U.S. patent application number 12/099085 was filed with the patent office on 2009-02-19 for optically-detectable enzyme substrates and their method of use.
This patent application is currently assigned to INVITROGEN CORPORATION. Invention is credited to Schuyler Boon CORRY, William Louis Downey, Brian Filanoski, Kyle Richard Gee, I. Lawrence Greenfield, James David Hirsch, Iain Johnson, Aleksey Rukavishnikov.
Application Number | 20090047692 12/099085 |
Document ID | / |
Family ID | 34807181 |
Filed Date | 2009-02-19 |
United States Patent
Application |
20090047692 |
Kind Code |
A1 |
CORRY; Schuyler Boon ; et
al. |
February 19, 2009 |
OPTICALLY-DETECTABLE ENZYME SUBSTRATES AND THEIR METHOD OF USE
Abstract
The present invention relates to compounds that are substrates
for an enzyme, and upon reaction with the enzyme provide a
detectable response, such as an optically detectable response. In
particular, the compounds have utility in detecting the presence of
a .beta.-lactamase in a sample. In addition to the compounds,
methods are disclosed for analyzing a sample for the presence of a
.beta.-lactmase, for example, as an indicator of expression of a
nucleic acid sequence including a sequence coding for a
.beta.-lactmase. Kits are disclosed that include the disclosed
compounds and additional components, for example, cells,
antibodies, a .beta.-lactmase or instructions for using the
components in an assay.
Inventors: |
CORRY; Schuyler Boon;
(Eugene, OR) ; Downey; William Louis; (Eugene,
OR) ; Filanoski; Brian; (Spokane Valley, WA) ;
Gee; Kyle Richard; (Springfield, OR) ; Greenfield; I.
Lawrence; (Eugene, OR) ; Hirsch; James David;
(Springfield, OR) ; Johnson; Iain; (Eugene,
OR) ; Rukavishnikov; Aleksey; (Eugene, OR) |
Correspondence
Address: |
INVITROGEN CORPORATION;C/O INTELLEVATE
P.O. BOX 52050
MINNEAPOLIS
MN
55402
US
|
Assignee: |
INVITROGEN CORPORATION
Carlsbad
CA
|
Family ID: |
34807181 |
Appl. No.: |
12/099085 |
Filed: |
April 7, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11040924 |
Jan 21, 2005 |
|
|
|
12099085 |
|
|
|
|
60538357 |
Jan 21, 2004 |
|
|
|
Current U.S.
Class: |
435/7.72 ;
435/18; 540/222; 540/225; 540/300 |
Current CPC
Class: |
C07F 5/022 20130101;
C12Q 1/34 20130101; C07D 499/00 20130101; C07D 501/58 20130101;
C07D 501/60 20130101; C07D 501/00 20130101; G01N 2333/986 20130101;
C12Q 2334/00 20130101; C07D 519/00 20130101; G01N 33/581 20130101;
C07D 503/00 20130101 |
Class at
Publication: |
435/7.72 ;
540/222; 540/225; 540/300; 435/18 |
International
Class: |
G01N 33/53 20060101
G01N033/53; C07D 501/60 20060101 C07D501/60; C07D 498/04 20060101
C07D498/04; C12Q 1/34 20060101 C12Q001/34 |
Claims
1. A compound having the formula: ##STR00142## A is S, O, SO,
SO.sub.2 or CH.sub.2; X is O, S or NH; L is a linker; R.sup.2 is
hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.3 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.4 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl; R.sup.5 is
hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.6 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.7 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl; R.sup.8 is
hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.9 is ##STR00143## in which W is an alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, aryloxy, substituted aryloxy, heteroaryl,
substituted heteroaryl, a dye moiety or CN, and; s is an integer
from 0 to 5; W' and W'' are independently hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl,
heteroaryl, substituted heteroaryl, (.dbd.O), (.dbd.NH), OR.sup.10,
NHR.sup.11, or halogen; wherein R.sub.10 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl; or substituted heteroaryl; and,
R.sup.11 is hydrogen, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl; substituted
heteroaryl or OR.sup.12; wherein R.sup.12 is hydrogen, substituted
or unsubstituted alkyl, and substituted or unsubstituted
heteroalkyl or substituted or unsubstituted aryl or heteroaryl; and
Y is a dye moiety or a quencher moiety.
2. The compound according to claim 1, wherein the compound is other
than a cephalosporin, and at least one of W, W' or W'' is a
quencher of fluorescence emitted by the first dye moiety.
3. The compound according to claim 1, wherein the compound is other
than a cephalosporin, at least one of W, W' and W'' includes a
second dye moiety, and the first dye moiety is a quencher of the
fluorescence of the second dye moiety.
4. The compound according to claim 1, wherein R.sup.9 is:
##STR00144## ##STR00145## where the symbol n is an integer selected
from 1 to about 8.
5. The compound according to claim 1, wherein R.sup.9 is other than
benzyl, 2-thienylmethyl or cyanomethyl.
6. The compound according to claim 1, wherein the compound has the
formula: ##STR00146## where A is S, O, SO, SO.sub.2 or CH.sub.2;
one of Y and R.sup.9 includes a dye moiety, and the other has the
formula: ##STR00147## where W is substituted or unsubstituted alkyl
substituted or unsubstituted heteroaklyl, substituted or
unsubstituted aryl, substituted or unsubstituted aryloxy,
substituted or unsubstituted heteroaryl, or CN; the symbol s
represents an integer selected from 0 to 5; W' and W'' are
independently H, substituted or unsubstituted alkyl (.dbd.O),
(.dbd.NH), OR.sup.10, NHR.sup.11, or halogen; Wherein W, W', and
W'' are not quenchers of the fluorescence emitted by the dye
moiety; R.sub.10 is hydrogen, alkyl substituted alkyl heteroalkyl,
or substituted heteroalkyl; R.sup.11 is hydrogen, alkyl substituted
alkyl heteroalkyl, substituted heteroalkyl, or OR.sup.12; wherein
R.sup.12 is hydrogen, alkyl substituted alkyl heteroalkyl,
substituted heteroalkyl.
7. The compound according to claim 6, wherein R.sup.9 is other than
benzyl, 2-thienylmethyl or cyanomethyl.
8. The compound according to claim 6, wherein Y includes a dye
moiety and R.sup.9 is ##STR00148## where W is alkyl, substituted
alkyl, heteroalkyl, substituted heteroalkyl, aryl, substituted
aryl, aryloxy, substituted aryloxy, heteroaryl, substituted
heteroaryl, or CN; s is an integer from 0 to about 5; and, W, W',
and W'' are not quenchers of the fluorescence emitted by the dye
moiety.
9. The compound according to claim 6, wherein R.sup.9 is benzyl,
substituted benzyl, 5-membered heteroaryl, substituted 5-membered
heteroaryl, or CN.
10. The compound according to claim 6, wherein A is S or SO.
11. The compound according to claim 6, wherein, W' is (.dbd.O) and
W'' is (OH).
12. The compound according to claim 6, wherein R.sup.9 is
##STR00149## where R.sup.10 and R.sup.11 are independently H, --OH,
--NH.sub.2, substituted or unsubstituted C.sub.1-C.sub.18 alkyl,
substituted or unsubstituted C.sub.1-C.sub.18 heteroalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 cycloalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 heterocycloalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 aryl, or substituted
or unsubstituted C.sub.1-C.sub.18 heteroaryl.
13. The compound according to claim 6, wherein R.sup.9 is other
than benzyl, 2-thienylmethyl or cyanomethyl.
14. The compound according to claim 6, wherein the compound has the
formula: ##STR00150## where R.sup.9 and each R.sup.a group is
independently H, substituted or unsubstituted akyl or heteroalkyl,
or substituted or unsubstituted aryl or heteroaryl.
15. The compound according to claim 1, wherein the compound is:
##STR00151## ##STR00152## ##STR00153## ##STR00154## ##STR00155##
##STR00156##
16. The compound according to claim 1, wherein the first dye moiety
is bonded to two substrate moieties, and the two substrate moieties
are independently a cephalosporin, a clavulanate, an aceturate, a
malonamate, benzofuranone, benzopyranone or a simple .beta.-lactam
ring substrate.
17. The compound according to claim 16, wherein at least one of the
two substrate moieties bonded to the single dye moiety is other
than a cephalosporin substrate moiety.
18. The compound of claim 16, wherein the compound is:
##STR00157##
19. The compound according to claim 16, wherein the two substrate
moieties are two clavulanates, two aceturates, two malonamates, two
benzofuranones, two benzopyranones, a clavulanate and a
cephalosporin, a clavulanate and an aceturate, a clavulanate and a
malonamate, a clavulanate and a benzofuranone, a clavulanate and a
benzopyranone, a clavulanate and a simple .beta.-lactam ring
substrate, an aceturate and a cephalosporin, an aceturate and a
malonamate, an aceturate and a benzofuranone, an aceturate and a
benzopyranone, an aceturate and a simple .beta.-lactam ring
substrate, a malonamate and a cephalosporin, a malonamate and a
benzofuranone, a malonamate and a benzopyranone, a malonamate and a
simple .beta.-lactam ring substrate, a benzofuranone and a
cephalosporin, a benzofuranone and a benzopyranone, a benzofuranone
and a simple .beta.-lactam ring substrate, a benzopyranone and a
cephalosporin, or a benzopyranone and a simple .beta.-lactam ring
substrate.
20. The compound according to claim 1, wherein the compound is a
clavulanic acid derivative (a clavulanate) and has the formula:
##STR00158## where Y is a first dye moiety; L is a linker moiety; A
is S, O, SO, SO.sub.2, or CH.sub.2; X is O, S or NH; W' and W'' are
independently hydrogen, alkyl substituted alkyl (.dbd.O),
(.dbd.NH), OR.sup.13, NHR.sup.14; wherein R.sup.13 is hydrogen,
alkyl substituted alkyl heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, or substituted heteroaryl; R.sup.14
is hydrogen, alkyl substituted alkyl heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl, or OR.sup.15; wherein R.sup.15 is hydrogen, alkyl
substituted alkyl heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, or substituted heteroaryl.
21. The compound according to claim 20, wherein X and A are O.
22. The compound according to claim 21, wherein W' is (.dbd.O) and
W'' is (OH).
23. The compound according to claim 21, wherein the compound has
the formula: ##STR00159## where each R.sup.a group is independently
hydrogen, alkyl substituted alkyl heteroalkyl, substituted
heteroaklyl, aryl, substituted aryl, heteroaryl, or substituted
heteroaryl.
24. The compound according to claim 1, wherein the compound has the
formula: ##STR00160##
25. A method for determining the presence or absence of
.beta.-lactamase enzyme in a sample, the method comprising: a)
contacting the sample with a .beta.-lactamase substrate to form a
contacted sample, wherein the .beta.-lactamase substrate has the
formula: ##STR00161## A is S, O, SO, SO.sub.2 or CH.sub.2; X is O,
S or NH; L is a linker; R.sup.2 is hydrogen, alkyl, substituted
alkyl, heteroalkyl, substituted heteroalkyl, aryl, substituted
aryl, heteroaryl, substituted heteroaryl; R.sup.3 is hydrogen,
alkyl, substituted alkyl, heteroalkyl, substituted heteroalkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl; R.sup.4
is hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.5 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.6 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl; R.sup.7 is
hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.8 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.9 is ##STR00162## in
which W is an alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, aryloxy, substituted aryloxy,
heteroaryl, substituted heteroaryl, dye moiety, or CN, and; s is an
integer from 0 to 5; W' and W'' are independently hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl,
heteroaryl, substituted heteroaryl, (.dbd.O), (.dbd.NH), OR.sup.10,
NHR.sup.11, or halogen; wherein R.sub.10 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl; or substituted heteroaryl; and,
R.sup.11 is hydrogen, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl; substituted
heteroaryl or OR.sup.12; wherein R.sup.12 is hydrogen, substituted
or unsubstituted alkyl, and substituted or unsubstituted
heteroalkyl or substituted or unsubstituted aryl or heteroaryl; and
Y is a dye moiety or quencher moiety; b) incubating the contacted
sample for a sufficient amount of time for the .beta.-lactamase
enzyme to to cleave the .beta.-lactamase substrate to form an
incubated sample; c) illuminating the incubated sample with an
appropriate wavelength; and d) observing the illuminated sample
whereby the presence or absence of .beta.-lactamase enzyme in the
sample is determined.
26. A method for determining the presence or absence of
.beta.-lactamase enzyme in a sample, the method comprising: a)
contacting the sample with a .beta.-lactamase substrate to form a
contacted sample, wherein the .beta.-lactamase substrate has the
formula: ##STR00163## ##STR00164## ##STR00165## ##STR00166##
##STR00167## ##STR00168## ##STR00169## ##STR00170## b) incubating
the contacted sample for a sufficient amount of time for the
.beta.-lactamase enzyme to to cleave the .beta.-lactamase substrate
to form an incubated sample; c) illuminating the incubated sample
with an appropriate wavelength; and d) observing the illuminated
sample whereby the presence or absence of .beta.-lactamase enzyme
in the sample is determined.
27. A method of localizing a fluorescent dye product in an
environment comprising an aqueous solution and a .beta.-lactamase,
the method comprising: a) contacting the environment with a
non-fluorescent compound comprising a dye moiety and a
.beta.-lactam moiety; b) incubating the product of step a) for a
sufficient amount of time for the .beta.-lactamase to cleave the
dye moiety from the .beta.-lactam moiety, thereby producing a
fluorescent dye product which is insoluble in the aqueous solution,
and thereby localizing the fluorescent dye product in the
environment.
28. The method according to claim 27, wherein the non-fluorescent
compound has the formula: ##STR00171## ##STR00172## ##STR00173##
##STR00174##
29. The method according to claim 27, wherein the environment is a
member selected from a biological cell and a cell-free
environment.
30. The method according to claim 28, wherein the biological cell
environment is an interior of a cell, an interior of a cell
organelle, and an exterior of a cell.
31. A method for detecting the presence or absence of a target
antigen in a sample, the method comprising: a) contacting the
sample with an antibody to form a contacted sample, wherein the
antibody binds either directly or indirectly to the target antigen,
and wherein the antibody comprises a .beta.-lactamase enzyme; b)
adding a non-fluorescent .beta.-lactamase substrate to the
incubated sample to form an added sample; c) incubating the added
sample for a sufficient amount of time for the .beta.-lactamase
enzyme to cleave the non-fluorescent .beta.-lactamase substrate to
form a fluorescent dye moiety; d) illuminating the fluorescent dye
moiety with an appropriate wavelength to form an illuminated
sample; e) observing the illuminated sample whereby the presence or
absence of the target antigen is determined.
32. A method for detecting the presence or absence of a target
antigen in a sample, the method comprising: a) contacting the
sample with an antibody to form a contacted sample, wherein the
antibody binds either directly or indirectly to the target antigen,
and wherein the antibody comprises a .beta.-lactamase enzyme; b)
adding a non-fluorescent .beta.-lactamase substrate to the
incubated sample to form an added sample, wherein the
non-fluorescent .beta.-lactamase substrate has the formula:
##STR00175## c) incubating the added sample for a sufficient amount
of time for the .beta.-lactamase enzyme to cleave the
non-fluorescent .beta.-lactamase substrate to form a fluorescent
dye moiety; d) illuminating the fluorescent dye moiety with an
appropriate wavelength to form an illuminated sample; e) observing
the illuminated sample whereby the presence or absence of the
target antigen is determined.
33. A kit for determining the presence or absence of
.beta.-lactamase in a sample, the kit comprising: a) a compound
having the formula: ##STR00176## A is S, O, SO, SO.sub.2 or
CH.sub.2; X is O, S or NH; L is a linker; R.sup.2 is hydrogen,
alkyl, substituted alkyl, heteroalkyl, substituted heteroalkyl,
aryl, substituted aryl, heteroaryl, substituted heteroaryl; R.sup.3
is hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.4 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.5 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl; R.sup.6 is
hydrogen, alkyl, substituted alkyl, heteroalkyl, substituted
heteroalkyl, aryl, substituted aryl, heteroaryl, substituted
heteroaryl; R.sup.7 is hydrogen, alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
heteroaryl, substituted heteroaryl; R.sup.8 is hydrogen, alkyl,
substituted alkyl, heteroalkyl, substituted heteroalkyl, aryl,
substituted aryl, heteroaryl, substituted heteroaryl; R.sup.9 is
##STR00177## in which W is an alkyl, substituted alkyl,
heteroalkyl, substituted heteroalkyl, aryl, substituted aryl,
aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, a
dye moiety or CN, and; s is an integer from 0 to 5; W' and W'' are
independently hydrogen, alkyl, substituted alkyl, heteroalkyl,
substituted heteroalkyl, heteroaryl, substituted heteroaryl,
(.dbd.O), (.dbd.NH), OR.sup.10, NHR.sup.11, or halogen; wherein
R.sub.10 is hydrogen, alkyl, substituted alkyl, heteroalkyl,
substituted heteroalkyl, aryl, substituted aryl, heteroaryl; or
substituted heteroaryl; and, R.sup.11 is hydrogen, substituted
alkyl, heteroalkyl, substituted heteroalkyl, aryl, substituted
aryl, heteroaryl; substituted heteroaryl or OR.sup.12; wherein
R.sup.12 is hydrogen, substituted or unsubstituted alkyl, and
substituted or unsubstituted heteroalkyl or substituted or
unsubstituted aryl or heteroaryl; and Y is a dye moiety or a
quencher moiety; and b) instructions on the use of the kit.
34. The kit according to claim 33, further comprising at least one
of a reaction buffer, a .beta.-lactamase, a antibody conjugated to
a .beta.-lactamase enzyme, a nucleic acid sequence coding for a
.beta.-lactamase, and a cell comprising a nucleic acid sequence
coding for a .beta.-lactamase.
35. A kit for determining the presence or absence of
.beta.-lactamase in a sample, the kit comprising: a) a compound
having the formula: ##STR00178## ##STR00179## ##STR00180##
##STR00181## ##STR00182## ##STR00183## ##STR00184## ##STR00185## b)
instructions on the use of the kit.
37. The kit according to claim 36, further comprising at least one
of a reaction buffer, a .beta.-lactamase, a antibody conjugated to
a .beta.-lactamase enzyme, a nucleic acid sequence coding for a
.beta.-lactamase, and a cell comprising a nucleic acid sequence
coding for a .beta.-lactamase.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority of U.S. Ser. No.
60/538,357, filed Jan. 21, 2004, which disclosure is herein
incorporated by reference.
FIELD OF THE INVENTION
[0002] This disclosure relates to enzyme substrates that exhibit a
detectable response following a reaction catalyzed by an enzyme.
Particular embodiments concern substrates that provide detectable
optical responses (such as fluorescence changes) when contacted
with a .beta.-lactamase [and/or a related enzymes]. The substrates
are useful in a variety of fields, including immunology,
diagnostics, drug discovery and molecular biology.
BACKGROUND OF THE INVENTION
[0003] An important mechanism of microbial resistance to
.beta.-lactam antibiotics is the production of enzymes known as
.beta.-lactamases or cephalosporinases. These enzymes
hydrolytically cleave .beta.-lactam antibiotics such as penicillins
and cephalosporins. This type of resistance can be transferred
horizontally by plasmids that are capable of rapidly spreading the
resistance, not only to other members of the same strain of
bacteria, but even to other species of bacteria.
[0004] In one classification scheme, .beta.-lactamases are
organized into four molecular classes (A, B, C and D) based on
their amino acid sequences. Class A enzymes have a molecular weight
of about 29 kDa and preferentially hydrolyze penicillins. Examples
of class A enzymes include RTEM and the .beta.-lactamase of
Staphylococcus aureus. Class B enzymes include metalloenzymes that
have a broader substrate profile than the other classes of
.beta.-lactamases. Class C enzymes have molecular weights of
approximately 39 kDa and include the chromosomal cephalosporinases
of gram-negative bacteria, which are responsible for the resistance
of gram-negative bacteria to a variety of both traditional and
newly designed antibiotics. In addition, class C enzymes also
include the lactamase of P99 Enterobacter cloacae, which is
responsible for making this Enterobacter species one of the most
widely spread bacterial agents in United States hospitals. The
recently recognized class D enzymes are serine hydrolases, which
exhibit a unique substrate profile.
[0005] The spread of antibiotic resistance conferred by expression
of .beta.-lactamases in bacteria threatens the ability to treat
bacterial infections. Therefore, both the detection of
.beta.-lactamase activity and the development of .beta.-lactamase
inhibitors are top priorities for pharmaceutical companies.
[0006] .beta.-lactamase enzymes also are an important component of
various assays used for detecting gene expression and measuring
gene regulation by various substances. For example, a number of
commercially available nucleic acid expression vectors include
nucleic acid sequences that code for a .beta.-lactamase. In these
vectors, the .beta.-lactamase coding sequence is coupled to a
nucleic acid sequence of interest, and .beta.-lactamase activity is
used as a measure of the expression level of the sequence of
interest. .beta.-lactamase-based detection of expression is
especially useful for detecting nucleic acid expression in
mammalian cells since mammalian cells do not contain endogenous
.beta.-lactamase activity.
[0007] An additional component of a .beta.-lactamase assay is a
substrate for the enzyme that undergoes a detectable response when
acted upon by the enzyme. One method that has been utilized for
detecting .beta.-lactamase activity uses pairs of fluorescent donor
and quencher dyes coupled to a cephalosporin ring system. In the
intact substrate, the close proximity and optical characteristics
of the dyes result in fluorescence resonance energy transfer (FRET)
between an excited donor dye and the acceptor dye, thereby masking
the fluorescence of the donor dye. Cleavage of the .beta.-lactam
portion of the cephalosporin ring by a .beta.-lactamase initiates a
reaction that allows the donor and quencher dyes to separate by a
distance that reduces or eliminates FRET. Once separated, quenching
of the donor dye's fluorescence is relieved and the donor dye's
fluorescence may be detected as an indicator of .beta.-lactamase
activity. FRET-based .beta.-lactamase substrates for detection of
.beta.-lactamase activity are disclosed, for example, in U.S. Pat.
No. 5,741,657.
[0008] Since .beta.-lactamase enzymes differ in their specificity,
a need still exists for additional detectable .beta.-lactamase
substrates. Furthermore, since .beta.-lactamase enzymes are
increasingly being used as reporters in gene regulation assays, a
need also exists for .beta.-lactamase substrates that are more
readily incorporated into living cells than large FRET-based
substrates. The disclosed .beta.-lactamase substrates provide new
options for additional, sensitive assays of .beta.-lactamase
activity that can be used to exploit differential substrate
specificities of .beta.-lactamases.
SUMMARY OF THE INVENTION
[0009] Compounds which are useful for detecting a .beta.-lactamase
are disclosed. The disclosed compounds have the general
formula:
##STR00001##
[0010] where B is a .beta.-lactamase substrate moiety ("substrate
moiety"), Y is a first dye moiety, R is a group of one or more
atoms that can include a second, optional dye moiety. G and L are
optional linking moieties. Cleavage of the substrate moiety by a
.beta.-lactamase generates a detectable optical response that may
be used to detect the presence of .beta.-lactamase activity (and a
.beta.-lactamase) in a sample. In particular embodiments, a
detectable optical response is provided when cleavage of the
substrate moiety generates a free phenolic, thiophenolic or amine
group on the dye moiety, thereby generating a detectable response,
for example, a detectable optical response such as a change in
fluorescence of the dye moiety. In some embodiments, the disclosed
compounds further include a reactive group, a carrier molecule or a
targeting molecule. In still other embodiments, the disclosed
compounds are bonded to a solid support.
[0011] In another aspect, methods are described in which the
disclosed compounds are used to detect the presence and/or quantify
amounts of a .beta.-lactamase (or activity) in a sample. In these
methods, .beta.-lactamase activity is detected by detecting an
optical response of a disclosed compound. The detected optical
response is a measure of amounts/activity of the .beta.-lactmase
present in the sample. In some embodiments, a .beta.-lactamase is
detected (and/or quantified) by contacting a sample with a
disclosed compound and a change in a fluorescence property of a dye
moiety of the compound is measured. Changes in sample fluorescence
are optionally detected in real time [using desired time increments
including, for example, nanosecond, microsecond, millisecond,
second or minute(s) time increments] to provide kinetic information
about the .beta.-lactamase's catalytic activity and/or the rate at
which a .beta.-lactamase is produced in the sample.
[0012] In yet another aspect, kits including the disclosed
compounds are provided. Particularly disclosed kits further include
one or more of the following: nucleic acid expression vectors
including a nucleic acid sequence coding for a .beta.-lactamase,
antibodies conjugated to a .beta.-lactamase and instructions for
using the disclosed compounds to detect .beta.-lactamase activity
(and thus a .beta.-lactamase) in a sample. Additional aspects and
advantages will be apparent from the detailed description that
follows.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1: Shows normalized absorption and fluorescence
emission spectra of Compound 108 after reaction with the
.beta.-lactamase enzyme.
[0014] FIG. 2: Shows the dynamic range of Compound 108 in a direct
ELISA format wherein streptavidin is detected with a primary
antibody conjugated to a .beta.-lactamase enzyme and subsequent
cleavage of the Compound 108. The wells of a microplate were coated
with a saturating amount of streptavidin. After incubation and
washes, biotinylated IgG was applied to the wells at the stated
concentrations (100 .mu.l/well). Detection was achieved using 100
.mu.l of a 10 .mu.g/ml of a .beta.-lactamase--conjugated goat
anti-mouse IgG secondary antibody in the presence of 1 .mu.g of
Compound 108 substrate (with appropriate washes between steps).
Fluorescence was read at 60 minutes without the addition of the
stop reagent (.beta.-lactamase inhibitor). IgG was reliably
detected in the range of 320 pg/ml to 640 ng/ml (over three orders
of magnitude). Across the range of detection, the accuracy of the
data obtained can be dramatically improved if curve fitting (e.g.,
Hill plot) is employed.
[0015] FIG. 3: Shows a comparison of a A) fluorescent assay using
Compound 108 and a B) colimertic assay. For the fluorogenic assay,
100 .mu.l/well of a 10 .mu.g/ml solution of anti-prostate specific
antigen (PSA) antibody was applied to microplate wells. After
incubation and washes, a dilution series of purified PSA was
applied, and detection was achieved using 100 .mu.l of a 10
.mu.g/ml of an anti-PSA primary antibody and 100 .mu.l of a 10
.mu.g/ml of a .beta.-lactamase--conjugated secondary antibody in
the presence of 1 .mu.g Compound 108 substrate (with appropriate
washes between steps). The Z-statistic.sup.1 gives a lower limit of
detection of PSA in this assay of 16 pg/ml. For the colorimetric
assay, a commercially available kit for the detection of PSA in
human serum or plasma was used according to the manufacturer's
instructions. The assay was performed using the PSA standards
provided in the kit. The capture antibody was supplied
preimmobilzed in the wells, and detection was achieved using an
HRP-labeled detection antibody and tetramethyl benzidine (TMB)
substrate. The reaction was stopped after 15 minutes using the stop
solution provided in the kit and the absorbance was read at 450 nm.
The Z-statistic gives a lower limit of detection of PSA in this
assay of 250 pg/ml. See, Example 32.
[0016] FIG. 4 Shows the background of Compound 108 over time in
different buffers. Compound 108 was prepared at a concentration of
1 .mu.g/ml in three different buffers: MES at pH 5.5, PBS at pH
7.2, and Tris at pH 8.0. The substrate solutions were applied to
the wells of a microplate, the plate was protected from light, and
fluorescence values were gathered at time points from 10-250
minutes. The bar graph shows the percentage of maximum signal given
by each substrate solution after 250 minutes. The line graph
(inset) shows the background signal given by each substrate
solution as a function of time. Maximum signal was determined by
the fluorescence value obtained when 10 .mu.l of a 100 .mu.g/ml
solution of .beta.-lactamase was added to control wells. Each point
is the mean of 12 replicates. See, Example 32.
[0017] FIG. 5: Shows a schematic diagram of the sandwich ELISA
method. The microplate is coated with a capture antibody that has
reactivity to the target antigen but has no reactivity to the
detection antibody or the enzyme-labeled secondary antibody. A
solution containing the target antigen is applied to the plate. A
portion of the target antigen is retained by the capture antibody,
and nonbinding components of the solution are washed away. A
solution containing the detection antibody is applied to the plate.
The detection antibody is specific for the target antigen, and any
detection antibody not bound to the target antigen is washed away.
The B-LA-labeled secondary antibody binds to the detection antibody
and cleaves the substrate, producing a fluorescent signal. The
target antigen described in this assay is "sandwiched" between two
antibodies, hence the name "sandwich ELISA." This is in contrast to
direct-capture assays where the plate is coated with the target
antigen. Sandwich ELISAs are generally more sensitive than
direct-capture ELISAs because of the amplification of signal that
arises from the presence of the capture antibody.
[0018] FIG. 6: Shows Fluorescence vs. TEM-1 concentration for A)
Compound 128, the instrument gain was set to 59-60 and B) Compound
123, the instrument gain was set to 179-180. See, Example 32.
[0019] FIG. 7: Shows A) the Lineweaver-Burk plot for TEM-1 with
Compound 108 and B) The Scatchard plot for TEM-1 with Compound 108.
See, Example 32.
[0020] FIG. 8: Shows the Experimental and theoretical
Michaelis-Menten curves.
[0021] FIG. 9: Shows Signal vs. Concentration and Z vs.
Concentration for various TEM-1 concentrations with 2 .mu.g/mL
(Figures A and B) or 0.5 .mu.g/mL Fluorocillin substrate (Figures C
and D). See, Example 32.
[0022] FIG. 10: Shows A) fluorescent signal and B) Z-factor vs. PSA
concentration for a sandwich ELISA using optimized concentrations
of TEM-1 conjugate and Compound 108. See, Example 32.
[0023] FIG. 11: is a comparison of the fluorescence intensity at
450 nm versus time of
7.beta.-(2-(Thien-2-yl)acetamido)-3-((((6,8-difluoro)-4-methylumbellifery-
l)-7-oxy)methyl)-3-cephem-4-carboxylic acid 1.beta.-sulfoxide
(Compound 41) after reaction with a .beta.-lactamase (excitation at
360 nm). The variation in fluorescence intensity at different
concentrations of the compound also is shown.
[0024] FIG. 12: is a comparison of the fluorescence intensity at
450 nm versus time of
7.beta.-(2-(Thien-2-yl)acetamido)-3-((((6,8-difluoro)-4-methylumbellifery-
l)-7-oxy)methyl)-3-cephem-4-carboxylic acid 1.beta.-sulfoxide
(Compound 41) after reaction with a .beta.-lactamase (excitation at
360 nm). Fluorescence intensity caused by non-enzymatic hydrolysis
of the compound also shown.
[0025] FIG. 13: is a comparison of the fluorescence intensity at
540 nm versus time of
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl)-(ph-
enyl)oxy)methyl)-3-cephem-4-carboxylic acid (Compound 25) after
reaction with a .beta.-lactamase (excitation at 360 nm).
Fluorescence intensity caused by non-enzymatic hydrolysis of the
substrate also is shown.
DETAILED DESCRIPTION OF THE INVENTION
[0026] In order to facilitate an understanding of the embodiments
presented, the following abbreviations, terms, explanations and
examples are provided. Although methods and materials similar or
equivalent to those described herein can be used in practice,
suitable methods and materials are described below. The
specifically described materials, methods, and examples are
illustrative only and not intended to be limiting.
[0027] Definitions
[0028] Before describing the present invention in detail, it is to
be understood that this invention is not limited to specific
compositions or process steps, as such may vary. It must be noted
that, as used in this specification and the appended claims, the
singular form "a", "an" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a present compound" includes a plurality of compounds
and reference to "a .beta.-lactamase substrate" includes a
plurality of ions and the like.
[0029] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention is related. The
following terms are defined for purposes of the invention as
described herein.
[0030] The symbol , whether utilized as a bond or displayed
perpendicular to a bond indicates the point at which the displayed
moiety is attached to the remainder of the molecule, solid support,
etc.
[0031] Certain compounds of the present invention can exist in
unsolvated forms as well as solvated forms, including hydrated
forms. In general, the solvated forms are equivalent to unsolvated
forms and are encompassed within the scope of the present
invention. Certain compounds of the present invention may exist in
multiple crystalline or amorphous forms. In general, all physical
forms are equivalent and are intended to be included in the scope
of the disclosed compounds and methods.
[0032] Certain disclosed compounds are chiral molecules, some
embodiments of which possess one or more asymmetrically bonded
atoms, particularly carbon atoms (optical or chiral centers),
double bonds and/or planes of asymmetry. Individual isomers (such
as individual enantiomers, diasteromers and geometric isomers),
racemates, optically-active mixtures of enantiomers and/or
diastereomers, and mixtures of geometric isomers are also included
as part of the disclosure.
[0033] The disclosed compounds may be prepared as a single isomer
(such as a single enantiomer, single cis-trans isomer, single
positional isomer, or single diastereomer) or as a mixture of
isomers. In one embodiment, the compounds are prepared
substantially as a single isomer. Methods of preparing
substantially isomerically pure compounds are known in the art. For
example, enantiomerically enriched mixtures and pure enantiomeric
compounds can be prepared by using synthetic intermediates that are
enantiomerically pure in combination with reactions that either
retain the stereochemistry at a chiral center unchanged or result
in its complete or partial inversion. Alternatively, the final
product or intermediates along the synthetic route can be resolved
into a single stereoisomer. Techniques for inverting or leaving a
particular chiral center unchanged, and those for resolving
mixtures of stereoisomers are well known in the art, and it is well
within the ability of one of skill in the art to choose appropriate
methods for a particular situation. See, generally, Furniss et al.
(eds.), VOGEL'S ENCYCLOPEDIA OF PRACTICAL ORGANIC CHEMISTRY
5.sup.TH ED., Longman Scientific and Technical Ltd., Essex, 1991,
pp. 809-816; and Heller, Acc. Chem. Res. 23: 128 (1990).
[0034] The disclosed compounds and the components used in the
disclosed methods and/or included in the disclosed kits also may
contain non-naturally occurring proportions of atomic isotopes at
one or more of the atoms that constitute such compounds and
components. For example, the compounds and components may be
radio-labeled with radioactive isotopes, such as for example
tritium (.sup.3H), iodine-125 (.sup.125I) or carbon-14 (.sup.14C).
Alternatively, or in addition to radio-labeling, the compounds and
components may be labeled with stable isotopes such as .sup.13C,
.sup.2H, .sup.18O and .sup.15N. All isotopic variations of the
compounds and components are contemplated herein. For example, the
compounds and components may include both radioactive and stable
isotopes in non-naturally occurring proportions.
[0035] Where substituent groups are specified by their conventional
chemical formulae, written from left to right, they equally
encompass the chemically identical substituents, which would result
from writing the structure from right to left (for example,
--CH.sub.2O-- is equivalent to --OCH.sub.2--).
[0036] As used herein, the term "radical" is synonymous with the
term "group" and is not intended to mean, unless otherwise stated,
a group of atoms bearing an unpaired electron.
[0037] The term "acyl" or "alkanoyl" by itself or in combination
with another term, means, unless otherwise stated, a stable
straight or branched chain, or cyclic hydrocarbon radical, or
combinations thereof, consisting of the stated number of carbon
atoms and an acyl radical on at least one terminus or position of
the alkane radical. The "acyl group" is the group derived from a
carboxylic acid by removing the --OH moiety therefrom.
[0038] The term "alkyl," by itself or as part of another
substituent means, unless otherwise stated, a straight or branched
chain, or cyclic hydrocarbon radical, or combination thereof, which
may be fully saturated, mono- or polyunsaturated and can include
divalent ("alkylene") and multivalent radicals, having the number
of carbon atoms designated (that is C.sub.1-C.sub.10 means one to
ten carbons). Examples of saturated hydrocarbon radicals include,
but are not limited to, groups such as methyl, ethyl, n-propyl,
isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl,
(cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for
example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An
unsaturated alkyl group is one having one or more double bonds or
triple bonds. Examples of unsaturated alkyl groups include, but are
not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl,
2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1-
and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The
term "alkyl," unless otherwise noted, is also meant to include
those derivatives of alkyl defined in more detail below, such as
"heteroalkyl." Alkyl groups that are limited to hydrocarbon groups
are termed "homoalkyl".
[0039] Exemplary alkyl groups of use in the present invention
contain between about one and about twenty five carbon atoms (for
example, methyl, ethyl and the like). Straight, branched or cyclic
hydrocarbon chains having eight or fewer carbon atoms will also be
referred to herein as "lower alkyl". In addition, the term "alkyl"
as used herein further includes one or more substitutions at one or
more carbon atoms of the hydrocarbon chain fragment.
[0040] The terms "alkoxy," "alkylamino" and "alkylthio" (or
thioalkoxy) are used in their conventional sense, and refer to
those alkyl groups attached to the remainder of the molecule via an
oxygen atom, an amino group, or a sulfur atom, respectively.
[0041] The term "heteroalkyl," by itself or in combination with
another term, means, unless otherwise stated, a straight or
branched chain, or cyclic carbon-containing radical, or
combinations thereof, consisting of the stated number of carbon
atoms and at least one heteroatom, for example, O, N, Si, P or S.
Nitrogen, phosphorous and sulfur atoms are optionally oxidized, and
the nitrogen heteroatom is optionally quaternized. The
heteroatom(s) such as O, N, P, S and Si also may be placed at any
interior position of the heteroalkyl group or at the position at
which the alkyl group is attached to the remainder of the molecule.
Examples include, but are not limited to,
--CH.sub.2--CH.sub.2--O--CH.sub.3,
--CH.sub.2--CH.sub.2--NH--CH.sub.3,
--CH.sub.2--CH.sub.2--N(CH.sub.3)--CH.sub.3,
--CH.sub.2--S--CH.sub.2--CH.sub.3, --CH.sub.2--CH.sub.2,
--S(O)--CH.sub.3, --CH.sub.2--CH.sub.2--S(O).sub.2--CH.sub.3,
--CH.dbd.CH--O--CH.sub.3, --Si(CH.sub.3).sub.3,
--CH.sub.2--CH.dbd.N--OCH.sub.3, and
--CH.dbd.CH--N(CH.sub.3)--CH.sub.3. Up to two heteroatoms may be
consecutive, such as, for example, --CH.sub.2--NH--OCH.sub.3 and
--CH.sub.2--O--Si(CH.sub.3).sub.3. Similarly, the term
"heteroalkylene" by itself or as part of another substituent means
a divalent radical derived from heteroalkyl, as exemplified, but
not limited by, --CH.sub.2--CH.sub.2--S--CH.sub.2--CH.sub.2-- and
--CH.sub.2--S--CH.sub.2--CH.sub.2--NH--CH.sub.2--. For
heteroalkylene groups, heteroatoms also can occupy either or both
of the chain termini (e.g., alkyleneoxy, alkylenedioxy,
alkyleneamino, alkylenediamino, and the like). Still further, for
alkylene and heteroalkylene linking groups, no orientation of the
linking group is implied by the direction in which the formula of
the linking group is written. For example, the formula
--C(O).sub.2R'-- represents both --C(O).sub.2R'-- and
--R'C(O).sub.2--.
[0042] The terms "cycloalkyl" and "heterocycloalkyl", by themselves
or in combination with other terms, represent, unless otherwise
stated, cyclic versions of "alkyl" and "heteroalkyl", respectively.
Additionally, for heterocycloalkyl, a heteroatom can occupy the
position at which the heterocycle is attached to the remainder of
the molecule. Examples of cycloalkyl include, but are not limited
to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl,
cycloheptyl, and the like. Examples of heterocycloalkyl include,
but are not limited to, 1-(1,2,5,6-tetrahydropyridyl),
1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl,
3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl,
tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl,
2-piperazinyl, and the like.
[0043] The term "aryl" means an aromatic compound, and unless
otherwise stated, a polyunsaturated, aromatic moiety that can be a
single ring or multiple rings (for example, from 1 to 3 rings),
which are fused together or linked covalently. The term
"heteroaryl" refers to aryl groups (or rings) that contain from at
least one heteroatom (such as from 1 to 4) which are a member
selected from N, O, and S, wherein the nitrogen and sulfur atoms
are optionally oxidized, and the nitrogen atom(s) are optionally
quaternized. A heteroaryl group can be attached to the remainder of
the molecule through a heteroatom. Non-limiting examples of aryl
and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl,
4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl,
2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl,
2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl,
5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl,
3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl,
2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl,
2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, tetrazolyl,
benzo[b]furanyl, benzo[b]thienyl, 2,3-dihydrobenzo[1,4]dioxin-6-yl,
benzo[1,3]dioxol-5-yl and 6-quinolyl. Substituents for each of the
above noted aryl and heteroaryl ring systems are selected from the
group of acceptable substituents described below.
[0044] For brevity, the term "aryl" when used in combination with
other terms (such as in aryloxy, arylthioxy or arylalkyl) includes
both aryl and heteroaryl rings as defined above. Thus, the term
"arylalkyl" is meant to include those radicals in which an aryl
group is attached to an alkyl group (such as benzyl, phenethyl,
pyridylmethyl and the like) including those alkyl groups in which a
carbon atom (such as a methylene group) has been replaced by, for
example, an oxygen atom (for example, phenoxymethyl,
2-pyridyloxymethyl, 3-(1-naphthyloxy)propyl, and the like).
[0045] Each of the above terms (for example, "alkyl,"
"heteroalkyl," "aryl" and "heteroaryl") includes both substituted
and unsubstituted forms of the indicated radical. Substituents that
can occupy one or more positions for each type of radical are
provided below.
[0046] Substituents for the alkyl and heteroalkyl radicals
(including those groups often referred to as alkylene, alkenyl,
heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl,
heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are
generically referred to as "alkyl group substituents," and they can
be one or more of a variety of groups selected from, but not
limited to: --OR', .dbd.O, .dbd.NR', .dbd.N--OR', --NR'R'', --SR',
-halogen (--F, --Cl, --Br, and --I), --SiR'R''R''', --OC(O)R',
--C(O)R', --CO.sub.2R', --CONR'R'', --OC(O)NR'R'', --NR''C(O)R',
--NR'--C(O)NR''R''', --NR''C(O).sub.2R',
--NR--C(NR'R''R''').dbd.NR'''', --NR--C(NR'R'').dbd.NR''',
--S(O)R', --S(O).sub.2R', --S(O).sub.2NR'R'', --NRSO.sub.2R', --CN
and --NO.sub.2 in a number ranging from zero to (2 m'+1), where m'
is the total number of carbon atoms in such radical. R', R'', R'''
and R'''' each independently refer to hydrogen, substituted or
unsubstituted heteroalkyl, substituted aryl (such as aryl
substituted with 1-3 halogens) or unsubstituted aryl, substituted
or unsubstituted alkyl, alkoxy or thioalkoxy groups, or arylalkyl
groups. When a compound includes more than one R group, unless
otherwise stated, each of the R groups is independently selected as
are each of the R', R'', R''' and R'''' groups when more than one
of these groups is present. When R' and R'' are attached to the
same nitrogen atom, they can be combined with the nitrogen atom to
form a 5-, 6-, or 7-membered ring. For example, --NR'R'' is meant
to include, but not be limited to, 1-pyrrolidinyl and
4-morpholinyl. From the above discussion of substituents, one of
skill in the art will understand that the term "alkyl" is meant to
include groups including carbon atoms bound to groups other than
hydrogen groups, such as haloalkyl (e.g., --CF.sub.3 and
--CH.sub.2CF.sub.3) and acyl (e.g., --C(O)CH.sub.3, --C(O)CF.sub.3,
--C(O)CH.sub.2OCH.sub.3, and the like).
[0047] Similar to the substituents described for the alkyl radical,
substituents for the aryl and heteroaryl groups are generically
referred to as "aryl group substituents." The substituents are
selected from, for example: halogen (--F, --Cl, --Br and --I),
--OR', .dbd.O, .dbd.NR', .dbd.N--OR', --NR'R'', --SR',
--SiR'R''R''', --OC(O)R', --C(O)R', --CO.sub.2R', --CONR'R'',
--OC(O)NR'R'', --NR''C(O)R', --NR'--C(O)NR''R''',
--NR''C(O).sub.2R', --NR--C(NR'R''R''').dbd.NR'''',
--NR--C(NR'R'').dbd.NR''', --S(O)R', --S(O).sub.2R',
--S(O).sub.2NR'R'', --NRSO.sub.2R', --CN and --NO.sub.2, --R',
--N.sub.3, --CH(Ph).sub.2, fluoro(C.sub.1-C.sub.4)alkoxy, and
fluoro(C.sub.1-C.sub.4)alkyl, in a number ranging from zero to the
total number of open valences on the aromatic ring system; and in
particular embodiments R', R'', R'' and R'''' are independently
selected from hydrogen, substituted or unsubstituted alkyl,
substituted or unsubstituted heteroalkyl, substituted or
unsubstituted aryl and substituted or unsubstituted heteroaryl.
When a compound of the disclosed embodiments includes more than one
R group, unless otherwise stated, each of the R groups is
independently selected as are each R', R'', R''' and R'''' groups
when more than one of these groups is present.
[0048] Two of the substituents on adjacent atoms of the aryl or
heteroaryl ring optionally may be replaced with a substituent of
the formula --T--C(O)--(CRR').sub.q--U--, wherein T and U are
independently --NR--, --O--, --CRR'-- or a single bond, and q is an
integer of from 0 to 3. Alternatively, two of the substituents on
adjacent atoms of the aryl or heteroaryl ring optionally may be
replaced with a substituent of the formula
-A-(CH.sub.2).sub.r--B--, wherein A and B are independently
--CRR'--, --O--, --NR--, --S--, --S(O)--, --S(O).sub.2--,
--S(O).sub.2NR'-- or a single bond, and r is an integer of from 1
to 4. One of the single bonds of the new ring so formed optionally
may be replaced with a double bond. Alternatively, two of the
substituents on adjacent atoms of the aryl or heteroaryl ring
optionally may be replaced with a substituent of the formula
--(CRR').sub.s--Z--(CR''R''').sub.d--, where s and d are
independently integers of from 0 to 3, and Z is --O--, --NR'--,
--S--, --S(O)--, --S(O).sub.2--, or --S(O).sub.2NR'--. The
substituents R, R', R'' and R''' are preferably independently
selected from hydrogen or substituted or unsubstituted
(C.sub.1-C.sub.6) alkyl.
[0049] As used herein, the term "heteroatom" includes oxygen (O),
nitrogen (N), sulfur (S), phosphorus (P) and silicon (Si).
[0050] The term "amino" or "amine group" refers to the group
--NR'R'' (or N.sup.+RR'R'') where R, R' and R'' are independently
selected from the group consisting of hydrogen, alkyl, substituted
alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl,
heteroaryl, and substituted heteroaryl. A substituted amine is an
amine group wherein R' or R'' is other than hydrogen. In a primary
amino group, both R' and R'' are hydrogen, whereas in a secondary
amino group, either, but not both, R' or R'' is hydrogen. In
addition, the terms "amine" and "amino" can include protonated and
quaternized versions of nitrogen, comprising the group
--N.sup.+RR'R'' and anionic counterions such as biologically
compatible anionic counterions.
[0051] The term "aqueous solution" as used herein refers to a
solution that is predominantly water and retains the solution
characteristics of water. Where the aqueous solution contains
solvents in addition to water, water is typically the predominant
solvent.
[0052] The term "detectable response" as used herein refers to an
occurrence of, or a change in, a signal that is directly or
indirectly detectable (observable) either by visual observation or
by instrumentation. Typically, the detectable response is a
detectable response in an optical property ("detectable optical
response") such as a change in the wavelength distribution patterns
or intensity of absorbance or fluorescence or a change in light
scatter, fluorescence lifetime, fluorescence polarization, or a
combination of such parameters in a sample.
[0053] The term "dye" refers to a compound that absorbs and/or
emits light to produce a detectable optical response or reacts with
a second molecule to produce a compound that absorbs and/or emits
light to produce a detectable optical response. "Dyes" include
colored, fluorescent and non-fluorescent compounds that include,
without limitation, pigments, fluorophores, chemiluminescent
compounds, quenchers (including collisional and electronic),
luminescent compounds and chromophores. "Dyes" also include
colorogenic and fluorogenic compounds and compositions.
[0054] Fluorescence refers to light that is re-emitted by a
molecule following absorption of energy, such light as light
energy, by the molecule. A photon that is re-emitted as
fluorescence typically has a lower energy than the photon(s) that
is (are) initially absorbed.
[0055] The term "non-fluorescent" is a relative term since
virtually all compounds will exhibit some detectable fluorescence.
In some embodiments, a non-fluorescent compound is a compound that
emits less fluorescence than a compound to which it is compared. In
other embodiments, a non-fluorescent compound has a fluorescence
quantum yield below 0.1, for example, below 0.01, below 0.001 or
below 0.001.
[0056] The term "quencher" refers to a compound or moiety that
absorbs energy from an excited donor compound or moiety. A quencher
may absorb the fluorescent photons emitted by a donor compound,
thereby masking the donor compound's fluorescence. In some
embodiments, the quencher receives energy from an excited donor
compound by fluorescence resonance energy transfer (FRET).
Alternatively, the quencher may receive energy from the donor in
the form of heat or an electron. Quenchers include collisional and
electronic quenchers. In particular embodiments, a quencher absorbs
30% or greater, 50% or greater, 70% or greater, or 90% or greater
of the fluorescence photons emitted by a dye product or dye
moiety.
[0057] The term "FRET-pair" refers to a pair of dye molecules where
one of the dye molecules absorbs light (the acceptor or quencher
dye) at a wavelength at which the other emits light (the donor dye)
and the two dyes are spatially separated by a distance that permits
energy transfer with the disclose emobodiments generally being
within about 100 angstroms, such as within about 50, 20 or 10
angstroms of each other (for example, because they are bonded to
the same substrate moiety). Excitation of the donor dye leads to
excitation of the acceptor dye throught the FRET mechanism, and a
lower level of fluorescence is observed from the donor dye. The
dependence of FRET efficiency on the distance between the dyes, the
quantum yield of the donor dye, the fluorescence lifetime of the
donor dye, and the overlap of the donor's emission spectrum and the
acceptor's aborption spectrum is well known and is discussed in
detail in U.S. Pat. No. 5,955,604, which is incorporated by
reference herein. In some embodiments, a FRET-pair is substantially
non-fluorescent, for example, when FRET is very efficient (such as
greater than about 90%, 95% or 99%) and the acceptor dye is
substantially non-fluorescent (for example, because it dissipates
the excitation energy it receives from the donor to its
surroundings, such as to a solvent). A FRET-pair also can be
substantially non-fluorescent because the donor and acceptor dyes
stack due to hydrophobic interactions, creating a non-fluorescent
"dark complex." In other embodiments, the FRET-pair exhibits
fluorescence from the donor and/or acceptor dye. For example,
substantially only acceptor dye fluorescence may be observed from a
FRET-pair where FRET is very efficient and the acceptor dye is
fluorescent. If FRET is less efficient (such as between 10% and 90%
efficient) and both the donor and acceptor dyes are fluorescent,
fluorescence is observed at wavelengths characteristic of both the
donor and acceptor. When the FRET-pair is attached to a substrate
moiety, cleavage of the substrate moiety, such as by a
.beta.-lactamase, can lead to separation of the dyes in the
FRET-pair, thereby relieving the quenching (to whatever extent it
is present). Relief of quenching can lead, for example, to an
increase in the fluorescence intensity and the fluorescence
lifetime of the donor dye. Examples of combinations of dyes that
are suitable for use as a FRET-pair, and methods for measuring FRET
in a sample are provided in U.S. Pat. No. 5,955,604, which is
incorporated by reference herein. Xanthene dyes that are
particularly suited for use as an acceptor (quencher) in a
FRET-pair are disclosed in U.S. Pat. No. 6,399,392, which discloses
nitrogen-substituted xanthenes that are substituted by one or more
aromatic or heteroaromatic quenching moieties, and exhibit little
or no observable fluorescence. In one example, FRET is measured by
ratioing the donor and acceptor dye fluorescence intensities and/or
lifetimes at one or more wavelengths. In embodiments of the
disclosed compounds that include a FRET-pair, monitoring of the
amount of FRET can be used as a measure of enzymatic activity,
particularly the .beta.-lacatamase activity, in a sample.
Typically, the amount of FRET is reduced over time as the compound
is cleaved.
[0058] The term non-FRET-pair refers to a pair of dye moieties that
do not substantially transfer energy between each other by the FRET
mechanism, and thus there is no substantial affect on the
fluorescence properties of the dyes when they are in close
proximity, such as within 100 angstroms of each other. In some
embodiments, a non-FRET-pair exhibits FRET with an efficiency
(calculated or measured) of less than about 10%, 5%, 1% or
0.1%.
[0059] The term ".beta.-lactam moiety", as used herein, refers to a
compound which comprises a .beta.-lactam ring structure. Examples
of compounds that include the beta-lactam moiety include clavulanic
acid, penicillanic acid, and cephalosporanic acid. The
.beta.-lactam structure is:
##STR00002##
[0060] The term "buffer" as used herein refers to a system that
acts to minimize the change in acidity or basicity of the solution
against addition or depletion of chemical substances.
[0061] The term "carbonyl" as used herein refers to the functional
group --(C.dbd.O)--. However, it will be appreciated that this
group may be replaced with other well-known groups that have
similar electronic and/or steric character, such as thiocarbonyl
(--(C.dbd.S)--); sulfinyl (--S(O)--); sulfonyl (--SO.sub.2)--),
phosphonyl (--PO.sub.2--).
[0062] The term "carboxy" or "carboxyl" refers to the group
--R'(COOR) where R' is alkyl, substituted alkyl, aryl, substituted
aryl, arylalkyl, substituted arylalkyl, heteroaryl, or substituted
heteroaryl. R is hydrogen, a salt or --CH.sub.2OC(O)CH.sub.3.
[0063] The term "colored" refers to a composition (or compound)
that absorbs light, such as light with wavelengths between about
260 nm and about 1200 nm, likely between about 300 nm and about
1000 nm and typically between about 400 nm and 750 nm. Generally,
colored compositions and compounds may be detected visually or
using a spectrophotometer, such as a UV-Vis or UV-Vis-NIR
spectrophotometer. The term "colorogenic" refers to a composition
that generates a colored composition or a colored composition that
exhibits a change in its absorption spectrum upon interacting with
another substance, for example, upon binding to a biological
compound or metal ion, upon reaction with another molecule or upon
metabolism by an enzyme.
[0064] The term "fluorophore" refers to a compound, a portion of a
compound or a composition that exhibits fluorescence. The term
"fluorogenic" refers to a compound or composition that becomes
fluorescent or demonstrates a change in its fluorescence (such as
an increase or decrease in fluorescence intensity or a change in
its fluorescence spectrum) upon interacting with another substance,
for example, upon binding to a biological compound or metal ion,
upon reaction with another molecule or upon metabolism by an
enzyme. Fluorophores may be substituted to alter their solubility,
spectral properties and/or physical properties. Numerous
fluorophores and fluorogenic compounds and compositions are known
to those skilled in the art and include, but are not limited to
benzofurans, quinolines, quinazolines, quinazolinones, indoles,
benzazoles, indodicarbocyanines, borapolyazaindacenes and
xanthenes, with the latter including fluoresceins, rhodamines and
rhodols as well as other fluorophores described in Haugland,
Molecular Probes, Inc. Handbook of Fluorescent Probes and Research
Chemicals, (9.sup.th ed., including the CD-ROM, September
2002).
[0065] The term "carrier molecule" as used herein refers to a
biological or non-biological component to which a disclosed
compound is associated, typically bonded (such as covalently
bonded). Such components include, but are not limited to, an amino
acid, a peptide, a protein (such as an antiobody or a binding
fragment thereof, such as a Fab fragment thereof), a
polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a
nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a
lipid assembly, a synthetic polymer, a polymeric microparticle, a
biological cell, a virus and combinations thereof.
[0066] The term "cell permeable" as used herein refers to compounds
of the present invention that are able to cross the cell membrane
of live cells. Lipophilc groups that are covalently attached to the
present compounds facilitate this permeability and live cell entry.
Once inside the cells, the lipophilic groups are hydrolyzed
resulting in charged molecules that are well retained in living
cells. Particularly useful lipophilic groups include acetoxymethyl
(AM) ester and acetate esters wherein once inside the cells the
groups are cleaved by nonspecific esterases resulting in charged
molecules.
[0067] The term "complex" as used herein refers to the association
of two or more molecules, usually by non-covalent bonding.
[0068] The term "directly detectable" as used herein refers to the
presence of a detectable label or the signal generated from a
detectable label that is immediately detectable by observation,
instrumentation, or film without requiring chemical modifications
or additional substances. For example, a fluorophore produces a
directly detectable response.
[0069] The term "kit" as used herein refers to a packaged set of
related components, typically one or more compounds or
compositions.
[0070] The term "linker" or "L" as used herein refers to a bond or
one or more atoms that effectively couple two molecules or moieties
together. More specifically, "linker" or "L" refers to a single
covalent bond or a series of stable covalent bonds incorporating
1-30 non-hydrogen atoms selected from the group consisting of C, N,
O, S and P that covalently attach the present .beta.-lactamase
substrate compounds to another moiety such as a chemically reactive
group, fluorphore, quencher or a conjugated substance including
biological and non-biological substances. Exemplary linking members
include a moiety that includes --C(O)NH--, --C(O)O--, --NH--,
--S--, --O--, and the like. A "cleavable linker" is a linker
whereby its coupling of two molecules or moieties can be disrupted.
Particular embodiments of disclosed cleavable linkers have one or
more covalent bonds that can be broken by the result of a reaction
or condition. For example, an ester in a molecule is a linker that
can be cleaved by a reagent, e.g. sodium hydroxide, resulting in a
carboxylate-containing fragment and a hydroxyl-containing product,
or by an enzyme, for example, a hydrolase. In some embodiments, the
linker includes a --C(O)O--, --C(S)O--, C(O)S--, or --C(S)S--
group.
[0071] In addition to enzymatically cleavable groups, it is within
the scope of the present invention to include one or more sites
that are cleaved by the action of an agent other than an enzyme.
Exemplary non-enzymatic cleavage agents include, but are not
limited to, acids, bases, light (e.g., nitrobenzyl derivatives,
phenacyl groups, benzoin esters), and heat. Many cleaveable groups
are known in the art. See, for example, Jung et al., Biochem.
Biophys. Acta, 761: 152-162 (1983); Joshi et al., J. Biol. Chem.,
265: 14518-14525 (1990); Zarling et al., J. Immunol., 124: 913-920
(1980); Bouizaretal., Eur. J. Biochem., 155: 141-147 (1986); Park
et al., J. Biol. Chem., 261: 205-210 (1986); Browning et al., J.
Immunol., 143: 1859-1867 (1989). Moreover a broad range of
cleavable, bifunctional (both homo- and hetero-bifunctional) spacer
arms are commercially available.
[0072] An exemplary cleavable group, an ester, is cleavable group
that may be cleaved by a reagent, e.g. sodium hydroxide, resulting
in a carboxylate-containing fragment and a hydroxyl-containing
product.
[0073] The linker can be used to attach the compound to another
component of a conjugate, such as a targeting moiety (e.g.,
antibody, ligand, non-covalent protein-binding group, etc.), an
analyte, a biomolecule, a drug and the like.
[0074] The terms "protein" and "polypeptide" are used herein in a
generic sense to include polymers of amino acid residues of any
length. The term "peptide" is used herein to refer to polypeptides
having less than 250 amino acid residues, typically less than 100
amino acid residues. The terms apply to amino acid polymers in
which one or more amino acid residues and/or peptide bonds are an
artificial chemical analogue of a corresponding naturally occurring
amino acid or peptide bond, as well as to naturally occurring amino
acid polymers.
[0075] The term "reactive group" as used herein refers to a group
that is capable of reacting with another species, such as an atom
or chemical group to form a covalent bond, that is, a group that is
covalently reactive under suitable reaction conditions, and
generally represents a point of attachment for another substance,
for example, a carrier molecule or a substrate. For example, the
reactive group on a disclosed compound is a moiety, such as
carboxylic acid or succinimidyl ester, on the compounds that can
chemically react with a functional group on a different compound to
form a covalent linkage. Reactive groups generally include
nucleophiles, electrophiles and photoactivatable groups.
[0076] Exemplary reactive groups include, but are not limited to,
olefins, acetylenes, alcohols, phenols, ethers, oxides, halides,
aldehydes, ketones, carboxylic acids, esters, amines, amides,
cyanates, isocyanates, thiocyanates, isothiocyanates, hydrazines,
hydrazones, hydrazides, diazo groups, diazonium groups, nitro
groups, nitriles, mercaptans, sulfides, disulfides, sulfoxides,
sulfones, sulfonic acid groups, sulfinic acid groups, acetals,
ketals, anhydrides, sulfates, sulfenic acid groups isonitriles,
amidines, imides, imidates, nitrones, hydroxylamines, oximes,
hydroxamic acid groups thiohydroxamic acid groups, allenes, ortho
esters, sulfites, enamines, ynamines, ureas, pseudoureas,
semicarbazides, carbodiimides, carbamates, imines, azides, azo
groups, azoxy groups, and nitroso groups. Reactive functional
groups also include those used to prepare bioconjugates, for
example, N-hydroxysuccinimide esters, maleimides and the like.
Methods to prepare each of these functional groups are well known
in the art and their application to or modification for a
particular purpose is within the ability of one of skill in the art
(see, for example, Sandler and Karo, eds., Organic Functional Group
Preparations, Academic Press, San Diego, 1989).
[0077] The term "sample" as used herein refers to any material that
may contain a .beta.-lactamase or a nucleotide sequence coding for
a .beta.-lactamase, or to a material to which a .beta.-lactamase or
a nucleotide sequence coding for a .beta.-lactamase is added.
Typically, the sample is a live cell or a fluid, such as a
biological fluid, that further includes endogenous host cell
proteins, nucleic acid polymers, nucleotides, oligonucleotides
proteins or peptides, and also may include a buffer solution. The
sample may be in a fluid dispersion, such as an aqueous solution, a
cell culture (viable or otherwise) or immobilized on a solid or
semi solid surface such as a polyacrylamide gel, membrane blot or
on a microarray.
[0078] As used herein, the term ".beta.-lactamase" denotes a
protein capable of catalyzing cleavage of a .beta.-lactamase
substrate such as a .beta.-lactam containing molecule (such as a
.beta.-lactam antibiotic) or derivative thereof, a clavulanic acid
or derivative thereof, an aceturate or derivative thereof, a
benzofuranone or derivative thereof, a benzopyranone or a
derivative thereof or a malonamate or a derivative thereof. In an
exemplary embodiment, the .beta.-lactamase is an enzyme which
catalyzes the hydrolysis of the .beta.-lactam ring of a
.beta.-lactam antibiotic. In another exemplary embodiment, the
.beta.-lactamase is microbial. In yet another exemplary embodiment,
the .beta.-lactamase is a serine .beta.-lactamase. In still another
exemplary embodiment, the .beta.-lactamase is a zinc
.beta.-lactamase. The terms "class A", "class B", "class C", and
"class D" .beta.-lactamase are understood by those skilled in the
art and are described in Waley, The Chemistry of .beta.-Lactamase,
Page Ed., Chapman & Hall, London, (1992) 198-228. In yet
another exemplary embodiment, the .beta.-lactamase is class C
.beta.-lactamase of Enterobacter cloacae P99 (hereinafter P99
.beta.-lactamase), or class A .beta.-lactamase of the TEM-2 plasmid
(hereinafter TEM .beta.-lactamase). In certain embodiments, a
.beta.-lactamase is a portion of a .beta.-lactamase enzyme, such as
a catalytic portion of a .beta.-lactamase enzyme. In other
embodiments, the .beta.-lactamase is a fusion protein including a
.beta.-lactamase or a portion therof, such as a catalytic portion
thereof. The term .beta.-lactamase also is meant to include
conservative and functional variants of a .beta.-lactamase.
Moreover, the term is meant to include variants of a
.beta.-lactmase that exhibits a substrate specificity that differs
due to one or more amino acid substitutions, particularly one or
more amino acid substitutions in the catalytic region of the
.beta.-lactamase.
[0079] One skilled in the art will recognize that individual
substitutions, deletions or additions which alter, add or delete a
single amino acid or a small percentage of amino acids (typically
less than 5%, more typically less than 1%) in an encoded sequence
are "conservative substitutions" or "conservatively modified
variations" where the alterations result in the substitution of an
amino acid with a chemically similar amino acid. Conservative
substitution tables providing functionally similar amino acids are
well known in the art. The following five groups each contain amino
acids that are conservative substitutions for one another: [0080]
Aliphatic: Glycine (G), Alanine (A), Valine (V), Leucine (L),
Isoleucine (I); [0081] Aromatic: Phenylalanine (F), Tyrosine (Y),
Tryptophan (W); [0082] Sulfur-containing: Methionine (M), Cysteine
(C); [0083] Basic: Arginine (R), Lysine (K), Histidine (H); [0084]
Acidic: Aspartic acid (D), Glutamic acid (E), Asparagine (N),
Glutamine (Q). [0085] See also, Creighton, Proteins, W. H. Freeman
and Company, 1984, for additional groupings of amino acids. In
addition, individual substitutions, deletions or additions which
alter, add or delete a single amino acid or a small percentage of
amino acids in an encoded sequence are also "conservative
variations." Variants of a peptide are typically characterized by
possession of at least 50% sequence identity counted over the full
length alignment with the amino acid sequence of the peptide using
the NCBI Blast 2.0, gapped blastp set to default parameters. For
comparisons of amino acid sequences of greater than 30 amino acids,
the Blast 2 sequences function is employed using the default
BLOSUM62 matrix set to default parameters, (gap existence cost of
11, and a per residue gap cost of 1). When aligning short peptides
(fewer than around 30 amino acids), the alignment is performed
using the Blast 2 sequences function, employing the PAM30 matrix
set to default parameters (open gap 9, extension gap1 penalties).
Proteins with even greater similarity to the reference sequences
will show increasing percentage of identities when assessed by this
method, such as at least 60%, at least 65%, at least 75%, at least
80%, at least 90%, or 95%, or 98%, or 99% sequence identity. When
less than the entire sequence is being compared for sequence
identity (for example, sequence identity of catalytic portions of a
.beta.-lactamase), homologs and variants will typically possess at
least 75% sequence identity over short windows of 10-20 amino
acids, and may possess sequence identifies of at least 85% or at
least 90%, or 95%, or 98%, or 99% depending on their similarity to
the reference sequence. Methods for determining sequence identity
over such short windows are described at the website that is
maintained by the National Center for Biotechnology Information in
Bethesda, Maryland. One of skill in the art will appreciate that
these sequence identity ranges are provided for guidance only; it
is entirely possible that strongly significant homologs could be
obtained that fall outside of the ranges provided.
[0086] As used herein, the term ".beta.-lactamase conjugate" refers
to a ".beta.-lactamase enzyme", as disclosed above, that has been
covalently attached to a carrier molecule or solid support such as
an antibody or streptavidin.
[0087] As used herein, the term ".beta.-lactamase inhibitor" is
used to identify a compound that inhibits a .beta.-lactamase
activity. Inhibiting .beta.-lactamase activity means reducing the
catalytic activity, such as the observed catalytic activity, of a
class A, B, C, or class D .beta.-lactamase, or other
.beta.-lactamase, for example, with a 50% inhibition concentration
(IC.sub.50) below 100 micrograms/mL, below 30 micrograms/mL or
below 10 micrograms/mL.
[0088] In some embodiments, the .beta.-lactamase inhibitor is also
capable of acting as an antibiotic, for example, by inhibiting
bacterial cell-wall cross-linking enzymes. Thus, the term
.beta.-lactamase inhibitor is intended to encompass such
dual-acting inhibitors. In certain preferred embodiments, the
.beta.-lactamase inhibitor is capable of inhibiting
D-alanyl-D-alanine-carboxy-peptidases/transpeptidases (hereinafter
DD-peptidases). The term "DD-peptidase" is used in its usual sense
to denote penicillin-binding proteins involved in bacterial cell
wall biosynthesis (e.g., Ghysen, Prospect. Biotechnol., 128:67-95
(1987)). In certain particularly preferred embodiments, the
D-alanyl-D-alanine-carboxy-peptidases/transpeptidase inhibited is
the Streptomyces R61 DD-peptidase.
[0089] "rt", as used herein, refers to room temperature.
[0090] A "lipophilic moiety" as used herein, refers to a molecule
or a portion of a molecule that confers hydrophobicity to a second
molecule. In general, hydrophobicity may be conferred by a
non-polar group of atoms, for example, substituted or unsubstituted
alkyl groups containing six or more carbons. Such alkyl groups can
include heteroatoms. Examples of hydrophobic groups include long
chain fatty acids (such as dodecanoyl) long chain fatty alcohols
(such as octanol), and phospholipids. One skilled in the art will
recognize that lipophilicity may be conferred to a molecule by
adding to it a single, large and non polar group of atoms (such as
a a phospholipid), or by converting one or more polar groups on a
molecule to less polar groups. For example, polar hydroxyl groups,
carboxylic acid groups, and amine groups may be reacted to form
esters or amides. Lipophilic moieties further include
"hydrolase-cleavable moieties" such as esters and amides that are
added to a molecule to increase its lipophilicity, but which may be
removed by a hydrolase (other than a .beta.-lactamase), such as by
an endogenous lipase or esterase. For example, where a disclosed
compound does not readily enter a cell because it is too polar to
cross a cell membrane the molecule may be reacted to convert polar
groups to non-polar hydrolase-cleavable moieties, which facilitate
movement of the compound across the cell membrane into the interior
of the cell. Once in the interior of the cell, endogenous
hydrolases remove the non-polar hydrolase-cleavable moieties and
thereby trap the compound in the interior of the cell.
[0091] A "targeting moiety", as used herein, refers to species that
will selectively localize in a particular tissue or region of the
body or a cell. Localization of the targeting moiety may be
mediated, for example, by specific recognition of molecular
determinants, molecular size of the targeting agent or conjugate,
ionic interactions or hydrophobic interactions. Other mechanisms of
targeting an agent to a particular tissue or region are known to
those of skill in the art. Exemplary targeting moieties include
antibodies, antibody fragments, transferrin, HS-glycoprotein,
coagulation factors, serum proteins, .beta.-glycoprotein, G-CSF,
GM-CSF, M-CSF, EPO and the like. In some embodiments, a targeting
moiety binds specifically to another substance, for example, a
protein, a nucleic acid, a cell or a cell component, such as an
organelle. As used herein, a targeting moiety such as an antibody,
or antigen-binding fragment thereof, is said to "bind specifically"
if it reacts at a detectable level (within, for example, an ELISA)
with a substance, such as a protein, and does not react detectably
with unrelated substances, such as other peptides, polypeptides,
nucleic acids and proteins, under similar conditions. As used
herein, "binding" refers to a noncovalent association between two
separate molecules such that a complex is formed. The ability to
bind may be evaluated by, for example, determining a binding
constant for the formation of the complex. The binding constant is
the value obtained when the concentration of the complex is divided
by the product of the component concentrations. In particular
embodiments, two compounds are said to "bind specifically" when the
binding constant for complex formation exceeds about 10.sup.2
L/mol, for example, exceeds 10.sup.3 L/mol, or exceeds 10.sup.4
L/mol, or greater. The binding constant may be determined using
methods well known in the art.
[0092] "Localize," as used herein, means to accumulate in, or be
restricted to, a specific or limited area.
[0093] The Compounds
[0094] In general, for ease of understanding the present invention,
the .beta.-lactamase substrate compounds and corresponding
substituents will first be described in detail, followed by the
.beta.-lactamase conjugates, the methods in which the substrates
and conjugates find uses, which is followed by exemplified methods
of use and synthesis of certain novel compounds that are
particularly advantageous for use with the methods of the present
invention.
[0095] Compounds are provided that are useful for the detection of
.beta.-lactamase activity. The disclosed compounds include colored,
colorogenic, fluorescent and fluorogenic compounds that produce a
detectable optical response (for example, an increase, decrease or
wavelength shift in absorption and/or fluorescence) when contacted
with a .beta.-lactamase. The compounds include a dye moiety
effectively coupled to, such as covalently bonded to, a
.beta.-lactamase substrate moiety, such as a cephalosporin, a
benzofuranone, a benzopyranone, an aceturate, a malonamate or a
clavulanic acid moiety. The .beta.-lactamase substrate moiety
("substrate moiety") is a group of atoms in which at least one bond
is cleaved when contacted by a .beta.-lactamase. Cleavage of the
substrate moiety of the disclosed compounds by a .beta.-lactamase
provides a detectable response, such as a detectable optical
response, of the dye moiety, which either remains connected to the
cleaved substrate moiety or separates from the cleaved substrate
moiety. In some embodiments, cleavage of the substrate generates a
free phenol (phenolate), thiophenol (thiophenolate) or amine group
on the dye moiety, thereby causing a change in the electronic
structure of the dye moiety that provides a detectable optical
change, such as a change in fluorescence. In particular
embodiments, cleavage of the substrate moiety generates a free
phenol or phenolate group on the dye moiety, and alters the
fluorescence of the dye moiety.
[0096] Certain embodiments of the disclosed compounds have the
general formula:
##STR00003##
where B is a .beta.-lactamase substrate moiety ("substrate
moiety"), Y is a first dye moiety, R is one or more atoms that can
include a second dye moiety, and also can be selected to confer
.beta.-lactamase enzyme specificity to the compound. B also can
further include a second dye moiety. G is first optional linking
moiety. If G is present, B and G are bonded to the first dye moiety
at different atoms. A second optional linker, L, can be present
between B and Y when G is absent.
[0097] The substrate moiety can be cleaved by a .beta.-lactamase to
generate a detectable optical response of the first and/or second
dye moiety (if present). When G is absent, the first dye moiety Y
is released from the substrate moiety B following cleavage of the
substrate moiety by a .beta.-lactamase. When G is absent, R or B
includes a second dye moiety, and B is not a cephalosporin ring
system, the first and second dye moieties can be a donor and
acceptor dye moiety pair selected for fluorescence resonance energy
transfer (a FRET-pair). In such FRET embodiments, cleavage of the
substrate moiety allows the first and second dye moieties to move
apart, thereby relieving or eliminating the quenching of the donor
dye moiety's fluorescence by the acceptor dye moiety. One or more
of R, B, G and Y may further include a reactive group, a lipophilic
moiety, a hydrolase cleavable moiety or a targeting moiety.
[0098] In some embodiments, when the compound is contacted with a
.beta.-lactamase, the substrate moiety B undergoes an
enzyme-catalyzed reaction that severs a bond between the substrate
moiety and the dye moiety to generate a free amine, phenol
(phenolate) or thiophenol (thiophenolate) group on the first dye
moiety. Generation of the free amine, phenol (phenolate) or
thiophenol (thiophenolate) group on the first dye moiety induces a
detectable optical response. Detection of an optical response in a
sample that is contacted with a disclosed compound indicates
.beta.-lactamase activity (and the presence a .beta.-lactamase) in
the sample.
[0099] If G is present, the substrate moiety and the first dye
moiety remain bonded following the enzyme-catalyzed reaction. If G
is absent, the substrate moiety and the first dye moiety are no
longer bonded following the enzyme-catalyzed reaction. In
particular embodiments, the optically detectable response catalyzed
by a .beta.-lactamase includes a change in a fluorescence
characteristic of the first dye moiety (for example, a change in
the dye's fluourescence quantum yield and/or fluorescence
spectrum).
[0100] In other embodiments, cleavage of the substrate moiety does
not generate a free amine, phenol (phenolate) or thiophenol
(thiophenolate) group on the dye moiety, but nonetheless generates
a detectable response, such as a detectable optical response.
[0101] In some embodiments, the disclosed compounds have the
structure:
##STR00004##
where R.sub.1 is H.
##STR00005##
[0102] A is S, O, SO, SO.sub.2 or CH.sub.2; G is a first optional
linker that can be nothing (absent), a bond, or --CH.sub.2--; If A
and/or G is --CH.sub.2--, either or both of the hydrogens of the
methylene group can be replaced by an alkyl, heteroalkyl, aryl or
heteroaryl group; X is O, S or NH; L is a second optional linker
that can be present if G is absent from the structure; R.sup.2
through R.sup.8 are independently H, substituted or unsubstituted
alkyl or heteroalkyl, or substituted or unsubstituted aryl or
heteroaryl; R.sup.9 is
##STR00006##
in which W is substituted or unsubstituted alkyl or heteroalkyl,
substituted or unsubstituted aryl, substituted or unsubstituted
aryloxy, substituted or unsubstituted heteroaryl, or CN, and s is
an integer from 0 to 5; W' and W'' are independently H, substituted
or unsubstituted alkyl or heteroalkyl, substituted or unsubstituted
aryl or heteroaryl, (.dbd.O), (.dbd.NH), OR.sup.10, NHR.sup.11, or
halogen; R.sub.10 is H, substituted or unsubstituted alkyl or
heteroalkyl, or substituted or unsubstituted aryl or heteroaryl;
R.sup.11 is H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroalkyl, substituted or unsubstituted aryl or
heteroaryl or OR.sup.12; R.sup.12 is H, substituted or
unsubstituted alkyl, and substituted or unsubstituted heteroalkyl
or substituted or unsubstituted aryl or heteroaryl; and Y is a
first dye moiety. W, W' W'' may or may not be quenchers of
fluorescence emitted by the first dye moiety. In some embodiments,
at least one of W, W', and W'' includes a second dye moiety and
either the second dye moiety is a quencher of fluorescence of the
first dye moiety or the first dye moiety is a quencher of
fluorescence of the second dye moiety. In particular embodiments,
the compound is other than a cephalosporin having an R.sup.9 group
that is benzyl, 2-thienylmethyl or cyanomethyl.
[0103] In particular embodiments, R.sup.9 is:
##STR00007## ##STR00008##
##STR00009##
where the symbol n is an integer selected from 1 to 8. In other
particular embodiments, R.sup.9 is other than benzyl,
2-thienylmethyl or cyanomethyl.
[0104] In an exemplary embodiment, the disclosed compound is a
cephalosporin derivative (a cephalosporin) and has the formula:
##STR00010##
in which A is S, O, SO, SO.sub.2 or CH.sub.2. One of Y and R.sup.9
includes a dye moiety, and the other has the formula:
##STR00011##
in which W is substituted or unsubstituted alkyl, substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, substituted or unsubstituted
heteroaryl, or CN. The symbol s represents an integer selected from
0 to 5. The symbols W' and W'' are independently H, substituted or
unsubstituted alkyl, (.dbd.O), (.dbd.NH), OR.sup.10, NHR.sup.11, or
halogen. In this embodiment, W, W', and W'' are not quenchers of
the fluorescence emitted by the dye moiety, nor is the first dye
moiety a quencher of flurosecence emitted by W, W' or W'' if one or
more of these groups includes a fluorescent dye moiety. Thus, for
example, non-FRET pairs are possible in this embodiment. R.sub.10
is a member selected from H, substituted or unsubstituted alkyl,
and substituted or unsubstituted heteroalkyl. R.sup.11 is a member
selected from H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroalkyl, and OR.sup.12. R.sup.12 is a member
selected from H, substituted or unsubstituted alkyl, and
substituted or unsubstituted heteroalkyl. In some particular
embodiments, R.sup.9 is one of those groups specifically listed
above for R.sup.9, and in other particular embodiments, R.sup.9 is
other than benzyl, 2-thienylmethyl or cyanomethyl.
[0105] In some embodiments, Y is a dye moiety and R.sup.9 is
##STR00012##
in which W is substituted or unsubstituted alkyl, substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, substituted or unsubstituted
heteroaryl, or CN. The symbol s represents an integer selected from
0 to 5. W, W', and W'' are not quenchers of the fluorescence
emitted by the dye moiety, nor is the first dye moiety a quencher
of flurosecence emitted by W, W' or W'' if one or more of these
groups includes a fluorescent dye moiety. Thus, for example,
non-FRET pairs are possible in this embodiment. In yet another
exemplary embodiment, R.sup.9 is substituted or unsubstituted
benzyl, substituted or unsubstituted 5-membered heteroaryl, or CN.
In still another exemplary embodiment, A is a member selected from
S and SO. In another exemplary embodiment, W' is (.dbd.O) and W''
is (OH). In yet another embodiment, R.sup.9 is
##STR00013##
in which R.sup.10 and R.sup.11 are independently H, --OH,
--NH.sub.2, substituted or unsubstituted C.sub.1-C.sub.18 alkyl,
substituted or unsubstituted C.sub.1-C.sub.18 heteroalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 cycloalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 heterocycloalkyl,
substituted or unsubstituted C.sub.1-C.sub.18 aryl, or substituted
or unsubstituted C.sub.1-C.sub.18 heteroaryl. R.sup.9 also can be
any of the particular R.sup.9 groups recited above. In some
embodiments, R.sup.9 is other than benzyl, 2-thienylmethyl or
cyanomethyl. Particular structural embodiments of such compounds
are provided below:
##STR00014##
where R.sup.9 and each R.sup.a group is independently H,
substituted or unsubstituted akyl or heteroalkyl, or substituted or
unsubstituted aryl or heteroaryl.
[0106] In more particular embodiments, the compound is:
##STR00015## ##STR00016## ##STR00017## ##STR00018## ##STR00019##
##STR00020##
[0107] In some embodiments, one dye moiety is bonded to two
substrate moieties. The two substrate moieties that are bonded to
the single dye moiety can be the same or different. For example,
the two substrate moieties bonded to the single dye moiety can
independently be a cephalosporin, a clavulanate, an aceturate, a
malonamate, benzofuranone or benzopyranone as disclosed herein, or
a simple .beta.-lactam ring substrate moiety as disclosed in U.S.
Pat. No. 6,031,094. In some embodiments, at least one of the two
substrate moieties bonded to the single dye moiety is other than
cephalosporin substrate moieties. In other embodiments the two
substrate moieties are, for example, two clavulanates, two
aceturates, two malonamates, two benzofuranones, two
benzopyranones, a clavulanate and a cephalosporin, a clavulanate
and an aceturate, a clavulanate and a malonamate, a clavulanate and
a benzofuranone, a clavulanate and a benzopyranone, a clavulanate
and a simple .beta.-lactam ring substrate moiety, an aceturate and
a cephalosporin, an aceturate and a malonamate, an aceturate and a
benzofuranone, an aceturate and a benzopyranone, an aceturate and a
simple .beta.-lactam ring substrate moiety, a malonamate and a
cephalosporin, a malonamate and a benzofuranone, a malonamate and a
benzopyranone, a malonamate and a simple .beta.-lactam ring
substrate moiety, a benzofuranone and a cephalosporin, a
benzofuranone and a benzopyranone, a benzofuranone and a simple
.beta.-lactam ring substrate moiety, a benzopyranone and a
cephalosporin, or a benzopyranone and a simple .beta.-lactam ring
substrate moiety. A detectable optical change can occur upon
cleavage of either or both of the substrate moieties. For example,
one substrate moiety can be specifically cleaved by one
.beta.-lactamase and the other substrate moiety can be specifically
cleaved by another, different .beta.-lactamase. Thus, a first
detectable optical response can occur in the presence of one of the
.beta.-lactamases, a second detectable response can occur in the
presence of the other .beta.-lactamase, and a third detectable
optical response can occur in the presence of both
.beta.-lactamases. In particular embodiments, cleavage of two
substrate moiety bonded to a single dye moiety generates at least
one phenol (phenolate), thiophenol (thiophenolate) or amine groups
on the dye moiety. In a more particular embodiment, the compound
has the formula:
##STR00021##
[0108] In another exemplary embodiment, the compound is a
clavulanic acid derivative (a clavulanate) and has the formula:
##STR00022##
in which Y is a first dye moiety. L is an optional linker moiety
(for example, --OC(O)--, --OC(S)--, --SC(O)--, or --SC(S)--). A is
S, O, SO, SO.sub.2, or CH.sub.2. X is O, S or NH. W' and W'' are
independently H, substituted or unsubstituted alkyl (.dbd.O),
(.dbd.NH), OR.sup.13, NHR.sup.14, or halogen. In this embodiment,
W' and W'' may or may not be quenchers of the fluorescence emitted
by the first dye moiety. If at least one of W' and W'' includes a
second dye moiety, the first dye moiety may or may not be a
quencher of fluorescence of the second dye moiety and vice versa.
R.sup.13 is a member selected from H, substituted or unsubstituted
alkyl and substituted or unsubstituted heteroalkyl. R.sup.14 is a
member selected from H, substituted or unsubstituted alkyl
substituted or unsubstituted heteroalkyl, and OR.sup.15. R.sup.15
is a member selected from H, substituted or unsubstituted alkyl and
substituted or unsubstituted heteroalkyl. In a particular
embodiment, X and A are O. In another particular embodiment, W' is
(.dbd.O) and W'' is (OH). In other particular embodiments, the
compound is:
##STR00023##
where each R' group is independently H, substituted or
unsubstituted alkyl substituted or unsubstituted heteroaklyl,
substituted or unsubstituted aryl, or substituted or unsubstituted
heteroaryl. The dye moiety can be further substituted as described
below.
[0109] In another exemplary embodiment, the compound is an
aceturate derivative (an aceturate), a malonamate derivative (a
malonamate), a benzofuranone derivative (a benzofuranone) or a
benzopyranone derivative (a benzopyranone) and has the formula:
##STR00024##
where R.sup.1 is,
##STR00025##
X is O, S or NH, Y is a first dye moiety, G is a first optional
linker moiety that can be absent, a bond or --CH.sub.2--. If G is a
bond or --CH.sub.2--, it is attached to a different atom on Y than
where Y is bonded to the remainder of the molecule. R.sup.2,
R.sup.8 and R.sup.9 are independently H, substituted or
unsubstituted alkyl, substituted or unsubstituted heteroaklyl,
substituted or unsubstituted aryl, substituted or unsubstituted
aryloxy, or substituted or unsubstituted heteroaryl. One or more of
R.sup.2, R.sup.8 and R.sup.9 can include a second dye moiety. If G
is absent, the first and second dye moieties can comprise a
FRET-pair. Also, if G is absent, a second optional linker L [for
example, --OC(O)--, --OC(S)--, --SC(O)--, or --SC(S)--] can be
present between dye moiety Y and the remainder of the molecule.
[0110] In some embodiments, the compound is a malonamate derivative
(a malonamate) with the structure:
##STR00026##
where Y is a first dye moiety. L is an optional linker moiety [for
example, --OC(O)--, --OC(S)--, --SC(O)--, or --SC(S)--]. R.sup.9 is
H, substituted or unsubstituted alkyl, substituted or unsubstituted
heteroaklyl, substituted or unsubstituted aryl, substituted or
unsubstituted aryloxy, or substituted or unsubstituted heteroaryl,
and can be any of the specific or sub-generic R.sup.9 groups
described above. R.sup.a is H, substituted or unsubstituted alkyl,
substituted or unsubstituted heteroaklyl, substituted or
unsubstituted aryl, substituted or unsubstituted aryloxy, or
substituted or unsubstituted heteroaryl. In some particular
embodiments, at least one of R.sup.9 and R.sup.a includes a second
dye moiety, and in more particular embodiments the first and second
dye moieties can be a FRET-pair. In other particular embodiments,
the compound has the structure:
##STR00027##
where R.sup.9 is H, substituted or unsubstituted alkyl, substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. In some particular embodiments, at least
one of R.sup.9 and R.sup.a includes a second dye moiety, and in
more particular embodiments the first and second dye moieties can
be a FRET-pair. The first and/or second dye moieties can be further
substituted as described below.
[0111] In a more particular embodiment, the compound has a coumarin
dye moiety, the compound having the formula:
##STR00028##
where the coumarin dye moiety may be further substituted as
described below.
[0112] In other exemplary embodiments, the compound is an aceturate
derivative (an aceturate) with the structure:
##STR00029##
where Y is a first dye moiety. L is an optional linker moiety [for
example, --OC(O)--, --OC(S)--, --SC(O)--, or --SC(S)--]. R.sup.9 is
H, substituted or unsubstituted alkyl, substituted or unsubstituted
heteroaklyl, substituted or unsubstituted aryl, substituted or
unsubstituted aryloxy, or substituted or unsubstituted heteroaryl,
and can be any of the specific or sub-generic R.sup.9 groups
described above. R.sup.a is H, substituted or unsubstituted alkyl
substituted or unsubstituted heteroaklyl, substituted or
unsubstituted aryl, substituted or unsubstituted aryloxy, or
substituted or unsubstituted heteroaryl. In some particular
embodiments, at least one of R.sup.9 and R.sup.a includes a second
dye moiety, and in more particular embodiments the first and second
dye moieties can be a FRET-pair.
[0113] In particular embodiments, the compound has the formula:
##STR00030##
where R.sup.9 is H, substituted or unsubstituted alkyl substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. In some particular embodiments, at least
one of R.sup.9 and R.sup.a is a second dye moiety, and in more
particular embodiments the first and second dye moieties can be a
FRET-pair. The first and/or second dye moieties can be further
substituted as described below.
[0114] In a more particular embodiment the compound has the
structure:
##STR00031##
where the dye moiety can be further substituted as described
below.
[0115] In another exemplary embodiment, the compound is a
benzofuranone (G=a bond) derivative (a benzofuranone) and has the
structure:
##STR00032##
where R.sup.9 is H, substituted or unsubstituted alkyl, substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl, substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl; and Y' and Y'' are connections to an aryl
or heteroaryl ring of the remainder of the dye moiety, which is
fused to the five-membered ring shown. For example, in particular
embodiments, the compound has the structure:
##STR00033##
where R.sup.9 is H, substituted or unsubstituted alkyl substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. The dye moiety can be further substituted
as described below.
[0116] In other particular embodiments, the compound has the
structure:
##STR00034##
where R.sup.9 is H, substituted or unsubstituted alkyl substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. The dye moiety can be further substituted
as described below.
[0117] In more particular embodiments, the compound has the
structure:
##STR00035##
where the dye moiety can be further substituted as described
below.
[0118] In yet another exemplary embodiment, the compound is a
benzopyranone (G=--CH2-) derivative (a benzopyranone) and has the
structure:
##STR00036##
where R.sup.9 is H, substituted or unsubstituted alkyl, substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a, R.sup.b and
R.sup.c are independently H, substituted or unsubstituted alkyl,
substituted or unsubstituted heteroaklyl, substituted or
unsubstituted aryl, substituted or unsubstituted aryloxy, or
substituted or unsubstituted heteroaryl; and Y' and Y'' are
connections to an aryl or heteroaryl ring of the remainder of the
dye moiety which is fused to the six-membered ring shown. For
example, in particular embodiments, the compound has the
structure:
##STR00037##
where R.sup.9 is H, substituted or unsubstituted alkyl, substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. The dye moiety can be further substituted
as described below.
[0119] In other particular embodiments, the compound has the
structure:
##STR00038##
where R.sup.9 is H, substituted or unsubstituted alkyl substituted
or unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl, and can be any of the specific or
sub-generic R.sup.9 groups described above. R.sup.a and R.sup.b are
independently H, substituted or unsubstituted alkyl substituted or
unsubstituted heteroaklyl, substituted or unsubstituted aryl,
substituted or unsubstituted aryloxy, or substituted or
unsubstituted heteroaryl. The dye moiety can be further substituted
as described below.
[0120] In more particular embodiments, the compound has the
structure:
##STR00039##
where the dye moiety can be further substituted as described
below.
[0121] Reporter Molecule Moiety
[0122] In an exemplary embodiment, the present compounds confer a
detectable signal, directly or indirectly, to the sample comprising
a .beta.-lactamase enzyme, wherein they are covalently bonded to a
reporter molecule. This results in the ability to detect, monitor
and quantitate .beta.-lactmase enzyme in a sample.
[0123] The present reporter molecules can be any reporter molecule
known to one skilled in the art and when the reporter molecule is
either covalently linked to a metal-chelating moiety or comprises
part of the metal-chelating moiety wherein no linker is present,
forms a metal ion binding compound of the present invention that is
useful for the detection of lead, mercury and/or cadmium ions.
Reporter molecules include, without limitation, a dye, (chromophore
or fluorophore), a fluorescent protein, a phosphorescent dye, a
tandem dye (energy transfer pair), a microparticle, a hapten, an
enzyme and a radioisotope. Preferred reporter molecules include
dyes (both chromophores and fluorophores), fluorescent proteins,
haptens, and enzymes. When the reporter molecule is a chromophore
the .beta.-lactamase substrates compounds are chromogenic
substrates, or more preferably, the reporter molecule is a
fluorophore, resulting in a compound that is a fluorescent or
fluorogenic indicator for .beta.-lactamase activity.
[0124] Where the detectable response is a fluorescence response, it
is typically a change in fluorescence, such as a change in the
intensity, excitation or emission wavelength, distribution of
fluorescence, fluorescence lifetime, fluorescence polarization, or
a combination thereof. Preferably, the detectable optical response
upon cleavage by a .beta.-lactamase enzyme is a change in
fluorescence intensity that is greater than approximately 10-fold
relative to the same compound in the absence of the enzyme, more
preferably greater than 50-fold, and most preferably more that
100-fold. In another aspect, the detectable optical response upon
cleavage by a .beta.-lactamase enzyme is a shift in either the
maximal excitation or emission wavelength or both that is greater
than about 20 nm, more preferably greater than about 30 nm.
[0125] A dye of the present invention is any chemical moiety that
exhibits an absorption maximum beyond 280 nm, and when covalently
linked to the .beta.-lactamase substrate of the present invention,
or shares atoms with the .beta.-lactamase substrate, forms a
fluorescent or fluorogenic .beta.-lactamase substrate. As described
below in more detail, the covalent linkage can be a single covalent
bond or a combination of stable chemical bonds. The covalent
linkage binding the dye to the .beta.-lacamase substrate moiety is
typically a single covalent bond or a substituted alkyl chain that
incorporates 1-20 nonhydrogen atoms selected from the group
consisting of C, N, O, S and P.
[0126] A variety of dye moieties and combinations of dye moieties
can be effectively coupled, such as covalently bonded, to the
.beta.-lactamase substrate moiety in order to provide a substrate
that is capable of reacting with a .beta.-lactamase to provide a
detectable response, such as a detectable optical response, upon
reaction with a .beta.-lactamase. Dye moieties include
luminophores, chromophores, fluorophores and moieties that react
with a second compound to generate a luminophore, chromphore or
fluorophore. In some embodiments, FRET-pairs of dyes are added to
the disclosed compounds. In other embodiments, the dye moiety is
joined to a substrate moiety through an amine, hydroxyl or thiol
group on an aryl ring or heteroaryl ring of the dye moiety, so that
when the substrate moiety is cleaved by a .beta.-lactamase, a
phenol (phenolate), thiophenol (thiophenolate) or amine group is
generated on the dye moiety.
[0127] Exemplary dye moieties include, for example, a pyrene, an
anthracene, a naphthalene, an acridine, a stilbene, an indole or
benzindole, an oxazole or benzoxazole, a thiazole, a benzothiazole,
a 4-amino-7-nitrobenz-2-oxa-1,3-diazole (NBD), a cyanine (including
such compounds disclosed in U.S. patent application Ser. Nos.
09/968,401 and 09/969,853, and U.S. Pat. Nos. 6,403,807 and
6,348,599, all of which are incorporated by reference herein), a
carbocyanine (including such compounds disclosed in U.S. patent
application Ser. No. 09/557,275, and in U.S. Pat. Nos. 5,486,616;
5,268,486; 5,569,587; 5,569,766; 5,627,027 and 6,048,982; all of
which are incorporated by reference herein), a carbostyryl, a
porphyrin, a salicylate, an anthranilate, an azulene, a perylene, a
pyridine, a quinoline, a quinone, a borapolyazaindacene (including
such compounds disclosed in U.S. Pat. Nos. 4,774,339; 5,187,288;
5,248,782; 5,274,113 and 5,433,896, all of which are incorporated
by reference herein), a xanthene (including any such compounds
disclosed in U.S. Pat. Nos. 6,162,931; 6,130,101; 6,229,055;
6,339,392; 5,451,343 6,221,606; 6,358,684; 6,008,379; 6,111,116;
6,184,379; 6,017,712; 6,080,852; and 5,847,162 and U.S. patent
application Ser. No. 09/922,333; all of which are incorporated by
reference herein) an oxazine or a benzoxazine, a carbazine
(including any such compounds disclosed in U.S. Pat. No. 4,810,636,
which is incorporated by reference herein), a phenalenone, a
coumarin (including an such compounds disclosed in U.S. Pat. Nos.
5,696,157; 5,459,276; 5,501,980 and 5,830,912; all of which are
incorporated by reference herein), a benzofuran (including any such
compounds disclosed in U.S. Pat. Nos. 4,603,209 and 4,849,362; both
of which are incorporated by reference herein) and benzphenalenone
(including any such compounds disclosed in U.S. Pat. No. 4,812,409)
and derivatives thereof. As used herein, oxazines include
resorufins (including any such compounds disclosed in U.S. Pat. No.
5,242,805, which is incorporated by reference herein),
aminooxazinones, diaminooxazines, and their benzo-substituted
analogs. Any such dyes are optionally substituted at one or more
positions (such as at a position occupied by a hydrogen in a parent
ring structure that is characteristic of the class of dyes) with a
variety of substituents, including without limitation, halogen,
nitro, cyano, alkyl, perfluoroalkyl, alkoxy, alkenyl, alkynyl,
cycloalkyl, arylalkyl, acyl, aryl or heteroaryl ring system, benzo,
or other substituents typically present on dyes known in the art.
In particular embodiments, the dyes are substituted at one or more
positions with fluorine, chlorine, alkoxy (such as methoxy or
ethoxy), carboxy (such as ester or amide groups), alkyl, aryl, or
heteroaryl. In more particular embodiments, the dyes are
substituted at one or more positions with fluorine, chlorine or
alkoxy.
[0128] Where the dye is a xanthene, the dye is optionally a
fluorescein, a rhodol (including any such compounds disclosed in
U.S. Pat. Nos. 5,227,487 and 5,442,045, which are both incorporated
by reference herein), a rhodamine (including any such compounds in
U.S. Pat. Nos. 5,798,276 and 5,846,737, which are both incorporated
by reference herein). As used herein, rhodamine and rhodol dyes
include, among other derivatives, compounds that comprise xanthenes
with saturated or unsaturated "julolidine" rings. As used herein,
fluorescein includes benzo- or dibenzofluoresceins,
seminaphthofluoresceins, and naphthofluoresceins. Similarly, as
used herein, rhodol includes seminaphthorhodafluors (including any
such compounds disclosed in U.S. Pat. No. 4,945,171, which is
incorporated by reference herein).
[0129] In certain embodiments, the dye moiety is a benzofuran, a
quinoline, a quinazolinone, a xanthene, an indole, a benzazole or a
borapolyazaindacene. Particular xanthenes include
julolidine-containing xanthenes, as well as fluoresceins, rhodols,
rhodamines and rosamines. Xanthenes also include compounds that are
substituted or unsubstituted on the carbon atom of the central ring
of the xanthene, for example, with substituents typically found in
such xanthene-based dyes such as phenyl and substituted-phenyl
moieties.
[0130] In one aspect, the dye can have an absorption maximum at
wavelengths longer than 480 nm. In a particularly useful
embodiment, the dye moiety absorbs at or near 488 nm to 514 nm
(particularly suitable for excitation by the output of the
argon-ion laser excitation source) or near 546 nm (particularly
suitable for excitation by a mercury arc lamp). As is the case for
many dyes, such dyes can function as both chromophores and
fluorophores that may be detected in both colorimetric and
fluorescent assays.
[0131] Additional examples of suitable dyes are known (see, for
example MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND
RESEARCH CHEMICALS, Ninth Ed., Richard P. Haugland, ed. (2002), in
particular Chapters 1-3; BIOPROBES 26 (October 1997); BIOPROBES 27
(February 1998); BIOPROBES 28 (May 1998); BIOPROBES 29 (November
1998); and BIOPROBES 30 (January 1999). The spectral properties of
dye moieties in solution or when conjugated to a selected substrate
moiety are known or are readily measured using a
spectrofluorometer. Still further examples of suitable dye moieties
include those disclosed in U.S. Pat. No. 5,955,604 and in U.S.
Patent Application Publication No. 2003/0003526A1, both of which
are incorporated by reference herein. Dyes disclosed in U.S. Pat.
No. 5,955,604 include coumarins and related dyes, xanthene dyes
(including fluoresceins, rhodols, and rhodamines), resorufins,
cyanine dyes, difluroboradiazaindacene dyes, bimanes, acridines,
isoindoles, dansyl dyes, aminophthalic hydrazides (luminal and
isoluminol derivatives), aminophthalimides, aminonaphthalimides,
aminobenzofurans, aminoquinolines, dicyanohdroquinones, indigo
dyes, anthraquinone dyes, polymethine dyes, nitro dyes and their
cyano derivatives, quinione dyes, dicyanovinyl and tricyanovinyl
dyes, indoaniline dyes (ninhydrin derivatives), di- and
tri-phenylmethane dyes, indamines, lanthanide metal chelates and
porphyrins.
[0132] In an exemplary embodiment, the dye moiety is a substituted
or unsubstituted coumarin, a substituted or unsubstituted
borapolyazaindacene, a substituted or unsubstituted cyanine, a
substituted or unsubstituted styryl, a substituted or unsubstituted
4-[5-(4-dimethylaminophenyl)-2-oxazolyl]phenyl, a substituted or
unsubstituted fluorescein, a substituted or unsubstituted
rhodamine, a substituted or unsubstituted rhodol, a substituted or
unsubstituted oxazine, a substituted or unsubstituted acridinone, a
substituted or unsubstituted napthofluorescein, or a substituted or
unsubstituted oxoquinazoline.
[0133] In some embodiments the dye moiety has the structure:
##STR00040##
where T is O, S, CR.sup.s.sub.2 [such as C(CH.sub.3).sub.2], or
NR.sup.p; V is N or CR.sup.s; Z is O, S or N.sup.+R.sup.pR.sup.q;
a, b, c, d, e, f, g, and h are independently, a bond, H, --O--,
--NR.sup.p--, --OH, --OR.sup.t, --NR.sup.pR.sup.q, --F, --Cl, --Br,
--I, --OOCR.sup.s, --CO.sub.2R.sup.s, -L-O--, -L-NR.sup.p--,
-L-S--; R.sup.p, R.sup.q are independently H, substitituted or
unsubstituted alkyl or heteroalkyl, substituted or unsubstituted
aryl or heteroaryl, or substituted or unsubstituted acyl; R.sup.s,
R.sup.t are independently H, substitituted or unsubstituted alkyl
or heteroalkyl, or substituted or unsubstituted aryl or heteroaryl;
and L is a linker.
[0134] In particular embodiments, the dye moiety is:
##STR00041## ##STR00042##
V is N or CR.sup.s. R.sup.s, R.sup.v and R.sup.w are independently
H, substituted or unsubstituted alkyl or heteroalkyl, substituted
or unsubstituted aryl or heteroaryl, or substituted or
unsubstituted acyl. R.sup.x is one or more of H, substituted or
unsubstituted alkyl or heteroalkyl, substituted or unsubstituted
aryl or heteroaryl, or substituted or unsubstituted acyl, or
halogen. R.sup.y is H, halogen, --SO.sub.3H, or --SO.sub.3--.
R.sup.z is H, a metal ion (such as a physiologically acceptable
metal ion, for example, Na.sup.+ or K.sup.+), substituted or
unsubstituted alkyl or heteroalkyl, or substituted or unsubstituted
aryl or heteroaryl. In more particular embodiments, R.sup.x is H,
halogen (F, Cl, Br or I), alkoxy (such as methoxy or ethoxy), or
--C(O)OR.sup.z.
[0135] In other particular embodiments, the dye moiety is:
##STR00043##
where at least one of R.sup.w or R.sup.x is an attachment point of
the dye moiety to a substrate moiety or an attachment to a linker
between the dye moiety and a substrate moiety. If other than an
attachment point, R.sup.w is H, substituted or unsubstituted alkyl
or heteroalkyl, substituted or unsubstituted aryl or heteroaryl, or
substituted or unsubstituted acyl. If other than an attachment
point, R.sup.x is one or more of H, substituted or unsubstituted
alkyl or heteroalkyl, substituted or unsubstituted aryl or
heteroaryl, or substituted or unsubstituted acyl, or halogen.
R.sup.v is H, substituted or unsubstituted alkyl or heteroalkyl,
substituted or unsubstituted aryl or heteroaryl, or substituted or
unsubstituted acyl. In more particular embodiments, R.sup.x is H,
halogen (F, Cl, Br or I), alkoxy (such as methoxy or ethoxy), or
--C(O)OR.sup.z, where R.sup.z is H, a metal ion (such as a
physiologically acceptable metal ion, for example, Na.sup.+ or
K.sup.+), or substituted or unsubstituted alkyl or heteroalkyl,
substituted or unsubstituted aryl or heteroaryl.
[0136] In other embodiments, the dye moiety is a substituted or
unsubstituted fluorescein, a substituted or unsubstituted
oxoquinazoline, a substituted or unsubstituted
difluoromethylcoumarin, and substituted or unsubstituted
acridinone. In particular embodiments, the dye moiety is:
##STR00044## ##STR00045## ##STR00046##
[0137] In another exemplary embodiment, the dye moiety further
comprises a member selected from a lipophilic moiety, chloromethyl,
pentafluorobenzyl, and a targeting moiety. In yet another exemplary
embodiment, the dye moiety is a member selected from substituted or
unsubstituted aminofluorescein, substituted or unsubstituted
aminorhodamine, and substituted or unsubstituted aminorhodol. In
still another exemplary embodiment, the dye moiety is
##STR00047##
[0138] Fluorescent proteins also find use as labels for the
.beta.-lactamase substrates of the present invention. Examples of
fluorescent proteins include green fluorescent protein (GFP) and
the phycobiliproteins and the derivatives thereof. The fluorescent
proteins, especially phycobiliproteins, are particularly useful for
creating tandem dye-reporter molecules. These tandem dyes comprise
a fluorescent protein and a fluorophore for the purposes of
obtaining a larger Stokes shift, wherein the emission spectra are
farther shifted from the wavelength of the fluorescent protein's
absorption spectra. This property is particularly advantageous for
detecting a low quantity of a target heavy metal ion in a sample
wherein the emitted fluorescent light is maximally optimized; in
other words, little to none of the emitted light is reabsorbed by
the fluorescent protein. For this to work, the fluorescent protein
and fluorophore function as an energy transfer pair wherein the
fluorescent protein emits at the wavelength that the acceptor
fluorophore absorbs and the fluorophore then emits at a wavelength
farther from the fluorescent proteins than could have been obtained
with only the fluorescent protein. Alternatively, the fluorophore
functions as the energy donor and the fluorescent protein is the
energy acceptor. Particularly useful fluorescent proteins are the
phycobiliproteins disclosed in U.S. Pat. Nos. 4,520,110; 4,859,582;
5,055,556 and the fluorophore bilin protein combinations disclosed
in U.S. Pat. No. 4,542,104. Alternatively, two or more fluorophore
dyes can function as an energy transfer pair wherein one
fluorophore is a donor dye and the other is the acceptor dye
including any dye compounds disclosed in U.S. Pat. Nos. 6,358,684;
5,863,727; 6,372,445; 6,221,606; 6,008,379; 5,945,526; 5,863,727;
5,800,996; 6,335,440; 6,008,373; 6,184,379; 6,140,494 and
5,656,554.
[0139] Reactive Groups, Carrier Molecules and Solid Supports
[0140] The present compounds, in certain embodiments, are
chemically reactive wherein the compounds comprise a reactive
group. In a further embodiment, the compounds comprise a carrier
molecule or solid support. These substituents, reactive groups,
carrier molecules, solid supports and Reporter molecule (as
described above), comprise a linker that is used to covalently
attach the substituents to any of the moieties of the present
compounds. The solid support, carrier molecule or reactive group
may be directly attached (where linker is a single bond) to the
moieties or attached through a series of stable bonds, as disclosed
above.
[0141] Any combination of linkers may be used to attach the carrier
molecule, solid support or reactive group and the present compounds
together. This description of the linker also applies to the
reporter molecules, as disclosed above. The linker may also be
substituted to alter the physical properties of the reporter moiety
or chelating moiety, such as spectral properties of the dye.
Examples of L include substituted or unsubstituted polyalkylene,
arylene, alkylarylene, arylenealkyl, or arylthio moieties.
[0142] The linker typically incorporates 1-30 nonhydrogen atoms
selected from the group consisting of C, N, O, S and P. The linker
may be any combination of stable chemical bonds, optionally
including, single, double, triple or aromatic carbon-carbon bonds,
as well as carbon-nitrogen bonds, nitrogen-nitrogen bonds,
carbon-oxygen bonds, sulfur-sulfur bonds, carbon-sulfur bonds,
phosphorus-oxygen bonds, phosphorus-nitrogen bonds, and
nitrogen-platinum bonds. Typically the linker incorporates less
than 15 nonhydrogen atoms and are composed of any combination of
ether, thioether, thiourea, amine, ester, carboxamide, sulfonamide,
hydrazide bonds and aromatic or heteroaromatic bonds. Typically the
linker is a combination of single carbon-carbon bonds and
carboxamide, sulfonamide or thioether bonds. The bonds of the
linker typically result in the following moieties that can be found
in the linker: ether, thioether, carboxamide, thiourea,
sulfonamide, urea, urethane, hydrazine, alkyl, aryl, heteroaryl,
alkoxy, cycloalkyl and amine moieties. Examples of a linker include
substituted or unsubstituted polymethylene, arylene, alkylarylene,
arylenealkyl, and arylthio.
[0143] In one embodiment, the linker contains 1-6 carbon atoms; in
another, the linker comprises a thioether linkage. Exemplary
linking members include a moiety that includes --C(O)NH--,
--C(O)O--, --NH--, --S--, --O--, and the like. In another
embodiment, the linker is or incorporates the formula
--(CH.sub.2).sub.d(CONH(CH.sub.2).sub.e).sub.z-- or where d is an
integer from 0-5, e is an integer from 1-5 and z is 0 or 1. In a
further embodiment, the linker is or incorporates the formula
--O--(CH.sub.2)--. In yet another embodiment, the linker is or
incorporates a phenylene or a 2-carboxy-substituted phenylene.
[0144] In another exemplary embodiment of the invention, the
present compounds are chemically reactive, and are substituted by
at least one reactive group. The reactive group functions as the
site of attachment for another moiety, such as a carrier molecule
or a solid support, wherein the reactive group chemically reacts
with an appropriate reactive or functional group on the carrier
molecule or solid support. Thus, in another aspect the compounds
comprise a dye moiety, a substrate moiety, and a reactive group
moiety.
[0145] The reactive group can, for example, be bound to the
compounds at R.sup.9, W, W', W'', A, or Y. In another exemplary
embodiment, the reactive group can be bound to the compounds at
R.sup.9 or Y. In another exemplary embodiment, the reactive group
can be bound to the compounds at R.sup.9. In yet another exemplary
embodiment, the reactive group can be bound to the compounds at A,
W', W'', or Y. In another exemplary embodiment, the reactive group
can be bound to the compounds at W' or W''. In another exemplary
embodiment, the reactive group can be bound to the compounds at Y.
In another exemplary embodiment, the reactive group can be bound to
the compounds at A.
[0146] In an exemplary embodiment, the compounds further comprise a
reactive group that is acrylamide, an activated ester of a
carboxylic acid, an acyl azide, an acyl nitrile, an aldehyde, an
alkyl halide, an anhydride, an aniline, an aryl halide, an azide,
an aziridine, a boronate, a carboxylic acid, a diazoalkane, a
haloacetamide, a halotriazine, a hydrazine, a hydrazide, an imido
ester, an isocyanate, an isothiocyanate, a maleimide, a
phosphoramidite, a reactive platinum complex, a sulfonyl halide, a
thiol group, or a photoactivatable group.
[0147] The pro-reactive groups are synthesized during the formation
of the monomer moieties and carrier molecule and solid support
containing compounds to provide chemically reactive compounds. In
this way, compounds incorporating a reactive group can be
covalently attached to a wide variety of carrier molecules or solid
supports that contain or are modified to contain functional groups
with suitable reactivity, resulting in chemical attachment of the
components. In an exemplary embodiment, the reactive group of the
compounds of the invention and the functional group of the carrier
molecule or solid support comprise electrophiles and nucleophiles
that can generate a covalent linkage between them. Alternatively,
the reactive group comprises a photoactivatable group, which
becomes chemically reactive only after illumination with light of
an appropriate wavelength. Typically, the conjugation reaction
between the reactive group and the carrier molecule or solid
support results in one or more atoms of the reactive group being
incorporated into a new linkage attaching the present compound of
the invention to the carrier molecule or solid support. Selected
examples of functional groups and linkages are shown in Table 1,
where the reaction of an electrophilic group and a nucleophilic
group yields a covalent linkage.
TABLE-US-00001 TABLE 1 Examples of some routes to useful covalent
linkages Electrophilic Group Nucleophilic Group Resulting Covalent
Linkage activated esters* amines/anilines carboxamides acrylamides
thiols thioethers acyl azides** amines/anilines carboxamides acyl
halides amines/anilines carboxamides acyl halides alcohols/phenols
esters acyl nitriles alcohols/phenols esters acyl nitriles
amines/anilines carboxamides aldehydes amines/anilines imines
aldehydes or ketones hydrazines hydrazones aldehydes or ketones
hydroxylamines oximes alkyl halides amines/anilines alkyl amines
alkyl halides carboxylic acids esters alkyl halides thiols
thioethers alkyl halides alcohols/phenols ethers alkyl sulfonates
thiols thioethers alkyl sulfonates carboxylic acids esters alkyl
sulfonates alcohols/phenols ethers anhydrides alcohols/phenols
esters anhydrides amines/anilines carboxamides aryl halides thiols
thiophenols aryl halides amines aryl amines aziridines thiols
thioethers boronates glycols boronate esters carbodiimides
carboxylic acids N-acylureas or anhydrides diazoalkanes carboxylic
acids esters epoxides thiols thioethers haloacetamides thiols
thioethers haloplatinate amino platinum complex haloplatinate
heterocycle platinum complex haloplatinate thiol platinum complex
halotriazines amines/anilines aminotriazines halotriazines
alcohols/phenols triazinyl ethers halotriazines thiols triazinyl
thioethers imido esters amines/anilines amidines isocyanates
amines/anilines ureas isocyanates alcohols/phenols urethanes
isothiocyanates amines/anilines thioureas maleimides thiols
thioethers phosphoramidites alcohols phosphite esters silyl halides
alcohols silyl ethers sulfonate esters amines/anilines alkyl amines
sulfonate esters thiols thioethers sulfonate esters carboxylic
acids esters sulfonate esters alcohols ethers sulfonyl halides
amines/anilines sulfonamides sulfonyl halides phenols/alcohols
sulfonate esters *Activated esters, as understood in the art,
generally have the formula --CO.OMEGA., where .OMEGA. is a good
leaving group (e.g. succinimidyloxy (--OCH.sub.4C.sub.4O.sub.2)
sulfosuccinimidyloxy (--OC.sub.4H.sub.3O.sub.2--SO.sub.3H),
-1-oxybenzotriazolyl (--OC.sub.6H.sub.4N.sub.3); or an aryloxy
group or aryloxy substituted one or more times by electron
withdrawing substituents such as nitro, fluoro, chloro, cyano or
trifluoromethyl, or combinations thereof, used to form activated
aryl esters; or a carboxylic acid activated by a carbodiimide to
form an anhydride or mixed anhydride --OCOR.sup.a or
--OCNR.sup.aNHR.sup.b, where R.sup.a and R.sup.b, which may be the
same or different, are C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6
perfluoroalkyl, or C.sub.1-C.sub.6 alkoxy; or cyclohexyl,
3-dimethylaminopropyl, or N-morpholineoethyl). **Acyl azides can
also rearrange to isocyanates
[0148] Choice of the reactive group used to attach the compound of
the invention to the substance to be conjugated typically depends
on the reactive or functional group on the substance to be
conjugated and the type or length of covalent linkage desired. The
types of functional groups typically present on the organic or
inorganic substances (biomolecule or non-biomolecule) include, but
are not limited to, amines, amides, thiols, alcohols, phenols,
aldehydes, ketones, phosphates, imidazoles, hydrazines,
hydroxylamines, disubstituted amines, halides, epoxides, silyl
halides, carboxylate esters, sulfonate esters, purines,
pyrimidines, carboxylic acids, olefinic bonds, or a combination of
these groups. A single type of reactive site may be available on
the substance (typical for polysaccharides or silica), or a variety
of sites may occur (e.g., amines, thiols, alcohols, phenols), as is
typical for proteins.
[0149] Typically, the reactive group will react with an amine, a
thiol, an alcohol, an aldehyde, a ketone, or with silica.
Preferably, reactive groups react with an amine or a thiol
functional group, or with silica. In one embodiment, the reactive
group is an acrylamide, an activated ester of a carboxylic acid, an
acyl azide, an acyl nitrile, an aldehyde, an alkyl halide, a silyl
halide, an anhydride, an aniline, an aryl halide, an azide, an
aziridine, a boronate, a diazoalkane, a haloacetamide, a
halotriazine, a hydrazine (including hydrazides), an imido ester,
an isocyanate, an isothiocyanate, a maleimide, a phosphoramidite, a
reactive platinum complex, a sulfonyl halide, or a thiol group. By
"reactive platinum complex" is particularly meant chemically
reactive platinum complexes such as described in U.S. Pat. No.
5,714,327.
[0150] Where the reactive group is an activated ester of a
carboxylic acid, such as a succinimidyl ester of a carboxylic acid,
a sulfonyl halide, a tetrafluorophenyl ester or an isothiocyanates,
the resulting compound is particularly useful for preparing
conjugates of carrier molecules such as proteins, nucleotides,
oligonucleotides, or haptens. Where the reactive group is a
maleimide, haloalkyl or haloacetamide (including any reactive
groups disclosed in U.S. Pat. Nos. 5,362,628; 5,352,803 and
5,573,904 (supra)) the resulting compound is particularly useful
for conjugation to thiol-containing substances. Where the reactive
group is a hydrazide, the resulting compound is particularly useful
for conjugation to periodate-oxidized carbohydrates and
glycoproteins, and in addition is an aldehyde-fixable polar tracer
for cell microinjection. Where the reactive group is a silyl
halide, the resulting compound is particularly useful for
conjugation to silica surfaces, particularly where the silica
surface is incorporated into a fiber optic probe subsequently used
for remote ion detection or quantitation.
[0151] In a particular aspect, the reactive group is a
photoactivatable group such that the group is only converted to a
reactive species after illumination with an appropriate wavelength.
An appropriate wavelength is generally a UV wavelength that is less
than 400 nm. This method provides for specific attachment to only
the target molecules, either in solution or immobilized on a solid
or semi-solid matrix. Photoactivatable reactive groups include,
without limitation, benzophenones, aryl azides and diazirines.
[0152] Preferably, the reactive group is a photoactivatable group,
succinimidyl ester of a carboxylic acid, a haloacetamide,
haloalkyl, a hydrazine, an isothiocyanate, a maleimide group, an
aliphatic amine, a silyl halide, a cadaverine or a psoralen. More
preferably, the reactive group is a succinimidyl ester of a
carboxylic acid, a maleimide, an iodoacetamide, or a silyl halide.
In a particular embodiment the reactive group is a succinimidyl
ester of a carboxylic acid, a sulfonyl halide, a tetrafluorophenyl
ester, an iosothiocyanates or a maleimide.
[0153] The selection of a covalent linkage to attach the reporter
molecule to the carrier molecule or solid support typically depends
on the chemically reactive group on the component to be conjugated.
The discussion regarding reactive groups in the section immediately
preceding is relevant here as well. Exemplary reactive groups
typically present on the biological or non-biological components
include, but are not limited to, amines, thiols, alcohols, phenols,
aldehydes, ketones, phosphates, imidazoles, hydrazines,
hydroxylamines, disubstituted amines, halides, epoxides, sulfonate
esters, purines, pyrimidines, carboxylic acids, or a combination of
these groups. A single type of reactive site may be available on
the component (typical for polysaccharides), or a variety of sites
may occur (e.g. amines, thiols, alcohols, phenols), as is typical
for proteins. A carrier molecule or solid support may be conjugated
to more than one reporter molecule, which may be the same or
different, or to a substance that is additionally modified by a
hapten. Although some selectivity can be obtained by careful
control of the reaction conditions, selectivity of labeling is best
obtained by selection of an appropriate reactive compound.
[0154] In another exemplary embodiment, the present compound is
covalently bound to a carrier molecule. If the compound has a
reactive group, then the carrier molecule can alternatively be
linked to the compound through the reactive group. The reactive
group may contain both a reactive functional moiety and a linker,
or only the reactive functional moiety.
[0155] A variety of carrier molecules are useful in the present
invention. Exemplary carrier molecules include antigens, steroids,
vitamins, drugs, haptens, metabolites, toxins, environmental
pollutants, amino acids, peptides, proteins, nucleic acids, nucleic
acid polymers, carbohydrates, lipids, and polymers. The carrier
molecule can, for example, be bound to the compounds at R.sup.9, W,
W', W'', A, or Y. In another exemplary embodiment, the carrier
molecule can be bound to the compounds at R.sup.9 or Y. In another
exemplary embodiment, the carrier molecule can be bound to the
compounds at R.sup.9. In yet another exemplary embodiment, the
carrier molecule can be bound to the compounds at A, W', W'', or Y.
In another exemplary embodiment, the carrier molecule can be bound
to the compounds at W' or W''. In another exemplary embodiment, the
carrier molecule can be bound to the compounds at Y. In another
exemplary embodiment, the carrier molecule can be bound to the
compounds at A.
[0156] In an exemplary embodiment, the carrier molecule comprises
an amino acid, a peptide, a protein, a polysaccharide, a
nucleoside, a nucleotide, an oligonucleotide, a nucleic acid, a
hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a
synthetic polymer, a polymeric microparticle, a biological cell, a
virus and combinations thereof. In another exemplary embodiment,
the carrier molecule is selected from a hapten, a nucleotide, an
oligonucleotide, a nucleic acid polymer, a protein, a peptide or a
polysaccharide. In a preferred embodiment the carrier molecule is
amino acid, a peptide, a protein, a polysaccharide, a nucleoside, a
nucleotide, an oligonucleotide, a nucleic acid, a hapten, a
psoralen, a drug, a hormone, a lipid, a lipid assembly, a tyramine,
a synthetic polymer, a polymeric microparticle, a biological cell,
cellular components, an ion chelating moiety, an enzymatic
substrate or a virus. In another preferred embodiment, the carrier
molecule is an antibody or fragment thereof, an antigen, an avidin
or streptavidin, a biotin, a dextran, an antibody binding protein,
a fluorescent protein, agarose, and a non-biological microparticle.
Typically, the carrier molecule is an antibody, an antibody
fragment, antibody-binding proteins, avidin, streptavidin, a toxin,
a lectin, or a growth factor. Preferred haptens include biotin,
digoxigenin and fluorophores.
[0157] Antibody binging proteins include, but are not limited to,
protein A, protein G, soluble Fc receptor, protein L, lectins,
anti-IgG, anti-IgA, anti-IgM, anti-IgD, anti-IgE or a fragment
thereof.
[0158] In an exemplary embodiment, the enzymatic substrate is
selected from an amino acid, peptide, sugar, alcohol, alkanoic
acid, 4-guanidinobenzoic acid, nucleic acid, lipid, sulfate,
phosphate, --CH.sub.2OCO alkyl and combinations thereof. Thus, the
enzyme substrates can be cleave by enzymes selected from the group
consisting of peptidase, phosphatase, glycosidase, dealkylase,
esterase, guanidinobenzotase, sulfatase, lipase, peroxidase,
histone deacetylase, endoglycoceramidase, exonuclease, reductase
and endonuclease.
[0159] In another exemplary embodiment, the carrier molecule is an
amino acid (including those that are protected or are substituted
by phosphates, carbohydrates, or C.sub.1 to C.sub.22 carboxylic
acids), or a polymer of amino acids such as a peptide or protein.
In a related embodiment, the carrier molecule contains at least
five amino acids, more preferably 5 to 36 amino acids. Exemplary
peptides include, but are not limited to, neuropeptides, cytokines,
toxins, protease substrates, and protein kinase substrates. Other
exemplary peptides may function as organelle localization peptides,
that is, peptides that serve to target the conjugated compound for
localization within a particular cellular substructure by cellular
transport mechanisms. Preferred protein carrier molecules include
enzymes, antibodies, lectins, glycoproteins, histones, albumins,
lipoproteins, avidin, streptavidin, protein A, protein G,
phycobiliproteins and other fluorescent proteins, hormones, toxins
and growth factors. Typically, the protein carrier molecule is an
antibody, an antibody fragment, avidin, streptavidin, a toxin, a
lectin, or a growth factor. Exemplary haptens include biotin,
digoxigenin and fluorophores.
[0160] In another exemplary embodiment, the carrier molecule
comprises a nucleic acid base, nucleoside, nucleotide or a nucleic
acid polymer, optionally containing an additional linker or spacer
for attachment of a fluorophore or other ligand, such as an alkynyl
linkage (U.S. Pat. No. 5,047,519), an aminoallyl linkage (U.S. Pat.
No. 4,711,955) or other linkage. In another exemplary embodiment,
the nucleotide carrier molecule is a nucleoside or a
deoxynucleoside or a dideoxynucleoside.
[0161] Exemplary nucleic acid polymer carrier molecules are single-
or multi-stranded, natural or synthetic DNA or RNA
oligonucleotides, or DNA/RNA hybrids, or incorporating an unusual
linker such as morpholine derivatized phosphates (AntiVirals, Inc.,
Corvallis Oreg.), or peptide nucleic acids such as
N-(2-aminoethyl)glycine units, where the nucleic acid contains
fewer than 50 nucleotides, more typically fewer than 25
nucleotides.
[0162] In another exemplary embodiment, the carrier molecule
comprises a carbohydrate or polyol that is typically a
polysaccharide, such as dextran, FICOLL, heparin, glycogen,
amylopectin, mannan, inulin, starch, agarose and cellulose, or is a
polymer such as a poly(ethylene glycol). In a related embodiment,
the polysaccharide carrier molecule includes dextran, agarose or
FICOLL.
[0163] In another exemplary embodiment, the carrier molecule
comprises a lipid (typically having 6-25 carbons), including
glycolipids, phospholipids, and sphingolipids. Alternatively, the
carrier molecule comprises a lipid vesicle, such as a liposome, or
is a lipoprotein (see below). Some lipophilic substituents are
useful for facilitating transport of the conjugated dye into cells
or cellular organelles.
[0164] Alternatively, the carrier molecule is cells, cellular
systems, cellular fragments, or subcellular particles. Examples of
this type of conjugated material include virus particles, bacterial
particles, virus components, biological cells (such as animal
cells, plant cells, bacteria, or yeast), or cellular components.
Examples of cellular components that can be labeled, or whose
constituent molecules can be labeled, include but are not limited
to lysosomes, endosomes, cytoplasm, nuclei, histones, mitochondria,
Golgi apparatus, endoplasmic reticulum and vacuoles.
[0165] In an exemplary embodiment, the carrier molecule comprises a
specific binding pair member wherein the present compounds are
conjugated to a specific binding pair member and are used to detect
a heavy metal ion in close proximity to the complimentary member of
the specific binding pair. Exemplary binding pairs are set forth in
Table 2.
TABLE-US-00002 TABLE 2 Representative Specific Binding Pairs
antigen antibody biotin avidin (or streptavidin or anti-biotin)
IgG* protein A or protein G drug drug receptor folate folate
binding protein toxin toxin receptor carbohydrate lectin or
carbohydrate receptor peptide peptide receptor protein protein
receptor enzyme substrate enzyme DNA (RNA) cDNA (cRNA).dagger.
hormone hormone receptor ion chelator antibody antibody-binding
proteins *IgG is an immunoglobulin .dagger.cDNA and cRNA are the
complementary strands used for hybridization
[0166] In an exemplary embodiment, the compounds of the invention
are covalently bonded to a solid support. The solid support may be
attached to the compound either through the .beta.-lactam moiety,
or through the dye moiety, or through the reactive group, if
present, or through a carrier molecule, if present. Even if a
reactive group and/or a carrier molecule are present, the solid
support may be attached through the .beta.-lactam moiety or the dye
moiety. In another exemplary embodiment, at least one member
selected from R.sup.9, W, W', W'', A, and Y includes a solid
support or is attached to a solid support.
[0167] A solid support suitable for use in the present invention is
typically substantially insoluble in liquid phases. Solid supports
of the current invention are not limited to a specific type of
support. Rather, a large number of supports are available and are
known to one of ordinary skill in the art. Thus, useful solid
supports include solid and semi-solid matrixes, such as aerogels
and hydrogels, resins, beads, biochips (including thin film coated
biochips), microfluidic chip, a silicon chip, multi-well plates
(also referred to as microtitre plates or microplates), membranes,
conducting and nonconducting metals, glass (including microscope
slides) and magnetic supports. More specific examples of useful
solid supports include silica gels, polymeric membranes, particles,
derivatized plastic films, glass beads, cotton, plastic beads,
alumina gels, polysaccharides such as Sepharose, poly(acrylate),
polystyrene, poly(acrylamide), polyol, agarose, agar, cellulose,
dextran, starch, FICOLL, heparin, glycogen, amylopectin, mannan,
inulin, nitrocellulose, diazocellulose, polyvinylchloride,
polypropylene, polyethylene (including poly(ethylene glycol)),
nylon, latex bead, magnetic bead, paramagnetic bead,
superparamagnetic bead, starch and the like.
[0168] In some embodiments, the solid support may include a solid
support reactive functional group, including, but not limited to,
hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano,
amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate,
sulfonamide, sulfoxide, etc., for attaching the compounds of the
invention. Useful reactive groups are disclosed above and are
equally applicable to the solid support reactive functional groups
herein.
[0169] A suitable solid phase support can be selected on the basis
of desired end use and suitability for various synthetic protocols.
For example, where amide bond formation is desirable to attach the
compounds of the invention to the solid support, resins generally
useful in peptide synthesis may be employed, such as polystyrene
(e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories,
etc.), POLYHIPE.TM. resin (obtained from Aminotech, Canada),
polyamide resin (obtained from Peninsula Laboratories), polystyrene
resin grafted with polyethylene glycol (TentaGel.TM., Rapp
Polymere, Tubingen, Germany), polydimethyl-acrylamide resin
(available from Milligen/Biosearch, California), or PEGA beads
(obtained from Polymer Laboratories).
[0170] While it has been stressed that a wide range of components
can be used to make the heavy metal-binding compounds it should
also be understood that the individual selection of components to
make a particularly useful heavy metal-binding compound for
detection purposes requires an understanding of the reporter
molecules, carrier molecules, reactive group, solid supports, the
linkers, the metal chelating moiety and how certain combinations,
and substituents function to selectively bind to physiological
concentrations of heavy metal ions in the presence of physiological
concentrations of calcium ions or other non-target metal ions.
[0171] Preparation of Conjugates
[0172] Conjugates of components (carrier molecules or solid
supports), e.g., drugs, peptides, toxins, nucleotides,
phospholipids and other organic molecules are prepared by organic
synthesis methods using the reactive dyes, are generally prepared
by means well recognized in the art (Haugland, MOLECULAR PROBES
HANDBOOK, supra, 2002). Conjugation to form a covalent bond may
consist of simply mixing the reactive compounds of the present
invention in a suitable solvent in which both the reactive compound
and the substance to be conjugated are soluble. The reaction
preferably proceeds spontaneously without added reagents at room
temperature or below. For those reactive dyes that are
photoactivated, conjugation is facilitated by illumination of the
reaction mixture to activate the reactive dye. Chemical
modification of water-insoluble substances, so that a desired
dye-conjugate may be prepared, is preferably performed in an
aprotic solvent such as dimethylformamide (DMF), dimethylsulfoxide
(DMSO), acetone, ethyl acetate, toluene, or chloroform.
[0173] Preparation of peptide or protein conjugates typically
comprises first dissolving the protein to be conjugated in aqueous
buffer at about 1-10 mg/mL at room temperature or below.
Bicarbonate buffers (pH about 8.3) are especially suitable for
reaction with succinimidyl esters, phosphate buffers (pH about
7.2-8) for reaction with thiol-reactive functional groups and
carbonate or borate buffers (pH about 9) for reaction with
isothiocyanates and dichlorotriazines. The appropriate reactive
compound is then dissolved in a nonhydroxylic solvent (usually DMSO
or DMF) in an amount sufficient to give a suitable degree of
conjugation when added to a solution of the protein to be
conjugated. The appropriate amount of compound for any protein or
other component is conveniently predetermined by experimentation in
which variable amounts of the present compound are added to the
protein, the conjugate is chromatographically purified to separate
unconjugated compound and the compound-protein conjugate is tested
in its desired application.
[0174] Following addition of the reactive compound to the component
solution, the mixture may be incubated for a suitable period
(typically about 1 hour at room temperature to several hours on
ice), the excess unreacted compound is removed by gel filtration,
dialysis, HPLC, adsorption on an ion exchange or hydrophobic
polymer or other suitable means. The conjugate is used in solution
or lyophilized. In this way, suitable conjugates can be prepared
from antibodies, antibody fragments, avidins, lectins, enzymes,
proteins A and G, cellular proteins, albumins, histones, growth
factors, hormones, and other proteins. The approximate degree of
substitution is determined from the long wavelength absorption of
the compound-protein conjugate by using the extinction coefficient
of the un-reacted compound at its long wavelength absorption peak,
the unmodified protein's absorption peak in the ultraviolet and by
correcting the UV absorption of the conjugate for absorption by the
compound in the UV.
[0175] Conjugates of polymers, including biopolymers and other
higher molecular weight polymers are typically prepared by means
well recognized in the art (for example, Brinkley et al.,
Bioconjugate Chem., 3: 2 (1992)). In these embodiments, a single
type of reactive site may be available, as is typical for
polysaccharides or multiple types of reactive sites (e.g. amines,
thiols, alcohols, phenols) may be available, as is typical for
proteins. Selectivity of labeling is best obtained by selection of
an appropriate reactive compound. For example, modification of
thiols with a thiol-selective reagent such as a haloacetamide or
maleimide, or modification of amines with an amine-reactive reagent
such as an activated ester, acyl azide, isothiocyanate or
3,5-dichloro-2,4,6-triazine. Partial selectivity can also be
obtained by careful control of the reaction conditions.
[0176] When modifying polymers with the compounds, an excess of the
compound is typically used, relative to the expected degree of
compound substitution. Any residual, un-reacted compound or
hydrolysis product is typically removed by dialysis, chromatography
or precipitation. Presence of residual, unconjugated compound can
be detected by thin layer chromatography using a solvent that
elutes the compound away from its conjugate. In all cases it is
usually preferred that the reagents be kept as concentrated as
practical so as to obtain adequate rates of conjugation.
[0177] In an exemplary embodiment, the conjugate is associated with
an additional substance that binds either to the compound or the
component (reporter molecule, carrier molecule, solid support)
through noncovalent interaction. In another exemplary embodiment,
the additional substance is an antibody, an enzyme, a hapten, a
lectin, a receptor, an oligonucleotide, a nucleic acid, a liposome,
or a polymer. The additional substance is optionally used to probe
for the location of the conjugate, for example, as a means of
enhancing the signal of the conjugate.
[0178] Synthesis
[0179] The compounds of the invention are synthesized by an
appropriate combination of generally well known synthetic methods.
Techniques useful in synthesizing the compounds of the invention
are both readily apparent and accessible to those of skill in the
relevant art. The discussion below is offered to illustrate certain
of the diverse methods available for use in assembling the
compounds of the invention; it is not intended to define the scope
of reactions or reaction sequences that are useful in preparing the
compounds of the present invention.
[0180] a) Exemplary Synthesis of Cephalosporin-Containing
Compounds
[0181] In Schemes 1-8, a general preparatory synthesis for the
cephalosporin-containing compounds of the invention is
presented.
##STR00048##
[0182] In Scheme 1, 7-aminocephalosporanic acid is reacted with a
substituted acyl chloride in order to produce a (reaction i).
##STR00049##
[0183] In Scheme 2, the carboxylate in a is protected to yield b.
Examples of protecting groups include allyl, benzhydryl, and
t-butyl ester (reaction ii).
##STR00050##
[0184] In Scheme 3, the acetate moiety in b is cleaved to afford
the electrophilic iodide c, commonly using reagents such as
trimethylsilyl iodide (reaction iii).
##STR00051##
[0185] In Scheme 4, reaction of the iodide with the hydroxyl group
of a dye compound, mediated by a mild base such as potassium
carbonate or sodium methoxide, affords, for example, a
non-fluorescent or weakly fluorescent ether d. (reaction iv). In an
exemplary embodiment, this reaction affords two products, d and e,
instead of a single product, d. Examples of reactions which produce
both d and e include those involving fluorescein or an
oxoquinazoline as the dye moiety.
##STR00052##
[0186] When fluorescein is the dye, the fluorescein can optionally
be substituted before the addition reaction in Scheme 4. In an
exemplary embodiment, R is the optionally substituted moiety, and
it comprises substituted and unsubstituted alkyl. Thus, in Scheme
5, when Y is fluorescein, the fluorescein can be substituted to
yield f (reaction v).
##STR00053##
[0187] In Scheme 6, the protecting group R is removed to afford the
.quadrature.-lactamase substrate g (reaction vi). In an exemplary
embodiment, this reaction affords two products, g and h, instead of
a single product, g. Examples of reactions which produce both g and
h include those involving fluorescein or an oxoquinazoline as the
dye moiety.
##STR00054##
[0188] In optional Scheme 7, the sulfide g can be oxidized,
commonly using 3-chloroperbenzoic acid, to yield the sulfoxide i
(reaction vii). In an exemplary embodiment, a mixture of sulfides g
and h can be oxidized, commonly using 3-chloroperbenzoic acid, to
yield one sulfoxide, i.
##STR00055##
[0189] In optional Scheme 8, the sulfoxide i can be reduced,
commonly using a tin derivative, to yield the sulfide j (reaction
viii). This synthetic step is performed in order to convert isomer
h into isomer g.
[0190] b) Exemplary Synthesis of Clavulanic Acid-Containing
Compounds
[0191] In Schemes 9-13, a general preparatory synthesis for the
clavulanic acid-containing compounds of the invention is
presented.
##STR00056##
[0192] In Scheme 9, the carboxylate in clavulanic acid is
esterified to produce k (reaction ix). In an exemplary embodiment,
the ester formed includes allyl, benzhydryl or t-butyl ester.
##STR00057##
[0193] In Scheme 10, k is coupled with the hydroxyl group of a dye
under standard Mitsunobu reaction conditions to afford I (reaction
x).
##STR00058##
[0194] In Scheme 11, removal of the protecting group R from I
yields the .hoarfrost.-lactamase substrate m (reaction xi).
##STR00059##
[0195] In Scheme 12, reaction of p with .quadrature.-lactamase
yields hydrolyzed clavulanic acid and a fluorescent precipitate
(reaction xiii).
[0196] c) Exemplary Synthesis of Malonamate and Phenaceturate
Compounds
##STR00060##
[0197] In scheme 13, a malonamate s is coulpled with a
phenol-bearing dye moiety to provide, for example, a colorogenic or
fluorogenic malonamate t. Reaction xv employs any one of a number
of coupling protocols, for example, carbodiimide mediated
esterification catalyzed, for example, by DCC, DIC, or EDCI.
Additional agents for esterification include phosphonium salts,
such as PyBop and the like, and uronium salts, such as HBTU, HATU,
TFFH and the like.
##STR00061##
[0198] In scheme 14, an optionally protected aceturate u (protected
shown, for example, protected with BOC) is reacted with a
phenol-bearing dye to provide, for example, a colorogenic or
fluorogenic aceturate v. In reaction xvi, the protected aceturate
is coupled to the dye using, for example, DCC. In the second step,
the product is deprotected (if protecting group present) using, for
example, TFA.
##STR00062##
[0199] In scheme 15, a malonamate is first reacted (reaction xvii)
to form acyl chloride w, for example, with COCl.sub.2. The acyl
chloride w is then reacted (reaction xviii) with an amine-bearing
dye to provide, for example, a colorogenic or fluorogenic
malonamate.
##STR00063##
[0200] In scheme 16, an optionally protected aceturate (protected
shown) is first reacted (reaction xix) to form acyl chloride z, for
example, by reaction with COCl.sub.2. The acyl chloride z is then
reacted (reaction xvii) with an amine-bearing dye to provide aa,
which can then be deprotected (if protecting group present), for
example, with TFA, to provide a colorogenic or fluorogenic
aceturate ab.
[0201] d) Exemplary Synthesis of Benzofuranone Compounds
##STR00064##
[0202] In scheme 17, a dye bearing adjacent hydroxyl and halogen
(bromine shown) groups (ac) is esterified (reaction xxii) with an
N-substituted malonamic acid (where R=substituted or unsubstituted
alkyl or heteroakyl, or substituted or unsubstituted aryl or
heteroaryl) in the presence of a coupling reagent (such as DCC) to
provide a compound of formula ad. Compound ad is then cyclized in
reaction xxiii to provide compound ae, which can be a colorogenic
or fluorogenic benzofuranone.
##STR00065##
[0203] In scheme 18, a dye bearing adjacent methyl and ester groups
af (R'=substituted or unsubstituted alkyl or heteroakyl, or
substituted or unsubstituted aryl or heteroaryl) is halogenated
(reaction xxiv, employing, for example, 2 equivalents of NBS) to
provide a dye compound ag with adjacent dihalomethyl (dibromomethyl
shown) and ester groups. In reaction xxv, the dihalomethyl group is
converted to an aldehyde group and the ester group is cleaved to
provide a hydroxyl group (for example, with sodium carbonate in
ethanol/water). The product of reaction xxv is a dye bearing
adjacent hydroxyl and aldehyde groups (compound ah). The hydroxyl
group on compound ah is then protected (reaction xxvi), for
example, by reaction with an akyl or aryl halide (such as with
benzyl bromide in potassium carbonate/DMF) to provide a dye moiety
bearing adjacent aldehyde and ether groups (compound ai). The
aldehyde group on compound ai is then reacted (reaction xxvii) to
provide an amino-cyano-methyl group (such as with a solution of
NaCN, NH.sub.4Cl, and NH.sub.3 in MeOH) as shown in compound aj.
The cyano group bonded to the methyl group is then converted to a
carboxylic acid group and the ether group is converted back to a
hydroxyl group (deprotection) to provide compound ak (reaction
xxviii, employing, for example, HCl). Next, compound ak is reacted
(reaction xxix) with an acyl halide [R--C(O)-halide, such as
R--C(O)--Cl, where R=substituted or unsubstituted alkyl or
heteroakyl, or substituted or unsubstituted aryl or heteroaryl] to
provide a compound of formula al, which is then cyclized (reaction
xxx) to provide a benzofuranone compound am, which can be a
colorogenic or fluorogenic benzofuranone.
[0204] e) Exemplary Synthesis of Benzopyranone Compounds
##STR00066##
[0205] In scheme 19, a dye compound an bearing adjacent methyl and
ester groups (where R'=substituted or unsubstituted alkyl or
heteroakyl, or substituted or unsubstituted aryl or heteroaryl) is
halogenated (reaction xxxi), for example with 1 equivalent of NBS,
to provide a dye compound of formula ao having adjacent ester and
halomethyl groups (bromomethyl shown). The dye compound of formula
ao is then reacted (reaction xxxii) with an N-substituted
amidomalonate diester in the presence of an alkali or alkaline
earth hydride such as NaH to provide compound ap (where R'' and
R''' can be substituted or unsubstituted alkyl or heteroakyl, or
substituted or unsubstituted aryl or heteroaryl, for example,
diethyl-benzamidomalonate). The ester groups are converted to
carboxylic acid and hydroxyl groups in reaction xxxiii to provide
compound aq, which is cyclized in reaction xxxiv to provide a
benzopyranone compound ar, which may, for example, be a colorogenic
or fluorogenic benzopyranone compound.
##STR00067##
[0206] In scheme 20, a dye bearing adjacent methyl and ester groups
(compound as, where R'=substituted or unsubstituted alkyl or
heteroakyl, or substituted or unsubstituted aryl or heteroaryl) is
halogenated (bromine shown) in reaction xxxv, for example, with 1
equivalent NBS, to generate a dye (at) bearing adjacent halomethyl
(bromomethyl shown) and ester groups. In reaction xxxvi, the ester
is cleaved, for example, with sodium or potassium carbonate, to
provide a dye (au) bearing adjacent halomethyl (bromomethyl shown)
and hydroxyl groups. In reaction xxxvii, dye au is the coupled with
an N-substituted malonamate (where R=substituted or unsubstituted
alkyl or heteroakyl, or substituted or unsubstituted aryl or
heteroaryl, for example, N-benzylmalonamate) in the presence of a
coupling reagent (such as DCC) to provide a compound of formula av.
Compound av is then cyclized in the presence of a mild base (such
as potassium carbonate) to provide a benzopyranone compound of
formula aw, which can, for example, be a colorogenic or fluorogenic
benzopyranone compound.
[0207] Methods of Use
[0208] In another aspect, methods of using the compounds described
herein for a wide variety of chemical, biological and biochemical
applications are disclosed.
[0209] Thus, in another aspect, the present invention provides a
method for detecting the presence of .beta.-lactamase activity in a
sample. The method includes contacting the sample with at least one
disclosed compound, for example, a disclosed cephalosporin,
clavulanate, aceturate, malonamate, benzofuranone or
benzopyranone.
[0210] In another aspect, the a method is provided for the
determination of the presence of a .beta.-lactamase in a sample.
The method includes contacting the sample with a disclosed
compound, which is substantially nonfluorescent. The compound is
then incubated with the sample for a sufficient amount of time (for
example, between 1 and 60 minutes, or longer) for the
.beta.-lactamase to react with the compound to produce a
fluorescent product. The fluorescent product is illuminated with an
appropriate wavelength and its fluorescence is detected, whereby
the presence of the .beta.-lactamase is determined in the sample.
In an exemplary embodiment, the method further comprises incubating
the sample with an esterase, for example, to remove any
hydrolase-cleavable moieties that are present.
[0211] In another aspect, a method is provided for the
determination of the presence of .beta.-lactamase in a sample. The
method includes contacting the sample with a disclosed compound,
which is fluorescent. The sample is then illuminated with an
appropriate wavelength and the fluorescence intensity of the
fluorescent compound is determined. The .beta.-lactamase substrate
is then incubated with the sample for a sufficient amount of time
(for example, between 1 and 60 minutes) for the .beta.-lactamase to
react with the compound to produce a non-fluorescent product. The
sample is illuminated with an appropriate wavelength and the
difference in fluorescence intensity between the first and second
measurements is determined. In an exemplary embodiment, the method
further comprises incubating the sample with an esterase.
[0212] In yet another aspect, a method is provided for the
determination of the presence of .beta.-lactamase in a sample. The
method includes contacting the sample with a fluorescent compound
comprising a first .beta.-lactam moiety and a first dye moiety, and
a (relative) non-fluorescent compound comprising a second
.beta.-lactam moiety and a second dye moiety. The sample is
illuminated with an appropriate wavelength(s) for determining the
fluorescence intensity of the fluorescent compound (and the
non-fluorescent compound, if it is not substantially
non-fluorescent). The fluorescent and non-fluorescent compounds are
incubated with the sample for a sufficient amount of time for the
.beta.-lactamase to cleave the first and second compounds, for
example, to produce a non-fluorescent (relative) product from the
fluorescent compound and a fluorescent (relative ) product from the
non-fluorescent compound. The sample is illuminated with an
appropriate wavelength(s) for determining the fluorescence
intensity of the products.
[0213] In another aspect, a method is provided for localizing a
fluorescent dye product in an environment comprising an aqueous
solution and a .beta.-lactamase. In this method, the environment is
contacted with a disclosed fluorogenic compound. Next, the
environment is incubated for a sufficient amount of time for the
.beta.-lactamase to cleave the substrate moiety, thereby producing
a fluorescent dye product which is insoluble in the aqueous
solution, and thereby localizing the fluorescent dye product in the
environment. In an exemplary embodiment, the environment is either
a biological cell or a cell-free environment. In another exemplary
embodiment, the environment is a either an interior of a cell, an
interior of a cell organelle, or an exterior of a cell.
[0214] In another aspect, the invention provides a method of
localizing a fluorescent dye product on the exterior of a cell, in
which the exterior comprises a .beta.-lactamase and is surrounded
by an aqueous solution. This method includes contacting the
exterior with a disclosed fluorogenic compound. The exterior is
incubated for a sufficient amount of time for the .beta.-lactamase
to cleave the compound, and produce a fluorescent dye product which
is insoluble in the aqueous solution and thereby localized on the
cell exterior.
[0215] In another aspect, a method of detecting a protein or target
antigen is disclosed. This method includes contacting the protein
with a primary antibody that binds specifically to the protein. The
primary antibody is contacted with a secondary antibody that binds
specifically to the primary antibody, wherein the secondary
antibody includes a .beta.-lactamase. The secondary antibody is
contacted with a disclosed compound. The sample is incubated for a
sufficient amount of time for the .beta.-lactamase to cleave the
compound, and produce a detectable optical response, which is used
to detect the presence of the protein. If, for example, the
detectable optical response includes production of an insoluble dye
product, the location of the protein in the sample may be
determined by visual or electronic inspection (such as with a
fluorescence microscope, optionally including a CCD camera).
[0216] In another aspect, the invention provides a method of
detecting a protein in a sample immobilized on a gel. This method
includes subjecting the sample to an electrophoretic separation.
Next, the protein is transferred from the gel to a polymer sheet.
Next, the protein on the polymer sheet is contacted with a primary
antibody. Then the primary antibody is contacted with a secondary
antibody that comprises a .beta.-lactamase. Then the protein on the
polymer sheet with the primary and secondary antibodies is
contacted with a fluorogenic compound comprising a dye moiety and a
.beta.-lactam moiety. Finally, the product of this reaction is
incubated for a sufficient amount of time for said .beta.-lactamase
to cleave the dye moiety from the .beta.-lactam moiety. This
produces a fluorescent dye product which is insoluble in an aqueous
solution, and thereby enables the detection of the protein.
[0217] Compounds disclosed to include a reactive group or a carrier
molecule are discussed in detail above and are equally applicable
to the methods discussed herein.
[0218] In another exemplary embodiment, the present invention
provides a method of detecting a .beta.-lactamase in a sample by
using an immobilized compound of the invention comprising a
.beta.-lactam moiety and a dye moiety. The method includes
combining the sample with a compound of the invention covalently
bonded to a solid support. The .beta.-lactamase in the sample is
then allowed to react and cleave the bond linking the .beta.-lactam
moiety and a dye moiety, thus producing a fluorescent dye product.
In another exemplary embodiment, the method further comprises
illuminating the fluorescent dye product with an appropriate
wavelength so that the presence of the .beta.-lactamase in the
sample is determined and its concentration in the sample is
optionally quantified.
[0219] In methods of detecting a .beta.-lactamase by using an
immobilized compound of the invention, the methods may further
include, after forming the fluorescent product, rinsing the solid
support to remove components of the sample other than the
immobilized fluorescent product. In another exemplary embodiment,
the methods may further provide, after forming the immobilized
fluorescent product, detecting the immobilized fluorescent product.
In a related embodiment, the immobilized fluorescent product is
detected after rinsing the solid support.
[0220] In another exemplary embodiment, the present invention
provides a method of detecting a .beta.-lactamase in a sample by
using an immobilized compound of the invention which is fluorescent
and comprises a .beta.-lactam moiety and a dye moiety. The method
includes combining the sample with a compound of the invention
covalently bonded to a solid support. In this method, the
immobilized compound is illuminated with an appropriate wavelength
in order to determine its fluorescence intensity. The
.beta.-lactamase in the sample is then allowed to react and cleave
the bond linking the .beta.-lactam moiety and the dye moiety, thus
producing a non-fluorescent product. In another exemplary
embodiment, the method further comprises illuminating the
non-fluorescent product with an appropriate wavelength in order to
determine the fluorescence intensity. Then, the first and second
fluorescence intensities are compared in order to determine the
presence, and optionally the concentration, of .beta.-lactamase in
the sample.
[0221] Solid supports covalently bonded to a compound of the
invention are discussed in detail above and are equally applicable
to the methods discussed herein. Likewise, carrier molecules
covalently bonded to a compound of the invention are discussed in
detail above and are equally applicable to the methods discussed
herein.
[0222] Rinsing the solid support typically functions to remove
residual, excess or unbound materials from the solid support other
than the immobilized fluorescent product. Any appropriate solution
or series of solutions may be used to rinse the solid support.
Exemplary solvents useful in the present invention include both
polar and non-polar solvents. Thus, any appropriate organic solvent
or aqueous solution is useful in the methods of the current
invention.
[0223] Solutions of the disclosed compounds may be prepared
according to methods generally known in the art. The disclosed
compounds are generally soluble in water and aqueous solutions
having a pH greater than or equal to about 6. Stock solutions of
pure compounds of the invention, however, may be dissolved in
organic solvent before diluting into aqueous solution or buffer.
Exemplary organic solvents include aprotic polar solvents such as
DMSO, DMF, N-methylpyrrolidone, acetone, acetonitrile, dioxane,
tetrahydrofuran and other nonhydroxylic, completely water-miscible
solvents. In general, the amount of the disclosed compounds in
solution is the minimum amount that will yield a detectable optical
response in the presence of a particular enzyme, in a particular
amount, within a reasonable time, and with minimal background
signal. The exact concentration of compound of the invention to be
used is dependent upon the experimental conditions and the desired
results, and those skilled in the art can readily determine the
optimal concentration to be used in a given application. The
concentration typically ranges from nanomolar to micromolar. The
optimal concentration is determined by systematic variation in
compound concentration until satisfactory results are accomplished.
The starting ranges are readily determined from methods known in
the art for use of similar compounds under comparable conditions
for the desired response.
[0224] For those compounds of the present invention that are
substituted by lipophilic moieties, the compounds of the invention
are optionally introduced into living cells by passive permeation
through the cellular membranes. Less cell-per meant embodiments of
the invention are optionally introduced into cells by pressure
microinjection methods, scrape loading techniques (short mechanical
disruption of the plasma membrane where the plasma membrane is
peeled away from the cytoplasm, the compound is perfused through
the sample and the plasma membrane is reassembled), patch clamp
methods (where an opening is maintained in the plasma membrane for
long periods) or phagocytosis. Any other treatment that will
permeabilize the plasma membrane, such as electroporation, shock
treatments or high extracellular ATP can be used to introduce the
compounds into the cellular cytoplasm.
[0225] Any suitable method of detection is useful in detecting
fluorogenic or fluorescent compounds of the invention. In an
exemplary embodiment, detection is achieved by illuminating the
fluorogenic or fluorescent compounds at a wavelength selected to
elicit a detectable optical response.
[0226] A detectable optical response means a change in, or
occurrence of, a parameter in a test system that is capable of
being perceived, either by direct observation or instrumentally.
Typically the detectable response is a change in fluorescence, such
as a change in the intensity, excitation or emission wavelength
distribution of fluorescence, fluorescence lifetime, fluorescence
polarization, or a combination thereof. The detectable optical
response may occur throughout the sample or in a localized portion
of the sample. The presence or absence of the optical response
after the elapsed time is indicative of one or more characteristic
of the sample. Comparison of the amount of the compound of the
invention with a standard or expected response can be used to
determine whether and to what degree a sample possesses the enzyme
(and enzymatic activity) of interest.
[0227] In those embodiments in which a compound of the invention is
covalently bonded to a carrier molecule that is a chelator of
calcium, sodium, magnesium, potassium, or other biologically
important metal ion, the amount of the compound that fluoresces
functions as an indicator of the ion, which indicators are
optionally further conjugated to a biological or plastic polymer
according to methods known in the art; e.g., using fluorinated
analogs of the compounds described in U.S. Pat. No. 5,453,517 and
5,405,975. Alternatively, the compound of the invention acts as a
pH indicator at pH values within about 1.5 pH units of the
individual dye's pKa. Typically the detectable optical response of
the ion indicators is a change in fluorescence of the ion
chelator.
[0228] Also disclosed are methods for detecting .beta.-lactamase
activity using the disclosed compounds, which include methods for
detecting .beta.-lactmase activity per se (such as for detecting
antibiotic resistance in bacteria) and for detecting
.beta.-lactamase activity as a measure of another process that
involves production of a .beta.-lactamase (such as where a
.beta.-lactamase encoding nucleic acid is used as a reporter gene
to measure expression of the nucleic acid). The methods may be
practiced on both cell-free and cellular systems (e.g.,
intracellular detection). Examples of methods for detecting
.beta.-lactamase activity in which the presently disclosed
compounds may be utilized as susbstrates for a .beta.-lactamase
include those methods disclosed in U.S. Pat. Nos. 5,955,604,
5,741,657, 6,031,094, 6,291,162, and 6,472,205.
[0229] As described in the above-referenced United States patents
(such as, U.S. Pat. No. 6,472,205), cells to be assayed for
.beta.-lactamase activity may be contacted with a disclosed
compound, for example, a fluorogenic compound. In the presence of a
.beta.-lactamase, the substrate is cleaved and a detectable optical
response, such as a change in the fluorescence emission spectrum of
the dye, is produced. If a .beta.-lactamase is present in the
sample, then the sample will exhibit increased or decreased
fluorescence when contacted with a disclosed compound. Such
fluorescence changes can be detected by exciting the sample with
radiation of a first wavelength, which excites the dye moiety,
which emits radiation of a second wavelength, which can be
detected. The amount of the emission is measured, and compared to
proper control or background values. The amount of emitted
radiation that differs from the background and control levels,
either increased or decreased, correlates with the amount or
activity of the .beta.-lactamase in the sample. Standard curves can
be determined for quantitative measurements. .beta.-lactamase
activity may be measured using the disclosed compounds by measuring
any number of optical changes catalyzed by a .beta.-lactamase. For
example, cleavage of the substrate moiety of a disclosed compound
by a .beta.-lactamase may result in any of the following: (1) a
shifting of the emission spectrum of the dye moiety (2) the
compound is fluorescent and the product of the reaction with the
.beta.-lactamase is non-fluorescent, and (3) the compound is
non-fluorescent and the product of the reaction with the
.beta.-lactamase is fluorescent.
[0230] In another aspect, a method is provided for determining
whether a .beta.-lactamase enzyme can cleave a disclosed compound.
The method involves contacting the sample with a compound of the
present invention, exciting the sample with radiation of one or
more wavelengths that are suitable for the cleaved compound, and
determining the degree of fluorescence emitted from the sample. A
degree of fluorescence emitted from the sample that is greater than
an expected degree indicates that the beta-lactamase enzyme can
cleave the compound and that the compound is a substrate for the
.beta.-lactamase enzyme.
[0231] In another aspect, a method for determining whether a sample
contains beta-lactamase activity is provided. The method involves
contacting the sample with a disclosed compound, exciting the
sample with radiation of one or more wavelengths that are absorbed
by the cleaved compound, and determining the degree of fluorescence
emitted from the sample. A degree of fluorescence emitted from the
sample that is greater than an expected degree indicates the
presence of .beta.-lactamase activity in the sample. One aspect of
this method is for determining the amount of an enzyme in a sample
by determining the degree of fluorescence emitted at a first and
second time after contacting the sample with a compound of the
present invention. The difference in the degree of fluorescence
emitted from the sample at the first and second time is determined,
and the difference reflects the amount of a beta-lactamase enzyme
in the sample.
[0232] In another aspect, screening assays are presented for the
use of the disclosed compounds and a host cell, such as a mammalian
cell, transfected with at least one recombinant nucleic acid
molecule encoding at least one protein having .beta.-lactamase
activity. Such recombinant nucleic acid molecules can include
expression control sequences adapted for function in a eukaryotic
cell, such as a vertebrate cell, operatively linked to a nucleotide
sequence coding for the expression of a .beta.-lactamase enzyme.
Such recombinant nucleic acid molecules include the GeneBLAzer,
LiveBLAzer and LyticBALzer constructs sold by Invitrogen (Carlsbad,
Calif.).
[0233] In yet another aspect, methods are provided for determining
the amount of beta-lactamase activity in a cell. This method
involves contacting a sample including a host cell that is
transfected with a recombinant nucleic acid molecule that includes
a nucleic acid sequence coding for the expression of a
beta-lactamase. The sample can comprise whole host cells, or an
extract of the host cells, which is contacted with a compound of
the present invention. The amount of compound cleaved is measured
by measuring a detectable optical response, whereby the amount of
substrate cleaved is related to the amount of beta-lactamase
activity in the host cell.
[0234] In another aspect, a method for monitoring the expression of
a gene operably linked to a set of expression control sequences is
provided. The method involves providing a host cell transfected
with a recombinant nucleic acid molecule, where the nucleic acid
molecule comprises a set of expression control sequences
operatively linked to nucleic acid sequences coding for the
expression of a beta-lactamase enzyme, except if the host cell is a
fungus, the beta-lactamase is a cytosolic beta-lactamase enzyme. A
sample comprising the host cell, or an extract or conditioned
medium produced therefrom or thereby, is contacted with a disclosed
compound. The amount of compound cleaved is determined, wherein the
amount of substrate cleaved is related to the amount of
beta-lactamase activity in the host eukaryotic cell, which is
related to the expression of the gene.
[0235] In another aspect, a method is provided for determining
whether a test compound alters the expression of nucleic acid
sequence operably linked to an expression control sequence(s). The
method involves contacting a host cell transfected with a
recombinant nucleic acid sequence, where the recombinant nucleic
acid comprises an expression control sequence(s) operably linked to
a nucleic acid sequence coding for a beta-lactamase. The host cell
is contacted with the test compound, and the host cell is then
contacted with a disclosed compound. The amount of the compound
cleaved is then measured, whereby the amount of the compound
cleaved is related to the amount of beta-lactamase activity in the
cell. In addition, the amount of compound cleaved in the presence
of the test compound can be compared to the amount of compound
cleaved in the absence of the test compound to determine if the
test compound alters expression regulated by the control
sequence.
[0236] In another aspect, a method for clonal selection is
provided, wherein cells that are presumably transfected with a
recombinant nucleic acid molecule comprising a sequence coding for
a .beta.-lactamase are contacted with a disclosed compound. Those
cells that are in fact transfected with the recombinant nucleic
acid molecule will exhibit .beta.-lactamase activity, which is
detected by measuring the detectable optical change produced upon
cleavage of the compound. Cells that exhibit .beta.-lactamase
activity, or greater than a predetermined level of .beta.-lactamase
activity may be selected, and propagated if desired. Selection of
cells exhibiting .beta.-lactamase acitvity can be accomplished
using fluorescence activated cell sorting (FACS), using, for
example, a Becton Dickinson FACS Vantage.
[0237] Another aspect is to use a beta-lactamase reporter gene and
a compound of the present invention to screen test chemicals for
biochemical activity. A cell transfected with a recombinant nucleic
acid molecule that includes at least one expression control
sequence operably linked to at least one nucleic acid sequence
encoding for the expression of a beta-lactamase enzyme is contacted
with the test chemical. The cell is contacted with a disclosed
compound and the amount of the compound cleaved is measured. The
amount of compound cleaved reflects the amount of beta-lactamase
activity within the at least one cell, and reflects the biochemical
activity of the test chemical. The amount of compound cleaved in
the presence of the test chemical is compared to the amount of
compound cleaved in the absence of the test chemical to determine
if the test chemical increases, decreases or does not alter
expression under control of the control sequence.
[0238] The interaction of a particular disclosed compound with a
particular .beta.-lactamase enzyme can be readily determined. In
one embodiment, such a method involves contacting the sample with
the compound, exciting at one or more wavelengths that are suitable
for the cleaved compound, and determining the degree of
fluorescence in the sample. A degree of fluorescence that is
greater than an expected amount in the absence of beta-lactamase
activity indicates that the particular beta-lactamase enzyme can
cleave the particular compound. The amount of fluorescence expected
can be determined using, for example, a control sample, or control
values determined contemporaneously, prior to, or after a
particular assay was performed. Such expected values can include a
statistical analysis, such as a mean and standard deviation, to
provide a chosen statistical confidence level. Both naturally
occurring beta-lactamase enzymes and beta-lactamase enzymes
prepared by mutagenesis can be tested with a particular disclosed
compound.
[0239] Even if a particular compound is not cleaved by a particular
.beta.-lactamase, the particular compound may have value as an
inhibitor of the .beta.-lactamase enzyme. The ability of a compound
to inhibit a beta-lactamase can be confirmed by comparing the
amount of .beta.-lactamase activity detected with the compound,
compared to that detected with a compound that is a known to be
cleaved by the .beta.-lactamase. An amount of beta-lactamase
activity less than expected indicates that the compound inhibits
beta-lactamase activity. The expected level of activity can be
determined using a proper control or historical values, or other
methods known in the art.
[0240] Any of the above methods specifically disclosed, and other
method that include the use of the disclosed compounds to detect
.beta.-lactamase activity may further include use of the methods
described in U.S. Pat. No. 6,284,461 to increase the signal to
noise ratio of the disclosed assays.
[0241] In addition, the disclosed compounds may be used to detect
beta-lactamase activity in a wide variety of biologically important
environments, such as human blood serum, the cytoplasm of cells and
intracellular compartments, which can facilitate the measurement of
periplasmic or secreted beta-lactamase enzyme. In addition, the
presence (for example, in human serum, pus, urine, or other fluid,
sample, or tissue) of bacteria resistant to beta-lactam antibiotics
may be readily detected by using the disclosed compounds. Only in
the presence of an active beta-lactamase enzyme is there a
fluorescence spectrum that is characteristic of the cleaved
compound. Such methods include contacting the environment with a
disclosed compound and detecting any .beta.-lactamase activity
present by measuring the detectable optical change that occurs upon
cleavage of the compound by a .beta.-lactamase. Further, the
expression of any target protein may be detected by fusing a gene
encoding the target protein to a beta-lactamase gene, which can be
localized by immunostaining or fluorescence or electron microscopy.
For example, beta-lactamase fusion proteins can be detected in the
lumen of organelles through the use of the substrates of the
invention. In this instance, only subcellular compartments
containing the fusion protein fluoresce at a wavelength
characteristic of the cleaved substrate, whereas all others
fluoresce at a wavelength characteristic of the intact
molecule.
[0242] Illumination
[0243] A sample can be illuminated with a wavelength of light
selected to give a detectable optical response, and observed with a
means for detecting the optical response. Equipment that is useful
for illuminating the present compounds and compositions of the
invention includes, but is not limited to, hand-held ultraviolet
lamps, mercury arc lamps, xenon lamps, lasers and laser diodes.
These illumination sources are optically integrated into laser
scanners, fluorescence microplate readers or standard or
microfluorometers.
[0244] The disclosed compounds and their products and precursors
may, at any time after or during an assay, be illuminated with a
wavelength of light that results in a detectable optical response,
and observed with a means for detecting the optical response. Upon
illumination, such as by an ultraviolet or visible wavelength
emission lamp, an arc lamp, a laser, or even sunlight or ordinary
room light, the fluorescent compounds, including those bound to the
complementary specific binding pair member, display intense visible
absorption as well as fluorescence emission. Selected equipment
that is useful for illuminating the fluorescent compounds of the
invention includes, but is not limited to, hand-held ultraviolet
lamps, mercury arc lamps, xenon lamps, argon lasers, laser diodes,
and YAG lasers. These illumination sources are optionally
integrated into laser scanners, fluorescence microplate readers,
standard or mini fluorometers, or chromatographic detectors. This
fluorescence emission is optionally detected by visual inspection,
or by use of any of the following devices: CCD cameras, video
cameras, photographic film, laser scanning devices, fluorometers,
photodiodes, quantum counters, epifluorescence microscopes,
scanning microscopes, flow cytometers, fluorescence microplate
readers, or by means for amplifying the signal such as
photomultiplier tubes. Where the sample is examined using a flow
cytometer, a fluorescence microscope or a fluorometer, the
instrument is optionally used to distinguish and discriminate
between the fluorescent compounds of the invention and a second
fluorophore with detectably different optical properties, typically
by distinguishing the fluorescence response of the fluorescent
compounds of the invention from that of the second fluorophore.
Where a sample is examined using a flow cytometer, examination of
the sample optionally includes isolation of particles within the
sample based on the fluorescence response by using a sorting
device.
[0245] Sample Preparation
[0246] The end user will determine the choice of the sample and the
way in which the sample is prepared. The sample includes, without
limitation, any biological derived material that is thought to
contain a .beta.-lactamase. Alternatively, samples also include
material in which a .beta.-lactamase has been added.
[0247] The sample can be a biological fluid such as whole blood,
plasma, serum, nasal secretions, sputum, saliva, urine, sweat,
transdermal exudates, cerebrospinal fluid, or the like. Biological
fluids also include tissue and cell culture medium wherein an
analyte of interest has been secreted into the medium.
Alternatively, the sample may be whole organs, tissue or cells from
the animal. Examples of sources of such samples include muscle,
eye, skin, gonads, lymph nodes, heart, brain, lung, liver, kidney,
spleen, thymus, pancreas, solid tumors, macrophages, mammary
glands, mesothelium, and the like. Cells include without limitation
prokaryotic cells and eukaryotic cells that include primary
cultures and immortalized cell lines. Eukaryotic cells include
without limitation ovary cells, epithelial cells, circulating
immune cells, .beta. cells, hepatocytes, and neurons.
[0248] In many instances, it may be advantageous to add a small
amount of a non-ionic detergent to the sample. Generally the
detergent will be present in from about 0.01 to 0.1 vol. %.
Illustrative non-ionic detergents include the polyoxyalkylene
diols, e.g. Pluronics, Tweens, Triton X-100, etc.
[0249] In fluorescence experiments, the reaction is optionally
quenched. Various quenching agents may be used, both physical and
chemical. Conveniently, a small amount of a water-soluble solvent
may be added, such as acetonitrile, DMSO, SDS, methanol, DMF,
etc.
[0250] Kits
[0251] In another aspect, a kit is provided that includes one or
more of the disclosed compounds. The kit also includes at least one
additional component, for example, instructions for using the
compound(s) in one or more methods, additional molecules (such as a
.beta.-lactamase, or a nucleic acid coding for a .beta.-lactamase
such as a vector having a .beta.-lactamase sequence as a reporter),
substances (such as a reaction buffer), or biological components
(such as cells, or cell extracts). For example, cells (e.g.,
prokaryotic or eukaryotic cells) which contain .beta.-lactamase
activity and/or at least one .beta.-lactamase substrate, as well as
compositions and reaction mixtures which contain such cells can be
included in the kits. Cells may further include receptor and
signaling molecules that regulate expression of nucleic acid
sequences within the cell, either sequences found on vectors, or in
the nucleus or mitochondria of the cells. Cells, compositions and
reaction mixtures that include at least one of the disclosed
compounds are also part of the disclosure, regardless of whether or
not they are part of a "kit" per se.
[0252] In some embodiments, the kit includes a solid support
covalently bonded to a disclosed compound and instructions for
detecting a .beta.-lactamase in a sample with the solid support. In
other embodiments, the kit includes a disclosed compound that
includes a reactive group, a solid support and instructions which
specify how to immobilize the compound on the solid support and
how, after forming the immobilized compound, to detect a
.beta.-lactamase. Alternatively, the kit includes a solid support
bearing reactive groups that can react with and immobilize a
.beta.-lactamase, and instructions that specify how to immobilize
.beta.-lactamases to the solid support and to detect such
immobilized .beta.-lactamases using one or more of the compounds of
the disclosure. Methods of detecting immobilized .beta.-lactamases
are presented above.
[0253] In another aspect, the kit may include compositions for the
quantitative determination of a .beta.-lactamase in a sample. In an
exemplary embodiment, the composition comprises a sample containing
a known amount of a .beta.-lactamase (such as a solution containing
the known amount of .beta.-lactamase or cells expressing known
amounts of the .beta.-lactmase) and a disclosed compound of the
invention, wherein the compound reacts with a .beta.-lactamase to
produce a detectable optical response that is proportional to the
amount of the .beta.-lactamase in the sample, for example, an
amount of a fluorescent product that is proportional to the amount
of the .beta.-lactmase in the sample.
[0254] .beta.-lactamases that may be included in a kit according to
the disclosure can be of any type, and include both
naturally-occurring .beta.-lactmases and non-naturally-occurring
.beta.-lactamases. .beta.-lactamases are classified based on amino
acid and nucleotide sequence (Ambler, R. P., Phil. Trans. R. Soc.
Lond. [Ser. B.] 289: 321-331 (1980)) into classes A-D. Class A
.beta.-lactamases possess a serine in the active site and have an
approximate weight of 29 kd. This class contains the
plasmid-mediated TEM .beta.-lactamases such as the RTEM enzyme of
pBR322. Class B .beta.-lactamases have an active-site zinc bound to
a cysteine residue. Class C enzymes have an active site serine and
a molecular weight of approximately 39 kd, but have no amino acid
homology to the class A enzymes. Class D enzymes also contain an
active site serine. Representative examples of each class are
provided in Tables 1-4 along with the accession numbers that may be
used to retrieve the sequences from the indicated databases. The
sequences of the enzymes in Tables 1-4 are specifically
incorporated herein by reference, and any of these
.beta.-lactamases, or nucleic acids which encode these
.beta.-lactamases, which have suitable characteristics (for
example, they cleave at least one of the disclosed compounds or
other fluorogenic and colorogenic compounds known in the art) for
the particular application may be used in the practice of the
invention.
TABLE-US-00003 TABLE 3 Exemplary Class A .beta.-lactamases
Accession Class A .beta.-lactamase and Source No. Database
Bacteroides fragilis CS30 L13472 GenBank Bacteroides uniformis
WAL-7088 P30898 SWISS-PROT PER-1, P. aeruginosa RNL-1 P37321
SWISS-PROT Bacteroides vulgatus CLA341 P30899 SWISS-PROT OHIO-1,
Enterobacter cloacae P18251 SWISS-PROT SHV-1, K. pneumoniae P23982
SWISS-PROT LEN-1, K. pneumoniae LEN-1 P05192 SWISS-PROT TEM-1, E.
coli P00810 SWISS-PROT Proteus mirabilis GN179 P30897 SWISS-PROT
PSE-4, P. aeruginosa Dalgleish P16897 SWISS-PROT Rhodopseudomonas
capsulatus SP108 P14171 SWISS-PROT NMC, E. cloacae NOR-1 P52663
SWISS-PROT Sme-1, Serratia marcescens S6 P52682 SWISS-PROT OXY-2,
Klebsiella oxytoca D488 P23954 SWISS-PROT K. oxytoca
E23004/SL781/SL7811 P22391 SWISS-PROT S. typhimurium CAS-5 X92507
GenBank MEN-1, E. coli MEN P28585 SWISS-PROT Serratia fonticola CUV
P80545 SWISS-PROT Citrobacter diversus ULA27 P22390 SWISS-PROT
Proteus vulgaris 5E78-1 P52664 SWISS-PROT Burkholderia cepacia 249
U85041 GenBank Yersinia enterocolitica serotype O:3/Y-56 Q01166
SWISS-PROT M. tuberculosis H37RV Q10670 SWISS-PROT S. clavuligerus
NRRL 3585 Z54190 GenBank III, Bacillus cereus 569/H P06548
SWISS-PROT B. licheniformis 749/C P00808 SWISS-PROT I, Bacillus
mycoides NI10R P28018 SWISS-PROT I, B. cereus 569/H/9 P00809
SWISS-PROT I, B. cereus 5/B P10424 SWISS-PROT B. subtilis 168/6GM
P39824 SWISS-PROT 2, Streptomyces cacaoi DSM40057 P14560 SWISS-PROT
Streptomyces badius DSM40139 P35391 SWISS-PROT Actinomadura sp.
strain R39 X53650 GenBank Nocardia lactamdurans LC411 Q06316
SWISS-PROT S. cacaoi KCC S0352 Q03680 SWISS-PROT ROB-1, H.
influenzae F990/LNPB51/ P33949 SWISS-PROT serotype A1 Streptomyces
fradiae DSM40063 P35392 SWISS-PROT Streptomyces lavendulae DSM2014
P35393 SWISS-PROT Streptomyces albus G P14559 SWISS-PROT S.
lavendulae KCCS0263 D12693 GenBank Streptomyces aureofaciens P10509
SWISS-PROT Streptomyces cellulosae KCCS0127 Q06650 SWISS-PROT
Mycobacterium fortuitum L25634 GenBank S. aureus PC1/SK456/NCTC9789
P00807 SWISS-PROT BRO-1, Moraxella catarrhalis ATCC 53879 Z54181
GenBank; Q59514 SWISS-PROT
TABLE-US-00004 TABLE 4 Exemplary Class B .beta.-lactamases Class B
.beta.-lactamase and Source Accession No. Database II, B. cereus
569/H P04190 SWISS-PROT II, Bacillus sp. 170 P10425 SWISS-PROT II,
B. cereus 5/B/6 P14488 SWISS-PROT Chryseobacterium X96858 GenBank
meningosepticum CCUG4310 IMP-1, S. marcescens AK9373/TN9106 P52699
SWISS-PROT B. fragilis TAL3636/TAL2480 P25910 SWISS-PROT Aeromonas
hydrophila AE036 P26918 SWISS-PROT L1, Xanthomonas maltophilia IID
1275 P52700 SWISS-PROT
TABLE-US-00005 TABLE 5 Exemplary Class C .beta.-lactamases Class C
.beta.-lactamase and Source Accession No. Database Citrobacter
freundii OS60/GN346 P05193 SWISS-PROT E. coli K-12/MG1655 P00811
SWISS-PROT P99, E. cloacae P99/Q908R/MHN1 P05364 SWISS-PROT Y.
enterocolitica IP97/serotype O:5B P45460 SWISS-PROT Morganella
morganii SLM01 Y10283 GenBank A. sobria 163a X80277 GenBank FOX-3,
K. oxytoca 1731 Y11068 GenBank K. pneumoniae NU2936 D13304 GenBank
P. aeruginosa PAO1 P24735 SWISS-PROT S. marcescens SR50 P18539
SWISS-PROT Psychrobacter immobilis A5 X83586 GenBank
TABLE-US-00006 TABLE 6 Exemplary Class D .beta.-lactamases
Accession Class D .beta.-lactamase and Source No. Database OXA-18,
Pseudomonas aeruginosa Mus U85514 GenBank OXA-9, Klebsiella
pneumoniae P22070 SWISS-PROT Aeromonas sobria AER 14 X80276 GenBank
OXA-1, Escherichia coli K10-35 P13661 SWISS-PROT OXA-7, E. coli
7181 P35695 SWISS-PROT OXA-11, P. aeruginosa ABD Q06778 SWISS-PROT
OXA-5, P. aeruginosa 76072601 Q00982 SWISS-PROT LCR-1, P.
aeruginosa 2293E Q00983 SWISS-PROT OXA-2, Salmonella typhimurium
type 1A P05191 SWISS-PROT
[0255] For additional .beta.-lactamases and a more detailed
description of substrate specificities of .beta.-lactamases,
consult Bush et al. (1995) Antimicrob. Agents Chemother
39:1211-1233.
[0256] Those skilled in the art will appreciate that the
polypeptides having .beta.-lactamase activity disclosed herein may
be altered by for example, mutating, deleting, and/or adding one or
more amino acids and may still be used in the practice of the
invention so long as the polypeptide retains detectable
.beta.-lactamase activity toward at least one disclosed compound.
An example of a suitably altered polypeptide having
.beta.-lactamase activity is one from which a signal peptide
sequence has been deleted and/or altered such that the polypeptide
is retained in the cytosol of prokaryotic and/or eukaryotic cells.
The amino acid sequence of one such polypeptide is provided in SEQ
ID NO:1. In many eukaryotic cells, the signal peptide of bacterial
.beta.-lactamases is functional, which function rests in the enzyme
being exported from the cells. In instances where this is desirable
a functional signal peptide may be associated with the enzyme. In
instances where it is desirable that the .beta.-lactamases remain
intracellular for at least a period of time, the signal peptide may
be deleted or rendered otherwise non-functional.
[0257] One skilled in the art will appreciate that the sequence in
SEQ ID NO:1 may be modified and still be within the scope of the
disclosure. For example, the Gly-His sequence of the polypeptide in
Table 3 (amino acids 2-3) can be changed to an Asp.
[0258] Any number of nucleic acid molecules (e.g., vectors) may be
used to practice the disclosed methods, and thus may be part of the
disclosed kits. In many instances, such nucleic acid molecules will
encode a polypeptide having .beta.-lactamase activity. In
appropriate instances, nucleic acids which encode polypeptides
having .beta.-lactamase activity will be operable connected to
nucleic acid segments with promoter activity (e.g., an activity
associated with a regulatable promoter, such an inducible promoter
or a repressible promoter, or a constitutive promoter). Thus, in
particular aspects, the invention includes methods for detecting
the presence of a polypeptide with .beta.-lactamase activity. In
many instances, this polypeptide will be expressed from a nucleic
acid molecule which encodes a polypeptide having .beta.-lactamase
activity.
[0259] As indicated above, nucleic acids which may be used to
practice the disclosed methods include vectors. Such vectors, which
may be included in the disclosed kits may contain a nucleic acid
sequence that encodes a polypeptide having .beta.-lactamase
activity, wherein the nucleic acid segment is located between
cloning sites (e.g., is flanked by cloning sites). The nucleic acid
segment which encodes a polypeptide having .beta.-lactamase
activity in such vectors may also have a cloning site on one end
(e.g., a cloning site may be present on both ends or on only one
end). Vectors such as these may be used for any number of
purposes.
[0260] For example, such vectors may be used to clone nucleic acid
sequences which are then screened for promoter activity (see, for
example, U.S. Patent Application Nos. 60/482,504 filed Jun. 26,
2003, 60/487,301 filed Jul. 16, 2003, and 60/511,634 filed Oct. 17,
2003, the entire disclosures of which are incorporated herein by
reference). A typical mammalian expression vector contains the
promoter element, which mediates the initiation of transcription of
mRNA, the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as pSVL and pMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and
pBC12MI (ATCC 67109).
[0261] Cloning sites present in nucleic acid molecules can include
multiple cloning sites (for example, a nucleic acid segment of 15
nucleotides or less which contains at least four sites which are
recognized by one or more restriction endonucleases), recombination
sites and topoisomerase recognition sequences. Thus, nucleic acid
molecules include those which contain at least one cloning
site.
[0262] A used herein, the phrase "recombination site" refers to a
recognition sequence on a nucleic acid molecule that participates
in an integration/recombination reaction by recombination proteins,
and the disclosed kits may contain vectors having any known or
later discovered recombination site. Recombination sites are
discrete sections or segments of nucleic acid on the participating
nucleic acid molecules that are recognized and bound by a
site-specific recombination protein during the initial stages of
integration or recombination. For example, the recombination site
for Cre recombinase is loxP, which is a 34 base pair sequence
comprised of two 13 base pair inverted repeats (serving as the
recombinase binding sites) flanking an 8 base pair core sequence
[see FIG. 1 of Sauer, B., Curr. Opin. Biotech. 5:521-527 (1994)].
Other examples of recombination sites include the attB, attP, attL,
and attR sequences described in U.S. provisional patent
applications 60/136,744, filed May 28, 1999, and 60/188,000, filed
Mar. 9, 2000, and in co-pending U.S. patent application Ser. No.
09/517,466 all of which are specifically incorporated herein by
reference--and mutants, fragments, variants and derivatives
thereof, which are recognized by the recombination protein .lamda.
Int and by the auxiliary proteins integration host factor (IHF),
FIS and excisionase (Xis) [see Landy, Curr. Opin. Biotech.
3:699-707 (1993)].
[0263] Recombination sites may be added to molecules by any number
of known methods. For example, recombination sites can be added to
nucleic acid molecules by blunt end ligation, PCR performed with
fully or partially random primers, or inserting the nucleic acid
molecules into a vector using a restriction site flanked by
recombination sites.
[0264] As used herein, the term "topoisomerase recognition site" or
"topoisomerase site" means a defined nucleotide sequence that is
recognized and bound by a site specific topoisomerase. For example,
the nucleotide sequence 5'-(C/T)CCTT-3' (SEQ ID NO:2) is a
topoisomerase recognition site that is bound specifically by most
poxvirus topoisomerases, including vaccinia virus DNA topoisomerase
I, which then can cleave the strand after the 3'-most thymidine of
the recognition site to produce a nucleotide sequence comprising
5'-(C/T)CCTT-PO.sub.4-TOPO (SEQ ID NO:2), i.e., a complex of the
topoisomerase covalently bound to the 3' phosphate through a
tyrosine residue in the topoisomerase (see Shuman, J. Biol. Chem.
266:11372-11379, 1991; Sekiguchi and Shuman, Nucl. Acids Res.
22:5360-5365, 1994; each of which is incorporated herein by
reference; see, also, U.S. Pat. No. 5,766,891; PCT/US95/16099; and
PCT/US98/12372 also incorporated herein by reference). In
comparison, the nucleotide sequence 5'-GCAACTT-3' (SEQ ID NO:3) is
the topoisomerase recognition site for type IA E. coli
topoisomerase III.
[0265] Recombination sites may be any nucleic acid that can serve
as a substrate in a recombination reaction. Such recombination
sites may be wild-type or naturally occurring recombination sites,
or modified, variant, derivative, or mutant recombination sites.
Examples of recombination sites for use in the invention include,
but are not limited to, phage-lambda recombination sites (such as
attP, attB, attL, and attR and mutants or derivatives thereof) and
recombination sites from other bacteriophages such as phi80, P22,
P2, 186, P4 and P1 (including Iox sites such as IoxP and
IoxP511).
[0266] Recombination proteins and mutant, modified, variant, or
derivative recombination sites include those described in U.S. Pat.
Nos. 5,888,732, 6,143,557, 6,171,861, 6,270,969, and 6,277,608 and
in U.S. application Ser. No. 09/438,358, filed Nov. 12, 1999, which
are specifically incorporated herein by reference. Mutated att
sites (e.g., attB 1-10, attP 1-10, attR 1-10 and attL 1-10) are
described in U.S. application Ser. No. 09/517,466, filed Mar. 2,
2000, and Ser. No. 09/732,914, filed Dec. 11, 2000 (published as US
2002/0007051-A1) the disclosures of which are specifically
incorporated herein by reference in their entirety. Other suitable
recombination sites and proteins are those associated with the
GATEWAY.RTM. Cloning Technology systems available from Invitrogen
Corporation, Carlsbad, Calif., and are described in the associated
product literature, the entire disclosures of all of which are
specifically incorporated herein by reference in their
entireties.
[0267] Recombination sites that may be present include att sites.
The 15 bp core region of the wild-type att site (GCTTTTTTAT ACTAA
(SEQ ID NO: 4)), which is identical in all wild-type att sites, may
be mutated in one or more positions. Engineered att sites that
specifically recombine with other engineered att sites can be
constructed by altering nucleotides in and near the 7 base pair
overlap region, bases 6-12, of the core region. Thus, recombination
sites suitable for use in the methods, molecules, compositions, and
vectors of the invention include, but are not limited to, those
with insertions, deletions or substitutions of one, two, three,
four, or more nucleotide bases within the 15 base pair core region
(see U.S. Pat. Nos. 5,888,732 and 6,277,608, which describe the
core region in further detail, and the disclosures of which are
incorporated herein by reference in their entireties).
Recombination sites suitable also include those with insertions,
deletions or substitutions of one, two, three, four, or more
nucleotide bases within the 15 base pair core region that are at
least 50% identical, at least 55% identical, at least 60%
identical, at least 65% identical, at least 70% identical, at least
75% identical, at least 80% identical, at least 85% identical, at
least 90% identical, or at least 95% identical to this 15 base pair
core region.
[0268] As a practical matter, whether any particular nucleic acid
molecule is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98% or 99% identical to, for instance, a given recombination
site nucleotide sequence or portion thereof can be determined
conventionally using known computer programs such as DNAsis
software (Hitachi Software, San Bruno, Calif.) for initial sequence
alignment followed by ESEE version 3.0 DNA/protein sequence
software (cabot@trog.mbb.sfu.ca) for multiple sequence alignments.
Alternatively, such determinations may be accomplished using the
BESTFIT program (Wisconsin Sequence Analysis Package, Genetics
Computer Group, University Research Park, 575 Science Drive,
Madison, Wis. 53711), which employs a local homology algorithm
(Smith and Waterman, Advances in Applied Mathematics 2: 482-489
(1981)) to find the best segment of homology between two sequences.
When using DNAsis, ESEE, BESTFIT or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set such that the percentage
of identity is calculated over the full length of the reference
nucleotide sequence and that gaps in homology of up to 5% of the
total number of nucleotides in the reference sequence are allowed.
Computer programs such as those discussed above may also be used to
determine percent identity and homology between two proteins at the
amino acid level.
[0269] Analogously, the core regions in attB1, attP1, attL1 and
attR1 are identical to one another, as are the core regions in
attB2, attP2, attL2 and attR2. Nucleic acid molecules suitable for
use with the invention also include those comprising insertions,
deletions or substitutions of one, two, three, four, or more
nucleotides within the seven base pair overlap region (TTTATAC (SEQ
ID NO:5), bases 6-12 in the core region). The overlap region is
defined by the cut sites for the integrase protein and is the
region where strand exchange takes place. Examples of such mutants,
fragments, variants and derivatives include, but are not limited
to, nucleic acid molecules in which (1) the thymine at position 1
of the seven bp overlap region has been deleted or substituted with
a guanine, cytosine, or adenine; (2) the thymine at position 2 of
the seven bp overlap region has been deleted or substituted with a
guanine, cytosine, or adenine; (3) the thymine at position 3 of the
seven bp overlap region has been deleted or substituted with a
guanine, cytosine, or adenine; (4) the adenine at position 4 of the
seven bp overlap region has been deleted or substituted with a
guanine, cytosine, or thymine; (5) the thymine at position 5 of the
seven bp overlap region has been deleted or substituted with a
guanine, cytosine, or adenine; (6) the adenine at position 6 of the
seven bp overlap region has been deleted or substituted with a
guanine, cytosine, or thymine; and (7) the cytosine at position 7
of the seven bp overlap region has been deleted or substituted with
a guanine, thymine, or adenine; or any combination of one or more
(e.g., two, three, four, five, etc.) such deletions and/or
substitutions within this seven bp overlap region. The nucleotide
sequences of representative seven base pair core regions are set
out below.
[0270] Altered att sites have been constructed that demonstrate
that (1) substitutions made within the first three positions of the
seven base pair overlap (TTTATAC; SEQ ID NO:6) strongly affect the
specificity of recombination, (2) substitutions made in the last
four positions (TTTATAC; SEQ ID NO:6) only partially alter
recombination specificity, and (3) nucleotide substitutions outside
of the seven bp overlap, but elsewhere within the 15 base pair core
region, do not affect specificity of recombination but do influence
the efficiency of recombination. Thus, nucleic acid molecules and
methods of the invention include those comprising or employing one,
two, three, four, five, six, eight, ten, or more recombination
sites which affect recombination specificity, particularly one or
more (e.g., one, two, three, four, five, six, eight, ten, twenty,
thirty, forty, fifty, etc.) different recombination sites that may
correspond substantially to the seven base pair overlap within the
15 base pair core region, having one or more mutations that affect
recombination specificity. Such molecules may comprise a consensus
sequence such as NNNATAC (SEQ ID NO:7) wherein "N" refers to any
nucleotide (i.e., may be A, G, T/U or C, or an analogue or
derivative thereof).
[0271] In particular embodiments, if one of the first three
nucleotides in the consensus sequence is a T/U, then at least one
of the other two of the first three nucleotides is not a T/U.
[0272] The core sequence of each att site (attB, attP, attL and
attR) can be divided into functional units consisting of integrase
binding sites, integrase cleavage sites and sequences that
determine specificity. Specificity determinants are defined by the
first three positions following the integrase top strand cleavage
site. These three positions are shown with underlining in the
following reference sequence: CAACTTTTTTATAC AAAGTTG (SEQ ID NO:8).
Modification of these three positions (64 possible combinations)
can be used to generate att sites that recombine with high
specificity with other att sites having the same sequence for the
first three nucleotides of the seven base pair overlap region. The
possible combinations of first three nucleotides of the overlap
region are shown in Table 7.
TABLE-US-00007 TABLE 7 Modifications of the First Three Nucleotides
of the att Site Seven Base Pair Overlap Region that Alter
Recombination Specificity. AAA CAA GAA TAA AAC CAC GAC TAC AAG CAG
GAG TAG AAT CAT GAT TAT ACA CCA GCA TCA ACC CCC GCC TCC ACG CCG GCG
TCG ACT CCT GCT TCT AGA CGA GGA TGA AGC CGC GGC TGC AGG CGG GGG TGG
AGT CGT GGT TGT ATA CTA GTA TTA ATC CTC GTC TTC ATG CTG GTG TTG ATT
CTT GTT TTT
[0273] Representative examples of suitable seven base pair att site
overlap regions of the vectors are shown in Table 8. The invention
further includes nucleic acid molecules comprising one or more
(e.g., one, two, three, four, five, six, eight, ten, twenty,
thirty, forty, fifty, etc.) nucleotides sequences set out in Table
8. Thus, for example, in one aspect, the invention provides nucleic
acid molecules comprising the nucleotide sequence GAAATAC (SEQ ID
NO:9), GATATAC (SEQ ID NO:10), ACAATAC (SEQ ID NO:11), or TGCATAC
(SEQ ID NO:12).
TABLE-US-00008 TABLE 8 Representative Examples of Seven Base Pair
att Site Overlap Regions Suitable for use in the recombination
sites of the Invention. Sequence SEQ ID NO: AAAATAC 13 AACATAC 14
AAGATAC 15 AATATAC 16 ACAATAC 17 ACCATAC 18 ACGATAC 19 ACTATAC 20
AGAATAC 21 AGCATAC 22 AGGATAC 23 AGTATAC 24 ATAATAC 25 ATCATAC 26
ATGATAC 27 ATTATAC 28 CAAATAC 29 CACATAC 30 CAGATAC 31 CATATAC 32
CCAATAC 33 CCCATAC 34 CCGATAC 35 CCTATAC 36 CGAATAC 37 CGCATAC 38
CGGATAC 39 CGTATAC 40 CTAATAC 41 CTCATAC 42 CTGATAC 43 CTTATAC 44
GAAATAC 45 GACATAC 46 GAGATAC 47 GATATAC 48 GCAATAC 49 GCCATAC 50
GCGATAC 51 GCTATAC 52 GGAATAC 53 GGCATAC 54 GGGATAC 55 GGTATAC 56
GTAATAC 57 GTCATAC 58 GTGATAC 59 GTTATAC 60 TAAATAC 61 TACATAC 62
TAGATAC 63 TATATAC 64 TCAATAC 65 TCCATAC 66 TCGATAC 67 TCTATAC 68
TGAATAC 69 TGCATAC 70 TGGATAC 71 TGTATAC 72 TTAATAC 73 TTCATAC 74
TTGATAC 75 TTTATAC 76
[0274] As noted above, alterations of nucleotides located 3' to the
three base pair region discussed above can also affect
recombination specificity. For example, alterations within the last
four positions of the seven base pair overlap can also affect
recombination specificity.
[0275] For example, mutated att sites that may be included in the
vectors of the kits include attB1 (AGCCTGCTTT TTTGTACAAA CTTGT (SEQ
ID NO:77)), attP1 (TACAGGTCAC TAATACCATC TAAGTAGTTG ATTCATAGTG
ACTGGATATG TTGTGTTTTA CAGTATTATG TAGTCTGTTT TTTATGCAAA ATCTAATTTA
ATATATTGAT ATTTATATCA TTTTACGTTT CTCGTTCAGC TTTTTTGTAC AAAGTTGGCA
TTATAAAAAA GCATTGCTCA TCAATTTGTT GCAACGAACA GGTCACTATC AGTCAAAATA
AAATCATTAT TTG (SEQ ID NO:78)), attL1 (CAAATAATGA TTTTATTTTG
ACTGATAGTG ACCTGTTCGT TGCAACAAAT TGATAAGCAA TGCTTTTTTA TAATGCCAAC
TTTGTACAAA AAAGCAGGCT (SEQ ID NO:79)), and attR1 (ACAAGTTTGT
ACAAAAAAGC TGAACGAGAA ACGTAAAATG ATATAAATAT CAATATATTA AATTAGATTT
TGCATAAAAA ACAGACTACA TAATACTGTA AAACACAACA TATCCAGTCA CTATG (SEQ
ID NO:80)). Table 9 provides the sequences of the regions
surrounding the core region for the wild type att sites (attB0, P0,
R0, and L0) as well as a variety of other suitable recombination
sites. Those skilled in the art will appreciated that the remainder
of the site may be the same as the corresponding site (B. P. L, or
R) listed above.
TABLE-US-00009 TABLE 9 Nucleotide sequences of att sites. attB0
AGCCTGCTTT TTTATACTAA CTTGAGC (SEQ ID NO:81) attP0 GTTCAGCTTT
TTTATACTAA GTTGGCA (SEQ ID NO:82) attL0 AGCCTGCTTT TTTATACTAA
GTTGGCA (SEQ ID NO:83) attR0 GTTCAGCTTT TTTATACTAA CTTGAGC (SEQ ID
NO:84) attB1 AGCCTGCTTT TTTGTACAAA CTTGT (SEQ ID NO:85) attP1
GTTCAGCTTT TTTGTACAAA GTTGGCA (SEQ ID NO:86) attL1 AGCCTGCTTT
TTTGTACAAA GTTGGCA (SEQ ID NO:87) attR1 GTTCAGCTTT TTTGTACAAA CTTGT
(SEQ ID NO:88) attB2 ACCCAGCTTT CTTGTACAAA GTGGT (SEQ ID NO:89)
attP2 GTTCAGCTTT CTTGTACAAA GTTGGCA (SEQ ID NO:90) attL2 ACCCAGCTTT
CTTGTACAAA GTTGGCA (SEQ ID NO:91) attR2 GTTCAGCTTT CTTGTACAAA GTGGT
(SEQ ID NO:92) attB5 CAACTTTATT ATACAAAGTT GT (SEQ ID NO:93) attP5
GTTCAACTTT ATTATACAAA GTTGGCA (SEQ ID NO:94) attL5 CAACTTTATT
ATACAAAGTT GGCA (SEQ ID NO:95) attR5 GTTCAACTTT ATTATACAAA GTTGT
(SEQ ID NO:96) attB11 CAACTTTTCT ATACAAAGTT GT (SEQ ID NO:97)
attP11 GTTCAACTTT TCTATACAAA GTTGGCA (SEQ ID NO:98) attL11
CAACTTTTCT ATACAAAGTT GGCA (SEQ ID NO:99) attR11 GTTCAACTTT
TCTATACAAA GTTGT (SEQ ID NO:100) attB17 CAACTTTTGT ATACAAAGTT GT
(SEQ ID NO:101) attP17 GTTCAACTTT TGTATACAAA GTTGGCA (SEQ ID
NO:102) attL17 CAACTTTTGT ATACAAAGTT GGCA (SEQ ID NO:103) attR17
GTTCAACTTT TGTATACAAA GTTGT (SEQ ID NO:104) attB19 CAACTTTTTC
GTACAAAGTT GT (SEQ ID NO:105) attP19 GTTCAACTTT TTCGTACAAA GTTGGCA
(SEQ ID NO:106) attL19 CAACTTTTTC GTACAAAGTT GGCA (SEQ ID NO:107)
attR19 GTTCAACTTT TTCGTACAAA GTTGT (SEQ ID NO:108) attB20
CAACTTTTTG GTACAAAGTT GT (SEQ ID NO:109) attP20 GTTCAACTTT
TTGGTACAAA GTTGGCA (SEQ ID NO:110) attL20 CAACTTTTTG GTACAAAGTT
GGCA (SEQ ID NO:111) attR20 GTTCAACTTT TTGGTACAAA GTTGT (SEQ ID
NO:112) attB21 CAACTTTTTAATACAAAGTT GT (SEQ ID NO:113) attP21
GTTCAACTTT TTAATACAAA GTTGGCA (SEQ ID NO:114) attL21
CAACTTTTTAATACAAAGTT GGCA (SEQ ID NO:115) attR21 GTTCAACTTT
TTAATACAAA GTTGT (SEQ ID NO:116)
[0276] Other recombination sites having unique specificity (i.e., a
first site will recombine with its corresponding site and will not
substantially recombine with a second site having a different
specificity) are known to those skilled in the art and may be
included in the vectors. Corresponding recombination proteins for
these systems may be used with the indicated recombination sites.
Other systems providing recombination sites and recombination
proteins include the FLP/FRT system from Saccharomyces cerevisiae,
the resolvase family (e.g., .gamma..delta., TndX, TnpX, Tn3
resolvase, Hin, Hjc, Gin, SpCCE1, ParA, and Cin), and IS231 and
other Bacillus thuringiensis transposable elements. Other suitable
recombination systems include the XerC and XerD recombinases and
the psi, dif and cer recombination sites in E. coli. Other suitable
recombination sites may be found in U.S. Pat. No. 5,851,808 issued
to Elledge and Liu which is specifically incorporated herein by
reference.
[0277] Those skilled in the art can readily optimize the conditions
for conducting the recombination reactions described herein without
the use of undue experimentation, based on the guidance provided
herein and available in the art (see, e.g., U.S. Pat. Nos.
5,888,732 and 6,277,608, which are specifically incorporated herein
by reference in their entireties). Such guidance for performing
recombination reactions with vectors of a kit may be included as
part of instructions included in the kit.
[0278] In a typical recombination reaction from, about 50 ng to
about 1000 ng of a second nucleic acid molecule may be contacted
with a first nucleic acid molecule under suitable reaction
conditions. Each nucleic acid molecule may be present in a molar
ratio of from about 25:1 to about 1:25 first nucleic acid
molecule:second nucleic acid molecule. In some embodiments, a first
nucleic acid molecule may be present at a molar ratio of from about
10:1 to 1:10 first nucleic acid molecule:second nucleic acid
molecule. In one embodiment, each nucleic acid molecule may be
present at a molar ratio of about 1:1 first nucleic acid
molecule:second nucleic acid molecule.
[0279] Typically, the nucleic acid molecules may be dissolved in an
aqueous buffer and added to the reaction mixture. One suitable set
of conditions is 4 .mu.l CLONASE.TM. enzyme mixture (e.g.,
Invitrogen Corporation, Cat. Nos. 11791-019 and 11789-013), 4 .mu.l
5.times. reaction buffer and nucleic acid and water to a final
volume of 20 .mu.l. This will typically result in the inclusion of
about 200 ng of Int and about 80 ng of IHF in a 20 .mu.l BP
reaction and about 150 ng Int, about 25 ng IHF and about 30 ng Xis
in a 20 .mu.I LR reaction.
[0280] Proteins for conducting an LR reaction may be stored in a
suitable buffer, for example, LR Storage Buffer, which may comprise
about 50 mM Tris at about pH 7.5, about 50 mM NaCl, about 0.25 mM
EDTA, about 2.5 mM Spermidine, and about 0.2 mg/ml BSA. When
stored, proteins for an LR reaction may be stored at a
concentration of about 37.5 ng/.quadrature.l INT, 10
ng/.quadrature.l IHF and 15 ng/.quadrature.l XIS. Proteins for
conducting a BP reaction may be stored in a suitable buffer, for
example, BP Storage Buffer, which may comprise about 25 mM Tris at
about pH 7.5, about 22 mM NaCl, about 5 mM EDTA, about 5 mM
Spermidine, about 1 mg/ml BSA, and about 0.0025% Triton X-100. When
stored, proteins for an BP reaction may be stored at a
concentration of about 37.5 ng/.quadrature.l INT and 20
ng/.quadrature.l IHF. One skilled in the art will recognize that
enzymatic activity may vary in different preparations of enzymes.
The amounts suggested above may be modified to adjust for the
amount of activity in any specific preparation of enzymes.
[0281] A suitable 5.times. reaction buffer for conducting
recombination reactions may comprise 100 mM Tris pH 7.5, 88 mM
NaCl, 20 mM EDTA, 20 mM Spermidine, and 4 mg/ml BSA. Thus, in a
recombination reaction, the final buffer concentrations may be 20
mM Tris pH 7.5, 17.6 mM NaCl, 4 mM EDTA, 4 mM Spermidine, and 0.8
mg/ml BSA. Those skilled in the art will appreciate that the final
reaction mixture may incorporate additional components added with
the reagents used to prepare the mixture, for example, a BP
reaction may include 0.005% Triton X-100 incorporated from the BP
CLONASE.TM..
[0282] In some embodiments, particularly those in which attL sites
are to be recombined with attR sites, the final reaction mixture
may include about 50 mM Tris HCl, pH 7.5, about 1 mM EDTA, about 1
mg/ml BSA, about 75 mM NaCl and about 7.5 mM spermidine in addition
to recombination enzymes and the nucleic acids to be combined. In
other embodiments, particularly those in which an attB site is to
be recombined with an attP site, the final reaction mixture may
include about 25 mM Tris HCl, pH 7.5, about 5 mM EDTA, about 1
mg/ml bovine serum albumin (BSA), about 22 mM NaCl, and about 5 mM
spermidine.
[0283] In some embodiments, particularly those in which attL sites
are to be recombined with attR sites, the final reaction mixture
may include about 40 mM Tris HCl, pH 7.5, about 1 mM EDTA, about 1
mg/ml BSA, about 64 mM NaCl and about 8 mM spermidine in addition
to recombination enzymes and the nucleic acids to be combined. One
of skill in the art will appreciate that the reaction conditions
may be varied somewhat without departing from the invention. For
example, the pH of the reaction may be varied from about 7.0 to
about 8.0; the concentration of buffer may be varied from about 25
mM to about 100 mM; the concentration of EDTA may be varied from
about 0.5 mM to about 2 mM; the concentration of NaCl may be varied
from about 25 mM to about 150 mM; and the concentration of BSA may
be varied from 0.5 mg/ml to about 5 mg/ml. In other embodiments,
particularly those in which an attB site is to be recombined with
an attP site, the final reaction mixture may include about 25 mM
Tris HCl, pH 7.5, about 5 mM EDTA, about 1 mg/ml bovine serum
albumin (BSA), about 22 mM NaCl, about 5 mM spermidine and about
0.005% detergent (e.g., Triton X-100).
[0284] One or more topoisomerases may be used to generate a
recombinant nucleic acid molecule comprising two or more nucleotide
sequences, any one or more of which may comprise, for example, all
or a portion of a nucleic acid sequence encoding a polypeptide
having a detectable activity such as .beta.-lactamase activity.
Topoisomerases may be used in combination with recombinational
cloning techniques described above. For example, a
topoisomerase-mediated reaction may be used to attach one or more
recombination sites to one or more nucleic acid segments. The
segments may then be further manipulated and combined using, for
example, recombinational cloning techniques.
[0285] A method for generating a double stranded recombinant
nucleic acid molecule covalently linked in one strand can be
performed by contacting a first nucleic acid molecule which has a
site-specific topoisomerase recognition site (e.g., a type IA or a
type II topoisomerase recognition site), or a cleavage product
thereof, at a 5' or 3' terminus, with a second (or other) nucleic
acid molecule, and optionally, a topoisomerase (e.g., a type IA,
type IB, and/or type 11 topoisomerase), such that the second
nucleotide sequence can be covalently attached to the first
nucleotide sequence.
[0286] Generation of a double stranded recombinant nucleic acid
molecule covalently linked in both strands can be performed, for
example, by contacting a first nucleic acid molecule having a first
end and a second end, wherein, at the first end or second end or
both ends, the first nucleic acid molecule has a topoisomerase
recognition site (or cleavage product thereof) at or near the 5' or
3' terminus; at least a second nucleic acid molecule having a first
end and a second end, wherein, at the first end or second end or
both ends, the at least second double stranded nucleotide sequence
has a topoisomerase recognition site (or cleavage product thereof)
at or near a 5' or 3' terminus; and at least one site specific
topoisomerase (e.g., a type IA and/or a type IB topoisomerase),
under conditions such that all components are in contact and the
topoisomerase can effect its activity. In one embodiment, the
method is performed by contacting a first nucleic acid molecule and
a second (or other) nucleic acid molecule, each of which has a
topoisomerase recognition site in addition to viral sequences an/or
sequences of interest, or a cleavage product thereof, at the 3'
termini or at the 5' termini of two ends to be covalently linked.
In another embodiment, the method is performed by contacting a
first nucleic acid molecule having a topoisomerase recognition
site, or cleavage product thereof, at the 5' terminus and the 3'
terminus of at least one end, and a second (or other) nucleic acid
molecule having a 3' hydroxyl group and a 5' hydroxyl group at the
end to be linked to the end of the first nucleic acid molecule
containing the recognition sites.
[0287] Topoisomerases are categorized as type I, including type IA
and type IB topoisomerases, which cleave a single strand of a
double stranded nucleic acid molecule, and type II topoisomerases
(gyrases), which cleave both strands of a nucleic acid molecule.
Type IA and IB topoisomerases cleave one strand of a nucleic acid
molecule. Cleavage of a nucleic acid molecule by type IA
topoisomerases generates a 5' phosphate and a 3' hydroxyl at the
cleavage site, with the type IA topoisomerase covalently binding to
the 5' terminus of a cleaved strand. In comparison, cleavage of a
nucleic acid molecule by type IB topoisomerases generates a 3'
phosphate and a 5' hydroxyl at the cleavage site, with the type IB
topoisomerase covalently binding to the 3' terminus of a cleaved
strand. As disclosed herein, type I and type II topoisomerases, as
well as catalytic domains and mutant forms thereof, are useful for
generating double stranded recombinant nucleic acid molecules
covalently linked in both strands.
[0288] Type IA topoisomerases include E. coi topoisomerase I, E.
coli topoisomerase III, eukaryotic topoisomerase II, archeal
reverse gyrase, yeast topoisomerase III, Drosophila topoisomerase
III, human topoisomerase III, Streptococcus pneumoniae
topoisomerase III, and the like, including other type IA
topoisomerases (see Berger, Biochim. Biophys. Acta 1400:3-18, 1998;
DiGate and Marians, J. Biol. Chem. 264:17924-17930, 1989; Kim and
Wang, J. Biol. Chem. 267:17178-17185, 1992; Wilson, et al., J.
Biol. Chem. 275:1533-1540, 2000; Hanai, et al., Proc. Natl. Acad.
Sci., USA 93:3653-3657, 1996, U.S. Pat. No. 6,277,620, each of
which is incorporated herein by reference). E. coli topoisomerase
III, which is a type IA topoisomerase that recognizes, binds to and
cleaves the sequence 5'-GCAACTT-3', can be particularly useful
(Zhang, et al., J. Biol. Chem. 270:23700-23705, 1995, which is
incorporated herein by reference). A homolog, the traE protein of
plasmid RP4, has been described by Li, et al., J. Biol. Chem.
272:19582-19587 (1997) and can also be used. A DNA-protein adduct
is formed with the enzyme covalently binding to the 5'-thymidine
residue, with cleavage occurring between the two thymidine
residues.
[0289] Type IB topoisomerases include the nuclear type I
topoisomerases present in all eukaryotic cells and those encoded by
vaccinia and other cellular poxviruses (see Cheng, et al., Cell
92:841-850, 1998, which is incorporated herein by reference). The
eukaryotic type IB topoisomerases are exemplified by those
expressed in yeast, Drosophila and mammalian cells, including human
cells (see Caron and Wang, Adv. Pharmacol. 29B,:271-297, 1994;
Gupta, et al., Biochim. Biophys. Acta 1262:1-14, 1995, each of
which is incorporated herein by reference; see, also, Berger,
supra, 1998). Viral type IB topoisomerases are exemplified by those
produced by the vertebrate poxviruses (vaccinia, Shope fibroma
virus, ORF virus, fowlpox virus, and molluscum contagiosum virus),
and the insect poxvirus (Amsacta moorei entomopoxvirus) (see
Shuman, Biochim. Biophys. Acta 1400:321-337, 1998; Petersen, et
al., Virology 230:197-206, 1997; Shuman and Prescott, Proc. Natl.
Acad. Sci., USA 84:7478-7482, 1987; Shuman, J. Biol. Chem.
269:32678-32684, 1994; U.S. Pat. No. 5,766,891; PCT/US95/16099;
PCT/US98/12372, each of which is incorporated herein by reference;
see, also, Cheng, et al., supra, 1998).
[0290] Type II topoisomerases include, for example, bacterial
gyrase, bacterial DNA topoisomerase IV, eukaryotic DNA
topoisomerase II, and T-even phage encoded DNA topoisomerases (Roca
and Wang, Cell 71:833-840, 1992; Wang, J. Biol. Chem.
266:6659-6662, 1991, each of which is incorporated herein by
reference; Berger, supra, 1998;). Like the type IB topoisomerases,
the type II topoisomerases have both cleaving and ligating
activities. In addition, like type IB topoisomerase, substrate
nucleic acid molecules can be prepared such that the type II
topoisomerase can form a covalent linkage to one strand at a
cleavage site. For example, calf thymus type II topoisomerase can
cleave a substrate nucleic acid molecule containing a 5' recessed
topoisomerase recognition site positioned three nucleotides from
the 5' end, resulting in dissociation of the three nucleotide
sequence 5' to the cleavage site and covalent binding the of the
topoisomerase to the 5' terminus of the nucleic acid molecule
(Andersen, et al., supra, 1991). Furthermore, upon contacting such
a type II topoisomerase charged nucleic acid molecule with a second
nucleotide sequence containing a 3' hydroxyl group, the type II
topoisomerase can ligate the sequences together, and then is
released from the recombinant nucleic acid molecule. As such, type
II topoisomerases also are useful.
[0291] The various topoisomerases exhibit a range of sequence
specificity, and any may be included in the disclosed kits, for
example, as components of the expression system. For example, type
II topoisomerases can bind to a variety of sequences, but cleave at
a highly specific recognition site (see Andersen, et al., J. Biol.
Chem. 266:9203-9210, 1991, which is incorporated herein by
reference.). In comparison, the type IB topoisomerases include site
specific topoisomerases, which bind to and cleave a specific
nucleotide sequence ("topoisomerase recognition site"). Upon
cleavage of a nucleic acid molecule by a topoisomerase, for
example, a type IB topoisomerase, the energy of the phosphodiester
bond is conserved via the formation of a phosphotyrosyl linkage
between a specific tyrosine residue in the topoisomerase and the 3'
nucleotide of the topoisomerase recognition site. Where the
topoisomerase cleavage site is near the 3' terminus of the nucleic
acid molecule, the downstream sequence (3' to the cleavage site)
can dissociate, leaving a nucleic acid molecule having the
topoisomerase covalently bound to the newly generated 3' end.
[0292] In particular embodiments, the 5' termini of the ends of the
nucleotide sequences to be linked by a type IB topoisomerase
according to a method of certain aspects of the invention contain
complementary 5' overhanging sequences, which can facilitate the
initial association of the nucleotide sequences, including, if
desired, in a predetermined directional orientation. Alternatively,
the 5' termini of the ends of the nucleotide sequences to be linked
by a type IB topoisomerase according to a method of certain aspects
of the invention contain complementary 5' sequences wherein one of
the sequences contains a 5' overhanging sequence and the other
nucleotide sequence contains a complementary sequence at a blunt
end of a 5' terminus, to facilitate the initial association of the
nucleotide sequences through strand invasion, including, if
desired, in a predetermined directional orientation. The term "5'
overhang" or "5' overhanging sequence" is used herein to refer to a
strand of a nucleic acid molecule that extends in a 5' direction
beyond the terminus of the complementary strand of the nucleic acid
molecule. Conveniently, a 5' overhang can be produced as a result
of site specific cleavage of a nucleic acid molecule by a type IB
topoisomerase.
[0293] In particular embodiments, the 3' termini of the ends of the
nucleotide sequences to be linked by a type IA topoisomerase
contain complementary 3' overhanging sequences, which can
facilitate the initial association of the nucleotide sequences,
including, if desired, in a predetermined directional orientation.
Alternatively, the 3' termini of the ends of the nucleotide
sequences to be linked by a topoisomerase (e.g., a type IA or a
type II topoisomerase) according to a method of certain aspects of
the invention contain complementary 3' sequences wherein one of the
sequences contains a 3' overhanging sequence and the other
nucleotide sequence contains a complementary sequence at a blunt
end of a 3' terminus, to facilitate the initial association of the
nucleotide sequences through strand invasion, including, if
desired, in a predetermined directional orientation. The term "3'
overhang" or "3' overhanging sequence" is used herein to refer to a
strand of a nucleic acid molecule that extends in a 3' direction
beyond the terminus of the complementary strand of the nucleic acid
molecule. Conveniently, a 3' overhang can be produced upon cleavage
by a type IA or type II topoisomerase.
[0294] The 3' or 5' overhanging sequences can have any sequence,
though generally the sequences are selected such that they allow
ligation of a predetermined end of one nucleic acid molecule to a
predetermined end of a second nucleotide sequence according to a
method of the invention. As such, while the 3' or 5' overhangs can
be palindromic, they generally are not because nucleic acid
molecules having palindromic overhangs can associate with each
other, thus reducing the yield of a ds recombinant nucleic acid
molecule covalently linked in both strands comprising two or more
nucleic acid molecules in a predetermined orientation.
[0295] Any number of methods may be used to add topoisomerase
cleavage sites to nucleic acid molecules and/or generate nucleic
acid molecules to which topoisomerase is covalently bound. Examples
of such methods are provided in U.S. Patent Publication No.
2003-0186233, the entire disclosure of which is incorporated herein
by reference.
[0296] Mutant tRNA molecules that recognize what are ordinarily
stop codons suppress the termination of translation of an mRNA
molecule and are termed suppressor tRNAs, and also may be included
in the disclosed kits. Three codons are used by both eukaryotes and
prokaryotes to signal the end of gene. When transcribed into mRNA,
the codons have the following sequences: UAG (amber), UGA (opal)
and UAA (ochre). Under most circumstances, the cell does not
contain any tRNA molecules that recognize these codons. Thus, when
a ribosome translating an mRNA reaches one of these codons, the
ribosome stalls and falls of the RNA, terminating translation of
the mRNA. The release of the ribosome from the mRNA is mediated by
specific factors (see S. Mottagui-Tabar, Nucleic Acids Research
26(11), 2789, 1998). A gene with an in-frame stop codon (TAA, TAG,
or TGA) will ordinarily encode a protein with a native carboxy
terminus. However, suppressor tRNAs can result in the insertion of
amino acids and continuation of translation past stop codons.
[0297] A number of such suppressor tRNAs have been found. Examples
include, but are not limited to, the supE, supP, supD, supF and
supZ suppressors, which suppress the termination of translation of
the amber stop codon, supB, gIT, supL, supN, supC and supM
suppressors, which suppress the function of the ochre stop codon
and glyT, trpT and Su-9 suppressors, which suppress the function of
the opal stop codon. In general, suppressor tRNAs contain one or
more mutations in the anti-codon loop of the tRNA that allows the
tRNA to base pair with a codon that ordinarily functions as a stop
codon. The mutant tRNA is charged with its cognate amino acid
residue and the cognate amino acid residue is inserted into the
translating polypeptide when the stop codon is encountered. For a
more detailed discussion of suppressor tRNAs, the reader may
consult Eggertsson, et al., (1988) Microbiological Review
52(3):354-374, and Engleerg-Kukla, et al. (1996) in Escherichia
coli and Salmonella Cellular and Molecular Biology, Chapter 60, pps
909-921, Neidhardt, et al. eds., ASM Press, Washington, DC.
[0298] Mutations that enhance the efficiency of termination
suppressors, i.e., increase the read through of the stop codon,
have been identified. These include, but are not limited to,
mutations in the uar gene (also known as the prfA gene), mutations
in the ups gene, mutations in the sueA, sueB and sueC genes,
mutations in the rpsD (ramA) and rpsE (spcA) genes and mutations in
the rpIL gene.
[0299] Under ordinary circumstances, host cells would not be
expected to be healthy if suppression of stop codons is too
efficient. This is because of the thousands or tens of thousands of
genes in a genome, a significant fraction will naturally have one
of the three stop codons; complete read-through of these would
result in a large number of aberrant proteins containing additional
amino acids at their carboxy termini. If some level of suppressing
tRNA is present, there is a race between the incorporation of the
amino acid and the release of the ribosome. Higher levels of tRNA
may lead to more read-through although other factors, such as the
codon context, can influence the efficiency of suppression.
[0300] Organisms ordinarily have multiple genes for tRNAs. Combined
with the redundancy of the genetic code (multiple codons for many
of the amino acids), mutation of one tRNA gene to a suppressor tRNA
status does not lead to high levels of suppression. The TAA stop
codon is the strongest, and most difficult to suppress. The TGA is
the weakest, and naturally (in E. coli) leaks to the extent of 3%.
The TAG (amber) codon is relatively tight, with a read-through of
.about.1% without suppression. In addition, the amber codon can be
suppressed with efficiencies on the order of 50% with naturally
occurring suppressor mutants. Suppression in some organisms (e.g.,
E. coli) may be enhanced when the nucleotide following the stop
codon is an adenosine. Thus, the present invention contemplates
nucleic acid molecules having a stop codon followed by an adenosine
(e.g., having the sequence TAGA, TAAA, and/or TGAA).
[0301] Cells which may used in the disclosed methods and may be
included as a component of the disclosed kits include both
prokaryotic and eukaryotic cells. Particular examples of cells,
specifically mammalian cells include baby hamster kidney (BHK)
cells (ATCC No. CCL10), mouse L cells (ATCC No. CCLI.3), Jurkats
(ATCC No. TIB 152) and 153 DG44 cells (see, Chasin (1986) Cell.
Molec. Genet. 12: 555) human embryonic kidney (HEK) cells (ATCC No.
CRL1573), Chinese hamster ovary (CHO) cells (ATCC Nos. CRL9618,
CCL61, CRL9096), PC12 cells (ATCC No. CRL17.21) and COS-7 cells
(ATCC No. CRL1651). Additional examples of mammalian host cells
that could be used include, human Hela 293, and H9 cells, mouse
NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, and quail QC1-3
cells.
[0302] Such cells can, for example, further include nucleic acid
sequences that code for heterologous cell surface proteins and
thus, are desirably readily and efficiently transfected with
appropriate vectors. Particularly useful cells include Jurkat cells
and HEK 293 cells, such as those described in U.S. Pat. No.
5,024,939 and by Stillman et al. (1985) Mol. Cell. Biol. 5:
2051-2060.
[0303] Exemplary proteins that may be expressed by cells include,
but are not limited to, surface receptors and ion channels. Surface
receptors include, but are not limited to, muscarinic receptors
[for example, human M2 (GenBank accession #M16404), rat M3 (GenBank
accession #M16407), human M4 (GenBank accession #M16405), and human
M5 (Bonner, et al., 1988 Neuron 1, pp. 403-410)] and the like,
neuronal nicotinic acetylcholine receptors, GABA receptors,
glutamate receptors, adrenergic receptors, dopamine receptors, NGF
receptors, and serotonin receptors. Ion channels include, calcium
channels, potassium ion channels, sodium ion channels, chloride ion
channels. Intracellular receptors may also be included in the
cells, such as estrogen receptors, glucocorticoid receptors,
androgen receptors, progesterone receptors, and mineralocorticoid
receptor. In addition, transcription factors and kinases can also
be present in the cells. In particular embodiments, the influence
of compounds, such as toxins, on the receptors and other components
of the cells are determined by their effect on expression of
nucleic acid sequences under their control, which nucleic acid
sequences also code for a peptide having .beta.-lactamase
activity.
[0304] A detailed description of the invention having been provided
above, the following examples are given for the purpose of
illustrating the invention and shall not be construed as being a
limitation on the scope of the invention or claims.
EXAMPLES
[0305] The materials and methods of the present invention are
further illustrated by the examples which follow. These examples
are offered to illustrate, but not to limit, the claimed
invention.
Example 1
7-phenoxyacetamidocephalosporanic acid (1)
[0306] Phenoxyacetic acid (0.50 g, 3.3 mmol) was dissolved in 5 mL
of methylene chloride and the solution was cooled in an ice/water
bath. (COCl).sub.2 was added to the solution followed by 3 drops of
DMF. The reaction mixture was stirred for 20 min in the bath before
the solvent was removed in vacuo. The residue was dissolved in
toluene, which was removed in vacuo. The residue was then dissolved
in 5 mL of dioxane and added dropwise to a stirred and ice/water
bath-cooled mixture of 7-aminocephalosporanic acid (0.60 g, 2.2
mmol), 1 M Et.sub.3NH.sub.2CO.sub.3 buffer (13.5 mL, 13.5 mmol) and
dioxane (5 mL). After the reaction mixture was stirred overnight at
rt, the solvent was removed in vacuo. The residue was dissolved in
water, which was removed in vacuo. The residue was dissolved in
chloroform and loaded onto a silica gel column. The resulting
solution was eluted using chloroform:methanol:acetic acid
(6:2:0.1). The product-containing fractions were concentrated. The
residue was dissolved in toluene, which was removed in vacuo. The
residue was dissolved in 50 mL of 10% HCl and extracted with ethyl
acetate (3.times.30 mL). The combined extracts were washed with
water (2.times.20 mL), brine (20 mL), and dried over sodium
sulfate. After filtering, the solvent was removed in vacuo to yield
1 (0.676 g, 76%).
Example 2
Preparation of b: Compounds 2-3
a) Allyl
7,8-(phenoxy)acetamido)-3-(acetoxymethyl)-3-cephem-4-carboxylate
(2)
##STR00068##
[0308] 7-Phenoxyacetamidocephalosporanic acid 1 (0.676 g, 1.66
mmol) was dissolved in 20 mL of CH.sub.3CN. i-Pr.sub.2NEt (0.38 mL,
2.2 mmol) and allyl bromide (0.16 mL, 1.8 mmol) were added to the
reaction mixture, which was then stirred for 72 h at rt. The
solvent was removed in vacuo, dissolved in 30 mL of 5% HCl, and
extracted with ethyl acetate (3.times.30 mL). The combined extracts
were washed with water (30 mL), brine (30 mL), and dried over
sodium sulfate. After filtering, the solvent was removed in vacuo.
The residue was dissolved in chloroform and loaded onto a silica
gel column, which was eluted using chloroform:ethyl acetate (5:1).
The eluate containing the desired product was then evaporated to
yield 2 (0.334 g, 45%).
b) Allyl
7,8-((2-thien-2-yl)acetamido)-3-(acetoxymethyl)-3-cephem-4-carbox-
ylate (3)
##STR00069##
[0310] Compound 3 was prepared from cephalothin sodium salt (Sigma)
according to the literature procedure of Jungheim et al., J. Org.
Chem., 57: 2334-2340 (1992).
Example 3
Preparation of c: Compounds 4-5
a) Allyl
7.beta.-(phenoxy)acetamido)-3-(iodomethyl)-3-cephem-4-carboxylate
(4)
##STR00070##
[0312] Compound 2 (0.288 g, 0.646 mmol) was dissolved in 5 mL of
dry methylene chloride and the solution was cooled in an ice/water
bath. Me.sub.3Sil (0.20 mL, 1.4 mmol) was added to the cooled
solution. The reaction mixture was stirred for 20 min in the cooled
bath, then stirred for 40 min at rt and diluted with ethyl acetate
(80 mL). The solution was washed with 10% sodium thiosulfate
(2.times.30 mL), sat. sodium bicarbonate (2.times.30 mL), brine (30
mL), and dried over sodium sulfate. After filtering, the solvent
was removed in vacuo to yield 4 (0.248 g, 75%).
b) Allyl
7.beta.-((2-thien-2-yl)acetamido)-3-(iodomethyl)-3-cephem-4-carbo-
xylate (5)
##STR00071##
[0314] Compound 5 was prepared from 3 according to the literature
procedure of Jungheim et al., J. Org. Chem., 57: 2334-2340
(1992).
Example 4
Preparation of f: Compounds 6-8
a) Fluorescein 3-O-butyl ether, n-butyl ester (6)
##STR00072##
[0316] Fluorescein (2.0 g, 6.0 mmol) was dissolved in 50 mL of DMF.
Powdered K.sub.2CO.sub.3 (2.0 g, 14 mmol) and bromobutane (6.4 mL,
60 mmol) were added to the solution and the mixture was stirred at
80.degree. C. for 3 h. The solids were filtered off and washed with
ethyl acetate. The ethyl acetate washings were then combined with
the DMF solution and diluted with 150 mL of 10% HCl. An extraction
was performed using ethyl acetate (3.times.40 mL). The combined
ethyl acetate extracts were then washed with water (3.times.40 mL),
brine (40 mL), and dried over sodium sulfate. After filtering, the
solvent was removed in vacuo to yield 6 (2.23 g, 84%).
b) Fluorescein 3-O-butyl ether (7)
##STR00073##
[0318] Compound 6 (2.23 g, 5.02 mmol) was dissolved in 100 mL of
dioxane. 1 M aqueous KOH (30 mL, 30 mmol) was added and the mixture
was stirred at rt for 6 h. The solution was diluted with 10% HCl
(300 mL) and the product was extracted with ethyl acetate
(4.times.80 mL). The combined extracts were washed with water
(3.times.60 mL), brine (60 mL), and dried over sodium sulfate.
After filtering, the solvent was removed in vacuo. The crude
product was dissolved in chloroform and purified by silica gel
column chromatography using chloroform:ethyl acetate (5:1) as an
eluent. Evaporation of eluate provided 7 as an orange powder (1.0
g, 51%).
c) Fluorescein 3-O-acetic acid ether (8)
##STR00074##
[0320] Fluorescein (3.00 g, 9.03 mmol) was dissolved in 30 mL of
DMF. Powdered potassium carbonate (1.26 g, 9.13 mmol) and KI (0.30
g, 1.8 mmol) were added to the solution followed by the addition of
allyl bromoacetate (1.05 mL, 9.04 mmol). The reaction mixture was
stirred for 20 h at rt and then diluted with 10% HCl (50 mL). The
reaction mixture was then extracted with ethyl acetate (3.times.30
mL). The combined ethyl acetate extracts were then washed with
water (3.times.30 mL), brine (30 mL), and dried over sodium
sulfate. After filtering, the solvent was removed in vacuo. The
residue was dissolved in chloroform and loaded onto a silica gel
column, which was eluted using chloroform:ethyl acetate (2:1).
Evaporation of the eluate yielded 8 as an orange powder (0.64 g,
16%).
Example 5
Preparation of d and/or e: Compounds 9-22
a) Allyl
7.beta.-(phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phe-
nyl)oxy)methyl)-3-cephem-4-carboxylate (9)
Allyl
7.beta.-(phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phenyl-
)oxy)methyl)-2-cephem-4-carboxylate (10)
##STR00075##
[0322] 2-(2-Hydroxy-phenyl)-3H-quinazolin-4-one (0.150 g, 0.630
mmol) was suspended in 5 mL of DMF. Sodium methoxide in MeOH (25%
solution, 0.11 mL, 0.48 mmol) was then added to the suspension. The
suspension soon became clear and was then cooled using an ice/water
bath. Compound 4 (0.248 g, 0.482 mmol) was dissolved in 3 mL of DMF
and added dropwise to the oxoquinazolinone solution with stirring.
The reaction mixture was stirred for 1.5 h at the bath temperature
and then diluted with 10% HCl (50 mL). The reaction mixture was
then extracted with ethyl acetate (30+3.times.20 mL). The combined
ethyl acetate extracts were then washed with water (4.times.20 mL),
brine (20 mL), and dried over sodium sulfate. After filtering, the
solvent was removed in vacuo. The residue was suspended in
chloroform and loaded onto a silica gel column, which was eluted
using chloroform:ethyl acetate (5:1). Evaporation of the eluate
yielded two separable isomers, 9 and 10 (0.075 g, 25%).
b) Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-
-yl)-(phenyl)oxy)methyl)-3-cephem-4-carboxylate (11)
Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl-
)-(phenyl)oxy)methyl)-2-cephem-4-carboxylate (12)
##STR00076##
[0324] 2-(2-Hydroxy-phenyl)-3H-quinazolin-4-one (2.64 g, 5.24 mmol)
was suspended in 30 mL of DMF. Sodium methoxide in MeOH (25%
solution, 0.12 mL, 0.525 mmol) was then added to the suspension.
The suspension soon became clear and was then cooled using an
ice/water bath. 5 (1.62 g, 6.81 mmol) was dissolved in 15 mL of DMF
and added to the oxoquinazoline solution dropwise with stirring.
The reaction mixture was stirred for 1.5 h at the bath temperature
and then diluted with 10% HCl (150 mL). The reaction mixture was
then extracted with ethyl acetate (4.times.40 mL). The combined
ethyl acetate extracts were then washed with water (4.times.40 mL),
brine (40 mL), and dried over sodium sulfate. After filtering, the
solvent was removed in vacuo. The residue was suspended in
chloroform and loaded onto a silica gel column. Less polar
impurities were eluted with chloroform:ethyl acetate (10:1). The
desired product was eluted with chloroform:ethyl acetate (5:1).
Evaporation of the eluate yielded two separable isomers, 11 and 12
(1.54 g, 48%).
c) Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-(((2-((6-chloro)-3H-quinazoli-
ne-4-one-2-yl)-(4-chlorophenyl)oxy)methyl)-3-cephem-4-carboxylate
(13)
Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-((2-((6-chloro)-3H-quinazoline-4-
-one-2-yl)-(4-chlorophenyloxy)methyl)-2-cephem-4-carboxylate
(14)
##STR00077##
[0326] 3H-quinazolin-4-one (0.299 g, 0.973 mmol) was suspended in 5
mL of DMF. Sodium methoxide in MeOH (25% solution, 0.148 mL, 0.647
mmol) was then added to the suspension, which was stirred for 30
min. Compound 5 (0.327 g, 0.649 mmol) was dissolved in 4 mL of DMF
and added to the above suspension. The reaction mixture was stirred
for 2 h at rt, then diluted with 5% HCl (50 mL). The reaction
mixture was then extracted with ethyl acetate (3.times.30 mL). The
combined ethyl acetate extracts were then washed with brine (30
mL), and dried over sodium sulfate. After filtering, the solvent
was removed in vacuo. The residue was mixed with chloroform
(.about.20 mL) and loaded onto a silica gel column. Less polar
impurities were eluted with chloroform:ethyl acetate (10:1). The
desired product was eluted with chloroform:ethyl acetate (5:1).
Evaporation of the eluate yielded two separable isomers, 13 and 14
(0.138 g, 31%).
d) Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-((9H-(1,3-dichloro-9,9-dimeth-
ylacridin-2-one)-7-oxy)methyl)-3-cephem-4-carboxylate (15)
##STR00078##
[0328] 7-Hydroxy-9H-(1,3-dichloro-9,9-dimethylacridin-2-one) (0.361
g, 1.17 mmol) was suspended in 90 mL of acetone. Powdered
K.sub.2CO.sub.3 (0.16 g, 1.16 mmol) was added to the suspension
followed by addition of 5 (0.591 g, 1.17 mmol). The reaction
mixture was stirred at rt for 4 h and concentrated in vacuo. The
residue was mixed with 50 mL of 5% HCl and the solution was
extracted with ethyl acetate (3.times.30 mL). The combined ethyl
acetate extracts were washed with water (30 mL), brine (30 mL), and
dried over sodium sulfate. After filtering, the solvent was removed
in vacuo. The residue was suspended in chloroform and loaded onto a
silica gel column, which was eluted using hexanes:ethyl acetate
(4:3). Evaporation of the eluate yielded 15 as a brown wax (0.173
g, 22%).
e) Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-(((4-methylumbelliferyl)-7-ox-
y)methyl)-3-cephem-4-carboxylate (16)
##STR00079##
[0330] 7-Hydroxy-4-methylcoumarin (0.212 g, 1.20 mmol) was
dissolved in 3 mL of DMF. Sodium methoxide (25% solution in
methanol, 0.206 mL, 0.901 mmol) was added to the solution and the
mixture was cooled down using ice/water bath. 5 (0.303 g, 0.601
mmol) was added to the mixture as a solution in 3 mL of DMF. The
reaction mixture was stirred at bath temperature for 1 h, and then
diluted with 5% HCl (60 mL). The reaction mixture was then
extracted with ethyl acetate (3.times.25 mL). The combined ethyl
acetate extracts were washed with water (3.times.15 mL), brine (20
mL), and dried over sodium sulfate. After filtering, the solvent
was removed in vacuo. The residue was dissolved in chloroform and
loaded onto a silica gel column. Less polar impurities were eluted
with hexanes:ethyl acetate (1:1). The desired product was eluted
using hexanes:ethyl acetate (4:5). Evaporation of the eluate
yielded 16 as a viscous oil (0.05 g, 15%).
f) Allyl
7.beta.-(2-(thien-2-yl)acetamido)-3-((((6,8-difluoro)-4-methylumb-
elliferyl)-7-oxy)methyl)-3-cephem-4-carboxylate (17)
##STR00080##
[0332] 6,8-Difluoro-7-hydroxy-4-methylcoumarin (0.209 g, 0.986
mmol) was dissolved in 3 mL of DMF and the solution was cooled in
an ice/water bath. Sodium methoxide (25% in MeOH, 0.15 mL, 0.66
mmol) was added to the solution followed by addition of 5 (0.332 g,
0.659 mmol) dissolved in 3 mL of DMF. The reaction mixture was
stirred for 1.5 h at bath temperature, and then diluted with 5% HCl
(80 mL). The reaction mixture was then extracted with ethyl acetate
(3.times.30 mL). The combined ethyl acetate extracts were washed
with water (40 mL), brine (20 mL), and dried over sodium sulfate.
After filtering, the solvent was removed in vacuo. The residue was
dissolved in chloroform and loaded onto a silica gel column, which
was eluted with chloroform:ethyl acetate (5:1). Evaporation of the
eluate yielded 17 as a white powder (0.22 g, 57%).
g) Preparation of (18) and (19)
##STR00081##
[0334] Compound 5 (0.33 g, 0.65 mmol) was dissolved in 10 mL of
acetone. Butyl-fluorescein (0.25 g, 0.64 mmol) was added to the
solution followed by addition of powdered potassium carbonate (0.09
g, 0.6 mmol). The mixture was stirred at rt for 2.5 h and diluted
with 10% HCl (50 mL). The reaction mixture was then extracted with
ethyl acetate (2.times.40 mL). The combined ethyl acetate extracts
were washed with water (30 mL), brine (30 mL), and dried over
sodium sulfate. After filtering, the solvent was removed in vacuo.
The residue was dissolved in chloroform and loaded onto a silica
gel column, which was eluted with chloroform:ethyl acetate (10:1).
Evaporation of the eluate yielded two separable isomers, 18 and 19,
as an orange powder (0.075 g, 15%).
h) Preparation of (20) and (21)
##STR00082##
[0336] Compound 5 (0.744 g, 1.48 mmol) and O-alkylated fluorescein
(0.423 g, 0.984 mmol) were dissolved in 15 mL of acetone. Powdered
potassium carbonate (0.204 g, 1.48 mmol) was added to the solution
and reaction mixture was stirred overnight at rt. The mixture was
concentrated in vacuo, and the residue was mixed with 100 mL of
ethyl acetate. An extraction was then performed with 1 M KOH
solution (2.times.20 mL). The combined ethyl acetate extracts were
washed with water (30 mL), brine (30 mL), and dried over sodium
sulfate. After filtering, the solvent was removed in vacuo. The
residue was dissolved in chloroform and loaded onto a silica gel
column. Less polar impurities were eluted with chloroform:ethyl
acetate (10:1). The desired product was eluted using
chloroform:ethyl acetate (5:1). Evaporation of the eluate yielded
two separable isomers, 20 and 21, as a yellow glass (0.231 g,
19%).
i) Preparation of (22)
##STR00083##
[0338] Fluorescein (0.20 g, 0.060 mmol) is dissolved in dioxane (20
mL), then diluted with toluene (50 mL). 5 (0.18 mmol) is added,
followed by silver carbonate (0.20 mmol). The resulting mixture is
heated at 50.degree. C. for 48 h, then cooled and filtered. 22 is
identified in the filtrate by TLC analysis (Rf 0.6, 5%
MeOH/chloroform) as a non-fluorescent quenching spot, in contrast
to fluorescing impurities. Compound 22 is purified by flash
chromatography using methanol in chloroform to afford a pale yellow
powder.
Example 6
Preparation of g and/or h: Compounds 23-36
a)
7.beta.-(Phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phenyl)ox-
y)methyl)-3-cephem-4-carboxylic acid (23)
7.beta.-(Phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phenyl)oxy)m-
ethyl)-2-cephem-4-carboxylic acid (24)
##STR00084##
[0340] Compound 9 and 10 (0.071 g, 0.114 mmol) were dissolved in 5
mL of dry methylene chloride. Sodium 2-ethylhexanoate (0.019 g,
0.11 mmol) was dissolved in 2 mL of ethyl acetate. After these two
solutions were mixed together, PPh.sub.3 (0.01 g, 0.04 mmol) and
Pd(PPh.sub.3).sub.4 (0.01 g, 0.009 mmol) were added. The combined
reaction mixture was stirred for 1.5 h at rt. AcOH (0.5 mL) was
added to the solution and the reaction mixture was evaporated in
vacuo. The residue was re-evaporated from toluene to yield two
separable isomers, 23 and 24 (0.09 g). The crude product was used
for the next step without any purification.
b)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl)-(-
phenyl)oxy)methyl)-3-cephem-4-carboxylic acid (25)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl)-(phe-
nyl)oxy)methyl)-2-cephem-4-carboxylic acid (26)
##STR00085##
[0342] Compound 11 and 12 (1.54 g, 2.51 mmol) were dissolved in 150
mL of dry methylene chloride. Sodium 2-ethylhexanoate (0.417 g,
2.51 mmol) was dissolved in 50 mL of ethyl acetate. After these two
solutions were mixed together, PPh.sub.3 (0.05 g, 0.2 mmol) and
Pd(PPh.sub.3).sub.4 (0.05 g, 0.04 mmol) were added. The combined
reaction mixture was stirred for 1.5 h at rt. AcOH (5 mL) was added
to the solution and the reaction mixture was evaporated in vacuo.
The residue was re-evaporated from toluene to yield two separable
isomers, 25 and 26 (2.27 g). The crude product was used for the
next reaction without purification.
c)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((2-((6-chloro)-3H-quinazoline-4-on-
e-2-yl)-4-chlorophenyloxy)methyl)-3-cephem-4-carboxylic acid
(27)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((2-((6-chloro)-3H-quinazoline-4-one-2-
-yl)-4-chlorophenyloxy)methyl)-2-cephem-4-carboxylic acid (28)
##STR00086##
[0344] Compound 13 and 14 (0.133 g, 0.195 mmol) were dissolved in 4
mL of methylene chloride. PPh.sub.3 (0.006 g, 0.02 mmol) and
Pd(PPh.sub.3).sub.4 (0.005 g, 0.004 mmol) were then added, followed
by sodium 2-ethylhexanoate (0.036 g, 0.217 mmol) in 3 mL of ethyl
acetate. The solution was stirred at rt for 1.5 h. During this
period, a white precipitate formed. AcOH (0.5 mL) was added to the
solution and the reaction mixture was evaporated in vacuo. The
residue was re-evaporated from toluene to yield two separable
isomers, 27 and 28 (0.170 g). The crude product was used for the
next step without purification.
d)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((9H-(1,3-dichloro-9,9-dimethylacri-
din-2-one)-7-oxy)methyl)-3-cephem-4-carboxylic acid (29)
##STR00087##
[0346] Compound 15 (0.173 g, 0.253 mmol) were dissolved in a
mixture of 2 mL methylene chloride and 2 mL ethyl acetate.
PPh.sub.3 (0.005 g, 0.02 mmol) and Pd(PPh.sub.3).sub.4 (0.005 g,
0.0043 mmol) were then added, followed by sodium 2-ethylhexanoate
(0.042 g, 0.253 mmol) in 2 mL of ethyl acetate. The solution was
stirred for 2 h at rt. During this period, a precipitate formed
which was centrifuged, and separated from the supernatant. The
solid was washed with methylene chloride and dried. After
filtering, the solid was dissolved in chloroform and loaded onto a
silica gel column. Less polar impurities were eluted with
chloroform:methanol (10:1) mixture. The desired product was eluted
using chloroform:methanol:acetic acid (20:3:0.5). The eluate was
concentrated in vacuo, dissolved in toluene, and concentrated
again. This residue was then dissolved in chloroform:methanol
(10:1), filtered and evaporated to yield 29 (0.06 g, 36%).
[0347] .sup.1H NMR (.delta., CD.sub.3OD): 1.88 (s, 6H), 3.84 (AB,
J=15.2, 2H), 3.87 (AB, J=18.0, 2H), 4.77 (d, J=11.6, 1H), 4.98 (d,
J=11.6, 1H), 5.13 (d, J=4.8, 1H), 5.74 (d, J=4.8, 1H), 6.47-6.55
(m, 2H), 6.67 (s, 1H), 6.81 (d, J=2.4, 1H), 6.96-7.00 (m, 2H), 7.30
(d, J=4.8, 1H).
e)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((4-methylumbelliferyl)-7-oxy)meth-
yl)-3-cephem-4-carboxylic acid (30)
##STR00088##
[0349] Compound 16 (0.05 g, 0.090 mmol) was dissolved in a mixture
of 2 mL methylene chloride and 2 mL ethyl acetate. Sodium
2-ethylhexanoate (0.022 g, 0.13 mmol) was added to the solution
followed by PPh.sub.3 (0.005 g, 0.02 mmol) and Pd(PPh.sub.3).sub.4
(0.005 g, 0.0043 mmol). The combined reaction mixture was stirred
for 2 h at rt. During this period, a precipitate formed which was
centrifuged, and separated from the supernatant. The solid was
washed with ethyl acetate and dissolved in
chloroform:methanol:acetic acid (50:10:0.5). The solution was
loaded on prep. TLC plate, and the plate was developed using
chloroform:methanol:acetic acid (50:10:0.5). The band of the
product was separated, and the compound was dissolved in methanol.
Evaporation of the methanol yielded 30 as a white powder (0.021 g,
45%).
[0350] LCMS: single peak, 511 [M-H.sup.+], calculated for
C.sub.24H.sub.20N.sub.2O.sub.7S.sub.2: 512.
f)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((((6,8-difluoro)-4-methylumbellife-
ryl)-7-oxy)methyl)-3-cephem-4-carboxylic acid (31)
##STR00089##
[0352] Compound 17 (0.22 g, 0.37 mmol) was dissolved in a mixture
of 8 mL of methylene chloride. Sodium 2-ethylhexanoate (0.093 g,
0.56 mmol) was dissolved in 3 mL of ethyl acetate. After these two
solutions were mixed together, PPh.sub.3 (0.005 g, 0.02 mmol) and
Pd(PPh.sub.3).sub.4 (0.005 g, 0.0043 mmol) were added. The combined
reaction mixture was stirred overnight at rt. The formed
precipitate was separated, washed with ethyl acetate and dried to
yield 31 as a white powder (0.19 g, 89%).
[0353] .sup.1H NMR (.delta., CD.sub.3OD): 2.45 (s, 3H), 3.58 (d,
J=17.6, 1H), 3.82 (d, J=17.6, 1H), 3.83 (AB, J=19.3, 2H), 5.04 (d,
J=4.4, 1H), 5.06 (d, J=12.0, 1H), 7.41 (d, J=11.2, 1H), 5.31 (d,
J=11.6, 1H), 5.67 (d, J=4.8, 1H), 6.36 (s, 1H), 6.98 (m, 2H), 7.28
(d, J=5.2, 1H). LCMS: single peak, 549 [M+H.sup.+], calculated for
C.sub.24H.sub.18N.sub.2O.sub.7F.sub.2S.sub.2: 548.
g) Preparation of (32) and (33)
##STR00090##
[0355] Compound 18 and 19 (0.075 g, 0.098 mmol) were dissolved in
the mixture of 1 mL of methylene chloride and 1 mL of ethyl
acetate. Sodium 2-ethylhexanoate (0.0163 g, 0.098 mmol) was added
to the solution followed by PPh.sub.3 (0.005 g, 0.02 mmol) and
Pd(PPh.sub.3).sub.4 (0.005 g, 0.0043 mmol). The combined reaction
mixture was stirred for 2 h at rt. After that 0.5 mL of AcOH was
added to the mixture and it was concentrated in vacuo. The residue
was concentrated in vacuo, dissolved in toluene, and concentrated
again. The crude product was dissolved in chloroform and loaded on
a prep. TLC plate. The plate was developed using
chloroform:methanol:acetic acid (50:10:0.5). The product was
separated as a mixture of two isomers. The bands were separated
from the plate, and the product was dissolved in methanol. After
evaporation, dissolution in methanol, filtration, and evaporation,
two separable isomers, 32 and 33 (0.024 g, 34%), was recovered.
h) Preparation of (34) and (35)
##STR00091##
[0357] Compound 20 and 21 (0.120 g, 0.146 mmol) were dissolved in 3
mL of methylene chloride. PPh.sub.3 (0.0046 g, 0.0175 mmol) and
Pd(PPh.sub.3).sub.4 (0.0033 g, 0.00285 mmol) were added to the
solution followed by addition of sodium 2-ethylhexanoate (0.053 g,
0.319 mmol), dissolved in 3 mL of ethyl acetate. The reaction
mixture was stirred for 2 h at rt. The formed yellow precipitate
was separated, washed with methylene chloride and dried. The
residue was re-dissolved in 6:2:0.4 chloroform-methanol-acetic acid
mixture and the solution was loaded on prep. PLC plate. The plate
was developed in 6:2:0.4 chloroform-methanol-acetic acid mixture.
The band containing desired product was separated, compound was
washed out of silica gel with methanol and solution was evaporated.
The residue was re-dissolved in chloroform, filtered and evaporated
to yield two separable isomers, 34 and 35, as a yellow powder
(0.048 g, 44%).
[0358] .sup.1H NMR (.delta., CD.sub.3OD): 3.87 (2AB, J=15.6, 4H),
4.68 (br s, 2H), 4.75 (d, J=4.0, 1H), 4.84 (d, J=12.4, 1H), 5.40
(d, J=12.4, 1H), 5.86 (d, J=4.4, 1H), 6.50-7.30 (m, 10H), 7.72 (t,
J=7.6, 1H), 7.79 (t, J=7.6, 1H), 8.02 (d, J=7.6, 1H). LCMS: single
peak, 741 [M-H.sup.+], calculated for
C.sub.36H.sub.26N.sub.2O.sub.12S.sub.2: 742.
i) Preparation of (36)
##STR00092##
[0360] Compound 22 (0.01 mmol) is dissolved in dry dichloromethane
(20 mL). Sodium 2-ethylhexanoate (0.02 mmol) is dissolved in 5 mL
ethyl acetate. After these two solutions are mixed together,
PPh.sub.3 (0.002 mmol) and Pd(PPh.sub.3).sub.4 (0.002 mmol) are
added. The resulting solution is stirred at rt for 3 h, then acetic
acid (2 mL) is added and the reaction mixture evaporated in vacuo
to afford 36 as a pale yellow powder.
Example 7
Preparation of i: Compounds 37-43
a)
7.beta.-(Phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phenyl)ox-
y)methyl)-3-cephem-4-carboxylic acid 1,8-sulfoxide (37)
##STR00093##
[0362] Compound 23 and 24 (0.09 g) were dissolved in 3 mL of
methylene chloride and the solution was cooled in an ice/water
bath. m-Chloroperoxybenzoic acid (77% in methylene chloride, 0.025
g, 0.11 mmol) was added to the above solution. The reaction mixture
was stirred at the bath temperature for 30 min, and then
concentrated in vacuo to .about.2 mL. During concentration, a
precipitate formed, which was then centrifuged, and separated from
the supernatant. The solid was washed with 1 mL of methylene
chloride and dried to yield a single product, 37, as a white powder
(0.02 g).
[0363] .sup.1H NMR (.delta., CD.sub.3OD): 3.50 (d, J=18.4, 1H),
3.98 (d, J=18.4, 1H), 4.65 (AB, 2H), 4.81 (d, J=4.8, 1H), 4.93 (d,
J=11.6, 1H), 5.44 (d, J=11.6, 1H), 6.90-8.0 (m, 12H), 8.25 (d,
J=8.0, 1H). LCMS: single peak, 555 [M-CO.sub.2--H.sup.+],
calculated for C.sub.30H.sub.24N.sub.4O.sub.8S: 600.
b)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl)-(-
phenyl)oxy)methyl)-3-cephem-4-carboxylic acid 1.beta.-sulfoxide
(38)
##STR00094##
[0365] Compound 25 and 26 (2.27 g) were dissolved in 40 mL of
methylene chloride and the solution was cooled with an ice/water
bath. m-Chloroperoxybenzoic acid (77% in methylene chloride, 0.85
g, 3.79 mmol) was added dropwise to the above solution. The
reaction mixture was stirred at the bath temperature for 30 min,
and then concentrated in vacuo. During concentration, a precipitate
formed, which was separated from the solution by filtration. The
solid was washed with methylene chloride (3.times.10 mL) and dried
to give the first crop of sulfoxide (.about.0.8 g). An organic
solution was combined with the washings, which produced a white
precipitate. The precipitate was filtered, washed with methylene
chloride (3.times.5 mL) and dried to give a second crop of product
(0.2 g). These two crops were similar by TLC and were combined to
yield a single product, 38 (1.05 g).
[0366] .sup.1H NMR (.delta., CD.sub.3OD): 3.46 (d, J=20.0, 1H),
3.86 (AB, J=16.0, 2H), 3.91 (d, J=20.0, 1H), 4.75 (d, J=4.8, 1H),
4.90 (d, J=11.6, 1H), 5.85 (d, J=11.6, 1H), 6.90-7.90 (m, 10H),
8.25 (d, J=8.0, 1H). LCMS: single peak, 545 [M-CO.sub.2--H.sup.+],
calculated for C.sub.28H.sub.22N.sub.4O.sub.7S.sub.2: 590.
c)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-((6-chloro)-3H-quinazoline-4-o-
ne-2-yl)-(4-chlorophenyl)oxy)methyl)-3-cephem-4-carboxylic acid
1,8-sulfoxide (39)
##STR00095##
[0368] Compound 27 and 28 (0.170 g) were dissolved in a solution of
methylene chloride (.about.15 mL) and methanol (.about.2 mL) which
was cooled in an ice/water bath. m-Chloroperoxybenzoic acid was
dissolved in 2 mL of methylene chloride and added to the above
solution. The reaction mixture was stirred at the bath temperature
for 1.5 h. During this period, a precipitate formed, which was
separated, washed with methylene chloride and dried to give the
first crop of product. An organic solution was combined with the
washings. After evaporation, the residue was mixed with 10 mL of
methylene chloride. A white precipitate formed, which was separated
from the solution, washed with methylene chloride, and dried to
give a second crop of product. These two crops were similar by TLC
and were combined to yield a single product, 39 (0.07 g).
[0369] .sup.1H NMR (.delta., DMSO-d.sub.6): 3.28 (d, J=18.0, 1H),
3.78 (d, J=18, 1H), 3.84 (AB, J=15.6, 2H), 4.70 (d, J=3.6, 1H),
4.80 (d, J=11.2, 1H), 5.33 (d, J=10.9, 1H), 5.58 (brs, 1H),
6.90-8.20 (m, 9H). LCMS: single peak, 615 [M-CO.sub.2--H.sup.+],
calculated for C.sub.28H.sub.20N.sub.4O.sub.7S.sub.2Cl.sub.2:
660.
d)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((9H-(1,3-dichloro-9,9-dimethylacri-
din-2-one)-7-oxy)methyl)-3-cephem-4-carboxylic acid
1.beta.-sulfoxide (40)
##STR00096##
[0371] Compound 29 (0.10 g, 0.20 mmol) was dissolved in 4 mL
methylene chloride and the solution was cooled in an ice/water
batch. m-Chloroperbenzoic acid (77% in 4 mL methylene chloride,
0.075 g, 0.33 mmol) was added to the above solution. The reaction
mixture was stirred at bath temperature for 30 min, then
concentrated in vacuo to a volume of 2 mL. During the concentration
a precipitate formed, which was isolated by centrifugation,
separated from the supernatant, washed with 1 mL cold methylene
chloride, and dried to yield 40 as a brown solid (0.02 g).
e)
7.beta.-(2-(Thien-2-yl)acetamido)-3-((((6,8-difluoro)-4-methylumbellife-
ryl)-7-oxy)methyl)-3-cephem-4-carboxylic acid 1.beta.-sulfoxide
(41)
##STR00097##
[0373] Compound 30 (0.047 g, 0.083 mmol) was dissolved in 20 mL of
water. The solution was acidified with 3 mL of 10% HCl and the acid
was extracted with methylene chloride (4.times.20 mL). The combined
extracts were washed with brine (20 mL), and dried over sodium
sulfate. After filtering, the solution was concentrated down to
.about.20 mL. The solution was then cooled in an ice/water bath,
and m-chloroperoxybenzoic acid (77% in methylene chloride, 0.0185
g, 0.0825 mmol) and added. The reaction mixture was stirred at the
bath temperature for 30 min. During this period, a precipitate
formed, which was separated, washed with methylene chloride
(.about.1.5 mL) and dried to yield 41 as a white powder (0.040 g,
86%).
[0374] .sup.1H NMR (.delta., DMSO-d.sub.6): 2.40 (s, 3H), 3.69 (d,
J=18.4, 1H), 3.86 (AB, J=15.2, 2H), 4.92 (d, J=3.6, 1H), 4.96 (d,
J=12.4, 1H), 5.44 (d, J=12.4, 1H), 5.85 (dd, J.sub.1=8.4,
J.sub.2=4.8, 1H), 6.47 (s, 1H), 6.97 (m, 2H), 7.39 (dd,
J.sub.1=4.8, J.sub.2=1.6, 1H), 7.62 (d, J=11.6, 1H), 8.47 (d,
J=8.4, 1H). LCMS: single peak, 565 [M+H.sup.+], calculated for
C.sub.24H.sub.18N.sub.2O.sub.8F.sub.2S.sub.2: 564.
[0375] The fluorescence intensity versus time of .beta.-lactamase
substrate 41 after reaction with .beta.-lactamase is shown in FIG.
1. The variation in fluorescence intensity at different
concentrations of .beta.-lactamase substrate 41 is also shown. A
comparison of the fluorescence intensity versus time of
.beta.-lactamase substrate 41 alone and also after reaction with
.beta.-lactamase is shown in FIG. 2.
f) Preparation of (42)
##STR00098##
[0377] Compound 32 and 33 (0.015 g, 0.021 mmol) were dissolved in 1
mL of methylene chloride and the solution was cooled in an
ice/water bath. m-Chloroperoxyacetic acid (77% in methylene
chloride, 0.0046 g, 0.021 mmol) was added to the solution and the
reaction mixture was stirred for 30 min at bath temperature. The
resulting solution was loaded on prep. TLC plate, and developed
using chloroform:methanol:acetic acid (50:7:0.3) as an eluent. The
product band was separated and the product was dissolved in
methanol. After evaporation and dissolution in chloroform, the
solution was filtered and concentrated to yield a single product,
42, as a yellowish powder (0.008 g, 52%).
[0378] LCMS: single peak, 741 [M+H.sup.+], calculated for
C.sub.38H.sub.32N.sub.2O.sub.10S.sub.2: 740.
g) Preparation of (43)
##STR00099##
[0380] Compound 34 and 35 (0.231 g, 0.287 mmol) were dissolved in 5
mL of methylene chloride and the solution was cooled in an
ice/water bath. m-Chloroperoxybenzoic acid (77% in 2 mL methylene
chloride, 0.064 g, 0.285 mmol) was added to the solution and the
reaction mixture was stirred for 20 min at rt and evaporated. The
residue was re-dissolved in chloroform and the solution was loaded
on a silica gel column, which was eluted with chloroform:ethyl
acetate (5:1). The eluate was evaporated to yield a single product,
43, as a yellow glass (0.124 g, 53%).
Example 8
Preparation of i: Compounds 23, 25, and 34
a)
7.beta.-(Phenoxyacetamido)-3-(((2-(3H-quinazoline-4-one-2-yl)-phenyl)ox-
y)methyl)-3-cephem-4-carboxylic acid (23)
##STR00100##
[0382] Compound 37 (0.05 g, 0.083 mmol) was dissolved in 2 mL of
DMF. SnCl.sub.2.2H.sub.2O (0.047 g, 0.21 mmol) was added to the
solution and the mixture was cooled in an ice/water bath. AcCl
(0.21 mL, 2.95 mmol) was added to the solution and the mixture was
stirred for 1 h at bath temperature. MeOH (2 mL) was added to the
solution and the mixture was diluted with 10 mL of water. The
product was extracted with ethyl acetate (5.times.10 mL). The
combined extracts were washed with water (3.times.10 mL), brine (10
mL), and dried over sodium sulfate. After filtering, the solvent
was removed in vacuo to yield 23 as a white powder (0.039 g,
80%).
[0383] LCMS: single peak, 585 [M+H.sup.+], calculated for
C.sub.30H.sub.24N.sub.4O.sub.7S: 584.
b)
7.beta.-(2-(Thien-2-yl)acetamido)-3-(((2-(-3H-quinazoline-4-one-2-yl)-(-
phenyl)oxy)methyl)-3-cephem-4-carboxylic acid (25)
##STR00101##
[0385] Compound 38 (0.10 g, 0.16 mmol) was dissolved in 4 mL of
DMF. SnCl.sub.2.2H.sub.2O was added to the solution and the mixture
was cooled in an ice/water bath. AcCl (0.4 mL, 5.62 mmol) was added
to the solution and the mixture was stirred at bath temperature for
30 min, diluted with 10% HCl (50 mL) and extracted with ethyl
acetate (4.times.30 mL). The combined extracts were washed with
brine (30 mL), and dried over sodium sulfate. After filtering, the
solvent was removed in vacuo. The residue was triturated with ethyl
acetate. A precipitate formed which was filtered and evaporated in
vacuo to yield 25 (0.09 g, 96%).
[0386] .sup.1H NMR (.delta., CD.sub.3OD): 3.67 (s, 2H), 3.80 (AB,
2H), 5.08 (d, J=4.8, 1H), 5.13 (s, 2H), 5.75 (d, J=4.8, 1H),
6.90-7.90 (m, 10H), 8.27 (d, J=8.0, 1H). LCMS: single peak, 575
[M+H.sup.+], calculated for C.sub.28H.sub.22N.sub.4O.sub.6S.sub.2:
574.
[0387] A comparison of the fluorescence intensity versus time of
.beta.-lactamase substrate 25 after reaction with .beta.-lactamase
is shown in FIG. 3.
c) Preparation of (34)
##STR00102##
[0389] Compound 43 (0.027 g, 0.036 mmol) was dissolved in 2 mL of
DMF. SnCl.sub.2.2H.sub.2O (0.020 g, 0.089 mmol) was added to the
solution and the mixture was cooled in an ice/water bath. AcCl
(0.090 mL, 1.26 mmol) was added to the solution and the mixture was
stirred for 1 h at bath temperature. The reaction mixture was
concentrated in vacuo to dryness and re-dissolved in
chloroform:methanol:acetic acid (6:2:0.4). This solution was loaded
onto a prep. TLC plate, which was developed in
chloroform:methanol:acetic acid (6:2:0.4). The band containing the
desired product was separated, and the product was dissolved in
methanol. After evaporation of methanol, the residue was
re-dissolved in chloroform, filtered and evaporated to yield 34 as
a yellow powder (0.009 g, 34%).
[0390] LCMS: single peak, 725 [M-H.sup.+], calculated for
C.sub.36H.sub.26N.sub.2O.sub.11S.sub.2: 726.
Example 9
Preparation of k (Compound 44)
[0391] A 0.1 M solution of clavulanic acid in anhydrous
acetonitrile (20 mL) is treated with DIEA (1.2 eq) and allyl
bromide (1.1 eq). The resulting reaction mixture is stirred
overnight at rt, then evaporated and mixed with 30 mL 5% HCl,
followed by extraction with ethyl acetate (3.times.30 mL). The
extract is washed with brine (1.times.30 mL), dried over sodium
sulfate, and concentrated. The crude product is purified by flash
chromatography using methanol in chloroform to give ester Compound
44 as a colorless oil.
Example 10
Preparation of l (Compound 45)
[0392] To a 0.1 M solution of ester Compound 44 in 20 mL anhydrous
THF is added 1.1 eq of triphenylphosphine and 1.1 eq of diethyl
azodicarboxylate. After 30' 0.1M solution of 1.0 eq
4-methyl-7-hydroxycoumarin and 1.0 eq of DIEA is added. The
resulting mixture is stirred overnight, then evaporated and mixed
with 30 mL 5% HCl, followed by extraction with ethyl acetate
(3.times.30 mL). The extract is washed with brine (1.times.30 mL),
dried over sodium sulfate, and concentrated. The crude product is
purified by flash chromatography using ethyl acetate in chloroform
to give ester Compound 45 as a colorless oil.
Example 11
Preparation of m (Compound 46)
[0393] A 0.05 M solution of 45, triphenylphosphine (0.3 eq), and
tetrakis(triphenylphosphine)palladium (0.1 eq) in anhydrous
dichloromethane is treated dropwise with a 0.1 M solution of 1.1 eq
sodium 2-ethylhexanoate in anhydrous ethyl acetate with stirring.
The reaction mixture is stirred at rt for 4 h, and the resulting
precipitate is collected by filtration and rinsed with ethyl
acetate to afford fluorogenic substrate 46 as a colorless
powder.
Example 12
Exemplary Synthetic Scheme for Preparing Fluorogenic
Rhodol-Cephalosporins
##STR00103##
[0394] Example 13
Exemplary Synthetic Scheme for Preparing Fluorogenic
Rhodamine-Cephalosporins
##STR00104##
[0395] Example 14
Exemplary Synthetic Scheme for Preparation of Fluorogenic Rhodol
Clavulanates
##STR00105##
[0396] Example 15
Exemplary Synthetic Scheme for Preparing Fluorogenic
Rhodamine-Clavulanates
##STR00106##
[0397] Example 16
Synthetic Scheme for Fluorogenic Rhodamine-Diclavulanate
##STR00107##
[0398] Example 17
Exemplary Synthetic Schemes for Colorogenic
Nitrophenol-Clavulanates
##STR00108##
[0399] Example 18
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Benzopyranone
##STR00109##
[0400] Example 19
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Benzofuranone
##STR00110##
[0402] The Heck reaction employs a source of palladium (0) [Pd(0)]
catalyst and a base. Examples of commercially available Pd(0)
sources include palladium tetrakis triphenylphosphine
(Pd(Ph.sub.3).sub.4); palladium acetate (Pd(OAc).sub.2);
Tris(dibenzylideneacetone) dipalladium (0)
(C.sub.6H.sub.5CH.dbd.CHCOCH.dbd.CHC.sub.6H.sub.5).sub.3Pd.sub.2);
Tris(dibenzylideneacetone) dipalladium (0) chloroform adduct
(C.sub.6H.sub.5CH.dbd.CHCOCH.dbd.CHC.sub.6H.sub.5).sub.3Pd.sub.2.CHCl.sub-
.3), and the like. Examples suitable bases include weak bases, such
as tertiary amine bases, for example triethylamine. Additional
suitable bases include metal carbonates, such as potassium
carbonate. Additives can optionally be included in the Heck
reaction, such as additional ligands, for example phosphine
ligands, salts, particularly silver (I) salts. General conditions
for intramolecular Heck reactions are provided by Link and Overman,
In Metal Catalyzed Cross-coupling Reactions, Diederich, F., Ed.;
Wiley-VCH: New York, 1998, pp. 231-269; and by Gibson and
Middleton, Contemp. Org. Synth. 1996, 3, 447-471.
Example 20
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Phenaceturate
##STR00111##
[0403] Example 21
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Malonamate
##STR00112##
[0404] Example 22
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Benzopyranone
##STR00113##
[0405] Example 23
Exemplary Synthetic Scheme for a Fluorogenic
Coumarin-Benzofuranone
##STR00114##
[0406] Example 24
Synthesis of the PEG-.beta.-Lactamse Substrate Lacking a C2
Linker
##STR00115##
[0408] 2-[2-(2-Methoxyethoxy)ethoxy]acetic acid (67, 1.0 mL, 6.5
mmol) was dissolved in CH.sub.2Cl.sub.2 (10.0 mL). DMF (5 drops)
was added and the solution was cooled to 0.degree. C. Following the
dropwise addition of oxalyl chloride (1.7 mL, 19 mmol), the
reaction was stirred at 0.degree. C. for 40 min. The volatiles were
evaporated and the residue was re-evaporated from toluene one time.
A 100% conversion to the acid chloride was assumed, and crude acid
chloride 68 was used directly in the next reaction without further
purification.
##STR00116##
[0409] 7-Aminocephalosporanic acid (69, 0.44 g, 1.6 mmol) was
dissolved in a 1.0 M, pH 8.5 solution of triethylammonium
bicarbonate buffer (13 mL). Dioxane (10 mL) was added. Acid
chloride 68 (3.2 mmol) was dissolved in dioxane (2.0 mL) and added
dropwise to the 7-aminocephalosporanic acid solution. The initial
clear, pale yellow solution turned white and cloudy as the acid
chloride was added. After 10 min at room temperature, the white,
cloudy solution was concentrated to half volume and acidified to a
pH of 2 with 1 N HCl. The solution was extracted with EtOAc
(15.times.30 mL); the EtOAc layer was checked by TLC for the
presence of product. Saturated NaCl was added to the aqueous layer,
and the layer was extracted with EtOAc (7.times.15 mL). The
combined organic layers were dried over Na.sub.2SO.sub.4, filtered
and concentrated. The residue was purified using column
chromatography (SiO.sub.2, 6:2:0.1, CHCl.sub.3/MeOH/AcOH) to afford
product 70 (0.69 g, 99%) as a clear, pale yellow oil. R.sub.f=0.38
(6:2:0.05, CHCl.sub.3/MeOH/AcOH.
##STR00117##
[0410] Intermediate 70 (1.1 g, 2.6 mmol) was dissolved in water (15
mL) and the pH was adjusted to 7.2 using saturated sodium
bicarbonate. In a second flask, tetrabutylammonium bisulfate (0.90
g, 2.6 mmol) was dissolved in water (15 mL) and adjusted to a pH of
7.0 using saturated sodium bicarbonate. The two solutions were
combined and the product was extracted with CH.sub.2Cl.sub.2
(15.times.150 mL). The combined organic solutions were dried over
Na.sub.2SO.sub.4, then decanted. The solution was concentrated and
71 (1.6 g, 89%), a clear, brown oil, was used directly in the next
step without further purification.
##STR00118##
[0411] Tetrabutylammonium salt 71 (0.37 g, 0.55 mmol) was dissolved
in acetonitrile (4.0 mL). Allyl bromide (0.47 mL, 5.5 mmol) was
added and the solution was stirred overnight at room temperature.
Following concentration of the solution, the residue was dissolved
in EtOAc (50 mL), and washed sequentially with 1 N HCl (20 mL) and
saturated NaCl (20 mL). The organic layer was dried over
Na.sub.2SO.sub.4, decanted and concentrated. The residue was
purified using column chromatography (SiO.sub.2, 100% EtOAc) to
afford product 72 (0.14 g, 59%) as a viscous, pale yellow oil.
R.sub.f=0.41 (100% EtOAc); MS (ESI+) m/e 413.3
(M-CH.sub.3CO.sub.2H, C.sub.18H.sub.25N.sub.2O.sub.7S requires
413.47).
##STR00119##
[0412] Intermediate 72 (0.25 g, 0.53 mmol) was dissolved in
CH.sub.2Cl.sub.2 (3.0 mL) and cooled to 0.degree. C. TMSI (0.16 mL,
1.2 mmol) was added. The reaction was stirred at 0.degree. C. for
10 min, and then removed from the ice bath and stirred for 40 min
at room temperature. Following complete consumption of the starting
material, the reaction solution was diluted with EtOAc (65 mL),
extracted with ice cold 5% sodium sulfite (2.times.25 mL) and
rinsed with saturated NaCl (1.times.25 mL). The pale yellow organic
layer was dried over Na.sub.2SO.sub.4, decanted and concentrated to
provide crude 73 (0.18 g, 61%) that was used directly in the next
reaction without further purification. R.sub.f=0.50 (100%
EtOAc).
##STR00120##
[0413] Phenol 74 (0.22 g, 0.20 mmol) was suspended in DMF (5.0 mL).
A 25% MeONa solution (0.11 mL, 0.48 mmol) was added and the
reaction was stirred and sonicated for 15 min at room temperature.
Intermediately 73 (0.25 g, 0.47 mmol) was added as a solution in
DMF (3 mL) and the reaction was stirred for 1.5 h at room
temperature. The solution was then diluted with 5% HCl (80 mL), and
the product was extracted with EtOAc (4.times.50 mL). The combined
extracts (which contained a white solid) was washed with water
(3.times.30 mL), saturated NaCl (1.times.30 mL) and dried over
Na.sub.2SO.sub.4. Following evaporation, the residue was mixed with
CHCl.sub.3 (100 mL) and stirred for 10 min, filtered and evaporated
to give the product as a yellow glass. The residue was purified
using column chromatography (SiO.sub.2, 1:1, CHCl.sub.3/EtOAc) to
afford product 75 (0.13 g, 39%). MS (ESI+) m/e 719.2 (M.sup.+,
C.sub.32H.sub.32Cl.sub.2N.sub.4O.sub.9S requires 719.59).
##STR00121##
[0414] 5-Chloroisatoic anhydride (76, 50.0 g, 250 mol) was
suspended in anhydrous THF (660 mL). The mixture was cooled to
0.degree. C. and dry ammonia was bubbled through the mixture for 2
h. The ice bath was removed, and the mixture warmed to room
temperature. Stirring continued overnight at room temperature. The
volatiles were removed in vacuo, and the residue was suspended in a
3:1 solution of water to saturated sodium bicarbonate and stirred
for 30 min. The white precipitate which formed was filtered. The
filtrate was back-extracted with EtOAc (3.times.200 mL) and the
combined extracts were rinsed with brine (1.times.100 mL) and then
dried over Na.sub.2SO.sub.4. The solution was concentrated. The
solids were checked for purity, and when verified that they were of
equal purity, combined to afford 77 as a white solid (39 g,
91%).
##STR00122##
[0415] 5-Chloroanthranilamide (77, 670 mg, 3.9 mmol) and
5-chlorosalicylaldehyde (78, 620 mg, 4.0 mmol) were added to EtOH
(10 mL). p-Toluenesulfonic acid monohydrate (20 mg, 0.11 mmol) was
added to the reaction mixture and the solution was refluxed 1 h.
The reaction solution was cooled to 5.degree. C. and added
2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ, 0.90 g, 4.0 mmol).
The solution was stirred for 1 h at 5.degree. C. A white
precipitate formed, and was subsequently filtered. The precipitate
was rinsed with cold EtOH (3.times.10 mL). Phenol 74 was obtained
as a white solid (1.0 g, 83%).
##STR00123##
[0416] The allyl ester 75 (0.13 g, 0.18 mmol) was dissolved in
CH.sub.2Cl.sub.2 (3 mL). Triphenylphosphine (5 mg, 0.02 mmol) and
tetrakis(triphenylphosphine) palladium(0) (4 mg, 0.004 mmol) were
added followed by the addition of sodium 2-ethylhexanoate (32 mg,
0.19 mmol) in EtOAc (2 mL). The reaction mixture was stirred for 1
h at room temperature. Acetic acid (0.1 mL) was added and the
solution was evaporated to dryness. The residue was washed with
hexanes (2.times.20 mL), and then the solid was mixed with 5% HCl
(20 mL). The product was extracted with EtOAc (3.times.30 mL) and
the combined extracts were washed with brine (20 mL), dried over
Na.sub.2SO.sub.4 and evaporated to provide 80 (0.12 g, 99%). 2
isomers, R.sub.f=0.38 and 0.50 (6:2:0.1, CHCl.sub.3/MeOH/AcOH.
##STR00124##
[0417] Intermediately 80 (0.12 g, 0.18 mmol) was dissolved in
CH.sub.2Cl.sub.2 (30 mL) and the solution was filtered through
celite. Following concentration to 4 mL, the solution was cooled in
an ice/water bath. m-CPBA (77% solid, 44 mg, 0.20 mmol) in
CH.sub.2Cl.sub.2 (1 mL) was added. After stirring at 5.degree. C.
for 40 min, a white precipitate was observed. The mixture was
centrifuged and the supernant was removed. The solid was washed
with fresh CH.sub.2Cl.sub.2 (4 mL) and centrifuged again. After
removing the supernant, 81 was obtained as a yellow powder (38 mg,
30%). MS (ESI+) m/e 695.0 (M.sup.+,
C.sub.29H.sub.28Cl.sub.2N.sub.4O.sub.10S requires 695.52).
Example 25
Synthesis of the PEG-.beta.-Lactamse Substrate Containing a C2
Linker
##STR00125##
[0419] Intermediately 73 (0.15 g, 0.28 mmol) was dissolved in EtOAc
(1.0 mL) at room temperature. A solution of triphenylphospine (73
mg, 0.28 mmol) in EtOAc (0.5 mL) was added and the reaction
solution was stirred at room temperature for 2.5 h. The initial
clear, orange solution turned cloudy as the triphenylphosphine was
added and a sticky orange precipitate was observed. The solution
was decanted and the filtrate obtained was resubjected to stirring
at room temperature. After 1 h, the solution was decanted again and
the solids obtained were combined. The decanted solution was
concentrated to a few milliliters and let to sit at room
temperature for another 30 min. After that time, the solution was
again decanted. The combined orange precipitates, 82, (0.12 g, 52%)
obtained were used without purification in the next reaction.
##STR00126##
[0420] Compound 82 (0.081 g, 0.10 mmol) was dissolved in
CH.sub.2Cl.sub.2(2.6 mL). An aqueous solution of 1 N NaOH (0.9 mL)
was added and the solution was stirred vigorously at room
temperature for 40 min. The organic solution was separated from the
aqueous solution. The aqueous layer was back-extracted with
CH.sub.2Cl.sub.2 (5.times.10 mL). The organic layer was dried over
MgSO.sub.4, decanted and concentrated to a few mLs. A 100%
conversion was assumed and intermediate 83 was used without further
purification in the next reaction.
##STR00127##
[0421] To a solution of 83 (0.10 mmol) was added a solution of
aldehyde 84 (45 mg, 0.13 mmol) in CH.sub.2Cl.sub.2 (2.6 mL); the
mixture was stirred overnight at room temperature. The solvent was
removed via evaporation, and the residue was purified using column
chromatography (SiO.sub.2, 5:1, CHCl.sub.3/EtOAc, followed by
rinsing with 100% EtOAc which eluted the pure product) to afford 85
(17 mg, 23%) as a yellow solid. R.sub.f=0.25 (6:1:0.05,
CHCl.sub.3/MeOH/AcOH); MS (ESI+) m/e 745.8 (M.sup.+,
C.sub.34H.sub.34Cl.sub.2N.sub.4O.sub.9S requires 745.6).
[0422] Preparation of Aldehyde 84:
##STR00128##
[0423] Phenol 74 (1.0 g, 3.3 mmol) was dissolved in DMF (75 mL) and
bromoacetaldehyde dimethyl acetal (1.9 mL, 16 mmol), potassium
carbonate (2.3 g, 16 mmol) and potassium iodide (0.5 g, 3.0 mmol)
were added. The reaction was refluxed at 95.degree. C. for 5 days.
The reaction solution was removed from the oil bath and allowed to
cool to room temperature. The solution was partitioned between
EtOAc (300 mL) and water (100 mL). The aqueous layer was then
re-extracted with EtOAc (2.times.250 mL) and the combined organic
layers were dried over Na.sub.2SO.sub.4, decanted and concentrated.
The residue was purified using column chromatography (SiO.sub.2,
loaded with 100% CHCl.sub.3, eluted with 6:1 CHCl.sub.3/EtOAc) to
afford 86 (0.25 g, 20%) as an orange solid. R.sub.f=0.27 (1:1,
CHCl.sub.3/EtOAc); MS (ESI+) m/e 395.2 (M.sup.+,
C.sub.18H.sub.16Cl.sub.2N.sub.2O.sub.4 requires 395.24).
##STR00129##
[0424] To a solution of 86 (0.28 g, 0.70 mmol) in dioxane (11 mL)
was added concentrated HCl (3.5 mL). After stirring the reaction at
room temperature for 20 min, the solution was diluted with water
(200 mL) and extracted with EtOAc (3.times.100 mL). The combined
organic layers were rinsed with water (1.times.200 mL), saturated
sodium bicarbonate (1.times.200 mL) and brine (1.times.200 mL).
After drying over Na.sub.2SO.sub.4, the solution was decanted and
concentrated. Aldehyde 84 (a yellow solid, 0.19 g, 76%), was used
directly in the next reaction without further purification.
R.sub.f=0.29 (100% EtOAc).
##STR00130##
[0425] Allyl ester 85 (0.11 g, 0.15 mmol) was dissolved in dry
CH.sub.2Cl.sub.2 (1.2 mL). Triphenylphosphine (4.6 mg, 0.02 mmol),
tetrakis(triphenylphosphine) palladium(0) (3.4 mg, 0.003 mmol) were
added. Sodium 2-ethylhexanoate (0.024 g, 0.15 mmol) was dissolved
in EtOAc (0.5 mL) and added to the reaction solution. After
stirring at room temperature 7 h, the solution was quenched with
AcOH (7.0 mL), evaporated and then re-evaporated from toluene
twice. The solid was washed with hexanes multiple times, then
dissolved in EtOAc and rinsed with 1% HCl. The organic layer was
separated and the aqueous layer was back-extracted with EtOAc (5
times). The combined organics were rinse with saturated NaCl and
dried over Na.sub.2SO.sub.4. The resulting yellow solution was
concentrated and 87 (an orange solid, 43 mg, 41%) was used directly
in the next reaction without further purification. R.sub.f=0.37
(6:1:0.05, CHCl.sub.3/MeOH/AcOH); MS (ESI+) m/e 704.97 (M.sup.+,
C.sub.31H.sub.29Cl.sub.2N.sub.4O.sub.9S requires 704.55).
##STR00131##
[0426] Acid 87 (43 mg, 0.061 mmol) was dissolved in
CH.sub.2Cl.sub.2 (3.0 mL) and cooled to 0.degree. C.
m-Chloroperbenzoic acid (m-CPBA, 10 mg, 0.061 mmol) was dissolved
in CH.sub.2Cl.sub.2 (0.5 mL) and added to the solution. The orange
solution was stirred at 0.degree. C. for 2 h and a white
precipitate was observed. The solution was centrifuged and the
solution decanted to provide the product as a white-yellow solid.
The resulting reaction solution and crude product were further
purified by HPLC (Xterra MS C8, internal diameter 2.1 mm, eluent
20-60% CH.sub.3CN, 10 mM NH.sub.4OAc, pH 4.7, flow rate of 0.2
mL/min) to provide the 88 (t.sub.R=14.0 min, 7 mg, 16%). MS (ESI+)
m/e 721.7 (M.sup.+, C.sub.31H.sub.30Cl.sub.2N.sub.4O.sub.10S
requires 721.56).
Example 26
Preparation of
o,o'-Di-{3-[2-carboxy-5,8-dioxo-7-(2-thiophen-2-yl-acetylamino)-5.lamda..-
sup.4-thia-1-aza-bicyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-dichlorofluores-
cein (Compound 100)
2-(2,7-Dichloro-3,6-dihydroxy-9H-xanthen-9-yl)-benzoic acid
(Compound 89)
[0427] 2',7'-Dichlorofluorescein (2.0 g, 5.0 mmol) was dissolved in
80 mL of THF, containing 2 mL of acetic acid. Zn (powder, 8.0 g,
122 mmol) was added portionwise (0.5 g with .about.15 min
intervals) to the solution of 2',7'-Dichlorofluorescein. After all
amount of Zn was added the reaction mixture was stirred overnight.
All solids have been filtered off, washed with THF and evaporated.
The residue was re-dissolved in ethyl acetate (120 mL) and washed
with water (2.times.30 mL), brine (30 mL), dried over sodium
sulfate and evaporated. The crude product (.about.2.0 g, oil) was
used for the next step without further purification.
2-[3,6-Bis-(2,2-dimethoxy-ethoxy)-2,7-dichloro-9H-xanthen-9-yl]-benzoic
acid 2,2-dimethoxy-ethyl ester (Compound 90)
[0428] Phenol 89(.about.5 mmol of the crude product) was dissolved
in 80 mL of DMF. Powdered K.sub.2CO.sub.3 (6.9 g, 50 mmol) was
added to the solution followed by BrCH.sub.2CH(OMe).sub.2 (8.8 mL,
75 mmol). The reaction mixture was stirred at .about.120.degree. C.
for 6 hrs, then concentrated oin vacuum. The residue was mixed with
100 mL of water and extracted with ethyl acetate (100 mL, then
2.times.30 mL). The combined extracts were washed with water (30
mL), brine (30 mL), dried over sodium sulfate and evaporated. The
crude product was re-dissolved in chloroform and loaded on silica
gel column (packed in 100:3 chloroform-ethyl acetate). The column
was eluted with 100:3 chloroform-ethyl acetate mixture. Pure
fractions containing ester 90 were combined and evaporated to give
desired product (2.62 g, 79%) as viscous oil which solidified
later.
2-[3,6-Bis-(2,2-dimethoxy-ethoxy)-2,7-dichloro-9H-xanthen-9-yl]-benzoic
acid (Compound 91)
[0429] Ester 90 (2.62 g, 3.93 mmol) was dissolved in 260 mL of
dioxane. 80 mL of water and 40 mL 1M KOH was added to the solution
and the mixture was stirred overnight at RT. The reaction mixture
was concentrated in vacuum to the volume .about.150 mL and
acidified with 10% HCl. The product was extracted with ethyl
acetate (2.times.70 mL). The combined extracts were washed with
water (3.times.30 mL), brine (30 mL), dried over sodium sulfate and
evaporated to give acid 91 as a yellow solid (2.27 g, quant.). The
material was used for the next step without any purification
o,o'-Di-(2,2-dimethoxyethyl)-2',7'-dichlorofluorescein (Compound
92)
[0430] Carboxylic acid 91 (2.35 g, 4.06 mmol) was dissolved in 100
mL of chloroform. The solution was diluted with 100 mL of methanol
and then tetrachloro-1,4-benzoquinone (1.99 g, 8.09 mmol) was added
to the solution. The reaction mixture was stirred under reflux for
7 hrs and concentrated in vacuum. The crude product was loaded on
silica gel column (packed in 100:1 chloroform-ethyl acetate
mixture) as a suspension in chloroform. The column was eluted with
50:2 chloroform-ethyl acetate mixture. Fractions containing
substituted fluorescein 92 were combined and evaporated to give 92
as a yellow solid (2.0 g. 85%).
o,o'-Di-(2-oxoethyl)-2',7'-dichlorofluorescein (Compound 93)
[0431] Protected aldehyde 92 (0.30 g, 0.52 mmol) was dissolved 10
mL of dioxane. Conc. HCl (3 mL) was added and the mixture was
stirred for 40 min at RT. Then it was diluted with 80 mL of water
and the product was extracted with ethyl acetate (4.times.30 mL).
The combined extracts were washed with water (30 mL), brine (30
mL), dried over sodium sulfate and evaporated. The residue was
re-dissolved in ethyl acetate and loaded on silica gel column
(packed in ethyl acetate). The column was eluted with ethyl
acetate. Pure fractions containing the product were combined and
solvent was evaporated to give aldehyde 93 as a yellow glass (0.26
g, quant.).
##STR00132##
3-Acetoxymethyl-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thia-1-aza-bicycl-
o[4.2.0]oct-2-ene-2-carboxylic acid allyl ester (Compound 95)
[0432] Tetrabutylammonium hydrogensulfate (7.40 g, 21.8 mmol) was
dissolved in 50 mL of water and pH of solution was adjusted to 7.0
using conc. NaHCO.sub.3. Cephalothune sodium salt 94 (9.12 g, 21.8
mmol) was added to the solution and tetrabutylammonium salt was
extracted with methylene chloride (6.times.60 mL+8.times.30 mL).
The combined extracts were dried over sodium sulfate and
concentrated in vacuum. The residue was re-dissolved in
acetonitrile (400 mL) and then allyl bromide (18.8 mL, 218 mmol)
was added to the solution. The reaction mixture was stirred
overnight at RT and evaporated. The residue was re-dissolved in
ethyl acetate (400 mL) and washed with 1% HCl (2.times.50 mL),
water (50 mL), brine (50 mL) and dry over sodium sulfate to give
allyl ester 95 as a white solid (9.55 g, quant.).
3-lodomethyl-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thia-1-aza-bicyclo[4.-
2.0]oct-2-ene-2-carboxylicacid allyl ester (Compound 96)
[0433] Acetate 95 (3.00 g, 6.88 mmol) was dissolved in 15 mL of dry
methylene chloride and solution was cooled using ice/water bath.
Trimethylsilyl iodide was added to the solution and reaction
mixture was stirred for .about.20 min on ice/water bath and then
.about.40 min at RT. The solution was diluted with 120 mL of ethyl
acetate and washed with 10% Na.sub.2S.sub.2O.sub.3 solution
(2.times.40 mL), sat. NaHCO.sub.3 solution (2.times.40 mL), brine
(40 mL) and dried over sodium sulfate. The crude product was
re-dissolved in chloroform and loaded on silica gel column (packed
in chloroform). The column was eluted with 6:1 chloroform-EtOAc
mixture. Pure fractions containing product were combined and the
solvent was evaporated to give iodide 96 as a yellow solid (2.69 g,
77%).
[2-Allyloxycarbonyl-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thia-1-aza-bic-
yclo[4.2.0]oct-2-en-3-ylmethyl]-triphenyl-phosphonium iodide
(Compound 97)
[0434] Iodide 96 (2.69 g, 5.34 mmol) was dissolved in 15 mL of
ethyl acetate. Triphenylphosphine (1.68 g, 6.40 mmol) was added as
a solution in 6 mL of ethyl acetate. The resulting mixture was
stirred for 35 min at RT. Yellow precipitate was collected on
fritted glass funnel, washed with ethyl acetate (3.times.10 mL) and
dried in vacuum to give phosphonium salt 97 as a yellow powder
(2.82 g, 69%).
o,o'-Di-{3-[2-allyloxycarbonyl-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thi-
a-1-aza-bicyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-dichlorofluorescein
(Compound 98)
[0435] Phosphonium salt 97 (0.57 g, 0.744 mmol) was dissolved in 40
mL of methylene chloride. 1M KOH (7.4 mL, 7.4 mmol) was adde to the
solution and the mixture was stirred for 30 min at RT. Organic
layer was separated, dried over magnesium sulfate and filtered. The
resulting solution was added to the flask containing freshly
prepared aldehyde 93 (0.120 g, 0.248 mmol). The reaction mixture
was stirred overnight at RT and then concentrated in vacuum. The
crude product was dissolved in chloroform and loaded on silica gel
column (packed in chloroform). The column was eluted with 3:1
chloroform-EtOAc mixture. Fractions containing pure product were
combined and evaporated to obtain 98 as yellow foam (0.100 g,
11%).
o,o'-Di-{3-[2-carbxy-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thia-1-aza-bi-
cyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-dichlorofluorescein
(Compound 99)
[0436] Allyl ester 98 (0.050 g, 0.041 mmol) was dissolved in 2 mL
of methylene chloride. Triphenylphosphine (0.0026 g, 0.0.0099 mmol)
and tetrakis(triphenylphosphine)palladium(0) (0.0019 g, 0.0016
mmol) were added to solution followed by adding of sodium
2-ethylhexanoate (0.015 g, 0.090 mmol) dissolved in 15 mL of EtOAc.
The reaction mixture was stirred for 40 min at RT and then acetic
acid (0.2 mL) was added. The reaction mixture was concentrated in
vacuum and re-evaporated from toluene. The residue was washed with
hexanes (2.times.30 mL) and dried in vacuum. The resulting solid
was mixed with 10 mL of 1% HCl and extracted with ethyl acetate
(4.times.20 mL). The organic solution was washed with brine (30
mL), dried over sodium sulfate and evaporated to give acid 99 as a
brown glass (0.05 g, quant.).
o,o'-Di-(3-(2-carboxy-5,8-dioxo-7-(2-thiophen-2-yl-acetylamino)-5.lamda..s-
up.4-thia-1-aza-bicyclo[4.2.0]oct-2-en-3-yl)-allyl-2',7'-dichlorofluoresce-
in (Compound 100)
[0437] Acid 99 (0.05 g, 0.044 mmol) was sonicated with 3 mL of
methylene chloride and filtered. The solution was cooled using
ice/water bath. m-Chloroperoxybenzoic acid (77% pure, 0.022 g,
0.098 mmol) was added as a solution in 1 mL of methylene chloride.
The resulting mixture was stirred for 30 min in ice/water bath and
then put on centrifuge for 15 min. Supernatant was discarded and
centrifugation was repeated twice with fresh 2 mL of methylene
chloride. Solid was dried in vacuum and then washed with 0.5 mL of
methanol. The mixture was put on centrifuge for 10 min, supernatant
was discarded. Repeated two times with 0.5 mL of methanol. After
that, solid was dried in vacuum to give sulfoxide 100 as yellow
powder (0.008 g, 16%).
##STR00133## ##STR00134##
Example 27
Preparation of
o,o'-Di-{3-[2-carboxy-5,8-dioxo-7-(2-thiophen-2-yl-acetylamino)-5.lamda..-
sup.4-thia-1-aza-bicyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-difluorofluores-
cein (Compound 108)
2-(2,7-difluoro-3,6-dihydroxy-9H-xanthen-9-yl)-benzoic acid
(Compound 101)
[0438] 2',7'-Difluoroscein (4.0 g, 10.9 mmol) was suspended in 330
mL of THF containing 10 mL of acetic acid. Zinc powder (30 g, 460
mmol) was added to the suspension portionwise during 4 hrs at RT
with vigorous stirring under nitrogen. Zinc was filtered off using
glass fritted funnel, washed with THF (4.times.30 mL). Combined
washings and solution were evaporated. The residue was mixed with
150 mL of 5% HCl, the product was extracted with EtOAc (4.times.40
mL). The combined extracts were washed with water (30 mL), brine
(30 mL), dried over sodium sulfate and evaporate to give acid 101
(yellow oil, about 7 g). It was used for the next step without
further purification.
2-[3,6-Bis-(2,2-dimethoxy-ethoxy)-2,7-difluoro-9H-xanthen-9-yl]-benzoic
acid 2,2-dimethoxy-ethyl ester (Compound 102)
[0439] Acid 101 (all material prepared in the previous step,
.about.10.9 mmol) was dissolved in 150 mL of DMF. Powdered
K.sub.2CO.sub.3 (25 g, 180 mmol) was added to the solution followed
by adding of bromoacetaldehyde dimethyl acetal (33.3. mL, 283
mmol). The reaction mixture was stirred overnight at 110.degree. C.
DMF solution was removed from the flask (leaving insoluble material
in the flask) and evaporated. The residue was mixed with 150 mL of
water and combined with the solid left in the flask. The product
was extracted with ethyl acetate (4.times.45 mL), combined extracts
were washed with water (4.times.30 mL), brine (30 mL), dried over
sodium sulfate and evaporated in vacuum. The residue was dissolved
in chloroform, loaded on silica gel column (packed in 100:3
chloroform-EtOAc mixture). The column was eluted with 100:3
chloroform-EtOAc mixture. Pure fractions containing the product
were combined and evaporated to give ester 102 as a clear oil,
solidified later to form white solid (4.54 g, 66%).
2-[3,6-Bis-(2,2-dimethoxy-ethoxy)-2,7-difluoro-9H-xanthen-9-yl]-benzoic
acid (Compound 103)
[0440] Ester 102 (4.54 g, 7.12 mmol) was dissolved in 470 mL of
1,4-dioxane. Water (144 mL) and 1M KOH (72 mL) were added to the
solution. The reaction mixture was stirred overnight at RT and then
concentrated in vacuum to .about.200 mL. 5% HCl (.about.100 mL) was
added and, the product was extracted with EtOAc (4.times.50 mL).
The combined extracts were washed with water (3.times.30 mL), brine
(40 mL), dried over sodium sulfate and evaporate to give acid 103
as a white solid (3.918 g, quant.).
o,o'-Di-(2,2-dimethoxyethyl)-2',7'-difluorofluorescein (Compound
104)
[0441] Acid 103 (3.92 g, 7.18 mmol) was dissolved in 100 mL of
chloroform and 80 mL of methanol. p-Chloranil (3.53 g, 14.4 mmol)
was added to solution and the mixture was stirred under reflux for
.about.6 hrs. Solvents were removed in vacuum, the residue was
suspended in chloroform and loaded on silica gel column (packed in
100:1 chloroform-EtOAc mixture). The column was eluted with 25:1
chloroform-EtOAc mixture, fractions containing the product were
combined and evaporated in vacuum. The residue was re-purified on
silica gel column (packed in chloroform) using first chloroform and
then 50:1 chloroform-EtOAc mixture to remove impurities. The
product was eluted with 25:1 chloroform-EtOAc. Pure fractions were
combined and solution evaporated to give pure 104 as a white solid
(3.86 g, 98%).
o,o'-Di-(2-oxoethyl)-2',7'-difluorofluorescein (Compound 105)
[0442] Protected aldehyde 104 (0.50 g, 0.92 mmol) was dissolved in
20 mL of dioxane. Conc. HCl (6 mL) was added and the mixture was
vigorously stirred for 40 min at RT. Then it was diluted with 150
mL of water, and the product was extracted with EtOAc (40,
3.times.30 mL). The combined extracts were washed with water
(4.times.30 mL), brine (30 mL), dried over sodium sulfate and
evaporated. The residue was dissolved in EtOAc and loaded on silica
gel column (packed in EtOAc). The column was eluted with EtOAc.
Pure fractions were combined and the solvent was evaporated to give
aldehyde 105 as a clear glass (0.436 g, quant.).
##STR00135##
o,o'-Di-{3-[2-alzyloxyarbonyl-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thi-
a-1-aza-bicyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-difluorofluorescein
(Compound 106)
[0443] Phosphonium salt 97 (2.82 g, 3.68 mmol) was dissolved in 80
mL of methylene chloride. 1M NaOH (41 mL, 41 mmol) was added to the
solution and reaction mixture was stirred for 30 min at RT. Organic
layer was separated, dried over magnesium sulfate and filtered. The
resulting solution was added to the flask containing freshly
prepared aldehyde 105 (0.616 g, 1.36 mmol). The reaction mixture
was stirred overnight at RT and then concentrated in vacuum. The
crude product was dissolved in chloroform and loaded on silica gel
column (packed in chloroform). The column was eluted with 3:1
chloroform-EtOAc mixture. Fractions containing pure product were
combined and evaporated to obtain 106 as yellow foam (0.807 g,
50%).
o,o'-Di-{3-[2-carboxy-8-oxo-7-(2-thiophen-2-yl-acetylamino)-5-thia-1-aza-b-
icyclo[4.2.0]oct-2-en-3-yl]-allyl}-2',7'-difluorofluorescein
(Compound 107)
[0444] Allyl ester 106 (0.775 g, 0.661 mmol) was dissolved in 26 mL
of dry methylene chloride. Triphenylphosphine (0.042 g, 0.16 mmol)
and tetrakis(triphenylphosphine)palladium(0) (0.030 g, 0.026 mmol)
were added to solution followed by adding of sodium
2-ethylhexanoate (0.243 g, 1.46 mmol) dissolved in 15 mL of EtOAc.
The reaction mixture was stirred for 40 min at RT and then acetic
acid (1 mL) was added. The reaction mixture was concentrated in
vacuum and re-evaporated from toluene. The residue was washed with
hexanes (2.times.30 mL) and dried in vacuum. The resulting solid
was mixed with 80 mL of 1% HCl and extracted with ethyl acetate
(2.times.40 mL). All insoluble in ethyl acetate/1% HCl brown
material was dissolved in 10:1 ethyl acetate-methanol mixture and
solution combined with EtOAc extracts. The organic solution was
washed with brine (30 mL), dried over sodium sulfate and evaporated
to give acid 107 as a brown glass (0.755 g, quant).
o,o'-Di-(3-(
2-carboxy-5,8-dioxo-7-(2-thiophen-2-yl-acetylamino)-5.lamda..sup.4-thia-1-
-aza-bicyclo[4.2.0]oct-2-en-3-yl)-allyl-2',7'-difluorofluorescein
(Compound 108)
[0445] Acid 107 (0.755 g, 0.690 mmol) was sonicated with 100 mL of
methylene chloride and filtered. The solution was concentrated at
30.degree. C. until fine precipitate start to form and then cooled
using ice/water bath. m-Chloroperoxybenzoic acid (77% pure, 0.341
g, 1.52 mmol) was added as a solution in 5 mL of methylene
chloride. The resulting mixture was stirred for 30 min in ice/water
bath and then put on centrifuge for 15 min. Supernatant was
discarded and centrifugation was repeated twice with fresh 8 mL of
methylene chloride. Solid was dried in vacuum and then washed with
2 mL of methanol. The mixture was put on centrifuge for 10 min,
supernatant was discarded. Repeated two times with 2 mL of
methanol. After that solid was dried in vacuum to give sulfoxide
108 as a yellow powder (0.219 g, 28%).
##STR00136##
Example 28
7-[3-(4,4-Difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacen-3-yl)-propion-
ylamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5-th-
ia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid 117
4-(4-dimethylaminophenylazophenyl) 4-aminophenyl disulfide
(Compound 109)
[0446] 4-Aminodisulfide (1.03 g, 4.03 mmol) was dissolved in 100 mL
of methanol and 6.5 mL of acetic acid. The solution was cooled down
to 0.degree. C. using ice/salt bath. Conc. H.sub.2SO.sub.4 (0.05
mL) was added to the solution followed by dropwise addition of
NaNO.sub.2 (0.61 g, 8.8 mmol) dissolved in 10 mL of water keeping
the temperature of reaction mixture in 0.degree. C.-+5.degree. C.
interval. The resulting solution was stirred for 1 h at 0.degree.
C. The solution of N,N-dimethylaminoaniline (0.911 mL, 7.19 mmol)
in 5 mL of methanol was added to reaction mixture followed by
adding of sodium acetate (25.0 g, 184 mmol) in 60 mL of water. The
reaction mixture was allowed to warm to RT, and then it was stirred
overnight. The mixture was diluted with 200 mL of water and
filtered using glass fritted funnel. Clear solution was discarded,
all insoluble material (including solid collected on the funnel and
the brown gummy material in the flask) was dissolved in chloroform
(-150 mL), washed with water (30 mL), brine (30 mL), dried over
sodium sulfate and evaporated. The crude material was re-dissolved
in chloroform and loaded on silica gel column (packed in
chloroform). The column was eluted first with chloroform to
separated disulfide 110 (minor component), then with 5% ethyl
acetate in chloroform to separate amine 109 (major component, 1.04
g, 22%) as an orange solid.
4-(4-Dimethylamino-phenylazo)-phenyl disulfide (Compound 110)
[0447] Amine 109 (1.04 g, 2.73 mmol) was dissolved in the mixture
of methanol (30 mL) and dioxane (30 mL) and the solution was cooled
using ice/water bath. NaBH.sub.4 (1.03 g, 27.2 mmol) was added and
the reaction mixture was stirred for 15 min under nitrogen. Then
170 mL of 12% acetic acid was added and the products were extracted
with ethyl acetate (4.times.30 mL). The combined extracts were
washed with water (3.times.30 mL), brine (30 mL), dried over sodium
sulfate and evaporated. The residue was dissolved in chloroform and
loaded on silica gel column (packed in chloroform). The column was
eluted with chloroform to remove mixture of two products:
thiophenol 111 and disulfide 110 (TLC solvent: 3:1 hexanes-EtOAc).
Chloroform was evaporated and the residue was re-dissolved in 80 mL
of ethyl acetate and 40 mL of chloroform. Iodine (0.10 g, 0.39
mmol) was added to the solution to oxidize 111 to disulfide 110. If
reaction is not complete (control by TLC) after 5 min, more iodine
(.about.0.05 g) needs to be added. Sat. NaHCO.sub.3 (50 mL) was
added to reaction mixture and organic solution was separated. Water
solution containing insoluble product was extracted with chloroform
until all insoluble material dissolved in chloroform. The combined
organic solutions were washed with brine (40 mL), dried over sodium
sulfate and evaporated to give crude disulfide 110. It was combined
with disulfide obtained as the minor product in the first step and
the resulting material was washed with hexanes (2.times.30 mL),
dissolved in chloroform and loaded on silica gel column (packed in
chloroform). The column was eluted with chloroform, pure fractions
combined and solvent was evaporated to give disulfide 110 as an
orange solid (0.684 g, 49%).
4-(4-Dimethylamino-phenylazo)-benzenethiol (Compound 111)
[0448] Disulfide 110 (0.326 g, 0.637 mmol) was suspended in
methanol (10 mL) and dioxane (10 mL) mixture. NaBH.sub.4 (0.313 g,
8.27 mmol) was added to the suspension and the reaction mixture was
stirred for 15 min at RT under nitrogen. Dark red solution was
diluted with 100 mL of 5% acetic acid and the product was extracted
with ethyl acetate (3.times.40 mL). The combined extracts were
washed with water (3.times.30 mL), brine (30 mL), dried over sodium
sulfate and evaporated to give thiol 111 as orange solid (0.269 g,
82%). The product was used for the next step without further
purification.
7-Amino-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5-thi-
a-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid benzhydryl ester
(Compound 113)
[0449] Hydrochloride 112 (Otsuka Chemical, 0.422 g, 0.935 mmol) was
mixed with 100 mL of sat. NaHCO.sub.3. Free amine was extracted
with ethyl acetate (5.times.30 mL). The combined extracts were
washed with brine (30 mL), dried over sodium sulfate and
evaporated. The residue was dissolved in 30 mL of chloroform then
thiol 111 was added followed by adding of i-Pr.sub.2NEt (0.182 mL,
1.05 mmol). Reaction mixture was stirred for 1.5 hrs at RT, then
diluted with 50 mL of chloroform and washed with 5% acetic acid
(2.times.30 mL), water (2.times.30 mL), brine (30 mL), dried over
sodium sulfate and evaporated. The residue was re-evaporated from
toluene (20 mL), dissolved in chloroform and loaded on silica gel
column (packed in chloroform). The column was eluted with 3:1
chloroform-EtOAc mixture. Pure fractions were combined and
evaporated to give amine 113 (red foam, 0.320 g, 54%).
7-[3-(4,4-Difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacen-3-yl)-propion-
ylamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5-th-
ia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid benzhydril ester
(Compound 116)
[0450] BODIPY acid 114 (Molecular Probes, 0.100 g, 0.342 mmol) was
dissolved in dry methylene chloride (10 mL) containing 3 drops of
DMF. Oxalyl chloride (0.082 mL, 0.94 mmol) was added to the
solution and the reaction mixture was stirred for 15 min at RT.
Then solution was concentrated in vacuum at 30.degree. C. and the
residue was re-evaporated from toluene to give acid chloride 115 as
an orange gum (.about.0.11 g). The resulting material was dissolved
in 6 mL of methylene chloride and the solution was added dropwise
to the solution of amine 113 (0.198 g, 0.311 mmol) in 10 mL of
methylene chloride containing N,N-diisopropyl ethyl amine (0.163
mL, 0.937 mmol). The reaction mixture was stirred for 15 min at RT
then diluted with 100 mL of methylene chloride and washed with 3%
acetic acid (2.times.30 mL), water (30 mL), sat. NaHCO.sub.3
(2.times.30 mL), dried over sodium sulfate and evaporated. The
residue was dissolved in chloroform and loaded on silica gel column
(packed in chloroform). The column was eluted with 100:2
chloroform-ethyl acetate to 100:6 chloroform-ethyl acetate mixture.
All fractions containing desired material (TLC hexanes-ethyl
acetate 1:1) were combined and evaporated. The residue was
re-dissolved in .about.3 mL of chloroform and precipitated from the
solution with 6 mL of methanol. The resulting solid was
re-crystallized from 4:3 chloroform-methanol mixture to give amid
116 as orange solid (0.164 g, 58%).
7-[3-(4,4-Difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacen-3-yl)-propion-
ylamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5-th-
ia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid (Compound
117)
[0451] Ester 116 (0.164 g, 0.180 mmol) and thioanisol (4.9 mL, 41.7
mmol) were dissolved in 150 mL of methylene chloride. The solution
was cooled using ice/water bath and then cooled trifluoroacetic
acid (25 mL, 324 mmol) was added to the solution. The reaction
mixture was stirred for 15 min on ice/water bath, mixed with 150 mL
of icy cooled water and shaken. Water solution was removed and
extracted with methylene chloride (2.times.30 mL). Combined organic
solutions were washed with water (8.times.40 mL, until pH 7 of the
last water extract). Then it was washed with brine (40 mL), dried
over sodium sulfate and evaporated. The crude product was dissolved
in chloroform and loaded on silica gel column packed in
chloroform). The column was eluted firs with chloroform to remove
thioanisole, then with 10:1:0.05 chloroform-methanol-acetic acid.
Fractions containing desired material were combined and evaporated.
The residue was re-evaporated from toluene and dried in vacuum to
give acid 117 as black powder (0.096 g, 72%).
##STR00137## ##STR00138##
Example 29
7-[3-(4,4-Difluoro-5-(2-pyrrolyl)-4-bora-3a,4a-diaza-s-indacen-3-yl)-propi-
onylamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5--
thia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid 120
7-[3-(4,4-Difluoro-5-(2-pyrrolyi)-4-bora-3a,4a-diaza-s-indacen-3-yl)-propi-
onyiamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5--
thia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid benzhydril
ester (Compound 119)
[0452] 5-(2-pyrrolyl)-BODIPY acid 118 (0.052 g, 0.158 mmol) and
amine 113 (0.100 g, 0.157 mmol) were dissolved in 3 mL of
acetonitrile. EDC (0.030 g, 0.156 mmol) was adde to the solution
and reaction mixture was stirred overnight at RT. Then the reaction
mixture was diluted with chloroform (80 mL), washed with 3% acetic
acid (2.times.30 mL), water (4.times.30 mL), brine (30 mL) and
dried over sodium sulfate. The solution was evaporated, the residue
was re-dissolved in chloroform and loaded on silica gel column
(packed in chloroform). The column was eluted with 15:1
chloroform-ethyl acetate mixture. Pure fractions were combined and
evaporated to give amide 119 as a black gum (0.093 g, 62%).
7-[3-(4,4-Difluoro-5-(2-pyrrolyi)-4-bora-3a,4a-diaza-s-indacen-3-yl)-propi-
onyiamino]-3-[4-(4-dimethylamino-phenylazo)-phenylsulfanylmethyl]-8-oxo-5--
thia-1-aza-bicyclo[4.2.0]oct-2-ene-2-carboxylic acid (Compound
120)
[0453] Ester 119 (0.093 g, 0.098 mmol) and thioanisol (3.0 mL, 25.5
mmol) were dissolved in 90 mL of methylene chloride. The solution
was cooled using ice/water bath and then cooled trifluoroacetic
acid (30 mL, 389 mmol) was added to the solution. The reaction
mixture was stirred for 15 min on ice/water bath, mixed with 150 mL
of icy cooled water and shaken. Water solution was removed and
extracted with methylene chloride (2.times.30 mL). Combined organic
solutions were washed with water (8.times.40 mL, until pH 7 of the
last water extract). Then it was washed with brine (40 mL), dried
over sodium sulfate and evaporated. The crude product was dissolved
in chloroform and loaded on silica gel column packed in
chloroform). The column was eluted firs with chloroform to remove
thioanisole, then with 10:1:0.05 chloroform-methanol-acetic acid.
Pure fractions containing desired material were combined and
evaporated. The residue was re-evaporated from toluene and dried in
vacuum to give acid 120 as black powder (0.025 g, 33%).
##STR00139##
Example 30
Preparation of Compound 123
[0454] DDAO-hexanoic acid 121 (0.064 g, 0.157 mmol) and amine 113
(0.10 g, 0.157 mmol) were dissolved in 10 mL of acetonitrile. EDC
(0.030 g, 0.156 mmol) was added to the solution and the reaction
mixture was stirred overnight at RT. Then the mixture was diluted
with 100 mL of chloroform, washed with water (30 mL), brine (30
mL), dried over sodium sulfate and evaporated. The residue was
dissolved in chloroform and loaded on silica gel column (packed in
chloroform). The column was eluted with 1:1 chloroform-ethyl
acetate. The desired product and unreacted amine 113 came out
together. Fractions containing both compounds were combined and
evaporated. The residue was re-dissolved in 80 mL of ethyl acetate
and amine 113 was washed out using 10% HCl (4.times.30 mL). The
organic solution was washed with brine (30 mL), dried over sodium
sulfate and evaporated to give amide 122 as a black powder (0.023
g, 14%).
[0455] Ester 122 (0.023 g, 0.022 mmol) and thioanisol (1.0 mL, 8.5
mmol) were dissolved in 30 mL of methylene chloride. The solution
was cooled using ice/water bath and then cooled trifluoroacetic
acid (6 mL, 65 mmol) was added to the solution. The reaction
mixture was stirred for 15 min on ice/water bath, and then diluted
with 80 mL of methylene chloride. Then it was washed with icy
cooled water (6.times.30 mL, until pH of of the last extract is
neutral), brine (30 mL), dried over sodium sulfate and evaporated.
The crude product was dissolved in chloroform and loaded on silica
gel column packed in chloroform). The column was eluted firs with
chloroform to remove thioanisole, then with 10:1:0.05
chloroform-methanol-acetic acid. Pure fractions containing desired
material were combined and evaporated. The residue was
re-evaporated from toluene and dried in vacuum to give acid 123 as
black powder (0.0062 g, 36%).
##STR00140##
Example 31
Preparation of Compound 128
[0456] 4-Nitroresorcinol (1.39 g, 10.0 mmol) was combined with
2,6-dihydroxybenzoic acid (1.69 g, 11.0 mmol). Conc.
H.sub.2SO.sub.4 was added and the mixture was stirred at 70.degree.
C. for 1 hr. Then it was cooled down to RT and diluted with icy
cooled water (300 mL). The product was extracted with ethyl acetate
(15.times.200 mL). The combined extracts were evaporated and the
residue was dissolved in 15% MeOH in chloroform, loaded on silica
gel column (packed in chloroform). The column was eluted with
chloroform, then with 10 to 15% methanol in chloroform and finally
with 15 to 30% methanol +1% acetic acid in chloroform. Clean
fractions were combined and evaporated to give carboxylic acid 124
as a dark brown solid (0.321 g, 19%).
[0457] Carboxylic acid 124 (0.119 g, 0.463 mmol) was dissolved in 8
mL of pyridine. The solution was cooled using ice/water bath. SE
trifluoroacetate (1.2 g, 5.68 mmol) was added to the solution and
the mixture was stirred for 30 min. The solution was diluted with
ethyl acetate (120 mL), washed with 5% acetic acid (6.times.30 mL),
water (4.times.30 mL), brine (30 mL), dried over sodium sulfate and
evaporated to give SE ester 125 as a brown solid (0.103 g,
63%).
[0458] SE ester 125 (0.103 g, 0.291 mmol) was dissolved in 10 mL of
dioxane. .beta.-Alanine (0.260 g, 2.92 mmol) was dissolved 5 mL of
water containing 5.8 mL of 1M Et.sub.3NH.sub.2CO.sub.3. Two
solutions were mixed and the resulting mixture was stirred
overnight at RT. The reaction mixture was diluted with 80 mL of 2%
HCl and the product was extracted with ethyl acetate (5.times.30
mL). The combined extracts were washed with water (3.times.30 mL),
brine (30 mL), dried over sodium sulfate and evaporated to give
carboxylic acid 126 as a brown solid (0.072 g, 75%).
[0459] Carboxylic acid 126 (0.068 g, 0.207 mmol) was suspended in 5
ML acetonitrile and 2 mL of DMF. Amine 113 (0.126 g, 0.198 mmol)
was added to this suspension followed by adding EDC (0.040 g, 0.209
mmol). The resulting mixture was stirred overnight at RT. The
mixture was diluted with water (80 mL) and the product was
extracted with ethyl acetate (3.times.30 mL). The combined extract
was washed with water (3.times.30 mL), brine (30 mL), dried over
sodium sulfate and evaporated. The crude product was dissolved in
chloroform and loaded on preparative TLC plate. The plate was
developed in 2:1 ethyl acetate-chloroform mixture. The red quenched
band was separated from the plate and the compound was washed from
silica gel using chloroform-ethyl acetate 1:1 mixture. The solution
was evaporated to give desired amide 127 (0.038 g, 20%).
[0460] Ester 127 (0.038 g, 0.040 mmol) and thioanisol (1.15 mL,
9.77 mmol) were dissolved in 36 mL of methylene chloride. The
solution was cooled using ice/water bath and then cooled
trifluoroacetic acid (11.5 mL, 124 mmol) was added to the solution.
The reaction mixture was stirred for 15 min on ice/water bath, and
then diluted with 80 mL of methylene chloride. Then it was washed
with icy cooled water (6.times.30 mL, until pH of of the last
extract is neutral), brine (30 mL), dried over sodium sulfate and
evaporated. The crude product was dissolved in chloroform and
loaded on silica gel column packed in chloroform). The column was
eluted firs with chloroform to remove thioanisole, then with
10:1:0.05 chloroform-methanol-acetic acid. Pure fractions
containing desired material were combined and evaporated. The
residue was re-evaporated from toluene and dried in vacuum to give
acid 128 as a black powder (0.013 g, 41%).
##STR00141##
Example 32
Development for ELISA Method Using .beta.-Lactamase Enzyme
Conjugated to a Detection Reagent and a .beta.-Lacatamase
Fluorogenic Substrate
[0461] Screening Method:
[0462] Dilutions of TEM-1 or a TEM-1 enzyme/protein conjugate were
prepared, with concentrations ranging from .about.100 pg/mL to
.about.10 .mu.g/mL total protein plus several negative controls (no
TEM-1). Several replicates of each dilution were added to a 96-well
plate. The substrate to be tested was prepared in water or pH 7.2
PBS at a concentration of .about.10 .mu.g/mL and immediately added
to the TEM-1 dilutions and controls. The volume of substrate added
was equivalent to the amount of TEM-1 solution present, so that
enzyme and substrate final concentrations were half the initial
concentrations. The plate was read at various time points after
addition of substrate to the enzyme dilutions. Overall fluorescence
(proportional to the instrument gain setting), variance of signal
(for replicates), and monotonicity (more enzyme results in higher
signal) were the primary screening criteria. This screening method
also applies to other .beta.-lactamase variants, such as p99. It
can be used to test a new substrate's activity with an enzyme, or
an enzyme's activity with a working substrate after the enzyme has
been conjugated. See FIG. 6, which show examples of a substrate
with high TEM-1 activity (FIG. 6A), and with very low TEM-1
activity (FIG. 6B).
[0463] A variety of substrates were tested including Compound 123,
128, 108, 100, 117 and 120
[0464] K.sub.m Determination:
[0465] Both K.sub.m and V.sub.mex are parameters used to describe
enzyme/substrate activity. While K.sub.m is constant regardless of
enzyme or substrate concentration, V.sub.mex is only constant for a
given enzyme concentration. The Michaelis-Menten equation is used
to derive both V.sub.mex and K.sub.m:
d[P]/dt=V.sub.max[S]/(K.sub.m+[S]) (1)
[0466] [S] is substrate concentration, while [P] is product
concentration. The reaction's initial velocity, v.sub.0, is defined
as d[P]/dt at time zero. If we only look at the initial velocity,
Equation 1 becomes:
v.sub.0=V.sub.max[S]/(K.sub.m+[S]) (2)
[0467] Both the Lineweaver-Burk and Scatchard equations are simply
linearizations of the Michaelis-Menten equation:
[0468] Lineweaver-Burk Equation
1/v.sub.0=K.sub.m/V.sub.max*1/[S]+1/V.sub.max (3)
[0469] Scatchard Equation
v.sub.0/[S]=(-1/K.sub.m)*v.sub.0+V.sub.max/K.sub.m (4)
[0470] For determination of K.sub.m of the .beta.-lactamase
substrate with TEM-1, substrates ranging from 40 .mu.g/mL to 5
.mu.g/mL were added to microplate wells with a constant
concentration of 5 nM TEM-1. The plate was read for the first 5
minutes with a Tecan Safire fluorescence plate reader using a
constant gain setting. Relative Fluorescence Units (RFUs) were
converted into moles of product produced using a standard curve of
the substrate's fluorescent product. This standard curve was
produced by adding an excess of TEM-1 (0.5 .mu.M) to an equal
volume of substrate, and incubating for more than 1 hour. Substrate
standard concentrations ranged from 16 nM to 2 .mu.M. It was
assumed the reaction went to completion. All enzyme and substrate
solutions were prepared in PBS, pH 7.2. See, FIG. 7, which shows
the Lineweaver-Burk and Scatchard plots for TEM-1 with the
.beta.-lactamase substrate, and FIG. 8 which plots the
experimentally-determined values for v.sub.0 along with theoretical
curves based on the K.sub.m and V.sub.mex values obtained from the
Lineweaver-Burk and Scatchard plots:
[0471] The table below summarizes K.sub.m determinations for both
methods.
TABLE-US-00010 TABLE 10 K.sub.m as determined from Lineweaver-Burk
and Scatchard plots. K.sub.m (.mu.M) R.sup.2 K.sub.m difluoro
(linear model equation (variables) sub. regression) Scatchard v/[S]
= (-1/Km) * -1 36 .986 v + Vmax/Km slope Lineweaver- 1/v = Km/Vmax
* -intercent 40 .999 Burk 1/[S] + 1/Vmax slope
[0472] pH Range, Hydrolysis Rate:
[0473] Solutions of Compound 108 (1 .mu.g/mL) were prepared in pH
5.5 MES, pH 7.2 PBS, and pH 8.0 Tris-HCl, then added to 16 wells of
a 96-well plate. For each pH, high concentrations of TEM-1 were
added to 4 wells to obtain a maximum signal (assuming complete
cleavage of all substrate). The entire plate was read every 15 min.
for 250 min. All fluorescent signals were averaged, then normalized
to a percentage of the maximum fluorescence. The pH 5.5 MES and pH
7.2 PBS showed nearly identical hydrolysis rates, while the
hydrolysis for pH 8.0 Tris-HCl was about double that rate. The
Tris-HCl samples increased in fluorescence about 7.5% over 250
min., corresponding to complete hydrolysis after about 55 hrs. The
MES and PBS samples increase in fluorescence about 3.25% over 250
min., corresponding to complete hydrolysis after about 128 hrs.
These estimations assume a constant rate of hydrolysis. See FIG. 4,
which shows the fluorescence at each pH (as a percentage of the
maximum fluorescence at that pH) versus time due to hydrolysis as a
function of time nad pH.
[0474] Optimization of TEM-1 and .beta.-lactamase Substrate
Concentrations:
[0475] Optimal concentrations for use in ELISA-format assays was
determined experimentally using a model sandwich ELISA to detect
human Prostate Specific Antigen (PSA). For each sandwich ELISA, a
Nunc Maxisorp 96-well plate was coated with a monoclonal mouse
anti-PSA antibody, then blocked with BSA. A range of concentrations
of a PSA standard was added to the plate, including negative
controls (no PSA). The PSA standards were detected with a
polyclonal rabbit anti-PSA antibody, then a secondary conjugate of
goat anti-rabbit TEM-1. Plates were developed by addition of a
.beta.-lactamase substrate solution to drained wells, then
measurement of fluorescence on the Tecan Safire fluorescence plate
reader.
[0476] There were several criteria used to evaluate enzyme and
substrate concentrations. a) The Z-factor, which indicates the
lower limit of detection.
[0477] b) Monotonicity. That is, a higher concentration of the
antigen (PSA) should produce a larger fluorescent signal.
[0478] c) Dynamic range; a broader range was more desirable.
[0479] d) Goodness of fit, in which the fluorescent signal vs. PSA
concentration data set was fit with a four-parameter model, where
the four parameters are designated as A, M, Q, and n:
fluorescence=A+[M*(concentration).sup.n]/[Q+(concentration).sup.n]
(1)
[0480] After the parameters have been optimized to give the lowest
residuals, we can solve for concentration:
concentration={Q*[(fluorescence-A)/M]/[1-(fluorescence-A)/M]}.sup.1/n
(2)
[0481] The known PSA concentration is compared with the
concentration calculated from the signal and fit parameters. A
close correlation between known and calculated concentration was
desirable. Consistant results were obtained using TEM-1
concentrations ranging from 0.1-10 .mu.g/mL and .beta.-lactamase
substrate concentrations ranging from 1-10 .mu.g/mL. Furthermore,
results did not deteriorate when the plate continued to incubate
for up to 24 hrs for samples with low to moderate PSA
concentrations. Sensitivity for higher PSA concentrations did
deteriorate if the plate was incubated too long. By reading the
plate early (15-30 min.) and later (up to 24 hrs later) better
results were obtained for both the low- and high-ends of the PSA
concentration range. See, FIG. 9 which shows normalized fluorescent
signal and Z-factors for some of the enzyme and substrate
concentrations tested. See, FIG. 10, which shows fluorescent signal
and Z-factors vs. PSA concentration for an optimized assay.
Example 33
Fluorescence from Precipitating .beta.-Lactamase Substrate
[0482] 3.08 mg of Compound 38 was dissolved in 3 mL of methanol to
give a stock solution of 2 mM. This was diluted 4-fold to give a
working solution of 500 uM. 200 uL of Compound 38 was added to 100
mM phosphate, 150 mM NaCl (pH 7.1) in a cuvette to give a final
volume of 2 mL (50 .mu.M final concentration of Compound 38). To
another cuvette, TEM-1 .beta.-lactamase was added to give a final
concentration of 250 nM, with a substrate concentration of 50 .mu.M
and final volume of 2 mL. Samples were excited @ 360 nm and spectra
were plotted from 400-700 nm.
Example 34
Fluorescence from Precipitating .beta.-Lactamase Substrate
[0483] 4 mg of Compound 38 was dissolved in 2:1 H.sub.2O:methanol
to give a stock solution concentration of 2 mM. This was diluted
2-fold in methanol to give a working solution of 1 mM. 20 .mu.L of
250 nM TEM-1 .beta.-lactamase was added to the wells of a 96-well
microplate. Appropriate volumes of substrate were added to the
wells to give final concentrations of 0, 30, 50, 60, 75, 100, 140,
160 and 200 uM after diluting to 100 .mu.L with 100 mM phosphate,
150 mM NaCl (pH 7.1). The final .beta.-lactamase concentration was
50 nM. Samples were excited @ 360 nm and fluorescence was measured
@ 450 nm, signal was read @ 5, 13, 19, 26, 35, 45, 51 and 65
minutes. Maximum signal was attained after 5 minutes. The substrate
exhibited at least a 90-fold enhancement upon reaction
w/.beta.-lactamase. The signal dropped at high concentrations of
substrate presumably due to decreased solubility. Experiments were
also done in the presence of 40% methanol, but no reaction
occurred.
Example 35
Preparation of .beta.-Lactamase Enzyme Conjugates (Strpetaviding
and IgG)
[0484] SMCC Derivatization of TEM-1 Enzyme.
[0485] After dialysis into pH 7.5 coupling buffer (0.1 M NaPhos,
0.1 M NaCl) the enzyme (5-10 mg/ml concentration) is modified with
SMCC (succinimidyl maleimidomethyl cyclohexane carboxylate, at MR
(molar ratio) 8 for 30 min (room temp). Unreacted SMCC is then
removed by standard desalting chromatography over P30 or G50
resin.
[0486] DTT Reduction of IgG.
[0487] IgG (concentration 5-10 mg/ml in pH 7.5 bfr) is reduced with
50 mM DTT (dithiothreitol) for 30 minutes at room temp. The reagent
is then removed by desalting chromatography.
[0488] IgG-BLA Conjugation.
[0489] Immediately after DTT treatment, the reduced IgG is mixed
with SMCC-modified BLA (equimolar ratio) and allowed to react for
1-2 hrs at room temp or overnight at 4 degrees C. The IgG-BLA
conjugate product is purified by size-exclusion chromatography (gel
filtration) over P-100 resin.
[0490] SPDP/DTT Modification of Streptavidin.
[0491] Streptavidin (5-10 mg/ml in pH 7.5 bfr) is reacted with SPDP
(succinimidylpyridyl dithiopropionate) at MR 8 for 30 minutes at
room temp, then the reagent is removed by desalting chromatography.
This material is then treated with 50 mM DTT for 30 min (RT), and
purified by desalting chromatography.
[0492] Streptavidin-BLA Conjugation.
[0493] SPDP-modified/DTT-reduced streptavidin is mixed with
SMCC-modified BLA (equimolar ratio) and allowed to react for 1-2
hrs RT (or overnight at 4 degrees). The streptavidin-BLA conjugate
product is purified by gel filtration over P-60 resin.
[0494] The preceding examples can be repeated with similar success
by substituting the specifically described compounds of the
preceding examples with those generically and specifically
described in the foregoing description. One skilled in the art can
easily ascertain the essential characteristics of the present
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications of the invention to
adapt to various usages and conditions. All patents and patent
applications cited herein are hereby incorporated by reference in
their entirety for all purposes.
Sequence CWU 1
1
1161265PRTKlebsiella pneumoniae 1Met Gly His Pro Glu Thr Leu Val
Lys Val Lys Asp Ala Glu Asp Gln1 5 10 15Leu Gly Ala Arg Val Gly Tyr
Ile Glu Leu Asp Leu Asn Ser Gly Lys 20 25 30Ile Leu Glu Ser Phe Arg
Pro Glu Glu Arg Phe Pro Met Met Ser Thr 35 40 45Phe Lys Val Leu Leu
Cys Gly Ala Val Leu Ser Arg Asp Asp Ala Gly 50 55 60Gln Glu Gln Leu
Gly Arg Arg Ile His Tyr Ser Gln Asn Asp Leu Val65 70 75 80Glu Tyr
Ser Pro Val Thr Glu Lys His Leu Thr Asp Gly Met Thr Val 85 90 95Arg
Glu Leu Cys Ser Ala Ala Ile Thr Met Ser Asp Asn Thr Ala Ala 100 105
110Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys Glu Leu Thr Ala Phe
115 120 125Leu His Asn Met Gly Asp His Val Thr Arg Leu Asp His Trp
Glu Pro 130 135 140Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg Asp
Thr Thr Met Pro145 150 155 160Val Ala Met Ala Thr Thr Leu Arg Lys
Leu Leu Thr Gly Glu Leu Leu 165 170 175Thr Leu Ala Ser Arg Gln Gln
Leu Ile Asp Trp Met Glu Ala Asp Lys 180 185 190Val Ala Gly Pro Leu
Leu Arg Ser Ala Leu Pro Ala Gly Trp Phe Ile 195 200 205Ala Asp Lys
Ser Gly Ala Gly Glu Arg Gly Ser Arg Gly Ile Ile Ala 210 215 220Ala
Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile Val Val Ile Tyr Thr225 230
235 240Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn Arg Gln Ile Ala
Glu 245 250 255Ile Gly Ala Ser Leu Ile Lys His Trp 260
26525DNAVaccinia virus 2ycctt 537DNAEscherichia coli 3gcaactt
7415DNABacteriophage lambda 4gcttttttat actaa 1557DNABacteriophage
lambda 5tttatac 767DNABacteriophage lambda 6tttatac
777DNABacteriophage lambdamisc_feature(1)..(3)n is a, c, g, or t
7nnnatac 7821DNABacteriophage lambda 8caactttttt atacaaagtt g
2197DNABacteriophage lambda 9gaaatac 7107DNABacteriophage lambda
10gatatac 7117DNABacteriophage lambda 11acaatac
7127DNABacteriophage lambda 12tgcatac 7137DNABacteriophage lambda
13aaaatac 7147DNABacteriophage lambda 14aacatac
7157DNABacteriophage lambda 15aagatac 7167DNABacteriophage lambda
16aatatac 7177DNABacteriophage lambda 17acaatac
7187DNABacteriophage lambda 18accatac 7197DNABacteriophage lambda
19acgatac 7207DNABacteriophage lambda 20actatac
7217DNABacteriophage lambda 21agaatac 7227DNABacteriophage lambda
22agcatac 7237DNABacteriophage lambda 23aggatac
7247DNABacteriophage lambda 24agtatac 7257DNABacteriophage lambda
25ataatac 7267DNABacteriophage lambda 26atcatac
7277DNABacteriophage lambda 27atgatac 7287DNABacteriophage lambda
28attatac 7297DNABacteriophage lambda 29caaatac
7307DNABacteriophage lambda 30cacatac 7317DNABacteriophage lambda
31cagatac 7327DNABacteriophage lambda 32catatac
7337DNABacteriophage lambda 33ccaatac 7347DNABacteriophage lambda
34cccatac 7357DNABacteriophage lambda 35ccgatac
7367DNABacteriophage lambda 36cctatac 7377DNABacteriophage lambda
37cgaatac 7387DNABacteriophage lambda 38cgcatac
7397DNABacteriophage lambda 39cggatac 7407DNABacteriophage lambda
40cggatac 7417DNABacteriophage lambda 41ctaatac
7427DNABacteriophage lambda 42ctcatac 7437DNABacteriophage lambda
43ctgatac 7447DNABacteriophage lambda 44cttatac
7457DNABacteriophage lambda 45gaaatac 7467DNABacteriophage lambda
46gacatac 7477DNABacteriophage lambda 47gacatac
7487DNABacteriophage lambda 48gatatac 7497DNABacteriophage lambda
49gcaatac 7507DNABacteriophage lambda 50gccatac
7517DNABacteriophage lambda 51gcgatac 7527DNABacteriophage lambda
52gctatac 7537DNABacteriophage lambda 53ggaatac
7547DNABacteriophage lambda 54ggcatac 7557DNABacteriophage lambda
55gggatac 7567DNABacteriophage lambda 56ggtatac
7577DNABacteriophage lambda 57gtaatac 7587DNABacteriophage lambda
58gtcatac 7597DNABacteriophage lambda 59gtgatac
7607DNABacteriophage lambda 60gttatac 7617DNABacteriophage lambda
61taaatac 7627DNABacteriophage lambda 62tacatac
7637DNABacteriophage lambda 63tagatac 7647DNABacteriophage lambda
64tatatac 7657DNABacteriophage lambda 65tcaatac
7667DNABacteriophage lambda 66tccatac 7677DNABacteriophage lambda
67tcgatac 7687DNABacteriophage lambda 68tctatac
7697DNABacteriophage lambda 69tgaatac 7707DNABacteriophage lambda
70tgcatac 7717DNABacteriophage lambda 71tggatac
7727DNABacteriophage lambda 72tgtatac 7737DNABacteriophage lambda
73ttaatac 7747DNABacteriophage lambda 74ttcatac
7757DNABacteriophage lambda 75ttgatac 7767DNABacteriophage lambda
76tttatac 77725DNABacteriophage lambda 77agcctgcttt tttgtacaaa
cttgt 2578233DNABacteriophage lambda 78tacaggtcac taataccatc
taagtagttg attcatagtg actggatatg ttgtgtttta 60cagtattatg tagtctgttt
tttatgcaaa atctaattta atatattgat atttatatca 120ttttacgttt
ctcgttcagc ttttttgtac aaagttggca ttataaaaaa gcattgctca
180tcaatttgtt gcaacgaaca ggtcactatc agtcaaaata aaatcattat ttg
23379100DNABacteriophage lambda 79caaataatga ttttattttg actgatagtg
acctgttcgt tgcaacaaat tgataagcaa 60tgctttttta taatgccaac tttgtacaaa
aaagcaggct 10080125DNABacteriophage lambda 80acaagtttgt acaaaaaagc
tgaacgagaa acgtaaaatg atataaatat caatatatta 60aattagattt tgcataaaaa
acagactaca taatactgta aaacacaaca tatccagtca 120ctatg
1258127DNABacteriophage lambda 81agcctgcttt tttatactaa cttgagc
278227DNABacteriophage lambda 82gttcagcttt tttatactaa gttggca
278327DNABacteriophage lambda 83agcctgcttt tttatactaa gttggca
278427DNABacteriophage lambda 84gttcagcttt tttatactaa cttgagc
278525DNABacteriophage lambda 85agcctgcttt tttgtacaaa cttgt
258627DNABacteriophage lambda 86gttcagcttt tttgtacaaa gttggca
278727DNABacteriophage lambda 87agcctgcttt tttgtacaaa gttggca
278825DNABacteriophage lambda 88gttcagcttt tttgtacaaa cttgt
258925DNABacteriophage lambda 89acccagcttt cttgtacaaa gtggt
259027DNABacteriophage lambda 90gttcagcttt cttgtacaaa gttggca
279127DNABacteriophage lambda 91acccagcttt cttgtacaaa gttggca
279225DNABacteriophage lambda 92gttcagcttt cttgtacaaa gtggt
259322DNABacteriophage lambda 93caactttatt atacaaagtt gt
229427DNABacteriophage lambda 94gttcaacttt attatacaaa gttggca
279524DNABacteriophage lambda 95caactttatt atacaaagtt ggca
249625DNABacteriophage lambda 96gttcaacttt attatacaaa gttgt
259722DNABacteriophage lambda 97caacttttct atacaaagtt gt
229827DNABacteriophage lambda 98gttcaacttt tctatacaaa gttggca
279924DNABacteriophage lambda 99caacttttct atacaaagtt ggca
2410025DNABacteriophage lambda 100gttcaacttt tctatacaaa gttgt
2510122DNABacteriophage lambda 101caacttttgt atacaaagtt gt
2210227DNABacteriophage lambda 102gttcaacttt tgtatacaaa gttggca
2710324DNABacteriophage lambda 103caacttttgt atacaaagtt ggca
2410425DNABacteriophage lambda 104gttcaacttt tgtatacaaa gttgt
2510522DNABacteriophage lambda 105caactttttc gtacaaagtt gt
2210627DNABacteriophage lambda 106gttcaacttt ttcgtacaaa gttggca
2710724DNABacteriophage lambda 107caactttttc gtacaaagtt ggca
2410825DNABacteriophage lambda 108gttcaacttt ttcgtacaaa gttgt
2510922DNABacteriophage lambda 109caactttttg gtacaaagtt gt
2211027DNABacteriophage lambda 110gttcaacttt ttggtacaaa gttggca
2711124DNABacteriophage lambda 111caactttttg gtacaaagtt ggca
2411225DNABacteriophage lambda 112gttcaacttt ttggtacaaa gttgt
2511322DNABacteriophage lambda 113caacttttta atacaaagtt gt
2211427DNABacteriophage lambda 114gttcaacttt ttaatacaaa gttggca
2711524DNABacteriophage lambda 115caacttttta atacaaagtt ggca
2411625DNABacteriophage lambda 116gttcaacttt ttaatacaaa gttgt
25
* * * * *