U.S. patent application number 11/663570 was filed with the patent office on 2009-01-29 for method of enhancing proliferation and/or survival of mesenchymal precursor cells (mpc).
Invention is credited to Stan Gronthos, Andrew Christopher William Zannettino.
Application Number | 20090029912 11/663570 |
Document ID | / |
Family ID | 36089761 |
Filed Date | 2009-01-29 |
United States Patent
Application |
20090029912 |
Kind Code |
A1 |
Gronthos; Stan ; et
al. |
January 29, 2009 |
Method of enhancing proliferation and/or survival of mesenchymal
precursor cells (mpc)
Abstract
The present invention relates to methods of enhancing
proliferation and/or survival of mesenchymal precursor cells (MPC)
and/or progeny derived therefrom in vitro or in vivo comprising
exposing the MPC or progeny to SDF-1 or analog thereof. The
invention also relates to compositions comprising isolated MPCs or
progeny derived therefrom and SDF-1 or analogues thereof. The
present invention also relates to using such methods and
compositions for ex vivo or in vivo bone formation in mammals.
Inventors: |
Gronthos; Stan; (South
Australia, AU) ; Zannettino; Andrew Christopher William;
(South Australia, AU) |
Correspondence
Address: |
COOPER & DUNHAM, LLP
30 Rockefeller Plaza, 20th Floor
NEW YORK
NY
10112
US
|
Family ID: |
36089761 |
Appl. No.: |
11/663570 |
Filed: |
June 29, 2005 |
PCT Filed: |
June 29, 2005 |
PCT NO: |
PCT/AU05/00953 |
371 Date: |
March 12, 2008 |
Current U.S.
Class: |
514/1.1 ;
435/325; 435/377; 514/9.1 |
Current CPC
Class: |
A61P 19/10 20180101;
A61P 21/00 20180101; C12N 2501/2301 20130101; A61P 9/00 20180101;
C12N 2501/25 20130101; A61P 1/02 20180101; C12N 2501/2306 20130101;
A61P 43/00 20180101; C12N 2501/22 20130101; C12N 2502/13 20130101;
A61P 19/02 20180101; C12N 2501/135 20130101; A61P 29/00 20180101;
C12N 5/0652 20130101; A61P 9/10 20180101; C12N 2501/2303 20130101;
C12N 2501/125 20130101; C12N 2501/999 20130101; A61P 19/08
20180101; C12N 5/0663 20130101; A61P 19/00 20180101 |
Class at
Publication: |
514/12 ; 435/325;
435/377 |
International
Class: |
A61K 38/17 20060101
A61K038/17; C12N 5/06 20060101 C12N005/06; A61P 19/00 20060101
A61P019/00; A61P 21/00 20060101 A61P021/00; A61P 9/10 20060101
A61P009/10 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 24, 2004 |
US |
60/613021 |
Claims
1. A method of enhancing proliferation and/or survival of
mesenchymal precursor cells (MPC) or progeny derived therefrom, the
method comprising exposing the MPC or progeny to SDF-1 or an analog
thereof.
2. A method as claimed in claim 1 wherein the MPC are positive for
at least one marker selected from the group consisting of
STRO-1.sup.bright, VCAM-1.sup.bright, THY-1.sup.bright,
CD146.sup.bright and STRO-2.sup.bright.
3. A method as claimed in claim 1 wherein the MPC carry at least
two markers selected from the group of surface markers specific for
mesenchymal precursor cells consisting of STRO-1.sup.bri, LFA-3,
THY-1, VCAM-1, ICAM-1, PECAM-1, P-selectin, L-selectin,
CD49a/CD49b/CD29, CD49c/CD29, CD49d/CD29, CD29, CD18, CD61, beta-1
integrin, 6-19, thrombomodulin, CD10, CD13, SCF, PDGF-R, EGF-R,
IGF1-R, NGF-R, FGF-R, Leptin-R, RANKL and CD146 or any combination
of these markers.
4. A method as claimed in claim 1 wherein the MPC are negative for
at least one marker selected from the group consisting of CBFA-1,
collagen type II, PPAR.gamma.2, and glycophorin A.
5. A method as claimed in claim 1 wherein the MPC are present in an
enriched composition in vitro and constitute at least 1% of the
total cells of the composition.
6. A method as claimed in claim 1 wherein the MPC are in situ.
7-9. (canceled)
10. A method as claimed in claim 1 wherein the SDF-1 analog is a
ligand that activates CXCR4 signalling.
11. A method as claimed in claim 10 wherein the SDF-1 analog is
selected from the group consisting of the HIV-1 coat protein gp120,
AMD3100 and ALX40-4C.
12. (canceled)
13. A method of developing a tissue specific committed cell
population, the method comprising exposing MPC or progeny derived
therefrom to exogenous SDF-1 or an analog thereof to enhance
proliferation and/or survival of the MPC or progeny, and subjecting
the proliferated population to conditions biasing differentiation
of the MPC or progeny derived therefrom to a specific tissue
type.
14. A method as claimed in claim 13 wherein the tissue type is
selected from the group consisting of cardiac muscle tissue,
vascular tissue, bone tissue, neural tissue and endothelial
tissue.
15. A composition comprising isolated MPC or progeny derived
therefrom and SDF-1 or an analog thereof.
16. A composition as claimed in claim 15 wherein the composition
comprises substantially purified MPC or progeny, comprising at
least about 0.1% of total cells of the composition.
17. (canceled)
18. A composition as claimed in claim 15 wherein the composition
comprises an additional stimulatory factor selected from the group
consisting of PDGF, SCF, FL, G-CSF, IL-3, IL-6, 1,25D, TNF-.alpha.
and IL-1.beta..
19-22. (canceled)
23. An MPC or precursor cell derived therefrom that has been
genetically modified to overexpress SDF-1 or an analog thereof.
24. An MPC or precursor cell derived therefrom as claimed in claim
23 wherein the MPC or precursor cell derived therefrom is
transfected with a polynucleotide encoding SDF-1.
25. (canceled)
26. A composition comprising a population of genetically modified
MPC as claimed in claim 23.
27-31. (canceled)
32. A method of generating bone in a subject, the method comprising
exposing MPC or progeny derived therefrom in the subject to
exogenous SDF-1 or an analog thereof.
33. A method as claimed in claim 32 wherein the SDF-1 analog is a
ligand that activates CXCR4 signalling.
34. A method as claimed in claim 33 wherein the SDF-1 analog is
selected from the group consisting of the HIV-1 coat protein gp120,
AMD3100 and ALX40-4C.
35-36. (canceled)
37. A method as claimed in claim 32 wherein the method further
comprises administering to the subject a synthetic glucocorticoid
and/or a bone morphogenic protein.
38-40. (canceled)
41. A method of generating vascular tissue in a subject, the method
comprising exposing MPC or progeny derived therefrom in the subject
to exogenous SDF-1 or an analog thereof.
42. A method as claimed in claim 41 wherein the SDF-1 analog is a
ligand that activates CXCR4 signalling.
43-45. (canceled)
46. A method of generating cardiac muscle or smooth muscle in a
subject, the method comprising exposing MPC or progeny derived
therefrom in the subject to exogenous SDF-1 or an analog
thereof.
47. A method as claimed in claim 46 wherein the SDF-1 analog is a
ligand that activates CXCR4 signalling.
48. A method as claimed in claim 47 wherein the SDF-1 analog is
selected from the group consisting of the HIV-1 coat protein gp120,
AMD3100 and ALX40-4C.
49-50. (canceled)
51. A method for generating bone ex vivo, the method comprising
exposing MPC or progeny derived therefrom to exogenous SDF-1 or an
analog thereof to enhance proliferation and/or survival of the MPC
or progeny, and subjecting the proliferated population to
conditions biasing differentiation of the MPC to bone precursor
cells, or to conditions biasing differentiation of bone precursor
cells to bone.
52. A method as claimed in claim 51 wherein the conditions biasing
differentiation involve culturing the cells in .alpha.MEM
supplemented with FCS, L-ascorbate-2-phosphate, dexamethasone and
inorganic phosphate.
53. A method as claimed in claim 51 wherein the conditions biasing
differentiation involve culturing the cells in the presence of a
compound selected from the group consisting of type I collagen,
fibrinogen, fibrin, polyglycolic acid, polylactic acid, osteocalcin
and osteonectin or any combination thereof.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to compositions comprising
mesenchymal precursor cells (MPC) and/or precursor cells derived
therefrom and to methods for enhancing the proliferation and/or
survival of these cells in vitro or in vivo. The present invention
also relates to methods for ex vivo or in vivo formation of bone in
mammals.
BACKGROUND OF THE INVENTION
[0002] Bone remodelling is a continuous physiological process that
occurs in adult skeleton in which bone resorption is followed by
new bone formation, maintaining mechanical strength and structure.
Bone cells that are responsible for this coupled process include
bone-resorbing cells (osteoclasts, which are derived from
haematopoietic cells of the monocyte/macrophage lineage) and
bone-forming cells (osteoblasts, which are of mesenchymal origin).
The bone resorption process is involved in many clinical situations
that are relevant to the work of rheumatologists, such as focal
bone destruction or erosion in RA and other inflammatory arthritis,
and the diffuse bone loss that is encountered in osteoporosis.
[0003] Osteoclast activation is a critical cellular process for
pathological bone resorption, such as erosions in rheumatoid
arthritis (RA) or generalized bone loss. Among many factors
triggering excessive osteoclast activity, cytokines such as IL-1 or
tumour necrosis factor (TNF)-.alpha. play a central role. More
recently, the chemokine stromal cell-derived factor-1 (SDF-1) has
been shown to promote the chemotactic recruitment, development and
survival of human osteoclasts (Wright et al., Bone 36:840-853,
2005; Zannettino et al., Cancer Res 65(5): 1700-1709, 2005; Grassi
et al., J. Cell. Physiol. 199:244-251, 2004).
[0004] Chemokines are a superfamily of chemoattractant proteins
which regulate a variety of biological responses and they promote
the recruitment of multiple lineages of leukocytes and lymphocytes
to a body organ tissue. Chemokines may be classified into two
families according to the relative position of the first two
cysteine residues in the protein. In one family, the first two
cysteines are separated by one amino acid residue, the CXC
chemokines, and in the other family the first two cysteines are
adjacent, the CC chemokines. In humans, the genes of the CXC
chemokines are clustered on chromosome 4 (with the exception of
SDF-1 gene, which has been localized to chromosome 10) and those of
the CC chemokines on chromosome 17.
[0005] The molecular targets for chemokines are cell surface
receptors. One such receptor is CXC chemokine receptor 4 (CXCR4),
which is a 7 transmembrane protein, coupled to G1 and was
previously called LESTR (Loetscher et al., (1994) J. Biol. Chem,
269: 232-237, 1994), HUMSTR (Federsppiel et al., Genomics 16,
707-712, 1993) and Fusin (Feng et al., Science 272: 872-877, 1996).
CXCR4 is widely expressed on cells of hemopoietic origin, and is a
major co-receptor with CD4.sup.+ for human immunodeficiency virus 1
(HIV-1) (Feng et al., Science 272: 872-877, 1996).
[0006] Currently, the only known natural ligand for CXCR4 is SDF-1.
Stromal cell derived factor-1 alpha (SDF-1 alpha) and stromal cell
derived factor-1 beta (SDF-1 beta) are closely related proteins
(together referred to herein as SDF-1). The native amino acid
sequences of SDF-1 alpha and SDF-1 beta are known, as are the
genomic sequences encoding these proteins (U.S. Pat. No. 5,563,048
and U.S. Pat. No. 5,756,084).
[0007] The 3-dimensional crystallographic structure of SDF-1 has
been described (Crump et al., EMBO J. 16: 6996-7007, 1997).
Structure-activity analysis of SDF-1 indicates that although
N-terminal residues 1-8 or 1-9 are involved in receptor binding,
the 1-8 and 1-9 peptides alone exhibited no in vitro activity
indicative of receptor binding, supporting a reported conclusion
that the peptides do not assume the conformation necessary for
binding to the receptor. This result was taken to imply that the
remainder of the protein scaffold, and/or various consensus
receptor binding sites elsewhere in the protein are important for
mediating the conformational requirements for N-terminal binding to
the receptor (Crump et al., EMBO J. 16: 6996-7007, 1997). Based on
these results, a two-site model has been proposed for SDF-1 binding
to CXCR4, involving two binding sites in residues 1-17, an
N-terminal site and an upstream RFFESH site (Crump et al., EMBO J.
16: 6996-7007, 1997). The two putative binding sites are joined by
the CXC motif that characterizes the whole CXC chemokine family.
These two putative binding regions have been identified as being
important in other CC and CXC chemokines (Crump et al., EMBO J. 16:
6996-7007, 1997). This is consistent with the finding that although
N-terminal regions of a wide variety of chemokines are critical for
receptor activation, N-terminal peptides of chemokines other than
SDF-1 have been reported to lack receptor binding activity and not
to be receptor agonists (Crump et al., EMBO J. 16: 6996-7007,
1997).
[0008] Postnatal human bone marrow stromal stem cells (BMSSCs) or
mesenchymal precursor cells (MPCs) have the capacity to regenerate
a hematopoietic-supportive bone marrow organ and associated bone
trabecular, when transplanted into immunocompromised mice
(Friedenstein et al. Exp Hematol. 6: 440-444, 1978; Kuznetsov et
al. J Bone Miner Res. 12: 1335-1347, 1997; Pittenger et al. Science
284: 143-147, 1999; Bianco et al., Stem Cells 19: 180-192, 2001;
Gronthos et al. J Cell Sci. 116: 1827-1835, 2003). Recent studies
have also reported that BMSSCs are more plastic than first
realized, by virtue of their ability to develop into diverse cell
lineages such as myelosupportive stroma, osteoblasts, chondrocytes,
adipocytes, myoblasts, hepatocytes, cardiomyocytes, and neural
cells (Liechty et al. Nat. Med. 6: 1282-1286, 2000; Zhao et al. Exp
Neurol. 174: 11-20, 2002; Verfaillie et al. Ann N Y Acad. Sci. 996:
231-234, 2003). These developments have prompted investigations
into the possible use of ex vivo-expanded BMSSC populations for
bone regeneration. However, the progress of these studies has
largely been restrained because of a lack of understanding of the
critical factors that regulate the growth and survival of human
multipotential BMSSCs and the eventual development of these cells
into bone.
SUMMARY OF THE INVENTION
[0009] The present inventors have now identified SDF-1 as a
differentially expressed gene that is highly expressed by purified
BMSSCs prior to culture. In particular, the present inventors have
found that immature preosteogenic cells cultured in vitro expressed
greater levels of SDF-1 when compared with mature cell types
representative of osteoblasts and osteocytes/bone lining cells.
Furthermore, SDF-1 expression was rapidly down-regulated when
BMSSCs were cultured under osteoinductive conditions.
[0010] BMSSCs were also shown to express functional cell surface
SDF-1 receptors (CXCR4). Transduced BMSSC lines, secreting high
SDF-1 levels, displayed an enhanced ability to form ectopic bone in
vivo, in comparison with control BMSSC lines. Moreover, high
SDF-1-expressing BMSSCs displayed an increased capacity for
cellular growth and protection against interleukin-4-induced
apoptosis. Similarly, fibroblast colony-forming units (CFU-Fs) also
displayed increased growth and resistance to
.alpha.-interferon-2a-induced apoptosis, in synergy with
platelet-derived growth factor BB (PDGF-BB) and SDF-1 in vitro.
[0011] These findings indicate that the chemokine SDF-1 plays a
role in the proliferation, survival, and osteogenic capacity of
immature BMSSC populations.
[0012] Accordingly, the present invention provides a method of
enhancing proliferation and/or survival of mesenchymal precursor
cells (MPC) or progeny derived therefrom, the method comprising
exposing the MPC or progeny to SDF-1 or an analog thereof.
[0013] The present invention also provides a method of developing a
tissue specific committed cell population, the method comprising
the steps of [0014] contacting MPC or progeny derived therefrom
with SDF-1 or an analog thereof to enhance proliferation and/or
survival of the MPC or progeny, and [0015] subjecting the
proliferated population to conditions biasing differentiation of
the MPC or progeny derived therefrom to a specific tissue type.
[0016] The present invention also provides an MPC or precursor cell
derived therefrom that has been genetically modified to overexpress
SDF-1 or an analog thereof.
[0017] The present invention also provides a composition comprising
a population of transfected MPC of the present invention.
[0018] The present invention also provides a composition comprising
MPC or progeny derived therefrom and SDF-1 or an analog
thereof.
[0019] The present invention also provides a method of generating
bone in a subject, the method comprising exposing MPC or progeny
derived therefrom in the subject to exogenous SDF-1 or an analog
thereof.
[0020] The present invention also provides a method of generating
bone in a subject, the method comprising administering a
composition of the invention to the subject at the site of desired
bone generation.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1. Gene expression profile of STRO-1.sup.bri or
STRO-1.sup.dim expressing cells derived from cultured MPC. Single
cell suspensions of ex vivo expanded bone marrow MPC were prepared
by trypsin/EDTA treatment. Cells were stained with the STRO-1
antibody which was subsequently revealed by incubation with
goat-anti murine IgM-fluorescein isothiocyanate. Total cellular RNA
was prepared from purified populations of STRO-1.sup.dim or
STRO-1.sup.bri expressing cells, following fluorescence activated
cell sorting (A). Using RNAzo1B extraction method, and standard
procedures, total RNA was isolated from each subpopulation and used
as a template for cDNA synthesis. The expression of various
transcripts was assessed by PCR amplification, using a standard
protocol as described previously (Gronthos et al. J Cell Sci.
116:1827-1835, 2003). Primers sets used in this study are shown in
Table 2. Following amplification, each reaction mixture was
analysed by 1.5% agarose gel electrophoresis, and visualised by
ethidium bromide staining (B). Relative gene expression for each
cell marker was assessed with reference to the expression of the
house-keeping gene, GAPDH, using ImageQant software (C).
[0022] FIG. 2. Immunophenotypic expression pattern of ex vivo
expanded cells derived from bone marrow MPCs. Single cell
suspensions of ex vivo expanded cells derived bone marrow MPC were
prepared by trypsin/EDTA detachment and subsequently incubated with
the STRO-1 antibody in combination with antibodies identifying a
wide range of cell lineage-associated markers. STRO-1 was
identified using a goat anti-murine IgM-fluorescein isothiocyanate
while all other markers were identified using either a goat
anti-mouse or anti-rabbit IgG-phycoerythrin. For those antibodies
identifying intracellular antigens, cell preparations were first
labelled with the STRO-1 antibody, fixed with cold 70% ethanol to
permeabilize the cellular membrane and then incubated with
intracellular antigen-specific antibodies. Isotype matched control
antibodies were used under identical conditions. Dual-colour flow
cytometric analysis was performed using a COULTER EPICS flow
cytometer and list mode data collected. The dot plots represent
5,000 listmode events indicating the level of fluorescence
intensity for each lineage cell marker (y-axis) and STRO-1
(x-axis). The vertical and horizontal quadrants were established
with reference to the isotype matched negative control
antibodies.
[0023] FIG. 3. Adipogenic Development In Vitro. Single cell
suspensions were generated by trypsin/EDTA digest from secondary
cultures of ex vivo expanded cells, derived from
STRO-1.sup.bri/VCAM-1.sup.+ sorted bone marrow cells. The expanded
cells were then isolated according to their expression of STRO-1
using single colour fluorescence activated cell sorting as shown in
FIG. 1A. STRO-1.sup.bri and STRO-1.sup.dim sorted MPC derived cells
were then plated overnight, into 6-well plates, at a density of
1.times.10.sup.5 cells per well under regular growth medium. On the
following day the culture medium was replaced with adipogenic
inductive medium as described in the methods. The cultures were fed
twice a week thereafter for a total period of three weeks at which
time the cells were fixed and stained for Oil red O. Low (4.times.)
and high (20.times.) power magnifications are shown depicting Oil
red 0 staining of lipid containing adipocytes scattered throughout
the adherent stromal layers. On average 22.+-.5 Oil red O positive
adipocytes were identified in the STRO-1.sup.bri cultures (per unit
area at 20.times., n=9 fields) when compared to 7.+-.2 adipocytes
(per unit area at 20.times., n=9 fields) in the STRO-1.sup.dim
cultures.
[0024] FIG. 4. Osteogenic Development In Vitro. Single cell
suspensions were generated by trypsin/EDTA digest from secondary
cultures of ex vivo expanded cells, derived from
STRO-1.sup.bri/VCAM-1.sup.+ sorted bone marrow cells. The expanded
cells were then isolated according to their expression of STRO-1
using single colour fluorescence activated cell sorting (FACS) as
shown in FIG. 1A. STRO-1.sup.bri and STRO-1.sup.dim FACS isolated
cells were then plated overnight, into 48-well plates, at a density
of 0.3.times.10.sup.5 cells per well under regular growth medium
(four replicates per condition). On the following day the culture
medium was replaced with osteogenic inductive medium as described
in the methods. The cultures were fed twice a week thereafter for a
total period of three weeks at which time the cells were washed
then treated with 0.6N HCl to extract the calcium within the
mineralized deposits. Samples were reacted with
o-cresol-phthalein-complexon and the colorimetric reaction was read
at 570 .mu.m. The absolute calcium concentration was determined
according to a standard curve for calcium. (A) Calcium measurements
showed that the STRO-1.sup.bri cultures synthesised significantly
(*; p<0.05; t-test) more mineral when compared to the
STRO-1.sup.dim cultures. Replicate cultures were fixed and stained
for Alizarin red staining depicting typical levels of mineralised
deposits in the adherent layers of STRO-1.sup.bri (B) and
STRO-1.sup.dim (C) cultures.
[0025] FIG. 5. Chondrogenic Development In Vitro. Single cell
suspensions were generated by trypsin/EDTA digest from secondary
cultures of ex vivo expanded cells, derived from
STRO-1.sup.bri/VCAM-1.sup.+ sorted bone marrow cells. The expanded
cells were then isolated according to their expression of STRO-1
using single colour fluorescence activated cell sorting (FACS) as
shown in FIG. 1A. STRO-1.sup.bri and STRO-1.sup.dim FACS isolated
cells were then pelleted into polypropylene tubes at a density of
2.5.times.10.sup.5 cells per tube and cultured in chondrogenic
inductive media. The cultures were fed twice a week thereafter for
a total period of three weeks. Cell pellets were retrieved and used
for histological examination or preparation for total RNA as
described in the methods. Both STRO-1.sup.bri (A) and
STRO-1.sup.dim (B) cell populations were capable of forming cell
pellets containing chondrocyte-like cells. RT-PCR analysis
indicated that the STRO-1.sup.bri (SB) population demonstrated
higher levels of the cartilage associated genes collagen type X and
aggrecan when compared to the STRO-1.sup.dim (SD) cell population
(C).
[0026] FIG. 6. STRO-1.sup.Bri cells induce the proliferation of
STRO-1.sup.dim cells. Single cell suspensions of ex vivo expanded
bone marrow MPC were prepared by trypsin/EDTA treatment. Cells were
stained with the STRO-1 antibody and sorted into populations of
STRO-1.sup.dim or STRO-1.sup.bri expressing cultured cell
populations as described in FIG. 1. Cells were labelled with CFSE
as described in the methods. Unlabelled cells were used to
establish a negative control (auto-fluorescence). Colcemid.RTM.
(100 ng/ml) was used to inhibit cell division and provided an input
labelling index (Generation 0). Unlabelled STRO-1.sup.bri were
subsequently added back to the CFSE-labelled STRO-1.sup.dim cells
at a ratio of (A) 0 STRO-1.sup.bri cells:1.times.10.sup.5
STRO-1.sup.dim cells (0%); (B) 0.05.times.10.sup.5 STRO-1.sup.bri
cells:0.95.times.10.sup.5 STRO-1.sup.dim cells (5%); (C)
0.1.times.10.sup.5 STRO-1.sup.bri cells:0.9.times.10.sup.5
STRO-1.sup.dim cells (10%); (D) 0.2.times.10.sup.5 STRO-1.sup.bri
cells: 0.8.times.10.sup.5 STRO-1.sup.dim cells (20%); (E)
0.5.times.10.sup.5 STRO-1.sup.bri cells:0.5.times.10.sup.5
STRO-1.sup.dim cells (50%). The add-mixtures were cultured for a
period of 7 days, harvested, and analysed by flow cytometry as
described in the methods. Cell proliferation was analysed using the
ModFit LT for win 32 (Version 2.0). The STRO-1.sup.bri cells (R1)
were found to stimulate the proliferation of STRO-1.sup.dim cells
in a dose-dependent manner.
[0027] FIG. 7. Cytokines and osteotropic agents increase the number
of STRO-1.sup.bri cells in culture. Established cultures of MPC
were cultured in basal medium supplemented with 10% FCS (A), or a
range of factors, including 1.times.10.sup.-8M
1.alpha.,25-dihydroxyvitamin D.sub.3 (1,25D) (B), 10 ng/ml Platelet
derived growth factor (PDGF) (C), 10 ng/ml Tumour necrosis
factor-alpha (TNF-.alpha.) (D); 10 ng/ml interleukin-1.beta.
(IL-1.beta.) (E) and 30 ng/ml stromal derived factor 1-alpha
(SDF-1.alpha.) (F), for 5 days, stained with STRO-1 mAb and
analysed as described above. These factors were found to increase
the number of STRO-1.sup.bri MPC. The results displayed are a
representative example of 3 independent experiments.
[0028] FIG. 8. Athymic nude rats underwent ligation of the left
anterior descending (LAD) coronary artery and injected 48 hours
later with saline, 1.times.10.sup.6 human Stro-1.sup.dim cells,
1.times.10.sup.6 human Stro-1.sup.bri cells or 1.times.10.sup.6
human Stro-1-depleted bone marrow mononuclear cells. Two weeks
later, animals were sacrificed, and cardiac tissues were fixed and
concomitantly stained with two monoclonal antibodies: the first
being selectively reactive with the rat, but not the human, Ki67
antigen, and the second being reactive with the cardiomyocyte
marker troponin I. Dually stained cells, indicative of
proliferating rat cardiomyocytes, were detected by immunoperoxidase
technique. Animals receiving 1.times.10.sup.6 Stro-1.sup.bri human
cells demonstrated 2.5-5 fold higher numbers of proliferating rat
cardiomyocytes compared with control animals receiving saline or
1.times.10.sup.6 Stro-1.sup.dim human cells (p<0.05).
[0029] FIG. 9. Athymic nude rats were injected subcutaneously with
rat glioblastoma tumor cells, which constitutively secrete VEGF.
Two weeks later, the rats received intra-tumor injections with
saline, 0.5.times.10.sup.6 human Stro-1.sup.dim cells or
0.5.times.10.sup.6 human Stro-1.sup.bri cells. One week later,
animals were sacrificed, and tumor tissues were fixed and
concomitantly stained with two monoclonal antibodies: the first
being reactive with the alpha-smooth muscle actin antigen expressed
by smooth muscle cells, and the second being reactive with the vWF
antigen expressed by vascular endothelial cells. Dually stained
structures, indicative of arterioles and arteries containing both
endothelium and smooth muscle, were detected by immunoperoxidase
technique. Animals receiving 0.5.times.10.sup.6 Stro-1.sup.bri
human cells demonstrated 3.5-8 fold higher numbers of arterioles
and arteries at the site of cellular injection in the tumors
compared with control animals receiving saline or 1.times.10.sup.6
Stro-1.sup.dim human cells (p<0.05). No differences were seen at
sites distal to where the human cells had been injected.
[0030] FIG. 10. IL-1.beta. increases the proliferative potential of
cells expanded from MPC. Cells were labelled with CFSE as described
in the methods. Cells were subsequently cultured in the presence of
10 ng/ml IL-1.beta. for 5 days, stained with STRO-1 and ALK PHOS
mAb and analysed as described above. (A) non-treated (NT) and (B)
IL-1.beta.-treated cultures display an increase in the number of
STRO-1.sup.bri/ALP positive cells. This increase in STRO-1
expression is accompanied by an increase in cell proliferation as
shown in (C) where untreated cultures have undergone four cell
divisions, whilst (D) IL-1.beta. treated cultures exhibit an
increase in the number of cell divisions by increasing the number
of STRO-1.sup.bri osteoprogenitor cells. The results displayed are
a representative example of 3 independent experiments. Similar
results were also obtained 1,25D, PDGF-BB, TNF-.alpha., IL-1.beta.,
and SDF-1.alpha. were used to stimulate MPCs.
[0031] FIG. 11. IL-1.beta. stimulates MPC proliferation and
enhances their bone forming potential in the presence of the
osteoinductive agent, dexamethasone. Human (A) ex vivo expanded
progeny of MPC were seeded in 96-well plates at a cell density of
2,000 cells/well and cultured in .alpha.-MEM-10. Cultures were
supplemented with IL-1.beta. at the indicated concentrations and
the cell number and viability quantitated at d7 using WST-1, as
described in the methods. IL-1.beta. at concentration 0.01 ng/ml
significantly increased cell number to 136.6.+-.1.2% of untreated
control cultures (D, P=0.000003, Student t-test). A plateau effect
was achieved at concentrations greater than 0.1 ng/ml. Values
represent means.+-.SEM of triplicate cultures of each
concentration. (B & C) Ex vivo expanded progeny of MPC were
seeded into 24-well plates at a cell density of
5.times.10.sup.4/well in triplicate, and cultured in osteoinductive
conditions, as described in the methods. The cells were treated
with IL-1.beta. at a concentration 10 ng/ml and cultures were "fed"
weekly with fresh medium containing IL-1.beta.. The release of free
calcium from the matrix was achieved by treating the adherent cell
layers under acidic condition as described in the methods. Samples
were reacted with o-cresol-phthalein-complexon and the colorimetric
reaction was read at 570 nm. The absolute calcium concentration was
determined according to a standard curve for calcium. The results
showed that mineral deposition was increased in cells treated with
IL-1.beta. (C) compared to untreated cells (B). The calcium level
in IL-1.beta. treated cells was significantly higher than that in
untreated cells at both week 4 (**P=0.00009, Student t-test) and
week 6 (**P=0.00004, Student t-test) (D). The results displayed are
a representative example of 3 independent experiments, using
stromal cells derived from three different donors.
[0032] FIG. 12. IL-1.beta. stimulates the proliferation and
STRO-1.sup.bri MPC, whilst dexamethasone induces alkaline
phosphatase (ALP) expression. Established cultures of human MPC
were seeded in a 24-well plate at a cell density of
3.times.10.sup.4/well in complete medium supplemented with (A)
nothing (NT), (B) 10 ng/ml IL-1.beta., or (C) 1.times.10.sup.-8M
Dexamethasone and (D) 10 ng/ml IL-1.beta. and 1.times.10.sup.-8M
Dexamethasone. Cells were cultured for 21 days as described in the
methods. The results suggest that the mitogenic action of
IL-1.beta. serves to increase the number of STRO-1.sup.bri MPC (B),
which in turn stimulates the proliferation of the STRO-1.sup.dim
cells (Refer FIG. 6). In addition, MPC acquire the expression of
ALP in response to the FCS and ascorbate-2-phosphate present in the
growth medium which is enhanced in response to the
glucocortico-steroid, dexamethasone (dex) (D). The combined action
of IL-1.beta. and dex serve to enhance bone formation as seen in
FIG. 11. The experiments were performed three times and a similar
trend was observed in MPC derived from three different donors.
[0033] FIG. 13. Effect of PDGF on Bone Formation In Vivo.
Semi-confluent secondary cultures of ex vivo expanded cells,
derived from STRO-1.sup.bri/VCAM-1.sup.+ sorted bone marrow cells,
were cultured in the presence or absence of PDGF-BB (10 ng/ml) for
five days. Single cell suspensions were generated by trypsin/EDTA
digest then incubated with 40 mg of hydroxyapetite/tricalcium
phosphate particles (HA/TCP) for implantation into
immunocompromised mice as described in the methods. After eight
weeks, the harvested transplants were fixed and processed for
histological examination. Analysis of new bone formation was
determined using Scion Imaging software per surface area
(20.times.) from three replicate transplants (A). Cultures
pre-treated with PDGF-BB demonstrated significantly (*; p<0.05;
t-test) more ectopic bone formation when compared to control
untreated cultures. Typical images are shown depicting
haematoxylin/eosin stained ectopic bone in cross-sections
representative of untreated (B) and PDGF treated (C)
transplants.
[0034] FIG. 14. BMSSCs express high levels of SDF-1. (A)
MACS-isolated preparations of STRO-1.sup.+ BMMNCs were partitioned
into different STRO-1 subsets according to the regions,
STRO-1.sup.bright and STRO-1.sup.dull using FACS. Total RNA was
prepared from each STRO-1 subpopulation and used to construct a
STRO-1.sup.bright subtraction hybridization library as described in
"Materials and methods." (B-C) Replicate nitrocellulose filters,
which have been blotted with representative PCR products amplified
from bacterial clones transformed with STRO-1.sup.bright subtracted
cDNA. The filters were then probed with either [.sup.32P]
deoxycytidine triphosphate (dCTP)-labeled STRO-1.sup.bright (B) or
STRO-1.sup.dull (C) subtracted cDNA. The arrows indicate
differential expression of 1 clone containing a cDNA fragment
corresponding to human SDF-1. (D) Reverse transcriptase (RT)-PCR
analysis demonstrating the relative expression of SDF-1 and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts in
total RNA prepared from freshly MACS/FACS-isolated BMMNC STRO-1
populations prior to culture. bp indicates base pair.
[0035] FIG. 15. Immature BMSSCs express higher levels of SDF-1 than
more mature populations. (A) The dot plot represents dual flow
cytometric analysis of single-cell suspensions of ex vivo-expanded
BMSSCs examining cell surface expression of STRO-1 and AP antigens
following culture in standard media. The different sorted STRO-1/AP
subpopulations were isolated by FACS according to the sorting
regions R1, R2, R3, and R4. (B) The graph depicts semiquantitative
RT-PCR analysis of the relative expression of SDF-1 compared with
the house keeping gene GAPDH, in total RNA prepared from unsorted
and FACS-isolated cultured BMSSC populations according to their
cell surface expression of STRO-1 and AP. The most immature
osteogenic precursor population (STRO-1.sup.+/AP.sup.-) expressed
higher levels than preosteoblasts (STRO-1.sup.+/AP.sup.+), followed
by more mature osteoblast (STRO-1.sup.-/AP.sup.+) and osteocyte
(STRO-1.sup.-/AP.sup.-) populations. The data represent the mean
values.+-.standard errors of 2 independent experiments, using
secondary BMSSC cultures established from 2 different healthy bone
marrow donors.
[0036] FIG. 16. SDF-1 is down-regulated by BMSSCs following
osteoinduction. (A) Semiquantitative RT-PCR of SDF-1 expression
relative to GAPDH by cultured BMSSCs in the presence of
osteoinductive media over time. The mean values.+-.standard errors
represent 4 independent experiments. Osteoinductive conditions
versus the corresponding controls were analyzed using paired t test
at each time point with a significance value (*) of P<0.05. (B)
The dot plot represents dual-colour flow cytometric analysis of
single-cell suspensions of ex vivo-expanded BMSSCs, cultured for 48
hours in the presence of osteogenic induction media, based on the
cell surface expression of STRO-1 and alkaline phosphatase
antigens.
[0037] FIG. 17. BMSSCs express functional SDF-1 receptors. (A)
RT-PCR analysis demonstrating the relative expression of CXCR4 and
GAPDH transcripts in total RNA isolated from either primary BMSSC
cultures or the human osteosarcoma cell line, MG63. (B) Single-cell
suspensions of cultured BMSSCs were incubated with either a mouse
anti-human CXCR4 antibody or the isotype-matched control antibody,
1A6.11 followed by a goat anti-mouse IgG.sub.1 FITC-conjugated
antibody. A representative histogram depicts the level of cell
surface expression of CXCR4 (solid line) by BMSSCs relative to the
control samples (dotted line) as assessed by flow cytometric
analysis. (C) The graph demonstrates the levels of intracellular
calcium measured in primary BMSSC cultures over time following the
addition of human recombinant SDF-1.alpha. (30 ng/mL).
[0038] FIG. 18. Enforced SDF-1 expression by BMSSCs enhances their
osteogenic potential. (A) The retroviral packaging line PT67 was
used to transduce secondary BMSSC cultures, derived from 3
different bone marrow aspirates, with a pLNCX2 construct containing
either human SDF-1 cDNA or vector alone. Stable multicolony-derived
high SDF-1-expressing BMSSCs and corresponding control lines were
generated after G418 selection. Triplicate samples of tissue
culture supernatant were assessed for SDF-1.alpha. levels using a
commercially available ELISA kit. The data represent the mean
values.+-.standard errors generated from 3 different high
SDF-1-expressing BMSSC cell lines versus the corresponding
controls. (B) Single-cell suspensions of each of the transduced
BMSSC lines were mixed with hydroxyapatite (HA/TCP) particles and
then implanted subcutaneously into NOD/SCID mice. The images
represent cross-sections of 8-week-old harvested transplants of new
bone (b) formed by high SDF-1-expressing BMSSCs (SDF-1) and control
cell lines (LNCX2) stained with hematoxylin & eosin
(.times.200). Images were captured with an Olympus BX50 light
microscope (Olympus, Tokyo, Japan) equipped with an Olympus D11
digital camera. Magnification .times.200. (C) Each graph represents
a different high SDF-1-expressing BMSSC line and corresponding
control cell line derived from 3 different bone marrow donors. The
level of new bone formation is expressed as a percentage of the
total tissue surface area analyzed from 12 representative tissue
sections, using Scion Imaging software. The data represent the mean
values.+-.standard errors from duplicate transplants. Statistical
differences (*) of P<0.05 between the SDF-1 high-expressing
BMSSC lines and corresponding controls were determined using the
unpaired t test.
[0039] FIG. 19. Enforced expression of SDF-1 by BMSSCs improves
cell survival. (A) Proliferation studies were performed by plating
high SDF-1-expressing BMSSCs and vector control cell lines in
triplicate wells at a density of 5.times.10.sup.3 cells/well in
96-well plates in regular growth medium for 5 days. Single-cell
suspensions were then prepared by trypsin/EDTA digest and counted
to assess the total number of cells. (B) Parallel cultures were
established in the presence of interleukin 4 (IL-4; 30 ng/mL), and
the percentage of apoptotic cells was measured by using trypan blue
exclusion. (C) The histogram represents the level of cell surface
annexin V staining (solid line) by control cell lines compared with
the isotype-matched control antibody (dotted line) cultured in the
presence of IL-4. A representative image is shown of the intensity
of fluorescence staining on living cells in situ (.times.100). (D)
The histogram represents the level of cell surface annexin V
staining (solid line) by high SDF-1-expressing BMSSC lines compared
with the isotype-matched control (dotted line) cultured in the
presence of IL-4. A representative image is shown of the intensity
of fluorescence staining on living cells in situ (.times.100). The
data represent the mean values.+-.standard errors of triplicate
experiments. Statistical differences (*) of P<0.05 between the
SDF-1 high-expressing BMSSC lines and corresponding controls were
determined by using the unpaired t test.
[0040] FIG. 20. SDF-1 promotes the growth and survival of CFU-F.
The total number of CFU-F colonies derived from MACS/FACS-solated
STRO-1.sup.bright BMMNCs plated in serum-free media in the presence
of different cytokine combinations was enumerated. Recombinant
human PDGF-BB, SDF-1.alpha., and .alpha.-interferon 2a were used at
the optimal concentrations 5 ng/mL, 30 000 IU/mL, and 30 ng/mL,
respectively. The data represent the mean values.+-.standard errors
of triplicate wells. Similar results were obtained by using 3
different bone marrow aspirates. Statistical significance
(P<0.01) was determined by using one-way ANOVA for all
treatments. The Fisher test was then used to determine the
differences between all groups. Significant differences (P<0.05)
were found between all treatments compared with PDGF-BB alone (*),
and PDGF+IFN (interferon) verses PDGF+SDF-1+IFN (**) at a
significance of P<0.05.
[0041] FIG. 21. SDF-1 protects CFU-F formation against the
apoptotic effects of IFN-alpha in a dose dependent manner. STRO-1
MACS selected human bone marrow mononuclear cells were plated into
serum-deprived media in the presence of either PDGF (5 ng/ml) alone
or PDGF and IFN-alpha (30,000 i.u./ml) or PDGF and IFN-alpha and
SDF-1 (0.1-100 ng/ml). Following 14 days of culture the plates were
fixed and stained as described in the Methods for CFU-F colony
enumeration.
DETAILED DESCRIPTION OF THE INVENTION
[0042] The present inventors have made the surprising finding that
the chemokine SDF-1 plays a role in the proliferation, survival,
and osteogenic capacity of immature BMSSC populations.
[0043] Accordingly, the present invention provides a method of
enhancing proliferation and/or survival of mesenchymal precursor
cells (MPC) or progeny derived therefrom, the method comprising
exposing the MPC or progeny to SDF-1 or an analog thereof.
[0044] As used herein, MPC are non-hematopoietic progenitor cells
that are capable of forming large numbers of multipotential cell
colonies.
[0045] In a preferred example of the present invention the MPC are
positive for at least one marker selected from the group consisting
of STRO-1.sup.bright, VCAM-1.sup.bright, THY-1.sup.bright,
CD146.sup.bright and STRO-2.sup.bright.
[0046] The term "bright", when used herein, refers to a marker on a
cell surface that generates a relatively high signal when
detectably labelled. Whilst not wishing to be limited by theory, it
is proposed that "bright" cells express more of the target marker
protein (for example the antigen recognised by STRO-1) than other
cells in the sample. For instance, STRO-1.sup.bright cells produce
a greater fluorescent signal, when labelled with a FITC-conjugated
STRO-1 antibody as determined by FACS analysis, than non-bright
cells (STRO-1.sup.dull/neg). Preferably, "bright" cells constitute
at least about 0.1% of the most brightly labelled bone marrow
mononuclear cells contained in the starting sample. In other
embodiments, "bright" cells constitute at least about 0.1%, at
least about 0.5%, at least about 1%, at least about 1.5%, or at
least about 2%, of the most brightly labelled bone marrow
mononuclear cells contained in the starting sample. Preferably, the
"bright" cells are STRO-1.sup.bright, VCAM-1.sup.bright
THY-1.sup.bright, STRO-2.sup.bright and/or CD146.sup.bright cells.
As discussed in WO 01/04268, a sub-population of cells selected
upon the basis of label intensity, such as STRO-1.sup.bright cells,
have a greater proportion of MPCs than sub-populations solely
selected on a positive/negative identification of the cell
marker.
[0047] In a further preferred example of the present invention the
MPC carry at least two markers selected from the group of surface
markers specific for mesenchymal precursor cells consisting of
STRO-1.sup.bri, LFA-3, THY-1, VCAM-1, ICAM-1, PECAM-1, P-selectin,
L-selectin, CD49a/CD49b/CD29, CD49c/CD29, CD49d/CD29, CD29, CD18,
CD61, beta-1 integrin, 6-19, thrombomodulin, CD10, CD13, SCF,
PDGF-R, EGF-R, IGF1-R, NGF-R, FGF-R, Leptin-R, (STRO-2=Leptin-R),
RANKL and CD146 or any combination of these markers.
[0048] In a further preferred example of the present invention the
MPC are negative for at least one marker selected from the group
consisting of CD34, CD14, CD45, CBFA-1, collagen type II,
PPAR.gamma.2, and glycophorin A.
[0049] Methods for preparing enriched populations of MPC are
described in WO01/04268 and WO2004/085630.
[0050] In an in vitro context MPCs will rarely be present as an
absolutely pure preparation and will generally be present with
other cells that are tissue specific committed cells (TSCC).
WO01/04268 refers to harvesting such cells from bone marrow at
purity levels of about 0.1% to 90%. Alternative harvesting methods
may result in proportions of MPC that are present at lower
levels.
[0051] The population comprising MPC to which the method of the
invention is applied may be directly harvested from a tissue
source, or alternatively it may be a population that has already
been expanded ex vivo.
[0052] For example, the method of the invention may be applied to a
harvested, unexpanded, population of substantially purified MPC,
comprising at least about 0.1, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80
or 95% of total cells of the population in which they are present.
This level may be achieved, for example, by selecting for cells
that are positive for at least one marker selected from the group
consisting of STRO-1.sup.bright, VCAM-1.sup.bright,
THY-1.sup.bright, CD146.sup.bright and STRO-2.sup.bright.
[0053] The MPC may be derived from any one or more tissue types set
out in WO01/04268 or WO2004/085630, namely bone marrow, dental pulp
cells, adipose tissue and skin, or perhaps more broadly from
adipose tissue, teeth, dental pulp, skin, liver, kidney, heart,
retina, brain, hair follicles, intestine, lung, spleen, lymph node,
thymus, pancreas, bone, ligament, bone marrow, tendon and skeletal
muscle.
[0054] The preferred source of such cells is human, however, it is
expected that the invention is also applicable to animals,
including agricultural animals such as cows, sheep, pigs and the
like, domestic animals such as dogs and cats, laboratory animals
such as mice, rats, hamsters and rabbits or animals that are be
used for sport such as horses.
[0055] The term "progeny" as used herein is intended to refer to
cells derived from MPC. The progeny may be precursor cells or fully
differentiated cells (such as bone cells).
[0056] In one preferred embodiment, the progeny is a precursor
cell.
[0057] As used herein, a "precursor cell" derived from an MPC is a
partially specialized or tissue specific committed cell (TSCC) that
divides and gives rise to differentiated cells. Although a
precursor cell is committed to a differentiation pathway it
generally does not express the markers of or function as a mature,
fully differentiated cell. Thus, precursor cells give rise to
related types of cells but in their normal state do not generate a
wide variety of cell types. Precursor cells tend to be committed to
one cell or tissue lineage type, however they may be bi-potential,
that is capable of further differentiation into one of two
different cell or tissue types.
[0058] Non-limiting examples of the lineages to which precursor
cells may be committed include bone precursor cells; hepatocyte
progenitors, which are pluripotent for bile duct epithelial cells
and hepatocytes; neural restricted cells, which can generate glial
cell precursors that progress to oligodendrocytes and astrocytes;
neuronal precursors that progress to neurons; precursors for
cardiac muscle and cardiomyocytes, glucose-responsive insulin
secreting pancreatic beta cell lines. Other committed precursor
cells include but are not limited to chondrocytes, odontoblast,
dentin-producing and chondrocytes, and precursor cells of the
following: retinal pigment epithelial cells, fibroblasts, skin
cells such as keratinocytes, dendritic cells, hair follicle cells,
renal duct epithelial cells, smooth and skeletal muscle cells,
testicular progenitors, vascular endothelial cells, tendon,
ligament, cartilage, adipocyte, fibroblast, marrow stroma, cardiac
muscle, smooth muscle, skeletal muscle, pericyte, vascular,
epithelial, glial, neuronal, astrocyte and oligodendrocyte cells.
Precursor cells also include those that specifically lead to
connective tissue including adipose, areolar, osseous,
cartilaginous, elastic and fibrous connective tissues.
[0059] In a preferred example of the present invention, the
precursor cells are bone precursor cells.
[0060] As used herein, a "bone precursor cell" is any cell that is
capable of differentiating or expanding into an osteoblast cell.
Preferred bone precursor cells include osteoprogenitor cells and
preosteoblast cells.
[0061] The enhanced proliferation effected by the method of the
invention may result in increases in MPC numbers of greater than
10, 20, 30 40 or 50% relative to non stimulated controls.
Alternatively the increases may be 1, 2 or more fold.
[0062] In a preferred example of the present invention, the SDF-1
analog is a ligand that activates CXCR4 signalling. The SDF-1
analog may be, for example, a biologically active fragment, variant
or derivatives of naturally occurring SDF-1.
[0063] In a further preferred example of the present invention, the
SDF-1 analog is selected from the group consisting of the HIV-1
coat protein gp120, AMD3100 (AnorMED Inc, British Columbia, Canada)
and ALX40-4C (Allelix Biopharmaceuticals Inc, Canada).
[0064] In a further preferred example of the present invention the
MPC or progeny derived therefrom are also exposed to a stimulatory
factor selected from the group consisting of exogenous platelet
derived growth factor (PDGF), stem cell factor (SCF), fit 3 ligand
(FL), granulocyte colony-stimulating factor (G-CSF), interleukin-3
(IL-3), interleukin-6 (IL-6), 1.alpha.,25-dihydroxyvitamin D3
(1,25D), tumour necrosis factor .alpha. (TNF-.alpha.) and
interleukin-1.beta. (IL-1.beta.).
[0065] It is generally contemplated that the method of the
invention has applicability to in vitro cultivation of cells, for
example, in relation to freshly harvested or ex vivo expanded
cultures, however, the invention may also have applicability where
the MPC or progeny derived therefrom are in situ in a body tissue
site and exogenous SDF-1 or an analog thereof is delivered to the
site. One such delivery may be adequate, however temporally spaced
delivery may provide an accelerated or greater benefit.
[0066] The exogenous SDF-1 or analog thereof may be administered to
the subject in the form of a polypeptide or in the form of a
nucleic acid that can be expressed to produce a polypeptide. For
example, the exogenous SDF-1 or analog thereof may be administered
in the form of a nucleic acid-containing composition or in the form
of a host cell that has been genetically modified to overexpress
SDF-1 or analog thereof.
[0067] In the context of in vivo delivery it might also be
desirable to deliver (at the same time as the SDF-1 or analog
thereof) a composition comprising MPC or progeny derived therefrom.
For example, in the case of a lesion in a bone, a cardiac muscle, a
vascular tissue or endothelial cells, the progeny that are
delivered are preferably at least partially committed to a relevant
cell type (e.g., an osteoblast, a cardiomyocyte or an endothelial
cell). These may be provided as part of a mixed precursor cell
culture or in a more purified form, for example, being sorted for
markers known to be present on the tissue specific committed cell
type. Alternatively or additionally the composition being delivered
may include one or more differentiation stimulatory factors to
differentiate MPC either present in the composition or present in
situ at the target site to one or more tissue types of
interest.
[0068] The present invention also provides a method of developing a
tissue specific committed cell population, the method comprising
[0069] exposing MPC or progeny derived therefrom to exogenous SDF-1
or an analog thereof to enhance proliferation and/or survival of
the MPC or progeny, and [0070] subjecting the proliferated
population to conditions biasing differentiation of the MPC or
progeny derived therefrom to a specific tissue type.
[0071] The tissue type may be selected from the group consisting of
cardiac muscle, a vascular tissue, osteoblast, odontoblast,
osteocyte, bone lining cell and endothelial cell. Exemplified
conditions for in vitro development of these tissue types and for
in vivo promotion of these tissue types will be known to those
skilled in the art.
[0072] The above method may be applied the generation or repair of
skeletal muscle, cardiac muscle, bone, teeth, or vascular tissue.
In particular, the method may be applied to the generation or
repair of cells or tissue selected from the group consisting of
cardiac muscle, cardiomyocytes, chondrocytes, osteoblasts,
osteoclast, odontoblast, dentin-producing chrondocyte, osteocyte,
bone lining cell, skeletal muscle cells, vascular endothelial
cells, marrow stroma, osteoclast and hemopoietic-supportive stroma,
cardiac muscle, skeletal muscle, endothelial cell and a vascular
cell.
[0073] In one particular example the present invention provides a
method for generating bone ex vivo, the method comprising [0074]
exposing MPC or progeny derived therefrom to exogenous SDF-1 or an
analog thereof to enhance proliferation and/or survival of the MPC
or progeny, and [0075] subjecting the proliferated population to
conditions biasing differentiation of the MPC to bone precursor
cells, or to conditions biasing differentiation of bone precursor
cells to bone.
[0076] Conditions that bias differentiation of the MPC or bone
precursor cells derived therefrom to bone may involve, for example,
culturing in .alpha.MEM supplemented with 10% FCS, 100 .mu.M
L-ascorbate-2-phosphate, dexamethasone 10.sup.-7 M and 3 mM
inorganic phosphate. These conditions have been shown to induce
human BM stromal cells to develop a mineralized bone matrix in
vitro (Gronthos et al., Blood. 84:4164-73, 1994).
[0077] In an alternative example, the method may involve
differentiating the bone precursor cells into osteoblasts by
cultivating the bone precursor cells in the presence of type I
collagen, fibrinogen, fibrin, polyglycolic acid, polylactic acid,
osteocalcin, or osteonectin. In one particular example, bone
precursor cells are cultivated in the presence of type I collagen,
fibrinogen, and fibrin. In an alternative example, bone precursor
cells are cultivated in the presence of type I collagen,
fibrinogen, fibrin, osteocalcin, and osteonectin. In the context of
this method, type I collagen, fibrinogen, fibrin, polyglycolic
acid, polylactic acid, osteocalcin, or osteonectin may be used
alone or in the presence of a growth factor. It will be understood
that any combination of the compounds listed above in this
paragraph is contemplated by the present invention.
[0078] The present invention also provides a composition comprising
isolated MPC or progeny derived therefrom and SDF-1 or an analog
thereof.
[0079] In a preferred example, the composition comprises
substantially purified MPC or progeny, comprising at least about
0.1, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 95% of total cells of
the composition.
[0080] In a further preferred example, the SDF-1 or analog thereof
is present in the composition at a concentration of about 0.1
nM-0.1 M, 0.1 nM-0.05 M, 0.05 nM-15 .mu.M or 0.01 nM-10 .mu.M.
[0081] The present invention also provides an MPC or precursor cell
derived therefrom that has been genetically modified to overexpress
SDF-1.
[0082] In one example the MPC or precursor cell derived therefrom
is transfected with a polynucleotide encoding SDF-1.
[0083] In another example, the genome of the MPC or precursor cell
derived therefrom is modified to effect overexpression of the SDF-1
protein. In one example, a regulatory region of the SDF-1 gene of
the MPC or precursor cell derived therefrom is modified to effect
overexpression of the SDF-1 protein.
[0084] The present invention also provides a composition comprising
a population of transfected MPC of the present invention.
[0085] The composition of the present invention may further
comprises one or more additional stimulatory factors. For example,
the additional stimulatory factor may be selected from the group
consisting of PDGF, SCF, FL, G-CSF, IL-3, IL-6, 1,25D, TNF-.alpha.
and IL-1.beta..
[0086] The present invention encompasses delivery systems in which
a composition of the present invention (for example, a composition
comprising genetically modified MPC) is administered systemically
or locally to colonize a selected type of tissue, e.g., an injured
tissue. For example, a composition of the present invention may be
directly injected into the target tissue. The injection site is
preferably at a site of injury, or nearby the injured tissue.
Alternatively, genetically modified MPC expressing SDF-1 and a
specific recombinant ligand or receptor may be introduced to the
subject and then the cells targeted to a desired target tissue by
inducing expression of the cognate binding partner in the target
tissue.
[0087] It will be appreciated that the compositions of the present
invention are useful for enhancing survival of grafted MPC or cells
derived therefrom used in repairing or regenerating tissue, e.g.,
cardiomyocytes undergoing apoptosis due to an ischemic or
reperfusion related injury; chondrocytes following traumatic injury
to bone, ligament, tendon or cartilage; or hepatocytes in an
alcohol-induced cirrhotic liver.
[0088] In one particular example the compositions of the invention
are useful for enhancing survival of grafted MPC or cells derived
therefrom used in repairing or regenerating bone. Thus, the
compositions of the invention may further comprise a matrix such as
absorbable gelatin, cellulose or collagen. The composition can be
used in the form of a sponge, strip, powder, gel or web.
[0089] The present invention also provides a method of generating
bone in a subject, the method comprising exposing MPC or progeny
derived therefrom in the subject to exogenous SDF-1 or an analog
thereof.
[0090] The present invention also provides a method of generating
bone in a subject, the method comprising administering a
composition of the invention to the subject at the site of desired
bone generation.
[0091] This method may be used, for example, in the repair of
bones, and as such a composition of the present invention and
optionally a suitable support may be introduced into a site
requiring bone formation. Thus, for example, skeletal defects
caused by bone injury or the removal of sections of bone infected
with tumour may be repaired by implanting compositions of the
present invention into the defect site. Such defects include, for
example, segmental bone defects, non-unions, malunions or delayed
unions, cysts, tumors, necroses or developmental abnormalities.
Other conditions requiring bone augmentation, such as joint
reconstruction, cosmetic reconstruction or bone fusion, such as
spinal fusion or joint fusion, may be treated in an individual by
administering into the site of bone in need of augmentation, a
composition of the present invention. The composition may be in
combination with, for example, a resorbable biopolymer such as
gelatin, cellulose or collagen based medium, or in a calcium
phosphate ceramic vehicle to an extent sufficient to augment bone
formation therefrom. The resorbable biopolymer can be in the form
of a powder or sponge, and is preferably a porcine skin-derived
gelatin. The ceramic vehicle can be in particulate form or can be
in the form of a structurally stable, three dimensional implant.
The structurally stable, three dimensional implant can be, for
example, a cube, cylinder, block or an appropriate anatomical form.
The composition can also contain one or more other components which
degrade, resorb or remodel at rates approximating the formation of
new tissue. For appropriate methods and techniques see Caplan et
al. in U.S. Pat. No. 5,226,914 and U.S. Pat. No. 5,837,539.
[0092] This method may also be used to assist in anchoring
prosthetic devices. Thus, the surface of a prosthetic device such
as those used in hip, knee and shoulder replacement, may be coated
with a composition of the present invention prior to implantation.
The MPC or progeny derived therefrom in the composition may then
differentiate into osteogenic cells to thereby speed up the process
of bony ingrowth and incorporation of the prosthetic device (see
Caplan et al. in U.S. Pat. No. 5,226,914 and U.S. Pat. No.
5,837,539).
[0093] The above methods may further comprise administering to the
individual at least one bioactive factor which induces or
accelerates the differentiation of MPC or progeny derived therefrom
into the osteogenic lineage. The bioactive factor can be, for
example, a synthetic glucocorticoid, such as dexamethasone, or a
bone morphogenic protein, such as BMP-2, BMP-3, BMP-4, BMP-6 or
BMP-7. The bone morphogenic protein can be in a liquid or
semi-solid carrier suitable for intramuscular, intravenous,
intramedullary or intra-articular injection.
[0094] The present invention also provides a method of generating
vascular tissue in a subject, the method comprising exposing MPC or
progeny derived therefrom in the subject to exogenous SDF-1 or an
analog thereof.
[0095] The present invention also provides a method of generating
vascular tissue in a subject, the method comprising administering a
composition of the invention to the subject at the site of desired
vascular tissue generation.
[0096] The present invention also provides a method of generating
cardiac muscle or smooth muscle in a subject, the method comprising
exposing MPC or progeny derived therefrom in the subject to
exogenous SDF-1 or an analog thereof.
[0097] The present invention also provides a method of generating
cardiac muscle or smooth muscle in a subject, the method comprising
administering a composition of the invention to the subject at the
site of cardiac muscle or smooth muscle generation.
[0098] Throughout this specification the word "comprise", or
variations such as "comprises" or "comprising", will be understood
to imply the inclusion of a stated element, integer or step, or
group of elements, integers or steps, but not the exclusion of any
other element, integer or step, or group of elements, integers or
steps.
Stromal Derived Factor-1 and Analogs Thereof
[0099] Stromal Derived Factor-1 (SDF-1) has also be referred to in
the art as Chemokine CXC motif ligand 12 (CXCL12) and pre-B cell
growth stimulating factor (PBSF). Stromal cell-derived factors
1-alpha and 1-beta are small cytokines that belong to the
intercrine family, members of which activate leukocytes and are
often induced by proinflammatory stimuli such as
lipopolysaccharide, TNF or IL-1. The intercrines are characterized
by the presence of 4 conserved cysteines which form 2 disulfide
bonds. They can be classified into 2 subfamilies. In the CC
subfamily, the cysteine residues are adjacent to each other. In the
CXC subfamily, they are separated by an intervening amino acid. The
SDF-1 proteins belong to the latter group.
[0100] As indicated above, there are at least two known isoforms of
SDF-1 known as SDF-1 alpha and SDF-1 beta. Shirozu et al.
(Genomics, 28:495, 1995) identified human SDF-1 genomic clones and
showed that the alpha and beta isoforms are a consequence of
alternative splicing of a single gene. The alpha form is derived
from exons 1-3 while the beta form contains additional sequence
from exon 4. The entire human gene is approximately 10 kb and is
located at chromosome 10q11.1.
[0101] Unless stated to the contrary, the term "SDF-1" as used
herein refers to at least the alpha and/or beta isoform. This term
also includes biologically active fragments, variants and
derivatives of the naturally occurring molecules which maintain at
least some activity such that they are useful for the methods of
the invention. In a preferred embodiment, the invention relates to
the use of the alpha isoform.
[0102] The amino acid sequence of a number of different native
mammalian SDF-1 alpha and/or beta proteins are known, including
human, rat, mouse, and cat (see, for example, Shirozu et al.,
Genomics, 28:495, 1995; Tashiro et al., Science 261:600, 1993;
Nishimura et al., Eur. J. Immunogenet. 25:303, 1998); and GenBank
Accession No. AF189724). The amino acid sequence of the human alpha
isoform is provided as SEQ ID NO:1, and the amino acid sequence of
the human beta isoform is provided as SEQ ID NO:2. A preferred form
of SDF-1 protein is a purified native SDF-1 protein that has an
amino acid sequence identical to one of the foregoing mammalian
SDF-1 proteins, or orthologs thereof obtained from other
species.
[0103] SDF-1 biologically active fragments corresponding to one or
more particular motifs and/or domains or to arbitrary sizes, for
example, at least 5, 10, 25, 50, or 75 amino acids in length are
within the scope of the present invention. The fragments can be
produced (recombinantly or by chemical synthesis) and tested to
identify those peptidyl fragments which can function as analogs of
native SDF-1 protein.
[0104] SDF-1 variants have a peptide sequence that differs from a
native SDF-1 protein in one or more amino acids. The peptide
sequence of such variants can feature a deletion, addition, or
substitution of one or more amino acids of a native SDF-1 protein.
Amino acid insertions are preferably of about 1 to 4 contiguous
amino acids, and deletions are preferably of about 1 to 10
contiguous amino acids.
[0105] SDF-1 variants can be generated through various techniques
known in the art. For example, SDF-1 variants can be made by
mutagenesis, such as by introducing discrete point mutation(s), or
by truncation. Mutation can give rise to a SDF-1 variant having
substantially the same functional activity of native SDF-1 protein.
In particular, agonistic forms of the protein may be generated that
constitutively express on or more of the functional activities of a
native SDF-1 protein. Other SDF-1 protein variants that can be
generated include those that are resistant to proteolytic cleavage,
as for example, due to mutations which alter protease target
sequences. Whether a change in the amino acid sequence of a peptide
results in a variant having one or more functional activities of a
native SDF-1 protein can be readily determined by testing the
variant for a native SDF-1 protein functional activity, for
example, testing the ability of the variant to stimulate the
proliferation of MPCs as described herein.
[0106] A wide range of techniques are known in the art for
screening gene products of combinatorial libraries made by point
mutations or truncation, and for screening cDNA libraries for gene
products having a certain property. Such techniques will be
generally adaptable for rapid screening of the gene libraries
generated by the combinatorial mutagenesis of SDF-1 gene variants.
The most widely used techniques for screening large gene libraries
typically comprise cloning the gene library into replicable
expression vectors, transforming appropriate cells with the
resulting library of vectors, and expressing the combinatorial
genes under conditions in which detection of a desired activity
facilitates relatively easy isolation of the vector encoding the
gene whose product was detected.
[0107] At present SDF-1 is the only known naturally occurring
agonist of the G-coupled seven transmembrane CXCR4 receptor (also
known in the art as fusin or LESTR). Furthermore, MPCs have been
shown to express the CXCR4 receptor (human molecule provided as SEQ
ID NO:3). Thus, the biological effects of SDF-1 described herein
are most likely mediated through the chemokine receptor CXCR4.
Accordingly, SDF-1 analogs useful for the methods of the invention
may also be CRCX4 agonists. However, the present invention does not
exclude the possibility that MPCs express a receptor other than
CXCR4 through which the biological activities described herein are
mediated wholly, or in conjunction with another receptor such as
CRCX4.
[0108] As used herein, the term "SDF-1 analog" refers to any
molecule which is structurally or functionally related to SDF-1 and
is suitable for use in the methods of the invention. Preferably,
the SDF-1 analog is an antagonist of SDF-1 binding to CXCR4. SDF-1
analogs include biologically active fragments, variants and
derivatives of naturally occurring SDF-1 as described above.
[0109] Examples of SDF-1 analogs include molecules described in US
20050065064, US 20050059584, and Pelus et al., Exp. Hematol.
33:295, 2005. In addition, evidence suggests the HIV-1 coat protein
gp120 acts as a SDF-1 analog (Tran et al., J. Neuroimmunol. 160, 68
2005). Furthermore, studies have shown that AMD3100 (AnorMED Inc,
British Columbia, Canada) and ALX40-4C (Allelix Biopharmaceuticals
Inc, Canada) can act as agonists of the CXCR4 receptor (Zhang et
al., J. Biol. Chem. 277, 24515 2002).
[0110] A variety of peptide or mimetic (including peptido-mimetics)
SDF-1 protein analogs can be made utilizing conventional
techniques. For example, antibodies or antibody fragments can be
made against receptors (such as CXCR4) that bind SDF-1, and then
screened to identify those that act as analogs of a native SDF-1
protein. Further, SDF-1 analogs can be identified by screening
libraries of other molecules (such as small organic or inorganic
molecules) by identifying those that bind SDF-1 protein receptors
such as CXCR4. Those identified can be further characterized as
agonists based on the type of signals they induce or prevent in
cells.
[0111] SDF-1 analogs useful for the methods of the invention can
also be identified and/or verified using the CXCR4 Receptor Agonist
Redistribution.TM. Assay (BioImage A/S, Soeberg, Denmark).
[0112] Further examples of SDF-1 analogs are compounds containing
structures corresponding to various regions or portions of SDF-1.
In one embodiment, the analog comprises an N-terminal region and a
C-terminal region joined together by means of a linker. In other
embodiments, the amino acid residues of SDF-1 are cyclized, e.g.,
by etherification of lysine and serine residues or by other means
known in the art. In still other embodiments, the SDF-1 analog
comprises an amino acid sequence derived from the wild-type
chemokine sequence but with one or more of the cysteines replaced
with another amino acid. Other embodiments include chemokine
analogs comprising an N-terminal region, an internal region
containing up to three anti-parallel .beta.-sheets, a C-terminal
region containing an .alpha.-helical structure, a combination of
the N- and C-terminal regions linked together directly, a
combination of a N-terminal and internal region, or a combination
of an internal and C-terminal region, or finally a combination of
N-terminal, internal and C-terminal regions. The regions selected
from the N-terminal, internal and C-terminal regions may be 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 20, 25, 30, 35, 40, 41, or
45 amino acids in length.
[0113] SDF-1 analogs useful for the methods of the invention may
include derivatives such as C-terminal hydroxymethyl derivatives,
O-modified derivatives (e.g., C-terminal hydroxymethyl benzyl
ether), N-terminally modified derivatives including substituted
amides such as alkylamides and hydrazides and compounds in which a
C-terminal phenylalanine residue is replaced with a phenethylamide
analogue (e.g., Ser-Ile-phenethylamide as an analog of the
tripeptide Ser-Ile-Phe), glycosylated chemokine derivatives,
polyethylene glycol modified derivatives, or biotinylated
derivatives.
[0114] The SDF-1 analogs useful for the methods of the invention
may be coupled directly or indirectly to at least one modifying
group. The term "modifying group" is intended to include structures
that are directly attached to the peptidic structure (e.g., by
covalent bonding or covalent coupling), as well as those that are
indirectly attached to the peptidic structure (e.g., by a stable
non-covalent bond association or by covalent coupling through a
linker to additional amino acid residues). The term "modifying
group" may also refer to mimetics, analogs or derivatives thereof,
which may flank the SDF-1 core peptidic structure. For example, the
modifying group can be coupled to the amino-terminus or
carboxy-terminus of a SDF-1 peptidic structure, or to a peptidic or
peptidomimetic region flanking the core structure. Alternatively,
the modifying group can be coupled to a side chain of at least one
amino acid residue of a SDF-1 peptidic structure, or to a peptidic
or peptido-mimetic region flanking the core domain (e.g., through
the epsilon amino group of a lysyl residue(s); through the carboxyl
group of an aspartic acid residue(s) or a glutamic acid residue(s);
through a hydroxy group of a tyrosyl residue(s), a serine
residue(s) or a threonine residue(s); or any other suitable
reactive group on an amino acid side chain). The modifying groups
covalently coupled to the peptidic structure can be attached by
means and using methods well known in the art for linking chemical
structures, including, for example, amide, alkylamino, sulfide,
carbamate or urea bonds.
[0115] In some embodiments, the modifying group may comprise a
cyclic, heterocyclic or polycyclic group. The term "cyclic group,"
as used herein, includes cyclic saturated or unsaturated (i.e.,
aromatic) group having from 3 to 10; from 4 to 8; or 5, 6, or 7
carbon atoms. Exemplary non-aromatic cyclic groups include
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cyclooctyl.
The term "heterocyclic group" includes optionally substituted,
saturated or unsaturated, three- to eight-membered cyclic
structures in which one or more skeletal atoms is oxygen, nitrogen,
sulfur, or combinations thereof. Cyclic groups or heterocyclic
groups may be unsubstituted or substituted at one or more ring
positions. A cyclic group may for example be substituted with
halogens, alkyls, cycloalkyls, alkenyls, alkynyls, aryls,
heterocycles, hydroxyls, aminos, nitros, thiols amines, imines,
amides, phosphonates, phosphines, carbonyls, carboxyls, silyls,
ethers, thioethers, sulfonyls, sulfonates, selenoethers, ketones,
aldehydes, esters, --CF.sub.3, --CN. The cyclic group may also be
linked to a substituent, such as halogens, alkyls, cycloalkyls,
alkenyls, alkynyls, aryls, heterocycles, hydroxyls, aminos, nitros,
thiols amines, imines, amides, phosphonates, phosphines, carbonyls,
carboxyls, silyls, ethers, thioethers, sulfonyls, sulfonates,
selenoethers, ketones, aldehydes, esters, --CF.sub.3, --CN by means
of a saturated or unsaturated chain of 1, 2, 3, 4, 5, 6, 7, 8, or
more carbon atoms; additionally one or more of the carbon atoms may
be replaced with an oxygen, nitrogen, or sulfur atoms.
[0116] SDF-1 analogs useful for the methods of the invention may be
modified by the addition of polyethylene glycol (PEG). PEG
modification may lead to improved circulation time, improved
solubility, improved resistance to proteolysis, reduced
antigenicity and immunogenicity, improved bioavailability, reduced
toxicity, improved stability, and easier formulation. PEGylation
may also result in a substantial reduction in bioactivity. SDF-1
analogs useful for the methods of the invention may be prepared in
a "prodrug" form, wherein the compound itself does not act as a
SDF-1 analog, but rather is capable of being transformed, upon
metabolism in vitro and/or in vivo, into a SDF-1 analog. For
example, in this type of compound, the modifying group can be
present in a prodrug form that is capable of being converted upon
metabolism into the form of an active SDF-1 analog. Such a prodrug
form of a modifying group is referred to herein as a "secondary
modifying group." A variety of strategies are known in the art for
preparing peptide prodrugs that limit metabolism in order to
optimize delivery of the active form of the peptide-based drug.
[0117] The various features and embodiments of the present
invention, referred to in individual sections above apply, as
appropriate, to other sections. In particular, features specified
in one section may be combined with features specified in other
sections, as appropriate.
Production of Genetically Modified Cells
[0118] In a further aspect of the invention, the MPC or precursors
cells derived therefrom, are genetically modified to produce SDF-1,
or peptide analogs thereof. Typically, the cells will be
genetically modified such that SDF-1, or the peptide analog
thereof, is secreted from the cells.
[0119] Genetically modified cells can be cultured in the presence
of at least one cytokine in an amount sufficient to support growth
of the modified cells. The modified cells are then selected wherein
the encoded polypeptide is overexpressed. The genetically modified
cells thus obtained may be used immediately (e.g., in transplant),
cultured and expanded in vitro, or stored for later uses. The
modified cells may be stored by methods well known in the art,
e.g., frozen in liquid nitrogen.
[0120] Genetic modification as used herein encompasses any genetic
modification method which involves introduction of an exogenous or
foreign polynucleotide into a MPC or precursor cell derived
therefrom or modification of an endogenous gene within a MPC or
precursor cell derived therefrom. Genetic modification includes but
is not limited to transduction (viral mediated transfer of host DNA
from a host or donor to a recipient, either in vitro or in vivo),
transfection (transformation of cells with isolated viral DNA
genomes), liposome mediated transfer, electroporation, calcium
phosphate transfection or coprecipitation and others. Methods of
transduction include direct co-culture of cells with producer cells
(Bregni et al., Blood 80:1418-1422, 1992) or culturing with viral
supernatant alone with or without appropriate growth factors and
polycations (Xu et al., Exp. Hemat. 22:223-230, 1994).
[0121] A polynucleotide encoding SDF-1, or a peptide analog
thereof, is typically introduced to a host cell in a vector. The
vector typically includes the necessary elements for the
transcription and translation of the inserted coding sequence.
Methods used to construct such vectors are well known in the art.
For example, techniques for constructing suitable expression
vectors are described in detail in Sambrook et al., Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Press, N.Y. (3rd
Ed., 2000); and Ausubel et al., Current Protocols in Molecular
Biology, John Wiley & Sons, Inc., New York (1999).
[0122] Vectors may include but are not limited to viral vectors,
such as retroviruses, adenoviruses, adeno-associated viruses, and
herpes simplex viruses; cosmids; plasmid vectors; synthetic
vectors; and other recombination vehicles typically used in the
art. Vectors containing both a promoter and a cloning site into
which a polynucleotide can be operatively linked are well known in
the art. Such vectors are capable of transcribing RNA in vitro or
in vivo, and are commercially available from sources such as
Stratagene (La Jolla, Calif.) and Promega Biotech (Madison, Wis.).
Specific examples include, pSG, pSV2CAT, pXt1 from Stratagene; and
pMSG, pSVL, pBPV and pSVK3 from Pharmacia.
[0123] Preferred vectors include retroviral vectors (see, Coffin et
al., "Retroviruses", Chapter 9 pp; 437-473, Cold Springs Harbor
Laboratory Press, 1997). Vectors useful in the invention can be
produced recombinantly by procedures well known in the art. For
example, WO94/29438, WO97/21824 and WO97/21825 describe the
construction of retroviral packaging plasmids and packing cell
lines. Exemplary vectors include the pCMV mammalian expression
vectors, such as pCMV6b and pCMV6c (Chiron Corp.), pSFFV-Neo, and
pBluescript-Sk+. Non-limiting examples of useful retroviral vectors
are those derived from murine, avian or primate retroviruses.
Common retroviral vectors include those based on the Moloney murine
leukemia virus (MoMLV-vector). Other MoMLV derived vectors include,
Lmily, LINGFER, MINGFR and MINT (Chang et al., Blood 92:1-11,
1998). Additional vectors include those based on Gibbon ape
leukemia virus (GALV) and Moloney murine sarcoma virus (MOMSV) and
spleen focus forming virus (SFFV). Vectors derived from the murine
stem cell virus (MESV) include MESV-MiLy (Agarwal et al., J. of
Virology, 72:3720-3728, 1998). Retroviral vectors also include
vectors based on lentiviruses, and non-limiting examples include
vectors based on human immunodeficiency virus (HIV-1 and
HIV-2).
[0124] In producing retroviral vector constructs, the viral gag,
pol and env sequences can be removed from the virus, creating room
for insertion of foreign DNA sequences. Genes encoded by foreign
DNA are usually expressed under the control a strong viral promoter
in the long terminal repeat (LTR). Selection of appropriate control
regulatory sequences is dependent on the host cell used and
selection is within the skill of one in the art. Numerous promoters
are known in addition to the promoter of the LTR. Non-limiting
examples include the phage lambda PL promoter, the human
cytomegalovirus (CMV) immediate early promoter; the U3 region
promoter of the Moloney Murine Sarcoma Virus (MMSV), Rous Sacroma
Virus (RSV), or Spleen Focus Forming Virus (SFFV); Granzyme A
promoter; and the Granzyme B promoter. Additionally inducible or
multiple control elements may be used. The selection of a suitable
promoter will be apparent to those skilled in the art.
[0125] Such a construct can be packed into viral particles
efficiently if the gag, pol and env functions are provided in trans
by a packing cell line. Therefore, when the vector construct is
introduced into the packaging cell, the gag-pol and env proteins
produced by the cell, assemble with the vector RNA to produce
infectious virons that are secreted into the culture medium. The
virus thus produced can infect and integrate into the DNA of the
target cell, but does not produce infectious viral particles since
it is lacking essential packaging sequences. Most of the packing
cell lines currently in use have been transfected with separate
plasmids, each containing one of the necessary coding sequences, so
that multiple recombination events are necessary before a
replication competent virus can be produced. Alternatively the
packaging cell line harbors a provirus. The provirus has been
crippled so that although it may produce all the proteins required
to assemble infectious viruses, its own RNA cannot be packaged into
virus. RNA produced from the recombinant virus is packaged instead.
Therefore, the virus stock released from the packaging cells
contains only recombinant virus. Non-limiting examples of
retroviral packaging lines include PA12, PA317, PE501, PG13,
PSI.CRIP, RDI 14, GP7C-tTA-G10, ProPak-A (PPA-6), and PT67.
Reference is made to Miller et al., Mol. Cell. Biol. 6:2895, 1986;
Miller et al., Biotechniques 7:980, 1989; Danos et al., Proc. Natl.
Acad. Sci. USA 85:6460, 1988; Pear et al., Proc. Natl. Acad. Sci.
USA 90:8392-8396, 1993; and Finer et al., Blood 83:43-50, 1994.
[0126] Other suitable vectors include adenoviral vectors (see, Frey
et al., Blood 91:2781, 1998; and WO 95/27071) and adeno-associated
viral vectors. These vectors are all well know in the art, e.g., as
described in Chatterjee et al., Current Topics in Microbiol. And
Immunol., 218:61-73, 1996; Stem cell Biology and Gene Therapy, eds.
Quesenberry et al., John Wiley & Sons, 1998; and U.S. Pat. Nos.
5,693,531 and 5,691,176. The use of adenovirus-derived vectors may
be advantageous under certain situation because they are not
capable of infecting non-dividing cells. Unlike retroviral DNA, the
adenoviral DNA is not integrated into the genome of the target
cell. Further, the capacity to carry foreign DNA is much larger in
adenoviral vectors than retroviral vectors. The adeno-associated
viral vectors are another useful delivery system. The DNA of this
virus may be integrated into non-dividing cells, and a number of
polynucleotides have been successful introduced into different cell
types using adeno-associated viral vectors.
[0127] In some embodiments, the construct or vector will include
two or more heterologous polynucleotide sequences; a) the nucleic
acid sequence encoding SDF-1 or a peptide analog thereof, and b)
one or more additional nucleic acid sequence. Preferably the
additional nucleic acid sequence is a polynucleotide which encodes
a selective marker, a structural gene, a therapeutic gene, a CXCR4
receptor or a further cytokine/chemokine gene.
[0128] A selective marker may be included in the construct or
vector for the purposes of monitoring successful genetic
modification and for selection of cells into which DNA has been
integrated. Non-limiting examples include drug resistance markers,
such as G148 or hygromycin. Additionally negative selection may be
used, for example wherein the marker is the HSV-tk gene. This gene
will make the cells sensitive to agents such as acyclovir and
gancyclovir. The NeoR (neomycin/G148 resistance) gene is commonly
used but any convenient marker gene may be used whose gene
sequences are not already present in the target cell can be used.
Further non-limiting examples include low-affinity Nerve Growth
Factor (NGFR), enhanced fluorescent green protein (EFGP),
dihydrofolate reductase gene (DHFR) the bacterial hisD gene, murine
CD24 (HSA), murine CD8a(lyt), bacterial genes which confer
resistance to puromycin or phleomycin, and
.beta.-galactosidase.
[0129] The additional polynucleotide sequence(s) may be introduced
into the host cell on the same vector as the polynucleotide
sequence encoding SDF-1 or peptide analog thereof, or the
additional polynucleotide sequence may be introduced into the host
cells on a second vector. In a preferred embodiment, a selective
marker will be included on the same vector as the polynucleotide
encoding SDF-1 or peptide analog thereof.
[0130] The present invention also encompasses genetically modifying
the promoter region of the endogenous SDF-1 gene such that
expression of the endogenous gene is up-regulated resulting in the
increased production of SDF-1 compared to a wild type MPC or
precursor cell derived therefrom.
Administration of Stromal Derived Factor-1 (SDF-1) and Analogs
Thereof
[0131] Methods of the present invention may involve administration
of SDF-1 or an analog thereof to a subject in order to enhance
proliferation and/or survival of MPC or progeny derived therefrom
in situ.
[0132] These methods may involve administering SDF-1 or an analog
thereof topically, systematically, or locally such as within an
implant or device.
[0133] In one particular embodiment the invention provides a method
of enhancing proliferation and/or survival of MPC or progeny
derived therefrom in a subject in need thereof by administering
SDF-1 or an analog thereof systemically to the subject. For
example, the SDF-1 or analog thereof may be administered by
subcutaneous or intramuscular injection.
[0134] This embodiment of the invention may be useful for the
treatment of systemic degenerative diseases where increased
proliferation and/or survival of MPC in particular tissues is
desirable. Examples of systemic degenerative diseases that can be
treated in this way include osteoporosis or fractures, degenerative
diseases of cartilage, atherosclerosis, peripheral artery diseases
or cardiovascular diseases and the like.
[0135] Thus, according to the present invention, compositions
comprising SDF-1 or an analog thereof in a therapeutically or
prophylactically effective amount may be used in treating diseases
or disorders selected from the group consisting of autoimmune
diseases, acute chronic inflammation, cancer, cardiovascular
disease, infectious disease, and inflammatory disorders including
rheumatoid arthritis, chronic inflammatory bowel disease, chronic
inflammatory pelvic disease, multiple sclerosis, asthma,
osteoarthritis, atherosclerosis, psoriasis, rhinitis, autoimmunity,
and organ transplant rejection. In one example, such compositions
include SDF-1 or an analog thereof in a therapeutically or
prophylactically effective amount sufficient to be used to assist
in stimulating the production of tissue specific cells.
[0136] A "therapeutically effective amount" refers to an amount
effective, at dosages and for periods of time necessary, to achieve
enhanced proliferation and/or survival of MPC or progeny derived
therefrom.
[0137] A "prophylactically effective amount" refers to an amount
effective, at dosages and for periods of time necessary, to achieve
the desired prophylactic result, such as preventing or inhibiting
death of MPC or progeny derived therefrom.
[0138] In particular embodiments, a preferred range for
therapeutically or prophylactically effective amounts of SDF-1 or
an analog thereof may be 0.1 nM-0.1 M, 0.1 nM-0.05 M, 0.05 nM-15
.mu.M or 0.01 nM-10 .mu.M. It is to be noted that dosage values may
vary with the severity of the condition to be alleviated. For any
particular subject, specific dosage regimens may be adjusted over
time according to the individual need and the professional
judgement of the person administering or supervising the
administration of the compositions. Dosage ranges set forth herein
are exemplary only and do not limit the dosage ranges that may be
selected by medical practitioners.
[0139] The amount of SDF-1 or an analog thereof in the composition
may vary according to factors such as the disease state, age, sex,
and weight of the individual. Dosage regimens may be adjusted to
provide the optimum therapeutic response. For example, a single
bolus may be administered, several divided doses may be
administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It may be advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage. "Dosage unit form" as used herein refers to
physically discrete units suited as unitary dosages for subjects to
be treated; each unit containing a predetermined quantity of active
compound calculated to produce the desired therapeutic effect in
association with the required pharmaceutical carrier.
[0140] It will be appreciated that the SDF-1 or analog thereof may
be administered in the form of a composition comprising a
pharmaceutically acceptable carrier or excipient.
[0141] As used herein "pharmaceutically acceptable carrier" or
"excipient" includes any and all solvents, dispersion media,
coatings, antibacterial and antifungal agents, isotonic and
absorption delaying agents, and the like that are physiologically
compatible. In one embodiment, the carrier is suitable for
parenteral administration. Alternatively, the carrier can be
suitable for intravenous, intraperitoneal, intramuscular,
sublingual or oral administration. Pharmaceutically acceptable
carriers include sterile aqueous solutions or dispersions and
sterile powders for the extemporaneous preparation of sterile
injectable solutions or dispersion. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
pharmaceutical compositions of the invention is contemplated.
Supplementary active compounds can also be incorporated into the
compositions.
[0142] Pharmaceutical formulations for parenteral administration
may include liposomes. Liposomes and emulsions are well known
examples of delivery vehicles or carriers that are especially
useful for hydrophobic drugs. Depending on biological stability of
the therapeutic reagent, additional strategies for protein
stabilization may be employed. Furthermore, one may administer the
drug in a targeted drug delivery system, for example, in a liposome
coated with target-specific antibody. The liposomes will bind to
the target protein and be taken up selectively by the cell
expressing the target protein.
[0143] Therapeutic compositions typically should be sterile and
stable under the conditions of manufacture and storage. The
composition can be formulated as a solution, microemulsion,
liposome, or other ordered structure suitable to high drug
concentration. The carrier can be a solvent or dispersion medium
containing, for example, water, ethanol, polyol (for example,
glycerol, propylene glycol, and liquid polyethylene glycol, and the
like), and suitable mixtures thereof. The proper fluidity can be
maintained, for example, by the use of a coating such as lecithin,
by the maintenance of the required particle size in the case of
dispersion and by the use of surfactants. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, or sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, monostearate salts and gelatin.
Moreover, the SDF-1 or analog thereof may be administered in a time
release formulation, for example in a composition which includes a
slow release polymer. The active compounds can be prepared with
carriers that will protect the compound against rapid release, such
as a controlled release formulation, including implants and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters,
polylactic acid and polylactic, polyglycolic copolymers (PLG). Many
methods for the preparation of such formulations are patented or
generally known to those skilled in the art.
[0144] Additionally, suspensions of the compounds of the invention
may be prepared as appropriate oily suspensions for injection.
Suitable lipophilic solvents or vehicles include fatty oils such as
sesame oil; or synthetic fatty acid esters, such as ethyl oleate or
triglycerides; or liposomes. Suspensions to be used for injection
may also contain substances which increase the viscosity of the
suspension, such as sodium carboxymethyl cellulose, sorbitol, or
dextran. Optionally, the suspension may also contain suitable
stabilizers or agents which increase the solubility of the
compounds to allow for the preparation of highly concentrated
solutions.
[0145] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, the preferred methods of preparation
are vacuum drying and freeze-drying which yields a powder of the
active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof. In accordance with an
alternative aspect of the invention, SDF-1 or an analog thereof may
be formulated with one or more additional compounds that enhance
the solubility of the SDF-1 or analog.
[0146] If the compounds of the invention are to be administered by
inhalation, they may be conveniently delivered in the form of an
aerosol spray presentation from pressurized packs or a nebuliser;
together with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of gelatin, for example, for use in an inhaler may be
formulated containing a powder mix of the compound and a suitable
powder base such as starch or lactose.
Administration of Cellular Compositions of the Present
Invention
[0147] The cellular compositions of the present invention
comprising MPC and/or progeny derived therefrom may be useful for
the regeneration of tissue of various types, including bone,
cartilage, tendon, ligament, muscle, skin, and other connective
tissue, as well as nerve, cardiac, liver, lung, kidney, pancreas,
brain, and other organ tissues.
[0148] In some embodiments, the compositions of the present
invention may be administered in combination with an appropriate
matrix, for instance, for supporting the MPC and/or progeny derived
therefrom and providing a surface for bone, cartilage, muscle,
nerve, epidermis and/or other connective tissue growth. The matrix
may be in the form of traditional matrix biomaterials. The matrix
may provide slow release of the expressed protein and
differentiated cells and/or the appropriate environment for
presentation thereof. In some embodiments, various collagenous and
non-collagenous proteins are expected to be upregulated and
secreted from the MPC or progeny derived therefrom. This phenomenon
accelerates tissue regeneration by enhancing matrix deposition.
Matrix proteins can also be expressed in the genetically engineered
cells and enhance the engraftment and attachment of transplanted
cells into the transplant area.
[0149] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. The particular application of the cellular
based compositions will define the appropriate formulation.
Potential matrices for the compositions may be biodegradable and
chemically defined calcium sulfate, tricalcium phosphate,
hydroxyapatite, polylactic acid and polyanhydrides. Other potential
materials are biodegradable and biologically well defined, such as
bone or dermal collagen. Further matrices are comprised of pure
proteins or extracellular matrix components. Other potential
matrices are nonbiodegradable and chemically defined, such as
sintered hydroxyapatite, bioglass, aluminates, or other ceramics.
Matrices may be comprised of combinations of any of the above
mentioned types of material, such as polylactic acid and
hydroxyapatite or collagen and tricalcium phosphate. The
bioceramics may be altered in composition, such as in
calcium-aluminate-phosphate and processing to alter pore size,
particle size, particle shape, and biodegradability.
[0150] The cellular compositions of the invention may be used to
treat patients requiring the repair or replacement of cartilage or
bone tissue resulting from disease or trauma or failure of the
tissue to develop normally, or to provide a cosmetic function, such
as to augment facial or other features of the body. Treatment may
entail the use of the cells of the invention to produce new
cartilage tissue or bone tissue. For example, compositions
comprising undifferentiated or chondrogenic differentiation-induced
precursor cells may be used to treat a cartilage condition, for
example, rheumatoid arthritis or osteoarthritis or a traumatic or
surgical injury to cartilage. As another example, compositions
comprising bone precursor cells may be used to treat bone
conditions, including metabolic and non-metabolic bone diseases.
Examples of bone conditions include meniscal tears, spinal fusion,
spinal disc removal, spinal reconstruction, bone fractures,
bone/spinal deformation, osteosarcoma, myeloma, bone dysplasia,
scoliosis, osteoporosis, periodontal disease, dental bone loss,
osteomalacia, rickets, fibrous osteitis, renal bone dystrophy, and
Paget's disease of bone.
[0151] The cellular compositions of the invention may be
administered alone or as admixtures with other cells. Cells that
may be administered in conjunction with the compositions of the
present invention include, but are not limited to, other
multipotent or pluripotent cells or chondrocytes, chondroblasts,
osteocytes, osteoblasts, osteoclasts, bone lining cells, stem
cells, or bone marrow cells. The cells of different types may be
admixed with a composition of the invention immediately or shortly
prior to administration, or they may be co-cultured together for a
period of time prior to administration.
[0152] The cellular compositions of the invention may be
administered with other beneficial drugs or biological molecules
(growth factors, trophic factors). When the MPC and/or progeny
derived therefrom are administered with other agents, they may be
administered together in a single pharmaceutical composition, or in
separate pharmaceutical compositions, simultaneously or
sequentially with the other agents (either before or after
administration of the other agents). Bioactive factors which may be
co-administered include anti-apoptotic agents (e.g., EPO, EPO
mimetibody, TPO, IGF-I and IGF-II, HGF, caspase inhibitors);
anti-inflammatory agents (e.g., p38 MAPK inhibitors, TGF-beta
inhibitors, statins, IL-6 and IL-1 inhibitors, PEMIROLAST,
TRANILAST, REMICADE, SIROLIMUS, and NSAIDs (non-steroidal
anti-inflammatory drugs; e.g., TEPOXALIN, TOLMETIN, SUPROFEN);
immunosuppressive/immunomodulatory agents (e.g., calcineurin
inhibitors, such as cyclosporine, tacrolimus; mTOR inhibitors
(e.g., SIROLIMUS, EVEROLIMUS); anti-proliferatives (e.g.,
azathioprine, mycophenolate mofetil); corticosteroids (e.g.,
prednisolone, hydrocortisone); antibodies such as monoclonal
anti-IL-2Ralpha receptor antibodies (e.g., basiliximab,
daclizumab), polyclonal anti-T-cell antibodies (e.g.,
anti-thymocyte globulin (ATG); anti-lymphocyte globulin (ALG);
monoclonal anti-T cell antibody OKT3)); anti-thrombogenic agents
(e.g., heparin, heparin derivatives, urokinase, PPack
(dextrophenylalanine proline arginine chloromethylketone),
antithrombin compounds, platelet receptor antagonists,
anti-thrombin antibodies, anti-platelet receptor antibodies,
aspirin, dipyridamole, protamine, hirudin, prostaglandin
inhibitors, and platelet inhibitors); and anti-oxidants (e.g.,
probucol, vitamin A, ascorbic acid, tocopherol, coenzyme Q-10,
glutathione, L-cysteine, N-acetylcysteine) as well as local
anesthetics. As another example, the cells may be co-administered
with scar inhibitory factor as described in U.S. Pat. No.
5,827,735, incorporated herein by reference.
[0153] In one embodiment, cellular compositions of the invention
are administered as undifferentiated cells, i.e., as cultured in
Growth Medium. Alternatively, the cellular compositions may be
administered following exposure in culture to conditions that
stimulate differentiation toward a desired phenotype, for example,
an osteogenic phenotype.
[0154] The cellular compositions of the invention may be surgically
implanted, injected, delivered (e.g., by way of a catheter or
syringe), or otherwise administered directly or indirectly to the
site in need of repair or augmentation. The cells may be
administered by way of a matrix (e.g., a three-dimensional
scaffold). The cells may be administered with conventional
pharmaceutically acceptable carriers. Routes of administration of
the cells of the invention or compositions or components (e.g.,
ECM, cell lysate, conditioned medium) thereof include
intramuscular, ophthalmic, parenteral (including intravenous),
intraarterial, subcutaneous, oral, and nasal administration.
Particular routes of parenteral administration include, but are not
limited to, intramuscular, subcutaneous, intraperitoneal,
intracerebral, intraventricular, intracerebroventricular,
intrathecal, intracisternal, intraspinal and/or peri-spinal routes
of administration.
[0155] When cells are administered in semi-solid or solid devices,
surgical implantation into a precise location in the body is
typically a suitable means of administration. Liquid or fluid
pharmaceutical compositions, however, may be administered to a more
general location (e.g., throughout a diffusely affected area, for
example), from which they migrate to a particular location, e.g.,
by responding to chemical signals.
[0156] Other embodiments encompass methods of treatment by
administering pharmaceutical compositions comprising cellular
components (e.g., cell lysates or components thereof) or products
(e.g., extracellular matrix, trophic and other biological factors
produced through genetic modification).
[0157] Dosage forms and regimes for administering cellular
compositions described herein are developed in accordance with good
medical practice, taking into account the condition of the
individual patient, e.g., nature and extent of the condition being
treated, age, sex, body weight and general medical condition, and
other factors known to medical practitioners. Thus, the effective
amount of a pharmaceutical composition to be administered to a
patient is determined by these considerations as known in the
art.
[0158] In some embodiments of the invention, it may not be
necessary or desirable to immunosuppress a patient prior to
initiation of therapy with cellular compositions of the present
invention. Accordingly, transplantation with allogeneic, or even
xenogeneic, MPC or progeny derived therefrom may be tolerated in
some instances.
[0159] However, in other instances it may be desirable or
appropriate to pharmacologically immunosuppress a patient prior to
initiating cell therapy. This may be accomplished through the use
of systemic or local immunosuppressive agents, or it may be
accomplished by delivering the cells in an encapsulated device. MPC
or progeny derived therefrom may be encapsulated in a capsule that
is permeable to nutrients and oxygen required by the cell and
therapeutic factors the cell is yet impermeable to immune humoral
factors and cells. Preferably the encapsulant is hypoallergenic, is
easily and stably situated in a target tissue, and provides added
protection to the implanted structure. These and other means for
reducing or eliminating an immune response to the transplanted
cells are known in the art. As an alternative, MPC or progeny
derived therefrom may be genetically modified to reduce their
immunogenicity.
[0160] Survival of transplanted MPC or progeny derived therefrom in
a living patient can be determined through the use of a variety of
scanning techniques, e.g., computerized axial tomography (CAT or
CT) scan, magnetic resonance imaging (MRI) or positron emission
tomography (PET) scans. Determination of transplant survival can
also be done post mortem by removing the target tissue, and
examining it visually or through a microscope. Alternatively, cells
can be treated with stains that are specific for cells of a
specific lineage. Transplanted cells can also be identified by
prior incorporation of tracer dyes such as rhodamine- or
fluorescein-labeled microspheres, fast blue, bisbenzamide, ferric
microparticles, or genetically introduced reporter gene products,
such as beta-galactosidase or beta-glucuronidase.
[0161] Functional integration of transplanted MPC or progeny
derived therefrom into a subject can be assessed by examining
restoration of the function that was damaged or diseased, for
example, restoration of joint or bone function, or augmentation of
function.
[0162] Cellular compositions of the invention may include one or
more bioactive factors, for example but not limited to a growth
factor, a differentiation-inducing factor, a cell survival factor
such as caspase inhibitor, an anti-inflammatory agent such as p38
kinase inhibitor, or an angiogenic factor such as VEGF or bFGF.
Some examples of bioactive factors include PDGF-bb, EGF, bFGF,
IGF-1, and LIF.
[0163] Alternatively, MPC or progeny derived therefrom to be
transplanted may be genetically engineered to express such growth
factors, antioxidants, antiapoptotic agents, anti-inflammatory
agents, or angiogenic factors.
[0164] Pharmaceutical compositions of the invention may comprise
homogeneous or heterogeneous populations of MPC or progeny derived
therefrom, extracellular matrix or cell lysate thereof, or
conditioned medium thereof in a pharmaceutically acceptable
carrier. Pharmaceutically acceptable carriers for the cells of the
invention include organic or inorganic carrier substances suitable
which do not deleteriously react with the cells of the invention or
compositions or components thereof. To the extent they are
biocompatible, suitable pharmaceutically acceptable carriers
include water, salt solution (such as Ringer's solution), alcohols,
oils, gelatins, and carbohydrates, such as lactose, amylose, or
starch, fatty acid esters, hydroxymethylcellulose, and polyvinyl
pyrrolidine. Such preparations can be sterilized, and if desired,
mixed with auxiliary agents such as lubricants, preservatives,
stabilizers, wetting agents, emulsifiers, salts for influencing
osmotic pressure, buffers, and coloring. Pharmaceutical carriers
suitable for use in the present invention are known in the art and
are described, for example, in Pharmaceutical Sciences (17.sup.th
Ed., Mack Pub. Co., Easton, Pa.) and WO 96/05309, each of which are
incorporated by reference herein.
[0165] One or more other components may be added to transplanted
cells, including selected extracellular matrix components, such as
one or more types of collagen known in the art, and/or growth
factors, platelet-rich plasma, and drugs. Alternatively, the cells
of the invention may be genetically engineered to express and
produce for growth factors. Details on genetic engineering of the
cells of the invention are provided herein.
[0166] In a non-limiting embodiment, a formulation comprising the
cells of the invention is prepared for administration directly to
the site where the production of new tissue, such as bone tissue,
is desired. For example, and not by way of limitation, the MPC or
progeny derived therefrom may be suspended in a hydrogel solution
for injection. Examples of suitable hydrogels for use in the
invention include self-assembling peptides, such as RAD16.
Alternatively, the hydrogel solution containing the cells may be
allowed to harden, for instance in a mold, to form a matrix having
cells dispersed therein prior to implantation. Or, once the matrix
has hardened, the cell formations may be cultured so that the cells
are mitotically expanded prior to implantation. The hydrogel is an
organic polymer (natural or synthetic) which is cross-linked via
covalent, ionic, or hydrogen bonds to create a three-dimensional
open-lattice structure which entraps water molecules to form a gel.
Examples of materials which can be used to form a hydrogel include
polysaccharides such as alginate and salts thereof, peptides,
polyphosphazines, and polyacrylates, which are crosslinked
ionically, or block polymers such as polyethylene
oxide-polypropylene glycol block copolymers which are crosslinked
by temperature or pH, respectively. In some embodiments, the
support for the MPC or progeny derived therefrom is
biodegradable.
[0167] In some embodiments of the invention, the formulation
comprises an in situ polymerizable gel, as described, for example,
in U.S. Patent Application Publication 2002/0022676; Anseth et al.,
J. Control Release, 78(1-3): 199-209 (2002); Wang et al.,
Biomaterials, 24(22):3969-80 (2003).
[0168] In some embodiments, the polymers are at least partially
soluble in aqueous solutions, such as water, buffered salt
solutions, or aqueous alcohol solutions, that have charged side
groups, or a monovalent ionic salt thereof. Examples of polymers
with acidic side groups that can be reacted with cations are
poly(phosphazenes), poly(acrylic acids), poly(methacrylic acids),
copolymers of acrylic acid and methacrylic acid, poly(vinyl
acetate), and sulfonated polymers, such as sulfonated polystyrene.
Copolymers having acidic side groups formed by reaction of acrylic
or methacrylic acid and vinyl ether monomers or polymers can also
be used. Examples of acidic groups are carboxylic acid groups,
sulfonic acid groups, halogenated (preferably fluorinated) alcohol
groups, phenolic OH groups, and acidic OH groups.
[0169] Examples of polymers with basic side groups that can be
reacted with anions are poly(vinyl amines), poly(vinyl pyridine),
poly(vinyl imidazole), and some imino substituted polyphosphazenes.
The ammonium or quaternary salt of the polymers can also be formed
from the backbone nitrogens or pendant imino groups. Examples of
basic side groups are amino and imino groups.
[0170] Alginate can be ionically cross-linked with divalent
cations, in water, at room temperature, to form a hydrogel matrix.
Due to these mild conditions, alginate has been the most commonly
used polymer for hybridoma cell encapsulation, as described, for
example, in U.S. Pat. No. 4,352,883 to Lim. In the Lim process, an
aqueous solution containing the biological materials to be
encapsulated is suspended in a solution of a water soluble polymer,
the suspension is formed into droplets which are configured into
discrete microcapsules by contact with multivalent cations, then
the surface of the microcapsules is crosslinked with polyamino
acids to form a semipermeable membrane around the encapsulated
materials.
[0171] Polyphosphazenes are polymers with backbones consisting of
nitrogen and phosphorous separated by alternating single and double
bonds. Each phosphorous atom is covalently bonded to two side
chains.
[0172] The polyphosphazenes suitable for cross-linking have a
majority of side chain groups which are acidic and capable of
forming salt bridges with di- or trivalent cations. Examples of
preferred acidic side groups are carboxylic acid groups and
sulfonic acid groups. Hydrolytically stable polyphosphazenes are
formed of monomers having carboxylic acid side groups that are
crosslinked by divalent or trivalent cations such as Ca.sup.2+ or
Al.sup.3+. Polymers can be synthesized that degrade by hydrolysis
by incorporating monomers having imidazole, amino acid ester, or
glycerol side groups. For example, a polyanionic
poly[bis(carboxylatophenoxy)]phosphazene (PCPP) can be synthesized,
which is cross-linked with dissolved multivalent cations in aqueous
media at room temperature or below to form hydrogel matrices.
[0173] Biodegradable polyphosphazenes have at least two differing
types of side chains, acidic side groups capable of forming salt
bridges with multivalent cations, and side groups that hydrolyze
under in vivo conditions, e.g., imidazole groups, amino acid
esters, glycerol and glucosyl.
[0174] Hydrolysis of the side chain results in erosion of the
polymer. Examples of hydrolyzing side chains are unsubstituted and
substituted imidazoles and amino acid esters in which the group is
bonded to the phosphorous atom through an amino linkage
(polyphosphazene polymers in which both R groups are attached in
this manner are known as polyaminophosphazenes). For
polyimidazolephosphazenes, some of the "R" groups on the
polyphosphazene backbone are imidazole rings, attached to
phosphorous in the backbone through a ring nitrogen atom. Other "R"
groups can be organic residues that do not participate in
hydrolysis, such as methyl phenoxy groups or other groups shown in
the scientific paper of Allcock et al., Macromolecule 10:824
(1977). Methods of synthesis of the hydrogel materials, as well as
methods for preparing such hydrogels, are known in the art.
[0175] Other components may also be included in the formulation,
including but not limited to any of the following: (1) buffers to
provide appropriate pH and isotonicity; (2) lubricants; (3) viscous
materials to retain the cells at or near the site of
administration, including, for example, alginates, agars and plant
gums; and (4) other cell types that may produce a desired effect at
the site of administration, such as, for example, enhancement or
modification of the formation of tissue or its physicochemical
characteristics, or as support for the viability of the cells, or
inhibition of inflammation or rejection. The cells may be covered
by an appropriate wound covering to prevent cells from leaving the
site. Such wound coverings are known as those of skill in the
art.
Formulation of a Bone Tissue Patch
[0176] Culture or co-cultures of MPC or progeny derived therefrom
in a pre-shaped well enables the manufacture of a tissue patch of
pre-determined thickness and volume. The volume of the resulting
tissue patch is dependent upon the volume of the well and upon the
number of MPC or progeny derived therefrom in the well. Tissue of
optimal pre-determined volume may be prepared by routine
experimentation by altering either or both of the aforementioned
parameters.
[0177] The cell contacting surface of the well may be coated with a
molecule that discourages adhesion of MPC or progeny derived
therefrom to the cell contacting surface. Preferred coating
reagents include silicon based reagents i.e.,
dichlorodimethylsilane or polytetrafluoroethylene based reagents,
i.e., TEFLON. Procedures for coating materials with silicon based
reagents, specifically dichlorodimethylsilane, are well known in
the art. See for example, Sambrook et al. (1989) "Molecular Cloning
A Laboratory Manual", Cold Spring Harbor Laboratory Press, the
disclosure of which is incorporated by reference herein. It is
appreciated that other biocompatible reagents that prevent the
attachment of cells to the surface of the well may be useful in the
practice of the instant invention.
[0178] Alternatively, the well may be cast from a pliable or
moldable biocompatible material that does not permit attachment of
cells per se. Preferred materials that prevent such cell attachment
include, but are not limited to, agarose, glass, untreated cell
culture plastic and polytetrafluoroethylene, i.e., TEFLON.
Untreated cell culture plastics, i.e., plastics that have not been
treated with or made from materials that have an electrostatic
charge are commercially available, and may be purchased, for
example, from Falcon Labware, Becton-Dickinson, Lincoln Park, N.J.
The aforementioned materials, however, are not meant to be
limiting. It is appreciated that any other pliable or moldable
biocompatible material that inherently discourages the attachment
of MPC or progeny derived therefrom may be useful in the practice
of the instant invention.
[0179] MPC or progeny derived therefrom in suspension may be seeded
into and cultured in the pre-shaped well. The MPC or progeny
derived therefrom may be induced to differentiate to a chondrogenic
or osteogenic phenotype in culture in the well or may have been
induced to differentiate prior to seeding in the well. The cells
may be diluted by the addition of culture medium to a cell density
of about 1.times.10.sup.5 to 1.times.10.sup.9 cells per
milliliter.
[0180] The cells may form a cohesive plug of cells. The cohesive
plug of cells may be removed from the well and surgically implanted
into the tissue defect. It is anticipated that undifferentiated MPC
or progeny derived therefrom may differentiate in situ thereby to
form tissue in vivo.
[0181] Bone defects may be identified inferentially by using
computer aided tomography (CAT scanning); X-ray examination,
magnetic resonance imaging (MRI), analysis of synovial fluid or
serum markers or by any other procedures known in the art. Defects
in mammals also are readily identifiable visually during
arthroscopic examination or during open surgery of the joint.
Treatment of the defects can be effected during an arthroscopic or
open surgical procedure using the methods and compositions
disclosed herein.
[0182] Accordingly, once the defect has been identified, the defect
may be treated by the following steps of (1) surgically implanting
at the pre-determined site a tissue patch prepared by the
methodologies described herein, and (2) permitting the tissue patch
to integrate into pre-determined site.
[0183] The tissue patch optimally has a size and shape such that
when the patch is implanted into the defect, the edges of the
implanted tissue contact directly the edges of the defect. In
addition, the tissue patch may be fixed in place during the
surgical procedure. This can be effected by surgically fixing the
patch into the defect with biodegradable sutures and/or by applying
a bioadhesive to the region interfacing the patch and the
defect.
[0184] In some instances, damaged tissue may be surgically excised
prior to the implantation of the patch of tissue.
Transplantation of MPC or Progeny Derived Therefrom Using
Scaffolds
[0185] The cellular compositions of the invention or co-cultures
thereof may be seeded onto or into a three-dimensional scaffold and
implanted in vivo, where the seeded cells will proliferate on the
framework and form a replacement tissue, such as bone tissue, in
vivo in cooperation with the cells of the patient.
[0186] For example, but not by way of limitation, the scaffold may
be designed such that the scaffold structure: (1) supports the
seeded cells without subsequent degradation; (2) supports the cells
from the time of seeding until the tissue transplant is remodeled
by the host tissue; (2) allows the seeded cells to attach,
proliferate, and develop into a tissue structure having sufficient
mechanical integrity to support itself in vitro, at which point,
the scaffold is degraded. A review of scaffold design is provided
by Hutmacher, J. Biomat. Sci. Polymer Edn., 12(1):107-124
(2001).
[0187] Scaffolds of the invention can be administered in
combination with any one or more growth factors, cells, for example
stem cells, bone marrow cells, chondrocytes, chondroblasts,
osteocytes, osteoblasts, osteoclasts, bone lining cells, or their
precursors, drugs or other components described above that
stimulate tissue formation or otherwise enhance or improve the
practice of the invention. The MPC or progeny derived therefrom to
be seeded onto the scaffolds may be genetically engineered to
express growth factors or drugs.
[0188] The cells of the invention can be used to produce new tissue
in vitro, which can then be implanted, transplanted or otherwise
inserted into a site requiring tissue repair, replacement or
augmentation in a patient.
[0189] In a non-limiting embodiment, the cells of the invention are
used to produce a three-dimensional tissue construct in vitro,
which is then implanted in vivo. As an example of the production of
three-dimensional tissue constructs, see U.S. Pat. No. 4,963,489,
which is incorporated herein by reference. For example, the cells
of the invention may be inoculated or "seeded" onto a
three-dimensional framework or scaffold, and proliferated or grown
in vitro to form a living tissue that can be implanted in vivo.
[0190] The cells of the invention can be grown freely in a culture
vessel to sub-confluency or confluency, lifted from the culture and
inoculated onto a three-dimensional framework. Inoculation of the
three-dimensional framework with a high concentration of cells,
e.g., approximately 10.sup.6 to 5.times.10.sup.7 cells per
milliliter, will result in the establishment of the
three-dimensional support in relatively shorter periods of
time.
[0191] Examples of scaffolds which may be used in the present
invention include nonwoven mats, porous foams, or self assembling
peptides. Nonwoven mats may, for example, be formed using fibers
comprised of a synthetic absorbable copolymer of glycolic and
lactic acids (PGA/PLA), sold under the tradename VICRYL (Ethicon,
Inc., Somerville, N.J.). Foams, composed of, for example,
poly(epsilon-caprolactone)/poly(glycolic acid) (PCL/PGA) copolymer,
formed by processes such as freeze-drying, or lyophilized, as
discussed in U.S. Pat. No. 6,355,699, are also possible scaffolds.
Hydrogels such as self-assembling peptides (e.g., RAD16) may also
be used. These materials are frequently used as supports for growth
of tissue.
[0192] The three-dimensional framework may be made of ceramic
materials including, but not limited to: mono-, di-, tri-,
alpha-tri-, beta-tri-, and tetra-calcium phosphate, hydroxyapatite,
fluoroapatites, calcium sulfates, calcium fluorides, calcium
oxides, calcium carbonates, magnesium calcium phosphates,
biologically active glasses such as BIOGLASS (University of
Florida, Gainesville, Fla.), and mixtures thereof. There are a
number of suitable porous biocompatible ceramic materials currently
available on the commercial market such as SURGIBON (Unilab
Surgibone, Inc., Canada), ENDOBON (Merck Biomaterial France,
France), CEROS (Mathys, A. G., Bettlach, Switzerland), and
INTERPORE (Interpore, Irvine, Calif., United States), and
mineralized collagen bone grafting products such as HEALOS
(Orquest, Inc., Mountain View, Calif.) and VITOSS, RHAKOSS, and
CORTOSS (Orthovita, Malvern, Pa.). The framework may be a mixture,
blend or composite of natural and/or synthetic materials. In some
embodiments, the scaffold is in the form of a cage. In a preferred
embodiment, the scaffold is coated with collagen.
[0193] According to a preferred embodiment, the framework is a
felt, which can be composed of a multifilament yarn made from a
bioabsorbable material, e.g., PGA, PLA, PCL copolymers or blends,
or hyaluronic acid. The yarn is made into a felt using standard
textile processing techniques consisting of crimping, cutting,
carding and needling.
[0194] In another preferred embodiment the cells of the invention
are seeded onto foam scaffolds that may be composite structures. In
addition, the three-dimensional framework may be molded into a
useful shape, such as that of the external portion of the ear, a
bone, joint or other specific structure in the body to be repaired,
replaced or augmented.
[0195] In another preferred embodiment, the cells are seeded onto a
framework comprising a prosthetic device for implantation into a
patient, as described in U.S. Pat. No. 6,200,606, incorporated
herein by reference. As described therein, a variety of clinically
useful prosthetic devices have been developed for use in bone and
cartilage grafting procedures. (see e.g. Bone Grafts and Bone
Substitutions. Ed. M. B. Habal & A. H. Reddi, W. B. Saunders
Co., 1992). For example, effective knee and hip replacement devices
have been and continue to be widely used in the clinical
environment. Many of these devices are fabricated using a variety
of inorganic materials having low immunogenic activity, which
safely function in the body. Examples of synthetic materials which
have been tried and proven include titanium alloys, calcium
phosphate, ceramic hydroxyapatite, and a variety of stainless steel
and cobalt-chrome alloys. These materials provide structural
support and can form a scaffolding into which host vascularization
and cell migration can occur.
[0196] The framework may be treated prior to inoculation of the
cells of the invention in order to enhance cell attachment. For
example, prior to inoculation with the cells of the invention,
nylon matrices could be treated with 0.1 molar acetic acid and
incubated in polylysine, PBS, and/or collagen to coat the nylon.
Polystyrene could be similarly treated using sulfuric acid.
[0197] In addition, the external surfaces of the three-dimensional
framework may be modified to improve the attachment or growth of
cells and differentiation of tissue, such as by plasma coating the
framework or addition of one or more proteins (e.g., collagens,
elastic fibers, reticular fibers), glycoproteins,
glycosaminoglycans (e.g., heparin sulfate, chondroitin-4-sulfate,
chondroitin-6-sulfate, dermatan sulfate, keratin sulfate), a
cellular matrix, and/or other materials such as, but not limited
to, gelatin, alginates, agar, agarose, and plant gums, among
others.
[0198] In some embodiments, the scaffold is comprised of or is
treated with materials that render it non-thrombogenic. These
treatments and materials may also promote and sustain endothelial
growth, migration, and extracellular matrix deposition. Examples of
these materials and treatments include but are not limited to
natural materials such as basement membrane proteins such as
laminin and Type IV collagen, synthetic materials such as ePTFE,
and segmented polyurethaneurea silicones, such as PURSPAN (The
Polymer Technology Group, Inc., Berkeley, Calif.). These materials
can be further treated to render the scaffold non-thrombogenic.
Such treatments include anti-thrombotic agents such as heparin, and
treatments which alter the surface charge of the material such as
plasma coating.
[0199] In some embodiments, the surface of the scaffold is
textured. For example, in some aspects of the invention, the
scaffold is provided with a groove and ridge pattern. The grooves
are preferably less than about 500 microns, more preferably less
than about 100 microns, and most preferably between about 10
nanometers and 10 microns. Such "microgrooves" allow the cells to
align and/or migrate guided by the surface grooves.
[0200] In some embodiments, it is important to re-create in culture
the cellular microenvironment found in vivo, such that the extent
to which the cells of the invention are grown prior to implantation
in vivo or use in vitro may vary. In addition, growth factors,
chondrogenic differentiation inducing agents, osteogenic inducing
agents, and angiogenic factors may be added to the culture medium
prior to, during, or subsequent to inoculation of the cells to
trigger differentiation and tissue formation by the MPC or progeny
derived therefrom or co-cultures thereof.
[0201] The three-dimensional framework may be modified so that the
growth of cells and the production of tissue thereon is enhanced,
or so that the risk of rejection of the implant is reduced. Thus,
one or more biologically active compounds, including, but not
limited to, anti-inflammatories, immunosuppressants or growth
factors, may be added to the framework.
Therapeutic Uses for Extracellular Matrix or Cell Lysates
[0202] As an alternative to implanting the cells of the invention,
or living tissue produced therefrom, a subject in need of tissue
repair, replacement, or augmentation may benefit from the
administration of a component or product of MPC or progeny derived
therefrom (particularly where they have been genetically modified),
such as the extracellular matrix (ECM) or cell lysate produced by
those cells.
[0203] In some embodiments, after the cells of the invention have
been cultured in vitro, such as, for example, by using a
three-dimensional scaffold system described herein, such that a
desired amount of ECM has been secreted onto the framework. Once
ECM is secreted onto the framework, the cells may be removed. The
ECM may be processed for further use, for example, as an injectable
preparation.
[0204] In some embodiments, the cells are killed and cellular
debris (e.g., cellular membranes) is removed from the framework.
This process may be carried out in a number of different ways. For
example, the living tissue can be flash-frozen in liquid nitrogen
without a cryopreservative, or the tissue can be immersed in
sterile distilled water so that the cells burst in response to
osmotic pressure. Once the cells have been killed, the cellular
membranes may be disrupted and cellular debris removed by treatment
with a mild detergent rinse, such as EDTA, CHAPS or a zwitterionic
detergent. An advantage to using a mild detergent rinse is that it
solubilizes membrane-bound proteins, which are often highly
antigenic.
[0205] Alternatively, the tissue can be enzymatically digested
and/or extracted with reagents that break down cellular membranes.
Example of such enzymes include, but are not limited to,
hyaluronidase, dispase, proteases, and nucleases (for example,
deoxyribonuclease and ribonuclease). Examples of detergents include
non-ionic detergents such as, for example, alkylaryl polyether
alcohol (TRITON.TM. X-100), octylphenoxy polyethoxy-ethanol (Rohm
and Haas Philadelphia, Pa.), BRIJ-35, a polyethoxyethanol lauryl
ether (Atlas Chemical Co., San Diego, Calif.), polysorbate 20
(TWEEN 20.TM.), a polyethoxyethanol sorbitan monolaureate (Rohm and
Haas), polyethylene lauryl ether (Rohm and Haas); and ionic
detergents such as, for example, sodium dodecyl sulphate, sulfated
higher aliphatic alcohols, sulfonated alkanes and sulfonated
alkylarenes containing 7 to 22 carbon atoms in a branched or
unbranched chain.
[0206] Scaffolds comprising the ECM may be used therapeutically as
described above. Alternatively, ECM may be collected from the
scaffold. The collection of the ECM can be accomplished in a
variety of ways, depending, for example, on whether the scaffold is
biodegradable or non-biodegradable. For example, if the framework
is non-biodegradable, the ECM can be removed by subjecting the
framework to sonication, high pressure water jets, mechanical
scraping, or mild treatment with detergents or enzymes, or any
combination of the above.
[0207] If the framework is biodegradable, the ECM can be collected,
for example, by allowing the framework to degrade or dissolve in
solution. Alternatively, if the biodegradable framework is composed
of a material that can itself be injected along with the ECM, the
framework and the ECM can be processed in toto for subsequent
injection. Alternatively, the ECM can be removed from the
biodegradable framework by any of the methods described above for
collection of ECM from a non-biodegradable framework. All
collection processes are preferably designed so as not to denature
the ECM or cell lysate produced by the cells of the invention.
[0208] Embodiments of the present invention will now be described
in detail with reference to the following non-limiting
examples.
EXAMPLES
Materials and Methods
Subjects and Cell Culture.
[0209] Bone marrow (BM) aspirates were obtained from the posterior
iliac crest of healthy adult volunteers (19-35 years old) following
informed consent, according to procedures approved by the ethics
committee of the Royal Adelaide Hospital, South Australia. Bone
marrow mononuclear cells (BMMNCs) were prepared as previously
described (Gronthos et al. J Cell Sci. 116: 1827-1835, 2003).
Primary BMSSC cultures were established in .alpha.-MEM (Minimum
Essential Media) supplemented with 20% fetal calf serum, 2 mM
L-glutamine, and 100 .mu.M L-ascorbate-2-phosphate as previously
described (Gronthos et al. J Cell Sci. 116: 1827-1835, 2003). BMSSC
clonal cell lines were generated by limiting dilution from day 14
colonies derived from STRO-1.sup.bri/VCAM-1.sup.+ sorted cells as
described below, following subculture in serum replete medium for
proliferation, RT-PCR, immunohistochemistry, and developmental
studies.
Magnetic-Activated Cell Sorting (MACS).
[0210] This was performed as previously described (Gronthos et al.,
Isolation, Purification and In Vitro Manipulation of Human Bone
Marrow Stromal Precursor Cells. In Marrow Stromal Cell Culture.
Owen M. and Beresford J. N. (eds). Cambridge University Press UK,
Chapter 3, p. 26-42, 1998; Gronthos and Simmons, Blood 85(4):
929-940, 1995). In brief, approximately 1-3.times.10.sup.8 normal
human bone marrow mononuclear cells were sequentially incubated
with STRO-1 supernatant, anti-IgM-biotin, streptavidin microbeads
and finally streptavidin FITC (Caltag Laboratories, Burlingame,
Calif.) before being separated on a Mini MACS magnetic column
(Miltenyi Biotec Inc., Auburn, Calif.) according to the
manufacturers instructions.
Fluorescence-Activated Cell Sorting (FACS).
[0211] The STRO-1.sup.+ MACS isolated cells were labelled with
streptavidin conjugated FITC, then incubated with either purified
anti-CD106 (VCAM-1) antibody 6G10 or anti-CD146 (MUC-18) antibody
or isotype control 1B5 (10 .mu.g/ml) for 30 minutes on ice, washed
and incubated with phycoerythrin (PE) conjugated goat anti-mouse
IgG antibody (1/50; Southern Biotechnology Associates, Birmingham,
Ala.) for an additional 20 minutes on ice. Cells were sorted using
a FACStar.sup.PLUS flow cytometer (Becton Dickinson, Sunnyvale,
Calif.). The STRO-1.sup.bri/CD106.sup.+ or
STRO-1.sup.bri/CD146.sup.+ cells were cultured in
alpha-Modification of Eagle's Medium supplemented with 20% fetal
calf serum, L-glutamine 2 mM, ascorbate-2-phosphate (100 .mu.M) to
initiate primary culture in 5% CO.sub.2, at 37.degree. C.
humidified atmosphere.
Two-Colour Flow Cytometric Analysis Using Indirect
Immuofluorescence.
[0212] This procedure has been reported previously (Gronthos et
al., Isolation, Purification and In Vitro Manipulation of Human
Bone Marrow Stromal Precursor Cells. In Marrow Stromal Cell
Culture. Owen M. and Beresford J. N. (eds). Cambridge University
Press UK, Chapter 3, p. 26-42, 1998). Briefly, primary cultures of
MPC or MPC derived cells were liberated by trypsin/EDTA digest then
incubated for 30 min on ice. Approximately 2.times.10.sup.5 cells
were washed then resuspended in 200 .mu.l of primary antibody
cocktail for 1 hr on ice. The primary antibody cocktail consisted
of saturating concentrations of the mouse IgM monoclonal antibody
STRO-1 and a mouse IgG monoclonal antibody or rabbit IgG for each
tube (Table 1). For the staining with antibodies reactive with
intracellular antigens the cells were first washed with PBS then
permeabalized by treatment with 70% ethanol on ice for ten minutes
then washed prior to staining. The mouse isotype IgM and IgG
negative control Mabs were treated under the same conditions.
Following incubation with primary antibodies, cells were washed and
exposed to saturating levels of goat anti-mouse IgM .mu.-chain
specific-FITC (1/50 dilution) and either goat anti-mouse IgG
.gamma.-specific-PE (1/50 dilution) or anti-rabbit Ig-specific-PE
(1/50 dilution) (Southern Biotechnology Associates) in a final
volume of 100 .mu.l. The cells were incubated for 45 min on ice,
then washed twice then fixed in FAX FIX (PBS supplemented with 1%
(v/v), 2% (w/v) D-glucose, 0.01% sodium azide). The cells were then
analysed on an Epics.RTM.-XL-MCL flow cytometer (Beckman Coulter,
Hialeah, Fla.).
Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE)
Labelling.
[0213] The cell-permeant fluorescein-based dye CFSE was used to
study division-related phenotypic and functional changes during MPC
derived cell development. CFSE covalently attaches to cytoplasmic
components of cells, resulting in uniform bright fluorescence,
which upon cell division is equally distributed between daughter
cells. This technique allows the resolution of up to eight cycles
of cell division by flow cytometry. Single cell suspensions of ex
vivo expanded MPC derived cells were washed once, resuspended in 1
ml of PBS/0.1% BSA and 2 .mu.l of 5 mM CFSE (final 10 .mu.M) was
added prior to incubating at 37.degree. C. for 10 mins. The
staining was quenched by the addition of 5 volumes of ice cold
culture medium .alpha.-MEM-10 and incubated on ice for 5 mins. The
cells were washed three times in the culture medium and then plated
at low density 1.times.10.sup.5 in culture flasks (T-25). At
various time points, cells were detached by trypsin-EDTA and
analysed by flow cytometric analysis.
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
Analysis.
[0214] Primary MPC derived cultures were liberated by trypsin/EDTA
treatment then stained with STRO-1 supernatant as described above.
Following washing the cells were incubated with phycoerythrin (PE)
conjugated goat anti-mouse IgM antibody (1/50; Southern
Biotechnology Associates, Birmingham, Ala.) for an additional 20
minutes on ice. Cells were sorted using a FACStar.sup.PLUS flow
cytometer (Becton Dickinson, Sunnyvale, Calif.). Total cellular RNA
was prepared from either 2.times.10.sup.6 STRO-1.sup.bri or
STRO-1.sup.dim sorted primary cells, chondrocyte pellets and other
induced cultures and lysed using RNAzo1B extraction method (Biotecx
Lab. Inc., Houston, Tex.), according to the manufacturer's
recommendations. RNA isolated from each subpopulation was then used
as a template for cDNA synthesis, prepared using a First-strand
cDNA synthesis kit (Pharmacia Biotech, Uppsala, Sweden). The
expression of various transcripts was assessed by PCR
amplification, using a standard protocol as described previously
(Gronthos et al., J. Bone and Min. Res. 14:48-57, 1999). Primers
sets used in this study are shown in Table 2. Following
amplification, each reaction mixture was analysed by 1.5% agarose
gel electrophoresis, and visualised by ethidium bromide staining.
RNA integrity was assessed by the expression of GAPDH.
Differentiation of CFU-F In Vitro.
[0215] We have previously reported the conditions for the induction
of human BM stromal cells to develop a mineralized bone matrix in
vitro cultured in .alpha.MEM supplemented with 10% FCS, 100 .mu.M
L-ascorbate-2-phosphate, dexamethasone 10.sup.-7 M and 3 mM
inorganic phosphate (Gronthos et al., Blood. 84: 4164-4173, 1994).
Mineral deposits were identified by positive von Kossa staining.
Adipogenesis was induced in the presence of 0.5 mM
methylisobutylmethylxanthine, 0.5 .mu.M hydrocortisone, and 60
.mu.M indomethacin as previously described (Gimble, J. M. Marrow
stromal adipocytes. In Marrow stromal cell culture. Owen M. and
Beresford J. N. (eds). Cambridge: Cambridge University Press UK.
Chapter 5, p. 67-87, 1998). Oil Red 0 staining was used to identify
lipid-laden fat cells. Chondrogenic differentiation was assessed in
aggregate cultures treated with 10 ng/ml TGF-.beta.3 as described
(Pittenger et al., Science, 284:143-147, 1999).
In Vivo Assay of Bone Formation.
[0216] The adherent cells derived from STRO-1.sup.bri/VCAM-1.sup.+
cells at passage 2-3 were trypsinised, mixed with 40 mg
hydroxyapatite/tricalcium phosphate ceramic particles (Zimmer
Corporation, Warsaw, Ind.) and then implanted into subcutaneous
pockets on the dorsal surface of two month old SCID mice as
described previously (Gronthos et al., Proceedings of the National
Academy of Sciences (USA), 97 (25): 13625-13630, 2000). These
procedures were performed in accordance to specifications of an
approved animal protocol (Adelaide University AEC# M/079/94).
Implants were recovered after 6-8 weeks, fixed in 4%
paraformaldehyde for 2 days, then decalcified for a further ten
days in 10% EDTA prior to embedding in paraffin. For histological
analysis, 5 .mu.m sections of the implants were prepared and
stained with haematoxylin and eosin (Gronthos et al., Proceedings
of the National Academy of Sciences (USA), 97 (25): 13625-13630,
2000).
[0217] Neural Tissue Development. Monolayer cultures are grown in
Neuroblast A medium (Invitrogen/GIBCO)+5% horse serum, 1% fetal
calf serum, L-glutamine (2 mM), transferrin (100 .mu.g/ml), insulin
(2 .mu.g/ml), retinoic acid 0.5 mM, brain-derived neurothrophic
factor (10 ng/ml).
[0218] Fat Development. Monolayer cultures are grown in
alpha-Modification of Eagle's Medium (JRH) supplemented with 10%
fetal calf serum, L-glutamine 2 mM, ascorbate-2-phosphate (100
.mu.M), 0.5 mM methylisobutylxanthine, 0.5 mM hydrocortisone, 60 mM
indomethicin.
[0219] Cartilage Development Pellet cultures in polypropylene tubes
are grown in alpha-Modification of Eagle's Medium supplemented with
1% bovine serum albumin, transferrin (100 .mu.g/ml), insulin (2
.mu.g/ml), L-glutamine (2 mM), ascorbate-2-phosphate (100
.mu.M/ml), dexamethasone (10.sup.-8M), with BMP-7 (50 ng/ml),
TGF.beta..sub.3 (10 ng/ml).
[0220] Skeletal/Cardiac Muscle Development. Monolayer cultures are
grown in alpha-Modification of Eagle's Medium supplemented with 10%
fetal calf serum, L-glutamine (2 mM), ascorbate-2-phosphate (100
.mu.M/ml), and 5-azacytodine (5 .mu.M/ml).
[0221] Epithelial Development. Monolayer cultures are grown in
keratinocyte basal medium (Clontenics) supplemented with Bovine
Pituitary Extract (50 .mu.g/ml), epidermal growth factor (10
ng/ml), Hydrocortisone (0.5 .mu.g/ml), Insulin (5 .mu.g/ml).
[0222] Osteoblasts, Tendon, Ligament or Odontoblast Development.
Monolayer cultures are grown in alpha-Modification of Eagle's
Medium supplemented with 10% fetal calf serum, L-glutamine 2 mM,
ascorbate-2-phosphate (1100 .mu.M), Dexamethasone (10.sup.-7M) and
BMP-2 (50 ng/ml)
[0223] Pericyte or Smooth Muscle Cell Development. Cultures of
20,000 ex vivo cultured MPCs per well are grown in
alpha-Modification of Eagle's Medium supplemented with 10% fetal
calf serum, L-glutamine 2 mM, ascorbate-2-phosphate (100 .mu.M),
platelet derived growth factor-BB (10 ng/ml) suspended over 200 l
of matrigel in 48-well plates.
Primary Antibodies.
[0224] Primary antibodies used in this study were as follows:
STRO-1 (mouse IgM [immunoglobulin M]) (Gronthos et al. J Cell Sci.
116: 1827-1835, 2003), anti-human alkaline phosphatase antibody
(B4-78, mouse IgG1; Hybridoma Studies Bank, University of Iowa,
Ames), anti-human CXCR4 antibody (mouse IgG2b; Chemicon
International, Temecula, Calif.), and anti-human annexin V antibody
(mouse IgG1; Chemicon) were used as either tissue culture
supernatant diluted 1:2 or as purified immunoglobulin 10 .mu.g/mL,
respectively. Isotype-matched control mouse monoclonal antibodies
used in this study included 1A6.12 (IgM), 1B5 (IgG1), and 1A6.11
(IgG2b) (kindly provided by Prof L. K. Ashman, University of
Newcastle, NSW, Australia).
Purification of BMSSCs.
[0225] This was performed essentially as previously described
(Gronthos et al. J Cell Sci. 116: 1827-1835, 2003; Gronthos and
Simmons, Blood. 85: 929-940, 1995). In brief, approximately 1 to
3.times.10.sup.8 adult human BMMNCs were incubated with blocking
buffer (Hanks balanced salt solution [HBSS] supplemented with 1%
human serum, 1% bovine serum albumin, and 5% fetal bovine serum),
then sequentially incubated with STRO-1 supernatant,
anti-IgM-biotin, streptavidin microbeads (Miltenyi Biotec, Auburn,
Calif.), and finally streptavidin fluorescein isothiocyanate (FITC;
Caltag Laboratories, Burlingame, Calif.) before being separated on
a Mini magnetic-activated cell sorting (MACS) magnetic column
(Miltenyi Biotec), according to the manufacturer's recommendations.
The MACS-isolated STRO-1+ bone marrow mononuclear cells were
subsequently sorted by using a FACStar flow cytometer (Becton
Dickinson, Sunnyvale, Calif.), based on their high (STRO-1bright)
or low (STRO-1dull) STRO-1 expression (FIG. 1A).
Isolation of STRO-1/Alkaline Phosphatase BMSSC Subpopulations.
[0226] Secondary cultures of human BMSSCs were prepared as
single-cell suspensions by trypsin/EDTA (ethylenediaminetetraacetic
acid) digest and then incubated with antibodies identifying STRO-1
and the bone-associated antigen alkaline phosphatase (AP), B4-78,
as described by Gronthos et al., J Bone Miner Res. 14: 47-56, 1999.
Approximately 2.times.10.sup.7 cells were incubated with antibodies
reactive to STRO-1 and alkaline phosphatase (B4-78) for 1 hour on
ice. Replicate tubes were incubated with the corresponding single
color and negative control antibodies. After washing, the samples
were incubated with goat anti-mouse IgG1-FITC and IgM-PE
(phycoerythrin) antibodies (Southern Biotechnology Associates,
Birmingham, Ala.) as secondary detection agents for 45 minutes on
ice. Following washing, the cells were subsequently sorted to
purity by double sorting, using a FACStar flow cytometer (Becton
Dickinson), based on the 4 STRO-1/AP BMSSC subpopulations (Gronthos
et al., J Bone Miner Res. 14: 47-56, 1999; Pan et al., Bone
34(1):112-23, 2004; and Atkins et al., J Bone Miner Res.
18(6):1088-98, 2003).
Calcium Flux Assays.
[0227] Single-cell suspensions of trypsin-detached secondary BMSSC
cultures were resuspended to a concentration of 1.times.10.sup.6
cells/mL in HBSS supplemented with 1% fetal calf serum (FCS) and
1.25 mM CaCl.sub.2. The cells were incubated with 2 .mu.M fura-2-AM
(fura-2 acetoxymethyl ester; Molecular Probes, Eugene, Oreg.) for
30 minutes at 37.degree. C. Excess fura-2-AM was removed by washing
the cells twice, and the cells were resuspended in 2 mL HBSS
containing 1% FCS and 1.25 mM CaCl.sub.2 to a final concentration
of 1.times.10.sup.6 cells/mL. [Ca2+].sub.i was measured using
spectrofluorometer (LS55 Luminescence spectrometer; Perkin Elmer,
Boston, Mass.), with alternating excitation of 340 and 380 nm and
fluorescence emission at 510 nm. After establishing a base line
level of [Ca2+].sub.i, the cells were treated with 30 ng/mL
SDF-1.alpha.. When a stable peak of [Ca2+].sub.i in response to
SDF-1.alpha. was achieved, the BMSSCs were permeabilized with 0.1
mM digitonin, and ethylene glycol tetraacetic acid (EGTA) was added
to a final concentration of 5 mM. The digitonin and EGTA
measurements were used to calibrate [Ca2+].sub.i with regard to
fura 2-AM fluorescence in each sample using a calibration equation
as previously described (Grynkiewicz et al., J Biol. Chem. 260:
3440-3450, 1985)
Colony Efficiency Assays.
[0228] Colony-forming assays were performed using
MACS/FACS-isolated STRO-1bright BMMNCs and then plated at a density
of 5.times.10.sup.4 per well in 24-well plates under serum-deprived
conditions as previously described (Gronthos et al. J Cell Sci.
116: 1827-1835, 2003; Gronthos and Simmons, Blood. 85: 929-940,
1995). Cells were plated in the presence of different cytokine
combinations. Growth factors used in this study included
.alpha.-interferon 2a (30 000 IU/mL; F Hoffmann-La Roche, Basel,
Switzerland), platelet-derived growth factor-BB (5 ng/mL),
interleukin-4 (30 ng/mL), and stromal derived factor-1 (30 ng/mL;
CytoLab/PeproTech, Rehovot, Israel). The cultures were terminated
at day 14, and the number of CFU-Fs enumerated following staining
with 0.1% (wt/vol) toluidine blue in 1% paraformaldehyde.
Aggregates of greater than 50 cells were scored as CFU-F-derived
colonies.
Flow Cytometric Analysis.
[0229] BMSSC cultures were prepared by trypsin/EDTA digest, then
resuspended in blocking buffer for 30 minutes. Single-cell
suspensions were then incubated with either anti-CXCR4 antibody or
1A6.11 at a concentration of 10 .mu.g/mL for 1 hour on ice.
Similarly, high SDF-1-expressing BMSSC and vector control cell
lines were prepared by trypsin/EDTA treatment, blocked, then
incubated with either anti-annexin V antibody or the
isotype-matched control antibody, 1D4.5. After washing, the cells
were incubated with the secondary detection reagents, goat
anti-mouse IgG1- or IgG2b-FITC-conjugated antibodies (1/50;
Southern Biotechnology Associates) for 45 minutes on ice. Following
washing, the samples were analyzed using an Epics-XL-MCL flow
cytometer (Beckman Coulter, Hialeah, Fla.).
RT-PCR Analysis.
[0230] Total RNA was prepared from 2.times.10.sup.4
STRO-1.sup.bright-, STRO-1.sup.dull-, and
STRO-1.sup.negative-sorted bone marrow mononuclear cells; cultured
BMSSC STRO-1/alkaline phosphatase-sorted subpopulations; or the
human osteosarcoma cell line, MG63, using the RNA STAT-60 system
(TEL-TEST, Friendswood, Tex.). Total RNA isolated from each
subpopulation was then used as a template for cDNA synthesis,
prepared using a first-strand cDNA synthesis kit (Pharmacia
Biotech, Uppsala, Sweden). The expression of various transcripts
was assessed by PCR amplification, using a standard protocol as
previously described. 5 Primer sets used in this study were as
follows: SDF-1 (forward, 5'-gacccgcgctcgtccgcc-3'; reverse,
5'-gctggactcctactgtaaggg-3'); CXCR4 (forward,
5'-tctggagaaccagcggttac-3'; reverse, 5'-gacgccaacatagaccacct-3');
GAPDH (forward, 5'-catggagaaggctggggctc-3'; reverse,
5'-cactgacacgttggcagtgg-3'). Amplified products were analyzed by
1.5% agarose gel electrophoresis and visualized by ethidium bromide
staining. Semiquantitative analysis of transcript abundance was
assessed relative to GAPDH expression using ImageQant software
(Molecular Dynamics, Sunnyvale, Calif.).
Generation of Transduced BMSSC Lines.
[0231] Retroviral expression constructs were generated with the
retroviral vector pLNCX2 (Clontech Laboratories, Palo Alto, Calif.)
encoding the full-length human SDF-1 cDNA amplified using the PCR
forward (5'-aataactcgagacccgcgctcgtccgcc-3') and reverse
(5'-aattaagcggccgctggactcctactgtaaggg-3') primer set (underlined),
constructed with XhoI and NotI (bold) restriction sites,
respectively. The packaging cell line PT67 was transfected with
either the SDF-1-containing constructs or pLNCX2 vector alone using
Fugene-6-reagent (Boehringer Mannheim, Mannheim, Germany), then
selected with 800 .mu.g/mL G418 (Sigma, Castle Hill, NSW,
Australia). Harvested supernatant containing infectious particles
from stable PT67 lines was used to transduce cultured BMSSCs in the
presence of 5 .mu.g/mL polybrene (Sigma). Stable
multicolony-derived BMSSCs expressing high levels of SDF-1.alpha.
and control cell lines were established following selection with
800 .mu.g/mL G418. Secreted SDF-1.alpha. concentrations were
measured from supernatant filtered through a 0.2 .mu.m filter using
a standard SDF-1 enzyme-linked immunosorbent assay (ELISA) kit
according to the manufacturer's specifications (R&D Systems,
Minneapolis, Minn.).
Construction of a BMSSC cDNA Subtraction Hybridization Library.
[0232] In preliminary studies, STRO-1dull-expressing marrow cells
(glycophorin-A+ nucleated red cells) and STRO-1bright-expressing
cells (CFU-F population) were isolated by the MACS/FACS procedure
as described in "Purification of BMSSCs." Total RNA was prepared
from STRO-1bright and STRO-1dull cells pooled from 5 different
marrow samples (2 men and 3 women, aged 19-32 years) using the RNA
STAT-60 system (TEL-TEST). First-strand synthesize was performed
using the SMART cDNA synthesis kit (Clontech Laboratories). The
resultant mRNA/single-stranded cDNA hybrid was amplified by
long-distance PCR (Advantage 2 PCR kit; Clontech) using specific
primer sites at the 3' and 5' prime ends formed during the initial
RT process according to the manufacturer's specifications.
Following RsaI digestion of the STRO-1bright cDNA, 2 aliquots were
used to ligate different specific adaptor oligonucleotides using
the Clontech PCR-Select cDNA Subtraction Kit. Two rounds of
subtractive hybridization were performed using STRO-1bright
(tester) and STRO-1dull (driver) cDNA, and vice versa, according to
the manufacturer's protocol. This procedure was also performed in
reverse using STRO-1dull tester cDNA hybridized against
STRO-1bright driver cDNA.
Differential Screening of BMSSC Subtraction Library.
[0233] To identify genes uniquely expressed by STRO-1bright BMSSC
population, STRO-1bright-subtracted cDNA was ligated into a T/A
cloning vector (AdvaTAge PCR cloning kit; Clontech) then
transformed into DH5.alpha. Escherichia coli. Two hundred randomly
selected, ampicillin-resistant bacterial clones were amplified by
PCR using the Clontech PCR-Select Differential Screening Kit
according to the manufacturer's specifications. Briefly, the cDNA
was used to construct replicate low-density microarray filters
(zeta-probe GT membranes; BioRad, Hercules, Calif.) using a BRL
Hybri-dot 96-well format manifold vacuum system as recommended by
the manufacturer. Subtracted STRO-1bright and subtracted STRO-1dull
cDNA were denatured at 95.degree. C. then labeled with 50 .mu.Ci
(1.85 MBq) .alpha.-[32P] dCTP (3000 Ci [1.85 MBq]/mmol; ICN
Radiochemicals, Irvine, Calif.) using Klenow enzyme (exo-; 5 U) for
40 minutes at 37.degree. C. The DNA probes were hybridized to
replicate filters overnight at 72.degree. C., using Clontech
Express Hyb. The filters were washed 4 times with 2.times.standard
saline citrate (SSC)/0.5% sodium dodecyl sulfate (SDS) and 2 times
with 0.2.times.SSC/0.5% SDS at 68.degree. C., then screened using a
PhosphoImager and analyzed using ImageQuant software (Molecular
Dynamics).
Differentiation of CFU-F In Vitro.
[0234] We have previously reported the conditions for the induction
of human BM stromal cells to develop a mineralized bone matrix in
vitro cultured in .alpha.-MEM supplemented with 10% FCS, 100 .mu.M
L-ascorbate-2-phosphate, dexamethasone 10.sup.-7 M, and 3 mM
inorganic phosphate (Gronthos et al., Blood. 84: 4164-4173,
1994).
Ectopic Bone Formation Assay.
[0235] The adherent cells derived from STRO-1bright-sorted bone
marrow mononuclear cells at passage 2 to 3 were trypsinized, mixed
with 40 mg hydroxyapatite/tricalcium phosphate ceramic particles
(Zimmer, Warsaw, Ind.) and then implanted into subcutaneous pockets
on the dorsal surface of 8-week-old nonobese diabetic/severe
combined immunodeficient (NOD/SCID) mice as described previously
(Gronthos et al. J Cell Sci. 116: 1827-1835, 2003). These
procedures were performed in accordance to specifications of an
approved animal protocol (The University Adelaide AEC no.
M29/2002). Implants were recovered after 8 weeks, fixed in 4%
paraformaldehyde for 2 days, and then decalcified for a further 10
days in 10% EDTA prior to embedding in paraffin. Each transplant
was cut into 2 pieces, then placed cut-surface down for paraffin
embedding. For histologic analysis, 5-.mu.m sections of the
implants were prepared and stained with hematoxylin and eosin
(H&E) representative of the middle and either end of each
transplant approximately 3 to 4 mm in length. The amount of new
bone formation was calculated as a percentage of the total surface
area present in 12 tissue sections. Measurement of new bone
formation was assessed using Scion Imaging Software (Frederick,
Md.) as previously described (Shi et al. Nat. Biotechnol. 20:
587-591, 2002).
Statistics.
[0236] The Student t test was used for pairwise comparisons as
indicated. Statistical significance was given at P less than 0.05.
One-way analysis of variance (ANOVA) was used for multiple
comparisons as indicated. Statistical significance between the
groups was determined using the Fisher projected least significance
difference test at P less than 0.05.
Example 1
Stro-1.sup.dim Cultured Cells are More Committed while
Stro-1.sup.bri Cells are Less Committed Precursor Cells
[0237] We have previously reported that multipotential mesenchymal
precursor cells (MPC) can be purified from adult human bone marrow
mononuclear cells based on the phenotype STRO-1.sup.bri/VCAM-1
(CD106).sup.+ or STRO-1.sup.bri/MUC-18 (CD146).sup.+ (Gronthos et
al. J. Cell Sci 116:1827-1835, 2003; Shi and Gronthos JBMR 18(4):
696-704, 2003; PCTAU2004/000416). The MPC population can be readily
expanded in vitro under defined culture conditions (Gronthos et al.
J. Cell Sci 116:1827-1835, 2003). We now present data
characterising the ex vivo expanded MPC progeny based on markers
associated with different cell lineages, at both the mRNA and
protein level, using reverse transcription-polymerase chain
reaction (RT-PCR) and flow cytometric analysis, respectively.
Whilst, all freshly isolated bone marrow MPC express STRO-1 at high
levels (Stro-1.sup.bri), the majority of cells down regulate STRO-1
expression (Stro-1.sup.dim) following ex vivo expansion (Gronthos
et al. J. Cell Sci 116:1827-1835, 2003). In the first series of
experiments, semi-quantitative RT-PCR analysis was employed to
examine the gene expression profile of various lineage-associated
genes expressed by STRO-1.sup.dim or STRO-1.sup.bri populations,
isolated by fluorescence activated cell sorting (FIG. 1A). Relative
gene expression for each cell marker was assessed with reference to
the expression of the house-keeping gene, GAPDH, using ImageQant
software (FIG. 1B, C). In addition, dual-colour flow cytometric
analysis was used to examine the protein expression profile of ex
vivo expanded MPC based on their expression of a wider range of
cell lineage-associated markers in combination with the STRO-1
antibody (FIG. 2). A summary of the general phenotype based on the
gene and protein expression of STRO-1.sup.dim and STRO-1.sup.bri
cultured cells is presented in Table 3. The data indicate that ex
vivo expanded STRO-1.sup.bri MPC exhibit differentially higher
expression of markers associated with perivascular cells, including
angiopoietin-1, VCAM-1, SDF-1, IL-1.sub..beta., TNF.alpha., and
RANKL. Conversely, STRO-1.sup.dim ex vivo expanded cells expressed
higher levels of nestin, GFAP, osterix, osteocalcin, SOX9, GATA-4,
leptin, and smooth muscle myosin heavy chain. It therefore appears
that ex vivo expanded STRO-1.sup.bri MPC exhibit a more immature
and perivascular-like phenotype in comparison to STRO-1.sup.dim
cells which exhibit a phenotype characteristic of more committed
precursor cell types including chondroblasts, osteoblasts,
adipoblasts, epithelial cells, neural progenitors and
cardiomyoblasts. Comparisons between the protein and gene
expression profiles of STRO-1.sup.dim and STRO-1.sup.bri cultured
cells are summarised in Tables 3 and 4.
Example 2
Differential Capacity of STRO-1.sup.dim and STRO-1.sup.bri Cultured
Cells to Differentiate In Vitro
[0238] We next examined whether the observed differences in the
gene and protein expression profiles of STRO-1.sup.dim and
STRO-1.sup.bri cultured cells was reflective of any functional
differences in their capacity to differentiate into multiple cell
lineages. Cultures of ex vivo expanded STRO-1.sup.bri/CD146.sup.+
derived cells were isolated by FACS based on their expression of
STRO-1 antigen as described above. FACS isolated STRO-1.sup.dim and
STRO-1.sup.bri cultured cells were subsequently plated under
inductive conditions for fat (FIG. 3), bone (FIG. 4) and cartilage
(FIG. 5) formation. In all cases STRO-1.sup.bri cultured cells
showed a higher capacity to form fat, bone and cartilage under the
specified conditions when compared with STRO-1.sup.dim cultured
cells. The data from these experiments, substantiate the gene and
protein expression results obtained above, demonstrating that
STRO-1.sup.bri cultured cells are a primitive population containing
a high proportion of less committed precursor cells that can be
influenced to differentiate towards any specified cell lineage
under the appropriate culture conditions (FIGS. 3, 4, 5) and may be
referred to as MPC. Conversely, the STRO-1.sup.dim cultured cells
contain a high proportion of committed cells representative of
various lineages and may be referred to as TSCC. It is proposed
that the Stro-1.sup.dim population is heterogenous comprising cells
separately committed to range of different tissue types.
Example 3
STRO-1.sup.bri Cells can Modify the Growth Potential of Tissue
Specific Committed Cells In Vitro and In Vivo
[0239] The identification of the two different ex vivo expanded MPC
derived cell populations representative of different developmental
stages has significant implications in the use of whole cultured
preparations derived from Stro-1.sup.bri cells for clinical
therapies. Initial studies were design to examine the influence of
primitive, less committed STRO-1.sup.bri cultured MPC on the growth
of more mature and committed STRO-1.sup.dim cultured TSCC.
Experiments were designed to add increasing percentages of FACS
isolated STRO-1.sup.bri cultured MPC with FACS isolated
STRO-1.sup.dim cultured TSCC, previously labelled with a
fluorescent tag, CFSE. FIG. 6 shows that the proliferation of
labelled STRO-1.sup.dim cells is effected by the presence of
unlabelled STRO-1.sup.bri cells. When a CFSE labelled cell divides
the two daughter cells contain half the fluorescence of the
parental cell. Therefore, different generations of daughter cells
are represented as fluorescent distributions with proportionate
ever decreasing fluorescence intensity, where the curve on the far
right of the histogram (intersected by vertical line) represents
the point of the initial STRO-1.sup.dim population (FIG. 6). The
data demonstrated that a higher proportion of STRO-1.sup.dim cells
were stimulated to increase their proliferation rates, where more
cells were shown to be undergoing at least 3 to 4 divisions,
following the addition of greater than 5% STRO-1.sup.bri cells.
Therefore, it follows that in order to get a sustainable and
efficient ex vivo expansion of unfractionated MPC derived cells the
cultures require the presence of greater than 5% of STRO-1.sup.bri
cells within the population.
[0240] Further investigations were performed to determine whether
more primitive, less committed STRO-1.sup.bri cultured MPC could
also influence the proliferation capacity of TSCC in vivo. Two in
vivo models were used to address this question. The first model
employed athymic nude rats that had undergone ligation of the left
anterior descending (LAD) coronary artery and injected 48 hours
later with saline, FACS isolated cultured human STRO-1.sup.dim and
STRO-1.sup.bri cells and fresh aspirates of STRO-1 depleted bone
marrow mononuclear cells (FIG. 7). After two weeks animals were
sacrificed, and cardiac tissues were fixed and concomitantly
stained with two monoclonal antibodies: the first being selectively
reactive with the rat, but not the human, Ki67 antigen, and the
second being reactive with the cardiomyocyte marker troponin I.
Dually stained cells, indicative of proliferating rat
cardiomyocytes, were detected by immunoperoxidase technique.
Animals receiving STRO-1.sup.bri human cells demonstrated 2.5-5
fold higher numbers of proliferating rat cardiomyocytes compared
with control animals receiving saline or STRO-1.sup.dim human cells
(FIG. 7).
[0241] The second model utilized athymic nude rats injected
subcutaneously with rat glioblastoma tumor cells, which
constitutively secrete VEGF. Two weeks later, the rats received
intratumor injections with either saline, FACS isolated human
STRO-1.sup.dim or STRO-1.sup.bri human cells (FIG. 8). One week
later, animals were sacrificed, and tumor tissues were fixed and
concomitantly stained with two monoclonal antibodies: the first
being reactive with the alpha-smooth muscle actin antigen expressed
by smooth muscle cells, and the second being reactive with the vWF
antigen expressed by vascular endothelial cells. Dually stained
structures, indicative of arterioles and arteries containing both
endothelium and smooth muscle, were detected by immunoperoxidase
technique. Animals receiving STRO-1.sup.bri human cells
demonstrated 3.5-8 fold higher numbers of arterioles and arteries
at the site of cellular injection in the tumors compared with
control animals receiving saline or STRO-1.sup.dim human cells
(FIG. 8). No differences were seen at sites distal to where the
human cells had been injected.
Example 4
Increase in the Number of STRO-1.sup.bri MPC in Cell Cultures
Derived from STRO-1 Positive Cells
[0242] After demonstrating the capacity of STRO-1.sup.bri cultured
MPC to increase the proliferation of more TSCC we next examined the
effect of a range of growth factors to increase the proportion of
ex vivo expanded STRO-1.sup.bri MPC (FIG. 9). Established cultures
derived from STRO-1.sup.bri/CD146.sup.+ isolated bone marrow cells
were grown in basal medium supplemented with 10% FCS (A) or a range
of factors, including 1.times.10.sup.-8M
1.alpha.,25-dihydroxyvitamin D.sub.3 (1,25D) (B) 10 ng/ml Platelet
derived growth factor (PDGF) (C), 10 ng/ml Tumor necrosis
factor-alpha (TNF-.alpha.) (D); 10 ng/ml interleukin-1.beta.
(IL-1.beta.) (E) and 30 ng/ml stromal derived factor 1-alpha
(SDF-1.alpha.) (F), for 5 days, stained with STRO-1 mAb. (FIG. 9).
These factors were found to greatly enhance the number of number of
STRO-1.sup.bri MPC in vitro.
[0243] To investigate the mechanisms of how these factors enhanced
the percentage of STRO-1.sup.bri expressing cells following ex vivo
expansion, cultured Stro-1.sup.bri were labelled with CFSE as
described in the method then exposed to the various factors. FIG.
10 shows a representative experiment, where IL-1.beta. increased
the proliferative potential of MPC labelled with CFSE as described
in the methods. Cells were cultured in the presence of 10 ng/ml
IL-1.beta. for 5 days, stained with STRO-1 mAb and analysed as
described above. IL-1.beta. was found to enhance the number of MPC
divisions by increasing the number of bright STRO-1.sup.+
osteoprogenitor cells. Similar results were also obtained 1,25D,
PDGF-BB, TNF-.alpha., IL-1.beta., and SDF-1.alpha. were used to
stimulate MPCs.
Example 5
Increasing Proliferation of Stro-1.sup.bri Cells Also Increases the
Number of Stro-1.sup.dim Cells
[0244] The ability to enhance the proportion of STRO-1.sup.bri
cultured MPC in the presence of various factors also correlated
with an increase in the number of Stro-1.sup.dim cells. For example
STRO-1.sup.bri/Alk Phos.sup.+ cells (FIG. 10B) a phenotype
consistent with pre-osteoblastic cells (Gronthos et al., J Bone
Miner Res. 14: 47-56, 1999; Pan et al., Bone 34(1):112-23, 2004).
We therefore examined whether this change in phenotype also
correlated with an increased capacity of the induced STRO-1.sup.bri
MPC to differentiate into bone forming cells, osteoblasts. FIG. 11
shows that IL-1.beta. not only stimulated STRO-1 positive MPC
proliferation, but also enhanced their bone forming potential in
the presence of the osteoinductive agent, dexamethasone. IL-1.beta.
at concentration 0.01 ng/ml significantly increased MPC number to
136.6.+-.1.2% of untreated control cultures (FIG. 11A). A plateau
effect was achieved at concentrations greater than 0.1 ng/ml. Ex
vivo expanded progeny of MPC were seeded into 24-well plates in the
presence of osteoinductive conditions, as described in the methods.
The cells were also treated with IL-1.beta. at a concentration 10
ng/ml and cultures were "fed" weekly with fresh medium containing
IL-1.beta.. The absolute extracellular matrix calcium concentration
was determined according to the methods. The results showed that
mineral deposition was increased in cells treated with IL-1.beta.
(FIG. 11C) compared to untreated cells (FIG. 11B). The calcium
level in IL-1.beta. treated cells was significantly higher than
that in untreated cells at both week 4 and week 6.
[0245] Data presented in FIG. 12 suggests that IL-1.beta.
stimulated the proliferation and STRO-1.sup.Bri MPC, resulting in
an expansion of oetoprogenitors, whilst later addition of a
secondary differentiation agent, dexamethasone, induced alkaline
phosphatase (ALP) expression and loss of STRO-1 expression
effectively enhancing the number of functional osteoblasts in
vitro. The concept that, different factors can expand and regulate
the STRO-1.sup.Bri MPC population was further tested in vivo.
Semi-confluent secondary cultures of ex vivo expanded from
Stro-1.sup.bri MPC, were cultured in the presence or absence of
PDGF-BB (10 ng/ml) an additional factor known to enhance the number
of ex vivo expanded STRO-1.sup.Bri MPC (please refer to FIG. 9C).
PDGF-induced and non-induced cell preparations were subsequently
co-transplanted with hydroxyapetite/tricalcium phosphate particles
(HA/TCP) into immunocompromised mice as described in the methods.
After eight weeks, examination of the harvested transplants showed
that cultures pre-treated with PDGF-BB exhibited significantly more
ectopic bone formation (FIG. 13C) when compared with untreated
control cultures (FIG. 13B) as quantitated by Scion Imaging (FIG.
13A).
Example 6
Purified Human BMSSCs Express High Levels of SDF-1
[0246] Subtractive hybridization has previously been used to
increase the frequency of differentially expressed genes in rare
cell populations (Xu et al., Cancer Res. 60: 1677-1682, 2000;
Kingsley et al., Dev Growth Differ. 43: 133-143, 2001). In the
present study, STRO-1.sup.dull (glycophorin-A.sup.+ nucleated red
cells) and the minor fraction of STRO-1.sup.bright-expressing
marrow cells (which includes all colony-forming BMSSCs) were
isolated, using a combined MACS/FACS procedure as previously
described (Gronthos et al. J Cell Sci. 116: 1827-1835, 2003) (FIG.
14A). For each sorted STRO-1 population, total RNA was prepared
from 5 individual bone marrow donors and pooled. Following
first-strand synthesis, STRO-1.sup.bright and STRO-1.sup.dull cDNA
was subjected to a series of subtractive hybridization steps as
described in "Materials and methods." To identify genes uniquely
expressed by STRO-1.sup.bright BMSSC population,
STRO-1.sup.bright-subtracted cDNA was used to construct replicate
low-density microarray filters comprising 200 randomly selected
bacterial clones transformed with the STRO-1.sup.bright subtracted
cDNAs ligated into a T/A cloning vector. The microarrays were
subsequently probed with either [.sup.32P] dCTP-labeled
STRO-1.sup.bright or STRO-1.sup.dull subtracted cDNA (FIG. 14B-C).
Differential screening identified a total of 44 clones, which were
highly differentially expressed between the STRO-1.sup.dull and
STRO-1.sup.bright subpopulations. DNA sequencing of all the
differentially expressed clones revealed that only 1 clone was
representative of a known stromal cell mitogen; namely,
platelet-derived growth factor (PDGF) (Gronthos and Simmons, Blood.
85: 929-940, 1995). Interestingly, 6 of the 44 clones were found to
contain DNA inserts corresponding to the chemokine, stromal-derived
factor-1 (SDF-1). The high abundance of SDF-1 transcripts in human
BMSSCs was confirmed by semiquantitative RT-PCR of total RNA
prepared from freshly sorted STRO-1.sup.bright, STRO-1.sup.dull,
and STRO-1.sup.negative bone marrow subpopulations (FIG. 14D).
Example 7
SDF-1 is Preferentially Expressed by Immature Stromal Populations
In Vitro
[0247] We next examined whether the expression of SDF-1 was
correlated to the developmental stage of BMSSCs in vitro. SDF-1
expression levels were assessed in different stromal populations by
using an established in vitro model of osteogenic differentiation,
based on the cell surface expression of STRO-1 and alkaline
phosphatase (AP) (Gronthos et al., J Bone Miner Res. 14: 47-56,
1999; Stewart et al., J Bone Miner Res. 14: 1345-1356, 1999; Pan et
al., Bone. 34(1):112-23, 2004). Dual-color FACS was used to
partition the different BMSSC STRO-1/AP subfractions according to
the sorting regions (R1-R4) depicted in FIG. 15A. Each STRO-1/AP
subfraction was double sorted to obtain more than 99.9% purity.
Semiquantative RT-PCR examining SDF-1 expression was subsequently
performed on total RNA isolated from each STRO-1/AP sorted
population. The analysis revealed that the most immature stromal
population STRO-1.sup.+/AP.sup.- (osteoprogenitors) followed by
STRO-1.sup.+/AP.sup.+ (preosteoblasts) expressed higher levels of
SDF-1 in comparison to the most mature cell populations,
STRO-1.sup.-/AP.sup.+ (osteoblasts) and STRO-1.sup.-/AP.sup.-
(osteocytes, bone lining cells) when normalized to the housekeeping
gene GAPDH (FIG. 15B).
[0248] In parallel experiments, secondary cultures of BMSSCs,
supplemented with osteogenic inductive media (supplemented with
L-ascorbate-2-phosphate, dexamethasone, and inorganic phosphate),
demonstrated a decrease in SDF-1 expression in a time-dependent
manner (FIG. 16A). The data revealed that lower levels of SDF-1
expression were correlated with a higher proportion of
preosteoblast-like cells (STRO-1.sup.+/AP.sup.+), following 48
hours of stimulation with osteogenic induction medium (FIG.
16B).
Example 8
BMSSCs Express the SDF-1 Receptor, CXCR4
[0249] To determine whether SDF-1 could act as an autocrine factor,
preliminary experiments using RT-PCR analysis confirmed that BMSSCs
did in fact express the SDF-1 receptor, CXCR4 (FIG. 17A).
Examination of CXCR4 expression by normal cultured BMSSCs and the
human osteosarcoma cell line, MG63, revealed varying expression of
the expected 568 base pair PCR product and a second, larger band.
DNA sequence analysis confirmed the lower band as corresponding to
the normal human CXCR4 isoform, while the larger band corresponded
to a previously reported alternative splice variation (Gupta and
Pillarisetti, J. Immunol. 163: 2368-2372, 1999). BMSSCs were also
shown to constitutively express low levels of CXCR4 protein at the
cell surface as shown by flow cytometric analysis (FIG. 17B).
Calcium mobilization studies were carried out to determine whether
CXCR4 expressed by BMSSCs were functionally active. FURA-2-loaded
BMSSCs were challenged with 30 ng/mL recombinant human SDF-1.alpha.
(rhSDF-1.alpha.), resulting in a rapid and robust increase in
intracellular calcium levels characteristic of SDF-1/CXCR4
signaling (FIG. 17C).
Example 9
Overexpression of SDF-1 Enhances the Potential of BMSSCs to Form
Ectopic Bone In Vivo
[0250] To determine whether SDF-1 had any functional role in
stromal cell development, retroviral expression constructs
containing the full-length human SDF-1 cDNA were used to transfect
the packaging cell line PT67 as described in "Materials and
methods." Harvested supernatant containing infectious particles
were then used to generate stable, multicolony-derived BMSSC cell
lines expressing high levels of SDF-1.alpha. and corresponding
control cell lines transduced with empty pLNCX2 vector (FIG.
18A).
[0251] Cell lines derived from 3 individual bone marrow aspirates
were implanted into immunocompromised mice in combination with
hydroxyapatite/tricalcium phosphate particles, as described in
"Materials and methods." Scion Imaging analysis of histologic
sections from the harvested implants showed significantly greater
levels (P<0.05, t test) of ectopic bone formation per area in
those transplants containing high SDF-1-expressing BMSSC lines in
comparison to the vector controls (FIG. 18C).
[0252] Parallel studies were performed to identify potential
mechanisms of the observed SDF-1-mediated enhanced bone formation
capacity. Surprisingly, we failed to detect any statistical
difference in the capacity of high SDF-1-expressing BMSCs to form
mineralized deposits of hydroxyapatite in vitro above the vector
control cell lines (data not shown). Furthermore, we failed to
detect any consistent differences in the expression of various
bone-associated genes (BMP2, BMP4, CBFA1, osterix, osteocalcin,
alkaline phosphatase [AP]) between the high SDF-1-expressing and
matched vector control BMSSC lines (data not shown). Collectively,
these data suggested that SDF-1 imposed an indirect effect on bone
formation in vivo.
Example 10
SDF-1 Mediates BMSSC Growth and Survival
[0253] We next examined the possibility that overexpression of
SDF-1 may provide a growth or survival advantage to the transduced
BMSSCs. This notion was supported by proliferation studies
demonstrating that high SDF-1-expressing BMSSCs displayed a
moderate but not significant increase in their growth capacity
above that of the BMSSC vector control cell lines (FIG. 19A).
Furthermore, BMSSC lines overexpressing SDF-1 also exhibited a
greater resistance to the apoptosis-inducing effects of the
inflammatory cytokine, IL-4, previously shown to inhibit the growth
of BMSSCs in vitro (Gronthos and Simmons, Blood. 85: 929-940,
1995), as assessed by the trypan blue uptake method (FIG. 19B). In
accordance with these findings, living cultures of overexpressing
SDF-1 BMSSCs also showed decreased cell surface staining of the
early apoptosis marker, annexin V, when challenged with IL-4 (FIG.
19C-D).
[0254] Comparative experiments were subsequently performed to
determine the effects of exogenous SDF-1 on the growth of normal
BMSSCs. Purified STRO-1-positive bone marrow cells were cultured
under serum-deprived conditions, previously shown to enhance the
formation of the earliest identifiable mesenchymal precursor cells,
(CFU-F; fibroblastic colony-forming unit), in the presence of
PDGF-BB to levels comparable to serum-replete cultures (Gronthos et
al. J Cell Sci. 116: 1827-1835, 2003; Gronthos and Simmons, Blood.
85: 929-940, 1995). While exogenous rhSDF-1.alpha. showed no
inherent ability to stimulate colony production alone, an increase
in CFU-F number was observed in combination with PDGF-BB (FIG. 20).
Moreover, addition of the known potent CFU-F inhibitor,
.alpha.-interferon 2a (Gronthos and Simmons, Blood. 85: 929-940,
1995; Wang et al., Am J. Hematol. 40: 81-85. 1992) demonstrated a
typical decline in PDGF-BB-induced colony formation, which was
shown to be partially reversible in the presence of SDF-1. The
observed response in the presence of SDF-1 was found to be optimal
at 30 ng/mL over a concentration range 0.1 to 100 ng/mL (FIG. 21).
Collectively, these data suggest that SDF-1 plays a role in
promoting the self-renewal and survival capacity of BMSSCs.
Discussion
[0255] The present study demonstrates for the first time that the
earliest detectable BMSSCs isolated directly from human bone marrow
aspirates express high levels of SDF-1 prior to culture. We have
previously reported that multipotential BMSSCs are localized within
the bone marrow microenvironment among the perivascular cells of
large blood vessels (Shi and Gronthos, J Bone Miner Res. 18:
696-704, 2003). These observations correspond with the published
distribution pattern of SDF-1 in human bone marrow, where the
highest levels of SDF-1 are expressed by cells that surround blood
vessels, including periarterial regions and blood capillaries of
the bone, and by some bone marrow stromal cells near the endosteum
at sites of early myelopoiesis and B-lymphocyte development
(Ponomaryov et al., J Clin Invest. 106: 1331-1339, 2000; Petit et
al., Nat. Immunol. 3: 687-694, 2002; Salvucci et al., Blood 99:
2703-2711, 2002). Importantly, mature osteogenic cell populations
located at the bone surfaces, or osteocytes within the bone matrix,
appear to lack SDF-1 expression in situ (Ponomaryov et al., J Clin
Invest. 106: 1331-1339, 2000).
[0256] Previous work by Stewart et al (Stewart et al., J. Bone
Miner Res. 14: 1345-1356, 1999) and our laboratory (Gronthos et
al., J Bone Miner Res. 1999; 14: 47-56, 1999; Pan et al., Bone.
34(1):112-23, 2004) have shown that early preosteogenic cells exist
in normal stromal cultures that express the mesenchymal stem cell
marker, STRO-1, but lack the expression of the
osteoblast-associated marker, alkaline phosphatase. Progression of
these precursor cell populations toward a mature and functional
osteoblastic phenotype correlates to the loss of STRO-1 expression
and an acquisition of AP cell-surface expression (Gronthos et al.,
J Bone Miner Res. 1999; 14: 47-56, 1999; Stewart et al., J Bone
Miner Res. 14: 1345-1356, 1999). Using this in vitro model of
osteogenic cellular differentiation we have demonstrated that
cultured BMSSC cells, representative of committed osteogenic
populations, displayed decreased levels of SDF-1 when compared with
more immature STRO-1.sup.+ BMSSC fractions. Moreover, there was a
significant diminution of SDF-1 expression following treatment of
BMSSCs with osteogenic induction media, providing further evidence
that high SDF-1 expression is linked with a more primitive, less
committed stage of preosteogenic differentiation. Collectively, our
data suggest that SDF-1 may act to localize primitive uncommitted
BMSSC populations within their perivascular niche until required to
proliferate and differentiate in response to environmental cues
that may act to disrupt SDF-1/CXCR4 interactions.
[0257] While SDF-1 is thought to be critical in normal
hematopoiesis, inflammation, and the metastasis of various tumors,
little is known about the role of SDF-1 on the growth or
differentiation of BMSSCs.
[0258] SDF-1 mediates its effects through its receptor, CXCR4, a
transmembrane glycoprotein, belonging to the family of G
protein-coupled molecules, where CXCR4 also acts as the main
coreceptor for human immunodeficiency virus type-1 (Bleul et al.,
Nature 382: 829-833, 1996; Oberlin et al., Nature 382: 833-835,
1996; Ma et al., Proc Natl Acad Sci USA. 95: 9448-9453, 1998).
Interestingly, we observed 2 CXCR4 splice variants both in normal
cultured BMSSCs and the human osteosarcoma cell line, MG63. DNA
sequence analysis confirmed the smaller splice variant to
correspond to the normal human CXCR4 cDNA spanning exons 1 and 2,
the abundant form found in normal BMSSCs. In contrast, the larger
splice variant, found to be highly abundant in MG63 cells,
corresponded to a previously described alternative splice
variation, generated through the inclusion of transcribed DNA
sequence from the intersecting intron, resulting in the addition of
a further 9 amino acids (Gupta et al., J Immunol. 163: 2368-2372,
1999). Tissue distribution studies demonstrated that the smaller
transcript was the predominant CXCR4 isoform found in normal
tissues, while the larger transcript was highly expressed in
various leukemic and carcinoma cell lines (Gupta et al., J Immunol.
163: 2368-2372, 1999). While both splice variants are active, the
functional significance of the larger CXCR4 transcript has not yet
been determined but may relate to the importance of SDF-1/CXCR4 in
development as a mechanism to compensate for any errors that may
occur in CXCR4 splicing during embryonic development.
[0259] In the present study, we demonstrated that BMSSCs
constitutively expressed low cell-surface levels of functional
CXCR4 protein as shown by flow cytometric analysis and calcium
mobilization studies. Therefore, SDF-1/CXCR4 signaling may play a
critical role in regulating BMSSC growth and migration.
[0260] In the present study we also showed that the majority of ex
vivo-expanded BMSSCs begin to undergo partial osteogenic
differentiation, which correlated with a decrease in SDF-1
expression. This maturation appeared to enhance the susceptibility
of BMSSCs to factors that induce apoptosis. Our studies showed that
BMSSC lines overexpressing SDF-1 exhibited increased protection
against the apoptotic effects of IL-4, previously shown to inhibit
the growth of BMSSCs in vitro (Gronthos and Simmons, Blood. 85:
929-940, 1995). Similar experiments demonstrated that high
SDF-1-expressing BMSSC lines were more resistant to the induction
of early apoptosis in the presence of IL-4.
[0261] The present study confirmed the survival and growth
advantage conveyed by SDF-1 on the earliest identifiable
mesenchymal precursor cells, freshly isolated STRO-1.sup.bright
bone marrow cells that contain the CFU-F population. While
exogenous rhSDF-1.alpha. showed no inherent ability to stimulate
colony production alone, an increase in CFU-F number was observed
when added in combination with PDGF-BB. The varied effect of SDF-1
on the growth rates between different BMSSC populations may be due
to differences in the developmental stage of the freshly isolated
primitive BMSSCs versus more mature ex vivo-expanded stromal cells.
Therefore, PDGF and SDF-1 may act in synergy in promoting the
self-renewal and survival capacity of BMSSCs.
[0262] Any discussion of documents, acts, materials, devices,
articles or the like which has been included in the present
specification is solely for the purpose of providing a context for
the present invention. It is not to be taken as an admission that
any or all of these matters form part of the prior art base or were
common general knowledge in the field relevant to the present
invention as it existed before the priority date of each claim of
this application.
[0263] It will be appreciated by persons skilled in the art that
numerous variations and/or modifications may be made to the
invention as shown in the specific embodiments without departing
from the spirit or scope of the invention as broadly described. The
present embodiments are, therefore, to be considered in all
respects as illustrative and not restrictive.
TABLE-US-00001 TABLE 1 Antibodies used in this patent CELL TYPE
ANTIGEN SOURCE ISOTYPE DILUTION Skeletal Muscle Myo D Santa Cruz
Rabbit Ig 1/50 Desmin DAKO IgG1 10 ug/ml Smooth Muscle SMMHC Sigma
mIgG1 Acites 1/500 SMHC-FAST Sigma mIgG1 10 ug/ml alphaSMAC DAKO
mIgG2a 10 ug/ml PDGF-R Pharmigen mIgG 10 ug/ml Vimentin DAKO mIgG1
10 ug/ml Chondrocytes Type II Chemicon mIgG1 10 ug/ml Collagen
Collagen IX Chemicon mIgG2A 10 ug/ml Aggrecan Chemicon mIgG1 10
ug/ml Link Protein DSHB mouse IgG2b 10 ug/ml S-100 Chemicon rabbit
Ig 1/100 Biglycan Dr. Larry Fisher NIH RABBIT Ig 1/500 Basal
Fibroblasts Laminin Chemicon mIgG1 10 ug/ml Type IV DAKO mIgG1 10
ug/ml Collagen Versican DHSB 12C5 IgG1 10 ug/ml Endothelial Cells
vWF DAKO IgG1 mouse VCAM-1 Chemicon IgG1 6G10 10 ug/ml Endoglin BD
IgG1 10 ug/ml MUC18 In house CC9 IgG2a 10 ug/ml CD31 DAKO IgG 10
ug/ml CD34 DAKO mIgG1 10 ug/ml SDF-1 R&D IgG1 10 ug/ml
Cardiomyocytes calponin Chemicon IgG1 10 ug/ml Troponin I Accurate
Chem and Sci Corp IgG1 10 ug/ml Troponin C Chemicon mIgG2a 10 ug/ml
Neurons NCAM DAKO IgG2a 10 ug/ml GFAP DAKO mIgG1 10 ug/ml
Neuroanalase DAKO RABBIT Ig 1/200 Neurofilament DAKO IgG1 10 ug/ml
Bone AP DSHB mIgG1 10 ug/ml Type I CHEMICON mouse IgG 10 ug/ml
Collagen CBFA 1 Alpha Diagnostic RABBIT Ig 1/200 OCN Chemicon
RABBIT Ig 1/200 OPG R&D IgG2b 10 ug/ml RANKL R&D IgG2a 10
ug/ml Annexin II Santa Cruz RABBIT Ig 1/100 Fat CEPBalpha Santa
Cruz RABBIT Ig 1/200 PPARgamma Santa Cruz RABBIT Ig 1/200 Leptin
Chemicon IgG 10 ug/ml Epithelial Cells Keratin 14 DAKO mIgG 10
ug/ml Cytokeratin DAKO mIgG2a 10 ug/ml 10 + 13 EGFR Pharmingen mIgG
10 ug/ml Fibroblast Collagen III Chemicon mIgG1 10 ug/ml NGFR Santa
Cruz mIgG1 10 ug/ml Fibroblast SIGMA mIgG 10 ug/ml marker
Haematopoietic CD14 DAKO IgG2a 10 ug/ml CD45 DAKO IgG1 10 ug/ml
Glycophorin-A DAKO IgG 10 ug/ml
TABLE-US-00002 TABLE 2 RT-PCR primers and conditions for the
specific amplification of human mRNA Target Sense/Antisense (5'-3')
Product Gene Primer Sequences Size GAPDH CACTGACACGTTGGCAGTGG/ 417
CATGGAGAAGGCTGGGGCTC SDF-1 GAGACCCGCGCTCGTCCGCC/ 364
GCTGGACTCCTACTGTAAGGG IL-1.beta. AGGAAGATGCTGGTTCCCTCTC/ 151
CAGTTCAGTGATCGTACAGGTGC FLT-1 TCACTATGGAAGATCTGATTTCTTACAGT/ 380
GGTATAAATACACATGTGCTTCTAG TNF-.alpha. TCAGATCATCTTCTCGAACC/ 361
CAGATAGATGGGCTCATACC KDR TATAGATGGTGTAACCCGGA/ 450
TTTGTCACTGAGACAGCTTGG RANKL AACAGGCCTTTCAAGGAGCTG/ 538
TAAGGAGGGGTTGGAGACCTCG Leptin ATGCATTGGGAACCCTGTGC/ 492
GCACCCAGGGCTGAGGTCCA CBFA-1 GTGGACGAGGCAAGAGTTTCA/ 632
TGGCAGGTAGGTGTGGTAGTG PPAR.gamma.2 AACTGCGGGGAAACTTGGGAGATTCTCC/
341 AATAATAAGGTGGAGATGCAGGCTCC OCN ATGAGAGCCCTCACACTCCTC/ 289
CGTAGAAGCGCCGATAGGC MyoD AAGCGCCATCTCTTGAGGTA/ 270
GCGAGAAACGTGAACCTAGC SMMHC CTGGGCAACGTAGTAAAACC/ 150
TATAGCTCATTGCAGCCTCG GFAP CTGTTGCCAGAGATGGAGGTT/ 370
TCATCGCTCAGGAGGTCCTT Nestin GGCAGCGTTGGAACAGAGGTTGGA/ 460
CTCTAAACTGGAGTGGTCAGGGCT SOX9 CTCTGCCTGTTTGGACTTTGT/ 598
CCTTTGCTTGCCTTTTACCTC Collagen AGCCAGGGTTGCCAGGACCA/ 387 type X
TTTTCCCACTCCAGGAGGGC Aggrecan CACTGTTACCGCCACTTCCC/ 184
ACCAGCGGAAGTCCCCTTCG
TABLE-US-00003 TABLE 3 Summary of the Relative Gene Expression in
STRO-1.sup.Bri and STRO-1.sup.Dim populations. Gene Expression
relative to GAPDH Tissue Marker STRO-1.sup.Bri STRO-1.sup.Dim
Neurons GFAP (Glial Fibrillary 0.1 0.7 Acidic Protein) Bone OCN
(Osteocalcin) 1.1 2.5 OSX (Osterix) 0.4 1.3 CBFA-1 (Core Factor 0.3
0.6 Binding Protein-1) RANKL (Receptor 1.6 0.3 Activator of Nuclear
Factor .kappa. B) Fat Leptin 3.1 4.2 Cardiomyocytes GATA-4 1.1 2.9
Endothelial cells Ang-1 (Angiopoietin-1) 1.5 0.8 SDF-1-alpha
(Stromal 3.2 0.1 Derived factor-1-alpha) Chondrocytes Sox 9 0.3 1.1
COL X (Collagen X) 3.5 2.8 Pro- TNF-alpha (Tumour 1.7 0.9
inflammatory necrosis alpha) Cytokines A list of genes which
displayed measurable and differential expression between the
STRO-1.sup.Bri and STRO-1.sup.Dim populations as determined by
reverse transcription-PCR are presented. Values represent the
relative gene expression with reference to the house-keeping gene,
GAPDH.
TABLE-US-00004 TABLE 4 Summary of the Relative Protein Expression
in STRO-1.sup.Bri and STRO-1.sup.Dim populations. Mean Fluorescence
Intensity Tissue Marker STRO-1.sup.Bri STRO-1.sup.Dim Neurons
Neurofilament 1.7 20.5 Bone ALK PHOS 5.7 44.5 (Alkaline Phophatase)
RANKL (Receptor 658.5 31.0 Activator of Nuclear Factor .kappa. B)
Epithelial Cells CytoKeratin 10 + 13 1.2 23.3 Cytokeratin 14 1.8
8.8 Smooth Muscle .alpha.-SMA (Alpha 318.0 286.0 Smooth Muscle
Actin) Chondrocytes Byglycan 84.4 65.9 Basal Fibroblast Tenascin C
22.2 6.9 Cardiomyocyte Troponin C 2.5 15.0 A list of proteins which
displayed differential expression between the STRO-1.sup.Bri and
STRO-1.sup.Dim populations as determined by flow cytometry are
presented. Values represent the relative mean fluorescence
intensity of staining as described in FIG. 2.
Sequence CWU 1
1
3189PRTHomo sapiens 1Met Asn Ala Lys Val Val Val Val Leu Val Leu
Val Leu Thr Ala Leu1 5 10 15Cys Leu Ser Asp Gly Lys Pro Val Ser Leu
Ser Tyr Arg Cys Pro Cys 20 25 30Arg Phe Phe Glu Ser His Val Ala Arg
Ala Asn Val Lys His Leu Lys 35 40 45Ile Leu Asn Thr Pro Asn Cys Ala
Leu Gln Ile Val Ala Arg Leu Lys 50 55 60Asn Asn Asn Arg Gln Val Cys
Ile Asp Pro Lys Leu Lys Trp Ile Gln65 70 75 80Glu Tyr Leu Glu Lys
Ala Leu Asn Lys 85293PRTHomo sapiens 2Met Asn Ala Lys Val Val Val
Val Leu Val Leu Val Leu Thr Ala Leu1 5 10 15Cys Leu Ser Asp Gly Lys
Pro Val Ser Leu Ser Tyr Arg Cys Pro Cys 20 25 30Arg Phe Phe Glu Ser
His Val Ala Arg Ala Asn Val Lys His Leu Lys 35 40 45Ile Leu Asn Thr
Pro Asn Cys Ala Leu Gln Ile Val Ala Arg Leu Lys 50 55 60Asn Asn Asn
Arg Gln Val Cys Ile Asp Pro Lys Leu Lys Trp Ile Gln65 70 75 80Glu
Tyr Leu Glu Lys Ala Leu Asn Lys Arg Phe Lys Met 85 903352PRTHomo
sapiens 3Met Glu Gly Ile Ser Ile Tyr Thr Ser Asp Asn Tyr Thr Glu
Glu Met1 5 10 15Gly Ser Gly Asp Tyr Asp Ser Met Lys Glu Pro Cys Phe
Arg Glu Glu 20 25 30Asn Ala Asn Phe Asn Lys Ile Phe Leu Pro Thr Ile
Tyr Ser Ile Ile 35 40 45Phe Leu Thr Gly Ile Val Gly Asn Gly Leu Val
Ile Leu Val Met Gly 50 55 60Tyr Gln Lys Lys Leu Arg Ser Met Thr Asp
Lys Tyr Arg Leu His Leu65 70 75 80Ser Val Ala Asp Leu Leu Phe Val
Ile Thr Leu Pro Phe Trp Ala Val 85 90 95Asp Ala Val Ala Asn Trp Tyr
Phe Gly Asn Phe Leu Cys Lys Ala Val 100 105 110His Val Ile Tyr Thr
Val Asn Leu Tyr Ser Ser Val Leu Ile Leu Ala 115 120 125Phe Ile Ser
Leu Asp Arg Tyr Leu Ala Ile Val His Ala Thr Asn Ser 130 135 140Gln
Arg Pro Arg Lys Leu Leu Ala Glu Lys Val Val Tyr Val Gly Val145 150
155 160Trp Ile Pro Ala Leu Leu Leu Thr Ile Pro Asp Phe Ile Phe Ala
Asn 165 170 175Val Ser Glu Ala Asp Asp Arg Tyr Ile Cys Asp Arg Phe
Tyr Pro Asn 180 185 190Asp Leu Trp Val Val Val Phe Gln Phe Gln His
Ile Met Val Gly Leu 195 200 205Ile Leu Pro Gly Ile Val Ile Leu Ser
Cys Tyr Cys Ile Ile Ile Ser 210 215 220Lys Leu Ser His Ser Lys Gly
His Gln Lys Arg Lys Ala Leu Lys Thr225 230 235 240Thr Val Ile Leu
Ile Leu Ala Phe Phe Ala Cys Trp Leu Pro Tyr Tyr 245 250 255Ile Gly
Ile Ser Ile Asp Ser Phe Ile Leu Leu Glu Ile Ile Lys Gln 260 265
270Gly Cys Glu Phe Glu Asn Thr Val His Lys Trp Ile Ser Ile Thr Glu
275 280 285Ala Leu Ala Phe Phe His Cys Cys Leu Asn Pro Ile Leu Tyr
Ala Phe 290 295 300Leu Gly Ala Lys Phe Lys Thr Ser Ala Gln His Ala
Leu Thr Ser Val305 310 315 320Ser Arg Gly Ser Ser Leu Lys Ile Leu
Ser Lys Gly Lys Arg Gly Gly 325 330 335His Ser Ser Val Ser Thr Glu
Ser Glu Ser Ser Ser Phe His Ser Ser 340 345 350
* * * * *