U.S. patent application number 12/184351 was filed with the patent office on 2009-02-05 for rnai-related inhibition of tnfalpha signaling pathway for treatment of ocular angiogenesis.
This patent application is currently assigned to ALCON RESEARCH, LTD.. Invention is credited to David P. Bingaman, Jon E. Chatterton, Abbot F. Clark, Adrian M. Timmers, Martin B. Wax.
Application Number | 20090036396 12/184351 |
Document ID | / |
Family ID | 40263006 |
Filed Date | 2009-02-05 |
United States Patent
Application |
20090036396 |
Kind Code |
A1 |
Chatterton; Jon E. ; et
al. |
February 5, 2009 |
RNAi-RELATED INHIBITION OF TNFalpha SIGNALING PATHWAY FOR TREATMENT
OF OCULAR ANGIOGENESIS
Abstract
RNA interference is provided for inhibition of tumor necrosis
factor .alpha. (TNF.alpha.) by silencing TNF.alpha. cell surface
receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing
TNF.alpha. converting enzyme (TACE/ADAM17) mRNA expression.
Silencing such TNF.alpha. targets, in particular, is useful for
treating patients having a TNF.alpha.-related condition or at risk
of developing a TNF.alpha.-related condition, such as ocular
angiogenesis, retinal ischemia, and diabetic retinopathy.
Inventors: |
Chatterton; Jon E.;
(Crowley, TX) ; Clark; Abbot F.; (Arlington,
TX) ; Bingaman; David P.; (Weatherford, TX) ;
Wax; Martin B.; (Westlake, TX) ; Timmers; Adrian
M.; (Fort Worth, TX) |
Correspondence
Address: |
ALCON
IP LEGAL, TB4-8, 6201 SOUTH FREEWAY
FORT WORTH
TX
76134
US
|
Assignee: |
ALCON RESEARCH, LTD.
Fort Worth
TX
|
Family ID: |
40263006 |
Appl. No.: |
12/184351 |
Filed: |
August 1, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60953825 |
Aug 3, 2007 |
|
|
|
Current U.S.
Class: |
514/44R ;
536/24.5 |
Current CPC
Class: |
C12N 2310/319 20130101;
C12N 2310/53 20130101; C12N 2310/141 20130101; C12N 15/1138
20130101; A61P 27/00 20180101; C12N 2310/31 20130101; C12N 2310/14
20130101; C12N 15/1137 20130101; C12N 2310/531 20130101; C12N
2310/321 20130101; C12N 15/1136 20130101; C12N 15/113 20130101;
A61P 27/02 20180101; C12N 2310/32 20130101; C12N 2310/111 20130101;
A61P 35/00 20180101 |
Class at
Publication: |
514/44 ;
536/24.5 |
International
Class: |
A61K 31/7105 20060101
A61K031/7105; C07H 21/02 20060101 C07H021/02; A61P 27/00 20060101
A61P027/00 |
Claims
1. A method of treating a TNF.alpha.-related ocular disorder in a
patient in need thereof, comprising administering to the patient an
interfering RNA molecule that attenuates expression of the TNFR1 or
TACE mRNA via RNA interference, wherein the TNF.alpha.-related
ocular disorder is ocular angiogenesis, ocular neovascularization,
proliferative diabetic retinopathy, sequela associated with retinal
ischemia, posterior segment neovascularization (PSNV), or
neovascular glaucoma.
2. The method of claim 1, wherein the interfering RNA molecule is
double stranded and each strand is independently about 19 to about
27 nucleotides in length.
3. The method of claim 2, wherein each strand is independently
about 19 nucleotides to about 25 nucleotides in length.
4. The method of claim 2, wherein each strand is independently
about 19 nucleotides to about 21 nucleotides in length.
5. The method of claim 2, wherein the sense and antisense strands
are connected by a linker to form a shRNA that can attenuate
expression of TACE or TNFR1 mRNA in a patient.
6. The method of claim 2, wherein the interfering RNA molecule has
blunt ends.
7. The method of claim 2, wherein at least one strand of the
interfering RNA molecule comprises a 3' overhang.
8. The method of claim 7, wherein the 3' overhang comprises about 1
to about 6 nucleotides.
9. The method of claim 8, wherein the 3' overhang comprises 2
nucleotides.
10. The method of claim 1, wherein the interfering RNA molecule is
administered via in vivo expression from an expression vector
capable of expressing the interfering RNA molecule.
11. The method of claim 1, wherein the patient has or is at risk of
developing a TNF.alpha.-related ocular disorder.
12. The method of claim 1, wherein the interfering RNA molecule
recognizes a portion of TACE mRNA that corresponds to any of SEQ ID
NO: 3 and SEQ ID NO: 14-SEQ ID NO: 58.
13. The method of claim 1, wherein the interfering RNA molecule
recognizes a portion of TNFR1 mRNA that corresponds to any of SEQ
ID NO: 155-SEQ ID NO: 201.
14. The method of claim 1, wherein the interfering RNA molecule
recognizes a portion of TACE mRNA, wherein the portion comprises
nucleotide 297, 333, 334, 335, 434, 470, 493, 547, 570, 573, 618,
649, 689, 755, 842, 844, 846, 860, 878, 894, 900, 909, 910, 913,
942, 970, 984, 1002, 1010, 1053, 1064, 1137, 1162, 1215, 1330,
1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541, 1553, 1557, 1591,
1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658, 1661, 1691, 1794,
1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100, 2121, 2263, 2277,
2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629, 2639, 2764, 2766,
2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313, 3317, 3332, or 3337
of SEQ ID NO: 1.
15. The method of claim 1, wherein the interfering RNA molecule
recognizes a portion of TNFR1 mRNA, wherein the portion comprises
nucleotide 124, 328, 387, 391, 393, 395, 406, 421, 423, 444, 447,
455, 459, 460, 467, 469, 470, 471, 475, 479, 513, 517, 531, 543,
556, 576, 587, 588, 589, 595, 601, 602, 611, 612, 651, 664, 667,
668, 669, 677, 678, 785, 786, 788, 791, 792, 804, 813, 824, 838,
843, 877, 884, 929, 959, 960, 961, 963, 964, 965, 970, 973, 974,
1000, 1002, 1013, 1026, 1053, 1056, 1057, 1058, 1161, 1315, 1318,
1324, 1357, 1360, 1383, 1393, 1420, 1471, 1573, 1671, 2044, 2045,
2046, 2047, 2048, 2089, 2090, 2091, or, 2092 of SEQ ID NO: 2.
16. The method of claim 1, wherein the interfering RNA molecule
comprises at least one modification.
17. The method of claim 1, wherein the interfering RNA molecule is
a shRNA, a siRNA, or a miRNA.
18. The method of claim 1, wherein the interfering RNA molecule is
administered via a topical, intravitreal, transcleral, periocular,
conjunctival, subtenon, intracameral, subretinal, subconjunctival,
retrobulbar, or intracanalicular route.
19. An interfering RNA molecule having a length of about 19 to
about 49 nucleotides, the interfering RNA molecule comprising: (a)
a region of at least 13 contiguous nucleotides having at least 90%
sequence complementarity to, or at least 90% sequence identity
with, the penultimate 13 nucleotides of the 3' end of a mRNA
corresponding to any one of SEQ ID NO:3 and SEQ ID NO:14-SEQ ID
NO:58; (b) a region of at least 14 contiguous nucleotides having at
least 85% sequence complementarity to, or at least 85% sequence
identity with, the penultimate 14 nucleotides of the 3' end of an
mRNA corresponding to any one of SEQ ID NO:3 and SEQ ID NO:14-SEQ
ID NO:58; or (c) a region of at least 15, 16, 17, or 18 contiguous
nucleotides having at least 80% sequence complementarity to, or at
least 80% sequence identity with, the penultimate 15, 16, 17, or 18
nucleotides, respectively, of the 3' end of an mRNA corresponding
to any one of SEQ ID NO:3 and SEQ ID NO:14-SEQ ID NO:58.
20. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule recognizes a portion of TACE mRNA that
corresponds to any of SEQ ID NO:3 and SEQ ID NO:14-SEQ ID
NO:58.
21. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule recognizes a portion of TACE mRNA, wherein
the portion comprises nucleotide 297, 333, 334, 335, 434, 470, 493,
547, 570, 573, 618, 649, 689, 755, 842, 844, 846, 860, 878, 894,
900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053, 1064, 1137,
1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505, 1508, 1541,
1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626, 1632, 1658,
1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022, 2094, 2100,
2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606, 2608, 2629,
2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264, 3284, 3313,
3317, 3332, or 3337 of SEQ ID NO: 1.
22. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule is a shRNA, a siRNA, or a miRNA.
23. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule comprises at least one modification.
24. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule is double stranded, and wherein at least
one strand of the interfering RNA molecule comprises a 3'
overhang.
25. The interfering RNA molecule of claim 24, wherein the 3'
overhang comprises about 1 to about 6 nucleotides.
26. The interfering RNA molecule of claim 25, wherein the 3'
overhang comprises 2 nucleotides.
27. The interfering RNA molecule of claim 19, wherein the
interfering RNA molecule is double stranded, and the interfering
RNA molecule has blunt ends.
28. An interfering RNA molecule having a length of about 19 to
about 49 nucleotides, the interfering RNA molecule comprising: (a)
a region of at least 13 contiguous nucleotides having at least 90%
sequence complementarity to, or at least 90% sequence identity
with, the penultimate 13 nucleotides of the 3' end of a mRNA
corresponding to any one of SEQ ID NO:155-SEQ ID NO:201; (b) a
region of at least 14 contiguous nucleotides having at least 85%
sequence complementarity to, or at least 85% sequence identity
with, the penultimate 14 nucleotides of the 3' end of an mRNA
corresponding to any one of SEQ ID NO:155-SEQ ID NO:201; or (d) a
region of at least 15, 16, 17, or 18 contiguous nucleotides having
at least 80% sequence complementarity to, or at least 80% sequence
identity with, the penultimate 15, 16, 17, or 18 nucleotides,
respectively, of the 3' end of an mRNA corresponding to any one of
SEQ ID NO:155-SEQ ID NO:201.
29. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule recognizes a portion of TNFR1 mRNA that
corresponds to any of SEQ ID NO:155-SEQ ID NO:201.
30. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule recognizes a portion of TNFR1 mRNA,
wherein the portion comprises nucleotide 124, 328, 387, 391, 393,
395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470, 471,
475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595, 601,
602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786, 788,
791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960, 961,
963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053, 1056,
1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393, 1420,
1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090, 2091,
or, 2092 of SEQ ID NO: 2.
31. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule is a shRNA, a siRNA, or a miRNA.
32. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule comprises at least one modification.
33. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule is double stranded, and wherein at least
one strand of the interfering RNA molecule comprises a 3'
overhang.
34. The interfering RNA molecule of claim 33, wherein the 3'
overhang comprises about 1 to about 6 nucleotides.
35. The interfering RNA molecule of claim 34, wherein the 3'
overhang comprises 2 nucleotides.
36. The interfering RNA molecule of claim 28, wherein the
interfering RNA molecule is double stranded, and the interfering
RNA molecule has blunt ends.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority under 35 U.S.C. .sctn.119
to U.S. Provisional Patent Application No. 60/953,825 filed Aug. 3,
2007, the entire contents of which are incorporated herein by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of interfering
RNA compositions for silencing tumor necrosis factor .alpha.
(TNF.alpha.) by silencing the TNF.alpha. cell surface receptor TNF
receptor-1 (TNFR1) mRNA, or the TNF.alpha. converting enzyme
(TACE/ADAM17) mRNA. Silencing such TNF.alpha. targets is useful for
treatment of patients having a TNF.alpha.-related condition or at
risk of developing such a condition.
BACKGROUND OF THE INVENTION
[0003] Pathologic ocular neovascularization (NV) and related
conditions occur as a cascade of events that progresses from an
initiating stimulus to the formation of abnormal new capillaries.
The stimulus appears to be the elaboration of various proangiogenic
growth factors such as vascular endothelial growth factor (VEGF),
platelet-derived growth factor (PDGF), and angiopoetins, among
others. Following initiation of the angiogenic cascade, the
capillary basement membrane and extracellular matrix are degraded
and capillary endothelial cell proliferation and migration occur.
Endothelial sprouts anastomose to form tubes with subsequent patent
lumen formation. The new capillaries commonly have increased
vascular permeability or leakiness due to immature barrier
function, which can lead to tissue edema. Differentiation into a
mature capillary is indicated by the presence of a continuous
basement membrane and normal endothelial junctions between other
endothelial cells and pericytes; however, this differentiation
process is often impaired during pathologic conditions.
[0004] Retinal NV is observed in retinal ischemia, proliferative
and nonproliferative diabetic retinopathy (PDR and NPDR,
respectively), retinopathy of prematurity (ROP), central and branch
retinal vein occlusion, and age-related macular degeneration (AMD).
The retina includes choriocapillaries that form the choroid and are
responsible for providing nourishment to the retina, Bruch's
membrane that acts as a filter between the retinal pigment
epithelium (RPE) and the choriocapillaries, and the RPE that
secretes angiogenic and anti-angiogenic factors responsible for,
among many other things, the growth and recession of blood
vessels.
[0005] NV can include damage to Bruch's membrane which then allows
growth factor to come in contact with the choriocapillaries and
initiating the process of angiogenesis. The new capillaries can
break through the RPE as well as Bruch's membrane to form a new
vascular layer above the RPE. Leakage of the vascular layer leads
to wet or exudative AMD and subsequent loss of cones and rods that
are vital to vision.
[0006] Exudative AMD and PDR are the major causes of acquired
blindness in developed countries and are characterized by
pathologic posterior segment neovascularization (PSNV). The PSNV
found in exudative AMD is characterized as pathologic choroidal NV,
whereas PDR exhibits preretinal NV. In spite of the prevalence of
PSNV, treatment strategies are few and palliative at best. Approved
treatments for the PSNV in exudative AMD include laser
photocoagulation and photodynamic therapy with VISUDYNE.RTM.; both
therapies involve laser-induced occlusion of affected vasculature
and are associated with localized laser-induced damage to the
retina. For patients with PDR, grid or panretinal laser
photocoagulation and surgical interventions, such as vitrectomy and
removal of preretinal membranes, are the only options currently
available. Several different compounds are being evaluated
clinically for the pharmacologic treatment of PSNV, including
RETAANE.RTM. (Alcon Research, Ltd.), Lucentis.TM., Avastin.TM.
(Genentech), adPEDF (GenVec), squalamine (Genaera), CA4P (OxiGENE),
VEGF trap (Regeneron), LY333531 (Lilly), and siRNAs targeting VEGF
(Cand5, Acuity) and VEGFR-1 (Sirna-027, Sirna Therapeutics).
Lucentis.TM. (Genentech), an anti-VEGF antibody injected
intravitreally, and Macugen.TM. (Eyetech/Pfizer), an anti-VEGF
aptamer injected intravitreally, have recently been approved for
such use.
[0007] Diabetes mellitus is characterized by persistent
hyperglycemia that produces reversible and irreversible pathologic
changes within the microvasculature of various organs. Diabetic
retinopathy (DR) is a retinal microvascular disease that is
manifested as a cascade of stages with increasing levels of
severity and worsening prognoses for vision. Major risk factors
reported for developing diabetic retinopathy include the duration
of diabetes mellitus, quality of glycemic control, and presence of
systemic hypertension. DR is broadly classified into 2 major
clinical stages: nonproliferative diabetic retinopathy (NPDR) and
proliferative diabetic retinopathy (PDR), where the term
"proliferative" refers to the presence of preretinal
neovascularization as previously stated. Nonproliferative diabetic
retinopathy (NPDR) and subsequent macular edema are associated, in
part, with retinal ischemia that results from the retinal
microvasculopathy induced by persistent hyperglycemia.
[0008] Neovascularization also occurs in a type of glaucoma called
neovascular glaucoma in which increased intraocular pressure is
caused by growth of connective tissue and new blood vessels upon
the trabecular meshwork. Neovascular glaucoma is a form of
secondary glaucoma caused by neovascularization in the chamber
angle.
[0009] Tumor necrosis factor .alpha. (TNF.alpha.) is a major
mediator of the inflammatory response, and has been implicated in
many human diseases. Binding of TNF.alpha. to its cell surface
receptor, TNF receptor-1 (TNFR1), activates a signaling cascase
affecting a wide variety of cellular responses, including apoptosis
and inflammation. TNF.alpha. is initially expressed as an inactive,
membrane-bound precursor. Release of the active form of TNF.alpha.
from the cell surface requires proteolytic processing of the
precursor by TNF.alpha. converting enzyme (TACE/ADAM17). Inhibiting
expression of TNFR1, TACE, or both will effectively reduce the
action of TNF.alpha.. It has also been reported that TNF.alpha. is
involved in neovascularization and endothelial cell function
(Hangai et al., 2006, J. Neuroimmunol. 171:45-56; and Picchi et
al., 2006, Circ. Res. 99:69-77). In addition, Kociok et al.
demonstrated that TNFR1 deficient mice exhibited reduced
angiogenesis in an oxygen-induced retinopathy model (Kociok et al.,
2006, Invest. Ophthalmol. Vis. Sci. 47:5057-5065). In contrast,
Vinores et al. observed reduced leukostasis but not reduced retinal
neovascularization in response to oxygen-induced retinopathy in
TNFR1 deficient mice relative to wild-type mice (Vinores et al.,
2006, J. Neuroimmunol. 182:73-79). These studies indicated that
TNF.alpha. is critical for ischemia-induced leukostasis, but not
retinal neovascularization or VEGF-induced leakage. Thus,
interfering with the TNF.alpha. pathway may selectively block
pathological neovascularization without affecting the normal
process.
[0010] The present invention addresses the above-cited ocular
pathologies and provides compositions and methods using interfering
RNAs that target TACE and/or TNFR1 for treating neovascularization
associated with retinal edema, diabetic retinopathy, sequela
associated with retinal ischemia, and posterior segment
neovascularization, for example. U.S. Patent Publication
2005/0227935, published Oct. 13, 2005, to McSwiggen et al. relates
to RNA interference mediated inhibition of TNF and TNF receptor
gene expression. However, said publication teaches none of the
particular target sequences for RNA interference as provided
herein.
SUMMARY OF THE INVENTION
[0011] The invention provides interfering RNAs that silence
expression of TACE mRNA or TNFR1 mRNA, thus interfering with
proteolytic processing of the precursor to TNF.alpha., or
interfering with binding of TNF.alpha. to its cell surface
receptor, respectively, thereby attenuating activity of TNF.alpha.,
and decreasing TNFR1 or TACE levels in patients with a
TNF.alpha.-related ocular disorder or at risk of developing a
TNF.alpha.-related ocular disorder. The interfering RNAs of the
invention are useful for treating ocular angiogenesis.
[0012] The invention also provides a method of attenuating
expression of a TNFR1 or TACE mRNA in a subject. In one aspect, the
method comprises administering to the subject a composition
comprising an effective amount of interfering RNA having a length
of 19 to 49 nucleotides and a pharmaceutically acceptable carrier.
In another aspect, administration is to an eye of the subject for
attenuating expression of TNFR1 or TACE in a human.
[0013] In one aspect, the invention provides a method of
attenuating expression of TACE mRNA in an eye of a subject,
comprising administering to the eye of the subject an interfering
RNA that comprises a region that can recognize a portion of mRNA
corresponding to SEQ ID NO: 1, which is the sense cDNA sequence
encoding TACE (GenBank Accession No. NM.sub.--003183), wherein the
expression of TACE mRNA is attenuated thereby. In addition, the
invention provides methods of treating an TNF.alpha.-related ocular
disorder in a subject in need thereof, comprising administering to
the eye of the subject an interfering RNA that comprises a region
that can recognize a portion of mRNA corresponding to a portion of
SEQ ID NO: 1, wherein the expression of TACE mRNA is attenuated
thereby.
[0014] The invention also provides a method of attenuating
expression of TNFR1 mRNA in an eye of a subject, comprising
administering to the eye of the subject an interfering RNA that
comprises a region that can recognize a portion of mRNA
corresponding to SEQ ID NO: 2, which is the sense cDNA sequence
encoding TNFR1 (GenBank Accession No. NM.sub.--001065), wherein the
expression of TNFR1 mRNA is attenuated thereby. In addition, the
invention provides methods of treating an TNF.alpha.-related ocular
disorder in a subject in need thereof, comprising administering to
the eye of the subject an interfering RNA that comprises a region
that can recognize a portion of mRNA corresponding to a portion of
SEQ ID NO: 2, wherein the expression of TNFR1 mRNA is attenuated
thereby.
[0015] In certain aspects, an interfering RNA of the invention is
designed to target an mRNA corresponding to a portion of SEQ ID NO:
1, wherein the portion comprises nucleotide 297, 333, 334, 335,
434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844, 846,
860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010, 1053,
1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428, 1505,
1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605, 1626,
1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958, 2022,
2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595, 2606,
2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261, 3264,
3284, 3313, 3317, 3332, or 3337 of SEQ ID NO: 1. In particular
aspects, a "portion of SEQ ID NO: 1" is about 19 to about 49
nucleotides in length.
[0016] In certain aspects, an interfering RNA of the invention is
designed to target an mRNA corresponding to a portion of SEQ ID NO:
2, wherein the portion comprises nucleotide 124, 328, 387, 391,
393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470,
471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595,
601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786,
788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960,
961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053,
1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393,
1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090,
2091, or, 2092 of SEQ ID NO: 2. In particular aspects, a "portion
of SEQ ID NO: 2" is about 19 to about 49 nucleotides in length.
[0017] In certain aspects, an interfering RNA of the invention has
a length of about 19 to about 49 nucleotides. In other aspects, the
interfering RNA comprises a sense nucleotide strand and an
antisense nucleotide strand, wherein each strand has a region of at
least near-perfect contiguous complementarity of at least 19
nucleotides with the other strand, and wherein the antisense strand
can recognize (a) a portion of TACE mRNA corresponding to a portion
of SEQ ID NO: 1, and has a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides with the
portion of TACE mRNA; or (b) a portion of TNFR1 mRNA corresponding
to a portion of SEQ ID NO: 2, and has a region of at least
near-perfect contiguous complementarity of at least 19 nucleotides
with the portion of TNFR1 mRNA. The sense and antisense strands can
be connected by a linker sequence, which allows the sense and
antisense strands to hybridize to each other thereby forming a
hairpin loop structure as described herein.
[0018] In still other aspects, an interfering RNA of the invention
is a single-stranded interfering RNA, and wherein single-stranded
interfering RNA recognizes a portion of mRNA corresponding to a
portion of SEQ ID NO: 1 or SEQ ID NO: 2. In certain aspects, the
interfering RNA has a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides with the portion of mRNA
corresponding to the portion of SEQ ID NO: 1 or SEQ ID NO: 2. In
other aspects, the portion of SEQ ID NO: 1 comprises 297, 333, 334,
335, 434, 470, 493, 547, 570, 573, 618, 649, 689, 755, 842, 844,
846, 860, 878, 894, 900, 909, 910, 913, 942, 970, 984, 1002, 1010,
1053, 1064, 1137, 1162, 1215, 1330, 1334, 1340, 1386, 1393, 1428,
1505, 1508, 1541, 1553, 1557, 1591, 1592, 1593, 1597, 1604, 1605,
1626, 1632, 1658, 1661, 1691, 1794, 1856, 1945, 1946, 1947, 1958,
2022, 2094, 2100, 2121, 2263, 2277, 2347, 2349, 2549, 2578, 2595,
2606, 2608, 2629, 2639, 2764, 2766, 2767, 2769, 3027, 3028, 3261,
3264, 3284, 3313, 3317, 3332, or 3337 of SEQ ID NO: 1. In other
aspects, the portion of SEQ ID NO: 2 comprises 124, 328, 387, 391,
393, 395, 406, 421, 423, 444, 447, 455, 459, 460, 467, 469, 470,
471, 475, 479, 513, 517, 531, 543, 556, 576, 587, 588, 589, 595,
601, 602, 611, 612, 651, 664, 667, 668, 669, 677, 678, 785, 786,
788, 791, 792, 804, 813, 824, 838, 843, 877, 884, 929, 959, 960,
961, 963, 964, 965, 970, 973, 974, 1000, 1002, 1013, 1026, 1053,
1056, 1057, 1058, 1161, 1315, 1318, 1324, 1357, 1360, 1383, 1393,
1420, 1471, 1573, 1671, 2044, 2045, 2046, 2047, 2048, 2089, 2090,
2091, or, 2092 of SEQ ID NO: 2.
[0019] In still other aspects, an interfering RNA of the invention
comprises: (a) a region of at least 13 contiguous nucleotides
having at least 90% sequence complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of a mRNA corresponding to any one of SEQ ID NO:3 and SEQ ID
NO:14-SEQ ID NO:58; (b) a region of at least 14 contiguous
nucleotides having at least 85% sequence complementarity to, or at
least 85% sequence identity with, the penultimate 14 nucleotides of
the 3' end of an mRNA corresponding to any one of SEQ ID NO:3 and
SEQ ID NO:14-SEQ ID NO:58; or (c) a region of at least 15, 16, 17,
or 18 contiguous nucleotides having at least 80% sequence
complementarity to, or at least 80% sequence identity with, the
penultimate 15, 16, 17, or 18 nucleotides, respectively, of the 3'
end of an mRNA corresponding to any one of SEQ ID NO:3 and SEQ ID
NO:14-SEQ ID NO:58; wherein the expression of the TACE mRNA is
attenuated thereby.
[0020] In still other aspects, an interfering RNA of the invention
comprises: (a) a region of at least 13 contiguous nucleotides
having at least 90% sequence complementarity to, or at least 90%
sequence identity with, the penultimate 13 nucleotides of the 3'
end of a mRNA corresponding to any one of SEQ ID NO:155-SEQ ID
NO:201; (b) a region of at least 14 contiguous nucleotides having
at least 85% sequence complementarity to, or at least 85% sequence
identity with, the penultimate 14 nucleotides of the 3' end of an
mRNA corresponding to any one of SEQ ID NO:155-SEQ ID NO:201; or
(c) a region of at least 15, 16, 17, or 18 contiguous nucleotides
having at least 80% sequence complementarity to, or at least 80%
sequence identity with, the penultimate 15, 16, 17, or 18
nucleotides, respectively, of the 3' end of an mRNA corresponding
to any one of SEQ ID NO:155-SEQ ID NO:201; wherein the expression
of the TNFR1 mRNA is attenuated thereby.
[0021] In further aspects, an interfering RNA of the invention or
composition comprising an interfering RNA of the invention is
administered to a subject via a topical, intravitreal, transcleral,
periocular, conjunctival, subtenon, intracameral, subretinal,
subconjunctival, retrobulbar, or intracanalicular route. The
interfering RNA or composition can be administered, for example,
via in vivo expression from an interfering RNA expression vector.
In certain aspects, the interfering RNA or composition can be
administered via an aerosol, buccal, dermal, intradermal, inhaling,
intramuscular, intranasal, intraocular, intrapulmonary,
intravenous, intraperitoneal, nasal, ocular, oral, otic,
parenteral, patch, subcutaneous, sublingual, topical, or
transdermal route.
[0022] In one aspect, an interfering RNA molecule of the invention
is isolated. The term "isolated" means that the interfering RNA is
free of its total natural milieu.
[0023] The invention further provides methods of treating a
TNF.alpha.-related ocular disorder in a subject in need thereof,
comprising administering to the subject a composition comprising a
double-stranded siRNA molecule that down regulates expression of a
TACE or TNFR1 gene via RNA interference, wherein each strand of the
siRNA molecule is independently about 19 to about 27 nucleotides in
length, and one strand of the siRNA molecule comprises a nucleotide
sequence having substantial complementarity to an mRNA
corresponding to the TACE or TNFR1 gene so that the siRNA molecule
directs cleavage of the mRNA via RNA interference. In certain
aspects, the siRNA molecule is administered via an aerosol, buccal,
dermal, intradermal, inhaling, intramuscular, intranasal,
intraocular, intrapulmonary, intravenous, intraperitoneal, nasal,
ocular, oral, otic, parenteral, patch, subcutaneous, sublingual,
topical, or transdermal route.
[0024] The invention further provides for administering a second
interfering RNA to a subject in addition to a first interfering
RNA. The second interfering RNA may target the same mRNA target
gene as the first interfering RNA or may target a different gene.
Further, a third, fourth, or fifth, etc. interfering RNA may be
administered in a similar manner.
[0025] Use of any of the embodiments as described herein in the
preparation of a medicament for attenuating expression of TACE or
TNFR1 mRNA is also an embodiment of the present invention.
[0026] Specific preferred embodiments of the invention will become
evident from the following more detailed description of certain
preferred embodiments and the claims.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIG. 1 provides a TNFR1 western blot of GTM-3 cells
transfected with TNFR1 siRNAs #1, #2, #3, and #4, and a RISC-free
control siRNA, each at 10 nM, 1 nM, and 0.1 nM; a non-targeting
control siRNA (NTC2) at 10 nM; and a buffer control (-siRNA). The
arrows indicate the positions of the 55-kDa TNFR1 and 42-kDa actin
bands.
DETAILED DESCRIPTION OF THE INVENTION
[0028] The particulars shown herein are by way of example and for
purposes of illustrative discussion of the preferred embodiments of
the present invention only and are presented in the cause of
providing what is believed to be the most useful and readily
understood description of the principles and conceptual aspects of
various embodiments of the invention. In this regard, no attempt is
made to show structural details of the invention in more detail
than is necessary for the fundamental understanding of the
invention, the description taken with the drawings and/or examples
making apparent to those skilled in the art how the several forms
of the invention may be embodied in practice.
[0029] The following definitions and explanations are meant and
intended to be controlling in any future construction unless
clearly and unambiguously modified in the following examples or
when application of the meaning renders any construction
meaningless or essentially meaningless. In cases where the
construction of the term would render it meaningless or essentially
meaningless, the definition should be taken from Webster's
Dictionary, 3.sup.rd Edition or a dictionary known to those of
skill in the art, such as the Oxford Dictionary of Biochemistry and
Molecular Biology (Ed. Anthony Smith, Oxford University Press,
Oxford, 2004).
[0030] As used herein, all percentages are percentages by weight,
unless stated otherwise.
[0031] As used herein and unless otherwise indicated, the terms "a"
and "an" are taken to mean "one", "at least one" or "one or more".
Unless otherwise required by context, singular terms used herein
shall include pluralities and plural terms shall include the
singular.
[0032] In certain embodiments, the invention provides interfering
RNA molecules that can direct cleavage and/or degradation of
TNF.alpha. cell surface receptor TNF receptor-1 (TNFR1) mRNA, or
the TNF.alpha. converting enzyme (TACE/ADAM17, designated herein
"TACE") mRNA, which inhibition effects reduction of tumor necrosis
factor .alpha. (TNF.alpha.) activity, via RNA interference. Binding
of TNF.alpha. to its cell surface receptor, TNF receptor-1 (TNFR1),
activates a signaling cascade which affects a variety of cellular
responses including apoptosis and inflammation. TNF.alpha. itself
is initially expressed as an inactive, membrane-bound precursor.
Release of the active form of TNF.alpha. from the cell surface
requires proteolytic processing of the precursor by TNF.alpha.
converting enzyme (TACE/ADAM17), a member of the `A Disintegrin And
Metalloprotease` (ADAM) family.
[0033] According to the present invention, inhibiting the
expression of TNFR1 mRNA, TACE mRNA, or both TNFR1 and TACE mRNAs
effectively reduces the action of TNF.alpha.. Further, interfering
RNAs as set forth herein provided exogenously or expressed
endogenously are particularly effective at silencing TNFR1 mRNA or
TACE mRNA.
[0034] RNA interference (RNAi) is a process by which
double-stranded RNA (dsRNA) is used to silence gene expression.
While not wanting to be bound by theory, RNAi begins with the
cleavage of longer dsRNAs into small interfering RNAs (siRNAs) by
an RNaseIII-like enzyme, dicer. SiRNAs are dsRNAs that are usually
about 19 to 28 nucleotides, or 20 to 25 nucleotides, or 21 to 22
nucleotides in length and often contain 2-nucleotide 3' overhangs,
and 5' phosphate and 3' hydroxyl termini. One strand of the siRNA
is incorporated into a ribonucleoprotein complex known as the
RNA-induced silencing complex (RISC). RISC uses this siRNA strand
to identify mRNA molecules that are at least partially
complementary to the incorporated siRNA strand, and then cleaves
these target mRNAs or inhibits their translation. Therefore, the
siRNA strand that is incorporated into RISC is known as the guide
strand or the antisense strand. The other siRNA strand, known as
the passenger strand or the sense strand, is eliminated from the
siRNA and is at least partially homologous to the target mRNA.
Those of skill in the art will recognize that, in principle, either
strand of an siRNA can be incorporated into RISC and function as a
guide strand. However, siRNA design (e.g., decreased siRNA duplex
stability at the 5' end of the desired guide strand) can favor
incorporation of the desired guide strand into RISC.
[0035] The antisense strand of an siRNA is the active guiding agent
of the siRNA in that the antisense strand is incorporated into
RISC, thus allowing RISC to identify target mRNAs with at least
partial complementarity to the antisense siRNA strand for cleavage
or translational repression. RISC-related cleavage of mRNAs having
a sequence at least partially complementary to the guide strand
leads to a decrease in the steady state level of that mRNA and of
the corresponding protein encoded by this mRNA. Alternatively, RISC
can also decrease expression of the corresponding protein via
translational repression without cleavage of the target mRNA.
[0036] Interfering RNAs of the invention appear to act in a
catalytic manner for cleavage of target mRNA, i.e., interfering RNA
is able to effect inhibition of target mRNA in substoichiometric
amounts. As compared to antisense therapies, significantly less
interfering RNA is required to provide a therapeutic effect under
such cleavage conditions.
[0037] In certain embodiments, the invention provides methods of
using interfering RNA to inhibit the expression of TACE or TNFR1
target mRNA thus decreasing TACE or TNFR1 levels in patients with a
TNF.alpha.-related ocular disorder. According to the present
invention, interfering RNAs provided exogenously or expressed
endogenously effect silencing of TACE or TNFR1 expression in ocular
tissues.
[0038] The phrase, "attenuating expression of an mRNA," as used
herein, means administering or expressing an amount of interfering
RNA (e.g., an siRNA) to reduce translation of the target mRNA into
protein, either through mRNA cleavage or through direct inhibition
of translation. The terms "inhibit," "silencing," and "attenuating"
as used herein refer to a measurable reduction in expression of a
target mRNA or the corresponding protein as compared with the
expression of the target mRNA or the corresponding protein in the
absence of an interfering RNA of the invention. The reduction in
expression of the target mRNA or the corresponding protein is
commonly referred to as "knock-down" and is reported relative to
levels present following administration or expression of a
non-targeting control RNA (e.g., a non-targeting control siRNA).
Knock-down of expression of an amount including and between 50% and
100% is contemplated by embodiments herein. However, it is not
necessary that such knock-down levels be achieved for purposes of
the present invention.
[0039] Knock-down is commonly assessed by measuring the mRNA levels
using quantitative polymerase chain reaction (qPCR) amplification
or by measuring protein levels by western blot or enzyme-linked
immunosorbent assay (ELISA). Analyzing the protein level provides
an assessment of both mRNA cleavage as well as translation
inhibition. Further techniques for measuring knock-down include RNA
solution hybridization, nuclease protection, northern
hybridization, gene expression monitoring with a microarray,
antibody binding, radioimmunoassay, and fluorescence activated cell
analysis.
[0040] Attenuating expression of TACE or TNFR1 by an interfering
RNA molecule of the invention can be inferred in a human or other
mammal by observing an improvement in an an improvement in an
ocular angiogenesis symptom such as improvement in diabetic
retinopathy, retinal ischemia, or in posterior segment
neovascularization (PSNV), for example.
[0041] The ability of TACE- or TNFR1-interfering RNA to knock-down
the levels of TACE or TNFR1 gene expression in, for example, HeLa
cells can be evaluated in vitro as follows. HeLa cells are plated
24 h prior to transfection in standard growth medium (e.g., DMEM
supplemented with 10% fetal bovine serum). Transfection is
performed using, for example, Dharmafect 1 (Dharmacon, Lafayette,
Colo.) according to the manufacturer's instructions at interfering
RNA concentrations ranging from 0.1 nM-100 nM. SiCONTROL.TM.
Non-Targeting siRNA #1 and siCONTROL.TM. Cyclophilin B siRNA
(Dharmacon) are used as negative and positive controls,
respectively. Target mRNA levels and cyclophilin B mRNA (PPIB,
NM.sub.--000942) levels are assessed by qPCR 24 h post-transfection
using, for example, a TAQMAN.RTM. Gene Expression Assay that
preferably overlaps the target site (Applied Biosystems, Foster
City, Calif.). The positive control siRNA gives essentially
complete knockdown of cyclophilin B mRNA when transfection
efficiency is 100%. Therefore, target mRNA knockdown is corrected
for transfection efficiency by reference to the cyclophilin B mRNA
level in cells transfected with the cyclophilin B siRNA. Target
protein levels may be assessed approximately 72 h post-transfection
(actual time dependent on protein turnover rate) by western blot,
for example. Standard techniques for RNA and/or protein isolation
from cultured cells are well-known to those skilled in the art. To
reduce the chance of non-specific, off-target effects, the lowest
possible concentration of interfering RNA is used that produces the
desired level of knock-down in target gene expression.
[0042] Human retinal pigment epithelial (RPE) cells or other human
ocular cell lines may also be use for an evaluation of the ability
of interfering RNA to knock-down levels of an endogenous target
gene. The ability of TACE- or TNFR1-interfering RNA to knock-down
the levels of endogenous TACE or TNFR1 expression in, for example,
human RPE cells can be evaluated in vitro as follows. ARPE-19 cells
(Dunn et al., 1996, Exp. Eye Res. 62:155-169) are plated 24 h prior
to transfection inDMEM:F-12 medium supplemented with 10% FBS and 56
mM sodium bicarbonate and grown in 10% CO.sub.2. Transfection is
performed using DharmaFECT.TM. 1 (Dharmacon, Lafayette, Colo.)
according to the manufacturer's instructions at TACE- or
TNFR1-interfering RNA concentrations ranging from 0.1 nM-100 nM.
Non-targeting control interfering RNA and cyclophilin B interfering
RNA are used as controls. Target mRNA levels are assessed by qPCR
24 h post-transfection using, for example, TAQMAN.RTM. forward and
reverse primers and a probe set that encompasses the target site
(Applied Biosystems, Foster City, Calif.). Target protein levels
may be assessed approximately 72 h post-transfection (actual time
dependent on protein turnover rate) by western blot, for example.
Standard techniques for RNA and/or protein isolation from cultured
cells are well-known to those skilled in the art. To reduce the
chance of non-specific, off-target effects, the lowest possible
concentration of TACE- or TNFR1 interfering RNA is used that
produces the desired level of knock-down in target gene
expression.
[0043] A number of animal models are known that can be used to test
the activity of an interfering RNA molecule of the invention. For
example, siRNA molecules can be tested in murine laser-induced
models of choroidal neovascularization (CNV) as described in Reich
et al., 2003, Mol. Vision 9:210-216; Shen et al., 2006, Gene
Therapy 13:225-234; or Bora et al., 2006, J. Immunol.
177:1872-1878.
[0044] In one embodiment, a single interfering RNA targeting TACE
or TNFR1 mRNA is administered to decrease TACE or TNFR1 levels. In
other embodiments, two or more interfering RNAs targeting the TACE
and/or TNFR1 mRNA are administered to decrease TACE and/or TNFR1
levels. In certain embodiments, interfering RNA targeting TACE and
interfering RNA targeting TNFR1 are administered to the subject
sequentially or concurrently, thereby treating the
TNF.alpha.-related ocular disease.
[0045] The GenBank database provides the DNA sequence for TACE as
accession no. NM.sub.--003183, provided in the "Sequence Listing"
as SEQ ID NO:1. SEQ ID NO:1 provides the sense strand sequence of
DNA that corresponds to the mRNA encoding TACE (with the exception
of "T" bases for "U" bases). The coding sequence for TACE is from
nucleotides 184-2658.
[0046] Equivalents of the above cited TACE mRNA sequence are
alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is a tumor necrosis factor .alpha. converting
enzyme mRNA from another mammalian species that is homologous to
SEQ ID NO:1 (i.e., an ortholog).
[0047] The GenBank database provides the DNA sequence for TNFR1 as
accession no. NM.sub.--001065, provided in the "Sequence Listing"
as SEQ ID NO:2. SEQ ID NO:2 provides the sense strand sequence of
DNA that corresponds to the mRNA encoding TNFR1 (with the exception
of "T" bases for "U" bases). The coding sequence for TNFR1 is from
nucleotides 282-1649.
[0048] Equivalents of the above cited TNFR1 mRNA sequence are
alternative splice forms, allelic forms, isozymes, or a cognate
thereof. A cognate is a tumor necrosis factor receptor-1 mRNA from
another mammalian species that is homologous to SEQ ID NO:2 (i.e.,
an ortholog).
[0049] In certain embodiments, a "subject" in need of treatment for
a TNF.alpha.-related ocular disorder or at risk for developing a
TNF.alpha.-related ocular disorder is a human or other mammal
having a TNF.alpha.-related ocular disorder or at risk of having a
TNF.alpha.-related ocular disorder associated with undesired or
inappropriate expression or activity of targets as cited herein,
i.e., TACE or TNFR1. Ocular structures associated with such
disorders may include the eye, retina, choroid, lens, cornea,
trabecular meshwork, iris, optic nerve, optic nerve head, sclera,
anterior or posterior segment, or ciliary body, for example. A
subject may also be an ocular cell, cell culture, organ or an ex
vivo organ or tissue or cell.
[0050] "TNF.alpha.-related ocular disorder" as used herein includes
conditions associated with ocular angiogenesis. The term "ocular
angiogenesis," as used herein, includes ocular pre-angiogenic
conditions and ocular angiogenic conditions, and includes those
cellular changes resulting from the expression of TACE and/or TNFR1
mRNAs that lead directly or indirectly to ocular angiogenesis,
ocular neovascularization, diabetic retinopathy, sequela associated
with retinal ischemia, posterior segment neovascularization (PSNV),
and neovascular glaucoma, for example. The interfering RNAs of the
invention are useful for treating patients with ocular
angiogenesis, ocular neovascularization, diabetic retinopathy,
sequela associated with retinal ischemia, PSNV, and neovascular
glaucoma, or patients at risk of developing such conditions, for
example. The term "ocular neovascularization" includes age-related
macular degeneration, cataract, acute ischemic optic neuropathy
(AION), commotio retinae, retinal detachment, retinal tears or
holes, iatrogenic retinopathy and other ischemic retinopathies or
optic neuropathies, myopia, retinitis pigmentosa, and/or the
like.
[0051] The term "siRNA" as used herein refers to a double-stranded
interfering RNA unless otherwise noted. Typically, an siRNA of the
invention is a double-stranded nucleic acid molecule comprising two
nucleotide strands, each strand having about 19 to about 28
nucleotides (i.e. about 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28
nucleotides). The phrase "interfering RNA having a length of 19 to
49 nucleotides" when referring to a double-stranded interfering RNA
means that the antisense and sense strands independently have a
length of about 19 to about 49 nucleotides, including interfering
RNA molecules where the sense and antisense strands are connected
by a linker molecule.
[0052] In addition to siRNA molecules, other interfering RNA
molecules and RNA-like molecules can interact with RISC and silence
gene expression. Examples of other interfering RNA molecules that
can interact with RISC include short hairpin RNAs (shRNAs),
single-stranded siRNAs, microRNAs (miRNAs), and dicer-substrate
27-mer duplexes. Examples of RNA-like molecules that can interact
with RISC include siRNA, single-stranded siRNA, microRNA, and shRNA
molecules containing one or more chemically modified nucleotides,
one or more non-nucleotides, one or more deoxyribonucleotides,
and/or one or more non-phosphodiester linkages. All RNA or RNA-like
molecules that can interact with RISC and participate in
RISC-related changes in gene expression are referred to herein as
"interfering RNAs" or "interfering RNA molecules." SiRNAs,
single-stranded siRNAs, shRNAs, miRNAs, and dicer-substrate 27-mer
duplexes are, therefore, subsets of "interfering RNAs" or
"interfering RNA molecules."
[0053] Single-stranded interfering RNA has been found to effect
mRNA silencing, albeit less efficiently than double-stranded RNA.
Therefore, embodiments of the present invention also provide for
administration of a single-stranded interfering RNA that has a
region of at least near-perfect contiguous complementarity with a
portion of SEQ ID NO: 1 or a portion of SEQ ID NO: 2. The
single-stranded interfering RNA has a length of about 19 to about
49 nucleotides as for the double-stranded interfering RNA cited
above. The single-stranded interfering RNA has a 5' phosphate or is
phosphorylated in situ or in vivo at the 5' position. The term "5'
phosphorylated" is used to describe, for example, polynucleotides
or oligonucleotides having a phosphate group attached via ester
linkage to the C5 hydroxyl of the sugar (e.g., ribose, deoxyribose,
or an analog of same) at the 5' end of the polynucleotide or
oligonucleotide.
[0054] Single-stranded interfering RNAs can be synthesized
chemically or by in vitro transcription or expressed endogenously
from vectors or expression cassettes as described herein in
reference to double-stranded interfering RNAs. 5' Phosphate groups
may be added via a kinase, or a 5' phosphate may be the result of
nuclease cleavage of an RNA. A hairpin interfering RNA is a single
molecule (e.g., a single oligonucleotide chain) that comprises both
the sense and antisense strands of an interfering RNA in a
stem-loop or hairpin structure (e.g., a shRNA). For example, shRNAs
can be expressed from DNA vectors in which the DNA oligonucleotides
encoding a sense interfering RNA strand are linked to the DNA
oligonucleotides encoding the reverse complementary antisense
interfering RNA strand by a short spacer. If needed for the chosen
expression vector, 3' terminal T's and nucleotides forming
restriction sites may be added. The resulting RNA transcript folds
back onto itself to form a stem-loop structure.
[0055] Nucleic acid sequences cited herein are written in a 5' to
3' direction unless indicated otherwise. The term "nucleic acid,"
as used herein, refers to either DNA or RNA or a modified form
thereof comprising the purine or pyrimidine bases present in DNA
(adenine "A," cytosine "C," guanine "G," thymine "T") or in RNA
(adenine "A," cytosine "C," guanine "G," uracil "U"). Interfering
RNAs provided herein may comprise "T" bases, particularly at 3'
ends, even though "T" bases do not naturally occur in RNA. "Nucleic
acid" includes the terms "oligonucleotide" and "polynucleotide" and
can refer to a single-stranded molecule or a double-stranded
molecule. A double-stranded molecule is formed by Watson-Crick base
pairing between A and T bases, C and G bases, and between A and U
bases. The strands of a double-stranded molecule may have partial,
substantial or full complementarity to each other and will form a
duplex hybrid, the strength of bonding of which is dependent upon
the nature and degree of complementarity of the sequence of
bases.
[0056] The phrase "DNA target sequence" as used herein refers to
the DNA sequence that is used to derive an interfering RNA of the
invention. The phrases "RNA target sequence," "interfering RNA
target sequence," and "RNA target" as used herein refer to the TACE
or TNFR1 mRNA or the portion of the TACE or TNFR1 mRNA sequence
that can be recognized by an interfering RNA of the invention,
whereby the interfering RNA can silence TACE or TNFR1 gene
expression as discussed herein. An "RNA target sequence," an "siRNA
target sequence," and an "RNA target" are typically mRNA sequences
that correspond to a portion of a DNA sequence. An mRNA sequence is
readily deduced from the sequence of the corresponding DNA
sequence. For example, SEQ ID NO: 1 provides the sense strand
sequence of DNA corresponding to the mRNA for TACE, while SEQ ID
NO: 2 provides the sense strand sequence of DNA corresponding to
the mRNA for TNFR1. The mRNA sequence is identical to the DNA sense
strand sequence with the "T" bases replaced with "U" bases.
Therefore, the mRNA sequence of TACE is known from SEQ ID NO: 1,
and the mRNA sequence of TNFR1 is known from SEQ ID NO: 2. A target
sequence in the mRNAs corresponding to SEQ ID NO: 1 or SEQ ID NO: 2
may be in the 5' or 3' untranslated regions of the mRNA as well as
in the coding region of the mRNA.
[0057] In certain embodiments, interfering RNA target sequences
(e.g., siRNA target sequences) within a target mRNA sequence are
selected using available design tools. Interfering RNAs
corresponding to a TACE or TNFR1 target sequence are then tested in
vitro by transfection of cells expressing the target mRNA followed
by assessment of knockdown as described herein. The interfering
RNAs can be further evaluated in vivo using animal models as
described herein.
[0058] Techniques for selecting target sequences for siRNAs are
provided, for example, by Tuschl, T. et al., "The siRNA User
Guide," revised May 6, 2004, available on the Rockefeller
University web site; by Technical Bulletin #506, "siRNA Design
Guidelines," Ambion Inc. at Ambion's web site; and by other
web-based design tools at, for example, the Invitrogen, Dharmacon,
Integrated DNA Technologies, Genscript, or Proligo web sites.
Initial search parameters can include G/C contents between 35% and
55% and siRNA lengths between 19 and 27 nucleotides. The target
sequence may be located in the coding region or in the 5' or 3'
untranslated regions of the mRNA. The target sequences can be used
to derive interfering RNA molecules, such as those described
herein.
[0059] Table 1 lists examples of TACE DNA target sequences of SEQ
ID NO: 1 from which interfering RNA molecules of the present
invention are designed in a manner as set forth above.
TABLE-US-00001 TABLE 1 TACE Target Sequences for siRNAs # of
Starting Nucleotide with reference to TACE Target Sequence SEQ ID
NO: 1 SEQ ID NO: GCTCTCAGACTACGATATT 297 3 CCAGCAGCATTCGGTAAGA 333
14 CAGCAGCATTCGGTAAGAA 334 15 AGCAGCATTCGGTAAGAAA 335 16
AGAGATCTACAGACTTCAA 355 17 GAAAGCGAGTACACTGTAA 493 18
CCATGAAGAACACGTGTAA 842 19 GAAGAACACGTGTAAATTA 846 20
ATCATCGCTTCTACAGATA 878 21 AGAGCAATTTAGCTTTGAT 1137 22
GGTTTGACGAGCACAAAGA 1330 23 TGATCCGGATGGTCTAGCA 1428 24
GCGATCACGAGAACAATAA 1508 25 GCAGTAAACAATCAATCTA 1541 26
CAATCTATAAGACCATTGA 1553 27 TTTCAAGAACGCAGCAATA 1591 28
TTCAAGAACGCAGCAATAA 1592 29 TCAAGAACGCAGCAATAAA 1593 30
TCATGTATCTGAACAACGA 1661 31 ACAGCGACTGCACGTTGAA 1691 32
GATTAATGCTACTTGCAAA 1794 33 CTGGAGTCCTGTGCATGTA 1945 34
TGGAGTCCTGTGCATGTAA 1946 35 GGAGTCCTGTGCATGTAAT 1947 36
CATGTAATGAAACTGACAA 1958 37 CTATGTCGATGCTGAACAA 2022 38
CAAATGTGAGAAACGAGTA 2100 39 GCATCGGTTCGCATTATCA 2347 40
ATCGGTTCGCATTATCAAA 2349 41 CCAAGTCATTTGAGGATCT 2549 42
CCGGTCACCAGAAGTGAAA 2578 43 AAAGGCTGCCTCCTTTAAA 2595 44
TTTAAACTGCAGCGTCAGA 2608 45 AGATGCTGGTCATGTGTTT 2764 46
ATGCTGGTCATGTGTTTGA 2766 47 TGCTGGTCATGTGTTTGAA 2767 48
CTGGTCATGTGTTTGAACT 2769 49 TGTAATGAACCGCTGAATA 3027 50
GTAATGAACCGCTGAATAT 3028 51 CTAAGACTAATGCTCTCTA 3261 52
AGACTAATGCTCTCTAGAA 3264 53 CCTAACCACCTACCTTACA 3284 54
TACATGGTAGCCAGTTGAA 3313 55 TGGTAGCCAGTTGAATTTA 3317 56
TTTATGGAATCTACCAACT 3332 57 GGAATCTACCAACTGTTTA 3337 58
CATCAAGTACTGAACGTTT 434 155 TCGTGGTGGTGGATGGTAA 470 156
GAAAGCGAGTACACTGTAA 493 157 GAGCCTGACTCTAGGGTTC 547 158
CCACATAAGAGATGATGAT 570 159 CATAAGAGATGATGATGTT 573 160
CGAATATAACATAGAGCCA 618 161 GTTAATGATACCAAAGACA 649 162
CTGAAGATATCAAGAATGT 689 163 ATGAAGAGTTGCTCCCAAA 755 164
ATGAAGAACACGTGTAAAT 844 165 AATTATTGGTGGTAGCAGA 860 166
ATCATCGCTTCTACAGATA 878 167 ATACATGGGCAGAGGGGAA 894 168
GGGCAGAGGGGAAGAGAGT 900 169 GGAAGAGAGTACAACTACA 909 170
GAAGAGAGTACAACTACAA 910 171 GAGAGTACAACTACAAATT 913 172
GCTAATTGACAGAGTTGAT 942 173 CGGAACACTTCATGGGATA 970 174
GGATAATGCAGGTTTTAAA 984 175 AGGCTATGGAATACAGATA 1002 176
GAATACAGATAGAGCAGAT 1010 177 GGTAAAACCTGGTGAAAAG 1053 178
GTGAAAAGCACTACAACAT 1064 179 GAGGAAGCATCTAAAGTTT 1162 180
TATGGGAACTCTTGGATTA 1215 181 TGACGAGCACAAAGAATTA 1334 182
GCACAAAGAATTATGGTAA 1340 183 GGTTACAACTCATGAATTG 1386 184
ACTCATGAATTGGGACATA 1393 185 GTGGCGATCACGAGAACAA 1505 186
CTATAAGACCATTGAAAGT 1557 187 GAACGCAGCAATAAAGTTT 1597 188
GCAATAAAGTTTGTGGGAA 1604 189 CAATAAAGTTTGTGGGAAC 1605 190
GAGGGTGGATGAAGGAGAA 1626 191 GGATGAAGGAGAAGAGTGT 1632 192
GCATCATGTATCTGAACAA 1658 193 CAGGAAATGCTGAAGATGA 1856 194
GAATGGCAAATGTGAGAAA 2094 195 GGATGTAATTGAACGATTT 2121 196
GTGGATAAGAAATTGGATA 2263 197 GGATAAACAGTATGAATCT 2277 198
CCTTTAAACTGCAGCGTCA 2606 199 CGTGTTGACAGCAAAGAAA 2629 200
GCAAAGAAACAGAGTGCTA 2639 201
[0060] Table 2 lists examples of TNFR1 DNA target sequences of SEQ
ID NO:2 from which siRNAs of the present invention are designed in
a manner as set forth above. TNFR1 encodes tumor necrosis factor
.alpha. receptor-1, as noted above.
TABLE-US-00002 TABLE 2 TNFR1 Target Sequences for siRNAs # of
Starting Nucleotide with reference to TNFR1 Target Sequence SEQ ID
NO: 2 SEQ ID NO: ACCAGGCCGTGATCTCTAT 124 59 AATTCGATTTGCTGTACCA 444
60 TCGATTTGCTGTACCAAGT 447 61 ACAAAGGAACCTACTTGTA 469 62
GAACCTACTTGTACAATGA 475 63 CTACTTGTACAATGACTGT 479 64
TGTGAGAGCGGCTCCTTCA 531 65 TCAGGTGGAGATCTCTTCT 611 66
CAGGTGGAGATCTCTTCTT 612 67 AGAACCAGTACCGGCATTA 667 68
GAACCAGTACCGGCATTAT 668 69 AACCAGTACCGGCATTATT 669 70
CCGGCATTATTGGAGTGAA 677 71 CGGCATTATTGGAGTGAAA 678 72
AGCCTGGAGTGCACGAAGT 843 73 CTCCTCTTCATTGGTTTAA 960 74
TTGGTTTAATGTATCGCTA 970 75 GTTTAATGTATCGCTACCA 973 76
TTTAATGTATCGCTACCAA 974 77 AGTCCAAGCTCTACTCCAT 1000 78
GAGCTTGAAGGAACTACTA 1053 79 CTTGAAGGAACTACTACTA 1056 80
TTGAAGGAACTACTACTAA 1057 81 ACAAGCCACAGAGCCTAGA 1318 82
TGTACGCCGTGGTGGAGAA 1357 83 CCGTTGCGCTGGAAGGAAT 1383 84
TCTAAGGACCGTCCTGCGA 1671 85 CTAATAGAAACTTGGCACT 2044 86
TAATAGAAACTTGGCACTC 2045 87 AATAGAAACTTGGCACTCC 2046 88
ATAGAAACTTGGCACTCCT 2047 89 TAGAAACTTGGCACTCCTG 2048 90
ATAGCAAGCTGAACTGTCC 2089 91 TAGCAAGCTGAACTGTCCT 2090 92
AGCAAGCTGAACTGTCCTA 2091 93 GCAAGCTGAACTGTCCTAA 2092 94
TGAACTGTCCTAAGGCAGG 2098 95 CAAAGGAACCTACTTGTAC 470 96
GAGCTTGAAGGAACTACTA 1053 97 CACAGAGCCTAGACACTGA 1324 98
TCCAAGCTCTACTCCATTG 1002 99 TGGAGCTGTTGGTGGGAAT 328 100
GACAGGGAGAAGAGAGATA 387 101 GGGAGAAGAGAGATAGTGT 391 102
GAGAAGAGAGATAGTGTGT 393 103 GAAGAGAGATAGTGTGTGT 395 104
GTGTGTGTCCCCAAGGAAA 406 105 GAAAATATATCCACCCTCA 421 106
AAATATATCCACCCTCAAA 423 107 CTGTACCAAGTGCCACAAA 455 108
ACCAAGTGCCACAAAGGAA 459 109 CCAAGTGCCACAAAGGAAC 460 110
CCACAAAGGAACCTACTTG 467 111 CAAAGGAACCTACTTGTAC 470 112
AAAGGAACCTACTTGTACA 471 113 GATACGGACTGCAGGGAGT 513 114
CGGACTGCAGGGAGTGTGA 517 115 TCCTTCACCGCTTCAGAAA 543 116
CAGAAAACCACCTCAGACA 556 117 TGCCTCAGCTGCTCCAAAT 576 118
CTCCAAATGCCGAAAGGAA 587 119 TCCAAATGCCGAAAGGAAA 588 120
CCAAATGCCGAAAGGAAAT 589 121 GCCGAAAGGAAATGGGTCA 595 122
AGGAAATGGGTCAGGTGGA 601 123 GGAAATGGGTCAGGTGGAG 602 124
GTGTGTGGCTGCAGGAAGA 651 125 GGAAGAACCAGTACCGGCA 664 126
CCATGCAGGTTTCTTTCTA 785 127 CATGCAGGTTTCTTTCTAA 786 128
TGCAGGTTTCTTTCTAAGA 788 129 AGGTTTCTTTCTAAGAGAA 791 130
GGTTTCTTTCTAAGAGAAA 792 131 AGAGAAAACGAGTGTGTCT 804 132
GAGTGTGTCTCCTGTAGTA 813 133 CTGTAGTAACTGTAAGAAA 824 134
AGAAAAGCCTGGAGTGCAC 838 135 TTGAGAATGTTAAGGGCAC 877 136
TGTTAAGGGCACTGAGGAC 884 137 GGTCATTTTCTTTGGTCTT 929 138
CCTCCTCTTCATTGGTTTA 959 139 TCCTCTTCATTGGTTTAAT 961 140
CTCTTCATTGGTTTAATGT 963 141 TCTTCATTGGTTTAATGTA 964 142
CTTCATTGGTTTAATGTAT 965 143 TCCAAGCTCTACTCCATTG 1002 144
CTCCATTGTTTGTGGGAAA 1013 145 GGGAAATCGACACCTGAAA 1026 146
TGAAGGAACTACTACTAAG 1058 147 ACCTCCAGCTCCACCTATA 1161 148
CCCACAAGCCACAGAGCCT 1315 149 ACGCCGTGGTGGAGAACGT 1360 150
GGAAGGAATTCGTGCGGCG 1393 151 TGAGCGACCACGAGATCGA 1420 152
GCGAGGCGCAATACAGCAT 1471 153 TGGGCTGCCTGGAGGACAT 1573 154
[0061] As cited in the examples above, one of skill in the art is
able to use the target sequence information provided in Table 1 to
design interfering RNAs having a length shorter or longer than the
sequences provided in Table 1 by referring to the sequence position
in SEQ ID NO: 1 and adding or deleting nucleotides complementary or
near complementary to SEQ ID NO: 1.
[0062] For example, SEQ ID NO: 3 represents a 19-nucleotide DNA
target sequence for TACE mRNA is present at nucleotides 297 to 315
of SEQ ID NO:1:
TABLE-US-00003 5'- GCTCTCAGACTACGATATT -3'. SEQ ID NO: 3
[0063] An example of an siRNA of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:3 and having 21-nucleotide
strands and a 2-nucleotide 3' overhang is:
TABLE-US-00004 5'- GCUCUCAGACUACGAUAUUNN -3' SEQ ID NO: 4 3'-
NNCGAGAGUCUGAUGCUAUAA -5'. SEQ ID NO: 5
[0064] Each "N" residue can be any nucleotide (A, C, G, U, T) or
modified nucleotide. The 3' end can have a number of "N" residues
between and including 1, 2, 3, 4, 5, and 6. The "N" residues on
either strand can be the same residue (e.g., UU, AA, CC, GG, or TT)
or they can be different (e.g., AC, AG, AU, CA, CG, CU, GA, GC, GU,
UA, UC, or UG). The 3' overhangs can be the same or they can be
different. In one embodiment, both strands have a 3'UU
overhang.
[0065] An example of an siRNA of the invention for targeting a
corresponding mRNA sequence of SEQ ID NO:3 and having 21-nucleotide
strands and a 3'UU overhang on each strand is:
TABLE-US-00005 5'- GCUCUCAGACUACGAUAUUUU -3' SEQ ID NO: 6 3'-
UUCGAGAGUCUGAUGCUAUAA -5'. SEQ ID NO: 7
[0066] The interfering RNA may also have a 5' overhang of
nucleotides or it may have blunt ends. An siRNA of the invention
for targeting a corresponding mRNA sequence of SEQ ID NO:3 and
having 19-nucleotide strands and blunt ends is:
TABLE-US-00006 5'- GCUCUCAGACUACGAUAUU -3' SEQ ID NO: 8 3'-
CGAGAGUCUGAUGCUAUAA -5'. SEQ ID NO: 9
[0067] The strands of a double-stranded interfering RNA (e.g., an
siRNA) may be connected to form a hairpin or stem-loop structure
(e.g., an shRNA). An shRNA of the invention targeting a
corresponding mRNA sequence of SEQ ID NO:3 and having a 19 bp
double-stranded stem region and a 3'UU overhang is:
##STR00001##
[0068] N is a nucleotide A, T, C, G, U, or a modified form known by
one of ordinary skill in the art. The number of nucleotides N in
the loop is a number between and including 3 to 23, or 5 to 15, or
7 to 13, or 4 to 9, or 9 to 11, or the number of nucleotides N is
9. Some of the nucleotides in the loop can be involved in base-pair
interactions with other nucleotides in the loop. Examples of
oligonucleotide sequences that can be used to form the loop include
5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. (2002) Science 296: 550)
and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). It
will be recognized by one of skill in the art that the resulting
single chain oligonucleotide forms a stem-loop or hairpin structure
comprising a double-stranded region capable of interacting with the
RNAi machinery.
[0069] The siRNA target sequence identified above can be extended
at the 3' end to facilitate the design of dicer-substrate 27-mer
duplexes. Extension of the 19-nucleotide DNA target sequence (SEQ
ID NO:3) identified in the TACE DNA sequence (SEQ ID NO:1) by 6
nucleotides yields a 25-nucleotide DNA target sequence present at
nucleotides 297 to 321 of SEQ ID NO:1:
TABLE-US-00007 5'- GCTCTCAGACTACGATATTCTCTCT -3'. SEQ ID NO: 11
[0070] An example of a dicer-substrate 27-mer duplex of the
invention for targeting a corresponding mRNA sequence of SEQ ID
NO:11 is:
TABLE-US-00008 5'- GCUCUCAGACUACGAUAUUCUCUCU -3' SEQ ID NO: 12 3'-
UUCGAGAGUCUGAUGCUAUAAGAGAGA -5'. SEQ ID NO: 13
[0071] The two nucleotides at the 3' end of the sense strand (i.e.,
the CU nucleotides of SEQ ID NO:12) may be deoxynucleotides for
enhanced processing. Design of dicer-substrate 27-mer duplexes from
19-21 nucleotide target sequences, such as provided herein, is
further discussed by the Integrated DNA Technologies (IDT) website
and by Kim, D.-H. et al., (February 2005) Nature Biotechnology
23:2; 222-226.
[0072] The target RNA cleavage reaction guided by siRNAs and other
forms of interfering RNA is highly sequence specific. For example,
in general, an siRNA molecule contains a sense nucleotide strand
identical in sequence to a portion of the target mRNA and an
antisense nucleotide strand exactly complementary to a portion of
the target for inhibition of mRNA expression. However, 100%
sequence complementarity between the antisense siRNA strand and the
target mRNA, or between the antisense siRNA strand and the sense
siRNA strand, is not required to practice the present invention, so
long as the interfering RNA can recognize the target mRNA and
silence expression of the TACE or TNFR1 gene. Thus, for example,
the invention allows for sequence variations between the antisense
strand and the target mRNA and between the antisense strand and the
sense strand, including nucleotide substitutions that do not affect
activity of the interfering RNA molecule, as well as variations
that might be expected due to genetic mutation, strain
polymorphism, or evolutionary divergence, wherein the variations do
not preclude recognition of the antisense strand to the target
mRNA.
[0073] In one embodiment of the invention, interfering RNA of the
invention has a sense strand and an antisense strand, and the sense
and antisense strands comprise a region of at least near-perfect
contiguous complementarity of at least 19 nucleotides. In another
embodiment of the invention, an interfering RNA of the invention
has a sense strand and an antisense strand, and the antisense
strand comprises a region of at least near-perfect contiguous
complementarity of at least 19 nucleotides to a target sequence of
TACE or TNFR1 mRNA, and the sense strand comprises a region of at
least near-perfect contiguous identity of at least 19 nucleotides
with a target sequence of TACE or TNFR1 mRNA, respectively. In a
further embodiment of the invention, the interfering RNA comprises
a region of at least 13, 14, 15, 16, 17, or 18 contiguous
nucleotides having percentages of sequence complementarity to or,
having percentages of sequence identity with, the penultimate 13,
14, 15, 16, 17, or 18 nucleotides, respectively, of the 3' end of
the corresponding target sequence within an mRNA. The length of
each strand of the interfering RNA comprises about 19 to about 49
nucleotides, and may comprise a length of about 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides.
[0074] In certain embodiments, the antisense strand of an
interfering RNA of the invention has at least near-perfect
contiguous complementarity of at least 19 nucleotides with the
target mRNA. "Near-perfect," as used herein, means the antisense
strand of the siRNA is "substantially complementary to," and the
sense strand of the siRNA is "substantially identical to" at least
a portion of the target mRNA. "Identity," as known by one of
ordinary skill in the art, is the degree of sequence relatedness
between nucleotide sequences as determined by matching the order
and identity of nucleotides between the sequences. In one
embodiment, the antisense strand of an siRNA having 80% and between
80% up to 100% complementarity, for example, 85%, 90% or 95%
complementarity, to the target mRNA sequence are considered
near-perfect complementarity and may be used in the present
invention. "Perfect" contiguous complementarity is standard
Watson-Crick base pairing of adjacent base pairs. "At least
near-perfect" contiguous complementarity includes "perfect"
complementarity as used herein. Computer methods for determining
identity or complementarity are designed to identify the greatest
degree of matching of nucleotide sequences, for example, BLASTN
(Altschul, S. F., et al. (1990) J. Mol. Biol. 215:403-410).
[0075] The term "percent identity" describes the percentage of
contiguous nucleotides in a first nucleic acid molecule that is the
same as in a set of contiguous nucleotides of the same length in a
second nucleic acid molecule. The term "percent complementarity"
describes the percentage of contiguous nucleotides in a first
nucleic acid molecule that can base pair in the Watson-Crick sense
with a set of contiguous nucleotides in a second nucleic acid
molecule.
[0076] The relationship between a target mRNA and one strand of an
siRNA (the sense strand) is that of identity. The sense strand of
an siRNA is also called a passenger strand, if present. The
relationship between a target mRNA and the other strand of an siRNA
(the antisense strand) is that of complementarity. The antisense
strand of an siRNA is also called a guide strand.
[0077] There may be a region or regions of the antisense siRNA
strand that is (are) not complementary to a portion of SEQ ID NO: 1
or a portion of SEQ ID NO: 2. Non-complementary regions may be at
the 3', 5' or both ends of a complementary region or between two
complementary regions. A region can be one or more bases.
[0078] The sense and antisense strands in an interfering RNA
molecule can also comprise nucleotides that do not form base pairs
with the other strand. For example, one or both strands can
comprise additional nucleotides or nucleotides that do not pair
with a nucleotide in that position on the other strand, such that a
bulge or a mismatch is formed when the strands are hybridized.
Thus, an interfering RNA molecule of the invention can comprise
sense and antisense strands having mismatches, G-U wobbles, or
bulges. Mismatches, G-U wobbles, and bulges can also occur between
the antisense strand and its target (see, for example, Saxena et
al., 2003, J. Biol. Chem. 278:44312-9).
[0079] One or both of the strands of double-stranded interfering
RNA may have a 3' overhang of from 1 to 6 nucleotides, which may be
ribonucleotides or deoxyribonucleotides or a mixture thereof. The
nucleotides of the overhang are not base-paired. In one embodiment
of the invention, the interfering RNA comprises a 3' overhang of TT
or UU. In another embodiment of the invention, the interfering RNA
comprises at least one blunt end. The termini usually have a 5'
phosphate group or a 3' hydroxyl group. In other embodiments, the
antisense strand has a 5' phosphate group, and the sense strand has
a 5' hydroxyl group. In still other embodiments, the termini are
further modified by covalent addition of other molecules or
functional groups.
[0080] The sense and antisense strands of the double-stranded siRNA
may be in a duplex formation of two single strands as described
above or may be a single-stranded molecule where the regions of
complementarity are base-paired and are covalently linked by a
linker molecule to form a hairpin loop when the regions are
hybridized to each other. It is believed that the hairpin is
cleaved intracellularly by a protein termed dicer to form an
interfering RNA of two individual base-paired RNA molecules. A
linker molecule can also be designed to comprise a restriction site
that can be cleaved in vivo or in vitro by a particular
nuclease.
[0081] In one embodiment, the invention provides an interfering RNA
molecule that comprises a region of at least 13 contiguous
nucleotides having at least 90% sequence complementarity to, or at
least 90% sequence identity with, the penultimate 13 nucleotides of
the 3' end of an mRNA corresponding to a DNA target, which allows a
one nucleotide substitution within the region. Two nucleotide
substitutions (i.e., 11/13=85% identity/complementarity) are not
included in such a phrase. In another embodiment, the invention
provides an interfering RNA molecule that comprises a region of at
least 14 contiguous nucleotides having at least 85% sequence
complementarity to, or at least 85% sequence identity with, the
penultimate 14 nucleotides of the 3' end of an mRNA corresponding
to a DNA target. Two nucleotide substitutions (i.e., 12/14=86%
identity/complementarity) are included in such a phrase. In a
further embodiment, the invention provides an interfering RNA
molecule that comprises a region of at least 15, 16, 17, or 18
contiguous nucleotides having at least 80% sequence complementarity
to, or at least 80% sequence identity with, the penultimate 14
nucleotides of the 3' end of an mRNA corresponding to a DNA target.
Three nucleotide substitutions are included in such a phrase.
[0082] The penultimate base in a nucleic acid sequence that is
written in a 5' to 3' direction is the next to the last base, i.e.,
the base next to the 3' base. The penultimate 13 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 13 bases
of a sequence next to the 3' base and not including the 3' base.
Similarly, the penultimate 14, 15, 16, 17, or 18 bases of a nucleic
acid sequence written in a 5' to 3' direction are the last 14, 15,
16, 17, or 18 bases of a sequence, respectively, next to the 3'
base and not including the 3' base.
[0083] Interfering RNAs may be generated exogenously by chemical
synthesis, by in vitro transcription, or by cleavage of longer
double-stranded RNA with dicer or another appropriate nuclease with
similar activity. Chemically synthesized interfering RNAs, produced
from protected ribonucleoside phosphoramidites using a conventional
DNA/RNA synthesizer, may be obtained from commercial suppliers such
as Ambion Inc. (Austin, Tex.), Invitrogen (Carlsbad, Calif.), or
Dharmacon (Lafayette, Colo.). Interfering RNAs can be purified by
extraction with a solvent or resin, precipitation, electrophoresis,
chromatography, or a combination thereof, for example.
Alternatively, interfering RNA may be used with little if any
purification to avoid losses due to sample processing.
[0084] When interfering RNAs are produced by chemical synthesis,
phosphorylation at the 5' position of the nucleotide at the 5' end
of one or both strands (when present) can enhance siRNA efficacy
and specificity of the bound RISC complex, but is not required
since phosphorylation can occur intracellularly.
[0085] Interfering RNAs can also be expressed endogenously from
plasmid or viral expression vectors or from minimal expression
cassettes, for example, PCR generated fragments comprising one or
more promoters and an appropriate template or templates for the
interfering RNA. Examples of commercially available plasmid-based
expression vectors for shRNA include members of the pSilencer
series (Ambion, Austin, Tex.) and pCpG-siRNA (InvivoGen, San Diego,
Calif.). Viral vectors for expression of interfering RNA may be
derived from a variety of viruses including adenovirus,
adeno-associated virus, lentivirus (e.g., HIV, FIV, and EIAV), and
herpes virus. Examples of commercially available viral vectors for
shRNA expression include pSilencer adeno (Ambion, Austin, Tex.) and
pLenti6/BLOCK-iT.TM.-DEST (Invitrogen, Carlsbad, Calif.). Selection
of viral vectors, methods for expressing the interfering RNA from
the vector and methods of delivering the viral vector are within
the ordinary skill of one in the art. Examples of kits for
production of PCR-generated shRNA expression cassettes include
Silencer Express (Ambion, Austin, Tex.) and siXpress (Mirus,
Madison, Wis.).
[0086] In certain embodiments, a first interfering RNA may be
administered via in vivo expression from a first expression vector
capable of expressing the first interfering RNA and a second
interfering RNA may be administered via in vivo expression from a
second expression vector capable of expressing the second
interfering RNA, or both interfering RNAs may be administered via
in vivo expression from a single expression vector capable of
expressing both interfering RNAs. Additional interfering RNAs can
be administered in a like manner (i.e. via separate expression
vectors or via a single expression vector capable of expressing
multiple interfering RNAs).
[0087] Interfering RNAs may be expressed from a variety of
eukaryotic promoters known to those of ordinary skill in the art,
including pol III promoters, such as the U6 or H1 promoters, or pol
II promoters, such as the cytomegalovirus promoter. Those of skill
in the art will recognize that these promoters can also be adapted
to allow inducible expression of the interfering RNA.
[0088] In certain embodiments of the present invention, an
antisense strand of an interfering RNA hybridizes with an mRNA in
vivo as part of the RISC complex.
[0089] "Hybridization" refers to a process in which single-stranded
nucleic acids with complementary or near-complementary base
sequences interact to form hydrogen-bonded complexes called
hybrids. Hybridization reactions are sensitive and selective. In
vitro, the specificity of hybridization (i.e., stringency) is
controlled by the concentrations of salt or formamide in
prehybridization and hybridization solutions, for example, and by
the hybridization temperature; such procedures are well known in
the art. In particular, stringency is increased by reducing the
concentration of salt, increasing the concentration of formamide,
or raising the hybridization temperature.
[0090] For example, high stringency conditions could occur at about
50% formamide at 37.degree. C. to 42.degree. C. Reduced stringency
conditions could occur at about 35% to 25% formamide at 30.degree.
C. to 35.degree. C. Examples of stringency conditions for
hybridization are provided in Sambrook, J., 1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. Further examples of stringent
hybridization conditions include 400 mM NaCl, 40 mM PIPES pH 6.4, 1
mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by
washing, or hybridization at 70.degree. C. in 1.times.SSC or
50.degree. C. in 1.times.SSC, 50% formamide followed by washing at
70.degree. C. in 0.3.times.SSC, or hybridization at 70.degree. C.
in 4.times.SSC or 50.degree. C. in 4.times.SSC, 50% formamide
followed by washing at 67.degree. C. in 1.times.SSC. The
temperature for hybridization is about 5-10.degree. C. less than
the melting temperature (T.sub.m) of the hybrid where T.sub.m is
determined for hybrids between 19 and 49 base pairs in length using
the following calculation: T.sub.m .degree.
C.=81.5+16.6(log.sub.10[Na+])+0.41 (% G+C)-(600/N) where N is the
number of bases in the hybrid, and [Na+] is the concentration of
sodium ions in the hybridization buffer.
[0091] The above-described in vitro hybridization assay provides a
method of predicting whether binding between a candidate siRNA and
a target will have specificity. However, in the context of the RISC
complex, specific cleavage of a target can also occur with an
antisense strand that does not demonstrate high stringency for
hybridization in vitro.
[0092] Interfering RNAs may differ from naturally-occurring RNA by
the addition, deletion, substitution or modification of one or more
nucleotides. Non-nucleotide material may be bound to the
interfering RNA, either at the 5' end, the 3' end, or internally.
Such modifications are commonly designed to increase the nuclease
resistance of the interfering RNAs, to improve cellular uptake, to
enhance cellular targeting, to assist in tracing the interfering
RNA, to further improve stability, or to reduce the potential for
activation of the interferon pathway. For example, interfering RNAs
may comprise a purine nucleotide at the ends of overhangs.
Conjugation of cholesterol to the 3' end of the sense strand of an
siRNA molecule by means of a pyrrolidine linker, for example, also
provides stability to an siRNA.
[0093] Further modifications include a 3' terminal biotin molecule,
a peptide known to have cell-penetrating properties, a
nanoparticle, a peptidomimetic, a fluorescent dye, or a dendrimer,
for example.
[0094] Nucleotides may be modified on their base portion, on their
sugar portion, or on the phosphate portion of the molecule and
function in embodiments of the present invention. Modifications
include substitutions with alkyl, alkoxy, amino, deaza, halo,
hydroxyl, thiol groups, or a combination thereof, for example.
Nucleotides may be substituted with analogs with greater stability
such as replacing a ribonucleotide with a deoxyribonucleotide, or
having sugar modifications such as 2' OH groups replaced by 2'
amino groups, 2' O-methyl groups, 2' methoxyethyl groups, or a
2'-O, 4'-C methylene bridge, for example. Examples of a purine or
pyrimidine analog of nucleotides include a xanthine, a
hypoxanthine, an azapurine, a methylthioadenine, 7-deaza-adenosine
and O-- and N-modified nucleotides. The phosphate group of the
nucleotide may be modified by substituting one or more of the
oxygens of the phosphate group with nitrogen or with sulfur
(phosphorothioates). Modifications are useful, for example, to
enhance function, to improve stability or permeability, or to
direct localization or targeting.
[0095] In certain embodiments, an interfering molecule of the
invention comprises at least one of the modifications as described
above.
[0096] In certain embodiments, the invention provides
pharmaceutical compositions (also referred to herein as
"compositions") comprising an interfering RNA molecule of the
invention. Pharmaceutical compositions are formulations that
comprise interfering RNAs, or salts thereof, of the invention up to
99% by weight mixed with a physiologically acceptable carrier
medium, including those described infra, and such as water, buffer,
saline, glycine, hyaluronic acid, mannitol, and the like.
[0097] Interfering RNAs of the present invention are administered
as solutions, suspensions, or emulsions. The following are examples
of pharmaceutical composition formulations that may be used in the
methods of the invention.
TABLE-US-00009 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Hydroxypropylmethylcellulose 0.5 Sodium chloride
0.8 Benzalkonium Chloride 0.01 EDTA 0.01 NaOH/HCl qs pH 7.4
Purified water (RNase-free) qs 100 mL
TABLE-US-00010 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0 Benzalkonium
Chloride 0.01 Polysorbate 80 0.5 Purified water (RNase-free) q.s.
to 100%
TABLE-US-00011 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Monobasic sodium phosphate 0.05 Dibasic sodium
phosphate 0.15 (anhydrous) Sodium chloride 0.75 Disodium EDTA 0.05
Cremophor EL 0.1 Benzalkonium chloride 0.01 HCl and/or NaOH pH
7.3-7.4 Purified water (RNase-free) q.s. to 100%
TABLE-US-00012 Amount in weight % Interfering RNA up to 99; 0.1-99;
0.1-50; 0.5-10.0 Phosphate Buffered Saline 1.0
Hydroxypropyl-.beta.-cyclodextrin 4.0 Purified water (RNase-free)
q.s. to 100%
[0098] As used herein the term "effective amount" refers to the
amount of interfering RNA or a pharmaceutical composition
comprising an interfering RNA determined to produce a therapeutic
response in a mammal. Such therapeutically effective amounts are
readily ascertained by one of ordinary skill in the art and using
methods as described herein.
[0099] Generally, an effective amount of the interfering RNAs of
the invention results in an extracellular concentration at the
surface of the target cell of from 100 pM to 1 .mu.M, or from 1 nM
to 100 nM, or from 5 nM to about 50 nM, or to about 25 nM. The dose
required to achieve this local concentration will vary depending on
a number of factors including the delivery method, the site of
delivery, the number of cell layers between the delivery site and
the target cell or tissue, whether delivery is local or systemic,
etc. The concentration at the delivery site may be considerably
higher than it is at the surface of the target cell or tissue.
Topical compositions can be delivered to the surface of the target
organ, such as the eye, one to four times per day, or on an
extended delivery schedule such as daily, weekly, bi-weekly,
monthly, or longer, according to the routine discretion of a
skilled clinician. The pH of the formulation is about pH 4.0 to
about pH 9.0, or about pH 4.5 to about pH 7.4.
[0100] An effective amount of a formulation may depend on factors
such as the age, race, and sex of the subject, the rate of target
gene transcript/protein turnover, the interfering RNA potency, and
the interfering RNA stability, for example. In one embodiment, the
interfering RNA is delivered topically to a target organ and
reaches the TACE or TNFR1 mRNA-containing tissue such as the
trabecular meshwork, retina or optic nerve head at a therapeutic
dose thereby ameliorating TNF.alpha.-associated disease
process.
[0101] Therapeutic treatment of patients with interfering RNAs
directed against TACE or TNFR1 mRNA is expected to be beneficial
over small molecule treatments by increasing the duration of
action, thereby allowing less frequent dosing and greater patient
compliance, and by increasing target specificity, thereby reducing
side effects.
[0102] An "acceptable carrier" as used herein refers to those
carriers that cause at most, little to no ocular irritation,
provide suitable preservation if needed, and deliver one or more
interfering RNAs of the present invention in a homogenous dosage.
An acceptable carrier for administration of interfering RNA of
embodiments of the present invention include the cationic
lipid-based transfection reagents TransIT.RTM.-TKO (Mirus
Corporation, Madison, Wis.), LIPOFECTIN.RTM., Lipofectamine,
OLIGOFECTAMINE.TM. (Invitrogen, Carlsbad, Calif.), or
DHARMAFECT.TM. (Dharmacon, Lafayette, Colo.); polycations such as
polyethyleneimine; cationic peptides such as Tat, polyarginine, or
Penetratin (Antp peptide); nanoparticles; or liposomes. Liposomes
are formed from standard vesicle-forming lipids and a sterol, such
as cholesterol, and may include a targeting molecule such as a
monoclonal antibody having binding affinity for cell surface
antigens, for example. Further, the liposomes may be PEGylated
liposomes.
[0103] The interfering RNAs may be delivered in solution, in
suspension, or in bioerodible or non-bioerodible delivery devices.
The interfering RNAs can be delivered alone or as components of
defined, covalent conjugates. The interfering RNAs can also be
complexed with cationic lipids, cationic peptides, or cationic
polymers; complexed with proteins, fusion proteins, or protein
domains with nucleic acid binding properties (e.g., protamine); or
encapsulated in nanoparticles or liposomes. Tissue- or
cell-specific delivery can be accomplished by the inclusion of an
appropriate targeting moiety such as an antibody or antibody
fragment.
[0104] Interfering RNA may be delivered via aerosol, buccal,
dermal, intradermal, inhaling, intramuscular, intranasal,
intraocular, intrapulmonary, intravenous, intraperitoneal, nasal,
ocular, oral, otic, parenteral, patch, subcutaneous, sublingual,
topical, or transdermal administration, for example.
[0105] In certain embodiments, treatment of ocular disorders with
interfering RNA molecules is accomplished by administration of an
interfering RNA molecule directly to the eye. Local administration
to the eye is advantageous for a number or reasons, including: the
dose can be smaller than for systemic delivery, and there is less
chance of the molecules silencing the gene target in tissues other
than in the eye.
[0106] A number of studies have shown successful and effective in
vivo delivery of interfering RNA molecules to the eye. For example,
Kim et al. demonstrated that subconjunctival injection and systemic
delivery of siRNAs targeting VEGF pathway genes inhibited
angiogenesis in a mouse eye (Kim et al., 2004, Am. J. Pathol.
165:2177-2185). In addition, studies have shown that siRNA
delivered to the vitreous cavity can diffuse throughout the eye,
and is detectable up to five days after injection (Campochiaro,
2006, Gene Therapy 13:559-562).
[0107] Interfering RNA may be delivered directly to the eye by
ocular tissue injection such as periocular, conjunctival, subtenon,
intracameral, intravitreal, intraocular, subretinal,
subconjunctival, retrobulbar, or intracanalicular injections; by
direct application to the eye using a catheter or other placement
device such as a retinal pellet, intraocular insert, suppository or
an implant comprising a porous, non-porous, or gelatinous material;
by topical ocular drops or ointments; or by a slow release device
in the cul-de-sac or implanted adjacent to the sclera
(transscleral) or in the sclera (intrascleral) or within the eye.
Intracameral injection may be through the cornea into the anterior
chamber to allow the agent to reach the trabecular meshwork.
Intracanalicular injection may be into the venous collector
channels draining Schlemm's canal or into Schlemm's canal.
[0108] For ophthalmic delivery, an interfering RNA may be combined
with ophthalmologically acceptable preservatives, co-solvents,
surfactants, viscosity enhancers, penetration enhancers, buffers,
sodium chloride, or water to form an aqueous, sterile ophthalmic
suspension or solution. Solution formulations may be prepared by
dissolving the interfering RNA in a physiologically acceptable
isotonic aqueous buffer. Further, the solution may include an
acceptable surfactant to assist in dissolving the interfering RNA.
Viscosity building agents, such as hydroxymethyl cellulose,
hydroxyethyl cellulose, methylcellulose, polyvinylpyrrolidone, or
the like may be added to the compositions of the present invention
to improve the retention of the compound.
[0109] In order to prepare a sterile ophthalmic ointment
formulation, the interfering RNA is combined with a preservative in
an appropriate vehicle, such as mineral oil, liquid lanolin, or
white petrolatum. Sterile ophthalmic gel formulations may be
prepared by suspending the interfering RNA in a hydrophilic base
prepared from the combination of, for example, CARBOPOL.RTM.-940
(BF Goodrich, Charlotte, N.C.), or the like, according to methods
known in the art. VISCOAT.RTM. (Alcon Laboratories, Inc., Fort
Worth, Tex.) may be used for intraocular injection, for example.
Other compositions of the present invention may contain penetration
enhancing agents such as cremephor and TWEEN.RTM. 80
(polyoxyethylene sorbitan monolaureate, Sigma Aldrich, St. Louis,
Mo.), in the event the interfering RNA is less penetrating in the
eye.
[0110] In certain embodiments, the invention also provides a kit
that includes reagents for attenuating the expression of an mRNA as
cited herein in a cell. The kit contains an siRNA or an shRNA
expression vector. For siRNAs and non-viral shRNA expression
vectors the kit also contains a transfection reagent or other
suitable delivery vehicle. For viral shRNA expression vectors, the
kit may contain the viral vector and/or the necessary components
for viral vector production (e.g., a packaging cell line as well as
a vector comprising the viral vector template and additional helper
vectors for packaging). The kit may also contain positive and
negative control siRNAs or shRNA expression vectors (e.g., a
non-targeting control siRNA or an siRNA that targets an unrelated
mRNA). The kit also may contain reagents for assessing knockdown of
the intended target gene (e.g., primers and probes for quantitative
PCR to detect the target mRNA and/or antibodies against the
corresponding protein for western blots). Alternatively, the kit
may comprise an siRNA sequence or an shRNA sequence and the
instructions and materials necessary to generate the siRNA by in
vitro transcription or to construct an shRNA expression vector.
[0111] A pharmaceutical combination in kit form is further provided
that includes, in packaged combination, a carrier means adapted to
receive a container means in close confinement therewith and a
first container means including an interfering RNA composition and
an acceptable carrier. Such kits can further include, if desired,
one or more of various conventional pharmaceutical kit components,
such as, for example, containers with one or more pharmaceutically
acceptable carriers, additional containers, etc., as will be
readily apparent to those skilled in the art. Printed instructions,
either as inserts or as labels, indicating quantities of the
components to be administered, guidelines for administration,
and/or guidelines for mixing the components, can also be included
in the kit.
[0112] The references cited herein, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated by reference.
[0113] Those of skill in the art, in light of the present
disclosure, will appreciate that obvious modifications of the
embodiments disclosed herein can be made without departing from the
spirit and scope of the invention. All of the embodiments disclosed
herein can be made and executed without undue experimentation in
light of the present disclosure. The full scope of the invention is
set out in the disclosure and equivalent embodiments thereof. The
specification should not be construed to unduly narrow the full
scope of protection to which the present invention is entitled.
[0114] While a particular embodiment of the invention has been
shown and described, numerous variations and alternate embodiments
will occur to those skilled in the art. Accordingly, the invention
may be embodied in other specific forms without departing from its
spirit or essential characteristics. The described embodiments are
to be considered in all respects only as illustrative and not
restrictive. The scope of the invention is, therefore, indicated by
the appended claims rather than by the foregoing description. All
changes to the claims that come within the meaning and range of
equivalency of the claims are to be embraced within their scope.
Further, all published documents, patents, and applications
mentioned herein are hereby incorporated by reference, as if
presented in their entirety.
EXAMPLES
[0115] The following examples, including the experiments conducted
and results achieved, are provided for illustrative purposes only
and are not to be construed as limiting the invention.
Example 1
Interfering RNA for Specifically Silencing TNFR1 in GTM-3 Cells
[0116] The present study examines the ability of TNFR1 interfering
RNA to knock down the levels of endogenous TNFR1 protein expression
in cultured GTM-3 cells.
[0117] Transfection of GTM-3 cells (Pang, I. H. et al., 1994. Curr.
Eye Res. 13:51-63) was accomplished using standard in vitro
concentrations (0.1-10 nM) of TNFR1 siRNAs, siCONTROL RISC-free
siRNA, or siCONTROL Non-targeting siRNA #2 (NTC2) and
DHARMAFECT.RTM. #1 transfection reagent (Dharmacon, Lafayette,
Colo.). All siRNAs were dissolved in 1.times. siRNA buffer, an
aqueous solution of 20 mM KCl, 6 mM HEPES (pH 7.5), 0.2 mM
MgCl.sub.2. Control samples included a buffer control in which the
volume of siRNA was replaced with an equal volume of 1.times. siRNA
buffer (-siRNA). Western blots using an anti-TNFR1 antibody (Santa
Cruz Biotechnology, Santa Cruz, Calif.) were performed to assess
TNFR1 protein expression. The TNFR1 siRNAs are double-stranded
interfering RNAs having specificity for the following targets:
siTNFR1 #1 targets the sequence CAAAGGAACCUACUUGUAC (SEQ ID NO:
202); siTNFR1 #2 targets the sequence GAGCUUGAAGGAACUACUA (SEQ ID
NO: 203); siTNFR1 #3 targets the sequence CACAGAGCCUAGACACUGA (SEQ
ID NO: 204); siTNFR1 #4 targets the sequence UCCAAGCUCUACUCCAUUG
(SEQ ID NO: 205). As shown by the data in FIG. 1, siTNFR1 #1,
siTNFR1 #2, and siTNFR1 #3 siRNAs reduced TNFR1 protein expression
significantly at the 10 nM and 1 nM concentrations relative to the
control siRNAs, but exhibited reduced efficacy at 0.1 nM. The
siTNFR1 #2 and siTNFR1 #3 siRNAs were particularly effective. The
siTNFR1 #4 siRNA also showed a concentration dependent reduction in
TNFR1 protein expression as expected.
[0118] It should be understood that the foregoing disclosure
emphasizes certain specific embodiments of the invention and that
all modifications or alternatives equivalent thereto are within the
spirit and scope of the invention as set forth in the appended
claims.
Sequence CWU 1
1
20513572DNAHomo sapiens 1acctgcactt ctgggggcgt cgagcctggc
ggtagaatct tcccagtagg cggcgcggga 60gggaaaagag gattgagggg ctaggccggg
cggatcccgt cctcccccga tgtgagcagt 120tttccgaaac cccgtcaggc
gaaggctgcc cagagaggtg gagtcggtag cggggccggg 180aacatgaggc
agtctctcct attcctgacc agcgtggttc ctttcgtgct ggcgccgcga
240cctccggatg acccgggctt cggcccccac cagagactcg agaagcttga
ttctttgctc 300tcagactacg atattctctc tttatctaat atccagcagc
attcggtaag aaaaagagat 360ctacagactt caacacatgt agaaacacta
ctaacttttt cagctttgaa aaggcatttt 420aaattatacc tgacatcaag
tactgaacgt ttttcacaaa atttcaaggt cgtggtggtg 480gatggtaaaa
acgaaagcga gtacactgta aaatggcagg acttcttcac tggacacgtg
540gttggtgagc ctgactctag ggttctagcc cacataagag atgatgatgt
tataatcaga 600atcaacacag atggggccga atataacata gagccacttt
ggagatttgt taatgatacc 660aaagacaaaa gaatgttagt ttataaatct
gaagatatca agaatgtttc acgtttgcag 720tctccaaaag tgtgtggtta
tttaaaagtg gataatgaag agttgctccc aaaagggtta 780gtagacagag
aaccacctga agagcttgtt catcgagtga aaagaagagc tgacccagat
840cccatgaaga acacgtgtaa attattggtg gtagcagatc atcgcttcta
cagatacatg 900ggcagagggg aagagagtac aactacaaat tacttaatag
agctaattga cagagttgat 960gacatctatc ggaacacttc atgggataat
gcaggtttta aaggctatgg aatacagata 1020gagcagattc gcattctcaa
gtctccacaa gaggtaaaac ctggtgaaaa gcactacaac 1080atggcaaaaa
gttacccaaa tgaagaaaag gatgcttggg atgtgaagat gttgctagag
1140caatttagct ttgatatagc tgaggaagca tctaaagttt gcttggcaca
ccttttcaca 1200taccaagatt ttgatatggg aactcttgga ttagcttatg
ttggctctcc cagagcaaac 1260agccatggag gtgtttgtcc aaaggcttat
tatagcccag ttgggaagaa aaatatctat 1320ttgaatagtg gtttgacgag
cacaaagaat tatggtaaaa ccatccttac aaaggaagct 1380gacctggtta
caactcatga attgggacat aattttggag cagaacatga tccggatggt
1440ctagcagaat gtgccccgaa tgaggaccag ggagggaaat atgtcatgta
tcccatagct 1500gtgagtggcg atcacgagaa caataagatg ttttcaaact
gcagtaaaca atcaatctat 1560aagaccattg aaagtaaggc ccaggagtgt
tttcaagaac gcagcaataa agtttgtggg 1620aactcgaggg tggatgaagg
agaagagtgt gatcctggca tcatgtatct gaacaacgac 1680acctgctgca
acagcgactg cacgttgaag gaaggtgtcc agtgcagtga caggaacagt
1740ccttgctgta aaaactgtca gtttgagact gcccagaaga agtgccagga
ggcgattaat 1800gctacttgca aaggcgtgtc ctactgcaca ggtaatagca
gtgagtgccc gcctccagga 1860aatgctgaag atgacactgt ttgcttggat
cttggcaagt gtaaggatgg gaaatgcatc 1920cctttctgcg agagggaaca
gcagctggag tcctgtgcat gtaatgaaac tgacaactcc 1980tgcaaggtgt
gctgcaggga cctttctggc cgctgtgtgc cctatgtcga tgctgaacaa
2040aagaacttat ttttgaggaa aggaaagccc tgtacagtag gattttgtga
catgaatggc 2100aaatgtgaga aacgagtaca ggatgtaatt gaacgatttt
gggatttcat tgaccagctg 2160agcatcaata cttttggaaa gtttttagca
gacaacatcg ttgggtctgt cctggttttc 2220tccttgatat tttggattcc
tttcagcatt cttgtccatt gtgtggataa gaaattggat 2280aaacagtatg
aatctctgtc tctgtttcac cccagtaacg tcgaaatgct gagcagcatg
2340gattctgcat cggttcgcat tatcaaaccc tttcctgcgc cccagactcc
aggccgcctg 2400cagcctgccc ctgtgatccc ttcggcgcca gcagctccaa
aactggacca ccagagaatg 2460gacaccatcc aggaagaccc cagcacagac
tcacatatgg acgaggatgg gtttgagaag 2520gaccccttcc caaatagcag
cacagctgcc aagtcatttg aggatctcac ggaccatccg 2580gtcaccagaa
gtgaaaaggc tgcctccttt aaactgcagc gtcagaatcg tgttgacagc
2640aaagaaacag agtgctaatt tagttctcag ctcttctgac ttaagtgtgc
aaaatatttt 2700tatagatttg acctacaaat caatcacagc ttgtattttg
tgaagactgg gaagtgactt 2760agcagatgct ggtcatgtgt ttgaacttcc
tgcaggtaaa cagttcttgt gtggtttggc 2820ccttctcctt ttgaaaaggt
aaggtgaagg tgaatctagc ttattttgag gctttcaggt 2880tttagttttt
aaaatatctt ttgacctgtg gtgcaaaagc agaaaataca gctggattgg
2940gttatgaata tttacgtttt tgtaaattaa tcttttatat tgataacagc
actgactagg 3000gaaatgatca gttttttttt atacactgta atgaaccgct
gaatatgagg catttggcat 3060ttatttgtga tgacaactgg aatagttttt
tttttttttt tttttttttg ccttcaacta 3120aaaacaaagg agataaatct
agtatacatt gtctctaaat tgtgggtcta tttctagtta 3180ttacccagag
tttttatgta gcagggaaaa tatatatcta aatttagaaa tcatttgggt
3240taatatggct cttcataatt ctaagactaa tgctctctag aaacctaacc
acctacctta 3300cagtgagggc tatacatggt agccagttga atttatggaa
tctaccaact gtttagggcc 3360ctgatttgct gggcagtttt tctgtatttt
ataagtatct tcatgtatcc ctgttactga 3420tagggataca tgctcttaga
aaattcacta ttggctggga gtggtggctc atgcctgtaa 3480tcccagcact
tggagaggct gaggttgcgc cactacactc cagcctgggt gacagagtga
3540gactctgcct caaaaaaaaa aaaaaaaaaa aa 357222236DNAHomo sapiens
2gctgttgcaa cactgcctca ctcttcccct cccaccttct ctcccctcct ctctgcttta
60attttctcag aattctctgg actgaggctc cagttctggc ctttggggtt caagatcact
120gggaccaggc cgtgatctct atgcccgagt ctcaaccctc aactgtcacc
ccaaggcact 180tgggacgtcc tggacagacc gagtcccggg aagccccagc
actgccgctg ccacactgcc 240ctgagcccaa atgggggagt gagaggccat
agctgtctgg catgggcctc tccaccgtgc 300ctgacctgct gctgccactg
gtgctcctgg agctgttggt gggaatatac ccctcagggg 360ttattggact
ggtccctcac ctaggggaca gggagaagag agatagtgtg tgtccccaag
420gaaaatatat ccaccctcaa aataattcga tttgctgtac caagtgccac
aaaggaacct 480acttgtacaa tgactgtcca ggcccggggc aggatacgga
ctgcagggag tgtgagagcg 540gctccttcac cgcttcagaa aaccacctca
gacactgcct cagctgctcc aaatgccgaa 600aggaaatggg tcaggtggag
atctcttctt gcacagtgga ccgggacacc gtgtgtggct 660gcaggaagaa
ccagtaccgg cattattgga gtgaaaacct tttccagtgc ttcaattgca
720gcctctgcct caatgggacc gtgcacctct cctgccagga gaaacagaac
accgtgtgca 780cctgccatgc aggtttcttt ctaagagaaa acgagtgtgt
ctcctgtagt aactgtaaga 840aaagcctgga gtgcacgaag ttgtgcctac
cccagattga gaatgttaag ggcactgagg 900actcaggcac cacagtgctg
ttgcccctgg tcattttctt tggtctttgc cttttatccc 960tcctcttcat
tggtttaatg tatcgctacc aacggtggaa gtccaagctc tactccattg
1020tttgtgggaa atcgacacct gaaaaagagg gggagcttga aggaactact
actaagcccc 1080tggccccaaa cccaagcttc agtcccactc caggcttcac
ccccaccctg ggcttcagtc 1140ccgtgcccag ttccaccttc acctccagct
ccacctatac ccccggtgac tgtcccaact 1200ttgcggctcc ccgcagagag
gtggcaccac cctatcaggg ggctgacccc atccttgcga 1260cagccctcgc
ctccgacccc atccccaacc cccttcagaa gtgggaggac agcgcccaca
1320agccacagag cctagacact gatgaccccg cgacgctgta cgccgtggtg
gagaacgtgc 1380ccccgttgcg ctggaaggaa ttcgtgcggc gcctagggct
gagcgaccac gagatcgatc 1440ggctggagct gcagaacggg cgctgcctgc
gcgaggcgca atacagcatg ctggcgacct 1500ggaggcggcg cacgccgcgg
cgcgaggcca cgctggagct gctgggacgc gtgctccgcg 1560acatggacct
gctgggctgc ctggaggaca tcgaggaggc gctttgcggc cccgccgccc
1620tcccgcccgc gcccagtctt ctcagatgag gctgcgcccc tgcgggcagc
tctaaggacc 1680gtcctgcgag atcgccttcc aaccccactt ttttctggaa
aggaggggtc ctgcaggggc 1740aagcaggagc tagcagccgc ctacttggtg
ctaacccctc gatgtacata gcttttctca 1800gctgcctgcg cgccgccgac
agtcagcgct gtgcgcgcgg agagaggtgc gccgtgggct 1860caagagcctg
agtgggtggt ttgcgaggat gagggacgct atgcctcatg cccgttttgg
1920gtgtcctcac cagcaaggct gctcgggggc ccctggttcg tccctgagcc
tttttcacag 1980tgcataagca gttttttttg tttttgtttt gttttgtttt
gtttttaaat caatcatgtt 2040acactaatag aaacttggca ctcctgtgcc
ctctgcctgg acaagcacat agcaagctga 2100actgtcctaa ggcaggggcg
agcacggaac aatggggcct tcagctggag ctgtggactt 2160ttgtacatac
actaaaattc tgaagttaaa gctctgctct tggaaaaaaa aaaaaaaaaa
2220aaaaaaaaaa aaaaaa 2236319DNAArtificialTarget Sequence
3gctctcagac tacgatatt 19421DNAArtificialSense Strand with 3'NN
4gcucucagac uacgauauun n 21521DNAArtificialAntisense strand with
3'NN 5aauaucguag ucugagagcn n 21621RNAArtificialSense Strand
6gcucucagac uacgauauuu u 21721RNAArtificialAntisense Strand
7aauaucguag ucugagagcu u 21819RNAArtificialSense Strand 8gcucucagac
uacgauauu 19919RNAArtificialAntisense Strand 9aauaucguag ucugagagc
191048DNAArtificialHairpin duplex with loop 10gcucucagac uacgauauun
nnnnnnnaau aucguagucu gagagcuu 481125DNAArtificialSense Strand
11gcucucagac uacgauauuc ucucu 251225RNAArtificialSense Strand
12gcucucagac uacgauauuc ucucu 251327RNAArtificialAntisense Strand
13agagagaaua ucguagucug agagcuu 271419DNAArtificialTarget Sequence
14ccagcagcat tcggtaaga 191519DNAArtificialTarget Sequence
15cagcagcatt cggtaagaa 191619DNAArtificialTarget Sequence
16agcagcattc ggtaagaaa 191719DNAArtificialTarget Sequence
17agagatctac agacttcaa 191819DNAArtificialTarget Sequence
18gaaagcgagt acactgtaa 191919DNAArtificialTarget Sequence
19ccatgaagaa cacgtgtaa 192019DNAArtificialTarget Sequence
20gaagaacacg tgtaaatta 192119DNAArtificialTarget Sequence
21atcatcgctt ctacagata 192219DNAArtificialTarget Sequence
22agagcaattt agctttgat 192319DNAArtificialTarget Sequence
23ggtttgacga gcacaaaga 192419DNAArtificialTarget Sequence
24tgatccggat ggtctagca 192519DNAArtificialTarget Sequence
25gcgatcacga gaacaataa 192619DNAArtificialTarget Sequence
26gcagtaaaca atcaatcta 192719DNAArtificialTarget Sequence
27caatctataa gaccattga 192819DNAArtificialTarget Sequence
28tttcaagaac gcagcaata 192919DNAArtificialTarget Sequence
29ttcaagaacg cagcaataa 193019DNAArtificialTarget Sequence
30tcaagaacgc agcaataaa 193119DNAArtificialTarget Sequence
31tcatgtatct gaacaacga 193219DNAArtificialTarget Sequence
32acagcgactg cacgttgaa 193319DNAArtificialTarget Sequence
33gattaatgct acttgcaaa 193419DNAArtificialTarget Sequence
34ctggagtcct gtgcatgta 193519DNAArtificialTarget Sequence
35tggagtcctg tgcatgtaa 193619DNAArtificialTarget Sequence
36ggagtcctgt gcatgtaat 193719DNAArtificialTarget Sequence
37catgtaatga aactgacaa 193819DNAArtificialTarget Sequence
38ctatgtcgat gctgaacaa 193919DNAArtificialTarget Sequence
39caaatgtgag aaacgagta 194019DNAArtificialTarget Sequence
40gcatcggttc gcattatca 194119DNAArtificialTarget Sequence
41atcggttcgc attatcaaa 194219DNAArtificialTarget Sequence
42ccaagtcatt tgaggatct 194319DNAArtificialTarget Sequence
43ccggtcacca gaagtgaaa 194419DNAArtificialTarget Sequence
44aaaggctgcc tcctttaaa 194519DNAArtificialTarget Sequence
45tttaaactgc agcgtcaga 194619DNAArtificialTarget Sequence
46agatgctggt catgtgttt 194719DNAArtificialTarget Sequence
47atgctggtca tgtgtttga 194819DNAArtificialTarget Sequence
48tgctggtcat gtgtttgaa 194919DNAArtificialTarget Sequence
49ctggtcatgt gtttgaact 195019DNAArtificialTarget Sequence
50tgtaatgaac cgctgaata 195119DNAArtificialTarget Sequence
51gtaatgaacc gctgaatat 195219DNAArtificialTarget Sequence
52ctaagactaa tgctctcta 195319DNAArtificialTarget Sequence
53agactaatgc tctctagaa 195419DNAArtificialTarget Sequence
54cctaaccacc taccttaca 195519DNAArtificialTarget Sequence
55tacatggtag ccagttgaa 195619DNAArtificialTarget Sequence
56tggtagccag ttgaattta 195719DNAArtificialTarget Sequence
57tttatggaat ctaccaact 195819DNAArtificialTarget Sequence
58ggaatctacc aactgttta 195919DNAArtificialTarget Sequence
59accaggccgt gatctctat 196019DNAArtificialTarget Sequence
60aattcgattt gctgtacca 196119DNAArtificialTarget Sequence
61tcgatttgct gtaccaagt 196219DNAArtificialTarget Sequence
62acaaaggaac ctacttgta 196319DNAArtificialTarget Sequence
63gaacctactt gtacaatga 196419DNAArtificialTarget Sequence
64ctacttgtac aatgactgt 196519DNAArtificialTarget Sequence
65tgtgagagcg gctccttca 196619DNAArtificialTarget Sequence
66tcaggtggag atctcttct 196719DNAArtificialTarget Sequence
67caggtggaga tctcttctt 196819DNAArtificialTarget Sequence
68agaaccagta ccggcatta 196919DNAArtificialTarget Sequence
69gaaccagtac cggcattat 197019DNAArtificialTarget Sequence
70aaccagtacc ggcattatt 197119DNAArtificialTarget Sequence
71ccggcattat tggagtgaa 197219DNAArtificialTarget Sequence
72cggcattatt ggagtgaaa 197319DNAArtificialTarget Sequence
73agcctggagt gcacgaagt 197419DNAArtificialTarget Sequence
74ctcctcttca ttggtttaa 197519DNAArtificialTarget Sequence
75ttggtttaat gtatcgcta 197619DNAArtificialTarget Sequence
76gtttaatgta tcgctacca 197719DNAArtificialTarget Sequence
77tttaatgtat cgctaccaa 197819DNAArtificialTarget Sequence
78agtccaagct ctactccat 197919DNAArtificialTarget Sequence
79gagcttgaag gaactacta 198019DNAArtificialTarget Sequence
80cttgaaggaa ctactacta 198119DNAArtificialTarget Sequence
81ttgaaggaac tactactaa 198219DNAArtificialTarget Sequence
82acaagccaca gagcctaga 198319DNAArtificialTarget Sequence
83tgtacgccgt ggtggagaa 198419DNAArtificialTarget Sequence
84ccgttgcgct ggaaggaat 198519DNAArtificialTarget Sequence
85tctaaggacc gtcctgcga 198619DNAArtificialTarget Sequence
86ctaatagaaa cttggcact 198719DNAArtificialTarget Sequence
87taatagaaac ttggcactc 198819DNAArtificialTarget Sequence
88aatagaaact tggcactcc 198919DNAArtificialTarget Sequence
89atagaaactt ggcactcct 199019DNAArtificialTarget Sequence
90tagaaacttg gcactcctg 199119DNAArtificialTarget Sequence
91atagcaagct gaactgtcc 199219DNAArtificialTarget Sequence
92tagcaagctg aactgtcct 199319DNAArtificialTarget Sequence
93agcaagctga actgtccta 199419DNAArtificialTarget Sequence
94gcaagctgaa ctgtcctaa 199519DNAArtificialTarget Sequence
95tgaactgtcc taaggcagg 199619DNAArtificialTarget Sequence
96caaaggaacc tacttgtac 199719DNAArtificialTarget Sequence
97gagcttgaag gaactacta 199819DNAArtificialTarget Sequence
98cacagagcct agacactga 199919DNAArtificialTarget Sequence
99tccaagctct actccattg 1910019DNAArtificialTarget Sequence
100tggagctgtt ggtgggaat 1910119DNAArtificialTarget Sequence
101gacagggaga agagagata 1910219DNAArtificialTarget Sequence
102gggagaagag agatagtgt 1910319DNAArtificialTarget Sequence
103gagaagagag atagtgtgt 1910419DNAArtificialTarget Sequence
104gaagagagat agtgtgtgt
1910519DNAArtificialTarget Sequence 105gtgtgtgtcc ccaaggaaa
1910619DNAArtificialTarget Sequence 106gaaaatatat ccaccctca
1910719DNAArtificialTarget Sequence 107aaatatatcc accctcaaa
1910819DNAArtificialTarget Sequence 108ctgtaccaag tgccacaaa
1910919DNAArtificialTarget Sequence 109accaagtgcc acaaaggaa
1911019DNAArtificialTarget Sequence 110ccaagtgccacaaaggaac
1911119DNAArtificialTarget Sequence 111ccacaaaggaacctacttg
1911219DNAArtificialTarget Sequence 112caaaggaacc tacttgtac
1911319DNAArtificialTarget Sequence 113aaaggaacct acttgtaca
1911419DNAArtificialTarget Sequence 114gatacggact gcagggagt
1911519DNAArtificialTarget Sequence 115cggactgcag ggagtgtga
1911619DNAArtificialTarget Sequence 116tccttcaccg cttcagaaa
1911719DNAArtificialTarget Sequence 117cagaaaacca cctcagaca
1911819DNAArtificialTarget Sequence 118tgcctcagct gctccaaat
1911919DNAArtificialTarget Sequence 119ctccaaatgc cgaaaggaa
1912019DNAArtificialTarget Sequence 120tccaaatgccgaaaggaaa
1912119DNAArtificialTarget Sequence 121ccaaatgccg aaaggaaat
1912219DNAArtificialTarget Sequence 122gccgaaagga aatgggtca
1912319DNAArtificialTarget Sequence 123aggaaatggg tcaggtgga
1912419DNAArtificialTarget Sequence 124ggaaatgggt caggtggag
1912519DNAArtificialTarget Sequence 125gtgtgtggct gcaggaaga
1912619DNAArtificialTarget Sequence 126ggaagaacca gtaccggca
1912719DNAArtificialTarget Sequence 127ccatgcaggt ttctttcta
1912819DNAArtificialTarget Sequence 128catgcaggtt tctttctaa
1912919DNAArtificialTarget Sequence 129tgcaggtttc tttctaaga
1913019DNAArtificialTarget Sequence 130aggtttcttt ctaagagaa
1913119DNAArtificialTarget Sequence 131ggtttctttc taagagaaa
1913219DNAArtificialTarget Sequence 132agagaaaacg agtgtgtct
1913319DNAArtificialTarget Sequence 133gagtgtgtct cctgtagta
1913419DNAArtificialTarget Sequence 134ctgtagtaac tgtaagaaa
1913519DNAArtificialTarget Sequence 135agaaaagcct ggagtgcac
1913619DNAArtificialTarget Sequence 136ttgagaatgt taagggcac
1913719DNAArtificialTarget Sequence 137tgttaagggc actgaggac
1913819DNAArtificialTarget Sequence 138ggtcattttc tttggtctt
1913919DNAArtificialTarget Sequence 139cctcctcttc attggttta
1914019DNAArtificialTarget Sequence 140tcctcttcat tggtttaat
1914119DNAArtificialTarget Sequence 141ctcttcattg gtttaatgt
1914219DNAArtificialTarget Sequence 142tcttcattgg tttaatgta
1914319DNAArtificialTarget Sequence 143cttcattggt ttaatgtat
1914419DNAArtificialTarget Sequence 144tccaagctct actccattg
1914519DNAArtificialTarget Sequence 145ctccattgtt tgtgggaaa
1914619DNAArtificialTarget Sequence 146gggaaatcga cacctgaaa
1914719DNAArtificialTarget Sequence 147tgaaggaact actactaag
1914819DNAArtificialTarget Sequence 148acctccagct ccacctata
1914919DNAArtificialTarget Sequence 149cccacaagcc acagagcct
1915019DNAArtificialTarget Sequence 150acgccgtggt ggagaacgt
1915119DNAArtificialTarget Sequence 151ggaaggaatt cgtgcggcg
1915219DNAArtificialTarget Sequence 152tgagcgacca cgagatcga
1915319DNAArtificialTarget Sequence 153gcgaggcgca atacagcat
1915419DNAArtificialTarget Sequence 154tgggctgcct ggaggacat
1915519DNAArtificialTarget Sequence 155catcaagtac tgaacgttt
1915619DNAArtificialTarget Sequence 156tcgtggtggt ggatggtaa
1915719DNAArtificialTarget Sequence 157gaaagcgagt acactgtaa
1915819DNAArtificialTarget Sequence 158gagcctgact ctagggttc
1915919DNAArtificialTarget Sequence 159ccacataaga gatgatgat
1916019DNAArtificialTarget Sequence 160cataagagat gatgatgtt
1916119DNAArtificialTarget Sequence 161cgaatataac atagagcca
1916219DNAArtificialTarget Sequence 162gttaatgata ccaaagaca
1916319DNAArtificialTarget Sequence 163ctgaagatat caagaatgt
1916419DNAArtificialTarget Sequence 164atgaagagtt gctcccaaa
1916519DNAArtificialTarget Sequence 165atgaagaaca cgtgtaaat
1916619DNAArtificialTarget Sequence 166aattattggt ggtagcaga
1916719DNAArtificialTarget Sequence 167atcatcgctt ctacagata
1916819DNAArtificialTarget Sequence 168atacatgggc agaggggaa
1916919DNAArtificialTarget Sequence 169gggcagaggg gaagagagt
1917019DNAArtificialTarget Sequence 170ggaagagagt acaactaca
1917119DNAArtificialTarget Sequence 171gaagagagta caactacaa
1917219DNAArtificialTarget Sequence 172gagagtacaa ctacaaatt
1917319DNAArtificialTarget Sequence 173gctaattgac agagttgat
1917419DNAArtificialTarget Sequence 174cggaacactt catgggata
1917519DNAArtificialTarget Sequence 175ggataatgca ggttttaaa
1917619DNAArtificialTarget Sequence 176aggctatgga atacagata
1917719DNAArtificialTarget Sequence 177gaatacagat agagcagat
1917819DNAArtificialTarget Sequence 178ggtaaaacct ggtgaaaag
1917919DNAArtificialTarget Sequence 179gtgaaaagca ctacaacat
1918019DNAArtificialTarget Sequence 180gaggaagcat ctaaagttt
1918119DNAArtificialTarget Sequence 181tatgggaact cttggatta
1918219DNAArtificialTarget Sequence 182tgacgagcac aaagaatta
1918319DNAArtificialTarget Sequence 183gcacaaagaa ttatggtaa
1918419DNAArtificialTarget Sequence 184ggttacaact catgaattg
1918519DNAArtificialTarget Sequence 185actcatgaat tgggacata
1918619DNAArtificialTarget Sequence 186gtggcgatca cgagaacaa
1918719DNAArtificialTarget Sequence 187ctataagacc attgaaagt
1918819DNAArtificialTarget Sequence 188gaacgcagca ataaagttt
1918919DNAArtificialTarget Sequence 189gcaataaagt ttgtgggaa
1919019DNAArtificialTarget Sequence 190caataaagtt tgtgggaac
1919119DNAArtificialTarget Sequence 191gagggtggat gaaggagaa
1919219DNAArtificialTarget Sequence 192ggatgaagga gaagagtgt
1919319DNAArtificialTarget Sequence 193gcatcatgta tctgaacaa
1919419DNAArtificialTarget Sequence 194caggaaatgc tgaagatga
1919519DNAArtificialTarget Sequence 195gaatggcaaa tgtgagaaa
1919619DNAArtificialTarget Sequence 196ggatgtaatt gaacgattt
1919719DNAArtificialTarget Sequence 197gtggataaga aattggata
1919819DNAArtificialTarget Sequence 198ggataaacag tatgaatct
1919919DNAArtificialTarget Sequence 199cctttaaact gcagcgtca
1920019DNAArtificialTarget Sequence 200cgtgttgaca gcaaagaaa
1920119DNAArtificialTarget Sequence 201gcaaagaaac agagtgcta
1920219RNAArtificialTarget Sequence 202caaaggaacc uacuuguac
1920319RNAArtificialTarget Sequence 203gagcuugaag gaacuacua
1920419RNAArtificialTarget Sequence 204cacagagccu agacacuga
1920519RNAArtificialTarget Sequence 205uccaagcucu acuccauug 19
* * * * *