U.S. patent application number 11/901569 was filed with the patent office on 2009-02-05 for method for producing circular or multimeric protein species in vivo or in vitro and related methods.
Invention is credited to Thomas C. Evans, Ming-Qun Xu.
Application Number | 20090035814 11/901569 |
Document ID | / |
Family ID | 22660004 |
Filed Date | 2009-02-05 |
United States Patent
Application |
20090035814 |
Kind Code |
A1 |
Evans; Thomas C. ; et
al. |
February 5, 2009 |
Method for producing circular or multimeric protein species in vivo
or in vitro and related methods
Abstract
A method is disclosed for forming multimeric proteins. The
method relies on intermolecular trans-splicing of a split intein
either in vivo or in vitro.
Inventors: |
Evans; Thomas C.;
(Topsfield, MA) ; Xu; Ming-Qun; (Hamilton,
MA) |
Correspondence
Address: |
HARRIET M. STRIMPEL, D. Phil.
New England Biolabs, Inc., 240 COUNTY ROAD
IPSWICH
MA
01938-2723
US
|
Family ID: |
22660004 |
Appl. No.: |
11/901569 |
Filed: |
September 18, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09937070 |
Jan 29, 2002 |
7271256 |
|
|
PCT/US01/03147 |
Jan 31, 2001 |
|
|
|
11901569 |
|
|
|
|
60180319 |
Feb 4, 2000 |
|
|
|
Current U.S.
Class: |
435/68.1 ;
435/69.1; 530/412 |
Current CPC
Class: |
C07K 14/195 20130101;
C07K 19/00 20130101; C07K 14/47 20130101 |
Class at
Publication: |
435/68.1 ;
530/412; 435/69.1 |
International
Class: |
C12P 21/00 20060101
C12P021/00; C07K 14/00 20060101 C07K014/00 |
Claims
1. A method for producing a multimeric protein, comprising the
steps of: (a) providing a first and a second target protein and a
first and second intein fragment wherein the first intein fragment
is fused at its C-terminus to the N-terminus of the first target
protein and the second intein fragment is fused at its N-terminus
to the C-terminus of the second target protein at its C-terminus;
and (b) permitting intermolecular trans-splicing of the first and
second target proteins to produce the multimeric protein.
2. A method according to claim 1, wherein the multimeric protein is
produced in vitro.
3. A method according to claim 1, wherein step (a) further
comprises: introducing into a host cell, a first DNA encoding the
first target protein and the first intein fragment and a second DNA
encoding the second target protein and the second intein
fragment.
4. A method according to claims 1 and 5, wherein the target protein
is selected from the group consisting of a peptide, a protein and
an enzyme.
5. A method according to claim 1, further comprising: attaching the
first or the second target protein fused to an intein fragment, to
an affinity resin via an affinity domain associated with the intein
fragment.
6. A method according to claim 1, wherein the affinity resin is
formulated as an affinity-based support, a chip, a plate, a biochip
support, a glass wafer or a microtiter plate.
7. A method according to claim 1, wherein the intein fragments are
derived from a naturally split intein.
8. A method according to claim 1, wherein the intein fragments are
derived from an artificially split intein.
9. A method according to claim 5, wherein the affinity resin is
selected from the group consisting of: a chitin-binding domain, the
maltose-binding protein, a His tag, a cellulose-binding protein and
a Flag-tag.
10. A method according to claim 1, further comprising: adding a
thiol reagent or altering pH or temperature for enhancing cleavage
of the intein fragments from the target proteins.
11. A method according to claim 1, further comprising: performing
the trans-splicing reaction at an effective pH and temperature in
the presence of a reducing agent to facilitate trans-splicing.
Description
CROSS REFERENCE
[0001] This application is a continuation of application Ser. No.
09/937,070 filed Jan. 29, 2002, now U.S. Pat. No. 7,271,256, which
is a .sctn.371 of PCT Application No. PCT/US01/03147, which claims
priority from U.S. Provisional Application No. 60/180,319 filed
Feb. 4, 2000.
BACKGROUND OF THE INVENTION
[0002] There are a number of modifications that proteins can
undergo following translation. Some of the many post-translational
modifications result in proteolytic processing or the covalent
linkage of an important functional group to the protein. An
interesting post-translational modification is the head-to-tail
cyclization of a protein or peptide to form a continuous peptide
backbone. Many of the naturally occurring circular peptides posses
anti-bacterial activity, such as the AS-48 peptide (Samyn, et al.,
FEBS Lett., 352(1) 87-90 (1994)). Also, these antibacterial
peptides have been found in organisms as divergent as bacteria and
primates (Samyn, et al., FEBS Lett., 352(1) 87-90 (1994); Tang, et
al., Science, 286(5439) 498-502 (1999)). One possibility for
forming a cyclic protein species may be that the peptide or protein
is more conformationally stable once its N- and C-termini have been
constrained.
[0003] In addition to the naturally occurring cyclic peptides a
number of synthetic techniques have been developed to generate
synthetic circular peptides (Tam and Lu, Protein Sci., 7(7)
1583-1592 (1998); Romanovskis and Spatola, J. Pept. Res., 52(5)
356-374 (1998); Camarero and Muir, J. Amer. Chem. Soc., 121
5597-5598 (1999); Valero, et al., J. Pept. Res., 53(1) 56-67
(1999)). However, due to the limitations of total chemical
synthesis it is difficult to generate synthetic cyclic peptides
larger than 100 amino acids. This was circumvented using intein
based technologies that allowed ribosomally synthesized proteins to
cyclize in a head-to-tail fashion in vitro (Camarero and Muir, J.
Amer. Chem. Soc., 121 5597-5598 (1999); Evans, et al., J. Biol.
Chem., 274 18359-18363 (1999); Iwai and Pluckthun, FEBS Lett., 459
166-172 (1999)). However, these procedures did not allow the
cyclization of a protein or peptide in vivo for study in a living
organism.
[0004] The in vitro cyclization of ribosomally synthesized proteins
utilize the activity of protein splicing elements (termed inteins
Perler, et al., Nucleic Acids Res., 22 1125-1127 (1994)). Inteins,
catalyze their own excision from a primary translation product with
the concomitant ligation of the flanking protein sequences
(reviewed in Paulus, Chem. Soc. Rev., 27:375-386 (1998), Perler,
Cell 92(1)1-4 (1998) and Shao and Kent, Chem. Biol. 4(3):187-194
(1997)). Inteins catalyze three highly coordinated reactions at the
N- and C-terminal splice junctions (Xu and Perler, EMBO J.
15(19):5146-5153 (1996) and Chong, et al., J. Biol. Chem.,
271:22159-22168 (1996)): 1) an acyl rearrangement at the N-terminal
cysteine or serine; 2) a transesterification reaction between the
two termini to form a branched ester or thioester intermediate; and
3) peptide bond cleavage coupled to cyclization of the intein
C-terminal asparagine to free the intein. Inteins have been
engineered to be versatile tools in protein purification (Chong, et
al., Gene, 192(2) 271-281 (1997), Chong, et al., Nucleic Acids Res.
26(22):5109-5115 (1998), Evans, et al., Protein Sci., 7:2256-2264
(1998), Mathys, et al., Gene 231:1-13 (1999), Evans, et al., J.
Biol. Chem., 274:3923-3926 (1999), Southworth, et al.,
Biotechniques, 27:110-120 (1999) and Wood, et al., Nature
Biotechnology, 17(9):889-892 (1999)), protein ligation (Evans, et
al., Protein Sci., 7:2256-2264 (1998), Mathys, et al., Gene
231:1-13 (1999), Evans, et al., J. Biol. Chem., 274:3923-3926
(1999), Southworth, et al., Biotechniques, 27:110-120 (1999),
Cotton, et al., J. Am. Chem. Soc. 121:1100-1101 (1999), Muir, et
al., Proc. Natl. Acad. Sci. USA. 95:6705-6710 (1998), Severinov and
Muir, J. Biol. Chem. 273:16205-16209 (1998), and Xu, et al., Proc.
Natl. Acad. Sci. USA 96(2):388-393 (1999)) as well as in the
aforementioned formation of cyclic proteins and peptides (Evans, et
al., J. Biol. Chem. 274:18359-18363 (1999), Iwai and Pluckthun,
FEBS Lett 459:166-172 (1999) and Camarero and Muir, J. Amer. Chem.
Soc., 121:5597-5598 (1999)). Limitations of these intein
technologies include the necessity of generating an N-terminal
cysteine and/or C-terminal thioester intermediate in vitro for
ligation or cyclization, the need to perform extra purification
steps to separate unligated reactants from the ligation products
and the requirement of a denaturant to permit in vitro
trans-splicing reactions (Yamazaki, et al., J. Am. Chem. Soc.
120:5591-5592 (1998), Mills, et al., Proc. Natl. Acad. Sci. USA,
95(7):3543-3548 (1998), and Southworth, et al., EMBO J.,
17(4):918-926 (1998)).
[0005] In addition to the cis-splicing inteins and those engineered
to trans-splice (Yamazaki, et al., J. Am. Chem. Soc. 120:5591-5592
(1998), Wu, et al., Biochim. Biophys. Acta, 1387:422-432 (1998),
Mills, et al., Proc. Natl. Acad. Sci. USA, 95(7):3543-3548 (1998),
Otomo, et al., J. Biomol. NMR, 14(2):105-114, Otomo, et al.,
Biochemistry, 39(49):16040-16044, and Southworth, et al., EMBO J.,
17(4):918-926 (1998)), a naturally-occurring split intein was
recently identified in the dnaE gene encoding the catalytic subunit
of DNA polymerase III of Synechocystis sp. PCC6803 (Wu, et al.,
Proc. Natl. Acad. Sci. USA, 95(16):9226-9231 (1998)). The
N-terminal half of DnaE, followed by a 123-amino acid intein
sequence, and the C-terminal half, preceded by a 36-amino acid
intein sequence, are encoded by two open reading frames located
more than 745 kilobases apart in the genome. When co-expressed in
E. coli, the two DnaE-intein fragments exhibited protein
trans-splicing (Wu, et al., Proc. Natl. Acad. Sci. USA,
95(16):9226-9231 (1998)).
[0006] Accordingly, it would be desirable to utilize intein
technology in developing methods for producing circular or
multimeric protein species in vivo in vitro. Such methods would
permit the formation of cyclic polypeptides in new hosts,
facilitate the separation of products from reactants when ligating
proteins for isotopic labeling, and allow the generation of cyclic
polypeptides that are sensitive to reducing agents.
SUMMARY
[0007] The abbreviations used herein are:
[0008] "Ssp DnaE intein" means a naturally split intein from the
dnaE gene of Synechocystis sp. PCC6803;
[0009] "DnaE(N)" means the N-terminal 123 amino acid residues of
the Ssp DnaE intein;
[0010] "DnaE(C)" means the C-terminal 36 amino acid residues of the
Ssp DnaE intein;
[0011] "MBP" means maltose binding protein;
[0012] "CBD" means chitin binding domain;
[0013] "Fxa" means factor Xa;
[0014] "ITS" means intramolecular trans-splicing.
[0015] In accordance with one embodiment of the present invention,
there is provided a method for producing a circular or multimeric
protein species in vivo or in vitro. The steps comprising the in
vivo cyclization or multimerization reaction consists of fusing the
C-terminal splicing domain of a protein splicing element (an
intein) to the N-terminus of the target protein and the N-terminal
splicing domain of an intein to the C-terminus of the same target
protein and expressing the fusion protein in the desired organism
at the temperature permissive for intein splicing. Cyclization
occurs when the two splicing domains from the same target protein
interact and splice whereas multimerization occurs if the two
splicing domains from two different target proteins interact and
splice.
[0016] The intein splicing domains are also referred to herein as
intein fragments. The intein fragments are chosen so that they
represent complementary trans-splicing domains. These complementary
intein fragments could be chosen from the known trans-splicing
inteins (Yamazaki, et al., J. Am. Chem. Soc. 120:5591-5592 (1998),
Wu, et al., Biochim. Biophys. Acta, 1387:422-432 (1998), Mills, et
al., Proc. Natl. Acad. Sci. USA, 95(7):3543-3548 (1998), Wu, et
al., Proc. Natl. Acad. Sci. USA, 95(16):9226-9231 (1998), Otomo, et
al., J. Biomol. NMR, 14(2):105-114, Otomo, et al., Biochemistry,
39(49):16040-16044, and Southworth, et al., EMBO J., 17(4):918-926
(1998)). The intein fragments used in the present study were the
N-terminal 123 amino acids and the 36 C-terminal amino acids of the
of the Ssp DnaE intein, respectively.
[0017] This intein based technology allows naturally occurring
circular proteins to be expressed in organisms that are not the
native host. Furthermore, this technology permits a wide range of
circular proteins, including those not found in nature to be
expressed in such organisms.
[0018] In vitro cyclization also involves fusing the C-terminal
splicing domain of an intein to the N-terminus of the target
protein and the N-terminal splicing domain of an intein to the
C-terminus of the same target protein as described above. However,
expression of the fusion protein in the desired organism is carried
out under conditions that are not permissive for intein splicing.
Also, one or both intein splicing domains may carry an affinity tag
that allows immobilization on an affinity resin.
[0019] The present invention is exemplified by, though not limited
to, the intein found in the dnaE gene of Synechocystis sp. PCC6803
(Ssp DnaE intein). The first step in the in vitro cyclization
reaction is the generation of the full length precursor protein,
either by ribosomal synthesis or by total chemical synthesis. The
full length precursor protein is then immobilized on a solid
support, such as a chitin resin. Protein cyclization occurs when
the resin containing the bound protein is equilibrated at the
appropriate temperature and pH to allow splicing to proceed. As
described above for the in vivo case, cyclization occurs if the two
splicing domains from the same target protein interact and splice
whereas multimerization occurs if the two splicing domains from two
different target proteins interact and splice. Following the
trans-splicing reaction to generate the cyclic protein species the
final products were eluted from the chitin resin. This method is
unlike previous intein based in vitro cyclization techniques,
referenced above, and may be used to circularize proteins that are
sensitive to the reducing agents used in the other procedures or
are not amenable to use with other inteins.
[0020] The present invention also describes a method for ligating
two protein fragments on-column and separating away the reactants
by elution from the affinity resin. The steps involved comprise
fusing target protein 1 to a C-terminal intein splicing domain
while target protein 2 is fused to an N-terminal intein splicing
domain.
[0021] An affinity domain can be fused to both or either of the N-
and C-terminal intein splicing domains so that the N- and
C-terminal protein fusion molecules can be immobilized on an
affinity resin. The affinity domain exemplified herein is the
chitin binding domain from B. circulans (Watanabe, et al., J.
Bacteriol., 176:4465-4472 (1994)). Following the generation of the
precursor proteins in the present invention they are applied to a
chitin resin. The immobilized proteins are ligated together when
favorable conditions exist to permit the complementary intein
fragments from separate molecules to undergo the trans-splicing
reaction.
[0022] Following trans-splicing the ligated protein products were
no longer fused to the intein fragments or the affinity domain and
so these products were isolated by eluting it from the chitin
resin. In contrast, the unused reactants remained bound. This
permits the localization of the ligation reaction and overcomes
many of the disadvantages and problems of the previous technologies
noted above. Specifically, the present invention allows the facile
separation of the ligated protein species from the unused reactants
and the use of inteins such as the Ssp DnaE intein eliminates the
need for the denaturant treatment step to permit the trans-splicing
reaction.
[0023] The present invention also relates to a method for
controlling cleavage at the intein splice junctions. In this
embodiment, a protein is fused to the N-terminal intein splicing
domain. This fusion protein may or may not be purified. Cleavage of
the fusion protein is induced by the addition of the complementary
C-terminal splicing domain, that may or may not contain a mutation
to block any potential splicing activity. Alternatively, a protein
is fused to the C-terminal intein splicing domain. This fusion may
or may not be purified. Cleavage is induced by the addition of the
N-terminal intein splicing domain. In both of the above instances,
the cleavage reaction may be accelerated using reagents or
conditions that increase the rate of cleavage, such as thiol
reagents, pH, or temperature. This mechanism of controllable
cleavage has been termed trans-cleavage.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 depicts the Ssp DnaE intein cis- and trans-splicing
constructs. The cis-splicing constructs, pMEB8, pMEB8-N2, pMEB8-C1,
-C2, and -C3 all use maltose binding protein (MBP) and the chitin
binding domain (CBD) as the N- and C-exteins, respectively. The
differences are in the extein residues adjacent to the intein and
are represented by their single letter code for ease of comparison.
The constructs used in the two plasmid, trans-splicing system were
pMEB4 and pKEB 1 which contain the N- and C-terminal Ssp DnaE
intein fragments, DnaE(N) and DnaE(C), respectively. The
intramolecular trans-splicing construct, pMEB21, placed DnaE(C) and
DnaE(N) at the N- and C-terminus of MBP, respectively.
[0025] FIG. 2 is a gel depicting the in vivo splicing of the Ssp
DnaE intein by SDS-PAGE.
[0026] FIG. 2A, Cis-splicing activity of the Ssp DnaE intein
investigated by expression of the MBP-DnaE-CBD fusion (MEB) protein
in E. coli. Lane 1, uninduced crude cell extract. Lane 2, crude
cell extract following induction at 15.degree. C. overnight. The
MEB precursor (68 kDa), the splicing products MB (50 kDa) and E (18
kDa) and the cleavage products M (43 kDa) and EB (25 kDa) are
visible. Lane 3, crude cell extract after a 2 hour induction at
37.degree. C. Lane 4. Crude cell extract after a 2 hour induction
at 37.degree. C. followed by overnight incubation at 15.degree.
C.
[0027] FIG. 2B, The cis-splicing activity of the Ssp DnaE intein in
vivo with mutated extein residues. Lane 1, in vivo splicing
activity with 2 native N-extein and 3 native C-extein residues
(pMEB-N2). The splicing of the Ssp DnaE intein with 5 native
N-extein residues and 1 (pMEB8-C1, lane 2), 2 (pMEB8-C2, lane 3) or
3 native C-extein residues (pMEB8-C3, lane 4).
[0028] FIG. 2C, The Ssp DnaE intein in vivo trans-splicing activity
investigated by co-expression of the MBP-DnaE(N) (57 kDa) and the
DnaE(C)-CBD (10 kDa) fusion proteins. Lane 1, uninduced crude cell
extract. Crude cell extract after induction of protein expression
at 15.degree. C. (Lane 2), at 37.degree. C. (Lane 3) and at
37.degree. C. followed by incubation with shaking at 15.degree. C.
(Lane 4) all displayed precursor (MEB), spliced product (MB) and
cleavage product (M). Lane 5, induction of protein expression with
ME(N), but not E(C)B, displayed no detectable splicing or cleavage.
All samples were analyzed by Coomassie Blue stained 12% SDS-PAGE
gels.
[0029] FIG. 3 is a gel depicting protein trans-splicing and
cyclization reactions using the Ssp DnaE intein.
[0030] FIG. 3A, Intermolecular trans-splicing (ITS). The
association of the N-terminal and C-terminal Ssp DnaE intein
fragments, DnaE(N) and DnaE(C), respectively, aligns the two splice
junctions for the fusion of the N- and C-extein sequences. The
splicing reaction presumably occurs via the same splicing pathway
as the cis-splicing pathway proposed previously (Xu and Perler,
EMBO J., 15(19):5146-5153 (1996) and Chong, et al., J. Biol. Chem.
271:22159-22168 (1996)). Cleavage at the N-terminal splice junction
can occur by hydrolysis or nucleophilic attack of the thioester
bond formed at the C-terminus of the N-extein.
[0031] FIG. 3B, Intramolecular trans-splicing (ITS). A target
protein is sandwiched between the intein C-terminal segment (36
amino acids) and the intein N-terminal segment (123 amino acids).
Splicing joins the N-terminus of the target protein to its own
C-terminus through a peptide bond. The presence of a chitin binding
domain (CBD) fused to the C-terminus of the intein N-terminal
segment facilitated purification of the precursor protein and the
subsequent in vitro cyclization reaction on chitin resin.
[0032] FIG. 4 is a gel depicting the in vitro trans-splicing of the
Ssp DnaE intein as well as the trans-cleavage reaction.
[0033] FIG. 4A, 10-20% SDS-PAGE gel of peptide induced splicing and
cleavage of MBP-DnaE(N)-CBD (ME(N)B). Lane 1, amylose purified
ME(N)B (64 kDa). Lane 2, ME(N)B, 1 mg/mL, following overnight
incubation with the splicing peptide (Splice-pep, 500:M). The
cleavage product (M) and spliced product (M-CFNK*) co-migrate at 43
kDa. Lane 3, ME(N)B, 1 mg/mL, after overnight incubation with the
cleavage peptide (Cleav-pep, 500:M). Both Splice-pep and Cleav-pep
are based on the C-terminal fragment of the Ssp DnaE intein as
described in the Example III and Example IV.
[0034] FIG. 4B, trans-splicing of MBP-DnaE(N)-CBD (ME(N)B) and
CBD-DnaE(C)-T4 ligase (BE(C)L) examined by 12% SDS-PAGE. Lane 1,
crude cell extract after induction of ME(N)B expression. Lane 2,
ME(N)B following purification over an amylose column. Lane 3,
ME(N)B that was bound to chitin beads and eluted with SDS. The
chitin binding domain (CBD) permits binding to a chitin resin. Lane
4, crude cell extract after induction of BE(C)L expression. Lane 5,
chitin bound BE(C)L that was removed by treatment with SDS. Lane 6,
incubation of amylose-purified ME(N)B and chitin bound BE(C)L at
4.degree. C. for 16 hours followed by elution of the chitin resin
with SDS. The fusion proteins ME(N)B and BE(C)L were bound to
separate batches of chitin beads and the chitin bound proteins were
mixed followed by elution of the beads with SDS after incubation at
4.degree. C. (lane 7), 16.degree. C. (lane 8) or 37.degree. C.
(lane 9) for 16 hours. Lane 10, the supernatant from the chitin
bead mixture described in lane 8. Note that the spliced product
(ML) is free in solution while the reactants remain bound to the
chitin beads. Lane 11, Factor Xa (Fxa) treatment (1:100 FXa:ML) of
the supernatant fraction. M, MBP (43 kDa). L, T4 DNA ligase (58
kDa).
[0035] FIG. 5 is a gel depicting protein circularization in E. coli
and on a chitin column using the intein based technologies
described in the present patent application.
[0036] FIG. 5A, in vivo protein cyclization. Lane 1, uninduced
crude cell extract. Lane 2, crude cell extract following induction
at 15.degree. C. contains the precursor DnaE(C)-MBP-DnaE(N)-CBD
(E(C)ME(N)B, 65 kDa), cyclic MBP (c-MBP, 47 kDa), linear MBP
(1-MBP, 43 kDa), the DnaE(C)-MBP (E(C)M, 45 kDa), and DnaE(N)-CBD
(E(N)B, 23 kDa). Lane 3, clarified cell extract from Lane 2
following passage over an amylose column. Note that the cyclic
maltose binding protein (MBP) binds to amylose. Lane 4, proteins
eluted from amylose resin. Lane 5, the eluted sample incubated with
Factor Xa (1:100 FXa:MBP). FXa treatment also resulted in the
release of a 45 kDa species corresponding to E(C)M.
[0037] FIG. 5B, in vitro protein circularization. Lane 1, uninduced
cell extract. Lane 2, crude cell extract following induction at
37.degree. C. Lane 3, clarified cell extract following passage over
a chitin column. Lane 4, proteins eluted from the chitin column
following incubation at 23.degree. C. for 16 hours. Lane 5,
incubation of the chitin eluted sample with Factor Xa (1:100
FXa:MBP). All reactions were performed as described in Example V
and were analyzed on a 12% SDS-PAGE gel.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0038] The cyclization and ligation methods of the present
invention are based on the discovery that split inteins are capable
of trans-splicing either in vitro or in vivo (U.S. Pat. No.
5,834,247; Mills, et al., Proc. Natl. Acad. Sci. USA, 95(7)
3543-3548 (1998); Otomo, et al., J. Biomol. NMR, 14(2) 105-114
(1999); Shingledecker, et al., Gene, 207(2) 187-195 (1998);
Southworth, et al., EMBO J., 17(4) 918-926 (1998); Yamazaki, et
al., J. Am. Chem. Soc., 120 5591-5592 (1998))
[0039] The ligation procedure disclosed herein utilizes a split
protein splicing element, an intein (Perler, et al., Nucleic Acids
Res., 22 1125-1127 (1994)) to join the N- and C-termini of the same
or separate protein species. Previously, the ligation of the N- and
C-termini of separate protein sequences was described using an
intein (CIVPS) that was artificially split (U.S. Pat. No.
5,834,247; Mills, et al., Proc. Natl. Acad. Sci. USA, 95(7)
3543-3548 (1998); Otomo, et al., J. Biomol. NMR, 14(2) 105-114
(1999); Shingledecker, et al., Gene, 207(2) 187-195 (1998);
Southworth, et al., EMBO J., 17(4) 918-926 (1998); Yamazaki, et
al., J. Am. Chem. Soc., 120 5591-5592 (1998). However, the present
invention describes how a split intein can be used to fuse two
protein segments on a solid support. The present invention relies
on the generation of precursor proteins composed of complementary
intein fragments and the desired target proteins.
[0040] The first step in the ligation of proteins on a solid
support is the generation of the necessary precursor proteins
comprising the intein fragment fused to the target protein at the
genetic level followed by expression of the gene. For example, in
order to create a fusion protein of a C-terminal intein fragment
fused to the N-terminus of a first target protein (target protein
1), the gene encoding the C-terminal intein fragment is cloned in
frame to the gene encoding the target protein 1. The genes are
arranged so that the C-terminus of the C-terminal intein fragment
is fused to the N-terminus of target protein 1.
[0041] Alternatively, the precursor protein comprising an
N-terminal intein fragment fused to a second target protein (target
protein 2) is created by cloning the gene encoding the N-terminal
intein fragment in frame to the gene encoding target protein 2.
Specifically, the genes are arranged so that the C-terminus of
target protein 2 is fused in-frame with the N-terminus of the
N-terminal intein fragment. In either case the new gene fusion is
placed into a context that permits it's transcription and
translation to result in the production of the desired fusion
protein. For example, the fusion genes could be cloned into an E.
coli expression vector such as that described previously for intein
purification vectors (Chong, et al., Gene 192(2):271-281 (1997);
(Evans, et al., Protein Sci., 7:2256-2264 (1998)), but could be any
expression vector system. In addition to the generation of
ribosomally synthesized precursor proteins as described above, the
same fusion proteins could be chemically synthesized using standard
procedures (reviewed in Kent, S. B. H., Annu. Rev. Biochem.,
57:957-989 (1988).
[0042] The intein fragments are chosen to be complementary
trans-splicing domains. For example, the complementary intein
fragments could be chosen from the known trans-splicing inteins,
such as the Ssp DnaE intein, Ssp DnaB intein, Mtu RecA intein, Psp
Pol-1 intein, PI-pfuI intein and PI-pfuII intein (Yamazaki, et al.,
J. Am. Chem. Soc. 120:5591-5592 (1998), Wu, et al., Biochim.
Biophys. Acta, 1387:422-432 (1998), Mills, et al., Proc. Natl.
Acad. Sci. USA, 95(7):3543-3548 (1998), Wu, et al., Proc. Natl.
Acad. Sci. USA, 95(16):9226-9231 (1998), Otomo, et al., J. Biomol.
NMR, 14(2):105-114, Otomo, et al., Biochemistry,
39(49):16040-16044, and Southworth, et al., EMBO J., 17(4):918-926
(1998)). The intein fragments used in the present study were the
N-terminal 123 amino acids and the 36 C-terminal amino acids of the
of the Ssp DnaE intein, respectively.
[0043] An affinity domain can be fused to both or either of the N-
and C-terminal intein splicing domains so that the N- and
C-terminal protein fusion molecules can be immobilized on a solid
support such as an affinity resin. The affinity domain exemplified
herein is the chitin binding domain from B. circulans (Watanabe, et
al., J. Bacteriol., 176:4465-4472 (1994)). Following the generation
of the precursor proteins they are applied to a solid support where
they are immobilized. The nature of the solid support will depend
on the goals of the experiment, but may be an affinity column. The
solid support in the present disclosure is a chitin resin, but
could be any support such as microtiter plates, beads, or materials
used in biochips, such as glass wafers.
[0044] The immobilized proteins are ligated together when favorable
conditions exist to permit the complementary intein fragments from
separate molecules to undergo the trans-splicing reaction.
Favorable conditions include the proper salt concentration, pH,
temperature, or the presence of a molecule, such as a reducing
agent, that facilitates the splicing reaction. The conditions that
favor trans-splicing can be elucidated for the intein fragments
being used by directly testing its performance in vitro in a
variety of conditions. The design of these experiments can be as
described previously for trans-splicing inteins (Yamazaki, et al.,
J. Am. Chem. Soc. 120:5591-5592 (1998), Wu, et al., Biochim.
Biophys. Acta, 1387:422-432 (1998), Mills, et al., Proc. Natl.
Acad. Sci. USA, 95(7):3543-3548 (1998), Wu, et al., Proc. Natl.
Acad. Sci. USA, 95(16):9226-9231 (1998), Otomo, et al., J. Biomol.
NMR, 14(2): 105-114, Otomo, et al., Biochemistry, 39(49):
16040-16044, and Southworth, et al., EMBO J., 17(4):918-926
(1998)). For example, in the present disclosure the Ssp DnaE intein
was found to trans-splice less efficiently at 37.degree. C. than at
15.degree. C. and was less active at pH>10 than at a neutral
pH.
[0045] Following trans-splicing the ligated protein products are no
longer fused to the intein fragments or the affinity domain and so
these products can be isolated by eluting it from the solid
support. In contrast, the unused reactants remain bound. This
permits the localization of the ligation reaction and overcomes
many of the disadvantages and problems of the previous technologies
noted above. Specifically, the present invention allows the facile
separation of the ligated protein species from the unused reactants
and the use of the Ssp DnaE intein eliminates the need for the
denaturant treatment step to permit the trans-splicing
reaction.
[0046] The in vivo cyclization reaction of the instant invention
begins with the in-frame fusion of the gene encoding the C-terminal
splicing domain of an intein to the gene encoding the target
protein and the in-frame fusion of the gene encoding the N-terminal
splicing domain of an intein to the gene encoding the same target
protein. The gene is arranged so that following translation the
C-terminus of the C-terminal splicing domain is fused to the
N-terminus of the target protein and the N-terminus of the
N-terminal splicing domain is fused to the C-terminus of the target
protein. This precursor protein is represented as
Intein.sub.C-target-Intein.sub.N. The intein used in the present
disclosure is the Ssp DnaE intein, but could be any complementary
intein fragments as described above.
[0047] The Intein.sub.C-target-Intein.sub.N fusion gene is placed
into a context that permits its transcription and translation to
result in the production of the desired precursor protein. For
example, the gene could be cloned into an E. coli expression vector
such as those described previously (Chong, et al., Gene
192(2):271-281 (1997); Evans, et al., Protein Sci., 7:2256-2264
(1998). The organisms intracellular environment and the organisms
growth conditions should be favorable for trans-splicing. The
conditions that favor trans-splicing can be elucidated for the
intein fragments being used by directly testing its trans-splicing
activity in the desired organism or by testing its performance in
vitro in a variety of conditions. The design of these experiments
can be as described previously for trans-splicing inteins
(Yamazaki, et al., J. Am. Chem. Soc. 120:5591-5592 (1998), Wu, et
al., Biochim. Biophys. Acta, 1387:422-432 (1998), Mills, et al.,
Proc. Natl. Acad. Sci. USA, 95(7):3543-3548 (1998), Wu, et al.,
Proc. Natl. Acad. Sci. USA, 95(16):9226-9231 (1998), Otomo, et al.,
J. Biomol. NMR, 14(2):105-114, Otomo, et al., Biochemistry,
39(49):16040-16044, and Southworth, et al., EMBO J., 17(4):918-926
(1998)). For example, in the present disclosure the Ssp DnaE intein
was found to trans-splice less efficiently at 37.degree. C. than at
15.degree. C. temperatures. In this case, the E. coli cells
expressing the Intein.sub.C-target-Intein.sub.N precursor should be
grown at 15.degree. C. to facilitate trans-splicing and thereby the
cyclization reaction.
[0048] The cyclization reaction itself occurs when the
trans-splicing of the inteins in the
Intein.sub.C-target-Intein.sub.N precursor generates a peptide bond
between the N- and C-terminus of the target protein. This allows
circular proteins to be produced in organisms that may not normally
be able to do so.
[0049] The in vivo multimerization reaction of the present
invention also begins with an Intein.sub.C-target-Intein.sub.N gene
fusion. However, following expression of the fusion protein the two
complementary intein splicing domains from separate
Intein.sub.C-target-Intein.sub.N precursor proteins initiate the
splicing reaction to ligate the two or more target proteins
together.
[0050] The ratio of the intramolecular reaction, cyclization, to
the intermolecular reaction, multimerization, may be controlled by
engineering the target protein. For example if the N- and
C-terminus of the target protein cannot come into close proximity,
then the cyclization reaction will not be favored and
multimerization should predominate. However, if the N- and
C-terminus of the target protein are spatially close to one
another, then the cyclization reaction should predominate. The
determination of the proximity of the N- and C-terminus of the
target protein can be estimated based on X-ray or NMR structural
data. However, the exact determination of whether the N- and
C-terminus of a target protein can be brought together and ligated
by trans-splicing will need to be determined experimentally. Should
it be discovered that the target protein does not cyclize, then an
extra amino acid linker can be added to facilitate the cyclization
reaction. The number of amino acids needed in the linker to ligate
the ends of the target protein may be determined by adding a linker
of increasing length until cyclization occurs, as determined
experimentally. Alternatively, if X-ray or NMR structural data is
available, then a starting point for the length of the linker would
be to determine the distance between the ends of the target
protein. This distance would be converted into a trial length for
the linker by estimating the number of amino acids needed to span
that distance. However, the final determination if the linker is of
the proper number of amino acids is by experimental verification of
the production of the desired cyclic protein.
[0051] The in vitro cyclization reaction of the present invention
begins with the Intein.sub.C-target-Intein.sub.N gene fusion
arranged as described above. The gene is placed into a context that
permits its expression to generate the precursor protein as
described above. In this example, however, the intracellular
environment of the host organism or its growth conditions should
not favor the trans-splicing reaction. This is to prevent the
cyclization reaction due to trans-splicing from occurring in vivo.
In the present description, the Ssp DnaE intein did not splice
proficiently at 37.degree. C. and so induction of protein
expression was performed at 37.degree. C. Conditions which are not
favorable for intein splicing can be determined for the intein
being used by performing experiments as described above for the
determination of favorable splicing conditions. In addition to the
generation of ribosomally synthesized precursor proteins, the same
fusion protein could be chemically synthesized using standard
procedures (reviewed in Kent, S. B. H., Annu. Rev. Biochem.,
57:957-989 (1988)).
[0052] The full length fusion protein is then purified on a solid
support using an affinity tag. The solid support used in the
present disclosure is a chitin resin, but could be any solid
support such as microtiter plates, beads, or materials used in
biochips such as glass wafers. Furthermore, while the affinity tag
used in the present invention was a chitin binding domain
(Watanabe, et al., J. Bacteriol., 176 4465-4472 (1994)), any
affinity tag such as maltose binding protein, His tag, Flag tag or
the cellulose binding domain could be used. The affinity tag can be
present on none, both, or one of the intein splicing domains.
[0053] Following immobilization of the full length fusion protein
on an affinity resin any unbound protein can be washed away. Cyclic
protein is generated by equilibrating the solid support at
conditions that favor trans-splicing of the intein. In the present
invention the solid support, a chitin resin, with the immobilized
Intein.sub.C-target-Intein.sub.N precursor protein was allowed to
equilibrate to room temperature, which is a temperature that was
determined experimentally to be favorable for trans-splicing of the
Ssp DnaE intein. The optimal conditions for the intein being used
can be determined experimentally as described above. Trans-splicing
of the intein fragments results in a cyclic protein which can be
eluted from the solid support.
[0054] Furthermore, as described for the in vivo case, it is
possible to generate multimers consisting of repeating units of the
target protein. As described above these are generated by an
intermolecular reaction of the Intein.sub.C-target-Intein.sub.N
precursor proteins. The conditions necessary are the same as for in
vitro cyclization with the exception that the intermolecular
reaction should be optimized over the intramolecular reaction. This
needs to be determined experimentally, but can be carried out as
described for the in vivo cyclization reaction.
[0055] The intein based trans-cleavage method of the present
invention begins with the fusion of a target protein to the
N-terminal intein splicing domain. Specifically the C-terminus of
the target protein is fused to the N-terminus of the intein
splicing domain. This Intein.sub.N-target protein fusion may or may
not be purified. Because only a portion of the intein is present no
unwanted intein mediated cleavage occurs in vivo or in vitro. Also,
the precursor can be stored in the presence of reagents that induce
cleavage in other intein fusions or in conditions that promote full
length intein cleavage. Cleavage is initiated by adding the
C-terminal intein splicing domain. This may be synthetic or
ribosomally synthesized. In the present disclosure both a native
and a modified C-terminal intein domain were used to induce
cleavage of the peptide bond at the N-terminus of the complementary
intein fragment, the N-terminal intein splicing domain. Mutations
that may be made to block intein splicing activity, but which can
still allow cleavage of certain peptide bonds adjacent to the
intein have been described previously (Chong, et al., Gene,
192(2):271-281 (1997), Chong, et al., Nucleic Acids Res.
26(22):5109-5115 (1998), Evans, et al., Protein Sci., 7:2256-2264
(1998), Mathys, et al., Gene 231:1-13 (1999), Evans, et al., J.
Biol. Chem., 274:3923-3926 (1999), Southworth, et al.,
Biotechniques, 27:110-120 (1999) and Wood, et al., Nature
Biotechnology, 17(9):889-892 (1999) and reviewed in Evans, et al.,
Biopolymers, 51(5):333-342 (1999) and Noren, et al., Angewandte
Chemie Int. Ed., 39:450-466 (2000)). Alternatively, the target
protein could be fused to the C-terminal intein splicing domain.
Specifically, the N-terminus of the target protein is fused to the
C-terminus of the intein splicing domain. Cleavage is induced by
adding the N-terminal splicing domain with or without a mutation to
block splicing activity. In either of the above cases, the
precursor protein may or may not be purified. Purification would be
simplified using an affinity domain attached to the intein tag. The
precursor would be immobilized on the appropriate affinity column
and unbound proteins could be washed away. Cleavage would be
initiated by adding the appropriate intein splicing domain. The
trans-cleavage reaction could be accelerated using reagents or
conditions known to induce or increase the rate of cleavage in
other inteins, for example thiol reagents, pH, or temperature
(Chong, et al., Gene, 192(2):271-281 (1997), Chong, et al., Nucleic
Acids Res. 26(22):5109-5115 (1998), Evans, et al., Protein Sci.,
7:2256-2264 (1998), Mathys, et al., Gene 231:1-13 (1999), Evans, et
al., J. Biol. Chem., 274:3923-3926 (1999), Southworth, et al.,
Biotechniques, 27:110-120 (1999) and Wood, et al., Nature
Biotechnology, 17(9):889-892 (1999) and reviewed in Evans, et al.,
Biopolymers, 51(5):333-342 (1999) and Noren, et al., Angewandte
Chemie Int. Ed., 39:450-466 (2000)).
[0056] The present invention is further illustrated by the
following Examples. These Examples are provided to aid in the
understanding of the invention and are not construed as a
limitation thereof.
[0057] The references cited above and below are herein incorporated
by reference.
Example I
Creation of Vectors pMEB1, pMEB2, pMEB3 for Cis-Splicing
Studies
[0058] Construction of Plasmids-pMEB 1 was constructed by replacing
the Sce VMA intein in pMYB129 (Chong, et al., Gene 192(2):271-281
(1997)) with the Ssp DnaE intein sequence spanning residues 5-123
to create a fusion gene composed of E. coli maltose-binding protein
(MBP) (Duplay, et al., J. Biol. Chem. 259:10606-10613 (1984)), the
Ssp DnaE intein (residues 5-123) and the Bacillus circulans chitin
binding domain (CBD) (Watanabe, et al., J. Bacteriol. 176:4465-4472
(1994)). The Ssp DnaE intein fragment was amplified from plasmid
pDnaE-C209 with primers 5'-TTTGGTACCGAAATTTTAACCGTTGAG-3' (SEQ ID
NO:1) and 5'-GGCTCTTCCTTTAATTGTCCCAGCGTCAAG-3' (SEQ ID NO:2). The
N-terminal splice junction sequence, containing the flanking 5
native N-extein residues and the 5 intein N-terminal residues, was
inserted between maltose binding protein (MBP) and the intein
coding regions by linker insertion into the XhoI and KpnI sites in
pMEB1 to create pMEB2. The linker was formed by annealing
oligonucleotides, 5'-TCGAGAAATTTGCTGAATATTGCCTGTCT TTTGGTAC-3' (SEQ
ID NO:3) and 5'-CAAAAGACAGGCAATATTCAGCAA ATTTC-3' (SEQ ID
NO:4).
[0059] The DNA sequence encoding the C-terminal 36 amino acid
residues and the first 3 C-extein residues
(5'-ATGGTTAAAGTTATCGGTCGTAGATCTCTGGG
CGTGCAGCGCATCTTTGATATCGGTCTGCCGCAGGACCATAACTTTCT G
CTAGCCAACGGCGCTATCGCTGCTAACTGCTTTAACAAATCC-3' (SEQ ID NO:5)) was
inserted into pMEB2 to create pMEB3 which expresses a fusion
protein (MEB) composed of maltose binding protein (MBP), the full
length Ssp DnaE intein (residues 1-159) with 5 native extein
residues at its N-terminus and 3 native residues at its C-terminus,
and the chitin binding domain (CBD).
Creation of Vectors pMEB4, pKEB1, pBEL11, and pMEB8 for
Trans-Splicing Studies:
[0060] A translation termination codon was introduced into pMEB2
following the codon for Lys.sup.123 of the Ssp DnaE intein by
insertion of a linker formed by annealing oligonucleotides
5'-AAATAAGGAGGTTAATAAAAGGAAGA GCCATGGCGCGCCTTAATTAAA-3' (SEQ ID
NO:6) and 5'-CCGGT TTAATTAAGGCGCGCCATGGCTCTTCCTTTFATTAACCTCCTTA-3'
(SEQ ID NO:7). The resulting plasmid, pMEB4, expresses a fusion
protein composed of maltose binding protein (MBP) and the
N-terminal 123 residues of the Ssp DnaE intein [DnaE(N)]. pKEB1
contains the kanamycin resistance gene and the p15a origin of
replication from pACYC177 (Chang and Cohen, J. Bacteriol.
134:1141-1156 (1978)). It also expresses a fusion protein composed
of the 36 C-terminal amino acids of the Ssp DnaE intein [DnaE(C)]
followed by 3 native extein residues and the chitin binding domain
(CBD). pBEL11 expresses a CBD-DnaE(C)-T4 DNA ligase fusion protein
in the pBSL-C155 vector (Mathys, et al., Gene 231:1-13 (1999)).
[0061] pMEB8 was generated by transferring the 0.6 kb XhoI to PstI
fragment of pMEB3 into pMYB5 (New England Biolabs, Inc., Beverly,
Mass.). Mutation of the extein residues in pMEB8 was performed by
linker substitutions using the XhoI and KpnI sites flanking the
N-terminal splice junction or the NheI and AgeI sites flanking the
C-terminal splice junction. pMEB8-N2 retains 2 native N-extein
residues while pMEB8-C1, C2, or C3 possess 1, 2 or 3 native
C-extein residues (FIG. 1).
Creation of Vector pMEB21 for In Vivo and In Vitro Cyclization
Studies:
[0062] The protein cyclization vector, pMEB21, expresses a fusion
protein with the DnaE(C) immediately followed by amino acid
residues CFNISTG (SEQ ID NO:8), maltose binding protein (MBP),
which terminates with amino acid residues GTLEKFAEY (SEQ ID NO:9),
and then DnaE(N)-CBD.
Example II
The Cis-Splicing Activity of the Ssp DnaE Intein In Vivo
[0063] The in vivo splicing activity of the full length Ssp DnaE
intein was investigated by analyzing protein expression from E.
coli ER2566 cells (Chong, et al., Gene 192(2):271-281 (1997))
bearing plasmid pMEB8. The cells bearing the plasmid were grown in
LB medium containing the appropriate antibiotic selection at
37.degree. C. with shaking to an OD.sub.600 of 0.5. Protein
expression was induced by the addition of 0.3 mM Isopropyl
.beta.-D-Thiogalactopyranoside (IPTG) at either 15.degree. C. for
16 h or at 37.degree. C. for 2 h. Crude cell extracts were
visualized by electrophoresis on a 12% Tris-Glycine gel (Novex, San
Diego, Calif.) followed by staining with Coomassie Brilliant
Blue.
Example III
The Ligation of Two Protein In Vivo Using Trans-Splicing
[0064] The in vivo trans-splicing activity of the Ssp DnaE intein
was demonstrated by analyzing the proteins from E. coli strain
ER2566 (Chong, et al., Gene 192(2):271-281 (1997)) bearing the two
compatible plasmids, pMEB4 and pKEB1. The E. coli bearing the
plasmids were grown in LB medium containing the appropriate
antibiotics (50 .mu.g/mL kanamycin and 50 .mu.g/mL ampicillin) at
37.degree. C. with shaking until an OD.sub.600 of 0.5 was reached.
Protein expression was induced by the addition of 0.3 mM Isopropyl
.beta.-D-Thiogalactopyranoside (IPTG) at either 15.degree. C. for
16 h or at 37.degree. C. for 2 h. Crude cell extracts were
visualized by electrophoresis on a 12% Tris-Glycine gel (Novex, San
Diego, Calif.) followed by staining with Coomassie Brilliant
Blue.
Protein Purification for in vitro trans-splicing or trans-cleavage
reactions:
[0065] ER2566 cells containing pMEB2 or pBEL11 were grown at
37.degree. C. to an OD.sub.600 of 0.5. Following IPTG (0.5 mM)
induced protein expression overnight at 15.degree. C., cells were
harvested by centrifugation at 3,000.times.g for 30 minutes. The
MBP-DnaE(N)-CBD (ME(N)B) fusion protein was purified by amylose as
described previously (Evans, et al., Protein Sci., 7:2256-2264
(1998)). The cell pellet was resuspended in Buffer A (20 mM
Tris-HCl, pH 7.0 containing 500 mM NaCl) and lysed by sonication.
After centrifugation at 23,000.times.g for 30 minutes the
supernatant was applied to a 15 ml amylose resin (New England
Biolabs, Inc., Beverly, Mass.) equilibrated in Buffer A. The resin
was washed with 10-15 column volumes of Buffer A. The fusion
protein was eluted with Buffer B (20 mM Tris-HCl, pH 7.0 containing
500 mM NaCl and 10 mM maltose). Protein concentrations were
determined using the Bio-Rad Protein Assay (Bio-Rad Laboratories,
Hercules, Calif.).
Example IV
In Vitro Trans-Splicing and/or Trans-Cleavage
[0066] Trans-splicing and/or trans-cleavage studies of the Ssp DnaE
intein were conducted in vitro using the purified ME(N)B and two 40
amino acid peptides, synthesized as described previously (Evans, et
al., Protein Sci. 7:2256-2264 (1998)), consisting of the C-terminal
36 amino acids of the Ssp DnaE intein, with either an Asn
(Splice-pep) or an Ala at residue 36 (Cleav-pep), and the next four
naturally occurring amino acids (CFNK). The splicing peptide had a
biotinylated lysine (K*) as the C-terminal residue. The reaction
consisted of adding either the splicing or cleavage peptide (500:M
final concentration) to ME(N)B (1 mg/ml) in reaction buffer (100 mM
Tris-HCl, pH 7.0 containing 500 mM NaCl) followed by incubation
overnight at room temperature. The on-column trans-splicing used
the CBD-DnaE(C)-T4 DNA ligase protein absorbed onto a chitin resin
in which unbound protein was washed off with 20 column volumes of
Buffer A. The ME(N)B fusion protein (9:M), either free in solution
or pre-bound to chitin beads, was then added to the chitin bound
CBD-DnaE(C)-T4 DNA ligase (3:M). The reactions were then incubated
for 16 hours at the appropriate temperature in Buffer A and
monitored by SDS-PAGE.
Example V
In Vitro and In Vivo Protein Cyclization Using a Trans-Splicing
Intein
[0067] ER2566 cells bearing pMEB21 were grown, induced, harvested
and lysed as described in Example II and Example III. The clarified
supernatant from cells induced at 15.degree. C. was applied to an
amylose resin (10 mL bed volume) whereas the clarified supernatant
from cells induced at 37.degree. C. was applied to a chitin resin
(15 mL bed volume). Unbound proteins were washed from the resin
with 20 column volumes of Buffer A. Proteins were eluted from the
amylose column with Buffer B. The intramolecular trans-splicing
reaction proceeded in vitro when the chitin column was incubated
for 20 hours at room temperature. Reaction products were eluted
from the resin with Buffer A. The cyclic maltose binding protein
(MBP) was analyzed by treatment with Factor Xa (Fxa) (1:100,
FXa:protein mass to mass ratio) overnight at 4.degree. C. to
generate linearized MBP. The proteolyzed proteins were subjected to
amino acid sequencing using a Procise 494 protein sequencer (PE
Applied Biosystems, Foster City, Calif.).
Example VI
The Ligation of Maltose Binding Protein and the Chitin Binding
Domain Using a Cis-Splicing Intein
[0068] A gene fusion was created in which full length Ssp DnaE
intein had maltose binding protein (MBP, 42 kDa) fused to its
N-terminus and the chitin binding domain fused to its C-terminus.
This fusion protein was expressed from the from the ER2566 cells
bearing plasmid pMEB8 as described in FIG. 1 and in Example II and
Example III above. A band corresponding to the ligation of maltose
binding protein and the chitin binding domain (MBP-CBD) (MB)
following induction of protein expression demonstrated that the Ssp
DnaE intein can splice in cis with only 5 native N-terminal and 3
native C-terminal extein residues (FIG. 2A, lane 2). The identity
of splicing products was confirmed by western blot analysis using
anti-maltose binding protein (anti-MBP) and anti-chitin binding
domain (anti-CBD) antibodies and binding to chitin and amylose
resins (data not shown). In addition to the spliced product, there
was significant cleavage of the peptide bond at the N-terminus of
the Ssp DnaE intein.
Example VII
Alteration of Cis-Splicing by Changing the Amino Acids Adjacent to
the Intein
[0069] The amino acids adjacent to the intein (the extein amino
acid residues) were changed by mutation in the cis-splicing
construct (FIG. 2B). Splicing products were detected upon induction
of ER2566 E. coli cells bearing plasmids pMEB8, pMEB8-N2, or
pMEB8-C3 as described in Example I above. These results
demonstrated that splicing could occur with either 2 proximal
N-extein residues or 3 proximal C-extein residues (FIG. 1 and FIG.
2B, lanes 1 & 4). However, analysis of protein expression
following induction of ER2566 E. coli cells bearing plasmids
pMEB8-C1 or pMEB8-C2 as described above in Example I did not detect
any MBP-CBD fusion protein. This demonstrated that splicing
activity could be altered by reduction of the C-extein sequence to
1 or 2 native amino acid residues (FIG. 2B, lanes 2 & 3).
Example VIII
Temperature Dependent Trans-Splicing of the Ssp DnaE Intein
[0070] The extent of in vivo trans-splicing varied depending on the
temperature of the E. coli cell growth during induction of protein
expression. E. coli ER2566 bearing plasmids pMEB4 and pKEB1 were
induced to express protein as described above in Example II. The
temperature at which the E. coli cells were incubated following
induction was either 37.degree. C. or 15.degree. C. There was an
accumulation of Ssp DnaE intein precursor protein when protein
expression was induced at 37.degree. C. and this was processed
after further growth overnight at 15.degree. C. (FIG. 2A and FIG.
2C).
Example IX
The Ligation of Two Ribosomally Expressed Proteins In Vitro Using
the Trans-Splicing Ssp DnaE Intein
[0071] Maltose binding protein was ligated to T4 DNA ligase by
first purifying Maltose binding protein fused to the N-terminus of
the N-terminal splicing domain of the Ssp DnaE intein. The chitin
binding domain was present as an in-frame fusion to the C-terminus
of the Ssp DnaE intein N-terminal splicing domain. This fusion
protein is expressed from plasmid pMEB8 as described in Example II
and is abbreviated MBP-DnaE(N)-CBD. T4 DNA ligase was purified
separately as a fusion to the C-terminus of the C-terminal splicing
domain of the Ssp DnaE intein. The chitin binding domain was
present as an in-frame fusion to the N-terminus of the Ssp DnaE
intein C-terminal splicing domain. This fusion protein is expressed
from plasmid pBEL11 and is abbreviated CBD-DnaE(C)-T4 DNA ligase.
These two proteins were bound to a chitin resin through the chitin
binding domain regions. Efficient in vitro trans-splicing occurred
between the two bacterially-expressed proteins, MBP-DnaE(N)--CBD
and CBD-DnaE(C)-T4 DNA ligase, yielding spliced product, MBP-T4 DNA
Ligase (ML), at 4.degree. C. and 16.degree. C. but significantly
less at 37.degree. C. (FIG. 4B). Little difference in splicing
efficiency was observed when either chitin bound or free ME(N)B was
used to react with the chitin bound BE(C) ligase. Following Factor
Xa (Fxa) proteolysis of the released ligation product, amino acid
sequencing of the 58 kDa band (expected for T4 DNA ligase) yielded
NH.sub.2-GTLEKFAEYCFNIST-COOH (SEQ ID NO:10) which corresponds to
the expected sequence of the splice junction.
Example X
In Vitro Trans-Cleavage or Trans-Splicing Using a Synthetic
Peptide
[0072] The in vitro trans-splicing (FIG. 3) and/or trans-cleavage
activity of the Ssp DnaE intein was demonstrated using the
bacterially-expressed ME(N)B precursor and 2 peptides, Splice-pep
and Cleav-pep, that mimic the C-terminal Ssp DnaE intein fragment
(see Example IV above). Both the Splice-pep and the Cleav-pep could
activate ME(N)B, resulting in bands corresponding to the expected
spliced and/or cleavage product (FIG. 4A). Furthermore, the ME(N)B
precursor was stable in the absence of either peptide (FIG. 4A,
lane 1). The cleavage and splicing products, maltose binding
protein (MBP) and MBP-CFNK*, respectively, are indistinguishable by
SDS-PAGE. However, a western blot using anti-biotin antibody
indicated that splicing was occurring, albeit the extent of
reaction could not be determined (data not shown).
Example XI
In Vivo Protein Cyclization Using the Ssp DnaE Intein
[0073] Maltose binding protein was cyclized both in vitro and in
vivo using the Ssp DnaE intein. The C-terminus of the C-terminal
Ssp DnaE intein splicing domain was fused to the N-terminus of
maltose binding protein and the N-terminus of the N-terminal Ssp
DnaE intein splicing domain was fused to the C-terminus of the same
maltose binding protein. The N-terminal splicing domain of the Ssp
DnaE intein also had the chitin binding domain fused in-frame to
its C-terminus. This fusion protein, abbreviated
DnaE(C)-MBP-DnaE(N)-CBD, was expressed in E. coli ER2566 cells
bearing plasmid pMEB21 as described in Example V above. Following
induction of the cells bearing plasmid pMEB21 the crude cell lysate
was analyzed by SDS-PAGE (FIG. 5A, lane 2) and western blot
analysis and demonstrated that cells expressing pMEB21 contained
precursor protein, DnaE(C)-MBP-DnaE(N)-CBD, linear MBP, circular
MBP, DnaE(N)-CBD, and DnaE(C)-MBP. The putative linear and cyclic
MBP species as well as higher molecular weight species (FIG. 5A,
lane 4) were found to bind to amylose and elute with maltose.
Example XII
In Vitro Protein Cyclization Using the Ssp DnaE Intein
[0074] In vitro cyclization was performed by isolating the
precursor consisting of DnaE(C)-MBP-DnaE(N)-CBD which could be
obtained by inducing protein expression of E. coli ER2566 bearing
plasmid pMEB21 for 2 hours at 37.degree. C. (FIG. 5B, lane 2) as
described in Example V above. The crude cell lysate was applied to
a chitin resin to which the precursor bound through the CBD.
Unbound proteins were washed from the column and the cyclization
reaction proceeded overnight at 23.degree. C. Fractions from the
chitin resin contained cyclic and linear MBP species (FIG. 5B, lane
4). Factor Xa (Fxa) treatment of the isolated proteins (FIG. 5B,
lane 5) followed by amino acid sequencing confirmed the presence of
both the linear and circular forms.
Example XIII
Amino Acid Sequencing of the Ligation Junction of Cyclic MBP
[0075] The maltose eluted proteins were subjected to Factor Xa
(Fxa) proteolysis and amino acid sequencing. The upper portion of
the 43 kDa band yielded NH.sub.2-G TLEKFAEYXFNISTGM-COOH (SEQ ID
NO:11) which matched the sequence for the cyclic maltose binding
protein (MBP) that was linearized with Factor Xa (Fxa). Sequencing
the lower part of the 43 kDa band gave NH.sub.2-XFNISTGM-COOH (SEQ
ID NO:12) which matched the N-terminus of the linear maltose
binding protein (MBP) which had not undergone cyclization.
NH.sub.2-XVKIG RRSLGV-COOH (SEQ ID NO:13) was obtained from the 45
kDa band and correlates with the expected sequence from the
DnaE(C)-MBP product. The X designates a sequencing cycle in which
no amino acid could be assigned with confidence.
Sequence CWU 1
1
13127DNAartificialprimer 1tttggtaccg aaattttaac cgttgag
27230DNAartificialprimer 2ggctcttcct ttaattgtcc cagcgtcaag
30337DNAunknownoligonucleotide 3tcgagaaatt tgctgaatat tgcctgtctt
ttggtac 37429DNAunknownoligonucleotide 4caaaagacag gcaatattca
gcaaatttc 295123DNAartificialDNA sequence encoding the C-terminal
36 amino acid residues and the first 3 C-extein residues of the
DnaE intein from Synechocystis sp. 6803 5atggttaaag ttatcggtcg
tagatctctg ggcgtgcagc gcatctttga tatcggtctg 60ccgcaggacc ataactttct
gctagccaac ggcgctatcg ctgctaactg ctttaacaaa 120tcc
123648DNAartificialoligonucleotides 6aaataaggag gttaataaaa
ggaagagcca tggcgcgcct taattaaa 48749DNAartificialoligonucleotide
7ccggtttaat taaggcgcgc catggctctt ccttttatta acctcctta
4987PRTartificialcompleted synthesized 8Cys Phe Asn Ile Ser Thr
Gly1 599PRTartificialcompletely synthesized 9Gly Thr Leu Glu Lys
Phe Ala Glu Tyr1 51015PRTartificialcompletely synthesized 10Gly Thr
Leu Glu Lys Phe Ala Glu Tyr Cys Phe Asn Ile Ser Thr1 5 10
151117PRTartificialcompletely synthesized 11Gly Thr Leu Glu Lys Phe
Ala Glu Tyr Xaa Phe Asn Ile Ser Thr Gly1 5 10
15Met128PRTartificialcompletely synthesized 12Xaa Phe Asn Ile Ser
Thr Gly Met1 51311PRTartificialcompletely synthesized 13Xaa Val Lys
Ile Gly Arg Arg Ser Leu Gly Val1 5 10
* * * * *