U.S. patent application number 12/102983 was filed with the patent office on 2009-02-26 for cytotoxicity mediation of cells evidencing surface expression of cd63.
Invention is credited to Luis A. G. da Cruz, Helen P. Findlay, Susan E. Hahn, David S. F. Young.
Application Number | 20090053215 12/102983 |
Document ID | / |
Family ID | 32712510 |
Filed Date | 2009-02-26 |
United States Patent
Application |
20090053215 |
Kind Code |
A1 |
Young; David S. F. ; et
al. |
February 26, 2009 |
Cytotoxicity mediation of cells evidencing surface expression of
CD63
Abstract
This invention relates to the diagnosis and treatment of
cancerous diseases, particularly to the mediation of cytotoxicity
of tumor cells; and most particularly to the use of cancerous
disease modifying antibodies (CDMAB), optionally in combination
with one or more chemotherapeutic agents, as a means for initiating
the cytotoxic response. The invention further relates to binding
assays which utilize the CDMABs of the instant invention.
Inventors: |
Young; David S. F.;
(Toronto, CA) ; Hahn; Susan E.; (Toronto, CA)
; Findlay; Helen P.; (Toronto, CA) ; da Cruz; Luis
A. G.; (Toronto, CA) |
Correspondence
Address: |
MCHALE & SLAVIN, P.A.
2855 PGA BLVD
PALM BEACH GARDENS
FL
33410
US
|
Family ID: |
32712510 |
Appl. No.: |
12/102983 |
Filed: |
April 15, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10810751 |
Mar 26, 2004 |
7361343 |
|
|
12102983 |
|
|
|
|
10603006 |
Jun 23, 2003 |
|
|
|
10810751 |
|
|
|
|
10348231 |
Jan 21, 2003 |
7009040 |
|
|
10603006 |
|
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/138.1; 424/178.1; 435/7.23 |
Current CPC
Class: |
C07K 16/3069 20130101;
A61K 51/1051 20130101; A61P 35/00 20180101; A61K 51/1045 20130101;
G01N 33/57484 20130101; C07K 16/3015 20130101; C07K 16/3023
20130101; C07K 16/00 20130101; C07K 16/3046 20130101; A61K 51/1096
20130101; A61K 2039/505 20130101; C07K 16/30 20130101; G01N 33/574
20130101 |
Class at
Publication: |
424/133.1 ;
424/138.1; 424/178.1; 435/7.23 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61P 35/00 20060101 A61P035/00; G01N 33/574 20060101
G01N033/574 |
Claims
1. A method for treating a patient suffering from a cancerous
disease comprising: administering to said patient an anti-cancer
antibody or fragment thereof produced in accordance with a method
for the production of anti-cancer antibodies which are useful in
treating a cancerous disease, said antibody or fragment thereof
characterized as being cytotoxic against cells of a cancerous
tissue, and being essentially benign to non-cancerous cells;
wherein said antibody or fragment thereof is placed in admixture
with a pharmaceutically acceptable adjuvant and is administered in
an amount effective to mediate treatment of said cancerous disease;
said antibody being an isolated monoclonal antibody or antigen
binding fragment thereof which binds to an antigenic moiety
expressed by said cancerous tissue, said antigenic moiety
characterized as being bound by an antibody having identifying
characteristics of a monoclonal antibody encoded by a clone
deposited with the ATCC as PTA-4890.
2. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1, wherein said antibody or
fragment thereof is humanized or chimerized.
3. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 comprising: conjugating said
antibody or antigen binding fragment thereof with a member selected
from the group consisting of toxins, enzymes, radioactive
compounds, and hematogenous cells, thereby forming an antibody
conjugate; and administering said antibody conjugate or conjugated
fragments thereof to said patient; wherein said antibody conjugate
or conjugated fragments are placed in admixture with a
pharmaceutically acceptable adjuvant and are administered in an
amount effective to mediate treatment of said cancerous
disease.
4. The method of claim 3, wherein said antibody or fragment thereof
is humanized or chimerized.
5. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through antibody
dependent cellular toxicity.
6. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through complement
dependent cellular toxicity.
7. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through catalyzing of
the hydrolysis of cellular chemical bonds.
8. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through producing an
immune response against putative cancer antigens residing on tumor
cells.
9. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through targeting of
cell membrane proteins to interfere with their function.
10. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through production of
a conformational change in a cellular protein effective to produce
a signal to initiate cell-killing.
11. The method for treating a patient suffering from a cancerous
disease in accordance with claim 1 wherein: said method of
production utilizes a tissue sample containing cancerous and
non-cancerous cells obtained from a particular individual.
12. A method for treating a patient suffering from a cancerous
disease comprising: administering to said patient an antibody or
antigen binding fragment thereof produced in accordance with a
method for the production of anti-cancer antibodies which are
useful in treating a cancerous disease, said antibody being
cytotoxic against cells of a cancerous tissue, and essentially
benign to non-cancerous cells; wherein said antibody is the
isolated monoclonal antibody encoded by the clone deposited with
the ATCC as PTA-4890 or an antigen binding fragment thereof, and is
placed in admixture with a pharmaceutically acceptable adjuvant and
is administered in an amount effective to mediate treatment of said
cancerous disease.
13. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12, wherein said antibody or
fragment thereof is humanized or chimerized.
14. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 comprising: conjugating said
antibody or fragment thereof with a member selected from the group
consisting of toxins, enzymes, radioactive compounds, and
hematogenous cells, whereby an antibody conjugate is formed; and
administering said antibody conjugates or fragments thereof to said
patient; wherein said conjugated antibodies are placed in admixture
with a pharmaceutically acceptable adjuvant and are administered in
an amount effective to mediate treatment of said cancerous
disease.
15. The method of claim 14, wherein said antibody or fragment
thereof is selected from said subset are humanized or
chimerized.
16. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through antibody
dependent cellular toxicity.
17. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through complement
dependent cellular toxicity.
18. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through catalyzing of
the hydrolysis of cellular chemical bonds.
19. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through producing an
immune response against putative cancer antigens residing on tumor
cells.
20. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through targeting of
cell membrane proteins to interfere with their function.
21. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: the cytotoxicity of
said antibody or fragment thereof is mediated through production of
a conformational change in a cellular protein effective to produce
a signal to initiate cell-killing.
22. The method for treating a patient suffering from a cancerous
disease in accordance with claim 12 wherein: said method of
production utilizes a tissue sample containing cancerous and
non-cancerous cells obtained from a particular individual.
23. A process for mediating cytotoxicity of a human tumor cell
which expresses a CD63 antigenic moiety on the cell surface
comprising: contacting said tumor cell with an isolated monoclonal
antibody or antigen binding fragment thereof, said antibody or
antigen binding fragment thereof being an isolated monoclonal
antibody or antigen binding fragment thereof which binds to said
expressed CD63 antigenic moiety, said antigenic moiety
characterized as being bound by an antibody having the identifying
characteristics of a monoclonal antibody encoded by the clone
deposited with the ATCC as PTA-4890, whereby cell cytotoxicity
occurs as a result of said binding.
24. The process of claim 23 wherein said isolated antibody or
antigen binding fragments thereof are humanized or chimerized.
25. The process of claim 23 wherein said isolated antibody or
antigen binding fragments thereof are conjugated with a member
selected from the group consisting of cytotoxic moieties, enzymes,
radioactive compounds, and hematogenous cells, whereby an antibody
conjugate is formed.
26. The process of claim 23 wherein said isolated antibody or
antigen binding fragments thereof are humanized or chimerized.
27. The process of claim 23 wherein said isolated antibody or
antigen binding fragments thereof are murine.
28. The process of claim 23 wherein the human tumor tissue sample
is obtained from a tumor originating in a tissue selected from the
group consisting of colon, ovarian, lung, prostate and breast
tissue.
29. A binding assay to determine a presence of cells which express
a CD63 antigenic moiety which specifically binds to an isolated
monoclonal antibody encoded by the clone deposited with the ATCC as
PTA-4890 or an antigen binding fragment thereof comprising:
providing a cell sample; providing an isolated monoclonal antibody
or antigen binding fragment thereof, said antibody or antigen
binding fragment thereof being an isolated monoclonal antibody or
antigen binding fragment thereof which binds to said expressed CD63
antigenic moiety, said antigenic moiety characterized as being
bound by an antibody having the identifying characteristics of a
monoclonal antibody encoded by the clone deposited with the ATCC as
PTA-4890; contacting said isolated monoclonal antibody or antigen
binding fragment thereof with said cell sample; and determining
binding of said isolated monoclonal antibody or antigen binding
fragment thereof with said cell sample; whereby the presence of
cells which express a CD63 antigenic moiety which specifically
binds to said isolated monoclonal antibody or antigen binding
fragment thereof is determined.
30. The binding assay of claim 29 wherein the cell sample is
obtained from a tumor originating in a tissue selected from the
group consisting of colon, ovarian, lung, prostate and breast
tissue.
31. A process of isolating or screening for cells in a sample which
express a CD63 antigenic moiety which specifically binds to an
isolated monoclonal antibody or antigen binding fragment thereof,
said antigenic moiety characterized as being bound by an antibody
having the identifying characteristics of a monoclonal antibody
encoded by the clone deposited with the ATCC as PTA-4890
comprising: providing a cell sample; providing an isolated
monoclonal antibody or antigen binding fragment thereof, said
antibody or antigen binding fragment thereof being an isolated
monoclonal antibody or antigen binding fragment thereof which binds
to said expressed CD63 antigenic moiety, said antigenic moiety
characterized as being bound by an antibody having the identifying
characteristics of a monoclonal antibody encoded by the clone
deposited with the ATCC as PTA-4890; contacting said isolated
monoclonal antibody or antigen binding fragment thereof with said
cell sample; and determining binding of said isolated monoclonal
antibody or antigen binding fragment thereof with said cell sample;
whereby said cells which express a CD63 antigenic moiety which
specifically binds to an isolated monoclonal antibody encoded by
the clone deposited with the ATCC as PTA-4890, or antigen binding
fragment thereof are isolated by said binding and their presence in
said cell sample is confirmed.
32. The process of claim 31 wherein the cell sample is obtained
from a tumor originating in a tissue selected from the group
consisting of colon, ovarian, lung, prostate and breast tissue.
33. A method of extending survival and/or delaying disease
progression by treating a human tumor in a mammal, wherein said
tumor expresses an antigen which specifically binds to a monoclonal
antibody or antigen binding fragment thereof which has the
identifying characteristics of a monoclonal antibody encoded by a
clone deposited with the ATCC as accession number PTA-4890
comprising administering to said mammal said monoclonal antibody in
an amount effective to reduce said mammal's tumor burden, whereby
disease progression is delayed and/or survival is extended.
34. The method of claim 33 wherein said antibody is conjugated to a
cytotoxic moiety.
35. The method of claim 33 wherein said cytotoxic moiety is a
radioactive isotope.
36. The method of claim 33 wherein said antibody activates
complement.
37. The method of claim 33 wherein said antibody mediates antibody
dependent cellular cytotoxicity.
38. The method of claim 33 wherein said antibody is a murine
antibody.
39. The method of claim 33 wherein said antibody is a humanized
antibody
40. The method of claim 33 wherein said antibody is a chimerized
antibody.
Description
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of application Ser. No.
10/810,751, filed Mar. 26, 2004, which is a continuation-in-part of
application Ser. No. 10/603,006, filed Jun. 23, 2003, which is a
continuation-in-part of application Ser. No. 10/348,231, filed Jan.
21, 2003, now U.S. Pat. No. 7,009,040, issued Mar. 7, 2006, the
contents of each of which are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] This invention relates to the diagnosis and treatment of
cancerous diseases, particularly to the mediation of cytotoxicity
of tumor cells; and most particularly to the use of cancerous
disease modifying antibodies (CDMAB), optionally in combination
with one or more chemotherapeutic agents, as a means for initiating
the cytotoxic response. The invention further relates to binding
assays, which utilize the CDMAB of the instant invention.
BACKGROUND OF THE INVENTION
[0003] CD63 is a Type III membrane protein of the tetraspanin
family whose 20 current members are characterized by the presence
of four transmembrane segments. Several groups independently
identified CD63, using antibodies raised to whole cell preparations
of activated platelets, granulocytes, and melanoma cells. Cloning
of the respective cDNAs of their cognate glycoprotein antigens led
to the recognition that the different antigens were one and the
same molecule. The Sixth International Workshop on Leukocyte Typing
(1996) subsequently categorized these antibodies as CD63
antibodies. Prior to the 1996 Workshop, CD63 was known by multiple
names (melanoma 1 antigen, ocular melanoma-associated antigen,
melanoma associated antigen ME491, lysosome-associated membrane
glycoprotein 3, granulophysin, melanoma-associated antigen MLA1),
which were sometimes related to the antibodies that led to its
partial characterization and identification. Thus, CD63 was also
designated as antigen ME491 (MAb ME491), neuroglandular antigen
(MAbs LS59, LS62, LS76, LS113, LS140 and LS152), Pltgp40 (MAbs
H5C6, H.sub.4F.sub.8 and H5D2), human bone marrow stromal cell
antigen (MAb 12F12), osteoprogenitor-specific marker (MAb HOP-26),
and integrin-associated protein (MAb 6H1). Other antibodies that
were found to cross react with human CD63 were 8-1H, 8-2A
(cross-reactivity with ME491), NKI/C-3 and NKI/black-13 (Vannegoor
and Rumke, 1986; Demetrick et al., 1992; Wang et al., 1992).
[0004] CD63 was initially cloned from a melanoma cDNA library using
MAb ME491, one of a number of antibodies raised against a
preparation of human melanoma cells. It was shown that the
reactivity of MAb ME491 appeared to be inversely correlated with
melanoma progression in a study of human melanoma biopsies. The
reactivity of the ME491 antibody was low in normal melanocytes,
higher in the early stages of melanoma progression (dysplastic nevi
and radial growth phase (RGP) tumors) and decreased or even absent
in more advanced melanoma tumors such as those in the vertical
growth phase (VGP) and in metastatic tumors.
[0005] CD63 was also found and partially characterized in human
platelets using MAb 2.28 (raised against activated platelets) that
detected an activation-dependent platelet membrane 53 kDa
glycoprotein. This molecule was also associated with the membrane
of internal granules in unstimulated platelets. In the same study
MAb 2.28 also labelled internal granules in megakaryocytes and
endothelial cells, where it co-localized with antibodies to the
enzyme cathepsin D, a known marker of lysosomal compartments.
Follow up studies with antibody clustering and expression cloning,
led to the identification of the antigen recognized by this
antibody as CD63, and further confirmed its presence in lysosomal
compartments, where it co-localized with the compartment-specific
markers LAMP-1 and LAMP-2. Cloning of this molecule identified it
as CD63 and allowed its inclusion in the tetraspanin family.
[0006] Expression of CD63 was detected in many different tissues
and cell types. At the cellular level it was found to be associated
with the plasma membrane and also with intracellular late endosomal
vesicular structures. Cell activation led, in certain cases, to
increased surface expression by mobilization of intracellular
stores of CD63. CD63 was also found to co-localize, and physically
associate, with MHC class II in B-lymphocytes, particularly in
endosomes, in exosomes involved in exporting MHC class II complexes
to the surface, and in secreted vesicles. CD63 was found to
interact with other members of the tetraspanin family, such as CD9,
CD81, CD11 (integrin chain .alpha..sub.M,L,X), CD18 (integrin chain
.beta..sub.2), CD49c (VLA-3 or integrin chain .alpha..sub.3), CD49d
(integrin chain .alpha..sub.4), CD49f (VLA-6 or integrin chain
.alpha..sub.6) and CD29 (integrin chain .beta..sub.1), in a variety
of cell types including B- and T-lymphocytes, neutrophils, breast
cancer and melanoma cells.
[0007] The role of CD63 in cancer has been unclear. Although CD63
was initially discovered by several independent groups to be
involved in diverse events such as platelet and granulocyte
activation, MHC class II-dependent antigen presentation,
integrin-dependent cell adhesion and motility, and tumor
progression in certain types of cancers, its function has yet to be
fully elucidated. Even though current evidence supports its role in
a variety of cellular physiological events, it is not clear if
these functions are independent of each other or if there is an
underlying common cellular mechanism in which CD63 is involved.
[0008] Several groups have investigated the association between
CD63 and the progression of certain types of tumors, particularly
melanomas. A number of other anti-CD63 monoclonal antibodies, in
addition to Mab ME491, were developed for immunohistochemical (IHC)
staining of cancer samples obtained from patients with tumors at
various stages of progression. It was observed that decreased
staining, interpreted by the authors as most likely reflecting
decreased expression of CD63, correlated with advanced progression
and with metastatic characteristics of the tumors. A more recent
study, also described a significant correlation between the
apparent decreased expression levels (after quantitation of mRNA)
of several members of the tetraspanin protein family, including
CD63, and the in vitro invasiveness of several mammary
carcinoma-derived cell lines. Another study identified CD63, by
differential display, in cultured breast cancer cells subjected to
estrogen deprivation. This indicated that CD63 expression can be
steroid-hormone regulated and that altered CD63 abundance and/or
function might also be associated with breast tumor
progression.
[0009] By contrast, work with anti-CD63 monoclonal antibody MAb
FC-5.01 revealed that its reactive epitope was variably expressed
in different normal tissues. Although this antibody was found to
recognize CD63, it did not distinguish between early and more
advanced stage melanomas, including metastatic melanomas (unlike
MAb ME491), which suggested that the CD63 antigen was present in
these more advanced tumors, but that some of its epitopes may have
been masked in the cells from tumors at different stages. This
might have been due to altered post-translational modifications of
the core CD63 polypeptide, or to the interaction of CD63 with other
molecules, which might have affected the availability of specific
epitopes for antibody recognition and binding. These results
supported the observation, described by Si and Hersey (1993), that
staining with the anti-CD63 MAb NKI-C3, did not distinguish between
tissue sections from melanomas at different stages of progression,
such as primary, radial growth phase, vertical growth phase, and
metastatic melanomas. Although in other studies (Adachi et al.,
1998; Huang et al., 1998) analysis of mRNA from breast, and from
non-small-cell lung cancers, by quantitative PCR, revealed that for
two tetraspanin family members (CD9 and CD82) there was a
significant correlation between their expression levels and tumor
progression and patient prognosis, no such correlation was found
for CD63, in that its expression was similar in all the samples. As
a result of these, apparently conflicting, results, there is lack
of strong and consistent data that would definitively demonstrate
the association of CD63 with cancer.
[0010] To date very few in vivo studies have attempted to establish
a link between CD63 and an eventual tumor suppressor function of
this molecule. In one of these studies, human CD63-overexpressing
H-ras-transformed NIH-3T3 cells, injected both subcutaneously and
intraperitoneally into athymic mice, revealed a decreased
malignant/tumorigenic phenotype, as indicated by decreased tumor
size and metastatic potential as well as by increased survival
time, when compared to the behavior of the parental
non-CD63-overexpressing cells. This suggested that the presence of
human CD63 in the transformed cells might suppress their malignant
behavior. More recently, work with a transgenic mouse model
expressing human CD63, and developed to induce tolerance to CD63,
indicated that tumor growth of an injected human CD63-MHC class I
(H-2K.sup.b) co-transfected murine melanoma cell line could be
inhibited, and survival increased, upon immunization with human
CD63 fused to vaccinia virus. It was suggested by the authors that
the therapeutic effect was T-lymphocyte dependent, and that
endogenous anti-CD63 antibodies did not appear to be involved in
this protective effect, since tumor growth inhibition only occurred
when animals were injected with the CD63-MHC class I co-transfected
cells and not with the CD63-only transfected cell line. This
interpretation was supported by the fact that in wild type animals,
pre-immunized with purified human CD63 and shown to have developed
anti-human CD63 antibodies, there was no protective effect against
tumor cell growth. Work described by Radford et al. (1995) using
the KM3 cell line, initially thought to be of human origin but
later characterized as being of rat lineage, transfected with human
CD63, suggested that expression of this protein decreased the
growth and metastastic potential of these cells, relative to that
observed using the parental non-transfected KM3 cells, when
injected intradermally into athymic mice, although there was no
significant difference between the in vitro growth rates of the
various transfected and non-transfected cell lines. These
observations distinguished the potential effect of CD63 from that
of other tumor suppressor genes known to affect both the in vivo
and the in vitro growth rates of tumor cells. Furthermore, addition
of the anti-CD63 monoclonal antibody ME491, which was found to have
a functional effect on the same cells by decreasing their random
motility in an in vitro assay (Radford et al., 1997), did not
impact their in vitro growth rates.
[0011] This study also described the observation that CD63 may
promote migration in response to extracellular matrix (ECM)-derived
chemoattractants, such as laminin, fibronectin, collagen and
vitronectin, and that this effect may be mediated by the functional
involvement of .beta..sub.1-type integrins, although antibodies to
the integrins were unable to block these effects. However, there
appeared to be an antagonistic effect between the role of
vitronectin-mediated signaling (a known ligand for the integrin
.alpha..sub.v.beta..sub.5) and that of the signaling mediated by
other ECM components such as fibronectin, laminin and collagen on
CD63 transfected cells. This suggested that under specific
conditions, in the presence of ECM components, expression of CD63
may lead to decreased migration, and that this may be dependent on
a fine balance between adhesion and motility. In another study, an
anti-CD63 monoclonal antibody (MAb 710F) enhanced the adhesion and
spreading of PMA-treated HL-60 cells, while another anti-CD63
monoclonal antibody (MAb 2.28), promoted a similar effect, but only
on a much smaller fraction of the cell population, and only when
added in much larger amounts. These results showed that although
many antibodies to CD63 have been developed, their functional
effects can be quite different.
[0012] Tetraspanins may also be involved in cell proliferation.
Oren et al. (1990) described anti-proliferative effects of the
murine MAb 5A6, that recognizes CD81 (TAPA-1), on lymphoma cell
lines. In another study, ligation of CD37 in human T-lymphocytes
with antibodies blocked CD37-induced proliferation. More recently,
a study with an animal model deficient in the expression of CD37
(CD37 knockout) revealed that T lymphocytes from this animal were
hyperproliferative compared to those from wild type animals in
response to concanavalin A activation and CD3/T cell receptor
engagement. It was therefore proposed that a functional role in
cell growth and proliferation might be a common feature of the
tetraspanin family. Recent studies with hepatoblastoma and
hepatocellular carcinoma cells revealed that engagement of these
cells with anti-CD81 monoclonal antibodies led to activation of the
Erk/MAP kinase pathway. This signaling pathway has been shown to be
involved with cell growth and proliferation events. In parallel
work, transfected cell lines overexpressing human CD81 displayed
increased proliferation relative to the mock-transfected control
cells. Therefore, available evidence has pointed to a role of the
tetraspanins in general, and of CD63 in particular, in events
associated with cell growth proliferation and with cell
adhesion/motility. These two types of cellular events are currently
the target of intense research as both play a central role in tumor
progression and metastasis.
[0013] Until now, no anti-CD63 antibodies, or other reagents that
specifically targeted CD63-expressing cells, were reported and
shown to have a simultaneous impact on the in vitro and on the in
vivo growth characteristics of tumor cells, and also on the
survival time of animal models of tumor cell growth.
[0014] Amino acid sequence determination and analysis did not
reveal homology between tetraspanins and other protein families, or
with any previously characterized functional modules, nor has it
suggested any previously known enzymatic activity. As a result it
has been very difficult to investigate the role of this family of
proteins in the modulation of signal transduction pathways.
However, the evidence generated using tetraspanin-specific reagents
that led to changes in cellular physiology, and which were
intimately dependent on the modulation of signal transduction
pathways, suggests that tetraspanins have signal transduction
properties. CD63 was shown to associate, both physically and
functionally, with a number of molecules that are themselves either
enzymes involved in the generation of secondary messenger signals,
or are associated physically and/or functionally with such
enzymes.
[0015] Experiments designed to dissect the mechanism controlling
the interaction of human neutrophils with endothelial cells, which
is one of the initial steps of the inflammatory response, revealed
that pre-treatment of neutrophils with several anti-CD63 monoclonal
antibodies (AHN-16, AHN-16.1, AHN-16.2, AHN-16.3 and AHN-16-5)
promoted their adhesion to cultured endothelial cell layers.
Furthermore this effect was strongly dependent on the presence of
calcium ion (Ca.sup.2+), a well-known modulator of many
intracellular signaling pathways and which was restricted to a
specific period of time during which the cells were exposed to the
stimulating antibodies. After longer exposure to the antibody,
adhesion of the neutrophils to the endothelial cells became
insensitive to the later addition of Ca.sup.2+, therefore
implicating a dynamic and temporally regulated (transitory) event.
In addition, CD63 was found to physically interact with the
CD11/CD18 protein complex, and reagents that specifically targeted
this complex mediated a modulatory signal. In this study CD63 was
also found to be physically associated with, or to be part of, a
complex that included the enzyme tyrosine kinases Lck and Hck.
These enzymes are members of a class of proteins that play a
central role in mediating intracellular regulatory signals upon
activation of specific surface receptors and are part of cascades
of signaling pathways that result in cell-specific physiological
changes. Another study suggested that co-ligation of tetraspanins
(including CD63) with monoclonal antibodies could enhance the
phosphorylation or activity of the enzyme focal adhesion kinase
(FAK) that was induced by adhesion of MDA-MB-231 breast cancer
cells to collagen substrate. This pointed to a direct involvement
of CD63 (and of other tetraspanin family members) in the modulation
of integrin-mediated tyrosine kinase signaling pathways. Other
signaling pathways that may functionally intersect with the
presence and ligation of surface CD63 by the anti-CD63 monoclonal
antibody MAb 710F appear to be those dependent on modulation of
phosphorylation by the enzyme protein kinase C (PKC), another well
known modulator of intracellular signaling pathways. In this
context, enhancement of adhesion and of morphological changes in
the myeloid cell line HL-60 by MAb 710F was dependent on
pre-treatment of the cells with phorbol myristate acetate (PMA)
although the temporal involvement of PKC was not conclusively
demonstrated. However, later work by an independent group
demonstrated that PMA-induced HL-60 differentiation was
PKC-activity dependent since the molecule Ro31-8220, a specific
inhibitor of this enzyme, blocked the effect of PMA.
[0016] Further evidence supporting the association of CD63, and
other tetraspanin family members, with signal transduction
pathways, arose from work that described a physical association,
either direct or as part of a supramolecular complex, between CD63
(and also CD53) molecules with tyrosine phosphatase activity. In
this study, immunoprecipitate complexes isolated with anti-CD63
antibodies were shown to be associated with tyrosine phosphatase
activity, although unlike for CD53, which was shown to associate
with the tyrosine phosphatase CD45, it was not possible to identify
the CD63-associated phosphatase. More recently several members of
the tetraspanin family were also found to be associated with a type
II phosphatidylinositol 4-kinase (type II PI 4-K) (Berditchevski et
al., 1997). This interaction appeared to be very specific since it
was only identified for CD9, CD63, CD81, CD151 and A15/TALLA, and
it was not observed to occur with CD37, CD52, CD82, or NAG-2. In
addition, the association between tetraspanin family members and
PI-4K was mutually exclusive since each PI-4 kinase-containing
complex was limited to a single tetraspanin family member.
CD63-PI-4 kinase complexes, in particular, were found, almost
entirely, in intracellular compartments in lipid raft-like domains,
unlike those formed with the other tetraspanin members. This
observation suggested that this CD63 fraction, found to interact
with the PI-4 kinase, might have been involved in specific
intracellular events (Claas, C, et al., 2001) related to, or
dependent from, phosphoinositide biosynthesis pathways, which are
well known for their involvement in the regulation of membrane
trafficking (endocytosis and exocytosis) and of cytoskeleton
reorganization, in addition to their function as secondary
messenger molecules (Martin, T., 1998).
[0017] The direct and important involvement of all the enzymes,
that CD63 was found until now to be directly associated with, in
the regulation of signaling pathways provided further evidence in
support of the association of CD63 with the modulation of signal
transduction pathways, either as a regulator or as an effector
molecule downstream from the activity of these enzymes.
[0018] Elucidation of the mechanisms that lead to tumor progression
is a very difficult and complex endeavor frequently marked by
apparently contradictory observations and, as a result, it rare
that those observations successfully translate into effective
therapies. In view of what is currently known about the association
of CD63 with tumor progression and metastasis and with signal
transduction mechanisms, it is possible that its function may be
altered, in tumor cells.
[0019] Development of antigen-specific reagents with cytotoxic
effects on tumor cells, that bind cells expressing the recognized
antigen(s) and which by themselves, or associated with other
molecules, have cellular and in vivo physiological activity such
that these reagents inhibit tumor cell growth, progression and
metastasis, without significant deleterious effects on normal cell
populations, would be extremely beneficial as a potential
therapeutic and or diagnostic tool.
Prior Patents
[0020] U.S. Pat. No. 5,296,348 teaches methods for selecting
monoclonal antibodies specific for cancer cell surface antigens
that are internalizing, and for identifying monoclonal antibodies
having anti-transcriptional and/or anti-replicational effects on
cell metabolism. By way of example the ME491 antibody was shown to
internalize in W9, WM35, WM983 melanoma cells, and SW948 colorectal
carcinoma cells. In addition ME491 antibody was shown to decrease
transcription and cell proliferation in SW948 cells. The patent
application US20030211498A1 (and its related applications:
WO0175177A3, WO0175177A2, AU0153140A5) allege a method of
inhibiting the growth or metastasis of an ovarian tumor with an
antibody that binds an ovarian tumor marker polypeptide encoded by
an ovarian tumor marker gene selected from among a group that
includes CD63 antigen. Serial analysis of gene expression using
ovarian cancer was carried out to identify ovarian tumor marker
genes which lead to the identification of CD63 as a candidate. The
patent application WO02055551A1 (and its related application
CN1364803A) alleges a new polypeptide-human CD63 antigen 56.87. The
patent application CN1326962A alleges a new polypeptide-human CD63
antigen 14.63. The patent application CN1326951A alleges a new
polypeptide-human CD63 antigen 15.07. The patent application
CN1351054A alleges a new polypeptide-human CD63 antigen 11.11.
These patents and patent applications identify CD63 antigens and
antibodies but fail to disclose the isolated monoclonal antibody of
the instant invention, or the utility of the isolated monoclonal
antibody of the instant invention.
SUMMARY OF THE INVENTION
[0021] The instant inventors have previously been awarded U.S. Pat.
No. 6,180,357, entitled "Individualized Patient Specific
Anti-Cancer Antibodies" directed to a process for selecting
individually customized anti-cancer antibodies, which are useful in
treating a cancerous disease. For the purpose of this document, the
terms "antibody" and "monoclonal antibody" (mAb) may be used
interchangeably and refer to intact immunoglobulins produced by
hybridomas (e.g. murine or human), immunoconjugates and, as
appropriate, immunoglobulin fragments and recombinant proteins
derived from said immunoglobulins, such as chimeric and humanized
immunoglobulins, F(ab') and F(ab').sub.2 fragments, single-chain
antibodies, recombinant immunoglobulin variable regions (Fv)s,
fusion proteins etc. It is well recognized in the art that some
amino acid sequence can be varied in a polypeptide without
significant effect on the structure or function of the protein. In
the molecular rearrangement of antibodies, modifications in the
nucleic or amino acid sequence of the backbone region can generally
be tolerated. These include, but are not limited to, substitutions
(preferred are conservative substitutions), deletions or additions.
Furthermore, it is within the purview of this invention to
conjugate standard chemotherapeutic modalities, e.g. radionuclides,
with the CDMAB of the instant invention, thereby focusing the use
of said chemotherapeutics. The CDMAB can also be conjugated to
toxins, cytotoxic moieties, enzymes e.g. biotin conjugated enzymes,
or hematogenous cells, thereby forming an antibody conjugate.
[0022] This application utilizes the method for producing patient
specific anti-cancer antibodies as taught in the '357 patent for
isolating hybridoma cell lines which encode for cancerous disease
modifying monoclonal antibodies. These antibodies can be made
specifically for one tumor and thus make possible the customization
of cancer therapy. Within the context of this application,
anti-cancer antibodies having either cell-killing (cytotoxic) or
cell-growth inhibiting (cytostatic) properties will hereafter be
referred to as cytotoxic. These antibodies can be used in aid of
staging and diagnosis of a cancer, and can be used to treat tumor
metastases.
[0023] The prospect of individualized anti-cancer treatment will
bring about a change in the way a patient is managed. A likely
clinical scenario is that a tumor sample is obtained at the time of
presentation, and banked. From this sample, the tumor can be typed
from a panel of pre-existing cancerous disease modifying
antibodies. The patient will be conventionally staged but the
available antibodies can be of use in further staging the patient.
The patient can be treated immediately with the existing antibodies
and/or a panel of antibodies specific to the tumor can be produced
either using the methods outlined herein or through the use of
phage display libraries in conjunction with the screening methods
herein disclosed. All the antibodies generated will be added to the
library of anti-cancer antibodies since there is a possibility that
other tumors can bear some of the same epitopes as the one that is
being treated. The antibodies produced according to this method may
be useful to treat cancerous disease in any number of patients who
have cancers that bind to these antibodies.
[0024] Using substantially the process of U.S. Pat. No. 6,180,357,
and as disclosed in Ser. No. 10/348,231, the mouse monoclonal
antibody 7BD-33-11A was obtained following immunization of mice
with cells from a patient's breast tumor biopsy. The 7BD-33-11A
antigen was expressed on the cell surface of a wide range of human
cell lines from different tissue origins. The breast cancer cell
line MCF-7 and prostate cancer cell line PC-3 were susceptible to
the cytotoxic effects of 7BD-33-11A in vitro.
[0025] The result of 7BD-33-11A cytotoxicity against breast and
prostate cancer cells in culture was further extended by its
anti-tumor activity towards these cancer indications in vivo (as
disclosed in Ser. No. 10/348,231 and Ser. No. 10/603,006).
Pre-clinical xenograft tumor models are considered valid predictors
of therapeutic efficacy.
[0026] As outlined and described in Ser. No. 10/348,284 and Ser.
No. 10/603,006, 7BD-33-11A prevented tumor growth and tumor burden
in a preventative in vivo model of human breast cancer. Monitoring
continued past 300 days post-treatment. 7BD-33-11A never developed
tumors and 87.5 percent of the 7BD-33-11A treatment group was still
alive at over 9 months post-implantation. Conversely, the isotype
control group had 100 percent mortality by day 72 (23 days
post-treatment). Therefore 7BD-33-11A enhanced survival and
prevented tumor growth (thus delaying disease progression) in a
breast cancer model.
[0027] Also as outlined and described in Ser. No. 10/348,284 and
Ser. No. 10/603,006, 7BD-33-11A significantly suppressed tumor
growth and decreased tumor burden in an established in vivo model
of human breast cancer. By day 80 (23 days post-treatment),
7BD-33-11A treated mice had 83 percent lower mean tumor volumes in
comparison to the isotype control group (p=0.001). Using survival
as a measure of antibody efficacy, it was estimated that the risk
of dying in the 7BD-33-11A treatment group was about 16 percent of
the isotype control group (p=0.0006) at around 60 days
post-treatment. 100 percent of the isotype control group died by 50
days post-treatment. In comparison, 60 percent of the 7BD-33-11A
treatment groups were still alive at 130 days post-treatment. This
data demonstrated that 7BD-33-11A treatment conferred a survival
benefit and reduced tumor burden compared to the control treated
group. 7BD-33-11A treatment appeared safe, as it did not induce any
signs of toxicity, including reduced body weight and clinical
distress. Thus, 7BD-33-11A treatment was efficacious as it both
delayed tumor growth and enhanced survival compared to the
control-treated groups in a well-established model of human breast
cancer.
[0028] The effect of 7BD-33-11A compared to a chemotherapeutic drug
(Cisplatin) treatment alone or in combination was determined in two
different established breast cancer xenograft models. In the
MDA-MB-231 (MB-231) model, at day 69 (5 days after treatment),
7BD-33-11A treatment resulted in a 76 percent reduction in tumor
growth relative to the buffer control treated animals (p<0.001).
Cisplatin treatment alone or in combination with 7BD-33-11A
resulted in a 79 and 86 percent reduction in tumor size,
respectively, relative to the control (p<0.001). In the
MDA-MB-468 (MB-468) model, at day 55 (5 days after treatment)
Cisplatin treatment alone and in combination with 7BD-33-11A showed
the greatest reduction in tumor growth, 95 percent (p=0.024) and 97
percent (p=0.17) respectively. Also at day 55, 7BD-33-11A treatment
alone showed a reduction in tumor growth by 37 percent (p=0.3958),
in comparison to the buffer control. In both the MB-231 and MB-468
model, treatment with 7BD-33-11A led to greater animal well-being
in comparison to treatment with Cisplatin as measured by body
weight. These results indicate that 7BD-33-11A treatment has
greater efficacy in comparison to Cisplatin treatment alone in the
MB-231 model and was better tolerated with fewer adverse effects,
such as weight loss, than Cisplatin in both breast cancer
models.
[0029] To determine the efficacious effects of 7BD-33-11A treatment
at various doses, a dose response experiment was performed in a
preventative breast cancer xenograft model. At day 55 (5 days after
treatment), the 0.2 mg/kg treatment group had prevented tumor
growth by 85 percent relative to the isotype control treated group.
Also at day 55, both the 2 and 20 mg/kg treatment groups had yet to
develop tumors. Similar results were obtained past day 125 (75 days
after treatment), where the 20 mg/kg treatment group had still not
developed tumors and the 2 mg/kg treatment group had some initial
tumor growth. 7BD-33-11A treatment also demonstrated a survival
benefit. All of the mice in the isotype control group had died by
day 104 (54 days after treatment) while the 0.2 mg/kg 7BD-33-11A
treatment group survived until day 197 (147 days after treatment).
Even greater survival benefits were observed with the 2.0 and 20
mg/kg 7BD-33-11A treatment groups; only 50 percent of the 2.0 mg/kg
treatment group had died by day 290 (240 days after treatment)
while none of the 20 mg/kg treatment group had died by also day
290. Therefore, 7BD-33-11A treatment showed significant tumor
growth reduction and increased survival with all three doses with
the greatest degree of efficacy being exhibited by the highest
dose.
[0030] In addition to the beneficial effects in the established in
vivo tumor model of breast cancer, 7BD-33-11A treatment also had
anti-tumor activity against PC-3 cells in a preventative in vivo
prostate cancer model (outlined in Ser. No. 10/603,006). 7BD-33-11A
treatment was significantly (p=0.001) more effective in suppressing
tumor growth shortly after the treatment period than an isotype
control antibody. At the end of the treatment phase, mice given
7BD-33-11A had tumors that grew to only 31 percent of the isotype
control group. For PC-3 SCID xenograft models, body weight can be
used as a surrogate indicator of disease progression. On day 52,
7BD-33-11A treatment significantly (p=0.002) prevented the loss of
body weight by 54 percent in comparison to isotype control. Mice
were monitored for survival post-treatment. At 11 days
post-treatment, isotype and buffer control mice had reached 100
percent mortality. Conversely, 7BD-33-11A reached 100 percent
mortality at day 38 post-treatment, 3 times longer than the control
groups. Thus, 7BD-33-11A treatment was efficacious as it both
delayed tumor growth, prevented body weight loss and extended
survival compared to the isotype control treated group in a
well-established model of human prostate cancer.
[0031] In addition to the preventative in vivo tumor model of
prostate cancer, 7BD-33-11A demonstrated anti-tumor activity
against PC-3 cells in an established in vivo tumor model (outlined
in Ser. No. 10/603,006). Treatment with 7BD-33-11A was again
compared to isotype control. It was shown that the 7BD-33-11A
treatment group had significantly (p<0.024) smaller mean tumor
volumes compared with the isotype control treated group immediately
following treatment. 7BD-33-11A treatment mediated tumor
suppression by 36 percent compared to the isotype control group.
The anti-tumor activities of 7BD-33-11A, in several different
cancer models, make it an attractive anti-cancer therapeutic
agent.
[0032] In order to validate the 7BD-33-11A epitope as a drug
target, the expression of 7BD-33-11A antigen in normal human
tissues was previously determined (Ser. No. 10/603,006). This work
was extended by comparison with commercially available anti-CD63
antibodies (RFAC4 and H5C6). Results from tissue staining indicated
that 7BD-33-11A again showed restricted binding to various cell
types but had binding to infiltrating macrophages, lymphocytes, and
fibroblasts. The RFAC4 and H5C6 antibodies showed a similar
staining pattern in comparison to each other. However, the staining
pattern of both RFAC4 and H5C6 was quite different than that
observed with 7BD-33-11A. Specifically, both RFAC4 and H5C6
antibodies bound to a broader range of normal tissues, usually had
higher staining intensity in tissues where 7BD-33-11A was also
positive and bound not only to infiltrating macrophages,
lymphocytes and fibroblasts but also to the epithelium in a
majority of the tissues.
[0033] Localization of the 7BD-33-11A antigen and determining its
prevalence within the population, such as among breast cancer
patients, is important in assessing the therapeutic use of
7BD-33-11A and designing effective clinical trials. To address
7BD-33-11A antigen expression in breast tumors from cancer
patients, tumor tissue samples from 50 individual breast cancer
patients were previously screened for expression of the 7BD-33-11A
antigen (Ser. No. 10/603,006). Current work compared the staining
of 7BD-33-11A to RFAC4 and H5C6 and to an anti-Her2 antibody
(c-erbB-2). The results of the current study were similar to
previous results and showed that 36 percent of tumor tissue samples
stained positive for the 7BD-33-11A antigen while 94 and 85 percent
of breast tumor tissues were positive for the H5C6 and RFAC4
epitope respectively. Expression of 7BD-33-11A within patient
samples appeared specific for cancer cells as staining was
restricted to malignant cells. In addition, 7BD-33-11A stained 0 of
10 samples of normal tissue from breast cancer patients while both
H5C6 and RFAC4 stained 7 of 8 samples of normal breast tissue.
Breast tumor expression of the 7BD-33-11A antigen appeared to be
localized to the cell membrane and cytoplasm of malignant cells,
making CD63 an attractive target for therapy. 7BD-33-11A expression
was further evaluated based on breast tumor expression of the
receptors for the hormones estrogen and progesterone, which play an
important role in the development, treatment, and prognosis of
breast tumors. There was a slight correlation between estrogen or
progesterone receptor expression and expression of 7BD-33-11A;
tissues with receptor expression had slightly higher 7BD-33-11A
expression. When tumors were analyzed based on their stage, or
degree to which the cancer advanced, results suggested a trend
towards greater positive expression with higher tumor stage for
7BD-33-11A. Similar results were obtained with RFAC4. H5C6 also
showed a very slight correlation with estrogen or progesterone
receptor expression but there was no apparent correlation with
tumor stage. However, for all three antibodies, the results were
limited by the small sample size. In comparison to c-erbB-2,
7BD-33-11A showed a completely different staining profile where
half of the breast tumor tissue samples that were positive for the
7BD-33-11A antigen were negative for Her2 expression indicating a
yet unmet targeted therapeutic need for breast cancer patients.
There were also differences in the intensity of staining between
the breast tumor tissue sections that were positive for both
7BD-33-11A and Her2. The c-erbB-2 antibody also positively stained
one of the normal breast tissue sections.
[0034] Localization of the 7BD-33-11A antigen and its prevalence
within prostate cancer patients is important in assessing the
benefits of 7BD-33-11A immunotherapy to patients with prostate
cancer and designing effective clinical trials. To address
7BD-33-11A antigen expression in prostate tumors from cancer
patients, tumor tissue samples from 51 individual prostate cancer
patients were screened for expression of the 7BD-33-11A antigen.
The results of the study showed that 88 percent of tissue samples
stained positive for the 7BD-33-11A antigen. Although 7BD-33-11A
stained the normal tissue sections with high intensity as well,
there was a higher degree of membranous staining in the tumor
tissue samples in comparison to the normal samples. There was one
embryonal rhabdomyosarcroma tissue sample that did not stain for
the 7BD-33-11A antigen. There also appeared to be no direct
correlation between tumor stage and presence of the 7BD-33-11A
antigen. However, the results were limited by the small sample
size.
[0035] To further extend the potential therapeutic benefit of
7BD-33-11A, the frequency and localization of the antigen within
various human cancer tissues was also previously determined (Ser.
No. 10/603,006). Several cancer types, in addition to breast and
prostate cancer, expressed the 7BD-33-11A antigen. The positive
human cancer types included skin (1/2), lung (3/4), liver (2/3),
stomach (4/5), thyroid (2/2), uterus (4/4) and kidney (3/3). Some
cancers did not express the antigen; these included ovary (0/3),
testis (0/1), brain (0/2) and lymph node (0/2). As with human
breast and prostate cancer tissue, localization of 7BD-33-11A
occurred both on the membrane and within the cytoplasm of these
tumor cells. So, in addition to the 7BD-33-11A antibody binding to
cancer cell lines in vitro, there is evidence that the antigen is
expressed in humans, and on multiple types of cancers.
[0036] As outlined herein, additional biochemical data also
indicate that the antigen recognized by 7BD-33-11A is CD63. This is
supported by studies showing that two monoclonal antibodies (RFAC4
and H5C6), reactive against CD63, identify proteins that bound to
7BD-33-11A by immunoprecipitation. In addition, further bacterial
expression studies elucidated that 7BD-33-11A bound to
extracellular loop 2 of CD63. The 7BD-33-11A epitope was also
distinguished by being conformation dependent. These IHC and
biochemical results demonstrate that 7BD-33-11A binds to the CD63
antigen. Thus, the preponderance of evidence shows that 7BD-33-11A
mediates anti-cancer effects through ligation of a unique
conformational epitope present on CD63. For the purpose of this
invention, said epitope is defined as a "CD63 antigenic moiety"
characterized by its ability to bind with a monoclonal antibody
encoded by the hybridoma cell line 7BD-33-11A, antigenic binding
fragments thereof or antibody conjugates thereof.
[0037] In toto, this data demonstrates that the 7BD-33-11A antigen
is a cancer associated antigen and is expressed in humans, and is a
pathologically relevant cancer target. Further, this data also
demonstrates the binding of the 7BD-33-11A antibody to human cancer
tissues, and can be used appropriately for assays that can be
diagnostic, predictive of therapy, or prognostic. In addition, the
cell membrane localization of this antigen is indicative of the
cancer status of the cell due to the lack of expression of the
antigen in most non-malignant cells, and this observation permits
the use of this antigen, its gene or derivatives, its protein or
its variants to be used for assays that can be diagnostic,
predictive of therapy, or prognostic.
[0038] The present invention describes the development and use of
7BD-33-11A, developed by the process described in patent U.S. Pat.
No. 6,180,357 and identified by, its effect, in a cytotoxic assay,
in non-established and established tumor growth in animal models
and in prolonging survival time in those suffering from cancerous
disease. This invention represents an advance in the field of
cancer treatment in that it describes, for the first time, a
reagent that binds specifically to an epitope present on the target
molecule, CD63, and that also has in vitro cytotoxic properties
against malignant tumor cells but not normal cells, and which also
directly mediates inhibition of tumor growth and enhancement of
survival in in vivo models of human cancer. This is an advance in
relation to any other previously described anti-CD63 antibody,
since none have been shown to have similar properties. It also
provides an advance in the field since it clearly demonstrates, and
for the first time, the direct involvement of CD63 in events
associated with growth and development of certain types of tumors.
It also represents an advance in cancer therapy since it has the
potential, to display similar anti-cancer properties in human
patients. A further advance is that inclusion of this antibody in a
library of anti-cancer antibodies will enhance the possibility of
targeting tumors expressing different antigen markers by
determination of the appropriate combination of different
anti-cancer antibodies, to find the most effective in targeting and
inhibiting growth and development of the tumors.
[0039] In all, this invention teaches the use of the 7BD-33-11A
antigen as a target for a therapeutic agent, that when administered
can reduce the tumor burden of a cancer expressing the antigen in a
mammal, and can also lead to a prolonged survival of the treated
mammal. This invention also teaches the use of a CDMAB
(7BD-33-11A), and its derivatives, and antigen binding fragments
thereof, to target its antigen to reduce the tumor burden of a
cancer expressing the antigen in a mammal, and to prolong the
survival of a mammal bearing tumors that express this antigen.
Furthermore, this invention also teaches the use of detecting the
7BD-33-11A antigen in cancerous cells that can be useful for the
diagnosis, prediction of therapy, and prognosis of mammals bearing
tumors that express this antigen.
[0040] If a patient is refractory to the initial course of therapy
or metastases develop, the process of generating specific
antibodies to the tumor can be repeated for re-treatment.
Furthermore, the anti-cancer antibodies can be conjugated to red
blood cells obtained from that patient, or a compatible donor, and
re-infused for treatment of metastases. There have been few
effective treatments for metastatic cancer and metastases usually
portend a poor outcome resulting in death. However, metastatic
cancers are usually well vascularized and the delivery of
anti-cancer antibodies by red blood cells can have the effect of
concentrating the antibodies at the site of the tumor. Even prior
to metastases, most cancer cells are dependent on the host's blood
supply for their survival and anti-cancer antibodies conjugated to
red blood cells can be effective against in situ tumors as well.
Alternatively, the antibodies may be conjugated to other
hematogenous cells, e.g. lymphocytes, macrophages, monocytes,
natural killer cells, etc.
[0041] There are five classes of antibodies and each is associated
with a function that is conferred by its heavy chain. It is
generally thought that cancer cell killing by naked antibodies are
mediated either through antibody-dependent cell-mediated
cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC). For
example murine IgM and IgG2a antibodies can activate human
complement by binding the C-1 component of the complement system
thereby activating the classical pathway of complement activation
which can lead to tumor lysis. For human antibodies, the most
effective complement-activating antibodies are generally IgM and
IgG1. Murine antibodies of the IgG2a and IgG3 isotype are effective
at recruiting cytotoxic cells that have Fc receptors which will
lead to cell killing by monocytes, macrophages, granulocytes and
certain lymphocytes. Human antibodies of both the IgG1 and IgG3
isotype mediate ADCC.
[0042] Another possible mechanism of antibody-mediated cancer
killing may be through the use of antibodies that function to
catalyze the hydrolysis of various chemical bonds in the cell
membrane and its associated glycoproteins or glycolipids, so-called
catalytic antibodies.
[0043] There are two additional mechanisms of antibody-mediated
cancer cell killing, which are more widely accepted. The first is
the use of antibodies as a vaccine to induce the body to produce an
immune response against the putative antigen that resides on the
cancer cell. The second is the use of antibodies to target growth
receptors and interfere with their function or to down regulate
that receptor so that its function is effectively lost.
[0044] The clinical utility of a cancer drug is based on the
benefit of the drug under an acceptable risk profile to the
patient. In cancer therapy survival has generally been the most
sought after benefit, however there are a number of other
well-recognized benefits in addition to prolonging life. These
other benefits, where treatment does not adversely affect survival,
include symptom palliation, protection against adverse events,
prolongation in time to recurrence or disease-free survival, and
prolongation in time to progression. These criteria are generally
accepted and regulatory bodies such as the U.S. Food and Drug
Administration (F.D.A.) approve drugs that produce these benefits
(Hirschfeld et al. Critical Reviews in Oncology/Hematolgy
42:137-143 2002). In addition to these criteria it is well
recognized that there are other endpoints that may presage these
types of benefits. In part, the accelerated approval process
granted by the U.S. F.D.A. acknowledges that there are surrogates
that will likely predict patient benefit. As of year-end (2003),
there have been sixteen drugs approved under this process, and of
these, four have gone on to full approval, i.e., follow-up studies
have demonstrated direct patient benefit as predicted by surrogate
endpoints. One important endpoint for determining drug effects in
solid tumors is the assessment of tumor burden by measuring
response to treatment (Therasse et al. Journal of the National
Cancer Institute 92(3):205-216 2000). The clinical criteria (RECIST
criteria) for such evaluation have been promulgated by Response
Evaluation Criteria in Solid Tumors Working Group, a group of
international experts in cancer. Drugs with a demonstrated effect
on tumor burden, as shown by objective responses according to
RECIST criteria, in comparison to the appropriate control group
tend to, ultimately, produce direct patient benefit. In the
pre-clinical setting tumor burden is generally more straightforward
to assess and document. In that pre-clinical studies can be
translated to the clinical setting, drugs that produce prolonged
survival in pre-clinical models have the greatest anticipated
clinical utility. Analogous to producing positive responses to
clinical treatment, drugs that reduce tumor burden in the
pre-clinical setting may also have significant direct impact on the
disease. Although prolongation of survival is the most sought after
clinical outcome from cancer drug treatment, there are other
benefits that have clinical utility and it is clear that tumor
burden reduction, which may correlate to a delay in disease
progression, extended survival or both, can also lead to direct
benefits and have clinical impact (Eckhardt et al. Developmental
Therapeutics: Successes and Failures of Clinical Trial Designs of
Targeted Compounds; ASCO Educational Book, 39.sup.th Annual
Meeting, 2003, pages 209-219).
[0045] Accordingly, it is an objective of the invention to utilize
a method for producing cancerous disease modifying antibodies from
cells derived from a particular individual which are cytotoxic with
respect to cancer cells while simultaneously being relatively
non-toxic to non-cancerous cells, in order to isolate hybridoma
cell lines and the corresponding isolated monoclonal antibodies and
antigen binding fragments thereof for which said hybridoma cell
lines are encoded.
[0046] It is an additional objective of the invention to teach
CDMAB and antigen binding fragments thereof.
[0047] It is a further objective of the instant invention to
produce CDMAB whose cytotoxicity is mediated through ADCC.
[0048] It is yet an additional objective of the instant invention
to produce CDMAB whose cytotoxicity is mediated through CDC.
[0049] It is still a further objective of the instant invention to
produce CDMAB whose cytotoxicity is a function of their ability to
catalyze hydrolysis of cellular chemical bonds.
[0050] A still further objective of the instant invention is to
produce CDMAB which are useful in a binding assay for diagnosis,
prognosis, and monitoring of cancer.
[0051] Other objects and advantages of this invention will become
apparent from the following description wherein, by way of
illustration and example, certain embodiments of this invention are
set forth.
BRIEF DESCRIPTION OF THE FIGURES
[0052] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the Office
upon request and payment of the necessary fee.
[0053] FIG. 1. Western blot of MDA-MB-231 whole cell lysates (Lane
1) or membranes (Lanes 2 and 3) probed with 7BD-33-11A (Panel A) or
isotype control (Panel B). Molecular weight markers are indicated
on the left.
[0054] FIG. 2. Western blot of MDA-MB-231 membranes probed with
7BD-33-11A. Lane 1: Membrane run under reducing conditions. Lane 2:
Membranes run under non-reducing conditions. Molecular weight
markers are indicated on the left.
[0055] FIG. 3. Effect of deglycosylation on the binding of
7BD-33-11A to MDA-MB-231 membranes. MDA-MB-231 membranes were
subjected to treatment with glycopeptidast F (PNGase F; Lane 1),
O-glycanase (Lane 2), sialidase (Lane 3), the combination of PNGase
F, O-glycanase and sialidase (Lane 4), the combination of PNGase F,
O-glycanase, sialidase, galactosidase and glucosaminidase (Lane 5)
or buffer control (Lane 6). Molecular weight markers are indicated
on the left.
[0056] FIG. 4. SDS-PAGE (Panel A) and Western blot (Panel B) of
MDA-MB-231 membrane proteins immunoprecipitated with 7BD-33-11A.
Lane A isotype control immunoprecipitated proteins, Lane B:
7BD-33-11A immunoprecipitated proteins and Lane TM: Total
MDA-MB-231 membrane proteins. Rectangular box outlines the same
band from Lane B in the SDS-PAGE and Lane TM in the Western blot.
Molecular weight markers are indicated on the left.
[0057] FIG. 5. Profound search summary table.
[0058] FIG. 6. MASCOT search summary table. The peptide disclosed
in the lower right corner is designated SEQ ID NO: 5.
[0059] FIG. 7a: Western blots of proteins probed with 7BD-33-11A
(Panel A), anti-CD63 (clone RFAC4, Panel B), IgG2a isotype control
(Panel C) and IgG1 isotype control (Panel D). Lane A: Total
MDA-MB-231 membrane proteins; Lane B: 7BD-33-11A immunoprecipitated
proteins; Lane C: anti-CD63 (RFAC4) immunoprecipitated proteins,
Lane D: IgG2a isotype control immunoprecipitated proteins and Lane
E: IgG1 isotype control immunoprecipitated proteins. Molecular
weight markers are indicated on the left.
[0060] FIG. 7b: Western blots of proteins probed with 7BD-33-11A
(Panel A), anti-CD63 (clone H5C6, Panel B), IgG2a isotype control
(Panel C) and IgG1 isotype control (Panel D). Lane A: Total
MDA-MB-231 membrane proteins; Lane B: 7BD-33-11A immunoprecipitated
proteins; Lane C: anti-CD63 (H5C6) immunoprecipitated proteins,
Lane D: IgG2a isotype control immunoprecipitated proteins and Lane
E: IgG1 isotype control immunoprecipitated proteins. Molecular
weight markers are indicated on the left.
[0061] FIG. 8. Western blots of proteins probed with 7BD-33-11A
(Panel A), anti-CD63 (clone RFAC4, Panel B), anti-CD63 (clone H5C6,
Panel C), IgG2a isotype control (Panel D) and IgG1 isotype control
(Panel E). Lanes 1-5 contain 7BD-33-11A immunoprecipitated proteins
and Lanes 6-10 contain IgG2a isotype control immunoprecipitated
proteins. Lanes 1 and 6: no NaCl, Lanes 2 and 7: 150 mM NaCl, Lanes
3 and 8: 500 mM NaCl, Lanes 4 and 9: 2000 mM NaCl and Lanes 5 and
10: RIPA buffer.
[0062] FIG. 9. Western blots of proteins probed with 7BD-33-11A
(Panel A), anti-CD63 (clone RFAC4, Panel B), anti-CD63 (clone H5C6,
Panel C), IgG2a isotype control (Panel D) and Coomassie Colloidal
Blue protein stain (Panel E). Lane 1: non-induced vector alone,
Lane 2: non-induced GST-EC1, Lane 3: non-induced GST-EC2, Lane 4:
induced vector alone, Lane 5: induced GST-EC1 and Lane 6: induced
GST-EC2. Molecular weight markers are indicated on the left.
[0063] FIG. 10. Representative FACS histograms of 7BD-33-11A,
isotype controls and anti-EGFR directed against several cancer cell
lines and non-cancer cells.
[0064] FIG. 11. Representative micrographs showing the binding
pattern obtained with 7BD-33-11A (A), isotype negative control (B),
anti-CD63 (RFAC4) antibody or the anti-CD63 (H5C6) antibody (D) on
tissues sections of colon from a normal human tissue array.
7BD-33-11A, RFAC4 and H5C6 displayed positive staining for
macrophages and lymphocytes at the lamina propria. RFAC4 and H5C6
also displayed strong staining for the mucosal epithelieum.
Magnification is 200.times..
[0065] FIG. 12. Representative micrographs showing the binding
pattern obtained with 7BD-33-11A (A), isotype negative control (B),
anti-CD63 (RFAC4) antibody or the anti-CD63 (H5C6) antibody (D) on
tissues sections of infiltrative ductal carcinoma from a human
breast cancer tissue array. 7BD-33-11A displayed weaker positive
staining for the tumor cells in comparison to either RFAC4 or H5C6
antibody. Magnification is 200.times..
[0066] FIG. 13. Representative micrographs showing the binding
pattern obtained with 7BD-33-11A (A) or the anti-Her2 (c-erbB-2)
antibody (B) on tissues sections of infiltrative ductal carcinoma
from a human breast cancer tissue array. 7BD-33-11A displayed
strong positive staining for the tumor cells in comparison to the
anti-Her2 antibody, which displayed negative staining.
Magnification is 200.times..
[0067] FIG. 14. Representative micrographs showing the binding
pattern obtained with 7BD-33-11A on tissues sections of prostate
adenocarinoma (A) or normal prostate (B) from a human prostate
cancer tissue array. 7BD-33-11A displayed strong positive
membranous staining for the tumor cells in the adenocarcinoma
tissue section. 7BD-33-11A showed both membranous and cytoplasmic
staining of the glandular epithelium in the normal prostate tissue
section. Magnification is 200.times..
[0068] FIG. 15. Effect of 7BD-33-11A or isotype control on tumor
growth in a dose response preventative MDA-MB-231 breast cancer
model. The dashed line indicates the period during which the
antibody was administered. Data points represent the
mean+/-SEM.
[0069] FIG. 16. Survival of tumor-bearing mice after treatment with
7BD-33-11A or isotype control antibody in a dose response
preventative MDA-MB-231 xenograft study.
[0070] FIG. 17. Effect of 7BD-33-11A, Cisplatin,
7BD-33-11A+Cisplatin or buffer control on tumor growth in an
established MDA-MB-231 breast cancer model. The dashed line
indicates the period during which the antibody was administered.
Data points represent the mean+/-SEM.
[0071] FIG. 18. Effect of 7BD-33-11A, Cisplatin,
7BD-33-11A+Cisplatin or buffer control on body weight in an
established MDA-MB-231 breast cancer model.
[0072] FIG. 19. Effect of 7BD-33-11A, Cisplatin,
7BD-33-11A+Cisplatin or buffer control on tumor growth in an
established MDA-MB-468 breast cancer model. The dashed line
indicates the period during which the antibody/Cisplatin was
administered. Data points represent the mean+/-SEM.
[0073] FIG. 20. Effect of 7BD-33-11A, Cisplatin,
7BD-33-11A+Cisplatin or buffer control on body weight in an
established MDA-MB-468 breast cancer model.
DETAILED DESCRIPTION OF THE INVENTION
Example 1
Identification of Binding Proteins by Western Immunoblotting
[0074] To identify the antigen(s) recognized by the antibody
7BD-33-11A, cell membrane preparations were subjected to sodium
dodecylsulphate polyacrylamide gel electrophoresis (SDS-PAGE), and
transferred to membranes. The latter were probed with the antibody
7BD-33-11A to visualize the proteins detected by this antibody.
1 Whole Cell Lysate and Total Membrane Fraction Preparation
1.1. Whole Cell Lysate Preparation
[0075] Previous work by FACS demonstrated binding of antibody
7BD-33-11A to the breast cancer cell line MDA-MB-231 (MB-231). As a
result total cell membrane preparations and whole cell lysates
obtained from this cell line were used for the antigen
identification and characterization. Total cell lysate from MB-231
cells was prepared as follows: MB-231 cell pellet (1.5 g) was
resuspended in 2 mL lysis buffer containing 20 mM Tris, pH 7.4, 150
mM NaCl, 1% (v/v) Triton X-100, 0.02% (w/v) sodium azide, 2 mM
sodium orthovanadate, 50 mM sodium fluoride, and a protease
inhibitor cocktail (Roche Diagnostics; Manheim, Germany). The
pellet was homogenized with a glass homogenizer and was incubated
with stirring, for 1 hr at 4.degree. C. Samples were then subjected
to centrifugation (20,000 g) for 15 min at 4.degree. C., to remove
detergent insoluble material. Supernatants were collected, divided
in aliquots, and frozen at -80.degree. C. The protein concentration
in the cell lysate was determined by the BCA (bicinchoninic acid)
assay (Pierce; Rockford, Ill.).
1.2. Total Cell Membrane Fraction Preparation
[0076] Total cell membranes were prepared from confluent cultures
of MB-231 breast cancer cells. Media was removed from cell stacks
and the cells were washed with phosphate buffered saline (PBS).
Cells were dissociated with dissociation buffer (Gibco-BRL; Grand
Island, N.Y.) for 20 min at 37.degree. C. on a platform shaker.
Cells were collected and centrifuged at 900 g for 10 min at
4.degree. C. After centrifugation, cell pellets were washed by
resuspending in PBS and centrifuging again at 900 g for 10 min at
4.degree. C. Pellets were then stored at -80.degree. C. until
required. To prepare membranes, cell pellets were thawed and
resuspended in homogenization buffer containing 1 tablet per 50 mL
of complete protease inhibitor cocktail (Roche; Laval QC) at a
ratio of 3 mL buffer per gram of cells. The cell suspension was
subjected to homogenization using a polytron homogenizer on ice in
order to lyse the cells. The cell homogenate was centrifuged at
15,000 g for 10 min at 4.degree. C. to remove the nuclear
particulate. Supernatant was harvested, divided into tubes and then
centrifuged at 75,600 g for 90 min at 4.degree. C. Supernatant was
carefully removed and each membrane pellet was resuspended in
approximately 5 mL of homogenization buffer. The membrane pellets
from all tubes were combined, divided one more time, and
centrifuged at 75,600 g for 90 min at 4.degree. C. Supernatant was
carefully removed and the pellets were weighed. Solubilization
buffer containing 1% Triton X-100 was added to the pellets at a
ratio of 3 mL buffer per gram of membrane pellet. Membranes were
solubilized by shaking on a platform shaker at 300 rpm, for 1 hr on
ice. The membrane suspension was centrifuged at 75,600 g to pellet
insoluble material. The supernatant, containing the solubilized
membrane proteins, was carefully removed from the tubes, assayed
for protein concentration, and stored at -80.degree. C.
2. 1-Dimensional SDS-PAGE and Western Immunoblotting
[0077] Proteins from the total membrane fraction and whole cell
lysate of MB-231 cells were separated by 1-dimensional SDS-PAGE (1D
SDS-PAGE), on a 5 and 10 percent stacking and separating gel,
respectively. Proteins were transferred overnight, at 4.degree. C.,
by electroblotting onto PVDF membranes (Millipore; Billerica,
Mass.). Complete transfer was determined by assessing the transfer
of prestained molecular weight markers onto the membrane. After
transfer, the membranes were blocked with 5 percent (w/v) skim milk
in TBST, for 1 hr at room temperature (RT), and two replicate blots
were then probed as follows: one blot was probed with the antibody
7BD-33-11A (5 .mu.g/ml, in 5 percent skim milk in TBST) and the
replicate blot was probed with an IgG.sub.2a isotype control (5
.mu.g/ml, in 5 percent skim milk in TBST). Blots were washed 3
times for 10 min in TBST and then incubated with horseradish
HRP-conjugated goat anti-mouse IgG (Fc) (Bio-Rad Laboratories;
Hercules, Calif.), for 1 hr at RT. After washing 3 times for 10 min
each with TBST, the blots were developed with the TMB peroxidase
substrate kit (Vector Laboratories; Burlingame, Calif.) following
the manufacturers' instructions. The blots were rinsed with water
and images were acquired with a gel documentation system (FIGS. 1
and 2) (Bio-Rad; Hercules, Calif.). Blots were imaged under the
same conditions of camera focus, aperture and image acquisition
time. In FIG. 1, 7BD-33-11A clearly bound to proteins in the 20-80
kDa range, and its reactivity was detected in the lanes containing
whole cell lysate and total membrane fraction. The isotype control
did not bind to any proteins in the MB-231 lysate or membrane
fractions, indicating that the binding for 7BD-33-11A was specific.
FIG. 2 demonstrated the effect of sample reduction on 7BD-33-11A
binding, on a Western blot. Reactivity of this antibody was only
detected when the samples were prepared under non-reducing
conditions (Lane 2). Reducing agents such as DTT or
.beta.-mercaptoethanol completely eliminated binding (Lane 1),
indicating that recognition and binding of 7BD-33-11A to its
epitope on the native protein depended on the presence of disulfide
bonds.
[0078] To determine if the disperse nature of the antigen, as
detected by Western immunoblotting, was due to heterogeneous
glycosylation, total membrane fractions were subjected to treatment
with several glycosidases (glycopeptidase F, o-glycanase,
sialidase, galactosidase and glucosaminidase) which removed
specific carbohydrate groups. After treatment the samples were
subjected to 1D SDS-PAGE and Western blotting. It was expected that
if some of the enzymes removed a portion of carbohydrate that
accounted for a significant amount of the mass of the antigen(s)
recognized by the antibody 7BD-33-11A, that it would be possible to
detect that difference by SDS-PAGE. FIG. 3 shows that glycosidase
treatment of total membrane fractions from MB-231 cells resulted in
a significant decrease in the mass of the recognized antigen(s).
This indicated that the antigen recognized by the 7BD-33-11A
antibody was comprised of at least one glycoprotein. The fact that
a significant shift in the mobility of the antigen(s) only occurred
when several enzymes were used together indicated that at least
some of the carbohydrate moiety consisted of a complex N-linked
carbohydrate. Although treatment of the membrane with glycosidases
resulted in a molecular weight shift, it did not reduce the
intensity of binding. This suggested that the antibody bound
primarily to the polypeptide portion of the glycoprotein.
Example 2
Identification of Antigens Bound by 7BD-33-11A
[0079] 1. Immunoprecipitation of Antigens from MB-231 Total
Membrane Fraction
[0080] Total membrane extracts (5 mg total protein) were diluted to
a 1 mg/ml final protein concentration with the appropriate volume
of 1.times. lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton
X-100, 0.02% NaN.sub.3, 2 mM sodium orthovanadate, 50 mM sodium
fluoride, and protease inhibitor cocktail (Roche Diagnostics,
Manheim, Germany)), and with the appropriate volume of 2.times.RIPA
buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1.0% sodium cholate, 0.2%
SDS, 1% Triton X-100 and 0.02% NaN.sub.3), in order to obtain a
final 1.times.RIPA buffer concentration. The extracts were
pre-cleared for 2 hr with protein G-Sepharose beads (Amersham
Biosciences, Uppsala, Sweden) at 4.degree. C. Total membrane
extracts were removed and stock BSA (10 mg/ml) was added to a 0.5
mg/ml final BSA concentration. While extracts were being
pre-cleared, antibody-conjugated protein G-Sepharose beads (60
.mu.g of antibody chemically cross-linked to 30 .mu.l of protein G
Sepharose) were blocked with 1 mL of 0.5 mg/ml BSA, by incubation
at 4.degree. C., also for 2 hr. After blocking, the
antibody-conjugated beads were washed twice for 5 min with
1.times.RIPA buffer. The antibody-conjugated protein G-Sepharose
beads were then added to the BSA-containing total membrane
extracts, and incubated for 3 hr, at 4.degree. C., on an
end-over-end rotator. After centrifugation at 20,000 g, for 10
seconds, at 4.degree. C., the unbound fraction was removed and
discarded, and the beads were washed 3 times for 5 min, with 1 mL
of RIPA buffer in each wash step. The beads were then rinsed once
with 1.5 ml of PBS. The immunoprecipitation (IP) described above,
with 7BD-33-11A-conjugated protein G Sepharose was carried out in
parallel with a similar IP in which the protein G-Sepharose beads
were chemically cross-linked with an IgG2a isotype control (BD
Biosciences, San Diego, Calif.). This step was carried out to
enable assessment of non-specific binding of proteins to the
immunocomplexes. After completely draining the PBS, the beads were
boiled in 40 .mu.l of non-reducing sample buffer and the samples
were analyzed by 1D SDS-PAGE followed by Western immunoblotting of
a portion of the gel, and staining with Coomassie Colloidal Blue of
the remaining portion of the gel. Of the 40 .mu.l, a fraction (8
.mu.l) was loaded onto the SDS-PAGE for Western blotting and the
remaining fraction (32 .mu.l) was loaded onto a separate lane of
the same gel for protein staining with Coomassie Colloidal Blue.
The portion of the gel designated for protein staining was
incubated overnight with the Coomassie Colloidal Blue stain. The
portion of the gel designated for Western blotting was transferred
onto a PVDF membrane for 2 hr at 320 mA, rinsed with deionized
water, blocked for 1 hr at RT with 5 percent milk in TBST and then
incubated overnight at 4.degree. C. with 7BD-33-11A in 5 percent
milk in TBST. Blots were washed 3 times for 10 min in TBST and
incubated with an HRP-conjugated Fc-specific goat anti-mouse IgG
(1:5000) in 5 percent milk in TBST, for 1 hr at room temperature.
Blots were then washed 3 times for 10 min and were developed
according to the standard procedure of TMB substrate for HRP. As
displayed in FIG. 4, the Western immunoblot and the Coomassie
Colloidal Blue stained gel were lined up, using the molecular
weight markers as reference. The main band that stained with
Coomassie Colloidal Blue lined up with the main band that reacted
with 7BD-33-11A on the Western blot. This section is highlighted
(rectangle inset) on FIG. 4.
2. Peptide Mapping, and Antigen Identification by Mass
Spectrometry
[0081] From the experiment above, the band on the Coomassie
Colloidal Blue stained gel that lined up with the most intense
reactivity on the Western blot was then cut out and subjected to
in-gel tryptic digestion using a commercially available kit
(Pierce, Rockford, Ill.). Aliquots of the digest were subjected to
mass spectrometry analysis on a SELDI-TOF Ciphergen PBSIIc reader
(Ciphergen Biosystems Inc., Freemont, Calif.). Briefly, an aliquot
of the digest was manually spotted onto an H4 chip (Ciphergen
Biosystems Inc., Freemont, Calif.). After drying, an aliquot of
CHCA matrix (.alpha.-cyano 4-hydroxy cinnaminic acid; Ciphergen
Biosystems Inc., Freemont, Calif.) was added onto the same spot on
the chip and allowed to dry. The sample was then analyzed on the
PBSIIc reader. Similar sized bands from parallel regions on isotype
control lanes and blank gel region were processed side-by-side with
the gel plug from the 7BD-33-11A IP, so as to enable determination
of unique peptide fragments generated by the digestion of the
antigen immunoprecipitated by 7BD-33-11A. The masses of the unique
peptide fragments were searched using PROFOUND, a publicly
accessible online tool for searching protein sequence databases
using information from mass spectra. The unique peptides in the
sample from the 7BD-33-11A IP digest were then subjected to MS/MS
analysis on a QSTAR (Applied Biosystems, Foster City, Calif.)
equipped with an interface that enabled analysis of the same sample
spots that were previously analyzed on the PBSIIc reader. The MS/MS
data was then analyzed with MASCOT, a publicly accessible online
tool for searching protein databases using information from MS/MS
spectra. FIG. 5 is a summary of the table that resulted from the
ProFound search. The only protein that was suggested as a putative
candidate, with a significant degree of confidence was CD63. FIG. 6
is a summary table that resulted from the MASCOT search. The only
protein that was identified with a high degree of probability was
CD63, supporting the previous tentative identification by peptide
map fingerprinting.
3. 7BD-33-11A Antigen ID Confirmation
[0082] Confirmation of the ID of the putative antigen for
7BD-33-11A was carried out through determination of whether known
anti-human CD63 monoclonal antibodies (e.g. RFAC4 and H5C6) would
react with the protein(s) immunoprecipitated by 7BD-33-11A, and
vice versa. Further confirmation was also carried out by Western
immunoblotting of total lysates from induced and non-induced
bacteria transformed with glutathione S-transferase (GST)-fusion
constructs of the extracellular domains of human CD63.
Immunoprecipitates from MB-231 total membrane, and prepared with
the monoclonal antibodies 7BD-33-11A, RFAC4 (Cymbus Biotechnology
LTD, Hants, UK), H5C6 (BD Biosciences, San Diego, Calif.), and with
the IgG.sub.2a and IgG.sub.1 (BD Biosciences, San Diego, Calif.)
isotype controls, were analyzed by 1D SDS-PAGE followed by Western
immunoblotting. Equal fraction volumes from each immunocomplex
sample were analyzed on replicate gels. After electroblotting onto
PVDF membranes, the blots from the replicate gels were probed in
parallel with the monoclonal antibodies 7BD-33-11A, RFAC4, H5C6,
and with the IgG.sub.2a and IgG.sub.1 isotype controls. In FIG. 7a
the result from the cross-IP experiments in which the material
immunoprecipitated by each of the test monoclonal antibodies
7BD-33-11A and RFAC4 was analyzed by Western immunoblotting. In
FIG. 7b the result from the cross-IP experiments in which the
material immunoprecipitated by each of the test monoclonal
antibodies 7BD-33-11A and H5C6 was analyzed by Western
immunoblotting. Each of the monoclonal antibodies 7BD-33-11A, RFAC4
and H.sub.5C5 cross-reacted with similar antigen(s)
immunoprecipitated by 7BD-33-11A. In addition, 7BD-33-11A cross
reacted, on a Western blot, with similar antigen(s)
immunoprecipitated by RFAC4 and H5C6, in the range of 20-80 kDa,
but not with the immunocomplexes prepared with the isotype control
antibodies. The blots probed with the isotype control antibodies
were completely negative. This data indicated that the epitope
recognized by the 7BD-33-11A antibody was contained within the CD63
antigen.
[0083] To determine if the cross-reactivity could be due to the
same molecules being recognized by all antibodies, or if it was due
to the presence of interacting molecules with similar mass,
immunoprecipitations with the antibody 7BD-33-11A were carried out
in conditions of increasing buffer stringency (50 mM Tris pH 7.4,
1% Triton X-100, and varying concentrations of NaCl: 0, 150, 500
and 200 mM; and also with RIPA buffer as described above but
containing 500 mM NaCl). The resulting immunocomplexes were then
probed by Western immunoblotting with the monoclonal antibodies
7BD-33-11A, H5C6 and RFAC4 and with the isotype controls IgG.sub.2a
and IgG.sub.1. FIG. 8 showed that varying the stringency of the IP
conditions did not have any detectable impact on the formation of
the immunocomplexes, which indicated that the molecule(s)
recognized by the antibody 7BD-33-11A were also recognized by the
anti-CD63 antibodies and vice versa.
[0084] To further confirm that 7BD-33-11A was directly binding to
the human CD63 antigen, its reactivity was assessed, by Western
immunoblotting against lysates of E. coli expressing recombinant
fusion polypeptides containing the extracellular domains (loops EC1
and EC2) of human CD63. For this work, GST-fusion constructs of the
extracellular loops of CD63 (loop 1 and loop 2--EC1 and EC2,
respectively) were generated by subcloning the appropriate cDNA
fragments into the bacterial expression vector PGEX-4T-2 (Amersham
Biosciences, Piscataway, N.J.). The cDNA fragments encoding the
loops were obtained by polymerase chain reaction amplification
(PCR), using the full-length human cDNA as a template (clone
MGC-8339, American Type Culture Collection Manassas, Va.). The cDNA
encoding the EC1 loop was obtained using the following PCR
primers:
TABLE-US-00001 5' primer (EC1_5'), (SEQ ID NO:1)
5'GCCGTGGGATCCGGGGCACAGCTTGTCCTG3' and 3' primer (EC1_3'), (SEQ ID
NO:2) 5'GATGACGAATTCTCACAGAGAGCCAGGGGTAGC3'.
The cDNA encoding the EC2 loop was obtained using the following PCR
primers:
TABLE-US-00002 5' primer (EC2_5'), 5'GGCTATGGATCCAGAGATAAGGTGATG3'
(SEQ ID NO:3) and 3' primer (EC2_3'),
5'TACCAGAATTCAATTTTTCCTCAGCCAGCC3'. (SEQ ID NO:4)
The conditions for the PCR reactions were as follows: 2 .mu.L of 5'
primer (25 pmol/.mu.L), 2 .mu.L of 3' primer (25 pmol/.mu.L), 0.2
.mu.L of template DNA (pOTB-CD63, 0.76 mg/mL), and 45.8 .mu.L of
PCR SuperMix High Fidelity (Invitrogen, Burlington, ON). The PCR
reaction was carried out as follows: 94.degree. C. for 5 min
followed by 30 cycles of: melting at 94.degree. C. for 30 sec,
annealing at 55.degree. C. for 30 sec and extension at 72.degree.
C. for 1 min, per cycle.
[0085] After subcloning, the constructs, including a PGEX-4T-2
vector alone negative control (no cDNA fragment subcloned into the
vector), were transformed into E. coli (strain BL-21). A single
ampicillin-resistant colony from each transformation was grown and
the respective insert cDNAs were sequenced. After confirming that
the cDNA sequence was correct, each of the clones was grown in
liquid culture and the expression of the GST-fusion constructs was
induced by addition of 1 mM IPTG
(isopropyl-.beta.-D-thiogalactopyranoside) (Gibco-BRL; Rockville,
Md.). After a 2 hr incubation, the bacteria culture was centrifuged
at 2000 g, for 5 min, at room temperature. The supernatant was
discarded and the bacteria pellets were boiled in non-reducing
SDS-PAGE sample buffer. The samples were then analyzed by SDS-PAGE
(5 and 12 percent) polyacrylamide stacking and separating gels
respectively) and Western immunoblotting, as previously described.
Blot membranes were probed with 7BD-33-11A, H5C6, RFAC4, or with an
IgG2a isotype control. The results illustrated by FIG. 9 revealed
that 7BD-33-11A specifically recognized loop 2 (amino acids
108-202) of human CD63 (lane 6 of blot probed with 7BD-33-11A), and
does not recognize loop 1 (amino acids 34-52). The specificity of
the antibody against the bacterial lysate was further confirmed by
the observation that two well-characterized anti-human CD63
antibodies (RFAC4 and H5C6) also recognized a similar size band,
only on the lysates from induced E. coli expressing the EC2 fusion
polypeptide. All of the above results demonstrate that 7BD-33-11A
recognized and directly bound to human CD63, and specifically to
the extracellular region encompassing amino acids 108-202.
Example 3
[0086] As outlined in Ser. No. 10/348,231, the hybridoma cell line
7BD-33-11A was deposited, in accordance with the Budapest Treaty,
with the American Type Culture Collection, University Blvd.,
Manassas, Va. 20110-2209 on Jan. 8, 2003, under Accession Number
PTA-4890. In accordance with 37 CFR 1.808, the depositors assure
that all restrictions imposed on the availability to the public of
the deposited materials will be irrevocably removed upon the
granting of a patent.
Antibody Production:
[0087] 7BD-33-11A monoclonal antibody was produced by culturing the
hybridoma in CL-1000 flasks (BD Biosciences, Oakville, ON) with
collections and reseeding occurring twice/week. The antibody was
purified according to standard antibody purification procedures
with Protein G Sepharose 4 Fast Flow (Amersham Biosciences, Baie
d'Urfe, QC).
[0088] As previously described in Ser. No. 10/348,231, 7BD-33-11A
was compared to a number of both positive (anti-Fas (EOS9.1, IgM,
kappa, 20 micrograms/mL, eBioscience, San Diego, Calif.),
anti-Her2/neu (IgG1, kappa, 10 microgram/mL, Inter Medico, Markham,
ON), anti-EGFR(C225, IgG1, kappa, 5 microgram/mL, Cedarlane,
Hornby, ON), Cycloheximide (100 micromolar, Sigma, Oakville, ON),
NaN.sub.3 (0.1%, Sigma, Oakville, ON)) and negative (107.3
(anti-TNP, IgG1, kappa, 20 microgram/mL, BD Biosciences, Oakville,
ON), G155-178 (anti-TNP, IgG2a, kappa, 20 microgram/mL, BD
Biosciences, Oakville, ON), MPC-11 (antigenic specificity unknown,
IgG2b, kappa, 20 microgram/mL), J606 (anti-fructosan, IgG3, kappa,
20 microgram/mL), IgG Buffer (2%)) controls in a cytotoxicity assay
(Table 2). Breast cancer (MDA-MB-231 (MB-231), MDA-MB-468 (MB-468),
MCF-7), colon cancer (HT-29, SWI116, SW620), lung cancer (NCI
H460), ovarian cancer (OVCAR), prostate cancer (PC-3), and
non-cancer (CCD 27sk, Hs888 Lu) cell lines were tested (all from
the ATCC, Manassas, Va.). The Live/Dead cytotoxicity assay was
obtained from Molecular Probes (Eugene, Oreg.). The assays were
performed according to the manufacturer's instructions with the
changes outlined below. Cells were plated before the assay at the
predetermined appropriate density. After 2 days, purified antibody
or controls were diluted into media, and then 100 microliters were
transferred to the cell plates and incubated in a 5 percent
CO.sub.2 incubator for 5 days. The plate was then emptied by
inverting and blotted dry. Room temperature DPBS containing
MgCl.sub.2 and CaCl.sub.2 was dispensed into each well from a
multi-channel squeeze bottle, tapped three times, emptied by
inversion and then blotted dry. 50 microliters of the fluorescent
calcein dye diluted in DPBS containing MgCl.sub.2 and CaCl.sub.2
was added to each well and incubated at 37.degree. C. in a 5
percent CO.sub.2 incubator for 30 minutes. The plates were read in
a Perkin-Elmer HTS7000 fluorescence plate reader and the data was
analyzed in Microsoft Excel and the results were tabulated in Table
1. The data represented an average of four experiments tested in
triplicate and presented qualitatively in the following fashion:
4/4 experiments greater than threshold cytotoxicity (+++), 3/4
experiments greater than threshold cytotoxicity (++), 2/4
experiments greater than threshold cytotoxicity (+). Unmarked cells
in Table 1 represent inconsistent or effects less than the
threshold cytotoxicity. The 7BD-33-11A antibody demonstrated
cytotoxicity in a breast and prostate tumor cell line selectively,
while having no effect on non-transformed normal cells. 7BD-33-11A
demonstrated greater killing than the positive control anti-Fas
antibody on the prostate cancer cell line. The chemical cytotoxic
agents induced their expected cytotoxicity while a number of other
antibodies which were included for comparison also performed as
expected given the limitations of biological cell assays. In toto,
it was shown that the 7BD-33-11A antibody has cytotoxic activity
against a number of cancer cell types. The antibody was selective
in its activity since not all cancer cell types were susceptible.
Furthermore, the antibodies demonstrated functional specificity
since they did not produce cytotoxicity against non-cancer cell
types, which is an important factor in a therapeutic situation.
TABLE-US-00003 TABLE 1 BREAST COLON LUNG OVARY PROSTATE NORMAL
MB-231 MB-468 MCF-7 HT-29 SW1116 SW620 NCI H460 OVCAR PC-3 CCD 27sk
Hs888 Lu 7BD-33-11A - - + - - - - - ++ - - Positive anti-Fas - -
+++ - - - - +++ + - + Controls anti-Her2 + - + - - - - + - - -
anti-EGFR - +++ + - +++ - - + - + - CHX (100 .mu.M) +++ +++ +++ +++
+++ +++ +++ +++ +++ +++ +++ NaN.sub.3 (0.1%) +++ +++ +++ +++ - -
+++ +++ +++ - - Negative IgG1 +++ + Controls IgG2a +++ + IgG2b +++
IgG3 IgG Buffer +
[0089] Binding of 7BD-33-11A to the above-mentioned panel of cancer
and normal cell lines and to the following additional cancer cell
lines; colon (LOVO), pancreatic (BxPC-3), ovarian (ES-2, OCC-1) and
prostate (DU-145) and the following additional normal cell line
(CCD-12) was assessed by flow cytometry (FACS). Cells were prepared
for FACS by initially washing the cell monolayer with DPBS (without
Ca.sup.++ and Mg.sup.++). Cell dissociation buffer (INVITROGEN,
Burlington, ON) was then used to dislodge the cells from their cell
culture plates at 37.degree. C. After centrifugation and collection
the cells were resuspended in Dulbecco's phosphate buffered saline
containing MgCl.sub.2, CaCl.sub.2 and 2 or 25 percent fetal bovine
serum (FBS) at 4.degree. C. (wash media) and counted, aliquoted to
appropriate cell density, spun down to pellet the cells and
resuspended in staining media (DPBS containing MgCl.sub.2 and
CaCl.sub.2+/-2 percent FBS) containing 7BD-33-11A or control
antibodies (isotype control or anti-EGFR) at 20 .mu.g/mL on ice for
30 min. Prior to the addition of Alexa Fluor 488-conjugated
secondary antibody the cells were washed once with wash media. The
Alexa Fluor 488-conjugated antibody in staining media was then
added for 20 to 30 min. The cells were then washed for the final
time and resuspended in staining media containing 1 .mu.g/mL
propidium iodide or 1.5 percent paraformaldehyde. Flow cytometric
acquisition of the cells was assessed by running samples on a
FACScan using the CellQuest software (BD Biosciences). The forward
(FSC) and side scatter (SSC) of the cells were set by adjusting the
voltage and amplitude gains on the FSC and SSC detectors. The
detectors for the three fluorescence channels (FL1, FL2, and FL3)
were adjusted by running cells stained with purified isotype
control antibody followed by Alexa Fluor 488-conjugated secondary
antibody such that cells had a uniform peak with a median
fluorescent intensity of approximately 1-5 units. Live cells were
acquired by gating for FSC and propidium iodide exclusion (when
used). For each sample, approximately 10,000 live cells were
acquired for analysis and the resulted presented in Table 2. Table
2 tabulated the mean fluorescence intensity fold increase above
isotype control and is presented qualitatively as: less than 5 (-);
5 to 50 (+); 50 to 100 (++); above 100 (+++) and in parenthesis,
the percentage of cells stained.
[0090] Representative histograms of 7BD-33-11A antibodies were
compiled for FIG. 9. 7BD-33-11A displayed similar binding to cancer
lines of breast (MB-231 and MCF-7), colon (HT-29, SW1116 and
SW520), lung, ovary, pancreatic and prostate (PC-3) origin and
differential binding to one of the breast (MB-468), colon (LOVO)
and prostate (DU-145) cancer cell lines. There was also binding of
7BD-33-11A to non-cancer cells, however that binding did not
produce cytotoxicity. This was further evidence that binding was
not necessarily predictive of the outcome of antibody ligation of
its cognate antigen, and was a non-obvious finding. This suggested
that the context of antibody ligation in different cells was
determinative of cytoxicity rather than just antibody binding.
TABLE-US-00004 TABLE 2 BREAST COLON LUNG OVARY Antibody Isotype
MB-231 MB-468 MCF-7 HT-29 LOVO SW1116 SW620 NCI H460 ES-2 OCC-1
OVCAR 7BD-33-11A IgG2a, k + - + + - + + + + + + anti-EGFR IgG1, k
++ ++ - + - + - + + + + PANCREATIC PROSTATE NORMAL Antibody Isotype
BxPC-3 DU-145 PC-3 CCD 27sk CCD-112 Hs888 Lu 7BD-33-11A IgG2a, k +
- + + + + anti-EGFR IgG1, k + + + + + +
Example 4
Normal Human Tissue Staining
[0091] IHC studies were previously conducted to characterize the
7BD-33-11A antigen distribution in humans (Ser. No. 10/603,006).
The current studies compared 7BD-33-11A to two antibodies directed
against CD63 (RFAC4 and H5C6) since the 7BD-33-11A antigen is CD63
as determined previously by biochemical methods. Binding of
antibodies to 24 normal human tissues was performed using a human
normal organ tissue array (Clinomics, Watervliet, N.Y.). All
primary antibodies (7BD-33-11A; RFAC4 (Cymbus Biotechnology Ltd.,
Hants, UK) and H5C6 anti-CD63 (BD PharMingen, Oakville, ON); and
mouse IgG.sub.1 negative control (Dako, Toronto, ON)) were diluted
in antibody dilution buffer (Dako, Toronto, ON) to a concentration
of 5 .mu.g/ml (found to be the optimal concentration in previous
optimization steps). The negative control antibody has been shown
to be negative to all mammalian tissues by the manufacturer. The
procedure for IHC is as follows.
[0092] Tissue sections were deparaffinized by drying in an oven at
58.degree. C. for 1 hr and dewaxed by immersing in xylene 5 times
for 4 min each in Coplin jars. Following treatment through a series
of graded ethanol washes (100%-75%) the sections were re-hydrated
in water. The slides were immersed in 10 mM citrate buffer at pH 6
(Dako, Toronto, Ontario) then microwaved at high, medium, and low
power settings for 5 min each and finally immersed in cold PBS.
Slides were then immersed in 3% hydrogen peroxide solution for 6
min, washed with PBS three times for 5 min each, dried, incubated
with Universal blocking solution (Dako, Toronto, Ontario) for 5 min
at room temperature. 7BD-33-11A, monoclonal mouse anti-CD63 (Cymbus
Biotechnology Ltd., Hants, UK or Dako, Toronto, Ontario) or isotype
control antibody (directed towards Aspergillus niger glucose
oxidase, an enzyme which is neither present nor inducible in
mammalian tissues; Dako, Toronto, Ontario) were diluted in antibody
dilution buffer (Dako, Toronto, Ontario) to its working
concentration (5 .mu.g/mL for each antibody) and incubated
overnight for 1 hr at room temperature. The slides were washed with
PBS 3 times for 5 minutes each. Immunoreactivity of the primary
antibodies was detected/visualized with HRP conjugated secondary
antibodies as supplied (Dako Envision System, Toronto, Ontario) for
30 minutes at room temperature. Following this step the slides were
washed with PBS 3 times for 5 minutes each and a color reaction
developed by adding DAB (3,3'-diaminobenzidine tetrahydrachloride,
Dako, Toronto, Ontario) chromogen substrate solution for
immunoperoxidase staining for 10 minutes at room temperature.
Washing the slides in tap water terminated the chromogenic
reaction. Following counterstaining with Meyer's Hematoxylin (Sigma
Diagnostics, Oakville, ON), the slides were dehyrdated with graded
ethanols (75-100%) and cleared with xylene. Using mounting media
(Dako Faramount, Toronto, Ontario) the slides were coverslipped.
Slides were microscopically examined using an Axiovert 200 (Zeiss
Canada, Toronto, ON) and digital images acquired and stored using
Northern Eclipse Imaging Software (Mississauga, ON). Results were
read, scored and interpreted by a pathologist.
[0093] Table 3 presents a summary of the results of 7BD-33-11A and
RFAC4 and H5C6 anti-CD63 staining of a test array of normal human
tissues. The staining of tissues with 7BD-33-11A is similar to that
described previously (Ser. No. 10/603,006). It should again be
noted that 7BD-33-11A showed restricted binding to various cell
types but had binding to infiltrating macrophages, lymphocytes, and
fibroblasts. The RFAC4 and H5C6 antibodies showed a similar
staining pattern in comparison to each other. However, the staining
pattern of both RFAC4 and H5C6 was quite different than that
observed with 7BD-33-11A. Specifically, both RFAC4 and H5C6
antibodies bound to a broader range of normal tissues, usually had
higher staining intensity in tissues where 7BD-33-11A was also
positive and bound not only to infiltrating macrophages,
lymphocytes and fibroblasts and but to also to the epithelium in a
majority of the tissues (FIG. 11).
[0094] Tissues that were positive for 7BD-33-11A were also positive
for either RFAC4 or H5C6 anti-CD63 antibodies (sometimes with less
intensity). Tissues that were negative for 7BD-33-11A were
generally not negative for the RFAC4 or H5C6. These results
demonstrated that 7BD-33-11A bound to a smaller subset of the
tissues recognized by either the RFAC4 or H5C6 anti-CD63 antibody
and within tissues the intensity of staining was also sometimes
less. These results showed that the antigen for 7BD-33-11A was not
widely expressed on normal tissues, and that the antibody bound
specifically to a limited number of tissues in humans. It also
supported the biochemical evidence that 7BD-33-11A was directed
against an epitope of CD63, albeit to a different epitope than the
one recognized by either the RFAC4 or H5C6 antibodies used for
these IHC studies.
TABLE-US-00005 TABLE 3 Comparison of RFAC4 and H5C6 anti-CD63 and
7BD-33-11A IHC on Human Normal Tissue Section Tissue 7BD-33-11A
RFAC4 H5C6 Aa3 Breast -- + (Ductular epithelium and +++ (Ductular
epithelium and stromal stromal fibroblasts) fibroblasts) Aa4 Breast
+/- (2-3 stromal fibroblasts) +/- (Ductular epithelium and +++
(Stromal fibroblasts) *No staining of ductular epithelium stromal
fibroblasts) +/- (Ductular epithelium) Ab3 Lung +++ (Macrophages
and +++ (Macrophages and +++ (Alveolar epithelium and fibroblasts
at interalveolar septum) fibroblasts at interalveolar septum)
macrophages) Ab4 Lung +++ (Macrophages and +++ (Macrophages and +++
(Macrophages and fibroblasts at fibroblasts at interalveolar
septum) fibroblasts at interalveolar septum) interalveolar septum)
Ab5 Lung +/- (Macrophages and fibroblasts +++ (Macrophages and +++
(Macrophages and fibroblasts at at interalveolar septum)
fibroblasts at interalveolar septum) interalveolar septum) Ac1
Colon +++ (Lymphocytes and +++ (Mucosal epithelium, +++ (Mucosal
epithelium, lymphocytes macrophages in lamina propria) *No
lymphocytes and macrophages at and macrophages at lamina propria)
staining of Mucosal epithelium lamina propria) Ac3 Colon -- -- +/-
(Lymphocytes at lamina propria) Ac4 Colon +++ (Macrophages and
fibroblasts +++ (Macrophages and +++ (Mucosal epithelium,
lymphocytes at lamina propria) + (Mucosal fibroblasts at lamina
propria) + and macrophages at lamina propria) epithelium) (Mucosal
epithelium) Ac5 Colon +/- (Macrophages and fibroblasts +++
(Macrophages and +++ (Lymphocytes and macrophages in at lamina
propria) fibroblasts at lamina propria) + lamina propria) (Mucosal
epithelium) Ad1 Prostate +++ (Glandular epithelium) +++ (Glandular
epithelium) +++ (Glandular epithelium) Ad2 Prostate +++ (Glandular
epithelium) +++ (Glandular epithelium) +++ (Glandular epithelium)
Ad4 Prostate ++ (Glandular epithelium) +++ (Glandular epithelium)
Ad5 Prostate +++ (Glandular epithelium) +++ (Glandular epithelium)
+++ (Glandular epithelium) Ae1 Kidney -- + (Tubular epithelium) ++
(Tubular epithelium) Ae2 Kidney +/- (2-3 interstitial cells) *No ++
(Tubular epithelium) ++ (Tubular epithelium) staining of tubular
epithelium Ae3 Kidney +/- (2-3 interstitial cells) ++ (Tubular
epithelium) ++ (Tubular epithelium) Ae4 Liver ++ (Hepatocytes and
sinusoidal +++ (Hepatocytes & sinusoidal +++ (Hepatocytes,
sinusoidal staining staining) staining and bile duct epithelium)
and bile ducts) Af1 Liver -- ++ (Sinusoidal and bile duct ++
(Sinusoidal and bile duct epithelium) epithelium) Af2 Liver -- +/-
(Hepatocytes and sinusoidal +/- (Hepatocytes and sinusoidal
staining) staining) Af3 Lymph node -- ++ (Reticular cells) ++
(Reticular cells) Ag1 Thyroid -- +/- (Follicular cells) +/-
(Follicular cells) Ag2 Thyroid +++ (Follicular cells) +++
(Follicular cells) +++ (Follicular cells) Ah1 Placenta -- +++
(Syncytiotrophoblasts & +++ (Syncytiotrophoblasts &
basement basement membrane of chorionic membrane of chorionic
villi) villi) Ah2 Placenta -- +++ (Syncytiotrophoblasts & +++
(Syncytiotrophoblasts & basement basement membrane of chorionic
membrane of chorionic villi) villi)
Example 5
Human Breast Tumor Tissue Staining
[0095] A previous IHC study was undertaken to determine the cancer
association of the 7BD-33-11A antigen with human breast cancers and
whether the 7BD-33-11A antibody was likely to recognize human
cancers (Ser. No. 10/603,006). Currently, a comparison was carried
out using RFAC4 and H5C6 anti-CD63 and c-erbB-2 anti-Her2
antibodies. A breast cancer tissue array derived from 50 breast
cancer patients and 10 samples derived from non-neoplastic breast
tissue in breast cancer patients was used (Imgenex Corporation, San
Diego, Calif.). The following information was provided for each
patient: age, sex, American Joint Committee on Cancer (AJCC) tumor
stage, lymph node, estrogen receptor (ER) and projesterone receptor
(PR) status. The procedure for IHC from Example 4 was followed. All
antibodies were used at a working concentration of 5 .mu.g/mL
except for the anti-Her2 antibody where a concentration of 1.5
.mu.g/mL was used.
[0096] Tables 4, 5 and 6 and 7 provide summaries of 7BD-33-11A,
RFAC4 and H5C6 anti-CD63 antibody staining of breast cancer tissue
arrays. Overall, 36 percent of the 50 patients tested were positive
for 7BD-33-11A antigen compared to 85 and 94 percent for RFAC4 and
H5C6 anti-CD63 antibodies respectively. In cases where both
7BD-33-11A and RFAC4 or H5C6 anti-CD63 antibodies stained the same
tissue, 97 percent of the samples had higher intensity staining
with both the RFAC4 and H5C6 anti-CD63 in comparison to 7BD-33-11A
(FIG. 12). For 7BD-33-11A 0 out of 10 and for both RFAC4 and H5C6
anti-CD63 antigen 7 out of 8 (2 samples were not representative)
normal breast tissue samples from breast cancer patients were
positive, respectively. There was a slight correlation between
estrogen or progesterone receptor expression and expression of
7BD-33-11A antigen; tissues with either receptor expression had
slightly higher 7BD-33-11A antigen expression. When tumors were
analyzed based on their stage, or degree to which the cancer
advanced, results suggested a trend towards greater positive
expression with higher tumor stage for 7BD-33-11A. Similar results
were obtained with RFAC4. H5C6 also showed a very slight
correlation with estrogen or progesterone receptor expression but
there was no apparent correlation with tumor stage. However, for
all three antibodies, the results were limited by the small sample
size.
TABLE-US-00006 TABLE 4 Human Breast Tumor IHC Summary for
7BD-33-11A Binding Score % positive Total # - +/- + ++ +++ Total
positive of total Patient Tumor 50 32 10 4 3 1 18 36% Samples
Normal 10 10 0 0 0 0 0 0% ER Status ER+ 28 16 9 1 2 0 12 43% ER- 22
15 3 2 1 1 7 32% Unknown 0 0 0 0 0 0 0 0% PR Status PR+ 19 9 6 2 2
0 10 53% PR- 30 20 6 2 1 1 10 33% Unknown 1 1 0 0 0 0 0 0% AJCC
Tumor T1 4 4 0 0 0 0 0 0% Stage T2 21 14 3 2 1 1 7 33% T3 20 11 6 2
1 0 9 45% T4 5 1 3 0 1 0 4 80%
TABLE-US-00007 TABLE 5 Human Breast Tumor IHC Summary for RFAC4
Binding Score Total # - +/- + ++ +++ Total positive % positive of
total Patient Samples Tumor 47 7 3 7 16 14 40 85% Normal 8 1 1 0 2
4 7 87.50% ER Status ER+ 27 1 2 3 15 6 26 96% ER- 20 6 1 3 4 6 14
70% Unknown 0 0 0 0 0 0 0 0% PR Status PR+ 18 0 1 2 9 6 18 100% PR-
28 7 2 4 9 6 21 75% Unknown 1 0 0 0 1 0 1 100% AJCC Tumor Stage T1
4 2 0 1 1 0 2 50% T2 20 4 2 3 6 5 16 80% T3 18 1 1 2 7 7 17 94% T4
5 0 0 1 2 2 5 100%
TABLE-US-00008 TABLE 6 Human Breast Tumor IHC Summary for H5C6
Binding Score Total # - +/- + ++ +++ Total positive % positive of
total Patient Samples Tumor 47 3 4 8 15 17 44 94% Normal 8 1 1 0 2
4 7 87.50% ER Status ER+ 27 1 1 6 8 11 26 96% ER- 20 2 3 2 8 5 18
90% Unknown 0 0 0 0 0 0 0 0% PR Status PR+ 18 0 0 4 4 10 18 100%
PR- 28 3 4 4 11 6 25 89% Unknown 1 0 0 0 1 0 1 100% AJCC Tumor
Stage T1 4 0 0 1 2 1 4 100% T2 20 2 4 3 7 4 18 90% T3 18 1 0 3 4 10
17 94% T4 5 0 0 1 2 2 5 100%
[0097] The 7BD-33-11A staining was specific for cancerous cells in
comparison to normal cells where stromal cells were clearly
negative and sheets of malignant cells were positive. The cellular
localization pattern seen with the 7BD-33-11A antigen was confined
to the cell membrane and cytoplasm. Similar membranous and
cytoplasmic staining results were obtained with the anti-CD63
antibodies, RFAC4 and H5C6 on the breast tumor tissue samples.
Additionally, both of these antibodies showed this staining
localization pattern on normal breast tissue samples whereas
7BD-33-11A was negative.
[0098] In comparison to c-erbB-2, 7BD-33-11A showed a completely
different staining profile where 9 out of the 18 breast tumor
tissue samples that were positive for the 7BD-33-11A antigen were
negative for Her2 expression indicating a yet unmet targeted
therapeutic need for breast cancer patients (Table 8, FIG. 13).
There were also differences in the intensity of staining between
the breast tumor tissue sections that were positive for both
7BD-33-11A and Her2; some breast tumor tissue sections that were
highly positive for the 7BD-33-11A antigen were only mildly
positive for Her2 and vice versa again illustrating that 7BD-33-11A
would therapeutically target a different cohort of breast cancer
patients. The c-erbB-2 antibody also positively stained one of the
normal breast tissue sections.
[0099] These results suggested the antigen for 7BD-33-11A may be
expressed by approximately two thirds of breast cancer patients and
half of those were completely negative for the Her2 antigen. The
staining pattern showed that in patient samples, the antibody is
highly specific for malignant cells and the 7BD-33-11A antigen was
present on the cell membrane thereby making it an attractive
drugable target. The similar albeit much more limited staining of
7BD-33-11A versus either the RFAC4 or H5C6 anti-CD63 antibody again
demonstrates the likelihood of the 7BD-33-11A epitope being a more
restrictive epitope on CD63.
TABLE-US-00009 TABLE 7 Comparison of RFAC4 and H5C6 anti-CD63 and
7BD-33-11A IHC on Human Tumor and Normal Breast Tissue Data sheet
RFAC4 H5C6 7BD-33-11A Sec. No. Sex Age Diagnosis Section Score
Section Score Section Score 1 F 28 Infiltrating duct carcinoma +++
+++ ++ 2 F 71 Solid papillary carcinoma +++ +++ +/- 3 F 26
Infiltrating duct carcinoma ++ + - 4 F 43 Infiltrating duct
carcinoma ++ ++ +/- 5 F 39 Infiltrating duct carcinoma NR NR +/- 6
F 46 Ductal carcinoma in situ + + +/- 7 F 47 Infiltrating duct
carcinoma +++ +++ + 8 M 67 Infiltrating duct carcinoma +++ +++ + 9
F 33 Infiltrating duct carcinoma +++ +++ - 10 F 47 Infiltrating
duct carcinoma ++ ++ - 11 F 49 Invasive lobular carcinoma - - - 12
F 46 Infiltrating duct carcinoma ++ ++ - 13 F 39 Infiltrating duct
carcinoma ++ ++ - 14 F 43 Infiltrating lobular carcinoma +++ +++
+/- 15 F 54 Infiltrating lobular carcinoma ++ ++ +/- 16 F 58
Infiltrating duct carcinoma + ++ +/- 17 F 37 Infiltrating duct
carcinoma +++ ++ - 18 F 43 Infiltrating duct carcinoma +++ +++ +++
19 F 51 Infiltrating duct carcinoma +++ +++ + 20 F 80 Medullary
carcinoma ++ ++ - 21 F 36 Infiltrating duct carcinoma NR NR - 22 F
59 Infiltrating duct carcinoma + + - 23 F 34 Ductal carcinoma in
situ +++ +++ + 24 F 54 Infiltrating duct carcinoma ++ +++ +/- 25 F
47 Infiltrating duct carcinoma +++ +++ ++ 26 F 53 Infiltrating duct
carcinoma ++ ++ - 27 F 59 Infiltrating duct carcinoma + + - 28 F 60
Signet ring cell carcinoma F F - 29 F 37 Infiltrating duct
carcinoma +++ +++ ++ 30 F 46 Infiltrating duct carcinoma ++ ++ +/-
31 F 35 Infiltrating duct carcinoma - - - 32 F 47 Infiltrating duct
carcinoma ++ ++ - 33 F 54 Infiltrating duct carcinoma + + - 34 F 47
Infiltrating duct carcinoma - +/- - 35 F 41 Infiltrating duct
carcinoma +++ +++ - 36 F 38 Infiltrating duct carcinoma +++ +++ -
37 F 55 Infiltrating duct carcinoma - +/- - 38 F 65 Infiltrating
duct carcinoma +/- +/- - 39 M 66 Infiltrating duct carcinoma - + -
40 F 44 Infiltrating duct carcinoma ++ +++ - 41 F 52 Metastatic
carcinoma in lymph node ++ ++ - 42 F 32 Metastatic carcinoma in
lymph node +/- + - 43 F 58 Metastatic carcinoma in lymph node ++
+++ +/- 44 F 52 Metastatic carcinoma in lymph node + + - 45 F 58
Metastatic carcinoma in lymph node - - - 46 F 38 Metastatic
carcinoma in lymph node ++ +++ - 47 F 45 Metastatic carcinoma in
lymph node - ++ - 48 F 45 Metastatic carcinoma in lymph node ++ ++
- 49 F 29 Metastatic carcinoma in lymph node +/- +/- - 50 F 61
Metastatic carcinoma in lymph node + ++ - 51 F 46 Nipple ++ ++ - 52
F 47 Nipple NR NR - 53 F 40 Normal breast +/- +/- - 54 F 43 Normal
breast +++ +++ - 55 F 40 Normal breast ++ +++ - 56 F 40 Normal
breast +++ ++ - 57 F 45 Normal breast NR NR - 58 F 44 Normal breast
- - - 59 F 37 Normal breast +++ +++ - 60 F 51 Normal breast +++ +++
- Abbreviations: NR: the sample is not representative and F: the
section is folded.
TABLE-US-00010 TABLE 8 Comparison of c-erbB-2 anti-Her2 and
7BD-33-11A IHC on Human Tumor and Normal Breast Tissue Data sheet
c-erbB-2 7BD-33-11A Sec. No. Sex Age Diagnosis Section Score
Section Score 1 F 28 Infiltrating duct carcinoma + ++ 2 F 71 Solid
papillary carcinoma - +/- 3 F 26 Infiltrating duct carcinoma +/- -
4 F 43 Infiltrating duct carcinoma +/- +/- 5 F 39 Infiltrating duct
carcinoma NR +/- 6 F 46 Ductal carcinoma in situ - +/- 7 F 47
Infiltrating duct carcinoma +++ + 8 M 67 Infiltrating duct
carcinoma - + 9 F 33 Infiltrating duct carcinoma +++ - 10 F 47
Infiltrating duct carcinoma ++ - 11 F 49 Invasive Lobular carcinoma
PD - 12 F 46 Infiltrating duct carcinoma - - 13 F 39 Infiltrating
duct carcinoma +++ - 14 F 43 Infiltrating lobular carcinoma - +/-
15 F 54 Infiltrating lobular carcinoma - +/- 16 F 58 Infiltrating
duct carcinoma - +/- 17 F 37 Infiltrating duct carcinoma +++ - 18 F
43 Infiltrating duct carcinoma - +++ 19 F 51 Infiltrating duct
carcinoma + + 20 F 80 Medullary carcinoma - - 21 F 36 Infiltrating
duct carcinoma NR - 22 F 59 Infiltrating duct carcinoma - - 23 F 34
Ductal carcinoma in situ +++ + 24 F 54 Infiltrating duct carcinoma
+ +/- 25 F 47 Infiltrating duct carcinoma - ++ 26 F 53 Infiltrating
duct carcinoma +++ - 27 F 59 Infiltrating duct carcinoma + - 28 F
60 Signet ring cell carcinoma - - 29 F 37 Infiltrating duct
carcinoma +++ ++ 30 F 46 Infiltrating duct carcinoma - +/- 31 F 35
Infiltrating duct carcinoma - - 32 F 47 Infiltrating duct carcinoma
+++ - 33 F 54 Infiltrating duct carcinoma - - 34 F 47 Infiltrating
duct carcinoma +++ - 35 F 41 Infiltrating duct carcinoma - - 36 F
38 Infiltrating duct carcinoma ++ - 37 F 55 Infiltrating duct
carcinoma +/- - 38 F 65 Infiltrating duct carcinoma - - 39 M 66
Infiltrating duct carcinoma - - 40 F 44 Infiltrating duct carcinoma
- - 41 F 52 Metastatic carcinoma in Lymph node - - 42 F 32
Metastatic carcinoma in Lymph node - - 43 F 58 Metastatic carcinoma
in Lymph node ++ +/- 44 F 52 Metastatic carcinoma in Lymph node +++
- 45 F 58 Metastatic carcinoma in Lymph node - - 46 F 38 Metastatic
carcinoma in Lymph node ++ - 47 F 45 Metastatic carcinoma in Lymph
node - - 48 F 45 Metastatic carcinoma in Lymph node - - 49 F 29
Metastatic carcinoma in Lymph node - - 50 F 61 Metastatic carcinoma
in Lymph node - - 51 F 46 Nipple - - 52 F 47 Nipple +++ - 53 F 40
Normal Breast - - 54 F 43 Normal Breast - - 55 F 40 Normal Breast
+/- - 56 F 40 Normal Breast - - 57 F 45 Normal Breast - - 58 F 44
Normal Breast - - 59 F 37 Normal Breast - - 60 F 51 Normal Breast -
-
Example 6
Human Prostate Tissue Staining
[0100] To determine whether the 7BD-33-11A antigen was expressed on
other human cancer tissues in addition to breast cancer, a multiple
human tumor tissue array was probed with 7BD-33-11A (Ser. No.
10/603,006; Imgenex, San Diego, Calif.). In furthering those
studies, the staining pattern of 7BD-33-11A was determined on a
human prostate tumor tissue array (Imgenex Corporation, San Diego,
Calif.). The staining procedure used was the same as the one
outlined in Example 4. All antibodies were used at a working
concentration of 5 .mu.g/mL.
[0101] As outlined in Table 9, 7BD-33-11A stained 88 percent of
human prostate cancers. Although 7BD-33-11A stained the normal
tissue sections with high intensity as well, there was a higher
degree of membranous staining in the tumor tissue samples in
comparison to the normal samples. There was one embryonal
rhabdomyosarcroma tissue sample that did not stain for the
7BD-33-11A antigen. There also appeared to be no direct correlation
between tumor stage and presence of the 7BD-33-11A antigen.
However, the results were limited by the small sample size. Again
with 7BD-33-11A there was both membranous and cytoplasmic staining
observed on the prostate tumor tissue samples. However, there was
an increase in the degree of membranous staining relative to that
seen with the breast tumor tissue samples (FIG. 14). For the normal
prostate tissue samples, this increase in the degree of membranous
staining was not observed.
TABLE-US-00011 TABLE 9 Human Prostate Tumor IHC Summary for
7BD-33-11A Binding Score Total # - +/- + ++ +++ Total positive % of
positive of total Patients' Tumor 51 6 6 6 7 26 45 88% Sample
Normal 3 0 0 0 1 2 3 100% Tumor Adenocarcinoma 50 5 6 6 7 26 44 88%
Subtype embryonal 1 1 0 0 0 0 0 0% Rhabdomyosarcoma Tumor I 1 0 0 0
0 1 1 100% Stage II 11 0 0 1 3 7 11 100% III 2 1 0 0 0 1 1 50% IV
32 6 5 5 3 13 26 81%
[0102] Therefore, it appeared that the 7BD-33-11A antigen was not
solely found on the membranes of breast cancers but also on the
membrane of prostate cancers. These results indicated that
7BD-33-11A has potential as a therapeutic drug in tumor types
besides breast.
[0103] The preponderance of evidence shows that 7BD-33-11A mediates
anti-cancer effects through ligation of a conformational epitope
present on a variant of CD63. It has been shown, in Example 2,
7BD-33-11A antibody can be used to immunoprecipitate the cognate
antigen from expressing cells such as MDA-MB-231 cells. Further it
could be shown that the 7BD-33-11A antibody could be used in
detection of cells and/or tissues which express a CD63 antigenic
moiety which specifically binds thereto, utilizing techniques
illustrated by, but not limited to FACS, cell ELISA or IHC.
[0104] Thus, it could be shown that the immunoprecipitated
7BD-33-11A antigen can inhibit the binding of 7BD-33-11A to such
cells or tissues using such FACS, cell ELISA or IHC assays.
Further, as with the 7BD-33-11A antibody, other anti-CD63
antibodies could be used to immunoprecipitate and isolate other
forms of the CD63 antigen, and the antigen can also be used to
inhibit the binding of those antibodies to the cells or tissues
that express the antigen using the same types of assays.
Example 7
In Vivo MDA-MB-231 Preventative Dose Response Tumor Experiments
[0105] With reference to the data shown in FIGS. 15 and 16, 6 to 8
week old, female SCID mice were implanted with 5 million MDA-MB-231
human breast cancer cells in 100 microliters saline injected
subcutaneously in the scruff of the neck. The mice were randomly
divided into 4 treatment groups of 10. On the day after
implantation 0.2, 2.0 or 20 mg/kg of 7BD-33-11A or 20 mg/kg IgG
isotype control antibody was administered intraperitoneally at a
volume of 300 microliters after dilution from the stock
concentration with a diluent that contained 2.7 mM KCl, 1 mM
KH.sub.2PO.sub.4, 137 mM NaCl and 20 mM Na.sub.2HPO.sub.4. The
antibodies were then administered once per week for a period of 7
weeks in the same fashion. Tumor growth was measured about every
7th day with calipers or until individual animals reached the CCAC
end-points. Body weights of the animals were recorded for the
duration of the study.
[0106] At the end of treatment (day 55), the 0.2 mg/kg treatment
group had tumor growth that was 15 percent of the isotype control
group. The 85 percent reduction in tumor growth in the 0.2 mg/kg
7BD-33-11A treatment group was determined to be a significant
difference in comparison to the isotype control as determined by a
paired t-test (p<0.0001). Both of the 2.0 and 20 mg/kg treatment
groups had yet to develop tumors by the end of treatment (day 55).
This trend continued on well beyond the treatment period. Treatment
with 7BD-33-11A antibody, at all doses, also led to an increase in
survival in comparison to the isotype control treated group. All of
the mice in control treated group had died by day 104 (54 days
after treatment). By contrast, the mice in the 0.2 mg/kg group
survived until day 197 (147 days after treatment), 50 percent of
the mice in the 2.0 mg/kg treatment group were sill alive at day
290 (240 days after treatment) and 100 percent of the 20 mg/kg
group were also still alive at also day 290. Therefore, 7BD-33-11A
treatment, at all 3 doses, significantly reduced tumor burden and
increased survival in comparison to an isotype control antibody.
Treatment at the highest dose demonstrated the greatest reduction
in tumor growth (100 percent) and the largest increase in survival
(all mice are still alive). Consequently, 7BD-33-11A is a potent
anti-tumor antibody suggesting pharmacologic and pharmaceutical
benefits of this antibody for therapy in other mammals, including
man.
Example 8
In Vivo MDA-MB-231 Established Chemotherapy Combination Tumor
Experiments
[0107] With reference to FIGS. 17 and 18, 6 to 8 week old female
SCID mice were implanted with 5 million MDA-MB-231 human breast
cancer cells in 100 microlitres saline injected subcutaneously in
the scruff of the neck. Tumor growth was measured with calipers
every week. When the majority of the cohort reached a tumor volume
of 100 mm.sup.3 (range 48-122 mm.sup.3) at 41 days
post-implantation 8 mice were randomly assigned into each of 4
treatment groups. 7BD-33-11A antibody, the chemotherapeutic drug
Cisplatin, the combination of 7BD-33-11A and Cisplatin or buffer
control was administered intraperitoneally with 10 or 9 mg/kg of
antibody or Cisplatin respectively at a volume of 300 microliters
after dilution from the stock concentration with a diluent that
contained 2.7 mM KCl, 1 mM KH.sub.2PO.sub.4, 137 mM NaCl and 20 mM
Na.sub.2HPO.sub.4. 7BD-33-11A or buffer control was then
administered 3 times per week for 10 doses in total in the same
fashion until day 64 post-implantation. Cisplatin was administered
on days 1, 3 and 9 of the treatment period. Tumor growth was
measured about every seventh day with calipers until day 125
post-implantation or until individual animals reached the CCAC
end-points. Body weights of the animals were recorded for the
duration of the study. At the end of the study all animals were
euthanised according to CCAC guidelines.
[0108] Using a paired t-test, there was a post-treatment tumor
burden reduction (FIG. 16) associated with treatment with either
7BD-33-11A, Cisplatin or the combination of the two. At day 69 (5
days post-treatment) both 7BD-33-11A, Cisplatin and the
antibody-drug combination had decreased mean tumor volumes compared
to buffer control treatment; 76 (p<0.001), 79 (p<0.001) and
86 percent (p<0.001) respectively. Body weight was used as a
surrogate for well-being. Although both Cisplatin and 7BD-33-11A
displayed similar tumor suppression, there was not the same degree
of weight loss seen with Cisplatin treatment in comparison to
treatment with the 7BD-33-11A antibody. There was little difference
between the buffer control and 7BD-33-11A treated groups over the
time points monitored. In fact, groups treated with the buffer
control and 7BD-33-11A showed a slight weight gain after the
treatment period. In contrast, the groups treated with Cisplatin
experienced a weight loss that was especially evident after
administration of the final dose. On day 55 post-implantation (4
days after the final dose of Cisplatin), the Cisplatin treated
groups showed a 24-30 percent loss in body weight. Therefore both
7BD-33-11A and Cisplatin lowered the tumor burden in comparison to
a buffer control in a well-recognized model of human breast cancer
disease. However, 7BD-33-11A treated animals experienced better
well-being than the Cisplatin treatment group as measured by body
weight. These results suggest pharmacologic, pharmaceutical and
quality of life benefits of this antibody for therapy in other
mammals, including man.
Example 9
In Vivo MDA-MB-468 Established Chemotherapy Combination Tumor
Experiments
[0109] With reference to FIGS. 19 and 20, 6 to 8 week old female
SCID mice were implanted with 2 million MDA-MB-468 human breast
cancer cells in 100 microlitres saline injected subcutaneously in
the scruff of the neck. Tumor growth was measured with calipers
every week. When the majority of the cohort reached a tumor volume
of 100 mm.sup.3 (range 11-119 mm.sup.3) at 27 days
post-implantation 8 mice were randomly assigned into each of 4
treatment groups. 7BD-33-11A antibody, the chemotherapeutic drug
Cisplatin, the combination of 7BD-33-11A and Cisplatin or buffer
control was administered intraperitoneally with 10 or 6 mg/kg of
antibody or Cisplatin respectively at a volume of 300 microliters
after dilution from the stock concentration with a diluent that
contained 2.7 mM KCl, 1 mM KH.sub.2PO.sub.4, 137 mM NaCl and 20 mM
Na.sub.2HPO.sub.4. 7BD-33-11A or buffer control was then
administered 4 times per week for the first week followed by 3
times per week for 11 doses in total in the same fashion until day
50 post-implantation. Cisplatin was administered on days 1, 6, 11
and 16 of the treatment period. Tumor growth was measured about
every seventh day with calipers until day 66 post-implantation or
until individual animals reached the CCAC end-points. Body weights
of the animals were recorded for the duration of the study. At the
end of the study all animals were euthanised according to CCAC
guidelines.
[0110] Using a paired t-test, there was a post-treatment tumor
burden reduction (FIG. 18) associated with treatment with either
7BD-33-11A or Cisplatin or the combination of the two. At day 55 (5
days post-treatment) both 7BD-33-11A, Cisplatin and the
antibody-drug combination had decreased mean tumor volumes compared
to buffer control treatment; 37 (p=0.3958), 95 (p=0.024) and 97
percent (p=0.017) respectively. Body weight was used as a surrogate
for well-being. Although both 7BD-33-11A and, to a greater extent,
Cisplatin displayed tumor suppression, there was not the same
degree of weight loss seen with 7BD-33-11A antibody treatment in
comparison to Cisplatin treatment. There was little difference
between the buffer control and the 7BD-33-11A treated groups over
the time points monitored. In fact, groups treated with the buffer
control and 7BD-33-11A showed some slight weight gain during the
treatment period. In contrast, the groups treated with Cisplatin
experienced a weight loss that was especially evident after the
final dose of Cisplatin was administered. On day 48
post-implantation (4 days after the final dose of Cisplatin), the
Cisplatin treated groups showed a 20 percent loss in body weight.
Therefore both 7BD-33-11A and Cisplatin lowered the tumor burden in
comparison to a buffer control in another well-recognized model of
human breast cancer disease. However, 7BD-33-11A treated animals
experienced better well-being than the Cisplatin treatment group as
measured by body weight. In all, these results in which 7BD-33-11A
produced significant benefits (improved survival, decreased tumor
burden in comparison to control treatment, and better tolerability
in comparison to chemotherapy) in multiple models of human cancer
suggest pharmacologic, pharmaceutical and quality of life benefits
of this antibody for therapy in other mammals, including man.
[0111] The preponderance of evidence shows that 7BD-33-11A mediates
anti-cancer effects through ligation of an epitope present on
extracellular loop 2 on CD63. It has been shown, in Example 2,
7BD-33-11A antibody can be used to immunoprecipitate the cognate
antigen from expressing cells such as MDA-MB-231 cells. Further it
could be shown that the 7BD-33-11A antibody could be used in
detection of cells and/or tissues which express a CD63 antigenic
moiety which specifically binds thereto, utilizing techniques
illustrated by, but not limited to FACS, cell ELISA or IHC.
[0112] Thus, it could be shown that the immunoprecipitated
7BD-33-11A antigen can inhibit the binding of 7BD-33-11A to such
cells or tissues using FACS, cell ELISA or IHC assays. Further, as
with the 7BD-33-11A antibody, other anti-CD63 antibodies could be
used to immunoprecipitate and isolate other forms of the CD63
antigen, and the antigen can also be used to inhibit the binding of
those antibodies to the cells or tissues that express the antigen
using the same types of assays.
[0113] All patents and publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. All patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0114] It is to be understood that while a certain form of the
invention is illustrated, it is not to be limited to the specific
form or arrangement of parts herein described and shown. It will be
apparent to those skilled in the art that various changes may be
made without departing from the scope of the invention and the
invention is not to be considered limited to what is shown and
described in the specification. One skilled in the art will readily
appreciate that the present invention is well adapted to carry out
the objects and obtain the ends and advantages mentioned, as well
as those inherent therein. Any oligonucleotides, peptides,
polypeptides, biologically related compounds, methods, procedures
and techniques described herein are presently representative of the
preferred embodiments, are intended to be exemplary and are not
intended as limitations on the scope. Changes therein and other
uses will occur to those skilled in the art which are encompassed
within the spirit of the invention and are defined by the scope of
the appended claims. Although the invention has been described in
connection with specific preferred embodiments, it should be
understood that the invention as claimed should not be unduly
limited to such specific embodiments. Indeed, various modifications
of the described modes for carrying out the invention which are
obvious to those skilled in the art are intended to be within the
scope of the following claims.
Sequence CWU 1
1
5130DNAArtificialprimer sequence used for PCR 1gccgtgggat
ccggggcaca gcttgtcctg 30233DNAArtificialprimer sequence used for
PCR 2gatgacgaat tctcacagag agccaggggt agc 33327DNAArtificialprimer
sequence used for PCR 3ggctatggat ccagagataa ggtgatg
27430DNAArtificialprimer sequence used for PCR 4taccagaatt
caatttttcc tcagccagcc 30510PRTHomo sapiens 5Val Met Ser Glu Phe Asn
Asn Asn Phe Arg1 5 10
* * * * *