U.S. patent application number 12/029050 was filed with the patent office on 2009-02-05 for leukocyte adhesion inhibitor-1 (lai-1).
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Brent L. Kreider, Haodong Li.
Application Number | 20090036370 12/029050 |
Document ID | / |
Family ID | 27556109 |
Filed Date | 2009-02-05 |
United States Patent
Application |
20090036370 |
Kind Code |
A1 |
Li; Haodong ; et
al. |
February 5, 2009 |
Leukocyte Adhesion Inhibitor-1 (LAI-1)
Abstract
There are disclosed therapeutic compositions and methods using
isolated nucleic acid molecules encoding a human chemokine beta-11
(Ck beta-11) polypeptide and a human leukocyte adhesion inhibitor-1
(LAI-1) polypeptide (previously termed chemokine .alpha.1
(CK.alpha.1 or cka-1), as well as Ck beta-11 and/or LAI-1
polypeptides themselves, as are vectors, host cells and recombinant
methods for producing the same.
Inventors: |
Li; Haodong; (Gaithersburg,
MD) ; Kreider; Brent L.; (Bedford, MA) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
27556109 |
Appl. No.: |
12/029050 |
Filed: |
February 11, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11247235 |
Oct 12, 2005 |
7332302 |
|
|
12029050 |
|
|
|
|
10247287 |
Sep 20, 2002 |
|
|
|
11247235 |
|
|
|
|
09635899 |
Aug 11, 2000 |
6485719 |
|
|
10247287 |
|
|
|
|
08943336 |
Oct 3, 1997 |
6139832 |
|
|
09635899 |
|
|
|
|
08724871 |
Oct 4, 1996 |
|
|
|
08943336 |
|
|
|
|
08464401 |
Jun 5, 1995 |
|
|
|
08724871 |
|
|
|
|
PCT/US95/01780 |
Feb 8, 1995 |
|
|
|
08464401 |
|
|
|
|
08460987 |
Jun 5, 1995 |
|
|
|
08724871 |
|
|
|
|
PCT/US95/01780 |
Feb 8, 1995 |
|
|
|
08460987 |
|
|
|
|
PCT/US96/09572 |
Jun 5, 1996 |
|
|
|
08724871 |
|
|
|
|
60027769 |
Oct 4, 1996 |
|
|
|
Current U.S.
Class: |
514/1.1 ;
435/320.1; 435/325; 435/69.1; 530/324; 530/387.9; 536/23.1 |
Current CPC
Class: |
Y10S 930/14 20130101;
Y02A 50/30 20180101; C07K 14/523 20130101; C07K 14/521 20130101;
C07K 14/522 20130101; C07K 14/5421 20130101; A61P 9/10 20180101;
A61K 38/00 20130101; Y02A 50/473 20180101 |
Class at
Publication: |
514/12 ; 530/324;
530/387.9; 536/23.1; 435/320.1; 435/325; 435/69.1 |
International
Class: |
A61K 38/19 20060101
A61K038/19; C07K 14/52 20060101 C07K014/52; C07K 16/00 20060101
C07K016/00; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C12N 5/10 20060101 C12N005/10; C12P 21/00 20060101
C12P021/00; A61P 9/10 20060101 A61P009/10 |
Claims
1. An isolated leukocyte adhesion inhibitor-1 (LAI-1) polypeptide
having an amino acid sequence selected from the group consisting
of: (a) Val (23)-Pro (109) of SEQ ID NO:4; (b) Val (26)-Pro (109)
of SEQ ID NO:4; (c) Thr (29)-Pro (109) of SEQ ID NO:4; and (d) Ser
(30)-Pro (109) of SEQ ID NO:4.
2. The isolated polypeptide of claim 1, which is produced
recombinantly using a baculovirus expression system.
3. A method of inhibiting angiogenesis, comprising administering to
an animal an effective amount of an LAI-1 polypeptide of claim
1.
4. A method of inhibiting adhesion of peripheral blood mononuclear
cells (PBMCs) to endothelial cells comprising administering to an
animal an effective amount of the polypeptide of claim 1.
5. The method of claim 4, wherein said inhibition alleviates or
prevents joint inflammation.
6. An isolated Chemokine .beta.-11 polypeptide having an amino acid
sequence of Gly (22)-Ser (98) of SEQ ID NO:2.
7. A method for attracting T-lymphocytes comprising administering
to an animal an effective amount of the polypeptide of claim 6.
8. The isolated polypeptide of claim 1, wherein at position 30 of
said amino acid sequence, Glu is substituted for Ser.
9. An isolated antibody or fragment thereof that specifically binds
to a protein selected from the group consisting of: (a) a protein
whose amino acid sequence consists of amino acid residues 1 to 109
of SEQ ID NO:4; (b) a protein whose amino acid sequence consists of
amino acid residues 23 to 109 of SEQ ID NO:4; (c) a protein whose
amino acid sequence consists of a portion of SEQ ID NO:4, wherein
said portion is at least 30 contiguous amino acid residues in
length; and (d) a protein whose amino acid sequence consists of a
portion of SEQ ID NO:4, wherein said portion is at least 50
contiguous amino acid residues in length.
10. An isolated polynucleotide comprising a member selected from
the group consisting of: (a) a polynucleotide encoding the
polypeptide as set forth in SEQ ID NO:2; (b) a polynucleotide
encoding the polypeptide as set forth in SEQ ID NO:4; (c) a
polynucleotide which encodes a mature polypeptide encoded by the
DNA contained in ATCC Deposit No. 75948; and (d) a polynucleotide
which encodes a mature polypeptide encoded by the DNA contained in
ATCC Deposit No. 75947.
11. A vector containing the isolated polynucleotide of claim
10.
12. The vector of claim 11, wherein the isolated polynucleotide is
DNA.
13. A host cell genetically engineered with the vector of claim
12.
14. A host cell comprising the expression vector of claim 13.
15. A process for producing a polypeptide comprising: (a) culturing
the host cell of claim 14 under conditions suitable for the
expression of the polypeptide; and (b) recovering said polypeptide
from the cell culture.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 11/247,235, filed Oct. 12, 2005, which is a continuation of
U.S. application Ser. No. 10/247,287, filed Sep. 20, 2002, which is
a divisional of U.S. application Ser. No. 09/635,899, filed Aug.
11, 2000 (now U.S. Pat. No. 6,485,719, issued Nov. 26, 2002), which
is a continuation of U.S. application Ser. No. 08/943,336, filed
Oct. 3, 1997 (now U.S. Pat. No. 6,139,832, issued Oct. 31, 2000),
which claims benefit under 35 U.S.C. .sctn. 119(e) of U.S. Prov.
App. No. 60/027,769, filed on Oct. 4, 1996; U.S. application Ser.
No. 08/943,336 is also a continuation-in-part of U.S. application
Ser. No. 08/724,871, filed Oct. 4, 1996, which is a
continuation-in-part of International App. No. PCT/US96/09572,
filed Jun. 5, 1996, U.S. application Ser. No. 08/464,401, filed
Jun. 5, 1995, and U.S. application Ser. No. 08/460,987, filed Jun.
5, 1995; U.S. application Ser. Nos. 08/464,401 and 08/460,987 are
both continuations-in-part of International App. No.
PCT/US95/01780, filed Feb. 8, 1995. All of the above-listed
applications are incorporated by reference herein in their
entirety.
STATEMENT UNDER 37 C.F.R. .sctn. 1.77(b)(5)
[0002] This application refers to a "Sequence Listing" listed
below, which is provided as a text document. The document is
entitled "PF154P4D1C2_SeqListing.txt" (7,627 bytes, created Jan.
10, 2008), and is hereby incorporated by reference in its entirety
herein.
FIELD OF THE INVENTION
[0003] The present invention relates to novel chemokine
polypeptides and encoding nucleic acids. More specifically,
therapeutic compositions and methods are provided using isolated
nucleic acid molecules encoding a human chemokine beta-11 (Ck
beta-11) polypeptide; and a human leukocyte adhesion inhibitor
(LAI-1) polypeptide (previously termed chemokine .alpha.1
(CK.alpha.1 or cka-1)), as well as Ck beta-11 and/or LAI-1
polypeptides themselves, as are vectors, host cells and recombinant
methods for producing the same.
BACKGROUND OF THE INVENTION
[0004] Chemokines, also referred to as intercrine cytokines, are a
subfamily of structurally and functionally related cytokines. These
molecules are 8-10 kd in size. In general, chemokines exhibit 20%
to 75% homology at the amino acid level and are characterized by
four conserved cysteine residues that form two disulfide bonds.
Based on the arrangement of the first two cysteine residues,
chemokines have been classified into two subfamilies, alpha and
beta. In the alpha subfamily, the first two cysteines are separated
by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in an
adjacent position and are, therefore, referred to as the "C-C"
subfamily. Thus far, at least eight different members of this
family have been identified in humans.
[0005] The intercrine cytokines exhibit a wide variety of
functions. A hallmark feature is their ability to elicit
chemotactic migration of distinct cell types, including monocytes,
neutrophils, T lymphocytes, basophils and fibroblasts. Many
chemokines have proinflammatory activity and are involved in
multiple steps during an inflammatory reaction. These activities
include stimulation of histamine release, lysosomal enzyme and
leukotriene release, increased adherence of target immune cells to
endothelial cells, enhanced binding of complement proteins, induced
expression of granulocyte adhesion molecules and complement
receptors, and respiratory burst. In addition to their involvement
in inflammation, certain chemokines have been shown to exhibit
other activities. For example, macrophage inflammatory protein 1
(MIP-1) is able to suppress hematopoietic stem cell proliferation,
platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell
growth, Interleukin-3 (IL-8) promotes proliferation of
keratinocytes, and GRO is an autocrine growth factor for melanoma
cells.
[0006] In light of the diverse biological activities, it is not
surprising that chemokines have been implicated in a number of
physiological and disease conditions, including lymphocyte
trafficking, wound healing, hematopoietic regulation and
immunological disorders such as allergy, asthma and arthritis.
[0007] Members of the "C-C" branch exert their effects on the
following cells: eosinophils which destroy parasites to lessen
parasitic infection and cause chronic inflammation in the airways
of the respiratory system; macrophages which suppress tumor
formation in vertebrates; and basophils which release histamine
which plays a role in allergic inflammation. However, members of
one branch can exert an effect on cells which are normally
responsive to the other branch of chemokines and, therefore, no
precise role can be attached to the members of the branches.
[0008] While members of the C-C branch act predominantly on
mononuclear cells and members of the C-X-C branch act predominantly
on neutrophils a distinct chemoattractant property cannot be
assigned to a chemokine based on this guideline. Some chemokines
from one family show characteristics of the other.
SUMMARY OF THE INVENTION
[0009] In accordance with one aspect of the present invention,
there are provided novel full length or mature polypeptides which
are LAI-1 and/or Ck beta-11, as well as biologically active,
diagnostically useful or therapeutically useful fragments, analogs
and derivatives thereof. LAI-1 and/or Ck beta-11 polypeptides or
encoding nucleic acids of the present invention are preferably of
animal origin, and more preferably of human origin.
[0010] In accordance with another aspect of the present invention
there are provided nucleic acid probes comprising nucleic acid
molecules of sufficient length to specifically hybridize to
Ck.beta.-11 and Ck.alpha.-1 sequences.
[0011] In accordance with another aspect of the present invention,
there are provided polynucleotides (DNA or RNA) which encode such
polypeptides and isolated nucleic acid molecules encoding such
polypeptides, including mRNAs, DNAs, cDNAs, genomic DNA as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof.
[0012] Ck beta-11 Polynucleotides. The present invention also
provides isolated nucleic acid molecules comprising a
polynucleotide encoding the Ck beta-11 polypeptide having the amino
acid sequence shown in FIG. 1 (SEQ ID NO:2) or the amino acid
sequence encoded by the cDNA clone deposited in a bacterial host as
ATCC Deposit Number 75948 on Nov. 11, 1994. The nucleotide sequence
determined by sequencing the deposited Ck beta-11 clone, which is
shown in FIG. 1 (SEQ ID NO:1), contains an open reading frame
encoding a polypeptide of 98 amino acid residues, with a leader
sequence of about 17 amino acid residues, and a predicted molecular
weight for the mature protein of about 10 kDa in non-glycosylated
form, and about 10-14 kDa in glycosylated form, depending on the
extent of glycosylation. The amino acid sequence of the mature Ck
beta-11 protein is shown in FIG. 1, as amino acid residues 18-98 of
SEQ ID NO:2.
[0013] Thus, one aspect of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (1)(a) a
nucleotide sequence encoding an Ck beta-11 polypeptide having the
complete amino acid sequence in FIG. 1 (SEQ ID NO:2); (1)(b) a
nucleotide sequence encoding the mature Ck beta-11 polypeptide
having the amino acid sequence at positions 18-98 in FIG. 1 (SEQ ID
NO:2); (1)(c) a nucleotide sequence encoding the Ck beta-11
polypeptide having the complete amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 75948; (1)(d) a nucleotide
sequence encoding the mature Ck beta-11 polypeptide having the
amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 75948; and (1)(e) a nucleotide sequence complementary
to any of the nucleotide sequences in (1)-(a), (b), (c) or (d)
above.
[0014] LAI-1 Polynucleotides. In one aspect, the present invention
provides isolated nucleic acid molecules comprising a
polynucleotide encoding the LAI-1 polypeptide having the amino acid
sequence shown in FIG. 2 (SEQ ID NO:4) or the amino acid sequence
encoded by the cDNA clone deposited in a bacterial host as ATCC
Deposit Number 75947 on Nov. 11, 1994. The nucleotide sequence
determined by sequencing the deposited LAI-1 clone, which is shown
in FIG. 2 (SEQ ID NO: 3), contains an open reading frame encoding a
polypeptide of 109 amino acid residues, with a leader sequence of
about 22 amino acid residues, and a predicted molecular weight of
about 110 kDa in non-glycosylated form, and about 11-14 kDa in
glycosylated form, depending on the extent of glycosylation. The
amino acid sequence of the mature LAI-1 protein is shown in FIG. 2,
as amino acid residues 23-109 of SEQ ID NO:4.
[0015] Thus, one aspect of the invention provides an isolated
nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence selected from the group consisting of: (2)(a) a
nucleotide sequence encoding the LAI-1 polypeptide having the
complete amino acid sequence in FIG. 2 (SEQ ID NO:4); (2)(b) a
nucleotide sequence encoding the mature LAI-1 polypeptide having
the amino acid sequence at positions 23-109 in FIG. 2 (SEQ ID
NO:4); (2)(c) a nucleotide sequence encoding the LAI-1 polypeptide
having the complete amino acid sequence encoded by the cDNA clone
contained in ATCC Deposit No. 75947; (2)(d) a nucleotide sequence
encoding the mature LAI-1 polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
75947; and (2)(e) a nucleotide sequence complementary to any of the
nucleotide sequences in (2)-(a), (b), (c) or (d) above.
[0016] Ck beta-11 and LAI-1 Polynucleotide Variants. The present
invention further relates to variants of the hereinabove described
polynucleotides which encode for fragments, analogs and derivatives
of the polypeptide having the deduced amino acid sequence of FIGS.
1 and 2 (SEQ ID NOS:2 and 4) or the polypeptides encoded by the
cDNA of the deposited clone(s). The variants of the polynucleotides
can be a naturally occurring allelic variant of the polynucleotides
or a non-naturally occurring variant of the polynucleotides.
[0017] Homologous Ck beta-11 and LAI-1 Polynucleotides. Further
embodiments of the invention include isolated nucleic acid
molecules that comprise a polynucleotide having a nucleotide
sequence at least 90% homologous or identical, and more preferably
at least 95%, 96%, 97%, 98% or 99% identical, to any of the
nucleotide sequences in (1)-, (2)- or (3)-(a), (b), (c), (d) or
(e), above, or a polynucleotide which hybridizes under stringent
hybridization conditions to a polynucleotide in (1)- or (2)-(a),
(b), (c), (d) or (e), above. These polynucleotides which hybridize
do not hybridize under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence consisting of only A
residues or of only T residues.
[0018] Nucleic Acid Probes. In accordance with yet another aspect
of the present invention, there are also provided nucleic acid
probes comprising nucleic acid molecules of sufficient length to
specifically hybridize to the Ck beta-11 and/or LAI-1 nucleic acid
sequences.
[0019] Recombinant Vectors, Host Cells and Expression. The present
invention also relates to recombinant vectors, which include the
isolated nucleic acid molecules of the present invention, and to
host cells containing the recombinant vectors, as well as to
methods of making such vectors and host cells and for using them
for production of Ck beta-11 and/or LAI-1 polypeptides or peptides
by recombinant techniques.
[0020] Ck beta-11 Polypeptides. The invention further provides an
isolated Ck beta-11 polypeptide having an amino acid sequence
selected from the group consisting of: (I)(a) the amino acid
sequence of the Ck beta-11 polypeptide having the complete 98 amino
acid sequence, including the leader sequence shown in FIG. 1 (SEQ
ID NO:2); (I)(b) the amino acid sequence of the mature Ck beta-11
polypeptide (without the leader) having the amino acid sequence at
positions 18-98 in FIG. 1 (SEQ ID NO:2); (I)(c) the amino acid
sequence of the Ck beta-11 polypeptide having the complete amino
acid sequence, including the leader, encoded by the cDNA clone
contained in ATCC Deposit No. 75948; and (I)(d) the amino acid
sequence of the mature Ck beta-11 polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
75948.
[0021] LAI-1 Polypeptides. The invention further provides an
isolated LAI-1 polypeptide having an amino acid sequence selected
from the group consisting of: (II)(a) the amino acid sequence of
the LAI-1 polypeptide having the complete 109 amino acid sequence,
including the leader sequence shown in FIG. 2 (SEQ ID NO:4);
(II)(b) the amino acid sequence of the mature LAI-1 polypeptide
(without the leader) having the amino acid sequence at positions
23-109 in FIG. 2 (SEQ ID NO:4); (II)(c) the amino acid sequence of
the LAI-1 polypeptide having the complete amino acid sequence,
including the leader, encoded by the cDNA clone contained in ATCC
Deposit No. 75947; and (II)(d) the amino acid sequence of the
mature LAI-1 polypeptide having the amino acid sequence encoded by
the cDNA clone contained in ATCC Deposit No. 75947.
[0022] Homologous Ck beta-11 and/or LAI-1 Polypeptides.
Polypeptides of the present invention also include homologous
polypeptides having an amino acid sequence with at least 90%
identity, and more preferably at least 95% identity to those
described in (I)- and (II)-(a), (b), (c) or (d) above, as well as
polypeptides having an amino acid sequence at least 80% identical,
more preferably at least 90% identical, and still more preferably
95%, 96%, 97%, 98% or 99% identical to those above.
[0023] Ck beta-11 and/or LAI-1 Epitope Bearing Polypeptides and
Encoding Polynucleotides. An additional embodiment of this aspect
of the invention relates to a peptide or polypeptide which has the
amino acid sequence of an epitope-bearing portion of an Ck beta-11
and/or LAI-1 polypeptide having an amino acid sequence described in
(I)- or (II)-(a), (b), (c) or (d), above. Peptides or polypeptides
having the amino acid sequence of an epitope-bearing portion of an
Ck beta-11 and/or LAI-1 polypeptide of the invention include
portions of such polypeptides with at least six or seven,
preferably at least nine, and more preferably at least about 30
amino acids to about 50 amino acids, although epitope-bearing
polypeptides of any length up to and including the entire amino
acid sequence of a polypeptide of the invention described above
also are included in the invention.
[0024] An additional nucleic acid embodiment of the invention
relates to an isolated nucleic acid molecule comprising a
polynucleotide which encodes the amino acid sequence of an
epitope-bearing portion of an Ck beta-11 and/or LAI-1 polypeptide
having an amino acid sequence in (I)- or (II)-(a), (b), (c) or (d),
above.
[0025] Ck beta-11 and/or LAI-1 Antibodies. In accordance with yet a
further aspect of the present invention, there is provided an
antibody against such polypeptides. In another embodiment, the
invention provides an isolated antibody that binds specifically to
an Ck beta-11 and/or LAI-1 polypeptide having an amino acid
sequence described in (I)- and/or (II)-(a), (b), (c) or (d)
above.
[0026] The invention further provides methods for isolating
antibodies that bind specifically to an Ck beta-11 and/or LAI-1
polypeptide having an amino acid sequence as described herein. Such
antibodies are useful diagnostically or therapeutically as
described below.
[0027] Ck beta-11 and/or LAI-1 Polypeptides, Agonists, Antagonists
and Methods. In accordance with yet another aspect of the present
invention, there are provided polypeptides, agonists, antagonists
or inhibitors of such polypeptides, which can be used to modulate
the action of such polypeptides, agonists, antagonists or
inhibitors, e.g., in the treatment of arteriosclerosis, autoimmune
and chronic inflammatory and infective diseases, histamine-mediated
allergic reactions, hyper-eosinophilic syndrome, silicosis,
sarcoidosis, inflammatory diseases of the lung, inhibition of IL-1
and TNF, aplastic anaemia, and myelodysplastic syndrome.
Alternatively, such polypeptides can be used to inhibit production
of IL-1 and TNF-.alpha. in any related diseases, e.g., to treat
aplastic anemia, myelodysplastic syndrome, inflammatory diseases,
diabetes, asthma and arthritis.
[0028] Such polypeptides, agonists, antagonists or inhibitors, can
also be used to modulate (e.g., enhance or inhibit) the action of
such polypeptides, for example, in the treatment of certain
autoimmune diseases, atherosclerosis, chronic inflammatory and
infectious diseases, histamine and IgE-mediated allergic reactions,
prostaglandin-independent fever, bone marrow failure, cancers,
silicosis, sarcoidosis, rheumatoid arthritis, shock,
hyper-eosinophilic syndrome and fibrosis in the asthmatic lung.
[0029] Diagnostic Assays. In accordance with still another aspect
of the present invention, there are provided diagnostic assays for
detecting diseases related to the underexpression and
overexpression of the polypeptides and for detecting mutations in
the nucleic acid sequences encoding such polypeptides.
[0030] In accordance with yet another aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, as
research reagents for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, for the
purpose of developing therapeutics and diagnostics for the
treatment of human disease.
[0031] The present invention also provides a screening method for
identifying compounds capable of enhancing or inhibiting a cellular
response induced by an Ck beta-11 and/or LAI-1 polypeptide, which
involves contacting cells which express the Ck beta-11 and/or LAI-1
polypeptide with the candidate compound, assaying a cellular
response, and comparing the cellular response to a standard
cellular response, the standard being assayed when contact is made
in absence of the candidate compound; whereby, an increased
cellular response over the standard indicates that the compound is
an agonist and a decreased cellular response over the standard
indicates that the compound is an antagonist.
[0032] For a number of disorders, it is believed that significantly
higher or lower levels of Ck beta-11 and/or LAI-1 gene expression
can be detected in certain tissues or bodily fluids (e.g., serum,
plasma, urine, synovial fluid or spinal fluid) taken from an
individual having such a disorder, relative to a "standard" Ck
beta-11 and/or LAI-1 gene expression level, i.e., the Ck beta-11
and/or LAI-1 expression level in tissue or bodily fluids from an
individual not having the disorder. Thus, the invention provides a
diagnostic method useful during diagnosis of a disorder, which
involves: (a) assaying Ck beta-11 and/or LAI-1 gene expression
level in cells or body fluid of an individual; (b) comparing the Ck
beta-11 and/or LAI-1 gene expression level with a standard Ck
beta-11 and/or LAI-1 gene expression level, whereby an increase or
decrease in the assayed Ck beta-11 and/or LAI-1 gene expression
level compared to the standard expression level is indicative of a
disorder. Such disorders include leukemia, chronic inflammation,
autoimmune diseases, solid tumors.
[0033] Pharmaceutical Compositions. The present invention also
provides, in another aspect, pharmaceutical compositions comprising
at least one of an Ck beta-11 and/or LAI-1: polynucleotide, probe,
vector, host cell, polypeptide, fragment, variant, derivative,
epitope bearing portion, antibody, antagonist, agonist.
[0034] Therapeutic Methods. In accordance with yet a further aspect
of the present invention, there is provided a process for utilizing
such polypeptides, or polynucleotides encoding such polypeptides
for therapeutic purposes, for example, to protect bone marrow stem
cells from chemotherapeutic agents during chemotherapy, to remove
leukemic cells, to stimulate an immune response, to regulate
hematopoiesis and lymphocyte trafficking, treatment of psoriasis,
solid tumors, to enhance host defenses against resistant and acute
and chronic infection, and to stimulate wound healing.
[0035] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, agonists, antagonists, or inhibitors, or
polynucleotides encoding such polypeptides, for therapeutic
purposes, for example, to treat solid tumors, chronic infections,
leukemia, T-cell mediated auto-immune diseases, parasitic
infections, psoriasis, asthma, allergy, to regulate hematopoiesis,
to stimulate growth factor activity, to inhibit angiogenesis and to
promote wound healing.
[0036] Alternatively or additionally, such treatment includes
arteriosclerosis, autoimmune and chronic inflammatory and infective
diseases, histamine-mediated allergic reactions, hyper-eosinophilic
syndrome, silicosis, sarcoidosis, inflammatory diseases of the
lung, inhibition of IL-1 and TNF, aplastic anaemia, and
myelodysplastic syndrome. Alternatively, such polypeptides can be
used to inhibit production of IL-1 and TNF-.alpha. in any related
diseases, e.g., to treat aplastic anemia, myelodysplastic syndrome,
inflammatory diseases, diabetes, asthma and arthritis.
[0037] Such polypeptides, agonists, antagonists or inhibitors, can
also be used to treat (e.g., enhance or inhibit) the action of such
polypeptides, agonists, antagonists or inhibitors, e.g., in the
treatment of certain autoimmune diseases, atherosclerosis, chronic
inflammatory and infectious diseases, histamine and IgE-mediated
allergic reactions, prostaglandin-independent fever, bone marrow
failure, cancers, silicosis, sarcoidosis, rheumatoid arthritis,
shock, hyper-eosinophilic syndrome and fibrosis in the asthmatic
lung.
[0038] An additional aspect of the invention is related to a method
for treating an individual in need of an increased level of Ck
beta-11 and/or LAI-1 activity in the body comprising administering
to such an individual a composition comprising a therapeutically
effective amount of an isolated Ck beta-11 and/or LAI-1
polypeptide, agonist, antagonist or inhibitor, of the
invention.
[0039] A still further aspect of the invention is related to a
method for treating an individual in need of a decreased level of
Ck beta-11 and/or LAI-1 activity in the body comprising,
administering to such an individual a composition comprising a
therapeutically effective amount of an Ck beta-11 and/or LAI-1
polypeptide, agonist, antagonist or inhibitor, of the
invention.
[0040] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE FIGURES
[0041] The following drawings are illustrative of embodiments of
the invention and are not meant to limit the scope of the invention
as encompassed by the claims.
[0042] FIG. 1 displays the cDNA sequence and corresponding deduced
amino acid sequence of Ck.beta.-11. The initial 17 amino acids
represent the leader sequence such that the mature polypeptide
comprises 81 amino acids. The standard one-letter abbreviations for
amino acids are used. Sequencing was performed using a 373
Automated DNA sequencer (Applied Biosystems, Inc.). Sequencing
accuracy is expected to be greater than 97% accurate. However, in a
baculovirus expression system, the first 21 amino acids were
cleaved leaving a mature protein of Gly (22)-Ser (98).
[0043] FIG. 2 displays the cDNA sequence and corresponding deduced
amino acid sequence of Ck.alpha.-1. The initial 22 amino acids
represent the leader sequence such that the mature polypeptide
comprises 87 amino acids. The standard one-letter abbreviations for
amino acids are used.
[0044] FIG. 3 shows data representing that Ck beta-11 affects
chemotaxis with activated T-lymphocytes. The maximal effect of
Ck-beta-11 was observed at 100 ng/ml.
[0045] FIG. 4 shows data representing that LAI-1 inhibits PBMC
adhesion to ILL-.beta. or TNF-.alpha. induced HUVEC monolayers.
Human peripheral blood mononuclear cells (PBMCs) were used in
adhesion assays with primary HUVEC monolayers as described in the
materials and methods section. As shown, the addition of LAI-1
during the adhesion assay caused a bi-phasic, dose dependent
inhibition of PBMC adhesion to endothelial cell monolayers which
were activated with IL1-.beta. (closed triangles) or with
TNF-.alpha. (open circles). The maximal effect of LAI-1 was
observed at 1-10 pg/ml. Data shown represents the specific cells
bound as a percentage of the maximal binding seen with IL1-.beta.
or TNF-.alpha.+/-the standard deviation of triplicate samples.
[0046] FIG. 5A-B shows data representing that LAI-1 inhibits PBMC
(FIG. 5A), but not PMN (FIG. 5B) adhesion to IL1-.beta. activated
HUVEC Cells. PBMCs (FIG. 5A) and polymorphonucleated neutrophil
cells (PMNS) (FIG. 5B) were used for adhesion assays with
IL1-.beta. activated C monolayers. As shown, addition of LAI-1 to
the adhesion assay resulted in the inhibition of PBMC adhesion to
the HUVEC monolayer but had no effect on the adhesion of
neutrophils in the same assay. Data shown represents the specific
cells bound as a percentage of the maximal binding seen with
IL1-.beta.+/-the standard deviation of triplicate samples.
[0047] FIG. 6A-B shows data representing that the pre-treatment of
PBMCs with LAI-1 inhibits subsequent adhesion to ILL-P activated
HUVEC Cells. FIG. 6A: The IL1-.beta. activated C monolayer was
either pre-treated with LAI-1 (closed triangles) which was then
washed away or had LAI-1 added during the adhesion assay (open
circles) as described in FIG. 4. As shown, pre-treatment of the
HUVEC monolayer with LAI-1 had no significant effect on the
subsequent adhesion of PBMCS. Within this same assay, LAI-1 was
still able to inhibit PBMC adhesion when present during the
adhesion assay. FIG. 6B: Three separate donor PBMCs were
pre-treated with LAI-1 at the concentrations indicated and the
pre-treated cells monitored for their capacity to bind to an
IL1-.beta. activated HUVEC monolayer in the absence of any added
LAI-1 during the assay. As shown, pre-treatment of the PBMCs with
LAI-1 resulted in a reduction in binding ranging from 20 to 60% of
that seen with the untreated PBMCS.
[0048] FIG. 7A-B shows data representing a decrease in the mean
fluorescence intensity of CD29 on PBMCs treated with LAI-1. PBMCs
from two donors were treated for 4 hours with LAI-1 at the
concentrations indicated and then stained for surface expression of
CD11b, CD11c, CD29, CD54, CD49d, CD49e, and CD106. The only
significant differences noted were with CD29. As shown in FIG. 7A,
there was no effect on the percentage of cells which stained
positive for CD29 (open symbols). However, the mean fluorescence
intensity of the CD29 signal was reduced in both donors when the
PBMCs were exposed to LAI-1 (closed symbols). This decrease in CD29
mean fluorescence was evident within a CD3 gated population of
PBMCs but not in a CD20, CD56, or CD14 gated population. In
addition, as shown in FIG. 7B, LAI-1 treatment caused an increase
in the percentage of CD3.sup.+/CD29.sup.- cells.
[0049] FIG. 8A-D are photographic representations showing that
Anti-vWF immunostaining of histological sections of Matrigel plugs
treated with bFGF, Ck.alpha.-1 revealed a near total inhibition of
the vWF-positive endothelial cells in large vessels and blood
sinuses numerous in the bFGF-treated positive control (FIG. 8A).
The Matrigel was mixed with inactive protein control (FIG. 8A),
bFGF (150 ng/ml) alone (FIG. 8B), bFGF (150 ng/ml)+Ck.alpha.-1 (500
ng/ml) (FIG. 8C), bFGF (150 ng/ml)+IP-10 (500 ng/ml) (FIG. 8D).
DETAILED DESCRIPTION
[0050] The present invention provides diagnostic or therapeutic
compositions and methods that utilize isolated polynucleotide
molecules encoding polypeptides, or the polypeptides themselves,
as: (i) a human leukocyte adhesion inhibitor-1 (LAI-1) polypeptides
(previously termed chemokine al (CK.alpha.1 or cka-1)); and/or (ii)
human chemokine beta-11 (Ck beta-11) polypeptides, as are vectors,
host cells and recombinant or synthetic methods for producing the
same.
Ck Beta-11 and/or LAI-1 Polynucleotides
[0051] In accordance with an aspect of the present invention, there
are provided isolated nucleic acids (polynucleotides) which encode
for the full-length or mature Ck beta-11 (FIG. 1) and/or LAI-1
polypeptide (FIG. 2) having the deduced amino acid sequence of,
respectively, FIG. 1 or 2 (SEQ ID NOS:2 or 4) and for the mature Ck
beta-11 polypeptide encoded by the cDNA of the clone(s) deposited
as ATCC Deposit No. 75948 on Nov. 11, 1994, and for the mature
LAI-1 polypeptide encoded by the cDNA of the clone deposited as
ATCC no. 75947, deposited on Nov. 11, 1994. The address of the
American Type Culture Collection is 12301 Park Lawn Drive,
Rockville, Md. 20852. The deposited clones are contained in the
pBluescript SK(-) plasmid (Stratagene, LaJolla, Calif.).
[0052] The deposit(s) referred to herein will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-Organisms for Purposes of Patent Procedure.
These deposits are provided merely as convenience to those of skill
in the art and are not an admission that a deposit is required
under 35 U.S.C. .sctn. 112. The sequence of the polynucleotides
contained in the deposited materials, as well as the amino acid
sequence of the polypeptides encoded thereby, are incorporated
herein by reference and are controlling in the event of any
conflict with description of sequences herein. A license can be
required to make, use or sell the deposited materials, and no such
license is hereby granted.
[0053] Polynucleotides encoding Ck.beta.-11 can be isolated from
numerous human adult and fetal cDNA libraries, for example, a human
fetal spleen cDNA library. Ck.beta.-11 is a member of the C-C
branch of chemokines. It contains an open reading frame encoding a
protein of 98 amino acid residues of which approximately the first
17 amino acids residues are the putative leader sequence such that
the mature protein comprises 81 amino acids. The protein exhibits
the highest degree of homology to the Rat RANTES polypeptide with
31% identity and 47% similarity over a stretch of 89 amino acids.
It is also important that the four spatially conserved cysteine
residues in chemokines are found in the polypeptides.
[0054] Polynucleotides encoding LAI-1 can be isolated from numerous
human adult and fetal cDNA libraries, for example, human tonsils
cDNA library. LAI-1 is a member of the C-X-C branch of chemokines.
It contains an open reading frame encoding a protein of 109 amino
acid residues of which approximately the first 22 amino acids
residues are the putative leader sequence such that the mature
protein comprises 87 amino acids. The protein exhibits the highest
degree of homology to interleukin-8 from Sheep (Ovis Aries) with
31% identity and 80% similarity over a stretch of 97 amino acids.
It is also important that the four spatially conserved cysteine
residues in chemokines are found in the polypeptides.
[0055] The polynucleotides of the present invention can be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA can be double-stranded or
single-stranded, and if single stranded can be the coding strand or
non-coding (anti-sense) strand. The coding sequence which encodes
the mature polypeptides can be identical to the coding sequence
shown in FIGS. 1 and 2 (SEQ ID NOS: 1 and 3, respectively) or that
of the deposited clone(s) or can be a different coding sequence
which coding sequence, as a result of the redundancy or degeneracy
of the genetic code, encodes the same, mature polypeptides as the
DNA of FIGS. 1 and 2 (SEQ ID NOS: 1 and 3) or the deposited
cDNAs.
[0056] The polynucleotides which encode for the mature polypeptides
of FIGS. 1 and 2 (SEQ ID NOS: 2 and 4) or for the mature
polypeptides encoded by the deposited cDNA can include: only the
coding sequence for the mature polypeptide; the coding sequence for
the mature polypeptides and additional coding sequence such as a
leader or secretory sequence or a proprotein sequence; the coding
sequence for the mature polypeptides (and optionally additional
coding sequence) and non-coding sequence, such as introns or
non-coding sequence 5' and/or 3' of the coding sequence for the
mature polypeptides.
[0057] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0058] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein can contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0059] Unless otherwise indicated, each "nucleotide sequence" set
forth herein is presented as a sequence of deoxyribonucleotides
(abbreviated A, G, C and T). However, by "nucleotide sequence" of a
nucleic acid molecule or polynucleotide is intended, for a DNA
molecule or polynucleotide, a sequence of deoxyribonucleotides, and
for an RNA molecule or polynucleotide, the corresponding sequence
of ribonucleotides (A, G, C and U), where each thymidine
deoxyribonucleotide (T) in the specified deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U). For
instance, reference to an RNA molecule having the sequence of SEQ
ID NO:1 or 3, as set forth using deoxyribonucleotide abbreviations,
is intended to indicate an RNA molecule having a sequence in which
each deoxyribonucleotide A, G or C of SEQ ID NOS:1 and/or 2 have
been replaced by the corresponding ribonucleotide A, G or C, and
each deoxyribonucleotide T has been replaced by a ribonucleotide
U.
[0060] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1 and/or 2, a nucleic acid molecule of
the present invention encoding an Ck beta-11 and/or LAI-1
(respectively) polypeptide can be obtained using standard cloning
and screening procedures, such as those for cloning cDNAs using
mRNA as starting material.
[0061] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptide having the deduced amino
acid sequence of FIGS. 1 and 2 (SEQ ID NOS:2 and 4) or the
polypeptides encoded by the cDNA of the deposited clone(s). The
variants of the polynucleotides can be a naturally occurring
allelic variant of the polynucleotides or a non-naturally occurring
variant of the polynucleotides.
[0062] The present invention also includes polynucleotides encoding
the same mature polypeptides as shown in FIGS. 1 and 2 (SEQ ID
NOS:2 and 4) or the same mature polypeptides encoded by the cDNA of
the deposited clone(s) as well as variants of such polynucleotides
which variants encode for a fragment, derivative or analog of the
polypeptides of FIGS. 1 and 2 (SEQ ID NOS:2 and 4) or the
polypeptides encoded by the cDNA of the deposited clone(s). Such
nucleotide variants include deletion variants, substitution
variants and addition or insertion variants.
[0063] As hereinabove indicated, the polynucleotide can have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1 and 2 (SEQ ID NOS:2 and 4) or
of the coding sequence of the deposited clone(s). As known in the
art, an allelic variant is an alternate form of a polynucleotide
sequence which can have a substitution, deletion or addition of one
or more nucleotides, which does not substantially alter the
function of the encoded polypeptide.
[0064] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptides can be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and can have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides can also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0065] Thus, for example, the polynucleotides of the present
invention can encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0066] The polynucleotides of the present invention can also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptides of the present
invention. The marker sequence can be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptides fused to the marker in the case of a bacterial host,
or, for example, the marker sequence can be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0067] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0068] As indicated, nucleic acid molecules of the present
invention can be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA can be double-stranded
or single-stranded. Single-stranded DNA or RNA can be the coding
strand, also known as the sense strand, or it can be the non-coding
strand, also referred to as the anti-sense strand.
[0069] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotides or polypeptides present in a living animal is not
isolated, but the same polynucleotides or DNA or polypeptides,
separated from some or all of the coexisting materials in the
natural system, is isolated. Such polynucleotides could be part of
a vector and/or such polynucleotides or polypeptides could be part
of a composition, and still be isolated in that such vector or
composition is not part of its natural environment. Isolated RNA
molecules include in vivo or in vitro RNA transcripts of the DNA
molecules of the present invention. Isolated nucleic acid molecules
according to the present invention further include such molecules
produced synthetically.
[0070] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) for a
Ck beta-11 and/or LAI-1 cDNA; DNA molecules comprising the coding
sequence for a mature Ck beta-11 and/or LAI-1 protein; and DNA
molecules which comprise a sequence substantially different from
those described above but which, due to the degeneracy of the
genetic code, still encode an Ck beta-11 and/or LAI-1 polypeptide.
Of course, the genetic code is well known in the art. Thus, it
would be routine for one skilled in the art to generate the
degenerate variants described above.
[0071] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which retain substantially
the same biological function or activity as the mature polypeptide
encoded by the cDNAs of FIGS. 1 and 2 (SEQ ID NO:1 and 3) or the
deposited cDNA(s).
[0072] Alternatively, the polynucleotide can have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
can or can not retain activity. For example, such polynucleotides
can be employed as probes for the polynucleotide of SEQ ID NO:1 and
3, for example, for recovery of the polynucleotide or as a
diagnostic probe or as a PCR primer.
[0073] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone contained in ATCC
Deposit 75947 (LAI-1) or ATCC Deposit 75948 (Ck beta-11). By
"stringent hybridization conditions" is intended, as anon-limiting
example, overnight incubation at 42.degree. C. in a solution
comprising: 50% formamide, 5.times.SSC (150 mM NaCl, 15 mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate, and 20 g/ml
denatured, sheared salmon sperm DNA, followed by washing the
filters in 0.1.times.SSC at about 65.degree. C. Similar stringent
conditions are well-known in the art.
[0074] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0075] Of course, polynucleotides hybridizing to a larger portion
of the reference polynucleotide (e.g. the deposited cDNA clone),
for instance, a portion 50-750 nt in length, or even to the entire
length of the reference polynucleotide, are also useful as probes
according to the present invention, as are polynucleotides
corresponding to most, if not all, of the nucleotide sequence of
the deposited cDNA or the nucleotide sequence as shown in FIG. 2
(LAI-1); and/or FIG. 1 (Ck beta-11). By a portion of a
polynucleotide of "at least 20 nt in length," for example, is
intended 20 or more contiguous nucleotides from the nucleotide
sequence of the reference polynucleotide. As indicated, such
portions are useful diagnostically either as a probe according to
conventional DNA hybridization techniques or as primers for
amplification of a target sequence by the polymerase chain reaction
(PCR), as described, for instance, in Molecular Cloning, A
Laboratory Manual, 2nd. edition, Sambrook, J., Fritsch, E. F. and
Maniatis, T., eds., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y. (1989), the entire disclosure of which is
hereby incorporated herein by reference.
[0076] Since a Ck beta-11 and/or LAI-1 cDNA clones have been
deposited and its determined nucleotide sequence provided,
generating polynucleotides which hybridize to a portion of the Ck
beta-11 and/or LAI-1 cDNA molecules would be routine to the skilled
artisan. For example, restriction endonuclease cleavage or shearing
by sonication of a Ck beta-11 and/or LAI-1 cDNA clone could easily
be used to generate DNA portions of various sizes which are
polynucleotides that hybridize, respectively, to a portion of the
Ck beta-11 and/or LAI-1 cDNA molecules.
[0077] Alternatively, the hybridizing polynucleotides of the
present invention could be generated synthetically according to
known techniques. Of course, a polynucleotide which hybridizes only
to a poly A sequence (such as the 3' terminal poly(A) tract of a
cDNA, or to a complementary stretch of T (or U) residues, would not
be included in a polynucleotide of the invention used to hybridize
to a portion of a nucleic acid of the invention, since such a
polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.
practically any double-stranded cDNA clone).
[0078] As indicated, nucleic acid molecules of the present
invention which encode an Ck beta-11 and/or LAI-1 polypeptide can
include, but are not limited to those encoding the amino acid
sequence of the mature polypeptide, by itself; the coding sequence
for the mature polypeptide and additional sequences, such as those
encoding the leader or secretory sequence, such as a pre-, or pro-
or prepro-protein sequence; the coding sequence of the mature
polypeptide, with or without the aforementioned additional coding
sequences, together with additional, non-coding sequences,
including for example, but not limited to introns and non-coding 5'
and 3' sequences, such as the transcribed, non-translated sequences
that play a role in transcription, mRNA processing, including
splicing and polyadenylation signals, for example--ribosome binding
and stability of mRNA; an additional coding sequence which codes
for additional amino acids, such as those which provide additional
functionalities. Thus, the sequence encoding the polypeptide can be
fused to a marker sequence, such as a sequence encoding a peptide
which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker
amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE vector (Qiagen, Inc.), among others, many of
which are commercially available. As described in Gentz et al.,
Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance,
hexa-histidine provides for convenient purification of the fusion
protein. The "HA" tag is another peptide useful for purification
which corresponds to an epitope derived from the influenza
hemagglutinin protein, which has been described by Wilson et al.,
Cell 37: 767 (1984). As discussed below, other such fusion proteins
include at least one of an Ck beta-11 and/or LAI-1 polypeptide or
fragment fused to Fc at the N- or C-terminus.
[0079] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of an Ck beta-11 and/or LAI-1
polypeptide. Variants can occur naturally, such as a natural
allelic variant. By an "allelic variant" is intended one of several
alternate forms of a gene occupying a given locus on a chromosome
of an organism. Genes V, Lewin, B., ed., Oxford University Press,
New York (1994). Non-naturally occurring variants can be produced
using art-known mutagenesis techniques.
[0080] Such variants include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions
or additions can involve one or more nucleotides. The variants can
be altered in coding regions, non-coding regions, or both.
Alterations in the coding regions can produce conservative or
non-conservative amino acid substitutions, deletions or additions.
Especially preferred among these are silent substitutions,
additions and deletions, which do not alter the properties and
activities of an Ck beta-11 and/or LAI-1 polypeptide or portions
thereof. Also especially preferred in this regard are conservative
substitutions. Most highly preferred are nucleic acid molecules
encoding the mature protein or the mature amino acid sequence
encoded by the deposited cDNA clone, as described herein.
[0081] Ck beta-11 and/or LAI-1 Homolog Polynucleotides. The present
invention is further directed to polynucleotides having at least a
70% identity, preferably at least 90% and more preferably at least
a 95% identity to a polynucleotide which encodes the polypeptide of
SEQ ID NO:2 or 4, as well as fragments thereof, which fragments
have at least 30 bases and preferably at least 50 bases and to
polypeptides encoded by such polynucleotides.
[0082] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide
sequence encoding an Ck beta-11 and/or LAI-1 polypeptide or
fragment, having an amino acid sequence of FIG. 1 and/or FIG. 2,
respectively, including the predicted leader sequence; (b) a
nucleotide sequence encoding the mature Ck beta-11 and/or LAI-1
polypeptide (full-length polypeptide with the leader removed); (c)
a nucleotide sequence encoding the full-length polypeptide having
the complete amino acid sequence including the leader encoded by
the deposited cDNA clone; (d) a nucleotide sequence encoding the
mature polypeptide having the amino acid sequence encoded by the
deposited cDNA clone; or (e) a nucleotide sequence complementary to
any of the nucleotide sequences in (a), (b), (c) or (d).
[0083] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding an Ck beta-11 and/or LAI-1 polypeptide is intended that
the nucleotide sequence of the polynucleotide is identical to the
reference sequence except that the polynucleotide sequence can
include up to five point mutations per each 100 nucleotides of the
reference nucleotide sequence encoding the polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of
the nucleotides in the reference sequence can be deleted or
substituted with another nucleotide, or a number of nucleotides up
to 5% of the total nucleotides in the reference sequence can be
inserted into the reference sequence. These mutations of the
reference sequence can occur at the 5' or 3' terminal positions of
the reference nucleotide sequence or anywhere between those
terminal positions, interspersed either individually among
nucleotides in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0084] As a practical matter, whether any particular nucleic acid
molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequence shown in FIG. 1 or 3, or to
the nucleotides sequence of the deposited cDNA clone can be
determined conventionally using known computer programs such as the
Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, Wis. 53711. Bestfit uses the local homology
algorithm of Smith and Waterman, Advances in Applied Mathematics 2:
482-489 (1981), to find the best segment of homology between two
sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference nucleotide sequence and that gaps in homology of up to 5%
of the total number of nucleotides in the reference sequence are
allowed.
[0085] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, as well as the
variability of cleavage sites for leaders in different known
proteins, the actual LAI-1 polypeptide encoded by the deposited
cDNA comprises about 87 amino acids, but can be anywhere in the
range of 79-103 amino acids; and the actual leader sequence of this
protein is about 22 amino acids, but can be anywhere in the range
of about 15 to about 30 amino acids.
[0086] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, as well as the
variability of cleavage sites for leaders in different known
proteins, the actual Ck beta-11 polypeptide encoded by the
deposited cDNA comprises about 81 amino acids, but can be anywhere
in the range of 70-95 amino acids; and the actual leader sequence
of this protein is about 17 amino acids, but can be anywhere in the
range of about 10 to about 25 amino acids.
[0087] Nucleic Acid Probes. Such isolated molecules, particularly
DNA molecules, are useful as probes for gene mapping, by in situ
hybridization with chromosomes, and for detecting expression of a
Ck beta-11 and/or LAI-1 gene in human or other animal tissue, for
instance, by Northern blot analysis. The present invention is
further directed to fragments of the isolated nucleic acid
molecules described herein. By a fragment of an isolated nucleic
acid molecule having the nucleotide sequence of the deposited Ck
beta-11 and/or LAI-1 cDNAs, or a nucleotide sequence shown in any
or all of FIGS. 1 and 2 (SEQ ID NOS:1 and 3), respectively, is
intended fragments at least about 15 nt, and more preferably at
least about 20 nt, still more preferably at least about 30 nt, and
even more preferably, at least about 40 nt in length which are
useful as diagnostic probes and primers as discussed herein. Of
course, larger fragments 50-500 nt in length are also useful
according to the present invention as are fragments corresponding
to most, if not all, of a nucleotide sequence of the deposited Ck
beta-11 and/or LAI-1 cDNAs, or as shown in FIGS. 1 and 2 (SEQ ID
NOS:1 and 3). By a fragment at least 20 nt in length, for example,
is intended fragments which include 20 or more contiguous bases
from the nucleotide sequence of the deposited cDNA or the
nucleotide sequence as shown in FIGS. 1 and 2 (SEQ ID NOS:1 and 3).
Since the gene has been deposited and the nucleotide sequences
shown in FIGS. 1 and 2 (SEQ ID NOS:1 and 3) are provided,
generating such DNA fragments would be routine to the skilled
artisan. For example, restriction endonuclease cleavage or shearing
by sonication could easily be used to generate fragments of various
sizes. Alternatively, such fragments could be generated
synthetically.
[0088] Fragments of the full length gene of the present invention
can be used as a hybridization. probe for a cDNA library to isolate
the full length cDNA and to isolate other cDNAs which have a high
sequence similarity to the gene or similar biological activity.
Probes of this type preferably have at least 30 bases and can
contain, for example, 50 or more bases. The probe can also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete gene
including regulatory and promoter regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
gene by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the gene of the present invention are used
to screen a library of human cDNA, genomic DNA or mRNA to determine
which members of the library the probe hybridizes to.
[0089] Vectors and Host Cells. The present invention also relates
to vectors which include the isolated DNA molecules of the present
invention, host cells which are genetically engineered with the
recombinant vectors, and the production of Ck beta-11 and/or LAI-1
polypeptides, variants, mutants or fragments thereof by recombinant
techniques.
[0090] Recombinant constructs can be introduced into host cells
using well known techniques such infection, transduction,
transfection, transvection, electroporation and transformation. The
vector can be, for example, a phage, plasmid, viral or retroviral
vector. Retroviral vectors can be replication competent or
replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells.
[0091] The polynucleotides can be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it can be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0092] Preferred are vectors comprising cis-acting control regions
to the polynucleotide of interest. Appropriate trans-acting factors
can be supplied by the host, supplied by a complementing vector or
supplied by the vector itself upon introduction into the host.
[0093] In certain preferred embodiments in this regard, the vectors
provide for specific expression, which can be inducible and/or cell
type-specific. Particularly preferred among such vectors are those
inducible by environmental factors that are easy to manipulate,
such as temperature and nutrient additives.
[0094] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors, e.g. vectors
derived from bacterial plasmids, bacteriophage, yeast episomes,
yeast chromosomal elements, viruses such as baculoviruses, papova
viruses, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as cosmids and phagemids.
[0095] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will preferably include a translation
initiating at the beginning and a termination codon (UAA, UGA or
UAG) appropriately positioned at the end of the polypeptide to be
translated.
[0096] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the above-described host cells are known in the
art.
[0097] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, (Qiagen); pBS vectors, pD10, Phagescript vectors,
pBluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from
Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
available from Pharmacia. Among preferred eukaryotic vectors are
pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and
pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable
vectors will be readily apparent to the skilled artisan.
[0098] Among known bacterial promoters suitable for use in the
present invention include the E. coli lacI and lacZ promoters, the
T3 and T7 promoters, the gpt promoter, the lambda PR and PL
promoters and the trp promoter. Suitable eukaryotic promoters
include the CMV immediate early promoter, the HSV thymidine kinase
promoter, the early and late SV40 promoters, the promoters of
retroviral LTRs, such as those of the Rous Sarcoma Virus (RSV), and
metallothionein promoters, such as the mouse metallothionein-I
promoter.
[0099] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0100] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes can be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers.
[0101] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0102] Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which can be, for example, a cloning vector or an expression
vector. The vector can be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the
LAI-1 and/or Ck beta-11 genes. The culture conditions, such as
temperature, pH and the like, are those previously used with the
host cell selected for expression, and will be apparent to the
ordinarily skilled artisan.
[0103] The polynucleotides of the present invention can be employed
for producing polypeptides by recombinant techniques. Thus, for
example, the polynucleotide sequence can be included in any one of
a variety of expression vehicles, in particular vectors or plasmids
for expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g. derivatives of
SV40; bacterial plasmids; phage DNA; yeast plasmids; vectors
derived from combinations of plasmids and phage DNA, viral DNA such
as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However,
any other plasmid or vector can be used as long they are replicable
and viable in the host.
[0104] The appropriate DNA sequence can be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease site(s) by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0105] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there can be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector can also include appropriate
sequences for amplifying expression.
[0106] In addition, the expression vectors preferably contain a
gene to provide a phenotypic trait for selection of transformed
host cells such as dihydrofolate reductase or neomycin resistance
for eukaryotic cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
[0107] The vector containing the appropriate DNA sequence as
hereinabove described, as well as an appropriate promoter or
control sequence, can be employed to transform an appropriate host
to permit the host to express the protein. As representative
examples of appropriate hosts, there can be mentioned: bacterial
cells, such as E. coli, Streptomyces, Salmonella Typhimurium;
fungal cells, such as yeast; insect cells such as Drosophila and
Sf9; animal cells such as CHO, COS or Bowes melanoma; plant cells,
etc. The selection of an appropriate host is deemed to be within
the scope of those skilled in the art from the teachings
herein.
[0108] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10,
phagescript, psix174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A,
pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector can be used as long as they are replicable
and viable in the host.
[0109] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are PKK232-8 and PCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-I. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0110] In a further embodiment, the present invention relates to
host cells containing the above-described construct. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, (1986)).
[0111] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0112] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which
is hereby incorporated by reference.
[0113] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp that act on a
promoter to increase its transcription. Examples including the SV40
enhancer on the late side of the replication origin bp 100 to 270,
a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of the replication origin, and adenovirus
enhancers.
[0114] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g. the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), .alpha.-factor, acid phosphatase, or heat shock
proteins, among others. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and
termination sequences, and preferably, a leader sequence capable of
directing secretion of translated protein into the periplasmic
space or extracellular medium. Optionally, the heterologous
sequence can encode a fusion protein including an N-terminal
identification peptide imparting desired characteristics, e.g.
stabilization or simplified purification of expressed recombinant
product.
[0115] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others can also be employed as a matter of choice.
[0116] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed. Following
transformation of a suitable host strain and growth of the host
strain to an appropriate cell density, the selected promoter is
induced by appropriate means (e.g. temperature shift or chemical
induction) and cells are cultured for an additional period.
[0117] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0118] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing agents,
such methods are well known to those skilled in the art.
[0119] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40
splice, and polyadenylation sites can be used to provide the
required nontranscribed genetic elements.
[0120] Polypeptides and Polypeptide Fragments. The invention
further provides an isolated Ck beta-11 and/or LAI-1 polypeptide
having the amino acid sequence encoded by the deposited cDNA, or
the amino acid sequence in FIG. 1 or 2 (SEQ ID NO:2 or 4,
respectively), or a peptide or polypeptide comprising a portion of
the above polypeptides. The terms "peptide" and "oligopeptide" are
considered synonymous (as is commonly recognized) and each term can
be used interchangeably as the context requires to indicate a chain
of at least two amino acids coupled by peptidyl linkages. The word
"polypeptide" is used herein for chains containing more than ten
amino acid residues. All oligopeptide and polypeptide formulas or
sequences herein are written from left to right and in the
direction from amino terminus to carboxy terminus.
[0121] By "a polypeptide having Ck beta-11 activity" is intended
polypeptides exhibiting activity similar, but not necessarily
identical, to an activity of the Ck beta-11 protein of the
invention (either the full-length protein or, preferably, the
mature protein), as measured in a particular biological assay. Ck
beta-11 protein activity can be measured using the chemotaxis assay
disclosed in Example 8, infra.
[0122] Thus, "a polypeptide having Ck beta-11 protein activity"
includes polypeptides that exhibit Ck beta-11 activity, in the
above-described assay. Although the degree of activity need not be
identical to that of the Ck beta-11 protein, preferably, "a
polypeptide having Ck beta-11 protein activity" will exhibit
substantially similar activity as compared to the Ck beta-11
protein (i.e., the candidate polypeptide will exhibit greater
activity or not more than about twenty-fold less and, preferably,
not more than about ten-fold less activity relative to the
reference Ck beta-11 protein).
[0123] By "a polypeptide having LAI-1 activity" is intended
polypeptides exhibiting activity similar, but not necessarily
identical, to an activity of the LAI-1 protein of the invention
(either the full-length protein or, preferably, the mature
protein), as measured in a particular biological assay. For
example, LAI-1 protein activity can be measured using the leukocyte
adhesion assay as described in Example 10, the angiogenesis assay
of Example 11, or the chemotaxis assay as described in Example 9,
infra.
[0124] Thus, "a polypeptide having LAI-1 protein activity" includes
polypeptides that exhibit LAI-1 activity, in the above-described
assays. Although the degree of activity need not be identical to
that of the LAI-1 protein, preferably, "a polypeptide having LAI-1
protein activity" will exhibit substantially similar activity as
compared to the LAI-1 protein (i.e., the candidate polypeptide will
exhibit greater activity or not more than about twenty-fold less
and, preferably, not more than about ten-fold less activity
relative to the reference LAI-1 protein).
[0125] The present invention further relates to Ck beta-11 and/or
LAI-1 polypeptides which have the deduced amino acid sequence of
FIGS. 1 and 2 (SEQ ID NOS: 2 and 4) or which have the amino acid
sequence encoded by the deposited cDNA, as well as fragments,
analogs and derivatives of such polypeptide.
[0126] The terms "fragment," "derivative" and "analog" when
referring to the polypeptides of FIGS. 1 and 2 (SEQ ID NOS: 2 and
4) or that encoded by the deposited cDNA, means a polypeptide which
retains essentially the same biological function or activity as
such polypeptide. Thus, an analog includes a proprotein which can
be activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0127] The polypeptides of the present invention can be a
recombinant polypeptide, a natural polypeptide or a synthetic
polypeptide, preferably a recombinant polypeptide.
[0128] The fragment, derivative or analog of the polypeptides of
FIGS. 1 and 2 (SEQ ID NOS: 2 and 4) or that encoded by the
deposited cDNA can be (i) one in which one or more of the amino
acid residues are substituted with a conserved or non-conserved
amino acid residue (preferably a conserved amino acid residue) and
such substituted amino acid residues is or is not be one encoded by
the genetic code, or (ii) one in which one or more of the amino
acid residues includes a substituent group, or (iii) one in which
the mature polypeptides are fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptides, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptides or a proprotein sequence. Such
fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0129] The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are purified to
homogeneity.
[0130] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 and 4 (in particular the mature
polypeptide) as well as polypeptides which have at least 70%
similarity (preferably at least 70% identity) to the polypeptide of
SEQ ID NO:2 and 4 and more preferably at least 90% similarity (more
preferably at least 90% identity) to the polypeptide of SEQ ID NO:
2 and 4 and still more preferably at least 95% similarity (still
more preferably at least 95% identity) to the polypeptide of SEQ ID
NO:2 and 4 and also include portions of such polypeptides with such
portion of the polypeptide generally containing at least 30 amino
acids and more preferably at least 50 amino acids.
[0131] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0132] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence of the deposited cDNA (ATCC 75948) or the nucleic acid
sequence shown in FIG. 1 (SEQ ID NO:1) will encode a polypeptide
"having Ck beta-11 protein activity." One of ordinary skill in the
art will also immediately recognize that a large number of the
nucleic acid molecules having a sequence at least 90%, 95%, 96%,
97%, 98%, or 99% identical to the nucleic acid sequence of the
deposited cDNA (ATCC 75947) or the nucleic acid sequence shown in
FIG. 2 (SEQ ID NO:3) will encode a polypeptide "having LAI-1
protein activity." In fact, since degenerate variants of these
nucleotide sequences all encode the same polypeptide, this will be
clear to the skilled artisan even without performing the above
described comparison assay. It will be further recognized in the
art that, for such nucleic acid molecules that are not degenerate
variants, a reasonable number will also encode a polypeptide having
Ck beta-11 and/or LAI-1 protein activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are
either less likely or not likely to significantly effect protein
function (e.g. replacing one aliphatic amino acid with a second
aliphatic amino acid).
[0133] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main approaches for studying
the tolerance of an amino acid sequence to change. The first method
relies on the process of evolution, in which mutations are either
accepted or rejected by natural selection. The second approach uses
genetic engineering to introduce amino acid changes at specific
positions of a cloned gene and selections or screens to identify
sequences that maintain functionality. As the authors state, these
studies have revealed that proteins are surprisingly tolerant of
amino acid substitutions. The authors further indicate which amino
acid changes are likely to be permissive at a certain position of
the protein. For example, most buried amino acid residues require
nonpolar side chains, whereas few features of surface side chains
are generally conserved. Other such phenotypically silent
substitutions are described in Bowie, J. U. et al., supra, and the
references cited therein.
[0134] Fragments or portions of the polypeptides of the present
invention can be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments can be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention can be used to synthesize
full-length polynucleotides of the present invention.
[0135] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals can be
incorporated into the expressed polypeptide. The signals can be
endogenous to the polypeptide or they can be heterologous
signals.
[0136] The polypeptide can be expressed in a modified form, such as
a fusion protein, and can include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
can be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties can
be added to the polypeptide to facilitate purification. Such
regions can be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine
techniques in the art. A preferred fusion protein comprises a
heterologous region from immunoglobulin that is useful to
solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in a fusion protein is thoroughly advantageous for use in therapy
and diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, hIL-5 has been fused with Fc portions for the purpose of
high-throughput screening assays to identify antagonists of hIL-5.
See, D. Bennett et al., Journal of Molecular Recognition, Vol.
8:52-58 (1995) and K. Johanson et al., The Journal of Biological
Chemistry, Vol. 270, No. 16:9459-9471 (1995).
[0137] The Ck beta-11 and/or LAI-1 protein can be recovered and
purified from recombinant cell cultures by well-known methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification. Polypeptides of the present invention include
naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention can be glycosylated or can be
non-glycosylated. In addition, polypeptides of the invention can
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
[0138] Ck beta-11 and/or LAI-1 Polypeptide Variants. It will be
recognized in the art that some amino acid sequences of the Ck
beta-11 and/or LAI-1 polypeptide can be varied without significant
effect of the structure or function of the protein. If such
differences in sequence are contemplated, it should be remembered
that there will be critical areas on the protein which determine
activity. In general, it is possible to replace residues which form
the tertiary structure, provided that residues performing a similar
function are used. In other instances, the type of residue can be
completely unimportant if the alteration occurs at a non-critical
region of the protein.
[0139] Thus, the invention further includes variations of an Ck
beta-11, LAI-1 polypeptide which show, respectively, substantial Ck
beta-11 and/or LAI-1 polypeptide activity or which include regions,
respectively, of an Ck beta-11 and/or LAI-1 protein such as the
protein portions discussed below. Such mutants include deletions,
insertions, inversions, repeats, and type substitutions (for
example, substituting one hydrophilic residue for another, but not
strongly hydrophilic for strongly hydrophobic as a rule). Small
changes or such "neutral" amino acid substitutions will generally
have little effect on activity.
[0140] Typically seen as conservative substitutions are the
replacements, one for another, among the aliphatic amino acids Ala,
Val, Leu and Ile; interchange of the hydroxyl residues Ser and Thr,
exchange of the acidic residues Asp and Glu, substitution between
the amide residues Asn and Gln, exchange of the basic residues Lys
and Arg and replacements among the aromatic residues Phe, Tyr.
Preferred substitutions are at positions 1-28, 31-70 and/or 72-89
of Ck beta-11 (FIG. 1; SEQ ID NO:2); and at positions 1-29, 35-75
and/or 77-109 of LAI-1 (FIG. 2; SEQ ID NO:4).
[0141] Of additional special interest are also substitutions of
charged amino acids with another charged amino acid or with neutral
amino acids. This can result in proteins with improved
characteristics such as less aggregation. Prevention of aggregation
is highly desirable. Aggregation of proteins cannot only result in
a reduced activity but be problematic when preparing pharmaceutical
formulations because they can be immunogenic (Pinckard et al.,
Clin. Exp. Immunol. 2:331-340 (1967), Robbins et al., Diabetes 36:
838-845 (1987), Cleland et al., Crit. Rev. Therapeutic Drug Carrier
Systems 10:307-377 (1993).
[0142] The replacement of amino acids can also change the
selectivity of the binding to cell surface receptors. Ostade et
al., Nature 361: 266-268 (1993), described certain TNF alpha
mutations resulting in selective binding of TNF alpha to only one
of the two known TNF receptors.
[0143] As indicated in detail above, further guidance concerning
which amino acid changes are likely to be phenotypically silent
(i.e., are not likely to have a significant deleterious effect on a
function) can be found in Bowie, J. U., et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247:1306-1310 (1990). The number of amino
acid substitutions a skilled artisan would make depends on several
factors, including those described above and below. Generally
speaking the number of substitutions for any given LAI-1 or
Ck.beta.-1 polypeptide will not be more than 50, 40, 30, 20, 10, 5,
or 3, depending on the objective.
[0144] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0145] Ck beta-11 Variants. In order to improve or alter the
characteristics of the Ck beta-11 polypeptide(s), protein
engineering can be employed. Recombinant DNA technology known to
those skilled in the art can be used to create novel proteins.
Muteins and deletions or fusion proteins can show, e.g., enhanced
activity or increased stability. In addition, they could be
purified in higher yields and show better solubility at least under
certain purification and storage conditions. Set below are
additional examples of mutations that can be constructed.
[0146] Ck beta-11 Amino terminal and carboxy terminal deletions:
Interferon gamma shows up to ten times higher activities by
deleting 8-10 amino acid residues from the carboxy terminus of the
protein (Dobeli et al., J. of Biotechnology 7:199-216 (1988). Ron
et al., J. Biol. Chem., 268(4):2984-2988 (1993) reported modified
KGF proteins that had heparin binding activity even if 3, 8, or 27
amino terminal amino acid residues were missing. Many other
examples are known to anyone skilled in the art.
[0147] Ck beta-11 deletion variants include deletions of 1-28 from
the N-terminus and 1-27 from the C-terminus (FIG. 1, SEQ ID NO:2).
Particularly preferred Ck beta-11 polypeptides are shown below:
TABLE-US-00002 Pro (18) --- Ser (98) Pro (18) --- Leu (86) Gly (22)
--- Lys (92) Thr (19) --- Ser (98) Pro (18) --- Arg (85) Gly (22)
--- Ala (91) Leu (20) --- Ser (98) Pro (18) --- Gln (84) Gly (22)
--- Ser (90) Ser (21) --- Ser (98) Pro (18) --- Ile (83) Gly (22)
--- Thr (89) Gly (22) --- Ser (98) Pro (18) --- Ile (82) Gly (22)
--- Arg (88) Thr (23) --- Ser (98) Pro (18) --- Arg (81) Gly (22)
--- Gln (87) Asn (24) --- Ser (98) Pro (18) --- Glu (80) Gly (22)
--- Leu (86) Asp (25) --- Ser (98) Pro (18) --- Val (79) Gly (22)
--- Arg (85) Ala (26) --- Ser (98) Pro (18) --- Trp (78) Gly (22)
--- Gln (84) Glu (27) --- Ser (98) Pro (18) --- Pro (77) Gly (22)
--- Ile (83) Asp (28) --- Ser (98) Pro (18) --- Gln (76) Gly (22)
--- Ile (82) Pro (18) --- Cys (71) Pro (18) --- Asp (75) Gly (22)
--- Arg (81) Pro (18) --- Ser (97) Pro (18) --- Pro (74) Gly (22)
--- Glu (80) Pro (18) --- Arg (96) Pro (18) --- Pro (73) Gly (22)
--- Val (79) Pro (18) --- Arg (95) Pro (18) --- Ala (72) Gly (22)
--- Trp (78) Pro (18) --- Lys (94) Ser (21) --- Lys (94) Gly (22)
--- Pro (77) Pro (18) --- Met (93) Ser (21) --- Lys (92) Gly (22)
--- Gln (76) Pro (18) --- Lys (92) Gly (22) --- Cys (71) Gly (22)
--- Asp (75) Pro (18) --- Ala (91) Gly (22) --- Ser (97) Gly (22)
--- Pro (74) Pro (18) --- Ser (90) Gly (22) --- Arg (96) Gly (22)
--- Pro (73) Pro (18) --- Thr (89) Gly (22) --- Arg (95) Gly (22)
--- Ala (72) Pro (18) --- Arg (88) Gly (22) --- Lys (94) Pro (18)
--- Gln (87) Gly (22) --- Met (93)
[0148] Substitution of amino acids: A further aspect of the present
invention also includes the substitution of amino acids. Of special
interest are conservative amino acid substitutions that do not
significantly affect the folding of the protein. Examples of
conservative amino acid substitutions known to those skilled in the
art are set forth Table 1, above.
[0149] Of additional special interest are also substitutions of
charged amino acids with another charged amino acid or with neutral
amino acids. This can result in proteins with improved
characteristics such as less aggregation. Prevention of aggregation
is highly desirable. Aggregation of proteins cannot only result in
a reduced activity but be problematic when preparing pharmaceutical
formulations because they can be immunogenic (Pinckard et al.,
Clin. Exp. Immunol. 2:331-340 (1967), Robbins et al., Diabetes
36:838-845 (1987), Cleland et al., Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993).
[0150] The Ck beta-11 protein can contain one or several amino acid
substitutions, deletions or additions, either from natural mutation
or human manipulation. Preferred substitutions are at positions
1-28, 31-70 and 72-89 of Ck beta-11 (FIG. 1; SEQ ID NO:2).
Non-limiting examples of some preferred mutations are:
TABLE-US-00003 Ala (17) Met Pro (18) Met Asp (53) Ala Asp (53) Gly
Asp (53) Ser Asp (53) Thr Asp (53) Met Asp (53) Ala
[0151] LAI-1 Variants. In order to improve or alter the
characteristics of the LAI-1 polypeptide(s), protein engineering
can be employed. Recombinant DNA technology known to those skilled
in the art can be used to create novel proteins. Muteins and
deletions or fusion proteins can show, e.g., enhanced activity or
increased stability. In addition, they could be purified in higher
yields and show better solubility at least under certain
purification and storage conditions. Set below are examples of
mutations that can be constructed.
[0152] LAI-1 Amino terminal and carboxy terminal deletions:
Interferon gamma shows up to ten times higher activities by
deleting 8-10 amino acid residues from the carboxy terminus of the
protein (Dobeli et al., J. of Biotechnology 7:199-216 (1988). Ron
et al., J. Biol. Chem., 268(4):2984-2988 (1993) reported modified
KGF proteins that had heparin binding activity even if 3, 8, or 27
amino terminal amino acid residues were missing. Many other
examples are known to anyone skilled in the art.
[0153] LAI-1 deletion variants include deletions of 1-29 from the
N-terminus and 1-33 from the C-terminus (FIG. 2, SEQ ID NO:4).
Particularly preferred variants of LAI-1 polypeptides of some
preferred mutations are:
TABLE-US-00004 Gly (22) --- Pro (109) Val (23) --- Ile (109) Val
(23) --- Pro (100) Val (23) --- Pro (109) Leu (24) --- Ile (108)
Val (23) --- Leu (99) Leu (24) --- Pro (109) Glu (25) --- Lys (107)
Val (23) --- Thr (98) Glu (25) --- Pro (109) Val (26) --- Arg (106)
Val (23) --- Ser (97) Val (26) --- Pro (109) Tyr (27) --- Lys (105)
Val (23) --- Ser (96) Tyr (27) --- Pro (109) Tyr (28) --- Phe (104)
Val (23) --- Ser (95) Tyr (28) --- Pro (109) Thr (29) --- Val (103)
Val (23) --- Arg (94) Thr (29) --- Pro (109) Val (23) --- Pro (102)
Val (23) --- Lys (93) Ser (30) --- Pro (109) Val (23) --- Cys (76)
Val (23) --- Arg (92) Gly (22) --- Pro (109) Val (23) --- Val (101)
Val (23) --- Leu (91) Val (23) --- Val (90) Val (23) --- Ile (84)
Val (23) --- Asp (78) Val (23) --- Glu (89) Val (23) --- Trp (83)
Val (23) --- Val (77) Val (23) --- Met (88) Val (23) --- Glu (82)
Ser (30) --- Lys (107) Val (23) --- Met (87) Val (23) --- Ala (81)
Ser (30) --- Lys (105) Val (23) --- Arg (86) Val (23) --- Gln (80)
Ser (30) --- Lys (93) Val (23) --- Gln (85) Val (23) --- Pro (79)
Ser (30) --- Cys(76)
[0154] An LAI-1 polypeptide can contain one or several amino acid
substitutions, deletions or additions, either from natural mutation
or human manipulation. Preferred substitutions are at positions
1-29, 35-75 and 77-109 of LAI-1 (FIG. 2; SEQ ID NO:4). Non-limiting
examples of some preferred mutations are:
[0155] Gly (22) Met
[0156] Val (23) Met
[0157] The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are substantially
purified. A recombinantly produced version of the Ck beta-11 and/or
LAI-1 polypeptide can be substantially purified by the one-step
method described in Smith and Johnson, Gene 67:31-40 (1988).
[0158] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA including the leader, the
mature polypeptide encoded by the deposited the cDNA minus the
leader (i.e., the mature protein), the Ck beta-11 polypeptide of
FIG. 1 (SEQ ID NO:2) or the LAI-1 polypeptide of FIG. 2 (SEQ ID
NO:4) including the leader, Ck beta-11 the polypeptide of FIG. 1
(SEQ ID NO:2), or the LAI-1 polypeptide of FIG. 2 (SEQ ID NO:4)
minus the leader, as well as polypeptides which have at least 90%
similarity, more preferably at least 95% similarity, and still more
preferably at least 96%, 97%, 98% or 99% similarity to those
described above. Further polypeptides of the present invention
include polypeptides at least 80% identical, more preferably at
least 90% or 95% identical, still more preferably at least 96%,
97%, 98% or 99% identical to the polypeptide encoded by the
deposited cDNA, to the Ck beta-11 polypeptide of FIG. 1 (SEQ ID
NO:2) or the LAI-1 polypeptide of FIG. 2 (SEQ ID NO:4) and also
include portions of such polypeptides with at least 30 amino acids
and more preferably at least 50 amino acids.
[0159] By "% similarity" for two polypeptides is intended a
similarity score produced by comparing the amino acid sequences of
the two polypeptides using the Bestfit program (Wisconsin Sequence
Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, Wis. 53711)
and the default settings for determining similarity. Bestfit uses
the local homology algorithm of Smith and Waterman (Advances in
Applied Mathematics 2:482-489, 1981) to find the best segment of
similarity between two sequences.
[0160] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of an
Ck beta-11 and/or LAI-1 polypeptide is intended that the amino acid
sequence of the polypeptide is identical to the reference sequence
except that the polypeptide sequence can include up to five amino
acid alterations per each 100 amino acids of the reference amino
acid of the Ck beta-11 and/or LAI-1 polypeptide. In other words, to
obtain a polypeptide having an amino acid sequence at least 95%
identical to a reference amino acid sequence, up to 5% of the amino
acid residues in the reference sequence can be deleted or
substituted with another amino acid, or a number of amino acids up
to 5% of the total amino acid residues in the reference sequence
can be inserted into the reference sequence. These alterations of
the reference sequence can occur at the amino or carboxy terminal
positions of the reference amino acid sequence or anywhere between
those terminal positions, interspersed either individually among
residues in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0161] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequence shown in FIG. 1 (SEQ ID NO:2) or FIG. 2
(SEQ ID NO:4), or to the amino acid sequence encoded by deposited
cDNA clones can be determined conventionally using known computer
programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8 for Unix, Genetics Computer Group, University
Research Park, 575 Science Drive, Madison, Wis. 53711. When using
Bestfit or any other sequence alignment program to determine
whether a particular sequence is, for instance, 95% identical to a
reference sequence according to the present invention, the
parameters are set, of course, such that the percentage of identity
is calculated over the full length of the reference amino acid
sequence and that gaps in homology of up to 5% of the total number
of amino acid residues in the reference sequence are allowed.
[0162] The polypeptide of the present invention could be used as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0163] As described in detail below, the polypeptides of the
present invention can also be used to raise polyclonal and
monoclonal antibodies, which are useful in assays for detecting Ck
beta-11 and/or LAI-1 protein expression as described below or as
agonists and antagonists capable of enhancing or inhibiting Ck
beta-11 and/or LAI-1 protein function. Further, such polypeptides
can be used in the yeast two-hybrid system to "capture" Ck beta-11
and/or LAI-1 protein binding proteins which are also candidate
agonist and antagonist according to the present invention. The
yeast two hybrid system is described in Fields and Song, Nature
340:245-246 (1989).
[0164] Ck beta-11 and/or LAI-1 Epitope-Bearing Polypeptides. In
another aspect, the invention provides a peptide or polypeptide
comprising an epitope-bearing portion of a polypeptide of the
invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide of the invention.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. These immunogenic epitopes are believed to be confined
to a few loci on the molecule. On the other hand, a region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." The number of immunogenic epitopes of a
protein generally is less than the number of antigenic epitopes.
See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1983).
[0165] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, e.g.,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A.,
Science 219:660-666 (1983).
[0166] Peptides capable of eliciting protein-reactive sera are
frequently represented in the primary sequence of a protein, can be
characterized by a set of simple chemical rules, and are confined
neither to immunodominant regions of intact proteins (i.e.,
immunogenic epitopes) nor to the amino or carboxyl terminals.
Peptides that are extremely hydrophobic and those of six or fewer
residues generally are ineffective at inducing antibodies that bind
to the mimicked protein; longer, peptides, especially those
containing proline residues, usually are effective. Sutcliffe et
al., supra, at 661. For instance, 18 of 20 peptides designed
according to these guidelines, containing 8-39 residues covering
75% of the sequence of the influenza virus hemagglutinin HA1
polypeptide chain, induced antibodies that reacted with the HA1
protein or intact virus; and 12/12 peptides from the MuLV
polymerase and 18/18 from the rabies glycoprotein induced
antibodies that precipitated the respective proteins.
[0167] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. Thus, a high proportion of hybridomas obtained by
fusion of spleen cells from donors immunized with an antigen
epitope-bearing peptide generally secrete antibody reactive with
the native protein. Sutcliffe et al., supra, at 663. The antibodies
raised by antigenic epitope-bearing peptides or polypeptides are
useful to detect the mimicked protein, and antibodies to different
peptides can be used for tracking the fate of various regions of a
protein precursor which undergoes post-translational processing.
The peptides and anti-peptide antibodies can be used in a variety
of qualitative or quantitative assays for the mimicked protein, for
instance in competition assays since it has been shown that even
short peptides (e.g. about 9 amino acids) can bind and displace the
larger peptides in immunoprecipitation assays. See, for instance,
Wilson et al., Cell 37:767-778 (1984) at 777. The anti-peptide
antibodies of the invention also are useful for purification of the
mimicked protein, for instance, by adsorption chromatography using
methods well known in the art.
[0168] Antigenic epitope-bearing peptides and polypeptides of the
invention designed according to the above guidelines preferably
contain a sequence of at least seven, more preferably at least nine
and most preferably between about 15 to about 30 amino acids
contained within the amino acid sequence of a polypeptide of the
invention. However, peptides or polypeptides comprising a larger
portion of an amino acid sequence of a polypeptide of the
invention, containing about 30 to about 50 amino acids, or any
length up to and including the entire amino acid sequence of a
polypeptide of the invention, also are considered epitope-bearing
peptides or polypeptides of the invention and also are useful for
inducing antibodies that react with the mimicked protein.
Preferably, the amino acid sequence of the epitope-bearing peptide
is selected to provide substantial solubility in aqueous solvents
(i.e., the sequence includes relatively hydrophilic residues and
highly hydrophobic sequences are preferably avoided); and sequences
containing proline residues are particularly preferred.
[0169] The epitope-bearing peptides and polypeptides of the
invention can be produced by any conventional means for making
peptides or polypeptides including recombinant means using nucleic
acid molecules of the invention. For instance, a short
epitope-bearing amino acid sequence can be fused to a larger
polypeptide which acts as a carrier during recombinant production
and purification, as well as during immunization to produce
anti-peptide antibodies. Epitope-bearing peptides also can be
synthesized using known methods of chemical synthesis. For
instance, Houghten has described a simple method for synthesis of
large numbers of peptides, such as 10-20 mg of 248 different 13
residue peptides representing single amino acid variants of a
segment of the HA1 polypeptide which were prepared and
characterized (by ELISA-type binding studies) in less than four
weeks. Houghten, R. A. (1985) General method for the rapid
solid-phase synthesis of large numbers of peptides: specificity of
antigen-antibody interaction at the level of individual amino
acids. Proc. Natl. Acad. Sci. USA 82:5131-5135. This "Simultaneous
Multiple Peptide Synthesis (SMPS)" process is further described in
U.S. Pat. No. 4,631,211 to Houghten et al. (1986). In this
procedure the individual resins for the solid-phase synthesis of
various peptides are contained in separate solvent-permeable
packets, enabling the optimal use of the many identical repetitive
steps involved in solid-phase methods. A completely manual
procedure allows 500-1000 or more syntheses to be conducted
simultaneously. Houghten et al., supra, at 5134.
[0170] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the Ck beta-11 and/or LAI-1 protein.
[0171] The inventors have determined that the above polypeptide
fragments are antigenic regions of the Ck beta-11 and/or LAI-1
protein. Methods for determining other such epitope-bearing
portions of the Ck beta-11 and/or LAI-1 protein are described in
detail below.
[0172] Methods for determining other such epitope-bearing portions
of an Ck beta-11 and/or LAI-1 polypeptide are described herein.
[0173] Epitope-bearing peptides and polypeptides of the invention
are used to induce antibodies according to methods well known in
the art. See, for instance, Sutcliffe et al., supra; Wilson et al,
supra; Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:910-914; and
Bittle, F. J. et al, J. Gen. Virol. 66:2347-2354 (1985). Generally,
animals can be immunized with free peptide; however, anti-peptide
antibody titer can be boosted by coupling of the peptide to a
macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or
tetanus toxoid. For instance, peptides containing cysteine can be
coupled to carrier using a linker such as
m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other
peptides can be coupled to carrier using a more general linking
agent such as glutaraldehyde. Animals such as rabbits, rats and
mice are immunized with either free or carrier-coupled peptides,
for instance, by intraperitoneal and/or intradermal injection of
emulsions containing about 100 g peptide or carrier protein and
Freund's adjuvant. Several booster injections can be needed, for
instance, at intervals of about two weeks, to provide a useful
titer of anti-peptide antibody which can be detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The
titer of anti-peptide antibodies in serum from an immunized animal
can be increased by selection of anti-peptide antibodies, for
instance, by adsorption to the peptide on a solid support and
elution of the selected antibodies according to methods well known
in the art.
[0174] Immunogenic epitope-bearing peptides of the invention, i.e.,
those parts of a protein that elicit an antibody response when the
whole protein is the immunogen, are identified according to methods
known in the art. For instance, Geysen et al, supra, discloses a
procedure for rapid concurrent synthesis on solid supports of
hundreds of peptides of sufficient purity to react in an
enzyme-linked immunosorbent assay. Interaction of synthesized
peptides with antibodies is then easily detected without removing
them from the support. In this manner a peptide bearing an
immunogenic epitope of a desired protein can be identified
routinely by one of ordinary skill in the art. For instance, the
immunologically important epitope in the coat protein of
foot-and-mouth disease virus was located by Geysen et al. with a
resolution of seven amino acids by synthesis of an overlapping set
of all 208 possible hexapeptides covering the entire 213 amino acid
sequence of the protein. Then, a complete replacement set of
peptides in which all 20 amino acids were substituted in turn at
every position within the epitope were synthesized, and the
particular amino acids conferring specificity for the reaction with
antibody were determined. Thus, peptide analogs of the
epitope-bearing peptides of the invention can be made routinely by
this method. U.S. Pat. No. 4,708,781 to Geysen (1987) further
describes this method of identifying a peptide bearing an
immunogenic epitope of a desired protein.
[0175] Further still, U.S. Pat. No. 5,194,392 to Geysen (1990)
describes a general method of detecting or determining the sequence
of monomers (amino acids or other compounds) which is a topological
equivalent of the epitope (i.e., a "mimotope") which is
complementary to a particular paratope (antigen binding site) of an
antibody of interest. More generally, U.S. Pat. No. 4,433,092 to
Geysen (1989) describes a method of detecting or determining a
sequence of monomers which is a topographical equivalent of a
ligand which is complementary to the ligand binding site of a
particular receptor of interest. Similarly, U.S. Pat. No. 5,480,971
to Houghten, R. A. et al. (1996) on Peralkylated Oligopeptide
Mixtures discloses linear C.sub.1-C.sub.7-alkyl peralkylated
oligopeptides and sets and libraries of such peptides, as well as
methods for using such oligopeptide sets and libraries for
determining the sequence of a peralkylated oligopeptide that
preferentially binds to an acceptor molecule of interest. Thus,
non-peptide analogs of the epitope-bearing peptides of the
invention also can be made routinely by these methods.
[0176] The entire disclosure of each document cited in this section
on "Polypeptides and Peptides" is hereby incorporated herein by
reference.
[0177] As one of skill in the art will appreciate, Ck beta-11
and/or LAI-1 polypeptides of the present invention and the
epitope-bearing fragments thereof described above can be combined
with parts of the constant domain of immunoglobulins (IgG),
resulting in chimeric polypeptides. These fusion proteins
facilitate purification and show an increased half-life in vivo.
This has been shown, e.g. for chimeric proteins consisting of the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have a disulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric Ck beta-11
and/or LAI-1 protein or protein fragment alone (Fountoulakis et
al., J Biochem 270:3958-3964 (1995)).
[0178] Polypeptide Purification and Isolation. LAI-1 and/or Ck
beta-11 are recovered and purified from recombinant cell cultures
by methods including ammonium sulfate or ethanol precipitation,
acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography hydroxylapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
mature protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0179] The polypeptides of the present invention can be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention can be glycosylated with mammalian or other eukaryotic
carbohydrates or can be non-glycosylated. Polypeptides of the
invention can also include an initial methionine amino acid
residue.
[0180] Antibodies. Ck beta-11 and/or LAI-1-protein specific
antibodies for use in the present invention can be raised against
the intact Ck beta-11 and/or LAI-1 protein or an antigenic
polypeptide fragment thereof, which can presented together with a
carrier protein, such as an albumin, to an animal system (such as
rabbit or mouse) or, if it is long enough (at least about 25 amino
acids), without a carrier.
[0181] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (Mab) is meant to include intact molecules as well as
antibody fragments (such as, for example, Fab and F(ab').sub.2
fragments) which are capable of specifically binding to Ck beta-11
and/or LAI-1 protein. Fab and F(ab').sub.2 fragments lack the Fc
fragment of intact antibody, clear more rapidly from the
circulation, and can have less non-specific tissue binding of an
intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
Thus, these fragments are preferred.
[0182] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art can be used
for the production of such antibodies and fragments.
[0183] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention or its in vivo receptor can
be obtained by direct injection of the polypeptides into an animal
or by administering the polypeptides to an animal, preferably a
nonhuman. The antibody so obtained will then bind the polypeptides
itself. In this manner, even a sequence encoding only a fragment of
the polypeptides can be used to generate antibodies binding the
whole native polypeptides. Such antibodies can then be used to
isolate the polypeptides from tissue expressing that
polypeptide.
[0184] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0185] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptides products of
this invention.
[0186] The antibodies of the present invention can be prepared by
any of a variety of methods. For example, cells expressing the Ck
beta-11 and/or LAI-1 protein or an antigenic fragment thereof can
be administered to an animal in order to induce the production of
sera containing polyclonal antibodies. In a preferred method, a
preparation of Ck beta-11 and/or LAI-1 protein is prepared and
purified to render it substantially free of natural contaminants.
Such a preparation is then introduced into an animal in order to
produce polyclonal antisera of greater specific activity.
[0187] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or Ck beta-11 and/or LAI-1
protein binding fragments thereof). Such monoclonal antibodies can
be prepared using hybridoma technology (Kohler et al., Nature
256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976);
Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al.,
In: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y.,
(1981) pp. 563-681). In general, such procedures involve immunizing
an animal (preferably a mouse) with an Ck beta-11 and/or LAI-1
protein antigen or, more preferably, with an Ck beta-11 and/or
LAI-1 protein-expressing cell. Suitable cells can be recognized by
their capacity to bind anti-Ck beta-11 and/or LAI-1 protein
antibody. Such cells can be cultured in any suitable tissue culture
medium; however, it is preferable to culture cells in Earle's
modified Eagle's medium supplemented with 10% fetal bovine serum
(inactivated at about 56.degree. C.), and supplemented with about
10 g/l of nonessential amino acids, about 1,000 U/ml of penicillin,
and about 100 g/ml of streptomycin. The splenocytes of such mice
are extracted and fused with a suitable myeloma cell line. Any
suitable myeloma cell line can be employed in accordance with the
present invention; however, it is preferable to employ the parent
myeloma cell line (SP2O), available from the American Type Culture
Collection, Rockville, Md. After fusion, the resulting hybridoma
cells are selectively maintained in HAT medium, and then cloned by
limiting dilution as described by Wands et al. (Gastroenterology
80:225-232 (1981)). The hybridoma cells obtained through such a
selection are then assayed to identify clones which secrete
antibodies capable of binding the Ck beta-11 and/or LAI-1 protein
antigen.
[0188] Alternatively, additional antibodies capable of binding to
the Ck beta-11 and/or LAI-1 protein antigen can be produced in a
two-step procedure through the use of anti-idiotypic antibodies.
Such a method makes use of the fact that antibodies are themselves
antigens, and that, therefore, it is possible to obtain an antibody
which binds to a second antibody. In accordance with this method,
Ck beta-11 and/or LAI-1-protein specific antibodies are used to
immunize an animal, preferably a mouse. The splenocytes of such an
animal are then used to produce hybridoma cells, and the hybridoma
cells are screened to identify clones which produce an antibody
whose ability to bind to the Ck beta-11 and/or LAI-1
protein-specific antibody can be blocked by the Ck beta-11 and/or
LAI-1 protein antigen. Such antibodies comprise anti-idiotypic
antibodies to the Ck beta-11 and/or LAI-1 protein-specific antibody
and can be used to immunize an animal to induce formation of
further Ck beta-11 and/or LAI-1 protein-specific antibodies.
[0189] It will be appreciated that Fab and F(ab').sub.2 and other
fragments of the antibodies of the present invention can be used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce
F(ab').sub.2 fragments). Alternatively, Ck beta-11 and/or LAI-1
protein-binding fragments can be produced through the application
of recombinant DNA technology or through synthetic chemistry.
[0190] It can be preferable to use "humanized" chimeric monoclonal
antibodies. Such antibodies can be produced using genetic
constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric
antibodies are known in the art. See, for review, Morrison, Science
229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et
al., U.S. Pat. No. 4,816,567; Taniguchi et al., EP 171496; Morrison
et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al.,
WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et
al., Nature 314:268 (1985).
[0191] Further suitable labels for the Ck beta-11 and/or LAI-1
protein-specific antibodies of the present invention are provided
below. Examples of suitable enzyme labels include malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase,
yeast-alcohol dehydrogenase, alpha-glycerol phosphate
dehydrogenase, triose phosphate isomerase, peroxidase, alkaline
phosphatase, asparaginase, glucose oxidase, beta-galactosidase,
ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase,
glucoamylase, and acetylcholine esterase.
[0192] Examples of suitable radioisotopic labels include .sup.3H,
.sup.111In, .sup.125I, .sup.131I, .sup.32P, .sup.35S, .sup.14C,
.sup.51Cr, .sup.57To, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu,
.sup.90Y, .sup.67Cu, .sup.217Ci, .sup.211At, .sup.212Pb, .sup.47Sc,
.sup.109Pd, etc. .sup.111In is a preferred isotope where in vivo
imaging is used since its avoids the problem of dehalogenation of
the .sup.125I or .sup.131I-labeled monoclonal antibody by the
liver. In addition, this radionucleotide has a more favorable gamma
emission energy for imaging (Perkins et al., Eur. J. Nucl. Med.
10:296-301 (1985); Carasquillo et al., J. Nucl. Med. 28:281-287
(1987)).
[0193] Examples of suitable non-radioactive isotopic labels include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Tr, and .sup.56Fe.
[0194] Examples of suitable fluorescent labels include an
.sup.152Eu label, a fluorescein label, an isothiocyanate label, a
rhodamine label, a phycoerythrin label, a phycocyanin label, an
allophycocyanin label, an o-phthaldehyde label, and a fluorescamine
label.
[0195] Examples of suitable toxin labels include diphtheria toxin,
ricin, and cholera toxin.
[0196] Examples of chemiluminescent labels include a luminal label,
an isoluminal label, an aromatic acridinium ester label, an
imidazole label, an acridinium salt label, an oxalate ester label,
a luciferin label, a luciferase label, and an aequorin label.
[0197] Examples of nuclear magnetic resonance contrasting agents
include heavy metal nuclei such as Gd, Mn, and iron.
[0198] Typical techniques for binding the above-described labels to
antibodies are provided by Kennedy et al., Clin. Chim. Acta 70:1-31
(1976), and Schurs et al., Clin. Chim. Acta 81:1-40 (1977).
Coupling techniques mentioned in the latter are the glutaraldehyde
method, the periodate method, the dimaleimide method, the
m-maleimidobenzoyl-N-hydroxy-succinimide ester method, all of which
methods are incorporated by reference herein.
[0199] Chromosome Assays. The nucleic acid molecules of the present
invention are also valuable for chromosome identification. The
sequence is specifically targeted to and can hybridize with a
particular location on an individual human chromosome. Moreover,
there is a current need for identifying particular sites on the
chromosome. Few chromosome marking reagents based on actual
sequence data (repeat polymorphisms) are presently available for
marking chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important first step in
correlating those sequences with genes associated with disease.
[0200] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of an Ck beta-11
and/or LAI-1 protein gene. This can be accomplished using a variety
of well known techniques and libraries, which generally are
available commercially. The genomic DNA then is used for in situ
chromosome mapping using well known techniques for this purpose.
Typically, in accordance with routine procedures for chromosome
mapping, some trial and error can be necessary to identify a
genomic probe that gives a good in situ hybridization signal.
[0201] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the cDNA is used to rapidly select primers that do not span more
than one exon in the genomic DNA, thus complicating the
amplification process. These primers are then used for PCR
screening of somatic cell hybrids containing individual human
chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0202] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of portions from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0203] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
probes from the cDNA as short as 50 or 60 bp. For a review of this
technique, see Verma et al., Human Chromosomes: A Manual Of Basic
Techniques, Pergamon Press, New York (1988).
[0204] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance In Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0205] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0206] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. This assumes 1 megabase mapping
resolution and one gene per 20 kb.
[0207] Comparison of affected and unaffected individuals generally
involves first looking for structural alterations in the
chromosomes, such as deletions or translocations that are visible
from chromosome spreads or detectable using PCR based on that cDNA
sequence. Ultimately, complete sequencing of genes from several
individuals is required to confirm the presence of a mutation and
to distinguish mutations from polymorphisms.
[0208] The present invention is further directed to inhibiting
LAI-1 and/or Ck beta-11 in vivo by the use of antisense technology.
Antisense technology can be used to control gene expression through
triple-helix formation or antisense DNA or RNA, both of which
methods are based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide sequence,
which encodes for the polypeptides of the present invention, is
used to design an antisense RNA oligonucleotide of from about 10 to
40 base pairs in length. A DNA oligonucleotide is designed to be
complementary to a region of the gene involved in transcription
(triple helix-see Lee et al., Nucl. Acids Res., 6:3073 (1979);
Cooney et al, Science, 241:456 (1988); and Dervan et al., Science,
251: 1360 (1991)), thereby preventing transcription and the
production of LAI-1 and/or Ck beta-11. The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and blocks
translation of the mRNA molecule into the LAI-1 and/or Ck beta-11
(antisense--Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)).
[0209] Alternatively, the oligonucleotides described above can be
delivered to cells by procedures in the art such that the antisense
RNA or DNA can be expressed in vivo to inhibit production of LAI-1
and/or Ck beta-11 in the manner described above.
[0210] Accordingly, antisense constructs to the LAI-1 and/or Ck
beta-11 can be used to treat disorders which are either Ck beta-11
and/or LAI-1-induced or enhanced, for example, atherosclerosis,
auto-immune, e.g. multiple sclerosis and insulin-dependent
diabetes, and chronic inflammatory and infective diseases,
histamine-mediated allergic reactions, rheumatoid arthritis,
silicosis, sarcoidosis, idiopathic pulmonary fibrosis and other
chronic inflammatory diseases of the lung, idiopathic
hyper-eosinophilic syndrome, endotoxic shock, histamine-mediated
allergic reactions, prostaglandin-independent fever, and aplastic
anemia and other cases of bone marrow failure.
[0211] Antagonists, Agonists, Polypeptides and Methods. This
invention further provides methods for screening compounds to
identify agonists and antagonists to the chemokine polypeptides of
the present invention. An agonist is a compound which has similar
biological functions, or enhances the functions, of the
polypeptides, while antagonists block such functions. Chemotaxis
can be assayed by placing cells, which are chemoattracted by either
of the polypeptides of the present invention, on top of a filter
with pores of sufficient diameter to admit the cells (about 5
.mu.m). Solutions of potential agonists, antagonists or
polypeptides are placed in the bottom of the chamber with an
appropriate control medium in the upper compartment, and thus a
concentration gradient of the agonist, antagonist or polypeptides
is measured by counting cells that migrate into or through the
porous membrane over time.
[0212] Alternatively, a mammalian cell or membrane preparation
expressing the receptors of the polypeptides would be incubated
with a labeled chemokine polypeptide, e.g. radioactivity, in the
presence of the compound. The ability of the compound to block this
interaction could then be measured. When assaying for agonists in
this fashion, the chemokines would be absent and the ability of the
agonist itself to interact with the receptor could be measured.
[0213] Examples of potential LAI-1 and/or Ck beta-11 antagonists
include antibodies, or in some cases, oligonucleotides, which bind
to the polypeptides. Another example of a potential antagonist is a
negative dominant mutant of the polypeptides. Negative dominant
mutants are polypeptides which bind to the receptor of the
wild-type polypeptide, but fail to retain biological activity.
[0214] Antisense constructs prepared using antisense technology are
also potential antagonists. Antisense technology can be used to
control gene expression through triple-helix formation or antisense
DNA or RNA, both of which methods are based on binding of a
polynucleotide to DNA or RNA. For example, the 5' coding portion of
the polynucleotide sequence, which encodes for the mature
polypeptides of the present invention, is used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple-helix, see Lee
et al., Nucl. Acids Res. 6:3073 (1979); Cooney et al, Science
241:456 (1988); and Dervan et al., Science 251:1360 (1991)),
thereby preventing transcription and the production of the
chemokine polypeptides. The antisense RNA oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA
molecule into the polypeptides (antisense--Okano, J. Neurochem.
56:560 (1991); oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, Fla. (1988)). The
oligonucleotides described above can also be delivered to cells
such that the antisense RNA or DNA can be expressed in vivo to
inhibit production of the chemokine polypeptides.
[0215] Another potential chemokine antagonist is a peptide
derivative of the polypeptides which are naturally or synthetically
modified analogs of the polypeptides that have lost biological
function yet still recognize and bind to the receptors of the
polypeptides to thereby effectively block the receptors. Examples
of peptide derivatives include, but are not limited to, small
peptides or peptide-like molecules.
[0216] Another potential human chemokine antagonist is a peptide
derivative of the polypeptides which are naturally or synthetically
modified analogs of the polypeptides that have lost biological
function yet still recognize and bind to the receptors of the
polypeptides to thereby effectively block the receptors. Examples
of peptide derivatives include, but are not limited to, small
peptides or peptide-like molecules.
[0217] The antagonists may be employed to inhibit the chemotaxis
and activation of macrophages and their precursors, and of
neutrophils, basophils, B lymphocytes and some T cell subsets,
e.g., activated and CD8 cytotoxic T cells and natural killer cells,
in certain auto-immune and chronic inflammatory and infective
diseases. Examples of auto-immune diseases include multiple
sclerosis, and insulin-dependent diabetes.
[0218] The antagonists may also be employed to treat infectious
diseases including silicosis, sarcoidosis, idiopathic pulmonary
fibrosis by preventing the recruitment and activation of
mononuclear phagocytes. They may also be employed to treat
idiopathic hyper-eosinophilic syndrome by preventing eosinophil
production and migration. Endotoxic shock may also be treated by
the antagonists by preventing the migration of macrophages and
their production of the human chemokine polypeptides of the present
invention.
[0219] The antagonists may also be employed for treating
atherosclerosis, by preventing monocyte infiltration in the artery
wall.
[0220] The antagonists may also be employed to treat
histamine-mediated allergic reactions and immunological disorders
including late phase allergic reactions, chronic urticaria, and
atopic dermatitis by inhibiting chemokine-induced mast cell and
basophil degranulation and release of histamine. IgE-mediated
allergic reactions such as allergic asthma, rhinitis, and eczema
may also be treated.
[0221] The antagonists may also be employed to treat chronic and
acute inflammation by preventing the attraction of monocytes to a
wound area. They may also be employed to regulate normal pulmonary
macrophage populations, since chronic and acute inflammatory
pulmonary diseases are associated with sequestration of mononuclear
phagocytes in the lung.
[0222] Antagonists may also be employed to treat rheumatoid
arthritis by preventing the attraction of monocytes into synovial
fluid in the joints of patients. Monocyte influx and activation
plays a significant role in the pathogenesis of both degenerative
and inflammatory arthropathies.
[0223] The antagonists may be employed to interfere with the
deleterious cascades attributed primarily to IL-1 and TNF, which
prevents the biosynthesis of other inflammatory cytokines. In this
way, the antagonists may be employed to prevent inflammation. The
antagonists may also be employed to inhibit
prostaglandin-independent fever induced by chemokines.
[0224] The antagonists may also be employed to treat cases of bone
marrow failure, for example, aplastic anemia and myelodysplastic
syndrome.
[0225] The antagonists may also be employed to treat asthma and
allergy by preventing eosinophil accumulation in the lung. The
antagonists may also be employed to treat subepithelial basement
membrane fibrosis which is a prominent feature of the asthmatic
lung.
[0226] The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0227] The antagonists can be employed to treat disorders which are
either Ck beta-11 and/or LAI-1-induced or enhanced, for example,
auto-immune and chronic inflammatory and infectious diseases.
Examples of auto-immune diseases include multiple sclerosis, and
insulin-dependent diabetes.
[0228] The antagonists can also be employed to treat infectious
diseases including silicosis, sarcoidosis, idiopathic pulmonary
fibrosis by preventing the recruitment and activation of
mononuclear phagocytes. They can also be employed to treat
idiopathic hyper-eosinophilic syndrome by preventing eosinophil
production and migration. Endotoxic shock can also be treated by
the antagonists by preventing the migration of macrophages and
their production of the chemokine polypeptides of the present
invention.
[0229] The antagonists can also be employed for treating
atherosclerosis, by preventing monocyte infiltration in the artery
wall.
[0230] The antagonists can also be employed to treat histamine
mediated allergic reactions and immunological disorders including
late phase allergic reactions, chronic urticaria, and atopic
dermatitis by inhibiting chemokine-induced mast cell and basophil
degranulation and release of histamine. IgE-mediated allergic
reactions such as allergic asthma, rhinitis, and eczema can also be
treated.
[0231] The antagonists can also be employed to treat chronic and
acute inflammation by preventing the attraction of monocytes to a
wound area. They can also be employed to regulate normal pulmonary
macrophage populations, since chronic and acute inflammatory
pulmonary diseases are associated with sequestration of mononuclear
phagocytes in the lung.
[0232] Antagonists can also be employed to treat rheumatoid
arthritis by preventing the attraction of monocytes into synovial
fluid in the joints of patients. Monocyte influx and activation
plays a significant role in the pathogenesis of both degenerative
and inflammatory arthropathies.
[0233] The antagonists, agonists or polypeptides can be employed to
interfere with the deleterious cascades attributed primarily to
IL-1 and TNF, which prevents the biosynthesis of other inflammatory
cytokines. In this way, the antagonists, agonists or polypeptides
can be employed to prevent inflammation. The antagonists can also
be employed to inhibit prostaglandin-independent fever induced by
chemokines.
[0234] The antagonists can also be employed to treat cases of bone
marrow failure, for example, aplastic anemia and myelodysplastic
syndrome.
[0235] The antagonists can also be employed to treat asthma and
allergy by preventing eosinophil accumulation in the lung. The
antagonists can also be employed to treat subepithelial basement
membrane fibrosis which is a prominent feature of the asthmatic
lung.
[0236] Agonists. LAI-1 and Ck beta-11 agonists include any small
molecule that has an activity similar to any one or more of these
polypeptides, as described herein. For example, Ck beta-11 agonists
can be used to enhance Ck beta-11 activity. For example, to enhance
Ck beta-11 induced myeloprotection in patients undergoing
chemotherapy or bone marrow transplantation. As another example,
LAI-1 agonists can provide one or more of antiinflammatory
activity, anti-TNF.alpha. activity, anti-cancer activity,
antiangiogenic activity, and the like, as described herein for
various functional activities of LAI-1.
[0237] Disease Diagnosis and Prognosis. Certain diseases or
disorders, as discussed below, can be associated with enhanced
levels of the Ck beta-11 and/or LAI-1 protein and mRNA encoding the
Ck beta-11 and/or LAI-1 protein when compared to a corresponding
"standard" mammal, i.e., a mammal of the same species not having
the disease or disorder. Further, it is believed that enhanced
levels of the Ck beta-11 and/or LAI-1 protein can be detected in
certain body fluids (e.g. sera, plasma, urine, and spinal fluid)
from mammals with a disease or disorder when compared to sera from
mammals of the same species not having the disease or disorder.
Thus, the invention provides a diagnostic method, which involves
assaying the expression level of the gene encoding the Ck beta-11
and/or LAI-1 protein in mammalian cells or body fluid and comparing
the gene expression level with a standard Ck beta-11 and/or LAI-1
gene expression level, whereby an increase in the gene expression
level over the standard is indicative of certain diseases or
disorders.
[0238] Where a disease or disorder diagnosis has already been made
according to conventional methods, the present invention is useful
as a prognostic indicator, whereby patients exhibiting enhanced Ck
beta-11 and/or LAI-1 gene expression will experience a worse
clinical outcome relative to patients expressing the gene at a
lower level.
[0239] By "assaying the expression level of the gene encoding the
Ck beta-11 and/or LAI-1 protein" is intended qualitatively or
quantitatively measuring or estimating the level of the Ck beta-11
and/or LAI-1 protein or the level of the mRNA encoding the Ck
beta-11 and/or LAI-1 protein in a first biological sample either
directly (e.g. by determining or estimating absolute protein level
or mRNA level) or relatively (e.g. by comparing to the Ck beta-11
and/or LAI-1 protein level or mRNA level in a second biological
sample).
[0240] Preferably, the Ck beta-11 and/or LAI-1 protein level or
mRNA level in the first biological sample is measured or estimated
and compared to a standard Ck beta-11 and/or LAI-1 protein level or
mRNA level, the standard being taken from a second biological
sample obtained from an individual not having the disease or
disorder. As will be appreciated in the art, once a standard Ck
beta-11 and/or LAI-1 protein level or mRNA level is known, it can
be used repeatedly as a standard for comparison.
[0241] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source which contains Ck beta-11 and/or LAI-1 protein or mRNA.
Biological samples include mammalian body fluids (such as sera,
plasma, urine, synovial fluid and spinal fluid) which contain
secreted mature Ck beta-11 and/or LAI-1 protein, and ovarian,
prostate, heart, placenta, pancreas, ascites, muscle, skin,
glandular, kidney, liver, spleen, lung, bone, bone marrow, ocular,
peripheral nervous, central nervous, breast and umbilical tissue.
Methods for obtaining tissue biopsies and body fluids from mammals
are well known in the art. Where the biological sample is to
include mRNA, a tissue biopsy is the preferred source.
[0242] The present invention is useful for detecting disease in
mammals. In particular the invention is useful during useful for
diagnosis or treatment of various immune system-related disorders
in mammals, preferably humans. Such disorders include tumors,
cancers, and any disregulation of immune cell function including,
but not limited to, autoimmunity, arthritis, leukemias, lymphomas,
immunosuppression, sepsis, wound healing, acute and chronic
infection, cell mediated immunity, humoral immunity, inflammatory
bowel disease, myelosuppression, and the like. Preferred mammals
include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and
humans. Particularly preferred are humans.
[0243] Total cellular RNA can be isolated from a biological sample
using any suitable technique such as the single-step
guanidinium-thiocyanate-phenol-chloroform method described in
Chomczynski and Sacchi, Anal Biochem. 162:156-159 (1987). Levels of
mRNA encoding the Ck beta-11 and/or LAI-1 protein are then assayed
using any appropriate method. These include Northern blot analysis,
S1 nuclease mapping, the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR), and reverse transcription in combination with the ligase
chain reaction (RT-LCR).
[0244] Northern blot analysis can be performed as described in
Harada et al., Cell 63:303-312 (1990). Briefly, total RNA is
prepared from a biological sample as described above. For the
Northern blot, the RNA is denatured in an appropriate buffer (such
as glyoxal/dimethyl sulfoxide/sodium phosphate buffer), subjected
to agarose gel electrophoresis, and transferred onto a
nitrocellulose filter. After the RNAs have been linked to the
filter by a UV linker, the filter is prehybridized in a solution
containing formamide, SSC, Denhardt's solution, denatured salmon
sperm, SDS, and sodium phosphate buffer. Ck beta-11 and/or LAI-1
protein cDNA labeled according to any appropriate method (such as
the .sup.32P-multiprimed DNA labeling system (Amersham)) is used as
probe. After hybridization overnight, the filter is washed and
exposed to x-ray film. cDNA for use as probe according to the
present invention is described in the sections above and will
preferably at least 15 bp in length.
[0245] S1 mapping can be performed as described in Fujita et al.,
Cell 49:357-367 (1987). To prepare probe DNA for use in S1 mapping,
the sense strand of above-described cDNA is used as a template to
synthesize labeled antisense DNA. The antisense DNA can then be
digested using an appropriate restriction endonuclease to generate
further DNA probes of a desired length. Such antisense probes are
useful for visualizing protected bands corresponding to the target
mRNA (i.e., mRNA encoding the Ck beta-11 and/or LAI-1 protein).
Northern blot analysis can be performed as described above.
[0246] Preferably, levels of mRNA encoding the Ck beta-11 and/or
LAI-1 protein are assayed using the RT-PCR method described in
Makino et al., Technique 2:295-301 (1990). By this method, the
radioactivities of the "amplicons" in the polyacrylamide gel bands
are linearly related to the initial concentration of the target
mRNA. Briefly, this method involves adding total RNA isolated from
a biological sample in a reaction mixture containing a RT primer
and appropriate buffer. After incubating for primer annealing, the
mixture can be supplemented with a RT buffer, dNTPs, DTT, RNase
inhibitor and reverse transcriptase. After incubation to achieve
reverse transcription of the RNA, the RT products are then subject
to PCR using labeled primers. Alternatively, rather than labeling
the primers, a labeled dNTP can be included in the PCR reaction
mixture. PCR amplification can be performed in a DNA thermal cycler
according to conventional techniques. After a suitable number of
rounds to achieve amplification, the PCR reaction mixture is
electrophoresed on a polyacrylamide gel. After drying the gel, the
radioactivity of the appropriate bands (corresponding to the mRNA
encoding the Ck beta-11 and/or LAI-1 protein)) is quantified using
an imaging analyzer. RT and PCR reaction ingredients and
conditions, reagent and gel concentrations, and labeling methods
are well known in the art. Variations on the RT-PCR method will be
apparent to the skilled artisan.
[0247] Any set of oligonucleotide primers which will amplify
reverse transcribed target mRNA can be used and can be designed as
described in the sections above.
[0248] Assaying Ck beta-11 and/or LAI-1 protein levels in a
biological sample can occur using any art-known method. Preferred
for assaying Ck beta-11 and/or LAI-1 protein levels in a biological
sample are antibody-based techniques. For example, Ck beta-11
and/or LAI-1 protein expression in tissues can be studied with
classical immunohistological methods. In these, the specific
recognition is provided by the primary antibody (polyclonal or
monoclonal) but the secondary detection system can utilize
fluorescent, enzyme, or other conjugated secondary antibodies. As a
result, an immunohistological staining of tissue section for
pathological examination is obtained. Tissues can also be
extracted, e.g. with urea and neutral detergent, for the liberation
of Ck beta-11 and/or LAI-1 protein for Western-blot or dot/slot
assay (Jalkanen, M., et al., J. Cell. Biol. 101:976-985 (1985);
Jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987)). In this
technique, which is based on the use of cationic solid phases,
quantitation of Ck beta-11 and/or LAI-1 protein can be accomplished
using isolated Ck beta-11 and/or LAI-1 protein as a standard. This
technique can also be applied to body fluids. With these samples, a
molar concentration of Ck beta-11 and/or LAI-1 protein will aid to
set standard values of Ck beta-11 and/or LAI-1 protein content for
different body fluids, like serum, plasma, urine, spinal fluid,
etc. The normal appearance of Ck beta-11 and/or LAI-1 protein
amounts can then be set using values from healthy individuals,
which can be compared to those obtained from a test subject.
[0249] Other antibody-based methods useful for detecting Ck beta-11
and/or LAI-1 protein gene expression include immunoassays, such as
the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). For example, an Ck beta-11 and/or LAI-1
protein-specific monoclonal antibodies can be used both as an
immunoabsorbent and as an enzyme-labeled probe to detect and
quantify the Ck beta-11 and/or LAI-1 protein. The amount of Ck
beta-11 and/or LAI-1 protein present in the sample can be
calculated by reference to the amount present in a standard
preparation using a linear regression computer algorithm. In
another ELISA assay, two distinct specific monoclonal antibodies
can be used to detect Ck beta-11 and/or LAI-1 protein in a body
fluid. In this assay, one of the antibodies is used as the
immunoabsorbent and the other as the enzyme-labeled probe.
[0250] The above techniques can be conducted essentially as a
"one-step" or "two-step" assay. The "one-step" assay involves
contacting Ck beta-11 and/or LAI-1 protein with immobilized
antibody and, without washing, contacting the mixture with the
labeled antibody. The "two-step" assay involves washing before
contacting the mixture with the labeled antibody. Other
conventional methods can also be employed as suitable. It is
usually desirable to immobilize one component of the assay system
on a support, thereby allowing other components of the system to be
brought into contact with the component and readily removed from
the sample.
[0251] Suitable enzyme labels include, for example, those from the
oxidase group, which catalyze the production of hydrogen peroxide
by reacting with substrate. Glucose oxidase is particularly
preferred as it has good stability and its substrate (glucose) is
readily available. Activity of an oxidase label can be assayed by
measuring the concentration of hydrogen peroxide formed by the
enzyme-labeled antibody/substrate reaction. Besides enzymes, other
suitable labels include radioisotopes, such as iodine (.sup.125I,
.sup.121I), carbon (.sup.14C), sulphur (.sup.35S), tritium
(.sup.3H), indium (.sup.112In), and technetium (.sup.99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0252] The polypeptides of the present invention, and
polynucleotides encoding such polypeptides, can be employed as
research reagents for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, and for
the purpose of developing therapeutics and diagnostics for the
treatment of human disease. For example, LAI-1 and Ck beta-11 can
be employed for the expansion of immature hematopoietic progenitor
cells, for example, granulocytes, macrophages or monocytes, by
temporarily preventing their differentiation. These bone marrow
cells can be cultured in vitro.
[0253] Fragments of the full length LAI-1 and/or Ck beta-11 genes
can be used as a hybridization probe for a cDNA library to isolate
the full length gene and to isolate other genes which have a high
sequence similarity to the gene or similar biological activity.
Preferably, however, the probes have at least 30 bases and can
contain, for example, 50 or more bases. The probe can also be used
to identify a cDNA clone corresponding to a full length transcript
and a genomic clone or clones that contain the complete genes
including regulatory and promoter regions, exons, and introns. An
example of a screen comprises isolating the coding region of the
genes by using the known DNA sequence to synthesize an
oligonucleotide probe. Labeled oligonucleotides having a sequence
complementary to that of the genes of the present invention are
used to screen a library of human cDNA, genomic DNA or mRNA to
determine which members of the library the probe hybridizes to.
[0254] This invention is also related to the use of the LAI-1
and/or Ck beta-11 gene as part of a diagnostic assay for detecting
diseases or susceptibility to diseases related to the presence of
mutations in the nucleic acid sequences. Such diseases are related
to under-expression of the chemokine polypeptides.
[0255] Individuals carrying mutations in the LAI-1 and/or Ck
beta-11 can be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis can be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA can be used directly for
detection or can be amplified enzymatically by using PCR (Saiki et
al., Nature 324:163-166 (1986)) prior to analysis. RNA or cDNA can
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding LAI-1 and/or Ck beta-11
can be used to identify and analyze LAI-1 and/or Ck beta-11
mutations. For example, deletions and insertions can be detected by
a change in size of the amplified product in comparison to the
normal genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled LAI-1 and/or Ck beta-11 RNA or
alternatively, radiolabeled LAI-1 and/or Ck beta-11 antisense DNA
sequences. Perfectly matched sequences can be distinguished from
mismatched duplexes by RNase A digestion or by differences in
melting temperatures.
[0256] Genetic testing based on DNA sequence differences can be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences can be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g. Myers
et al., Science 230:1242 (1985)).
[0257] Sequence changes at specific locations can also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g. Cotton et al., PNAS, USA
85:4397-4401 (1985)).
[0258] Thus, the detection of a specific DNA sequence can be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g. Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0259] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0260] The present invention also relates to a diagnostic assay for
detecting altered levels of LAI-1 and/or Ck beta-11 protein in
various tissues since an over-expression of the proteins compared
to normal control tissue samples can detect the presence of a
disease or susceptibility to a disease, for example, a tumor.
Assays used to detect levels of LAI-1 and/or Ck beta-11 protein in
a sample derived from a host are well-known to those of skill in
the art and include radioimmunoassays, competitive-binding assays,
Western Blot analysis, ELISA assays and "sandwich" assay. An ELISA
assay (Coligan, et al., Current Protocols in Immunology 1(2),
Chapter 6, (1991)) initially comprises preparing an antibody
specific to the Ck beta-11 and LAI-1 antigens, preferably a
monoclonal antibody. In addition a reporter antibody is prepared
against the monoclonal antibody. To the reporter antibody is
attached a detectable reagent such as radioactivity, fluorescence
or, in this example, a horseradish peroxidase enzyme. A sample is
removed from a host and incubated on a solid support, e.g. a
polystyrene dish, that binds the proteins in the sample. Any free
protein binding sites on the dish are then covered by incubating
with a non-specific protein like BSA. Next, the monoclonal antibody
is incubated in the dish during which time the monoclonal
antibodies attach to any LAI-1 and/or Ck beta-11 proteins attached
to the polystyrene dish. All unbound monoclonal antibody is washed
out with buffer. The reporter antibody linked to horseradish
peroxidase is now placed in the dish resulting in binding of the
reporter antibody to any monoclonal antibody bound to LAI-1 and/or
Ck beta-11. Unattached reporter antibody is then washed out.
Peroxidase substrates are then added to the dish and the amount of
color developed in a given time period is a measurement of the
amount of LAI-1 and/or Ck beta-11 protein present in a given volume
of patient sample when compared against a standard curve.
[0261] A competition assay can be employed wherein antibodies
specific to LAI-1 and/or Ck beta-11 are attached to a solid support
and labeled Ck beta-11, MIP-4 and LAI-1 and a sample derived from
the host are passed over the solid support and the amount of label
detected, for example by liquid scintillation chromatography, can
be correlated to a quantity of protein in the sample.
[0262] A "sandwich" assay is similar to an ELISA assay. In a
"sandwich" assay LAI-1 and/or Ck beta-11 is passed over a solid
support and binds to antibody attached to a solid support. A second
antibody is then bound to the LAI-1 and/or Ck beta-11. A third
antibody which is labeled and specific to the second antibody is
then passed over the solid support and binds to the second antibody
and an amount can then be quantified.
[0263] This invention provides a method for identification of the
receptors for the chemokine polypeptides. The gene encoding the
receptor can be identified by numerous methods known to those of
skill in the art, for example, ligand panning and FACS sorting
(Coligan, et al., Current Protocols in Immun. 1(2), Chapter 5,
(1991)). Preferably, expression cloning is employed wherein
polyadenylated RNA is prepared from a cell responsive to the
polypeptides, and a cDNA library created from this RNA is divided
into pools and used to transfect COS cells or other cells that are
not responsive to the polypeptides. Transfected cells which are
grown on glass slides are exposed to the labeled polypeptides. The
polypeptides can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-specific
protein kinase. Following fixation and incubation, the slides are
subjected to autoradiographic analysis. Positive pools are
identified and sub-pools are prepared and retransfected using an
iterative sub-pooling and rescreening process, eventually yielding
a single clones that encodes the putative receptor.
[0264] As an alternative approach for receptor identification, the
labeled polypeptides can be photoaffinity linked with cell membrane
or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE analysis and exposed to
X-ray film. The labeled complex containing the receptors of the
polypeptides can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing would be used to design a set of
degenerate oligonucleotide probes to screen a cDNA library to
identify the genes encoding the putative receptors.
[0265] Therapeutics. Polypeptides of the present invention can be
used in a variety of immunoregulatory and inflammatory functions
and also in a number of disease conditions. LAI-1 and/or Ck beta-11
are in the chemokine family and therefore they are a
chemo-attractant for leukocytes (such as monocytes, neutrophils, T
lymphocytes, eosinophils, basophils, etc.).
[0266] Northern Blot analyses show that LAI-1 and/or Ck beta-11 are
expressed predominantly is tissues of hemopoietic origin.
[0267] The human chemokine polypeptides may be employed to inhibit
bone marrow stem cell colony formation as adjunct protective
treatment during cancer chemotherapy and for leukemia.
[0268] The human chemokine polypeptides may also be employed to
inhibit epidermal keratinocyte proliferation for treatment of
psoriasis, which is characterized by keratinocyte
hyper-proliferation.
[0269] The human chemokine polypeptides may also be employed to
treat solid tumors by stimulating the invasion and activation of
host defense cells, e.g., cytotoxic T cells and macrophages and by
inhibiting the angiogenesis of tumors. They may also be employed to
enhance host defenses against resistant chronic and acute
infections, for example, mycobacterial infections via the
attraction and activation of microbicidal leukocytes.
[0270] The human chemokine polypeptides may also be employed to
inhibit T cell proliferation by the inhibition of IL-2 biosynthesis
for the treatment of T-cell mediated auto-immune diseases and
lymphocytic leukemias.
[0271] They may also be employed to regulate hematopoiesis, by
regulating the activation and differentiation of various
hematopoietic progenitor cells, for example, to release mature
leukocytes from the bone marrow following chemotherapy.
[0272] Ck beta-11 Therapeutic/Diagnostic Applications. Ck beta-11
is shown to play an important role in the regulation of the immune
response and inflammation. Accordingly, administration of Ck
beta-11 is employed to stimulate or regulate the immune response of
a host. Ck beta-11 could be used as an anti-inflammatory agent.
[0273] As illustrated in FIG. 3 and Example 8, there is some
chemoattractant activity attributable to Ck beta-11.
[0274] Further, the polypeptides of the present invention can be
useful in anti-tumor therapy since there is evidence that chemokine
expressing cells injected into tumors have caused regression of the
tumor, for example, in the treatment of Karposi sarcoma. Ck beta-11
can induce cells to secrete TNF-.alpha., which is a known agent for
regressing tumors, in which case this protein could be used to
induce tumor regression. Ck beta-11 can also induce human monocytes
to secrete other tumor and cancer inhibiting agents such as IL-6,
IL-1 and G-CSF. Also, LAI-1 and/or Ck beta-11 stimulate the
invasion and activation of host defense (tumoricidal) cells, e.g.
cytotoxic T-cells and macrophages via their chemotactic activity,
and in this way can also be used to treat solid tumors.
[0275] The polypeptides can also be employed to inhibit the
proliferation and differentiation of hematopoietic cells and
therefore can be employed to protect bone marrow stem cells from
chemotherapeutic agents during chemotherapy.
[0276] The inhibitory effect of the LAI-1 and Ck beta-11
polypeptides on the subpopulation of committed progenitor cells,
(for example granulocyte, and macrophage/monocyte cells) can be
employed therapeutically to inhibit proliferation of leukemic
cells.
[0277] The pharmaceutical compositions of the present invention are
also useful in the treatment of leukemia, which causes a
hyperproliferative myeloid cell state. Thus, the invention further
provides methods for treating leukemia, which involve administering
to a leukemia patient an effective amount of Ck beta-11 either
alone or together with one or more chemokines selected from the
group consisting of MIP-1.alpha., MIP-2.alpha., PF4, IL-8, MCAF,
and MRP-2.
[0278] Certain chemokines, such as MIP-1.beta., MIP-2.beta. and
GRO-.alpha., inhibit (at least partially block) the myeloid
suppressive affects of the myelosuppressive compositions of the
present invention. Thus, in a further embodiment, the invention
provides methods for inhibiting myelosuppression, which involves
administering an effective amount of a myelosuppressive inhibitor
selected from the group consisting of MIP-1.beta., MIP-2.beta. and
GRO-.alpha. to a mammal previously exposed to the myelosuppressive
agent Ck beta-11 either alone or together with one or more of
MIP-1.alpha., MIP-2.alpha., PF4, IL-8, MCAF, and MRP-2.
[0279] One of ordinary skill will appreciate that effective amounts
of the Ck beta-11 polypeptides for treating an individual in need
of an increased level of Ck beta-11 activity (including amounts of
Ck beta-11 polypeptides effective for myelosuppression with or
without myelosuppressive agents or myelosuppressive inhibitors) can
be determined empirically for each condition where administration
of Ck beta-11 is indicated. The polypeptide having Ck beta-11
activity my be administered in pharmaceutical compositions in
combination with one or more pharmaceutically acceptable
excipients.
[0280] Ck beta-11 can also be employed to treat leukemia and
abnormally proliferating cells, for example tumor cells, by
inducing apoptosis. Ck beta-11 induces apoptosis in a population of
hematopoietic progenitor cells.
[0281] In addition, since Ck beta-11 has effects on T-lymphocytes
as well as macrophages, Ck beta-11 can enhance the capacity of
antigen presenting cells (APCs) to take up virus, bacteria or other
foreign substances, process them and present them to the
lymphocytes responsible for immune responses. Ck beta-11 can also
modulate the interaction of APCs with T-lymphocytes and
B-lymphocytes. Ck beta-11 can provide a costimulatory signal during
antigen presentation which directs the responding cell to survive,
proliferate, differentiate, secrete additional cytokines or soluble
mediators, or selectively removes the responding cell by inducing
apoptosis or other mechanisms of cell death. Since APCs have been
shown to facilitate the transfer of HIV to CD4+ T-lymphocytes, Ck
beta-11 can also influence this ability and prevent infection of
lymphocytes by HIV or other viruses mediated through APCs. This is
also true for the initial infection of APCs, T-lymphocytes or other
cell types by HIV, EBV, or any other such viruses.
[0282] In addition, recent demonstration that the MIP-1a receptor
serves as a cofactor in facilitating the entry of HIV into human
monocytes and T-lymphocytes raises an interesting possibility that
Ck beta-11 or its variants might interfere with the process of HIV
entry into the cells. Thus, Ck beta-11 can be useful as an
antiviral agent for viruses and retroviruses whose entry is
facilitated by the MIP-1a receptor.
[0283] Ck beta-11 can act as an immune enhancement factor by
stimulating the intrinsic activity of T-lymphocytes to fight
bacterial and viral infection as well as other foreign bodies. Such
activities are useful for the normal response to foreign antigens
such as infection of allergies as well as immunoresponses to
neoplastic or benign growth including both solid tumors and
leukemias.
[0284] For these reasons the present invention is useful for
diagnosis or treatment of various immune system-related disorders
in mammals, preferably humans. Such disorders include tumors,
cancers, and any disregulation of immune cell function including,
but not limited to, autoimmunity, arthritis, leukemias, lymphomas,
immunosuppression, sepsis, wound healing, acute and chronic
infection, cell mediated immunity, humoral immunity, inflammatory
bowel disease, myelosuppression, and the like.
[0285] LAI-1 Therapeutic/Diagnostic Applications. LAI-1 activity is
useful for immune enhancement or suppression, myeloprotection, stem
cell mobilization, acute and chronic inflammatory control and
treatment of leukemia. In addition, since LAI-1 has effects on
T-lymphocytes as well as macrophages, LAI-1 enhances the capacity
of antigen presenting cells (APCs) to take up virus, bacteria or
other foreign substances, process them and present them to the
lymphocytes responsible for immune responses. In addition, LAI-1
also modulates the interaction of APCs with T-lymphocytes and
B-lymphocytes. For instance, LAI-1 provides a costimulation signal
during antigen presentation which directs the responding cell to
survive, proliferate, differentiate, secrete additional cytokines
or soluble mediators, or selectively removes the responding cell by
inducing apoptosis or other mechanisms of cell death. Since APCs
have been shown to facilitate the transfer of HIV to CD4+
T-lymphocytes LAI-1 also influences this ability and prevents
infection of lymphocytes by HIV or other viruses mediated through
APCs. This is also true for the initial infection of APCs,
T-lymphocytes or other cell types by HIV, EBV, or any other such
viruses.
[0286] In addition, since LAI-1 directly effects T-lymphocytes in
vivo, LAI-1 acts as an immune enhancement factor by stimulating the
intrinsic activity of T-lymphocytes to fight bacterial and viral
infection as well as other foreign bodies. Such activities are
useful for the normal response to foreign antigens such as
infection of allergies as well as immunoresponses to neoplastic or
benign growth including both solid tumors and leukemias.
[0287] For these reasons the present invention is useful for
diagnosis or treatment of various immune system-related disorders
in mammals, preferably humans. Such disorders include tumors,
cancers, and any disregulation of immune cell function including,
but not limited to, autoimmunity, arthritis, asthma, leukemias,
lymphomas, immunosuppression, sepsis, wound healing, acute and
chronic infection, cell mediated immunity, humoral immunity,
inflammatory bowel disease, myelosuppression, and the like.
[0288] LAI-1, as an antiinflammatory, can treat such disorders as,
but not limited to, those involving abnormal production of
TNF.alpha.. Such disorders include, but are not limited to, sepsis
syndrome, including cachexia, circulatory collapse and shock
resulting from acute or chronic bacterial infection, acute and
chronic parasitic or infectious processes, including bacterial,
viral and fungal infections, acute and chronic immune and
autoimmune pathologies, such as systemic lupus erythematosus and
rheumatoid arthritis, alcohol-induced hepatitis, chronic
inflammatory pathologies such as sarcoidosis and Crohn's pathology,
vascular inflammatory pathologies such as disseminated
intravascular coagulation, graft-versus-host pathology, Kawasaki's
pathology; malignant pathologies involving TNF-secreting tumors and
neurodegenerative diseases.
[0289] Neurodegenerative diseases include, but are not limited to,
AIDS dementia complex, demyelinating diseases, such as multiple
sclerosis and acute transverse myelitis; extrapyramidal and
cerebellar disorders' such as lesions of the corticospinal system;
disorders of the basal ganglia or cerebellar disorders;
hyperkinetic movement disorders such as Huntington's Chorea and
senile chorea; drug-induced movement disorders, such as those
induced by drugs which block CNS dopamine receptors; hypokinetic
movement disorders, such as Parkinson's disease; Progressive
supranucleo Palsy; structural lesions of the cerebellum;
spinocerebellar degenerations, such as spinal ataxia, Friedreich's
ataxia, cerebellar cortical degenerations, multiple systems
degenerations (Mencel, Dejerine-Thomas, Shi-Drager, and
Machado-Joseph); systemic disorders (Refsum's disease,
abetalipoprotemia, ataxia, telangiectasia, and mitochondrial
multi-system disorder); demyelinating core disorders, such as
multiple sclerosis, acute transverse myelitis; and disorders of the
motor unit such as neurogenic muscular atrophies (anterior horn
cell degeneration, such as amyotrophic lateral sclerosis, infantile
spinal muscular atrophy and juvenile spinal muscular atrophy);
Alzheimer's disease; Down's Syndrome in middle age; Diffuse Lewy
body disease; Senile Dementia of Lewy body type; Wernicke-Korsakoff
syndrome; chronic alcoholism; Creutzfeldt-Jakob disease; Subacute
sclerosing panencephalitis Hallerrorden-Spatz disease; and Dementia
pugilistica. One preferred neurodegenerative disease is multiple
sclerosis.
[0290] See, e.g., Berkow et al, eds., The Merck Manual, 16th
edition, Merck and Co., Rahway, N.J., 1992, which reference, and
references cited therein, are entirely incorporated herein by
reference.
[0291] Accordingly, LAI-1 and/or Ck beta-11 can be used to
facilitate wound healing by controlling infiltration of target
immune cells to the wound area. In a similar fashion, the
polypeptides of the present invention can enhance host defenses
against chronic infections, e.g. mycobacterial, via the attraction
and activation of microbicidal leukocytes.
[0292] The polypeptides of the present invention, and
polynucleotides encoding such polypeptides, can be employed as
research reagents for in vitro purposes related to scientific
research, synthesis of DNA and manufacture of DNA vectors, and for
the purpose of developing therapeutics and diagnostics for the
treatment of human disease. For example, LAI-1 and Ck beta-11 can
be employed for the expansion of immature hematopoietic progenitor
cells, for example, granulocytes, macrophages or monocytes, by
temporarily preventing their differentiation. These bone marrow
cells can be cultured in vitro.
[0293] Another use of the polypeptides is the inhibition of T-cell
proliferation via inhibition of IL-2 biosynthesis, for example, in
auto-immune diseases and lymphocytic leukemia.
[0294] LAI-1 and/or Ck beta-11 can also be useful for inhibiting
epidermal keratinocyte proliferation which has utility in psoriasis
(keratinocyte hyper-proliferation) since Langerhans cells in skin
have been found to produce MIP-1.alpha..
[0295] LAI-1 and/or Ck beta-11 can be used to prevent scarring
during wound healing both via the recruitment of debris-cleaning
and connective tissue-promoting inflammatory cells and by its
control of excessive TGF.beta.-mediated fibrosis, in addition these
polypeptides can be used to treat stroke, thrombocytosis, pulmonary
emboli and myeloproliferative disorders, since LAI-1 and/or Ck
beta-11 increase vascular permeability.
[0296] Pharmaceutical Compositions. The Ck beta-11 and/or LAI-1
polypeptide pharmaceutical composition comprises an effective
amount of an isolated Ck beta-11 and/or LAI-1 polypeptide of the
invention, particularly a mature form of the Ck beta-11 and/or
LAI-1, effective to increase the Ck beta-11 and/or LAI-1 activity
level in such an individual. Such compositions can be formulated
and dosed in a fashion consistent with good medical practice,
taking into account the clinical condition of the individual
patient (especially the side effects of treatment with Ck beta-11
and/or LAI-1 polypeptide alone), the site of delivery of the Ck
beta-11 and/or LAI-1 polypeptide composition, the method of
administration, the scheduling of administration, and other factors
known to practitioners. The "effective amount" of Ck beta-11 and/or
LAI-1 polypeptide for purposes herein is thus determined by such
considerations.
[0297] Polypeptides, antagonists or agonists of the present
invention can be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the protein, and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formulation
should suit the mode of administration.
[0298] By "pharmaceutically acceptable carrier" is meant a
non-toxic solid, semisolid or liquid filler, diluent, encapsulating
material or formulation auxiliary of any type. The term
"parenteral" as used herein refers to modes of administration which
include intravenous, intramuscular, intraperitoneal, intrasternal,
subcutaneous and intraarticular injection and infusion.
[0299] The human chemokine polypeptides and agonists and
antagonists may be employed in combination with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically effective amount of the polypeptide, and a
pharmaceutically acceptable carrier or excipient. Such a carrier
includes but is not limited to saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The formation
should suit the mode of administration.
[0300] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides and agonists
and antagonists may be employed in conjunction with other
therapeutic compounds.
[0301] The pharmaceutical compositions may be administered in a
convenient manner such as by the topical, intravenous,
intraperitoneal, intramuscular, intratumor, subcutaneous,
intranasal or intradermal routes. The pharmaceutical compositions
are administered in the amount which is effective for treating
and/or prophylaxis of the specific indication. In general, the
polypeptides will be administered in an amount of at least about 10
.mu.g'/kg body weight and in most cases they will be administered
in an amount not in excess of about 8 mg/Kg body weight per day. In
most cases, the dosage is from about 10 .mu.g'kg to about 1 mg/kg
body weight daily, taking into account the routes of
administration, symptoms, etc.
[0302] The Ck beta-11 and/or LAI-1 polypeptide is also suitably
administered by sustained-release systems. Suitable examples of
sustained-release compositions include semi-permeable polymer
matrices in the form of shaped articles, e.g. films, or
microcapsules. Sustained-release matrices include polylactides
(U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid
and gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers
22:547-556 (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer
et al., J. Biomed. Mater. Res. 15:167-277 (1981), and R. Langer,
Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (R. Langer et
al., Id.) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release Ck beta-11 and/or LAI-1 polypeptide compositions
also include liposomally entrapped Ck beta-11 and/or LAI-1
polypeptide. Liposomes containing Ck beta-11 and/or LAI-1
polypeptide are prepared by methods known per se: DE 3,218,121;
Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985);
Hwang et al., Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP
52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat.
Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP
102,324. Ordinarily, the liposomes are of the small (about 200-800
Angstroms) unilamellar type in which the lipid content is greater
than about 30 mol. percent cholesterol, the selected proportion
being adjusted for the optimal Ck beta-11 and/or LAI-1 polypeptide
therapy.
[0303] For parenteral administration, in one embodiment, the Ck
beta-11 and/or LAI-1 polypeptide is formulated generally by mixing
it at the desired degree of purity, in a unit dosage injectable
form (solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at
the dosages and concentrations employed and is compatible with
other ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to polypeptides.
[0304] Generally, the formulations are prepared by contacting the
Ck beta-11 and/or LAI-1 polypeptide uniformly and intimately with
liquid carriers or finely divided solid carriers or both. Then, if
necessary, the product is shaped into the desired formulation.
Preferably the carrier is a parenteral carrier, more preferably a
solution that is isotonic with the blood of the recipient. Examples
of such carrier vehicles include water, saline, Ringer's solution,
and dextrose solution. Non-aqueous vehicles such as fixed oils and
ethyl oleate are also useful herein, as well as liposomes.
[0305] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g. polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, manose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[0306] The Ck beta-11 and/or LAI-1 polypeptide is typically
formulated in such vehicles at a concentration of about 0.1 mg/ml
to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It
will be understood that the use of certain of the foregoing
excipients, carriers, or stabilizers will result in the formation
of Ck beta-11 and/or LAI-1 polypeptide salts.
[0307] Ck beta-11 and/or LAI-1 polypeptide to be used for
therapeutic administration must be sterile. Sterility is readily
accomplished by filtration through sterile filtration membranes
(e.g. 0.2 micron membranes). Therapeutic Ck beta-11 and/or LAI-1
polypeptide compositions generally are placed into a container
having a sterile access port, for example, an intravenous solution
bag or vial having a stopper pierceable by a hypodermic injection
needle.
[0308] Ck beta-11 and/or LAI-1 polypeptide ordinarily will be
stored in unit or multi-dose containers, for example, sealed
ampules or vials, as an aqueous solution or as a lyophilized
formulation for reconstitution. As an example of a lyophilized
formulation, 10-ml vials are filled with 5 ml of sterile-filtered
1% (w/v) aqueous Ck beta-11 and/or LAI-1 polypeptide solution, and
the resulting mixture is lyophilized. The infusion solution is
prepared by reconstituting the lyophilized Ck beta-11 and/or LAI-1
polypeptide using bacteriostatic Water-for-Injection.
[0309] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention can be employed in conjunction with other therapeutic
compounds.
[0310] Modes of administration. It will be appreciated that
conditions caused by a decrease in the standard or normal level of
Ck beta-11 and/or LAI-1 activity in an individual, can be treated
by administration of Ck beta-11 and/or LAI-1 protein. Thus, the
invention further provides a method of treating an individual in
need of an increased level of Ck beta-11 and/or LAI-1 activity
comprising administering to such an individual a pharmaceutical
composition comprising an effective amount of an isolated Ck
beta-11 and/or LAI-1 polypeptide of the invention, particularly a
mature form of the Ck beta-11 and/or LAI-1, effective to increase
the Ck beta-11 and/or LAI-1 activity level in such an
individual.
[0311] The amounts and dosage regimens of LAI-1 and/or Ck beta-11
administered to a subject will depend on a number of factors such
as the mode of administration, the nature of the condition being
treated and the judgment of the prescribing physician. The
pharmaceutical compositions are administered in an amount which is
effective for treating and/or prophylaxis of the specific
indication. In general, the polypeptides will be administered in an
amount of at least about 10 .mu.g/kg body weight and in most cases
they will be administered in an amount not in excess of about 10
mg/kg body weight per day and preferably the dosage is from about
10 .mu.g/kg body weight daily, taking into account the routes of
administration, symptoms, etc.
[0312] As a general proposition, the total pharmaceutically
effective amount of Ck beta-11 and/or LAI-1 polypeptide
administered parenterally per dose will more preferably be in the
range of about 1 .mu.g/kg/day to 10 mg/kg/day of patient body
weight, although, as noted above, this will be subject to
therapeutic discretion. Even more preferably, this dose is at least
0.01 mg/kg/day, and most preferably for humans between about 0.01
and 1 mg/kg/day. If given continuously, the Ck beta-11 and/or LAI-1
polypeptide is typically administered at a dose rate of about 1
.mu.g/kg/hour to about 50 .mu.g/kg/hour, either by 1-4 injections
per day or by continuous subcutaneous infusions, for example, using
a mini-pump. An intravenous bag solution can also be employed. The
length of treatment needed to observe changes and the interval
following treatment for responses to occur appears to vary
depending on the desired effect.
[0313] Pharmaceutical compositions containing the Ck beta-11 and/or
LAI-1 of the invention can be administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, drops or transdermal patch),
bucally, or as an oral or nasal spray.
[0314] Gene Therapy. The chemokine polypeptides, and agonists or
antagonists which are polypeptides, can be employed in accordance
with the present invention by expression of such polypeptides in
vivo, which is often referred to as "gene therapy."
[0315] Thus, for example, cells from a patient can be engineered
with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo,
with the engineered cells then being provided to a patient to be
treated with the polypeptides. Such methods are well-known in the
art. For example, cells can be engineered by procedures known in
the art by use of a retroviral particle containing RNA encoding the
polypeptides of the present invention.
[0316] Similarly, cells can be engineered in vivo for expression of
a polypeptides in vivo by, for example, procedures known in the
art. As known in the art, a producer cell for producing a
retroviral particle containing RNA encoding the polypeptides of the
present invention can be administered to a patient for engineering
the cells in vivo and expression of the polypeptides in vivo. These
and other methods for administering polypeptides of the present
invention by such method should be apparent to those skilled in the
art from the teachings of the present invention. For example, the
expression vehicle for engineering cells can be other than a
retrovirus, for example, an adenovirus which can be used to
engineer cells in vivo after combination with a suitable delivery
vehicle.
[0317] The retroviral plasmid vectors can be derived from
retroviruses which include, but are not limited to, Moloney Murine
Sarcoma Virus, Moloney Murine Leukemia Virus, spleen necrosis
virus, Rous Sarcoma Virus and Harvey Sarcoma Virus.
[0318] In a preferred embodiment the retroviral expression vector,
pMV-7, is flanked by the long terminal repeats (LTRs) of the
Moloney murine sarcoma virus and contains the selectable drug
resistance gene neo under the regulation of the herpes simplex
virus (HSV) thymidine kinase (tk) promoter. Unique EcoRI and
HindIII sites facilitate the introduction of coding sequence
(Kirschmeier, P. T. et al., DNA 7:219-25 (1988)).
[0319] The vectors include one or more suitable promoters which
include, but are not limited to, the retroviral LTR; the SV40
promoter; and the human cytomegalovirus (CMV) promoter described in
Miller, et al., Biotechniques, Vol. 7, No. 9:980-990 (1989), or any
other promoter (e.g. cellular promoters such as eukaryotic cellular
promoters including, but not limited to, the histone, pol III, and
.beta.-actin promoters). The selection of a suitable promoter will
be apparent to those skilled in the art from the teachings
contained herein.
[0320] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter which
includes, but is not limited to, viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs, the .beta.-actin promoter, and the native promoter which
controls the gene encoding the polypeptide.
[0321] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which can be transfected include, but are not
limited to, the PE501, PA317 and GP+am12. The vector can transduce
the packaging cells through any means known in the art. Such means
include, but are not limited to, electroporation, the use of
liposomes, and CaPO.sub.4 precipitation.
[0322] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
can be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
can be transduced, include but are not limited to, fibroblasts and
endothelial cells.
[0323] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0324] In order to facilitate understanding of the following
examples certain frequently occurring methods and/or terms will be
described.
[0325] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0326] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but can
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0327] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0328] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which can be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0329] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation can
be accomplished using known buffers and conditions with 10 units to
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0330] Unless otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
[0331] Having now generally described the invention, the same will
be more readily understood through reference to the following
example which is provided by way of illustration, and is not
intended to be limiting of the present invention.
EXAMPLE 1
Bacterial Expression and Purification of Ck.beta.-11
[0332] The DNA sequence encoding for Ck.beta.-11, ATCC #75948, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' end sequences of the processed Ck.beta.-11 nucleic
acid sequence (minus the putative signal peptide sequence).
Additional nucleotides corresponding to the Ck.beta.-11 gene are
added to the 5' and 3' end sequences respectively. The 5'
oligonucleotide primer has the sequence 5'
CCCGCATGCCAACTCTGAGTGGCACCA 3' (SEQ ID NO:5) contains a SphI
restriction enzyme site (bold) followed by 18 nucleotides of
Ck.beta.-11 coding sequence (underlined) starting from the second
nucleotide of the sequences coding for the mature protein. The ATG
codon is included in the SphI site. In the next codon following the
ATG, the first base is from the SphI site and the remaining two
bases correspond to the second and third base of the first codon
(residue 18) of the putative mature protein. The 3' sequence 5'
CCCGGATCCCAATGCTTCGGACT 3' (SEQ ID NO:6) contains complementary
sequences to a BamH1 site (bold) and is followed by 18 nucleotides
of gene specific sequences preceding the termination codon. The
restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
Calif.). pQE-9 encodes antibiotic resistance (Amp.sup.r), a
bacterial origin of replication (ori), an IPTG-regulatable promoter
operator (P/O), a ribosome binding site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 is then digested with SphI and
BamH1. The amplified sequences are ligated into pQE-9 and are
inserted in frame with the sequence encoding for the histidine tag
and the RBS. The ligation mixture is then used to transform the E.
coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in
Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989). M15/rep4 contains multiple copies
of the plasmid pREP4, which expresses the lacI repressor and also
confers kanamycin resistance (Kan.sup.r). Transformants are
identified by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies are selected. Plasmid DNA
is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl pH 5.0. After clarification,
solubilized Ck.beta.-11 is purified from this solution by
chromatography on a Nickel-Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E. et al., J. Chromatography 411:177-184 (1984)).
Ck.beta.-11 (>98% pure) is eluted from the column in 6M
guanidine HCl. Protein renaturation out of GnHCl can be
accomplished by several protocols (Jaenicke, R. and Rudolph, R.,
Protein Structure-A Practical Approach, IRL Press, New York
(1990)). Initially, step dialysis is utilized to remove the GnHCL.
Alternatively, the purified protein isolated from the Nichelate
column can be bound to a second column over which a decreasing
linear GnHCL gradient is run. The protein is allowed to renature
while bound to the column and is subsequently eluted with a buffer
containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and
10% Glycerol. Finally, soluble protein is dialyzed against a
storage buffer containing 5 mM Ammonium Bicarbonate.
EXAMPLE 2
Bacterial Expression and Purification of-Ck.alpha.-1
[0333] The DNA sequence encoding for Ck.alpha.-1, ATCC #75947, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' and 3' end sequences of the processed Ck.alpha.-1 nucleic
acid sequence (minus the putative signal peptide sequence).
Additional nucleotides corresponding to Ck.alpha.-1 are added to
the 5' and 3' end sequences respectively. The 5' oligonucleotide
primer has the sequence 5' CCCGCATGCCTTCTGGAGGTCTATTACACA 3' (SEQ
ID NO:7) contains a SphI restriction enzyme site (bold) followed by
21 nucleotides of Ck.alpha.-1 coding sequence starting from the
second nucleotide of the sequences coding for the mature protein.
The ATG codon is included in the SphI site. In the next codon
following the ATG, the first base is from the SphI site and the
remaining two bases correspond to the second and third base of the
first codon (residue 23) of the putative mature protein. As a
consequence, the first base in this codon is changed from G to C
comparing with the original sequences, resulting in a Val to Leu
substitution in the recombinant protein. The 3' sequence 5'
CCCGGATCCGGGAATCTTTCTCTTAAAC 3' (SEQ ID NO: 8) contains
complementary sequences to a BamHl site (bold) and is followed by
19 nucleotides of gene specific sequences preceding the termination
codon. The restriction enzyme sites correspond to the restriction
enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc.
Chatsworth, Calif.). pQE-9 encodes antibiotic resistance
(Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQE-9 is then
digested with SphI and BamH1. The amplified sequences are ligated
into pQE-9 and are inserted in frame with the sequence encoding for
the histidine tag and the RBS. The ligation mixture is then used to
transform the E. coli M15/rep 4 (Qiagen, Inc.) by the procedure
described in Sambrook, J. et al., Molecular Cloning: A Laboratory
Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains
multiple copies of the plasmid pREP4, which expresses the lacI
repressor and also confers kanamycin resistance (Kan.sup.r).
Transformants are identified by their ability to grow on LB plates
and ampicillin/kanamycin resistant colonies are selected. Plasmid
DNA is isolated and confirmed by restriction analysis. Clones
containing the desired constructs are grown overnight (O/N) in
liquid culture in LB media supplemented with both Amp (100 ug/ml)
and Kan (25 ug/ml). The O/N culture is used to inoculate a large
culture at a ratio of 1:100 to 1:250. The cells are grown to an
optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene expression.
Cells are grown an extra 3 to 4 hours. Cells are then harvested by
centrifugation. The cell pellet is solubilized in the chaotropic
agent 6 Molar Guanidine HCl pH 5.0. After clarification,
solubilized Ck.alpha.-1 is purified from this solution by
chromatography on a Nickel Chelate column under conditions that
allow for tight binding by proteins containing the 6-His tag
(Hochuli, E. et al., J. Chromatography 411:177-184 (1984)).
Ck.alpha.-1 (>98% pure) is eluted from the column in 6M
guanidine HCl. Protein renaturation out of GnHCl can be
accomplished by several protocols (Jaenicke, R. & Rudolph, R.,
Protein Structure A Practical Approach, IRL Press, New York
(1990)). Initially, step dialysis is utilized to remove the GnHCL.
Alternatively, the purified protein isolated from the Ni-chelate
column can be bound to a second column over which a decreasing
linear GnHCL gradient is run. The protein is allowed to renature
while bound to the column and is subsequently eluted with a buffer
containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and
10% Glycerol. Finally, soluble protein is dialyzed against a
storage buffer containing 5 mM Ammonium Bicarbonate.
EXAMPLE 3
Expression of Recombinant Ck.beta.-11 in COS Cells
[0334] The expression of plasmid, Ck.beta.-11 HA is derived from a
vector pcDNAI/Amp (Invitragen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
Ck.beta.-11 precursor and a HA tag fused in frame to its 3' end is
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, et al.,
Cell 37:767 (1984)). The infusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope. The plasmid construction strategy
is described as follows:
[0335] The DNA sequence encoding for Ck.beta.-11, ATCC #75948, is
constructed by PCR using two primers: the 5' primer 5'
AAAAAGCTTGCCATGGCCCTGCTACTG 3' (SEQ ID NO:9) contains a HindIII
site followed by 18 nucleotides of Ck.beta.-11 coding sequence
starting from the minus 3 position relative to initiation codon;
the 3' sequence 5'
CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTATAGGTTAACTGCTGCGAC 3' (SEQ
ID NO:10) contains complementary sequences to an XbaI site,
translation stop codon, HA tag and the last 18 nucleotides of the
Ck.beta.-11 coding sequence (not including the stop codon).
Therefore, the PCR product contains a HindIII site, Ck.beta.-11
coding sequence followed by HA tag fused in frame, a translation
termination stop codon next to the HA tag, and an XbaI site. The
PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested
with HindIII and XbaI restriction enzyme and ligated. The ligation
mixture is transformed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, Calif.) the transformed culture is plated on
ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and examined by
restriction analysis for the presence of the correct fragment. For
expression of the recombinant Ck.beta.-11, COS cells are
transfected with the expression vector by DEAEDEXTRAN method (J.
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989)). The expression of the Ck.beta.-11
HA protein is detected by radiolabelling and immunoprecipitation
method (E. Harlow, & D. Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, (1988)). Cells are labeled for
8 hours with .sup.35S-cysteine two days post transfection. Culture
media are then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and culture media are precipitated with a HA specific
monoclonal antibody. Proteins precipitated are analyzed by
SDS-PAGE.
EXAMPLE 4
Expression of Recombinant Ck.alpha.-1 in COS Cells
[0336] The expression of plasmid, Ck.alpha.-1 HA is derived from a
vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of
replication, 2) ampicillin resistance gene, 3) E. coli replication
origin, 4) CMV promoter followed by a polylinker region, a SV40
intron and polyadenylation site. A DNA fragment encoding the entire
Ck.alpha.-1 precursor and a HA tag fused in frame to its 3' end is
cloned into the polylinker region of the vector, therefore, the
recombinant protein expression is directed under the CMV promoter.
The HA tag correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, et al.,
Cell 37:767 (1984)). The infusion of HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope. The plasmid construction strategy
is described as follows:
[0337] The DNA sequence encoding for Ck.alpha.-1, ATCC #75947, is
constructed by PCR using two primers: the 5' primer 5'
AAAAAGCTTAGAATGAAGTTCATCTCG 3' (SEQ ID NO:11) contains a HindIII
site followed by 18 nucleotides of Ck.alpha.-1 coding sequence
starting from the minus 3 position relative to the initiation
codon; the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAG
GGAATCTTTCTCTT 3' (SEQ ID NO:12) contains complementary sequences
to an XbaI site, translation stop codon, HA tag and the last 18
nucleotides of the Ck.alpha.-1 coding sequence (not including the
stop codon). Therefore, the PCR product contains a HindIII site,
Ck.alpha.-1 coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an XbaI
site. The PCR amplified DNA fragment and the vector, PcDNAI/Amp,
are digested with HindIII and an XbaI restriction enzyme and
ligated. The ligation mixture is transformed into E. coli strain
SURE (Stratagene Cloning Systems, La Jolla, Calif.) the transformed
culture is plated on ampicillin media plates and resistant colonies
are selected. Plasmid DNA is isolated from transformants and
examined by restriction analysis for the presence of the correct
fragment. For expression of the recombinant Ck.alpha.-1, COS cells
are transfected with the expression vector by DEAE-DEXTRAN method
(J. Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Laboratory Press, (1989)). The expression of the Ck.alpha.-1
HA protein is detected by radiolabelling and immunoprecipitation
method (E. Harlow, & D. Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, (1988)). Cells are labeled for
8 hours with .sup.35S-cysteine two days post transfection. Culture
media are then collected and cells are lysed with detergent (RIPA
buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM
Tris, pH 7.5). (Wilson, I. et al, Id. 37:767 (1984)). Both cell
lysate and culture media are precipitated with a HA specific
monoclonal antibody. Proteins precipitated are analyzed by
SDS-PAGE.
EXAMPLE 5
Cloning and Expression of Ck.beta.-11 Using the Baculovirus
Expression System
[0338] The DNA sequence encoding the full length Ck.beta.-11
protein, ATCC #75948, was amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene:
[0339] The 5' primer has the sequence 5' CGCGGGATCCGCCATCATG
GCCCTGCTACTGGCCCT 3' (SEQ ID NO:13) and contains a BamHI
restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol. 196:947-950 (1987))
which is just behind the first 20 nucleotides of the Ck.beta.-11
gene (the initiation codon for translation "ATG" is
underlined).
[0340] The 3' primer has the sequence 5'
CGGCGGTACCTGGCTGCACGGTCCATAGG 3' (SEQ ID NO:14) and contains the
cleavage site for the restriction endonuclease Asp781 and 19
nucleotides complementary to the 3' non-translated sequence of the
Ck.beta.-11 gene. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("Geneclean, "BIO
101 Inc., La Jolla, Calif.). The fragment was then digested with
the endonucleases BamHI and Asp781 and then purified again on a 1%
agarose gel. This fragment was designated F2.
[0341] The vector pRG1 (modification of pVL941 vector, discussed
below) was used for the expression of the Ck.beta.-11 protein using
the baculovirus expression system (for review see: Summers, M. D.
& Smith, G. E., A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures, Texas Agricultural Experimental
Station Bulletin No. 1555 (1987)). This expression vector contains
the strong polyhedrin promoter of the Autographa californica
nuclear polyhedrosis virus (AcMNPV) followed by the recognition
sites for the restriction endonucleases BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 was used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli was inserted in
the same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of cotransfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. &
Summers, M. D., Virology 170:31-39).
[0342] The plasmid was digested with the restriction enzymes BamHI
and Asp781 and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
isolated from a 1% agarose gel using the commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA has
been designated V2.
[0343] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells are then transformed and
bacteria identified that contained the plasmid (pBac-Ck.beta.-11)
with the CK.beta.-11 gene using the enzymes BamHI and Asp781. The
sequence of the cloned fragment was confirmed by DNA
sequencing.
[0344] 5 .mu.g of the plasmid pBac-CK.beta.-11 was cotransfected
with 1.0 .mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al., Proc. Natl. Acad.
Sci. USA 84:7413-7417 (1987)).
[0345] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac-CK.beta.-11 were mixed in a sterile well of a
microliter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0346] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gall" (Life
Technologies Inc., Gaithersburg) was used which allows an easy
isolation of blue stained plaques. (A detailed description of a
"plaque assay" can also be found in the user's guide for insect
cell culture and baculovirology distributed by Life Technologies
Inc., Gaithersburg, page 9-10).
[0347] Four days after the serial dilution, the viruses are added
to the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses was
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0348] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-CK.beta.-11 at a multiplicity of infection (MOI) of
2. Six hours later the medium was removed and replaced with SF900
II medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) were added. The cells were
further incubated for 16 hours before they are harvested by
centrifugation and the labeled proteins visualized by SDS-PAGE and
autoradiography.
[0349] Several batches were obtained. Batch B1 was not recorded. In
batch B2, the N-terminus of the major product was determined to be
Gly (22)-Thr (23)-Asn (24) . . . . Similarly, in batch B3, about
95% of the protein was determined to have an N-terminus of
Gly(22)-Thr (23)-Asn (24) . . . .
EXAMPLE 6
Cloning and Expression of Ck.alpha.-1 Using the Baculovirus
Expression System
[0350] The DNA sequence encoding the full length Ck.alpha.-1
protein, ATCC #75947, was amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene:
[0351] The 5' primer had the sequence 5' GCCGGATCCGCCATC
ATGAAGTTCATCTCGACATC 3' (SEQ ID NO:15) and contained a BamHI
restriction enzyme site (in bold) followed by 6 nucleotides
resembling an efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol. 196:947-950 (1987))
which was just behind the first 20 nucleotides of the Ck.alpha.-1
gene (the initiation codon for translation "ATG" is
underlined).
[0352] The 3' primer had the sequence 5' CGCGGGTACCGG
TGTTCTTAGTGGAAA 3' (SEQ ID NO:16) and contained the cleavage site
for the restriction endonuclease Asp781 (in bold) and 17
nucleotides complementary to the 3' non-translated sequence of the
Ck.alpha.-1 gene. The amplified sequences were isolated from a 1%
agarose gel using a commercially available kit ("Geneclean," BIO
101 Inc., La Jolla, Calif.). The fragment was then digested with
the endonucleases BamHI and Asp781 and then purified again on a 1%
agarose gel. This fragment was designated F2.
[0353] The vector pRGI (modification of pVL941 vector, discussed
below) was used for the expression of the Ck.alpha.-1 protein using
the baculovirus expression system (for review see: Summers, M. D.
& Smith, G. E., A manual of methods for baculovirus vectors and
insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555 (1987)). This expression vector contains
the strong polyhedrin promoter of the Autographa californica
nuclear polyhedrosis virus (AcMNPV) followed by the recognition
sites for the restriction endonucleases BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 was used for
efficient polyadenylation. For an easy selection of recombinant
viruses the beta-galactosidase gene from E. coli was inserted in
the same orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences in this vector are flanked at both sides by viral
sequences for the cell-mediated homologous recombination of
cotransfected wild-type viral DNA. Many other baculovirus vectors
could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1
(Luckow, V. A. & Summers, M. D., Virology 170:31-39).
[0354] The plasmid was digested with the restriction enzymes BamHI
and Asp781 and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The DNA was then
isolated from a 1% agarose gel using a commercially available kit
("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA was
designated V2.
[0355] Fragment F2 and the dephosphorylated plasmid V2 were ligated
with T4 DNA ligase. E. coli HB101 cells were then transformed and
bacteria identified that contained the plasmid (pBac-Ck.alpha.-1)
with the Ck.alpha.-1 gene using the enzymes BamHI and Asp781. The
sequence of the cloned fragment was confirmed by DNA
sequencing.
[0356] 5 .mu.g of the plasmid pBac-Ck.alpha.-1 was cotransfected
with 1.0 g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al., Proc. Natl. Acad.
Sci. USA 84:7413-7417 (1987)).
[0357] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid pBac-Ck.alpha.-1 were mixed in a sterile well of a
microliter plate containing 50 .mu.l of serum free Grace's medium
(Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium were added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate was rocked back and forth to mix the newly
added solution. The plate was then incubated for 5 hours at
27.degree. C. After 5 hours the transfection solution was removed
from the plate and 1 ml of Grace's insect medium supplemented with
10% fetal calf serum was added. The plate was put back into an
incubator and cultivation continued at 27.degree. C. for four
days.
[0358] After four days the supernatant was collected and a plaque
assay performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) was used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0359] Four days after the serial dilution, the viruses were added
to the cells and blue stained plaques were picked with the tip of
an Eppendorf pipette. The agar containing the recombinant viruses
was then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar was removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus was used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes were harvested and then stored
at 4.degree. C.
[0360] Sf9 cells were grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells were infected with the recombinant
baculovirus V-Ck.alpha.-1 at a multiplicity of infection (MOI) of
2. Six hours later the medium was removed and replaced with SF900
II medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg, Md.). 42 hours later 5 .mu.Ci of .sup.35S-methionine
and 5 .mu.Ci .sup.35S cysteine (Amersham) were added. The cells
were further incubated for 16 hours before they were harvested by
centrifugation and the labeled proteins visualized by SDS-PAGE and
autoradiography.
[0361] Several batches were obtained. In batch B1, about 50% of the
protein was determined to have an N-terminus of Val(23)-Leu
(24)-Glu(25) . . . ; about 10% to have Val(26)-Tyr(27)-Tyr(28) . .
. ; about 20% to have Thr(29)-Ser(30)-Leu(31) . . . ; and about 20%
to have Ser(30)-Leu(31)-Arg(32) . . . .
[0362] In batch B2, about 95% of the protein was determined to have
an N-terminus of Val(23)-Leu (24)-Glu(25) . . . .
[0363] In batch B3 about 35% of the protein was determined to have
an N-terminus of Val(23)-Leu (24)-Glu(25) . . . ; about 20% to have
Val(26)-Tyr(27)-Tyr(28) . . . ; and about 35% to have
Ser(30)-Leu(31)-Arg(32) . . . .
[0364] In batch B4, about 96% of the protein was determined to have
an N-terminus of Val(23)-Leu (24)-Glu(25) . . . .
[0365] In batch B5, about 5% of the protein was determined to have
an N-terminus of Val(23)-Leu (24)-Glu(25) . . . ; about 10% to have
an N-terminus of Val(26)-Tyr(27)-Tyr(28) . . . ; about 30% to have
an N-terminus of Thr(29)-Ser(30)-Leu(31) . . . ; and about 40% to
have an N-terminus of Ser(30)-Leu(31)-Arg(32) . . . .
[0366] In batch B6, about 96% of the protein was determined to have
an N-terminus of Val(23)-Leu (24)-Glu(25) . . . .
EXAMPLE 7
Expression Via Gene Therapy
[0367] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0368] pMV-7 (Kirschmeier et al., DNA 7:219-25 (1988)) flanked by
the long terminal repeats of the Moloney murine sarcoma virus, is
digested with EcoRI and HindIII and subsequently treated with calf
intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads.
[0369] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer further includes a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the amplified
EcoRI and HindIII fragment are added together, in the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0370] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0371] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0372] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
EXAMPLE 8
Chemotaxis
[0373] Peripheral blood mononuclear cells were purified from donor
leukopacks (Red Cross) by centrifugation on lymphocyte separation
medium (LSM; density 1.077 g/ml; Organon Teknika Corp.) and
harvesting the interface band. Granulocytes were recovered from the
pellet following a dextran sedimentation step prior to ficol
separation. Monocytes were purified by elutriation and
T-lymphocytes purified from the PBMCs using T-cell enrichment
columns (R&D Systems). For activation of the T-lymphocytes,
cells were stimulated by crosslinking through the CD3 receptor in
the presence of IL-2 (10 U/ml) for 16 hours prior to the chemotaxis
assay.
[0374] Cells used for the assay were washed 3.times. with HBSS/0.1%
BSA and resuspended at 2.times.10.sup.6/ml for labeling. Calcein-AM
(Molecular Probes) was added to a final concentration of 1 .mu.M
and the cells incubated at 37.degree. C. for 30 minutes. Following
this incubation the cells were washed 3.times. with HBSS/0.1% BSA.
Labeled cells were resuspended as 4-8.times.10.sup.6/ml and 25
.mu.l (1-2.times.10.sup.5 cells) added to the top of a
polycarbonate filter (3-5 gm pore size; PVP free; NeuroProbe, Inc.)
which separates the cell suspension from the chemotactic agent in
the plate below. Cells are allowed to migrate for 45-90 minutes and
then the number of migrated cells (both attached to the filter as
well as in the bottom plate) are quantitated using a Cytofluor II
fluorescence plate reader (PerSeptive Biosystems).
EXAMPLE 9
LAI-1 Inhibits PBMC Adhesion
[0375] Chemotaxis, Adhesion and Cell surface staining. Human
peripheral blood mononuclear cells (PBMCs) and polymorphonucleated
neutrophil cells (PMNs) were purified from single donor leukopacks
(Red Cross) according to established methods. Monocytes were
purified by elutriation. Primary human umbilical vein endothelial
cells were isolated from healthy donors also following established
methods. Target cells used for the chemotaxis and adhesion assays
were washed three times in HBSS with 0.1% BSA (HBSS/BSA) and
resuspended at 2.times.10.sup.6/ml for labeling. Calcein-AM
(Molecular Probes) was added to a final concentration of 1 .mu.M
and the cells incubated at 37.degree. C. for 30 minutes. Following
this incubation the cells were washed three times in HBSS/BSA.
[0376] For the chemotaxis assays, labeled cells were resuspended as
4-8.times.10.sup.6/ml and 25 .mu.l (1-2.times.10.sup.5 cells) added
to the top of a polycarbonate filter (3-5 .mu.m pore size; PVP
free; NeuroProbe, Inc.) which separates the cell suspension from
the chemotactic agent in the plate below. Cells were allowed to
migrate for 45-90 minutes and then the number of migrated cells
(both attached to the filter as well as in the bottom plate) were
quantitated using a Cytofluor II fluorescence plate reader
(PerSeptive Biosystems). For the adhesion assays, primary HUVEC
cells were plated into 48 well dishes, allowed to reach near
confluency and then used immediately or treated with various test
factors prior to the adhesion assay. Labeled target cells were
plated onto the 48 well dishes containing the monolayer of primary
HUVEC cells in the presence or absence of test factors. The cells
were allowed to attach to the HUVEC cells in RPMI/0.1% BSA for
45-90 minutes, and the plate was then washed and the bound cells
quantitated in a Cytofluor II. Direct and indirect cell surface
staining was performed using established methods and the cells
analyzed on a Becton Dickinson FACScan.
[0377] FIG. 4 shows data representing that LAI-1 inhibits PBMC
adhesion to ILL-.beta. or TNF-.alpha. induced HUVEC monolayers.
Human peripheral blood mononuclear cells (PBMCs) were used in
adhesion assays with primary HUVEC monolayers as described above.
As shown, the addition of LAI-1 during the adhesion assay caused a
bi-phasic, dose dependent inhibition of PBMC adhesion to
endothelial cell monolayers which were activated with IL1-.beta.
(closed triangles) or with TNF-.alpha. (open circles). The maximal
effect of LAI-1 was observed at 1-10 pg/ml. Data shown represents
the specific cells bound as a percentage of the maximal binding
seen with IL1-.beta. or TNF-.alpha.+/-the standard deviation of
triplicate samples.
[0378] FIG. 5A-B shows data representing that LAI-1 inhibits PBMC
(FIG. 5A), but not PMN (FIG. 5B) adhesion to IL1-.beta. activated
HUVEC Cells. PBMCs (FIG. 5A) and polymorphonucleated neutrophil
cells (PMNS) (FIG. 5B) were used for adhesion assays with
IL1-.beta. activated C monolayers. As shown, addition of LAI-1 to
the adhesion assay resulted in the inhibition of PBMC adhesion to
the HUVEC monolayer but had no effect on the adhesion of
neutrophils in the same assay. Data shown represents the specific
cells bound as a percentage of the maximal binding seen with
IL1-.beta.+/-the standard deviation of triplicate samples.
[0379] FIG. 6A-B shows data representing that the pre-treatment of
PBMCs with LAI-1 inhibits subsequent adhesion to ILL-P activated
HUVEC Cells. In FIG. 6A, the IL1-.beta. activated C monolayer was
either pre-treated with LAI-1 (closed triangles) which was then
washed away or had LAI-1 added during the adhesion assay (open
circles) as described in FIG. 4. As shown, pre-treatment of the
HUVEC monolayer with LAI-1 had no significant effect on the
subsequent adhesion of PBMCS. Within this same assay, LAI-1 was
still able to inhibit PBMC adhesion when present during the
adhesion assay. FIG. 6B shows three separate donor PBMCs were
pre-treated with LAI-1 at the concentrations indicated and the
pre-treated cells monitored for their capacity to bind to an
IL1-.beta. activated HUVEC monolayer in the absence of any added
LAI-1 during the assay. As shown, pre-treatment of the PBMCs with
LAI-1 resulted in a reduction in binding ranging from 20 to 60% of
that seen with the untreated PBMCS.
[0380] FIG. 7A-B shows data representing a decrease in the mean
fluorescence intensity of CD29 on PBMCs treated with LAI-1. PBMCs
from two donors were treated for 4 hours with LAI-1 at the
concentrations indicated and then stained for surface expression of
CD11b, CD11c, CD29, CD54, CD49d, CD49e, and CD106. The only
significant differences noted were with CD29. As shown in FIG. 7A,
there was no effect on the percentage of cells which stained
positive for CD29 (open symbols). However, the mean fluorescence
intensity of the CD29 signal was reduced in both donors when the
PBMCs were exposed to LAI-1 (closed symbols). This decrease in CD29
mean fluorescence was evident within a CD3 gated population of
PBMCs but not in a CD20, CD56, or CD14 gated population. In
addition, as shown in FIG. 7B, LAI-1 treatment caused an increase
in the percentage of CD3.sup.+/CD29.sup.- cells.
EXAMPLE 10
LAI-1, a Novel C-X-C Chemokine which Inhibits Leukocyte Adhesion to
Activated Endothelium
[0381] A novel C-X-C (alpha) chemokine, LAI-1, was identified,
cloned and functionally characterized. LAI-1 mRNA is constitutively
expressed in the liver and spleen but not in a variety of other
tissues assayed. LAI-1 encodes a protein of 109 amino acids of
which the first 22 represent the leader sequence. Although LAI-1 is
a member of the alpha-chemokine family, it shows very limited
homology to the other known members. Similar to IP-10, it also
lacks the ELR motif (having instead the SLR motif) present in other
alpha family-chemokines and shows no significant chemotactic
activity on neutrophils. In adhesion assays using IL-1.beta. or
TNF-.alpha. activated HUVEC monolayers, LAI-1 specifically
decreased the adhesion of peripheral blood leukocytes and has
therefore been named Leukocyte Adhesion Inhibitor-1, or LAI-1. The
ability of LAI-1 to block leukocyte adhesion to HUVEC monolayers
appears to be directed towards the leukocytes since
LAI-pre-treatment of HUVEC cells had no effect on subsequent
adhesion capacity. Furthermore, pre-treatment of leukocytes with
LAI-1 was enough to inhibit their adhesion to an activated
endothelial layer. Based on co-culture experiments with leukocytes,
it appears that LAI-1 can actually decrease .beta.1 integrin levels
on leukocytes and this can explain their decreased adhesive
properties.
EXAMPLE 11
In Vivo Angiogenesis Assay of LAI-1 (Ck.alpha.-1)
[0382] This bioassay measures the ability of an existing capillary
network to form new vessels in an implanted capsule of murine
extracellular matrix-material (Matrigel). HGS proteins are mixed
with the liquid Matrigel at 4.degree. C. and the mixture is then
injected subcutaneously in mice where it solidifies. After 7 days,
the solid "plug" of Matrigel is removed and examined for the
presence of new blood vessels.
Assay:
[0383] Matrigel was purchased from Becton Dickinson
Labware/Collaborative Biomedical Products. When thawed at 4.degree.
C. this material is a liquid. The Matrigel was mixed with bFGF (150
ng/ml) alone, bFGF (150 ng/ml)+Ck.alpha.-1 (500 ng/ml) or bFGF (150
ng/ml)+IP-10 (500 ng/ml) at 4.degree. C. and drawn into cold 3 ml
syringes. Female C57B1/6 mice approximately 8 weeks old were
injected with the mixture of Matrigel and experimental protein at 2
sites at the midventral aspect of the abdomen (0.5 ml/site). After
7 days, the mice were sacrificed by cervical dislocation, the
Matrigel plugs were removed and cleaned (i.e., all clinging
membranes and fibrous tissue is removed). Replicate whole plugs
were fixed in neutral buffered 10% formaldehyde, embedded in
paraffin and used to produce sections for histological examination
after staining with Masson's Trichrome. Cross sections from 3
different regions of each plug were processed. Selected sections
were stained for the presence of vWF (an endothelial cell-specific
marker). The positive control for this assay was bovine basic FGF
(I 50 ng/ml). Matrigel alone was used to determine basal levels of
angiogenesis.
Results:
[0384] Basic FGF induced marked vascularization of the Matrigel
plug as analyzed by visual inspection of the dissected plugs and
examination of histological sections of the plugs. Ck.alpha.-1
inhibited the bFGF-induced accumulation of blood in the plugs by
greater than 90% as estimated by visual inspection of the intact
plugs and histological sections. Anti-vWF immunostaining of
histological sections of Matrigel plugs treated with BFGF and
Ck.alpha.-1 revealed a near total inhibition of the vWF-positive
endothelial cells in large vessels and blood sinuses numerous in
the BFGF-treated positive control (FIG. 8A-D).
TABLE-US-00005 angiostimulatory protein angiogenic activity bFGF
(FIG. 8B) +++++ bFGF + Ck.alpha.-1 (FIG. 8C) + bFGF + IP-10 (FIG.
8D) + no protein control (FIG. 8A) -
[0385] These results show that LAI-1 polypeptides and agonists of
the present invention have anti-angiogenic activity in vivo and are
therefore useful in treating pathologies that are associated with,
or involve increased vascularization. Such pathologies or disorders
include, but are not limited to, cancers that involve increased
vascularization; inflammation involving vascularized tissue; or any
disorders that involve, or rely on, vascularization, as is well
known in the art.
[0386] Similarly, these results indicate that LAI-1 polypeptide
antagonists or LAI-1 variants having antagonistic activity have
angiogenic activity. Such activities include, but are not limited
to wound healing, revascularization, and/or any disorders that can
be treated by increasing vascularization (e.g., diabetes), as are
well known in the art. Such antagonists include an LAI-1 variant
containing at least a substitution of Glu30 for Ser30.
EXAMPLE 12
Expression Via Gene Therapy
[0387] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g. Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0388] pMV-7 (Kirschmeier, P. T. et al, DNA 7:219-25 (1988) flanked
by the long terminal repeats of the Moloney murine sarcoma virus,
is digested with EcoRI and HindIII and subsequently treated with
calf intestinal phosphatase. The linear vector is fractionated on
agarose gel and purified, using glass beads.
[0389] The cDNA encoding a Ck beta-11 or LAI-1 polypeptide or
variant of the present invention is amplified using PCR primers
which correspond to the 5' and 3' end sequences respectively. The
5' primer containing an EcoRI site and the 3' primer having
contains a HindIII site. Equal quantities of the Moloney murine
sarcoma virus linear backbone and the EcoRI and HindIII fragment
are added together, in the presence of T4 DNA ligase. The resulting
mixture is maintained under conditions appropriate for ligation of
the two fragments. The ligation mixture is used to transform
bacteria HB101, which are then plated onto agar-containing
kanamycin for the purpose of confirming that the vector had the
gene of interest properly inserted.
[0390] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbeccol's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0391] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0392] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
EXAMPLE 13
LAI-1 as a Chemoattractant for T-Lymphocytes In Vivo
[0393] Female Balb/c mice, 4-6 weeks old are put into 4 groups of
ten animals per group. The groups are either untreated, injected
intraperitoneally with vehicle control or injected with LAI-1 at 1
mg/kg or 3 mg/kg for 6 consecutive days. On day seven, the mice are
sacrificed and peritoneal cavity lavage performed to collect the
resident cells. Total cell numbers are calculated and the cells
subjected to cell surface staining using the following panel of
monoclonal antibodies: CD3, CD4, CD8, Mac1, GR1, B220, MHC class
II, CD14, CD45, and CD5 (Pharmingen, San Diego, Calif.).
[0394] The total cell numbers within the peritoneal cavity are
expected to significantly increased over untreated or vehicle
treated controls. This is expected to be due to an influx of
T-lymphocytes as determined by cell surface staining for CD4, CD5,
and CD8. There is expected a dramatic increase in CD4 positive
cells as well as CD5 and CD8 cells resulting in a net increase in
the relative number of T-lymphocytes. In addition, there is
expected a significant increase in Mac 1 positive, MHC class II
negative, subpopulation of cells within the peritoneal cavity with
a corresponding decrease in the percentage of MHC class II
positive, Mac1 positive subpopulation of cells. This is also
reflected in the total number of MHC class II negative, Mac1
positive cells within the peritoneal cavity.
[0395] LAI-1 is thus expected to shown to be a chemoattractant for
T-lymphocytes in vivo. This could be for CD4, CD8 or both
subpopulations of T-cells. Based on this, LAI-1 can be beneficial
for disease states which would benefit from the attraction and/or
activation of this population of immune cells. This would include
bacterial or viral infection, cancer, and the like. Also, if LAI-1
has a specific effect on the Th1 or Th2 subclass of CD4
lymphocytes, it could bias the normal production of cytokines from
these cells and dramatically influence other immune cells such as
monocytes, macrophages, eosinophils, and other immune cells.
EXAMPLE 14
Purification of LAI-1
[0396] Purification from CHO Expression System
[0397] Following expression of LAI-1 in Chinese hamster ovary
cells, the protein is purified using the following procedure. All
of the purification procedures are performed at 5-10.degree. C.,
unless otherwise specified. The transfected CHO cells are grown in
HGS-CHO-3 medium using the microcarrier culture system (cytodex I,
Pharmacia) for 4 days. The conditioned media are harvested using
low speed centrifugation to remove cells and cell debris. After pH
is adjusted to 7.0 with acetic acid, the conditioned media is
loaded onto a strong cation exchange column (Poros HS-50,
Perseptive Biosystems Inc.) pre-equilibrated with phosphate
buffered saline (PBS), pH 7.0. The column is then washed with same
buffer until the absorbance at 280 nm is less than 0.01 O.D. (10
CV). The desired protein is eluted by washing the column with 1M
NaCl in phosphate buffered saline, pH 7.0. Fractions are then
analyzed by SDS-PAGE through 4-20% gradient gels to confirm the
presence of the desired polypeptide.
[0398] Those fractions containing LAI-1 are then pooled and loaded
onto a gel filtration column of Superdex-75 resin (Pharmacia)
equilibrated in "sizing buffer" comprising 50 mM sodium acetate and
150 mM NaCl, pH 6.0. The sample loaded is less than 10% (V/V) of
the column volume. After allowing the sample to run into the
column, the protein is eluted from the gel filtration matrix using
the same buffer. Fractions are collected and the absorbance at 280
nm of the effluent is continuously monitored. Fractions identified
by A280 as containing eluted material are then analyzed by
SDS-PAGE. Fractions containing LAI-1 is eluted in a peak centered
at 0.62 column volumes and pooled.
[0399] The pooled fractions from gel filtration chromatography is
applied onto a set of strong anion (Poros HQ-50, Perseptive
Biosystems) and weak anion (Poros CM-20) exchange columns in a
tandem mode. Both columns are pre-equilibrated and washed with 50
mM sodium acetate buffer, pH 6.0 after sample loading. The cation
exchange column (CM-20) is then washed with 0.3M NaCl followed by a
0.3M to 0.8M NaCl gradient elution in the same buffer system. The
eluted fractions are analyzed through SDS-PAGE and fractions
containing protein of interest are combined.
[0400] Following the purification steps described above, the
resultant LAI-1 is of greater than 95% purity as determined from
Commassie blue staining of a SDS-PAGE gel. The purified protein is
also tested for endotoxin/LPS contamination. The LPS content is
less than 0.1 ng/mg of purified protein according to LAL
assays.
[0401] An alternative purification procedure is also used to purify
LAI-1. The procedure involves the following steps, and unless
otherwise specified, all procedures are conducted at 5-10.degree.
C.
[0402] Upon completion of the production phase of a CHO culture,
the conditioned media are obtained after cells/cell debris removal
using low speed centrifugation. Following pH of the media being
adjusted to pH 7.0 by adding acetic acid, the media are loaded onto
a strong cation exchange column (Poros HS-50, Perspective
Biosystems, Inc.) pre-equilibrated with phosphate buffered saline
(PBS), pH 7.0. The column is then washed with same buffer until the
absorbance at 280 nm is less than 0.01 O.D. (10 CV). The desired
protein is eluted by ishing the column with 1M NaCl in phosphate
buffered saline, pH 7.0. Fractions are then analyzed by SDS-PAGE
through 4-20% gradient gels to confirm the presence of the
LAI-1.
[0403] Those fractions containing LAI-1 are then pooled, followed
by the addition of 4 volumes of 10 mM sodium acetate, pH 6.5. The
diluted sample is then loaded onto a previously prepared set of
tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems)
and weak anion (Poros CM-20, Perceptive Biosystems) exchange resin.
The columns are equilibrated with 50 mM sodium acetate pH 6.5. The
CM-20 column is washed with 5 column volumes of 0.2 M NaCl, 50 mM
sodium acetate, pH 6.5 and eluted using a 10 column volume linear
gradient ranging from 0.2M NaCl, 50 mM sodium acetate, pH 6.5 to
1.0M NaCl 50 mM sodium acetate, pH 6.5. Fractions are collected
under constant A280 monitoring of the effluent. Those fractions
containing the protein of interest (determined by 4-20% SDS-PAGE)
are then pooled.
[0404] The combined fractions containing LAI-1 are then loaded
(V/V, 5% of the column volume) onto a sizing exclusion column
(Superdex-75, Pharmacia) equilibrated with 100 mM NaCl, 50 mM
sodium acetate, pH 6.5. After allowing the sample to run into the
column, the protein is eluted from the gel filtration matrix using
100 mM NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected
and the absorbance at 280 nm of the effluent is continuously
monitored. Fractions identified to A.sub.280 as containing the
eluted material are then analyzed by SDS-PAGE. Fractions containing
LAI-1 is then pooled.
[0405] Following the three step purification procedure described
above, the resultant LAI-1 is of greater than 95% purity as
determined from Commassie blue staining of a SDS-PAGE gel. The
purified protein is also tested for endotoxin/LPS contamination.
The LPS content is less than 0.1 ng/mg of purified protein
according to LAL assays.
Purification of LAI-1 from E. coli
[0406] The purification involves the following steps, and unless
otherwise specified, all procedures are conducted at 4-10.degree.
C.
[0407] Upon completion of the production phase of the E. coli
fermentation, the cell culture is cooled to 4-10.degree. C. and the
cells are harvested by continuous centrifugation at 15,000 rpm
(Heraeus Sepatech). On the basis of the expected yield of protein
per unit weight of cell paste and the amount of purified protein
required, an appropriate amount of cell paste, by weight, is
suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA,
pH 7.4. The cells are dispersed to a homogeneous solution using a
high shear mixer.
[0408] The cells are then lysed by passing the solution through
microfluidizer (Microfluidics, Corp. or APV Gaulin, Inc.) twice at
4000-6000 psi. The homogenate is then mixed with NaCl solution to a
final concentration of 0.5 M NaCl, followed by centrifugation at
7000 g for 15 min. The resulted pellet is washed again using 0.5M
NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.
[0409] The washed inclusion body is solubilized with 1.5 M
Guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 g
centrifugation for 15 min., pellet is discarded and the
LAI-1-containing supernatant is placed at 4.degree. C. overnight
for further GUHCl extraction.
[0410] Following high speed centrifugation (30000 g) to remove the
insoluble particles, the GuHCl solubilized proteins are refolded by
quickly mixing the GuHCl extraction with 20 volumes of buffer
containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by vigorous
stirring. The refolded diluted protein solution is set kept at
4.degree. C. without mixing for 12 hours prior to further
purification steps.
[0411] To clarify the refolded LAI-1 solution, a previously
prepared tangential filtration unit equipped with 0.16 um membrane
filter with appropriate surface area (Filtron), equilibrated with
40 mM sodium acetate, pH 6.0 is employed. The filtered sample is
loaded onto a cation exchange of poros HS-50 resin (Perseptive
Biosystems). The column is washed with 40 mM sodium acetate, pH 6.0
and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the
same buffer, in a stepwise manner. The absorbance at 280 mm of the
effluent is continuously monitored. Fractions are collected and
further analyzed by SDS-PAGE.
[0412] Those fractions contained desired protein is then pooled and
mixed with 4 volumes of water. The diluted sample is then loaded
onto a previously prepared set of tandem columns of strong anion
(Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20,
Perseptive Biosystems) exchange resin. The columns are equilibrated
with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40
mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20 column is then
eluted using a 10 column volume linear gradient ranging from 0.2M
NaCl, 50 mM sodium acetate, pH 6.0 to 1.0M NaCl, 50 mM sodium
acetate, pH 6.5. Fractions are collected under constant A280
monitoring of the effluent. Those fractions containing the protein
of interest (determined by 16% SDS-PAGE) are then pooled.
[0413] The resultant LAI-1 is of greater than 95% purity after the
above refolding and purification steps. No major contaminant bands
are observed from the Commassie blue stained 16% SDS-PAGE gel when
5 ug of purified protein is loaded. The purified protein is also
tested for endotoxin/LPS contamination. The LPS content is expected
to be less than 0.1 ng/ml according to LAL assays.
[0414] The above methods can be similarly applied to purification
of similarly expressed Ck beta-11 polypeptides with suitable
results.
[0415] It will be clear that the invention can be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0416] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0417] The disclosures of all patents, patent applications, and
publications referred to herein are entirely hereby incorporated by
reference.
Sequence CWU 1
1
161297DNAHomo sapiensCDS(1)..(294) 1atg gcc ctg cta ctg gcc ctc agc
ctg ctg gtt ctc tgg act tcc cca 48Met Ala Leu Leu Leu Ala Leu Ser
Leu Leu Val Leu Trp Thr Ser Pro1 5 10 15gcc cca act ctg agt ggc acc
aat gat gct gaa gac tgc tgc ctg tct 96Ala Pro Thr Leu Ser Gly Thr
Asn Asp Ala Glu Asp Cys Cys Leu Ser20 25 30gtg acc cag aaa ccc atc
cct ggg tac atc gtg agg aac ttc cac tac 144Val Thr Gln Lys Pro Ile
Pro Gly Tyr Ile Val Arg Asn Phe His Tyr35 40 45ctt ctc atc aag gat
ggt tgc agg gtg cct gct gta gtg ttc acc aca 192Leu Leu Ile Lys Asp
Gly Cys Arg Val Pro Ala Val Val Phe Thr Thr50 55 60ctg agg ggc cgc
cag ctc tgt gca ccc cca gac cag ccc tgg gta gaa 240Leu Arg Gly Arg
Gln Leu Cys Ala Pro Pro Asp Gln Pro Trp Val Glu65 70 75 80cgc atc
atc cag aga ctg cag agg acc tca gcc aag atg aag cgc cgc 288Arg Ile
Ile Gln Arg Leu Gln Arg Thr Ser Ala Lys Met Lys Arg Arg85 90 95agc
agt taa 297Ser Ser298PRTHomo sapiens 2Met Ala Leu Leu Leu Ala Leu
Ser Leu Leu Val Leu Trp Thr Ser Pro1 5 10 15Ala Pro Thr Leu Ser Gly
Thr Asn Asp Ala Glu Asp Cys Cys Leu Ser20 25 30Val Thr Gln Lys Pro
Ile Pro Gly Tyr Ile Val Arg Asn Phe His Tyr35 40 45Leu Leu Ile Lys
Asp Gly Cys Arg Val Pro Ala Val Val Phe Thr Thr50 55 60Leu Arg Gly
Arg Gln Leu Cys Ala Pro Pro Asp Gln Pro Trp Val Glu65 70 75 80Arg
Ile Ile Gln Arg Leu Gln Arg Thr Ser Ala Lys Met Lys Arg Arg85 90
95Ser Ser3330DNAHomo sapiensCDS(1)..(327) 3atg aag ttc atc tcg aca
tct ctg ctt ctc atg ctg ctg gtc agc agc 48Met Lys Phe Ile Ser Thr
Ser Leu Leu Leu Met Leu Leu Val Ser Ser1 5 10 15ctc tct cca gtc caa
ggt gtt ctg gag gtc tat tac aca agc ttg agg 96Leu Ser Pro Val Gln
Gly Val Leu Glu Val Tyr Tyr Thr Ser Leu Arg20 25 30tgt aga tgt gtc
caa gag agc tca gtc ttt atc cct aga cgc ttc att 144Cys Arg Cys Val
Gln Glu Ser Ser Val Phe Ile Pro Arg Arg Phe Ile35 40 45gat cga att
caa atc ttg ccc cgt ggg aat ggt tgt cca aga aaa gaa 192Asp Arg Ile
Gln Ile Leu Pro Arg Gly Asn Gly Cys Pro Arg Lys Glu50 55 60atc ata
gtc tgg aag aag aac aag tca att gtg tgt gtg gac cct caa 240Ile Ile
Val Trp Lys Lys Asn Lys Ser Ile Val Cys Val Asp Pro Gln65 70 75
80gct gaa tgg ata caa aga atg atg gaa gta ttg aga aaa aga agt tct
288Ala Glu Trp Ile Gln Arg Met Met Glu Val Leu Arg Lys Arg Ser
Ser85 90 95tca act cta cca gtt cca gtg ttt aag aga aag att ccc tga
330Ser Thr Leu Pro Val Pro Val Phe Lys Arg Lys Ile Pro100
1054109PRTHomo sapiens 4Met Lys Phe Ile Ser Thr Ser Leu Leu Leu Met
Leu Leu Val Ser Ser1 5 10 15Leu Ser Pro Val Gln Gly Val Leu Glu Val
Tyr Tyr Thr Ser Leu Arg20 25 30Cys Arg Cys Val Gln Glu Ser Ser Val
Phe Ile Pro Arg Arg Phe Ile35 40 45Asp Arg Ile Gln Ile Leu Pro Arg
Gly Asn Gly Cys Pro Arg Lys Glu50 55 60Ile Ile Val Trp Lys Lys Asn
Lys Ser Ile Val Cys Val Asp Pro Gln65 70 75 80Ala Glu Trp Ile Gln
Arg Met Met Glu Val Leu Arg Lys Arg Ser Ser85 90 95Ser Thr Leu Pro
Val Pro Val Phe Lys Arg Lys Ile Pro100 105527DNAArtificial
sequencePrimer 5cccgcatgcc aactctgagt ggcacca 27623DNAArtificial
sequencePrimer 6cccggatccc aatgcttcgg act 23730DNAArtificial
sequencePrimer 7cccgcatgcc ttctggaggt ctattacaca 30828DNAArtificial
sequencePrimer 8cccggatccg ggaatctttc tcttaaac 28927DNAArtificial
sequencePrimer 9aaaaagcttg ccatggccct gctactg 271057DNAArtificial
sequencePrimer 10cgctctagat taagcgtagt ctgggacgtc gtatgggtat
aggttaactg ctgcgac 571127DNAArtificial sequencePrimer 11aaaaagctta
gaatgaagtt catctcg 271254DNAArtificial sequencePrimer 12cgctctagat
taagcgtagt ctgggacgtc gtatgggtag ggaatctttc tctt
541336DNAArtificial sequencePrimer 13cgcgggatcc gccatcatgg
ccctgctact ggccct 361429DNAArtificial sequencePrimer 14cggcggtacc
tggctgcacg gtccatagg 291535DNAArtificial sequencePrimer
15gccggatccg ccatcatgaa gttcatctcg acatc 351627DNAArtificial
sequencePrimer 16cgcgggtacc ggtgttctta gtggaaa 27
* * * * *