U.S. patent application number 12/090400 was filed with the patent office on 2008-11-13 for polypeptides having endoglucanase activity and polynucleotides encoding same.
Invention is credited to Keith Gibson, Katja Salomon Johansen, Preben Nielsen, Helle Outtrup.
Application Number | 20080280325 12/090400 |
Document ID | / |
Family ID | 37635789 |
Filed Date | 2008-11-13 |
United States Patent
Application |
20080280325 |
Kind Code |
A1 |
Johansen; Katja Salomon ; et
al. |
November 13, 2008 |
Polypeptides Having Endoglucanase Activity and Polynucleotides
Encoding Same
Abstract
The present invention relates to isolated polypeptides having
endoglucanase activity and isolated polynucleotides encoding the
polypeptides. The invention also relates to nucleic acid
constructs, vectors, and host cells comprising the polynucleotides
as well as methods for producing and using the polypeptides.
Inventors: |
Johansen; Katja Salomon;
(Gentofte, DK) ; Gibson; Keith; (Bagsvaerd,
DK) ; Nielsen; Preben; (Hoersholm, DK) ;
Outtrup; Helle; (Vaerloese, DK) |
Correspondence
Address: |
NOVOZYMES NORTH AMERICA, INC.
500 FIFTH AVENUE, SUITE 1600
NEW YORK
NY
10110
US
|
Family ID: |
37635789 |
Appl. No.: |
12/090400 |
Filed: |
November 15, 2006 |
PCT Filed: |
November 15, 2006 |
PCT NO: |
PCT/EP2006/068509 |
371 Date: |
April 16, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60738430 |
Nov 21, 2005 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/209; 435/252.33; 435/267; 435/320.1; 510/392; 536/23.2 |
Current CPC
Class: |
C12N 9/2437 20130101;
C11D 3/38645 20130101; C12Y 302/01004 20130101 |
Class at
Publication: |
435/69.1 ;
435/209; 510/392; 435/267; 536/23.2; 435/320.1; 435/252.33 |
International
Class: |
C12P 21/04 20060101
C12P021/04; C12N 9/42 20060101 C12N009/42; C11D 7/42 20060101
C11D007/42; C12N 15/11 20060101 C12N015/11; C12N 15/00 20060101
C12N015/00; C12N 1/20 20060101 C12N001/20 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 16, 2005 |
DK |
PA 2005 01599 |
Claims
1-20. (canceled)
21. An isolated polypeptide having endoglucanase activity, selected
from the group consisting of: a) a polypeptide having an amino acid
sequence which has at least 72% identity with amino acids 1 to 759
of SEQ ID NO: 2; b) a polypeptide having an amino acid sequence
which has at least 86% identity with amino acids 65 to 347 of SEQ
ID NO: 2; c) a polypeptide which is encoded by a polynucleotide
which hybridizes under at least low stringency conditions with (i)
nucleotides 100 to 2376 of SEQ ID NO: 1, (ii) nucleotides 193 to
1041 of SEQ ID NO: 1, or (iii) a complementary strand of (i) or
(ii); d) a variant comprising a conservative substitution,
deletion, and/or insertion of one or more amino acids of amino
acids 1 to 759 of SEQ ID NO: 2; e) a polypeptide encoded by a
nucleotide sequence which comprises nucleotides 100 to 2376 of SEQ
ID NO: 1 or nucleotides 193 to 1041 of SEQ ID NO: 1.
22. The polypeptide of claim 21, which comprises amino acids 368 to
569 of SEQ ID NO: 2 has carbohydrate binding module activity.
23. The polypeptide of claim 21, which has at least one of the
following properties: a) a pI of 4.4, b) a pH optimum of 9, c) a
temperature optimum of 40.degree. C., or d) stability at pH from 5
to 10.5.
24. An enzyme composition comprising a polypeptide of claim 21.
25. The composition of claim 24, which further comprises one or
more enzymes selected from the group consisting of proteases,
cellulases, endoglucanases, beta-glucanases, hemicellulases,
lipases, peroxidases, laccases, alpha-amylases, glucoamylases,
cutinases, pectinases, reductases, oxidases, phenoloxidases,
ligninases, pullulanases, pectate lyases, xyloglucanases,
xylanases, pectin acetyl esterases, polygalacturonases,
rhamnogalacturonases, pectin lyases, mannanases, pectin
methylesterases, cellobiohydrolases, transglutaminases; or mixtures
thereof.
26. A detergent composition comprising a polypeptide of claim 21
and a surfactant.
27. A textile treatment composition comprising a polypeptide of
claim 21.
28. A method for degradation of cellulose-containing biomass,
comprising treating the biomass with an effective amount of a
polypeptide of claim 21.
29. An isolated polynucleotide comprising a nucleotide sequence
which encodes the polypeptide of claim 24.
30. The polynucleotide of claim 29, having at least one mutation in
the mature polypeptide coding sequence of SEQ ID NO: 1, in which
the mutant nucleotide sequence encodes a polypeptide consisting of
amino acids 1 to 759 of SEQ ID NO: 2.
31. An isolated polynucleotide hybridizing under at least low
stringency conditions with (a) nucleotides 100 to 2376 of SEQ ID
NO: 1, (b) nucleotides 193 to 1041 of SEQ ID NO: 1, (c) nucleotides
1104 to 1707 of SEQ ID NO: 1, or (d) a complementary strand of (a),
(b) or (c).
32. A nucleic acid construct comprising the polynucleotide of claim
29 operably linked to one or more control sequences that direct the
production of the polypeptide in an expression host.
33. A recombinant expression vector comprising the nucleic acid
construct of claim 32.
34. A recombinant host cell comprising the nucleic acid construct
of claim 32.
35. A method for producing the polypeptide having endoglucanase
activity, comprising (a) cultivating a host cell of claim 34; and
(b) recovering the polypeptide.
Description
SEQUENCES
[0001] SEQ ID NO:1, Polynucleotide sequence encoding Bacillus sp.
ACE160 endoglucanase. SEQ ID NO:2, Polypeptide sequence of Bacillus
sp. ACE160 endoglucanase and carbohydrate binding module.
FIELD OF THE INVENTION
[0002] The present invention relates to isolated polypeptides
having endoglucanase activity and isolated polynucleotides encoding
the polypeptides. The invention also relates to nucleic acid
constructs, vectors, and host cells comprising the polynucleotides
as well as methods for producing and using the polypeptides in the
detergent, paper and pulp, oil drilling, oil extraction, wine and
juice, food ingredients, animal feed or textile industries.
BACKGROUND OF THE INVENTION
[0003] Cellulose is a polymer of glucose linked by
beta-1,4-glucosidic bonds. Cellulose chains form numerous intra-
and intermolecular hydrogen bonds, which result in the formation of
insoluble cellulose micro-fibrils. Microbial hydrolysis of
cellulose to glucose involves the following three major classes of
cellulases: (i) endo-glucanases (EC 3.2.1.4) which cleave
beta-1,4-glucosidic links randomly throughout cellulose molecules,
also called endo-beta-1,4-glucanases; (ii) cellobiohydrolases (EC
3.2.1.91) which digest cellulose from the non-reducing end,
releasing cellobiose; and (iii) beta-glucosidases (EC 3.2.1.21)
which hydrolyse cellobiose and low molecular-weight cellodextrins
to release glucose.
[0004] Beta-1,4-glucosidic bonds are also present in other
naturally occurring polymers, e.g. in the beta-glucans from plants
such as barley and oats. In some cases, endoglucanases also provide
hydrolysis of such non-cellulose polymers.
[0005] Cellulases are produced by many micro-organisms and are
often present in multiple forms. Recognition of the economic
significance of the enzymatic degradation of cellulose has promoted
an extensive search for microbial cellulases, which can be used
industrially. As a result, the enzymatic properties and the primary
structures of a large number of cellulases have been investigated.
On the basis of the results of a hydrophobic cluster analysis of
the amino acid sequence of the catalytic domain, these cellulases
have been placed into different families of glycosyl hydrolases;
fungal and bacterial glycosyl hydrolases have been grouped into 35
families (Henrissat, B.: A classification of glycosyl hydrolases
based on amino acid sequence similarities. Biochem. J. 280 (1991),
309-316. Henrissat, B., and Bairoch, A.: New families in the
classification of glycosyl hydrolases based on amino acid sequence
similarities. Biochem. J. 293 (1993), 781-788.). Most cellulases
consist of a carbohydrate binding module (CBM) and a catalytic
domain (CAD) separated by a linker which may be rich in proline and
hydroxy amino acid residues. Another classification of cellulases
has been established on the basis of the similarity of their CBMs
(Gilkes et al. (1991)) giving five families of glycosyl hydrolases
(I-V).
[0006] Cellulases are synthesized by a large number of
microorganisms which include fungi, actinomycetes, myxobacteria and
true bacteria but also by plants. Especially
endo-beta-1,4-glucanases of a wide variety of specificities have
been identified. Many bacterial endo-glucanases have been described
(Gilbert, H. J. and Hazlewood, G. P. (1993) J. Gen. Microbiol.
139:187-194. Henrissat, B., and Bairoch, A.: New families in the
classification of glycosyl hydrolases based on amino acid sequence
similarities. Biochem. J. 293 (1993), 781-788.).
[0007] An important industrial use of cellulolytic enzymes is for
treatment of paper pulp, e.g. for improving the drainage or for
de-inking of recycled paper. Another important industrial use of
cellulolytic enzymes is for treatment of cellulosic textile or
fabrics, e.g. as ingredients in detergent compositions or fabric
softener compositions, for bio-polishing of new fabric (garment
finishing), and for obtaining a "stone-washed" look of
cellulose-containing fabric, especially denim, and several methods
for such treatment have been suggested, e.g. in GB-A-1 368 599,
EP-A-0 307 564 and EP-A-0 435 876, WO 91/17243, WO 91/10732, WO
91/17244, WO 95/24471 and WO 95/26398. JP patent application no.
13049/1999 discloses a heat resistant alkaline cellulase derived
from Bacillus sp. KSM-S237 (deposited as FERM-P-16067) suitable for
detergents.
[0008] There is an ever existing need for providing novel cellulase
enzymes or enzyme preparations which may be used for applications
where cellulase, preferably an endo-beta-1,4-glucanase, activity
(endoglucanase, EC 3.2.1.4) is desirable.
[0009] The object of the present invention is to provide
polypeptides and polypeptide compositions having substantial
beta-1,4-glucanase activity under slightly acid to alkaline
conditions and improved performance in paper pulp processing,
textile treatment, laundry processes, extraction processes or in
animal feed; preferably such novel well-performing endo-glucanases
are producible or produced by using recombinant techniques in high
yields.
SUMMARY OF THE INVENTION
[0010] The present invention relates to isolated polypeptides
having endoglucanase activity selected from the group consisting
of:
[0011] (a) a polypeptide having an amino acid sequence which has at
least 72% identity with amino acids 1 to 759 of SEQ ID NO: 2;
[0012] (b) a polypeptide which is encoded by a nucleotide sequence
which hybridizes under at least low stringency conditions with (i)
nucleotides 100 to 2376 of SEQ ID NO: 1, or (ii) a complementary
strand of (i); and
[0013] (c) a variant comprising a conservative substitution,
deletion, and/or insertion of one or more amino acids of amino
acids 1 to 759 of SEQ ID NO: 2.
[0014] The present invention also relates to isolated
polynucleotides encoding polypeptides having endoglucanase
activity, selected from the group consisting of:
[0015] (a) a polynucleotide encoding a polypeptide having an amino
acid sequence which has at least 72% identity with amino acids 1 to
759 of SEQ ID NO: 2;
[0016] (b) a polynucleotide which hybridizes under at least low
stringency conditions with (i) nucleotides 100 to 2376 of SEQ ID
NO: 1, or (ii) a complementary strand of (i).
[0017] The present invention also relates to nucleic acid
constructs, recombinant expression vectors, and recombinant host
cells comprising the polynucleotides.
The present invention also relates to methods for producing such
polypeptides having endoglucanase activity comprising (a)
cultivating a recombinant host cell comprising a nucleic acid
construct comprising a polynucleotide encoding the polypeptide
under conditions conducive for production of the polypeptide; and
(b) recovering the polypeptide.
[0018] The endo-beta-1,4-glucanase of the invention has stability
and activity properties that make it exceptionally well-suited for
use in applications involving aqueous alkaline solutions that
contain surfactants and/or oxidative active species such as
chemical bleaches. Such application conditions are very commonly
found, both within household and industrial detergents, textile
finishing treatments and in the manufacture or recycling of
cellulosic pulps.
[0019] Because the endoglucanase of the invention maintains its
activity to an exceptional extent under such relevant application
conditions it is contemplated that it will be more useful than
other known enzymes, e.g., when used in detergents, for paper/pulp
processing or for textile treatments. The present invention thus
also relates to methods of using the polypeptides of the invention
in a detergent or textile treatment composition, a composition for
treatment of paper pulp or for degradation of biomass e.g. for the
production of ethanol. Further, the invention relates to methods
for washing textile, kitchenware or hard surfaces with a detergent
comprising the polypeptides, methods for treatment of cellulosic
textile or fabrics, such as softening, bio-polishing or
stone-washing. Also, methods for improving the drainage or for
de-inking of recycled paper are included.
[0020] The present invention further relates to nucleic acid
constructs comprising a gene encoding a protein, wherein the gene
is operably linked to one or both of a first nucleotide sequence
encoding a signal peptide consisting of nucleotides 1 to 99 of SEQ
ID NO: 1.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1, Alignment of the amino acid sequence of the
polypeptide of the invention (ACE160, SEQ ID NO:2) with related
polypeptides of the prior art. The prior art polypeptides are
disclosed as:
TABLE-US-00001 Name Entry number Patent number KSM-64 ADP87708,
GeneseqP JP2004173598 KSM-365 AAR77395, GeneseqP JP07203960-1994
KSM-634 AAR07478, GeneseqP JP01281090 KSM-S237 ADP87707, GeneseqP
JP2004173598 MB1181 ABG76403, GeneseqP WO200299091 KSM-635 P19424,
Uniprot --
[0022] FIG. 2, Phylogenetic tree showing the relationship of the
endoglucanase of the invention (ACE160, SEQ ID NO:2) with prior art
polypeptide sequences were constructed upon alignment with default
settings in the ClustaIV function of program MegAlign.TM. version
5.05 in DNAStar.TM. program package.
DEFINITIONS
[0023] Endoglucanase activity: The term "endoglucanase activity" is
defined herein as a hydrolytic activity which catalyzes the
endohydrolysis of 1,4-beta-D-glucosidic linkages in cellulose,
lichenin and cereal beta-D-glucans, EC 3.2.1.4. A method for
determination of endoglucanase activity is described below.
[0024] The polypeptides of the present invention have at least 70%,
more preferably at least 80%, even more preferably at least 90%,
even more preferably at least 95%, most preferably at least 98%,
and even most preferably at least 100% of the endoglucanase
activity of the polypeptide consisting of the amino acid sequence
shown as amino acids 1 to 759 of SEQ ID NO: 2, or the catalytic
core domain consisting of the amino acid 65 to 347 of SEQ ID NO:
2.
[0025] Isolated polypeptide: The term "isolated polypeptide" as
used herein refers to a polypeptide which is at least 20% pure,
preferably at least 40% pure, more preferably at least 60% pure,
even more preferably at least 80% pure, most preferably at least
90% pure, and even most preferably at least 95% pure, as determined
by SDS-PAGE.
[0026] Substantially pure polypeptide: The term "substantially pure
polypeptide" denotes herein a polypeptide preparation which
contains at most 10%, preferably at most 8%, more preferably at
most 6%, more preferably at most 5%, more preferably at most 4%, at
most 3%, even more preferably at most 2%, most preferably at most
1%, and even most preferably at most 0.5% by weight of other
polypeptide material with which it is natively associated. It is,
therefore, preferred that the substantially pure polypeptide is at
least 92% pure, preferably at least 94% pure, more preferably at
least 95% pure, more preferably at least 96% pure, more preferably
at least 96% pure, more preferably at least 97% pure, more
preferably at least 98% pure, even more preferably at least 99%,
most preferably at least 99.5% pure, and even most preferably 100%
pure by weight of the total polypeptide material present in the
preparation.
[0027] The polypeptides of the present invention are preferably in
a substantially pure form. In particular, it is preferred that the
polypeptides are in "essentially pure form", i.e., that the
polypeptide preparation is essentially free of other polypeptide
material with which it is natively associated. This can be
accomplished, for example, by preparing the polypeptide by means of
well-known recombinant methods or by classical purification
methods.
[0028] Herein, the term "substantially pure polypeptide" is
synonymous with the terms "isolated polypeptide" and "polypeptide
in isolated form."
[0029] Identity: The relatedness between two amino acid sequences
is described by the parameter "identity".
[0030] For purposes of the present invention, the alignment of two
amino acid sequences is determined by using the Needle program from
the EMBOSS package (http://emboss.org) version 2.8.0. The Needle
program implements the global alignment algorithm described in
Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48,
443-453. The substitution matrix used is BLOSUM62, gap opening
penalty is 10, and gap extension penalty is 0.5.
[0031] The degree of identity between an amino acid sequence of the
present invention ("invention sequence"; e.g. amino acids 1 to 759
of SEQ ID NO:2 or the catalytic core domain of amino acids 65 to
347 of SEQ ID NO:2) and a different amino acid sequence ("foreign
sequence") is calculated as the number of exact matches in an
alignment of the two sequences, divided by the length of the
"invention sequence" or the length of the "foreign sequence",
whichever is the shortest. The result is expressed in percent
identity.
[0032] An exact match occurs when the "invention sequence" and the
"foreign sequence" have identical amino acid residues in the same
positions of the overlap (in the alignment example below this is
represented by "|"). The length of a sequence is the number of
amino acid residues in the sequence (e.g. the length of the
"invention sequence" of SEQ ID NO:2 is 759 amino acids).
[0033] In the alignment example below, the overlap is the amino
acid sequence "HTWGER.NLG" of Sequence 1; or the amino acid
sequence "HGWGEDANLA" of Sequence 2. A gap is indicated by a
".".
ALIGNMENT EXAMPLE
##STR00001##
[0035] The length of the overlap of the "invention sequence" may be
at least 20% of the length of the "invention sequence", more
preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or at least 90%
of the length of the "invention sequence".
[0036] The length of the overlap of the "foreign sequence" may be
at least 20% of the length of the "foreign sequence", more
preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or at least 90%
of the length of the "invention sequence".
[0037] Polypeptide Fragment: The term "polypeptide fragment" is
defined herein as a polypeptide having one or more amino acids
deleted from the amino and/or carboxyl terminus of SEQ ID NO: 2 or
a homologous sequence thereof, wherein the fragment has
endoglucanase activity. Preferably, the fragment contains at least
283 amino acid residues, e.g., amino acids 65 to 347 of SEQ ID NO:
2.
[0038] Subsequence: The term "subsequence" is defined herein as a
nucleotide sequence having one or more nucleotides deleted from the
5' and/or 3' end of SEQ ID NO: 1 or a homologous sequence thereof,
wherein the subsequence encodes a polypeptide fragment having
endoglucanase activity. Preferably, a subsequence contains at least
849 nucleotides, e.g., nucleic acids 193 to 1041 of SEQ ID
NO:1.
[0039] Allelic variant: The term "allelic variant" denotes herein
any of two or more alternative forms of a gene occupying the same
chromosomal locus. Allelic variation arises naturally through
mutation, and may result in polymorphism within populations. Gene
mutations can be silent (no change in the encoded polypeptide) or
may encode polypeptides having altered amino acid sequences. An
allelic variant of a polypeptide is a polypeptide encoded by an
allelic variant of a gene.
[0040] Substantially pure polynucleotide: The term "substantially
pure polynucleotide" as used herein refers to a polynucleotide
preparation free of other extraneous or unwanted nucleotides and in
a form suitable for use within genetically engineered protein
production systems. Thus, a substantially pure polynucleotide
contains at most 10%, preferably at most 8%, more preferably at
most 6%, more preferably at most 5%, more preferably at most 4%,
more preferably at most 3%, even more preferably at most 2%, most
preferably at most 1%, and even most preferably at most 0.5% by
weight of other polynucleotide material with which it is natively
associated. A substantially pure polynucleotide may, however,
include naturally occurring 5' and 3' untranslated regions, such as
promoters and terminators. It is preferred that the substantially
pure polynucleotide is at least 90% pure, preferably at least 92%
pure, more preferably at least 94% pure, more preferably at least
95% pure, more preferably at least 96% pure, more preferably at
least 97% pure, even more preferably at least 98% pure, most
preferably at least 99%, and even most preferably at least 99.5%
pure by weight. The polynucleotides of the present invention are
preferably in a substantially pure form. In particular, it is
preferred that the polynucleotides disclosed herein are in
"essentially pure form", i.e., that the polynucleotide preparation
is essentially free of other polynucleotide material with which it
is natively associated. Herein, the term "substantially pure
polynucleotide" is synonymous with the terms "isolated
polynucleotide" and "polynucleotide in isolated form." The
polynucleotides may be of genomic, cDNA, RNA, semisynthetic,
synthetic origin, or any combinations thereof.
[0041] Nucleic acid construct: The term "nucleic acid construct" as
used herein refers to a nucleic acid molecule, either single- or
double-stranded, which is isolated from a naturally occurring gene
or which is modified to contain segments of nucleic acids in a
manner that would not otherwise exist in nature. The term nucleic
acid construct is synonymous with the term "expression cassette"
when the nucleic acid construct contains the control sequences
required for expression of a coding sequence of the present
invention.
[0042] Control sequence: The term "control sequences" is defined
herein to include all components, which are necessary or
advantageous for the expression of a polynucleotide encoding a
polypeptide of the present invention. Each control sequence may be
native or foreign to the nucleotide sequence encoding the
polypeptide. Such control sequences include, but are not limited
to, a leader, polyadenylation sequence, propeptide sequence,
promoter, signal peptide sequence, and transcription terminator. At
a minimum, the control sequences include a promoter, and
transcriptional and translational stop signals. The control
sequences may be provided with linkers for the purpose of
introducing specific restriction sites facilitating ligation of the
control sequences with the coding region of the nucleotide sequence
encoding a polypeptide.
[0043] Operably linked: The term "operably linked" denotes herein a
configuration in which a control sequence is placed at an
appropriate position relative to the coding sequence of the
polynucleotide sequence such that the control sequence directs the
expression of the coding sequence of a polypeptide.
[0044] Coding sequence: When used herein the term "coding sequence"
means a nucleotide sequence, which directly specifies the amino
acid sequence of its protein product. The boundaries of the coding
sequence are generally determined by an open reading frame, which
usually begins with the ATG start codon or alternative start codons
such as GTG and TTG. The coding sequence may be a DNA, cDNA, or
recombinant nucleotide sequence.
[0045] Expression: The term "expression" includes any step involved
in the production of the polypeptide including, but not limited to,
transcription, post-transcriptional modification, translation,
post-translational modification, and secretion.
[0046] Expression vector: The term "expression vector" is defined
herein as a linear or circular DNA molecule that comprises a
polynucleotide encoding a polypeptide of the invention, and which
is operably linked to additional nucleotides that provide for its
expression.
[0047] Host cell: The term "host cell", as used herein, includes
any cell type which is susceptible to transformation, transfection,
transduction, and the like with a nucleic acid construct comprising
a polynucleotide of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
Polypeptides Having Endoglucanase Activity
[0048] In a first aspect, the present invention relates to isolated
polypeptides having an amino acid sequence which has a degree of
identity to amino acids 1 to 759 of SEQ ID NO:2, i.e., the mature
polypeptide of at least 72%, more preferably at least 75%, more
preferably at least 80%, more preferably at least 85%, even more
preferably at least 90%, most preferably at least 95%, and even
most preferably at least 97%, which have endoglucanase activity
(hereinafter "homologous polypeptides"). In a preferred aspect, the
homologous polypeptides have an amino acid sequence which differs
by ten amino acids, preferably by five amino acids, more preferably
by four amino acids, even more preferably by three amino acids,
most preferably by two amino acids, and even most preferably by one
amino acid from amino acids 1 to 759 of SEQ ID NO:2.
[0049] A polypeptide of the present invention preferably comprises
the amino acid sequence of SEQ ID NO:2 or an allelic variant
thereof; or a fragment thereof that has endoglucanase activity. In
a preferred aspect, a polypeptide comprises the amino acid sequence
of SEQ ID NO:2. In another preferred aspect, a polypeptide consists
of the amino acid sequence of SEQ ID NO:2 or an allelic variant
thereof; or a fragment thereof that has endoglucanase activity. In
another preferred aspect, a polypeptide consists of the amino acid
sequence of SEQ ID NO:2.
[0050] In another preferred aspect, a polypeptide comprises a
catalytic core domain in amino acids 65 to 347 of SEQ ID NO:2, or
an allelic variant thereof; or a fragment thereof that has
endoglucanase activity. The polypeptide of the catalytic core
domain has an amino acid sequence which has a degree of identity to
amino acids 65 to 347 of SEQ ID NO:2 of at least 86%, more
preferably at least 88%, even more preferably at least 90%, most
preferably at least 95%, and even most preferably at least 97%. In
another preferred aspect, a polypeptide comprises a catalytic core
domain in amino acids 65 to 347 of SEQ ID NO:2, or an allelic
variant thereof; or a fragment thereof that has endoglucanase
activity. In another preferred aspect, a polypeptide consists of
amino acids 65 to 347 of SEQ ID NO:2.
[0051] The annotation of the catalytic core domain is based on
homology to cellulases of the Glycosyl hydrolase Family 5
(Henrissat B. A classification of glycosyl hydrolases based on
amino acid sequence similarities. Biochem. J. 280 309-316 (1991);
Henrissat B., Bairoch A. New families in the classification of
glycosyl hydrolases based on amino acid sequence similarities.
Biochem. J. 293 781-788 (1993); Henrissat B., Bairoch A. Updating
the sequence-based classification of glycosyl hydrolases. Biochem.
J. 316 695-696 (1996); Davies G., Henrissat B. Structures and
mechanisms of glycosyl hydrolases. Structure 3 853-859 (1995);
Henrissat B., Claeyssens M., Tomme P., Lemesle L., Mornon J.-P.
Cellulase families revealed by hydrophobic cluster analysis. Gene
81 83-95 (1989); Py B., Bortoli-German I., Haiech J., Chippaux M.,
Barras F. Cellulase EGZ of Erwinia chrysanthemi: structural
organization and importance of His98 and Glu133 residues for
catalysis. Protein Eng. 4 325-333 (1991)). The domain annotation of
the catalytic core domain is available through
http://afmb.cnrs-mrs.fr/CAZY/, http://www.ebi.acuk/interpro/,
http://www.sanger.ac.uk/Software/Pfam/, or
http://www.expasy.org/prosite/.
[0052] In another aspect of the invention, the polypeptide
comprises a carbohydrate binding module in amino acids 368 to 569
of SEQ ID NO:2. In another preferred aspect the present invention
relates to polypeptides comprising a carbohydrate binding module
having a degree of identity to amino acids 368 to 569 of SEQ ID
NO:2 of at least 67%, more preferably at least 70%, more preferably
at least 75%, more preferably at least 80%, more preferably at
least 85%, even more preferably at least 90%, most preferably at
least 95%, and even most preferably at least 97%. In another
preferred aspect, a polypeptide comprises a carbohydrate binding
module in amino acids 368 to 569 of SEQ ID NO:2, or an allelic
variant thereof; or a fragment thereof that has carbohydrate
binding activity. In another preferred aspect, a polypeptide
consists of amino acids 368 to 569 of SEQ ID NO:2.
[0053] The carbohydrate binding module belongs to the family 17/28.
The annotation of the CBM is based on homology with known
sequences, especially the CBM of KSM-635 (Ozaki,K. Shikata, S.
Kawai, S. Ito, S. Okamoto, K.; "Molecular cloning and nucleotide
sequence of a gene for alkaline cellulase from Bacillus sp.
KSM-635."; J. Gen. Microbiol. 136:1327-1334 (1990), Uniprot No.
P19424), which was annotated as a CBM based on relation to the
galactose binding like domains described in Ito N., Phillips S. E.,
Stevens C., Ogel Z. B., McPherson M. J., Keen J. N., Yadav K. D.,
Knowles P. F. Novel thioether bond revealed by a 1.7 A crystal
structure of galactose oxidase. Nature 350 87-90 (1991);
Macedo-ribeiro S., Bode W., Huber R., Quinn-Allen M. A., Kim S. W.,
Ortel T. L., Bourenkov G. P., Bartunik H. D., Stubbs M. T., Kane W.
H., Fuentes-prior P. Crystal structures of the membrane-binding C2
domain of human coagulation factor V. Nature 402 434-439 (1999);
Himanen J. P., Rajashankar K. R., Lackmann M., Cowan C. A.,
Henkemeyer M., Nikolov D. B. Crystal structure of an Eph
receptor-ephrin complex. Nature 414 933-938 (2001)
[PUBMED:11780069] [PUB00010665]; and Marintchev A., Mullen M. A.,
Maciejewski M. W., Pan B., Gryk M. R., Mullen G. P. Solution
structure of the single-strand break repair protein XRCC1
N-terminal domain. Nat. Struct. Biol. 6 884-893 (1999). The domain
annotation of the carbohydrate binding module is available through
http://afmb.cnrs-mrs.fr/CAZY/, http://www.ebi.ac.uk/interpro/,
http://www.sanger.ac. uk/Software/Pfam/, or
http://www.expasy.org/prosite/.
[0054] In a second aspect, the present invention relates to
isolated polypeptides having endoglucanase activity which are
encoded by polynucleotides which hybridize under very low
stringency conditions, preferably low stringency conditions, more
preferably medium stringency conditions, more preferably
medium-high stringency conditions, even more preferably high
stringency conditions, and most preferably very high stringency
conditions with (i) nucleotides 100 to 2376 of SEQ ID NO: 1, (ii) a
subsequence of (i) or (iii) a complementary strand of (i) or (ii)
(J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular
Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor,
N.Y.). A subsequence of SEQ ID NO: 1 contains at least 100
contiguous nucleotides or preferably at least 200 contiguous
nucleotides, more preferably 300, 400, 500, 600, 700, 800, 900
contiguous nucleotides or even more preferably at least 1000
contiguous nucleotides. Moreover, the subsequence may encode a
polypeptide fragment which has endoglucanase activity.
[0055] The nucleotide sequence of SEQ ID NO: 1 or a subsequence
thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a
fragment thereof, may be used to design a nucleic acid probe to
identify and clone DNA encoding polypeptides having endoglucanase
activity from strains of different genera or species according to
methods well known in the art. In particular, such probes can be
used for hybridization with the genomic or cDNA of the genus or
species of interest, following standard Southern blotting
procedures, in order to identify and isolate the corresponding gene
therein. Such probes can be considerably shorter than the entire
sequence, but should be at least 14, preferably at least 25, more
preferably at least 35, and most preferably at least 70 nucleotides
in length. It is, however, preferred that the nucleic acid probe is
at least 100 nucleotides in length. For example, the nucleic acid
probe may be at least 200 nucleotides, preferably at least 300
nucleotides, more preferably at least 400 nucleotides, or most
preferably at least 500 nucleotides in length. Even longer probes
may be used, e.g., nucleic acid probes which are at least 600
nucleotides, at least preferably at least 700 nucleotides, more
preferably at least 800 nucleotides, or most preferably at least
900 nucleotides in length. Both DNA and RNA probes can be used. The
probes are typically labeled for detecting the corresponding gene
(for example, with .sup.32P, .sup.3H, .sup.35S, biotin, or avidin).
Such probes are encompassed by the present invention.
[0056] A genomic DNA library prepared from such other organisms
may, therefore, be screened for DNA which hybridizes with the
probes described above and which encodes a polypeptide having
endoglucanase activity. Genomic or other DNA from such other
organisms may be separated by agarose or polyacrylamide gel
electrophoresis, or other separation techniques. DNA from the
libraries or the separated DNA may be transferred to and
immobilized on nitrocellulose or other suitable carrier material.
In order to identify a clone or DNA which is homologous with SEQ ID
NO:1 or a subsequence thereof, the carrier material is used in a
Southern blot.
[0057] For purposes of the present invention, hybridization
indicates that the nucleotide sequence hybridizes to a labeled
nucleic acid probe corresponding to the nucleotide sequence shown
in SEQ ID NO:1, its complementary strand, or a subsequence thereof,
under very low to very high stringency conditions. Molecules to
which the nucleic acid probe hybridizes under these conditions can
be detected using X-ray film.
[0058] In a preferred aspect, the nucleic acid probe is nucleotides
193 to 1041 of SEQ ID NO:1. In another preferred aspect, the
nucleic acid probe is a polynucleotide sequence which encodes the
polypeptide of SEQ ID NO:2, or a subsequence thereof. In another
preferred aspect, the nucleic acid probe is SEQ ID NO:1. In another
preferred aspect, the nucleic acid probe is the mature polypeptide
coding region of SEQ ID NO:1.
[0059] For long probes of at least 100 nucleotides in length, very
low to very high stringency conditions are defined as
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 .mu.g/ml sheared and denatured salmon
sperm DNA, and either 25% formamide for very low and low
stringencies, 35% formamide for medium and medium-high
stringencies, or 50% formamide for high and very high stringencies,
following standard Southern blotting procedures for 12 to 24 hours
optimally.
[0060] For long probes of at least 100 nucleotides in length, the
carrier material is finally washed three times each for 15 minutes
using 2.times.SSC, 0.2% SDS preferably at least at 45.degree. C.
(very low stringency), more preferably at least at 50.degree. C.
(low stringency), more preferably at least at 55.degree. C. (medium
stringency), more preferably at least at 60.degree. C. (medium-high
stringency), even more preferably at least at 65.degree. C. (high
stringency), and most preferably at least at 70.degree. C. (very
high stringency). Preferably, the wash is conducted using
0.2.times.SSC, 0.2% SDS preferably at least at 45.degree. C. (very
low stringency), more preferably at least at 50.degree. C. (low
stringency), more preferably at least at 55.degree. C. (medium
stringency), more preferably at least at 60.degree. C. (medium-high
stringency), even more preferably at least at 65.degree. C. (high
stringency), and most preferably at least at 70.degree. C. (very
high stringency).
[0061] For short probes which are about 15 nucleotides to about 70
nucleotides in length, stringency conditions are defined as
prehybridization, hybridization, and washing post-hybridization at
about 5.degree. C. to about 10.degree. C. below the calculated
T.sub.m using the calculation according to Bolton and McCarthy
(1962, Proceedings of the National Academy of Sciences USA 48:1390)
in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40,
1.times. Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM
sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per
ml following standard Southern blotting procedures.
[0062] For short probes which are about 15 nucleotides to about 70
nucleotides in length, the carrier material is washed once in
6.times.SCC plus 0.1% SDS for 15 minutes and twice each for 15
minutes using 6.times.SSC at 5.degree. C. to 10.degree. C. below
the calculated T.sub.m.
[0063] In a third aspect, the present invention relates to isolated
polypeptides having endoglucanase activity encoded by a
polynucleotide comprising nucleotides 193 to 1041 of SEQ ID NO: 1,
as a unique motif.
[0064] In a fourth aspect, the present invention relates to
isolated polypeptides having the following physicochemical
properties: pI of 4.4, pH optimum of 9, temperature optimum of
40.degree. C. and stability at pH from 5 to 10.5. The
beta-1,4-glucanase of the invention is not significantly
inactivated by Fe(II) ions. A sensitivity of the enzymatic activity
of the polypeptide to the presence of ferrous ions could place
restrictions on the applicability of the polypeptide, such as in
processes taking place in metal containers or equipment.
[0065] In a fifth aspect, the present invention relates to
artificial variants comprising a conservative substitution,
deletion, and/or insertion of one or more amino acids of SEQ ID NO:
2 or the mature polypeptide thereof. Preferably, amino acid changes
are of a minor nature, that is conservative amino acid
substitutions or insertions that do not significantly affect the
folding and/or activity of the protein; small deletions, typically
of one to about 30 amino acids; small amino- or carboxyl-terminal
extensions, such as an amino-terminal methionine residue; a small
linker peptide of up to about 20-25 residues; or a small extension
that facilitates purification by changing net charge or another
function, such as a poly-histidine tract, an antigenic epitope or a
binding domain.
[0066] Examples of conservative substitutions are within the group
of basic amino acids (arginine, lysine and histidine), acidic amino
acids (glutamic acid and aspartic acid), polar amino acids
(glutamine and asparagine), hydrophobic amino acids (leucine,
isoleucine and valine), aromatic amino acids (phenylalanine,
tryptophan and tyrosine), and small amino acids (glycine, alanine,
serine, threonine and methionine). Amino acid substitutions which
do not generally alter specific activity are known in the art and
are described, for example, by H. Neurath and R. L. Hill, 1979, In,
The Proteins, Academic Press, New York. The most commonly occurring
exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr,
Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn,
Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.
[0067] In addition to the 20 standard amino acids, non-standard
amino acids (such as 4-hydroxyproline, 6-N-methyl lysine,
2-aminoisobutyric acid, isovaline, and alpha-methyl serine) may be
substituted for amino acid residues of a wild-type polypeptide. A
limited number of non-conservative amino acids, amino acids that
are not encoded by the genetic code, and unnatural amino acids may
be substituted for amino acid residues. "Unnatural amino acids"
have been modified after protein synthesis, and/or have a chemical
structure in their side chain(s) different from that of the
standard amino acids. Unnatural amino acids can be chemically
synthesized, and preferably, are commercially available, and
include pipecolic acid, thiazolidine carboxylic acid,
dehydroproline, 3- and 4-methylproline, and
3,3-dimethylproline.
[0068] Alternatively, the amino acid changes are of such a nature
that the physico-chemical properties of the polypeptides are
altered. For example, amino acid changes may improve the thermal
stability of the polypeptide, alter the substrate specificity,
change the pH optimum, and the like.
[0069] Essential amino acids in the parent polypeptide can be
identified according to procedures known in the art, such as
site-directed mutagenesis or alanine-scanning mutagenesis
(Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter
technique, single alanine mutations are introduced at every residue
in the molecule, and the resultant mutant molecules are tested for
biological activity (i.e., endoglucanase activity) to identify
amino acid residues that are critical to the activity of the
molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271:
4699-4708. The active site of the enzyme or other biological
interaction can also be determined by physical analysis of
structure, as determined by such techniques as nuclear magnetic
resonance, crystallography, electron diffraction, or photoaffinity
labeling, in conjunction with mutation of putative contact site
amino acids. See, for example, de Vos et al., 1992, Science 255:
306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver
et al., 1992, FEBS Lett. 309:59-64. The identities of essential
amino acids can also be inferred from analysis of identities with
polypeptides which are related to a polypeptide according to the
invention.
[0070] Single or multiple amino acid substitutions can be made and
tested using known methods of mutagenesis, recombination, and/or
shuffling, followed by a relevant screening procedure, such as
those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241:
53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86:
2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be
used include error-prone PCR, phage display (e.g., Lowman et al.,
1991, Biochem. 30:10832-10837; U.S. Pat. No. 5,223,409; WO
92/06204), and region-directed mutagenesis (Derbyshire et al.,
1986, Gene 46:145; Ner et al., 1988, DNA 7:127).
Sources of Polypeptides Having Endoglucanase Activity
[0071] A polypeptide of the present invention may be obtained from
microorganisms of any genus. For purposes of the present invention,
the term "obtained from" as used herein in connection with a given
source shall mean that the polypeptide encoded by a nucleotide
sequence is produced by the source or by a strain in which the
nucleotide sequence from the source has been inserted. In a
preferred aspect, the polypeptide obtained from a given source is
secreted extracellularly.
[0072] A polypeptide of the present invention may be a bacterial
polypeptide. For example, the polypeptide may be a gram positive
bacterial polypeptide such as a Bacillus polypeptide, e.g., a
Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis,
Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus
lentus, Bacillus lichenifonnis, Bacillus megaterium, Bacillus
stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis
polypeptide; or a Streptomyces polypeptide, e.g., a Streptomyces
lividans or Streptomyces murinus polypeptide; or a gram negative
bacterial polypeptide, e.g., an E. coli or a Pseudomonas sp.
polypeptide.
[0073] In another preferred aspect, the polypeptide is a Bacillus
sp. ACE160 polypeptide e.g., the polypeptide of SEQ ID NO:2.
[0074] It will be understood that for the aforementioned species,
the invention encompasses both the perfect and imperfect states,
and other taxonomic equivalents, e.g., anamorphs, regardless of the
species name by which they are known. Those skilled in the art will
readily recognize the identity of appropriate equivalents.
[0075] Strains of these species are readily accessible to the
public in a number of culture collections, such as the American
Type Culture Collection (ATCC), Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH (DSMZ), Centraalbureau Voor
Schimmelcultures (CBS), and Agricultural Research Service Patent
Culture Collection, Northern Regional Research Center (NRRL).
[0076] Furthermore, such polypeptides may be identified and
obtained from other sources including microorganisms isolated from
nature (e.g., soil, composts, water, etc.) using the
above-mentioned probes. Techniques for isolating microorganisms
from natural habitats are well known in the art. The polynucleotide
may then be obtained by similarly screening a genomic or cDNA
library of another microorganism. Once a polynucleotide sequence
encoding a polypeptide has been detected with the probe(s), the
polynucleotide can be isolated or cloned by utilizing techniques
which are well known to those of ordinary skill in the art (see,
e.g., Sambrook et al., 1989, supra).
[0077] Polypeptides of the present invention also include fused
polypeptides or cleavable fusion polypeptides in which another
polypeptide is fused at the N-terminus or the C-terminus of the
polypeptide or fragment thereof. A fused polypeptide is produced by
fusing a nucleotide sequence (or a portion thereof) encoding
another polypeptide to a nucleotide sequence (or a portion thereof)
of the present invention. Techniques for producing fusion
polypeptides are known in the art, and include ligating the coding
sequences encoding the polypeptides so that they are in frame and
that expression of the fused polypeptide is under control of the
same promoter(s) and terminator.
Polynucleotides
[0078] The present invention also relates to isolated
polynucleotides having a nucleotide sequence which encode a
polypeptide of the present invention. In a preferred aspect, the
nucleotide sequence is set forth in SEQ ID NO:1. In another
preferred aspect, the nucleotide sequence is the mature polypeptide
coding region of SEQ ID NO:1. The present invention also
encompasses nucleotide sequences which encode a polypeptide having
the amino acid sequence of SEQ ID NO:2 or the mature polypeptide
thereof, which differs from SEQ ID NO:1 by virtue of the degeneracy
of the genetic code. The present invention also relates to
subsequences of SEQ ID NO:1 which encode fragments of SEQ ID NO:2
that have endoglucanase activity, such as the catalytic core domain
of amino acid 65 to 347 of SEQ ID NO:2 or the fragment of amino
acid 368 to 569 of SEQ ID NO:2.
[0079] The present invention also relates to mutant polynucleotides
comprising at least one mutation in the mature polypeptide coding
sequence of SEQ ID NO:1, in which the mutant nucleotide sequence
encodes a polypeptide which consists of amino acids 1 to 759 of SEQ
ID NO:2.
[0080] The techniques used to isolate or clone a polynucleotide
encoding a polypeptide are known in the art and include isolation
from genomic DNA, preparation from cDNA, or a combination thereof.
The cloning of the polynucleotides of the present invention from
such genomic DNA can be effected, e.g., by using the well known
polymerase chain reaction (PCR) or antibody screening of expression
libraries to detect cloned DNA fragments with shared structural
features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods
and Application, Academic Press, New York. Other nucleic acid
amplification procedures such as ligase chain reaction (LCR),
ligated activated transcription (LAT) and nucleotide sequence-based
amplification (NASBA) may be used. The polynucleotides may be
cloned from a strain of Bacillus, or another or related organism
and thus, for example, may be an allelic or species variant of the
polypeptide encoding region of the nucleotide sequence.
[0081] The present invention also relates to polynucleotides having
nucleotide sequences which have a degree of identity to the mature
polypeptide coding sequence of SEQ ID NO:1 (i.e., nucleotides 100
to 2376) of at least 60%, preferably at least 65%, more preferably
at least 70%, more preferably at least 75%, more preferably at
least 80%, more preferably at least 85%, more preferably at least
90%, even more preferably at least 95%, and most preferably at
least 97% identity, which encode an active polypeptide.
[0082] Modification of a nucleotide sequence encoding a polypeptide
of the present invention may be necessary for the synthesis of
polypeptides substantially similar to the polypeptide. The term
"substantially similar" to the polypeptide refers to non-naturally
occurring forms of the polypeptide. These polypeptides may differ
in some engineered way from the polypeptide isolated from its
native source, e.g., artificial variants that differ in specific
activity, thermostability, pH optimum, or the like. The variant
sequence may be constructed on the basis of the nucleotide sequence
presented as the polypeptide encoding region of SEQ ID NO:1, e.g.,
a subsequence thereof, and/or by introduction of nucleotide
substitutions which do not give rise to another amino acid sequence
of the polypeptide encoded by the nucleotide sequence, but which
correspond to the codon usage of the host organism intended for
production of the enzyme, or by introduction of nucleotide
substitutions which may give rise to a different amino acid
sequence. For a general description of nucleotide substitution,
see, e.g., Ford et al., 1991, Protein Expression and Purification
2: 95-107.
[0083] It will be apparent to those skilled in the art that such
substitutions can be made outside the regions critical to the
function of the molecule and still result in an active polypeptide.
Amino acid residues essential to the activity of the polypeptide
encoded by an isolated polynucleotide of the invention, and
therefore preferably not subject to substitution, may be identified
according to procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham
and Wells, 1989, Science 244: 1081-1085). In the latter technique,
mutations are introduced at every positively charged residue in the
molecule, and the resultant mutant molecules are tested for
endoglucanase activity to identify amino acid residues that are
critical to the activity of the molecule. Sites of substrate-enzyme
interaction can also be determined by analysis of the
three-dimensional structure as determined by such techniques as
nuclear magnetic resonance analysis, crystallography or
photoaffinity labelling (see, e.g., deVos et al., 1992, Science
255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224:
899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
[0084] The present invention also relates to isolated
polynucleotides encoding a polypeptide of the present invention,
which hybridize under very low stringency conditions, preferably
low stringency conditions, more preferably medium stringency
conditions, more preferably medium-high stringency conditions, even
more preferably high stringency conditions, and most preferably
very high stringency conditions with (i) nucleotides 100 to 2376 of
SEQ ID NO:1, (ii) nucleotides 193 to 1041 of SEQ ID NO:1, (iii)
nucleotides 1104 to 1707 of SEQ ID NO:1 or (iv) a complementary
strand of (i) to (iii); or allelic variants and subsequences
thereof (Sambrook et al., 1989, supra), as defined herein.
[0085] The present invention also relates to isolated
polynucleotides obtained by (a) hybridizing a population of DNA
under very low, low, medium, medium-high, high, or very high
stringency conditions with (i) nucleotides 100 to 2376 of SEQ ID
NO:1, or (ii) a complementary strand of (i); and (b) isolating the
hybridizing polynucleotide, which encodes a polypeptide having
endoglucanase activity.
Nucleic Acid Constructs
[0086] The present invention also relates to nucleic acid
constructs comprising an isolated polynucleotide of the present
invention operably linked to one or more control sequences which
direct the expression of the coding sequence in a suitable host
cell under conditions compatible with the control sequences.
[0087] An isolated polynucleotide encoding a polypeptide of the
present invention may be manipulated in a variety of ways to
provide for expression of the polypeptide. Manipulation of the
polynucleotide's sequence prior to its insertion into a vector may
be desirable or necessary depending on the expression vector. The
techniques for modifying polynucleotide sequences utilizing
recombinant DNA methods are well known in the art.
[0088] The control sequence may be an appropriate promoter
sequence, a nucleotide sequence which is recognized by a host cell
for expression of a polynucleotide encoding a polypeptide of the
present invention. The promoter sequence contains transcriptional
control sequences which mediate the expression of the polypeptide.
The promoter may be any nucleotide sequence which shows
transcriptional activity in the host cell of choice including
mutant, truncated, and hybrid promoters, and may be obtained from
genes encoding extracellular or intracellular polypeptides either
homologous or heterologous to the host cell.
[0089] Examples of suitable promoters for directing the
transcription of the nucleic acid constructs of the present
invention, especially in a bacterial host cell, are the promoters
obtained from the E. coli lac operon, Streptomyces coelicolor
agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB),
Bacillus lichenifonnis alpha-amylase gene (amyL), Bacillus
stearothermophilus maltogenic amylase gene (amyM), Bacillus
amyloliquefaciens alpha-amylase gene (amyQ), Bacillus lichenifonnis
penicillinase gene (penP), Bacillus subtilis xylA and xylB genes,
and prokaryotic beta-lactamase gene (VIIIa-Kamaroff et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 3727-3731),
as well as the tac promoter (DeBoer et al., 1983, Proceedings of
the National Academy of Sciences USA 80: 21-25). Further promoters
are described in "Useful proteins from recombinant bacteria" in
Scientific American, 1980, 242: 74-94; and in Sambrook et al.,
1989, supra.
[0090] Examples of suitable promoters for directing the
transcription of the nucleic acid constructs of the present
invention in a filamentous fungal host cell are promoters obtained
from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor
miehei aspartic proteinase, Aspergillus niger neutral
alpha-amylase, Aspergillus niger acid stable alpha-amylase,
Aspergillus niger or Aspergillus awamori glucoamylase (glaA),
Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans
acetamidase, Fusarium venenatum amyloglucosidase (WO 00/56900),
Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
(WO 00/56900), Fusarium oxysporum trypsin-like protease (WO
96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei
cellobiohydrolase I, Trichoderma reesei endoglucanase I,
Trichoderma reesei endoglucanase II, Trichoderma reesei
endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma
reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma
reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as
the NA2-tpi promoter (a hybrid of the promoters from the genes for
Aspergillus niger neutral alpha-amylase and Aspergillus oryzae
triose phosphate isomerase); and mutant, truncated, and hybrid
promoters thereof.
[0091] In a yeast host, useful promoters are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydro-genase (ADH1,
ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase
(TPI), Saccharomyces cerevisiae metallothionine (CUP1), and
Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful
promoters for yeast host cells are described by Romanos et al.,
1992, Yeast 8: 423-488.
[0092] The control sequence may also be a suitable transcription
terminator sequence, a sequence recognized by a host cell to
terminate transcription. The terminator sequence is operably linked
to the 3' terminus of the nucleotide sequence encoding the
polypeptide. Any terminator which is functional in the host cell of
choice may be used in the present invention.
[0093] Preferred terminators for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase,
Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate
synthase, Aspergillus niger alpha-glucosidase, and Fusarium
oxysporum trypsin-like protease.
[0094] Preferred terminators for yeast host cells are obtained from
the genes for Saccharomyces cerevisiae enolase, Saccharomyces
cerevisiae cytochrome C(CYC1), and Saccharomyces cerevisiae
glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators
for yeast host cells are described by Romanos et al., 1992,
supra.
[0095] The control sequence may also be a suitable leader sequence,
a nontranslated region of an mRNA which is important for
translation by the host cell. The leader sequence is operably
linked to the 5' terminus of the nucleotide sequence encoding the
polypeptide. Any leader sequence that is functional in the host
cell of choice may be used in the present invention.
[0096] Preferred leaders for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase and
Aspergillus nidulans triose phosphate isomerase.
[0097] Suitable leaders for yeast host cells are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae
alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH2/GAP).
[0098] The control sequence may also be a polyadenylation sequence,
a sequence operably linked to the 3' terminus of the nucleotide
sequence and which, when transcribed, is recognized by the host
cell as a signal to add polyadenosine residues to transcribed mRNA.
Any polyadenylation sequence which is functional in the host cell
of choice may be used in the present invention.
[0099] Preferred polyadenylation sequences for filamentous fungal
host cells are obtained from the genes for Aspergillus oryzae TAKA
amylase, Aspergillus niger glucoamylase, Aspergillus nidulans
anthranilate synthase, Fusarium oxysporum trypsin-like protease,
and Aspergillus niger alpha-glucosidase.
[0100] Useful polyadenylation sequences for yeast host cells are
described by Guo and Sherman, 1995, Molecular Cellular Biology 15:
5983-5990.
[0101] The control sequence may also be a signal peptide coding
region that codes for an amino acid sequence linked to the amino
terminus of a polypeptide and directs the encoded polypeptide into
the cell's secretory pathway. The 5' end of the coding sequence of
the nucleotide sequence may inherently contain a signal peptide
coding region naturally linked in translation reading frame with
the segment of the coding region which encodes the secreted
polypeptide. Alternatively, the 5' end of the coding sequence may
contain a signal peptide coding region which is foreign to the
coding sequence. The foreign signal peptide coding region may be
required where the coding sequence does not naturally contain a
signal peptide coding region. Alternatively, the foreign signal
peptide coding region may simply replace the natural signal peptide
coding region in order to enhance secretion of the polypeptide.
However, any signal peptide coding region which directs the
expressed polypeptide into the secretory pathway of a host cell of
choice may be used in the present invention.
[0102] Effective signal peptide coding regions for bacterial host
cells are the signal peptide coding regions obtained from the genes
for Bacillus NCIB 11837 maltogenic amylase, Bacillus
stearothermophilus alpha-amylase, Bacillus licheniformis
subtilisin, Bacillus licheniformis beta-lactamase, Bacillus
stearothermophilus neutral proteases (nprT, nprS, nprM), and
Bacillus subtilis prsA. Further signal peptides are described by
Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
[0103] Effective signal peptide coding regions for filamentous
fungal host cells are the signal peptide coding regions obtained
from the genes for Aspergillus oryzae TAKA amylase, Aspergillus
niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor
miehei aspartic proteinase, Humicola insolens cellulase, and
Humicola lanuginosa lipase.
[0104] In a preferred aspect, the signal peptide coding region is
nucleotides 1 to 99 of SEQ ID NO:1 which encode amino acids -33 to
-1 of SEQ ID NO:2.
[0105] Useful signal peptides for yeast host cells are obtained
from the genes for Saccharomyces cerevisiae alpha-factor and
Saccharomyces cerevisiae invertase. Other useful signal peptide
coding regions are described by Romanos et al., 1992, supra.
[0106] The control sequence may also be a propeptide coding region
that codes for an amino acid sequence positioned at the amino
terminus of a polypeptide. The resultant polypeptide is known as a
proenzyme or propolypeptide (or a zymogen in some cases). A
propolypeptide is generally inactive and can be converted to a
mature active polypeptide by catalytic or autocatalytic cleavage of
the propeptide from the propolypeptide. The propeptide coding
region may be obtained from the genes for Bacillus subtilis
alkaline protease (aprE), Bacillus subtilis neutral protease
(nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei
aspartic proteinase, and Myceliophthora thermophila laccase (WO
95/33836).
[0107] Where both signal peptide and propeptide regions are present
at the amino terminus of a polypeptide, the propeptide region is
positioned next to the amino terminus of a polypeptide and the
signal peptide region is positioned next to the amino terminus of
the propeptide region.
[0108] It may also be desirable to add regulatory sequences which
allow the regulation of the expression of the polypeptide relative
to the growth of the host cell. Examples of regulatory systems are
those which cause the expression of the gene to be turned on or off
in response to a chemical or physical stimulus, including the
presence of a regulatory compound. Regulatory systems in
prokaryotic systems include the lac, tac, and trp operator systems.
In yeast, the ADH2 system or GALL system may be used. In
filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus
niger glucoamylase promoter, and Aspergillus oryzae glucoamylase
promoter may be used as regulatory sequences. Other examples of
regulatory sequences are those which allow for gene amplification.
In eukaryotic systems, these include the dihydrofolate reductase
gene which is amplified in the presence of methotrexate, and the
metallothionein genes which are amplified with heavy metals. In
these cases, the nucleotide sequence encoding the polypeptide would
be operably linked with the regulatory sequence.
Expression Vectors
[0109] The present invention also relates to recombinant expression
vectors comprising a polynucleotide of the present invention, a
promoter, and transcriptional and translational stop signals. The
various nucleic acids and control sequences described above may be
joined together to produce a recombinant expression vector which
may include one or more convenient restriction sites to allow for
insertion or substitution of the nucleotide sequence encoding the
polypeptide at such sites. Alternatively, a nucleotide sequence of
the present invention may be expressed by inserting the nucleotide
sequence or a nucleic acid construct comprising the sequence into
an appropriate vector for expression. In creating the expression
vector, the coding sequence is located in the vector so that the
coding sequence is operably linked with the appropriate control
sequences for expression.
[0110] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) which can be conveniently subjected to
recombinant DNA procedures and can bring about expression of the
nucleotide sequence. The choice of the vector will typically depend
on the compatibility of the vector with the host cell into which
the vector is to be introduced. The vectors may be linear or closed
circular plasmids.
[0111] The vector may be an autonomously replicating vector, i.e.,
a vector which exists as an extrachromosomal entity, the
replication of which is independent of chromosomal replication,
e.g., a plasmid, an extrachromosomal element, a minichromosome, or
an artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
which, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids which together contain the total DNA to
be introduced into the genome of the host cell, or a transposon may
be used.
[0112] The vectors of the present invention preferably contain one
or more selectable markers which permit easy selection of
transformed cells. A selectable marker is a gene the product of
which provides for biocide or viral resistance, resistance to heavy
metals, prototrophy to auxotrophs, and the like.
[0113] A conditionally essential gene may function as a
non-antibiotic selectable marker. Non-limiting examples of
bacterial conditionally essential non-antibiotic selectable markers
are the dal genes from Bacillus subtilis, Bacillus licheniformis,
or other Bacilli, that are only essential when the bacterium is
cultivated in the absence of D-alanine. Also the genes encoding
enzymes involved in the turnover of UDP-galactose can function as
conditionally essential markers in a cell when the cell is grown in
the presence of galactose or grown in a medium which gives rise to
the presence of galactose. Non-limiting examples of such genes are
those from B. subtilis or B. licheniformis encoding UTP-dependent
phosphorylase (EC 2.7.7.10), UDP-glucose-dependent
uridylyltransferase (EC 2.7.7.12), or UDP-galactose epimerase (EC
5.1.3.2). Also a xylose isomerase gene such as xylA, of Bacilli can
be used as selectable markers in cells grown in minimal medium with
xylose as sole carbon source. The genes necessary for utilizing
gluconate, gntK, and gntP can also be used as selectable markers in
cells grown in minimal medium with gluconate as sole carbon source.
Other examples of conditionally essential genes are known in the
art. Antibiotic selectable markers confer antibiotic resistance to
such antibiotics as ampicillin, kanamycin, chloramphenicol,
erythromycin, tetracycline, neomycin, hygromycin or
methotrexate.
[0114] Suitable markers for yeast host cells are ADE2, HIS3, LEU2,
LYS2, MET3, TRP1, and URA3. Selectable markers for use in a
filamentous fungal host cell include, but are not limited to, amdS
(acetamidase), argB (ornithine carbamoyltransferase), bar
(phosphinothricin acetyltransferase), hph (hygromycin
phosphotransferase), niaD (nitrate reductase), pyrG
(orotidine-5'-phosphate decarboxylase), sC (sulfate
adenyltransferase), and trpC (anthranilate synthase), as well as
equivalents thereof. Preferred for use in an Aspergillus cell are
the amdS and pyrG genes of Aspergillus nidulans or Aspergillus
oryzae and the bar gene of Streptomyces hygroscopicus.
[0115] The vectors of the present invention preferably contain an
element(s) that permits integration of the vector into the host
cell's genome or autonomous replication of the vector in the cell
independent of the genome.
[0116] For integration into the host cell genome, the vector may
rely on the polynucleotide's sequence encoding the polypeptide or
any other element of the vector for integration into the genome by
homologous or nonhomologous recombination. Alternatively, the
vector may contain additional nucleotide sequences for directing
integration by homologous recombination into the genome of the host
cell at a precise location(s) in the chromosome(s). To increase the
likelihood of integration at a precise location, the integrational
elements should preferably contain a sufficient number of nucleic
acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000
base pairs, and most preferably 800 to 10,000 base pairs, which
have a high degree of identity with the corresponding target
sequence to enhance the probability of homologous recombination.
The integrational elements may be any sequence that is homologous
with the target sequence in the genome of the host cell.
Furthermore, the integrational elements may be non-encoding or
encoding nucleotide sequences. On the other hand, the vector may be
integrated into the genome of the host cell by non-homologous
recombination.
[0117] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the host cell in question. The origin of
replication may be any plasmid replicator mediating autonomous
replication which functions in a cell. The term "origin of
replication" or "plasmid replicator" is defined herein as a
nucleotide sequence that enables a plasmid or vector to replicate
in vivo.
[0118] Examples of bacterial origins of replication are the origins
of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184
permitting replication in E. coli, and pUB110, pE194, pTA1060, and
pAMf1 permitting replication in Bacillus.
[0119] Examples of origins of replication for use in a yeast host
cell are the 2 micron origin of replication, ARS1, ARS4, the
combination of ARS1 and CEN3, and the combination of ARS4 and
CEN6.
[0120] Examples of origins of replication useful in a filamentous
fungal cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67;
Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO
00/24883). Isolation of the AMA1 gene and construction of plasmids
or vectors comprising the gene can be accomplished according to the
methods disclosed in WO 00/24883.
[0121] More than one copy of a polynucleotide of the present
invention may be inserted into the host cell to increase production
of the gene product. An increase in the copy number of the
polynucleotide can be obtained by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable selectable marker gene with the
polynucleotide where cells containing amplified copies of the
selectable marker gene, and thereby additional copies of the
polynucleotide, can be selected for by cultivating the cells in the
presence of the appropriate selectable agent.
[0122] The procedures used to ligate the elements described above
to construct the recombinant expression vectors of the present
invention are well known to one skilled in the art (see, e.g.,
Sambrook et al., 1989, supra).
Host Cells
[0123] The present invention also relates to recombinant host
cells, comprising a polynucleotide of the present invention, which
are advantageously used in the recombinant production of the
polypeptides. A vector comprising a polynucleotide of the present
invention is introduced into a host cell so that the vector is
maintained as a chromosomal integrant or as a self-replicating
extra-chromosomal vector as described earlier. The term "host cell"
encompasses any progeny of a parent cell that is not identical to
the parent cell due to mutations that occur during replication. The
choice of a host cell will to a large extent depend upon the gene
encoding the polypeptide and its source.
[0124] The host cell may be a unicellular microorganism, e.g., a
prokaryote, or a non-unicellular microorganism, e.g., a
eukaryote.
[0125] Useful unicellular microorganisms are bacterial cells such
as gram positive bacteria including, but not limited to, a Bacillus
cell, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens,
Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus
coagulans, Bacillus lautus, Bacillus lentus, Bacillus
licheniformis, Bacillus megaterium, Bacillus stearothermophilus,
Bacillus subtilis, and Bacillus thuringiensis; or a Streptomyces
cell, e.g., Streptomyces lividans and Streptomyces murinus, or gram
negative bacteria such as E. coli and Pseudomonas sp. In a
preferred aspect, the bacterial host cell is a Bacillus lentus,
Bacillus licheniformis, Bacillus stearothermophilus, or Bacillus
subtilis cell. In another preferred aspect, the Bacillus cell is an
alkalophilic Bacillus.
[0126] The introduction of a vector into a bacterial host cell may,
for instance, be effected by protoplast transformation (see, e.g.,
Chang and Cohen, 1979, Molecular General Genetics 168: 111-115),
using competent cells (see, e.g., Young and Spizizin, 1961, Journal
of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971,
Journal of Molecular Biology 56: 209-221), electroporation (see,
e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or
conjugation (see, e.g., Koehler and Thorne, 1987, Journal of
Bacteriology 169: 5771-5278).
[0127] The host cell may also be a eukaryote, such as a mammalian,
insect, plant, or fungal cell.
[0128] In a preferred aspect, the host cell is a fungal cell.
"Fungi" as used herein includes the phyla Ascomycota,
Basidiomycota, Chytridiomycota, and Zygomycota (as defined by
Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The
Fungi, 8th edition, 1995, CAB International, University Press,
Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et
al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et
al., 1995, supra).
[0129] In a more preferred aspect, the fungal host cell is a yeast
cell. "Yeast" as used herein includes ascosporogenous yeast
(Endomycetales), basidiosporogenous yeast, and yeast belonging to
the Fungi Imperfecti (Blastomycetes). Since the classification of
yeast may change in the future, for the purposes of this invention,
yeast shall be defined as described in Biology and Activities of
Yeast (Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds,
Soc. App. Bacteriol. Symposium Series No. 9, 1980).
[0130] In an even more preferred aspect, the yeast host cell is a
Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces,
Schizosaccharomyces, or Yarrowia cell.
[0131] In a most preferred aspect, the yeast host cell is a
Saccharomyces carlsbergensis, Saccharomyces cerevisiae,
Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces
kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell.
In another most preferred aspect, the yeast host cell is a
Kluyveromyces lactis cell. In another most preferred aspect, the
yeast host cell is a Yarrowia lipolytica cell.
[0132] In another more preferred aspect, the fungal host cell is a
filamentous fungal cell. "Filamentous fungi" include all
filamentous forms of the subdivision Eumycota and Oomycota (as
defined by Hawksworth et al., 1995, supra). The filamentous fungi
are generally characterized by a mycelial wall composed of chitin,
cellulose, glucan, chitosan, mannan, and other complex
polysaccharides. Vegetative growth is by hyphal elongation and
carbon catabolism is obligately aerobic. In contrast, vegetative
growth by yeasts such as Saccharomyces cerevisiae is by budding of
a unicellular thallus and carbon catabolism may be
fermentative.
[0133] In an even more preferred aspect, the filamentous fungal
host cell is an Acremonium, Aspergillus, Aureobasidium,
Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus,
Filobasidium, Fusarium, Humicola, Magnaporthe, Mucor,
Myceliophthora, Neocallimastix, Neurospora, Paecilomyces,
Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus,
Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium,
Trametes, or Trichoderma cell.
[0134] In a most preferred aspect, the filamentous fungal host cell
is an Aspergillus awamori, Aspergillus fumigatus, Aspergillus
foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus
niger or Aspergillus oryzae cell. In another most preferred aspect,
the filamentous fungal host cell is a Fusarium bactridioides,
Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum,
Fusarium graminearum, Fusarium graminum, Fusarium heterosporum,
Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,
Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum,
Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum,
Fusarium trichothecioides, or Fusarium venenatum cell. In another
most preferred aspect, the filamentous fungal host cell is a
Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina,
Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis
pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, or
Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus,
Humicola insolens, Humicola lanuginosa, Mucor miehei,
Myceliophthora thermophila, Neurospora crassa, Penicillium
purpurogenum, Phanerochaete chrysosporium, Phlebia radiata,
Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes
versicolor, Trichoderma harzianum, Trichoderma koningii,
Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma
viride strain cell.
[0135] Fungal cells may be transformed by a process involving
protoplast formation, transformation of the protoplasts, and
regeneration of the cell wall in a manner known per se. Suitable
procedures for transformation of Aspergillus and Trichoderma host
cells are described in EP 238 023 and Yelton et al., 1984,
Proceedings of the National Academy of Sciences USA 81: 1470-1474.
Suitable methods for transforming Fusarium species are described by
Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast
may be transformed using the procedures described by Becker and
Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to
Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume
194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983,
Journal of Bacteriology 153: 163; and Hinnen et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 1920.
Methods of Production
[0136] The present invention also relates to methods for producing
a polypeptide of the present invention, comprising (a) cultivating
a cell, which in its wild-type form is capable of producing the
polypeptide, under conditions conducive for production of the
polypeptide; and (b) recovering the polypeptide. Preferably, the
cell is of the genus Bacillus.
[0137] The present invention also relates to methods for producing
a polypeptide of the present invention, comprising (a) cultivating
a host cell under conditions conducive for production of the
polypeptide; and (b) recovering the polypeptide.
[0138] The present invention also relates to methods for producing
a polypeptide of the present invention, comprising (a) cultivating
a host cell under conditions conducive for production of the
polypeptide, wherein the host cell comprises a mutant nucleotide
sequence having at least one mutation in the mature polypeptide
coding region of SEQ ID NO: 1, wherein the mutant nucleotide
sequence encodes a polypeptide which comprises amino acids 1-759 of
SEQ ID NO:2, or amino acids 65 to 347 of SEQ ID NO:2 or amino acids
368 to 569 of SEQ ID NO:2, and (b) recovering the polypeptide.
[0139] In the production methods of the present invention, the
cells are cultivated in a nutrient medium suitable for production
of the polypeptide using methods well known in the art. For
example, the cell may be cultivated by shake flask cultivation, and
small-scale or large-scale fermentation (including continuous,
batch, fed-batch, or solid state fermentations) in laboratory or
industrial fermentors performed in a suitable medium and under
conditions allowing the polypeptide to be expressed and/or
isolated. The cultivation takes place in a suitable nutrient medium
comprising carbon and nitrogen sources and inorganic salts, using
procedures known in the art. Suitable media are available from
commercial suppliers or may be prepared according to published
compositions (e.g., in catalogues of the American Type Culture
Collection). If the polypeptide is secreted into the nutrient
medium, the polypeptide can be recovered directly from the medium.
If the polypeptide is not secreted, it can be recovered from cell
lysates.
[0140] The polypeptides may be detected using methods known in the
art that are specific for the polypeptides. These detection methods
may include use of specific antibodies, formation of an enzyme
product, or disappearance of an enzyme substrate. For example, an
enzyme assay may be used to determine the activity of the
polypeptide as described herein.
[0141] The resulting polypeptide may be recovered using methods
known in the art. For example, the polypeptide may be recovered
from the nutrient medium by conventional procedures including, but
not limited to, centrifugation, filtration, extraction,
spray-drying, evaporation, or precipitation.
[0142] The polypeptides of the present invention may be purified by
a variety of procedures known in the art including, but not limited
to, chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing, and size exclusion), electrophoretic procedures
(e.g., preparative isoelectric focusing), differential solubility
(e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction
(see, e.g., Protein Purification, J.-C. Janson and Lars Ryden,
editors, VCH Publishers, New York, 1989).
[0143] The present invention also relates to isolated enzymes
having endo-beta-1,4-glucanse activity and which are produced by
one of the above mentioned methods, preferably by recombinant
production techniques. The isolated enzymes are preferably free
from homologous impurities. Such impurities may arise from
endogenous endo-beta-1,4-glucanse genes, hence if production is
performed in a host cell which does not express endogenous
polypeptides with endo-beta-1,4-glucanse activity, the enzyme will
be free of homologous impurities.
Compositions
[0144] The present invention also relates to compositions
comprising a polypeptide of the present invention. Preferably, the
compositions are enriched in such a polypeptide. The term
"enriched" indicates that the endoglucanase activity of the
composition has been increased, e.g., with an enrichment factor of
1.1.
[0145] The composition may comprise a polypeptide of the present
invention as the major enzymatic component, e.g., a mono-component
composition. Alternatively, the composition may comprise multiple
enzymatic activities, such as an aminopeptidase, amylase,
carbohydrase, carboxypeptidase, catalase, cellulase, chitinase,
cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease,
esterase, alpha-galactosidase, beta-galactosidase, glucoamylase,
alpha-glucosidase, beta-glucosidase, haloperoxidase, invertase,
laccase, lipase, mannosidase, oxidase, pectinolytic enzyme,
peptidoglutaminase, peroxidase, phytase, polyphenoloxidase,
proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
The additional enzyme(s) may be produced, for example, by a
microorganism belonging to the genus Aspergillus, preferably
Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus,
Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans,
Aspergillus niger, or Aspergillus oryzae; Fusarium, preferably
Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,
Fusarium culmorum, Fusarium graminearum, Fusarium graminum,
Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum,
Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum,
Fusarium sarcochroum, Fusarium sulphureum, Fusarium toruloseum,
Fusarium trichothecioides, or Fusarium venenatum; Humicola,
preferably Humicola insolens or Humicola lanuginosa; or
Trichoderma, preferably Trichoderma harzianum, Trichoderma
koningii, Trichoderma longibrachiatum, Trichoderma reesei, or
Trichoderma viride.
[0146] The polypeptide compositions may be prepared in accordance
with methods known in the art and may be in the form of a liquid or
a dry composition. For instance, the polypeptide composition may be
in the form of a granulate or a microgranulate. The polypeptide to
be included in the composition may be stabilized in accordance with
methods known in the art.
[0147] Examples are given below of preferred uses of the
polypeptide compositions of the invention. The dosage of the
polypeptide composition of the invention and other conditions under
which the composition is used may be determined on the basis of
methods known in the art.
Uses
Textile Applications
[0148] In another embodiment, the present invention relates to use
of the endoglucanase of the invention in textile finishing
processes, such as bio-polishing. Bio-polishing is a specific
treatment of the yarn surface which improves fabric quality with
respect to handle and appearance without loss of fabric
wettability. The most important effects of bio-polishing can be
characterized by less fuzz and pilling, increased gloss/luster,
improved fabric handle, increased durable softness and altered
water absorbency. Bio-polishing usually takes place in the wet
processing during the manufacture of knitted and woven fabrics. Wet
processing comprises such steps as e.g. desizing, scouring,
bleaching, washing, dying/printing and finishing. During each of
these steps, the fabric is more or less subjected to mechanical
action. In general, after the textiles have been knitted or woven,
the fabric proceeds to an optional desizing stage, followed by a
scouring stage, etc. Desizing is the act of removing size from
textiles. Prior to weaving on mechanical looms, warp yarns are
often coated with size consisting of starch or starch derivatives
in order to increase their tensile strength. After weaving, the
size coating must be removed before further processing of the
fabric in order to ensure a homogeneous and wash-proof result. In
the scouring process impurities are removed from the fabric. The
endoglucanase of the invention can advantageously be used in the
scouring of cellulosic and cotton textiles, as well as bast fibers
and may improve efficiency of removal of impurities.
[0149] One of the most commonly used methods for delivering durable
press to cellulosic textiles is via finishing with cellulose
crosslinking chemistry. Crosslinking immobilizes cellulose at a
molecular level and substantially reduces shrinking and wrinkling
of cellulosic garments. Treatment of durable press treated
cellulosic textiles with the endo-glucanase of the invention may
result in a selective relaxation of stressed regions to minimize
edge abrasion. Additionally, the endoglucanase of the invention can
be used to efficiently remove excess carboxymethyl cellulose-based
print paste from textile and equipment used in the printing
process.
[0150] It is known that in order to achieve the effects of
bio-polishing, a combination of cellulolytic and mechanical action
is required. It is also known that "super-softness" is achievable
when the treatment with a cellulase is combined with a conventional
treatment with softening agents. It is contemplated that use of the
endoglucanase of the invention and of combinations of this enzyme
with other enzymes for bio-polishing of cellulosics (natural and
manufactured cellulosics, fabrics, garments, yarns, and fibers) is
advantageous, e.g. a more thorough polishing can be achieved. It is
believed that bio-polishing may be obtained by applying the method
described e.g. in WO 93/20278. It is further contemplated that the
endoglucanase of the invention can be applied to simultaneous or
sequential textile wet processes, including different combinations
of desizing, scouring, bleaching, bio-polishing, dyeing, and
finishing.
Stone-Washing
[0151] It is known that a "stone-washed" look (localized abrasion
of the colour) in dyed fabric, especially in denim fabric or jeans,
can be provided either by washing the denim or jeans made from such
fabric in the presence of pumice stones to provide the desired
localized lightening of the colour of the fabric or by treating the
fabric enzymatically, in particular with cellulytic enzymes. The
treatment with an endoglucanase of the present invention, alone or
in combination with other enzymes, may be carried out either alone
such as disclosed in U.S. Pat. No. 4,832,864, together with a
smaller amount of pumice than required in the traditional process,
or together with perlite such as disclosed in WO 95/09225.
Treatment of denim fabric with the endoglucanase of the invention
may reduce backstaining compared to conventional methods.
Biomass Degradation
[0152] The enzyme or the enzyme composition according to the
invention may be applied advantageously e.g. as follows: [0153] For
debarking, i.e. pre-treatment with hydrolytic enzymes which may
partly degrade the pectin-rich cambium layer prior to debarking in
mechanical drums resulting in advantageous energy savings. [0154]
For defibration (refining or beating), i.e. treatment of material
containing cellulosic fibers with hydrolytic enzymes prior to the
refining or beating which results in reduction of the energy
consumption due to the hydrolysing effect of the enzymes on the
surfaces of the fibers. [0155] For fibre modification, i.e.
improvement of fibre properties where partial hydrolysis across the
fibre wall is needed which requires deeper penetrating enzymes
(e.g. in order to make coarse fibers more flexible). [0156] For
drainage: The drainability of papermaking pulps may be improved by
treatment of the pulp with hydrolysing enzymes. Use of the enzyme
or enzyme composition of to the invention may be more effective,
e.g. result in a higher degree of loosening bundles of strongly
hydrated micro-fibrils in the fines fraction that limits the rate
of drainage by blocking hollow spaces between the fibers and in the
wire mesh of the paper machine.
[0157] The treatment of lignocellulosic pulp may, e.g., be
performed as described in WO 93/08275, WO 91/02839 and WO
92/03608.
Laundry
[0158] The enzyme or enzyme composition of the invention may be
useful in a detergent composition for household or industrial
laundering of textiles and garments, and in a process for machine
wash treatment of fabrics comprising treating the fabrics during
one or more washing cycle of a machine washing process with a
washing solution containing the enzyme or enzyme preparation of the
invention.
[0159] Typically, the detergent composition used in the washing
process comprises conventional ingredients such as surfactants
(anionic, nonionic, zwitterionic, amphoteric), builders, bleaches
(perborates, percarbonates or hydrogen peroxide) and other
ingredients, e.g. as described in WO 97/01629 which is hereby
incorporated by reference in its entirety.
Detergent Applications
[0160] The enzyme of the invention may be added to and thus become
a component of a detergent composition.
[0161] The detergent composition of the invention may for example
be formulated as a hand or machine laundry detergent composition
including a laundry additive composition suitable for pre-treatment
of stained fabrics and a rinse added fabric softener composition,
or be formulated as a detergent composition for use in general
household hard surface cleaning operations, or be formulated for
hand or machine dishwashing operations, especially for automatic
dish washing (ADW).
[0162] The endo-beta-1,4-glucanase of the invention provides
advantages such as improved stain removal and decreased soil
redeposition. Certain stains, for example certain food stains,
contain beta-glucans which make complete removal of the stain
difficult to achieve. Also, the cellulosic fibres of the fabrics
may possess, particularly in the "non-crystalline" and surface
regions, beta-glucan polymers that are degraded by this enzyme.
Hydrolysis of such beta-glucans, either in the stain or on the
fabric, during the washing process decreases the binding of soils
onto the fabrics.
[0163] Household laundry processes are carried out under a range of
conditions. Commonly, the washing time is from 5 to 60 minutes and
the washing temperature is in the range 15-60.degree. C., most
commonly from 20-40.degree. C. The washing solution is normally
neutral or alkaline, most commonly with pH 7-10.5. Bleaches are
commonly used, particularly for laundry of white fabrics. These
bleaches are commonly the peroxide bleaches, such as sodium
perborate, sodium percarbonate or hydrogen peroxide.
[0164] In a specific aspect, the invention provides a detergent
additive comprising the enzyme of the invention. The detergent
additive as well as the detergent composition may comprise one or
more other enzymes such as a protease, a lipase, a cutinase, an
amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an
arabinase, a galactanase, a xylanase, an oxidase, e.g., a laccase,
and/or a peroxidase.
[0165] In general the properties of the chosen enzyme(s) should be
compatible with the selected detergent, (i.e. pH-optimum,
compatibility with other enzymatic and non-enzymatic ingredients,
etc.), and the enzyme(s) should be present in effective
amounts.
Proteases: Suitable proteases include those of animal, vegetable or
microbial origin. Microbial origin is preferred. Chemically
modified or protein engineered mutants are included. The protease
may be a serine protease or a metallo protease, preferably an
alkaline microbial protease or a trypsin-like protease. Examples of
alkaline proteases are subtilisins, especially those derived from
Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin
309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
Examples of trypsin-like proteases are trypsin (e.g. of porcine or
bovine origin) and the Fusarium protease described in WO 89/06270
and WO 94/25583.
[0166] Examples of useful proteases are the variants described in
WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially
the variants with substitutions in one or more of the following
positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170,
194, 206, 218, 222, 224, 235 and 274.
[0167] Preferred commercially available protease enzymes include
Relase.RTM., Alcalase.RTM., Savinase.RTM., Primase.RTM.,
Everlase.RTM., Esperase.RTM., Ovozyme.RTM., Coronase.RTM.,
Polarzyme.RTM. and Kannase.RTM. (Novozymes A/S), Maxatase.TM.,
Maxacal.TM., Maxapem.TM., Properase.TM., Purafect.TM., Purafect
OXP.TM., FN2.TM., FN3.TM., FN4.TM. and Purafect Prime.TM. (Genencor
International, Inc.), BLAP X and BLAP S (Henkel).
Lipases: Suitable lipases include those of bacterial or fungal
origin. Chemically modified or protein engineered mutants are
included. Examples of useful lipases include lipases from Humicola
(synonym Thermomyces), e.g. from H. lanuginosa (T. lanuginosus) as
described in EP 258 068 and EP 305 216 or from H. insolens as
described in WO 96/13580, a Pseudomonas lipase, e.g. from P.
alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP
331 376), P. stutzeri (GB 1,372,034), P. fluorescens, Pseudomonas
sp. strain SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis
(WO 96/12012), a Bacillus lipase, e.g. from B. subtilis (Dartois et
al. (1993), Biochemica et Biophysica Acta, 1131, 253-360), B.
stearothermophilus (JP 64/744992) or B. pumilus (WO 91/16422).
[0168] Other examples are lipase variants such as those described
in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381,
WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO
97/04079 and WO 97/07202. Preferred commercially available lipase
enzymes include Lipolase.TM. and Lipolase Ultra.TM. (Novozymes
A/S).
Amylases: Suitable amylases (.alpha. and/or .beta.) include those
of bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Amylases include, for example,
.alpha.-amylases obtained from Bacillus, e.g. a special strain of
B. licheniformis, described in more detail in GB 1,296,839.
[0169] Examples of useful amylases are the variants described in WO
94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the
variants with substitutions in one or more of the following
positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188,
190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408, and 444.
Commercially used amylases are Duramyl.RTM., Termamyl.RTM.,
Stainzyme.RTM., Fungamyl.RTM. and BAN.RTM. (Novozymes A/S),
Rapidase.TM., Purastar.TM. and Purastar OxAm.TM. (from Genencor
International Inc.). Cellulases: Other suitable cellulases include
those of bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Suitable cellulases include
cellulases from the genera Bacillus, Pseudomonas, Humicola,
Fusarium, Thielavia, Acremonium, e.g. the fungal cellulases
produced from Humicola insolens, Myceliophthora thermophila and
Fusarium oxysporum disclosed in U.S. Pat. No. 4,435,307, U.S. Pat.
No. 5,648,263, U.S. Pat. No. 5,691,178, U.S. Pat. No. 5,776,757 and
WO 89/09259.
[0170] Especially suitable cellulases are the alkaline or neutral
cellulases having colour care benefits. Examples of such cellulases
are cellulases described in EP 0 495 257, EP 0 531 372, WO
96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase
variants such as those described in WO 94/07998, EP 0 531 315, U.S.
Pat. No. 5,457,046, U.S. Pat. No. 5,686,593, U.S. Pat. No.
5,763,254, WO 95/24471, WO 98/12307 and WO 99/01544.
[0171] Commercially available cellulases include Celluzyme.TM.,
Renozyme.RTM. and Carezyme.TM. (Novozymes A/S), Clazinase.TM., and
Puradax HA.TM. (Genencor International Inc.), and KAC-500(B).TM.
(Kao Corporation).
Peroxidases/Oxidases: Suitable peroxidases/oxidases include those
of plant, bacterial or fungal origin. Chemically modified or
protein engineered mutants are included. Examples of useful
peroxidases include peroxidases from Coprinus, e.g. from C.
cinereus, and variants thereof as those described in WO 93/24618,
WO 95/10602, and WO 98/15257. Commercially available peroxidases
include Guardzyme.TM. (Novozymes A/S). Hemicellulases: Suitable
hemicellulases include those of bacterial or fungal origin.
Chemically modified or protein engineered mutants are included.
Suitable hemicellulases include mannanase, lichenase, xylanase,
arabinase, galactanase acetyl xylan esterase, glucorunidase,
ferulic acid esterase, coumaric acid esterase and
arabinofuranosidase as described in WO 95/35362. Suitable
mannanases are described in WO 99/64619.
[0172] The detergent enzyme(s) may be included in a detergent
composition by adding separate additives containing one or more
enzymes, or by adding a combined additive comprising all of these
enzymes. A detergent additive of the invention, i.e. a separate
additive or a combined additive, can be formulated e.g. as a
granulate, a liquid, a slurry, etc. Preferred detergent additive
formulations are granulates, in particular non-dusting granulates,
liquids, in particular stabilized liquids, or slurries.
[0173] Non-dusting granulates may be produced, e.g., as disclosed
in U.S. Pat. Nos. 4,106,991 and 4,661,452 and may optionally be
coated by methods known in the art. Examples of waxy coating
materials are poly(ethylene oxide) products (polyethyleneglycol,
PEG) with mean molar weights of 1000 to 20000; ethoxylated
nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated
fatty alcohols in which the alcohol contains from 12 to 20 carbon
atoms and in which there are 15 to 80 ethylene oxide units; fatty
alcohols; fatty acids; and mono- and di- and triglycerides of fatty
acids. Examples of film-forming coating materials suitable for
application by fluid bed techniques are given in GB 1483591. Liquid
enzyme preparations may, for instance, be stabilized by adding a
polyol such as propylene glycol, a sugar or sugar alcohol, lactic
acid or boric acid according to established methods. Protected
enzymes may be prepared according to the method disclosed in EP
238,216.
[0174] The detergent composition of the invention may be in any
convenient form, e.g., a bar, a tablet, a powder, a granule, a
paste or a liquid. A liquid detergent may be aqueous, typically
containing up to 70% water and 0-30% organic solvent, or
non-aqueous.
[0175] The detergent composition comprises one or more surfactants,
which may be non-ionic including semi-polar and/or anionic and/or
cationic and/or zwitterionic. The surfactants are typically present
at a level of from 0.1% to 60% by weight.
[0176] When included therein the detergent will usually contain
from about 1% to about 40% of an anionic surfactant such as linear
alkylbenzenesulfonate, alpha-olefinsulfonate, alkyl sulfate (fatty
alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate,
alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid
or soap.
[0177] When included therein the detergent will usually contain
from about 0.2% to about 40% of a non-ionic surfactant such as
alcohol ethoxylate, nonylphenol ethoxylate, alkylpolyglycoside,
alkyldimethylamineoxide, ethoxylated fatty acid monoethanolamide,
fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or
N-acyl N-alkyl derivatives of glucosamine ("glucamides").
[0178] The detergent may contain 0-65% of a detergent builder or
complexing agent such as zeolite, diphosphate, triphosphate,
phosphonate, carbonate, citrate, nitrilotriacetic acid,
ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic
acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered
silicates (e.g. SKS-6 from Hoechst).
[0179] The detergent may comprise one or more polymers. Examples
are carboxymethyl-cellulose, poly(vinylpyrrolidone), poly(ethylene
glycol), poly(vinyl alcohol), poly(vinylpyridine-N-oxide),
poly(vinylimidazole), polycarboxylates such as polyacrylates,
maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid
copolymers.
[0180] The detergent may contain a bleaching system which may
comprise a H.sub.2O.sub.2 source such as perborate or percarbonate
which may be combined with a peracid-forming bleach activator such
as tetraacetylethylenediamine or nonanoyloxybenzenesulfonate.
Alternatively, the bleaching system may comprise peroxyacids of
e.g. the amide, imide, or sulfone type.
[0181] The enzyme(s) of the detergent composition of the invention
may be stabilized using conventional stabilizing agents, e.g., a
polyol such as propylene glycol or glycerol, a sugar or sugar
alcohol, lactic acid, boric acid, or a boric acid derivative, e.g.,
an aromatic borate ester, or a phenyl boronic acid derivative such
as 4-formylphenyl boronic acid, and the composition may be
formulated as described in e.g. WO 92/19709 and WO 92/19708.
[0182] The detergent may also contain other conventional detergent
ingredients such as e.g. fabric conditioners including clays, foam
boosters, suds suppressors, anti-corrosion agents, soil-suspending
agents, anti-soil redeposition agents, dyes, bacteriocides, optical
brighteners, hydrotropes, tarnish inhibitors, or perfumes.
[0183] In the detergent compositions any enzyme, in particular the
enzyme of the invention, may be added in an amount corresponding to
0.01-100 mg of enzyme protein per litre of wash liquor, preferably
0.05-5 mg of enzyme protein per litre of wash liquor, in particular
0.1-1 mg of enzyme protein per litre of wash liquor.
[0184] The enzyme of the invention may additionally be incorporated
in the detergent formulations disclosed in WO 97/07202 which is
hereby incorporated as reference.
Signal Peptide and Propeptide
[0185] The present invention also relates to nucleic acid
constructs comprising a gene encoding a protein operably linked to
a nucleotide sequence encoding a signal peptide, wherein the gene
is foreign to the nucleotide sequence encoding a signal
peptide.
[0186] The present invention also relates to recombinant expression
vectors and recombinant host cells comprising such nucleic acid
constructs.
[0187] The present invention also relates to methods for producing
a protein comprising (a) cultivating such a recombinant host cell
under conditions suitable for production of the protein; and (b)
recovering the protein.
[0188] The first and second nucleotide sequences may be operably
linked to foreign genes individually with other control sequences
or in combination with other control sequences. Such other control
sequences are described supra. As described earlier, where both
signal peptide and propeptide regions are present at the amino
terminus of a protein, the propeptide region is positioned next to
the amino terminus of a protein and the signal peptide region is
positioned next to the amino terminus of the propeptide region.
[0189] The protein may be native or heterologous to a host cell.
The term "protein" is not meant herein to refer to a specific
length of the encoded product and, therefore, encompasses peptides,
oligopeptides, and proteins. The term "protein" also encompasses
two or more polypeptides combined to form the encoded product. The
proteins also include hybrid polypeptides which comprise a
combination of partial or complete polypeptide sequences obtained
from at least two different proteins wherein one or more may be
heterologous or native to the host cell. Proteins further include
naturally occurring allelic and engineered variations of the above
mentioned proteins and hybrid proteins.
[0190] Preferably, the protein is a hormone or variant thereof,
enzyme, receptor or portion thereof, antibody or portion thereof,
or reporter. In a more preferred aspect, the protein is an
oxidoreductase, transferase, hydrolase, lyase, isomerase, or
ligase. In an even more preferred aspect, the protein is an
aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase,
cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase,
deoxyribonuclease, esterase, alpha-galactosidase,
beta-galactosidase, glucoamylase, alpha-glucosidase,
beta-glucosidase, invertase, laccase, lipase, mannosidase,
mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase,
polyphenoloxidase, proteolytic enzyme, ribonuclease,
transglutaminase or xylanase.
[0191] The gene may be obtained from any prokaryotic, eukaryotic,
or other source.
[0192] The present invention is further described by the following
examples which should not be construed as limiting the scope of the
invention.
EXAMPLES
[0193] Chemicals used as buffers and substrates were commercial
products of at least reagent grade.
Endoglucanase Activity Assay
Materials:
[0194] Berol 537, nonionic surfactant supplied by Akzo Nobel, or
similar. Cellazyme C tablets, supplied by Megazyme International,
Ireland. Glass microfiber filters, GF/C, 9 cm diameter, supplied by
Whatman.
pH9.5 Buffer Solution:
[0195] Dissolve 21.0 g of NaHCO.sub.3 and 14.6 g of NaCl in about
900 ml of deionised water. Add 10 ml Berol 537 (nonionic surfactant
supplied by Akzo Nobel). Adjust the pH to 9.5 by addition of 4N
NaOH. Then adjust the final volume to 1000 ml.
Method:
[0196] In test tubes, mix 1 ml pH9.5 buffer and 5 ml deionised
water. Add 100 microliter of the enzyme sample (or of dilutions of
the enzyme sample with known weight:weight dilution factor). Add 1
Cellazyme C tablet into each tube, cap the tubes and mix on a
vortex mixer for 10 seconds. Place the tubes in a thermostated
water bath, temperature 40.degree. C. After 15, 30 and 45 minutes,
mix the contents of the tubes by inverting the tubes, and replace
in the water bath. After 60 minutes, mix the contents of the tubes
by inversion and then filter through a GF/C filter. Collect the
filtrate in a clean tubes. Measure Absorbance (A.sub.enz) at 590
nm, with a spectrophotometer. A blank value, A.sub.water, is
determined by adding 100PI water instead of 100 microliter enzyme
dilution.
Calculate A.sub.delta=A.sub.enz-A.sub.water.
[0197] A.sub.delta must be <0.5. If higher results are obtained,
repeat with a different enzyme dilution factor. Determine DF0.1,
where DF0.1 is the dilution factor needed to give
A.sub.delta=0.1.
Unit Definition:
[0198] 1 Endo-Beta-Glucanase activity unit (1 EBG) is the amount of
enzyme that gives A.sub.delta=0.10, under the assay conditions
specified above. Thus, for example, if a given enzyme sample, after
dilution by a dilution factor of 100, gives A.sub.delta=0.10, then
the enzyme sample has an activity of 100 EBG/g. Temperature and pH
optima of the endoglucanase are determined by running the activity
assay at a range of different temperatures when the pH is fixed and
vice versa a range of different pH's when the temperature is
fixed.
Example 1
Screening for Novel Endoglucanase
[0199] A number of Bacillus strains were screened for production of
alkaline endoglucanase by growing the bacteria on TY agar added
0.1% AZCL-betaglucan (barley, Megazyme). Strain ACE160 produced
blue haloes on this substrate, the bacterium was identified by
determination of a part of the 16S rDNA, and insertion of the
sequence in the phylogenetic tree showed that ACE160 represent a
new species with the Bacillus group.
Example 2
Production of Full Length Subtilases
Genomic Library Construction
[0200] Chromosomal DNA from ACE160 was prepared by using standard
molecular biology techniques (Ausuble et al. 1995 "Current
protocols in molecular biology" Publ: John Wiley and sons). The
prepared DNA was partially cleaved with Sau3A and separated on an
agarose gel. Fragments of 3 to 8 kilobases were eluted and
precipitated and resuspended in a suitable buffer. A genomic
library was made by using the Stratagene ZAP Express.TM.
predigested Vector kit and Stratagene ZAP Express.TM. predigested
Gigapack.RTM. cloning kit (Bam HI predigested) (Stratagene Inc.,
USA) following the instructions/recommendations from the vendor.
The resulting lambdaZAP library comprised 38000 pfu (plaque forming
units) of which 10000 were collected for mass excision. The
resulting 70000 E. coli colonies were pooled. The E. coli clone
pool was diluted by mixing 100 .mu.l pool with 100 ml LB medium and
plated out 100 .mu.l per agarplate on LB supplemented with 0.1%
AZCL.betaglucan (barley, Megazyme) and 50 .mu.g/ml kanamycin, and
incubated for 2-3 days. Among 1600-1800 colonies per plate on 50
agarplates three colonies with blue haloes were obtained. From
these three colonies plasmid DNA was recovered and sequenced with
vector primers. By subsequent primer walking the entire nucleotide
sequence of the endo-1,4-betaglucanase open reading frame (ORF) was
characterised. The three colonies contained the same ORF shown as
SEQ ID NO:1.
Production of the Full Length Endoglucanase
[0201] To produce the endo-1,4-betaglucanase, the gene was
amplified from chromosomal DNA of the wild type strain Bacillus sp.
ACE160. The enzymes were expressed using the indigenous trans
membrane signal peptide.
Primers
TABLE-US-00002 [0202] ACE160-Bglu-Mlu1-4:
GATTAACGCGTTCCTCGTGCTGAGCACAGAGG (SEQ ID NO: 3) ACE160-Bglu-Sac1:
TTATGGAGCTCAAATCAACTCTAGGAGGCTG (SEQ ID NO: 4)
[0203] The endo-1,4-betaglucanase gene was amplified as a ca. 2500
nt PCR product. The primers ACE160-Bglu-SacI and ACE160-Bglu-Mlu1-4
were used. Template DNA was chromosomal DNA of Bacillus sp. ACE160.
The PCR product was recovered using Qiaquick.TM. spin columns as
recommended (Qiagen, Germany). The quality of the isolated template
was evaluated by agarose gel electrophoresis. PCR was run in the
following protocol: 94.degree. C., 2 minutes 40 cycles of
[94.degree. C. for 30 seconds, 52.degree. C. for 30 seconds,
68.degree. C. for 1 minute] completed with 68.degree. C. for 10
minutes. PCR product was analysed on a 1% agarose gel in TAE buffer
stained with Ethidium bromide to confirm a single band of the
correct size. The PCR product was digested with restriction enzymes
Sac1 and Mlu1 and purified on GFX.TM. PCR and Gel Band Purification
Kit (Amerham Biosciences).
[0204] The digested and purified PCR fragment was ligated to the
Sac I and Mlu I digested plasmid
pDG268NeoMCS-PramyQ/PrcryIII/cryIIIAstab/Sav (U.S. Pat. No.
5,955,310). The ligation mixture was used for transformation into
E. coli TOP10F' (Invitrogen BV, The Netherlands) and several
colonies were selected for miniprep (QIAprep.RTM. spin, QIAGEN
GmbH, Germany). The purified plasmids were checked for insert
before transformation into Bacillus subtilis strain TH1 (TH1 is a
Bacillus subtilis strain (amy-, spo-, apr-, npr-), that has been
modified by insertion of a construct, from the strain DN3 (Noone et
al. 2000, J Bacteriol 182 (6) 1592-1599) by transformation and
selection for Erytromycin. The changed genotype is: ykdA::pDN3
(PykdA-lacZ Pspac-ykdA) Ermr. TH1 contains the following features:
the full ykdA promoter is fused to the LacZ reporter gene. In
addition the ykdA gene is placed under control of the
IPTG-inducible Pspac promoter, so the ykdA gene no longer has it's
naturally regulation. The strain can be used as host for expression
clones and libraries and transformants expressing and secreting
protein can be selected on plates containing X-gal and IPTG. TH1
can be maintained on LB agar+6 .mu.g/mL erythromycin.)
[0205] Transformed cells were plated on LB-PG agar plates,
supplemented with 1% skim milk, 100 .mu.g/L X-gal, 1 mM IPTG, 6
.mu.g/ml chloramphenicol and 12 .mu.g/ml erythromycin. The plated
cells were incubated over night at 37.degree. C. and colonies with
blue color and without clearing zone were picked, the correct
insert was confirmed by PCR and nucleotide sequencing.
Example 3
Purification of the Endoglucanase from Bacillus sp. ACE160
[0206] The endoglucanase was purified from 670 ml fermentation
broth from which the cells were removed by a combination of
centrifugation and filtration of the broth. The volume was adjusted
to 21 with deionised water and the pH titrated to 8.5. This
material was loaded on a Q-sepharose column equilibrated with 25 mM
Tris buffer pH 8.5. The enzyme was eluted by the application of a
NaCl gradient in the same buffer and the fractions containing the
endoglucanase were pooled. A portion of this pool was fractionated
on a S-200 gel-filtration column with 100 mM sodium acetate pH 6 as
the liquid fase. The fractions containing the endoglucanase were
pooled and concentrated about three times on an Amicon
ultrafiltration unit. The concentrate was analysed by SDS PAGE,
where a protein band of app. 80 kD was obtained.
Example 4
Wash Performance of Endoglucanase from Bacillus sp. ACE160
[0207] This procedure is used to determine the "enzyme detergency
benefit".
[0208] The wash tests are made by washing samples of soiled cotton
fabric and samples of clean cotton fabric, both together, in a
small-scale wash test apparatus. After the washing the soil on the
cotton fabric is evaluated by light reflectance. Both the
originally soiled cotton fabric and the originally clean cotton
fabric samples are evaluated.
Cotton fabric: #2003 white woven 100% cotton fabric, supplied by
Tanigashira, 4-11-15 Komatsu Yodogawa-ku, Osaka, 533-0004, Japan.
The new cotton fabric is pre-washed three times before use in the
wash test. The pre-washing is done using a European household
front-loader washing machine, and using a standard 40.degree. C.
wash process. LAS (Surfac.RTM. SDBS80 sodium alkylbenzene
sulfonate, 80%) is added to the wash water at concentration 0.5 g
per liter and the wash solution pH is adjusted to 10 by addition of
sodium carbonate. After the pre-washing the fabric is dried in a
tumbler drier. Swatches of the pre-washed cotton fabric, size
5.times.5 cm, weight approximately 0.3 g each, are cut out and
these swatches are used for the wash tests. Soiled cotton swatches:
These are prepared from the 5.times.5 cm swatches described above.
Soiled swatches are made using beta-glucan (medium viscosity, from
barley, supplied by Megazymes International, Ireland) and carbon
black ("carbon for detergency tests", supplied by Sentaku Kagaku
Kyokai, Tokyo, Japan). Dissolve about 0.67 g of beta-glucan in 100
ml tap water by stirring and warming to >50.degree. C. Add 0.33
g carbon black. Blend with an UltraTurrax T25 blender, speed 4000
rpm for 2 minutes. Apply 250 microliter of the beta-glucan/carbon
onto the center of each swatch. Allow to dry overnight at room
temperature. Wash tests: Three soiled swatches and three clean
swatches are washed in a Mini-Terg-O-Tometer machine. The
Mini-Terg-O-Tometer is a small-scale version of the Terg-O-Tometer
test washing machine described in Jay C. Harris, "Detergency
Evaluation and Testing", Interscience Publishers Ltd. (1954) pp.
60-61. The following conditions are used:
TABLE-US-00003 Beaker size 250 ml Wash solution volume 100 ml Wash
temperature 40.degree. C. Wash time 30 minutes Agitation 150
rpm
The detergent solutions are pre-warmed to 40.degree. C. before
starting the test. The fabric and the enzymes are added at the
start of the 30 minute wash period. After the wash, the fabric
swatches are rinsed for 5 minutes under running tap water, then
spread out flat and allowed to air dry at room temperature
overnight. Instrumental evaluations: Light reflectance evaluation
of the fabric swatches is done using a Macbeth Color Eye 7000
reflectance spectrophotometer. The measurements are made at 500 nm.
The UV filter is not included. Measurements are made on the front
and back of each swatch. The soiled swatches are measured in the
centre of the soiled area. Average results for reflectance (R, 500
nm) for the soiled swatches and for the clean swatches are then
calculated from the six measurements on each type. Detergent
solutions: Detergent solutions are prepared as follows: To prepare
1 liter of solution, dissolve in deionised water 0.5 g sodium
carbonate and 1.0 g sodium hydrogen carbonate and add 2 ml of a
solution containing 117.8 g/l CaCl.sub.2.2H.sub.2O and 54.3 g/l
MgCl.sub.2.6H.sub.2O. This calcium/magnesium addition provides a
water hardness of 12.degree. dH. Add 0.2 g nonionic surfactant
(Berol.RTM. 537, Akzo Nobel) and 0.5 g LAS (Surfac.RTM. SDBS80
sodium alkylbenzene sulfonate, 80%) and adjust the final volume to
1 liter. Adjust the pH to pH 9.5.+-.0.1 (by addition of sodium
carbonate or 10% citric acid solution). Enzyme addition: The
enzymes to be tested are pre-dissolved at known concentrations in
water, and the required amount of enzyme is added to the detergent
solution at the start of the wash process. Calculation of enzyme
detergency benefit: The enzyme detergency benefit is a measure of
how much more clean the swatches, both the originally soiled and
the originally clean, become as a result of including enzymes in
the wash test. The enzyme detergency benefit is calculated as
follows: After the wash test the average R, 500 nm value for the
soiled swatches is R, soiled. After the wash test the average R,
500 nm value for the clean swatches is R, clean. The enzyme
detergency benefit from a wash test with enzymes is the sum of R,
soiled+R. clean with enzymes minus the sum of R, soiled+R, clean
with no added enzyme. The enzyme detergency benefit value
determined in this way is a combined measure both of the removal of
soil from the fabric and of the redeposition of soil onto the
fabric. Thus the enzyme detergency benefit value can have values
that are negative or positive. The enzyme detergency benefit value
can be used to compare the performance of different enzymes. The
highest positive detergency benefit value is the preferred result.
For comparison, the wash performance of the endoglucanase from
Bacillus sp. ACE160 was compared with of the wash performance of
the prior art Bacillus endoglucanase MB1181-7 disclosed in WO
2002/099091.
Results:
TABLE-US-00004 [0209] Enzyme activity in wash solution Enzyme
Detergency Benefit ACE160, 6 EBG per liter 28.1 ACE160, 12 EBG per
liter 29.9 MB1181-7, 6 EBG per liter 15.2 MB1181-7, 12 EBG per
liter 22.2
The results show that the endoglucanase from Bacillus sp. ACE160
gives a higher Enzyme Detergency Benefit than the known
endoglucanase.
[0210] The invention described and claimed herein is not to be
limited in scope by the specific aspects herein disclosed, since
these aspects are intended as illustrations of several aspects of
the invention. Any equivalent aspects are intended to be within the
scope of this invention. Indeed, various modifications of the
invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims. In the case of conflict, the
present disclosure including definitions will control.
Sequence CWU 1
1
412379DNABacillus sp.
ACE160CDS(1)..(2376)sig_peptide(1)..(99)mat_peptide(100)..(2376)
1gtg aga caa ccc ata ggt aaa aag ata att gct gca gga atg atc ttt
48Val Arg Gln Pro Ile Gly Lys Lys Ile Ile Ala Ala Gly Met Ile
Phe-30 -25 -20acc ctc tta ttt tcg tta atc gtc act gtg ttc cca act
gct ggt caa 96Thr Leu Leu Phe Ser Leu Ile Val Thr Val Phe Pro Thr
Ala Gly Gln-15 -10 -5gca cta gaa tca gac tat agc cat tta tta gga
aat gat gca gtg aag 144Ala Leu Glu Ser Asp Tyr Ser His Leu Leu Gly
Asn Asp Ala Val Lys-1 1 5 10 15cgc ccc tcg gaa ggc gga gct tta agt
tta tgt aat gaa act act cca 192Arg Pro Ser Glu Gly Gly Ala Leu Ser
Leu Cys Asn Glu Thr Thr Pro20 25 30gta aaa cca aac cat gcg ggg gac
cgt ggg aaa cca agc cac gca ggt 240Val Lys Pro Asn His Ala Gly Asp
Arg Gly Lys Pro Ser His Ala Gly35 40 45aaa gga aag cct ccc cat gct
ggt aag cct gaa cat gcc gga cca aag 288Lys Gly Lys Pro Pro His Ala
Gly Lys Pro Glu His Ala Gly Pro Lys50 55 60cgt aaa aca ctg tgt gat
gca acc ggc agc caa att cag ctc cgg ggg 336Arg Lys Thr Leu Cys Asp
Ala Thr Gly Ser Gln Ile Gln Leu Arg Gly65 70 75atg agc act cac gga
ttg caa tgg ttt ggc gag att ata aat gat aat 384Met Ser Thr His Gly
Leu Gln Trp Phe Gly Glu Ile Ile Asn Asp Asn80 85 90 95gct ttt gct
gct ctt tcc aac gac tgg gag gca aat atg atc cgc ctt 432Ala Phe Ala
Ala Leu Ser Asn Asp Trp Glu Ala Asn Met Ile Arg Leu100 105 110gcc
atg tat att ggc gaa aat gga tat gcg act aac cct gaa gta aaa 480Ala
Met Tyr Ile Gly Glu Asn Gly Tyr Ala Thr Asn Pro Glu Val Lys115 120
125gaa ctt gtt tac gaa gga att gag ctt gca ttc aaa cat gat atg tat
528Glu Leu Val Tyr Glu Gly Ile Glu Leu Ala Phe Lys His Asp Met
Tyr130 135 140gta att gtt gac tgg cac gta cac gcc ccg gga gat cca
agg gct gac 576Val Ile Val Asp Trp His Val His Ala Pro Gly Asp Pro
Arg Ala Asp145 150 155att tat tcc ggt gct cta gac ttt ttt aaa gaa
att gca gac cac tat 624Ile Tyr Ser Gly Ala Leu Asp Phe Phe Lys Glu
Ile Ala Asp His Tyr160 165 170 175aag gac cat cct aag ttc cat tat
att ata tgg gaa att gca aat gaa 672Lys Asp His Pro Lys Phe His Tyr
Ile Ile Trp Glu Ile Ala Asn Glu180 185 190cca agc cca aat aac agc
gga gga cct gga att cct aat gat gaa aca 720Pro Ser Pro Asn Asn Ser
Gly Gly Pro Gly Ile Pro Asn Asp Glu Thr195 200 205gga tgg aaa gca
gta aag gaa tat gct gaa cct atc gtg gaa atg ctt 768Gly Trp Lys Ala
Val Lys Glu Tyr Ala Glu Pro Ile Val Glu Met Leu210 215 220cgt gaa
agg ggg gac aat ata att ctt gta ggc agc ccg aac tgg agc 816Arg Glu
Arg Gly Asp Asn Ile Ile Leu Val Gly Ser Pro Asn Trp Ser225 230
235cag cgc ccg gat tta gct gca gat aac cct ata gat gca aaa aat atc
864Gln Arg Pro Asp Leu Ala Ala Asp Asn Pro Ile Asp Ala Lys Asn
Ile240 245 250 255atg tac tct gtc cac ttc tat act gga tct cat gaa
cct tca gat aca 912Met Tyr Ser Val His Phe Tyr Thr Gly Ser His Glu
Pro Ser Asp Thr260 265 270agc tat cct gaa ggc act ccg tcc tcg gaa
cgg aat aac gtt atg gca 960Ser Tyr Pro Glu Gly Thr Pro Ser Ser Glu
Arg Asn Asn Val Met Ala275 280 285aat gta cga tat gca ctc gag aat
ggt gct gca gtt ttt gct aca gaa 1008Asn Val Arg Tyr Ala Leu Glu Asn
Gly Ala Ala Val Phe Ala Thr Glu290 295 300tgg ggt aca agc caa gcc
aat ggt gat ggc ggc cca tac ctt gac gaa 1056Trp Gly Thr Ser Gln Ala
Asn Gly Asp Gly Gly Pro Tyr Leu Asp Glu305 310 315gct gat gta tgg
ctt aac ttc ctt aac gag aac aat atc agc tgg gtc 1104Ala Asp Val Trp
Leu Asn Phe Leu Asn Glu Asn Asn Ile Ser Trp Val320 325 330 335aac
tgg tca ttg aca aat aaa aac gaa aca tca ggt tcc ttc act ccc 1152Asn
Trp Ser Leu Thr Asn Lys Asn Glu Thr Ser Gly Ser Phe Thr Pro340 345
350ttt gag ctg ggg aaa tcc aat gcc aca agt ctt gat cct ggc cct gaa
1200Phe Glu Leu Gly Lys Ser Asn Ala Thr Ser Leu Asp Pro Gly Pro
Glu355 360 365caa gca tgg tcc ctg ccg gaa cta agc gta tca ggc gag
tat gtt cgt 1248Gln Ala Trp Ser Leu Pro Glu Leu Ser Val Ser Gly Glu
Tyr Val Arg370 375 380tca cga att aaa ggt agt ccg tat gaa ccg ttt
gac cgg acg aaa ttt 1296Ser Arg Ile Lys Gly Ser Pro Tyr Glu Pro Phe
Asp Arg Thr Lys Phe385 390 395aat aaa gta atc tgg gat ttt aac gac
ggt aca gtt cag ggg ttt gaa 1344Asn Lys Val Ile Trp Asp Phe Asn Asp
Gly Thr Val Gln Gly Phe Glu400 405 410 415gta aat gac gac agt cct
gtt aaa gaa gaa ata gct gtc agc aat gca 1392Val Asn Asp Asp Ser Pro
Val Lys Glu Glu Ile Ala Val Ser Asn Ala420 425 430ggt aat gcc ctt
caa att acc ggt ctt aat gct agc aac gac atc tcc 1440Gly Asn Ala Leu
Gln Ile Thr Gly Leu Asn Ala Ser Asn Asp Ile Ser435 440 445aca gat
aac ttc tgg agt aac ctc agg ctt tca gcc aat tcc tgg gga 1488Thr Asp
Asn Phe Trp Ser Asn Leu Arg Leu Ser Ala Asn Ser Trp Gly450 455
460gaa tcg gtt aat atc ctg ggg gca gaa gaa ctg aca tta gat gtg atc
1536Glu Ser Val Asn Ile Leu Gly Ala Glu Glu Leu Thr Leu Asp Val
Ile465 470 475gtc gat gag cca act tcc gtc tca atc gca gca att ccg
caa agt gca 1584Val Asp Glu Pro Thr Ser Val Ser Ile Ala Ala Ile Pro
Gln Ser Ala480 485 490 495gca gtt ggc tgg gca aat cct aac aat gcg
gtc gtt gtt tct aaa gaa 1632Ala Val Gly Trp Ala Asn Pro Asn Asn Ala
Val Val Val Ser Lys Glu500 505 510gat ttc gca cct tat ggt ggc cag
tat aag gct gtc ctg acg ata aca 1680Asp Phe Ala Pro Tyr Gly Gly Gln
Tyr Lys Ala Val Leu Thr Ile Thr515 520 525ccg gaa gat tct cca gct
ctg ggt gcc ata gca aca cat agt gat gat 1728Pro Glu Asp Ser Pro Ala
Leu Gly Ala Ile Ala Thr His Ser Asp Asp530 535 540aac atg atg aat
aac att atc ttg ttt ata ggt aca gaa aat gct gat 1776Asn Met Met Asn
Asn Ile Ile Leu Phe Ile Gly Thr Glu Asn Ala Asp545 550 555gta ctc
tca ctt gat aac att aca gtt aaa ggt tcc atc gtt gaa att 1824Val Leu
Ser Leu Asp Asn Ile Thr Val Lys Gly Ser Ile Val Glu Ile560 565 570
575cca gta atc cat gat cca aag ggc atc gcg gtt ctt cct tca aac ttt
1872Pro Val Ile His Asp Pro Lys Gly Ile Ala Val Leu Pro Ser Asn
Phe580 585 590gag gac gga acc cgc caa ggc tgg gac tgg aac cct gaa
tca ggg gta 1920Glu Asp Gly Thr Arg Gln Gly Trp Asp Trp Asn Pro Glu
Ser Gly Val595 600 605aaa act gct tta aca att aaa gag gcc gat ggt
tca cat gcc cta tcc 1968Lys Thr Ala Leu Thr Ile Lys Glu Ala Asp Gly
Ser His Ala Leu Ser610 615 620tgg gag ttt gct tac ccg gaa gtt aaa
cct ggt gat ggg tgg gca aca 2016Trp Glu Phe Ala Tyr Pro Glu Val Lys
Pro Gly Asp Gly Trp Ala Thr625 630 635gct cca cga ttg gag ttt tgg
aaa gat gga ctg gta aga gga gca aac 2064Ala Pro Arg Leu Glu Phe Trp
Lys Asp Gly Leu Val Arg Gly Ala Asn640 645 650 655gat tac ctc tca
ttt gat tta tac ctt gac cct gtc cgt gcc aca gag 2112Asp Tyr Leu Ser
Phe Asp Leu Tyr Leu Asp Pro Val Arg Ala Thr Glu660 665 670ggt gct
atc aca aca cat ctc gta ttc cag ccg cca agt gct gga tac 2160Gly Ala
Ile Thr Thr His Leu Val Phe Gln Pro Pro Ser Ala Gly Tyr675 680
685tgg gta caa gct cca gct tct cac agc ata gat ttg tta aac tta gat
2208Trp Val Gln Ala Pro Ala Ser His Ser Ile Asp Leu Leu Asn Leu
Asp690 695 700tca gct gat atc aca gca gat gga ctg tac cat tat gaa
gtg aaa ttc 2256Ser Ala Asp Ile Thr Ala Asp Gly Leu Tyr His Tyr Glu
Val Lys Phe705 710 715aat att aga gac att aca gca att caa gat gac
aca gct ctg cgc aat 2304Asn Ile Arg Asp Ile Thr Ala Ile Gln Asp Asp
Thr Ala Leu Arg Asn720 725 730 735atg atc ctc ata ttg gag gat agg
aac agc gac ttc gcg ggc cgg gcg 2352Met Ile Leu Ile Leu Glu Asp Arg
Asn Ser Asp Phe Ala Gly Arg Ala740 745 750ttc atc gac aat gta aga
ttc gaa taa 2379Phe Ile Asp Asn Val Arg Phe Glu7552792PRTBacillus
sp. ACE160 2Val Arg Gln Pro Ile Gly Lys Lys Ile Ile Ala Ala Gly Met
Ile Phe-30 -25 -20Thr Leu Leu Phe Ser Leu Ile Val Thr Val Phe Pro
Thr Ala Gly Gln-15 -10 -5Ala Leu Glu Ser Asp Tyr Ser His Leu Leu
Gly Asn Asp Ala Val Lys-1 1 5 10 15Arg Pro Ser Glu Gly Gly Ala Leu
Ser Leu Cys Asn Glu Thr Thr Pro20 25 30Val Lys Pro Asn His Ala Gly
Asp Arg Gly Lys Pro Ser His Ala Gly35 40 45Lys Gly Lys Pro Pro His
Ala Gly Lys Pro Glu His Ala Gly Pro Lys50 55 60Arg Lys Thr Leu Cys
Asp Ala Thr Gly Ser Gln Ile Gln Leu Arg Gly65 70 75Met Ser Thr His
Gly Leu Gln Trp Phe Gly Glu Ile Ile Asn Asp Asn80 85 90 95Ala Phe
Ala Ala Leu Ser Asn Asp Trp Glu Ala Asn Met Ile Arg Leu100 105
110Ala Met Tyr Ile Gly Glu Asn Gly Tyr Ala Thr Asn Pro Glu Val
Lys115 120 125Glu Leu Val Tyr Glu Gly Ile Glu Leu Ala Phe Lys His
Asp Met Tyr130 135 140Val Ile Val Asp Trp His Val His Ala Pro Gly
Asp Pro Arg Ala Asp145 150 155Ile Tyr Ser Gly Ala Leu Asp Phe Phe
Lys Glu Ile Ala Asp His Tyr160 165 170 175Lys Asp His Pro Lys Phe
His Tyr Ile Ile Trp Glu Ile Ala Asn Glu180 185 190Pro Ser Pro Asn
Asn Ser Gly Gly Pro Gly Ile Pro Asn Asp Glu Thr195 200 205Gly Trp
Lys Ala Val Lys Glu Tyr Ala Glu Pro Ile Val Glu Met Leu210 215
220Arg Glu Arg Gly Asp Asn Ile Ile Leu Val Gly Ser Pro Asn Trp
Ser225 230 235Gln Arg Pro Asp Leu Ala Ala Asp Asn Pro Ile Asp Ala
Lys Asn Ile240 245 250 255Met Tyr Ser Val His Phe Tyr Thr Gly Ser
His Glu Pro Ser Asp Thr260 265 270Ser Tyr Pro Glu Gly Thr Pro Ser
Ser Glu Arg Asn Asn Val Met Ala275 280 285Asn Val Arg Tyr Ala Leu
Glu Asn Gly Ala Ala Val Phe Ala Thr Glu290 295 300Trp Gly Thr Ser
Gln Ala Asn Gly Asp Gly Gly Pro Tyr Leu Asp Glu305 310 315Ala Asp
Val Trp Leu Asn Phe Leu Asn Glu Asn Asn Ile Ser Trp Val320 325 330
335Asn Trp Ser Leu Thr Asn Lys Asn Glu Thr Ser Gly Ser Phe Thr
Pro340 345 350Phe Glu Leu Gly Lys Ser Asn Ala Thr Ser Leu Asp Pro
Gly Pro Glu355 360 365Gln Ala Trp Ser Leu Pro Glu Leu Ser Val Ser
Gly Glu Tyr Val Arg370 375 380Ser Arg Ile Lys Gly Ser Pro Tyr Glu
Pro Phe Asp Arg Thr Lys Phe385 390 395Asn Lys Val Ile Trp Asp Phe
Asn Asp Gly Thr Val Gln Gly Phe Glu400 405 410 415Val Asn Asp Asp
Ser Pro Val Lys Glu Glu Ile Ala Val Ser Asn Ala420 425 430Gly Asn
Ala Leu Gln Ile Thr Gly Leu Asn Ala Ser Asn Asp Ile Ser435 440
445Thr Asp Asn Phe Trp Ser Asn Leu Arg Leu Ser Ala Asn Ser Trp
Gly450 455 460Glu Ser Val Asn Ile Leu Gly Ala Glu Glu Leu Thr Leu
Asp Val Ile465 470 475Val Asp Glu Pro Thr Ser Val Ser Ile Ala Ala
Ile Pro Gln Ser Ala480 485 490 495Ala Val Gly Trp Ala Asn Pro Asn
Asn Ala Val Val Val Ser Lys Glu500 505 510Asp Phe Ala Pro Tyr Gly
Gly Gln Tyr Lys Ala Val Leu Thr Ile Thr515 520 525Pro Glu Asp Ser
Pro Ala Leu Gly Ala Ile Ala Thr His Ser Asp Asp530 535 540Asn Met
Met Asn Asn Ile Ile Leu Phe Ile Gly Thr Glu Asn Ala Asp545 550
555Val Leu Ser Leu Asp Asn Ile Thr Val Lys Gly Ser Ile Val Glu
Ile560 565 570 575Pro Val Ile His Asp Pro Lys Gly Ile Ala Val Leu
Pro Ser Asn Phe580 585 590Glu Asp Gly Thr Arg Gln Gly Trp Asp Trp
Asn Pro Glu Ser Gly Val595 600 605Lys Thr Ala Leu Thr Ile Lys Glu
Ala Asp Gly Ser His Ala Leu Ser610 615 620Trp Glu Phe Ala Tyr Pro
Glu Val Lys Pro Gly Asp Gly Trp Ala Thr625 630 635Ala Pro Arg Leu
Glu Phe Trp Lys Asp Gly Leu Val Arg Gly Ala Asn640 645 650 655Asp
Tyr Leu Ser Phe Asp Leu Tyr Leu Asp Pro Val Arg Ala Thr Glu660 665
670Gly Ala Ile Thr Thr His Leu Val Phe Gln Pro Pro Ser Ala Gly
Tyr675 680 685Trp Val Gln Ala Pro Ala Ser His Ser Ile Asp Leu Leu
Asn Leu Asp690 695 700Ser Ala Asp Ile Thr Ala Asp Gly Leu Tyr His
Tyr Glu Val Lys Phe705 710 715Asn Ile Arg Asp Ile Thr Ala Ile Gln
Asp Asp Thr Ala Leu Arg Asn720 725 730 735Met Ile Leu Ile Leu Glu
Asp Arg Asn Ser Asp Phe Ala Gly Arg Ala740 745 750Phe Ile Asp Asn
Val Arg Phe Glu755332DNAArtificial sequencePrimer 3gattaacgcg
ttcctcgtgc tgagcacaga gg 32431DNAArtificial sequencePrimer
4ttatggagct caaatcaact ctaggaggct g 31
* * * * *
References