U.S. patent application number 11/888502 was filed with the patent office on 2009-01-15 for methods and systems for detecting and/or sorting targets.
Invention is credited to Ryan C. Bailey, Rong Fan, James R. Heath, Gabriel A. Kwong.
Application Number | 20090017455 11/888502 |
Document ID | / |
Family ID | 38997476 |
Filed Date | 2009-01-15 |
United States Patent
Application |
20090017455 |
Kind Code |
A1 |
Kwong; Gabriel A. ; et
al. |
January 15, 2009 |
Methods and systems for detecting and/or sorting targets
Abstract
Provided herein are methods and systems for detecting and/or
sorting targets in a sample based on the combined use of
polynucleotide-encoded-protein and substrate polynucleotides. The
polynucleotide-encoded protein is comprised of a protein that
specifically binds to a predetermined target and of an encoding
polynucleotide that specifically binds to a substrate
polynucleotide, wherein the substrate polynucleotide is attached to
a substrate.
Inventors: |
Kwong; Gabriel A.;
(Alhambra, CA) ; Bailey; Ryan C.; (Urbana, IL)
; Fan; Rong; (Pasadena, CA) ; Heath; James R.;
(South Pasadena, CA) |
Correspondence
Address: |
Steinfl & Bruno
301 N Lake Ave Ste 810
Pasadena
CA
91101
US
|
Family ID: |
38997476 |
Appl. No.: |
11/888502 |
Filed: |
August 1, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60834823 |
Aug 2, 2006 |
|
|
|
60959665 |
Jul 16, 2007 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6834 20130101;
C12Q 1/6834 20130101; G01N 33/6845 20130101; C12Q 2563/131
20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT OF GOVERNMENT GRANT
[0002] The U.S. Government has certain rights in this disclosure
pursuant to Grant No. CA119347 awarded by the National Cancer
Institute at Frederick and pursuant to Grant No.
DAAD19-03-D-0004/0008 and Grant No. 5U54CA119347 awarded by ARO-US
Army Robert Morris Acquisition Center.
Claims
1. A method to detect a target in a sample, the method comprising
combining a substrate polynucleotide attached to a substrate with a
polynucleotide-encoded protein, the polynucleotide-encoded protein
comprising a protein and an encoding polynucleotide attached to the
protein, wherein the protein specifically binds to the target and
the encoding polynucleotide specifically binds to the substrate
polynucleotide; and detecting a polynucleotide-encoded
protein-target complex bound to the substrate polynucleotide
attached to the substrate.
2. The method of claim 1, wherein combining a substrate
polynucleotide attached to a substrate with a
polynucleotide-encoded protein is performed by providing a
substrate polynucleotide attached to a substrate; providing a
polynucleotide-encoded protein comprising a protein and an encoding
polynucleotide attached to the protein, wherein the protein
specifically binds to the target and the encoding-polynucleotide
specifically binds to the substrate polynucleotide; and contacting
the polynucleotide-encoded protein with the sample and with the
substrate for a time and under conditions to allow binding of the
polynucleotide-encoded protein with the target in a
polynucleotide-encoded protein-target complex; and binding of the
encoding polynucleotide with the substrate polynucleotide.
3. The method of claim 2, wherein contacting the
polynucleotide-encoded protein with the sample and with the
substrate is performed by contacting the polynucleotide-encoded
protein with the sample for a time and under conditions to allow
binding of the polynucleotide-encoded protein with the target in a
polynucleotide-encoded-protein-target complex; and contacting the
polynucleotide-encoded protein-target complex with the substrate
for a time and under conditions to allow binding the
encoding-polynucleotide with the substrate polynucleotide.
4. The method of claim 2, wherein contacting the
polynucleotide-encoded protein with the sample and with the
substrate is performed by contacting the polynucleotide-encoded
protein with the substrate for a time and under conditions to allow
binding the encoding polynucleotide with the substrate
polynucleotide; and contacting the polynucleotide-encoded protein
with the sample for a time and under conditions to allow binding of
the polynucleotide-encoded protein in a polynucleotide-encoded
protein-target complex.
5. The method of claim 1, wherein detecting the
polynucleotide-encoded protein-target complex on the substrate is
performed by providing a labeled molecule comprising a molecule
that specifically binds to the target and a label compound attached
to the molecule, the label compound providing a labeling signal;
contacting the labeled molecule with the polynucleotide-encoded
protein-target complex for a time and under condition to allow
binding of the labeled molecule with the polynucleotide-encoded
protein-target complex; and detecting the labeling signal from the
labeled molecule bound to the polynucleotide-encoded protein-target
complex on the substrate.
6. The method of claim 5, wherein the label compound is a metal
nanoparticle.
7. The method of claim 1, wherein the
polynucleotide-encoded-protein is an antibody.
8. The method of claim 1, wherein the target is a plurality of
targets, and wherein combining a substrate polynucleotide attached
to a substrate with a polynucleotide-encoded protein is performed
by providing a plurality of substrate polynucleotides attached to a
substrate, each substrate polynucleotide being sequence specific
and positionally distinguishable from another; providing a
plurality of polynucleotide-encoded proteins, each
polynucleotide-encoded protein comprising a protein and an
encoding-polynucleotide attached to the protein, wherein the
protein specifically binds to a target of the plurality of targets
and the encoding-polynucleotide specifically binds to a sequence
specific and positionally distinguishable substrate polynucleotide
of the plurality of substrate polynucleotides, each protein and
encoding polynucleotide being bindingly distinguishable from
another; and contacting the plurality of polynucleotide-encoded
proteins with the sample and the plurality of substrate
polynucleotides for a time and under conditions to allow binding of
the proteins with the target molecules in a plurality of
polynucleotide-encoded protein-target complexes and binding of the
encoding polynucleotides to the substrate polynucleotides.
9. The method of claim 8, wherein detecting the plurality of
polynucleotide-encoded protein-target complexes on the substrate is
performed by providing a plurality of labeled molecules, each
labeled molecule comprising a molecule that specifically binds one
target of the plurality of targets and a label compound providing a
labeling signal, the label compound attached to a labeled molecule,
each labeled molecule detectably distinguishable from another;
contacting the plurality of labeled molecules with the plurality of
polynucleotide-encoded protein-target complexes for a time and
under condition to allow binding of the plurality of polynucleotide
encoded-target complexes with the plurality of labeled molecules;
and detecting the labeling signal from the plurality of labeled
molecules bound to the plurality of polynucleotide encoded-target
complexes on the substrate.
10. The method of claim 9, wherein the label compound is a metal
nanoparticle.
11. The method of claim 8, wherein the protein component of the
polynucleotide --encoded protein is an antibody.
12. The method of claim 1, wherein the target is a plurality of
targets, the targets comprising at least one target polynucleotide,
and wherein combining a substrate polynucleotide attached to a
substrate with a polynucleotide-encoded protein is performed by
providing a plurality of substrate polynucleotides attached to a
substrate, each substrate polynucleotide being sequence-specific
and positionally distinguishable from another; providing at least
one labeled polynucleotide that specifically binds to the at least
one target polynucleotide, each labeled polynucleotide being
bindingly distinguishable from another; contacting the at least one
labeled polynucleotide with the sample for a time and under
conditions to allow binding of the labeled polynucleotide with the
target polynucleotide to provide at least one labeled target
polynucleotide, wherein the at least one labeled target
polynucleotide is comprised of a sequence that specifically binds
to a sequence-specific and positionally distinguishable substrate
polynucleotide; providing at least one polynucleotide-encoded
protein comprising a protein and an encoding polynucleotide
attached to the protein, wherein the protein specifically binds to
a target of the plurality of the targets and the encoding
polynucleotide specifically binds to a sequence-specific and
positionally distinguishable substrate polynucleotide, each protein
and encoding polynucleotide being bindingly distinguishable from
another, each protein being bindingly distinguishable from each
labeled polynucleotide, each polynucleotide-encoded protein being
bindingly distinguishable from each labeled target polynucleotide;
contacting the at least one polynucleotide-encoded protein with the
sample for a time and under conditions to allow binding of the
protein with the target, in at least one polynucleotide-encoded
protein-target complex; and contacting the at least one labeled
target polynucleotide with the at least one polynucleotide-encoded
protein-target complex with the plurality of substrate
polynucleotides for a time and under conditions to allow binding of
the at least one labeled target polynucleotide with a corresponding
substrate polynucleotide and binding of the at least one encoding
polynucleotide with a corresponding substrate polynucleotide; the
method further comprising detecting the labeled target
polynucleotides bound to the plurality of spatially located
substrate polynucleotides on the substrate.
13. The method of claim 12, wherein detecting the
polynucleotide-encoded protein-target complexes on the substrate is
performed by providing a plurality of labeled proteins, each
labeled molecule comprising a molecule component that specifically
binds one target of the plurality of targets and a label compound
providing a labeling signal; the label compound attached to a
labeled molecule. contacting the plurality of labeled molecules
with the plurality of polynucleotide-encoded protein-target
complexes for a time and under condition to allow binding of the
plurality of polynucleotide encoded-target complexes with the
plurality of labeled molecules; and detecting the labeling signal
from the plurality of labeled proteins bound to the plurality of
polynucleotide encoded-target complexes on the substrate.
14. The method of claim 13, wherein the label compound is a metal
nanoparticle attached to the protein.
15. The method of claim 12, wherein the protein component of the
polynucleotide --encoded protein is an antibody.
16. A system for the detection of a target molecule in a sample,
the system comprising a substrate with a substrate polynucleotide
attached to the substrate; and a polynucleotide-encoded protein
comprising a protein and an encoding polynucleotide attached to the
protein, wherein the protein specifically binds a target and the
encoding-polynucleotide specifically binds to the substrate
polynucleotide.
17. The system of claim 16, the system further comprising a labeled
molecule comprising a molecule that specifically binds to the
target and a label compound attached to the protein, the label
compound providing a labeling signal.
18. The system of claim 16, wherein the target is a plurality of
targets, the system comprising, a substrate with a plurality of
substrate polynucleotides attached to the substrate, each
polynucleotide of the plurality of substrate polynucleotides
attached to the substrate being sequence specific and positionally
distinguishable from another; and a plurality of
polynucleotide-encoded proteins, each polynucleotide-encoded
protein comprising a protein and an encoding polynucleotide
attached to the protein, wherein the protein specifically binds to
a predetermined target of the plurality of targets and the encoding
polynucleotide specifically binds to a sequence-specific and
positionally distinguishable polynucleotide of the plurality of
polynucleotides attached to the substrate, each protein and
encoding polynucleotide being bindingly distinguishable from
another.
19. The system of claim 18, the system further comprising a
plurality of labeled molecules, each labeled molecule comprising a
molecule that specifically binds one target of the plurality of
targets and a label compound attached to the protein component, the
label compound providing a labeling signal, each labeled molecule
being detectably distinguishable from another.
20. The system of claim 16, wherein the target is a plurality of
targets, the plurality of targets comprising at least one target
polynucleotide, the system comprising a substrate with a plurality
of substrate polynucleotides attached to the substrate, each
substrate polynucleotide being sequence-specific and positionally
distinguishable from another; at least one labeled polynucleotide
that specifically binds to the at least one target polynucleotide,
each labeled polynucleotide bindingly distinguishable from another,
each labeled polynucleotide being for the production of a labeled
target polynucleotide that specifically binds to a
sequence-specific and positionally distinguishable substrate
polynucleotide of the plurality of spatially located substrate
polynucleotides; at least one polynucleotide-encoded protein
comprising a protein and an encoding polynucleotide attached to the
protein, wherein the protein specifically binds to a target of the
plurality of targets and the encoding polynucleotide-specifically
binds to a sequence-specific and positionally distinguishable
substrate polynucleotide, each protein and encoding polynucleotide
being bindingly distinguishable from another, each protein being
bindingly distinguishable from each labeled polynucleotide, each
polynucleotide-encoded protein being bindingly distinguishable from
each labeled target polynucleotide.
21. The system of claim 20, the system further comprising at least
one labeled molecule comprising a molecule that specifically binds
to the at least one target and a label compound attached to the
molecule, the label compound providing a labeling signal.
22. A method for sorting targets of a plurality of targets, the
method comprising providing a plurality of substrate
polynucleotides attached to a substrate, each substrate
polynucleotide being sequence-specific and positionally
distinguishable from another; providing a plurality of
polynucleotide-encoded proteins, each polynucleotide-encoded
protein comprising a protein and an encoding polynucleotide
attached to the protein, wherein the protein specifically binds to
a predetermined target of the plurality of targets and the encoding
polynucleotide specifically binds to a sequence-specific and
positionally distinguishable substrate polynucleotide of the
plurality of substrate polynucleotides, each protein and encoding
polynucleotide being bindingly distinguishable from another;
contacting the plurality of polynucleotide-encoded antibodies with
the sample for a time and under conditions to allow binding of the
antibodies with the targets, thus providing a plurality of
polynucleotide-encoded protein-target complexes; and contacting the
plurality of polynucleotide-encoded protein-target complexes with
the plurality of substrate polynucleotides for a time and under
conditions to allow binding of the encoding-polynucleotides to the
substrate polynucleotides attached to the substrate, thus sorting
the plurality of targets in a plurality of polynucleotide-encoded
protein-target-complexes bound to the substrate.
23. The method of claim 22, wherein the targets are cells.
24. A system for sorting a plurality of targets, the system
comprising, a substrate with a plurality of substrate
polynucleotides attached to the substrate, each polynucleotide of
the plurality of substrate polynucleotides attached to the
substrate being sequence-specific and positionally distinguishable
from another; and a plurality of polynucleotide-encoded proteins,
each polynucleotide-encoded protein comprising a protein and a
encoding-polynucleotide attached to the protein, wherein the
protein specifically binds to a predetermined target of the
plurality of targets and the encoding-polynucleotide specifically
binds to a sequence-specific and positionally distinguishable
polynucleotide of the plurality of polynucleotides attached to the
substrate, each protein being bindingly distinguishable from the
other, each encoding polynucleotide being bindingly distinguishable
from the other.
25. A microfluidic array for the detection of one or more targets
in a sample fluid, comprising a microfluidic component having a
microfluidic feature for carrying the sample fluid, and a substrate
component with a plurality of substrate polynucleotides attached to
said substrate component, the substrate polynucleotides being
sequence-specific and positionally distinguishable, the substrate
component in operable association with the microfluidic feature of
the microfluidic component for the analysis of the sample fluid;
wherein each of the substrate polynucleotides is comprised of a
sequence that is orthogonal to the sequence of another substrate
polynucleotide.
26. A method to detect one or more targets in a sample fluid,
comprising performing the method of claim 1 with the microfluidic
array of claim 25.
27. A method to detect one or more targets in a sample fluid,
comprising performing the method of claim 8 with the microfluidic
array of claim 25.
28. A method to detect one or more targets in a sample fluid,
comprising performing the method of claim 12 with the microfluidic
array of claim 25.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application entitled "A unified Platform for Multiplexed Cell
Sorting and Detection of Genes and Proteins" Ser. No. 60/834,823,
filed on Aug. 2, 2006 Docket No. CIT-4707, and to U.S. Provisional
Application entitled "Digital DEAL: A quantitative and digital
Protein Detection Immunoassay" Ser. No. 60/959,665 filed on Jul.
16, 2007 Docket No. CIT-4944, the disclosures of which are
incorporated herein by reference in their entirety.
TECHNICAL FIELD
[0003] The present disclosure relates to detection of one or more
targets, in particular biomarkers, in a sample such as a biological
sample. More specifically, it relates to methods and systems for
detecting and/or sorting targets.
BACKGROUND
[0004] High sensitivity detection of targets and in particular of
biomarkers has been a challenge in the field of biological molecule
analysis, in particular when aimed at detection of a plurality of
targets. Whether for pathological examination or for fundamental
biology studies, several methods are commonly used for the
detection of various classes of biomaterials and biomolecules.
[0005] Some of the techniques most commonly used in the laboratory
for detection of single biological targets include gel
electrophoresis, polyacrylamide gel electrophoresis (PAGE), western
blots, fluorescent in situ hybridization (FISH), Florescent
activated cell sorting (FACS), Polymerase chain reaction (PCR), and
enzyme linked immunosorbent assay (ELISA). These methods have
provided the ability to detect one or more biomarkers in biological
samples such as tissues and are also suitable for diagnostic
purposes.
[0006] However, current global genomic and proteomic analyses of
tissues are impacting our molecular-level understanding of many
human cancers. Particularly informative are studies that integrate
both gene expression and proteomic data. Such multiparameter data
sets are beginning to reveal the perturbed regulatory networks
which define the onset and progression of cancers (Lin, B.; White,
J. T.; Lu, W.; Xie, T.; Utleg, A. G.; Yan, X.; Yi, E. C.; Shannon,
P.; Khretbukova, I.; Lange, P. H.; Goodlett, D. R.; Zhou, D.;
Vasicek, T. J.; Hood, L. Cancer Res. 2005, 65, 3081-3091. Kwong, K.
Y.; Bloom, G. C.; Yang, I.; Boulware, D.; Coppola, D.; Haseman, J.;
Chen, E.; McGrath, A.; Makusky, A. J.; Taylor, J.; Steiner, S.;
Zhou, J.; Yeatman, T. J.; Quackenbush, J. Genomics 2005, 86,
142-158. Huber, M.; Bahr, I.; Kratzchmar, J. R.; Becker, A.;
Muller, E.-C.; Donner, P.; Pohlenz, H.-D.; Schneider, M. R.;
Sommer, A. Molec. Cell. Proteomics 2004, 3, 43-55. Tian, Q.;
Stepaniants, S. B.; Mao, M.; Weng, L.; Feetham, M. C.; Doyle, M.
J.; Yi, E. C.; Dai, H.; Thorsson, V.; Eng, J.; Goodlett, D.;
Berger, J. P.; Gunter, B.; Linseley, P. S.; Stoughton, R. B.;
Aebersold, R.; Collins, S. J.; Hanlon, W. A.; Hood, L. E. Molec.
Cell. Proteomics 2004, 3, 960-969. Chen, G.; Gharib, T. G.; Huang,
C.-C.; Taylor, J. M. G.; Misek, D. E.; Kardia, S. L. R.; Giordano,
T. J.; Iannettoni, M. D.; Orringer, M. B.; Hanash, S. M.; Beer, D.
G. Molec. Cell. Proteomics 2002, 1, 304-313). This new picture of
complex diseases such as cancer, and the emergence of promising new
cancer drugs (Prados, M.; Chang, S.; Burton, E.; Kapadia, A.;
Rabbitt, J.; Page, M.; Federoff, A.; Kelly, S.; Fyfe, G. Proc. Am.
Soc. Clin. Oncology 2003, 22, 99. Rich, J. N.; Reardon, D. A.;
Peery, T.; Dowell, J. M.; Quinn, J. A.; Penne, K. L.; Wikstrand, C.
J.; van Duyn, L. B.; Dancey, J. E.; McLendon, R. E.; Kao, J. C.;
Stenzel, T. T.; Rasheed, B. K. A.; Tourt-Uhlig, S. E.; Herndon, J.
E.; Vredenburgh, J. J.; Sampson, J. H.; Friedman, A. H.; Bigner, D.
D.; Friedman, H. S. J. Clin. Oncology 2004, 22, 133-142.), are
placing new demands on clinical pathology (Mellinghoff, 1. K.;
Wang, M. Y.; Vivanco, I.; Haas-Kogan, D. A.; Zhu, S.; Dia, E. Q.;
Lu, K. V.; Yoshimoto, K.; Huang, J. H. Y.; Chute, D. J.; Riggs, B.
L.; Horvath, S.; Liau., L. M.; Cavenee, W. K:; Rao, P. N.;
Beroukhim, R.; Peck, T. C.; Lee, J. C.; Sellers, W. R.; Stokoe, D.;
Prados, M.; Cloughesy, T. F.; Sawyers, C. L.; Mischel, P. S, N.
Engl. J. Med. 2006, 353, 2012-2024). For example, traditional
pathology practices (i.e. microscopic analysis of tissues) does not
distinguish potential responders from non-responders for the new
cancer molecular therapeutics (Betensky, R. A.; Louis, D. N.;
Cairncross, J. G. J. Clin. Oncology 2002, 20, 2495-2499). Recent
examples exist in which pauciparameter molecular measurements are
being employed to identify potential responders to at least two
therapeutics (Hughes, T.; Branford, S., 2003. Semin Hematol. 2
Suppl 2, 62-68. Lamb, J.; Crawford, E. D.; Peck, D.; Modell, J. W.;
Blat, 1. C.; Wrobel, M. J.; Lerner, J.; Brunet, J. P.; Subramanian,
A.; Ross, K. N.; Reich, M.; Hieronymus, H.; Wei, G.; Armstrong, S.
A.; Haggarty, S. J.; Clemons, P. A.; Wei, R.; Carr, S. A.; Lander,
E. S.; Golub, T. R., Science 2006, 313, (5795), 1929-1935. Martin,
M., Clin. Transl Oncol. 8, (1), 7-14. Radich, J. P.; Dai, H.; Mao,
M.; Oehler, V.; Schelter, J.; Druker, B.; Sawyers, C. L.; Shah, N.;
Stock, W.; Willman, C. L.; Friend, S.; Linsley, P. S., Proc. Nail.
Acad. Sci. 2006, 103, (8), 2794-2799). However, it is unlikely that
single-parameter measurements will be the norm. Instead, the
coupling of molecular diagnostics with molecular therapeutics will
eventually require measurements of a multiparameter (e.g. cells,
mRNAs and proteins) biomarker panel that can be used to direct
patients to appropriate therapies or combination therapies.
[0007] Currently, the measurement of a multiparameter panel of
biomarkers from diseased tissues requires combinations of
microscopic analysis, microarray data (Mischel, P. S.; Cloughesy,
T. F.; Nelson, S. F. Nature Rev. Neuroscience 2004, 5, 782-794),
immunohistochemical staining, Western Blots (Mellinghoff, 1. K.;
Wang, M. Y.; Vivanco, I.; Haas-Kogan, D. A.; Zhu, S.; Dia, E. Q.;
Lu, K. V.; Yoshimoto, K.; Huang, J. H. Y.; Chute, D. J.; Riggs, B.
L.; Horvath, S.; Liau., L. M.; Cavenee, W. K.; Rao, P. N.;
Beroukhim, R.; Peck, T. C.; Lee, J. C.; Sellers, W. R.; Stokoe, D.;
Prados, M.; Cloughesy, T. F.; Sawyers, C. L.; Mischel, P. S, N.
Engl. J. Med. 2006, 353, 2012-2024), and other methods. The
collected data is integrated together within some model for the
disease, such as a cancer pathway model (Weinberg, R. A., Cancer
Biology. Garland Science: 2006), to generate a diagnosis.
Currently, performing these various measurements requires a
surgically resected tissue sample. The heterogeneity of such
biopsies can lead to significant sampling errors since various
measurements of cells, mRNAs, and proteins are each executed from
different regions of the tissue.
SUMMARY
[0008] Provided herein, are methods and systems based on the use of
a polynucleotide-encoded protein in combination with a substrate
polynucleotide. The polynucleotide-encoded protein herein disclosed
is comprised of a protein that specifically binds to a target and
of an encoding-polynucleotide attached to the protein. The encoding
polynucleotide is comprised of a sequence that specifically binds
to a substrate polynucleotide. The substrate polynucleotide herein
disclosed is attached to a substrate and is comprised of a sequence
that specifically binds to the encoding polynucleotide.
[0009] Several assays, including but not limited to assays for the
detection and/or separation of targets, in particular biomarkers,
such as cells, proteins and/or polynucleotides, can be performed
according to the methods and systems herein disclosed. In
particular, in the assays with the methods and systems herein
disclosed, the polynucleotide-encoded protein is used to
specifically bind to a target in a polynucleotide-encoded
protein-target complex, and the substrate polynucleotide is used to
bind the polynucleotide-encoded protein-target complex to the
substrate for detection. The methods and systems herein disclosed
allow the advantageous performance of several assays in particular,
in a microfluidic environment as it will be apparent to a skilled
person upon reading of the present disclosure.
[0010] According to a first aspect, a method and a system to detect
a target in a sample are disclosed, the method and system based on
the combined use of a substrate polynucleotide attached to a
substrate, and a polynucleotide-encoded protein comprised of a
protein that specifically binds to the target and of an encoding
polynucleotide that specifically binds to the substrate
polynucleotide attached to the substrate.
[0011] In the method, the polynucleotide-encoded protein is
contacted with the sample and the substrate polynucleotide for a
time and under conditions to allow binding of the
polynucleotide-encoded protein with the target in a
polynucleotide-encoded protein-target complex, and binding of the
encoding polynucleotide with the substrate polynucleotide thus
providing a polynucleotide-encoded protein-target complex bound to
the substrate polynucleotide. In the method, the
polynucleotide-encoded protein-target complex bound to the
substrate polynucleotide is then detected by way of detecting
techniques which will be identifiable by a skilled person upon
reading of the present disclosure.
[0012] In the system, a substrate with a substrate polynucleotide
attached to the substrate is provided, together with a
polynucleotide-encoded protein comprising a protein that
specifically binds to the target and an encoding-polynucleotide
that specifically binds to the substrate polynucleotide.
[0013] According to a second aspect, a method and a system for
detecting a plurality of targets in a sample are disclosed, the
method and system based on the combined use of a plurality of
substrate polynucleotides attached to a substrate and a plurality
of polynucleotide-encoded antibodies.
[0014] In the method and system, each of the substrate
polynucleotides is sequence specific and positionally
distinguishable from another. In the method and system, each of the
polynucleotide-encoded proteins is comprised of a protein that
specifically binds to a predetermined target of the plurality of
targets and of an encoding polynucleotide that specifically binds
to a sequence specific and positionally distinguishable substrate
polynucleotide of the plurality of substrate polynucleotides.
Further, in the method and system, each protein and encoding
polynucleotide is bindingly distinguishable from another.
[0015] In the method, the plurality of polynucleotide-encoded
antibodies is contacted with the sample and the plurality of
substrate polynucleotides for a time and under conditions to allow
binding of the antibodies with the targets in a plurality of
polynucleotide-encoded protein-target complexes and binding of the
encoding polynucleotides to the substrate polynucleotides. In the
method, the plurality of polynucleotide-encoded protein-target
complexes bound to the plurality of substrate polynucleotides on
the substrate is then detected by way of detecting techniques that
will be identifiable by the skilled person upon reading of the
present disclosure.
[0016] In the system, a substrate with the plurality substrate
polynucleotides attached to the substrate is comprised, together
with the plurality of polynucleotide-encoded antibodies.
[0017] According to a third aspect, a method and a system for
detecting a plurality of targets in a sample, are disclosed,
wherein the targets comprise at least one target polynucleotide.
The method and system are based on the combined use of a plurality
of substrate polynucleotides attached to a substrate, at least one
polynucleotide-encoded protein and at least one labeled
polynucleotide.
[0018] In the method and system, each substrate polynucleotide is
sequence-specific and positionally distinguishable from another. In
the method and system, the at least one labeled polynucleotide
specifically binds to the at least one target polynucleotide, with
each labeled polynucleotide bindingly distinguishable from another.
In the method and system, the at least one polynucleotide-encoded
protein is comprised of a protein that specifically binds to a
predetermined target of the plurality of the targets and of an
encoding polynucleotide that specifically binds to a
sequence-specific and positionally distinguishable substrate
polynucleotide of the plurality of substrate polynucleotides. In
the method and system, each protein and encoding polynucleotide is
bindingly distinguishable from another, each protein is further
bindingly distinguishable from each labeled polynucleotide, and
each polynucleotide-encoded protein is bindingly distinguishable
from each labeled target polynucleotide
[0019] In the method, the at least one labeled polynucleotide is
contacted with the sample for a time and under conditions to allow
binding of the labeled polynucleotide with the target
polynucleotide to provide at least one labeled target
polynucleotide, wherein the at least one labeled target
polynucleotides is comprised of a sequence that specifically binds
to a sequence-specific and positionally distinguishable substrate
polynucleotide. Additionally, in the method, the at least one
polynucleotide-encoded protein is contacted with the sample for a
time and under conditions to allow binding of the protein with the
target, in at least one polynucleotide-encoded protein-target
complex. Further, in the method, the at least one labeled target
polynucleotide and the at least one polynucleotide-encoded
protein-target complex are contacted with the plurality of
substrate polynucleotides for a time and under conditions to allow
binding of the at least one labeled target polynucleotide with a
corresponding substrate polynucleotide and binding of the at least
one encoding polynucleotide with a corresponding substrate
polynucleotide. In the method, the labeled target polynucleotides
and the polynucleotide-encoded protein-target complexes bound to
the plurality of spatially located substrate polynucleotides on the
substrate are then detected by use of detecting techniques that
will be identifiable by the skilled person upon reading of the
present disclosure.
[0020] In the system, a substrate with the plurality of substrate
polynucleotides attached to the substrate is comprised together
with, the at least one labeled polynucleotide and the at least one
polynucleotide-encoded-protein. In the system, the at least one
labeled polynucleotide of the system is for the production of a
labeled target polynucleotide that specifically binds to a
sequence-specific and positionally distinguishable substrate
polynucleotide.
[0021] According to a fourth aspect, a method and system for
sorting targets of a plurality of targets is disclosed, the method
and system based on the combined use of a plurality of substrate
polynucleotides attached to a substrate and a plurality of
polynucleotide-encoded antibodies. In some embodiments the targets
are cells and the method and systems are for sorting a plurality of
cells.
[0022] In the method and system, each substrate polynucleotide is
sequence-specific and positionally distinguishable from another. In
the method and system, each polynucleotide-encoded protein is
comprised of a protein and of a encoding polynucleotide attached to
the protein, wherein the protein specifically binds to a
predetermined target of the plurality of targets and the encoding
polynucleotide specifically binds to a sequence-specific and
positionally distinguishable substrate polynucleotide of the
plurality of substrate polynucleotides. In the method and system,
each protein and encoding polynucleotide is bindingly
distinguishable from another.
[0023] In the method, the plurality of polynucleotide-encoded
antibodies is contacted with the sample for a time and under
conditions to allow binding of the antibodies with the targets,
thus providing a plurality of polynucleotide-encoded protein-target
complexes. In the method the plurality of polynucleotide-encoded
protein-target complexes is then contacted with the plurality of
substrate polynucleotides for a time and under conditions to allow
binding of the encoding polynucleotides to the substrate
polynucleotides attached to the substrate, thus sorting the
plurality of targets in a plurality of polynucleotide-encoded
protein-target complexes bound to the substrate.
[0024] In the system, a substrate with the plurality of substrate
polynucleotides attached to the substrate is comprised together
with the plurality of polynucleotide-encoded antibodies.
[0025] According to a fifth aspect, an array for the detection of
one or more targets in a sample fluid is disclosed, the array
comprising a substrate with a plurality of substrate
polynucleotides attached to said substrate component, the substrate
polynucleotide sequence specific and positionally distinguishable,
wherein each of the substrate polynucleotides is comprised of a
sequence that is orthogonal to the sequence of another substrate
polynucleotide.
[0026] According to a sixth aspect, the substrate of each of the
methods, systems and arrays disclosed herein is in operable
association with a microfluidic component comprising a microfluidic
feature for carrying a fluid. Accordingly, in the methods, at least
contacting the encoding-polynucleotide and/or the labeled
polynucleotide target with the substrate polynucleotide, can be
performed in the fluid carried by the microfluidic feature.
Additionally, each of the systems herein disclosed can further
include the microfluidic component comprising the microfluidic
feature.
[0027] A first advantage of the methods and systems disclosed
herein is that, in each of the methods and systems herein
disclosed, contacting the polynucleotide-encoded protein to the
target can be performed before the protein is bound to the
substrate. As a consequence, with targets such as cells, access of
the target to the binding site of the protein cannot be impaired by
the substrate and both the protein and the target molecule will
have a complete orientational freedom in performing the contact,
thus improving the sensitivity of any related assay performed with
the disclosed methods and systems.
[0028] A second advantage of the methods and systems disclosed
herein is that each of the methods and systems herein disclosed the
polynucleotide-encoded proteins can be assembled in solution,
thereby minimizing the effect of protein denaturation associated to
prior art methods, which include drying the substrate after binding
and elevated temperature (e.g., close to 100.degree. C.). In some
of those prior art methods, protein arrays are generated by
spotting via a fine pin onto a glass substrate, so that the
manufacturer steps needs to be closely monitored to ensure that the
proteins do not dry out and hence denature. On the contrary, in the
methods and systems herein disclosed the proteins can be assembled
onto the substrate in solution, so to minimize to zero proteins
drying out and denaturation.
[0029] A third advantage of the methods and systems disclosed
herein is that in each of the methods and systems herein disclosed,
biofouling, i.e. non-specific binding of non-encoded protein to the
substrate, is greatly reduced when compared to the protein-based
methods and systems of the art, therefore allowing a more efficient
binding and, when detection is desired, a more accurate
quantitative detection of the target molecule in the sample when
compared with antibodies based methods and system of the art.
[0030] A fourth advantage of the methods and systems disclosed
herein, is that the multiplexed detection and/or separation of a
higher number of targets can be performed when compared to the
protein-based methods and systems of the art. This is due to
several factors. A first factor is that the reduced biofouling
associated with the use of a polynucleotide-encoded protein in
combination with a substrate polynucleotide attached to a substrate
allows a more efficient binding and detection of the
polynucleotide-encoded protein-target complexes to the substrate. A
second factor is that the size of the substrate polynucleotide in
the method system herein disclosed is much smaller, than the
corresponding anchoring molecules used in the protein-based methods
and systems of the art. As a consequence, a higher density of
proteins can be assembled on the substrate in comparison with the
prior art techniques (e.g., about 5,000 spots per square inch
versus 96 well plates of techniques like ELISA).
[0031] A fifth advantage of the methods and systems disclosed
herein is that in each of the methods and systems herein disclosed
it is possible to detect and separate in a single substrate
chemically different targets, including biomarkers such as
polynucleotides, proteins, and cells that have a different surface
marker. Accordingly, the methods and systems herein disclosed allow
the multiplexed detection and/or separation of genes, proteins and
cells within the same environment.
[0032] A further advantage of the methods and systems for sorting
targets herein disclosed, is that the methods and systems herein
disclosed make the sorted cells immediately available for
post-sorting analysis, which is particularly relevant in the
embodiments wherein the targets are cells that are made available
for post-sorting analysis of gene and protein expression in the
cells.
[0033] An additional advantage of the methods and systems herein
disclosed when used to perform diagnostic assays is that
multiplexed detection of multiple biomarkers from a same region of
tissue can be performed on a single substrate. A further advantage
of the methods and systems used to perform diagnostic assays is
that the biomarkers can be chemically distinct biomarkers such as
cells, mRNAs and proteins and that the detection can be a
quantitative detection and/or a qualitative. A still further
advantage of the methods and systems herein disclosed when used to
perform a diagnostic assay is that they allow detection of complex
genomic and/or proteomic profiles that, when compared with
pre-determined profiles provide diagnostic indications for diseases
characterized by perturbed regulatory networks, such as cancer.
Another advantage of the methods and systems herein disclosed when
used to perform a diagnostic assay, is the possibility to analyze a
small amount of biological sample in a multiparameter fashion, and
be able to bridge the three relevant areas of biological
information, that of the genes (represented by DNA), proteins, and
cells.
[0034] Further remarkable advantages of all the methods and systems
herein disclosed when the substrate is in operable association with
a microfluidic component, are to allow performance of multiplexed
multiparameter assays with a sample greatly reduced in size, in a
reduced time and with a reduced number of steps when compared to
corresponding methods and systems of the art. In particular, the
multiplexed multiparameter microfluidic methods and systems herein
disclosed are particularly advantageous when the targets are
biomarkers from a tissue in view of the reduced amount of sample
required to perform the analysis which minimizes the need to
euthanize mice. Additionally, the methods and systems performed in
a microfluidic environment herein disclosed, allow a detection of a
target that is included in a sample in a small quantities allowing
detection of molecules present in the sample at a concentration
down to about a 10 femtoMolar.
[0035] Still further advantages of the methods and systems herein
disclosed, when the substrate is in operable association with a
microfluidic component when used to perform a diagnostic assay, are
to allow the multiplexed detection of biomarkers, including
chemically distinct biomarkers such as polynucleotides, proteins
and cells. A further additional advantage of the diagnostic methods
and systems herein disclosed, in embodiments wherein the substrate
is in operable association with a microfluidic component, is to
allow performance of multiplexed multiparameter assays on a single
sample from the same microscopic region of an heterogeneous tissue.
As a consequence, the methods and systems herein disclosed also
minimize the sampling errors associated with heterogeneous biopsies
required to perform the various measurements of the diagnostic
method and systems for the detection of multiple chemically
distinct biomarkers of the art.
[0036] The details of one or more embodiments of the disclosure are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages will be apparent from the
description and drawings, and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The accompanying drawings, which are incorporated into and
constitute a part of this specification, illustrate one or more
embodiments of the present disclosure and, together with the
detailed description, serve to explain the principles and
implementations of the disclosure.
[0038] In the drawings:
[0039] FIG. 1 is a schematic illustration of a coupling strategy
utilized to prepare polynucleotide-encoded-protein herein
disclosed. Panel a is a schematic illustration of a reaction for
the preparation of an antibody; Panel b is a schematic illustration
of a reaction the preparation of a polynucleotide; Panel c is an
illustration of the polynucleotide-encoded antibody resulting from
the conjugation of the antibody shown in Panel a and the
polynucleotide shown in Panel b; Panel d shows a gel mobility shift
assay showing that the number of polynucleotide strand A1' attached
to the antibody can be controlled by adjusting the amount of
coupling molecule to antibody as shown in Panel a. Here, lanes I-IV
corresponds to stoichiometric ratios of 300:1, 100:1, 50:1, 25:1 of
the coupling molecule to antibody respectively;
[0040] FIG. 2 is a schematic illustration of the conjugation
chemistry of a polynucleotide-encoded protein disclosed herein.
Panel a shows a schematic illustration of the conjugation chemistry
between a polynucleotide and the protein streptavidin; Panel b
shows the assembly of the polynucleotide-encoded streptavidin with
a protein containing biotin, which is the ligand of streptavidin;
SA indicates the streptavidin protein, Biotin-Protein: indicates a
protein containing the ligand biotin;
[0041] FIG. 3 shows diagrams illustrating the optimization of
polynucleotide loading of polynucleotide-encoded antibodies for
cell surface marker recognition herein disclosed. Panel a shows
FACS plots comparing .alpha.-CD90.2/FITC-polynucleotide conjugates
(FITC-DNA-labeled .alpha.-CD90.2) with FITC .alpha.-CD90.2 antibody
having no polynucleotide attached to antibody (FITC .alpha.-CD90.2)
along with a negative control with no antibody and no
polynucleotide encoded antibody (unlabeled). The florescent
intensity corresponding to the FITC channel is given on the x axis,
the y axis corresponding to a null florescent channel; Panel b
shows histograms of the mean fluorescent intensities for different
numbers of FITC-polynucleotide attached to the antibody; on the x
axis the number of polynucleotides attached to the antibody are
reported, on the y axis the mean fluorescence intensity is
reported;
[0042] FIG. 4, is a schematic illustration of a combined use of
polynucleotide-encoded antibodies and substrate polynucleotides
herein disclosed;
[0043] FIG. 5 illustrates an embodiment of the methods and systems
wherein the polynucleotide-encoded protein is based on the
streptavidin biotin system and the targets are cells. Panel a shows
assembly of the polynucleotide-encoded streptavidin according to
FIG. 2, wherein the biotin containing protein is the Major
histocompatibility complex (MHC) and preassembly of the
polynucleotide-encoded straptavidin onto the substrate before the
cells of interest are exposed to the glass substrate. Panel b shows
exposure of the microarray following binding of the
polynucleotide-encoded MHC to the cells in solution;
[0044] FIG. 6 illustrates a method of detecting a plurality of
targets using polynucleotide-encoded antibodies and substrate
polynucleotide herein disclosed. Panel a shows a schematic
illustration of a combined used of a plurality of
polynucleotide-encoded antibodies herein disclosed in combination
with substrate polynucleotides Panel b shows a related immunoassay
performed using polynucleotide-encoded antibodies and substrate
polynucleotide herein disclosed;
[0045] FIG. 7 shows a spatially encoded protein array using encoded
polynucleotide-encoded antibodies and substrate polynucleotides
herein disclosed. Panel a shows an immunoassay performed with three
identical goat .alpha.-human IgG (labeled with Alexa488, Alexa594,
or Alexa 647 dyes) and tagged with polynucleotides A1', B1' and C1'
respectively; shows a schematic representation of the results of
the immunoassays from the portion of the array of Panel a indicated
by a white bar; the scale bar shown in the Figure corresponding to
1 mm;
[0046] FIG. 8 shows the results of an immunoassay showing
minimization of non specific protein absorption resulting from the
combined used of polynucleotide-encoded antibodies and substrate
polynucleotide herein disclosed. Panel a shows a microarray
simultaneously exposed to goat .alpha.-human IgG-Alexa488/A1', goat
.alpha.-human IgG-Alexa647/C1' each conjugated with a specific
polynucleotide and goat .alpha.-human IgG-Alexa594 with no pendant
DNA, Panel b shows a schematic representation of the results of the
immunoassays from the portion of the array of Panel a indicated by
a white bar; the scale bar shown in the Figure corresponding to 1
mm;
[0047] FIG. 9 illustrates the results of the in silico
orthogonalization of substrate polynucleotides wherein each
substrate polynucleotide is orthogonal to the others and bind to
their corresponding antibody specific polynucleotides. Panel a,
shows a glass slide printed with three substrate polynucleotides
exposed to two polynucleotide-encoded antibodies complementary to
two out of the three substrate polynucleotides; Panel b shows the
secondary structure formed from the hybridization of A1 in silico
hybridization in silico of the two substrate polynucleotides
complementary to the antibody specific polynucleotide; Panel c
shows generation in silico of additional substrate polynucleotide
with the constraints that each strand be orthogonal with each other
and with their corresponding complements; Panel d shows a set of 6
orthogonal sequences, listed 5' to 3' end;
[0048] FIG. 10 illustrates a method for performing multiplexed cell
sorting using the polynucleotide-encoded antibody and the substrate
polynucleotide herein disclosed. Panel a, shows a homogeneous assay
in which polynucleotide-encoded antibodies are combined with the
cells, and then the mixture is introduced onto the spotted DNA
array microchip; Panel b shows polynucleotide-encoded antibodies
assembled onto a spotted DNA array, followed by introduction of the
cells; Panel c shows brightfield and fluorescence microscopy images
of multiplexed cell sorting experiments where a 1:1 mixture of
mRFP-expressing T cells (red channel) and EGFP-expressing B cells
(green channel) is spatially stratified onto spots A1 and C1,
corresponding to the encoding of .alpha.-CD90.2 and .alpha.-B220
antibodies with A1' and C1', respectively; Panel d, is a
fluorescence micrograph of multiplexed sorting of primary cells
harvested from mice. A 1:1 mixture of CD4+ cells from EGFP
transgenic mice and CD8+ cells from dsRed transgenic mice are
separated to spots A1 and C1 by utilizing polynucleotide-encoded
conjugates .alpha.-CD4-A1' and .alpha.-CD8-C1', respectively;
[0049] FIG. 11 is a schematic illustration of a combined use of
polynucleotide-encoded antibodies and substrate polynucleotides
herein disclosed for cell sorting and/or co-detection of chemically
distinct molecules;
[0050] FIG. 12 illustrates the ability of a polynucleotide-encoded
protein to detect a plurality of targets according to an
embodiments of the methods and systems herein disclosed; Panel a,
shows a microarrays exposed to an antibody specific for antigen IL4
encoded with polynucleotide C1 and a polynucleotide complementary
to polynucleotide B1 labeled with a fluorophore; Panel b shows a
schematic representation of the embodiment of the methods and
systems herein disclosed used to perform the assay; Panel c shows a
schematic representation of the results of the assay illustrated in
the portion of panel A identified by a white bar;
[0051] FIG. 13 shows microscopy images demonstrating simultaneous
cell capture and multiparameter detection of genes and proteins,
the scale bar shown in the Figure corresponding to 300 .mu.m;
[0052] FIG. 14 shows a protein array used in an embodiment of the
method for detecting targets herein disclosed assembled in
microfluidics;
[0053] FIG. 15 shows fluorescence and brightfield images of
DNA-templated protein immunoassays executed within microfluidic
channels, the 600 .mu.m micrometer wide channels being delineated
with white dashed lines. Panel a shows a two-parameter immunoassay
performed using polynucleotide-encoded antibodies in combination
with substrate polynucleotides herein disclosed; Panel b shows
detection of a target concentration series in an embodiment of the
method and system herein disclosed wherein the detection is
performed using fluorescence based techniques; Panel c shows
detection of a target concentration series in an embodiment of the
method and system herein disclosed wherein the detection is
performed using Au electroless deposition as a visualization and
amplification strategy;
[0054] FIG. 16 is a schematic illustration of a combined use of
polynucleotide-encoded antibodies and substrate polynucleotides
wherein the polynucleotide-encoded antibodies are labeled with
metal nanoparticles according to an embodiment of the methods and
systems herein disclosed;
[0055] FIG. 17 is an additional schematic illustration of the
combined use of FIG. 16, showing the polynucleotide-encoded
antibody target complex bound to the substrate and labeled with
metal nanoparticles according to an embodiment of the methods and
systems herein disclosed;
[0056] FIG. 18 is a schematic illustration of a device and related
method to detect a signal from polynucleotide-encoded antibodies
labeled with metal nanoparticles according to an embodiment of the
methods and systems herein disclosed;
[0057] FIG. 19 shows detection of a proteomic with a method and
system herein disclosed wherein the detection is performed using Au
electroless deposition as a visualization and amplification
strategy. Panel a shows detection at concentration of about 100 pM;
Panel b shows detection at concentration of about 100 femtoM; Panel
c shows detection at concentration of about 100 attoM;
[0058] FIG. 20 shows detection of a proteomic with a method and
system herein disclosed wherein the detection is performed using Au
electroless deposition as a visualization and amplification
strategy. Panel a shows detection at concentration of about 100 pM;
Panel b shows detection at concentration of about 1 pM; Panel c
shows detection at concentration of about 10 fM; Panel d shows
detection at concentration of about 100 aM; Panel e shows an
histogram correlating the numbers of proteins counted (y axis)
versus their concentration in solution (x-axis);
[0059] FIG. 21 shows detection of a proteomic of 3 proteins
(IFN-.gamma., TNF-.alpha. and IL-2) from tissue culture media
spiked with the three proteins with a method and system herein
disclosed wherein the detection is performed using Au electroless
deposition as a visualization and amplification strategy. Panel a
shows detection of IFN-.gamma.; Panel b shows detection of
TNF-.alpha.; Panel c shows detection of IL-2;
[0060] FIG. 22 shows detection of a proteomic of 3 proteins
(IFN-.gamma., TNF-.alpha. and IL-2) from a serum sample spiked with
the three proteins (Panel a) and from the serum of a healthy human
(Panel b) with a method and system herein disclosed wherein the
detection is performed using Au electroless deposition as a
visualization and amplification strategy;
[0061] FIG. 23 is a diagram illustrating the calibration and
quantification of the protein marker, Pten, with an embodiment of
the methods and systems herein disclosed; Panel a shows a diagram
wherein the average fluorescent intensity of the signal detected
from the microfluidic experiments illustrated in Panels b and c, is
illustrated; Panel b shows the raw data from the calibration lanes
for recombinant pten; Panel c shows the raw fluorescent data from
the samples from two cell lines, one is the null U87, expressing
basal levels of pten, and the other is the U-87-pten overexpressing
cell samples; and
[0062] FIG. 24 illustrates the pathway from serum biomarker
discovery via tandem mass spectrometry (Panel a or 1) to antibody
validation and selection (Panel c or 3) via large scale SPR (Panel
b or 2) to validating clinical pathways with an embodiment of the
methods and systems herein disclosed.
DETAILED DESCRIPTION
[0063] Methods and systems for the detection of targets in a sample
are disclosed. In the methods and systems herein disclosed
polynucleotide-encoded proteins are used in combination with
substrate polynucleotides to detect one or more targets in a
sample.
[0064] The term "detect" or "detection" as used herein indicates
the determination of the existence, presence or fact of a target or
signal in a limited portion of space, including but not limited to
a sample, a reaction mixture, a molecular complex and a substrate.
A detection is "quantitative" when it refers, relates to, or
involves the measurement of quantity or amount of the target or
signal (also referred as quantitation), which includes but is not
limited to any analysis designed to determine the amounts or
proportions of the target or signal. A detection is "qualitative"
when it refers, relates to, or involves identification of a quality
or kind of the target or signal in terms of relative abundance to
another target or signal, which is not quantified.
[0065] The term "target" as used herein indicates an analyte of
interest. The term "analyte" refers to a substance, compound or
component whose presence or absence in a sample has to be detected.
Analytes include but are not limited to biomolecules and in
particular biomarkers. The term "biomolecule" as used herein
indicates a substance compound or component associated to a
biological environment including but not limited to sugars,
aminoacids, peptides proteins, oligonucleotides, polynucleotides,
polypeptides, organic molecules, haptens, epitopes, biological
cells, parts of biological cells, vitamins, hormones and the like.
The term "biomarker" indicates a biomolecule that is associated
with a specific state of a biological environment including but not
limited to a phase of cellular cycle, health and disease state. The
presence, absence, reduction, upregulation of the biomarker is
associated with and is indicative of a particular state.
[0066] The term "sample" as used herein indicates a limited
quantity of something that is indicative of a larger quantity of
that something, including but not limited to fluids from a
biological environment, specimen, cultures, tissues, commercial
recombinant proteins, synthetic compounds or portions thereof.
[0067] The term "polynucleotide" as used herein indicates an
organic polymer composed of two or more monomers including
nucleotides, nucleosides or analogs thereof. The term "nucleotide"
refers to any of several compounds that consist of a ribose or
deoxyribose sugar joined to a purine or pyrimidine base and to a
phosphate group and that are the basic structural units of nucleic
acids. The term "nucleoside" refers to a compound (as guanosine or
adenosine) that consists of a purine or pyrimidine base combined
with deoxyribose or ribose and is found especially in nucleic
acids. The term "nucleotide analog" or "nucleoside analog" refers
respectively to a nucleotide or nucleoside in which one or more
individual atoms have been replaced with a different atom or a with
a different functional group. Accordingly, the term polynucleotide
includes nucleic acids of any length DNA RNA analogs and fragments
thereof. A polynucleotide of three or more nucleotides is also
called nucleotidic oligomers or oligonucleotide.
[0068] The term "polypeptide" as used herein indicates an organic
polymer composed of two or more amino acid monomers and/or analogs
thereof. The term "polypeptide" includes amino acid polymers of any
length including full length proteins and peptides, as well as
analogs and fragments thereof. A polypeptide of three or more amino
acids is also called a protein oligomer or oligopeptide. As used
herein the term "amino acid", "amino acidic monomer", or "amino
acid residue" refers to any of the twenty naturally occurring amino
acids including synthetic amino acids with unnatural side chains
and including both D an L optical isomers. The term "amino acid
analog" refers to an amino acid in which one or more individual
atoms have been replaced, either with a different atom, isotope, or
with a different functional group but is otherwise identical to its
natural amino acid analog.
[0069] The term "protein" as used herein indicates a polypeptide
with a particular secondary and tertiary structure that can
participate in, but not limited to, interactions with other
biomolecules including other proteins, DNA, RNA, lipids,
metabolites, hormones, chemokines, and small molecules.
[0070] The term "antibody" as used herein refers to a protein that
is produced by activated B cells after stimulation by an antigen
and binds specifically to the antigen promoting an immune response
in biological systems and that typically consists of four subunits
including two heavy chains and two light chains. The term antibody
includes natural and synthetic antibodies, including but not
limited to monoclonal antibodies, polyclonal antibodies or
fragments thereof. Exemplary antibodies include IgA, IgD, IgG1,
IgG2, IgG3, IgM and the like. Exemplary fragments include Fab Fv,
Fab' F(ab').sub.2 and the like. A monoclonal antibody is an
antibody that specifically binds to and is thereby defined as
complementary to a single particular spatial and polar organization
of another biomolecule which is termed an "epitope". A polyclonal
antibody refers to a mixture of monoclonal antibodies with each
monoclonal antibody binding to a different antigenic epitope.
Antibodies can be prepared by techniques that are well known in the
art, such as immunization of a host and collection of sera
(polyclonal) or by preparing continuous hybridoma cell lines and
collecting the secreted protein (monoclonal).
[0071] The wording "specific" "specifically" or specificity" as
used herein with reference to the binding of a molecule to another
refers to the recognition, contact and formation of a stable
complex between the molecule and the another, together with
substantially less to no recognition, contact and formation of a
stable complex between each of the molecule and the another with
other molecules. Exemplary specific bindings are antibody-antigen
interaction, cellular receptor-ligand interactions, polynucleotide
hybridization, enzyme substrate interactions etc. The term
"specific" as used herein with reference to a molecular component
of a complex, refers to the unique association of that component to
the specific complex which the component is part of. The term
"specific"as used herein with reference to a sequence of a
polynucleotide refers to the unique association of the sequence
with a single polynucleotide which is the complementary
sequence.
[0072] The wording "polynucleotide-encoded protein" refers to a
polynucleotide-protein complex comprising a protein component that
specifically binds to, and is thereby defined as complementary to,
a target and an encoding polynucleotide attached to the protein
component. In some embodiments, the encoding polynucleotide
attached to the protein is protein-specific. Those embodiments can
be used to perform assays that exploit the protein-specific
interaction to detect other proteins, cytokines, chemokines, small
molecules, DNA, RNA, lipids, etc., whenever a target is known, and
sensitive detection of that target is required.
[0073] The term "polynucleotide-encoded antibody" as used herein
refers to a polynucleotide-encoded protein wherein the protein
component is an antibody. The term "attach" or "attached" as used
herein, refers to connecting or uniting by a bond, link, force or
tie in order to keep two or more components together, which
encompasses either direct or indirect attachment such that for
example where a first molecule is directly bound to a second
molecule or material, and the embodiments wherein one or more
intermediate molecules are disposed between the first molecule and
the second molecule or material.
[0074] The wording "substrate polynucleotide" as used herein refers
to a polynucleotide that is attached to a substrate so to maintain
the ability to bind to its complementary polynucleotide. A
substrate polynucleotide can be in particular comprised of a
sequence that specifically binds and is thereby defined as
complementary with an encoding-polynucleotide of a polynucleotide
encoded protein. The term "substrate" as used herein indicates an
underlying support or substratum. Exemplary substrates include
solid substrates, such as glass plates, microtiter well plates,
magnetic beads, silicon wafers and additional substrates
identifiable by a skilled person upon reading of the present
disclosure.
[0075] In the polynucleotide-encoded proteins herein disclosed each
protein specifically binds to, and is thereby defined as
complementary to, a pre-determined target, and each encoding
polynucleotide-specifically binds to, and is thereby defined as
complementary to, a pre-determined substrate polynucleotide.
[0076] In embodiments wherein the protein is an antibody, the
protein-target interaction is an antibody-antigen interaction. In
embodiments wherein the protein is other than an antibody, the
interaction can be receptor-ligand, enzyme-substrate and additional
protein-protein interactions identifiable by a skilled person upon
reading of the present disclosure. For example, in embodiments
where the protein is streptavidin, the protein-target interaction,
is a receptor-ligand interaction, where the receptor is
streptavidin and the ligand is biotin, free or attached to any
biomolecules.
[0077] Additionally, in the methods and systems herein disclosed
each substrate polynucleotide and encoding polynucleotide is
bindingly distinguishable from another. In some embodiments of the
methods and systems herein disclosed, each substrate polynucleotide
of a substrate is sequence specific and positionally
distinguishable from another.
[0078] The wording "bindingly distinguishable" as used herein with
reference to molecules, indicates molecules that are
distinguishable based on their ability to specifically bind to, and
are thereby defined as complementary to a specific molecule.
Accordingly, a first molecule is bindingly distinguishable from a
second molecule if the first molecule specifically binds and is
thereby defined as complementary to a third molecule and the second
molecule specifically binds and is thereby defined as complementary
to a fourth molecule, with the fourth molecule distinct from the
third molecule.
[0079] The wording "positionally distinguishable" as used herein
refers to with reference to molecules, indicates molecules that are
distinguishable based on the point or area occupied by the
molecules. Accordingly, positionally distinguishable substrate
polynucleotides are substrate polynucleotide that occupy different
points or areas on the substrate and are thereby positionally
distinguishable.
[0080] The polynucleotide-encoded protein herein disclosed can be
produced with common bioconjugation methods, such as chemical
cross-linking which include techniques relying on the presence of
primary amines in the protein to be bound (usually found on Lysine
residues). In particular, polynucleotide-encoded-protein can be
produced by the covalent conjugation strategy shown in FIGS. 1 and
2 for polynucleotide-encoded antibodies (FIG. 1) and a
polynucleotide-encoded streptavidin (FIG. 2).
[0081] In the embodiment illustrated in FIG. 1, 5'-aminated
polynucleotides are coupled to the antibody via a hydrazone linkage
(Kozlov, I. A.; Melnyk, P. C.; Stromsborg, K. E.; Chee, M. S.;
Barker, D. L.; Zhao, C. Biopolymers 2004, 73, 621-630), as
schematically illustrated in FIG. 1 and exemplified in Example
1.
[0082] Identical bioconjugation chemistry can be used for the
production of any polynucleotide-encoded-protein such as
polynucleotide-encoded streptavidin, as exemplified in Example 2
and illustrated in FIG. 2.
[0083] The number of encoding polynucleotides to be conjugated with
a particular polynucleotide-encoded protein can be varied. In
particular, the number of polynucleotides attached to the protein
component can be modulated to minimize the size and therefore the
steric hindrance of the pending moieties while still maintaining
binding specificity. The optimization can be performed by way of
procedures exemplified in Example 3 and illustrated in the related
in FIG. 3. In Example 3 and FIG. 3, different batches of
polynucleotide-encoded antibodies were made, in which the total
number of polynucleotides linked to each antibody were varied.
Because the encoding polynucleotides of FIG. 3 and Example 3
contained a fluorophore, the binding efficiency of each variant for
cell surface markers could be tested out using FACS. It should be
noted that there are other analogous techniques to measure and
optimize antibody binding affinity as a function of polynucleotide
loading, including techniques which directly measure the binding
kinetics of antibodies such as surface plasmon resonance (SPR) and
isothermal titration calorimetery (ITC).
[0084] In some embodiments, the number of encoding polynucleotides
to be attached to each protein can be any from 1 to 6. In some
embodiments, such as cell sorting, attaching 3 encoding
polynucleotides per protein provides the further advantage of
minimizing the steric effects of labeling and therefore allowing a
labeling of a polynucleotide-encoded protein with a plurality of
encoding polynucleotides for high affinity hybridization with the
complementary substrate polynucleotide.
[0085] The length of the polynucleotide forming the pending
moieties can also be controlled to optimize binding of the
polynucleotide-encoded protein to the substrate. In particular, the
length of the encoding polynucleotides can be optimized for
orthogonalization purposes as illustrated in Example 8 and FIG. 9
and further discussed below.
[0086] In the following detailed description reference will be
often made to embodiments wherein the polynucleotide-encoded
protein is a polynucleotide-encoded antibody. A skilled person will
be able to adapt the teaching provided for the
polynucleotide-encoded antibodies to other polynucleotide-encoded
proteins upon reading of the present disclosure.
[0087] The substrate polynucleotides can be produced by normal
techniques in the field. For example, first the polynucleotides can
be chemically synthesized. The polynucleotides can then be pin
spotted according the paradigm outlined by Pat Brown at Stanford
(Schena M, Shalon D, Davis R W, Brown P O. Science. 1995 Oct. 20;
270(5235): 467-70). The substrate polynucleotides so produced can
be then attached to a substrate according to techniques
identifiable by a skilled person upon reading of the present
disclosure. Particularly, suitable polynucleotides for the
production of substrate polynucleotides include at least 75 mers
long on polylysine substrates.
[0088] In some embodiments, the encoding polynucleotides and/or the
substrate polynucleotides are orthogonalized to minimize the
non-specific binding between encoding-polynucleotide and substrate
polynucleotide. Accordingly, orthogonalized polynucleotides include
polynucleotides whose sequence is computationally generated to
minimize incomplete base pairing, metastable states and/or other
secondary structures to minimize non specific interactions between
polynucleotides and non linear secondary interactions in the
polynucleotide usually associated with random generation of the
relevant sequences.
[0089] The term "orthogonalization" as used herein refers to the
process by which a set of polynucleotides are generated
computationally, in which incomplete base pairing, metastable
states and other secondary structures are minimized, such that a
polynucleotide only binds to its complementary strand and none
other. Exemplary orthogonalization techniques used in this
disclosure include orthogonalization performed according to the
paradigm outlined by Dirks et al. (Dirks, R. M.; Lin, M.; Winfree,
E.; Pierce, N. A. Nucleic Acids Research 2004, 32, (4),
1392-1403)
[0090] In particular, in some embodiments, the
encoding-polynucleotides and the corresponding complementary
substrate polynucleotides are orthogonalized polynucleotides having
the sequences from SEQ ID NO: 7 to SEQ ID NO 18 (see Example 8 and
related Table 1)
[0091] Additional orthogonalized polynucleotides can be further
identified by way of methods and procedures, such as in silico
orthogonalization (i.e. computerized orthogonalization) of
polynucleotides exemplified in Example 8 and illustrated in FIG. 9,
and additional procedures that would be apparent to a skilled
person upon reading of the present disclosure.
[0092] The methods and systems herein disclosed can be used for
performing assays for the detection of targets, including
mono-parameter assays, and multiparameter assays, all of which can
be performed as multiplex assays.
[0093] The term "monoparameter assay" as used herein refers to an
analysis performed to determine the presence, absence, or quantity
of one target. The term "multiparameter assay" refers to an
analysis performed to determine the presence, absence, or quantity
of a plurality of targets. The term "multiplex" or "multiplexed"
assays refers to an assay in which multiple assays reactions, e.g.,
simultaneous assays of multiple analytes, are carried out in a
single reaction chamber and/or analyzed in a single separation and
detection format.
[0094] In some embodiments, the methods and systems herein
disclosed can advantageously used to perform diagnostic assays,
wherein the target(s) to be detected are predetermined biomarkers
associated with a predetermined disease. Those embodiments are
particularly advantageous in a diagnostic approach where different
classes of biomaterials and biomolecules are each measured from a
different region of a typically heterogeneous tissue sample, thus
introducing unavoidable sources of noise that are hard to
quantitate.
[0095] In some embodiments of the methods and systems herein
disclosed, the polynucleotide-encoded protein and substrate
polynucleotide are used in combination as schematically illustrated
in FIG. 4 wherein the polynucleotide-encoded proteins are
polynucleotide-encoded antibodies.
[0096] In the embodiment of FIG. 4, a polynucleotide-encoded
antibody (10) is provided in combination with a substrate (100).
The polynucleotide-encoded antibody (10) is comprised of an
antibody (11) and an encoding-polynucleotide (12). The substrate
(100) has a substrate polynucleotide (120) bound to a substrate
surface. The encoding polynucleotide (12) is complementary to the
substrate polynucleotide (120) so that when contacted the substrate
polynucleotide (120) and the encoding polynucleotide (12)
hybridize.
[0097] In the embodiment shown in FIG. 4 the polynucleotide-encoded
antibodies herein disclosed form a protein array that can be
contacted with a sample to detect a target in the sample. The
embodiment of FIG. 4 is particularly advantageous for detecting
and/or sorting protein-targets.
[0098] In additional embodiments, particularly suitable for
detecting and/or sorting cells targets, some or all of the
polynucleotide-encoded antibodies are contacted with the sample
before contacting the polynucleotide-encoded-antibodies with the
complementary substrate polynucleotide. In those additional
embodiments, the antibodies and the one or more corresponding
targets can bind in absence of the substrate, e.g., in a solution
phase, where both molecules have a complete orientational freedom
and the access of the target to the binding pocket of the antibody
is not impaired by the substrate. Additionally, surface-induced
protein denaturation does not occur because the
polynucleotide-encoded antibodies remain in solution preserving the
tertiary fold of the protein. In addition, biofouling is minimized
(see also description below), so that the sensitivity and
specificity of the performed assay is improved as well as the
detectability of the antibody target complex bound to the
substrate, when compared to corresponding methods and system of the
art. Exemplary embodiments showing some of the above advantages are
illustrated in FIGS. 5, 7, 8 11 and 13.
[0099] In the methods and systems herein disclosed the
antibody-target complex bound to the substrate is eventually
detected from the substrate.
[0100] In some embodiments, detection of the complex is performed
by providing a labeled molecule, which includes any molecule that
can specifically bind a polynucleotide-encoded-protein target
complex to be detected (e.g. an antibody, aptamers, peptides etc)
and a label that provides a labeling signal, the label compound
attached to the molecule. The labeled molecule is contacted with
the polynucleotide-encoded protein-target complex and the labeling
signal from the label compound bound to the polynucleotide-encoded
protein-target complex on the substrate can then be detected,
according to procedure identifiable by a skilled upon reading of
the present disclosure and, in particular, of the Examples
section.
[0101] In embodiments wherein one or more targets and/or a
plurality of targets is detected described below in more details,
the labeled molecule can be formed of a plurality of labeled
molecules. Each labeled molecules comprises a molecule that
specifically binds one target of the one or more targets/plurality
of targets and a label compound attached to the molecule, the label
compound providing a labeling signal, each labeled molecule
detectably distinguishable from another.
[0102] The wording "detectably distinguishable" as used herein with
reference to labeled molecule indicates molecules that are
distinguishable on the basis of the labeling signal provided by the
label compound attached to the molecule. Exemplary label compounds
that can be use to provide detectably distinguishable labeled
molecules, include but are not limited to radioactive isotopes,
fluorophores, chemiluminescent dyes, chromophores, enzymes, enzymes
substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions,
nanoparticles, metal sols, ligands (such as biotin, avidin,
streptavidin or haptens) and additional compounds identifiable by a
skilled person upon reading of the present disclosure.
[0103] In some embodiments, the plurality of labeled molecules is
contacted with the plurality of polynucleotide-encoded
protein-target complexes for a time and under condition to allow
binding of the plurality of polynucleotide-encoded protein-target
complexes with the plurality of labeled molecules. The labeling
signal is then detected from the plurality of labeled molecules
bound to the plurality of polynucleotide-encoded protein-target
complexes on the substrate.
[0104] In some embodiments, the detection method can be carried
either via fluorescent based readouts, in which the labeled
antibody is labeled with fluorophore which includes but not
exhaustively small molecular dyes, protein chromophores, quantum
dots, and gold nanoparticles. In particular, in some embodiments,
in any of the methods and systems herein disclosed, detection can
be carried out on gold nanoparticle-labeled secondary detection
systems in which a common photographic development solution can
amplify the gold nanoparticles as further described below. Also, if
the readout comes from dark field scattering of gold particles,
single molecule digital proteomics is enabled. Additional
techniques are identifiable by a skilled person upon reading of the
present disclosure and will not be further discussed in
details.
[0105] The terms "label" and "labeled molecule" as used herein as a
component of a complex or molecule refer to a molecule capable of
detection, including but not limited to radioactive isotopes,
fluorophores, chemiluminescent dyes, chromophores, enzymes, enzymes
substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions,
nanoparticles, metal sols, ligands (such as biotin, avidin,
streptavidin or haptens) and the like. The term "fluorophore"
refers to a substance or a portion thereof which is capable of
exhibiting fluorescence in a detectable image. As a consequence the
wording and "labeling signal" as used herein indicates the signal
emitted from the label that allows detection of the label,
including but not limited to radioactivity, fluorescence,
chemoluminescence, production of a compound in outcome of an
enzymatic reaction and the likes.
[0106] In some embodiments, one specific target is detected. In
those embodiments contacting the polynucleotide-encoded antibodies
with the target can be performed before or after contacting the
polynucleotide-encoded antibody with the substrate.
[0107] The embodiments wherein contacting the polynucleotide
antibodies with the target is performed before contacting the
polynucleotide-encoded antibody with the substrate are particularly
suitable to sort or detect cells. In those embodiments, the
efficiency and specificity of the binding between antibody and
target is maximized even for a detection of a single target. A
possible, although non binding, explanation is that in the methods
and system herein disclosed the target capture is not driven by
antibody to cell surface marker interactions, but rather by the
increased avidity of antibody specific polynucleotide for the
corresponding strands on the microarray through cooperative
binding, greatly increasing capture efficiency. This advantage is
particularly relevant for target cells that can be efficiently
captured so that with this process it is typical to see a DNA spot
entirely occupied by a confluent layer of cells. (see Example 5 and
FIG. 5).
[0108] The embodiments wherein contacting the
polynucleotide-encoded antibodies with the target is performed
after contacting the polynucleotide-encoded antibody with the
substrate are particularly suitable to sort or detect proteins with
high sensitivity. Exemplary embodiments of methods and systems
herein disclosed wherein contacting the polynucleotide-encoded
antibodies with the target is performed after contacting the
polynucleotide-encoded antibody with the substrate are exemplified
in Examples 12, and 13 and illustrated in FIGS. 15, 19, 20, 21, 22,
23, 24(c). In those embodiments, competition for the same specific
substrate polynucleotide between a polynucleotide-encoded-proteins
bound to the target and polynucleotide-encoded-proteins not bound
to the target can be eliminated and the sensitivity of the assay
consequently increased. Further, in those embodiments the
concentration of polynucleotides on the substrate can be optimized
so that higher concentration of polynucleotide-encoded proteins can
be bound to the substrate, which will in turn result in higher
concentrations of correctly assembled complex, which in turn
increase the overall detection sensitivity, by virtue of
equilibrium thermodynamics law that govern each binding.
[0109] Monoparameter assays that can be performed with the methods
and systems exemplified in FIGS. 4 and 5 and in Example 5, include
but are not limited to, any assays for the detection of single
markers in serum, single protein detection in biological samples,
cell sorting according to one surface marker and further assays
identifiable by a skilled person upon reading of the present
disclosure.
[0110] In some embodiments, detection of a plurality of targets is
performed, according to a strategy schematically illustrated in
FIG. 6.
[0111] A plurality of polynucleotide-encoded antibodies (10, 20 and
30) is produced, each polynucleotide-encoded antibody able to
specifically bind to a predetermined target with the antibody
component (11, 21 and 31) and to bind to a complementary substrate
polynucleotide with the encoding-polynucleotide component. (12, 22
and 32). A substrate is generated with sequence specific
positionally distinguishable substrate polynucleotides (12, 122,
and 132).
[0112] The polynucleotide-encoded antibodies (10), (20) and (30)
are then contacted with the substrate polynucleotide (112), (122)
and (132) and upon binding of the antibody specific polynucleotide
with the corresponding substrate polynucleotide,
polynucleotide-encoded antibody complexes self assemble on the
substrate.
[0113] In the embodiment shown in FIG. 6, a protein array composed
of a plurality of bindingly distinguishable and positionally
distinguishable antibodies is produced. Those embodiments are
particularly advantageous for sorting and/or detecting different
protein-targets with a high sensitivity. Exemplary illustrations of
those embodiments are shown in Examples 9, 10 and 12 and in FIGS.
10, 12, 13 and 15a.
[0114] In additional embodiments, the plurality of
polynucleotide-encoded antibodies is contacted with a sample for
detection of the related target before contacting the substrate
polynucleotides. In those embodiments, the methods and systems
herein disclosed can be used to perform multiplexed multiparameter
assays wherein due to the improved sensitivity and selectivity
associated with binding of antibody and target in absence of a
substrate and in view of the reduced biofouling and protein
denaturation, a large number of biomarkers can be efficiently
detected in a quantitative and/or qualitative fashion. Exemplary
illustrations of those embodiments are shown in Examples 9, 10 and
12 and in FIGS. 10, 12, 13 and 15.
[0115] Multiparameter assays that can be performed with the methods
and systems exemplified in Examples 9, 10 and 12 and illustrated in
FIGS. 10, 12, 13 and 15 include but are not limited to any
proteomic analysis, tissue analysis, serum diagnostics, biomarker,
serum profiling, multiparameter cell sorting, single cell studies,
and additional assays identifiable by a person skilled in the art
upon reading of the present disclosure.
[0116] In some embodiments, the combined use schematically
illustrated in FIG. 6 can be applied in a method for sorting a
plurality of targets which is particularly advantageous when the
plurality of targets is composed of different types of cells, and
in particular primary cells. In those embodiments, the
polynucleotide-encoded antibody is preferably contacted with the
sample including the cells before contacting the substrate
according to procedure exemplified in Example 9 and illustrated in
FIG. 10.
[0117] Embodiments of the methods and systems wherein the plurality
of targets is composed of different types of cells are particularly
advantageous over corresponding methods and systems of the art such
as panning in which cells interact with surface marker-specific
antibodies printed onto an underlying substrate (Cardoso, A. A.;
Watt, S. M.; Batard, P.; Li, M. L.; Hatzfeld, A.; Genevier, H.;
Hatzfeld, J. Exp. Hematol. 1995, 23, 407-412). In particular, the
efficiency of cell capture on the substrate is improved with
respect to prior art methods and systems, due to the use of
polynucleotide to bind the antibody to the substrate (see FIG. 5
and FIG. 10). Additionally, those preferred embodiments do not have
the same limitations as conventional spotted protein microarrays,
such as antibodies that are not always oriented appropriately on a
surface, and/or antibodies that can dry out and lose
functionality.
[0118] Any of the embodiments to sort cells has several advantages
over methods and systems to sort cells known in the art such as
FACS, since the cells sorted by the methods and systems herein
disclosed are immediately available for post-sorting analysis of
gene and/or protein expression. In addition, the methods and
systems herein disclosed perform a spatially multiplexed sorting of
multiple cells that is particularly effective in sorting cells
according to multiple cells surface markers and is not limited by
the number of spectrally distinct fluorophores that can be utilized
to label the cell surface markers used for the sorting, as
exemplified in Example 9 and related FIG. 10.
[0119] In some embodiments the combined use depicted in FIG. 6 can
be applied to detection of a plurality of chemically distinct
targets according to the approach schematically illustrated in FIG.
11. In particular, the approach is illustrated for separation of a
plurality of distinct biomarkers such as DNA cells and proteins. In
the embodiment illustrated in FIG. 11, the methods and systems
herein disclosed are performed to separate cells (1) (see FIG. 11,
arrow A1) and analyze the relevant genomic and proteomic signature
(see FIG. 11, arrow A2) using a substrate (2) with a plurality of
substrate polynucleotides (3) attached thereto in a multiparameter
assay for the analysis of cells, genes and proteins.
[0120] In some of those embodiments, the sample is contacted with a
plurality of polynucleotide-encoded antibodies to allow formation
of a plurality of polynucleotide-encoded biomarker complexes that
are then contacted to a substrate such as a DNA array wherein the
antibody specific polynucleotides specifically bind the
corresponding DNA strands. In some embodiments, where detection of
a target polynucleotide is desired, a labeled polynucleotide that
specifically bind to the target polynucleotide can further be
contacted with the sample for the production of a labeled target
polynucleotide that specifically binds a predetermined DNA strands
on the substrate. The labeled target polynucleotide is eventually
contacted with the substrate polynucleotide and detected. According
to this approach, the cells, protein and DNA biomarkers are sorted
and then detected in a single substrate, thus allowing advantageous
performance of multiplexed multiparameter assays.
[0121] In those embodiments, by using polynucleotides as a common
assembly strategy for cells, cDNAs, and proteins, it is possible to
optimize the substrate conditions for high DNA loading onto the
spotted substrates, and for complementary DNA loading on the
antibodies. This and the reduced biofouling associated with
polynucleotide based binding of antibodies on the substrate, allows
performance of highly sensitive sandwich assays for protein
detection, as well as high efficiency cell sorting (compared with
traditional panning). An exemplary method and system to perform
detection of chemically different biomarkers is described in
Example 10 and illustrated in FIG. 13.
[0122] Assays to sort targets performable with the methods and
systems exemplified in Examples 9, 10, 12 and 13 and illustrated in
FIGS. 13, 10c, 10d 15a, 22, 23, 24, include any assay that requires
detection of a particular target (including but not limited to cell
targets, protein-target or gene targets) in a mixture, which will
be identifiable by a skilled person upon reading of the present
disclosure.
[0123] In some embodiments, high sensitivity detection of single or
multiple targets can be performed by using antibodies labeled with
metal nanoparticles for the detection, followed by electroless
metal deposition.
[0124] In those embodiments, any of the methods and systems herein
disclosed can be performed by using a metal nanoparticle (in
particular Au nanoparticles) as a labeling molecule to detect the
encoded-polynucleotide protein-target complex bound to the
substrate. In particular, a metal nanoparticle, such as a gold
nanoparticle, is conjugated to the labeled molecule (e.g., a second
antibody) used for labeling the polynucleotide-encoded
protein-target complex bound to the substrate. Metal particles,
such as Au nanoparticles, have unique optical properties in that a
particle that is much smaller than the wavelength of visual light
can still be readily imaged using light scattering. This allows for
an immunoassay to be read out by counting the nanoparticle labels
(and hence the proteins) using a light scattering microscope. This
approach is herein also defined as digital method or digital
DEAL--the counted number of particles represents the absolute
number of proteins captured via specific antibodies, with the
assumption that each nanoparticle corresponds to a single
protein.
[0125] FIGS. 16 and 17 show schematically an exemplary embodiment
of the methods and systems herein disclosed, wherein the labeling
molecule includes a metal nanoparticle such as a gold nanoparticle.
In particular, a gold nanoparticle (210) is attached via a linker
molecule (211) onto a 2.degree. antibody (212). On the 1 AB (213)
one or more ssDNA oligomers (214) are attached. The target to be
detected (217) is in a solution or biological environment. The
assay itself will be measured on a surface (216) that has been
coated with ssDNA' (215). Exemplary embodiments are further
illustrated in FIGS. 18 to 22 and exemplified in Example 13.
[0126] An advantage of some embodiments of the methods and systems
herein disclosed when metal nanoparticles are used for labeling is
that there is no need to calibrate the immunoassay each time a
protein measurement is done, since amount of protein counted
represents an absolute measurement. Fluorescence or absorbance
assays, by comparison, represent relative measurements, since they
are dependent upon background fluorescence (absorbance) levels,
light amplification electronics, photobleaching effects (for
fluorescence), etc. The nanoparticle-based digital methods and
systems herein disclosed can be advantageously used for: (1) the
ultrasensitive detection of proteins at high attoMolar levels
(10.sup.3-10.sup.6 fold improvement over conventional ELISA
immunoassays) and over a broad concentration range; (2) the
multiplexed detection of several proteins on the same chip; and (3)
the detection of extracellular signaling molecules, cytokines, in
human patient sera.
[0127] Some embodiments of the methods and systems herein disclosed
wherein labeling and detection is performed by using metal
nanoparticles is based on a detection system, such as a Raleigh
scattering mechanism that allows for the indirect visualization of
individual plasmonic nanoparticles, in this case 40 nm Au
nanoparticles, that are conjugated to detection antibodies to
realize single protein counting. A graphical software interface can
be utilized to digitally count the absolute number of particles and
to thus quantitate the amount of proteins. Those embodiments are in
sharp contrast to conventional quantitation methods using averaged
signal readout after amplification. In conjunction with the DNA
encoded antibody library technique, the methods and systems herein
disclosed that use metal nanoparticles as label compounds are able
to multiplex the detection by simultaneously counting different
kinds of proteins from the same biological sample.
[0128] A further advantage of the methods and systems herein
disclosed wherein metal nanoparticles are used as label compounds
over highly sensitive protein detection techniques of the art that
are based upon variants of the ELISA scheme are the possibility to
eliminate an amplification of the signal and associated additional
noise and time required for performance. The prior art methods all
require some sort of amplification step, and each method requires
some level of calibration that must be carried out for every assay
performed. For example, methods in which the 2.degree. AB is
labeled with DNA, and that DNA is amplified using the polymerase
chain reaction (PCR) have been reported. It is this amplified DNA
that is detected and then correlated to the measured protein
concentration. In another variant, the 2.degree. AB is labeled with
a gold nanoparticle, and then silver metal is deposited (via
electroless deposition) onto that gold nanoparticle in order to
generate an amplified absorbance signal. For both of those cases,
the amplification step itself introduces noise into the assay, and
requires an additional amount of time--often a significant amount
of time.
[0129] An additional advantage of the methods and systems herein
disclosed that use metal nanoparticles over the above mentioned
prior art methods is that none of the prior art methods are
digital--meaning none of those methods involve actually counting
the numbers of proteins, but instead measure relative signals, such
as fluorescence or absorbance. This implies that they must be
calibrated. On the contrary, once the assays performed with the
methods and systems herein disclosed that use metal nanoparticles
as label compound, has been characterized, there is no need for
calibration, since the counting of proteins produces an absolute
number that can be correlated to protein concentration.
[0130] This application would be particularly advantageous for
detection the field of proteomics (FIGS. 21 an 22), and/or
detection of biomarkers present at a very low concentration in a
small volume sample, e.g., a drop of blood (FIGS. 19 and 20).
[0131] In additional embodiments, the substrate of any of the
methods and systems herein disclosed can be associated with a
microfluidic component so to allow performance of microfluidic
based assays. Microfluidic-based assays offer advantages such as
reduced sample and reagent volumes, and shortened assay times
(Breslauer, D. N.; Lee, P. J.; Lee, L. P. Mol. BioSyst. 2006, 2,
97-112). For example, under certain operational conditions, the
surface binding assay kinetics are primarily determined by the
analyte (protein) concentration and the analyte/antigen binding
affinity, rather than by diffusion (Zimmermann, M.; Delamarche, E.;
Wolf, M.; Hunziker, P. Biomedical Microdevices 2005, 7, (2),
99-110).
[0132] The term "microfluidic" as used herein refers to a component
or system that has microfluidic features e.g. channels and/or
chambers that are generally fabricated on the micron or sub-micron
scale. For example, the typical channels or chambers have at least
one cross-sectional dimension in the range of about 0.1 microns to
about 1500 microns, more typically in the range of about 0.2
microns to about 1000 microns, still more typically in the range of
about 0.4 microns to about 500 microns. Individual microfluidic
features typically hold very small quantities of fluid, e.g from
about 10 nanoliters to about 5 milliliters, more typically from
about 100 nanoliters to about 2 milliliters, still more typically
from about 200 nanoliters to about 500 microliters, or yet more
typically from about 500 nanoliters to about 200 microliters.
[0133] The microfluidic components can be included in an integrated
device. As used herein, "integrated device" refers to a device
having two (or more) components physically and operably joined
together. The components may be (fully or partially) fabricated
separate from each other and joined after their (full or partial)
fabrication, or the integrated device may be fabricated including
the distinct components in the integrated device. An integrated
microfluidic array device includes an array component joined to a
microfluidic component, wherein the microfluidic component and the
array component are in operable association with each other such
that an array substrate of the array component is in fluid
communication with a microfluidic feature of the microfluidic
component. A microfluidic component is a component that includes a
microfluidic feature and is adapted to being in operable
association with an array component. An array component is a
component that includes a substrate and is adapted to being in
operable association with a microfluidic component.
[0134] The microfluidic systems can also be provided in a modular
form. "Modular" describes a system or device having multiple
standardized components for use together, wherein one of multiple
different examples of a type of component may be substituted for
another of the same type of component to alter the function or
capabilities of the system or device; in such a system or device,
each of the standardized components being a "module".
[0135] Exemplary embodiments of the methods and systems herein
disclosed to perform microfluidic assays are described in Examples
10 and 11 and illustrated in FIGS. 13 and 14.
[0136] In microfluidic embodiments of the methods and systems
herein disclosed, measurements of large panels of protein
biomarkers within extremely small sample volumes and a very reduced
background/biofouling are possible (see FIG. 14).
[0137] In the microfluidic embodiments of the methods and systems
herein disclosed, the sensitivity of the assay can also be
increased to detect targets at a concentration as low as 10 fM,
including biomarkers (e.g. proteins in human sera) previously
considered below detectable levels by any other techniques.
[0138] In the exemplified embodiments, such result is obtained by
increasing the loading capacity of the substrate and by using
antibodies labeled with metal nanoparticles for the detection,
followed by electroless metal deposition (see Example 11 and FIG.
14(c)).
[0139] Additionally, since in the exemplified embodiments spatial,
rather than colorimetric multiplexing, is utilized in the methods
and system herein disclosed, a fluorescence based read out can be
transformed into an optical one. The microfluidic methods and
systems herein disclosed accordingly allow optical read out of
assays that are 100-1000 fold more sensitive than corresponding
methods and system of the art (see FIG. 14). Accordingly, a further
advantage of the microfluidic methods and systems herein disclosed
is the possibility of using said methods and systems as a digital
technique--i.e. a technique for the quantitative detection of
protein via single molecule counting. This application would be
particularly advantageous for detection in the field of proteomics
(FIG. 14), and/or detection of biomarkers present at a very low
concentration in a small volume sample (e.g., a drop of blood)
[0140] Additionally, the microfluidic methods and systems herein
disclosed allow performance of both (i) mono step assays (wherein
the polynucleotide-encoded antibodies the target(s) and labeled
antibodies are contacted in a single step) and (ii) multi-steps
assays (wherein the substrate is sequentially exposed to
polynucleotide-encoded antibodies, target(s), and then secondary
antibody) in a reduced amount of time, with samples reduced in size
and with a higher sensitivity when compared with corresponding
microfluidic methods and system of the art and with other
non-microfluidic methods and systems for molecule detection (see
Examples 11 and 12).
[0141] An additional advantage associated with microfluidic methods
and systems herein disclosed includes the possibility of performing
in a microfluidic environment any assay that involves
substrate-supported antibodies, which would not have survived
microfluidic chip assembly with the use of previous techniques.
[0142] Further advantages associated with the methods and systems
herein disclosed are: the possibility of performing sensitive
measurements using low cost reagents, such as glass, and plastic;
and of using the substrate in combination with additional
components for sample pretreatment and purification
[0143] The methods and systems herein disclosed allow the
multiplexed multiparameter detection, sorting and of biomarkers of
interest and related diagnostic analysis. Exemplary illustration of
applications of the methods and systems herein disclosed for
diagnostic analysis are described in Example 14 and shown in FIGS.
23 and 24, and any additional assay identifiable by a skilled
person upon reading of the present disclosure.
[0144] The systems herein disclosed can be provided in the form of
arrays or kits of parts. An array sometimes referred to as a
"microarray"includes any one, two or three dimensional arrangement
of addressable regions bearing a particular molecule associated to
that region. Usually the characteristic feature size is
micrometers. FIGS. 4, 5, 6, 7, 8, 9 and 10 provide exemplary
microarrays.
[0145] In a kit of parts, the polynucleotide-encoded proteins and a
substrate are comprised in the kit independently. The
polynucleotide-encoded protein is included in one or more
compositions, and each polynucleotide-encoded protein is in a
composition together with a suitable vehicle carrier or auxiliary
agent.
[0146] The substrate provided in the system can have substrate
polynucleotide attached thereto. In some embodiments, the substrate
polynucleotides can be further provided as an additional component
of the kit. Additional components can include labeled
polynucleotides, labeled antibodies, labels, microfluidic chip,
reference standards, and additional components identifiable by a
skilled person upon reading of the present disclosure. In
particular, the components of the kit can be provided, with
suitable instructions and other necessary reagents, in order to
perform the methods here disclosed. The kit will normally contain
the compositions in separate containers. Instructions, for example
written or audio instructions, on paper or electronic support such
as tapes or CD-ROMs, for carrying out the assay, will usually be
included in the kit. The kit can also contain, depending on the
particular method used, other packaged reagents and materials (i.e.
wash buffers and the like).
[0147] Further details concerning the identification of the
suitable carrier agent or auxiliary agent of the compositions, and
generally manufacturing and packaging of the kit, can be identified
by the person skilled in the art upon reading of the present
disclosure.
EXAMPLES
[0148] The methods and system herein disclosed are further
illustrated in the following examples, which are provided by way of
illustration and are not intended to be limiting.
Example 1
Production of Polynucleotide-Encoded Antibodies
[0149] DNA encoded antibodies were generated according to the two
step strategy illustrated in FIG. 1. In particular, an aldehyde
functionality was introduced to the 5'-aminated oligonucleotide via
succinimide chemistry, using commercially available reagents (FIG.
1 Panel a). Similarly, a hydrazide moiety was introduced via
reaction with the lysine side chains of the respective antibody
(FIG. 1 Panel a). DNA-antibody conjugate formation was then
facilitated via stoichiometric hydrazone bond formation between the
aldehyde and hydrazide functionalities. Conjugate formation and
control over DNA-loading was verified by PAGE electrophoresis (FIG.
1 Panel b).
[0150] To perform those experiments, AlexaFluor 488, 594, and
647-labeled polyclonal Goat anti-Human IgGs were purchased from
Invitrogen. Monoclonal Rabbit anti-Human Interleukin-4 (clone:
8D4-8), non-fluorescent and APC-labeled Rabbit anti-Human Tumor
Necrosis Factor-.alpha.(clones: MAb1 and MAb11, respectively), and
non-fluorescent and PE-labeled Rabbit anti-Human Interferon-.gamma.
(clones: NIB42 and 4S.B3, respectively) were all purchased from
eBioscience. Non-fluorescent and biotin-labeled mouse anti-Human
Interleukin-2 (clones: 5344.111 and B33-2, respectively) were
purchased from BD Biosciences. All DNA strands were purchased with
a 5'-amino modification from the Midland Certified Reagent company.
Sequences for all six 26-mers and their respective designations are
given in Table I below together with the respective name/identifier
by which the sequences are listed in the enclosed Sequence
Listing
TABLE-US-00001 TABLE 1 Name/ identi- fier Sequence SEQ ID A1:
5'-NH2-AAAAAAAAAACGTGACATCATGCATG-3' NO 1 SEQ ID
3'-GCACTGTAGTACGTACAAAAAAAAAA-NH2-5':A1' NO 2 SEQ ID B1:
5'-NH2-AAAAAAAAAAGGATTCGCATACCAGT-3' NO 3 SEQ ID
3'-CCTAAGCGTATGGTCAAAAAAAAAAA-NH2-5':B1' NO 4 SEQ ID C1:
5'-NH2-AAAAAAAAAATGGACGCATTGCACAT-3' NO 5 SEQ ID
3'-ACCTGCGTAACGTGTAAAAAAAAAAA-NH2-5':C1' NO 6
[0151] Prior to use, all antibodies were desalted, buffer exchanged
to pH 7.4 PBS and concentrated to .about.1 mg/ml using 3000 MWCO
spin filters (Millipore.TM.).
[0152] Hydrazide groups were introduced in parallel onto a
monoclonal antibody and 5' aldehyde modified single-stranded DNA
was prepared from 5' aminated oligomers (see FIG. 1 Panel a).
[0153] In particular, succinimidyl 4-hydrazinonicotinate acetone
hydrazone in DMF (SANH, Solulink.TM.) was added to the antibodies
at variable molar excess of (1000:1 to 5:1) of SANH to antibody. In
this way the number of hydrazide groups introduced to the
antibodies was varied. Separately, succinimidyl 4-formylbenzoate in
DMF (SFB, Solulink.TM.) was added at a 20-fold molar excess to 5'
aminated 26mer oligomers in PBS. This ratio of SFB to DNA ensured
complete reaction of the 5' amine groups to yield 5' aldehydes. No
further improvement in yield was observed for both the antibody and
oligonucleotide coupling reactions after 4 hours at room
temperature. Excess SANH and SFB were removed and samples buffered
exchanged to pH 6.0 citrate buffer using protein desalting spin
columns (Pierce.TM.).
[0154] A 20-fold excess of derivatized DNA was then combined with
the antibody and allowed to react overnight at room temperature and
form the DNA encoded antibody shown in FIG. 1 Panel b. Non-coupled
DNA was removed with size exclusion spin columns (Bio-Gel P-30,
Bio-Rad.TM.) or purified using a Pharmacia Superdex 200 gel
filtration column at 0.5 ml/min isocratic flow of PBS. The
synthesis of DNA-antibody conjugates was verified by non-reducing
7.5% Tris-HCl SDS-PAGE at relaxed denaturing conditions of
60.degree. C. for 5 minutes, and visualized with a Molecular Imager
FX gel scanner (Bio-Rad). Conjugation reactions involving
fluorescent antibodies or fluorescently-labeled oligonucleotides
were imaged similarly using appropriate excitation and emission
filters.
[0155] Varied oligomer (strand A1') loading unto .alpha.-human IL-4
was measured by gel mobility shift assay (see FIG. 1 Panel b). By
varying the stoichiometric ratios of SANH to antibody (lanes I-IV
corresponds to 300:1, 100:1, 50:1, 25:1 respectively), the average
number of attached oligonucleotides can be controlled.
[0156] Noticeably, although the above mentioned approach to
conjugate synthesis is expected to result in a distribution of DNA
loadings for each antibody, this effect might be affected by the
methods for performing PAGE analysis. It was in particular observed
that normal conditions for the heat-induced denaturation proceeding
gel electrophoresis (100.degree. for 5 minutes) reduced the number
of DNA-strands visualized, presumably by breaking the hydrazone
linkage between the DNA and the protein. By relaxing the denaturing
conditions, a sample heated at 60.degree. for 5 minutes (minimum
required for good gel) showed up to 7 discrete bands, whereas the
same sample heated at 100.degree. for 5 minutes showed no pendant
oligonucleotides
Example 2
Production of Polynucleotide-Encoded Streptavidin
[0157] The production of DNA encoded streptavidin was performed
according to the same approach illustrated in Example 1 for
production of DNA encoded antibodies. The only difference was that
the SANH:streptavidin ratio was kept constant at 100:1.
Example 3
Optimization of Polynucleotides Loading of Polynucleotide-Encoded
Antibodies
[0158] The adverse steric effects of tagging antibodies with
oligonucleotides are of concern when performing various assays,
such as the immunoassays and cell sorting/capture experiments
described herein. For this reason, the ability of DNA-encoded
antibodies to retain recognition of cell surface markers, was
investigated, as visualized by fluorescence activated cell sorting
(FACS). By using a fluorophore covalently-tagged onto the DNA, but
not the antibody, FACS was used to optimize DNA-loading for the
polynucleotide-encoded conjugates. For the analysis, 5' aminated,
3' FITC-labeled DNA was tagged unto .alpha.-CD90.2 antibodies at
various stoichiometric ratios of SANH to antibody (5:1, 25:1, 50:1,
100:1, 300:1). This produced, on average, conjugates with 1, 2, 3,
4-5 and 6-7 strands of FITC-DNA respectively, as measured by gel
mobility shift assays see Panel d, FIG. 1. These conjugates were
tested for their ability to bind to the T cell line VL3 (CD90.2
expressing), by monitoring the FITC fluorescence with the flow
cytometer. The B cell line A20 (CD90.2 negative) was used as a
negative control (see FIG. 3 Panels a and b).
[0159] In particular, VL3 and A-20 cells were incubated for 20 min.
on ice with 0.5 .mu.g of FITC-conjugated Rat Anti-Mouse CD90.2
(Thy1.2, BD Pharmingen, clone 30-H12, catalog #553012) in 100 .mu.L
PBS-3% FCS. Cells were also incubated with equimolar amounts of
.alpha.-CD90.2/FITC-DNA conjugates characterized by various
FITC-DNA loadings. Cells were washed once with PBS-3% FCS and then
were analyzed by flow cytometry on a BD FACSCanto.TM. instrument
running the BD FACSDiva.TM. software.
[0160] The results are shown in FIG. 3 where FACS plot (Panel a)
and histograms (Panel b) comparing .alpha.-CD90.2/FITC-DNA
conjugates with the commercially-available FITC .alpha.-CD90.2
antibody (no DNA) are shown.
[0161] As shown in FIG. 3, the conjugates bind to VL3 cells (100%)
with minimal non-specific interactions with A20 (1.3%). When
compared with FITC .alpha.-CD90.2, the overall fluorescent
intensities are lower by a factor of 10, with slightly higher
non-specific binding to A20. The histogram of the mean fluorescent
intensities for various FITC-DNA loadings illustrated in Panel b
shows that the fluorescence increases are roughly linear when the
number of DNA strands is increased from 1 to 2 to 3, corresponding
to the 1, 2 and 3 chromophores (1 per strand). For higher loadings,
the fluorescence plateaus and then decreases.
[0162] In particular, at higher loadings, the increase in
fluorescence first plateaus (4-5 oligomers) and then decreases up
to the highest loading (6-7 oligomers). Thus, excess DNA labels
(4-7 oligomers) did sterically reduce the ability of antibodies to
recognize cell surface markers. Optimal loading for cell surface
marker recognition was achieved with antibodies synthesized with
the 50:1 SANH:antibody ratio--corresponding to approximately three
DNA strands per antibody. Subsequent cell sorting experiments were
performed in consideration of this observation. When compared with
the FITC .alpha.-CD90.2 control, the DNA antibody conjugates had
reduced fluorescence by a factor of 10 and slightly higher
nonspecific binding to A20 cells. A likely factor is that the
stoichiometric ratio of fluorophore to antibody for the DNA
antibody conjugates versus the commercial antibody is different.
For the DNA antibody conjugates, each strand of DNA is attached to
one fluorophore only (i.e. conjugates with one DNA strand has a
fluorophore to antibody ratio of 1:1) whereas the commercial
antibodies generally have more than one fluorophore per antibody
(i.e. fluorescent antibodies have a fluorophore to antibody
ratio>1).
[0163] Thus the factor of 10 less fluorescence should not be
strictly interpreted as a 10.times. reduction in the binding
affinity of the DNA antibody conjugates, although it is possible
that the oligomer steric effects discussed earlier do account for
some reduction in relative fluorescence intensity. Direct
measurement of the affinity of the DNA antibody conjugate compared
with the corresponding unmodified antibody using methods like
Surface Plasmon Resonance (SPR) can provide more conclusive
information.
[0164] A further optimization of polynucleotides loading of the
polynucleotide-encoded-antibodies was performed as follows. Two
different lengths of complementary polynucleotides were invested.
One set had an overlap of 16 bases, the other an overlap of 20
bases. Orthogonal DNA sequences for set of 16 or 20 were designed
according to procedures exemplified in Example 8 below, and it was
discovered empirically that 16 bases did not have the variability
in the total number of sequences possible to generate large numbers
of orthogonal sequences. In moving to 20 bases, the initial pool of
possible sequences dramatically increased and computing orthogonal
sequences seemed to be much easier. It should be noted that the
total number of possible sequences is exponential, (4.sup.n, where
n is the length of the complementary region).
Example 4
Microarray Fabrication
[0165] DNA microarrays were printed via standard methods by the
microarray facility at the Institute for Systems Biology
(ISB--Seattle, Wash.) onto amine-coated glass slides. In
particular, the DNA microarrays were printed with various
combination of oligomers having sequences SEQ ID NO 2, SEQ ID NO 4,
SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14,
SEQ ID NO 16, and SEQ ID NO 18,
[0166] Typical spot size and spacing were 150 and 500 .mu.m,
respectively. Poly-lysine slides were made in house. Blank glass
slides were cleaned with IPA and water in a sonication bath for 10
minutes each. They were then treated with oxygen plasma at 150 W
for 60 sec., and then quickly dipped into D1 water to produce a
silanol terminated, highly hydrophilic surface. After drying them
with a nitrogen gun, poly-L-lysine solution (Sigma P8920, 0.1% w/v
without dilution) was applied to the plasma treated surfaces for 15
minutes, and then rinsed off with D1 water for several seconds.
Finally, these treated slides were baked at 60.degree. C. for 1 hr.
These slides were then sent to ISB and printed as described
above.
Example 5
Monoparameter Polynucleotide-Encoded Antibody-Based
Immunoassays
[0167] FIG. 5 is an example of using DNA-encoded streptavidin to
perform cell sorting experiments. Here the DNA-encoded streptavidin
is first exposed to its ligand, biotin labeled protein at a ratio
of 4:1 biotin-MHC: DNA-encoded streptavidin. Here the protein is
the major histocompatiblity complex (MHC). Both the panning analog
and solution phase cell capture experiments are performed in
parallel. In particular, 5 ul of Streptavidin-C3' is combined with
20 ul of tyrosinase MHC in 200 ul of RPMI media. They are allowed
to assemble on ice for 20 min. After which, for the panning analog,
the tetramer is allowed to bind to the substrate for 30 minutes and
rinsed in PBS before subsequence exposure of 2.times.10.sup.6 cells
onto the array. In Panel b, DNA-encoded MHC is first allowed to
bind to the same number of cells on ice for 20 min. before
subsequent exposure to the underlying DNA array. The cell capture
efficiencies between the two panels are apparent. Solution phase
capture for pMHC complexes is much higher than the panning analog.
Of notice is the enhanced cell capture efficiency of the latter
series of events.
Example 6
Protein Arrays Including Polynucleotide-Encoded Antibody
[0168] The polynucleotide-encoded protein approach for spatially
localizing antibodies was demonstrated using three identical goat
anti-human IgGs, each bearing a different molecular fluorophore and
each encoded with a unique DNA strand. A solution containing all
three antibodies was then introduced onto a microarray spotted with
complementary oligonucleotides. After a two-hour hybridization
period and substrate rinse, the antibodies self-assembled according
to Watson-Crick base-pairing.
[0169] In particular, antibody microarrays were generated by first
blocking the DNA slide with 0.1% BSA in 3.times.SSC for 30 minutes
at 37.degree. C. The slides were washed with dH.sub.2O and blown
dry. A 30 .mu.l solution containing DNA-antibody conjugates
(3.times.SSC, 0.1% SDS, 0.1% BSA, 15 ng/.mu.l of each conjugate)
was sandwiched to the array with a microscope slide, and incubated
at 37.degree. C. for 4 hours. Arrays were then washed first in
1.times.SSC, 0.05% SDS at 37.degree. C. with gentle agitation, then
at 0.2.times.SSC, then finally at 0.05.times.SSC. The slides were
blown dry and scanned with a Gene Pix 4200 A two-color array
scanner (Axon Instruments.TM.).
[0170] For the immunoassays, the DNA-encoded 1.degree. antibody (15
ng/.mu.l), antigen (3 ng/.mu.l) and fluorescently-labeled 2.degree.
antibody (0.5 ng/.mu.l) were combined in a single tube. After 2
hour incubation at 37.degree. C., the formed
antibody-antigen-antibody complexes were introduced to the
microarrays as described above in Example 3. Subsequent wash steps
and visualization were identical
[0171] In particular, three biochemically identical goat
.alpha.-human IgG (labeled with Alexa488, Alexa594, or Alexa 647
dyes) were tagged with oligos A1', B1' and C1' respectively. After
a 2-hour incubation, antibody/DNA conjugates were localized to
specific sites dictated by the underlying DNA microarray.
[0172] The results are shown in FIGS. 6 and 7, wherein a spatially
encoded-protein array with a scale bar that corresponds to 1 mm is
shown. As it is evident from FIG. 7, the antibodies assemble with
the DNA on the substrate thus converting the >900 spot
complementary DNA chip into a multi-element antibody microarray
(see FIG. 7). This observation implied that quite large antibody
arrays can be assembled in similar fashion.
Example 7
Reduction of Biofouling
[0173] The ultimate size of any protein array is likely be limited
by interference from non-specific binding of proteins. In an effort
to visualize the contributions of non-specific binding, three
antibodies were similarly introduced onto a microarray: two
antibodies having complementary DNA-labeling spotted
oligonucleotides and a third unmodified antibody. In particular, a
microarray was simultaneously exposed to goat .alpha.-human
IgG-Alexa488/A1', goat .alpha.-human IgG-Alexa647/C1'
polynucleotide-encoded conjugates and goat .alpha.-human
IgG-Alexa594 with no pendant DNA.
[0174] For demonstration purposes, the slide was not thoroughly
rinsed following hybridization and accordingly a high background
signal due to non-specific adsorption of non-encoded
fluorescently-labeled antibody was observed.
[0175] The results are shown in FIG. 8 that is an illustration of
the resistance of the polynucleotide encoded-protein approach
towards non-specific protein absorption.
[0176] When the arrays were not fully blocked and/or rinsed,
non-specific binding was observed on the surface of the glass
slide, but not on the non-complementary spots of printed DNA, i.e.,
spot B1 did not have fluorescence from non-complementary IgG
conjugates nor did it exhibit fluorescence from proteins not
encoded with DNA (goat .alpha.-human IgG-Alexa594).
[0177] The spotted nucleotide regions, to which no antibody was
chemically encoded, displayed much less non-specifically attached
protein, implying that DNA greatly diminishes active area
biofouling. Such retardation of biofouling is reminiscent of
substrates that are functionalized with polyethyleneglycol (PEG)
(Prime, K. L.; Whitesides, G. M. Science 1991, 252, 1164-1167.
Prime, K. L.; Whitesides, G. M. J. Am. Chem. Soc. 1993, 115, (23),
10714-10721). By analogy with postulated mechanisms associated with
PEG (Jeon, S. 1.; Lee, J. H.; Andrade, J. D.; De Gennes, P. G.
Journal of Colloid and Interface Science 1991, 142, (1), 149-158.
Jeon, S. I.; Andrade, J. D. Journal of Colloid and Interface
Science 1991, 142, (1), 159-166. Andrade, J. D.; Hlady, V. Advances
in Polymer Science 1986, 79, (1-63)), the Applicants hypothesize
that the hydrophilic nature of the spotted oligonucleotides
minimizes interactions with hydrophobic portions of proteins often
exposed during non-specific adsorption. Conjugate hybridization
experiments were also carried out within 5 degrees of the
calculated duplex melting temperatures, taking advantage of
Watson-Crick stringencies and thus diminishing non-complementary
DNA interactions. In any case, this reduced biofouling means that
the polynucleotide-encoded-protein method can likely be harnessed
to detect reasonably large panels of proteins within a single
environment.
Example 8
In Silico Polynucleotide Orthogonalization
[0178] Another important empirical observation is the level of
cross talk between non-complementary DNA strands. The DNA sequences
A1, B1, C1 along with their complements were generated randomly.
The inclusion of a 5' A.sub.10 segment for flexibility and a
recognition length of 16 bases were the only constraints. In
running the experiments, it was discovered that there is a low but
appreciable amount of noise generated from mismatched sequences due
to non-linear secondary interactions. Stringency washes alone were
not able to clean the noise appreciably. In any realistic
multiparameter platform, this noise can grow in proportion to the
number of parameters in investigation. Thus, the model platform
should utilize DNA sequences which are orthogonal to each other and
also orthogonal to all the exposed complementary strands printed on
the DNA array.
[0179] As a consequence, DNA sequences were designed with the
objective of minimizing any intra- and intermolecular interactions
between the sequences and the complementary targets, at 37.degree.
C. The computational design was performed using the paradigm
outlined by Dirks et al. (Dirks, R. M.; Lin, M.; Winfree, E.;
Pierce, N. A. Nucleic Acids Research 2004, 32, (4), 1392-1403). In
particular, six orthogonal sequences have been designed and
empirically verified and are reported in Table 2.
TABLE-US-00002 TABLE 2 Corresponding substrate
Encoding-polynucleotide polynucleotide SEQ ID NO: 7 SEQ ID NO: 8
AAAAAAAAAAATCCTGGAGCTAAGTCCGTA AAAAAAAAAATACGGACTTAGCTCCAGGAT SEQ
ID NO: 9 SEQ ID NO: 10 AAAAAAAAAAGCCTCATTGAATCATGCCTA
AAAAAAAAAATAGGCATGATTCAATGAGGC SEQ ID NO: 11 SEQ ID NO:12
AAAAAAAAAAAGCACTCGTCTACTATCGCTA AAAAAAAAAATAGCGATAGTAGACGAGTGC SEQ
ID NO: 13 SEQ ID NO: 14 AAAAAAAAAAATGGTCGAGATGTCAGAGTA
AAAAAAAAAATACTCTGACATCTCGACCAT SEQ ID NO:15 SEQ ID NO:16
AAAAAAAAAAATGTGAAGTGGCAGTATCTA AAAAAAAAAATAGATACTGCCACTTCACAT SEQ
ID NO:17 SEQ ID NO:18 AAAAAAAAAAATCAGGTAAGGTTCACGGTA
AAAAAAAAAATTACCGTGAACCTTACCTGAT
[0180] A skilled person can identify additional orthogonalized
polynucleotides upon reading of the present disclosure.
Example 9
Cell Capture, Separation, and Sorting Methods
[0181] The optimization and use of the
polynucleotide-encoded-protein for multiplexed cell sorting was
demonstrated by using DNA labeled antibody.
[0182] Two murine cell lines, VL-3 T cells (thymic lymphoma line
(Groves, T.; Katis, P.; Madden, Z.; Manickam, K.; Ramsden, D.; Wu,
G.; Guidos, C. J. J. Immunol. 1995, 154, 5011-5022)) and A20 B
cells (mouse B cell lymphoma (Kim, K. J.; Langevin, C. K.; Merwin,
R. M.; Sachs, D. H.; Asfsky, R. J. Immunol. 1979, 122, 549-554),
purchased from ATCC) were engineered to express mRFP and EGFP,
respectively, using standard retroviral transduction protocols.
Antibodies against surface markers for each of these cell lines,
.alpha.-CD90.2 for VL-3 and .alpha.-B220 for A20 (eBioscience),
were encoded as described above with DNA strands A1' and B1',
respectively.
[0183] For sorting experiments, cells were passaged to fresh
culture media [RPMI 1640 (ATCC) supplemented with 10% fetal bovine
serum, 0.1 mM non-essential amino acids and 0.05 mM
.beta.-mercaptoethanol] at a concentration of 10.sup.6 cells/100
.mu.l media and incubated with DNA-antibody conjugate (0.5
.mu.g/100 .mu.l) for 30 minutes on ice. Excess conjugate was
removed from the supernatant after centrifugation, after which
cells were resuspended in fresh media. Prior to cell incubation the
microarray slide was passivated, to reduce non-specific cell
adhesion, by reaction of the residual amine groups with
methyl-PEO.sub.2-NHS ester (Pierce) 10 mM in pH=7.4 PBS for 4 hours
at room temperature. Cells were spread evenly across the microarray
surface and allowed to localize for one hour on ice. After this
period, non-adherent cells were removed with gentle washing with
room temperature Tris-buffered saline solution including 1 mM
MgCl.sub.2. Cell enrichment experiments were performed identically
except that all incubation steps were performed in the presence of
a 1:1 mixture of both T- and B-cells (each at 10.sup.6/100
.mu.l).
[0184] Primary CD4+ and CD8+ T cells were purified from EGFP and
dsRed transgenic mice (obtained from Jackson Laboratories),
respectively, using standard magnetic bead negative selection
protocols and the BD IMagTM cell separation system. Prior to
polynucleotide-encoded based fractionation, the purity of these
populations was analyzed by FACS and found to be greater than
80%.
[0185] Simultaneous cell, gene and protein experiments were
performed similarly to those as previously described on a PEGylated
microarray substrate.
[0186] Briefly, GFP-expressing B cells (106/100 .mu.l) were located
on B1 spots after labeling with .alpha.-B220-B1' (0.5 .mu.g/100
.mu.L). Following removal of non-adherent cells, a TNF-.alpha.
ELISA pair with C1'-encoded 10 and APC-labeled 2.degree. antibodies
were introduced along with 0.5 ng/.mu.l FITC-labeled A1' and
allowed to hybridize for a period of 30 minutes at room
temperature. The slide was then rinsed with TBS+MgCl.sub.2 and
visualized via brightfield and fluorescence microscopy.
[0187] Homogeneous and panning cell experiments were performed in
parallel. For the homogenous cell capture process, 5.times.10.sup.6
Jurkats (ATCC) suspended in 1 ml of RPMI media along with 5 .mu.g
of .alpha.-CD3/C3' conjugates and incubated on ice for 1 hour.
Excess conjugates were removed by centrifugation and the Jurkats
were resuspended into 200 .mu.l of fresh media before exposure to
the DNA microarray. After 1 hour incubation on ice, the slides were
rinsed gently with TBS. The cell panning experiments were performed
in parallel; 5 .mu.g of a-CD3/C3' conjugate in 1 ml RPMI media was
incubated on a microarray for 1 hour on ice before rinsing in
0.5.times.PBS, then deionized water. The slide was not blown dry,
but gently tapped on the side to remove the majority of the excess
solution, keeping the array hydrated. Jurkats (5.times.10.sup.6/200
.mu.L) were immediately placed on the array for one hour on ice.
Subsequent wash and visualization steps are identical.
[0188] The results of these experiments are illustrated in FIG. 10
wherein Panels a and b show brightfield images showing the
efficiency of the homogeneous cell capture process according to an
embodiment of the methods and systems herein disclosed.
[0189] In particular, in Panel a, a homogeneous assay is described
in which DNA labeled antibodies are combined with the cells, and
then the mixture is introduced onto the spotted DNA array
microchip. In Panel b, DNA labeled antibodies are first assembled
onto a spotted DNA array, followed by introduction of the cells.
This heterogeneous process is similar to the traditional panning
method of using surface bound antibodies to trap specific
cells.
[0190] By comparing the results illustrated in Panels a and b, the
polynucleotide-encoded protein based cell sorting was compared with
panning by evaluating homogeneous cell capture (solution phase cell
capture) and heterogeneous capture of cells (surface confined cell
capture). The homogeneous DNA-encoded protein method exhibited a
higher cell capture efficiency.
[0191] The increase in capture efficiency can be attributed to
several factors. In homogeneous cell capture, the DNA-antibody
conjugates are allowed to properly orient and bind to the cell
surface markers in solution. Cell capture is not driven by antibody
to cell surface marker interactions, but rather by the increased
avidity of the multivalent DNA-antibody conjugates for the
complementary DNA strands on the microarray through cooperative
binding, greatly increasing capture efficiency. Similar trends have
been reported for nanoparticle, DNA hybridization schemes (Taton,
T. A.; Mirkin, C. A.; Letsinger, R. L. Science 2000, 289,
1757-1760). With panning methods, which are analogous to a
heterogeneous DNA-antibody defined arrays herein disclosed, the
capture agents are restricted to adopt a random orientation on the
surface. The activity of the antibodies is reduced, simply because
of improper orientation for interaction with the cell surface
markers, decreasing maximum avidity and cooperation with
neighboring antibodies.
[0192] In Panel c, brightfield and fluorescence microscopy images
of multiplexed cell sorting experiments are shown, where a 1:1
mixture of mRFP-expressing T cells (red channel) and
EGFP-expressing B cells (green channel) is spatially stratified
onto spots A1 and C1, corresponding to the encoding of
.alpha.-CD90.2 and .alpha.-B220 antibodies with A1' and C1',
respectively. In particular, in the experiments of FIG. 10c, two
unique DNA strands were conjugated to antibodies raised against the
T cell marker CD90.2 (Thy1.2) and the B cell marker CD45R (B220),
respectively. Multiplexed DNA-antibody-based cell sorting was
demonstrated by spatially separating a 1:1 mixture of monomeric Red
fluorescent protein (Campbell, R. E.; Tour, O.; Palmer, A. E.;
Steinbach, P. A.; Baird, G. S.; Zacharias, D. A.; Tsien, R. Y.
Proc. Natl. Acad. Sci. 2002, 99, 7877-7882) (mRFP)-expressing T
cells (VL-3, murine thymic lymphoma) and EGFP-expressing B cells
(mouse B cell lymphoma). This mixture was incubated with
uniquely-encoded DNA-antibody conjugates against both T and B cell
markers and introduced to an appropriately spotted microarray. The
results show both brightfield and false color fluorescence
micrographs demonstrating that the mRFP-expressing T cells are
enriched at spots A1 and EGFP-expressing B-cells located at B1,
consistent with the DNA-encoding of the respective antibodies.
[0193] In Panel d, a fluorescence micrograph of multiplexed sorting
of primary cells harvested from mice. A 1:1 mixture of CD4+ cells
from EGFP transgenic mice and CD8+ cells from dsRed transgenic mice
is separated to spots A1 and C1 by utilizing polynucleotide-encoded
conjugates .alpha.-CD4-A1' and .alpha.-CD8-C1', respectively.
Primary cells are usually more fragile than established cell lines.
This is due to the fact that they have to be extracted (usually by
enzymatic digestions) from the surrounding tissues, a process that
can lead to decreased viability. Moreover, the culture process
often selects for clones characterized by greatly increased
viability as well as proliferation potential. A generalized cell
sorting technology must therefore also work on primary cells with
minimal sample manipulation. To demonstrate the utility of the
polynucleotide-encoded-protein approach for primary cell sorting, a
synthetic mixture of CD4+ and CD8+ T cells was isolated via
magnetic negative depletion from EGFP- and dsRED-transgenic mice,
respectively. The mixture was stratified using .alpha.-CD4 and
.alpha.-CD8 DNA-antibody conjugates. As shown in FIG. 10d, the two
cell types were separated to different spatial locations according
to the pendant DNA encoding.
Example 10
Multiparameter Multiplexed Analysis Using DNA Encoded Antibodies in
Combination with DNA Printed Array
[0194] A multiparameter analysis (cells, mRNAs and proteins) was
performed according to the strategy schematically described in FIG.
12.
[0195] FIG. 11 is an illustration of the polynucleotide-encoded
protein method for cell sorting and co-detection of proteins and
cDNAs (mRNAs). Antibodies against proteins (for cell sorting) or
other proteins (including cell surface markers) are labeled with
distinct DNA oligomers. These conjugates may then be combined with
the biological sample (cells, tissue, etc.) where they bind to
their cognate antigens. When introduced onto a DNA microarray,
parallel self assembly, according to Watson-Crick base pairing,
localizes the bound species to a specific spatial location allowing
for multiplexed, multiparameter analysis.
[0196] An immunoassay was performed to illustrate the ability of
polynucleotide-encoded protein herein disclosed to detect a
plurality of targets, including chemically different targets. In
particular, the assay was performed for the detection of protein
target IL4 and a polynucleotide B1. To this purpose, an antibody
specific to the protein target IL4 was encoded with polynucleotide
C1 and a polynucleotide complementary to polynucleotide B1 was
prepared. The polynucleotide complementary to polynucleotide B1 was
incubated together with the C1' encoded anti-IL4 as described
above. Upon specific binding, a fluorophore secondary antibody to
IL4 was introduced, and the simultaneous detection of the protein
target IL4, and the oligonucleotide B1 performed as illustrated in
FIG. 12.
[0197] To highlight the universal diversity of the platform
schematically illustrated in FIG. 11, GFP-expressing B cells were
tagged with B1' DNA-encoded antibody conjugates and spatially
located onto spots (B1) encoded with the complementary
oligonucleotide. Post cell localization, FITC-labeled A1' DNA and a
C1'-encoded TNF-.alpha. immunosandwich, were combined and
introduced to the same microarray platform. The resulting
brightfield and fluorescence microscopy images, shown in FIG. 13,
demonstrate the validity of a platform according to an embodiment
of the methods and systems herein disclosed, for simultaneously
extending across different levels of biological complexity.
[0198] In particular, FIG. 13 shows microscopy images demonstrating
simultaneous cell capture at spot B1 and multiparameter detection
of genes and proteins, at spots A1 and C1, respectively. The
brightfield image shows EGFP-expressing B cells (green channel)
located to spots B1, FITC-labeled (green) cDNA at A1, and an
APC-labeled TNF-.alpha. sandwich immunoassay (blue) encoded to C1.
The scale bar corresponds to 300 .mu.m.
[0199] The efficiency of the polynucleotide-encoded-protein methods
and systems exemplified herein can possibly be ascribed to the use
of polynucleotide specific binding to anchor the antibody to the
substrate. Conventional antibody arrays for protein detection or
for panning cells (Wysocki, L. J.; Sato, V. L., Proc. Natl. Acad.
Sci. 1978, 75, (6), 2844-2848) require immobilization of the
antibody on to aldehyde, epoxy, maleimide, or hydrophobic solid
supports (Liu, X.; Wang, H.; Herron, J.; Prestwich, G, Bioconjugate
Chem. 2000, 11, (755-761). Macbeath, G.; Schreiber, S. L. Science
2000, 289, 1760-1763. Pal, M.; Moffa, A.; Sreekumar, A.; Ethier,
S.; Barder, T.; Chinnaiyan, A.; Lubman, D. Anal. Chem. 2006, 78,
702-710. Thirumalapura, N. R.; Morton, R. J.; Ramachandran, A.;
Malayer, J. R. Journal of Immunological Methods 2005, 298, 73-81).
It is often difficult to preserve folded (active) antibody
conformations due to surface induced denaturation which depends on
many variables including pH, ionic strength, temperature and
concentration (Seigel, R. R.; Harder, P.; Dahint, R.; Grunze, M.;
Josse, F.; Mrksich, M.; Whitesides, G. M. Anal. Chem. 1997, 69,
3321-3328. Ramsden, J. J. Chem. Soc. Rev. 1995, 24, 73-78.
Fainerman, V. B.; Lucassen-Reynders, E.; Miller, R. Colloids Surf A
1998, 143, 141). This has spurred the development of alternative
approaches to preserve the native conformation of proteins
including 3-dimensional matrixes like hydrogels, and polyacrylamide
(Arenkov, P.; Kukhtin, A.; Gemmel, A.; Voloshchuk, S.; Chupeeva,
V.; Mirzabekov, A. Anal. Biochem. 2000, 278, 123-131. Kiyonaka, S.;
Sada, K.; Yoshimura, I.; Shinkai, S.; Kato, N.; Hamachi, I. Nature
Materials 2004, 3, 58-64.), cutinase-directed antibody
immobilization onto SAMs (Kwon, Y.; Han, Z.; Karatan, E.; Mrksich,
M.; Kay, B. K. Anal. Chem. 2004, 76, 5713-5720), and the coupling
of biotinylated antibodies onto streptavidin coated surfaces
(Peluso, P.; Wilson, D.; Do, D.; Tran, H.; Venkatasubbaiah, M.;
Quincy, D.; Heidecker, B.; Poindexter, K.; Tolani, N.; Phelan, M.;
Witte, K.; Jung, L.; Wagner, P.; Nock, S. Anal. Biochem. 2003, 312,
113-124). In addition, the arrays need to remain hydrated
throughout the entire manufacturing process in order to prevent
protein denaturation (Macbeath, G.; Schreiber, S. L. Science 2000,
289, 1760-1763). DNA microarrays, on the other hand, are typically
electrostatically absorbed (via spotting) unto amine surfaces.
[0200] One option for detecting both DNA and proteins on the same
slide would be to pattern both functional groups used to immobilize
DNA and protein onto the same substrate, although this would
significantly increase the complexity and engineering of the
system. Alternatively, a compatible surface may be an activated
ester glass slide to which amine-DNA and proteins can both
covalently attach. However, the inventors have found that the
loading capacity of these slides for DNA is diminished, resulting
in poor signal intensity when compared with DNA printed on
conventionally prepared amine slides. In addition, unreacted esters
are hydrolyzed back to carboxylic acids, which are negatively
charged at normal hybridization buffers (pH 7), electrostatically
reducing the DNA interaction. Moreover, to interrogate cells and
proteins, the best surface to reduce non specific binding of cells
while maintaining full antibody functionality is acrylamide (Soen,
Y.; Chen, D. S.; Kraft, D. L.; Davis, M. M.; Brown, P. O. PLoS
Biology 2003, 1, (3), 429-438. Boozer, C.; Ladd, J.; Chen, S.; Yu,
Q.; Homola, J.; Jiang, S. Anal. Chem. 2004, 76, 6967-6972), which
is incompatible with DNA.
[0201] Additionally, by using DNA as a common assembly strategy for
cells, cDNAs, and proteins, the substrate conditions for high DNA
loading onto the spotted substrates, and for complementary DNA
loading on the antibodies can be optimized. This leads to highly
sensitive sandwich assays for protein detection, as well as high
efficiency cell sorting (compared with traditional panning).
Example 11
Fabrication of Microfluidic Devices
[0202] Microfluidic-based assays offer advantages such as reduced
sample and reagent volumes, and shortened assay times (Breslauer,
D. N.; Lee, P. J.; Lee, L. P. Mol. BioSyst. 2006, 2, 97-112). For
example, under certain operational conditions, the surface binding
assay kinetics are primarily determined by the analyte (protein)
concentration and the analyte/antigen binding affinity, rather than
by diffusion (Zimmermann, M.; Delamarche, E.; Wolf, M.; Hunziker,
P. Biomedical Microdevices 2005, 7, (2), 99-110). A
microfluidics-based polynucleotide-encoded-protein approach was
evaluated by bonding a polydimethylsiloxane (PDMS)-based
microfluidic channel on top of a DNA microarray.
[0203] In particular, microfluidic channels were fabricated from
polydimethylsiloxane (PDMS) using conventional soft lithographic
techniques. The goal was to fabricate robust microfluidics channels
that could be disassembled after the surface assays were complete
for optical analysis. Master molds were made photolithographically
from a high resolution transparency mask (CadArt) so that the
resulting fluidic network consisted of 20 parallel channels each
having a cross-sectional profile of 10.times.600 .mu.m and were 2
cm long. This corresponds to channel volumes of 120 nl. A silicone
elastomer (Dow Corning Sylgard 184.TM.) was mixed and poured on top
of the mold. After curing, the PDMS was removed from the mold and
sample inlet and outlet ports punched with a 20 gauge steel pin
(Technical Innovations.TM.). The microfluidic channels were then
aligned on top of the microarray and bonded to the substrate in an
80.degree. C. oven overnight.
Example 12
Microfluidics-Based Assay Procedures Using DNA Encoded
Antibodies
[0204] Microfluidic devices were interfaced with 23 gauge steel
pins and Tygon.TM. tubing to allow pneumatically controlled flow
rates of .about.0.5 .mu.l/min. Several assays were performed in
Tris Buffered Saline (TBS), which was found to be better than
1.times.SSC and PBS in terms of reduced background noise. Each
channel was blocked with 1.0% BSA in TBS prior to exposure to
DNA-antibody conjugates or immunoassay pairs for 10 minutes under
flowing conditions. After a 10 minute exposure to conjugates or
antigens under flowing conditions, channels were washed with buffer
for 2 minutes and the microfluidics disassembled from the glass
slide in order to be scanned. Immediately prior to imaging, the
entire slide was briefly rinsed in TBS, blown dry and imaged on an
array scanner as described above.
[0205] In a first series of assays, two goat .alpha.-human IgG
(labeled with Alexa594 or Alexa 647) were tagged with oligos A1'
and B1' respectively and introduced into a microfluidic device
bonded on top of a DNA microarray with corresponding complementary
strands A1 and B1 along with non-complementary strand C1. No
polynucleotide-encoded conjugate encoded to spot C1 was added.
After flowing at .about.0.5 .mu.l/min for 10 minutes, the
microfluidic PDMS slab was removed and the glass slide imaged. The
results illustrated in FIG. 14 show that the antibody conjugates
self-assembled at precise spatial locations encoded by the pendant
oligonucleotide in <10 minutes (see FIG. 14), consistent with
the time scales reported on DNA hybridization in microfluidics
(Erickson, D.; Li, D.; Krull, U. Anal. Biochem. 2003, 317, 186-200.
Bunimovich, Y.; Shin, Y.; Yeo, W.; Amori, M.; Kwong, G.; Heath, J.
J. Am. Chem. Soc. 2006 (web release 12 1 2006) DOI:
10.1021/ja065923u. Wei, C.; Cheng, J.; Huang, C.; Yen, M.; Young,
T. Nucleic Acids Research 2005, 33, (8), 1-11). To validate the
polynucleotide-encoded protein strategy for protein detection,
further assays were performed where encoded antibodies were
utilized to detect cognate antigens in a variant of standard
immunoassays.
[0206] In a standard immunoassay (Engvall, E.; Perlmann, P. O. J.
Immunol. 1972, 109, 129-135), a primary antibody is adsorbed onto a
solid support, followed by the sequential introduction and
incubation of the antigen-containing sample and secondary labeled
"read-out" antibody, with rinsing steps in between. In order to
simplify this conventional five step immunoassay, the encoding
power of the DNA encoded antibodies was used to position the entire
sandwich complex to the appropriate location for multiplexed
readout, reducing the assay to a single step.
[0207] In particular, a non-fluorescent, DNA-encoded 1.degree.
antibody was combined with antigen and a fluorescently labeled (no
DNA) 2.degree. antibody. Under these conditions, a fluorescent
signal will be spatially encoded only if an
antibody-antigen-antibody sandwich is successfully formed in
homogeneous solution and localized onto the microarray.
[0208] In particular in a first further series of assays, upon
introduction of DNA-encoded antibodies against two cytokines, human
IFN-.gamma. and TNF-.alpha., cognate antigens and
fluorescently-labeled 2.degree. antibodies. The DNA-encoded
antibody sandwich assays self-assembled to their specific spatial
locations where they were detected, as shown in FIG. 15a. This
multi-protein immunoassay also took 10 minutes to complete.
[0209] The sensitivity limits of a microfluidics, DNA encoded
antibody-based sandwich immunoassay, was investigated in a second
series of assays using a third interleukin, IL-2. The results are
shown in FIG. 15b and FIG. 15c wherein visualization was performed
using a fluorescent 2.degree. antibody (panel b) and Au electroless
deposition as a visualization and amplification strategy (panel c),
respectively.
[0210] Using a fluorescent readout strategy, the assay peaked with
a sensitivity limit of around 1 nM on slides printed at saturating
concentrations of 5 .mu.M of complementary DNA (data not shown).
For the human IL-2 concentration series, primary DNA-antibody
conjugates were laid down first on the surface, before exposure to
antigen and secondary antibody. This is because at lower
concentrations of antigen, the signals decrease, due to the high
ratio of antigen-unbound primary antibody competing with
antigen-bound primary for hybridization to the DNA array. By first
exposing the array to the primary DNA-antibody conjugate, excesses
were washed away before subsequent exposure to antigen and
secondary antibody, increasing signal.
[0211] Several strategies were employed to increase the
sensitivity. First, the applicants reasoned that increasing the
loading capacity of the glass slide for DNA will increase the
density of polynucleotide-encoded conjugates localized and
therefore, increase the number of capture events possible.
Conventional DNA microarrays are printed on primary amine surfaces
generated by reacting amine-silane with glass (Pirrung, M. Angew.
Chem. Int. Ed. 2002, 41, 1276-1289). DNA strands are immobilized
through electrostatic interactions between the negative charges on
the phosphate backbone of DNA and the positive charges from the
protonated amines at neutral pH conditions. To increase the loading
capacity of the slide, poly-lysine surfaces were generated,
increasing both the charge density as well as the surface area of
interaction with DNA. By adopting these changes, it became possible
to print complementary DNA at saturating concentrations of 100
.mu.M on the glass slides. Correspondingly, the sensitivity of the
fluorescent based assays increased to 10 pM (FIG. 15b).
[0212] In a different visualization approach, Au
nanoparticle-labeled 2.degree. antibodies were used, followed by
electroless metal deposition (Hainfeld, J. F.; Powell, R. D.,
Silver- and Gold-Based Autometallography of Nanogold. In Gold and
Silver Staining. Techniques in Molecular Morphology, Hacker, G. W.;
Gu, J., Eds. CRC Press: Washington, D.C., 2002; pp 29-46), to
further amplify the signal and transform a florescence based read
out to an optical one. This is possible since spatial, rather than
colorimetric multiplexing, is utilized.
[0213] In particular, microfluidics-based Au amplification
experiments were performed in a manner similar to the one disclosed
above, with the notable exception that a biotin-secondary antibody
was used instead of a fluorescently labeled antibody. Subsequently,
Au-streptavidin (Nanoprobes) was introduced into each channel (3
ng/.mu.l) for 10 minutes, after which the channels were thoroughly
rinsed with buffer. After removal of the PDMS, the entire slide was
then amplified with gold enhancer kit (Nanoprobes) according to
manufacturer's protocol.
[0214] Adopting these improvements, the presence of IL-2
interleukin can be readily detected at a concentration limit less
than 10 fM (FIG. 15c), representing at least a 1000-fold
sensitivity increase over the fluorescence based microfluidics
immunoassay. In comparison, this method is 100-1000 fold more
sensitive than conventional ELISA (Crowther, J. R., ELISA; Theory
and Practice. In Methods in Molecular Biology, Humana Press Inc.:
Totowa, N.J., 1995), and 150 times more sensitive than the
corresponding human IL-2 ELISA data from the manufacturer
(http://www.bdbiosciences.com/ptProduct.jsp?prodld=6725).
[0215] The results of these experiments show an improved
sensitivity of the assays performed through sequential exposition
of the reagent when compared to 1 step immunoassay, especially at
lower concentrations of antigen. This is most likely due to
competitive binding between DNA antibody conjugates with and
without cargo for hybridization unto the underlying DNA microarray.
By sequentially exposing the array to polynucleotide-encoded
conjugate, antigen, and then secondary antibody, the sensitivities
were increased. The most appropriate approach has to be selected in
view of the desired results in term of convenience and sensitivity.
It should still be stressed however, that maximum signal is still
reached under microfluidic flowing conditions within 10 minutes for
each step. Thus in a fully automated device, a complete
microfluidic immunoassay with sensitivities down to 10 fM can be
obtained in 1 hour (including a 30 minute step for Au
amplification).
Example 13
Target-Quantitation of Using DNA Encoded Antibody Labeled with
Metal Nanoparticles
[0216] Digital proteomics were detected using DNA encoded antibody
in combination with DNA arrays according to the strategy described
in FIGS. 16 and 17. In particular, assays have been performed to
detect certain cytokines (IL2, TNF-.alpha. and IFN-.gamma.). All
experiments were performed in a manner analogous to the 3-step
immunoassays described above with the notable exception that a 40
nm Au particle is used and the detection scheme is a dark field
light scattering microscope.
[0217] In particular, in the digital approach the 2.degree.
antibodies were labeled with 40 nm Au nanoparticles, which are
readily detected by dark-field light scattering microscopy. More
specifically a 40 nanometer Au nanoparticle-Streptavidin conjugate
was used as the detection probe for the digital assay.
[0218] Detection of the relevant digital immunoassays was performed
with the method illustrated in FIG. 18. According to the method
illustrated in FIG. 18, scattered light is measured using a
dark-field microscope objective. The plasmonic response of even
very small Au particles is readily picked detected. The individual
particles are counted either manually or using an automated
software package for particle counting. Note that the scattering
color of all of the particles is very similar--yellow-to-green.
This is because the Au nanoparticles (10) are of a fairly narrow
size range (.about.60 nanometers diameter). An optical filter can
be utilized in the light scattering microscope to eliminate all
other scattered colors and thus reduce background.
[0219] The results of the experiments are shown in FIGS. 19 to 22
wherein the conjugates are visualized using Rayleigh light
scattering.
[0220] The sensitivity of the digital assay performed according to
an embodiment of the methods and systems herein disclosed, is
demonstrated in FIGS. 19 and 20 in which a concentration series of
TNF-.alpha. is presented. The signal from this protein can be
easily identified at concentrations as low as 100 attoMolar. FIGS.
19 and 20 show the representative dark field images of TNF-.alpha.
Digital immunoassays performed at different concentrations with a
method and system herein disclosed. Image.TM., a scientific graph
processing software provided by NIH, was used automatically count
the particle numbers. The number of gold nanoparticles vs
TNF-.alpha. concentration is plotted in the histogram of FIG.
20.
[0221] To further assess the capability of this new technique in
serum measurement, the above mentioned three cytokine proteins
(IL2, TNF-.alpha. and IFN-.gamma.) were spiked in human serum
(purchased from Sigma-Aldrich) and the same AuNP based assay
performed above, was conducted. The results are shown in FIG. 21.
In particular, the images of Panel a were collected from a serum
sample that was spiked with the three proteins: IFN-.gamma.;
TNF-.alpha., and IL-2. The images of Panel b are from a digital
immunoassay that was measured from the serum of a healthy human
according to an embodiment of the methods and systems herein
disclosed. All three of these proteins are typically present at
below-detectable concentrations in human serum. TNF-.alpha. is
below the detectable limit, but IFN-.gamma. and IL-2 are present at
the few femtoMolar (10.sup.-15M) concentration levels. This amount
of protein is well below the detection limit of a conventional
absorbance or fluorescent ELISA or even immunoassay performed with
another embodiment of the methods and systems herein disclosed.
[0222] It was found that the method according to the embodiments
exemplified above worked well in serum, with high sensitivity and
very little background noise. It is significant that the Digital
immunoassay embodiment was sensitive to cytokines, which are
biologically informative molecules but are present in trace
quantities in pure, healthy human serum. As shown in FIG. 21 right,
signals corresponding to human IFN-.gamma. and IL-2 are present
while TNF-.alpha. was not detected. This result illustrates the
capabilities of methods and systems herein disclosed wherein
detection is performed using metal nanoparticles.
[0223] The detection of the above mentioned three human cytokine
proteins, all prepared at identical concentrations was tested (FIG.
22). In particular, Three different ssDNA' molecules were spotted
onto the substrate, with each ssDNA' being complementary to ssDNA
oligomers that were labeled onto the 1.degree. ABs:
anti-IFN-.quadrature.; anti-TNF-.quadrature., and anti-IL-2. 2oABs,
labeled with 60 nanometer diameter Au nanoparticles, were
introduced after the substrate had been exposed to the
serum/protein mixture. The Au nanoparticles are visualized using a
dark-field light scattering miscroscope.
[0224] The results shown in FIG. 22, can be unambiguously
visualized and, in agreement with fluorescence-based assay,
TNF-.alpha. exhibits the best signal intensity due to the high
affinity of the 1.degree. anti-TNF-.alpha. AB.
[0225] It should be noted that the background is near zero, and
that the dynamic range of detected proteins is at least 10.sup.6.
These types of assays have been utilized to detect certain
cytokines (IL2, TNF-.alpha. and IFN-.gamma.) out of healthy human
serum. This has not been previously possible, as those proteins are
present (by our measurements) at a level of only 1-5 femtoM. It is
to be noted that once the antibody/protein affinities have been
characterized, these types of assays are absolute and
quantitative--meaning that they do not require calibration.
[0226] The digital detection of molecules with the methods and
systems herein disclosed is readily adapted into microfluidics
environments (the results from FIG. 21 were carried out in a
microfluidic environment). In addition to the sample size and
time-scale benefits that accompany this type of microfluidics
immunoassay, there are other advantages. For example, since the
entire assay is performed in solution prior to read-out, protein
denaturation (a concern for spotted antibody microarrays) does not
reduce binding efficiency. In addition, any assay that involves
substrate-supported antibodies, would not have survived
microfluidic chip assembly (which involved an extended bake at
80.degree. C.). That procedure was designed to yield robust PDMS
microfluidics channels that could then be disassembled for the
optical readout step.
[0227] Another benefit of performing solution phase assays is that
the orientational freedom enjoyed by both the antigens and
antibodies ensures that the solid support will not limit the access
of analytes to the binding pocket of the capture agent.
Example 14
Diagnostic Methods and System
[0228] Some initial calibration and quantitation of methods and
systems herein disclosed for the analysis of biomarkers was
performed in the P13K pathway that is perturbed in many cancers, in
particular glioblastoma. In particular, in FIG. 23, an embodiment
is illustrated wherein the technology is applied to the detection
of the biomarker pten, which is an important marker in glioblastoma
(brain cancer).
[0229] Methods and systems herein disclosed have been used in a
fluorescent based assay first to calibrate a device by using
recombinant pten as the standard (FIG. 23, Panels a and b). The
calibration of the protein pten is shown with the left 7 bins,
ranging from 25 nM to 375 pM. The right 3 bins represent
pten-positive and pten-null samples. By comparing with the
calibration bins, one can interpolate the concentration of pten to
be around 1 nM. The inventors then proceeded to quantitate pten
expression levels in the glioblastoma cell line U87 (Panels a and
c). It is apparent that reasonable levels of pten (1 nM) are
detectable using methods and systems herein disclosed as
illustrated in FIG. 23.
[0230] With the methods and systems herein disclosed is also
possible to perform detecting and relevant analysis of biomarkers
in serum as an indication to the health state of an individual.
Specifically, liver toxicity studies can be performed using the
methods and systems herein disclosed. The results in liver are
particularly interesting because the liver is the second largest
organ in the human body (the first is the skin) and is in constant
contact with the blood. Thus it is highly likely that perturbations
at this organ will result in a notable change in the amount of
protein biomakers found in serum that are liver specific.
[0231] An exemplary pathway from serum biomarker discovery to
clinical validation is illustrated in FIG. 24.
[0232] A first step in serum biomarker discovery involves the
proteomic analysis of the proteins in the blood via current state
of the art in tandem mass spectrometry. Accordingly an initial
protein list of about 25 proteins was discovered to be upregulated
or downregulated following administration of high levels of
acetomaniphen to murine model using tandem mass spectrometry (FIG.
24 Panel a (1). In particular, the peptides that are detected are
mapped back to generate a list of candidate protein biomarkers.
These biomarkers and their associated capture agents (antibodies)
are screened and verified using the state of the art in surface
plasmon resonance. In particular, a particularly effective antibody
pairs was validated using SPR (FIG. 24 Panel b (2). Finally to
enable highly sensitive, multiplexed, monitoring, these verified
protein capture agents are translated into a microfluidic system
according to an embodiment herein disclosed, allowing the
monitoring of serum biomarkers in blood. In particular, a chip was
designed and tested to detect 4 liver specific serum proteins and 3
immune specific proteins from whole serum (FIG. 24 Panel c (3). The
results shown in FIG. 24 indicate that all targets were detected
without difficulty from serum.
[0233] All of the above demonstrations have been carried out in
either murine or human sera samples or both.
[0234] The examples set forth above are provided to give those of
ordinary skill in the art a complete disclosure and description of
how to make and use the embodiments of the devices, systems and
methods of the disclosure, and are not intended to limit the scope
of what the inventors regard as their disclosure. Modifications of
the above-described modes for carrying out the disclosure that are
obvious to persons of skill in the art are intended to be within
the scope of the following claims. All patents and publications
mentioned in the specification are indicative of the levels of
skill of those skilled in the art to which the disclosure pertains.
All references cited in this disclosure are incorporated by
reference to the same extent as if each reference had been
incorporated by reference in its entirety individually.
[0235] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background,
Detailed Description, and Examples is hereby incorporated herein by
reference. Further, the hard copy of the sequence listing submitted
herewith and the corresponding computer readable form are both
incorporated herein by reference in their entireties.
[0236] It is to be understood that the disclosures are not limited
to particular compositions or biological systems, which can, of
course, vary. It is also to be understood that the terminology used
herein is for the purpose of describing particular embodiments
only, and is not intended to be limiting. As used in this
specification and the appended claims, the singular forms "a,"
"an," and "the" include plural referents unless the content clearly
dictates otherwise. The term "plurality" includes two or more
referents unless the content clearly dictates otherwise. Unless
defined otherwise, all technical and scientific terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art to which the disclosure pertains. Although any
methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the specific
examples of appropriate materials and methods are described
herein.
[0237] A number of embodiments of the disclosure have been
described. Nevertheless, it will be understood that various
modifications may be made without departing from the spirit and
scope of the present disclosure. Accordingly, other embodiments are
within the scope of the following claims.
Sequence CWU 1
1
18126DNAartificial sequenceSynthetic oligonucleotide 1aaaaaaaaaa
cgtgacatca tgcatg 26226DNAartificial sequenceSynthetic
oligonucleotide 2aaaaaaaaaa catgcatgat gtcacg 26326DNAartificial
sequenceSynthetic oligonucleotide 3aaaaaaaaaa ggattcgcat accagt
26426DNAartificial sequenceSynthetic oligonucleotide 4aaaaaaaaaa
actggtatgc gaatcc 26526DNAartificial sequenceSynthetic
oligonucleotide 5aaaaaaaaaa tggacgcatt gcacat 26626DNAartificial
sequenceSynthetic oligonucleotide 6aaaaaaaaaa atgtgcaatg cgtcca
26730DNAartificial sequenceSynthetic oligonucleotide 7aaaaaaaaaa
atcctggagc taagtccgta 30830DNAartificial sequenceSynthetic
oligonucleotide 8aaaaaaaaaa tacggactta gctccaggat
30930DNAartificial sequenceSynthetic oligonucleotide 9aaaaaaaaaa
gcctcattga atcatgccta 301030DNAartificial sequenceSynthetic
oligonucleotide 10aaaaaaaaaa taggcatgat tcaatgaggc
301131DNAartificial sequenceSynthetic oligonucleotide 11aaaaaaaaaa
agcactcgtc tactatcgct a 311230DNAartificial sequenceSynthetic
oligonucleotide 12aaaaaaaaaa tagcgatagt agacgagtgc
301330DNAartificial sequenceSynthetic oligonucleotide 13aaaaaaaaaa
atggtcgaga tgtcagagta 301430DNAartificial sequenceSynthetic
oligonucleotide 14aaaaaaaaaa tactctgaca tctcgaccat
301530DNAartificial sequenceSynthetic oligonucleotide 15aaaaaaaaaa
atgtgaagtg gcagtatcta 301630DNAartificial sequenceSynthetic
oligonucleotide 16aaaaaaaaaa tagatactgc cacttcacat
301730DNAartificial sequenceSynthetic oligonucleotide 17aaaaaaaaaa
atcaggtaag gttcacggta 301831DNAartificial sequenceSynthetic
oligonucleotide 18aaaaaaaaaa ttaccgtgaa ccttacctga t 31
* * * * *
References