U.S. patent application number 11/836322 was filed with the patent office on 2009-02-12 for replication-deficient rna viruses as vaccines.
Invention is credited to Sascha Bossow, Wolfgang J. Neubert, Sabine Schlecht.
Application Number | 20090041725 11/836322 |
Document ID | / |
Family ID | 36353666 |
Filed Date | 2009-02-12 |
United States Patent
Application |
20090041725 |
Kind Code |
A1 |
Neubert; Wolfgang J. ; et
al. |
February 12, 2009 |
Replication-Deficient RNA Viruses as Vaccines
Abstract
The present invention relates to a genome-replication-deficient
and transcription-competent negative-strand RNA virus, which can be
used for the expression of transgenes and in particular for the
area of vaccine development.
Inventors: |
Neubert; Wolfgang J.;
(Greifenberg, DE) ; Bossow; Sascha; (Augsburg,
DE) ; Schlecht; Sabine; (Munchen, DE) |
Correspondence
Address: |
Beusse Wolter Sanks Mora & Maire
390 N. ORANGE AVENUE, SUITE 2500
ORLANDO
FL
32801
US
|
Family ID: |
36353666 |
Appl. No.: |
11/836322 |
Filed: |
August 9, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/EP06/01251 |
Feb 10, 2006 |
|
|
|
11836322 |
|
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/236; 435/325; 435/456; 536/23.72 |
Current CPC
Class: |
C12N 15/63 20130101;
A61P 35/00 20180101; C12N 2770/36143 20130101; A61K 48/00 20130101;
A61P 31/12 20180101; A61P 43/00 20180101; C12N 2510/00 20130101;
C12N 15/86 20130101; C12N 2760/18811 20130101 |
Class at
Publication: |
424/93.2 ;
435/236; 536/23.72; 435/325; 435/456 |
International
Class: |
A61K 35/76 20060101
A61K035/76; C12N 7/00 20060101 C12N007/00; C12N 15/11 20060101
C12N015/11; A61P 43/00 20060101 A61P043/00; C12N 5/06 20060101
C12N005/06; C12N 15/87 20060101 C12N015/87 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 11, 2005 |
DE |
10 2005 006 388.8 |
Claims
1. A recombinant negative-strand RNA virus, containing a viral
genome with a mutation in at least one of the genes L and P, which
leads to loss of capacity for replication without loss of capacity
for secondary transcription.
2. The virus as claimed in claim 1, characterized in that it is a
paramyxovirus.
3. The virus as claimed in claim 1, characterized in that it is a
Sendai virus.
4. The virus as claimed in claim 1, characterized in that it has a
mutation in gene P.
5. The virus as claimed in claim 4, characterized in that the
mutation relates to the N-terminal partial sequence of the protein
encoded by gene P.
6. The virus as claimed in claim 5, characterized in that the
mutation comprises: a deletion of (a) amino acids 2-77 of the
protein encoded by gene P or (b) a partial sequence of (a)
sufficient for loss of the capacity for replication.
7. The virus as claimed in claim 1, characterized in that the viral
genome contains at least one sequence coding for a heterologous
gene product.
8. The virus as claimed in claim 7, characterized in that the
heterologous gene product is a protein, a ribozyme, an antisense
molecule or an siRNA molecule.
9. The virus as claimed in claim 7, characterized in that the
heterologous gene product is a reporter protein, an antigen or a
therapeutic protein.
10. The virus as claimed in claim 7, characterized in that the
heterologous gene product is an antigen of a heterologous pathogen,
selected from viruses, bacteria and protozoa.
11. The virus as claimed in claim 7, characterized in that the
heterologous gene product is a viral antigen.
12. The virus as claimed in claim 11, characterized in that the
viral genome codes for several heterologous antigens from the same
or different viruses.
13. The virus as claimed in claim 7, characterized in that the
sequence coding for at least one heterologous gene product is
inserted in the viral genome and/or replaces sequences coding for a
homologous gene product.
14. The virus as claimed in claim 1, characterized in that the
virus has a capacity for transcription that is reduced by at most a
factor of 20 relative to the wild-type virus.
15. A nucleocapsid of a negative-strand RNA virus as claimed in
claim 1.
16. A genome of a negative-strand RNA virus as claimed in claim
1.
17. A DNA molecule that codes for the genome and/or antigenome of a
recombinant negative-strand RNA virus as claimed in claim 1.
18. (canceled)
19. The DNA molecule as claimed in claim 18, characterized in that
the transcription signal is a bacteriophage promoter, e.g. a T7 or
SP6 promoter.
20. A cell that contains a virus as claimed in claim 1, a
nucleocapsid as claimed in claim 15, a genome as claimed in claim
16 or a DNA molecule as claimed in claim 17.
21-22. (canceled)
23. The cell as claimed in claim 22, characterized in that it
further contains a DNA molecule coding for a heterologous
DNA-dependent RNA polymerase, which effects the transcription of
the DNA molecule coding for the recombinant negative-strand RNA
virus.
24. The cell as claimed in claim 20, characterized in that it is a
virus multiplying cell.
25. The cell as claimed in claim 20, characterized in that it
further contains DNA molecules coding for the viral L and/or P
protein.
26. A method of production of a negative-strand RNA virus as
claimed in claim 1, comprising the steps: (a) preparation of a cell
that is transfected with a DNA molecule that codes for the genome
of a negative-strand RNA virus, containing a mutation in at least
one of the genes L and P, which leads to loss of the capacity for
viral genome replication without loss of the capacity for secondary
transcription, and optionally at least one sequence coding for a
heterologous gene product, and (b) cultivation of the cell under
conditions such that a transcription of the DNA according to (a)
takes place and the recombinant negative-strand RNA virus is
formed.
27. The method as claimed in claim 26, further comprising the
obtaining of the nucleocapsid or of the viral genome from the
negative-strand RNA virus.
28. A method of multiplying a negative-strand RNA virus as claimed
in claim 1, comprising the steps: (a) preparation of a cell that is
infected with a negative-strand RNA virus, containing a mutation in
at least one of the genes L and P, which leads to loss of the
capacity for viral genome replication without loss of the capacity
for secondary transcription, and optionally at least one sequence
coding for a heterologous gene product, and (b) cultivation of the
cell under conditions such that multiplication of the virus takes
place.
29. A pharmaceutical composition, characterized in that it contains
a recombinant negative-strand RNA virus as claimed in claim 1, a
nucleocapsid as claimed in claim 15 or a viral genome as claimed in
claim 16 as active substance and optionally pharmaceutically
acceptable vehicles and/or excipients.
30-35. (canceled)
36. The use of a cell which stably expresses, constitutively or
inducibly, the proteins L and/or P of a negative-strand RNA virus,
for the production or multiplication of recombinant negative-strand
RNA viruses as claimed in claim 1, of nucleocapsids as claimed in
claim 15 or of viral genomes as claimed in claim 16.
37. (canceled)
38. The use as claimed in claim 36, characterized in that the cell
is selected from the H29 cell (DSM ACC2702) or a cell derived
therefrom.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of and claims priority
under 35 U.S.C. .sctn.120 to PCT/EP2006/001251 filed Feb. 10, 2006,
which claims priority to German application 10 2005 006 388.8 filed
Feb. 11, 2005.
DESCRIPTION
[0002] The present invention relates to a replication-defective and
transcription-competent negative-strand RNA virus, which can be
used for the expression of transgenes and in particular for the
area of vaccine development.
[0003] Immunizations with live vaccines imitate natural infection
and produce a comprehensive immune response. Attenuated, but still
viable, viruses are used for vaccination. Multiplication of the
vaccine viruses must take place so slowly that an immunological
response and therefore control of multiplication and/or elimination
of the virus is ensured. The live vaccine concept has frequently
proved itself in various age groups. There are, however, important
target groups for whom immunization with live vaccines is
problematic and extra safety measures are required: maternal
antibodies protect infants in the first few months of life. At the
same time they represent a barrier that must be overcome in
immunization with live vaccine, though without leading to excessive
multiplication of the vaccine virus and associated vaccination
lesions. Another target group are the elderly, whose immune system
is no longer so efficient, so that it can be overloaded by
vaccination, and increased multiplication of the vaccine virus may
lead to vaccination lesions. There is therefore the problem of
making the immunologically excellent live vaccination even safer
for application in certain target groups, as well as increasing the
safety profile for general use.
[0004] For some years it has been possible to alter negative-strand
RNA viruses, such as the rabies virus or the Sendai virus (SeV) for
example, purposefully by reverse genetic engineering. EP-A-0 702
085 describes the production of recombinant, infectious,
replicating unsegmented negative-strand RNA viruses from cloned
cDNA. EP-A-0 863 202 describes a recombinant Sendai virus, in whose
genome a heterologous gene is inserted or a gene is deleted or
inactivated, but whose genome replication is still intact.
[0005] Negative-strand RNA viruses are especially suitable as the
backbone of vaccines, as their multiplication in the cytoplasm
takes place at the RNA level and genes within the viral genome can
simply be exchanged. Thus, there has already been success in
producing recombinant viruses with surface proteins of various
virus types and using them as vaccines in animal experiments
(Schmidt et al., J. Virol. 75 (2001), 4594-4603 and WO 01/42445).
By recombinant insertion of F-- and HN-proteins of human
parainfluenza virus type 3 (hPIV 3) and of the G- or F-protein of
Respiratory Syncytial Virus (RSV) in a vector based on bovine
parainfluenza virus type 3 (bPIV 3), a mucosal immune response to
hPIV 3 and RSV was detected after application in hamsters. A
bivalent antigenicity of this live vaccine, which has been tested
in animal experiments, has thus already been achieved.
[0006] Owing to the involvement of the species barrier, this bovine
parainfluenza virus with human PIV 3 and RSV surface antigens
should already be sufficiently attenuated for application in
humans. Reversions to the wild type should not be expected, as
complete genes were exchanged for viral surface proteins. Clinical
testing of the vaccine has already begun.
[0007] As the virus mutants described are, however,
replication-competent, virus multiplication will undoubtedly occur
in the vaccinee, the intensity of which is attenuated by
modification of the virus, but is not excluded completely. The
intensity of the viremia that is to be expected and therefore the
side-effects suffered by the vaccinee then depend on individual
factors.
[0008] Within the scope of the present invention, an attempt is to
be made to substantially reduce the risks of live vaccination, and
especially the risks for vaccinees in certain target groups.
[0009] One approach is the suppression of viral genome replication
after application of the vaccine. As a result, multiplication of
the virus and corresponding vaccination lesions will not occur,
regardless of the vaccinee's state of immunity.
A fundamental difficulty in this approach is that the viral RNA
polymerase performs two functions: synthesis of viral mRNA and
multiplication of the viral genomes. This coupling must be removed
in the new vaccine, as the vaccine must now only be capable of
synthesis of viral mRNA.
[0010] Another problem is that the recombinant virus must perform
efficient synthesis of viral mRNA, if it is to be suitable at all
as live vaccine. There are thus two basically contradictory
requirements, which mean that considerable difficulties are to be
expected in the production of safe, but efficient live vaccines
based on negative-strand RNA viruses.
[0011] Shoji et al. (Virology 318 (2004), 295-305) describe the
production and characterization of a P gene-deficient rabies virus.
The virus was produced by means of P-protein-expressing helper
cells. Without de novo synthesis of P-protein, the viruses are only
capable of primary transcription. The slight viral gene expression
is manifested in a very weak signal for N-protein in
immunofluorescence and only in very few cells, and convincing proof
of this slight viral gene expression will only be provided by PCR
analysis. Use of this mutant virus in a challenge test in the mouse
model should show protection, but there is no control experiment
with transcription-inactive virus and the time interval for the
viral challenge is too short. The duration of supposed protection
is not being investigated. The use of such mutant viruses for the
development of an attenuated rabies vaccine therefore seems not to
be very promising.
[0012] Within the scope of the investigations that led to the
present invention, it was found that in paramyxoviruses, decoupling
of the replication and transcription functions can be achieved by
partially removing the constituents of polymerase that are
essential for the genome replication function. This may involve one
of the viral proteins N, P and L, or a special functional domain of
such a protein.
Surprisingly it was found that by mutations in which the function
of the proteins encoded by the viral genes N, L and/or P is not
deleted completely, but partially, it is possible to produce
replication-defective RNA viruses which possess an adequate
transcription function to be suitable for the production of live
vaccines.
[0013] One object of the present invention is thus a recombinant
negative-strand RNA virus, which is replication-deficient and
transcription-competent. The virus according to the invention
contains a viral genome with a mutation in at least one of the
genes N, L and P, with the mutation leading to loss of genome
replication without loss of secondary transcription capacity.
[0014] The virus according to the invention is a prerequisite for
the production of live vaccines, especially for the production of
live vaccines with an enhanced safety profile, which is especially
suitable for use in high-risk patients with a weak or damaged
immune system.
[0015] The invention also relates to a nucleocapsid of the
recombinant virus, comprising the viral negative-strand RNA,
complexed with the proteins N, L and P plus the negative-strand RNA
of the recombinant virus in isolated form.
The invention also relates to a cDNA, which codes for a
negative-strand RNA according to the invention, in particular a
viral RNA and/or an RNA complementary to it.
[0016] The invention further relates to a cell line for
multiplication of the recombinant negative-strand RNA virus
according to the invention.
The recombinant negative-strand RNA virus according to the
invention can be obtained by mutation of a starting virus in at
least one of the genes N, L and P. The starting virus can be a
natural negative-strand RNA virus, especially from the families
Paramyxoviridae or Rhabdoviridae or recombinant variants thereof.
Especially preferred representatives are paramyxoviruses, e.g.
Sendai virus, human or bovine parainfluenza virus, e.g. human
parainfluenza virus (hPIV) type 1, 2, 3, 4a or 4b, Newcastle
disease virus, mumps virus, measles virus or human respiratory
syncytial virus (hRSV) or rhabdoviruses, e.g. vesicular stomatitis
virus (VSV). Especially preferably, the virus is a Sendai virus,
e.g. of the Fushimi strain (ATCC VR105). Recombinant variants of
the aforementioned viruses, as described for example in EP-A-702
085, EP-A-0 863 202 or WO 01/42445, are also covered by the
invention.
[0017] Further preferred negative-strand RNA viruses are
representatives of the Rhabdoviridae, Filoviridae, Bornaviridae,
Arenaviridae or Bunyaviridae, e.g. VSV.
Like other paramyxoviruses, the Sendai virus is an enveloped virus
with a helical nucleocapsid (FIG. 1). The envelope consists of a
lipid membrane, which is derived from the plasma membrane of the
host cell from which the virus was released. Transmembrane
glycoproteins, namely the fusion protein (F) and
hemagglutinin-neuramidase (HN), are anchored in the viral envelope.
The matrix protein (M) lines the inside of the membrane. The
nucleocapsid contained in the envelope consists of single-stranded
RNA complexed with nucleoprotein (N), with in each case 6
nucleotides of the RNA bound by one N protein, an RNA-dependent RNA
polymerase (L) and the co-factor phosphoprotein (P).
[0018] The negative-strand RNA genome of the Sendai virus contains
the genes of the 6 structural proteins in the order:
3'-N-P/C-M-F-HN-L-5' (FIG. 2). The P/C gene codes for a total of 8
proteins, the structural phosphoprotein and all non-structural
proteins known to date.
[0019] The proteins P, N and L are important for functional
transcription and replication (Lamb et al., Paramyxoviridae: The
Viruses and their Replication. Fields Virology, 4th edition (2001),
Lippincott, Williams & Wilkins, Philadelphia, 1305-1340).
[0020] The recombinant negative-strand RNA virus according to the
invention contains a mutation in at least one of the genes N, L and
P. The mutation can be a deletion, substitution and/or insertion in
one of the genes N, L or P, which gives rise to a replication
deficiency of the virus, but does not disturb the capacity for
transcription. The mutation preferably affects a partial sequence
of the proteins encoded by the genes N, L and/or P, which is
necessary for replication, whereas other partial sequences
necessary for transcription remain functional.
[0021] In a preferred embodiment of the invention, the recombinant
virus has a mutation in gene P, namely in an N-terminal partial
sequence of gene P. The mutation preferably affects at least the
region of amino acids 33-41 of the protein P, which are important
for the capacity for replication. It is further preferred that the
C-terminal region (starting from amino acid 320) does not have any
mutations impairing the transcription function. Especially
preferably, the mutation is a mutation in the region of amino acids
2-77 leading to loss of capacity for replication, for example a
deletion of (a) the amino acids 2-77 of the protein encoded by gene
P or (b) a partial sequence of (a) sufficient for loss of the
capacity for replication. Corresponding mutations can also take
place in P proteins of other negative-strand RNA viruses, e.g. of
other paramyxoviruses, e.g. hPIV3.
[0022] The recombinant virus according to the invention is
replication-deficient and transcription-competent. Loss of the
capacity for replication means that in a target cell (a cell which
does not produce in trans any of the functions deleted by mutation)
no detectable virus genome multiplication is found, and in contrast
to a reduced or conditional replication deficiency, also no
permissive conditions exist, in which replication can occur. The
loss of the capacity for replication can be determined as described
in Example 8. However, the virus according to the invention is
capable of transcribing the gene products encoded by it after
infection in a target cell, so that expression of the viral
proteins including one or more heterologous gene products can take
place in the target cell. It is important that the recombinant
virus according to the invention should possess the capacity for
secondary transcription, i.e. the viral gene products that arise
through primary transcription with the protein components
originally contained in the nucleocapsid are capable of bringing
about and/or supporting a secondary transcription themselves. The
extent of the secondary transcription then leads to protein
synthesis of preferably at least 1%, at least 2%, at least 3%, at
least 4% or at least 5% relative to a corresponding wild-type
virus, i.e. a virus without the mutation in at least one of the
genes N, L and P. The capacity for secondary transcription can be
reduced relative to the corresponding wild-type virus, though
preferably at most by a factor of 20, especially preferably at most
by a factor of 10. The capacity for secondary transcription can be
determined as in Example 7.1 and/or 7.3 by quantitative
determination of the expression of a heterologous gene product,
e.g. a reporter protein.
[0023] Besides the mutation, the recombinant virus according to the
invention preferably contains at least one transgene, i.e. at least
one sequence coding for a heterologous gene product. The
heterologous gene product can be a protein, for example a reporter
protein, e.g. a fluorescence protein such as GFP or a derivative
thereof, or an antigen, against which an immune response is to be
produced, or a therapeutic protein, e.g. a protein for virotherapy
or a functional RNA molecule, e.g. an antisense RNA, a ribozyme or
an siRNA molecule capable of RNA interference. Preferably the
heterologous gene product is an antigen, originating from a
pathogen, such as a virus, a bacterium, a fungus or a protozoon, a
tumor antigen or an autoantigen. Especially preferably, the antigen
is a viral antigen, derived from a heterologous negative-strand RNA
virus, such as a human parainfluenza virus or RSV, e.g. hPIV3 F and
HN or hRSV F and G. The virus according to the invention can
contain one or more, e.g. two or three, sequences coding for a
heterologous gene product.
[0024] Sequences coding for heterologous gene products can be
inserted in the genome of the recombinant virus. On the other hand,
sequences coding for homologous gene products, e.g. genes F and/or
HN, can also be substituted with sequences that code for
heterologous gene products, e.g. chimeric gene products.
Combinations of inserted and substituted transgenes are also
possible.
[0025] For example, sequences of a Sendai virus can be replaced
completely or partially with heterologous sequences of other
negative-strand RNA viruses, e.g. with sequences of parainfluenza
viruses, e.g. hPIV3, and/or with sequences of RSV. Use of chimeric
sequences is especially preferred, i.e. sequences comprising
segments of the base virus genome and segments of a heterologous
virus genome. For example, chimeric genes F and/or HN can be
inserted in the virus genome, which comprise sequences of the base
virus genome, e.g. Sendai virus and heterologous sequences, e.g.
from human parainfluenza viruses such as hPIV3, and/or RSV.
[0026] The recombinant virus can contain one or more different
transgenes. If several transgenes are present, these can be of the
same or of different origin, which can be derived for example from
a single or from several different pathogens, e.g. viruses. Thus,
transgenes from several, e.g. 2 or 3 different pathogens,
preferably viruses, and especially negative-strand RNA viruses, can
be present.
[0027] The incorporation of transgenes in paramyxoviruses is
described for example in Hasan et al. (J. Gen. Virol. 78 (1997),
2813-2820), Bukreyev et al., (J. Virol. 70 (1996), 6634-6641), Yu
et al. (Genes Cells 2 (1997), 457-466), Masaki et al. (FASEBVB J.
15 (2001), 1294-1296), Shiotani et al. (Gene Therapy 8 (2001),
1043-1050) and Bitzer et al. (Mol. Therapy. 7 (2003), 210-217).
Preferably the transgenes are inserted in the 3' region of the
viral genome. Insertion is effected for example in the form of
transcription cassettes, with one or more transcription cassettes
with singular restriction sites for integration of the respective
reading frames inserted directly after the leader region at the
vector level (i.e. at the level of the vector, e.g. of a plasmid
vector, which codes for the negative-strand RNA). Integration of
several transgenes is preferably effected in independent
transcription cassettes in each case. A transcription cassette
preferably contains the sequence coding for the heterologous gene
product in operational linkage with a transcription start sequence
and a transcription termination sequence and preferably translation
signals.
[0028] A further object of the present invention is a
single-stranded or double-stranded DNA molecule, e.g. a cDNA
molecule, which codes for a recombinant negative-strand RNA virus
genome according to the invention or a precursor thereof or the
virus-antigenome or a precursor thereof. The term "precursor" means
in this context that the DNA molecule does not yet contain a
sequence coding for a heterologous gene product, but only a cloning
site for insertion of such a sequence. The cloning site can be a
restriction site, for example a singular or non-singular
restriction site in the DNA or a multiple cloning site, containing
several consecutive restriction sites, preferably singular
restriction sites. The DNA molecule coding for the virus genome
and/or the complementary sequence is preferably in operational
linkage with suitable expression control sequences.
[0029] The DNA molecule is preferably a vector, for example a
plasmid vector, which is suitable for propagation in a suitable
host cell, i.e. in a vector or plasmid amplification cell,
preferably in a prokaryotic cell, but also in a eukaryotic cell,
especially in a mammalian cell, and has the necessary genetic
elements for this, such as replication origin, integration
sequences and/or selectable marker sequences.
[0030] The DNA molecule contains the sequence coding for the
recombinant virus or the complementary sequence, preferably under
the control of a transcription signal, so that during transcription
with a DNA-dependent RNA polymerase in a host cell suitable for the
initial production of the virus, i.e. in a virus production cell,
the viral negative-strand RNA can be formed. The transcription
signal is selected to permit efficient transcription of the DNA in
the host cell used in each case. It is also possible to use a
heterologous transcription signal for the particular cell, e.g. a
bacteriophage promoter, such as the T7 or SP6 promoter, and then
the virus production cell must also contain a corresponding
heterologous DNA-dependent RNA polymerase, e.g. T7 or SP6 RNA
polymerase, which effects the transcription. In addition to the
transcription signal, the DNA molecule further contains, preferably
at the 3' end of the sequence coding for the recombinant virus, a
transcription terminator and a ribozyme sequence, which permits
cleavage of the transcript at the end of the viral sequence. The
virus production cell is preferably a eukaryotic cell and
especially a mammalian cell.
[0031] In addition to the DNA coding for the replication-deficient
paramyxovirus, the virus production cell according to the invention
also contains helper sequences, whose gene products permit assembly
of the recombinant virus RNA according to the invention in trans.
For this, the cell can for example additionally contain one or more
vectors which produce the N protein, the P protein and/or the L
protein in trans. This makes assembly of nucleocapsids of the
recombinant virus according to the invention possible in the
production cell.
[0032] Multiplication of the recombinant virus initially assembled
in the virus production cell takes place in a virus multiplication
cell, which is infected with the virus according to the invention.
In addition the virus multiplication cell contains helper sequences
as mentioned above, for production of the N protein, the P protein
and/or the L protein in trans. Preferably a virus multiplication
cell is used in which there is stable expression of the helper
sequences, e.g. by genomic integration. The virus multiplication
cell is preferably a mammalian cell. An especially preferred
multiplication cell is cell H29, derived from a 293 cell, of a
human embryonic renal fibroblast cell line, or a cell derived from
that. Cell H29 was deposited on 11.05.2004 (DSM ACC 2702) in
accordance with the provisions of the Budapest Treaty with the
Deutsche Sammlung fur Mikroorganismen und Zellkulturen GmbH,
Braunschweig, Mascheroder Weg. Vero cells, of a renal cell line
from the African green monkey, or cells derived from LLCMK2 cells,
of a renal cell line from the rhesus monkey, which have been stably
transfected with corresponding helper sequences, e.g. SeV N and P
genes, are also suitable.
[0033] The invention therefore further relates to a cell,
preferably a eukaryotic cell and especially preferably a mammalian
cell, which contains (i) a DNA molecule, which codes for the genome
of the recombinant virus according to the invention and/or the
complementary sequence thereof or a precursor thereof, and/or (ii)
an RNA genome of the virus according to the invention. The cell can
be a vector multiplication cell, a virus production cell or a virus
multiplication cell, as explained previously.
[0034] If the cell is a vector multiplication cell, e.g. a plasmid
multiplication cell, any cell that is suitable for multiplication
of the corresponding vector can be used, e.g. also a prokaryotic
cell such as a transformed E. coli cell.
[0035] If the cell is a virus production or multiplication cell, it
contains helper sequences for production of the virus proteins N, P
and/or L in trans. The DNA inserted in a virus production cell is
preferably under the control of a heterologous transcription
signal, and advantageously the cell further contains a DNA that
codes for a heterologous DNA-dependent RNA polymerase, which
recognizes the heterologous transcription signal and effects
transcription of the DNA coding for the recombinant negative-strand
RNA virus.
[0036] If the cell is a virus multiplication cell, it is infected
with a genomic viral RNA molecule, e.g. in the form of a
nucleocapsid, and contains the helper sequences in stably
expressible form.
[0037] The present invention further relates to a method of
production of a recombinant negative-strand RNA virus according to
the invention comprising the steps: (a) preparation of a virus
production cell, which is transfected with a DNA molecule that
codes for the genome of a negative-strand RNA virus, containing a
mutation in at least one of the genes N, L and P, which leads to
loss of the capacity for genome replication without loss of the
capacity for transcription, and optionally at least one sequence
coding for a heterologous gene product, and (b) cultivation of the
host cell in conditions such that transcription of the DNA molecule
according to (a) takes place and the recombinant negative-strand
RNA virus is formed initially. The host cell is preferably capable
of producing the N protein, the P protein and/or the L protein in
trans, e.g. by transfection with the corresponding helper plasmids
which contain sequences coding for the proteins N, P and/or L.
[0038] For the production of large quantities of the nucleocapsids
or of the virus particles, preferably a cell is used which stably
expresses, constitutively or inducibly, the proteins N, L and/or P,
preferably at least protein P of a negative-strand RNA virus. The
invention thus also relates to a method of multiplication of a
recombinant negative-strand RNA virus according to the invention,
comprising the steps: (a) preparation of a virus multiplication
cell, which is infected with the genome of a negative-strand RNA
virus, containing a mutation in at least one of the genes N, L and
P, which leads to loss of the capacity for genome replication
without loss of the capacity for transcription, and optionally at
least one sequence coding for a heterologous gene product, and (b)
cultivation of the host cell in conditions such that multiplication
of the virus takes place.
[0039] The present invention further relates to a pharmaceutical
composition, which contains a recombinant replication-deficient and
transcription-competent negative-strand RNA virus, as stated
previously, or its nucleocapsid as active substance and optionally
as pharmaceutically usual vehicles and/or excipients. The
pharmaceutical composition is suitable for applications in human
and veterinary medicine. It can be used in particular as vaccine or
for antitumor therapy, in particular for application in high-risk
patients, such as children, the elderly and/or persons with a
damaged or weak immune system. The pharmaceutical composition can
contain the negative-strand RNA virus in its native viral
envelope.
[0040] Application as vaccine is especially preferred, e.g. as
vaccine against pathogens such as viruses, bacteria or protozoa.
When the recombinant virus contains a transgene or several
transgenes of the same origin, e.g. from a single pathogen, it is a
monovalent vaccine. When the recombinant virus contains transgenes
of various origins, it can be used as a polyvalent vaccine, e.g. as
bivalent or trivalent vaccine. For example, it is possible to
produce a polyvalent vaccine against several pathogenic viruses,
e.g. against several pathogenic negative-strand RNA viruses, such
as human parainfluenza virus and RSV.
[0041] A vaccine according to the invention is capable of
triggering a humoral immune response, preferably the formation of
neutralizing antibodies, and/or a T-cell immune response.
Especially preferably, a humoral immune response and a T-cell
immune response are triggered.
[0042] The pharmaceutical composition can be in the form of a
solution, a suspension, a lyophilizate or in any other suitable
form. In addition to the active substance, the composition can
contain agents for adjusting the pH value, buffers, agents for
adjusting tonicity, wetting agents and the like, and adjuvants. It
can be administered by the usual routes, e.g. oral, topical, nasal,
pulmonary etc., in the form of aerosols, liquids, powders etc. The
therapeutically effective dose of the virus is administered to the
patient, and this dose depends on the particular application (e.g.
virotherapy or vaccine), on the type of disease, the patient's
weight and state of health, the manner of administration and the
formulation etc. Usually 10.sup.3 to 10.sup.7 virus particles,
especially preferably about 10.sup.4 to 10.sup.6 virus particles
are administered per application. Optionally, several different
virus particles can be administered together, e.g. in the case of
combination vaccinations. Administration can be single or multiple,
as required. Preferred fields of application are for example the
prevention or treatment of respiratory viral diseases.
[0043] The invention will be further explained with the following
drawings and examples.
EXAMPLES
1. General
[0044] FIG. 1 shows the morphology of a Sendai virus (SeV)
according to Fields (Virology. Lippincott, Williams and Wilkins
(2001), 4th edition; modified). The genome comprises a
single-stranded RNA, which has the proteins N, P and L in the form
of a nucleocapsid. The nucleocapsid is surrounded by a membrane
envelope, in which the proteins HN and F (each consisting of one
F.sub.1 and F.sub.2 subunit) are incorporated. Protein M is
associated with the inside of the membrane, and is also bound to
the nucleocapsid components at the same time.
The single-stranded negatively oriented RNA genome of the wild-type
Sendai virus comprises 15384 nucleotides. The genes of the 6
structural proteins are located thereon in the order
3'-N-P/C-M-F-HN-L-5' (FIG. 2). Between the genes there are
transitions of 50-80 nucleotides, each containing a highly
conserved region of 22 nucleotides: the termination signal of the
preceding gene, an intergenic sequence and the start signal for the
next gene. A unit comprising start signal, open reading frame
(ORF), optionally untranslated regions and termination signal is
called a transcription cassette. Before the N gene there is a
leader sequence (ld) 55 nucleotides long, which is transcribed, but
not translated. The L gene is followed by a trailer sequence (tr)
54 nucleotides long. The ld and tr regions function as genomic and
antigenomic promoters for the replication of genome or antigenome.
With the exception of P/C-RNA, the mRNA molecules formed by
transcription are monocistronic.
[0045] The multiplication cycle of the Sendai virus comprises entry
into the host cell, transcription and translation plus replication
and virus maturation followed by release of newly produced viruses.
In particular the proteins N, P and L are involved in the
transcription process, with L representing the viral RNA-dependent
RNA polymerase with all catalytic activities. As the genome of the
Sendai virus is in negative-strand orientation, the viral RNA
cannot be converted to proteins directly. First there is primary
transcription to mRNAs by RNA polymerase, which is brought into the
cell associated with the nucleocapsid.
[0046] FIG. 3 is a schematic representation of the transcription
mode of the Sendai virus. The polymerase complex, comprising an L
protein and a homotetramer of P proteins, migrates along the RNA
packed with N proteins toward the 5' end. The genetic information
on the genomic negative-strand RNA is read off and transcribed into
positive-strand mRNA.
[0047] Replication of the genome comprises the production of new
virus genomes with negative polarity. For this, first antigenomes
are formed, which then serve as matrixes for the formation of the
genomes. As transcription begins at the 3' end of the genome (ld),
switching from transcription to replication mode is required. This
switching is determined by the amount of free N protein in the
cell. Replication cannot take place until sufficient N protein has
been formed after translation of mRNA molecules. Once an
antigenome, which is complexed with N proteins over its entire
length, is present, this can serve as a matrix for the production
of further genomes. These are also packed directly with N proteins.
Once again the proteins N, P and L are responsible for the process
of replication (FIG. 4).
[0048] During virus replication, owing to the increasing number of
mRNA molecules there is also increasing synthesis of viral
proteins. Then complexes of viral RNA and viral proteins
(nucleocapsids) are transported in the form of secretory vesicles
to the cytoplasmic membrane, where enveloping with viral surface
proteins and budding of virus particles occur.
Within the scope of the present invention, recombinant virus
mutants are prepared, in which the functions of transcription and
replication are decoupled, i.e. the viruses are
transcription-competent, but replication-deficient. The missing
genome replication function must, for the production of virus
particles and/or their nucleocapsids, be compensated by helper
cells which complement the missing or functionally deficient viral
protein in trans. A preferred helper cell of this kind is the cell
line H29 (Willenbrink and Neubert, J. Virol. 68 (1994), 8413-8417).
Within the scope of the present application, this cell line was
deposited under reference DSM ACC2702 on 11.05.2004 in accordance
with the provisions of the Budapest Treaty. For the production of
replication-deficient, but transcription-competent viruses, the
gene coding for the P protein was not removed completely, but only
a domain essential for genome replication. Thus, it was known from
earlier works (Curran, Virology 221 (1996), 130-140; Curran et al.,
J. Virol. 69 (1995), 849-855) that in an in vitro system, on
deleting the amino acids 2-77 of protein P, genome replication is
inhibited, whereas viral transcription remains active.
[0049] FIG. 5 is a schematic representation of the P protein with
its N-terminal and C-terminal domains (PNT, PCT), the
tetramerization domain (amino acids 320-446), the P:L domain (amino
acids 411-445) and the P:RNP binding domain (amino acids 479-568).
For switching off the viral genome replication function while
simultaneously retaining the capacity for viral mRNA synthesis, a
deletion of the first 77 amino acids of the protein P was selected.
Firstly a corresponding Sendai virus mutant (SeV-P.DELTA.2-77) was
produced, in which the 5'-terminal region of the P-ORF was deleted.
Only N-terminal-shortened P proteins can be encoded by these
viruses. Infection studies showed that the virus mutant is not
capable of multiplying in cell culture. By means of helper cell
line H29 (DSM ACC2702), which among other things provides the
required wild-type P protein, multiplication of the virus mutant
can be achieved. The efficiency of virus multiplication is approx.
45% compared with wild-type Sendai viruses.
[0050] After infection, the virus mutant according to the invention
is able to express virus-encoded transgenes in infected cells. The
shortened protein P produced by the virus mutant gives sufficient
support for secondary viral mRNA synthesis. Synthesis of
virus-encoded proteins continues over several days in the infected
cells and is only reduced by a factor of approx. 10 relative to the
wild-type virus, so that a sufficient immune response can reliably
be expected on using the mutant as vaccine.
2. Production of Basic Constructs for Replication-Deficient Sendai
Virus Vectors (SeVV)
[0051] 2.1 Production of a cDNA Construct pSeV-X
[0052] An encoding transcription cassette was inserted in the 3'
region of SeV, Fushimi strain (ATCC VR105). In all manipulations of
the genome it is essential to ensure that the total number of
nucleotides of the recombinant SeV genome is divisible by six
("rule of six").
[0053] Starting from the cDNA pSeV used as matrix, two PCR
fragments PCR X I and PCR X II were prepared for the production of
pSeV-X (FIG. 6).
[0054] PCR X I (370 bp) comprises the sequence of the T7 promoter
(T7-prom.), the leader (ld) sequence, the N-gene start with 5'-NTR
up to before the start codon of the N-ORF (open reading frame). Via
the reverse primer X I (+) (Table 3), a singular NotI restriction
site and 24 nucleotides of the N-gene stop sequence were attached.
The 24 nucleotides of the N-gene stop sequence of PCR X I, inserted
by the mutagenic primer X I (+), serve in the subsequent fusion
step as the region overlapping PCR X II.
[0055] PCR X II (970 bp) comprises the sequence of the N-gene start
and the first third of the N-ORF. Via the forward primer X II, the
sequence of the 3'-NTR N and the gene-stop sequence of N, as well
as the intergenic region (IR) were attached. The reverse primer XII
(+) binds in the first third of the N-ORF just behind the singular
SphI site in the SeV genome. The amplicon PCR X I was
complementary, in the 3' region, to the 5' region of PCR X II.
Through this overlapping region, the two PCR fragments X I and X II
could be fused. After completion of PCR, the fusion product (1310
bp) could be inserted, by restriction cleavage with the enzymes
MluI and SphI, in the vector pSeV, also treated with MluI and SphI.
From the clones obtained, plasmid-DNA was isolated by plasmid
preparation, and verified by restriction analysis and sequencing
for correct insertion of the transcription cassette. The cDNA
construct pSeV-X was thus made available.
[0056] So that the production of recombinant viruses can be
monitored easily, the gene for the enhanced green fluorescent
protein (eGFP) was now inserted in the empty cassette of pSeV-X.
The eGFP-ORF was amplified by PCR from the expression plasmid
pEGFP-N1 (from Clontech), maintaining the "rule of six" and
achieving attachment of two flanking NotI sites by means of
mutagenic primers. The resultant 771-bp PCR fragment was cleaved
with the restriction enzyme NotI and a 738-bp fragment was isolated
by gel elution, and was inserted via the NotI site of pSeV-X in its
"empty" transcription cassette pSeV-X. After transformation of E.
coli, plasmid preparation and subsequent sequencing of the eGFP
reading frame inserted via PCR, the cDNA construct pSeV-eGFP was
made available.
2.2 Production of the cDNA Construct pSeV-X-X
[0057] With the construct pSeV-X-X, two additional transcription
cassettes were to be made available, in which two transgenes can be
incorporated. The use of pSeV-X-X as base vector for the production
of the replication-deficient vectors should make it possible to
equip the vector with multivalent, e.g. trivalent, properties.
[0058] pSeV-X-X was produced via a PCR reaction, in which pSeV-X
served as template (FIG. 7). The primer XX-forward hybridizes with
pSeV-X in the region of the NotI site and the 3'-NTR of the second
transcription cassette that is to be integrated. A singular SgrAI
restriction site was introduced by means of the XX-forward primer
between the NotI site and the 3'-NTR. It serves as singular
restriction site for the later insertion of the ORF of a transgene.
Gene stop, intergenic region (IR), gene start and 5'-NTR follow in
the PCR product XX. The singular restriction sites FseI and Nru I
were inserted by the primer XX (+), which hybridizes with the
5'-NTR. The FseI site serves for incorporation of the ORF of a
second transgene. The singular Nru I site was cloned-in
prospectively, so as to be able to integrate a third transcription
cassette if necessary. Primer XX (+) hybridizes in the 3' region
with the sequence of the NotI site of pSeV-X. The PCR product XX
(220 bp) was treated with the restriction enzyme NotI and a
fragment of 144 bp was isolated by gel extraction. This fragment,
designed maintaining the "rule of six", could then be incorporated
in the plasmid pSeV-X, which was also treated with NotI. After
checking for correct orientation of the NotI PCR fragment XX and
verification of the sequence, the plasmid pSeV-X-X was ready. Any
desired transgenes can be integrated in the singular sites SgrAI
and FseI.
[0059] For the investigations in this work, the two transcription
cassettes (X) of pSeV-X-X were provided with reading frames of two
different fluorescent proteins. On the one hand, the reading frame
for the fluorescent protein eGFP from the expression plasmid
pEGFP-N1 was amplified by PCR while observing the "rule of six",
attaching two flanking SgrAI sites by means of mutagenic primers.
After restriction cleavage with SgrAI and gel elution, the approx.
738-bp fragment could be incorporated in the first transcription
cassette of pSeV-X-X (pSeV-eGFP-X). On the other hand, in the same
way the ORF of the fluorescent protein DsRed (from the plasmid
"pDsRed", from Clontech) was provided by PCR, observing the "rule
of six", with the restriction sites of FseI, the DNA was cleaved,
gel-eluted and this fragment (702 bp) was then cloned into the
second transcription cassette in the 3' region of pSeV-eGFP-X. The
result was the genomic SeV cDNA construct pSeV-eGFP-DsRed.
3. Production of Replication-Deficient Sendai Virus Vectors
(SeVV)
[0060] cDNA constructs pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L
were produced, which code for replication-deficient Sendai viruses,
in each of which the gene for the protein N, P and L has been
deleted. For this, in each case a reading frame of the genes N, P
or L had to be deleted while observing the rule of six, and a
non-coding transcription cassette was to be retained at the
corresponding position (FIG. 8A).
[0061] By incorporating a restriction site instead of the deleted
ORF, an additional functional transcription cassette, into which a
further transgene can be inserted if required, was to be made
available, for later applications, in each cDNA construct
pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L.
[0062] As a further variant of a replication-deficient SeVV, the
deletion mutant pSeVV-eGFP-P.DELTA.2-77 was produced, which codes
for an N-terminal-shortened P protein lacking amino acids 2 to 77
(FIG. 8B).
[0063] The clonings pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L
were all carried out according to the same principle. As an
example, the cloning of pSeVV-eGFP-.DELTA.P will be described in
detail in the next section. Then just the differences in the
clonings of pSeVV-eGFP-.DELTA.N, and -.DELTA.L will be presented in
a table.
3.1 Cloning of the cDNA Constructs pSeVV-eGFP-.DELTA.P and
pSeVV-eGFP-P.DELTA.2-77
[0064] The ORF of the P protein was removed from the cDNA construct
of the replication-competent virus pSeV-eGFP, to produce the new
cDNA pSeVV-eGFP-.DELTA.P, coding for the replication-deficient
vector. An XhoI restriction site was used instead of the P-ORF.
For the cloning of pSeVV-eGFP-.DELTA.P, two PCR fragments named PCR
.DELTA.P I and PCR .DELTA.P II were produced and then fused.
pSeV-eGFP served as template for both PCR reactions. In the case of
fragment PCR .DELTA.P I (1272 bp), by means of the forward primer
.DELTA.P I (=N-578; Table 3) hybridization with the template in the
region of the N ORF was achieved before a singular SphI site. The
reverse primer .DELTA.P I (+) hybridizes with the template in the
5'-NTR region of the P-gene up to before the ATG codon of P and
inserts the restriction site XhoI there.
[0065] The fragment PCR .DELTA.P II comprises 1938 bp, and pSeV
also serves as template here. The forward primer .DELTA.P II
hybridizes with a portion of the 5'-NTR P sequence and attaches an
XhoI site. The reverse primer of PCR .DELTA.P II (+) binds in the
ORF of the F gene after a singular Eco47III site and additionally
has an artificial MluI site.
[0066] The two PCR fragments .DELTA.P I and .DELTA.P II were
combined via the XhoI site. The fusion product--comprising a
partial sequence of the N ORF, the non-coding P-transcription
cassette with inserted XhoI restriction site, the M plus a quarter
of the F ORF--was cleaved with the restriction enzymes SphI and
MiuI, intercloned and sequence-verified. An SphI-Eco47III fragment
with a size of 3006 bp was cut out of a subclone with correct
sequence and was ligated in the identically treated vector
pSeV-eGFP. A corresponding pSeVV-eGFP-.DELTA.P clone (genomic viral
cDNA) was now ready, after sequence verification, for the
production of the replication-deficient SeVV-eGFP-.DELTA.P (FIG.
9).
[0067] A PCR with two mutagenic primers was employed for
constructing the deletion mutant pSeVV-eGFP-P.DELTA.2-77. The
forward primer "XhoI P.DELTA.2-77" contains an XhoI site, followed
by an ATG start codon plus codons for the amino acids 78 to 86 of
the P protein. The reverse primer "P.DELTA.2-77 (+) XhoI" contains
the last 10 codons of the P protein and an XhoI site. The reading
frame of the P protein shortened by 76 amino acids at the
N-terminal was produced by PCR, starting from the template pSeV,
observing the rule of six. The XhoI-cleaved, 1488-bp fragment was
inserted via two cloning steps into the non-coding transcription
cassette of pSeVV-eGFP-.DELTA.P at the position of the original
P-ORF. After sequence verification, a genomic cDNA clone was now
also ready for production of the replication-deficient
SeVV-eGFP-P.DELTA.2-77.
[0068] Deletion of the codons 2 to 77 in the P ORF has the result
that, in the case of the non-structural proteins, the V and W
proteins are also shortened at the N-terminal end and, of the C
family, only C'--also truncated--is still encoded; because the
start codons are missing, the proteins C, Y1 and Y2 can no longer
be translated by the shortened mRNA.
3.2. Cloning of the cDNA Constructs pSeVV-eGFP-.DELTA.N and
-.DELTA.L
[0069] Production of pSeVV-eGFP-.DELTA.N and pSeVV-eGFP-.DELTA.L
was carried out by a similar strategy to the cloning of
pSeVV-eGFP-.DELTA.P. In order to summarize the cloning procedures,
all the decisive parameters are presented in Table 1.
[0070] Through the production in each case of two fusible PCR
products PCR I and PCR II, the ORF of the genes N or L were removed
from pSeV-eGFP, observing the rule of six, and were replaced with a
singular ApaI restriction site both in pSeVV-eGFP-.DELTA.N and in
SeVV-eGFP-.DELTA.L. The sequences of the primers for cloning
pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L are listed together
with the DNA oligonucleotides used (Table 3). The PCR products
obtained, PCR I and PCR II, were fused and amplified using the
forward primer of PCR I and the reverse primer of PCR II. Then the
fusion PCR products were cleaved with restriction enzymes which
occur singly in pSeV-eGFP and allow the insertion of the
corresponding fusion product in pSeV-eGFP (e.g.: NarI when cloning
pSeVV-eGFP-.DELTA.N, see Table 1). The purified cleavage product
was inserted by ligation in the vector pSeV-eGFP, which was also
digested with the corresponding enzymes.
TABLE-US-00001 TABLE 1 Review of the primers and restriction sites
used in the cloning of pSeVV-eGFP-.DELTA.X pSeVV-eGFP-.DELTA.N
pSeVV-eGFP-.DELTA.P pSeVV-eGFP-.DELTA.L Primer pair .DELTA.N I,
.DELTA.N I (+) .DELTA.P I, .DELTA.P I (+) .DELTA.L I, .DELTA.L I
(+) PCR I Primer pair .DELTA.N II, .DELTA.N II (+) .DELTA.P II,
.DELTA.P II (+) .DELTA.L II, .DELTA.L II (+) PCR II RS.sup..sctn.
of the ApaI XhoI ApaI transcription cassette RS.sup..sctn. of
cloning NarI SphI + Eco47III Eco47III + AscI .sup..sctn.RS =
restriction site
[0071] E. coli cells were transformed with a portion of the
ligation preparations and plasmid DNA of the clones obtained was
isolated by plasmid mini-preparation. After verification of the
correct sequence by restriction analysis and sequencing, a plasmid
preparation was prepared from one positive clone in each case (DNA
Maxi Prep-Kit, Qiagen), and the various pSeVV-eGFP-.DELTA.X were
thus ready for the production of recombinant deletion mutants.
4. Production of Replication-Deficient Virus Mutants
[0072] Replication-deficient SeV vectors (SeVV-eGFP-.DELTA.X) were
produced in cell culture from the cDNA constructs
pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L.
4.1 Initial Production of SeVV-eGFP-.DELTA.X
[0073] For the production of reactive SeV with a complete genome:
[0074] either the cell line "BSR-T7", which stably expresses the T7
RNA polymerase (Buchholz et al. (1999) J. Virol. 73, 251-259)
[0075] or cell cultures are infected with the recombinant vaccinia
virus MVA-T7, which expresses T7 RNA polymerase (Sutter et al.
(1995) FEBS 371, 9-12), and [0076] transfected with the cDNA of the
viral genome (pSeV) and the plasmid-encoded genes N, P and L
(pTM-N, -P, -L; Elroy-Stein et al. (1989) PNAS 86, 6126-6130). The
T7 polymerase now transcribes the viral antigenome and/or the
complementary sequence and the genes N, P and L. The N protein
expressed via pTM-N packages the synthesized viral antigenomic
and/or complementary RNA, and this nucleocapsid core (RNP) forms,
together with the proteins P and L, the replication complex, via
which genomic RNA can in turn be produced and packaged as
nucleocapsids (Leyrer et al., J. Virol. Meth. 75 (1998), 47-55).
This is followed by transcription of all virus-encoded proteins and
replication of further viral genomes (FIG. 10).
[0077] In contrast to the production of recombinant SeV wt with
complete genome described, the plasmid-encoded cDNA of
pSeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L lacks the genomic
information of one of the genes N, P or L in each case. Accordingly
the nucleocapsids initially produced are only able to express two
of the genes N, P or L in each case. The amount of the missing
protein required for multiplication of SeVV-eGFP-.DELTA.N,
-.DELTA.P and -.DELTA.L nucleocapsids must therefore be provided
exclusively via the T7-promoter-controlled expression of the
plasmid-encoded genes N, P and L.
Production of the replication-deficient SeVV-eGFP-.DELTA.N,
-.DELTA.P and -.DELTA.L was similar to the production of
replication-competent SeV variants in HeLa cells (ATCC CCL2) or
BSR-T7 cells. After incubation of the HeLa cells for 48 hours, we
investigated whether viral particles of SeVV-eGFP-.DELTA.N,
-.DELTA.P or -.DELTA.L had been released into the culture
supernatants, and how many initial deletion mutants had been
produced.
4.2. Detection of Initially Produced SeVV-eGFP-.DELTA.N, -.DELTA.P
or -.DELTA.L
[0078] The supernatants of HeLa cells or BSR-T7 cells, in which
SeVV-eGFP-.DELTA.N, -.DELTA.P or -.DELTA.L should have been
produced initially, were investigated for the presence of these
viral vectors. SeVV-eGFP-.DELTA.N, -.DELTA.P or -.DELTA.L have, in
contrast to the recombinant SeV wt, the reporter gene for eGFP
integrated in the 3' region. This detection marker was now used for
analyzing how many SeVV-eGFP-.DELTA.X had been formed.
[0079] In parallel assays, 5.times.10.sup.5 Vero cells (ATCC CCL18)
were in each case co-infected with 1 ml of cell culture supernatant
of the HeLa cells transfected during the initial production of
SeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L, and simultaneously
with SeV wt (MOI=3) for transcomplementation of the missing
protein. As control, Vero cells were infected either only with 1 ml
of the initially produced SeV-eGFP or alternatively with initially
produced SeV-eGFP and simultaneously with SeV wt (MOI=3).
[0080] The result of co-infection of cells with culture
supernatants from production of SeVV-eGFP-.DELTA.N, -.DELTA.P or
-.DELTA.L and SeV wt shows that all three virus mutants
SeVV-eGFP-.DELTA.X can be produced initially and after initial
production are also capable of infecting cells, which can be
detected by a detectable eGFP transgene expression. Approximately
13.times.10.sup.2 SeV-eGFP, 6.7.times.10.sup.2 SeVV-eGFP-.DELTA.N,
3.2.times.10.sup.2 SeVV-eGFP-.DELTA.P and 0.55.times.10.sup.2
SeVV-eGFP-.DELTA.L virus mutants can be produced initially.
5. Multiplication of SeVV-eGFP-.DELTA.X
[0081] Investigations were conducted to determine whether the
SeVV-eGFP-.DELTA.X vectors are multipliable, i.e. are biologically
functional. Capacity for replication was first to be investigated
by preparing the proteins of the missing genes N, P or L by viral
transcomplementation with SeV.
5.1 Demonstration of the Ability of SeVV-eGFP-.DELTA.X to
Multiply
[0082] It was first necessary to demonstrate that the mutants, on
corresponding transcomplementation by the SeV wt virus, are able to
multiply and infect the surrounding cells. For investigating the
ability of SeVV-eGFP-.DELTA.X to multiply, it is again possible to
use co-infection of cells with SeVV-eGFP-.DELTA.X and SeV wt. In
this test the cells were infected with SeV wt at low MOI,
co-infected with SeVV-eGFP-.DELTA.X and incubated for several days,
so as to be able to detect the spread of the SeVV-eGFP-.DELTA.X
vectors from the increasing number of fluorescing cells.
[0083] 5.times.10.sup.5 Vero cells were infected simultaneously
with on average 100 initially produced SeVV-eGFP-.DELTA.N,
-.DELTA.P or -.DELTA.L and SeV wt (MOI=0.2). Co-infection of Vero
cells with about 100 particles of the replication-competent virus
SeV-eGFP and SeV wt was used as positive control. During a 48-hour
incubation phase, multiplication of all three deletion mutants was
observed: in each case, at first there was only fluorescence of
individual Vero cells, which had been co-infected with
SeVV-eGFP-.DELTA.X and SeV wt. After about 24 h, newly synthesized
virus particles were released from these cells, and were capable of
penetrating nearby cells. If these cells were also infected
simultaneously with SeVV-eGFP-.DELTA.X and SeV wt, there was also
detectable fluorescence in those cells. The multiplication of
SeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L in cells co-infected
with wt could be detected from this "tailing" of fluorescing cells
48 h p.i. and beyond.
[0084] This test established that the genomic cDNA constructs, from
which SeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L were derived, are
functional in all regions. It could also be shown that
multiplication of virus mutants is possible on adding the missing
viral protein. The protein (e.g. P) produced exclusively by wt
virus is sufficient for multiplying both the deletion mutant and
the wt, i.e. even a possibly suboptimal amount of P protein leads
to the formation of functional nucleocapsids of SeV wt and
SeVV-eGFP-.DELTA.P. Supply of the missing protein by the
transcomplementation partner SeV wt led to visible multiplication
of all SeVV-eGFP-.DELTA.X, measured from the increase in
fluorescing cells in the cultures.
5.2 Determination of the Proteins Required for Multiplication of
SeVV-eGFP-.DELTA.X
[0085] Next we investigated which proteins must be made available
by a helper cell in each individual case of multiplication of
SeVV-eGFP-.DELTA.N, -.DELTA.P and -.DELTA.L, if it is to be
possible for the SeV proteins N, P and L to be synthesized
independently of one another. The three recombinant vaccinia
viruses (VV) VV-N, VV-P and VV-L, which provide recombinant
expression of the SeV proteins N, P or L, were available for
independent synthesis of the SeV proteins N, P and L (Graef, H.
(1994) Functional characterization of the recombinant Sendai virus
large (L) protein. Thesis, Eberhard-Karls University Tubingen).
[0086] 1.times.10.sup.6 Vero cells were co-infected simultaneously
with SeVV-eGFP-.DELTA.X or SeV-eGFP (MOI=0.01) and VV. VV-N, -P and
-L were used individually or in combinations (MOI=0.5). After an
adsorption time of one hour, the medium was replaced with DMEM+10%
fetal calf serum (FCS)+cytosine-arabinoside (AraC) (100 .mu.g/ml)
and the cells were incubated for 72 h at 33.degree. C., changing
the medium daily, to add fresh AraC.
[0087] The propagation of SeVV-eGFP-.DELTA.X was analyzed via eGFP
expression after 72 h. In this time, in the positive assays there
was multiplication of green-fluorescing cells from one initial cell
to 10-30 adjacent fluorescing cells.
[0088] The results of the investigation of which SeV proteins are
necessary for the multiplication of SeVV-eGFP-.DELTA.N, -.DELTA.P
or -.DELTA.L in Vero cells are presented in Table 2. Just
expression of SeV N by VV-N does not lead to multiplication of
SeVV-eGFP-.DELTA.N. SeVV-eGFP-.DELTA.N only multiplies if the SeV
proteins N and P are expressed simultaneously in the infected cell
by means of recombinant vaccinia viruses VV-N and VV-P.
SeVV-eGFP-.DELTA.P can be multiplied just by the expression of SeV
P proteins by means of VV-P in Vero cells. Multiplication of
SeVV-eGFP-.DELTA.L required simultaneous synthesis of proteins P
and L by VV. No multiplication of SeVV-eGFP-.DELTA.L occurs in an
SeVV-eGFP-.DELTA.L and only VV-L infected Vero cell.
TABLE-US-00002 TABLE 2 SeV proteins required for multiplication of
SeVV-eGFP-.DELTA.X in vitro multiplication by means of VV
SeVV-eGFP-.DELTA.N N - (N + P)+ SeVV-eGFP-.DELTA.P P + (N + P)+
SeVV-eGFP-.DELTA.L L - (L + P)+
[0089] For the multiplication of SeVV-eGFP-.DELTA.N, a helper cell
must express the SeV proteins N and P simultaneously, expression of
SeV P protein in the helper cell is sufficient for multiplication
of SeVV-eGFP-.DELTA.P, and the amplification of SeVV-eGFP-.DELTA.L
should be possible by cellular expression of the SeV proteins P and
L.
5.3 Supporting of Amplification of SeVV-eGFP-.DELTA.X by H29 Helper
Cells
[0090] For the investigations of the multiplication of
SeVV-eGFP-.DELTA.X with the aid of the H29 cell line,
1.times.10.sup.6 H29 cells in four different assays were each
infected with approx. 100 SeVV-eGFP-.DELTA.N, -.DELTA.P and
-.DELTA.L virus particles initially produced in HeLa cells or, as
control for the successful multiplication of replicable SeV in H29
cells, with about 100 SeV-eGFP virus particles. In the period from
1 to 10 d p.i., investigation of the multiplication of
SeVV-eGFP-.DELTA.X was based on detection of a tail-like spread of
the fluorescing cells (spot formation), starting from an initially
infected H29 cell.
[0091] Multiplication of SeV-eGFP was observed in the control
assay, starting from singly fluorescing cells 1 d p.i. to spots
with up to 50 fluorescing cells 3 d p.i. It was thus established
that the selected test setup leads to multiplication of SeV.
[0092] Virus multiplication also occurred in H29 cells infected
with SeVV-eGFP-.DELTA.N. In addition to H29 (a derivative of human
293 renal cells), derivatives of Vero cells (renal cells of the
African green monkey) and derivatives of LLCMK2 cells (renal cells
of the rhesus monkey), stably transfected with SeV P and N genes,
are also suitable for virus multiplication.
[0093] In the assay with SeVV-eGFP-.DELTA.P, about a hundred
initially infected individual cells could be detected 1 d p.i.
About 70% of the fluorescing individual cells had developed to
spots, with up to 30 fluorescing cells, 3 d p.i. Therefore
propagation of SeVV-eGFP-.DELTA.P to surrounding H29 cells could
definitely be observed. Thus, it is possible for the first time to
multiply a viral SeV vector whose P-ORF has been deleted.
Characterization of the multiplication of SeVV-eGFP-.DELTA.P will
be discussed in the next subsection.
5.4 Multiplication of SeVV-eGFP-.DELTA.P on H29 Cells
[0094] SeVV-eGFP-.DELTA.P can be amplified by the SeV P proteins
produced by H29 helper cells. The P-deletion mutants released are
able to infect surrounding H29 cells. It was now necessary to
analyze the propagation of SeVV-eGFP-.DELTA.P in comparison with
the propagation of the replication-competent SeV-eGFP.
For this purpose, 1.times.10.sup.6 H29 cells were infected with on
average 100 SeVV-eGFP-.DELTA.P or SeV-eGFP. 3, 5 and 10 days p.i.,
green-fluorescing cells were detected using the fluorescence
microscope.
[0095] SeVV-eGFP-.DELTA.P could be multiplied successfully by
cellular supply of SeV P proteins. It was found, at all times of
investigation, that SeVV-eGFP-.DELTA.P and SeV-eGFP multiply
efficiently on H29 cells.
In contrast, propagation of SeVV-eGFP-.DELTA.P to cells that do not
supply the missing P protein ("target cells", e.g. Vero cells) was
not observed, which confirms that SeVV-eGFP-.DELTA.P is
replication-deficient (see Section 8).
5.5 Gene Expression of SeVV-eGFP-.DELTA.P in Infected Target
Cells
[0096] Absence of multiplication of SeVV-eGFP-.DELTA.P on cell
types which do not supply the P protein in trans was verified. At
the same time, capacity for expression was way below
expectations.
As in the case of the rabies virus .DELTA.P mutant (Shoji et al.
(2004) Virology 318, 295-305), very few infected cells displayed a
weak eGFP fluorescence (less than 5%; see FIG. 11), although
statistically at an MOI=1 in fact approx. 70% of the cells are each
infected with one virus particle. Even at a higher MOI=5, only
isolated green-fluorescing Vero cells are observed due to
SeVV-eGFP-.DELTA.P (see FIG. 12, top left).
[0097] This confirms the assumption that after a cell is infected
with a P gene-deficient virus, only a primary transcription is
possible via the polymerase complex that is also supplied from the
virus particle. In the case of the SeV .DELTA.P mutant,
furthermore, apparently only a small percentage of the infecting
particles are capable of that, or gene expression is only observed
if several transcribable nucleocapsids are present simultaneously
in a cell.
[0098] For a therapeutic application of this replication-deficient
SeVV, the capacity for expression seems too weak, or
disproportionately many particles of SeVV .DELTA.P would have to be
applied per patient. Therefore it is desirable to use a
replication-deficient SeV variant that also performs a secondary
transcription. This leads to the development of additional modified
polymerase complexes, which cannot replicate the viral genome, but
are capable of increased expression of the therapeutic gene or
antigen.
6. Production of a Modified SeVV-eGFP-.DELTA.P cDNA Construct
[0099] For possible improvement of the transcription capacity of P
gene-deficient SeVV in the target cell, another recombinant
construct was produced, which codes for a form of the P protein
shortened by 76 amino acids at the N-terminal end, at the position
of the original P reading frame ("pSeVV-eGFP-P.DELTA.2-77"; see
Section 3.1 and FIG. 8B).
[0100] SeVV-eGFP-P.DELTA.2-77 particles were generated and
multiplied as in Section 4.1 and 5.4.
6.1 Growth Behavior of SeVV-eGFP-P.DELTA.2-77 in H29 Helper
Cells
[0101] In SeVV-eGFP-P.DELTA.2-77 infected H29 helper cells, the
viral-encoded P.DELTA.2-77 protein, shortened by 76 amino acids at
the N-terminal end, is synthesized together with the
cellular-encoded P protein.
[0102] In order to investigate the effect of expression of the
shortened P protein P.DELTA.2-77 on viral replication, H29 cells
were infected (MOI=3) with SeVV-eGFP-P.DELTA.2-77,
SeV-eGFP-.DELTA.P or the control virus SeV-eGFP as in the method
described with reference to the growth kinetics of
SeVV-eGFP-.DELTA.P. The supernatants of the individual assays were
determined over a period of 120 h by a cell infection dose test of
the titers of progeny viruses from the number of eGFP-expressing
cells.
[0103] From one SeV-eGFP infected H29 cell (positive control), on
average 80 virus particles are released in a period of 120 h, and
in this case transcomplementation of the P protein by H29 cells was
not required. In the H29 transcomplementation system,
SeVV-eGFP-P.DELTA.2-77 could be multiplied with about equal
efficiency as SeVV-eGFP-.DELTA.P: From infected H29 cells, after
120 h about 20.times.10.sup.6 virus particles of SeVV-eGFP-.DELTA.P
or SeVV-eGFP-P.DELTA.2-77 are released, which corresponds to a
number of about 40 released virus particles of the P mutants per
H29 cell.
7. Comparison of Gene Expression of SeVV-eGFP-.DELTA.P and
SeVV-eGFP-P.DELTA.2-77 and Quantification of Protein Synthesis in
Infected Target Cells
[0104] To investigate whether the vector SeVV-eGFP-P.DELTA.2-77
displays increased transgene expression--compared with
SeVV-eGFP-.DELTA.P--in infected target cells, the virus-encoded
expression of the reporter gene eGFP and of the HN protein was
characterized in detail.
5.times.10.sup.5 Vero cells were infected with
SeVV-eGFP-P.DELTA.2-77 (MOI=1), and on day 2 p.i. approx. 70%
fluorescing Vero cells were observed (not shown). This means that
almost every RNP complex of this viral vector variant is capable of
inducing a measurable transcription in the target cell. 7.1
Quantification of eGFP Expression by FACS Analysis
[0105] In subsequent applications in the medical area, the
transcription cassette, into which the reporter gene eGFP in
SeVV-eGFP-P.DELTA.2-77 was inserted, is to encode the antigen of a
pathogen, e.g. of a desired virus. This antigen expression must be
sufficient to elicit a protective immune response in the
patient.
In order to establish that each SeVV-eGFP-P.DELTA.2-77 nucleocapsid
that infects a target cell is able to perform a detectable
transgene expression, the same number of H29 and Vero cells were
infected with the same quantity of virus particles and the number
of eGFP-expressing H29 or Vero cells were compared by FACS
(fluorescence-activated cell sorting) analysis using a FACS-Calibur
flow cytometer. The data were evaluated from a computer-generated
histogram, plotting the fluorescence signals of infected cells
against the total cell count.
[0106] 2.5.times.10.sup.5 Vero cells or H29 cells were infected
with SeVV-eGFP-P.DELTA.2-77 or with the P gene-deficient virus
SeVV-eGFP-.DELTA.P at MOI=1. FACS analysis of the samples was
carried out 24 h after infection. The infected cells were taken up
in PBS and the number of fluorescing cells was determined by flow
cytometry. The result is shown in FIG. 11 as the proportion [%] of
fluorescing Vero and H29 cells.
[0107] 24 h after infection of H29 helper cells with
SeVV-eGFP-.DELTA.P, 86% eGFP-expressing H29 cells were detected by
FACS analysis. Cellular synthesis of the P protein supports the
formation of new P:L complexes and therefore production of new
mRNA, which leads to synthesis of eGFP proteins in the infected
cell. However, when Vero cells were infected with
SeVV-eGFP-.DELTA.P, expression of the eGFP protein was not detected
24 h p.i. nor at a later time in additional assays. The P:L
complexes transferred by SeVV-eGFP-.DELTA.P nucleocapsids are not
able, on infection at MOI=1, to bring about detectable expression
in infected Vero cells.
[0108] In contrast, 24 h after SeVV-eGFP-P.DELTA.2-77 infection,
almost 80% eGFP-expressing H29 cells and likewise 75%
eGFP-expressing Vero cells were identified by FACS analysis. When
H29 cells are infected, transcription of the eGFP mRNA can be
supported by the cellular synthesis of the P protein and therefore
by new P:L complexes. When Vero cells are infected with
SeVV-eGFP-P.DELTA.2-77, transcription is intensified by new
synthesis of the P protein P.DELTA.2-77 shortened at the N-terminal
end.
[0109] Based on these results, an important statement can be made
concerning the number of transcribable SeVV-eGFP-P.DELTA.2-77: H29
cells and Vero cells were infected with an MOI of 1. Theoretically
occurring multiple infections of a cell are statistically of
equally low probability in both assays. 24 h p.i., almost 80% of
eGFP-expressing H29 cells and about 75% eGFP-expressing Vero cells
were identified. It can therefore be concluded that each RNP
complex with the shortened P-variant P.DELTA.2-77, which is capable
of transgene expression in a P helper cell, likewise brings about
transgene expression in the infected target cell. In contrast, the
variant SeVV-eGFP-.DELTA.P with a complete deletion of the P ORF
does not have this property.
7.2 Function Test of the HN Protein Expressed in Infected Target
Cells
[0110] The efficiency of binding of human erythrocytes and
therefore the efficiency of exposure of viral HN proteins on
individual infected cells were detected using a heme adsorption
(HAD) test (FIG. 12).
5.times.10.sup.5 Vero cells were infected with
SeVV-eGFP-P.DELTA.2-77 at a low MOI=0.5. In contrast, in the case
of SeVV-eGFP-.DELTA.P, Vero cells had to be infected with a
10-times higher MOI=5, to be able to observe even occasional
fluorescing cells. After 1 h adsorption, the medium was replaced
with DMEM+10% FCS. Then the cells were incubated at 33.degree. C.
for several days. At first, the transgene expression of both vector
variants was monitored from the eGFP fluorescence. On day 5 and 9
p.i., HAD test series were performed, for analyzing the exposure of
the viral HN proteins on the basis of binding of human
erythrocytes.
[0111] Although in the case of SeVV-eGFP-.DELTA.P, at MOI=5,
statistically 99.3% of the Vero cells ought to be infected, only
0.01% eGFP-positive cells could be observed under the microscope
(FIG. 12 top left). In contrast, with SeVV-eGFP-P.DELTA.2-77 a
green fluorescence is seen at MOI=0.5 in 40% of the cells, as was
expected (FIG. 12 bottom left).
[0112] Two days after infection with SeVV-eGFP-.DELTA.P, only half
of the eGFP-positive cells (25 of 5.times.10.sup.5 infected) were
capable of binding erythrocytes on their surface (FIG. 12 top
centre). After further incubation and HAD testing again, there was
no longer adsorption of erythrocytes on infected cells. With the
second replication-deficient SeVV variant SeVV-eGFP-P.DELTA.2-77,
much better results were achieved: 5 days after infection, approx.
40% of the infected cells (MOI=0.5) were capable of binding
erythrocytes on their surface (FIG. 12 bottom center). A variation
in binding activity from 10 to 70 complexed red blood cells was
observed for the individual cells. It had thus been shown that
cells infected with SeVV-eGFP-P.DELTA.2-77 are capable, 5 d p.i.,
of exposing HN proteins on the cell surface, and the functional HAD
test can be assessed as positive. At the same time, efficient
expression of the HN protein in the infected cells was found, based
on the difference in quantity of bound erythrocytes.
[0113] The infected cells were further incubated at 33.degree. C.,
during which the neuraminidase activity of the HN protein causes
the erythrocytes bound to infected cells to be released. The cells
were washed to remove the released erythrocytes, and incubated for
a further 4 d at 33.degree. C. A HAD test was performed again on
day 9 p.i. About 30% HAD-positive Vero cells were now detected. The
number of bound red blood cells dropped to 5-20 erythrocytes per
cell.
[0114] Thus, 9 days i.p., sufficient functional HN was still
synthesized by the replication-deficient variant
SeVV-eGFP-P.DELTA.2-77. In contrast, the variant SeVV-eGFP-.DELTA.P
with complete deletion of the P ORF does not have these
properties.
7.3 Quantification of eGFP Expression by Western Blot Analysis
[0115] A semi-quantitative assessment of eGFP expression of the
replication-deficient SeV vector in comparison with
replication-competent SeV-eGFP was carried out by Western blot
analysis using serial dilution of total cellular protein.
5.times.10.sup.5 Vero cells were infected with SeV-eGFP or
SeVV-eGFP-P.DELTA.2-77 (MOI=3). Cell disruption was performed 24 h
p.i. The cellular extracts were separated in SDS-PAGE in serial
dilutions (1:2) from 20 .mu.g to 2.5 .mu.g total quantity. The
proteins were transferred to a PVDF membrane and the viral-encoded
eGFP protein (26 kDa) was detected first by Western blot analysis
(FIG. 13).
[0116] The fluorescence protein eGFP was detected using Western
blot analysis both in SeV-eGFP and in SeVV-eGFP-P.DELTA.2-77
infected Vero cells. It can be concluded, from comparison of the
intensities of the eGFP signals, that expression--mediated by the
replication-deficient SeVV-eGFP-P.DELTA.2-77--is reduced by about a
factor of 16 compared with the replication-competent SeV-eGFP.
[0117] A reduction by a factor of 16 is slight, and it can
therefore be concluded that despite the modified P protein,
SeVV-eGFP-P.DELTA.2-77 can produce very efficient secondary
transcription.
7.4 Estimation of HN Expression by Western Blot Analysis
[0118] In contrast to the eGFP protein, the SeV HN protein is a
membrane-bound surface protein and is an important antigenic
determinant. By relative quantification of the level of expression
of the HN protein in SeVV-eGFP-P.DELTA.2-77 infected cells, a
conclusion could be drawn concerning the intensity of expression of
the SeV HN antigen.
[0119] A semi-quantitative assessment of HN expression of the
replication-deficient SeV vector in comparison with the
replication-competent SeV-eGFP was carried out by Western blot
analysis using serial dilutions of total cellular protein. In each
case, 5.times.10.sup.5 Vero cells were infected with SeV-eGFP or
SeVV-eGFP-P.DELTA.2-77 in 2 parallel assays (MOI=1) and incubated
for 24 h or 48 h. Then the cells were disrupted. The cellular
extracts were separated in SDS-PAGE in serial dilutions (1:2) from
16 .mu.g to 2 .mu.g total quantity. The proteins were transferred
to a PVDF membrane and the viral-encoded HN protein (60 kDa) was
detected by means of a monoclonal HN-antibody (FIG. 14).
[0120] The HN protein was detected efficiently in the case of
SeV-eGFP infected Vero cells after both incubation times in all
traces (16 to 2 .mu.g total protein; traces 2-5 left and right). In
the case of SeVV-eGFP-P.DELTA.2-77, the band of the HN protein is
still visible in the traces with 16 and 8 .mu.g total protein
(trace 7, 8), though at lower intensity. Relative quantification of
HN expression in SeVV-eGFP-P.DELTA.2-77 infected Vero cells
relative to SeV-eGFP was carried out by comparing the traces with
16 and 8 .mu.g vs. 2 .mu.g total protein (traces 7 and 8 vs. 5,
left and right) and permits an estimated reduction of HN expression
by a factor of 8-16 of the P-deletion variant, regardless of the
incubation time. It can be concluded that the transcription rate in
SeVV-eGFP-P.DELTA.2-77 infected cells is relatively high, and
therefore transgene expression of the viral replication-deficient
vector is generally high.
[0121] Taking both measurements (eGFP protein and HN protein) into
account, it can be assumed that there is an average reduction of
expression by a factor of 10.
8. Replication Deficiency of SeVV-eGFP-P.DELTA.2-77 in the Target
Cell
[0122] If Vero cells are infected with the replication-competent
SeV-eGFP, in the next two days a spot comprising up to a thousand
additional fluorescing cells forms around the initially infected,
strongly fluorescing cell. To prove the replication deficiency of
SeVV-eGFP-P.DELTA.2-77 in Vero cells, it was necessary to confirm
the absence of this increase in green-fluorescing cells around the
initially infected target cell, taking into account the natural
rate of division of Vero cells. Vero cells divide on average every
24 h. If Vero cells are infected with SeVV-eGFP-P.DELTA.2-77, a
detectable eGFP expression can be seen after about 24 h. It was
observed that after a further 24 h incubation phase, in some cases
two (more weakly) fluorescing daughter cells are produced from this
initially infected, fluorescing Vero cell on account of natural
division. This observation has nothing to do with virus
multiplication, in which between 10.sup.1 to 10.sup.4 virus
particles are released from an infected target cell, and can then
infect nearby cells. This natural rate of division of infected
cells does not, however, affect the level of eGFP expression, which
is reduced with increasing number of cell divisions. This
observation shows that the viral vector SeVV-eGFP-P.DELTA.2-77 is
genome-replication-deficient, so no new genomes are synthesized. If
several successive cell divisions of an infected cell lead to a
continuous decrease in fluorescence intensity, until it finally
stops, virus multiplication can be ruled out.
[0123] For final confirmation of the replication deficiency of
SeVV-eGFP-P.DELTA.2-77 in target cells, one last study was
conducted:
.about.20.times.10.sup.6 Vero cells were placed in a T75 flask. The
cells had been seeded at high density at the beginning of the
incubation phase and accordingly were no longer dividing actively.
These Vero cells were infected with SeVV-eGFP-P.DELTA.2-77 at an
MOI of 0.001. The medium was changed to DMEM with 5% FCS (for
reduced activity of division) after incubation for 1 hour, and the
Vero cells were incubated at 33.degree. C. (P1). Two days p.i.,
according to the selected MOI, initially several thousand separate
infected, fluorescing Vero cells were observed. Owing to the high
cell density, over the next 4 days of incubation there was hardly
any cell division, i.e. the number of initially infected cells,
detected by fluorescence, remained constant. If virus particles had
been formed in this period, they would have been able to infect
nearby cells, and this would have been reflected in increased
fluorescence. Even after 8 days, propagation of the viral vector
could be ruled out, owing to absence of new infections of
surrounding cells. To supply the cells with fresh medium, the
supernatant was removed and the Vero cells were covered with fresh
medium. 12 days after the start of incubation, the Vero cells
became detached from the culture medium. For the whole test period,
no replication of the viral vector was observed in the form of an
increase in fluorescing cells. Propagation of
SeVV-eGFP-P.DELTA.2-77 from the originally infected cells to
surrounding Vero cells by production of new virus genomes and
particles could thus be ruled out. Therefore SeVV-eGFP-P.DELTA.2-77
can be described as a replication-deficient viral vector.
Summary:
[0124] The above results show that specific manipulations of genes
for components of the polymerase complex can lead to the production
of replication-deficient negative-strand RNA viruses, which are
still able to transcribe the virus-encoded genes, but are no longer
able to replicate the viral genome.
[0125] In the case of the Sendai virus, two particular variants
were investigated more closely, in which the gene for the
polymerase cofactor phosphoprotein was deleted completely
("SeVV-eGFP-.DELTA.P") or the codons for amino acids 2 to 77 were
removed ("SeVV-eGFP-P.DELTA.2-77"). Both SeV vectors are
replication-deficient in cells which do not supply the P protein in
trans (so-called target cells), but they differ considerably in
their capacity for gene expression.
Although in the case of SeVV-eGFP-.DELTA.P at an MOI=5,
statistically only 0.7% of the Vero cells remain uninfected--99.3%
should contain at least one RNP complex--only 0.01% eGFP-positive
cells were observed under the microscope. It can be concluded from
this mathematically that visible transgene expression only occurs
if 15 or more RNPs of SeVV-eGFP-.DELTA.P are present simultaneously
in an infected target cell.
[0126] This P gene-deficient SeVV displays similar weak expression
as the analogous rabies .DELTA.P variant (Shoji et al., supra).
Both vectors are only capable of primary transcription in the
infected target cell, via the polymerase complex that is supplied
from the virus particle. However, stronger expression of the
encoded transgene or antigen is desired for therapeutic application
of the vector. This condition can be fulfilled with the aid of the
replication-deficient variant SeVV-eGFP-P.DELTA.2-77, which only
gives a capacity for expression in the target cells that is reduced
on average by a factor of 10 in comparison with
replication-competent SeV. Owing to the presence of the gene for a
P protein shortened at the N-terminal end in the vector genome, not
only primary, but also secondary transcription is possible. This is
realized with newly formed, modified polymerase complexes, which
contain the vector-encoded P.DELTA.2-77 protein; this does not,
however, support the replication mode of polymerase.
Quantification of protein synthesis in infected target cells has
demonstrated that the replication-deficient viral vector
SeVV-eGFP-P.DELTA.2-77 is capable of performing efficient
transcription and expression of viral-encoded genes. Not only is
the 3'-proximal transgene (eGFP) effectively synthesized; the HN
gene located at genome position 6 is transcribed for at least 9
days after infection and the protein is exposed functionally on
infected target cells.
9. Determination of the Immune Response Induced in a Mouse Model by
a Replication-Deficient RNA Vaccine
[0127] It was shown that preferably by a deletion in the P gene
("P.DELTA.2-77") an altered viral polymerase complex is produced,
which no longer allows synthesis of new genomes. At the same time,
after infection with these replication-deficient viruses, the viral
gene expression mediated in the target cell is only approx.
10.times. lower in comparison with infections with
replication-competent virus.
[0128] In order to demonstrate a sufficiently immunogenic property
of the replication-deficient negative-strand RNA virus as
vaccination vector, antigens or antigenic determinants of two
heterologous viruses (human parainfluenza virus type 3, hPIV3, and
respiratory syncytial virus, RSV) were inserted in the virus
genome: for this, a replication-deficient SeV P.DELTA.2-77 was
constructed, in which the genes of the original surface proteins F
and HN were replaced with genes coding for chimeric F and HN
proteins SeV/hPIV3. The chimeric F protein contains 558 amino acids
and comprises the extracellular domain of hPIV3 (493 amino acids),
the transmembrane domain of SeV (23 amino acids) and the
cytoplasmic domain of SeV (42 amino acids). The chimeric HN protein
has 579 amino acids and comprises the cytoplasmic domain of SeV (35
amino acids), the transmembrane domain of SeV (25 amino acids) and
the extracellular domain of hPIV3 (519 amino acids). The amino acid
sequences of the chimeric F protein and of the chimeric HN protein
are shown in the sequence listing as SEQ ID No. 27 and 28.
Inserting chimeric genes in the virus genome produces a novel
antigenicity and in addition ensures efficient assembly of vaccine
particles during their production.
[0129] The surface protein F of RSV was encoded in an additional
expression cassette interposed between two viral genes, so that the
construct was extended to a bivalent vaccine.
[0130] This new vaccine was tested in an animal model. Groups of
Balb/C mice were immunized intranasally three times with two
different virus preparations (group A or C, 10.sup.4 infectious
units each) at intervals of three weeks, and a control group (B)
received PBS instead of the vaccine. After the third immunization,
nasal wash fluid (NW) was obtained for analysis of the mucosal
immune response, and broncho-alveolar (BAL) flushing was carried
out, and the serum was isolated for analysis of the humoral immune
response. Using ELISA, we determined the quantity of induced
immunoglobulins IgA and IgG specifically against hPIV3 and RSV. The
replication-deficient vaccine prototype produced a definite
induction of IgA antibodies specifically against hPIV3 (FIG. 15A),
but there was less induction of anti-RSV IgA antibodies (not
shown). The induction of a humoral immune response to the surface
antigens of both viruses produced comparable titers, and the amount
of specific IgG differs by a factor of 2 (FIG. 15B). Further
analysis of the anti-hPIV3-IgG showed that the induced antibodies
have neutralizing properties (titer 1/64). In contrast, as
expected, no specific IgA or IgG induction was found in the control
group.
[0131] The vaccine according to the invention was able to induce a
specific mucosal and humoral immune response to heterologous viral
antigens. Additional experiments showed that lymphocytes of
immunized mice produced interferon-.gamma., whereas IL-5 could not
be detected. This finding indicates that the bivalent,
replication-deficient RNA vaccine is able to trigger a T-cell
immune response, which is a prerequisite for long-lasting
immunity.
Summary
[0132] Following infection of experimental animals with a modified
vector, in which coding sequences for antigens of two heterologous
viruses were inserted, the induction of neutralizing antibodies was
detected. This shows the potential of replication-deficient
negative-strand RNA viruses for the development of novel
vaccines.
10. List of DNA Oligonucleotides Used
[0133] The DNA oligonucleotides used in the above examples are
shown below in Table 3.
TABLE-US-00003 TABLE 3 SEQ ID Length T.sub.m No. Designation [nt]
Sequence 5'.fwdarw.3' [.degree. C.] 1 X I = M13 19
GGAAACAGCTATGACCATG 54 2 X I (+) 59
GGATCATTAGTACCTTGAAGCCTCGTAGATCGCGGC 56 CGCGTGAACTTTGGCAGCAAAG 3 X
II 57 GGCTTCAAGGTACTAATGATCCGTAGTAAGAAAAAC 64 TTAGGGTGAAAGTATTCCACC
4 X II (+) = 18 GGTAGGTGTCTATGAGGC 56 N-1029 (+) 5 XX 44
GGAAGGAAAAGCGGCCGCCGGCGGGATCATACGAGG 61 CTTCAAGG 6 XX (+) 57
CCTGTGTTTCTGCGGCCGCCGTTCGCGAGGCCGGCC 61 CGTGAACTTTGGCAGCAAAGC 7
NotI eGFP 44 CGCGGGCCCGGGGCGGCCGCGTCGCCACCATGGTGA 60 GCAAGGGC 8
eGFP NotI 26 GATGCATGCTCGAGCGGCCGCTTTAC 58 (+) 9 SgrAI eGFP 36
GGATTACTATCGCCGGCGGTCGCCACCATGGTGAGC 61 10 eGFP SgrAI 37
CGCTAACTGTCGCCGGCGTTTACTTGTACAGCTCGT 63 (+) CC 11 FseI DsRed 36
CGGATCAAGTGGCCGGCCGTCGCCACCATGGTGCGC 59 12 DsRed FseI 42
CGCGAATATCGGCCGGCCAAGTCTACAGGAACAGGT 63 (+) GGTGGC 13 .DELTA.N I =
M13 19 GGAAACAGCTATGACCATG 54 14 .DELTA.N I (+) 35
CGGTGCGGGCCCGCACGTGAACTTTGGCAGCAAAGC 50 15 .DELTA.N II 28
GTTCACGTGCGGGCCCGATCATACGAGG 44 16 .DELTA.N II (+) = 19
CGCGTCTCGGGATGATTCG 62 P-2892 (+) 17 .DELTA.P I = N- 17
CCCTGACACACTCCTTC 54 578 18 .DELTA.P I (+) 31
GCGCCGCTCGAGGCGGTAAGTGTAGCCGAAG 64 19 .DELTA.P II 34
CCTGCGCTCGAGCTCATCCCGGGTGAGGCATCCC 64 20 .DELTA.P II (+) 34
GGCGACGCGTCAGTCTCACAGCCTAATTCG 64 21 XhoI P.DELTA.2-77 47
CCCCCTTTTTCTCGAGATGTCGACCCAAGATAATCG 84 ATCAGGTGAGG 22 P.DELTA.2-77
(+) 46 TTTTTCCCCCCTCGAGTTACTAGTTGGTCAGTGACT 80 XhoI CTATGTCCTC 23
.DELTA.L I = F- 20 AGCATATATCCAGAGGTCAC 58 4871 24 .DELTA.L I (+)
38 GGGACTAATTAGTCGGGCCCGACC 58 25 .DELTA.L II 31
GCACTTGGGCCCGACTAATTAGTCCCTC 60 26 .DELTA.L II (+) 21
CGAATGGCGCGCCTGATGCGG 64
Sequence CWU 1
1
28119DNAartificialartificial sequence 1ggaaacagct atgaccatg
19258DNAartificialartificial sequence 2ggatcattag taccttgaag
cctcgtagat cgcggccgcg tgaactttgg cagcaaag
58357DNAartificialartificial sequence 3ggcttcaagg tactaatgat
ccgtagtaag aaaaacttag ggtgaaagta ttccacc
57418DNAartificialartificial sequence 4ggtaggtgtc tatgaggc
18544DNAartificialartificial sequence 5ggaaggaaaa gcggccgccg
gcgggatcat acgaggcttc aagg 44657DNAartificialoligonucleotide
6cctgtgtttc tgcggccgcc gttcgcgagg ccggcccgtg aactttggca gcaaagc
57744DNAartificialartificial sequence 7cgcgggcccg gggcggccgc
gtcgccacca tggtgagcaa gggc 44826DNAartificialartificial sequence
8gatgcatgct cgagcggccg ctttac 26936DNAartificialartificial sequence
9ggattactat cgccggcggt cgccaccatg gtgagc
361038DNAartificialartificial sequence 10cgctaactgt cgccggcgtt
tacttgtaca gctcgtcc 381136DNAartificialartificial sequence
11cggatcaagt ggccggccgt cgccaccatg gtgcgc
361242DNAartificialartificial sequence 12cgcgaatatc ggccggccaa
gtctacagga acaggtggtg gc 421319DNAartificialartificial sequence
13ggaaacagct atgaccatg 191436DNAartificialartificial sequence
14cggtgcgggc ccgcacgtga actttggcag caaagc
361528DNAartificialartificial sequence 15gttcacgtgc gggcccgatc
atacgagg 281619DNAartificialartificial sequence 16cgcgtctcgg
gatgattcg 191717DNAartificialartificial sequence 17ccctgacaca
ctccttc 171831DNAartificialartificial sequence 18gcgccgctcg
aggcggtaag tgtagccgaa g 311934DNAartificialartificial sequence
19cctgcgctcg agctcatccc gggtgaggca tccc
342030DNAartificialartificial sequence 20ggcgacgcgt cagtctcaca
gcctaattcg 302147DNAartificialartificial sequence 21cccccttttt
ctcgagatgt cgacccaaga taatcgatca ggtgagg
472246DNAartificialartificial sequence 22tttttccccc ctcgagttac
tagttggtca gtgactctat gtcctc 462320DNAartificialartificial sequence
23agcatatatc cagaggtcac 202424DNAartificialartificial sequence
24gggactaatt agtcgggccc gacc 242528DNAartificialartificial sequence
25gcacttgggc ccgactaatt agtccctc 282621DNAartificialartificial
sequence 26cgaatggcgc gcctgatgcg g 2127558PRTartificialartificial
sequence 27Met Pro Thr Ser Ile Leu Leu Ile Ile Thr Thr Met Ile Met
Ala Ser1 5 10 15Phe Cys Gln Ile Asp Ile Thr Lys Leu Gln His Val Gly
Val Leu Val20 25 30Asn Ser Pro Lys Gly Met Lys Ile Ser Gln Asn Phe
Glu Thr Arg Tyr35 40 45Leu Ile Leu Ser Leu Ile Pro Lys Ile Glu Asp
Ser Asn Ser Cys Gly50 55 60Asp Gln Gln Ile Lys Gln Tyr Lys Arg Leu
Leu Asp Arg Leu Ile Ile65 70 75 80Pro Leu Tyr Asp Gly Leu Arg Leu
Gln Lys Asp Val Ile Val Ser Asn85 90 95Gln Glu Ser Asn Glu Asn Thr
Asp Pro Arg Thr Lys Arg Phe Phe Gly100 105 110Gly Val Ile Gly Thr
Ile Ala Leu Gly Val Ala Thr Ser Ala Gln Ile115 120 125Thr Ala Ala
Val Ala Leu Val Glu Ala Lys Gln Ala Arg Ser Asp Ile130 135 140Glu
Lys Leu Lys Glu Ala Ile Arg Asp Thr Asn Lys Ala Val Gln Ser145 150
155 160Val Gln Ser Ser Ile Gly Asn Leu Ile Val Ala Ile Lys Ser Val
Gln165 170 175Asp Tyr Val Asn Lys Glu Ile Val Pro Ser Ile Ala Arg
Leu Gly Cys180 185 190Glu Ala Ala Gly Leu Gln Leu Gly Ile Ala Leu
Thr Gln His Tyr Ser195 200 205Glu Leu Thr Asn Ile Phe Gly Asp Asn
Ile Gly Ser Leu Gln Glu Lys210 215 220Gly Ile Lys Leu Gln Gly Ile
Ala Ser Leu Tyr Arg Thr Asn Ile Thr225 230 235 240Glu Ile Phe Thr
Thr Ser Thr Val Asp Lys Tyr Asp Ile Tyr Asp Leu245 250 255Leu Phe
Thr Glu Ser Ile Lys Val Arg Val Ile Asp Val Asp Leu Asn260 265
270Asp Tyr Ser Ile Thr Leu Gln Val Arg Leu Pro Leu Leu Thr Arg
Leu275 280 285Leu Asn Thr Gln Ile Tyr Arg Val Asp Ser Ile Ser Tyr
Asn Ile Gln290 295 300Asn Arg Glu Trp Tyr Ile Pro Leu Pro Ser His
Ile Met Thr Lys Gly305 310 315 320Ala Phe Leu Gly Gly Ala Asp Val
Lys Glu Cys Ile Glu Ala Phe Ser325 330 335Ser Tyr Ile Cys Pro Ser
Asp Pro Gly Phe Val Leu Asn His Glu Met340 345 350Glu Ser Cys Leu
Ser Gly Asn Ile Ser Gln Cys Pro Arg Thr Val Val355 360 365Lys Ser
Asp Ile Val Pro Arg Tyr Ala Phe Val Asn Gly Gly Val Val370 375
380Ala Asn Cys Ile Thr Thr Thr Cys Thr Cys Asn Gly Ile Gly Asn
Arg385 390 395 400Ile Asn Gln Pro Pro Asp Gln Gly Val Lys Ile Ile
Thr His Lys Glu405 410 415Cys Asn Thr Ile Gly Ile Asn Gly Met Leu
Phe Asn Thr Asn Lys Glu420 425 430Gly Thr Leu Ala Phe Tyr Thr Pro
Asn Asp Ile Thr Leu Asn Asn Ser435 440 445Val Ala Leu Asp Pro Ile
Asp Ile Ser Ile Glu Leu Asn Lys Ala Lys450 455 460Ser Asp Leu Glu
Glu Ser Lys Glu Trp Ile Arg Arg Ser Asn Gln Lys465 470 475 480Leu
Asp Ser Ile Gly Asn Trp His Gln Ser Ser Thr Thr Val Ile Thr485 490
495Ile Ile Val Val Met Val Val Ile Leu Val Val Ile Ile Val Ile
Val500 505 510Ile Val Leu Tyr Arg Leu Lys Arg Ser Met Leu Met Gly
Asn Pro Asp515 520 525Asp Arg Ile Pro Arg Asp Thr Tyr Thr Leu Glu
Pro Lys Ile Arg His530 535 540Met Tyr Thr Asn Gly Gly Phe Asp Ala
Met Ala Glu Lys Arg545 550 55528579PRTartificialartificial sequence
28Met Asp Gly Asp Arg Gly Lys Arg Asp Ser Tyr Trp Ser Thr Ser Pro1
5 10 15Ser Gly Ser Thr Thr Lys Leu Ala Ser Gly Trp Glu Arg Ser Ser
Lys20 25 30Val Asp Thr Trp Leu Leu Ile Leu Ser Phe Thr Gln Trp Ala
Leu Ser35 40 45Ile Ala Thr Val Ile Ile Cys Ile Ile Ile Ser Ala Asn
Ser Ile Lys50 55 60Ser Glu Lys Ala His Glu Ser Leu Leu Gln Asp Val
Asn Asn Glu Phe65 70 75 80Met Glu Val Thr Glu Lys Ile Gln Met Ala
Ser Asp Asn Ile Asn Asp85 90 95Leu Ile Gln Ser Gly Val Asn Thr Arg
Leu Leu Thr Ile Gln Ser His100 105 110Val Gln Asn Tyr Ile Pro Ile
Ser Leu Thr Gln Gln Met Ser Asp Leu115 120 125Arg Lys Phe Ile Ser
Glu Ile Thr Ile Arg Asn Asp Asn Arg Glu Val130 135 140Pro Pro Gln
Arg Ile Thr His Asp Ala Gly Ile Lys Pro Leu Asn Pro145 150 155
160Asp Asp Phe Trp Arg Cys Thr Ser Gly Leu Pro Ser Leu Met Lys
Thr165 170 175Pro Lys Ile Arg Leu Met Pro Gly Pro Gly Leu Leu Ala
Met Pro Thr180 185 190Thr Val Asp Gly Cys Val Arg Thr Pro Ser Leu
Val Ile Asn Asp Leu195 200 205Ile Tyr Ala Tyr Thr Ser Asn Leu Ile
Thr Arg Gly Cys Gln Asp Ile210 215 220Gly Lys Ser Tyr Gln Val Leu
Gln Ile Gly Ile Ile Thr Val Asn Ser225 230 235 240Asp Leu Val Pro
Asp Leu Asn Pro Arg Ile Ser His Thr Phe Asn Ile245 250 255Asn Asp
Asn Arg Lys Ser Cys Ser Leu Ala Leu Leu Asn Thr Asp Val260 265
270Tyr Gln Leu Cys Ser Thr Pro Lys Val Asp Glu Arg Ser Asp Tyr
Ala275 280 285Ser Ser Gly Ile Glu Asp Ile Val Leu Asp Ile Val Asn
His Asp Gly290 295 300Ser Ile Ser Thr Thr Arg Phe Lys Asn Asn Asn
Ile Ser Phe Asp Gln305 310 315 320Pro Tyr Ala Ala Leu Tyr Pro Ser
Val Gly Pro Gly Ile Tyr Tyr Lys325 330 335Gly Lys Ile Ile Phe Leu
Gly Tyr Gly Gly Leu Glu His Pro Ile Asn340 345 350Glu Asn Ala Ile
Cys Asn Thr Thr Gly Cys Pro Gly Lys Thr Gln Arg355 360 365Asp Cys
Asn Gln Ala Ser His Ser Pro Trp Phe Ser Asp Arg Arg Met370 375
380Val Asn Ser Ile Ile Val Val Asp Lys Gly Leu Asn Ser Ile Pro
Lys385 390 395 400Leu Lys Val Trp Thr Ile Ser Met Arg Gln Asn Tyr
Trp Gly Ser Glu405 410 415Gly Arg Leu Leu Leu Leu Gly Asn Lys Ile
Tyr Ile Tyr Thr Arg Ser420 425 430Thr Ser Trp His Ser Lys Leu Gln
Leu Gly Ile Ile Asp Ile Thr Asp435 440 445Tyr Ser Asp Ile Arg Ile
Lys Trp Thr Trp His Asn Val Leu Ser Arg450 455 460Pro Gly Asn Asn
Glu Cys Pro Trp Gly His Ser Cys Pro Asp Gly Cys465 470 475 480Ile
Thr Gly Val Tyr Thr Asp Ala Tyr Pro Leu Asn Pro Thr Gly Ser485 490
495Ile Val Ser Ser Val Ile Leu Asp Ser Gln Lys Ser Arg Val Asn
Pro500 505 510Val Ile Thr Tyr Ser Thr Ser Thr Glu Arg Val Asn Glu
Leu Ala Ile515 520 525Arg Asn Lys Thr Leu Ser Ala Gly Tyr Thr Thr
Thr Ser Cys Ile Thr530 535 540His Tyr Asn Lys Gly Tyr Cys Phe His
Ile Val Glu Ile Asn His Lys545 550 555 560Ser Leu Asp Thr Phe Gln
Pro Met Leu Phe Lys Thr Glu Ile Pro Lys565 570 575Ser Cys Ser
* * * * *