U.S. patent application number 11/846699 was filed with the patent office on 2008-11-13 for methods of treating neurological conditions with hematopoeitic growth factors.
This patent application is currently assigned to AXARON BIOSCIENCE AG. Invention is credited to Nikolaus Gassler, Rainer Kollmar, Carola Krueger, Martin Maurer, Wolf-Ruediger SCHAEBITZ, Armin Schneider, Stefan Schwab, Clemens Sommer, Daniela Weber.
Application Number | 20080279814 11/846699 |
Document ID | / |
Family ID | 32710846 |
Filed Date | 2008-11-13 |
United States Patent
Application |
20080279814 |
Kind Code |
A1 |
SCHAEBITZ; Wolf-Ruediger ;
et al. |
November 13, 2008 |
METHODS OF TREATING NEUROLOGICAL CONDITIONS WITH HEMATOPOEITIC
GROWTH FACTORS
Abstract
The present invention relates to a method of treating a
neurological condition in a mammal by administering at least one
hematopoietic growth factor.
Inventors: |
SCHAEBITZ; Wolf-Ruediger;
(Dossenheim, DE) ; Schneider; Armin; (Heidelberg,
DE) ; Krueger; Carola; (Neustadt/Wstr., DE) ;
Sommer; Clemens; (Guenzburg, DE) ; Schwab;
Stefan; (Heidelberg, DE) ; Kollmar; Rainer;
(Heidelberg, DE) ; Maurer; Martin; (Heidelberg,
DE) ; Weber; Daniela; (Mannheim, DE) ;
Gassler; Nikolaus; (Heidelberg, DE) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND MAIER & NEUSTADT, P.C.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
AXARON BIOSCIENCE AG
Heidelberg
DE
|
Family ID: |
32710846 |
Appl. No.: |
11/846699 |
Filed: |
August 29, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10880101 |
Jun 30, 2004 |
|
|
|
11846699 |
|
|
|
|
PCT/IB03/06446 |
Dec 31, 2003 |
|
|
|
10880101 |
|
|
|
|
10659295 |
Sep 11, 2003 |
|
|
|
PCT/IB03/06446 |
|
|
|
|
10331755 |
Dec 31, 2002 |
|
|
|
10659295 |
|
|
|
|
Current U.S.
Class: |
424/85.2 |
Current CPC
Class: |
A61P 9/00 20180101; Y10S
514/912 20130101; G01N 33/5008 20130101; A61P 25/14 20180101; A61P
25/28 20180101; G01N 33/5058 20130101; A61K 38/49 20130101; A61P
21/00 20180101; A61P 25/00 20180101; A61K 38/193 20130101; A61P
25/16 20180101; Y10S 514/913 20130101; A61K 38/193 20130101; G01N
33/6872 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A61P 25/24 20180101; A61P 25/22 20180101; A61P 9/10 20180101; G01N
33/5041 20130101; A61K 38/49 20130101; G01N 33/5023 20130101 |
Class at
Publication: |
424/85.2 |
International
Class: |
A61K 38/20 20060101
A61K038/20; A61P 25/00 20060101 A61P025/00 |
Claims
1. A method of treating a neurological condition in a mammal,
comprising administering to the mammal in need thereof, a
hematopoietic factor selected from the group consisting of IL-5, a
derivative thereof, a mimetic thereof, and a combination thereof in
an amount sufficient to treat the neurological condition.
2. The method of claim 1, wherein said neurological condition is
selected from the group consisting of a neurological disease with
pathophysiological mechanisms involving ischemia, a neurological
disease with pathophysiological mechanisms involving hypoxia, a
neurodegenerative disease, and a disease of the nervous system
accompanied by neural cell death.
3. The method of claim 1, wherein the neurological condition is
neurological disease with pathophysiological mechanisms involving
ischemia or hypoxia.
4. The method of claim 3, wherein the neurological disease with
pathophysiological mechanisms involving ischemia or hypoxia is
stroke.
5. The method of claim 1, further comprising administering one or
more additional hematopoietic factors.
6. The method of claim 1, wherein the neurological condition is a
psychiatric condition.
7. The method of claim 6, wherein the psychiatric condition is
depression.
8. The method of claim 1, wherein the neurological condition is a
dementia or multiple sclerosis.
9. (canceled)
10. (canceled)
11. The method of claim 1, wherein the neurological condition is
stroke, Parkinson's disease, amyotrophic lateral sclerosis,
neurotrauma, cerebral ischemia due to cardiac arrest, cerebral
ischemia during an operative procedure, multiple sclerosis,
Huntington's disease, glaucoma, neuropathy, a lysosomal storage
disease, or spinal cord injury.
12. (canceled)
13. (canceled)
14. The method of claim 1, which further comprises administering a
hemodynamically active compound.
15. The method of claim 1, which further comprises administering
tissue plasminogen activator to the mammal.
16. The method of claim 1, which further comprises administering an
agent that facilitates passage over the blood brain barrier.
17. The method of claim 1, which further comprises administering an
anti-apoptotic agent.
18. The method of claim 15, wherein the neurological condition is
stroke.
19. The method of claim 10, further comprising administering tissue
plasminogen activator to the mammal.
20. The method of claim 1, wherein the hematopoietic factor is a
human factor or derived from a human factor.
21. The method of claim 1, wherein the mammal is human.
22. The method of claim 1, wherein the hematopoietic factor is
administered by one or more modes of administration selected from
the group consisting of direct intracerebral injection,
intravenously, intraarterially, orally, and subcutaneously.
23-55. (canceled)
56. A method for enhancing the cognitive ability of a mammal in
need thereof, comprising administering a hematopoietic factor
selected from the group consisting of IL-3, IL-5, a derivative
thereof, a mimetic thereof, and a combination thereof in an amount
sufficient to enhance the cognitive ability of a mammal relative to
the mammal prior to the administrating.
57. The method of claim 56, wherein the mammal is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of
PCT/IB03/006446 filed Dec. 31, 2003, pending, and is also a
continuation-in-part of U.S. application Ser. No. 10/659,295 filed
Sep. 11, 2003, pending, which is a continuation application of U.S.
application Ser. No. 10/331,755 filed Dec. 31, 2002, abandoned.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a method of treating a
neurological condition in a mammal by administering at least one
hematopoietic growth factor.
[0004] 2. Discussion of the Related Art
[0005] Growth factors are proteins that are essentially involved in
regulating survival, proliferation, maturation, and outgrowth of
developing neuronal cells. For example, the expression of a large
number of growth factors increases in response to various brain
insults. Many factors display endogenous neuroprotective and
neurotrophic effects (see Arvidsson A et al., Neuroscience 2001;
106:27-41; Larsson E et al., J Cereb Blood Flow Metab 1999;
19:1220-8; Mattson M P, et al., J Neurotrauma 1994; 11:3-33;
Semkova I, et al., Brain Res Brain Res Rev 1999; 30:176-88). These
effects were also reported after exogenous administration in vitro
and in vivo after brain trauma and stroke (see Semkova I. et al.,
Brain Res. Rev. 1999; 30:176-88; Fisher Ma et al., J. Cereb. Blood
Flow Metab. 1995; 15:953-9; Schabitz W R et al. Stroke 2001;
32:1226-33; Schabitz W R et al., Stroke 2000; 31:2212-7). After
binding to high-affinity membrane receptors the effects of growth
factors are mediated by a cascade of intracellular
signal-transduction events (Kernie S G, et al., Arch Neurol 2000;
57:654-7), which induces cells to grow and differentiate; or
provides trophic support for cell survival.
[0006] Granulocyte-colony stimulating factor (GCSF), a 20 kDa
protein, together with tumor necrosis factor-.alpha. (TNF-.alpha.)
and the interleukins is a member of the cytokine family of growth
factors. GCSF is the major growth factor involved in the production
of neutrophilic granulocytes.
[0007] GCSF exerts its function via the activation of a membrane
receptor (GCSF receptor) that belongs to the super-family of
hematopoietin receptors, also being referred to as class I cytokine
receptors (de Konin, and Touw, Curr. Opin. Hematol., 1996, 3,
180-4).
[0008] A number of receptors for lymphokines, hematopoietic growth
factors, and growth hormone-related molecules have been found to
share a common binding domain. These receptors are referred to as
hematopoietin receptors and the corresponding ligands as
hematopoietins. Further, hematopoietins have been subdivided into
two major structural groups: Large/long and small/short
hematopoietins. One subset of individual receptor chains that are
part of receptor complexes for large hematopoietins contain common
structural elements in their extracellular parts: an
immunoglobin-like domain, a hematopoietin-receptor domain, and 3
fibronectin type-III domains (2 in the leptin receptor). This
subgroup was designated the "gp130 family of receptors" (Mosley, et
al., J Biol. Chem. 1996, 271, 32635-43) and include Leptin receptor
(LPTR), Granulocyte colony stimulating factor receptor (GCSFR),
Interleukin-6/-11/LIF/OSM/CNTF common beta chain (GPI30), Leukemia
inhibiting factor receptor (LIFR), Oncostatin-M receptor beta chain
(OSMR), Interleukin-12 receptor beta-1 chain (IL12RB1),
Interleukin-12 receptor beta-2 chain (IL12RB2). These receptor
chains homodimerize (GCSFR, GPI30, LPTR) or heterodimerize (GPI30
with LIFR or OSMR, IL12RB1 with IL12RB2) upon binding the cognate
cytokine. In addition, a prosite consensus pattern is
characteristic of this receptor family, which is:
N-x(4)-S-x(28,35)-[LVIM]-x-W-x(0,3)-P-x(5,9)-[YF]-x(1,2)-[VILM]-x-W
(SEQ ID NO:1)
[0009] GCSF stimulates proliferation, survival, and maturation of
cells committed to the neutrophilic granulocyte lineage through
binding to the specific GCSF receptor (GCSFR) (see Hartung T., et
al., Curr. Opin. Hematol. 1998; 5:221-5). GCSFR mediated signaling
activates the family of Signal Transducer and Activator of
Transcription (STAT) proteins which translocate to the nucleus and
regulate transcription (Damell J E Jr., Science 1997; 277:1630-5).
GCSF is typically used for the treatment of different kinds of
neutropenia in humans. It is one of the few growth factors approved
for clinical use. In particular, it is used to reduce chemotherapy
(CT)-induced cytopenia (Viens et al., J. of Clin. Oncology, Vol.
20, No. 1, 2002:24-36). GCSF has also been implicated for
therapeutic use in infectious diseases as potential adjunctive
agent (Hubel et al., J. of Infectious Diseases, Vol. 185:1490-501,
2002). GCSF has reportedly been crystallized to some extent (EP 344
796), and the overall structure of GCSF has been surmised, but only
on a gross level (Bazan, Immunology Today 11:350-354 (1990); Parry
et al. J. Molecular Recognition 8: 107-110 (1988)).
[0010] In recent years a number of growth factors such as bFGF and
pharmaceutically promising substances such as thrombocyte adhesion
blockers like anti-GP Ib/IIa and Abcizimab have been tested for
neuroprotective efficacy in clinical studies. Unfortunately, none
of these prevailed to provide neuroprotective efficacy. In
particular, NMDA antagonists, free radical scavengers and glutamate
antagonists failed or demonstrated severe side-effects. The list of
substances such as anti-ICAM or inhibitors of the
glutamate-mediated NO-synthetase that have failed growing (De
Keyser, et al. (1999), Trends Neurosci, 22, 535-40).
[0011] Most studies on cerebral ischemia and testing of
pharmacological substances in vivo have only been concerned with
the immediate effects of the drug or paradigm under investigation
(i.e. infarct size 24 h after induction of the stroke). However, a
more valid parameter of true efficacy of a particular substance is
the long-term effect on functional recovery, which is also
reflected in human stroke studies, where clinical scales (e.g.,
Scandinavian stroke scale, NIH scale, Barthel index) also reflect
the ability to perform daily life activities. Recovery in the first
few days after focal lesions may be due to resolution of edema or
reperfusion of the ischemic penumbra. Much of the functional
recovery after the acute phase is likely due to brain plasticity,
with adjacent cortical areas of the brain taking over functions
previously performed by the damaged regions (Chen R, Cohen L G
Hallett M. Neuroscience 2002; 111(4):761-73). The two main
mechanisms proposed to explain reorganization are unmasking of
previously present but functionally inactive connections and growth
of new connections such as collateral sprouting (Chen R. Cohen L G,
Hallett M. 2002 Neuroscience 2002; 111 (4):761-73). Short term
plastic changes are mediated by removing inhibition to excitatory
synapses, which is likely due to reduced GABAergic inhibition (Kaas
J H. Annu Rev Neurosci. 1991; 14:137-67; Jones E G. Cereb Cortex.
1993 September-October; 3(5):361-72). Plasticity changes that occur
over a longer time involve mechanisms in addition to the unmasking
of latent synapses such as long-term potentiation (LTP), which
requires NMDA receptor activation and increased intracellular
calcium concentration (Hess and Dono hue, J. Neurophysiol. 1994
71(6):2543-7). Long term changes also involve axonal regeneration
and sprouting with alterations in synapse shape, number, size and
type (Kaas J H. Annu Rev Neurosci. 1991; 14:137-67, 3).
[0012] Stroke is the third-leading cause of death, and the main
cause of disability in the western world. It presents a large
socioeconomic burden. The etiology can be either ischemic (in the
majority of cases) or hemorraghic. The cause of ischemic stroke is
often embolic, or thrombotic. So far, there is no effective
treatment for the majority of stroke patients. The only clinically
proven drugs so far are tissue plasminogen activator (TPA) and
Aspirin. After massive cell death in the immediate infarct core due
to lack of glucose and oxygen, the infarct area expands for days,
owing to secondary mechanisms such as glutamate excitotoxicity,
apoptotic mechanisms, and generation of free radicals.
[0013] Amyotrophic lateral sclerosis (ALS; Lou-Gehrig's disease;
Charcot's disease) is a neurodegenerative disorder with an annual
incidence of 0.4 to 1.76 per 100.000 population (Adams et al.,
Principles of Neurology, 6.sup.th ed., New York, pp 1090-1095). It
is the most common form of motor neuron disease with typical
manifestations of generalized fasciculations, progressive atrophy
and weakness of the skeletal muscles, spasticity and pyramidal
tract signs, dysarthria, dysphagia, and dyspnea. The pathology
consists principally in loss of nerve cells in the anterior horn of
the spinal cord and motor nuclei of the lower brainstem, but can
also include the first order motor neurons in the cortex.
Pathogenesis of this devastating disease is still largely unknown,
although the role of superoxide-dismutase (SOD1) mutants in
familial cases has been worked out quite well, which invokes an
oxidative stress hypothesis. So far, more than 90 mutations in the
SOD1 protein have been described, that can cause ALS (Cleveland and
Rothstein (2001), Nat Rev Neurosci, 2, 806-19). Also, a role for
neurofilaments in this disease was shown. Excitotoxicity, a
mechanism evoked by an excess glutamate stimulation is also an
important factor, exemplified by the beneficial role of Riluzole in
human patients. Most convincingly shown in the SOD1 mutants,
activation of caspases and apoptosis seems to be the common final
pathway in ALS (Ishigaki, et al. (2002), J. Neurochem, 82, 576-84,
Li, et al. (2000), Science, 288, 335-9). Therefore, it seems that
ALS also falls into the same general pathogenetic pattern that is
also operative in other neurodegenerative diseases and stroke, e.g.
glutamate involvement, oxidative stress, and programmed cell
death.
[0014] Parkinson's disease is the most frequent movement disorder,
with approximately 1 million patients in North America; about 1
percent of the population over the age of 65 years is affected. The
core symptoms of the disease are rigor, tremor and akinesia (Adams
et al., Principles of Neurology, 6.sup.th ed., New York, pp
1090-1095). The etiology of Parkinson's disease is not known.
Nevertheless, a significant body of biochemical data from human
brain autopsy studies and from animal models points to an ongoing
process of oxidative stress in the substantia nigra, which could
initiate dopaminergic neurodegeneration. Oxidative stress, as
induced by the neurotoxins 6-hydroxydopamine and MPTP
(N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), has been used in
animal models to investigate the process of neurodegeneration.
Although a symptomatic therapy exists (e.g. L-DOPA plus a
decarboxylase inhibitor; bromocriptine, pergolide as dopamine
agonists; and anticholinergic agents such as trihexyphenidyl
(artane)), there is a clear need for a causative therapy, e.g. a
neuroprotective therapy, that really halts the disease progress.
These animal models have been used to test the efficacy of radical
scavengers, iron chelators, dopamine agonists, nitric oxide
synthase inhibitors and certain calcium channel antagonists.
Apoptotic mechanisms are clearly operative in the animal models as
well as in the patient (Mochizuki, et al. (2001), Proc. Natl. Acad.
Sci. USA, 98, 10918-23, Xu et al. (2002), Nat. Med., 8, 600-6,
Viswanath, et al. (2001), J. Neurosci., 21, 9519-28, Hartmann, et
al. (2002), Neurology, 58, 308-10). This pathophysiology with
involvement of oxidative stress and apoptosis also places
Parkinson's disease amongst the other neurodegenerative disorders
and stroke.
[0015] Cerebral ischemia may result from a variety of causes that
impair cerebral blood flow (CBF) and lead to deprivation of both
oxygen and glucose. Traumatic brain injury (TBI), on the other
hand, involves a primary mechanical impact that usually causes
skull fracture and abruptly disrupts the brain parenchyma with
shearing and tearing of blood vessels and brain tissue. This, in
turn, triggers a cascade of events characterized by activation of
molecular and cellular responses that lead to secondary injury. The
evolution of such secondary damage is an active process in which
many biochemical pathways are involved (Leker and Shohami (2002),
Brain Res. Rev., 39, 55-73). Many similarities between the harmful
pathways that lead to secondary cellular death in the penumbral
ischemic zone and in the area exposed to secondary post-traumatic
injury have been identified (e.g. excitotoxity by excess glutamate
release, nitric oxide, reactive oxygen species, inflammation, and
apoptosis (Leker and Shohami (2002), Brain Res. Rev., 39, 55-73)).
In addition, early ischemic episodes are reported to occur after
traumatic brain injury, adding a component of ischemia to the
primary mechanical damage.
[0016] Cardiovascular disease is the major cause of death in
western industrialized nations. In the United States, there are
approximately 1 million deaths each year with nearly 50% of them
being sudden and occurring outside the hospital (Zheng, et al.
(2001), Circulation, 104, 2158-63). Cardio-pulmonary resuscitation
(CPR) is attempted in 40-90 of 100,000 inhabitants annually, and
restoration of spontaneous circulation (ROSC) is achieved in 25-50%
of these patients. However, the hospital discharge rate following
successful ROSC is only 2-10% (Bottiger, et al. (1999), Heart, 82,
674-9). Therefore, the vast majority of the cardiac arrest victims
annually in the United States is not treated successfully. The
major reason for the low survival rates after successful CPR, i.e.,
for postarrest in-hospital mortality, is persistent brain damage.
Brain damage following cardiocirculatory arrest is related both to
the short period of tolerance to hypoxic stress and to specific
reperfusion disorders (Safar (1986), Circulation, 74, IV138-53,
Hossmann (1993), Resuscitation, 26, 225-35). Initially, a higher
number of patients can be stabilized hemodynamically after
cardiocirculatory arrest; many of them, however, die due to central
nervous system injury. The personal, social, and economic
consequences of brain damage following cardiac arrest are
devastating. One of the most important issues in cardiac arrest and
resuscitation ("whole body ischemia and reperfusion") research,
therefore, is cerebral resuscitation and postarrest cerebral damage
(Safar (1986), Circulation, 74, Iv138-53, Safar, et al. (2002),
Crit. Care Med, 30, p. 140-4). Presently, it is not possible to
decrease the primary damage to neurons that is caused by hypoxia
during cardiac arrest by any post-arrest therapeutic measures.
Major pathophysiological issues include hypoxia and subsequent
necrosis, reperfusion injury with free radical formation and
cellular calcium influx, release of excitatory amino acids,
cerebral microcirculatory reperfusion disorders, and programmed
neuronal death or apoptosis (Safar (1986), Circulation, 74,
IV138-53, Safar et al. (2002), Crit. Care Med, 30, 140-4).
[0017] Several clinical trials have attempted to improve
neurological outcome after cardiac arrest without success. The
therapeutic use of barbiturates (to enhance neuroprotection) or the
use of calcium channel blockers (to reduce ischemia reperfusion
damage) was tested (Group (1986), Am J. Emerg Med., 4, 72-86, Group
(1986), N. Engl. J. Med., 314, 397-403, Group (1991), Control Clin.
Trials, 12, 525-45, Group (1991), N. Engl. J. Med., 324, 1225-31).
To date no specific post-arrest treatment options are available to
improve neurological outcome following cardiocirculatory arrest in
the clinical setting (with the possible exception of mild
hypothermia and thrombolysis where the results of large,
randomized, and controlled clinical trials are eagerly awaited
(Safar et al (2002), Crit. Care Med., 30, 140-4)). Therefore, an
innovative therapy to improve neurological outcome after cardiac
arrest is crucial.
[0018] Multiple sclerosis is the prototype inflammatory autoimmune
disorder of the central nervous system and, with a lifetime risk of
one in 400, potentially the most common cause of neurological
disability in young adults. Worldwide, there are about 2-5 million
patients suffering from this disease (Compston and Coles (2002),
Lancet, 359, 1221-31). As with all complex traits, the disorder
results from interplay between as yet unidentified environmental
factors and susceptibility genes. Together, these factors trigger a
cascade of events, involving engagement of the immune system, acute
inflammatory injury of axons and glia, recovery of function and
structural repair, post-inflammatory gliosis, and
neurodegeneration. The sequential involvement of these processes
underlies the clinical course characterized by episodes with
recovery, episodes leaving persistent deficits, and secondary
progression. The aim of treatment is to reduce the frequency, and
limit the lasting effects of relapses, relieve symptoms, prevent
disability arising from disease progression, and promote tissue
repair.
[0019] Depression is a common mental disorder characterized by
sadness, loss of interest in activities and by decreased energy.
Depression is differentiated from normal mood changes by the extent
of its severity, the symptoms and the duration of the disorder.
Suicide remains one of the common and often unavoidable outcomes of
depression. If depressive episodes alternate with exaggerated
elation or irritability they are known as bipolar disorder.
Depressive disorders and schizophrenia are responsible for 60% of
all suicides. The causes of depression can vary. Psychosocial
factors, such as adverse living conditions, can influence the onset
and persistence of depressive episodes. Genetic and biological
factors can also play a part.
[0020] An estimated 121 million people currently suffer from
depression. Depression is the leading cause of disability as
measured by YLDs (Years Lived with Disability) and the 4th leading
contributor to the global burden of disease (DALYs=Disability
Adjusted Life Years; The sum of years of potential life lost due to
premature mortality and the years of productive life lost due to
disability) in 2000. An estimated 5.8% of men and 9.5% of women
will experience a depressive episode in any given year. By the year
2020, depression is projected to reach second place of the ranking
of DALYs calculated for all ages, both sexes. In the developed
regions, depression will then be the highest ranking cause of
burden of disease.
[0021] Today the first-line treatment for most people with
depression consists of antidepressant medication, psychotherapy or
a combination of both. Anti-depressants are effective across the
full range of severity of major depressive episodes. Currently,
effective antidepressive therapy is closely related to modulation
or fine-tuning of serotonergic neurotransmission. Drugs that
increase the levels of serotonin in the brain are the most potent
known antidepressants (such as fluoxetine, Prozac.RTM. or
Fluctin.RTM.). Treatments, which have antidepressive effects in
patients, too, are e.g. pharmacological antidepressants such as
lithium, electro-convulsive therapy and physical exercise. Other
interventions include setting up supportive network systems for
vulnerable individuals, families and groups. The evidence regarding
prevention of depression is less conclusive, only a few isolated
studies show that interventions proposed for the prevention of
depression are effective. It is important to have in mind that the
existing drugs are aimed at alleviating symptoms of the disease,
but not primarily to address basic pathophysiological mechanisms
causative to this disease. Therefore, a new treatment is needed
that specifically addresses the newly discovered causal aspects in
depression
[0022] Schizophrenia is one of the most common mental illnesses.
About 1 of every 100 people (1% of the population) is affected by
schizophrenia. This disorder is found throughout the world and in
all races and cultures. Schizophrenia affects men and women in
equal numbers, although on average, men appear to develop
schizophrenia earlier than women. Generally, men show the first
signs of schizophrenia in their mid 20s and women show the first
signs in their late 20s. Schizophrenia has a tremendous cost to
society, estimated at $32.5 billion per year in the US.
Schizophrenia is characterized by several of the following
symptoms: delusions, hallucinations, disorganized thinking and
speech, negative symptoms (social withdrawal, absence of emotion
and expression, reduced energy, motivation and activity),
catatonia. The main therapy for schizophrenia is based on
neuropleptics, such as chlorpromazine, haloperidol, olanzapine,
clozapine, thioridazine, and others. However, neuroleptic treatment
often does not reduce all of the symptoms of schizophrenia.
Moreover, antipsychotic treatment can have severe side effects,
such as tardive dyskinesias. The etiology of schizophrenia is not
clear, although there seems to be a strong genetic influence.
Recently, it has become clear that schizophrenia has at least some
aspects of a neurodegenerative disease. In particular, MR studies
have revealed rapid cortical grey matter loss in schizophrenic
patients (Thompson et al. (2001), Proc Natl Acad Sci U S A, 98,
11650-5; Cannon et al. (2002), Proc Natl Acad Sci USA, 99,
3228-33). Therefore, treatment of schizophrenics with
neuroprotective medication such as GCSF or GMCSF or other
hematopoetic factors is warranted.
[0023] In humans there is a need for ways to increase cognitive
capacities, and boost intelligence. "Intelligence" in modern
understanding is not limited to purely logical or semantic
capabilities. For example, the theory of multiple intelligences by
Howard Gardner evaluates intelligence from evolutionary and
anthropological perspectives and yields a broader view that
includes athletic, musical, artistic, and empathetic capacities as
well as the linguistic/logical abilities that are more commonly
associated with intelligence and measured by IQ tests. This broader
sense of intelligence also extends into the area of creativity. In
addition, there is a non-pathological condition known in the human
as ARML (age-related memory loss) or MC1 (mild cognitive
impairment) or ARCD (age-related cognitive decline) that usually
commences at about age 40, and is different from early signs of
Alzheimer's disease.
[0024] There is a physiological loss of nerve cells throughout
adulthood, estimated to as many as 100,000 neurons a day.
Throughout adulthood, there is a gradual reduction in the weight
and volume of the brain. This decline is about 2% per decade.
Contrary to previously held beliefs, the decline does not
accelerate after the age of 50, but continues at about the same
pace from early adulthood on. The accumulative effects of this are
generally not noticed until older age.
[0025] While the brain does shrink in size, it does not do so
uniformly. Certain structures are more prone to shrinkage. For
example, the hippocampus and the frontal lobes, two structures
involved in memory, often become smaller. This is partly due to a
loss of neurons and partly due to the atrophy of some neurons. Many
other brain structures suffer no loss in size. The slowing of
mental processing may be caused by the deterioration of neurons,
whether they are lost, shrink, or lose connections. This depletion
of fully functioning neurons makes it necessary to recruit
additional networks of neurons to manage mental tasks that would
otherwise be simple or automatic. Thus, the process is slowed
down.
[0026] A portion of the frontal lobe, called the prefrontal cortex,
is involved in monitoring and controlling thoughts and actions. The
atrophy that occurs in this brain region may account for the word
finding difficulties many older adults experience. It may also
account for forgetting where the car keys were put or general
absentmindedness. The shrinkage of both the frontal lobe and the
hippocampus are thought to be responsible for memory difficulties.
Therefore, there also remains a need for improving or enhancing the
cognitive ability of an individual.
[0027] In the past, neuroprotective therapies were mostly explored
in neurodegenerative disorders like Parkinson's and Alzheimer's
disease, and in ischaemic stroke. More recently, however,
neuroprotection has been proclaimed an important goal for multiple
sclerosis (MS) therapy. The basis for widening the scope of
neuroprotection is evidence that neuronal and axonal injury are key
features of MS lesions. Axon loss most likely determines the
persistent neurological deficit in progressive MS. Recent studies
pointed out that axon damage occurs early in the disease and during
lesion development. Two different phases of axon degeneration were
characterized, the first occurring during active myelin breakdown
and the second in chronic demyelinated plaques in which the naked
axon seems more susceptible to further damage. In contrast with
degenerative and ischaemic central nervous system injury, however,
neurodegeneration in MS appears to be caused by an inflammatory,
presumably autoimmune, process. The challenge for neuroprotection
in MS is therefore greater than in degenerative and ischaemic
disorders, because MS requires the combination of neuroprotective
therapy and effective immunomodulation. The exact mechanisms and
effector molecules of axonal degeneration, however, are not yet
defined, and an axon-protective therapy has not yet been
established. (Bruck and Stadelmann (2003), Neurol Sci, 24 Suppl 5,
S265-7) (Hohlfeld (2003), Int MS J, 10, 103-5)
[0028] One group of Neurodegenerative disorders is characterized by
an expansion of trinucleotides. Those neurodegenerative
trinucleotide repeat disorders are chronic and progressive
characterised by selective and symmetric loss of neurons in motor,
sensory, or cognitive systems. Symptoms are often ataxia, dementia
or motor dysfunction. The best known trinucleotide repeat disorder
is Huntingtons disease, others are Spinal and bulbar muscular
atrophy (Kennedy's disease), Autosomal dominant spinocerebellar
ataxia's: Type 1 SCA1, Type 2 SCA2, Type 3 (Machado-Joseph disease)
SCA3/MJD, Type6 SCA6, Type 7 SCA7, Type 8 SCA8, Friedreich's Ataxia
and Dentatorubral pallidoluysian atrophy DRPLA/Haw-River syndrome.
(Hardy and Gwirm-Hardy (1998), Science, 282, 1075-9) (Martin
(1999), N Engl J Med, 340, 1970-80) (Schols, et al. (1997), Ann
Neurol, 42, 924-32)
[0029] Huntington's disease (HD) is an autosomal dominant,
inherited, neuropsychiatric disease which gives rise to progressive
motor, cognitive and behavioural symptoms. The course of
Huntington's is characterized by jerking uncontrollable movement of
the limbs, trunk, and face (chorea); progressive loss of mental
abilities; and the development of psychiatric problems.
Huntington's disease progresses without remission over 10 to 25
years and usually appears in middle age (30-50 years). Juvenile HD
(also called Westphal variant or akinetic-rigid HD) develops before
the age of 20, progresses rapidly, and produces muscle rigidity in
which the patient moves little, if at all (akinesia). It is
estimated that one in every 10,000 persons--nearly 30,000 in the
United States--have Huntington's disease. Juvenile Huntington's
occurs in approximately 16% of all cases. Its core pathology
involves degeneration of the basal ganglia, in particular, the
caudate and putamen, and is caused by an unstable expansion of the
trinucleotide CAG, coding for glutamine, in a single autosomal gene
IT-15 on chromosome 4, coding for a mutated form of the protein,
huntingtin. How the mutation of gene IT-15 alters the function of
the protein is not well understood.
[0030] Treatment of Huntington's disease focuses on reducing
symptoms, preventing complications, and providing support and
assistance to the patient. There are several substances available
today for the treatment of chorea. Other neurological symptoms,
such as dystonia, can be treated, but treatment is associated with
a high risk of adverse events. Psychiatric symptoms, on the other
hand, are often amenable to treatment and relief of these symptoms
may provide significant improvement in quality of life. (Bonelli
and Hofmann (2004), Expert Opin Pharmacother, 5, 767-76). Most
drugs used to treat the symptoms of HD have side effects such as
fatigue, restlessness, or hyperexcitability. Cystamine
(=Decarboxycystine) alleviates tremors and prolongs life in mice
with the gene mutation for Huntington's disease (HD). The drug
appears to work by increasing the activity of proteins that protect
nerve cells, or neurons, from degeneration. The study suggests that
a similar treatment may one day be useful in humans with HD and
related disorders. (Karpuj, et al. (2002), Nat Med, 8, 143-9)
[0031] Glaucoma is the number one cause of preventable blindness in
the United States. Glaucoma is a group of conditions where the
nerve of sight (the optic nerve) is damaged, usually as a result of
increased pressure within the eye, but glaucoma can also occur with
normal or even below-normal eye pressure. The lamina cribrosa (LC)
region of the optic nerve head (ONH) is a major site of injury in
glaucomatous optic neuropathy. It is a patchy loss of vision, which
is permanent, but progress of the condition can be minimised if it
is detected early enough and treatment is begun. However, if left
untreated, glaucoma can eventually lead to blindness. Glaucoma is
one of the most common eye disorders amongst older people.
Worldwide, it is estimated that about 66.8 million people have
visual impairment from glaucoma, with 6.7 million suffering from
blindness.
[0032] There are a variety of different types of glaucoma. The most
common forms are: Primary Open-Angle Glaucoma; Normal Tension
Glaucoma; Angle-Closure Glaucoma; Acute Glaucoma; Pigmentary
Glaucoma; Exfoliation Syndrome or Trauma-Related Glaucoma.
[0033] Glaucoma can be treated with eyedrops, pills, laser surgery,
eye operations, or a combination of methods. The whole purpose of
treatment is to prevent further loss of vision. This is imperative
as loss of vision due to glaucoma is irreversible. Keeping the IOP
under control is the key to preventing loss of vision from
glaucoma.
[0034] Peripheral neuropathy is a pain initiated or caused by a
primary lesion or dysfunction of the nervous system. Many
classification systems exist but typically it is divided into
central (i.e. thalamic, post-stroke pain) and peripheral deafferent
pain (i.e. meralgia paresthetica). Neuropathies may affect just one
nerve (mononeuropathy) or several nerves (polyneuropathy). They are
allodynia, hyperalgesia, and dysesthesias. Common symptoms include
burning, stabbing, electric shock, or deep aching sensations. The
causes of neuralgia include diabetic neuropathy, trigeminal
neuralgia, complex regional pain syndrome and post-herpetic
neuralgia, uremia, AIDS, or nutritional deficiencies. Other causes
include mechanical pressure such as compression or entrapment,
direct trauma, penetrating injuries, contusions, fracture or
dislocated bones; pressure involving the superficial nerves (ulna,
radial, or peroneal) which can result from prolonged use of
crutches or staying in one position for too long, or from a tumor;
intraneural hemorrhage; exposure to cold or radiation or, rarely,
certain medicines or toxic substances; and vascular or collagen
disorders such as atherosclerosis, systemic lupus erythematosus,
scleroderma, sarcoidosis, rheumatoid arthritis, and polyarteritis
nodosa. A common example of entrapment neuropathy is carpal tunnel
syndrome, which has become more common because of the increasing
use of computers. Although the causes of peripheral neuropathy are
diverse, they produce common symptoms including weakness, numbness,
paresthesia (abnormal sensations such as burning, tickling,
pricking or tingling) and pain in the arms, hands, legs and/or
feet. A large number of cases are of unknown cause.
[0035] Treating the underlying condition may relieve some cases of
peripheral neuropathy. In other cases, treatment may focus on
managing pain. Therapy for peripheral neuropathy differs depending
on the cause. For example, therapy for peripheral neuropathy caused
by diabetes involves control of the diabetes. In cases where a
tumor or ruptured disc is the cause, therapy may involve surgery to
remove the tumor or to repair the ruptured disc. In entrapment or
compression neuropathy treatment may consist of splinting or
surgical decompression of the ulnar or median nerves. Peroneal and
radial compression neuropathies may require avoidance of pressure.
Physical therapy and/or splints may be useful in preventing
contractors. Peripheral nerves have a remarkable ability to
regenerate themselves, and new treatments using nerve growth
factors or gene therapy may offer even better chances for recovery
in the future.
[0036] The lysosomal storage diseases are a group of about 40
different diseases, each characterised by a specific lysosomal
enzyme deficiency in a variety of tissues. They occur in total in
about 1 in 5,000 live births and display considerable clinical and
biochemical heterogeneity. The majority are inherited as autosomal
recessive conditions although two (Hunter disease and Fabry
disease) are X-linked. They include Tay-Sachs disease, a
gangliosidosis, and Gaucher's and Niemann-Pick's diseases, which
are lipid storage disorders. Most of these diseases affect the
brain and are fatal. (Brooks, et al. (2002), Proc Natl Acad Sci
USA, 99, 6216-21)
[0037] There has been limited success in only treating the symptoms
of these diseases. One way is to replace the enzyme to put a normal
gene into the body that can make the enzyme by bone marrow or stem
cell transplant or gene therapy. Bone marrow transplantation (BMT)
has been successful in several LSDs and allowed long term survival
with less severe symptoms. Enzyme replacement therapy (ERT) has
been available for patients with Gaucher disease for over 10 years
and has provided enormous benefit.
[0038] Spinal cord injury (SCI) occurs when a traumatic event
results in damage to cells within the spinal cord or severs the
nerve tracts that relay signals up and down the spinal cord. The
most common types of SCI include contusion (bruising of the spinal
cord) and compression (caused by pressure on the spinal cord).
Other types of injuries include lacerations (severing or tearing of
some nerve fibers, such as damage caused by a gun shot wound), and
central cord syndrome (specific damage to the corticospinal tracts
of the cervical region of the spinal cord). Severe SCI often causes
paralysis (loss of control over voluntary movement and muscles of
the body) and loss of sensation and reflex function below the point
of injury, including autonomic activity such as breathing and other
activities such as bowel and bladder control. Other symptoms such
as pain or sensitivity to stimuli, muscle spasms, and sexual
dysfunction may develop over time. SCI patients are also prone to
develop secondary medical problems, such as bladder infections,
lung infections, and bed sores. While recent advances in emergency
care and rehabilitation allow many SCI patients to survive, methods
for reducing the extent of injury and for restoring function are
still limited. Immediate treatment for acute SCI includes
techniques to relieve cord compression, prompt (within 8 hours of
the injury) drug therapy with corticosteroids such as
methylprednisolone to minimize cell damage, and stabilization of
the vertebrae of the spine to prevent further injury. The types of
disability associated with SCI vary greatly depending on the
severity of the injury, the segment of the spinal cord at which the
injury occurs, and which nerve fibers are damaged.
[0039] In view of the above, there is a need for treating
neurological and/or psychiatric conditions, such as neurological
diseases that relate to the enhancement of plasticity and
functional recovery, or cell-death in the nervous system. In
particular, there is a need for treating neurological diseases by
providing neuroprotection to the neural cells involved or to induce
neurogenesis to recover from neuronal loss.
SUMMARY OF THE INVENTION
[0040] Accordingly, one object of the present invention is to
provide a method of treating a neurological or a psychiatric
condition in a mammal by administering to the mammal a
hematopoietic factor such as GCSF, GM-CSF, IL-3, IL-5, derivatives
thereof, mimetics thereof and combinations thereof, or cells
secreting these factors, to treat the condition.
[0041] Another object of the present invention is to provide a
method of treating a neurological condition in a mammal, by
conditioning a neural stem cell composition with a hematopoietic
factor such as GCSF, GM-CSF, IL-3, IL-5, derivatives thereof,
mimetics thereof and combinations thereof, and subsequently
administering the neural stem cells to a mammal for the treatment
of the condition.
[0042] Another object of the present invention is to provide a
method of treating a neurological condition in a mammal by
agonizing a GMCSF receptor, a GCSF receptor, IL-3 receptor, Il-S
receptor or combinations of these to treat the neurological
condition. Another object of the present invention is to provide a
method of enhancing the survival of a cell transplanted into a
mammal, by introducing into the cell one or more polynucleotides
which encode GCSF, GM-CSF, IL-3, IL-5, derivatives thereof,
mimetics thereof and/or combinations thereof prior to transplanting
the cell into the mammal, whereby the cell expresses the
hematopoietic factor in an amount sufficient to enhance the
survival of the cell relative to the cell survival prior to the
introduction of the polynucleotides.
[0043] Another object of the present invention is to provide a
method of enhancing the viability of a neural cell culture by
providing GCSF, GM-CSF, IL-3, IL-5, derivatives thereof, mimetics
thereof and/or combinations thereof to enhance the viability of the
neural cell culture relative to the culture prior to providing the
hematopoietic factor. In such a method, the hematopoietic factors
can be used to contact the cells of the culture or may be provided
using polynucleotides that encode and express the hematopoietic
factors.
[0044] An other object of the present invention is to provide a
method to treat a neurological condition such as trinucleotide
repeate disorder, a peripheral neuropathy, a lysosomal storage
disease, a Parkinsonism or a Glaucoma with a hematopoietic factor
such as GCSF, GMCSF, IL-3 or IL-5 combinations thereof or fusion
proteins thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] FIG. 1 demonstrates effective neuroprotection by GCSF in
vivo and in vitro. A. The extent of neuroprotection of GCSF after
focal cerebral ischemia (filament model; middle cerebral artery
occlusion, MCAO) as measured by TTC-staining. The values of the
y-axis relate to percent of infarction of the total hemisphere
(data are mean .+-.SD; T-test; p<0.05). B. Cell survival assay
in NGF-treated PC12 cells under increasing oxidative stress by
H.sub.2O.sub.2 (O uM, 400 uM, 750 uM). GCSF treatment produces
dramatic increases in cell survival. In comparison, cell survival
after treatment of the cells with Erythropoetin (EPO), a known
neuroprotective substance, is given. Y-axis: Relative (Rel) cell
survival (light units of luciferase activity).
[0046] FIG. 2A shows a RT-PCR specific for the mouse GCSFR. GCSF-R
RNA was detected in the brain tissue with the expected size of 567
bp. The identity was verified by sequencing the PCR product.
[0047] FIG. 3 Representative immunoblots of GCSF-R. Using the
GCSF-R antiserum a band at about 130 kDa is detectable in tissue of
the rat cortex (lane 1). Additional bands of lower molecular weight
most probably reflect break down products. After preabsorption of
the antiserum with the respective peptide, no bands are yet
detectable (lane 2).
[0048] FIG. 4 Immunohistochemistry showing the distribution of
GCSF-receptor in different brain regions in the mouse (paraffin
sections, 2 .mu.m). a-d: localization of GCSF-R in the hippocampus.
Note that the antibody predominantly stains neurons in the CA3 area
(a,b), with a sharp boundary between the CA3 and CA2 region (c,
arrow). GCSF-R is distributed over the soma, as well as processes
of neurons (b, arrow). Note the presence of the receptor in the
hilus and the basal cell layers of the dentate gyrus (d, arrow).
GCSF-Receptor was also detected in cortical areas: piriform cortex
(e), and perirhinal cortex (f) as examples. In the cerebellum,
Purkinje cells are labeled (g, arrow). Also, some of the large
mitral cells in the olfactory bulb are GCSF-R positive (h, arrow).
Strong staining is exhibited by the anterior columns in the spinal
cord (i, j), and higher magnification identifies the large
motoneurons as GCSF-R positive (k,l). Note that the neuronal
processes are strongly labeled. In the midbrain, neurons in the
substantia nigra show GCSF-R positivity (m). Especially, all
neurons in the pars compacta (SNC) are labeled (arrow in m, and n).
Also, in the pars reticulata, several neurons express GCSF-R(O).
Apart from neurons, oligodendrocytes in white matter tracts are
stained, for example, in the anterior commissure (p, arrow).
Surprisingly, the staining of the GCSF ligand (antibody sc13102,
Santa Cruz) colocalizes with the expression of its receptor
(antibody sc694, Santa Cruz) (FIG. 4 q-u). This argues for a
autocrine mechanism as a protective measure of neurons against
noxious stimuli. In the hippocampus, the same subfield specificity
is observed for the GCSF ligand (q: GCSFR, r: GCSF, arrows point to
the border between subfields CA 2-3, ca3 and ca2 labels indicate
the subfield). This specificity coincides with known differences in
susceptibilities of these regions against ischemic damage, and
argues again for a neuroprotective function of the GCSF system.
Also, in the dentate gyrus, the same interesting pattern of
expression in the hilus and the subgranular zone is observed (FIG.
4s, GCSF receptor; FIG. 4t, GCSF; arrows point to one neuron in the
subgranular zone, labels: s: subgranular zone, h: hilus of the
dentate gyrus), which underlines the importance of the GCSF system
for neurogenesis, and nicely parallels the expression of receptor
and ligand on neurospheres (see FIG. 13). Interestingly, GCSF is
also expressed in the large motoneurons of the spinal cord (FIG. 4
u) where its receptor is also expressed (FIG. 4 i-l).
[0049] FIG. 5 shows a staining for the GCSFR on cortical (a, b) and
hippocampal cultured neurons (c, d). The receptor is both present
on the somata and processes of the neurons. Not all neurons on the
slide were labelled. Preincubation of the antibody with the
respective peptide, or omission of the primary antibody did not
result in specific staining (not shown).
[0050] FIGS. 6 and 7 show the immunohistochemical results obtained
with an antibody against STAT3. FIG. 6: STAT3 immunohistochemistry.
Note, that numerous neuronal nuclei are positively stained in the
cortical penumbra of GCSF treated rats (b, arrows) compared to the
cortical periinfarct area of a placebo treated animal (a, arrows;
left: infarct; right: penumbra; original magnification .times.200).
FIG. 7: Cortical neurons in the unaffected contralateral side (CL)
and ipsilateral in the vicinity of the infarction (IL) were
quantified in GCSF treated animals and controls. There was a
significant activation of STAT3 in neurons adjacent to the
infarction in the GCSF-treated group as quantified by counting
neurons with nuclear translocation of STAT3 (*p<0.05,
t-test).
[0051] FIG. 8 shows the effect of GCSF treatment in the
photothrombotic bengal rose model of cerebral ischemia. A, rotarod
performance; B, neurological score, including beam balance; C, D:
adhesive tape removal test, measured on the ipsi-(C), as well as
contralateral side (D). Legend: ischemia: group of ischemic rats,
non-treated; ischemia +GCSF: group of ischemic rats treated with
GCSF; sham +GCSF: sham-operated animals, treated with GCSF; sham:
sham-operated animals, untreated. L: tape-removal test on the left
paw; R: tape-removal test on the right paw. Note that there is an
effect on both sides in the tape-removal test (C,D), probably
caused by a predominant motor deficit when the tape is on the
ipsilateral side, and a predominant sensor deficit, when the tape
is on the contralateral side.
[0052] FIG. 9 shows the upregulation of the GCSF-Receptor in the
bengal-rose model 48 h after induction of photothrombosis on the
contralateral side to the ischemia. A, scheme of a coronal section
of a rat brain, tissue samples 3 and 4 were used for the
quantification of the GCSF receptor mRNA compared to the same
tissue samples from sham-operated rats. B, quantification of GCSF
receptor mRNA in the cortical penumbral samples (samples 3 and 4
from A). An initial upregulation at 6 h after ischemia induction on
the ipsilateral side is followed by an upregulation on the
contralateral side at 48 h after the infarct. This contralateral
upregulation was also seen with the GMCSF receptor (see below).
[0053] FIG. 10 shows an alignment of the GCSF from different
species using the ClustalW algorithm (SEQ ID NOS:28-33)
(MEGALIGN.TM., Lasergene, Wis.).
[0054] FIG. 11 shows an alignment of GCSF receptors from mouse and
human, and a fragment of rat using the ClustalW algorithm (SEQ ID
NOS: 34-36) (MEGALIGN.TM., Lasergene, Wis.).
[0055] FIG. 12 demonstrates the presence of the GCSF receptor on
adult neuronal stem cells (nsc) by RT-PCR (reverse transcription
PCR). Shown is an agarose gel. Lane 1: size marker; lane 2: PCR
products from neuronal stem cells (nsc), visible is the rat
GCSFR--specific band (279 bp); lane 3: negative control.
[0056] FIG. 13 demonstrates the presence of the GCSF-Receptor and
GCSF on neural stem cells. A. DAPI stain of a neurosphere for
visualization of all cells, B, the same neurosphere stained with an
antibody directed against the GCSF receptor. C,D neurosphere
stained with DAPI (C) and an antibody for GCSF (D).
[0057] FIG. 14 demonstrates the rapid uptake of biotinylated GCSF
after intraperitoneal injection into mice. A, Western blot of serum
from mice sacrificed at 1, 2, 4, 6, 20, 28 h post injection of 7.5
ug GCSF/mouse. B. ELISA of Serum GCSF after i.p. injection. There
is rapid uptake of GCSF from the peritoneum with serum peak levels
at 2 hrs., demonstrating applicability of this administration
route.
[0058] FIG. 15 shows the identification of the GMCSF-Receptor as an
upregulated mRNA after induction of photothrombosis (bengal rose
model) on the ipsilateral and contralateral side to the ischemia. A
shows a schematic coronal section of a mouse brain and areas of
interest are marked in grey; B shows a section of an RMDD-Gel, on
which the transcript of the GMCSF-Receptor was identified as being
regulated. The lanes represent RT-PCR-products on RNA samples of
mouse brain. Samples were taken from cortex penumbra at different
timepoints after the stroke (3 and 4 in A, respectively).
[0059] FIG. 16 shows the verification of the upregulation of the
GMCSF-Receptor in the bengal-rose model at 48 h by quantitative
RT-PCR by applying the LightCycler-System. Samples were taken at 6
h, 48 h and 21 d after induction of photothrombosis and induction
levels were compared to sham-operated animals. On the ipsilateral
hemisphere the upregulation of the GMCSF receptor is maximal early
after the cortical ischemia and drops steadily until day 21. On the
corresponding contralateral cortex-sample, the upregulation is seen
most clearly at 2 days after the infarct, and is still moderately
upregulated at day 21. This regulation pattern on the contralateral
side is reminiscent of the GCSF receptor (see above).
[0060] FIG. 17 shows an alignment of GMCSF receptors from human,
mouse, and the sequence from rat identified as an upregulated
transcript (SEQ ID NOS:22, 23 and 24) (ClustalW algorithm,
MEGALIGN.TM., Lasergene, Wis.). It is concluded from this homology
that the identified sequence is the rat GMCSF receptor.
[0061] FIG. 18 shows an alignment of GMCSF from human, mouse, and
rat (SEQ ID NOS: 25, 26, and 27) (ClustalW algorithm, MEGALIGN.TM.,
Lasergene, Wis.).
[0062] FIG. 19 Immunohistochemistry showing the distribution of
GMCSF-receptor alpha (a-d) and GMCSF (e-g) in different brain
regions in the mouse (paraffin sections, 2 .mu.m). a: In the
cerebellum, Purkinje cells are labeled (arrow). b-d: localization
of GMCSF-R alpha in the hippocampus. Note the presence of the
receptor in the hilus of the dentate gyrus (b, arrow). The antibody
predominantly stains neurons in the CA3 area (c) with a sharp
boundary between the CA3 and CA2 region (c, arrow). GMCSF-R alpha
is distributed over the soma (CA3), as well as processes of neurons
(CA2). GMCSF-receptor was also detected in the entorhinal cortex
(d). GMCSF shows similar distribution in comparison with
GMCSF-receptor alpha. Note that the GMCSF antibody stains as well
Purkinje cells (e, arrow), neurons in the CA3 area (D) with sharp
boundary between CA3 and CA2 region (f, arrow), and neurons in the
entorhinal cortex (g). FIG. 19 h-m: Shown here is the surprising
colocalization of the GMCSF receptor and its ligand in neurons. h,
localization of the GMCSF receptor (antibody sc690, Santa Cruz) in
neurons in hippocampal subfield CA3, arrow points to the sharp
expression boundary to the adjacent CA2 region. i, the GMCSF ligand
(antibody sc13101) shows the same subfield-specific expression, the
arrow points to one neuron in the CA3 region. j, expression of the
GMCSF receptor in the hilus and subgranular zone of the dentate
gyrus. An arrow points to a neuron in the subgranular zone. k,
expression of the GMCSF ligand in that region. Here, the ligand
shows a slightly different expression compared to its receptor.
There is clear expression in the CA3 region (arrow), but less in
the dentate gyrus region. l,m: expression of the GMCSF receptor (1)
and ligand (m) in the large motoneurons of the spinal cord. This
surprising expression is a clear indication for the therapeutic
applicability of the GMCSF system for motoneuron diseases,
especially amyotrophic lateral sclerosis (ALS).
[0063] FIG. 20 shows a staining for the GMCSFR alpha on cortical
neuronal cultures. The receptor is both present on the somata and
processes of the neurons (verified by double labeling with an
antibody directed against the nuclear epitope NeuN, and an antibody
for synaptophysin, which is not included in the Figure).
Preincubation of the antibody with the respective peptide, or
omission of the primary antibody did not result in specific
staining (not shown).
[0064] FIG. 21 demonstrates the presence of the GMCSF-receptor
alpha on adult neuronal stem cells (nsc) and on PC12 cells (PC12)
by RT-PCR. Shown is an agarose gel. Lane 1: size marker (M); lane
2: PCR on neuronal stem cells (nsc); lane 3: PCR on PC12 cells
(PC12); lane 4: negative control (neg). The rat GM-CSFR
alpha-specific band (176 bp) is visible in lanes 2 and 3.
[0065] FIG. 22 demonstrates the presence of the GMCSF-receptor
alpha on adult neuronal stem cells (nsc) by immunocytochemistry.
Shown is one neurosphere that is stained with DAPI (A, stains all
cell nuclei), and an antibody specific for the GMCSF receptor (B)
(magnification 10.times.).
[0066] FIG. 23 demonstrates effective neuroprotection by GMCSF in
vitro. Cell survival assay in NGF-treated PC12 cells under
increasing oxidative stress by H.sub.2O.sub.2 (O uM, 400 uM, 750
uM). GMCSF treatment produces dramatic increases in cell survival.
In comparison, cell survival after treatment of the cells with
Erythropoetin (EPO; 0.5 U/ml), a known neuroprotective substance,
is given. Y-axis: Rel. cell survival (light units of luciferase
activity).
[0067] FIG. 24 shows the effect of intravenously applied G-CSF on
infarct volume in the rat MCAO model when applied 120 min after
onset of ischemia compared to no C-CSF administration
(control).
[0068] FIG. 25 shows TTC-staining in the hippocampus and cortex for
the G-CSG receptor and G-CSF. The data shows that the GCSF receptor
(a, d, g) shows a co-localization with its ligand (b, e, h) both in
the hippocampus (a-c dentate gyrus, d-f hilus) and the cortex
(g-i).
[0069] FIG. 26 shows coexpression of both the G-CSF and GM-CSF
receptors on neurons in the dentate gyrus (a-c) and the hilus (d-f)
of the hippocampus as well as in the cortex (g-i). The GCSF
receptor (a, d, g) and the GMCSF receptor (b, e, h) are expressed
on the same neurons in both the hippocampus and the cortex (c, f,
i).
[0070] FIG. 27 shows that G-CSF acts anti-apoptotically by
activating stat3 in neurons.
[0071] FIG. 28 (arts I and II) A shows a very strong upregulation
of GCSF 2 h and 6 h after focal ischemia on the ipsi- and
contralateral side, whereas the receptor is moderately regulated
(B) after 6 h. An induced expression of GCSF is not specific to the
MCAO model, but could also be seen albeit to a lesser degree in
global ischemia (C).
[0072] FIG. 29 shows G-CSF and its receptor in the penumbra of the
infarct (Benegal Rose).
[0073] FIG. 30 shows the expression of GCSF receptors (a, d, g) and
doublecortin (b, e, h) on neurons in the dentate gyrus (a-f) and
the hilus (g-i) of the hippocampus,
[0074] FIG. 31 shows a strong and concentration dependent
upregulation of the neuronal markers NSE and beta III-tubulin 4 d
after GCSF treatment. PLP and GFAP are moderately regulated in
dependency of the GCSF-concentration. Error bars indicate standard
deviations, calculated from 3-fold serially diluted cDNA-samples,
and reflect reliability of measurements.
[0075] FIG. 32 shows co-localisation of GMCSF and its receptor in
the brain. The GMCSF receptor (a, d, g) and GMCSF (b, e, h) are
colocalised on neurons in the dentate gyrus (a-c), the hilus (d-f),
and the cortex (g-i).
[0076] FIG. 33 shows that GCSF and its receptor are upregulated by
cerebral ischemia.
[0077] FIG. 34 shows the expression of the GMCSF receptor (a, d, g)
and doublecortin (b, e, h) on neurons in the dentate gyrus (a-c)
and the hilus (d-i) of the hippocampus.
[0078] FIG. 35 shows the differentiation potential of neural stem
cells and the specific marker expressions of differentiated cells
and that treatment of neural stem cells with 10 ng/ml GMCSF results
in a significantly induced expression of beta III-tubulin (n=3;
p<0.05, two-tailed t-test) and to a lesser extend of NSE, a
marker for mature neurons (B).
[0079] FIG. 36 shows that G-CSF passes the blood-brain-barrier
(BBB).
[0080] FIG. 37 shows that GM-CSF passes the blood-brain-barrier
(BBB).
[0081] FIG. 38 shows the efficacy of G-CSF for the treatment of
Amyotrophic Lateral Sclerosis (ALS).
[0082] FIG. 39 shows the efficacy of GCSF in rodent models of
Parkinson's disease (PD).
[0083] FIG. 40 shows that GMCSF acts anti-apoptotically in neurons
by activating stat3 pathways, part I shows that GMCSF inhibits PARP
cleavage, that is specifically occurring as a sign of apoptosis.
Cell death was induced in primary neurons by using the NO-donor
NOR-3. Part II shows that GMCSF does not lead to increased
phosphorylation of STAT1 ("pSTAT1") or STAT5 ("pSTAT5"), although
the proteins themselves are expressed in neurons. part III A shows
that GMCSF leads to a time-dependent activation of STAT3, that is
maximal at 5 min following the GMCSF stimulus. B, quantification of
three independent experiments. C. Activation of STAT3 by
phosphorylation can be inhibited by the JAK2 inhibitor AG490. part
IV shows that GMCSF strongly induces the expression of the stat3
target genes Bcl2, and BclXl. These genes are known as being
antiapoptotic.
[0084] FIG. 41 demonstrates that there is a significant reduction
of infarct volume in the GMCSF-treated animals, both at the early
(part 1), and at the late time window of 3 h (part II).
[0085] FIG. 42 shows the upregulation of IL-5 in focal ischemia at
2 h and 6 h by quantitative RT-PCR by applying the
Light-Cycler-System. Samples were taken at 2 h, 6 h and 20 h after
induction of MCAo in rats and induction levels were compared to
sham-operated animals. On the ipsilateral hemisphere the
upregulation of the IL-5 mRNA is rising early after the focal
ischemia and reaches its maximum 6 h after the stroke. 20 h after
onset normal IL-5 level is reached. On the corresponding
contralateral cortex-sample, a slight upregulation is seen 6 h
after the infarct.
[0086] FIG. 43 shows the induction of both, PI3K/Akt pathway and
ERK-pathway, in neurons after G-CSF-treatment. In FIG. 43A, B and D
the lanes show different timepoints after onset of G-CSF treatment.
In FIG. 43A the phosphorylation of Akt (upper lane) compared to
total Akt-Protein is shown. Akt was phosphorylated 5 min after GCSF
addition. In FIG. 43B the amount of phosphorylation of PDK1 (upper
lane) compared to total PDK1-Protein is shown. PDK1 was
phosphorylated 5 min after G-CSF addition with a peak after 30 min
of G-CSF exposure. FIG. 43C shows that the PI3-kinase inhibitor
LY294002 completely blocked phosphorylation of Akt 5 min after
G-CSF addition. FIG. 43D shows the phosphorylation of ERK1, 2 and 5
after G-CSF addition. The amount of phosphorylated ERK1/2 peaked at
5-15 min after G-CSF addition, while most ERK5 was phosphorylated
at 30 min of exposure.
[0087] FIG. 44 shows the induction of both, PI3K/Akt pathway and
ERK-pathway, in neurons after GM-CSF-treatment. In FIGS. 44A and B
the lanes show different timepoints after onset of G-CSF treatment.
In FIG. 44A the phosphorylation of Akt (upper lane) and
phosphorylation of PDK1 (Third lane) compared to total Akt-(second
lane) and PDK1-protein (fourth lane) is shown. Akt and PDK1 were
phosphorylated 5 min after GCSF addition. The blot also shows that
the PI3-kinase inhibitor LY294002 completely blocked
phosphorylation of Akt 5 min after GM-CSF addition. FIG. 44B shows
the phosphorylation of ERK1/2 and 5 after GM-CSF addition. The
amount of phosphorylated ERK1/2 peaked 5 min after GM-CSF addition,
while ERK5 was phosphorylated after 5 min of exposure and stayed
constant.
[0088] FIG. 45 shows that GM-CSF is upregulated after cell death in
vitro.
[0089] FIGS. 46a and b shows that IL-3 and IL-5 have an
anti-apoptotic effect on cells after Camptothecin treatment at
specific concentrations (rising from 1 to 100 ng/ml). Given are
Luminiscence values of detected Caspase-3 and -7 activity as a
detector for Apoptosis (Caspase Glow assay (Promega).
[0090] FIG. 46a shows that IL-3 is protective at concentrations of
1-20 ng/ml in rat neuronal cultures and human neuroblastoma cells
(SHSY5-Y).
[0091] FIG. 46b shows that IL-5 has its highest protectivity at a
concentration of ng/ml in rat neuronal cultures and human
SHSY5-Y.
[0092] FIG. 47 shows the induction of PI3K/Akt pathway after IL-3
treatment. Given are different timepoints after onset of IL-3
treatment (5 and 60 min after onset). The first lane in FIG. 47
shows the phosphorylation of Akt. Akt was phosphorylated 5 min
after IL-3 addition and was still phosphorylated 1 h later. The
second lane shows that PDK was phosphorylated after 5 min of IL-5
and was still phosphorylated 1 h later, too. FIG. 48 shows the
induction of PI3K/Akt pathway after IL-5 treatment. Given are
different timepoints after onset of IL-5 treatment (5 and 60 min
after onset). The first lane in FIG. 48 shows the phosphorylation
of Akt. Akt was phosphorylated 5 min after IL-5 addition and was
still phosphorylated 1 h later. The second lane shows that PDK was
phosphorylated after 5 min of IL-5 and was still phosphorylated 1 h
later, too.
[0093] FIG. 49 shows that the infarct volume in an additional model
of cortical ischemia was reduced after GCSF treatment. Given is the
average value of the measured infarct volume of 6 respectively 5
animals. The infarct volume is significantly reduced if GCSF is
given 1 h after onset of ischemia.
[0094] FIG. 50 shows that GCSF stimulated the differentiation of
neuronal stem cells toward a neuronal phenotype. Cells were
transfected with a Luciferase under the control of
.beta.-Tubulin-Promotor. Given are relative luciferase signals
after stimulation with different concentrations of GCSF. The more
GCSF is added to the culture medium, the more Luciferasesignal can
be detected. This shows that GCSF triggers the differentiation
towards a neuronal phenotype.
[0095] FIG. 51 shows that GMCSF stimulated the differentiation of
neuronal stem cells toward a neuronal phenotype. Cells were
transfected with a Luciferase under the control of
.beta.-Tubulin-Promotor. Given are relative luciferase signals
after stimulation with different concentrations of GMCSF. The more
GMCSF is added to the culture medium, the more Luciferasesignal can
be detected. This shows that GMCSF triggers the differentiation
towards a neuronal phenotype.
[0096] FIG. 52 demonstrates that GMCSF triggers the differentiation
towards a neuronal phenotype. Given are the results of a FACS
analysis of NSC after GMCSF treatment. MAP-2 as a neuronal marker
protein is detected by a fluorescent labeled antibody. The bars
give the percentage of MAP-2-positive cells in the sample analyzed.
This showed that GMCSF induced the expression of a typically
neuronal protein.
[0097] FIG. 53 shows the detection of GMCSF receptor (GMCSFR) and
GMCSF in human brain slices. 53a and d show the detection of
GMCSFR, b and e show GMCSF and c and f reflect an overlay of a and
b and d and e, respectively. The merged pictures show that in human
brain GMCSF and its receptor are expressed in the same cell.
[0098] FIG. 54 shows the detection of GCSF receptor (GCSFR) in
human brain slices from cortex. 54a and d show the detection of
GCSFR, b and e show a DAPI-staining of the cell nuclei and c and f
reflect an overlay of the a and b and d and e, respectively. The
pictures show that GMCSF is expressed in human Cortex.
[0099] FIG. 55 shows that GCSF was upregulated after cell death
induction. Given are the relative values of GCSF-mRNA expression in
neuronal cell culture after H.sub.2O.sub.2 treatment. Stimulation
with rising concentrations of H.sub.2O.sub.2 lead to an increasing
amount of GCSF-mRNA Synthesis in these stressed cells; GCSF-mRNA
was upregulated up to 3 fold.
[0100] FIG. 56 shows the detection of IL-5 receptor alpha (IL5Ra)
by immunohistochemistry in slices of the rat brain. The expression
of the IL-5 receptor alpha was detected in the frontal Cortex (FIG.
56 a), in the dentate gyrus (FIG. 56 b), in the mitral cells of the
olfactory bulb (FIG. 56 c), and in Purkinje cells of the cerebellum
(FIG. 56 d). This reflects the widespread expression of IL5Ra in
the rat brain.
[0101] FIG. 57: G-CSF and GM-CSF protect human neuroblastoma cells
from Nor3 induced apoptosis. Caspase 3/7 activity of SHSY5Y cells
after treatment with 150 .mu.M Nor3 for 5 h in the presence or
absence of 60 ng/ml G-CSF or 20 ng/ml GM-CSF, as determined with
Caspase Glow assay (Promega).
[0102] FIG. 58: Human and murine GM-CSF both reduce camptothecin
induced cell death in human neuroblastoma cells (SHSY5Y). Caspase
3/7 activity of SHSY5Y cells after treatment with Camptothecin for
5 h in the presence or absence of human or murine GM-CSF (20
ng/ml), as determined with Caspase Glow assay (Promega).
DETAILED DESCRIPTION OF THE INVENTION
[0103] The receptors for human IL-3, IL-5, and GM-CSF are members
of the hematopoietin receptor superfamily. Multi-subunit receptors
may consist of two subunit types such as the receptors for
granulocyte-macrophage CSF (GM-CSF), interleukin-3 (IL-3), and IL-5
where an .alpha. subunit is specific for each ligand and a .beta.
subunit is common to all three .beta..sub.c, with both chains
participating in signalling. In the GM-CSF, IL-3, IL-5 receptor
subfamily, intriguing differences are beginning to emerge that may
have implications for the role of these receptors in hematopoietic
cell function. The major difference lies in the absolute
requirement for IL-3 and IL-5 for dimerization of IL-3Rx with
.beta..sub.c, and IL-5Rx with .beta..sub.c whereas, in contrast, at
least some of the GM-CSFR probably exists as a preformed complex.
(Guthridge, et al. (2004), Blood, 103, 820-7) This shows that
although IL-3, IL-5 and GM-CSF even share a Receptor-Subunit; they
still differ in their specific function.
[0104] IL-3
[0105] Interleukin 3 (IL-3) is a well known hematopoietic factor.
The IL-3 that can be employed in the inventive methods described
herein are those full length coding sequences, protein sequences,
and the various functional variants, chimeric proteins, muteins,
and mimetics that are known and available. The structure of both
the coding DNA and protein are known. For example, DNA encoding
IL-3 and IL-3 protein sequences comprise the sequences of SEQ ID
NOS: 68-84.
[0106] Human IL3 is a protein of 15-17 kDa (133 amino acids). It is
synthesized as a precursor containing a hydrophobic secretory
signal sequence of 19 amino acids. IL-3 contains two putative
glycosylation sites at positions 15 and 70 and contains a single
disulfide bond (Cys16/84). The analysis of bacterial-derived
recombinant IL-3 shows that glycosylation is not required for the
activity of IL-3.
[0107] IL-3 is produced mainly by T-cells following cell activation
by antigens and mitogens, but also by keratinocytes, NK-cells, mast
cells, endothelial cells, and monocytes. IL-3 may be associated
with the extracellular matrix in the form of complexes with heparin
sulfate/proteoglycan. It can thus be stored in a biologically
inactive form but it may exert juxtacrine activities also. The
molecular mechanisms underlying the release from extracellular
matrix stores are still unknown.
[0108] IL-3 is a growth factor that establishes the link between
the immune system and the hematopoietic system. It supports the
proliferation and development of almost all types of hematopoietic
progenitor cells. In rhesus monkeys IL-3 causes the expansion of
all types of circulating hematopoietic progenitor cells. IL-3 also
supports the differentiation of early non-lineage-committed
hematopoietic progenitor cells into granulocytes, macrophages,
erythroid cells, megakaryocytes, and mast cell colonies. IL-3 also
stimulates clonal growth of non-hematopoietic stromal cells in bone
marrow cultures. IL3 is one of the priming factors for
hematopoietic stem cells in vitro and in vivo that makes the cells
responsive to later-acting factors such as Erythropoietin, GM-CSF
and IL6. IL3 also induces the increased expression of receptors for
colony stimulating factors.
[0109] IL-3 also specifically induces the production of enzymes
involved in cellular metabolism, differentiation and DNA/RNA
metabolism. Among other things IL3 induces the expression of
20-alpha-steroid dehydrogenase and of histidine and Ornithine
decarboxylase.
[0110] In another embodiment, the IL-3 that can be used are those
that are encoded by polynucleotide sequence with at least 70%,
preferably 80%, more preferably at least 90% identity to the
wildtype full-length human IL-3 coding sequence, these
polynucleotides will hybridize under stringent conditions to the
coding polynucleotide sequence of the wild-type full length human
IL-3. The terms "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a
polynucleotide will hybridize to its target sequence, to a
detectably greater degree than other sequences (e.g., at least
2-fold over background). Stringent conditions will be those in
which the salt concentration is less than about 1.5 M Na ion,
typically about 0.01 to 1.0 M Na ion concentration (or other salts)
at pH 7.0 to 8.3 and the temperature is at least about 30.degree.
C. for short probes (e.g., 10 to 50 nucleotides) and at least about
60.degree. C. for long probes (e.g., greater than 50 nucleotides),
for example, high stringency conditions include hybridization in
50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. (see Tijssen, Laboratory
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles
of hybridization and the strategy of nucleic acid probe assays",
Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology,
Chapter 2, Ausubel, et al., Eds., Greene Publishing and
Wiley-Interscience, New York (1995)). Amino acid and polynucleotide
identity, homology and/or similarity can be determined using the
ClustalW algorithm, MEGALIGN.TM., Lasergene, Wis.)
[0111] Examples of the various IL-3 functional variants, muteins,
and mimetics include functional fragments and variants (e.g.,
structurally and biologically similar to the wild-type protein and
having at least one biologically equivalent domain), chemical
derivatives of IL-3 (e.g., containing additional chemical moieties,
such as polyethyleneglycol and polyethyleneglycol derivatives
thereof, and/or glycosylated forms), and peptidomimetics of IL-3
(e.g., a low molecular weight compound that mimics a peptide in
structure and/or function (see, e.g., Abell, Advances in Amino Acid
Mimetics and Peptidomimetics, London: JAI Press (1997); Gante,
Peptidmimetica-massgeschneiderte Enzyminhibitoren Angew. Chem. 106:
1780-1802 (1994); and Olson et al., J. Med. Chem. 36: 3039-3049
(1993)).
[0112] The various functional derivatives, variants, muteins and/or
mimetics of IL-3 preferably retain at least 20%, preferably 50%,
more preferably at least 75% and/or most preferably at least 90% of
the biological activity of wild-type mammalian IL-3 activity--the
amount of biological activity include 25%, 30%, 35%, 40%, 45%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 95%; and all values and subranges
there between. Furthermore, the functional derivatives, variants,
muteins and/or mimetics of IL-3 can also have 100% or more of the
biological activity relative to wild-type mammalian IL-3
activity--the amount of biological activity including at least
105%, at least 110%, at least 125%, at least 150%, and at least
200%.
[0113] One example of a functional variant is the human recombinant
interleukin-3 (IL-3; SDZ ILE-964; Sandoz A G, Basel,
Switzerland/Novartis) (Lokker, et al. (1991), J Biol Chem, 266,
10624-31).
[0114] To measure the biological activity of IL-3, several known
assays can be employed singularly or in combination. Those IL-3
functions include its known immunomodulatory functions and to one
or more functions relating to its role in neuroprotection. IL-3 can
be detected in Bioassays employing cell lines that respond to this
factor (e.g., cell lines: AML-193; 32D; B6SUt-A; B13; Da; Ea3.17;
FDCP1; GF-D8; IC-2; KMT-2; L138.8A; LyD9; MO7E; NFS-60; PT-18;
TALL-103; TF-1; TMD2; UT-7).
[0115] These and other assays are described in (Aglietta, et al.
(1993), Blood, 82, 2054-61); (Cohen, et al. (1991), Immunol Lett,
28, 121-6) (Kobayashi, et al. (1989), Blood, 73, 1836-41) (Lemoli,
et al. (1993), Exp Hematol, 21, 1668-72); (Warring a, et al.
(1991), Blood, 77, 2694-700))
[0116] In other embodiments of the present invention combinations
of IL-3 with other hematopoietic factors preparations to support
their therapeutic actions, preferably by its neuroprotective action
can be used. The effect exerted by these combinations can be
cumulative or superadditive/synergistic. In one embodiment, various
IL-3 and/or IL-3 derivatives are used in combination with each
other. Likewise, IL-3 can be used in combination with one or more
additional hematopoietic growth factors such as Erythropoietin, and
derivatives thereof, which has recently been shown to mediate
strong neuroprotective properties (e.g., Brines et al (2000) Proc
Natl Acad Sci USA 97:10526-10531; Cerami et al (2002) Nephrol Dial
Transplant 17:8-12; Siren A L, Ehrenreich H (2001) Eur Arch
Psychiatry Clin Neurosci 251:179-184). In addition, IL-3 can be
used in combination with, for example, various colony stimulating
factors (such as G-CSF, GM-CSF or M-CSF), SCF (stem cell factor),
SCPF (stem cell proliferation factor), various Interleukins (IL1,
IL4, IL5, IL6, IL11, IL12), LIF, TGF-.beta., MIP-1-.alpha.,
TNF-.alpha., and also many other low molecular weight factors.
[0117] In one embodiment the biological activity of IL-3 is
enhanced by fusion to another hematopoietic factor. Examples for
such fusionproteins are the IL-3/GMCSF-fusion protein PIXY321,
Imunex (Vadhan-Raj (1994), Stem Cells, 12, 253-61) (Anderson and
Appelbaum (1994), Curr Opin Hematol, 1, 203-9) (Buescher,
McIlheran, Banks and Vadhan-Raj (1993), Exp Hematol, 21, 1467-72);
or Promegapoietin; IL-3/thrombopoietin, Pharmacia (Farese, Smith,
Giri, Siegel, McKeam and MacVittie (2001), Stem Cells, 19, 329-38).
The enhanced activity can be measured in a biological activity
assay as described above. In one embodiment, the IL-3 is modified
or formulated, or is present as a IL-3 mimetic that increases its
ability to cross the blood-brain barrier, or shift its distribution
coefficient towards brain tissue. An example of such a modification
is the addition of PTD or TAT sequences (Cao et al. (2002) J.
Neurosci. 22:5423-5431; Mi et al. (2000) Mol. Ther. 2:339-347;
Morris et al. (2001) Nat Biotechnol 19:1173-1176; Park et al.
(2002) J Gen Virol 83:1173-1181). These sequences can also be used
in mutated forms, and added with additional amino acids at the
amino- or carboxy-terminus of proteins. Also, adding bradykinin, or
analogous substances to an intravenous application of any IL-3
preparation will support its delivery to the brain, or spinal cord
(Emerich et al. (2001) Clin Pharmacokinet 40:105-123; Sie al et al
(2002) Clin Pharmacokinet 41:171-186).
[0118] IL-3 and IL-3R alpha show a widespread expression in the
brain. Its mRNA was detected in Neurons and Astrocytes (Farrar, et
al. (1989), Blood, 73, 137-40) and is localized in discrete areas
of the brain e.g. in hippocampal neurons but not in glia (Konishi,
et al. (1994), Neurosci Lett, 182, 271-4). IL-3 R was shown to be
expressed by Microglia and Oligodendrocytes and septal cholinergic
neurons. IL-3R alpha-positive cells are mainly present in the
medial septal and basal forebrain region. Tabira et al. have
demonstrated that interleukin 3 (IL-3) has a neurotrophic effect on
central cholinergic neurons and have demonstrated the presence of
IL-3 receptor (IL-3R)beta subunits in septal cholinergic neurons.
Functional IL-3 receptors were expressed in the central cholinergic
neurons and contribute to some physiological roles such as the
differentiation and maintenance of these neurons. (Tabira, et al.
(1998), Ann N Y Acad Sci, 840, 107-16)
[0119] Several members of hematopoietic factors are known to have
neuroprotective effects against axotomized motor neuron death.
Iwasaki et al. have shown that IL-3 and EPO significantly prevented
the loss of motor neurons. Protective potentials is the same
between them. These results suggest that IL-3 and EPO play a role
for motor neuron survival in vivo and suggest the potential use of
these hematopoietic factors in treating diseases that involve
degeneration and death of motor neurons, such as motor neuropathy
and amyotrophic lateral sclerosis. (Iwasaki, et al. (2002), Neurol
Res, 24, 643-6).
[0120] In the central nervous system, interleukin (IL)-3 has been
shown to exert a trophic action only on septal cholinergic neurons
in vitro and in vivo, but a widespread distribution of IL-3
receptor (IL-3R) in the brain does not conform to such a selective
central action of the ligand. Moreover, the mechanism(s) underlying
the neurotrophic action of IL-3 has not been elucidated. Wen et al.
have shown that IL-3 prevents delayed neuronal death in the
hippocampal CA1 field through a receptor-mediated expression of
Bcl-xL protein, which is known to facilitate neuron survival. Since
IL-3R alpha in the hippocampal CA1 region, even though upregulated
in response to ischemic insult, is much less intensely expressed
than that in the CA3 region tolerant to ischemia, the paucity of
IL-3R interacting with the ligand may account for the vulnerability
of CA1 neurons to ischemia. (Wen, et al. (1998), J Exp Med, 188,
635-49).
[0121] Bright et al, in contrast suggest a role of IL-3 in
inflammatory responses by activating Microglia. Microglia, the
resident macrophage of the brain, mediates immune and inflammatory
responses in the central nervous system (CNS). Activation of
microglia and secretion of inflammatory cytokines associate with
the pathogenesis of CNS diseases, including multiple sclerosis
(MS), Alzheimer's disease (AD), Parkinson's disease, prion disease,
and AIDS dementia. IL-3 induces the activation of JAK-STAT and MAP
kinase pathways in microglial cells and leads to a IL3-induced
activation of microglia. (Bright, et al. (2004), Glia, 45, 188-96).
Thus, there is evidence for the presence of the IL-3 receptor and
ligand in the nervous system.
[0122] For IL-3 it was shown that it has a neuroprotective activity
on rat cortical cells in culture. IL-3 had a neuroprotective
activity in an Caspase-3/7 activity-assay in camptothecin treated
primary cortical cultures (FIG. 46a). This shows that IL-3 has the
potential to reduce cell death in neuronal cells. We also have
shown that IL-3 induces Akt-Pathway in these cells, which
demonstrates that a typically anti-apoptotic pathway is activated
by the treatment of neuronal cells with IL-3 (FIG. 47).
[0123] Additionally we could show that IL-3 is effective on human
neuroblastoma cells. Camptothecin treated SHSY5-Y cells had shown a
reduced Caspase 3/7 activity when IL-3 was added (FIG. 46a). In
summary the results show the neuroprotective effect of IL-3 in rat
and human cell culture.
[0124] IL-5
[0125] Interleukin 5 (IL-5) is a well known hematopoietic factor.
The IL-5 that can be employed in the inventive methods described
herein are those full length coding sequences, protein sequences,
and the various functional variants, chimeric proteins, muteins,
and mimetics that are known and available. The structure of both
the coding DNA and protein are known. For example, DNA encoding
IL-5 and IL-5 proteins comprise the sequences of SEQ ID
NOS:85-92.
[0126] The human IL5 cDNA encodes a protein of 115 amino acids.
Interleukin-5 (IL-5) is produced by lymphocytes as a
N-glycosylated, disulfide-linked antiparallel homodimer. Monomeric
forms are biologically inactive. Variable molecular masses of the
native protein are caused by heterogeneous glycosylation.
Non-glycosylated IL5 is also biologically active. The genes
encoding IL-4 and IL-5 are tightly linked and the proteins are
frequently co-expressed although they are under the control of
unrelated promoters. IL-5 belongs to a family of structurally
related cytokines including IL-2, IL-4, GM-CSF and Growth
Hormone.
[0127] While initially identified by a number of groups based on
different biochemical aspects, IL-5 is now known to be the
predominant cytokine in eosinophilia. IL5 is a specific
hematopoietic growth factor that is responsible for the growth and
differentiation of eosinophils. IL5 promotes the growth of immature
hematopoietic progenitor cells BFU-E while it causes
differentiation of CFU-E the proliferation of which is inhibited by
IL5. IL5 strongly stimulates the proliferation, cell activation,
and differentiation of eosinophilic granulocytes.
[0128] IL5 also promotes the generation of cytotoxic T-cells from
thymocytes. In thymocytes IL5 induces the expression of high
affinity IL2 receptors.
[0129] In one embodiment, the proteins that are at least 70%,
preferably at least 80%, more preferably at least 90% identical to
the full-length human IL-5 amino acid sequences can be employed in
the present invention. In another embodiment, the IL-5 that can be
used are those that are encoded by polynucleotide sequence with at
least 70%, preferably 80%, more preferably at least 90% identical
to the wildtype full-length human IL-5 coding sequence, these
polynucleotides will hybridize under stringent conditions to the
coding polynucleotide sequence of the wild-type full length human
IL-5.
[0130] The terms "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a
polynucleotide will hybridize to its target sequence, to a
detectably greater degree than other sequences (e.g., at least
2-fold over background). Stringent conditions will be those in
which the salt concentration is less than about 1.5 M Na ion,
typically about 0.01 to 1.0 M Na ion concentration (or other salts)
at pH 7.0 to 8.3 and the temperature is at least about 30.degree.
C. for short probes (e.g., 10 to 50 nucleotides) and at least about
60.degree. C. for long probes (e.g., greater than 50 nucleotides),
for example, high stringency conditions include hybridization in
50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. (see Tijssen, Laboratory
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles
of hybridization and the strategy of nucleic acid probe assays",
Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology,
Chapter 2, Ausubel, et al., Eds., Greene Publishing and
Wiley-Interscience, New York (1995)). Amino acid and polynucleotide
identity, homology and/or similarity can be determined using the
ClustalW algorithm, MEGALIGN.TM., Lasergene, Wis.)
[0131] The various functional derivatives, variants, muteins and/or
mimetics of IL-5 preferably retain at least 20%, preferably 50%,
more preferably at least 75% and/or most preferably at least 90% of
the biological activity of wild-type mammalian IL-5 activity--the
amount of biological activity include 25%, 30%, 35%, 40%, 45%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 95%; and all values and subranges
there between. Furthermore, the functional derivatives, variants,
muteins and/or mimetics of IL-5 can also have 100% or more of the
biological activity relative to wild-type mammalian IL-5
activity--the amount of biological activity including at least
105%, at least 110%, at least 125%, at least 150%, and at least
200%.
[0132] For practicing the present invention derivatives of IL-5,
more preferably IL-5-mimetics, that retain their potential to
protect neurons and that also have diminished action on
eosinophiles, thereby reducing potential adverse effects, are
preferred. Derivatives of IL-5, preferably IL-5-mimetics, can be
tested in an in vitro neuroprotective assay. Substances
demonstrating a positive neuroprotective effect in this assay can
be further tested for their immune-modulatory activity.
[0133] To measure the biological activity of IL-5, several known
assays can be employed singularly or in combination. Those IL-5
functions include its known immunmodulatory functions and to one or
more functions relating to its role in neuroprotection. IL5 can be
detected in Bioassays employing cell lines that respond to this
factor (e.g., cell lines: B13; BCL1; T88-M; TALL-103; TF-1). IL5
can be detected also by sensitive immunoassays. Another assay
involves the detection of eosinophilic colonies in a Colony
formation assay (EDF, eosinophil differentiation factor) or the
detection of eosinophil peroxidase.
[0134] These and other assays are described in (Kikuchi, et al.
(1994), J Immunol Methods, 167, 289-98) (McNamee, et al. (1991), J
Immunol Methods, 141, 81-8) O'Garra A and Sanderson C J
Eosinophilic differentiation factor and its associated B cell
growth factor activities. in: Clemens M J et al (eds) Lymphokines
and Interferons. A practical Approach, pp. 323-43, JRL Press,
Oxford 1987; (Schoenbeck, et al. (1991), J Immunol Methods, 137,
47-54) (Taguchi, et al. (1990), J Immunol Methods, 128, 65-73)
[0135] In other embodiments of the present invention combinations
of IL-5 with other hematopoietic factors preparations to support
their therapeutic actions, preferably by its neuroprotective action
can be used. The effect exerted by these combinations can be
cumulative or superadditive/synergistic. In one embodiment, various
IL-5 and/or IL-5 derivatives are used in combination with each
other. Likewise, IL-5 can be used in combination with one or more
additional hematopoietic growth factors such as Erythropoietin, and
derivatives thereof, which has recently been shown to mediate
strong neuroprotective properties (e.g., Brines et al (2000) Proc
Natl Acad Sci USA 97:10526-10531; Cerami et al (2002) Nephrol Dial
Transplant 17:8-12; Siren A L, Ehrenreich H (2001) Eur Arch
Psychiatry Clin Neurosci 251:179-184). In addition, IL-5 can be
used in combination with, for example, various colony stimulating
factors (such as G-CSF, GM-CSF or M-CSF), SCF (stem cell factor),
SCPF (stem cell proliferation factor), various Interleukins (IL1,
IL3, IL4, IL6, IL11, IL12), LIF, TGF-.beta., MIP-1-.alpha.,
TNF-.alpha., and also many other low molecular weight factors.
[0136] In one embodiment the biological activity of IL-5 is
enhanced by fusion to another hematopoietic factor. Examples for
such fusion protein were given for GCSF, GMCSF and IL-3. The
enhanced activity can be measured in a biological activity assay as
described above.
[0137] Also preferred are modifications or formulations of IL-5, or
mimetic substances that increase its ability to cross the
blood-brain barrier, or shift its distribution coefficient towards
brain tissue. An example for such a modification is the addition of
Protein transduction domain (PTD) or TAT sequences (CaoG, et al
(2002) J. Neurosci. 22:5423-5431; Mi Zet al (2000) Mol. Ther.
2:339-347; Morris et al (2001) Nat Biotechnol 19:1173-1176; Park et
al (2002) J Gen Virol 83:1173-1181). These sequences can also be
used in mutated forms, and added with additional amino acids at the
amino- or carboxyterminus of proteins. Also, adding bradykinin, or
analogous substances to an intravenous application of any IL-5
preparation will support its delivery to the brain, or spinal cord
(Emerich et al (2001) Clin Pharmacokinet 40:105-123; Si al et al
(2002) Clin Pharmacokinet 41:171-186).
[0138] In the mouse brain both IL-5 and IL-5 receptor alpha chain
(IL-5 R alpha) were expressed in vitro in astrocytes, but not in
neurons. Expression of IL-5 R alpha was highly regulated both in
quantitative terms and in the number of alternatively spliced
isoforms. In adulthood, no expression of IL-5 R alpha was detected
in normal mice, but all the isoforms were produced in mice with
inflammatory reactions. IL-5 has a specific autocrine and/or
paracrine function in astrocytes, maintaining the homogeneity of
the activation state in a given astrocyte population. (Lins and
Borojevic (2001), Growth Factors, 19, 145-52) (Sawada, et al.
(1993), Neurosci Lett, 155, 175-8)
[0139] The inventors have also shown that IL-5R is expressed in the
rat brain. In contrast to mouse, however, a predominant expression
of IL-5R alpha in neurons was found (FIG. 56)
[0140] IL-5 had a neuroprotective activity in an Caspase-3/7
activity-assay in camptothecin treated rat primary cortical
cultures (FIG. 46b). This shows that IL-5 has the potential to
reduce cell death in neuronal cells. We also have shown that IL-5
induces Akt-Pathway in these cells, which demonstrates that a
typically anti-apoptotic pathway is activated by the treatment of
neuronal cells with IL-5 (FIG. 48).
[0141] Additionally we could show that IL-5 is effective on human
neuroblastoma cells. Camptothecin treated SHSY5-Y cells had shown a
reduced Caspase 3/7 activity when IL-5 was added. This shows the
neuroprotective effect of IL-5 in rat and human cell culture (FIG.
46b).
[0142] GCSF
[0143] Granulocyte-colony stimulating factor (GCSF) is a well known
growth factor. The GCSF that can be employed in the inventive
methods described herein are those full length coding sequences,
protein sequences, and the various functional variants, muteins,
and mimetics that are known and available. In the discussion that
follows these are referred to as GCSF derivatives.
[0144] The structure of both the coding DNA and protein are known
as well as methods for recombinantly producing mammalian
pluripotent granulocyte colony-stimulating factor (WO 87/01132;
U.S. Pat. No. 4,810,643). For example, several amino acid sequences
corresponding to G-CSF is shown in FIG. 10 and the Sequence
Listing, i.e., SEQ ID NOS: 28, 29, 30, 31, 32, and 33.
[0145] In one embodiment, the proteins that are at least 70%,
preferably at least 80%, more preferably at least 90% identical to
the full-length human GCSF amino acid sequences described herein
can be employed in the present invention, e.g., SEQ ID NO:28. In
another embodiment, the GCSF that can be used are those that are
encoded by polynucleotide sequence with at least 70%, preferably
80%, more preferably at least 90%, 95%, and 97% identity to the
wildtype full-length human GCSF coding sequence, e.g., a
polynucleotide encoding SEQ ID NO:28, these polynucleotides will
hybridize under stringent conditions to the coding polynucleotide
sequence of the wild-type full length human GCSF. The terms
"stringent conditions" or "stringent hybridization conditions"
includes reference to conditions under which a polynucleotide will
hybridize to its target sequence, to a detectably greater degree
than other sequences (e.g., at least 2-fold over background).
Stringent conditions will be those in which the salt concentration
is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na
ion concentration (or other salts) at pH 7.0 to 8.3 and the
temperature is at least about 30.degree. C. for short probes (e.g.,
10 to 50 nucleotides) and at least about 60.degree. C. for long
probes (e.g., greater than 50 nucleotides), for example, high
stringency conditions include hybridization in 50% formamide, 1 M
NaCl, 1% SDS at 37.degree. C., and a wash in 0.1.times.SSC at 60 to
65.degree. C. (see Tijssen, Laboratory Techniques in Biochemistry
and Molecular Biology--Hybridization with Nucleic Acid Probes, Part
I, Chapter 2 "Overview of principles of hybridization and the
strategy of nucleic acid probe assays", Elsevier, N.Y. (1993); and
Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al.,
Eds., Greene Publishing and Wiley-Interscience, New York (1995)).
Amino acid and polynucleotide identity, homology and/or similarity
can be determined using the ClustalW algorithm, MEGALIGN.TM.,
Lasergene, Wis.)
[0146] Examples of the various GCSF functional variants, muteins,
and mimetics include functional fragments and variants (e.g.,
structurally and biologically similar to the wild-type protein and
having at least one biologically equivalent domain), chemical
derivatives of GCSF (e.g., containing additional chemical moieties,
such as polyethyleneglycol and polyethyleneglycol derivatives
thereof, and/or glycosylated forms such as Lenogastrim.TM.), and
peptidomimetics of GCSF (e.g., a low molecular weight compound that
mimics a peptide in structure and/or function (see, e.g., Abell,
Advances in Amino Acid Mimetics and Peptidomimetics, London: JAI
Press (1997); Gante, Peptidmimetica-massgeschneiderte
Enzyminhibitoren Angew. Chem. 106: 1780-1802 (1994); and Olson et
al., J. Med. Chem. 36: 3039-3049 (1993)).
[0147] Additional examples of GCSF derivatives include a fusion
protein of albumin and GCSF (Albugranin.TM.), or other fusion
modifications such as those disclosed in U.S. Pat. No. 6,261,250);
PEG-GCSF conjugates and other PEGylated forms; those described in
WO 00/44785 and Viens et al., J of Clin. Oncology, Vl., Nr. 1,
2002: 24-36; norleucine analogues of GCSF, those described in U.S.
Pat. No. 5,599,690; GCSF mimetics, such as those described in WO
99/61445, WO 99/61446, and Tian et al., Science, Vol. 281,
1998:257-259; GCSF muteins, where single or multiple amino acids
have been modified, deleted or inserted, as described in U.S. Pat.
Nos. 5,214,132 and 5,218,092; those GCSF derivatives described in
U.S. Pat. No. 6,261,550 and U.S. Pat. No. 4,810,643; and chimeric
molecules, which contain the full sequence or a portion of GCSF in
combination with other sequence fragments, e.g. Leridistim--see,
for example, Streeter, et al. (2001) Exp. Hematol., 29, 41-50,
Monahan, et al. (2001) Exp. Hematol., 29, 416-24, Hood et al.
(2001) Biochemistry, 40, 13598-606, Farese et al. (2001) Stem
Cells, 19, 514-21, Farese et al. (2001) Stem Cells, 19, 522-33,
MacVittie, et al. (2000) Blood, 95, 837-45. Additionally, the GCSF
derivatives include those with the cysteines at positions 17, 36,
42, 64, and 74 (of the 174 amino acid species (SEQ ID NO:37) or of
those having 175 amino acids, the additional amino acid being an
N-terminal methionine(SEQ ID NO:38)) substituted with another amino
acid, (such as serine) as described in U.S. Pat. No. 6,004,548,
GCSF with an alanine in the first (N-terminal) position; the
modification of at least one amino group in a polypeptide having
GCSF activity as described in EP 0 335 423; GCSF derivatives having
an amino acid substituted or deleted in the N-terminal region of
the protein as described in EP 0 272 703; derivatives of naturally
occurring GCSF having at least one of the biological properties of
naturally occurring GCSF and a solution stability of at least 35%
at 5 mg/ml in which the derivative has at least Cys.sup.17 of the
native sequence replaced by a Ser.sup.17 residue and Asp.sup.27 of
the native sequence replaced by a Ser.sup.27 residue as described
in EP 0 459 630; a modified DNA sequence encoding GCSF where the
N-terminus is modified for enhanced expression of protein in
recombinant host cells, without changing the amino acid sequence of
the protein as described in EP 0 459 630; a GCSF which is modified
by inactivating at least one yeast KEX2 protease processing site
for increased yield in recombinant production using yeast as
described in EP 0 243 153; lysine altered proteins as described in
U.S. Pat. No. 4,904,584; cysteine altered variants of proteins as
described in WO/9012874 (U.S. Pat. No. 5,166,322); the addition of
amino acids to either terminus of a GCSF molecule for the purpose
of aiding in the folding of the molecule after prokaryotic
expression as described in AU-A-10948/92; substituting the sequence
Leu-Gly-His-Ser-Leu-Gly-Ile (SEQ ID NO:11) at position 50-56 of
GCSF with 174 amino acids (SEQ ID NO:37), and position 53 to 59 of
the GCSF with 177 amino acids (SEQ ID NO:39), or/and at least one
of the four histadine residues at positions 43, 79, 156 and 170 of
the mature GCSF with 174 amino acids (SEQ ID NO:37) or at positions
46, 82, 159, or 173 of the mature GCSF with 177 amino acids (SEQ ID
NO:39) as described in AU-A-76380/91; and a synthetic GCSF-encoding
nucleic acid sequence incorporating restriction sites to facilitate
the cassette mutagenesis of selected regions and flanking
restriction sites to facilitate the incorporation of the gene into
a desired expression system as described in GB 2 213 821. Further
examples of G-CSF analogs include SEQ ID NOS:64 and 65, and others
described in U.S. Pat. No. 6,632,426. The contents of the above are
incorporated herein by reference.
[0148] The various functional derivatives, variants, muteins and/or
mimetics of GCSF preferably retain at least 20%, preferably 50%,
more preferably at least 75% and/or most preferably at least 90% of
the biological activity of wild-type mammalian GCSF activity--the
amount of biological activity include 25%, 30%, 35%, 40%, 45%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 95%; and all values and subranges
there between. Furthermore, the functional derivatives, variants,
muteins and/or mimetics of GCSF can also have 100% or more of the
biological activity relative to wild-type mammalian GCSF
activity--the amount of biological activity including at least
105%, at least 110%, at least 125%, at least 150%, and at least
200%.
[0149] To measure the biological activity of GCSF, several known
assays can be employed singularly or in combination. One example of
determining GCSF function is illustrated in Example 1. Other
methods for determining GCSF function are known and include a
colony formation assay employing murine bone marrow cells;
stimulation of proliferation of bone marrow cells induced by G-CSF;
specific bioassays with cells lines that depend on G-CSF for growth
or that respond to GCSF (e.g., AML-193; 32D; BaF3; GNFS-60; HL-60,
M1; NFS-60; OCI/AML1a; and WEHI-3B). These and other assays are
described in Braman et al. Am. J. Hematology 39: 194-201 (1992);
Cloaston C L et al Anal Biochem 202: 375-83 (1992); Hattori K et al
Blood 75: 1228-33 (1990); Kuwabara T et al Journal of
Pharmacobiodyn 15: 121-9 (1992); Motojima H et al Journal of
Immunological Methods 118: 187-92 (1989); Sallerfors B and Olofsson
European Journal of Haematology 49: 199-207 (1992); Shorter S C et
al Immunology 75: 468-74 (1992); Tanaka H and Kaneko Journal of
Pharmacobiodyn. 15: 359-66 (1992); Tie F et al Journal of
Immunological Methods 149: 115-20 (1992); Watanabe M et al Anal.
Biochem. 195: 38-44 (1991).
[0150] In one embodiment, the GCSF is modified or formulated, or is
present as a GCSF mimetic that increases its ability to cross the
blood-brain barrier, or shift its distribution coefficient towards
brain tissue. An example of such a modification is the addition of
PTD or TAT sequences (Cao et al. (2002) J. Neurosci. 22:5423-5431;
Mi et al. (2000) Mol. Ther. 2:339-347; Morris et al. (2001) Nat
Biotechnol 19:1173-1176; Park et al. (2002) J Gen Virol
83:1173-1181). These sequences can also be used in mutated forms,
and added with additional amino acids at the amino- or
carboxy-terminus of proteins. Also, adding bradykinin, or analogous
substances to an intravenous application of any GCSF preparation
will support its delivery to the brain, or spinal cord (Emerich et
al. (2001) Clin Pharmacokinet 40:105-123; Siegal et al (2002) Clin
Pharmacokinet 41:171-186).
[0151] In one embodiment the biological activity of GCSF is
enhanced by fusion to another hematopoietic factor. The enhanced
activity can be measured in a biological activity assay as
described above. Such a preferred modification or formulation of
GCSF leads to an increased antiapoptotic effect and/or an increase
in neurogenesis. An example for such a modification is
Myelopoietin-1, a GCSF/IL-3 fusion protein (McCubrey, et al.
(2001), Leukemia, 15, 1203-16) or Progenipoietin-1 (ProGP-1) is a
fusion protein that binds to the human fetal liver tyrosine kinase
flt-3 and the G-CSF receptor.
[0152] GM-CSF
[0153] Granulocyte-macrophage colony stimulating factor (GMCSF) is
a well known growth factor (see, e.g., FIG. 18, SEQ ID NOS:25, 26,
and 27). The GMCSF that can be employed in the inventive methods
described herein are those full length coding sequences, protein
sequences, and the various functional variants, chimeric proteins,
muteins, and mimetics that are known and available, for example
PEGylated forms or albumin-coupled forms. The structure of both the
coding DNA and protein are known as well as methods for
recombinantly producing mammalian pluripotent granulocyte
macrophage colony-stimulating factor (U.S. Pat. No. 5,641,663). The
GMCSF receptor is also known and is described, for example, in U.S.
Pat. No. 5,629,283.
[0154] In one embodiment, the proteins that are at least 70%,
preferably at least 80%, more preferably at least 90% identical to
the full-length human GMCSF amino acid sequences can be employed in
the present invention. In another embodiment, the GMCSF that can be
used are those that are encoded by polynucleotide sequence with at
least 70%, preferably 80%, more preferably at least 90%, 95%, 97%
and 98% identical to the wildtype full-length human GMCSF coding
sequence, e.g., a polynucleotide which encodes SEQ ID NO:25, these
polynucleotides will hybridize under stringent conditions to the
coding polynucleotide sequence of the wild-type full length human
GMCSF. The terms "stringent conditions" or "stringent hybridization
conditions" includes reference to conditions under which a
polynucleotide will hybridize to its target sequence, to a
detectably greater degree than other sequences (e.g., at least
2-fold over background). Stringent conditions will be those in
which the salt concentration is less than about 1.5 M Na ion,
typically about 0.01 to 1.0 M Na ion concentration (or other salts)
at pH 7.0 to 8.3 and the temperature is at least about 30.degree.
C. for short probes (e.g., 10 to 50 nucleotides) and at least about
60.degree. C. for long probes (e.g., greater than 50 nucleotides),
for example, high stringency conditions include hybridization in
50% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. (see Tijssen, Laboratory
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles
of hybridization and the strategy of nucleic acid probe assays",
Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology,
Chapter 2, Ausubel, et al., Eds., Greene Publishing and
Wiley-Interscience, New York (1995)). Amino acid and polynucleotide
identity, homology and/or similarity can be determined using the
ClustalW algorithm, MEGALIGN.TM., Lasergene, Wis.)
[0155] The various functional derivatives, variants, muteins and/or
mimetics of GMCSF preferably retain at least 20%, preferably 50%,
more preferably at least 75% and/or most preferably at least 90% of
the biological activity of wild-type mammalian GMCSF activity--the
amount of biological activity include 25%, 30%, 35%, 40%, 45%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 95%; and all values and subranges
there between. Furthermore, the functional derivatives, variants,
muteins and/or mimetics of GMCSF can also have 100% or more of the
biological activity relative to wild-type mammalian GMCSF
activity--the amount of biological activity including at least
105%, at least 110%, at least 125%, at least 150%, and at least
200%.
[0156] For practicing the present invention derivatives of GMCSF,
more preferably GMCSF-mimetics, that retain their potential to
protect neurons and that also have diminished action on leukocytes,
thereby reducing potential adverse effects, are preferred.
Derivatives of GMCSF, preferably GMCSF-mimetics, can be tested in
an in vitro neuroprotective assay, such as described in Example 17.
Substances demonstrating a positive neuroprotective effect in this
assay can be further tested for their immune-modulatory
activity.
[0157] To measure the biological activity of GMCSF, several known
assays can be employed singularly or in combination. Those GMCSF
functions include its known immunmodulatory functions and to one or
more functions relating to its role in neuroprotection. Other
methods for determining GMCSF function include, for example, in a
colony formation assay by the development of colonies containing
macrophages, neutrophils, eosinophils, and megakaryocytes; in
specific Bioassays with cell lines that depend in their growth on
the presence of GM-CSF or that respond to this factor (e.g., cell
lines: AML-193; B6SUt-A; BAC1.2F5; BCL1; Da; FDCP1; GF-D8; GM/SO;
IC-2; MO7E; NFS-60; PT-18; TALL-103; TF-1; UT-7). These and other
assays are described in Cebon J et al Blood 72: 1340-7 (1988);
Katzen N A et al European Cytokine Network 3: 365-72 (1992); Lewis
C E et al Journal of Immunological Methods 127: 51-9 (1990);
Mortensen B T et al Experimental Hematology 21: 1366-70 (1993); Oez
S et al Experimental Hematology 18: 1108-11 (1990); Roncaroli F et
al Journal of Immunological Methodsl58: 191-6 (1993); Sallerfors B
and Olofsson European Journal of Haematology 49: 199-207 (1992);
Zenke G et al Journal of Immunoassay 12: 185-206 (1991).
[0158] Also preferred are modifications or formulations of GMCSF,
or mimetic substances that increase its ability to cross the
blood-brain barrier, or shift its distribution coefficient towards
brain tissue. An example for such a modification is the addition of
Protein transduction domain (PTD) or TAT sequences (Cao G et al
(2002) J. Neurosci. 22:5423-5431; Mi Zet al (2000) Mol. Ther.
2:339-347; Morris et al (2001) Nat Biotechnol 19:1173-1176; Park et
al (2002) J Gen Virol 83:1173-1181). These sequences can also be
used in mutated forms, and added with additional amino acids at the
amino- or carboxyterminus of proteins. Also, adding bradykinin, or
analogous substances to an intravenous application of any GMCSF
preparation will support its delivery to the brain, or spinal cord
(Emerich et al (2001) Clin Pharmacokinet 40:105-123; Sie al et al
(2002) Clin Pharmacokinet 41:171-186). Examples for different
suitable forms and derivatives are sargramostim (Leukine.RTM.,
Prokine.RTM.), Leucotropin.RTM. or molgramostim
(Leucomax.RTM.).
[0159] GMCSFR mRNA has been detected in isolated microglia,
astrocytes, oligodendrocytes and neurons (Sawada, et al. (1993),
Neurosci Lett, 160, 131-4); Baldwin, et al. (1993), Blood, 82,
3279-82.) It has been shown that GMCSF stimulates the proliferation
of astrocytes (Guillemin et al. (1996), Glia, 16, 71-80). GMCSF
also induces the release of interleukin 6 from microglia (Suzumura,
et al. (1996), Brain Res, 713, 192-8). Recently, a publication
showed that interleukin 1 increased GMCSF protein production in the
neuronal cell line NT2 (Dame et al. (2002), Eur Cytokine Netw, 13,
128-33). The presence of GMCSFR in the brain was shown on material
from a human fetus on a systematic search for GMCSF receptor
expression in the fetus (Dame, et al. (1999), Pediatr Res, 46,
358-66). Dame et al. conclude from their findings, that GMCSF may
have a role in neural development in the fetus, and a role in
immunosurveillance in the adult brain. Importantly, they do not
mention any possible disease relevance, especially no involvement
in neuroprotection. GMCSF augments choline acetyltransferase
activity in vitro (SN6.10.2.2 cell line and cultured mouse septal
neurons) and in vivo increases survival of lesioned rat cholinergic
septal neurons after fimbria-fornix transections (Kamegai. et al.
(1990), Brain Res, 532, 323-5.) (Konishi et al. (1993), Brain Res,
609, 29-35). Importantly, this finding only pertains to a certain
subtype of neurons, and has not been generalized by the authors to
other neuronal or neural cell types. They have not derived a
general neuroprotective property of GMCSF from these data, nor have
they mentioned any possible therapeutic applicability. GMCSF is
upregulated in astrocytes upon addition of advanced glycosylation
end products (AGEs) (Li, et al. (1998), Mol Med, 4, 46-60). GMCSF
has been shown to promote microglia proliferation in vitro (Lee et
al. (1994), Glia, 12, 309-18). Recently, it has been found that
GMCSF level were elevated in the cerebrospinal fluid (csf) of
patients with Alzheimer's disease (Tarkowski, et al. (2001), Acta
Neurol Scand, 103, 166-74). GMCSF has also been studied in the CSF
of stroke patients (Tarkowski, et al. (1999), Stroke, 30, 321-7).
In the latter study, the level of the FAS ligand, a proapoptotic
protein, correlates positively with GMCSF levels in the
cerebrospinal fluid of stroke patients at day 21-26 and later than
3 months. However, there is no conclusion drawn to any therapeutic
usefulness of this finding in stroke patients, and no mentioning of
any possible neuroprotective role of GMCSF. A release of GMCSF
after stroke per se can have many reasons, and does not allow any
functional prediction to be made. GMCSF crosses the
blood-brain-barrier (McLay, et al. (1997), Brain, 120, 2083-91).
This study has not been performed with the purpose of showing any
therapeutic applicability of GMCSF to neurological diseases, and
there is no contextual mentioning of a possible usefulness of GMCSF
in neurodegenerative diseases or stroke.
[0160] In summary, the above mentioned references in the literature
provide evidence for presence of the GMCSF receptor and ligand in
the nervous system, but do not show any general neuroprotective
property of GMCSF. These studies certainly do not imply use of
GMCSF for the treatment of neurodegenerative and ischemic disorders
such as stroke.
[0161] In one embodiment the biological activity of GMCSF is
enhanced by fusion to another hematopoietic factor, e.g
IL-3/GMCSF-f sion protein PIXY321, Immunex (Vadhan-Raj (1994), Stem
Cells, 12, 253-61) (Anderson and Appelbaum (1994), Curr Opin
Hematol, 1, 203-9) (Buescher, et al. (1993), Exp Hematol, 21,
1467-72); Promegapoietin; IL-3/thrombopoietin, Pharmacia (Farese,
et al. (2001), Stem Cells, 19, 329-38). The enhanced activity can
be measured in a biological activity assay as described above. Such
a preferred modification or formulation of GCSF leads to an
increased antiapoptotic effect and or an increase in
neurogenesis.
[0162] Other Hematopoeitic Growth Factors
[0163] In other embodiments of the present invention combination
preparations that support its therapeutic actions, preferably its
neuroprotective action can be used. The effect exerted by these
combinations can be cumulative or superadditive/synergistic. In a
one embodiment, the factors discussed above are used in combination
with each other. Likewise, one or more additional hematopoietic
growth factors such as Erythropoietin, and derivatives thereof,
which has recently been shown to mediate strong neuroprotective
properties (e.g., Brines et al (2000) Proc Natl Acad Sci USA
97:10526-10531; Cerami et al (2002) Nephrol Dial Transplant
17:8-12; Siren A L, Ehrenreich H (2001) Eur Arch Psychiatry Clin
Neurosci 251:179-184). In addition, combinations of the above along
with, for example, various colony stimulating factors (such as
M-CSF), SCF (stem cell factor), SCPF (stem cell proliferation
factor), various Interleukins (other than those delineated above,
e.g., IL, IL4, IL6, IL11, IL12), LIF, TGF-.beta., MIP-1-.alpha.,
TNF-.alpha., and also many other low molecular weight factors.
[0164] In another embodiment, the various hematopoietic growth
factors with the exception of Erythropoetin may be used alone. In
another embodiment, for example, in the context of stroke, one or
more of the hematopoeitic factors can be combined with substances
that have thrombolytic activities, e.g., tissue-plasminogen
activator (TPA), streptokinase, urokinase, and/or Ancrod. GCSF
and/or GMCSF can also be combined with either acetylsalicylic acid
(Aspirin) or Heparin; with Melatonin; and/or substances that
interfere with apoptotic signaling (e.g. inhibitors of caspases).
Also, especially in, but not limited to, the treatment of
amyotrophic lateral sclerosis (ALS) combinations of GCSF and/or
GMCSF with Riluzole (Rilutek.RTM.), vitamins such as vitamin E,
Q10, or antioxidative substances are possible. For treating
Parkinson's disease, combinations of GCSF and/or GMCSF with known
drugs used in the treatment of Parkinson's disease, such as
Trihexyphenidyl, Selegiline, L-DOPA, Pergolide, and others may be
employed. Other substances that may be combined with the
hematopoietic growth factors, e.g., G-CSF and/or GM-CSF, include
bFGF, anti-GPIlb/IIa, anti-ICAM, nitric oxide inhibitors,
thrombolytic agents, rotamas inhibitors, calcineurin inhibitors,
and cyclosporin. In addition, when treating neurodegenerative
disorders the administration of one or more agents effecting
neurotransmitter levels can also be included. Further, when
treating cognitive conditions, one or more cholinergic agents,
catecholamine reuptake inhibitors and the like may also be
administered.
[0165] Combinations with existing antidepressants may also be used
where advantageous, e.g., to treat depression in the individual.
Non-limiting examples of antidepressants include SSRI's (selective
serotonin reuptake inhibitors): Paxil (paroxetine); Prozac
(fluoxetine); Zoloft (sertraline); Celexa (citalopram); Lexapro
(escitalopram oxalate); Luvox (fluvoxamine), MOAI's (monoamine
oxidase inhibitors): Nardil (phenelzine); Parnate
(tranylcypromine); TCA's (tricyclic antidepressants) Adapin
(doxepin); Anafranil (clomipramine); Elavil (amitriptyline); Endep
(amitriptyline); Ludiomil (maprotiline); Norpramin (desipramine);
Pamelor (nortryptyline); Pertofrane (desipramine); Sinequan
(doxepin); Sur ontil (trimipramine); Tofranil (imipramine);
Vivactil (protriptyline), or other drug types: Effexor
(venlafaxine); Cymbalta (duloxetine); Desyrel (trazodone); Buspar
(buspirone); Edronax, Vestra (reboxetine); Remeron (mirtazapine);
Serzone (nefazodone); Wellbutrin (bupropion).
Neurological Conditions
[0166] Neurological conditions that can be treated according to the
present invention can be generally classified into three classes:
those disease with ischemic or hypoxic mechanisms;
neurodegenerative diseases (see Adams et al, Principles of
Neurology, 1997, 6.sup.th Ed., New York, pp 1048 ff); and
neurological and psychiatric diseases associated with neural cell
death. Other neurological conditions that can be treated according
to the present invention also include enhancing cognitive ability
and the treatment of brain tumors, such as glioblastomas,
astrocytomas, meningiomas, and neurinomas.
[0167] Diseases with ischemic or hypoxic mechanisms can be further
subclassified into general diseases and cerebral ischemia. Examples
of such general diseases involving ischemic or hypoxic mechanisms
include myocardial infarction, cardiac insufficiency, cardiac
failure, congestive heart failure, myocarditis, pericarditis,
perimyocarditis, coronary heart disease (stenosis of coronary
arteries), angina pectoris, congenital heart disease, shock,
ischemia of extremities, stenosis of renal arteries, diabetic
retinopathy, thrombosis associated with malaria, artificial heart
valves, anemias, hypersplenic syndrome, emphysema, lung fibrosis,
and pulmonary edema. Examples of cerebral ischemia disease include
stroke (as well as hemorrhagic stroke), cerebral microangiopathy
(small vessel disease), intrapartal cerebral ischemia, cerebral
ischemia during/after cardiac arrest or resuscitation, cerebral
ischemia due to intraoperative problems, cerebral ischemia during
carotid surgery, chronic cerebral ischemia due to stenosis of
blood-supplying arteries to the brain, sinus thrombosis or
thrombosis of cerebral veins, cerebral vessel malformations, and
diabetic retinopathy.
[0168] Examples of neurodegenerative diseases include amyotrophic
lateral sclerosis (ALS), Parkinson's disease, Huntington's disease,
Wilson's disease, multi-system atrophy, Alzheimer's disease, Pick's
disease, Lewy-body disease, Hallervorden-Spatz disease, torsion
dystonia, hereditary sensorimotor neuropathies (HMSN),
Gerstmann-Straussler-Schanker disease, Creutzfeld-Jakob-disease,
Machado-Joseph disease, Friedreich ataxia, Non-Friedreich ataxias,
Gilles de la Tourette syndrome, familial tremors,
olivopontocerebellar degenerations, paraneoplastic cerebral
syndromes, hereditary spastic paraplegias, hereditary optic
neuropathy (Leber), retinitis pigmentosa, Stargardt disease, and
Keams-Sayre syndrome.
[0169] Examples of neurological and psychiatric diseases associated
with neural cell death include septic shock, intracerebral
bleeding, subarachnoidal hemorrhage, multiinfarct dementia,
inflammatory diseases (such as vasculitis, multiple sclerosis, and
Guillain-Barre-syndrome), neurotrauma (such as spinal cord trauma,
and brain trauma), peripheral neuropathies, polyneuropathies,
epilepsies, schizophrenia, depression, metabolic encephalopathies,
and infections of the central nervous system (viral, bacterial,
fungal).
[0170] By "treating" is meant the slowing, interrupting, arresting
or stopping of the progression of the disease or condition and does
not necessarily require the complete elimination of all disease
symptoms and signs. "Preventing" is intended to include the
prophylaxis of the neurological disease, wherein "prophylaxis" is
understood to be any degree of inhibition of the time of onset or
severity of signs or symptoms of the disease or condition,
including, but not limited to, the complete prevention of the
disease or condition.
[0171] Since strong expression of the GCSF receptor, and the GMCSF
receptor on the large motor neurons in the spinal cord was found
(see FIG. 4 i-l), and GCSF is effective in focal cerebral ischemia
(see FIG. 1), where the same basic pathogenetic mechanisms are
operative like in ALS and other neurodegenerative diseases, such as
glutamate involvement, oxidative stress, and programmed cell death
GCSF is especially suited for long-term therapy in a chronic
condition such as ALS, since it is well-tolerated in humans when
given chronically (Ozer et al. (2000), J. Clin. Oncol, 18,
3558-85). Accordingly, in one embodiment of the present invention,
the hematopoeitic growth factors such as GCSF and GMCSF alone, in
combination with each other, and/or in combination with one or more
additional factors can be used to treat ALS. In an additional
embodiment, IL-3 and IL5 alone, in combination with each other,
and/or in combination with one or more additional factors can be
used.
[0172] The pathophysiology associated with Parkinson's disease,
such as the involvement of oxidative stress and apoptosis also
places Parkinson's disease amongst the other neurodegenerative
disorders and stroke. GCSF is strongly neuroprotective in
H.sub.2O.sub.2-invoked cell death in the cell line PC12 (FIG. 1b).
PCl.sub.2 cells display features of dopaminergic cells, for example
presence of a functional dopamine transporter (Maruyama, et al.
(2001), Arch Toxicol, 75, 209-13), and are used as in vitro models
for important aspects of Parkinson's disease, for example toxicity
by the MPTP metabolite MPP+ (Bai, et al. (2002), Neurosci Lett,
321, 81-4). H.sub.2O.sub.2 is a noxious stimulus for PC12 cells
that clearly models some aspects of Parkinson's disease in PC12
cells. For example, H.sub.2O.sub.2 is one of the intermediates of
MPTP-evoked cellular events (Fabre et al 1999 J Physiol Biochem
55(4):325-31). There is a remarkable overlap in the cascade of
cellular events and signaling mechanisms involved in MPTP- and
H.sub.2O.sub.2-mediated cell death in dopaminergic neurons (Chun, H
S et al., J Neurochem 2001 February; 76(4):1010-21; Lai et al.,
Biochem Pharmacol 1993 Feb. 24; 45(4):927-33). H.sub.2O.sub.2 acts
by producing reactive oxygen species (ROS) that lead to oxidative
stress and apoptosis. Damage by oxygen radicals is one of the main
pathophysiological events in Parkinson's disease (Bo net and Houeto
(1999), Biomed Pharmacother, 53, 117-21, Beal (2001), Nat Rev
Neurosci, 2, 325-34), and antioxidant therapy is effective in
patients (Beal (2002), Free Radic Res, 36, 455-60, Shults, et al.
(2002), Arch Neurol, 59, 1541-50). Therefore, efficacy of GCSF in
H.sub.2O.sub.2 evoked cell death in PC12 cells, a model for the
important pathophysiological mechanisms of oxidative stress and
apoptosis predicts efficacy in Parkinson's disease (PD):
Surprisingly, the expression of the GCSF receptor in the area
affected by Parkinson's disease, the substantia nigra (SN), in
particular the substantia nigra pars compacta (SNC) (see FIG. 4
m-o) was demonstrated. Efficacy in a cellular model, in vivo
localization of receptors, and overlap of pathophysiological
mechanisms with cerebral ischemia (oxygen radicals/apoptosis)
provides compelling evidence that GCSF and/or other growth factors,
for example, GMCSF, can be used to treat Parkinson's disease.
Efficacy testing in rodent models can be performed as exemplified
in Example 5. Accordingly, in another embodiment of the present
invention, the hematopoeitic growth factors such as GCSF and GMCSF
alone, in combination with each other, and/or in combination with
one or more additional factors can be used to treat Parkinson's
disease. In an additional embodiment, IL3 and IL5 alone, in
combination with each other, and/or in combination with one or more
additional factors can be used. Pathologically Parkinson's disease
is defined as a neurodegenerative disorder characterized chiefly by
depigmentation of the substantia nigra and by the presence of Lewy
bodies. These criteria, however, are too restrictive and simple,
and they do not take into account the heterogeneous clinical and
pathologic presentation of Parkinson's disease and the overlap with
other parkinsonian disorders, each with presumably distinct
etiology. In the absence of a specific biologic marker for
Parkinson's disease, the differentiation of Parkinson's disease
from other parkinsonian disorders rests on clinicopathologic
criteria. (see Table2; (Dauer and Przedborski (2003), Neuron, 39,
889-909)
[0173] In one embodiment the neurological condition is
Parkinsonism, with Parkinsonism being a Parkinsons disease,
Secondary Parkinsonism, a familial neurodegenerative disease or a
`parkinsonism plus syndrome`.
[0174] Classification of Parkinsonism is shown in below [0175]
Primary (idiopathic) parkinsonism--Parkinson's disease (sporadic,
familial) [0176] Secondary (acquired, symptomatic)
parkinsonism-infectious (ostencephalitic, slow virus), drug-induced
(dopamine antagonists and depletors), Hemiatrophy
(hemiparkinsonism), Hydrocephalus (normal pressure hydrocephalus),
hypoxia, infectious (postencephalistis), metabolic (parathyroid
dysfunction), toxin (MPTP, CO, Mn, Hg. CS2, methanol, ethanol),
Trauma (pugilistic encephalopathy), tumor, and vascular
(multiinfarct state). [0177] Heredodegenerative
parkinsonism-Huntington's disase, Wilson's disease,
Hallervorden-Spatz disease, Olivopontocerebellar and
spinocerebeller degenerations, neuroacanthocytosis, Lubag (X-linked
dystonia-parkinsonism), and mitochondrial cytopathies with stratial
necrosis [0178] Multiple system degenerations (parkinsonism
plus)-Cortical-basal ganglionic degeneration, Dementia syndromes
(Alzheimer's disease, diffuse Lewy body disease, frontotemporal
dementia), Lytico-Bodig (Guamanian Parkinsonism-dementia-ALS),
Multiple system atrophy syndromes (striatonigral degeneration,
Shy-Drager syndrome, sporadic olivopontocerebellar degeneration
(OPAC), motor neuron disease parkinsonism), Progressive pallidal
atrophy, and progressive supranuclear palsy.
[0179] The inventors have shown, by the discussion contained
herein, that GCSF and GMCSF have the ability to enhance
neurogenesis, and improve behavioural outcome after an ischemic
lesion. Neurogenesis is one mechanism that can lead to increased
plasticity of neural networks, and can replace gradual loss of
neurons. Therefore, one embodiment of the present invention is to
provide enhancement, improvement or an increase in cognitive
ability to an individual suffering from, displaying, and/or
believed to some level of cognitive loss by administering one or
more compositions as described herein to the individual in
accordance with the administration discussion herein. In an
alternative embodiment, cognitive enhancement may also benefit
those individuals even useful under non-pathological conditions,
e.g, those individuals who do not present with cognitive
impairment.
[0180] Determining cognitive ability and therefore enhancement is
known by one of skill in the art. Where increases or enhancement of
cognitive ability are measured, they are compared before
administration of the compositions of the invention and after the
administration (and can also be measured during the administration
in some embodiments) using the same test, e.g., with same criteria,
parameters, etc.
[0181] In addition, the use of compositions according to the
invention in cognition enhancement is not limited to a
non-pathological decline in mental capacity, but can also be
applied to boosting the normal, physiological repertoire of mental
capabilities, for example memory enhancement, enhancement of fine
motor coordination, and/or enhancement of logical capabilities.
[0182] Depression is characterized by sadness, loss of interest in
activities, and decreased energy. Other symptoms include loss of
confidence and self-esteem, inappropriate guilt, thoughts of death
and suicide, diminished concentration, and disturbance of sleep and
appetite. A variety of somatic symptoms may also be present. Though
depressive feelings are common, especially after experiencing
setbacks in life, depressive disorder is diagnosed only when the
symptoms reach a threshold and last at least two weeks. Depression
can vary in severity from mild to very severe.
[0183] Depression can affect individuals at any stage of the life
span, although the incidence is highest in the middle ages. There
is, however, an increasing recognition of depression during
adolescence and young adulthood (Lewinsohn, et al. (1993), J Abnorm
Psychol, 102, 110-20). Depression is essentially an episodic
recurring disorder, each episode lasting usually from a few months
to a few years, with a normal period in between. In about 20% of
cases, however, depression follows a chronic course with no
remission (Thomicroft and Sartorius (1993), Psychol Med, 23,
1023-32), especially when adequate treatment is not available. The
recurrence rate for those who recover from the first episode is
around 35% within 2 years and about 60% at 12 years. The recurrence
rate is higher in those who are more than 45 years of age. One of
the particularly tragic outcomes of a depressive disorder is
suicide. Around 15-20% of depressive patients end their lives by
committing suicide. Suicide remains one of the common and avoidable
outcomes of depression. To summarize, depression is a common mental
disorder, causing a very high level of disease burden, and is
expected to show a rising trend during the coming 20 years.
[0184] Depression can harm a patient constantly (unipolar) or have
a bipolar character (manic or bipolar depression). The bipolar
depression is marked by extreme mood swings, from "highs" of
excessive energy and elation to "lows" of utter despair and
lethargy. Manic depression is often treated with Lithium, which
evens out the mood swings.
[0185] The depression can be a Seasonal Affective Disorder (SAD).
It is a type of depression which generally coincides with the
approach of winter, starting with September and lasting until
Spring brings longer days and more sunshine.
[0186] The depression can be a postnatal depression that can occurs
from about 2 weeks and up to 2 years after the birth.
[0187] Attempts have been made to classify the severity of a
depression, eg. (Abdel-Khalek (2003), Psychol Rep, 93, 544-60)
identified the following eight basic dimensions i.e., Pessimism,
Weak Concentration, Sleep Problems, Anhedonia, Fatigue, Loneliness,
Low Self-esteem, and Somatic Complaints to define the profile of
children's and adolescents' depression.
[0188] Depression can occur as an idiopathic disease (with no
somatic disease associated with it), or it can be a psychiatric
symptom of a somatic disorder, especially a number of
neurodegenerative disorders, Depressive disorders (DDs) are
frequent psychiatric comorbidities of neurological disorders like
multiple sclerosis, stroke, dementia, migraine, Parkinson's
disease, and epilepsy. The clinical manifestations of DDs in these
neurological disorders are identical to those of idiopathic mood
disorders. Neurodegenerative disorders often exhibit "classical"
psychiatric symptoms as an initial presentation of the disease. The
symptomatology of depression in the context of a neurodegenerative
disorder may differ from depression alone. In the following some
neurodegenerative disorders that have depression as a symptom are
listed: [0189] 1. Multiple Sclerosis [0190] 2. Traumatic brain
injury: Depression also affects patients with traumatic brain
injury (TBI): Between 30% and 38% of patients with TBI can be
classified as depressed (Seel and Kreuzer 03) [0191] 3. Stroke:
Approximately 30% of stroke patients are clinically depressed.
(Williams 86) [0192] 4. Dementia and Alzheimers disease [0193] 5.
Migraine [0194] 6. Parkinsons disease: Depressive symptoms occur in
approximately half of PD patients and are a significant cause of
functional impairment for PD patients. There is accumulating
evidence suggesting that depression in PD is secondary to the
underlying neuroanatomical degeneration, rather than simply a
reaction to the psychosocial stress and disability. The incidence
of depression is correlated with changes in central serotonergic
function and neurodegeneration of specific cortical and subcortical
pathways. Understanding comorbid depression in PD may therefore add
to the understanding of the neuroanatomical basis of melancholia.
[0195] 7. Epilepsy: Epilepsy is a chronic condition that has
complex effects on social, vocational, and psychological function.
Several psychiatric disorders have been shown to have increased
prevalence in persons with epilepsy compared to the general
population. Depression appears to be the most common psychiatric
comorbidity, but anxiety and other diagnoses have not been
extensively investigated. In epilepsy, however, Depressive
Disorders can frequently also present with clinical characteristics
that differ from those of idiopathic depression and fail to meet
the criteria included in the Diagnostic and Statistical Manual of
Psychiatric Disorders-Fourth Edition. Several studies have found
that depression or psychological distress may be the strongest
predictors of health-related quality of life, even including
seizure frequency and severity, employment, or driving status
(Gillian, et al. (2003), Epilepsy Behav, 4 Suppl 4, 26-30).
Clinically depressed people with epilepsy reported higher levels of
perceived severity and bother from seizures, as well as greater
problems with overall seizure recovery than did nondepressed people
experiencing similar types of seizures. The pervasive influence of
depressive symptoms on reports of seizure activity suggests that
people with epilepsy should be screened for depression. These data
highlight the importance of detecting and treating depression among
people with epilepsy (Gilliam, Hecimovic, and Sheline (2003),
Epilepsy Behav, 4 Suppl 4, 26-30). [0196] 8. Huntington's disease:
Huntington's disease (HD) is a neurodegenerative process that is
manifest as deterioration in a person's motor control, cognition
and emotional stability. Emotional instability is reflected through
a variety of symptoms such as personality change, anxiety and
irritability. Cognitive decline may precede motor symptoms in
Huntington's disease (HD). Depression is common in HD and has also
been linked to cognitive impairment. Depressed mood and estimated
time to disease onset, calculated by using DNA mutation length,
both were significant predictors of working memory performance.
Findings are consistent with and contribute to existing research
with individuals presymptomatic for HD, identifying a potentially
remediable contribution to cognitive decline (i.e., depressed mood)
(Nehl, et al. (2001), J Neuropsychiatry Clin Neurosci, 13, 342-6).
Depression may also occur in relation to other somatic diseases not
listed here.
[0197] Recently, new exciting progress has been made towards the
pathogenesis of depression that implies that depression is linked
to neurodegenerative events in brain structures, and to the
possible failure of correct adult neurogenesis in hippocampal
structures. Therefore, hematopoietic growth factor, e.g., G-CSF,
GM-CSF, IL3 and/or IL5 treatment with both its anti-apoptotic
actions and pro-regenerative actions (including stimulation of
endogenous adult neural stem cells) as described herein may be used
to treat depression.
[0198] The following describes research related to the
neurodegenerative concept of depression (Reviewed by Kempermann and
Kronenberg (2003), Biol Psychiatry, 54, 499-503).
[0199] The study of morphological alterations of depressive
patients has revealed structural changes in the hippocampus
including grey matter changes (Sheline (2000), Biol Psychiatr, 48,
791-800). Studies of early-onset recurrent depression, late life
depression associated with neurologic disorders, and bipolar
illness have revealed structural brain changes within a
neuroanatomical circuit. This circuit has been termed the
limbic-cortical-striatal-pallidal-thalamic tract and is comprised
of structures which are extensively interconnected. In
three-dimensional magnetic resonance imaging studies of affective
illness, many of the structures that comprise this tract have been
found to have volume loss or structural abnormalities. Mechanisms
proposed to explain volume loss in depression include neurotoxicity
caused neuronal loss, decreased neurogenesis, and loss of
plasticity. These aspects can all be treated by activities of GCSF
or GMCSF, I-3 or IL-5. One favoured hypothesis is a disturbance in
adult hippocampal neurogenesis (Kempermann and Kronenberg (2003),
Biol Psychiatry, 54, 499-503, Jacobs, et al. (2000), Mol
Psychiatry, 5, 262-9, Jacobs (2002), Brain Behav Inun, 16, 602-9).
Depression and other mood disorders are therefore `stem cell
disorders`. Recent research brought up new aspects on how adult
hippocampal neurogenesis is regulated. One of the factors that
potently suppresses adult neurogenesis is stress, probably due to
increased glucocorticoid release. (Jacobs, Praag and Gage (2000),
Mol Psychiatry, 5, 262-9).
[0200] Adult hippocampal neurogenesis was first described in 1965
by Altman and Das, and underwent several rediscoveries. A broader
interest in the phenomenon was first sparked in the early 1980s by
reports on activity correlated neurogenesis in the brain of adult
canaries. Marking proliferating cells in the brain with
bromodeoxyuridine (BrdU) in combination with confocal laser
scanning microscopy, instead of the more cumbersome use of
tritiated thymidine and autoradiographic techniques, allowed a more
straightforward quantitative approach to adult neurogenesis. A
subset of the new cells survives, migrates into the granule cell
layer and differentiates into neurons. They establish axonal
projections to area CA3 along the mossy fiber tracts, as do all
other granule cells in the granule cell layer, and become virtually
indistinguishable from the surrounding older cells.
[0201] The finding that chronic antidepressive treatment alleviates
the decrease in adult neurogenesis strengthens the hypothesis
outlined above (Benninghoff, et al. (2002), J Neural Transm, 109,
947-62, Dremencov, et al. (2003), Prog Neuropsychopharmacol Biol
Psychiatry, 27, 729-39, D'Sa and Duman (2002), Bipolar Disord, 4,
183-94, Duman, et al. (2001), J Pharmacol Exp Ther, 299, 401-7,
Duman, et al. (1999), Biol Psychiatry, 46, 1181-91).
[0202] Therefore, in another embodiment of the present invention,
the hematopoeitic growth factors, for example, G-CSF and GM-CSF,
alone, in combination with each other, in combination with
additional factors as described herein, can be used to treat
depression and/or provide prophylactic depression therapy by, for
example, administration to a patient predisposed to depression or
expected to develop depression symptoms. In an additional
embodiment, IL-3 and IL5 alone, in combination with each other,
and/or in combination with one or more additional factors can be
used.
[0203] In one embodiment, depression can be treated with
formulations with longer plasma half-lives, such as described
hereinabove, for example PEGylated forms (PEGfilgrastim),
albumin-coupled forms (albugranin). Treatment will not be limited
to idiopathic depression, but used also for symptomatic
depressions, and depression as a co-morbidity. In another
embodiment, the treatment can provide weekly subcutaneous
injections and which may be combined with orally available agonists
of the cognate receptors in the brain. Treatment doses can be as
described hereinabove, and in one preferred embodiment, can be from
0.1 to 1000 .mu.g/kg body weight of the factor (or combination of
factors) daily. The similar neurochemical milieu around the
ischemic core and the site of trauma, along with similarly altered
gene transcription suggest that similar neuroprotective strategies,
aimed at interference with harmful mechanisms should be effective
in cerebral ischemia and traumatic brain injury. The goal of such
therapy in both types of injuries is to minimize activating toxic
pathways and to enhance activity of endogenous neuroprotective
mechanisms as the balance between these pathways will eventually
determine the fate of the tissue at risk. Indeed, most
neuroprotectants found to be effective in models of experimental
stroke are also effective in models of experimental traumatic brain
injury (TBI).
[0204] In light of the common pathological and protective processes
active in cerebral ischemia and traumatic brain injury, as well as,
a common response to neuroprotective strategies indicates that GCSF
therapy will be effective in traumatic brain injury. There has been
one study that examined GCSF under conditions of traumatic brain
injury (Heard, et al (1998), Crit. Care Med., 26, 748-54). However
this study did not aim at any neuroprotective effects of GCSF
(filgrastim), but merely reducing infection parameters (primary
endpoints of the study: increase in absolute neutrophil count,
safety of filgrastim, and frequency of nosocomial infections
(pneumonia, bacteremia, and urinary tract infection)). There was no
improvement of mortality in that study. In the context of clinical
safety, this study demonstrated that GCSF administration is safe
for TBI, confirming the safe practicability of GCSF treatment for
neuroprotection according to the present invention. Accordingly, in
another embodiment of the present invention, the hematopoeitic
growth factors, for example GCSF and GMCSF, alone, in combination
with each other, and/or in combination with one or more additional
factors can be used to treat cerebral ischemia and traumatic brain
injury, for example, by providing a prophylactic way of protecting
neuronal cells in those patients with the injury. In an additional
embodiment, IL-3 and IL5 alone, in combination with each other,
and/or in combination with one or more additional factors can be
used.
[0205] Since the basic pathophysiological mechanisms operative in
cerebral ischemia due to cardiac failure and resuscitation are
comparable to those occurring under cerebral ischemia due to
occlusion of blood vessels (see Example 1), GCSF therapy will also
be effective under conditions of cardiac problems for
neuroprotection. Therefore, in another embodiment of the present
invention, the hematopoeitic growth factors, for example, GCSF and
GMCSF, alone, in combination with each other, and/or in combination
with one or more additional factors can be used to treat ischemia
as a result of cardiac problems/diseases and/or provide
prophylactic neuroprotective therapy. In an additional embodiment,
IL-3 and IL5 alone, in combination with each other, and/or in
combination with one or more additional factors can be used.
Therapy can be started as soon as emergency resuscitation is
started. Alternatively, in patients belonging to known risk groups
for cardiac problems (prior myocardial infarction, high blood
cholesterol levels, high blood pressure, diabetes, smoking), a
prophylactic continued therapy with the hematopoietic growth
factors, for example, GCSF, can also be performed, e.g. using a
slow release form of the factor(s).
[0206] Likewise, these above considerations apply to the large
group of patients that undergo surgery with subsequent cerebral
ischemia. In particular, cardiac surgery (Hogue et al. (1999),
Circulation, 100, 642-7), and surgery on the large blood vessels
supplying the brain (e.g. carotid endarterectomies) have a high
risk of neurological complications associated with them. An
objective, retrospective review of 358 carotid endarterectomies
performed in the neurosurgical teaching units of the University of
Toronto in the year 1982 demonstrated a perioperative stroke rate
of 3.9% and a death rate of 1.5%. Most (82%) surgical neurological
complications occurred after the immediate post-operative period
(24 hours). This high incidence of delayed stroke suggests that
most perioperative strokes are embolic rather than hemodynamic. A
5-6% combined morbidity and mortality should be expected in carotid
endarterectomy (Group (1986), Stroke, 17, 848-52). These and other
data demonstrate a clear need for a prophylactic neuroprotective
therapy in these procedures. Therefore, in another embodiment of
the present invention, the hematopoeitic growth factors, for
example, GCSF and GMCSF, alone, in combination with each other,
and/or in combination with one or more additional factors can be
used to treat ischemia as a result of surgically induced cerebral
ischemia and/or provide prophylactic neuroprotective therapy. In an
additional embodiment, IL-3 and IL5 alone, in combination with each
other, and/or in combination with one or more additional factors
can be used. In one embodiment, the treatment is started in the at
risk patients prior to a major surgical procedure.
[0207] In another embodiment of the present invention, the
hematopoeitic growth factors, for example, such as GCSF and GMCSF,
alone, in combination with each other, and/or in combination with
one or more additional factors can be used to treat multiple
sclerosis (MS) and/or provide prophylactic neuroprotective therapy
in multiple sclerosis patients. This method is based on the
presence of the GCSF receptor on oligodendrocytes, supporting a
direct efficacy of GCSF on the primary target cells of the MS. In
addition, the GCSF receptor is present on nerve cells and their
processes, which are compromised at later stages of the disease,
and could correlate with lasting disabilities (Cid, et al. (2002),
J Neurol Sci, 193, 103-9). Indeed, recently a paradigm shift in
therapeutic concepts for multiple sclerosis from immunomodulation
to neuroprotection has occurred, as it appears that
neurodegenerative mechanisms are most important for the disabling
aspects of multiple sclerosis (Bo, et al. (2003), Mult Scler, 9,
323-31, Bjartmar, et al. (2003), J Neurol Sci, 206, 165-71, Wujek,
et al. (2002), J Neuropathol Exp Neurol, 61, 23-32, Bjartmar, et
al. (2001), Neurology, 57, 1248-52, Peterson, et al. (2001), Ann
Neurol, 50, 389-400, Bjartmar and Trapp (2001), Curr Opin Neurol,
14, 271-8, Bjartmar, et al. (2000), Ann Neurol, 48, 893-901,
Bjartmar, et al. (1999), J Neurocytol, 28, 383-95, Trapp, et al.
(1999), Curr Opin Neurol, 12, 295-302, Trapp, et al. (1998), N Engl
J Med, 338, 278-85, Neuhaus, et al. (2003), Trends Pharmacol Sci,
24, 131-8, Pryce, et al. (2003), Brain, 126, 2191-202, Waubant
(2003), Expert Opin Emerg Drugs, 8, 145-61, Graumann, et al.
(2003), Brain Pathol, 13, 554-73, Golde, et al. (2003), Eur J
Neurosci, 18, 2527-37). Even areas in the brain that appear normal
with regard to white matter changes show signs of
neurodegeneration. Axonal pathology and neurodegeneration therefore
are important therapeutic targets in Multiple Sclerosis. GCSF and
GMCSF with their anti-apoptotic activity in neurons, as shown in
the present invention, and their pro-regenerative potential (by
enhancing neurogenesis and plasticity) supports that the
compositions described herein can be used as new therapies for
treating Multiple Sclerosis. In an additional embodiment, IL-3 and
IL5 alone, in combination with each other, and/or in combination
with one or more additional factors can be used.
[0208] Furthermore, pathophysiological mechanisms in multiple
sclerosis overlap with important mechanisms in cerebral ischemia,
e.g. the involvement of nitric oxide (Smith, et al (2001), Ann
Neurol, 49, 470-6), and involvement of glutamate excitotoxicity
(Pitt, et al. (2000), Nat Med, 6, 67-70). In light of this
information, the hematopoeitic growth factors such as GCSF and
GMCSF are a novel treatment option for multiple sclerosiswhich
while not being bound to any particular mechanism or theory
protects neurons directly as opposed to common treatments which
reduce inflammation. In an additional embodiment, IL-3 and IL5
alone, in combination with each other, and/or in combination with
one or more additional factors can be used.
[0209] Another embodiment of the present invention relates to the
neuroprotective treatment of schizophrenia. There has been
surprising evidence in the recent years of progressive grey matter
loss in schizophrenics. This evidence has been primarily provided
by novel magnetic resonance imaging techniques. Although
neurodegenerative processes in schizophrenia are not understood at
the molecular level, neuroprotective treatment in schizophrenia
with GCSF and/or GMCSF is a novel approach to this disease. In an
additional embodiment, IL-3 and IL5 alone, in combination with each
other, and/or in combination with one or more additional factors
can be used.
[0210] To test the efficacy of hematopoietic growth factors, such
as GCSF, in the protection of primary neurons neurons can be
prepared as follows. 10-12 rat cortices can be prepared from
embryos of the stage E18 (embryonic day 18). Tissue can be
dissociated using trypsin [10 mg/ml] IEDTA IDNase [5 mg/ml] (Roche
diagnostics, Mannheim, Germany) in HBSS (Hanks balanced salt
solution, BioWithakker). The digest can be stopped using 4 parts
medium (neurobasalmedium+1 ml 50.times.B-27 supplement
(Invitrogen)+0.5 M L-glutamine+25 .mu.M glutamate) and can be
centrifuged at room temperature for 5 min at 800 g. The pellet can
be dissolved in 5 ml medium and cell number determined by counting
(Neubauer slide). The cells can be plated at a density of 250 000
cells per well of a 24-well-plate on cover slips which can be
coated with poly-L-lysine. These neurons can then be treated with
combinations of a protective stimulus (GCSF) and a noxious stimulus
(glutamate, 100 .mu.M). GCSF is applied 30 min prior to treatment
of cultures with glutamate. Control groups are treated with either
no GCSF (just saline) or no glutamate. After 24 h, neuronal cell
death can be determined using the LDH assay (Roche Diagnostics,
Mannheim, Germany), following the manufacturers recommendations.
Alternatively, other noxious stimuli known for inducing cell death
can be used, e.g., NMDA and glycine, 3-nitropropionic acid (3-NPA),
H.sub.2O.sub.2, staurosporine, hypoxia/glucose deprivation,
potassium withdrawal, MPP+, Interleukin-1beta, TNFalpha, FAS ligand
or others known to be harmful to cells and neurons. Different
assays can also be used for assessing cell death or relative cell
survival, e.g. the cell-death ELISA (Roche Diagnostics),
Annexin/propidium iodide staining followed by a laser-scanning
cytometry analysis (Kamentsky (2001), Methods Cell Biol, 63,
51-87), Compucyte, Cambridge, Mass.), counting of cell nuclei with
apoptotic features following DAPI or HOECHST33342 staining
(condensation, fragmentation), counting of cells positive for
activated caspase 3 after immunostaining with a cleavage-specific
antibody (e.g., Promega caspase 3 antibody), or an assay for
caspase3 activity in cell lysates (e.g., ApoOne Assay, Promega;
Western blots, Elisas), or any other assay suited for measuring
cell survival or apoptotic features. Alternatively, other cells can
be used, for example differentiated PCl.sub.2 cells, HN33 cells,
SHSY5 cells, primary hippocampal neurons, primary motor neurons,
primary sensory ganglia cells, primary mesencephalic cultures,
neuronal stem cells, differentiated ES cells, or other neuron-like
cells known in the art, or cells exhibiting one or more neuronal
phenotypes. Times and concentrations exemplified here can also be
varied, for example, GCSF can be applied concomitantly with a
stimulus, or before or after the stimulus. Varying concentrations
of the factor (or combination of factors) can also be used, e.g.
0.1-100 .mu.g/ml. In principal, this assay can also be adapted for
the use in brain slice cultures.
[0211] To test the effectiveness of hematopoietic growth factors,
such as GCSF, in a model of brain trauma (controlled cortical
impact) the following can be performed. Experimental protocols can
be approved by the local ethics committee. Twenty male Wistar rats
(Charles River, Germany) weighing 280 to 320 g can be randomly
assigned to the following groups: A (Control group, n=10, traumatic
brain injury (TBI), treatment with 2 ml saline 0.9% for 90 min
beginning 30 min TBI); B (GCSF group, n=10, ischemia for 90 min,
treatment with 60 .mu.g/kg body weight of recombinant G-CSF,
Neupogen.RTM., Amgen, Europe B.V., Netherlands, soluted in 2 ml
saline 0.9% for 90 min beginning 30 min TBI); C (sham-operated
GCSF-treated control group, n=10, sham operation, treatment with 60
.mu.g/kg body weight of recombinant G-CSF, Neupogen.RTM. Amgen,
Europe B.V., Netherlands, soluted in 2 ml saline 0.9% for 90 min
beginning 30 min after TBI).
[0212] Animals can be anesthetized with an intraperitoneal
injection of 100 mg/kg body weight ketaminehydrochloride (WDT,
Garbsen, Ger any). Anesthesia can be maintained with 50 mg/kg body
weight, if necessary. A PE-50 polyethylene tube can be inserted
into the right femoral artery for continuous monitoring of mean
arterial blood pressure, blood gases, hematocrit, leukocyte count,
and blood glucose levels. The right femoral vein can be cannulated
by a PE-50 tube for treatment infusion. During the experiment,
rectal temperature can be monitored and maintained at 37.degree. C.
by a thermostatically controlled heating pad (Fohr Medical
Instruments, Germany).
[0213] For TBI the skin then can be cut around the probe and the
skull exposed and cleaned. TBI can be inflicted using a weight-drop
device with indirect impact, modified for compatibility with
microdialysis (a weight of 150 g dropped from 40 cm onto a PVC
cylinder with a Teflon point of 2.0 mm diameter). Sham operated
controls can be identically prepared to rats that received TBI,
without the trauma.
[0214] In all animals outcome can be measured by mortality, as well
as, Neurological Severity Scores (NSS), performed daily for 1 week
after traumatic brain injury by an investigator blinded to the
experimental groups. Neurological function can be graded on a scale
of 0 to 16 (normal score, 0; maximal deficit score, 16). NSS is a
composite of motor, sensory, and reflex tests and includes the beam
balance test. In the severity scores of injury, 1 score point is
awarded for the inability to perform the test or for the lack of a
tested reflex; thus, the higher score, the more severe is the
injury.
[0215] One week after TBI, the rats can be anesthetized with
ketamine 150 mg/kg body weight and decapitated. The brains can be
removed, and fixed with 4% paraformaldehyde in 0.1 mol/l phosphate
buffer for 24 hrs. After paraffin-embedding, 1-.mu.m-thick sections
can be cut and used for H&E staining, Nissl staining and
immunohistochemical analysis.
[0216] Immunohistochemical study can be performed with antisera
against myeloperoxidase (DAKO, USA), and G-CSFR (Santa Cruz
Biotechnology Inc., USA). Antisera can be generated in rabbits
immunized with the isolated human protein (anti-myeloperoxidase) or
with a synthetic peptide mapping the carboxy terminus of G-CSFR of
mouse origin, respectively. For antigen retrieval, sections
provided for G-CSFR immunohistochemistry can be heated for 20 min
in a 10 mM citrate buffer at 99.degree. C. Sections can be then
incubated in normal swine serum (10% in phosphate-buffered saline)
for 30 min and then in the primary antisera overnight at 4.degree.
C. The primary antibodies can be diluted 1:150 (myeloperoxidase)
1:400 (G-CSFR). Immunoreactivity can be visualized by the avidin
biotin complex method. (Vectastain, Vector Laboratories, USA).
Sections can be developed in 0.02% diaminobenzidine (DAB) with
0.02% hydrogen peroxide. The reaction product can be intensified by
the addition of 0.02% cobalt chloride and nickel ammonium sulfate.
Neuronal survival after TBI can be measured by quantifying neurons
under the microscope (magnification.times.40) in the hippocampus of
G-CSF treated animals and controls. Invasion of neutrophilic
granulocytes (NG) can be measured semiquantitatively on a four
point scale (0=MPO negative, 1=low MPO expression, 2=moderate MPO
expression, 3=strong MPO expression).
[0217] The description provided herein demonstrates that GCSF and
GM-CSF as well as IL-3 and IL-5 can stimulate neuronal stem cells
to differentiate into a neuronal cell type, these four cytokines
are valuable in treating neurodegenerative diseases. Independent of
the pathogenic mechanism treatment of a patient with neuronal
damage GCSF and GMCSF induce the differentiation of stem cells in
the brain into new neurons. These newborn neurons are able to take
on the lost function and in the end lead to a (at least partial)
recovery of the patient.
[0218] For Multiple Sclerosis it was shown that several cytokines
are upregulated in the brain. (Baranzini, et al. (2000), J Immunol,
165, 6576-82) It has become evident that multiple sclerosis (MS)
has significant neurodegenerative components. An increasing number
of reports show neuronal and axonal damage in MS patients and
experimental allergic encephalomyelitis (EAE) in an animal model of
MS. The mechanisms behind this neurodegeneration are unknown, but
evidence suggests immune-mediated damage. (Giuliani and Yong
(2003), Int MS J, 10, 122-30). These data show that the mode of
action of Hematopoietic factors is still thought to be
immune-mediated.
[0219] In contrast to this, in one embodiment of the present
invention a direct action of Hematopoietic factor directly on a
neuron or a neuronal stem cell, with the Hematopoietic factor being
G-CSF, GM-CSF, IL-3 or IL-5. The beneficial effect is given by
preventing/treating/providing prophylaxis for neuronal and axonal
damage and/or recover from damage by formation of new neurons.
[0220] Huntington's disease (HD) is a devastating genetic disorder.
Despite the absence of effective therapy, there has been an
explosion in interest for developing treatment strategies aimed at
lessening or preventing the neuronal death that occurs in this
disease. In large part, the renewed interest in neuroprotective
strategies has been spurred by our increasing understanding of the
genetic and molecular events that drive the underlying
neuropathology of HD. (Emerich (2001), Expert Opin Biol Ther, 1,
467-79)
[0221] There is evidence in HD that cell death is mediated through
mitochondrial pathways, and mitochondrial deficits are commonly
associated with HD. Keene et al. have previously reported that
treatment with tauroursodeoxycholic acid (TUDCA), a hydrophilic
bile acid, prevented neuropathology and associated behavioral
deficits in the 3-nitropropionic acid rat model of HD. They show
that TUDCA is a nontoxic, endogenously produced hydrophilic bile
acid that is neuroprotective in a transgenic mouse model of HD and,
therefore, may provide a novel and effective treatment in patients
with HD. (Keene, et al. (2002), Proc Natl Acad Sci USA, 99,
10671-6)
[0222] Other approaches to treat HD include novel anti-oxidants
(such as BN82451 (Klivenyi, et al. (2003), J Neurochem, 86,
267-72), intracerebrally delivered neurotrophic factors (Anderson,
et al. (1996), Proc Natl Acad Sci USA, 93, 7346-51);
(Perez-Navarro, et al. (2000), J Neurochem, 75, 2190-9) the use of
antiglutamatergic drugs ((Kieburtz (1999), J Neural Transm Suppl,
55, 97-102)) or the use of caspase inhibitors (Toulmond, et al.
(2004), Br J Pharmacol, 141, 689-97)
[0223] All of these possibilities are highlighted in the context
that HD is a neurodegenerative disorder in which genetic detection
provides a clear and unequivocal opportunity for neuroprotection.
(Emerich (2001), Expert Opin Biol Ther, 1, 467-79).
[0224] Other neurodegenerative trinucleotide disorders are also
characterised by selective and symmetric loss of neurons in motor,
sensory, or cognitive systems. Neuroprotective strategies are a
chance for all these diseases. The neuroprotective activity of
G-CSF, GM-CSF IL-3 and/or IL-5 can be used pharmacologically to
treat neurodegenerative trinucleotide disorders, like HD or even
prevent from developing symptoms.
[0225] Currently, glaucoma is recognised as an optic neuropathy.
Selective death of retinal ganglion cells (RGC) is the hallmark of
glaucoma, which is also associated with structural changes in the
optic nerve head. The process of RGC death is thought to be
biphasic: a primary injury responsible for initiation of damage
that is followed by a slower secondary degeneration related to
noxious environment surrounding the degenerating cells. For
example, retinal ischaemia may establish a cascade of changes that
ultimately result in cell death: hypoxia leads to excitotoxic
levels of glutamate, which cause a rise in intracellular calcium,
which in turn, leads to neuronal death due to apoptosis or
necrosis. Neuroprotection is a process that attempts to preserve
the cells that were spared during the initial insult, but are still
vulnerable to damage. (Kaushik, et al. (2003), J Postgrad Med, 49,
90-5). Hematopoietic factors like G-CSF, GM-CSF, IL-5 or IL-3 have
the potential to protect RGC from dying and therefore will be of
great use at least in arresting the progression of glaucoma.
[0226] In one embodiment the growth factor to treat Glaucoma is a
Hematopoietic factor; e.g. G-CSF, GM-CSF, IL-3 or IL-5. In another
embodiment of the present invention, the hematopoeitic growth
factors, for example, such as G-CSF, GM-CSF, IL-3 and IL-5 alone,
in combination with each other, and/or in combination with one or
more additional factors can be used to treat Glaucoma and/or
provide prophylactic neuroprotective therapy.
[0227] Theories abound and numerous animal models exist for the
pathophysiology of neuropathic pain. Most studies conclude that
there is a primary process that causes direct damage to the axons.
Thereafter, the waters get muddied. The most common postulation
states that axonal damage causes local and distal inflammatory
responses. These inflammatory responses lead to hyperexcitability
of the nerve at its axons with increased sodium fluxes generating
sensations of pain. In addition, an up-regulation of pain pathways
leads to increased pain sensation at the dorsal root ganglion and
at the substantia gelatinosa of the spinal cord. Until recently
patients with neuropathic pain had limited effective treatment
options.
[0228] Historically, treatment options were limited to effective
drugs with numerous side effects (i.e. TCAs and Tegretol), or
ineffective regimens (TENS units, SSRIs (i.e. Prozac, Zoloft).
Based on their modest side-effect profiles and overall
effectiveness, newer Anti-epileptic drugs (AEDs) have supplanted
TCAs and older AEDs as the first-line agents for the treatment of
neuropathic pain. (Covington (1998), Cleve Clin J Med, 65 Suppl 1,
SI21-9; discussion S145-7)
[0229] New therapies could include newer AEDs, the use of NMDA
antagonists or preventative measures with intrathecal steroids, or
nerve regeneration. Reversing peripheral nerve damage through nerve
regeneration with nerve growth factor is one hope to treat
neuropathy. (Pittenger and Vinik (2003), Exp Diabesity Res, 4,
271-85)
[0230] In one embodiment the growth factor to treat peripheral
Neuropathy is a Hematopoietic factor; e.g. G-CSF, GM-CSF, IL-3 or
IL-5. In another embodiment of the present invention, the
hematopoeitic growth factors, for example, such as G-CSF, GM-CSF,
IL-3 and IL-5 alone, in combination with each other, and/or in
combination with one or more additional factors can be used to
treat peripheral Neuropathy and/or provide prophylactic
neuroprotective therapy in e.g. diabetic patients or patient with
Herpes infection.
[0231] Although the causes of peripheral neuropathy are diverse,
the pathophysiological mechanisms in peripheral Neuropathy often
overlaps with important mechanisms in cerebral ischemia, e.g. the
involvement of nitric oxide (Smith, et al. (2001), Ann Neurol, 49,
470-6), and involvement of glutamate excitotoxicity (Pitt, et al.
(2000), Nat Med, 6, 67-70). In light of this information, the
hematopoeitic growth factors such as G-CSF, GM-CSF, IL-3 and IL-5
are a novel treatment option for peripheral Neuropathy and
inflammatory brain disorders.
[0232] Lysosomal storage diseases result from a deficiency of
specific lysosomal enzymes that normally degrade glycoproteins,
glycolipids or mucopolysaccharides (MPS). When not degraded, these
substances accumulate in the lysosomes, eventually causing cells to
fail and damage the organ in which they live.
[0233] Enzyme replacement therapy is actually the main therapy in
Lysosomal storage diseases. Neural stem cells (NSCs) in the
treatment of diffuse central nervous system (CNS) alterations in a
murine model of mucopolysaccharidosis VII (MPS VII), a lysosomal
storage disease caused by a genetic defect in the
beta-glucuronidase gene. NSCs would serve as a useful gene transfer
vehicle for the treatment of diffuse CNS lesions in human lysosomal
storage diseases and are potentially applicable in the treatment of
patients suffering from neurological disorders. (Meng, et al.
(2003), J Neurosci Res, 74, 266-77)
[0234] Early transplantation is the goal so that enzyme replacement
may occur before extensive central nervous system injury becomes
evident (Malatack, et al. (2003), Pediatr Neurol, 29, 391-403).
Hematopoietic factors could be supportive by providing
neuroprotection to the neural cells involved. Additionally, by the
induction of neurogenesis it might help a patient to recover at
least partly.
[0235] In one embodiment the growth factor to treat a neurological
and/or psychiatric conditions is a Hematopoietic factor; e.g.
G-CSF, GM-CSF, IL-3 or IL-5. In another embodiment of the present
invention, the hematopoeitic growth factors, for example, such as
G-CSF, GM-CSF, IL-3 and IL-5 alone, in combination with each other,
and/or in combination with one or more additional factors can be
used to treat neurological and/or psychiatric conditions.
[0236] In one embodiment a Hematopoietic factor is given in
combination to an enzyme replacement therapy, e.g. stem cell
transplantation or vector mediated gene transfer.
[0237] Spinal cord injury (SCI) will permanently handicap about 1
in 1,000 individuals over the course of their lifetime. Much effort
has been devoted to understanding the complex cellular changes that
develop after injury, and to inventing ways to overcome the poor
capacity of the adult spinal cord for spontaneous regeneration.
Programmed cell death within the damaged tissue is one of these
changes. Some cells undergo apoptosis shortly after SCI. Like in
other models of neurodegenerative diseases, such as stroke, some
cells undergo apoptosis shortly after the injury. Hematopoietic
factors like GCSF, GMCSF, IL-3 or IL-5 can be beneficial to prevent
cells from dying after SCI. Application of the hematopoietic factor
can be locally or systemically.
[0238] On the other hand first experiments of transplanting stem
cells are promising in being beneficial for recovery from SCI
(Gorio, et al. (2004), Neuroscience, 125, 179-89). Hematopoietic
factors can be useful by treating a stem cell previous to
transplantation into the lesion side to force the development
towards a neuronal phenotype.
[0239] To test the efficacy of a hematopoietic factor in a model of
Spinal cord injury the cytokine can be assayed as follows: SCI can
be performed in female wild-type or gld mice on a C57BL/6
background, all matched for age (mean, 75 d old) and weight (mean,
24 g). After a laminectomy on the vertebral level Th8/9, the dorsal
spinal cord is symmetrically lesioned with fine iridectomy
scissors. Mice are postoperatively treated once with GCSF by
intravenous injection and treated with gentamycin (5 ml/kg at 0.2
mg/ml) once a day for 7 d. Their bladders were emptied manually
once a day until restoration of autonomic bladder function. The
overall locomotor performance of the animals was assessed one to
four weeks after the injury using the BBB locomotor, the grid-walk
test and the swimming score.
[0240] Likewise the test substance can be GMCSF, IL-3 or IL-5. The
application of the test substance can be done by single or
repetitive depositioning at the lesion site, constant injection by
a operatively attached pump, subcutaneous injection, oral
administration or as suppositories. Other locomotor performance
assays, like open-field or locomotor activity, rotarod performance,
etc. can be useful as a readout, too.
[0241] Also cells can be transplanted into the side of injury,
whereby the cell can be a stem cell after treatment with a
hematopoietic factor or a cell that expresses and releases a
hematopoietic factor.
[0242] To test the efficacy of hematopoietic growth factors, such
as GCSF, GM-CSF, IL-3 or IL-5, in the protection of human e.g.
neuroblastoma cells (SHSY5-Y) can be prepared as described
herein.
[0243] Another way to test the efficacy of hematopoietic growth
factors, such as GCSF, GM-CSF, IL-3 or IL-5, in the protection of
neuronal or neuronal like cells (E.g. primary neuronal cells,
primary neuronal cultured cells, SHSY5-Y, PC-12, etc) can be done
by FACS analysis. Cells can be prepared as follows: 200.000 primary
neuronal cells are seeded into a Poly-L-Lysin coated 24-well plate.
After 2 weeks of culture cells are treated with 0.5 .mu.M
Staurosporin and GCSF. After 16 h of incubation the cells are
harvested with Trypsin and a single cell suspension can be stained
with AnnexinV-FITC and PI (e.g. bdbioscience). Cells can be
analysed by flow cytometry (e.g. FACSCalibur (Becton-Dickinson))
whereby AnnexinV detects early and PI late apoptotic cells.
Likewise cells can be treated with another stressor like NOR3,
Camptothecin, H2O2, fas-ligand, etc. Another modification of the
assay would be to exchange the hematopoietic factor (e.g. GMCSF,
IL-3 or IL-5 instead of GCSF) or to use combinations thereof.
Likewise derivatives can be tested for efficacy in neuroprotection.
Also the detection method can be changed to another
Apoptosis-marker e.g. a TUNEL-staining can be performed or a
marker-protein of Apoptosis can be detected by a fluorescent
labelled commercially available antibody (e.g. activated Caspase-3,
cleaved PARP, etc).
Statistical Analysis
[0244] Values are displayed as means .+-.SD. After acquiring all
the data, the randomization code can be broken. ANOVA and
subsequent post hoc Fisher protected least significant difference
test can be used to determine the statistical significance of
differences in continuous variables such as physiological
parameters. The t-test can be used for comparison of neuronal
damage and immunohistochemical data. The Mann-Whitney U test can be
performed for nonparametric data such as the mortality rate and MPO
immunohistochemistry. A p value <0.05 is considered
statistically significant.
[0245] Based on the effect of hematopoietic factors, such as GMCSF,
GCSF, IL-3 and IL-5, and the effects of agonizing the cognate
receptors on neuronal cells, another embodiment of the present
invention is to treat brain tumors or other neurological cancers by
antagonizing the GMCSF and/or GCSF receptors on the cancerous
cells.
Neuronal Stem Cells
[0246] Recently, the importance of forming new nerve cells
(neurogenesis) for treating neurological disease has been
recognized. Unlike many other tissues, the mature brain has limited
regenerative capacity, and its unusual degree of cellular
specialization restricts the extent to which residual healthy
tissue can assume the function of damaged brain. However, cerebral
neurons are derived from precursor cells that persist in the adult
brain, so stimulation of endogenous neural precursors in the adult
brain could have therapeutic potential.
[0247] Neurogenesis occurs in discrete regions of the adult brain,
including the rostral subventricular zone (SVZ) of the lateral
ventricles and the subgranular zone (SGZ) of the dentate gyrus
(DG). Neurogenesis occurs in the adult animal especially after a
particular neurological paradigm (e.g. cerebral ischemia (Jin. et
al. (2001), Proc. Natl. Acad. Sci. USA, 98, 4710-5, Jiang et al.
(2001), Stroke, 32, 1201-7, Kee, et al. (2001), Exp. Brain. Res.,
136, 313-20, Perfilieva, et al. (2001), J. Cereb. Blood Flow
Metab., 21, 211-7)). Neurogenesis has also been demonstrated in
humans (Eriksson, et al. (1998), Nat Med, 4, 1313-7), and indeed
leads to functional neurons (van Praag et al. (2002), Nature, 415,
1030-4). In particular, the subgranular zone of the dentate gyrus,
and the hilus has the potential to generate new neurons during
adult life (Gage et al. (1998), J Neurobiol, 36, 249-66). It is
striking that the GCSF Receptor is expressed in this area (FIG. 4
a,d). Together with the surprising data demonstrating improvement
of functional outcome after GCSF treatment (FIG. 8), and the fact
that GCSF is a stem cell factor in another system (hematopoesis),
it is expected that GCSF exerts part of its actions, especially the
long-term effects observed (FIG. 8) via its stimulating function on
adult stem cells at least in the dentate gyrus.
[0248] This is confirmed in the present application by
demonstrating the presence of the GCSF receptor on adult neuronal
stem cells, isolated from the hippocampal region encompassing the
dentate gyrus from rat (FIGS. 12 and 13). The importance in
neurogenesis provides another reason for the applicability and
usefulness of GCSF treatment in all facets of neurodegenerative
disease, and all conditions where neurons die. In contrast to
acting on endogenous stem cells in the brain for the treatment of
neurological conditions, GCSF can be applied to in vitro
manipulations of stem cells, for example differentiation and
proliferation. Stem cell therapy in humans is presently being
explored for a number of diseases, in particular Parkinson's
disease and stroke. It is desirable to differentiate stem cells in
culture to particular types of neural cells, e.g., dopaminergic
cells for the treatment of Parkinson's disease. Differentiated, or
otherwise adapted cells to the new enviro nent, are then
administered via different routes to the organism. In Parkinson's
disease, for example, stem cells have been injected directly into
the brain to substitute for the loss of dopaminergic neurons in the
substantia nigra ("replacement therapy") (Arenas (2002), Brain Res.
Bull, 57, 795-808, Barker (2002), Mov. Disord., 17, 233-41).
[0249] Therefore, one embodiment of the present invention is to
stimulate the growth and differentiation of neuronal stem cells or
precondition neuronal stem cells prior to implantation into a
mammal using the hematopoietic growth factors and derivatives
thereof. A further embodiment of this method is to utilize these
neuronal stem cells in methods for treating neurological disease as
described herein, preferably in methods which provide a
neuroprotective effect when the neuronal stem cells are
administered to the individual.
[0250] In one embodiment, the stem cells can be administered
intravenously or intra-arterially. It has been shown, for example,
in cerebral ischemia or traumatic brain injury, that bone marrow
stromal cells injected i.v. find their way to target areas in the
brain (Mahmood et al. (2001), Neurosurgery, 49, 1196-203;
discussion 1203-4, Lu et al. (2001), J Neurotrauma, 18, 813-9, Lu,
et al. (2002), Cell Transplant, 11, 275-81, Li et al. (2002),
Neurology, 59, 514-23). Stem cells may thus be treated by GCSF or
GMCSF, or other hematopoetic factors in vitro, and then injected
via different routes to patients with any of the diseases described
herein.
[0251] In one embodiment of the present invention, the stem cells
that are transplanted are genetically engineered to express factors
that are secreted, and enhance the survival of neighboring cells,
or lead to increase proliferation and/or differentiation of adult
endogenous stem cells. For example, stem cells may be engineered to
stably express GCSF, GMCSF, and/or one or more additional
hematopoietic factors such as IL3 and/or IL5; and then be delivered
to the central nervous system to constantly secrete GCSF or GMCSF,
or other hematopoetic factors to the local environment. Stem cells
can be treated with GCSF, GMCSF, and/or other hematopoetic factor
receptor agonists. Stem cells that can be used include immortalized
stem cells (e.g., oncogene immortalized), neurospheres, and
embryonic stem cell (ES)-derived neural cells (Gottlieb (2002),
Annu Rev Neurosci, 25, 381-407), but can also include cells like
bone marrow stromal cells, or umbilical cord cells (Luf et al
(2002), Cell Transplant, 11, 275-81, Li et al (2002), Neurology,
59, 514-23). Transplantation of stem cells of variable types is a
therapeutic possibility in a variety of neurological diseases,
including Parkinsons disease (Isacson (2002), Brain Res Bull, 57,
839-46) and stroke (Kondziolka et al. (2002), J Clin Neurosci, 9,
225-30).
[0252] The stem cells, e.g., human neuronal stem cells, can be
treated with factors to condition them prior to transplantation.
One example of those conditioning factors is growth factors. One
example of conditioning is differentiating them in the direction of
desired cells, e.g. neurons. (Svendsen, et al. (1999), Brain
Pathol, 9, 499-513). The presence of the GCSF receptor on stem
cells indicates the importance of agonists for this receptor for
conditioning these cells. Adult neuronal stem cells can be treated
with different concentrations of GCSF, or other GCSF receptor
agonists, and assayed for increased differentiation potential by a
quantitative PCR approach, e.g., by quantifying the ratio of
neuronal markers (Map2, NSE (neuron-specific enolase),
neurofilament, NeuN) compared to markers of neuronal stem cells
(nestin). An increased ratio after treatment signals an increased
differentiation of stem cells towards the neuronal lineage. A
suited concentration and time window can be used to treat stem
cells prior to transplantation for neurological disease.
[0253] In another embodiment of the invention, GCSF, GMCSF,
derivatives thereof as well as GCSF and GMCSF receptor agonists can
be used to facilitate culturing of neural cell, such as, for
example, neural stem cells. In this method, the GCSF, GMCSF,
derivatives thereof as well as GCSF and GMCSF receptor agonists can
be added to the media and premixed before adding to the cells or
can be added into the media in which the cells are being cultured.
In another embodiment of this method, the neural cells are
transfected with a polynucleotide which encoded GCSF, GMCSF, and
derivatives thereof, which when transfected express the respective
factors in the cell.
[0254] In the present application we additionally demonstrate that
GCSF and GMCSF trigger the differentiation of a neuronal stem cell
towards a neuronal phenotype of the cells. The importance in
neurogenesis provides another reason for the applicability and
usefulness of GCSF and/or GMCSF treatment in all facets of
neurodegenerative disease, and all conditions where neurons die. In
contrast to acting on endogenous stem cells in the brain for the
treatment of neurological conditions, GCSF and GMCSF can be applied
to in vitro manipulations of stem cells, for example
differentiation and proliferation.
[0255] To test the efficacy of a hematopoietic factor or
combinations thereof in triggering neurogenesis stem cells can be
prepared as follows: Adult neural stem cells are generated and
cultured. The cells are plated in 15 cm.sup.2 culture flasks at a
density of 4 million cells and are treated once with 100 ng/ml
G-CSF. 4 days after stimulation the cells are harvested for the
antibody staining and the FACS-analysis. A single cell suspension
is made by triturating the neurospheres, and then the cells are
pelleted by centrifugation. After resuspension in 1.times.
phosphate-buffered saline (PBS), the cells are fixed by adding the
same volume of 2% Paraformaldehyde (PFA). The cells are incubated
for 15 min on ice, washed once with 1.times.PBS and then
permeabilised by resuspension in 0.2% tween20 solved in
1.times.PBS. After an incubation on ice for 15 min, fetal calf
serum (FCS) is added in a 1:50 dilution for blocking. As primary
antibody an anti-MAP2 antibody can be used and added at a dilution
1:100. The cells are incubated for 2 hrs on ice and washed three
times with 0.1% tween20 in 1.times.PBS. Following an incubation for
30 min on ice with a FITC-conjugated secondary antibody, the cells
are washed again three times with 0.1% tween20 in 1.times.PBS and
are finally resuspended in 1.times.PBS for FACS analysis. Flow
cytometry of cells can be performed on a FACSCalibur
(Becton-Dickinson). The cells can be analyzed by light forward and
right-angle (side) scatter, and for FITC fluorescence through an
adequate filter system. The number of FITC, e.g. MAP 2, positive
cells gives the number of stem cells that have developed a neuronal
like phenotype.
[0256] Likewise cells can be stimulated with another hematopoietic
factor, like GMCSF, IL-3 or IL-5 or combinations thereof.
[0257] IL-3 and IL-5 have the potential to induce neurogenesis in
stem cells, too. The described methods to treat stem cells with a
hematopoietic factor hold true for IL-3 and IL-5, also.
Administration/Formulation/Dosage
[0258] G-CSF, GM-CSF, IL-3, IL-5 and the other factors,
derivatives, genes, and combinations thereof, may be administered
in a variety of dosage forms which include, but are not limited to,
liquid solutions or suspensions, tablets, pills, powders,
suppositories, polymeric microcapsules or microvesicles, liposomes,
and injectable or infusible solutions.
[0259] The preferred form depends upon the mode of administration
and the therapeutic application. The composition may be in the form
of a liquid, slurry, or sterile solid which can be dissolved in a
sterile injectable medium before use. The parenteral administration
is preferably intravenously. This injection can be via a syringe or
comparable means. This may contain a pharmaceutically acceptable
carrier. Alternatively, the compositions, e.g. containing G-CSF,
may be administered via a mucosal route, in a suitable dose, and in
a liquid form. For oral administration, the compositions, e.g.,
containing G-CSF, can be administered in liquid, or solid form with
a suitable carrier.
[0260] The mammal to be treated can be, for example, a guinea pig,
dog, cat, rat, mouse, horse, cow, sheep, monkey or chimpanzee. In
one embodiment, the mammal is a human. Likewise, in one embodiment
the hematopoietic factors, such as GCSF IL-3, IL-5 and GMCSF used
for therapy or prophylaxis is a human factor or derived from a
human source.
[0261] A therapeutically effective amount of the hematopoeitic
factors for use in the methods of treating neurological disease
when the factors are used either singularly or in combination
should be used in an amount that results in a neuroprotective
effect. Such an amount can range from about 100 ng to about 10
mg/kg body weight per factor or as a combination and can be
determined based on age, race, sex, and other factors based on the
individual patient. For example, an amount of GCSF for use in the
present methods would be from about 5 to about 60 .mu.g/kg and for
GMCSF from about 5 to about 7501 g/kg body weight. Likewise, IL-3,
or IL-3 mimetics, IL-5, or IL-5-mimetics can be administered in the
given doses and formulations as described for G-CSF and GM-CSF, for
example, a therapeutically effective amount of IL-3 or IL-5 can be
from about 1 to about 1000 .mu.g/kg body weight. When the factors
are administered in combination, they may be premixed prior to
administration, administered simultaneously, or administered singly
in series.
[0262] In certain embodiments of treating neurological conditions
as described herein, higher doses of G-CSF, GM-CSF, IL-3, IL-5
and/or the other factors described herein can be especially useful,
for example, at least 1 mg, at least 2 mg, or at least 3 mg may be
used, a range from about 1 to 3 mg is preferable. These higher
doses cannot be conveniently achieved for adult patients by using
the currently available packaging units. Therefore, in one
embodiment, the present invention provides packages, especially for
doses in the range of 20 to 250 .mu.g/kg body weight, which may be
administered, e.g., intravenously, or sub-cutaneously, for the
purpose of neuroprotection according to the description herein.
Examples of the packaged units useful for delivery of the high
dosage compositions include, for example, single use vials and
prefilled syringes containing 0.75 to 25 mg G-CSF, GM-CSF, IL-3,
IL-5 and/or the other factors described herein at a fill volume of
1.0 ml or 2.0 ml. In a preferred embodiment, the packaged units
would also contain instructions, on a label or separate printed
material, for the delivery of the composition(s) contained
therein.
[0263] Preferred are also prefilled syringes for G-CSF, GM-CSF,
IL-3, IL-5 and/or the other factors described herein administration
calibrated with kg/bdy weight scales that allow the exact and fast
dosage for each individual patient according to the patient's body
weight. These packaging units are very useful under emergency
settings, for example in the case of stroke, where patients have to
be treated very quickly after injury. Accordingly, another
embodiment of the present invention is to provide neuroprotection,
for example, in a patient who has suffered a stroke or other
neurotraumatic event, by administration of one or more composition
as described herein a short time after the injury has occurred. In
an alternative embodiment, the compositions described herein, such
as the prefilled syringes, may also be administered/used anytime
after the injury not specifically limited to only a short time
after the injury.
[0264] As used in the context of this embodiment, "a short time
after injury" means within about 10 minutes, 15 minutes, 20
minutes, 25 minutes, 30 minutes or even up to about 1 hour after
the occurrence of the injury or the event causing the injury. The
compositions may be administered by a medical professional or in
some instances a non-medical professional who has access to a
packaging unit containing the appropriate dosages of factor(s). In
the case of a medical professional, such as an ambulance
technician, nurse, doctor, etc, the administration may be performed
at the location where the patient has suffered a neurotrauma, e.g.,
such as stroke, in an ambulance or other vehicle while being
transported to the hospital (or other medical facility), or in the
hospital, such as in the emergency room. Without being limited to
theory, the administration of one or more hematopoietic factors,
such as G-CSF, GM-CSF, IL-3, IL-5 and/or the other factors
described herein containing compositions, within a short time after
injury, a greater neuroprotective effect may be achieved.
[0265] In another embodiment, the present invention also provides a
device especially suited for slow release and constant long-term
application that may be an implanted mini-pump, preferably
implanted sub-cutaneously (for example, as described in Edith
Mathiowitz; (Ed.), Encyclopedia of Controlled Drug Delivery, John
Wiley & Sons vol. 2, pp. 896-920, 1999). Such pumps are known
to be useful in insulin therapy. Examples of such pumps include
those manufactured/distributed by Animas, Dana Diabecare, Deltec
Cozm, Disetronic Switzerland, Medtronic, and Nipro Amigo as well as
those described, for example, in U.S. Pat. Nos. 5,474,552;
6,558,345; 6,122,536; 5,492,534; and 6,551,276, the relevant
contents of which are incorporated herein by reference.
[0266] The present invention also provides a device that measures
endogenous serum-levels of G-CSF, GM-CSF, IL-3, IL-5 and/or the
other factors described herein and upon this basis, taking into
account age and body weight, calculates and injects the appropriate
amount of drug (for example, as described in Renard E., Curr Opin
Pharmacol. 2002 December; 2(6):708-16). This can be done on a
chronic basis, for example by using the above described mini-pump,
or on an acute basis. An example of such a device is produced by
the company Medtronic minimet (Medtronic MiniMed, 18000 Devonshire
Street, Northridge, Calif. 91325-1219) for insulin therapy. A way
of measuring the G-CSF, GM-CSF, IL-3, IL-5 and/or the other factors
described herein serum level may be accomplished using protein
chips or arrays, for example, as described in U.S. Pat. Nos.
6,630,358; 6,537,749; and 6,475,809, the relevant disclosures of
which are incorporated herein by reference.
[0267] The above embodiments of drug delivery using pumps and/or
coupled with serum level detection of G-CSF, GM-CSF, IL-3, IL-5
and/or the other factors described herein can be especially useful
for the treatment of chronic neurodegenerative diseases, for
example, Parkinson's disease, amyotrophic lateral sclerosis (ALS),
dementia, and others.
[0268] The route of administration can include the typical routes
including, for example, orally, subcutaneously, transdermally,
intradermally, rectally, vaginally, intramuscularly, intravenously,
intraarterially, by direct injection to the brain, and
parenterally. In addition, in some circumstances, pulmonary
administration may be useful, e.g., pulmonary sprays and other
respirable forms.
[0269] In addition to pulmonary sprays, intranasal (IN) delivery
(for example by nasal sprays) is a preferred application mode of
delivering the compositions of the present invention for
neurological/psychiatric conditions. Intranasal delivery is well
suited to serve as application mode of proteins and peptides, and
is very convenient to use, especially for long-term treatments.
Examples for the use of intranasal delivery (nasal sprays) for
applying peptides or proteins to the brain can be found in:
(Lyritis and Trovas (2002), Bone, 30, 71S-74S, Dhillo and Bloom
(2001), Curr Opin Pharmacol, 1, 651-5, Thome and Frey (2001), Clin
Pharmacokinet, 40, 907-46, Tirucherai, et al. (2001), Expert Opin
Biol Ther, 1, 49-66, Jin, et al. (2003), Ann Neurol, 53, 405-9,
Lernere, et al. (2002), Neurobiol Aging, 23, 991-1000, Lawrence
(2002), Lancet, 359, 1674, Liu, et al. (2001), Neurosci Lett, 308,
91-4). For intranasal application, G-CSF, GM-CSF, IL-3, IL-5 and/or
other compositions as described herein can be combined with
solvents, detergents and substances that increase penetration of
the nasal epithelium or delivery into blood vessels, such as drugs
that widen nasal blood vessel, increase perfusion, etcetera.
[0270] Based on the mode of administration, and under consideration
of the relevant pharmacokinetics involved, the dose may be further
modified, e.g., for a direct injection into the brain the dose
would be lower, and the amount would be specified in absolute
doses, based on local availability of G-CSF, GM-CSF, IL-3, IL-5
and/or other compositions as described herein (e.g., 5 .mu.g total
dose). Preferably, G-CSF, GM-CSF, IL-3, IL-5 and/or other
compositions as described herein are administered intravenously,
subcutaneously, or by direct intracerebral injection, which may be
performed with an osmotic pump.
[0271] In another embodiment, G-CSF, GM-CSF, IL-3, IL-5 and/or
other compositions as described hereincan be provided to the
individual by administrating one or more nucleic acids that encodes
these factors. The coding sequence nucleic acid is preferably
administered in the form of a recombinant vector, such as a viral
vector. The selection of a suitable vector and expression control
sequences as well as vector construction is known. Examples, of
viral vectors include an adenovirus (Acsadi et al., Hum. Gene Ther.
7(2): 129-140 (1996); Quantin et al., PNAS USA 89(7): 2581-2584
(1992); and Ragot et al., Nature 361 (6413): 647-650 (1993)), an
adeno-associated viral vector (Rabinowitz et al., Curr. Opin.
Biotechnol. 9(5): 470-475 (1998)), a retroviral vector (Federico,
Curr. Opin. Biotechnol. 10(5): 448-453 (1999)), a Herpes simplex
viral vector (Latchman, Gene 264(1): 1-9 (2001)), a lentiviral
vector, a Sindbis viral vector, or a Semliki forest viral vector.
Suitable vectors are also liposomes containing proteins that will
attach to neural cells, e.g., virus epitopes, and contain either
nucleic acid encoding G-CSF, GM-CSF, IL-3, IL-5 and/or other
factors as described herein, or protein, or oligonucleotides. An
example of such a transfer system is the HVJ-liposome (Kaneda, et
al. (2002), Mol Ther, 6, 219-26. Kaneda (1999), Mol Membr Biol, 16,
119-22). Preferably, the isolated and purified nucleic acid
encoding and expressing the protein or polypeptide is operably
linked to a promoter that is suitable for expression in neural
cells. These and other suitable vectors are reviewed in Kay et al.,
Nature Medicine 7: 33-40 (2001); Somia et al., Nature Reviews 1:
91-99 (2000); and van Deutekom et al., Neuromuscular Disorders 8:
135-148 (1998).
[0272] Suitable promoters for operable linkage to the isolated and
purified nucleic acid are known in the art. Preferably, the
isolated and purified nucleic acid encoding the polypeptide is
operably linked to a promoter selected from the group consisting of
the muscle creatine kinase (MCK) promoter (Jaynes et al., Mol.
Cell. Biol. 6: 2855-2864 (1986)), the cytomegalovirus (CMV)
promoter, a tetracycline/doxycycline-regulatable promoter (Gossen
et al., PNAS USA 89: 5547-5551 (1992)).
[0273] Generally, to ensure effective transfer of the vectors of
the present invention, about 1 to about 5,000 copies of the vector
are employed per cell to be contacted, based on an approximate
number of cells to be contacted in view of the given route of
administration, and it is even more preferred that about 3 to about
300 pfu enter each cell. These viral quantities can be varied
according to the need and use whether in vitro or in vivo. The
actual dose and schedule can also vary depending on whether the
composition is administered in combination with other compositions,
e.g., pharmaceutical compositions, or depending on individual
differences in pharmacokinetics, drug disposition, and metabolism.
Similarly, amounts can vary in in vitro applications depending on
the particular type of cell or the means by which the vector is
transferred.
[0274] The above-described proteins or derivatives thereof,
substances or nucleic acids can be formulated for medical purposes
according to standard procedures available in the art, e.g., a
pharmaceutically acceptable carrier (or excipient) can be added. A
carrier or excipient can be a solid, semi-solid or liquid material
which can serve as a vehicle or medium for the active ingredient.
The proper form and mode of administration can be selected
depending on the particular characteristics of the product
selected, the disease, or condition to be treated, the stage of the
disease or condition, and other relevant circumstances (Remington's
Pharmaceutical Sciences, Mack Publishing Co. (1990)). The
proportion and nature of the pharmaceutically acceptable carrier or
excipient are determined by the solubility and chemical properties
of the substance selected the chosen route of administration, and
standard pharmaceutical practice. The pharmaceutical preparation
may be adapted for oral, parenteral or topical use and may be
administered to the patient in the form of tablets, capsules,
suppositories, solution, suspensions, or the like. The growth
factors, derivatives thereof, a nucleic acid coding sequence
thereof of the present invention, while effective themselves, can
be formulated and administered as pharmaceutically acceptable
salts, such as acid addition salts or base addition salts, for
purposes of stability, convenience of crystallization, increased
solubility, and the like.
[0275] For some neurological diseases, especially in ischemic
diseases it is crucial for an effective therapy not to delay the
onset of the therapy. In a preferred embodiment, the present
invention relates to a method, wherein G-CSF, GM-CSF, IL-3, IL-5
and/or other compositions as described herein or a substance
activating STAT proteins or an agonist to the GCSF, GMCSF, IL-3,
and/or IL-5 receptors is administered within 24, preferably within
10, most preferably within 3 to 6 hours after the occlusion of a
blood vessel, or the onset of neurological symptoms, or another
wise detected onset of an ischemic event. As G-CSF, GM-CSF, IL-3,
IL-5 and/or other compositions as described herein also have
beneficial effects for long-term functional improvement, treatment
begins at considerable time after the ischemic insult is also
possible (e.g., 1 day to 7 days after the insult). Treatment may be
continued for several days and weeks after the ischemic event, as a
means to improve functional recovery of the patient in analogy to
the functional improvement seen in our long-term cortical infarct
model (see FIG. 8). Treatment may consist of several doses per day
(e.g. short i.v. infusions) to reach steady-state trough levels of
G-CSF, GM-CSF, IL-3, IL-5 and/or other compositions as described
herein or related factors. Treatment may also include continuous
slow infusion of the described substances (e.g., by a perfusor
unit) to guarantee steady serum levels.
[0276] In the case of chronic neurodegenerative processes, such as
Parkinson's disease, or amyotrophic lateral sclerosis, treatment
will more likely consist in one daily dose of G-CSF, GM-CSF, IL-3,
IL-5 and/or other compositions as described hereinor related
factors, or preferably use slow-release formulations, or more
stable derivatives of G-CSF, GM-CSF, IL-3, IL-5 and/or other
compositions as described hereinor related factors.
Screening for Neuroprotective Substances which Bind to a GCSF,
IL-3, IL-5 or GM-CSF Receptor on Neural Cells
[0277] For practicing the present invention, derivatives of GCSF,
GMCSF (e.g., GCSF- or GMCSF-mimetics), and/or other hemotopoietic
factors that retain their potential to protect neurons and that
also have diminished action on leukocytes, thereby reducing
potential adverse effects, are preferred. Therefore, one embodiment
of the present invention is to screen for compounds that bind to
the GCSF or GM-CSF receptor on neural cells and which stimulate the
neuroprotective effect observed with GM-CSF or GCSF as described in
this application.
[0278] Derivatives of GCSF, e.g., GCSF-mimetics, can be tested in
an in vitro neuroprotective assay such as exemplified in Example
10. This neuroprotective assay can be varied without changing the
basic principle of the test by adapting for, for example, (i) other
damaging stimuli like Interleukin-1, oxygen deprivation, A4
peptides, FAS ligand, or (ii) other cells, e.g. neuronal-like cells
like SH-SY5Y cells, or PC12 cells, or (iii) other readouts for
cell-viability or cell-death such as e.g. DNA-fragmentation,
nuclear condensation, activity of co-transfected
beta-galactosidase, detection of a fluorigenic substrate of
caspases etc. All these numerous adaptations are known and may also
be used in high-throughput systems. High throughput screening
technology is commonly used to define the rapid processing of cells
on a large scale. Substances demonstrating a positive
neuroprotective effect in this assay can be further tested for
their granulopoetic activity as, for example, described in Tian et
al., Science 281, 257-259. Selection of GCSF derivatives is
preferably based on the comparison of these two specific effects
elicited by the test substances with those effects elicited by
known forms of GCSF, Likewise, derivatives of GMCSF, e.g.,
GMCSF-mimetics can be tested in an in vitro neuroprotective assay
as described for GCSF.
[0279] Further neuroprotective substances can be obtained by
measuring the presence of activated transcription factors such as
STAT-proteins, including STAT-3 and STAT-5 in neuronal or
neuron-like cells (for example, PC12, SH-SY5Y, hNT, NT2, hn33)
after exposure of these cells to a test substance. Therefore, in
another embodiment of the present invention, the ability of a
particular substance or compound to act as an agonist to the GCSF
or GMCSF receptor can be assessed by the activation of the STAT
proteins, e.g., STAT3 and/or STAT5, in neuron-like cells as
described herein and using conventional gene expression assays,
such as quantitative PCR by LightCycler.TM. or TaqMan.TM.
analysis.
[0280] Activated STAT proteins are phosphorylated (pSTAT) and can
be detected by a commercially available pSTAT-specific antibody
(Santa Cruz Biotechnology) in Western Blot or in
immunohistochemical studies, or ELISAs.
[0281] Alternatively, STAT activity can be measured using a
reporter construct which includes a STAT-responsive promoter
element (for example, a multimerized STAT-binding element, such as
a multimerized STAT-3 or STAT-5-binding element) linked to a
reporter gene, such as luciferase, SEAP (secreted alkaline
phosphatase), chloramphenicol transferase (CAT), green fluorescent
protein (GFP), or other common gene expression reporters. After
transfecting cells with reporter construct, the cell is contacted
with the test substance and the amount of the reporter expression
can be identified. This method of measuring STAT activity can be
adapted to a high-throughput format.
[0282] A typical reporter assay can be conducted using, for
example, commercially available assay systems (Mercury Pathway
Profiling System from Clontech; Path Detect-System from
Stratagene). An example of a protocol that can be performed is as
follows.
[0283] Cells are cultured in a multiwell plate, e.g. 20.000 cells
per well in a 96 well plate. Two days after seeding the cells
culture medium is exchanged to an serum-free medium (40 .mu.l per
well) and cells can be transfected with a reporter plasmid,
encoding the STAT-binding element and the reporter protein
(STAT-3_firefly-luciferase plasmid; 50 ng/well), and a transfection
control plasmid (renilla-luciferase expression plasmid; 10-20
ng/well) under optimized conditions referring to each cell type
(for example: PC-12 cells can be transfected by lipofection using
LIPOFECTAMINE2000.TM., Invitrogen, as recommended). 48-72 h after
transfection the assay can be run. Cells are stimulated with the
testing substance in multiple concentrations which should cover a
broad range of concentrations. Multiple assaying time points
starting within 5 minutes of stimulation should be chosen. When
using a Luciferase assay, the readout can be assessed in a
Luminometer, plate format (Berthold, Germany), measuring stepwise
the activity of renilla and firefly luciferase. The detection of
the two luciferase-activities is done by the use of commercially
available detection kits (Dual luciferase reporter assay kit,
Promega; Luciferase reporter assay kit, Clonetech). Values of
firefly luciferase are then normalized to renilla luciferase values
and relative induction of reporter gene can be calculated.
[0284] In an alternative example of a screening method, the agonist
activity on the GCSF or GMCSF receptor on neuronal cells can be
utilized and measured. For example, the homodimerization upon
ligand binding can be assayed by using fluorescence resonance
transfer energy measurements (FRET, or BRET (bioluminescence
resonance energy transfer) (Siegel R M et al Sci STKE (2000) 2000
(38):L1; Xu Y et al Proc Natl Acad Sci USA (1999) 96(1):151-6), or
reporter systems for dimerization events, e.g. the double switch
system (DE 10211063.8), the beta-gal reporter system (Rossi F et al
Proc Natl Acad Sci USA (1997) 94 (16):8405-10), or the
split-ubiquitin system (WO 954/29195, U.S. Pat. No. 5,585,245, or
Johnsson N and Varshavsky, Proc Natl Acad Sci USA (1994) 91
(22):10340-4).
[0285] In an additional alternative to screening for
neuroprotective substances which bind to GCSF and GMSCF on neuronal
cells, inducing the brain-endogenous levels of GCSF and/or GMCSF is
provided in the present invention. As described herein and
demonstrated in the following examples, GCSF as well as GMCSF were
surprisingly discovered as brain-endogenous ligands. These ligands
were induced by several ischemic conditions of the brain.
Therefore, they act as part of a brain-endogenous neuroprotective
system. In the same sense as exogenously added GCSF or GMCSF that
cross the blood-brain barrier are beneficial for a wide range of
conditions where neuroprotection is a valid therapeutic principle,
drugs that increase the brain-endogenous levels of GCSF/GMCSF can
be beneficial for these conditions.
[0286] A screening system to identify such substances can be setup
in the basic way of adding substances (for example from a large
small molecule library) to cells in culture, for example, neuronal
cells, either primary cells or neuron-like immortalized cells such
as PC 12 cells, SHSY5-cells, and others, and measuring levels of
GCSF and GMCSF.
[0287] Measuring the levels of GCSF/GMCSF can be performed by
assaying the proteins themselves (by Western blotting, ELISA, RIA,
and other techniques known to one skilled in the art), by assaying
the mRNA encoding these proteins (such as quantitative PCR,
Northern blotting, RNAse protection assay, RNA dot-blotting, and
other techniques known to one skilled in the art), or by assaying
the activity of the regulatory elements of the genes for
GCSF/GMCSF. Preferably, the activity of regulatory elements can be
assessed by reporter constructs consisting of DNA segments from the
promoter, enhancer, and/or intronic elements coupled to cDNAs
encoding reporters (such as luciferase, beta-galactosidase, green
fluorescent protein, or other reporting genes that can be easily
assayed). These reporter constructs can be transfected into cells,
either stably, or transiently.
[0288] The cells may be kept under physiological conditions, or
additionally exposed to noxious stimuli (such as hypoxia/glucose
deprivation, NO donors, glutamate excess and others) to observe
effects of concomitant addition of the respective substances to
test.
[0289] Identified substances can be further validated by giving the
substance to an animal, and measuring content of GCSF/GMCSF in the
brain (e.g. by quantitative PCR).
[0290] In another embodiment, increasing the expression levels of
the receptors for GCSF and GMCSF can be useful for increasing the
responsiveness of the cells to the ligands. Therefore, the
screening assays outlined above can also be adapted to screen for
increases in receptor expression.
[0291] Derivatives of GCSF, e.g., GCSF-mimetics can be tested in an
in vitro assay as described in Example 23. This neuroprotective
assay is one preferred variation of the given neuroprotective assay
given in Example 10 with the cell type being primary cortical cells
or SHSY5-Y cells and the damaging stimulus being Camptothecin. The
detection of cell death is done by a fluorogenic substrate of
caspases.
[0292] In addition to JAK/STAT-Pathway the PI3K/Akt pathway and
ERK-pathway are activated by GCSF (see FIG. 43). Additionally
neuroprotective substances can be obtained by measuring the
activation of one of the three pathways activated by GCSF.
Activated proteins of these pathways can be detected by
commercially available antibodies (e.g., cell signalling) that
detect their phosphorylation status in Western Blot, or in
immunohistochernical studies, or in ELISA (see, e.g., Example
21).
[0293] A selection of derivatives can be based on the comparison of
the two species elected by the test substances with those effects
elected by known forms of GCSF. Thereby a comparison of the amount
of phosphorylation or the time pattern of activation can be
done.
[0294] The different time pattern of activation of any of the
pathways can be used to identify substances of long lasting or
transient activation. This can be useful in selection of a
substance or a combination of substances for optimized effect with
respect to the neurological condition that is treated.
[0295] Alternatively the activated Pathway can be detected by a
downstream transcription factor (TF) that is activated (e.g. p53,
FKHR/AFX for PI3K/Akt-Pathway or Stat1/3 or Creb for ERK-Pathway).
TF activity can be measured by using a reporter construst that
includes the TF responsive element linked to a reporter gene, such
as luciferase, SEAP (secreted alkaline phosphatese),
chloramphenicol acetyltransferase (CAT), green fluorescent protein
(GFP), or common gene expression reporters. After transfecting the
cells with the reporter construct, the cell is contacted with the
test substance and the amount of reporter expression can be
identified.
[0296] Furthermore pathway activation can be detected by a
commercially available Kinase activity assay. (MAP Kinase (ERK1/2)
Activity Assay Kit; Chemikon; Kinase-Glo.TM. Luminescent Kinase
Assay; Promega). Such an assay can be used to identify derivatives
of GCSF or combinations of GCSF with other hematopoietic factors
that have a higher activity.
[0297] Likewise, derivatives of GMCSF or IL-3 or IL-5, e.g., GM-CSF
or IL-3 or IL-5-mimetics can be tested in an in vitro
neuroprotective assay as described for G-CSF. Likewise,
combinations or fusion proteins of CGSF, GMCSF, IL-3 or IL-5 or
derivatives thereof can be tested in an in vitro neuroprotective
assay as described for GCSF.
[0298] Also, the efficacy derivatives of GMCSF or IL-3 or IL-5,
e.g., GM-CSF or IL-3 or IL-5-mimetics in protecting a neuronal cell
from dying can be assayed in an FACS analysis as described above.
Likewise the derivative can be a fusion protein of GCSF, GMCSF,
IL-3 or IL-5 with another Hematopoietic factor.
[0299] Having generally described this invention, a further
understanding can be obtained by reference to certain specific
examples which are provided herein for purposes of illustration
only and are not intended to be limiting unless otherwise
specified.
EXAMPLES
[0300] The experiments underlying the present invention demonstrate
that GCSF is neuroprotective in vitro, and that GCSF displays
significant infarct reducing effects after transient focal cerebral
ischernia. Neurons in the periphery of the infarction but also on
the contralateral side exhibited specific binding of anti
GCSFR-antibody, indicative for a GCSF receptor. The presence of
GCSFR on neurons is novel and was verified by Western blot, RT-PCR,
and a detailed immunohistochemistry in the brain, and by PCR and
immunocytochemistry in cultured primary neurons. Furthermore, STAT3
activation as judged by nuclear translocation of STAT3 was
significantly increased in neurons of the penumbra of GCSF treated
animals compared to controls suggesting a GCSFR/STAT mediated
mechanism of action. In the in vivo ischemic experiment (middle
cerebral artery occlusion, MCAO) there was no effect on cerebral
blood flow as measured by laser Doppler flowmetry (Idf) when
comparing both groups. There were no significant differences in
physiological parameters and weight decline between both groups
during the MCAO experiment. Mortality rate was significantly
improved in animals treated with GCSF compared to controls in the
MCAO experiment. Neutrophilic blood count (NGC) was significantly
increased after 24 hours in GCSF treated animals compared to
controls. Myeloperoxidase (MP0)-staining as a measure of invading
neutrophilic granulocytes (NGs) into the ischemic hemisphere was
not significantly different between GCSF treated animals and
controls.
[0301] The dose of the i.v. delivered GCSF (60 .mu.g/kg/body
weight) used in the experiments was comparable to the doses used
for other experimental conditions. It had been tested for safety in
an earlier pilot project before and consequently no significant
side effects were observed. This dose (60 .mu.g/kg/body weight) is
six times higher than the approved dose for the treatment of human
myelodysblastic and other diseases, and has shown no appreciable
side effects in the rat model.
[0302] An infarct reducing effect of 50% achieved with GCSF is
comparable with that of other growth factors such as bFGF, or IGF
after systemic application (Fisher M, et al., J. Cereb. Blood Flow
Metab., 1995; 15:953-9; Schabitz W R, et al., Stroke 2001;
32:1226-33). It seems that glucose deprivation and excitotoxicity
with subsequent Ca.sup.2+ overload of cells as well as apoptosis,
reactive oxygen species, and decreased energy reserve in the face
of increased requirements (e.g., from spreading depression) are the
main causes of neuronal cell death following ischemia (Lee J M, et
al., Nature 1999; 399(Suppl):A7-14). As demonstrated in the
examples, GCSF protects in vitro neuronal-like cells
(NGF-differentiated PCl.sub.2 cells) against H.sub.2O.sub.2 induced
cell death. H.sub.2O.sub.2 elicits oxidative stress by the
production of reactive oxygen species (ROS), which invokes cell
death. H.sub.2O.sub.2-mediated cellular stress in mammalian cells
is well-characterized in terms of cellular phenotype, dosage,
time-course and signaling pathways involved. The wide-spread usage
of H.sub.2O.sub.2 in a multitude of studies supports apoptotic
mechanisms as effects of H.sub.2O.sub.2 in cells (see for example
FASEB J. 2002 January; 16(1):111-3: J Cell Biochem 2001;
82(3):437-44). For example, roles of the pro-apoptotic Kinase ASK1
and the FasLigand have been convincingly demonstrated in
H.sub.2O.sub.2-mediated cell-death (Tobiume K, EMBO Rep 2001 March;
2(3):222-8; Kwon, D., J. Neuroimmunol. 2001 Feb. 1; 113(1):1-9;
Facchinetti, F., J Neurosci Res. 2002 Jul. 15; 69(2):178-88).
Therefore, it is likely that GCSF interferes with apoptotic
mechanisms invoked in cerebral ischemia. GCSF's action is probably
mediated by binding to the high-affinity receptor GCSFR.
Interaction with this receptor activates the Janus family kinases
(JAKs) and STATs (Darnell JE Jr., Science 1997; 277:1630-5). JAK
are non-receptor-type tyrosine protein kinases that become
activated upon ligand-induced receptor dimerization. GCSF induced
activation of JAKs phosphorylate STATs on a conserved tyrosine
residue, which induces STAT dimerization (Quelle F W, et al, Mol.
Cell. Biol. 1994; 14:4335-41). Furthermore, STATs translocate to
the nucleus and subsequently regulate gene expression (Shuai K, et
al., Nature 1993; 366:580-3; Shuai K., Oncogene 2000; 19:2638-44).
STAT3 is the principal STAT protein activated by GCSFR (Shuai K.,
Oncogene 2000; 19:2638-44). STAT3 mediates antiapoptotic function
by activating bcl-2 and induces proliferation and differentiation
of granulocytes by upregulating the c-myc gene (Fukada T, Immunity
1996; 5:449-60; Shimozaki K, J. Biol. Chem. 1997; 272:25184-9). As
shown here by using immunohistochemistry, RT-PCR, and Western-Blot
GCSFR exists not only on hematopoetic cells but also on neurons,
glial cells, neuronal-like cells, and neuronal stem cells.
Furthermore, GCSF induced STAT3 upregulation in neurons of the
penumbra may mediate anti-apoptotic effects such as bcl-2
upregulation as shown for BDNF or bFGF, (Schabitz et al., Stroke
2001; 32:1226-33) and provide trophic support of neurons to
survive. Dense nuclear labeling of STAT3 in the penumbra of the
infarction could reflect membrane receptor-mediated translocation
of STAT3 from the cytoplasm to the nucleus which was already shown
for activated microglia after cerebral ischemia (Planas A M et al.,
Eur. J. Neurosci. 1996; 8:2612-8). GCSF is known to stimulate
release, enhancement of effector function, and extension of
lifetime by delaying apoptotic cell death of neutrophilic
granulocytes (NGCs), the body's first line of defense against all
kinds of infections (Hartung T, Curr Opin Hematol 1998; 5:221-5).
Neutrophils could occlude microvessels, subsequent invasion of
leukocytes triggers the release of proteolytic enzymes, oxygen free
radicals, interleukines, and TNK-.alpha.--effects known to
deteriorate infarct size and outcome after cerebral ischemia (Del
Zoppo G J, Stroke 1991; 22:1276-83; Jean W C, et al., Neurosurgery
1998; 43:1382-96; Matsuo Y. et al., Brain Res. 1994; 656:344-52).
In contrast, GCSF has significant anti-inflammatory effects: GCSF
reduces in models of peripheral infections TNF-.alpha., IL-1, IL-2,
IL-6 and IL-8 and elevates IL-11 receptor-antagonists (Gorgen I, et
al., J Immunol 1992; 149:918-24; Heard S O et al., Crit. Care Med.
1999; 27:1019-21; Heard S O, et al., Crit. Care Med. 1998;
26:748-54; Hebert J C et al., Arch. Surg. 1990; 125:1075-8;
Lundblad R, et al., Crit. Care Med. 1996; 24:820-6; Squadrito F, et
al., Br J Pharmacol 1997; 120:333-9). GCSF decreased TNF-.alpha.
release in vitro and in vivo in healthy volunteers and elevated
levels of antagonists for TNF, IL-6, IL-8, and IL-1.beta. (Hartung
T. Curr Opin Hematol 1998; 5:221-5; Gorgen I, et al., J. Immunol,
1992; 149:918-24; Heard S O, et al., Crit. Care Med 1999;
27:1019-21). Moreover, reduced neutrophil infiltration in lung and
ileum was observed in a model of splanchnic ischemia and
reperfusion 15 minutes after administration of GCSF and reperfusion
of the small bowel (Squadrito F, et al., Br J Pharmacol 1997;
120:333-9). Consistent with these findings an increase of
neutrophil infiltration into the ischemic hemisphere was not found
although total neutrophilic granulocytes (NGCs) increased after
GCSF treatment.
[0303] Another possible mechanism of action of growth factors in
particular bFGF includes effects on cerebral blood flow. bFGF
treatment dilates collaterals in the peri-ischemic zone even at
doses not promoting systemic hypotension, thus increasing the blood
flow to the penumbral regions (Tanaka R et al., Stroke 1995;
26:2154-8; discussion 2158-9). However, as shown here, GCSF
treatment did not reduce systemic blood pressure or change cerebral
blood flow compared with the control group as measured by LDF.
[0304] In the photothrombotic bengal rose model, postischemic
intravenous GCSF treatment clearly improved sensory motor
functional outcome six weeks after photothrombotic stroke, further
supporting the hypothesis that growth factors induce recovery and
regeneration after traumatic brain lesions in vivo. Two other
compounds, basic fibroblast growth factor (bFGF) and osteogenic
protein-1 (OP-1) were reported before to improve sensorimotor
function and to induce neuronal sprouting after focal cerebral
ischemia (Kawamata et al Proc Natl Acad Sci USA 1997; 94:8179-84;
Kawamata et al Neuroreport 1998; 9:1441-5; Ren et al
Neuropharmacology 2000; 39:860-5). In most of these studies growth
factors were administered into the cerebral ventricles which is
clinically not relevant. Only Ramirez et al. (Ramirez, et al.
(1999), Neuroreport, 10, 1201-4) reported that intravenous
administration of bFGF supports lesion-induced hippocampal
sprouting, but the authors did not study functional outcome
measures. The results presented here indicate that a clinically
relevant dose protocol of GCSF administration induces functional
recovery after cerebral ischemia. The capacity for enhancement of
plasticity is clearly not limited to ischemic brain damage, but
also relevant for neurodegenerative diseases such as Parkinson's
disease and amyotrophic lateral sclerosis (ALS), the trinucleotide
repeat diseases, cerebral ischemias due to resuscitation or
intrapartal problems, probably also to dementias such as
Alzheimer's disease, and to the neurodegenerative aspects of
schizophrenia.
[0305] The results also show the similarities in the mode of action
of GCSF, GMCSF, IL-3 and IL-5 and support their beneficial activity
in the case of neuronal damage.
Overview of the Methods for the Experiments on Cerebral
Ischemia
[0306] Ischemia was induced by using the suture occlusion model of
the middle cerebral artery (90 min) in the rat. 30 min after
induction of ischemia, animals (n=12 per group) received 60
.mu.g/kg body weight of GCSF intravenously for 90 min or vehicle.
Infarct volume was calculated based on TTC
(2,3,5-triphenyltetrazolium chloride)-staining 24 hours after
ischemia. Expression of the GCSFR was studied by
immunohistochemistry, verified by RT-PCR and immunoblotting.
Expression of STAT3 was studied by immunohistochemistry. Efficacy
of GCSF in functional recovery was studied in the Bengal rose
photothrombotic model
Statistical Analyses
[0307] The values presented in this study are means .+-.SD. After
acquiring all the data, the randomization code was broken. ANOVA
and subsequent post hoc Fisher protected least significant
difference test or Bonferroni correction were used to determine the
statistical significance of differences for in vitro data and
physiological parameters, or functional outcome in test batteries.
The t-test was used for comparison of postmortem infarct volumes,
MPO, and STAT3 immunohistochemistry. The Chi-Square test was
performed for mortality data. A p value <0.05 was considered
statistically significant.
Results
[0308] GCSF reduced infarct volume to 131.96 mm.sup.3.+-.112.7
mm.sup.3 vs 278.9 mm.sup.3.+-.91.56 mm.sup.3<0.05) in the
control group. Imunohistochemistry, Western blotting, and RT-PCR
revealed the existence of GCSF receptors in neurons and glial
cells. GCSF significantly activated STAT3 in the periphery of the
infarction compared to controls (p<0.05). GCSF is effective in
improving functional recovery after ischemia in the model of Bengal
rose photothrombosis.
[0309] It has therefore been demonstrated that GCSF has a
significant neuroprotective effect in cell culture and after focal
cerebral ischemia. This effect seems to be mediated by interaction
with GCSFR and activation of STAT3.
Example 1
Focal Cerebral Ischemia
Procedure for Inducing Focal Cerebral Ischemia (MCAO, Middle
Cerebral Artery Occlusion)
[0310] Experimental protocols were approved by the local ethics
committee. Twenty-four male Wistar rats (Charles River, Germany)
weighing 280 to 320 g were randomly assigned to the following
groups: A (Control group, n=12, ischemia for 90 min, treatment with
2 ml saline 0.9% for 90 min beginning 30 min after vessel
occlusion); B (GCSF group, n=12, ischemia for 90 min, treatment
with 60 .mu.g/kg body weight of recombinant human GCSF,
Neupogen.RTM., Amgen, Europe B.V., Netherlands, soluted in 2 ml
saline 0.9% for 90 min beginning 30 min after vessel occlusion.
Alternatively, any GCSF or derivative or formulation of other
source (another manufacturer (e.g. Lenogastrim.TM. by Roche or
Granocyte.TM. by Chugai or Albugranin.TM. by HGS or Neulasta.TM. by
Roche/Amngen) can be used here.
[0311] Animals then were anesthetized with an intraperitoneal
injection of 100 mg/kg body weight ketamine hydrochloride (WDT,
Garbsen, Germany). Anesthesia was maintained with 50 mg/kg body
weight if necessary. A PE-50 polyethylene tube was inserted into
the right femoral artery for continuous monitoring of mean arterial
blood pressure, blood gases, hematocrit, leukocyte count, and blood
glucose levels. The right femoral vein was cannulated by a PE-50
tube for treatment infusion. During the experiment rectal
temperature was monitored and maintained at 37.degree. C. by a
thermostatically controlled heating pad (Fohr Medical Instruments,
Germany). Transient focal cerebral ischemia was induced by using
the suture occlusion model as described in detail by Zea Longa et
al. (Stroke 1989; 20:84-91). Briefly, the right common carotid
artery and the right external carotid artery were exposed through a
midline neck incision. A 4-0 monofilament nylon suture (Ethicon,
Germany) coated with silicon (Bayer, Germany) was inserted through
an arteriectomy in the common carotid artery, gently advanced into
the internal carotid artery and positioned approximately 17 mm from
the carotid bifurcation. Using this technique, the tip of the
suture occludes unilaterally the proximal anterior cerebral artery,
the origins of the MCA and the posterior communicating artery. A
large infarct in the territory of the MCA is typically produced.
Reperfusion was performed by withdrawal of the occluder filament 90
minutes after vessel occlusion. Sham-operated animals underwent the
same experimental procedures as described above but the nylon
filament was not advanced beyond the common carotid artery, so that
no infarction occurred. After surgery, the catheters were removed,
and the animals were allowed to recover from the anesthesia and
given food and water ad libitum.
Measurement of Regional Cerebral Blood Flow
[0312] Laser-Doppler flowmetry (LDF) (Periflux 4001 Master, Perimed
AB, Sweden) was used to monitor cerebral blood flow (CBF) before,
during and after occlusion of the MCA. After placing the animal
into a stereotactic frame, the animal's skull was exposed and a
hole of 1.5 mm in diameter was drilled under the microscope on the
right side 4 mm lateral and 2 mm caudal to the bregma. The dura was
left intact and the LDF probe (1.4 mm in diameter) was placed into
the burr hole. The area selected for CBF monitoring corresponded to
the ischemic penumbra of the MCA occlusion model in rats.
Infarct Volume Calculation
[0313] 24 hours after MCA occlusion, the rats were anesthetized
with ketamine 150 mg/kg body weight and decapitated. The brains
were dissected and cut into 5 coronal slices of 2 mm thickness,
incubated in a 2% solution of 2,3,5-triphenyltetrazolium chloride
(TTC) at 37.degree. C. for 30 ml and fixed by immersion in a 10%
buffered formalin solution. TTC-stained sections were photographed
using a charge coupled device camera (EDH-1000 HR Computer Camera,
Electrim Corporation, Princetown, N.J., USA). A blinded
investigator measured the infarct sizes with a computerized image
analyzer (Bio Scan Optimas, Edmonds, W A). To compensate for the
effect of brain edema the corrected infarct volume was calculated
as previously described in detail: Corrected infarct area equals
left hemisphere area minus (right hemisphere area minus infarct
area) (Schabitz, et al., Stroke 2001; 32:1226-33). Infarct volumes
were expressed as a percentage of the contralateral hemisphere.
Ischemia Experiment
[0314] GCSF achieved a potent neuroprotective effect after focal
cerebral ischemia. Mean infarct volume in intraperitoneal GCSF
treated animals was 131,96 mm.sup.3.+-.112,7 mm.sup.3 versus 278.9
mm.sup.3.+-.91.56 mm.sup.3 in the control group or 9.96.+-.8.31%
(n=12) versus 22.7.+-.6.69% of the total hemisphere (p<0.05;
FIG. 1).
[0315] GCSF treatment significantly reduced mortality: Four animals
in the control group and one in the GCSF-treated group died within
the 24-hour reperfusion period (p<0.05). No statistical
differences were observed between the control and GCSF-treated
group for rectal temperature, pH, pCO.sub.2, PO.sub.2, hematocrit
(hct), blood glucose, heart rate, mean arterial pressure, and body
weight for all animals (Table 1). Leukocyte count in the peripheral
blood was significantly increased 24 hours after ischemia in GCSF
treated animals compared to controls (p<0.05, Table 1).
TABLE-US-00001 TABLE 1 HR Body Group rectal pCO2 pO2 Hct Glue MABP
(Beats/ Leukocytes Weight Time (n = 1) Temp pH (mm Hg) (mm Hg) (%)
(mg/dL) (mm Hg) min) (.times.10.sup.9/L) (g) Pre-ischemia Control
37 .+-. 0.2 7.38 .+-. 0.03 39 .+-. 7 89 .+-. 7 47.4 .+-. 3.6 263
.+-. 25 98 .+-. 12 358 .+-. 13 1.9 .+-. 0.3 314 .+-. 25 rGCSF 37
.+-. 0.3 7.35 .+-. 0.02 38 .+-. 5 91 .+-. 7 46 .+-. 0.9 251 .+-. 31
102 .+-. 15 350 .+-. 24 1.8 .+-. 0.4 318 .+-. 29 1 h Control 37
.+-. 0.1 7.38 .+-. 0.02 41 .+-. 6 88 .+-. 5 45.3 .+-. 0.8 160 .+-.
13 112 .+-. 21 384 .+-. 16 6.5 .+-. 0.6 rGCSF 37 .+-. 0.2 7.37 .+-.
0.03 39 .+-. 4 89 .+-. 8 44.3 .+-. 0.7 172 .+-. 17 109 .+-. 19 371
.+-. 27 6.8 .+-. 0.3 2 h Control 37 .+-. 0.3 7.39 .+-. 0.03 37 .+-.
3 87 .+-. 8 44.6 .+-. 0.8 149 .+-. 12 101 .+-. 14 368 .+-. 13 8.2
.+-. 0.4 rGCSF 37 .+-. 0.2 7.4 .+-. 0.04 39 .+-. 6 89 .+-. 5 44.2
.+-. 0.4 152 .+-. 14 99 .+-. 8 372 .+-. 9 8.5 .+-. 0.3 3 h Control
37 .+-. 0.2 7.38 .+-. 0.02 38 .+-. 5 91 .+-. 5 43.3 .+-. 0.9 133
.+-. 7 102 .+-. 16 366 .+-. 17 9.7 .+-. 0.8 rGCSF 37 .+-. 0.1 7.37
.+-. 0.03 37 .+-. 4 94 .+-. 10 43.1 .+-. 1.2 141 .+-. 10 99 .+-. 12
384 .+-. 13 10.6 .+-. 0.5 4 h Control 37 .+-. 0.2 7.36 .+-. 0.02 37
.+-. 6 87 .+-. 5 42.1 .+-. 0.9 168 .+-. 13 113 .+-. 24 373 .+-. 21
13.2 .+-. 0.6 rGCSF 37 .+-. 0.3 7.38 .+-. 0.03 39 .+-. 7 89 .+-. 9
42.8 .+-. 1.1 174 .+-. 16 120 .+-. 17 361 .+-. 12 13.7 .+-. 0.6 24
h Control 37 .+-. 0.2 7.37 .+-. 0.03 38 .+-. 4 86 .+-. 6 46.7 .+-.
1.5 198 .+-. 13 115 .+-. 17 365 .+-. 10 *3.8 .+-. 0.8 285 .+-. 24
rGCSF 37 .+-. 0.2 7.37 .+-. 0.04 41 .+-. 5 87 .+-. 8 47 .+-. 0.5
204 .+-. 16 117 .+-. 21 359 .+-. 15 9.7 .+-. 0.4 293 .+-. 16 Table
1 lists physiological parameters of GCSF treated animals and
controls. Values are given as mean .+-. SD (p < 0.05; ANOVA;
F-test).
[0316] LDF-monitoring revealed no statistical differences between
the two treatment groups (data not shown).
Example 2
Immunohistochemistry in the Context of Focal Cerebral Ischemia
Immunohistochemical Methods Used
[0317] For morphological analysis of STAT3 activation (FIG. 6) and
GCSFR distribution in infracted brains, and counts of neutrophilic
granulocytes, a 2-mrn-thick brain slice of GCSF-treated animals and
controls was immersion fixed in 4% paraformaldehyde in 0.1 mol/l
phosphate buffer for 24 hrs (n=5 per group). After
paraffin-embedding, 1-.mu.m-thick sections were cut and used for
H&E staining, Nissl staining and immunohistochemical
analysis.
Immunohistochernical studies were performed with antisera against
myeloperoxidase (DAKO, Carpinteria, Calif., USA), glial fibrillary
acidic protein (GFAP) (DAKO, Carpinteria, Calif., USA), GCSFR
(Santa Cruz Biotechnology Inc., Santa Cruz, Calif., USA) and STAT3
(Santa Cruz Biotechnology Inc., Santa Cruz, Calif., USA). For
antigen retrieval, sections provided for GCSFR and STAT3
immunohistochemistry were heated for 20 min in a 10 mM citrate
buffer at 99.degree. C. Sections were then incubated in normal
swine serum (10% in phosphate-buffered saline) for 30 min and then
in the primary antisera overnight at 4.degree. C. The primary
antibodies were diluted 1:150 (myeloperoxidase), 1:400 (GFAP),
1:400 (GCSFR) and 1:100 (STAT3), respectively. Immunoreactivity was
visualized by the avidin biotin complex method (Vectastain, Vector
Laboratories, USA). Sections were developed in 0.02%
diaminobenzidine (DAB) with 0.02% hydrogen peroxide. The reaction
product was intensified by the addition of 0.02% cobalt chloride
and nickel ammonium sulfate. In a subset of control slides
preabsorption of the GCSFR antiserum with the respective peptide
did not produce immunostaining (not shown). When omitting the
primary antisera, no immunostaining was produced either (not
shown). Invasion of neutrophilic granulocytes (NG) was
quantitatively measured by counting NGs per infracted hemisphere.
STAT3 protein expression was quantified in 2 overlapping fields
rostro-caudal in the vicinity of the infarction of the parietal
cortex and the corresponding contralateral side
(magnification.times.400). To this end, neurons with nuclear
translocation were counted, given as percent of STAT3 positive
neurons from all neurons. Results of the immunohistochemical
experiments in focal cerebral ischemia
[0318] Myeloperoxidase (MPO) staining detected no neutrophilic
granulocytes (NGs) in the non-ischemic hemispheres of both groups.
MPO staining was not significantly different between GCSF treated
animals and controls based on quantified MPO positive cells in the
ischemic hemisphere (14.+-.17.6 versus 14.3.+-.12.5, n.s.).
[0319] GFAP immunoreactivity (IR) was present in scattered
astrocytic processes throughout the cortex, striatum and white
matter of the non-infracted hemisphere. No difference in the
pattern and intensity of GFAP staining was detectable in the
cortical peri-infarct zone both in untreated and GCSF treated rats.
In particular, GFAP IR was not increased in the cortical penumbra,
neither in the placebo group, nor in the GCSF group (not shown).
Within the infarct core, scattered GFAP immunoreactive astrocytes
were detectable (not shown).
[0320] Immunohistochemically, staining for GCSFR was detectable in
scattered cortical neurons and neurites (not shown) both in
untreated and GCSF treated animals. Glial cells were also stained
with the GCSF-R antibody (not shown). In the infarct core, no
GCSF-R immunoreactive cells were seen. No difference in the pattern
and intensity of GCSF-R IR was evident between the two experimental
groups. STAT3 IR was seen in scattered nuclei of neurons and glial
cells within the uninfracted hemisphere of both placebo and GCSF
treated rats. Some cytoplasmic staining was also present in a few
scattered neurons. STAT3 protein expression was significantly
increased after GCSF treatment in the penumbra of the infarction
compared to untreated controls (34.4.+-.7.05 versus 13.7.+-.4.4;
p<0.0003)(FIGS. 6, 7). No difference occurred on the
contralateral side (16.2.+-.6.9 versus 13.3.+-.6.9; n.s.).
Example 3
Western Blots and PCR in the Context of Focal Cerebral Ischemia
Western Blots (FIG. 3)
[0321] For immunoblotting, brain tissue (transient ischemia of 2
hours) was lysed in 20 volumes (w/v) of homogenization buffer (320
mM sucrose, 0.1 .mu.M phenylmethylsulfonyl fluoride, and 2 .mu.g/ml
Pepstatin) at 4.degree. C. Homogenates were centrifuged at 9,200 G
for 15 min at 4.degree. C. After resuspending pellets in 1/10 of
the homogenization volume, aliquots for protein determination
(Bio-Rad protein-assay, Munich, Germany) were separated and samples
were rapidly frozen in nitric oxide and stored at -70.degree. C.
Per lane 15 .mu.g protein were loaded on a 8% SDS polyacrylamide
gel containing 4 M urea and electrophoresed under standard
conditions. Proteins were electrophoretically transferred to
Immobilon-P.TM. membranes (Millipore Corp., Eschborn, Germany) by
semi-dry blotting. After blocking in 3% nonfat dry milk in TBST (20
mM Tris base, pH 7.6, 137 mM NaCl and 0.05% Tween-20) for 1 hour at
room temperature (RT), membranes were incubated with the primary
GCSFR antibody (1:500) overnight at 4.degree. C. After washing in
TBST the membranes were incubated for 1 hour at RT with 1:2,000
dilutions of the appropriate horseradish peroxidase-conjugated
secondary antibody. Immunoreactive bands were visualized in the
linear range with enhanced chemoluminescence (Amersham Intl.,
Braunschweig, Germany).
[0322] In immunoblotting experiments with cortical extracts (FIG.
3), the GCSF-R antiserum detected a protein band of approximately
130%, consistent with the deduced molecular weight (Fukunaa R et
al., J Biol Chem 1990; 265:14008-15). In addition, a few bands of
lower molecular weight were seen, probably reflecting breakdown
products. After preabsorption of the GCSFR antiserum with the
respective peptide the bands disappeared (FIG. 3).
PCR for the GCSF Receptor in Brain (FIG. 2A)
[0323] After rats were deeply anesthetized and perfused
transcardially, brains were rapidly dissected. RNA was extracted
from brains by the RNA-clean kit (AGS, Heidelberg, Germany),
according to the manufacturer's instructions. A total of 10 .mu.g
RNA was reverse transcribed with MMLV reverse transcriptase and
random hexamers. For PCR, the following primers from exons 5 and 7
of the murine GCSFR were used: sense, 5'-CCC CTC AAA CCT ATC CTG
CCT C-3' (SEQ ID NO:5); and antisense, 5'-TCC AGG CAG AGA TCA GCG
AAT G-3' (SEQ ID NO:6). (Ashihara E, et al., J Cell Physiol 1997;
171:343-56). PCR was performed according to the following protocol:
3 min 94.degree. C., 1 min 94.degree. C., 1 min 58.degree. C., and
1 min 72.degree. C. (40 cycles). The product was analyzed on a 2%
agarose gel.
[0324] Using a RT-PCR specific for the mouse GCSFR, GCSF-R mRNA was
detected in the brain tissue (FIG. 2A). The PCR product had the
expected size of 567 bp. The identity was verified by sequencing
the PCR product (FIG. 2).
Example 4
GCSF Efficacy in ALS Models
Survival Test in ALS Mouse Models
[0325] Previous experiments have demonstrated that SOD1 mouse
models of ALS are predictive of the success of therapy in humans
(Cleveland and Rothstein (2001), Nat Rev Neurosci, 2, 806-19).
Primary endpoints in such analyses are both onset of motor signs,
and mortality. For example, the onset of motor signs can be defined
as the first day that a mouse can not remain on the rotarod for 7
min at a speed of 20 rpm (Li, et al (2000), Science, 288, 335-9).
Mortality is scored as the day of death, or the day where deficits
are so severe that the mouse has to be sacrificed (e.g. apathy and
unability to right itself). Additional parameters are determined by
the measurement of motor strength by grip strength tests, counts of
motor neurons in the spinal cord, nerve thickness (e.g. sciatic
nerve, phrenic nerve), and the presence of apoptotic stainings in
spinal cord motor neurons. GCSF can be infused via an osmotic pump
into the cerebral ventricles at a pre-determined dose, e.g. at 60
ug/kg body weight/day. Alternatively, GCSF is given via i.v. or
i.p. injection at a dose of 60 ug/kg body weight per day, or higher
doses. Alternatively, a slow-release form of GCSF is administered,
such as a PEG formulation (see above), or an albumin formulation
(see above), or other slow-release formulations. Alternatively, any
GCSF or derivative or formulation of other source (another
manufacturer (e.g. LENOGASTRIM.TM. from Roche, GRANOCYTE.TM. from
Chugai Pharma, Co. Ltd., ALBUGRANIN.TM. from Human Genome Sciences,
or NEULASTA.TM. from Roche/Amgen) is used. Treatment is started at
day 60 in the late presymptomatic stage of the SOD1 G93A mutant. In
nontreated familial ALS mice, motor impairments appear at 12-14
weeks of age, whereas paralysis is not observed before 20 weeks of
age. Life expectancy is 140-170 days. Effective treatment should
prolong life as compared to the control group by more than 15%
(Cleveland and Rothstein (2001), Nat. Rev. Neurosci., 2, 806-19).
As a control group for treatment, both vehicle and zVADfmk (a
potent caspase inhibitor that has shown efficacy in this model)
treated animals will be used. Each group comprises 10 animals
each.
Example 5
GCSF Efficacy in Parkinson Models
[0326] There are various rodent models of Parkinson's disease
available, that are suitable for efficacy studies of GCSF
(Grunblatt et al. (2000), J Neurol, 247 Suppl 2, 1195-102). One
well-characterized model is the use of
1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). 4 doses of
MPTP-HCl (15 mg/kg per dose) can be given to eight-week-old male
mice (n=20) via i.p. injection at 2 hr intervals. Sham-treated
animals receive saline. 20 animals receive both the MPTP treatment,
and a daily dose of GCSF (iv., 60 ug/kg bodyweight) seven days
after the last MPTP treatment mice are sacrificed. Until that time,
mice are analyzed both for motor parameters (rotarod performance,
free locomotion). The brains of 10 mice each are processed for
immunohistochemistry to assay the total number of neurons in the
substantia nigra that are positive for tyrosine hydroxylase or the
dopamine transporter (using commercially available antibodies), the
number of apoptosis-positive neurons (TUNEL staining, caspase-3
staining). Remaining dopaminergic neurons after MPTP treatment are
compared to those receiving MPTP plus GCSF, and to the sham
group.
[0327] The remaining 10 animals in each group will be perfused
transcardially with saline, sacrificed, and the striatum dissected
out. The striatum will be homogenized on ice, and the dopamine
content measured by HPLC with electrochemical detection. Comparison
of the three groups will provide a good measure of dopamine
depletion due to loss of cells in the substantia nigra.
[0328] This experiment can also be performed using different dosing
schemes for MPTP (i.e. mg/kg body weight once; 30 mg/kg body weight
twice, etc.).
Example 6
GCSF Improves Sensory-Motor Function after Photothrombotic Cerebral
Ischemia (FIG. 8)
Experimental Groups
[0329] Experimental protocols were approved by the local ethics
committee. Male Wistar rats (Charles River, Germany) weighing 280
to 320 g were randomly assigned to the following groups: A (Control
group, n=6), ischemia, treatment with 0.5 ml saline 0.9% as i.v.
bolus infusion beginning 1 h after ischemia); B (GCSF group, n=6),
ischemia, treatment with 5 .mu.g GCSF (Amgen) soluted in 0.5 ml
saline 0.9% as i.v. bolus beginning 1 h after ischemia.
Alternatively, any GCSF or derivative or formulation of other
source (another manufacturer (e.g. Lenogastrim.TM. by Roche or
Granocyte.TM. by Chugai or Albugranin.TM. by HGS or Neulasta.TM. by
Roche/Amgen) can be used here. Repetitive i.v. bolus infusions via
the tail vene followed at day 1 to 5. C (sham operated group, n=6),
sham operation, no ischemia, treatment with 0.5 ml saline 0.9% as
i.v. bolus infusion beginning 1 h after ischemia.
Focal Cerebral Ischemia by Photothrombosis
[0330] Animals were anesthetized with an intramuscular injection of
100 mg/kg body weight ketaminehydrochloride (WDT, Garbsen,
Germany). Anesthesia was maintained with 50 mg/kg body weight if
necessary. A PE-50 polyethylene tube was inserted into the right
femoral artery for continuous monitoring of mean arterial blood
pressure, and blood gases. The right femoral vein was cannulated by
a PE-50 tube for treatment infusion. During the experiment rectal
temperature was monitored and maintained at 37.degree. C. by a
thermostatically controlled heating pad (Fohr Medical Instruments,
Germany).
[0331] Photothrombotic ischemia was induced in the right rat
parietal cortex according to the method of Watson et al.(Watson B
D, Dietrich W D, Busto R, Wachtel M S, Ginsberg M D. Induction of
reproducible brain infarction by photochemically initiated
thrombosis. Ann Neurol 1985; 17:497-504). Animals were anesthetized
with ketamine hydrochloride and placed in a stereotaxic frame, and
the scalp was incised for exposure of the skull surface. For
illumination, a fiber-optic bundle with a 1.5-mm aperture was
placed stereotaxically onto the skull 4 mm posterior to the bregma
and 4 mm lateral from the midline. The skull was illuminated with a
cold, white light beam (150 W) for 20 minutes. During the first 2
minutes of illumination, the dye rose bengal (0.133 mL/kg body wt,
10 mg/mL saline) was injected intravenously; Sham-operated animals
underwent the same experimental procedures as described above
without infusion of rose bengal and illumination. After surgery,
the catheters were removed, and the animals were allowed to recover
from the anesthesia and given food and water ad libitum.
Behavioural Testing
[0332] In all animals a battery of behavioral tests was performed
before ischemia and at baseline, 2, 3, 4, 5, and 6 weeks after
ischemia by an investigator who was blinded to the experimental
groups. For the rotarod test, rats were placed on an accelerating
rotarod cylinder, and the time the animals remained on the rotarod
was measured (Hamm et al, J Neurotrauma 1994 April; 11(2):187-96,
Chen J, Li Y, Wang L, Zhang Z, Lu D, Lu M, Chopp M. Therapeutic
Benefit of Intravenous Administration of Bone Marrow Stromal Cells
After Cerebral Ischemia in Rats. Stroke. 2001; 32:1005). The speed
was slowly increased from 4 to 40 rpm within 5 minutes. The trial
ended if the animal fell off the rungs or gripped the device and
spun around for 2 consecutive revolutions without attempting to
walk on the rungs. An arbitrary limit of time was set for the rats
at 500 seconds on the rotarod cylinder in training as well as in
testing procedures. The animals were trained 3 days before
ischemia. The mean duration (in seconds) on the device was recorded
with 3 rotarod measurements 1 day before surgery. Motor test data
are presented as percentage of mean duration (3 trials) on the
rotarod compared with the internal baseline control (before
surgery).
[0333] For the adhesive-removal test, somatosensory deficit was
measured both before and after ischemia (Schallert T, Kozlowski D
A, Humm J L, Cocke R R. Use-dependent structural events in recovery
of function. Adv Neurol. 1997; 73:229-238; Chen J, Li Y, Wang L,
Zhang Z, Lu D, Lu M, Chopp M. Therapeutic Benefit of Intravenous
Administration of Bone Marrow Stromal Cells After Cerebral Ischemia
in Rats. Stroke. 2001; 32:1005). All rats were familiarized with
the testing environment. In the initial test, 2 small pieces of
adhesive-backed paper dots (of equal size, 113.1 mm.sup.2) were
used as bilateral tactile stimuli occupying the distal-radial
region on the wrist of each forelimb. The rat was then returned to
its cage. The time to remove each stimulus from forelimbs was
recorded on 5 trials per day for each forepaw. Individual trials
were separated by at least 5 minutes. Before surgery, the animals
were trained for 3 days. Once the rats were able to remove the dots
within 10 seconds, they were subjected to ischemia.
[0334] Neurological Severity Scores (NSS) were modified according
to Chen J, Li Y, Wang L, Zhang Z, Lu D, Lu M, Chopp M. Therapeutic
Benefit of Intravenous Administration of Bone Marrow Stromal Cells
After Cerebral Ischemia in Rats. Stroke. 2001; 32: 1005., and
Schallert T, Kozlowski D A, Humm J L, Cocke R R. Use-dependent
structural events in recovery of function. Adv Neurol. 1997;
73:229-238. Neurological function was graded on a scale of 0 to 16
(normal score, 0; maximal deficit score, 16). NSS is a composite of
motor, sensory, reflex, and balance tests (Chen J, Li Y, Wang L,
Zhang Z, Lu D, Lu M, Chopp M. Therapeutic Benefit of Intravenous
Administration of Bone Marrow Stromal Cells After Cerebral Ischemia
in Rats. Stroke. 2001; 32:1005., Germano A F, Dixon C E, d'Avella
D, Hayes R L, Tomasello F. Behavioral deficits following
experimental subarachnoid hemorrhage in the rat. J. Neurotrauma.
1994; 11:345-353) In the severity scores of injury, 1 score point
is awarded for the inability to perform the test or for the lack of
a tested reflex; thus, the higher score, the more severe is the
injury.
Results
[0335] No statistical differences were observed between the groups
for rectal temperature, pH, pCO.sub.2, PO.sub.2, hematocrit (hct),
blood glucose, heart rate, mean arterial pressure, body weight, and
mortality for all animals (data not shown).
[0336] Functional recovery in GCSF treated animals was remarkably
better over time compared with all other groups. GCSF treated
animals had significantly lower NSS scores including Beam-Balance
during the experiment compared to the control group (p<0.001,
FIG. 8 b), and resulted in significantly better rotarod performance
compared to controls (P<0.05, FIG. 8 a). Sensorimotor function
as measured by adhesive tape removal was also better in GCSF
treated animals on the contralateral forepaw over time compared to
controls as well as on the ipsilateral forepaw at week 6 (see FIG.
8 c,d).
Example 7
GCSF Receptor is Upregulated in the Photothrombotic Model of
Cerebral Ischemia
[0337] RNA was isolated according to standard protocols
(Chomczynski and Sacchi (1987), Anal. Biochem., 162, 156-159),
followed by Qiagen RNeasy.TM. mini kit purification from rat
cortical penumbral samples, ipsi- and contralateral to the lesion
side (see FIG. 9a for localization of the tissue samples; here: 3
vs. 4). cDNA was synthesized from 1 .mu.g total RNA using oligodT
primers, superscript II reverse transcriptase (Gibco) using
standard conditions. Quantitative PCR was performed using the
Lightcycler.RTM. system (Roche Diagnostics, Mannheim, Germany) with
SYBR-green staining of DNA doublestrands. Cycling conditions were
as follows: 5 min 95.degree. C., 5 sec 95.degree. C., 7 sec
66.degree. C., 30 sec 72.degree. C.; 9 sec 84.degree. C. for 55
cycles. Melting curves were done with the following parameters:
95.degree. C. cooling to 50.degree. C.; ramping to 99.degree. C. at
0.2.degree. C./sec. The following primer pairs were used: "rat
GCSFR-frag-32s" CCATTGTCCATCTTGGGGATC (SEQ ID NO:7), and "rat
GCSFR-frag-265 as" CCTGGAAGCTGTTGTTCCATG (SEQ ID NO:8). The
Lightcycler.RTM. PCR was performed using the SYBR green master mix,
following the manufacturer's recommendations (Roche Diagnostics).
Specificity of product was ensured by melting point analysis and
agarose gel electrophoresis. cDNA content of samples was normalized
to the expression level of Cyclophilin (primers: "cyc5"
ACCCCACCGTGTTCTTCGAC (SEQ ED NO:9); "acyc300" CATTTGCCATGGACAAGATG
(SEQ ID NO:10)). Relative regulation levels were derived after
normalization to cyclophilin, and comparison to the sham-operated
animals. FIG. 9 b shows upregulation of the GCSFR after 48 h on the
contralateral side, error bars indicate standard deviations, these
are calculated from 3-fold serially diluted cDNA-samples, and
reflect reliability of measurements.
Example 8
GCSF Receptor is Present on Neuronal Cells in Primary Cultures:
Immunocytochemistry
Preparation of Neurons
[0338] 10-12 Cortices were prepared from embryos of the stage E18
(embryonal day 18). Tissue was dissociated using trypsin [10
mg/ml]/EDTA/DNase [5 mg/ml] (Roche Diagnostics) in HBSS (Hanks
balanced salt solution, BioWithakker). The digest was stopped using
4 parts medium (neurobasalmedium +1 ml 50.times.B-27 supplement
(Invitrogen)+0.5 mM L-glutamin+25 .mu.M glutamate) and centrifuged
at room temperature for 5 min at 800 g. The pellet was dissolved in
5 ml medium and cell number determined by counting (Neubauer
slide). The cells were plated at a density of 250 000 cells per
well of a 24-well-plate on cover slips which were coated with
poly-L-lysine.
Immunocytochemistry
[0339] 14 days after preparation neurons were washed with PBS
(Gibco) (37.degree. C.) and fixed with 2% paraformaldehyde for 10
min on ice. Then, cells were washed with PBS (4.degree. C.) and
stored at 4.degree. C. Cells were incubated for 10 min in 50 mM
glycine in PBS, and then washed with PBS. Cells were permeabilized
on ice using 0.2% TritonX-100 (Sigma) in PBS, and incubated with
blocking solution (0.2% Triton-X100, 4% normal goat serum (GS)
(Jackson Immunoresearch Laboratories) in PBS) at room temperature.
The primary antibody (rabbit-anti-GCSF-Rezeptor-antibody directed
against the C-terminus of mouse GCSFR, M-20; sc-694; SantaCruz
Biotechnology, Inc.) was used in a dilution of 1:800 (in 0.1%
Triton-X100/2% NGS), and incubated overnight at 4.degree. C. Cells
were then washed with 1% NGS/PBS, and incubated for 30 min with the
secondary antibody (anti-rabbit-FITC, 1:400; dianova) at room
temperature. Cells were then washed briefly in 1% NGS/PBS, and
stained with Hoechst 33342 (Molecular Probes) (1:10000 in PBS) for
counterstaining the nuclei. Finally, cover slips were washed
briefly twice in 1% NGS/PBS, twice in PBS, and once for 10 min in
10 nM Tris/HCl, pH 7.6. The cover slips were embedded using
Aquamount (Polyscience).
[0340] Pictures were taken digitally with an Olympus IX81
microscope, and the "Analysis" software package (Soft Imaging
Systems, Stuttgart, Germany).
Example 9
GCSF Receptor is Present on Neuronal Stem Cells: PCR and
Immunocytochemistry (FIGS. 12,13); GCSF Receptor is Present on PC12
Cells: PCR (FIG. 2B)
[0341] Generation of Neural Stem Cells Neural stem cells were
isolated from the brain areas with known spontaneous neurogenesis,
i.e., hippocampus, olfactory bulb, and subventricular zone, of 4-6
week old male Wistar rats as described. (Ray J et al (1993), Proc
Natl Acad Sci USA 90: 3602-6). Protocols are concordant with the
policy on the use of animals, as endorsed by the National Research
Council of the U.S.A., and fulfill the requirements of German law.
Briefly, animals were anesthesized with 1% (v/v) isoflurane, 70%
N2O, 29% oxygen and sacrificed by decapitation. The brains were
removed and washed in 50 mL ice-cold Dulbecco's Phosphate Buffered
Saline (DPBS) supplemented with 4.5 g/L glucose (DPBS/Glc).
Hippocampus, olfactory bulb, and subventricular zone from 6 animals
were dissected, washed in 10 mL DPBS/Glc and centrifuged for 5 min
at 1600.times.g at 4.degree. C. After removal of the supernatant,
the tissue was homogenized with scissors and scalpels. The tissue
pieces were washed with DPBS/Glc medium for 5 min at 800 g, and the
three pellets were resuspended in 0.01% (w/v) papain, 0.1% (w/v)
dispase II (neutral protease), 0.01% (w/v) DNase I, and 12.4 mM
manganese sulfate in Hank's Balanced Salt Solution (HBSS). The
tissue was triturated with plastic pipet tips and incubated for 40
min at room temperature, but every 10 min the solution was mixed
well. The suspension was centrifuged at 800.times.g for 5 min at
4.degree. C. and pellets were washed three times in 10 mL
DMEM-Ham's F-12 medium supplemented with 2 mM L-glutamine, 100
units/mL penicillin and 100 units/mL strepotomycin. Then, the cell
pellets were resuspended in 1 mL Neurobasal medium supplemented
with B27 (Invitrogen, Carlsbad, Calif., USA), 2 mM L-glutamine, 100
units/mL penicillin and 100 units/mL strepotomycin, 20 ng/mL EGF,
20 ng/mL FGF-2, and 2 .mu.g/mL heparin. Cells were plated under
sterile conditions in 6-well dishes in a concentration of
25,000-100,000 cells/mL. The dishes were incubated at 37.degree. C.
in 5% CO2. Cell culture media were changed once a week, where about
two thirds of the media were replaced. (Ray J et al (1993), Proc
Natl Acad Sci U S A 90: 3602-6)
RT-PCR Protocol:
[0342] RNA was isolated according to standard protocols from
hippocampal stem cells (FIG. 12) that were propagated 3 weeks in
culture after thawing them from frozen stocks, following the
manufacturer's recommendations (RNeasy kit, Qiagen). cDNA was
synthesized using oligodT primers, Superscript II reverse
transcriptase (Gibco) using standard conditions. Polymerase chain
reaction (PCR) was performed with the following cycling conditions:
3 min 94.degree., 30 sec 94.degree., 30 sec 60.degree., 1 min
72.degree.; for 32 cycles, using the primer pairs "rat
GCSFR-frag-8s" GCGGGCAAATCAGGATCTCAC (SEQ ID NO:2), and "rat
GCSFR-frag-287 as" CGAAGCTCAGCTTGATCCAGG (SEQ ID NO:3). The primers
were derived from a fragment of rat GCSFR identified from rat
genomic databases by TBLASTX searches (see FIG. 11). Reaction
conditions: 2 mM MgCl2, 200 uM dNTP, 200 nM each primer, 1 unit Taq
Polymerase (Invitrogen)/25 .mu.l. The PCR product was resolved on a
1.5% agarose gel. The specific PCR product length was 279 bp, with
the following sequence (SEQ ID NO:4) (primer sequences are
underlined):
TABLE-US-00002 gcgggcaaatcaggatctcaccccccattgtccatcttggggatcctgtc
ctggcctcctgcaccatcagcccaaactgcagcaaactggaccgacagcc
aaagatcctatggagactgcaagatgaaccaaaccagcctggggacagac
agcatcacctgcctgacgggtcccaggagtccatcatcactctgcctcat
ctgaactacactcaggccttcctcttctgcttggtgccatggaacaacag
cttccaggtcctggatcaagctgagcttcg.
For PCR on PC12 cells (FIG. 2B), the above protocol was
followed.
Immunocytochemistry of Neurospheres:
[0343] Neurospheres consisting of the neural stem cells were
pipetted onto the glass slide, coverslip was put onto the cells,
and the slide was put at -80.degree. C. for at least 30 min. The
coverslip was removed, and put into 4% PFA (paraformaldehyde) in
0.1 M Phosphatpuffer, pH 7.4 immediately. Cells were fixed for 20
min. Cells were washed 3.times.5 min in PBS (pH 7.4) with 1% FCS
and 0.02% NaN.sub.3. Cells were permeabilised for 10 min in PBS
containing 0.5% TX-100. Antigens were blocked for 60 min in PBS (pH
7.4) containing 1% FCS and 0.02% NaN.sub.3. Cells were stained for
12 min with the nuclear dye DAPI at a concentration of 0.001 mg/ml
in PBS. Cells were then washed 2.times.5 min with PBS (pH 7.4)
containing 1% FCS and 0.02% N.sub.3. The first antibody was applied
for 2 h diluted in PBS (pH 7.4) containing 1% FCS and 0.02%
NaN.sub.3, at concentrations of: anti-G-GSF 1:1000, anti-G-CSF-R
1:1000, anti-GM-CSF-R 1:1000 (Santa Cruz), respectively. Cells were
washed for 3.times.5 min with PBS (pH 7.4) containing 1% FCS and
0.02% NaN.sub.3. The second antibody (goat anti-rabbit IgG-FITC,
(DAKO)) was then applied for 60 min in PBS (pH 7.4) containing 1%
FCS and 0.02% NaN.sub.3, at a concentration of 1:30. Cells were
washed for 3.times.5 min in PBS (pH 7.4) containing 1% FCS and
0.02% NaN.sub.3. Cells were finally mounted with Aquamount and
coverslips.
Example 10
GMCSFR Alpha is Upregulated in the Phototrombotic Model of Cerebral
Ischemia (Discovery by RMDD)
[0344] Experimental protocols were approved by the local ethics
committee. Male Wistar rats (Charles River, Germany) weighing 280
to 320 g were assigned to the following treatments: a) ischemia for
various timepoints (6 h, 48 h, and 21d); b) sham operation, no
ischemia, for accordant timepoints (6 h, 48 h, and 21d), with n=2
for each timepoint and treatment.
Focal Cerebral Ischemia by Photothrombosis
[0345] Animals were anesthetized with an intramuscular injection of
100 mg/kg body weight ketaminehydrochloride (WDT, Garbsen,
Germany). Anesthesia was maintained with 50 mg/kg body weight if
necessary. A PE-50 polyethylene tube was inserted into the right
femoral artery for continuous monitoring of mean arterial blood
pressure, and blood gases. The right femoral vein was cannulated by
a PE-50 tube for treatment infusion. During the experiment rectal
temperature was monitored and maintained at 37.degree. C. by a
thermostatically controlled heating pad (Fohr Medical Instruments,
Germany).
Photothrombotic ischemia was induced in the right rat parietal
cortex according to the method of Watson B D, Dietrich W D, Busto
R, Wachtel M S, Ginsberg M D. Induction of reproducible brain
infarction by photochemically initiated thrombosis. Ann Neurol.
1985; 17:497-504. Animals were anesthetized with
ketaminehydrochloride and placed in a stereotaxic frame, and the
scalp was incised for exposure of the skull surface. For
illumination, a fiber-optic bundle with a 1.5-mm aperture was
placed stereotaxically onto the skull 4 mm posterior to the bregma
and 4 mm lateral from the midline. The skull was illuminated with a
cold, white light beam (150 W) for 20 minutes. During the first 2
minutes of illumination, the dye rose bengal (0.133 mL/kg body wt,
10 mg/mL saline) was injected intravenously. Sham-operated animals
underwent the same experimental procedures as described above
without infusion of rose bengal and illumination. After surgery,
the catheters were removed, and the animals were allowed to recover
from the anesthesia and given food and water ad libitum. Animals
were killed according to the various timepoints (6 h, 48 h, and 21d
after ischemia and sham operation, respectively) and the
preparation of the penumbral cortex both ipsi- and contralateral is
known to those skilled in the art.
RNA Isolation and RMDD
[0346] RNA was isolated according to standard protocols
(Chomczvnski and Sacchi (Anal Biochem (1987), 162, 156-9), followed
by Qiagen Reasy mini kit purification) from rat cortical penumbral
samples, ipsi- and contralateral to the lesion side (see FIG. 13a
for localization of the tissue samples; here: 3 vs. 4). cDNA
synthesis was performed from 1 .mu.g total RNA according to the
RMDD (restriction mediated differential display)-protocol as
described in EP 0 743 367 A2 and U.S. Pat. No. 5,876,932. Following
first strand and second strand synthesis, and MboI digestion an
adaptor ligation was done. Two PCR reactions with subsets of primer
combinations were performed. Subsequently the PCR reactions were
loaded on a denaturing gel and blotted on a nylon membrane (GATC
Biotech AG, Konstanz, Germany). Biotin-labeled bands were
visualised with a common streptavidin-peroxidase reaction. PCR
samples from the cortical penumbra were loaded on the gel in the
following order: ipsilateral: naive (untreated), sham 6 h, sham 48
h, sham 21d, and 6 h, 48h and 21d photothrombosis; contralateral:
sham 6 h, sham 48 h, sham 21d, and 6 h, 48h and 21 d
photothrombosis. Bands having different intensity in the ipsi- and
contralateral region were cut out of the nylon membrane and
reamplification of the according PCR product was performed.
Amplified products were cloned in the pCR-BluntII-TOPO vector
(Invitrogen GmbH, Karlsruhe, Germany) and sequenced with T7 and
M13rev primers (ABI 3700). Obtained sequences were compared with
the EMBL-database. A sequence upregulated after 48 h both in ipsi-
and contralateral cortical penumbra was identified (FIG. 14). The
identified EST-sequence was extended with BLASTN-searches in
EST-databases and a mouse homologous sequence coding for the mouse
GM-CSFR alpha was identified in EST- and genomic databases
(ensembl; www.ensembl.org) by using screening programs (BLAST,
TBLASTN (Altschul, et al. (1997), Nucleic Acids Res, 25,
3389-402)).
[0347] Screens were performed in rat cDNA libraries with the PCR
cloning method of Shepard ((1997) Nucleic Acids Res 25:3183-3185)
to confirm the obtained rat sequence. This method is based on
hybridization of cDNA molecules derived from a plasmid library to a
biotin-coupled oligonucleotide sequence. Following plasmid
extraction with streptavidin-coupled magnetic beads the result was
ensured by diagnostic PCR and two fold replication of the steps
following retransformation of the obtained plasmids until
recovering the single clone. The following primer combinations were
used:
TABLE-US-00003 5'block-2.clb4-4-4: (SEQ ID NO:12)
CGGGATCCGGGACCGCGTATCTGATGACGAGCGTGTCAA 25bio-2.clb4-4-4: (SEQ ID
NO:13) CTCGGAGACGCTGAGGAAGGACCTG 3'block-2.clb4-4-4: (SEQ ID NO:14)
CTGCGGCCCTAGACCACGCCCACCGCTCCCCGTGACGTCG
(The ORF was determined for the single clone and the sequence is
shown as SEQ ID NO. 40, the corresponding amino acid sequence is
shown as SEQ ID NO:41).
Example 11
GMCSF Receptor Alpha is Upregulated in the Photothrombotic Model of
Cerebral Ischemia (Verification by Quantitative PCR)
[0348] RNA was isolated according to standard protocols
(Chomczynski and Sacchi (Anal Biochem (1987), 162, 156-9), followed
by Qiagen RNeasy mini kit purification), from rat cortical
penumbral samples, ipsi- and contralateral to the lesion side (see
FIG. 13a for localization of the tissue samples; here: 3 vs. 4).
cDNA was synthesized from 1 .mu.g total RNA using oligodT primers,
Superscript II reverse transcriptase (Gibco) using standard
conditions.
[0349] Quantitative PCR was performed using the Lightcycler system
(Roche Diagnostics, Mannheim, Germany) with SYBR-green staining of
DNA doublestrands. Cycling conditions were as follows: 5 min
95.degree. C., 5 sec 95.degree. C., 7 sec 62.degree. C., 30 sec
72.degree. C.; 9 sec 80.degree. C. for 50 cycles. Melting curves
were done with the following parameters: 95.degree. C. cooling to
50.degree. C.; ramping to 99.degree. C. at 0.2.degree. C./sec. The
following primer pairs were used: "rat BR4-4s96"
ACGTCGTTGGCTCAGTTATGTC (SEQ ID NO:15), and "rat BR4-4 as272"
ATTTATGTCAGAGATGGAGGATGG (SEQ ID NO:16). The Lightcyclerm PCR was
performed using the SYBR green master mix, following the
manufacturer's recommendations (Roche diagnostics). Specificity of
product was ensured by melting point analysis and agarose gel
electrophoresis. cDNA content of samples was normalized to the
expression level of Cyclophilin primers: "cyc5"
ACCCCACCGTGTTCTTCGAC (SEQ ID NO:17); "acyc300" CATTTGCCATGGACAAGATG
(SEQ ID NO:18)). Relative regulation levels were derived after
normalization to cyclophilin, and comparison to the sham-operated
animals. FIG. 14 a shows upregulation of the GMCSFR alpha after 48
h on the ipsi- and contralateral side. There is no significant
regulation detectable 21 d after induction of photothrombosis (FIG.
14 b). Error bars indicate standard deviations, these are
calculated from 3-fold serially diluted cDNA-samples, and reflect
reliability of measurements.
Example 12
GMCSF-Receptor Alpha is Present on Neuronal Cells in Primary
Cortical Cultures: Preparation of Neurons
[0350] 10-12 Cortices were prepared from embryos of the stage E18
(embryonal day 18). Tissue was dissociated using trypsin [10
mg/ml]/EDTA/DNase [5 mg/ml] (Roche diagnostics) in HBSS (Hanks
balanced salt solution, BioWithakker). The digest was stopped using
4 parts medium (neurobasalmedium +1 ml 50.times.B-27 supplement
(Invitrogen)+0.5 mM L-glutamin+25 .mu.M glutamate) and centrifuged
at room temperature for 5 min at 800.times.g. The pellet was
dissolved in 5 ml medium and cell number determined by counting
(Neubauer slide). The cells were plated at a density of 250 000
cells per well of a 24-well-plate on cover slips which were coated
with poly-L-lysine.
Immunocytochemistry
[0351] 1 week after preparation neurons were washed with PBS
(Gibco) (37.degree. C.) and fixed with 2% paraformaldehyde for 10
min on ice. Then, cells were washed with PBS (4.degree. C.) and
then incubated for 10 min in 50 nM glycine in PBS, then washed with
PBS. Cells were permeabilized on ice using 0.2% TritonX-100 (Sigma)
in PBS, and incubated with blocking solution (0.2% Triton-X100, 4%
normal goat serum (GS) (Jackson Immunoresearch Laboratories) in
PBS) at room temperature. The primary antibody
(rabbit-anti-GM-CSF-Receptor-antibody directed against the
C-terminus of mouse GMCSFR, M-20; sc-691; SantaCruz) was used in a
dilution of 1:300 (in 0.1% Triton-X100/2% NGS), and incubated
overnight at 4.degree. C. Cells were then washed with 1% NGS PBS,
and incubated for 30 min with the secondary antibody
(anti-rabbit-FITC, 1:400; dianova) at room temperature. Cells were
then washed briefly in 1% NGS/PBS, and stained with Hoechst 33342
(Molecular Probes) (1:10.000 in PBS) for counterstaining the
nuclei. Finally, cover slips were washed briefly twice in 1%
NGS/PBS, twice in PBS, and once for 10 min in 10 mM Tris/HCl, pH
7.6. The cover slips were embedded using Aquamount
(Polyscience).
Pictures were taken digitally with an Olympus IX81 microscope, and
the "Analysis" software package (Soft Imaging Systems, Stuttgart,
Germany).
Example 13
GMCSF Receptor is Present on Neural Stem Cells: Generation of
Neural Stem Cells (FIG. 13)
[0352] Neural stem cells were isolated from the brain areas with
known spontaneous neurogenesis, i.e. hippocampus, olfactory bulb,
and subventricular zone, of 4-6 week old male Wistar rats as
described (Ray J et al (1993) Proc Natl Acad Sci USA 90: 3602-6).
Protocols are concordant with the policy on the use of animals, as
endorsed by the National Research Council of the U.S.A., and
fulfill the requirements of German law. Briefly, animals were
anesthesized with 1% (v/v) isoflurane, 70% N2O, 29% oxygen and
sacrificed by decapitation. The brains were removed and washed in
50 mL ice-cold Dulbecco's Phosphate Buffered Saline (DPBS)
supplemented with 4.5 g/L glucose (DPBS/Glc). Hippocampus,
olfactory bulb, and subventricular zone from 6 animals were
dissected, washed in 10 mL DPBS/Glc and centrifuged for 5 min at
1600.times.g at 4.degree. C. After removal of the supernatant, the
tissue was homogenized with scissors and scalpels. The tissue
pieces were washed with DPBS/Glc medium for 5 min at 800 g, and the
three pellets were resuspended in 0.01% (w/v) papain, 0.1% (w/v)
dispase II (neutral protease), 0.01% (w/v) DNase I, and 12.4 mM
manganese sulfate in Hank's Balanced Salt Solution (HBSS). The
tissue was triturated with plastic pipet tips and incubated for 40
min at room temperature, but every 10 min the solution was mixed
well. The suspension was centrifuged at 800.times.g for 5 min at
4.degree. C. and pellets were washed three times in 10 mL
DMEM-Ham's F-12 medium supplemented with 2 mM L-glutamine, 100
units/mL penicillin and 100 units/mL strepotomycin. Then, the cell
pellets were resuspended in 1 mL Neurobasal medium supplemented
with B27 (Invitrogen, Carlsbad, Calif., USA), 2 mM L-glutamine, 100
units/mL penicillin and 100 units/mL strepotomycin, 20 ng/mL EGF,
20 ng/mL FGF-2, and 2 .mu.g/mL heparin. Cells were plated under
sterile conditions in 6-well dishes in a concentration of
25,000-100,000 cells/mL. The dishes were incubated at 37.degree. C.
in 5% CO2. Cell culture media were changed once a week, where about
two thirds of the media were replaced. (Ray J et al (1993) Proc
Natl Acad Sci U S A 90: 3602-6.)
RT-PCR Protocol
[0353] RNA was isolated according to standard protocols from
hippocampal stem cells that were propagated 3 weeks in culture
after thawing them from frozen stocks, following the manufacturers
recommendations (RNeasy kit, Qiagen). cDNA was synthesized using
oligodT primers, superscript II reverse transcriptase (Gibco) using
standard conditions. Polymerase chain reaction (PCR) was performed
with the following cycling conditions: 3 min 94.degree., 30 sec
94.degree., 30 sec 60.degree., 1 min 72.degree.; for 32 cycles,
using the primer pairs "rat BR4-4s96" ACGTCGTTGGCTCAGTTATGTC (SEQ
ID NO:19), and "rat BR4-4 as272" ATTTATGTCAGAGATGGAGGATGG (SEQ ID
NO:20). Reaction conditions: 2 mM MgCl2, 200 uM dNTP, 200 nM each
primer, 1 unit Taq Polymerase (Invitrogen)/25 .mu.l. PCR was
resolved on a 1.5% agarose gel. The specific PCR product length was
176 bp with the following sequence (primer sequences are
underlined):
TABLE-US-00004 (SEQ ID NO:21)
ACGTCGTTGGCTCAGTTATGTCAGACAGGAAATCTCACCATCCCACAATG
ATTGACAGCTCTCACAGGGAATCCCGCCTCCGCTGGGACCAATTGACATC
ACGGACAGGAATACCCGCCCCTGTGGCCCTGATGGGCAGGTCCTGCCTGG
CTCCCATCCTCCATCTCTGACATAAAT
Example 14
Assay for Determining the Serum Half-Life and Passage of
GCSF/GM-CSF Through the Blood Brain Barrier
[0354] It is desirable to know whether GCSF and GMCSF pass the
blood-brain barrier. GCSF/GM-CSF are biotinylated to make use of
the highly sensitive avidin-biotin-interaction for detection of the
chemokines in brain tissue. G-CSF (Neupogen, Amgen) was
biotinylated using Biotin-XX-SE (Molecular Probes B 1606). G-CSF
was diluted into 20 mM sodium carbonate buffer pH 8 with 250 mM
sorbitol and 0.004% Tween-80 and Biotin-XX-SE added. After 1 h at
room temperature, Tris-buffer pH 8 was added to 50 mM concentration
to quench unreacted labeling reagent. The sample was spun 30 min at
45000 rpm in a TLA 10 rotor (Beckman Instruments) to remove
aggregates.
[0355] 7.5 .mu.g biotinylated G-CSF was injected into mice
intraperitoneally at time zero (in 200 .mu.l 20 mM sodium carbonate
buffer pH 8 with 250 mM sorbitol and 0.004% Tween-80). Mice were
anesthesized with chloralhydrate at times indicated and blood
samples (approx 200 .mu.l) were taken from the right heart chamber.
EDTA was added to 5 mM and the sample centrifuged for 10 min at
1000 g to obtain serum. 4.times. sample buffer was added to serum,
proteins denatured by heating to 95.degree. C. for 5 min and 20
.mu.l applied to a minigel. Proteins were transferred to
nitrocellulose, blocked and incubated with Streptavidin-HRP
(Amersham) in TBST. After washing, signals were detected using
Pierce Supersignal chemiluminescence reagent.
[0356] For Elisa analysis serum samples were diluted 1:20 in assay
buffer and the assay performed according to the manufacturer's
instructions (IBL, Hamburg, Germany).
[0357] This assay can be adapted accordingly to cerebrospinal fluid
(csf) or brain homogenate to determine the transition of GCSF
across the blood-brain-barrier.
Example 15
Assay for Neuroprotective Action of GCSF, GMCSF (FIG. 1b)
[0358] The neuroprotective action of GCSF/GMCSF was determined in
vitro on NGF-treated PC12 cells. PC12 cells were seeded into 96
well plates coated with poly-1-lysine (0.01% final concentration)
at a density of 40.000 cells/well. Cells were kept in DMEM medium
containing 1000 mg glucose/1 and 10% HS (horse serum) 5% FCS (fetal
calf serum), 1% Penicillin/Streptomycin. Cells were then
transfected with pSV40--RL (encoding the renilla luciferase gene)
using the Lipofectamine-20000.RTM. transfection agent (Gibco BRL)
(0.2 ug DNA/well), following the manufacturers recommendations.
Immediately after transfection, NGF (nerve growth factor) was added
at a concentration of 40 ng/ml to induce differentiation of PC12
cells. At 24 h after treatment, PC12 cells develop a neuron-like
morphology with extended processes. Cells were then treated with
H.sub.2O.sub.2 at varying concentrations (FIG. 1b), and GCSF at
varying concentrations (1-100 ng/ml). EPO was added as a positive
control for a substance with known neuroprotective potency in vitro
(Cerami, et al. (2002), Nephrol Dial Transplant, 17, 8-12,
Kawakami, et al. (2001), J Biol Chem, 276, 39469-75, Sinor and
Greenberg (2000), Neurosci Lett, 290, 213-5, Chong, et al. (2002),
J Cereb Blood Flow Metab, 22, 503-14.) at concentrations of 0.01
U/ml to 1 U/ml. After 24 h, medium supernatant was discarded, and
cells were lysed using the passive lysis buffer (Promega). Renilla
luciferase activity was then recorded in a luminometer (Mithras,
Berthold), and readings expressed as relative light units. This
assay measures cell survival as the amount luciferase detectable.
Therefore, the higher the relative light units, the more cells have
survived. In this assay, GCSF showed a dose-dependent
neuroprotection of PC12 cells, that was more potent than
Erythropoetin.
Example 16
GCSF Receptor is Expressed in Various Brain Regions Important for
Neurological Diseases (FIG. 4); GMCSF is Expressed in Various
Important Brain Regions (FIG. 19)
[0359] To systematically assess the distribution of the GCSF
receptor in the normal mouse brain, C57/b16 mice (2-3 months old)
were anesthetized using an i.p. injection of Rompun.RTM. and
Ketanest.RTM.. Mice were then transcardially perfused with 20 ml
hanks balanced salt solution (HBSS), followed by 20 ml of 4%
paraformaldehyde (PFA) in PBS (pH 7.4). The brain was dissected
out, and stored overnight in 2% PFA solution. Paraffin-embedded
tissues were sectioned (2 .mu.m), mounted on pre-treated slides
(DAKO, Glostrup, Denmark), air-dried overnight and subsequently
deparaffinized. After microwave treatment (citrate buffer; 500 W,
10 min), the anti-GCSFR antibody (1:400) was applicated and tissues
were incubated for 1 h at room temperature in a moist chamber.
Antibody labeling was visualized using the routine ABC technique
and DAB as a chromogen following manufacturers recommendations
(DAKO, Glostrup, Denmark). Negative controls included similarly
processed sections in which the primary antibody had been totally
omitted as well as sections where the appropriate normal serum was
used (Dianova, Hamburg, Germany). Localization of GCSF-R was seen
in the hippocampus (FIG. 4a-d) with predominant staining of neurons
in the CA3 area (FIG. 4 a,b), with a sharp boundary between the CA3
and CA2 region (FIG. 4 c, arrow). GCSF-R is distributed over the
soma, as well as processes of neurons (FIG. 4 b, arrow). The
receptor is present in the hilus and the basal cell layers of the
dentate gyrus (FIG. 4 d, arrow). GCSF-Receptor was also detected in
cortical areas: piriform cortex (FIG. 4 e), and perirhinal cortex
(f) as examples. In the cerebellum, Purkinje cells were labeled
(FIG. 4 g, arrow). Also, some of the large mitral cells in the
olfactory bulb are GCSF-R positive (FIG. 4 h, arrow). Strong
staining is exhibited by the anterior columns in the spinal cord
(FIG. 4 i, j), and higher magnification identifies the large
motoneurons as GCSF-R positive (FIG. 4 k,l). Note that the neuronal
processes are strongly labeled. In the midbrain, neurons in the
substantia nigra show GCSF-R positivity (FIG. 4 m,n,o). Apart from
neurons, oligodendrocytes in white matter tracts are stained, for
example, in the anterior commissure (FIG. 4, p, arrow).
[0360] The same example applies for the localization of the GMCSFR
(FIG. 19). Here, staining was seen in the hippocampus, in the
cortex, in the cerebellum, and in the choroid plexus. Midbrain and
spinal cord were not examined so far.
Example 17
Assay for Neuroprotective Action of GCSF, GMCSF (FIG. 1b, FIG.
23)
[0361] The neuroprotective action of GCSF/GMCSF was determined in
vitro on NGF-treated PC12 cells. PC12 cells were seeded into 96
well plates coated with poly-1-lysine (0.01% final concentration)
at a density of 40,000 cells/well. Cells were kept in DMEM medium
containing 1000 mg glucose/l and 10% HS (horse serum) 5% FCS (fetal
calf serum), 1% Penicillin/Streptomycin. Cells were then
transfected with pSV40-RL (encoding the renilla luciferase gene)
using the Lipofectamine-2000.RTM. (transfection agent (Gibco BRL)
(0.2 ug DNA/well), following the manufacturers recommendations.
Immediately after transfection, NGF (nerve growth factor) was added
at a concentration of 40 ng/ml to induce differentiation of PC12
cells. At 24 h after treatment, PC12 cells develop a neuron-like
morphology with extended processes. Cells were then treated with
H.sub.2O.sub.2 at varying concentrations (FIG. 1b, FIG. 23), and
GCSF and GMCSF at varying concentrations (1-100 ng/ml). EPO was
added as a positive control for a substance with known
neuroprotective potency in vitro (Cerami et al (2002), Nephrol Dial
Transplant, 17, 8-12, Kawakami, et al. (2001), J Biol Chem, 276,
39469-75, Sinor and Greenberg (2000), Neurosci Lett, 290, 213-5,
Chong, et al. (2002), J Cereb Blood Flow Metab, 22, 503-14.) at
concentrations of 0.01 U/ml to 1 U/ml (FIG. 1b), or 0.5 U/ml (FIG.
23). After 24 h, medium supernatant was discarded, and cells were
lysed using the passive lysis buffer (Promega). Renilla luciferase
activity was then recorded in a luminometer (Mithras, Berthold),
and readings expressed as relative light units. This assay measures
cell survival as the amount luciferase detectable. Therefore, the
higher the relative light units, the more cells have survived. In
this assay, GCSF as well as GMCSF showed a dose-dependent
neuroprotection of PC12 cells that was more potent than
Erythropoetin.
Example 18
Thrombembolic Cerebral Ischemia
[0362] Experimental protocols will be approved by the local ethics
committee. Forty male Wistar rats (Charles River, Germany) weighing
280 to 320 g will be randomly assigned to the following groups: A)
early thrombolysis with 10 mg rt-PA/kg body weight for 1 hour, 1
hour after thrombembolic vessel occlusion; B late thrombolysis with
10 mg rt-PA/kg body weight for 1 hour, 3 hour after thrombembolic
vessel occlusion; C) no thrombolysis, but treatment with 60
.mu.g/kg body weight of recombinant G-CSF (Neupogen.RTM., Amgen,
Europe B.V., Netherlands) in 2 ml saline 0.9% for 90 min beginning
30 min after thrombembolic ischemia; D) treatment with 60 .mu.g/kg
body weight of recombinant G-CSF Neupogen.RTM., Amgen, Europe B.V.,
Netherlands) in 2 ml saline 0.9% for 90 min beginning 30 min after
thrombembolic ischemia combined with late thrombolysis with 10 mg
rt-P Akg body weight for 1 hour, 3 hour after thrombembolic vessel
occlusion.
[0363] Animals will be anesthetized with an intraperitoneal
injection of 100 mg/kg body weight ketaminehydrochloride (WDT,
Garbsen, Germany). Anesthesia will be maintained with 50 mg/kg body
weight, if necessary. A PE-50 polyethylene tube will be inserted
into the right femoral artery for continuous monitoring of mean
arterial blood pressure, blood gases, hematocrit, leukocyte count
and blood glucose levels. The right femoral vein will be cannulated
by a PE-50 tube for treatment infusion. During the experiment
rectal temperature will be monitored and maintained at 37.degree.
C. by a thermostatically controlled heating pad (Fohr Medical
Instruments, Germany).
[0364] Thromboembolic stroke will be induced according to the
modified method described by Busch et al (Brain Res 1997 Dec. 5;
778(1):16-24). Briefly, the right common carotid (CCA), internal
carotid (ICA) and external carotid arteries (ECA) will be exposed
through a midline incision of the neck. Further dissection
identified the origin of the pterygopalatine artery (PPA). The ECA
and the PPA will be permanently ligated by a 6-0 silk suture. The
CCA will be only temporarily ligated for the time of embolization.
A catheter will be inserted into the ECA proximal to its ligation
and 12 red blood clots (each 0.35 mm in diameter and 3 mm in
length) were injected, resulting in embolization of the right
middle cerebral artery (MCA).
[0365] Infarct evolution will be monitored by MR-imaging at 1, 2,
4, and 24 hours by using diffusion-, perfusion-, and T2-weighted
imaging. In all animals, outcome will be measured by mortality as
well as neurological outcome based on a five point scale 24 hours
after ischemia. 24 hours after ischemia, the rats will be
anesthetized with ketamine 150 mg/kg body weight and decapitated.
The brains will be removed, and fixed with 4% paraformaldehyde in
0.1 mol/l phosphate buffer for 24 hrs. After paraffin-embedding,
1-.mu.m-thick sections will be cut and used for TTC, H&E, and
Nissl staining and immuno-histochemical analysis.
Statistical Analysis
[0366] The values will be means .+-.SD. After acquiring all the
data, the randomization code will be broken. ANOVA and subsequent
post hoc Fisher protected least significant difference test will be
used to determine the statistical significance of differences in
continuous variables such as physiological parameters, and infarct
volume. The Mann-Whitney U test will be performed for nonparametric
data such as the mortality rate. A p value <0.05 will be
considered statistically significant.
Example 19
G-CSF is Effective when Given at an Extended Time Window in Middle
Cerebral Artery Occlusion (MCAO), a Rodent Stroke Model
[0367] FIG. 24 shows the effect of intravenously applied G-CSF on
infarct volume in the rat MCAO model when applied 120 min after
onset of ischemia. The experiment was conducted as described in
Example 1, with the exception that anesthesia was induced by
inhalation anesthesia (1% halothane, 30% O.sub.2, and 70%
N.sub.2O). Also here, a dose of 60 .mu.g G-CSF (Neupogen.RTM.,
AMGEN)/kg bodyweight of the rat was used. A significant protection
was seen when comparing infarct volumes by TTC-staining (see FIG.
25). The operations were performed by another set of investigators
as those in example 1, demonstrating efficacy in another laboratory
setup. This example further demonstrates the usefulness of G-CSF as
a treatment for stroke and other ischemic disorders of the nervous
system.
Example 20
Colocalisation of GCSF and its Receptor in the Brain
Immunohistochemical Methods Used
[0368] Sections of paraffin-embedded tissues (2 .mu.m) were
deparaffinated by treating them 2.times.5 min with Xylol, 2.times.2
min 100% ethanol, and then with descending concentrations of
ethanol from 96% up to 70%. Finally the sections are washed with
distilled water and microwaved (citrate buffer at 600 W for 15
min). Afterwards, sections were washed with distilled water and
antigens were blocked 3.times.5 min in 1.times.TBS (pH 7.4)
containing 0.2% BSA. The GCSF-receptor antiserum (SC694; Santa Cruz
Biotechnology, Santa Cruz, Calif., USA; 1:100) diluted in
1.times.TBS (pH 7.4) containing 0.2% BSA was incubated at room
temperature for 1 h in a humid chamber. Sections were then washed
3.times.2 min with 1.times.TBS (pH 7.4) containing 0.2% BSA. The
second antibody (goat anti-rabbit Fab-FITC, dianova, 1:50) was then
applied over night at 4.degree. C. in 1.times.TBS (pH 7.4)
containing 0.2% BSA. After washing the sections 3.times.2 min with
0.2% BSA in 1.times.TBS (pH 7.4), the GCSF antiserum (SC13102;
Santa Cruz Biotechnology, Santa Cruz, Calif., USA) diluted 1:100 in
0.2% BSA in 1.times.TBS (pH 7.4) was applied for 1 h at room
temperature. The sections were washed 3.times. as described before
and incubated for 30 min with biotinylated goat anti-rabbit IgG
(Vector Laboratories, USA) diluted 1:200 in 1.times.TBS (pH 7.4)
containing 0.2% BSA. Again after washing the sections,
TRITC-conjugated streptavidin (dianova; 1:200) was applied for 1.5
h at room temperature. Then, the sections were washed 3.times.2 min
with 1.times.TBS and stained for 10 min with the nuclear dye DAPI
diluted 1:10 000 in 1.times.TBS. Finally the sections were washed
3.times.2 min with 1.times.TBS and mounted with mounting medium for
fluorescence (Vectashield, Vector Laboratories, USA). Pictures were
taken digitally with an Olympus IX81 microscope, and the "Analysis"
software package (Soft Imaging Systems, Stuttgart, Germany).
[0369] All double-fluorescence experiments were controlled by
parallel single-staining, which were checked for absence of any
fluorescence carry-over in the second channel. As a second control,
all double-fluorescence staining were done with switched
chromophores for the secondary antibody.
Results
[0370] The GCSF receptor (FIG. 25 a, d, g) shows a co-localization
with its ligand (FIG. 25 b, e, h) both in the hippocampus (FIG. 25
a-c dentate gyrus, d-f hilus) and the cortex (FIG. 25 g-i). The
surprising finding that the same neurons express both the receptor
and the ligand, suggest an autocrine signaling mechanism of GCSF,
which supports a novel endogenous neuroprotective system of the
nervous system.
Example 21
Colocalisation of the GCSF Receptor and the GMCSF Receptor in the
Brain
Immunohistochemical Methods
[0371] Immunohistochemistry was performed as described in example
20. After incubating the sections with the GCSFR antiserum and goat
anti-rabbit Fab-FITC, the sections were washed 3.times.2 min with
0.2% BSA in 1.times.TBS (pH 7.4). Afterwards, the GMCSFR antiserum
(SC690; Santa Cruz Biotechnology, Santa Cruz, Calif., USA; 1:100)
was applied for 1 h at room temperature. The following procedure
including incubation with biotinylated goat anti-rabbit IgG (Vector
Laboratories, USA) and TRITC-conjugated streptavidin (dianova;
1:200) was done as described for GCSF detection in example 2.
[0372] All double-fluorescence experiments were controlled by
parallel single-stainings, which were checked for absence of any
fluorescence carry-over in the second channel. As a second control,
all double-fluorescence stainings were done with switched
chromophores for the secondary antibody.
Results
[0373] The GCSF receptor (FIG. 26 a, d, g) and the GMCSF receptor
(FIG. 26 b, e, h) are expressed on the same neurons in both the
hippocampus and the cortex (FIG. 26 c, f, i). FIG. 26 shows
coexpression of both receptors on neurons in the dentate gyrus
(a-c) and the hilus (d-f) of the hippocampus as well as in the
cortex (g-i). This finding further illustrates the claim that GCSF
and GMCSF could be used in conjunction to treat neurological
conditions, and that the neuroprotective properties of
hematopoietic factors could be enhanced by combined
application.
Example 22
GCSF Acts Anti-Apoptotically by Activating Stat3 in Neurons
Results
[0374] Primary cultured neurons are a tool to dissect mechanisms of
action. We therefore checked whether the G-CSF receptor would be
expressed on hippocampal or cortical neurons after 21 days in
culture. Indeed, we confirmed expression by PCR (previous examples)
and immuno-cytochemistry, both on cortical as well as most
hippocampal neurons. One of the most important mechanisms in stroke
pathophysiology is delayed neuronal cell death (Choi (1996), Curr
Opin Neurobiol, 6, 667-72, Schneider, et al. (1999), Nat Med, 5,
554-9, Mattson (2000), Nat Rev Mol Cell Biol, 1, 120-9). We
therefore hypothesized that G-CSF might be interfering with
apoptotic cascades in neurons. In primary neuronal cultures that
were found to express the G-CSF receptor, exposure to nitric oxide,
a relevant event during cerebral ischemia, leads to dose-dependent
increase in programmed cell death as evidenced by PARP-cleavage
(not shown). Treatment with 50 ng/ml G-CSF drastically reduced
apoptotic cell death after NOR3 treatment, as exemplified in FIG.
27. In cells of the hematopoietic lineage, the GM-CSF receptor
transmits its anti-apoptotic signal via the Janus kinase 2 (JAK2)
and signal transducer and transactivator (stat) proteins (Jak-stat
pathway) (e.g. (Epling-Burnette, et al. (2001), J Immunol, 166,
7486-95, Sakamoto, et al. (2003), Int J Hematol, 77, 60-70)). While
we could not detect activation by phosphorylation of statl or stat5
(FIG. 27, part III), stat3 was strongly phosphorylated by the
addition of G-CSF in a time-dependent manner typical (FIG. 27, part
IV) of the JAK-stat kinetics in other cell types (FIG. 27, part V;
taken and adapted from: Kuroki, M. & O'Flaherty, J. T.
Extracellular signal-regulated protein kinase (ERK)-dependent and
ERK-independent pathways target STAT3 on serine-727 in human
neutrophils stimulated by chemotactic factors and cytokines.
Biochem J341 (Pt 3), 691-6 (1999)). The stat3 tyr705
phosphorylation evoked by the addition of G-CSF to the culture
medium was specifically mediated via the G-CSF receptor/JAK2
pathway, as blocking of the JA/stat3 connection by the inhibitor
AG490 led to drastically reduced signals in the presence of G-CSF
(Figure X). Stat3 activation leads to induction of anti-apoptotic
proteins of the bcl family (Yoshida, et al. (2002), J Exp Med, 196,
641-53, Sakai and Kraft (1997), J Biol Chem, 272, 12350-8, Nielsen,
et al. (1999), Leukemia, 13, 735-8). Addition of G-CSF to neuronal
cultures led to a time-dependent increase of both Bcl-X1 and Bcl-2,
potent anti-apoptotic proteins in neurons, and during cerebral
ischemia (FIG. 27, part VI). Interestingly, a recent report
suggests stat3 as an essential survival protein for motoneurons
after nerve injury (Schweizer, et al. (2002), J Cell Biol, 156,
287-97). G-CSF therefore seems to act differently from the proposed
anti-apoptotic mechanism of EPO involving stat5 and NF-kB
activation (Digicaylioglu and Lipton (2001), Nature, 412,
641-7).
Methods
[0375] Primary cortical neurons from rats were generated as
follows: Ten to 12 cortices were dissected from rat embryos E18.
The tissue was dissociated using 10 mg/ml trypsin, 5 mg/ml
EDTA/DNase (Roche diagnostics, Mannheim, Germany) in HBSS
(BioWhitakker, Taufkirchen, Germany). The digestion was stopped
using four parts neurobasal medium containing 1.times.B-27
supplement (Invitrogen, Karlsruhe, Germany). After centrifugation,
the pellet was dissolved in 5 ml medium and cells were plated at a
density of 250,000 cells per well of a 24-well-plate on glass cover
slips coated with poly-L-lysine. The medium typically contains: 50
ml neurobasal medium (life technologies, Karlsruhe, Germany), 1 ml
supplement B 27 (Life technologies), 5 .mu.l bFGF (Sigma, 19 .mu.g
was dissolved in 100 .mu.l 10 mM Tris/HCl pH 7), and 50 .mu.l
Penicillin/Streptomycin (Life technologies).
[0376] Detection of STAT1, pSTAT1, STATS, pSTAT5, GCSFR, PARP,
cleaved PARP, caspase3, cleaved caspase3, Bcl2, and Bcl xl was done
by Western blotting. In brief, neurons were treated for 24 h with
150 mM NOR-3 (Sigma-Aldrich, Seelze, Germany), and 50 ng/ml G-CSF
(eupogen, Amgen, Thousand Oaks, Calif., USA) as indicated. The
cells were scraped off the plate, spun down at 800 rpm for 5 min,
and washed in ice-cold PBS containing 2.5 mg/ml pepstatin
(Sigma-Aldrich, Seelze, Germany) and aprotinin (1:1000,
Sigma-Aldrich). Pellets were resuspended in 100 .mu.l benzonase
solution (containing 10 .mu.l 10.times.PBS, 79.5 .mu.l H.sub.2O, 10
.mu.l 10% SDS, 0.5 .mu.l 100 nM MgCl.sub.2, 0.1 .mu.l Aprotinin,
0.1 .mu.l Leupeptin, 0.1 .mu.l Pepstatin, 0.1 .mu.l PMSF, 0.1 .mu.l
benzonase (Roche Diagnostics, Mannheim, Germany)) was added. After
solubilization, 1 volume PBS was added and the protein
concentration determined (BCA-Test, Pierce, Rockford, Ill., USA).
After denaturing at 95.degree. C. for 5 min, 100 .mu.g was run on
8%-12% SDS-polyacrylamide gels. Proteins were transferred to
nitrocellulose membranes (Protan BA79, Schleicher & Schuell,
Dassel, Germany) using a semi-dry-blotting chamber (Whatman
Biometra, Gottingen, Germany). Blots were blocked with 5% milk
powder in PBS/0.02% Tween 20, washed three times with PBS/0.02%
Tween 20, and incubated overnight at 4.degree. C. with the
respective primary antibody (anti-cleaved-PARP-antibody, Cell
Signaling, 1:1000; anti PARP, Cell Signaling, 1:1000; anti cleaved
caspase 3, Cell Signaling, 1:200; anti caspase3, Cell Signaling,
1:200; anti Bcl2, BD Transduction Laboratories, 1:500; anti Bcl X1,
BD Transduction Laboratories, 1:500; anti pSTAT3tyr, Cell
Signaling, 1:500; anti STAT3, Cell Signaling, 1:500; anti GCSFR,
Santa Cruz, 1:200; anti pSTAT5, Cell signaling, 1:500; anti stat5,
Cell signaling, 1:200; anti pSTAT1, Cell signaling, 1:500). After
washing, the blots were incubated with the respective secondary
antibody (anti-rabbit, or anti-mouse-antiserum He-coupled, Dianova,
Hamburg, Germany 1:4000) for 1 h at room temperature. Signals were
detected using the supersignal chemiluminescence system (Pierce,
Rockford, USA) and exposed to Hyperfilm-ECL (Amersham Pharmacia
Biotech, Piscataway, N.J., USA). PARP cleavage was quantified on
scanned autoradiographs using Windows ImageJ v1.29
(http://rsb.info.nih.gov/ij/index.html).
Example 23
GCSF and its Receptor are Induced by Cerebral Ischemia
MCAO Model of Cerebral Ischemia
[0377] Procedure for inducing focal cerebral ischemia (MCAO, middle
cerebral artery occlusion) was performed as described in example
1.
Global Ischemia Model
[0378] The experimental procedures on animals randomized for
ischemia/reperfusion were performed as previously described in
details (Brambrink, et al. (2000), J Cereb Blood Flow Metab, 20,
1425-36). In brief, the rats were anesthetized (chloral hydrate),
orally intubated and mechanically ventilated (Pa.sub.CO2 at 35-40
mmHg, Pa.sub.CO2 at 95-110 nmHg throughout the experiment). Both
common carotid arteries (CCA) were exposed and the left side was
catheterized with polyethylene tubing (PE-50) for blood sampling
and continuous monitoring of MABP (Sirecust 310, Siemens, Danvers,
Mass., USA). On the right side a nylon thread was looped loosely
around the CCA to be used later to induce transient cerebral
ischemia. The head of the animal was fixed in a stereotaxic frame
for EEG and CBF measurements (for details see (Brambrink,
Schneider, Noga, Astheimer, Gotz, Korner, Heimann, Welschof and
Kempski (2000), J Cereb Blood Flow Metab, 20, 1425-36)). The
calvarium was exposed by a median incision and two depressions
designed to hold chlorinated silver pin FEG electrodes were made
(high speed dental drill, positioned over the left somatosensory
cortex and frontal sinus according to the Praxinos and Watson
(1986) brain atlas). Over the right hemisphere about 24 mm.sup.2 of
the skull bone was removed leaving a thin bone lamina (1.3-5.3 mm
lateral to the right and 1.5-7.5 mm occipital from the bregma). A
laser Doppler-flow probe (wavelength: 780 .mu.m, BPM 403A, TSI
Inc., St. Paul, Minn., USA) controlled with a computer driven
micromanipulator was employed to determine regional cerebral blood
flow (RCBF) at 30 locations, using the "scanning technique"
(Soehle, et al. (2000), Acta Neurochir Suppl, 76, 181-4)). On the
contralateral side (3.3-5.3 mm lateral to the left and 5.0-7.0 mm
occipital of the bregma) a smaller (4 mm.sup.2) window was
established to measure local cerebral blood flow (lCBF), using a
stationary laser Doppler-flow probe (wavelength: 780 .mu.m, BPM 2,
Vasamedices Inc., St. Paul, Minn., USA). Temperature probes were
placed as described previously ((Brambrink, et al. (1999), J
Neurosci Methods, 92, 111-22)) in the right temporal muscle, in the
left auricular tube, and at 6 cm depth in the rectum. Core
temperature (thermostatically controlled heating blanket) and
temporal muscle temperature (near infracted heat radiator) were
controlled to 37.5.+-.0.1.degree. C. throughout the experimental
procedures. The lower body section of the animal was placed in an
air-tight chamber. This allows to establish hypobaric pressures by
an electronically regulated vacuum pump, thereby reducing arterial
blood pressure of the animal (venous pooling) in a controlled
fashion ("hypobaric hypotension"). After a 30-minutes post surgical
stabilization period, transient global cerebral ischemia was
initiated by pulling the nylon thread attached to a defined weight
around the right carotid artery to occlude the vessel (arterial
pressure was measured by a catheter placed in the left carotid
artery); MABP was simultaneously reduced to 35 mm Hg, using the
hypobaric hypotension technique. Brain ischemia was confirmed by
continuous ICBF, rCBF, and EEG measurements. After 15 minutes of
global cerebral ischemia, the thread was cut and vacuum was
terminated to allow reperfusion. After 90 minutes of recovery the
CCA catheter was removed, incisions were closed, and the animals
were weaned from the ventilator. On extubation (around 110 minutes
of reperfusion) and in the presence of stabile vital signs, the
rats were returned to their cage and a heating blanket was used to
prevent heat loss.
Quantitative PCR
[0379] RNA was isolated according to standard protocols
((Chomczynski and Sacchi (1987), Anal Biochem, 162, 156-9),
followed by Qiagen RNeasy.TM. mini kit purification. Tissue samples
were taken from total rat brain after global cerebral ischemia, and
ipsi- and contralateral to the lesion side at various timepoints
after focal cerebral ischemia, respectively. cDNA was synthesized
from 10 .mu.g total RNA using oligodT primers, superscript II
reverse transcriptase (Gibco) using standard conditions.
Quantitative PCR was performed using the Lightcycler.RTM. system
(Roche Diagnostics, Marmheim, Germany) with SYBR-green staining of
DNA doublestrands. Cycling conditions were as follows: GCSFR: 5 min
95.degree. C., 5 sec 95.degree. C., 10 sec 66.degree. C., 30 sec
72.degree. C.; 10 sec 84.degree. C. for 50 cycles; GCSF: 5 min
95.degree. C., 5 sec 95.degree. C., 10 sec 64.degree. C., 30 sec
72.degree. C., 10 sec 88.degree. C. for 50 cycles. Melting curves
were done with the following parameters: 95.degree. C. cooling to
50.degree. C.; ramping to 99.degree. C. at 0.2.degree. C./sec. The
following primer pairs were used: "rat GCSFR-frag-32s" CCA TTG TCC
ATC TTG GGG ATC (SEQ ID NO:42), "rat GCSFR-frag-265 as" CCT GGA AGC
TGT TGT TCC ATG (SEQ ID NO:43), "rat GCSF-345s" CAC AGC GGG CTC TTC
CTC TAC CAA (SEQ ID NO:44), and "rat GCSF-862 as" AGC AGC GGC AGG
AAT CAA TAC TCG (SEQ ID NO:45). The Lightcycler.RTM. PCR was
performed using the SYBR green master mix, following the
manufacturer's recommendations (Roche Diagnostics). Specificity of
products was ensured by melting point analysis and agarose gel
electrophoresis. cDNA content of samples was normalized to the
expression level of Cyclophilin (primers: "cyc5" ACC CCA CCG TGT
TCT TCG AC (SEQ ID NO:46); "acyc300" CATTTGCCATGGACAAGATG (SEQ ID
NO:47)). Relative regulation levels derived from normalization to
cyclophilin, and comparison to the sham-operated animals. Error
bars indicate standard deviations, these are calculated from 3-fold
serially diluted cDNA-samples, and reflect reliability of
measurements.
[0380] FIG. 28 (part I and II) A shows a very strong upregulation
of GCSF 2 h and 6 h after focal ischemia on the ipsi- and
contralateral side, whereas the receptor is moderately regulated
(FIG. 28 B) after 6 h.
[0381] An induced expression of GCSF is not specific to the MCAO
model, but could also be seen albeit to a lesser degree in global
ischemia (FIG. 28 C). This finding supports the hypothesis that
G-CSF indeed is a brain-endogenous neuroprotective ligand, and that
treatment with GCSF or GMCSF utilizes an endogenous principle of
neuroprotection.
Example 24
GCSF and its Receptor are Upregulated in the Penumbral Zone of a
Cortical Infarct
Methods
[0382] The ischemic model of photothrombotic cortical ischemia was
conducted as described in above examples.
[0383] Immunohistochemistry: Sections of paraffin-embedded tissues
(2 .mu.m) were deparaffinated and microwaved (citrate buffer at 500
W for 10 min). Afterwards, sections were incubated at room
temperature with GCSF or GCSF-receptor antiserum (SC13102 or SC694;
Santa Cruz Biotechnology, Santa Cruz, Calif., USA; 1:500) for 1 h
in a humid chamber. Staining was visualized using the ABC technique
with DAB as chromogen (DAKO, Glostrup, Denmark). Negative controls
were done by omitting the primary antiserum.
Results
[0384] 6 h following induction of photothrombotic ischemia, there
was clear evidence for enhanced staining of neurons in the
surrounding area of the primary ischemic lesion ("penumbra"), as
shown by arrows in FIG. 29, both for the receptor and the lignad.
This finding underlines the principle that we have uncovered a
novel endogenous neuroprotective system of the nervous system. It
also underlines that the primary mechanism of action of GCSF in the
penumbral zone is indeed most likely antiapoptotic.
Example 25
Colocalisation of the GCSFR and Doublecortin in the Hippocampus
Immunohistochemical Methods Used
[0385] The experiment was performed as described in example 21.
Instead of the GCSF antiserum, a guinea-pig anti-doublecortin (DCX)
polyclonal antibody (Chemicon International, Germany) diluted 1:200
in 0.2% BSA in 1.times.TBS (pH 7.4) was applied. After washing the
sections 3.times.2 min with 0.2% BSA in 1.times.TBS (pH 7.4), they
were incubated for 30 min with biotinylated goat anti-guinea-pig
IgG (Vector Laboratories, USA) diluted 1:200 in 1.times.TBS (pH
7.4) containing 0.2% BSA. Again after washing the sections,
TRITC-conjugated streptavidin (dianova; 1:200) was applied for 1.5
h at room temperature following the protocol described in example
21.
Results
[0386] FIG. 30 shows the expression of GCSF receptors (a, d, g) and
doublecortin (b, e, h) on neurons in the dentate gyrus (a-f) and
the hilus (g-i) of the hippocampus. The overlap of the expression
of both the G-CSF receptor and the early neuronal marker
doublecortin (Jin, et al. (2001), Proc Natl Acad Sci USA, 98,
4710-5) (FIG. 30 c, f, i) implicate a functional role of G-CSF at
an early stage of neuronal differentiation.
Example 26
GCSF Induces Neuronal Differentiation of Adult Neural Stem
Cells
Generation of Neural Stem Cells (NSCs)
[0387] Generation of adult neural stem cells from rat was performed
as described in example 9.
[0388] 39 DIV cultured neurospheres derived from the subventricular
zone (SVZ) were stimulated once with the following
GCSF-concentrations: 10 ng/ml, 100 ng/ml and 500 ng/ml,
respectively. 4 days after addition of recombinant human GCSF
(Neupogen.RTM., Amgen, Europe B.V., Netherlands) cells were
harvested and RNA was isolated. Untreated cells served as
control.
Quantitative PCR
[0389] RNA of GCSF-treated and untreated neurospheres of the SVZ
was isolated using the Qiagen RNeasy mini kit following the
manufacturers protocol. cDNA was synthesized from 2 .mu.g total RNA
using oligodT primers, superscript II reverse transcriptase (Gibco)
using standard conditions. Quantitative PCR was performed using the
Lightcycler system (Roche Diagnostics, Mannheim, Germany) with
SYBR-green staining of DNA doublestrands. Cycling conditions were
as follows:
[0390] Nestin and NSE (neuron specific enolase): 3 min 95.degree.
C., 5 sec 95.degree. C., 10 sec 58.degree. C., 30 sec 72.degree.
C.; 10 sec 81.degree. C. for 50 cycles; beta II-tubulin: 3 min
95.degree. C., 5 sec 95.degree. C., 10 sec 65.degree. C., 30 sec
72.degree. C.; 10 sec 87.degree. C. for 50 cycles; PLP: 3 min
95.degree. C., 5 see 95.degree. C., 10 sec 62.degree. C., 30 sec
72.degree. C.; 10 sec 84.degree. C. for 50 cycles; GFAP: 3 min
95.degree. C., 5 sec 95.degree. C., 10 sec 60.degree. C., 30 sec
72.degree. C.; 10 sec 81.degree. C. for 50 cycles. Melting curves
were determined using the following parameters: 95.degree. C.
cooling to 50.degree. C.; ramping to 99.degree. C. at 0.2.degree.
C./sec. The following primer pairs were used: "rat nestin-plus" AGG
AAG AAG CTG CAG CAG AG (SEQ ID NO:48), "rat nestin-minus" TTC ACC
TGC TTG GGC TCT AT (SEQ ID NO:49), "rat NSE-plus" GGC AAG GAT GCC
ACT AAT GT (SEQ ID NO:50), "rat NSE-minus" AGG GTC AGC AGG AGAC TTG
A (SEQ ID NO:51), "rat beta III-tub-716s" CCA CCT ACG GGG ACC TCA
ACC AC (SEQ ID NO:52), "rat beta III-tub-1022 as" GAC ATG CGC CCA
CGG AAG ACG (SEQ ID NO:53), "rat PLP-518s" TCA TTC TTT GGA GCG GGT
GTG (SEQ ID NO:54), "rat PLP-927 as" TAA GGA CGG CAA AGT TGT AAG
TGG (SEQ ID NO:55), "rat GFAP3'-1123s" CCT TTC TTA TGC ATG TAC GGA
G (SEQ ID NO:56), "rat GFAP3'-1245 as" GTA CAC TAA TAC GAA GGC ACT
C (SEQ ID NO:57). The Lightcycler PCR was performed using the SYBR
green master mix, following the manufacturer's recommendations
(Roche diagnostics). Specificity of product was ensured by melting
point analysis and agarose gel electrophoresis. cDNA content of
samples was normalized to the expression level of Cyclophilin
(primers: "cyc5" ACC CCA CCG TGT TCT TCG AC (SEQ ID NO:58),
"acyc300" CAT TTG CCA TGG ACA AGA TG (SEQ ID NO:59)). Relative
regulation levels derived from normalization to cyclophilin, and
comparison to the untreated cells. FIG. 31 shows a strong and
concentration dependent upregulation of the neuronal markers NSE
and beta III-tubulin 4d after GCSF treatment. PLP and GFAP are
moderately regulated in dependency of the GCSF-concentration. Error
bars indicate standard deviations, calculated from 3-fold serially
diluted cDNA-samples, and reflect reliability of measurements.
Example 27
Colocalisation of GMCSF and its Receptor in the Brain
Immunohistochemical Methods Used
[0391] Sections of paraffin-embedded tissues (2 .mu.m) were
deparaffinated by treating them 2.times.5 min with Xylol, 2.times.2
min 100% ethanol, and then with descending concentrations of
ethanol from 96% up to 70%. Finally the sections are washed with
destined water and microwaved (citrate buffer at 600 W for 15 min).
Afterwards, sections were washed with destined water and antigens
were blocked 3.times.5 min in 1.times.TBS (pH 7.4) containing 0.2%
BSA. The GMCSF receptor antiserum (SC690; Santa Cruz Biotechnology,
Santa Cruz, Calif., USA; 1: 100) diluted in 1.times.TBS (pH 7.4)
containing 0.2% BSA was incubated at room temperature for 1 h in a
humid chamber. Sections were then washed 3.times.2 min with
1.times.TBS (pH 7.4) containing 0.2% BSA. The second antibody (goat
anti-rabbit Fab-FITC, dianova, 1:50) was then applied over night at
4.degree. C. in 1.times.TBS (pH 7.4) containing 0.2% BSA. After
washing the sections 3.times.2 min with 0.2% BSA in 1.times.TBS (pH
7.4), the GMCSF antiserum (SC13101; Santa Cruz Biotechnology, Santa
Cruz, Calif., USA) diluted 1:100 in 0.2% BSA in 1.times.TBS (pH
7.4) was applied for 1 h at room temperature. The sections were
washed 3.times. as described before and incubated for 30 min with
biotinylated goat anti-rabbit IgG (Vector Laboratories, USA)
diluted 1:200 in 1.times.TBS (pH 7.4) containing 0.2% BSA.
[0392] Again after washing the sections, TRITC-conjugated
streptavidin (dianova; 1:200) was applied for 1.5 h at room
temperature. Then, the sections were washed 3.times.2 min with
1.times.TBS 20 and stained for 10 min with the nuclear dye DAPI
diluted 1:10 000 in 1.times.TBS. Finally the sections were washed
3.times.2 min with 1.times.TBS and mounted with mounting medium for
fluorescence (Vectashield, Vector Laboratories, USA). Pictures were
taken digitally with an Olympus IX81 microscope, and the "Analysis"
software package (Soft Imaging Systems, Stuttgart, Germany).
[0393] All double-fluorescence experiments were controlled by
parallel single-stainings, which were checked for absence of any
fluorescence carry-over in the second channel. As a second control,
all double-fluorescence stainings were done with switched
chromophores for the secondary antibody.
Results
[0394] The GMCSF receptor (FIG. 32 a, d, g) and GMCSF (FIG. 32 b,
e, h) are colocalised on neurons in the dentate gyrus (FIG. 32
a-c), the hilus (FIG. 32 d-f), and the cortex (FIG. 32 g-i). These
data support the notion that GMCSF is an autocrine ligand.
Example 28
GCSF and its Receptor are Upregulated by Cerebral Ischemia
MCAO Model of Cerebral Ischemia
[0395] Procedure for inducing focal cerebral ischemia (MCAO, middle
cerebral artery occlusion) was performed as described in example
1.
Global Ischemia Model
[0396] Surgical preparations and transient global cerebral ischemia
were performed as described before.
Quantitative PCR
[0397] RNA isolation and cDNA synthesis were done following the
protocol described before. Cycling conditions were as follows:
GCSFR: 5 min 95.degree. C., 5 sec 95.degree. C., 10 sec 62.degree.
C., 30 sec 72.degree. C.; 10 sec 80.degree. C. for 50 cycles; GCSF:
5 min 95.degree. C., 5 sec 95.degree. C., 10 sec 60.degree. C., 30
sec 72.degree. C.; 10 sec 81.degree. C. for 50 cycles. Melting
curves were done with the following parameters: 95.degree. C.
cooling to 50.degree. C.; ramping to 99.degree. C. at 0.2.degree.
C./sec. The following primer pairs were used: rat GCSFR "BR4-4s96"
ACG TCG TTG GCT CAG TTA TGT C (SEQ ID NO:60), "BR4-4 as272" ATT TAT
GTC AGA GAT GGA GGA TGG (SEQ ID NO:61), "rat GCSF-723s" GGA GCT CTA
AGC TTC TAG ATC (SEQ ID NO:62), and "rat GCSF-908 as" GGC TCA ATG
TGA TTT CTT GGG (SEQ ID NO:63). The Lightcycler.RTM. PCR was
performed using the SYBR green master mix, following the
manufacturer's recommendations (Roche Diagnostics). By melting
point analysis and agarose gel electrophoresis the specificity of
products was ensured. cDNA content of samples was normalized to the
expression level of Cyclophilin (primers: "cyc5" ACC CCA CCG TGT
TCT TCG AC (SEQ ID NO:58); "acyc300" CATTTGCCATGGACAAGATG (SEQ ID
NO:59)). Relative regulation levels derived from normalization to
cyclophilin, and comparison to the sham-operated animals. Error
bars indicate standard deviations, these are calculated from 3-fold
serially diluted cDNA-samples, and reflect reliability of
measurements.
[0398] A very strong upregulation of GCSF 2 h and 6 h after focal
ischemia on the ipsi- and contralateral side is shown in FIG. 33 A.
An induction of GCSF can be shown in global ischemia as well albeit
to a lesser extend (FIG. 33 B). Even the GCSF receptor is slightly
upregulated 6 h after global ischemia (FIG. 33 C). These data
support the hypothesis that GCSF is part of an endogenous
neuroprotective mechanism.
Example 29
Colocalised Expression of the GCSFR and Doublecortin in the
Hippocampus
Immunohistochemical Methods Used
[0399] The experiment was performed as described before. Instead of
the GMCSF antiserum, a guinea-pig anti-doublecortin (DCX)
polyclonal antibody (Chemicon International, Germany) diluted 1:200
in 0.2% BSA in 1.times.TBS (pH 7.4) was applied. After washing the
sections 3.times.2 min with 0.2% BSA in 1.times.TBS (pH 7.4), they
were incubated for 30 min with biotinylated goat anti-guinea-pig
IgG (Vector Laboratories, USA) diluted 1:200 in 1.times.TBS (pH
7.4) containing 0.2% BSA. After again washing the sections,
TRITC-conjugated streptavidin (dianova; 1:200) was applied for 1.5
h at room temperature following the protocol described before.
Results
[0400] FIG. 34 shows the expression of the GMCSF receptor (a, d, g)
and doublecortin (b, e, h) on neurons in the dentate gyrus (a-c)
and the hilus (d-i) of the hippocampus. The overlap of the
expression of both the G-CSF receptor and the early neuronal marker
doublecortin (Jin, Minami, Lan, Mao, Batteur, Simon and Greenberg
(2001), Proc Natl Acad Sci USA, 98, 4710-5) (FIG. 34 c, f, i)
implicate a functional role of GMCSF at an early stage of neuronal
differentiation, and underline the applicability of GMCSF to all
neurodegenerative diseases, where influencing neurogenesis may be a
therapeutic target, such as stroke, Parkinson's disease, ALS, and
many others.
Example 30
GMCSF Induces Neuronal Differentiation of Adult Neural Stem
Cells
Generation of Neural Stem Cells
[0401] Generation of adult neural stem cells from rat was performed
as described in example 9. Cells were passaged every two to three
weeks by centrifugating the cells for 5 min at 800.times.g,
removing the supernatant, and washing them once with 1.times.PBS.
After resuspension in 1 ml Accutase (Sigma) and incubation for 15
min at 37.degree. C. the cells were counted and plated at a density
of 1.5-2.0.times.10.sup.5 cells per well in a 6 well plate. Neural
stem cells derived from the hippocampus were stimulated after the
4.sup.th passage with 10 ng/ml GMCSF (Leukine.RTM., Berlex,
Schering AG Germany), and after 3 days they were harvested for RNA
isolation. Untreated cells served as a control.
Quantitative PCR
[0402] RNA of the GMCSF-treated and untreated neurospheres of the
SVZ was isolated using the Qiagen RNeasy mini kit following the
manufacturers recommendations. cDNA was synthesized from 5 .mu.g
total RNA using oligodT primers, superscript II reverse
transcriptase (Gibco) using standard conditions. Quantitative PCR
was performed using the Lightcycler system (Roche Diagnostics,
Mannheim, Germany) with SYBR-green staining of DNA doublestrands.
The performance of the Lightcycler PCR, the cycling conditions and
primer pairs used for beta III-tubulin, NSE, PLP, and GFAP are
described before. Relative regulation levels derived from
normalization to cyclophilin, and comparison to the untreated
cells. In FIG. 35 A the differentiation potential of neural stem
cells and the specific marker expressions of differentiated cells
are illustrated schematically. Treatment of neural stem cells with
10 ng/ml GMCSF results in a significantly induced expression of
beta III-tubulin (n=3; p<0.05, two-tailed t-test) and to a
lesser extend of NSE, a marker for mature neurons (FIG. 35 B).
There was no change observed in the expression level of PLP and
GFAP. This example underlines the applicability of GMCSF to
modulation of neurogenesis. This is useful for both in vitro
generation of differentiating neurons, as well as influencing
endogenous stem cells, and applicable to a wide range of human
diseases, particularly neurodegenerative diseases.
Example 31
G-CSF Passes the Blood-Brain-Barrier (BBB)
[0403] The most data available in the literature contain
information about serum levels of G-CSF and related cytokines. One
important parameter for the effective use of G-CSF in the therapy
of neurological disorders however, is the passage of the protein
through the blood-brain-barrier (BBB). This question is of special
interest because it is known that many proteinacious drugs cannot
cross this natural border between blood and neurons. On the other
hand, it was shown for several proteins, including hematopetic
factors like Erythropoietin and also granulocyte-macrophage colony
stimulating factor (GM-CSF) that they can pass the BBB and get
effective on neurons in the CNS (McLay, et al. (1997), Brain, 120,
2083-91, Brines, et al. (2000), Proc Natl Acad Sci USA, 97,
10526-31).
[0404] To prove that G-CSF can pass the blood-brain barrier, we
tested the appearance of injected G-CSF in rat brain. Therefore we
applied an extremely sensitive iodination assay. G-CSF and BSA as a
control were radiolabelled with .sup.131I (Amersham Biosciences,
Freiburg Germany) by the Iodogen (Sigma, Taufkirchen, Germany)
method and purified on Sephadex G-25 (Amersham Biosciences,
Freiburg Germany) columns. The purified proteins coeluted with the
unlabeled standard compounds as a single peak of correct molecular
weight when analyzed by size exclusion chromatography. The
radiolabeled proteins were injected via the tail vein of female
Sprague-Dawley rats (250-300 g). For competitive uptake studies the
cold proteins were mixed with the labelled compound and coinjected.
Shortly before dissection rats were anaesthetized with
Rompun/Ketanest and perfused with 100 ml of saline via the inferior
abdominal aorta (at 1, 4 and 24 hours after injection) to remove
the blood. The whole brain and blood were dissected, blotted dry
and weighed. Blood was centrifuged to obtain the serum. The
radioactivity was measured with a .gamma.-counter (LB 951 G,
Berthold, Germany) along with a sample of the injectate to
calculate % ID/g of the tissues. The results showed that G-CSF was
present in the brain and compared to albumin the passage of the
blood brain barrier was increased by a factor of 4-5 over the time.
Samples, that were taken 24 h after injection of radiolabeld G-CSF
show an increased level compared to 1 and 4 h (FIG. 36). These
observations shows that G-CSF injected intravenously in the blood
crosses the BBB and can principally activate specific receptors on
CNS-neurons.
[0405] The amount of radiolabeled G-CSF in serum and brain was
measured and the ratio of brain/serum was plotted against the time.
As a control bovine serum albumin was used. To avoid blood
contamination of brain tissue the rats were perfused with 100 ml of
saline prior to dissection.
Example 32
GM-CSF Passes the Blood-Brain-Barrier (BBB)
[0406] To show that GM-CSF can cross the blood-brain-barrier we
injected rats with iodinated GM-CSF as described in Example 31 for
G-CSF. The experiment gave similar results, a comparison of GM-CSF
and Albumin presence in rat brain after intravenous administration
show that GM-CSF levels (ratio brain vs. serum) are 3-4 fold higher
than albumin. The data demonstrate that GM-CSF can cross the
blood-brain-barrier (FIG. 37).
[0407] FIG. 37 The amount of radiolabeled GM-CSF in serum and brain
was measured and the ratio of brain/serum was plotted against the
time. As a control bovine serum albumin was used. To avoid blood
contamination of brain tissue the rats were perfused with 100 ml of
saline prior to dissection.
Example 33
G-CSF for the Treatment of Amyotrophic Lateral Sclerosis (ALS)
[0408] The idea that G-CSF and GM-CSF is beneficial for the
treatment of ALS originated from two directions: First, both
receptor and ligand for both GCSF and GMCSF are expressed in the
large motoneurons in the anterior horn of the spinal cord. Second,
the prove that G-CSF partly acts by counteracting apoptotic
cascades is very attractive in light of the evidence for apoptotic
mechanisms operative in ALS (Li, et al. (2000), Science, 288,
335-9). The most commonly used mouse model for ALS is transgenic
mice carrying mutations in the SOD1 gene that have been shown to be
responsible for familial human ALS. The most frequently used of
those is the SOD1 (G93A) transgenic line. Typically, these mice
have a reduced life span, and show progressing signs of motor
weakness, that can be easily accessed by behavioural tests (e.g.
grip strength test, rotarod tests). A number of tests for
therapeutic efficacy have been conducted in these mice, and shown
life-prolonging activity for substances such as Riluzole,
Minocycline, Carnitine, and others. These mice are thought to have
clinically predictive relevance, as Riluzole, the only approved
drug in human, has protective effects in these mice, whereas BDNF,
which failed in a human trial, has not. Therefore we have tested if
G-CSF prolongs life expectancy, or functional outcome in the
SOD1-transgenic mouse model of ALS. SOD1 and wildtype mice were
injected subcutaneously with 10 .mu.g/KG BW G-CSF or vehicle
starting from postnatal day 60 and monitored over the time. The
results indicated a clear trend for longer life expectancy in the
G-CSF treated group (FIG. 38 A), as well as improvement of motor
function (grip strength test (FIG. 38 B)), that reached
significance at several measurement points over time. Moreover,
there was a trend for increased weight in the treated group.
[0409] FIG. 38 A: SOD1-tg mice were injected with 10 .mu.g/KG BW
starting from postnatal day 60. There is a clear trend for
prolonged life expectancy in the G-CSF treated SOD1-tg mice (closed
line vs. dashed line). At several points this difference reached
significance.
[0410] FIG. 38 B: SOD1-tg mice were injected with 10 .mu.g KG BW
starting from postnatal day 60. The grip strength assay shows a
improvement for motor strength in the G-CSF treated SOD1-tg mice
(open squares vs. open triangles). At several points this
difference reached significance.
Example 34
Efficacy of GCSF in Rodent Models of Parkinson's Disease (PD)
MPTP Model:
[0411] The best-characterized model of Parkinson's Disease (PD) has
been developed by using the neurotoxin
1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). To study the
efficacy of GCSF in the Parkinson model, we administrated MPTP in
eight-week-old male mice. Each group of mice (n=15) was given a
repeated i.p. injection of MPTP-HCl or saline (once daily for 5
consecutice days at a concentration of 30 mg/kg, 5 ml/kg) and a
repeated s.c. (once daily, for 22 consecutive days) administration
of buffer, GCSF (0.03 mg/kg/; 5 ml/kg) or minocycline (45 mg/kg; 5
ml/kg). While the first application of GCSF was performed
immediately after MPTP (or saline for group 0), minocycline was
administrated 30 minutes thereafter, because of possible
interactions of both compounds. All animals of each group were
sacrified at day 22. Until that time, mice were analyzed both for
locomotor activity (accelerating RotaRod) and body weight was
determined daily. Furthermore each brain is subjected to a HPLC
analysis with electrochemical detection for measuring the
concentration of dopamine, 3,4-Dihydroxyphenylacetic acid (DOPAC)
and the Homovanilic acid (HVA) in the striatum and nucleus
accumbens.
[0412] However, the most important and direct parameter for the
action of a neuroprotective drug in that model is the number of
surviving neurons after that toxin. Therefore, tyrosine hydroxylase
(TH) imm unhistochemistry and stereological quantitation of
TH-positive neurons were performed with midbrain sections of each
animal (Triarhou, et al. (1988), J Neurocytol, 17, 221-32).
[0413] Results indicated a trend for a gain of body weight for the
GCSF treated group (data not shown). Moreover an improvement of
locomotor activity is observed after the testing in accelerating
Rotarod (data not shown). A recent study with MPTP induced
Parkinson in mice shown that minocycline prevents nigrostriatal
dopaminergic neurodegeneration in these animals (Du, et al. (2001),
Proc Natl Acad Sci USA, 98, 14669-74). In our study we selected
minocycline as neuroprotective compound reference for validating
our data. Subacute treatment with MPTP over 5 consecutive days
significantly decreased tyrosine hydrolase (TH)-positive neurons
within the substantia nigra pars compacta (FIG. 39 A). A treatment
with GCSF and minocycline shown nearly the same efficient
counteracting this reduction of nigral level of TH-positive neurons
(FIG. 39 B). Furthermore GCSF and minocycline shown nearly the same
therapeutic efficacy when striatal levels of dopamine (FIG. 39 B),
and its metabolites were taken in consideration.
Example 35
GMCSF Efficacy in a Model for Parkinson's Disease
MPTP Model
[0414] As described for GCSF the efficacy of GMCSF in the Parkinson
model is ascertained in the following study (see previous
example).
[0415] Each group of mice (n=15) was given a repeated i.p.
injection of MPTP-HCl or saline (once daily for 5 consecutive days
at a concentration of 30 mg/kg, 5 ml/kg) and a repeated s.c. (once
daily, for 22 consecutive days) administration of buffer, GMCSF
(0.03 mg/kg/; 5 ml kg) or minocycline (45 mg/kg; 5 ml/kg). While
the first application of GCSF was performed immediately after MPTP
(or saline for group 0), minocycline was administrated 30 minutes
thereafter, because of possible interaction of both compounds. All
animals of each group are sacrified at day 22.
[0416] An improvement of the gain of body weight and an
amelioration of the locomotor activity with the accelerating
rotarod have been observed after application of GMCSF, similar to
the results scored by GCSF (data not shown). The therapeutic
efficacy of GMCSF is therefore better compared to GCSF when the
nigral levels of TH-positive neurons is taking in consideration
(FIG. 39 B). The reduction of striatal dopamine levels and its
metabolites can be counteract after administration of GMCSF
comparable to GCSF (data not shown).
Example 36
Efficacy of GCSF and GMCSF in the 6-Hydroxydopamine (6OHDA) Model
for Parkinson's Disease in Rats
[0417] As exemplified above, GCSF as well as GMCSF had strong
neuroprotective properties in the MPTP model in mice. This is a
very strong proof for the applicability to human Parkinson's
disease, as MPTP is a toxin that was discovered due to its ability
to cause PD in humans.
[0418] One additional model for studying efficacy of the
hematopoeitic factors for Parkinson's disease is the 6-OHDA model.
This model is based upon the injection of 6OHDA directly into the
substantia nigra or into the striatum. The drug selectively
accumulates in dopaminergic neurons and leads to the apoptosis of
these cells. In rats, 6OHDA is an effective neurotoxin that has
been predominantly used to produce unilateral lesions. The extent
of dopamine depletion can be assessed by examining rotational
behaviour in response to amphetamine or apomorphine (Ungerstedt
1971). The easily and good quantifiable motor deficit constitutes a
major advantage of this model. Additionally to the behaviour
parameter the striatal level of tyrosine hydroxylase (TH) positive
neurons after immunhistochemistry and the level of dopamine and its
metabolites after a HPLC analysis can also been determined. The
6OHDA can be used to ascertain the efficacy of GCSF and GMCSF in a
PD rat model. Adult Sprague-Dawley rats (body weight 250 g) are
unilateral lesioned after one stereotaxic injection of 8 .mu.g in 2
.mu.l 6OHDA in the substantia nigra or in the striatum. Different
doses of GCSF (0.03 mg/kg; 0.1 mg/kg, or others) can be
administrated subcutaneously daily immediately after the lesioning
for 2 weeks. Other groups of treated animals receive a single dose
of intrastriatal or intranigral GCSF, or GMCSF (300 .mu.g/kg)
immediately after the injection of 6OHDA. As for the MPTP model
study minocycline can be used as a neuroprotective reference
compound (45 mg/kg once daily s.c.). Sham animals and lesioned
animals treated with buffer are used as control groups. Two weeks
after lesioning animals are subjected to rotational behaviour
testing. Rats are injected s.c. with apomorphine, placed in a bowl
cage and the number of contralateral rotations over a 1 h period
are recorded. Numbers of rotations for each animal group are
compared using standard statistical tests. After the behavioural
testing, animals are killed and the brains are processed to for
immunochemistry to assay the total number of TH-positive neurons
and for HPLC for determining the level of dopamine.
Example 37
GMCSF Acts Anti-Apoptotically in Neurons by Activating Stat3
Pathways
[0419] As already exemplified above (Example 22), GCSF had potent
activities by inhibiting apoptosis in primary neurons. We suspected
that GMCSF might also have a strong anti-apoptotic
mechanism-of-action. Therefore, the same type of experiment as
exemplified in example 22 was conducted for GMCSF. Here, the
concentration applied to the neurons was 50 ng GMCSF (Leukine,
Immunex)/ml medium.
[0420] FIG. 40, part I shows that GMCSF inhibits PARP cleavage,
that is specifically occurring as a sign of apoptosis. Cell death
was induced in primary neurons by using the NO-donor NOR-3.
[0421] FIG. 40, part II shows that GMCSF does not lead to increased
phosphorylation of STAT1 ("pSTAT1") or STAT5 ("pSTAT5"), although
the proteins themselves are expressed in neurons.
[0422] FIG. 40, part III A shows that GMCSF leads to a
time-dependent activation of STAT3, that is maximal at 5 min
following the GMCSF stimulus. At 60 min, the level of pSTAT3 drops
below the initial level, a response kinetic known from cells of the
hematopoeitic system. B, quantification of three independent
experiments. C. Activation of STAT3 by phosphorylation can be
inhibited by the JAK2 inhibitor AG490. 5 min after giving GMCSF the
levels of pSTAT3 are quite different in presence of the inhibitor.
FIG. 40, part IV shows that GMCSF strongly induces the expression
of the stat3 target genes Bcl2, and BCIX1. These genes are known as
being antiapoptotic, This experiment demonstrates that 1.) GMCSF
acts antiapoptotically on neurons 2.) this is mediated by the stat3
pathway. Therefore this also demonstrates the possibility to use
the stat3 system in neurons as a screening tool for finding novel
neuroprotective durgs, including novel mimetics of gcsf or
gmcsf.
Example 38
GMCSF Reduces Infarct Volume in Rodent Stroke Models
[0423] We conducted experiments with GMCSF in the most accepted
model for stroke in the rat, the middle cerebral artery occlusion
model (MCAO).
[0424] In principle, the experiment was conducted as exemplified in
example 1 and 19. In brief, male Wistar rats were anesthesized
using inhalation anesthesia (halothane/N.sub.2O/O.sub.2). The
carotid artery was exposed, and a coated nylon filament inserted
into the common carotid artery, and advanced until it blocked blood
flow to the MCA. Correct positioning of the filament was monitored
by Laser Doppler flowmetry. After 90 min occlusion, the filament
was withdrawn allowing reperfusion. GMCSF (Leukine, Immunex) was
applied at a dose of 250 .mu.g/kg body weight to the rats via an
intravenous catheter (femoral vein) over a period of app. 20 min by
an infusion pump at either 30 min or 3 h following onset of
ischemia. Infarct volumes were determined 24 h later with the
standard method of TTC-staining, and a computer-based
volumetry.
[0425] FIG. 41 demonstrates that there is a significant reduction
of infarct volume in the GMCSF-treated animals, both at the early
(FIG. 41, part 1), and at the late time window of 3 h (FIG. 41,
part II).
[0426] This exemplifies the applicability to GMCSF to
neurodegenerative disorders in general, and to stroke treatment in
particular.
Example 39
IL-5 is Upregulated in the MCAO Model of Focal Ischemia
[0427] RNA was isolated according to standard protocols
(Chomczynski and Sacchi (1987), Anal Biochem, 162, 156-9) followed
by Qiagen RNeasy.TM. mini kit purification from rat cortical
penumbral samples, ipsi- and contralateral to the lesion side (see
FIG. 9a for localization of the tissue samples; here: 3 vs. 4).
cDNA was synthesized from 1 .mu.g total RNA using oligodT primers,
superscript II reverse transcriptase (Gibco) using standard
conditions. Quantitative PCR was performed using the
Lightcycler.RTM. system (Roche Diagnostics, Mannheim, Germany) with
SYBR-green staining of DNA doublestrands. Cycling conditions were
as follows: 5 min 95.degree. C., 5 sec 95.degree. C., 7 sec
62.degree. C., 30 sec 72.degree. C.; 9 sec 83.degree. C. for 50
cycles. Melting curves were done with the following parameters:
95.degree. C. cooling to 50.degree. C.; ramping to 99.degree. C. at
0.2.degree. C./sec. The following primer pairs were used: "rat
IL-5-38s" GCTGTGTCTGGGCCATTGCTAT (SEQ ID NO:66), and "rat IL-5-318
as" CTCTTCGCCACACTTCTCTTTTTG (SEQ ID NO:67). The Lightcycler.RTM.
PCR was performed using the SYBR green master mix, following the
manufacturer's recommendations (Roche Diagnostics). Specificity of
product was ensured by melting point analysis and agarose gel
electrophoresis. cDNA content of samples was normalized to the
expression level of Cyclophilin (primers:
"cyc5"ACCCCACCGTGTTCTTCGAC (SEQ ID NO:9); "acyc300"
CATTTGCCATGGACAAGATG (SEQ ID NO:10)). Relative regulation levels
were derived after normalization to cyclophilin, and comparison to
the sham-operated animals. FIG. 42 shows upregulation of IL-5 after
2 h and 6 h on the ipsilateral side, and a slight upregulation
after 6 h on the contralateral side, error bars indicate standard
deviations, these are calculated from 3-fold serially diluted
cDNA-samples, and reflect reliability of measurements.
Example 40
G-CSF, GM-CSF, IL-3 and IL-5 Induce Antiapoptotic Pathways in
Neuronal Cell Cultures
[0428] Cortices were dissected from rat embryos E18. The tissue was
dissociated using 10 mg/ml trypsin, 5 mg/ml EDTA/DNase (Roche
diagnostics) in HBSS. The digestion was stopped using four parts
neurobasal medium containing 1.times.B-27 supplement (Invitrogen),
0.5 mM L-glutamine, and 25 .mu.M glutamate. After centrifugation,
the pellet was dissolved in 5 ml medium and cells were plated at a
density of 2mio cells on 6 cm dishes coated with poly-L-lysine.
[0429] For Pathway mapping culture medium was removed after 21 days
in culture and fresh medium containing 50 ng 1 ml G-CSF or 20 ng/ml
GM-CSF. In the case of IL3 and IL-5 3 ml culture medium was removed
and fresh medium was added containing IL-3 or IL-5 to reach a final
concentration of 10 ng 1 ml each. Cells were harvested at different
timepoints after onset of Cytokine treatment, stating with 5 min
after onset (see below and Figures).
[0430] For Western blots cells were harvested and cells were lysed
in SDS-Benzonase-Buffer (1% SDS, 5 mM MgCl.sub.2, PBS, Inhibitors
1:1000: Aprotinin, Leupeptin, Pepstatin, PMSF, ALLN, ALLM,
Benzonase 1:100). Blots containing 100 .mu.g of neuronal protein
per sample were loaded on a SDS polyacrylamide gel containing 4 M
urea and electrophoresed under standard conditions. Proteins were
electrophoretically transferred to Immobilon-P.TM. membranes
(Millipore Corp., Eschbom, Germany) by semi-dry blotting. The
membranes were blocked in 3% nonfat dry milk in TBST (20 mM Tris
base, pH 7.6, 137 mM NaCl and 0.05% Tween-20) for 1 hour at room
temperature (RT).
[0431] For Detection blots were incubated for 1 h at room
temperature with the respective primary (all antibodies from Cell
Signalling Technology) and secondary antibodies (Dianova). Signals
were detected using the supersignal chemiluminescence system
(Pierce). G-CSF
[0432] Another potent anti-apoptotic transduction pathway that can
be activated by a number of growth factor receptors is the PI3K/Akt
pathway (Dudek, et al. (1997), Science, 275, 661-5). Akt is
activated via PI3-kinase and the kinase PDK, and active Akt can be
determined by the level of Ser.sup.473 phosphorylation. In
untreated cells, there was only a faint band visible corresponding
to phosphorylated Akt (FIG. 43A, first lane). 5 min after addition
of 20 ng/ml G-CSF there was a massive increase in phosphorylated
Akt, that appeared stable for at least 1 h after G-CSF addition
(FIG. 43A). Overall levels of Akt remained constant (FIG. 43A,
second row). Parallel to the induction of Akt, we observed an even
stronger phosphorylation of the upstream kinase PDK1, that appeared
as two bands with a slight size difference (FIG. 43B).
Interestingly, the activation of both PDK and Akt appeared
bi-phasic with a temporary decrease of the signal at 15 min. The
phosphorylation of Akt 5 min after G-CSF addition could be
completely blocked by the PI3-kinase inhibitor LY294002 (FIG. 43C).
Thus, Akt is a prominent signal induced by G-CSF in neurons, and
appears activated via the known PI3-kinase--PDK pathway.
[0433] Finally, we determined activation levels of the Erk family
of kinases, that also have a protective funtion in neurons
(Anderson and Tolkovsky (1999), J Neurosci, 19, 664-73). While
Erkl/2 was only transiently activated (FIG. 43D), Erk5 had a
stronger and longer-lasting activation (FIG. 43D, lower rows).
Interestingly, a recent report connects Erk5 activation to survival
signals elicited by trk receptors (Watson, et al. (2001), J Biol
Chem, 276, 3536-42).
Together, G-CSF leads to the induction of three anti-apoptotic
pathways in neurons.
GM-CSF
[0434] GM-CSF led to a massive increase in phosphorylated Akt, that
appeared stable for at least 1 h after GM-CSF addition (FIG. 44A),
too. Parallel to the induction of Akt, we observed an even stronger
phosphorylation of the upstream kinase PDK1 (FIG. 44A). The
phosphorylation of Akt 5 min after GM-CSF addition could be
completely blocked by the PI3-kinase inhibitor LY294002 (FIG. 44A).
Thus, Akt is a prominent signal induced by GM-CSF in neurons, and
is activated via its cognate PI3-kinase--PDK pathway originating at
the GM-CSF receptor. A third pathway that may originate at cytokine
receptors is the Raf-Erk pathway. Erk 1/2 was shown to promote
neuronal survival (Anderson and Tolkovsky (1999), J Neurosci, 19,
664-73, Xia, et al. (1995), Science, 270, 1326-31), and mediates
BDNF's protective action in ischemic models (Han and Holtzman
(2000), J Neurosci, 20, 5775-81). Indeed, GM-CSF also induced rapid
but transient activation of Erk 1/2 by phosphorylation (FIG. 44B).
Surprisingly, we also detected activation of the newly discovered
Erk 5, that appeared stronger and lasted for at least 1 h after
GM-CSF addition (FIG. 44B). Erk 5 has also been implied in
mediating neuronal survival signals (Watson, et al. (2001), Nat
Neurosci, 4, 981-8).
[0435] Together, GM-CSF leads to the induction of at least three
major independent survival pathways in neurons.
IL-3
[0436] Also IL-3 led to a massive increase in phosphorylated Akt,
that was detected at 5 min and 1 h after IL-3 addition (FIG. 47).
Thus, Akt is a prominent signal induced by IL-3 in neurons, and is
activated via its cognate PI3-kinase--PDK pathway originating at
the IL-3 receptor. As for GCSF and GMCSF we also could show that
PDK is phosphorylated by IL-3 stimulation of neuronal cells. (FIG.
47) The phosphorylation could be detected 5 min and 1 h after onset
of IL-3 stimulation.
IL-5
[0437] IL-5 led to a massive increase in phosphorylated Akt and
PDK, as described for IL-3, that was detected at 5 min and 1 h
after IL-5 addition (FIG. 47). Thus, Akt and PDK are a prominent
signal induced by IL-5 in neurons, and is activated via its cognate
PI3-kinase--PDK pathway originating at the IL-5 receptor.
Example 41
GM-CSF is Upregulated after Cell Death In Vitro
[0438] Primary cortical neurons from rats were generated as
described in example 12. Two weeks after preparation, neurons were
treated with various concentrations of H.sub.2O.sub.2 (0 .mu.M, 300
.mu.M, 450 .mu.M, 600 .mu.M and 900 .mu.M) for 6 h. Medium was
withdrawn, and the cells were scraped off the plate by adding
Lysisbuffer and following the manufacturer's recommendations for
the RNA-preparation by Qiagen RNeasy mini kit. In principle, the
Light-Cycler measurements were performed as described in example
23. The PCR was performed using "rat GM-CSF-94s"
CTGGAGAACGAAAAGAACGAAGAC (SEQ ID NO:93) and "rat GM-CSF-359 as"
TCAAAAGGGATATCAAACAGAAAG (SEQ ID NO:94), and the following cycling
conditions were used: 10 min 95.degree. C., 10 sec 95.degree. C.,
10 sec 63.degree. C., 30 sec 72.degree. C.; 10 sec 86.degree. C.
for 50 cycles.
Results
[0439] With increasing concentrations of H.sub.2O.sub.2, the
expression of GM-CSF increases as well up to 4-fold in comparison
to untreated neurons (FIG. 45). This concentration-dependent
induction of GM-CSF after stimulation of cell death confirms the
suggestion that GM-CSF might act as an endogenous neuroprotective
factor after brain damage.
Example 42
IL-3 and IL-5 protect cells from Camptothecin Induced Dying in Rat
Primary Cortical Cell Culture and Human Neuroblastoma Cells
(SHSY5-Y)
[0440] SHSY5-Y cells were cultured in DMEM (high glucose; 4500
mg/ml)+20% FCS+1% Penicillin/Streptomycin. For Caspase3/7 activity
assay 45000 cells/well were seeded into a 96 well plate. One day
after plating culture medium was adjusted to 90 .mu.l/well and 10
.mu.l of camptothecin was added or cells were left untreated. Then
10 .mu.l of diluted Cytokine was added to Capmtothecin treated
cells to reach final concentrations of 0, 1, 10, 20, 50 or 100
ng/ml. After 16h of incubation at 37.degree. C., 5% CO.sub.2
Caspase 3 and 7--activity was measured (Caspase3/7 activity assay,
Promega; following the instructions) with a plate reader
(Berthold).
[0441] Cortical cultures were prepared as described above. 30000
cells/well were seeded in a 96 well plate and cultured for 2 weeks.
Then culture medium was adjusted to 90 .mu.l/well and 10 .mu.l of
Camptothecin was added or cells were left untreated. Then 10 .mu.l
of diluted Cytokine was added to Camptothecin treated cells to
reach final concentrations of 0, 1, 10, 20, 50 or 100 ng/ml. After
16h of incubation at 37.degree. C., 5% CO.sub.2 Caspase 3 and
7--activity was measured (Caspase3/7 activity assay, Promega;
following the instructions) with a plate reader (Berthold).
[0442] The results show that the Cytokines have their highest
anti-apoptotic activity at different concentrations (FIG. 46).
[0443] IL-3 has its highest anti-apoptotic activity at a
concentration of 1-20 ng/ml on neuronal cultures and was most
protective at 1 ng/mlon SHSY5-Y cells (FIG. 46a).
[0444] IL-5 was most protective at 1 ng/ml on both rat neuronal
cells and human SHSY5-Y (FIG. 46b).
Example 43
G-CSF is Protective in Cortical Ischemia
Ischemic Model
[0445] Distal MCA/CCA occlusion model. Transient left common
carotid/MCA (CCA/MCA) occlusion was achieved as described
previously. Briefly, animals fasted overnight were anesthetized
with chloral hydrate (0.45 g/kg IP). The right femoral vein and
artery were cannulated for arterial blood pressure recording and
drug administration. Core body temperature was maintained at
36.5.+-.0.5.degree. C. during ischemia and the first hour of
reperfusion through the use of a feed-forward temperature
controller. The ipsilateral CCA was isolated and tagged through a
ventral, cervical midline incision. A 0.005-inch-diameter stainless
steel wire (Small Parts Inc) was placed underneath the left MCA
rostral to the rhinal fissure, proximal to the major bifurcation of
the MCA, and distal to the lenticulostriate arteries. The artery
was then lifted, and the wire was rotated clockwise to ensure
occlusion. The CCA was next occluded with an atraumatic aneurysm
clip. Cerebral perfusion at the cortical surface, 3 mm distal to
the locus of the MCA occlusion, was measured with a laser-Doppler
flowmeter (LDF) (model BPM2, Vesamedic). Only those animals that
displayed a cerebral perfusion of 10% to 15% of the initial value
on the LDF scale (expressing relative values of cerebral perfusion)
were included in the study. 50 .mu.g/kg G-CSF was infused i.v. over
20 min starting 60 min after induction of ischemia. After 180
minutes of MCA/CCA occlusion, reperfusion was established by
reversing the occlusion procedure. After 72 hours of reperfusion,
animals were reanesthetized and transcardially perfused with 50 mL
of saline. Perfused isolated brains were transferred into ice-cold
PBS for sectioning. Infarct volumes were determined by TTC
staining. All procedures were in compliance with National
Institutes of Health guidelines for the humane care of animals and
were approved by the institutional animal welfare committee.
Example 44
G-CSF Induces Neurogenesis in Adult Neural Stem Cells
Generation of Neural Stem Cells (NSCS)
[0446] Generation of adult neural stem cells from rat was performed
as described in example 9. For transfection of neural stem cells
with the luciferase reporter, they were passaged once a week and
luciferase-experiments were performed after 14 weeks in vitro.
[0447] For the differentiation experiment, the cells were plated in
15cM2 culture flasks at a density of 4 million cells and were
treated once with 100 ng/ml G-CSF (Neupogen.RTM., Amgen, Europe
B.V., Netherlands) (n=6). The control cells were left untreated
(n=4) and 4 d after stimulation the cells were harvested for the
antibody staining and the FACS-analysis.
Luciferase Assay
[0448] The effects of G-CSF treatment on adult neural stem cells in
vitro were further examined by a reporter strategy using luciferase
under control of an adequate .beta.-III-tubulin promoter fragment.
The class III .beta.-tubulin gene promoter (fragment -450-+54)
(described previously) was amplified by using genomic DNA as a
template for PCR, and then the fragment was inserted into the Mlu
I/Xho I site of the pGL3-Basic firefly luciferase reporter vector
(Promega). The pRL SV40 vector (Promega) served as an internal
control vector. For DNA transfection, the cells were dissociated
and plated on poly-L-ornithin/laminin-coated 96-well plates at a
density of 35 000 cells/well. After 24 hrs cultivation, cells were
washed once with 1.times.Dulbecco's phosphate-buffered saline
(DPBS, Gibco). Cotransfection with the pGL3-p-.beta.III-tubulin
vector (150 ng/well) and the pRL SV40 vector (10 ng/well) was
carried out according to the Lipofectamine method (Invitrogen). The
pGL3-basic firefly luciferase reporter vector served as negative
control, and as positive control the cells were cotransfected with
pCMV-luciferase. The DNA-Lipofectamine 2000 complexes were added to
each well after removing the DPBS, without adding Neurobasal
medium. Following the incubation of transfected cells for 24 hrs,
Opti-MEM was removed and cells were stimulated with various
concentrations of G-CSF (Neupogen.RTM., Amgen, Europe B.V.,
Netherlands) in Neurobasal medium (5 ng/ml, 10 ng/ml, 100 ng/ml)
for 48 hrs. As a control for in vitro differentiation, stem cells
were treated by adding 5% fetal calf serum (FCS) to the medium and
withdrawing mitogens. Then the cells were harvested to prepare the
cellular extracts for luciferase assay following the directions of
Promega. As the cells were cotransfected with the firefly and the
Renilla luciferase, the Dual-Luciferase Reporter Assay System
(Promega) was used and the ratio of luminescence signals from the
reaction mediated by firefly luciferase to those from the reaction
mediated by Renilla luciferase were measured with a luminometer
(Berthold Technologies, Mithras LB 940).
[0449] As shown in FIG. 50, the luciferase activity increased
dose-dependently in a range of 5 to 100 ng/ml. Interestingly, 100
ng/ml had a stronger differentiation-inducing effect compared to
the standard differentiation procedure of omitting bFGF and EGF
from the medium, and adding FCS.
FACS Analysis
[0450] A single cell suspension was made by triturating the
neurospheres in 1 ml plastic pipettes, and then the cells were
pelleted by centrifugation. After resuspension in 1.times.
phosphate-buffered saline (PBS), the cells were fixed by adding the
same volume of 2% Paraformaldehyde (PFA) in 1.times.PBS resulting
in a final concentration of 1% PFA. The cells were incubated for 5
min on ice, washed once with 1.times.PBS and then permeabilised by
resuspension in 0.2% tween20 solved in 1.times.PBS. After an
incubation on ice for 15 min, fetal calf serum (FCS) was added in a
1:50 dilution for blocking. As primary antibody served a monoclonal
mouse anti-rat MAP2 antibody (Sigma) added at a dilution 1:100. The
cells were incubated for 2 hrs on ice and washed three times with
0.1% tween20 in 1.times.PBS. Following an incubation for 30 min on
ice with a donkey anti-mouse FITC-conjugated secondary antibody
(Dianova), the cells were washed again three times with 0.1%
tween20 in 1.times.PBS and were finally resuspended in 1.times.PBS
for FACS analysis. Flow cytometry of cells was performed on a
FACSCalibur (Becton-Dickinson). The cells were analyzed by light
forward and right-angle (side) scatter, and for FITC fluorescence
through an adequate filter system.
[0451] After treatment of adult neural stem cells for 4 d with
G-CSF, the percentage of cells expressing the neuronal marker MAP-2
increased from 32.8.+-.6.4 to 65.0.+-.3.3% (p<0.005; N=4 and 6,
respectively) (FIG. 45). Taken together, G-CSF induces
differentiation of neural stem cells towards a neuronal phenotype
as shown before in example 26.
Example 45
GM-CSF Induces Neurogenesis in Adult Neural Stem Cells
Generation of Neural Stem Cells (NSCS)
[0452] Generation of adult neural stem cells from rat was performed
as described in example 9. For transfection of neural stem cells
with the luciferase reporter, they were passaged once a week and
luciferase-experiments were performed after 14 weeks in vitro.
[0453] For the differentiation experiment, the cells were plated in
15 cm.sup.2 culture flasks at a density of 4 million cells and were
treated once with 10 ng/ml GM-CSF (Leukine.RTM., Berlex, Schering
AG Germany) (n=3). The control cells were left untreated (n=3) and
4 d after stimulation the cells were harvested for the antibody
staining and the FACS-analysis.
Luciferase Assay
[0454] To examine the effects of GM-CSF treatment on adult neural
stem cells in vitro, a reporter strategy using luciferase under
control of a .beta.-III-tubulin promoter fragment was used as
described in example 44. Neural stem cells were stimulated with
various concentrations of GM-CSF (Leukine.RTM., Berlex, Schering AG
Germany) in Neurobasal medium (0.5 ng/ml, 5 ng/ml, 10 ng/ml) for 48
hrs. In FIG. 51, a concentration-dependent increase in
luciferase-activity is shown after GM-CSF treatment of the neural
stem cells. With a concentration of 10 ng/ml GM-CSF, the same
differentiation-inducing effect can be achieved as with omitting
bFGF and EGF and adding FCS which is known as standard
differentiation protocol.
FACS Analysis
[0455] The antibody staining for the neuronal marker MAP2 was
performed as described in example 44. The counts of MAP2-positive
cells increases from 28.36.+-.2.26% in untreated to 56.86.+-.8.36
in GM-CSF treated stem cells (p<0.03; N=3) as shown in FIG. 52.
Thus, GM-CSF induces significantly neurogenesis in adult neural
stem cells.
Example 46
GM-CSF and its Receptor are Expressed in Human Brain
Immunohistochemical methods
[0456] Sections of paraffin-embedded tissues (2 .mu.m) were
deparaffinated by treating them 2.times.5 min with Xylol, 2.times.2
min 100% ethanol, and then with descending concentrations of
ethanol from 96% up to 70%. Finally the sections are washed with
distilled water and microwaved (citrate buffer at 600 W for 15
min). Afterwards, sections were washed with distilled water and
antigens were blocked 3.times.5 min in 1.times.TBS (pH 7.4)
containing 0.2% BSA. The GM-CSF antiserum (SC13101; Santa Cruz
Biotechnology, Santa Cruz, Calif., USA; 1: 100) diluted in
1.times.TBS (pH 7.4) containing 0.2% BSA was incubated at room
temperature for 1 h in a humid chamber. Sections were then washed
3.times.2 min with 1.times.TBS (pH 7.4) containing 0.2% BSA. The
biotinylated secondary antibody (goat anti-rabbit, Vector
Laboratories, 1:200) was then applied for 30 min in 1.times.TBS (pH
7.4) containing 0.2% BSA. Following washing the sections 3.times.2
min with 1.times.TBS (pH 7.4) containing 0.2% BSA, the sections
were incubated for 1 h at room temperature with a saturating amount
of TRITC-conjugated Streptavidin (Dianova 1:200). Again after
washing 3.times.2 min with 1.times.TBS (pH 7.4) containing 0.2%
BSA, the GM-CSF receptor alpha antiserum (Chemicon, 1:100) was
applied. After 1 h, the sections were washed 3.times.2 min with
1.times.TBS (pH 7.4) containing 0.2% BSA. As described above, the
detection was performed by applying a biotinylated secondary
antibody (goat anti-mouse, Vector Laboratories, 1:200), and
afterwards the sections were incubated with Cy5-conjugated
Streptavidin (Dianova 1:200). After washing the sections 3.times.2
min with 1.times.TBS, they were stained for 10 min with the nuclear
dye DAPI diluted 1:10 000 in 1.times.TBS. Finally the sections were
washed 3.times.2 min with 1.times.TBS and mounted with mounting
medium for fluorescence (Vectashield, Vector Laboratories, USA).
Pictures were taken digitally with an Olympus IX81 microscope, and
the "Analysis" software package (Soft Imaging Systems, Stuttgart,
Germany).
[0457] All double-fluorescence experiments were controlled by
parallel single-staining, which were checked for absence of any
fluorescence carry-over in the second channel.
Results
[0458] In the human frontal cortex the GM-CSF receptor alpha (FIG.
53 a, d) was expressed on the same neurons as GM-CSF (FIG. 53 b, e)
as shown in FIG. 53 c, f, where the two stainings are merged. Thus,
the expression of GM-CSF and its receptor is not restricted to
mouse and rat brain, but can also be found in human brain.
Example 47
The G-CSF Receptor is Expressed in Human Brain
Immunohistochemical Methods
[0459] The sections of paraffin-embedded tissues (2 .mu.m) were
treated as described in example 46. Briefly, after
deparaffinisation and microwaving in citrate buffer, the sections
were blocked with 1.times.TBS (pH 7.4) containing 0.2% BSA. After
washing, the G-CSF receptor antiserum (SC694; Santa Cruz
Biotechnology, Santa Cruz, Calif., USA; 1:100) was applied for 1 h
in a humid chamber. Following incubation with a biotinylated
secondary antibody (goat anti-rabbit, Vector Laboratories, 1:200)
and detection with Cy5-conjugated Streptavidin (Dianova 1:200),
nuclei were stained for 10 min with DAPI diluted 1:10 000 in
1.times.TBS. Finally the sections were mounted and pictures were
taken digitally with an Olympus IX81 microscope, and the "Analysis"
software package (Soft Imaging Systems, Stuttgart, Germany).
Results
[0460] As shown in example 46 for the GM-CSF receptor alpha, the
G-CSF receptor was expressed in the frontal cortex of human brain
(FIG. 54).
Example 48
G-CSF is Upregulated after Cell Death In Vitro
[0461] Primary cortical neurons from rats were generated as
described in example 12. Two weeks after preparation, neurons were
treated with various concentrations of H.sub.2O.sub.2 (0 .mu.M, 300
.mu.M, 450 .mu.M, 600 .mu.M and 900 .mu.M) for 6 h. Medium was
withdrawn, and the cells were scraped off the plate by adding
Lysisbuffer and following the manufacturer's recommendations for
the RNA-preparation by Qiagen RNeasy mini kit. The Light-Cycler
measurements on G-CSF were performed as described in example
23.
Results
[0462] As cell death arises with increasing concentrations of
H.sub.2O.sub.2, the expression of G-CSF was increased as well (FIG.
55). These results confirm the suggestion that G-CSF might act as
an endogenous neuroprotective factor after brain damage.
Example 49
Expression of the IL-5 Receptor in Rat Brain
[0463] To systematically assess the distribution of the IL-5
receptor in the normal rat brain, sections of paraffin-embedded
tissues (2 .mu.m) were deparaffinated and microwaved (citrate
buffer at 500 W for 10 min). Afterwards, sections were incubated at
room temperature with IL-5 receptor alpha antiserum (AF553; R&D
Systems; 1:100) for 1 h in a humid chamber. Staining was visualized
using the ABC technique with DAB as chromogen (DAKO, Glostrup,
Denmark). Negative controls were done by omitting the primary
antiserum.
Results
[0464] The expression of the IL-5 receptor alpha was detected in
the frontal Cortex (FIG. 56 a), in the dentate gyrus (FIG. 56 b),
in the mitral cells of the olfactory bulb (FIG. 56 c), and in
Purkinje cells of the cerebellum (FIG. 56 d).
Example 50
Neuroprotective Effect of G-CSF on Human Cells
[0465] In this example we tested the neuroprotective potential of
G-CSF and GM-CSF on cells of human origin. Therefore we used the
human neuroblastoma cell line SHSY5Y. To model oxidative stress the
cells were treated with NO-donor NOR3 in the presence or absence of
G-CSF/GM-CSF and elevated caspase 3/7 activity was used as a
measure for damage. Cells were seeded in 96 well plates
(5.times.10.sup.4 cells/well) for 2 days. To induce oxidative
stress the cells were treated with 150 .mu.M Nor3 for 5 h with or
without G-CSF (50 .mu.g/ml). Caspase 3/7 activity was then
determined by Caspase-Glow Assay (Promega) according to the
manufacturer's protocol and luminescence detected with a plate
reader (Berthold). FIG. 57 shows that G-CSF [60 ng/ml] and GM-CSF
[20 ng/ml] both reduce the NOR3 evoked Caspase activity in human
neuroblastoma cells. This underlines the neuroprotective efficacy
of both cytokines and shows that human neuronal cells are
susceptible to them.
Example 60
Human and Rodent GM-CSF are Neuroprotective on Rat Primary
Neurons
[0466] Testing for different efficacy of G-CSF from human and
rodent GM-CSF origin. We compared the neuroprotective activity of
recombinant mouse GM-CSF and recombinant human G-CSF on primary
neurons prepared from fetal rats. To induce apotosis in neuron
preparations we treated the cells with the topoisomerase inhibitor
Camptothecin [20 .mu.M] for 5 h before measuring Caspase activity.
FIG. 58 shows the result of the experiment, addition of GM-CSF [20
ng/ml] significantly reduced Camptothecin induced caspase 3/7
activity as measured by luminescence increase with the CaspaseGlow
assay (Promega). We could not observe any significant difference
between treatment with mouse and human G-CSF, this indicates that
G-CSF different species can activate the G-CSF-receptor on rat
neurons.
[0467] All of the references cited herein, including patents,
patent applications, and publications, are hereby incorporated in
their entireties by reference.
[0468] Obviously, numerous modifications and variations of the
present invention are possible in light of the above teachings. It
is therefore to be understood that within the scope of the appended
claims, the invention may be practiced otherwise than as
specifically described herein.
Sequence CWU 1
1
94170PRTArtificial Sequencecomputer generated consensus sequence
1Asn Xaa Xaa Xaa Xaa Ser Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5
10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Val Ile Met Xaa
Trp Xaa 35 40 45Xaa Xaa Pro Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Tyr
Phe Xaa Xaa 50 55 60Val Ile Leu Met Xaa Trp65 70221DNAArtificial
Sequencesynthetic DNA 2gcgggcaaat caggatctca c 21321DNAArtificial
Sequencesynthetic DNA 3cgaagctcag cttgatccag g 214280DNARattus
rattus 4gcgggcaaat caggatctca ccccccattg tccatcttgg ggatcctgtc
ctggcctcct 60gcaccatcag cccaaactgc agcaaactgg accgacagcc aaagatccta
tggagactgc 120aagatgaacc aaaccagcct ggggacagac agcatcacct
gcctgacggg tcccaggagt 180ccatcatcac tctgcctcat ctgaactaca
ctcaggcctt cctcttctgc ttggtgccat 240ggaacaacag cttccaggtc
ctggatcaag ctgagcttcg 280522DNAArtificial Sequencesynthetic DNA
5cccctcaaac ctatcctgcc tc 22622DNAArtificial Sequencesynthetic DNA
6tccaggcaga gatcagcgaa tg 22721DNAArtificial Sequencesynthetic DNA
7ccattgtcca tcttggggat c 21821DNAArtificial Sequencesynthetic DNA
8cctggaagct gttgttccat g 21920DNAArtificial Sequencesynthetic DNA
9accccaccgt gttcttcgac 201020DNAArtificial Sequencesynthetic DNA
10catttgccat ggacaagatg 20117PRTArtificial Sequencesynthetic
peptide sequence 11Leu Gly His Ser Leu Gly Ile1 51239DNAArtificial
Sequencesynthetic DNA 12cgggatccgg gaccgcgtat ctgatgacga gcgtgtcaa
391325DNAArtificial Sequencesynthetic DNA 13ctcggagacg ctgaggaagg
acctg 251440DNAArtificial Sequencesynthetic DNA 14ctgcggccct
agaccacgcc caccgctccc cgtgacgtcg 401522DNAArtificial
Sequencesynthetic DNA 15acgtcgttgg ctcagttatg tc
221624DNAArtificial Sequencesynthetic DNA 16atttatgtca gagatggagg
atgg 241720DNAArtificial Sequencesynthetic DNA 17accccaccgt
gttcttcgac 201820DNAArtificial Sequencesynthetic DNA 18catttgccat
ggacaagatg 201922DNAArtificial Sequencesynthetic DNA 19acgtcgttgg
ctcagttatg tc 222024DNAArtificial Sequencesynthetic DNA
20atttatgtca gagatggagg atgg 2421177DNARattus rattus 21acgtcgttgg
ctcagttatg tcagacagga aatctcacca tcccacaatg attgacagct 60ctcacaggga
atcccgcctc cgctgggacc aattgacatc acggacagga atacccgccc
120ctgtggccct gatgggcagg tcctgcctgg ctcccatcct ccatctctga cataaat
17722400PRTHomo sapiens 22Met Leu Leu Leu Val Thr Ser Leu Leu Leu
Cys Glu Leu Pro His Pro1 5 10 15Ala Phe Leu Leu Ile Pro Glu Lys Ser
Asp Leu Arg Thr Val Ala Pro 20 25 30Ala Ser Ser Leu Asn Val Arg Phe
Asp Ser Arg Thr Met Asn Leu Ser 35 40 45Trp Asp Cys Gln Glu Asn Thr
Thr Phe Ser Lys Cys Phe Leu Thr Asp 50 55 60Lys Lys Asn Arg Val Val
Glu Pro Arg Leu Ser Asn Asn Glu Cys Ser65 70 75 80Cys Thr Phe Arg
Glu Ile Cys Leu His Glu Gly Val Thr Phe Glu Val 85 90 95His Val Asn
Thr Ser Gln Arg Gly Phe Gln Gln Lys Leu Leu Tyr Pro 100 105 110Asn
Ser Gly Arg Glu Gly Thr Ala Ala Gln Asn Phe Ser Cys Phe Ile 115 120
125Tyr Asn Ala Asp Leu Met Asn Cys Thr Trp Ala Arg Gly Pro Thr Ala
130 135 140Pro Arg Asp Val Gln Tyr Phe Leu Tyr Ile Arg Asn Ser Lys
Arg Arg145 150 155 160Arg Glu Ile Arg Cys Pro Tyr Tyr Ile Gln Asp
Ser Gly Thr His Val 165 170 175Gly Cys His Leu Asp Asn Leu Ser Gly
Leu Thr Ser Arg Asn Tyr Phe 180 185 190Leu Val Asn Gly Thr Ser Arg
Glu Ile Gly Ile Gln Phe Phe Asp Ser 195 200 205Leu Leu Asp Thr Lys
Lys Ile Glu Arg Phe Asn Pro Pro Ser Asn Val 210 215 220Thr Val Arg
Cys Asn Thr Thr His Cys Leu Val Arg Trp Lys Gln Pro225 230 235
240Arg Thr Tyr Gln Lys Leu Ser Tyr Leu Asp Phe Gln Tyr Gln Leu Asp
245 250 255Val His Arg Lys Asn Thr Gln Pro Gly Thr Glu Asn Leu Leu
Ile Asn 260 265 270Val Ser Gly Asp Leu Glu Asn Arg Tyr Asn Phe Pro
Ser Ser Glu Pro 275 280 285Arg Ala Lys His Ser Val Lys Ile Arg Ala
Ala Asp Val Arg Ile Leu 290 295 300Asn Trp Ser Ser Trp Ser Glu Ala
Ile Glu Phe Gly Ser Asp Asp Gly305 310 315 320Asn Leu Gly Ser Val
Tyr Ile Tyr Val Leu Leu Ile Val Gly Thr Leu 325 330 335Val Cys Gly
Ile Val Leu Gly Phe Leu Phe Lys Arg Phe Leu Arg Ile 340 345 350Gln
Arg Leu Phe Pro Pro Val Pro Gln Ile Lys Asp Lys Leu Asn Asp 355 360
365Asn His Glu Val Glu Asp Glu Ile Ile Trp Glu Glu Phe Thr Pro Glu
370 375 380Glu Gly Lys Gly Tyr Arg Glu Glu Val Leu Ile Val Lys Glu
Ile Thr385 390 395 40023388PRTMus musculus 23Met Thr Ser Ser His
Ala Met Asn Ile Thr Pro Leu Ala Gln Leu Ala1 5 10 15Leu Leu Phe Ser
Thr Leu Leu Leu Pro Gly Thr Gln Ala Leu Leu Ala 20 25 30Pro Thr Thr
Pro Asp Ala Gly Ser Ala Leu Asn Leu Thr Phe Asp Pro 35 40 45Trp Thr
Arg Thr Leu Thr Trp Ala Cys Asp Thr Ala Ala Gly Asn Val 50 55 60Thr
Val Thr Ser Cys Thr Val Thr Ser Arg Glu Ala Gly Ile His Arg65 70 75
80Arg Val Ser Pro Phe Gly Cys Arg Cys Trp Phe Arg Arg Met Met Ala
85 90 95Leu His His Gly Val Thr Leu Asp Val Asn Gly Thr Val Gly Gly
Ala 100 105 110Ala Ala His Trp Arg Leu Ser Phe Val Asn Glu Ser Ala
Ala Gly Ser 115 120 125Gly Ala Glu Asn Leu Thr Cys Glu Ile Arg Ala
Ala Arg Phe Leu Ser 130 135 140Cys Ala Trp Arg Glu Gly Pro Ala Ala
Pro Ala Asp Val Arg Tyr Ser145 150 155 160Leu Arg Val Leu Asn Ser
Thr Gly His Asp Val Ala Arg Cys Met Ala 165 170 175Asp Pro Gly Asp
Asp Val Ile Thr Gln Cys Ile Ala Asn Asp Leu Ser 180 185 190Leu Leu
Gly Ser Glu Ala Tyr Leu Val Val Thr Gly Arg Ser Gly Ala 195 200
205Gly Pro Val Arg Phe Leu Asp Asp Val Val Ala Thr Lys Ala Leu Glu
210 215 220Arg Leu Gly Pro Pro Arg Asp Val Thr Ala Ser Cys Asn Ser
Ser His225 230 235 240Cys Thr Val Ser Trp Ala Pro Pro Ser Thr Trp
Ala Ser Leu Thr Ala 245 250 255Arg Asp Phe Gln Phe Glu Val Gln Trp
Gln Ser Ala Glu Pro Gly Ser 260 265 270Thr Pro Arg Lys Val Leu Val
Val Glu Glu Thr Arg Leu Ala Phe Pro 275 280 285Ser Pro Ala Pro His
Gly Gly His Lys Val Lys Val Arg Ala Gly Asp 290 295 300Thr Arg Met
Lys His Trp Gly Glu Trp Ser Pro Ala His Pro Leu Glu305 310 315
320Ala Glu Asp Thr Arg Val Pro Gly Ala Leu Leu Tyr Ala Val Thr Ala
325 330 335Cys Ala Val Leu Leu Cys Ala Leu Ala Leu Gly Val Thr Cys
Arg Arg 340 345 350Phe Glu Val Thr Arg Arg Leu Phe Pro Pro Ile Pro
Gly Ile Arg Asp 355 360 365Lys Val Ser Asp Asp Val Arg Val Asn Pro
Glu Thr Leu Arg Lys Asp 370 375 380Leu Leu Gln Pro385249PRTRattus
rattus 24Ile Asn Ser Glu Arg Thr Ser Glu Gln1 525127PRTRattus
rattus 25Ala Pro Thr Arg Ser Pro Asn Pro Val Thr Arg Pro Trp Lys
His Val1 5 10 15Asp Ala Ile Lys Glu Ala Leu Ser Leu Leu Asn Asp Met
Arg Ala Leu 20 25 30Glu Asn Glu Lys Asn Glu Asp Val Asp Ile Ile Ser
Asn Glu Phe Ser 35 40 45Ile Gln Arg Pro Thr Cys Val Gln Thr Arg Leu
Lys Leu Tyr Lys Gln 50 55 60Gly Leu Arg Gly Asn Leu Thr Lys Leu Asn
Gly Ala Leu Thr Met Ile65 70 75 80Ala Ser His Tyr Gln Thr Asn Cys
Pro Pro Thr Pro Glu Thr Asp Cys 85 90 95Glu Ile Asp Val Thr Thr Phe
Glu Asp Phe Ile Lys Asn Leu Lys Gly 100 105 110Phe Leu Phe Asp Ile
Pro Phe Asp Cys Trp Lys Pro Val Gln Lys 115 120 12526141PRTMus
musculus 26Met Trp Leu Gln Asn Leu Arg Leu Lys Ile Phe Glu Gln Gly
Leu Arg1 5 10 15Gly Asn Phe Thr Lys Leu Lys Gly Ala Leu Asn Met Thr
Ala Ser Tyr 20 25 30Tyr Gln Thr Tyr Cys Pro Pro Thr Pro Glu Thr Asp
Cys Glu Thr Gln 35 40 45Val Thr Thr Tyr Ala Asp Phe Ile Asp Ser Leu
Lys Thr Leu Phe Leu 50 55 60Gly Ile Val Val Tyr Ser Leu Ser Ala Pro
Thr Arg Ser Pro Ile Phe65 70 75 80Leu Thr Asp Ile Pro Phe Glu Cys
Lys Lys Pro Gly Gln Lys Thr Val 85 90 95Thr Arg Pro Trp Lys His Val
Glu Ala Ile Lys Glu Ala Leu Asn Leu 100 105 110Leu Asp Asp Met Pro
Val Thr Leu Asn Glu Glu Val Glu Val Val Ser 115 120 125Asn Glu Phe
Ser Phe Lys Lys Leu Thr Cys Val Gln Thr 130 135 14027144PRTHomo
sapiens 27Met Trp Leu Gln Ser Leu Leu Leu Leu Gly Thr Val Ala Cys
Ser Ile1 5 10 15Ser Ala Pro Ala Arg Ser Pro Ser Pro Ser Thr Gln Pro
Trp Glu His 20 25 30Val Asn Ala Ile Gln Glu Ala Arg Arg Leu Leu Asn
Leu Ser Arg Asp 35 40 45Thr Ala Ala Glu Met Asn Glu Thr Val Glu Val
Ile Ser Glu Met Phe 50 55 60Asp Leu Gln Glu Pro Thr Cys Leu Gln Thr
Arg Leu Glu Leu Tyr Lys65 70 75 80Gln Gly Leu Arg Gly Ser Leu Thr
Lys Leu Lys Gly Pro Leu Thr Met 85 90 95Met Ala Ser His Tyr Lys Gln
His Cys Pro Pro Thr Pro Glu Thr Ser 100 105 110Cys Ala Thr Gln Ile
Ile Thr Phe Glu Ser Phe Lys Glu Asn Leu Lys 115 120 125Asp Phe Leu
Leu Val Ile Pro Phe Asp Cys Trp Glu Pro Val Gln Glu 130 135
14028207PRTHomo sapiens 28Met Ala Gly Pro Ala Thr Gln Ser Pro Met
Lys Leu Met Ala Leu Gln1 5 10 15Leu Leu Leu Trp His Ser Ala Leu Trp
Thr Val Gln Glu Ala Thr Pro 20 25 30Leu Gly Pro Ala Ser Ser Leu Pro
Gln Ser Phe Leu Leu Lys Cys Leu 35 40 45Glu Gln Val Arg Lys Ile Gln
Gly Asp Gly Ala Ala Leu Gln Glu Lys 50 55 60Leu Val Ser Glu Cys Ala
Thr Tyr Lys Leu Cys His Pro Glu Glu Leu65 70 75 80Val Leu Leu Gly
His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 85 90 95Cys Pro Ser
Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 100 105 110Ser
Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile 115 120
125Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala
130 135 140Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly
Met Ala145 150 155 160Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro
Ala Phe Ala Ser Ala 165 170 175Phe Gln Arg Arg Ala Gly Gly Val Leu
Val Ala Ser His Leu Gln Ser 180 185 190Phe Leu Glu Val Ser Tyr Arg
Val Leu Arg His Leu Ala Gln Pro 195 200 20529208PRTMus musculus
29Met Ala Gln Leu Ser Ala Gln Arg Arg Met Lys Leu Met Ala Leu Gln1
5 10 15Leu Leu Leu Trp Gln Ser Ala Leu Trp Ser Gly Arg Glu Ala Val
Pro 20 25 30Leu Val Thr Val Ser Ala Leu Pro Pro Ser Leu Pro Leu Pro
Arg Ser 35 40 45Phe Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile Gln
Ala Ser Gly 50 55 60Ser Val Leu Leu Glu Gln Leu Cys Ala Thr Tyr Lys
Leu Cys His Pro65 70 75 80Glu Glu Leu Val Leu Leu Gly His Ser Leu
Gly Ile Pro Lys Ala Ser 85 90 95Leu Ser Gly Cys Ser Ser Gln Ala Leu
Gln Gln Thr Gln Cys Leu Ser 100 105 110Gln Leu His Ser Gly Leu Cys
Leu Tyr Gln Gly Leu Leu Gln Ala Leu 115 120 125Ser Gly Ile Ser Pro
Ala Leu Ala Pro Thr Leu Asp Leu Leu Gln Leu 130 135 140Asp Val Ala
Asn Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Asn Leu145 150 155
160Gly Val Ala Pro Thr Val Gln Pro Thr Gln Ser Ala Met Pro Ala Phe
165 170 175Thr Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Ala Ile
Ser Tyr 180 185 190Leu Gln Gly Phe Leu Glu Thr Ala Arg Leu Ala Leu
His His Leu Ala 195 200 20530214PRTRattus norvegicus 30Met Lys Leu
Met Ala Leu Gln Leu Leu Leu Trp His Ser Ala Leu Trp1 5 10 15Ser Gly
Gln Glu Ala Ile Pro Leu Leu Thr Val Ser Ser Leu Pro Pro 20 25 30Ser
Leu Pro Leu Pro Arg Ser Phe Leu Leu Lys Ser Leu Glu Gln Val 35 40
45Arg Lys Ile Gln Ala Arg Asn Thr Glu Leu Leu Glu Gln Leu Cys Ala
50 55 60Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Phe Gly His
Ser65 70 75 80Leu Gly Ile Pro Lys Ala Ser Leu Ser Ser Cys Ser Ser
Gln Ala Leu 85 90 95Gln Gln Thr Lys Cys Leu Ser Gln Leu His Ser Gly
Leu Phe Leu Tyr 100 105 110Gln Gly Leu Leu Gln Ala Leu Ala Gly Ile
Ser Ser Glu Leu Ala Pro 115 120 125Thr Leu Asp Met Leu His Leu Asp
Val Asp Asn Phe Ala Thr Thr Ile 130 135 140Trp Gln Gln Met Glu Ser
Leu Gly Val Ala Pro Thr Val Gln Pro Thr145 150 155 160Gln Ser Thr
Met Pro Ile Phe Thr Ser Ala Phe Gln Arg Arg Ala Gly 165 170 175Gly
Val Leu Val Thr Ser Tyr Leu Gln Ser Phe Leu Glu Thr Ala His 180 185
190His Ala Leu His His Leu Pro Arg Pro Ala Gln Lys His Phe Pro Glu
195 200 205Ser Leu Phe Ile Ser Ile 21031195PRTFelis catus 31Met Lys
Leu Thr Ala Leu Gln Leu Leu Leu Trp His Ser Ala Leu Trp1 5 10 15Met
Val Gln Glu Ala Thr Pro Leu Gly Pro Thr Ser Ser Leu Pro Gln 20 25
30Ser Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Val Gln Ala Asp
35 40 45Gly Thr Ala Leu Gln Glu Arg Leu Cys Ala Ala His Lys Leu Cys
His 50 55 60Pro Glu Glu Leu Val Leu Leu Gly His Ala Leu Gly Ile Pro
Gln Ala65 70 75 80Pro Leu Ser Ser Cys Ser Ser Gln Ala Leu Gln Leu
Thr Gly Cys Leu 85 90 95Arg Gln Leu His Ser Gly Leu Phe Leu Tyr Gln
Gly Leu Leu Gln Ala 100 105 110Leu Ala Gly Ile Ser Pro Glu Leu Ala
Pro Thr Leu Asp Met Leu Gln 115 120 125Leu Asp Ile Thr Asp Phe Ala
Ile Asn Ile Trp Gln Gln Met Glu Asp 130 135 140Val Gly Met Ala Pro
Ala Val Pro Pro Thr Gln Gly Thr Met Pro Thr145 150 155
160Phe Thr Ser Ala Phe Gln Arg Arg Ala Gly Gly Thr Leu Val Ala Ser
165 170 175Asn Leu Gln Ser Phe Leu Glu Val Ala Tyr Arg Ala Leu Arg
His Phe 180 185 190Thr Lys Pro 19532195PRTBos taurus 32Met Lys Leu
Met Val Leu Gln Leu Leu Leu Trp His Ser Ala Leu Trp1 5 10 15Thr Val
His Glu Ala Thr Pro Leu Gly Pro Ala Arg Ser Leu Pro Gln 20 25 30Ser
Phe Leu Leu Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Ala Asp 35 40
45Gly Ala Glu Leu Gln Glu Arg Leu Cys Ala Ala His Lys Leu Cys His
50 55 60Pro Glu Glu Leu Met Leu Leu Arg His Ser Leu Gly Ile Pro Gln
Ala65 70 75 80Pro Leu Ser Ser Cys Ser Ser Gln Ser Leu Gln Leu Thr
Ser Cys Leu 85 90 95Asn Gln Leu His Gly Gly Leu Phe Leu Tyr Gln Gly
Leu Leu Gln Ala 100 105 110Leu Ala Gly Ile Ser Pro Glu Leu Ala Pro
Thr Leu Asp Thr Leu Gln 115 120 125Leu Asp Val Thr Asp Phe Ala Thr
Asn Ile Trp Leu Gln Met Glu Asp 130 135 140Leu Gly Ala Ala Pro Ala
Val Gln Pro Thr Gln Gly Ala Met Pro Thr145 150 155 160Phe Thr Ser
Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser 165 170 175Gln
Leu His Arg Phe Leu Glu Leu Ala Tyr Arg Gly Leu Arg Tyr Leu 180 185
190Ala Glu Pro 19533195PRTSus scrofa 33Met Lys Leu Met Ala Leu Gln
Leu Leu Leu Trp His Ile Ala Leu Trp1 5 10 15Met Val Pro Glu Ala Ala
Pro Leu Ser Pro Ala Ser Ser Leu Pro Gln 20 25 30Ser Phe Leu Leu Lys
Cys Leu Glu Gln Val Arg Lys Ile Gln Ala Asp35 40 45Gly Ala Glu Leu
Gln Glu Arg Leu Cys Ala Thr His Lys Leu Cys His50 55 60Pro Gln Glu
Leu Val Leu Leu Gly His Ser Leu Gly Leu Pro Gln Ala65 70 75 80Ser
Leu Ser Ser Cys Ser Ser Gln Ala Leu Gln Leu Thr Gly Cys Leu 85 90
95Asn Gln Leu His Gly Gly Leu Val Leu Tyr Gln Gly Leu Leu Gln Ala
100 105 110Leu Ala Gly Ile Ser Pro Glu Leu Ala Pro Ala Leu Asp Ile
Leu Gln115 120 125Leu Asp Val Thr Asp Leu Ala Thr Asn Ile Trp Leu
Gln Met Glu Asp130 135 140Leu Arg Met Ala Pro Ala Ser Leu Pro Thr
Gln Gly Thr Val Pro Thr145 150 155 160Phe Thr Ser Ala Phe Gln Arg
Arg Ala Gly Gly Val Leu Val Val Ser 165 170 175Gln Leu Gln Ser Phe
Leu Glu Leu Ala Tyr Arg Val Leu Arg Tyr Leu 180 185 190Ala Glu
Pro19534836PRTHomo sapiens 34Met Ala Arg Leu Gly Asn Cys Ser Leu
Thr Trp Ala Ala Leu Ile Ile1 5 10 15Leu Leu Leu Pro Gly Ser Leu Glu
Glu Cys Gly His Ile Ser Val Ser 20 25 30Ala Pro Ile Val His Leu Gly
Asp Pro Ile Thr Ala Ser Cys Ile Ile 35 40 45Lys Gln Asn Cys Ser His
Leu Asp Pro Glu Pro Gln Ile Leu Trp Arg 50 55 60Leu Gly Ala Glu Leu
Gln Pro Gly Gly Arg Gln Gln Arg Leu Ser Asp65 70 75 80Gly Thr Gln
Glu Ser Ile Ile Thr Leu Pro His Leu Asn His Thr Gln 85 90 95Ala Phe
Leu Ser Cys Cys Leu Asn Trp Gly Asn Ser Leu Gln Ile Leu 100 105
110Asp Gln Val Glu Leu Arg Ala Gly Tyr Pro Pro Ala Ile Pro His Asn
115 120 125Leu Ser Cys Leu Met Asn Leu Thr Thr Ser Ser Leu Ile Cys
Gln Trp 130 135 140Glu Pro Gly Pro Glu Thr His Leu Pro Thr Ser Phe
Thr Leu Lys Ser145 150 155 160Phe Lys Ser Arg Gly Asn Cys Gln Thr
Gln Gly Asp Ser Ile Leu Asp 165 170 175Cys Val Pro Lys Asp Gly Gln
Ser His Cys Cys Ile Pro Arg Lys His 180 185 190Leu Leu Leu Tyr Gln
Asn Met Gly Ile Trp Val Gln Ala Glu Asn Ala 195 200 205Leu Gly Thr
Ser Met Ser Pro Gln Leu Cys Leu Asp Pro Met Asp Val 210 215 220Val
Lys Leu Glu Pro Pro Met Leu Arg Thr Met Asp Pro Ser Pro Glu225 230
235 240Ala Ala Pro Pro Gln Ala Gly Cys Leu Gln Leu Cys Trp Glu Pro
Trp 245 250 255Gln Pro Gly Leu His Ile Asn Gln Lys Cys Glu Leu Arg
His Lys Pro 260 265 270Gln Arg Gly Glu Ala Ser Trp Ala Leu Val Gly
Pro Leu Pro Leu Glu 275 280 285Ala Leu Gln Tyr Glu Leu Cys Gly Leu
Leu Pro Ala Thr Ala Tyr Thr 290 295 300Leu Gln Ile Arg Cys Ile Arg
Trp Pro Leu Pro Gly His Trp Ser Asp305 310 315 320Trp Ser Pro Ser
Leu Glu Leu Arg Thr Thr Glu Arg Ala Pro Thr Val 325 330 335Arg Leu
Asp Thr Trp Trp Arg Gln Arg Gln Leu Asp Pro Arg Thr Val 340 345
350Gln Leu Phe Trp Lys Pro Val Pro Leu Glu Glu Asp Ser Gly Arg Ile
355 360 365Gln Gly Tyr Val Val Ser Trp Arg Pro Ser Gly Gln Ala Gly
Ala Ile 370 375 380Leu Pro Leu Cys Asn Thr Thr Glu Leu Ser Cys Thr
Phe His Leu Pro385 390 395 400Ser Glu Ala Gln Glu Val Ala Leu Val
Ala Tyr Asn Ser Ala Gly Thr 405 410 415Ser Arg Pro Thr Pro Val Val
Phe Ser Glu Ser Arg Gly Pro Ala Leu 420 425 430Thr Arg Leu His Ala
Met Ala Arg Asp Pro His Ser Leu Trp Val Gly 435 440 445Trp Glu Pro
Pro Asn Pro Trp Pro Gln Gly Tyr Val Ile Glu Trp Gly 450 455 460Leu
Gly Pro Pro Ser Ala Ser Asn Ser Asn Lys Thr Trp Arg Met Glu465 470
475 480Gln Asn Gly Arg Ala Thr Gly Phe Leu Leu Lys Glu Asn Ile Arg
Pro 485 490 495Phe Gln Leu Tyr Glu Ile Ile Val Thr Pro Leu Tyr Gln
Asp Thr Met 500 505 510Gly Pro Ser Gln His Val Tyr Ala Tyr Ser Gln
Glu Met Ala Pro Ser 515 520 525His Ala Pro Glu Leu His Leu Lys His
Ile Gly Lys Thr Trp Ala Gln 530 535 540Leu Glu Trp Val Pro Glu Pro
Pro Glu Leu Gly Lys Ser Pro Leu Thr545 550 555 560His Tyr Thr Ile
Phe Trp Thr Asn Ala Gln Asn Gln Ser Phe Ser Ala 565 570 575Ile Leu
Asn Ala Ser Ser Arg Gly Phe Val Leu His Gly Leu Glu Pro 580 585
590Ala Ser Leu Tyr His Ile His Leu Met Ala Ala Ser Gln Ala Gly Ala
595 600 605Thr Asn Ser Thr Val Leu Thr Leu Met Thr Leu Thr Pro Glu
Gly Ser 610 615 620Glu Leu His Ile Ile Leu Gly Leu Phe Gly Leu Leu
Leu Leu Leu Thr625 630 635 640Cys Leu Cys Gly Thr Ala Trp Leu Cys
Cys Ser Pro Asn Arg Lys Asn 645 650 655Pro Leu Trp Pro Ser Val Pro
Asp Pro Ala His Ser Ser Leu Gly Ser 660 665 670Trp Val Pro Thr Ile
Met Glu Glu Asp Ala Phe Gln Leu Pro Gly Leu 675 680 685Gly Thr Pro
Pro Ile Thr Lys Leu Thr Val Leu Glu Glu Asp Glu Lys 690 695 700Lys
Pro Val Pro Trp Glu Ser His Asn Ser Ser Glu Thr Cys Gly Leu705 710
715 720Pro Thr Leu Val Gln Thr Tyr Val Leu Gln Gly Asp Pro Arg Ala
Val 725 730 735Ser Thr Gln Pro Gln Ser Gln Ser Gly Thr Ser Asp Gln
Val Leu Tyr 740 745 750Gly Gln Leu Leu Gly Ser Pro Thr Ser Pro Gly
Pro Gly His Tyr Leu 755 760 765Arg Cys Asp Ser Thr Gln Pro Leu Leu
Ala Gly Leu Thr Pro Ser Pro 770 775 780Lys Ser Tyr Glu Asn Leu Trp
Phe Gln Ala Ser Pro Leu Gly Thr Leu785 790 795 800Val Thr Pro Ala
Pro Ser Gln Glu Asp Asp Cys Val Phe Gly Pro Leu 805 810 815Leu Asn
Phe Pro Leu Leu Gln Gly Ile Arg Val His Gly Met Glu Ala 820 825
830Leu Gly Ser Phe 83535837PRTMus musculus 35Met Val Gly Leu Gly
Ala Cys Thr Leu Thr Gly Val Thr Leu Ile Phe1 5 10 15Leu Leu Leu Pro
Arg Ser Leu Glu Ser Cys Gly His Ile Glu Ile Ser 20 25 30Pro Pro Val
Val Arg Leu Gly Asp Pro Val Leu Ala Ser Cys Thr Ile 35 40 45Ser Pro
Asn Cys Ser Lys Leu Asp Gln Gln Ala Lys Ile Leu Trp Arg 50 55 60Leu
Gln Asp Glu Pro Ile Gln Pro Gly Asp Arg Gln His His Leu Pro65 70 75
80Asp Gly Thr Gln Glu Ser Leu Ile Thr Leu Pro His Leu Asn Tyr Thr
85 90 95Gln Ala Phe Leu Phe Cys Leu Val Pro Trp Glu Asp Ser Val Gln
Leu 100 105 110Leu Asp Gln Ala Glu Leu His Ala Gly Tyr Pro Pro Ala
Ser Pro Ser 115 120 125Asn Leu Ser Cys Leu Met His Leu Thr Thr Asn
Ser Leu Val Cys Gln 130 135 140Trp Glu Pro Gly Pro Glu Thr His Leu
Pro Thr Ser Phe Ile Leu Lys145 150 155 160Ser Phe Arg Ser Arg Ala
Asp Cys Gln Tyr Gln Gly Asp Thr Ile Pro 165 170 175Asp Cys Val Ala
Lys Lys Arg Gln Asn Asn Cys Ser Ile Pro Arg Lys 180 185 190Asn Leu
Leu Leu Tyr Gln Tyr Met Ala Ile Trp Val Gln Ala Glu Asn 195 200
205Met Leu Gly Ser Ser Glu Ser Pro Lys Leu Cys Leu Asp Pro Met Asp
210 215 220Val Val Lys Leu Glu Pro Pro Met Leu Gln Ala Leu Asp Ile
Gly Pro225 230 235 240Asp Val Val Ser His Gln Pro Gly Cys Leu Trp
Leu Ser Trp Lys Pro 245 250 255Trp Lys Pro Ser Glu Tyr Met Glu Gln
Glu Cys Glu Leu Arg Tyr Gln 260 265 270Pro Gln Leu Lys Gly Ala Asn
Trp Thr Leu Val Phe His Leu Pro Ser 275 280 285Ser Lys Asp Gln Phe
Glu Leu Cys Gly Leu His Gln Ala Pro Val Tyr 290 295 300Thr Leu Gln
Met Arg Cys Ile Arg Ser Ser Leu Pro Gly Phe Trp Ser305 310 315
320Pro Trp Ser Pro Gly Leu Gln Leu Arg Pro Thr Met Lys Ala Pro Thr
325 330 335Ile Arg Leu Asp Thr Trp Cys Gln Lys Lys Gln Leu Asp Pro
Gly Thr 340 345 350Val Ser Val Gln Leu Phe Trp Lys Pro Thr Pro Leu
Gln Glu Asp Ser 355 360 365Gly Gln Ile Gln Gly Tyr Leu Leu Ser Trp
Asn Ser Pro Asp His Gln 370 375 380Gly Gln Asp Ile His Leu Cys Asn
Thr Thr Gln Leu Ser Cys Ile Phe385 390 395 400Leu Leu Pro Ser Glu
Ala Gln Asn Val Thr Leu Val Ala Tyr Asn Lys 405 410 415Ala Gly Thr
Ser Ser Pro Thr Thr Val Val Phe Leu Glu Asn Glu Gly 420 425 430Pro
Ala Val Thr Gly Leu His Ala Met Ala Gln Asp Leu Asn Thr Ile 435 440
445Trp Val Asp Trp Glu Ala Pro Ser Leu Leu Pro Gln Gly Tyr Leu Ile
450 455 460Glu Trp Glu Met Ser Ser Pro Ser Tyr Asn Asn Ser Tyr Lys
Ser Trp465 470 475 480Met Ile Glu Pro Asn Gly Asn Ile Thr Gly Ile
Leu Leu Lys Asp Asn 485 490 495Ile Asn Pro Phe Gln Leu Tyr Arg Ile
Thr Val Ala Pro Leu Tyr Pro 500 505 510Gly Ile Val Gly Pro Pro Val
Asn Val Tyr Thr Phe Ala Gly Glu Arg 515 520 525Ala Pro Pro His Ala
Pro Ala Leu His Leu Lys His Val Gly Thr Thr 530 535 540Trp Ala Gln
Leu Glu Trp Val Pro Glu Ala Pro Arg Leu Gly Met Ile545 550 555
560Pro Leu Thr His Tyr Thr Ile Phe Trp Ala Asp Ala Gly Asp His Ser
565 570 575Phe Ser Val Thr Leu Asn Ile Ser Leu His Asp Phe Val Leu
Lys His 580 585 590Leu Glu Pro Ala Ser Leu Tyr His Val Tyr Leu Met
Ala Thr Ser Arg 595 600 605Ala Gly Ser Thr Asn Ser Thr Gly Leu Thr
Leu Arg Thr Leu Asp Pro 610 615 620Ser Asp Leu Asn Ile Phe Leu Gly
Ile Leu Cys Leu Val Leu Leu Ser625 630 635 640Thr Thr Cys Val Val
Thr Trp Leu Cys Cys Lys Arg Arg Gly Lys Thr 645 650 655Ser Phe Trp
Ser Asp Val Pro Asp Pro Ala His Ser Ser Leu Ser Ser 660 665 670Trp
Leu Pro Thr Ile Met Thr Glu Glu Thr Phe Gln Leu Pro Ser Phe 675 680
685Trp Asp Ser Ser Val Pro Ser Ile Thr Lys Ile Thr Glu Leu Glu Glu
690 695 700Asp Lys Lys Pro Thr His Trp Asp Ser Glu Ser Ser Gly Asn
Gly Ser705 710 715 720Leu Pro Ala Leu Val Gln Ala Tyr Val Leu Gln
Gly Asp Pro Arg Glu 725 730 735Ile Ser Asn Gln Ser Gln Pro Pro Ser
Arg Thr Gly Asp Gln Val Leu 740 745 750Tyr Gly Gln Val Leu Glu Ser
Pro Thr Ser Pro Gly Val Met Gln Tyr 755 760 765Ile Arg Ser Asp Ser
Thr Gln Pro Leu Leu Gly Gly Pro Thr Pro Ser 770 775 780Pro Lys Ser
Tyr Glu Asn Ile Trp Phe His Ser Arg Pro Gln Glu Thr785 790 795
800Phe Val Pro Gln Pro Pro Asn Gln Glu Asp Asp Cys Val Phe Gly Pro
805 810 815Pro Phe Asp Phe Pro Leu Phe Gln Gly Leu Gln Val His Gly
Val Glu 820 825 830Glu Gln Gly Gly Phe 83536112PRTRattus rattus
36Leu Glu Gly Cys Gly Gln Ile Arg Ile Ser Pro Pro Ile Val His Leu1
5 10 15Gly Asp Pro Val Leu Ala Ser Cys Thr Ile Ser Pro Asn Cys Ser
Lys 20 25 30Leu Asp Arg Gln Pro Lys Ile Leu Trp Arg Leu Gln Asp Glu
Pro Asn35 40 45Gln Pro Gly Asp Arg Gln His His Leu Pro Asp Gly Ser
Gln Glu Ser50 55 60Ile Ile Thr Leu Pro His Leu Asn Tyr Thr Gln Ala
Phe Leu Phe Cys65 70 75 80Leu Val Pro Trp Asn Asn Ser Phe Gln Val
Leu Asp Gln Ala Glu Leu 85 90 95Arg Ala Gly Cys Lys Ser Leu Gln Pro
Pro Thr His Leu Leu Gln Cys 100 105 11037174PRTHomo sapiens 37Thr
Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys1 5 10
15Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln
20 25 30Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu
Val 35 40 45Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser
Ser Cys 50 55 60Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln
Leu His Ser65 70 75 80Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala
Leu Glu Gly Ile Ser 85 90 95Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu
Gln Leu Asp Val Ala Asp 100 105 110Phe Ala Thr Thr Ile Trp Gln Gln
Met Glu Glu Leu Gly Met Ala Pro 115 120 125Ala Leu Gln Pro Thr Gln
Gly Ala Met Pro Ala Phe Ala Ser Ala Phe 130 135 140Gln Arg Arg Ala
Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe145 150 155 160Leu
Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 165
17038175PRTHomo sapiens 38Met Thr Pro Leu Gly Pro Ala Ser Ser Leu
Pro Gln Ser Phe Leu Leu1 5 10 15Lys Cys Leu Glu Gln Val Arg Lys Ile
Gln Gly Asp Gly Ala Ala Leu 20 25 30Gln Glu Lys Leu Cys Ala Thr Tyr
Lys Leu Cys His Pro Glu Glu Leu 35 40 45Val Leu Leu Gly His Ser Leu
Gly Ile Pro Trp Ala Pro Leu Ser Ser 50 55 60Cys Pro Ser Gln Ala Leu
Gln Leu Ala Gly Cys Leu Ser Gln Leu His65 70 75 80Ser Gly Leu Phe
Leu Tyr Gln Gly Leu Leu Gln
Ala Leu Glu Gly Ile 85 90 95Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr
Leu Gln Leu Asp Val Ala 100 105 110Asp Phe Ala Thr Thr Ile Trp Gln
Gln Met Glu Glu Leu Gly Met Ala 115 120 125Pro Ala Leu Gln Pro Thr
Gln Gly Ala Met Pro Ala Phe Ala Ser Ala 130 135 140Phe Gln Arg Arg
Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser145 150 155 160Phe
Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 165 170
17539177PRTHomo sapiens 39Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro
Gln Ser Phe Leu Leu Lys1 5 10 15Cys Leu Glu Gln Val Arg Lys Ile Gln
Gly Asp Gly Ala Ala Leu Gln 20 25 30Glu Lys Leu Val Ser Glu Cys Ala
Thr Tyr Lys Leu Cys His Pro Glu 35 40 45Glu Leu Val Leu Leu Gly His
Ser Leu Gly Ile Pro Trp Ala Pro Leu 50 55 60Ser Ser Cys Pro Ser Gln
Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln65 70 75 80Leu His Ser Gly
Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu 85 90 95Gly Ile Ser
Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp 100 105 110Val
Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly 115 120
125Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala
130 135 140Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser
His Leu145 150 155 160Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu
Arg His Leu Ala Gln 165 170 175Pro401155DNARattus rattus
40atgagcatca ttcccctgcc tcagctcctc gccctgctct gctgctgcgg acttgctgct
60gctactcagg gccccacaga cccgtccacg ccccctaacc tgggcctcgc ccacttccac
120aacctgacct tcgaccccgg gacctggaca ctgagctggg cctgtggcgg
ccatgatggg 180gcagtgatgt cgtgcacggt gattgaccag gaggcaggga
tccggcgcag agtgcggtcc 240cggggctgcc gctgccggtt tcagccaatg
gagttacacc gcggggtcga cctggaggtt 300gcgggggaca aaggccatgc
ccaagtccat cagactctgc gcttcgagaa tgaaggtgcc 360ccaggctccg
gggcagagaa cctgacctgt gagatccttg ctgcccactt cctgtgctgt
420tattgggcgg tggggccggc tgcacccgat gacatcagat actcactgcg
cgtgctcaac 480gccactggtc atgaggtcgc cagctgctcc gctgcccccg
gaaccccacc cacgcgttgc 540caggctgatg atctcacaca tctgccccgc
ctcgcataca tcgtcgtcac tgggcagagc 600cggacggggc tggtgcggtt
cctggatgcc gtggtcaaca ccaagggcat tgagcgcctg 660ggtcccccag
ataacgtctc tgcctcctgt aacttctccc actgcaccat cacctgggct
720ccgcccccta cctgggcgcc tatgacggaa caggatttcc gctttgagat
cgagtggaag 780aaggcggagc ccagcagcat tgcccagaag gtggttatcg
cagggcgcga ggacaacgcc 840ttcgccttcc ccagccccgc cccccgtggc
cgcctctggg tcagagttcg tgcaggggac 900acacgcagtg atcggtggag
cgactggagc cccgccctgg agctcggctc ggaggccaca 960accccgccgc
gggccctggt gttggcggcg tcgagctgtg cagccctgct gtgtgcgctg
1020gcactggggg cggcctgcag gagactcgcg ctctcacgcc gcctcctccc
ccccatcccc 1080gggatccggg accgcgtatc tgatgacgag cgtgtcaact
cggagacgct gaggaaggac 1140ctgctgcggc cctag 115541384PRTRattus
rattus 41Met Ser Ile Ile Pro Leu Pro Gln Leu Leu Ala Leu Leu Cys
Cys Cys1 5 10 15Gly Leu Ala Ala Ala Thr Gln Gly Pro Thr Asp Pro Ser
Thr Pro Pro 20 25 30Asn Leu Gly Leu Ala His Phe His Asn Leu Thr Phe
Asp Pro Gly Thr 35 40 45Trp Thr Leu Ser Trp Ala Cys Gly Gly His Asp
Gly Ala Val Met Ser 50 55 60Cys Thr Val Ile Asp Gln Glu Ala Gly Ile
Arg Arg Arg Val Arg Ser65 70 75 80Arg Gly Cys Arg Cys Arg Phe Gln
Pro Met Glu Leu His Arg Gly Val 85 90 95Asp Leu Glu Val Ala Gly Asp
Lys Gly His Ala Gln Val His Gln Thr 100 105 110Leu Arg Phe Glu Asn
Glu Gly Ala Pro Gly Ser Gly Ala Glu Asn Leu 115 120 125Thr Cys Glu
Ile Leu Ala Ala His Phe Leu Cys Cys Tyr Trp Ala Val 130 135 140Gly
Pro Ala Ala Pro Asp Asp Ile Arg Tyr Ser Leu Arg Val Leu Asn145 150
155 160Ala Thr Gly His Glu Val Ala Ser Cys Ser Ala Ala Pro Gly Thr
Pro 165 170 175Pro Thr Arg Cys Gln Ala Asp Asp Leu Thr His Leu Pro
Arg Leu Ala 180 185 190Tyr Ile Val Val Thr Gly Gln Ser Arg Thr Gly
Leu Val Arg Phe Leu 195 200 205Asp Ala Val Val Asn Thr Lys Gly Ile
Glu Arg Leu Gly Pro Pro Asp 210 215 220Asn Val Ser Ala Ser Cys Asn
Phe Ser His Cys Thr Ile Thr Trp Ala225 230 235 240Pro Pro Pro Thr
Trp Ala Pro Met Thr Glu Gln Asp Phe Arg Phe Glu 245 250 255Ile Glu
Trp Lys Lys Ala Glu Pro Ser Ser Ile Ala Gln Lys Val Val 260 265
270Ile Ala Gly Arg Glu Asp Asn Ala Phe Ala Phe Pro Ser Pro Ala Pro
275 280 285Arg Gly Arg Leu Trp Val Arg Val Arg Ala Gly Asp Thr Arg
Ser Asp 290 295 300Arg Trp Ser Asp Trp Ser Pro Ala Leu Glu Leu Gly
Ser Glu Ala Thr305 310 315 320Thr Pro Pro Arg Ala Leu Val Leu Ala
Ala Ser Ser Cys Ala Ala Leu 325 330 335Leu Cys Ala Leu Ala Leu Gly
Ala Ala Cys Arg Arg Leu Ala Leu Ser 340 345 350Arg Arg Leu Leu Pro
Pro Ile Pro Gly Ile Arg Asp Arg Val Ser Asp 355 360 365Asp Glu Arg
Val Asn Ser Glu Thr Leu Arg Lys Asp Leu Leu Arg Pro 370 375
3804221DNAArtificial Sequencesynthetic oligonucleotide 42ccattgtcca
tcttggggat c 214321DNAArtificial Sequencesynthetic oligonucleotide
43cctggaagct gttgttccat g 214424DNAArtificial Sequencesynthetic
oligonucleotide 44cacagcgggc tcttcctcta ccaa 244524DNAArtificial
Sequencesynthetic oligonucleotide 45agcagcggca ggaatcaata ctcg
244620DNAArtificial Sequencesynthetic oligonucleotide 46accccaccgt
gttcttcgac 204720DNAArtificial Sequencesynthetic oligonucleotide
47catttgccat ggacaagatg 204820DNAArtificial Sequencesynthetic
oligonucleotide 48aggaagaagc tgcagcagag 204920DNAArtificial
Sequencesynthetic oligonucleotide 49ttcacctgct tgggctctat
205020DNAArtificial Sequencesynthetic oligonucleotide 50ggcaaggatg
ccactaatgt 205120DNAArtificial Sequencesynthetic oligonucleotide
51agggtcagca ggagacttga 205223DNAArtificial Sequencesynthetic
oligonucleotide 52ccacctacgg ggacctcaac cac 235321DNAArtificial
Sequencesynthetic oligonucleotide 53gacatgcgcc cacggaagac g
215421DNAArtificial Sequencesynthetic oligonucleotide 54tcattctttg
gagcgggtgt g 215524DNAArtificial Sequencesynthetic oligonucleotide
55taaggacggc aaagttgtaa gtgg 245622DNAArtificial Sequencesynthetic
oligonucleotide 56cctttcttat gcatgtacgg ag 225722DNAArtificial
Sequencesynthetic oligonucleotide 57gtacactaat acgaaggcac tc
225820DNAArtificial Sequencesynthetic oligonucleotide 58accccaccgt
gttcttcgac 205920DNAArtificial Sequencesynthetic oligonucleotide
59catttgccat ggacaagatg 206022DNAArtificial Sequencesynthetic
oligonucleotide 60acgtcgttgg ctcagttatg tc 226124DNAArtificial
Sequencesynthetic oligonucleotide 61atttatgtca gagatggagg atgg
246221DNAArtificial Sequencesynthetic oligonucleotide 62ggagctctaa
gcttctagat c 216321DNAArtificial Sequencesynthetic oligonucleotide
63ggctcaatgt gatttcttgg g 2164175PRTHomo sapiens 64Met Thr Pro Leu
Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu1 5 10 15Lys Cys Leu
Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu 20 25 30Gln Glu
Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu 35 40 45Val
Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 50 55
60Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His65
70 75 80Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly
Ile 85 90 95Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp
Val Ala 100 105 110Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu
Leu Gly Met Ala 115 120 125Pro Ala Leu Gln Pro Thr Gln Gly Ala Met
Pro Ala Phe Ala Ser Ala 130 135 140Phe Gln Arg Arg Ala Gly Gly Val
Leu Val Ala Ser His Leu Gln Ser145 150 155 160Phe Leu Glu Val Ser
Tyr Arg Val Leu Arg His Leu Ala Gln Pro 165 170 17565174PRTHomo
sapiens 65Ala Pro Thr Thr Arg Ala Ser Ser Leu Pro Gln Ser Phe Leu
Leu Lys1 5 10 15Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala
Ala Leu Gln 20 25 30Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro
Glu Glu Leu Val 35 40 45Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala
Pro Leu Ser Ser Cys 50 55 60Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys
Leu Ser Gln Leu His Ser65 70 75 80Gly Leu Phe Leu Tyr Gln Gly Leu
Leu Gln Ala Leu Glu Gly Ile Ser 85 90 95Pro Glu Leu Gly Pro Thr Leu
Asp Thr Leu Gln Leu Asp Val Ala Asp 100 105 110Phe Ala Thr Thr Ile
Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro 115 120 125Ala Leu Gln
Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe 130 135 140Gln
Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser Phe145 150
155 160Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 165
1706622DNAArtificial Sequencesynthetic oligonucleotide 66gctgtgtctg
ggccattgct at 226724DNAArtificial Sequencesynthetic oligonucleotide
67ctcttcgcca cacttctctt tttg 2468551DNAHomo sapiens 68ccacgaagga
ccagaacaag acagagtgct tcctgccgat ccaaacatga gccgcctgcc 60cgtcctgctc
ctgctccaac tcctggtccg ccccggactc caagctccca tgacccagac
120aacgtccttg aagacaagct gggttaactg ctctaacatg atcgatgaaa
ttataacacg 180cttaaagcag ccacctttgc ctttgctgga cttcaacaac
ctcaatgggg aagaccaaga 240cattctgatg gaaaataacc ttcgaaggcc
aaacctggag gcattcaaca gggctgtcaa 300gagtttacag aacgcatcag
caattgagag cattcttaaa aatctcctgc catgtctgcc 360cctggccacg
gccgcaccca cgcgacatcc aatccatatc aaggacggtg actggaatga
420attccggagg aaactgacgt tctatctgaa aacccttgag aatgcgcagg
ctcaacagac 480gactttgagc ctcgcgatct tttgagtcca acgtccagct
cgttctctgg gccttctcac 540cacagagcct c 55169152PRTHomo sapiens 69Met
Ser Arg Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10
15Gly Leu Gln Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp
20 25 30Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr Arg Leu Lys
Gln 35 40 45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu
Asp Gln 50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu
Glu Ala Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Ala Ile Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu
Ala Thr Ala Ala Pro Thr 100 105 110Arg His Pro Ile His Ile Lys Asp
Gly Asp Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu
Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser
Leu Ala Ile Phe145 15070551DNAHomo sapiens 70ccacgaagga ccagaacaag
acagagtgcc tcctgccgat ccaaacatga gccgcctgcc 60cgtcctgctc ctgctccaac
tcctggtccg ccccggactc caagctccca tgacccagac 120aacgtccttg
aagacaagct gggttaactg ctctaacatg atcgatgaaa ttataacaca
180cttaaagcag ccacctttgc ctttgctgga cttcaacaac ctcaatgggg
aagaccaaga 240cattctgatg gaaaataacc ttcgaaggcc aaacctggag
gcattcaaca gggctgtcaa 300gagtttacag aacgcatcag caattgagag
cattcttaaa aatctcctgc catgtctgcc 360cctggccacg gccgcaccca
cgcgacatcc aatccatatc aaggacggtg actggaatga 420attccggagg
aaactgacgt tctatctgaa aacccttgag aatgcgcagg ctcaacagac
480gactttgagc ctcgcgatct tttgagtcca acgtccagct cgttctctgg
gccttctcac 540cacagagcct c 55171152PRTHomo sapiens 71Met Ser Arg
Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10 15Gly Leu
Gln Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp 20 25 30Val
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln 35 40
45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala
Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr 100 105 110Arg His Pro Ile His Ile Lys Asp Gly Asp
Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu Lys Thr
Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser Leu Ala
Ile Phe145 15072551DNAHomo sapiens 72ccacgaagga ccagaacaag
acagagtgcc tcctgccgat ccaaacatga gccgcctgcc 60cgtcctgctc ctgctccaac
tcctggtccg ccccggactc caagctccca tgacccagac 120aacgtccttg
aagacaagct gggttaactg ctctaacatg atcgatgaaa ttataacaca
180cttaaagcag ccacctttgc ctttgctgga cttcaacaac ctcaatgggg
aagaccaaga 240cattctgatg gaaaataacc ttcgaaggcc aaacctggag
gcattcaaca gggctgtcaa 300gagtttacag aacgcatcag caattgagag
cattcttaaa aatctcctgc catgtctgcc 360cctggccacg gccgcaccca
cgcgacatcc aatccatatc aaggacggtg actggaatga 420attccggagg
aaactgacgt tctatctgaa aacccttgag aatgcgcagg ctcaacagac
480gactttgagc ctcgcgatct tttgagtcca acgtccagct cgttctctgg
gccttctcac 540cacagagcct c 55173152PRTHomo sapiens 73Met Ser Arg
Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10 15Gly Leu
Gln Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp 20 25 30Val
Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln 35 40
45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln
50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala
Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile
Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr
Ala Ala Pro Thr 100 105 110Arg His Pro Ile His Ile Lys Asp Gly Asp
Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu Lys Thr
Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser Leu Ala
Ile Phe145 15074551DNAHomo sapiens 74ccacgaagga ccagaacaag
acagagtgcc tcctgccgat ccaaacatga gccgcctgcc 60cgtcctgctc ctgctccaac
tcctggtccg ccccggactc caagctccca tgacccagac 120aacgtccttg
aagacaagct gggttaactg ctctaacatg atcgatgaaa ttataacaca
180cttaaagcag ccacctttgc ctttgctgga cttcaacaac
ctcaatgggg aagaccaaga 240cattctgatg gaaaataacc ttcgaaggcc
aaacctggag gcattcaaca gggctgtcaa 300gagtttacag aacgcatcag
caattgagag cattcttaaa aatctcctgc catgtctgcc 360cctggccacg
gccgcaccca cgcgacatcc aatccatatc aaggacggtg actggaatga
420attccggagg aaactgacgt tctatctgaa aacccttgag aatgcgcagg
ctcaacagac 480gactttgagc ctcgcgatct tttgagtcca acgtccagct
cgttctctgg gccttctcac 540cacagagcct c 55175152PRTHomo sapiens 75Met
Ser Arg Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10
15Gly Leu Gln Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp
20 25 30Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys
Gln 35 40 45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu
Asp Gln 50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu
Glu Ala Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser
Ala Ile Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu
Ala Thr Ala Ala Pro Thr 100 105 110Arg His Pro Ile His Ile Lys Asp
Gly Asp Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu
Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser
Leu Ala Ile Phe145 15076557DNAHomo sapiens 76gccccacgaa ggaccagaac
aagacagagt gcctcctgcc gatccaaaca tgagccgcct 60gcccgtcctg ctcctgctcc
aactcctggt ccgccccgga ctccaagctc ccatgaccca 120gacaacgccc
ttgaagacaa gctgggttaa ctgctctaac atgatcgatg aaattataac
180acacttaaag cagccacctt tgcctttgct ggacttcaac aacctcaatg
gggaagacca 240agacattctg atggaaaata accttcgaag gccaaacctg
gaggcattca acagggctgt 300caagagttta cagaacgcat cagcaattga
gagcattctt aaaaatctcc tgccatgtct 360gcccctggcc acggccgcac
ccacgcgaca tccaatccat atcaaggacg gtgactggaa 420tgaattccgg
aggaaactga cgttctatct gaaaaccctt gagaatgcgc aggctcaaca
480gacgactttg agcctcgcga tcttttgagt ccaacgtcca gctcgttctc
tgggccttct 540caccacagag cctcggg 55777152PRTHomo sapiens 77Met Ser
Arg Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10 15Gly
Leu Gln Ala Pro Met Thr Gln Thr Thr Pro Leu Lys Thr Ser Trp 20 25
30Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln
35 40 45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp
Gln 50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu
Ala Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala
Ile Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala
Thr Ala Ala Pro Thr 100 105 110Arg His Pro Ile His Ile Lys Asp Gly
Asp Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu Lys
Thr Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser Leu
Ala Ile Phe145 15078924DNAHomo sapiens 78cagagcccca cgaaggacca
gaacaagaca gagtgcctcc tgccgatcca aacatgagcc 60gcctgcccgt cctgctcctg
ctccaactcc tggtccgccc cggactccaa gctcccatga 120cccagacaac
gcccttgaag acaagctggg ttaactgctc taacatgatc gatgaaatta
180taacacactt aaagcagcca cctttgcctt tgctggactt caacaacctc
aatggggaag 240accaagacat tctgatggaa aataaccttc gaaggccaaa
cctggaggca ttcaacaggg 300ctgtcaagag tttacagaac gcatcagcaa
ttgagagcat tcttaaaaat ctcctgccat 360gtctgcccct ggccacggcc
gcacccacgc gacatccaat ccatatcaag gacggtgact 420ggaatgaatt
ccggaggaaa ctgacgttct atctgaaaac ccttgagaat gcgcaggctc
480aacagacgac tttgagcctc gcgatctttt gagtccaacg tccagctcgt
tctctgggcc 540ttctcaccac agagcctcgg gacatcaaaa acagcagaac
ttctgaaacc tctgggtcat 600ctctcacaca ttccaggacc agaagcattt
caccttttcc tgcggcatca gatgaattgt 660taattatcta atttctgaaa
tgtgcagctc ccatttggcc ttgtgcggtt gtgttctcat 720ttttatccca
ttgagactat ttatttatgt atgtatgtat ttatttattt attgcctgga
780gtgtgaactg tatttatttt agcagaggag ccatgtcctg ctgcttctgc
aaaaaactca 840gagtggggtg gggagcatgt tcatttgtac ctcgagtttt
aaactggttc ctagggatgt 900gtgagaataa actagactct gaac 92479152PRTHomo
sapiens 79Met Ser Arg Leu Pro Val Leu Leu Leu Leu Gln Leu Leu Val
Arg Pro1 5 10 15Gly Leu Gln Ala Pro Met Thr Gln Thr Thr Pro Leu Lys
Thr Ser Trp 20 25 30Val Asn Cys Ser Asn Met Ile Asp Glu Ile Ile Thr
His Leu Lys Gln 35 40 45Pro Pro Leu Pro Leu Leu Asp Phe Asn Asn Leu
Asn Gly Glu Asp Gln 50 55 60Asp Ile Leu Met Glu Asn Asn Leu Arg Arg
Pro Asn Leu Glu Ala Phe65 70 75 80Asn Arg Ala Val Lys Ser Leu Gln
Asn Ala Ser Ala Ile Glu Ser Ile 85 90 95Leu Lys Asn Leu Leu Pro Cys
Leu Pro Leu Ala Thr Ala Ala Pro Thr 100 105 110Arg His Pro Ile His
Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg 115 120 125Lys Leu Thr
Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln 130 135 140Thr
Thr Leu Ser Leu Ala Ile Phe145 15080923DNAHomo sapiens 80cagagcccca
cgaaggacca gaacaagaca gagtgcctcc tgccgatcca aacatgagcc 60gcctgcccgt
cctgctcctg ctccaactcc tggtccgccc cggactccaa gctcccatga
120cccagacaac gcccttgaag acaagctggg ttaactgctc taacatgatc
gatgaaatta 180taacacactt aaagcagcca cctttgcctt tgctggactt
caacaacctc aatggggaag 240accaagacat tctgatggaa aataaccttc
gaaggccaaa cctggaggca ttcaacaggg 300ctgtcaagag tttacagaac
gcatcagcaa ttgagagcat tcttaaaaat ctcctgccat 360gtctgcccct
ggccacggcc gcacccacgc gacatccaat ccatatcaag gacggtgact
420ggaatgaatt ccggaggaaa ctgacgttct atctgaaaac ccttgagaat
gcgcaggctc 480aacagacgac tttgagcctc gcgatctttt agtccaacgt
ccagctcgtt ctctgggcct 540tctcaccaca gagcctcggg acatcaaaaa
cagcagaact tctgaaacct ctgggtcatc 600tctcacacat tccaggacca
gaagcatttc accttttcct gcggcatcag atgaattgtt 660aattatctaa
tttctgaaat gtgcagctcc catttggcct tgtgcggttg tgttctcatt
720tttatcccat tgagactatt tatttatgta tgtatgtatt tatttattta
ttgcctggag 780tgtgaactgt atttatttta gcagaggagc catgtcctgc
tgcttctgca aaaaactcag 840agtggggtgg ggagcatgtt catttgtacc
tcgagtttta aactggttcc tagggatgtg 900tgagaataaa ctagactctg aac
92381152PRTHomo sapiens 81Met Ser Arg Leu Pro Val Leu Leu Leu Leu
Gln Leu Leu Val Arg Pro1 5 10 15Gly Leu Gln Ala Pro Met Thr Gln Thr
Thr Pro Leu Lys Thr Ser Trp 20 25 30Val Asn Cys Ser Asn Met Ile Asp
Glu Ile Ile Thr His Leu Lys Gln 35 40 45Pro Pro Leu Pro Leu Leu Asp
Phe Asn Asn Leu Asn Gly Glu Asp Gln 50 55 60Asp Ile Leu Met Glu Asn
Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe65 70 75 80Asn Arg Ala Val
Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile 85 90 95Leu Lys Asn
Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro Thr 100 105 110Arg
His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg Arg 115 120
125Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn Ala Gln Ala Gln Gln
130 135 140Thr Thr Leu Ser Leu Ala Ile Phe145 15082674DNAHomo
sapiens 82gatccaaaca tgagccgcct gcccgtcctg ctcctgctcc aactcctggt
ccgccccgga 60ctccaagctc ccatgaccca gacaacgtcc ttgaagacaa gctgggttaa
ctgctctaac 120atgatcgatg aaattataac acacttaaag cagccacctt
tgcctttgct ggacttcaac 180aacctcaatg gggaagacca agacattctg
atggaaaata accttcgaag gccaaacctg 240gaggcattca acagggctgt
caagagttta cagaacgcat cagcaattga gagcattctt 300aaaaatctcc
tgccatgtct gcccctggcc acggccgcac ccacgcgaca tccaatccat
360atcaaggacg gtgactggaa tgaattccgg aggaaactga cgttctatct
gaaaaccctt 420gagaatgcgc aggctcaaca gacgactttg agcctcgcga
tcttttagtc caacgtccag 480ctcgttctct gggccttctc accacagcgc
ctcgggacat caaaaacagc agaacttctg 540aaacctctgg gtcatctctc
acacattcca ggaccagaag catttcacct tttcctgcgg 600catcagatga
attgttaatt atctaatttc tgaaatgtgc agctcccatt tggccttgtg
660cggttgtgtt ctca 67483152PRTHomo sapiens 83Met Ser Arg Leu Pro
Val Leu Leu Leu Leu Gln Leu Leu Val Arg Pro1 5 10 15Gly Leu Gln Ala
Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser Trp 20 25 30Val Asn Cys
Ser Asn Met Ile Asp Glu Ile Ile Thr His Leu Lys Gln 35 40 45Pro Pro
Leu Pro Leu Leu Asp Phe Asn Asn Leu Asn Gly Glu Asp Gln 50 55 60Asp
Ile Leu Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala Phe65 70 75
80Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser Ala Ile Glu Ser Ile
85 90 95Leu Lys Asn Leu Leu Pro Cys Leu Pro Leu Ala Thr Ala Ala Pro
Thr 100 105 110Arg His Pro Ile His Ile Lys Asp Gly Asp Trp Asn Glu
Phe Arg Arg 115 120 125Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn
Ala Gln Ala Gln Gln 130 135 140Thr Thr Leu Ser Leu Ala Ile Phe145
15084490DNAHomo sapiens 84gatccaaaca tgagccgcct gcccgtcctg
ctcctgctcc aactcctggt ccgccccgga 60ctccaagcgc ccatgaccca gacaacgtcc
ttgaagacaa gctgggttaa ctgctctaac 120atgatcgatg aaattataac
acacttaaag cagccacctt tgcctttgct ggacttcaac 180aacctcaatg
gggaagacca agacattctg atggaaaata accttcgaag gccaaacctg
240gaggcattca acagggctgt caagagttta cagaacgcat cagcaattga
gagcattctt 300aaaaatctcc tgccatgtct gcccctcgcc acggccgcac
ccacgcgaca tccaatccat 360atcaaggacg gtgactggaa tgagttccgg
aggaaactga cgttctatct gaaaaccctt 420gagaatgcgc aggctcaaca
gacgactttg agcctcgcga tcttttagtc caacgtccag 480ctcgagctcg
49085459DNAHomo sapiens 85caaacgcaga acgtttcaga gccatgagga
tgcttctgca tttgagtttg ctagctcttg 60gagctgccta cgtgtatgcc atccccacag
aaattcccac aagtgcattg gtgaaagaga 120ccttggcact gctttctact
catcgaactc tgctgatagc caatgagact ctgaggattc 180ctgttcctgt
acataaaaat caccaactgt gcactgaaga aatctttcag ggaataggca
240cactggagag tcaaactgtg caagggggta ctgtggaaag actattcaaa
aacttgtcct 300taataaagaa atacattgac ggccaaaaaa aaaagtgtgg
agaagaaaga cggagagtaa 360accaattcct agactacctg caagagtttc
ttggtgtaat gaacaccgag tggataatag 420aaagttgaga ctaaactggt
tgttgcagcc aaagataac 45986134PRTHomo sapiens 86Met Arg Met Leu Leu
His Leu Ser Leu Leu Ala Leu Gly Ala Ala Tyr1 5 10 15Val Tyr Ala Ile
Pro Thr Glu Ile Pro Thr Ser Ala Leu Val Lys Glu 20 25 30Thr Leu Ala
Leu Leu Ser Thr His Arg Thr Leu Leu Ile Ala Asn Glu 35 40 45Thr Leu
Arg Ile Pro Val Pro Val His Lys Asn His Gln Leu Cys Thr 50 55 60Glu
Glu Ile Phe Gln Gly Ile Gly Thr Leu Glu Ser Gln Thr Val Gln65 70 75
80Gly Gly Thr Val Glu Arg Leu Phe Lys Asn Leu Ser Leu Ile Lys Lys
85 90 95Tyr Ile Asp Gly Gln Lys Lys Lys Cys Gly Glu Glu Arg Arg Arg
Val 100 105 110Asn Gln Phe Leu Asp Tyr Leu Gln Glu Phe Leu Gly Val
Met Asn Thr 115 120 125Glu Trp Ile Ile Glu Ser 13087816DNAHomo
sapiens 87atgcactttc tttgccaaag gcaaacgcag aacgtttcag agccatgagg
atgcttctgc 60atttgagttt gctagctctt ggagctgcct acgtgtatgc catccccaca
gaaattccca 120caagtgcatt ggtgaaagag accttggcac tgctttctac
tcatcgaact ctgctgatag 180ccaatgagac tctgaggatt cctgttcctg
tacataaaaa tcaccaactg tgcactgaag 240aaatctttca gggaataggc
acactggaga gtcaaactgt gcaagggggt actgtggaaa 300gactattcaa
aaacttgtcc ttaataaaga aatacattga cggccaaaaa aaaaagtgtg
360gagaagaaag acggagagta aaccaattcc tagactacct gcaagagttt
cttggtgtaa 420tgaacaccga gtggataata gaaagttgag actaaactgg
tttgttgcag ccaaagattt 480tggaggagaa ggacatttta ctgcagtgag
aatgagggcc aagaaagagt caggccttaa 540ttttcagtat aatttaactt
cagagggaaa gtaaatattt caggcatact gacactttgc 600cagaaagcat
aaaattctta aaatatattt cagatatcag aatcattgaa gtattttcct
660ccaggcaaaa ttgatatact tttttcttat ttaacttaac attctgtaaa
atgtctgtta 720acttaatagt atttatgaaa tggttaagaa tttggtaaat
tagtatttat ttaatgttat 780gttgtgttct aataaaacaa aaatagacaa ctgttc
81688134PRTHomo sapiens 88Met Arg Met Leu Leu His Leu Ser Leu Leu
Ala Leu Gly Ala Ala Tyr1 5 10 15Val Tyr Ala Ile Pro Thr Glu Ile Pro
Thr Ser Ala Leu Val Lys Glu 20 25 30Thr Leu Ala Leu Leu Ser Thr His
Arg Thr Leu Leu Ile Ala Asn Glu 35 40 45Thr Leu Arg Ile Pro Val Pro
Val His Lys Asn His Gln Leu Cys Thr 50 55 60Glu Glu Ile Phe Gln Gly
Ile Gly Thr Leu Glu Ser Gln Thr Val Gln65 70 75 80Gly Gly Thr Val
Glu Arg Leu Phe Lys Asn Leu Ser Leu Ile Lys Lys 85 90 95Tyr Ile Asp
Gly Gln Lys Lys Lys Cys Gly Glu Glu Arg Arg Arg Val 100 105 110Asn
Gln Phe Leu Asp Tyr Leu Gln Glu Phe Leu Gly Val Met Asn Thr 115 120
125Glu Trp Ile Ile Glu Ser 130893230DNAHomo sapiens 89atcctaatca
agaccccagt gaacagaact cgaccctgcc aaggcttggc atttccattt 60caatcactgt
cttcccacca gtattttcaa tttcttttaa gacagattaa tctagccaca
120gtcatagtag aacatagccg atcttgaaaa aaaacattcc caatatttat
gtattttagc 180ataaaattct gtttagtggt ctaccttata ctttgttttg
cacacatctt ttaagaggaa 240gttaattttc tgattttaag aaatgcaaat
gtggggcaat gatgtattaa cccaaagatt 300ccttccgtaa tagaaaatgt
ttttaaaggg gggaaacagg gatttttatt attaaaagat 360aaaagtaaat
ttatttttta agatataagg cattggaaac atttagtttc acgatatgcc
420attattaggc attctctatc tgattgttag aaattattca tttcctcaaa
gacagacaat 480aaattgactg gggacgcagt cttgtactat gcactttctt
tgccaaaggc aaacgcagaa 540cgtttcagag ccatgaggat gcttctgcat
ttgagtttgc tagctcttgg agctgcctac 600gtgtatgcca tccccacaga
aattcccaca agtgcattgg tgaaagagac cttggcactg 660ctttctactc
atcgaactct gctgatagcc aatgaggtaa ttttctttat gattcctaca
720gtctgtaaag tgcataggta atcatttgtg atggttcctt tactatatat
agagatctgt 780tataaataat aagattctga gcacattagt acatgggtga
taactacatc accagcaaac 840attctgttaa aagttatgaa tgctggtgtg
ctgtaaaaat gattgtattt cctttcctct 900ccagactctg aggattcctg
ttcctgtaca taaaaatgta agttaaatta tgattcagta 960aaatgatggc
atgaataagt aaatttcctg ttttaagctg taaatcatta gttatcattg
1020gaactattta attttctata ttttgttttc atatgggtgg ctgtgaatgt
ctgtacttat 1080aaatatgagg aatgactttt tatcaagtag aatcctttaa
acaagtggat taggctcttt 1140ggtgatgttg ttagtttgcc ttcccaaaga
gcatcgtgtc aggattcttt ccagaaggat 1200tccacactga gtgagaggtg
cgtgctagtc tccgtgcagt tctgactctt tctcactcta 1260acgtgtttct
gaaagtatta gcaactcaga attatatttt tagaaccatg atcagtagac
1320attaaaatat ataacaaatg ccctatatta ataattctgc atacttaaat
aattatgact 1380atatgatggt gtgtatgcat tgaatatgcc tggtcatatt
aaaatgtaaa atatatagtt 1440tattagtcta aatagaataa aactaccagc
tagaactgta gaaacacatt gatatgagtt 1500taatgtataa tgcattacac
ttccaaaaca tttttttcca gttacataat taagttatat 1560cctttataaa
actcctcagt aatcatataa gcttcatcta ctttttgaaa attttatctt
1620aatatgtggt ggtttgttgc ctagaaaaca aacaaaaaac tctttggaga
agggaactca 1680tgtaaatacc acaaaacaaa gcctaacttt gtggaccaaa
attgttttaa taattatttt 1740ttaattgatg aattaaaaag tatatatatt
tattgtgtac aatatgatgt tttgaagtat 1800gtatacattg cagaatggac
aatggaccaa atttttatac cttgtcttga ttatttgcat 1860tttaaaaatt
ttcctcattt agcaccaact gtgcactgaa gaaatctttc agggaatagg
1920cacactggag agtcaaactg tgcaaggggg tactgtggaa agactattca
aaaacttgtc 1980cttaataaag aaatacattg acggccaaaa agtaagttac
acacattcaa tggaagctat 2040atttgtcctg gctgtgccta tttctatgga
attgacagtt tcctgtaata cctattgtca 2100tttttctttt ttcacagaaa
aagtgtggag aagaaagacg gagagtaaac caattcctag 2160actacctgca
agagtttctt ggtgtaatga acaccgagtg gataatagaa agttgagact
2220aaactggttt gttgcagcca aagattttgg aggagaagga cattttactg
cagtgagaat 2280gagggccaag aaagagtcag gccttaattt tcaatataat
ttaacttcag agggaaagta 2340aatatttcag gcatactgac actttgccag
aaagcataaa attcttaaaa tatatttcag 2400atatcagaat cattgaagta
ttttcctcca ggcaaaattg atatactttt ttcttattta 2460acttaacatt
ctgtaaaatg tctgttaact taatagtatt tatgaaatgg ttaagaattt
2520ggtaaattag tatttattta atgttatgtt gtgttctaat aaaacaaaaa
tagacaactg 2580ttcaatttgc tgctggcctc tgtccttagc aatttgaagt
tagcacagtc cattgagtac 2640atgcccagtt tggaggaagg gtctgagcac
atgtggctga gcatccccat ttctctggag 2700aagtctcaag gttgcaaggc
acaccagagg tggaagtgat ctagcaggac ttagtgggga 2760tgtggggagc
agggacacag gcaggaggtg aacctggttt tctctctaca gtatatccag
2820aacctgggat ggtcgaaggg taaatggtag ggaataaatg aatgaatgtc
gtttccaaga 2880tgattgtaga actaaaatga gttgtaagct cccctggaag
aagggatgtg gaacctgtaa 2940ctaggttcct gcccagcctg tgagaagaat
ttggcagatc atctcattgc cagtatagag 3000aggaagccag aaaccctctc
tgccaaggcc tgcaggggtt cttaccacct gaccctgcac 3060cataacaaaa
ggacagagag
acatggtagg gcagtcccat tagaaagact gagttccgta 3120ttcccggggc
agggcagcac caggccgcac aacatccatt ctgcctgctt atggctatca
3180gtagcatcac tagagattct tctgtttgag aaaacttctc tcaaggatcc
323090134PRTHomo sapiens 90Met Arg Met Leu Leu His Leu Ser Leu Leu
Ala Leu Gly Ala Ala Tyr1 5 10 15Val Tyr Ala Ile Pro Thr Glu Ile Pro
Thr Ser Ala Leu Val Lys Glu 20 25 30Thr Leu Ala Leu Leu Ser Thr His
Arg Thr Leu Leu Ile Ala Asn Glu 35 40 45Thr Leu Arg Ile Pro Val Pro
Val His Lys Asn His Gln Leu Cys Thr 50 55 60Glu Glu Ile Phe Gln Gly
Ile Gly Thr Leu Glu Ser Gln Thr Val Gln65 70 75 80Gly Gly Thr Val
Glu Arg Leu Phe Lys Asn Leu Ser Leu Ile Lys Lys 85 90 95Tyr Ile Asp
Gly Gln Lys Lys Lys Cys Gly Glu Glu Arg Arg Arg Val 100 105 110Asn
Gln Phe Leu Asp Tyr Leu Gln Glu Phe Leu Gly Val Met Asn Thr 115 120
125Glu Trp Ile Ile Glu Ser 130913241DNAHomo sapiens 91ggatcctaat
caagacccca gtgaacagaa ctcgaccctg ccaaggcttg gcagtttcca 60tttcaatcac
tgtcttccca ccagtatttt caatttcttt taagacagat taatctagcc
120acagtcatag tagaacatag ccgatctgaa aaaaacattc ccaatattta
tgtattttag 180cataaaattc tgtttagtgg tctaccttat actttgtttt
gcacacatct tttaagagga 240agttaatttt ctgattttaa gaaatgcaaa
tgtggggcaa tgatgtatta acccaaagat 300tcttcgtaat agaaaatgtt
tttaaagggg ggaaacaggg atttttatta ttaaaagata 360aaagtaaatt
tattttttaa gatataaggc attggaaaca tttagtttca cgatatgcca
420ttattaggca ttctctatct gattgttaga aattattcat ttcctcaaag
acagacaata 480aattgactgg ggacgcagtc ttgtactatg cactttcttt
gccaaaggca aacgcagaac 540gtttcagagc catgaggatg cttctgcatt
tgagtttgct agctcttgga gctgcctacg 600tgtatgccat ccccacagaa
attcccacaa gtgcattggt gaaagagacc ttggcactgc 660tttctactca
tcgaactctg ctgatagcca atgaggtaat tttctttatg attcctacag
720tctgtaaagt gcataggtaa tcatttgtga tggttccttt actatatata
gagatctgtt 780ataaataata agattctgag cacattagta catgggtgat
aactacatca ccagcaaaca 840ttctgttaaa agttatgaat gctggtgtgc
tgtaaaaatg attgtatttc ctttcctctc 900cagactctga ggattcctgt
tcctgtacat aaaaatgtaa gttaaattat gattcagtaa 960aatgatggca
tgaataagta aatttcctgt tttaagctgt aaatcattag ttatcattgg
1020aactatttaa ttttctatat tttgttttca tatgggtggc tgtgaatgtc
tgtacttata 1080aatatgagga atgacttttt atcaagtaga atcctttaaa
caagtggatt aggctctttg 1140gtgatgttgt tagtttgcct cccaaagagc
atcgtgtcag ggattctttc cagaaggatt 1200ccacactgag tgagaggtgc
gtgctagtct ccgtgcagtt ctgactcttt ctcactctaa 1260cgtgtttctg
aaagtattag caactcagaa ttatattttt agaaccatga tcagtagaca
1320ttaaaatata taacaaatgc cctatattaa taatttctgc atacttaaat
aattatgact 1380atatgatggt gttgtatgca tttgaatatg tcctggtcat
attaaaatgt aaaatatata 1440gttttattag tctaaataga ataaaactac
cagctagaac tgtagaaaca cattgatatg 1500agtttaatgt ataatgcatt
acacttccaa aacatttttt tccagttaca taattaagtt 1560atatccttta
taaaactcct cagtaatcat ataagcttca tctacttttt gaaaatttta
1620tcttaatatg tggtggtttg ttgcctagaa aacaaacaaa aaactctttg
gagaagggaa 1680ctcatgtaaa taccacaaaa caaagcctaa ctttgtggac
caaaattgtt ttaataatta 1740ttttttaatt gatgaattaa aaagtatata
tatttattgt gtacaatatg atgttttgaa 1800gtatgtatac attgcagaat
ggacaatgga ccaaattttt ataccttgtc ttgattattt 1860gcattttaaa
aattttcctc atttagcacc aactgtgcac tgaagaaatc tttcagggaa
1920taggcacact ggagagtcaa actgtgcaag ggggtactgt ggaaagacta
ttcaaaaact 1980tgtccttaat aaagaaatac attgacggcc aaaaagtaag
ttacacacat tcaatggaag 2040ctatatttgt ctggctgtgc ctatttctat
ggaattgaca gtttcctgta atacctattg 2100tcatttttct tttttcacag
aaaaagtgtg gagaagaaag acggagagta aaccaattcc 2160tagactacct
gcaagagttt cttggtgtaa tgaacaccga gtggataata gaaagttgag
2220actaaactgg tttgttgcag ccaaagattt tggaggagaa ggacatttta
ctgcagtgag 2280aatgagggcc aagaaagagt caggccttaa ttttcagtat
aatttaactt cagagggaaa 2340gtaaatattt caggcatact gacactttgc
cagaaagcat aaaattctta aaatatattt 2400cagatatcag aatcattgaa
gtattttcct ccaggcaaaa ttgatatact tttttcttat 2460ttaacttaac
attctgtaaa atgtctgtta acttaatagt atttatgaaa tggttaagaa
2520tttggtaaat tagtatttat ttaatgttat gttgtgttct aataaaacaa
aaatagacaa 2580ctgttcaatt tgctgctggc ctctgtctta gcaattgaag
ttagcacagt ccattgagta 2640catgcccagt ttggaggaag ggtctgagca
catgtggctg agcatcccca tttctctgga 2700gaagtctcaa ggttgcaagg
cacaccagag gtggaagtga tctagcagga cttagtgggg 2760atgtggggag
cagggacaca ggcaggaggt gaacctggtt ttctctctac agtatatcca
2820gaacctggga tggtgcaggg taaatggtag ggaataaatg aatgaatgtg
ctttccaaga 2880ctgattgtag aactaaaatg agttgtaagg cgtcccctgg
aagaagggca gtgtgggaac 2940ctgtaactag gttcctgccc agcctgtgag
aagaatttgg cagatcaatc tcattgccag 3000tatagagagg aagccagaaa
ccctctctgc caaggcctgc aggggttctt accccacctg 3060accctgcacc
ataacaaaag gaacagagag acactggtag ggcagtccca ttagaaagac
3120tgagttccgt attcccgggg gcagggcagc accaggccgc acaacactcc
attctgcctg 3180cttatggcta tcagtagcat cactagagat tcttctgttt
gagaaaactt ctcaaggatc 3240c 324192134PRTHomo sapiens 92Met Arg Met
Leu Leu His Leu Ser Leu Leu Ala Leu Gly Ala Ala Tyr1 5 10 15Val Tyr
Ala Ile Pro Thr Glu Ile Pro Thr Ser Ala Leu Val Lys Glu 20 25 30Thr
Leu Ala Leu Leu Ser Thr His Arg Thr Leu Leu Ile Ala Asn Glu 35 40
45Thr Leu Arg Ile Pro Val Pro Val His Lys Asn His Gln Leu Cys Thr
50 55 60Glu Glu Ile Phe Gln Gly Ile Gly Thr Leu Glu Ser Gln Thr Val
Gln65 70 75 80Gly Gly Thr Val Glu Arg Leu Phe Lys Asn Leu Ser Leu
Ile Lys Lys 85 90 95Tyr Ile Asp Gly Gln Lys Lys Lys Cys Gly Glu Glu
Arg Arg Arg Val 100 105 110Asn Gln Phe Leu Asp Tyr Leu Gln Glu Phe
Leu Gly Val Met Asn Thr 115 120 125Glu Trp Ile Ile Glu Ser
1309324DNAArtificial Sequencesynthetic oligonucleotide 93ctggagaacg
aaaagaacga agac 249424DNAArtificial Sequencesynthetic
oligonucleotide 94tcaaaaggga tatcaaacag aaag 24
* * * * *
References