U.S. patent application number 11/521839 was filed with the patent office on 2008-12-04 for oncoprotein protein kinase antibody kit.
This patent application is currently assigned to THE REGENTS OF THE UNIVERSITY OF CALIFORNIA. Invention is credited to Masahiko Hibi, Michael Karin, Anning Lin.
Application Number | 20080299584 11/521839 |
Document ID | / |
Family ID | 27536710 |
Filed Date | 2008-12-04 |
United States Patent
Application |
20080299584 |
Kind Code |
A1 |
Karin; Michael ; et
al. |
December 4, 2008 |
ONCOPROTEIN PROTEIN KINASE ANTIBODY KIT
Abstract
An isolated polypeptide (JNK) characterized by having a
molecular weight of 46 kD as determined by reducing SDS-PAGE,
having serine and threonine kinase activity, phosphorylating the
c-Jun N-terminal activation domain and polynucleotide sequences and
method of detection of JNK are provided herein. JNK phosphorylates
c-Jun N-terminal activation domain which affects gene expression
from AP-1 sites.
Inventors: |
Karin; Michael; (San Diego,
CA) ; Hibi; Masahiko; (San Diego, CA) ; Lin;
Anning; (La Jolla, CA) |
Correspondence
Address: |
Lisa A. Haile, J.D., Ph.D.;DLA PIPER US LLP
Suite 1100, 4365 Executive Drive
San Diego
CA
92121-2133
US
|
Assignee: |
THE REGENTS OF THE UNIVERSITY OF
CALIFORNIA
|
Family ID: |
27536710 |
Appl. No.: |
11/521839 |
Filed: |
September 15, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11346709 |
Feb 3, 2006 |
|
|
|
11521839 |
|
|
|
|
10648823 |
Aug 25, 2003 |
|
|
|
11346709 |
|
|
|
|
10051989 |
Jan 16, 2002 |
6610505 |
|
|
10648823 |
|
|
|
|
09461649 |
Dec 14, 1999 |
6342595 |
|
|
10051989 |
|
|
|
|
09150201 |
Sep 8, 1998 |
6001584 |
|
|
09461649 |
|
|
|
|
08799913 |
Feb 13, 1997 |
5804399 |
|
|
09150201 |
|
|
|
|
08444393 |
May 19, 1995 |
5605808 |
|
|
08799913 |
|
|
|
|
08276860 |
Jul 18, 1994 |
5593884 |
|
|
08444393 |
|
|
|
|
08220602 |
Mar 25, 1994 |
6514745 |
|
|
08276860 |
|
|
|
|
08094533 |
Jul 19, 1993 |
5534426 |
|
|
08220602 |
|
|
|
|
Current U.S.
Class: |
435/7.4 ;
530/388.26 |
Current CPC
Class: |
G01N 2500/04 20130101;
C12Q 1/485 20130101; C12N 9/12 20130101; C07K 16/40 20130101; C12N
9/1205 20130101; A61K 38/00 20130101; C12Q 1/6897 20130101; Y10S
435/81 20130101; G01N 2333/9121 20130101; Y10S 435/975
20130101 |
Class at
Publication: |
435/7.4 ;
530/388.26 |
International
Class: |
G01N 33/573 20060101
G01N033/573; C07K 16/40 20060101 C07K016/40 |
Goverment Interests
[0002] This invention was made with support by Howard Hughes
Medical Institute and Government support under Grant No.
DE-86ER60429, awarded by the Department of Energy and Grant No.
CA-50528 and CA-58396, awarded by the National Institute of Health.
The Government has certain rights in this invention. Also supported
by the Howard Hughes Medical Institute.
Claims
1. A kit comprising: an antibody that binds to a protein a) having
a molecular weight of 46 kD or 55 kD as determined by reducing
SDS-PAGE; b) having serine and threonine kinase activity; c)
phosphorylating the c-Jun N-terminal activation domain; and d)
having an amino acid sequence of JNK1 or JNK2, respectively; and at
least one detectable label for detecting the antibody.
2. The kit of claim 1, wherein the antibody is polyclonal.
3. The kit of claim 1, wherein the antibody is monoclonal.
4. The kit of claim 1, wherein the c-Jun N-terminal activation
domain is set forth in SEQ ID NO:1.
5. The kit of claim 1, wherein the detectable label is a
biotin-binding protein.
6. The kit of claim 5, wherein the biotin-binding protein is avidin
or streptavidin.
7. The kit of claim 1, further comprising at least one buffer.
Description
[0001] This application is a continuation application of U.S.
application Ser. No. 11/346,709 filed Feb. 3, 2006, now pending;
which is a continuation application of Ser. No. 10/648,823, filed
Aug. 23, 2003, now pending; which is a continuation of U.S.
application Ser. No. 10/051,989, filed Jan. 16, 2002, now issued as
U.S. Pat. No. 6,610,505; which is a divisional of U.S. application
Ser. No. 09/461,649, filed Dec. 14, 1999, now issued as U.S. Pat.
No. 6,342,595; which is a continuation of U.S. application Ser. No.
09/150,201, filed Sep. 8, 1998, now issued as U.S. Pat. No.
6,001,584; which is a divisional of Ser. No. 08/799,913, filed Feb.
13, 1997, now issued as U.S. Pat. No. 5,804,399; which is a
continuation of U.S. application Ser. No. 08/444,393, filed May 19,
1995, now issued as U.S. Pat. No. 5,605,808, which is a divisional
of U.S. application Ser. No. 08/276,860, filed Jul. 18, 1994, now
issued as U.S. Pat. No. 5,593,884; which is a continuation-in-part
of U.S. application Ser. No. 08/220,602, filed Mar. 25, 1994, now
issued as U.S. Pat. No. 6,514,745, which is a continuation-in-part
of U.S. application Ser. No. 08/094,533, filed Jul. 19, 1993, now
issued as U.S. Pat. No. 5,534,426. The disclosure of each of the
prior applications is considered part of and is incorporated by
reference in the disclosure of this application.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] This invention relates generally to the field of protein
kinases, oncogenes and oncoproteins and, specifically, to a protein
kinase which binds, phosphorylates and potentiates the c-Jun
N-terminal activation domain.
[0005] 2. Description of Related Art
[0006] A number of viral and cellular genes have been identified as
potential cancer genes, collectively referred to as oncogenes. The
cellular homologs of viral oncogenes, the proto-oncogenes or
c-oncogenes, act in the control of cell growth and differentiation
or mediate intracellular signaling systems. The products of
oncogenes are classified according to their cellular location, for
example, secreted, surface, cytoplasmic, and nuclear
oncoproteins.
[0007] Proto-oncogenes which express proteins which are targeted to
the cell nucleus make up a small fraction of oncogenes. These
nuclear proto-oncoproteins typically act directly as
transactivators and regulators of RNA and DNA synthesis. Nuclear
oncogene products have the ability to induce alterations in gene
regulation leading to abnormal cell growth and ultimately
neoplasia. Examples of nuclear oncogenes include the myc, ski, myb,
fos and jun genes.
[0008] The c-Jun protein, encoded by the c-jun proto-oncogene, is
an important component of the dimeric, sequence specific,
transcriptional activator, AP-1. Like other transcriptional
activators, c-Jun contains two functional domains, including a DNA
binding domain and a transactivation domain. The DNA binding domain
is located at the C-terminus and is a BZip structure which consists
of conserved basic (B) and leucine zipper (Zip) domains that are
required for DNA binding and dimerization, respectively. The
N-terminus contains the transactivation domain. Although c-Jun
expression is rapidly induced by many extracellular signals, its
activity is also regulated post-translationally by protein
phosphorylation. Phosphorylation of sites clustered next to c-Jun's
DNA binding domain inhibits DNA binding (Boyle, et al., Cell,
64:573, 1991; Lin, et al., Cell, 70:777, 1992). Phosphorylation of
two other sites, Ser 63 and Ser 73, located within the
transactivation domain, potentiates c-Jun's ability to activate
transcription (Binetruy, et al., Nature 351:122, 1991; Smeal, et
al., Nature 354:494. 1991). Phosphorylation rates of these sites
are low in non-stimulated cells and are rapidly increased in
response to growth factors such as platelet derived growth factor
(PDGF) or v-S is, or expression of oncogenically activated Src, Ras
and Raf proteins. In myeloid and lymphoid cells, phosphorylation of
these sites is stimulated by the phorbol ester, TPA, but not in
fibroblasts and epithelial cells. These differences may be due to
different modes of Ha-ras regulation in lymphoid cells versus
fibroblasts.
[0009] Many proteins cooperate with each other in the activation of
transcription from specific promoters. Through this cooperation, a
gene can be transcribed and a protein product generated. Members of
the Fos proto-oncogene family, along with members of the Jun gene
family, form stable complexes which bind to DNA at an AP-1 site.
The AP-1 site is located in the promoter region of a large number
of genes. Binding of the Fos/Jun complex activates transcription of
a gene associated with an AP-1 site. In cells that have lost their
growth regulatory mechanisms, it is believed that this Fos/Jun
complex may "sit" on the AP-1 site, causing overexpression of a
particular gene. Since many proliferative disorders result from the
overexpression of an otherwise normal gene, such as a
proto-oncogene, it would be desirable to identify compositions
which interfere with the excessive activation of these genes.
[0010] For many years, various drugs have been tested for their
ability to alter the expression of genes or the translation of
their messages into protein products. One problem with existing
drug therapy is that it tends to act indiscriminately and affects
healthy cells as well as neoplastic cells. This is a major problem
with many forms of chemotherapy where there are severe side effects
primarily due to the action of toxic drugs on healthy cells.
[0011] In view of the foregoing, there is a need to identify
specific targets in the abnormal cell which are associated with the
overexpression of genes whose expression products are implicated in
cell proliferative disorders, in order to decrease potential
negative effects on healthy cells. The present invention provides
such a target.
SUMMARY OF THE INVENTION
[0012] The present invention provides a novel protein kinase (JNK)
which phosphorylates the c-Jun N-terminal activation domain. JNK1
is characterized by having a molecular weight of 46 kD (as
determined by reducing SDS-polyacrylamide gel electrophoresis
(PAGE)) and having serine and threonine kinase activity.
Specifically, JNK1 phosphorylates serine residues 63 and 73 of
c-Jun.
[0013] Since the product of the jun proto-oncogene is a
transactivator protein which binds at AP-1 sites, regulation of
c-Jun activation may be important in affecting normal gene
expression and growth control in a cell. The discovery of JNK
provides a means for identifying compositions which affect JNK
activity, thereby affecting c-Jun activation and subsequent
activation of genes associated with AP-1 sites.
[0014] The identification of JNK now allows the detection of the
level of specific kinase activity associated with activation of
c-Jun and AP-1. In addition, the invention provides a method of
treating a cell proliferative disorder associated with JNK by
administering to a subject with the disorder, a therapeutically
effective amount of a reagent which modulates JNK activity.
[0015] The invention also provides a synthetic peptide comprising
the JNK binding region on c-Jun which corresponds to amino acids
33-79. The peptide is useful as a competitive inhibitor of the
naturally occurring c-Jun in situations where it is desirable to
decrease the amount of c-Jun activation by JNK.
[0016] The invention also describes JNK2, a novel protein kinase
with activity similar to JNK1 and having a molecular weight of 55
kD.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 shows an SDS-PAGE of nuclear and cytosolic extracts
from FR3T3 (-) and Ha-ras-transformed FR3T3 (+) cells after
incubation with .sup.32P-ATP and GST-cJun (wt). GSTcJun(Ala63/73)
or GST.
[0018] FIG. 2 shows an SDS-PAGE of A) HeLaS3 cells either untreated
or irradiated with UV light and B) Jurkat cells either untreated or
incubated with TPA. Cell extracts were incubated with .sup.32P-ATP
and GST-cJun (wt). GSTcJun-(Ala63/73) or GST.
[0019] FIG. 3 shows phosphopeptide mapping of GST-cJun and c-Jun
phosphorylated by JNK. 3(A) shows maps of GSTcJun and (B) shows
maps of c-Jun.
[0020] FIG. 4 A shows an SDS-PAGE of phosphorylated proteins after
elution of JNK from GSTc-Jun after washes of NaCl, Urea,
Guanidine-HCl(GuHCl) or SDS.
[0021] FIG. 4B shows an SDS-PAGE of phosphorylated c-Jun after
GSTcJun(wt) was covalently linked to GSH-beads and incubated with
whole cell extract of TPA-stimulated Jurkat cells.
[0022] FIG. 5 shows an in-gel kinase assay. GSTcJun-GSH agarose
beads were incubated with cell extracts from A) TPA-stimulated
Jurkat cells on SDS gels that were polymerized in the absence (-)
or presence (+) of GSTcJun (wt); B) extracts of unstimulated or UV
stimulated HeLa cells and unstimulated or TPA-stimulated Jurkat
cells; and C) extracts from cells of logarithmically growing K562
and Ha-ras-transformed FR3T3, TPA-stimulated Jurkat and U937 cells
and UV-irradiated HeLa, F9 and QT6 cells.
[0023] FIG. 6A is a protein gel of various GST c-Jun fusion
proteins; FIG. 6B shows an SDS-PAGE of whole cell extracts of
UV-irradiated Hela S3 cells after passage over GSH-beads containing
the GST fusion proteins as shown in FIG. 6A; FIG. 6C shows an
SDS-PAGE of phosphorylated GSTcJun fusion proteins eluted with
1MNaCl from GSH-agarose beads.
[0024] FIG. 7A shows patterns of GST, GSTcJun and GSTvJun as
expressed in E. coli, FIG. 7B shows the phosphorylated proteins of
7A from extracts of TPA-activated Jurkat cells incubated with
GSH-beads; FIG. 7C shows cJun protein after phosphorylation with
protein bound to GSTcJun and GSTvJun beads.
[0025] FIG. 8 shows CAT activity in cells containing various
portions of the c-Jun activation domain (cJ=AA1-223; 33=AA33-223;
43=AA43-223; 56=AA56-223; A63,73=AA1-246(Ala63/73)) and a CAT
reporter in the absence or presence of A) Ha-ras or B) UV
treatment.
[0026] FIG. 9 shows SDS-PAGE analyses of .sup.32P and .sup.35S
labelled F9 cells transfected with v-Jun and c-Jun in the absence
or presence of A) Ha-ras or B) UV exposure.
[0027] FIG. 10 shows the nucleotide and deduced amino acid sequence
of c-Jun. The arrows represent amino acid residues 33-79.
[0028] FIG. 11A shows a Northern blot of total cytoplasmic RNA from
Jurkat cells. Cells were incubated with 50 ng/ml TPA (T), 1
.mu.g/ml A23187 (A) or 100 ng/ml cydosporin A (CsA) for 40 minutes,
either alone or in combination, as indicated. Levels of c-jun,
jun-B, jun-D, c-fos and .alpha.-tubulin expression were determined
by hybridization to random primed cDNA probes.
[0029] FIG. 11B shows Jurkat cells after incubation with soluble
anti-CD3 (OKT3), 2 .mu.g/ml soluble anti-CD28 (9.3) or a
combination of 50 ng/ml TPA and 1 .mu.g/ml A23817 (T/A) as
indicated for 40 minutes. Total cytoplasmic RNA was isolated and 10
.mu.g samples were analyzed using c-jun, jun-D and c-fos probes.
IL-2 induction by the same treatments was measured after 6 hours of
stimulation by blot hybridization using IL-2 and .alpha.-tubulin
specific probes.
[0030] FIG. 11C shows Jurkat cells transfected with 10 .mu.g of
either -73Col-LUC or -60Col-LUC reporter plasmids. 24 hours after
transfection, the cells were aliquoted into 24 well plates and
incubated for 9 hours with 50 ng/ml TPA, 1 .mu.g/ml A23187 or 100
ng/ml CsA, either alone or in combination, as indicated. The cells
were harvested and luciferase activity was determined. The results
shown are averages of three experiments done in triplicates.
[0031] FIG. 12A shows Jurkat cells (10.sup.6 cells per lane)
transfected with 0.5 .mu.g of a SR.alpha.-cJun expression vector
and 24 hours later were labeled for 3 hours with
.sup.32P-orthophosphate (1 mCi/ml). After 15 minutes, treatment
with 50 ng/ml TPA (T), 1 .mu.g/ml A23187 (A) and 100 ng/ml CsA,
either alone or in combination, as indicated, the cells were lysed
in RIPA buffer and c-Jun was isolated by immunoprecipitation and
analyzed by SDS-PAGE. The c-Jun bands are indicated.
[0032] FIG. 12B shows 2.times.10.sup.7 Jurkat cells labeled for 3
hours with either .sup.35S-methionine (900 .mu.Ci/ml) or
.sup.32P-orthophosphate (1 mCi/ml). After 15 minutes incubation
with 50 ng/ml TPA+1 .mu.g/ml A23178 (T/A) in the absence or
presence of and 100 ng/ml CsA or no addition, as indicated, the
cells were lysed in RIPA buffer and c-Jun isolated by
immunoprecipitation and analyzed by SDS-PAGE. The c-Jun band is
indicated.
[0033] FIG. 12C shows all of the c-Jun specific protein bands shown
in FIG. 12A isolated from equal numbers of cells excised from the
gel and subjected to tryptic phosphopeptide mapping. Shown is a
typical result (this experiment was repeated at least three times).
N-nonstimulated cells; T-cells treated with 50 ng/ml TPA; T/A:
cells treated with 50 ng/ml TPA and 1 .mu.g/ml A23187; T/A+CsA:
cells treated with T/A and 100 ng/ml CsA. a, b, c, x and y
correspond to the various tryptic phosphopeptides of c-Jun,
previously described by Boyle, et al., (Cell, 64:573-584, 1991) and
Smeal, et al., (Nature, 354:494-496, 1991). T1 and T2 correspond to
the minor phosphorylation sites; Thr91, 93 and 95 (Hibi, et al.,
Genes & Dev., 7:000, 1993).
[0034] FIG. 13A shows whole cell extracts (WCE) of Jurkat cells
incubated with TPA (T, 50 ng/ml), A23187 (A, 1 .mu.g/ml) or CsA
(100 ng/ml) for 15 minutes, alone or in combination, and separated
by SDS-PAGE (100 .mu.g protein/lane) on gels that were cast in the
absence or presence of GST-cJun (1-223). The gels were subjected to
renaturation protocol and incubated in kinase buffer, containing
.gamma.-.sup.32P-ATP. The protein bands corresponding to the 55 kD
and 46 kD forms of JNK are indicated.
[0035] FIG. 13B shows WCE (50 .mu.g) of Jurkat cells treated as
described above were incubated with 5 .mu.l of GSH agarose beads
coated with 10 .mu.g GST-cJun (1-223) for 12 hours at 4.degree. C.
After extensive washing, the beads were incubated in kinase buffer
containing .gamma.-.sup.32P-ATP for 20 minutes at 30.degree. C.,
after which the proteins were dissociated by incubation in SDS
sample buffer and separated by SDS-PAGE. The 49 kD band corresponds
to GST-cJun (1-223).
[0036] FIG. 13C shows WCE (200 .mu.g) of Jurkat cells treated as
described in FIG. 13A and incubated with GST-cJun(1-223)-GSH
agarose beads. The bound fraction was eluted in SDS sample buffer
and separated by SDS-PAGE on a gel containing GST-cJun(1-223). The
gel was renatured and incubated in kinase buffer containing
.gamma.-.sup.32P-ATP to label the JNK polypeptides.
[0037] FIG. 14 shows a phosphorylation assay of cultures of FR3T3,
CV-1, PC12 and mouse thymocytes were incubated for 15 minutes in
the presence of TPA (50 ng/ml, T). A23817 (1 .mu.g/ml, A) and/or
CsA (100 ng/ml), as indicated. WCE prepared from 2-4.times.10.sup.5
cells for the established cell lines and 1.5.times.10.sup.6 cells
for primary thymocytes were incubated with GSTcJun(1-223)-GSH
agarose beads. After washing, JNK activity was determined by
solid-state phosphorylation assay.
[0038] FIG. 15 shows WCE (5 .mu.g) of Jurkat (panel A) or mouse
thymocytes (panel C) incubated with 1 .mu.g of kinase-defective
ERK1 in kinase buffer containing .gamma.-.sup.32P-ATP for 20
minutes. The phosphorylated proteins were separated by SDS-PAGE and
the band corresponding to the mutant ERK1 is indicated. WCE (20
.mu.g) of Jurkat (panel A) or mouse thymocytes (panel C) that were
treated as described above were immunoprecipitated with anti-ERK
antibodies. The immune complexes were washed and incubated in
kinase buffer containing .gamma.-.sup.32P-ATP and 2 .mu.g MBP for
15 minutes at 30.degree. C. The phosphorylated proteins were
separated by SDS-PAGE. The band corresponding to phosphorylated MBP
is indicated in panels B and D.
[0039] FIG. 16A shows Jurkat cells (1.times.10.sup.7) incubated for
15 minutes with either normal mouse serum, 1 .mu.g/ml anti-CD3
and/or 2 .mu.g/ml anti-CD28, in the absence or presence of 100
ng/ml CsA, as indicated. WCE were prepared and 100 .mu.g samples
were analyzed for JNK activation using an in-gel kinase assay.
[0040] FIG. 16B shows WCE (50 .mu.g) of Jurkat cells treated as
described for FIG. 16A incubated with GSTcJun(1-223)-GSH agarose
beads and assayed for JNK activity using the solid-state kinase
assay. The same WCE (20 .mu.g) were immunoprecipitated with
anti-ERK2 antibodies and assayed for MBP-kinase activity.
[0041] FIG. 16C shows WCE (50 .mu.g) of Jurkat cells treated as
described in FIG. 16A with various stimuli alone or their
combinations were incubated with GSTcJun(1-223)-GSH agarose beads
and assayed for JNK activity using solid-state kinase assay. The
same samples (20 .mu.g) were also assayed for MBP-kinase activity
as described in FIG. 16B.
[0042] FIG. 17A shows Jurkat cells (2.times.10.sup.6 cells per
point) labeled with 0.4 mCi of .sup.32P-orthophosphate for 3 hours
and incubated with nonspecific antibody (1 .mu.g/ml mouse IgG;
control), 1 .mu.g/ml anti-CD3, 2 .mu.g/ml anti-CD28, 10 ng/ml TPA
or 500 ng/ml A23187 (A), as indicated. After 2 minutes, the cells
were harvested, lysed and Ha-Ras was isolated by
immunoprecipitation. The guanine nucleotide bound to Ha-Ras was
extracted, separated by thin layer chromatography and quantitiated.
The values shown represent the averages of two separate experiments
done in duplicates.
[0043] FIG. 17B shows Jurkat cells labeled with
.sup.32P-orthophosphate and stimulated with either TPA or anti-CD3.
At the indicated time points, the cells were harvested and the GTP
content of Ha-Ras was determined.
DETAILED DESCRIPTION OF THE INVENTION
[0044] The present invention provides a novel protein kinase (JNK)
which binds to a well-defined region of the c-Jun proto-oncoprotein
and phosphorylates two sites within its activation domain. The
phosphorylation of these sites increases the ability of c-Jun to
stimulate transcription and mediate oncogenic transformation.
[0045] The activity of c-Jun is regulated by phosphorylation.
Various stimuli, including transforming oncogenes and UV light,
induce the phosphorylation of serines 63 and 73 in c-Jun's
N-terminal activation domain, thereby potentiating its
transactivation function. The invention relates to an isolated
polypeptide characterized by having a molecular weight of 46 kD as
determined by reducing SDS-PAGE, having serine and threonine kinase
activity and capable of phosphorylating the c-Jun N-terminal
activation domain. This protein is referred to JNK1. In addition, a
second JNK protein (55 kD) referred to as JNK2, is described.
[0046] The term "isolated" means any JNK polypeptide of the present
invention, or any gene encoding a JNK polypeptide, which is
essentially free of other polypeptides or genes; respectively, or
of other contaminants with which the JNK polypeptide or gene might
normally be found in nature.
[0047] The invention includes a functional polypeptide, JNK, and
functional fragments thereof. As used herein, the term "functional
polypeptide" refers to a polypeptide which possesses a biological
function or activity which is identified through a defined
functional assay and which is associated with a particular
biologic, morphologic, or phenotypic alteration in the cell. The
biological function, for example, can vary from a polypeptide
fragment as small as an epitope to which an antibody molecule can
bind to a large polypeptide which is capable of participating in
the characteristic induction or programming of phenotypic changes
within a cell. An enzymatically functional polypeptide or fragment
of JNK possesses c-Jun N-terminal activation domain kinase
activity. A "functional polynucleotide" denotes a polynucleotide
which encodes a functional polypeptide as described herein.
[0048] Minor modifications of the JNK primary amino acid sequence
may result in proteins which have substantially equivalent activity
as compared to the JNK polypeptide described herein. Such
modifications may be deliberate, as by site-directed mutagenesis,
or may be spontaneous. All of the polypeptides produced by these
modifications are included herein as long as the kinase activity of
JNK is present. Further, deletion of one or more amino acids can
also result in a modification of the structure of the resultant
molecule without significantly altering its kinase activity. This
can lead to the development of a smaller active molecule which
would have broader utility. For example, it is possible to remove
amino or carboxy terminal amino acids which may not be required for
JNK kinase activity.
[0049] The JNK polypeptide of the invention also includes
conservative variations of the polypeptide sequence. The term
"conservative variation" as used herein denotes the replacement of
an amino acid residue by another, biologically similar residue.
Examples of conservative variations include the substitution of one
hydrophobic residue such as isoleucine, valine, leucine or
methionine for another, or the substitution of one polar residue
for another, such as the substitution of arginine for lysine,
glutamic for aspartic acids, or glutamine for asparagine, and the
like. The term "conservative variation" also includes the use of a
substituted amino acid in place of an unsubstituted parent amino
acid provided that antibodies raised to the substituted polypeptide
also immuno-react with the unsubstituted polypeptide.
[0050] The invention also provides a synthetic peptide which binds
to the c-Jun N-terminal kinase, JNK. The amino acid sequence of SEQ
ID NO: 1, and conservative variations, comprises the synthetic
peptide of the invention. This sequence represents amino acids
33-79 of c-Jun polypeptide (Angel, et al., Nature, 332(6160):166,
1988) As used herein, the term "synthetic peptide" denotes a
peptide which does not comprise an entire naturally occurring
protein molecule. The peptide is "synthetic" in that it may be
produced by human intervention using such techniques as chemical
synthesis, recombinant genetic techniques, or fragmentation of
whole antigen or the like.
[0051] Peptides of the invention can be synthesized by such
commonly used methods as t-BOC or FMOC protection of alpha-amino
groups. Both methods involve stepwise syntheses whereby a single
amino acid is added at each step starting from the C terminus of
the peptide (See, Coligan, et al., Current Protocols in Immunology,
Wiley Interscience, 1991, Unit 9). Peptides of the invention can
also be synthesized by the well known solid phase peptide synthesis
methods described Merrifield, J. Am. Chem. Soc., 85:2149, 1962).
and Stewart and Young, Solid Phase Peptides Synthesis, (Freeman,
San Francisco, 1969, pp. 27-62), using a
copoly(styrene-divinylbenzene) containing 0.1-1.0 mMol amines/g
polymer. On completion of chemical synthesis, the peptides can be
deprotected and cleaved from the polymer by treatment with liquid
HF-10% anisole for about 1/4-1 hours at 0.degree. C. After
evaporation of the reagents, the peptides are extracted from the
polymer with 1% acetic acid solution which is then lyophilized to
yield the crude material. This can normally be purified by such
techniques as gel filtration on Sephadex G-15 using 5% acetic acid
as a solvent. Lyophilization of appropriate fractions of the column
will yield the homogeneous peptide or peptide derivatives, which
can then be characterized by such standard techniques as amino acid
analysis, thin layer chromatography, high performance liquid
chromatography, ultraviolet absorption spectroscopy, molar
rotation, solubility, and quantitated by the solid phase Edman
degradation.
[0052] The invention also provides polynucleotides which encode the
JNK polypeptide of the invention and the synthetic peptide of SEQ
ID NO: 1. As used herein, "polynucleotide" refers to a polymer of
deoxyribonucleotides or ribonucleotides, in the form of a separate
fragment or as a component of a larger construct. DNA encoding the
polypeptide of the invention can be assembled from cDNA fragments
or from oligonucleotides which provide a synthetic gene which is
capable of being expressed in a recombinant transcriptional unit.
Polynucleotide sequences of the invention include DNA, RNA and cDNA
sequences.
[0053] DNA sequences of the invention can be obtained by several
methods. For example, the DNA can be isolated using hybridization
procedures which are well known in the art. These include, but are
not limited to: 1) hybridization of probes to genomic or cDNA
libraries to detect shared nucleotide sequences; 2) antibody
screening of expression libraries to detect shared structural
features and 3) synthesis by the polymerase chain reaction
(PCR).
[0054] Hybridization procedures are useful for the screening of
recombinant clones by using labeled mixed synthetic oligonucleotide
probes where each probe is potentially the complete complement of a
specific DNA sequence in the hybridization sample which includes a
heterogeneous mixture of denatured double-stranded DNA. For such
screening, hybridization is preferably performed on either
single-stranded DNA or denatured double-stranded DNA. Hybridization
is particularly useful in the detection of cDNA clones derived from
sources where an extremely low amount of mRNA sequences relating to
the polypeptide of interest are present. In other words, by using
stringent hybridization conditions directed to avoid non-specific
binding, it is possible, for example, to allow the autoradiographic
visualization of a specific cDNA clone by the hybridization of the
target DNA to that single probe in the mixture which is its
complete complement (Wallace, et al., Nucleic Acid Research, 9:879,
1981).
[0055] The development of specific DNA sequences encoding JNK can
also be obtained by: 1) isolation of double-stranded DNA sequences
from the genomic DNA; 2) chemical manufacture of a DNA sequence to
provide the necessary codons for the polypeptide of interest; and
3) in vitro synthesis of a double-stranded DNA sequence by reverse
transcription of mRNA isolated from a eukaryotic donor cell. In the
latter case, a double-stranded DNA complement of mRNA is eventually
formed which is generally referred to as cDNA. Of these three
methods for developing specific DNA sequences for use in
recombinant procedures, the isolation of genomic DNA isolates is
the least common. This is especially true when it is desirable to
obtain the microbial expression of mammalian polypeptides due to
the presence of introns.
[0056] The synthesis of DNA sequences is frequently the method of
choice when the entire sequence of amino acid residues of the
desired polypeptide product is known. When the entire sequence of
amino acid residues of the desired polypeptide is not known, the
direct synthesis of DNA sequences is not possible and the method of
choice is the synthesis of cDNA sequences. Among the standard
procedures for isolating cDNA sequences of interest is the
formation of plasmid- or phage-carrying cDNA libraries which are
derived from reverse transcription of mRNA which is abundant in
donor cells that have a high level of genetic expression. When used
in combination with polymerase chain reaction technology, even rare
expression products can be cloned. In those cases where significant
portions of the amino acid sequence of the polypeptide are known,
the production of labeled single or double-stranded DNA or RNA
probe sequences duplicating a sequence putatively present in the
target cDNA may be employed in DNA/DNA hybridization procedures
which are carried out on cloned copies of the cDNA which have been
denatured into a single-stranded form (Jay et al., Nucl. Acid Res.
11:2325, 1983).
[0057] A cDNA expression library, such as lambda gt11, can be
screened indirectly for JNK polypeptide having at least one
epitope, using antibodies specific for JNK. Such antibodies can be
either polyclonally or monoclonally derived and used to detect
expression product indicative of the presence of JNK cDNA.
[0058] A polynucleotide sequence can be deduced from the genetic
code, however, the degeneracy of the code must be taken into
account. Polynucleotides of the invention include sequences which
are degenerate as a result of the genetic code. The polynucleotides
of the invention include sequences that are degenerate as a result
of the genetic code. There are 20 natural amino acids, most of
which are specified by more than one codon. Therefore, as long as
the amino acid sequence of JNK results in a functional polypeptide
(at least, in the case of the sense polynucleotide strand), all
degenerate nucleotide sequences are included in the invention.
[0059] The polynucleotide sequence for JNK also includes sequences
complementary to the polynucleotide encoding JNK (antisense
sequences). Antisense nucleic acids are DNA or RNA molecules that
are complementary to at least a portion of a specific mRNA molecule
(Weintraub, Scientific American, 262:40, 1990). The invention
embraces all antisense polynucleotides capable of inhibiting
production of JNK polypeptide. In the cell, the antisense nucleic
acids hybridize to the corresponding mRNA, forming a
double-stranded molecule. The antisense nucleic acids interfere
with the translation of the mRNA since the cell will not translate
a mRNA that is double-stranded. Antisense oligomers of about 15
nucleotides are preferred, since they are easily synthesized and
are less likely to cause problems than larger molecules when
introduced into the target JNK-producing cell. The use of antisense
methods to inhibit the translation of genes is well known in the
art (Marcus-Sakura, Anal. Biochem., 172:289, 1988).
[0060] In addition, ribozyme nucleotide sequences for JNK are
included in the invention. Ribozymes are RNA molecules possessing
the ability to specifically cleave other single-stranded RNA in a
manner analogous to DNA restriction endonucleases. Through the
modification of nucleotide sequences which encode these RNAs, it is
possible to engineer molecules that recognize specific nucleotide
sequences in an RNA molecule and cleave it (Cech, J. Amer. Med.
Assn., 260:3030, 1988). A major advantage of this approach is that,
because they are sequence-specific, only mRNAs with particular
sequences are inactivated.
[0061] There are two basic types of ribozymes namely,
tetrahymena-type (Hasselhoff, Nature, 334:585, 1988) and
"hammerhead"-type. Tetrahymena-type ribozymes recognize sequences
which are four bases in length, while "hammerhead"-type ribozymes
recognize base sequences 11-18 bases in length. The longer the
recognition sequence, the greater the likelihood that that sequence
will occur exclusively in the target mRNA species. Consequently,
hammerhead-type ribozymes are preferable to tetrahymena-type
ribozymes for inactivating, a specific mRNA species and 18-based
recognition sequences are preferable to shorter recognition
sequences.
[0062] The JNK polypeptides of the invention can also be used to
produce antibodies which are immunoreactive or bind to epitopes of
the JNK polypeptides. Antibodies of the invention also include
antibodies which bind to the synthetic peptide in SEQ ID NO: 1.
Antibody which consists essentially of pooled monoclonal antibodies
with different epitopic specificities, as well as distinct
monoclonal antibody preparations are provided. Monoclonal
antibodies are made from antigen containing fragments of the
protein by methods well known in the art (Kohler, et al., Nature,
256:495, 1975; Current Protocols in Molecular Biology, Ausubel, et
al, ed., 1989).
[0063] The term "antibody" as used in this invention includes
intact molecules as well as fragments thereof, such as Fab,
F(ab').sub.2, and Fv which are capable of binding the epitopic
determinant. These antibody fragments retain some ability to
selectively bind with its antigen or receptor and are defined as
follows: [0064] (1) Fab, the fragment which contains a monovalent
antigen-binding fragment of an antibody molecule can be produced by
digestion of whole antibody with the enzyme papain to yield an
intact light chain and a portion of one heavy chain; [0065] (2)
Fab', the fragment of an antibody molecule can be obtained by
treating whole antibody with pepsin, followed by reduction, to
yield an intact light chain and a portion of the heavy chain; two
Fab' fragments are obtained per antibody molecule; [0066] (3)
(Fab').sub.2, the fragment of the antibody that can be obtained by
treating whole antibody with the enzyme pepsin without subsequent
reduction; F(ab').sub.2 is a dimer of two Fab' fragments held
together by two disulfide bonds; [0067] (4) Fv, defined as a
genetically engineered fragment containing the variable region of
the light chain and the variable region of the heavy chain
expressed as two chains; and [0068] (5) Single chain antibody
("SCA"), defined as a genetically engineered molecule containing
the variable region of the light chain, the variable region of the
heavy chain, linked by a suitable polypeptide linker as a
genetically fused single chain molecule.
[0069] Methods of making these fragments are known in the art. (See
for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratory, New York (1988), incorporated herein by
reference).
[0070] As used in this invention, the term "epitope" means any
antigenic determinant on an antigen to which the paratope of an
antibody binds. Epitopic determinants usually consist of chemically
active surface groupings of molecules such as amino acids or sugar
side chains and usually have specific three dimensional structural
characteristics, as well as specific charge characteristics.
[0071] Antibodies which bind to the JNK polypeptide of the
invention can be prepared using an intact polypeptide or fragments
containing small peptides of interest as the immunizing antigen.
The polypeptide or a peptide such as Sequence ID No.1 used to
immunize an animal can be derived from translated cDNA or chemical
synthesis which can be conjugated to a carrier protein, if desired.
Such commonly used carriers which are chemically coupled to the
peptide include keyhole limpet hemocyanin (KLH), thyroglobulin,
bovine serum albumin (BSA), and tetanus toxoid. The coupled peptide
is then used to immunize the animal (e.g., a mouse, a rat, or a
rabbit).
[0072] If desired, polyclonal or monoclonal antibodies can be
further purified, for example, by binding to and elution from a
matrix to which the polypeptide or a peptide to which the
antibodies were raised is bound. Those of skill in the art will
know of various techniques common in the immunology arts for
purification and/or concentration of polyclonal antibodies, as well
as monoclonal antibodies (See for example, Coligan, et al., Unit 9,
Current Protocols in Immunology, Wiley Interscience, 1991,
incorporated by reference).
[0073] It is also possible to use the anti-idiotype technology to
produce monoclonal antibodies which mimic an epitope. For example,
an anti-idiotypic monoclonal antibody made to a first monoclonal
antibody will have a binding domain in the hypervariable region
which is the "image" of the epitope bound by the first monoclonal
antibody. Thus, in the present invention, an anti-idiotype antibody
produced from an antibody which binds to the synthetic peptide of
the invention can bind to the site on JNK which binds to c-Jun,
thereby preventing JNK from binding to and phosphorylating
c-Jun.
[0074] Polynucleotide sequences encoding the polypeptide or the
synthetic peptide (SEQ ID NO: 1) of the invention can be expressed
in either prokaryotes or eukaryotes. Hosts can include microbial,
yeast, insect and mammalian organisms. Methods of expressing DNA
sequences having eukaryotic or viral sequences in prokaryotes are
well known in the art. Biologically functional viral and plasmid
DNA vectors capable of expression and replication in a host are
known in the art. Such vectors are used to incorporate DNA
sequences of the invention.
[0075] DNA sequences encoding the polypeptides can be expressed in
vitro by DNA transfer into a suitable host cell. "Host cells" are
cells in which a vector can be propagated and its DNA expressed.
The term also includes any progeny of the subject host cell. It is
understood that all progeny may not be identical to the parental
cell since there may be mutations that occur during replication.
However, such progeny are included when the term "host cell" is
used. Methods of stable transfer, in other words when the foreign
DNA is continuously maintained in the host, are known in the
art
[0076] In the present invention, the JNK polynucleotide sequences
may be inserted into a recombinant expression vector. The term
"recombinant expression vector" refers to a plasmid, virus or other
vehicle known in the art that has been manipulated by insertion or
incorporation of the genetic sequences. Such expression vectors
contain a promoter sequence which facilitates the efficient
transcription of the inserted genetic sequence of the host. The
expression vector typically contains an origin of replication, a
promoter, as well as specific genes which allow phenotypic
selection of the transformed cells. Vectors suitable for use in the
present invention include, but are not limited to the T7-based
expression vector for expression in bacteria (Rosenberg et al.,
Gene 56:125, 1987), the pMSXND expression vector for expression in
mammalian cells (Lee and Nathans, J. Biol. Chem. 263:3521. 1988)
and baculovirus-derived vectors for expression in insect cells. The
DNA segment can be present in the vector operably linked to
regulatory elements, for example, a promoter (e.g., T7,
metallothionein I, or polyhedrin promoters).
[0077] The vector may include a phenotypically selectable marker to
identify host cells which contain the expression vector. Examples
of markers typically used in prokaryotic expression vectors include
antibiotic resistance genes for ampicillin (.beta.-lactamases),
tetracycline and chloramphenicol (chloramphenicol
acetyl-transferase). Examples of such markers typically used in
mammalian expression vectors include the gene for adenosine
deaminase (ADA), aminoglycoside phosphotransferase (neo, G418),
dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase
(HPH), thymidine kinase (TK), and xanthine guanine
phosphoribosyltransferase (XGPRT, gpt).
[0078] Transformation of a host cell with recombinant DNA may be
carried out by conventional techniques which are well known to
those skilled in the art. Where the host is prokaryotic, such as E.
coli, competent cells which are capable of DNA uptake can be
prepared from cells harvested after exponential growth phase and
subsequently treated by the CaCl.sub.2 method by procedures well
known in the art. Alternatively, MgCl.sub.2 or RbCl can be used.
Transformation can also be performed after forming a protoplast of
the host cell or by electroporation.
[0079] When the host is a eukaryote, such methods of transfection
of DNA as calcium phosphate co-precipitates, conventional
mechanical procedures such as microinjection, electroporation,
insertion of a plasmid encased in liposomes, or virus vectors may
be used. Eukaryotic cells can also be cotransformed with DNA
sequences encoding the polypeptides of the invention, and a second
foreign DNA molecule encoding a selectable phenotype, such as the
herpes simplex thymidine kinase gene. Another method is to use a
eukaryotic viral vector, such as simian virus 40 (SV40) or bovine
papilloma virus, to transiently infect or transform eukaryotic
cells and express the protein. (Eukaryotic Viral Vectors, Gold
Spring Harbor Laboratory, Gluzman ed., 1982). Examples of mammalian
host cells include COS, BHK, 293, and CHO cells.
[0080] Isolation and purification of host cell expressed
polypeptide, or fragments thereof, provided by the invention, may
be carried out by conventional means including preparative
chromatography and immunological separations involving monoclonal
or polyclonal antibodies.
[0081] The JNK protein kinase of the invention is useful in a
screening method for identifying compounds or compositions which
affect the activity of the kinase. Thus, in another embodiment, the
invention provides a method for identifying a composition which
affects a c-Jun N-terminal kinase comprising incubating the
components, which include the composition to be tested and the
kinase or a polynucleotide encoding the kinase, under conditions
sufficient to allow the components to interact, then subsequently
measuring the effect the composition has on kinase activity or on
the polynucleotide encoding the kinase. The observed effect on the
kinase may be either inhibitory or stimulatory. For example, the
increase or decrease of kinase activity can be measured by adding a
radioactive compound to the mixture of components, such as
.sup.32P-ATP, and observing radioactive incorporation into c-Jun or
other suitable substrate for JNK, to determine whether the compound
inhibits or stimulates protein kinase activity. A polynucleotide
encoding the kinase may be inserted into an expression vector and
the effect of a composition on transcription of the kinase can be
measured, for example, by Northern blot analysis.
[0082] In another embodiment, the invention provides a method of
treating a cell proliferative disorder associated with JNK
comprising administering to a subject with the disorder a
therapeutically effective amount of reagent which modulates kinase
activity. The term "therapeutically effective" means that the
amount of monoclonal antibody or antisense nucleotide, for example,
which is used, is of sufficient quantity to ameliorate the JNK
associated disorder. The term "cell-proliferative disorder" denotes
malignant as well as non-malignant cell populations which
morphologically often appear to differ from the surrounding tissue.
For example, the method may be useful in treating malignancies of
the various organ systems, such as lung, breast, lymphoid,
gastrointestinal, and genito-urinary tract as well as
adenocarcinomas which include malignancies such as most colon
cancers, renal-cell carcinoma, prostate cancer, non-small cell
carcinoma of the lung, cancer of the small intestine and cancer of
the esophagus.
[0083] The method is also useful in treating non-malignant or
immunological-related cell-proliferative diseases such as
psoriasis, pemphigus vulgaris, Behcet's syndrome, acute respiratory
distress syndrome (ARDS), ischemic heart disease, post-dialysis
syndrome, leukemia, rheumatoid arthritis, acquired immune
deficiency syndrome, vasculitis, septic shock and other types of
acute inflammation, and lipid histiocytosis. Especially preferred
are immunopathological disorders. Essentially, any disorder which
is etiologically linked to JNK kinase activity would be considered
susceptible to treatment.
[0084] Treatment includes administration of a reagent which
modulates JNK kinase activity. The term "modulate" envisions the
suppression of expression of JNK when it is over-expressed, or
augmentation of JNK expression when it is under-expressed. It also
envisions suppression of phosphorylation of c-Jun, for example, by
using the peptide of SEQ ID NO:1 as a competitive inhibitor of the
natural c-Jun binding site in a cell. When a cell proliferative
disorder is associated with JNK overexpression, such suppressive
reagents as antisense JNK polynucleotide sequence or JNK binding
antibody can be introduced to a cell. In addition, an anti-idiotype
antibody which binds to a monoclonal antibody which binds a peptide
of the invention may also be used in the therapeutic method of the
invention. Alternatively, when a cell proliferative disorder is
associated with underexpression or expression of a mutant JNK
polypeptide, a sense polynucleotide sequence (the DNA coding
strand) or JNK polypeptide can be introduced into the cell.
[0085] The antibodies of the invention can be administered
parenterally by injection or by gradual infusion over time. The
monoclonal antibodies of the invention can be administered
intravenously, intraperitoneally, intramuscularly, subcutaneously,
intracavity, or transdermally.
[0086] Preparations for parenteral administration of a peptide or
an antibody of the invention include sterile aqueous or non-aqueous
solutions, suspensions, and emulsions. Examples of non-aqueous
solvents are propylene glycol, polyethylene glycol, vegetable oils
such as olive oil, and injectable organic esters such as ethyl
oleate. Aqueous earners include water, alcoholic/aqueous solutions,
emulsions or suspensions, including saline and buffered media.
Parenteral vehicles include sodium chloride solution, Ringer's
dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed
oils. Intravenous vehicles include fluid and nutrient replenishers,
electrolyte replenishers (such as those based on Ringer's
dextrose), and the like. Preservatives and other additives may also
be present such as, for example, antimicrobials, anti-oxidants,
chelating agents, and inert gases and the like.
[0087] Polynucleotide sequences, including antisense sequences, can
be therapeutically administered by various techniques known to
those of skill in the art. Such therapy would achieve its
therapeutic effect by introduction of the JNK polynucleotide, into
cells of animals having the proliferative disorder. Delivery of JNK
polynucleotide can be achieved using free polynucleotide or a
recombinant expression vector such as a chimeric virus or a
colloidal dispersion system. Especially preferred for therapeutic
delivery of nucleotide sequences is the use of targeted
liposomes.
[0088] Various viral vectors which can be utilized for gene therapy
as taught herein include adenovirus, herpes virus, vaccinia, or,
preferably, an RNA virus such as a retrovirus. Preferably, the
retroviral vector is a derivative of a murine or avian retrovirus.
Examples of retroviral vectors in which a single foreign gene can
be inserted include, but are not limited to: Moloney murine
leukemia virus (MoMuLV). Harvey murine sarcoma virus (HaMuSV),
murine mammary tumor virus (MuMTV), and Rous Sarcoma Virus (RSV). A
number of additional retroviral vectors can incorporate multiple
genes. All of these vectors can transfer or incorporate a gene for
a selectable marker so that transduced cells can be identified and
generated. By inserting a JNK sequence into the viral vector, along
with another gene which encodes the ligand for a receptor on a
specific target cell, for example, the vector is now target
specific. Retroviral vectors can be made target specific by
inserting, for example, a polynucleotide encoding a sugar, a
glycolipid, or a protein. Preferred targeting is accomplished by
using an antibody to target the retroviral vector. Those of skill
in the art will know of, or can readily ascertain without undue
experimentation, specific polynucleotide sequences which can be
inserted into the retroviral genome to allow target specific
delivery of the retroviral vector containing the JNK
polynucleotide.
[0089] Since recombinant retroviruses are defective, they require
assistance in order to produce infectious vector particles. This
assistance can be provided, for example, by using helper cell lines
that contain plasmids encoding all of the structural genes of the
retrovirus under the control of regulatory sequences within the
LTR. These plasmids are missing a nucleotide sequence which enables
the packaging mechanism to recognize an RNA transcript for
encapsulation. Helper cell lines which have deletions of the
packaging signal include but are not limited to .psi.2, PA317 and
PA12, for example. These cell lines produce empty virions, since no
genome is packaged. If a retroviral vector is introduced into such
cells in which the packaging signal is intact, but the structural
genes are replaced by other genes of interest the vector can be
packaged and vector virion produced. The vector virions produced by
this method can then be used to infect a tissue cell line, such as
NIH 3T3 cells, to produce large quantities of chimeric retroviral
virions.
[0090] Another targeted delivery system for JNK polynucleotides is
a colloidal dispersion system. Colloidal dispersion systems include
macromolecule complexes, nanocapsules, microspheres, beads, and
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes. The preferred colloidal system of
this invention is a liposome. Liposomes are artificial membrane
vesicles which are useful as delivery vehicles in vitro and in
vivo. It has been shown that large unilamellar vesides (LUV), which
range in size from 0.2-4.0 um can encapsulate a substantial
percentage of an aqueous buffer containing large macromolecules.
RNA, DNA and intact virions can be encapsulated within the aqueous
interior and be delivered to cells in a biologically active form
(Fraley, et al., Trends Biochem. Sci., 6:77, 1981). In addition to
mammalian cells, liposomes have been used for delivery of
polynucleotides in plant, yeast and bacterial cells. In order for a
liposome to be an efficient gene transfer vehicle, the following
characteristics should be present: (1) encapsulation of the genes
of interest at high efficiency while not compromising their
biological activity; (2) preferential and substantial binding to a
target cell in comparison to non-target cells; (3) delivery of the
aqueous contents of the vesicle to the target cell cytoplasm at
high efficiency; and (4) accurate and effective expression of
genetic information (Mannino, et al., Biotechniques, 6:682,
1988).
[0091] The targeting of liposomes can be classified based on
anatomical and mechanistic factors. Anatomical classification is
based on the level of selectivity, for example, organ-specific,
cell-specific, and organelle-specific. Mechanistic targeting can be
distinguished based upon whether it is passive or active. Passive
targeting utilizes the natural tendency of liposomes to distribute
to cells of the reticulo-endothelial system (RES) in organs which
contain sinusoidal capillaries. Active targeting, on the other
hand, involves alteration of the liposome by coupling the liposome
to a specific ligand such as a monoclonal antibody, sugar,
glycolipid, or protein, or by changing the composition or size of
the liposome in order to achieve targeting to organs and cell types
other than the naturally occurring sites of localization.
[0092] The invention also provides a method for detecting a cell
with JNK kinase activity or a cell proliferative disorder
associated with JNK comprising contacting a cell component with
c-Jun N-terminal kinase activity with a reagent which binds to the
component and measuring the interaction of the reagent with the
component. Such reagents can be used to measure relative levels of
JNK expression compared to normal tissue. The cell component can be
nucleic acid, such as DNA- or RNA, or protein. When the component
is nucleic acid, the reagent is a nucleic acid probe or PCR primer.
The interaction of a nucleic acid reagent with a nucleic acid
encoding a polypeptide with c-Jun N-terminal kinase activity is
typically measured using radioactive labels, however, other types
of labels will be known to those of skill in the art. When the cell
component is protein, the reagent is typically an antibody probe.
The probes are directly or indirectly detectably labeled, for
example, with a radioisotope, a fluorescent compound, a
bioluminescent compound, a chemiluminescent compound, a metal
chelator or an enzyme. Those of ordinary skill in the art will know
of other suitable labels for binding to the antibody, or will be
able to ascertain such, using routine experimentation.
[0093] Preferably the probe for identification of a cell with JNK
kinase activity is a c-Jun protein. JNK activity within a cell is
measured by the amount of phosphorylation of the c-Jun protein
probe. For example, the amount of JNK activity in a cell extract
can be measured by mixing the extract with c-Jun protein and adding
a radioactive compound such as .sup.32P-ATP to the mixture of
components. The amount of radioactivity that is incorporated into
the c-Jun probe is determined, for example by SDS-PAGE, and
compared to a cell control containing c-Jun and a normal level of
JNK kinase activity.
[0094] The c-Jun substrate can be immobilized onto a 96 well
microtiter dish and extracts from treated cells added to the wells.
The wells are then washed and an appropriate buffer containing
.sup.32P-ATP is added to the wells. The phosphorylation reaction
proceeds for about 15 minutes and the wells are washed and counted.
Modifications of the assay include immobilizing the substrate using
beads or magnetic particles and non-radioactive procedures to
measure the substrate phosphorylation, such as using monoclonal
antibodies and a detection system (e.g., biotinylated antibodies
and avidin peroxidase reaction).
[0095] The Jun protein used in the method of detection of the JNK
kinase described above may exist as a single protein unit or a
fusion protein. The fusion protein preferably consists of c-Jun and
glutathione-S-transferase (GST) as a carrier protein. The c-jun
nucleotide sequence is cloned 3' to the carrier protein in an
expression vector, such as pGEX or such derivatives as pGEX2T or
pGEX3X, the gene is expressed, the cells are lysed, and the extract
is poured over a column containing a resin or mixed directly with a
resin to which the carrier protein binds. When GST is the carrier,
a glutathione (GSH) resin is used. When maltose-binding protein
(MBP) is the carrier, an amylose resin is used. Other carrier
proteins and the appropriate binding resin will be known to those
of skill in the art.
[0096] The materials of the invention are ideally suited for the
preparation of a kit. The kit is useful for the detection of the
level of a c-Jun N-terminal kinase comprising an antibody which
binds a c-Jun N-terminal kinase or a nucleic acid probe which
hybridizes to JNK nucleotide, the kit comprising a carrier means
being compartmentalized to receive in close confinement therein one
or more containers such as vials, tubes, and the like, each of the
container means comprising one of the separate elements to be used
in the assay. For example, one of the container means may comprise
a monoclonal antibody of the invention which is, or can be,
detectably labelled. The kit may also have containers containing
buffer(s) and/or a container comprising a reporter-means (for
example, a biotin-binding protein, such as avidin or streptavidin)
bound to a reporter molecule (for example, an enzymatic or
fluorescent label).
[0097] The following examples are intended to illustrate but not
limit the invention. While they are typical of those that might be
used, other procedures known to those skilled in the art may
alternatively be used.
EXAMPLE 1
Plasmids and Expression of GST Fusion Proteins
[0098] The glutathione-S-transferase (GST)-cJun expression vector,
pGEX2T-cJun(wt), was constructed by inserting a filled-in
BspHI-PstI fragment (encoding AA 1-223) from RSV-cJun(BspHI) into
the SmaI site of pGEX2T (Pharmacia). RSV-cJun(BspHI) was
constructed by changing the translation initiation sequence CTATGA
of RSV-cJun to TCATGA by site-directed mutagenesis. The
GSTcJun(Ala63/67)(BspHI) expression vector was derived in the same
manner from RSV-cJun(Ala63/73) (Smeal, et al., supra, 1991) and was
used to construct pGEX2T-cJun(Ala 63/67). The various GSTcJun
truncation mutants were constructed using the polymerase chain
reaction (PCR) to amplify various portions of c-Jun coding region.
The sequences of the primers are indicated below:
TABLE-US-00001 N-terminal primers:
TCTGCAGGATCCCCATGACTGCAAAGATGGAAACG (SEQ ID NO: 2) (underlined
codon: amino acid 1); TCTGCAGGATCCCCGACGATGCCCTCAACGCCTC (SEQ ID
NO: 3) (a.a. 11); TCTGCAGGATCCCCGAGAGCGGACCTTATGGCTAC (SEQ ID NO:
4) (a.a. 22); TCTGCAGGATCCCCGCCGACCCAGTGGGGAGCCTG (SEQ ID NO: 5)
(a.a. 43); TCTGCAGGATCCCCAAGAACTCGGACCTCCTCACC (SEQ ID NO: 6) (a.a.
56) C-terminal primers: TGAATTCTGCAGGCGCTCCAGCTCGGGCGA (SEQ ID NO:
7) (a.a. 79); and TGAATTCCTGCAGGTCGGCGTGGTGGTGATGTG (SEQ ID NO: 8)
(aa. 93).
[0099] The DNA fragments were amplified by using Pfu polymerase
(Strategene, La Jolla, Calif.), digested with BamHI and Pstl, and
subcloned to BamHI, Pstl sites of pBluescript SK+ (Strategene). The
BamHI-EcoRI fragments were excised from pBluescript and subcloned
to BamHI, Pstl sites of pGEX3X (Pharmacia). Some constructs were
made by inserting BamHI-Aval fragments of the PCR products and the
Aval-EcoRI fragment of pGEX2T-cJun(wt) into BamHI, EcoRI sites of
pGEX3X. pGEX3X-cJun(33-223) was constructed by inserting a
Xholl-EcoRI fragment into pGEX3X.
[0100] The v-Jun and chick c-Jun sequences were derived from RCAS
VC-3 and RCAS CJ-3 respectively (Bos, et al., Genes Dev., 4:1677,
1990). GSTfusion vectors for v-Jun and chicken c-Jun were
constructed by inserting Ncol fragments of RCAS VC-3 and RCAS CJ-3
into Ncol site of pGEX-KG (Guan and Dixon, Anal. Biochem., 192:262,
1989). The same fragments contain various portions of the c-Jun and
v-Jun coding regions were cloned into pSG424, a GAL4 DNA binding
domain expression vector (Sadowski and Ptashne, Nucl. Acids Res.,
17:753, 1989).
[0101] The GST fusion protein expression vectors were transformed
into the XL 1-Blue or NM522 strains of E. coli. Protein induction
and purification were performed as previously described (Smith and
Johnson, Gene, 67:31, 1988). The amount of purified fusion protein
was estimated by the Bio-Rad Protein Assay Kit. In some experiments
GST fusion proteins were not eluted from the glutathione
(GSH)-agarose beads and were retained on the beads for isolation of
the c-Jun N-terminal kinase.
Cell Culture and Preparation of Cell Extracts
[0102] FR3T3, Ha-ras transformed FR3T3, HeLaS3 and QT6 cells were
grown in Dulbecco's modified Eagle's Medium (DMEM) containing 10%
fetal calf serum (FCS), 100 U/ml penicillin (Pc), and 100 .mu.g/ml
streptomycin (Sm). Jurkat, K562 and U937 cells were grown in RPMI
1640 supplemented with 10% FCS, 100 U/ml Pc, and 100 .mu.g/ml Sm.
F9 cells were grown in 45% DMEM, 45% Ham's F12, 10% FCS, 100 U/ml
Pc and 100 .mu.g/ml Sm. Nuclear and cytoplasmic extracts were
prepared as described by Dignam, et al., (1983). To prepare whole
cell extract (WCE), harvested cells were suspended in WCE buffer:
25 mM HEPES pH 7.7, 0.3 M NaCl; 1.5 mM MgC.sub.2 0.2 mM EDTA, 0.1%
Triton X-100, 0.5 mM DTT, 20 mM, .beta.-glycerophosphate, 0.1 mM
Na.sub.3VO.sub.4, 2 .mu.g/ml leupeptin, 100 .mu.g/ml PMSF. The cell
suspension was rotated at 4.degree. C. for 30 minutes and the
extract was cleared by centrifugation at 10,000.times.g for 10
minutes. Protein amount was estimated by Bio-Rad Protein Assay
Kit.
Transfection Experiments
[0103] Transfection experiments were performed using RSV-cJun,
RSV-vJun and GAL4-Jun, GAL4-vJun and Ha-Ras(Leu 61) expression
vectors as previously described (Boyle, et al., supra, 1991;
Binetruy, et al., supra, 1991; Smeal, et al., supra, 1991). CAT
activity was determined as described in Example 8 below. c-Jun and
v-Jun protein expression and phosphorylation were analyzed as
described by Smeal, et al., supra, 1991; Smeal, et at., Mol. Cell.
Biol., 12:3507, 1992).
Protein Purification
[0104] GST-fusion proteins were purified by affinity chromatography
on GSH-agarose as described (Smith, et al., Gene, 67:31-40, 1988).
Purified MAP kinase (a mixture of ERK1 and ERK2) was obtained from
Dr. M. Cobb (University of Texas Southwestern). JNK-46 was purified
from UV-irradiated HeLa S3 cells by standard liquid chromatography.
Epitope-tagged JNK was immunopurified from transiently transfected
COS cells. Briefly, COS cells were solubilized with 20 mM Tris (pH
7.6), 0.5% NP-40. 250 mM NaCl, 3 mM .beta.-glycerophosphate, 3 mM
EDTA, 3 mM EGTA, 100 .mu.M Na orthovanadate, 10 .mu.g/ml leupeptin,
1 mM PMSF. JNK was isolated by immunoaffinity chromatography using
the M2 monoclonal antibody bound to protein A-Sepharose. The beads
were washed extensively with Buffer A (20 mM Hepes (ph 7.7), 50 mM
NaCl, 0.1 mM EDTA, 0.05% Triton X-100). JNK was eluted from the
column with 3 M urea in Buffer A and the dialyzed against Buffer A
with 10% glycerol.
EXAMPLE 2
Kinase Assays
Solid Phase Kinase Assay
[0105] Cell extracts were diluted so that the final composition of
the WCE buffer was 20 mM HEPES pH 7.7, 75 mM NaCl, 2.5 mM
MgCl.sub.2, 0.1 mM EDTA, 0.05% Triton X-100, 0.5 mM DTT, 20 mM,
.beta.-glycerolphosphate, 0.1 mM Na.sub.3VO.sub.4, 2 .mu.g/ml
leupeptin, 100 .mu.g/ml PMSF. The extracts were mixed with 10 .mu.l
of GSH-agarose suspension (Sigma) to which 10 .mu.g of either GST
or GST-Jun fusion proteins were bound. The mixture was rotated at
4.degree. C. for 3 hours in a microfuge tube and pelleted by
centrifugation at 10,000.times.g for 20 sec. After 4.times.1 ml
washes in HEPES binding buffer (20 mM HEPES pH 7.7, 50 mM NaCl. 2.5
mM MgCl.sub.2, 0.1 mM EDTA, 0.05% Triton X-100), the pelleted beads
were resuspended in 30 .mu.l of kinase buffer (20 mM HEPES pH 7.6,
20 mM MgCl.sub.2, 20 mM .beta.-glycerolphosphate, 20 .mu.M
p-nitrophenyl phosphate, 0.1 mM Na.sub.3VO.sub.4, 2 mM DTT)
containing 20 .mu.M ATP and 5 .mu.Cl .gamma.-.sup.32P-ATP. After 20
minutes at 30.degree. C. the reaction was terminated by washing
with HEPES binding buffer. Phosphorylated proteins were eluted with
30 .mu.l of 1.5.times. Laemlli sample buffer and resolved on a 10%
SDS polyacrylamide gel, followed by autoradiography. Quantitation
of phosphate incorporated was determined by gel slicing, and
scintillation counting. Phosphorylated GST fusion proteins were
eluted from gel slices and subjected to phosphopeptide mapping as
described (Boyle, et al., supra, 1991).
In-Gel Kinase Assay
[0106] In-gel kinase assay was performed as described by Kameshita
and Fujisawa, Anal. Biochem., 183:139, (1989) with slight
modifications. Briefly, c-Jun binding proteins were isolated from
whole cell extracts by using GSH-agarose beads containing 80 .mu.g
GST-cJun as described above. Proteins were eluted in Laemlli sample
buffer and resolved on 10% SDS-polyacrylamide gel, which was
polymerized in the absence or presence of GST-cJun (40 .mu.g/ml).
After electrophoresis, the gel was washed twice, 30 minutes each
time with 100 ml of 20% 2-propanol, 50 mM HEPES pH 7.6 to remove
SDS. After the gel was washed twice, 30 minutes each time, with 100
ml of buffer A (50 mM HEPES pH 7.6, 5 mM .beta.-mercaptoethanol),
it was incubated in 200 ml of 6M urea in buffer A at room
temperature for 1 hr, followed by serial incubations in buffer A
containing 0.05% Tween 20 and either 3M, 1.5M or 0.75M urea. After
the gel was washed several times, 1 hr each time, with 100 ml of
buffer A containing 0.05% Tween 20 at 4.degree. C., it was
incubated with kinase buffer containing 50 .mu.M ATP and 5
.mu.Ci/ml .gamma.-.sup.32P-ATP at 30.degree. C. for 1 hour. After
the reaction, the gel was washed with 100 ml of 5% tricholoroacetic
acid and 1% sodium pyrophosphate at room temperature several times,
followed by drying and autoradiography.
EXAMPLE 3
Binding of a Protein Kinase to GST-cJun-GSH-agarose Beads
[0107] The fusion protein, GSTcJun(wt), can bind through its GST
moiety to glutathione (GSH)-agarose beads to generate an affinity
matrix for identification of c-Jun binding proteins, which may
include protein kinases. Ha-ras transformation of FR3T3 cells
results in increased phosphorylation of c-Jun on Ser 63 and 73
(Binetruy, et al., supra, 1991; Smeal. et al., supra, 1991).
Preliminary experiments indicated that transformed cells contained
higher levels of c-Jun N-terminal kinase activity, while the levels
of c-Jun C-terminal kinase activity remained unchanged. To develop
a more convenient assay for characterizing the c-Jun N-terminal
kinase activity, nuclear and cytoplasmic extracts of untransformed
and transformed FR3T3 cells were mixed with GSTcJun(wt)-GSH-agarose
beads. FRT3T3(-) and Ha-ras-transformed FR3T3(+) cells were kept in
0.5% FCS for 24 hours and harvested to prepare nuclear and
cytosolic extracts. These extracts (prepared from equal number of
cells) were mixed with GSH-agarose beads containing 10 .mu.g of
GST-cJun(wt), GSTcJun(Ala63/73) or GST. After a 3 hour incubation,
the beads were spun down, washed 4-times and incubated in kinase
buffer containing .gamma.-.sup.32P-ATP for 20 minutes at 30.degree.
C. The reaction was terminated by washing in SDS sample buffer. The
eluted proteins were resolved by SDS-PAGE. The location of the
GSTcJun fusion proteins is indicated in FIG. 1. Similar results
were obtained when protein concentration rather than cell number
(300 .mu.g of cytosolic extract and an equivalent amount of nuclear
extract) was used to normalize the amounts of extracts used in this
assay. This procedure resulted in phosphorylation of GSTcJun(wt),
suggesting that a protein kinase bound to it and phosphorylated it
while attached to GSH-agarose (FIG. 1). On the other hand, no
phosphorylation of GST bound to GSH-agarose could be detected by
this assay.
[0108] The same experiment was repeated using a GSTcJun(Ala63/73)
fusion protein, in which both the serine at position 63 and 73 were
converted to alanines in order to identify a kinase that targets
Ser 63 and 73 of c-Jun. Phosphorylation of this protein was
considerably lower than that of GSTcJun(wt) (FIG. 1). These
experiments confirmed the previous observations that the kinase
activity affecting the N-terminal sites of c-Jun was elevated upon
Has-ras transformation and are consistent with the differences in
the extent of c-Jun N-terminal phosphorylation between transformed
and untransformed cells detected by in vivo labelling (Binetruy, et
al., supra, 1991; Smeal, et al., supra, 1991, 1992). The kinase
activity detected by this solid-phase assay was present in both the
cytosolic and the nuclear fractions and was several-fold more
abundant in the cytosol on a per-cell basis. However, it is
possible that some of the kinase leaked from the nuclei to the
cytosol during the cell fractionation.
[0109] The solid-phase assay was used to examine N-terminal c-Jun
kinase activity in other cell types. Exposure of HeLa cells to UV
activates the Ha-Ras signalling pathway and results in a large
increase in N-terminal phosphorylation of c-Jun (Devary, et al.,
Cell, 71:1081, 1992). Treatment of HeLa cells with the phorbol
ester, TPA, on the other hand, has only a marginal effect on
N-terminal phosphorylation of c-Jun (Boyle, et al., 1991). HeLa S3
cells were serum starved for 12 hours and were either left
untreated, irradiated with UV light (40 J/m.sup.2) or incubated
with TPA (100 ng/ml). The cells were harvested at the indicated
times (min) after UV or TPA exposure. Whole cell extracts
(approximately 800 .mu.g protein) isolated form equal numbers of
cells were mixed with GSH-agarose beads containing 10 .mu.g of
either GST, GSTcJun(wt), or GSTcJun(AIa 63A73). After 3 hours
incubation, followed by extensive washing, the solid state
phosphorylation assay was performed as described above. After a 20
minute reaction, the proteins were dissociated in SDS sample buffer
and resolved by SDS-PAGE.
[0110] As shown in FIG. 2A, N-terminal c-Jun kinase activity was
elevated within 5 minutes after UV irradiation and was 250-fold
higher after 30 minutes than in unstimulated cells. The effect of
TPA, however, was minor compared to that of UV. As found before,
GSTcJun(wt) was more efficiently phosphorylated than
GSTcJun(Ala63/73), whereas GST was not phosphorylated. These
results are consistent with in vivo measurements of c-Jun
phosphorylation (Boyle, et al., supra. 1991; Devary, et al., supra,
1992).
[0111] TPA treatment of Jurkat T cells, in contrast to HeLa cells,
resulted in stimulation of c-Jun phosphorylation on Ser 63 and 73.
Jurkat cells were serum starved for 2 hours and either left
untreated or stimulated with TPA (50 ng/ml) for 10 or 30 minutes.
Whole cell extracts prepared from 5.times.10.sup.6 cells were mixed
with GSH-agarose beads containing GST. GSTcJun(wt) or
GSTcJun(Ala63/73). Phosphorylation of the GST proteins attached to
the beads was performed as described above. The faster moving bands
correspond to degradation products of the GSTcJun proteins.
[0112] In Jurkat cells, unlike HeLa cells, the N-terminal kinase
activity was found to be strongly activated by TPA (25-fold after
30 minutes) (FIG. 2B). This kinase also preferred GSTcJun(wt) over
GSTcJun(Ala63/73) and did not bind to or phosphorylate the GST
moiety. Collectively, these findings suggest that the kinase
detected by the solid-phase assay phosphorylates c-Jun on Ser 63
and 73 and that its regulation parallels that of c-Jun N-terminal
phosphorylation examined by in vivo labelling.
EXAMPLE 4
Phosphorylation of Serines 63 and 73 by Bound Kinase. JNK
[0113] To determine the exact phosphoacceptor sites used by the
kinase that binds to GSTcJun, the phosphorylated GSTcJun(wt) and
GSTcJun(AJa63/73) proteins were subjected to two-dimensional
tryptic phosphopeptide mapping. Whole cell extracts of
Has-ras-transformed FR3T3 cells (2.5 mg), UV irradiated HeLa cells
(200 .mu.g) or TPA-stimulated Jurkat cells (1.2 mg) were mixed with
GSH-agarose beads, containing either GSTcJun(wt) or
GSTcJun(Ala63/73). The GSTcJun proteins were phosphorylated as
described above by the bound-kinase, isolated by SDS-PAGE, excised
from the gel, digested with trypsin and subjected to
two-dimensional phosphopeptide mapping. The X, Y, T1, and T2
phosphopeptides are indicated. All the autoradiograms were exposed
for the same length of time.
[0114] As shown in FIG. 3A, the kinases isolated from
Ha-ras-transformed FR3T3 cells, UV-irradiated HeLa cells and
TPA-stimulated Jurkat cells, phosphorylated GSTcJun on X, Y, and
two other peptides, T1 and T2. X and Y correspond to
phosphorylation of Ser-73- and Ser-63, respectively (Smeal, et al.,
supra, 1991) and were absent in digests of GSTcJun(A1a63/73), which
contained higher relative levels of T1 and T2. Phosphoaminoacid
analysis indicated that T1 and T2 contain only phosphothreonine. By
deletion analysis these threonines were assigned to AA 91, 93 or 95
of c-Jun.
[0115] As described below, the kinase bound to GSTcJun was eluted
from the beads and used to phosphorylate recombinant full-length
c-Jun protein in solution (FIG. 3B). Recombinant c-Jun protein was
phosphorylated in vitro by the c-Jun N-terminal kinase (JNK) eluted
from GSTcJun(WT)-GSH-agarose beads. In addition, c-Jun was isolated
by immunoprecipitation from .sup.32P-labelled F9 cells that were
cotransfected with c-Jun and Ha-Ras expression vectors (Smeal, et
al., supra, 1991). Equal counts of each protein preparation were
digested with trypsin and subjected to phosphopeptide mapping. The
migration positions of the X, X' (a derivative of X generated by
alkylation; Smeal, et al., supra, 1991) Y, b and c phosphopeptides
are indicated.
[0116] As found in vivo, the bound kinase phosphorylated c-Jun
mostly on Ser 73, followed by phosphorylation of Ser 63. In
addition, the bound kinase activity phosphorylated c-Jun weakly on
two of its C-terminal sites, resulting in appearance of
phosphopeptides b and c. Since this is the first protein kinase
that was detected with clear specificity for at least one of the
N-terminal sites of c-Jun, it was named JNK for cJun N-terminal
protein-kinase.
EXAMPLE 5
Binding of JNK to cJun
[0117] To examine the stability of the interaction between GSTcJun
and JNK, extracts of TPA-stimulated Jurkat cells were incubated
with GSTcJun(wt)-GSH-agarose beads. After extensive washing, the
beads were subjected to elution with increasing concentrations of
NaCl, urea, guanidine-HCl and SDS. Bution of JNK was examined by
its ability to phosphorylate recombinant c-Jun in solution.
GSTcJun(wt)-GSH-agarose beads were incubated for 3 hours with a
whole cell extract of TPA-stimulated Jurkat cells and after four
washes were subjected to elution in kinase buffer containing
increasing concentrations of NaCl, urea, guanidine-HC! (in M) or
SDS (in %) (FIG. 4). The eluted fractions (equal volumes) were
dialyzed at 4.degree. C. against kinase buffer containing 10%
glycerol and no ATP and then incubated with recombinant c-Jun
protein (250 ng) in the presence of 20 .mu.M ATP and 5 .mu.Ci of
.gamma.-.sup.32P-ATP for 20 minutes at 30.degree. C. The amount of
kinase remaining on the beads after the elution steps (R lanes) was
determined by incubation of the isolated beads with kinase buffer
in the presence of 20 .mu.M ATP and 5 .mu.Ci .sup.32P-ATP for 20
minutes at 30.degree. C. The phosphorylated proteins were analyzed
by SDS-PAGE as described above and visualized by autoradiography.
The migration positions of GSTcJun and c-Jun are indicated.
[0118] Surprisingly, JNK was found to bind GSTcJun rather tightly;
only a small fraction of kinase activity was eluted by 0.5M NaCl
and even after elution with 2M NaCl, most of the kinase remained on
the beads (FIG. 4A). Approximately 50% of the bound kinase was
eluted by 1M urea and the rest was eluted by 2M urea. Nearly
complete elution was achieved by either 0.5M guanidine-HCI or 0.01%
SDS. Under all of these elution conditions, GSTcJun(wt) was also
partially eluted from the GSH-agarose beads. This suggests that the
stability of the JNK:c-Jun complex is similar to that of the
GST:GSH complex.
[0119] GSTcJun(wt) was covalently linked to GSH-agarose beads,
using cyanogen-bromide, and incubated with a whole cell extract of
TPA-stimulated Jurkat cells. After extensive washing, part of the
beads were eluted with kinase buffer-containing: no ATP (FIG. 48,
lane 2), 20 .mu.M ATP (lane 3) or 50 .mu.M ATP (lane 4). The eluted
fractions (equal volumes) were incubated with recombinant c-Jun
protein (500 ng) as a substrate and 5 .mu.Ci .gamma.-.sup.32P-ATP
for 30 minutes. In addition, the beads after elution with either
kinase buffer alone (lane 1) or kinase buffer containing 50 .mu.M
ATP (lane 5) were incubated with c-Jun protein (500 ng) in the
presence of 5 .mu.Ci .gamma.-.sup.32P-ATP for 30 minutes.
Phosphorylation of c-Jun (indicted by the arrow) was analyzed by
SDS-PAGE and autoradiography.
[0120] Addition of exogenous c-Jun to kinase-loaded GSH-agarose
beads to which GSTcJun was covalently linked results in its
efficient phosphorylation (FIG. 4B, Lane 1). This suggests that
after phosphorylating GSTcJun, JNK dissociates from it and
phosphorylates exogenous c-Jun. In addition, incubation with kinase
buffer containing ATP resulted in elution of JNK from the GSTcJun
beads, as indicated by its ability to phosphorylate exogenous c-Jun
(FIG. 4B, lanes 2-4). After incubation with 50 .mu.M ATP less than
20% of the kinase remained on the beads (comparer lanes 1 and 5,
FIG. 4B).
EXAMPLE 6
JNK1 is a 46 kD Protein
[0121] An in-gel kinase assay was performed to determine the size
of JNK. GSTcJun-GSH-agarose beads were incubated with a whole cell
extract of TPA-stimulated Jurkat cells, washed extensively and the
bound proteins were eluted in SDS sample buffer and separated on
SDS-polyacrylamide gels that were polymerized in the absence (-) or
presence (+) of GSTcJun(wt). After electrophoresis, the gel was
incubated in 6 M urea and subjected to renaturation as described in
Example 1. The renatured gels were incubated in kinase buffer
containing 50 .mu.M ATP and 5 .mu.Ci/ml .gamma.-.sup.32P-ATP for 1
hour at 30.degree. C. washed, fixed, and visualized by
autoradiography.
[0122] In both cases a protein band whose apparent molecular weight
was 46 kD was phosphorylated (FIG. 5A). Phosphorylation was 2-fold
more efficient in the presence of GSTcJun. This indicates that 46
kD protein band is either autophosphorylated JNK or a comigrating
protein. No .sup.32P-labelled protein was detected in eluates of
GST-GSH-agarose beads.
[0123] The same in-gel kinase assay was used to demonstrate
increased JNK activity upon TPA stimulation of Jurkat cells or UV
irradiation of HeLa cells (FIG. 5B). GSTcJun-GSH-agarose beads were
incubated with whole cell extracts of unstimulated or UV-stimulated
HeLa cells and unstimulated or TPA-stimulated Jurkat cells. After
washing, the bound proteins were eluted in SDS sample buffer and
separated by SDS-PAGE After renaturation, the gel was incubated in
kinase buffer containing 50 .mu.M ATP and 5 .mu.Ci/ml
.gamma.-.sup.32P-ATP and the phosphorylated proteins were
visualized by autoradiography.
[0124] These results provide further evidence that the apparent
molecular weight of JNK is 46 kD. To determine whether the same
N-terminal c-Jun kinase is present in various cell types, the
in-gel kinase assay was used to examine extracts of K562 human
erythroleukemia cells, U937 human histiocytic leukemia cells,
Jurkat cells, HeLa cells, F9 embryonal carcinoma cells,
Has-ras-transformed FR3T3 cells and QT6 quail fibroblasts. The
HeLa, F9 and QT6 extracts were prepared form UV-irradiated cells
and the U937 and Jurkat extracts were made from TPA-stimulated
cells, while the K562 cells were not subjected to any special
treatment. All cells contained a protein kinase that bound to
GSTcJun and migrated around 46 kD (FIG. 5C). Some cells, especially
QT6 cells, contained a second less abundant protein kinase species,
migrating at about 55 kD. The activities of both kinases were
induced by cell stimulation. GSTcJun(WT)-GSH-agarose beads were
incubated with whole cell extracts of logarithmically growing K562
and Ha-ras transformed FR3T3 cells, TPA-stimulated Jurkat and U937
cells and UV-irradiated HeLa, F9 and QT6 cells. After washing, the
bound proteins were eluted and analyzed by in-gel kinase assay as
described above.
[0125] Further evidence that JNK is 46 kD in size was obtained by
separating the GSTcJun-bound protein fraction of TPA-stimulated
Jurkat cell extract by SDS-PAGE. After elution and renaturation of
the fractionated proteins, the molecular weight of the major
protein kinase bound to GSTcJun, capable of specific
phosphorylation of Ser 63 and 73, was determined to be 46 kD.
Although the sizes of ERK1 and ERK2, 44 and 42 kD, respectively,
are close to that of JNK, Western blot analysis, using an antiserum
that reacts with both ERK's, indicates that the 46 kD JNK is not
immunologically related to either of them. In addition, JNK is not
immunologically related to Raf-1. In addition, a 55 kD polypeptide
was identified as exhibiting JNK activity, however, the 46 kD
appears to bind c-Jun more efficiently (Hibi, et al., Genes Dev.,
7:2135, 1993).
EXAMPLE 7
Delineation of the Kinase Binding Site
[0126] Deletion mutants of GSTcJun lacking either N-terminal or
C-terminal sequences (FIG. 6A) were used to define the JNK binding
site. GSTcJun fusion proteins containing various c-Jun sequences
were expressed in E. coli and isolated by binding to GSH-agarose.
The bound proteins were analyzed by SDS-PAGE and stained with
Coomassie Blue. Numbers indicate the amino acids of c-Jun present
in each fusion protein. The migration positions of the intact
GST-fusion proteins are indicated by the dots. Faster migrating
bands are degradation products.
[0127] These proteins were immobilized on GSH-agarose beads and
incubated with an extract of UV-irradiated HeLa cells. Whole cell
extracts of UV-irradiated HeLa S3 cells were mixed with GSH-agarose
beads containing equal amounts of the various GST fusion proteins.
After washing, the beads were incubated for 20 minutes in kinase
buffer containing .gamma.-.sup.32P-ATP. The GST fusion proteins
were eluted from the beads and analyzed by SDS-PAGE and
autoradiography. The migration positions of the intact GST fusion
proteins are indicated by the dots. After incubation with whole
cell extracts of UV-irradiated HeLa cells and washing, part of the
bound JNK fraction was eluted with 1 M NaCl and examined for its
ability to phosphorylate recombinant c-Jun (250 ng) in solution.
Protein phosphorylation was analyzed by SDS-PAGE and
autoradiography.
[0128] Binding of JNK was examined by its ability to phosphorylate
the GSTcJun fusion proteins, all of which contained both Ser 63 and
73 (FIG. 6B). To exclude the possibility that any of the
truncations may have altered the conformation of c-Jun affecting
the presentation of its N-terminal phosphoacceptors without
affecting JNK binding, the kinase eluted from these beads was
examined for its ability to phosphorylate exogenous full-length
c-Jun in solution (FIG. 6C). The results obtained by both assays
indicated that removal of amino acids (AA) 1-21 had no effect on
JNK binding. Removal of AA 1-32 decreased phosphorylation of
GSTcJun but had only a small effect on kinase binding. Removal of
AA 1-42, however, completely eliminated kinase binding. In contrast
to the N-terminal truncations, the two C-terminal truncations, that
were examined, had no effect on JNK binding and a GST fusion
protein containing AA 1-79 of c-Jun exhibited full binding
activity. Hence, AA 33-79 constitute the kinase binding site.
[0129] The JNK binding site encompasses the .delta. region,
spanning AA 31-57 of c-Jun that are deleted in v-Jun (Vogt and Bos,
1990). To determine the involvement of the .delta. region in kinase
binding, GST fusion proteins containing the N-terminal activation
domain of chicken c-Jun (AA 1-144), or the equivalent region of
v-Jun (FIG. 7A) were constructed. The activation domain (AA 1-144)
of chicken (ch) c-Jun and the equivalent region of v-Jun were fused
to GST and expressed in E. coli. GST fusion proteins were isolated
on GSH-agarose beads and analyzed by SDS-PAGE and Coomassie Blue
staining. The migration positions of the intact proteins are
indicated by the dots. After loading these GST fusion proteins onto
GSH-agarose the kinase binding assays were performed as described
above.
[0130] Extracts of TPA-activated Jurkat cells were incubated with
GSH-agarose beads containing GST, GSTcJun (Ch) or GSTvJun. After
washing, the beads were incubated in kinase buffer containing
.gamma.-.sup.32P-ATP and the phosphorylated GST fusion protein were
analyzed as described for FIG. 6. The bound protein fraction was
eluted from the GSTcJun(Ch) and GSTvJun beads and analyzed for its
ability to phosphorylate c-Jun in solution, as described for FIG.
6. While chicken GSTcJun bound the kinase as efficiently as human
GSTcJun, GSTvJun was defective in-JNK binding (FIG. 7B, C).
EXAMPLE 8
JNK Binding is Required for Ha-Ras and UV Responsiveness
[0131] Phosphorylation of Ser 63 and 73 is necessary for
potentiation of c-Jun mediated transactivation by Ha-Ras (Smeal, et
al., supra, 1991). If binding of JNK has any role in this response,
mutations that decrease kinase binding in vitro should attenuate
the stimulation of c-Jun activity by Ha-Ras in vivo. This
relationship was examined by cotransfection assays. Expression
vectors were constructed to express chimeric GAL4-cJun and
GAL4-vJun proteins, that consist of the DNA binding domain of the
yeast activator GAL4 (Sadowski and Ptashne, 1989) and N-terminal
sequences of c-Jun or v-Jun. The ability of these chimeras to
activate the GAL4-dependent reporter 5.times.GAL4-Elb-CAT (Lillie
and Green, 1989) was examined in the absence or presence of a
cotransfected Ha-Ras expression vector (FIG. 8A). F9 cells were
cotransfected with 1.0 .mu.g of expression vector encoding the
indicated GAL4-cJun chimeric proteins containing various portions
of the c-Jun activation domain [cJ=AA1-223; 33-AA33-223;
56=AA56-223; A63, 73=AA1-246(Ala63/73)] and 2.0 .mu.g of a
5.times.GAL4-Elb-CAT reporter in the absence or presence of the
indicated amounts (in .mu.g) of pZIPNeoRas(Leu61). The total amount
of expression vector was kept constant and the total amount of
transfected DNA was brought to 15 .mu.g using pUC18 and the
appropriate amount of pZIPneo. Cells were harvested 28 hours after
transfection and CAT activity was determined. Shown are the
averages of two experiments, calculated as fold-activation over the
level of reporter expression seen in the absence of the GAL4-Jun
expressions vectors.
[0132] While deletion of AA 1-32 of c-Jun resulted in a small
decrease in Ha-Ras responsiveness (9.8-fold induction vs. 19-fold
induction for wt GAL4-cJun), deletion of AA 1-42 or 1-55 resulted
in a greater decrease in Ha-Ras responsiveness (5.2-fold
induction). A similar decrease in Ha-Ras responsiveness was
observed upon substitution of c-Jun sequences with v-Jun sequences
(4.7-fold induction). In fact, the GAL4-cJun(56-223) and GAL4-vJun
chimeras were only 2-fold more responsive than
GAL4-cJun(1-246;Ala63/73) in which Ser 63 and 73 were converted to
alanines. That chimera exhibited only a marginal response (2-fold)
to Ha-Ras. The same set of GAL4-cJun and GAL4-vJun fusion proteins
was tested for UV responsiveness. F9 cells were transfected as
described above except that instead of cotransfection with
pZIPNeoRas, the cells were either exposed or not exposed to 40 J/m2
of UV-C 8 hours after transfection. The cells were harvested and
assayed for CAT activity 20 hours later. FIG. 8B shows the averages
of two experiments calculated as described above.
[0133] As shown in FIG. 8B, those proteins incapable of binding JNK
in vitro, were non-responsive to UV in vivo. While the activity of
GAL4-cJun(1-223) was stimulated 7.5-fold by UV, the activities of
GAL4-cJun(43-223), GAL4-cJun(56-223) and GAL4-vJun were induced
only 1.5-fold.
[0134] To reveal the role of JNK binding in c-Jun phosphorylation.
F9 cells were transfected with c-Jun and v-Jun expression vectors
in the absence or presence of an activated Ha-Ras expression
vector. UV-irradiation was also used to activate the Ha-Ras pathway
(Devary, et al., 1992). v-Jun and c-Jun were isolated by
immunoprecipitation from .sup.32S- or .sup.32P-labelled F9 cells
that were transfected with v-Jun and c-Jun expression vectors in
the absence or presence of pZIPNeoRas (Leu61). The isolated
proteins were analyzed by SDS-PAGE and autoradiography. Shown are
the results of one typical experiment for each protein. Note that
the .sup.32P-labelled v-Jun autoradiogram was exposed 3 times
longer than the corresponding c-Jun autoradiogram to generate
signals of similar intensity. v-Jun and c-Jun were isolated from
.sup.32P and .sup.32S-labelled F9 cells that were transfected with
v-Jun or c-Jun expression vectors. One half of the cells were
irradiated with UV-C(40 J/m.sup.2) for 30 minutes prior to
isolation of the Jun proteins by immunoprecipitation. In this case,
the c-Jun and v-Jun lanes represent equal autoradiographic
exposures. The two arrowheads indicate the migration positions of
the two forms of c-Jun (Devary, et al., 1992), whereas the square
indicates the migration position of v-Jun.
[0135] Immunoprecipitation from .sup.32S-labelled cells showed that
c-Jun and v-Jun were expressed at similar levels and that their
expression level was not affected by either Ha-Ras (FIG. 9A) or UV
(FIG. 9B). Immunopredpitation from .sup.32P-labeled cells indicated
that both Ha-Ras and UV stimulated the phosphorylation of c-Jun,
whereas the phosphorylation of v-Jun, whose basal level was
several-fold lower than that of c-Jun, was not enhanced by either
treatment As observed previously (Devary, et al., supra, 1991), UV
was a stronger inducer of c-Jun phosphorylation resulting in its
retarded electrophoretic mobility. Phosphopeptide mapping confirmed
that Ha-Ras expression had a much smaller effect on the
phosphorylation of v-Jun in comparison to its effect on c-Jun. As
shown previously (Smeal, et al., supra, 1991), v-Jun was
phosphorylated only on one site which is equivalent to Ser 73 of
c-Jun.
EXAMPLE 9
Antisera and Proteins
[0136] c-Jun polyclonal antiserum was described by Binetruy, et
al., (Nature, 351:122-127, 1991). The anti-CD3 monoclonal antibody
OKT3 (Van Wauwe, et al., J. Immunol., 124:2708-2713, 1980) was
obtained from Dr. Amnon Altman, La Jolla Institute for Allergy and
Immunology, and the anti-CD28 monoclonal antibody 9.3 is described
in Hansen, et al., (Immunogenetics, 10:247-260, 1980). The
anti-ERK2 and anti-ERK antibodies were provided by Drs. M. Weber
and M. Cobb (University of Texas Southwestern), respectively.
Expression and purification of GST-cJun(1-223) was described (Hibi,
et al., Genes & Dev., 7:2135, 1993). The bacterial expression
vector for kinase-defective ERK-1 was a gift from Dr. M. Cobb and
the recombinant protein was prepared and purified by Dr. J.
Hagstrom. MBP was purchased from Sigma.
Cell Culture, Metabolic Labeling, and Immunoprecipitation
[0137] Jurkat cells were grown in RPM1 with 10% fetal calf serum
(FCS), 1 mM glutamate, 100 .mu./ml penicillin (pen), 100 .mu.g/ml
streptomycin (strep) and 250 ng/ml amphotericin (complete medium).
HeLa S3, CV-1 and FR3T3 cells were grown in DMEM supplemented with
10% FCS, 100 .mu./ml pen, 100 .mu.g/ml strep. All cells were
cultured at 37.degree. C. with 5% CO.sub.2. Mouse thymocytes were
prepared from 8 week old Balb/C mice by gradient centrifugation on
lymphocyte separation medium (Pharmacia). The lymphocytes were
cultured for 5 hours at 37.degree. C. in RPMI+ 10% FCS, prior to
stimulation. Jurkat cells were labelled for 90 minutes with 0.5
mCi/ml .sup.32P-orthophosphate (ICN Radiochemicals) in medium
lacking sodium phosphate. Labelled cells were treated with TPA
(Sigma) and A23187 (Calbiochem) 1 .mu.g/ml as indicated. When used,
cydosporin A (CsA) (Sandoz) 100 ng/ml in ethanol was added 10
minutes prior to cell stimulation. Following stimulation, the
labelled cells were washed twice with ice-cold PBS then lysed with
RIPA buffer (10 mM Tris pH 7.5, 150 mM NaCl, 2 mM EDTA. 1% Triton-X
100, 1% DOC, 0.1% SDS) supplemented with phosphatase inhibitors (20
mM, .beta.-glycerophosphate, 10 mM p-nitro-phenylphosphate, 1 mM
Na.sub.3, VO.sub.4), and protease inhibitors (10 .mu.g/ml
leupeptin, aprotonin, pepstatin and 1 mM phenylmethyl
sulfonylfluoride). c-Jun was immunoprecipitated as described
(Binetruy, et al., supra, 1992) and analyzed by SDS-PAGE, followed
by peptide mapping (Boyle, et al., Cell, 64:573-584, 1991; Lin, et
al., Cell, 70:777-789, 1992). Ha-Ras was immunoprecipitated with
Y13-259. Ha-Ras bound nucleotides were extracted and analyzed as
described by Satoh, et al., (Proc. Natl. Acad. Sci., USA,
15:5993-5997, 1990).
RNA Extraction and Northern Blot Analysis
[0138] Exponentially growing Jurkat cells (10.sup.6/ml) grown in
complete RPMI medium was pretreated with CsA for 15 minutes when
applicable, then subjected to various treatments for another 40
minutes. Total cytoplasmic RNA was extracted as previously
described (Angel, et al, Cell, 49:729-739, 1987). 10 .mu.g RNA was
denatured by incubating with glyoxal for 60 minutes at 55.degree.
C. and fractionated on a 1% agarose gel in phosphate buffer. The
fractionated RNA was blotted to Zetabind Nylon membrane (CUNO Labs)
and hybridized to .sup.32P-label led cDNA probes specific for
c-jun, jun-B, jun-D, c-fos, .alpha.-tubulin and IL-2.
Protein Kinase Assays
[0139] Exponentially growing cells were stimulated for the
indicated times and hypotonic detergent cellular extracts were
prepared as described (Hibi, et al., Genes and Dev., supra, 1993).
The solid-state phosphorylation assay for measuring JNK activity
was performed by incubated extracts with GSTcJun(1-223)-GSH agarose
beads as described (Hibi, et al., supra., 1993) and as in Example
2. ERK1 and 2 activity was assayed by an immunocomplex kinase assay
using MBP as a substrate (Minden, et al., Nature, 1993).
Reporters, Expression Vectors and Transfections
[0140] -79 jun-LUC, -73/+63 Col-LUC, -60/+63 Col-LUC were described
previously (Deng and Karin, 1993). The IL2-LUC reporter plasmid was
constructed by subcloning the IL-2 promoter (298 bp) from IL2CAT/+1
(Serfling, et al., EMBO J., 8:465-473, 1988) into the p20Luc vector
(Deng and Karin, Genes and Dev., 7:479, 1993) between the Sacl and
Kpnl site. The c-Jun expression vector pSRallc-Jun was constructed
by subcloning the human c-jun HindIII-Notl fragment from pRSVc-Jun
(Binetruy, et al., supra., 1991) into pSR.alpha.II vector by blunt
end ligation. pBJ-CNA and pBJ-CNB were from Dr. G. Crabtree,
Stanford University. .beta.-Actin-LUC was from Dr. C. Glass,
UCSD.
[0141] T Ag Jurkat cells, a derivative of the human Jurkat T-cell
line stably transfected with the SV40 large T antigen (a gift from
Dr. G. Crabtree) were grown to 10.sup.6/ml, then resuspended at
2.times.10.sup.7/ml in fresh complete medium. 10.sup.7 cells (0.5
ml) were mixed with reporter plasmids (5 .mu.g, -79 jun-LUC; 10
.mu.g, -73/+63 Col-LUC or -60/+63 Col-LUC; 5 .mu.g IL2-LUC) at room
temperature for 10 minutes, then electroporated at 250 V, 960 uF in
a 0.4 cm cuvette using a Bio-Rad GenePulser. After electroporation,
cells were immediately put on ice for 10 minutes, then resuspended
in 10 ml complete medium for 24 hours before stimulation. 0.5 .mu.g
of pSRallc-Jun were used to transfect 107 Jurkat cells. Luciferase
activity was determined as described (Deng and Karin, supra.,
1993).
Analysis of GDP and GTP Bound to RAS p21
[0142] Jurkat cells 10.times.10.sup.6 were labelled for 3 hours
with .sup.32P-orthophosphate (ICN Radiochemicals) at 1 mCi/ml in 5
mM of Na.sub.3VO.sub.4 phosphate-free DMEM supplemented with 1
mg/ml BSA. Before harvest, cells were stimulated with TPA, 10
ng/ml, A23187, .mu.g/ml anti-CD3 antibody (OKT3), 10 .mu.g/ml,
anti-CD28 antibody, 2 .mu.g/ml or their combinations. After
treatment for a specified period, cells were washed once
immediately with ice cold PBS, twice with ice-cold Tris-Buffered
saline (50 mM Tris-HCl. pH 7.5, 20 mM MgCl.sub.2 150 mM NaCl, 10.5%
Nonidet P-40/1 .mu.g/ml of aprotinin; leupeptin, pepstatin and 1 mM
phenylmethyl sulfonylfluoride). Ras p21 was immunoprecipitated with
monoclonal antibody Y 12-259 (Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.). The GDP/GTP content of Ras was analyzed by TLC as
described (Satoh, et al., Proc. Natl. Acad. Sci., USA, 15:5993,
1990) and quantitated with an Ambis radioanalytic image system
(Ambis, San Diego, Calif.).
EXAMPLE 10
Synergistic Induction of AP-1 Activity During T Cell Activation
[0143] During the first stage of T lymphocyte activation, early
response genes are rapidly included (Crabtree, Science, 243:355,
361, 1989; Zipfel, et al., Mol. Cell. Bio., 9:1041-1048, 1989).
Induction of jun and fos genes during activation of the Jurkat T
cell line was investigated. Two different co-stimulatory paradigms
were used, one employing TPA and the Ca.sup.2+ ionophore A23187,
and the second based on simultaneous stimulation of the TCR complex
with an antibody to its CD3 component (OKT3; Van Wauwe, et al., J.
Immunol., 124:2708-2713, 1980) and stimulation of the CD28
auxiliary receptor with an anti-CD28 antibody (9.3; Hansen, et al.,
Immunogenetics, 10:247-260, 1993; June, et al., Immunol. Today,
11:211-216, 1990). Total cytoplasmic RNA was extracted from Jurkat
cells that were incubated with 50 ng/ml TPA (T). 1 .mu.g/ml A23187
(A) or 100 ng/ml cyclosporin A (CsA) for 40 minutes, either alone
or in combinations, as indicated. After fractionation of 10 .mu.g
samples on an agarose gel and transfer to nylon membrane, the level
of c-jun, jun-B, jun-D, c-fos and .alpha.-tubulin expression was
determined by hybridization to random primed cDNA probes.
[0144] Second, Jurkat cells were incubated with 10 .mu.g/ml soluble
anti-CD3 (OKT3), 2 .mu.g/ml soluble anti-CD28 (9.3) or a
combination of 50 ng/ml TPA and 1 .mu.g/ml A23817 (T/A) as
indicated for 40 minutes. Total cytoplasmic RNA was isolated and 10
.mu.g samples were analyzed as described above using c-jun, jun-D
and c-fos probes. IL-2 induction by the same treatments was
measured after 6 hours of stimulation by blot hybridization using
IL-2 and .alpha.-tubulin specific probes.
[0145] Both the first and second costimulatory paradigms induced
IL-2 transcription (FIG. 11B). Optimal induction of c-jun also
required a combined treatment with TPA and A23187 (FIG. 11 A) or
anti-CD3 and anti-CD28 (FIG. 11B). The synergistic induction of
c-jun by both costimulatory paradigms was partially inhibited by
CsA. jun-B was also induced by TPA, but its induction was not
affected by A23187 or CsA. Although TPA+A23187 potentiated jun-D
expression, this effect was also not inhibited by CsA. As reported
by Matilla, et al., (EMBO J, 9: 4425-4433, 1990), maximal induction
of c-fos also required treatment with TPA+A23187, but was not
inhibited by CsA. Therefore sensitivity to CsA is unique to c-jun.
While incubation with soluble anti-CD3 led to induction of c-jun
and c-fos, only c-jun expression was augmented by simultaneous
exposure to anti-CD28.
[0146] The effects of the different stimuli on AP-1 transcriptional
activity in Jurkat cells were examined using a truncated, AP-1
responsive, human collagenase promoter (Angel, et al., Cell,
49:729-739, 1987) fused to the luciferase (LUC) reporter gene.
Jurkat cells were transfected with 10 .mu.g of either -73Col-LUC or
-60Col-LUC reporter plasmids. 24 hours after transfection, the
cells were aliquoted into 24 well plates and incubated for 9 hours
with 50 ng/ml TPA, 1 .mu.g/ml A23187 or 100 ng/ml CsA, either alone
or in combinations, as indicated. The cells were harvested and
luciferase activity was determined. The results shown are averages
of three experiments done in triplicates.
[0147] While TPA and A23187 administered alone had marginal effects
on -73Col-LUC, the two together resulted in its synergistic
activation (FIG. 11C). The -60Col-LUC reporter, lacking an AP-1
binding site, was not induced. Induction of -73Col-LUC was
inhibited by CsA. Treatment with anti-CD3 and anti-CD28 also
resulted in synergistic activation of -73Col-LUC. Similar results
were obtained with the AP-1 responsive c-jun promoter. These
findings differ from previous measurements of AP-1 activity in
Jurkat cells that relied on the use of synthetic promoters
containing multiple AP-1 sites (Matilla, et al., supra, 1993;
Ullman, et al., Genes & Dev., 7:188-196, 1993). While these
findings were reproducible, previous studies indicate that the
physiological collagenase and c-jun promoters provide a more
accurate and valid measurement of AP-1 transcriptional activity.
Indeed, the expression patterns of the collagenase and c-jun
reporters are very similar to that of the c-jun gene.
EXAMPLE 11
Costimulation of c-Jun N-Terminal
Phosphorylation is Suppressed by CsA
[0148] Induction of c-Jun transcription and optimal stimulation of
AP-1 correlate with changes in c-Jun phosphorylation (Devary, et
al., Cell, 71:1081-1091, 1992). The effect of TPA and A23187 on
c-Jun phosphorylation in Jurkat cells was examined. To elevate
c-Jun expression, Jurkat cells were transfected with a c-Jun
expression vector. The cells were labelled with .sup.32P and c-Jun
was immunoprecipitated from cells subjected to various stimuli and
analyzed by SDS-PAGE (FIG. 12A). Jurkat cells (10.sup.6 cells per
lane) were transfected with 0.5 .mu.g of a SR.alpha.-cJun
expression vector and 24 hours later were labeled for 3 hours with
.sup.32P-orthophosphate (1 mCi/ml). After 15 minutes, treatment
with 50 ng/ml TPA (T), 1 .mu.g/ml A23187 (A) and 100 ng/ml CsA,
either alone or in combination, as indicated, the cells were lysed
in RIPA buffer and c-Jun was isolated by immunoprecipitation and
analyzed by SDS-PAGE. The c-Jun bands are indicated.
[0149] In unstimulated cells, phosphorylated c-Jun migrated as a
single band. Treatment with TPA for 15 minutes induced the
appearance of slower migrating bands and costimulation with A23187
enhanced this effect, while CsA reduced the Ca.sup.++ effect.
Within the short time frame of this experiment there were minimal
effects on c-Jun expression.
[0150] Similar results were obtained by analysis of endogenous
c-Jun expression and phosphorylation (FIG. 12B). 2.times.10.sup.7
Jurkat cells were labeled for 3 hours with either
.sup.35S-methionine (900 .mu.Ci/ml) or .sup.32P-orthophosphate (1
mCi/ml). After 15 minutes incubation with 50 ng/ml TPA+1 .mu.g/ml
A23178 (T/A) in the absence or presence of and 100 ng/ml CsA or no
addition, as indicated, the cells were lysed in RIPA buffer and
c-Jun isolated by immunoprecipitation and analyzed by SDS-PAGE. The
c-Jun band is indicated. However, due to lower expression levels,
some of the slower migrating forms were not clearly visible.
[0151] c-Jun phosphorylation was further analyzed by
two-dimensional phosphopeptide mapping (FIG. 12C). This analysis
included all the isoforms of c-Jun. All of the c-Jun specific
protein bands shown in FIG. 12A, isolated from equal numbers of
cells, were excised from the gel and subjected to tryptic
phosphopeptide mapping. Shown is a typical result (this experiment
was repeated at least three times). N-nonstimulated cells; T-cells
treated with 50 ng/ml TPA; T/A: cells treated with 50 ng/ml TPA and
1 .mu.g/ml A23187; T/A+CsA; cells treated with T/A and 100 ng/ml
CsA. a, b, c, x and y correspond to the various tryptic
phosphopeptides of c-Jun, previously described by Boyle, et al.,
(Cell, 64:573-584, 1991) and Smeal, et al., (Nature, 354:494-496,
1991). T1 and T2 correspond to the minor phosphorylation sites;
Thr91, 93 and 95 (Hibi, et al., Genes & Dev., 7:000, 1993).
[0152] While the intensity of spot b, a doubly phosphorylated
tryptic peptide containing the C-terminal phosphorylation sites of
c-Jun (Boyle, et al., Cell, 64:573-584, 1991; Lin, et al., Cell,
70:777-789, 1992), was more or less invariant, TPA treatment
resulted in a small increase in the intensity of the
monophosphorylated form of this peptide (spot c) at the expense of
the triple phosphorylated form (spot a). This effect was also
observed in response to costimulation with TPA+A23187. In contrast
to HeLa cells and fibroblasts (Boyle, et al., supra, 1991; Minden,
et al., Nature, 1993), TPA treatment of Jurkat cells resulted in
increased phosphorylation of the N-terminal sites, corresponding to
Ser63 (spot y) and Ser73 (spot x) and this effect was strongly
enhanced by A23187. CsA prevented the enhancement of N-terminal
phosphorylation by A23187.
EXAMPLE 12
Synergistic Activation of JNK
[0153] Studies were done to determine whether enhanced N-terminal
c-Jun phosphorylation in response to TPA+A23187 was due to
synergistic activation of JNK, the protein kinase that binds to
c-Jun and phosphorylates its N-terminal sites. JNK exists in two
forms, 46 kD and 55 kD in size, both of which are activated by
external stimuli (Hibi, et al., supra, 1993; Deng, et al., supra,
1993). In-gel kinase assays indicated that both forms of JNK were
activated by TPA (FIG. 13A). Whole cell extracts (WCE) of Jurkat
cells incubated with TPA (T, 50 ng/ml), A23187 (A, 1 .mu.g/ml) or
CsA (100 ng/ml) for 15 minutes, alone or in combination, were
separated by SDS-PAGE (100 .mu.g protein/lane) on gels that were
cast in the absence or presence of GST-cJun (1-223). The gels were
subjected to renaturation protocol and incubated in kinase buffer
containing .gamma.-.sup.32P-ATP. The protein bands corresponding to
the 55 kD and 46 kD forms of JNK are indicated.
[0154] While A23187 treatment by itself did not activate JNK, it
potentiated its activation by TPA. CsA blocked this costimulatory
effect.
[0155] JNK can be retained on GSTcJun-glutathione (GSH) agarose
affinity resin and its kinase activity measured by phosphorylation
of GSTcJun. WCE (50 .mu.g) of Jurkat cells treated as described
above were incubated with 5 .mu.l of GSH agarose beads coated with
10 .mu.g GST-cJun (1-223) for 12 hours at 4.degree. C. After
extensive washing, the beads were incubated in kinase buffer
containing .gamma.-.sup.32P-ATP for 20 minutes at 30.degree. C.,
after which the proteins were dissociated by incubation in SDS
sample buffer and separated by SDS-PAGE (FIG. 13B). The 49 kD band
corresponds to GST-cJun (1-223). The faster migrating bands are
degradation products (Hibi, et al., supra, 1993).
[0156] This solid-state assay also indicated that TPA treatment
resulted in activation of JNK, which was strongly potentiated by
A23187, which by itself had no effect. This synergistic activation
of JNK was inhibited by CsA (FIG. 13B). To prove that the
solid-state assay measures the activity of the same polypeptides
identified by the in-gel kinase assay, JNK was first isolated on
GSTcJun-GSH agarose beads and then analyzed it by an in-gel kinase
assay. Both the 55 and 46 kD forms of JNK bound to GSTcJun and were
regulated in the same manner revealed by the binding assay (FIG.
13C). WCE (200 .mu.g) of Jurkat cells treated as described in FIG.
13A were incubated with GST-cJun(1-223)-GSH agarose beads as
described above and the bound fraction was eluted in SDS sample
buffer and separated by SDS-PAGE on a gel containing
GST-cJun(1-223). The gel was renatured and incubated in kinase
buffer containing .gamma.-.sup.32P-ATP to label the JNK
polypeptides.
EXAMPLE 13
Costimulation by Ca.sup.++ is Unique to JNK and T Lymphocytes
[0157] We examined whether elevated intracellular Ca.sup.++ affects
JNK activation in other cells. JNK activity was weakly stimulated
by TPA in CV1 and FR3T3 cells, but not in PC12 cells (FIG. 14).
Cultures of FR3T3, CV-1, PC12 and mouse thymocytes were incubated
for 15 minutes in the presence of TPA (50 ng/ml, T), A23817 (1
.mu.g/ml, A) and/or CsA (100 ng/ml), as indicated. WCE prepared
from 2-4.times.10.sup.5 cells for the established cell lines and
1.5.times.10.sup.6 cells for primary thymocytes were incubated with
GSTcJun(1-223)-GSH agarose beads. After washing, JNK activity was
determined by solid-state phosphorylation assay as described
above.
[0158] In none of these cells was JNK activity affected by A23187
or CsA treatment. Similar results were obtained in HeLa, HepG2 and
Gc cells. By contrast, the regulation of JNK activity in mouse
thymocytes was similar to that observed in Jurkat cells. TPA
induced a moderate increase in JNK activity which was enhanced by
A23187 and that costimulation was inhibited by CsA (FIG. 14).
[0159] JNK is a proline-directed protein kinase activated by
extracellular stimuli (Hibi, et al, supra, 1993). In that respect
it resembles the ERK1 and 2 MAP kinases (Boulton, et al., Cell,
65:663-675, 1991). Since ERK1 and 2 appear to be involved in
induction of c-fos (Gille, et al., Nature, 358:414-417, 1992;
Marais, et al., Cell, 73:381-393, 1993) and could thereby
participate in T cell activation, their regulation was examined.
ERK1 and ERK2 activities were measured in both Jurkat and mouse
thymocytes using an immunocomplex kinase assay and myelin basic
protein (MBP) as a substrate. Recombinant, kinase-defective ERK1
was also used a substrate for assaying MEK, the protein kinase
responsible for activation of ERK1 and 2 (Crews, et al., Science,
258:478-480, 1992). Both ERK and MEK activities were fully
stimulated by TPA treatment of either Jurkat cells or mouse
thymocytes (FIG. 15).
[0160] WCE (5 .mu.g) of Jurkat (FIG. 15, panel A) or mouse
thymocytes (panel C) were incubated with 1 .mu.g of
kinase-defective ERK1 in kinase buffer containing
.gamma.-.sup.32P-ATP for 20 minutes. The phosphorylated proteins
were separated by SDS-PAGE and the band corresponding to the mutant
ERK1 is indicated. WCE (20 .mu.g) of Jurkat (panel B) or mouse
thymocytes (panel C) that were treated as described above were
immunoprecipitated with anti-ERK antibodies (a gift from Dr. M.
Weber). The immune complexes were washed and incubated in kinase
buffer containing .gamma.-.sup.32P-ATP and 2 .mu.g MBP for 15
minutes at 30.degree. C. The phosphorylated proteins were separated
by SDS-PAGE. The band corresponding to phosphorylated MBP is
indicated. A23187 and CsA had no effect on either activity.
EXAMPLE 14
Synergistic Activation of JNK by Anti-CD3 and Anti-CD28
[0161] If JNK plays a central role in signal integration during T
cell activation, then other costimulatory paradigms should also
cause its synergistic activation. The regulation of JNK in response
to T cell activation with anti-CD3 and anti-CD28 antibodies was
examined. Jurkat cells (1.times.10.sup.7) were incubated for 15
minutes with either normal mouse serum, 1 .mu.g/ml anti-CD3 and/or
2 .mu.g/ml anti-CD28, in the absence or presence of 100 ng/ml CsA,
as indicated. WCE were prepared and 100 .mu.g samples were analyzed
for JNK activation using the in-gel kinase assay, as described
above.
[0162] While incubation of Jurkat cells with either soluble
anti-CD3 or soluble anti-CD 28 alone had a negligible effect on JNK
activity, simultaneous incubation with both antibodies resulted in
strong synergistic activation of both forms (FIG. 16A).
[0163] WCE (50 .mu.g) of Jurkat cells treated as described above
were incubated with GSTcJun(1-223)-GSH agarose beads and assayed
for JNK activity using the solid-state kinase assay. The same WCE
(20 .mu.g) were immunoprecipitated with anti-ERK2 antibodies and
assayed for MBP-kinase activity. CsA partially attenuated this
effect. By contrast, incubation with soluble anti-CD3 was
sufficient for efficient activation of ERK2, which was not enhanced
by costimulation with anti-CD28, nor was it inhibited by CsA (FIG.
16B).
[0164] To further investigate the nature of signal integration by
JNK, the effect of a suboptimal dose of TPA was examined, which by
itself does not lead to JNK activation on the responses to either
anti-CD3 or anti-CD28 (FIG. 16C). WCE (50 .mu.g) of Jurkat cells
treated as described in Panel A with various stimuli alone or their
combinations were incubated with GSTcJun(1-223)-GSH agarose beads
and assayed for JNK activity using solid-state kinase assay. The
same samples (20 .mu.g) were also assayed for MBP-kinase activity
as described in FIG. 16B.
[0165] Together with A23187, this suboptimal dose of TPA resulted
in a strong synergistic activation of JNK but not ERK2. The
activation of JNK was completely inhibited by CsA. The suboptimal
dose of TPA also led to strong synergistic activation of JNK
together with either anti-CD3 or anti-CD28. ERK2, on the other
hand, was fully activated by anti-CD3 and suboptimal TPA, which by
itself led to partial activation of ERK2, had no further effect
Exposure to anti-CD28 did not augment the activation of ERK2 by
TPA. JNK was also efficiently activated by combined treatment with
anti-CD3+A23187. but not by anti-CD28+A23187.
EXAMPLE 15
Activation of Ha-Ras
[0166] The effects of the various treatments on Ha-Ras activation
were examined and the results shown in FIG. 17. Jurkat cells
(2.times.10.sup.6 cells per point) labeled with 0.4 mCi of
.sup.32P-orthophosphate for 3 hours were incubated with nonspecific
antibody (1 .mu.g/ml mouse IgG; control), 1 .mu.g/ml anti-CD3, 2
.mu.g/ml anti-CD28, 10 ng/ml TPA or 500 ng/ml A23187 (A), as
indicated. After 2 minutes, the cells were harvested, lysed and
Ha-Ras was isolated by immunoprecipitation. The guanine nucleotide
bound to Ha-Ras were extracted, separated by thin layer
chromatography and quantitiated as described in EXAMPLE 9. The
values shown represent the averages of two separate experiments
done in duplicates. Jurkat cells were labeled with
.sup.32P-orthophosphate and stimulated with either TPA or anti-CD 3
as described above. At the indicated time points, the cells were
harvested and the GTP content of Ha-Ras was determined as described
directly above.
[0167] Whereas an optimal dose of TPA and exposure to soluble
anti-CD3 led to activation of Ha-Ras, measured by an increase in
its GTP content, soluble anti-CD28 had no effect on Ha-Ras activity
(FIG. 17A). The activation of Ha-Ras by either anti-CD3 or TPA was
not augmented by costimulation with either anti-CD28 or A23187,
respectively. While the activation of Ha-Ras by TPA persisted for
at least 20 minutes, the response to soluble anti-CD3 was highly
transient (FIG. 17B). Therefore, signal integration must occur
downstream of Ha-Ras.
[0168] The foregoing is meant to illustrate, but not to limit, the
scope of the invention. Indeed, those of ordinary skill in the art
can readily envision and produce further embodiments, based on the
teachings herein, without undue experimentation.
Sequence CWU 1
1
10147PRTArtificial sequenceSynthetic peptide 1Ile Leu Lys Gln Ser
Met Thr Leu Asn Leu Ala Asp Pro Val Gly Ser1 5 10 15Leu Lys Pro His
Leu Arg Ala Lys Asn Ser Asp Leu Leu Thr Ser Pro 20 25 30Asp Val Gly
Leu Leu Lys Leu Ala Ser Pro Glu Leu Glu Arg Leu 35 40
45235DNAArtificial sequencePCR primer 2tctgcaggat ccccatgact
gcaaagatgg aaacg 35334DNAArtificial sequencePCR primer 3tctgcaggat
ccccgacgat gccctcaacg cctc 34435DNAArtificial sequencePCR primer
4tctgcaggat ccccgagagc ggaccttatg gctac 35535DNAArtificial
sequencePCR primer 5tctgcaggat ccccgccgac ccagtgggga gcctg
35635DNAArtificial sequencePCR primer 6tctgcaggat ccccaagaac
tcggacctcc tcacc 35730DNAArtificial sequencePCR primer 7tgaattctgc
aggcgctcca gctcgggcga 30833DNAArtificial sequencePCR primer
8tgaattcctg caggtcggcg tggtggtgat gtg
3392096DNAChickenCDS(412)..(1404) 9gaattccggg gcggccaaga cccgccgccg
gccggccact gcagggtccg cactgatccg 60ctccggcgga gagccgctgc tctgggaagt
cagttcgcct gcggactccg aggaaccgct 120gcgcacgaag agccgtcagt
gagtgaccgc gacttttcaa agccgggtag ggcgcgcgag 180tcgacaagta
agagtgcggg aggcatctta attaaccctg cgctccctgg agcagctggt
240gaggagggcg cacggggacg acagccagcg ggtgcgtgcg ctcttagaga
aactttccct 300gtcaaaggct ccggggggcg cgggtgtccc ccgcttgcca
cagccctgtt gcggccccga 360aacttgtgcg cgcacgccaa actaacctca
cgtgaagtga cggactgttc t atg act 417 Met Thr 1gca aag atg gaa acg
acc ttc tat gac gat gcc ctc aac gcc tcg ttc 465Ala Lys Met Glu Thr
Thr Phe Tyr Asp Asp Ala Leu Asn Ala Ser Phe 5 10 15ctc ccg tcc gag
agc gga cct tat ggc tac agt aac ccc aag atc ctg 513Leu Pro Ser Glu
Ser Gly Pro Tyr Gly Tyr Ser Asn Pro Lys Ile Leu 20 25 30aaa cag agc
atg acc ctg aac ctg gcc gac cca gtg ggg agc ctg aag 561Lys Gln Ser
Met Thr Leu Asn Leu Ala Asp Pro Val Gly Ser Leu Lys35 40 45 50ccg
cac ctc cgc gcc aag aac tcg gac ctc ctc acc tcg ccc gac gtg 609Pro
His Leu Arg Ala Lys Asn Ser Asp Leu Leu Thr Ser Pro Asp Val 55 60
65ggg ctg ctc aag ctg gcg tcg ccc gag ctg gag cgc ctg ata atc cag
657Gly Leu Leu Lys Leu Ala Ser Pro Glu Leu Glu Arg Leu Ile Ile Gln
70 75 80tcc agc aac ggg cac atc acc acc acg ccg acc ccc acc cag ttc
ctg 705Ser Ser Asn Gly His Ile Thr Thr Thr Pro Thr Pro Thr Gln Phe
Leu 85 90 95tgc ccc aag aac gtg aca gat gag cag gag ggg ttc gcc gag
ggc ttc 753Cys Pro Lys Asn Val Thr Asp Glu Gln Glu Gly Phe Ala Glu
Gly Phe 100 105 110gtg cgc gcc ctg gcc gaa ctg cac agc cag aac acg
ctg ccc agc gtc 801Val Arg Ala Leu Ala Glu Leu His Ser Gln Asn Thr
Leu Pro Ser Val115 120 125 130acg tcg gcg gcg cag ccg gtc aac ggg
gca ggc atg gtg gct ccc gcg 849Thr Ser Ala Ala Gln Pro Val Asn Gly
Ala Gly Met Val Ala Pro Ala 135 140 145gta gcc tcg gtg gca ggg ggc
agc ggc agc ggc ggc ttc agc gcc agc 897Val Ala Ser Val Ala Gly Gly
Ser Gly Ser Gly Gly Phe Ser Ala Ser 150 155 160ctg cac agc gag ccg
ccg gtc tac gca aac ctc agc aac ttc aac cca 945Leu His Ser Glu Pro
Pro Val Tyr Ala Asn Leu Ser Asn Phe Asn Pro 165 170 175ggc gcg ctg
agc agc ggc ggc ggg gcg ccc tcc tac ggc gcg gcc ggc 993Gly Ala Leu
Ser Ser Gly Gly Gly Ala Pro Ser Tyr Gly Ala Ala Gly 180 185 190ctg
gcc ttt ccc gcg caa ccc cag cag cag cag cag ccg ccg cac cac 1041Leu
Ala Phe Pro Ala Gln Pro Gln Gln Gln Gln Gln Pro Pro His His195 200
205 210ctg ccc cag cag atg ccc gtg cag cac ccg cgg ctg cag gcc ctg
aag 1089Leu Pro Gln Gln Met Pro Val Gln His Pro Arg Leu Gln Ala Leu
Lys 215 220 225gag gag cct cag aca gtg ccc gag atg ccc ggc gag aca
ccg ccc ctg 1137Glu Glu Pro Gln Thr Val Pro Glu Met Pro Gly Glu Thr
Pro Pro Leu 230 235 240tcc ccc atc gac atg gag tcc cag gag cgg atc
aag gcg gag agg aag 1185Ser Pro Ile Asp Met Glu Ser Gln Glu Arg Ile
Lys Ala Glu Arg Lys 245 250 255cgc atg agg aac cgc atc gct gcc tcc
aag tgc cga aaa agg aag ctg 1233Arg Met Arg Asn Arg Ile Ala Ala Ser
Lys Cys Arg Lys Arg Lys Leu 260 265 270gag aga atc gcc cgg ctg gag
gaa aaa gtg aaa acc ttg aaa gct cag 1281Glu Arg Ile Ala Arg Leu Glu
Glu Lys Val Lys Thr Leu Lys Ala Gln275 280 285 290aac tcg gag ctg
gcg tcc acg gcc aac atg ctc agg gaa cag gtg gca 1329Asn Ser Glu Leu
Ala Ser Thr Ala Asn Met Leu Arg Glu Gln Val Ala 295 300 305cag ctt
aaa cag aaa gtc atg aac cac gtt aac agt ggg tgc caa ctc 1377Gln Leu
Lys Gln Lys Val Met Asn His Val Asn Ser Gly Cys Gln Leu 310 315
320atg cta acg cag cag ttg caa aca ttt tgaagagaga ccgtcggggg
1424Met Leu Thr Gln Gln Leu Gln Thr Phe 325 330ctgaggggca
acgaagaaaa aaaataacac agagagacag acttgagaac ttgacaagtt
1484gcgacggaga gaaaaaagaa gtgtccgaga actaaagcca agggtatcca
agttggactg 1544ggttcggtct gacggcgccc ccagtgtgca cgagtgggaa
ccacctggtc gcgccctccc 1604ttggcgtcga gccagggagc ggccgcctgg
gggctgcccc gctttgcgga cgggctgtcc 1664ccgcgcgaac ggaacgttgg
actttcgtta acattgacca agaactgcat ggacctaaca 1724ttcgatctca
ttcagtatta aagggggcag ggggaggggg ttacaaactg caatagagac
1784tgtagattgc ttctgtagta ctccttaaga acacaaagcg gggggagggt
tggggagggg 1844cggcaggagg gaggtttgtg agagcgaggc tgagcctaca
gatgaactct ttctggcctg 1904ctttcgttaa ctgtgtatgt acatatatat
attttttaat ttgattaaag ctgattactg 1964tcaataaaca gcttcatgcc
tttgtaagtt atttcttgtt tgtttgtttg ggatcctgcc 2024cagtgttgtt
tgtaaataag agatttggag cactctgagt ttaccatttg taataaagta
2084tataattttt tt 209610331PRTChicken 10Met Thr Ala Lys Met Glu Thr
Thr Phe Tyr Asp Asp Ala Leu Asn Ala1 5 10 15Ser Phe Leu Pro Ser Glu
Ser Gly Pro Tyr Gly Tyr Ser Asn Pro Lys 20 25 30Ile Leu Lys Gln Ser
Met Thr Leu Asn Leu Ala Asp Pro Val Gly Ser 35 40 45Leu Lys Pro His
Leu Arg Ala Lys Asn Ser Asp Leu Leu Thr Ser Pro 50 55 60Asp Val Gly
Leu Leu Lys Leu Ala Ser Pro Glu Leu Glu Arg Leu Ile65 70 75 80Ile
Gln Ser Ser Asn Gly His Ile Thr Thr Thr Pro Thr Pro Thr Gln 85 90
95Phe Leu Cys Pro Lys Asn Val Thr Asp Glu Gln Glu Gly Phe Ala Glu
100 105 110Gly Phe Val Arg Ala Leu Ala Glu Leu His Ser Gln Asn Thr
Leu Pro 115 120 125Ser Val Thr Ser Ala Ala Gln Pro Val Asn Gly Ala
Gly Met Val Ala 130 135 140Pro Ala Val Ala Ser Val Ala Gly Gly Ser
Gly Ser Gly Gly Phe Ser145 150 155 160Ala Ser Leu His Ser Glu Pro
Pro Val Tyr Ala Asn Leu Ser Asn Phe 165 170 175Asn Pro Gly Ala Leu
Ser Ser Gly Gly Gly Ala Pro Ser Tyr Gly Ala 180 185 190Ala Gly Leu
Ala Phe Pro Ala Gln Pro Gln Gln Gln Gln Gln Pro Pro 195 200 205His
His Leu Pro Gln Gln Met Pro Val Gln His Pro Arg Leu Gln Ala 210 215
220Leu Lys Glu Glu Pro Gln Thr Val Pro Glu Met Pro Gly Glu Thr
Pro225 230 235 240Pro Leu Ser Pro Ile Asp Met Glu Ser Gln Glu Arg
Ile Lys Ala Glu 245 250 255Arg Lys Arg Met Arg Asn Arg Ile Ala Ala
Ser Lys Cys Arg Lys Arg 260 265 270Lys Leu Glu Arg Ile Ala Arg Leu
Glu Glu Lys Val Lys Thr Leu Lys 275 280 285Ala Gln Asn Ser Glu Leu
Ala Ser Thr Ala Asn Met Leu Arg Glu Gln 290 295 300Val Ala Gln Leu
Lys Gln Lys Val Met Asn His Val Asn Ser Gly Cys305 310 315 320Gln
Leu Met Leu Thr Gln Gln Leu Gln Thr Phe 325 330
* * * * *