloned into
SacII digested p.delta.-UB.
[0162] A description of plasmids used in this study is provided in
Table 2.
TABLE-US-00002 TABLE 2 Name Gene expressed Plasmid status Marker
pRS425ADS ADS 2-micron replicon LEU2 pRS-HMGR tHMGR 2-micron
replicon URA3 pRS-UPC2 upc2-1 2-micron replicon URA3 pRS-ECM22
ECM22 (upc2-1 mutant) 2-micron replicon URA3 p.delta.-HMGR tHMGR
Integration URA3 p.delta.-UPC2 upc2-1 Integration URA3 pRS-ERG9
P.sub.MET3-ERG9 Integration HIS3 p.delta.-ERG20 ERG20 Integration
URA3
[0163] A list of yeast strains used in this study, and the relevant
genotypes of the strains, is provided in Table 3.
TABLE-US-00003 TABLE 3 BY4742 MAT.alpha. his3.DELTA.1 leu2.DELTA.0
lys2.DELTA.0 ura3.DELTA.0 EPY201 BY4742 pRS425ADS EPY203 BY4742
pRS425ADS pRS-HMGR EPY204 BY4742 pRS425ADS pRS-UPC2 EPY205 BY4742
pRS425ADS pRS-ECM22 EPY206 BY4742 pRS425ADS pRS-ERG20 EPY207 BY4742
pRS425ADS tHMGR (ura+) EPY209 BY4742 pRS425ADS tHMGR upc2-1 (ura+)
EPY212 BY4742 pRS425ADS tHMGR upc2-1 erg9::PMET3-ERG9 (ura+) EPY214
BY4742 pRS425ADS tHMGR upc2-1 erg9::PMET3-ERG9 ERG20 (ura+)
[0164] Yeast transformation and strain construction. S. cerevisiae
strain BY4742 (Carrie Baker Brachmann et al. (1998) "Yeast"
14(2):115-132), a derivative of S288C was used as the parent strain
for all S. cerevisiae strains. Transformation of all strains of S.
cerevisiae was performed by the standard lithium acetate method
(Gietz et al. (2002) Guide to Yeast Genetics and Molecular and Cell
Biology, Pt B., Academic Press Inc: San Diego. 87-96). Three to ten
colonies from each transformation were screened for the selection
of the highest amorphadiene producing transformant. Strain EPY201
was constructed by the transformation of strain BY4742 with plasmid
pRS425ADS and selection on SD-LEU plates. Strains EPY203, EPY204,
EPY205, and EPY206 were constructed by the transformation of strain
EPY201 with plasmid pRS-HMGR, pRS-UPC2, pRS-ECM22, and pRS-ERG20,
respectively. Transformants were selected on SD-LEU-URA plates.
Plasmid p.delta.-HMGR was digested with XhoI before transformation
of the DNA into strain EPY201 for the construction of EPY207.
Strain EPY207 was cultured and plated on SD-LEU plates including 1
g/L 5-FOA selection of the loss of the URA3 marker. The resulting
uracil auxotroph was then transformed with XhoI digested
p.delta.-UPC2 plasmid DNA for the construction of EPY209, which was
selected on SD-LEU-URA plates. Plasmid pRS-ERG9 was cleaved with
HindIII for the integration of the P.sub.MET3-ERG9 fusion at the
ERG9 loci of EPY209 for the construction of EPY212. This strain was
selected for on SD-LEU-URA-HIS-MET plates. EPY212 was cultured and
plated on SD-LEU-HIS-MET plates containing 5-FOA for selection of
the loss of the URA3 marker. The resulting uracil auxotroph was
then transformed with XhoI digested p.delta.-ERG20 plasmid DNA for
the construction of EPY214, which was selected on
SD-LEU-URA-HIS-MET plates.
[0165] Yeast cultivation. For time course experiments for the
measurement of amorphadiene production, culture tubes containing 5
mL of SD (2% galactose) media (with appropriate amino acid
omissions as described above) were inoculated with the strains of
interest. These innocula were grown at 30.degree. C. to an optical
density at 600 nm (OD.sub.600) of approximately 1.250 mL battled
tasks containing 50 mL SD media were inoculated to an OD.sub.600
0.05 with these seed cultures. FIG. 4. represents strains grown in
SD-URA-LEU-HIS with methionine at the level indicated. Media for
strains shown in FIG. 5 contained SD-URA supplemented with
methionine to a final concentration of 1 mM. All other production
experiments used SD-URA or SD-URA-LEU where appropriate.
[0166] All flasks also contained 5 mL dodecane. This dodecane layer
was sampled and diluted in ethyl acetate for determination of
amorphadiene production by GC-MS.
[0167] GC-MS analysis of amorphadiene. Amorphadiene production by
the various strains was measured by GC-MS as previously described
(Martin et al. (2001) Biotechnology and Bioengineering,
75(5):497-503) by scanning only for two ions, the molecular ion
(204m/z) and the 189m/z ion. Amorphadiene concentrations were
converted to caryophyllene equivalents using a caryophyllene
standard curve and the relative abundance of ions 189 and 204 m/z
to their total ions.
Results
[0168] To maximize production of amorphadiene, a step-wise approach
was taken with the successive integration of constructs into the S.
cerevisiae genome.
[0169] Production of amorphadiene. A platform host cell, S.
cerevisiae, was engineered for high-level production of
isoprenoids. S. cerevisiae directs all of its isoprenoid production
through isopentenyl diphosphate (IPP), and most of this then
through farnesyl diphosphate (FPP). The levels of IPP and FPP were
increased in the host strain. IPP and FPP are metabolized to a
variety of native products. Instead of measuring FPP levels, the
level of amorphadiene, a direct product of FPP that will not be
metabolized or degraded during the time course of growth, was
measured. Amorphadiene synthase (ADS) was expressed in S.
cerevisiae for the enzymatic cyclization of FPP to the
sesquiterpene amorphadiene. Amorphadiene is also readily quantified
by GCMS.
[0170] ADS was expressed on the 2-micron plasmid pRS425ADS under
the inducible control of the GAL1 promoter. Cultures of S.
cerevisiae were grown for six days on galactose for expression of
ADS, and amorphadiene levels were measured every 24 hours. S.
cerevisiae modified solely by the introduction of pRS425ADS reached
a maximum amorphadiene production of 4.6 .mu.g amorphadiene
mL.sup.-1 after four days (FIG. 3A).
[0171] Previous control experiments consisting of media spiked with
pure amorphadiene showed the rapid loss of the sesquiterpene from
the liquid phase. A layer of dodecane equivalent to 10% of the
medium volume was added to each shaker flask to sequester the
amorphadiene from the culture. The addition of this organic layer
ensures accurate measurement of the total amount of amorphadiene
produced by preventing loss to the air. The volatilization of
amorphadiene is a particular problem during extended time courses
of several days like those used in this study.
[0172] Overexpression of HMG-CoA reductase. The medical importance
of the biosynthesis of cholesterol and the experimental ease of
analysis in S. cerevisiae has made it an ideal organism for study
of the regulation of the mevalonate pathway over the past decades
(Szkopinska et al. (2000) Biochemical and Biophysical Research
Communications, 267(1):473-477; Dimster-Denk et al. (1999) J. Lipid
Res., 40(5):850-860).
[0173] These studies have elucidated a complex system of
regulation, with 3-hydroxy-3-methylglutaryl-coenzyme A reductase
(HMGR) as the major regulatory control point of the pathway. Two
isozymes of HMGR, Hmg1p and Hmg2p, are present in yeast, with Hmg1p
being the more stable of the two (Hampton et al. (1996) Trends in
Biochemical Sciences, 21(4):140-145). Hmg1p is an integral membrane
bound protein containing an N-terminal region responsible for
anchoring the protein to the ER membrane (Liscum et al. (1985) J.
Biol. Chem., 260(1):522-530). For expression of a soluble form of
the enzyme (Donald et al. (1997) Appl. Environ. Microbiol.
63(9):3341-44) removed the membrane-bound N-terminus of Hmg1p and
expressed only the catalytic domain. In our study, this truncated
form of HMGR (tHMGR) on a 2-micron plasmid was expressed under the
control of the GAL1 promoter. When expressed in conjunction with
ADS, S. cerevisiae reached a maximal production of 11.2 .mu.g
amorphadiene mL.sup.-1 after four days (FIG. 3A.).
[0174] Overexpression of sterol-involved transcription factors. In
another approach to increase amorphadiene, two S. cerevisiae
transcription factors previously identified for their importance in
regulation of sterol biosynthesis were used. upc2-1 S. cerevisiae
mutants were originally identified by their unique ability to
uptake sterols under aerobic conditions (Lewis et al. (1988) Yeast,
4(2):93-106). Further characterization showed that these mutants
had increased sterol synthesis capabilities (Lewis et al. (1988)
Yeast, 4(2):93-106). The mutation responsible for these
characteristics is a single guanine to adenine transition in the
UPC2 gene; this point mutation results in a residue change from
glycine to aspartate at amino acid 888 near the carboxy terminus
(Crowley et al. (1998) J. Bacteriol., 180(16):4177-83). A homolog
to this gene, ECM22, was later identified with 45% amino acid
sequence identity (Shianna et al. (2001) J. Bacteriol.,
183(3):830-834). 36 amino acids are completely conserved between
UPC2 and ECM22 at the locus of the upc2-1 point mutation (Shianna
et al. (2001) J. Bacteriol., 183(3):830-834). The upc2-1 point
mutation was introduced into the wild type ECM22 allele resulting
in a strain with a similar phenotype to that of the upc2-1 mutant
(Shianna et al. (2001) J. Bacteriol., 183(3):830-834).
[0175] Vik and Rine identified ERG2 and ERG3 as targets for gene
regulation by Ecm22p and Upc2p. A 7 base pair sterol regulatory
element was identified as the necessary binding location for these
transcription factors. This 7 base pair sequence element is found
in the promoters of many other sterol pathway genes including ERG8,
ERG12, and ERG13 (Vik et al. (2001) Mol. Cell. Biol.,
21(19):6395-6405.). The enzyme products for each of these three
genes are involved in isoprenoid synthesis upstream of FPP (see
FIG. 1).
[0176] It was hypothesized that coexpression of the mutant alleles
for UPC2 and ECM22 with ADS would increase amorphadiene production
by increasing metabolic flux through the mevalonate pathway. The
upc2-1 mutant alleles of UPC2 and ECM22 were each expressed under
the control of the GAL1 promoter on a 2-micron plasmid in a strain
already harboring pRS425ADS. Absolute amorphadiene production in
the cultures increased only minimally for UPC2 and ECM22
expression, in part due to decreased cell densities. However
production normalized for cell density rose 76% and 53% for the
expression of UPC2 and ECM22, respectively (FIG. 3B).
[0177] This relatively small increase in amorphadiene production
compared to overexpression of tHMGR supports the fact that HMGR
activity is the major limiting bottleneck of the mevalonate
pathway. Even high-level expression of ERG 8, ERG12, and ERG13 is
unlikely to greatly enhance flux through the pathway if HMGR
remains at basal expression level. The decreased cell densities
observed for the overexpression of UPC2 and ECM22 is unlikely due
to increased flux through the mevalonate pathway to FPP. It is
instead likely caused by an unfavorable change in transcriptional
regulation for one or multiple other genes controlled by UPC2 and
ECM22.
[0178] Coexpression of tHMGR and upc2-1. Overexpression of tHMGR
and upc2-1 each increased the final yield of amorphadiene in the
cell cultures. To test the possibility of a synergistic effect from
the overexpression of these genes together, the expression
cassettes were integrated sequentially into the S. cerevisiae
genome. Plasmid p.delta.-UB (Lee et al. (1997) Biotechnol Prog.,
13(4):368-373) was used for the construction of the integration
plasmids. This plasmid contains a reusable URA3Blaster Cassette
allowing for recycling of the URA3 marker. Additionally, it
integrates at a .delta.-sequence (found in the long terminal
repeats of Ty-transposon sites), of which there are approximately
425 dispersed through the genome (Dujon (1996) Trends in Genetics,
12(7):263-270).
[0179] tHMGR was integrated into the chromosome of a strain
harboring pRS425ADS using p.delta.-HMGR. The amorphadiene
production level of 13.8 .mu.g amorphadiene mL.sup.-1 was
comparable in this strain to strain EP203 which contained tHMGR on
a high-copy plasmid (FIG. 5). After recycling the URA3 marker by
plating on 5-FOA, upc2-1 was integrating into the chromosome using
plasmid p.delta.-UPC2. The effects of overexpressing tHMGR and
upc2-1 combined to raise amorphadiene production to 16.2 .mu.g
amorphadiene mL.sup.-1 (FIG. 5). Although expression of upc2-1 in
combination with tHMGR raised absolute amorphadiene production by
17%, this increase is only comparable to that seen when upc2-1 is
expressed with ADS alone. With the removal of the HMGR bottleneck,
a more significant impact was expected from upc2-1 expression.
Potential increases in amorphadiene production might be prevented
due to the routing of FPP to other metabolites.
[0180] Down-regulation of squalene synthase. The increases seen in
amorphadiene production suggested an increased precursor pool of
FPP. FPP is central to the synthesis of a number of S. cerevisiae
compounds including sterols, dolichols and polyprenols, and
prenylated proteins. Although increased flux through the mevalonate
pathway lead to higher amorphadiene production, a number of other
enzymes were also competing for the increased pool of FPP, most
importantly squalene synthase encoded by ERG9. Squalene synthesis
is the branch-point from FPP leading to ergosterol. In a strain
expressing the catalytic domain of HMGR and containing an ERG9
deletion, FPP was seen to accumulate (Song (2003) Analytical
Biochemistry, 317(2):180-185). With the aim of routing FPP away
from the sterol production and toward amorphadiene production,
reduction in squalene synthase activity would be useful. However,
an ERG9 deletion is lethal without exogenous supplementation of
sterols.
[0181] Employing an alternate strategy, ERG9 was transcriptionally
down-regulated by replacing its native promoter with a methionine
repressible promoter, P.sub.MET3 (Cherest et al. (1985) Gene,
34(2-3):269-281). Gardner et al. previously utilized such a
P.sub.MET3-ERG9 fusion construct for the study of HMGR degradation
signals (Gardner et al. (1999) J. Biol. Chem. 274(44):31671-31678;
Gardner et al. (2001) J. Biol. Chem., 276(12):8681-8694). Plasmid
pRS-ERG9 was constructed to utilize the same strategy as Gardner in
the replacement of the ERG9 native promoter with the MET3 promoter.
The utility of the P.sub.MET3-ERG9 fusion is underscored by the
tight regulatory control between 0 and 100 .mu.M extracellular
concentrations of methionine (Mao et al. (2002) Current
Microbiology, 45(1):37-40). In the presence of the high
extracellular concentrations of methionine, expression from the
MET3 promoter is very low. After integration of pRS-ERG9 at the
ERG9 locus, we could tune the squalene synthase expression based
upon methionine supplementation to the medium.
[0182] pRS-ERG9 was integrated into strain EPY209, and amorphadiene
production was measured with a range of 0 to 1 mM methionine in the
medium. Time points of 64 and 87 hours after inoculation are shown
(FIG. 4). The data suggests that minimal expression of ERG9
(methionine concentrations above 0.5 mM) maximize the production of
amorphadiene. As the S. cerevisiae cultures increase in cell
density and metabolize the nutrients in the medium, the methionine
concentration likely drops, explaining why cultures provided with
0.1 mM methionine in the medium have lower yields of amorphadiene.
1 mM methionine was selected for future experiments to ensure high
extracellular concentrations throughout the extended time
courses.
[0183] Strain EPY212 containing an integrated copy of tHMGR and
upc2-1 as well as methionine-repressible allele of ERG9 was grown
in culture and amorphadiene production was measured for six days
(FIG. 5). Limiting the FPP incorporated into squalene had a large
impact on amorphadiene production, increasing it four-fold to 61
.mu.g amorphadiene mL.sup.-1 over the strain EPY209 containing the
wild type ERG9 allele. Although limited in its ability to produce
ergosterol, EPY212 still grew to a final OD .about.75% of that of
EPY209.
[0184] Overexpression of FPP Synthase. FPP Synthase (FPPS), encoded
by ERG20, was targeted as the next target for overexpression in
hopes of increasing sesquiterpene yields further. A six-fold
increase in FPPS activity has been correlated with an 80% and 32%
increase in dolichol and ergosterol, respectively (Szkopinska et
al. (2000) Biochemical and Biophysical Research Communications,
267(1):473-477). Similar to the studies overexpressing HMGR and
upc2-1, ERG20 was first cloned behind the GAL1 promoter on a high
copy plasmid to create pRS-ERG20. Coexpression of ERG20 on this
plasmid with pRS425ADS actually lowered the absolute productivity
of amorphadiene by 60%. It is possible that an increase in FPPS
activity increased only the content of other FPP derived products
such as ergosterol. Another possibility is that overexpression of
FPPS increased the intracellular concentration of FPP--the main
signal for HMGR degradation (Gardner et al. (1999) J. Biol. Chem.
274(44):31671-31678). Without the overexpression of a deregulated
form of the reductase, increased FPP concentrations could act to
limit flux through the mevalonate pathway and decrease amorphadiene
production.
[0185] p.delta.-ERG20 was then constructed for the integration and
expression of ERG20 in our highest amorphadiene producer. The URA3
marker was recycled, and p.delta.-ERG20 integrated in the
chromosome to create strain EPY212. This strain overexpressing
FPPS, further increased the production of amorphadiene to 73 .mu.g
amorphadiene mL-1 (FIG. 5). Earlier we had seen a 60% decrease in
amorphadiene production in strain EPY206 overexpressing ERG20 with
ADS. However, now in a strain expressing tHMGR and upc2-1 and with
a regulated squalene synthase, amorphadiene production increased
20% with the overexpression of ERG20.
[0186] In strains EPY206 and EPY212 each expressing ERG20, a
decrease in cell density was observed. This decrease in cell growth
might be explained by a toxicity caused directly by ERG20p.
Alternatively an effect could arise from an accumulation or
depletion of a pathway intermediate due to modified flux through
the FPP synthase.
Example 2
Yeast Cells Genetically Modified to Produce Higher Levels of
Acetyl-CoA
[0187] A multicopy plasmid, pRS426ALD6 was constructed, which
carries the ALD6 gene encoding acetaldehyde dehydrogenase. Plasmid
constructs are shown schematically in FIG. 9. When pRS426ALD6 was
introduced into control Saccharomyces cerevisiae strain EPY213
(MAT.alpha. lys2 ura3 erg9::pMET-ERG9 pRS425 ADS integrated tHMGR,
upc2-1), cell growth and amorphadiene production level decreased,
as shown in FIGS. 10a and 10b. Overexpression of the ALD6 gene
increased the level of acetaldehyde dehydrogenase (ALD) activity
about 20 times higher than that of the control strain, and led to
an accumulation of acetate at about 1 g/L (16 mM) in the medium, as
shown in FIG. 10c. Overproduction of ALD resulted in a reduction in
the carbon flux through alcohol fermentation and an increase in the
carbon flux through the pyruvate dehydrogenase bypass that leads to
the mevalonate pathway.
[0188] The multicopy plasmid pRS426ACS1 (as depicted in FIG. 9) was
constructed. pTS426ACS1 carries the ACS1 gene encoding acetyl-CoA
synthetase (ACS). When pRS426ACS1 was introduced into the control
strain EPY213, ACS activity increased 2-3 times. Overexpression of
the ACS1 gene led to a consumption of acetate and an increase of
amorphadiene production level of 20-50%, as shown in FIGS. 11A-D.
These data show that overproduction of ACS is effective to increase
isoprenoid production through the pyruvate dehydrogenase bypass and
the mevalonate pathway.
[0189] The multicopy plasmid pES-ALD6-ACS1 (as depicted in FIG. 9)
was constructed. pES-ALD6-ACS1 provides for overexpression of both
the ALD6 and the ACS1 genes. Overexpression of both ALD and ACS was
not effective to increase amorphadiene production, and resulted in
a much higher amount of acetate accumulation in the medium, as
shown in FIGS. 12A-D. The strain overexpressing both ALD6 and ACS1
genes showed a 50-times higher level of ALD activity, compared to
the control EPY213 strain, as shown in FIG. 14A. Overexpression of
both ALD6 and ACS1 genes did not result in an increase in ACS
activity, as shown in FIG. 14B. Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis
showed that more protein with a deduced molecular weight of ACS was
observed in the strain overexpressing both ALD6 and ACS1 genes, as
shown in FIG. 14C.
[0190] In the prokaryote Salmonella enterica, ACS is
posttranslationally regulated via acetylation/deacetylation of
residue Lys-609, as depicted schematically in FIG. 15. Protein
acetyl transferase (Pat) catalyzes the acetylation reaction;
acetylation of ACS renders the enzyme inactive. CobB, encoding
NAD.sup.+-dependent Sir2 protein deactylase catalyzes the
deacetylation of Lys-609 of ACS; removal of the inhibitory acetyl
group activates ACS. The Lue-641 of S. enterica ACS is critical for
the acetylation of residue Lys-609. Although the activity of
ACS.sup.L641P derived from S. enterica is about one third that of
the wild-type ACS, Pat does not acetylate ACS.sup.L641P and does
not inhibit its activity. The amino acid sequences surrounding the
acetylation site is conserved between S. enterica ACS and S.
cerevisiae ACS, as shown in FIG. 16.
Example 3
Producing High Levels of an Isoprenoid Compound in a Genetically
Modified Yeast Cell
[0191] Plasmid pRS425-Leu2d was constructed by deleting the
promoter starting from 29 base pairs before the ATG start codon
from the LEU2 gene on pRS425ADS to create the leu2-d allele. A 2
micron plasmid containing leu2-d as the selection marker has been
previously found to increase copy number and stability of the
plasmid. Plasmid pRS425-Leu2d is depicted schematically in FIG.
21.
[0192] S. cerevisiae strain EPY224 was cured of plasmid pRS425ADS
and transformed with the newly constructed pRS425ADS-Leu2d.
[0193] Each of these strains (EPY224 containing pRS425ADS; and
EPY224 containing pRS425ADS-Leu2d) was grown overnight in a culture
tube containing 10 mL of synthetically defined medium (dropped out
for leucine, histidine, and methionine) containing 2% glucose. Six
50 mL cultures were inoculated from each of the overnight cultures.
Three contained synthetically defined (SD) medium lacking leucine,
supplemented with an additional 1 mM methionine, and containing
1.8% galactose/0.2% glucose; this medium is referred to as SD-Leu).
Three contained YP (Yeast extract, peptone) medium supplemented
with an additional 1 mM methionine and containing 1.8%
galactose/0.2% glucose; this medium is referred to as YPG. 5 mL of
dodecane was also added to each flask.
[0194] The cultures were grown for 144 hours. Every 24 hours the
dodecane layer was sampled to quantify the amorphadiene levels by
GC-MS. Optical density (OD.sub.600) was also measured. Amorphadiene
levels over time are presented in FIG. 22. As shown in FIG. 22,
after 120 hours in culture, EPY224 containing pRS425ADS-Leu2d and
grown in YPG medium produced amorphadiene at levels over 700
.mu.g/ml; EPY224 containing pRS425ADS and grown in YPG medium
produced amorphadiene at levels above about 500 .mu.g/ml; EPY224
containing either pRS425ADS-Leu2d or pRS425ADS and grown in SD-Leu
produced low levels of amorphadiene.
[0195] Plasmid stability was tested at 24, 72, and 144 hours. A
small aliquot of each culture was diluted and plated on Yeast
Peptone Dextrose (YPD; "rich") and SD-Leu ("selective") plates.
Colonies were counted on each plate and the percent of cells
retaining the plasmid was determined by dividing the cell count on
the plates selective for the cells containing the plasmid (SD-Leu)
by the nonselective plates (YPD). FIG. 23 is a graph depicting the
percent of cells retaining the plasmid over time, when grown in
various culture media: EPY224 containing pRS425ADS and grown on
selective (SD-Leu) medium ("LEU2 selective"); EPY224 containing
pRS425ADS-Leu2d and grown on selective medium ("Leu2-d selective");
EPY224 containing pRS425ADS and grown on rich (YPD) medium ("LEU2
Rich"); and EPY224 containing pRS425ADS-Leu2d and grown on rich
medium ("Leu2-d Rich").
[0196] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
2511509DNAArtificial SequenceSequence encoding truncated
hydroxymethylglutaryl coenzyme-A reductase 1atggttttaa ccaataaaac
agtcatttct ggatcgaaag tcaaaagttt atcatctgcg 60caatcgagct catcaggacc
ttcatcatct agtgaggaag atgattcccg cgatattgaa 120agcttggata
agaaaatacg tcctttagaa gaattagaag cattattaag tagtggaaat
180acaaaacaat tgaagaacaa agaggtcgct gccttggtta ttcacggtaa
gttacctttg 240tacgctttgg agaaaaaatt aggtgatact acgagagcgg
ttgcggtacg taggaaggct 300ctttcaattt tggcagaagc tcctgtatta
gcatctgatc gtttaccata taaaaattat 360gactacgacc gcgtatttgg
cgcttgttgt gaaaatgtta taggttacat gcctttgccc 420gttggtgtta
taggcccctt ggttatcgat ggtacatctt atcatatacc aatggcaact
480acagagggtt gtttggtagc ttctgccatg cgtggctgta aggcaatcaa
tgctggcggt 540ggtgcaacaa ctgttttaac taaggatggt atgacaagag
gcccagtagt ccgtttccca 600actttgaaaa gatctggtgc ctgtaagata
tggttagact cagaagaggg acaaaacgca 660attaaaaaag cttttaactc
tacatcaaga tttgcacgtc tgcaacatat tcaaacttgt 720ctagcaggag
atttactctt catgagattt agaacaacta ctggtgacgc aatgggtatg
780aatatgattt ctaaaggtgt cgaatactca ttaaagcaaa tggtagaaga
gtatggctgg 840gaagatatgg aggttgtctc cgtttctggt aactactgta
ccgacaaaaa accagctgcc 900atcaactgga tcgaaggtcg tggtaagagt
gtcgtcgcag aagctactat tcctggtgat 960gttgtcagaa aagtgttaaa
aagtgatgtt tccgcattgg ttgagttgaa cattgctaag 1020aatttggttg
gatctgcaat ggctgggtct gttggtggat ttaacgcaca tgcagctaat
1080ttagtgacag ctgttttctt ggcattagga caagatcctg cacaaaatgt
tgaaagttcc 1140aactgtataa cattgatgaa agaagtggac ggtgatttga
gaatttccgt atccatgcca 1200tccatcgaag taggtaccat cggtggtggt
actgttctag aaccacaagg tgccatgttg 1260gacttattag gtgtaagagg
cccgcatgct accgctcctg gtaccaacgc acgtcaatta 1320gcaagaatag
ttgcctgtgc cgtcttggca ggtgaattat ccttatgtgc tgccctagca
1380gccggccatt tggttcaaag tcatatgacc cacaacagga aacctgctga
accaacaaaa 1440cctaacaatt tggacgccac tgatataaat cgtttgaaag
atgggtccgt cacctgcatt 1500aaatcctaa 15092502PRTArtificial
Sequencetruncated hydroxymethylglutaryl coenzyme-A reductase 2Met
Val Leu Thr Asn Lys Thr Val Ile Ser Gly Ser Lys Val Lys Ser1 5 10
15Leu Ser Ser Ala Gln Ser Ser Ser Ser Gly Pro Ser Ser Ser Ser Glu
20 25 30Glu Asp Asp Ser Arg Asp Ile Glu Ser Leu Asp Lys Lys Ile Arg
Pro 35 40 45Leu Glu Glu Leu Glu Ala Leu Leu Ser Ser Gly Asn Thr Lys
Gln Leu 50 55 60Lys Asn Lys Glu Val Ala Ala Leu Val Ile His Gly Lys
Leu Pro Leu65 70 75 80Tyr Ala Leu Glu Lys Lys Leu Gly Asp Thr Thr
Arg Ala Val Ala Val 85 90 95Arg Arg Lys Ala Leu Ser Ile Leu Ala Glu
Ala Pro Val Leu Ala Ser 100 105 110Asp Arg Leu Pro Tyr Lys Asn Tyr
Asp Tyr Asp Arg Val Phe Gly Ala 115 120 125Cys Cys Glu Asn Val Ile
Gly Tyr Met Pro Leu Pro Val Gly Val Ile 130 135 140Gly Pro Leu Val
Ile Asp Gly Thr Ser Tyr His Ile Pro Met Ala Thr145 150 155 160Thr
Glu Gly Cys Leu Val Ala Ser Ala Met Arg Gly Cys Lys Ala Ile 165 170
175Asn Ala Gly Gly Gly Ala Thr Thr Val Leu Thr Lys Asp Gly Met Thr
180 185 190Arg Gly Pro Val Val Arg Phe Pro Thr Leu Lys Arg Ser Gly
Ala Cys 195 200 205Lys Ile Trp Leu Asp Ser Glu Glu Gly Gln Asn Ala
Ile Lys Lys Ala 210 215 220Phe Asn Ser Thr Ser Arg Phe Ala Arg Leu
Gln His Ile Gln Thr Cys225 230 235 240Leu Ala Gly Asp Leu Leu Phe
Met Arg Phe Arg Thr Thr Thr Gly Asp 245 250 255Ala Met Gly Met Asn
Met Ile Ser Lys Gly Val Glu Tyr Ser Leu Lys 260 265 270Gln Met Val
Glu Glu Tyr Gly Trp Glu Asp Met Glu Val Val Ser Val 275 280 285Ser
Gly Asn Tyr Cys Thr Asp Lys Lys Pro Ala Ala Ile Asn Trp Ile 290 295
300Glu Gly Arg Gly Lys Ser Val Val Ala Glu Ala Thr Ile Pro Gly
Asp305 310 315 320Val Val Arg Lys Val Leu Lys Ser Asp Val Ser Ala
Leu Val Glu Leu 325 330 335Asn Ile Ala Lys Asn Leu Val Gly Ser Ala
Met Ala Gly Ser Val Gly 340 345 350Gly Phe Asn Ala His Ala Ala Asn
Leu Val Thr Ala Val Phe Leu Ala 355 360 365Leu Gly Gln Asp Pro Ala
Gln Asn Val Glu Ser Ser Asn Cys Ile Thr 370 375 380Leu Met Lys Glu
Val Asp Gly Asp Leu Arg Ile Ser Val Ser Met Pro385 390 395 400Ser
Ile Glu Val Gly Thr Ile Gly Gly Gly Thr Val Leu Glu Pro Gln 405 410
415Gly Ala Met Leu Asp Leu Leu Gly Val Arg Gly Pro His Ala Thr Ala
420 425 430Pro Gly Thr Asn Ala Arg Gln Leu Ala Arg Ile Val Ala Cys
Ala Val 435 440 445Leu Ala Gly Glu Leu Ser Leu Cys Ala Ala Leu Ala
Ala Gly His Leu 450 455 460Val Gln Ser His Met Thr His Asn Arg Lys
Pro Ala Glu Pro Thr Lys465 470 475 480Pro Asn Asn Leu Asp Ala Thr
Asp Ile Asn Arg Leu Lys Asp Gly Ser 485 490 495Val Thr Cys Ile Lys
Ser 500332DNAArtificial Sequencesynthetic primer 3ggactagtaa
aacaatggcc ctgaccgaag ag 32429DNAArtificial Sequencesynthetic
primer 4ccaagctttc agatggacat cgggtaaac 29535DNAArtificial
Sequencesynthetic primer 5cgggatccaa aacaatggct gcagaccaat tggtg
35630DNAArtificial Sequencesynthetic primer 6gcgtcgactt aggatttaat
gcaggtgacg 30729DNAArtificial Sequencesynthetic primer 7ctgccgcggg
gccgcaaatt aaagccttc 29829DNAArtificial Sequencesynthetic primer
8ctgccgcggt agtacggatt agaagccgc 29935DNAArtificial
Sequencesynthetic primer 9cgggatccaa aacaatgagc gaagtcggta tacag
351034DNAArtificial Sequencesynthetic primer 10gcgtcgactc
ataacgaaaa atcagagaaa tttg 341136DNAArtificial Sequencesynthetic
primer 11cgggatccaa aacaatgaca tccgatgatg ggaatg
361234DNAArtificial Sequencesynthetic primer 12gcgtcgactt
acataaaagc tgaaaagttt gtag 341337DNAArtificial Sequencesynthetic
primer 13ggactagtaa aacaatggct tcagaaaaag aaattag
371430DNAArtificial Sequencesynthetic primer 14tcccccgggc
tatttgcttc tcttgtaaac 301511PRTArtificial Sequencesynthetic peptide
15Ile Val Arg His Leu Ile Asp Ser Val Lys Leu1 5
101611PRTArtificial Sequencesynthetic peptide 16Ile Val Arg His Ser
Ile Asp Ser Val Lys Leu1 5 101711PRTArtificial Sequencesynthetic
peptide 17Ile Val Arg His Pro Ile Asp Ser Val Lys Leu1 5
101817PRTArtificial Sequencesynthetic peptide 18Asp Leu Pro Lys Thr
Arg Ser Gly Lys Ile Met Arg Arg Ile Leu Arg1 5 10
15Lys1917PRTArtificial Sequencesynthetic peptide 19Asp Leu Pro Lys
Thr Arg Ser Gly Ser Ile Met Arg Arg Ile Leu Arg1 5 10
15Lys2052PRTSalmonella enterica 20Ser Leu Pro Lys Thr Arg Ser Gly
Lys Ile Met Arg Arg Ile Leu Arg1 5 10 15Lys Ile Ala Ala Gly Asp Thr
Ser Asn Leu Gly Asp Thr Ser Thr Leu 20 25 30Ala Asp Pro Gly Val Val
Glu Lys Leu Leu Glu Glu Lys Gln Ala Ile 35 40 45Ala Met Pro Ser
502147PRTSaccharomyces cerevisiae 21Asp Leu Pro Lys Thr Arg Ser Gly
Lys Ile Met Arg Arg Ile Leu Arg1 5 10 15Lys Ile Leu Ala Gly Glu Ser
Asp Gln Leu Gly Asp Val Ser Thr Leu 20 25 30Ser Asn Pro Gly Ile Val
Arg His Leu Ile Asp Ser Val Lys Leu 35 40 4522500PRTSaccharomyces
cerevisiae 22Met Thr Lys Leu His Phe Asp Thr Ala Glu Pro Val Lys
Ile Thr Leu1 5 10 15Pro Asn Gly Leu Thr Tyr Glu Gln Pro Thr Gly Leu
Phe Ile Asn Asn 20 25 30Lys Phe Met Lys Ala Gln Asp Gly Lys Thr Tyr
Pro Val Glu Asp Pro 35 40 45Ser Thr Glu Asn Thr Val Cys Glu Val Ser
Ser Ala Thr Thr Glu Asp 50 55 60Val Glu Tyr Ala Ile Glu Cys Ala Asp
Arg Ala Phe His Asp Thr Glu65 70 75 80Trp Ala Thr Gln Asp Pro Arg
Glu Arg Gly Arg Leu Leu Ser Lys Leu 85 90 95Ala Asp Glu Leu Glu Ser
Gln Ile Asp Leu Val Ser Ser Ile Glu Ala 100 105 110Leu Asp Asn Gly
Lys Thr Leu Ala Leu Ala Arg Gly Asp Val Thr Ile 115 120 125Ala Ile
Asn Cys Leu Arg Asp Ala Ala Ala Tyr Ala Asp Lys Val Asn 130 135
140Gly Arg Thr Ile Asn Thr Gly Asp Gly Tyr Met Asn Phe Thr Thr
Leu145 150 155 160Glu Pro Ile Gly Val Cys Gly Gln Ile Ile Pro Trp
Asn Phe Pro Ile 165 170 175Met Met Leu Ala Trp Lys Ile Ala Pro Ala
Leu Ala Met Gly Asn Val 180 185 190Cys Ile Leu Lys Pro Ala Ala Val
Thr Pro Leu Asn Ala Leu Tyr Phe 195 200 205Ala Ser Leu Cys Lys Lys
Val Gly Ile Pro Ala Gly Val Val Asn Ile 210 215 220Val Pro Gly Pro
Gly Arg Thr Val Gly Ala Ala Leu Thr Asn Asp Pro225 230 235 240Arg
Ile Arg Lys Leu Ala Phe Thr Gly Ser Thr Glu Val Gly Lys Ser 245 250
255Val Ala Val Asp Ser Ser Glu Ser Asn Leu Lys Lys Ile Thr Leu Glu
260 265 270Leu Gly Gly Lys Ser Ala His Leu Val Phe Asp Asp Ala Asn
Ile Lys 275 280 285Lys Thr Leu Pro Asn Leu Val Asn Gly Ile Phe Lys
Asn Ala Gly Gln 290 295 300Ile Cys Ser Ser Gly Ser Arg Ile Tyr Val
Gln Glu Gly Ile Tyr Asp305 310 315 320Glu Leu Leu Ala Ala Phe Lys
Ala Tyr Leu Glu Thr Glu Ile Lys Val 325 330 335Gly Asn Pro Phe Asp
Lys Ala Asn Phe Gln Gly Ala Ile Thr Asn Arg 340 345 350Gln Gln Phe
Asp Thr Ile Met Asn Tyr Ile Asp Ile Gly Lys Lys Glu 355 360 365Gly
Ala Lys Ile Leu Thr Gly Gly Glu Lys Val Gly Asp Lys Gly Tyr 370 375
380Phe Ile Arg Pro Thr Val Phe Tyr Asp Val Asn Glu Asp Met Arg
Ile385 390 395 400Val Lys Glu Glu Ile Phe Gly Pro Val Val Thr Val
Ala Lys Phe Lys 405 410 415Thr Leu Glu Glu Gly Val Glu Met Ala Asn
Ser Ser Glu Phe Gly Leu 420 425 430Gly Ser Gly Ile Glu Thr Glu Ser
Leu Ser Thr Gly Leu Lys Val Ala 435 440 445Lys Met Leu Lys Ala Gly
Thr Val Trp Ile Asn Thr Tyr Asn Asp Phe 450 455 460Asp Ser Arg Val
Pro Phe Gly Gly Val Lys Gln Ser Gly Tyr Gly Arg465 470 475 480Glu
Met Gly Glu Glu Val Tyr His Ala Tyr Thr Glu Val Lys Ala Val 485 490
495Arg Ile Lys Leu 500231503DNASaccharomyces cerevisiae
23atgactaagc tacactttga cactgctgaa ccagtcaaga tcacacttcc aaatggtttg
60acatacgagc aaccaaccgg tctattcatt aacaacaagt ttatgaaagc tcaagacggt
120aagacctatc ccgtcgaaga tccttccact gaaaacaccg tttgtgaggt
ctcttctgcc 180accactgaag atgttgaata tgctatcgaa tgtgccgacc
gtgctttcca cgacactgaa 240tgggctaccc aagacccaag agaaagaggc
cgtctactaa gtaagttggc tgacgaattg 300gaaagccaaa ttgacttggt
ttcttccatt gaagctttgg acaatggtaa aactttggcc 360ttagcccgtg
gggatgttac cattgcaatc aactgtctaa gagatgctgc tgcctatgcc
420gacaaagtca acggtagaac aatcaacacc ggtgacggct acatgaactt
caccacctta 480gagccaatcg gtgtctgtgg tcaaattatt ccatggaact
ttccaataat gatgttggct 540tggaagatcg ccccagcatt ggccatgggt
aacgtctgta tcttgaaacc cgctgctgtc 600acacctttaa atgccctata
ctttgcttct ttatgtaaga aggttggtat tccagctggt 660gtcgtcaaca
tcgttccagg tcctggtaga actgttggtg ctgctttgac caacgaccca
720agaatcagaa agctggcttt taccggttct acagaagtcg gtaagagtgt
tgctgtcgac 780tcttctgaat ctaacttgaa gaaaatcact ttggaactag
gtggtaagtc cgcccatttg 840gtctttgacg atgctaacat taagaagact
ttaccaaatc tagtaaacgg tattttcaag 900aacgctggtc aaatttgttc
ctctggttct agaatttacg ttcaagaagg tatttacgac 960gaactattgg
ctgctttcaa ggcttacttg gaaaccgaaa tcaaagttgg taatccattt
1020gacaaggcta acttccaagg tgctatcact aaccgtcaac aattcgacac
aattatgaac 1080tacatcgata tcggtaagaa agaaggcgcc aagatcttaa
ctggtggcga aaaagttggt 1140gacaagggtt acttcatcag accaaccgtt
ttctacgatg ttaatgaaga catgagaatt 1200gttaaggaag aaatttttgg
accagttgtc actgtcgcaa agttcaagac tttagaagaa 1260ggtgtcgaaa
tggctaacag ctctgaattc ggtctaggtt ctggtatcga aacagaatct
1320ttgagcacag gtttgaaggt ggccaagatg ttgaaggccg gtaccgtctg
gatcaacaca 1380tacaacgatt ttgactccag agttccattc ggtggtgtta
agcaatctgg ttacggtaga 1440gaaatgggtg aagaagtcta ccatgcatac
actgaagtaa aagctgtcag aattaagttg 1500taa 150324713PRTSaccharomyces
cerevisiae 24Met Ser Pro Ser Ala Val Gln Ser Ser Lys Leu Glu Glu
Gln Ser Ser1 5 10 15Glu Ile Asp Lys Leu Lys Ala Lys Met Ser Gln Ser
Ala Ala Thr Ala 20 25 30Gln Gln Lys Lys Glu His Glu Tyr Glu His Leu
Thr Ser Val Lys Ile 35 40 45Val Pro Gln Arg Pro Ile Ser Asp Arg Leu
Gln Pro Ala Ile Ala Thr 50 55 60His Tyr Ser Pro His Leu Asp Gly Leu
Gln Asp Tyr Gln Arg Leu His65 70 75 80Lys Glu Ser Ile Glu Asp Pro
Ala Lys Phe Phe Gly Ser Lys Ala Thr 85 90 95Gln Phe Leu Asn Trp Ser
Lys Pro Phe Asp Lys Val Phe Ile Pro Asp 100 105 110Pro Lys Thr Gly
Arg Pro Ser Phe Gln Asn Asn Ala Trp Phe Leu Asn 115 120 125Gly Gln
Leu Asn Ala Cys Tyr Asn Cys Val Asp Arg His Ala Leu Lys 130 135
140Thr Pro Asn Lys Lys Ala Ile Ile Phe Glu Gly Asp Glu Pro Gly
Gln145 150 155 160Gly Tyr Ser Ile Thr Tyr Lys Glu Leu Leu Glu Glu
Val Cys Gln Val 165 170 175Ala Gln Val Leu Thr Tyr Ser Met Gly Val
Arg Lys Gly Asp Thr Val 180 185 190Ala Val Tyr Met Pro Met Val Pro
Glu Ala Ile Ile Thr Leu Leu Ala 195 200 205Ile Ser Arg Ile Gly Ala
Ile His Ser Val Val Phe Ala Gly Phe Ser 210 215 220Ser Asn Ser Leu
Arg Asp Arg Ile Asn Asp Gly Asp Ser Lys Val Val225 230 235 240Ile
Thr Thr Asp Glu Ser Asn Arg Gly Gly Lys Val Ile Glu Thr Lys 245 250
255Arg Ile Val Asp Asp Ala Leu Arg Glu Thr Pro Gly Val Arg His Val
260 265 270Leu Val Tyr Arg Lys Thr Asn Asn Pro Ser Val Ala Phe His
Ala Pro 275 280 285Arg Asp Leu Asp Trp Ala Thr Glu Lys Lys Lys Tyr
Lys Thr Tyr Tyr 290 295 300Pro Cys Thr Pro Val Asp Ser Glu Asp Pro
Leu Phe Leu Leu Tyr Thr305 310 315 320Ser Gly Ser Thr Gly Ala Pro
Lys Gly Val Gln His Ser Thr Ala Gly 325 330 335Tyr Leu Leu Gly Ala
Leu Leu Thr Met Arg Tyr Thr Phe Asp Thr His 340 345 350Gln Glu Asp
Val Phe Phe Thr Ala Gly Asp Ile Gly Trp Ile Thr Gly 355 360 365His
Thr Tyr Val Val Tyr Gly Pro Leu Leu Tyr Gly Cys Ala Thr Leu 370 375
380Val Phe Glu Gly Thr Pro Ala Tyr Pro Asn Tyr Ser Arg Tyr Trp
Asp385 390 395 400Ile Ile Asp Glu His Lys Val Thr Gln Phe Tyr Val
Ala Pro Thr Ala 405 410 415Leu Arg Leu Leu Lys Arg Ala Gly Asp Ser
Tyr Ile Glu Asn His Ser 420 425 430Leu Lys Ser Leu Arg Cys Leu Gly
Ser Val Gly Glu Pro Ile Ala Ala 435 440 445Glu Val Trp Glu Trp Tyr
Ser Glu Lys Ile Gly Lys Asn Glu Ile Pro 450 455 460Ile Val Asp Thr
Tyr Trp Gln Thr Glu Ser Gly Ser His Leu Val Thr465 470 475 480Pro
Leu Ala Gly Gly Val Thr Pro Met Lys Pro Gly Ser Ala Ser Phe 485 490
495Pro Phe Phe Gly Ile Asp Ala Val Val Leu Asp Pro
Asn Thr Gly Glu 500 505 510Glu Leu Asn Thr Ser His Ala Glu Gly Val
Leu Ala Val Lys Ala Ala 515 520 525Trp Pro Ser Phe Ala Arg Thr Ile
Trp Lys Asn His Asp Arg Tyr Leu 530 535 540Asp Thr Tyr Leu Asn Pro
Tyr Pro Gly Tyr Tyr Phe Thr Gly Asp Gly545 550 555 560Ala Ala Lys
Asp Lys Asp Gly Tyr Ile Trp Ile Leu Gly Arg Val Asp 565 570 575Asp
Val Val Asn Val Ser Gly His Arg Leu Ser Thr Ala Glu Ile Glu 580 585
590Ala Ala Ile Ile Glu Asp Pro Ile Val Ala Glu Cys Ala Val Val Gly
595 600 605Phe Asn Asp Asp Leu Thr Gly Gln Ala Val Ala Ala Phe Val
Val Leu 610 615 620Lys Asn Lys Ser Ser Trp Ser Thr Ala Thr Asp Asp
Glu Leu Gln Asp625 630 635 640Ile Lys Lys His Leu Val Phe Thr Val
Arg Lys Asp Ile Gly Pro Phe 645 650 655Ala Ala Pro Lys Leu Ile Ile
Leu Val Asp Asp Leu Pro Lys Thr Arg 660 665 670Ser Gly Lys Ile Met
Arg Arg Ile Leu Arg Lys Ile Leu Ala Gly Glu 675 680 685Ser Asp Gln
Leu Gly Asp Val Ser Thr Leu Ser Asn Pro Gly Ile Val 690 695 700Arg
His Leu Ile Asp Ser Val Lys Leu705 710252142DNASaccharomyces
cerevisiae 25atgtcgccct ctgccgtaca atcatcaaaa ctagaagaac agtcaagtga
aattgacaag 60ttgaaagcaa aaatgtccca gtctgccgcc actgcgcagc agaagaagga
acatgagtat 120gaacatttga cttcggtcaa gatcgtgcca caacggccca
tctcagatag actgcagccc 180gcaattgcta cccactattc tccacacttg
gacgggttgc aggactatca gcgcttgcac 240aaggagtcta ttgaagaccc
tgctaagttc ttcggttcta aagctaccca atttttaaac 300tggtctaagc
cattcgataa ggtgttcatc ccagacccta aaacgggcag gccctccttc
360cagaacaatg catggttcct caacggccaa ttaaacgcct gttacaactg
tgttgacaga 420catgccttga agactcctaa caagaaagcc attattttcg
aaggtgacga gcctggccaa 480ggctattcca ttacctacaa ggaactactt
gaagaagttt gtcaagtggc acaagtgctg 540acttactcta tgggcgttcg
caagggcgat actgttgccg tgtacatgcc tatggtccca 600gaagcaatca
taaccttgtt ggccatttcc cgtatcggtg ccattcactc cgtagtcttt
660gccgggtttt cttccaactc cttgagagat cgtatcaacg atggggactc
taaagttgtc 720atcactacag atgaatccaa cagaggtggt aaagtcattg
agactaaaag aattgttgat 780gacgcgctaa gagagacccc aggcgtgaga
cacgtcttgg tttatagaaa gaccaacaat 840ccatctgttg ctttccatgc
ccccagagat ttggattggg caacagaaaa gaagaaatac 900aagacctact
atccatgcac acccgttgat tctgaggatc cattattctt gttgtatacg
960tctggttcta ctggtgcccc caagggtgtt caacattcta ccgcaggtta
cttgctggga 1020gctttgttga ccatgcgcta cacttttgac actcaccaag
aagacgtttt cttcacagct 1080ggagacattg gctggattac aggccacact
tatgtggttt atggtccctt actatatggt 1140tgtgccactt tggtctttga
agggactcct gcgtacccaa attactcccg ttattgggat 1200attattgatg
aacacaaagt cacccaattt tatgttgcgc caactgcttt gcgtttgttg
1260aaaagagctg gtgattccta catcgaaaat cattccttaa aatctttgcg
ttgcttgggt 1320tcggtcggtg agccaattgc tgctgaagtt tgggagtggt
actctgaaaa aataggtaaa 1380aatgaaatcc ccattgtaga cacctactgg
caaacagaat ctggttcgca tctggtcacc 1440ccgctggctg gtggtgttac
accaatgaaa ccgggttctg cctcattccc cttcttcggt 1500attgatgcag
ttgttcttga ccctaacact ggtgaagaac ttaacaccag ccacgcagag
1560ggtgtccttg ccgtcaaagc tgcatggcca tcatttgcaa gaactatttg
gaaaaatcat 1620gataggtatc tagacactta tttgaaccct taccctggct
actatttcac tggtgatggt 1680gctgcaaagg ataaggatgg ttatatctgg
attttgggtc gtgtagacga tgtggtgaac 1740gtctctggtc accgtctgtc
taccgctgaa attgaggctg ctattatcga agatccaatt 1800gtggccgagt
gtgctgttgt cggattcaac gatgacttga ctggtcaagc agttgctgca
1860tttgtggtgt tgaaaaacaa atctagttgg tccaccgcaa cagatgatga
attacaagat 1920atcaagaagc atttggtctt tactgttaga aaagacatcg
ggccatttgc cgcaccaaaa 1980ttgatcattt tagtggatga cttgcccaag
acaagatccg gcaaaattat gagacgtatt 2040ttaagaaaaa tcctagcagg
agaaagtgac caactaggcg acgtttctac attgtcaaac 2100cctggcattg
ttagacatct aattgattcg gtcaagttgt aa 2142
* * * * *