U.S. patent application number 12/184100 was filed with the patent office on 2009-02-26 for analysis of nucleic acids by digital pcr.
This patent application is currently assigned to The Chinese University of Hong Kong. Invention is credited to Rossa Wai Kwun CHIU, Yuk Ming Dennis Lo.
Application Number | 20090053719 12/184100 |
Document ID | / |
Family ID | 40193585 |
Filed Date | 2009-02-26 |
United States Patent
Application |
20090053719 |
Kind Code |
A1 |
Lo; Yuk Ming Dennis ; et
al. |
February 26, 2009 |
ANALYSIS OF NUCLEIC ACIDS BY DIGITAL PCR
Abstract
The present invention provides a method for analyzing nucleic
acids for their lengths and relative abundance in a sample, based
on digital amplification of individual template molecules. This
invention has many applications, including those in noninvasive
prenatal diagnosis, transplantation monitoring, and the detection
and monitoring of cancers and virus-associated diseases.
Inventors: |
Lo; Yuk Ming Dennis;
(Kowloon, HK) ; CHIU; Rossa Wai Kwun; (New
Territories, HK) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
The Chinese University of Hong
Kong
Shatin
HK
|
Family ID: |
40193585 |
Appl. No.: |
12/184100 |
Filed: |
July 31, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60953872 |
Aug 3, 2007 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6851 20130101;
C12Q 2563/159 20130101; C12Q 2565/629 20130101; C12Q 2527/107
20130101; C12Q 1/6851 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for analyzing nucleic acids in a sample, comprising the
steps of: (i) preparing multiple equal fractions from the sample,
wherein more than 50% of the fractions contain no more than 1
target nucleic acid molecule per fraction; (ii) performing
amplification reactions in each fraction using at least one forward
primer with at least two reverse primers, or using at least two
forward primers with at least one reverse primer, wherein each of
the forward or reverse primers has a distinct and definitive
nucleotide sequence; (iii) detecting in each fraction amplified
nucleotide sequence from each pair of forward and reverse primers;
and (iv) counting the number of fractions in which different
combinations of amplified nucleotide sequences from different pairs
of forward and reverse primers are detected, thereby determining
the relative amount of the target nucleic acids of different
lengths in the sample.
2. The method of claim 1, wherein the multiple equal fractions are
multiple equal dilutions from the sample.
3. The method of claim 1, wherein step (i) is performed by a
microfluidics system.
4. The method of claim 1, wherein the amplification reactions are
polymerase chain reactions (PCR).
5. The method of claim 4, wherein the PCR is real-time PCR.
6. The method of claim 4, wherein a fluorescent dye is present in
the PCR.
7. The method of claim 6, wherein the fluorescent dye is SYBR Green
or LC Green.
8. The method of claim 1, further comprising a step of reverse
transcription prior to step (i) or step (ii).
9. The method of claim 1, wherein the amplified nucleotide
sequences from different pairs of forward and reverse primers are
of distinct lengths.
10. The method of claim 1, wherein step (ii) is performed by
emulsion polymerase chain reaction.
11. The method of claim 1, wherein step (iii) is performed by
melting curve analysis.
12. The method of claim 9, wherein step (iii) is performed by
electrophoresis.
13. The method of claim 1, wherein step (iii) is performed by
sequence-specific hybridization with probes with detectable labels,
wherein each probe has a distinct detectable label and specifically
hybridizes with an amplified nucleotide sequence from a pair of
forward and reverse primers.
14. The method of claim 13, wherein the detectable labels are
distinct fluorescent molecules.
15. The method of claim 1, wherein step (iii) is performed by
primer extension reactions or by sequencing reactions.
16. The method of claim 15, wherein products of the primer
extension reactions are detected by mass spectrometry.
17. The method of claim 1, wherein step (iii) is performed by flow
cytometry.
18. The method of claim 1, wherein steps (ii) and (iii) are
performed by BEAMing.
19. The method of claim 1, wherein the amplification reactions in
step (ii) are performed consecutively using different pairs of
forward and reverse primers.
20. The method of claim 1, wherein the amplification reactions in
step (ii) are performed concurrently using different pairs of
forward and reverse primers.
21. The method of claim 1, wherein the sample is from a pregnant
woman.
22. The method of claim 21, wherein the sample is blood, plasma,
serum, saliva, or a cervical lavage sample.
23. The method of claim 21, wherein each of the target nucleic
acids comprises at least a portion of chromosome 13, 18, 21, X, or
Y.
24. The method of claim 21, wherein each of the target nucleic
acids comprises at least a portion of a gene related to a genetic
disease or a genetic polymorphism.
25. The method of claim 24, wherein the gene is the .beta.-globin
gene or the cystic fibrosis transmembrane conductance regulator
gene.
26. The method of claim 24, wherein the genetic polymorphism is a
single nucleotide polymorphism (SNP).
27. The method of claim 1, wherein the sample is from a cancer
patient.
28. The method of claim 27, wherein the cancer is nasopharyngeal
carcinoma, lymphoma, hepatocellular carcinoma, or cervical
carcinoma.
29. The method of claim 27, wherein the sample is blood, plasma,
serum, saliva, or tumor tissue.
30. The method of claim 27, wherein each of the target nucleic
acids comprises at least a portion of an oncogene or a tumor
suppressor gene.
31. The method of claim 30, wherein the oncogene or tumor
suppressor gene is KRAS, erbB-2, p16, or RASSF1A.
32. The method of claim 1, wherein each of the target nucleic acids
is from a virus genome.
33. The method of claim 32, wherein the virus is Epstein-Barr
Virus, Human Papilloma Virus, or Hepatitis B Virus.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 60/953,872, filed Aug. 3, 2007, the disclosure of
which is incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] The analysis of the size of nucleic acids is useful for many
research and diagnostic applications. Electrophoresis, e.g.,
agarose gel electrophoresis, polyacrylamide gel electrophoresis and
capillary electrophoresis, is commonly used for the size analysis
of nucleic acids. Mass spectrometry has also been used for size
analysis, as nucleic acid fragments of different sizes, such as
those produced by a primer extension reaction, have different
molecular masses (Ding and Cantor, 2003, Proc Natl Acad Sci USA,
100, 7449-7453).
[0003] Below are several examples of the use of size analysis. For
example, the presence of a mutation which creates a restriction
enzyme site can be detected by treatment with the said enzyme,
followed by the analysis of the sizes of the treated products. The
presence of shorter fragments of a particular size indicates that
the mutation is present. Conversely, the presence of longer DNA
fragments corresponding to the unrestricted state is suggestive of
the absence of the mutation. If the restriction enzyme used is
sensitive to the methylation status of the target DNA fragment,
then this type of analysis can also be used for the analysis of DNA
methylation. Thus, if an enzyme that only cuts unmethylated DNA is
used, then the presence of shorter restricted DNA fragments is
indicative of the presence of unmethylated DNA. Conversely, the
presence of the longer unrestricted DNA fragments is suggestive of
the presence of methylated DNA. The interpretation of these results
would be reversed if an enzyme such as McrBC (Sutherland, et al.
1992, J Mol Biol, 225, 327-348), which cuts methylated DNA and
which does not cut unmethylated DNA, is used.
[0004] As another example, it is known that cell-free fetal DNA in
maternal plasma is of a smaller size than maternal DNA (Chan, et
al. 2004, Clin Chem, 50, 88-92; Li, et al. 2004, Clin Chem, 50,
1002-1011) (see also European Patent Application No. 03405742.2
"Noninvasive detection of fetal genetic traits"). Thus, size
fractionation by electrophoresis has been used to enrich for fetal
DNA in maternal plasma (Li, et al 2005, JAMA, 293, 843-849).
[0005] In the field of oncology, increased DNA integrity has been
observed in cancer patients (Hanley, et al. 2006, Clin Cancer Res,
12, 4569-4574; Jiang, et al. 2006, Int J Cancer, 119, 2673-2676;
Umetani, et al. 2006, J Clin Oncol, 24, 4270-4276; Wang, et al
2003, Cancer Res, 63, 3966-3968) (see also U.S. Pat. No.
6,964,846). This phenomenon is thought to be related to necrotic
changes which are associated with the tumor. DNA integrity in
cancer patients has been analyzed by separate real-time PCR assays
for different sized amplicons. Exact Sciences also has a
proprietary DNA integrity assay (for more information see the web
site exactsciences.com/applied/applied.html).
[0006] DNA size analysis has also been used for the analysis of
viral-derived nucleic acid sequences, such as the size of
Epstein-Barr virus (EBV) DNA in the plasma of patients with
nasopharyngeal carcinoma and certain lymphomas (Chan, et al. 2003,
Cancer Res, 63, 2028-2032). Size analysis has also been used for
the measurement of RNA integrity (Wong, et al. 2006, Clin Cancer
Res, 12, 2512-2516; Wong, et al 2005, Clin Chem, 51, 1786-1795).
Such analysis might be of use in clinical diagnosis, as decreased
RNA integrity has been observed in cancer patients. Also, placental
RNA in the plasma of pregnant women has been shown to be consisted
of partially degraded fragments, with a 5' preponderance (Wong, et
al 2005, Clin Chem, 51, 1786-1795). It has been suggested that
oxidative stress would decrease the integrity of such
placental-derived mRNA (Rusterholz, et al. 2007, Fetal Diagn Ther,
22, 313-317). Digital PCR followed by DNA sequencing has been used
for the analysis of the size distribution of plasma DNA in patients
with colorectal tumors (Diehl, et al. 2005, Proc Natl Acad Sci USA,
102, 16368-16373).
[0007] The present invention provides novel methods for analyzing
the size of nucleic acids, especially nucleic acids derived from
the same longer sequence, and the relative abundance of such
nucleic acids of different lengths in a test sample.
BRIEF SUMMARY OF THE INVENTION
[0008] The present invention provides a new method for analyzing
target nucleic acids in a sample. Target nucleic acids can be any
nucleic acids of varying lengths originated from the same source,
for instance, the same gene or the same chromosomal region,
although the target nucleic acids may originate from one
individual, or from multiple individuals (e.g., a sample from a
pregnant woman may contain nucleic acids from her and her fetus;
or, a sample from a transplant recipient may contain nucleic acids
from the recipient and the donor), or from more than one type of
cells (e.g. tumor cells, placental cells, blood cells). This method
comprises the following steps: first, multiple equal (or identical)
fractions are prepared from the sample. Among these equal
fractions, at least 50% of the fractions contain no more than one
target nucleic acid molecule in each one of the fractions. In some
cases, these multiple fractions are directly taken from the sample
in equal amount; in other cases, these multiple fractions are
obtained, also in equal amount, from a dilution, or less commonly a
concentration, that is first made from a portion or the entirety of
the sample. In some embodiments, the first step of the claimed
method is performed by a microfluidics system. In other
embodiments, the fractions can be prepared by binding the target
onto a solid surface, e.g., the prelude to a bridge amplification
system (website is
www.promega.com/geneticidproc/ussymp7proc/0726.html).
[0009] In some embodiments, the sample to be analyzed is from a
pregnant woman, for instance, the sample may be blood, plasma,
serum, saliva, or a cervical lavage sample. In some cases, each of
the target nucleic acids includes at least a portion of chromosome
13, 18, 21, X, or Y; or each of the target nucleic acids may
include a genetic polymorphism (e.g., single nucleotide
polymorphism (SNP)); or each of the target nucleic acids may
include at least a portion of a gene linked to a disease (e.g., the
.beta.-globin gene in .beta.-thalassemia or the cystic fibrosis
transmembrane conductance regulator gene in cystic fibrosis) or a
genetic polymorphism linked to such a gene (e.g., the SNPs
rs713040, rs10768683 and rs7480526 within the .beta.-globin gene
locus).
[0010] In other embodiments, the sample to be analyzed is from a
cancer patient. For instance, the sample may be blood, plasma,
serum, saliva, or tumor tissue. In some cases, each of the target
nucleic acids comprises at least a portion of the KRAS, erbB-2,
p16, RASSF1A gene sequence; or each of the target nucleic acids is
from a virus genome, such as the genome of Epstein Barr Virus
(EBV), Human Papilloma Virus (HPV), or Hepatitis B Virus (HBV).
[0011] Second, identical amplification reactions are carried out in
each and every one of the multiple equal fractions. In every
fraction, at least three different oligonucleotide primers are
used: at least one forward primer combined with at least two
reverse primers, or at least two forward primers combined with at
least one reverse primer. Each of the forward or reverse primers
has a distinct and definitive nucleotide sequence, designed such
that each forward/reverse primer pair permits the amplification of
different regions of the target nucleic acid sequence, producing
amplification products (i.e., amplicons) in distinct lengths. In
some embodiments, the amplification reaction is a polymerase chain
reaction (PCR) or a variation of a PCR, such as emulsion PCR,
real-time PCR, reverse transcription PCR (RT-PCR), or real-time
RT-PCR, or PCR conducted on a solid surface, e.g., bridge
amplification system (website is
www.promega.com/geneticidproc/ussymp7proc/0726.html). For RT-PCR,
there is a prior step of reverse transcription that produces a DNA
sequence from a target RNA sequence originally present in the
sample, and the DNA sequence then can be amplified. In some cases,
a fluorescent dye, such as SYBR Green or LC Green, is present in
the PCR.
[0012] When performing the amplification reactions in the second
step of the claimed method, various primers can be added to the
reaction mix either at the same time or at separate times. In other
words, different forward/reverse primer sets may be present in the
reaction all at once, permitting all possible amplicons to be
produced concurrently; or the reaction may start with at least one
primer set and later have one or more primers added to provide
additional primer set(s), allowing the initial and additional
amplification reactions to take place in a consecutive manner.
[0013] In the third step, the polynucleotide sequence or sequences
that have been produced by the amplification reaction(s) (i.e.,
amplicons) within each one of the multiple equal fractions of the
sample are detected and distinguished from each other, based on
from which forward/reverse primer set the amplicons have been
amplified. Various means are available for the detection step, such
as melting curve analysis, electrophoresis, flow cytometry, or
sequence-specific hybridization with probes attached to detectable
labels, each probe having a distinct detectable label and
specifically hybridizing with an amplified nucleotide sequence from
a pair of forward and reverse primers. In some cases, the
detectable labels are distinct fluorescent molecules. In other
cases, the third step of the claimed method is performed by primer
extension reactions, using a distinct oligonucleotide primer to
initiate a polymerization process for each distinct amplicon. The
products of the primer extension reactions are detected by mass
spectrometry or by electrophoresis. In some embodiments, the second
and third steps are performed by BEAMing.
[0014] In the fourth step, the number of fractions are counted in
separate categories according to the presence of various amplicons.
As an example, one forward primer (A) and two reverse primers (a
and b) are used in the amplification reaction. If fraction #1 is
positive for amplicon Aa, which is the amplification product from
forward primer A and reverse primer a, and also positive for
amplicon Ab, which is the amplification product from forward primer
A and reverse primer b, fraction #1 will be counted once in the
category of Aa.sup.+/Ab.sup.+. On the other hand, if fraction #2 is
positive for amplicon Aa but not Ab, then it will score one count
in the category of Aa.sup.+/Ab.sup.-. All negative reactions need
not be counted as their number can be deducted from the total
number of fractions and the number of fractions containing at least
one amplicon.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGS. 1-12 depict various schemes of primer design and means
for detecting different polynucleotide sequences following
amplification reactions involving distinct primer sets.
[0016] FIG. 13: Fetal percentages in third trimester maternal
plasma calculated using assays of different size combinations.
Panels a, b, and c show results for individual third trimester
maternal plasma samples. Panel d shows the averaged results from
the three maternal plasma samples.
[0017] FIG. 14: Fetal percentages in first trimester maternal
plasma calculated using assays of different size combinations.
Panels a, b, c, and d show results for individual third trimester
maternal plasma samples. Panel e shows the averaged results from
the three maternal plasma samples.
DEFINITIONS
[0018] The term "nucleic acid" or "polynucleotide" refers to
deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and
polymers thereof in either single- or double-stranded form. Unless
specifically limited, the term encompasses nucleic acids containing
known analogs of natural nucleotides that have similar binding
properties as the reference nucleic acid and are metabolized in a
manner similar to naturally occurring nucleotides. Unless otherwise
indicated, a particular nucleic acid sequence also implicitly
encompasses conservatively modified variants thereof (e.g.,
degenerate codon substitutions), alleles, orthologs, single
nucleotide polymorphisms (SNPs), and complementary sequences as
well as the sequence explicitly indicated. Specifically, degenerate
codon substitutions may be achieved by generating sequences in
which the third position of one or more selected (or all) codons is
substituted with mixed-base and/or deoxyinosine residues (Batzer et
al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol.
Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes
8:91-98 (1994)). The term "oligonucleotide" as used herein is
generally interchangeable with the term "polynucleotide," although
a polynucleotide sequence of relatively shorter length (e.g., no
more than 50 nucleotides, preferably no more than 30 nucleotides,
and more preferably no more than 15-20 nucleotides) is frequently
referred to as an "oligonucleotide."
[0019] The term "gene" refers to a segment of genomic DNA involved
in producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) involved in the
transcription/translation of the gene product and the regulation of
the transcription/translation, as well as intervening sequences
(introns) between individual coding segments (exons).
[0020] In this application, "target nucleic acids" being analyzed
in a sample are a collection of nucleic acid molecules of the same
origin (e.g., from the same chromosome, genomic locus, or gene,
although the molecules may come from one individual, or multiple
individuals, or more than one type of cells, such as tumor cells,
placental cells, blood cells, etc.) but in different lengths. For
instance, segments of .beta.-globin coding sequence may be present
in a test sample as "target nucleic acid molecules" of varying
lengths. Because each of these target nucleic acids contains at
least a portion of the .beta.-globin gene, primers having sequences
corresponding (or complementary) to various locations within the
.beta.-globin gene can then be used for target nucleic acid length
analysis by the claimed method. Whereas nucleic acids of varying
lengths derived from the same origin, e.g., the same gene, are
collectively referred to as "target nucleic acids," the term "1
(one) target nucleic acid molecule" is used to referred to any one
member of the target nucleic acids collection, regardless of its
length or actual sequence.
[0021] A "nucleotide sequence-specific hybridization" as used
herein refers to a means for detecting the presence and/or quantity
of a polynucleotide sequence based on its ability to form
Watson-Crick base-pairing, under appropriate hybridization
conditions, with a polynucleotide or oligonucleotide probe of a
known sequence. Examples of such hybridization methods include
Southern blotting and Northern blotting.
[0022] "Primers" as used herein refer to oligonucleotides that can
be used in an amplification method, such as a polymerase chain
reaction (PCR), to amplify a predetermined target nucleotide
sequence. In a typical PCR, at least one set of primers, one
forward primer and one reverse primer, are needed to amplify a
target polynucleotide sequence. Conventionally, when a target DNA
sequence consisting of a (+) strand and a (-) strand is amplified,
a forward primer is an oligonucleotide that can hybridize to the 3'
end of the (-) strand under the reaction condition and can
therefore initiate the polymerization of a new (+) strand; whereas
a reverse primer is an oligonucleotide that can hybridize to the 3'
end of the (+) strand under the reaction condition and can
therefore initiate the polymerization of a new (-) strand. As an
example, a forward primer may have the same sequence as the 5' end
of the (+) strand, and a reverse primer may have the same sequence
as the 5' end of the (-) strand.
[0023] The method of the present invention involves amplification
reactions using multiple sets of forward and reverse primers. These
amplification reactions may take place at the same time or
different times. For instance, an amplification reaction may take
place "concurrently" with other amplification reaction(s) when one
or more sets of primers are present in the same reaction mixture at
the same time. On the other hand, amplification reactions may take
place "consecutively" when at least one set of primers is made
complete at a different time in the reaction mixture, so that the
amplification using this particular primer set takes place at a
time different from that of the other amplification
reaction(s).
[0024] As used in this application, a "microfluidics system" refers
to a system, typically an automated system, that can manipulate
very small volume of fluid samples with required precision. A
"microfluidics system" suitable for this invention is capable of
accurately taking one or more aliquots from a fluid sample and
distributing the aliquots into separate, individually defined
compartments (e.g., individual wells on a plate). The volume of
each aliquot is generally in the range of nanoliters (10.sup.-9
liter) to picoliters (10.sup.-12 liter).
[0025] As used in this application, an "emulsion polymerase chain
reaction" refers to a polymerase chain reaction in which the
reaction mixture, an aqueous solution, is added into a large volume
of a second liquid phase that is water-insoluble, e.g., oil, and
emulsified prior to the amplification process, so that droplets of
the reaction mixture act as micro-reactors and therefore achieve a
higher concentration for a target nucleic acid in at least some of
the micro-reactors.
[0026] As used in this application, "BEAMing" (beads, emulsions,
amplification, and magnetics) refers to a modified emulsion PCR
process. At least one of the PCR primers is conjugated with a
molecule that is a partner of a known binding pair. For instance, a
biotin moiety may be conjugated to a forward primer used in the
PCR. In each reaction compartment, one or more metal beads coated
with the other member of the binding pair, e.g., streptavidin, are
provided. Upon completion of the amplification step, the amplicon
from the labeled primer is adsorbed to the coated bead(s), which in
turn can be concentrated and isolated by magnetic beads. For more
description of BEAMing, see, e.g., Diehl et al., Nat. Methods. 2006
July; 3(7):551-9.
[0027] As used in this application, a "melting curve analysis"
refers to an analysis in which the melting point of a
double-stranded DNA is determined by way of measuring changes in a
detectable signal indicative of the transition from double-stranded
state to single-stranded state of the DNA molecule. Typically, a
fluorescent dye that binds only double stranded DNA by
intercalation between the base pairs and therefore does not bind
single stranded DNA is used in the assay, such as ethidium bromide
or SYBR Green. The assay is carried out by gradually increasing the
temperature of a mixture of DNA and a labeling material (e.g., SYBR
Green) while monitoring the level of the label signal. When the DNA
strands separate or "melt," a quick and significant change in the
signal output occurs. The melting point temperature can thus be
determined. Because the melting point of a double-stranded DNA
molecule is determined by factors including length, nucleotide
sequence, and how well two strands match, this assay can be used
for discriminating DNA molecules of different lengths and
sequences.
[0028] A "PCR on a solid phase" is a type of polymerase chain
reaction that yields amplification products immobilized on a solid
surface or support. "Bridge amplification" is an example. It is a
technology that uses primers bound to a solid phase for the
extension and amplification of solution phase target nucleic acid
sequences. The name refers to the fact that during the annealing
step, the extension product from one bound primer forms a bridge to
the other bound primer. All amplified products are covalently bound
to the surface, and can be detected and quantified without
electrophoresis. In one study, bridge systems were developed to
amplify and detect single nucleotide sequence polymorphisms.
Primers carrying 5'-amines were covalently attached to silica,
polymethylmethacrylate, or polystyrene bead supports and used in
place of solution phase primers under standard PCR reaction
conditions. Amplification reactions were monitored by the
incorporation of .sup.32P-labeled deoxynucleotide triphosphates
into support-bound form. The presence of the correct product was
confirmed by restriction analysis of the solid phase products. In
another variation of this theme, the amplification reactions are
detected by hybridization with one or more fluorescent probes
labeled with one or more types of fluorescent reporters.
DETAILED DESCRIPTION OF THE INVENTION
[0029] This invention provides a method for the quantitative
measurement of nucleic acid molecules of different sizes by the use
of single molecule analysis. Thus, a sample containing nucleic
acids is diluted or fractionated to an extent such that many of the
test wells will not contain any target nucleic acid molecule. For
wells containing the target nucleic acid molecules, most of them
will just contain a single one. The nucleic acid molecules
contained in the reaction wells will then be amplified by a nested
series of primers amplifying target sequences of different sizes,
such as a series of polymerase chain reactions (PCR) utilizing
several sets of forward and reverse primers. Following
amplification, wells containing a long nucleic acid template will
contain the longest amplicon plus all of the smaller ones. A well
containing a shorter nucleic acid template will produce one or more
amplicons, up to the size delineated by the template molecule.
Thus, by counting the number of wells containing each combination
of amplicons, a determination of the size distribution of nucleic
acid molecules in the original sample can be achieved.
[0030] One configuration of this analysis is indicated in the
diagram of FIG. 1. This configuration consists of 3 PCR primers:
Primer 1, Primer 2 and Primer 3. Primer 1 and Primer 3 will form a
long PCR product. Primer 2 and Primer 3 will form a short PCR
product. The sizes of the long and short PCR products can be
changed from application to application. In one version of this,
the long product can be 200 bp while the short product can be 80
bp. The long product can also for example be 100 bp, 150 bp, 250
bp, 300 bp, 350 bp or 450 bp. The short product can be 70 bp, 60
bp, 50 bp, 40 bp, 30 bp or 25 bp in length. Different combinations
of sizes of the long and short products are possible and would be
used for different applications. Thus, the three primers will be
used simultaneously to amplify the diluted or fractionated nucleic
acid sample mentioned to above in a digital fashion (Vogelstein and
Kinzler, 1999, Proc Natl Acad Sci USA, 96, 9236-9241) (see also
U.S. Pat. Nos. 6,440,706, 6,753,147, and US Patent Application
Publication Nos. 20050130176, 20060046258 (especially section 0040)
and 20040096892).
[0031] The present invention is different from that of Diehl et al.
(Proc Natl Acad Sci USA, 102, 16368-16373, 2005), who used digital
PCR followed by DNA sequence to determine the size of plasma DNA
fragment in separate PCRs but did not obtain or analyze multiple
amplicons of different sizes present in one single amplification
reaction.
[0032] The method of this invention can be used for both DNA and
RNA targets, with DNA polymerase being directly used for DNA
targets. With RNA targets, a reverse transcription step will need
to be first performed. Thus, RNA targets can be amplified by either
a reverse transcription step followed by a DNA amplification step
using different enzymes, or to use an enzyme, such as the Thermus
thermophilus (Tth) polymerase that possesses both reverse
transcriptase and DNA polymerase functions (Myers and Gelfand 1991,
Biochemistry, 30, 7661-7666).
[0033] If a well contains a nucleic acid fragment that is long and
contains the sequence between Primer 1 and Primer 3, then it would
have both the PCR products from Primer 1/Primer 3 and Primer
2/Primer 3. On the other hand, if a well contains a short nucleic
acid fragment containing just the sequence encompasses Primer 2 and
Primer 3, then only the PCR product from Primer 2/Primer 3 will be
formed.
[0034] To detect which product(s) has (have) been formed in each
well, a number of methods can be used. One example is to use
agarose gel or capillary electrophoresis. Another method is to add
a fluorescent dye, e.g., SYBR Green or LC Green, which would bind
to double stranded DNA and then to perform melting curve analysis
(Ririe, et al. 1997, Anal Biochem, 245, 154-160; Wittwer, et al.
2003, Clin Chem, 49, 853-860). Melting curve analysis can be used
to discriminate the products produced by Primer 1/Primer 3 and by
Primer 2/Primer 3.
[0035] Yet another method is to add two fluorescent probes to the
system, as illustrated in FIG. 2. The two probes in this scheme,
labeled with different fluorescent reporters, can be TaqMan probes,
molecular beacons, or other probes well-known to those in the art
for performing real-time PCR (Heid, et al. 1996, Genome Res, 6,
986-994; Lo, et al. 1998, Am J Hum Genet, 62, 768-775). Thus, a
well containing a nucleic acid fragment at least as long as that
delineated by Primer 1 and Primer 3 will produce the long PCR
product (produced by Primer 1/Primer 3) and will contain
fluorescence signals from both Probe 1 and Probe 2. On the other
hand, a well containing a nucleic acid fragment at least as long as
that delineated by Primer 2 and Primer 3, but shorter than that
delineated by Primer 1 and Primer 3, will generate the short PCR
product (produced by Primer 2/Primer 3) and will contain only the
fluorescence signal from Probe 2. Such real-time digital PCR
analysis can be performed in any of the machines well-known to
those in the art, such as an Applied Biosystems 7900 Sequence
Detector, or a real-time PCR system with a microfluidics chip,
e.g., the Fluidigm BioMark System (Warren, et al. 2006, Proc Natl
Acad Sci USA, 103, 17807-17812), or the OpenArray Technology of
BioTrove (website www.biotrove.com/technologies/thru/, and
Morrison, et al., 2006, Nucleic Acids Res 34: e123).
[0036] Another method for scoring the wells is illustrated in FIG.
3. For this configuration, the digital PCR is first conducted using
Primer 1, Primer 2 and Primer 3. After that the amplification
products from each well are then subjected to a primer extension
reaction using Extension Primer 1 and Extension Primer 2, such as
using the homogenous MassEXTEND assay from Sequenom (Ding and
Cantor 2003, Proc Natl Acad Sci USA, 100, 7449-7453). For the
extension reaction, dideoxynucleotide triphosphate with or without
deoxynucleotide triphosphate is used. In one configuration,
Extension Primer 1 and Extension Primer 2 will both be extended if
the long PCR product (produced by Primer 1/Primer 2) is present. In
this configuration, only Extension Primer 2 will be extended if
only the short PCR product (produced by Primer 2/Primer 3) is
present. The extension products from each well will then be
analyzed such as using matrix-assisted laser desorption/ionization
time-of-flight mass spectrometry (Ding and Cantor 2003, Proc Natl
Acad Sci USA, 100, 7449-7453). Extension Primer 1 and Extension
Primer 2 are designed in such a way that the extended versions of
these primers are easily distinguishable on the mass spectrometer.
In other embodiments, the extension primers can be replaced with
sequencing primers, with the respective amplicons distinguished by
sequencing reactions.
[0037] The above configurations are for illustrative purposes only,
using the scenario of measuring the amount of nucleic acid
fragments of two different sizes. However, this method can be used
for measuring the concentration of nucleic acid fragments of 3 or
more size categories. FIG. 4 illustrates this general concept. In
this configuration, multiple forward primers are used: Primer 1,
Primer 2, Primer 3 . . . to Primer X. One reverse primer, Primer R,
is used. If we have a piece of template nucleic acid which is
longer than the largest amplicon, namely, that delineated by Primer
1/Primer R, then all PCR products will be produced. However,
template nucleic acids which are shorter than that will only
produce a subset of the amplicons, namely, those shorter than or
equal to the length of the template. By counting the number of
wells with each of these various types of PCR product combinations,
the size distribution of the original nucleic acid sample can be
determined.
[0038] The detection of the PCR products in this multiple primer
configuration (i.e., Primers 1 to X, and Primer R) can be performed
with the use of fluorescent probes, each labeled with a different
fluorescence reporter or combinations of fluorescence reporters.
See FIG. 5.
[0039] Multiple primer extension assays can also be used to detect
these multiple PCR products, such as using the homogenous
MassEXTEND assay from Sequenom (Ding and Cantor 2003, Proc Natl
Acad Sci USA, 100, 7449-7453). For the extension reaction,
dideoxynucleotide triphosphate with or without deoxynucleotide
triphosphate is used. In one configuration, all of the extension
primers will be extended if the long PCR product (produced by
Primer 1/Primer R) is present (see diagram below). In this
configuration, with progressively shorter template nucleic acid,
only the extension primers targeting the respectively PCR products
will be extended. The extension products from each well will then
be analyzed using either electrophoresis OR by using mass
spectrometry, e.g., matrix-assisted laser desorption/ionization
time-of-flight mass spectrometry (Ding and Cantor 2003, Proc Natl
Acad Sci USA, 100, 7449-7453). The extension primers are designed
in such a way that their extension products are easily
distinguishable on the mass spectrometer or electrophoresis. This
scheme is illustrated in FIG. 6. In other embodiments, the
extension primers can be replaced with sequencing primers, with the
respective amplicons distinguished by sequencing reactions.
[0040] In all of the above configurations, we have illustrated the
principle of this invention with the use of two or more primers in
one orientation; and only a single primer in the reverse
orientation. However, it is also possible to practice this
invention using more than one primer in the reverse orientation.
One such configuration is illustrated in FIG. 7. One advantage of
having multiple primers in both orientations is that for a given
number of primers, the number of possible PCR products, and thus
the size categories, is higher than in the scenario when only one
primer is used in the reverse orientation. For example, with a
total of 4 primers, in which 2 are in one orientation and 2 are in
the reverse orientation (as illustrated above), 4 size categories
are possible (one longest, one shortest and two intermediate
categories (which can be of different sizes)). On the other hand,
if 3 primers are in one orientation and only one is in the reverse
orientation, then only 3 size categories would be possible.
[0041] Similar to the configurations involving a single primer in
the reverse orientation, for configurations in which more than one
primer are used in both orientations, the detection of the various
PCR products can be performed by electrophoresis, fluorescence
probes and primer extension followed by mass spectrometry.
Furthermore, other variants of digital PCR can be performed in the
fashion described in this invention, including: nanoliter PCR
microplate systems (Morrison, et al. 2006, Nucleic Acids Res, 34,
e123), emulsion PCR (Dressman, et al. 2003, Proc Natl Acad Sci USA,
100, 8817-8822), and polony PCR (Mitra and Church 1999, Nucleic
Acids Res, 27, e34).
EXAMPLES
[0042] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of non-critical parameters that could
be changed or modified to yield essentially the same or similar
results.
Example 1
DNA Size Analysis in Buffy Coat Sample and Plasma
[0043] This example illustrates the use of the present invention
for comparing the size of DNA in buffy coat and plasma. Plasma DNA
are short in nature as previously reported (Chan et al, supra)
while buffy coat DNA is genomic DNA and thus is expected to be
longer than plasma DNA. Two plasma samples and one buffy coat
sample were obtained from male subjects. These DNA samples should
have both X and Y chromosomal sequences. In this example, the ZFX
and ZFY genes were targeted. The PCR primers and extension primers
have the sequences as tabulated below:
TABLE-US-00001 Primer sequences: 213 bp-forward PCR
5'-ACGTTGGATGAACTGTGCATAACTTTGTTCCTGA-3' primer (Primer A) 82
bp-forward PCR 5'-ACGTTGGATGTCATTCCTGAGCAAGTGCTG-3' primer (Primer
B) Reverse PCR primer 5'-ACGTTGGATGGCTAAAACATCATCTGGGAC-3' (Primer
C) 213 bp-extension 5'-AACATCTTGGATTACAACTG-3' primer (L) 82
bp-extension 5'-TCATCTGGGACTGTGCA-3' primer S
[0044] ZFX and ZFY are homologous genes and therefore are
co-amplifiable by the same primers. In our assay, the two genes are
distinguished by the extension products of the S extension primer.
The configuration of this assay is illustrated in FIG. 8.
[0045] The buffy coat DNA sample and the two plasma DNA samples
were diluted to single molecule level. The amount of DNA
corresponding to one template per well was determined by serially
diluting the DNA samples and testing with the real-time PCR assay
for the .beta.-globin gene in a 96-well format. The reaction was
set up using 2.times. TaqMan Universal PCR Master Mix (Applied
Biosystems) in a reaction volume of 5 .mu.L. 300 nM of each primer
and 200 nM of the probe were used in each reaction. The primer
sequences were 5'-GTGCACCTGACTCCTGAGGAGA-3' and
5'-CCTTGATACCAACCTGCCCAG-3' and the probe sequence was
5'-(VIC)AAGGTGAACGTGGATGAAGTTGGTGG(TAMRA)-3', where TAMRA is
6-carboxytetramethylrhodamine. The reaction was carried out in an
ABI PRISM 7900HT Sequence Detection System (Applied Biosystems)
with the reaction condition of 50.degree. C. for 2 min, 95.degree.
C. for 10 min, followed by 50 cycles of 95.degree. C. for 15 s and
60.degree. C. for 1 min.
[0046] The size of the template DNA was determined by digital PCR.
DNA was amplified in a 5-uL PCR reaction. Each reaction contained
1.25.times. HotStar Taq PCR buffer with 1.875 mM MgCl.sub.2
(Qiagen), an additional 1.625 mM MgCl.sub.2 (Qiagen), 50 .mu.M each
of dATP, dGTP, and dCTP, 100 .mu.M dUTP (Applied Biosystems), 100
nM each of the forward primers for the 213 bp- and the 82
bp-amplicon (Integrated DNA Technologies), 200 nM of the reverse
primer, and 0.1 U of HotStar Taq Polymerase (Qiagen). The PCR
reaction was initiated at 95.degree. C. for 15 min, followed by
94.degree. C. for 20 s, 55.degree. C. for 30 s, and 72.degree. C.
for 1 min for 50 cycles, and a final incubation at 72.degree. C.
for 3 min. 384 digital PCRs were carried out for the buffy coat
sample and 192 digital PCRs were carried out for each of the plasma
DNA sample.
[0047] PCR products were subjected to shrimp alkaline phosphatase
treatment with 0.12 .mu.L of shrimp alkaline phosphatase
(Sequenom), 0.068 .mu.L of MassARRAY.TM. Homogenous MassEXTEND.TM.
(hME) buffer (Sequenom), and 0.612 .mu.L of water. The mixture was
incubated at 37.degree. C. for 40 min followed by 85.degree. C. for
5 min. hME assays were then performed. Each reaction contained 463
nM of the extension primer for the 213 bp-amplicon, 771 nM of the
extension primer for the 82 bp-amplicon, 1.15 U of Thermosequenase
(Sequenom), and 64 .mu.M each of ddATP, ddCTP, ddTTP, and dGTP
(Sequenom). The reaction conditions were 94.degree. C. for 2 min,
followed by 94.degree. C. for 5 s, 52.degree. C. for 5 s, and
72.degree. C. for 5 s for 80 cycles.
[0048] The results are tabulated below. L denotes the presence of
the extension products by the extension primer L, indicating the
presence of a long PCR product of 213 bp. X and Y denote the
presence of the X and Y extension products, respectively, from
extension primer S. Thus, if either X or Y signal is present alone,
then it would indicate the presence of template DNA shorter than or
equal to 82 bp. On the contrary, the presence of the L extension
product should be accompanied by either an X or a Y signal, denoted
as LX or LY in the table. If just an L signal is present, then it
would mean that either the short PCR by Primer B/Primer C or the
extension reaction by S has failed. As indicated in the table, this
has not happened for any of the wells.
TABLE-US-00002 Total Number of Well Wells with Number No Signals L
X Y LX LY LXY Buffy coat DNA 384 235 0 1 5 62 60 21 Plasma DNA 1
192 112 0 22 30 5 11 4 Plasma DNA 2 192 131 0 19 19 10 8 2
[0049] The above data have shown that the buffy coat sample
contained predominantly DNA molecules at least as long as 213 bp,
as most of the wells had either a LX or LY combination of signals.
Only 6 wells contained either the short X or Y signal. The 21 LXY
wells indicate that these wells contain more than one molecule, at
least one of which was a long one (either a long X or a long Y
molecule).
[0050] Conversely, the two plasma samples contained predominantly
sequences shorter than 213 bp, as evidenced by the preponderance of
X only and Y only signals.
Example 2
Size Analysis of DNA in the Plasma of Pregnant Women by Digital
PCR
[0051] DNA in the plasma of a pregnant woman is predominantly
derived from maternal cells, with a small proportion being derived
from the fetus (Lo, et al. 1998, Am J Hum Genet, 62, 768-775). When
studying the total DNA as a whole, the DNA in the plasma of
pregnant women is larger than that in the plasma of non-pregnant
women (Chan, et al. 2004, Clin Chem, 50, 88-92). On the other hand,
when one compares the fetal-derived and maternal-derived DNA in
maternal plasma, then the fetal-derived DNA is generally of a
smaller size than that derived from the mother (Chan, et al. 2004,
supra).
[0052] Size analysis by the digital PCR-based approach described
here allows one to measure the relative concentrations of DNA of
different sizes in maternal plasma. The principle of this approach
is illustrated by using the model system in which a pregnant woman
is carrying a male fetus. The fetal DNA contains X and Y
chromosomal sequences; while the maternal DNA contains X, but not
Y, chromosomal sequences. The ZFX gene is used as a marker of the X
chromosome; while the ZFY gene is used as a marker of the Y
chromosome. The configuration of this system is exactly the same as
that described in Example 1. The detection of the long and short
PCR products is carried out by primer extension followed by mass
spectrometry. The short PCR products can be further classified into
those that are derived from the X and those that are derived from
the Y chromosome. The primer extension products of the X- and
Y-derived products can be distinguished by their masses.
[0053] As described in Example 1, different types of signals can be
expected from this digital PCR system. Thus, the presence of L, the
extension product of the long PCR product, is indicative of the
presence of template DNA as least as long as the sequence
delineated by Primer A and Primer C (or at least as long as the
sequence amplifiable by Primer A and Primer C, which can be
slightly shorter than that delineated by the two primers). The
presence of L in a particular well will be expected to be
accompanied by either X or Y or both (if there is more than one
molecule in a particular well). On the other hand, if a well
contains either the signal of X or Y, but no L, then this is
indicative of the presence of template molecule that is shorter
than the sequence delineated by Primer A and Primer C, but longer
than that delineated by Primer B and Primer C.
[0054] As fetal DNA is enriched in the shorter DNA fragments, the
proportion of wells positive for a Y (i.e., fetal) signal but
without the L signal is expected to be higher than the
corresponding proportion of wells positive for both the Y and L
signals. In other words, this invention will allow one to
selectively focus on a subset of wells containing template
molecules of a particular size.
[0055] To illustrate the above concepts, an experiment was carried
out using this system on a maternal plasma sample. The results are
tabulated below:
TABLE-US-00003 Total Number of Well Wells with Number No Signals L
X Y LX LY LXY M2891P 384 197 0 97 16 65 1 5
[0056] As can be seen, most of the Y chromosome-containing (i.e.,
fetal DNA) wells contained short template DNA, as evidenced by the
fact that they contained the Y signal indicative of short DNA, but
not the LY signal combination indicative of long DNA. The
relatively large number of wells containing the LX signal
combination mainly contained DNA derived from the pregnant women
(i.e., non-fetal DNA). As an illustration of the usefulness of size
analysis by digital PCR, for case M2891P, without the size
analysis, 22 of the 384 wells (i.e., 5.7%) contained Y-specific
(i.e., fetal) signals. On the other hand, when one looks at the
wells containing short template DNA (i.e., those with either the X
or the Y signals; but no L signal), the proportion of wells with
Y-specific signals increased to 16/(16+97), i.e., 14.1%.
[0057] This method has the advantage that one can easily change the
size window of interest. For example, further increase in the wells
showing a fetal-specific signal can be achieved by further reducing
the size of short PCR, e.g., to 60 bp, to 50 bp, or to 40 bp and
below. Similarly, one can also readily change the size of the long
PCR to between 150 bp and 200 bp; or to between 100 bp and 149
bp.
[0058] This approach has considerable advantage over those
previously reported, such as electrophoresis (Li, et al. 2004, Clin
Chem, 50, 1002-1011), as the electrophoresis step as well as the
post-electrophoresis harvesting of the DNA are potentially
contamination-prone.
[0059] The method of the present invention can work in a
synergistic manner with existing methods for enhancing the
fractional concentrations of fetal DNA in maternal plasma, e.g.,
electrophoresis (Li, et al. 2004, Clin Chem, 50, 1002-1011) and the
use of formaldehyde or other additives in suppressing the
concentration of maternal-derived DNA in maternal plasma (Dhallan,
et al. 2004, JAMA, 291, 1114-1119).
Example 3
Methylation Analysis by Methylation-Sensitive Restriction Enzyme
Treatment
[0060] Some restriction enzymes will cleave or not cleave their
target sequences dependent on the DNA methylation status at or
around the target sequence. Most methylation-sensitive restriction
enzymes will cut an unmethylated sequence but will not cut a
methylated sequence. There is also a relative small subset of
enzymes, such as McrBC which will cut methylated sequences, leaving
unmethylated sequences intact (Sutherland, et al. 1992, J Mol Biol,
225, 327-348).
[0061] In either case, the restricted DNA fragment will be shorter
than the uncut template. Thus, the present invention can be used to
obtained quantitative information regarding the cut and uncut DNA
molecules.
[0062] In this example, the gene SERPINB5 coding for maspin is used
as an example (Dokras, et al. 2002, Placenta, 23, 274-280).
SERPINB5 is hypomethylated in the placenta and hypermethylated in
the blood cells of pregnant women (Chim, et al 2005, Proc Natl Acad
Sci USA, 102, 14753-14758).
[0063] In the scheme shown in FIG. 9, two forward primers (primer 1
and primer 2) and one reverse primer are designed. One of the
forward primers (primer 1) is upstream of a restriction site for a
methylation-sensitive restriction enzyme, such as the HpaII site at
position -178 of the SERPINB5 gene. When plasma DNA is cut by the
methylation-sensitive restriction enzyme, such as HpaII as
illustrated in the diagram, the maternal blood cell DNA, which is
hypermethylated, will be uncut. On the other hand, for fetal
(placental) DNA which is hypomethylated, the site will be cut by
HpaII. For digital PCR analysis of maternal plasma DNA using this
strategy, maternal plasma DNA will be extracted as described (Lo,
et al. 1998, Am J Hum Genet, 62, 768-775), then the plasma DNA will
be digested with HpaII. The HpaII-treated plasma DNA will then be
quantified by real-time PCR using primer 2 and primer 3, plus a
TaqMan probe in between the two primers. Then, the HpaII-treated
plasma DNA will be diluted such that for the subsequent digital PCR
analysis, on average each reaction well will only contain one
SERPINB5 molecule which could be amplified using primer 2 and
primer 3. Then, the diluted HpaII-treated plasma DNA will be
subjected to digital PCR analysis using the combination of primer
1, primer 2 and primer 3. Two TaqMan or hybridization probes will
also be added, one targeting a sequence between primer 2 and primer
3, and the other one straddling the HpaII restriction site between
primer 1 and primer 2. The two probes will be labeled with
different fluorescent reporters, e.g., FAM for one and VIC for the
other. If a well contains a molecule containing the maternal
SERPINB5 sequence, then signals from both probes will be present.
On the other hand, if a well contains a molecule containing the
fetal SERPINB5 sequence, then only the signal from the probe
between primer 2 and primer 3 will be present. Thus, the counting
of the number of wells containing the fetal pattern of signals will
allow us to count the number of fetal SERPINB5 molecules.
[0064] To illustrate the practical utility of the above concepts,
the following example was realized in the laboratory.
[0065] Assay design. The long and short SERPINB5 assays involve the
use of two forward primers (Mpn_Forward L and Mpn_Forward S) and
one common reverse primer (Mpn_Reverse). The detection of the long
and short PCR products depends on the probes Mpn_Probe L and
Mpn_Probe S, respectively. A methylation-sensitive restriction
endonuclease digestion site is located between Mpn_Probe L and
Mpn_Forward S. As a result, both PCR products would be expected to
be detectable in mock-digested DNA samples. With the addition of
the restriction enzyme, the detection of the long signal would be
expected to decrease for the hypomethylated DNA samples. The
sequences for the primers and probes are listed as below:
TABLE-US-00004 Primers and probes sequences Mpn_Forward L
5'-CGTGTCTGAGAAATTTGTAGTGTTACTATC-3' Mpn_Forward S
5'-CGGTCCTGCGTGGGCC-3' Mpn_Reverse 5'-GCTGTGAGTTACATGCATACGTACA-3'
Mpn_Probe L 5'-VIC-CACATTACTTTTATTTCATC(MGB)-3' Mpn_Probe S
5'-6FAM-TTGCCGTACGCATGT(MGB)-3'
[0066] Methylation-sensitive restriction enzyme digestion. The
methylation-sensitive restriction endonuclease, HpaII (New England
Biolabs), was used to digest the maternal blood cell DNA and the
placental DNA samples at 37.degree. C. for 16 hours in a 20 .mu.L
reaction mixture. 100 .mu.g of each DNA sample was digested with 20
U of the HpaII enzyme. A mock-digested aliquot was included for
each sample. For mock-digestion, an equal amount of DNA was
subjected to the same digestion condition without the addition of
enzyme.
[0067] Real-time PCR on the 7900 platform. The long and short
SERPINB5 assays were performed as duplex on the mock-digested and
HpaII-digested DNA samples from two pairs of maternal blood cells
and placentas. Each 5 .mu.L real-time PCR included 1.times.
TaqMan.RTM. Universal PCR Master Mix (Applied Biosystems), 62.5 nM
each of the TaqMan.RTM. probe L and probe S (Applied Biosystems),
900 nM each of the forward primer L (Integrated DNA Technologies)
and the common reverse primer (Integrated DNA Technologies), and
450 nM forward primer S (Integrated DNA Technologies). A total of
32 replicates were performed for each sample at an input of 6.25 pg
DNA per reaction. The thermal profile was 50.degree. C. for 2 min,
95.degree. C. for 10 min, followed by 50 cycles of 95.degree. C.
for 15 s, and 60.degree. C. for 1 min.
[0068] Real-time PCR on the Fluidigm platform. Digital PCR for the
SERPINB5 promoter sequence was performed on the mock-digested and
HpaII-digested DNA samples from one pair of maternal blood cell and
placenta. For each panel (equivalent to 765 reaction wells),
1.times. TaqMan.RTM. Universal PCR Master Mix (Applied Biosystems),
31.25 nM each of the TaqMan.RTM. probe L and probe S (Applied
Biosystems), 900 nM each of the forward primer L (Integrated DNA
Technologies) and the common reverse primer (Integrated DNA
Technologies), and 450 nM forward primer S (Integrated DNA
Technologies) were mixed together with 3.5 ng of DNA sample. The
thermal profile was 50.degree. C. for 2 min, 95.degree. C. for 10
min, followed by 40 cycles of 95.degree. C. for 15 s, and
58.degree. C. for 1 min.
Results
[0069] Real-time PCR on the 7900 platform. Detection of the long
and short SERPINB5 molecules was at similar levels for the maternal
blood cell DNA with and without enzyme digestion. The level of
detectable long DNA molecules after enzyme digestion decreases for
the two placenta samples, while the level of short DNA remained
similar with and without enzyme digestion.
TABLE-US-00005 Total well Mock digestion HpaII digestion number
Long Short Long Short Maternal blood cell 1 32 25 25 28 29 Maternal
blood cell 2 32 16 27 23 29 Placenta 1 32 18 24 6 19 Placenta 2 32
22 25 8 30
[0070] Real-time PCR on the Fluidigm platform. Detection of the
long and short SERPINB5 molecules was at similar levels for
maternal blood cell DNA with and without enzyme digestion. The
number of detectable long DNA molecules after enzyme digestion
decreases for the placenta sample, while the number of short DNA
remained similar with and without enzyme digestion.
TABLE-US-00006 Total well Mock digestion HpaII digestion number
Long Short Long Short Maternal blood cell 765 351 358 330 339
Placenta 765 262 269 99 275
[0071] Using this principle, one can also develop a system for
detecting fetal DNA molecules which bear an opposite methylation
state to that of SERPINB5. One of such DNA target is the RASSF1A
gene which is hypermethylated in the placenta but hypomethylated in
maternal blood cells (Chan, et al. 2006, Clin Chem, 52, 2211-2218;
Chiu, et al. 2007, Am J Pathol, 170, 941-950), namely for the
counting of fetal-derived RASSF1A sequence in maternal plasma.
Following cutting with a restriction enzyme which cuts the
unmethylated maternal RASSF1A while leaving the fetal sequence
intact, the restriction products can be analyzed using the digital
PCR-based size analysis system described in this invention. The
fetal pattern in this case would be given by the presence of a two
probe signals in a particular well.
[0072] It will be obvious to those of skill in the art that a
multiplex PCR system combining both the SERPINB5 and RASSF1A
systems would be possible, with the four fluorescent probes each
labeled using a different reporter. Alternatively, the SERPINB5 and
RASSF1A systems could be separately applied in different digital
PCR analyses. In either scenario, the number of wells positive for
just fetal-derived SERPINB5 sequences will be compared to the
number of wells positive for just fetal-derived RASSF1A sequences.
The ratio, or difference in these numbers will give an indication
as to whether the fetus has trisomy 18. An increased ratio of these
numbers (SERPINB5/RASSF1A) is indicative of trisomy 18. Sequential
Probability Ratio Test (Zhou et al 2001, Nat Biotechnol, 19, 78-81;
Zhou, et al. 2002, Lancet, 359, 219-225) or other statistical
procedures well-known to those of skill in the art can be used to
provide statistical evidence for the confidence with which a
diagnosis of trisomy 18 can be made.
[0073] The scheme outlined in FIG. 9 can be used for detecting
other fetal-specific sequence in maternal plasma, as long as an
enzyme cleavage site (such as those for methylation-sensitive
restriction enzyme; but other enzymes can also be used) can be
found which can differentiate fetal from maternal nucleic
acids.
[0074] Apart from detecting the different PCR products using
fluorescent probes, it is also possible to use primer extension
reactions, followed by mass spectrometry, as illustrated in
Examples 1 and 2.
Example 4
Detection of Fetal Chromosomal Aneuploidy from Maternal Plasma
[0075] In a separate study, we have recently demonstrated the
feasibility of using digital relative chromosome dosage (RCD) for
detecting the presence of aneuploid DNA in a mixture of aneuploid
and euploid DNA (Lo YMD, Lun FMF, Chan KCA, Tsui NBY, Chong K C,
Lau T K, Leung T Y, Zee B C Y, Cantor C R, Chiu R W K. Digital PCR
for the molecular detection of fetal chromosomal aneuploidy. Proc.
Natl. Acad. Sci. U.S.A. 104:13116-13121, 2007). One example of
aneuploid DNA is that obtained from a subject with trisomy 21 (Down
syndrome). One example of a mixture of aneuploidy and euploid DNA
is maternal plasma DNA obtained from a pregnant woman carrying a
fetus with trisomy 21.
[0076] For digital RCD analysis, the higher the proportion of fetal
DNA, the smaller the number of digital PCR assays that would be
needed to detect the presence of aneuploid DNA. Hence, the use of
the present invention would allow us to focus on a subpopulation of
DNA molecules in maternal plasma of a particular size range, in
which the fractional concentration of fetal-derived DNA molecules
is higher than that in the total DNA in maternal plasma.
[0077] As an illustration of the use of the present invention for
the detection of fetal chromosomal aneuploidy from maternal plasma,
the design depicted in FIG. 10 is used. Primer 1, Primer 2, and
Primer 3 targets paralogous loci (Deutsch, et al. 2004, J Med
Genet, 41, 908-915), such as a pair of loci located on chromosome
21 and chromosome 1. In the latter example, the loci on chromosome
21 and chromosome 1 have significant homology to one another, with
differences in a relatively small number of nucleotides. Thus,
Primer 1, Primer 2 and Primer 3 are designed such that the two
paralogs have virtually identical sequences. The two primer pairs:
(1) Primer 1/Primer 3 (long PCR product) and (2) Primer 2/Primer 3
(short PCR product) would both amplify the chromosome 21 and
chromosome 1 paralogs. Extension Primer 1 is designed such that it
would bind to and extend the Primer 1/Primer 3 PCR product from
either paralog. It is not essential that the extension products of
Extension Primer 1 from each paralog be distinguishable from each
other. Extension Primer 2 is designed to bind to the PCR product of
both paralogs. The target site of Extension Primer 2 is designed
such that following extension, the extension products from the
chromosome 21 and chromosome 1 paralogs are distinguishable from
one another.
[0078] The first step of the analysis is the dilution of the sample
DNA to an extent such that most reaction wells would be amplifying
either no or just a single template molecule. Then, PCR
amplification using Primer 1, Primer 2 and Primer 3 is carried out.
Then, mass extension reaction using Extension Primer 1 and
Extension Primer 2 is carried out. The extension products, if any,
from each well are then analyzed by mass spectrometry, such as
using matrix-assisted laser desorption/ionization mass spectrometry
(Ding and Cantor 2003, Proc Natl Acad Sci USA, 100, 7449-7453). The
mass spectra from each well will inform us what template molecule
it contains prior to amplification. Thus, any well showing the
extension product of Extension Primer 1 indicates that it contains
a template DNA molecule of a length as least as long as that
delineated by Primer 1 and Primer 3. A well containing the
Extension Primer 1 product would also be expected to contain the
extension product of Extension Primer 2.
[0079] Conversely any well containing just the extension product,
if any, Extension Primer 2; but not the extension product from
Extension Primer 1 indicates that it contain a short DNA template.
A short DNA template is one which is at least as long as the
sequence delineated by Primer 2 and Primer 3, but shorter than the
sequence delineated by Primer 1 and Primer 3. The mass of the
extension product of Extension Primer 2 would indicate whether the
product is derived from the chromosome 21 or the chromosome 1
paralog.
[0080] As fetal DNA in maternal plasma is relatively shorter than
the maternally-derived counterpart (Chan, et al. 2004, Clin Chem,
50, 88-92), for noninvasive prenatal diagnosis of fetal trisomy 21,
it would be advantageous to focus the analysis on the subset of
wells showing just the Extension Primer 2 products, but no
Extension Primer 1 products. The proportion of such wells
containing fetal-derived template DNA would be higher than if all
wells are considered, without consideration to the results of such
size analysis. This focused subset of wells can be further
subdivided into those showing a chromosome 21 signal and those
showing a chromosome 1 signal. If the fetus has trisomy 21, then
the number of wells showing a chromosome 21 signal should be
overrepresented in comparison with that of wells showing a
chromosome 1 signal. Statistical evidence of such
overrepresentation can be obtained by a number of methods,
including the Sequential Probability Ratio Test (SPRT) (Zhou, et
al. 2001, Nat Biotechnol, 19, 78-81; Zhou, et al. 2002, Lancet,
359, 219-225; Lo Y M D, Lun F M F, Chan K C A, Tsui N B Y, Chong K
C, Lau T K, Leung T Y, Zee B C Y, Cantor C R, Chiu R W K. Digital
PCR for the molecular detection of fetal chromosomal aneuploidy.
Proc. Natl. Acad. Sci. U.S.A. 104:13116-13121, 2007), the
false-discovery rate (El Karoui, et al. 2006, Stat Med, 25,
3124-3133), etc.
[0081] The above example of using paralogous sequences as targets
is only described by way of example, and not as limitation of the
present invention. This present invention can be practiced using
separate primers and extension primers for the chromosome 21 and
the reference chromosome. In this configuration, three primers each
will be used for chromosome 21 and the reference chromosome. Indeed
more than three primers can be used, for covering a range of sizes
for digital analysis. Furthermore, this approach can be used to
detect other chromosome aneuploidies, besides trisomy 21, by
targeting the chromosome involved in the aneuploidy concerned,
e.g., chromosome 18 in trisomy 18, chromosome 13 in trisomy 13,
chromosome X and chromosome Y for the sex chromosome
aneuploidies.
[0082] Apart from digital RCD, the present invention is also useful
to enhance the robustness of the other approaches which have been
described for the detection of fetal chromosomal aneuploidies from
maternal plasma, such as the use of allelic ratios of single
nucleotide polymorphisms (SNPs) present on the potentially
aneuploid and a reference chromosome (Dhallan, et al. 2007, Lancet,
369, 474-481) and the use of allelic ratios of fetal-specific
nucleic acid species, e.g., using fetal-specific methylation
signatures (Tong, et al. 2006, Clin Chem, 52, 2194-2202).
Example 5
Size Analysis of Viral Nucleic Acids
[0083] The digital sizing technology described in this invention
can be used for size analysis of viral nucleic acids. Such size
analysis would provide diagnostic and monitoring information for
diseases associated with viral infections, including but not
limited to cancers associated with viral infections. Examples of
the latter include Epstein-Barr virus (EBV) in nasopharyngeal
carcinoma (NPC), certain lymphomas (e.g., Hodgkin's lymphoma and NK
cell lymphoma), and certain gastric carcinoma; human papillomavirus
(HPV) in cervical carcinoma; and hepatitis B virus (HBV) in
hepatocellular carcinoma.
[0084] As an example of such an application, the primer and probe
configuration illustrated in FIG. 11, is designed to target a
sequence within the EBV genome, such as in the BamHI-W fragment, or
within the EBNA-1 gene.
[0085] When such a system is applied on samples with long EBV DNA,
even intact virions, compared with those with short EBV DNA, e.g.,
plasma from NPC patients, the proportion of long DNA will decrease,
while the proportion of short DNA will increase. EBV DNA has been
detected in the plasma of some 96% of NPC patients and 7% of
individuals without NPC (Lo, et al. 1999, Cancer Res, 59,
1188-1191). The digital sizing system can be used to differentiate
EBV DNA in the plasma of NPC patients and those without cancer. As
an illustration of how this could be done, a digital sizing system
can be developed for EBV DNA. This system can be applied to the
plasma of subjects at risk of NPC. Without the digital sizing
system, it is expected that some 7% of the subjects will be
positive for EBV DNA in the plasma, even if they do not have NPC
(Lo, et al. 1999, Cancer Res, 59, 1188-1191). With the digital
sizing system, one can establish the relative and absolute
concentrations of the long and short EBV DNA fragments in plasma.
Reference ranges of the absolute and/or relative concentrations of
the long and short EBV DNA fragments in plasma can be determined
from a cohort of patients with NPC and in a cohort of range of NPC
subjects would be regarded as high risk for having NPC. Conversely,
those with values within the range of normal subjects would be
regarded as low risk for having NPC. The use of the digital sizing
system would be expected to reduce the cost of having to
investigate the latter group of subjects with additional
investigative procedures, e.g., nasopharyngeal endoscopy. This
system would also be useful for the other cancers associated with
EBV, e.g., certain lymphomas (Lei, et al., 2002, Clin Cancer Res
8:29-34 and Lei et al., 2000, Br J Haematol 111:239-246).
Example 6
Size Analysis of Nucleic Acids Containing Tumor-Associated
Molecular Alterations
[0086] A number of molecular alterations are associated with the
neoplastic process, including oncogene mutations (e.g., KRAS
mutations) (Anker, et al. 1997, Gastroenterology, 112, 1114-1120),
oncogene amplification (e.g., erbB-2 amplifications) (Chiang, et
al. 1999, Clin Cancer Res, 5, 1381-1386) and promoter
hypermethylation of tumor suppressor genes (e.g., p16 and RASSF1A
hypermethylation) (Baylin, et al. 2001, Hum Mol Genet, 10, 687-692;
Hesson, et al. 2007, Dis Markers, 23, 73-87; Wong, et al. 1999,
Cancer Res, 59, 71-73). Of particular relevance to cancer detection
and monitoring, many of such changes have also been observed in the
body fluids of cancer patients, including blood (including its
various components, including plasma and serum), urine, saliva,
peritoneal fluid, etc. Many of these fluids contain a mixture of
neoplastic and non-neoplastic nucleic acids. These two categories
of nucleic acids will be expected to have different sizes.
Furthermore, cancer patients also have a different overall size
distribution of DNA in certain bodily fluids such as plasma, when
compared with individuals without cancer (Jiang, et al. 2006, Int J
Cancer, 119, 2673-2676). Thus, the digital sizing technology
described herein can also be used to detect, monitor, and
prognosticate cancer patients.
[0087] As an illustration of the application of this technology,
the example shown in FIG. 12 is constructed. In this example, a
mutation in an oncogene, e.g., KRAS, is to be detected.
[0088] The primer and probe sequences are constructed towards the
KRAS gene. Probe 2 and Probe 3 are designed in such a way that they
can differentiate the presence of a mutation (Probe 2) or wild-type
(Probe 3) sequence of the KRAS gene. Probe 1, Probe 2 and Probe 3
are labeled with different fluorescence reporters. Thus, following
digital PCR analysis, a significant proportion of wells will not
contain any signals. For those with the probe signals, any well
with the signal from Probe 1 will signify the presence of long
template DNA. This Probe 1 signal will be accompanied by a signal
from either Probe 2 (if a mutant template is present) or Probe 3
(if a wild-type template is present). If there are more than one
template molecules within a well, then it is possible for both
Probe 2 and Probe 3 signals to be present concurrently. If the
signal from Probe 1 is not present, then it indicates the presence
of a short template molecule in that well. In such a well, the
presence of Probe 2 or Probe 3 signal will indicate the presence of
a short mutant or a short wild-type template, respectively.
[0089] This system can also be performed using primer extension
followed by mass spectrometry. In such a system, Probe 1 will be
replaced by Extension Primer 1; Probe 2 and Probe 3 can be replaced
by a single Extension Primer 2. Extension Primer 2 can be designed
to terminate one base 5' of the mutation and such that the
extension products from the mutant and wild-type templates are
distinguishable by molecular masses.
[0090] It is also possible that the system can be constructed such
that the detection of the long template is done by a fluorescence
probe while the differentiation of the mutant and wild-type
templates is performed by primer extension followed by mass
spectrometry. Those of skilled in the art should be able to
construct variants along the core invention described here.
[0091] In the context of detecting oncogene amplification in bodily
fluids, the digital sizing technology can be used to identify a
size window at which the tumor-associated oncogene amplification is
most readily observed.
Example 7
Focused Analysis of Short Nucleic Acid Fragments by Digital
PCR-Based Size Analysis
Methods:
[0092] By designing PCR primers specifying amplicons of certain
combination of lengths, selective analysis of a subpopulation of
nucleic acid molecules of a predetermined size window, amongst a
larger population of nucleic acid molecules, could be achieved.
This was exemplified by showing the selective enrichment of fetal
DNA in maternal plasma. Circulating fetal DNA in maternal plasma
was previously reported to be of a shorter length than DNA
molecules of maternal origin (Chan et al, 2004 Clin Chem, 50,
88-92). In order to achieve a selective discrimination of short
fetal DNA molecules among the long maternal DNA molecules in
maternal plasma, various PCR amplicon sizes for detecting either
the long or the short DNA templates in maternal plasma were
investigated. Maternal plasma was collected from pregnant women
carrying male fetuses. Six PCR assays specifying amplicon sizes
ranging from 213 bp to 51 bp were designed towards ZFX and ZFY gene
regions. The ZFX target, on the X chromosome, was present in both
the maternal and fetal genomes. The ZFY target, on the Y
chromosome, was only present in the fetal genome. The amplicon
lengths and the sequences of PCR and extension primers are shown in
the table below.
TABLE-US-00007 ZFXY assays 213_51.sup.a 213_82 213_64 179_64 179_51
149_60 Forward PCR primer: Long F-213bp.sup.b F-213bp F-213bp
F-179bp F-179bp F-149bp amplicon Short F-51bp F-82bp F-64bp F-64bp
F-51bp F-60bp amplicon Reverse PCR R-a R-a R-a R-a R-a R-b primer
Extension primer: Long L-a L-a L-a L-b L-b L-c amplicon Short S-a
S-a S-a S-a S-a S-b amplicon .sup.athe assays were named in a way
that the former and the latter numbers separated by the underscore
indicate the amplicon sizes of the long and short PCR assays,
respectively, in the multiplex assay .sup.bthe primer sequences are
shown below:
TABLE-US-00008 Primer Seqeunce F-213 bp
ACGTTGGATGAACTGTGCATAACTTTGTTCCTGA F-179 bp
ACGTTGGATGTCAGTTGTAATCCAAGATGTT F-149 bp ACGTTGGATGTTTAAGGAGCTGATG
F-82 bp ACGTTGGATGTCATTCCTGAGCAAGTGCTG F-64 bp
ACGTTGGATGTGGACTCAGATGTAACTGAAGA F-60 bp
ACGTTGGATGGACATAACTGTGCATAA F-51 bp ACGTTGGATGAACTGAAGAAGTTTCTTTA
R-a ACGTTGGATGGCTAAAACATCATCTGGGAC R-b
ACGTTGGATGAACATCTTGGATTACAACTGA L-a AACATCTTGGATTACAACTG L-b
CATCATTCCTGAGCAAGTG L-c CACACATGGATGGTGATC S-a TCATCTGGGACTGTGCA
S-b GTTCCTGATGACCCAGA
[0093] Digital PCRs were performed in a 384-well format. Primer
extension assays were carried out and the size-specific extension
products were determined in a mass spectrometry system (Sequenom)
as described in Example 1. The sizes of the detected DNA molecules
were determined by the detection of the relevant size-specific
extension products. The ZFX or ZFY genes would give extension
products of different masses using the short extension primers, S-a
or S-b. The identification of the gene fragment as being ZFX or ZFY
was based on detecting the relevant extension product within the
short amplicon.
Results
[0094] In the first part of the study, six PCR assays with
combinations of short and long amplicons of different sizes were
studied in three third trimester maternal plasma samples. Fetal DNA
percentages were calculated using two approaches as described in
Example 1. The percentages were first calculated using wells
containing the X- and Y-specific signals, without considering the
sizes. The percentages were then re-calculated using the wells
showing signals of the short DNA amplicons only. As shown in FIG.
13, the calculated fractional fetal DNA concentrations were higher
by using only the short DNA molecules, compared with those
calculated using both the long and short molecules. The increments
in the fractional fetal DNA concentrations achieved or percentage
enrichment were further calculated. FIG. 13d shows the result
averaged from the three plasma samples. Assays 179.sub.--64 and
213.sub.--82 shows the greatest increments by this size analysis
strategy while assay 213.sub.--51 shows the highest fetal
percentage among the six assays evaluated in this example. Thus,
these three assays were selected for further study in maternal
plasma samples from an earlier gestational age.
[0095] In the second part of the study, assays 179.sub.--64,
213.sub.--51 and 213.sub.--82 were studied in four first trimester
maternal plasma samples. The fractional fetal DNA concentrations
and the percentage enrichment by this size analysis strategy are
shown in FIG. 14. As shown in FIG. 14e which shows data averaged
from the four maternal plasma samples, assay 179.sub.--64 shows the
highest percentage enrichment. The result demonstrates that the
combination of 179 bp and 64 bp amplicons shows the greatest power
to discriminate between maternal and fetal molecules in maternal
plasma and thus resulted in the highest degree of fetal DNA
enrichment.
[0096] In the third part of the study, the assay 179.sub.--64 was
further investigated in a total of ten first trimester maternal
plasma samples. The result is tabulated below. By using the sizing
strategy, the calculated fractional fetal DNA concentrations
increased by an average of 36%.
TABLE-US-00009 fetal % digital PCR data all short samples wells neg
L X Y LX LY XY LXY fragments fragments enrichment* M2790P 380 109 0
163 17 65 1 13 12 19.8 31.7 60.5 M2791P 384 159 0 151 15 31 2 17 9
26.4 32.8 24.2 M2795P 383 269 0 82 8 19 1 2 2 19.5 22.8 17.1 M2797P
377 206 0 114 6 44 1 5 1 11.6 15.7 35.7 M2811P 384 256 0 77 10 36 0
2 3 19.6 29.5 50.6 M2812P 383 268 0 68 8 32 0 5 2 21.7 31.8 46.2
M3616P 384 268 0 86 5 24 1 0 0 8.9 9.8 10.3 M3591P 383 288 0 74 7
12 0 2 0 16.7 19.4 16.3 M3539P 384 297 0 50 6 30 0 1 0 14.4 22.9
58.7 M3501P 384 269 0 75 6 30 0 4 0 14.6 20.6 40.3 * enrichment % =
( fetal % calculated from short fragments - fetal % calculate from
all fragments ) fetal % calculated from all fragments .times. 100 %
##EQU00001##
Example 8
DNA Size Analysis for Fetal Single Nucleotide Polymorphism in
Maternal Plasma
Methods
[0097] The size analysis strategy for maternal plasma fetal DNA
quantification was further adopted for fetal SNP detection in
maternal plasma. A polymorphic SNP (rs8130833) on PLAC4 was
utilized to differentiate fetal and maternal-derived DNA molecules.
Duplex PCR assay with amplicon sizes of 179 bp and 63 bp was
designed. The PLAC4 SNP was amplified by the 63 bp-assay. The
sequences of the primers are tabulated below:
TABLE-US-00010 Forward PCR primer (5' to 3'): Long amplicon
ACGTTGGATGGCCTGGAAGTAACGTGATCC Short amplicon
ACGTTGGATGTAGAACCATGTTTAGGCCAG Reverse PCR primer (5' to 3'):
ACGTTGGATGGCAACACCATTTGGGTTAAAT Extension primer (5' to 3'): Long
amplicon AGTATAGAGCCATAAAAGCC Short amplicon AGGCCAGATATATTCGTC
[0098] First trimester plasma samples were collected from 10
pregnant women. These women had different genotypes for the SNP
than the fetuses that they were carrying. Digital PCR were
performed in a 384-well format. Primer extension assays were then
carried out and the extension products generated from the short or
long amplicons were determined using mass spectrometry (Sequenom)
as described in Example 1. The SNP alleles were discriminated based
on the masses of the extension products of the short amplicon.
Results
[0099] The results are tabulated below. The fractional
concentrations of the fetal specific SNP allele were increased by
an average of 31% by using only the wells containing signals of the
short amplicons when compared with those calculated from wells
containing signals of both the short and long DNA fragments.
TABLE-US-00011 fetal % genotype digital PCR data short samples
fetus mother wells neg L A G LA LG AG LAG all fragments fragments
enrichment M2304P AG A 383 279 0 62 18 17 2 4 1 43 49 15 M2761P AG
A 384 283 0 64 2 33 1 1 0 7 8 18 M2329P AG A 384 265 0 76 6 30 1 4
2 18 24 32 M2325P AG A 384 246 0 103 4 27 0 2 2 9 12 32 M1897P AG A
380 290 0 58 1 31 0 0 0 2 3 60 M1853P AG A 384 263 0 80 4 34 1 1 1
10 12 28 M1854P AG G 382 239 0 5 88 2 43 2 3 14 18 33
[0100] This approach can also be used if the fetal SNP is a
pathogenic mutation, such as that in the .beta.-globin gene causing
.beta.-thalassemia, sickle cell anemia or hemoglobin E disease; or
that in the cystic fibrosis transmembrane conductance regulator
gene causing cystic fibrosis.
[0101] All patents, patent applications, and other publications
cited in this application, including published amino acid or
polynucleotide sequences, are incorporated by reference in the
entirety for all purposes.
Sequence CWU 1
1
32134DNAArtificial Sequence213bp-forward PCR primer (Primer A)
1acgttggatg aactgtgcat aactttgttc ctga 34230DNAArtificial
Sequence82bp-forward PCR primer (Primer B) 2acgttggatg tcattcctga
gcaagtgctg 30330DNAArtificial Sequencereverse PCR primer (Primer C)
3acgttggatg gctaaaacat catctgggac 30420DNAArtificial
Sequence213bp-extension primer (L) 4aacatcttgg attacaactg
20517DNAArtificial Sequence82bp-extension primer (S) 5tcatctggga
ctgtgca 17622DNAArtificial Sequencebeta-globin gene real-time PCR
primer 6gtgcacctga ctcctgagga ga 22721DNAArtificial
Sequencebeta-globin gene real-time PCR primer 7ccttgatacc
aacctgccca g 21826DNAArtificial Sequencebeta-globin gene real-time
PCR probe 8aaggtgaacg tggatgaagt tggtgg 26930DNAArtificial
SequenceSERPINB5 (maspin) Mpn_Forward L forward PCR primer
9cgtgtctgag aaatttgtag tgttactatc 301016DNAArtificial
SequenceSERPINB5 (maspin) Mpn_Forward S forward PCR primer
10cggtcctgcg tgggcc 161125DNAArtificial SequenceSERPINB5 (maspin)
Mpn_Reverse PCR common reverse primer 11gctgtgagtt acatgcatac gtaca
251220DNAArtificial SequenceSERPINB5 (maspin) long PCR product
Mpn_Probe L probe 12cacattactt ttatttcatc 201315DNAArtificial
SequenceSERPINB5 (maspin) short PCR product Mpn_Probe S probe
13ttgccgtacg catgt 151434DNAArtificial SequenceZFX and ZFY gene
region long amplicon F-213bp forward digital PCR primer
14acgttggatg aactgtgcat aactttgttc ctga 341531DNAArtificial
SequenceZFX and ZFY gene region long amplicon F-179bp forward
digital PCR primer 15acgttggatg tcagttgtaa tccaagatgt t
311625DNAArtificial SequenceZFX and ZFY gene region long amplicon
F-149bp forward digital PCR primer 16acgttggatg tttaaggagc tgatg
251730DNAArtificial SequenceZFX and ZFY gene region short amplicon
F-82bp forward digital PCR primer 17acgttggatg tcattcctga
gcaagtgctg 301832DNAArtificial SequenceZFX and ZFY gene region
short amplicon F-64bp forward digital PCR primer 18acgttggatg
tggactcaga tgtaactgaa ga 321927DNAArtificial SequenceZFX and ZFY
gene region short amplicon F-60bp forward digital PCR primer
19acgttggatg gacataactg tgcataa 272029DNAArtificial SequenceZFX and
ZFY gene region short amplicon F-51bp forward digital PCR primer
20acgttggatg aactgaagaa gtttcttta 292130DNAArtificial SequenceZFX
and ZFY gene region R-a reverse PCR primer 21acgttggatg gctaaaacat
catctgggac 302231DNAArtificial SequenceZFX and ZFY gene region R-b
reverse PCR primer 22acgttggatg aacatcttgg attacaactg a
312320DNAArtificial SequenceZFX and ZFY gene region long amplicon
L-a extension primer 23aacatcttgg attacaactg 202419DNAArtificial
SequenceZFX and ZFY gene region long amplicon L-b extension primer
24catcattcct gagcaagtg 192518DNAArtificial SequenceZFX and ZFY gene
region long amplicon L-c extension primer 25cacacatgga tggtgatc
182617DNAArtificial SequenceZFX and ZFY gene region short amplicon
S-a extension primer 26tcatctggga ctgtgca 172717DNAArtificial
SequenceZFX and ZFY gene region short amplicon S-b extension primer
27gttcctgatg acccaga 172830DNAArtificial SequencePLAC4 polymorphic
SNP (rs8130833) long amplicon forward duplex PCR primer
28acgttggatg gcctggaagt aacgtgatcc 302930DNAArtificial
SequencePLAC4 polymorphic SNP (rs8130833) short amplicon forward
duplex PCR primer 29acgttggatg tagaaccatg tttaggccag
303031DNAArtificial SequencePLAC4 polymorphic SNP (rs8130833)
reverse duplex PCR primer 30acgttggatg gcaacaccat ttgggttaaa t
313120DNAArtificial SequencePLAC4 polymorphic SNP (rs8130833) long
amplicon extension primer 31agtatagagc cataaaagcc
203218DNAArtificial SequencePLAC4 polymorphic SNP (rs8130833) short
amplicon extension primer 32aggccagata tattcgtc 18
* * * * *
References