U.S. patent application number 12/127237 was filed with the patent office on 2008-12-04 for single domain ligands, receptors comprising said ligands, methods for their production and use of said ligands and receptors.
This patent application is currently assigned to MEDICAL RESEARCH COUNCIL. Invention is credited to Detlef Gussow, Elizabeth S. Ward, Gregory P. WINTER.
Application Number | 20080299618 12/127237 |
Document ID | / |
Family ID | 27562806 |
Filed Date | 2008-12-04 |
United States Patent
Application |
20080299618 |
Kind Code |
A1 |
WINTER; Gregory P. ; et
al. |
December 4, 2008 |
SINGLE DOMAIN LIGANDS, RECEPTORS COMPRISING SAID LIGANDS, METHODS
FOR THEIR PRODUCTION AND USE OF SAID LIGANDS AND RECEPTORS
Abstract
The present invention relates to single domain ligands derived
from molecules in the immunoglobulin (Ig) superfamily, receptors
comprising at least one such ligand, methods for cloning,
amplifying and expressing DNA sequences encoding such ligands,
preferably using the polymerase chain reaction, methods for the use
of said DNA sequences in the productions of Ig-type molecules and
said ligands or receptors, and the use of said ligand or receptors
in therapy, diagnosis or catalysis.
Inventors: |
WINTER; Gregory P.;
(Cambridge, GB) ; Ward; Elizabeth S.; (Dallas,
TX) ; Gussow; Detlef; (London, GB) |
Correspondence
Address: |
NIXON & VANDERHYE, PC
901 NORTH GLEBE ROAD, 11TH FLOOR
ARLINGTON
VA
22203
US
|
Assignee: |
MEDICAL RESEARCH COUNCIL
LONDON
GB
|
Family ID: |
27562806 |
Appl. No.: |
12/127237 |
Filed: |
May 27, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10290233 |
Nov 8, 2002 |
|
|
|
12127237 |
|
|
|
|
09722364 |
Nov 28, 2000 |
6545142 |
|
|
10290233 |
|
|
|
|
08470031 |
Jun 6, 1995 |
6248516 |
|
|
09722364 |
|
|
|
|
08332046 |
Nov 1, 1994 |
|
|
|
08470031 |
|
|
|
|
07796805 |
Nov 25, 1991 |
|
|
|
08332046 |
|
|
|
|
07580374 |
Sep 11, 1990 |
|
|
|
07796805 |
|
|
|
|
PCT/GB89/01344 |
Nov 13, 1989 |
|
|
|
07580374 |
|
|
|
|
Current U.S.
Class: |
435/69.7 ;
435/91.2; 530/387.1; 530/387.3; 530/391.1; 530/391.3;
536/24.33 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 16/461 20130101; C07K 2317/24 20130101; C12Q 1/6876
20130101 |
Class at
Publication: |
435/69.7 ;
530/387.1; 530/391.1; 530/391.3; 530/387.3; 435/91.2;
536/24.33 |
International
Class: |
C12P 21/04 20060101
C12P021/04; C07K 16/00 20060101 C07K016/00; C07K 16/28 20060101
C07K016/28; C07H 21/00 20060101 C07H021/00; C07K 17/00 20060101
C07K017/00; C12P 19/34 20060101 C12P019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 11, 1988 |
GB |
8826444.5 |
Mar 16, 1989 |
GB |
8906034.7 |
Apr 22, 1989 |
GB |
8909217.5 |
May 15, 1989 |
GB |
8911047.2 |
Jun 2, 1989 |
GB |
8912652.8 |
Jun 16, 1989 |
GB |
8913900.0 |
Aug 15, 1989 |
GB |
8918543.3 |
Claims
1. A single domain ligand consisting of at least part of the
variable domain of one chain of a molecule from the immunoglobulin
(Ig) superfamily.
2. The ligand of claim 1, which consists of the variable domain of
an Ig heavy chain.
3. The ligand of claim 1, which consists of the variable domain of
an Ig chain with one or more point mutations from the natural
sequence.
4. A receptor comprising a ligand of claim 1 linked to one or more
of an effector molecule, a prosthetic group, a label, a solid
support or one or more other ligands having the same or different
specificity.
5. The receptor of claim 4, comprising at least two ligands.
6. The receptor of claim 5, wherein the first ligand binds to a
first epitope of an antigen and the second ligand binds to a second
epitope.
7. The receptor of claim 6, which includes an effector molecule or
label.
8. The receptor of claim 5 which comprises a ligand and another
protein molecule, produced by recombinant DNA technology as a
fusion product.
9. The receptor of claim 8, wherein a linker peptide sequence is
placed between the ligand and the other protein molecule.
10. A method of cloning a sequence (the target sequence) which
encodes at least part of the variable domain of an Ig superfamily
molecule, which method comprises: (a) providing a sample of double
stranded (ds) nucleic acid which contains the target sequence; (b)
denaturing the sample so as to separate the two strands; (c)
annealing to the sample a forward and a back oligonucleotide
primer, the forward primer being specific for a sequence at or
adjacent the 3' end of the sense strand of the target sequence, the
back primer being specific for a sequence at or adjacent the 3' end
of the antisense strand of the target sequence, under conditions
which allow the primers to hybridise to the nucleic acid at or
adjacent the target sequence; (d) treating the annealed sample with
a DNA polymerase enzyme in the presence of deoxynucleoside
triphosphates under conditions which cause primer extension to take
place; and (e) denaturing the sample under conditions such that the
extended primers become separated from the target sequence.
11. The method of claim 10, further including the step (f) of
repeating steps (c) to (e) on the denatured mixture a plurality of
times.
12. The method of claim 10, which is used to clone a complete
variable domain from an Ig heavy chain.
13. The method of claim 10 which is used to produce a DNA sequence
encoding a ligand.
14. The method of claim 10, wherein the forward and back primers
are provided as single oligonucleotides.
15. The method of claim 10, wherein the forward and back primers
are each supplied as a mixture of closely related
oligonucleotides.
16. The method of claim 14, wherein the primers which are used are
species specific general primers.
17. The method of claim 10, wherein the ds nucleic acid sequence is
genomic DNA.
18. The method of claim 10, wherein the ds nucleic acid is derived
from a human.
19. The method of claim 10, wherein the ds nucleic acid is derived
from peripheral blood lymphocytes.
20. The method of claim 10, wherein each primer includes a sequence
encoding a restriction enzyme recognition site.
21. The method of claim 20, wherein the restriction enzyme
recognition site is located in the sequence which is annealed to
the ds nucleic acid.
22. The method of claim 10, wherein the product ds cDNA is inserted
into an expression vector and expressed alone.
23. The method of claim 10, wherein the product ds cDNA is
expressed in combination with a complementary variable domain.
24. The method of claim 10, wherein the cloned ds cDNA is inserted
into an expression vector already containing sequences encoding one
or more constant domains to allow the vector to express Ig-type
chains.
25. The method of claim 10, wherein the cloned ds cDNA is inserted
into an expression vector so that it can be expressed as a fusion
protein.
26. The method of claim 10, wherein one or both of the primers
comprises a mixture of oligonucleotides of hypervariable sequence,
whereby a mixture of variable domain encoding sequences is
produced.
27. A method of cloning a sequence (the target sequence) which
encodes at least part of the variable domain of an Ig superfamily
molecule, which method comprises: (a) providing a sample of double
stranded (ds) nucleic acid which contains the target sequence; (b)
denaturing the sample so as to separate the two strands; (c)
annealing to the sample a forward and a back oligonucleotide
primer, the forward primer being specific for a sequence at or
adjacent the 3' end of the sense strand of the target sequence, the
back primer being specific for a sequence at or adjacent the 3' end
of the antisense strand of the target sequence, under conditions
which allow the primers to hybridise to the nucleic acid at or
adjacent the target sequence; (d) treating the annealed sample with
a DNA polymerase enzyme in the presence of deoxynucleoside
triphosphates under conditions which cause primer extension to take
place; (g) treating the sample of ds cDNA with traces of DNAse in
the presence of DNA polymerase I to allow nick translation of the
DNA; and (h) cloning the ds cDNA into a vector.
28. The method of claim 27, which further includes the steps of:
(i) digesting the DNA of recombinant plasmids to release DNA
fragments containing genes encoding variable domains; and (j)
treating the fragments in a further set of steps (c) to (h).
29. The method of claim 27, wherein the fragments are separated
from the vector and from other fragments of the incorrect size by
gel electrophoresis.
30. The method of claim 27, wherein the product ds cDNA is cloned
directly into an expression vector.
31. A species specific general oligonucleotide primer or mixture of
such primers useful for cloning at least part of a variable domain
encoding sequence from an animal of that species.
32. A primer or mixture of primers according to claim 27, wherein
each primer includes a restriction enzyme recognition site within
the sequence which anneals to the coding part of the variable
domain encoding sequence.
Description
RELATED APPLICATIONS
[0001] This is a continuation of application Ser. No. 10/290,233,
filed Nov. 8, 2002 (allowed), which is a continuation of
application Ser. No. 09/722,364, filed Nov. 28, 2000 (now U.S. Pat.
No. 6,545,142), which is a continuation of application Ser. No.
08/470,031, filed Jun. 6, 1995 (now U.S. Pat. No. 6,248,516), which
is a divisional of application Ser. No. 08/332,046, filed Nov. 1,
1994 (now abandoned), which is a continuation of application Ser.
No. 07/796,805, filed Nov. 25, 1991 (now abandoned), which is a
divisional of application Ser. No. 07/580,374, filed Sep. 11, 1990
(now abandoned), which is a continuation of PCT Application No.
PCT/GB89/01344, filed Nov. 13, 1989, the entire contents of each of
which is hereby incorporated by reference in this application.
SUMMARY OF THE INVENTION
[0002] The present invention relates to single domain ligands
derived from molecules in the immunoglobulin (Ig) superfamily,
receptors comprising at least one such ligand, methods for cloning,
amplifying and expressing DNA sequences encoding such ligands,
methods for the use of said DNA sequences in the production of
Ig-type molecules and said ligands or receptors, and the use of
said ligands or receptors in therapy, diagnosis or catalysis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0003] The present invention is now described, by way of example
only, with reference to the accompanying drawings.
[0004] FIG. 1 shows a schematic representation of the unrearranged
and rearranged heavy and light chain variable genes and the
location of the primers.
[0005] FIG. 2 shows a schematic representation of the M13-VHPCR1
vector and a cloning scheme for amplified heavy chain variable
domains.
[0006] FIG. 3 shows the sequence of the Ig variable region derived
sequences in M13-VHPCR1.
[0007] FIG. 4 shows a schematic representation of the M13-VKPCR1
vector and a cloning scheme for light chain variable domains.
[0008] FIG. 5 shows the sequence of the Ig variable region derived
sequences in M13-VKPCR1.
[0009] FIG. 6 shows the nucleotide sequences of the heavy and light
chain variable domain encoding sequences of MAb MBr1.
[0010] FIG. 7 shows a schematic representation of the pSV-gpt
vector (also known as .alpha.-Lys 30) which contains a variable
region cloned as a HindIII-BamHI fragment, which is excised on
introducing the new variable region. The gene for human IgG1 has
also been engineered to remove a BamHI site, such that the BamHI
site in the vector is unique.
[0011] FIG. 8 shows a schematic representation of the pSV-hygro
vector (also known as .alpha.-Lys 17). It is derived from pSV gpt
vector with the gene encoding mycophenolic acid replaced by a gene
coding for hygromycin resistance. The construct contains a variable
gene cloned as a HindIII-BamHI fragment which is excised on
introducing the new variable region. The gene for human C.kappa.
has also been engineered to remove a BamHI site, such that the
BamHI site in the vector is unique.
[0012] FIG. 9 shows the assembly of the mouse: human MBr1 chimeric
antibody.
[0013] FIGS. 10a-10b shows encoded amino acid sequences of 48 mouse
rearranged VH genes.
[0014] FIG. 11 shows encoded amino acid sequences of human
rearranged VH genes.
[0015] FIG. 12 shows encoded amino acid sequences of unrearranged
human VH genes.
[0016] FIG. 13 shows the sequence of part of the plasmid pSW1:
essentially the sequence of a pectate lyase leader linked to VHLYS
in pSW1 and cloned as an SphI-EcoRI fragment into pUC19 and the
translation of the open reading frame encoding the pectate lyase
leader-VHLYS polypeptide being shown.
[0017] FIGS. 14a-14b shows the sequence of part of the plasmid
pSW2: essentially the sequence of a pectate lyase leader linked to
VHLYS and to VKLYS, and cloned as an SphI-EcoRI-EcoRI fragment into
pUC19 and the translation of open reading frames encoding the
pectate lyase leader-VHLYS and pectate lyase leader-VKLYS
polypeptides being shown.
[0018] FIG. 15 shows the sequence of part of the plasmid
pSW1HPOLYMYC which is based on pSW1 and in which a polylinker
sequence has replaced the variable domain of VHLYS, and acts as a
cloning site for amplified VH genes, and a peptide tag is
introduced at the C-terminal end.
[0019] FIG. 16 shows the encoded amino acid sequences of two VH
domains derived from mouse spleen and having lysozyme binding
activity, and compared with the VH domain of the D1,3 antibody. The
arrows mark the points of difference between the two VH
domains.
[0020] FIG. 17 shows the encoded amino acid sequence of a VH domain
derived from human peripheral blood lymphocytes and having lysozyme
binding activity.
[0021] FIG. 18 shows a scheme for generating and cloning mutants of
the VHLYS gene, which is compared with the scheme for cloning
natural repertoires of VH genes.
[0022] FIG. 19 shows the sequence of part of the vector
pSW2HPOLY.
[0023] FIG. 20 shows the sequence of part of the vector pSW3 which
encodes the two linked VHLYS domains.
[0024] FIGS. 21a-21c shows the sequence of the VHLYS domain and
pelB leader sequence fused to the alkaline phosphatase gene.
[0025] FIG. 22 shows the sequence of the vector pSW1VHLYS-VKPOLYMYC
for expression of a repertoire of V.kappa. light chain variable
domains in association with the VHLYS domain.
[0026] FIG. 23 shows the sequence of VH domain which is secreted at
high levels from E. coli. The differences with VHLYS domain are
marked.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention relates to single domain ligands
derived from molecules in the immunoglobulin (Ig) superfamily,
receptors comprising at least one such ligand, methods for cloning,
amplifying and expressing DNA sequences encoding such ligands,
methods for the use of said DNA sequences in the production of
Ig-type molecules and said ligands or receptors, and the use of
said ligands or receptors in therapy, diagnosis or catalysis.
[0028] A list of references is appended to the end of the
description. The documents listed therein are referred to in the
description by number, which is given in square brackets.
[0029] The Ig superfamily includes not only the Igs themselves but
also such molecules as receptors on lymphoid cells such as T
lymphocytes. Immunoglobulins comprise at least one heavy and one
light chain covalently bonded together. Each chain is divided into
a number of domains. At the N-terminal end of each chain is a
variable domain. The variable domains on the heavy and light chains
fit together to form a binding site designed to receive a
particular target molecule. In the case of Igs, the target
molecules are antigens. T-cell receptors have two chains of equal
size, the .alpha. and .beta. chains, each consisting of two
domains. At the N-terminal end of each chain is a variable domain
and the variable domains on the .alpha. and .beta. chains are
believed to fit together to form a binding site for target
molecules, in this case peptides presented by a histocompatibility
antigen. The variable domains are so called because their amino
acid sequences vary particularly from one molecule to another. This
variation in sequence enables the molecules to recognize an
extremely wide variety of target molecules.
[0030] Much research has been carried out on Ig molecules to
determine how the variable domains are produced. It has been shown
that each variable domain comprises a number of areas of relatively
conserved sequence and three areas of hypervariable sequence. The
three hypervariable areas are generally known as complementarity
determining regions (CDRs).
[0031] Crystallographic studies have shown that in each variable
domain of an Ig molecule the CDRs are supported on framework areas
formed by the areas of conserved sequences. The three CDRs are
brought together by the framework areas and, together with the CDRs
on the other chain, form a pocket in which the target molecule is
received.
[0032] Since the advent of recombinant DNA technology, there has
been much interest in the use of such technology to clone and
express Ig molecules and derivatives thereof. This interest is
reflected in the numbers of patent applications and other
publications on the subject.
[0033] The earliest work on the cloning and expression of full Igs
in the patent literature is EP-A-0 120 694 (Boss). The Boss
application also relates to the cloning and expression of chimeric
antibodies. Chimeric antibodies are Ig-type molecules in which the
variable domains from one Ig are fused to constant domains from
another Ig. Usually, the variable domains are derived from an Ig
from one species (often a mouse Ig) and the constant domains are
derived from an Ig from a different species (often a human Ig).
[0034] A later European patent application, EP-A-0 125 023
(Genentech), relates to much the same subject as the Boss
application, but also relates to the production by recombinant DNA
technology of other variations of Ig-type molecules.
[0035] EP-A-0 194 276 (Neuberger) discloses not only chimeric
antibodies of the type disclosed in the Boss application but also
chimeric antibodies in which some or all of the constant domains
have been replaced by non-Ig derived protein sequences. For
instance, the heavy chain CH2 and CH3 domains may be replaced by
protein sequences derived from an enzyme or a protein toxin.
[0036] EP-A-0 239 400 (Winter) discloses a different approach to
the production of Ig molecules. In this approach, only the CDRs
from a first type of Ig are grafted onto a second type of Ig in
place of its normal CDRs. The Ig molecule thus produced is
predominantly of the second type, since the CDRs form a relatively
small part of the whole Ig. However, since the CDRs are the parts
which define the specificity of the Ig, the Ig molecule thus
produced has its specificity derived from the first Ig.
[0037] Hereinafter, chimeric antibodies, CDR-grafted Igs, the
altered antibodies described by Genentech, and fragments of such
Igs such as F(ab').sub.2 and Fv fragments are referred to herein as
modified antibodies.
[0038] One of the main reasons for all the activity in the Ig field
using recombinant DNA technology is the desire to use Igs in
therapy. It is well known that, using the hybridoma technique
developed by Kohler and Milstein, it is possible to produce
monoclonal antibodies (MAbs) of almost any specificity. Thus, MAbs
directed against cancer antigens have been produced. It is
envisaged that these MAbs could be covalently attached or fused to
toxins to provide "magic bullets" for use in cancer therapy. MAbs
directed against normal tissue or cell surface antigens have also
been produced. Labels can be attached to these so that they can be
used for in vivo imaging.
[0039] The major obstacle to the use of such MAbs in therapy or in
vivo diagnosis is that the vast majority of MAbs which are produced
are of rodent, in particular mouse, origin. It is very difficult to
produce human MAbs. Since most MAbs are derived from non-human
species, they are antigenic in humans. Thus, administration of
these MAbs to humans generally results in an anti-Ig response being
mounted by the human. Such a response can interfere with therapy or
diagnosis, for instance by destroying or clearing the antibody
quickly, or can cause allergic reactions or immune complex
hypersensitivity which has adverse effects on the patient.
[0040] The production of modified Igs has been proposed to ensure
that the Ig administered to a patient is as "human" as possible,
but still retains the appropriate specificity. It is therefore
expected that modified Igs will be as effective as the MAb from
which the specificity is derived but at the same time not very
antigenic. Thus, it should be possible to use the modified Ig a
reasonable number of times in a treatment or diagnosis regime.
[0041] At the level of the gene, it is known that heavy chain
variable domains are encoded by a "rearranged" gene which is built
from three gene segments: an "unrearranged" VH gene (encoding the
N-terminal three framework regions, first two complete CDRs and the
first part of the third CDR), a diversity (DH)-segment (DH)
(encoding the central portion of the third CDR) and a joining
segment (JH) (encoding the last part of the third CDR and the
fourth framework region). In the maturation of B-cells, the genes
rearrange so that each unrearranged VH gene is linked to one DH
gene and one JH gene. The rearranged gene corresponds to VH-DH-JH.
This rearranged gene is linked to a gene which encodes the constant
portion of the Ig chain.
[0042] For light chains, the situation is similar, except that for
light chains there is no diversity region. Thus light chain
variable domains are encoded by an "unrearranged" VL gene and a JL
gene. There are two types of light chains, kappa (.kappa.) or
lambda (.lamda.), which are built respectively from unrearranged
V.kappa. genes and J.kappa. segments, and from unrearranged
V.lamda. genes and J.lamda. segments.
[0043] Previous work has shown that it is necessary to have two
variable domains in association together for efficient binding. For
example, the associated heavy and light chain variable domains were
shown to contain the antigen binding site [1]. This assumption is
borne out by X-ray crystallographic studies of crystallized
antibody/antigen complexes [2-6] which show that both the heavy and
light chains of the antibody's variable domains contact the
antigen. The expectation that association of heavy and light chain
variable domains is necessary for efficient antigen binding
underlies work to co-secrete these domains from bacteria [1], and
to link the domains together by a short section of polypeptide as
in the single chain antibodies [8, 9].
[0044] Binding of isolated heavy and light chains had also been
detected. However the evidence suggested strongly that this was a
property of heavy or light chain dimmers. Early work, mainly with
polyclonal antibodies, in which antibody heavy and light chains had
been separated under denaturing conditions [10] suggested that
isolated antibody heavy chains could bind to protein antigens [11]
or hapten [12]. The binding of protein antigen was not
characterized, but the hapten-binding affinity of the heavy chain
fragments was reduced by two orders of magnitude [12] and the
number of hapten molecules binding were variously estimated as 0.14
or 0.37 [13] or 0.26 [14] per isolated heavy chain. Furthermore
binding of haptens was shown to be a property of dimeric heavy or
dimeric light chains [14]. Indeed light chain dimers have been
crystallized. It has been shown that in light chain dimers the two
chains form a cavity which is able to bind to a single molecule of
hapten [15].
[0045] This confirms the assumption that, in order to obtain
efficient binding, it is necessary to have a dimer, and preferably
a heavy chain/light chain dimer, containing the respective variable
domains. This assumption also underlies the teaching of the patent
references cited above, wherein the intention is always to produce
dimeric, and preferably heavy/light chain dimeric, molecules.
[0046] It has now been discovered, contrary to expectations, that
isolated Ig heavy chain variable domains can bind to antigen in a
1:1 ratio and with binding constants of equivalent magnitude to
those of complete antibody molecules. In view of what was known up
until now and in view of the assumptions made by those skilled in
the art, this is highly surprising.
[0047] Therefore, according to a first aspect of the present
invention, there is provided a single domain ligand consisting of
at least part of the variable domain of one chain of a molecule
from the Ig superfamily.
[0048] Preferably, the ligand consists of the variable domain of an
Ig light, or, most preferably, heavy chain.
[0049] The ligand may be produced by any known technique, for
instance by controlled cleavage of Ig superfamily molecules or by
peptide synthesis. However, preferably the ligand is produced by
recombinant DNA technology. For instance, the gene encoding the
rearranged gene for a heavy chain variable domain may be produced,
for instance by cloning or gene synthesis, and placed into a
suitable expression vector. The expression vector is then used to
transform a compatible host cell which is then cultured to allow
the ligand to be expressed and, preferably, secreted.
[0050] If desired, the gene for the ligand can be mutated to
improve the properties of the expressed domain, for example to
increase the yields of expression or the solubility of the ligand,
to enable the ligand to bind better, or to introduce a second site
for covalent attachment (by introducing chemically reactive
residues such as cysteine and histidine) or non-covalent binding of
other molecules. In particular it would be desirable to introduce a
second site for binding to serum components, to prolong the
residence time of the domains in the serum; or for binding to
molecules with effector functions, such as components of
complement, or receptors on the surfaces of cells.
[0051] Thus, hydrophobic residues which would normally be at the
interface of the heavy chain variable domain with the light chain
variable domain could be mutated to more hydrophilic residues to
improve solubility; residues in the CDR loops could be mutated to
improve antigen binding; residues on the other loops or parts of
the .beta.-sheet could be mutated to introduce new binding
activities. Mutations could include single point mutations,
multiple point mutations or more extensive changes and could be
introduced by any of a variety of recombinant DNA methods, for
example gene synthesis, site directed mutagenesis or the polymerase
chain reaction.
[0052] Since the ligands of the present invention have equivalent
binding affinity to that of complete Ig molecules, the ligands can
be used in many of the ways as are Ig molecules or fragments. For
example, Ig molecules have been used in therapy (such as in
treating cancer, bacterial and viral diseases), in diagnosis (such
as pregnancy testing), in vaccination (such as in producing
anti-idiotypic antibodies which mimic antigens), in modulation of
activities of hormones or growth factors, in detection, in
biosensors and in catalysis.
[0053] It is envisaged that the small size of the ligands of the
present invention may confer some advantages over complete
antibodies, for example, in neutralizing the activity of low
molecular weight drugs (such as dioxin) and allowing their
filtration from the kidneys with drug attached; in penetrating
tissues and tumors; in neutralizing viruses by binding to small
conserved regions on the surfaces of viruses such as the "canyon"
sites of viruses [16]; in high resolution epitope mapping of
proteins; and in vaccination by ligands which mimic antigens.
[0054] The present invention also provides receptors comprising a
ligand according to the first aspect of the invention linked to one
or more of an effector molecule, a label, a surface, or one or more
other ligands having the same or different specificity.
[0055] A receptor comprising a ligand linked to an effector
molecule may be of use in therapy. The effector molecule may be a
toxin, such as ricin or pseudomonas exotoxin, an enzyme which is
able to activate a prodrug, a binding partner or a radio-isotope.
The radio-isotope may be directly linked to the ligand or may be
attached thereto by a chelating structure which is directly linked
to the ligand. Such ligands with attached isotopes are much smaller
than those based on Fv fragments, and could penetrate tissues and
access tumors more readily.
[0056] A receptor comprising a ligand linked to a label may be of
use in diagnosis. The label may be a heavy metal atom or a
radio-isotope, in which case the receptor can be used for in vivo
imaging using X-ray or other scanning apparatus. The metal atom or
radio-isotope may be attached to the ligand either directly or via
a chelating structure directly linked to the ligand. For in vitro
diagnostic testing, the label may be a heavy metal atom, a
radio-isotope, an enzyme, a fluorescent or colored molecule or a
protein or peptide tag which can be detected by an antibody, an
antibody fragment or another protein. Such receptors would be used
in any of the known diagnostic tests, such as ELISA or
fluorescence-linked assays.
[0057] A receptor comprising a ligand linked to a surface, such as
a chromatography medium, could be used for purification of other
molecules by affinity chromatography. Linking of ligands to cells,
for example to the outer membrane proteins of E. coli or to
hydrophobic tails which localize the ligands in the cell membranes,
could allow a simple diagnostic test in which the bacteria or cells
would agglutinate in the presence of molecules bearing multiple
sites for binding the ligand(s).
[0058] Receptors comprising at least two ligands can be used, for
instance, in diagnostic tests. The first ligand will bind to a test
antigen and the second ligand will bind to a reporter molecule,
such as an enzyme, a fluorescent dye, a colored dye, a
radio-isotope or a colored-, fluorescently- or radio-labelled
protein.
[0059] Alternatively, such receptors may be useful in increasing
the binding to an antigen. The first ligand will bind to a first
epitope of the antigen and the second ligand will bind to a second
epitope. Such receptors may also be used for increasing the
affinity and specificity of binding to different antigens in close
proximity on the surface of cells. The first ligand will bind to
the first antigen and the second epitope to the second antigen:
strong binding will depend on the co-expression of the epitopes on
the surface of the cell. This may be useful in therapy of tumors,
which can have elevated expression of several surface markers.
Further ligands could be added to further improve binding or
specificity. Moreover, the use of strings of ligands, with the same
or multiple specificities, creates a larger molecule which is less
readily filtered from the circulation by the kidney.
[0060] For vaccination with ligands which mimic antigens, the use
of strings of ligands may prove more effective than single ligands,
due to repetition of the immunizing epitopes.
[0061] If desired, such receptors with multiple ligands could
include effector molecules or labels so that they can be used in
therapy or diagnosis as described above.
[0062] The ligand may be linked to the other part of the receptor
by any suitable means, for instance by covalent or non-covalent
chemical linkages. However, where the receptor comprises a ligand
and another protein molecule, it is preferred that they are
produced by recombinant DNA technology as a fusion product. If
necessary, a linker peptide sequence can be placed between the
ligand and the other protein molecule to provide flexibility.
[0063] The basic techniques for manipulating Ig molecules by
recombinant DNA technology are described in the patent references
cited above. These may be adapted in order to allow for the
production of ligands and receptors according to the invention by
means of recombinant DNA technology.
[0064] Preferably, where the ligand is to be used for in vivo
diagnosis or therapy in humans, it is humanized, for instance by
CDR replacement as described in EP-A-0 239 400.
[0065] In order to obtain a DNA sequence encoding a ligand, it is
generally necessary firstly to produce a hybridoma which secretes
an appropriate MAb. This can be a very time consuming method. Once
an immunized animal has been produced, it is necessary to fuse
separated spleen cells with a suitable myeloma cell line, grow up
the cell lines thus produced, select appropriate lines, reclone the
selected lines and reselect. This can take some long time. This
problem also applies to the production of modified Igs.
[0066] A further problem with the production of ligands, and also
receptors according to the invention and modified Igs, by
recombinant DNA technology is the cloning of the variable domain
encoding sequences from the hybridoma which produces the MAb from
which the specificity is to be derived. This can be a relatively
long method involving the production of a suitable probe,
construction of a clone library from cDNA or genomic DNA, extensive
probing of the clone library, and manipulation of any isolated
clones to enable the cloning into a suitable expression vector. Due
to the inherent variability of the DNA sequences encoding Ig
variable domains, it has not previously been possible to avoid such
time consuming work. It is therefore a further aim of the present
invention to provide a method which enables substantially any
sequence encoding an Ig superfamily molecule variable domain
(ligand) to be cloned in a reasonable period of time.
[0067] According to another aspect of the present invention
therefore, there is provided a method of cloning a sequence (the
target sequence) which encodes at least part of the variable domain
of an Ig superfamily molecule, which method comprises:
[0068] (a) providing a sample of double stranded (ds) nucleic acid
which contains the target sequence;
[0069] (b) denaturing the sample so as to separate the two
strands;
[0070] (c) annealing to the sample a forward and a back
oligonucleotide primer, the forward primer being specific for a
sequence at or adjacent the 3' end of the sense strand of the
target sequence, the back primer being specific for a sequence at
or adjacent the 3' end of the antisense strand of the target
sequence, under conditions which allow the primers to hybridize to
the nucleic acid at or adjacent the target sequence;
[0071] (d) treating the annealed sample with a DNA polymerase
enzyme in the presence of deoxynucleoside triphosphates under
conditions which cause primer extension to take place; and
[0072] (e) denaturing the sample under conditions such that the
extended primers become separated from the target sequence.
[0073] Preferably, the method of the present invention further
includes the step (f) of repeating steps (c) to (e) on the
denatured mixture a plurality of times.
[0074] Preferably, the method of the present invention is used to
clone complete variable domains from Ig molecules, most preferably
from Ig heavy chains. In the most preferred instance, the method
will produce a DNA sequence encoding a ligand according to the
present invention.
[0075] In step (c) recited above, the forward primer becomes
annealed to the sense strand of the target sequence at or adjacent
the 3' end of the strand. In a similar manner, the back primer
becomes annealed to the antisense strand of the target sequence at
or adjacent the 3' end of the strand. Thus, the forward primer
anneals at or adjacent the region of the ds nucleic acid which
encodes the C-terminal end of the variable region or domain.
Similarly, the back primer anneals at or adjacent the region of the
ds nucleic acid which encodes the N-terminal end of the variable
domain.
[0076] In step (d), nucleotides are added onto the 3' end of the
forward and back primers in accordance with the sequence of the
strand to which they are annealed. Primer extension will continue
in this manner until stopped by the beginning of the denaturing
step (e). It must therefore be ensured that step (d) is carried out
for a long enough time to ensure that the primers are extended so
that the extended strands totally overlap one another.
[0077] In step (e), the extended primers are separated from the ds
nucleic acid. The ds nucleic acid can then serve again as a
substrate to which further primers can anneal. Moreover, the
extended primers themselves have the necessary complementary
sequences to enable the primers to anneal thereto.
[0078] During further cycles, if step (f) is used, the amount of
extended primers will increase exponentially so that at the end of
the cycles there will be a large quantity of cDNA having sequences
complementary to the sense and antisense strands of the target
sequence. Thus, the method of the present invention will result in
the accumulation of a large quantity of cDNA which can form ds cDNA
encoding at least part of the variable domain.
[0079] As will be apparent to the skilled person, some of the steps
in the method may be carried out simultaneously or sequentially as
desired.
[0080] The forward and back primers may be provided as isolated
oligonucleotides, in which case only two oligonucleotides will be
used. However, alternatively the forward and back primers may each
be supplied as a mixture of closely related oligonucleotides. For
instance, it may be found that at a particular point in the
sequence to which the primer is to anneal, there is the possibility
of nucleotide variation. In this case a primer may be used for each
possible nucleotide variation. Furthermore it may be possible to
use two or more sets of "nested" primers in the method to enhance
the specific cloning of variable region genes.
[0081] The method described above is similar to the method
described by Saiki et al. [17]. A similar method is also used in
the methods described in EP-A-0 200 362. In both cases the method
described is carried out using primers which are known to anneal
efficiently to the specified nucleotide sequence. In neither of
these disclosures was it suggested that the method could be used to
clone Ig parts of variable domain encoding sequences, where the
target sequence contains inherently highly variable areas.
[0082] The ds nucleic acid sequence used in the method of the
present invention may be derived from mRNA. For instance, RNA may
be isolated in known manner from a cell or cell line which is known
to produce Igs. mRNA may be separated from other RNA by oligo-dT
chromatography. A complementary strand of cDNA may then be
synthesized on the mRNA template, using reverse transcriptase and a
suitable primer, to yield an RNA/DNA heteroduplex. A second strand
of DNA can be made in one of several ways, for example, by priming
with RNA fragments of the mRNA strand (made by incubating RNA/DNA
heteroduplex with RNase H) and using DNA polymerase, or by priming
with a synthetic oligodeoxynucleotide primer which anneals to the
3' end of the first strand and using DNA polymerase. It has been
found that the method of the present invention can be carried out
using ds cDNA prepared in this way.
[0083] When making such ds cDNA, it is possible to use a forward
primer which anneals to a sequence in the CH1 domain (for a heavy
chain variable domain) or the C.lamda. or C.kappa. domain (for a
light chain variable domain). These will be located in close enough
proximity to the target sequence to allow the sequence to be
cloned.
[0084] The back primer may be one which anneals to a sequence at
the N-terminal end of the VH1, V.kappa. or V .lamda. domain. The
back primer may consist of a plurality of primers having a variety
of sequences designed to be complementary to the various families
of VH1, V.kappa. or V.lamda. sequences known. Alternatively the
back primer may be a single primer having a consensus sequence
derived from all the families of variable region genes.
[0085] Surprisingly, it has been found that the method of the
present invention can be carried out using genomic DNA. If genomic
DNA is used, there is a very large amount of DNA present, including
actual coding sequences, introns and untranslated sequences between
genes. Thus, there is considerable scope for non-specific annealing
under the conditions used. However, it has surprisingly been found
that there is very little non-specific annealing. It is therefore
unexpected that it has proved possible to clone the genes of
Ig-variable domains from genomic DNA.
[0086] Under some circumstances the use of genomic DNA may prove
advantageous compared with use of mRNA, as the mRNA is readily
degraded, and especially difficult to prepare from clinical samples
of human tissue.
[0087] Thus, in accordance with an aspect of the present invention,
the ds nucleic acid used in step (a) is genomic DNA.
[0088] When using genomic DNA as the ds nucleic acid source, it
will not be possible to use as the forward primer an
oligonucleotide having a sequence complementary to a sequence in a
constant domain. This is because, in genomic DNA, the constant
domain genes are generally separated from the variable domain genes
by a considerable number of base pairs. Thus, the site of annealing
would be too remote from the sequence to be cloned.
[0089] It should be noted that the method of the present invention
can be used to clone both rearranged and unrearranged variable
domain sequences from genomic DNA. It is known that in germ line
genomic DNA the three genes, encoding the VH, DH and JH
respectively, are separated from one another by considerable
numbers of base pairs. On maturation of the immune response, these
genes are rearranged so that the VH, DH and JH genes are fused
together to provide the gene encoding the whole variable domain
(see FIG. 1). By using a forward primer specific for a sequence at
or adjacent the 3' end of the sense strand of the genomic
"unrearranged" VH gene, it is possible to clone the "unrearranged"
VH gene alone, without also cloning the DH and JH genes. This can
be of use in that it will then be possible to fuse the VH gene onto
pre-cloned or synthetic DH and DH genes. In this way, rearrangement
of the variable domain genes can be carried out in vitro.
[0090] The oligonucleotide primers used in step (c) may be
specifically designed for use with a particular target sequence. In
this case, it will be necessary to sequence at least the 5' and 3'
ends of the target sequence so that the appropriate
oligonucleotides can be synthesized. However, the present inventors
have discovered that it is not necessary to use such specifically
designed primers. Instead, it is possible to use a species specific
general primer or a mixture of such primers for annealing to each
end of the target sequence. This is not particularly surprising as
regards the 3' end of the target sequence. It is known that this
end of the variable domain encoding sequence leads into a segment
encoding JH which is known to be relatively conserved. However, it
was surprisingly discovered that, within a single species, the
sequence at the 5' end of the target sequence is sufficiently well
conserved to enable a species specific general primer or a mixture
thereof to be designed for the 5' end of the target sequence.
[0091] Therefore according to a preferred aspect of the present
invention, in step (c) the two primers which are used are species
specific general primers, whether used as single primers or as
mixtures of primers. This greatly facilitates the cloning of any
undetermined target sequence since it will avoid the need to carry
out any sequencing on the target sequence in order to produce
target sequence-specific primers. Thus the method of this aspect of
the invention provides a general method for cloning variable region
or domain encoding sequences of a particular species.
[0092] Once the variable domain gene has been cloned using the
method described above, it may be directly inserted into an
expression vector, for instance using the PCR reaction to paste the
gene into a vector.
[0093] Advantageously, however, each primer includes a sequence
including a restriction enzyme recognition site. The sequence
recognized by the restriction enzyme need not be in the part of the
primer which anneals to the ds nucleic acid, but may be provided as
an extension which does not anneal. The use of primers with
restriction sites has the advantage that the DNA can be cut with at
least one restriction enzyme which leaves 3' or 5' overhanging
nucleotides. Such DNA is more readily cloned into the corresponding
sites on the vectors than blunt end fragments taken directly from
the method. The ds cDNA produced at the end of the cycles will thus
be readily insertable into a cloning vector by use of the
appropriate restriction enzymes. Preferably the choice of
restriction sites is such that the ds cDNA is cloned directly into
an expression vector, such that the ligand encoded by the gene is
expressed. In this case the restriction site is preferably located
in the sequence which is annealed to the ds nucleic acid.
[0094] Since the primers may not have a sequence exactly
complementary to the target sequence to which it is to be annealed,
for instance because of nucleotide variations or because of the
introduction of a restriction enzyme recognition site, it may be
necessary to adjust the conditions in the annealing mixture to
enable the primers to anneal to the ds nucleic acid. This is well
within the competence of the person skilled in the art and needs no
further explanation.
[0095] In step (d), any DNA polymerase may be used. Such
polymerases are known in the art and are available commercially.
The conditions to be used with each polymerase are well known and
require no further explanation here. The polymerase reaction will
need to be carried out in the presence of the four nucleoside
triphosphates. These and the polymerase enzyme may already be
present in the sample or may be provided afresh for each cycle.
[0096] The denaturing step (e) may be carried out, for instance, by
heating the sample, by use of chaotropic agents, such as urea or
guanidine, or by the use of changes in ionic strength or pH.
Preferably, denaturing is carried out by heating since this is
readily reversible. Where heating is used to carry out the
denaturing, it will be usual to use a thermostable DNA polymerase,
such as Taq polymerase, since this will not need replenishing at
each cycle.
[0097] If heating is used to control the method, a suitable cycle
of heating comprises denaturation at about 95.degree. C. for about
1 minute, annealing at from 30.degree. C. to 65.degree. C. for
about 1 minute and primer extension at about 75.degree. C. for
about 2 minutes. To ensure that elongation and renaturation is
complete, the mixture after the final cycle is preferably held at
about 60.degree. C. for about 5 minutes.
[0098] The product ds cDNA may be separated from the mixture for
instance by gel electrophoresis using agarose gels. However, if
desired, the ds cDNA may be used in unpurified form and inserted
directly into a suitable cloning or expression vector by
conventional methods. This will be particularly easy to accomplish
if the primers include restriction enzyme recognition
sequences.
[0099] The method of the present invention may be used to make
variations in the sequences encoding the variable domains. For
example this may be achieved by using a mixture of related
oligonucleotide primers as at least one of the primers. Preferably
the primers are particularly variable in the middle of the primer
and relatively conserved at the 5' and 3' ends. Preferably the ends
of the primers are complementary to the framework regions of the
variable domain, and the variable region in the middle of the
primer covers all or part of a CDR. Preferably a forward primer is
used in the area which forms the third CDR. If the method is
carried out using such a mixture of oligonucleotides, the product
will be a mixture of variable domain encoding sequences. Moreover,
variations in the sequence may be introduced by incorporating some
mutagenic nucleotide triphosphates in step (d), such that point
mutations are scattered throughout the target region. Alternatively
such point mutations are introduced by performing a large number of
cycles of amplification, as errors due to the natural error rate of
the DNA polymerase are amplified, particularly when using high
concentrations of nucleoside triphosphates.
[0100] The method of this aspect of the present invention has the
advantage that it greatly facilitates the cloning of variable
domain encoding sequences directly from mRNA or genomic DNA. This
in turn will facilitate the production of modified Ig-type
molecules by any of the prior art methods referred to above.
Further, target genes can be cloned from tissue samples containing
antibody producing cells, and the genes can be sequenced. By doing
this, it will be possible to look directly at the immune repertoire
of a patient. This "fingerprinting" of a patient's immune
repertoire could be of use in diagnosis, for instance of
auto-immune diseases.
[0101] In the method for amplifying the amount of a gene encoding a
variable domain, a single set of primers is used in several cycles
of copying via the polymerase chain reaction. As a less preferred
alternative, there is provided a second method which comprises
steps (a) to (d) as above, which further includes the steps of:
[0102] (g) treating the sample of ds cDNA with traces of DNAse in
the presence of DNA polymerase I to allow nick translation of the
DNA; and
[0103] (h) cloning the ds cDNA into a vector.
[0104] If desired, the second method may further include the steps
of:
[0105] (i) digesting the DNA of recombinant plasmids to release DNA
fragments containing genes encoding variable domains; and
[0106] (j) treating the fragments in a further set of steps (c) to
(h).
[0107] Preferably the fragments are separated from the vector and
from other fragments of the incorrect size by gel
electrophoresis.
[0108] The steps (a) to (d) then (g) to (h) can be followed once,
but preferably the entire cycle (c) to (d) and (g) to (h) is
repeated at least once. In this way a priming step, in which the
genes are specifically copied, is followed by a cloning step, in
which the amount of genes is increased.
[0109] In step (a) the ds cDNA is derived from mRNA. For Ig derived
variable domains, the mRNA is preferably be isolated from
lymphocytes which have been stimulated to enhance production of
mRNA.
[0110] In each step (c) the set of primers are preferably different
from the previous step (c), so as to enhance the specificity of
copying. Thus the sets of primers form a nested set. For example,
for cloning of Ig heavy chain variable domains, the first set of
primers may be located within the signal sequence and constant
region, as described by Larrick et al., [18], and the second set of
primers entirely within the variable region, as described by
Orlandi et al., [19]. Preferably the primers of step (c) include
restriction sites to facilitate subsequent cloning. In the last
cycle the set of primers used in step (c) should preferably include
restriction sites for introduction into expression vectors. In step
(g) possible mismatches between the primers and the template
strands are corrected by "nick translation". In step (h), the ds
cDNA is preferably cleaved with restriction enzymes at sites
introduced into the primers to facilitate the cloning.
[0111] According to another aspect of the present invention the
product ds cDNA is cloned directly into an expression vector. The
host may be prokaryotic or eukaryotic, but is preferably bacterial.
Preferably the choice of restriction sites in the primers and in
the vector, and other features of the vector will allow the
expression of complete ligands, while preserving all those features
of the amino acid sequence which are typical of the (methoded)
ligands. For example, for expression of the rearranged variable
genes, the primers would be chosen to allow the cloning of target
sequences including at least all the three CDR sequences. The
cloning vector would then encode a signal sequence (for secretion
of the ligand), and sequences encoding the N-terminal end of the
first framework region, restriction sites for cloning and then the
C-terminal end of the last (fourth) framework region.
[0112] For expression of unrearranged VH genes as part of complete
ligands, the primers would be chosen to allow the cloning of target
sequences including at least the first two CDRs. The cloning vector
could then encode signal sequence, the N-terminal end of the first
framework region, restriction sites for cloning and then the
C-terminal end of the third framework region, the third CDR and
fourth framework region.
[0113] Primers and cloning vectors may likewise be devised for
expression of single CDRs, particularly the third CDR, as parts of
complete ligands. The advantage of cloning repertoires of single
CDRs would permit the design of a "universal" set of framework
regions, incorporating desirable properties such as solubility.
[0114] Single ligands could be expressed alone or in combination
with a complementary variable domain. For example, a heavy chain
variable domain can be expressed either as an individual domain or,
if it is expressed with a complementary light chain variable
domain, as an antigen binding site. Preferably the two partners
would be expressed in the same cell, or secreted from the same
cell, and the proteins allowed to associate non-covalently to form
an Fv fragment. Thus the two genes encoding the complementary
partners can be placed in tandem and expressed from a single
vector, the vector including two sets of restriction sites.
Preferably the genes are introduced sequentially: for example the
heavy chain variable domain can be cloned first and then the light
chain variable domain. Alternatively the two genes are introduced
into the vector in a single step, for example by using the
polymerase chain reaction to paste together each gene with any
necessary intervening sequence, as essentially described by Yon and
Fried [29]. The two partners could be also expressed as a linked
protein to produce a single chain Fv fragment, using similar
vectors to those described above. As a further alternative the two
genes may be placed in two different vectors, for example in which
one vector is a phage vector and the other is a plasmid vector.
[0115] Moreover, the cloned ds cDNA may be inserted into an
expression vector already containing sequences encoding one or more
constant domains to allow the vector to express Ig-type chains. The
expression of Fab fragments, for example, would have the advantage
over Fv fragments that the heavy and light chains would tend to
associate through the constant domains in addition to the variable
domains. The final expression product may be any of the modified
Ig-type molecules referred to above.
[0116] The cloned sequence may also be inserted into an expression
vector so that it can be expressed as a fusion protein. The
variable domain encoding sequence may be linked directly or via a
linker sequence to a DNA sequence encoding any protein effector
molecule, such as a toxin, enzyme, label or another ligand. The
variable domain sequences may also be linked to proteins on the
outer side of bacteria or phage. Thus, the method of this aspect of
the invention may be used to produce receptors according to the
invention.
[0117] According to another aspect of the invention, the cloning of
ds cDNA directly for expression permits the rapid construction of
expression libraries which can be screened for binding activities.
For Ig heavy and light chain variable genes, the ds cDNA may
comprise variable genes isolated as complete rearranged genes from
the animal, or variable genes built from several different sources,
for example a repertoire of unrearranged VH genes combined with a
synthetic repertoire of DH and JH genes. Preferably repertoires of
genes encoding Ig heavy chain variable domains are prepared from
lymphocytes of animals immunized with an antigen.
[0118] The screening method may take a range of formats well known
in the art. For example Ig heavy chain variable domains secreted
from bacteria may be screened by binding to antigen on a solid
phase, and detecting the captured domains by antibodies. Thus the
domains may be screened by growing the bacteria in liquid culture
and binding to antigen coated on the surface of ELISA plates.
However, preferably bacterial colonies (or phage plaques) which
secrete ligands (or modified ligands, or ligand fusions with
proteins) are screened for antigen binding on membranes. Either the
ligands are bound directly to the membranes (and for example
detected with labelled antigen), or captured on antigen coated
membranes (and detected with reagents specific for ligands). The
use of membranes offers great convenience in screening many clones,
and such techniques are well known in the art.
[0119] The screening method may also be greatly facilitated by
making protein fusions with the ligands, for example by introducing
a peptide tag which is recognized by an antibody at the N-terminal
or C-terminal end of the ligand, or joining the ligand to an enzyme
which catalyses the conversion of a colorless substrate to a
colored product. In the latter case, the binding of antigen may be
detected simply by adding substrate. Alternatively, for ligands
expressed and folded correctly inside eukaryotic cells, joining of
the ligand and a domain of a transcriptional activator such as the
GAL4 protein of yeast, and joining of antigen to the other domain
of the GAL4 protein, could form the basis for screening binding
activities, as described by Fields and Song [21].
[0120] The preparation of proteins, or even cells with multiple
copies of the ligands, may improve the avidity of the ligand for
immobilized antigen, and hence the sensitivity of the screening
method. For example, the ligand may be joined to a protein subunit
of a multimeric protein, to a phage coat protein or to an outer
membrane protein of E. coli such as ompA or lamB. Such fusions to
phage or bacterial proteins also offers possibilities of selecting
bacteria displaying ligands with antigen binding activities. For
example such bacteria may be precipitated with antigen bound to a
solid support, or may be subjected to affinity chromatography, or
may be bound to larger cells or particles which have been coated
with antigen and sorted using a fluorescence activated cell sorter
(FACS). The proteins or peptides fused to the ligands are
preferably encoded by the vector, such that cloning of the ds cDNA
repertoire creates the fusion product.
[0121] In addition to screening for binding activities of single
ligands, it may be necessary to screen for binding or catalytic
activities of associated ligands, for example, the associated Ig
heavy and light chain variable domains. For example, repertoires of
heavy and light chain variable genes may be cloned such that two
domains are expressed together. Only some of the pairs of domains
may associate, and only some of these associated pairs may bind to
antigen. The repertoires of heavy and light chain variable domains
could be cloned such that each domain is paired at random. This
approach may be most suitable for isolation of associated domains
in which the presence of both partners is required to form a cleft.
Alternatively, to allow the binding of hapten. Alternatively, since
the repertoires of light chain sequences are less diverse than
those of heavy chains, a small repertoire of light chain variable
domains, for example including representative members of each
family of domains, may be combined with a large repertoire of heavy
chain variable domains.
[0122] Preferably however, a repertoire of heavy chain variable
domains is screened first for antigen binding in the absence of the
light chain partner, and then only those heavy chain variable
domains binding to antigen are combined with the repertoire of
light chain variable domains. Binding of associated heavy and light
chain variable domains may be distinguished readily from binding of
single domains, for example by fusing each domain to a different
C-terminal peptide tag which are specifically recognized by
different monoclonal antibodies.
[0123] The hierarchical approach of first cloning heavy chain
variable domains with binding activities, then cloning matching
light chain variable domains may be particularly appropriate for
the construction of catalytic antibodies, as the heavy chain may be
screened first for substrate binding. A light chain variable domain
would then be identified which is capable of association with the
heavy chain, and "catalytic" residues such as cysteine or histidine
(or prosthetic groups) would be introduced into the CDRs to
stabilize the transition state or attack the substrate, as
described by Baldwin and Schultz [22].
[0124] Although the binding activities of non-covalently associated
heavy and light chain variable domains (Fv fragments) may be
screened, suitable fusion proteins may drive the association of the
variable domain partners. Thus Fab fragments are more likely to be
associated than the Fv fragments, as the heavy chain variable
domain is attached to a single heavy chain constant domain, and the
light chain variable domain is attached to a single light chain
variable domain, and the two constant domains associate
together.
[0125] Alternatively the heavy and light chain variable domains are
covalently linked together with a peptide, as in the single chain
antibodies, or peptide sequences attached, preferably at the
C-terminal end which will associate through forming cysteine bonds
or through non-covalent interactions, such as the introduction of
"leucine zipper" motifs. However, in order to isolate pairs of
tightly associated variable domains, the Fv fragments are
preferably used.
[0126] The construction of Fv fragments isolated from a repertoire
of variable region genes offers a way of building complete
antibodies, and an alternative to hybridoma technology. For example
by attaching the variable domains to light or suitable heavy chain
constant domains, as appropriate, and expressing the assembled
genes in mammalian cells, complete antibodies may be made and
should possess natural effector functions, such as complement
lysis. This route is particularly attractive for the construction
of human monoclonal antibodies, as hybridoma technology has proved
difficult, and for example, although human peripheral blood
lymphocytes can be immortalized with Epstein Barr virus, such
hybridomas tend to secrete low affinity IgM antibodies.
[0127] Moreover, it is known that immunological mechanisms ensure
that lymphocytes do not generally secrete antibodies directed
against host-proteins. However it is desirable to make human
antibodies directed against human proteins, for example to human
cell surface markers to treat cancers, or to histocompatibility
antigens to treat auto-immune diseases. The construction of human
antibodies built from the combinatorial repertoire of heavy and
light chain variable domains may overcome this problem, as it will
allow human antibodies to be built with specificities which would
normally have been eliminated.
[0128] The method also offers a new way of making bispecific
antibodies. Antibodies with dual specificity can be made by fusing
two hybridomas of different specificities, so as to make a hybrid
antibody with an Fab arm of one specificity, and the other Fab arm
of a second specificity. However the yields of the bispecific
antibody are low, as heavy and light chains also find the wrong
partners. The construction of Fv fragments which are tightly
associated should preferentially drive the association of the
correct pairs of heavy with light chains. (It would not assist in
the correct pairing of the two heavy chains with each other.) The
improved production of bispecific antibodies would have a variety
of applications in diagnosis and therapy, as is well known.
[0129] Thus the invention provides a species specific general
oligonucleotide primer or a mixture of such primers useful for
cloning variable domain encoding sequences from animals of that
species. The method allows a single pair or pair of mixtures of
species specific general primers to be used to clone any desired
antibody specificity from that species. This eliminates the need to
carry out any sequencing of the target sequence to be cloned and
the need to design specific primers for each specificity to be
recovered.
[0130] Furthermore it provides for the construction of repertoires
of variable genes, for the expression of the variable genes
directly on cloning, for the screening of the encoded domains for
binding activities and for the assembly of the domains with other
variable domains derived from the repertoire.
[0131] Thus the use of the method of the present invention will
allow for the production of heavy chain variable domains with
binding activities and variants of these domains. It allows for the
production of monoclonal antibodies and bispecific antibodies, and
will provide an alternative to hybridoma technology. For instance,
mouse splenic ds mRNA or genomic DNA may be obtained from a
hyper-immunized mouse. This could be cloned using the method of the
present invention and then the cloned ds DNA inserted into a
suitable expression vector. The expression vector would be used to
transform a host cell, for instance a bacterial cell, to enable it
to produce an Fv fragment or a Fab fragment. The Fv or Fab fragment
would then be built into a monoclonal antibody by attaching
constant domains and expressing it in mammalian cells.
Primers
[0132] In the Examples described below, the following
oligonucleotide primers, or mixed primers were used. Their
locations are marked on FIG. 1 and sequences are as follows:
TABLE-US-00001 VH1FOR 5' TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG 3';
VH1FOR-2 5' TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC 3'; Hu1VHFOR 5'
CTTGGTGGAGGCTGAGGAGACGGTGACC 3'; Hu2VHFOR 5'
CTTGGTGGAGGCTGAGGAGACGGTGACC 3'; Hu3VHFOR 5'
CTTGGTGGATGCTGAGGAGACGGTGACC 3'; Hu4VHFOR 5'
CTTGGTGGATGCTGATGAGACGGTGACC 3'; MOJH1FOR 5'
TGAGGAGACGGTGACCGTGGTCCCTGCGCCCCAG 3'; MOJH2FOR 5'
TGAGGAGACGGTGACCGTGGTGCCTTGGCCCCAG 3'; MOJH3FOR 5'
TGCAGAGACGGTGACCAGAGTCCCTTGGCCCCAG 3'; MOJH4FOR 5'
TGAGGAGACGGTGACCGAGGTTCCTTGACCCCAG 3'; HUJH1FOR 5'
TGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAG 3'; HUJH2FOR 5'
TGAGGAGACGGTGACCAGGGTGCCACGGCCCCAG 3'; HUJH4FOR 5'
TGAGGAGACGGTGACCAGGGTTCCTTGGCCCCAG 3'; VK1FOR 5'
GTTAGATCTCCAGCTTGGTCCC 3'; VK2FOR 5' CGTTAGATCTCCAGCTTGGTCCC 3';
VK3FOR 5' CCGTTTCAGCTCGAGCTTGGTCCC 3'; MOJK1FOR 5'
CGTTAGATCTCCAGCTTGGTGCC 3'; MOJK3FOR 5' GGTTAGATCTCCAGTCTGGTCCC 3';
MOJK4FOR 5' CGTTAGATCTCCAACTTTGTCCC 3'; HUJK1FOR 5'
CGTTAGATCTCCACCTTGGTCCC 3'; HUJK3FOR 5' CGTTAGATCTCCACTTTGGTCCC 3';
HUJK4FOR 5' CGTTAGATCTCCACCTTGGTCCC 3'; HUJK5FOR 5'
CGTTAGATCTCCAGTCGTGTCCC 3'; VH1BACK 5'
AGGT(C/G)(C/A)A(G/A)CTGCAG(G/C)AGTC(T/A)GG 3'; Hu2VHIBACK: 5'
CAGGTGCAGCTGCAGCAGTCTGG 3'; HuVHIIBACK: 5' CAGGTGCAGCTGCAGGAGTCGGG
3'; Hu2VHIIIBACK: 5' GAGGTGCAGCTGCAGGAGTCTGG 3'; HuVHIVBACK: 5'
CAGGTGCAGCTGCAGCAGTCTGG 3'; MOVHIBACK 5' AGGTGCAGCTGCAGGAGTCAG 3';
MOVHIIABACK 5' AGGTCCAGCTGCAGCA(G/A)TCTGG 3'; MOVHIIBBACK 5'
AGGTCCAACTGCAGCAGCCTGG 3'; MOVHIIBACK 5' AGGTGAAGCTGCAGGAGTCTGG 3';
VK1BACK 5' GACATTCAGCTGACCCAGTCTCCA 3'; VK2BACK 5'
GACATTGAGCTCACCCAGTCTCCA 3'; MOVKIIABACK 5'
GATGTTCAGCTGACCCAAACTCCA 3' MOVKIIBBACK 5' GATATTCAGCTGACCCAGGATGAA
3'; HuHep1FOR 5' C(A/G)(C/G)TGAGCTCACTGTGTCTCTCGCACA 3';
HuOcta1BACK 5' CGTGAATATGCAAATAA 3'; HUOcta2BACK 5'
AGTAGGAGACATGCAAAT 3'; and HuOcta3BACK 5' CACCACCCACATGCAAAT 3';
VHMUT1 5' GGAGACGGTGACCGTGGTCCCTTGGCCCCAGTAGTCAAGNNNNNNNN
NNNNCTCTCTGGC 3' (where N is an equimolar mixture of T, C, G and A)
M13 pRIMER 5' AACAGCTATGACCATG 3' (New England Biolabs *1201)
EXAMPLE 1
Cloning of Mouse Rearranged Variable Region Genes from Hybridomas,
Assembly of Genes Encoding Chimeric Antibodies and the Expression
of Antibodies from Myeloma Cells
[0133] VH1FOR is designed to anneal with the 3' end of the sense
strand of any mouse heavy chain variable domain encoding sequence.
It contains a BstEII recognition site. VK1FOR is designed to anneal
with the 3' end of the sense strand of any mouse kappa-type light
chain variable domain encoding sequence and contains a BglII
recognition site. VH1BACK is designed to anneal with the 3' end of
the antisense strand of any mouse heavy chain variable domain and
contains a PstI recognition site. VK1BACK is designed to anneal
with the 3' end of the antisense strand of any mouse kappa-type
light chain variable domain encoding sequence and contains a PvuII
recognition site.
[0134] In this Example five mouse hybridomas were used as a source
of ds nucleic acid. The hybridomas produce monoclonal antibodies
(MAbs) designated MBr1 [23], BW431/26 [24], BW494/32 [25],
BW250/183 [24,26] and BW704/152 [27]. MAb MBr1 is particularly
interesting in that it is known to be specific for a saccharide
epitope on a human mammary carcinoma line MCF-7 [28].
[0135] Cloning Via mRNA
[0136] Each of the five hybridomas referred to above was grown up
in roller bottles and about 5.times.10.sup.8 cells of each
hybridoma were used to isolate RNA. mRNA was separated from the
isolated RNA using oligodT cellulose [29]. First strand cDNA was
synthesized according to the procedure described by Maniatis et al.
[30] as set out below.
[0137] In order to clone the heavy chain variable domain encoding
sequence, a 50 .mu.l reaction solution which contains 10 .mu.g
mRNA, 20 pmole VH1FOR primer, 250 .mu.M each of dATP, dTTP, dCTP
and dGTP, 10 mM dithiothreitol (DTT), 100 mM Tris.HCl, 10 MM
MgCl.sub.2 and 140 mM KCl, adjusted to pH 8.3 was prepared. The
reaction solution was heated at 70.degree. C. for ten minutes and
allowed to cool to anneal the primer to the 3' end of the variable
domain encoding sequence in the mRNA. To the reaction solution was
then added 46 units of reverse transcriptase (Anglian Biotec) and
the solution was then incubated at 42.degree. C. for 1 hour to
cause first strand cDNA synthesis.
[0138] In order to clone the light chain variable domain encoding
sequence, the same procedure as set out above was used except that
the VK1FOR primer was used in place of the VH1 FOR primer.
[0139] Amplification from RNA/DNA Hybrid
[0140] Once the ds RNA/DNA hybrids had been produced, the variable
domain encoding sequences were amplified as follows. For heavy
chain variable domain encoding sequence amplification, a 50 .mu.l
reaction solution containing 5 .mu.l of the ds RNA/DNA
hybrid-containing solution, 25 pmole each of VH1FOR and VH1BACK
primers, 250 .mu.M of dATP, dTTP, dCTP and dGTP, 67 mM Tris.HCl, 17
mM ammonium sulphate, 10 mM MgCl.sub.2, 200 .mu.g/ml gelatine and 2
units Taq polymerase (Cetus) was prepared. The reaction solution
was overlaid with paraffin oil and subjected to 25 rounds of
temperature cycling using a Techne PHC-1 programmable heating
block. Each cycle consisted of 1 minute and 95.degree. C. (to
denature the nucleic acids), 1 minute at 30.degree. C. (to anneal
the primers to the nucleic acids) and 2 minutes at 72.degree. C.
(to cause elongation from the primers). After the 25 cycles, the
reaction solution and the oil were extracted twice with ether, once
with phenol and once with phenol/CHCl3. Thereafter ds cDNA was
precipitated with ethanol. The precipitated ds cDNA was then taken
up in 50 .mu.l of water and frozen.
[0141] The procedure for light chain amplification was exactly as
described above, except that the VK1FOR and VK1BACK primers were
used in place of the VH1FOR and VH1BACK primers respectively.
[0142] 5 .mu.l of each sample of amplified cDNA was fractionated on
2% agarose gels by electrophoresis and stained with ethidium
bromide. This showed that the amplified ds cDNA gave a major band
of the expected size (about 330 bp). (However the band for VK 0 DNA
of MBr1 was very weak. It was therefore excised from the gel and
reamplified in a second round.) Thus by this simple procedure,
reasonable quantities of ds DNA encoding the light and heavy chain
variable domains of the five MAbs were produced.
[0143] Heavy Chain Vector Construction
[0144] A BstEII recognition site was introduced into the vector
M13-HuVHNP [31] by site directed mutagenesis [32,33] to produce the
vector M13-VHPCR1 (FIGS. 2 and 3).
[0145] Each amplified heavy chain variable domain encoding sequence
was digested with the restriction enzymes PstI and BstEII. The
fragments were phenol extracted, purified on 2% low melting point
agarose gels and force cloned into vector M13-VHPCR1 which had been
digested with PstI and BstEII and purified on an 0.8% agarose gel.
Clones containing the variable domain inserts were identified
directly by sequencing [34] using primers based in the 3'
non-coding variable gene in the M13-VHPCR1 vector.
[0146] There is an internal PstI site in the heavy chain variable
domain encoding sequences of BW431/26. This variable domain
encoding sequence was therefore assembled in two steps. The 3'
PstI-BstEII fragment was first cloned into M13-VHPCR1, followed in
a second step by the 5' PstI fragment.
[0147] Light Chain Vector Construction
[0148] Vector M13 mp 18 [35] was cut with PvuII and the vector
backbone was blunt ligated to a synthetic HindIII-BamHI polylinker.
Vector M13-HuVKLYS [36] was digested with HindIII and BamHI to
isolate the HuVKLYS gene. This HindIII-BamHI fragment was then
inserted into the HindIII-BamHI polylinker site to form a vector
M13-VKPCR1 which lacks any PvuII sites in the vector backbone
(FIGS. 4 and 5). This vector was prepared in E. coli JM110 [22] to
avoid dam methylation at the BclI site.
[0149] Each amplified light chain variable domain encoding sequence
was digested with PvuII and BglII. The fragments were phenol
extracted, purified on 2% low melting point agarose gels and force
cloned into vector M13-VKPCR1 which had been digested with PvuII
and BclI, purified on an 0.8% agarose gel and treated with calf
intestinal phosphatase. Clones containing the light chain variable
region inserts were identified directly by sequencing [34] using
primers based in the 3' non-coding region of the variable domain in
the M13-VKPCR1 vector.
[0150] The nucleotide sequences of the MBr1 heavy and light chain
variable domains are shown in FIG. 6 with part of the flanking
regions of the M13-VHPCR1 and M13-VKPCR1 vectors.
[0151] Antibody Expression
[0152] The HindIII-BamHI fragment carrying the MBr1 heavy chain
variable domain encoding sequence in M13-VHPCR1 was recloned into a
pSV-gpt vector with human .gamma.1 constant regions [37] (FIG. 7).
The MBr1 light chain variable domain encoding sequence in
M13-VKPCR1 was recloned as a HindIII-BamHI fragment into a pSV
vector, PSV-hyg-HuCK with a hygromycin resistance marker and a
human kappa constant domain (FIG. 8). The assembly of the genes is
summarized in FIG. 9.
[0153] The vectors thus produced were linearized with PvuI (in the
case of the pSV-hygro vectors the PvuI digest is only partial) and
cotransfected into the non-secreting mouse myeloma line NSO [38] by
electroporation [39]. One day after cotransfection, cells were
selected in 0.3 .mu.g/ml mycophenolic acid (MPA) and after seven
days in 1 .mu.g/ml MPA. After 14 days, four wells, each containing
one or two major colonies, were screened by incorporation of
.sup.14C-lysine [40] and the secreted antibody detected after
precipitation with protein-A Sepharose.TM. (Pharmacia) on SDS-PAGE
[41]. The gels were stained, fixed, soaked in a fluorographic
reagent, Amplify.TM. (Amersham), dried and autoradiographed on
preflashed film at -70.degree. C. for 2 days.
[0154] Supernatant was also tested for binding to the mammary
carcinoma line MCF-7 and the colon carcinoma line HT-29,
essentially as described by Menard et al. [23], either by an
indirect immunofluorescence assay on cell suspensions (using a
fluorescein-labelled goat anti-human IgG (Amersham)) or by a solid
phase RIA on monolayers of fixed cells (using .sup.125I-protein A
(Amersham)).
[0155] It was found that one of the supernatants from the four
wells contained secreted antibody. The chimeric antibody in the
supernatant, like the parent mouse MBr1 antibody, was found to bind
to MCF-7 cells but not the HT-29 cells, thus showing that the
specificity had been properly cloned and expressed.
EXAMPLE 2
Cloning of Rearranged Variable Genes from Genomic DNA of Mouse
Spleen
[0156] Preparation of DNA from Spleen
[0157] The DNA from the mouse spleen was prepared in one of two
ways (although other ways can be used).
[0158] Method 1. A mouse spleen was cut into two pieces and each
piece was put into a standard Eppendorf tube with 200 .mu.l of PBS.
The tip of a 1 ml glass pipette was closed and rounded in the blue
flame of a Bunsen burner. The pipette was used to squash the spleen
piece in each tube. The cells thus produced were transferred to a
fresh Eppendorf tube and the method was repeated three times until
the connective tissue of the spleen appeared white. Any connective
tissue which has been transferred with the cells was removed using
a drawn-out Pasteur pipette. The cells were then washed in PBS and
distributed into four tubes.
[0159] The mouse spleen cells were then sedimented by a 2 minute
spin in a Microcentaur centrifuge at low speed setting. All the
supernatant was aspirated with a drawn out Pasteur pipette. If
desired, at this point the cell sample can be frozen and stored at
-20.degree. C.
[0160] To the cell sample (once thawed if it had been frozen) was
added 500 .mu.l of water and 5 .mu.l of a 10% solution of NP-40, a
non-ionic detergent. The tube was closed and a hole was punched in
the lid. The tube was placed on a boiling water bath for 5 minutes
to disrupt the cells and was then cooled on ice for 5 minutes. The
tube was then spun for 2 minutes at high speed to remove cell
debris.
[0161] The supernatant was transferred to a new tube and to this
was added 125 .mu.l 5M NaCl and 30 .mu.l 1M MOPS adjusted to pH
7.0. The DNA in the supernatant was absorbed on a Quiagen 5 tip and
purified following the manufacturer's instructions for lambda DNA.
After isopropanol precipitation, the DNA was resuspended in 500
.mu.l water.
[0162] Method 2. This method is based on the technique described in
Maniatis et al. [30]. A mouse spleen was cut into very fine pieces
and put into a 2 ml glass homogenizer. The cells were then freed
from the tissue by several slow up and down strokes with the
piston. The cell suspension was made in 500 .mu.l phosphate
buffered saline (PBS) and transferred to an Eppendorf tube. The
cells were then spun for 2 min at low speed in a Microcentaur
centrifuge. This results in a visible separation of white and red
cells. The white cells, sedimenting slower, form a layer on top of
the red cells. The supernatant was carefully removed and spun to
ensure that all the white cells had sedimented. The layer of white
cells was resuspended in two portions of 500 .mu.l PBS and
transferred to another tube.
[0163] The white cells were precipitated by spinning in the
Microcentaur centrifuge at low speed for one minute. The cells were
washed a further two times with 500 .mu.l PBS, and were finally
resuspended in 200 .mu.l PBS. The white cells were added to 2.5 ml
25 mM EDTA and 10 mM Tris.Cl, pH 7.4, and vortexed slowly. While
vortexing 25 .mu.l 20% SDS was added. The cells lysed immediately
and the solution became viscous and clear. 100 .mu.l of 20 mg/ml
proteinase K was added and incubated one to three hours at
50.degree. C.
[0164] The sample was extracted with an equal volume of phenol and
the same volume of chloroform, and vortexed. After centrifuging,
the aqueous phase was removed and 1/10 volume 3M ammonium acetate
was added. This was overlaid with three volumes of cold ethanol and
the tube rocked carefully until the DNA strands became visible. The
DNA was spooled out with a Pasteur pipette, the ethanol allowed to
drip off, and the DNA transferred to 1 ml of 10 mM Tris.Cl pH 7.4,
0.1 mM EDTA in an Eppendorf tube. The DNA was allowed to dissolve
in the cold overnight on a roller.
[0165] Amplification From Genomic DNA
[0166] The DNA solution was diluted 1/10 in water and boiled for 5
min prior to using the polymerase chain reaction (PCR). For each
PCR reaction, typically 50-200 ng of DNA were used.
[0167] The heavy and light chain variable domain encoding sequences
in the genomic DNA isolated from the human PBL or the mouse spleen
cells was then amplified and cloned using the general protocol
described in the first two paragraphs of the section headed
"Amplification from RNA/DNA Hybrid" in Example 1, except that
during the annealing part of each cycle, the temperature was held
at 65.degree. C. and that 30 cycles were used. Furthermore, to
minimize the annealing between the 3' ends of the two primers, the
sample was first heated to 95.degree. C., then annealed at
65.degree. C., and only then was the Taq polymerase added. At the
end of the 30 cycles, the reaction mixture was held at 60.degree.
C. for five minutes to ensure that complete elongation and
renaturation of the amplified fragments had taken place.
[0168] The primers used to amplify the mouse spleen genomic DNA
were VH1FOR and VH1BACK, for the heavy chain variable domain and
VK2FOR and VK1BACK, for the light chain variable domain. (VK2FOR
only differs from VK1FOR in that it has an extra C residue on the
5' end.)
[0169] Other sets of primers, designed to optimize annealing with
different families of mouse VH and V.kappa. genes were devised and
used in mixtures with the primers above. For example, mixtures of
VK1FOR, MOJK1FOR, MOJK3FOR and MOJK4FOR were used as forward
primers and mixtures of VK1BACK, MOVKIIABACK and MOVKIIBBACK as
back primers for amplification of V.kappa. genes. Likewise mixtures
of VH1FOR, MOJH1FOR, MOJH2FOR, MOJH3FOR and MOJH4FOR were used as
forward primers and mixtures of VH1BACK, MOVHIBACK, MOVHIIABACK,
MOVHIIBBACK, MOVHIIIBACK were used as backward primers for
amplification of VH genes.
[0170] All these heavy chain FOR primers referred to above contain
a BstEII site and all the BACK primers referred to above contain a
PstI site. These light chain FOR and BACK primers referred to above
all contain BglII and PvuII sites respectively. Light chain primers
(VK3FOR and VK2BACK) were also devised which utilized different
restriction sites, SacI and XhoI.
[0171] Typically all these primers yielded amplified DNA of the
correct size on gel electrophoresis, although other bands were also
present. However, a problem was identified in which the 5' and 3'
ends of the forward and backward primers for the VH genes were
partially complementary, and this could yield a major band of
"primer-dimer" in which the two oligonucleotides prime on each
other. For this reason an improved forward primer, VH1FOR-2 was
devised in which the two 3' nucleotides were removed from
VH1FOR.
[0172] Thus, the preferred amplification conditions for mouse VH
genes are as follows: the sample was made in a volume of 50-100
.mu.l, 50-100 ng of DNA, VH1FOR-2 and VH1BACK primers (25 pmole of
each), 250 .mu.M of each deoxynucleotide triphosphate, 10 mM
Tris.HCl, pH 8.8, 50 mM KCl, 1.5 mM MgCl.sub.2, and 100 .mu.g/ml
gelatine. The sample was overlaid with paraffin oil, heated to
95.degree. C. for 2 min, 65.degree. C. for 2 min, and then to
72.degree. C.: taq polymerase was added after the sample had
reached the elongation temperature and the reaction continued for 2
min at 72.degree. C. The sample was subjected to a further 29
rounds of temperature cycling using the Techne PHC-1 programmable
heating block.
[0173] The preferred amplification conditions for mouse V.kappa.
genes from genomic DNA are as follows: the sample treated as above
except with V.kappa. primers, for example VK3FOR and VK2BACK, and
using a cycle of 94.degree. C. for one minute, 60.degree. C. for
one minute and 72.degree. C. for one minute.
[0174] The conditions which were devised for genomic DNA are also
suitable for amplification from the cDNA derived from mRNA from
mouse spleen or mouse hybridoma.
[0175] Cloning and Analysis of Variable Region Genes
[0176] The reaction mixture was then extracted twice with 40 .mu.l
of water-saturated diethyl ether. This was followed by a standard
phenol extraction and ethanol precipitation as described in Example
1. The DNA pellet was then dissolved in 100 .mu.l 10 mM Tris.Cl,
0.1 mM EDTA.
[0177] Each reaction mixture containing a light chain variable
domain encoding sequence was digested with SacI and XhoI (or with
PvuII and BglII) to enable it to be ligated into a suitable
expression vector. Each reaction mixture containing a heavy chain
variable domain encoding sequence was digested with PstI and BstEII
for the same purpose.
[0178] The heavy chain variable genes isolated as above from a
mouse hyper-immunized with lysozyme were cloned into M13VHPCR1
vector and sequenced. The complete sequences of 48 VH gene clones
were determined (FIGS. 10a-10b). All but two of the mouse VH gene
families were represented, with frequencies of: VA (1), IIIC (1),
IIIB (8), IIIA (3), IIB (17), IIA (2), IB (12), IA (4). In 30
clones, the D segments could be assigned to families SP2 (14), FL16
(11) and Q52 (5), and in 38 clones the JH minigenes to families JH1
(3), JH2 (7), JH3 (14) and JH4 (14). The different sequences of
CDR3 marked out each of the 48 clones as unique. Nine pseudogenes
and 16 unproductive rearrangements were identified. Of the clones
sequenced, 27 have open reading frames.
[0179] Thus the method is capable of generating a diverse
repertoire of heavy chain variable genes from mouse spleen DNA.
EXAMPLE 3
Cloning of Rearranged Variable Genes from mRNA from Human
Peripheral Blood lymphocytes
[0180] Preparation of mRNA
[0181] Human peripheral blood lymphocytes were purified and mRNA
prepared directly (Method 1), or mRNA was prepared after addition
of Epstein Barr virus (Method 2).
[0182] Method 1. 20 ml of heparinized human blood from a healthy
volunteer was diluted with an equal volume of phosphate buffered
saline (PBS) and distributed equally into 50 ml Falcon tubes. The
blood was then underlayed with 15 ml Ficoll Hypaque (Pharmacia
10-A-001-07). To separate the lymphocytes from the red blood cells,
the tubes were spun for 10 minutes at 1800 rpm at room temperature
in an IEC Centra 3E table centrifuge. The peripheral blood
lymphocytes (PBL) were then collected from the interphase by
aspiration with a Pasteur pipette. The cells were diluted with an
equal volume of PBS and spun again at 1500 rpm for 15 minutes. The
supernatant was aspirated, the cell pellet was resuspended in 1 ml
PBS and the cells were distributed into two Eppendorf tubes.
[0183] Method 2. 40 ml human blood from a patient with HIV in the
pre-AIDS condition was layered on Ficoll to separate the white
cells (see Method 1 above). The white cells were then incubated in
tissue culture medium for 4-5 days. On day 3, they were infected
with Epstein Barr virus. The cells were pelleted (approx
2.times.10.sup.7 cells) and washed in PBS.
[0184] The cells were pelleted again and lysed with 7 ml 5M
guanidine isothiocyanate, 50 mM Tris, 10 mM EDTA, 0.1 mM
dithiothreitol. The cells were vortexed vigorously and 7 volumes of
4M LiCl added. The mixture was incubated at 4.degree. C. for 15-20
hrs. The suspension was spun and the supernatant resuspended in 3M
LiCl and centrifuged again. The pellet was dissolved in 2 ml 0.1%
SDS, 10 mM Tris HCl and 1 mM EDTA. The suspension was frozen at
-20.degree. C., and thawed by vortexing for 20 s every 10 min for
45 min. A large white pellet was left behind and the clear
supernatant was extracted with phenol chloroform, then with
chloroform. The RNA was precipitated by adding 1/10 volume 3M
sodium acetate and 2 vol ethanol and leaving overnight at
-20.degree. C. The pellet was suspended in 0.2 ml water and
reprecipitated with ethanol. Aliquots for cDNA synthesis were taken
from the ethanol precipitate which had been vortexed to create a
fine suspension.
[0185] 100 .mu.l of the suspension was precipitated and dissolved
in 20 .mu.l water for cDNA synthesis [30] using 10 pmole of a HUFOR
primer (see below) in final volume of 50 .mu.l. A sample of 5 .mu.l
of the cDNA was amplified as in Example 2 except using the primers
for the human VH gene families (see below) using a cycle of
95.degree. C., 60.degree. C. and 72.degree. C.
[0186] The back primers for the amplification of human DNA were
designed to match the available human heavy and light chain
sequences, in which the different families have slightly different
nucleotide sequences at the 5' end. Thus for the human VH genes,
the primers Hu2VHIBACK, HuVHIIBACK, Hu2VHIIIBACK and HuVH1VBACK
were designed as back primers, and HUJH1FOR, HUJH2FOR and HUJH4FOR
as forward primers based entirely in the variable gene. Another set
of forward primers Hu1VHFOR, Hu2VHFOR, Hu3VHFOR, and Hu4VHFOR was
also used, which were designed to match the human J-regions and the
5' end of the constant regions of different human isotypes.
[0187] Using sets of these primers it was possible to demonstrate a
band of amplified ds cDNA by gel electrophoresis.
[0188] One such experiment was analyzed in detail to establish
whether there was a diverse repertoire in a patient with HIV
infection. It is known that during the course of AIDS, that T-cells
and also antibodies are greatly diminished in the blood. Presumably
the repertoire of lymphocytes is also diminished. In this
experiment, for the forward priming, an equimolar mixture of
primers Hu1VHFOR, Hu2VHFOR, Hu3VHFOR, and Hu4VHFOR (in PCR 25 pmole
of primer 5' ends) was used. For the back priming, the primers
Hu2VHIBACK, HuVHIIBACK, Hu2VHIIIBACK and HuVH1VBACK were used
separately in four separate primings. The amplified DNA from the
separate primings was then pooled, digested with restriction
enzymes PstI and BstEII as above, and then cloned into the vector
M13VHPCR1 for sequencing. The sequences reveal a diverse repertoire
(FIG. 11) at this stage of the disease.
[0189] For human V.kappa. genes the primers HuJK1FOR, HUJK3FOR;
HUJK4FOR and HUJK5FOR were used as forward primers and VK1BACK as
back primer. Using these primers it was possible to see a band of
amplified ds cDNA of the correct size by gel electrophoresis.
EXAMPLE 4
Cloning of Unrearranged Variable Gene Genomic DNA from Human
Peripheral Blood Lymphocytes
[0190] Human peripheral blood lymphocytes of a patient with
non-Hodgkins lymphoma were prepared as in Example 3 (Method 1). The
genomic DNA was prepared from the PBL using the technique described
in Example 2 (Method 2). The VH region in the isolated genomic DNA
was then amplified and cloned using the general protocol described
in the first two paragraphs of the section headed "Amplification
from RNA/DNA hybrid" in Example 1 above, except that during the
annealing part of each cycle, the temperature was held at
55.degree. C. and that 30 cycles were used. At the end of the 30
cycles, the reaction mixture was held at 60.degree. C. for five
minutes to ensure that complete elongation and renaturation of the
amplified fragments had taken place.
[0191] The forward primer used was HuHep1FOR, which contains a SacI
site. This primer is designed to anneal to the 3' end of the
unrearranged human VH region gene, and in particular includes a
sequence complementary to the last three codons in the VH region
gene and nine nucleotides downstream of these three codons.
[0192] As the back primer, an equimolar mixture of HuOcta1BACK,
HuOcta2BACK and HuOcta3BACK was used. These primers anneal to a
sequence in the promoter region of the genomic DNA VH gene (see
FIG. 1). 5 .mu.l of the amplified DNA was checked on 2% agarose
gels in TBE buffer and stained with ethidium bromide. A double band
was seen of about 620 nucleotides which corresponds to the size
expected for the unrearranged VH gene. The ds cDNA was digested
with SacI and cloned into an M13 vector for sequencing. Although
there are some sequences which are identical, a range of different
unrearranged human VH genes were identified (FIG. 12).
EXAMPLE 5
Cloning Variable Domains with Binding Activities from a
Hybridoma
[0193] The heavy chain variable domain (VHLYS) of the D1.3
(anti-lysozyme) antibody was cloned into a vector similar to that
described previously [42] but under the control of the lac z
promoter, such that the VHLYS domain is attached to a pelB leader
sequence for export into the periplasm. The vector was constructed
by synthesis of the pelB leader sequence [43], using overlapping
oligonucleotides, and cloning into a pUC 19 vector [35]. The VHLYS
domain of the D1.3 antibody was derived from a cDNA clone [44] and
the construct (PSW1) sequenced (FIG. 13).
[0194] To express both heavy and light chain variable domains
together, the light chain variable region (VKLYS) of the D1.3
antibody was introduced into the pSW1 vector, with a pelB signal
sequence to give the construct pSW2 (FIGS. 14a-14b).
[0195] A strain of E. coli (BMH71-18) [45] was then transformed
[46,47] with the plasmid pSW1 or pSW2, and colonies resistant to
ampicillin (100 .mu.g/ml) were selected on a rich (2.times.TY=per
litre of water, 16 g Bacto-tryptone, 10 g yeast extract, 5 g NaCl)
plate which contained 1% glucose to repress the expression of
variable domain(s) by catabolite repression.
[0196] The colonies were inoculated into 50 ml 2.times.TY (with 1%
glucose and 100 .mu.g/ml ampicillin) and grown in flasks at
37.degree. C. with shaking for 12-16 hr. The cells were
centrifuged, the pellet washed twice with 50 mM sodium chloride,
resuspended in 2.times.TY medium containing 100 .mu.g/ml ampicillin
and the inducer IPTG (1 mM) and grown for a further 30 hrs at
37.degree. C. The cells were centrifuged and the supernatant was
passed through a Nalgene filter (0.45 .mu.m) and then down a 1-5 ml
lysozyme-Sepharose.RTM. affinity column (Pharmacia Fine Chemicals,
Inc.). (The column was derived by coupling lysozyme at 10 mg/ml to
CNBr activated Sepharose.) The column was first washed with
phosphate buffered saline (PBS), then with 50 mM diethylamine to
elute the VHLYS domain (from pSW1) or VHLYS in association with
VKLYS (from pSW2).
[0197] The VHLYS and VKLYS domains were identified by SDS
polyacrylamide electrophoresis as the correct size. In addition,
N-terminal sequence determination of VHLYS and VKLYS isolated from
a polyacrylamide gel showed that the signal peptide had been
produced correctly. Thus both the Fv fragment and the VHLYS domains
are able to bind to the lysozyme affinity column, suggesting that
both retain at least some of the affinity of the original
antibody.
[0198] The size of the VHLYS domain was compared by FPLC with that
of the Fv fragment on Superose 12. This indicates that the VHLYS
domain is a monomer. The binding of the VHLYS and Fv fragment to
lysozyme was checked by ELISA, and equilibrium and rapid reaction
studies were carried out using fluorescence quench.
[0199] The ELISA for lysozyme binding was undertaken as
follows:
[0200] (1) The plates (Dynatech Immulon) were coated with 200 .mu.l
per well of 300 .mu.g/ml lysozyme in 50 mM NaHCO.sub.3, pH 9.6
overnight at room temperature;
[0201] (2) The wells were rinsed with three washes of PBS, and
blocked with 300 .mu.l per well of 1% Sainsbury's instant dried
skimmed milk powder in PBS for 2 hours at 37.degree. C.;
[0202] (3) The wells were rinsed with three washes of PBS and 200
.mu.l of VHLYS or Fv fragment (VHLYS associated with VKLYS) were
added and incubated for 2 hours at room temperature;
[0203] (4) The wells were washed three times with 0.05% Tween 20 in
PBS and then three times with PBS to remove detergent;
[0204] (5) 200 .mu.l of a suitable dilution (1:1000) of rabbit
polyclonal antisera raised against the Fv fragment in 2% skimmed
milk powder in PBS was added to each well and incubated at room
temperature for 2 hours;
[0205] (6) Washes were repeated as in (4);
[0206] (7) 200 .mu.l of a suitable dilution (1:1000) of goat
anti-rabbit antibody (ICN Immunochemicals) coupled to horse radish
peroxidase, in 2% skimmed milk powder in PBS, was added to each
well and incubated at room temperature for 1 hour;
[0207] (8) Washes were repeated as in (4); and
[0208] (9) 200 ml 2,2'azino-bis(3-ethylbenzthiazolinesulphonic
acid) [Sigma] (0.55 mg/ml, with 1 .mu.l 20% hydrogen peroxide:
water per 10 ml) was added to each well and the color allowed to
develop for up to 10 minutes at room temperature.
[0209] The reaction was stopped by adding 0.05% sodium azide in 50
mM citric acid pH 4.3. ELISA plates were read in a Titertek
Multiscan plate reader. Supernatant from the induced bacterial
cultures of both pSW1 (VHLYS domain) or pSW2 (Fv fragment) was
found to bind to lysozyme in the ELISA.
[0210] The purified VHLYS and Fv fragments were titrated with
lysozyme using fluorescence quench (Perkin Elmer LS5B Luminescence
Spectrometer) to measure the stoichiometry of binding and the
affinity constant for lysozyme [48,49]. The titration of the Fv
fragment at a concentration of 30 nM indicates a dissociation
constant of 2.8 nM using a Scatchard analysis.
[0211] A similar analysis using fluorescence quench and a Scatchard
plot was carried out for VHLYS, at a VHLYS concentration of 100 nM.
The stoichiometry of antigen binding is about 1 mole of lysozyme
per mole of VHLYS (calculated from plot). (The concentration of VH
domains was calculated from optical density at 280 nM using the
typical extinction coefficient for complete immunoglobulins.) Due
to possible errors in measuring low optical densities and the
assumption about the extinction coefficient, the stoichiometry was
also measured more carefully. VHLYS was titrated with lysozyme as
above using fluorescence quench. To determine the concentration of
VHLYS a sample of the stock solution was removed, a known amount of
norleucine added, and the sample subjected to quantitative amino
acid analysis. This showed a stoichiometry of 1.2 mole of lysozyme
per mole of VHLYS domain. The dissociation constant was calculated
as about 12 nM.
[0212] The on-rates for VHLYS and Fv fragments with lysozyme were
determined by stopped-flow analysis (HI Tech Stop Flow SHU machine)
under pseudo-first order conditions with the fragment at a ten fold
higher concentration than lysozyme [50]. The concentration of
lysozyme binding sites was first measured by titration with
lysozyme using fluorescence quench as above. The on rates were
calculated per mole of binding site (rather than amount of VHLYS
protein). The on-rate for the Fv fragment was found to be
2.2.times.10.sup.6 M.sup.-1 s.sup.-1 at 25.degree. C. The on-rate
for the VHLYS fragment found to be 3.8.times.10.sup.6 M.sup.-1
s.sup.-1 and the off-rate 0.075 s.sup.-1 at 20.degree. C. The
calculated affinity constant is 19 nM. Thus the VHLYS binds to
lysozyme with a dissociation constant of about 19 nM, compared with
that of the Fv of 3 nM.
EXAMPLE 6
Cloning Complete Variable Domains with Binding Activities from mRNA
or DNA of Antibody-Secreting Cells
[0213] A mouse was immunized with hen egg white lysozyme (100 .mu.g
i.p. day 1 in complete Freunds adjuvant), after 14 days immunized
i.p. again with 100 .mu.g lysozyme with incomplete Freunds
adjuvant, and on day 35 i.v. with 50 .mu.g lysozyme in saline. On
day 39, spleen was harvested. A second mouse was immunized with
keyhole limpet hemocyanin (KLH) in a similar way. The DNA was
prepared from the spleen according to Example 2 (Method 2). The VH
genes were amplified according to the preferred method in Example
2.
[0214] Human peripheral blood lymphocytes from a patient infected
with HIV were prepared as in Example 3 (Method 2) and mRNA
prepared. The VH genes were amplified according to the method
described in Example 3, using primers designed for human VH gene
families.
[0215] After the PCR, the reaction mixture and oil were extracted
twice with ether, once with phenol and once with phenol/CHCl.sub.3.
The double stranded DNA was then taken up in 50 .mu.l of water and
frozen. 5 .mu.l was digested with PstI and BstEII (encoded within
the amplification primers) and loaded on an agarose gel for
electrophoresis. The band of amplified DNA at about 350 bp was
extracted.
[0216] Expression of Anti-Lysozyme Activities
[0217] The repertoire of amplified heavy chain variable domains
(from mouse immunized with lysozyme and from human PBLs) was then
cloned directly into the expression vector pSW1HPOLYMYC. This
vector is derived from pSW1 except that the VHLYS gene has been
removed and replaced by a polylinker restriction site. A sequence
encoding a peptide tag was inserted (FIG. 15). Colonies were
toothpicked into 1 ml cultures. After induction (see Example 5 for
details), 10 .mu.l of the supernatant from fourteen 1 ml cultures
was loaded on SDS-PAGE gels and the proteins transferred
electrophoretically to nitrocellulose. The blot was probed with
antibody 9E10 directed against the peptide tag.
[0218] The probing was undertaken as follows. The nitrocellulose
filter was incubated in 3% bovine serum albumin (BSA)/TBS buffer
for 20 min (10.times.TBS buffer is 100 mM Tris.HCl, pH 7.4, 9% w/v
NaCl). The filter was incubated in a suitable dilution of antibody
9E10 (about 1/500) in 3% BSA/TBS for 1-4 hrs. After three washes in
TBS (100 ml per wash, each wash for 10 min), the filter was
incubated with 1:500 dilution of anti-mouse antibody (peroxidase
conjugated anti-mouse Ig (Dakopats)) in 3% BSA/TBS for 1-2 hrs.
After three washes in TBS and 0.1% Triton X-100 (about 100 ml per
wash, each wash for 10 min), a solution containing 10 ml
chloronaphthol in methanol (3 mg/ml), 40 ml TBS and 50 .mu.l
hydrogen peroxide solution was added over the blot and allowed to
react for up to 10 min. The substrate was washed out with excess
water. The blot revealed bands similar in mobility to VHLYSMYC on
the Western blot, showing that other VH domains could be
expressed.
[0219] Colonies were then toothpicked individually into wells of an
ELISA plate (200 .mu.l) for growth and induction. They were assayed
for lysozyme binding with the 9E10 antibody (as in Examples 5 and
7). Wells with lysozyme-binding activity were identified. Two
positive wells (of 200) were identified from the amplified mouse
spleen DNA and one well from the human cDNA. The heavy chain
variable domains were purified on a column of lysozyme-Sepharose.
The affinity for lysozyme of the clones was estimated by
fluorescence quench titration as >50 nM. The affinities of the
two clones (VH3 and VH8) derived from the mouse genes were also
estimated by stop flow analysis (ratio of k.sub.off/k.sub.on) as 12
nM and 27 nM respectively. Thus both these clones have a comparable
affinity to the VHLYS domain. The encoded amino acid sequences of
VH3 and VH8 are given in FIG. 16, and that of the human variable
domain in FIG. 17.
[0220] A library of VH domains made from the mouse immunized with
lysozyme was screened for both lysozyme and keyhole limpet
hemocyanin (KLH) binding activities. Two thousand colonies were
toothpicked in groups of five into wells of ELISA plates, and the
supernatants tested for binding to lysozyme coated plates and
separately to KLH coated plates. Twenty one supernatants were shown
to have lysozyme binding activities and two to have KLH binding
activities. A second expression library, prepared from a mouse
immunized with KLH was screened as above. Fourteen supernatants had
KLH binding activities and a single supernatant had lysozyme
binding activity.
[0221] This shows that antigen binding activities can be prepared
from single VH domains, and that immunization facilitates the
isolation of these domains.
EXAMPLE 7
Cloning Variable Domains with Binding Activities by Mutagenesis
[0222] Taking a single rearranged VH gene, it may be possible to
derive entirely new antigen binding activities by extensively
mutating each of the CDRs. The mutagenesis might be entirely
random, or be derived from pre-existing repertoires of CDRs. Thus a
repertoire of CDR3s might be prepared as in the preceding examples
by using "universal" primers based in the flanking sequences, and
likewise repertoires of the other CDRs (singly or in combination).
The CDR repertoires could be stitched into place in the flanking
framework regions by a variety of recombinant DNA techniques.
[0223] CDR3 appears to be the most promising region for mutagenesis
as CDR3 is more variable in size and sequence than CDRs 1 and 2.
This region would be expected to make a major contribution to
antigen binding. The heavy chain variable region (VHLYS) of the
anti-lysozyme antibody D1.3 is known to make several important
contacts in the CDR3 region.
[0224] Multiple mutations were made in CDR3. The polymerase chain
reaction (PCR) and a highly degenerate primer were used to make the
mutations and by this means the original sequence of CDR3 was
destroyed. (It would also have been possible to construct the
mutations in CDR3 by cloning a mixed oligonucleotide duplex into
restriction sites flanking the CDR or by other methods of
site-directed mutagenesis). Mutants expressing heavy chain variable
domains with affinities for lysozyme were screened and those with
improved affinities or new specificities were identified.
[0225] The source of the heavy chain variable domain was an M113
vector containing the VHLYS gene. The body of the sequence encoding
the variable region was amplified using the polymerase chain
reaction (PCR) with the mutagenic primer VHMUT1 based in CDR3 and
the M13 primer which is based in the M13 vector backbone. The
mutagenic primer hypermutates the central four residues of CDR3
(Arg-Asp-Tyr-Arg). The PCR was carried out for 25 cycles on a
Techne PHC-1 programmable heat block using 100 ng single stranded
M13 mp19SWO template, with 25 pmol of VHMUT1 and the M13 primer,
0.5 mM each dNTP, 67 mM Tris.HCl, pH 8.8, 10 mM MgCl.sub.2, 17 mM
(NH.sub.4).sub.2SO.sub.4, 200 .mu.g/ml gelatine and 2.5 units Taq
polymerase in a final volume of 50 .mu.l. The temperature regime
was 95.degree. C. for 1.5 min, 25.degree. C. for 1.5 min and
72.degree. C. for 3 min (However a range of PCR conditions could be
used). The reaction products were extracted with phenol/chloroform,
precipitated with ethanol and resuspended in 10 mM Tris. HCl and
0.1 mM EDTA, pH 8.0.
[0226] The products from the PCR were digested with PstI and BstEII
and purified on a 1.5% LGT agarose gel in Tris acetate buffer using
Geneclean.RTM. (Bio 101, LaJolla). The gel purified band was
ligated into pSW2HPOLY (FIG. 19). (This vector is related to pSW2
except that the body of the VHLYS gene has been replaced by a
polylinker.) The vector was first digested with BstEII and PstI and
treated with calf-intestinal phosphatase. Aliquots of the reaction
mix were used to transform E. coli BMH 71-18 to ampicillin
resistance. Colonies were selected on ampicillin (100 .mu.g/ml)
rich plates containing glucose at 0.8% w/v.
[0227] Colonies resulting from transfection were picked in pools of
five into two 96 well Corning microtitre plates, containing 200
.mu.l 2.times.TY medium and 100 .mu.l TY medium, 100 .mu.g/ml
ampicillin and 1% glucose. The colonies were grown for 24 hours at
37.degree. C. and then cells were washed twice in 200 .mu.l 50 mM
NaCl, pelleting the cells in an IEC Centra-3 bench top centrifuge
with microtitre plate head fitting. Plates were spun at 2,500 rpm
for 10 min at room temperature. Cells were resuspended in 200 .mu.l
2.times.TY, 100 .mu.g/ml ampicillin and 1 mM IPTG (Sigma) to induce
expression, and grown for a further 24 hr.
[0228] Cells were spun down and the supernatants used in ELISA with
lysozyme coated plates and anti-idiotypic sera (raised in rabbits
against the Fv fragment of the D1.3 antibody). Bound anti-idiotypic
serum was detected using horse radish peroxidase conjugated to
anti-rabbit sera (ICN Immunochemicals). Seven of the wells gave a
positive result in the ELISA. These pools were restreaked for
single colonies which were picked, grown up, induced in microtitre
plates and rescreened in the ELISA as above. Positive clones were
grown up at the 50 ml scale and expression was induced. Culture
supernatants were purified as in Example 5 on columns of
lysozyme-Sepharose and eluates analysed on SDS-PAGE and staining
with Page Blue 90 (BDH). On elution of the column with
diethylamine, bands corresponding to the VHLYS mutant domains were
identified, but none to the VKLYS domains. This suggested that
although the mutant domains could bind to lysozyme, they could no
longer associate with the VKYLS domains.
[0229] For seven clones giving a positive reaction in ELISA,
plasmids were prepared and the VKLYS gene excised by cutting with
EcoRI and religating. Thus the plasmids should only direct the
expression of the VHLYS mutants. 1.5 ml cultures were grown and
induced for expression as above. The cells were spun down and
supernatant shown to bind lysozyme as above. (Alternatively the
amplified mutant VKLYS genes could have been cloned directly into
the pSW1HPOLY vector for expression of the mutant activities in the
absence of VKLYS.)
[0230] An ELISA method was devised in which the activities of
bacterial supernatants for binding of lysozyme (or KLH) were
compared. Firstly a vector was devised for tagging of the VH
domains at its C-terminal region with a peptide from the c-myc
protein which is recognized by a monoclonal antibody 9E10. The
vector was derived from pSW1 by a BstEII and SmaI double digest,
and ligation of an oligonucleotide duplex made from
TABLE-US-00002 5' GTC ACC GTC TCC TCA GAA CAA AAA CTC ATA TCA GAA
GAG GAT CTG AAT TAA TAA 3' and 5' TTA TTA ATT CAG ATC CTC TTC TGA
GAT GAG TTT TTG TTC TGA GGA GAC G 3'.
[0231] The VHLYSMYC protein domain expressed after induction was
shown to bind to lysozyme and to the 9E10 antibody by ELISA as
follows:
[0232] (1) Falcon (3912) flat bottomed wells were coated with 180
.mu.l lysozyme (3 mg/ml) or KLH (50 .mu.g/ml) per well in 50 mM
NaHCO.sub.3, pH 9.6, and left to stand at room temperature
overnight;
[0233] (2) The wells were washed with PBS and blocked for 2 hrs at
37.degree. C. with 200 .mu.l 2% Sainsbury's instant dried skimmed
milk powder in PBS per well;
[0234] (3) The Blocking solution was discarded, and the walls
washed out with PBS (3 washes) and 150 .mu.l test solution
(supernatant or purified tagged domain) pipetted into each well.
The sample was incubated at 37.degree. C. for 2 hrs;
[0235] (4) The test solution was discarded, and the wells washed
out with PBS (3 washes). 100 .mu.l of 4 .mu.g/ml purified 9E10
antibody in 2% Sainsbury's instant dried skimmed milk powder in PBS
was added, and incubated at 37.degree. C. for 2 hrs;
[0236] (5) The 9E10 antibody was discarded, the wells washed with
PBS (3 washes). 100 ml of 1/500 dilution of anti-mouse antibody
(peroxidase conjugated anti-mouse Ig (Dakopats)) was added and
incubated at 37.degree. C. for 2 hrs;
[0237] (6) The second antibody was discarded and wells washed three
times with PBS; and
[0238] (7) 100 .mu.l 2,2'azino-bis(3-ethylbenzthiazolinesulphonic
acid) [Sigma] (0.55 mg/ml, with 1 .mu.l 20% hydrogen peroxide:
water per 10 ml) was added to each well and the color allowed to
develop for up to 10 minutes at room temperature.
[0239] The reaction was stopped by adding 0.05% sodium azide in 50
mM citric acid, pH 4.3. ELISA plates were read in an Titertek
Multiscan plate reader.
[0240] The activities of the mutant supernatants were compared with
VHLYS supernatant by competition with the VHLYSMYC domain for
binding to lysozyme. The results show that supernatant from clone
VHLYSMUT59 is more effective than wild type VHLYS supernatant in
competing for VHLYSMYC. Furthermore, Western blots of SDS-PAGE
aliquots of supernatant from the VHLYS and VHLYSMUT59 domain (using
anti-Fv antisera) indicated comparable amounts of the two samples.
Thus assuming identical amounts of VHLYS and VHLYSMUT59, the
affinity of the mutant appears to be greater than that of the VHLYS
domain.
[0241] To check the affinity of the VHLYSMUT59 domain directly, the
clone was grown at the 1 L scale and 200-300 .mu.g purified on
lysozyme-Sepharose as in Example 5. By fluorescence quench
titration of samples of VHLYS and VHLYSMUT59, the number of binding
sites for lysozyme were determined. The samples of VHLYS and
VHLYSMUT59 were then compared in the competition ELISA with
VHLYSMYC over two orders of magnitude. In the competition assay
each microtitre well contained a constant amount of VHLYSMYC
(approximately 0.6 .mu.g VHLYSMYC). Varying amounts of VHLYS or
VHLYSMUT59 (3.8 .mu.M in lysozyme binding sites) were added
(0.166-25 .mu.l). The final volume and buffer concentration in all
wells was constant. 9E10 (anti-myc) antibody was used to quantitate
bound VHLYSMYC in each assay well. The % inhibition of VHLYSMYC
binding was calculated for each addition of VHLYS or VHLYSMUT59,
after subtraction of background binding. Assays were carried out in
duplicate. The results indicate that VHLYSMUT59 has a higher
affinity for lysozyme than VHLYS.
[0242] The VHLYSMUT59 gene was sequenced (after recloning into M13)
and shown to be identical to the VHLYS gene except for the central
residues of CDR3 (Arg-Asp-Tyr-Arg). These were replaced by
Thr-Gln-Arg-Pro: (encoded by ACACAAAGGCCA).
[0243] A library of 2000 mutant VH clones was screened for lysozyme
and also for KLH binding (toothpicking 5 colonies per well as
described in Example 6). Nineteen supernatants were identified with
lysozyme binding activities and four with KLH binding activities.
This indicates that new specificities and improved affinities can
be derived by making a random repertoire of CDR3.
EXAMPLE 8
Construction and Expression of Double Domain for Lysozyme
Binding
[0244] The finding that single domains have excellent binding
activities should allow the construction of strings of domains
(concatamers). Thus, multiple specificities could be built into the
same molecule, allowing binding to different epitopes spaced apart
by the distance between domain heads. Flexible linker regions could
be built to space out the domains. In principle such molecules
could be devised to have exceptional specificity and affinity.
[0245] Two copies of the cloned heavy chain variable gene of the
D1.3 antibody were linked by a nucleotide sequence encoding a
flexible linker
Gly-Gly-Gly-Ala-Pro-Ala-Ala-Ala-Pro-Ala-Gly-Gly-Gly- (by several
steps of cutting, pasting and site directed mutagenesis) to yield
the plasmid pSW3 (FIG. 20). The expression was driven by a lacZ
promoter and the protein was secreted into the periplasm via a pelB
leader sequence (as described in Example 5 for expression of pSW1
and pSW2). The protein could be purified to homogeneity on a
lysozyme affinity column. On SDS polyacrylamide gels, it gave a
band of the right size (molecular weight about 26,000). The protein
also bound strongly to lysozyme as detected by ELISA (see Example
5) using anti-idiotypic antiserum directed against the Fv fragment
of the D1.3 antibody to detect the protein. Thus, such constructs
are readily made and secreted and at least one of the domains binds
to lysozyme.
EXAMPLE 9
Introduction of Cysteine Residue at C-Terminal End of VHLYS
[0246] A cysteine residue was introduced at the C-terminus of the
VHLYS domain in the vector pSW2. The cysteine was introduced by
cleavage of the vector with the restriction enzymes BstI and SmaI
(which excises the C-terminal portion of the J segment) and
ligation of a short oligonucleotide duplex
TABLE-US-00003 5' GTC ACC GTC TCC TCA TGT TAA TAA 3' and 5' TTA TTA
ACA TGA GGA GAC G 3'.
By purification on an affinity column of lysozyme Sepharose it was
shown that the VHLYS-Cys domain was expressed in association with
the VKLYS variable domain, but the overall yields were much lower
than the wild type Fv fragment. Comparison of non-reducing and
reducing SDS polyacrylamide gels of the purified Fv-Cys protein
indicated that the two VH-Cys domains had become linked-through the
introduced cysteine residue.
EXAMPLE 10
Linking of VH Domain with Enzyme
[0247] Linking of enzyme activities to VH domains should be
possible by either cloning the enzyme on either the N-terminal or
the C-terminal side of the VH domain. Since both partners must be
active, it may be necessary to design a suitable linker (see
Example 8) between the two domains. For secretion of the VH-enzyme
fusion, it would be preferable to utilize an enzyme which is
usually secreted. In FIGS. 21a-21c, there is shown the sequence of
a fusion of a VH domain with alkaline phosphatase. The alkaline
phosphatase gene was cloned from a plasmid carrying the E. coli
alkaline phosphatase gene in a plasmid pEK48 [51] using the
polymerase chain reaction. The gene was amplified with the
primers
TABLE-US-00004 5'CAC CAC GGT CAC CGT CTC CTC ACG GAC ACC AGA AAT
GCC TGT TCT G 3' and 5' GCG AAA ATT CAC TCC CGG GCG CGG TTT TAT TTC
3'.
The gene was introduced into the vector pSW1 by cutting at BstEII
and SmaI. The construction (FIGS. 21a-21c) was expressed in E. coli
strain BMH71-18 as in Example 5 and screened for phosphatase
activity using 1 mg/ml p-nitrophenylphosphate as substrate in 10 mM
diethanolamine and 0.5 mM MgCl.sub.2, pH 9.5) and also on SDS
polyacrylamide gels which had been Western blotted (detecting with
anti-idiotypic antiserum). No evidence was found for the secretion
of the linked VHLYS-alkaline phosphatase as detected by Western
blots (see Example 5), or for secretion of phosphatase
activity.
[0248] However when the construct was transfected into a bacterial
strain BL21DE3 [52] which is deficient in proteases, a band of the
correct size (as well as degraded products) was detected on the
Western blots. Furthermore phosphatase activity could now be
detected in the bacterial supernatant. Such activity is not present
in supernatant from the strain which had not been transfected with
the construct.
[0249] A variety of linker sequences could then be introduced at
the BstEII site to improve the spacing between the two domains.
EXAMPLE 11
Coexpression of VH Domains with V.kappa. Repertoire
[0250] A repertoire of V.kappa. genes was derived by PCR using
primers as described in Example 2 from DNA prepared from mouse
spleen and also from mouse spleen mRNA using the primers VK3FOR and
VK2BACK and a cycle of 94.degree. C. for 1 min, 60.degree. C. for 1
min, 72.degree. C. for 2 min. The PCR amplified DNA was
fractionated on the agarose gel, the band excised and cloned into a
vector which carries the VHLYS domain (from the D 1.3 antibody),
and a cloning site (SacI and XhoI) for cloning of the light chain
variable domains with a myc tail (pSW1VHLYS-VKPOLYMYC, FIG.
22).
[0251] Clones were screened for lysozyme binding activities as
described in Examples 5 and 7 via the myc tag on the light chain
variable domain, as this should permit the following kinds of
V.kappa. domains to be identified:
[0252] (1) those which bind to lysozyme in the absence of the VHLYS
domain;
[0253] (2) those which associate with the heavy chain and make no
contribution to binding of lysozyme; and
[0254] (3) those which associate with the heavy chain and also
contribute to binding of lysozyme (either helping or
hindering).
[0255] This would not identify those V.kappa. domains which
associated with the VHLYS domain and completely abolished its
binding to lysozyme.
[0256] In a further experiment, the VHLYS domain was replaced by
the heavy chain variable domain VH3 which had been isolated from
the repertoire (see Example 6), and then the V.kappa. domains
cloned into the vector. (Note that the VH3 domain has an internal
SacI site and this was first removed to allow the cloning of the
V.kappa. repertoire as SacI-XhoI fragments.)
[0257] By screening the supernatant using the ELISA described in
Example 6, bacterial supernatants will be identified which bind
lysozyme.
EXAMPLE 12
High Expression of VH Domains
[0258] By screening several clones from a VH library derived from a
mouse immunized with lysozyme via a Western blot, using the 9E10
antibody directed against the peptide tag, one clone was noted with
very high levels of expression of the domain (estimated as 25-50
mg/l). The clone was sequenced to determine the nature of the
sequence. The sequence proved to be closely related to that of the
VHLYS domain, except with a few amino acid changes (FIG. 23). The
result was unexpected, and shows that a limited number of amino
acid changes, perhaps even a single amino acid substitution, can
cause greatly elevated levels of expression.
[0259] By making mutations of the high expressing domain at these
residues, it was found that a single amino acid change in the VHLYS
domain (Asn 35 to H is) is sufficient to cause the domain to be
expressed at high levels.
CONCLUSION
[0260] It can thus be seen that the present invention enables the
cloning, amplification and expression of heavy and light chain
variable domain encoding sequences in a much more simple manner
than was previously possible. It also shows that isolated variable
domains or such domains linked to effector molecules are
unexpectedly useful.
[0261] It will be appreciated that the present invention has been
described above by way of example only and that variations and
modifications may be made by the skilled person without departing
from the scope of the invention.
LIST OF REFERENCES
[0262] [1] Inbar et al., PNAS-USA, 69, 2659-2662, 1972. [0263] [2]
Amit et al., Science, 233, 747, 1986. [0264] [3] Satow et al., J.
Mol. Biol., 190, 593, 1986. [0265] [4] Colman et al., Nature, 326,
358, 1987. [0266] [5] Sheriff et al., PNAS-USA, 84, 8075-8079,
1987. [0267] [6] Padlan et al., PNAS-USA, 86, 5938-5942, 1989.
[0268] [7] Skerra and Pluckthun, Science, 240, 1038-1041, 1988.
[0269] [8] Bird et al., Science, 242, 423-426, 1988. [0270] [9]
Huston et al., PNAS-USA, 85, 5879-5833, 1988. [0271] [10]
Fleischman, Arch. Biochem. Biophys. Suppl., 1, 174, 1966. [0272]
[1,1] Porter and Weir, J. Cell. Physiol. Suppl., 1, 51, 1967.
[0273] [1,2] Jaton et al., Biochemistry, 7, 4185, 1968. [0274]
[1,3] Rockey, J. Exp. Med., 125, 249, 1967. [0275] [1,4] Stevenson,
Biochem. J., 133, 827-836, 1973. [0276] [15] Edmundson et al.,
Biochemistry, 14, 3953, 1975. [0277] [1,6] Rossman et al., Nature,
317, 145-153, 1985. [0278] [1,7] Saiki et al., Science, 230,
1350-1354, 1985. [0279] [1,8] Larrick et al., Biochem. Biophys.
Res. Comm., 160, 1250, 1989. [0280] [1,9] Orlandi et al., PNAS-USA,
86, 3833, 1989. [0281] [20] Yon and Fried, Nuc. Acids Res., 17,
4895, 1989. [0282] [21] Fields and Song, Nature, 340, 245-246,
1989. [0283] [22] Baldwin and Schultz, Science, 245, 1104-1107,
1989. [0284] [23] Menard et al., Cancer Res., 43, 1295-1300, 1983.
[0285] [24] Bosslet et al., Eur. J. Nuc. Med., 14, 523-528, 1988.
[0286] [25] Bosslet et al., Cancer Immunol. Immunother., 23,
185-191, 1986. [0287] [26] Bosslet et al., Int. J. Cancer, 36,
75-84, 1985. [0288] [27] [0289] [28] Bremer et al., J. Biol. Chem.,
259, 14773-14777, 1984. [0290] [29] Griffiths & Milstein,
Hybridoma Technology in the Biosciences and Medicine, 103-115,
1985. [0291] [30] Maniatis et al., Molecular Cloning: a Laboratory
Manual, Cold Spring Harbour Laboratory, 1982. [0292] [31] Jones et
al., Nature, 321, 522-525, 1986. [0293] [32] Zoller & Smith,
Nuc. Acids Res., 10, 6457-6500, 1982. [0294] [33] Carter et al.,
Nuc. Acids Res., 13, 4431-4443, 1985. [0295] [34] Sanger et al.,
PNAS-USA, 74, 5463-5467, 1977. [0296] [35] Yannisch-Perron et al.,
Gene, 33, 103-119, 1985. [0297] [36] [0298] [37] Riechmann et al.,
Nature, 332, 323-327, 1988. [0299] [38] Kearney et al., J.
Immunol., 123, 1548-1550, 1979. [0300] [39] Patter et al.,
PNAS-USA, 81, 7161-7163, 1984. [0301] [40] Galfre & Milstein,
Meth. Enzym., 73, 1-46, 1981. [0302] [41] Laemmli, Nature, 227,
680-685, 1970. [0303] [42] Better et al., Science, 240, 1041, 1988.
[0304] [43] Lei et al., J. Bacteriol., 169, 4379, 1987. [0305] [44]
Verhoeyen et al., Science, 239, 1534, 1988. [0306] [45] Gronenbom,
Mol. Gen. Genet, 148, 243, 1976. [0307] [46] Dagert et al., Gene,
6, 23, 1974. [0308] [47] Hanahan, J. Mol. Biol., 166, 557, 1983.
[0309] [48] Jones et al., Nature, 321, 522, 1986. [0310] [49]
Segal, Enzyme Kinetics, 73, Wiley, New York, 1975. [0311] [50]
Gutfreund, Enzymes, Physical Principles, Wiley Interscience,
London, 1972. [0312] [51] Chaidaroglou, Biochem., 27, 8338, 1988.
[0313] [52] Grodberg and Dunn, J. Bacteriol., 170, 1245-1253,
1988.
* * * * *