U.S. patent application number 12/165436 was filed with the patent office on 2009-01-08 for methods for cloning small rna species.
This patent application is currently assigned to INTEGRATED DNA TECHNOLOGIES, INC.. Invention is credited to Mark A. Behlke, Eric J. Devor, Lingyan Huang, Andrei Laikhter.
Application Number | 20090011422 12/165436 |
Document ID | / |
Family ID | 40221749 |
Filed Date | 2009-01-08 |
United States Patent
Application |
20090011422 |
Kind Code |
A1 |
Devor; Eric J. ; et
al. |
January 8, 2009 |
METHODS FOR CLONING SMALL RNA SPECIES
Abstract
This invention pertains to methods for cloning microRNA (miRNA)
and other small ribonucleic acid (RNA) species from relevant cell
sources.
Inventors: |
Devor; Eric J.; (Iowa City,
IA) ; Huang; Lingyan; (Coralville, IA) ;
Behlke; Mark A.; (Coralville, IA) ; Laikhter;
Andrei; (West Roxbury, MA) |
Correspondence
Address: |
JOHN PETRAVICH;INTEGRATED DNA TECHNOLOGIES, INC.
8180 MCCORMICK BLVD.
SKOKIE
IL
60076-2920
US
|
Assignee: |
INTEGRATED DNA TECHNOLOGIES,
INC.
Skokie
IL
|
Family ID: |
40221749 |
Appl. No.: |
12/165436 |
Filed: |
June 30, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60946922 |
Jun 28, 2007 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/25.4 |
Current CPC
Class: |
C12Q 2525/151 20130101;
C12Q 1/6806 20130101; C12Q 2565/125 20130101; C12Q 1/6806
20130101 |
Class at
Publication: |
435/6 ;
536/25.4 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 1/00 20060101 C07H001/00 |
Claims
1. A method for identifying a desired fragment size during RNA size
purification, said method comprising: providing a control RNA,
wherein the control RNA is of a size that corresponds to the
desired fragment size, wherein the control RNA contains a 3'-OH and
does not contain a 5' phosphate group, mixing said control RNA with
a natural RNA sample, performing size separation on said mixture,
and utilizing the control RNA to identify the location of a desired
species within the unknown sample.
2. The method of claim 1 wherein the control RNA is distinct from
known RNA species.
3. A method according to claim 1 wherein the desired fragment size
is 19-25 bases in length.
4. A method according to claim 2, wherein the control RNA is SEQ ID
NO: 1.
5. A method according to claim 1 wherein the desired fragment size
corresponds is 26-32 bases in length.
6. A method according to claim 2 wherein the control RNA is SEQ ID
NO:2.
7. A method according to claim 1 wherein the control RNA has a
length that is within four nucleotides of the desired fragment
size.
8. A method for recovery of a desired RNA fragment from a
denaturing PAGE using a spin column dye terminator removal (DTR)
column, said method comprising: a) separating a total RNA sample on
a denaturing PAGE; b) staining the PAGE gel with a nucleic acid
stain and placing the gel on a long wavelength UV light box; c)
selecting a gel fragment containing the desired RNA fragment to be
purified and excise from the gel; d) crushing the gel fragment and
adding said gel fragment to a spin column or DTR column; e)
discarding the spin column or DTR column; and f) spinning the
solution to separate a supernatant from the desired RNA
fragment.
9. A method for performing chemical adenylation on an
oligonucleotide on a support, said method comprising: a) providing
a support-bound oligonucleotide having a free 5' hydroxyl group; b)
phosphitlyating the oligonucleotide with a diphenyl phosphate in an
acetonitrile/pyridine/N-methylimidazole solution; c) rinsing with a
pyridine/acetonitrile solution; d) converting the phosphitylated
oligonucleotide to a phosphite triester with chlorotrimethylsilane;
and e) treating the phosphate triester with between a 30 and 50
molar excess of adenosine monophosphate in a
pyridine/N-methylimidazole solution.
10. A composition for ensuring the selection of a desired fraction
of RNA corresponding to microRNA during RNA purification, said
composition comprising SEQ ID NO:1.
11. A composition for ensuring the selection of a desired fraction
of RNA corresponding to PIWI-interacting RNA during RNA
purification, said composition comprising SEQ ID NO:2.
12. A kit for cloning small RNA species, said kit comprising: a) a
3' cloning linker oligonucleotide; b) a 5' cloning linker
oligonucleotide; c) an internal control RNA; d) a ligation
enhancer; e) a T4 RNA ligase; and f) a T4 DNA ligase.
13. A kit according to claim 12 wherein the kit also comprises: a)
a forward PCR primer; b) a reverse transcription/PCR primer; c)
water that is substantially free of RNase, DNase and pyrogen; d)
Tris/EDTA buffer; e) a ligation buffer; f) ATP; g) Glycogen; and h)
Sodium acetate.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application claims priority under 35 U.S.C.
.sctn. 119(e) to U.S. provisional patent application No. 60/946,922
filed 28 Jun. 2007. The entire teachings of the above application
are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] This invention pertains to methods for cloning microRNA
(miRNA) and other small ribonucleic acid (RNA) species from
relevant cell sources.
BACKGROUND OF THE INVENTION
[0003] Small, non-coding, regulatory RNA species such as microRNAs
have emerged in recent years as a powerful agent in regulating gene
expression in eukaryotic cells. First discovered in 1993 (Lee at
al., Cell 75: 843-854 (1993)), microRNAs are an abundant new class
of regulatory elements that have been shown to impact all aspects
of normal cellular processes in both plants and animals, including
cell death, differentiation, and proliferation, as well as abnormal
processes including cancer (Bartel, Cell 116: 281-297 (2004); Du
and Zamore, Development 132: 4645-4652 (2005); Pillai, RNA 11:
1753-1761 (2006)). In general, an miRNA is composed of a highly
conserved core sequence of 21-23 nucleotides (the mature miRNA)
contained within a less well conserved precursor sequence
(pre-miRNA) ranging in size from 60 nucleotides to more than 120
nucleotides. This pre-miRNA sequence is part of a larger primary
transcript that may contain a single pre-miRNA or two or more
pre-miRNAs arranged as paired or polycistronic transcripts.
MicroRNA expression has been found to be highly specific and, in
many cases, sequestered by tissue type and/or developmental stage.
For this reason, discovery of new microRNAs requires the cloning of
RNA species that may be expressed only in certain cells harvested
at particular times. The availability of a generally applicable and
efficient cloning method is, therefore, key in advancing knowledge
of both the number of microRNAs present in a given genome and their
specific role in that organism's cells.
[0004] Since 2001, several methods for cloning microRNAs and other
small RNA species from total cellular RNA have been advanced
(Berezikov et al., 2006; Cummins et al., 2006; Elbashir et al.,
Genes and Development 15: 188-200 (2001); Lau et al., Science 294:
858-862 (2001); Pfeffer et al., Current Protocols in Molecular
Biology, 26.4.1-26.4.18 (2003); Sunkar and Zhu, The Plant Cell 16:
2001-2019 (2004)). Cloning small RNAs generally begins with the
isolation and purification of total cellular RNA from a relevant
cell source. More recent variations on the basic scheme advocate
enriching the RNA target pool for species in the proper size range.
This entails taking the total cellular RNA pool and isolating only
those RNAs that fall below or within a certain size range.
Commercial products are available to remove larger RNA species from
the target pool that would compete in the subsequent process that
forms the substance of the described method.
[0005] Once an enhanced RNA target pool has been purified, by
whatever means, the next step is to attach a 3'-end blocked linking
group that will ligate to the 3'-end of the small RNA species.
Generally, a 5'-end linking group is also ligated to the small RNA
species. Then reverse transcriptase polymerase chain reaction
(RT-PCR) is performed wherein the resulting fragments are cloned
into vectors to create a cDNA library comprising a heterogeneous
collection of small cellular RNA species. The cloned fragments can
then be sequenced and analyzed to determine the identity and
genomic origin of the small RNA species present in the sample.
[0006] Current methods have enabled investigators to identify
hundreds of unique miRNAs, and there are estimates that thousands
of unique miRNAs may exist. Additionally, several new classes of
small, regulatory RNAs have been discovered in the past few years.
These new classes include endogenous silencing RNAs (endo siRNAs),
PIWI-interacting RNAs (piRNAs), 21U RNAs, and repeat-associated
siRNAs (rasiRNAs), all of which have been discovered by direct
cloning from specific RNA sources. Production of small RNA
libraries is a complex task and it is possible to produce libraries
that are incomplete or contain skewed subsets of the RNA species
present in the original sample. There is a need for more efficient
methods of small RNA cloning that can be used by less-skilled
technicians to clone and identify miRNAs.
BRIEF SUMMARY OF THE INVENTION
[0007] The invention provides improvements to the current methods
of small RNA (such as miRNA) cloning to provide greater efficiency
and simplification to reduce error-rate. The invention also
provides methods to monitor the quality of the reaction using an
internal size marker to serve as a quality control reagent.
[0008] The method provides a synthetic RNA oligoribonucleotide that
serves as an internal size marker for identifying the correct
fragment sizes during RNA size purification steps needed as part of
library construction. This RNA is about 21 bases in length and is a
sequence that is distinct from known microRNAs. This sequence can
be added to the natural RNA sample at a relatively low mass amount
and initially will serve to identify the correct size range for
enrichment of small RNA species as the first step of library
construction. The synthetic marker sequence co-purifies along with
the target RNAs and, along with the target RNAs, will participate
in the 3'-linkering reactions. Ligation of a 3'-linker to the
marker RNA and the target RNAs will shift the molecular weight of
all species upward by the same mass amount and further will alter
migration of these species on gel electrophoresis by a similar
degree. Following the 3'-linkering step, the synthetic marker now
serves as a size marker for isolation and enrichment of those small
RNA species which have successfully been joined with the 3'-linker
oligonucleotide. At this point in library construction a new
5'-linker oligonucleotide is joined to the 5'-end of the RNA
species. Naturally occurring miRNAs possess a 5'-phosphate group
which is needed for joining to occur if the reaction is mediated by
the enzyme T4 RNA Ligase. However, the synthetic marker RNA does
not contain a 5'-phosphate group which renders it inactive for the
5'-linkering step. Thus, only the target RNAs will be 5'-linkered
and be available for subsequent enzymatic reactions. The presence
of linker species on both the 3'-end and 5'-end of the small RNAs
are required for cloning, amplification, and isolation. Therefore
the synthetic RNA marker oligonucleotide serves as a marker for
initial RNA isolation, serves as a positive control for 3'-linker
attachment, serves as a marker for isolation of 3'-linkered
species, but is blocked from further participation in the cloning
process and will not be present or otherwise contaminate the final
small RNA library produced by the procedure.
[0009] The invention additionally provides 5'-5'-adenylated
oligonucleotides for ligation of the oligonucleotides using T4
ligase. The adenylated oligonucleotides are made by a novel
chemical method by reacting 5'-monophosphate with 5'-silylated
phosphate followed by oxidation by N-chlorosuccinimide (NCS) in
acetonitrile. Using 5'-monophosphate instead of 5'-pyro- or
5'-polyphosphate eliminates side products because the phosphate
backbone is protected by a cyanoethyl group. The adenylation
reaction occurs on the support during oligonucleotide synthesis and
can be isolated with a single purification. The new method of the
invention does not require that adenylation be performed as an
additional handling step after oligonucleotide synthesis is
complete.
[0010] The invention also provides an efficient alternative to
current purification practices. The original protocols for small
RNA cloning required three separate denaturing polyacrylamide gel
(PAGE) purification steps. Each purification step is time
consuming, and each purification results in loss of product.
Reducing the number of purification steps improves yield of
recovered product. For this reason, small RNA cloning protocols
usually require a very large mass of starting RNA. The invention
eliminates one of the two PAGE purification steps generally needed
to perform cloning via end linkering and therefore improves yield
and permits library construction using lower input mass amounts of
RNA. The methods also use a reduced amount of ligase when linking
the 3'-linker to the RNA product as compared to current
methods.
[0011] The method further provides improvements in the post-PCR
amplification steps of the cloning process. The amplification
products (amplicons) must be digested with an appropriate
restriction enzyme to create the sticky ends used for
concatamerization and cloning. The proposed method introduces a
substantial improvement. Using conventional methods, the amplicons
generated in the PCR amplification are too small to be purified by
conventional means apart from excision from an agarose gel--a step
that would add time, effort and expense to the protocol. Unpurified
PCR reactions tend to be inefficient substrates for restriction
enzyme digestion and thus purification, with loss of product, is
usually performed. The proposed method utilizes
phenol/chloroform/isoamyl alcohol (25:24:1) extraction followed by
precipitation to enhance restriction enzyme digestion and
concatamerization without additional purification. The entire
cloning process for miRNA cloning with concatamerization has been
abbreviated "miRCat" hereafter.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 is an illustration of a complete process of cloning
small RNAs from a tissue or cell source using the described
methods.
[0013] FIG. 2 is a picture of a gel containing an RNA sample
stained with a nucleic acid stain. Lanes 1 and 3 contain
single-stranded DNA ladders, and Lane 2 contains single-stranded
RNA.
[0014] FIG. 3A is a 12% 7M urea PAGE (275v, 90 min) gel showing
small RNA enrichment from total cellular RNA. Lanes 1 and 2 contain
50 .mu.g of cellular RNA. Lane 1 contains 10 pmole of SEQ ID NO: 1
but Lane 2 does not. Lane 3 is 10 pmole of SEQ ID NO: 1 only. The
boxes indicate the gel slices taken for small RNA purification.
[0015] FIG. 3B is a 12% 7M urea PAGE (275v, 90 min) gel showing
recovery of 3' ligated RNAs from the sample in FIG. 3A. Lane 1
contains 10 pmole of SEQ ID NO: 1 but Lane 2 did not. Lane 3 is 10
pmole of SEQ ID NO: 1 only. The boxes indicate the gel slices taken
for small RNA purification in preparation for further
ligations.
[0016] FIG. 3C is a 1.3% low melting point agarose gel showing PCR
amplification of doubly-ligated RNAs from the sample in FIG. 3B.
Lane 1 is a conventional 3' plus 5' miRCat ligation. Lane 2 is
ligation with only SEQ ID NO: 1. Lane 3 is a 5'
ligation-independent (miRCat-33) cloning lane from RNA not
containing SEQ ID NO: 1. Lane 4 is a SEQ ID NO: 1 only 5'-LIC
showing that SEQ ID NO: 1 will clone using 5'-LIC whereas Lane 2
shows that SEQ ID NO: 1 will not clone using the conventional
miRCat method.
[0017] FIG. 4 is an example of the two PAGE RNA purification gels.
On the left is the 12% denaturing PAGE containing total RNA spiked
with the 21-mer control RNA. On the right is the second 12%
denaturing PAGE in which the spiked RNA recovered from the gel
slice is 3' ligated. Material at the 40 nt size is recovered and
purified for the subsequent 5' Tinkering step.
[0018] FIG. 5 is an electropherogram of a microRNA concatamer
sequence containing six microRNAs. The 5' linker is at position
138-159 followed by miR-26a; Connector 1 is at 182-198 followed by
miR-122a; Connector 2 is at 219-235 followed by miR-34a; Connector
s is at 258-274 followed by miR-21; Connector 4 is at 297-308
followed by miR-122a; Connector 5 is at 330-346 followed by
miR-23a; and the 3' linker is at 368-385.
[0019] FIG. 6 is a 12% denaturing PAGE containing 3' Tinkered RNA.
Marker (M) is an oligonucleotide length standard (Integrated DNA
Technologies). Lane 1 shows the Tinkered RNAs at 40 nt.
[0020] FIG. 7 is a 1.4% Low Melting Point Agarose gel containing
replicate PCR reactions. The marker (M) is the Low Molecular Weight
Marker from New England Biolabs. Lanes 1 and 3 are negative control
reactions. Lanes 2 and 4 show the expected PCR amplicons.
[0021] FIG. 8 shows a gel photograph of a Ban I concatamerization
on a 1.4% Low Melting Point Agarose Gel. The concatamers continue
beyond 600 bp (ten concatamers) but the very low mass of these
products makes them difficult to see on the photograph.
[0022] FIG. 9 shows a gel photograph of a mir-21 RNA (22-mer) with
a 5' phosphate group (R) run on a 15% denaturing PAGE for 90
minutes at 275V. The markers are IDT Oligo Ladders 10-60 (left) and
20-100 (right).
[0023] FIG. 10A shows a photograph of a 15% denaturing PAGE gel of
total RNA from Gossipium hirsutum, TM-1 with and without the
addition of a 21-mer RNA control. Lanes 1, 3 and 7 are markers,
lane 2 contains the total RNA without the 21-mer control, and lanes
4 and 6 contain the total RNA and the 21-mer control.
[0024] FIG. 10B shows a photograph of a 15% denaturing PAGE gel of
the RNA fraction containing the 21-mer control (lanes 4 and 6 from
the gel in FIG. 8A) post 3' Tinkering. The Tinkered material is
seen as bands in lanes 2 and 3 around the 40 nt mark. Lanes 1 and 4
are marker lanes.
[0025] FIG. 10C is a photograph of a 1.4% low melting point agarose
gel with the PCR amplicons from the RT-PCR. Lane 1 is a low
molecular weight ladder, and lane 2 contains a band identified as
"PCR amplicons" which is the recovered material from an RT-PCR
reaction containing the 3' linker and the 5' 454 sequence.
[0026] FIG. 11 is a photograph of colony PCR reactions run on a
1.4% Low Melting Point Agarose gel. The amplicons on the top are
from the PCR reaction on the left in FIG. 8 while those on the
bottom are from the PCR reaction on the right in FIG. 12.
[0027] FIG. 12 is a schematic illustration of the synthesis of an
on-support adenylation of an oligonucleotide using diphenyl
phosphate.
[0028] FIG. 13 is a schematic illustration of the synthesis of an
on-support adenylation of an oligonucleotide using salicyl
chlorophosphite.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The invention provides improvements to the current methods
of cloning small RNA species to provide greater efficiency and
simplification to reduce errors and increase yields. The invention
also provides methods to monitor the quality of the reaction using
a quality control reagent. FIG. 1 illustrates the complete cloning
process of one embodiment of the proposed invention.
[0030] The invention provides a non-radioactive staining method to
identify materials, wherein the staining does not affect downstream
applications. Because of the small amount of small RNA species
present in a typical sample, conventional methods generally utilize
radiolabeled markers to help isolate the small RNA species. The
present method utilizes a simple nucleic acid gel stain, such as
Gelstar.RTM. (Lonza.RTM.). As demonstrated in FIG. 2, the stain
provides clear bands, and the stain does not have any noticeable
effect on downstream applications (e.g., enzyme reactions,
ligations, and the like).
[0031] The method also provides a synthetic oligoribonucleotide
(ORN) that will serve as an internal size marker for identifying
the correct fragment sizes during RNA size purification. The ORN is
about 19-23 bases in length and is a sequence that is distinct from
known microRNAs. Preferably, the ORN is about 20-22 bases in length
and is a sequence that is distinct from known microRNAs. More
preferably, the ORN is 21 bases in length and is a sequence that is
distinct from known microRNAs. Small mass amounts of this ORN are
added into the RNA sample that is being used for cloning as a
size/mass marker to identify the correct size range for enrichment
of the RNA pool during purification steps. The RNA sample is then
subjected to purification. Any of a number of methods can be
employed. PAGE purification is most commonly performed. The ORN
marker co-purifies with the target RNAs and, like the natural small
RNA species present, will participate in the subsequent 3'
Tinkering step wherein it then serves as a marker for collecting
the Tinkered RNAs as well as a positive control for the 3'-linker
step. The ORN marker does not contain a 5' phosphate group which
renders it inactive for the 5' Tinkering step. Thus, only the
target RNAs will be 5' Tinkered and be available for downstream
procedures.
[0032] Similar synthetic ORN markers can be devised for other
classes of target RNAs that may vary in size. For example, a
synthetic ORN marker of about 30-31 nucleotides long could be
constructed to serve as a control for the isolation and cloning of
piwi-interacting RNAs (piRNAs), which are typically 26-32
nucleotides long.
[0033] In one embodiment, the synthetic ORN marker is comprised of
a sequence that is not a recognized miRNA or other naturally
occurring sequence. The marker's sequence can be verified against
established miRNA sequence databases to ensure that there is no
match between the marker and any known miRNAs. One such sequence is
described below. It will be appreciated by one skilled in the art
that need may arise to adjust or change the sequence of the
synthetic ORN marker as new miRNA species are discovered which, by
happenstance, may have similar or identical sequence to the
exemplary sequence employed herein.
[0034] In another embodiment, the RNA construct is the following
sequence.
TABLE-US-00001 SEQ ID NO: 1
5'-rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrU-3'
The sequence has been checked through miRNA databases GenBank and
miRBase (via BLAST) resulting in no match to any known species.
When SEQ ID NO: 1 is added to a sample, the resulting library is of
higher quality than that obtained without SEQ ID NO: 1. As
expected, the resulting clones within the library did not contain
the RNA construct, which may indicate that the synthetic ORN marker
acts as a carrier or provides some mechanism to offer a synergistic
effect for the cloning of the sample.
[0035] As illustrated in FIG. 3A, when 10 pmole of SEQ ID NO: 1
("miSPIKE") are added to 50 .mu.g of cellular RNA, an easily
identifiable band is visible in the gel region corresponding to
desired RNA length. Lane 1 contains both SEQ ID NO: 1 and the
cellular RNA, lane 2 contains only cellular RNA and lane 3 contains
only SEQ ID NO: 1. The SEQ ID NO: 1 sample is visible in lanes 1
and 3.
[0036] FIG. 3B shows a gel containing the corresponding samples
from FIG. 3A after the 3' ligation step. Again, lanes 1 and 3 are
visible due to the presence of SEQ ID NO: 1. And FIG. 3C shows PCR
amplification of doubly-ligated RNAs. Lane 1 is a conventional 3'
plus 5' miRCat ligation. Lane 2 is a miSPIKE only ligation. Lane 3
is a 5' ligation-independent (miRCat-33) cloning lane from RNA not
containing miSPIKE. Lane 4 is a miSPIKE only 5'-LIC showing that
miSPIKE will clone using 5'-LIC whereas Lane 2 shows that miSPIKE
will not clone using the conventional miRCat only method.
[0037] A second embodiment is the following sequence.
TABLE-US-00002 SEQ ID NO:2
5'-rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrUrCrArCrUrGrArArCrGrU-3'
The sequence, which is a ten base extension of SEQ ID NO: 1, has
also been checked through databases GenBank and miRBase (via BLAST)
resulting in no match to any known small RNA species.
[0038] The invention also provides an efficient alternative to
current purification practices. The original protocols for small
RNA cloning required three separate denaturing polyacrylamide gel
(PAGE) purification steps. Each of these is time consuming and each
has an associated cost in terms of lost mass. The purification
method associated with PAGE causes an unavoidable loss of material
regardless of how carefully the procedure is carried out. For this
reason, the early protocols required a very large mass of starting
RNA. The invention eliminates one of the three PAGE purifications
and its attendant loss of material. In addition, the invention also
provides an alternative purification method for the remaining two
PAGE purifications that reduce both time and material loss. The
alternative uses a dye-terminator removal cartridge (DTR, Edge
Biosystems) to remove salts and urea from an acrylamide gel slice.
The methods also use a reduced amount of ligase when linking the 3'
linker to the RNA product as compared to current methods.
[0039] Similarly, a variety of different sequences could be used to
direct RT-PCR of the Tinkered small RNA species, so long as they
are sufficiently complementary to anneal to the 5'- and 3'-linkers
in conditions employed in PCR. A first embodiment consists of
unmodified DNA oligonucleotides that are used for reverse
transcription and for PCR amplification of the RT products for
direct cloning (SEQ ID NO:3 and SEQ ID NO: 4).
TABLE-US-00003 SEQ ID NO: 3 5'-GATTGATGGTGCCTACAG-3' SEQ ID NO: 4
5'-TGGAATTCTGGGCACC-3'
[0040] A second embodiment consists of DNA oligonucleotides each
modified with a 5' biotin for use in concatamer construction
methods from PCR amplicons as a variant to direct cloning (SEQ ID
NO: 5 and SEQ ID NO: 6). The Reverse Transcription step is still
performed using an unmodified primer (SEQ ID NO:3) when later
performing PCR amplification using biotin-modified primers.
TABLE-US-00004 SEQ ID NO: 5 5'-Biotin-GATTGATGGTGCCTACAG-3' SEQ ID
NO: 6 5'-Biotin-TGGAATTCTGGGCACC-3'
[0041] A third embodiment combines the two functions into a single
pair of modified DNA oligonucleotides that can be used for either
approach. The sequences contain a biotin-dT as the penultimate 5'
nucleotide and an additional unmodified nucleotide at the 5' end,
thereby making the biotin-dT an internal biotin label (SEQ ID NO: 7
and SEQ ID NO: 8).
TABLE-US-00005 SEQ ID NO: 7 5'-C-Biotin dT-GATTGATGGTGCCTACAG-3'
SEQ ID NO: 8 5'-C-Biotin dT-TGGAATTCTGGGCACC-3'
[0042] The internal biotin-dT does not interfere with either the
Reverse Transcription reaction or with PCR amplification. Thus, the
RT step and both of the PCR amplification/cloning options can be
carried out with the same two modified oligonucleotides. The use of
the internal biotin-dT allows for PCR amplification with or without
restriction enzyme (in this case, Ban I) digestion and magnetic
bead removal of the fragment ends. Therefore PCR products generated
with these two primers can either be cloned directly or
concatamerized.
[0043] An alternative concatamerization method that does not
require biotinylated oligonucleotides can be substituted that
lowers cost without grossly affecting results.
[0044] The invention additionally provides a 5'-5'-adenylated
oligonucleotides for ligation of the oligonucleotides to a target
RNA species using T4 RNA Ligase. (SEQ ID NO: 9). This
oligonucleotide also contains a 3' dideoxycytidine base to prevent
reactions on that end.
TABLE-US-00006 SEQ ID NO: 9 5'-rAppCTGTAGGCACCATCAAT/3ddC/-3'
[0045] It will be appreciated by one skilled in the art that a
large number of different sequences could perform well as the
synthetic adaptor oligonucleotide employed in the 3'-linkering
step. It is, however, crucial that these sequences contain 1) an
activated adenylyl group at the 5'-end that permits ligation using
T4 RNA Ligase in the absence of ATP, 2) internal restriction
endonuclease sites suitable for use in library cloning, and 3) a
blocked 3'-end that cannot participate in ligation reactions.
[0046] The adenylated oligonucleotides are made using a novel
chemical method that is more direct and simple than traditional
chemical adenylation methods by reacting 5'-monophosphate with
5'-silylated phosphate followed by oxidation by N-chlorosuccinimide
(NCS) in acetonitrile. Using 5'-monophosphate instead of 5'-pyro-
or 5'-polyphosphate eliminates side products because the phosphate
backbone is protected by a cyanoethyl group. The adenylation occurs
on the support and can be purified in a single step. No
post-synthetic chemical reactions are necessary. All steps can be
performed "on column" on a nucleic acid synthesis machine.
[0047] The methods further provide post-PCR amplification
improvements. The amplification products (amplicons) must be
digested with the appropriate restriction enzyme to create the
sticky ends used for concatamerization and subsequent cloning. The
proposed method introduces a substantial improvement. Using
conventional methods, the amplicons generated in the PCR
amplification are too small to be purified by conventional means
apart from excision from an agarose gel--a step that would add
time, effort and expense to the protocol. Unpurified PCR reactions
tend to perform less well than purified PCR products for
restriction enzyme digestion. The proposed method utilizes a
commercial Dye Terminator Removal (DTR) spin cartridge (Edge
BioSystems) to clean up DNA sequencing reactions, having a salutary
effect on restriction enzyme digests of small amplicon residual
primers and salts from the PCR reactions resulting in products that
function with high efficiency in restriction enzyme digestions.
Moreover, there is virtually no loss of reaction mass during the
clean-up.
[0048] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
EXAMPLE 1
[0049] This example provides a protocol for practicing the proposed
microRNA cloning process. Total RNA is prepared using methods
well-known in the art, such as the use of the mirVana RNA isolation
kit (Ambion.RTM.) following the Ambion.RTM. protocol. RNA isolation
methods utilizing glass fiber filters (GFF) or silicate adsorption
should be avoided as these "rapid" methods for RNA isolation often
deplete the small RNA pool present in a natural sample. Organic
extraction reagents such as Trizol or RNA STAT 60 are preferred.
After the RNA is extracted and purified, the sample is enriched for
small RNA species. If practical, it is preferred to employ at least
50 .mu.g to 100 .mu.g of total RNAs for small RNA enrichment
however lower input mass amounts can be used when sample is
limited. The mass of RNAs in the miRNA size range of 18 nt to 26 nt
is a very small fraction of the total RNA present, and size
selection at this stage of library construction is essential to the
quality of the end product. The conventional means of purifying
small RNA fractions is through the use of a 12% denaturing (7M
Urea) polyacrylamide gel (denaturing PAGE).
[0050] Internal control oligonucleotide. 10 pmol (1 .mu.l) of the
internal ORN Marker was added to the total RNA before loading the
acrylamide gel. Following electrophoresis, the gel was stained with
GelStar.RTM. Nucleic Acid Stain, and the 21-mer ORN Marker is
clearly visualized. FIG. 4 provides an example of a gel prepared in
this fashion. To obtain an enriched small RNA fraction, the gel is
cut 2 mm above and below the control marker band and the small RNA
species are eluted from the excised gel slice.
[0051] The RNA is recovered using a standard crush and soak
recovery method. The gel slice(s) is placed in a tube such as a 1.5
ml RNase-free tube and, using an RNase-free glass rod, the gel
slice is crushed. An equal volume of nuclease-free water is added
to the tube (the gel slice is weighed to determine this volume at 1
ml/g). The suspension is vortexed for 15-30 seconds, then heated to
70.degree. C. for 10 minutes, and then optionally vortexed again
for 15-30 seconds. A Performa.RTM. spin column (Edge Biosystems) is
prepared for each gel slice by centrifuging the column at 3,000 rpm
for 3 minutes. The column is then transferred to a receiving tube.
The vortexed slurry is transferred to a spin column and spun at
3,000 rpm for 3 minutes. 3 .mu.l 10 mg/ml glycogen, 25 .mu.l of 3M
NaOAc (pH 5.2) and 900 .mu.l ice cold 100% EtOH is added to the
eluent. The solution is mixed by inversion and then placed at
-80.degree. C. for 20 minutes. The tubes were centrifuged at
16,000.times.g for 10 minutes. The supernatant was drained off and
the pellet was dried.
[0052] Alternatively, the RNA can be recovered from the denaturing
PAGE using DTR columns (Edge Biosystems DTR Gel Filtration
Cartridges Cat. No. 42453). This protocol successfully removes the
urea and other salts with substantially less loss of RNA than is
seen with conventional crush and soaks methods followed by NAP-5
column desalting. The total RNA was size separated on a 15%
denaturing PAGE (7M Urea) for 90 minutes at 275V and then the gel
was stained with GelStar.RTM. nucleic acid stain (Lonza.RTM.) and
placed on a long wavelength (312 nm) UV light box. Next, the RNA
fragment(s) to be purified are excised from the gel and placed in a
1.5 ml tube and crushed with a glass rod. 200 .mu.l sterile,
nuclease-free water is added while continuing to crush the gel into
a slurry. The tube is placed at 70.degree. C. for 10 minutes.
Following manufacturer's recommendations, prepare a DTR column
(EDGE Biosystems.RTM.) for each gel slice and vortex the gel slice
slurry and transfer the entire volume onto the DTR column and spin
at 850.times.g for 3 minutes. Next, discard the DTR column and add
3 .mu.l 10 mg/ml glycogen, 25 .mu.l of 3 M NaOAc (pH 5.2), and 900
.mu.l ice cold 100% EtOH. Mix by inversion and hold at -80.degree.
C. for 30 minutes. Spin the tubes at 16,000.times.g for 10 minutes,
pour off the supernatant and dry the RNA.
[0053] Other methods are available to select for small RNA species.
One option is the mirVana.TM. miRNA Isolation Kit (Ambion.RTM.,
Cat. No. AM1560) that uses spin columns for selecting RNA less than
200 nt in length. The other is the flashPAGE.TM. fractionator (Cat.
No. AM13100) that electrophoretically excludes RNA species greater
than 40 nt in length.
[0054] RNA linkering. Once the enriched small RNA fraction has been
recovered from the acrylamide gel slice, the small RNAs are ligated
with a 3' and a 5' linker in two separate, sequential reactions.
The first reaction is the 3' ligation. In order to avoid
circularization of the RNA fragments, the 3' linker is ligated to
the small RNAs using T4 RNA ligase in the absence of ATP. This
reaction requires use of a pre-activated 5' adenylated (rApp)
cloning linker with a 3' ddC end-block (Lau et al., 2001).
[0055] In an RNase-free 0.2 ml tube the following are added:
TABLE-US-00007 Recovered small RNA fraction y .mu.l 3' RNA linker
(50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l Ligation Enhancer
(such as DMSO) 6 .mu.l T4 RNA Ligase (1 U/.mu.l) 1 .mu.l IDT water
(10 - y) .mu.l Total Volume 20 .mu.l
The 10.times. Ligation Buffer is a reaction buffer. SEQ ID NO:9 is
an example of a 3' linker that has been utilized in cloning. The
Ban I restriction endonuclease site is underlined.
TABLE-US-00008 SEQ ID NO: 9 5'-rAppCTGTAGGCACCATCAAT/3ddC/-3'
[0056] The above reagents are incubated at 22.degree. C. for two
hours. Then 80 .mu.l IDTE (pH 7.5) is added and the entire volume
is transferred to an RNase-free 1.5 ml tube. 3 .mu.l glycogen (10
mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and 2.5 volumes (250
.mu.l)-20.degree. C. 100% EtOH are added. The sample is mixed by
inversion or vortexed briefly, and then placed at -80.degree. C.
for 30 min. The sample is centrifuged at 16000.times.g for 10 min.
The supernatant is removed, and the pellet is dried completely and
resuspended in 10 .mu.l DNase/RNase/pyrogen-free water.
[0057] Page purification of 3'-linkered products. Any free
3'-linker present will compete with the linkered small RNAs for
ligation in the subsequent 5' ligation step. Unreacted linkers are
therefore removed by PAGE purification. Ligated RNAs are 40 nt long
while the unligated 3' linker is 19 nt long. These sizes are easily
resolved on a 12% denaturing (7M urea) polyacrylamide gel (see FIG.
4). The linkered RNAs are recovered using the same methods as
employed during the enriched small RNA enrichment process performed
earlier. The gel is stained with GelStar.RTM. and cut out 2 mm
above and below the 40 nt band. The RNA is recovered using the spin
columns.
[0058] 5' Linkering reaction. The 5' multiple restriction site
(M.R.S.) linker is ligated to the 3' linkered small RNAs in the
presence of 1.0 mM ATP. The M.R.S. contains five restriction sites
and is therefore compatible with many cloning vectors. Several
different 3' linkers can be utilized with this single 5'-linker.
The Ban I 3'-linker employed herein is similar to the "modban"
sequence employed by Lau and Bartel (Lau et al., Science,
294:858-62, 2001) and contains a Ban-I restriction site. We have
also performed the same cloning process using a second 3'-linker
that contains Ava-I and Sty-I restriction sites. We have also
performed the same cloning process using a third 3'-linker that
contains Eco RI and Msp-I restriction sites which was adapted from
Pfeffer and Tuschl (Pfeffer et al., Nat Methods, 2, 269-276, 2005).
All three linkers are modified with a 3'-terminal dideoxy-C (ddC)
base to prevent self ligation. Other methods to block the 3'-end
could be used and are well known in the art. The following sequence
is the M.R.S. linker employed in the present example. It will be
appreciated that many different 5'-linker sequences could be
employed, so long as the restriction sites present are compatible
with the restriction sites present in the 3'-linker and the
intended cloning vector. It is preferred that 6 bases or more from
the 3'-end of this linker be RNA bases. It is more preferred that
10 bases or more at the 3'-end of this linker be RNA bases. It is
even more preferred that 15 bases or more at the 3'-end of this
linker be RNA bases. RNA content at the 3'-end of the 5'-linker
improves reaction efficiency with T4 RNA Ligase.
TABLE-US-00009 SEQ ID NO: 10 5'
TGGAATrUrCrUrCrGrGrGrCrArCrCrArArGrGrU 3'
[0059] The following are added to an RNase-free 0.2 ml tube:
TABLE-US-00010 Recovered 3' linkered RNA fraction y .mu.l 5' RNA
linker (50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l Ligation
Enhancer 6 .mu.l 10 mM ATP 2 .mu.l T4 RNA Ligase (5 U/.mu.l) 1
.mu.l RNase/DNase/pyrogen-free water (8 - y) .mu.l Total Volume 20
.mu.l
The ligation reactions are incubated at 22.degree. C. for two
hours.
[0060] Following incubation, 80 .mu.l IDTE (pH 7.5) is added and
the entire volume is transferred to an RNase-free 1.5 ml tube. 3
.mu.l glycogen (10 mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and
2.5 volumes (250 .mu.l)-20.degree. C. 100% EtOH is then added. The
sample is mixed by inversion or vortexed briefly and then placed at
-80.degree. C. for 30 min. The sample is then centrifuged at
16000.times.g for 10 min. and the supernatant is removed. The
pellet is completely dried and resuspended in 10 .mu.l
nuclease/pyrogen-free water. It is not necessary to gel purify this
reaction. If it is purified, it should be performed using the same
protocol as was employed previously.
[0061] Reverse Transcription. The 5' and 3' ligated RNAs contain
both RNA and DNA domains. These are converted to DNA via reverse
transcription using a RT/REV primer. For this example, the cDNA
reverse transcripts have Ban I restriction sites at both ends that
were designed into the linkers. The following protocol uses
SuperScript.TM. III Reverse Transcriptase (Invitrogen, Carslbad,
Calif.; Cat. Nos. 18080-093 or 18080-044).
[0062] The following was added to an RNase-free 0.2 ml tube:
TABLE-US-00011 Recovered linkered RNA fraction y .mu.l dNTPs (10
mM) 1.0 .mu.l RT primer (10 .mu.M) 1.0 .mu.l
DNase/RNase/pyrogen-free water (11.0 - y) .mu.l Total Volume 13.0
.mu.l
The sample was incubated at 65.degree. C. for 5 minutes, placed on
ice, and then 4 .mu.l 5.times. First Strand Buffer, 1 .mu.l 0.1 M
DTT, 1 .mu.l RNase-OUT.TM. (40 U/.mu.l), and 1 .mu.l
SuperScript.TM. III RT (200 U/.mu.l) 1 .mu.l were added for a total
volume of 20 .mu.l. The sample was incubated at 50.degree. C. for
one hour followed by a 15 minute incubation at 70.degree. C.
[0063] PCR amplification, restriction endonuclease digestion and
concatamerization/cloning. The double-stranded DNA products that
result from above can be directly cloned as single inserts into a
plasmid vector or can be serially contatamerized so that multiple
species will clone into each plasmid. Direct cloning is simpler and
is preferred for use in sequencing methods that result in short
read lengths (<100 bases). Concatamer cloning results in long
inserts that are more efficient for use in sequencing methods that
result in long read lengths (>300 bases).
[0064] For concatamerization/cloning, a previously optimized SAGE
protocol coupled with concatamerization protocols from the
laboratories of Dr. David Bartel (Lau et al., Science 294: 858-862,
2001), Dr. Andrew Fire (Pak and Fire, Science 315: 241-244, 2007),
and Dr. Victor Velculescu (Cummins et al., PNAS 103: 3687-3692,
2006) can be used. Concatamerization requires significantly more
amplicon mass than is routinely obtained in a single PCR
amplification. Therefore, six parallel PCR amplification reactions
in separate nuclease-free 0.2 ml tubes are assembled as
follows:
TABLE-US-00012 Reverse transcription reaction 3.0 .mu.l
DNase/RNase/pyrogen-free water 35.5 .mu.l 10X PCR Buffer 5.0 .mu.l
MgCl.sub.2 (1.5 mM) 3.0 .mu.l dNTPs (10 mM) 1.0 .mu.l Forward
Primer (10 .mu.M) 1.0 .mu.l Reverse Primer (10 .mu.M) 1.0 .mu.l Taq
polymerase (5 U/.mu.l) 0.5 .mu.l Total Volume 50.0 .mu.l
[0065] The PCR conditions are: 95.degree. C. for 5 minutes; 25
cycles of 95.degree. C. for 30 seconds, 52.degree. C. for 30
seconds and 72.degree. C. for 30 seconds; and finally 72.degree. C.
for 5 minutes. SEQ ID NO:4 is the PCR forward primer and SEQ ID
NO:3 is the reverse primer.
TABLE-US-00013 SEQ ID NO:4 5'-TGGAATTCTCGGGCACC-3' Tm =
55.0.degree. C. SEQ ID NO:3 5'-GATTGATGGTGCCTACAG-3' Tm =
50.2.degree. C.
The quality of the PCR amplification can be evaluated by running 5
.mu.l of each reaction on a high percentage agarose gel. The
expected amplicon size is 62 bp. The remaining 45 .mu.l of each of
these reactions are pooled in a single 1.5 ml tube.
[0066] For amplicon processing, an equal volume (270 .mu.l) is
added of phenol: chloroform:isoamyl alcohol (25:24:1) to the 1.5 ml
tube, vortexed and then centrifuged at 16000.times.g for 5 min. The
upper (aqueous) phase is transferred to a new 1.5 ml tube and 1/10
volume (27 .mu.l) of 3 M NaOAc (pH 5.2) and three volumes (900
.mu.l) of cold 100% EtOH are added. The tube is placed at
-80.degree. C. for 20 minutes, centrifuged at 16000.times.g for 10
minutes and the supernatant is removed. The pellet is washed in 900
.mu.l of ice cold 70% EtOH and centrifuged again at 16000.times.g
for 10 minutes. The supernatant is removed and the pellet is dried.
Then 20 .mu.l of DNase/RNase/pyrogen-free water is added.
[0067] The concentrated amplicon pool is digested with Ban I
restriction endonuclease (New England Biolabs R0118S) for 1 hour at
37.degree. C. with the following reagents:
TABLE-US-00014 Amplicon Pool 20 .mu.l 10X Ban I Buffer 3 .mu.l
DNase/RNase/pyrogen-free water 5 .mu.l Ban I (20 U/.mu.l)
endonuclease 2 .mu.l Total Volume 30 .mu.l
[0068] Following digestion, 30 .mu.l of phenol: chloroform: isoamyl
alcohol (25:24:1) is added and the sample is vortexed and
centrifuged at 16000.times.g for 3 minutes. The upper (aqueous)
phase is transferred to a new tube and 3 .mu.l of 3 M NaOAc (pH
5.2) and 100 .mu.l of ice cold 100% EtOH are added. The tube is
placed at -80.degree. C. for 20 minutes, centrifuged again at
.about.16000.times.g for 10 minutes, and the supernatant is
removed. The pellet is washed in 100 .mu.l of ice cold 70% EtOH.
The sample is centrifuged again at 16000.times.g for 10 minutes,
the supernatant is removed the pellet is dried. 7 .mu.l
nuclease/pyrogen-free water is added.
[0069] For concatamerization, the following reagents are added:
TABLE-US-00015 Ban I digested amplicons 15 .mu.l 10X Ligation
Buffer 2 .mu.l 10 mM ATP 2 .mu.l T4 DNA Ligase (30 U/.mu.l) 1 .mu.l
Total Volume 20 .mu.l
This reaction is incubated overnight at room temperature.
[0070] To prepare the concatamers for cloning into a PCR cloning
vector it is necessary to fill in the 3' concatamer ends and to add
an overhanging adenosine nucleotide. The following reagents are
added to the 20 .mu.l concatamer reaction:
TABLE-US-00016 10 mM dNTPs 1.7 .mu.l MgCl.sub.2 2.4 .mu.l 10X PCR
Buffer 3.0 .mu.l DNase/RNase/pyrogen-free water 2.4 .mu.l Taq
polymerase (5 U/.mu.l) 0.5 .mu.l Total Volume 30 .mu.l
This reaction is incubated at 95.degree. C. for five minutes,
72.degree. C. for ten minutes, and then cooled to 25.degree. C.
before cloning. The reaction can be passed through a QIAQuick.RTM.
PCR clean up column (QIAGEN Cat. No. 28104) to remove buffers and
dNTPs. This is also desirable as there will be small, unligated
fragments that can possibly compete in the cloning reaction. The
QIAQuick.RTM. column removes a significant amount of these smaller,
competing fragments.
[0071] Cloning. Cloning can be performed using a standard PCR
cloning vector such as TOPO TA Cloning.RTM. (Invitrogen) or
pGEM.RTM. T-EASY (Promega). Cloning should proceed according to the
protocol supplied with the vector.
[0072] Concatamers result in a series of small RNAs separated by
well defined linker units in which the Ban I restriction
endonuclease site is reconstituted. The connector sequence is SEQ
ID NO: 11 or it can be SEQ ID NO: 12 if the concatamers are
inserted in the reverse orientation.
TABLE-US-00017 SEQ ID NO: 11 CTGTAGGCACCAAGGT SEQ ID NO: 12
ACCTTGGTGCCTACAG
These connector sequences are not always perfectly reconstituted so
some care needs to be taken in reading the sequence traces. FIG. 5
illustrates an electropherogram of a microRNA concatamer sequence
containing six microRNAs. The 5' linker is at position 138-159
followed by miR-26a; Connector 1 is at 182-198 followed by
miR-122a; Connector 2 is at 219-235 followed by miR-34a; Connector
3 is at 258-274 followed by miR-21; Connector 4 is at 297-308
followed by miR-122a; Connector 5 is at 330-346 followed by
miR-23a; and the 3' linker is at 368-385. Note that four of the
five connectors are canonical but that connector four is truncated.
Connectors 1-3 and 5 are SEQ ID NO: 11, and Connector 4 is the same
as SEQ ID NO: 11 except the last three bases on the 3' end (GGT)
are missing.
[0073] A second option for cloning is to clone the PCR amplicons
from the reverse transcription directly using a standard PCR
cloning vector such as TOPO TA Cloning.RTM. (Invitrogen) or
pGEM.RTM. T-EASY (Promega). Cloning proceeds according to the
protocol supplied with the vector. While this option is less
efficient than the SAGE-like concatamerization method for
sequencing, it does not require the additional steps needed for the
latter.
EXAMPLE 2
[0074] The following example demonstrates the use of the method of
the invention to isolate novel miRNAs from tissue.
[0075] Total RNA was prepared from brain, heart, lung, liver and
kidney tissue of the South American marsupial species Monodelphis
domestica using the mirVana RNA isolation kit (Ambion.RTM., Austin,
Tex.) according to the manufacturer's protocol. Between 100 .mu.g
and 200 .mu.g of total cellular RNA was obtained from each tissue
fragment. A 100 .mu.g RNA pool, comprising 20 .mu.g of RNA from
each tissue, was used as the RNA source for the experiment. This
pooled RNA sample was spiked with 10 pmole of the 21 nt internal
control ORN marker "miSPIKE" and size fractionated on a 12%
denaturing (7M urea) polyacrylamide gel at 275 volts for 90
minutes.
TABLE-US-00018 SEQ ID NO. 1
5'-rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrU-3'
[0076] The gel was stained with GelStar.RTM. and RNAs were
visualized under UV excitation. A 4 mm square gel slice was excised
using the miSPIKE ORN marker as a size guide. The gel slice was cut
2 mm above the ORN marker and 2 mm below the marker, thereby
recovering RNAs in .about.19-24 nt size range. The gel slice was
pulverized in 200 .mu.l of sterile, RNase-free water in a 1.5 ml
microcentrifuge tube. The pulverized slurry was heated at
70.degree. C. for 10 minutes and the entire volume was loaded on an
EDGE Biosystems Performa.RTM. spin column and centrifuged for 3
minutes at 3,000 rpm. The target RNAs passed through the column and
were recovered in the eluent while the acrylamide, salts and urea
were retained within the column. The RNAs were precipitated with
the addition of 3 .mu.l of 10 mg/ml glycogen, 25 .mu.l of 3M sodium
acetate (pH 5.2), and 900 .mu.l of cold 100% ethanol. The
precipitated RNA was centrifuged for 10 minutes at 13,500 rpm to
pellet the RNAs and was dried under vacuum.
[0077] 3' small RNA Tinkering. The target RNAs were ligated to the
adenylated 3' cloning linker Ban I (Linker 1 and SEQ ID NO:3) using
the protocol in Example 1. In order to avoid circularization of the
small RNAs, the 3' linker is ligated to the small RNAs using T4 RNA
Ligase in the absence of ATP. This reaction involves a
pre-activated 5' adenylated (rApp) cloning linker with a 3' ddC
end-block (Lau et al., 2001).
[0078] In an RNase-free 0.2 ml tube the following reagents were
added:
TABLE-US-00019 Recovered small RNA fraction 6 .mu.l 3' RNA linker
(50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l DMSO 6 .mu.l T4 RNA
Ligase (1 U/.mu.l) 1 .mu.l Nuclease-free water 4 .mu.l Total Volume
20 .mu.l
The 10.times. Ligation Buffer employed was the buffer provided by
Epicentre Technologies with their T4 RNA Ligase. In this case, DMSO
serves as a ligation enhancer which improves efficiency of the
reaction. SEQ ID NO:3 is an adenylated cloning linker containing a
Ban I restriction endonuclease site, which is underlined.
TABLE-US-00020 SEQ ID NO: 9 5'-rAppCTGTAGGCACCATCAAT/3ddC/-3'
[0079] The ligation reaction was incubated at 22.degree. C. for two
hours. Then 80 .mu.l TE (pH 7.5) was added and the entire volume
transferred to an RNase-free 1.5 ml tube. 3 .mu.l glycogen (10
mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and 2.5 volumes (250
.mu.l) 100% EtOH were added, mixed, then placed at -80.degree. C.
for 30 min. The sample was centrifuged at 16000.times.g for 10 min.
The supernatant was removed, the pellet was dried and resuspended
in 10 .mu.l water.
[0080] The 3'-linkering reaction was run on a 12% denaturing PAGE,
stained, and products visualized under UV excitation. The miSPIKE
ORN marker now migrated around 40 nt size (due to the addition of
the 3'-linker). RNAs co-migrating with the ligated marker were
excised from the gel (see FIG. 6). Linkered RNAs were recovered
from the gel slices as previously described.
[0081] 5' Linkering reaction. The 5' multiple restriction site
(M.R.S.) linker was ligated to the small RNAs recovered from gel
purification above, this time using T4 RNA Ligase in the presence
of 1.0 mM ATP. The M.R.S. linker contains five restriction sites
and is therefore compatible with the Ban I 3'-linker employed in
earlier steps. Sequence of the M.R.S. linker employed is shown
below.
TABLE-US-00021 SEQ ID NO: 10 5'
TGGAATrUrCrUrCrGrGrGrCrArCrCrArArGrGrU 3'
[0082] The following was added to an RNase-free 0.2 ml tube:
TABLE-US-00022 Recovered 3' linkered RNA fraction 6 .mu.l 5' RNA
linker (50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l DMSO 6 .mu.l
10 mM ATP 2 .mu.l T4 RNA Ligase (5 U/.mu.l) 1 .mu.l Nuclease-free
water 2 .mu.l Total Volume 20 .mu.l
The ligation reactions were incubated at 22.degree. C. for two
hours. Following incubation, 80 .mu.l TE (pH 7.5) was added and the
entire volume transferred to an RNase-free 1.5 ml tube. 3 .mu.l
glycogen (10 mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and 2.5
volumes (250 .mu.l)-20.degree. C. 100% EtOH was added, mixed, and
stored at -80.degree. C. for 30 min. The sample was centrifuged at
16000.times.g for 10 min. and the supernatant removed. The pellet
was dried and resuspended in 10 .mu.l nuclease-free water.
[0083] Reverse Transcription. At this point the 5' and 3' ligated
RNAs contain both RNA and DNA regions. These are converted to DNA
via reverse transcription using a RT/REV primer. For this example,
the cDNA reverse transcripts have Ban I restriction sites at both
ends that were designed into the linkers. The following RT primer
was employed:
TABLE-US-00023 SEQ ID NO: 3 5'-GATTGATGGTGCCTACAG-3'
[0084] Reverse transcription was performed in the following
reaction mix in a 0.2 ml tube.
TABLE-US-00024 Recovered linkered RNA fraction 10 .mu.l dNTPs (10
mM) 1.0 .mu.l RT primer (10 .mu.M) 1.0 .mu.l
DNase/RNase/pyrogen-free water 1.0 .mu.l Total Volume 13.0
.mu.l
The sample was incubated at 65.degree. C. for 5 minutes, placed on
ice, and then 4 .mu.l 5.times. First Strand Buffer, 1 .mu.l 0.1 M
DTT, 1 .mu.l RNase-OUT.TM. (40 U/.mu.l), and 1 .mu.l
SuperScript.TM. III RT (200 U/.mu.l) were added for a total volume
of 20 .mu.l. The sample was incubated at 50.degree. C. for one hour
followed by a 15 minute incubation at 70.degree. C.
[0085] PCR and Cloning. Standard PCR amplifications of the reverse
transcribed linkered RNAs yielded expected amplicons (see FIG. 7).
SEQ ID NO:4 served as the Forward PCR primer and SEQ ID NO: 3
served as the Reverse PCR primer. PCR amplification conditions
consisted of a single initial incubation at 95.degree. C. for five
minutes followed by 25 cycles of 95.degree. C. for 30 seconds,
52.degree. C. for 30 seconds, and 72.degree. C. for 30 seconds. A
final extension incubation at 72.degree. C. for five minutes
followed the cycling to ensure that all PCR amplicons were full
length.
[0086] Concatamers. PCR amplicons were digested with the
restriction endonuclease Ban I and concatamerized by ligation using
30U of T4 DNA Ligase (Epicentre Biotechnologies). The result of
this process is shown in FIG. 10.
[0087] Concatemer Cloning. Concatemers were cloned into the pGEM
T-EASY cloning vector following manufacturer's (Promega)
protocol.
[0088] Concatemer Sequencing. 480 bacterial colonies containing
concatamer clones were directly sequenced on an Applied Biosystems
Model 3130xl Genetic Analyzer. From these sequences, more than 100
unique sequence signatures in the expected size range of 21 nt to
24 nt were identified. Of these, 92 were confirmed in miRBase as
previously identified mammalian microRNAs. Identification of these
previously known miRNA sequences validates the performance of the
method and also confirms their existence and expression in
Monodelphis. An additional fifteen sequences were subsequently
validated as new, marsupial-specific microRNAs. These sequences are
shown below.
TABLE-US-00025 TABLE 1 Sequences and miRBase assignments of fifteen
new marsupial microRNAs. SEQ ID NO: Sequence ID miRBase # Cloned
RNA sequence 13 Mdo-10 mdo-miR-1540 UGAUUCCAUAGAGCGCAUGU 14
Mdo-27.sup.# mdo-miR-1541 UGGUGUGCUCGUUUGGAUGUGG 15 Mdo- 172a
mdo-miR-1542-1 UAUUGAUCUCCAAUGCCUAGC 16 Mdo-172b mdo-miR-1542-2
UAUUGAUCUCCAAUGCCUAGC 17 Mdo-174 mdo-miR-1543
UUAGUCCUAGUCUAGGUGCACA 18 Mdo-182 mdo-miR-340
AAGUAAUGAGAUUGAUUUCUGU 19 Mdo-202.sup.# mdo-miR-1545
UGCACCCAGGGAUAGGAUAGCG 20 Mdo-253-3p.sup.# mdo-miR-1544-3p
ACUUUCCAUCCCUUGCACUGU 21 Mdo-253-5p.sup.# mdo-miR-1544-5p
AGUGUCCUGGGAUAGAUAGGCG 22 Mdo-254 mdo-miR-1546
UCAGGGAUUCUCAGGGAUGGAA 23 Mdo-302 mdo-miR-1547
UAUCAGAGUCUUGGGUCCUUGU 24 Mdo-305 unassigned*
UGCAUCCUGCAGCGGGCUCCCC 25 Mdo-315 unassigned* UUCCGCCCUGCAAGCCCGGUA
26 Mdo-204 unassigned* GUAACAGCCCACGAUGGUUUG 27 Mdo-301 unassigned*
CCGCUCCGCUUGGUGCUGGCG .sup.#microRNA found in Monodelphis domestica
only. All other miRNAs validated in additional marsupial species.
*microRNa has not been assigned a miRBase ID number as of Release
11.0 (April 2008).
EXAMPLE 3
[0089] The following example demonstrates the use of the method of
the invention to isolate novel piRNAs from tissue.
[0090] Unlike miRNAs which are expressed in all tissues, other
classes of small RNAs have limited tissue distribution. The Piwi
associated RNAs (piRNAs) are a different class of small RNA which
are specific to gonads (ovary and testis). The piRNAs are longer
than miRNAs, and usually are 26-32 nt long. The method of the
invention was used to isolate and sequence identify novel piRNAs.
Total RNA was prepared from testis of the South American marsupial
species Monodelphis domestica using the mirVana RNA isolation kit
(Ambion.RTM., Austin, Tex.) according to the manufacturer's
protocol. Between 100 .mu.g and 200 .mu.g of total cellular RNA was
obtained from each tissue fragment. 100 .mu.g testis derived RNA
was employed for the experiment. This RNA sample was spiked with 10
pmole of the 31 nt internal control ORN marker "piSPIKE" and size
fractionated on a 12% denaturing (7M urea) polyacrylamide gel at
275 volts for 90 minutes.
TABLE-US-00026 SEQ ID NO:2
5'-rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrUrCrArCrUrGrArArCrGrU-3'
[0091] The gel was stained with GelStar.RTM. and RNAs were
visualized under UV excitation. A 4 mm square gel slice was excised
using the miSPIKE ORN marker as a size guide. The gel slice was cut
2 mm above the ORN marker and 2 mm below the marker, thereby
recovering RNAs in .about.26-34 nt size range. The gel slice was
pulverized in 200 .mu.l of sterile, RNase-free water in a 1.5 ml
microcentrifuge tube. The pulverized slurry was heated at
70.degree. C. for 10 minutes and the entire volume was loaded on an
EDGE Biosystems Performa.RTM. spin column and centrifuged for 3
minutes at 3,000 rpm. The target RNAs passed through the column and
were recovered in the eluent while the acrylamide, salts and urea
were retained within the column. The RNAs were precipitated with
the addition of 3 .mu.l of 10 mg/ml glycogen, 25 .mu.l of 3M sodium
acetate (pH 5.2), and 900 .mu.l of cold 100% ethanol. The
precipitated RNA was centrifuged for 10 minutes at 13,500 rpm to
pellet the RNAs and was dried under vacuum.
[0092] 3' small RNA Tinkering. The target RNAs were ligated to the
adenylated 3' cloning linker Ban I (Linker 1 and SEQ ID NO:3) using
the protocol in Example 1. In order to avoid circularization of the
small RNAs, the 3' linker is ligated to the small RNAs using T4 RNA
Ligase in the absence of ATP. This reaction involves a
pre-activated 5' adenylated (rApp) cloning linker with a 3' ddC
end-block (Lau et al., 2001).
[0093] In an RNase-free 0.2 ml tube the following reagents were
added:
TABLE-US-00027 Recovered small RNA fraction 6 .mu.l 3' RNA linker
(50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l DMSO 6 .mu.l T4 RNA
Ligase (1 U/.mu.l) 1 .mu.l Nuclease-free water 4 .mu.l Total Volume
20 .mu.l
The 10.times. Ligation Buffer employed was the buffer provided by
Epicentre Technologies with their T4 RNA Ligase. In this case, DMSO
serves as a ligation enhancer which improves efficiency of the
reaction. SEQ ID NO:3 is an adenylated cloning linker containing a
Ban I restriction endonuclease site, which is underlined.
TABLE-US-00028 SEQ ID NO: 9 5'-rAppCTGTAGGCACCATCAAT/3ddC/-3'
[0094] The ligation reaction was incubated at 22.degree. C. for two
hours. Then 80 .mu.l TE (pH 7.5) was added and the entire volume
transferred to an RNase-free 1.5 ml tube. 3 .mu.l glycogen (10
mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and 2.5 volumes (250
.mu.l) 100% EtOH were added, mixed, then placed at -80.degree. C.
for 30 min. The sample was centrifuged at 16000.times.g for 10 min.
The supernatant was removed, the pellet was dried and resuspended
in 10 .mu.l water.
[0095] The 3'-linkering reaction was run on a 12% denaturing PAGE,
stained, and products visualized under UV excitation. The piSPIKE
ORN marker now migrated around 48 nt size (due to the addition of
the 3'-linker). RNAs co-migrating with the ligated marker were
excised from the gel (see FIGS. 6 and 7). Linkered RNAs were
recovered from the gel slices as previously described.
[0096] 5' Linkering reaction. The 5' multiple restriction site
(M.R.S.) linker was ligated to the small RNAs recovered from gel
purification above, this time using T4 RNA Ligase in the presence
of 1.0 mM ATP. The M.R.S. linker contains five restriction sites
and is therefore compatible with the Ban I 3'-linker employed in
earlier steps. Sequence of the M.R.S. linker employed is shown
below.
TABLE-US-00029 SEQ ID NO: 10 5'
TGGAATrUrCrUrCrGrGrGrCrArCrCrArArGrGrU 3'
[0097] The following was added to an RNase-free 0.2 ml tube:
TABLE-US-00030 Recovered 3' linkered RNA fraction 6 .mu.l 5' RNA
linker (50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l DMSO 6 .mu.l
10 mM ATP 2 .mu.l T4 RNA Ligase (5 U/.mu.l) 1 .mu.l Nuclease-free
water 2 .mu.l Total Volume 20 .mu.l
The ligation reactions were incubated at 22.degree. C. for two
hours. Following incubation, 80 .mu.l TE (pH 7.5) was added and the
entire volume transferred to an RNase-free 1.5 ml tube. 3 .mu.l
glycogen (10 mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc and 2.5
volumes (250 .mu.l)-20.degree. C. 100% EtOH was added, mixed, and
stored at -80.degree. C. for 30 min. The sample was centrifuged at
16000.times.g for 10 min. and the supernatant removed. The pellet
was dried and resuspended in 10 .mu.l nuclease-free water.
[0098] Reverse Transcription. At this point the 5' and 3' ligated
RNAs contain both RNA and DNA regions. These are converted to DNA
via reverse transcription using a RT/REV primer. For this example,
the cDNA reverse transcripts have Ban I restriction sites at both
ends that were designed into the linkers. The following RT primer
was employed:
TABLE-US-00031 SEQ ID NO: 3 5'-GATTGATGGTGCCTACAG-3'
[0099] Reverse transcription was performed in the following
reaction mix in a 0.2 ml tube.
TABLE-US-00032 Recovered linkered RNA fraction 10 .mu.l dNTPs (10
mM) 1.0 .mu.l RT primer (10 .mu.M) 1.0 .mu.l
DNase/RNase/pyrogen-free water 1.0 .mu.l Total Volume 13.0
.mu.l
The sample was incubated at 65.degree. C. for 5 minutes, placed on
ice, and then 4 .mu.l 5.times. First Strand Buffer, 1 .mu.l 0.1 M
DTT, 1 .mu.l RNase-OUT.TM. (40 U/.mu.l), and 1 .mu.l
SuperScript.TM. III RT (200 U/.mu.l) were added for a total volume
of 20 .mu.l. The sample was incubated at 50.degree. C. for one hour
followed by a 15 minute incubation at 70.degree. C. PCR and
Cloning. Standard PCR amplifications of the reverse transcribed
linkered RNAs yielded expected amplicons (see FIG. 7). SEQ ID NO:4
served as the Forward PCR primer and SEQ ID NO: 3 served as the
Reverse PCR primer. PCR amplification conditions consisted of a
single initial incubation at 95.degree. C. for five minutes
followed by 25 cycles of 95.degree. C. for 30 seconds, 52.degree.
C. for 30 seconds, and 72.degree. C. for 30 seconds. A final
extension incubation at 72.degree. C. for five minutes followed the
cycling to ensure that all PCR amplicons were full length.
[0100] Concatamers. PCR amplicons were digested with the
restriction endonuclease Ban I and concatamerized by ligation using
30U of T4 DNA Ligase (Epicentre Biotechnologies). The result of
this process is shown in FIG. 10.
[0101] Concatamer Cloning. Concatamers were cloned into the pGEM
T-EASY cloning vector following manufacturer's (Promega)
protocol.
[0102] Concatamer Sequencing. 600 bacterial colonies containing
concatamer clones were directly sequenced on an Applied Biosystems
Model 3130xl Genetic Analyzer. From these sequences, 406 unique
sequence signatures were identified after identical cloned
sequences were pooled. Of the 406 unique signatures, 310 (87.8%)
were found to be in the expected size range of 28 nt to 31 nt.
Analysis of these 310 sequences showed that they conform to the
criteria accepted for identification of a new small RNA class
called PIWI-interacting RNAs (piRNAs). These criteria include a
length of 28 nt to 31 nt, a pronounced preference for a 5' uridine
base (83.5% of these sequence signatures have a 5' U),
transcription from large clusters (most of these sequences mapped
to one of sixteen transcription clusters in the M. domestica
genome), and targets of action that are primarily transposons (38
marsupial transposon targets were identified). Representative
sequence identify are shown below.
TABLE-US-00033 TABLE 2 piRNA-like RNA sequences returning more than
100 full-length BLAST hits in the MonDom5 M. domestica genome
assembly. Flanking sequence from MonDom5 was used to query each
insert sequence in RepeatMasker to obtain a transposon
identification. One sequence, MdopiR-263, was deleted from this
group and reassigned as MdopiR-162 after further analysis. SEQ ID
Repeat Masker NO: piRNA ID Insert Sequence Transposon ID 28
MdopiR-245 UCAUCUAUAAAAUUAGUCGGAGAAGGAAA Mar1a Mdo 29 MdopiR-246
UGGAUUUGGAAUCAGAGGAUGUGGGU No ID 30 MdopiR-247
UAGUGCCAAUAGAGCGUAAGGUCAAAGAGU OposCharlie3a 31 MdopiR-247
UAGUGCCAAUAGAGCGUAAGGUCAAAGAGU LTR-ERV1 32 MdopiR-248
UUGAGGUAGUCUAUUUCAUUCGGUGCUGG OposCharlie3a 33 MdopiR-250
UGGGUCUGGAGUCAGGAAGCCUCAU Mar1a Mdo 34 MdopiR-251
GAGUCACUUAACCUGUUUGCCUCAGAUUCC Mar1b Mdo 35 MdopiR-252
AGUGGAUUGAGAGCCAGGCCUAGAGAUG SINE1 Mdo 36 MdopiR-253
UUGGCGAUUACAUUCCUGGGGGGUUGU L1 Mdo 37 MdopiR-254
UCAGGUCAUGCAGAGAAAAGUCUAAUGGUCC Mdo ERV2 38 MdopiR-255
UGUUGAAUGAAUGAAUGGAGGUUAUUUC No ID 39 MdopiR-256
CUUGAAUUCAAGACCUCCUGACUCUAGGCC SINE1 Mdo 40 MdopiR-257
UUUUGUGUCAUGGACCCCUUUGGUAGUCU MIR3 MarsA 41 MdopiR-258
UGCGGAUGACGUGUCCAGACCAUUGUAGC RTE Mdo 42 MdopiR-259
UGGUAUCCAUUUUCUACAAAACCCUGUUGC Mdo ERV2 43 MdopiR-260
UCAUUUUAUGUAUGAGAAACUGAGAUAAA Mar1a Mdo 44 MdopiR-261
UGGGAUAUAAACUUGCCGGGACCAAUGCC No ID 45 MdopiR-262
UUCUAUGUUAACCACUCGGGGAUUAUUAGG Mdo ERV15 46 MdopiR-264
UGGAUUCAUAUCUGACCUCAGACACUUC SINE1 Mdo 47 MdopiR-265
GUUAAUAUUAAUUUGUACCCCUUUUAGGCCC L1 Opos 48 MdopiR-266
UGAUACAUACUAGCUGUGUAACCGUGGAC Mar 1c Mdo 49 MdopiR-267
GGAUUGAGAGCCAGGCCUAGAGAUAGGAGGUC SINE1 Mdo 50 MdopiR-268
AGUGGAAUGAGAACCAGGCCUAGAGAUG SINE1 Mdo 51 MdopiR-269
UGUAAAAUGAGAGAGUUGGUGUAGGUGGC MIR3 MarsB 52 MdopiR-270
UUAUUUUAUAGAUAAGGAAACUGAGGCU Tigger 3 53 MdopiR-271
UGUGAUUGGUAGAUAUAAGGACUUGGGGGU LTR1k Mdo 54 MdopiR-272
UGGACUGAGAGCCAGGCCUAGAGACUGGAGU SINE1 Mdo 55 MdopiR-273
UCAUGAGUCCCUUGGAGUUGUCUUGGGU L1 Opos 56 MdopiR-274
GCAUUGGUGGUUCAGUGGUAGAAUUCUCG tRNA-GLY 57 MdopiR-275
UUGUGGAUAAUUUCCAUUUUGGGAGGCA L1 Mdo 58 MdopiR-276
UGAUGAUGUUUGAGCAGGGAUGGACAGA LTR2e MD 59 MdopiR-277
UGCUUUGUUUCUUCUCAGGCUGGUCAC LTR106 MD 60 MdopiR-278
UUGCAGCCAUAUUAACCCGGAAGUCCGCUC L1 Mdo 61 MdopiR-279
UUAAAAAAAAAUACUGGUGUAGA L1 Mdo 62 MdopiR-280
UACACAGCCAGUUAGUGUCUGAGGCCACAAAA Mar1a Mdo 63 MdopiR-281
UGGCAAACCUUUUAGAGACAGAGUGCCCA OposCharlie3a
EXAMPLE 4
[0103] The following example demonstrates the recovery of small RNA
fractions in an RNA sample. Accurate recovery of the small RNA
fraction as well as the 3' Tinkered RNAs from that fraction under
conventional methods is difficult. To illustrate the dilemma, a
22-mer RNA with a 5' phosphate group was run on a 15% denaturing
acrylamide gel adjacent to an Oligo Size Ladder (Integrated DNA
Technologies). The result, shown in FIG. 11, is that the RNA runs
high compared to the Size Ladder that is composed of
single-stranded DNAs. The following example demonstrates the
improvement of fraction collection utilizing an internal
marker.
[0104] SEQ ID NO: 1 was synthesized without a 5' phosphate. Two
samples were kept separate throughout the process. One of the two
samples was purified via the "crush and soak", NAP column method
after both denaturing PAGE gels. The other sample was purified
after each of the two denaturing PAGE gels by pulverizing the
acrylamide gel slice in 200 .mu.l of IDT water and vortexing until
the gel became a slurry in the tube. This slurry was then
transferred to a DTR column (Edge Biosystems) and centrifuged for
three minutes at 3000 rpm as per the manufacturers' instructions.
The eluent was precipitated in 1/10 volume of NaOAc (pH 8.0) and
three volume of ice cold ethanol with glycogen as the
co-precipitant. The precipitant was dried down and both the crush
and soak sample and the DTR column sample were used in each
subsequent step as per the miRNA cloning kit protocol. FIG. 10A
shows a comparison of total cotton RNA with and without 10 pmole of
the 21-mer spiked into the reaction. FIG. 10B shows the Tinkering
control function as the 3' Tinkered (with 454 3' linker) material
is clearly visible and serves as an internal size marker for RNA
recovery at that step as well (b). The recovered Tinkered material
in FIG. 10B was 5' linked with the 454 5' sequence and then carried
through an RT-PCR. The PCR gel is shown in FIG. 10C.
[0105] The two PCRs from lanes 2 and 3 of FIG. 10B were cloned
separately into pGEM T-EASY and seventeen clones from each reaction
were amplified with M13 For and M13 Rev. The Colony PCR gel is
shown in FIG. 11. As can be seen, with only a couple of exceptions
the colony PCRs in FIG. 11 compare favorably with those in FIG.
7.
[0106] Given the mass difference between the target small RNA
fraction and the 10 pmole of control RNA spiked in, it is evident
that the lack of the 5' phosphate on the control 21-mer RNA
successfully prevented participation in any enzymatic steps
following recovery of the 3' Tinkered species. None of the
sequences from the 34 clones contained the 21-mer RNA control
sequence. Moreover, the breakdown of the 34 sequences was better
than previously seen in cotton RNAs. Of the 34 clone sequences,
only one did not have an insert (3%), ten were linker-linker clones
(29%), and the remaining 23 clones were all linker-RNA-linker.
Among these was a definite microRNA (miR-167), 14 unidentified
RNAs, and eight identified RNA including two sequences identical to
so-called "small RNAs" from Arabidopsis thaliana (Qi et al. (2006)
Nature 443: 1008-1012), two cotton sequences, of which one is a
microsatellite, a fragment of the OGRE retrotransposon previously
identified only in Pisum sativum (Neumann et al. (2003) Plant
Molecular Biology 53: 399-410), and a fragment of an RNA binding
protein gene sequence.
[0107] The quality and content of these 34 clones appears to be
better than those previously obtained without the spiked in 21-mer
RNA, which may mean that the 21-mer is serving as a carrier.
[0108] The colony PCRs in FIG. 11 are from the two treatments with
the crush and soak material on the top and the DTR column material
on the bottom. The clone sequences from the two sets displayed no
difference. The results demonstrate that the DTR column method can
replace the crush and soak, thereby eliminating time and effort
(essentially one full day) from the preparation. The two crush and
soaks required very long dry downs owing to the elution volume of
1.0 ml from the NAP-5 columns. The DTR column procedure took one
hour.
EXAMPLE 5
Oligonucleotide Adenylation Using Diphenyl Phosphate
[0109] The following example demonstrates the on-support
adenylation of an oligonucleotide using diphenyl phosphate. The
reference numbers correspond to the synthesis scheme in FIG.
12.
[0110] Solid support-bound oligonucleotide having a free 5'
hydroxyl group (2) was phosphitylated with 0.5 M diphenyl phosphate
(1) in a 50%/35%/15% (v/v) acetonitrile/pyridine/N-methylimidazole
solution for five minutes. The solid support was rinsed with 1 mL
of 1:1 pyridine/acetonitrile. The phosphitylated oligonucleotide
was converted to a phosphite triester (3) with
chlorotrimethylsilane (10% in pyridine) and immediately treated
with a 40 molar excess of adenosine monophosphate (4) in a 70/30
pyridine/N-methylimidazole solution for 30 minutes. After rinsing
the column with 1:1 pyridine/acetonitrile, the adenylated
oligonucleotide was oxidized with 0.1 M N-chlorosuccinimide in
pyridine for 20 minutes. After oxidation and rinsing with 1:1
pyridine/acetonitrile, the unprotected ribose was labeled with
tert-butyldimethylsilyl chloride (1 M in acetonitrile with 10%
1,8-Diazabicylclo[5.4.0]undec-7-ene) for 15 minutes. The column was
rinsed with acetonitrile to remove excess TBDMS chloride. The
adenylated oligonucleotide was cleaved and deprotected in ammonia
for one hour at 65.degree. C. The oligonucleotide (8) was purified
by RP HPLC. After lyophilization, the two silyl groups were removed
from the oligonucleotide 8 with a 30 minute treatment of 5%
tetraethylammonium fluoride in DMSO. The molecular weight of the
final oligonucleotide (9) was verified by ESI mass-spectrum.
EXAMPLE 6
Oligonucleotide Adenylation Using Salicyl Chlorophosphite
[0111] The following example demonstrates an alternative on-support
adenylation of an oligonucleotide using salicyl chlorophosphite.
The reference numbers correspond to the synthesis scheme in FIG.
13.
[0112] Solid support-bound oligonucleotide (2) was phosphitylated
2.times.15 minutes with a solution of 0.1 M salicyl chlorophosphite
(1) in acetonitrile pre-wetted with pyridine. The oligonucleotide
was immediately treated with a 40 molar excess of
bis-TBDMS-adenosine monophosphate (4) in a 70/30
pyridine/N-methylimidazole solution for 30 minutes. After rinsing
the solid support with 1:1 pyridine/acetonitrile, the phosphite
triester (5) was oxidized with 0.1 M N-chlorosuccinimide in
pyridine for 20 minutes. The oligonucleotide was rinsed with 1:1
pyridine/acetonitrile and cleaved and deprotected in ammonia for
one hour at 65.degree. C. After lyophilization and RP HPLC
purification, the desired oligonucleotide 7 was verified by ESI.
The silyl groups were removed with 5% tetraethylammonium fluoride
in DMSO for 30 minutes. The molecular weight of final
oligonucleotide (8) was confirmed by ESI mass-spectrum.
EXAMPLE 7
5' Ligation-Independent Cloning
[0113] The following example provides an alternative method for
cloning small RNA species with 5' modifications that render them
refractory to conventional cloning. In conventional small RNA
cloning, including the methods in prior examples, cloning begins
with enrichment of the small RNA fraction of total RNA followed in
order by a 3' ligation of a linker sequence, a 5' ligation of a
second linker sequence, reverse transcription, PCR amplification
and cloning. The success of these methods relies on the fact that
the small RNAs will have a 3' hydroxyl group and a 5' phosphate
group. Recently, Pak and Fire (Science 315: 241-244 (2007)) showed
that some small RNA species in C. elegans are tri-phosphorylated on
the 5' end and, therefore, cannot be cloned by conventional
methods. This raises the possibility that there are other small
RNAs with 5' modifications that render them refractory to
conventional cloning.
[0114] Pak and Fire (2007) introduced a modification of the
conventional small RNA cloning procedure that circumvents the
problem of non-standard 5' ends. Called "5' ligation-independent
cloning", this modification involves reversing two of the steps in
the conventional protocol. Following 3' ligation, the ligated
material is reverse transcribed and then a second 3' ligation is
carried out using a different linker sequence.
[0115] The following oligonucleotides can be used in a 5'
ligation-independent cloning protocol.
TABLE-US-00034 SEQ ID NO:64 5'-rAppTGGAATTCTCGGGTGCCAAGGT/ddC/-3'
SEQ ID NO:65 5'-CCTTGGCACCCGAGAATT-3'
[0116] Reverse transcription reaction. The 3' ligated small RNA
fragments contain both RNA and DNA regions. This is converted to an
all DNA substrate via reverse transcription using the RT/REV
primer, which presents a free 3' hydroxyl group that could be used
in a second ligation reaction. The reverse transcription protocol
provided below is for SuperScript.TM. III Reverse Transcriptase
(Invitrogen Cat. Nos. 18080-093 or 18080-044). The following are
added to an RNase-free 0.2 ml tube:
TABLE-US-00035 Recovered linkered RNA fraction y .mu.l dNTPs (10
mM) 1.0 .mu.l RT primer (10 .mu.M) 1.0 .mu.l nuclease/pyrogen-free
water (11.0 - y) .mu.l Total Volume 13.0 .mu.l
This is incubated at 65.degree. C. for 5 minutes and then the
following are added:
TABLE-US-00036 5X First Strand Buffer 4 .mu.l 0.1 M DTT 1 .mu.l
RNase-OUT .TM. (40 U/.mu.l) 1 .mu.l Superscript .TM. III RT (200
U/.mu.l) 1 .mu.l Total Volume 20.0 .mu.l
This is incubated at 50.degree. C. for one hour followed by a 15
minute incubation at 70.degree. C.
[0117] Exonuclease digest. An exonuclease digest is carried out to
remove the unused deoxynucleotides and the primer. The protocol is
for the ExoSAP-IT.RTM. (USB Cat. No. 78200) clean up.
ExoSAP-IT.RTM. contains Exonuclease I and shrimp alkaline
phosphatase in a buffer that is compatible with the RT reaction.
Thus no buffer exchange or precipitation is required prior to
performing the clean up.
[0118] 20 .mu.l of RT reaction is added to 8 .mu.l of ExoSAP-IT for
a total volume of 28 .mu.l. This is incubated for 15 minutes at
37.degree. C. An equal volume of Phenol:Chloroform:Isoamyl Alcohol
(25:24:1) is added, and then the solution is vortexed and
centrifuged at 16000.times.g for 3 min. The aqueous (upper) phase
is transferred to a new 0.2 ml tube and 2.8 .mu.l of 3 M NaOAc is
added. 90 .mu.l of cold 100% EtOH is added and the tube is placed
at -80.degree. C. for 20 minutes. The sample is then centrifuged at
16000.times.g for 10 min and the supernatant is removed. The pellet
is completely dried and resuspended in 10 .mu.l
nuclease/pyrogen-free water.
[0119] The second 3' ligation. In an RNase-free 0.2 ml tube the
following reagents are added:
TABLE-US-00037 Resuspended Reverse Transcription Reaction 10 .mu.l
3' Linker-33 (50 .mu.M) 1 .mu.l 10X Ligation Buffer 2 .mu.l DMSA 6
.mu.l T4 RNA Ligase (1 U/.mu.l) 1 .mu.l Total Volume 20 .mu.l
The above reagents are incubated at 22.degree. C. for two hours and
then 80 .mu.l IDTE (pH 7.5) is added. The entire volume is
transferred to an RNase-free 1.5 ml tube and 3 .mu.l glycogen (10
mg/ml), 1/10 volume (10 .mu.l) 3.0 M NaOAc, and 2.5 volumes (250
.mu.l)-20.degree. C. 100% EtOH are added. The sample is mixed by
inversion or vortexed, and then placed at -80.degree. C. for 30
min. The sample is then centrifuged at 16000.times.g for 10 min and
the supernatant is removed. The pellet is completely dried and
resuspended in 10 .mu.l nuclease/pyrogen-free water.
[0120] PCR Amplification. After PAGE purification is performed (as
in Example 1), the following reagents are combined for PCR:
TABLE-US-00038 PAGE purified material 3.0 .mu.l
DNase/RNase/pyrogen-free water 35.5 .mu.l 10x PCR Buffer 5.0 .mu.l
MgCl.sub.2 (1.5 mM) 3.0 .mu.l dNTPs (10 mM) 1.0 .mu.l RT Primer (10
pmole) 1.0 .mu.l REV-33 Primer (10 pmole) 1.0 .mu.l Taq polymerase
(5 U/.mu.l) 0.5 .mu.l Total Volume 50.0 .mu.l
PCR is carried out as in Example 1.
[0121] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0122] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0123] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
65121RNAArtificial SequenceSynthetic Oligonucleotide 1cucaggaugg
cggagcgguc u 21231RNAArtificialSynthetic oligonucleotide
2cucaggaugg cggagcgguc ucacugaacg u 31318DNAArtificialSynthetic
oligonucleotide 3gattgatggt gcctacag 18417DNAArtificialSynthetic
oligonucleotide 4tggaattctc gggcacc 17518DNAArtificialSynthetic
oligonucleotide 5gattgatggt gcctacag 18616DNAArtificialSynthetic
oligonucleotide 6tggaattctg ggcacc 16720DNAArtificialSynthetic
oligonucleotide 7ctgattgatg gtgcctacag 20818DNAArtificialSynthetic
oligonucleotide 8cttggaattc tgggcacc 18919DNAArtificialSynthetic
oligonucleotide 9actgtaggca ccatcaatc 191022DNAArtificialSynthetic
oligonucleotide 10tggaatucuc gggcaccaag gu
221116DNAArtificialSynthetic oligonucleotide 11ctgtaggcac caaggt
161216DNAArtificialSynthetic oligonucleotide 12accttggtgc ctacag
161320RNAmonodelphis domestica 13ugauuccaua gagcgcaugu
201422RNAmonodelphis domestica 14uggugugcuc guuuggaugu gg
221521RNAmonodelphis domestica 15uauugaucuc caaugccuag c
211621RNAmonodelphis domestica 16uauugaucuc caaugccuag c
211722RNAmonodelphis domestica 17uuaguccuag ucuaggugca ca
221822RNAmonodelphis domestica 18aaguaaugag auugauuucu gu
221922RNAmonodelphis domestica 19ugcacccagg gauaggauag cg
222021RNAmonodelphis domestica 20acuuuccauc ccuugcacug u
212122RNAmonodelphis domestica 21aguguccugg gauagauagg cg
222222RNAmonodelphis domestica 22ucagggauuc ucagggaugg aa
222322RNAmonodelphis domestica 23uaucagaguc uuggguccuu gu
222422RNAmonodelphis domestica 24ugcauccugc agcgggcucc cc
222520RNAmonodelphis domestica 25uuccgcccug caagcccggu
202621RNAmonodelphis domestica 26guaacagccc acgaugguuu g
212721RNAmonodelphis domestica 27ccgcuccgcu uggugcuggc g
212829RNAmonodelphis domestica 28ucaucuauaa aauuagucgg agaaggaaa
292926RNAmonodelphis domestica 29uggauuugga aucagaggau gugggu
263030RNAmonodelphis domestica 30uagugccaau agagcguaag gucaaagagu
303130RNAmonodelphis domestica 31uagugccaau agagcguaag gucaaagagu
303229RNAmonodelphis domestica 32uugagguagu cuauuucauu cggugcugg
293325RNAmonodelphis domestica 33ugggucugga gucaggaagc cucau
253430RNAmonodelphis domestica 34gagucacuua accuguuugc cucagauucc
303528RNAmonodelphis domestica 35aguggauuga gagccaggcc uagagaug
283627RNAmonodelphis domestica 36uuggcgauua cauuccuggg ggguugu
273731RNAmonodelphis domestica 37ucaggucaug cagagaaaag ucuaaugguc c
313828RNAmonodelphis domestica 38uguugaauga augaauggag guuauuuc
283930RNAmonodelphis domestica 39cuugaauuca agaccuccug acucuaggcc
304029RNAmonodelphis domestica 40uuuuguguca uggaccccuu ugguagucu
294129RNAmonodelphis domestica 41ugcggaugac guguccagac cauuguagc
294230RNAmonodelphis domestica 42ugguauccau uuucuacaaa acccuguugc
304329RNAmonodelphis domestica 43ucauuuuaug uaugagaaac ugagauaaa
294429RNAmonodelphis domestica 44ugggauauaa acuugccggg accaaugcc
294530RNAmonodelphis domestica 45uucuauguua accacucggg gauuauuagg
304628RNAmonodelphis domestica 46uggauucaua ucugaccuca gacacuuc
284731RNAmonodelphis domestica 47guuaauauua auuuguaccc cuuuuaggcc c
314829RNAmonodelphis domestica 48ugauacauac uagcugugua accguggac
294932RNAmonodelphis domestica 49ggauugagag ccaggccuag agauaggagg
uc 325028RNAmonodelphis domestica 50aguggaauga gaaccaggcc uagagaug
285129RNAmonodelphis domestica 51uguaaaauga gagaguuggu guagguggc
295228RNAmonodelphis domestica 52uuauuuuaua gauaaggaaa cugaggcu
285330RNAmonodelphis domestica 53ugugauuggu agauauaagg acuugggggu
305431RNAmonodelphis domestica 54uggacugaga gccaggccua gagacuggag u
315528RNAmonodelphis domestica 55ucaugagucc cuuggaguug ucuugggu
285629RNAmonodelphis domestica 56gcauuggugg uucaguggua gaauucucg
295728RNAmonodelphis domestica 57uuguggauaa uuuccauuuu gggaggca
285828RNAmonodelphis domestica 58ugaugauguu ugagcaggga uggacaga
285927RNAmonodelphis domestica 59ugcuuuguuu cuucucaggc uggucac
276030RNAmonodelphis domestica 60uugcagccau auuaacccgg aaguccgcuc
306123RNAmonodelphis domestica 61uuaaaaaaaa auacuggugu aga
236232RNAmonodelphis domestica 62uacacagcca guuagugucu gaggccacaa
aa 326329RNAmonodelphis domestica 63uggcaaaccu uuuagagaca gagugccca
296424DNAArtificialSynthetic oligonucleotide 64atggaattct
cgggtgccaa ggtc 246518DNAArtificialSynthetic oligonucleotide
65ccttggcacc cgagaatt 18
* * * * *