U.S. patent application number 11/690957 was filed with the patent office on 2008-11-13 for recombinant rsv virus expression systems and vaccines.
This patent application is currently assigned to MedImmune Vaccines, Inc.. Invention is credited to Martin Bryant, Hong Jin, Shengqiang Li, Roderick Tang.
Application Number | 20080279892 11/690957 |
Document ID | / |
Family ID | 23449776 |
Filed Date | 2008-11-13 |
United States Patent
Application |
20080279892 |
Kind Code |
A1 |
Jin; Hong ; et al. |
November 13, 2008 |
Recombinant RSV Virus Expression Systems And Vaccines
Abstract
The present invention relates to genetically engineered
recombinant respiratory syncytial viruses and viral vectors which
contain deletions of various viral accessory gene(s) either singly
or in combination. In accordance with the present invention, the
recombinant respiratory syncytial viral vectors and viruses are
engineered to contain complete deletions of the M2-2, NS1, NS2, or
SH viral accessory genes or various combinations thereof. In
addition, the present invention relates to the attenuation of
respiratory syncytial virus by mutagenisis of the M2-1 gene.
Inventors: |
Jin; Hong; (Cupertino,
CA) ; Tang; Roderick; (San Mateo, CA) ; Li;
Shengqiang; (Los Altos, CA) ; Bryant; Martin;
(Los Altos, CA) |
Correspondence
Address: |
MEDIMMUNE, LLC;Jonathan Klein-Evans
ONE MEDIMMUNE WAY
GAITHERSBURG
MD
20878
US
|
Assignee: |
MedImmune Vaccines, Inc.
Gaithersburg
MD
|
Family ID: |
23449776 |
Appl. No.: |
11/690957 |
Filed: |
March 26, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10975060 |
Oct 25, 2004 |
7205013 |
|
|
11690957 |
|
|
|
|
09368076 |
Aug 3, 1999 |
6830748 |
|
|
10975060 |
|
|
|
|
09161122 |
Sep 25, 1998 |
|
|
|
09368076 |
|
|
|
|
60060153 |
Sep 26, 1997 |
|
|
|
60084133 |
May 1, 1998 |
|
|
|
60089207 |
Jun 12, 1998 |
|
|
|
Current U.S.
Class: |
424/205.1 ;
435/235.1 |
Current CPC
Class: |
C12N 7/00 20130101; A61K
39/00 20130101; A61K 2039/5254 20130101; C12N 2840/20 20130101;
A61K 39/12 20130101; C12N 2760/16022 20130101; A61P 31/14 20180101;
A61K 39/155 20130101; C07K 14/005 20130101; C12N 15/86 20130101;
A61K 2039/543 20130101; A61K 2039/51 20130101; C12N 2760/18534
20130101; C12N 2760/18543 20130101; C12N 2760/18522 20130101; C12N
2760/18561 20130101; A61K 2039/5256 20130101 |
Class at
Publication: |
424/205.1 ;
435/235.1 |
International
Class: |
A61K 35/76 20060101
A61K035/76; C12N 7/01 20060101 C12N007/01 |
Claims
1-35. (canceled)
36. An isolated infectious respiratory syncytial virus (RSV)
particle having an attenuated phenotype, wherein the particle
comprises an RSV antigenome or genome, and wherein the antigenome
or genome comprises: a M2-2 gene mutation and a SH gene mutation;
or a M2-2 gene mutation and a NS2 gene mutation; or a NS2 gene
mutation and a SH gene mutation.
37. The isolated infectious RSV particle of claim 36 wherein the
antigenome or genome comprises a M2-2 gene mutation and a SH gene
mutation.
38. The isolated infectious RSV particle of claim 36 wherein the
antigenome or genome comprises a M2-2 gene mutation and a NS2 gene
mutation.
39. The isolated infectious RSV particle of claim 36 wherein the
antigenome or genome comprises a NS2 gene mutation and a SH gene
mutation.
40. The isolated infectious RSV particle of claim 39 wherein the
antigenome or genome further comprises a mutation in gene NS1.
41. The isolated infectious RSV of claim 37 wherein the M2-2 gene
mutation is a deletion of the M2-2 gene.
42. The isolated infectious RSV of claim 37 wherein the SH gene
mutation is a deletion of the SH gene.
43. The isolated infectious RSV of claim 38 wherein the M2-2 gene
mutation is a deletion of the M2-2 gene.
44. The isolated infectious RSV of claim 38 wherein the NS2 gene
mutation is a deletion of the NS2 gene.
45. The isolated infectious RSV of claim 39 wherein the NS2 gene
mutation is a deletion of the NS2 gene.
46. The isolated infectious RSV of claim 39 wherein the SH gene
mutation is a deletion of the SH gene.
47. The isolated infectious RSV of claim 40 wherein the mutation in
gene NS1 is a deletion of gene NS1.
48. The isolated infectious RSV of claim 36 further comprising an L
gene mutation.
49. The isolated infectious RSV of claim 36 further comprising a
heterologous sequence.
50. The isolated infectious RSV of claim 49 wherein the
heterologous sequence is inserted in the RSV antigenome or
genome.
51. The isolated infectious RSV of claim 49 wherein the
heterologous sequence is substituted for all or a portion of the
RSV antigenome or genome.
52. The isolated infectious RSV of claim 49 wherein the
heterologous sequence is derived from the genome of another strain
of RSV.
53. The isolated infectious RSV of claim 49 wherein the
heterologous sequence is derived from the genome of a virus other
than RSV.
54. An immunogenic composition comprising the isolated infectious
RSV particle of claim 36.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of application
Ser. No. 09/161,122, filed Sep. 25, 1998, which claims priority
benefit under 35 U.S.C. .sctn.119(e) of provisional Application
Nos. 60/069,153, filed Sep. 26, 1997, 60/084,133, filed May 1,
1998, and 60/089,207, filed Jun. 12, 1998, each of which is
incorporated herein by reference in its entirety.
1. INTRODUCTION
[0002] The present invention relates to recombinant negative strand
virus RNA templates which may be used to express heterologous gene
products in appropriate host cell systems and/or to construct
recombinant viruses that express, package, and/or present the
heterologous gene product. The expression products and chimeric
viruses may advantageously be used in vaccine formulations. In
particular, the present invention relates to methods of generating
recombinant respiratory syncytial viruses and the use of these
recombinant viruses as expression vectors and vaccines. The
invention is described by way of examples in which recombinant
respiratory syncytial viral genomes are used to generate infectious
viral particles.
2. BACKGROUND OF THE INVENTION
[0003] A number of DNA viruses have been genetically engineered to
direct the expression of heterologous proteins in host cell systems
(e.g., vaccinia virus, baculovirus, etc.). Recently, similar
advances have been made with positive-strand RNA viruses (e.g.,
poliovirus). The expression products of these constructs, i.e., the
heterologous gene product or the chimeric virus which expresses the
heterologous gene product, are thought to be potentially useful in
vaccine formulations (either subunit or whole virus vaccines). One
drawback to the use of viruses such as vaccinia for constructing
recombinant or chimeric viruses for use in vaccines is the lack of
variation in its major epitopes. This lack of variability in the
viral strains places strict limitations on the repeated use of
chimeric vaccinia, in that multiple vaccinations will generate
host-resistance to the strain so that the inoculated virus cannot
infect the host. Inoculation of a resistant individual with
chimeric vaccinia will, therefore, not induce immune
stimulation.
[0004] By contrast, negative-strand RNA viruses such as influenza
virus and respiratory syncytial virus, demonstrate a wide
variability of their major epitopes. Indeed, thousands of variants
of influenza have been identified; each strain evolving by
antigenic drift. The negative-strand viruses such as influenza and
respiratory syncytial virus would be attractive candidates for
constructing chimeric viruses for use in vaccines because its
genetic variability allows for the construction of a vast
repertoire of vaccine formulations which will stimulate immunity
without risk of developing a tolerance.
[0005] 2.1. Respiratory Syncytial Virus
[0006] Virus families containing enveloped single-stranded RNA of
the negative-sense genome are classified into groups having
non-segmented genomes (Paramyxoviridae, Rhabdoviridae) or those
having segmented genomes (Orthomyxoviridae, Bunyaviridae and
Arenaviridae). Paramyxoviridae have been classified into three
genera: paramyxovirus (sendai virus, parainfluenza viruses types
1-4, mumps, newcastle disease virus); morbillivirus (measles virus,
canine distemper virus and rinderpest virus); and pneumovirus
(respiratory syncytial virus and bovine respiratory syncytial
virus).
[0007] Human respiratory syncytial virus (RSV) is the leading cause
of severe lower respiratory tract disease in infants and young
children and is responsible for considerable morbidity and
mortality. Two antigenically diverse RSV subgroups A and B are
present in human populations. RSV is also recognized as an
important agent of disease in immuno-compromised adults and in the
elderly. Due to the incomplete resistance to RSV reinfection
induced by natural infection, RSV may infect multiple times during
childhood and life. The goal of RSV immunoprophylaxis is to induce
sufficient resistance to prevent the serious disease which may be
associated with RSV infection. The current strategies for
developing RSV vaccines principally revolve around the
administration of purified viral antigen or the development of live
attenuated RSV for intranasal administration. However, to date
there have been no approved vaccines or highly effective antiviral
therapy for RSV. Infection with RSV can range from an unnoticeable
infection to severe pneumonia and death. RSV possesses a
single-stranded nonsegmented negative-sense RNA genome of 15, 221
nucleotides (Collins, 1991, In The paramyxoviruses pp. 103-162, D.
W. Kingsbury (ed.) Plenum Press, New York). The genome of RSV
encodes 10 mRNAs (Collins et al., 1984, J. Virol. 49: 572-578). The
genome contains a 44 nucleotide leader sequence at the 3' termini
followed by the NS1-NS2-N-P-M-SH-G-F-M2-L and a 155 nucleotide
trailer sequence at the 5' termini (Collins. 1991, supra). Each
gene transcription unit contains a short stretch of conserved gene
start (GS) sequence and a gene end (GE) sequences.
[0008] The viral genomic RNA is not infectious as naked RNA. The
RNA genome of RSV is tightly encapsidated with the major
nucleocapsid (N) protein and is associated with the phosphoprotein
(P) and the large (L) polymerase subunit. These proteins form the
nucleoprotein core, which is recognized as the minimum unit of
infectivity (Brown et al., 1967, J. Virol. 1: 368-373). The RSV N,
P, and L proteins form the viral RNA dependent RNA transcriptase
for transcription and replication of the RSV genome (Yu et al.,
1995, J. Virol. 69:2412-2419; Grosfeld et al., 1995, J. Virol.
69:5677-86). Recent studies indicate that the M2 gene products
(M2-1 and M2-2) are involved and are required for transcription
(Collins et al., 1996, Proc. Natl. Acad. Sci. 93:81-5).
[0009] The M protein is expressed as a peripheral membrane protein,
whereas the F and G proteins are expressed as integral membrane
proteins and are involved in virus attachment and viral entry into
cells. The G and F proteins are the major antigens that elicit
neutralizing antibodies in vivo (as reviewed in McIntosh and
Chanock, 1990 "Respiratory Syncytial Virus" 2nd ed. Virology (D. M.
Knipe et al., Ed.) Raven Press, Ltd., N.Y.). Antigenic dimorphism
between the subgroups of RSV A and B is mainly linked to the G
glycoprotein, whereas the F glycoprotein is more closely related
between the subgroups.
[0010] Despite decades of research, no safe and effective RSV
vaccine has been developed for the prevention of severe morbidity
and mortality associated with RSV infection. A formalin-inactivated
virus vaccine has failed to provide protection against RSV
infection and its exacerbated symptoms during subsequent infection
by the wild-type virus in infants (Kapikian et al., 1969, Am. J.
Epidemiol. 89:405-21; Chin et al., 1969, Am. J. Epidemiol.
89:449-63) Efforts since have focused on developing live attenuated
temperature-sensitive mutants by chemical mutagenesis or cold
passage of the wild-type RSV (Gharpure et al., 1969, J. Virol. 3:
414-21; Crowe et al., 1994, Vaccine 12: 691-9). However, earlier
trials yielded discouraging results with these live attenuated
temperature sensitive mutants. Virus candidates were either
underattenuated or overattenuated (Kim et al., 1973, Pediatrics
52:56-63; Wright et al., 1976, J. Pediatrics 88:931-6) and some of
the vaccine candidates were genetically unstable which resulted in
the loss of the attenuated phenotype (Hodes et al., 1974, Proc.
Soc. Exp. Biol. Med. 145:1158-64).
[0011] Attempts have also been made to engineer recombinant
vaccinia vectors which express RSV F or G envelope glycoproteins.
However, the use of these vectors as vaccines to protect against
RSV infection in animal studies has shown inconsistent results
(Olmsted et al. 1986, Proc. Natl. Acad. Sci. 83:7462-7466; Collins
et al., 1990, Vaccine 8:164-168).
[0012] Thus, efforts have turned to engineering recombinant RSV to
generate vaccines. For a long time, negative-sense RNA viruses were
refractory to study. Only recently has it been possible to recover
negative strand RNA viruses using a recombinant reverse genetics
approach (U.S. Pat. No. 5,166,057 to Palese et al.). Although this
method was originally applied to engineer influenza viral genomes
(Luytes et al. 1989, Cell 59:1107-1113; Enami et al. 1990, Proc.
Natl. Acad. Sci. USA 92: 11563-11567), it has been successfully
applied to a wide variety of segmented and nonsegmented negative
strand RNA viruses, including rabies (Schnell et al. 1994, EMBO J.
13: 4195-4203); VSV (Lawson et al., 1995, Proc. Natl. Acad. Sci.
USA 92: 4477-81); measles virus (Radecke et al., 1995, EMBO J.
14:5773-84); rinderpest virus (Baron & Barrett, 1997, J. virol.
71: 1265-71); humanparainfluenza virus (Hoffman & Banerjee,
1997, J. Virol. 71:3272-7; Dubin et al., 1997, Virology
235:323-32); SV5 (He et al., 1997, Virology 237:249-60);
respiratory syncytial virus (Collins et al. 1991, Proc. Natl. Acad.
Sci. USA 88: 9663-9667) and Sendai virus (Park et al. 1991, Proc.
Natl. Acad. Sci. USA 88:5537-5541; Kato et al. 1996, Genes to Cells
1:569-579). Although this approach has been used to successfully
rescue RSV, a number of groups have reported that RSV is still
refractory to study given several properties of RSV which
distinguish it from the better characterized paramyxoviruses of the
genera Paramnyxovirus, Rubulavirus, and Morbillivirus. These
differences include a greater number of RNAs, an unusual gene order
at the 3' end of the genome, extensive strain-to-strain sequence
diversity, several proteins not found in other nonsegmented
negative strand RNA viruses and a requirement for the M2 protein
(ORF1) to proceed with full processing of full length transcripts
and rescue of a full length genome (Collins et al. PCT WO97/12032;
Collins, P. L. et al. pp 1313-1357 of volume 1, Fields Virology. et
al., Eds. (3rd ed., Raven Press, 1996).
3. SUMMARY OF THE INVENTION
[0013] The present invention relates to genetically engineered
recombinant RS viruses and viral vectors which contain heterologous
genes which for the use as vaccines In accordance with the present
invention, the recombinant RS viral vectors and viruses are
engineered to contain heterologous genes, including genes of other
viruses, pathogens, cellular genes, tumor antigens, or to encode
combinations of genes from different strains of RSV.
[0014] Recombinant negative-strand viral RNA templates are
described which may be used to transfect transformed cell that
express the RNA dependent RNA polymerase and allow for
complementation. Alternatively, a plasmid expressing the components
of the RNA polymerase from an appropriate promoter can be used to
transfect cells to allow for complementation of the negative-strand
viral RNA templates. Complementation may also be achieved with the
use of a helper virus or wild-type virus to provide the RNA
dependent RNA polymerase. The RNA templates are prepared by
transcription of appropriate DNA sequences with a DNA-directed
RNApolymerase. The resulting RNA templates are
ofnegative-orpositive-polarity and contain appropriate terminal
sequences which enable the viral RNA-synthesizing apparatus to
recognize the template. Bicistronic mRNAs can be constructed to
permit internal initiation of translation of viral sequences and
allow for the expression of foreign protein coding sequences from
the regular terminal initiation site, or vice versa.
[0015] As demonstrated by the examples described herein,
recombinant RSV genome in the positive-sense or negative-sense
orientation is co-transfected with expression vectors encoding the
viral nucleocapsid (N) protein, the associated nucleocapsid
phosphoprotein (P), the large (L) polymerase subunit protein, with
or without the M2/ORF1 protein of RSV to generate infectious viral
particles. Plasmids encoding RS virus polypeptides are used as the
source of proteins which were able to replicate and transcribe
synthetically derived RNPs. The minimum subset of RSV proteins
needed for specific replication and expression of the viral RNP was
found to be the three polymerase complex proteins (N, P and L).
This suggests that the entire M2-1 gene function, supplied by a
separate plasmid expressing M2-1, may not be absolutely required
for the replication, expression and rescue of infectious RSV.
[0016] The expression products and/or chimeric virions obtained may
advantageously be utilized in vaccine formulations. In particular,
recombinant RSV genetically engineered to demonstrate an attenuated
phenotype may be utilized as a live RSV vaccine. In another
embodiment of the invention, recombinant RSV may be engineered to
express the antigenic polypeptides of another strain of RSV (e.g.
RSV G and F proteins) or another virus (e.g., an immunogenic
peptide from gp120 of HIV) to generate a chimeric RSV to serve as a
vaccine, that is able to elicit both vertebrate humoral and
cell-mediated immune responses. The use of recombinant influenza or
recombinant RSV for this purpose is especially attractive since
these viruses demonstrate tremendous strain variability allowing
for the construction of a vast repertoire of vaccine formulations.
The ability to select from thousands of virus variants for
constructing chimeric viruses obviates the problem of host
resistance encountered when using other viruses such as
vaccinia.
[0017] The present invention further relates to the attenuation of
human respiratory syncytial virus by deletion of viral accessory
gene(s) either singly or in combination.
[0018] The present invention further relates to the attenuation of
human respiratory syncytial virus by mutagenesis of the viral M2-1
gene.
[0019] 3.1. Definitions
[0020] As used herein, the following terms will have the meanings
indicated:
[0021] cRNA=anti-genomic RNA
[0022] HA=hemagglutinin (envelope glycoprotein)
[0023] HIV=human immunodefiency virus
[0024] L=large polymerase subunit
[0025] M=matrix protein (lines inside of envelope)
[0026] MDCK=Madin Darby canine kidney cells
[0027] MDBK=Madin Darby bovine kidney cells
[0028] moi=multiplicity of infection
[0029] N=nucleocapsid protein
[0030] NA=neuraminidase (envelope glycoprotein)
[0031] NP=nucleoprotein (associated with RNA and required for
polymerase activity)
[0032] NS=nonstructural protein (function unknown)
[0033] nt=nucleotide
[0034] P=nucleocapsid phosphoprotein
[0035] PA, PB1, PB2 RNA-directed RNA polymerase components
[0036] RNP=ribonucleoprotein (RNA, PB2, PB1, PA and NP)
[0037] rRNP=recombinant RNP
[0038] RSV=respiratory syncytial virus
[0039] vRNA=genomic virus RNA
[0040] viral polymerase complex=PA, PB1, PB2 and NP
[0041] WSN=influenza A/WSN/33 virus
[0042] WSN-HK virus: reassortment virus containing seven genes from
WSN virus and the NA gene from influenza A/HK/8/68 virus
4. DESCRIPTION OF THE FIGURES
[0043] FIG. 1. Schematic representation of the RSV/CAT construct
(pRSVA2CAT) used in rescue experiments. The approximate 100 nt long
leader and 200 nt long trailer regions of RSV were constructed by
the controlled annealing of synthetic oligonucleotides containing
partial overlapping complementarity. The overlapping leader
oligonucleotides are indicated by the 1 L-5L shown in the
construct. The overlapping trailer nucleotides are indicated by the
1T-9T shown in the construct. The nucleotide sequences of the
leader and trailer DNAs were ligated into purified CAT gene DNA at
the indicate XbaI and PstI sites respectively. This entire
construct was then ligated into KpnI/HindIII digested pUC19. The
inclusion of a T7 promoter sequence and a HgaI site flanking the
trailer and leader sequences, respectively, allowed in vitro
synthesis of RSV/CAT RNA transcripts containing the precise genomic
sequence 3' and 5' ends.
[0044] FIG. 2. Thin layer chromatogram (TLC) showing the CAT
activity present in 293 cell extracts following infection and
transfection with RNA transcribed from the RSV/CAT construct shown
in FIG. 11. Confluent monolayers of 293 cells in six-well plates
(-10.sup.6 cells) were infected with either RSV A2 or B9320 at an
m.o.i. of 0.1-1.0 pfu cell. At 1 hour post infection cells were
transfected with 5-10 .mu.g of CAT/RSV using the Transfect-Act.TM.
protocol of Life Technologies. At 24 hours post infection the
infected/transfected monolayers were harvested and processed for
subsequence CAT assay according to Current Protocols in Molecular
Biology, Vol. 1, Chapter 9.6.2; Gorman, et al., (1982) Mol. Cell.
Biol. 2:1044-1051. Lanes 1, 2, 3 and 4 show the CAT activity
present in (1) uninfected 293 cells, transfected with CAT/RSV-A2
infected 293 cells, co-infected with supernatant from (2) above.
The CAT activity observed in each lane was produced from 1/5 of the
total cellular extract from 10.sup.6 cells.
[0045] FIG. 3. Schematic representation of the RSV strain A2 genome
showing the relative positions of the primer pairs used for the
synthesis of cDNAs comprising the entire genome. The endonuclease
sites used to splice these clones together are indicated; these
sites were present in the native RSV sequence and were included in
the primers used for cDNA synthesis. Approximately 100 ng of viral
genomic RNA was used in RT/PCR reactions for the separate synthesis
of each of the seven cDNAs. The primers for the first and second
strand cDNA synthesis from the genomic RNA template are also shown.
For each cDNA, the primers for the first strand synthesis are nos.
1-7 and the primers for the second strand synthesis are nos.
1'-7'.
[0046] FIG. 4. Schematic representation of the RSV subgroup B
strain B9320. BamH1 sites were created in the oligonucleotide
primers used for RT/PCR in order to clone the G and F genes from
the B9320 strain into RSV subgroup A2 antigenomic cDNA (FIG. 4A). A
cDNA fragment which contained G and F genes from 4326 nucleotides
to 9387 nucleotides of A2 strain was first subcloned into pUC19
(pUCRVH). Bgl II sites were created at positions of 4630 (SH/G
intergenic junction) (FIG. 4B) and 7554 (F/M2 intergenic junction
(FIG. 4C). B93260 A-G and --F cDNA inserted into pUCR/H which is
deleted of the A-G and F genes. The resulting antigenomic cDNA
clone was termed as pRSVB-GF and was used to transfect Hep-2 cells
to generate infectious RSVB-GF virus.
[0047] FIG. 5. Recombinant RSVB-GF virus was characterized by
RT/PCR using RSV subgroup B specific primers. RSV subgroup B
specific primers in the G region were incubated with aliquots of
the recombinant RSV viral genomes and subjected to PCR. The PCR
products were analyzed by electrophoresis on a 1% agarose gel and
visualized by staining with ethidium bromide. As shown, no DNA
product was produced in the RT/PCR reaction using RSV A2 as a
template. However, a predicted product of 254 base pairs was seen
in RT/PCR of RSVB-GF RNA and PCR control of plasmid pRSV-GF DNA as
template, indicating the rescued virus contained G and F genes
derived from B9320 virus.
[0048] FIG. 6. Identification ofchimeric rRSVA2(B-G) by RT/PCR and
Northern blot analysis of RNA expression. FIG. 6A. RT/PCT analysis
of chimeric rRSV A2(B-G), in comparison with wild-type A2(A2).
Virion RNA extracted from rRSVA2(B-G) (lanes 1, 2) and rRSVA2
(lanes 3, 4) was reverse transcribed using a primer annealed to (-)
sense vRNA in the RSV F gene in the presence (+) or absence (-) of
reverse transcriptase (RT), followed by PCR with a primer fair
flanking the B-G insertion site. No DNA was detected in RT/PCR when
reverse transcriptase (RT) was absent (lanes 2, 4). A cDNA
fragment, which is about 1 kb bigger than the cDNA derived from A2,
was produced from rRSVA(B-G). This longer PCR DNA product was
digested by StuI restriction enzyme unique to the inserted B-G gene
(lane 5). 100 bp DNA size marker is indicated (M). FIG. 6B.
Northern blot analysis of G mRNA expression. Hep-2 cells were
infected with RSV B9320, rRSVA2 and chimeric rRSVA2(B-G). At 48 hr
postinfection, total cellular RNA was extracted and electrophoresed
on a 1.2% agarose gel containing formaldehyde. RNA was transferred
to Hybond Nylon membrane and the filter was hybridized with a
.sup.32P-labeled oligonucleotide probe specific for A2-G or
specific for B9320-G mRNA. Both A2 G specific and B9320 G specific
transcripts were detected in the rRSVA2 (B-G) infected cells. The
run-off RNA transcript (G-M2) from rRSV A2 (B-G) infected cells is
also indicated.
[0049] FIG. 7. Analysis, of protein expression by rRSVA2 (B-G).
Hep-2 cells were mock-infected (lanes 1, 5), infected with RSV
B9320 (lanes 2, 6), rRSVA2 (lanes 3, 7) and rRSV A2 (B-G) (lanes 4,
8). At 14-18 hr postinfection, infected cells were labeled with
.sup.35S-promix and polypeptides were immunoprecipitated by goat
polyclonal antiserum against RSV A2 strain (lanes 1-5) or by mouse
polyclonal antiserum against RSV B9320 strain (lanes 5-8).
Immunoprecipitated polypeptides were separated on a 10%
polyacrylamide gel. Both RSV A2 specific G protein and RSV B9320
specific G protein were produced in rRSV A2 (B-G) infected cells.
The G protein migration is indicated by *. Mobility of the F1
glycoprotein, and N, P, and M is indicated. Molecular sizes are
shown on the left in kilodaltons.
[0050] FIG. 8. Plaque morphology ofrRSV, rRSVC4G, rRSVA2(B-G) and
wild-type A2 virus (wt A2). Hep-2 cells were infected with each
virus and incubated at 35.degree. C. for six days. The cell
monolayers were fixed, visualized by immunostaining, and
photographed.
[0051] FIG. 9. Growth curve of rRSV, rRSVC4G, wild-type A2 RSV (wt
A2) and chimeric rRSVA2(B-G). Hep-2 cells were infected with either
virus at a moi of 0.5 and the medium was harvested at 24 hr
intervals. The titer of each virus was determined in duplicate by
plaque assay on Hep-2 cells and visualized by immunostaining.
[0052] FIG. 10. RSV L protein charged residue clusters targeted for
site-directed mutagenesis. Contiguous charged amino acid residues
in clusters were converted to alanines by site-directed mutagenesis
of the RSV L gene using the QuikChange site-directed mutagenesis
kit (Stratagene).
[0053] FIG. 11. RSV L protein cysteine residues targeted for
site-directed mutagenesis. Cysteine residues were converted to
alanine-residues by site-directed mutagenesis of the RSV L gene
using the QuikChange site-directed mutagenesis kit
(Stratagene).
[0054] FIG. 12. Identification RSV M2-2 and SH deletion mutants.
Deletions in M2-2 were generated by Hind III digestion of pET(S/B)
followed by recloning of a remaining Sac I to BamHI fragment into a
full-length clone. Deletions in SH were generated by Sac I
digestion ofpET(A/S) followed by recloning of a remaining Avr II
Sac I fragment into a full-length clone. FIG. 12A. Identification
of the recovered rRSV.DELTA.SH and rRSV.DELTA.M2-2 was performed by
RT/PCR using primer pairs specific for the SH gene or M2-2 gene,
respectively. FIG. 12B rRSV.DELTA.SH M2-2 was also detected by
RT/PCR using primer pairs specific for the M2-2 and SH genes.
RT/PCR products were run on an ethidium bromide agarose gel and
bands were visualized by ultraviolet (UV) light.
[0055] FIG. 13. Structure of rA2M2-2 genome and recovery of
rA2.DELTA.M2-2. (A). Sequences shown is the region of the M2 gene
that M2-1 and M2-2 open reading frames overlap. Total of 234 nt
that encode the C-terminal 78 amino acids of M2-2 was deleted
through the introduced Hind III sites (underlined). The N-terminal
12 amino acid residues of the M2-2 open reading frame are
maintained as it overlaps with the M2-1 gene. (B). RT/PCR products
of rA2.DELTA.M2-2 and rA2 viral RNA using primers V1948 and V1581
in the presence (+) or absence (-) of reverse transcriptase (RT).
The size of the DNA product derived from rA2 or rA2.DELTA.M2-2 is
indicated.
[0056] FIG. 14. Viral RNA expression by rA2.DELTA.M2-2 and rA2.
(A). Total RNA was extracted from rA2 or rA2.DELTA.M2-2 infected
Vero cells at 48 hr postinfection, separated by electrophoresis on
1.2% agarose/2.2 M formaldehyde gels and transferred to nylon
membranes. Each blot was hybridized with a Dig-labeled riboprobe
specific for the M2-2, M2-1, F, SH, G or N gene. The size of the
RNA marker is indicated on the left. (3). Hep-2 and Vero cells were
infected with rA2 or rA2.DELTA.M2-2 for 24 hr and total cellular
RNA was extracted. RNA Northern blot was hybridized with a
.sup.32P-labeled riboprobe specific to the negative sense F gene to
detect viral genomic RNA or a .sup.32P-labeled riboprobe specific
to the positive sense F gene to detect viral antigenomic RNA and F
mRNA. The top panel of the Northern blot on the right was taken
from the top portion of the gel shown in the lower panel and was
exposed for 1 week to show antigenome. The lower panel of the
Northern blot was exposed for 3 hr to show the F mRNA. The genome,
antigenome, F mRNA and dicistronic F-M2 RNA are indicated.
[0057] FIG. 15. Viral protein expression in rA2.DELTA.M2-2 and rA2
infected cells. (A). Mock-infected, rA2.DELTA.M2-2 and rA2 infected
Vero cells were metabolically labeled with .sup.35S-promix (100
.mu.Ci/ml) between 14 to 18 hr postinfection. Cell lysates were
prepared for immunoprecipitation with goat polyclonal anti-RSV or
rabbit polyclonal anti-M2-2 antisera. Immunoprecipitated
polypeptides were separated on a 17.5% polyacrylamide gel
containing 4 M urea and processed for autoradiography. The
positions of each viral protein are indicated on the right and the
molecular weight size markers are indicated on the left. (B).
Protein synthesis kinetics in Hep-2 and Vero cells by Western
blotting. Hep-2 and Vero cells were infected with rA2 or
rA2.DELTA.M2-2 and at 10 hr, 24 hr, or 48 hr postinfection, total
infected cellular polypeptides were separated on a 17.5%
polyacrylamide gel containing 4 M urea. Proteins were transferred
to a nylon membrane and the blot probed with polyclonal antisera
against M2-1, NS1 or SH as indicated.
[0058] FIG. 16. Plaque morphology of rA2.DELTA.M2-2 and rA2. Hep-2
or Vero cells were infected with rA2.DELTA.M2-2 or rA2 under
semisolid overlay composed of 1% methylcellulose and 1.times.L15
medium containing 2% FBS for 5 days. Virus plaques were visualized
by immunostaining with a goat polyclonal anti-RSV antiserum and
photographed under microscope.
[0059] FIG. 17. Growth curves of rA2.DELTA.M2-2 in Hep-2 and Vero
cells. Vero cells (A) or Hep-2 cells (B) were infected with
rA2.DELTA.M2-2 or rA2 at m.o.i. of 0.5, and aliquots of medium were
harvested at 24 hr intervals as indicated. The virus titers were
determined by plaque assay in Vero cells. Virus titer at each time
point is average of two experiments.
[0060] FIG. 18. Northern blot analysis of rA2.DELTA.NS1,
rA2.DELTA.NS2 and rA2.DELTA.NS1.DELTA.NS2. Total cellular RNA was
extracted from rA2, rA2.DELTA.NS1, rA2.DELTA.NS2 and rA2.DELTA.NS1
.DELTA.NS2 infected Vero cells at 24 hr postinfection, separated by
electrophoresis on 1.2% agarose/2.2 M formaldehyde gels and
transferred to nylon membranes. Each blot was hybridized with a
Dig-labeled riboprobe specific for the NS1, NS2, or M2-2 gene as
indicated.
[0061] FIG. 19. Plaque morphology of deletion mutants. Hep-2 or
Vero cells were infected with each deletion mutant as indicated
under semisolid overlay composed of 1% methylcellulose and
1.times.L15 medium containing 2% FBS for 6 days. Virus plaques were
visualized by immunostaining with a goat polyclonal anti-RSV
antiserum and photographed under microscope.
[0062] FIG. 20. Growth curves of rA.DELTA.NS1 in Vero cells. Vero
cells were infected with rA2 .DELTA.NS1 or rA2 at m.o.i. of 0.5,
and aliquots of medium were harvested at 24 hr intervals as
indicated. The virus titers were determined by plaque assay in Vero
cells.
[0063] FIG. 21. Growth curves of rA2.DELTA.NS2 in Vero cells. Vero
cells were infected with rA2 .DELTA.NS2 or rA2 at m.o.i. of 0.5,
and aliquots of medium were harvested at 24 hr intervals as
indicated. The virus titers were determined by plaque assay in Vero
cells.
[0064] FIG. 22. Growth curves of rA.DELTA.SH.DELTA.M2-2 in Vero
cells. Vero cells were infected with rA2.DELTA.NS2.DELTA.M-2 or rA2
at m.o.i. of 0.5, and aliquots of medium were harvested at 24 hr
intervals as indicated. The virus titers were determined by plaque
assay in Vero cells.
[0065] FIG. 23. Northern blot analysis of several deletion mutants.
Total cellular RNA was extracted from Vero cells infected with each
deletion mutant as indicated at 24 hr postinfection, separated by
electrophoresis on 1.2% agarose/2.2 M formaldehyde gels and
transferred to nylon membranes. Each blot was hybridized with a
Dig-labeled riboprobe specific for the NS1, NS2, SH or M2-2 gene as
indicated.
[0066] FIG. 24. Growth curves of rA2.DELTA.NS2.DELTA.M2-2 in Vero
cells. Vero cells were infected with rA2.DELTA.NS2.DELTA.M2-2 or
rA2 at m.o.i. of 0.5, and aliquots of medium were harvested at 24
hr intervals as indicated. The virus titers were determined by
plaque assay in Vero cells.
[0067] FIG. 25. Growth curves of rA2.DELTA.NS1.DELTA.NS2 in Vero
cells. Vero cells were infected with rA2.DELTA.NS1.DELTA.NS2 or rA2
at m.o.i. of 0.5, and aliquots of medium were harvested at 24 hr
intervals as indicated. The virus titers were determined by plaque
assay in Vero cells.
5. DESCRIPTION OF THE INVENTION
[0068] The present invention relates to genetically engineered
recombinant RS viruses and viral vectors which express heterologous
genes or mutated RS viral genes or a combination of viral genes
derived from different strains of RS virus. The invention relates
to the construction and use of recombinant negative strand RS viral
RNA templates which may be used with viral RNA-directed RNA
polymerase to express heterologous gene products in appropriate
host cells and/or to rescue the heterologous gene in virus
particles. The RNA templates of the present invention may be
prepared by transcription of appropriate DNA sequences using a
DNA-directed RNA polymerase such as bacteriophage T7, T3 or Sp6
polymerase. The recombinant RNA templates may be used to transfect
continuous/transfected cell lines that express the RNA-directed RNA
polymerase proteins allowing for complementation.
[0069] The invention is demonstrated by way of working examples in
which infectious RSV is rescued from cDNA containing the RSV genome
in the genomic or antigenomic sense introduced into cells
expressing the N, P, and L proteins of the RSV polymerase complex.
The working examples further demonstrate that expression of M2-1
expression plasmid is not required for recovery of infectious RSV
from cDNA which is contrary to what has been reported earlier
(Collins et al., 1995, Proc. Natl. Acad. Sci. USA 92:11563-7).
Furthermore, the deletion of the M2-ORF2 from recombinant RSV cDNA
results in the rescue of attenuated RSV particles. M2-2-deleted-RSV
is an excellent vehicle to generate chimeric RSV encoding
heterologous gene products, these chimeric viral vectors and
rescued virus particles have utility as expression vectors for the
expression of heterologous gene products and as live attenuated RSV
vaccines expressing either RSV antigenic polypeptides or antigenic
polypeptides of other viruses.
[0070] The invention is further demonstrated by way of working
examples in which a cDNA clone which contained the complete genome
of RSV, in addition to a T7 promoter, a hepatitis delta virus
ribozyme and a T7 terminator, is used to generate an infectious
viral particle when co-transfected with expression vectors encoding
the N, P, L proteins of RSV. In addition, the working examples
describe RNA transcripts of cloned DNA containing the coding
region--in negative sense orientation--of the
chloramphenicol-acetyl-transferase (CAT) gene or the green
fluorescent protein (GFP) gene flanked by the 5' terminal and 3'
terminal nucleotides of the RSV genome. The working examples
further demonstrate that an RSV promoter mutated to have increased
activity resulted in rescue of infectious RSV particles from a full
length RSV cDNA with high efficiency. These results demonstrate the
successful use of recombinant viral negative strand templates and
RSV polymerase with increased activity to rescue RSV. This system
is an excellent tool to engineer RSV viruses with defined
biological properties, e.g. live-attenuated vaccines against RSV,
and to use recombinant RSV as an expression vector for the
expression of heterologous gene products.
[0071] This invention relates to the construction and use of
recombinant negative strand viral RNA templates which may be used
with viral RNA-directed RNA polymerase to express heterologous gene
products in appropriate host cells, to rescue the heterologous gene
in virus particles and/or express mutated or chimeric recombinant
negative strand viral RNA templates (see U.S. Pat. No. 5,166,057 to
Palese et al., incorporated herein by reference in its entirety).
In a specific embodiment of the invention, the heterologous gene
product is a peptide or protein derived from another strain of the
virus or another virus. The RNA templates may be in the positive or
negative-sense orientation and are prepared by transcription of
appropriate DNA sequences using a DNA-directed RNA polymerase such
as bacteriophage T7, T3 or the Sp6 polymerase.
[0072] The ability to reconstitute RNP's in vitro allows the design
of novel chimeric influenza and RSV viruses which express foreign
genes. One way to achieve this goal involves modifying existing
viral genes. For example, the G or F gene may be modified to
contain foreign sequences, such as the HA gene of influenza in its
external domains. Where the heterologous sequence are epitopes or
antigens of pathogens, these chimeric viruses may be used to induce
a protective immune response against the disease agent from which
these determinants are derived. For example, a chimeric RNA may be
constructed in which a coding sequence derived from the gp120
coding region of human immunodeficiency virus was inserted into the
coding sequence of RSV, and chimeric virus produced from
transfection of this chimeric RNA segment into a host cell infected
with wild-type RSV.
[0073] In addition to modifying genes coding for surface proteins,
genes coding for nonsurface proteins may be altered. The latter
genes have been shown to be associated with most of the important
cellular immune responses in the RS virus system. Thus, the
inclusion of a foreign determinant in the G or F gene of RSV
may--following infection--induce an effective cellular immune
response against this determinant. Such an approach may be
particularly helpful in situations in which protective immunity
heavily depends on the induction of cellular immune responses
(e.g., malaria, etc.).
[0074] The present invention also relates to attenuated recombinant
RSV produced by introducing specific mutations in the genome of RSV
which results in an amino acid change in an RSV protein, such as a
polymerase protein, which results in an attenuated phenotype.
[0075] The present invention also further relates to the generation
of attenuated recombinant RSV produced by introducing specific
deletions of viral accessory gene(s) either singly or in
combination. Specifically, the present invention relates to the
generation of attenuated recombinant RSV bearing a deletion of
either the M2-2, SH, NS1, or NS2 viral accessory gene.
Additionally, the present invention specifically relates to the
generation of attenuated recombinant RSV bearing a combination
deletion of either the M2-2/SH viral accessory genes, the M2-2/NS2
viral accessory genes, the NS1/NS2 viral accessory genes, the
NS1/NS2 viral accessory genes, the SH/NS1 viral accessory genes,
the SH/NS2 viral accessory genes, or the SH/NS1/NS2 viral accessory
genes.
[0076] The invention is demonstrated by way of the working examples
presented herein in which infectious attenuated RSV is rescued from
RSV cDNA bearing deletions in the M2-2, SH, NS1, or NS2 viral
accessory gene(s) either singly or in combination. Such M2-2, SH,
NS1, NS2, M2-2/SH, M2-2/NS2, NS1/NS2, SH/NS1, SH/NS2, or
SH/NS1/NS2-deleted RSV represent excellent vehicles for the
generation of live attenuated RSV vaccines. Additionally, such
M2-2, SH, NS1, NS2, M2-2/SH, M2-2/NS2, NS1/NS2, SH/NS1, SH/NS2, or
SH/NS1/NS2-deleted RSV represent excellent vehicles for the
generation of chimeric RSV encoding heterologous gene products in
place of either the M2-2, SH, NS1, NS2, M2-2/SH, M2-2/NS2, NS1/NS2,
SH/NS1, SH/NS2, or SH/NS1/NS2 genes. These chimeric RSV-based viral
vectors and rescued infectious attenuated viral particles thus have
utility as expression vectors for the expression of heterologus gee
products and as live attenuated RSV vaccines expressing either RSV
antigenic polypeptides or antigenic polypeptides of heterologous
viruses.
[0077] The present invention further relates to the generation of
attenuated recombinant RSV produced by introducing specific
mutations into the M2-1 gene. Specifically, the present invention
relates to the generation of attenuated recombinant RSV bearing a
mutation of the M2-1 gene introduced by one or more techniques,
including, without limitation, cysteine scanning mutagenesis and
C-terminal truncations of the M2-1 protein.
[0078] 5.1. Construction of the Recombinant RNA Templates
[0079] Heterologous gene coding sequences flanked by the complement
of the viral polymerase binding site/promoter, e.g., the complement
of the 3'-RSV termini or the 3'- and 5'-RSV termini may be
constructed using techniques known in the art. Heterologous gene
coding sequences may also be flanked by the complement of the RSV
polymerase binding site/promoter, e.g., the leader and trailer
sequence of RSV using techniques known in the art. Recombinant DNA
molecules containing these hybrid sequences can be cloned and
transcribed by a DNA-directed RNA polymerase, such as bacteriophage
T7, T3 or the Sp6 polymerase and the like, to produce the
recombinant RNA templates which possess the appropriate viral
sequences that allow for viral polymerase recognition and
activity.
[0080] In a preferred embodiment of the present invention, the
heterologous sequences are derived from the genome of another
strain of RSV, e.g., the genome of RSV A strain is engineered to
include the nucleotide sequences encoding the antigenic
polypeptides G and F of RSV B strain, or fragments thereof. In such
an embodiment of the invention, heterologous coding sequences from
another strain of RSV can be used to substitute for nucleotide
sequences encoding antigenic polypeptides of the starting strain,
or be expressed in addition to the antigenic polypeptides of the
parent strain, so that a recombinant RSV genome is engineered to
express the antigenic polypeptides of one, two or more strains of
RSV.
[0081] In yet another embodiment of the invention, the heterologous
sequences are derived from the genome of any strain of influenza
virus. In accordance with the present invention, the heterologous
coding sequences of influenza may be inserted within a RSV coding
sequence such that a chimeric gene product is expressed which
contains the heterologous peptide sequence within the RSV viral
protein. In either embodiment, the heterologous sequences derived
from the genome of influenza may include, but are not limited to
HA, NA, PB1, PB2, PA, NS1 or NS2.
[0082] In one specific embodiment of the invention, the
heterologous sequences are derived from the genome of human
immunodeficiency virus (HIV), preferably human immunodeficiency
virus-1 or human immunodeficiency virus-2. In another embodiment of
the invention, the heterologous coding sequences may be inserted
within an RSV gene coding sequence such that a chimeric gene
product is expressed which contains the heterologous peptide
sequence within the influenza viral protein. In such an embodiment
of the invention, the heterologous sequences may also be derived
from the genome of a human immunodeficiency virus, preferably of
human immunodeficiency virus-1 or human immunodeficiency
virus-2.
[0083] In instances whereby the heterologous sequences are
HIV-derived, such sequences may include, but are not limited to,
sequences derived from the env gene (i.e., sequences encoding all
or part of gp160, gp120, and/or gp41), the pol gene (i.e. sequences
encoding all or part of reverse transcriptase, endonuclease,
protease, and/or integrase), the gag gene (i.e. sequences encoding
all or part of p7, p6, p55, p17/18, p24/25) tat, rev, nef, vif,
vpu, vpr, and/or vpx.
[0084] One approach for constructing these hybrid molecules is to
insert the heterologous coding sequence into a DNA complement of a
RSV genomic RNA so that the heterologous sequence is flanked by the
viral sequences required for viral polymerase activity; i.e., the
viral polymerase binding site/promoter, hereinafter referred to as
the viral polymerase binding site. In an alternative approach,
oligonucleotides encoding the viral polymerase binding site, e.g.,
the complement of the 3'-terminus or both termini of the virus
genomic segments can be ligated to the heterologous coding sequence
to construct the hybrid molecule. The placement of a foreign gene
or segment of a foreign gene within a target sequence was formerly
dictated by the presence of appropriate restriction enzyme sites
within the target sequence. However, recent advances in molecular
biology have lessened this problem greatly. Restriction enzyme
sites can readily be placed anywhere within a target sequence
through the use of site-directed mutagenesis (e.g., see, for
example, the techniques described by Kunkel, 1985, Proc. Natl.
Acad. Sci. U.S.A. 82; 488). Variations in polymerase chain reaction
(PCR) technology, described infra, also allow for the specific
insertion of sequences (i.e., restriction enzyme sites) and allow
for the facile construction of hybrid molecules. Alternatively, PCR
reactions could be used to prepare recombinant templates without
the need of cloning. For example, PCR reactions could be used to
prepare double-stranded DNA molecules containing a DNA-directed RNA
polymerase promoter (e.g., bacteriophage T3, T7 or Sp6) and the
hybrid sequence containing the heterologous gene and the influenza
viral polymerase binding site. RNA templates could then be
transcribed directly from this recombinant DNA. In yet another
embodiment, the recombinant RNA templates may be prepared by
ligating RNAs specifiing the negative polarity of the heterologous
gene and the viral polymerase binding site using an RNA ligase.
Sequence requirements for viral polymerase activity and constructs
which may be used in accordance with the invention are described in
the subsections below.
[0085] 5.1.1. Insertion of the Heterologous Genes
[0086] The gene coding for the L protein contains a single open
reading frame. The genes coding for M2 contain two open reading
frames for ORF1 and 2, respectively. NS1 and NS2 are coded for by
two genes, NS1 and NS2. The G and F proteins, coded for by separate
genes, are the major surface glycoproteins of the virus.
Consequently, these proteins are the major targets for the humoral
immune response after infection. Insertion of a foreign gene
sequence into any of these coding regions could be accomplished by
either an addition of the foreign sequences to be expressed or by a
complete replacement of the viral coding region with the foreign
gene or by a partial replacement. The heterologous sequences
inserted into the RSV genome may be any length up to approximately
5 kilobases. Complete replacement would probably best be
accomplished through the use of PCR-directed mutagenesis.
[0087] Alternatively, a bicistronic mRNA could be constructed to
permit internal initiation of translation of viral sequences and
allow for the expression of foreign protein coding sequences from
the regular terminal initiation site. Alternatively, a bicistronic
mRNA sequence may be constructed wherein the viral sequence is
translated from the regular terminal open reading frame, while the
foreign sequence is initiated from an internal site. Certain
internal ribosome entry site (IRES) sequences may be utilized. The
IRES sequences which are chosen should be short enough to not
interfere with RS virus packaging limitations. Thus, it is
preferable that the IRES chosen for such a bicistronic approach be
no more than 500 nucleotides in length, with less than 250
nucleotides being preferred. Further, it is preferable that the
IRES utilized not share sequence or structural homology with
picornaviral elements. Preferred IRES elements include, but are not
limited to the mammalian BiP IRES and the hepatitis C virus
IRES.
[0088] 5.2. Expression of Heterologous Gene Products Using
Recombinant RNA Template
[0089] The recombinant templates prepared as described above can be
used in a variety of ways to express the heterologous gene products
in appropriate host cells or to create chimeric viruses that
express the heterologous gene products. In one embodiment, the
recombinant template can be combined with viral polymerase complex
purified infra, to produce rRNPs which are infectious. To this end,
the recombinant template can be transcribed in the presence of the
viral polymerase complex. Alternatively, the recombinant template
may be mixed with or transcribed in the presence of viral
polymerase complex prepared using recombinant DNA methods (e.g. see
Kingsbury et al., 1987, Virology 156:396-403). In yet another
embodiment, the recombinant template can be used to transfect
appropriate host cells to direct the expression of the heterologous
gene product at high levels. Host cell systems which provide for
high levels of expression include continuous cell lines that supply
viral functions such as cell lines superinfected with RSV, cell
lines engineered to complement RSV viral functions, etc.
[0090] 5.3. Preparation of Chimeric Negative Strand RNA Virus
[0091] In order to prepare chimeric virus, reconstituted RNPs
containing modified RSV RNAs or RNA coding for foreign proteins may
be used to transfect cells which are also infected with a "parent"
RSV virus. Alternatively, the reconstituted RNP preparations may be
mixed with the RNPs of wild type parent virus and used for
transfection directly. Following transfection, the novel viruses
may be isolated and their genomes identified through hybridization
analysis. In additional approaches described herein for the
production of infectious chimeric virus, rRNPs may be replicated in
host cell systems that express the RSV or influenza viral
polymerase proteins e.g., in virus/host cell expression systems;
transformed cell lines engineered to express the polymerase
proteins, etc.), so that infectious chimeric virus are rescued; in
this instance, helper virus need not be utilized since this
function is provided by the viral polymerase proteins expressed. In
a particularly desirable approach, cells infected with rRNPs
engineered for all eight influenza virus segments may result in the
production of infectious chimeric virus which contain the desired
genotype; thus eliminating the need for a selection system.
[0092] Theoretically, one can replace any one of the genes of RSV,
or part of any one of the RSV genes, with the foreign sequence.
However, a necessary part of this equation is the ability to
propagate the defective virus (defective because a normal viral
gene product is missing or altered). A number of possible
approaches exist to circumvent this problem.
[0093] A third approach to propagating the recombinant virus may
involve co-cultivation with wild-type virus. This could be done by
simply taking recombinant virus and co-infecting cells with this
and another wild-type virus (preferably a vaccine strain). The
wild-type virus should complement for the defective virus gene
product and allow growth of both the wild-type and recombinant
virus. This would be an analogous situation to the propagation of
defective-interfering particles of influenza virus (Nayak et al.,
1983, In: Genetics of Influenza Viruses, P. Palese and D. W.
Kingsbury, eds., Springer-Verlag, Vienna, pp. 255-279). In the case
of defective-interfering viruses, conditions can be modified such
that the majority of the propagated virus is the defective particle
rather than the wild-type virus. Therefore this approach may be
useful in generating high titer stocks of recombinant virus.
However, these stocks would necessarily contain some wild-type
virus.
[0094] Alternatively, synthetic RNPs may be replicated in cells
co-infected with recombinant viruses that express the RS virus
polymerase proteins. In fact, this method may be used to rescue
recombinant infectious virus in accordance with the invention. To
this end, the RSV virus polymerase proteins may be expressed in any
expression vector/host cell system, including, but not limited to,
viral expression vectors (e.g., vaccinia virus, adenovirus,
baculovirus, etc.) or cell lines that express the polymerase
proteins e.g., see Krystal et al., 1986, Proc. Natl. Acad. Sci. USA
83: 2709-2713).
[0095] 5.4. Generation of Chimeric Viruses with an Attenuated
Phenotype
[0096] The methods of present invention may be used to introduce
mutations or heterologous sequences to generate chimeric attenuated
viruses which have many applications, including analysis of RSV
molecular biology, pathogenesis, and growth and infection
properties. In accordance with the present invention, mutations or
heterologous sequences may be introduced for example into the F or
G protein coding sequences, NS1, NS2, M1ORF1, M2ORF2, N, P, or L
coding sequences. In yet another embodiment of the present
invention, a particular viral gene, or the expression thereof, may
be eliminated to generate an attenuated phenotype, e.g., the M ORF
may be deleted from the RSV genome to generate a recombinant RSV
with an attenuated phenotype. In yet another embodiment, the
individual internal genes of human RSV can be replaced by another
strains counterpart, or their bovine or murine counterpart. This
may include part or all of one or more of the NS1, NS2, N, P, M,
SH, M2(ORF1), M2(ORF2) and L genes or the G and F genes. The RSV
genome contains ten mRNAs encoding three transmembrane proteins, G
protein, fusion F protein required for penetration, and the small
SH protein; the nucleocapsid proteins N, P and L; transcription
elongation factor M2 ORF 1; the matrix M protein and two
nonstructural proteins, NS1 and NS2. Any one of the proteins may be
targeted to generate an attenuated phenotype. Other mutations which
may be utilized to result in an attenuated phenotype are
insertional, deletional and site directed mutations of the leader
and trailer sequences.
[0097] In accordance with the present invention, an attenuated RSV
exhibits a substantially lower degree of virulence as compared to a
wild-type virus, including a slower growth rate, such that the
symptoms of viral infection do not occur in an immunized
individual.
[0098] In accordance with the present invention attenuated
recombinant RSV may be generated by incorporating a broad range of
mutations including single nucleotide changes, site-specific
mutations, insertions, substitutions, deletions, or rearrangements.
These mutations may affect a small segment of the RSV genome, e.g.,
15 to 30 nucleotides, or large segments of the RSV genome, e.g., 50
to 1000 nucleotides, depending on the nature of the mutation. In
yet another embodiment, mutations are introduced upstream or
downstream of an existing cis-acting regulatory element in order to
ablate its activity, thus resulting in an attenuated phenotype.
[0099] In accordance with the invention, a non-coding regulatory
region of a virus can be altered to down-regulate any viral gene,
e.g. reduce transcription of its mRNA and/or reduce replication of
vRNA (viral RNA), so that an attenuated virus is produced.
[0100] Alterations of non-coding regulatory regions of the viral
genome which result in down-regulation of replication of a viral
gene, and/or down-regulation of transcription of a viral gene will
result in the production of defective particles in each round of
replication; i.e. particles which package less than the full
complement of viral segments required for a fully infectious,
pathogenic virus. Therefore, the altered virus will demonstrate
attenuated characteristics in that the virus will shed more
defective particles than wild type particles in each round of
replication. However, since the amount of protein synthesized in
each round is similar for both wild type virus and the defective
particles, such attenuated viruses are capable of inducing a good
immune response.
[0101] The foregoing approach is equally applicable to both
segmented and non-segmented viruses, where the down regulation of
transcription of a viral gene will reduce the production of its
mRNA and the encoded gene product. Where the viral gene encodes a
structural protein, e.g., a capsid, matrix, surface or envelope
protein, the number of particles produced during replication will
be reduced so that the altered virus demonstrates attenuated
characteristics; e.g. a titer which results in subclinical levels
of infection. For example, a decrease in viral capsid expression
will reduce the number of nucleocapsids packaged during
replication, whereas a decrease in expression of the envelope
protein may reduce the number and/or infectivity of progeny
virions. Alternatively, a decrease in expression of the viral
enzymes required for replication, e.g., the polymerase, replicase,
helicase, and the like, should decrease the number of progeny
genomes generated during replication. Since the number of
infectious particles produced during replication are reduced, the
altered viruses demonstrated attenuated characteristics. However,
the number of antigenic virus particles produced will be sufficient
to induce a vigorous immune response.
[0102] An alternative way to engineer attenuated viruses involves
the introduction of an alteration, including but not limited to an
insertion, deletion or substitution of one or more amino acid
residues and/or epitopes into one or more of the viral proteins.
This may be readily accomplished by engineering the appropriate
alteration into the corresponding viral gene sequence. Any change
that alters the activity of the viral protein so that viral
replication is modified or reduced may be accomplished in
accordance with the invention.
[0103] For example, alterations that interfere with but do not
completely abolish viral attachment to host cell receptors and
ensuing infection can be engineered into viral surface antigens or
viral proteases involved in processing to produce an attenuated
strain. According to this embodiment, viral surface antigens can be
modified to contain insertions, substitution or deletions of one or
more amino acids or epitopes that interfere with or reduce the
binding affinity of the viral antigen for the host cell receptors.
This approach offers an added advantage in that a chimeric virus
which expresses a foreign epitope may be produced which also
demonstrates attenuated characteristics. Such viruses are ideal
candidates for use as live recombinant vaccines. For example,
heterologous gene sequences that can be engineered into the
chimeric viruses of the invention include, but are not limited to,
epitopes of human immunodeficiency virus (HIV) such as gp120;
hepatitis B virus surface antigen (HBsAg); the glycoproteins of
herpes virus (e.g., gD, gE); VP1 of poliovirus; and antigenic
determinants of nonviral pathogens such as bacteria and parasites,
to name but a few.
[0104] In this regard, RSV is an ideal system in which to engineer
foreign epitopes, because the ability to select from thousands of
virus variants for constructing chimeric viruses obviates the
problem of host resistance or immune tolerance encountered when
using other virus vectors such as vaccinia. In another embodiment,
alterations of viral proteases required for processing viral
proteins can be engineered to produce attenuation. Alterations
which affect enzyme activity and render the enzyme less efficient
in processing, should affect viral infectivity, packaging, and/or
release to produce an attenuated virus.
[0105] In another embodiment, viral enzymes involved in viral
replication and transcription of viral genes, e.g., viral
polymerases, replicases, helicases, etc. may be altered so that the
enzyme is less efficient or active. Reduction in such enzyme
activity may result in the production of fewer progeny genomes
and/or viral transcripts so that fewer infectious particles are
produced during replication.
[0106] The alterations engineered into any of the viral enzymes
include but are not limited to insertions, deletions and
substitutions in the amino acid sequence of the active site of the
molecule. For example, the binding site of the enzyme could be
altered so that its binding affinity for substrate is reduced, and
as a result, the enzyme is less specific and/or efficient. For
example, a target of choice is the viral polymerase complex since
temperature sensitive mutations exist in all polymerase proteins.
Thus, changes introduced into the amino acid positions associated
with such temperature sensitivity can be engineered into the viral
polymerase gene so that an attenuated strain is produced.
[0107] 5.4.1. The Rsv L Gene as a Target for Attenuation
[0108] In accordance with the present invention, the RSV L gene is
an important target to generate recombinant RSV with an attenuated
phenotype. The L gene represents 48% of the entire RSV genome. The
present invention encompasses generating L gene mutants with
defined mutations or random mutations in the RSV L gene. Any number
of techniques known to those skilled in the art may be used to
generate both defined or random mutations into the RSV L gene. Once
the mutations have been introduced, the functionality of the L gene
cDNA mutants are screened in vitro using a minigenome replication
system and the recovered L gene mutants are then further analyzed
in vitro and in vivo.
[0109] The following strategies are exemplary of the approaches
which may be used to generate mutants with an attenuated phenotype.
Further, the following strategies as described below have been
applied to the L gene only by way of example and may also be
applied to any of the other RSV genes.
[0110] One approach to generate mutants with an attenuated
phenotype utilizes a scanning mutagenesis approach to mutate
clusters of charged amino acids to alanines. This approach is
particularly effective in targeting functional domains, since the
clusters of charged amino acids generally are not found buried
within the protein structure. Replacing the charged amino acids
with conservative substitutions, such as neutral amino acids, e.g.,
alanine, should not grossly alter the structure of the protein but
rather, should alter the activity of the functional domain of the
protein. Thus, disruption of charged clusters should interfere with
the ability of that protein to interact with other proteins, thus
making the mutated protein's activity thermosensitive which can
yield temperature sensitive mutants.
[0111] A cluster of charged amino acids may be arbitrarily defined
as a stretch of five amino acids in which at least two or more
residues are charged residues. In accordance with the scanning
mutagenesis approach all of the charged residues in the cluster are
mutated to alanines using site-directed mutagenesis. Due to the
large site of the RSV L gene, there are many clustered charged
residues. Within the L gene, there are at least two clusters of
four contiguous charged residues and at least seventeen clusters of
three contiguous charged residues. At least two to four of the
charged residues in each cluster may be substituted with a neutral
amino acid, e.g. alanine.
[0112] In yet another approach to generate mutants with an
attenuated phenotype utilizes a scanning mutagenesis approach to
mutate cysteines to amino acids, such as glycines or alanines. Such
an approach takes advantage of the frequent role of cysteines in
intramolecular and intermolecular bond formations, thus by mutating
cysteines to another residue, such as a conservative substitution
e.g., valine or alanine, or a drastic substitution e.g., aspartic
acid, the stability and function of a protein may be altered due to
disruption of the protein's tertiary structure. There are
approximately thirty-nine cysteine residues present in the RSV L
gene.
[0113] In yet another approach random mutagenesis of the RSV L gene
will cover residues other than charged or cysteines. Since the RSV
L gene is very large, such an approach may be accomplished by
mutagenizing large cDNA fragments of the L gene by PCR mutagenesis.
The functionality of such mutants may be screened by a minigenome
replication system and the recovered mutants are then further
analyzed in vitro and in vivo.
[0114] 5.5. Vaccine Formulations Using the Chimeric Viruses
[0115] Virtually any heterologous gene sequence may be constructed
into the chimeric viruses of the invention for use in vaccines. In
a preferred embodiment, the present invention relates to bivalent
RSV vaccines which confers protection against RSV-A and RSV-B. To
formulate such a vaccine, a chimeric RS virus is used which
expresses the antigenic polypeptides of both RSV-A and RSV-B
subtypes. In yet another preferred embodiment, the present
invention relates to a bivalent vaccine which confers protection
against both RSV and influenza. To formulate such a vaccine, a
chimeric RS virus is used which expresses the antigenic
polypeptides of both RSV and influenza.
[0116] Preferably, epitopes that induce a protective immune
response to any of a variety of pathogens, or antigens that bind
neutralizing antibodies may be expressed by or as part of the
chimeric viruses. For example, heterologous gene sequences that can
be constructed into the chimeric viruses of the invention for use
in vaccines include but are not limited to sequences derived from a
human immunodeficiency virus (HIV), preferably type 1 or type 2. In
a preferred embodiment, an immunogenic HIV-derived peptide which
may be the source of an antigen may be constructed into a chimeric
influenza virus that may then be used to elicit a vertebrate immune
response.
[0117] Such HIV-derived peptides may include, but are not limited
to sequences derived from the env gene (i.e., sequences encoding
all or part of gp160, gp120, and/or gp41), the pol gene (i.e.,
sequences encoding all or part of reverse transcriptase,
endonuclease, protease, and/or integrase), the gag gene (i.e.
sequences encoding all or part of p7, p6, p55, p17/18, p24/25),
tat, rev, nef, vif, vpu, vpr, and/or vpx.
[0118] Other heterologous sequences may be derived from hepatitis B
virus surface antigen (HBsAg); the glycoproteins of herpes virus
(e.g. gD, gE); VP1 of poliovirus; antigenic determinants of
non-viral pathogens such as bacteria and parasites, to name but a
few. In another embodiment, all or portions of immunoglobulin genes
may be expressed. For example, variable regions of anti-idiotypic
immunoglobulins that mimic such epitopes may be constructed into
the chimeric viruses of the invention.
[0119] Either a live recombinant viral vaccine or an inactivated
recombinant viral vaccine can be formulated. A live vaccine may be
preferred because multiplication in the host leads to a prolonged
stimulus of similar kind and magnitude to that occurring in natural
infections, and therefore, confers substantial, long-lasting
immunity. Production of such live recombinant virus vaccine
formulations may be accomplished using conventional methods
involving propagation of the virus in cell culture or in the
allantois of the chick embryo followed by purification.
[0120] In this regard, the use of genetically engineered RSV
(vectors) for vaccine purposes may require the presence of
attenuation characteristics in these strains. Current live
influenza virus vaccine candidates for use in humans are either
cold adapted, temperature sensitive, or passaged so that they
derive several (six) genes from avian influenza viruses, which
results in attenuation. The introduction of appropriate mutations
(e.g., deletions) into the templates used for transfection may
provide the novel viruses with attenuation characteristics. For
example, specific missense mutations which are associated with
temperature sensitivity or cold adaption can be made into deletion
mutations. These mutations should be more stable than the point
mutations associated with cold or temperature-sensitive mutants and
reversion frequencies should be extremely low.
[0121] Alternatively, chimeric viruses with "suicide"
characteristics may be constructed. Such viruses would go through
only one or a few rounds of replication in the host. When used as a
vaccine, the recombinant virus would go through a single
replication cycle and induce a sufficient level of immune response
but it would not go further in the human host and cause disease.
Recombinant viruses lacking one or more of the essential RS virus
genes would not be able to undergo successive rounds of
replication. Such defective viruses can be produced by
co-transfecting reconstituted RNPs lacking a specific gene(s) into
cell lines which permanently express this gene(s). Viruses lacking
an essential gene(s) will be replicated in these cell lines but
when administered to the human host will not be able to complete a
round of replication. Such preparations may transcribe and
translate--in this abortive cycle--a sufficient number of genes to
induce an immune response. Alternatively, larger quantities of the
strains could be administered, so that these preparations serve as
inactivated (killed) virus vaccines. For inactivated vaccines, it
is preferred that the heterologous gene product be expressed as a
viral component, so that the gene product is associated with the
virion. The advantage of such preparations is that they contain
native proteins and do not undergo inactivation by treatment with
formalin or other agents used in the manufacturing of killed virus
vaccines.
[0122] In another embodiment of this aspect of the invention,
inactivated vaccine formulations may be prepared using conventional
techniques to "kill" the chimeric viruses. Inactivated vaccines are
"dead" in the sense that their infectivity has been destroyed.
Ideally, the infectivity of the virus is destroyed without
affecting its immunogenicity. In order to prepare inactivated
vaccines, the chimeric virus may be grown in cell culture or in the
allantois of the chick embryo, purified by zonal
ultracentrifugation, inactivated by formaldehyde or
.beta.-propiolactone, and pooled. The resulting vaccine is usually
inoculated intramuscularly.
[0123] Inactivated viruses may be formulated with a suitable
adjuvant in order to enhance the immunological response. Such
adjuvants may include but are not limited to mineral gels, e.g.,
aluminum hydroxide; surface active substances such as lysolecithin,
pluronic polyols, polyanions; peptides; oil emulsions; and
potentially useful human adjuvants such as BCG and Corynebacterium
parvum.
[0124] Many methods may be used to introduce the vaccine
formulations described above, these include but are not limited to
oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, and intranasal routes. It may be preferable to
introduce the chimeric virus vaccine formulation via the natural
route of infection of the pathogen for which the vaccine is
designed. Where a live chimeric virus vaccine preparation is used,
it may be preferable to introduce the formulation via the natural
route of infection for influenza virus. The ability of RSV and
influenza virus to induce a vigorous secretory and cellular immune
response can be used advantageously. For example, infection of the
respiratory tract by chimeric RSV or influenza viruses may induce a
strong secretory immune response, for example in the urogenital
system, with concomitant protection against a particular disease
causing agent.
[0125] The following sections describe by way of example, and not
by limitation, the manipulation of the negative strand RNA viral
genomes using RSV as an example to demonstrate the applicability of
the methods of the present invention to generate chimeric viruses
for the purposes of heterologous gene expression, generating
infectious viral particles and attenuated viral particles for the
purposes of vaccination.
6. RESCUE OF INFECTIOUS RESPIRATORY SYNCYTIALVIRUSES (RSV) USING
RNA DERIVED FROM SPECIFIC RECOMBINANT DNAS
[0126] This example describes a process for the rescue of
infectious respiratory syncytial virus (RSV), derived from
recombinant cDNAs encoding the entire RSV RNA genome into stable
and infectious RSVs, as noted in Section 5 above. The method
described may be applied to both segmented and non-segmented RNA
viruses, including orthomyxovirus, paramyxovirus, e.g., Sendai
virus, parainfluenza virus types 1-4, mumps, newcastle disease
virus; morbillivirus, e.g., measles, canine distemper virus,
rinderpest virus; pneumovirus, e.g., respiratory syncytial virus;
rhabdovirus, e.g., rabies, vesiculovirus, vesicular stomatitis
virus; but is described by way of example in terms of RSV. This
process can be used in the production of chimeric RSV viruses which
can express foreign genes, i.e., genes non-native to RSV, including
other viral proteins such as the HIV env protein. Another exemplary
way to achieve the production of chimeric RSV involves modifying
existing, native RSV genes, as is further described. Accordingly,
this example also describes the utility of this process in the
directed attenuation of RSV pathogenicity, resulting in production
of a vaccine with defined, engineered biological properties for use
in humans.
[0127] The first step of the rescue process involving the entire
RSV RNA genome requires synthesis of a full length copy of the 15
kilobase (Kb) genome of RSV strain A2. This is accomplished by
splicing together subgenomic double strand cDNAs (using standard
procedures for genetic manipulation) ranging in size from 1 kb-3.5
kb, to form the complete genomic cDNA. Determination of the
nucleotide sequence of the genomic cDNA allows identification of
errors introduced during the assembly process; errors can be
corrected by site directed mutagenesis, or by substitution of the
error region with a piece of chemically synthesized double strand
DNA. Following assembly, the genomic cDNA is positioned adjacent to
a transcriptional promoter (e.g., the T7 promoter) at one end and
DNA sequence which allows transcriptional termination at the other
end, e.g., a specific endonuclease or a ribozyme, to allow
synthesis of a plus or minus sense RNA copy of the complete virus
genome in vitro or in cultured cells. The leader or trailer
sequences may contain additional sequences as desired, such as
flanking ribozyme and tandem T7 transcriptional terminators. The
ribozyme can be a hepatitis delta virus ribozyme or a hammerhead
ribozyme and functions to yield an exact 3' end free of non-viral
nucleotides.
[0128] In accordance with this aspect of the invention, mutations,
substitutions or deletions can be made to the native RSV genomic
sequence which results in an increase in RSV promoter activity.
Applicants have demonstrated that even an increase in RSV promoter
activity greatly enhances the efficiency of rescue of RSV, allowing
for the rescue of infectious RSV particles from a full-length RSV
cDNA carrying the mutation. In particular, a point mutation at
position 4 of the genome (C to G) results in a several fold
increase in promoter activity and the rescue of infectious viral
particles from a full-length RSV cDNA clone carrying the
mutation.
[0129] The rescue process utilizes the interaction of full-length
RSV strain A2 genome RNA, which is transcribed from the constructed
cDNA, with helper RSV subgroup B virus proteins inside cultured
cells. This can be accomplished in a number of ways. For example,
full-length virus genomic RNA from RSV strain A2 can be transcribed
in vitro and transfected into RSV strain B9320 infected cells, such
as 293 cells using standard transfection protocols. In addition, in
vitro transcribed genomic RNA from RSV strain A2 can be transfected
into a cell line expressing the essential RSV strain A2 proteins
(in the absence of helper virus) from stably integrated virus
genes.
[0130] Alternatively, in vitro transcribed virus genome RNA (RSV
strain A2) can also be transfected into cells infected with a
heterologous virus (e.g., in particular vaccinia virus) expressing
the essential helper RSV strain A2 proteins, specifically the N, P,
L and/or M2-ORF1 proteins. In addition the in vitro transcribed
genomic RNA may be transfected into cells infected with a
heterologous virus, for example vaccinia virus, expressing T7
polymerase, which enables expression of helper proteins from
transfected plasmid DNAs containing the helper N, P, and L
genes.
[0131] As an alternative to transfection of in vitro transcribed
genomic RNA, plasmid DNA containing the entire RSV cDNA construct
may be transfected into cells infected with a heterologous virus,
for example vaccinia virus, expressing the essential helper RSV
strain A2 proteins and T7 polymerase, thereby enabling
transcription of the entire RSV genomic RNA from the plasmid DNA
containing the RSV cDNA construct. The vaccinia virus need not
however, supply the helper proteins themselves but only the T7
polymerase; then helper proteins may be expressed from transfected
plasmids containing the RSV N, P, and L genes, appropriately
positioned adjacent to their own T7 promoters.
[0132] When replicating virus is providing the helper function
during rescue experiments, the B9320 strain of RSV is used,
allowing differentiation of progeny rescue directed against RSV
B9320. Rescued RSV strain A2 is positively identified by the
presence of specific nucleotide `marker` sequences inserted in the
cDNA copy of the RSV genome prior to rescue.
[0133] The establishment of a rescue system for native, i.e.,
`wild-type` RSV strain A2 allows modifications to be introduced
into the cDNA copy of the RSV genome to construct chimeric RSV
containing sequences heterologous in some manner to that of native
RSV, such that the resulting rescued virus may be attenuated in
pathogenicity to provide a safe and efficacious human vaccine as
discussed in Section 5.4 above. The genetic alterations required to
cause virus attenuation may be gross (e.g., translocation of whole
genes and/or regulatory sequences within the virus genome), or
minor (e.g., single or multiple nucleotide substitution(s),
addition(s) and/or deletion(s) in key regulatory or functional
domains within the virus genome), as further described in
detail.
[0134] In addition to alteration(s) (including alteration resulting
from translocation) of the RSV genetic material to provide
heterologous sequence, this process permits the insertion of
`foreign` genes (i.e., genes non-native to RSV) or genetic
components thereof exhibiting biological function or antigenicity
in such a way as to give expression of these genetic elements; in
this way the modified, chimeric RSV can act as an expression system
for other heterologous proteins or genetic elements, such as
ribozymes, anti-sense RNA, specific oligoribonucleotides, with
prophylactic or therapeutic potential, or other viral proteins for
vaccine purposes.
[0135] 6.1. Rescue of the Leader and Trailer Sequences of RSV
Strain A2 Using RSV Strain B9320 as Helper Virus
[0136] 6.1.1. Viruses and Cells
[0137] Although RSV strain A2 and RSV strain B9320 were used in
this Example, they are exemplary. It is within the skill in the art
to use other strains of RSV subgroup A and RSV subgroup B viruses
in accordance with the teachings of this Example. Methods which
employ such other strains are encompassed by the invention.
[0138] RSV strain A2 and RSV strain B9320 were grown in Hep-2 cells
and Vero cells respectively, and 293 cells were used as host during
transfection/rescue experiments. All three cell lines were obtained
from the ATCC (Rockville, Md.).
[0139] 6.1.2. Construction and Functional Analysis of Reporter
Plasmids
[0140] Plasmid pRSVA2CAT (FIG. 1) was constructed as described
below.
[0141] The cDNAs of the 44 nucleotide leader and 155 nucleotide
trailer components of RSV strain A2 (see Mink et al., Virology
185:615-624 (1991); Collins et al., Proc. Natl. Acad. Sci.
88:9663-9667 (1991)), the trailer component also including the
promoter consensus sequence of bacteriophage T7 polymerase, were
separately assembled by controlled annealing of oligonucleotides
with partial overlapping complementarity (see FIG. 1). The
oligonucleotides used in the annealing were synthesized on an
Applied Biosystems DNA synthesizer (Foster City, Calif.). The
separate oligonucleotides and their relative positions in the
leader and trailer sequences are indicated in FIG. 1. The
oligonucleotides used to construct the leader were:
TABLE-US-00001 1. 5'CGA CGC ATA TTA CGC GAA AAA ATG CGT ACA ACA AAC
TTG CAT AAA C 2. 5'CAA AAA AAT GGG GCA AAT AAG AAT TTG ATA AGT ACC
ACT TAA ATT TAA CT 3. 5'CTA GAG TTA AAT TTA AGT GGT ACT 4. 5'TAT
CAA ATT CTT ATT TGC CCC ATT TTT TTG GTT TAT GCA AGT TTG TTG TA 5.
5'CGC ATT TTT TCG CGT AAT ATG CGT CGG TAC
The oligonucleotides used to construct the trailer were:
TABLE-US-00002 1. 5'GTA TTC AAT TAT AGT TAT TAA AAA TTA AAA ATC ATA
TAA TTT TTT AAA TA 2. 5'ACT TTT AGT GAA CTA ATC CTA AAG TTA TCA TTT
TAA TCT TGG AGG AAT AA 3. 5'ATT TAA ACC CTA ATC TAA TTG GTT TAT ATG
TGT ATT AAC TAA ATT ACG AG 4. 5'ATA TTA GTT TTT GAC ACT TTT TTT CTC
GTT ATA GTG AGT CGT ATT A 5. 5'AGC TTA ATA CGA CTC ACT ATA ACG A 6.
5'GAA AAA AAG TGT CAA AAA CTA ATA TCT CGT AAT TTA GTT AAT ACA CAT
AT 7. 5'AAA CCA ATT AGA TTA GGG TTT AAA TTT ATT CCT CCA AGA TTA AAA
TGA TA 8. 5'ACT TTA GGA TTA GTT CAC TAA AAG TTA TTT AAA AAA TTA TAT
GAT TTT TA 9. 5'ATT TTT AAT AAC TAT AAT TGA ATA CTG CA
[0142] The complete leader and trailer cDNAs were then ligated to
the chloramphenicol-acetyl-transferase (CAT) reporter gene XbaI and
PstI sites respectively to form a linear-1 kb RSV/CAT cDNA
construct. This cDNA construct was then ligated into the Kpn I and
Hind III sites ofp UC19. The integrity of the final pRSVA2CAT
construct was checked by gel analysis for the size of the Xba I/Pst
I and Kpn I/Hind III digestion products. The complete leader and
trailer cDNAs were also ligated to the green fluorescent protein
(GFP) gene using appropriate restriction enzyme sites to form a
linear cDNA construct. The resulting RSV-GFP-CAT is a bicistronic
reporter construct which expresses both CAT and GFP.
[0143] In vitro transcription of Hga I linearized pRSVA2CAT with
bacteriophage T7 polymerase was performed according to the T7
supplier protocol (Promega Corporation, Madison, Wis.). Confluent
293 cells in six-well dishes (-1.times.10.sup.6 cells per well)
were infected with RSV strain B9320 at 1 plaque forming units
(p.f.u.) per cell and 1 hour later were transfected with 5-10 .mu.g
of the in vitro transcribed RNA from the pRSVA2CAT construct. The
transfection procedure followed the transfection procedure of
Collins et al., Virology 195:252-256 (1993) and employed
Transect/ACT.TM. and Opti-MEM reagents according to the
manufacturers specifications (Gibco-BRL, Bethesda, Md.). At 24
hours post-infection the 293 cells were assayed for CAT activity
using a standard protocol (Current Protocols in Molecular Biology,
Vol. 1, Chapter 9.6.2; Gorman, et al., 1982) Mol. Cell. Biol. 2:
1044-1051). The detection of high levels of CAT activity indicated
that in vitro transcribed negative sense RNA containing the
`leader` and `trailer` regions of the RSV A2 strain genome and the
CAT gene can be encapsidated, replicated and expressed using
proteins supplied by RSV strain B9320 (See FIG. 2). The level of
CAT activity observed in these experiments was at least as high as
that observed in similar rescue experiments where homologous RSV
strain A2 was used as helper virus. The ability of an antigenically
distinct subgroup B RSV strain B9320 to support the encapsidation,
replication and transcription of a subgroup A RSV strain A2 RNA has
to our knowledge hitherto not been formally reported.
[0144] 6.2. Construction of a cDNA Representing the Complete Genome
of RSV
[0145] To obtain a template for cDNA synthesis, RSV genomic RNA,
comprising 15,222 nucleotides, was purified from infected Hep-2
cells according to the method described by Ward et al., J. Gen.
Virol. 64:167-1876 (1983). Based on the published nucleotide
sequence of RSV, oligonucleotides were synthesized using an Applied
Biosystems DNA synthesizer (Applied Biosystems, Foster City,
Calif.) to act as primers for first and second strand cDNA
synthesis from the genomic RNA template. The nucleotide sequences
and the relative positions of the cDNA primers and key endonuclease
sites within the RSV genome are indicated in FIG. 3. The production
of cDNAs from virus genomic RNA was carried out according to the
reverse transcription/polymerase chain reaction (RT/PCR) protocol
of Perkin Elmer Corporation, Norwalk, Conn. (see also Wang et al.,
(1989) Proc. Natl. Acad. Sci. 86:9717-9721); the amplified cDNAs
were purified by electroelution of the appropriate DNA band from
agarose gels. Purified DNA was ligated directly into the pCRII
plasmid vector (Invitrogen Corp. San Diego), and transformed into
either `One Shot E. coli cells (Invitrogen) or `SURE` E. coli cells
(Stratagene, San Diego). The resulting, cloned, virus specific,
cDNAs were assembled by standard cloning techniques (Sambrook et
al., Molecular Cloning--A Laboratory Manual, Cold Spring Harbor
laboratory Press (Cold Spring Harbor, N.Y., 1989) to produce a cDNA
spanning the complete RSV genome. The entire cDNA genome was
sequenced, and incorrect sequences were replaced by either
site-directed mutagenesis or chemically synthesized DNA. Nucleotide
substitutions were introduced at bases 7291 and 7294 (with base
number 1 being at the start of the genomic RNA 3' end) in the `F`
gene, to produce a novel Stu I endonuclease site, and at positions
7423, 7424, and 7425 (also in the F gene) to produce a novel Pme I
site. These changes were designed to act as definitive markers for
rescue events. The bacteriophage T7 polymerase and the Hga I
endonuclease site were placed at opposite ends of the virus genome
cDNA such that either negative or positive sense virus genome RNA
can be synthesized in vitro. The cDNAs representing the T7
polymerase promoter sequence and the recognition sequence for Hga I
were synthesized on an Applied Biosystems DNA synthesizer and were
separately ligated to the ends of the virus genome cDNA, or were
added as an integral part of PCR primers during amplification of
the terminal portion of the genome cDNA, where appropriate; the
latter procedure was used when suitable endonuclease sites near the
genome cDNA termini were absent, preventing direct ligation of
chemically synthesized T7 promoter/Hga I site cDNA to the genome
cDNA. This complete construct (genome cDNA and flanking T7
promoter/Hga I recognition sequence) was then cloned into the Kpn
I/Not I sites of the Bluescript II SK phagemid (Stratagene, San
Diego) from which the endogenous T7 promoter has been removed by
site-directed mutagenesis. RNA transcribed from this complete
genome construct may be rescued using RSV subgroup B helper virus
to give infectious RSV in accordance with Example 6.1. This basic
rescue system for the complete native, i.e., `wild-type` RSV A2
strain genomic RNA can be employed to introduce a variety of
modifications into the cDNA copy of the genome resulting in the
introduction of heterologous sequences into the genome. Such
changes can be designed to reduce viral pathogenicity without
restricting virus replication to a point where rescue becomes
impossible or where virus gene expression is insufficient to
stimulate adequate immunity.
[0146] The following oligonucleotides were used to construct the
ribozyme/T7 terminator sequence:
TABLE-US-00003 5'GGT*GGCCGGCATGGTCCCAGC 3'CCA CCGGCCGTACCAGGGTCG
CTCGCTGGCGCCGGCTGGGCAACA GAGCGACCGCGGCCGACCCGTGTG
TTCCGAGGGGACCGTCCCCTCGGT AAGGCTCCCCTGGCAGGGGAGCCA
AATGGCGAATGGGACGTCGACAGC TTACCGCTTACCCTGCAGCTGTCG
TAACAAAGCCCGAAGGAAGCT ATTGTTTCGGGCTTCCTTCGA GAGTTGCTGCTGCCACCGTTG
CTCAACGACGACGGAGGCAAC AGCAATAACTAGATAACCTTGGG
TCGTTATTGATCTATTGGAACCC CCTCTAAACGGGTCTTGAGGGTCT
GGAGATTTGCCCAGAACTCCCAGA TTTTGCTGAAAGGAGGAACTA
AAAACGACTTTCCTCCTTGAT TATGCGGCCGCGTCGACGGTA ATACGCCGGCGEAGCTGCCAT
CCGGCCCCGCCTTCGAAG3' GGCCCGGGCGGAAGCTTC5'
[0147] A cDNA clone containing the complete genome of RSV a T7
promoter, a hepatitis delta virus ribozyme and a T7 terminator was
generated. This construct can be used to generate antigenomic RNA
or RSV in vivo in the presence of T7 polymerase. Sequence analysis
indicated that the plasmid contained few mutations in RSV
genome.
[0148] 6.2.1. Modifications of the RSV Genome
[0149] Modifications of the RSV RNA genome can comprise gross
alterations of the genetic structure of RSV, such as gene
shuffling. For example, the RSV M2 gene can be translocated to a
position closer to the 5' end of the genome, in order to take
advantage of the known 3' to 5' gradient in virus gene expression,
resulting in reduced levels of M2 protein expression in infected
cells and thereby reducing the rate of virus assembly and
maturation. Other genes and/or regulatory regions may also be
translocated appropriately, in some cases from other strains of RSV
of human or animal origin. For example, the F gene (and possibly
the `G` gene) of the human subgroup B RSV could be inserted into an
otherwise RSV strain A genome (in place of, or in addition to the F
and G genes of RSV strain A).
[0150] In another approach, the RNA sequence of the RSV viruses N
protein can be translocated from its 3' proximal site to a position
closer to the 5' end of the genome, again taking advantage of the
3' to 5' gradient in gene transcription to reduce the level of N
protein produced. By reducing the level of N protein produced,
there would result a concomitant increase in the relative rates of
transcription of genes involved in stimulating host immunity to RSV
and a concomitant reduction in the relative rate of genome
replication. Thus, by translocating the RSV RNA sequence coding for
RSV N protein, a chimeric RS virus having attenuated pathogenicity
relative to native RSV will be produced.
[0151] Another exemplary translocation modification resulting in
the production of attenuated chimeric RSV comprises the
translocation of the RSV RNA sequence coding for the L protein of
RSV. This sequence of the RS virus is believed responsible for
viral polymerase protein production. By translocating the RSV
sequence coding for L protein from its native 5' terminal location
in the native RSV genome to a location at or near the 3' terminus
of the genome, a chimeric RSV virus exhibiting attenuated
pathogenicity will be produced. Yet another exemplary translocation
comprises the switching the locations of the RSV RNA sequences
coding for the RSV G and F proteins (i.e., relative to each other
in the genome) to achieve a chimeric RSV having attenuated
pathogenicity resulting from the slight modification in the amount
of the G and F proteins produced. Such gene shuffling modifications
as are exemplified and discussed above are believed to result in a
chimeric, modified RSV having attenuated pathogenicity in
comparison to the native RSV starting material. The nucleotide
sequences for the foregoing encoded proteins are known, as is the
nucleotide sequence for the entire RSV genome. See McIntosh,
Respiratory Syncytial Virus in Virology, 2d Ed. edited by B. N.
Fields, D. M. Knipe et al., Raven Press, Ltd. New York, 1990
Chapter 38, pp 1045-1073, and references cited therein.
[0152] These modifications can additionally or alternatively
comprise localized, site specific, single or multiple, nucleotide
substitutions, deletions or additions within genes and/or
regulatory domains of the RSV genome. Such site specific, single or
multiple, substitutions, deletions or additions can reduce virus
pathogenicity without overly attenuating it, for example, by
reducing the number of lysine or arginine residues at the cleavage
site in the F protein to reduce efficiency of its cleavage by host
cell protease (which cleavage is believed to be an essential step
in functional activation of the F protein), and thereby possibly
reduce virulence. Site specific modifications in the 3' or 5'
regulatory regions of the RSV genome may also be used to increase
transcription at the expense of genome replication. In addition,
localized manipulation of domains within the N protein, which is
believed to control the switch between transcription and
replication can be made to reduce genome replication but still
allow high levels of transcription. Further, the cytoplasmic
domain(s) of the G and F glycoproteins can be altered in order to
reduce their rate of migration through the endoplasmic reticulum
and golgi of infected cells, thereby slowing virus maturation. In
such cases, it may be sufficient to modify the migration of G
protein only, which would then allow additional up-regulation of
`F` production, the main antigen involved in stimulating
neutralizing antibody production during RSV infections. Such
localized substitutions, deletions or additions within genes and/or
regulatory domains of the RSV genome are believed to result in
chimeric, modified RSV also having reduced pathogenicity relative
to the native RSV genome.
[0153] 6.3. Rescue of a cDNA Representing the Complete Genome of
RSV
[0154] 6.3.1. The Construction and Functional Analysis of
Expression Plasmids
[0155] The RSV, N, P, and L genes encode the viral polymerase of
RSV. The function of the RSV M genes is unknown. The ability of
RSV, N, P, M, and L expression plasmids to serve the function of
helper RSV strain A2 proteins was assessed as described below. The
RSV, N, P, L, and M2-1 genes were cloned into the modified PCITE
2a(+) vector (Novagen, Madison, Wis.) under the control of the T7
promoter and flanked by a T7 terminator at it's 3' end. PCITE-2a(+)
was modified by insertion of a T7 terminator sequence from
PCITE-3a(+) into the Alwn I and Bgl II sites of pCITE-2a(+). The
functionality of the N, P, and L expression plasmids was determined
by their ability to replicate the transfected pRSVA2CAT. At
approximately 80% confluency, Hep-2 cells in six-well plates were
infected with MVA at a moi of 5. After 1 hour, the infected cells
were transfected with pRSVA.sub.2CAT (0.5 mg), and plasmids
encoding the N (0.4 mg), P (0.4 mg), and L (0.2 mg) genes using
lipofecTACE (Life Technologies, Gaithersburg, M.D.). The
transfection proceeded for 5 hours or overnight and then the
transfection medium was replaced with fresh MEM containing 2%
(fetal bovine serum) FBS. Two days post-infection, the cells were
lysed and the lysates were analyzed for CAT activity using
Boehringer Mannheim's CAT ELISA kit. CAT activity was detected in
cells that had been transfected with N, P, and L plasmids together
with pRSVA.sub.2CAT. However, no CAT activity was detected when any
one of the expression plasmids was omitted. Furthermore,
co-transfection of RSV-GFP-CAT with the N, P, and L expression
plasmids resulted in expression of both GFP and CAT proteins. The
ratios of different expression plasmids and moi of the recombinant
vaccinia virus were optimized in the reporter gene expression
system.
[0156] 6.3.2. Recovery of Infectious RSV From the Complete RSV
cDNA
[0157] Hep-2 cells were infected with MVA (recombinant vaccinia
virus expressing T7 polymerase) at an moi of one. Fifty minutes
later, transfection mixture was added onto the cells. The
transfection mixture consisted of 2 .mu.g of N expression vector, 2
.mu.g of P expression vector, 1 .mu.g of L expression vector, 1.25
.mu.g of M2/ORF1 expression vector, 2 .mu.g of RSV genome clone
with enhanced promoter, 50 .mu.l of LipofecTACE (Life Technologies,
Gaithersburg, M.D.) and 1 ml OPTI-MEM. One day later, the
transfection mixture was replaced by MEM containing 2% FCS. The
cells were incubated at 37.degree. C. for 2 days. The transfection
supernatant was harvested and used to infect fresh Hep-2 cells in
the presence of 40 .mu.g/ml arac (drug against vaccinia virus). The
infected Hep2 cells were incubated for 7 days. After harvesting the
P1 supernatant, cells were used for immunostaining using antibodies
directed against F protein of RSV A2 strain. Six positively stained
loci with visible cell-cell-fusion (typical for RSV infection) were
identified. The RNA was extracted from P1 supernatant, and used as
template for RT-PCR analysis. PCR products corresponding to F and
M2 regions were generated. both products contained the introduced
markers. In control, PCR products derived from natural RSV virus
lacked the markers.
[0158] A point mutation was created at position 4 of the leader
sequence of the RSV genome clone (C residue to G) and this genome
clone was designated pRSVC4GLwt. This clone has been shown in a
reporter gene context to increase the promoter activity by several
fold compared to wild-type. After introduction of this mutation
into the full-length genome, infectious virus was rescued from the
cDNA clone. The rescued recombinant RSV virus formed smaller
plaques than the wild-type RSV virus (FIG. 8).
[0159] This system allows the rescue mutated RSV. Therefore, it may
be an excellent tool to engineer live-attenuated vaccines against
RSV and to use RSV vector and viruses to achieve heterologous gene
expression. It may be possible to express G protein of type B RSV
into the type A background, so the vaccine is capable of protect
both type A and type B RSV infection. It may also be possible to
achieve attenuation and temperature sensitive mutations into the
RSV genome, by changing the gene order or by site-directed
mutagenesis of the L protein.
[0160] 6.4. Use of Monoclonal Antibodies to DIFFERENTIATE RESCUED
VIRUS FROM HELPER VIRUS
[0161] In order to neutralize the RSV strain B9320 helper virus and
facilitate identification of rescued A2 strain RSV, monoclonal
antibodies against RSV strain B9320 were made as follows.
[0162] Six BALB/c female mice were infected intranasally (i.n.)
with 10.sup.5 plaque forming units (p.f.u.) of RSVB9320, followed 5
weeks later by intraperitoneal (i.p.) inoculation with
10.sup.6-10.sup.7 pfu of RSV B9320 in a mixture containing 50%
complete Freund's adjuvant. Two weeks after i.p. inoculation, a
blood sample from each mouse was tested for the presence of RSV
specific antibody using a standard neutralization assay (Beeler and
Coelingh, J. Virol. 63:2941-2950 (1988)). Mice producing the
highest level of neutralizing antibody were then further boosted
with 10.sup.6 p.f.u. of RSV strain B9320 in phosphate buffered
saline (PBS), injected intravenously at the base of the tail. Three
days later, the mice were sacrificed and their spleens collected as
a source of monoclonal antibody producing B-cells. Splenocytes
(including B-cells) were teased from the mouse spleen through
incisions made in the spleen capsule into 5 ml of Dulbecco's
Modified Eagle's Medium (DME). Clumps of cells were allowed to
settle out, and the remaining suspended cells were separately
collected by centrifugation at 2000.times.g for 5 minutes at room
temperature. These cell pellets were resuspended in 15 ml 0.83
(W/V) NH.sub.4Cl, and allowed to stand for 5 minutes to lyse red
blood cells. Splenocytes were then collected by centrifugation as
before through a 10 ml; cushion of fetal calf serum. The
splenocytes were then rinsed in DME, repelleted and finally
resuspended in 20 ml of fresh DME. These splenocytes were then
mixed with Sp2/0 cells (a mouse myeloma cell line used as fusion
partners for the immortalization of splenocytes) in a ratio of
10:1, spleen cells: Sp2/0 cells. Sp2/0 cells were obtained from the
ATCC and maintained in DME supplemented with 10% fetal bovine
serum. The cell mixture was then centrifuged for 8 minutes at
2000.times.g at room temperature. The cell pellet was resuspended
in 1 ml of 50% polyethylene glycol 1000 mol. wt. (PEG 1000),
followed by addition of equal volumes of DME at 1 minute intervals
until a final volume of 25 ml was attained. The fused cells were
then pelleted as before and resuspended at 3.5.times.10.sup.6
spleen cells ml.sup.1 in growth medium (50% conditioned medium from
SP2/0 cells, 50% HA medium containing 100 ml RPMI 25 ml F.C.S., 100
.mu.gml gentamicin, 4 ml 50.times. Hypoxanthine, Thymidine,
Aminopterin (HAT) medium supplied as a prepared mixture of Sigma
Chem. Co., St. Louis, Mo.). The cell suspension was distributed
over well plates (200 .mu.l well.sup.-1) and incubated at
37.degree. C., 95 humidity and 5% CO.sub.2. Colonies of hybridoma
cells (fused splenocytes and Sp2/0 cells) were then subcultured
into 24 well plates and grown until nearly confluent; the
supernatant growth medium was then sampled for the presence of RSV
strain B9320 neutralizing monoclonal antibody, using a standard
neutralization assay (Beeler and Coelingh, J. Virol. 63:2941-50
(1988)). Hybridoma cells from wells with neutralizing activity were
resuspended in growth medium and diluted to give a cell density of
0.5 cells per 100 A1 and plated out in 96 well plates, 200 .mu.l
per well. This procedure ensured the production of monoclones (i.e.
hybridoma cell lines derived from a single cell) which were then
reassayed for the production of neutralizing monoclonal antibody.
Those hybridoma cell lines which produced monoclonal antibody
capable of neutralizing RSV strain B9320 but not RSV strain A2 were
subsequently infected into mice, i.p. (10.sup.6 cells per mouse).
Two weeks after the i.p. injection mouse ascites fluid containing
neutralizing monoclonal antibody for RSV strain B9320 was tapped
with a 19 gauge needle, and stored at -20.degree. C.
[0163] This monoclonal antibody was used to neutralize the RSV
strain B9320 helper virus following rescue of RSV strain A2 as
described in Section 9.1. This was carried out by diluting
neutralizing monoclonal antibody 1 in 50 with molten 0.4% (w/v)
agar in Eagle's Minimal Essential Medium (EMEM) containing 1%
F.C.S. This mixture was then added to Hep-2 cell monolayers, which
had been infected with the progeny of rescue experiments at an
m.o.i. of 0.1-0.01 p.f.u. per cell. The monoclonal antibody in the
agar overlay inhibited the growth of RSV strain B9320, but allowed
the growth of RSV strain A2, resulting in plaque formation by the
A2 strain. These plaques were picked using a pasteur pipette to
remove a plug a agar above the plaque and the infected cells within
the plaque; the cells and agar plug were resuspended in 2 ml of
EMEM, 1% FCS, and released virus was plaqued again in the presence
of monoclonal antibody on a fresh Hep-2 cell monolayer to further
purify from helper virus. The twice plaqued virus was then used to
infect Hep-2 cells in 24 well plates, and the progeny from that
were used to infect six-well plates at an m.o.i. of 0.1 p.f.u. per
cell. Finally, total infected cell RNA from one well of a six-well
plates was used in a RT/PCR reaction using first and second strand
primers on either side of the `marker sequences` (introduced into
the RSV strain A2 genome to act as a means of recognizing rescue
events) as described in Section 6.2 above. The DNA produced from
the RT/PCR reaction was subsequently digested with Stu I and Pme I
to positively identify the `marker sequences` introduced into RSV
strain A2 cDNA, and hence to establish the validity of the rescue
process.
7. RESCUE OF INFECTIOUS RSV PARTICLES IN THE ABSENCE OF M2
EXPRESSION
[0164] The following experiments were conducted to compare the
efficiencies of rescue of RS virions in the presence and absence of
the M2/ORF1 gene. If the M2/ORF1 gene function is not required to
achieve rescue of RSV infectious particles, it should be possible
to rescue RS virions in the absence of the expression of the
M2/0RF1 gene function. In the present analysis, Hep-2 cells which
are susceptible to RSV replication, were co-transfected with
plasmids encoding the `N`, `P` and `L` genes of the viral
polymerase of RSV and the cDNA corresponding to the full-length
antigenome of RSV, in the presence or absence of plasmid DNA
encoding the M2/0RF1 gene, and the number of RSV infectious units
were measured in order to determine whether or not the M2/0RF1 gene
product was required to rescue infectious RSV particles.
[0165] The following plasmids were used in the experiments
described below: a cDNA clone encoding the full-length antigenome
of RSV strain A2, designated pRSVC4GLwt; and plasmids encoding the
N, P, and L polymerase proteins, and plasmid encoding the M2/ORF1
elongation factor, each downstream of a T7 RNA promoter, designated
by the name of the viral protein encoded.
[0166] pRSVC4GLwt was transfected, together with plasmids encoding
proteins N, P and L, into Hep-2 cells which had been pre-infected
with a recombinant vaccinia virus expressing the T7 RNA polymerase
(designated MVA). In another set of Hep-2 cells, pRSVC4GLwt was
co-transfected with plasmids encoding the N, P and L polymerase
proteins, and in addition a plasmid encoding the M2 function.
Transfection and recovery of recombinant RSV were performed as
follows: Hep-2 cells were split in six-well dishes (35 mm per well)
5 hours or 24 hours prior to transfection. Each well contained
approximately 1.times.10.sup.6 cells which were grown in MEM
(minimum essential medium) containing 10% FBS (fetal bovine serum).
Monolayers of Hep-2 cells at 70%-80% confluence were infected with
MVA at a multiplicity of infection (moi) of 5 and incubated at
35.degree. C. for 60 minutes. The cells were then washed once with
OPTI-MEM (Life Technologies) and the medium of each dish replaced
with 1 ml of OPTI-MEM and 0.2 ml of the transfection mixture. The
transfection mixture was prepared by mixing the four plasmids,
pRSVC4GLwt, N, P and L plasmids in a final volume of 0.1 ml
OPTI-MEM at amounts of 0.5-0.6 .mu.g of pRSVC4GLwt, 0.4 .mu.g of N
plasmid, 0.4 .mu.g of P plasmid, and 0.2 .mu.g of L plasmid. A
second mixture was prepared which additionally included 0.4
.mu.M2/ORF1 plasmid. The plasmid mixtures of 0.1 ml were combined
with 0.1 ml of OPTI-MEM containing 10 .mu.l of lipofecTACE (Life
Technologies, Gaithersburg, M.D.) to constitute the complete
transfection mixture. After a 15 minute incubation at room
temperature, the transfection mixture was added to the cells, and
one day later this was replaced by MEM containing 2% FBS. Cultures
were incubated at 35.degree. C. for 3 days at which time the
supernatants were harvested. Cells were incubated at 35.degree. C.
since the MVA virus is slightly temperature sensitive and is much
more efficient at 35.degree. C.
[0167] Three days post-transfection, the transfected cell
supernatants were assayed for the presence of RSV infectious units
by an immunoassay which would indicate the presence of RSV packaged
particles (see Table 1). In this assay, 0.3-0.4 ml of the culture
supernatants were passaged onto fresh (uninfected) Hep-2 cells and
overlaid with 1% methylcellulose and 1.times.L15 medium containing
2% FBS. After incubation for 6 days, the supernatant was harvested
and the cells were fixed and stained by an indirect horseradish
peroxidase method, using a goat anti-RSV antibody which recognizes
the RSV viral particle (Biogenesis, Sandown, N.H.) followed by a
rabbit anti-goat antibody conjugated to horseradish peroxidase. The
antibody complexes that bound to RSV-infected cells were detected
by the addition of a AEC-3-amino-9-ethylcarbazole) chromogen
substrate (DAKO) according to the manufacturer's instructions. The
RSV plaques were indicated by a black-brown coloration resulting
from the reaction between the chromogen substrate and the
RSV-antibody complexes bound to the plaques. The number of RSV
plaques is expressed as the number of plaque forming units (p.f.u.)
per 0.5 ml of transfection supernatant (see Table 1).
[0168] Comparisons of the amount of RS virions recovered from the
supernatants of transfection dishes in the presence or absence of
M2/ORF1 are shown in Table 1. The results of four separate
experiments demonstrated that the absence of M2/ORF1 from the
transfection assay did not diminish the number of infectious units
of RSV observed. Thus, the results of these experiments clearly
indicate that RSV can be rescued in the absence of the M2/ORF1 from
cells transfected only with plasmids encoding the three polymerase
proteins, N, P and L, and the cDNA encoding the full-length RSV
antigenome. The rescue of true RS virions in the absence of M2/ORF1
was further indicated by the ability to passage the rescued
recombinant RSV for up to six passages. Therefore, the production
of RSV virions is not dependent on the expression of the M2/ORF1
gene, nor does the inclusion of the M2/ORF1 gene in the
transfection assay increase the efficiency of true RSV rescue.
TABLE-US-00004 TABLE 1 Production of infectious RSV through plasmid
transfection is not dependent on expression of M2ORF1 Production of
infectious RSV (pfu from 0.5 ml transfection supernatants) Expt.
+M2 0RF1 -M2 ORF1 1. 6, 10 (8) 16, 9 (13) 2. 120, 46, 428 (198)
100, 122, 105 (109) 3. 160, 180 (170) 150, 133 (142) 4. 588, 253,
725 (522) 300, 1000, 110 (470) Each experiment was done singly, in
duplicates or triplicates. The average number of plaque forming
units (pfu) from 0.5 ml transfected cell supernatants is shown in
the brackets.
8. EXAMPLE
Expression of RSV Subgroup B-G AND -F Proteins by RSV A2 Strain
[0169] The following experiments were conducted to generate a
chimeric RSV which expresses the antigenic polypeptides of more
than one strain of RSV. Two main antigenic subgroups (A and B) of
respiratory syncytial virus (RSV) cause human diseases.
Glycoproteins F and G are the two major antigenic determinants of
RSV. The F glycoproteins of subgroup A and B viruses are estimated
to be 50% related, while the relationship of G glycoproteins is
considerably less, about 1-5%. Infection of RSV subgroup A induces
either partial or no resistance to replication of a subgroup B
strain and vice versa. Both subgroup A and subgroup B RSV virus
vaccines are needed to protect from RSV infection.
[0170] The first approach described herein is to make an infectious
chimeric RSV cDNA clone expressing subgroup B antigens by replacing
the current infectious RSV A2 cDNA clone G and F region with
subgroup B-G and -F genes. The chimeric RSV would be subgroup B
antigenic specific. The second approach described herein is to
insert subgroup B-G gene in the current A2 cDNA clone so that one
virus would express both subgroup A and B specific antigens.
[0171] 8.1. Substitution of A2 G and F by B9320 G and F Genes
[0172] RSV subgroup B strain B9320 G and F genes were amplified
from B9320 vRNA by RT/PCR and cloned into pCRII vector for sequence
determination. BamH I site was created in the oligonucleotide
primers used for RT/PCR in order to clone the G and F genes from
B9320 strain into A2 antigenomic cDNA (FIG. 4A). A cDNA fragment
which contained G and F genes from 4326 nt to 9387 nt of A2 strain
was first subcloned into pUC19 (pUCR/H). Bgl II sites were created
at positions of 4630 (SH/G intergenic junction) and 7554 (F/M2
intergenic junction), respectively by Quickchange site-directed
mutagenesis kit (Stratagene, Lo Jolla, Calif.). B9320 G and F cDNA
inserted in pCR.II vector was digested with BamH I restriction
enzyme and then subcloned into Bgl II digested pUCR/H which had the
A2 G and F genes removed. The cDNA clone with A2 G and F genes
replaced by B9320 G and F was used to replace the Xho I to Msc I
region of the full-length A2 antigenomic cDNA. The resulting
antigenomic cDNA clone was termed pRSVB-GF and was used to
transfect Hep-2 cells to generate infectious RSVB-GF virus.
[0173] Generation of chirneric RSVB-GF virus was as follows,
pRSVB-GF was transfected, together with plasmids encoding proteins
N, P, and L, into Hep-2 cells which had been infected with MVA, a
recombinant vaccinia virus which expresses the T7 RNA polymerase.
Hep-2 cells were split a day before transfection in six-well
dishes. Monolayers of Hep-2 cells at 60%-70% confluence were
infected with MVA at moi of 5 and incubated at 35.degree. C. for 60
min. The cells were then washed once with OPTI-MEM (Life
Technologies, Gaithersburg, Md.). Each dish was replaced with 1 ml
of OPTI-MEM and added with 0.2 ml of transfection medium. The
transfection medium was prepared by mixing five plasmids in a final
volume of 0.1 ml of OPTI-MEM medium, namely 0.6 .mu.g of RSV
antigenome pRSVB-GF, 0.4 .mu.g of N plasmid, 0.4 .mu.g of P
plasmid, and 0.2 .mu.g of L plasmid. This was combined with 0.1 ml
of OPTI-MEM containing 101 lipofecTACE (Life Technologies,
Gaithersburg, Md. U.S.A.). After a 15 minute incubation at room
temperature, the DNA/lipofecTACE was added to the cells and the
medium was replaced one day later by MEM containing 2% FBS.
Cultures were further incubated at 35.degree. C. for 3 days and the
supernatants harvested. Aliquots of culture supernatants were then
used to infect fresh Hep-2 cells. After incubation for 6 days at
35.degree. C., the supernatant was harvested and the cells were
fixed and stained by an indirect horseradish peroxidase method
using goat anti-RSV antibody (Biogenesis, Sandown, N.H.) followed
by a rabbit anti-goat antibody linked to horseradish peroxidase.
The virus infected cells were then detected by addition of
substrate chromogen (DAKO, Carpinteria, Calif., U.S.A.) according
to the manufacturer's instructions. RSV-like plaques were detected
in the cells which were infected with the supernatants from cells
transfected with pRSVB-GF. The virus was further plaque purified
twice and amplified in Hep-2 cells.
[0174] Recombinant RSVB-GF virus was characterized by RT/PCR using
RSV subgroup B specific primers. Two independently purified
recombinant RSVB-GF virus isolates were extracted with an RNA
extraction kit (Tel-Test, Friendswood, Tex.) and RNA was
precipitated by isopropanol. Virion RNAs were annealed with a
primer spanning the RSV region from nt 4468 to 4492 and incubated
for 1 hr under standard RT conditions (10 .mu.l reactions) using
superscript reverse transcriptase (Life Technologies, Gaithersburg,
Md.). Aliquots of each reaction were subjected to PCR (30 cycles at
94.degree. C. for 30 s, 55.degree. C. for 30 s and 72.degree. C.
for 2 min) using subgroup B specific primers in G region
(CACCACCTACCTTACTCAAGT and TTTGTTTGTGGGTTTGATGGTTGG). The
PCRproducts were analyzed by electrophoresis on 1% agarose gel and
visualized by staining with ethidium bromide. As shown in FIG. 5,
no DNA product was produced in RT/PCR reactions using RSV A2 strain
as template. However, a predicted product of 254 bp was detected in
RT/PCR reactions utilizing RSVB-GF RNA or the PCR control plasmid,
pRSVB-GF DNA, as template, indicating the rescued virus contained G
and F genes derived form B9320 virus.
[0175] 8.2. Expression OF B9320G by RSV A2 Virus
[0176] RSV subgroup B strain B9320 G gene was amplified from B9320
vRNA by RT/PCR and cloned into pCRII vector for sequence
determination. Two Bgl II sites were incorporated into the PCR
primers which also contained gene start and gene end signals
(GATATCAAGATCTACAATAACATTGGGGCAAATGC and GCTAAGAGATCTTTTT
GAATAACTAAGCATG). B9320G cDNA insert was digested with Bgl II and
cloned into the SH/G (4630 nt) or F/M2 (7552 nt) intergenic
junction of a A2 cDNA subclone (FIG. 4B and FIG. 4C). The Xho I to
Msc I fragment containing B9320G insertion either at SH/G or F/M2
intergenic region was used to replace the corresponding Xho I to
Msc I region of the A2 antigenomic cDNA. The resulting RSV
antigenomic cDNA clone was termed as pRSVB9320G-SH/G or
pRSVB9320G-F/M2.
[0177] Generation of RSV A2 virus which had B9320 G gene inserted
at F/M2 intergenic region was performed similar to what has
described for generation of RSVB-GF virus. Briefly, pRSVB9320G-F/M2
together with plasmids encoding proteins N, P and L were
transfected, into Hep-2 cells, infected with a MVA vaccinia virus
recombinant, which expresses the T7 RNA polymerase (Life
Technologies, Gaithersburg, M.D.). The transfected cell medium was
replaced by MEM containing 2% fetal bovine serum (FBS) one day
after transfection and further incubated for 3 days at 35.degree.
C. Aliquots of culture supernatants (PO) were then used to infect
fresh Hep-2 cells. After incubation for 6 days at 35.degree. C.,
the supernatant was harvested and the cells were fixed and stained
by an indirect horseradish peroxidase method using goat anti-RSV
antibody (Biogenesis) followed by a rabbit anti-goat antibody
linked to horseradish peroxidase. The virus infected cells were
then detected by addition of substrate chromogen (Dako). RSV-like
plaques were detected in the cells which were infected with the
supernatants from cells transfected with pRSVB9320G/F/M2.
[0178] Characterization of pRSVB9320G-F/M2 virus was performed by
RT/PCR using B9320G specific primers. A predicted PCR product of
410 bp was seen in RT/PCR sample using pRSVB9320G-F/M2 RNA as
template, indicating the rescued virus contained G gene derived
from B9320. (FIG. 6)
[0179] Expression of the inserted RSV B9320 G gene was analyzed by
Northern blot using a .sup.32P-labeled oligonucleotide specific to
A2-G or B-G mRNA. Total cellular RNA was extracted from Hep-2 cells
infected with wild-type RSVB 9320, rRSVA2, or rRSVB9320G-F/M2 48
hours postinfection using an RNA extraction kit (RNA stat-60,
Tel-Test). RNA was electrophoresed on a 1.2% agarose gel containing
formaldehyde and transferred to a nylon membrane (Amersham). An
oligonucleotide specific to the G gene of the A2 stain
(5'TCTTGACTGTTGTGGATTGCAGGGTTGACTTGACTCCGATCGATCC-3') and an
oligonucleotide specific to the B9320 G gene
(5'CTTGTGTTGTTGTTGTATGGTGT GTTTCTGATTTTGTATTGATCGATCC-3') were
labeled with .sup.32P-ATP by a kinasing reaction known to those of
ordinary skill in the art. Hybridization of the membrane with one
of the .sup.32P labeled G gene specific oligonucletodies was
performed at 65.degree. C. and washed according to standard
procedure. Both A2-G and B9320-G specific RNA were detected in the
rRSVB9320G-F/M2 infected Hep-2 Cells. (FIG. 6B) These results
demonstrate subtype specific RNA expression.
[0180] Protein expression of the chimeric rRSVA2(B-G) was compared
to that of RSV B9320 and rRSV by immunoprecipitation of
.sup.35S-labeled infected Hep-2 cell lysates. Briefly, the virus
infected cells were labeled with .sup.35S-promix (100 .mu.Ci/ml
.sup.35S-Cys and .sup.35S-Met, Amersham, Arlington Heights, Ill.)
at 14 hours to 18 hours post-infection according to a protocol
known to those of ordinary skill in the art. The cell monolayers
were lysed by RIPA buffer and the polypeptides were
immunoprecipitated with either polyclonal antiserum raised in goat
against detergent disrupted RSV A2 virus (FIG. 7, lanes 14) or
antiserum raised in mice against undisrupted B9320 virions (FIG. 7,
lanes 5-8). The radio labeled immunoprecipitated polypeptides were
electrophoresed on 10% polyacrylamide gels containing 0.1% SDS and
detected by autoradiography. Anti-RSV A2 serum in
immunoprecipitated the major polypeptides of the RSV A2 strain,
whereas anti-B9320 serum mainly reacted with RSV B9320 G protein
and the conserved F protein of both A and B subgroups. As shown in
FIG. 7, a protein which is identical to the A2-G protein (lane 3),
was immunoprecipitated from the rRSVA2(B-G) infected cells (lane 4)
by using an antiserum against RSV A2. The G protein of RSV B9320
strain was not recognized by the anti-A2 antiserum. A protein
species, smaller than A2-G protein, was immunoprecipitated from
both B9320 (lane 6) and rRSVA2(B-G) (lane 9) infected cells using
the antiserum raised in mice against B9320 virions. This
polypeptide was not present in the uninfected and RSV A2 infected
cells and likely is to represent the G protein specific to the RSV
B 9320 strain. Amino acid sequence comparison of both A2 and B9320
RSV G proteins indicated that two additional potential
N-glycosylation sites (N-X-S/t) are present in the RSV A2G protein,
which may contribute to slower migration of the A2 G protein under
the conditions used. The F protein of RSV B9320 also migrated
slightly faster than RSV A2 F protein. The P and M proteins also
showed mobility differences between the two virus subtypes. The
identity of the polypeptide near the top of the protein gel present
in FSV B9320 and rRSVA2(B-G) infected cells is not known. Antisera
raised in mice against the RSV B9320 virions poorly recognized the
N, P and M proteins are compared to the goat antiserum raised
against the RSV A2 strain. The data described above clearly
indicate that chimeric rRSV A2(B-G) expresses both the RSV A2 and
B9320 specific G proteins.
[0181] 8.2.1 Replication of Recombinant RSV in Tissue Culture
[0182] Recombinant RS viruses were plaque purified three times and
amplified in Hep-2 cells. Plaque assays were performed in Hep-2
cells in 12-well plates using an overlay of 1% methylcellulose and
1.times.L15 medium containing 2% fetal bovine serum (FBS). After
incubation at 35.degree. C. for 6 days, the monolayers were fixed
with methanol and plaques were identified by immunostaining. Plaque
size and morphology of rRSV was very similar to that of wild-type
A2 RSV (FIG. 8). However, the plaques formed by rRSVC4G were
smaller than rRSV and wild-type A2 virus. The only genetic
difference between rRSV and rRSVC4 was a single nucleotide
substitution in the RSV leader region. Therefore, the smaller
plaque size of rRSV A2(B-G) was not distinguishable from that of
rRSVC4G.
[0183] The growth curves of rRSV, rRSVC4G and rRSV A2 (B-G) were
compared to that of the biologically derived wild-type A2 virus.
Hep-2 cells were grown in T25 culture flasks and infected with
rRSV, rRSVC4G, rRSVA2(B-G), or wild-type RSV A2 strain at a moi of
0.5. After 1 hour adsorption at 37.degree. C., the cells were
washed three times with MEM containing 2% FBS and incubated at
37.degree. C. in 5% CO.sub.2. At 4 hour intervals post-infection,
250 .mu.l of the culture supernatant was collected, and stored at
-70.degree. C. until virus titration. Each aliquot taken was
replaced with an equal amount of fresh medium. The titer of each
virus was determined by plaque assay on Hep-2 cells and visualized
by immunostaining (vide supra). As shown in FIG. 9, the growth
kinetics of rRSV is very similar to that of wild-type A2 virus.
Maximum virus titer for all the viruses were achieved between 48 hr
to 72 hr. The virus titer of rRSVC4G was about 2.4-fold (at 48 hr)
and 6.6-fold (at 72 hr) lower than rRSV and wild-type A2 RSV. The
poor growth of rRSVC4G may also be due to the single nucleotide
change in the leader region. The chimeric rRSV A2(B-G) showed
slower kinetics and lower peak titer (FIG. 9).
9. EXAMPLE
Generation of RSV L Gene Mutants
[0184] The strategy for generating L gene mutants is to introduce
defined mutations or random mutations into the RSV L gene. The
functionality of the L gene cDNA mutants can be screened in vitro
by a minigenome replication system. The recovered L gene mutants
are then further analyzed in vitro and in vivo.
[0185] 9.1 Mutagenesis Strategies
[0186] 9.1.1 Scanning Mutagenesis to Change the Clustered Charged
Amino Acids to Alanine
[0187] This mutagenesis strategy has been shown to be particularly
effective in systematically targeting functional domains exposed on
protein surfaces. The rationale is that clusters of charged
residues generally do not lie buried in the protein structure.
Making conservative substitutions of these charged residues with
alanines will therefore remove the charges without grossly changing
the structure of the protein. Disruption of charged clusters may
interfere with the interaction of RSV L protein with other proteins
and make its activity thermosensitive, thereby yielding
temperature-sensitive mutants.
[0188] A cluster was originally defined arbitrarily as a stretch of
5 amino acids in which two or more residues are charged residues.
For scanning mutagenesis, all the charged residues in the clusters
can be changed to alanines by site directed mutagenesis. Because of
the large size of the RSV L gene, there are many clustered charged
residues in the L protein. Therefore, only contiguous charged
residues of 3 to 5 amino acids throughout the entire L gene were
targeted (FIG. 10). The RSV L protein contains 2 clusters of five
contiguous charged residues, 2 clusters of four contiguous charged
residues and 17 clusters of three contiguous charge residues. Two
to four of the charged residues in each cluster were substituted
with alanines.
[0189] The first step of the invention was to introduce the changes
into pCITE-L which contains the entire RSV L-gene, using a
QuikChange site-directed mutagenesis kit (Stratagene). The
introduced mutations were then confirmed by sequence analysis.
[0190] 9.1.2. Cysteine Scanning Mutagenesis
[0191] Cysteines are good targets for mutagenesis as they are
frequently involved in intramolecular and intermolecular bond
formations. By changing cysteines to glycines or alanines, the
stability and function of a protein may be altered because of
disruption of its tertiary structure. Thirty-nine cysteine residues
are present in the RSV L protein (FIG. 11). Comparison of the RSV L
protein with other members of paramyxoviruses indicates that some
of the cysteine residues are conserved.
[0192] Five conserved cysteine residues were changed to either
valine (conservative change) or to aspartic acids (nonconservative
change) using a QuikChange site-directed mutagenesis kit
(Stratagene) degenerate mutagenic oligonucleotides. It will be
apparent to one skilled in the art that the sequence of the
mutagenic oligonucleotides is determined by the protein sequence
desired. The introduced mutations were confirmed by sequence
analysis.
[0193] 9.1.3. Random Mutagenesis
[0194] Random mutagenesis may change any residue, not simply
charged residues or cysteines. Because of the size of the RSV L
gene, several L gene cDNA fragments were mutagenized by PCR
mutagenesis. This was accomplished by PCR using exo. Pfu polymerase
obtained from Strategene. Mutagenized PCR fragments were then
cloned into a pCITE-L vector. Sequencing analysis of 20 mutagenized
cDNA fragments indicated that 80%-90% mutation rates were achieved.
The functionality of these mutants was then screened by a
minigenome replication system. Any mutants showing altered
polymerase function were then further cloned into the full-length
RSV cDNA clone and virus recovered from transfected cells.
[0195] 9.2. Functional Analysis of RSV L Protein Mutants by
Minigenome Replication System
[0196] The functionality of the L-genes mutants were tested by
their ability to replicate a RSV minigenome containing a CAT gene
in its antisense and flanked by RSV leader and trailer sequences.
Hep-2 cells were infected with MVA vaccinia recombinants expressing
T7 RNA polymerase. After one hour, the cells were transfected with
plasmids expressing mutated L protein together with plasmids
expressing N protein and P protein, and pRSV/CAT plasmid containing
CAT gene (minigenome). CAT gene expression from the transfected
cells was determined by a CAT ELISA assay (Boehringer Mannheim)
according to the manufacturer's instruction. The amount of CAT
activity produced by the L gene mutant was then compared to that of
wild-type L protein.
[0197] 9.3. Recovery of Mutant Recombinant RSV
[0198] To recover or rescue mutant recombinant RSV, mutations in
the L-gene were engineered into plasmids encoding the entire RSV
genome in the positive sense (antigenome). The L gene cDNA
restriction fragments (BamH I and Not I) containing mutations in
the L-gene were removed from pCITE vector and cloned into the
full-length RSV cDNA clone. The cDNA clones were sequenced to
confirm that each contained the introduced mutations.
[0199] Each RSV L gene mutant virus was rescued by co-transfection
of the following plasmids into subconfluent Hep-2 cells grown in
six-well plates. Prior to transfection, the Hep-2 cells were
infected with MVA, a recombinant vaccinia virus which expresses T7
RNA polymerase. One hour later, cells were transfected with the
following plasmids: [0200] pCITE-N: encoding wild-type RSV N gene,
0.4 .mu.g [0201] pCITE-P: encoding wild-type RSV P gene, 0.4 .mu.g
[0202] pCITE-Lmutant: encoding mutant RSV L gene, 0.2 .mu.g [0203]
pRSVL mutant: full-length genomic RSV of the positive sense
(antigenome) containing the same L-gene mutations as pCITE-L
mutant, 0.6 .mu.g
[0204] DNA was introduced into cells by lipofecTACE (Life
Technologies) in OPTI-MEM. After five hours or overnight
transfection, the transfection medium was removed and replaced with
2% MEM. Following incubation at 35.degree. C. for three days, the
media supernatants from the transfected cells were used to infect
Vero cells. The virus was recovered from the infected Vero cells
and the introduced mutations in the recovered recombinant viruses
confirmed by sequencing of the RT/PCR DNA derived from viral
RNA.
[0205] Examples of the L gene mutants obtained by charged to
alanine scanning mutagenesis are shown in the Table 2. Mutants were
assayed by determining the expression of CAT by pRSV/CAT minigenome
following co-transfection of plasmids expressing N, P and either
wild-type or mutant L. Cells were harvested and lysed 40 hours
post-transfection after incubation at 33.degree. C. or 39.degree.
C. The CAT activity was monitored by CAT ELISA assay (Boehringer
Mannheim). Each sample represents the average of duplicate
transfections. The amount of CAT produced for each sample was
determined from a linear standard curve.
[0206] From the above preliminary studies, different types of
mutations have been found.
[0207] 9.3.1. Detrimental Mutations
[0208] Seven L protein mutants displayed a greater than 99%
reduction in the amount of CAT produced compared to that of
wild-type L protein. These mutations drastically reduced the
activity of the RSV polymerase and are not expected to be
viable.
TABLE-US-00005 TABLE 2 CAT Expression levels of Mutant RSV L-gene
Conc. of CAT (ng/mL) Charge Charge to Rescued Mut. 33.degree. C.
39.degree. C. Cluster Alanine Change Virus A33 0.246 Bkg 5 135E,
136K No A73 3.700 0.318 3 146D, 147E, 148 D Yes A171 3.020 Bkg 3
157K, 158D Yes A81 1.000 0.280 3 255H, 256K Yes A185 Bkg Bkg 3
348E, 349E No A91 Bkg Bkg 3 353R, 355R No A101 Bkg Bkg 3 435D,
436E, 437R No A192 1.960 Bkg 3 510E, 511R Yes A11 0.452 Bkg 1 520R
Yes A111 2.320 0.267 4 568H, 569E Yes A121 0.772 Bkg 2 587L, 588R
No A133 Bkg Bkg 4 620E, 621R No A141 2.800 Bkg 3 1025K, 1026D Yes
A25 0.169 Bkg 3 1033D, 1034D Yes A45 5.640 0.478 5 1187D, 1188K Yes
A153 4.080 0.254 5 1187D, 1188K, 1189R, Yes 1190E A162 10.680 Bkg 3
1208E, 1209R No A201 Bkg Bkg 3 1269E, 1270K No A211 2.440 0.047 3
1306D, 1307E Yes A221 0.321 Bkg 3 1378D, 1379E No A231 Bkg Bkg 3
1515E, 1516K No A241 1.800 0.308 3 1662H, 1663K Yes A57 5.660 0.706
3 1725D, 1726K Yes A65 3.560 0.168 2 1957R, 1958K Yes A251 0.030
Bkg. 3 2043D, 2044K Yes A261 Bkg Bkg 3 2102K, 2103H No AD11 2.800
0.456 5 and 3 1187D, 1188K, 1725D, No 1726K AD21 2.640 0.226 5 and
2 1187D, 1188K, 1957R, No 1958K AD31 1.280 0.192 3 and 2 1725D,
1726K, 1957R, No 1958K F1 Bkg Bkg -- 521 F to L Yes F13 0.13 Bkg --
521 F to L Yes Lwt 3.16 -- -- no amino acid changes Yes
[0209] 9.3.2. Intermediate Mutations
[0210] Several L mutants showed an intermediate level of CAT
production which ranged from 1% to 50% of that wild-type L protein.
A subset of these mutants were introduced into virus and found to
be viable. Preliminary data indicated that mutant A2 showed 10- to
20-fold reduction in virus titer when grown at 40.degree. C.
compared 33.degree. C. Mutant A25 exhibited a smaller plaque
formation phenotype when grown at both 33.degree. C. and 39.degree.
C. This mutant also had a 10-fold reduction in virus titer at
40.degree. C. compared to 33.degree. C.
[0211] 9.3.3. Mutants with L Protein Function Similar or Higher
than Wild Type L Protein
[0212] Some L gene mutants produced CAT gene expression levels
similar to or greater than the wild-type L protein in vitro and the
recovered virus mutants have phenotypes indistinguishable from
wild-type viruses in tissue culture.
[0213] Once mutations in L that confer temperature sensitivity and
attenuation have been identified, the mutations will be combined to
test for the cumulative effect of multiple temperature-sensitivity
markers. The L mutants bearing more than one temperature sensitive
marker are expected to have lower permissive temperature and to be
genetically more stable than single-marker mutants.
[0214] The generated L gene mutants may also be combined with
mutations present in other RSV genes and/or with non-essential RSV
gene deletion mutants (e.g., SH, NS1 and NS2 deletion). This will
enable the selection of safe, stable and effective live attenuated
RSV vaccine candidates.
10. GENERATION OF HUMAN RESPIRATORY SYNCYTIAL VIRUS Vaccine (RSV)
CANDIDATE BY DELETING THE VIRAL SH AND M2ORF2 GENES
[0215] 10.1. M2-2 Deletion Mutant
[0216] To delete M2-2 genes, two Hind III restriction enzyme sites
were introduced at RSV nucleotides 8196 and 8430, respectively, in
a cDNA subclone pET(S/B) which contained an RSV restriction
fragment from 4478 to 8505. The RSV restriction fragment had been
previously prepared by Quikchange site-directed mutagenesis
(Strategene, Lo Jolla, Calif.). Digestion of pET(S/B) with Hind III
restriction enzyme removed a 234 nucleotide sequence which
contained the majority of the M2-2 open reading frame. The
nucleotides encoding the first 13 amino acids at the N-terminus of
the M2-2 gene product were not removed because this sequence
overlaps M2-1. The cDNA fragment which contained M2-2 gene deletion
was digested with SacI and BamHI and cloned back into a full-length
RSV cDNA clone, designated pRSV.DELTA.M2-2
[0217] Infectious RSV with this M2-2 deletion was generated by
transfecting pRSV.DELTA.M2-2 plasmid into MVA-infected Hep-2 cells
expressing N, P and L genes. Briefly, pRSV.DELTA.M2-2 was
transfected, together with plasmids encoding proteins N, P and L,
into Hep-2 cells which had been infected with a recombinant
vaccinia virus (MVA) expressing the T7 RNA polymerase. Transfection
and recovery of recombinant RSV was performed as follows. Hep-2
cells were split five hours or a day before the transfection in
six-well dishes. Monolayers of Hep-2 cells at 70%-80% confluence
were infected with MVA at a multiplicity of infection (moi) of 5
and incubated at 35.degree. C. for 60 min. The cells were then
washed once with OPTI-MEM (Life Technologies, Gaithersburg, M.D.).
Each dish was replaced with 1 ml of OPTI-MEM and 0.2 ml
transfection medium was added. The transfection medium was prepared
by mixing 0.5-0.6 .mu.g of RSV antigenome, 0.4 .mu.g of N plasmid,
0.4 .mu.g of P plasmid, and 0.2 .mu.g of L plasmid in a final
volume of 0.1 ml OPTI-MEM medium. This was combined with 0.1 ml of
OPTI-MEM containing 10 .mu.l lipofecTACE (Life Technologies). After
a 15 minute incubation at room temperature, the DNA/lipofecTACE
mixture was added to the cells. The medium was replaced one day
later with MEM containing 2% FBS. Cultures were further incubated
at 35.degree. C. for 3 days and the supernatants harvested. Three
days post-transfection, 0.3-0.4 ml culture supernatants were
passaged onto fresh Hep-2 cells and incubated with MEM containing
2% FBS. After incubation for six days, the supernatant was
harvested and the cells were fixed and stained by an indirect
horseradish peroxidase method using goat anti-RSV antibody
(Biogenesis) followed by a rabbit anti-goat antibody linked to
horseradish peroxidase. The virus infected cells were then detected
by addition of substrate chromogen (DAKO) according to the
manufacturer's instructions. Recombinant RSV which contained M2-2
gene deletion was recovered from the transfected cells.
Identification of rRSV.DELTA.M2-2 was performed by RT/PCR using
primers flanking the deleted region. As shown in FIG. 12A, a cDNA
fragment which is 234 nucleotides shorter than the wild-type RSV
was detected in rRSV.DELTA.M2-2 infected cells. No cDNA was
detected in the RT/PCR reaction which did not contain reverse
transcriptase in the RT reaction. This indicated that the DNA
product was derived from viral RNA and not from contamination. The
properties of the M2-2 deletion RSV are currently being
evaluated.
[0218] 10.2. SH Deletion Mutant.
[0219] To delete the SH gene from RSV, a Sac I restriction enzyme
site was introduced at the gene start signal of SH gene at position
of nt 4220. A unique SacI site also exists at the C-terminus of the
SH gene. Site-directed mutagenesis was performed in subclone
pET(A/S), which contains an AvrII (2129) SacI (4478) restriction
fragment. Digestion of pET(A/S) mutant with SacI removed a 258
nucleotide fragment of the SH gene. Digestion of the pET(A/S)
subclone containing the SH deletion was digested with Avr II and
Sac I and the resulting restriction fragment was then cloned into a
full-length RSV cDNA clone. The full-length cDNA clone containing
the SH deletion was designated pRSV.DELTA.SH.
[0220] Generation of the pRSV.DELTA.SH mutant was performed as
described above (see 10.1). SH-minus RSV (rRSV.DELTA.SH) was
recovered from MVA-infected cells that had been co-transfected with
pRSV.DELTA.SH together with N, P and L expression plasmids.
Identification of the recovered rRSV.DELTA.SH was performed by
RT/PCR using a pair of primers which flanked the SH gene. As shown
in FIG. 12A, a cDNA band which is about 258 nucleotides shorter
than the wild-type virus was detected in the rRSV.DELTA.SH infected
cells. No DNA was detected in the RT/PCR reaction which did not
have reverse transcriptase in the RT reaction. This indicated that
the PCR DNA was derived from viral RNA and was not artifact, and
that the virus obtained was truly SH-minus RSV.
[0221] 10.3. GENERATION OF BOTH SH AND M2-2 DELETION MUTANT.
[0222] Both SH and M2-2 genes were deleted from the full-length RSV
cDNA construct by cDNA subcloning. A Sac I to Bam HI fragment
containing M2-2 deletion removed from cDNA subclone
pET(S/B).DELTA.M2-2RSV was cloned into pRSV.DELTA.SH cDNA clone.
The double gene deletion plasmid pRSV.DELTA.SH.DELTA.M2-2 was
confirmed by restriction enzyme mapping. As shown in FIG. 12B, the
SH/M2-2 double deletion mutant is shorter than the wild-type pRSV
cDNA.
[0223] Recovery of infectious RSV containing both the SH and M2-2
deletion was performed as described earlier. Infectious virus with
both SH and M2-2 deleted was obtained from transfected Hep-2
cells.
11. EXAMPLE
Generation of a Human Respiratory Syncytial Virus Vaccine (RSV)
Candidate by Deleting a Viral Accessory Gene(s) Either Singly or in
Combination Rationale:
[0224] Human respiratory syncytial virus is the major course of
pneumonia and bronchiolitis in infants under one year of age. RSV
is responsible for more than one in five pediatric hospital
admissions due to respiratory tract disease and causes 4,500 deaths
yearly in the USA alone. Despite decades of investigation to
develop an effective vaccine against RSV, no safe and effective
vaccine has been achieved to prevent the severe morbidity and
significant mortality associated with RSV infection. Various
approaches have been used to develop RSV vaccine candidates:
formalin-inactivated virus, recombinant subunit vaccine of
expressed RSV glycoproteins, and live attenuated virus. Recently,
generation of live attenuated RSV mutants has been the focus for
the RSV vaccine development. In the past, generation of live
attenuated RSV mutant can only be achieved by in vitro passage
and/or chemical mutagenesis. Virus was either underattenuated or
overattenuated and was not genetically stable. The present
investigation provides an immediate approach to generate
genetically stable live attenuated RSV vaccines by deleting an
accessory gene(s) individually or in combination. Gene deletions
are considered to be a very powerful strategy for attenuating RSV
because such deletions will not revert and the recombinant RSV
deletion mutants are thus expected to be genetically very
stable.
[0225] RSV is unique among the paramyxoviruses in its gene
organization. In addition to the N, P, L, M, G and F genes which
are common to all the paramyxoviruses, RSV contains four additional
genes which encode five proteins: NS1, NS2, SH, M2-1 and M2-2. M2-1
and M2-2 are translated from two open reading frames that overlap
in the middle of the M2 mRNA. M2-1 enhances mRNA transcriptional
processivity and also functions as an antitermination factor by
increasing transcriptional readthrough at the intergenicjunctions
(Collins, P. L. et al. Proc. Natl. Acad. Sci. USA 93, 81-85 (1996);
Hardy, R. W. et al. J. Virol. 72, 520-526 (1998)). However, the
M2-2 protein was found to inhibit RSV RNA transcription and
replication in vitro (Collins, P. L. et al. Proc. Natl. Acad. Sci.
USA 93, 81-85 (1996)). The accessory protein NS1 was reported to be
a potent transcription inhibitor (Atreya, P. L. et al., J. Virol.
72, 1452-1461 (1998)). The SH gene has been shown to be dispensable
for RSV growth in tissue culture in a naturally occurring virus and
in a recombinant RSV harboring an engineered SH deletion (Bukreyev,
A. et al., J Virol 71(12), 8973-82 (1997); Karron, R. A. et al. J.
Infect. Dis. 176, 1428-1436 (1997)). SH minus RSV replicates as
well as the wild type RSV in vitro. Recently, it was reported that
the NS2 gene could also be deleted (Teng, M. N., et al J Virol
73(1), 466-73 (1999); Buchholz, U. J. et al. J Virol 73(1), 251-9
(1999)). Deletion of M2-1, M2-2, and NS1 has not been reported,
neither was deletion of more than two nonessential genes
reported.
[0226] Traditionally, live attenuated virus mutants were generated
by passaging of RSV at lower temperature for many times and/or
mutagenized by chemical reagents. The mutations are introduced
randomly and the virus phenotype is difficult to maintain because
revertants may develop. The ability to produce virus from an
infectious cDNA makes it possible to delete gene or genes that are
associated with virus pathogenesis. Gene deletion alone or in
combination with mutations in the other viral genes (G, F, M, N, P
and L) may yield a stably attenuated RSV vaccine to effectively
protect RSV infection.
[0227] 11.1 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate By Deleting the Viral M2-2 Gene
[0228] This example describes production of a recombinant RSV in
which expression of the M2-2 gene has been ablated by removal of a
polynucleotide sequence encoding the M2-2 gene and its encoded
protein. The RSV M2-2 gene is encoded by M2-2 gene and its open
reading frame is partially overlapped with the 5'-proximal M2-1
open reading frame by 12 amino acids (Collins, P. L. et al. Proc.
Natl. Acad. Sci. USA 93, 81-85 (1996)). The predicted M2-2
polypeptide contains 90 amino acids, but the M2-2 protein has not
yet been identified intracelluarly. The M2-2 protein down-regulates
RSV RNA transcription and replication in a minigenome model system
(Collins, P. L. et al. Proc. Natl. Acad. Sci. USA 92, 11563-11567
(1995)). The significance of this negative effect on RSV RNA
transcription and replication in the viral replication cycle is not
known.
[0229] 11.1.1 Recovery of Recombinant RSV that Lacks the M2-2
Gene
[0230] To produce a recombinant RSV that no longer expresses the
M2-2 protein, the M2-2 gene was deleted from a parental RSV cDNA
clone (Jin, H. et al. Virology 251, 206-214 (1998)). The
antigenomic cDNA clone encodes a complete antigenomic RNA of strain
A2 of RSV, which was used successfully to recover recombinant RSV.
This antigenomic cDNA contains a single nucleotide change in the
leader region at position 4 from C to G in its antigenomic sense.
The construction of plasmid pA2.DELTA.M2-2 involved a two step
cloning procedure. Two Hind III restriction enzyme sites were
introduced at RSV sequence of 8196 nt and 8430 nt respectively in a
cDNA subclone (pET-S/B) that contained RSV Sac I(4477 nt) to
BamHI(8504 nt) cDNA fragment using Quickchange mutagenesis kit
(Strategene). Digestion of this cDNA clone with Hind III
restriction enzyme removed the 234 nt Hind III cDNA fragment that
contained the M2-2 gene. The remaining Sac I to BamHI fragment that
did not contain the M2-2 gene was then cloned into a RSV
antigenomic cDNA pRSVC4G. The resulting plasmid was designated as
pA2.DELTA.M2-2.
[0231] To recover recombinant RSV with the M2-2 open reading frame
deleted, pA2.DELTA.M2-2 was transfected, together with plasmids
encoding the RSV N, P, and L proteins under the control of T7
promoter, into Hep-2 cells which had been infected with a modified
vaccinia virus encoding the T7 RNA polymerase (MVA-T7). After 5
hours incubation of the transfected Hep-2 cells at 35.degree. C.,
the medium was replaced with MEM containing 2% FBS and the cells
were further incubated at 35.degree. C. for 3 days. Culture
supernatants from the transfected Hep-2 cells were used to infect
the fresh Hep-2 or Vero cells to amplify the rescued virus.
Recovery of rA2 .mu.M-2 was indicated by syncytial formation and
confirmed by positive staining of the infected cells using
polyclonal anti-RSV A2 serum. Recovered rA2.DELTA.M2-2 was plaque
purified three times and amplified in Vero cells. To confirm that
rA2.DELTA.M2-2 contained the M2-2 gene deletion, viral RNA was
extracted from virus and subjected to RT/PCR using a pair of
primers spanning the M2-2 gene. Viral RNA was extracted from
rA2M2-2 and rA2 infected cell culture supernatant by an RNA
extraction kit (RNA STAT-50, Tel-Test, Friendswood, Tex.). Viral
RNA was reverse transcribed with reverse transcriptase using a
primer complementary to viral genome from 7430 nt to 7449 nt. The
cDNA fragment spanning the M2-2 gene was amplified by PCR with
primer V1948 (7486 nt to 7515 nt at positive-sense) and primer
V1581 (8544 nt to 8525 nt at negative sense). The PCR product was
analyzed on a 1.2% agarose gel and visualized by EtBr staining. As
shown in FIG. 13B, wild type rA2 yielded a PCR DNA product
corresponding to the predicted 1029 nt fragment, whereas
rA2.DELTA.M2-2 yielded a PCR product of 795 nt, 234 nt shorter.
Generation of RT/PCR product was dependent on the RT step,
indicating that they were derived from RNA rather than from DNA
contamination.
11.1.2 RNA Synthesis OF rA2.DELTA.M2-2
[0232] mRNA expression from cells infected with rA2M2-2 or rA2 was
analyzed by Northern blot hybridization analyses. Total cellular
RNA was extracted from rA2.DELTA.M2-2 or rA2 infected cells by an
RNA extraction kit (RNA STAT-60, Tel-Test, Friendswood, Tex.). RNA
was electrophoresed on a 1.2% agarose gel containing formaldehyde
and transferred to a nylon membrane (Amersham Pharmacia Biotech,
Piscataway, N.J.). The membrane was hybridized with a RSV gene
specific riboprobe labeled with digoxigenin (Dig). The hybridized
RNA bands were visualized by using Dig-Luminescent Detection Kit
for Nucleic Acids (Boehringer Mannheim, Indianapolis, Ind.).
Hybridization of the membranes with riboprobes was done at
65.degree. C., membrane washing and signal detection were performed
according to the standard procedures. To examine mRNA synthesis
from rA2.DELTA.M2-2 and rA2, accumulation of the M2 mRNA and the
other viral mRNA products in infected Vero cells was analyzed by
Northern blot hybridization. Hybridization of the blot with a probe
specific to the M2-2 open reading frame did not detect any signal
in rA2.DELTA.M2-2 infected cells. Instead, a shorter M2 mRNA was
detected in rA2.DELTA.M2-2 infected cells using a riboprobe
specific to the M2-1 gene (FIG. 14A). These observations confirmed
that the M2-2 gene was deleted from rA2.DELTA.M2-2. Accumulation of
the other nine RSV mRNA transcripts was also examined and the
amounts of each mRNA were found to be comparable between
rA2.DELTA.M2-2 and rA2 infected cells. Examples of Northern blots
probed with N, SH, G and F are also shown in FIG. 14A. Slightly
faster migration of F-M2 bicistronic mRNA was also discernible due
to the deletion of the M2-2 region.
[0233] The M2-2 protein was previously reported to be a potent
transcriptional negative regulator in a minigenome replication
assay. However, deletion of the M2-2 gene from virus did not appear
to affect viral mRNA production in infected cells. To determine if
levels of viral antigenome and genome RNA of rA2.DELTA.M2-2 were
also similar to rA2, the amount of viral genomic and antigenomic
RNA produced in infected Vero and Hep-2 cells was examined by
Northern hybridization. Hybridization of the infected total
cellular RNA with a .sup.32P-labeled F gene riboprobe specific to
the negative genomic sense RNA indicated that much less genomic RNA
was produced in cells infected with rA2.DELTA.M2-2 compared to rA2
(FIG. 14B). A duplicate membrane was hybridized with a
.sup.32P-labeled F gene riboprobe specific to the positive sense
RNA. Very little antigenomic RNA was detected in cells infected
with rA2.DELTA.M2-2, although the amount of the F mRNA in
rA2.DELTA.M2-2 infected cells was comparable to rA2. Therefore, it
appears that RSV genome and antigenome synthesis was down-regulated
due to deletion of the M2-2 gene. This down-regulation was seen in
both Vero and Hep-2 cells and thus was not cell type dependent.
11.1.3 Protein Synthesis of rA2.DELTA.M2-2
[0234] Since the putative M2-2 protein has not been identified in
RSV infected cells previously, it was thus necessary to demonstrate
that the M2-2 protein is indeed encoded by RSV and produced in
infected cells. A polyclonal antiserum was produced against the
M2-2 fusion protein that was expressed in a bacterial expression
system. To produce antiserum against the M2-2 protein of RSV, a
cDNA fiagment encoding the M2-2 open reading frame from 8155 nt to
8430 nt was amplified by PCR and cloned into the pRSETA vector
(Invitrogen, Carlsbad, Calif.). pRSETA/M2-2 was transformed into
BL21-Gold(DE3)plysS cells (Strategene, La Jolla, Calif.) and
expression of His-tagged M2-2 protein was induced by IPTG. The M2-2
fusion protein was purified through HiTrap affinity columns
(Amersham Pharmacia Biotech, Piscataway, N.J.) and was used to
immunize rabbits. Two weeks after a booster immunization, rabbits
were bled and the serum collected.
[0235] Viral specific proteins produced from infected cells were
analyzed by immunoprecipitation of the infected cell extracts or by
Western blotting. For immunoprecipitation analysis, the infected
Vero cells were labeled with .sup.35S-promix (100 .mu.Ci/ml
.sup.35S-Cys and .sup.35S-Met, Amersham, Arlington Heights, Ill.)
at 14 hr to 18 hr postinfection. The labeled cell monolayers were
lysed by RIPA buffer and the polypeptides immunoprecipitated by
polyclonal anti-RSV A2 serum (Biogenesis, Sandown, N.H.) or
anti-M2-2 serum. Immunoprecipitation of rA2 infected Vero cell
lysates with anti-M2-2 antibody produced a protein band of
approximately 10 kDa, which is the predicated size for the M2-2
polypeptide.
[0236] This polypeptide was not detected in rA2.DELTA.M2-2 infected
cells (FIG. 15A), confirming that M2-2 is a protein product
produced by RSV and its expression was ablated from rA2.DELTA.M2-2.
The overall polypeptide pattern of rA2.DELTA.M2-2 was
indistinguishable from that of rA2. However, it was noted that
slightly more P and SH proteins were produced in rA2.DELTA.M2-2
infected Vero cells by immunoprecipitation. Nevertheless, by
Western blotting analysis, a comparable amount of SH was produced
in cells infected with rA2.DELTA.M2-2 or rA2 (FIG. 15B).
[0237] Immunoprecipitated polypeptides were electrophoresed on
17.5% polyacrylamide gels containing 0.1% SDS and 4 M urea, and
detected by autoradiography. For Western blotting analysis, Hep-2
and Vero cells were infected with rA2.DELTA.M2-2 or rA2. At various
times postinfection, virus infected cells were lysed in protein
lysis buffer and the cell lysates were electrophoresed on 17.5%
polyacrylamide gels containing 0.1% SDS and 4 M urea. The proteins
were transferred to a nylon membrane. Immunoblotting was performed
as described in Jin et al. (Jin, H. et al. Embo J 16(6), 1236-47
(1997)), using polyclonal antiserum against M2-1, NS1, or SH.
[0238] Western blotting was used to determine the protein synthesis
kinetics of rA2.DELTA.M2-2 in both Vero and Hep-2 cell lines. Hep-2
or Vero cells were infected with rA2.DELTA.M2-2 or rA2 at moi of
0.5 and at various times of postinfection, the infected cells were
harvested and the polypeptides separated on a 17.5% polyacrylamide
gel containing 4 M urea. The proteins were transferred to a nylon
membrane and probed with polyclonal antisera against the three
accessory proteins: M2-1, NS1 and SH. Protein expression kinetics
for all three viral proteins were very similar for rA2.DELTA.M2-2
and rA2 in both Hep-2 and Vero cells (FIG. 15B). Synthesis of the
NS1 protein was detected at 10 hr postinfection, which was slightly
earlier than M2-1 and SH because the NS1 protein is the first gene
translated and is a very abundant protein product in infected
cells. Similar protein synthesis kinetics was also observed when
the membrane was probed with a polyclonal antiserum against RSV
(data not shown). Comparable M2-1 was detected in rA2.DELTA.M2-2
infected cells, indicating that deletion of the M2-2 open reading
frame did not affect the level of the M2-1 protein that is
translated by the same M2 mRNA.
[0239] 11.1.4 Growth Analysis of Recombinant RSV in Tissue
Culture
[0240] To compare plaque morphology of rA2.DELTA.M2-2 with rA2,
Hep-2 or Vero cells were infected with each virus and overlayed
with semisolid medium composed of 1% methylcellulose and
1.times.L15 medium with 2% FBS. Five days after infection, infected
cells were immunostained with antisera against RSV A2 strain.
Plaque size was determined by measuring plaques from photographed
microscopic images. Plaque formation of rA2.DELTA.M2-2 in Hep-2 and
Vero cells was compared with rA2. As shown in FIG. 16,
rA2.DELTA.M2-2 formed pin point sized plaques in Hep-2 cells, with
a reduction of about 5-fold in virus plaque size observed for
rA2.DELTA.M2-2 compared to rA2. However, only a slight reduction in
plaque size (30%) was seen in Vero cells infected with
rA2.DELTA.M2-2.
[0241] A growth kinetics study of rA2.DELTA.M2-2 in comparison with
rA2 was performed in both Hep-2 and Vero cells. Cells grown in 6-cm
dishes were infected with rA2 or rA2.DELTA.M2-2 at a moi of 0.5.
After 1 hr adsorption at room temperature, infected cells were
washed three times with PBS, replaced with 4 ml of OPTI-MEM and
incubated at 35.degree. C. incubator containing 5% CO.sub.2. At
various times post-infection, 200 .mu.l culture supernatant was
collected, and stored at -70.degree. C. until virus titration. Each
aliquot taken was replaced with an equal amount of fresh medium.
Virus titer was determined by plaque assay in Vero cells on 12-well
plates using an overlay of 1% methylcellulose and 1.times.L15
medium containing 2% FBS. As seen in FIG. 17, rA2.DELTA.M2-2 showed
very slow growth kinetics and the peak titer of rA2.DELTA.M2-2 was
about 2.5-3 log lower than that of rA2 in Hep-2 cells. In Vero
cells, rA2.DELTA.M2-2 reached a peak titer similar to rA2. To
analyze virus replication in different host cells, each cell line
grown in 6-well plates was infected with rA2.DELTA.M2-2 or rA2 at
moi of 0.2. Three days postinfection, the culture supernatants were
collected and virus was quantitated by plaque assay. rA2.DELTA.M2-2
was examined for its growth properties in various cell lines that
derived from different hosts with different tissue origins (Table
3). Significantly reduced replication of rA2.DELTA.M2-2, two orders
of magnitude less than rA2, was observed in infected Hep-2, MRC-5,
and Hela cells, all of human origin. However, replication of
rA2.DELTA.M2-2 was only slightly reduced in MDBK and LLC-MK2 cells
that are derived from bovine and rhesus monkey kidney cells,
respectively.
TABLE-US-00006 TABLE 3 Replication levels of rA2 M2-2 and rA2 in
various cell lines Virus titer [log.sub.10(pfu/ml)] Cell lines Host
Tissue origin rA2 rA2.DELTA.M2-2 Vero Monkey Kidney 6.1 6.1 Hep-2
Human Larynx 6.2 4.3 MDBK Bovine Kidney 6.1 5.5 MRC-5 Human Lung
5.5 3.0 Hela Human Cervix 6.6 4.5 LLC-MK2 Monkey Kidney 6.7 6.1
[0242] 11.1.5 Replication OF rA2.DELTA.M2-2 in Mice and Cotton
Rats
[0243] Virus replication in vivo was determined in respiratory
pathogen-free 12-week-old Balb/c mice (Simonsen Lab., Gilroy,
Calif.) and S. Hispidus cotton rats (Virion Systems, Rockville,
Md.). Mice or cotton rats in groups of 6 were inoculated
intranasally under light methoxyflurane anesthesia with 10.sup.6
pfu per animal in a 0.1-ml inoculum of rA2 or rA2.DELTA.M2-2. On
day 4 postinoculation, animals were sacrificed by CO.sub.2
asphyxiation and their nasal turbinates and lungs were obtained
separately. Tissues were homogenized and virus titers were
determined by plaque assay in Vero cells. To evaluate
immunogenicity and protective efficacy, three groups of mice were
inoculated intranasally with rA2, rA2.DELTA.M2-2 or medium only at
day 0. Three weeks later, mice were anesthetized, serum samples
were collected, and a challenge inoculation of 10.sup.6 pfu of
biologically derived wild type RSV strain A2 was administered
intranasally. Four days post-challenge, the animals were sacrificed
and both nasal turbinates and lungs were harvested and virus titer
determined by plaque assay. Serum antibodies against RSV A2 strain
were determined by 60% plaque reduction assay (Coates, H. V. et
al., AM J. Epid. 83:299-313 (1965)) and by immunostaining of RSV
infected cells.
TABLE-US-00007 TABLE 4 Replication of rA2.DELTA.M2-2 and rA2 in
cotton rats Virus titer (mean log.sub.10 pfu/g tissue .+-.
SE).sup.a Virus Nasal turbinates Lung rA2 4.0 .+-. 0.33 5.5 .+-.
0.12 rA2.DELTA.M2-2 <1.4 <1.4 .sup.aGroups of six cotton rats
were immunized intranasally with 10.sup.6 pfu of the indicated
virus on day 0. The level of infected virus replication at day 4
was determined by plaque assay on indicated specimens, and the mean
log.sub.10 titer .+-. standard error (SE) per gram tissue were
determined.
[0244] To evaluate levels of attenuation and immunogenicity of
rA2.DELTA.M2-2, replication of rA2.DELTA.M2-2 in the upper and
lower respiratory tract of mice and cotton rats was examined.
Cotton rats in groups of 6 were inoculated with 10.sup.6 .mu.l of
rA2.DELTA.M2-2 or rA2 intranasally. Animals were sacrificed at 4
days postinoculation, their nasal turbinates and lung tissues were
harvested, homogenized, and levels of virus replication in these
tissues were determined by plaque assay. rA2.DELTA.M2-2 exhibited
at least 2 log reduction of replication in both nasal turbinates
and lungs of the infected cotton rats (Table 4). No virus
replication was detected in cotton rats infected with
rA2.DELTA.M2-2, whereas a high level of wild type rA2 virus
replication was detected in both the upper and lower respiratory
tract of cotton rats. Attenuation of rA2.DELTA.M2-2 was also
observed in mice. Geometric mean titer of virus replication and
standard error obtained from two experiments are shown in Table 5.
rA2.DELTA.M2-2 replication was only detected in one or two of 12
infected mice. The replication was limited, only a few plaques were
observed at 10.sup.-1 dilution of the tissue homogenates. Despite
its restricted replication in mice, rA2.DELTA.M2-2 induced
significant resistance to challenge with wild type A2 RSV (Table
5). When mice previously inoculated with rA2.DELTA.M2-2 or rA2 were
inoculated intranasally with 10.sup.6 pfu dose of wild type A2
strain, no wild type A2 virus replication was detected in the upper
and lower respiratory tract of mice. Therefore, rA2.DELTA.M2-2 was
fully protective against wild type A2 virus challenge.
[0245] The immunogenicity of rA2.DELTA.M2-2 was also examined. Two
groups of mice were infected with rA2.DELTA.M2-2 or rA2, and three
weeks later, serum samples were collected. The serum neutralization
titer was determined by 50% plaque reduction titer. The
neutralization titer from rA2.DELTA.M2-2 infected mice was
comparable to that of rA2, both had 60% plaque reduction titer at
1:16 dilution. The serum obtained from rA2.DELTA.M2-2 infected mice
was also able to immunostain RSV plaques, confirming that
RSV-specific antibodies were produced in rA2.DELTA.M2-2 infected
mice.
TABLE-US-00008 TABLE 5 Replication of rA2.DELTA.M2-2 and rA2 in
mice, and protection against wild type A2 RSV challenge Virus
replication.sup.a RSV A2 replication (Mean log.sub.10 pfu/g after
challenge.sup.b tissue .+-. SE) (Mean log.sub.10 pfu/g Immunizing
Nasal tissue .+-. SE) Virus turbinates Lung Nasal turbinates Lung
rA2 3.72 .+-. 0.33 4.0 .+-. 0.13 <1.4 <1.4 rA2.DELTA.M2-2
<1.4 <1.4 <1.4 <1.4 Control <1.4 <1.4 3.53 .+-.
0.17 4.10 .+-. 0.13 .sup.aGroups of 12 Balb/c mice were immunized
intranasally with 10.sup.6 pfu of the indicated virus on day 0. The
level of infected virus in indicated tissues was determined by
plaque assay at day 4, and the mean log.sub.10 titer .+-. standard
error (SE) per gram tissue were determined. .sup.bGroups of 6
Balb/c Mice were intranasally administered with 10.sup.6 pfu of RSV
A2 on day 21 and sacrificed 4 days later. Replication of wild type
RSV A2 in tissues as indicated was determined by plaques assay, and
the mean log.sub.10 titer .+-. standard error (SE) per gram tissue
were determined.
[0246] The two RSV antigenic subgroups, A and B, exhibit a
relatively high degree of conservation in M2-2 proteins, suggesting
functional importance for the M2-2 protein. Transcriptional
analysis for rA2 and rA2.DELTA.M2-2 yielded important findings
within the present example. Although overall mRNA transcriptional
levels were substantially the same for both viruses, Northern blot
analysis revealed dramatic reduction of virus genome and antigenome
RNA for rA2.DELTA.M2-2 compared to wild type rA2. This finding is
contradictory with what has been reported for the negative
transcriptional regulation of the M2-2 protein in a minigenome
system. It thus appears that the functional role of M2-2 in the
virus life cycle is more complicated than previously thought.
Nevertheless, the reduction in the level of genome and antigenome
of rA2.DELTA.M2-2 did not appear to affect virus yields in infected
Vero cells.
[0247] The finding that rA2.DELTA.M2-2 exhibited host range
restricted replication in different cell lines provided a good
indication that deletion of a nonessential gene is a good means to
create a host range mutant, which can be a very important feature
for vaccine strains. rA2.DELTA.M2-2 did not replicate well in
several cell lines that are derived from human origin, lower virus
yield was produced from these cell lines. However, the levels of
protein synthesis in Hep-2 cells were similar to Vero cells that
produced high levels of rA2.DELTA.M2-2. This indicated that the
defect in virus release was probably due to a defect in a later
stage, probably during the virus assembly process.
[0248] The finding that the M2-2 minus virus grows well in Vero
cells and exhibits attenuation in the upper and lower respiratory
tracts of mice and cotton rats presents novel advantages for
vaccine development. The reduced replication in respiratory tracts
of rodents did not affect immunogenicity and protection against
challenging wild type virus replication, indicating that this M2-2
minus virus may serve as a good vaccine for human use. The nature
of the M2-2 deletion mutation, involving a 234 nt deletion,
represents a type of mutation that will be highly refractory to
reversion.
[0249] 11.2 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral SH Gene
[0250] This example describes production of a recombinant RSV in
which expression of the SH gene has been ablated by removal of a
polynucleotide sequence encoding the SH gene and its encoded
protein. The RSV SH protein is encoded by the SH mRNA which is the
5' gene translated by RSV. The SH protein contains 64 amino acids
in the strain A2 and contains a putative transmembrane domain at
amino acid positions 14-41. The SH protein only has counterparts in
simian virus 5 (Hiebert, S. W. et al. 5. J Virol 55(3), 744-51
(1985)) and mumps virus (Elango, N. et al. J Virol 63(3), 1413-5
(1989)). The function of the SH protein has not been defined. This
example demonstrated that the entire SH gene can be removed from
RSV. Thus, SH gene deletion may provide an additional method for
attenuating RSV by itself or in combination with other gene
deletions or mutations.
[0251] To produce a recombinant RSV having deletion in the RSV, the
entire SH open reading frame was deleted from an infectious cDNA
clone that derived from the RSV A2 strain. A two step cloning
procedure was performed to delete the SH gene (from 4220 nt to 4477
nt) from a cDNA subclone. A Sac I restriction enzyme site was
introduced at the gene start signal of the SH gene at position of
4220 nt. A unique Sac I site also exists at the C-terminal of the
SH gene at position of 4477 nt. Site-directed mutagenesis to
introduce a Sac Isite at the 5' of the SH gene was performed in
pET(A/S) subclone, which contained Avr II (2129 nt) to Sac I (4477
nt) restriction fragment of RSV sequence. Digestion of pET(A/S)
plasmid that contained the introduced Sac I site with Sac I
restriction enzyme removed 258 nt fragment of the SH gene. pET(A/S)
which had the SH gene deletion was digested with Avr II and Sac I
and the released RSV restriction fragment was then cloned into a
full length RSV cDNA clone. The full-length cDNA clone containing
the SH gene deletion was designated pA2.DELTA.SH.
[0252] Generation of pA2.DELTA.SH mutant was performed as described
above (see Section 7). SH-minus RSV (rA2.DELTA.SH) was recovered
from MVA-infected cells that had been co-transfected with pA2
.DELTA.SH together with three plasmids that expressed the N, P and
L proteins, respectively. Identification of the recovered
rA2.DELTA.SH was performed by RT/PCR using a pair of primers which
flanked the SH gene. A cDNA band that is about 258 nucleotide
shorter than the wild-type RSV (rA2) was detected in the
rA2.DELTA.SH infected cells. No PCR product was seen in the RT/PCR
reaction that did not have reverse transcriptase in the RT
reaction. This indicated that the PCR DNA was derived from viral
RNA and is not artifact, and the virus obtained is truly SH-minus
RSV.
[0253] To compare plaque morphology of rA2.DELTA.SH with rA2, Hep-2
or Vero cells were infected with each virus and overlayed with
semisolid medium composed of 1% methylcellulose and 1.times.L15
medium with 2% FBS. Five days after infection, infected cells were
immunostained with antisera against RSV A2 strain. The plaque size
of rA2.DELTA.SH is similar to that of rA2 in both Hep-2 and Vero
cells.
[0254] To analyze virus replication in different cell lines that
were derived from various hosts with different tissue origin, each
cell line grown in 6-well plates was infected with rA2.DELTA.SH or
rA2 at moi of 0.2. Three days postinfection, the culture
supernatants were collected and virus was quantitated by plaque
assay. As shown in Table 6, replication of rA2.DELTA.SH was very
similar to rA2 in all the cell lines examined, indicating that the
growth of SH-minus RSV was not substantially affected by host range
effects.
TABLE-US-00009 TABLE 6 Growth comparison of rA2.DELTA.SH and rA2 in
different cell lines Virus titer [log.sub.10 (pfu/ml)] Cell lines
Host Tissue origin rA2 rA2.DELTA.SH Vero Monkey Kidney 5.8 5.7
Hep-2 Human Larynx 6.5 6.1 MDBK Bovine Kidney 6.3 6.6 MRC-5 Human
Lung 5.5 5.3 Hela Human Cervix 6.5 6.0
[0255] Virus replication in vivo was determined in respiratory
pathogen-free 12-week-old Balb/c mice (Simonsen Lab., Gilroy,
Calif.). Mice in groups of 6 were inoculated intranasally under
light methoxyflurane anesthesia with 10.sup.6 pfu per animal in a
0.1-ml inoculum of rA2 or rA2.DELTA.SH. On day 4 postinoculation,
animals were sacrificed by CO.sub.2 asphyxiation and their nasal
turbinates and lungs were obtained separately. Tissues were
homogenized and virus titers were determined by plaque assay in
Vero cells. As shown in Table 7, level of rA2.DELTA.SH replication
in lower respiratory tract was only slightly lower than rA2,
indicating that SH deletion alone may not be sufficient to
attenuate RSV.
TABLE-US-00010 TABLE 7 Replication of rA2.DELTA.SH and rA2 in mice
Virus Virus titer in lung (mean log.sub.10 pfu/g tissue .+-.
SE).sup.a rA2 3.75 .+-. 0.07 rA2.DELTA.SH 3.21 .+-. 0.25
.sup.aGroups of mice were immunized intranasally with 10.sup.6 pfu
of the indicated virus on day 0. The level of infected virus
replication at day 4 was determined by plaque assay on indicated
specimens, and the mean log.sub.10 titer .+-. standard error (SE)
per gram tissue were determined.
[0256] 11.3 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS1 Gene
[0257] This example describes production of a recombinant RSV in
which expression of the NS1 gene has been ablated by removal of a
polynucleotide sequence encoding the NS1 gene and its encoded
protein. The RSV NS1 is encoded by the 3' proximal NS1 gene in the
3' to 5' direction of the RSV gene map. The NS1 protein is a small
139-amino acid polypeptide and its mRNA is most abundant of the RSV
mRNA. The function of the NS1 protein has not yet been clearly
identified. In the reconstituted RSV minigenome system, the NS1
protein appeared to be a negative regulatory protein for both
transcription and RNA replication of a RSV minigenome (Grosfeld, H.
et al. J. Virol. 69, 5677-5686 (1995)). The NS1 protein does not
have a known counterpart in other paramyxoviruses and its function
in virus replication is not known. This example demonstrated that
the entire NS1 gene can be removed from RSV and NS1 deletion may
provide an additional method for attenuating RSV or in combination
with other RSV gene deletions or mutations.
[0258] To delete the NS1 gene from RSV, two restriction enzyme
sites were inserted at positions of the NS1 gene start signal and
downstream of the NS1 gene end signal. A two step cloning procedure
was performed to delete the entire NS1 gene from RSV. A Pst I
restriction enzyme site was introduced at position of 45 nt and at
position of 577 nt of RSV sequence by site-directed mutagenesis.
Mutagenesis was performed in pET(X/A) cDNA subclone, which
contained the first 2128 nucleotides of RSV sequences that encode
the NS1, NS2 and part of the N gene of RSV. The 2128 nucleotide RSV
sequence was cloned into the pET vector through the Xma I and Avr
II restriction enzyme sites. Digestion of pET(X/A) plasmid that
contained the introduced two Pst I restriction enzyme sites removed
the 532 nucleotide fragment that contained the NS1 gene. The
deletion included the NS1 gene start signal, the NS1 coding region,
and the NS1 gene end signal. pET(X/A) which contained the NS1
deletion was digested with Avr II and Sac I and the released
restriction fragment was then cloned into a full length RSV cDNA
clone. The full-length RSV antigenomic cDNA clone containing the
NS1 gene deletion was designated pA2.DELTA.NS1.
[0259] Generation of pA2.DELTA.NS1 mutant was performed as
described above (see Section 7). NS1-minus RSV (rA2.DELTA.NS1) was
recovered from MVA-infected cells that had been co-transfected with
pA2.DELTA.NS1 together with three plasmids that expressed the N, P
and L proteins, respectively. Recovery of infectious RSV was
indicated by syncytial formation and confirmed by immunostaining
with an antibody against RSV. Identification of the recovered
rA2.DELTA.NS1 was performed by RT/PCR using a pair of primers
flanking the NS1 gene. A cDNA band that is about 532 nt shorter
than the wild-type RSV (rA2) was detected in the rA2.DELTA.NS1
infected cells. No PCR product was seen in the RT/PCR reaction that
did not have reverse transcriptase in the RT reaction. This
indicated that the PCR DNA was derived from viral RNA and is not
artifact, and the virus obtained is truly NS1-minus RSV.
[0260] mRNA expression from cells infected with rA2.DELTA.NS1 or
rA2 was analyzed by Northern blot hybridization analyses. Total
cellular RNA was extracted from rA2.DELTA.NS1 or rA2 infected cells
by an RNA extraction kit (RNA STAT-60, Tel-Test, Friendswood,
Tex.). RNA was electrophoresed on a 1.2% agarose gel containing
formaldehyde and transferred to a nylon membrane (Amersham
Pharmacia Biotech, Piscataway, N.J.). The membrane was hybridized
with a riboprobe specific to the NS1, NS2 or M2-2 gene. As shown in
FIG. 18, no NS1 mRNA was detected in cells infected with
rA2.DELTA.NS1 using a probe that was specific to the NS1 gene. The
fact that the NS1 gene can be deleted from RSV identifies that the
NS1 protein is an accessory protein product that is not essential
for RSV replication. rA2.DELTA.NS1 formed very small plaques in
infected Hep-2 cells, but only slight plaque size reduction was
seen in Vero cells (FIG. 19). The small plaque phenotype is
commonly associated with attenuating mutations.
[0261] A growth kinetics study of rA2.DELTA.NS1 in comparison with
rA2 was performed in Vero cells. Cells grown in 6-cm dishes were
infected with rA2 or rA2.DELTA.NS1 at a moi of 0.2. As seen in FIG.
20, rA2.DELTA.NS1 showed very slow growth kinetics and its peak
titer was about 1.5 log lower than that of rA2. To analyze virus
replication in different host cells, each cell line grown in 6-well
plates was infected with rA2.DELTA.NS1 or rA2 at moi of 0.2. Three
days postinfection, the culture supernatants were collected and
virus was quantitated by plaque assay. rA2.DELTA.NS1 had about
1-1.5 log reduction in virus titer compared to rA2 in Vero, Hep-2
and MDBK cells. About 2 log reduction in virus titer was observed
in Hela and MRC5 cells (Table 8). Replication of rA2.DELTA.NS1 in a
small animal model is currently being investigated. Preliminary
data indicated that rA2.DELTA.NS1 is attenuated in cotton rats. The
NS1 deletion mutant therefore provides an additional method for
attenuating RSV.
TABLE-US-00011 TABLE 8 Growth comparison of rA2.DELTA.NS1 and rA2
in different cell lines Virus titer [log.sub.10 (pfu/ml)] Cell
lines rA2 rA2.DELTA.NS1 Vero 6.4 5.5 Hep-2 6.7 5.1 MDBK 6.7 5.2
MRC-5 5.9 3.6 Hela 6.5 4.5
[0262] 11.4 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS2 Gene
[0263] This example describes production of a recombinant RSV in
which expression of the NS2 gene has been ablated by removal of a
polynucleotide sequence encoding the NS2 gene and its encoded
protein. The NS2 is a small protein that is encoded by the second
3' proximal NS2 gene in the 3' to 5' order of RSV genome. The NS2
protein might be the second most abundant RSV protein of RSV, but
its function remains to be identified.
[0264] To delete the NS2 gene from RSV, two restriction enzyme
sites were inserted at positions of upstream of the NS2 gene start
signal and downstream of the NS2 gene end signal. A two step
cloning procedure was performed to delete the entire NS1 gene from
RSV. A Pst I restriction enzyme site was introduced at position of
577 nt and at position of 1110 nt of RSV sequence by site-directed
mutagenesis. Mutagenesis was performed in pET(X/A) cDNA subclone,
which contained the first 2128 nt of RSV sequences at antigenomic
sense that encode the NS1, NS2 and part of the N gene of RSV. The
2128 nt RSV sequences were cloned into the pET vector through the
Xma I and Avr II restriction enzyme sites. Digestion of pET(X/A)
plasmid that contained the introduced two Pst I restriction enzyme
sites removed 533 nucleotide fragment of the NS2 gene. The 533 nt
fragment contained the gene start signal of NS2, NS2 coding region
and the gene end signal of NS2. pET(X/S) plasmid that contained the
NS2 gene deletion was digested with Avr II and Sac I restriction
enzymes and the released RSV restriction fragment was then cloned
into a full length RSV cDNA clone. The full-length cDNA clone
containing the NS2 gene deletion was designated pA2.DELTA.NS2.
[0265] Generation of rA2.DELTA.NS2 mutant was performed as
described above (see Section 7). NS2-minus RSV (rA2.DELTA.NS2) was
recovered from MVA-infected cells that had been co-transfected with
pA2.DELTA.NS2 together with three plasmids that expressed the N, P
and L proteins, respectively. Recovery of infectious RSV was
indicated by syncytial formation and confirmed by immunostaining
with an antibody against RSV. Identification of the recovered
rRSV.DELTA.NS2 was performed by RT/PCR using a pair of primers that
flanked the NS2 gene. A cDNA band that is about 533 nucleotide
shorter than the wild-type RSV (rA2) was detected in the
rA2.DELTA.NS2 infected cells. No PCR product was seen in the RT/PCR
reaction that did not have reverse transcriptase in the RT
reaction. This indicated that the PCR DNA was derived from viral
RNA and is not artifact, and the virus obtained is truly NS2-minus
RSV.
[0266] mRNA expression from cells infected with rA2.DELTA.NS2 or
rA2 was analyzed by Northern blot hybridization analyses as
described earlier. The blot was hybridized with a riboprobe
specific to the NS1, NS2 or M2-2 gene. As shown in FIG. 18, no NS2
mRNA was detected in cells infected with rA2.DELTA.NS2 using a
probe that was specific to the NS2 gene. Comparable level of NS1
and M2 mRNA was detected in rA2.DELTA.NS2-infected cells. The fact
that the NS2 gene can be deleted from RSV indicates that the NS2
protein is an accessory protein product that is not essential for
RSV replication. rA2.DELTA.NS2 formed very small plaques in
infected Hep-2 cells, but plaque size similar to rA2 was seen in
rA2.DELTA.NS2 infected Vero cells (FIG. 19). The small plaque
phenotype is commonly associated with attenuating mutations.
[0267] A growth kinetics study of rA2.DELTA.NS2 in comparison with
rA2 was performed in Vero cells. Cells grown in 6-cm dishes were
infected with rA2 or rA2.DELTA.NS2 at a moi of 0.2. As seen in FIG.
21, rA2.DELTA.NS2 showed slower growth kinetics and its peak titer
was about 5-fold lower than that of rA2. To analyze virus
replication in different host cells, each cell line grown in 6-well
plates was infected with rA2.DELTA.NS2 or rA2 at moi of 0.2. Three
days postinfection, the culture supernatants were collected and
virus was quantitated by plaque assay. rA2.DELTA.NS2 had only
slight reduction in virus titer compared to rA2 in Vero cells.
About a 1 log reduction in virus titer was observed in Hep-2, MDBK,
Hela and MRC5 cells (Table 9). Replication of rA2.DELTA.NS2 in a
small animal model is currently being investigated. rA2.DELTA.NS2
exhibited about 10-fold reduction of replication in the lower
respiratory tract of cotton rats (Table 10). The NS2 deletion
mutant therefore provides a method to obtain attenuated RSV.
TABLE-US-00012 TABLE 9 Growth comparison of rA2.DELTA.NS2 and rA2
in different cell lines Virus titer [log.sub.10 (pfu/ml)] Cell
lines rA2 rA2 NS2 Vero 6.4 6.2 Hep-2 6.7 5.9 MDBK 6.7 5.2 MRC-5 5.9
4.7 Hela 6.5 5.5
TABLE-US-00013 TABLE 10 Replication of rA2.DELTA.NS2 and rA2 in
cotton rats Virus Virus titer in lung (mean log.sub.10 pfu/g tissue
.+-. SE).sup.a rA2 3.93 .+-. 0.13 RA2.DELTA.NS2 2.79 .+-. 0.47
.sup.aGroups of five cotton rats were immunized intranasally with
10.sup.5 pfu of the indicated virus on day 0. The level of infected
virus replication at day 4 was determined by plaque assay on the
indicated specimens, and the mean log.sub.10 titer .+-. standard
error (SE) per gram tissue was determined.
[0268] 11.5 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral M2-2 and SH Genes
[0269] This example describes production of a recombinant RSV in
which expression of two RSV genes, M2-2 and SH, has been ablated by
removal of polynucleotide sequences encoding the M2-2 and SH genes
and their encoded proteins. As described earlier, the M2-2 or SH
gene is dispensable for RSV replication in vitro. It is possible
that deletion of two accessory genes will produce a recombinant RSV
with a different attenuation phenotype. The degree of attenuation
from deletion of two genes can be increased or decreased.
[0270] SH and M2-2 genes were deleted from the full-length RSV cDNA
construct through cDNA cloning. A Sac I to BamH I fragment that
contained M2-2 deletion in the pET(S/B) subclone as described
earlier was removed by digestion with Sac I and BamH I restriction
enzymes and was cloned into the full-length RSV antigenomic cDNA
clone that contained the SH gene deletion (pA2.DELTA.SH). The
resulting plasmid that contained deletion of SH and M2-2 was
designated pA2.DELTA.SH.DELTA.M2-2. Deletion of SH and M2-2 in
pA2.DELTA.SH.DELTA.M2-2 plasmid was confirmed by restriction enzyme
mapping.
[0271] Generation of rA2.DELTA.SH.DELTA.M2-2 mutant was performed
as described above (see Section 7). Recombinant RSV that contained
a deletion of the SH and M2-2 genes (rA2.DELTA.SH.DELTA.M2-2) was
recovered from MVA-infected cells that had been co-transfected with
pA2.DELTA.SH.DELTA.M2-2 together with three plasmids that expressed
the N, P and L proteins, respectively. Recovery of infectious RSV
deletion mutant was indicated by syncytial formation and confirmed
by immunostaining with an antibody against RSV.
[0272] Deletion of the SH and M2-2 genes in rA2.DELTA.SH.DELTA.M2-2
was confirmed by RT/PCR using two sets of primers that flanked the
SH gene and the M2-2 gene, respectively. mRNA expression from cells
infected with rA2.DELTA.SH.DELTA.M2-2 or rA2 was analyzed by
Northern blot hybridization analyses as described earlier. Both SH
and M2-2 mRNAs were not detected in cells infected with
rA2.DELTA.SH.DELTA.M2-2 using a probe that was specific to the SH
gene or M2-2 gene. The fact that two RSV genes (SH and M2-2) can be
deleted from RSV indicates that the SH and M2-2 proteins are
dispensable for RSV replication. In contrast to rA2.DELTA.M2-2 that
formed very small plaques in Hep-2 cells, rA2.DELTA.SH.DELTA.M2-2
had a plaque size larger than rA2.DELTA.M2-2 (FIG. 19).
[0273] A growth kinetics study of rA2.DELTA.SH.DELTA.M2-2 in
comparison with rA2 was performed in Vero cells. Cells grown in
6-cm dishes were infected with rA2 or rA2.DELTA.SH.DELTA.M-2 at a
moi of 0.2. As seen in FIG. 22, rA2.DELTA.SH.DELTA.M2-2 showed
slower growth kinetics and its peak titer was about 1.5 log lower
than that of rA2. This indicated that rA2.DELTA.SH.DELTA.M2-2 is
attenuated in tissue culture.
[0274] To evaluate the level of attenuation of
rA2.DELTA.SH.DELTA.M2-2, replication of rA2.DELTA.SH.DELTA.M2-2 in
the lower respiratory tracts of mice was examined. Mice in groups
of 6 were inoculated with 10.sup.6 pfu of rA2.DELTA.SH.DELTA.M2-2
or rA2 intranasally. Animals were sacrificed at 4 days
postinoculation, their nasal turbinates and lung tissues were
harvested, homogenized, and levels of virus replication in these
tissues were determined by plaque assay. rA2.DELTA.SH.DELTA.M2-2
exhibited about a 2 log reduction of replication in lungs of the
infected mice (Table 11). This data indicated that
rA2.DELTA.SH.DELTA.M2-2 is attenuated in mice, although the degree
of attenuation is not as significant as rA2.DELTA.M2-2.
TABLE-US-00014 TABLE 11 Replication of rA2.DELTA.SH.DELTA.M2-2 and
rA2 in mice Virus Virus titer in lung (mean log.sub.10 pfu/g tissue
.+-. SE).sup.a rA2 4.2 .+-. 0.08 rA2.DELTA.SH.DELTA.M2-2 2.4 .+-.
1.2 .sup.aGroups of six mice were immunized intranasally with
10.sup.6 pfu of the indicated virus on day 0. The level of infected
virus replication at day 4 was determined by plaque assay on
indicated specimens, and the mean log.sub.10 titer .+-. standard
error (SE) per gram tissue were determined.
[0275] 11.6 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral M2-2 and NS1
Genes
[0276] This example describes production of a recombinant RSV in
which expression of two different RSV genes, NS1 and M2-2, has been
ablated by removal of polynucleotide sequences encoding the NS1 and
M2-2 genes and their encoded proteins. As described earlier, NS1
and M2-2 gene alone is dispensable for RSV replication in vitro.
This example provided a different attenuating method by deletion of
two accessory genes from RSV.
[0277] NS1 and M2-2 genes were deleted from the full-length RSV
cDNA construct through cDNA cloning. A Xma Ito Avr II fragment that
contained NS1 deletion in pET(X/A) subclone was removed by
digestion with Xma I and Avr II restriction enzymes and was cloned
into the full-length RSV antigenomic cDNA clone that contained the
M2-2 gene deletion (pA2.DELTA.M2-2). The resulting plasmid that
contained deletion of both NS1 and M2-2 was designated
pA2.DELTA.NS1.DELTA.M2-2. Deletion of NS1 and M2-2 in pA2.DELTA.NS1
.DELTA.M2-2 plasmid was confirmed by restriction enzyme
mapping.
[0278] Generation rA2.DELTA.NS1.DELTA.M2-2 mutant was performed as
described above (see section 11.2). Recombinant RSV that contained
deletion of NS1 and M2-2 genes was recovered from MVA-infected
cells that had been co-transfected with pA2.DELTA.NS1.DELTA.M2-2
together with three plasmids that expressed the N, P and L
proteins, respectively. Recovery of infectious RSV was indicated by
syncytial formation and confirmed by immunostaining with an
antibody against RSV. Identification of the recovered rA2.DELTA.NS1
.DELTA.M2-2 was confirmed by RT/PCR using a pair of primers
flanking the NS1 gene and the M2-2 gene.
[0279] Replication of rA2.DELTA.NS1.DELTA.M2-2 in tissue culture
cell lines and in small animal models is being studied. Preliminary
in vitro data indicated that rA2.DELTA.NS1.DELTA.M2-2 is very
attenuated in tissue culture cells and recombinant RSV containing
deletion of NS1 and M2-2 genes is more attenuated than
rA2.DELTA.SH.DELTA.M2-2.
[0280] 11.7 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS2 and M2-2
Genes
[0281] This example describes production of a recombinant RSV in
which expression of two different RSV genes, NS2 and M2-2, has been
ablated by removal of polynucleotide sequences encoding the NS2 and
M2-2 genes and their encoded proteins. As described earlier, NS2 or
M2-2 gene is dispensable for RSV replication in vitro. It is
possible that deletion of two accessory genes from RSV will produce
a recombinant RSV with a different attenuation phenotype.
[0282] NS2 and M2-2 genes were deleted from the full-length RSV
cDNA construct through cDNA cloning. A Xma I to Avr II fragment
that contained NS2 deletion in pET(X/A) subclone was removed by
digestion with Xma I and Avr II restriction enzymes and was cloned
into the full-length RSV antigenomic cDNA clone that contained the
M2-2 gene deletion (pA2.DELTA.M2-2). The resulting plasmid that
contained deletion of both NS2 and M2-2 was designated
pA2.DELTA.NS2 .DELTA.M2-2. Deletion of NS2 and M2-2 in
pA2.DELTA.NS2.DELTA.M2-2 plasmid was confirmed by restriction
enzyme mapping.
[0283] Generation of rA2.DELTA.NS2.DELTA.M2-2 mutant was performed
as described above (see Section 7). Recombinant RSV that contained
deletion in the NS2 and M2-2 genes (rA2.DELTA.NS2.DELTA.M2-2) was
recovered from MVA-infected cells that had been co-transfected with
pA2.DELTA.NS2.DELTA.M2-2 together with three plasmids that
expressed the N, P and L proteins, respectively. Recovery of
infectious RSV was indicated by syncytial formation and confirmed
by immunostaining with an antibody against RSV. Identification of
the recovered rA2.DELTA.NS2.DELTA.M2-2 was confirmed by RT/PCR
using two pairs of primers flanking the NS2 or M2-2 gene,
respectively.
[0284] mRNA expression from cells infected with
rA2.DELTA.NS2.DELTA.M2-2 or rA2 was analyzed by Northern blot
hybridization analyses. As shown in FIG. 23, neither NS2 nor M2-2
mRNA was detected in cells infected with rA2.DELTA.NS2.DELTA.M2-2
using a probe that was specific to the NS2 gene or to the M2-2
gene. Comparable levels of NS1 and SH mRNA expression was observed
in cells infected with rA2.DELTA.NS2.DELTA.M2-2 Northern blot data
confirmed that expression of both NS2 and M2-2 was ablated in
rA2.DELTA.NS2.DELTA.M2-2.
[0285] A growth kinetics study of rA2.DELTA.NS2.DELTA.M2-2 in
comparison with rA2 was performed in Vero cells. Cells grown in
6-cm dishes were infected with rA2 or rA2.DELTA.NS2.DELTA.M2-2 at a
moi of 0.2. As seen in FIG. 24, rA2.DELTA.NS2.DELTA.M2-2 showed
very slow growth kinetics and its peak titer was about 10-fold
lower than that of rA2. To analyze virus replication in different
host cells, each cell line grown in 6-well plates was infected with
rA2.DELTA.NS2.DELTA.M2-2 or rA2 at moi of 0.2. Three days
postinfection, the culture supernatants were collected and virus
was quantitated by plaque assay. rA2.DELTA.NS2.DELTA.M2-2 had about
a few fold reduction in virus titer compared to rA2 in Vero cells.
However, a 2-3 log reduction in virus titer was observed in Hep-2,
MDBK, Hela, MRC5 and LLC-MK2 cells (Table 12). Therefore,
replication of rA2.DELTA.NS2.DELTA.M2-2 exhibits a substantial host
range effect, which is an indication of attenuation.
TABLE-US-00015 TABLE 12 Growth comparison of rA2.DELTA.NS2/M2-2 and
rA2 in different cell lines Virus titer [log.sub.10 (pfu/ml)] Cell
lines rA2 rA2.DELTA.NS2/M2-2 Vero 6.4 5.7 Hep-2 6.7 3.5 MDBK 6.7
3.7 MRC-5 5.9 2.0 Hela 6.5 2.9 LLC-MK2 6.7 4.8
[0286] Replication of rA2.DELTA.NS2/M2-2 in vivo was determined in
respiratory pathogen-free 4-week old cotton rats. Cotton rats in
groups of 5 were inoculated intranasally under light methoxyflurane
anesthesia with 10.sup.5 pfu per animal in a 0.1-ml inoculum of rA2
or rA2 .DELTA.NS2.DELTA.M2-2. On day 4 postinoculation, animals
were sacrificed by CO.sub.2 asphyxiation and their nasal turbinates
and lungs were obtained separately. Tissues were homogenized and
virus titers were determined by plaque assay in Vero cells. As
shown in Table 13, no virus replication was detected in the upper
and lower respiratory tracts of cotton rats that were infected with
rA2 .DELTA.NS2.DELTA.M2-2. This indicated that deletion of the NS2
and M2-2 genes severely attenuated RSV. Thus, this recombinant RSV
with an NS2 and M2-2 deletion might serve as a good vaccine
candidate for human use.
TABLE-US-00016 TABLE 13 Replication of rA2.DELTA.NS2/M2-2 and rA2
in cotton rats Virus titer (mean log.sub.10 pfu/g tissue .+-. SE)
Virus Nasal turbinates Lung rA2 2.30 .+-. 0.26 4.23 .+-. 0.10
rA2.DELTA.NS2/M2-2 <1.4 <1.4 .sup.aGroups of five cotton rats
were immunized intranasally with 10.sup.5 pfu of the indicated
virus on day 0. The level of infected virus replication at day 4
was determined by plaque assay on indicated specimens, and the mean
log.sub.10 titer .+-. standard error (SE) per gram tissue were
determined.
[0287] 11.8 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS1 and NS2 Genes
[0288] This example describes production of a recombinant RSV in
which expression of two RSV genes, NS1 and NS2, has been ablated by
removal of polynucleotide sequences encoding the NS1 and NS2 genes
and their encoded proteins. As described earlier, NS1 or NS2 gene
is dispensable for RSV replication in vitro. It is possible that
deletion of two accessory genes from RSV will produce a recombinant
RSV with alternative attenuation phenotype.
[0289] To delete the NS1 and NS2 gene from RSV, two restriction
enzyme sites were inserted at positions of the gene start signal of
NS1 and downstream of the gene end signal of NS2. A two step
cloning procedure was performed to delete the entire NS1 and NS2
genes from RSV. A PstI restriction enzyme site was introduced at
position of 45 nt and at position of 1110 nt of RSV sequence by
site-directed mutagenesis. Site-directed mutagenesis was performed
in pET(X/A) cDNA subclone, which contained the first 2128
nucleotides of RSV sequence that encode the NS1, NS2 and part of
the N gene of RSV. The 2128 nucleotide RSV cDNA fragment was cloned
into the pET vector through the Xma I and Avr II restriction sites.
Digestion of pET(X/A) plasmid that contained the introduced two Pst
I restriction enzyme sites removed a 1065-nt fragment that included
the NS1 and NS2 genes. pET(X/S) plasmid containing NS1 and NS2
deletion was digested with Avr II and Sac I restriction enzymes and
the remaining 1063 nucleotide RSV cDNA fragment was then cloned
into a full length RSV antigenomic cDNA clone. The resulting
plasmid that contained deletion of both NS1 and NS2 was designated
pA2 .DELTA.NS1.DELTA.NS2. Deletion of NS1 and NS2 in
pA2.DELTA.NS1.DELTA.NS2 plasmid was confirmed by restriction enzyme
mapping.
[0290] Recovery of infectious RSV that contained both NS1 and NS2
deletion (rA2 .DELTA.NS1.DELTA.NS2) was performed as described
earlier. Infectious virus with both NS1 and NS2 deleted was
obtained from transfected Hep-2 cells. RT/PCR was performed to
confirm that both NS1 and NS2 genes were deleted from
rA2.DELTA.NS1.DELTA.NS2 using a pair of primers flanking the NS1
and NS2 genes. Deletion of NS1 and NS2 from rA2.DELTA.NS1.DELTA.NS2
was further confirmed by Northern blot. As shown in FIG. 18,
neither NS1 nor NS2 mRNAs was detected in cells infected with
rA2.DELTA.NS1 .DELTA.NS2 using a riboprobe specific to the NS1 or
NS2 gene. This indicated that expression of NS1 and NS2 was ablated
from rA2.DELTA.NS1.DELTA.NS2.
[0291] rA2.DELTA.NS1.DELTA.NS2 formed very small plaques in
infected Hep-2 cells, but only slight plaque size reduction was
seen in Vero cells (FIG. 19). The small plaque phenotype is
commonly associated with attenuating mutations.
[0292] A growth kinetics study of rA2.DELTA.NS1.DELTA.NS2 in
comparison with rA2 was performed in Vero cells. Cells grown in
6-cm dishes were infected with rA2 or rA2.DELTA.NS1.DELTA.NS2 at a
moi of 0.2. As seen in FIG. 25, rA2.DELTA.NS1.DELTA.NS2 exhibited
slower growth kinetics and its peak titer was about 5-fold lower
than that of rA2. To analyze virus replication in different host
cells, each cell line grown in 6-well plates was infected with
rA2.DELTA.NS1.DELTA.NS2 or rA2 at moi of 0.2. Three days
postinfection, the culture supernatants were collected and virus
was quantitated by plaque assay. rA2.DELTA.NS1.DELTA.NS2 had only
slight reduction in virus titer compared to rA2 in Vero cells.
About 1.5 log reduction in virus titer was observed in Hep-2, MDBK
and LLC-MK2 cells. More reduction in virus (about 3 log) was seen
in Hela and MRC5 cells (Table 14). Replication of rA2 .DELTA.NS1
.DELTA.NS2 in a small animal model is currently being investigated.
Preliminary data indicated that rA2.DELTA.NS1.DELTA.NS2 is
attenuated in cotton rats. As replication of rA2
.DELTA.NS1.DELTA.NS2 was not detected in cotton rats, it appears
that the rA2.DELTA.NS1.DELTA.NS2 deletion mutant is very
attenuated. The NS1 and NS2 deletion mutant therefore provides an
alternative method for attenuating RSV.
TABLE-US-00017 TABLE 14 Growth comparison of
rA2.DELTA.NS1.DELTA.NS2 and rA2 in different cell lines Virus titer
[log.sub.10 (pfu/ml)] Cell lines rA2 rA2.DELTA.NS1.DELTA.NS2 Vero
6.4 6.2 Hep-2 6.7 5.1 MDBK 6.7 5.2 MRC-5 5.9 3.1 Hela 6.5 3.8
LLC-MK2 6.7 5.1
[0293] 11.9 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS1 and SH Genes
[0294] This example describes production of a recombinant RSV in
which expression of two different RSV genes, NS1 and SH, has been
ablated by removal of polynucleotide sequences encoding the NS1 and
SH genes and their encoded proteins. As described earlier, NS1 or
SH genes is dispensable for RSV replication in vitro. It is
possible that deletion of two accessory genes from RSV will produce
a recombinant RSV with increased attenuation phenotype.
[0295] NS1 and SH genes were deleted from the full-length RSV cDNA
construct through cDNA cloning. A Xma Ito Avr II fragment that
contained NS1 deletion in pET(X/A) subclone was removed by
digestion with Xma I and Avr II restriction enzymes and was cloned
into the full-length RSV antigenomic cDNA clone that contained the
SH gene deletion (pA2 SH). The resulting plasmid that contained
deletion ofboth NS1 and SH was designated pA2.DELTA.NS1.DELTA.SH.
Deletion of NS1 and SH in pA2.DELTA.NS1.DELTA.SH plasmid was
confirmed by restriction enzyme mapping.
[0296] Recovery of infectious RSV that contained both NS1 and SH
deletion (rA2.DELTA.NS1.DELTA.SH) was performed as described
earlier. Infectious virus with both NS1 and SH deleted was obtained
from transfected Hep-2 cells. Virus was plaque purified 3 times and
amplified in Vero cells. Deletion of both the NS1 and SH genes in
rA2.DELTA.NS1.DELTA.SH was confirmed by RT/PCR using two sets of
primers that flanked the NS1 or SH gene, respectively. Northern
blot of rA2.DELTA.NS1.DELTA.SH infected total cellular RNA was
performed using a riboprobe specific to the NS1 or SH gene. As
shown in FIG. 23, expression of NS1 and SH mRNA was ablated in
cells infected with rA2.DELTA.NS l.DELTA.SH.
[0297] Replication of rA2.DELTA.NS1.DELTA.SH in vitro and in vivo
is currently being studied. The fact that the rA2.DELTA.NS1
.DELTA.SH virus can grow, albeit with reduced efficiency, indicates
that the NS1 and SH genes are dispensable for RSV replication. This
mutant will therefore likely serve as an additional potential
recombinant RSV vaccine agent.
[0298] 11.10 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS2 and SH Genes
[0299] This example describes production of a recombinant RSV in
which expression of two different RSV genes, NS2 and SH, has been
ablated by removal of polynucleotide sequences encoding the NS2 and
SH genes and their encoded proteins. As described earlier, NS2 or
SH gene is dispensable for RSV replication in vitro. It is possible
that deletion of two accessory genes from RSV will produce a
recombinant RSV with different attenuation phenotype.
[0300] NS2 and SH genes were deleted from the full-length RSV cDNA
construct through cDNA cloning. A Xma Ito Avr II fragment that
contained NS2 deletion in pET(X/A) subclone was removed by
digestion with Xma I and Avr II restriction enzymes and was cloned
into the full-length RSV antigenomic cDNA clone that contained the
SH gene deletion (pA2.DELTA.SH). The resulting plasmid that
contained deletion of both NS2 and SH was designated
pA2.DELTA.NS2.DELTA.SH. Deletion of NS2 and SH in
pA2.DELTA.NS2.DELTA.SH plasmid was confirmed by restriction enzyme
mapping.
[0301] Recovery of infectious RSV that contained both NS2 and SH
deletion (rA2.DELTA.NS2.DELTA.SH) was performed as described
earlier. Infectious virus with both NS2 and SH deleted was obtained
from transfected Hep-2 cells. Virus was plaque purified 3 times and
amplified in Vero cells. Deletion of both NS2 and SH gene in
rA2.DELTA.NS2.DELTA.SH was confirmed by RT/PCR using two sets of
primers that flanked the NS2 or SH gene, respectively. Northern
blot of rA2.DELTA.NS2.DELTA.SH infected total cellular RNA was
performed using a riboprobe specific to the NS2 or SH gene. As
shown in FIG. 23, expression of NS2 and SH mRNA was ablated in
cells infected with rA2 .DELTA.NS2.DELTA.SH.
[0302] Replication of rA2.DELTA.NS2.DELTA.SH in vivo was determined
in respiratory pathogen-free 4-week old cotton rats. Cotton rats in
groups of 5 were inoculated intranasally under light methoxyflurane
anesthesia with 10.sup.5 pfu per animal in a 0.1-ml inoculum of rA2
or rA2.DELTA.NS2.DELTA.SH. On day 4 postinoculation, animals were
sacrificed by CO.sub.2 asphyxiation and their nasal trubinates and
lungs were obtained separately. Tissues were homogenized and virus
titers were determined by plaque assay in Vero cells. As shown in
Table 15, reduced virus replication was observed in the upper and
lower respiratory tracts of cotton rats that were infected with
rA2.DELTA.NS2.DELTA.SH. This indicated that deletion of the NS2 and
SH genes attenuated RSV and this recombinant RSV with NS2 and SH
deletion might serve as a good vaccine candidate for human use.
TABLE-US-00018 TABLE 15 Replication of rA2.DELTA.NS2.DELTA.SH and
rA2 in cotton rats Virus titer (mean log.sub.10 pfu/g tissue .+-.
SE) Virus Nasal turbinats Lung rA2 2.30 .+-. 0.26 4.23 .+-. 0.10
rA2.DELTA.NS2.DELTA.SH 1.11 .+-. 1.34 2.76 .+-. 0.06 .sup.aGroups
of five cotton rats were immunized intranasally with 10.sup.6 pfu
of the indicated virus on day 0. The level of infected virus
replication at day 4 was determined by plaque assay on indicated
specimens, and the mean log.sub.10 titer .+-. standard error (SE)
per gram tissue were determined.
[0303] 11.11 Generation of a Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Deleting the Viral NS1, NS2, and SH
Genes
[0304] This example describes production of a recombinant RSV in
which expression of three RSV genes, NS1, NS2 and SH, has been
ablated by removal of polynucleotide sequences encoding three RSV
genes (NS1, NS2 and SH) and their encoded proteins. As described
earlier, NS1, NS2 or SH alone is dispensable for RSV replication in
vitro. It is possible that deletion of three accessory genes from
RSV will produce a recombinant RSV with a different attenuation
phenotype.
[0305] NS1, NS2 and SH genes were deleted from the full-length RSV
cDNA construct through cDNA cloning. A Xma I to Avr II fragment
that contained NS1 and NS2 deletion in pET(X/A) subclone as
described earlier was removed by digestion with Xma I and Avr II
restriction enzymes and was cloned into the full-length RSV
antigenomic cDNA clone that contained the SH gene deletion
(pA2.DELTA.SH). The resulting plasmid that contained deletion of
three genes (NS1, NS2 and SH) was designated
pA2.DELTA.NS1.DELTA.NS2.DELTA.SH. Deletion of NS1, NS2 and SH in
pA2.DELTA.NS1.DELTA.NS2.DELTA.SH plasmid was confirmed by
restriction enzyme mapping.
[0306] Recovery of infectious RSV that contained three genes
deletion (NS1, NS2 and SH), rA2.DELTA.NS1.DELTA.NS2.DELTA.SH, was
performed as described earlier. Infectious virus was obtained from
transfected Hep-2 cells. Virus was plaque purified 3 times and
amplified in Vero cells. Deletion of NS1, NS2 and SH genes in
rA2.DELTA.NS1.DELTA.NS2.DELTA.SH was confirmed by RT/PCR using two
sets of primers that flanked the NS1 and NS2 genes or the SH gene,
respectively. Northern blot of infected total cellular RNA of
rA2.DELTA.NS1.DELTA.NS2.DELTA.SH was performed using a riboprobe
specific to the NS1, NS2 or SH gene. As shown in FIG. 23,
expression of NS1, NS2 and SH mRNA was ablated in cells infected
with rA2.DELTA.NS1.DELTA.NS2.DELTA.SH. This indicated that these
three genes were indeed deleted from RSV.
[0307] Replication of rA2.DELTA.NS 1.DELTA.NS2.DELTA.SH in vivo was
determined in respiratory pathogen-free 4-week old cotton rats.
Cotton rats in groups of 5 were inoculated intranasally under light
methoxyflurane anesthesia with 10.sup.5 pfu per animal in a 0.1-ml
inoculum of rA2 or rA2.DELTA.NS1.DELTA.NS2.DELTA.SH. On day 4
postinoculation, animals were sacrificed by CO.sub.2 asphyxiation
and their nasal turbinates and lungs were obtained separately.
Tissues were homogenized and virus titers were determined by plaque
assay in Vero cells. As shown in Table 16, no virus replication was
observed in the upper and lower respiratory tracts of cotton rats
that were infected with rA2.DELTA.NS1.DELTA.NS2.DELTA.SH. This
indicated that deletion of the NS2 and SH genes attenuated RSV and
this recombinant RSV with NS2 and M2-2 deletion might serve as a
good vaccine candidate for human use.
TABLE-US-00019 TABLE 16 Replication of
rA2.DELTA.NS1.DELTA.NS2.DELTA.SH and rA2 in cotton rats Virus titer
(mean log.sub.10 pfu/g tissue .+-. SE) Virus Nasal turbinates Lung
rA2 2.30 .+-. 0.26 4.23 .+-. 0.10 rA2.DELTA.NS1.DELTA.NS2.DELTA.SH
<1.4 <1.4 .sup.aGroups of five cotton rats were immunized
intranasally with 10.sup.5 pfu of the indicated virus on day 0. The
level of infected virus replication at day 4 was determined by
plaque assay on indicated specimens, and the mean log.sub.10 titer
.+-. standard error (SE) per gram tissue were determined.
[0308] In conclusion, 11 different gene deletion mutants have been
obtained as summarized in Table 17. Four RSV accessory genes have
been deleted either individually or in combination. These different
deletion mutants showed different plaque formation and growth
properties. A good correlation was demonstrated between plaque size
in vitro and attenuation in vivo. These different RSV deletion
mutants provide several choices for use as potential RSV vaccine
candidates.
TABLE-US-00020 TABLE 17 Summary of RSV gene deletion mutants Virus
Recovered .DELTA.M2-2 Yes .DELTA.SH Yes .DELTA.NS1 Yes .DELTA.NS2
Yes .DELTA.M2-2.DELTA.SH Yes .DELTA.M2-2.DELTA.NS1 Yes
.DELTA.M2-2.DELTA.NS2 Yes .DELTA.NS1.DELTA.NS2 Yes
.DELTA.SH.DELTA.NS1 Yes .DELTA.SH.DELTA.NS2 Yes
.DELTA.SH.DELTA.NS1.DELTA.NS2 Yes
12. EXAMPLE
Generation of an Attenuated Human Respiratory Syncytial Virus
Vaccine (RSV) Candidate by Mutagenesis of the Viral M2-1 Gene
Rationale
[0309] The ability to generate infectious RSV from cDNA allows
defined changes to be introduced into the RSV genome. The phenotype
of the rescued viruses can be directly attributed to the engineered
changes in the genome. Changes in the virus genome can be easily
verified by sequencing the region in which mutations are
introduced. Different point mutations and lesions can be combined
in a single virus to create suitably attenuated and genetically
stable RSV vaccine candidates. The RSV genome encodes several
auxiliary proteins: NS1, NS2, SH, M2-1 and M2-2 proteins that do
not have counterparts in other paramyxoviruses. The function of
these genes in the viral life cycle is the subject of ongoing
investigations.
[0310] The product of the M2-1 gene is a 22 kDa protein which has
been shown to promote processive sequential transcription and
antitermination of transcription at each gene junction of the RSV
genome in vitro (Collins, P. L. et al. Proc. Natl. Acad. Sci. USA
93, 81-85 (1996); Hardy, R. W. et al. J. Virol. 72, 520-526
(1998)). M2-1 is also thought to be a structural component of the
viral nucleocapsid and interaction of M2-1 with the N protein has
been observed in RSV infected cells (Garcia et al. Virology
195:243-247 (1993)). The M2-1 protein contains a putative zinc
binding motif (Cys3H is motif) at its N-terminus (Worthington et
al., 1996, Proc. Natl. Acad. Sci. 93:13754-13759). This motif is
highly conserved throughout the pneumovirus genus.
[0311] Two mutagenesis strategies are presented here to introduce
mutations in the M2-1 protein. The first method involves changing
each of the cysteine residues individually to glycine (cysteine
scanning mutagenesis). The second method involves engineering
premature stop codons at the carboxyl terminus of the protein to
produce truncated M2-1 proteins of various length. These strategies
provide different approaches to making attenuated RSV for use as
live vaccines.
[0312] 12.1 Cysteine Scanning Mutagenesis of M2-1
[0313] Four cysteine residues are present in the M2-1 protein at
amino acid positions 7, 15, 21 and 96. Cys7, Cys15 and Cys21 i.e.,
in the putative zinc binding motif, the Cys3His motif. DNA
oligonucleotides were designed to change these cysteine codons to
that for glycine by Quickchange site-directed mutagenesis
(Stratagene). Mutagenesis was performed using a cDNA subclone
(pET-S/B) that contained nucleotide 4482 to nucleotide 8505 of the
RSV genome. The oligonucleotides corresponding to the positive
sense of the RSV genome used for the mutagenesis reactions are
listed in Table 18.
[0314] The engineered changes in the pET-S/B RSV subclone were
verified by DNA sequence analysis. Each Sac I to Bam HI restriction
fragment that contained the mutated cysteine codon in M2-1 was
individually cloned into an infectious RSV antigenomic cDNA clone
that was derived from RSV strain A2 (Jin, H. et al. Virology 251,
206-214 (1998)). The full-length RSV antigenomic cDNA clone with an
engineered cysteine to glycine codon change was designated pA2MC1,
2, 3, or 4.
TABLE-US-00021 TABLE 18 Primers used for changing each cysteine
codon in the M2-1 gene.sup.a Position in Primer RSV antigenome
Sequence MC1 nt 7609-7641 5'TCACGAAGGAATCCTGGCAAATTTGAA ATTCGA MC2
nt 7633-7665 5'GAAATTCGAGGTCATGGTTTAAATGGT AAGAGG MC3 nt 7648-7683
5'TGCTTAAATGGTAAGAGGGGACATTTT AGTCATAAT MC4 nt 7876-7908
5'ACTAAACAATCAGCAGGTGTTGCCATG AGCAAA .sup.aThe numbers correspond
to nucleotides in the RSV antigenome. Nucleotides that were mutated
to change cysteine codons to glycine codons are in bold and
underlined.
[0315] To produce infectious RSV that contained an individual
cysteine mutation in M2-1, pA2MC1, 2, 3, or 4 was transfected into
cells that expressed the T7 RNA polymerase together with plasmids
that expressed the N, P and L protein. Briefly, monolayers of Hep-2
cells in 6 well dishes at a confluency of 70-80% were infected with
modified vaccinia virus that expressed the T7 RNA polymerase (MVA)
at a moi of 5. Absorption of MVA was performed at room temperature
for 1 hour. The infected cells were washed with OPTI-MEM (Life
Technologies) and transfected with pA2MC1, pA2MC2, pA2MC3 or pA2MC4
antigenomic plasmids together with a mixture of plasmids encoding
the RSV N, P and L proteins each under the control of the T7
promoter. The amount of plasmids used for each transfection are:
0.5 .mu.g antigenome plasmid, 0.4 .mu.g N plasmid, 0.4 .mu.g P
plasmid and 0.2 .mu.g L plasmid in a final volume of 0.1 ml
OPTI-MEM. The final plasmid mixture was combined with 0.1 ml
OPTI-MEM containing 10 .mu.l lipofecTACE (Life Technologies). After
15 minutes incubation at room temperature, the transfection mixture
was added to the MVA infected cells. The transfection reaction was
incubation at 33.degree. C. for 5 hours. After 5 hours, the
transfection medium was removed and replaced with MEM supplemented
with 2% fetal bovine serum and incubated at 33.degree. C. for 3
days. Following the 3-day incubation, medium was harvested and
passaged in Vero cells for 6 days. Positive immunostaining of the
infected cell monolayers using goat anti-RSV antibody (Biogenesis)
was then used to identify wells containing successfully rescued
viruses. RT/PCR of genomic viral RNA was performed to verify that
the engineered changes were present in the rescued viruses. A
recombinant RSV bearing the introduced cysteine change at position
of 96, rA2C4 was obtained. Replication in vitro and in an animal
model of rA2C4 is currently being studied. Preliminary results
indicated that rA2C4 showed reduced plaque size at 35.degree. C.
and is therefore probably attenuated. Preliminary results indicated
that rA2C4 has about a 10-fold reduction in replication of the
lungs of cotton rats (See Table 19). Recovery of rA2C1, rA2C2 and
rA2C3 are currently being pursued. It is quite possible that
changes in any of the three cysteine residues in the putative zinc
binding motif may prove to be lethal to the M2-1 protein.
TABLE-US-00022 TABLE 19 Replication of M2-1 mutants in cotton rats
Virus titer (mean log.sub.10 pfu/g tissue .+-. SE) Virus Lung rA2
3.55 .+-. 0.07 RA2C4 2.29 .+-. 0.13 rA2MSCH3 1.97 .+-. 0.18
.sup.aGroups of five cotton rats were immunized intranasally with
10.sup.5 pfu of the indicated virus on day 0. The level of infected
virus replication at day 4 was determined by plaque assay on the
indicated specimens, and the mean log.sub.10 titer .+-. standard
error (SE) per gram tissue was determined.
[0316] 12.2 C-Terminal Truncations of the M2-1 Protein
[0317] Tandem termination codons were introduced at the C-terminus
of the M2-1 protein by site-directed mutagenesis in order to create
progressively longer truncations from the C-terminal end of the
M2-1 protein. Mutagenesis was performed using a cDNA subclone
(pET-S/B) that contained RSV sequences from nucleotide 4482 to
nucleotide 8505. Oligonucleotides corresponding to the positive
sense of the RSV genome that were used for creating premature
tandem termination codons in M2-1 are listed in Table 20.
[0318] The engineered changes were verified by sequence analysis of
the RSV subclone containing the introduced mutations. The Sac I to
Bam HI restriction fragment containing the premature tandem
termination codons in M2-1 was excised from RSV subclone pET-S/B
and introduced into the fall length infectious RSV antigenomic cDNA
clone (Jin et al., 1998). Each reassembled full-length RSV
antigenomic cDNA containing the engineered premature tandem
termination codons along with a unique Hind III site was designated
pA2MCSCH1, pA2MSCH 2 or pA2MSCH3.
TABLE-US-00023 TABLE 20 Primers used to introduce tandem
termination codons in the C-terminus of the M2-1 protein Position
in Primer RSV antigenome Sequence.sup.a MSCH1 nt 7960-8011
5'GAGCTAAATTCACCCAAGATAAGCTTG TAATAAACTGTCATATCATATATTG MSCH2 nt
8035-8076 5'CAAACTATCCATCTGTAATAAAGCTTG CCAGCAGACGTATTG MSCH3 nt
8120-8169 5'CCATCAACAACCCAAAATAATAAAGCT TTAGTGATACAAATGACCATGCC
.sup.aThe numbers correspond to nucleotides in the RSV antigenome.
Tandem stop codons are indicated in bold. Mutated nucleotides are
underlined and unique Hind III sites introduced simultaneously with
the tandem stop codon are shown in italics.
[0319] Recombinant RSV that contained deletion in the C-terminal of
the M2-1 protein was generated by transfection of pA2MCSCH1,
pA2MSCH2 or pA2MSCH3 together with plasmids expressing the N, P and
L proteins as described above. Recovery of infectious RSV that
contained the shortest deletion in the C-terminus of the M2-1
protein, derived from pA2MSCH3 has been obtained. This virus had a
17 amino acid truncation at the C-terminus of M2-1 because of the
engineered two tandem stop codons at amino acid 178 and 179. Virus
plaque purification, amplification and verification of the
engineered tandem termination codons in rA2MSCH3 are currently
being performed. The rescue of recombinant RSV containing longer
deletions in the C-terminus of the M2-1 protein is also being
pursued. Preliminary results indicate that rA2MSCH3 has about a
15-fold reduction in replication of the lungs of cotton rats (See
Table 19). Viable M2-1 deletion mutants provide an alternative
method to attenuating RSV by itself or in combination with other
mutations in the RSV genome for vaccine use.
[0320] The present invention is not to be limited in scope by the
specific embodiments described which are intended as single
illustrations of individual aspects of the invention, and any
constructs, viruses or enzymes which are functionally equivalent
are within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown and
described herein will become apparent to those skilled in the art
from the foregoing description and accompanying drawings. Such
modifications are intended to fall within the scope of the appended
claims.
[0321] Various publications are cited herein, the disclosures of
which are incorporated herein by reference in their entireties.
Sequence CWU 1
1
62146DNAArtificial SequenceOligonucleotide 1cgacgcatat tacgcgaaaa
aatgcgtaca acaaacttgc ataaac 46250DNAArtificial
SequenceOligonucleotide 2caaaaaaatg gggcaaataa gaatttgata
agtaccactt aaatttaact 50324DNAArtificial SequenceOligonucleotide
3ctagagttaa atttaagtgg tact 24450DNAArtificial
SequenceOligonucleotide 4tatcaaattc ttatttgccc catttttttg
gtttatgcaa gtttgttgta 50530DNAArtificial SequenceOligonucleotide
5cgcatttttt cgcgtaatat gcgtcggtac 30650DNAArtificial
SequenceOligonucleotide 6gtattcaatt atagttatta aaaattaaaa
atcatataat tttttaaata 50750DNAArtificial SequenceOligonucleotide
7acttttagtg aactaatcct aaagttatca ttttaatctt ggaggaataa
50850DNAArtificial SequenceOligonucleotide 8atttaaaccc taatctaatt
ggtttatatg tgtattaact aaattacgag 50946DNAArtificial
SequenceOligonucleotide 9atattagttt ttgacacttt ttttctcgtt
atagtgagtc gtatta 461025DNAArtificial SequenceOligonucleotide
10agcttaatac gactcactat aacga 251150DNAArtificial
SequenceOligonucleotide 11gaaaaaaagt gtcaaaaact aatatctcgt
aatttagtta atacacatat 501250DNAArtificial SequenceOligonucleotide
12aaaccaatta gattagggtt taaatttatt cctccaagat taaaatgata
501350DNAArtificial SequenceOligonucleotide 13actttaggat tagttcacta
aaagttattt aaaaaattat atgattttta 501429DNAArtificial
SequenceOligonucleotide 14atttttaata actataattg aatactgca
291517DNAArtificial SequencePrimer 15gtttaacacg tggtgag
171617DNAArtificial SequencePrimer 16acatataggc atgcacc
171717DNAArtificial SequencePrimer 17gcaaaatgga tcccatt
171818DNAArtificial SequencePrimer 18tggttggtat accagtgt
181918DNAArtificial SequencePrimer 19taccaagagc tcgagtca
182021DNAArtificial SequencePrimer 20ggtggccggc atggtcccag c
212120DNAArtificial SequencePrimer 21tttaccatat gcgctaatgt
202219DNAArtificial SequencePrimer 22acgcgaaaaa atgcgtaca
192318DNAArtificial SequencePrimer 23acgagaaaaa agtggcaa
182417DNAArtificial SequencePrimer 24ctcaccacgt gttaaac
172517DNAArtificial SequencePrimer 25ggtgcatgcc tatatgt
172619DNAArtificial SequencePrimer 26aatgggatcc attttgtcc
192719DNAArtificial SequencePrimer 27aacactggta taccaacca
192820DNAArtificial SequencePrimer 28acattagcgc atatggtaaa
20292165PRTVirus 29Met Asp Pro Ile Ile Asn Gly Asn Ser Ala Asn Val
Tyr Leu Thr Asp1 5 10 15Ser Tyr Leu Lys Gly Val Ile Ser Phe Ser Glu
Cys Asn Ala Leu Gly 20 25 30Ser Tyr Ile Phe Asn Gly Pro Tyr Leu Lys
Asn Asp Tyr Thr Asn Leu 35 40 45Ile Ser Arg Gln Asn Pro Leu Ile Glu
His Met Asn Leu Lys Lys Leu 50 55 60Asn Ile Thr Gln Ser Leu Ile Ser
Lys Tyr His Lys Gly Glu Ile Lys65 70 75 80Leu Glu Glu Pro Thr Tyr
Phe Gln Ser Leu Leu Met Thr Tyr Lys Ser 85 90 95Met Thr Ser Ser Glu
Gln Ile Ala Thr Thr Asn Leu Leu Lys Lys Ile 100 105 110Ile Arg Arg
Ala Ile Glu Ile Ser Asp Val Lys Val Tyr Ala Ile Leu 115 120 125Asn
Lys Leu Gly Leu Lys Glu Lys Asp Lys Ile Lys Ser Asn Asn Gly 130 135
140Gln Asp Glu Asp Asn Ser Val Ile Thr Thr Ile Ile Lys Asp Asp
Ile145 150 155 160Leu Ser Ala Val Lys Asp Asn Gln Ser His Leu Lys
Ala Asp Lys Asn 165 170 175His Ser Thr Lys Gln Lys Asp Thr Ile Lys
Thr Thr Leu Leu Lys Lys 180 185 190Leu Met Cys Ser Met Gln His Pro
Pro Ser Trp Leu Ile His Trp Phe 195 200 205Asn Leu Tyr Thr Lys Leu
Asn Asn Ile Leu Thr Gln Tyr Arg Ser Asn 210 215 220Glu Val Lys Asn
His Gly Phe Thr Leu Ile Asp Asn Gln Thr Leu Ser225 230 235 240Gly
Phe Gln Phe Ile Leu Asn Gln Tyr Gly Cys Ile Val Tyr His Lys 245 250
255Glu Leu Lys Arg Ile Thr Val Thr Thr Tyr Asn Gln Phe Leu Thr Trp
260 265 270Lys Asp Ile Ser Leu Ser Arg Leu Asn Val Cys Leu Ile Thr
Trp Ile 275 280 285Ser Asn Cys Leu Asn Thr Leu Asn Lys Ser Leu Gly
Leu Arg Cys Gly 290 295 300Phe Asn Asn Val Ile Leu Thr Gln Leu Phe
Leu Tyr Gly Asp Cys Ile305 310 315 320Leu Lys Leu Phe His Asn Glu
Gly Phe Tyr Ile Ile Lys Glu Val Glu 325 330 335Gly Phe Ile Met Ser
Leu Ile Leu Asn Ile Thr Glu Glu Asp Gln Phe 340 345 350Arg Lys Arg
Phe Tyr Asn Ser Met Leu Asn Asn Ile Thr Asp Ala Ala 355 360 365Asn
Lys Ala Gln Lys Asn Leu Leu Ser Arg Val Cys His Thr Leu Leu 370 375
380Asp Lys Thr Val Ser Asp Asn Ile Ile Asn Gly Arg Trp Ile Ile
Leu385 390 395 400Leu Ser Lys Phe Leu Lys Leu Ile Lys Leu Ala Gly
Asp Asn Asn Leu 405 410 415Asn Asn Leu Ser Glu Leu Tyr Phe Leu Phe
Arg Ile Phe Gly His Pro 420 425 430Met Val Asp Glu Arg Gln Ala Met
Asp Ala Val Lys Ile Asn Cys Asn 435 440 445Glu Thr Lys Phe Tyr Leu
Leu Ser Ser Leu Ser Met Leu Arg Gly Ala 450 455 460Phe Ile Tyr Arg
Ile Ile Lys Gly Phe Val Asn Asn Tyr Asn Arg Trp465 470 475 480Pro
Thr Leu Arg Asn Ala Ile Val Leu Pro Leu Arg Trp Leu Thr Tyr 485 490
495Tyr Lys Leu Asn Thr Tyr Pro Ser Leu Leu Glu Leu Thr Glu Arg Asp
500 505 510Leu Ile Val Leu Ser Gly Leu Arg Phe Tyr Arg Glu Phe Arg
Leu Pro 515 520 525Lys Lys Val Asp Leu Glu Met Ile Ile Asn Asp Lys
Ala Ile Ser Pro 530 535 540Pro Lys Asn Leu Ile Trp Thr Ser Phe Pro
Arg Asn Tyr Met Pro Ser545 550 555 560His Ile Gln Asn Tyr Ile Glu
His Glu Lys Leu Lys Phe Ser Glu Ser 565 570 575Asp Lys Ser Arg Arg
Val Leu Glu Tyr Tyr Leu Arg Asp Asn Lys Phe 580 585 590Asn Glu Cys
Asp Leu Tyr Asn Cys Val Val Asn Gln Ser Tyr Leu Asn 595 600 605Asn
Pro Asn His Val Val Ser Leu Thr Gly Lys Glu Arg Glu Leu Ser 610 615
620Val Gly Arg Met Phe Ala Met Gln Pro Gly Met Phe Arg Gln Val
Gln625 630 635 640Ile Leu Ala Glu Lys Met Ile Ala Glu Asn Ile Leu
Gln Phe Phe Pro 645 650 655Glu Ser Leu Thr Arg Tyr Gly Asp Leu Glu
Leu Gln Lys Ile Leu Glu 660 665 670Leu Lys Ala Gly Ile Ser Asn Lys
Ser Asn Arg Tyr Asn Asp Asn Tyr 675 680 685Asn Asn Tyr Ile Ser Lys
Cys Ser Ile Ile Thr Asp Leu Ser Lys Phe 690 695 700Asn Gln Ala Phe
Arg Tyr Glu Thr Ser Cys Ile Cys Ser Asp Val Leu705 710 715 720Asp
Glu Leu His Gly Val Gln Ser Leu Phe Ser Trp Leu His Leu Thr 725 730
735Ile Pro His Val Thr Ile Ile Cys Thr Tyr Arg His Ala Pro Pro Tyr
740 745 750Ile Gly Asp His Ile Val Asp Leu Asn Asn Val Asp Glu Gln
Ser Gly 755 760 765Leu Tyr Arg Tyr His Met Gly Gly Ile Glu Gly Trp
Cys Gln Lys Leu 770 775 780Trp Thr Ile Glu Ala Ile Ser Leu Leu Asp
Leu Ile Ser Leu Lys Gly785 790 795 800Lys Phe Ser Ile Thr Ala Leu
Ile Asn Gly Asp Asn Gln Ser Ile Asp 805 810 815Ile Ser Lys Pro Ile
Arg Leu Met Glu Gly Gln Thr His Ala Gln Ala 820 825 830Asp Tyr Leu
Leu Ala Leu Asn Ser Leu Lys Leu Leu Tyr Lys Glu Tyr 835 840 845Ala
Gly Ile Gly His Lys Leu Lys Gly Thr Glu Thr Tyr Ile Ser Arg 850 855
860Asp Met Gln Phe Met Ser Lys Thr Ile Gln His Asn Gly Val Tyr
Tyr865 870 875 880Pro Ala Ser Ile Lys Lys Val Leu Arg Val Gly Pro
Trp Ile Asn Thr 885 890 895Ile Leu Asp Asp Phe Lys Val Ser Leu Glu
Ser Ile Gly Ser Leu Thr 900 905 910Gln Glu Leu Glu Tyr Arg Gly Glu
Ser Leu Leu Cys Ser Leu Ile Phe 915 920 925Arg Asn Val Trp Leu Tyr
Asn Gln Ile Ala Leu Gln Leu Lys Asn His 930 935 940Ala Leu Cys Asn
Asn Lys Leu Tyr Leu Asp Ile Leu Lys Val Leu Lys945 950 955 960His
Leu Lys Thr Phe Phe Asn Leu Asp Asn Ile Asp Thr Ala Leu Thr 965 970
975Leu Tyr Met Asn Leu Pro Met Leu Phe Gly Gly Gly Asp Pro Asn Leu
980 985 990Leu Tyr Arg Ser Phe Tyr Arg Arg Thr Pro Asp Phe Leu Thr
Glu Ala 995 1000 1005Ile Val His Ser Val Phe Ile Leu Ser Tyr Tyr
Thr Asn His Asp Leu 1010 1015 1020Lys Asp Lys Leu Gln Asp Leu Ser
Asp Asp Arg Leu Asn Lys Phe Leu1025 1030 1035 1040Thr Cys Ile Ile
Thr Phe Asp Lys Asn Pro Asn Ala Glu Phe Val Thr 1045 1050 1055Leu
Met Arg Asp Pro Gln Ala Leu Gly Ser Glu Arg Gln Ala Lys Ile 1060
1065 1070Thr Ser Glu Ile Asn Arg Leu Ala Val Thr Glu Val Leu Ser
Thr Ala 1075 1080 1085Pro Asn Lys Ile Phe Ser Lys Ser Ala Gln His
Tyr Thr Thr Thr Glu 1090 1095 1100Ile Asp Leu Asn Asp Ile Met Gln
Asn Ile Glu Pro Thr Tyr Pro His1105 1110 1115 1120Gly Leu Arg Val
Val Tyr Glu Ser Leu Pro Phe Tyr Lys Ala Glu Lys 1125 1130 1135Ile
Val Asn Leu Ile Ser Gly Thr Lys Ser Ile Thr Asn Ile Leu Glu 1140
1145 1150Lys Thr Ser Ala Ile Asp Leu Thr Asp Ile Asp Arg Ala Thr
Glu Met 1155 1160 1165Met Arg Lys Asn Ile Thr Leu Leu Ile Arg Ile
Leu Pro Leu Asp Cys 1170 1175 1180Asn Arg Asp Lys Arg Glu Ile Leu
Ser Met Glu Asn Leu Ser Ile Thr1185 1190 1195 1200Glu Leu Ser Lys
Tyr Val Arg Glu Arg Ser Trp Ser Leu Ser Asn Ile 1205 1210 1215Val
Gly Val Thr Ser Pro Ser Ile Met Tyr Thr Met Asp Ile Lys Tyr 1220
1225 1230Thr Thr Ser Thr Ile Ser Ser Gly Ile Ile Ile Glu Lys Tyr
Asn Val 1235 1240 1245Asn Ser Leu Thr Arg Gly Glu Arg Gly Pro Thr
Lys Pro Trp Val Gly 1250 1255 1260Ser Ser Thr Gln Glu Lys Lys Thr
Met Pro Val Tyr Asn Arg Gln Val1265 1270 1275 1280Leu Thr Lys Lys
Gln Arg Asp Gln Ile Asp Leu Leu Ala Lys Leu Asp 1285 1290 1295Trp
Val Tyr Ala Ser Ile Asp Asn Lys Asp Glu Phe Met Glu Glu Leu 1300
1305 1310Ser Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys Ala Lys Lys
Leu Phe 1315 1320 1325Pro Gln Tyr Leu Ser Val Asn Tyr Leu His Arg
Leu Thr Val Ser Ser 1330 1335 1340Arg Pro Cys Glu Phe Pro Ala Ser
Ile Pro Ala Tyr Arg Thr Thr Asn1345 1350 1355 1360Tyr His Phe Asp
Thr Ser Pro Ile Asn Arg Ile Leu Thr Glu Lys Tyr 1365 1370 1375Gly
Asp Glu Asp Ile Asp Ile Val Phe Gln Asn Cys Ile Ser Phe Gly 1380
1385 1390Leu Ser Leu Met Ser Val Val Glu Gln Phe Thr Asn Val Cys
Pro Asn 1395 1400 1405Arg Ile Ile Leu Ile Pro Lys Leu Asn Glu Ile
His Leu Met Lys Pro 1410 1415 1420Pro Ile Phe Thr Gly Asp Val Asp
Ile His Lys Leu Lys Gln Val Ile1425 1430 1435 1440Gln Lys Gln His
Met Phe Leu Pro Asp Lys Ile Ser Leu Thr Gln Tyr 1445 1450 1455Val
Glu Leu Phe Leu Ser Asn Lys Thr Leu Lys Ser Gly Ser His Val 1460
1465 1470Asn Ser Asn Leu Ile Leu Ala His Lys Ile Ser Asp Tyr Phe
His Asn 1475 1480 1485Thr Tyr Ile Leu Ser Thr Asn Leu Ala Gly His
Trp Ile Leu Ile Ile 1490 1495 1500Gln Leu Met Lys Asp Ser Lys Gly
Ile Phe Glu Lys Asp Trp Gly Glu1505 1510 1515 1520Gly Tyr Ile Thr
Asp His Met Phe Ile Asn Leu Lys Val Phe Phe Asn 1525 1530 1535Ala
Tyr Lys Thr Tyr Leu Leu Cys Phe His Lys Gly Tyr Gly Lys Ala 1540
1545 1550Lys Leu Glu Cys Asp Met Asn Thr Ser Asp Leu Leu Cys Val
Leu Glu 1555 1560 1565Leu Ile Asp Ser Ser Tyr Trp Lys Ser Met Ser
Lys Val Phe Leu Glu 1570 1575 1580Gln Lys Val Ile Lys Tyr Ile Leu
Ser Gln Asp Ala Ser Leu His Arg1585 1590 1595 1600Val Lys Gly Cys
His Ser Phe Lys Leu Trp Phe Leu Lys Arg Leu Asn 1605 1610 1615Val
Ala Glu Phe Thr Val Cys Pro Trp Val Val Asn Ile Asp Tyr His 1620
1625 1630Pro Thr His Met Lys Ala Ile Leu Thr Tyr Ile Asp Leu Val
Arg Met 1635 1640 1645Gly Leu Ile Asn Ile Asp Arg Ile His Ile Lys
Asn Lys His Lys Phe 1650 1655 1660Asn Asp Glu Phe Tyr Thr Ser Asn
Leu Phe Tyr Ile Asn Tyr Asn Phe1665 1670 1675 1680Ser Asp Asn Thr
His Leu Leu Thr Lys His Ile Arg Ile Ala Asn Ser 1685 1690 1695Glu
Leu Glu Asn Asn Tyr Asn Lys Leu Tyr His Pro Thr Pro Glu Thr 1700
1705 1710Leu Glu Asn Ile Leu Ala Asn Pro Ile Lys Ser Asn Asp Lys
Lys Thr 1715 1720 1725Leu Asn Asp Tyr Cys Ile Gly Lys Asn Val Asp
Ser Ile Met Leu Pro 1730 1735 1740Leu Leu Ser Asn Lys Lys Leu Ile
Lys Ser Ser Ala Met Ile Arg Thr1745 1750 1755 1760Asn Tyr Ser Lys
Gln Asp Leu Tyr Asn Leu Phe Pro Met Val Val Ile 1765 1770 1775Asp
Arg Ile Ile Asp His Ser Gly Asn Thr Ala Lys Ser Asn Gln Leu 1780
1785 1790Tyr Thr Thr Thr Ser His Gln Ile Ser Leu Val His Asn Ser
Thr Ser 1795 1800 1805Leu Tyr Cys Met Leu Pro Trp His His Ile Asn
Arg Phe Asn Phe Val 1810 1815 1820Phe Ser Ser Thr Gly Cys Lys Ile
Ser Ile Glu Tyr Ile Leu Lys Asp1825 1830 1835 1840Leu Lys Ile Lys
Asp Pro Asn Cys Ile Ala Phe Ile Gly Glu Gly Ala 1845 1850 1855Gly
Asn Leu Leu Leu Arg Thr Val Val Glu Leu His Pro Asp Ile Arg 1860
1865 1870Tyr Ile Tyr Arg Ser Leu Lys Asp Cys Asn Asp His Ser Leu
Pro Ile 1875 1880 1885Glu Phe Leu Arg Leu Tyr Asn Gly His Ile Asn
Ile Asp Tyr Gly Glu 1890 1895 1900Asn Leu Thr Ile Pro Ala Thr Asp
Ala Thr Asn Asn Ile His Trp Ser1905 1910 1915 1920Tyr Leu His Ile
Lys Phe Ala Glu Pro Ile Ser Leu Phe Val Cys Asp 1925 1930 1935Ala
Glu Leu Ser Val Thr Val Asn Trp Ser Lys Ile Ile Ile Glu Trp 1940
1945 1950Ser Lys His Val Arg Lys Cys Lys Tyr Cys Ser Ser Val Asn
Lys Cys 1955 1960 1965Met Leu Ile Val Lys Tyr His Ala Gln Asp Asp
Ile Asp Phe Lys Leu 1970 1975 1980Asp Asn Ile Thr Ile Leu Lys Thr
Tyr Val Cys Leu Gly Ser Lys Leu1985 1990 1995 2000Lys Gly Ser Glu
Val Tyr Leu Val Leu Thr Ile Gly Pro Ala Asn Ile 2005 2010 2015Phe
Pro Val Phe Asn Val Val Gln Asn Ala Lys Leu Ile Leu Ser Arg
2020 2025 2030Thr Lys Asn Phe Ile Met Pro Lys Lys Ala Asp Lys Glu
Ser Ile Asp 2035 2040 2045Ala Asn Ile Lys Ser Leu Ile Pro Phe Leu
Cys Tyr Pro Ile Thr Lys 2050 2055 2060Lys Gly Ile Asn Thr Ala Leu
Ser Lys Leu Lys Ser Val Val Ser Gly2065 2070 2075 2080Asp Ile Leu
Ser Tyr Ser Ile Ala Gly Arg Asn Glu Val Phe Ser Asn 2085 2090
2095Lys Leu Ile Asn His Lys His Met Asn Ile Leu Lys Trp Phe Asn His
2100 2105 2110Val Leu Asn Phe Arg Ser Thr Glu Leu Asn Tyr Asn His
Leu Tyr Met 2115 2120 2125Val Glu Ser Thr Tyr Pro Tyr Leu Ser Glu
Leu Leu Asn Ser Leu Thr 2130 2135 2140Thr Asn Glu Leu Lys Lys Leu
Ile Lys Ile Thr Gly Ser Leu Leu Tyr2145 2150 2155 2160Asn Phe His
Asn Glu 2165302165PRTVirus 30Met Asp Pro Ile Ile Asn Gly Asn Ser
Ala Asn Val Tyr Leu Thr Asp1 5 10 15Ser Tyr Leu Lys Gly Val Ile Ser
Phe Ser Glu Cys Asn Ala Leu Gly 20 25 30Ser Tyr Ile Phe Asn Gly Pro
Tyr Leu Lys Asn Asp Tyr Thr Asn Leu 35 40 45Ile Ser Arg Gln Asn Pro
Leu Ile Glu His Met Asn Leu Lys Lys Leu 50 55 60Asn Ile Thr Gln Ser
Leu Ile Ser Lys Tyr His Lys Gly Glu Ile Lys65 70 75 80Leu Glu Glu
Pro Thr Tyr Phe Gln Ser Leu Leu Met Thr Tyr Lys Ser 85 90 95Met Thr
Ser Ser Glu Gln Ile Ala Thr Thr Asn Leu Leu Lys Lys Ile 100 105
110Ile Arg Arg Ala Ile Glu Ile Ser Asp Val Lys Val Tyr Ala Ile Leu
115 120 125Asn Lys Leu Gly Leu Lys Glu Lys Asp Lys Ile Lys Ser Asn
Asn Gly 130 135 140Gln Asp Glu Asp Asn Ser Val Ile Thr Thr Ile Ile
Lys Asp Asp Ile145 150 155 160Leu Ser Ala Val Lys Asp Asn Gln Ser
His Leu Lys Ala Asp Lys Asn 165 170 175His Ser Thr Lys Gln Lys Asp
Thr Ile Lys Thr Thr Leu Leu Lys Lys 180 185 190Leu Met Cys Ser Met
Gln His Pro Pro Ser Trp Leu Ile His Trp Phe 195 200 205Asn Leu Tyr
Thr Lys Leu Asn Asn Ile Leu Thr Gln Tyr Arg Ser Asn 210 215 220Glu
Val Lys Asn His Gly Phe Thr Leu Ile Asp Asn Gln Thr Leu Ser225 230
235 240Gly Phe Gln Phe Ile Leu Asn Gln Tyr Gly Cys Ile Val Tyr His
Lys 245 250 255Glu Leu Lys Arg Ile Thr Val Thr Thr Tyr Asn Gln Phe
Leu Thr Trp 260 265 270Lys Asp Ile Ser Leu Ser Arg Leu Asn Val Cys
Leu Ile Thr Trp Ile 275 280 285Ser Asn Cys Leu Asn Thr Leu Asn Lys
Ser Leu Gly Leu Arg Cys Gly 290 295 300Phe Asn Asn Val Ile Leu Thr
Gln Leu Phe Leu Tyr Gly Asp Cys Ile305 310 315 320Leu Lys Leu Phe
His Asn Glu Gly Phe Tyr Ile Ile Lys Glu Val Glu 325 330 335Gly Phe
Ile Met Ser Leu Ile Leu Asn Ile Thr Glu Glu Asp Gln Phe 340 345
350Arg Lys Arg Phe Tyr Asn Ser Met Leu Asn Asn Ile Thr Asp Ala Ala
355 360 365Asn Lys Ala Gln Lys Asn Leu Leu Ser Arg Val Cys His Thr
Leu Leu 370 375 380Asp Lys Thr Val Ser Asp Asn Ile Ile Asn Gly Arg
Trp Ile Ile Leu385 390 395 400Leu Ser Lys Phe Leu Lys Leu Ile Lys
Leu Ala Gly Asp Asn Asn Leu 405 410 415Asn Asn Leu Ser Glu Leu Tyr
Phe Leu Phe Arg Ile Phe Gly His Pro 420 425 430Met Val Asp Glu Arg
Gln Ala Met Asp Ala Val Lys Ile Asn Cys Asn 435 440 445Glu Thr Lys
Phe Tyr Leu Leu Ser Ser Leu Ser Met Leu Arg Gly Ala 450 455 460Phe
Ile Tyr Arg Ile Ile Lys Gly Phe Val Asn Asn Tyr Asn Arg Trp465 470
475 480Pro Thr Leu Arg Asn Ala Ile Val Leu Pro Leu Arg Trp Leu Thr
Tyr 485 490 495Tyr Lys Leu Asn Thr Tyr Pro Ser Leu Leu Glu Leu Thr
Glu Arg Asp 500 505 510Leu Ile Val Leu Ser Gly Leu Arg Phe Tyr Arg
Glu Phe Arg Leu Pro 515 520 525Lys Lys Val Asp Leu Glu Met Ile Ile
Asn Asp Lys Ala Ile Ser Pro 530 535 540Pro Lys Asn Leu Ile Trp Thr
Ser Phe Pro Arg Asn Tyr Met Pro Ser545 550 555 560His Ile Gln Asn
Tyr Ile Glu His Glu Lys Leu Lys Phe Ser Glu Ser 565 570 575Asp Lys
Ser Arg Arg Val Leu Glu Tyr Tyr Leu Arg Asp Asn Lys Phe 580 585
590Asn Glu Cys Asp Leu Tyr Asn Cys Val Val Asn Gln Ser Tyr Leu Asn
595 600 605Asn Pro Asn His Val Val Ser Leu Thr Gly Lys Glu Arg Glu
Leu Ser 610 615 620Val Gly Arg Met Phe Ala Met Gln Pro Gly Met Phe
Arg Gln Val Gln625 630 635 640Ile Leu Ala Glu Lys Met Ile Ala Glu
Asn Ile Leu Gln Phe Phe Pro 645 650 655Glu Ser Leu Thr Arg Tyr Gly
Asp Leu Glu Leu Gln Lys Ile Leu Glu 660 665 670Leu Lys Ala Gly Ile
Ser Asn Lys Ser Asn Arg Tyr Asn Asp Asn Tyr 675 680 685Asn Asn Tyr
Ile Ser Lys Cys Ser Ile Ile Thr Asp Leu Ser Lys Phe 690 695 700Asn
Gln Ala Phe Arg Tyr Glu Thr Ser Cys Ile Cys Ser Asp Val Leu705 710
715 720Asp Glu Leu His Gly Val Gln Ser Leu Phe Ser Trp Leu His Leu
Thr 725 730 735Ile Pro His Val Thr Ile Ile Cys Thr Tyr Arg His Ala
Pro Pro Tyr 740 745 750Ile Gly Asp His Ile Val Asp Leu Asn Asn Val
Asp Glu Gln Ser Gly 755 760 765Leu Tyr Arg Tyr His Met Gly Gly Ile
Glu Gly Trp Cys Gln Lys Leu 770 775 780Trp Thr Ile Glu Ala Ile Ser
Leu Leu Asp Leu Ile Ser Leu Lys Gly785 790 795 800Lys Phe Ser Ile
Thr Ala Leu Ile Asn Gly Asp Asn Gln Ser Ile Asp 805 810 815Ile Ser
Lys Pro Ile Arg Leu Met Glu Gly Gln Thr His Ala Gln Ala 820 825
830Asp Tyr Leu Leu Ala Leu Asn Ser Leu Lys Leu Leu Tyr Lys Glu Tyr
835 840 845Ala Gly Ile Gly His Lys Leu Lys Gly Thr Glu Thr Tyr Ile
Ser Arg 850 855 860Asp Met Gln Phe Met Ser Lys Thr Ile Gln His Asn
Gly Val Tyr Tyr865 870 875 880Pro Ala Ser Ile Lys Lys Val Leu Arg
Val Gly Pro Trp Ile Asn Thr 885 890 895Ile Leu Asp Asp Phe Lys Val
Ser Leu Glu Ser Ile Gly Ser Leu Thr 900 905 910Gln Glu Leu Glu Tyr
Arg Gly Glu Ser Leu Leu Cys Ser Leu Ile Phe 915 920 925Arg Asn Val
Trp Leu Tyr Asn Gln Ile Ala Leu Gln Leu Lys Asn His 930 935 940Ala
Leu Cys Asn Asn Lys Leu Tyr Leu Asp Ile Leu Lys Val Leu Lys945 950
955 960His Leu Lys Thr Phe Phe Asn Leu Asp Asn Ile Asp Thr Ala Leu
Thr 965 970 975Leu Tyr Met Asn Leu Pro Met Leu Phe Gly Gly Gly Asp
Pro Asn Leu 980 985 990Leu Tyr Arg Ser Phe Tyr Arg Arg Thr Pro Asp
Phe Leu Thr Glu Ala 995 1000 1005Ile Val His Ser Val Phe Ile Leu
Ser Tyr Tyr Thr Asn His Asp Leu 1010 1015 1020Lys Asp Lys Leu Gln
Asp Leu Ser Asp Asp Arg Leu Asn Lys Phe Leu1025 1030 1035 1040Thr
Cys Ile Ile Thr Phe Asp Lys Asn Pro Asn Ala Glu Phe Val Thr 1045
1050 1055Leu Met Arg Asp Pro Gln Ala Leu Gly Ser Glu Arg Gln Ala
Lys Ile 1060 1065 1070Thr Ser Glu Ile Asn Arg Leu Ala Val Thr Glu
Val Leu Ser Thr Ala 1075 1080 1085Pro Asn Lys Ile Phe Ser Lys Ser
Ala Gln His Tyr Thr Thr Thr Glu 1090 1095 1100Ile Asp Leu Asn Asp
Ile Met Gln Asn Ile Glu Pro Thr Tyr Pro His1105 1110 1115 1120Gly
Leu Arg Val Val Tyr Glu Ser Leu Pro Phe Tyr Lys Ala Glu Lys 1125
1130 1135Ile Val Asn Leu Ile Ser Gly Thr Lys Ser Ile Thr Asn Ile
Leu Glu 1140 1145 1150Lys Thr Ser Ala Ile Asp Leu Thr Asp Ile Asp
Arg Ala Thr Glu Met 1155 1160 1165Met Arg Lys Asn Ile Thr Leu Leu
Ile Arg Ile Leu Pro Leu Asp Cys 1170 1175 1180Asn Arg Asp Lys Arg
Glu Ile Leu Ser Met Glu Asn Leu Ser Ile Thr1185 1190 1195 1200Glu
Leu Ser Lys Tyr Val Arg Glu Arg Ser Trp Ser Leu Ser Asn Ile 1205
1210 1215Val Gly Val Thr Ser Pro Ser Ile Met Tyr Thr Met Asp Ile
Lys Tyr 1220 1225 1230Thr Thr Ser Thr Ile Ser Ser Gly Ile Ile Ile
Glu Lys Tyr Asn Val 1235 1240 1245Asn Ser Leu Thr Arg Gly Glu Arg
Gly Pro Thr Lys Pro Trp Val Gly 1250 1255 1260Ser Ser Thr Gln Glu
Lys Lys Thr Met Pro Val Tyr Asn Arg Gln Val1265 1270 1275 1280Leu
Thr Lys Lys Gln Arg Asp Gln Ile Asp Leu Leu Ala Lys Leu Asp 1285
1290 1295Trp Val Tyr Ala Ser Ile Asp Asn Lys Asp Glu Phe Met Glu
Glu Leu 1300 1305 1310Ser Ile Gly Thr Leu Gly Leu Thr Tyr Glu Lys
Ala Lys Lys Leu Phe 1315 1320 1325Pro Gln Tyr Leu Ser Val Asn Tyr
Leu His Arg Leu Thr Val Ser Ser 1330 1335 1340Arg Pro Cys Glu Phe
Pro Ala Ser Ile Pro Ala Tyr Arg Thr Thr Asn1345 1350 1355 1360Tyr
His Phe Asp Thr Ser Pro Ile Asn Arg Ile Leu Thr Glu Lys Tyr 1365
1370 1375Gly Asp Glu Asp Ile Asp Ile Val Phe Gln Asn Cys Ile Ser
Phe Gly 1380 1385 1390Leu Ser Leu Met Ser Val Val Glu Gln Phe Thr
Asn Val Cys Pro Asn 1395 1400 1405Arg Ile Ile Leu Ile Pro Lys Leu
Asn Glu Ile His Leu Met Lys Pro 1410 1415 1420Pro Ile Phe Thr Gly
Asp Val Asp Ile His Lys Leu Lys Gln Val Ile1425 1430 1435 1440Gln
Lys Gln His Met Phe Leu Pro Asp Lys Ile Ser Leu Thr Gln Tyr 1445
1450 1455Val Glu Leu Phe Leu Ser Asn Lys Thr Leu Lys Ser Gly Ser
His Val 1460 1465 1470Asn Ser Asn Leu Ile Leu Ala His Lys Ile Ser
Asp Tyr Phe His Asn 1475 1480 1485Thr Tyr Ile Leu Ser Thr Asn Leu
Ala Gly His Trp Ile Leu Ile Ile 1490 1495 1500Gln Leu Met Lys Asp
Ser Lys Gly Ile Phe Glu Lys Asp Trp Gly Glu1505 1510 1515 1520Gly
Tyr Ile Thr Asp His Met Phe Ile Asn Leu Lys Val Phe Phe Asn 1525
1530 1535Ala Tyr Lys Thr Tyr Leu Leu Cys Phe His Lys Gly Tyr Gly
Lys Ala 1540 1545 1550Lys Leu Glu Cys Asp Met Asn Thr Ser Asp Leu
Leu Cys Val Leu Glu 1555 1560 1565Leu Ile Asp Ser Ser Tyr Trp Lys
Ser Met Ser Lys Val Phe Leu Glu 1570 1575 1580Gln Lys Val Ile Lys
Tyr Ile Leu Ser Gln Asp Ala Ser Leu His Arg1585 1590 1595 1600Val
Lys Gly Cys His Ser Phe Lys Leu Trp Phe Leu Lys Arg Leu Asn 1605
1610 1615Val Ala Glu Phe Thr Val Cys Pro Trp Val Val Asn Ile Asp
Tyr His 1620 1625 1630Pro Thr His Met Lys Ala Ile Leu Thr Tyr Ile
Asp Leu Val Arg Met 1635 1640 1645Gly Leu Ile Asn Ile Asp Arg Ile
His Ile Lys Asn Lys His Lys Phe 1650 1655 1660Asn Asp Glu Phe Tyr
Thr Ser Asn Leu Phe Tyr Ile Asn Tyr Asn Phe1665 1670 1675 1680Ser
Asp Asn Thr His Leu Leu Thr Lys His Ile Arg Ile Ala Asn Ser 1685
1690 1695Glu Leu Glu Asn Asn Tyr Asn Lys Leu Tyr His Pro Thr Pro
Glu Thr 1700 1705 1710Leu Glu Asn Ile Leu Ala Asn Pro Ile Lys Ser
Asn Asp Lys Lys Thr 1715 1720 1725Leu Asn Asp Tyr Cys Ile Gly Lys
Asn Val Asp Ser Ile Met Leu Pro 1730 1735 1740Leu Leu Ser Asn Lys
Lys Leu Ile Lys Ser Ser Ala Met Ile Arg Thr1745 1750 1755 1760Asn
Tyr Ser Lys Gln Asp Leu Tyr Asn Leu Phe Pro Met Val Val Ile 1765
1770 1775Asp Arg Ile Ile Asp His Ser Gly Asn Thr Ala Lys Ser Asn
Gln Leu 1780 1785 1790Tyr Thr Thr Thr Ser His Gln Ile Ser Leu Val
His Asn Ser Thr Ser 1795 1800 1805Leu Tyr Cys Met Leu Pro Trp His
His Ile Asn Arg Phe Asn Phe Val 1810 1815 1820Phe Ser Ser Thr Gly
Cys Lys Ile Ser Ile Glu Tyr Ile Leu Lys Asp1825 1830 1835 1840Leu
Lys Ile Lys Asp Pro Asn Cys Ile Ala Phe Ile Gly Glu Gly Ala 1845
1850 1855Gly Asn Leu Leu Leu Arg Thr Val Val Glu Leu His Pro Asp
Ile Arg 1860 1865 1870Tyr Ile Tyr Arg Ser Leu Lys Asp Cys Asn Asp
His Ser Leu Pro Ile 1875 1880 1885Glu Phe Leu Arg Leu Tyr Asn Gly
His Ile Asn Ile Asp Tyr Gly Glu 1890 1895 1900Asn Leu Thr Ile Pro
Ala Thr Asp Ala Thr Asn Asn Ile His Trp Ser1905 1910 1915 1920Tyr
Leu His Ile Lys Phe Ala Glu Pro Ile Ser Leu Phe Val Cys Asp 1925
1930 1935Ala Glu Leu Ser Val Thr Val Asn Trp Ser Lys Ile Ile Ile
Glu Trp 1940 1945 1950Ser Lys His Val Arg Lys Cys Lys Tyr Cys Ser
Ser Val Asn Lys Cys 1955 1960 1965Met Leu Ile Val Lys Tyr His Ala
Gln Asp Asp Ile Asp Phe Lys Leu 1970 1975 1980Asp Asn Ile Thr Ile
Leu Lys Thr Tyr Val Cys Leu Gly Ser Lys Leu1985 1990 1995 2000Lys
Gly Ser Glu Val Tyr Leu Val Leu Thr Ile Gly Pro Ala Asn Ile 2005
2010 2015Phe Pro Val Phe Asn Val Val Gln Asn Ala Lys Leu Ile Leu
Ser Arg 2020 2025 2030Thr Lys Asn Phe Ile Met Pro Lys Lys Ala Asp
Lys Glu Ser Ile Asp 2035 2040 2045Ala Asn Ile Lys Ser Leu Ile Pro
Phe Leu Cys Tyr Pro Ile Thr Lys 2050 2055 2060Lys Gly Ile Asn Thr
Ala Leu Ser Lys Leu Lys Ser Val Val Ser Gly2065 2070 2075 2080Asp
Ile Leu Ser Tyr Ser Ile Ala Gly Arg Asn Glu Val Phe Ser Asn 2085
2090 2095Lys Leu Ile Asn His Lys His Met Asn Ile Leu Lys Trp Phe
Asn His 2100 2105 2110Val Leu Asn Phe Arg Ser Thr Glu Leu Asn Tyr
Asn His Leu Tyr Met 2115 2120 2125Val Glu Ser Thr Tyr Pro Tyr Leu
Ser Glu Leu Leu Asn Ser Leu Thr 2130 2135 2140Thr Asn Glu Leu Lys
Lys Leu Ile Lys Ile Thr Gly Ser Leu Leu Tyr2145 2150 2155 2160Asn
Phe His Asn Glu 21653121DNAArtificial SequenceOligonucleotide
31ggtggccggc atggtcccag c 213224DNAArtificial
SequenceOligonucleotide 32ctcgctggcg ccggctgggc aaca
243324DNAArtificial SequenceOligonucleotide 33ttccgagggg accgtcccct
cggt 243424DNAArtificial SequenceOligonucleotide 34aatggcgaat
gggacgtcga cagc 243521DNAArtificial SequenceOligonucleotide
35taacaaagcc cgaaggaagc t 213621DNAArtificial
SequenceOligonucleotide 36gagttgctgc tgccaccgtt g
213723DNAArtificial SequenceOligonucleotide 37agcaataact agataacctt
ggg 233824DNAArtificial SequenceOligonucleotide 38cctctaaacg
ggtcttgagg gtct 243921DNAArtificial SequenceOligonucleotide
39ttttgctgaa aggaggaact a 214021DNAArtificial
SequenceOligonucleotide 40tatgcggccg cgtcgacggt a
214118DNAArtificial SequenceOligonucleotide 41ccgggcccgc cttcgaag
184221DNAArtificial SequencePrimer 42caccacctac cttactcaag t
214324DNAArtificial SequencePrimer 43tttgtttgtg ggtttgatgg ttgg
244435DNAArtificial SequencePrimer 44gatatcaaga tctacaataa
cattggggca aatgc 354531DNAArtificial SequencePrimer 45gctaagagat
ctttttgaat aactaagcat g 314646DNAArtificial SequenceOligonucleotide
46tcttgactgt tgtggattgc agggttgact tgactccgat cgatcc
464749DNAArtificial SequenceOligonucleotide 47cttgtgttgt tgttgtatgg
tgtgtttctg attttgtatt gatcgatcc 494811PRTVirus 48Thr Asn Gly His
Ala Lys Asn Asn Asp Thr Thr 1 5 104912PRTVirus 49Met Thr Met Pro
Lys Ile Met Ile Leu Pro Asp Lys 1 5 105033DNAArtificial
SequencePrimer 50tcacgaagga atcctggcaa atttgaaatt cga
335133DNAArtificial SequencePrimer 51gaaattcgag gtcatggttt
aaatggtaag agg 335236DNAArtificial SequencePrimer 52tgcttaaatg
gtaagaggtg tcattttagt cataat 365333DNAArtificial SequencePrimer
53actaaacaat cagcaggtgt tgccatgagc aaa 335452DNAArtificial
SequencePrimer 54gagctaaatt cacccaagat aagcttgtaa taaactgtca
tatcatatat tg 525542DNAArtificial SequencePrimer 55caaactatcc
atctgtaata aagcttgcca gcagacgtat tg 425650DNAArtificial
SequencePrimer 56ccatcaacaa cccaaaataa taaagcttta gtgatacaaa
tgaccatgcc 505729DNAArtificial SequencePrimer 57aattttaata
actataattg aatactgca 295818DNAArtificial SequencePrimer
58gacaaaatgga tcccatt 185919DNAArtificial SequencePrimer
59acgagaaaaa aagtgtcaa 196018DNAArtificial SequencePrimer
60tgactcgagc tcttggta 186136DNAArtificial SequencePrimer
61atcaggatcc acaataacat tggggcaaat gcaacc 366236DNAArtificial
SequencePrimer 62caactcatag ttacataaaa cggatccgaa tgccat 36
* * * * *