U.S. patent application number 11/968702 was filed with the patent office on 2009-01-29 for fibroblast growth factor-14.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Patrick J. Dillon, John M. Greene.
Application Number | 20090029916 11/968702 |
Document ID | / |
Family ID | 23835371 |
Filed Date | 2009-01-29 |
United States Patent
Application |
20090029916 |
Kind Code |
A1 |
Greene; John M. ; et
al. |
January 29, 2009 |
Fibroblast Growth Factor-14
Abstract
Disclosed is a human Fibroblast growth factor-14 polypeptide and
DNA(RNA) encoding such polypeptide. Also provided is a procedure
for producing such polypeptide by recombinant techniques. Also
disclosed are methods for utilizing such polypeptide for promoting
wound healing for example as a result of burns and ulcers, to
prevent neuronal damage due to associated with stroke and promote
neuronal growth, and to prevent skin aging and hair loss, to
stimulate angiogenesis, mesodermal induction in early embryos and
limb regeneration. Antagonists against such polypeptides and their
use as a therapeutic to prevent abnormal cellular proliferation,
hyper-vascular diseases and epithelial lens cell proliferation are
also disclosed. Diagnostic methods for detecting mutations in the
coding sequence and alterations in the concentration of the
polypeptides in a sample derived from a host are also
disclosed.
Inventors: |
Greene; John M.;
(Gaithersburg, MD) ; Dillon; Patrick J.;
(Carlsbad, CA) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
23835371 |
Appl. No.: |
11/968702 |
Filed: |
January 3, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10787879 |
Feb 27, 2004 |
7338934 |
|
|
11968702 |
|
|
|
|
08462159 |
Jun 5, 1995 |
6787640 |
|
|
10787879 |
|
|
|
|
Current U.S.
Class: |
514/1.1 ; 435/29;
435/320.1; 435/325; 435/455; 435/6.16; 435/69.1; 514/19.5; 514/44R;
514/8.1; 514/9.1; 530/387.9; 536/23.1 |
Current CPC
Class: |
C07K 14/50 20130101;
A61K 38/00 20130101; C12N 2799/026 20130101 |
Class at
Publication: |
514/12 ;
536/23.1; 435/320.1; 435/69.1; 435/325; 435/455; 530/387.9; 514/44;
435/29; 435/6 |
International
Class: |
C07K 14/475 20060101
C07K014/475; C12N 15/11 20060101 C12N015/11; C12N 15/85 20060101
C12N015/85; C12P 21/02 20060101 C12P021/02; C12N 5/10 20060101
C12N005/10; A61K 38/18 20060101 A61K038/18; C07K 16/00 20060101
C07K016/00; A61K 31/7088 20060101 A61K031/7088; C12Q 1/02 20060101
C12Q001/02; C12Q 1/68 20060101 C12Q001/68 |
Claims
1. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding the polypeptide
comprising amino acid 1 to amino acid 225 as set forth in SEQ ID
NO:2; (b) a polynucleotide encoding the polypeptide comprising
amino acid 27 to amino acid 225 as set forth in SEQ ID NO:2; (c) a
polynucleotide capable of hybridizing to and which is at least 70%
identical to the polynucleotide of (a) or (b); and (d) a
polynucleotide fragment of the polynucleotide of (a), (b) or
(c).
2. The polynucleotide of claim 1 wherein the polynucleotide is
DNA.
3. The polynucleotide of claim 1 comprising from nucleotide 1 to
nucleotide 679 as set forth in SEQ ID NO:1.
4. The polynucleotide of claim 1 comprising from nucleotide 79 to
nucleotide 679 as set forth in SEQ ID NO:1.
5. An isolated polynucleotide comprising a member selected from the
group consisting of: (a) a polynucleotide encoding a mature
polypeptide encoded by the DNA contained in ATCC.TM. Deposit No.
PTA-974; (b) a polynucleotide encoding the polypeptide expressed by
the DNA contained in ATCC.TM. Deposit No. PTA-974; (c) a
polynucleotide capable of hybridizing to and which is at least 70%
identical to the polynucleotide of (a) or (b); and (d) a
polynucleotide fragment of the polynucleotide of (a), (b) or
(c).
6. A vector containing the DNA of claim 2.
7. A host cell genetically engineered with the vector of claim
6.
8. A process for producing a polypeptide comprising: expressing
from the host cell of claim 7 the polypeptide encoded by said
DNA.
9. A process for producing cells capable of expressing a
polypeptide comprising genetically engineering cells with the
vector of claim 6.
10. A polypeptide comprising a member selected from the group
consisting of (i) a polypeptide having the deduced amino acid
sequence of SEQ ID NO:2 and fragments, analogs and derivatives
thereof, and (ii) a polypeptide encoded by the cDNA of ATCC.TM.
Deposit No. PTA-974 and fragments, analogs and derivatives of said
polypeptide.
11. An antibody against the polypeptide of claim 10.
12. A compound which inhibits the biological actions of the
polypeptide of claim 10.
13. A compound which activates a receptor to the polypeptide of
claim 10.
14. A method for the treatment of a patient having need of an
FGF-14 polypeptide comprising: administering to the patient a
therapeutically effective amount of the polypeptide of claim
10.
15. A method for the treatment of a patient having need to inhibit
an FGF-14 polypeptide comprising: administering to the patient a
therapeutically effective amount of the compound of claim 12.
16. The method of claim 14 wherein said therapeutically effective
amount of said polypeptide is administered by providing to the
patient DNA encoding said polypeptide and expressing said
polypeptide in vivo.
17. The method of claim 15 wherein said compound is a polypeptide
and a therapeutically effective amount of the compound is
administered by providing to the patient DNA encoding said
antagonist and expressing said antagonist in vivo.
18. A process for identifying compounds active as agonists to the
polypeptide of claim 10 comprising: (a) combining a compound to be
screened and a reaction mixture containing cells under conditions
where the cells are normally stimulated by said polypeptide, said
reaction mixture containing a label incorporated into the cells as
they proliferate; and (b) determining the extent of proliferation
of the cells to identify if the compound is an effective
agonist.
19. A process for identifying compounds active as antagonists to
the polypeptide of claim 10 comprising: (a) combining a compound to
be screened, the polypeptide and a reaction mixture containing
cells under conditions where the cells are normally stimulated by
said polypeptide, said reaction mixture containing a label
incorporated into the cells as they proliferate; and (b)
determining the extent of proliferation of the cells to identify if
the compound is an effective antagonist.
20. A process for diagnosing a disease or a susceptibility to a
disease related to an under-expression of the polypeptide of claim
10 comprising: determining a mutation in the nucleic acid sequence
encoding said polypeptide.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/787,879, filed Feb. 27, 2004, which is a divisional of U.S.
application Ser. No. 08/462,159, filed Jun. 5, 1995 (now U.S. Pat.
No. 6,787,640), each of which is hereby incorporated by reference
herein in its entirety. Statement Under 37 C.F.R. .sctn.
1.77(b)(5)
[0002] This application refers to a "Sequence Listing" listed
below, which is provided as a text document. The document is
entitled "PF176D2_SeqList.txt" (13,272 bytes, created Feb. 27,
2004), and is hereby incorporated by reference in its entirety
herein.
BACKGROUND OF THE INVENTION
[0003] This invention relates to newly identified polynucleotides,
polypeptides encoded by such polynucleotides, the use of such
polynucleotides and polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptide of the present invention have been putatively
identified as fibroblast growth factor/heparin binding growth
factor, hereinafter referred to as "FGF-14". The invention also
relates to inhibiting the action of such polypeptides.
[0004] Fibroblast growth factors are a family of proteins
characteristic of binding to heparin and are, therefore, also
called heparin binding growth factors (HBGF). Expression of
different members of these proteins are found in various tissues
and are under particular temporal and spatial control. These
proteins are potent mitogens for a variety of cells of mesodermal,
ectodermal, and endodermal origin, including fibroblasts, corneal
and vascular endothelial cells, granulocytes, adrenal cortical
cells, chondrocytes, myoblasts, vascular smooth muscle cells, lens
epithelial cells, melanocytes, keratinocytes, oligodendrocytes,
astrocytes, osteoblasts, and hematopoietic cells.
[0005] Each member has functions overlapping with others and also
has its unique spectrum of functions. In addition to the ability to
stimulate proliferation of vascular endothelial cells, both FGF-1
and 2 are chemotactic for endothelial cells and FGF-2 has been
shown to enable endothelial cells to penetrate the basement
membrane. Consistent with these properties, both FGF-1 and 2 have
the capacity to stimulate angiogenesis. Another important feature
of these growth factors is their ability to promote wound healing.
Many other members of the FGF family share similar activities with
FGF-1 and 2 such as promoting angiogenesis and wound healing.
Several members of the FGF family have been shown to induce
mesoderm formation and to modulate differentiation of neuronal
cells, adipocytes and skeletal muscle cells.
[0006] Other than these biological activities in normal tissues,
FGF proteins have been implicated in promoting tumorigenesis in
carcinomas and sarcomas by promoting tumor vascularization and as
transforming proteins when their expression is deregulated.
[0007] The FGF family presently consists of eight
structurally-related polypeptides: basic FGF, acidic FGF, int 2,
hst 1/k-FGF, FGF-5, FGF-6, keratinocyte growth factor, AIGF (FGF-8)
and recently a glia-activating factor has been shown to be a novel
heparin-binding growth factor which was purified from the culture
supernatant of a human glioma cell line (Miyamoto, M. et al., Mol.
and Cell. Biol., 13(7):4251-4259 (1993). The genes for each have
been cloned and sequenced. Two of the members, FGF-1 and FGF-2,
have been characterized under many names, but most often as acidic
and basic fibroblast growth factor, respectively. The normal gene
products influence the general proliferation capacity of the
majority of mesoderm and neuroectoderm-derived cells. They are
capable of inducing angiogenesis in vivo and may play important
roles in early development (Burgess, W. H. and Maciag, T., Annu.
Rev. Biochem., 58:575-606, (1989)).
[0008] Many of the above-identified members of the FGF family also
bind to the same receptors and elicit a second message through
binding to these receptors.
[0009] A eukaryotic expression vector encoding a secreted form of
FGF-1 has been introduced by gene transfer into porcine arteries.
This model defines gene function in the arterial wall in vivo.
FGF-1 expression induced intimal thickening in porcine arteries 21
days after gene transfer (Nabel, E. G., et al., Nature, 362:844-6
(1993)). It has further been demonstrated that basic fibroblast
growth factor may regulate glioma growth and progression
independent of its role in tumor angiogenesis and that basic
fibroblast growth factor release or secretion may be required for
these actions (Morrison, R. S., et al., J. Neurosci. Res., 34:502-9
(1993)).
[0010] Fibroblast growth factors, such as basic FGF, have further
been implicated in the growth of Kaposi's sarcoma cells in vitro
(Huang, Y. Q., et al., J. Clin. Invest., 91:1191-7 (1993)). Also,
the cDNA sequence encoding human basic fibroblast growth factor has
been cloned downstream of a transcription promoter recognized by
the bacteriophage T7 RNA polymerase. Basic fibroblast growth
factors so obtained have been shown to have biological activity
indistinguishable from human placental fibroblast growth factor in
mitogenicity, synthesis of plasminogen activator and angiogenesis
assays (Squires, C. H., et al., J. Biol. Chem., 263:16297-302
(1988)).
[0011] U.S. Pat. No. 5,155,214 discloses substantially pure
mammalian basic fibroblast growth factors and their production. The
amino acid sequences of bovine and human basic fibroblast growth
factor are disclosed, as well as the DNA sequence encoding the
polypeptide of the bovine species.
[0012] Newly discovered FGF-9 has around 30% sequence similarity to
other members of the FGF family. Two cysteine residues and other
consensus sequences in family members were also well conserved in
the FGF-9 sequence. FGF-9 was found to have no typical signal
sequence in its N terminus like those in acidic and basic FGF.
However, FGF-9 was found to be secreted from cells after synthesis
despite its lack of a typical signal sequence FGF (Miyamoto, M. et
al., Mol. and Cell. Biol., 13(7):4251-4259 (1993). Further, FGF-9
was found to stimulate the cell growth of oligodendrocyte type 2
astrocyte progenitor cells, BALB/c3T3, and PC-12 cells but not that
of human umbilical vein endothelial cells (Naruo, K., et al., J.
Biol. Chem., 268:2857-2864 (1993).
[0013] Basic FGF and acidic FGF are potent modulators of cell
proliferation, cell motility, differentiation, and survival and act
on cell types from ectoderm, mesoderm and endoderm. These two FGFs,
along with KGF and AIGF, were identified by protein purification.
However, the other four members were isolated as oncogenes.,
expression of which was restricted to embryogenesis and certain
types of cancers. FGF-9 was demonstrated to be a mitogen against
glial cells. Members of the FGF family are reported to have
oncogenic potency. FGF-9 has shown transforming potency when
transformed into BALB/c3T3 cells (Miyamoto, M., et al., Mol. Cell.
Biol., 13(7):4251-4259 (1993).
[0014] Androgen induced growth factor (AIGF), also known as FGF-8,
was purified from a conditioned medium of mouse mammary carcinoma
cells (SC-3) simulated with testosterone. AIGF is a distinctive
FGF-like growth factor, having a putative signal peptide and
sharing 30-40% homology with known members of the FGF family.
Mammalian cells transformed with AIGF shows a remarkable
stimulatory effect on the growth of SC-3 cells in the absence of
androgen. Therefore, AIGF mediates androgen-induced growth of SC-3
cells, and perhaps other cells, since it is secreted by the tumor
cells themselves.
BRIEF SUMMARY OF THE INVENTION
[0015] The polypeptide of the present invention has been putatively
identified as a member of the FGF family as a result of amino acid
sequence homology with other members of the FGF family.
DETAILED DESCRIPTION
[0016] In accordance with one aspect of the present invention,
there are provided novel mature polypeptides as well as
biologically active and diagnostically or therapeutically useful
fragments, analogs and derivatives thereof. The polypeptides of the
present invention are of human origin.
[0017] In accordance with another aspect of the present invention,
there are provided isolated nucleic acid molecules encoding the
polypeptides of the present invention, including mRNAs, DNAs,
cDNAs, genomic DNA, as well as antisense analogs thereof and
biologically active and diagnostically or therapeutically useful
fragments thereof.
[0018] In accordance with still another aspect of the present
invention, there are provided processes for producing such
polypeptides by recombinant techniques through the use of
recombinant vectors, such as cloning and expression plasmids useful
as reagents in the recombinant production of the polypeptides of
the present invention, as well as recombinant prokaryotic and/or
eukaryotic host cells comprising a nucleic acid sequence encoding a
polypeptide of the present invention.
[0019] In accordance with a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for
screening for agonists and antagonists thereto and for therapeutic
purposes, for example, promoting wound healing for example as a
result of burns and ulcers, to prevent neuronal damage due to
associated with stroke and promote neuronal growth, and to prevent
skin aging and hair loss, to stimulate angiogenesis, mesodermal
induction in early embryos and limb regeneration.
[0020] In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
[0021] In accordance with yet another aspect of the present
invention, there are provided antagonists against such polypeptides
and processes for their use to inhibit the action of such
polypeptides, for example, in the treatment of cellular
transformation, for example, tumors, to reduce scarring and treat
hyper-vascular diseases.
[0022] In accordance with another aspect of the present invention,
there are provided nucleic acid probes comprising nucleic acid
molecules of sufficient length to specifically hybridize to a
polynucleotide encoding a polypeptide of the present invention
[0023] In accordance with yet another aspect of the present
invention, there are provided diagnostic assays for detecting
diseases or susceptibility to diseases related to mutations in a
nucleic acid sequence of the present invention and for detecting
over-expression of the polypeptides encoded by such sequences.
[0024] In accordance with another aspect of the present invention,
there is provided a process for utilizing such polypeptides, or
polynucleotides encoding such polypeptides, for in vitro purposes
related to scientific research, synthesis of DNA and manufacture of
DNA vectors.
[0025] These and other aspects of the present invention should be
apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The following drawings are meant only as illustrations of
specific embodiments of the present invention and are not meant as
limitations in any manner.
[0027] FIGS. 1A-1B depict the cDNA sequence (SEQ ID NO:1) and
corresponding deduced amino acid sequence (SEQ ID NO:2) of FGF-14.
The initial 26 amino acid residues represent a putative leader
sequence.
[0028] In accordance with one aspect of the present invention,
there are provided isolated nucleic acid molecules
(polynucleotides) which encode for the mature polypeptide having
the deduced amino acid sequence of FIGS. 1A-1B (SEQ ID NO:2) or for
the mature polypeptide encoded by the cDNA of the clone deposited
as ATCC.TM. Deposit No. PTA-974 on Nov. 17, 1999. The ATCC.TM.
(American Type Culture Collection) is located at 10801 University
Boulevard, Manassas, Va. 20110-2209.
[0029] The polynucleotide encoding FGF-14 of this invention was
discovered initially in a cDNA library derived from human
cerebellum tissue. It is structurally related to all members of the
fibroblast growth factor family and contains an open reading frame
encoding a polypeptide of 225 amino acids of which the first 26
amino acids represent a putative signal sequence such that the
mature polypeptide comprises 199 amino acids. Among the top matches
are: 1) 40% identity and 61% sequence similarity to human FGF-9
over a stretch of 126 amino acids; 2) 40% identity and 61%
similarity to rat FGF-9 over a region of 126 amino acids; 3) 36%
identity and 57% similarity with human KGF over a stretch of 148
amino acids.
[0030] The FGF/HBGF family signature, GXLX(S,T,A,G)X6(D,E)CXFXE
(SEQ ID NOS:10-17, respectively) is conserved in the polypeptide of
the present invention, (X means any amino acid residue; (D,E) means
either D or E residue; X6 means any 6 amino acid residues).
[0031] The polynucleotide of the present invention may be in the
form of RNA or in the form of DNA, which DNA includes cDNA, genomic
DNA, and synthetic DNA. The DNA may be double-stranded or
single-stranded. The coding sequence which encodes the mature
polypeptide may be identical to the coding sequence shown in FIGS.
1A-1B (SEQ ID NO:1) or that of the deposited clone or may be a
different coding sequence, as a result of the redundancy or
degeneracy of the genetic code, encodes the same, mature
polypeptide as the DNA of FIGS. 1A-1B, (SEQ ID NO:1) or the
deposited cDNA.
[0032] The polynucleotides which encodes for the mature polypeptide
of FIGS. 1A-1B (SEQ ID NO:2) or for the mature polypeptides encoded
by the deposited cDNA(s) may include: only the coding sequence for
the mature polypeptide; the coding sequence for the mature
polypeptide and additional coding sequence such as a leader or
secretory sequence or a proprotein sequence; the coding sequence
for the mature polypeptide (and optionally additional coding
sequence) and non-coding sequence, such as introns or non-coding
sequence 5' and/or 3' of the coding sequence for the mature
polypeptide.
[0033] Thus, the term "polynucleotide encoding a polypeptide"
encompasses a polynucleotide which includes only coding sequence
for the polypeptide as well as a polynucleotide which includes
additional coding and/or non-coding sequence.
[0034] The present invention further relates to variants of the
hereinabove described polynucleotides which encode for fragments,
analogs and derivatives of the polypeptides having the deduced
amino acid sequence of FIGS. 1A-1B (SEQ ID NO:2) or the
polypeptides encoded by the cDNA(s) of the deposited clone(s). The
variants of the polynucleotide may be a naturally occurring allelic
variant of the polynucleotide or a non-naturally occurring variant
of the polynucleotide.
[0035] Thus, the present invention includes polynucleotides
encoding the same mature polypeptide as shown in FIGS. 1A-1B (SEQ
ID NO:2) or the same mature polypeptides encoded by the cDNA(s) of
the deposited clone(s) as well as variants of such polynucleotides
which variants encode for a fragment, derivative or analog of the
polypeptide of FIGS. 1A-1B (SEQ ID NO:2) or the polypeptides
encoded by the cDNA(s) of the deposited clone(s). Such nucleotide
variants include deletion variants, substitution variants and
addition or insertion variants.
[0036] As hereinabove indicated, the polynucleotide may have a
coding sequence which is a naturally occurring allelic variant of
the coding sequence shown in FIGS. 1A-1B (SEQ ID NO:1) or of the
coding sequence of the deposited clone(s). As known in the art, an
allelic variant is an alternate form of a polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function of the
encoded polypeptides.
[0037] The present invention also includes polynucleotides, wherein
the coding sequence for the mature polypeptides may be fused in the
same reading frame to a polynucleotide sequence which aids in
expression and secretion of a polypeptide from a host cell, for
example, a leader sequence which functions as a secretory sequence
for controlling transport of a polypeptide from the cell. The
polypeptide having a leader sequence is a preprotein and may have
the leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode for a
proprotein which is the mature protein plus additional 5' amino
acid residues. A mature protein having a prosequence is a
proprotein and is an inactive form of the protein. Once the
prosequence is cleaved an active mature protein remains.
[0038] Thus, for example, the polynucleotides of the present
invention may encode for a mature protein, or for a protein having
a prosequence or for a protein having both a prosequence and a
presequence (leader sequence).
[0039] The polynucleotides of the present invention may also have
the coding sequence fused in frame to a marker sequence which
allows for purification of the polypeptide of the present
invention. The marker sequence may be a hexa-histidine tag supplied
by a pQE-9 vector to provide for purification of the mature
polypeptide fused to the marker in the case of a bacterial host,
or, for example, the marker sequence may be a hemagglutinin (HA)
tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein (Wilson, I., et al., Cell, 37:767 (1984)).
[0040] The term "gene" means the segment of DNA involved in
producing a polypeptide chain; it includes regions preceding and
following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments
(exons).
[0041] Fragments of the full length FGF-14 gene may be used as a
hybridization probe for a cDNA library to isolate the full length
gene and to isolate other genes which have a high sequence
similarity to the gene or similar biological activity. Probes of
this type preferably have at least 30 bases and may contain, for
example, 50 or more bases. The probe may also be used to identify a
cDNA clone corresponding to a full length transcript and a genomic
clone or clones that contain the complete FGF-14 gene including
regulatory and promoter regions, exons, and introns. An example of
a screen comprises isolating the coding region of the FGF-14 gene
by using the known DNA sequence to synthesize an oligonucleotide
probe. Labeled oligonucleotides having a sequence complementary to
that of the gene of the present invention are used to screen a
library of human cDNA, genomic DNA or mRNA to determine which
members of the library the probe hybridizes to.
[0042] The present invention further relates to polynucleotides
which hybridize to the hereinabove-described sequences if there is
at least 70%, preferably at least 90%, and more preferably at least
95% identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the hereinabove-described polynucleotides.
As herein used, the term "stringent conditions" means hybridization
will occur only if there is at least 95% and preferably at least
97% identity between the sequences. The polynucleotides which
hybridize to the hereinabove described polynucleotides in a
preferred embodiment encode polypeptides which either retain
substantially the same biological function or activity as the
mature polypeptide encoded by the cDNAs of FIGS. 1A-1B (SEQ ID
NO:1) or the deposited cDNA(s).
[0043] Alternatively, the polynucleotide may have at least 20
bases, preferably 30 bases, and more preferably at least 50 bases
which hybridize to a polynucleotide of the present invention and
which has an identity thereto, as hereinabove described, and which
may or may not retain activity. For example, such polynucleotides
may be employed as probes for the polynucleotide of SEQ ID NO:1,
for example, for recovery of the polynucleotide or as a diagnostic
probe or as a PCR primer.
[0044] Thus, the present invention is directed to polynucleotides
having at least a 70% identity, preferably at least 90% and more
preferably at least a 95% identity to a polynucleotide which
encodes the polypeptide of SEQ ID NO:2 as well as fragments
thereof, which fragments have at least 30 bases and preferably at
least 50 bases and to polypeptides encoded by such
polynucleotides.
[0045] The deposit(s) referred to herein will be maintained under
the Budapest Treaty on the International Recognition of the Deposit
of Microorganisms for the purposes of Patent Procedure. These
deposits are provided merely as a convenience and are not an
admission that a deposit is required under 35 U.S.C. .sctn. 112.
The sequence of the polynucleotides contained in the deposited
materials, as well as the amino acid sequence of the polypeptides
encoded thereby, are incorporated herein by reference and are
controlling in the event of any conflict with the description of
sequences herein. A license may be required to make, use or sell
the deposited materials, and no such license is hereby granted.
[0046] The present invention further relates to an FGF polypeptide
which has the deduced amino acid sequence of FIGS. 1A-1B (SEQ ID
NO:2) or which has the amino acid sequence encoded by the deposited
cDNA(s), as well as fragments, analogs and derivatives of such
polypeptides.
[0047] The terms "fragment," "derivative" and "analog" when
referring to the polypeptide of FIGS. 1A-1B (SEQ ID NO:2) or those
encoded by the deposited cDNA(s), means polypeptides which retains
essentially the same biological function or activity as such
polypeptides. Thus, an analog includes a proprotein which can be
activated by cleavage of the proprotein portion to produce an
active mature polypeptide.
[0048] The polypeptides of the present invention may be recombinant
polypeptides, natural polypeptides or synthetic polypeptides,
preferably recombinant polypeptides.
[0049] The fragment, derivative or analog of the polypeptide of
FIGS. 1A-1B (SEQ ID NO:2) or that encoded by the deposited cDNA(s)
may be (i) one in which one or more of the amino acid residues are
substituted with a conserved or non-conserved amino acid residue
(preferably a conserved amino acid residue) and such substituted
amino acid residue may or may not be one encoded by the genetic
code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature
polypeptide is fused with another compound, such as a compound to
increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as a leader or
secretory sequence or a sequence which is employed for purification
of the mature polypeptide or a proprotein sequence. Such fragments,
derivatives and analogs are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0050] The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated form, and
preferably are purified to homogeneity.
[0051] The term "isolated" means that the material is removed from
its original environment (e.g., the natural environment if it is
naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or DNA or polypeptide,
separated from some or all of the coexisting materials in the
natural system, is isolated. Such polynucleotide could be part of a
vector and/or such polynucleotide or polypeptide could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural environment.
[0052] The polypeptides of the present invention include the
polypeptide of SEQ ID NO:2 (in particular the mature polypeptide)
as well as polypeptides which have at least 70% similarity
(preferably at least a 70% identity) to the polypeptide of SEQ ID
NO:2 and more preferably at least a 90% similarity (more preferably
at least a 90% identity) to the polypeptide of SEQ ID NO:2 and
still more preferably at least a 95% similarity (still more
preferably at least a 95% identity) to the polypeptide of SEQ ID
NO:2 and also include portions of such polypeptides with such
portion of the polypeptide generally containing at least 30 amino
acids and more preferably at least 50 amino acids.
[0053] As known in the art "similarity" between two polypeptides is
determined by comparing the amino acid sequence and its conserved
amino acid substitutes of one polypeptide to the sequence of a
second polypeptide.
[0054] Fragments or portions of the polypeptides of the present
invention may be employed for producing the corresponding
full-length polypeptide by peptide synthesis; therefore, the
fragments may be employed as intermediates for producing the
full-length polypeptides. Fragments or portions of the
polynucleotides of the present invention may be used to synthesize
full-length polynucleotides of the present invention.
[0055] The present invention also relates to vectors which include
polynucleotides of the present invention, host cells which are
genetically engineered with vectors of the invention and the
production of polypeptides of the invention by recombinant
techniques.
[0056] Host cells may be genetically engineered (transduced or
transformed or transfected) with the vectors of this invention
which may be, for example, a cloning vector or an expression
vector. The vector may be, for example, in the form of a plasmid, a
viral particle, a phage, etc. The engineered host cells can be
cultured in conventional nutrient media modified as appropriate for
activating promoters, selecting transformants or amplifying the FGF
genes. The culture conditions, such as temperature, pH and the
like, are those previously used with the host cell selected for
expression, and will be apparent to the ordinarily skilled
artisan.
[0057] The polynucleotide of the present invention may be employed
for producing a polypeptide by recombinant techniques. Thus, for
example, the polynucleotide sequence may be included in any one of
a variety of expression vehicles, in particular vectors or plasmids
for expressing a polypeptide. Such vectors include chromosomal,
nonchromosomal and synthetic DNA sequences, e.g., derivatives of
SV40; bacterial plasmids; phage DNA; yeast plasmids; vectors
derived from combinations of plasmids and phage DNA, viral DNA such
as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However,
any other vector or plasmid may be used as long as they are
replicable and viable in the host.
[0058] The appropriate DNA sequence may be inserted into the vector
by a variety of procedures. In general, the DNA sequence is
inserted into an appropriate restriction endonuclease sites by
procedures known in the art. Such procedures and others are deemed
to be within the scope of those skilled in the art.
[0059] The DNA sequence in the expression vector is operatively
linked to an appropriate expression control sequence(s) (promoter)
to direct mRNA synthesis. As representative examples of such
promoters, there may be mentioned: LTR or SV40 promoter, the E.
coli. lac or trp, the phage lambda P.sub.L promoter and other
promoters known to control expression of genes in prokaryotic or
eukaryotic cells or their viruses. The expression vector also
contains a ribosome binding site for translation initiation and a
transcription terminator. The vector may also include appropriate
sequences for amplifying expression.
[0060] In addition, the expression vectors preferably contain a
gene to provide a phenotypic trait for selection of transformed
host cells such as dihydrofolate reductase or neomycin resistance
for eukaryotic cell culture, or such as tetracycline or ampicillin
resistance in E. coli.
[0061] The vector containing the appropriate DNA sequence as herein
above described, as well as an appropriate promoter or control
sequence, may be employed to transform an appropriate host to
permit the host to express the protein. As representative examples
of appropriate hosts, there may be mentioned: bacterial cells, such
as E. coli, Salmonella typhimurium, Streptomyces; fungal cells,
such as yeast; insect cells, such as Drosophila S2 and Spodoptera
Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses;
plant cells, etc. The selection of an appropriate host is deemed to
be within the scope of those skilled in the art from the teachings
herein.
[0062] More particularly, the present invention also includes
recombinant constructs comprising one or more of the sequences as
broadly described above. The constructs comprise a vector, such as
a plasmid or viral vector, into which a sequence of the invention
has been inserted, in a forward or reverse orientation. In a
preferred aspect of this embodiment, the construct further
comprises regulatory sequences, including, for example, a promoter,
operably linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided by way
of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS,
phagescript, psiX174, pBluescript SK, pBsKS, pNH8a, pNH16a, pNH18a,
pNH46a (Stratagene); pTRC99A, pKK223-3, pKK233-3, pDR540, pRIT5
(Pharmacia). Eukaryotic: pWLneo, pSV2cat, pOG44, pXT1, pSG
(Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any
other plasmid or vector may be used as long as they are replicable
and viable in the host.
[0063] Promoter regions can be selected from any desired gene using
CAT (chloramphenicol transferase) vectors or other vectors with
selectable markers. Two appropriate vectors are pKK232-8 and pCM7.
Particular named bacterial promoters include lacI, lacZ, T3, T7,
gpt, lambda P.sub.R, P.sub.L and trp. Eukaryotic promoters include
CMV immediate early, HSV thymidine kinase, early and late SV40,
LTRs from retrovirus, and mouse metallothionein-1. Selection of the
appropriate vector and promoter is well within the level of
ordinary skill in the art.
[0064] In a further embodiment, the present invention relates to
host cells containing the above-described construct. The host cell
can be a higher eukaryotic cell, such as a mammalian cell, or a
lower eukaryotic cell, such as a yeast cell, or the host cell can
be a prokaryotic cell, such as a bacterial cell. Introduction of
the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-Dextran mediated transfection, or
electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods
in Molecular Biology, 1986)).
[0065] The constructs in host cells can be used in a conventional
manner to produce the gene product encoded by the recombinant
sequence. Alternatively, the polypeptides of the invention can be
synthetically produced by conventional peptide synthesizers.
[0066] Mature proteins can be expressed in mammalian cells, yeast,
bacteria, or other cells under the control of appropriate
promoters. Cell-free translation systems can also be employed to
produce such proteins using RNAs derived from the DNA constructs of
the present invention. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, (Cold Spring Harbor, N.Y., 1989), the disclosure of which
is hereby incorporated by reference.
[0067] Transcription of a DNA encoding the polypeptides of the
present invention by higher eukaryotes is increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Examples include the SV40
enhancer on the late side of the replication origin (bp 100 to
270), a cytomegalovirus early promoter enhancer, a polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers.
[0068] Generally, recombinant expression vectors will include
origins of replication and selectable markers permitting
transformation of the host cell, e.g., the ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived
from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase (PGK), a factor, acid phosphatase, or heat shock proteins,
among others. The heterologous structural sequence is assembled in
appropriate phase with translation, initiation and termination
sequences, and preferably, a leader sequence capable of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence can
encode a fusion protein including an N-terminal identification
peptide imparting desired characteristics, e.g., stabilization or
simplified purification of expressed recombinant product.
[0069] Useful expression vectors for bacterial use are constructed
by inserting a structural DNA sequence encoding a desired protein
together with suitable translation, initiation and termination
signals in operable reading phase with a functional promoter. The
vector will comprise one or more phenotypic selectable markers and
an origin of replication to ensure maintenance of the vector and
to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus
subtilis, Salmonella typhimurium and various species within the
genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be employed as a matter of choice.
[0070] As a representative but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable
marker and bacterial origin of replication derived from
commercially available plasmids comprising genetic elements of the
well known cloning vector pBR322 (ATCC.TM. 37017). Such commercial
vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals,
Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., USA).
These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed.
[0071] Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is derepressed by appropriate means (e.g.,
temperature shift or chemical induction) and cells are cultured for
an additional period.
[0072] Cells are typically harvested by centrifugation, disrupted
by physical or chemical means, and the resulting crude extract
retained for further purification.
[0073] Microbial cells employed in expression of proteins can be
disrupted by any convenient method, including freeze-thaw cycling,
sonication, mechanical disruption, or use of cell lysing
agents.
[0074] Various mammalian cell culture systems can also be employed
to express recombinant protein. Examples of mammalian expression
systems include the COS-7 lines of monkey kidney fibroblasts,
described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing a compatible vector, for example, the C127,
3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors
will comprise an origin of replication, a suitable promoter and
enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed sequences. DNA sequences derived from the SV40 viral
genome, for example, SV40 origin, early promoter, enhancer, splice,
and polyadenylation sites may be used to provide the required
nontranscribed genetic elements.
[0075] The polypeptide of the present invention may be recovered
and purified from recombinant cell cultures by methods used
heretofore, including ammonium sulfate or ethanol precipitation,
acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxyapatite
chromatography and lectin chromatography. Protein refolding steps
can be used, as necessary, in completing configuration of the
mature protein. Finally, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[0076] The polypeptide of the present invention may be a naturally
purified product, or a product of chemical synthetic procedures, or
produced by recombinant techniques from a prokaryotic or eukaryotic
host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in culture). Depending upon the host employed in a
recombinant production procedure, the polypeptides of the present
invention may be glycosylated with mammalian or other eukaryotic
carbohydrates or may be non-glycosylated. Polypeptides of the
invention may also include an initial methionine amino acid
residue.
[0077] The polypeptide of the present invention, as a result of the
ability to stimulate vascular endothelial cell growth, may be
employed in treatment for stimulating re-vascularization of
ischemic tissues due to various disease conditions such as
thrombosis, arteriosclerosis, and other cardiovascular conditions.
These polypeptide may also be employed to stimulate angiogenesis
and limb regeneration.
[0078] The polypeptide may also be employed for treating wounds due
to injuries, burns, post-operative tissue repair, and ulcers since
they are mitogenic to various cells of different origins, such as
fibroblast cells and skeletal muscle cells, and therefore,
facilitate the repair or replacement of damaged or diseased
tissue.
[0079] The polypeptide of the present invention may also be
employed stimulate neuronal growth and to treat and prevent
neuronal damage associated with stroke and which occurs in certain
neuronal disorders or neuro-degenerative conditions such as
Alzheimer's disease, Parkinson's disease, and AIDS-related complex.
FGF-14 has the ability to stimulate chondrocyte growth, therefore,
they may be employed to enhance bone and periodontal regeneration
and aid in tissue transplants or bone grafts.
[0080] The polypeptide of the present invention may be also be
employed to prevent skin aging due to sunburn by stimulating
keratinocyte growth.
[0081] The FGF-14 polypeptide may also be employed for preventing
hair loss, since FGF family members activate hair-forming cells and
promotes melanocyte growth. Along the same lines, the polypeptides
of the present invention may be employed to stimulate growth and
differentiation of hematopoietic cells and bone marrow cells when
used in combination with other cytokines.
[0082] The FGF-14 polypeptide may also be employed to maintain
organs before transplantation or for supporting cell culture of
primary tissues.
[0083] The polypeptide of the present invention may also be
employed for inducing tissue of mesodermal origin to differentiate
in early embryos.
[0084] In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides, for in
vitro purposes related to scientific research, synthesis of DNA,
manufacture of DNA vectors and for the purpose of providing
diagnostics and therapeutics for the treatment of human
disease.
[0085] This invention provides a method for identification of the
receptors for the polypeptides of the present invention. The genes
encoding the receptor can be identified by numerous methods known
to those of skill in the art, for example, ligand panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2),
Chapter 5, (1991)). Preferably, expression cloning is employed
wherein polyadenylated RNA is prepared from a cell responsive to
the polypeptides, for example, NIH3T3 cells which are known to
contain multiple receptors for the FGF family proteins, and SC-3
cells, and a cDNA library created from this RNA is divided into
pools and used to transfect COS cells or other cells that are not
responsive to the polypeptides. Transfected cells which are grown
on glass slides are exposed to the polypeptide of the present
invention, after they have been labelled. The polypeptides can be
labeled by a variety of means including iodination or inclusion of
a recognition site for a site-specific protein kinase.
[0086] Following fixation and incubation, the slides are subjected
to auto-radiographic analysis. Positive pools are identified and
sub-pools are prepared and re-transfected using an iterative
sub-pooling and re-screening process, eventually yielding a single
clones that encodes the putative receptor.
[0087] As an alternative approach for receptor identification, the
labeled polypeptides can be photoaffinity linked with cell membrane
or extract preparations that express the receptor molecule.
Cross-linked material is resolved by PAGE analysis and exposed to
X-ray film. The labeled complex containing the receptors of the
polypeptides can be excised, resolved into peptide fragments, and
subjected to protein microsequencing. The amino acid sequence
obtained from microsequencing would be used to design a set of
degenerate oligonucleotide probes to screen a cDNA library to
identify the genes encoding the putative receptors.
[0088] This invention provides a method of screening compounds to
identify those which modulate the action of the polypeptide of the
present invention. An example of such an assay comprises combining
a mammalian fibroblast cell, a the polypeptide of the present
invention, the compound to be screened and .sup.3[H] thymidine
under cell culture conditions where the fibroblast cell would
normally proliferate. A control assay may be performed in the
absence of the compound to be screened and compared to the amount
of fibroblast proliferation in the presence of the compound to
determine if the compound stimulates proliferation by determining
the uptake of .sup.3[H] thymidine in each case. The amount of
fibroblast cell proliferation is measured by liquid scintillation
chromatography which measures the incorporation of .sup.3[H]
thymidine. Both agonist and antagonist compounds may be identified
by this procedure.
[0089] In another method, a mammalian cell or membrane preparation
expressing a receptor for a polypeptide of the present invention is
incubated with a labeled polypeptide of the present invention in
the presence of the compound. The ability of the compound to
enhance or block this interaction could then be measured.
Alternatively, the response of a known second messenger system
following interaction of a compound to be screened and the FGF-14
receptor is measured and the ability of the compound to bind to the
receptor and elicit a second messenger response is measured to
determine if the compound is a potential agonist or antagonist.
Such second messenger systems include but are not limited to, cAMP
guanylate cyclase, ion channels, tyrosine phosphorylation or
phosphoinositide hydrolysis.
[0090] Examples of antagonist compounds include antibodies, or in
some cases, oligonucleotides, which bind to the receptor for the
polypeptide of the present invention but elicit no second messenger
response or bind to the FGF-14 polypeptide itself. Alternatively, a
potential antagonist may be a mutant form of the polypeptide which
binds to the receptors, however, no second messenger response is
elicited and, therefore, the action of the polypeptide is
effectively blocked.
[0091] Another antagonist compound to the FGF-14 gene and gene
product is an antisense construct prepared using antisense
technology. Antisense technology can be used to control gene
expression through triple-helix formation or antisense DNA or RNA,
both of which methods are based on binding of a polynucleotide to
DNA or RNA. For example, the 5' coding portion of the
polynucleotide sequence, which encodes for the mature polypeptides
of the present invention, is used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is designed to be complementary to a region of the
gene involved in transcription (triple helix--see Lee et al., Nucl.
Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al., Science, 251: 1360 (1991)), thereby preventing
transcription and the production of the polypeptides of the present
invention. The antisense RNA oligonucleotide hybridizes to the mRNA
in vivo and blocks translation of the mRNA molecule into the
polypeptide (Antisense--Okano, J. Neurochem., 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described
above can also be delivered to cells such that the antisense RNA or
DNA may be expressed in vivo to inhibit production of the
polypeptide.
[0092] Potential antagonist compounds also include small molecules
which bind to and occupy the binding site of the receptors thereby
making the receptor inaccessible to its polypeptide such that
normal biological activity is prevented. Examples of small
molecules include, but are not limited to, small peptides or
peptide-like molecules.
[0093] Antagonist compounds may be employed to inhibit the cell
growth and proliferation effects of the polypeptides of the present
invention on neoplastic cells and tissues, i.e. stimulation of
angiogenesis of tumors, and, therefore, retard or prevent abnormal
cellular growth and proliferation, for example, in tumor formation
or growth.
[0094] The antagonists may also be employed to prevent
hyper-vascular diseases, and prevent the proliferation of
epithelial lens cells after extracapsular cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the
present invention may also be desirous in cases such as restenosis
after balloon angioplasty.
[0095] The antagonists may also be employed to prevent the growth
of scar tissue during wound healing.
[0096] The antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter
described.
[0097] The polypeptides, agonists and antagonists of the present
invention may be employed in combination with a suitable
pharmaceutical carrier to comprise a pharmaceutical composition for
parenteral administration. Such compositions comprise a
therapeutically effective amount of the polypeptide, agonist or
antagonist and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes but is not limited to saline, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
administration.
[0098] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides, agonists and
antagonists of the present invention may be employed in conjunction
with other therapeutic compounds.
[0099] The pharmaceutical compositions may be administered in a
convenient manner such as by the oral, topical, intravenous,
intraperitoneal, intramuscular, subcutaneous, intranasal or
intradermal routes. The pharmaceutical compositions are
administered in an amount which is effective for treating and/or
prophylaxis of the specific indication. In general, they are
administered in an amount of at least about 10 .mu.g/kg body weight
and in most cases they will be administered in an amount not in
excess of about 8 mg/Kg body weight per day. In most cases, the
dosage is from about 10 .mu.g/kg to about 1 mg/kg body weight
daily, taking into account the routes of administration, symptoms,
etc. In the specific case of topical administration, dosages are
preferably administered from about 0.1 g to 9 mg per cm.sup.2.
[0100] The polypeptide of the invention and agonist and antagonist
compounds which are polypeptides, may also be employed in
accordance with the present invention by expression of such
polypeptide in vivo, which is often referred to as "gene
therapy."
[0101] Thus, for example, cells may be engineered with a
polynucleotide (DNA or RNA) encoding for the polypeptide ex vivo,
the engineered cells are then provided to a patient to be treated
with the polypeptide. Such methods are well-known in the art. For
example, cells may be engineered by procedures known in the art by
use of a retroviral particle containing RNA encoding for the
polypeptide of the present invention.
[0102] Similarly, cells may be engineered in vivo for expression of
the polypeptide in vivo, for example, by procedures known in the
art. As known in the art, a producer cell for producing a
retroviral particle containing RNA encoding the polypeptide of the
present invention may be administered to a patient for engineering
cells in vivo and expression of the polypeptide in vivo. These and
other methods for administering a polypeptide of the present
invention by such methods should be apparent to those skilled in
the art from the teachings of the present invention. For example,
the expression vehicle for engineering cells may be other than a
retroviral particle, for example, an adenovirus, which may be used
to engineer cells in vivo after combination with a suitable
delivery vehicle.
[0103] Retroviruses from which the retroviral plasmid vectors
hereinabove mentioned may be derived include, but are not limited
to, Moloney Murine Leukemia Virus, spleen necrosis virus,
retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus,
avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma
Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector is derived from Moloney Murine Leukemia Virus.
[0104] The vector includes one or more promoters. Suitable
promoters which may be employed include, but are not limited to,
the retroviral LTR; the SV40 promoter; and the human
cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter
(e.g., cellular promoters such as eukaryotic cellular promoters
including, but not limited to, the histone, pol III, and
.beta.-actin promoters). Other viral promoters which may be
employed include, but are not limited to, adenovirus promoters,
thymidine kinase (TK) promoters, and B19 parvovirus promoters. The
selection of a suitable promoter will be apparent to those skilled
in the art from the teachings contained herein.
[0105] The nucleic acid sequence encoding the polypeptide of the
present invention is under the control of a suitable promoter.
Suitable promoters which may be employed include, but are not
limited to, adenoviral promoters, such as the adenoviral major late
promoter; or heterologous promoters, such as the cytomegalovirus
(CMV) promoter; the respiratory syncytial virus (RSV) promoter;
inducible promoters, such as the MMT promoter, the metallothionein
promoter; heat shock promoters; the albumin promoter; the ApoAI
promoter; human globin promoters; viral thymidine kinase promoters,
such as the Herpes Simplex thymidine kinase promoter; retroviral
LTRs (including the modified retroviral LTRs hereinabove
described); the .beta.-actin promoter; and human growth hormone
promoters. The promoter also may be the native promoter which
controls the gene encoding the polypeptide.
[0106] The retroviral plasmid vector is employed to transduce
packaging cell lines to form producer cell lines. Examples of
packaging cells which may be transfected include, but are not
limited to, the PE501, PA317, .psi.-2, .psi.-AM, PA12, T19-14X,
VT-19-17-H2, .psi.CRE, .psi.CRIP, GP+E-86, GP+envAm12, and DAN cell
lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14
(1990), which is incorporated herein by reference in its entirety.
The vector may transduce the packaging cells through any means
known in the art. Such means include, but are not limited to,
electroporation, the use of liposomes, and CaPO.sub.4
precipitation. In one alternative, the retroviral plasmid vector
may be encapsulated into a liposome, or coupled to a lipid, and
then administered to a host.
[0107] The producer cell line generates infectious retroviral
vector particles which include the nucleic acid sequence(s)
encoding the polypeptides. Such retroviral vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or
in vivo. The transduced eukaryotic cells will express the nucleic
acid sequence(s) encoding the polypeptide. Eukaryotic cells which
may be transduced include, but are not limited to, embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem
cells, hepatocytes, fibroblasts, myoblasts, keratinocytes,
endothelial cells, and bronchial epithelial cells.
[0108] This invention is also related to the use of the genes of
the present invention as part of a diagnostic assay for detecting
diseases or susceptibility to diseases related to the presence of
mutations in the nucleic acid sequences encoding the polypeptide of
the present invention.
[0109] Individuals carrying mutations in a gene of the present
invention may be detected at the DNA level by a variety of
techniques. Nucleic acids for diagnosis may be obtained from a
patient's cells, such as from blood, urine, saliva, tissue biopsy
and autopsy material. The genomic DNA may be used directly for
detection or may be amplified enzymatically by using PCR (Saiki et
al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may
also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid encoding a polypeptide of the
present invention can be used to identify and analyze mutations.
For example, deletions and insertions can be detected by a change
in size of the amplified product in comparison to the normal
genotype. Point mutations can be identified by hybridizing
amplified DNA to radiolabeled RNA or alternatively, radiolabeled
antisense DNA sequences. Perfectly matched sequences can be
distinguished from mismatched duplexes by RNase A digestion or by
differences in melting temperatures.
[0110] Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic mobility of
DNA fragments in gels with or without denaturing agents. Small
sequence deletions and insertions can be visualized by high
resolution gel electrophoresis. DNA fragments of different
sequences may be distinguished on denaturing formamide gradient
gels in which the mobilities of different DNA fragments are
retarded in the gel at different positions according to their
specific melting or partial melting temperatures (see, e.g., Myers
et al., Science, 230:1242 (1985)).
[0111] Sequence changes at specific locations may also be revealed
by nuclease protection assays, such as RNase and S1 protection or
the chemical cleavage method (e.g., Cotton et al, PNAS, USA,
85:4397-4401 (1985)).
[0112] Thus, the detection of a specific DNA sequence may be
achieved by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA sequencing or the use of restriction
enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP))
and Southern blotting of genomic DNA.
[0113] In addition to more conventional gel-electrophoresis and DNA
sequencing, mutations can also be detected by in situ analysis.
[0114] The present invention also relates to a diagnostic assay for
detecting altered levels of FGF-14 proteins in various tissues
since an over-expression of the proteins compared to normal control
tissue samples may detect the presence of abnormal cellular
proliferation, for example, a tumor. Assays used to detect levels
of protein in a sample derived from a host are well-known to those
of skill in the art and include radioimmunoassays,
competitive-binding assays, Western Blot analysis, ELISA assays and
"sandwich" assay. An ELISA assay (Coligan, et al., Current
Protocols in Immunology, 1(2), Chapter 6, (1991)) initially
comprises preparing an antibody specific to an antigen to the
polypeptides of the present invention, preferably a monoclonal
antibody. In addition a reporter antibody is prepared against the
monoclonal antibody. To the reporter antibody is attached a
detectable reagent such as radioactivity, fluorescence or, in this
example, a horseradish peroxidase enzyme. A sample is removed from
a host and incubated on a solid support, e.g. a polystyrene dish,
that binds the proteins in the sample. Any free protein binding
sites on the dish are then covered by incubating with a
non-specific protein like bovine serum albumen. Next, the
monoclonal antibody is incubated in the dish during which time the
monoclonal antibodies attach to any polypeptides of the present
invention attached to the polystyrene dish. All unbound monoclonal
antibody is washed out with buffer. The reporter antibody linked to
horseradish peroxidase is now placed in the dish resulting in
binding of the reporter antibody to any monoclonal antibody bound
to the protein of interest.
[0115] Unattached reporter antibody is then washed out. Peroxidase
substrates are then added to the dish and the amount of color
developed in a given time period is a measurement of the amount of
a polypeptide of the present invention present in a given volume of
patient sample when compared against a standard curve.
[0116] A competition assay may be employed wherein antibodies
specific to a polypeptide of the present invention are attached to
a solid support and labeled FGF-13 and a sample derived from the
host are passed over the solid support and the amount of label
detected, for example by liquid scintillation chromatography, can
be correlated to a quantity of a polypeptide of the present
invention in the sample.
[0117] A "sandwich" assay is similar to an ELISA assay. In a
"sandwich" assay a polypeptide of the present invention is passed
over a solid support and binds to antibody attached to a solid
support. A second antibody is then bound to the polypeptide of
interest. A third antibody which is labeled and specific to the
second antibody is then passed over the solid support and binds to
the second antibody and an amount can then be quantified.
[0118] The sequences of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to
and can hybridize with a particular location on an individual human
chromosome. Moreover, there is a current need for identifying
particular sites on the chromosome. Few chromosome marking reagents
based on actual sequence data (repeat polymorphism's) are presently
available for marking chromosomal location. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0119] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of the 3' untranslated region is used to rapidly select primers
that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used
for PCR screening of somatic cell hybrids containing individual
human chromosomes. Only those hybrids containing the human gene
corresponding to the primer will yield an amplified fragment.
[0120] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of fragments from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0121] Fluorescence in situ hybridization (FISH) of a cDNA clone to
a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
cDNA as short as 50 or 60 bases. For a review of this technique,
see Verma et al., Human Chromosomes: a Manual of Basic Techniques,
Pergamon Press, New York (1988).
[0122] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. (Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man (available on
line through Johns Hopkins University Welch Medical Library). The
relationship between genes and diseases that have been mapped to
the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0123] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0124] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. (This assumes 1 megabase mapping
resolution and one gene per 20 kb).
[0125] The polypeptides, their fragments or other derivatives, or
analogs thereof, or cells expressing them can be used as an
immunogen to produce antibodies thereto. These antibodies can be,
for example, polyclonal or monoclonal antibodies. The present
invention also includes chimeric, single chain, and humanized
antibodies, as well as Fab fragments, or the product of an Fab
expression library. Various procedures known in the art may be used
for the production of such antibodies and fragments.
[0126] Antibodies generated against the polypeptides corresponding
to a sequence of the present invention can be obtained by direct
injection of the polypeptides into an animal or by administering
the polypeptides to an animal, preferably a nonhuman. The antibody
so obtained will then bind the polypeptides itself. In this manner,
even a sequence encoding only a fragment of the polypeptides can be
used to generate antibodies binding the whole native polypeptides.
Such antibodies can then be used to isolate the polypeptide from
tissue expressing that polypeptide.
[0127] For preparation of monoclonal antibodies, any technique
which provides antibodies produced by continuous cell line cultures
can be used. Examples include the hybridoma technique (Kohler and
Milstein, 1975, Nature, 256:495-497), the trioma technique, the
human B-cell hybridoma technique (Kozbor et al., 1983, Immunology
Today 4:72), and the EBV-hybridoma technique to produce human
monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[0128] Techniques described for the production of single chain
antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce
single chain antibodies to immunogenic polypeptide products of this
invention. Also, transgenic mice may be used to express humanized
antibodies to immunogenic polypeptide products of this
invention.
[0129] The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified, are by
weight.
[0130] In order to facilitate understanding of the following
examples, certain frequently occurring methods and/or terms will be
described.
[0131] "Plasmids" are designated by a lower case p preceded and/or
followed by capital letters and/or numbers. The starting plasmids
herein are either commercially available, publicly available on an
unrestricted basis, or can be constructed from available plasmids
in accord with published procedures. In addition, equivalent
plasmids to those described are known in the art and will be
apparent to the ordinarily skilled artisan.
[0132] "Digestion" of DNA refers to catalytic cleavage of the DNA
with a restriction enzyme that acts only at certain sequences in
the DNA. The various restriction enzymes used herein are
commercially available and their reaction conditions, cofactors and
other requirements were used as would be known to the ordinarily
skilled artisan. For analytical purposes, typically 1 .mu.g of
plasmid or DNA fragment is used with about 2 units of enzyme in
about 20 .mu.l of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 .mu.g of DNA
are digested with 20 to 250 units of enzyme in a larger volume.
Appropriate buffers and substrate amounts for particular
restriction enzymes are specified by the manufacturer. Incubation
times of about 1 hour at 37.degree. C. are ordinarily used, but may
vary in accordance with the supplier's instructions. After
digestion the reaction is electrophoresed directly on a
polyacrylamide gel to isolate the desired fragment.
[0133] Size separation of the cleaved fragments is performed using
8 percent polyacrylamide gel described by Goeddel, D. et al.,
Nucleic Acids Res., 8:4057 (1980).
[0134] "Oligonucleotides" refers to either a single stranded
polydeoxynucleotide or two complementary polydeoxynucleotide
strands which may be chemically synthesized. Such synthetic
oligonucleotides have no 5' phosphate and thus will not ligate to
another oligonucleotide without adding a phosphate with an ATP in
the presence of a kinase. A synthetic oligonucleotide will ligate
to a fragment that has not been dephosphorylated.
[0135] "Ligation" refers to the process of forming phosphodiester
bonds between two double stranded nucleic acid fragments (Maniatis,
T., et al., Id., p. 146). Unless otherwise provided, ligation may
be accomplished using known buffers and conditions with 10 units of
T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar
amounts of the DNA fragments to be ligated.
[0136] Unless otherwise stated, transformation was performed as
described by the method of Graham, F. and Van der Eb, A., Virology,
52:456-457 (1973).
EXAMPLE 1
Bacterial Expression and Purification of FGF-14 Protein
[0137] The DNA sequence encoding FGF-14 ATCC.TM. # 97148, is
initially amplified using PCR oligonucleotide primers corresponding
to the 5' sequences of the processed protein (minus the signal
peptide sequence) and the vector sequences 3' to the gene.
Additional nucleotides corresponding to the gene are added to the
5' and 3' sequences. The 5' oligonucleotide primer has the sequence
5' GCCAGAGCATGCAGCGGCGCGTGTGTCCCCGC 3' (SEQ ID NO:3) and contains
an SphI restriction enzyme site. The 3' sequence 5'
GCCAGAAGATCTGGGGGCAGGGGGACTGGAAGG 3' (SEQ ID NO:4) contains
complementary sequences to a BglII site and is followed by 21
nucleotides of FGF-14 coding sequence.
[0138] The restriction enzyme sites correspond to the restriction
enzyme sites on the bacterial expression vector pQE70 (Qiagen, Inc.
Chatsworth, Calif. 91311). pQE-70 encodes antibiotic resistance
(Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter operator (P/O), a ribosome binding site
(RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then
digested with NcoI and BglII. The amplified sequences are ligated
into pQE-70 and are inserted in frame with the sequence encoding
for the histidine tag and the ribosome binding site (RBS). The
ligation mixture is then used to transform E. coli strain M15/rep 4
(Qiagen, Inc.) by the procedure described in Sambrook, J. et al.,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989). M15/rep4 contains multiple copies of the plasmid
pREP4, which expresses the lacI repressor and also confers
kanamycin resistance (Kan.sup.r). Transformants are identified by
their ability to grow on LB plates and ampicillin/kanamycin
resistant colonies were selected. Plasmid DNA is isolated and
confirmed by restriction analysis. Clones containing the desired
constructs are grown overnight (O/N) in liquid culturein LB media
supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N
culture is used to inoculate a large culture at a ratio of 1:100 to
1:250. The cells are grown to an optical density 600 (O.D..sup.600)
of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto
pyranoside") is then added to a final concentration of 1 mM. IPTG
induces by inactivating the lacI repressor, clearing the P/0
leading to increased gene expression. Cells are grown an extra 3 to
4 hours. Cells are then harvested by centrifugation. The cell
pellet is solubilized in the chaotropic agent 6 Molar Guanidine
HCl. After clarification, solubilized FGF-14 is purified from this
solution by chromatography on a Nickel-Chelate column under
conditions that allow for tight binding by proteins containing the
6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184
(1984)). The proteins are eluted from the column in 6 molar
guanidine HCl pH 5.0 and for the purpose of renaturation adjusted
to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 mmolar
glutathione (reduced) and 2 mmolar glutathione (oxidized). After
incubation in this solution for 12 hours the proteins are dialyzed
to 10 mmolar sodium phosphate.
EXAMPLE 2
Cloning and Expression of FGF-14 Using the Baculovirus Expression
System
[0139] The DNA sequence encoding the full length FGF-14 protein,
ATCC.TM. # 97148, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
[0140] The FGF-14 5' primer has the sequence 5'CTAGTGGATCC
CATCATGGCGGCGCTGGCCAGT 3' (SEQ ID NO:5) for the pA2 vector and
contains a BamHI restriction enzyme site (in bold) followed by 4
nucleotides resembling an efficient signal for the initiation of
translation in eukaryotic cells (Kozak, M., J. Mol. Biol.,
196:947-950 (1987) which is just behind the first 18 nucleotides of
the gene (the initiation codon for translation "ATG" is
underlined). For the pA2gp vector the 5' primer has the sequence 5'
CGACTGGATCCCCAGCGGCGCGTGTGTCCC 3' (SEQ ID NO:6).
[0141] The 3' primer has the sequence 5'CGACTTCTAGAATCAGGGGG
CAGGGGGACTGGA 3' (SEQ ID NO:7) and contains the cleavage site for
the restriction endonuclease XbaI (in bold) and 22 nucleotides
complementary to the 3' non-translated sequence of the gene.
[0142] The amplified sequences are isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment is then digested with the respective
endonucleases and purified again on a 1% agarose gel. This fragment
is designated F2.
[0143] The vector pA2gp (and pA2) (modifications of pVL941 vector,
discussed below) is used for the expression of the proteins using
the baculovirus expression system (for review see: Summers, M. D.
and Smith, G. E. 1987, A manual of methods for baculovirus vectors
and insect cell culture procedures, Texas Agricultural Experimental
Station Bulletin No. 1555). This expression vector contains the
strong polyhedrin promoter of the Autographa californica nuclear
polyhedrosis virus (AcMNPV) followed by the recognition sites for
the restriction endonucleases BamHI and XbaI. The polyadenylation
site of the simian virus (SV)40 is used for efficient
polyadenylation. For an easy selection of recombinant virus the
beta-galactosidase gene from E. coli is inserted in the same
orientation as the polyhedrin promoter followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin
sequences are flanked at both sides by viral sequences for the
cell-mediated homologous recombination of co-transfected wild-type
viral DNA. Many other baculovirus vectors could be used in place of
pA2 such as pRG 1, pAc373, pVL941 and pAcIM1 (Luckow, V. A. and
Summers, M. D., Virology, 170:31-39).
[0144] The plasmid is digested with the restriction enzymes and
dephosphorylated using calf intestinal phosphatase by procedures
known in the art. The DNA is then isolated from a 1% agarose gel
using the commercially available kit ("Geneclean" BIO 101 Inc., La
Jolla, Calif.). This vector DNA is designated V2.
[0145] Fragment F2 and the dephosphorylated plasmid V2 are ligated
with T4 DNA ligase. E. coli DH5a cells are then transformed and
bacteria identified that contained the plasmid (pBacFGF-14) using
the respective restriction enzymes. The sequence of the cloned
fragment are confirmed by DNA sequencing. pBacFGF-14 is deposited
as ATCC.TM. # PTA-974.
[0146] 5 .mu.g of the plasmid pBacFGF-14 is co-transfected with 1.0
.mu.g of a commercially available linearized baculovirus
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.)
using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci.
USA, 84:7413-7417 (1987)).
[0147] 1 .mu.g of BaculoGold.TM. virus DNA and 5 .mu.g of the
plasmid is mixed in a sterile well of microtiter plates containing
50 .mu.l of serum free Grace's medium (Life Technologies Inc.,
Gaithersburg, Md.). Afterwards 10 .mu.l Lipofectin plus 90 .mu.l
Grace's medium are added, mixed and incubated for 15 minutes at
room temperature. Then the transfection mixture is added drop-wise
to the Sf9 insect cells (ATCC.TM. CRL 1711) seeded in 35 mm tissue
culture plates with 1 ml Grace's medium without serum. The plates
are rocked back and forth to mix the newly added solution. The
plates are then incubated for 5 hours at 27.degree. C. After 5
hours the transfection solution is removed from the plate and 1 ml
of Grace's insect medium supplemented with 10% fetal calf serum is
added. The plates are put back into an incubator and cultivation
continued at 27.degree. C. for four days.
[0148] After four days the supernatant is collected and plaque
assays performed similar as described by Summers and Smith (supra).
As a modification an agarose gel with "Blue Gal" (Life Technologies
Inc., Gaithersburg) is used which allows an easy isolation of blue
stained plaques. (A detailed description of a "plaque assay" can
also be found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10).
[0149] Four days after the serial dilution the virus is added to
the cells and blue stained plaques are picked with the tip of an
Eppendorf pipette. The agar containing the recombinant viruses is
then resuspended in an Eppendorf tube containing 200 .mu.l of
Grace's medium. The agar is removed by a brief centrifugation and
the supernatant containing the recombinant baculovirus is used to
infect Sf9 cells seeded in 35 mm dishes. Four days later the
supernatants of these culture dishes are harvested and then stored
at 4.degree. C.
[0150] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus V-FGF-14 at a multiplicity of infection (MOI) of 2. Six
hours later the medium is removed and replaced with SF900 II medium
minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S cysteine (Amersham) are added. The cells are
further incubated for 16 hours before they are harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
EXAMPLE 3
Expression of Recombinant FGF-14 in COS Cells
[0151] The expression of plasmids, FGF-14-HA derived from a vector
pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication,
2) ampicillin resistance gene, 3) E. coli replication origin, 4)
CMV promoter followed by a polylinker region, an SV40 intron and
polyadenylation site. DNA fragments encoding the entire FGF-14
precursor and an HA tag fused in frame to the 3' end is cloned into
the polylinker region of the vector, therefore, the recombinant
protein expression is directed under the CMV promoter. The HA tag
corresponds to an epitope derived from the influenza hemagglutinin
protein as previously described (I. Wilson, H. Niman, R. Heighten,
A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767,
(1984)). The infusion of HA tag to the target protein allows easy
detection of the recombinant protein with an antibody that
recognizes the HA epitope.
[0152] The plasmid construction strategy is described as
follows:
[0153] The DNA sequence encoding FGF-14, ATCC.TM. # 97148, is
constructed by PCR using two primers: the 5' primer 5'CTAG
TGGATCCCATCATGGCGGCGCTGGCCAGT 3' (SEQ ID NO:8) contains a BamHI
site followed by 18 nucleotides of coding sequence starting from
the initiation codon; the 3' sequence 5'
GATTTACTCGAGGGGGGCAGGGGGACTGGA 3' (SEQ ID NO:9) contains
complementary sequences to an XhoI site, translation stop codon, HA
tag and the last 18 nucleotides of the FGF-14 coding sequence (not
including the stop codon). Therefore, the PCR product contains a
BamHI site, coding sequence followed by HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an XhoI
site.
[0154] The PCR amplified DNA fragments and the vector, pcDNA3/Amp,
are digested with the respective restriction enzymes and ligated.
The ligation mixture is transformed into E. coli strain SURE
(available from Stratagene Cloning Systems, La Jolla, Calif. 92037)
the transformed culture is plated on ampicillin media plates and
resistant colonies are selected. Plasmid DNA is isolated from
transformants and examined by restriction analysis for the presence
of the correct fragment. For expression of the recombinant FGF-14
COS cells are transfected with the expression vector by
DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory
Press, (1989)). The expression of the FGF-14-HA protein is detected
by radiolabelling and immunoprecipitation method (E. Harlow, D.
Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, (1988)). Cells are labelled for 8 hours with
.sup.35S-cysteine two days post transfection. Culture media is then
collected and cells are lysed with detergent (RIPA buffer (150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5)
(Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and
culture media are precipitated with an HA specific monoclonal
antibody. Proteins precipitated are analyzed on 15% SDS-PAGE
gels.
EXAMPLE 4
Expression via Gene Therapy
[0155] Fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin, is added. This is
then incubated at 37.degree. C. for approximately one week. At this
time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into
larger flasks.
[0156] pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0157] The cDNA encoding a polypeptide of the present invention is
amplified using PCR primers which correspond to the 5' and 3' end
sequences respectively. The 5' primer containing an EcoRI site and
the 3' primer having contains a HindIII site. Equal quantities of
the Moloney murine sarcoma virus linear backbone and the EcoRI and
HimdIII fragment are added together, in the presence of T4 DNA
ligase. The resulting mixture is maintained under conditions
appropriate for ligation of the two fragments. The ligation mixture
is used to transform bacteria HB101, which are then plated onto
agar-containing kanamycin for the purpose of confirming that the
vector had the gene of interest properly inserted.
[0158] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells are transduced with the vector.
The packaging cells now produce infectious viral particles
containing the gene (the packaging cells are now referred to as
producer cells).
[0159] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his.
[0160] The engineered fibroblasts are then injected into the host,
either alone or after having been grown to confluence on cytodex 3
microcarrier beads. The fibroblasts now produce the protein
product.
[0161] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, within the scope of the appended claims, the invention
may be practiced otherwise than as particularly described.
Sequence CWU 1
1
171679DNAHomo sapiens 1atggcggcgc tggccagtag cctgatccgg cagaagcggg
aggtccgcga gcccgggggc 60agccggccgg tgtcggcgca gcggcgcgtg tgtccccgcg
gcaccaagtc cctttgccag 120aagcagctcc tcatcctgct gtccaaggtg
cgactgtgcg gggggcggcc cgcgcggccg 180gaccgcggcc cggagcctca
gctcaaaggc atcgtcacca aactgttctg ccgccagggt 240ttctacctcc
aggcgaatcc cgacggaagc atccagggca ccccagagga taccagctcc
300ttcacccact tcaacctgat ccctgtgggc ctccgtgtgg tcaccatcca
gagcgccaag 360ctgggtcact acatggccat gaatgctgag ggactgctct
acagttcgcc gcatttcaca 420gctgagtgtc gctttaagga gtgtgtcttt
gagaattact acgtcctgta cgcctctgct 480ctctaccgcc agcgtcgttc
tggccgggcc tggtacctcg gcctggacaa ggagggccag 540gtcatgaagg
gaaaccgagt taagaagacc aaggcagctg cccactttct gcccaagctc
600ctggaggtgg ccatgtacca ggagccttct ctccacagtg tccccgaggc
ctccccttcc 660agtccccctg ccccctgaa 6792225PRTHomo sapiens 2Met Ala
Ala Leu Ala Ser Ser Leu Ile Arg Gln Lys Arg Glu Val Arg 1 5 10
15Glu Pro Gly Gly Ser Arg Pro Val Ser Ala Gln Arg Arg Val Cys Pro20
25 30Arg Gly Thr Lys Ser Leu Cys Gln Lys Gln Leu Leu Ile Leu Leu
Ser35 40 45Lys Val Arg Leu Cys Gly Gly Arg Pro Ala Arg Pro Asp Arg
Gly Pro50 55 60Glu Pro Gln Leu Lys Gly Ile Val Thr Lys Leu Phe Cys
Arg Gln Gly65 70 75 80Phe Tyr Leu Gln Ala Asn Pro Asp Gly Ser Ile
Gln Gly Thr Pro Glu85 90 95Asp Thr Ser Ser Phe Thr His Phe Asn Leu
Ile Pro Val Gly Leu Arg100 105 110Val Val Thr Ile Gln Ser Ala Lys
Leu Gly His Tyr Met Ala Met Asn115 120 125Ala Glu Gly Leu Leu Tyr
Ser Ser Pro His Phe Thr Ala Glu Cys Arg130 135 140Phe Lys Glu Cys
Val Phe Glu Asn Tyr Tyr Val Leu Tyr Ala Ser Ala145 150 155 160Leu
Tyr Arg Gln Arg Arg Ser Gly Arg Ala Trp Tyr Leu Gly Leu Asp165 170
175Lys Glu Gly Gln Val Met Lys Gly Asn Arg Val Lys Lys Thr Lys
Ala180 185 190Ala Ala His Phe Leu Pro Lys Leu Leu Glu Val Ala Met
Tyr Gln Glu195 200 205Pro Ser Leu His Ser Val Pro Glu Ala Ser Pro
Ser Ser Pro Pro Ala210 215 220Pro225332DNAHomo sapiens 3gccagagcat
gcagcggcgc gtgtgtcccc gc 32433DNAHomo sapiens 4gccagaagat
ctgggggcag ggggactgga agg 33533DNAHomo sapiens 5ctagtggatc
ccatcatggc ggcgctggcc agt 33630DNAHomo sapiens 6cgactggatc
cccagcggcg cgtgtgtccc 30733DNAHomo sapiens 7cgacttctag aatcaggggg
cagggggact gga 33833DNAHomo sapiens 8ctagtggatc ccatcatggc
ggcgctggcc agt 33930DNAHomo sapiens 9gatttactcg aggggggcag
ggggactgga 301017PRTHomo sapiensSITE(2)Xaa equals any of the
naturally occurring L- amino acids 10Gly Xaa Leu Xaa Ser Xaa Xaa
Xaa Xaa Xaa Xaa Asp Cys Xaa Phe Xaa 1 5 10 15Glu1117PRTHomo
sapiensSITE(2)Xaa equals any of the naturally occurring L- amino
acids 11Gly Xaa Leu Xaa Thr Xaa Xaa Xaa Xaa Xaa Xaa Asp Cys Xaa Phe
Xaa 1 5 10 15Glu1217PRTHomo sapiensSITE(2)Xaa equals any of the
naturally occurring L- amino acids 12Gly Xaa Leu Xaa Ala Xaa Xaa
Xaa Xaa Xaa Xaa Asp Cys Xaa Phe Xaa 1 5 10 15Glu1317PRTHomo
sapiensSITE(2)Xaa equals any of the naturally occurring L- amino
acids 13Gly Xaa Leu Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Asp Cys Xaa Phe
Xaa 1 5 10 15Glu1417PRTHomo sapiensSITE(2)Xaa equals any of the
naturally occurring L- amino acids 14Gly Xaa Leu Xaa Ser Xaa Xaa
Xaa Xaa Xaa Xaa Glu Cys Xaa Phe Xaa 1 5 10 15Glu1517PRTHomo
sapiensSITE(2)Xaa equals any of the naturally occurring L- amino
acids 15Gly Xaa Leu Xaa Thr Xaa Xaa Xaa Xaa Xaa Xaa Glu Cys Xaa Phe
Xaa 1 5 10 15Glu1617PRTHomo sapiensSITE(2)Xaa equals any of the
naturally occurring L- amino acids 16Gly Xaa Leu Xaa Ala Xaa Xaa
Xaa Xaa Xaa Xaa Glu Cys Xaa Phe Xaa 1 5 10 15Glu1717PRTHomo
sapiensSITE(2)Xaa equals any of the naturally occurring L- amino
acids 17Gly Xaa Leu Xaa Gly Xaa Xaa Xaa Xaa Xaa Xaa Glu Cys Xaa Phe
Xaa 1 5 10 15Glu
* * * * *