U.S. patent application number 11/915666 was filed with the patent office on 2008-11-06 for chloroplasts engineering to express pharmaceutical proteins.
Invention is credited to Henry Daniell.
Application Number | 20080274143 11/915666 |
Document ID | / |
Family ID | 38006342 |
Filed Date | 2008-11-06 |
United States Patent
Application |
20080274143 |
Kind Code |
A1 |
Daniell; Henry |
November 6, 2008 |
Chloroplasts Engineering to Express Pharmaceutical Proteins
Abstract
Vaccines for conferring immunity in mammals to infective
pathogens are provided, as well as vectors and methods for plastid
transformation of plants to produce protective antigens and
vaccines for oral delivery. The vaccines are operative by
parenteral administration as well. The invention also extends to
the transformed plants, plant parts, and seeds and progeny thereof.
The invention is applicable to monocot and dicot plants.
Inventors: |
Daniell; Henry; (Winter
Park, FL) |
Correspondence
Address: |
Timothy H. Van Dyke
390 No. Orange Avenue, Suite 2500
Orlando
FL
32801
US
|
Family ID: |
38006342 |
Appl. No.: |
11/915666 |
Filed: |
May 30, 2006 |
PCT Filed: |
May 30, 2006 |
PCT NO: |
PCT/US2006/021024 |
371 Date: |
November 27, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60685734 |
May 27, 2005 |
|
|
|
Current U.S.
Class: |
424/228.1 ;
435/320.1; 514/1.1; 536/23.6; 800/288; 800/298; 800/306; 800/312;
800/314; 800/317.2; 800/317.3; 800/317.4; 800/320; 800/320.1;
800/320.2; 800/320.3 |
Current CPC
Class: |
A61K 39/0008 20130101;
A61K 2039/517 20130101; A61K 2039/6037 20130101; A61K 2039/542
20130101; A61P 31/14 20180101; C12N 15/8257 20130101; A61K 39/12
20130101; C07K 2319/60 20130101; A61P 31/12 20180101; C07K 14/56
20130101; A61P 3/10 20180101; C12N 15/8258 20130101; C12N 15/8214
20130101; A61K 39/00 20130101; A61K 39/29 20130101; C12N 2770/24234
20130101; C07K 2319/55 20130101; C12N 2720/12334 20130101; A61K
39/07 20130101; A61K 39/15 20130101 |
Class at
Publication: |
424/228.1 ;
800/288; 435/320.1; 800/298; 800/320.1; 800/320.2; 800/320.3;
800/320; 800/312; 800/317.2; 800/317.3; 800/317.4; 800/314;
800/306; 536/23.6; 514/12 |
International
Class: |
A61K 39/29 20060101
A61K039/29; C12N 15/82 20060101 C12N015/82; A01H 5/00 20060101
A01H005/00; C12N 15/29 20060101 C12N015/29; A61K 38/16 20060101
A61K038/16; A61P 3/10 20060101 A61P003/10; A61P 31/12 20060101
A61P031/12 |
Claims
1-11. (canceled)
12. A process for obtaining a PA polypeptide comprising:
integrating a plastid transformation vector, which comprises an
expression cassette comprising, as operably linked components in
the 5' to the 3' direction of translation, a promoter operative in
said plastid, a selectable marker sequence. a heterologous
polynucleotide sequence coding for comprising at least 70% identity
to a PA polypeptide, transcription termination functional in said
plastid, and flanking each side of the expression cassette,
flanking DNA sequences which are homologous to a DNA sequence of
the target plastid genome, whereby stable integration of the
heterologous coding sequence into the plastid genome of the target
plant is facilitated through homologous recombination of the
flanking sequence with the homologous sequences in the target
plastid genome, into the plastid genome of a plant cell, wherein
said plastid transformation vector that further comprises a
polynucleotide encoding a histidine tag such that said histidine
tag is conjugated with said PA polypeptide upon expression; growing
a plant comprising said plant cell to thereby express said
protective antigen; obtaining crude plant extract from said plant;
and subjecting said crude plant extract to a nickel column.
13. (canceled)
14. (canceled)
15. A method for vaccinating a human against Hepatitis C infection,
comprising administering to the human an immunizing amount of a
composition comprising a Hepatitis C NS3 antigen polypeptide,
wherein said Hepatitis C NS3 antigen polypeptide is derived from a
plant transformed to express said Hepatitis C NS3 antigen
polypeptide.
16. (canceled)
17. A stable plastid transformation and expression vector which
comprises an expression cassette comprising, as operably linked
components in the 5' to the 3' direction of translation, a promoter
operative in said plastid, a selectable marker sequence, a
heterologous polynucleotide sequence coding for comprising at least
70% identity to a Hepatitis C NS3 antigen protein, transcription
termination functional in said plastid, and flanking each side of
the expression cassette, flanking DNA sequences which are
homologous to a DNA sequence of the target plastid genome, whereby
stable integration of the heterologous coding sequence into the
plastid genome of the target plant is facilitated through
homologous recombination of the flanking sequence with the
homologous sequences in the target plastid genome.
18. A vector of claim 17, wherein the plastid is selected from the
group consisting of chloroplasts, chromoplasts, amyloplasts,
proplastide, leucoplasts and etioplasts.
19. A vector of claim 17, wherein the selectable marker sequence is
an antibiotic-free selectable marker.
20. A stably transformed plant which comprises plastid stably
transformed with the vector of claim 17 or the progeny thereof,
including seeds.
21. A stably transformed plant of claim 20 which is a
monocotyledonous or dicotyledonous plant.
22. A stably transformed plant of claim 20 which is maize, rice,
grass, rye, barley, oat, carrot, wheat, soybean, peanut, grape,
potato, sweet potato, pea, canola, tobacco, tomato or cotton.
23. A stably transformed plant of claim 20 which is edible for
mammals and humans.
24. A stably transformed plant of claim 20 in which all the
chloroplasts are uniformly transformed.
25. A process for producing a Hepatitis C NS3 antigen polypeptide
comprising: integrating a plastid transformation vector according
to claim 17 into the plastid genome of a plant cell; growing said
plant cell to thereby express said protective antigen.
26-37. (canceled)
38. A method of retarding the development of diabetes in a subject
in need thereof comprising obtaining from a plant a composition
comprising a CTB-Pris polypeptide and administering to said subject
said composition.
39. A composition for retarding the development of diabetes
comprising a therapeutically effective amount of a CTB-Pris
polypeptide and a plant remnant.
40. A stable plastid transformation and expression vector which
comprises an expression cassette comprising, as operably linked
components in the 5' to the 3' direction of translation, a promoter
operative in said plastid, a selectable marker sequence, a
heterologous polynucleotide sequence coding for comprising at least
70% identity to a CTB-Pris protein, transcription termination
functional in said plastid, and flanking each side of the
expression cassette, flanking DNA sequences which are homologous to
a DNA sequence of the target plastid genome, whereby stable
integration of the heterologous coding sequence into the plastid
genome of the target plant is facilitated through homologous
recombination of the flanking sequence with the homologous
sequences in the target plastid genome.
41-42. (canceled)
43. A stably transformed plant which comprises plastid stably
transformed with the vector of claim 40 or the progeny thereof,
including seeds.
44. A stably transformed plant of claim 43 which is a
monocotyledonous or dicotyledonous plant.
45. A stably transformed plant of claim 43 which is maize, rice,
carrot, grass, rye, barley, oat, wheat, soybean, peanut, grape,
potato, sweet potato, pea, canola, tobacco, tomato or cotton.
46. A stably transformed plant of claim 43 which is edible for
mammals and humans.
47. A stably transformed plant of claim 43 in which all the
chloroplasts are uniformly transformed.
48. A process for producing a CTB-Pris polypeptide comprising:
integrating a plastid transformation vector according to claim 40
into the plastid genome of a plant cell; growing said plant cell to
thereby express said CTB-Pris polypeptide.
49. A plastid genome transformed to contain a CTB-Pris
polynucleotide configured so as to express CTB-Pris protein.
50-78. (canceled)
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Ser. No. 60/685,734
filed May 27, 2005, which is incorporated herein in its entirety by
reference.
BACKGROUND
[0002] Progress has been made in engineering plant cells to produce
useful proteins. For example, plants have been shown to express
potentially medically important proteins that may be used for
immunization against pathogens. Many infectious diseases require
booster vaccinations or multiple antigens to induce and maintain
protective immunity. Advantages of plant-derived vaccines include
the delivery of multiple antigens, low cost of production, storage
& transportation, elimination of medical personnel and sterile
injections, heat stability, antigen protection through
bioencapsulation, the generation of systemic & mucosal immunity
and improved safety via the use of a subunit vaccine and absence of
human pathogens. Despite cases of successful expression of
proteins, the development of plant derived medically important
compositions is still in its formative stages.
BRIEF DESCRIPTION OF THE DRAWINGS
[0003] FIG. 1: CTB-Pris Construct and Site of Integration into the
Chloroplast Genome: Insertion of 5'UTR-CTB-human proinsulin into
the chloroplast transformation vector pLD and the site of
integration into the chloroplast genome between the trnI and trnA
genes.
[0004] FIG. 2: Western blot analysis of chloroplast transgenic
lines probed with proinsulin antibody: Lane 1 E. coli crude extract
expressing CTB-Pins, lane 2 untransformed plant extract, lanes 3-5
plant extract of transgenic lines.
[0005] FIG. 3A: Southern blot probed with BamHI/BglII 0.81 kb
flanking sequence. Gene specific probe (0.36 kb) was obtained by
MfeI/NotI digestion of pLD-5CP vector. 3B: Illustration of
untransformed and transformed chloroplast genomes at the site of
integration of transgenes. Untransformed & transformed plant
DNA was digested with AflIII and AflIII. The expected size for each
fragment is shown along with the hybridization site for the
flanking sequence probe and gene specific probe. 3C: Southern Blot
with gene specific probe: Lanes 1-5: DNA from transgenic lines;
lane 6: untransformed wild type. 3D: Southern Blot with flanking
sequence probe: Lane 1: untransformed wild type, lanes 2-6:
transgenic lines.
[0006] FIG. 4: A) Haematoxylin & Eosin staining of a section of
the pancreas (showing an islet: is1) of a mouse treated with
CTB-Pins for 7 weeks. There is no cellular infiltration inside the
islet. Lymphocytes are shown outside the islet (arrow in A). In 4
B) arrows indicate the borders of an islet in the pancreas of a
mouse treated with CTB-GFP (a control group). Blue dots show
cellular infiltration of the islet. FIG. 4C shows a big islet with
severe lymphocytic infiltration in a mouse treated with
untransformed (UN-Tr) plant leaf material. In 4 D) a severe
lymphocytic infiltration in a mouse treated with interferon-GFP
(IFN-GFP) is shown.
[0007] FIG. 5: Scoring (S) the insulitis according to the severity
of the lymphocytic infiltration of the pancreas Langerhans islets.
Score 1 indicates no or pre-islet infiltration, minimal
infiltrations were scored 2, moderate infiltrations were scored 3
and severe infiltrations were scored 4. When more than 80% of the
islets were infiltrated, the score was 5.
[0008] FIG. 6: Lymphocytic infiltrations (insulitis) were scored by
blindly evaluating 50 sections per pancreas of each animal in
different experimental groups as indicated. The NOD mice treated
with CTB-Pins scored significantly lower (P<0.05) than the
untransformed (UN-Tr) plant, interferon-GFP (IFN-GFP), or CTB-GFP
plant treated groups. ANOVA was done through Excel, and the P value
is less that 0.001. The bars represent the standard deviation.
[0009] FIG. 7: Insulin immunoreactivity in Langerhans islets of a
mouse treated with CTBPins (A). In 7 B, Caspase-3 immunostaining in
the same section is shown in the red channel. Merged picture of A
and B is shown in 7C. 7D) A view of the pancreas which shows the
remnant of a large langerhans islet of the mouse treated with
untransformed plant leaf material. E) shows the Caspase-3
immunoreactivity in the same section taken in red channel. F) shows
the merged picture of D and E; here, all the remaining cells which
are also depleted of insulin, are expressing the active
caspase-3.
[0010] FIG. 8: Interleukin 10 (IL10) immunoreactivity in the
pancreas of three mice treated with untransformed plant leaf
material A, B, and C. Blood vessels (BV) and the langerhans islets
(is1) are indicated. No significant IL10 immunostaining can bee
seen in or around the islets or around the blood vessels. D, E, and
F show the islets of mice treated with CTB-Proinsulin. Small arrows
indicate perivascular infiltration of IL10 expressing lymphocytes.
Large arrows indicate IL10 positive lymphocytes inside or around
the islets.
[0011] FIG. 9: Interleukin-4 (IL4) immunoreactivity in the pancreas
of mice treated with IFNGFP or CTB-GFP or CTB-Pins plant leaf
material. Blood vessels (BV) are free of perivascular lymphocytic
infiltration and no significant IL4 positive cells can be seen
around the islets (arrows demarcate the islets). A large number of
IL4 positive cells are shown around the islets of CTB-Pins treated
NOD mice.
[0012] FIG. 10: Serum levels of IgG1 in NOD mice treated with
CTB-Pins expressing plant leaf material as compared to the control
groups treated with untransformed plant, the CTB-IFN or CTB-GFP
plant expressing leaf material.
[0013] FIG. 11: PCR analysis of Wild type and putative
transformants of pLD-5'UTR-His-CTB-NSP4. A: PCR using specific
primers land within the native chloroplast genome (3P/3M) to yield
a 1.65 kb product and 5P/2M primers to yield 2.5 kb product. B:
Lane 1: 1 kb plus DNA ladder, Lane 2: Negative control (Wild type)
Lane 3-6: Transgenic lines of H is CTB-NSP4, Lane 7: Empty, Lane 8:
Positive control (Interferon clone). C:Lane 1: 1 kb plus DNA
ladder, Lane 2: Negative control (wild type), Lanes 3-6: Transgenic
lines of H is CTB-NSP4, Lane 7: Empty, Lane 8: Positive control pLD
5'UTR-His CTB-NSP4 plasmid.
[0014] FIG. 12 Southern Blot analysis of CTB-NSP4 T0 plants.
Schematic diagram of the products obtained from digestions of A:
Wild type untransformed plants show a DNA fragment of 5 kb. B: Two
DNA fragments of 4.3 kb and 2 kb indicate plants that are
transformed with pLD-5'UTR-His CTB-NSP4. C: A DNA fragment of 11 Kb
is seen for transgenic lines with gene specific probe D: Southern
with flanking sequence probe of CTB-NSP4 transgenic plants showing
homoplasmy. Lane 1:1 kb plus DNA ladder, Lane 2: Wild type, Lanes
3-8: CTB-NSP4 transgenic lines E: CTB-NSP4 gene specific probe
showing the presence of CTB-NSP4 gene in the transgenic plants.
Lane 1:1 kb plus DNA ladder, Lane 2: Wild type, Lanes 3-6: CTB-NSP4
transgenic lines
[0015] FIG. 13: Immunoblot analysis of crude plant extracts
expressing CTB-NSP4. Lane 1: Molecular weight markers, Lane 2-3:
Boiled T0 transgenic plant samples, Lane 4-5: Unboiled T0
transgenic plant samples (20 ug of crude plant extract was loaded).
Lane 6: Wild type, Lanes 7: Empty, Lane 8: bacterial
CTB-NSP4.sub.90 fusion protein purified from E. coli BL 21 cells
(0.9 ug).
[0016] FIG. 14. Quantification of CTB-NSP4 fusion protein
expression levels in transgenic plants (T0 generation). Expression
levels in % total soluble protein (TSP) of CTB-NSP4 expressed in
Young, Mature and Old leaves under continuous light illumination
observed for 0 to 5 days. The CTB-NSP4 expression levels reached a
maximum of 2.45% of TSP in mature leaves by day 1 under continuous
light and the expression levels declined to 0.6% of TSP by Day
5.
[0017] FIG. 15: Schematic steps to clone pLD-AB-NS3
[0018] (a) Amplification of 5' terminal 134 bp of NS3 gene using
PCR. SacI and SnaBI and NotI are introduced for further subcloning.
(b) Cloning of PCR product in p-Bluescript between SacI and NotI.
(c) pcDNA3.1-NS3 vector digested with BstXI and EcoRV and cloned
between same sites in p-Bluescript. NS3 gene cloned in p-Bluescript
between Sac and EcoRV. (d) NS3 gene in p-Bluescript digested with
SnaBI and HindIII and cloned in pCR2.1 between the same sites and
upstream of 5'UTR. (e) NS3 gene and 5'UTR (20.1 kb) digested from
pCR2.1 with EcoRI and EcoRV and cloned in between same sites in
pLD-AB-Ct vector.
[0019] FIG. 16: Nicotiana tabacum chloroplast genome
[0020] The pLD contains the chloroplast transfer RNAs coding for
Isoleucine and Alanine (trnI and trnA). These homologous flanking
DNA sequences direct the insertion of the Prrn/aadA/5'UTR/NS3'UTR
genes into the chloroplast genome by two homologous recombination
events.
[0021] FIG. 17: Chemiluminescent Detection of E. coli-expressed
NS3
[0022] Total E. coli proteins were separated on SDS-PAGE and
detected with monoclonal anti-NS3 as the primary antibody. The
secondary antibody was goat anti-mouse IgG conjugated to
horseradish peroxidase. Samples: Protein marker (lane 1); Extracts
of untransformed E. coli cells (lane 2 and 3); Protein extracts
from lysates of E. coli transformed with pLD-AB-NS3 (lane 5 and
spillover in lane 4).
[0023] FIG. 18: First Round of Selection
[0024] A. Shoots from bombardment of Petit Havana leaves appeared
within 4 weeks
[0025] B. Shoots from bombardment of LAMD-609 leaves appeared
within 7 weeks
[0026] FIG. 19: Second Round of Selection
[0027] A. Pettit Havana shoots from first selection on 500 .mu.g/ml
spectinomycin
[0028] B. LAMD-609 shoots from first selection on 350 .mu.g/ml
spectinomycin
[0029] FIG. 20: Propagation of Petit Havana Transgenic Lines
[0030] A. Petit Havana transgenic lines in jars containing MSO 500
ug/ml spectinomycin.
[0031] B. Petit Havana transgenic plant in pots with no added
antibiotic.
[0032] FIG. 21: 3P/3M PCR Analysis of Putative Petit Havana and
LAMD Transgenic
[0033] Lines
[0034] A. 3P/3M primers annealing to sequences in the chloroplast
genome of Petit Havana and LAMD.
[0035] B. A 1.65 kb PCR product with 3P/3M primers: 1 kb DNA ladder
(lane 1); untransformed (-) petit Havana (lane 2); transgenic PH
lines (lanes 3-8); untransformed LAMD (lane 9, control); LAMD
transgenic line (lane 10).
[0036] FIG. 22: 5P/2M PCR of Putative Petit Havana and LAMD
Transgenic Lines
[0037] A. 5P/2M primers annealing to sequences in the chloroplast
genome of Petit Havana and LAMD.
[0038] B. 0.8% agarose gel shows 3.7 kb PCR product utilizing 5P/2M
primers; 1 kb DNA ladder (lane 1); 1 .mu.g of pLD-AB-NS3 as the
positive control (lane 2); untransformed (-) Petit Havana (lane 3);
untransformed (-)LAMD (lane 4); transgenic petite havana lines
(lanes 5-9); transgenic LAMD lines (lane 10).
[0039] FIG. 23: Southern Blot using Flanking Probe
Confirmation of Chloroplast Integration and Determination of
Homoplasmy/Heteroplasmy in T.sub.0 Generation.
[0040] A 810 bp probe containing chloroplast flanking sequences and
DNA fragments of 4.47 kb indicate untransformed chloroplast. B. DNA
fragments of 5.2 and 2.7 kb indicate transformed chloroplasts of
transgenic plants (lanes 1-8) and DNA fragments of 4.47 kb indicate
untransformed chloroplasts of transgenic plants (lane 9).
[0041] FIG. 24: Southern Blot using NS3 gene specific probe
[0042] A 2.1 kb NS3 gene specific probe was used. All transformed
plants (lanes 2-9) show 2.7 kb DNA fragment and the untransformed
plant (lane 1) does not show any DNA fragment.
[0043] FIG. 25: Western Blot of Transgenic plants expressing
NS3
[0044] Plant tissue extracts separated on 10% SDS-PAGE with NS3
detected by mouse monoclonal antibody against NS3. Protein Marker
(lane 1); untransformed plant (lane 2); Blank-Sample buffer (lane
3); transgenic PH plant (lane 4); Mutant PH plant not expressing
NS3 (lane 5); transgenic PH plant (lane 6); transgenic LAMD plant
(lane 7).
[0045] FIG. 26: Quantification of NS3 in Transgenic
chloroplasts
[0046] A. Protein quantification by ELISA in young, mature and old
transgenic leaves of LAMD of plant in 16 h light and 8 h dark (day
0), 1, 3 and 5 day continuous illumination.
[0047] FIG. 27: Maternal inheritance
[0048] Seeds were sterilized and grown in MSO plates with
spectinomycin (500 ug/ul).
[0049] FIG. 28. pLD-CtV: Universal Chloroplast Expression Vector.
The pLD-CtV contains the 16S rRNA promoter, the aadA gene encoding
spectinomycin resistance (selectable marker), and psbA 5' & 3'
untranslated region to enhance translation in the light. The trnI
and trnA inverted repeat regions allow for direct insertion of
transgenes into the chloroplast genome by two homologous
recombination events.
[0050] FIG. 29. pLD-smGFP-IFN.alpha.5 (pLD-BB1) construct The
pLD-smGFP-IFN.alpha.5 contains the chloroplast transfer RNAs coding
for Isoleucine and Alanine (trnI and trnA). These homologous
flanking DNA sequences direct the insertion of the aadA gene,
5'UTR/smGFP/furin/INF.alpha.5 cassette and regulatory sequences
into the chloroplast genome by two homologous recombination
events.
[0051] FIG. 30. Expression of smGFP-IFN.alpha.5 in E. coli and
Immunoblot Analysis Lanes: M: Markers, 1: Negative control
(untransformed), 2: Positive control (IFN.alpha..sub.2b), 3:
Positive control (IFN.alpha.5), 4-8: smGFP-IFN.alpha.5
[0052] FIG. 31. Selection and Regeneration: a. Primary Selection
for Transgenic Lines on Antibiotic Media. Shoots from bombardment
of wild type Dark Fire leaves. b. Secondary Selection for
Transgenic Lines on Antibiotic Media. Shoots from Dark Fire on
spectinomycin. c. Propagation 1. Transgenic lines in jar containing
MSO with spectinomycin. 2. Transgenic lines and an untransformed
plant in pots with no added antibiotic.
[0053] FIG. 32. 5P/2M PCR Analysis Both primers land on flanking
sequences of the integrated construct. Integration into the
chloroplast genome creates a 3.0 kb PCR product. Untransformed
tobacco plants should not produce a PCR product. Lane 1: MW; 2-4:
pLD-BB1 transformed plants A, B, F; 5: positive control; 6:
untransformed plant (negative control).
[0054] FIG. 33. 3P/3M PCR Analysis The 3p primer lands on flanking
region in the native chloroplast genome and the 3m primer lands
within the aadA gene. Integration into the chloroplast genome
creates a 1.65 kb PCR product. Untransformed tobacco plants should
not produce a PCR product. Lane 1: MW; 2-4: pLD-BB1 transformed
plants A, B, F; 5: untransformed plant (negative control); 6:
positive control; 7: MW.
[0055] FIG. 34. Southern Blot Analysis: Flanking Probe Southern
Blot Confirmation of chloroplast integration and determination of
homoplasmy/heteroplasmy in T.sub.0 generation of tobacco. The 0.81
kb probe containing chloroplast flanking sequences generated an 8.3
kb fragment in the untransformed chloroplast genomes. In the
transformed genomes containing IFN.alpha.5 (A), 7.0 kb and 3.8 kb
fragments were generated. In the transformed genomes containing the
fusion of smGFP-IFN.alpha.5 (B,C,D), 6.3 kb and 3.8 kb fragments
were generated which showed integration as well as homoplasmy.
[0056] FIG. 35. Southern Blot Analysis: IFN.alpha.5 probe Southern
Blot using the 0.5 kb IFN.alpha.5 probe. Transformed plant samples
B,C, & D show the correct fragment size of 2.2 kb for the
IFN.alpha.5 gene specific probe. No fragments are evident in the
untransformed plant (WT). The IFN.alpha.5 probe was used as a
positive control.
[0057] FIG. 36. smGFP Expression Viewed Under UV Light 1) Wild Type
(a) & smGFP-IFN.alpha.5 (b) plants under normal light 2) Wild
Type (a) & smGFP-IFN.alpha.5 (b) plants under UV light
3)smGFP-IFN.alpha.5 plant under UV light 4) Wild Type plant under
UV light
[0058] FIG. 37. Immunoblot Analysis of Plants Western blot analysis
of protein expression of pLD-smGFP-IFN.alpha.5 in tobacco plants
(Dark Fire cultivar): Lanes: M: Markers, 1: Positive control (E.
coli pLD-IFN.alpha.2b), 2: Positive control (E. coli
pLD-IFN.alpha.5), 3: Positive Control (E. coli
pLD-smGFP-IFN.alpha.5), 4&6: skipped lanes, 5&7: Plant
samples B&C (pLD-smGFP-IFN.alpha.5), 8: Negative Control (D.F.
Wild Type).
[0059] FIG. 38. ELISA Quantification of IFN.alpha.S in transgenic
chloroplasts: Protein quantification by ELISA in transgenic tobacco
leaves. The amount of expression increased from 0.001% in the
transformed plants containing IFN.alpha.5 to about 5% in the
transformed plants expressing the fusion protein,
smGFP-IFN.alpha.5.
[0060] FIG. 39. PCR analysis for the confirmation of transgene
integration. A) Schematic representation of the transgene cassette.
B) 5P/2M--These primers land on the aadA and trnA regions (flanking
the CTB-GFP). A 2.9 kb PCR product was obtained from the PCR
analysis of transgenic plants. C) 3P/3M--The 3P primer lands on the
native chloroplast genome and the 3M primer lands on the aadA gene.
A 1.6 kb PCR product was obtained from the PCR analysis of the
transgenic plants. Lane 1: 1 kb plus ladder. Lanes 2-5: Transgenic
lines of CTBGFP. Lane 6: Positive Control. Lane 7: Empty. Lane 8:
Wild-type Plant. D) Southern blot analysis of the plants. Lane 1:
WT showing 4.4 kb fragment. Lanes 2-5: Transgenic plants showing
4.9 and 2.2 kb hybridizing fragments. Flanking sequence shown in
FIG. 28A was used as the probe.
[0061] FIG. 40. Visualization of GFP fluorescence in transgenic
plants under UV light. A) Wild-type (untransformed) plant seen
under UV light. B) CTB-GFP expressing leaf showing fluorescence
observed under UV light. C) Wild-type leaf under a
low-magnification microscope. D) CTB-GFP expressing leaf showing
fluorescence under a low-magnification microscope.
[0062] FIG. 41. Immunoblot analysis, furin cleavage assay and
quantification of CTB-GFP expressed in chloroplasts of
transgeniclines. A) Immunoblot demonstrating the expression of
CTB-GFP in transgenic plant crude extracts: Lane 1: Unboiled crude
extract of transgenic line A. Lane 3: boiled crude extract of
transgenic line A. Lane 5: Unboiled crude extract of transgenic
line B. Lane 6: Boiled crude extract of transgenic line A. Lane 8:
Purified CTB standard 200 ng. Lane 9: Wild-type plant crude
extract. Lanes 2, 4, 7: empty. B) Furin cleavage assay of the plant
extract: Lane 1: Marker. Lane 2: CTB-GFP, pH 6.0, with furin, no
PMSF. Lane 3: CTB-GFP no incubation, no furin. Lane 4: CTB-GFP pH
6.0 with furin and PMSF. Lane 5: CTB-GFP, pH 7.0, with furin and
PMSF. Lane 6: CTB-GFP, pH 6.0, with PMSF, no furin. Lane 7:
CTB-GFP, pH 6.0, no PMSF, no furin. Lane 8: Blank. Lane 9: Purified
recombinant GFP standard. C) Expression levels in % of CTB-GFP in
total soluble protein (TSP) of the CTB-GFP expressing plants. D)
GM1 ganglioside binding assay showing the presence of CTB-GFP
functional pentamers.
[0063] FIG. 42. Cryosections of the intestine and liver of the mice
fed with CTB-GFP or wild-type plant leaves material. A) GFP in the
ileum of a mouse following oral delivery of the CTB-GFP expressing
plant leaf material. Arrows show numerous columnar cells of the
intestinal mucous membrane, which have up-taken the CTB-GFP.
Various cells in the connective tissue beneath the epithelium also
show the presence of GFP. B) Section of the ileum of a mouse fed by
the wild-type (untransformed) plant leaf material. C) Section of
the ileum of a mouse fed by the IFN-GFP leaf material. D) GFP in
hepatocytes of a mouse liver following oral delivery of CTBGFP
expressing plant. E) Section of the liver of a mouse fed by the
wild-type plant material. F) Section of the liver of a mouse fed by
IFN-GFP expressing plant material. G) GFP in the spleen of a mouse
following oral delivery of CTB-GFP expressing plant. Arrows show
various splenic cells with GFP. H) Section of the spleen of a mouse
fed by the wild-type plant material. I) Section of the spleen of a
mouse fed by IFNGFP expressing plant material. Scale bar: 50
.mu.m.
[0064] FIG. 43. Immunohistochemical localization of the GFP in
mouse ileum, liver, and spleen. A-C) are sections of the ileum of
the mice fed with CTB-GFP expressing plant leaf. Arrows indicate
presence of GFP in the intestinal epithelium as well as cells of
the crypts. D) Shows a section of the ileum of a mouse fed with
wildtype (untransformed) plant leaf materials. E)
GFP-immunoreactivity in hepatocytes (arrows) in a mouse fed orally
by CTB-GFP expressing plant. F) Section of the liver from a mouse
fed by wild-type (untransformed) plant. G) Section of the liver
from a mouse fed by IFN-GFP expressing plant. H)
GFP-immunoreactivity in the spleen of mouse fed orally by CTB-GFP
expressing plant. Arrows indicate various cells with a higher GFP
content. I) Section of the spleen from a mouse fed by wild-type
(untransformed) plant. J) Section of the spleen from a mouse fed by
wild-type (untransformed) plant. Scale bar for A-D.sub.--50 .mu.m,
Scale bar for E-J.sub.--25 .mu.m.
[0065] FIG. 44. Immunohistochemistry of ileum, liver, and spleen
tissues of mice fed with CTBGFP expressing leaves or IFN-GFP
expressing leaves or wild-type leaves. A) Shows a section of the
intestine of a CTB-GFP treated mouse. The arrows indicate CTB in
the submucosa of the intestinal villi. B) Shows a section of mouse
ileum fed with wild-type plant, immunostained for CTB. C-F) Double
staining for macrophage (red) and CTB (green) in mouse intestine
and liver. C) Arrows show macrophages in the submucosa of the
intestine containing CTB, in a mouse fed with CTB-GFP expressing
plant leaf material. The merged color is yellow. D) Arrows indicate
F4/80-positive cells (macrophages, in red) in a merged picture in
the intestine of a mouse fed with WT leaf material. E) A merged
picture showing double staining for macrophage (Kupffer cells) and
CTB in mouse liver. Arrows show macrophages (red) in the liver. No
sign of CTB (green) was found in the liver of CTB-GFP fed mouse. F)
Liver section of an IFN-GFP fed mouse used as a negative control
for CTB. Macrophages are seen in red. G) F4/80 Ab was used as a
marker of macrophages in the intestine. Arrows indicate
macrophages, which have entrapped GFP (yellow after merging the red
and the green). Many of the macrophages are not associated with
GFP. H) Many macrophages are seen in the intestine of mouse fed
with IFN-GFP expressing plant leaf material, which do not show GFP
immunoreactivity. I, J) CD11c (red) and GFP (green)
immunoreactivities in the mouse intestine. I) Arrows indicate CD11c
(red, presumably dendritic cells, due to having a star shape
morphology) with internalized GFP (green), which can be seen in
yellow color when the red and green channels were merged. J) Arrows
indicate CD11c-positive cells in intestine of mice fed with IFN-GFP
expressing plant leaf material. Scale bar for A and B.sub.--25
.mu.m. Scale bar for C-J.sub.--50 .mu.m.
[0066] FIG. 45: Transcriptional and translational analysis of the
Cry2Aa2 operon: A. Schematic representation of the
orf1-orf2-cry2Aa2 operon in transgenic lines, including the aadA
gene and the upstream Prrn promoter (P); upstream native
chloroplast 16S ribosomal RNA gene with its respective promoter
(Prrn) and the trnI and trnA are shown. Arrows represent expected
transcripts and their respective sizes. B. RNA hybridized with the
cry2A probe, loaded as follows: wt: wild type control; lanes 1, 2
and 3: cry2Aa2 operon transgenic lines. Transcripts of the cry2Aa2
operon are indicated by lowercase letters and correspond to the
transcripts depicted in A. C. Relative heterologous transcript
abundance within each line hybridized with the cry2A probe. D.
Transcript analysis showing RNA hybridization with the aadA probe,
loaded as follows: wt: wild type control, lanes 1-3: cry2Aa2 operon
transgenic lines. Transcripts of the cry2Aa2 operon are of sizes as
described for the cry2Aa2 probe; f is aadA/orf1/orf2 tricistron,
2,5 knt. E. Heterologous transcript quantification for samples
hybridized with the aadA probe. F. RNA hybridization using the
orf1,2 probe. Samples were loaded in the same order as in D and
predicted transcript sizes correspond to those observed in D. G.
Relative transcript abundance within each transgenic line obtained
by hybridization with the orf1,2 probeH. Western blot analysis
using the Cry2Aa2 antibody. wt: wild type control; lanes 1 and 2:
cry2Aa2 operon transgenic lines; lane 3: positive control (Cry2Aa2
protein). The expected polypeptide of 65 kDa is shown in both
transgenic plants and the positive control. I. Western blot
analysis using the ORF2 antibody. wt: wild type control; lanes 1
and 2: cry2Aa2 operon transgenic lines; lane 3: positive control
(ORF2 protein). The expected polypeptide of 45 ka is shown in both
transgenic plants and the positive control.
[0067] FIG. 46: Polysome Fractionation Assays of the cry2Aa2
Operon
[0068] A. RNA hybridized with the cry2A probe after fractionation
through a sucrose gradient. WT: wild type control, T: total RNA
sample, lanes 1-12: RNA collected from the different fractions of
the gradient. Lower fractions correspond to the bottom of the
sucrose gradient (polysomal fractions). P: cry2Aa2 probe. c:
transcript "c" (aadA-orf1-orf2-cry2A polycistron) described in FIG.
1A. B. Same RNA blot after stripping and re-hybridizing with orf1,2
probe. Lane P is omitted because no orf1,2 probe was loaded. C.
Puromycin release and wild-type controls. Cry2Aa2 samples were
treated with puromycin before loading onto sucrose gradients,
whereas an additional wild-type sample was loaded onto sucrose
gradients and used as a negative control. RNA was hybridized with
the aadA probe. The gel was loaded as follows: WT: wild-type RNA;
T: total RNA; 1-11: RNA collected from the different fractions of
the sucrose gradient and hybridized with the aadA probe. Lanes
12-16: wild-type RNA from fractions 2, 4, 6, 8 and 10 collected
from the sucrose gradient. P: aadA probe. c: transcript "c"
(aadA-orf1-orf2-cry2A polycistron) described in FIG. 1A.
[0069] FIG. 47: Transcriptional and Translational Analysis of the
hsa Operons
[0070] A. Schematic representation of the hsa operons (rbs-hsa,
5'UTR-hsa, orf1-orf2-hsa) in transgenic lines, including the aadA
gene and upstream Prrn promoter (P); upstream native chloroplast
16S ribosomal RNA gene and promoter (Prrn) as well as trnI/trnA
genes are shown. Arrows represent expected transcripts and their
respective sizes. B. RNA hybridization with the hsa probe. wt: wild
type; lanes 1-3: rbs-hsa transgenic lines; lanes 4-6: 5'UTR-hsa
transgenic lines; lanes 7-9: orf1,2-hsa transgenic lines. Lowercase
letters correspond to the transcripts predicted in A. C. Relative
abundance of the transcripts obtained with the hsa probe. D. mRNA
transcripts hybridized with the aadA probe and loaded in the same
order as in B. Transcripts a-i corresponded to the same transcripts
observed in B, "k" corresponds to the 16rrn/hsa polycistron (6,9
kit). E. Quantification of relative heterologous transcript
abundance obtained with the aadA probe. F. mRNA transcripts of
wild-type (wt) and orf1,2-hsa transgenic lines (lanes 1-3)
hybridized with the orf1,2 probe. G. Relative abundance obtained
for the transcripts detected with the orf1,2 probe. H. Western blot
analysis using the HSA antibody. wt: wild type control. Lanes 1-2:
RBS-hsa transgenic lines; lanes 3-4: 5UTR-hsa transgenic lines.
Lanes 5 and 6 orf1,2-hsa transgenic lines. Lane 7: positive control
(HSA protein). Lane marked with (-) was left blank. All samples
presented 66 kDa and 132 kDa peptides, corresponding to the size of
the HSA protein, and its dimeric form, respectively. I. Western
blot analysis using the ORF2 antibody. Lanes 1-2: orf1,2-hsa
transgenic lines; lane 3: wild type control; lane 4: positive
control (ORF protein). 45 kDa ORF2 and 90 kDa dimer are shown.
[0071] FIG. 48: ELISA analysis of the orf1-orf2-hsa transgenic
fine.
[0072] Total soluble protein content of young, mature and old leaf
extracts of the orf1-orf2-hsa transgenic lines determined by ELISA
analyses. Transgenic plants were subjected to the following light
conditions: 4, 8, and 16 hours of light, as well as total
darkness.
[0073] FIG. 49: Transcriptional and translational analysis of the
tps1 operon
[0074] A. Schematic representation of the tps1 operon in transgenic
lines, including the aadA gene and upstream Prrn promoter (P).
Upstream native chloroplast 16S ribosomal RNA gene and promoter
(Prrn) as well as trnI/trnA genes are shown. Arrows represent
expected transcripts and their respective sizes. B. Northern blot
analysis obtained by hybridization with the tps1 probe, loaded as
follows: wt: wild type control; lanes 1, 2 and 3. tps1 transgenic
lines. Transcripts of the tps1 operon correspond to those depicted
in A, indicated with lowercase letters. C. Relative transcript
abundance per transgenic line, obtained with the tps1 probe. D. RNA
transcripts hybridized with the aadA probe, loaded as follows: wt:
wild type control; lanes 1-3: tps1 transgenic lines. Transcript
bands obtained for the tps1 operon are of sizes as described for
tps1 probe (B). D. Relative abundance of transcripts in each sample
after hybridization with the aadA probe. E. Western blot analysis
using the TPS1 antibody. Lane 1: positive control (TPS1 protein);
lane 2: wild type control; lane 3: tps1 transgenic line. A
polypeptide of 65 kDa was observed in the transgenic clone,
corresponding to the expected size of the TPS1 protein, as observed
in the positive control.
[0075] FIG. 50: Transcriptional and translational analysis of the
CTB operons
[0076] A. Schematic representation of the 5'UTR-ctb-gfp and RBS-ctb
operon in transgenic lines, including the aadA gene and the
upstream Prrn promoter (P); upstream native chloroplast 16S
ribosomal RNA gene with its respective promoter (Prrn) and the trnI
and trnA are also shown. Arrows represent expected transcripts and
their respective sizes. B. Northern blot analysis showing RNA
hybridized with the CTB probe. Samples were loaded as follows: wt:
wild type control; lanes 1-3: 5'UTR-ctb-g transgenic lines; lanes
4-6: rbs-ctb transgenic lines. The transcripts and respective sizes
correspond to those indicated in A with lowercase letters. C.
Relative transcript abundance, within each line, of the transcripts
shown in B. D. RNA hybridization using the aadA probe, and loaded
according to the following: M: molecular weight marker; wt: wild
type control; lanes 1-3: RBS-ctb transgenic lines. Lanes 4-6:
5UTR-ctb-gfp transgenic lines. Lanes marked with (--) were left
blank. The transcripts observed correspond to the same as in B. E.
Relative transcript abundance, per line, for the transcripts shown
in C. F. Western blot analysis of the RBS-CTB transgenic lines
using anti-CTB antibody. Lanes 1-3: transgenic clones; lane 4: wild
type control; lane 5: positive control (CTB protein). CTB from
transgenic lines is in trineric form. E. Western blot analysis of
the 5'UTR-ctb-gfp transgenic lines using the CTB antibody. Lane 1:
Wild type control. Lanes 2-5: transgenic lines. Lane 6: positive
control (CTB protein).
[0077] FIG. 51: Transcription of heterologous operons using the
psbA 3'UTR probe.
[0078] A. Northern blot analysis and corresponding quantification
of transcripts obtained from different HSA transgenic lines
described in FIG. 3, as well as of the native psbA transcripts. The
RNA gels were loaded as follows: wt: wild-type. Lanes 1-3: RBS-HSA
transgenic lines. Lanes 4-6: 5'UTR-HSA transgenic lines. Lanes 7-9:
ORF-1,2-HSA transgenic lines. P: psbA 3'UTR probe. Lowercase
letters correspond to the same transcripts predicted in FIG. 3A.
Transcript abundance was normalized against the wild-type psbA, to
which a value of 1 was assigned. B. Northern blot analysis and
corresponding transcript quantification of the cry2Aa2 operon. Gel
loading was as follows: wt: wild-type RNA. Lanes 1-3: Cry2Aa2
transgenic lines. P: psbA 3'UTR probe. Lowercase letters correspond
to transcripts predicted in FIG. 1A. Native psbA transcript is
indicated. Transcript abundance was normalized against the
wild-type psbA, to which a value of 1 was assigned. The low
transcript abundance of lane 1 is due to partial RNA degradation in
the sample. C. RNA blot and transcript quantification of the
transgenic TPS1 lines. The RNA gel was loaded as follows: wt:
wild-type. Lanes 1-3. TPS1 transgenic lines. P: psbA 3'UTR probe.
Lowercase letters correspond to transcript sizes shown in FIG. 5A.
Native psbA transcript is indicated Transcript abundance was
normalized against the wild-type psbA, showing a value of 1. D.
Northern blot analysis of the RBS-CTB and 5'UTR-CTB-GFP transgenic
lines. Samples were loaded as follows: wt: wild-type. Lanes 1-3:
RBS-CTB transgenic lines. Lanes 4-6: 5'UTR-CTB-GFP transgenic
lines. P: psbA 3'UTR probe. Lowercase letters correspond to
transcripts shown in FIG. 6A. Transcripts a* and b* are similar in
size to the native psbA and therefore they cannot be distinguished
from the native transcript. Because such transcripts were shown to
be very abundant in FIG. 6B, and because of increase in transcript
abundance in comparison to the wild-type psbA transcript, it is
assumed that such transcripts are present. Transcript abundance was
normalized against the wild-type psbA, to which a value of 1 was
assigned.
[0079] FIG. 52 Vector map and confirmation of transgene integration
into chloroplast genome by PCR and Southern blotting. (a) Schematic
representation of pLD-VK1 vector with protective antigen gene
(pagA), aadA (selectable marker), 5'UTR, and chloroplast flanking
sequences for site-specific integration with the primers 3P/3M and
5P/2M annealing sites within the native chloroplast genome and the
schematic diagram of expected products from digestion of plants
transformed with pLD-VK1. (b) Schematic diagram of expected
products from digestion of wild-type untransformed plant. (c)
Confirmation of site-specific transgene cassette integration by PCR
using primers (3P/3M) to yield a 1.65-kb product. Lane 1, 1-kb DNA
ladder; lane 2, wild type; lanes 3 to 6, pLD-VK1 transgenic lines;
lane 7, positive control (interferon transgenes).
[0080] FIG. 53. Immunoblotting analysis and quantification of PA
expressed in chloroplast of transgenic plants (pLD-VK1) in T0
generation. (a) Immunoblotting demonstrating the expression of PA
in transgenic plant crude extracts. Lane 1, wild type; lane 2,
100-ng standard; lane 4, transgenic line 5; lane 6, transgenic line
7; lane 8, transgenic line 8; lanes 3, 5, and 7, empty. (b)
Expression levels in percent TSP of PA-expressing leaves (young,
mature, and old) under normal and continuous illumination observed
for 0 to 7 days.
[0081] FIG. 54. Purification of PA by affinity chromatography from
the crude extracts of plant leaves expressing PA. (a) Coomassie
staining of the proteins in crude extract and purified protein:
Lane 1, protein plus precision ladder; lane 2, wild-type leaf crude
extract; lane 3, crude extract of transgenic plant expressing PA;
lanes 4 and 5, purified chloroplast-derived PA; lane 6, flowthrough
collected during purification. (b) Lane 1, ladder; lane 3,
concentrated protein; lane 5, purified protein (before
concentrating); lanes 2 and 4, overflow from lane 3.
[0082] FIG. 55. Functional analysis of PA with macrophage
cytotoxicity assay. The cytotoxicities of various PA preparations
for mouse macrophage RAW264.7 cells were assayed in the presence of
LF. Samples that were diluted serially were as follows: crude
extract of plant leaves expressing PA with His tag, wild-type (WT)
plant leaf crude extract, 20-.mu.g/ml stock of purified
chloroplast-derived PA, 20-.mu.g/ml stock of purified PA derived
from B. anthracis, and plant protein extraction buffer.
[0083] FIG. 56. IgG antibody titers and toxin neutralization assay
titers in serum samples obtained from mice after third and fourth
doses. (a) Comparison of immune responses in serum samples of mice
administered subcutaneously with chloroplast-derived PA (CpPA) with
adjuvant (column 1), chloroplast-derived PA (CpPA) alone (column
2), Std-PA derived from B. anthracis with adjuvant (column 3),
Std-PA alone (column 4), PA plant leaf crude extract with adjuvant
(column 5), wild-type plant leaf crude extract with adjuvant
(column 6), and unimmunized mice (column 7). (b) Toxin
neutralization titers of sera collected from the mice on day 43 of
post-initial immunization. Each symbol represents average EC50 from
three replicate assays of a single mouse serum. CHL, chloroplast;
ADJ, adjuvant; B.A., B. anthracis; WT, wild type. (c) Toxin
neutralization assays of serum samples collected from the mice on
day 155 of post-initial immunization. Each symbol represents the
average EC50 from three replicate assays of a single mouse
serum.
[0084] FIG. 57. Toxin challenge of the mice with systemic anthrax
lethal toxin. Shown is survival over time for different groups of
mice after challenge with a 150-.mu.g dose of lethal toxin. IP,
intraperitoneal; CHLPST, chloroplast; ADJ, adjuvant; WT, wild
type.
DETAILED DESCRIPTION
[0085] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art of molecular biology. Although methods
and materials similar or equivalent to those described herein can
be used in the practice or testing of the present invention,
suitable methods and materials are described herein. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and are not intended to be
limiting.
[0086] Reference is made to standard textbooks of molecular biology
that contain definitions and methods and means for carrying out
basic techniques, encompassed by the present invention. See, for
example, Maniatis et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, New York (1982) and Sambrook
et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York (1989); Methods in Plant Molecular
Biology, Maliga et al, Eds., Cold Spring Harbor Laboratory Press,
New York (1995); Arabidopsis, Meyerowitz et al, Eds., Cold Spring
Harbor Laboratory Press, New York (1994) and the various references
cited therein.
[0087] Methods, vectors, and compositions for transforming plants
and plant cells are taught for example in WO 01/72959; WO
03/057834; and WO 04/005467. WO 01/64023 discusses use of marker
free gene constructs.
[0088] Proteins expressed in accord with certain embodiments taught
herein may be used in vivo by administration to a subject, human or
animal in a variety of ways. The pharmaceutical compositions may be
administered orally or parenterally, i.e., subcutaneously,
intramuscularly or intravenously. Thus, this invention provides
compositions for parenteral administration which comprise a
solution of the fusion protein (or derivative thereof) or a
cocktail thereof dissolved in an acceptable carrier, preferably an
aqueous carrier. A variety of aqueous carriers can be used, e.g.,
water, buffered water, 0.4% saline, 0.3% glycerine and the like.
These solutions are sterile and generally free of particulate
matter. These compositions may be sterilized by conventional, well
known sterilization techniques. The compositions may contain
pharmaceutically acceptable auxiliary substances as required to
approximate physiological conditions such as pH adjusting and
buffering agents, toxicity adjusting agents and the like, for
example sodium acetate, sodium chloride, potassium chloride,
calcium chloride, sodium lactate, etc. The concentration of fusion
protein (or portion thereof) in these formulations can vary widely
depending on the specific amino acid sequence of the subject
proteins and the desired biological activity, e.g., from less than
about 0.5%, usually at or at least about 1% to as much as 15 or 20%
by weight and will be selected primarily based on fluid volumes,
viscosities, etc., in accordance with the particular mode of
administration selected.
[0089] Oral vaccines produced by embodiments of the present
invention can be administrated by the consumption of the foodstuff
that has been manufactured with the transgenic plant producing the
antigenic like particles. The edible part of the plant is used as a
dietary component while the vaccine is administrated in the
process.
[0090] To evaluate the antigenicity of the expressed antigens, the
level of immunoglobulin A in feces or immunoglobulin G in serum is
measured, respectively, after test animals has been immunized with
the antigen embodiments of the present invention by oral
administration or peritoneal injection. The ability to elicit the
antibody formation is measured by Enzyme-linked immunosorbent
assay. In addition, the direct consumption of the transgenic plant
producing the antigen induces the formation of antibodies against
the specific antigen.
[0091] The vaccines of certain embodiments of the present invention
may be formulated with a pharmaceutical vehicle or diluent for
oral, intravenous, subcutaneous, intranasal, intrabronchial or
rectal administration. The pharmaceutical composition can be
formulated in a classical manner using solid or liquid vehicles,
diluents and additives appropriate to the desired mode of
administration. Orally, the composition can be administered in the
form of tablets, capsules, granules, powders and the like with at
least one vehicle, e.g., starch, calcium carbonate, sucrose,
lactose, gelatin, etc. The preparation may also be emulsified. The
active immunogenic ingredient is often mixed with excipients which
are pharmaceutically acceptable and compatible with the active
ingredient. Suitable excipients are, e.g., water, saline, dextrose,
glycerol, ethanol or the like and combination thereof. In addition,
if desired, the vaccine may contain minor amounts of auxiliary
substances such as wetting or emulsifying agents, pH buffering
agents, or adjuvants which enhance the effectiveness of the
vaccines. The preparation for parental administration includes
sterilized water, suspension, emulsion, and suppositories. For the
emulsifying agents, propylene glycol, polyethylene glycol, olive
oil, ethyloleate, etc. may be used. For suppositories, traditional
binders and carriers may include polyalkene glycol, triglyceride,
witepsol, macrogol, tween 61, cocoa butter, glycerogelatin, etc. In
addition, pharmaceutical grades of mannitol, lactose, starch,
magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate and the like can be used as excipients.
[0092] Antigen(s) may be administered by the consumption of the
foodstuff that has been manufactured with the transgenic plant and
the edible part of the plant is used directly as a dietary
component while the vaccine is administrated in the process.
[0093] The vaccine may be provide with the juice of the transgenic
plants for the convenience of administration. For said purpose, the
plants to be transformed are preferably selected from the edible
plants consisting of tomato, carrot and apple, which are consumed
usually in the form of juice.
[0094] The vaccination will normally be taken at from two to twelve
week intervals, more usually from three to hive week intervals.
Periodic boosters at intervals of 1-5 years, usually three years,
will be desirable to maintain protective levels of the antibodies.
It will be desirable to have administrations of the vaccine in a
dosage range of the active ingredients of about 100-500 .mu.g/kg,
preferably 200-400 .mu.g/kg.
[0095] According to one embodiment, the subject invention relates
to a vaccine derived from a plant transformed to express antigenic
proteins capable of producing an immune response in a subject
(human or non-human animal).
[0096] According to another embodiment, the subject invention
pertains to a transformed chloroplast genome that has been
transformed with a vector comprising a heterologous gene that
expresses a peptide as disclosed herein.
[0097] Of particular present interest is a transformed chloroplast
genome that has been transformed with a vector comprising a
heterologous gene that expresses a peptide antigenic for rotavirus,
hepatitis C or Anthrax. In a related embodiment, the subject
invention pertains to a plant comprising at least one cell
transformed to express a peptide as disclosed herein.
[0098] Accordingly, in one embodiment, a vaccine pertains to an
administratable vaccine composition that comprises an antigen
having been expressed by a plant and a plant remnant. A plant
remnant may include one or more molecules (such as, but not limited
to, proteins and fragments thereof, minerals, nucleotides and
fragments thereof, plant structural components, etc.) derived from
the plant in which the antigen was expressed. Accordingly, a
vaccine pertaining to whole plant material (e.g., whole or portions
of plant leafs, stems, fruit, etc.) or crude plant extract would
certainly contain a high concentration of plant remnants, as well
as a composition comprising purified antigen that has one or more
detectable plant remnants.
[0099] Reference to specific polypeptide sequences herein (such as
but not limited to, CTB, proinsulin, interferon alpha, GFP, NSP4,
HCV NS3 protein, yeast trehalose phosphate synthase, human serum
albumin, Cry2Aa2 protein, and/or protective antigen relate to the
full length amino acid sequences as well as at least 12, 15, 25,
50, 75, 100, 125, 150, 175, 200, 225, 250 or 265 contiguous amino
acids selected from such amino acid sequences, or biologically
active variants thereof.
[0100] Variants which are biologically active, refer to those, in
the case of immunization, confer an ability to induce serum
antibodies which protect against infection against the pathogen
from which polypeptide is derived, or, in the case of desiring the
native function of the protein, is a variant which maintains the
native function of the protein. Preferably, naturally or
non-naturally occurring polypeptide variants have amino acid
sequences which are at least about 55, 60, 65, or 70, preferably
about 75, 80, 85, 90, 96, 96, or 98% identical to the full-length
amino acid sequence or a fragment thereof. Percent identity between
a putative polypeptide variant and a full length amino acid
sequence is determined using the Blast2 alignment program
(Blosum62, Expect 10, standard genetic codes).
[0101] Variations in percent identity can be due, for example, to
amino acid substitutions, insertions, or deletions. Amino acid
substitutions are defined as one for one amino acid replacements.
They are conservative in nature when the substituted amino acid has
similar structural and/or chemical properties. Examples of
conservative replacements are substitution of a leucine with an
isoleucine or valine, an aspartate with a glutamate, or a threonine
with a serine.
[0102] Amino acid insertions or deletions are changes to or within
an amino acid sequence. They typically fall in the range of about 1
to 5 amino acids. Guidance in determining which amino acid residues
can be substituted, inserted, or deleted without abolishing
biological or immunological activity of polypeptide can be found
using computer programs well known in the art, such as DNASTAR
software. Whether an amino acid change results in a biologically
active LecA polypeptide can readily be determined by assaying for
native activity, as described for example, in the specific
Examples, below.
[0103] Reference to genetic sequences herein refers to single- or
double-stranded nucleic acid sequences and comprises a coding
sequence or the complement of a coding sequence for polypeptide of
interest. Degenerate nucleic acid sequences encoding polypeptides,
as well as homologous nucleotide sequences which are at least about
50, 55, 60, 65, 60, preferably about 75, 90, 96, or 98% identical
to the cDNA may be used in accordance with the teachings herein
polynucleotides. Percent sequence identity between the sequences of
two polynucleotides is determined using computer programs such as
ALIGN which employ the FASTA algorithm, using an affine gap search
with a gap open penalty of -12 and a gap extension penalty of -2.
Complementary DNA (cDNA) molecules, species homologs, and variants
of nucleic acid sequences which encode biologically active
polypeptides also are useful polynucleotides.
[0104] Variants and homologs of the nucleic acid sequences
described above also are useful nucleic acid sequences. Typically,
homologous polynucleotide sequences can be identified by
hybridization of candidate polynucleotides to known polynucleotides
under stringent conditions, as is known in the art. For example,
using the following wash conditions: 2.times.SSC (0.3 M NaCl, 0.03
M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30
minutes each; then 2.times.SSC, 0.1% SDS, 50.degree. C. once, 30
minutes; then 2.times.SSC, room temperature twice, 10 minutes each
homologous sequences can be identified which contain at most about
25-30% basepair mismatches. More preferably, homologous nucleic
acid strands contain 15-25% basepair mismatches, even more
preferably 5-15% basepair mismatches.
[0105] Species homologs of polynucleotides referred to herein also
can be identified by making suitable probes or primers and
screening cDNA expression libraries. It is well known that the Tm
of a double-stranded DNA decreases by 1-1.5.degree. C. with every
1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123
(1973). Nucleotide sequences which hybridize to polynucleotides of
interest, or their complements following stringent hybridization
and/or wash conditions also are also useful polynucleotides.
Stringent wash conditions are well known and understood in the art
and are disclosed, for example, in Sambrook et al., MOLECULAR
CLONING: A LABORATORY MANUAL, 2.sup.nd ed., 1989, at pages
9.50-9.51.
[0106] Typically, for stringent hybridization conditions a
combination of temperature and salt concentration should be chosen
that is approximately 12-20.degree. C. below the calculated T.sub.m
of the hybrid under study. The T.sub.m of a hybrid between a
polynucleotide of interest or the complement thereof and a
polynucleotide sequence which is at least about 50, preferably
about 75, 90, 96, or 98% identical to one of those nucleotide
sequences can be calculated, for example, using the equation of
Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390
(1962):
T.sub.m81.5.degree. C.-16.6(log.sub.10[Na.sup.+])+0.41(%
G+C)-0.63(% formamide)-600/l),
[0107] where l=the length of the hybrid in basepairs.
[0108] Stringent wash conditions include, for example, 4.times.SSC
at 65.degree. C., or 50% formamide, 4.times.SSC at 42.degree. C.,
or 0.5.times.SSC, 0.1% SDS at 65.degree. C. Highly stringent wash
conditions include, for example, 0.2.times.SSC at 65.degree. C.
[0109] Relevant articles on genetic sequences is provided:
proinsulin (Brousseau et al., Gene, 1982 March; 17(3):279-89;
Narrang et al, Can J Biochem Cell Biol. 1984 April; 62(4):209-16;
and Georges et al, Gene 27 (2), 201-211 (1984)); GFP (Prasher et
al., Gene 111, 229-233, (1992)); protective antigen (Welkos et al.,
Gene. 1988 Sep. 30; 69(2):287-300); alpha interferon (Strausberg et
al., Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002));
rotavirus (Kirkwood et al., Virus Genes, Volume 19, Issue 2,
October 1999, Pages 113-122); hepatitis C NS3 (Lodrini et al., J
Biol Regul Homeost Agents. 2003 April-June; 17(2):198-204); and CTB
(Shi et al, Sheng Wu Hua Hsuch Tsa Chih 9 (No. 4), 395-399
(1993).
EXAMPLE 1
Expression of Cholera Toxin B Subunit-Proinsulin Fusion Protein in
Transgenic Tobacco Chloroplasts as a Treatment against Development
of Type-1 Autoimmune Diabetes.
[0110] Oral administration of disease specific autoantigens have
been demonstrated to delay or even prevent the onset of disease
symptoms, referred to as tolerance. The inventor has produced a
Nicotiana tabacum cv. petit Havana chloroplast transgenic lines
that expresses a cholera toxin B subunit (from Vibrio
Cholerae)-human proinsulin (a and b chain) fusion protein,
designated CTB-Pris. This approach has been previously demonstrated
by nuclear expression in potato tubers, to prevent the onset of
insulin-dependent diabetes mellitus (IDDM) in NOD mice, when
delivered orally. The pLD-PW contains the CTB-Pris gene cloned into
the universal chloroplast transformation vector pLD-ctv in which
the 16S rRNA promoter drives the aadA gene selectable marker, which
confers resistance to spectinomycin; the psbA 5' untranslated
region (UTR) enhanced translation of CTB-Pris in the presence of
light and the psbA 3'UTR conferred transcript stability. The trnI
and trnA homologous flanking sequences facilitated site-specific
integration of transgenes into the tobacco chloroplast genome.
Site-specific integration was demonstrated by PCR and Southern blot
analysis with probes for both CTB and Pris. Western Blot analysis
has demonstrated the presence of abundant CTB-Pris in transgenic
plants with both CTB polyclonal and proinsulin monoclonal
antibodies. Southern blot analysis has also confirmed that
homoplasmy had been achieved in the T0 generation. These
chloroplast transgenic lines grew slowly although their appearance
was normal. Quantification studies are conducted as well as animal
studies on NOD mice in order to determine the ED50 for prevention
of the onset of insulin-dependent diabetes mellitus. Techniques for
plant transformation and processing and uses of expressed protein
are discussed in WO 01/72959.
[0111] Diabetes is a disease in which the body does not produce or
properly utilizeinsulin. Type 1 diabetes results from the
autoimmune destruction of insulin-producing cells and a
corresponding failure to produce adequate insulin. In 2002, the
American Diabetes Association estimated that 18.2 million people in
the United States, or 6.3% of the total population, have diabetes,
with more than $120 billion in treatment costs each year.
Complications that can arise from diabetes include: heart disease,
nephropathy, retinopathy, neuropathy, hypertension, foot
complications, skin problems, gastroparesis, and depression. In
2002, diabetes was the sixth leading cause of death in the U.S.
contributing to 213,062 deaths. The only currently accepted form of
treatment is the administration of recombinant insulin, which
serves to temporarily replace the missing insulin in diabetic
patients. Therefore, it is essential to find a prevention and cure
for this dreadful disease.
[0112] Insulin is secreted by pancreatic .beta.-cells and is
regulated by a glucose-sensing system. The insulin polypeptide is
made up of an A chain (21 amino acids) and a B chain (30 amino
acids) that are bound together via disulfide bonds across cysteine
residues. It is initially translated in the endoplasmic reticulum
as preproinsulin, processed into proinsulin that is trafficked to
the secretory granules of the .beta.-cell, and finally processed
into C-peptide and mature insulin (reviewed in Halban 1991). The
function of C peptide, which is part of proinsulin prior to
processing, has remained a mystery until recently, when human
trials have demonstrated that the proinsulin C-peptide stimulates
the activities of Na+, K+-ATPase and endothelial nitric oxide
synthase, both of which are enzyme systems of importance for nerve
function and known to be deficient in Type 1 diabetes (Ekberg et
al., 2003). The major destruction of .beta.-cells occurs
predominantly from autoreactive T-cytotoxic cells (Nagata et al.,
1994) and T-helper 1 cells (Ploix et al., 1999) reactive to
.beta.-cell autoantigens such as insulin.
[0113] Biopharmaceutical proteins expressed in plant cells should
reduce their cost of production, purification, processing, cold
storage, transportation and delivery. Integration of transgenes via
the nuclear genome may have a few disadvantages. The chloroplast
genetic engineering approach overcomes such concerns of transgene
containment (Daniell 2002), low levels of transgene expression,
gene silencing, position effect, pleiotropic effects, and presence
of antibiotic resistant genes or vector sequences in transformed
genomes (Daniell et al. 2002, 2004a-c, 2005a,b; Grevich &
Daniell, 2005). This approach has been successfully used in our
laboratory to confer desired plant traits (Daniell et al. 1998;
Kota et al. 1999; DeGray et al. 2001; Lee et al. 2003; Kumar et al.
2004a; Ruiz et al. 2003). Employing knowledge gained through these
studies, we have demonstrated expression and assembly of several
vaccine antigens, including the cholera toxin B subunit (CTB,
Daniell et al. 2001), the F1.about.V fusion antigen for plague
(Singleton 2003; Daniell et al. 2005b), the 2L21 peptide from the
canine parvovirus (CPV, Molina et al. 2004), the anthrax protective
antigen (PA, Watson et al. 2004), and the NS3 protein as a vaccine
antigen for hepatitis C (Bhati 2004). Cytotoxicity measurements in
macrophage lysis assays showed that chloroplast-derived anthrax
protective antigen (PA) was equal in potency to PA produced in B.
anthracis. It was reported that one acre of land should produce 360
million doses of a purified vaccine free of the bacterial toxins
(Koya et al. 2005) because of the large yield of biomass. In
addition to its use for the hyper-expression of vaccine antigens,
transgenic chloroplasts have been used in our lab for the
production of valuable therapeutic proteins, such as human
elastin-derived polymers for various biomedical applications (Guda
et al. 2000); human serum albumin (Fernandez-San Millan et al.
2003); magainin, a broad spectrum topical agent, systemic
antibiotic, wound healing stimulant and a potential anticancer
agent (DeGray et al. 2001); various interferon .alpha. proteins
(Daniell et al. 2004b, 2005b); and insulin-like growth factor 1
(Ruiz 2002). Several other laboratories have expressed other
therapeutic proteins, including human somatotropin (Staub et al.
2000) and interferon .gamma.-GUS fusion proteins (Leelavathi &
Reddy 2003), and the C-terminus of Clostridium tetani (Tregoning et
al. 2003) in transgenic chloroplasts. The successful expression and
assembly of complex multi-subunit proteins has demonstrated that
chloroplasts contain the machinery that allows for correct folding
and disulfide bond formation, resulting in fully functional
proteins (Daniell et al. 2004b, 2005b).
[0114] Oral delivery of biopharmaceutical proteins expressed in
plant cells should reduce their cost of production, purification,
processing, cold storage, transportation and delivery. However,
poor intestinal absorption of intact proteins is a major challenge.
To overcome this limitation, we investigated the concept of
receptor-mediated oral delivery of transgenic proteins. Therefore,
the transmucosal carrier cholera toxin B-subunit and green
fluorescent protein (CTB-GFP), separated by a furin cleavage site,
was expressed via the tobacco chloroplast genome. Following oral
administration of CTBGFP expressing leaf material to mice, GFP was
observed in the mice intestinal mucosa, liver and spleen in
fluorescence and immunohistochemical studies, while CTB remained in
the intestinal cell (Limaye et al., 2006). This report of
receptor-mediated oral delivery of a foreign protein into the
circulatory system brings the delivery of human therapeutic
proteins one step closer to realization. Transformation of
non-green tissue plastids (Kumar et al. 2004 a,b; Daniell et al.,
2005a) was recently achieved, further facilitating the oral
delivery of therapeutic proteins.
[0115] The non-obese diabetic (NOD) mouse is a useful animal model
for research in human diabetes. About 60%-75% of NOD mice become
diabetic by 40 weeks of age (Homann et al., 1999a). These mice show
signs of insulitis due to lymphocytic infiltration of the endocrine
part of the pancreas, which leads to decreased production of
insulin and increased blood sugar with its consequent pathologies.
In this study, we examine the effect of oral administration of
chloroplast-derived proinsulin conjugated to CTB for the induction
of oral tolerance towards insulin. Oral administration of small
quantities of CTB-Proinsulin to NOD mice leads to its uptake by
intestinal epithelial cells via the GM1 receptor. These cells then
pass the antigen (proinsulin) to the underlying antigen presenting
cells (APCs), such as macrophages or dendritic cells. These cells
in turn activate lymphocytes to up-regulate the Th2 response,
leading to the production of immune-suppressing cytokines such as
interleukins 4 (IL-4) and 10 (IL-10), which suppress (reduce) the
immune attack against the endocrine insulin-producing .beta.-cells
of the Langerhans islets of the pancreas.
Material and Methods
Vector Construction
[0116] The human proinsulin gene was synthesized by a method that
utilized four overlapping oligos with a low annealing temperature
(50.degree. C.). The products were then used as templates for high
annealing temp (65.degree. C.) primers, thus synthesizing the
required 258 bp gene (Protocol from Prodromou and Pearl, 1992). The
PCR product was then subsequently cloned into the PCR 2.1 vector
and the sequence verified. The psbA promoter and 5' untranslated
region (UTR) was amplified from the tobacco chloroplast genome,
followed by sub-cloning, and sequence verification. The
promoter-5'UTR fragment was then spliced together with the cholera
toxin B-subunit (CTB) and human proinsulin by a process that
utilizes four primers (Splicing by Overlap Extension, Horton et
al., 1989). Thus, the construct now contained the 5'UTR-CTB, and a
GPGP (glycine-proline-glycine-proline) hinge region introduced by
mutagenesis to allow for the proper folding of each protein by
reducing steric hindrance, followed by human proinsulin; the final
construct was termed 5CP. Following SalI/NotI digestion to release
the fusion gene of interest, it was ligated into the pLD-ctv
chloroplast transformation vector. The 5CP insert was ligated into
the chloroplast transformation vector, pLD-ctv which was developed
previously by the Daniell laboratory (Daniell et al., 1998;
2004c).
Bombardment and Selection of Transgenic Plants
[0117] The Bio-Rad PDS-1000/He biolistic device was used to bombard
pLD-CTB-Pins onto sterile Nicotiana tabacum cv. Petit Havana
tobacco leaves, on the abaxial side as has been previously
described (Daniell, 1997; Daniell et al., 2004c). The bombarded
leaves were incubated in the dark for 24 hours and then placed on
shoot inducing media (RMOP) containing 500 .mu.g/ml spectinomycin
for two rounds of selection. This was followed by another round of
selection on MS0, a root-inducing medium which contained 500
.mu.g/ml spectinomycin.
Southern Blot Analysis
[0118] Total plant DNA was digested with AflIII, separated on a
0.7% agarose gel at 45V for 8 hours, and then transferred to a
nylon membrane. The pUC-CT vector DNA was digested with BamHI and
BglII to generate a 0.8 kb probe which was used as a flanking probe
(Daniell et al., 2004c) and pLD-CTB-Pins was digested with MfeI and
NotI to generate the 0.36 kb gene specific probe. After labeling
the probe with P32, hybridization of the membranes was done using
QUICK-HYB hybridization solution and protocol (Stratagene, La
Jolla, Calif.).
Western Blot Analysis
[0119] Approximately 100 mg of leaf tissue was ground in liquid
nitrogen and resuspended in 500 .mu.l of plant extraction buffer
(0.1% SDS, 100 mM NaCl, 200 mM Tris-HCl pH 8.0, 0.05% Tween 20, 400
mM sucrose, 2 mM PMSF). After centrifugation at 13,000 rpm for 5
minutes, the supernatant containing the soluble extracted protein
was collected. The plant extract along with the sample loading
buffer were boiled, and then run on a 13% SDS-PAGE gel for 40 mins
at 50V and then 2 hours at 80V. The protein was then transferred to
nitrocellulose membrane for 1 hour at 85V. After blocking the
membranes with PTM (1.times.PBS, 0.05% Tween 20, and 3% dry milk)
for 1 hour, mouse anti-proinsulin monoclonal antibody (Amersham
Pharmacia) at a 1:20,000 dilution was added and incubated for 2
hours. Goat anti-mouse IgG antibody conjugated to horseradish
peroxidase (Sigma) at a 1:15,000 dilution was used as a secondary
antibody and incubated for 1.5 hours.
Quantification via ELISA
[0120] Approximately 100 mg of leaf tissue was ground in liquid
nitrogen and resuspended in 500 .mu.l of plant extraction buffer
(15 mM Na2CO3, 35 mM NaHCO3, 3 mM NaN3, pH 9.6, 0.1% Tween 20 and 5
mM PMSF). Using the Total Proinsulin ELISA Kit (Linco Research, St
Charles, Mo.) and following manufactures instructions, the Insulin
present in the leaf was quantified. Ninety-six well plates were
read on a plate reader (Dynex Technologies) at 450 nM.
Animal Studies
[0121] Four week old female non-obese diabetic (NOD) mice were
purchased from The Jackson Laboratory (Bar Harbor, Me.). Mice were
kept in the UCF Wild Animal Facility under normal light/dark cycle
conditions and had access to food and water ad lib. Treatment by
means of oral administration of Cholera toxin B subunit-Proinsulin
(CTBPins) expressing transgenic or control plant leaf material
began when animals were 5 weeks old, to allow the mice one week to
acclimate to the facility. Mice were divided into the following
groups: group 1 was fed untransformed plant leaf material; group 2
was fed transgenic plant leaf expressing Cholera toxin B subunit
conjugated to GFP(CTB-GFP); group 3 was fed transgenic plant leaf
expressing interferon conjugated to GFP (IFNGFP); and group 4 was
fed CTB-Pins expressing transgenic plant leaf. Each group contained
five animals, except the CTB-Pins group, which contained seven.
Mice were fed 8 mg of the specified ground plant leaf material once
a week for 7 weeks. The animals were sacrificed at 12 weeks of age,
the pancreas and other tissues were collected, and both blood and
urine glucose levels were measured.
Blood and Urine Glucose Levels
[0122] Blood and urine glucose levels were measured for two
consequent weeks (11 and 12 weeks old) with urinary glucose test
strips (Clinistix and Diastix, Bayer), and blood glucose was
measured by bleeding from either the tail vein or the retro-bulbar
vein (at week 12, before sacrificing) by blood glucose analyzer
(Boehringer Mannheim). Blood glucose levels over 250 mg/dl were
considered diabetic (Arakawa et al, 1998).
Histochemistry for Lymphocytic Infiltration and Insulitis
[0123] Following the 7 week treatment, mice were sacrificed and
perfused transcardially with 10 ml of PBS followed by 50 ml of 4%
paraformaldehyde in PBS. Fresh frozen sections of the pancreas were
collected (Samsam et al., 2003). The pancreas was removed,
post-fixed overnight, and then cryo-protected by serially passing
through 10%, 20% and 30% sucrose solutions in PBS. The pancreatic
tissue was then immersed in Tissue Tek freezing medium (Vector
labs) and frozen in liquid nitrogen-cooled isomethylbuthane
(isopathane, Sigma). Ten micrometer (.mu.m) thick frozen sections
of the pancreas were then prepared using a cryostat. Pancreas
cryosections were stained with Hematoxillin and Eosin, dehydrated
in serial graded alcohol solutions, and the slides were cover
slid.
[0124] Insulitis levels were measured based on the extent of the
lymphocyte infiltration of the islets of Langerhans. At least 50
sections per animal were scored, the degree of insulitis was scored
based on a 5 level scale ranging from 1-5, where score 1 is a
normal islet with no sign of T-cell infiltration, and score 5
indicates increasing of insulitis.
Immunohistochemistry for Insulin, Caspase-3, Interleukin (IL) 4 and
IL10
[0125] Immunohistochemistry for the localization of insulin,
caspase-3 (a final molecule of apoptosis), and the
immunosuppressive cytokines IL4 and IL10 were performed on the
pancreas cryosections. Sections were blocked with 10% BSA (bovine
serum albumin) containing 0.3% Triton-X 100.
[0126] Polyclonal guinea pig anti-insulin, polyclonal rabbit
anti-caspase-3, rat monoclonal anti-IL4 and anti-IL10 primary
antibodies (Invitrogen) were diluted at a concentration of 1:300 in
1% BSA in PBS containing 0.3% Triton-X. Fluorescent conjugated
secondary antibodies were goat anti-guinea pig-Alexa Fluor 488
(green), goat anti-rabbit-Alexa Fluor 555 (red), and goat anti-rat
Alexa Fluor 555 (red, Invitrogen).
Antibody Titer
[0127] Serum and intestinal antibodies were assayed for the
presence of anti-insulin and anti-CTB antibodies using colorimetric
ELISA methods. Ninety-six well plates were coated with either CTB
or human insulin (Sigma). Serial dilutions of serum or supernatants
of fecal pellets collected from the different animal groups were
added to the coated microtiter plate wells. Secondary antibodies
were horseradish peroxidase (FIRP)-conjugated anti-mouse IgG2a,
IgG1, or IgA antibodies (BD Pharmingen, USA) at a concentration of
1:3000 in PBS containing 0.1% Tween-20 and 3% milk powder. The
plates were washed with 200 .mu.l of PBS, and the substrate
tetra-methyl benzidine (TMB) was added to the wells and incubated
in the dark at 37.degree. C. for 20 minutes. The reaction was
stopped by adding 50 .mu.l of H2SO4 and the plates were read on a
plate reader (Dynex Technologies) at 450 nm.
Results
[0128] Vector Construction of pLD-5'UTR-CTB-Human Proinsulin
(5CP)
[0129] The CTB-Pris fusion gene was inserted into the chloroplast
transformation vector pLD-ctv for homologous recombination into the
tobacco chloroplast genome The pLD vector contains the trnI and
trnA flanking sequences utilized to facilitate homologous
recombination into the inverted repeat region of the tobacco
chloroplast genome. The 5CP construct was expressed under the
control of the psbA 5'UTR/promoter in order to achieve
hyper-expression as previously demonstrated (Fernandez San-Millan
et al., 2003; Daniell et al., 2004c; Dhingra et al., 2004). The
aadA gene confers resistance to spectinomycin in order to select
for transformed shoots (Goldschmidt-Clermont 1991) and is regulated
by the 16S rRNA promoter. The 3'UTR located at the 3' end of the
introduced gene confers transcript stability (Stem and Gruissem
1987). The pLD vector also possesses the chloroplast origin of
replication (autonomously replicating sequence) located within the
trnI region (Kunnimalaiyaan and Nielsen, 1997) which promotes
replication of the plasmid following bombardment (FIG. 1). Crude
extracts from. coli clones that contained the 5'UTR-CTB-proinsulin
insert was subjected to SDS-PAGE/immunoblotting, along with
untransformed E. coli that served as a negative control. Following
immunoblot detection with the insulin antibody, the correct size
(-22 kDa) CTBProinsulin fusion protein was confirmed (FIG. 2, Lane
1).
Analysis of the Transgenic Chloroplast Genome Reveals
Homoplasmy
[0130] The chloroplast transgenic lines were subjected to Southern
blot analysis in order to confirm site-specific integration and to
determine whether they were homoplasmic or heteroplasmic.
Homoplasmy is achieved when all the copies of the genome within the
chloroplast have stably integrated transgenes. The gene-specific
probe (CTB-proinsulin) that was taken from the pLD-5CP vector by
MfeI/NotI digestion (FIG. 3A) (360 bp) bound to the proper
transgenic plant fragment but not wild-type plant fragment (FIG.
3C) following digestion of transgenic plant DNA with AflIII (FIG.
3B). This indicates that the gene of interest was integrated into
the correct region within the chloroplast genome and the
untransformed plant DNA showed no such hybridization. The flanking
sequence probe which contains the region of the trnI and trnA genes
was obtained by digestion of pUC-ct vector by BglII/BamHI digestion
(FIG. 3A). Chloroplast transgenic and untransformed plant DNA was
digested with AflIII (FIG. 3B). Upon hybridization with the
flanking sequence probe, transformed chloroplasts should yield a
6.4 kb fragment; untransformed plants, a 4.2 kb fragment. If the
4.2 kb fragment is not seen within the transgenic line, all the
chloroplast genomes carry the gene of interest, and homoplasmy has
been attained within our current limit of detection. Most of the
lines tested showed only the 6.4 kb fragment when hybridized to
transgenic plant DNA (FIG. 3D), indicating that homoplasmy was
indeed achieved within limits of detection.
CTB-Proinsulin Pentamers were Assembled in Transgenic
Chloroplasts
[0131] Immunoblots showed the presence of .about.22 kDa fusion
protein in the chloroplast transgenic lines. The formation of
monomers, dimers, trimers, tetramers, and pentamers of the CTB-Pins
fusion protein was also observed (FIG. 2). A similar banding
pattern was observed by immunodetection with both the proinsulin
monoclonal antibody (FIG. 2) and the CTB polyclonal antibody (data
not shown). Quantification of the fusion protein on western blots
was performed by comparing plant samples with a known quantity of
purified CTB and reading them on an alpha imager by spot
densitometry. Three different transgenic lines were found to
contain 358 .mu.g, 270 .mu.g and 364.8 .mu.g of CTB-proinsulin per
100 mg of leaf tissue, or approximately 30% of total soluble
protein (tsp). Quantification by Total Proinsulin ELISA Kit of
frozen plant tissue revealed that the same transgenic lines
contained 145 .mu.g, 95 .mu.g and 194 .mu.g of CTB-proinsulin per
100 mg of frozen leaf tissue, for a maximum of 13.8% tsp. Such
variation could be due to the use of fresh versus frozen plant
material for these assays or differences in sample preparation or
growth conditions.
Blood Glucose Levels of NOD Mice Treated with CTB-Human Proinsulin
were Lowered
[0132] We divided the NOD mice into four groups fed once a week for
seven weeks beginning at week 5. Each group differed only by the
plant material they were fed. We fed one group untransformed plant
material to control for the potential effects of plant material
alone. One group received transgenic plant material expressing
Cholera toxin B subunit-GFP fusion protein (CTB-GFP; Limaye et al,
2006) to assess the effects of high levels of conjugated CTB.
Another group received transgenic plant material expressing
interferon alpha 5 conjugated to GFP (IFN-GFP) as yet another
control of GFP without CTB. The last group received CTB-Pins, which
we hypothesized would protect against the onset of insulitis in
these mice.
[0133] Blood and urine glucose levels of the treated NOD mice were
measured twice, at weeks 6 and 7. The blood glucose values of all
groups in this study at both time points tested were below 200
mg/dl, and therefore considered to be within a normal, nondiabetic
range. This was not an unforeseen possibility, since NOD mice
typically do not develop high blood glucose until 12-15 weeks age
(Arakawa et al, 1998). However, the CTB-Pins treated animals tended
to have lower blood glucose values than the control groups (data
not shown). Likewise, urine glucose values were also within normal
limits.
Lymphocytic Infiltration of the Endocrine Part of Pancreas
(Insulitis)
[0134] Insulitis is characterized by lymphocytic infiltration of
the pancreatic islets, accompanied by the secretion of
proinflammatory cytokines, which leads to the destruction of the
pancreatic islets, including the insulin producing beta cells. We
collected pancreata from twelve week old NOD mice from the
different treatment groups to assess the degree of insulitis.
Representative sections prepared from each treatment group showed
that oral administration of transgenic plant material expressing
CTB-Pins led to much less destructive cellular infiltration of the
pancreatic islets as compared to the other experimental groups
(FIG. 4).
[0135] To quantify and compare the insulitis of each treatment
group, cellular infiltrations were scored blindly according to the
following: no islet cellular infiltration or pre-islet infiltration
were scored 1, minimal infiltrations were scored 2, moderate
infiltrations were scored 3, and severe infiltrations were scored 4
(FIG. 5). When more than 80% of the islets were infiltrated, the
score was 5 (FIG. 5). Accordingly, fifty sections per animal were
analyzed and the average score indicated that the pancreata from
NOD mice administered CTB-Pins had minimal cellular infiltration,
and this reduction in cellular infiltration is significantly less
than all other treatment groups (FIG. 6).
Preservation of the Insulin Producing .beta.-Cells following Oral
Delivery of CTB-Pins
[0136] We next wanted to determine if the remaining .beta.-cells
represented in the pancreata of the different treatment groups were
apoptotic. Because cellular infiltration can lead to apoptosis,
this could be used as a hallmark to study type 1 diabetes.
Therefore, we labeled sections with insulin and caspase-3, a known
marker for apoptosis (Riedl & Shi, 2004). We found that the
.beta.-cells from NOD mice administered CTB-Pins rarely expressed
caspase-3, suggesting that apoptosis was prevented in these cells
(FIG. 7). In the other experimental groups, even the very few
remaining insulin-producing .beta.-cells expressed activated
caspase-3, suggesting that they were undergoing apoptosis (FIG.
7).
Induction of Th2 Response and Production of Immunosuppressory
Cytokines
[0137] Oral administration of CTB-Pins to the NOD mice led to an
increased recruitment of immunosuppressive cytokine-producing cells
(lymphocytes) to the pancreas. A large number of IL10- or
IL4-producing cells are seen proximal to the pancreatic islets,
which are recruited through the circulation (FIGS. 8 & 9). This
process is supported by significant perivascular migration of IL4-
and IL10-expressing cells seen in the pancreas of CTBPins treated
NOD mice (FIGS. 8 & 9). Blood vessels were distinguished from
ducts as follows. The internal layer lining the blood vessels is
comprised of endothelium, a thin, flat layer different from the
more cuboidal lining of the ducts. These latter structures are
thicker with a narrower lumen. In addition, endocrine glands are
ductless glands. Although the pancreas has both endocrine and
exocrine parts, the blood vessels are more likely to be found close
to the endocrine parts where the products are secreted out of the
cell and absorbed into the blood vessels, which must be in close
contact to the endocrine cells. The third reason to believe that
blood vessels are depicted is that blood cells should be found in
the blood vessels and not the ducts. Also, there are no reports of
immune attack against or regulatory process in favor of the
pancreatic ducts.
Serum and Intestinal Immunoglobulin Levels following Oral Delivery
of CTB-Pins
[0138] Serum and intestinal mucosal immunoglobulin (Ig) levels were
determined by ELISA using CTB as the capture antigen. Serum levels
of IgG1 increased in NOD mice treated with CTB-Pins expressing
plant leaf material as compared to the control groups. There were
low serum IgG2a and mucosal IgA levels against CTB observed among
NOD mice treated with untransformed plant leaf material or plants
expressing CTB-IFN or CTB-GFP or CTB-Pins (FIG. 10).
Discussion
[0139] Oral administration of antigens represents a potential way
to induce oral tolerance. Tolerance refers to the state of lowered
systemic responsiveness toward an antigen following oral delivery.
Both active and passive forms of tolerance can be induced,
dependent upon the dose of antigen and the route of administration.
The passive form is the functional inactivation of antigen specific
lymphocytes and is selective for only pre-existing effectors. The
active form of tolerance operates through the action of regulatory
lymphocytes that are able to down-modulate inflammation via
bystander suppression of effector cells. Bystander suppression is
viewed as a form of immunoregulation rather than tolerance (Homman
et al., 1999b).
[0140] Mucosal immunity generated by oral delivery is a protective
immune response manifested by Th-2 type cytokines such as IL-4, IL
10, and TGF-.beta.. Antigen taken orally leads to presentation in
the intestinal mucosa, which is able to generate protective Th-2
cells in the gutassociated lymphoid tissue (GALT), such as the
Peyer's patches. The antigen utilized is important because its
nature may determine the type of cytokines produced by the antigen
specific T-cells, it must direct the mucosal-derived T-cells to
migrate to the organ of interest, and it must then be able to
down-regulate the localized immune response (Gottlieb and
Eisenbarth 2001). Previous studies have demonstrated that insulin
given orally to non-obese diabetic (NOD) mice reduced the level of
diabetes by 50%, and the protection was associated with the
development of a Th-3-type response, specifically TGF-.beta.
producing T-cells (Zhang et al., 1991).
[0141] Oral tolerance induced by autoantigens has been applied
successfully as a therapeutic tool in experimental models of
autoimmune diseases (Strobel et al., 1998). The basic mechanism of
oral tolerance in humans is currently a work in progress, and oral
antigen administration regimens have resulted in limited success
when applied to patients (Garside et al., 1999, Pozzilli et al.,
2000b, Chailous et al., 2000). A possible explanation for the
limited success could be due to the fact that the doses of the
orally administered antigens to humans was too low compared to
those we delivered to mice, considering the surface area of the
intestinal absorptive epithelium (Pozzilli et al., 2000a). In this
case, CTB may serve as the necessary co-factor required to overcome
the inefficient presentation of insulin to the mucosal T-cells,
resulting from the limited transport of native insulin across the
epithelial layer. In order for oral tolerance to become a realistic
therapy for human autoimmune diseases, adjuvants that possess the
ability to enhance the tolerogenic potential of orally delivered
antigens need to be identified. The coupling of autoantigens--in
this case, proinsulin--to the non-toxic Cholera toxin B subunit
(CTB) dramatically increases their tolerogenic potential (Sun et
al., 1994, Bergerot et al., 1997; Arakawa et al., 1998). This
effect is mediated by the ability of CTB to act as a transmucosal
carrier, although CTB may have a direct affect on the immune system
(Burkart et al., 1999, Li et al., 1996). The current primary
limitation in advancing this concept in clinical trials is the low
levels of expression in transgenic plants (Bergerot et al., 1997).
Therefore, this limitation can be overcome by the hyperexpression
of CTB-proinsulin fusion protein in transgenic chloroplasts.
[0142] Previous studies to express CTB-proinsulin fusion protein in
plants were performed with potato plants (Arakawa et al., 1998).
Expression levels in nuclear transgenic potato plants were
0.05-0.1% total soluble protein (tsp). The low expression levels
required feeding NOD mice with large amounts of fresh potatoes. In
this study, we have expressed CTB-proinsulin fusion protein in
transgenic tobacco chloroplasts to levels at least 130-300-fold
greater than those in nuclear transgenic potatoes. As such, we fed
the NOD mice 8 mg of leaf tissue per week, which is a 375-fold
lesser amount of plant tissue compared to the 3 g per week used
previously (Arakawa et al, 1998). Using these small concentrated
doses reduces the possibility of potential confounding effects of
leaf tissue and eliminates the need to process or purify the plant
material. Such hyperexpression of CTB-Proinsulin should make this
fusion protein abundantly available for animal studies in NOD mice.
Expression of CTB-Proinsulin within transgenic chloroplasts also
eliminates the detrimental effects that occurred to nuclear
transgenic proteins in the cytoplasm (Mason et al., 1999).
Secondly, the expression of the foreign gene within chloroplasts
provides a safeguard for transgene containment due to maternal
inheritance of the plastid genome (Daniell, 2002) and engineered
cytoplasmic male sterility (Ruiz & Daniell, 2005). Oral
delivery of biopharmaceutical proteins expressed in plant cells
reduces their cost of production, purification, processing, cold
storage, transportation and delivery.
[0143] Oral administration of self antigens such as insulin leads
to their uptake by the gut associated lymphoid tissue (GALT),
including the intestinal mucosal M cells, which pass the antigen to
underlying antigen presenting cells, such as macrophages and
dendritic cells (Limaye et al., 2006). This leads to the activation
of T-cells and induction of a Th2 cell response, which is
characterized by the up-regulation of immunosuppressive cytokines
(such as IL10 and IL4) and serum antibodies (such as IgG1 but not
IgG2a) (Salmound et al., 2002, Farier and Weiner 2005). No
significant increase in mucosal IgA was seen in our study in
CTB-Pins treated mice versus the control groups.
[0144] The presence of CTB in the intestine ensures an effective
receptor-mediated oral delivery of intact plant-derived fusion
protein across the intestinal mucosa via binding of CTB to the GM1
ganglioside receptor and uptake by intestinal M cells and
enterocytes. Taken together, the data presented here suggest that
the suppression of the disease was mediated by regulatory
Th-2-cells. Since T-cell regulation is a major player in mucosal
immunity, oral administration of an autoantigen can be used to
treat autoimmune diseases in animal models by generating active
T-cell suppression. Mucosal autoantigen administration represents a
potential way to establish tolerance towards autoantigens and the
prevention of autoimmune diseases. Several autoimmune diseases and
their antigens are known: Multiple Sclerosis (MBP and PLP),
Arthritis (Type II collagen), Uvetis (S-antigen and IRBP),
Myasthenia gravis (AChR) and Thyroiditis (Thyroglobin) (Hafler and
Weiner 1997).
[0145] One previous human clinical study on the oral delivery of
insulin was unsuccessful (Skyler et al., 2005) because insulin was
not protected from digestive enzymes and acid hydrolysis. In this
study, however, insulin was protected by bioecapsulation within
plant chloroplasts. Future experiments involving the CTBProinsulin
construct, including human clinical trials, will utilize cultured
cells free of nicotine or other alkaloids instead of leaves,
although the amount of nicotine present will be negligible.
Additionally, we used 5-week old mice in this study to demonstrate
the alleviation of symptomatic pancreatic insulitis and
preservation of insulin-producing .beta.-cells in mice, a condition
that mimics human type 1 diabetes. Based on the success of the
concept in older mice (Harrison et al., 1996), this strategy is
likely to work not only prior to the onset of diabetes, but also at
later stages of this autoimmune disease.
REFERENCES
[0146] Arakawa T, Yu J, Chong D, Hough J, Engen P, Langridge W.
(1998). A plant-bases cholera toxin B subunit-insulin fusion
protein protects against the development of autoimmune diabetes.
Nature, 16: 934-38 [0147] Bergerot, IPloix, C., Petersen, J.,
Moulin. V., Rask, C., Fabien, N. (1997) A cholera toxoid-insulin
conjugate as an oral vaccine against spontaneous autoimmune
diabetes. Proc. Natl. Acad. Sci. USA 94:4610-4614. [0148] Bhati A.
(2005) Expression of Hepatitic C viral non structural 3 protein in
transgenic chloroplast Master's Thesis, University of Central
Florida [0149] Burkart V, Kim Y, Kauer M, Kolb H. (1999) Induction
of tolerance in macrophages by cholera toxin B chain. Pathobiology.
67(5-6):314-7 [0150] Chaillous L, Lefevre H, Thivolet C, Boitard C,
Lahlou N, Atlan-Gepner C, Bouhanick B, Mogenet A, Nicolino M, Carel
J C, Lecomte P, Marechaud R, Bougneres P, Charbonnel B, Sai P:
(2000) Oral insulin administration and residual beta-cell function
in recent onset type 1 Diabetes: a multicentre randomised
controlled trial. Diabete Insuline Orale group. Lancet 356: 545-549
[0151] Daniell, H. (1997). Transformation and foreign gene
expression in plants mediated by microprojectile bombardment. Meth
Mol. Biol. 62:453-488. [0152] Daniell, H. (2002) Molecular
strategies for gene containment in transgenic crops. Nat.
Biotechnol. 20, 581-586. [0153] Daniell, H. Datta, R. Varma, S.
Gray, S, and Lee, S. B. (1998) Containment of herbicide resistance
through genetic engineering of the chloroplast genome. Nat.
Biotechnol. 16, 345-348. [0154] Daniell, H. Lee, S. B. Panchal, T.
and Wiebe, P.O. (2001) Expression of cholera toxin B subunit gene
and assembly as functional oligomers in transgenic tobacco
chloroplasts. J. Mol. Biol. 311, 1001-1009. [0155] Daniell, H.
Kahn, M. and Allison, L. (2002) Milestones in chloroplast genetic
engineering: an environmentally friendly era in biotechnology.
Trends Plant Sci. Vol. 7, No. 2 84-91. [0156] Daniell H, Cohill P,
Kumar S, Dufourmantel N, Dubald M. (2004a) Chloroplast genetic
engineering. H Daniell and C Chase, eds, Molecular biology and
biotechnology of plant organelles, Kluwer Academic Publishers,
Dordrecht, pp. 423-468. [0157] Daniell H, Carmona-Sanchez O, Burns
B B. (2004b) Chloroplast derived antibodies, biopharmaceuticals and
edible vaccines. In R Fischer and S Schillberg eds, Molecular
Farming Weinheim: WILEY-VCH Verlag, pp. 113-133. [0158] Daniell H,
Ruiz O N, Dhingra A. (2004c) Chloroplast genetic engineering to
improve agronomic traits. Methods in Molecular Biology 286:
111-137. [0159] Daniell H, Kumar S, Dufourmantel N. (2005a)
Breakthrough in chloroplast genetic engineering of agronomically
important crops. Trends Bioteclinol. 23:238-45 [0160] Daniell H,
Chebolu S, Kumar S, Singleton M, Falconer R. (2005b)
Chloroplastderived vaccine antigens and other therapeutic proteins.
Vaccine 23:1779-1783. [0161] DeGray, G. Rajasekaran, K. Smith, F.
Sanford, J. and Daniell, H. (2001) Expression of an antimicrobial
peptide via the chloroplast genome to control phytopathogenic
bacteria and fungi. Plant Physiology. 127, 852-862. [0162] Dhingra
A, Portis A R Jr, Daniell H. (2004) Enhanced translation of a
chloroplast expressed RbcS gene restores small subunit levels and
photosynthesis in nuclear RbcS antisense plants. Proc Natl Acad Sci
USA. 2004 Apr. 20; 101(16):6315-20. Epub April 5. [0163] Ekberg K,
Brismar T, Johansson B L, Jonsson B, Lindstrom P, Wahren J. (2003)
Amelioration of sensory nerve dysfunction by C-Peptide in patients
with type 1 diabetes. Diabetes. February; 52(2):536-41. [0164]
Faria A M, Weiner H L. (2005) Oral tolerance. Imnunol Rev. August;
206:232-59. Review. [0165] Fernandez-San Millan, A. Mingeo-Castel,
A. M. Miller, M. and Daniell, H. (2003) A chloroplast transgenic
approach to hyper-express and purify Human Serum Albumin, a protein
highly susceptible to proteolytic degradation. Plant Biotechnology
Journal. 1, 71-79. [0166] Garside P, Mowat A M, Khoruts A. (1999)
Oral tolerance in disease. Gut. January; 44(1):137-42. Review.
[0167] Goldschmidt-Clermont, M. (1991) Transgenic expression of
aminoglycoside adenine transferase in the chloroplast: a selectable
marker for site-directed transformation of Chlamydomonas. Nuc.
Acids Res. 19, 4083-4089 [0168] Gottlieb P A., and Eisenbarth G S.
(2002) Insulin-specific tolerance in diabetes. Clinical Immunology.
1: 2-11 [0169] Grevich, J. J. & Daniell, H. (2005) Chloroplast
genetic engineering: Recent advances and future perspectives.
Critical reviews in Plant sciences. 24: 83-107. [0170] Guda, C.
Lee, S. B. and Daniell, H. (2000) Stable expression of
biodegradable protein based polymer in tobacco chloroplasts. Plant
Cell Rep. 19, 257-262. [0171] Hafler and Weiner (1997) Oral
tolerance for the treatment of Autoimmune diseases. Novel
therapeutic agents for the treatment of autoimmune diseases. Marcel
Dekker inc. New York, Ch 17. pp. 201-220 [0172] Halban P A. (1991)
Structural domains and molecular lifestyles of insulin and its
precursors in the pancreatic beta-cell. Diabetologia. 1991
November; 34(11):767-78. Review [0173] Harrison L. C.,
Dempsey-Collier M., Kramer D R, Takahashi K. (1996) Insulin induces
regulatory CD8 T Cells that prevent murine insulin-dependent
diabetes. J. Exp. Med. Volume 184 December 2167-2174 [0174] Homann
D., Dyrberg, T., Petersen, J., Oldstone M. B., and von Herrath M.
G. (1999a) Insulin in oral immune (tolerance): a one-amino acid
change in the B chain makes the difference, J. Immunol. 163 (4),
pp. 1833-1838. [0175] Homann D, Holz A, Bot A, Coon B, Wolfe T,
Petersen J, Dyrberg T P, Grusby M J, von Herrath M G. (1999b)
Autoreactive CD4+ T cells protect from autoimmune diabetes via
bystander suppression using the IL-4/Stat6 pathway. Immunity.
October; 11(4):463-72. [0176] Horton R M, Hunt H D, Ho S N, Pullen
J K, Pease L R. (1989) Engineering hybrid genes without the use of
restriction enzymes: gene splicing by overlap extension. Gene.
April 15; 77(1):61-8 [0177] Kota M, Daniell H, Varma S, Garczynski
S F, Gould F, Moar W J. (1999) Overexpression of the Bacillus
thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers
resistance to plants against susceptible and Bt-resistant insects.
Proc Natl Acad Sci U S A. 1999 Mar. 2; 96(5):1840-5 [0178] Koya V,
Moayeri M, Leppla S E, Daniell E. (2005) Plant-based vaccine: mice
immunized with chloroplast-derived anthrax protective antigen
survive anthrax lethal toxin challenge. Infect Immun. December;
73(12):8266-74 [0179] Kumar S, Dhingra A, Daniell H. (2004a)
Plastid-expressed betaine aldehyde dehydrogenase gene in carrot
cultured cells, roots, and leaves confer enhanced salt tolerance.
Plant Physiol 136: 2843-2854 [0180] Kumar S, Dhingra A, Daniell R.
(2004b) Stable transformation of the cotton plastid genome and
maternal inheritance of transgenes. Plant Mol Biol 56:203-216.
[0181] Kunnimalaiyaan M, Nielsen B L. (1997) Fine mapping of
replication origins (ori A and ori B) in Nicotiana tabacum
chloroplast DNA. Nucleic Acids Res. September 15; 25(18):3681-6.
[0182] Lee, S. B. Kwon, H. B. Kwon, S. J. Park, S. C. Jeong, M. J.
Han, S. E. Byun, M. O. and [0183] Daniell, H. (2003) Accumulation
of trehalose within transgenic chloroplasts confers drought
tolerance. Mol. Breeding. 11, 1-13. [0184] Leelavathi S, Reddy V S.
(2003) Chloroplast expression of His-tagged GUS-fusions: a general
strategy to overproduce and purify foreign proteins using
transplastomic plants as bioreactors. Mol. Breed. 11: 49-58. [0185]
Li T K; Fox B S. (1999) Cholera toxin B subunit binding to an
antigen-presenting cell directly co-stimulates cytokine production
from a T cell clone. Int Immunol. 8:1849-56. [0186] Limaye, A., V.
Koya, S. M., and H. Daniell. (2006) Receptor mediated oral delivery
green fluorescent protein expressed in transgenic chloroplasts into
the mouse circulatory system. FASEB (in press) [0187] Mason H., Haq
T A., Clements J D., Arntzen C J. (1999) Edible vaccine protects
mice against Escherichia coli heat-labile enterotoxin (LT):
potatoes expressing a synthetic LTB gene. Vaccine, Vol. 16, No. 13,
pp. 1336-1343, 1998 [0188] Molina A, Herva-Stubbs S, Daniell H,
Mingo-Castel A M, Veramendi J. (2004) High yield expression of a
viral peptide animal vaccine in transgenic tobacco chloroplasts.
Plant Biotechnol. Journal 2:141-153. [0189] Nagata M, Santamaria P,
Kawamura T, Utsugi T, Yoon J W. (1991) Evidence for the role of
CD8+ cytotoxic T cells in the destruction of pancreatic beta-cells
in nonobese diabetic mice. J. Immunol. 1994 Feb. 15;
152(4):2042-50. [0190] Pozzilli P, Gisella Cavallo M. (2000a) Oral
insulin and the induction of tolerance in man: reality or fantasy?
Diabetes Metab Res Rev. September-October; 16(5):306-7. [0191]
Pozzilli P, Pitocco D, Visalli N, Cavallo M G, Buzzetti R, Crino A,
Spera S, Suraci C, Multari G, Cervoni M, Manca Bitti M L, Matteoli
M C, Marietti G, Ferrazzoli F, Cassone Faldetta M R, Giordano C,
Sbriglia M, Sarugeri E, Ghirlanda G (2000b) No effect of oral
insulin on residual beta-cell function in recent-onset type I
diabetes (the IMDIAB VII). IMDIAB Group. Diabetologia 43:1000-1004
[0192] Prodromou C, Pearl L H. (1992) Recursive PCR: a novel
technique for total gene synthesis. Protein Eng. December;
5(8):827-9. [0193] Riedl S J, Shi Y. Molecular mechanisms of
caspase regulation during apoptosis. Nat Rev Mol Cell Biol. 2004
November; 5(11):897-907 [0194] Ruiz, G. (2002) Optimization of
codon composition and regulatory elements for expression of the
human IGF-1 in transgenic chloroplasts. Master's Thesis, University
of Central Florida, USA. [0195] Ruiz O N, Hussein H, Terry N,
Daniell H. (2003) Phytoremediation of organomercurial compounds via
chloroplast genetic engineering. Plant Physiol. 132: 1344-1352.
[0196] Ruiz, O. & Daniell, H. (2005). Engineering Cytoplasmic
male sterility via. The chloroplast Genome by expression of
.beta.-ketothiolase. Plant Physio. 138, 232-246. [0197] Salmond R
J, Luross J A, Wiffliams N A. (2002) Immune modulation by the
cholera-like enterotoxins. Expert Rev Mol. Med. Oct. 1; 2002:1-16.
Review. [0198] Samsam M, Mi W, Wessig C, Zielasek J, Toyka K V,
Coleman M P, Martini R (2003)
[0199] The Wlds mutation delays robust loss of motor and sensory
axons in a genetic model for myelin-related axonopathy. J.
Neurosci. 1; 23(7):2833-9. [0200] Singleton M L. (2003) Expression
of CaF1 and LcrV as a fusion protein for development of a vaccine
against Yersisnia pestis via chloroplast genetic engineering.
Master's Thesis, University of Central Florida. [0201] Skyler J S.,
Krishner J P., Wolfsdorf J., Cowie C., Plamer J P., Greenbaum C.,
Cuthbertson D., Rafkin-Mervis L E., Chase B P., and Leschek E.
(2005) Effects of oral insulin in relatives of patients with type 1
diabetes. Diabetes Care 28: 1068-1076 [0202] Staub J M, Garcia B,
Graves J, Hajdukiewicz P T, Hunter P, Nehra N, Paradkar V,
Schlittler M, Carroll J A, Spatola L, Ward D, Ye G, Russell D A
(2000) High-yield production of a human therapeutic protein in
tobacco chloroplasts. Nat. Biotechnol. 18: 333-338. [0203] Stern D
B, Gruissem W (1987) Control of plastid gene expression: 3'
inverted repeats act as mRNA processing and stabilizing elements,
but do not terminate transcription. Cell. 51: 1145-57. [0204]
Strobel S, Mowat A M. (1998) Immune responses to dietary antigens:
oral tolerance. Immunol Today. April; 19(4):173-81. Review. [0205]
Sun, J-B., Holmgren J. Czerkinsky C. (1994). Cholera toxin B
subunit: an efficient transmucosal carrier-delivery system for
induction of peripheral immunological tolerance. Proc Natl Acad
Sci. USA 91: 10795-10799. [0206] Tregoning J S, Nixon P, Kuroda H,
Svab Z, Clare S, Bowe F, Fairweather N, Ytterberg J, van Wijk K J,
Dougan G, Maliga P. (2003) Expression of tetanus toxin fragment C
in tobacco chloroplasts. Nucleic Acids Res. 31: 1174-1179. [0207]
Watson J, Koya V, Leppla S, Daniell H. (2004) Expression of
Bacillus anthracis protective antigen in transgenic chloroplasts of
tobacco, a non-food/feed crop. Vaccine 22: 4374-4384. [0208] Zhang
Z J, Davidson L, Eisenbarth G, Weiner H L. (1991) Suppression of
diabetes in nonobese diabetic mice by oral administration of
porcine insulin. Proc Natl Acad Sci USA. November 15; 88
(22):10252-6
EXAMPLE 2
Expression of a Cholera Toxin B Subunit-Rotavirus Enterotoxin
Fusion Gene in Transgenic Nicotiana Tabacum Chloroplast
Introduction
[0209] Rotavirus, the major cause of life-threatening infantile
gastroenteritis, is a member of the Reoviridae family and is
considered to be the single most important cause of virus-based
severe diarrheal illness in infants and young children particularly
6 months to 2 years of age in industrialized and developing
countries. Rotaviruses belong to the family Reoviridae and are
spherical 70-nm particles. The virus genome contains 11 segments of
double-stranded RNA, each encoding a viral capsid or nonstructural
protein [1]. The identification of a rotavirus nonstructural
protein gene (NSP4) encoding a peptide, which functions both as a
viral enterotoxin and as a factor involved in the acquisition of
host cell membrane during virus budding from cells, provides a new
approach for mucosal immunization. NSP4 has been designated as the
viral enterotoxin as it was demonstrated that a peptide derived
from its cytoplasmic domain is enough to cause Diarrhea in 3-Day
old mice [2]. Various critical functions of NSP4 at the molecular
level have also been identified; it plays a major role in viral
morphogenesis by functioning as an intracellular receptor to aid in
the budding of subviral particles into the endoplasmic
reticulum(ER) [3]. It has been demonstrated that NSP4 possesses
membrane destabilization activity on ER by mobilizing intracellular
calcium and hence increasing its levels in intestinal cells. It
also affects the membrane trafficking from the ER to the Golgi
complex with its ability to bind to the micro tubules [4]. NSP4
induced intracellular calcium mobilization may be responsible for
some of the cellular aspects of rotavirus pathogenesis as this
increase in intracellular calcium ultimately stimulates endogenous
fluid secretory pathway in the intestinal mucosa [5]. These above
attributes of C-terminal portion led to the use of the truncated
form of NSP4 with 90 amino acids as a good candidate for rotavirus
vaccine antigen instead of the full length NSP4. Cholera toxin B
subunit (CTB) of Vibrio cholera has been shown to function
efficiently as an adjuvant and carrier molecule for foreign
proteins and especially for mucosal vaccines. Direct linking of
small antigens with CTB results in specific targeting of the
antigens to the mucosal immune system through its specific binding
affinity to GM1 receptors of enterocytes and also increases the
local antigen concentration at the mucosal surface. Hence the
immune response to CTB-NSP4 fusion protein is expected to be lot
stronger.
[0210] Presently there is no available vaccine for rotavirus
included in national immunization systems, the only live
tetravalent rhesus-human reassortant vaccine (RRV-TV; Rotashield)
for rotavirus was licensed in 1998 in USA but withdrawn from market
in 1999 for possible association with intussusception.sup.7. Among
the various protein expression systems available, genetically
engineered plants are considered to be most economical. As lot of
investment is needed to establish and maintain the industrial
facilities using fermentation or bioreactors when compared to the
technology that is already available for harvesting and processing
plants and plant products on a large scale [8, 9]. Plant-derived
products are less likely to be contaminated with human pathogenic
microorganisms than those derived from animal cells because plants
don't act as hosts for human infectious agents 10. Recombinant
proteins expressed in plant cells are naturally protected from
degradation when taken orally 11. The levels of recombinant
proteins expressed in transgenic plants by nuclear system have been
observed to be less than 1% of total soluble protein which is
considered to be commercially unfeasible for protein purification
8.
[0211] The inventors have realized that one of the most attractive
alternative means for achieving higher expression levels of foreign
proteins in plants is through the chloroplast transformation.
Chloroplast transformation is considered to be an ideal system for
expressing foreign proteins as it offers several advantages like
high-level transgene expression 12, proper folding of proteins,
multi-gene engineering in a single transformation event 12, 13,
transgene containment via maternal inheritance [14, 15, 16, 17],
lack of gene silencing, position effect due to site-specific
transgene integration. Chloroplasts also possess the ability to
accumulate any foreign proteins in large amounts that could
otherwise be harmful if they were in the cytoplasm. For example CTB
an oral subunit vaccine for cholera was not toxic when expressed in
transgenic plastids in very high quantities which were otherwise
toxic when expressed in leaves by nuclear transformation.
Trehalose, a pharmaceutical industry preservative was toxic when
accumulated in cytosol where as was non toxic when
compartmentalized in plastids by chloroplast expression
system.sup.14,18.
[0212] The various vaccine antigens and therapeutic proteins have
been successfully hyperexpressed via the chloroplast genetic
engineering. Vaccine antigens that have already been expressed in
the chloroplast include the Cholera toxin B-subunit (CTB) 15, the
F1.about.V fusion antigen for plague 19, the 2L21 peptide from the
Canine Parvovirus (CPV) 20, Anthrax Protective antigen (PA) 21,
LecA protein as vaccine antigen for Entamoeba histolytica 22, NS3
protein as vaccine antigen for hepatitis C 23, C terminus of
Clostridium tetani (TetC) (24, 25) and therapeutic proteins like
Human Serum Albumin 26, Magainin 27, Interferon and Insulin like
growth factor 28.
[0213] Plastid transformation has been proven to be highly
successful in tobacco. The popularity of tobacco is due to the
availability of well defined regulatory elements for the transgene
expression. Tobacco being a non food, non feed crop carries a
reduced risk of transgenic maternal or recombinant proteins
contaminating feed and human food chains. One of the other
advantages of tobacco crop is its ability to yield high biomass
(produces in excess of 40 metric tones of leaf fresh weight per
acre on multiple harvests annually) with low maintenance and
cost.sup.29,30. For these attractive reasons tobacco plastid
transformation has been a successful vehicle for the large scale
production of human recombinant proteins and vaccines too.
[0214] The expression levels of CTB-NSP4 that were achieved in
transgenic potato by nuclear expression was about 0.006% to 0.026%
which is not feasible for purification 31. Hence the main objective
of this project is to express the surface antigen CTB-NSP4.sub.90
fusion gene in plants using the chloroplast expression system to
achieve high levels of expression to enhance the protective
efficacy and also develop a low cost vaccine for rotavirus.
Results
[0215] Construction of pLD-5'UTR-His-CTB-NSP4 vector for tobacco
chloroplast Transformation.
[0216] The pRSET vector with Histag-CTB-NSP4 cloned in its multiple
cloning sites was a gift from Dr William H R Langridge, Loma Linda
Univeristy School of Medicine. The goal was to clone the cassette
into the universal chloroplast transformation vector, pLD-Ctv under
the control of light regulated psbA 5'UTR regulatory sequence which
enhances the translation of the genes. The Histag-CTB-NSP4 gene
cassette in pRSET vector was digested with Nde I and EcoRI and
cloned into p-bluescript containing the 5'UTR regulatory sequence
as shown in FIG. 11C named as p-bluescript-5'UTR-Histag-CTB-NSP4.
The p-bluescript containing the 5'UTR-Histag-CTB-NSP4 cassette was
then digested with EcoRV and XbaI and was cloned into the universal
chloroplast transformation vector, pLD-Ctv within the EcoRV and
XbaI sites and was designated as pLD-AK as shown in FIG. 11D. The
pLD vector contains the homologous recombination sequences
(flanking sequences) that allowed the homologous recombination of
the gene cassette (aadA, 5''UTR-His-CTB-NSP4) in between the trnI
and trnA of the chloroplast genome 15. Downstream to the trnI, the
vector provided the constitutive 16S rRNA promoter, which regulates
the expression of aadA gene (aminoglycoside 3' adenyltransferase)
that confers resistance to spectinomycin-streptomycin and the
5'UTR-His-CTB-NSP4 gene encoding the cholera toxin B
subunit-rotavirus NSP4 enterotoxin fusion protein. Upstream to the
trnA, the vector contains the 3'UTR which is a transcript
stabilizer derived from the psbA gene.
[0217] After recovering in the dark for 48 hours from bombardment,
leaves were cut into 5 mm.sup.2 pieces and placed on RMOP 32 plates
containing 500 .mu.g/ml spectinomycin for Petite Havana, for the
first round of selection as described in Daniell 33,34,35. From 10
bombarded Petit Havana leaves, about 20 green shoots appeared after
4 weeks. For second round of selection the leaves were cut into 2
mm.sup.2 pieces and then transferred to fresh RMOP plates with 500
.mu.g/ml spectinomycin for Petite Havana 33, 35.
[0218] The shoots that appeared during the second round of
selection were tested positive for cassette integration into the
chloroplast genome by PCR analysis, were grown in sterile jars
containing fresh plant MSO medium with spectinomycin until the
shoots grew to fill the jars. Then the plants were transferred to
pots with soil containing no antibiotic. Potted plants were grown
in a 16 hour light/8 hour dark photoperiod in the growth chamber at
26.degree. C.
Transgene Integration in Chloroplast and Homoplasmy
[0219] After bombardment of tobacco leaves with gold particles
coated with plasmid DNA (pLD-5'UTR-His-CTB-NSP4), about 5
shoots/plate appeared after a period of 5-6 weeks. The shoots that
were obtained on the RMOP selection medium could be due to any one
of the three possible and two types of integration: chloroplast
transgenic, nuclear transgenic or mutant shoots. Spontaneous
mutation of the 16S rRNA gene, which confers resistance to
spectinomycin in the ribosome, could allow plants to grow on
spectinomycin without integration of the gene cassette which will
result in the mutant shoot growth. The aadA gene in the gene
cassette confers resistance to spectinomycin and hence the shoots
with the integration of the gene cassette in either nuclear or
chloroplast genome grow on the selection medium. True chloroplast
transformants were distinguished from nuclear transformants and
mutants by PCR analysis. Two primers, 3P and 3M were used to test
for chloroplast integration of transgenes 15. 3P primer lands on
the native chloroplast DNA in the 16S rRNA gene region and the 3M
primer lands on the aadA gene as shown in FIG. 1A. Nuclear
transformants were eliminated because 3P will not anneal and
mutants were eliminated because 3M will not anneal. The 3P and 3M
primers upon chloroplast integration of transgene will yield a
product of 1.65 kb size fragment as shown in FIG. 11B.
[0220] The Integration of the aadA, 5'UTR-His-CTB-NSP4 gene and
3'psbA UTR, were additionally tested by using the 5P and 2M primer
pair for the PCR analysis. The 5P and 2M primers annealed to the
internal region of the aadA gene and the internal region of the
trnA gene respectively as shown in FIG. 11A 15. The product size of
a positive clone is of 2.5 kb for CTB-NSP4, while the mutants and
the control do not show any product. FIG. 11C shows the result of
the 5P/2M PCR analysis. After PCR analysis using both primer pairs,
the plants were subsequently transferred through different rounds
of selection on spectinomycin media to obtain a mature plant and
reach homoplasmy.
Southern Analysis of Transgenic Plants
[0221] The plants that tested positive for the PCR analysis were
moved through three rounds of selection and were then tested by
Southern analysis for site specific integration of the transgene
and homoplasmy. The DNA of the full regenerated clones growing in
jars (third selection) was extracted and used for the Southern
analysis. The flanking sequence probe of 0.81 kb in size allowed
detection of the site-specific integration of the gene cassette
into the chloroplast genome; this was obtained by double digesting
the pUC-Ct vector that contained the trnI and trnA flanking
sequences (FIG. 12A) with BamHI and BglII 15. FIG. 12B shows the
HincII sites used for the restriction digestion of the plant DNA
for pLD-5'UTR-Histag-CTB-NSP4. The transformed chloroplast genome
digested with HincII produced fragments of 4.3 kb and 2.0 kb for
pLD-5'UTR-Histag-CTB-NSP4, while the untransformed chloroplast
genome that had been digested with HincII resulted in a 5.0 kb
fragment (FIG. 12D). The flanking sequence probe can also show if
homoplasmy of the chloroplast genome has been achieved through the
three rounds of selection. The plants expressing CTB-NSP4 showed
homoplasmy as there is no wild type band seen in transgenic lines
within the levels of detection. The gene specific probe CTB-NSP4 of
size approx. 0.7 kb was used to show the specific gene integration
producing a fragment of 11 kb when CTB-NSP4 transgenic plant DNA
was digested with ClaI as shown in FIGS. 12C and 12E.
Immunoblot Analysis
[0222] Crude protein extract of 20 ug, was loaded in each well of
the SDS-PAGE. The rabbit anti-NSP4.sub.90 antibodies (provided by
Dr. William Langridge, Loma Linda Univ. of Loma Linda) were used to
detect the 27 kDa and 135 kDa monomeric and pentameric forms
CTB-NSP4 fusion protein (FIG. 13). The wild type plant (Petit
havana) did not show any bands indicating that the anti-NSP4
antibodies did not cross react with any other proteins in the crude
extract. As the CTB-NSP4 expression level was 2.45% of TSP in
mature leaves, which indicates that there is 2.4 ug of the fusion
protein in 100 ug of TSP. the total crude protein extract loaded in
each well is 20 ug and so the expected amount of CTB-NSP4 fusion
protein present in 20 ug of TSP will be about 0.6 ug. Hence each of
the wells contains approximately about 0.6 ug of the CTB-NSP4
protein detected by the CTB-NSP4 antibodies.
Protein Quantification and Binding Affinity using GM1 Binding Assay
ELISA
[0223] The levels of pentameric CTB-NSP4 fusion protein in
transformed tobacco plants and its affinity for GM1-ganglioside was
evaluated by quantitative GM1 ELISA. The standard curve has been
obtained using different dilutions of purified CTB-NSP4. The
dilutions were made in 0.01 M phosphate buffered saline (PBS). The
primary antibody used was Rabbit antibody raised against
NSP4.sub.90 protein expressed and purified from E. coli BL21 cells
and secondary antibodies were donkey anti-rabbit antibodies
peroxidase conjugated. The percentage of CTB-NSP4 expressed was as
a percent of total soluble protein calculated using the Bradford
assay i.e. the percentage of CTB-NSP4 is inversely proportional to
the TSP values. The CTB-NSP4 expression levels reached a maximum of
2.45% of the total soluble protein in the mature leaves after 1 Day
of continuous light exposure due to increase in translation
obtained under the control of light regulated psbA 5,UTR as shown
in FIG. 14. The increased expression in mature leaves is due to
more number of chloroplasts and high number of chloroplast genomes
(upto 10,000 copies/cell) in the mature leaves. Also, the large
size and more number of mature leaves per plant contributed to the
higher levels of CTB-NSP4 in mature leaves.
Discussion
[0224] The pLD-5'UTR-Histag-CTB-NSP4 chloroplast transformation
vector containing the aadA gene, CTB-NSP4 coding region and 3'
psbA, integrates the transgene cassette into the transcriptionally
active trnI-trnA spacer region of the chloroplast genome via
homologous recombination. The site directed insertion of CTB-NSP4
into the chloroplast genome is achieved by homologous recombination
between trnI-tmA regions of pLD-5'UTR-His-CTB-NSP4 and plastid
genome which prevents any random integration of transgene that is
usually observed with nuclear transformation. Achieving high
expression of the CTB-NSP4 recombinant fusion protein in the
chloroplast depends on various factors. First, the pLD-His-CTB-NSP4
vector is designed to integrate into the inverted repeat region of
the chloroplast genome via homologous recombination. When the
CTB-NSP4 fusion gene is inserted into the IR region, the copy
number of the transgene gets doubled by a phenomenon know as copy
correction that recruits the introduced transgene into another IR
region 36,37). Increased copy number results in increased
transcript levels resulting in higher protein accumulation 35, 12.
Second, the psbA 5' UTR typically has stem loop structure which aid
in transcript stability and is also a binding site for translation
activation factors to enhance the binding of ribosomes to the mRNA
for efficient translation. Also the translation of psbA mRNA is
stimulated by light proposed to be mediated by a nuclear encoded
protein. The binding of the nuclear encoded (RB) protein and psbA
is directly dependent light which there by enhances the initiation
of translation. The redox potential generated by light reactions of
photosynthesis is used by chloroplast Protein Disulfide Isomerase
system and thioredoxin which then activate the binding of
translation activation factors to the ribosome binding sites in
psbA 5' UTR thereby enhancing the translation in the presence of
light 38. The expression of CTB-NSP4 in transgenic plant under
continuous light showed an increase in expression at Day 1. The
psbA 3'untranslated region (UTR) used for the regulation of
transgene expression has potential role in post transcriptional
stabilization by binding to different RNA binding proteins and help
in enhancing translation of the foreign protein 14. Third, the
pLD-His-CTB-NSP4 vector consists of a OriA site for origin of
replication within trnI flanking region allowing to attain
homoplasmy even in the first round of replication by increasing the
number of templates for integration into the chloroplast genome
(36, 37. To obtain an optimal production of the CTB-NSP4 fusion
protein and transgene stability, it is essential to achieve
homoplasmy through several rounds of selection on media containing
spectinomycin. If homoplasmy is not achieved, it could result in
heteroplasmy which leads to changes in the relative ratios of the
two genomes upon cell division. The presence of heteroplasmic
condition in a transgenic plant might retrograde back to the wild
type eliminating the transgene in the absence of selection pressure
in subsequent generations. The chimeric, aminoglycoside 3' adenyl
transferase (aadA) gene, conferring resistance to spectinomycin was
used as a selectable marker and its expression is driven by the 16S
(Prrn) promoter (15, 39). Spectinomycin binds the 70S ribosome and
inhibits translocation of peptidal tRNA's from the A site to the P
site during protein synthesis. The aadA gene codes for the enzyme
aminoglycoside 3' adenlyltransferase, which transfers the adenlyl
moiety of ATP to spectinomycin and inactivating it. Fourth,
chloroplast translation system provides the necessary enzymes for
proper folding and disulphide bond formation. Chaperonins present
in chloroplast are thought to aid in the folding and assembly of
non native prokaryotic and eukaryotic proteins (15, 40). Reversible
activation of genes that regulate expression in the chloroplast is
the Protein Disulfide Isomerase (PDI) system composed of
chloroplast polyadenylate-binding proteins that specifically bind
to the 5'UTR of the psbA mRNA and are modulated by redox status
through PDI (37). The ability of chloroplasts to form disulfide
bonds and properly fold foreign proteins eliminates a major part of
the costly downstream processing. The chloroplast expressed
CTB-NSP4 fusion protein folded properly into functional pentameric
form which was clearly seen on the immunoblot. The positive result
in GM1 binding assay with CTB-NSP4 has reconfirmed the pentamer
forms of CTB-NSP4 from transgenic tobacco chloroplasts.
[0225] Chloroplast transformants were distinguished from the
nuclear transformants and mutants by PCR analysis. Southern blot
analysis with gene specific CTB-NSP4 probe and flaking probe for
chloroplast genome was done to confirm the site-specific
integration of the gene cassette and also to determine the homo or
heteroplasmy. High protein expression levels were obtained in the
mature leaves after Day 1 of continuous light exposure of up to
2.45% of the total soluble protein which was quantified using the
GM1 binding assay.
[0226] The present study reports the successful expression of the
CTB-NSP4 fusion protein as pentameric forms. This opens the doors
for the expression of CTB-NSP4 in carrot plastids so as to enable
oral delivery of the vaccine antigen. The immunogenecity of the
vaccine antigen needs to be tested in an animal model which is
underway.
Materials and Methods
[0227] Construction of pLD-5'UTR-His CTBNSP4 Vector for
Transformation of Tobacco Chloroplast
[0228] Initially the gene cassette Histag-CTB-NSP4 was cloned
downstream to 5'UTR in p-bluescript between EcoRV and EcoRI sites.
Then the final gene cassette containing the 5'UTR and His-CTB-NSP4
(approximate size 0.7 kb) were digested with EcoRV and XbaI and
cloned into tobacco universal vector pLD-Ctv between EcoRV and
XbaI.
Bombardment and Transgenic Plant Regeneration
[0229] Sterile Nicotiana tabacum cv. Petit Havana tobacco leaves
were bombarded using the Bio-Rad PDS-1000/He biolistic device as
previously described [32,33,35]. The bombarded leaves were allowed
to incubate in dark for 48 hours to recover from tissue damage and
then were placed on RMOP medium containing 5001 g/ml spectinomycin
for two rounds of selection on plates and subsequently moved to
jars with MSO medium containing 500 .mu.g/ml spectinomycin
Confirmation of Transgene Integration into the Chloroplast
Genome
[0230] To confirm the transgene cassette integration into the
chloroplast genome, PCR was performed using the primer pairs 3P
(5'-AAAACCCGTCCTCGTTCGGATTGC-3')-3M
(5'-CCGCGTTGTTTCATCAAGCCTTACG-3') 15 and the complete transgene
integration was confirmed by PCR analysis using primer pairs 5P
(5'-CTGTAGAAGTCACCATTGTTGTGC-3') and 2M
(5'-GACTGCCCACCTGAGAGC-GGACA-3') 15. The total DNA from putative
transgenic and untransformed tobacco plants was isolated using
Qiagen DNeasy Plant Mini Kit. The PCR reaction was set as follows:
150 ng of plant DNA, 1.times. Taq buffer, 0.5 mM dNTPs, 0.2 mM of
primers each, 0.05 units/.mu.l Taq polymerase. The amplification
was set for 30 cycles with a program timed in the following way:
94.degree. C. for 30 sec, 65.degree. C. for 30 sec, and 72.degree.
C. for 30 sec for the 3P-3M primer pair and 72.degree. C. for 1 min
for the 5P-2M primer pair. Cycles were preceded by denaturation for
5 min at 94.degree. C. and followed by a final extension for 7 min
at 72.degree. C. PCR products including the controls were loaded
into a 0.8% agarose gel to confirm the results.
Southern Blot Analysis
[0231] The total plant DNA was digested with HincII and probed with
Chloroplast flanking probe. The total plant DNA was also digested
with ClaI in the similar manner and probed with CTB-NSP4 gene
specific probe. The above set of digested samples was run on 0.7%
agarose gel. The gels were soaked in 0.25 N HCl for 15 minutes and
then rinsed 2 times with water. The gels were later soaked in
transfer buffer (0.4 N NaOH, 1 M NaCl) for 20 minutes and then
transferred overnight to a nitrocellulose membrane. The membranes
were rinsed twice in 2.times.SSC (0.3 M NaCl, 0.03 M Sodium
citrate), dried on filter paper, and then crosslinked in the GS
GeneLinker (Stratagene, La Jolla, Calif.) 35. The flanking sequence
probe was made by digesting pUC-CT vector DNA with BamHI and BglII
to generate a 0.81 kb probe lee et al. The CTB-NSP4 sequence of
about 0.7 kb was used as gene specific probe. The probes were
labeled with 32P using the ProbeQuant G-50 Micro Columns (Amersham,
Arlington Heights, Ill.). The probes were hybridized with the
membranes using Stratagene QUICK-HYB hybridization solution and
protocol (Stratagene, La Jolla, Calif.).
Immunoblot Analysis
[0232] To detect the CTB-NSP4 fusion protein expression in
transgenic tobacco plants the total protein was extracted from 100
mg of leaf tissue in 200 .mu.l of plant extraction bufer (0.1% SDS,
100 mM NaCl, 200 mM Tris-HCl pH 8.0, 0.05% Tween 20, 400 mM
sucrose, 2 mM PMSF). Similarly total protein from 100 mg of
untransformed tobacco plant was also extracted to use as control.
Both boiled (4 minutes) and unboiled samples of extracted protein
with sample loading buffer were separated on 10% SDS/PAGE gel for
one hour at 50V and then 3-4 hours at 80V for uniform separation.
The proteins thus separated were transferred to a nitrocellulose
membrane by electroblotting at 85V for one hour. The membrane was
initially blocked with PTM (1.times.PBS, 0.05% Tween 20, and 3% dry
milk) for one hour. Followed by incubation in P-T-M containing
diluted (1:3000) rabbit anti-NSP4.sub.90 antibody (provided by Dr
Langridge, Univ of Loma Linda). Membranes were then washed with
distilled water and transferred to P-T-M containing diluted
(1:5000) goat derived anti-rabbit IgG antibody conjugated with
alkaline phosphatase (AP) (Sigma, national immunization systems St.
Louis, Mo.). Blots were washed three times with PBST for 15 minutes
each time. Then washed with PBS for 10 minutes, followed by
addition of chemiluminescent substrate ((Pierce, Rockford, Ill.)
for AP and incubating at room temp for 5 min for the
chemiluminescence. Later the X-ray films were exposed to
chemiluminescence and the films were developed in the film
processor to visualize the bands.
Bradford Assay for Protein Quantification (Bio-Rad Manual).
[0233] The Bradford assay was used to determine the total protein
from the plant extracts prepared as described above. This was used
to determine the percent of CTB-NSP4 antigen in the total soluble
protein extract (or % TSP). An aliquot of plant extract as prepared
above was thawed on ice. Extraction buffer (15 mM Na.sub.2CO.sub.3,
35 mM NaHCO.sub.3, 0.2 g NaN3, 0.1% Tween 20, and 5 mM PMSF
adjusted to pH 9.6) was used to make Bovine Serum Albumin (BSA)
standards ranging from 0.05 to 0.5 .mu.g/gI. Plant extracts were
diluted 1:10 and 1:20 with extraction buffer. 10 .mu.l of each
standard and 10 .mu.l of each plant dilution was added to the wells
of a 96 well microtiter plate (Cellstar) in duplicates. Bradford
reagent (Biorad protein assay) was diluted 1:4 with distilled water
as specified and 200 .mu.l was added to each well. Absorbance was
read. Comparison of the absorbance to known amounts of BSA to that
of the samples was used to estimate the amount of total
protein.
GM1 Binding (ELISA) Assay
[0234] The quantification and binding affinity of chloroplast
derived CTB-NSP4 for GM1-ganglioside receptor in the plant crude
extract was done using the GM1 ganglioside binding affinity (ELISA)
as described by .sup.41. 100 mg of transgenic leaf samples (young,
mature, old) and the wild type leaf samples (young, mature, old)
were collected. The leaf samples were collected from plants exposed
to regular lighting pattern (16 h light and 8 h dark), 1 Day, 3 Day
and 5 Day continuous light exposure. The leaf samples were finely
ground in liquid nitrogen, followed by collection of leaf powder
into the eppendorf tube. Total soluble protein from the plant
leaves was extracted in plant protein extraction buffer (15mM
Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3, 3 mM NaN.sub.3, pH 9.6, 0.1%
Tween, and 5mM PMSF). The microtiter plate was coated initially
with (100 .mu.l/well) with monoganglioside-GM1 (Sigma) (3.0
.mu.g/ml in bicarbonate buffer pH 9.6) and incubated overnight at
4.degree. C. followed by washing three times with PBST (PBS and
0.05% Tween 20) and two times with dH.sub.2O. As control, BSA (3.0
.mu.g/ml in bicarbonate buffer pH 9.6) was coated in some wells.
The wells were then blocked with 1% BSA in 0.01M phosphate buffer
saline (PBS) (300 .mu.l/well) for 2 h at 37.degree. C. or incubate
overnight at 4.degree. C. followed by 3 washes with PBST and 2
washes with dH.sub.20. In order to check the protein concentration,
the standards, test samples and antibody were diluted in coating
buffer (15 mM Na.sub.2CO.sub.3, 35 mM NaHCO.sub.3, 3mM NaN.sub.3,
pH 9.6). The standards and protein samples (100 .mu.l) were coated
to 96-well polyvinyl chloride microtiter plate (Cellstar) for 1 h
at 37.degree. C. or incubate overnight 4.degree. C. followed by 3
washes with PBST and 2 washes with water. The primary rabbit
anti-NSP4 antibody (provided by Dr. Langridge, Univ. of Loma Linda)
diluted (1:1500) in 0.5% BSA in 1.times.PBS was loaded into wells
and incubated for 2 h at 37.degree. C. followed by washing steps
and then again incubated with 100 .mu.l of donkey anti-rabbit
IgG-HRP conjugated antibody made in goat (American Qualex) (1:3000)
diluted in 0.5% BSA in 1.times.PBS. The plate was then incubated
for 2 h at 37.degree. C. After the incubation the plate was washed
thrice with PBST and twice with water. The wells were then loaded
with 200 .mu.l of 3,3,5,5-tetramethyl benzidine (TMB from American
Qualex) substrate and incubated for 10-15 min at room temperature.
The reaction was terminated by adding 50 .mu.l of 2N sulfuric acid
per well and the plate was read on a plate reader (Dynex
Technologies) at 450 nm. (Modified form of protocol from Ausubel et
al., 4.sup.th edition).
REFERENCES
[0235] 1. Parashar U D, Hummelman E G, Bresee J S, Miller M A,
Glass R I. (2003) Global illness and deaths caused by rotavirus
disease in children. Emerg Infect Dis 9:565-572. [0236] 2. Ball J
M, Tian P, Zeng C Q Y, Morris A P, Estes M K (1996). Age dependent
diarrhea induced by rotavirus nonstructural glycoprotein. Science.
272: 101-104. [0237] 3. Tian P, Ball J M, Zeng C Q Y, Estes M
K.(1997) The rotavirus nonstructural glycoprotein NSP4 possesses
membrane destabilization activity. J. Virol. 70:6973-81. [0238] 4.
Xu A, Bellamy R A, Taylor A J. 2000) Immobilization of the early
secretory pathway by a virus glycoprotein that binds to
microtubules. 19:6465-6474. [0239] 5. Dong Y, Zeng C Q-Y, Ball 3 M,
Estes M K, Morris A P. (1997) The rotavirus enterotoxin mobilizes
intracellular calcium in human intestinal cells by stimulating
phospholipase C-mediated inositol 1,4,5-triphosphate production.
PNAS 94:3960-65. [0240] 6. Yu J, Langridge H R. (2001) A
plant-based multicomponent vaccine protects mice from enteric
diseases. Nat. Biotech. 19: 548-552. [0241] 7. Kombo L A, Gerber M
A, Pickering L K, Atreya C D, Breiman R F. (2001) Intussusception,
Infection, and Immunization: summary of a workshop on rotavirus.
Pediatrics. 108:2.e37. [0242] 8. Daniell H, Streatfield S J, Wycoff
K. (2001b) Medical molecular farming: production of antibodies,
biopharmaceuticals and edible vaccines in plants. Trends Plant Sci.
6:219-26. [0243] 9. Daniell H, Muthukumar B, Lee S B. (2001a)
Marker free transgenic plants: engineering the chloroplast genome
without the use of antibiotic selection. Curr Genet. 39:109-116.
[0244] 10. Giddings G, Allison G, Brooks D, Caryer A. (2000).
Transgenic plants as factories for biopharmaceuticals. Nat.
Biotechnol. 18:1151-55. [0245] 11. Kong et al 2001 [0246] 12.
DeCosa B, Moar W, Lee S B, Miller M, Daniell H. (2001) Over
expression of the Btcry2Aa2 operon in chloroplasts leads to
formation of insecticidal crystals. Nat. Biotechnol. 19: 71-74.
[0247] 13. Tania Q V, Ruiz N R, Daniell H. (2005). Characterization
of Heterologous Multigene Operons in Transgenic Chloroplasts:
Transcription, Processing and Translation. Plant Physiol. In press
[0248] 14. Daniell H, Kumar S, Dufourmantel N (2005a) Breakthrough
in chloroplast genetic engineering of agronomically important
crops. Trends Biotechnol. 23:238-45. [0249] 15. Daniell H, Lee S B,
Panchal T, Wiebe P O. (2001) Expression of cholera toxin B subunit
gene and assembly as functional oligomers in transgenic tobacco
chloroplasts. J Mol. Biol. 311: 1001-1009. [0250] 16. Daniell H.
(2002) Molecular strategies for gene containment in transgenic
crops. Nat Biotechnol. 20: 581-586. [0251] 17. Hagemann R. (2004)
The sexual inheritance of plant organelles. H Daniell and C Chase,
eds, Molecular biology and biotechnology of plant organelles,
Kluwer Academic Publishers, Dordrecht, pp. 93-113. [0252] 18. Lee S
B, Kwon H B, Kwon S J et al. (2003) Accumulation of trehalose
within transgenic chloroplasts confers drought tolerance. Mol
Breed. 11: 1-13. [0253] 19. Singleton M L. (2003) Expression of
CaFl and LcrV as a fusion protein for development of a vaccine
against Yersisnia pestis via chloroplast genetic engineering.
Master's thesis, University of Central Florida. [0254] 20. Molina
A, Herva-Stubbs S, Daniell H, Mingo-Castel A M, Veramnendi J.
(2004) High yield expression of a viral peptide animal vaccine in
transgenic tobacco chloroplasts. Plant Biotechnol. Journal
2:141-153. [0255] 21. Watson J, Koya V, Leppla S, Daniell H.(2004)
Expression of Bacillus anthracis protective antigen in transgenic
chloroplasts of tobacco, a non-food/feed crop. Vaccine 22:
4374-4384. [0256] 22. Chebolu S. (2005) Expression of GAL/GALNAc
lectin of Entamoeba Histolytica in transgenic chloroplast to
develop a vaccine for amebiasis. Master's thesis, University of
Central Florida. [0257] 23. Bhati A. (2005) Expression of Hepatitic
C viral non structural 3 protein in transgenic chloroplast Master's
thesis, University of Central Florida. [0258] 24. Tregoning J S,
Nixon P, Kuroda H, Svab Z, Clare S. et al (2003) Expression of
tetanus toxin fragment C in tobacco chloroplasts. Nucleic Acids
Res. 31: 1174-1179. [0259] 25. Maliga P. (2003) Progress towards
commercialization of plastid transformation technology. Trends
Biotechnol. 21: 20-28. [0260] 26. Fernandez-San Millan A,
Mingeo-Castel A M, Miller M, Daniell H. (2003) A chloroplast
transgenic approach to hyper-express and purify human serum
albumin, a protein highly susceptible to proteolytic degradation.
Plant Biotechnol J. 1: 71-79. [0261] 27. DeGray G, Rajasekaran K,
Smith F, Sanford J, Daniell H. (2001) Expression of an
antimicrobial peptide via the chloroplast genome to control
phytopathogenic bacteria and fugi. Plant Physiol. 127:852-862.
[0262] 28. Staub J M, Garcia B, Graves J. et al (2000). High-yield
production of a human therapeutic protein in tobacco chloroplasts.
Nat Biotechnol 2000: 18:333-338. [0263] 29. Daniell H, Cohill P,
Kumar S, Dufourmantel N, Dubald M. (2004a) Chloroplast genetic
engineering. H Daniell and C Chase, eds, Molecular biology and
biotechnology of plant organelles, Kluwer Academic Publishers,
Dordrecht, pp. 423-468. [0264] 30. Fischer R, Stoger E, Schillberg
S, Christou P, Twyman R M (2004). Plant based production of
biopharmaceuticals. Curr Opin Plant Bio. 17:152-158. [0265] 31.
Kim, J., Mayfield, S. (1997). Protein Disulfide Isomerase as a
Regulator of Chloroplast Translational Activation. Science.
278:1954-1957. [0266] 32. Daniell H. Foreign gene expression in
chloroplasts of higher plants mediated by tungsten particle
bombardment. Methods Enzymol 1993; 217: 536-556. [0267] 33.
Daniell, H. (1997). Transformation and foreign gene expression in
plants mediated by microprojectile bombardment. Meth Mol. Biol.
62:453-488. [0268] 34. Guda C, Lee S B, Daniell H. (2000) Stable
expression of biodegradable protein based polymer in tobacco
chloroplasts. Plant Cell Rep. 19: 257-262. [0269] 35. Kumar, S.,
and Daniell. H. (2004). Engineering the chloroplast genome for
hyper-expression of human therapeutic proteins and vaccine
antigens. Methods Mol. Biol. 267, 365-383. [0270] 36. Devine A L,
Daniell H. (2004) Chloroplast genetic engineering for enhanced
agronomic traits and expression of proteins for medical/industrial
applications. In S G Moller, ed, Plastids, Vol. 13. Blackwell
publishing, Oxford, pp. 283-323 [0271] 37. Daniell H, Ruiz O N,
Dhingra A. (2004c). Chloroplast genetic engineering to improve
agronomic traits. Methods in Molecular Biology 286: 111-137. [0272]
38. Zerges W (2000) Translation in chloroplasts. Biochimie
82:583-601. [0273] 39. Svab Z, Maliga P. (1993) High-frequency
plastid transformation in tobacco by selection for a chimeric aadA
gene. Proc Natl Acad Sci USA. 90: 913-917. [0274] 40. Daniell H,
Chebolu S, Kumar S, Singleton M, Falconer R. (2005)
Chloroplast-derived vaccine antigens and other therapeutic
proteins. Vaccine 23:1779-1783. [0275] 41. Arakawa T, Cong D K X.
Langridge W H R. (1998) Efficacy of a food-plant based oral cholera
toxin B subunit vaccine. Nat. Biotechnol. 15:248-252. 16
292-297.
EXAMPLE 3
Expression of Hepatitis C Virus Non Structural 3 Antigen in
Transgenic Chloroplasts
[0276] Hepatitis C virus infection is the major cause of acute
hepatitis and chronic liver disease. An estimated 180 million
people are infected globally (WHO). There is no vaccine available
to prevent hepatitis C and treatment with antiviral drugs is
expensive and is accompanied with various side effects. Therefore,
there is an urgent need for the development of effective vaccine
antigens and an efficacious HCV vaccine. The non-structural 3
protein of the hepatitis C virus is one of the most conserved and
multifunctional protein of the virus and therefore is a good
candidate for the development a HCV vaccine. Vaccine antigen
production via chloroplast transformation system usually results in
high expression levels and eliminates the possibility of
contamination with viral vector sequences, human or animal
pathogens. To express the HCV NS3 antigen in the chloroplast of
Nicotiana tabacum var. Petit havana and LAMD-609, the NS3 gene (1.9
kb) was cloned into a chloroplast expression vector, pLD-ctv
containing the 16S rRNA promoter, aadA gene coding for the
spectinomycin selectable marker, psbA 5' & 3' untranslated
regions to enhance translation in the light and trnI & trnA
homologous flanking sequences for site specific integration into
the chloroplast genome. Chloroplast integration of the NS3 gene was
first confirmed by PCR. Southern blot analysis further confirmed
site-specific gene integration and homoplasmy. The NS3 protein was
detected in transgenic chloroplasts by Immunoblot analysis. The NS3
protein was further quantified by ELISA. Maximum expression levels
of NS3 up to 2% in the total soluble protein were observed even in
old leaves, upon 3-day continuous illumination. These results
demonstrate successful expression of the HCV non-structural 3
antigen in transgenic tobacco chloroplasts.
Materials and Methods
[0277] NS3-pcDNA3.1 Vector. The plasmid encoding HCV NS3 protein
(initial concentration of the plasmid-280 ng/ul in H2O) was sent
cloned in the commercial plasmid pcDNA3.1/V5/His-TOPO (Invitrogen).
A PCR product encoding NS3 had been inserted in this plasmid (in
the cloning box) as described by the protocol supplied by the
manufacturer. The plasmid encoded NS3 with a ATG and a Kozak
sequence (5' end) and a TGA (3' end). The plasmid was transformed
into Ultra competent XL1 Blue MRP' Tetracycline (tet) E. coli cells
(Stratagene) that were endonuclease negative.
[0278] Preparation of Ultra Competent Cells (Rubidium Chloride
Method). the Ultra Competent cells were prepared using rubidium
chloride method (http://www.nwfsc.noaa.gov/protocols-/rbcl.html).
XL1 Blue MRF' (tet) E. coli cells (Stratagene) were made competent
by the rubidium chloride method. The E. coli glycerol stock was
streaked on the LB agar plate (1 liter LB broth, 15 grams agar),
containing 12.5 ug/ml Tetracycline and incubated at 37.degree. C.
overnight. An isolated colony was picked and it was grown in 5 ml
of Psi broth (per liter-5 g Bacto yeast extract, 20 g Bacto
Tryptone, 5 g magnesium sulfate, pH 7.6) with 5 ug/ml Tetracycline
and incubated at 37.degree. C. for 12-16 hrs in a shaker at 225
rpm. From the overnight culture, 1 ml was taken and inoculated in
100 ml of Psi broth and was incubated at 37.degree. C. for about 2
hours in a shaker at 225 rpm. After 2 hours, the O.D was checked at
550 nm and rechecked again after intervals, until the O.D reached
0.48. The culture was then kept on ice for 15 minutes and then the
cells were centrifuged at 3000 g/5000 rpm for 5 minutes in a
sorvall centrifuge. The supernatant was discarded and the pellet
was resuspended in 40 ml cold TFB-I solution (per 200 ml-0.558 g
Potassium acetate, 2.42 g rubidium chloride, 0.294 g calcium
chloride, 2.0 g manganese chloride, 30 n-1 glycerol, pH 5.8). The
cells were centrifuged at 3000 g/5000 rpm for 5 minutes. The
supernatant was discarded and the cells were resuspended in 4 ml of
TFB-1l solution (per 100 ml-0.21 g MOPS, 1.1 g calcium chloride,
0.121 g rubidium chloride, 15 ml glycerol, pH 6.5) and then kept on
ice for 15 minutes. The suspension was aliquoted (100 ul) and quick
freezed in dry ice/liquid nitrogen and the aliquots were stored at
-80.degree. C.
[0279] Transformation of pcDNA3.1 plasmid into Competent XL1 Blue
MRF' (tet) E. coli Cells.
[0280] The competent cells were removed out of -80.degree. C. and
thawed on ice. 100 .mu.l of competent cells were taken and 1 ul
(100 ng) of plasmid pcDNA3.1 DNA was added and mixed by gently
tapping. The cells were left on ice for 30 minutes, and the tube
was gently tapped every 15 minutes. The cells were heat shocked at
42.degree. C. for 90-120 seconds and then left on ice for 2
minutes, and then 900 .mu.l LB broth was added to the cells and the
cells were incubated at 37.degree. C. at 225 rpm in a shaker for 45
minutes. The cells were pelleted by centrifugation at 13,000 rpm
for 30 seconds and the supernatant was discarded. Almost 800 ul of
supernatant was discarded and only approximately 100 ul was left.
The remaining 100 ul of the cells were mixed well with the pellet.
About 50 ul and 100 ul of the transformed cells and untransformed
(control) were plated onto LB/amp agar plates (1 liter LB broth,
15gr agar, 100 .mu.g/ml ampicillin, pH 7) under the hood. Plates
were covered and incubated O/N at 37.degree. C.
(http://www.nwfsc.noaa.-gov/protocols-/rbcl.html).
[0281] Rapid Colony Screening by Cracking Method. To check the
colonies for the presence of plasmids, the Rapid Screen procedure
by Promega was used. Sterile toothpicks were used for picking 8
colonies from the incubated LB agar plates to the bottom of an
individual sterile microcentrifuge tube. 25 .mu.l of 10 mM ethylene
diamine tetra-acetic acid (EDTA), pH 8 was added to the tubes and
vortexed to mix. Then 25 .mu.l of fresh 2.times. cracking buffer
(2N NaOH, 10% sodium dodecyl sulfate, 1M sucrose) was added to each
colony and vortexed. The tubes were then incubated at 65.degree. C.
for 10 minutes and were cooled at room temperature. 1.5 .mu.l of 4M
KCl and 3.5 .mu.l of 6.times. bromophenol blue (0.25% Bromophenol
blue, 40% sucrose) was added to the tubes. The tubes were placed on
ice for 5 minutes and centrifuged at 12,000 rpm for 3 minutes at
room temperature. 20 .mu.l of the supernatant form each tube was
run on 0.8% agarose gel to visualize which of the selected colonies
contained plasmids. Positive colonies were inoculated into 5 ml of
fresh LB broth with 100 .mu.g/ml amp and incubated overnight at
37.degree. C. on shaker.
[0282] Midi-prep of pcDNA3.1. Inoculated a colony obtained from the
plate in 50 ml of liquid LB broth, to which 50 .mu.l of ampicillin
(stock concentration; 100 mg/ml) was added and incubated at
37.degree. C. for 12 hours in a shaker. 40 ml of the overnight
culture was transferred to a clean 50 ml round bottom sorvall
centrifuge tube. The cells were centrifuged for 10 minutes at 8000
rpm at 40 C. The supernatant was discarded. The pellet was
resuspended by vortexing in 5 ml of Solution 1 (50 mM Glucose, 10
mM EDTA, 25 mM Tris, pH-8) with 5 ul of 100 mg/ml of RNAse freshly
added to it. Solution II (500 ul of 2N NaOH, 100 ul of 10% SDS,
4400 ul of sterile water) which is a cell lysis solution was
prepared freshly, added, and mixed by gently inverting the tube 6-8
times and the solution turned from milky to clear. Then 5 ml of Sol
III (60 ml of 5M Potassium Acetate, 11.5 M glacial acetic acid, and
28.5 ml sterile dH2O) which is neutralizing solution was added to
the clear solution and mixed well by inverting the tube 6-8 times
and the solution precipitated. The solution was centrifuged for 15
minutes at 12,500 rpm at 40 C. The clear supernatant was poured
into a new 50 ml Sorvall centrifuge tube. Cold absolute ethanol (24
ml) was added to the supernatant and mixed well by inverting the
tube 6-8 times. The tube was then centrifuged for 10 minutes at
10,000 rpm at 40 C to pellet the plasmids. The supernatant
containing contaminants was discarded. The pellet was washed with
12 ml of 70% ethanol and resuspended by shaking. The solution was
centrifuged for 5 minutes at 10,000 rpm at 40 C. The supernatant
was discarded and the pellet was dried in a speed vacuum or
air-dried before resuspending the DNA pellet in 500 ul of TE (TE:
1M Tris, pH 8.0, 0.5M EDTA). The DNA sample was loaded in a 0.8%
agarose gel and run at 60 volts for 30 minutes to check for plasmid
isolation (Sambrook et al., 1989).
[0283] Phenol: Chloroform Extraction. Plasmid DNA (500 ul) was
taken and 250 ul Phenol and 250 ul Chloroform was added (1:1) and
mixed well. The tube was then centrifuged at 14,000 rpm at 40 C for
about 10 minutes. The supernatant was transferred to a new tube and
500 ul of Chloroform: IAA (Isoamyl alcohol) was added and
centrifuged at 14,000 rpm at 40 C for 10 minutes. The supernatant
was transferred to a new tube and 0.1 volume of 3M sodium acetate
(pH: 5.2) was added. Absolute ethanol (900 ul) was added and mixed
well by inverting several times and then centrifuged at 14,000 rpm,
40 C for 10 minutes. The supernatant was discarded and the pellet
was rinsed with 70% ethanol (400 ul) and centrifuged for 10 minutes
at 14,000 rpm at 40 C. The supernatant was discarded again and the
pellet was dried in a speed vacuum or air-dried before resuspending
the DNA pellet in Elution buffer,10 mM Tris Cl, (Sambrook et al.,
1989).
[0284] PCR amplification of NS3 gene. The NS3 gene (first 134 bp)
were amplified to introduce the Sac1 and SnaB1 restriction sites at
the 5' terminal end and NotI at the 3' end of the 134 bp of the NS3
gene for further subcloning. This was done to clone the 134 bp of
the NS3 gene first into p-bluescript between NotI and SacI sites.
The primers used for amplification were the NS3-F primer
(5'CAGTGTGGAGCTCTTGTACGTACCACCATGGCG3') and the NS3-R primer
(5'TGGAGAGCACCTGCGGCCGCCCATCGACCTGG3'). Primers (nvitrogen) were
diluted with EB to give a 100 .mu.M stock that was stored at
-20.degree. C. The PCR reaction was set up with 0.5 ul plasmid DNA
(60 ng), 10.times.PCR buffer, 5.0 .mu.l of 10 mM dNTP's, 1 .mu.l of
forward primer (NS3-F), 1 .mu.l of reverse primer (NS3-R), 0.5
.mu.l of Pfu polymerase and 37.0 .mu.l of distilled, autoclaved H20
to a total volume of 50 .mu.l.). Samples were carried through 35
cycles using the following temperatures and times: 94.degree. C.
for 5 minutes, 94.degree. C. for 45 seconds, 56.degree. C. for 45
seconds, 72.degree. C. for 45 seconds, and followed by a 10-minute
extension time at 72.degree. C. The final PCR product (0.1 ul) was
run on a 0.8% agarose gel to analyze the PCR products. The PCR
product was purified using the PCR purification kit (Qiagen).
[0285] Ligation of the PCR Product (Sac1/SnaBI/NS3/Not1) into
p-Bluescript vector. The PCR product was ligated into p-Bluescript
cloning vector (Invitrogen) between NotI and SacI restriction
sites. The ligation mixture consisted of 4 .mu.l of PCR product
after PCR purification, 16 ul of p-Bluescript, 0.5 ul of T4 DNA
ligase, 6.0 ul of Ligase buffer, and 3.5 ul distilled, autoclaved
H20 to a total of 30 ul total volume. The solution was gently mixed
and incubated overnight at 12.degree. C. Competent E. coli cells
were taken from -80.degree. C. freezer and thawed on ice and
transformation was started immediately after cells thawed. 15 ul of
the ligation mixture was mixed into a vial containing the 100 ul of
E. coli competent cells and transformation was done as previously
described (Sambrook et al., 1989).
[0286] Selection of Transformants. The p-Bluescript cloning vector
has the .beta.-galactosidase gene (lacZ). Within this coding region
is a multicloning site. Insertion of a fragment of foreign DNA into
the multicloning site of p-Bluescript almost invariably results in
production of an amino-terminal fragment that is not capable of
.alpha.-complementation. Selective plates were made with LB agar
with 100 .mu.g/ml ampicillin and 12.5 .mu.g/ml tetracycline. About
1 hour before transformation was complete, 40 .mu.g/ml of
5-bromo-4-chloro-3-indolyl-.beta.-D-galactoside (X-gal) was spread
onto the top of the plates while under the hood. X-gal is a lactose
analog that turns dark blue when it is hydrolyzed by
.beta.-galactosidase. After the X-gal dried (about 15 minutes), 40
.mu.l of 100 mM of isopropyl-.beta.-D-thiogalactoside (IPTG) was
spread onto the plates. IPTG, another lactose analog, is a strong
inducer of lacZ transcription but is not hydrolyzed by
.beta.-galactosidase. The plates were warned 37.degree. C. for 30
minutes and then the plates were streaked with 100 .mu.l of the
transformed bacterial cells were spread over the top of the agar.
Allowed the plates to dry for 5 minutes, and then incubated the
plates in an inverted position at 37.degree. C. overnight. Colonies
without an interrupting insert were blue because they had an active
.beta.-galactosidase. Colonies with an insert were white, so these
were picked to culture, and midi-prep was done with the Midi-prep
kit (Qiagen).
[0287] Sequencing of NS3 in p-Bluescript. The PCR product in the
plasmid (NS3-p-Bluescript) was sequenced using M13 forward
(5'-TGACCGGCAGCAAAATG-3') and M13 reverse
(5'GGAAACAGCTATGACC-ATG-3') primers. Sequencing results confirmed
that the fragment in the p-Bluescript vector was the NS3 gene.
[0288] Construction for pLD-AB-NS3 vector for transformation of
tobacco chloroplasts. The original vector pcDNA3.1 was digested
with BstXI and EcoRV and the NS3 gene (remaining 1760 bp) was
ligated between BstXI and EcoRV in p-Bluescript. The entire NS3
gene was digested from p-bluescript with SnaBI and HindIII and
ligated in pCR2.1 vector downstream of the psbA 5'UTR. Finally, the
pCR 2.1 vector containing the 5'U1TR and the NS3 gene was digested
with EcoRI and EcoRV (fragment size 2.1) and was cloned between the
same sites in the universal vector pLD-AB-Ct.
[0289] Extraction of NS3 Protein front Transformed E. coli Cells. 5
ml of Terrific Broth (TB) containing 5 ul ampicillin (100
.mu.g/.mu.l) and tetracycline (50 .mu.g/.mu.l) was inoculated with
the scrapping from the glycerol stock of E. coli transformed with
pLD-AB-NS3 and incubated in a shaker at 37.degree. C. for 10-12
hours. 5 ml of Terrific Broth (TB) with untransformed E. coli cells
was used as a negative control. The buffers and gels used in this
study were made from protocols in SDS-PAGE Buffer System (Laemmli,
1970). 800 .mu.l of cultured cells were taken and centrifuged for 2
minutes at 12,000 rpm. The supernatant was discarded from pelleted
E. coli cells and then washed with 1 ml of 1.times.
Phosphate-Buffered Saline (PBS: 140 mM NaCl, 2.7Mm KCl, 4 mM
Na.sub.2EIPO4, 1.8 mM KH2PO4, pH 7.2). The pellet was resuspended
and then centrifuged for 1 minute at 13,000 rpm. The supernatant
was then discarded. 50 .mu.l of 1.times.PBS was added and mixed
well. 50 .mu.l of 2.times. loading buffer, also called Sample
Buffer or SDS Reducing Buffer (1.25 ml of 0.5 M Tris-HCl, pH 6.8,
2.0 ml of 10% (w/v) SDS, 0.2 ml of 0.5% (w/v) bromophenol blue, 2.5
ml of glycerol, dH20 to a total volume of 9.5 ml, then add 50 .mu.l
of .beta.-mercaptoethanol to the 9.5 ml) was added. The sample
extracts were boiled for 4 minutes and then immediately loaded onto
gels (Sambrook et al., 1989).
[0290] SDS-PAGE. The buffers and gels used in this study were made
from protocols in SDS-PAGE Buffer System below (Laemmli 1970). To
detect the protein extracted from E. coli cells containing
pLD-AB-NS3, SDS-PAGE gels were made in duplicate utilizing the
following solutions: 1.) Bio-Rad (cat#161-0158), which is a 30%
Acrylamide/Bis solution according to the ratio 37:5:1. 2.) The
resolving buffer, which was used to make the lower portion of the
gel: 1.5M Tris-HCl, pH 8.8. The pH was adjusted with 6N HCl and
brought to a total volume of 150 nim with dH.sub.2O. 3.) The
stacking buffer that was used to make the stacking gel layered over
the resolving gel and concentrated the samples at top of the
resolving gel to improve resolution: 0.5M Tris-HCl, pH 6.8. 4.)
Electrode buffer (1.times.) which was the gel running buffer. For
10.times. Electrode buffer: Dissolved 30.3 g Tris base, 144.0 g
glycine and 10.0 g SDS into 1000 ml dH20. 5.) 2.times. loading
buffer also called the Sample buffer and the SDS Reducing Buffer.
6.) 10% (w/v) Sodium Dodecyl Sulfate (SDS): 7.)
N,N,N,N'-Tetra-methyl-ethylene diamine (TEMED) from BIO-RAD (cat#
161-0800). 8.) 20% Ammonium Persulfate (APS): Dissolved 20 mg of
APS into 1 ml dH20 and this solution can be stored at 4.degree. C.
for about a month. To make the 10% resolving gel, in 4.1 ml dH20,
3.3 ml of 30% Acrylamide/Bis, 2.5 ml of resolving buffer and 100
.mu.l of 10% SDS was added. 40 .mu.l of 20% APS and then 10 .mu.l
of TEMED was added to the gel mixture. The gel mixture was poured
between the two, vertical, glass plates leaving about 1.5 cm at the
top of glass plates for the stacking gel. The gel was allowed to
polymerize for 20 minutes. To make the 4% stacking gel, in 6.1 ml
dH20, 1.3 ml of 30% Acrylamide/Bis, 2.5 ml of the stacking buffer
and 100 .mu.l of 10% SDS was added. 40 .mu.l of 20% APS and then 10
.mu.L of TEMED was added to the gel mixture. The 4% gel mixture was
layered on top of resolving gel and then the comb is inserted for
the formation of wells. After polymerization for about 20 minutes,
the comb is removed and put vertically into PAGE apparatus
containing 1.times. Electrode (running) buffer. 20 .mu.l of protein
extract from pLD-AB-NS3 transformed and untransformed E. coli cells
was loaded along with 10 ul protein marker. Gel was ran at 50V
until samples stacked onto the top of the resolving gel, then ran
gel at 80V for 2-3 hours so that protein marker bands could spread
out sufficiently (Sambrook et al. 1989).
[0291] Transfer to Membranes and Immunoblot Analysis. The separated
proteins were transferred onto a 0.2 .mu.m Trans-Blot
nitrocellulose membrane (Bio-Rad) by electroblotting in
Mini-Transfer Blot Module at 80V for 45 minutes in Transfer buffer
(360 ml of 10.times. Electrode buffer, 360 ml of methanol, 0.18
grams of SDS, 1080 ml distilled H2O). The membranes were taken out
and rinsed with water and placed in blocking solution (100 ml
1.times.PBS, 100 ul of Tween 20, 5 g of non-fat, Carnation powdered
milk) and incubated for an hour at room temperature in a shaker.
The P-T-M was poured off and the Hepatitis C Virus (NS3)-specific
primary mouse monoclonal antibody (HCV NS3 Ab-1, Clone MMM33, from
Neomarkers) was added in the ratio of antibody:PTM as 1:1000 and
incubated for 2 hours at room temperature in a shaker. Membranes
were then washed with distilled water and transferred to P-T-M
containing goat derived anti-mouse IgG antibody conjugated with
Horseradish peroxidase (Sigma, St. Louis, Mo.), in the ratio of
antibody:PTM as 1:10,000 and incubated for 1.5 hours at room
temperature in shaker. Blots were washed three times with PBST for
15 minutes each time and then washed with only PBS for 10 minutes.
Then 750 III of 2.times. Stable Peroxidase Solution and 750 .mu.l
of 2.times. Luminol/Enhancer Solution (Pierce) was poured over the
membrane and a film was developed in the to visualize the bands
(Sambrook et al. 1989).
[0292] Sterilization of Seeds for Wild-type and T1. For generating
wild-type (untransformed) tobacco plants to use for bombardment,
pods were picked from both varieties of tobacco when the pods were
dry. The pods were broken under hood and then poured into labeled
eppendorf about until about 1/3 full. To germinate seeds, fresh MSO
(Murashige and Skoog, 1962) plates with no antibiotic were made.
The sterilization solution consisted of 1.5% bleach (4 ml of 5.25%
Chlorox bleach), 16 ml d/aH20, 0.05% Tween 20 (20 .mu.l of Tween
20). 1.2 ml of the sterilization solution was added to each
eppendorf and then vortexed for 20 minutes and then rinsed 7 times
with sterile H20. Then the seeds were dried and then spread onto
the surface of the MSO plates, covered and wrapped in parafilm. Put
plates at 26.degree. C. with a 16 hour photoperiod. For germination
of T1, 1.2 ml of sterilization solution was added and sterilized as
above, except the dry seeds were spread onto MSO plated with 500
.mu.g/ml spectinomycin (Petit Havana) and 350 .mu.g/ml to select
for transformants (Kumar and Daniell, 2004).
[0293] Preparation of tobacco tissue culture media (RMOP and MSO
media). The shoot-inducing RMOP media was made by adding one packet
MS salts mixture, 30 gm sucrose, 1 ml benzylaminopurine, BAP (1
mg/ml stock); 100 ul napthalene acetic acid, NAA (1 mg/ml stock), 1
ml thiamine hydrochloride (1 mg/ml stock) to 1 L dH2O. The pH was
adjusted to 5.8 with 1N KOH and 7.0 g/L phytagar was added to the
mixture which was autoclaved, cooled and plated out under the hood
(Kumar and Daniell, 2004). The root-inducing MSO media was prepared
by adding 30 g sucrose and one packet (4.3 g) of Murashige &
Skoog (MSO) salt mixture (Gibco BRL) to 1 L dH.sub.2O. The pH was
adjusted to 5.8 with 1N KOH, then 7 g/L phytagar was added and the
mixture was autoclaved (Kumar and Daniell, 2004).
[0294] Biolistic transformation of tobacco leaf chloroplast. About
4 weeks prior to the planned bombardment, wild-type (untransformed)
tobacco plants were micropropagated from seeds using sterile
techniques. Two varieties of tobacco were generated for the
bombardment: Petit Havana (model) and LAMD-609 (low nicotine hybrid
produced by backcrossing a Maryland type variety, MD-609, to a
low-nicotine producing burley variety, LA Burley 21 (Collins et
al., 1974).
[0295] Preparation of Tire Gold particles and DNA/Particle
Suspension. Fifty Mg of Gold Particles (0.6 gm) were placed in a
micro centrifuge tube and 1 ml of freshly prepared 70% ethanol was
added. The mixture was vortexed for 3-5 minutes and incubated at
room temperature for 15 minutes. The gold particles were pelleted
by spinning for 5 seconds and then the supernatant was discarded. 1
ml of H2O was added to the particles and vortexed for a minute.
Particles were allowed to sit for 1 minute and pulse centrifuged
for 3 seconds. The supernatant was discarded and this was repeated
three times. After the last spin, 50% glycerol was added to a
concentration of 60 mg/ml. The gold particles were stored at
-20.degree. C. (Kumar and Daniell, 2004).
[0296] Coating DNA onto macrocarriers. The gold particles prepared
in 50% glycerol (60 mg/ml) were vortexed for 5 minutes to
resuspended the particles. Fifty ul of gold particles was removed
and placed in a micro centrifuge tube. 10 ul (1 .mu.g/.mu.l) of the
pLD-AB-NS3 vector DNA was added and quickly vortexed. Then, 50 ul
of freshly prepared 2.5M CaCl2 (367.5 mg of CaCl2 into 1 ml of
d/aH2O) was added and vortexed. Finally, 0.1M spermidine-free base
(20 ul) was added and the tube was vortexed for 20 minutes at
4.degree. C. 200 ul of absolute ethanol added to each tube and
centrifuged for 2 seconds, then the ethanol was discarded. The wash
was repeated 4 times. After the washes, the particles were
resuspended in 40 ul of absolute ethanol and kept on ice (Kumar and
Daniell, 2004).
[0297] Preparing the Biolistic Gun and Consumables. Stopping
screens, rupture disk holders, macrocarrier holders were autoclaved
to ensure that they were sterile. Rupture disks and macrocarriers
were washed in 50 ml of autoclaved H2O and 70% ethanol. The Bio-Rad
PDS-1000/He (gene gun) shelves, macrocarrier holder, rupture disk
holder were washed with 70% ethanol. After the pump under the hood
was turned on, the main valve on the helium tank was opened and the
valve controlling pressure to the gene gun was set to 13500 psi
(Kumar and Daniell, 2004).
[0298] Bombardment. The bombardment was performed as described
previously (Daniell, 1997). Stopping screens were placed in
macrocarrier holders. 6 ul of particle mixture was spread evenly
onto the macrocarrier. The gold suspension was allowed to dry. One
rupture disk was placed in the holder ring and screwed in place at
the top of the vacuum chamber. The stopping screen and macrocarrier
with the gold/DNA (in holder) were placed into the retaining
assembly. The assembly was placed into the vacuum chamber. A piece
of sterile whatman #1 filter paper was placed on solidified RMOP
media in a petri dish. One leaf at a time was placed on the whatman
paper abaxial side upwards. The petri dish with leaf was placed on
a plastic holder and placed in the next to last slot in the vacuum
chamber. The chamber door was closed and secured. The power switch
for the gene gun was turned on. A vacuum was allowed to build to 28
psi in the bombardment chamber. When 28 psi was reached, the fire
switch was pressed until the rupture disk ruptured (u1100 psi).
After delivery of the gold particles with vector DNA, the vacuum
was released and the Petri dish taken out and covered. The petri
dishes were wrapped in aluminum foil and kept in the dark for 48
hours at room temperature to recover from the shock of bombardment
(Kumar and Daniell, 2004).
[0299] Selection and Regeneration of Transgenic Lines. After
recovering in the dark for 48 hours from bombardment, leaves were
cut into 5 mm2 squares and placed on a petri dish containing RMOP
media containing spectinomycin. For Petite Havana, 500 ug/ml of
spectinomycin was used and for LAMD-609, 350 ug/ml of spectinomycin
was used for the first round of selection (with the abaxial side
down). Four to six weeks later when the shoots appeared, they were
cut into 2 mm2 pieces and transferred to fresh RMOP media with
spectinomycin for the second round of selection (500 ug/ml for
Petite Havana and 350 ug/nl for LAMD-609). During the second
selection, the shoots that appeared and tested positive for
cassette integration into the chloroplast by PCR analysis were
grown in sterile glass jars containing fresh media with
spectinomycin until the shoots grew to fill the jar. Then the
plants were transferred to pots with soil containing no antibiotic.
Potted plants were grown in a 16 hour light/8 hour dark photoperiod
in the growth chamber at 26.degree. C. (Kumar and Daniell,
2004).
[0300] Isolation of total plant genomic DNA from Tobacco Leaf The
QIAGEN's DNeasy.RTM. Plant Mini Kit was used for isolating the
total DNA from plant tissue as described in the Qiagen manual. 100
mg of the tissue was grounded in liquid nitrogen to a fine powder
and was transferred to a cooled eppendorf and 400 ul of Buffer AP1
and 4 ul of RNase A stock solution (100 mg/ml) was added and
vortexed. The mixture was incubated for 10 minutes at 65.degree. C.
and mixed about 2-3 times during incubation by inverting the tube.
130 ul of Buffer AP2 was added to the lysate, mixed, and then
incubated on ice for 5 minutes. The lysate was applied to the
QIAshredder spin column (lilac) sitting in a 2 ml collection tube
and then centrifuged for 2 minutes. The flow-through was
transferred to a new tube and 1.5 volumes of buffer AP3/E were
added to the lysate and mixed immediately. 650 ul of the mixture
was applied to the DNeasy mini spin column sitting in a 2 mil
collection tube and then centrifuged for 1 minute at 8000 rpm. The
DNeasy column was placed in a new 2 ml collection tube and 500 ul
Buffer AW was added to the DNeasy column and centrifuged for 1
minute at 8000 rpm. The flow-through was discarded and collection
tube was reused in the next step. 500 ul Buffer AW was added to the
DNeasy column and centrifuged for 2 minutes at maximum speed to dry
the membrane. The DNeasy column was transferred to a 2 ml
microcentrifuge tube and 100 ul of preheated (65.degree. C.) Buffer
AE was directly added onto the DNeasy membrane. The membrane was
incubated for 5 minutes at room temperature and then centrifuged at
8,000 rpm for 1 minute to elute the DNA. The DNA was kept at
-20.degree. C. for use in PCR and Southern analysis.
[0301] PCR Analysis of Integration into the Chloroplast Genome. To
conform the transgene cassette integration into the chloroplast
genome, two primers sets were designed and assigned numbers with
the plus (P) being for the forward primer and minus (M) being for
the reverse primer. The 3P/3M (3P:
5'-AAAACCCGTCCTCCGTTCGGAT-TGC-3') primer annealed to anneal to a
unique portion of the chloroplast genome and 3M
(5'-CCGCGTTGTTTCATCAAGCCTTACG-3') annealed to the integrated aadA
gene (Daniell et al, 2001b). For the PCR reaction, 200 ng of plant
DNA, 5 .mu.l of 10.times. buffer, 4 .mu.l of 2.5 mM dNTP, 2 .mu.l
of each primer from the stock, 0.5 .mu.l Taq DNA polymerase and H2O
to make up the total volume to 50 ul. The amplification was carried
for 25 cycles of the following reaction: 94.degree. C. for 5 mins,
94.degree. C. for 45 sec, and 65.degree. C. for 45 sec, 68.degree.
C. for 1.5 min, 68.degree. C. for 7 mins. To confirm the
integration of gene of interest, PCR was performed using primer
pairs 5P (5'-CTGTAGAAGTCACCATTGTTGTGC-3' and 2M
(5'-TGACTGCCCACCTGAGAGCGGACA-3'). The amplification was carried
during 25 cycles of the following reaction: 95.degree. C. for 5
mins, 95.degree. C. for 1 min, and 68.degree. C. for 1 min,
72.degree. C. for 3 min, 72.degree. C. for 10 mins. 5 ul of each
PCR products including the controls were loaded into a 0.8% agarose
gel to confirm the results. pLD-NS3 was used as the positive
control and wild type petite Havana was used as a negative
control.
[0302] Southzern Blot Analysis. These steps were performed as
described in (Daniell et al., 2004a). The total DNA isolated from
TO plants as well as from untransformed tobacco plants with
QIAGEN's DNeasy.RTM. Plant Mini Kit was digested as follows: 10 ul
(2 ug) DNA from DNeasy, 3 .mu.l of 10.times. buffer 3, 2 .mu.l
BglII enzyme (NEB), 14.7 .mu.l sterile H2O, to a total volume of 30
.mu.l. The digest was incubated O/N at 37.degree. C. The digestion
was separated on a 0.8% agarose at 50V for 3.5 hours. The gel was
observed under UV light to verify the complete digestion of the
plant DNA. The gel was soaked in 0.25N HCl (depurination solution)
for 15 minutes in a continuous agitation. The depurination solution
was discarded, and the gel was rinsed 2 times with sterile H2O for
5 minutes. The gel was then soaked in transfer buffer on a rotary
shaker for 20 minutes. The transfer apparatus was assembled for the
transfer of the DNA to Duralon-UV nylon membrane. Four pieces of
the Whatman paper were cut slightly larger than the gel and the
membrane. Two pieces of Whatman paper were dipped into the transfer
solution and placed on three sponges placed in a large pyrex dish
partially filled with transfer buffer. The gel was removed from the
transfer buffer and inverted on the Whatman paper. The nylon
membrane was soaked in water and then placed on the gel. Removed
air bubble gently and arranged parafilm along all the side to
prevent horizontal DNA transfer. A stack of ordinary paper towels
onto the top of Whatman filter paper and then added a 500 g weight
to encourage transfer. From the bottom of the pyrex dish the
transfer was in the following order: sponges, 2 filter paper, gel,
parafilm at edges, nylon membrane, 2 filter paper, paper towels and
weight. The set up was left for transfer over night and the next
day the membrane was washed on 2.times.SSC (3M NaCl, 0.3M Na
citrate, H2O, the pH was adjusted with 1N HCl to 7 and water was
added to 1 L) for 5 minutes. The membrane was air-dried and then
cross-linked using the GS Gene Linker UV Chamber (BIO-RAD) at the
C3 setting.
[0303] Generating and Labeling Probes. The probes were prepared by
the random primed .sup.32P-labeling (Ready-to-go DNA labeling
beads, Amersham Pharmacia). A pUC universal vector containing the
chloroplast flanking sequences was used to generate the flanking
probe. The restriction digest was set-up as follows: 20 .mu.l of
pUC-ct, 1 .mu.l 10.times. buffer 3, 1 .mu.l BamHI (NEB), 1 .mu.l
BglII (NEB), 0.3 .mu.l of BSA, 6.7 .mu.l of sterile H2O to a total
volume of 30 .mu.l. The reaction was incubated overnight at
37.degree. C. The restriction digest for the gene specific probe
was as follows: 20 .mu.l of pLD-AB-NS3, 1 .mu.l of EcoRI (NEB), 1
.mu.l of EcoRV (NEB), 3 .mu.l of 10.times. buffer #3 (NEB), 0.3 ul
of BSA, 4.7 .mu.l sterile H2O to a total volume of 30 .mu.l. The
reaction was incubated O/N at 37.degree. C. 45 .mu.l of each probe
was denatured at 94.degree. C. for 5 minutes and then placed on ice
for 3 minutes. The probes were added to the ready mix tube (Quantum
G-50 Micro columns, Amersham) and gently mixed by flicking. 5 .mu.l
of .alpha.32P was added to the ready mix tube and then it was
incubated at 37.degree. C. for 1 hour. The resin in the G50 column
was resuspended by vortexing. The cap was loosened and the bottom
plug broken off. Then the column was placed in a microcentrifuge
tube with the top cut off and centrifuged for 1 minute at 3000 rpm.
The collection tube with the supernatant was discarded and the
column was transferred to a new tube. The probes were added to the
center of the resin and centrifuged for 2 minutes at 3000 rpm and
then the column was discarded. The amount of labeled DNA probe to
be used was determined.
[0304] Prehybridization, Hybridization and Washing of the membrane.
For prehybridization, the membrane was washed with sterile water.
The Quick Hyb solution was gently mixed by inverting and warmed.
The membrane was placed in a bottle with the top facing in towards
the solution and 5 ml of the pre-Hyb solution was added and
incubated for 60 mins at 68.degree. C. 100 .mu.l of salmon sperm
(10 mg/ml) was added to the labeled probes and the mixture was
heated at 94.degree. C. for 5 minutes. The probes were added to the
pre-Hyb solution and the blot was incubated for 1 hour at
68.degree. C. After hybridization, the membrane was removed from
the bottle and washed twice in 50 ml of 2.times.SSC and 0.1% SDS
for 15 minutes at room temperature. Then, the membrane was washed
twice in 50 ml of pre-heated 0.1.times. SSC and 0.1% SDS for 15
minutes at 60.degree. C. The membrane was then placed on top of
Whatman filter paper for 30 minutes to dry and then wrapped in
saran wrap. The membrane was exposed to film overnight, stored at
-80.degree. C. and then developed.
[0305] Plant Expression of NS3 and Immunoblot Analysis. Petit
Havana and LAMD-609 leaf sections were cut and 100 mg plant leaf
tissue was weighed and grounded with liquid nitrogen in cold mortar
and pestles and transferred to a microcentrifuge tube. Fresh plant
extraction buffer (PEB: 60 ul of 5M NaCl, 60 ul of 0.5M EDTA (pH
8), 600 ul of 1M Tris-HCl (pH 8), 2 ul of Tween-20, 30 ul of 10%
SDS, 3 ul of 14 mM .beta.-mercaptoethanol (BME), 1.2 ml of 1M
sucrose, 1 ml sterile H2O and 120 ul of 100 mM PMSF) was made and
kept on ice. To make 100 mM of PMSF, 17.4 mg of powdered PMSF
(Sigma) was weighed out, put into 1 ml of methanol and vortexed,
and stored at up to 1 month at -20.degree. C. 200 ul of PEB was
added to each plant sample on ice and then samples were mixed for 3
minutes with a micropestle. The samples were centrifuged at 13,000
rpm for 10 mins to obtain the supernatant containing the soluble
proteins. 20 .mu.l of these extracts were mixed with 20 .mu.l of
sample loading buffer containing BME. Samples were then boiled for
5 minutes and loaded into SDS-PAGE gel. The procedure for the rest
was identical to the protocol for E. coli-expressed NS3 and
Immunoblot Analysis (see above sections).
[0306] Enzyme Linked Immuno Sorbant assay (ELISA). The levels of
NS3 in transgenic LAMD-609 were calculated as a percentage of the
total soluble protein of leaf extracts. The quantification of NS3
in the plant crude extract was done using the enzyme linked
immunosorbant assay (ELISA). 100 mg of transgenic leaf samples
(young, mature, old) and the wild type leaf samples (young, mature,
old) were collected. The leaf samples were collected from plants
exposed to regular lighting pattern (16 h light and 8 h dark), 3
day continuous light, and 5 day continuous light. The leaf samples
were finely grounded in liquid nitrogen and the leaf powder was
transferred into an eppendorf tube. To extract the protein, plant
protein extraction buffer (15 mM Na2CO3, 35 mM NaHCO3, 3 mM NaN3,
pH: 9.6, 0.1% Tween, 5 mM PMSF) was used to resuspended the leaf
powder. In order to check the protein concentration, the standards,
test samples and antibody were diluted in coating buffer (15 mM
Na2CO3, 35 mM NaHCO3, 3 mM NaN3; pH: 9.6). The standards ranging
from 50 to 500 ng/ml (500 ng/ml, 400 ng/ml, 300 ng/ml, 200 ng/ml,
100 ng/ml and 50 ng/ml) were made by diluting purified NS3 in
coating buffer (stock: 1000 ng/ml). The standards and protein
samples (100 .mu.l) were coated to 96-well polyvinyl chloride
microtiter plate (Cellstar) for 1 h at 37 C followed by 3 washes
with PBST and 2 washes with water. Blocking was done with 3%
fat-free milk in PBS and 0.1% Tween and incubated for 1 h followed
by washing. The primary anti-NS3 antibody (Neomarkers) diluted
(1:500) in PBST containing milk powder was loaded into wells and
incubated for 1 h followed by washing steps and then again
incubated with 100 .mu.l of anti-mouse goat-HRP conjugated antibody
(American Qualex, 1:5000) diluted in PBST containing milk powder.
The plate was then incubated for 1 h at 37.degree. C. After the
incubation, the plate was washed thrice with PBST and twice with
water. The wells were then loaded with 100 .mu.l of
3,3,5,5-tetramethyl benzidine (TMB from American Qualex) substrate
and incubated for 10-15 min at room temperature. The reaction was
terminated by adding 50 .mu.l of 2N sulfuric acid per well and the
plate was read with a plate reader (Dynex Technologies) at 450 nm
(Modified form of protocol from Ausubel et al., 4.sup.th
edition).
[0307] Bradford assay for protein quantification (Bio-rad manual).
The Bradford assay was used to determine the total protein from the
plant extracts prepared as described above. This was used to
determine the percent of NS3 antigen in the total soluble protein
extract (or % TSP). An aliquot of plant extract as prepared above
was thawed on ice. Extraction buffer (15 n-M Na2CO3, 35 mM NaHCO3,
0.2 g NaN3, 0.1% Tween 20, and 5 mM PMSF adjusted to pH 9.6) was
used to make Bovine Serum Albumin (BSA) standards ranging from 0.05
to 0.5 .mu.g/.mu.l. Plant extracts were diluted 1:20 and 1:30 with
extraction buffer. 10 .mu.l of each standard and 10 .mu.l of each
plant dilution were added to the wells of a 96 well microtiter
plate (Costar) in duplicates. Bradford reagent (Biorad protein
assay) was diluted 1:4 with distilled water as specified and 200
.mu.l was added to each well. Absorbance was read. The comparison
of the absorbance to known amounts of BSA to that of the samples
was used to estimate the amount of total protein.
Results
[0308] Construction of pLD-5'UTR/NS3 Vector for tobacco chloroplast
transformation. The NS3 gene (starting 134 bp) in
pcDNA3.1DNV5-His-TOPO was PCR amplified and the restriction sites,
SacI and SnaBI at the 5' end and NotI at the 3' end of the 134 bp
of the NS3 gene were created for further subcloning. A PCR product
of 134 bp in size was obtained by amplification. The PCR product
was then digested with SacI and NotI and was ligated between the
same sites in p-Bluescript II KS vector. The transformed colonies
were selected as the pBluescript vector contains the LacZ gene for
a complementation and blue/white selection. The ligated plasmid
pBS-NS3 was isolated using midi-prep and the PCR product was
sequenced. The sequence was compared with the original NS3 sequence
sent by Dr. Lasarte. After confirming that the 5' of the NS3 gene
(beginning 134 bp) was successfully cloned into pBluescript, the
remaining NS3 gene (1770 bp) was digested from the original
pcDNA3.1D/V5-His-TOPO vector with BstXI and EcoRV and ligated
between the same sites in pBluescript vector. Therefore, the entire
NS3 gene (1.9 kb) was cloned into p-Bluescript vector. The entire
NS3 gene was digested with SnaBI and HindIII and cloned downstream
of psbA 5'UTR in pCR2.1. Finally, the psbA 5'UTR and the NS3 gene
were digested with EcoRV and EcoRI (fragment size 2. 1 kb) from
pCR2.1 and ligated into the final universal vector, pLD-AB-Ct. The
5.9 kb expression vector was developed with unique features
facilitating the genetic engineering of plant chloroplasts (FIG.
16). The integration of cloned chloroplast DNA into the plastid
genome occurs exclusively through site-specific homologous
recombination and excludes the foreign vector DNA (Kavanagh et al.,
1999). The pLD-AB-Ct uses trA and trnI genes (chloroplast transfer
RNAs coding for alanine and isoleucine) from the inverted repeat
region of the tobacco chloroplast genome as flanking sequences for
homologous recombination (Daniell, 1999). This chloroplast
expression vector is considered universal because it can be used to
transform the chloroplast genomes of not just tobacco, but several
other plant species as well (Daniell, 1999). Therefore, this
pLD-AB-Ct was successfully used as the backbone for the 5'LTR/NS3
cassette (FIG. 15).
[0309] Selection and Regeneration of Transgenic Lines. After
recovering in the dark for 48 hours from bombardment, leaves were
cut into 5 mm2 pieces and placed on RMOP (Daniell, 1993) plates
containing 500 .mu.g/ml spectinomycin for Petite Havana and 350
.mu.g/ml for LAMD-650, for the first round of selection as
described in Daniell (1997). From 10 bombarded Petit Havana leaves,
15 green shoots appeared after 4 weeks. From 10 bombarded LAMD
leaves, 3 green shoots appeared within 7 weeks, so the shoots from
the low-nicotine tobacco took longer to sprout and were less
numerous. Untransformed cells appeared bleached on the antibiotic
because they did not contain the aadA gene (FIG. 18). For second
selection the shoots were cut into 2 mm.sup.2 pieces and then
transferred to fresh RMOP plates with 500 .mu.g/ml and 350 .mu.g/ml
spectinomycin for Petite Havana and LAMD spectinomycin respectively
(FIG. 19).
[0310] During the second round of selection, the shoots that
appeared and tested positive for cassette integration into the
chloroplast genome by PCR analysis were grown in sterile jars
containing fresh plant media with spectinomycin until the shoots
grew to fill the jars (FIG. 20A).Then the plants were transferred
to pots with soil containing no antibiotic (FIG. 20B). Potted
plants were grown in a 16 hour light/8 hour dark photoperiod in the
growth chamber at 26.degree. C.
[0311] PCR Analysis of Transgenic Lines. Two primer sets were used
to identify transgenic lines. The 3P/3M set, the 3P primer annealed
to the chloroplast genome outside of the inserted cassette and the
3M primer annealed to the chimeric aadA gene (FIG. 21A). When both
of the primers annealed, a 1.65 kb PCR product was observed,
however, there was no PCR product in the untransformed (-) Petit
Havana and LAMD line (FIG. 21B). In addition, no PCR product should
be observed if the foreign gene cassette was integrated into the
nuclear genome or if the plants were mutants lacking the aadA gene.
Out of the 7 putative transgenic lines shown, all 7 were positive
for insertion of the foreign gene cassette (FIG. 21B).
[0312] For the 5P/2M set, the 5P primer annealed to the chimeric
aadA gene and the 2P primer annealed to trnA gene within the
cassette (FIG. 22A). When both of the primers annealed, a 3.7 kb
PCR product was observed, however, there was no PCR product in the
untransformed (-) petit Havana or LAMD line (FIG. 22B). The correct
size of PCR product (3.7 kb) indicated that the entire foreign gene
cassette and not just the aadA gene had been integrated into the
chloroplast genome (FIG. 22A).
[0313] Southern Blot Analysis of Transgenic Plants (T0). Southern
blots were performed to confirm integration of the NS3 gene
cassette utilizing two different DNA probes (FIG. 23 and FIG. 24).
A 0.81 kb DNA fragment containing chloroplast-flanking sequences
was used to probe a Southern blot to determine homoplasmy or
heteroplasmy after bombardment with pLD-AB-NS3 (T0). This
determination was also used to estimate chloroplasts genome copy
number. BglII digested DNA from transformed plants produced a 5.2
kb and 2.7 kb fragment when probed with the 0.81 kb probe that
hybridizes to the trnI and trnA flanking sequences (FIG. 23).
Untransformed plant DNA from both tobacco varieties produced only a
4.47 kb fragment, indicating no integration of foreign DNA.
Transgenic plant DNA (T0) produced only the 5.2 and 2.7 kb fragment
in all transgenic plants indicating homoplasmy (contained only
transformed chloroplast genomes).
[0314] The second probe used was a 2.1 kb 5'UTR/NS3 sequence that
hybridized to a 2.7 kb fragment in transformed plants and no
fragment was evident in untransformed plants (FIG. 24). All
transgenic plants produced a 2.7 kb fragment corresponding to the
NS3 sequence (FIG. 24).
[0315] Chloroplast-synthesized NS3 and Immunoblot Analysis. Petit
Havana and LAMD were bombarded with pLD-AB-NS3. Western blot
analysis was performed on the leaf cell extracts. The total plant
protein was separated using 10% sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE). The NS3 protein was
detected by mouse monoclonal antibody against NS3. Western blots
detected NS3 protein at 69 kDa using chemiluminescense (FIG.
25A).
[0316] Quantification of Chloroplast-synthesized NS3 by ELISA. To
quantify the amount of NS3 in transgenic Petit Havana and LAMD leaf
extracts, an indirect enzyme-linked immunosorbent assay (ELISA) was
used. The purified NS3 protein was used to make a six-point
standard curve. 1 .mu.l of the plant protein extracts were diluted
into 20 ul and 30 ul of coating buffer to determine the dilution
that would be in the linear range of NS3 standard curve. The
primary antibody was anti-NS3 Mouse Monoclonal Antibody. The
secondary antibody was Goat anti-mouse IgG conjugated to
horseradish peroxidase. The addition of one step substrate (TMB)
into the wells resulted in a color change that was eventually read
on a plate reader with a 450 nm filter. The total soluble protein
(tsp) in the plant leaf extracts was determined with a Bradford
Bio-Rad Protein Assay. The levels of NS3 in transgenic LAMD were
calculated as a percentage of the total soluble protein of leaf
extracts (FIG. 26).
Discussion
[0317] HCV vaccine development began recently with the use of
recombinant HCV proteins as the immunogenic material (Choo et al.,
1994). The initial candidate HCV vaccine developed in 1994, derived
from the envelope glycoproteins (gpE1/E2) of HCV, with muramyl
dipeptide adjuvants, induced high levels of neutralizing antibodies
in chimpanzees and provided protection in a proportion of animals
challenged with low doses of the homologous strain (Choo et al.,
1994; Houghton et al., 1997). In the chimpanzees that were
infected, the risk of persistent infection seemed to be reduced.
Little new information about this candidate vaccine is available.
Additional studies of a recombinant E1/E2 protein and peptide
vaccine produced in insect cells (Esumi et al., 1999) also
suggested that induced antibodies could neutralize low-level
challenge with homologous HCV in the chimpanzee. In one DNA vaccine
study utilizing chimpanzees, a plasmid encoding the E2 HCV protein
was used as immunogen and elicited antibodies and immune response
but on challenge with homologous HCV, sterilizing immunity could
not be achieved (Forns et al, 2000). Other approaches to vaccine
development have included the incorporation of HCV proteins into
recombinant viruses (Siler et al., 2002; Brinster et al., 2002),
the synthesis of HCV-like particles in insect cells (Lechmann et
al., 2001), expression of the hypervariable-1-region of E2 in
tobacco plants (Nemchinov et al., 2000) and DNA-based immunization
(Brinster et al., 2001; Foms et al., 2000). Plant synthesized
recombinant TMV/HCV HVR1 epitope/CTB induced a strong immune
response when mice were immunized intranasally (Nemchinov et al.,
2001). Plants infected with a recombinant tobacco mosaic virus
engineered to express the hypervariable region 1 (HVR1) of HCV, the
HVR1/CTB chimeric protein elicited both anti-CTB and anti-HVR1
serum which specifically bound to HCV virus-like particles. The HCV
HVR1 epitope was also cloned into alfalfa mosaic virus (ALMV) coat
protein and expressed in transgenic tobacco plants. The
Plant-derived HVR1/ALMV-CP reacted with HVR1 and ALMV-CP specific
monoclonal antibodies and immune sera from individuals infected
with HCV (Nemchinov et al., 2001). A replication-deficient
recombinant adenovirus expressing HCV NS3 protein was constructed.
Mice immunized with this recombinant adenovirus were protected
against challenge with a recombinant vaccinia virus expressing HCV
polyprotein (Arribillaga et al, 2002).
[0318] The NS3 gene was introduced into pLD-Ct, the universal
chloroplast expression vector, which was developed with unique
features that facilitate chloroplast genetic engineering (FIG. 16).
The 5' untranslated region (UTR) of the plastid psbA gene and its
promoter were used to increase translation efficiency. The 5'UTR is
involved in mRNA-rRNA interactions (between the mRNA
ribosome-binding site and 16S r RNA 3' end) and interactions with
translational-activating proteins that facilitate loading onto
ribosomes (Maliga, 2002). The psbA gene encodes the D1 protein of
photosystem II and is rapidly turned over in the chloroplasts (Eibl
et al., 1999). The psbA 5'UTR is about 200 bp and contains a
promoter. The 3' regulatory region (3'UTR) is important for mRNA
stability and functions as an inefficient terminator of
transcription. A unique short inverted repeat (IR) which can
potentially fold into a stem loop structure at the 3'UTR probably
act as a RNA processing signal rather than termination signal,
playing a role in both RNA 3' end formation and stabilization
(Hager and Bock, 2000). The pLD-Ct contains a chimeric aadA gene as
a selectable marker, which encodes aminoglycoside
3'-adenylyltransferase. This enzyme catalyzes the covalent
modification of aminoglycoside-type antibiotics and thereby
inactivates them. The aadA protein catalyses the covalent transfer
of an AMP residue from ATP to spectinomycin, thereby converting the
antibiotic into an inactive from (adenyl-spectinomycin) that no
longer inhibits protein biosynthesis on prokaryotic 70S ribosomes
present in the chloroplast. The aadA gene is driven by a portion of
the constitutive promoter of the chloroplast 16S rRNA operon
(Prrn). The pLD-AB vector integrates the 16S rRNA promoter, aadA
gene, 5'UTR, NS3 gene and 3'UTR cassette into the Inverted Repeat
(IR) regions of the chloroplast genome between the homologous
flanking sequences, trnI and tmA genes. The trnI and trnA
intergenic spacer regions are highly conserved among higher plants
(Guda et al., 2000). The pLD-Ct vector was constructed with a
multiple cloning site downstream of the aadA gene and upstream of
the TpsbA portion and flanked by chloroplast transfer RNA genes for
isoleucine and alanine (trnI and trnA respectively). The plasmid
can replicate autonomously because it contains a unique chloroplast
origin of replication (Daniell, 1990; Kumar et al. 2004a, b) and
ColE1 origin of replication that operates in E. coli (Glick and
Pasternak, 1998). The translational apparatus of chloroplasts very
much resembles that of prokaryotes, in that tRNAs, rRNAs, ribosomal
proteins and the initiation and elongation factors exhibit strong
similarity with their counterparts in E. coli (Brixey et al.,
1997). As a way of testing the integrity of the NS3 cassette and
its potential for protein expression, E. coli was transformed with
pLD-AB-NS3. Western blot analysis performed on the E. coli cell
lysates indicated the presence of NS3 protein at the expected size
of 69 kDa (FIG. 17), while the untransformed E. coli cell lysates
showed no protein. Since the protein synthetic machinery of
chloroplasts is similar to that of E. coli (Brixey et al., 1997),
the positive expression of NS3 suggested that it could be
successfully expressed within transgenic chloroplasts. Two
varieties of tobacco were bombarded with gold particles coated with
pLD-AB-NS3 (Daniell, 1993). Petit Havana is the model tobacco
variety because it is amenable to genetic engineering. The second
variety of tobacco bombarded with pLD-AB-NS3 was LAMD-609. This
tobacco hybrid contains 0.06% nicotine (Collin et al., 1974), which
is at least 50-fold lower than the Petit Havana tobacco (3-4%).
Tobacco is the easiest plant to genetically engineer and is widely
used to test suitability of plant-based systems for bioproduction
of recombinant proteins. Tobacco is ideal for transformation
because of its ease for genetic manipulation and is an excellent
biomass producer and a prolific seed producer (up to one million
seeds produced per plant). Bombarded leaves were placed on RMOP
medium containing no antibiotics and allowed to recover from
bombardment in the dark for 48 hours (Daniell, 1993; Daniell, 1997;
Daniell et al. 2004a).
[0319] After the recovery period, bombarded leaf discs were placed
on selective plant medium containing 500 g/ml of spectinomycin.
Green shoots that emerged from the part of the leaf disc in contact
with the medium were considered putative transformants because
growth indicated that the aadA gene had been integrated into the
chloroplast genome and was expressing functional enzyme. Each shoot
(transgenic event) was subjected to a second round of selection
(500 .mu.g/ml of spectinomycin) in an effort to ensure that only
transformed genomes existed in the cells of the transgenic lines
(homoplasmy). A heteroplasmic condition is unstable and will result
in loss of the transgene when the cell divides without selective
pressure (Hager and Bock, 2000). A PCR method of screening putative
transformants was utilized to distinguish chloroplast transformants
from mutants and nuclear transformants (Daniell et al. 2004a). Only
those transgenic lines with the appropriately sized PCR products
were used in further characterizations. The Southern blot analysis
utilized the integrity of DNA complimentary hybridization to
identify specific sequences in the various plant genomes. Different
positive transgenic lines (T0) were tested to confirm site-specific
integration and to determine homoplasmy or heteroplasmy (FIGS. 26
& 27). The 810 bp flanking sequence probe confirmed that the
NS3 gene cassette had been integrated into the chloroplast genome.
An enzyme-linked immunosorbent assay (ELISA) utilizing 96-well
microtiter plates, was used to quantify the amount of NS3 in
transgenic LAMD-609 leaf extracts. The highest percentage of NS3
was 2% of total soluble protein, observed in the old leaves. In
conclusion, this study reports successful expression of the HCV NS3
antigen in transgenic chloroplasts and the plant derived
recombinant HCV vaccine antigen can potentially reduce expenses
normally associated with the production and delivery of
conventional vaccines and is a safe and inexpensive source for the
production of HCV vaccine antigen.
REFERENCES
[0320] Alter M J. (1995) Epidemiology of hepatitis C in the west.
Semin Liver Dis. 15: 5-14. [0321] Arribillaga L, Cerio A, Sarobe P,
Casares N, Gorraiz M, Vales A, Bruna-Romero 0, Borras-Cuesta F,
Paranhos-Baccala G, Prieto J, Ruiz J, Lasarte J J. (2002)
Vaccination with an adenoviral vector encoding hepatitis C virus
(HCV) NS3 protein protects against infection with HCV-recombinant
vaccinia virus. Vaccine 21: 202-210. [0322] Bedbrook J. R. and
Bogorad, L. (1976) Endonuclease recognition sites mapped on the Zea
mays chloroplast DNA. Proc. Natl.Acad. Sci. USA 73: 4309-4313.
[0323] Blowers A D, Bogorad L, Shark K B, and Sanford J C. (1989)
Studies on Chlamydomonas chloroplast transformation: foreign DNA
can be stably maintained in the chromosome. Plant Cell 1, 123-132.
[0324] Bogorad L. (2000) Engineering chloroplasts: an alternative
site for foreign gene, proteins, reactions and products. TIBTECH
18, 257-263. [0325] Botarelli P, Brunetto M R, Minutello M A.
(1993) Tymphocyte response to hepatitis C virus in different
clinical courses of infection. Gastroenterology 104(2): 580-7.
[0326] Boynton J E, Gillham N R, Harris E H, Hosler J P, Johnson A
M, Jones A R, Randolph-Anderson B L, Robertson D, Klein T M, Shark
K B. (1988) Chloroplast transformation in Chlamydomonas with high
velocity microprojectiles. Science 240: 1534-1538. [0327] Bukh J,
Forns X, Emerson S U, Purcell R H. (2001) Studies of hepatitis C
virus in chimpanzees and their importance for vaccine development.
Intervirology 44: 132-142. [0328] Brinster C, Inchauspe G. (2001)
DNA vaccines for hepatitis C virus. Intervirology 44: 143-153.
[0329] Brinster C, Chen M., Boucreux D, Paranhos-Baccala G,
Liljestrom P, Lemmonier F, Inchauspe G. (2002) Hepatitis C virus
non-structural protein 3-specific cellular immune responses
following single or combined immunization with DNA or recombinant
Semliki Forest virus particles. J. Gen. Virol. 83: 369-381. [0330]
Brixey M, Guda C, Daniell H. (1997) The chloroplast psbA promoter
is more efficient in E. coli than the T7 promoter for
hyper-expression of a foreign protein. Biotechnology Letters. 19,
395-400 [0331] Camps J, Castilla A, Ruiz J, Ciweira M P, Prieto J.
(1993) Randomised trial of lymphoblastoid alpha-interferon in
chronic hepatitis C. Effects on inflammation, fibrogenesis and
viremia. J Hepatol 17(3): 390-6. [0332] Castanon S, Marin M S,
Martin-Alonso J M, (2000). Immunization with potato plants
expressing VP60 proteins protects against rabbit hemorrhagic
disease virus. J Virology 73: 4452-55. [0333] Cerny A, McHutchison
J G, Pasquinelli C. (1995) Cytotoxic T lymphocyte response to
hepatitis C virus-derived peptides containing the HLA A2.1 binding
motif. J Clin Invest 95(2):521-30. [0334] Choo Q. L. (1989)
Isolation of a cDNA clone derived from a blood bore non-A, non-B
viral hepatitis genome. Science 244: 359-362. [0335] Choo Q L, Kuo
G, Ralston R, Weiner A, Chien D, Van Nest G, Han J, Berger K,
Thudium K, Kuo C, Kanospon J, McFarland J, Tarizi A, Ching K, Moss
B, Cummins L B, Houghton M, Muchmore E. (1994) Vaccination of
chimpanzees against infection by the hepatitis C virus. Proc. Natl.
Acad. Sci. USA 91: 1294-1298. [0336] Collins, Legg, Kasperbauer
(1974). Tobbaco hybrid, LAMD-609. Crop Sci 14, 77-80. [0337] Cooper
S, Erickson A L, Adams EJ. (1999) Analysis of a successful immune
response against hepatitis C virus. Immunity 10 (4): 439-49. [0338]
Cowley D, Mackin R. (1996). Expression, purification and
characterization of recombinant human proinsulin. FEBS Letters
402:124-130. [0339] Esumi M, Rikihisa T, Nishimura S, Goto J,
Mizuno K, Zhou Y.-H., Shikata T. (1999) Experimental vaccine
activities of recombinant E1 and E2 glycoproteins and hypervariable
region 1 peptides of hepatitis C virus in chimpanzees. Arch. Virol.
144: 973-980. [0340] Eibl C, Zou Z, Beck A, Kim M, Mullet J, Koop
H. (1999). In vivo analysis of plastid psbA, rbcL and rpl32UTR
elements by chloroplast transformation: tobacco plastid gene
expression is, controlled by modulation of transcript levels, and
translational efficiency. Plant J. 19, 333-345 [0341] Daniell H.,
Ramanujan P, Krishnan M, Gnanam A, Rebeiz C A. (1983) hi vitro
synthesis of photosynthetic membranes: 1. Development of
photosystem I activity and cyclic phosphorylation. Biochem.
Biophys. Res. Comun. 111: 740-749. [0342] Daniell H, Krishnan M,
Umabai U, Gnanam A. (1986) An efficient and prolonged in vitro
translational system from cucumber etioplasts. Biochem. Biophys.
Res. Comun. 135: 48-255. [0343] Daniell H, McFadden B A. (1987)
Uptake and expression of bacterial and cyanobacterial genes by
isolated cucumber etioplasts. Proc. Natl. Acad. Sci. USA, 84:
6349-6353. [0344] Daniell H, Vivekananda J, Neilsen B, Ye G N,
Tewari K K, Sanford J C. (1990) Transient foreign gene expression
in chloroplasts of cultured tobacco cells following biolistic
delivery of chloroplast vectors. Proc Natl Acad Sci USA. 87: 88-92.
[0345] Daniell H, Krishnan M, McFadden BA. (1991) Expression of
B-glucuronidase gene in different cellular compartments following
biolistic delivery of foreign DNA into wheat leaves and calli.
Plant Cell Reports. 9: 615-619. [0346] Daniell H. (1993). Foreign
gene expression in chloroplasts of higher plants mediated by
tungsten particle bombardment. Methods Enzymol. 217: 536-556.
[0347] Daniell H. (1997). Transformation and foreign gene
expression in plants mediated by microprojectile bombardment. Meth
Mol Biol, 62: 453-488. [0348] Daniell H, Datta R, Varma S, Gray S,
and Lee S B. (1998) Containment of herbicide resistance through
genetic engineering of the chloroplast genome. Nature
Biotechnology. 16: 345-348. [0349] Daniell H. (1999) Universal
chloroplast integration and expression vectors, transformed plants
and products thereof, World Intellectual Property Organization. WO
99/10513. [0350] Daniell H, Streafield S J, Wycoff K. (2001).
Medical molecular farming: production of antibodies,
biopharmaceuticals and edible vaccines in plants. Trends Plant
Sci., 6(5): 219-26. [0351] Daniell H, Lee S B, Panchal T, Wiebe P
O. (2001a) Expression of the native cholera toxin B subunit gene
and assembly of functional oligomers in transgenic tobacco
chloroplasts. Journal of Molecular Biology, 311:1001-1009. [0352]
Daniell H, Muthukumar B, Lee S B. (2001b) Marker free transgenic
plants: engineering the chloroplast genome without the use of
antibiotic selection. Curr Genet., 39(2):109-16. [0353] Daniell H.
(2002). Molecular strategies for gene containment in GM crops.
Nature Biotechnology, 20: 581-586. [0354] Daniell H, Dhingra, A.
(2002a) Multiple gene engineering. Current Opinion in
Biotechnology, 13:136-141. [0355] Daniell H. (2004) Medical
Molecular Pharming: Therapeutic recombinant antibodies
biopharmaceuticals, and edible vaccines in transgenic plants
engineered via the chloroplast genome. Encyclopedia of Plant and
Crop Science. In Press. [0356] Daniell H, Ruiz O N, Dhingra A.
(2004a) Chloroplast genetic engineering to improve agronomic
traits. Methods in Molecular Biology 286: 111-137. [0357] Daniell
H, Carmona-Sanchez O, Burns B B (2004b) Chloroplast derived
antibodies, biopharmaceuticals and edible vaccines. In R Fischer
and S Schillberg eds, Molecular Farming Weinheim: WILEY-VCH Verlag,
pp. 113-133. [0358] Daniell H, Chebolu S, Kumar S, Singleton M,
Falconer R (2005) Chloroplast-derived vaccine and other therapeutic
proteins. Vaccine 23: 1779-1783. [0359] De Cosa B, Moar W, Lee S B,
Miller M, Daniell H. (2001). Hyper-expression of Bt Cry2Aa2 operon
in chloroplasts leads to formation of insecticidal crystals. Nature
Biotechnology, 19: 71-74. [0360] DeGray, G., Rajasekaran, K.,
Smith, F., Sanford, J., Daniell, H. (2001) Expression of an
antimicrobial peptide via the chloroplast genome to control
phytopathogenic bacteria and fungi. Plant Physiology, 127: 1-11.
[0361] Diepolder H M, Zachoval R, Homann R M, Wierenga E A,
Santantonio T, Jung M C, Eichenlaub D, Pape G R. (1995) Possible
mechanism involving T-lymphocyte response to nonstructural protein
3 in viral clearance in acute hepatitis C virus infection. Lancet
346: 1006-7. [0362] Diepolder H M, Gerlach J T, Zachoval R, Homann
R M, Jung M C, Wierenga E A, Scholz S, Santantonio T, Houghton M,
Southwood S, Sette A, Pape G R. (1997) Immunodominant CD4+ T-cell
epitope within nonstructural protein 3 in acute hepatitis C virus
infection. J Virol; 71:6011-9. [0363] El Attar A K, Shamloul A M,
Shalaby A A, Riad B Y, Saad A, Mazyad H M and Keith J M (2004).
Expression of chimeric HCV peptide in transgenic tobacco plants
infected with recombinant alfalfa mosaic virus for development of a
plant-derived vaccine against HCV. African Journal of Biotechnology
Vol. 3 (11), pp. 588-594. [0364] Erickson A L, Houghton M, Choo Q
L, Weiner A J, Ralston R, Muchmore E, Walker C M. Hepatitis C
virus-specific CTL responses in the liver of chimpanzees with acute
and chronic hepatitis C. (1993) J Immunol 151: 4189-99. [0365]
Falconer R. 2002. Expression of interferon alpha 2b in transgenic
chloroplasts of a low-nicotine tobacco. M.S. thesis, University of
Central Florida, Orlando, Fla. [0366] Fernandez-San Millan A,
Mingo-Castel A, Daniell H. (2003) A chloroplast transgenic approach
to hyper-express and purify human serum albumin, a protein highly
susceptible to proteolytic degradation. Plant Biotechnology
Journal. 1: 71-79. [0367] Ferrari C, Valli A, Galati L. (1994)
T-cell response to structural and nonstructural hepatitis C virus
antigens in persistent and self-limited hepatitis C virus
infections. Hepatology 19 (2):286-95. [0368] Forms X, Payette P J,
Satterfield W, Eder G, Mushahwar I K, Govindarajan S, Davis H L,
Emerson S U, Purcell R H, Bukh J. (2000). Vaccination of
chimpanzees with plasmid DNA encoding the hepatitis C virus (HCV)
envelope E2 protein modified the infection after challenge with
homologous monoclonal HCV. Hepatology 32: 618-625. [0369] Gillham N
W (1994). Organelles genes and genomes. Oxford University Press,
Oxford. [0370] Glick B, Pasternak J. (1998) Molecular
Biotechnology: Principles and Applications of Recombinant DNA. ASM
Press, 2.sup.nd edition. [0371] Grakoui A, Wychowski C, Lin C,
Feinstone S M, Rice C M (1993) Expression and identification of
hepatitis C virus polyprotein cleavage products. J Virol 67:
1385-95. [0372] Grakoui A, McCourt D W, Wychowski C, Feinstone Sm,
Rice C M. (1993) A second hepatitis C virus-encoded proteinase.
Proc Natl Acad Sci USA 10583-10587. [0373] Gruener N H, Gerlach T
J, Jung M C. (2000) Association of hepatitis C virus-specific CD8+
T cells with viral clearance in acute hepatitis C. J Infect Dis 181
(5): 1528-36. [0374] Guha C, Sha S J, Ghosh S, Lee S W,
Roy-Chowdhury N, Roy-Chowdhury H. (2003) Molecular therapies for
viral hepatitis. BioDrugs. 17: 81-91. [0375] Guda C, Lee S B,
Daniell H. (2000) Stable expression of biodegradable protein based
polymer in tobacco chloroplasts. Plant Cell Rep. 19: 257-262.
[0376] Hager M., Bock R. (2000). Enslaved bacteria as new hope for
plant biotechnologist. Appl. Microbiology Biotechnol. 54: 302-310.
[0377] Han D S, Hahm B, Rho H-M, Jang S K. (1995) Identification of
the proteinase domain in NS3 of hepatitis C virus. J Gen Virol. 76:
985-993. [0378] He X S, Rehermann B, Lopez-Labrador F X.
Quantitative analysis of hepatitis C virus-specific CD8+ T cells in
peripheral blood and liver using peptide-MHC tetramers. Proc Natl
Acad Sci USA, 96 (10):5692-7. [0379] Hoffmann R M, Diepolder H M,
Zachoval R. (1995) Mapping of immunodominant CD4+ T lymphocyte
epitopes of hepatitis C virus antigens and their relevance during
the course of chronic infection. Hepatology 21(3):632-8. [0380]
Houghton M. Hepatitis C viruses. (1996) In: Fields B N, Knipe D M,
Howley P M, editors. Fields Virology, 3rd edn. New York: Raven
Press p. 1035-1058. [0381] Houghton M, Choo Q L, Chien D, Kuo G,
Weiner A, Coates S, Cousens L, Wiuniger M, Selby M, Ralston R,
Berger K, Dong C, Crawford K, Tabrizi-Wright A, Purcell R H,
Muchmore E, Morandi P, Rosa D, Abrignani S. (1997) Development of
an HCV vaccine. In: Rizzetto, M., Purcell, R. H., Gerin, J. L.,
Verme, G. (Eds.), Viral Hepatitis and Liver Disease. Proceedings of
the Ninth Triennial International Symposium of Viral Hepatitis and
Liver Disease, Rome, Italy, 21-25 Apr. 1996. Edizioni Minerva
Medica, Turin, pp. 656-659. [0382] Invitrogen Catalog, 2000. [0383]
Kavanagh T, Thanh N, Lao N, McGrath N, Peter S, Horvath E, Dix P,
Medgyest P. (1999). Homeologous Plastid DNA Transformation in
Tobacco is Mediated by Multiple Recombination Events. Genetics,
152: 1111-1122. [0384] Klein T M (1987) High velocity
microprojectiles for delivering nucleic acids into living cells.
Nature 327: 70-73. [0385] Koff R S. Fulminant hepatitis due to
HBV/HDV coinfection. Hosp Pract (Off Ed). 1987 Nov. 15; 22(11)
145-50. [0386] Kong Q, Richter L, Yang Y, Aratzen C, Mason H,
Thanavala Y. (2001). Oral immunization with hepatitis B surface
antigen expressed in transgenic plants. Proc. Natl. Acad. Sci. USA,
20:11539-11544. [0387] Kota M, Daniell H, Varma S, Garczynski S F,
Gould F, William M J. (l 999) Overexpression of the Bacillus
thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers
resistance to plants against susceptible and Bt-resistant insects.
Proc. Natl. Acad. Sc. USA 96, 1840-1845. [0388] Kumar S, Daniell H.
(2004) Engineering the chloroplast genome for hyper-expression of
human therapeutic proteins and vaccine antigens in recombinant
protein protocols. Methods Mol. Biol. 267: 365-383. [0389] Kumar S,
Dhingra A, Daniell H. (2004a) Plastid-expressed betaine aldehyde
dehydrogenase gene in carrot cultured cells, roots, and leaves
confer enhanced salt tolerance. Plant Physiol 136: 2843-2854.
[0390] Kumar S, Dhingra A, Daniell H. (2004b) Stable transformation
of the cotton plastid genome and maternal inheritance of
transgenes. 2004 Plant Mol Biol 56: 203-216 [0391] Kurokohchi K,
Akatsuka T, Pendleton C D (1996) Use of recombinant protein to
identify a motif-negative human cytotoxic T-cell epitope presented
by HLA-A2 in the hepatitis C virus NS3 region. J Virol 70 (1):
232-40. [0392] Kusnadi A, Nikolov Z, Howard J. (1997) Production of
Recombinant proteins in transgenic plants: Practical
considerations. Biotechnology and Bioengineering, 56 (5), 473-484.
[0393] Kolodner R, Tewari, K K. (1979). Inverted repeats in
chloroplast DNA from higher plants. Proc. Natl. Acad. Sci. USA
76:41-45. [0394] Laemmli U. (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4. Nature 227:
680-685. [0395] Lasarte J J, Garcia Granero M, Lopez A. (1998)
Cellular immunity to hepatitis C virus core protein and the
response to interferon in patients with chronic hepatitis C.
Hepatology 28 (3): 815-22. [0396] Lechmann M, Ilenfeldt H G,
Braunschweiger I. (1996) T- and B-cell responses to different
hepatitis C virus antigens in patients with chronic hepatitis C
infection and in healthy anti-hepatitis C virus-positive blood
donors without viremia. Hepatology
24 (4): 790-5. [0397] Lechmann M, Liang T J. (2000). Vaccine
development for hepatitis C. Semin Liver Dis. 20 (2): 211-26.
[0398] Lechmann M, Murata K, Satoi J, Vergalla J, Baumert T F,
Liang T J. (2001). Hepatitis C virus-like particles induce
virus-specific humoral and cellular immune responses in mice.
Hepatology 34: 417-423. [0399] Lee S B, Kwon B B, Kwon S J, Park S
C, Jeong M J, Han S E, Byun M O, Daniell H (2003) Accumulation of
trehalose within transgenic chloroplasts confers drought tolerance.
Mol. Breeding, 11: 1-13. [0400] Leelavathi S, Reddy V S (2003)
Chloroplast expression of His-tagged GUS-fusions: a general
strategy to overproduce and purif foreign proteins using
transplastomic plants as bioreactors. Mol. Breeding, 11: 49-58.
[0401] Lohmann V, Korner F, Koch J, Herian U, Theilmann L,
Bartenschlager R. (1999) Replication of subgenomic hepatitis C
virus RNAs in a hepatoma cell line. Science 285:110-113. [0402]
Lohmann V, Komer F, Dobierzewska A, Bartenschlager R, (2001).
Mutations in hepatitis C virus RNAs conferring cell culture
adaptation. J. Virol. 75: 1437-1449. [0403] Maddrey W C. (1999)
Safety of combination interferon alfa-2b/ribavirin therapy in
chronic hepatitis C-relapsed and treatment-naive patients. Semin
Liver Dis. 19 (Suppl 1), 67-75. [0404] Maliga P. (2002) Engineering
the plastid genome of higher plants. Current Opinion in Plant
Biology, 5:164-172. [0405] Martin W, Hermann R G. (1998) Gene
transfer from organelles to the nucleus: how much, what happens,
and why? Plant Physiol. 118, 9-17. [0406] Mason H, Lam M, Arntzen
C. (1992) Expression of hepatitis B surface antigen in transgenic
plants. Proc. Natl. Acad. Sci. USA. 89:11745-11749. [0407] Mast E
E, Alter M J, Margolis H S (2004). Strategies to prevent and
control hepatitis B and C virus infections: a global perspective.
Vaccine. 17(13-14):1730-3. [0408] McHutchison J G, Poynard T.
Combination therapy with interferon plus ribavirin for the initial
treatment of chronic hepatitis C. (1999) Semin Liver Dis 19 (Suppl
1): 57-65. [0409] Missale G, Bertoni R, Lamonaca V. (1996)
Different clinical behaviors of acute hepatitis C virus infection
are associated with different vigor of the anti-viral cell-mediated
immune response. J Clin Invest 98 (3): 706-14. [0410] Molina A,
Herva-Stubbs S, Daniell H, Mingo-Castel A M, Veramendi J. (2004)
High yield expression of a viral peptide animal vaccine in
transgenic tobacco chloroplasts. Plant Biotechnology, In Press.
[0411] Mondelli M U, Cerino A, Boender P, Oudshoorn P, Middledorp
J, Fipaldidni C, La Monica N, Habets W (1994) Significance of the
immune response to a major, conformational B-cell epitope on the
hepatitis C virus NS3 region defined by a human monoclonal
antibody. J Virol 68: 4829-4836. [0412] Moreira D, Le Guyader H,
Phillippe H (2000). The origin of red algae and the evolution of
chloroplasts. Nature 405: 69-72. [0413] National Institutes of
Health Consensus Development Conference Statement: Management of
Hepatitis C. (2002b). Hepatology 36 (5 Supp1.1), S3-S20. [0414]
Nemchinov L G, Liang T J, Rifaat M M, Mazyad H M, Hadidi A, Keith J
M. (2001). Development of a plant-derived subunit vaccine candidate
against hepatitis C virus. Arch. Virol. 145: 2557-2573. [0415] Op
De Beeck A, L. Cocquerel, J. Dubuisson. (2001) Biogenesis of
hepatitis C virus envelope glycoproteins. J. Gen. Virol. 82:
2589-2595. [0416] Polakos, N. K., Drane, D., Cox, J., Ng, P.,
Selby, M. J., Chien, D., O'Hagan, D. T., Houghton, M., Paliard, X.
(2001). Characterization of hepatitis C virus core-specific immune
responses primed in rhesus macaques by a nonclassical ISCOM
vaccine. J. Immunol. 166: 3589-3598. [0417] Palmer J D (1985).
Comparative organization of Chloroplast genomes. Annu Rev genet 19:
325-354. [0418] Pape G R, Gerlach T J, Diepolder H M (1999). Role
of the specific T-cell response for clearance and control of
hepatitis C virus. J Viral Hepatol 6 (Suppl 1):36-40. [0419]
Purnell R. (1997) The hepatitis C virus: overview. Hepatology 26:
11 S-45S. [0420] Poynard T, Marcellin P, Lee S S (1998) Randomised
trial of interferon alpha2b plus ribavirin for 48 weeks or for 24
weeks versus interferon alpha2b plus placebo for 48 weeks for
treatment of chronic infection with hepatitis C virus.
International Hepatitis Interventional Therapy Group (1HIT). Lancet
352 (9138):1426-32. [0421] Ruiz O N, Hussein H, Terry N, Daniell H.
(2003) Phytoremediation of organomercurial compounds via
chloroplast genetic engineering. Plant Physiol. 132:1-9. [0422]
Sambrook, Frish, Maniatis. (1989) Molecular cloning. A laboratory
manual. 2nd edition. Cold spring harbor laboratory press. [0423]
Sanford J C (1991) An improved helium-driven biolistic device.
Technique 3: 3-16. [0424] Selby M J, Choo Q L, Berger K, Kuo G,
Glazer E, Eckart M, Lee C, Chien D, Kuo C, [0425] Houghton M (1993)
Expression, identification and subcellular localization of the
proteins encoded by the hepatitis C viral genome. J Gen Virol 74:
1103-13. [0426] Sidorov V A, Kasten D, Pang S Z, Hajdukiewicz P T,
Staub J M. (1999) Technical advance: stable chloroplast
transformation in potato: use of green fluorescent protein as a
plastid marker. Plant J. 19: 209-216. [0427] Siler C A, McGettigan
J P, Dietzcshold B, Herrine S K, Dubuisson J, Pomerantz R J,
Schnell M J (2002). Live and killed rhabdovirus-based vectors as
potential hepatitis C vaccines. Virology 292: 24-34. [0428]
Singleton M L (2003). Expression of CaF1 and LcrV as a fusion
protein for a vaccine against Yersinia pestis via chloroplast
genetic engineering. MS thesis, University of Central Florida, USA.
[0429] Sharara A I, Hunt C M, Hamilton J D. (1996) Ann. Intern.
Med. 125: 658-668. [0430] Staub J M, Garcia B, Graves J. (2000)
High-yield production of a human therapeutic protein in tobacco
chloroplasts. Nat. Biotechnol. 18: 333-338. [0431] Streatfield S J,
Jilka J M, Hood E E, Turner D D, Bailey M R (2001) Plant-based
vaccines: unique advantages. Vaccine. 19: 2742-2748. [0432] Svab Z,
Maliga P. (1993) High frequency plastid transformation in tobacco
by selection for a chimeric aadA gene. Proceedings of the National
Academy of Sciences, USA 90: 913-917. [0433] Tacket C O, Mason H S,
Losonsky G, Clements J D, Levine M M. (1998) Immunogenicity in
humans of a recombinant bacterial-antigen delivered in transgenic
potato. Nat. Med. 4 607-609. [0434] Tacket C O, Mason H S, Losonsky
G, Estes M K, Levine M M. (2000) Human immune responses to a novel
norwalk virus vaccine delivered in transgenic potatoes. J. Infect.
Dis 182: 302-305. [0435] Tacket C O, Sztein M B, Losonsky G A,
Wasserman S S, Estes M K (2003).Humoral, mucosal, and cellular
immune responses to oral Norwalk virus-like particles in
volunteers. Clinimmunology 108 (3): 241-7. [0436] Takamizawa A,
Mori C, Fuke I, Manabe S, Murakami S, Fujita J, Onishi E, Anodoh T,
Yoshida I, Oakayama H. (1991) Structure and organization of the
hepatitis C virus genome isolates from human carriers. J. Virol.
65: 1105-1113. [0437] Tanaka T, Kato N, Cho M J, Shimotohno K.
(1995) A novel sequence found at the 3' terminus of the hepatitis C
virus genome. Biochem Biophys Res Commun 215: 744-749. [0438]
Thimme R, Oldach D, Chang K M. (2001) Determinants of viral
clearance and persistence during acute hepatitis C virus infection.
J Exp Med 194(10):1395-406. [0439] Tomei L, Failla C, Santolini E,
De Francesco R, La Monica N (1993). NS3 is a serine proteinase
required for processing of hepatitis C virus polyprotein. J Virol
67: 4017-4026. [0440] Tuboly T, Yu W, Bailey A, Degrandis S, Du S.
(2000) Immunogenicity of porcupine transmissible gastroenteritis
virus spike protein expressed in plants. Vaccine 18: 2023-2028.
[0441] Vallari D S, Jett B W, Alter H J, Minuns L T, Holzman R,
Shih J W (1992) Serological markers of posttransfusion hepatitis C
viral infection. J Clin Microbiol 30: 552-556. [0442] Vertuani S,
Bazzaro M. Gualandi G. Micheletti F. Marastoni M. Fortini C Canella
A, Marino M, Tomatis R, Traniello S, Gavioli R. (2002) Effect of
interferon-alpha therapy on epitope-specific cytotoxic T lymphocyte
responses in hepatitis C virus-infected individuals. Eur J Immunol.
32(1):144-54. [0443] Viitanen P V, Devine A L. Kahn S, Deuel D L,
Van Dyk D E, Daniell H. (2004) Metabolic Engineering via the
Chloroplast Genome to Produce 4-Hydroxybenzoic Acid a Principle
Monomer of Liquid Crystal Polymers. Plant Physiol 136(4):4048-60.
[0444] Walmsley A., & Arntzen, C. (2000) Plants for Delivery of
Edible Vaccines. Current Opinion in Biotechnology, 11: 126-129.
[0445] Wang C, Siddiqui A. (1995) Structure and function of the
hepatitis C virus internal ribosome entry site. Curr Topics
Microbiol Immunol 203: 99-115. [0446] Watson J, Koya V, Leppla S H,
Daniell H. (2004) Expression of Bacillus anthracis protective
antigen in transgenic chloroplasts of tobacco, a non-food/feed
crop. Vaccine 22 (31-32): 4374-4384. [0447] Wedemeyer H, Gagneten
S, Davis A. (2001) Oral immunization with HCV-NS3 transformed
Salmonella: induction of HCV-specific CTL in a transgenic mouse
model. Gastroenterology 121(5): 1158-66. [0448] Wong J B. (2000)
Estimating future hepatitis C morbidity, mortality and costs in the
United States. Am J Public Health 90 (10):1562-9. [0449] World
Health Organisation. Hepatitis C. (1997) Wkly Epidemiol Rec 72:65.
[0450] Wuest T, Both G, Prince A, Hofmann C, Loser P (2004)
Recombinant ovine atadenovirus induces a strong and sustained T
cell response against the hepatitis C virus NS3 antigen in mice.
Vaccine 22: 2717-2721. [0451] Ye G N, Daniell H, & Sanford J C.
(1990) Optimization of delivery of foreign DNA into higher-plant
chloroplasts. Plant Mol. Biol., 15 (6): 809-819. [0452] Zoubenko O
V, Allison L A, Svab Z, Maliga P (1994) Efficient targeting of
foreign genes into the tobacco plastid genome. Nucleic Acids Res
22: 3819-3824.
EXAMPLE 4
Transgenic Chloroplast Expression of Soluble Modified Green
Flourescent Protein and Interferon alpha-5 Fusion
Introduction
[0453] The World Health Organization estimates that approximately
170 million people worldwide are infected with hepatitis C virus
(HCV), with 3-4 million new cases each year, and that more than one
third of the world's population is infected with hepatitis B virus
(HBV). A large majority of HCV-infected patients have severe liver
cirrhosis and currently there is no vaccine available for this
disease. In addition, the rising cost of treatment for severe
illnesses calls for the more economical production of therapeutic
proteins. Alpha interferons have therapeutic uses, such as the
inhibition of viral replication and cell proliferation, enhancement
of the immune response, and most recently, the treatment of
patients suffering from HCV. The Food and Drug Administration
approved a specific subtype of interferon-.alpha. (IFN.alpha.2b)
for the treatment of HCV. In an effort to produce another subtype
of interferon-.alpha. (EFN.alpha.5, kindly provided by Dr. Jesus
Prieto, Universidad De Navarra, Pamplona, Spain) in large
quantities and free of contaminants for possible treatment options
and oral delivery of HCV, a fusion of smGFP-IFN.alpha.5 has been
expressed in transgenic chloroplasts of Nicotiana tabacum var. dark
fire, by inserting the smGFP (745 bp) and IFN.alpha.5 (515 bp)
genes into the chloroplast genome by homologous recombination. The
pLD-BB1 vector contains smGFP with a C-terminal fusion to
IFN.alpha.5 containing a furin cleavage site between the fusion
proteins. The genes were cloned into a universal chloroplast
vector, pLD-ctv containing the 16S rRNA promoter, aadA gene coding
for the spectinomycin selectable marker, psbA 5' & 3'
untranslated regions to enhance translation in the light and trnI
& trnA homologous flanking sequences for site specific
integration into the chloroplast genome. Chloroplast integration of
the snGFP-IFN.alpha.5 genes was confirmed by PCR and Southern blot
analysis. The smGFP-IFN.alpha.5 fusion protein expression was
confirmed by immunoblot analysis and smGFP expression under UV
light. Expression was quantified by ELISA. The smGFP-IFN.alpha.5
fusion protein is analyzed via in vivo studies. The expression of
smGFP-IFN.alpha.5 transgenic chloroplasts will facilitate the
development of a new and alternate treatment for HCV and possible
oral delivery options with a lower cost of production.
Materials and Methods
[0454] Construction of the pLD-BB1 Vector
[0455] The IFN.alpha.5 gene was kindly provided by Dr. Jesus
Prieto, Universidad De Navarra, Pamplona, Spain, within Escherichia
coli expression vector designated pET-28b (Novagen). The smGFP gene
was obtained from Ohio State University, within the plasmid vector
psmGFP. The vector was transformed into Ultra competent XL1 Blue
MRF' Tetracycline (tet) E. coli cells (Stratagene) that were
endonuclease negative. The recombinant DNA techniques were carried
out as detailed in Sambrook et al., 1989.
Preparation of Competent Cells
[0456] Ultra competent XL1 Blue MRF' (tet) E. coli cells were made
competent by inoculating 50 ml of Luria Bertani (LB) broth (10 gr
Tryptone, 5 gr yeast extract, 5 gr NaCl, pH 7.0, dH.sub.20 to a
liter) with 500 .mu.l of cells and incubating at 37.degree. C.
overnight while shaking at 225 rpm using the Orbit Environ Shaker
(Lab-Line). Once the Optical Density (OD) reading at 600 nm was
between 0.4 and 0.6, the cells were transferred to several 14 ml
falcon tubes, chilled on ice for 15 minutes. The cells were
centrifuged at 8500 rpm for 6 minutes at 4.degree. C. The
subsequent E. coli pellet was resuspended in 25 ml of cold 50 mM
CaCl.sub.2, mixed by vortexing and then incubated on ice for 15
minutes. The cells were recentrifuged at 8500 rpm for 6 minutes at
4.degree. C. The cells were resuspended into 1 ml of 50 mM
CaCl.sub.2 and 1 ml of 30% glycerol, then gently inverted 3 times.
Competent cells were gently aliquoted into micro centrifuge tubes
(200 .mu.l/tube) being sure to keep everything cold at all times.
Competent cells were labeled and stored at -80.degree. C.
Midi-prep of psmGFP
[0457] Inoculated E. coli containing psmGFP into 50 ml of liquid LB
broth in a 250 ml flask. 25 .mu.l of ampicillin (amp) stock (100
mg/ml) was added to the 50 ml LB above so that only the
amp-resistant plasmids would grow. The flask was covered with
aluminum foil and put in shaker at 37.degree. C. for 16 hours to
grow-up cells. 40 ml of the overnight culture was transferred to a
clean 50 ml screw-cap centrifuge tube and spun down. The cells were
centrifuged for 5 minutes at 5000 rpm. The Bio-Rad Midi-prep kit
cat. # 732-6120 was used for DNA isolation. The supernatant
containing LB and cellular waste was discarded. 5 ml of cell
resuspension solution was added to the pellet and vortexed until
the cells were resuspended. 5 ml of cell lysis solution was added
and mixed by inverting the tube 8 times. The solution turned from
milky, light beige to clear, light beige. 5 ml of neutralization
solution was added to the clear, beige solution and then the
solution became a white precipitant. The solution was centrifuged
for 10 minutes at 8000 rpm. The supernatant was poured into a new
50 ml screw-cap centrifuge tube. The quantum prep mix was
resuspended by vigorously shaking. 1 ml of the quantum prep mix was
added to the clear supernatant. The solution was swirled for 30
seconds to mix and then centrifuged for 2 minutes at 8000 rpm to
pellet the plasmids. The supernatant containing contaminants was
dissolved by the quantum prep mix and the pelleted plasmids
remained. 10 ml of wash buffer was added to pelleted plasmids and
the matrix was resuspended in the wash buffer by shaking. The
solution was centrifuged for 2 minutes at 8000 rpm and discarded
the supernatant. The pellet was then resuspended in 600 .mu.l of
wash buffer and transferred to columns in collection tube provided
by the kit. Columns were centrifuged for 30 seconds at 12,000 rpm
at 4.degree. C. and flow-through was discarded. Column was
centrifuged for an additional 2 minutes at 12,000 rpm and then
columns were transferred to sterile microcentrifuge tubes. 300
.mu.l of Tris-EDTA (TE: 1M Tris, pH 8.0, 0.5M EDTA) was added to
the column and centrifuged at 8000 rpm for 2 minutes at 4.degree.
C. The column was transferred to a fresh microcentrifuge tube and
the same above step was repeated. The DNA was stored at -20.degree.
C.
Mini-prep of pET28-IFN.alpha.5 by Rapid Plasmid Isolation
[0458] After cells had been growing for 12-16 hours at 37.degree.
C. in LB broth containing antibiotic, 1.5 ml of the cell suspension
was put into an eppendorf and centrifuged at 13,000 rpm for 5
minutes. The supernatant was discarded. An additional 1.0 ml of the
same cell suspension was added and the centrifugation was repeated
and the supernatant was discarded. The pellet was resuspended in
100 .mu.l of Solution I (GTE: 50 mM D-(+)-Glucose, 10 mM EDTA, 25
mM Tris, pH 8) and vortexed. 1 .mu.l of 100 mg/ml Rnase was added
to each tube and pulse vortexed. 200 .mu.l of solution II (0.2NaOH,
10% SDS) was added and mixed by gently inverting 6 times. The
mixture was left to sit for 3 minutes and then centrifuged at
13,000 rpm for 10 minutes at 4.degree. C. The solution was pipetted
into a fresh, labeled eppendorf. Then, added 1000 .mu.l of cold 95%
ethanol to each supernatant and vortexed briefly. The supernatant
was centrifuged at 13,000 rpm at 4.degree. C. for 17 minutes. The
supernatant was removed and discarded, being careful not to
dislodge the beige plasmid DNA in bottom of eppendorf. 500 .mu.l of
70% cold ethanol was added and centrifuged for 5 minutes. The
ethanol was removed and discarded and subsequently dried in the
speed. The plasmid concentration and quality of DNA was measured by
spectrophotometer. The DNA was stored at -20.degree. C.
IFN.alpha.5 Amplification by Polymerase Chain Reaction (PCR)
[0459] Two primers were designed to amplify IFN.alpha.5 and include
a furin cleavage site at the 5' end of the IFN.alpha.5 gene with
the forward primer containing an EcoRV site and the reverse primer
containing a Not I site for further subcloning. Primers were
ordered from LIFE TECHNOLOGIES. When the primers arrived, they were
reconstituted in TE to yield a 100 FM stock that was stored at
-20.degree. C. The PCR reaction contained 1.0 .mu.l of
pET28-IFN.alpha.5, 5 .mu.l of 10.times.PCR buffer, 5.0 .mu.l of 10
mM dNTP's, 0.5 .mu.l of forward primer (Furin-IFN.alpha.5-F-EcoRV),
0.5 .mu.l of reverse primer (Furin-IFNa5-R-NotI), 0.5 .mu.l of Pfu
polymerase and 36.5.0 .mu.l of Rnase/Dnase Free H.sub.20 to a total
volume of 50 .mu.l. The PCR was performed as suggested by the
manufacturer using the Gene Amp PCR system 2400 (Perkin-Elmer).
Samples were carried through 30 cycles using the following
temperatures and times: 94.degree. C. for 1 minute, 55.degree. C.
for 1 minute, 72.degree. C. for 1 minute. Cycles were preceded by
denaturation at 94.degree. C. for 3 minutes and followed by a 5
minute extension time at 72.degree. C. The final PCR products were
separated on a 0.8% agarose gel at 60 volts until dye reached
bottom (about 50 minutes).
Extraction of the EcoRV/Furin/IFN.alpha.5/NotI PCR Product from the
Gel
[0460] The QIAGEN QIA quick gel extraction kit was used to extract
the PCR products from the agarose gel. The gel was placed on a flat
UV light source and the appropriate DNA fragment (515 bp) was cut
out using a sterile razor blade. The excised fragment was placed
into a previously weighed microcentrifuge tube and reweighed to
determine by difference weight of the cut out fragment. To the
eppendorf containing the fragment, 3 volumes of Buffer QC to 1
volume of gel slice was added. The eppendorf was incubated at
50.degree. C. for 10 minutes until the agarose melted and
solubilized. One volume of isopropanol was then added to the
eppendorf. The mixture was added to a QIA quick spin column placed
in a collection tube and then centrifuged for 1 minute at 12,000
rpm at room temperature. The flow-through was discarded and the
column was centrifuged for an additional minute as above. The
flow-through was discarded again and 750 .mu.l of buffer PE was
added to the column and centrifuged as above. The column was placed
in a sterile microcentrifuge tube and 50 .mu.l of elution buffer
(EB) was added to the column and centrifuged for 1 minute at 12,000
rpm to elute the DNA (PCR product).
Ligation of the EcoRV/Furin/IFN.alpha.5/NotI PCR Product into pBKS
Vector
[0461] PCR products were eluted from the gel. The PCR products and
the pBKS vector were restriction digested with EcoRV and Notli. For
digestion of pBKS, 2 .mu.l of midi-prepped pBKS, 0.2 .mu.l of
100.times. bovine serum albumin (BSA), 2 .mu.l of 10.times. New
England Bio-Labs (NEB) #3 buffer, 0.5 .mu.l of EcoRV (NEB), 0.5
.mu.l of Not I (NEB) and 14.8 .mu.l of Rnase/Dnase Free H.sub.20 to
a total volume of 20 .mu.l. This was done in duplicate to ensure
enough DNA was available for the ligation reaction. The reaction
was incubated at 37.degree. C. overnight (O/N). For the PCR product
digestion, 4 .mu.l of purified PCR product (IFN.alpha.5), 0.2 .mu.l
of 100.times. bovine serum albumin (BSA), 2 .mu.l of 10.times. New
England Bio-Labs (NEB) #3 buffer, 0.5 .mu.l of EcoRV (NEB), 0.5
.mu.l of Not I (NEB) and 10.8 .mu.l of Rnase/Dnase Free H2O to a
total volume of 20 .mu.l. This was done in duplicate to ensure
enough DNA was available for the ligation reaction. The reaction
was incubated at 37.degree. C. overnight (O/N). Pulse vortexed the
pBKS digestion, then added 4 .mu.l of 6.times. bromophenol blue
(bpb: 0.25% bromophenol blue, 40% w/v sucrose in d/a H.sub.2O to a
total volume of 10 ml) to the digestion. Loaded all 24 .mu.l into
well of 0.8% electrophoresis-grade agarose gel diluted into
1.times.TAE running buffer and then ran at 60 volts (V) for 60
minutes. Pulse vortexed the PCR product digestion, then added 4
.mu.l of 6.times. bpb. Loaded all 24 .mu.l into the well of a 0.8%
agarose gel and electrophoresed at 60V for 60 minutes. The
linearized pBKS DNA fragment and the PCR products were gel eluted.
The duplicates were combined and the volume was reduced by vacuum
to 25 .mu.l. Ligated EcoRV/Furin/lFN.alpha.5/NotI into pBKS to
complete pBKS-IFN.alpha.5 vector. For the ligation reaction, 4
.mu.l of the pBKS backbone, 10 .mu.l PCR product, 4 .mu.l 5.times.
Ligase Buffer (Invitrogen), 0.2 .mu.l T4 Ligase (Invitrogen), 2
.mu.l of Rnase/Dnase Free H.sub.2O to a total reaction volume of 20
.mu.l. The ligation mixture was incubated at 4.degree. C. O/N.
Transformed ligation mix containing pBKS-IFN.alpha.5 into competent
XL1 Blue MRF' (tet) E. coli cells.
Transformation of pBKS-IFN.alpha.5 into Competent XL1 BlueMRF'
(tet) E. coli Cells
[0462] Took out 100 .mu.l of competent cells from -80.degree. C.
freezer and thawed in an ice bucket. 10 .mu.l of DNA from ligation
reaction was added to the competent cells and mixed gently. The
mixture was allowed to stand on ice for a total of 30 minutes,
gently rocking tube back and forth every 10 minutes. The cells were
heat shocked at 42.degree. C. for 45-50 seconds. The cells were
left on ice for 2 minutes. 900 .mu.l LB broth was added to each and
incubated at 37.degree. C. on 225 rpm shaker for 45 minutes. The
cells were pelleted by centrifugation at 13,000 rpm for 45 seconds
and 800 .mu.l of the supernatant was discarded. The cells were
resuspended in the remaining 100 .mu.l of LB broth and plated out
transformed and untransformed (control) onto X-gal/IPTG LB/amp agar
plates (1 liter LB broth, 15 gr agar, 100 .mu.g/ml ampicillin, pH
7) under the hood. Plates were covered and incubated O/N at
37.degree. C.
Selecting for Transformants
[0463] The pBKS cloning vector has a ColE1 origin of replication,
ampicillin resistance, a DNA segment containing the lac promoter
and the .beta.-galactosidase .alpha.-fragment (ZacZ). Within this
coding region is a multiple cloning site that does not disrupt the
reading frame, but must be used in a host cell that codes for the
carboxy-terminal portion of the .beta.-galactosidase gene so that
an enzymatically active .beta.-galactosidase protein can be formed.
The cells that grow due to this .alpha.-complemention can be
visually selected through a chromogenic test. Insertion of a
fragment of foreign DNA into the multicloning site of pBKS almost
invariably results in production of an amino-terminal fragment that
is not capable of .alpha.-complemention. Selective plates were made
with LB agar and 100 .mu.g/ml of ampicillin. About 1 hour before
transformation was complete, 40 .mu.g/ml of
5-bromo-4-chloro-3-indolyl-.beta.-D-galactoside (X-gal) was spread
onto the top of the plates while under the hood. X-gal is a lactose
analog that turns dark blue when it is hydrolyzed by
.beta.-galactosidase. After the X-gal dried (about 15 minutes), 40
.mu.l of 100 mM of isopropyl-.beta.-D-thiogalactoside (IPTG) was
spread onto the plates. IPTG, another lactose analog, is a strong
inducer of lacZ transcription but is not digested/hydrolized by
.beta.-galactosidase. The plates were warned 37.degree. C. for 30
minutes and then the plates were streaked with 100 .mu.l of the
transformed bacterial cells were spread over the top of the agar.
Allowed the plates to dry for 5 minutes, then incubated the plates
in an inverted position at 37.degree. C. overnight. Stored the
plates after incubation at 4.degree. C. for 3 hours to allow the
blue color from the chromogenic process to develop fully. Colonies
without an interrupting insert were blue because they had an active
.beta.-galactosidase. Colonies which had incorporated the insert
were all white. These were picked to culture at 37.degree. C.
overnight and miniprepped as described in the previous section. The
DNA was stored at -20.degree. C. The vector was confirmed by
restriction digestion analysis.
Amplification of smGFP by Polymerase Chain Reaction (PCR)
[0464] Two primers were designed to amplify smGFP and include
specific restriction sites with the forward primer containing a
HindIII and SnaBI site and the reverse primer containing an EcoRV
site for further subcloning. Primers were ordered from LIFE
TECHNOLOGIES. When the primers arrived, they were reconstituted in
TE to yield a 100 .mu.M stock that was stored at -20.degree. C. The
PCR reaction contained 3.0 .mu.l of psmGFP, 5 .mu.l of 10.times.PCR
buffer, 1.0 .mu.l of MgSO.sub.4, 5.0 .mu.l of 10 nM dNTP's, 1.0
.mu.l of forward primer (smGFP-F-HindIII-SnaBI), 1.0 .mu.l of
reverse primer (smGFP-R-EcoRV), 0.5 .mu.l of Pfx polymerase and
33.5.0 .mu.l of Rnase/Dnase Free H.sub.20 to a total volume of 50
.mu.l. The PCR was performed as suggested by the manufacturer using
the Gene Amp PCR system 2400 (Perkin-Elmer). Samples were carried
through 30 cycles using the following temperatures and times:
94.degree. C. for 15 seconds, 50.degree. C. for 30 seconds,
68.degree. C. for 1 minute. Cycles were preceded by denaturation at
94.degree. C. for 5 minutes and followed by a 7 minute extension
time at 68.degree. C. After PCR, the vials were placed on ice and 1
unit of Taq polymerase was added to each tube and mixed. The vials
were incubated at 72.degree. C. for 10 minutes. The final PCR
products were separated on a 0.8% agarose gel at 60 volts for about
50 minutes. The PCR product was then PCR purified using the
QIAquick PCR purification kit (Qiagen).
Ligation of the smGFP PCR Product into pCR.RTM.2.1-TOPO.RTM.
[0465] Thermus aquaticus (Taq) polymerase has non-template
dependent activity which preferentially adds a single
deoxyadenosine(A) to the 3'-ends of a double stranded DNA molecule;
therefore, most of the molecules PCR amplified possess single 3' A
overhang. The linearized vector supplied with the kit has a single,
overhanging 3'deoxythymidine (T) which allows the PCR product to
ligate efficiently with the vector. TA cloning utilizes the
complementarity between the PCR product 3'-A overhangs and vector
3'-T overhangs and is one of the simpliest and most efficient
methods for the cloning of PCR products (Zhou, 2000). The PCR
products were ligated into pCR.RTM.2.1-TOPO.RTM. cloning vector
(Invitrogen, 2000) that contained multiple restriction sites
facilitating further subcloning. 2 .mu.l of psmGFP PCR product was
combined with 1 .mu.l of dilute salt solution, 2 .mu.l of
Rnase/Dnase Free dH.sub.2O and 1 .mu.l of the pCR.RTM.2.1-TOPO.RTM.
cloning vector. The solution was gently mixed and incubated 5
minutes at room temperature. Chemically competent E. coli cells
(TOP10) were taken from -80.degree. C. freezer and thawed on ice.
The transformation was started immediately after cells thawed. The
cells were removed and gently pipetted into a cold eppendorf on
ice. 2 .mu.l of the ligation mixture was added to an eppendorf
containing the chemically competent cells and mixed gently without
pipetting up and down. Then, the mixture was incubated on ice for
30 minutes. Heat shocked the cells for 30 seconds at 42.degree. C.
without any shaking. The mixture was immediately transferred to
ice. Then 250 .mu.l of warm SOC broth was added and allowed to
incubate in the shaker horizontally (200 rpm) for 1 hour at
37.degree. C.
Selecting for Transformants
[0466] The pCR.RTM.2.1-TOPO.RTM. cloning vector has a ColE1 origin
of replication, kanamycin resistance, ampicillin resistance and a
DNA segment containing the first 146 amino acids of the
.beta.-galactosidase gene (lacZ). Selective plates were made with
LB agar and 50 .mu.g/ml of kanamycin. About 1 hour before
transformation was complete, 40 .mu.g/ml of
5-bromo-4-chloro-3-indolyl-.beta.-D-galactoside (X-gal) was spread
onto the top of the plates while under the hood. X-gal is a lactose
analog that turns dark blue when it is hydrolyzed by
.beta.-galactosidase. After the X-gal dried (about 15 minutes), 40
.mu.l of 100 mM of isopropyl-.beta.-D-thiogalactoside (IPTG) was
spread onto the plates. IPTG, another lactose analog, is a strong
inducer of lacZ transcription but is not digested/hydrolized by
.beta.-galactosidase. The plates were warmed 37.degree. C. for 30
minutes and then the plates were streaked with 150 .mu.l of the
transformed bacterial cells were spread over the top of the agar.
Allowed the plates to dry for 5 minutes, then incubated the plates
in an inverted position at 37.degree. C. overnight. Stored the
plates after incubation at 4.degree. C. for 3 hours to allow the
blue color from the chromogenic process to develop fully. Colonies
without an interrupting insert were blue because they had an active
.beta.-galactosidase. Colonies which contained an insert were all
white so these were picked to culture. The culture was grown
overnight at 37 C and miniprepped as described in the previous
section. The DNA was confirmed by restriction digestion analysis
and stored at -20.degree. C.
Building the pCR.RTM.2.1-5'UTR Vector
[0467] Two primers were designed to amplify 5'UTR and include
specific restriction sites with the forward primer containing an
EcoRI site and the reverse primer containing an EcoRV site for
further subcloning. Primers were ordered from LIFE TECHNOLOGIES.
When the primers arrived, they were reconstituted in TE to yield a
100 .mu.M stock that was stored at -20.degree. C. The PCR reaction
contained 1.0 .mu.l of template DNA, 5 .mu.l of 10.times.PCR
buffer, 1.0 .mu.l of MgSO.sub.4, 5.0 .mu.l of 10 mM dNTP's, 1.0
.mu.l of forward primer (5'UTR-F-EcoRI), 1.0 .mu.l of reverse
primer (5'UTR-R-EcoRV), 0.5 .mu.l of Pfx polymerase and 33.5.0
.mu.l of Rnase/Dnase Free H.sub.20 to a total volume of 50 .mu.l.
The PCR was performed as suggested by the manufacturer using the
Gene Amp PCR system 2400 (Perkin-Elmer). Samples were carried
through 30 cycles using the following temperatures and times:
94.degree. C. for 15 seconds, 50.degree. C. for 30 seconds,
68.degree. C. for 30 seconds. Cycles were preceded by denaturation
at 94.degree. C. for 5 minutes and followed by a 7 minute extension
time at 68.degree. C. After PCR, the vials were placed on ice and 1
unit of Taq polymerase was added to each tube and mixed. The vials
were incubated at 72.degree. C. for 10 minutes. The final PCR
products were separated on a 0.8% agarose gel at 60 volts for about
50 minutes. The PCR product was then PCR purified using the
QIAquick PCR purification kit (Qiagen). The purified PCR product
was cloned into pCR.RTM.2.1-TOPO.RTM. cloning vector (Invitrogen,
2000) as described in previous section. The transformants were
selected and mini-prepped as described in previous section. The
vector was confirmed by restriction digestion analysis.
Building the pLD-5'UTR Vector
[0468] A scraping of an E. coli glycerol stock containing the pLD
expression vector which was developed by Lee and Daniell was grown
up in 50 ml of liquid LB broth in a 250 ml flask. 25 .mu.l of
ampicillin (amp) stock (100 mg/ml) was added to the 50 ml LB broth.
The flask was covered and put in shaker at 37.degree. C. for 16
hours to grow-up cells. A midi-prep was performed as described in
previous section. The vector was confirmed by restriction digestion
analysis. For further subcloning, a restriction digestion was set
up: 5.0 .mu.l of pCR.RTM.2.1-5'UTR vector, 0.2 .mu.l of 100.times.
bovine serum albumin (BSA), 2.0 .mu.l of 10.times. New England
Bio-Labs (NEB) #3 buffer, 0.5 .mu.l of EcoRV (NEB), 0.5 .mu.l of
EcoRI (NEB) and 11.8 .mu.l of Rnase/Dnase Free H.sub.20 to a total
volume of 20 .mu.l. This was done in duplicate to ensure enough DNA
was available for the ligation reaction. The reaction was incubated
at 37.degree. C. overnight (O/N). For the pLD restriction
digestion, 1.0 .mu.l of pLD vector, 0.2 .mu.l of 100.times. bovine
serum albumnin (BSA), 2 .mu.l of 10.times. New England Bio-Labs
(NEB) #3 buffer, 0.5 .mu.l of EcoRV (NEB), 0.5 .mu.l of EcoRI (NEB)
and 14.8 .mu.l of Rnase/Dnase Free H.sub.20 to a total volume of 20
.mu.l. This was done in duplicate to ensure enough DNA was
available for the ligation reaction. The reaction was incubated at
37.degree. C. for 1 hour. Pulse vortexed the digestions, then added
4 .mu.l of 6.times. bromophenol blue (bpb: 0.25% bromophenol blue,
40% w/v sucrose in d/a H.sub.2O to a total volume of 10 ml) to each
digestion. Loaded all 24 .mu.l of each digestion into separate
wells of 0.8% electrophoresis-grade agarose gel diluted into
1.times.TAE running buffer and then ran at 80 volts (V) for 60
minutes. The linearized pLD vector and the 5'-UTR DNA fragments
were gel eluted in 50 .mu.l of Rnase/Dnase Free H.sub.20 and vacuum
evaporated to a volume of 15 .mu.l. Ligated the 5'UTR DNA fragment
into pLD vector to complete pLD-5'UTR vector. For the ligation
reaction, 15 .mu.l of the pLD backbone and 5'UTR DNA fragment
combined, 4 .mu.l 5.times. Ligase Buffer (Invitrogen), and 1.0
.mu.l T4 Ligase (Invitrogen) to a total reaction volume of 20
.mu.l. The ligation mixture was incubated at 14.degree. C. O/N.
Transformed ligation mix containing pLD-5'UTR into competent XL1
Blue MRF' (tet) E. coli cells using SOC broth instead of LB broth
as described in previous section. The transformation reaction was
plated out onto LB/amp agar plates (1 liter LB broth, 15gr agar,
100 .mu.g/ml ampicillin, pH 7) under the hood. Plates were covered
and incubated O/N at 37.degree. C. 10 bacterial colonies were
selected and cultured O/N at 37.degree. C. and mini-prepped as
described in the previous section. The DNA was confirmed by
restriction digestion analysis and stored at -20.degree. C.
Building the pBKS-smGFP-IFN.alpha.5 Vector
[0469] The pBKS-IFN.alpha.5 vector and the pCR.RTM.2.1-smGFP vector
were thawed on ice. For further subcloning, a restriction digestion
was set up: 2.0 .mu.l of pCR.RTM.2.1-smGFP vector, 1.0 .mu.l of
1.times. bovine serum albumin (BSA), 2.0 .mu.l of 10.times. New
England Bio-Labs (NEB) #2 buffer, 1.0 .mu.l of EcoRV (NEB), 1.0
.mu.l of HindIII (NEB) and 12.0 pt of Rnase/Dnase Free H.sub.20 to
a total volume of 20 .mu.l. This was done in duplicate to ensure
enough DNA was available for the ligation reaction. The reaction
was incubated at 37.degree. C. for 2 hours. For the
pBKS-IFN.alpha.5 vector restriction digestion, 2.0 .mu.l of
pBKS-IFN.alpha.5 vector, 1.0 .mu.l of 1.times. bovine serum albumin
(BSA), 2 .mu.l of 10.times. New England Bio-Labs (NEB) #2 buffer,
1.0 .mu.l of EcoRV (NEB), 1.0 .mu.l of HindIII (NEB) and 12.0 .mu.l
of Rnase/Dnase Free H.sub.20 to a total volume of 20 .mu.l. This
was done in duplicate to ensure enough DNA was available for the
ligation reaction. The reaction was incubated at 37.degree. C. for
2 hours. Pulse vortexed the digestions, then added 4 .mu.l of
6.times. bromophenol blue (bpb: 0.25% bromophenol blue, 40% w/v
sucrose in d/a H.sub.2O to a total volume of 10 ml) to each
digestion. Loaded all 24 .mu.l of each digestion into separate
wells of 0.8% electrophoresis-grade agarose gel diluted into
1.times.TAE running buffer and then ran at 80 volts (V) for 60
minutes. The linearized vector and the smGFP DNA fragments were gel
eluted in 50 .mu.l of Rnase/Dnase Free H.sub.20 and vacuum
evaporated to a volume of 15 .mu.l. Ligated the smGFP DNA fragment
into pBKS-IFN.alpha.5 vector to complete pBKS-smGFP-IFN.alpha.5
vector. For the ligation reaction, 15 .mu.l of the pBKS-IFN.alpha.5
backbone and smGFP DNA fragment combined, 4 .mu.l 5.times. Ligase
Buffer (Invitrogen), and 1.0 .mu.l T4 Ligase (Invitrogen) to a
total reaction volume of 20 .mu.l. The ligation mixture was
incubated at 14.degree. C. O/N. Transformed ligation mix containing
pBKS-smGFP-IFN.alpha.5 vector into competent XL1 Blue MRF' (tet) E.
coli cells using SOC broth instead of LB broth as described in
previous section. The transformation reaction was plated out onto
LB/amp agar plates (1 liter LB broth, 15 gr agar, 100 .mu.g/ml
ampicillin, pH 7) under the hood. Plates were covered and incubated
O/N at 37.degree. C. 10 bacterial colonies were selected and
cultured O/N at 37.degree. C. Then, a mini-prep was performed as
described in the previous section. The DNA was confirmed by
restriction digestion analysis and stored at -20.degree. C.
Building the pLD-5'UTR-smGFP-IFN.alpha.5 Vector
[0470] The pBKS-smGFP-IFN.alpha.5 vector and the pLD-5'UTR vector
were thawed on ice. For further subcloning, a restriction digestion
was set up: 5.0 .mu.l of pLD-5'UTR vector, 2.0 .mu.l of 10.times.
New England Bio-Labs (NEB) #3 buffer, 2.0 .mu.l of 1.times. bovine
serum albumin (BSA) 1,0 .mu.l of NotI (NEB), 1.0 .mu.l of EcoRV
(NEB) and 9.0 .mu.l of Rnase/Dnase Free H.sub.20 to a total volume
of 20 .mu.l. This was done in duplicate to ensure enough DNA was
available for the ligation reaction. The reaction was incubated at
37.degree. C. for 1 hour. For the pBKS-smGFP-IFN.alpha.5
restriction digestion, 5.0 .mu.l of pBKS-smGFP-IFN.alpha.5 vector,
2.0 .mu.l of 1.times. bovine serum albumin (BSA), 2 .mu.l of
10.times. New England Bio-Labs (NEB) #4 buffer, 1.0 .mu.l of NotI
(NEB), and 10.0 .mu.L of Rnase/Dnase Free H.sub.2O to a total
volume of 20 .mu.l. This was done in duplicate to ensure enough DNA
was available for the ligation reaction. The reaction was incubated
at 37.degree. C. for 1 hour. Then, 1.0 .mu.l of SnaBI (NEB) was
added and the reaction was incubated an additional 1 hour at
37.degree. C. Pulse vortexed the digestions, then added 4 .mu.l of
6.times. bromophenol blue (bpb: 0.25% bromophenol blue, 40% w/v
sucrose in d/a H.sub.2O to a total volume of 10 ml) to each
digestion. Loaded all 24 .mu.l of each digestion into separate
wells of 0.8% electrophoresis-grade agarose gel diluted into
1.times.TAE running buffer and then ran at 80 volts (V) for 60
minutes. The linearized pLD-5'UTR vector and the smGFP-IFN.alpha.5
DNA fragments were gel eluted in 50 .mu.l of Rnase/Dnase Free
H.sub.20 and vacuum evaporated to a volume of 15 .mu.l. Ligated the
smGFP-IFN.alpha.5 DNA fragment into pLD-5'UTR vector to complete
pLD-BB1 vector (pLD-5'UTR-smGFP-IFN.alpha.5). For the ligation
reaction, 15 .mu.l of the pLD-5'UTR backbone and smGFP-IFN.alpha.5
DNA fragment combined, 4 .mu.l 5.times. Ligase Buffer (Invitrogen),
and 1.0 .mu.l T4 Ligase (Invitrogen) to a total reaction volume of
20 .mu.l. The ligation mixture was incubated at 14.degree. C. for
four hours. Transformed ligation mix containing pLD-BB1 into
competent XL1 Blue MRF' (tet) E. coli cells using SOC broth instead
of LB broth as described in previous section. The transformation
reaction was plated out onto LB/amp agar plates (1 liter LB broth,
15 gr agar, 100 .mu.g/ml ampicillin, pH 7) under the hood. Plates
were covered and incubated O/N at 37.degree. C. 15 bacterial
colonies were selected and cultured O/N at 37.degree. C. and
mini-prepped as described in the previous section. The remaining
500 .mu.l of each bacterial O/N cultures were placed on ice. The
DNA was confirmed by restriction digestion analysis and stored at
-20.degree. C. Four positive clones were selected and the
corresponding bacterial culture on ice was use to inoculate 50 ml
of liquid LB broth/Amp/Spec (100 .mu.g/mil of Ampicillin; 100 mg/ml
Spectinomycin) in a 250 ml flask and covered. The cultures were
placed in a shaker and incubated at 37.degree. C. for 16 hours. The
cultures were midi-prepped as described previously. The DNA was
confirmed by restriction digestion analysis and stored at
-20.degree. C. Glycerol stocks were also made and stored at
-80.degree. C.
E. coli Expression of smGFP-IFN.alpha.5 and Immunoblot Analysis
Extraction of Protein from Transformed E. coli Cells
[0471] E. coli containing pLD-smGFP-IFN.alpha.5 was scraped off the
top of the glycerol stock under the hood and inoculated 5 ml of
Terrific Broth (TB) containing 25 .mu.l of 100 mg/ml spectinomycin.
Untransformed E. coli cells were added to 5 ml of Terrific Broth
(TB) as a negative control. The inoculated broths were incubated in
a shaker at 37.degree. C. for 16 hours. 800 .mu.l of cultured cells
were placed in an eppendorf tube and centrifuged for 2 minutes. The
supernatant was discarded. The pelleted cells were washed with 1 ml
of 1.times. Phosphate-Buffered Saline (PBS: 140 mM NaCl, 2.7Mm KCl,
4 mM Na.sub.2HPO.sub.4, 1.8 mM KH2PO4, pH 7.2) resuspend the
pellet. Then, the suspension was centrifuged for 1 minute at 12,000
rpm and the supernatant was discarded. 50 .mu.l of 1.times.PBS was
added and mixed well. 50 .mu.l of 2.times. loading buffer, also
called Sample Buffer or SDS Reducing Buffer was added to the
samples and the sample extracts were boiled for exactly 4 minutes.
The samples were then immediately loaded onto polyacrylamide gels
(Laemmli, 1970).
Solutions, Standards, and SDS-PAGE Gel
[0472] The solutions used in the immunoblot were as follows: (1)
1.5 M Tris-HCL, pH 8.8 resolving gel buffer (27.23 g Tris base in
80 ml water, adjusted the pH to 8.8 using 6N HCL and raised the
volume to 150 ml. The solution was autoclaved and stored at
4.degree. C.) (2) 0.5M Tris-HCl, pH 6.8 stacking gel buffer (6.0 g
Tris base in 60 ml water, pH to 6.8 using 6N HCl and raised volume
to 100n-1. Autoclaved and stored at 4.degree. C.) (3) 10% SDS (10 g
Sodium Dodecyl Sulfate and bring up volume to 100 ml with water and
stored at room temperature) (Laemmli, 1970). (4) Acrylamide/Bis
solution (from Bio-Rad cat#161-0158). (5) Sample loading buffer was
an SDS reducing buffer (1.25 ml of 0.5 M Tris-HCl, pH6.8, 2.5 ml
glycerol, 2.0 ml of 10% SDS and 0.2 ml of 0.5% Bromophenol blue in
3.55 ml dH.sub.2O.) 25 .mu.l of .beta.-Mercapto ethanol was added
to 475 .mu.l of the sample buffer before use (Sambrook et al.,
1989). (6) 10.times. Electrode running buffer (30.3 g Tris Base,
144.0 g glycine, 10.0 g SDS and water added to bring the volume to
1 L. The buffer was stored at 4.degree. C.) (7) Transfer buffer
(300 ml of 10.times. electrode buffer, 300 ml methanol, 900 ml
water and 0.15 g SDS) (8) 20% APS (200 mg Ammonium persulfate in 1
ml water) (9) TEMED (N,N,N,N'-Tetra-methyl-ethylene diamine was
purchased from BIO-RAD cat# 161-0800) (10) 10.times.PBS (80 g NaCl,
2 g KCl, 26.8 g Na.sub.2HPO.sub.4*7H.sub.2O, 2.4 g KH.sub.2PO.sub.4
and water to a volume of 1 L with pH adjusted to 7.4 with HCl and
autoclaved) (Laemmli, 1970).
[0473] PEG-Intron (Schering corporation) was used a standard.
PEG-Intron is currently FDA approved to be used for Hepatitis C
treatment and consists of recombinant IFN.alpha.2b conjugated to
monomethoxy polyethylene glycol. The PEG portion weighs 12 kDa and
IFN.alpha.2b weights 19,271 daltons. PEG-Intron's specific activity
is 0.7.times.10.sup.8 IU/mg protein. Pegylation of IFN.alpha.2b
resulted in an increased half-life and lower blood clearance levels
thereby reducing the dosing frequency compared to the non-pegylated
form (Schering Corporation). Dilutions of the standard was made
from aliquots of 160 .mu.g/ml PEG-Intron stock stored at -4.degree.
C. 5 .mu.l of the 160 .mu.g/ml stock was mixed with 95 .mu.l of Peg
H.sub.2O and a 8 ng/.mu.l working stock was made.
[0474] All apparatus (glass plates and combs) to be used in the
experiment were cleaned using 70% ethanol. Two sets of plates were
inserted into the plastic green clamps with the shorter plates to
the front. The glass plates were leveled and locked into clamps.
The apparatus was placed in a holder with a foam strip on the
bottom to form a seal and to prevent leakage. The plates were
checked for leaks with dH.sub.2O water and it was blotted out with
filter paper. A 15% resolving gel was prepared in a 15 ml screw cap
tube using 2.4 ml DDI H.sub.2O, 5.0 ml of 30% Bio-Rad degassed Bis
Acrylamide, 2.5 ml of 1.5 M pH8.8 Tris-HCL gel buffer, and 100
.mu.l of 10% SDS. 50 .mu.l of 20% APS and 10 .mu.l TEMED were added
to the mixture and swirled to mix. The gel was immediately pipetted
into the glass plates leaving room at the top for the stacking to
added later. A 0.1% SDS solution was used to fill the space in the
plates on top of the gel to level and prevent bubbles. The gel
polymerized in 20 minutes and filter paper was used to remove the
0.1% SDS solution. A 4% stacking gel was prepared using 6.1 ml DDI
H.sub.2O, 1.3 ml Acrylamide/Bis, 2.5 ml of 0.5M Tris-HCl, pH6.8
buffer, and 100 ul of 10% SDS. 50 .mu.l of 20% APS and 10 .mu.l
TEMED were added to the mixture and swirled. The gel was
immediately pipetted over the resolving gel until reaching the top
of the glass plates. The 10 well combs were carefully inserted and
checked to make sure bubbles were not formed. The gel polymerized
in 20 minutes while the samples were prepared (Laemmli, 1970).
[0475] Equal volumes of the samples and the sample-loading buffer
were mixed as well as the desired concentrations of the standards
were prepared and also mixed with the sample-loading buffer. 15
.mu.l of the protein extracts was used. After the stacking gel
polymerized, the combs were removed and the plates were removed
from the casting frame and placed in an electrode assembly. The
assembly was locked and placed in a tank. The tank was filled with
1.times. ruing buffer inside and outside. All the samples and
standards were boiled for 4 minutes and loaded carefully with a
loading tip in to their respective wells. 5 .mu.l of precision plus
protein marker (Bio-Rad) was also loaded into one of the wells. The
gel was run for an hour at 50 V or until the samples were stacked
on top of the resolving gel and then run for 3-4 hours at 80 V
(Sambrook et al., 1989).
Transfer of Protein to Membrane and Immunoblot Analysis
[0476] After running the gel the specified time, the glass plates
were carefully separated and the stacking gel portion was removed.
A glass dish was used to assemble the transfer apparatus. Transfer
buffer was poured into the dish and the cassette was placed in it.
A thin sponge was soaked in transfer buffer and placed on the black
side of the cassette. The sponge was topped with a piece of wet
filter paper cut to the same size. The gel was placed into the
transfer buffer in the glass dish and carefully removed from the
glass plate. The gel was placed on top of the filter paper and the
bubbles were removed. A 0.2 .mu.m Trans-Blot nitrocellulose
membrane (Bio-Rad) was moistened and placed on top of the gel.
Then, wet filter paper was placed on top of the membrane and a wet
sponge placed on top of the paper. The cassette was closed. The
assembly was placed into a mini transfer blot module containing an
ice pack, a magnet and transfer buffer. The transfer process was
run at 85V for 1 hour. After the transfer, the membrane was washed
with water and stored overnight at -20.degree. C. The next day, the
membrane was removed from freezer and incubated in P-T-M
(1.times.PBS, 0.1% Tween 20 and 3% Milk) at room temperature in a
shaker for 1.5 hours. During the incubation period, a primary
antibody solution was made by adding 5 .mu.l of Mouse monoclonal
antibody against Human Interferon Alpha (PBL labs 21100-2) to 15 ml
P-T-M (1:3000 dilution). After the incubation period, the P-T-M was
discarded from the membrane and the membrane was incubated in the
primary antibody solution for 2 hours at room temperature in the
shaker. During the incubation period, a secondary antibody solution
containing 5 .mu.l of Goat Anti-Mouse IgG conjugated peroxidase
(Sigma, St. Louis, Mo.) in 20 ml P-T-M (1:4000 dilution) was
prepared. After the incubation period, the primary antibody
solution was discarded and the membrane was rinsed with water, two
times. The membrane was then incubated for 1.5 hours in secondary
anotbody solution. After the incubation period, the secondary
antibody solution was discarded and the membrane was washed with
P-T (1.times.PBS, 0.05% Tween 20) three times for 15 minutes each
wash. A final wash with 1.times.PBS was done for 10 minutes. A
chemiluminescent substrate solution for HRP (Pierce, Rockford,
Ill.) was prepared by mixing 750 .mu.l of Luminol Enhancer and 750
.mu.l of stable peroxide in the darkroom. The chemiluminescent
solution was added to the membrane and rinsed over the membrane
several times. The chemiluminescent membrane was exposed to an
X-ray film in the darkroom and developed in a film processor
(Sambrook et al., 1989).
Bombardment of the PLD-BB1 Vector
Generation Media for Tobacco Plants
[0477] MSO media was prepared by adding 30 g sucrose and one 4.3 g
packet of Murashige & Skoog (MSO) salt mixture (Gibco BRL) to 1
L dH.sub.2O. The solution was mixed well and the pH was adjusted to
5.8 with 1N KOH. 7 g/L phytagar was added to a 1 L flask and the
mixture was autoclaved. The autoclaved mixture was cooled slightly
and poured into Petri dishes and allowed to solidify. The
regeneration media of plants (RMOP) solution is prepared exactly
like the MSO media with the addition of growth hormones and
vitamins (1 ml benzylaminopurine, BAP (1 mg/ml stock); 100
.quadrature.l napthalene acetic acid, NAA (1 mg/ml stock), 1 ml
thiamine hydrochloride (1 mg/ml stock)) to interfere with root
development; therefore, only shoots would be produced (Daniell,
1993; Daniell, 1997).
Preparation of Microcarriers
[0478] In a microcentrifuge tube, 50 mg of gold particles (0.6
.mu.m) were placed and 1 ml of 70% ethanol was added. The mixture
was vortexed and incubated at room temperature for 15 minutes.
After the incubation, the mixture was centrifuged and the gold
particles formed a pellet in the bottom of the tube. The
supernatant was removed and discarded. Then, 1 ml of sterile
H.sub.2O was added to the particles and the tube was vortexed
again. After vortexing, the particles were to rest 1 minute and
then were centrifuged again for 3 seconds. The supernatant was
removed and discarded. These steps were repeated three times. Then,
50% glycerol was added to a concentration of 60 mg/ml and the gold
particles were stored at -20.degree. C. 50 .mu.l of gold particles
was removed from the stock stored at -20.degree. C. and placed in a
microcentrifuge tube. 10 .mu.l plasmid DNA (pLD-smGFP-IFN.alpha.5)
was added to the gold particles. Then, 50 .mu.l of 2.5M CaCl.sub.2
prepared that day, 367.5 mg of CaCl.sub.2 into 1 ml of d/aH.sub.2O)
was added and vortexed. Finally, 0.1M spermidine (20 .mu.l) was
added. The tube was placed in 4.degree. C. and vortexed for 20
minutes. The mixture was then washed by adding 200 .mu.l of
absolute ethanol to each tube, centrifuging for 2s and the ethanol
was discarded. The wash was repeated 4 times. Following the wash,
the gold particles were resuspended using 30 .mu.l of absolute
ethanol. The microcentrifuge tubes were then placed on ice.
Microprojectile Bombardment
[0479] The macrocarrier holders and stopping screens were
autoclaved to sterilize them. The macrocarriers and rupture disks
were soaked in 70% ethanol for 15 minutes. The macrocarriers and
rupture disks were then placed in a sterile Petri disk and allowed
to air dry in the hood. The entire hood and all interior parts of
chamber of the gene gun (Bio-Rad PDS-1000/He) were cleaned with 70%
ethanol to sterilize them. The pump was turned on and the main
valve of the helium tank was opened. The gene gun valve controlling
pressure was allowed to reach 13500 psi and set. Stopping screens
were placed in macrocarrier holders prior to adding the
macrocarrier. Macrocarriers were placed in holders and 6 III of
particle mixture was spread evenly onto the macrocarrier. Five
macrocarriers were used for every tube. The gold suspension was
allowed to dry and the macrocarrier holders were placed in the
launch assembly with gold particles facing downwards. One rupture
disk was placed in its holder and screwed in place at the top of
the vacuum chamber. The secure ring was screwed onto the launch
assembly and the assembly placed in the chamber slot below the
rupture disk holder. A piece of sterile whatman #1 filter paper was
placed on solidified RMOP media in a petri dish. Each leave clipped
from wild-type (untransformed) sterile plants in jars was taken
from the middle of plant and only healthy leaves were choosen of
medium size. One leaf at a time was placed on the whatman paper
abaxial side upwards because the waxy, thick cuticle lowers
transformation efficiency. The petri dish with leaf was placed on a
plastic holder and placed in the next to last slot in the vacuum
chamber. The chamber door was closed and secured. The power switch
for the gene gun was turned on. A vacuum was allowed to build to 28
psi in the bombardment chamber. When 28 psi was reached, the fire
switch was pressed until the rupture disk ruptured (.about.1100
psi). After delivery of the gold particles with vector DNA, the
vacuum was released and the petri dish containing the leaf
retrieved. After bombardment, covers were placed on petri dishes
with the bombarded leaf abaxial side facing up and the dishes were
wrapped in aluminum foil and kept in the dark for 48 hours to
recover from the shock of bombardment.
Results
[0480] A 5.9 kb expression vector created by Lee and Daniell
contain unique features facilitating the genetic engineering of
plant chloroplasts (FIG. 28). Cloned chloroplast DNA is integrated
into the plastid genome through site-specific homologous
recombination allowing for the exclusion of vector DNA (Kavanagh et
al., 1999). This universal chloroplast vector, pLD-CtV, contains
the trnI & trnA homologous flanking sequences (chloroplast
transfer RNAs coding for isoleucine and alanine) from the inverted
repeat region of the chloroplast genome for site specific
integration via homologous recombination (Daniell, 1999). The
pLD-CtV also contains the 16S rRNA promoter, the aadA gene encoding
spectinomycin resistance (selectable marker), and psbA3'
untranslated region to enhance translation. The pLD-BB1 vector
contains smGFP gene with a C-terminal fusion of the IFN.alpha.5
gene with a furin cleavage site between the fusion proteins cloned
into the universal chloroplast vector, pLD-CtV (FIG. 29).
Chloroplast integration of the smGFP-IFN.alpha.5 genes was
confirmed by PCR and Southern blot analysis. The smGFP-IFN.alpha.5
fusion protein expression was confirmed by immunoblot analysis and
smGFP expression under UV light. Expression was quantified by
ELISA. The smGFP-IFN.alpha.5 fusion protein is being further
analyzed via in vivo studies. The expression of smGFP-IFN.alpha.5
transgenic chloroplasts will facilitate the provision of a new and
alternate treatment for HCV and possible oral delivery options with
a lower cost of production.
EXAMPLE 5
Evaluation of Chloroplast Derived Cholera Toxin B Subunit (CTB) and
Green Fluorescent (GFP) Fusion Protein for Oral Delivery
[0481] Many infectious diseases require booster vaccinations or
multiple antigens to induce and maintain protective immunity.
Advantages of plant-derived vaccines include the delivery of
multiple antigens, low cost of production, storage &
transportation, elimination of medical personnel and sterile
injections, heat stability, antigen protection through
bioencapsulation, the generation of systemic & mucosal immunity
and improved safety via the use of a subunit vaccine and absence of
human pathogens. In an effort to study the oral delivery of
therapeutic proteins using the transmucosal carrier CTB, a fusion
of CTB-smGFP was expressed in transgenic chloroplasts of Nicotiana
tabacum var. petit Havana by inserting the CTB and smGFP genes into
the chloroplast genome. The pLD-CTB-smGFP vector contains CTB with
a C-terminal fusion to smGFP separated by a furin cleavage site.
Both genes were inserted into a universal chloroplast vector,
pLD-ctv containing the 16S rRNA promoter, the aadA gene coding for
spectinomycin selectable marker gene, the psbA 5' & 3'
untranslated regions to enhance translation in the light and tml,
trnA homologous flanking sequences for site specific integration
into the chloroplast genome. Chloroplast integration of the
CTB-smGFP genes was confirmed by PCR and Southern blot analysis.
The CTB-smGFP fusion protein expression was confirmed by smGFP
expression under UV light and immunoblot analysis. Expression level
was quantified by ELISA. GM1-ganglioside binding assays confirmed
that the chloroplast-derived CTB binds to the intestinal membrane
receptor of cholera toxin, confirming correct folding and disulfide
bond formation of CTB pentamers within transgenic chloroplasts.
Functional studies are being carried out in mice to investigate the
concept of bioencapsulation by plant cells by using smGFP as a
visible marker as well as to test the ability of
chloroplast-derived CTB to act as a transmucosal carrier of a
reporter gene product. These investigations might facilitate the
development of a novel cost effective oral delivery system for
vaccines and therapeutic proteins.
[0482] One of the most challenging problems of human health
management is the high cost of prescription drugs in developed
countries and their lack of availability in developing countries.
For example, interferon (IN) alpha 2b is used for the treatment of
viral diseases such as hepatitis C, as well as for certain cancers.
However, IFN treatment for four months costs $26,000 in the United
States, where more than forty-five million Americans do not have
health insurance (1).Several hundred million people in developing
countries are infected with hepatitis, but the daily income of
one-third of the world population is less than $2 per day(1). The
high cost of prescription drugs is due to a number reasons,
including fermentation-based production (each fermenter costs
several hundred million dollars to build), expensive purification
and in vitro processing methods (such as column chromatography,
disulfide bond formation) (2), the need for storage and
transportation at low temperature and delivery via sterile
injections requiring the involvement of hospitals and highly
qualified health professionals (1). Therefore, new approaches to
minimize or eliminate most of these expenses are urgently needed.
Transgenic plants offer many advantages, including the feasibility
of the oral delivery of foreign proteins, low cost of production,
storage and transportation, heat stability and protection through
bioencapsulation, elimination of the need for expensive
purification, in vitro processing, and sterile injections (1-5).
The generation of systemic and mucosal immunity (6) or induction of
oral tolerance (7), improved safety, and absence of human pathogens
(3) are other additional advantages (4, 5).
[0483] Chloroplast genetic engineering has recently become an
attractive method for production of recombinant proteins (8, 9)
because of high concentration of transgene expression [up to 47% of
the total soluble protein (10)] due to the presence of 10,000
copies of the transgene per cell, which is uniquely advantageous
for oral delivery of therapeutic proteins or vaccine antigens. It
is also an environmentally friendly approach due to effective gene
containment offered by maternal inheritance of chloroplast genomes
in most crops (11, 12) or engineered cytoplasmic male sterility
(13). Multigene engineering in a single transformation event (10,
14, 15) should facilitate delivery of polyvalent vaccines or
expression of therapeutic proteins with multiple subunits.
[0484] Despite these advantages, a major limitation remains in the
efficient delivery of plant-expressed therapeutic proteins across
the intestinal mucus membrane, primarily because of poor
permeability across the intestinal epithelial layer (16).
Receptor-mediated oral delivery across the intestine might serve as
a possible way to deliver not only vaccines but also
biopharmaceutical proteins. Ganglioside M1 (GM1) receptors on the
intestinal epithelial cells have been utilized by various pathogens
such as V. cholerae to facilitate entry of cholera toxin, into the
intestine. Crystal structures (17-19) of bacterial toxins like
cholera toxin, (CT), heat-labile enterotoxin (LT), and shigella
toxin show that they belong to AB5 subunit family. In CT, five
identical (11.6 kDa) peptides assemble into a highly stable
pentameric ring called the B subunit (58 kDa). The nontoxic B
subunit (CTB) exhibits specific and high-affinity binding to the
oligosaccharide domain of ganglioside GM1 (a lipid-based membrane
receptor) and functions to tether the toxin to the plasma membrane
of host cells (17, 20, 21). This receptor is present on the
intestinal epithelium as well as motoneurons and sympathetic
preganglionic neurons (22). GM1 sorts the CT into lipid rafts and a
retrograde trafficking pathway to the endoplasmic reticulum, where
the enzymatic subunit is transferred to the cytosol, probably by
dislocation through the transloconsec61P (20).
[0485] To test the concept of receptor-mediated oral delivery of
foreign proteins, the inventors have constructed a unique cholera
toxin B-green fluorescent protein (CTB-GFP) fusion gene with a
furin cleavage site between CTB and GFP and expressed the fusion
protein in transgenic chloroplasts. Furin, a member of
prohormone-proprotein convertases (23) (PCs), is a ubiquitously
expressed protein found in the trans-Golgi network (TGN) (24, 25),
endosomes, plasma membrane, and extracellular space (26). Furin
cleaves protein precursors with narrow specificity following basic
Arg-Xaa-Lys/Arg-Arg-like motifs (27). The furin cleavage site
between CTB and GFP would, therefore, facilitate intracellular
cleavage of the target protein (GFP).
[0486] Transgenic leaves expressing the CTB-GFP or IFNGFP fusion
protein were fed to Balb/c mice to investigate receptor-mediated
oral delivery of foreign protein using CTB as a transmucosal
carrier across the intestinal epithelium. In this study, we show
that CTB-GFP binds to the intestinal mucous membrane, including the
lymphoid tissue. Experimental observations suggest that GFP is
cleaved from CTB in the intestine through the action of furin and
enters the mucosal vasculature. We show that GFP, but not CTB, is
delivered to the liver and spleen of the CTB-GFP fed mice. No
significant levels of GFP were observed in the liver and spleen of
mice fed with IFN-GFP, which suggests that a transmucosal carrier
is essential for efficient delivery of proteins across the
intestinal lumen. Thus, CTB successfully delivers its fusion
protein to the systemic circulation and supports the use of
transmucosal carriers in the delivery of therapeutic proteins.
Materials and Methods
Construction of Chloroplast Vector
[0487] The pLD-CTB-GFP construct was based on the universal
chloroplast vector pLD (FIG. 39) that has been used successfully in
the inventors laboratory (28-31). CTB-GFP construct was engineered
with a furin cleavage site, Pro-Arg-Ala-Arg-Arg, in between CTB and
GFP. The constitutive 16 s rRNA promoter was used to drive
transcription of the aadA and the CTB-GFP genes. The aminoglycoside
3_adenylyltransferase (aadA) gene conferring spectinomycin
resistance was used as a selectable marker. The 5_-UTR from psbA,
including its promoter, was engineered to enhance translation of
the CTB-GFP because it has several ribosomal binding sites. The
3'UTR region conferred transcript stability. A GFP-IFN alpha5
fusion construct with a furin cleavage site between the two genes
was created and expressed in Nicotiana tabacam chloroplasts, which
served as a control molecule for the delivery of GFP without a
transmucosal carrier.
Bombardment and Selection of Transgenic Plants
[0488] The Bio-Rad PDS-1000/He biolistic device was used to bombard
pLD-CTB-GFP onto sterile Nicotiana tabacum cv. Petit Havana tobacco
leaves, on the abaxial side as has been described previously (29,
30, 32). The bombarded leaves were incubated in the dark for 24 h
and then placed on shooting media (RMOP) containing 500 .mu.g/ml
spectinomycin for two rounds of selection.
PCR Analysis to Test Stable Integration
[0489] DNA was isolated from the transgenic shoots by using Qiagen
DNeasy Plant Mini Kit, and PCR analysis was performed to confirm
integration of the transgene in the inverted repeat regions of the
chloroplast genome. PCR reactions were performed with two sets of
primers, 3P/3M and 5P/2M (28).
[0490] The samples were denaturated for 5 min at 95.degree. C.
followed by 30 cycles of the following temperatures: 95.degree. C.
for 1 min, 65.degree. C. for 1 min, and 72.degree. C. for 2 min and
a 72.degree. C. hold for 10 min after all 30 cycles were completed.
After confirmation of transgenic plants, the shoots were then
transferred to a rooting medium (MSO) with 500 .mu.g/ml
spectinomycin as a selective agent.
Southern Blot Analysis
[0491] Total plant DNA was digested with EcoRI, separated on a 0.7%
agarose gel at 45V for 8 h, and then transferred to a
nitrocellulose membrane. pUC-computed tomography vector DNA was
digested with BamHI and BglII to generate a 0.8 kb probe, which was
used as a flanking probe (28). After labeling the probe with P32,
hybridization of the membranes was performed by using Stratagene
QUICK-HYB hybridization solution and protocol (Stratagene, La
Jolla, Calif.).
Western Blot Analysis
[0492] Approximately 100 mg of leaf tissue was ground in liquid
nitrogen and resuspended in 500 .mu.l of plant extraction buffer
(0.1% SDS; 100 mM NaCl; 200 mM Tris-HCl, pH 8.0; 0.05% Tween 20;
400 mM sucrose; 2 mM PMSF). After centrifugation at 13,000 rpm for
5 min, the supernatant containing the extracted protein was
collected. We boiled 10 .mu.l of the plant extract along with 10
.mu.l of sample loading buffer, which was then run on a 15%
SDS-PAGE gel for 40 min at 50 V and then 2 h at 80 V. The protein
was then transferred to nitrocellulose membrane for 1 h at 80 V.
After blocking the membranes with PTM (1.times.PBS, 0.05% Tween 20,
and 3% dry milk) for 1 h, we added polyclonal rabbit anti-CTB
primary antibody (Ab) (Sigma) 1:3000 dilution. Goat anti-rabbit IgG
conjugated to alkaline phosphatase (Sigma) at a 1:5000 dilution was
used as a secondary Ab.
Furin Cleavage Assay
[0493] Approximately 100 mg of leaf material was powdered in liquid
nitrogen and resuspended in 500 .mu.l of plant extraction buffer
containing 15 mM Na.sub.2CO.sub.3, 35 mM NaHCO3, 3 Mhn NaN3, 5 mM
CaCl2, and 0.5% Triton-X, 2-mercaptoethanol at pH 6.0 and 7.0. We
added 1 mM PMSF to some of the samples. After centrifugation at
13,000 rpm for 5 min, the supernatant containing the extracted
protein was collected.
[0494] The extract (20 .mu.l) was incubated at 30.degree. C. for 4
h with 4 U of furin. A control group was also incubated at
30.degree. C. for 4 h without furin. After 4 h, each sample was
mixed with 20 .mu.l sample loading buffer, boiled, and run on 12%
SDS-PAGE gel for 45 min at 80 V and then 2 h at 100 V. The Western
blot analysis was performed as per the procedure outlined above.
Chicken anti-GFP Ab (Chemicon) at a 1:3000 dilution was used as the
primary Ab, and alkaline phosphatase conjugated rabbit antichicken
IgG (Chemicon) at a dilution of 1:5000 was used as a secondary
Ab.
ELISA
[0495] The CTB-GFP quantification was done using the ELISA (ELISA).
The standards and test samples were diluted in coating buffer (15
mM Na2CO3, 35 mM NaHCO.sub.3, 3 mM NaN3, pH 9.6). The standards,
ranging from 50 to 500 ng, were made by diluting recombinant GFP in
1% PBS. The leaf samples were collected from plants exposed to
regular lighting pattern (16 h light and 8 h dark), and total
protein was extracted using plant protein extraction buffer.
Standard GFP dilutions (100 .mu.l) and protein samples were bound
to a 96-well plate overnight at 4.degree. C. The background was
blocked with fat-free milk in PBST for 1 h at 37.degree. C.
followed by washing with PBST and water. Primary Ab used was
polyclonal chicken anti-GFP Ab (Chemicon) diluted (1:3000) in PBST
containing milk powder. Secondary Ab was BRP-conjugated rabbit
anti-chicken IgG-secondary Ab (Chemicon) at a 1: 5000 dilution in
PBST containing milk powder. For the color reaction, 100 .mu.l of
3,3.sub.--,5,5_-tetramethyl benzidine (TMB from American Qualex)
substrate was loaded in the wells and incubated for 10-15 min at
room temperature. The reaction was stopped by addition of 50 .mu.l
of 2N sulfuric acid per well, and the plate was read on a plate
reader (Dynex Technologies) at 450 nM.
GM1 Binding Assay
[0496] To test the functionality of CTB-GFP expressed in
chloroplasts, a CTB-GM1 binding assay was performed. We coated
96-well plates with 100 .mu.l of monosialoganglioside-GM 1 (Sigma)
(3.0 ng/ml in bicarbonate buffer) and incubated them overnight at
4.degree. C. After washing with PBST and water, the standards and
samples were incubated for 1 h at 37.degree. C. The plate was
blocked with 1% BSA in 1.times.PBS for 1 h at 37.degree. C. Rabbit
anti-CTB primary Ab (Sigma) and alkaline phosphatase (activating
protein) conjugated goat anti-rabbit secondary Ab (Sigma) was used
to detect the CTB binding to GM1 receptor. The plates were washed
with PBST and water, and 200 .mu.l of the substrate p-Nitrophenyl
phosphate (PNPP) was added to the wells and incubated in the dark
at 37.degree. C. for 20 min. The reaction was stopped by adding 50
gl of 3N NaOH, and the plates were read on a plate reader (Dynex
Technologies) at 405 nM.
Animal Studies
[0497] Three groups of 5-week-old female Balb/c mice were fed with
CTB-GFP, IFN alpha5-GFP (IFN-GFP), and wild-type (untransformed)
plant leaf material. Leaves (350 mg) were powdered in liquid
nitrogen, mixed with peanut butter, and fed to the mice, which had
been starved overnight prior to this experiment. The mice were then
gavaged for two more days, two times a day, with 40 mg of leaf
material per gavage that was powdered with liquid nitrogen and
mixed with 0.1M PBS (PBS). Five hours after the last gavage, the
mice were sacrificed and perfused with 10 ml of PBS followed by 4%
paraformaldehyde in PBS. Fresh frozen sections of the liver,
spleen, ileum, and jejunum were collected according to Samsam et.
al (33). Additional tissue was removed and immersed in Tissue Tec
freezing medium (Vector labs) and immediately frozen in
nitrogen-cooled isomethylbuthane (Sigma). Fixed tissue was
cryoprotected by passing through 10, 20, and 30% sucrose solutions
in PBS. Frozen sections (10_-m thick) of various tissues were then
made using a cryostat.
[0498] Fluorescence microscopy and immunohistochemistry for GFP,
CTB, and immune cells Frozen sections (10_-m thick) of intestine,
liver, and spleen were mounted with PBS and observed for GFP
fluorescence using a Leica 4500 microscope. Immunohistochemistry
was performed in order to show the presence of GFP and/or CTB in
various tissues. The slides were first blocked with 10% BSA (BSA)
and 0.3% Triton-X 100. Polyclonal chicken anti-GFP(Chemicon) or
polyclonal rabbit anti-CTB (Sigma) primary antibodies, at a
concentration of 1:500 and 1:300, respectively, in 1% BSA and 0.3%
Triton-X, were used for GFP or CTB localization of the tissues.
Those sections processed for HRP conjugated secondary antibodies
were blocked with a mixture of methanol/hydrogen peroxide 30% (2:1
ratio) to block the endogenous peroxidases. The secondary
antibodies were horseradish peroxidase (IJRP)-conjugated rabbit
antichicken IgG (Chemicon) or HRP-conjugated goat anti-rabbit
(Sigma). Tissue-bound peroxidase was developed by using the
3,3_diaminobenzidine (3,3_-diaminobenzidine) as a substrate to
visualize the immunoreaction.
[0499] For macrophage localization of the tissues, rat monoclonal
F4/80 Ab (Serotec) was used according to Berghoff et al. (34). The
secondary Ab was Alexa-555 conjugated Goat antirat IgG (Molecular
Probes). American hamster anti-CD11c primary Ab and anti-hamster
Alexa-546 conjugated secondary Ab (Molecular Probes) were used to
visualize dendritic cells in the intestine and other tissues.
FITC-labeled anti-chicken IgG was used as a secondary Ab in such
immunofluorescence staining to detect GFP in tissues.
Results
[0500] Confirmation of Transgene Integration into Chloroplast
Genome
[0501] Nicotiana tabacum cv. Petit Havana leaves were bombarded
with the pLD-CTB-GFP vector, and the leaves were grown on selective
medium containing 500 mg/l spectinomycin. The resultant shoots were
then screened for chloroplast transformants by PCR analysis by
using primers 3P/3M, and 5P/2M (FIG. 39A-C). The 3P primer lands on
the native chloroplast genome upstream of the site of integration,
whereas the 3M primer lands on the aadA transgene producing a 1.65
kb PCR product. This analysis ruled out the nuclear transformants
because 3P primer would not anneal and the spontaneous mutants are
eliminated because 3M primer would not anneal.
[0502] To check for the presence of the transgene in the
chloroplast, we performed the 5P-2M PCR analysis. The 5P primer
lands on aadA gene and the 2M lands on the tnA coding sequence,
which produces a 2.9 kb PCR product with CTB-GFP. This confirmed
the site-specific integration of the CTB-GFP fusion gene in the
inverted repeat regions of the chloroplast genome.
Southern Blot Analysis to Investigate Homoplasmy
[0503] To further confirm the integration of the transgene into the
chloroplast genome and to determine whether homoplasmy had been
achieved, Southern blot analysis was performed. Total plant DNA was
digested with the enzyme EcoR1 and hybridized with a chloroplast
flanking sequence probe (0.8 kb). Wild-type plants generated a 4.4
kb fragment, and transgenic plants generated 4.9 and a 2.2 kb
fragments (FIG. 39D). All of the transgenic lines tested appeared
to be homoplasmic (within the levels of detection), which means
that all of the chloroplast genomes within plant cells contained
the transgene CTB-GFP.
GFP Expression and Assembly of CTB-GFP Pentamers in Transgenic
Lines
[0504] FIG. 40 shows the transgenic and wild-type (WT) plants. In
FIG. 40B, the GFP expression of the transgenic plants can be seen
under the IV light, which is not seen in the wild-type
(untransformed) plant (FIG. 40A). FIG. 40C shows WT plant, and FIG.
40D, the CTB-GFP expressing plant under a low-magnification
microscope. Expression of GFP is clearly evident in FIG. 40D.
Western blot analysis was performed to investigate the expression
of the fusion protein CTB-GFP in transgenic tobacco chloroplasts
(FIG. 41A). The pentameric form (188 kDa) was observed in the
unboiled samples of the transgenic plants, while predominantly the
monomeric form (37.6 kDa) was detected in boiled samples.
Furin Cleavage Assay
[0505] The protease furin is present in the constitutive secretory
pathway and on the cell surface of virtually all cells (35). An in
vitro furin cleavage assay was performed on the CTB-GFP expressing
plant extract to show that the engineered cleavage site
(Aig-Ala-Arg-Arg) was recognized by firm. As seen in FIG. 41B, a 26
kDa polypeptide that corresponded with the recombinant GFP protein
was observed in the samples that were incubated with furin, thus
proving that furin could cleave CTB-GFP to release GFP. Furin
cleavage occurred at both pH 6.0 and 7.0 in the samples with and
without PMSF. Still, some protein did not get cleaved, probably
because the amount of enzyme was not sufficient to cleave all the
CTB-GFP protein present in the plant extract. The incubation time
of 4 h might also have been insufficient. However, the presence of
the cleaved GFP product in the samples incubated with furin
confirms that the engineered furin cleavage site is functional. The
introduction of furin consensus sequences at the Bchain/C-peptide
and the C-peptide/A-chain interfaces of human proinsulin has been
demonstrated to increase the processing of proinsulin to mature
insulin in a wide variety of non-neuroendocrine cells, including
fibroblasts, myoblasts, epithelial cells, and lymphocytes (3642).
As the furin cleavage site is also recognized by the endopeptidases
PC2 and PC3/1, it is likely that CTB-GFP fusion protein is cleaved
more efficiently during the process of receptor-mediated
delivery.
Quantification of CTB-GFP
[0506] To quantify the amount of CTB-GFP fusion protein in
transgenic tobacco leaves, ELISA (ELISA) was performed (FIG. 41B).
A standard curve was obtained using different concentrations of
recombinant GFP. The amount of CTB-GFP in the transgenic plants was
compared with the known concentrations of the recombinant GFP
(standard curve). Expression levels of CTBGFP ranged from 19.09 to
21.3% total soluble protein.
GM1 Binding Assay
[0507] The functionality of chloroplast-derived CTB-GFP was
determined by its ability to bind to GM1 in an in vitro GM1 binding
assay (FIG. 41C). GM1 binding assay showed that pentamers of
CTB-GFP were formed. This finding confirms the correct folding and
disulfide bond formation of CTB pentamers within transgenic
chloroplasts because only the pentameric form of CTB can bind to
GM1 (21).
Fluorescent Microscopy to Detect the Presence of GFP in the
Tissue
[0508] Fixed tissue and fresh frozen sections of the liver, spleen,
ileum, and jejunum were made from the three groups of mice fed with
plants expressing CTB-GFP, IFN-GFP, and WT plants, respectively. In
mice fed with CTB-GFP expressing plant leaf material, fluorescence
microscopy showed the presence of GFP in intestinal mucosa and
submucosa (FIG. 42A), the hepatocytes of the liver (FIG. 42D) as
well as various cells of the spleen (FIG. 42G). In the mice fed
with wild-type (untransformed) leaf material, no GFP fluorescence
was observed (FIGS. 42B, E, and B). In the mice fed with IFN-GFP
expressing plant leaf material, no GFP was detected in the liver or
spleen (FIGS. 42F and I). Detection of GFP in the liver and spleen
following oral delivery of CTB-GFP expressing plant leaf material,
suggests the successful delivery of the protein across the
intestinal lumen into the systemic circulation. Moreover, the lack
of detection of a significant amount of GFP in the liver and spleen
of mice fed with IFN-GFP expressing plants suggests that a
transmucosal carrier such as CTB is required for delivery of an
adequate amount of a macromolecule across the intestinal lumen into
the systemic circulation.
Immunohistochemistry
[0509] To confirm the fluorescent microscopy findings,
immunostaining was performed with both CTB and GFP antibodies. In
the intestine of the mice fed with CTBGFP, anti-GFP Ab detected GFP
inside the epithelial cells of the villi of the intestine, in the
crypts, as well as in the submucosal tissue (FIG. 43 A, C), which
suggesting GFP uptake by lymphoid cells as well as the circulation.
These results confirmed the previous microscopy findings (FIG. 42)
and showed the presence of GFP in various tissues, confirming that
GFP was successfully delivered to blood when transgenic leaf
material was orally fed to the mouse. GFP immunoreactivity was
detected in the liver and spleen (FIGS. 43E and B) in a similar
pattern to that seen with fluorescence microscopy of the native
tissue (FIGS. 42D and G). In the case of the mice fed with
wild-type leaf material, no GFP was detected in any of the tissues
(FIGS. 43F and I). In the mice fed with plants expressing IFN-GFP,
GFP was not detected in the liver or spleen cells (FIGS. 43G and
J).
[0510] To study the route of CTB in the body, we performed
immunohistochemistry using anti-CTB antibodies. CTB was detected in
the intestinal cells as well as inside the villi (FIG. 44A) in the
lamina propia and the submucosa. It was, however, not detected in
the liver (FIG. 44E), indicating that GFP is cleaved away from CTB
and that, while GFP leaves the cell, CTB probably is translocated
to the basolateral membrane of the cell. These results support the
feasibility of CTB to act as a transmucosal carrier and orally
deliver fused proteins via the intestinal cells. To localize the
GFP and/or CTB in the gut associated lymphoid tissue (GALT) and
other tissues, double staining for antigen-presenting cells such as
macrophages or dendritic cells was performed. A double staining
with F4/80 Ab for macrophages showed the presence of CTB inside
macrophages (FIG. 44C). FIG. 44G shows macrophages associated with
GFP, and FIG. 441 shows dendritic cells taking up the GFP. In
either case, associations of GFP with these antigen presenting
cells were found. Most of the macrophages were not associated with
GFP, which is perhaps due to uptake by the blood and lymph
circulation, while the CTB is translocated to the basolateral
membrane and is associated with macrophages.
Discussion
[0511] In this study, detection of GFP and CTB in the intestinal
mucosa (FIGS. 43, 44) suggests that CTB-GFP has been taken up by
the enterocytes and the gut-associated lymphoid tissue (GALT). The
CTB domain of the CTB-GFP forms the pentameric structure within
chloroplasts through disulfide bond formation; pentameric form
binds to the GM1 receptors on enterocytes and is endocytosed into
the intestinal cells as endosomes (20). GM1 functions to
concentrate CTB in detergent-insoluble, glycolipid-rich apical
membrane microdomains called lipid rafts (43, 44). Binding to lipid
rafts is required to couple the lipid-anchored protein with
intracellular machinery for protein sorting and vesicular traffic
(45, 46). After endocytosis, the CTB-GM1 complex trafficking occurs
retrogradely through Golgi cisternae and/or TGN (20, 47) into the
lumen of the endoplasmic reticulum (ER; 48). The GM1-CTB-GFP
complex in the lipid rafts, targeted to the TGN, loses its
endosomal covering. Within the TGN, ubiquitously expressed furin
cleaves numerous polypeptide precursors as it gets activated. In
eukaryotes, many essential secreted proteins and peptide hormones,
enzymes, and neuropeptides are initially synthesized as proproteins
(inactive precursors) and are activated by proteolytic cleavage by
furin and other members of the prohormone-proprotein convertase
(PCs, 23). Abundant experimental evidence indicates that the
CTB-GFP protein with furin cleavage site in between the fusion
protein gets cleaved and, as a result, the CTB and GFP separate.
The CTB is taken into the ER and from there to the baso-lateral
surface of the cell (transcytosis), where it remains membrane bound
to GM1 receptor (20). The GFP molecule getting out of the TGN
(presumeably membrane-bound) is exocytosed through the basolateral
membrane and finds its way into extracellular fluid and into the
submucosal vessels, including the lymphatic system. Due to the
large-size fenestrations of the lymphatic vessels, lymphatics
return over 3 L of fluid and .sub.--120 g of protein to the
bloodstream every 24 h in an adult human (49).
[0512] Besides the entry of CTB-GFP through the GM1 ganglioside
receptor, the M cells in intestinal epithelium covering the
mucosa-associated lymphoid tissue in the digestive tract also serve
as a port of entry of macromolecules and microorganisms by
pinocytosis (50). Therefore, a small amount of CTB-GFP could be
taken up by the GALT. This is shown in our study by CTB and GFP
expression in the antigen presenting cells, including the
macrophages as well as the dendritic cells in the intestinal lamina
propia and submucosa. Similarly, a small amount of GFP associated
with macrophages in the intestine of the INFGFP fed mice is likely
to be taken up by the M cells nonspecifically. The IFN-GFP fusion
protein also contains a furin cleavage site but, due to limited
uptake by the intestinal epithelial cells, there is not a
significant GFP transport to the tissues of the IFNGFP fed mice.
The amount of CTB-GFP reaching the enterocytes via GM1 receptor is
very high compared with the entry of IFN-GFP through M cells. This
is quite evident due to the GFP detected in various organs of the
CTB-GFP fed mice (FIGS. 43, 44). Presence of GFP and not CTB in the
liver of CTB-GFP treated mice in our study (FIGS. 43, 44) suggests
the cleavage of the CTB-GFP fusion protein in enterocytes and
uptake of GFP into the vasculature of the lamina propia and the
submucosa. CTB, however, might be translocated to the basolateral
cell membrane and remain bound to GM1 (20).
[0513] The main goal of this study is to develop an efficient oral
delivery of protein through GM1 receptor-mediated endocytosis.
Moreover, furin cleavage site facilitates the cleavage of the
candidate protein in the cell, so that it could be passed into the
extracellular space and into the circulation. Internalization of
GFP using receptor-mediated endocytosis suggests a possible way of
protein delivery across the impermeable intestinal mucous membrane.
Because of the rapid turnover of the intestinal epithelial cells
(51) in humans (renewal of the intestinal epithelium occurs in
every 3-6 d), repeated feeding of the CTB fused to a therapeutic
protein is possible due to the continuous availability of GM1
receptors in the new epithelium. Moreover, Peterson and colleagues
suggested a recycling mechanism for GM1 receptor as well (52).
[0514] One of the most challenging problems of human health
management is the high cost of prescription drugs in developed
countries and their lack of availability in developing countries.
Such high cost of therapeutic proteins can be attributed to their
production in fermentation-based system, expensive purification and
processing methods, low-temperature storage, transportation, and
sterile delivery using syringes through health professionals. Most
of these expenses could be avoided by expressing therapeutic
proteins in plant cells and through their oral delivery. This study
shows internalization of CTB-GFP by the mouse intestinal mucosal
cells as well as the antigen-presenting cells in the intestinal
mucosa and submucosa. We also show the presence of GFP but not CTB
in the liver of mice following oral delivery of CTB-GFP leaf
material. Detection of both CTB and GFP in mouse intestinal cells
following oral administration of CTB-GFP expressing leaf material
shows that the recombinant protein has been protected from
peptidases and/or acids by bioencapsulation (53) within the plant
cells. Several vaccine antigens (28, 5457) and human blood proteins
(31, 58-60) have been expressed in transgenic chloroplasts and
shown to be fully functional. The ability to express high levels of
foreign proteins in plastids present within edible plant parts (61,
62) and the rapid turnover of intestinal epithelial cells (51) for
recycling GM1 receptors make this approach a reality. This study
facilitates the provision of low-cost production and delivery of
human therapeutic proteins.
REFERENCES
[0515] 1. Daniell, H., Carmona-Sanchez, O., and Burns, B. E. (2004)
Chloroplast derived antibodies, biopharmaceuticals and edible
vaccines. In Molecular Farming (Fischer, R. and Schillberg, S. eds)
pp. 113-133, WILEY-VCH Verlag Publishers:Weinheim, Germany [0516]
2. Petridis, D., Sapidou, E., and Calandranis, J. (1995) Computer
aided process analysis and economic evaluation for biosynthetic
human insulin production--a case study. Biotechnol. Bioeng 48,
529-541 [0517] 3. Giddings, G., Allison, G., Brooks, D., and
Carter, A. (2000) Transgenic plants as factories for
biopharmaceuticals. Nat. Biotechnol. 18, 1151-1155 [0518] 4.
Arntzen, C., Plotkin, S, and Dodet, B. (2005) Plant-derived
vaccines and antibodies: potential and limitations. Vaccine 23,
1753-1756 [0519] 5. Mason, H. S., Warzecha, H., Mor, T. and
Arntzen, C. (2002) Trends Mol. Med. 8, 324 [0520] 6. Mason, H. S.,
Haq, T. A., Clements, J. D., and Arntzen, C. J. (1998) Vaccine 16,
1336 [0521] 7. Arakawa, T. Yu, J., Chong, D. K., Hough, J., Engen,
P. C., and Langridge, W. H. (1998) Nat. Biotechnol. 16, 934 [0522]
8. Grevich, J. J. and Daniell, H. (2005) Chloroplast genetic
engineering: Recent advances and future perspectives. Criti. Rev.
Plant Sci. 24, 83-107 [0523] 9. Daniell, H., Kumar, S., and
Dufourmantel, N. (2005) Breakthrough in chloroplast genetic
engineering of agronomically important crops. Trends Biotechnol.
23, 238-245 [0524] 10. De Cosa, B., Moar, W., Lee, S. B., Miller,
M., and Daniell, H. (2001) Overexpression of the Btcry2Aa2 operon
in chloroplasts leads to formation of insecticidal crystals. Nat.
Biotechnol. 19, 71-74 [0525] 11. Daniell, H. (2002) Molecular
strategies for gene containment in transgenic crops. Nat. Biotech.
20, 581-587 [0526] 12. Hagemann, R. (2004) The sexual inheritance
of plant organelles. In Molecular Biology and Biotechnology of
Plant Organelles (Daniell, H. and Chase, C. eds.) pp. 87-108.
Springer, Dordrecht, The Netherlands [0527] 13. Ruiz, O. and
Daniell, H. (2005) Engineering Cytoplasmic male sterility via the
chloroplast genome by expression of _-ketothiolase. Plant Physio.
138, 232-246 [0528] 14. Ruiz, O., Hussein, H., Terry, N. and
Daniell, H. (2003) Phytoremediation of organomercurial compounds
via chloroplast genetic engineering. Plant Physiol. 132, 1-9 [0529]
15. Quesada-Vargas, T., Ruiz, O., and Daniell, H. (2005)
Characterization of heterologous multigene operons in transgenic
chloroplasts. Transcription, processing, and translation. Plant
Physiol. 138, 1746-1762 [0530] 16. Hamman, J. H., Enslin, G. M. and
Kotze, A. F. (2005) BioDrugs 19, 165 [0531] 17. Sixma, T. K.,
Pronk, S. E., Kalk, K. H., Wartna, E. S., van Zanten, B. A.,
Witholt, B., and Hol, W. G. (1991) Crystal structure of a cholera
toxin-related heat-labile enterotoxin from E. coli. Nature 351,
371-377 [0532] 18. Merritt, E. A. and Hol, W. G. (1995) AB5 toxins.
Curr. Opin. Struct. Biol. 5, 165-71 [0533] 19. Ling, H., Boodhoo,
A., Hazes, B., Cummings, M. D., Armstrong, G. D., Brunton, J. L.
and Read, R. J. (1998) Structure of the shiga41ke toxin I
B-pentamer complexed with an analogue of its receptor Gb3.
Biochemistry 37, 1777-1788 [0534] 20. Lencer, W. I. (2001) Microbes
and microbial Toxins: paradigms for microbial-mucosal toxins. V.
Cholera: invasion of the intestinal epithelial barrier by a stably
folded protein toxin. Am. J. Physiol. Gastrointest Liver Physiol.
280, G781-786 21. Merritt, E.A., Sarfaty, S., van den Akker, F.,
L'Hoir, C., Martial J. A., Hol, W. G (1994) Crystal structure of
cholera toxin B-pentamer bound to receptor GM1 pentasaccharide.
Protein Sci. 3, 166-175 [0535] 22. Alisky, J. M., Van de Wetering,
C. I. and Davidson, B. L. (2002) Widespread dispersal of cholera
toxin subunit b to brain and spinal cord neurons following systemic
delivery. Exprimental Neurol. 178, 139-146 [0536] 23. Nakayama, K.
(1997) Furin: a mammalian subtilisin/Kex2p-like endoprotease
involved in processing of a wide variety of precursor proteins.
Biochem. J. 327, 625-635 [0537] 24. Bosshart, H., Humphrey, J.,
Deignan, E., Davidson, J., Drazba, J., Yuan, L., Oorschot, V.,
Peters, P. J., and Bonifacino, J. S. (1994) The cytoplasmic domain
mediates localization of furin to the TGN en route to the
endosomal/lysosomal system. J. Cell Biol. 126, 1157-1172 [0538] 25.
Molloy, S. S., Thomas, L., VanSlyke, J. K., Stenberg, P. E. and
Thomas, G. (1994) Intracellular trafficking and activation of the
furin proprotein convertase: localization to the TGN and recycling
from the cell surface. EMBO J: 13, 18-33 [0539] 26. Mayer, G.,
Boileau, G. and Bendayan, M. (2004) The proprotein convertase fin
colocalizes with caveolin-1 in the Golgi apparatus and endosomes of
hepatocytes. Cell Tissue Res. 316, 55-63 [0540] 27. Henrich. S.,
Cameron, A., Bourenkov, G. P., Kiefersauer, R., Huber, R.,
Lindberg, I., Bode, W., and Than, M. E. (2003) The crystal
structure of the proprotein processing proteinase furin explains
its stringent specificity. Nat. Struct. Biol. 10, 520-526 [0541]
28. Daniell, H., Lee, S. B., Panchal, T. and Wiebe, P. O. (2001)
Expression and assembly of the native cholera toxin B subunit gene
as functional oligomers in transgenic tobacco chloroplasts. J. Mol.
Bio. 311, 1001-1009 [0542] 29. Daniell, H., Ruiz, 0. N. and
Dhingra, A. (2004) Chloroplast genetic engineering to improve
agronomic traits. Methods Mol. Biol. 286, 111-137 [0543] 30. Kumar,
S, and Daniell, H. (2004) Engineering the chloroplast genome for
hyperexpression of human therapeutic proteins and vaccine antigens
in recombinant protein protocols. Methods Mol. Biol. 267, 365-383
[0544] 31. Daniell H., Chebolu S., Kumar S., Singleton M.,
Falconer, R. (2005) Chloroplast-derived vaccine antigens and other
therapeutic proteins. Vaccine 23, 1779-1783 [0545] 32. Daniell, H.
(1997) Transformation and foreign gene expression in plants
mediated by microprojectile bombardment. Methods Mol. Biol. 62,
453-488 [0546] 33. Samsam, M., Mi, W., Wessig, C., Zielasek, J.,
Toyka, K. V., Coleman, M. P., and Martini, R. (2003) The Wlds
mutation delays robust loss of motor and sensory axons in a genetic
model for myelin-related axonopathy. J. Neurosci. 23, 2833-2838
[0547] 34. Berghoff, M., Samsam, M., Muller, M., Kobsar, I., Toyka,
K.V., Kiefer, R., Maurer, M., and Martini, R. (2005)
Neuroprotective effect of the immune system in a mouse model of
severe dysmyelinating hereditary neuropathy: enhanced axonal
degeneration following disruption of the RAG-1 gene. Mol. Cell.
Neurosci. 28, 118-127 [0548] 35. Taylor, N. A. W. J. Van De Ven,
and J. W. Creemers. (2003) Curbing activation: proprotein
convertases in homeostasis and pathology. FASEB J: 17, 1215-27
[0549] 36. Groskreutz, D. J., Sliwkowski, M. X., and Gorman, C. M.
(1994) Genetically engineered proinsulin constitutively processed
and secreted as mature, active insulin. J. Biol. Chem. 269, [0550]
37. Hay, C. W., and Docherty, K. (2003) Enhanced expression of a
furin-cleavable proinsulin. J. Mol. Endocrinol. 31, 597-607 [0551]
38. Ito, M., Bujo H., Takahashi K., Arai T., Tanaka, I., and Saito,
Y. (2005) Implantation of primary cultured adipocytes that secrete
insulin modifies blood glucose levels in diabetic mice.
Diabetologia 48, 1614-1620 [0552] 39. Nishigori, T., Yanagita, M.,
and Takeuchi, T. (1996) Proinsulin cleaved by furin is processed to
chromatographically mature insulin by carboxypeptidases in
nonneuroendocrine cells. Peptides 17, 789-796 [0553] 40. Shaw, J.
A., Delday M. I., Hart A. W., Docherty H. M., Maltin, C. A., and
Docherty, K. (2002) Secretion of bioactive human insulin following
plasmid-mediated gene transfer to non-neuroendocrine cell lines,
primary cultures and rat skeletal muscle in vivo. J Endocrinol.
172, [0554] 41. Short, D. K., Okada S., Yamauchi, K., and Pessin,
J. E. (1998) Adenovirus-mediated transfer of a modified human
proinsulin gene reverses hyperglycemia in diabetic mice. Am. J.
Physiol. 275, E748-756 [0555] 42. Yanagita, M., Nakayama, K., and
Takeuchi, T. (1992) Processing of mutated proinsulin with
tetrabasic cleavage sites to bioactive insulin in the non-endocrine
cell line, COS-7. FEBS Lett. 311, 55-59 [0556] 43. Orlandi, P. A.
and Fishman, P. H. (1998) Filipin-dependent inhibition of cholera
toxin: evidence for toxin internalization and activation through
caveolae-like domains. J. Cell Biol. 141, 905-915 [0557] 44. Brown,
D. and Lendon, E. (2000) Structure and function of sphingolipid and
cholesterol-rich membrane rafts. J. Biol. Chem. 275, 17220-17224
[0558] 45. Lencer, W. I., Moe, S., Rufo, P. A. and Madara, J. L.
(1995) Transcytosis of cholera toxin subunits across model human
intestinal epithelia. Proc. Natl. Acad. Sci. USA 92, 10094-10098
[0559] 46. Badizadegan, K., Wolf, A. A., Rodighiero, C., Jobling,
M., Hirst, T. R., Holmes, R. K., and Lencer, W. I. (2000) Floating
cholera toxin into epithelial cells: functional association with
caveolaelike detergent-insoluble membrane microdomains. Int. Med.
Microbiol. 290, 403-408 [0560] 47. Feng, Y., Jadhav, A. P.,
Rodighiero, C., Fujinaga, Y., Kirchhausen, T., and Lencer, W. I.
(2004) Retrograde transport of cholera toxin from the plasma
membrane to the endoplasmic reticulum requires the TGN but not the
Golgi apparatus in Exo2-treated cells. EMBO Rep. 5, [0561] 48.
Fujinaga, Wolf, A. A., Rodighiero, C., Wheeler, H., Tsai, B.,
Allen, L., Jobling, M. G., Rapoport, T., Holmes, R. K., and Lencer,
W. I. (2003) Gangliosides that associate with lipid rafts mediate
transport of cholera and related toxins from the plasma membrane to
endoplasmic reticulum. Mol. Biol. Cell. 12, 4783-4793 [0562] 49.
Granger, D. N. (1997) Essential medical physiology; 2nd edition
(Leonard R. Johnson, ed.); pp. 217-225; Lippincott-Raven,
Philadelphia [0563] 50. Jepson, M. A. and Clark, M. A. (1998)
Studying M cells and their role in infection. Trends Microbiol. 6,
359-365 [0564] 51. Heath, J. P. (1996) Epithelial cell migration in
the intestine. Cell Biol. Int. 20, 139-146 [0565] 52.
Boonyarattanakalin, S, Martin, S. E., Dykstra, S. A., and Peterson,
B. R. (2004) Synthetic mimics of small Mammalian cell surface
receptors. J. Am. Chem. Soc. 126, 16379-16386 [0566] 53. Kong, Q.,
Richter, L., Yang, Y. F., Arntzen, Mason, H. S., and Thanavala, Y.
(2001) Oral immunization with hepatitis B surface antigen expressed
in transgenic plants. Proc. Natl. Acad. Sci. USA 98, 11539-11544
[0567] 54. Koya, V., Moayeri, M., Leppla, S. H., and Daniell, H.
(2005) Plant based vaccine: mice immunized with chloroplast-derived
anthrax protective antigen survive anthrax lethal toxin challenge.
Infect. Immun. 73, 8266-8274 [0568] 55. Watson J., Koya V., Leppla,
S., and Daniell, H. (2004) Expression of Bacillus anthracis
protective antigen in transgenic chloroplasts of tobacco, a
non-food/feed crop. Vaccine 22, [0569] 56. Molina A., Daniell H.,
Mingo-Castel, A., and Veramendi, J. (2004) High-yield expression of
a viral peptide animal vaccine in transgenic tobacco chloroplasts.
Plant Biotech. J. 2, 141-153 [0570] 57. Molina A., Veramendi, J.,
and Hervas-Stubbs, S. (2005) Induction of neutralizing antibodies
by a tobacco chloroplast derived vaccine based on a B cell epitope
from canine parvo virus. Virology 342, 266-275 [0571] 58.
Fernandez-San Millan, Mingeo-Castel A., Miller, M., and Daniell, H.
(2003) A chloroplast transgenic approach to hyperexpress and purify
Human Serum Albumin, a protein highly susceptible to proteolytic
degradation. Plant Biotech. J. 1, 71-79 [0572] 59. DeGray, G.,
Rajasekaran K., Smith F., Sanford, J., and Daniell, H. (2001)
Expression of an antimicrobial peptide via the chloroplast genome
to control phytopathogenic bacteria and fungi. Plant Physiol. 127,
852-862 [0573] 60. Leelavathi, S., and V. S. Reddy. (2003)
Chloroplast expression of His-tagged GUS-fusions: a general
strategy to overproduce and purify foreign proteins using
transplastomic plants as bioreactors. Molec. Breed. 11, 49 [0574]
61. Lelivelt, C. L., McCabe, M. S., Newell, C. A., Desnoo, C. B.,
vanDun, K. M., Birch-Machin, I., Gray, J. C., Mills, K. H., and
Nugent, J. M. (2005) Stable plastid transformation in lettuce
(Lactuca sativa L.). Plant Mol. Biol. 58, 763-74 [0575] 62. Kumar,
S., Dhingra, A., and Daniell, H. (2004) Plastid-expressed
betainealdehyde dehydrogenase gene in carrot cultured cells, roots,
and leaves confers enhanced salt tolerance. Plant Physiol. 136,
2843-2854
EXAMPLE 6
Characterization of Heterologous Muiltigene Operons in Transgenic
Chloroplasts: Transcription, Processing and Translation
Introduction
[0576] Plastid genes in higher plants are mainly organized as
operons, of which more than sixty have been described in the
tobacco chloroplast genome (Sugita and Sugiura, 1996). These may
group genes of related or unrelated functions, the former being the
most common (Barkan, 1988; Rochaix, 1996). Most of these genes are
transcribed into polycistronic precursors that may be later
processed and modified to render the transcripts competent for
translation (Eibl et al., 1999; Barkan & Goldschmidt-Clermont,
2000; Monde et al., 2000b).
[0577] The processing mechanisms for translation regulation in
chloroplast genes of higher plants are still largely unknown. The
general consensus is that most native primary transcripts require
processing in order to be functional (Barkan, 1988; Zerges, 2000;
Meierhoff et al., 2003), and that post-transcriptional RNA
processing of primary transcripts represents an important control
of chloroplast gene expression (Hashimoto et al., 2003; Nickelsen,
2003). However, it is believed that more than one pathway may be
involved in transcript processing (Danon, 1997; Choquet and
Wollman, 2002).
[0578] For example, several studies have shown that the regulation
of gene expression in the chloroplast relies more on RNA stability
than on transcriptional regulation (Deng and Gruissem, 1987; Jiao
et al., 2004). In chloroplast, such stability is mainly influenced
by the presence of 5' untranslated regions, or UTRs (Eibl et al.,
1999; Zou et al., 2003), nucleus-encoded factors (Lezhneva and
Meurer, 2004) and 3UTRs (Adams and Stern, 1990; Chen and Stem,
1991), without which rapid degradation or low accumulation of
primary transcripts has been observed. The role of plastid 3UTRs
differs from the role of its bacterial counterparts by being more
involved in transcript stability and less involved in the effective
termination of transcription (Stem and Gruissem, 1987).
[0579] Translation has also been a crucial step in the regulation
of gene expression, as in many cases protein levels in the
chloroplast did not correlate with steady-state transcript
abundance (Monde et al., 2000b). Therefore, the transcription of
native chloroplast operons and their post-transcriptional and
translational patterns have been the target of several studies
which showed that intercistronic processing enhanced translation of
chloroplast operons, including the maize psbB and pet clusters
(Barkan, 1988; Barkan et al., 1994). In addition, different species
may experience various processing mechanisms for the same gene
cluster. For example, species such as Arabidopsis (Meierhoff et
al., 2003), tobacco (Monde et al., 2000a) and spinach (Westhoff and
Herrmann, 1988) have a different mechanism than maize for the
translation of petD, which depends mainly upon the establishment of
dicistrons and tricistrons of this gene. Alternative processing of
the polycistron containing the petD gene, which produces
monocistronic petD, causes the degradation of the transcript,
inhibiting translation (Meierhoff et al., 2003; Tanaka et al.,
1987; Monde et al., 2000a, b). In contrast, in Chlamydomonas,
nearly all chloroplast genes appear to be transcribed as
monocistronic mRNAs, with translation being an essential regulatory
step of gene expression (Rochaix et al., 1989; Zerges and Rochaix,
1994). Other mechanisms, such as editing, which can produce
alternate start codons, have been linked to alternative processing
and to a complete different translation pattern (Hirose and
Sugiura, 1997; del Campo et al., 2002). These examples provide
evidence of different modifications of primary transcripts for
efficient translation in chloroplasts.
[0580] Traditionally, plant genetic engineering had involved the
introduction of single genes through nuclear transformation. In the
past decade, the introduction of multiple genes has also been
successful through this approach, allowing the incorporation of
complete metabolic pathways (Ma et al., 1995; Nawrath et al., 1994;
Ye et al., 2000). However, this approach required a long process of
integration of individual transgenes followed by breeding to
reconstruct the desired pathways. Additionally, transgene
segregation from nuclear transformed plants may be possible in
subsequent generations, which may result in loss of function of the
introduced pathway. Furthermore, plant nuclear genes are typically
transcribed monocistronically, which requires separate promoter
sequences for each of the introduced genes. Expression of foreign
genes may also be influenced by position effects and gene
silencing, causing levels of gene expression to vary among
independent transgenic lines (Daniell and Dhingra, 2002).
[0581] On the other hand, plant genetic engineering through
chloroplast transformation presents several additional advantages
over nuclear transformation, such as their ability to efficiently
transcribe and translate operons (DeCosa et al., 2001; Lossl et
al., 2003; Ruiz et al., 2003), as well as to confer hyperexpression
capability (Daniell et al., 2004c). In addition, chloroplasts are
able to accumulate foreign proteins that are toxic in the
cytoplasm, such as cholera toxin .quadrature. subunit (Daniell et
al., 2001), trehalose (Lee et al., 2003), and xylanase (Leelavathi
et al., 2003), without any deleterious effects, due to the
compartmentalization of transgene products (Bogorad, 2000).
Concerns about position effect are also eliminated due to
site-specific integration of transgenes via homologous
recombination of chloroplast DNA flanking sequences (Daniell et
al., 2002), and because chloroplasts are maternally inherited in
most crops, the risk of outcrossing transgenes to related species
through pollen is minimized (Daniell, 2002). Additionally,
transformation of plastids in non-green tissues, such as carrot
roots, offer promising options for oral delivery of vaccine
antigens (Kumar et al., 2004a).
[0582] As foreign genes are engineered into operons, the resulting
transcript differs from the native operons by lacking native
intergenic sequences. These sequences are removed during cloning or
by PCR amplification of the coding sequences. The effect of such
modifications in the transcription and translation of heterologous
operons has not yet been investigated. Therefore, the purpose of
this study is to examine the transcription, processing and
translation of several foreign operons engineered via the
chloroplast genome. The results of this investigation provide
sufficient evidence that suggests that engineered polycistrons in
chloroplast transgenic lines are efficiently translated and that
processing into monocistrons is not required to obtain
overexpression of transgenes. Additionally, the role of 5'UTRs and
3'UTRs in post-transcriptional modifications, translation, and
transcript stability are addressed. Addressing questions on
polycistron translation as well as the sequences required for
processing and transcript stability are essential for chloroplast
metabolic engineering.
Results
Multigene Engineering via the Tobacco Chloroplast Genome
[0583] Multigene engineering via the chloroplast genome has been
achieved by using several different foreign genes, promoters, and
5' and 3' regulatory sequences (Daniell et al., 2004a; Kumar and
Daniell, 2004). Chloroplast transgenic lines analyzed in this study
were genetically engineered with multigene cassettes that contained
the following basic features; the aadA (aminoglicoside
3'-adenylyltransferase) gene, which confers resistance to
spectinomycin and help in transgenic plant selection
(Goldschmidt-Clermont, 1991), downstream from the constitutive
chloroplast 16S ribosomal RNA gene promoter (Prrn). The
heterologous gene or genes of interest were inserted downstream of
the aadA gene and were flanked at the 3' end by the psbA 3'
untranslated region (3'UTR), which is involved in mRNA abundance
and stability in the chloroplast (Deng and Gruissem, 1987; Stern
and Gruissem, 1987). In some cases, the heterologous gene was also
engineered to contain the psbA promoter and 5' regulatory sequence
(5' untranslated region; 5'UTR) to enhance translation (Eibl et
al., 1999; Fernandez-San Millan et al., 2003; Dhingra et al., 2004,
Watson et al., 2004). The multigene cassettes were flanked at the
5' and 3' by sequences homologous to the tobacco chloroplast trnI
(tRNA Ile) and trnA (tRNA Ala) genes, respectively, which allow
site-specific integration by homologous recombination into the
inverted repeat region of the chloroplast genome (Daniell et al.,
1998). More than thirty genes have been successfully integrated and
expressed at this transcriptionally active spacer region (Daniell
et al., 2004a, b). In this study, the following foreign genes were
inserted into the basic expression cassettes: human serum albumin
(hsa), cholera toxin .beta. subunit (ctxB), ctxB-gfp (green
fluorescent protein) fusion, Bacillus thuringiensis insecticidal
protein (cry2Aa2) along with the associated chaperonin protein
(orf2) and orf1, and trehalose phosphate synthase (tps1). The
transgenic lines engineered to express CRY insecticidal protein
contained the entire cry2Aa2 native operon.
Transcription and Translation of the cry2Aa2 Operon
[0584] The chloroplast transgenic lines transformed with the
transgene cassette containing the aadA gene and the complete
cry2Aa2 operon (ORF1,2-Cry2Aa2 lines) were used to study the
transcriptional and translational patterns of a heterologous operon
in transgenic chloroplasts. This operon comprises the orf1, orf2,
and cry2Aa2 genes under the transcriptional regulation of the Prrn
promoter (FIG. 45A). Several transcripts were anticipated based on
transcription initiation at the engineered promoter (Prrn promoter)
and the native 16S ribosomal RNA promoter (native Prrn) in
transgenic lines (FIG. 45A). Northern blot analyses of three
independent lines harboring the cry2Aa2 operon revealed that the
predicted 4.9 kilonucleotide (knt) polycistron, which contained all
four transgenes (aadA-orf1-orf2-cry2Aa2), was the most abundant
transcript detected with the cry2Aa2 specific probe (FIG. 45B, c).
Interestingly, the cry specific probe also revealed a shorter
transcript of about 2.4 knt; which was about the same size as the
cry2Aa2 gene (FIG. 45B, a), suggesting that this transcript could
be the cry2aA2 monocistron. Densitometric analyses of the foreign
mRNA transcripts revealed that the cry2Aa2 monocistron and the
aadA-orf1-orf2-cry2Aa2 polycistron had similar abundances (FIG.
45C, a,c), indicating that processing in the intergenic region
between orf2 and cry2Aa2 occurred in about 50 percent of the
polycistrons transcribed from the Prrn promoter (FIGS. 45A, B a,
c). Another prominent 7.4 knt transcript was predicted, based on
the calculation of the length of the coding sequence, initiating at
the native 16S Prrn promoter (FIG. 45B, e). A low intensity
.about.6.0 knt transcript detected (FIG. 45B, d) may be produced by
read-through of the transcript starting at the Prrn promoter and
terminating downstream of the engineered 3' UTR. The low intensity
.about.3.5 knt transcript (FIG. 45B, b) terminates at the same
location as the 6.0 knt transcript, although it is smaller due to
the processing between or 2 and cry2Aa2. Because this fragment only
contained the cry gene and the sequences downstream from the 3'UTR,
it could not be detected with the aadA probe (FIG. 45D). The
read-through transcripts processed downstream of the 3'UTR
represent an average of 27.3.+-.3% of those produced in these
transgenic lines (FIG. 45B, b, d).
[0585] Northern blot analyses with the aadA specific probe
confirmed the results observed with the cry2Aa2 probe. The
predicted 4.9 knt polycistron that harbors the aadA gene plus the
complete cry operon was detected as expected (FIG. 45D, c).
Although the predicted 2.5 knt tricistron (FIG. 45D, f) containing
the aadA gene plus the orf1 and 2 was expected due to processing
between the orf2 and the cry2Aa2 genes, a transcript of a similar
intensity to that of the polycistron was observed instead (FIG.
45D, c, f). Densitometric analyses revealed a 1 to 1 ratio of the
polycistron (aadA-orf1-orf2-cry2Aa2) versus the aadA-orf1-orf2
tricistron (FIG. 45E, c,f), due to processing in the intergenic
region between orf2 and cry2Aa2 (FIG. 45A). These results showed
that the two transcripts produced by the processing in the
intergenic region between cry2Aa2 and orf2 resulted in transcripts
with a similar abundance to the complete polycistron containing all
four genes and the 3'UTR (FIG. 45C, a,c and FIG. 45E, f and c,
respectively). The fact that the tricistron containing the aadA,
orf1 and orf2 genes did not contain a chloroplast 3'UTR but still
was very stable, suggests that polycistrons are stable in the
chloroplast even in the absence of 3'UTRs. The results obtained by
using the orf1-orf2 fragment (orf1,2) as a probe, confirmed the
detection of the aadA-orf1-orf2 tricistron (predicted 2.5 knt),
indicating effective processing at the intergenic region between
orf2 and cry2Aa2 (FIG. 45F, f). Other transcripts of larger size
were also observed and corresponded to those obtained with the
cay2Aa2 gene-specific probe (FIG. 45 F, d,e).
[0586] Northern blots were also performed on the cry2Aa2 transgenic
lines using the psbA 3'UTR probe (FIG. 51B). Results revealed a
pattern similar to that obtained with the cry2Aa2 gene-specific
probe, as well as the presence of the endogenous psbA transcript.
In the case of the cry2Aa2 operon, transcripts were in much lower
proportion to the native psbA operon. Because the native psbA and
the heterologous cry2Aa2 operon are driven by different promoters,
transcript abundance cannot be quantitatively compared. In contrast
to the results obtained in FIG. 45B, only the major transcripts (a
and c) were detected.
[0587] Polysome fractionation assays of the cry2Aa2 operon support
polycistron translation, as the larger transcripts corresponding in
size to the complete operon (from the prrn promoter) were observed
mainly in the lower fractions of the sucrose gradients, when
hybridized with the cry2Aa2 probe (FIG. 46A) and with the orf1,2
probe (FIG. 46B). Additionally, smaller transcripts corresponding
in size to the cry2Aa2 gene processed from the rest of the operon
also appear associated to polysomes, suggesting that processing may
also occur and could be coupled to translation. Puromycin release
controls conform that the polycistronic transcripts found in the
lower fractions were indeed associated to polyribosomes (FIG.
46C).
[0588] Western blot analyses revealed that the Cry2Aa2 (65 kDa;
FIG. 45H) and the ORF2 proteins (45 kDa; FIG. 45) were highly
expressed in the transgenic lines. The abundant expression of the
orf2 confirmed that polycistrons were efficiently translated
without the need for processing into monocistrons.
Transcription and Translation of the hsa Operon
[0589] Chloroplast transgenic lines transformed with 3 different
multigene constructs, all containing the human serum albumin (hsa)
gene, were used to study transcription, translation and
posttranscriptional modifications (FIG. 47A). The Prrn promoter
drives the operon downstream in all three constructs. The first
transgenic line (referred to as RBS-HSA) has an operon formed by
the aadA gene, followed by the hsa gene, whereas the second
transgenic line (5'UTR-HSA) harbored an expression cassette that
contained the aadA gene under the transcriptional regulation of the
Prrn promoter, as well as the hsa gene under the transcriptional
regulation of the psbA promoter and the translational enhancement
of the 5' psbA UTR. This transgenic line was predicted to produce a
monocistronic hsa transcript (FIG. 47A). Finally, the third
transgenic line (ORF-HSA) contained a four-gene operon formed by
the aadA, and hsa genes, as well as the orf1 and orf2 sequences of
the cry2Aa2 operon from the bacterium Bacillus thuringiensis (FIG.
47A).
[0590] Northern blot analyses of the RBS-HSA lines with the hsa and
the aadA probes revealed that the most abundant transcript was a
dicistron of a predicted 2.8 knt (aadA-hsa, FIGS. 47B, D, b),
followed by two polycistronic transcripts: one transcribed from the
native 16S Prrn promoter of an expected size of 5.3 knt (FIGS. 47B,
D, h), and the 3.2-knt transcript transcribed (FIGS. 47B, D, d)
from the engineered Prrn promoter, terminating downstream of the
3'UTR of the gene cassette. No monocistrons were detected in these
RBS-HSA transgenic lines. Quantification of transcripts from the
northern blots obtained with the hsa probe revealed that the
polycistrons transcribed from the engineered Prrn promoter
accounted for 65.5.+-.3% of the transcript detected in these lines
(FIG. 47C). The polycistrons terminating downstream of the 3'UTR in
the trnA region and the one transcribed from the native 16S Prrn
were 24.9.+-.2. and 9.6.+-.1% of the total transcripts,
respectively (FIG. 47C, d, h). Values for the northern analysis
performed with the aadA probe were similar, with 61.8.+-.3% for the
polycistron transcribed from the engineered Prrn promoter,
31.7.+-.3% and 6.5.+-.0.3% for the read-through transcript and the
polycistron transcribed from the native promoter, respectively
(FIG. 47E, b, d, h). This analysis shows that there is abundant
read-though transcription.
[0591] The ORF-HSA transgenic lines also showed a similar
transcription pattern with respect to the RBS-HSA line when probed
with the hsa or aadA probe. When hybridized with the orf1,2 probe,
the same pattern to that obtained with the aadA probe was observed,
and no processing was detected between orf2 and the hsa gene (FIG.
47F, lanes 7-9). The most abundant transcript was the polycistron
containing all four genes (predicted size of 4.4 knt), which was
transcribed from the engineered Prrn promoter, representing
68.1.+-.2%, 65.5.+-.1% and 43.3.+-.4% of the total transcripts
detected with the hsa, aadA or orf1,2 probes, respectively (FIGS.
47B, D, F, f). Additionally, the predicted 6.9 knt polycistron
originating at the Prrn native promoter was also detected (FIG.
47D, k) and this represented 6.8.+-.0.4% of the polycistrons (FIG.
47E, k). A .about.5.2 knt transcript (FIGS. 47B, D, F, g) obtained
from the engineered 16S Prrn and processed downstream of the 3'UTR
was also observed. This transcript was about 27.7.+-.1.0% and
31.9.+-.2% of the polycistrons detected with the aadA or hsa probes
(FIG. 47C, g, and E, g), respectively, and 44.2.+-.1% of those
detected with the orf1,2 probe (FIG. 47G, g). Finally, transgenic
lines engineered with the aadA-5'UTR-hsa construct produced
transcripts about 200 nt longer than the transgenic lines
transformed with the aadA-hsa construct (FIGS. 47B, D, c, e). This
increase in transcript size is due to the presence of the psbA
5'UTR and promoter. Additionally, this transgenic line produced an
abundant hsa monocistron (2.1 knt) that accounted for approximately
50% of the total transcript detected with the hsa probe (FIGS. 47B,
C a); this transcript was not detected with the aadA, nor with the
orf1,2 probes, (FIG. 47D, lanes 7-9). The polycistrons transcribed
from the engineered Prrn and native promoter were 28.7.+-.3% and
9.4.+-.2% of the transcripts produced (FIG. 47E, g, k). Similar
transcript abundance was detected in northern blot analyses in
which the aadA probe was used (FIG. 47E, g, k). Furthermore,
read-through transcripts processed downstream of the transgene
cassette, in the trnA native gene, were detected (FIGS. 47B, D
letters e, j). The combined abundance of these transcripts was
15.5% (FIG. 47C, e, j), whereas the overall polycistron abundance
in this transgenic line was as much as the monocistronic
transcript.
[0592] When RNA from the different transgenic hsa lines were
hybridized with the psbA 3'UTR probe, a pattern similar to that
obtained with the hsa gene-specific probe was observed (FIG. 51A).
Because the native psbA transcript was also detected, the abundance
of both native and heterologous operons could be observed. However,
endogenous versus heterologous transcript abundance could only be
compared among transcripts that were regulated by the same psbA
promoter (FIG. 51A, lanes 4-6a). The results showed that the
5'UTR-HSA monocistronic transcript was approximately 1.6 times as
abundant as that of the native psbA. This may be due to the effect
of gene dosage, as the trangene is integrated into the inverted
repeat region, whereas the psbA gene is located in the large single
copy region.
[0593] Western blot analyses of the different constructs showed
expression of the HSA monomer (66 kDa) and dimer (132 kDa) in the
transgenic lines harboring the 5'UTR-hsa and the orf1,2-hsa
constructs (FIG. 47H). Transgenic lines expressing the monocistrons
showed expression levels similar to the ORF-HSA transgenic line, in
which only polycistrons were translated. The abundant translation
of ORF2 protein (45 kDa) from the aadA-orf1-orf2-hsa transgenic
lines (FIG. 47I), which only transcribed tricistrons and
polycistrons, support the view that polycistrons are highly stable
in the chloroplast and can be efficiently translated without
further processing. This was also observed in polysome
fractionation assays, in which larger polycistronic transcripts of
the ORF-HSA lines were detected in the lower fractions of the
gradient (data not shown). Expression of the hsa gene in the
transgenic line ORF-HSA at levels similar to the ones produced by
the psbA-5'UTR-hsa transgenic lines, suggest a similar translation
efficiency for heterologous polycistrons and monocistrons in the
chloroplast (FIG. 47H).
[0594] The accumulation of human serum albumin in transgenic lines
aadA-orf1-orf2-hsa was monitored under different photoperiods and
developmental stages by performing ELISA analyses. These
experiments were conducted to determine whether hsa expression
under the cry 5'UTR, which is a heterologous 5'UTR, is light
dependent or developmentally regulated. The data obtained from the
analysis of cell extracts from young, mature and old leaves exposed
to periods of 0, 4, 8, and 16 hours of light, revealed no
significant differences among age of leaf or among different
periods of illumination. Therefore, HSA accumulation in this
tralisgenic line regulated by a heterologous 5' UTR is independent
of light regulation and is free of cellular control (FIG. 48).
Transcription and Translation of the tps1 Operon
[0595] The tps1 gene coding for trehalose phosphate synthase was
engineered into a two-gene operon, formed by the aadA and the tps1
genes, and transcribed from the engineered Prrn promoter (RBS-TPS1
lines) (FIG. 49A). Northern blot analyses with either the
tps1-specific or aadA-specific probes detected the expected 2.7 knt
dicistron (aadA-tps1) as the most prominent transcript (FIGS. 49B,
D, a). Densitometric analyses of the northern blots showed that the
aadA-tps1 dicistron accounted for 43.3.+-.3% of the total
transcripts detected by the tps1 probe, and 59.8.+-.5% of the total
transcript when the aadA probe was used (FIG. 49C, a, and E, a). A
predicted 5.2 knt polycistron observed in the northern blots with
either the tps1 and aadA probes (FIG. 49B, c and D, c), is
transcribed from the native 16S Prrn (FIG. 49A, c). Additionally,
the tps1 probe detected less abundant polycistrons of about 3.5 knt
(FIGS. 49B, D, b) and .about.6.5 knt (FIG. 49B, d), transcribed
from the engineered Prrn promoter and the native 16S Prrn promoter,
respectively, terminating downstream of the 3'UTR. The 3.5-knt
polycistron was also detected by the aadA probe. Transcripts that
ended in the trnA intron region (downstream of the engineered
3T'UTR) were also detected in the cry (FIG. 45B, b and D, e) and
hsa transgenic lines (FIG. 47B, d, e, g; D d, e, g, and F, g),
indicating that this region may contain different processing
sequences. The transcripts processed at the trnA location account
for about 37% of the total transcripts detected in the transgenic
lines (FIG. 49C b, d and E, b). Transcripts longer than the 6.5 knt
polycistrons may terminate at undetermined locations and these were
not quantified densitometrically. No monocistron was detected in
the northern blots with the tps1 probe nor with the aadA probe,
indicating that the polycistron is not being processed in these
transgenic lines, whereas the larger transcripts detected are
likely to be read-through.
[0596] Northern blot analyses performed using the psbA 3'UTR probe
(FIG. 51C, lanes 1-3), revealed a pattern consistent to that
obtained using the gene-specific tps1 probe (see FIG. 49B). In
addition, the native psbA transcript was also detected and was
similar in abundance to the aadA/tps1 dicistron (FIG. 51C, a).
However, transcript abundance cannot be quantitatively compared
because they are regulated by different promoters. Larger, less
abundant transcripts (FIG. 51C, b-c) were also detected with the
gene-specific tps1 probe (see FIG. 49B), and may correspond to
read-through transcripts.
[0597] Western blot analyses performed to detect the trehalose
phosphate synthase revealed efficient translation of polycistrons,
as shown by the abundant accumulation of a 65 kDa polypeptide
corresponding to this protein (FIG. 49F). Because no monocistrons
for tps1 or aadA were detected in the northern blot analyses,
hyperexpression of TPS1 should thus be the result of efficient
translation of polycistrons in transgenic chloroplasts.
Transcription and Translation of the ctb Operon
[0598] RNA from chloroplast transgenic lines transformed with the
aadA-ctxb (referred to as RBS-CTB lines) or 5'UTR-ctxb-gp fusion
constructs (5'UTR-CTB-GFP lines) were also analyzed by northern
blots. The RBS-CTB lines showed dicistrons and polycistrons,
whereas the 5'UTR-CTB-GFP transgenic lines showed monocistrons
along with several polycistrons. Predicted dicistrons of 1.3 knt
(FIG. 50B, a and D, a) and 2.3 knt (FIGS. 50B, d and D, d)
transcribed from the engineered Prrn promoter were detected with
either the ctxb or aadA probe. Additionally, polycistrons
transcribed from the native 16S Prrn were observed in both
transgenic lines. In the RBS-CTB transgenic lines, the aadA-ctxb
polycistron was of a predicted size of 3.8 knt (FIGS. 50B, f and D,
f), while in the 5'UTR-CTB-GFP transgenic line aadA-5'-UTR-ctxb-gp
polyciston was 4.8 knt (FIGS. 50B, g and D, g); both polycistrons
code for four genes (16 rRNA gene, trnI gene plus the two
heterologous genes). Polycistronic transcripts of higher molecular
weight appear to terminate downstream from the engineered 3'UTR
(FIGS. 50B, D, i, h), as well as the transcripts of 2.2 knit (FIGS.
50A,B, c) and 3.5 kit (FIGS. 50A,B,e), obtained from the engineered
Prrn promoter and processed downstream of the 3'UTR in the gene
construct. The cxtb-gfp monocistron of 1.4 knt (FIGS. 50B, b) was
detected with the ctxb probe but not with the aadA probe; besides
this transcript, no other monocistron was detected in these
analyses. Its average relative abundance was 42.1.+-.3% of the
total heterologous transcripts in the 5'UTR-CTB-GFP transgenic
lines (FIG. 50C, b), while the total combined abundance of the
polycistrons averaged 56% (FIG. 50C, d, g), with the polycistron
transcribed from the engineered Prrn accounting for 22.9.+-.1% of
the total transcripts (FIG. 50C, d). For the RBS-CTB transgenic
line, 100% of the transcripts were polycistrons, of which the most
abundant transcript was the aadA-ctxB dicistron, (about 45% of the
total transcripts), followed by approximately 30% of the
polycistron transcribed from the engineered Prrn and processed
downstream at the trnA gene (FIG. 50D, a. c and E, a, c).
[0599] Additional northern blot analyses performed with the psbA
3'UTR probe (FIG. 51D) revealed a transcript pattern consistent to
that obtained with the ctxB gene-specific probe (see FIG. 50B).
Furthermore, the native psbA transcript was also detected. Because
the size of the aadA/ctxb dicistron (1.25 knt) is similar to that
of the endogenous psbA (1.3 knt), they could not be distinguished
from each other. However, this may account for the increase in
transcript abundance observed in relation to the native psbA
transcript (FIG. 51D, lanes wt and 1-3a*). Due to similar reasons,
the increase in transcript abundance of the native psbA transcript
observed on the 5'UTR-CTB-GFP transgenic lines (FIG. 51D, lanes
4-6b*) could be due to the presence of the ctxb-gfp monocistron
(1.4 klt). Although, the native psbA and the ctxb-gfp genes are
regulated by the same psbA promoter, transcript abundance could be
quantitatively compared. However, because both transcripts are
similar in size, comparison between these native and heterologous
transcripts was not possible.
[0600] The western blot analyses showed that transgenic lines
expressing either CTB or CTB-GFP fusion produced large amounts of
either protein (FIGS. 50F, G). CTB protein was detected as a higher
molecular weight polypeptide (trimer of 35 kDa) than the E. coli
expressed CTB (FIG. 50F). High protein level was also detected for
the gfp-ctxB fusion protein (FIG. 50G), which was detected in the
monomeric form (45 kDa). Interestingly, expression levels in both
transgenic lines were similar, even though in the
aadA-5'UTR-ctxb-gfp transgenic line the more abundant transcript
was the monocistron. This again suggests that polycistrons are
translated as effectively as monocistrons.
Discussion
[0601] The chloroplast genome has been engineered with single genes
to confer useful agronomic traits including herbicide resistance
(Daniell et al., 1998), insect resistance (McBride et al., 1995;
Kota et al., 1999, De Cosa et al., 2001), disease resistance
(DeGray et al., 2001), drought tolerance (Lee et al., 2003), salt
tolerance (Kumar et al., 2004a), and phytoremediation (Ruiz et al.,
2003). Recent success in transforming the chloroplast genome of
several major crops, including cotton (Kumar et al., 2004b) and
soybean (Dufournantel et al., 2004) has opened this field for
commercial development. Because most of the desired traits require
multigene engineering, it is important to understand transcription,
posttranscriptional changes and translation of heterologous
polycistrons within plastids.
[0602] Transcript analyses performed in this study repeatedly
confirmed that different transgenic lines harboring multigenic
operons generated polycistrons as the most abundant transcript
form, along with monocistronic mRNA. This observation is further
supported by the polysome fractionation assays performed on the
cry2Aa2 samples, in which larger transcripts were collected from
the fractions associated to polyribosomes. Smaller transcripts were
observed mainly in the upper fractions of the gradient, suggesting
that polycistrons may be preferentially translated without
processing. Similar results were obtained after stripping the
membranes and re-probing with the orf-0,2 probe. Polycistronic
polysomal RNA has been previously reported in native chloroplast
operons, as well as multiple open reading frames simultaneously
translated from polycistions (Barkan, 1988), however, in such case,
polycistronic transcripts were less abundant than monocistrons. In
the case of the cry2Aa2 operon, ribosome-associated polycistrons
were in much higher abundance than the monocistronic transcripts,
suggesting that the heterologous operon is preferentially
translated as a polycistronic unit. Similar results were observed
with chloroplast transgenic lines harboring the aadA-orf1-orf2-hsa
operon (data not shown). These observations contrast with the
general consensus for native chloroplast translation mechanisms
(Barkan, 1988; Barkan et al., 1994; Zerges, 2000; Meierhoff et al.,
2003), thus showing that multigene operons engineered into the
chloroplast genome do not necessarily require processing of
polycistrons to monocistrons or dicistrons for efficient
translation.
[0603] Processing was observed in the native cry2Aa2 operon,
between orf2 and the cry2Aa2 genes on the transgenic lines.
However, this event did not occur between orf1 and orf2 of this
operon, or at intergenic sequences of the other engineered operons
studied. The fact that processing occurred only in the cry2Aa2
5'UTR suggests that this intergenic sequence might contain unique
information required for processing. By using computer simulation,
it was observed that the heterologous bacterial intergenic
transcript sequences, may form secondary structures. Evidence for
the protection of chloroplast RNA by 5'UTRs has been previously
discussed (Drager et al., 1998), as well as the role of 5'UTR
secondary structures in RNA stability (Zou et al., 2003).
Additionally, previous reports have shown that, intergenic
sequences forming stable secondary structures that mask the
ribosome-binding site, may affect the translation of the downstream
gene (Barkan et al., 1994; Hirose and Sugiura 1997; Del Campo et
al., 2002). These observations offer the possibility of further
studies involving the role of intergenic secondary structures of
native and heterologous operons in post-transcriptional
processes.
[0604] Transgenic lines harboring the engineered aadA-orf1-orf2-hsa
operon showed no difference in HSA accumulation in response to
light or dark conditions, in contrast to those transformed with the
hsa gene and native psbA 5'UTR. This suggests that the translation
enhancement observed is not light-dependent. Thus, the heterologous
cry2aA2 operon UTR region is independent of nuclear and chloroplast
control, unlike the psbA regulatory sequences (Fernandez San
Millan, et al., 2003; Zerges, 2004). Such heterologous UTRs have
played a major role in transgene expression in non-green tissues,
such as carrot roots (Kumar et al., 2004a), or in non-green
cultured cells (Kumar et al., 2004 a, b), to facilitate
transformation of recalcitrant crops.
[0605] Data shown here supports the idea that engineered operons in
the chloroplast, which do not carry any intergenic sequences
capable of forming stable secondary structures, can be translated
very efficiently and do not require processing into monocistrons in
order to be translated. The processing observed in the cry2Aa2
transgenic lines may be due to endonucleolytic cleavage of a region
in the intergenic sequence, but it does not indicate that this
processing has to occur in order for translation to take place. An
interesting observation is that the aadA-orf1-orf2 tricistron
produced by the processing event does not contain a 3' UTR region,
yet this transcript is as abundant as the polycistrons, which
contain the 3'UTR and are efficiently translated. This shows that
polycistrons may be stable in the chloroplast, even in the absence
of the 3'UTR.
[0606] In chloroplasts, all of the genes in the 16S rrn operon,
including the trnA, trnI, as well as 23S, 4.5S and 5S rrn genes
(which are downstream of the integrated transgenes), are
transcribed from the native Prrn promoter. Therefore, disruption of
these polycistrons by the insertion of the foreign operon due to
effective termination at the 3' untranslated regions would mean
that the trnA and other downstream genes would not be transcribed,
affecting chloroplast protein synthesis. However, this was not the
case; all the transgenic lines grew similar to the wild type
plants, indicating that the read-through transcripts formed by the
insertion of foreign operons were sufficient for optimal ribosome
synthesis in chloroplasts. Read-through transcripts processed at
the trnA region accounted for about 26 to 39% of the total
heterologous transcripts in all transgenic lines tested whereas, in
HSA-expressing transgenic lines, this percentage was between 15%
and 32%. Introns within the trnA gene undergo splicing and other
posttranscriptional modifications in order to produce the
functional trnA (Barkan et al., 2004). Therefore, such processing
may modify polycistronic transcripts that read through from the
3'UTR psbA engineered in these chloroplast vectors. Additionally,
larger polycistrons were also detected, although these were not
quantified.
[0607] The transcript profile for the transgenic lines 5'UTR-hsa
and 5'UTR-ctxb-gfp, (the only two transgenic lines in this study
that transcribed monocistrons) was very similar. The monocistronic
transcripts accounted for about 42% to 50% of the total
heterologous transcripts examined. The total polycistronic levels
in these two transgenic lines, including read-through transcripts
were between 50% and 57%. In all the transgenic lines that did not
transcribe monocistrons, the most abundant transcript was
transcribed from the engineered Prrn promoter, terminating at the
3'UTR, which accounted for 43% to 59% of the total transcripts
detected.
[0608] Data generated by analyzing the different transcripts with
the psbA 3'UTR probe not only supported the previous results
observed with the gene-specific probes, but also allowed comparison
with the native psbA transcripts. In two transgenic lines
(5'UTR-HSA and 5T'UTR-CTB-GFP), the psbA 5'UTR was used upstream of
the genes of interest. Ea such cases, endogenous versus
heterologous transcript abundance could be quantitatively compared,
unless the 5'utr-ctxb-gfp transcript was similar in size to the
native psbA gene. Comparison of the native psbA and 5'utr-hsa
transcripts showed a greater abundance (1.6 times) of the
heterologous transcript. This could be attributed to gene dosage,
as the heterologous operons are integrated into the inverted repeat
region, whereas the native psbA gene is located in the single-copy
region. In addition, transcript abundance was variable among the
remaining heterologous operons regulated by the 16S prrn promoter.
Variability could be attributed to differences in mRNA stability,
as well as in the level of posttranscriptional processing of the
primary transcripts (Barkan and Goldschmidt-Clermont, 2000; Monde
et al., 2000b; del Campo et al., 2002).
[0609] The ability to engineer foreign genes without promoters or
other regulatory sequences has several advantages. Also, repeated
sequences may cause deletion of the transgene (Iamtham and Day,
2000). Observations reported here show evidence for transcription
and processing of heterologous operons. While endogenous
polycistrons require processing for effective translation, this is
not required for expression of foreign operons. Native polycistrons
require chloroplast specific 3'UTRs for stability, which is not
always required for heterologous polycistrons. Untranslated regions
in native transcripts are regulated by nuclear factors, whereas
heterologous transcripts have not been shown to be dependent of
such regulations. Specific nuclear-encoded factors recognize
sequences in native transcripts for the processing of primary mRNA
(Barkan, 2004). This is not the case in foreign operons where
heterologous sequences can be recognized and processed by the
chloroplast posttranscriptional machinery. Finally, in both native
and foreign operons there are abundant read-through transcripts
that allow the expression of genes downstream of 3'UTRs. Addressing
questions of the translation of polycistrons and sequences required
for transcript processing and stability is essential for
chloroplast metabolic engineering. Knowledge of such factors would
enable engineering pathways that will not be under the complex
post-transcriptional regulatory machinery of the chloroplast.
[0610] One of the primary advantages of using heterologous
sequences for increasing gene expression is the lack of cellular
control over these sequences, allowing the enhancement of transgene
expression in green and non-green tissues. Recently, the use of the
g10 5'UTR facilitated the transformation of non-green plastids of
carrot (Kumar et al., 2004a). Additionally, the use of a gene
cassette containing the selectable marker genes under the
regulation of heterologous UTRs, increased transformation
efficiency and facilitated cotton plastid transformation (Kurnar et
al., 2004b). Recent accomplishments in the transformation of
agronomically important species through somatic embryogenesis using
species-specific chloroplasts vectors, also broadens the
possibility of extending this technology to crops that have been,
until now, recalcitrant to chloroplast transformation (Dufourmantel
et al., 2004; Kumar et al., 2004a; Kumar et al., 2004b; Daniell et
al, 2005).
[0611] In this study, we report the translation of polycistronic
transcripts without processing, the expression of multigene operons
independently of cellular control, and the stability of
heterologous polycistrons lacking a 3'UTR. These results suggest
that it is possible to effectively express multiple genes via the
chloroplast genome without significant intervention of chloroplast
regulation. The findings of this study facilitate multigene
engineering via the plastid genome in both green and non-green
plastids. One embodiment of the invention relates to a vector
suitable for integration into the chloroplast genome that comprises
multigene operons, a plant stably transformed with such a vector
and a method of transforming a plant with such a vector.
[0612] The results reported here are the first attempts to
understand multigene engineering in transgenic plastids.
Materials and Methods
Chloroplast Transformation, Selection and Characterization of
Transgenic Plants
[0613] The chloroplast transformation, selection and
characterization of the transgenic lines used in this study have
been previously reported (Daniell et al., 2001; De Cosa et al.,
2001; Lee et al., 2003; Fernandez-San Millan et al., 2003) with the
exception of the ctb-gfp transgenic lines. Sterile tobacco leaves
were bombarded using the Bio-Rad PDS-1000/He biolistic device as
described previously (Daniell, 1997; Daniell et al., 2004a, b).
Chloroplast Expression Vector Carrying the hsa Gene.
[0614] The pLDA-sdHlSA vector was constructed by inserting the hsa
gene (1.8 kb) into Eco-./NotI sites of the multiple cloning site of
the chloroplast transformation vector (pLD-ctv). This construct
contained the hsa gene and a ribosome binding site sequence (ggagg)
upstream of the gene. For the pLDA-5'UTR-hsa vector, the promoter
and 5'UTR (205 bp) from psbA gene were amplified by PCR from
tobacco chloroplast DNA and then sequenced. The subsequent in-frame
cloning of the promoter/5'UTR upstream and hsa gene into pLD-ctv
vector by EcoRI/NotI digestion produced the functional gene
cassette.
Chloroplast Expression Vector Carrying the cfxB Gene.
[0615] A ribosome binding site (GGAGG) was engineered five bases
upstream of the start codon of the ctcB gene. The PCR product was
then cloned into pCR2.1 vector (Invitrogen) and subsequently cloned
into the chloroplast transformation vector (pLD-ctv) after the
sequencing of the open reading frame. The pLD vector carrying the
ctxb gene was used for successive transformation of tobacco
chloroplast genome according to the published protocol.
Chloroplast Expression Vector Carrying the tps1 gene.
[0616] The yeast trehalose phosphate synthase (tpsl) gene was
inserted into the XbaI site of the universal chloroplast expression
(pCt) vector between the aadA selection marker gene for
spectinomycin resistance and the psbA terminator to form the final
pCt-tps1 vector.
Chloroplast Expression Vector Carrying the Ciy2Aa2 Operon.
[0617] The cry2Aa2 operon from the HD-1 strain (Delattre et al.,
1999) was inserted into the universal chloroplast expression
vector, pLD ctv, to form the final shuttle vector pLD-BD Cry2Aa2
operon (De Cosa et al., 2001). This vector contains the 16S
ribosomal RNA (rRNA) promoter (Prrn) upstream of the aadA gene
(aminoglycoside 3'-adenylyltransferase) for spectinomycin
resistance, the three genes of the cry2Aa2 operon, and the psbA
terminator from the 3' region of the chloroplast photosystem II
gene.
Plant Transformation
[0618] Tobacco leaves were transformed by particle bombardment
(Bio-Rad PDS-1000He device), using 0.6 .mu.m gold microcarriers
coated with the pCt-TPS1 chloroplast expression vector, and
delivered at 1,100 psi with a target distance of 9 cm (Daniell,
1997). The bombarded leaves were selected on RMOP medium containing
500 .mu.g/ml spectinomycin to regenerate the transformants, as
previously described (Kumar and Daniell, 2004; Daniell et al.,
2004a)
Northern-Blot Analysis
[0619] Total plant RNA from untransformed tobacco (var. Petit
Havana) and from three clones of T, chloroplast transgenic tobacco
plants, was isolated by using the RNeasy Mini Kit (Qiagen,
Valencia, Calif.) and protocol. Northern blot analyses were
performed essentially as follows. Total RNA (1 .mu.g) per plant
sample was resolved in a 1.2% (w/v) agarose/formaldehyde gel at 55
V for 2.5 h. The RNA was transferred overnight to a nitrocellulose
membrane by capillarity. The next day, the membrane was rinsed
twice in 2.times.SSC (0.3 M NaCl and 0.03 M sodium citrate), dried
on Whatman paper, and then cross-linked in the GS Gene Linker
(Bio-Rad, Hercules, Calif.) at setting C3 (150 njouls).
[0620] The probes used for northern blot analyses were obtained as
follows: the aadA (aminoglycoside 3' adenylyl transferase) probe
was obtained by BstEII/YbaI restriction digestion of plasmid
pUC19-16S/aadA; the ctxB (cholera toxin .beta.-subunit) and tps1
(trehalose phosphate synthase) probes were obtained by XbaI
restriction digestion of plasmids pSBL-CTB and pSBL-TPS1,
respectively. The Cry2Aa2 (Bacillus thuringiensis insecticidal
protein) probe was obtained by XbaI digestion of plasmid
pSBL-ctv-CryIIA. The hsa (human serum albumin) probe was obtained
by EcoRV/NotI digestion of plasmid pCR2.1 ATG-HSA. Finally, the orf
1,2 probe was obtained by EcoRI digestion of plasmid pCR2.10RF1,2
and the psbA 3'UTR probe was obtained by pstI/XbaI digestion of
plasmid pLD-ctv.
[0621] Probes were radio labeled with .sup.32P dCTP by using Ready
Mix.RTM. and Quant G-50.RTM. micro columns for purification
(Amersham, Arlington Heights, Ill.). Prehybridization and
hybridization were performed using the Quick-Hyb.RTM. solution
(Stratagene, La Jolla, Calif.). The membrane was then washed twice
for 15 min at room temperature in 2.times.SSC with 0.1% (w/v) SDS,
followed by two additional washes at 60.degree. C. (to increase the
stringency) for 15 min with 0.1.times.SSC with 0.1% (w/v) SDS.
Radiolabeled blots were exposed to x-ray films and then developed
in the Mini-Medical Series x-ray film processor (AFP Imaging,
Elmsford, N.Y.). When required, membranes were stripped by applying
boiling 0.1% SSC and 0.1% SDS to the membrane, washing for 15
minutes, and repeating before re-hybridizing with a different
probe.
[0622] Relative transcript levels within each lane were measured by
spot densitometry (Alphaimager 3300, Alpha Innotech, San Leandro,
Calif.) on radiograms from the different northern blot analyses,
except those obtained using the psbA 3'UTR probe. The former are
shown as percentage of abundance within each line and therefore
comparison among lines cannot be made. For the blots obtained by
hybridization with the psbA 3'UTR probe, transcript abundance was
quantified by using the wild-type native psbA transcript, to which
a value of 1 was assigned. All other transcripts show values
greater or smaller than 1, depending on abundance in relation to
the wild-type psbA transcript, and are shown as additive values in
each line. Average transcript abundance was calculated among
corresponding clones and the standard deviation was determined.
Polysomal Fractionation Assays
[0623] Approximately 0.3 grams of leaf material from transgenic
tobacco harboring the cry2Aa2 operon were thoroughly ground in
liquid nitrogen and resuspended in polysome extraction buffer
(Barkan, personal communication). The ground tissue was treated
according to the protocol described by Barkan (1988), with some
modifications. The samples were treated with 0.5% sodium
deoxycholate and loaded onto 15%-55% sucrose gradients and
centrifuged at 45,000 rpm for 65 minutes (Beckmann rotor SW52Ti).
Fractions were collected from the bottom of the tube onto
microcentrifuge tubes containing 50 .mu.l 5% SDS and 0.2M EDTA, up
to a volume of about 5001 for each fraction. Polysomal RNA was
extracted with phenol:chloroform:isoamyl-alcohol (25:24:1),
followed by ethanol precipitation. The resulting pellets were
resuspended in RNase-free TE buffer (pH 8.0) and stored at
-80.degree. C., or loaded onto denaturing 1.2% agarose-formaldehyde
gels (5 .mu.l from each fraction). Northern blot analyses were then
performed as described above. Blots were hybridized with cry2Aa2
and o'j-1,2 probes.
[0624] To provide further evidence that the RNA obtained from the
bottom fractions of the sucrose gradient corresponded to
polysome-associated RNA, a puromycin-release control was included.
Before treatment with sodium deoxycholate, samples were treated
with 150 .mu.l of 2M KCl and 170 .mu.l of puromycin (3 mg/ml stock)
and incubated 10 minutes at 37.degree. C. Sodium deoxycholate was
then added to 0.5%, and the samples were incubated 5 minutes on ice
before loading onto the sucrose gradient. RNA extraction and
Northern blot analyses were performed as described above. The blots
were hybridized with the aadA and orf1,2 probes.
Western-Blot Analyses
[0625] Protein samples were obtained from 100 mg of leaf material
from the same wild type and transgenic lines used in the Northern
analyses by grinding the tissue to a fine powder in liquid
nitrogen. Subsequent homogenization in 200 .mu.l plant protein
extraction buffer (100 mM NaCl, 10 mM EDTA, 200 mM Tris-HCl, 0.05%
(w/v) Tween-20, 0.1% (w/v) SDS, 14 mM P-mercaptoethanol (BME), 400
mM sucrose and 2 mM phenylmethylsulfonyl fluoride) was performed,
followed by a centrifugation step at 15.7.times.g for 1 minute to
remove solids. The Bacillus thuringiensis Cry2Aa2 protein was
extracted from 100 mg of transgenic leaf material by adding 200
.mu.l of 50 mM NaOH to solubilize the Cry protein from the crystals
formed in the transgenic plants, and centrifuged at 10,000.times.g
for 1 minute to remove cell debris. Total protein concentrations
for the samples were determined by Bradford assay (Bio-Rad Protein
Assay) with bovine serum albumin as the protein standard.
[0626] Approximately 60 .mu.g of total soluble protein was loaded
onto 12% v/v SDS-polyacrylamide gels and separated by
electrophoresis. The separated proteins were then transferred to a
nitrocellulose membrane (31o-Rad, Hercules, Calif.). The membrane
was blocked for 11 hr with PTM buffer: 1.times.PBS (phosphate
buffer solution), 0.05% (v/v) Tween-20 and 3% (w/v) non-fat dry
milk. The membranes were probed with primary and secondary
antibodies as follows: for 2 hrs with primary antibody, then rinsed
with water twice and probed with secondary antibody for 1.5 hrs.
Finally, the membranes were washed 3 times for 15 minutes with PT
buffer (1.times.PBS, 0.05% (v/v) Tween-20) and one time with
1.times.PBS for 10 minutes, followed by incubation in
Lumi-phos.RTM. WB (Pierce, Rockford, Ill.) reagent for the alkaline
phosphatase reaction or SuperSignal (Pierce) reagent for
horseradish peroxidase (BRP) reaction.
[0627] Fihn exposure took place for 1, 3, 5 or 10 minutes,
depending on the strength of the signal of each blot. The
antibodies used and their respective dilutions were the following:
anti-cry2A (Envirologix, Portland, Me.), dilution 1:3,000;
anti-0RF2 (Moar et al., 1989), dilution 1:1,000; anti-HSA (Sigma,
St. Louis, Mo.), dilution 1:3,000; anti-CTB (Sigma), dilution
1:2,500; anti-PA (Dr. Stephan Leppla, NIH), dilution 1:30,000.
Secondary antibodies were used as follows: alkaline phosphatase
conjugated anti-rabbit antibody (Sigma) was used to probe against
every primary antibody with the exception of anti-PA which was
probed with HRP conjugated anti-mouse antibody; dilutions of
1:5,000 anti-rabbit antibody were used for anti-HSA, anti-ORF2 and
anti-Cry2A, for anti-CTB the dilution was 1:4,000. Anti-mouse
antibody was used in a 1:5,000 dilution.
ELISA Quantification
[0628] The Human Albumin Quantitation Kit (Bethyl Laboratories) was
used for ELISA quantification. Leaf material (100 mg) of the
aadA-orf1-orf2-hsa transgenic line was ground in liquid nitrogen
and resuspended in 700 .mu.l of 50 mM NaOH. The leaf extracts were
then diluted to fit in the linear range of the provided HSA
standard. Absorbance was read at 450 nm. The DC protein assay
(Bio-Rad) was used to determine total soluble protein concentration
following the manufacturer's protocol.
REFERENCES
[0629] Adams C C, Stern D B (1990) Control of mRNA stability in
chloroplasts by 3' inverted repeats: effects of stem and loop
mutations on degradation of psbA mRNA in vitro. Nucleic Acids Res
18: 6003-6010. [0630] Barkan A (1988) Proteins encoded by a complex
chloroplast transcription unit are each translated from both
monocistronic and polycistronic mRNAs. EMBO J. 7: 2637-2644. [0631]
Barkan A (2004) Intron splicing in plant organelles. In H Daniell,
C Chase eds, Molecular Biology and Biotechnology of Plant
Organelles, Kluwer Academic Publisher, The Netherlands, pp.
291-318. [0632] Barkan A, Goldschmidt-Clermont M (2000)
Participation of nuclear genes in chloroplast gene expression.
Biochimie 82: 559-572. [0633] Barkan A, Walker M, Nolasco M,
Johnson D (1994) A nuclear mutation in maize blocks the processing
and translation of several chloroplast mRNAs and provides evidence
for the differential translation of alternative mRNA forms. EMBO J.
13: 3170-3181. [0634] Bogorad L (2000) Engineering chloroplasts: an
alternative site for foreign genes, proteins, reactions and
products. Trends Biotechnol 18: 257-263. [0635] Bruick R K,
Mayfield S P (1999) Light-activated translation of chloroplast
mRNAs. Trends Plant Sci 4: 190-195. [0636] Chen H C, Stem D B
(1991) Specific ribonuclease activities in spinach chloroplasts
promote mRNA maturation and degradation. J Biol Chem 266: 24205-11
[0637] Choquet Y, Wollman F A (2002) Translational regulations as
specific traits of chloroplast gene expression. FEBS letters 529:
39-42. [0638] Daniell H (1997) Transformation and foreign gene
expression in plants mediated by microprojectile bombardment.
Methods Mol Biol 62: 453-488. [0639] Daniell H (2002) Molecular
strategies for gene containment in transgenic crops. Nat Biotechnol
20: 581-586. [0640] Daniell H, Dhingra A (2002) Multigene
engineering: dawn of an exciting new era in biotechnology. Curr
Opin Biotech 13: 136-141. [0641] Daniell H, Carmona-Sanchez 0,
Burns B B (2004b) Chloroplast derived antibodies,
biopharmaceuticals and edible vaccines, In R Fischer, S Schillberg
eds, Molecular Farming, WILEY-VCH Verlag, Winheim, pp. 113-133.
[0642] Daniell H, Cohill P R, Kumar S, Dufourmantel N, Dubald M
(2004c) Chloroplast genetic engineering. In H Daniell, C Chase,
eds, Molecular Biology and Biotechnology of Plant Organelles,
Kluwer Academic Publishers, The Netherlands, pp. 437-484. [0643]
Daniell H, Datta R, Varma S, Gray S, Lee S B (1998) Containment of
herbicide resistance through genetic engineering of the chloroplast
genome. Nature Biotechnol 16: 345-348. [0644] Daniell H, Khan M S,
Allison L (2002) Milestones in chloroplast genetic engineering: an
environmentally friendly era in biotechnology. Trends Plant Sci 7:
84-91. [0645] Daniell H, Kumar, S, Dufourmantel, N (2005)
Breakthrough in chloroplast genetic engineering of agronomically
important crops. Trends Biotechnol 23:238-245. [0646] Daniell H,
Lee S B, Panchal T, Wiebe P O (2001) Expression of the native
cholera toxin B subunit gene and assembly as functional oligomers
in transgenic tobacco chloroplasts. J Mol Biol 311: 1001-1009.
[0647] Daniell H, Ruiz O N, Dhingra A (2004a) Chloroplast genetic
engineering to improve agronomic traits. Methods Mol Biol 286:
111-137. [0648] Danon A (1997) Translational regulation in the
chloroplast. Plant Physiol 115: 1293-1298. [0649] DeCosa B, Moar W,
Lee S B, Miller M, Daniell H (2001) Overexpression of the Bt
cry2Aa2 operon in chloroplasts leads to formation of insecticidal
crystals. Nature Biotechnol 19: 71-74. [0650] DeGray G, Rajasekaran
K, Smith P, Sanford J, Daniell H (2001) Expression of an
antimicrobial peptide via the chloroplast genome to control
phytopathogenic bacteria and fungi. Plant Physiol 127: 852-862.
[0651] Del Canipo E M, Sabater B, Martin M (2002)
Post-transcriptional control of chloroplast gene expression.
Accumulation of stable psaC mRNA is due to downstream RNA cleavages
in the ndhD gene. J Biol Chem 277: 36457-36464. [0652] Delattre D,
Rang C, Lecointe N, Royer M, Delecluse A, Moar W J Frutos R (1999)
Expression of orf1 from the Bacillus thuringiensis NRD-12 cry2Aa1
Operon. Current Microbiology, 39:9-13. [0653] Deng X W, Gruissem W
(1987) Control of plastid gene expression during development: the
limited role of transcriptional regulation Cell 8: 379-87. [0654]
Dhingra A, Portis A R Jr., Daniell H (2004) Enhanced translation of
a chloroplast-expressed RbcS gene restores small subuit levels and
photosynthesis in nuclear RbcS antisense plants. Proc Natl Acad Sci
USA 101: 6315-6320. [0655] Drager R G, Girard-Bascou J, Choquet Y,
Kindle K L, Stem D B (1998) In vivo evidence for 5'-3'
exoribonuclease degradation of an unstable chloroplast mRNA. Plant
Journal 13:85-96. [0656] Dufourmantel N, Pelissier B, Garcon F,
Peltier J M, Tissot G (2004) Generation of fertile transplastomic
soybean. Plant. Mol. Biol. 55: 479-489. [0657] Eibl C, Zou Z, Beck
A, Kim M, Mullet J, Koop HU (1999) In vivo analysis of plastid
psbA, rbcL and rpl32 UTR elements by chloroplast transformation:
tobacco plastid gene expression is controlled by modulation of
transcript levels and translation efficiency. The Plant J 19:
333-345. [0658] Fernandez-San Millan A, Mingo-Castel A, Miller M,
Daniell H (2003) A chloroplast transgenic approach to hyper-express
and purify human serum albumin, a protein highly susceptible to
proteolytic degradation. Plant Biotechnol J1: 71-79. [0659]
Goldschmidt-Clermont M (1991) Transgenic expression of
aminoglycoside adenine transferase in the chloroplast: a selectable
marker for site-directed transformation of chlamydomonas. Nucleic
Acids Research 19: 4083-4089. [0660] Hashimoto M, Endo T, Peltier
G, Tasaka M, Shikanai T (2003) A nucleus-encoded factor, CRR2, is
essential for the expression of chloroplast ndhB in Arabidopsis.
Plant J 36: 541-549. [0661] Hirose T, Sugiura M (1997) Both RNA
editing and RNA cleavage are required for translation of tobacco
chloroplast ndhD mRNA: a possible regulatory mechanism for the
expression of a chloroplast operon consisting of functionally
unrelated genes. EMBO J. 16: 6804-6811. [0662] Iamtham S, Day A
(2000) Removal of antibiotic resistance genes from transgenic
tobacco plastids. Nature Biotechnol 18:1172-1176. [0663] Jiao H S,
Hicks A, Simpson C, Stem D B (2004) Short dispersed repeats in the
Chlamydomonas chloroplast genome are collocated with sites for mRNA
.sub.3' end formation. Curr Genet. 45: 311-22. [0664] Kota M,
Daniell H, Varma S, Garczynski S F, Gould F, William M J (1999)
Overexpression of the Bacillus thuringiensis (Bt) Cry2Aa2 protein
in chloroplasts confers resistance to plants against susceptible
and Bt-resistant insects. Proc Natl Acad Sci USA 96: 1840-1845.
[0665] Kumar S, Daniell H (2004) Engineering the chloroplast genome
for hyper-expression of human therapeutic proteins and vaccine
antigens. Methods Mol Biol 267: 365-383. [0666] Kumar S, Dhingra A,
Daniell H (2004a) Plastid expressed betaine aldehyde dehydrogenase
gene in carrot cultured cells, roots and leaves confers enhanced
salt tolerance. Plant Physiol 136: 2843-2854. [0667] Kumar S,
Dhingra A, Daniell H (2004b) Manipulation of gene expression
facilitates cotton plastid transformation by somatic embryogenesis
and maternal inheritance of transgenes. Plant Mol Biol 56: 203-216.
[0668] Lee S B, Kwon B B, Kwon S J, Park S C, Jeong M J, Han S E,
Byun M O, Daniell H (2003) Accumulation of trehalose within
transgenic chloroplasts confers drought tolerance. Mol Breed 11:
1-13. [0669] Leelavathi S, Gupta N, Maiti S, Ghosh A, Reddy V S
(2003) Overproduction of an alkali- and thermo-stable xylanase in
tobacco chloroplasts and efficient recovery of the enzyme. Mol
Breed 11: 59-67. [0670] Lezhneva L, Meurer J (2004) The nuclear
factor HCF145 affects chloroplast psaA-psaB-rps14 transcript
abundance in Arabidopsis thaliana. The Plant Journal 38: 740-753.
[0671] Lossl A, Eibl C, Harloff H J, Jung C, Koop H U (2003)
Polyester synthesis in transplastomic tobacco (Nicotiana tabacum
L.): significant contents of polyhydroxybutyrate are associated
with growth reduction. Plant Cell Rep 21: 891-899. [0672] Ma J K,
Hiatt A, Hein M, Vine N D, Wang F, Stabila P, van Dolleweerd C,
Mostov K, Lehner T (1995) Generation and assembly of secretory
antibodies in plants. Science 268: 716-719 [0673] McBride K E, Svab
Z, Schaaf D J, Hogan P S, Stalker D M, Maliga P (1995)
Amplification of a chimeric Bacillus gene in chloroplasts leads to
an extraordinary level of an insecticidal protein in tobacco.
Bio/Technology 13: 362-365. [0674] Meierhoff K, Felder S, Nakamura
T, Bechtold N, Schuster G (2003) HCF152, an, Arabidopsis RNA
binding pentatricopeptide repeat protein involved in the processing
of chloroplast psbB-psbT-psbH-petB-petD RNAs. Plant Cell 15:
1480-1495. [0675] Moar W. J, Trumble J T, Federici B A (1989)
Comparative toxicity of spores and crystals from the NRD-12 and
HD-1 strains of Bacillus thuringiensis subsp. kurstaki to neonate
beet armyworn (Lepidoptera:Noctuidae). J. Econ. Entomol. 82:
1593-1603. [0676] Monde R A, Greene J C, Stern D B (2000a)
Disruption of the petB-petD intergenic region in tobacco
chloroplasts affects petD RNA accumulation and translation. Mol Gen
Genet. 263: 610-8. [0677] Monde R, Schuster G, Stem D B (2000b)
Processing and degradation of chloroplast miRNA. Biochimie 82:
573-582. [0678] Nawrath C, Poirier Y, Somerville C (1994) Targeting
of the polyhydroxybutyrate biosynthetic pathway to the plastids of
Arabidopsis thaliana result in high levels of polymer accumulation.
Proc Natl Acad Sci 91: 12760-12764. [0679] Nickelsen J (2003)
Chloroplast RNA-binding proteins. Curr Genet. 43: 392-399. [0680]
Rochaix J D (1996) Post-transcriptional regulation of chloroplast
gene expression in Chamydomonas reinhardtii. Plant Mol Biol 32:
327-341. [0681] Rochaix J D, Kuchka M, Mayfield S, Schirner-Rahire
M, Girard-Bascou J, Bennoun P (1989) Nuclear and chloroplast
mutations affect the synthesis or stability of the chloroplast psbC
gene product in Chlamydomonas reinhardtii. EMBO J. 8: 1013-1021.
[0682] Ruiz O N, Hussein H, Terry N, Daniell H (2003)
Phytoremediation of organomercurial compounds via chloroplast
genetic engineering. Plant Physiol. 132: 1344-1352. [0683] Stern D
B, Gruissem W (1987) Control of plastid gene expression: 3'
inverted repeats act as NA processing and stabilizing elements, but
do not terminate transcription. Cell 51:1145-57. [0684] Sugita M,
Sugiura M (1996) Regulation of gene expression in chloroplasts of
higher plants. Plant Mol Biol 32: 315-26. [0685] Tanaka M, Obokata
J, Chunwongse J, Shinozaki K, Sugiura M (1987) Rapid splicing and
stepwise processing of a transcript from the psbB operon in tobacco
chloroplast: Determination of the intron sites inpetB andpetD. Mol
Gen Genet. 209: 427-431. [0686] Watson J, Koya V, Leppla S H,
Daniell H (2004) Expression of Bacillus anthracis protective
antigen in transgenic tobacco chloroplasts: development of an
improved anthrax vaccine in a non-food/feed crop. Vaccine 22:
4374-4384. [0687] Westhoff P, Herrmann R G (1988) Complex RNA
maturation in chloroplasts. The psbB operon from spinach. Eur J
Biochem 171: 551-64. [0688] Widner W R Whiteley H R (1989) Two
highly related insecticidal crystal proteins of Bacillus
thuringiensis subsp. Kurstaki possess different host range
specificities. Journal of Bacteriology 171:965-974. [0689] Ye X,
Al-Babili S, Kloti A, Zhang J, Lucca P, Beyer P, Potrykus I (2000)
Engineering the provitamin A (.quadrature.-carotene) biosynthetic
pathway into (carotenoid-free) rice endosperm. Science 287:
303-305. [0690] Zerges W. (2000) Translation in chloroplasts.
Biochimie 82: 583-601. [0691] Zerges W, Rochaix J D (1994) The 5'
leader of a chloroplast mRNA mediates the translational
requirements for two nucleus-encoded functions in Chlamydomonas
reinhardtii. Mol Cell Biol 14: 5268-5277. [0692] Zerges W (2004)
The regulation of translation and protein complex assembly in the
plastids. In H Daniell and C Chase eds, Molecular Biology and
Biotechnology of Plant Organelles, Kluwer Academic Publisher, The
Netherlands, pp. 343-379. [0693] Zou, Z, Eibl, C, Koop, H U (2003)
The stem-loop region of the tobacco psbA 5'UTR is an important
determinant of mRNA stability and translation efficiency. Mol Genet
Genomics 269: 340-349.
EXAMPLE 7
Efficacy and Functionality of Chloroplast-Derived Anturax
Protective Antigen
Introduction
[0694] Anthrax, a fatal bacterial infection, is caused by Bacillus
anthracis, a gram-positive spore-forming organism. It is a zoonotic
disease transmitted from animals to humans. CDC lists Bacillus
anthracis as a category A biological agent due to its severity of
impact on human health, high mortality rate, acuteness of disease,
and potential for delivery as a biological weapon. The disease is
acquired when spores enter the body through the skin or by
inhalation or ingestion. Virulent strains of B. anthracis contain
plasmids pX01, which carries genes encoding the toxins, and pX02,
which encodes the poly-Dglutamic acid capsule. Plasmid pX01 carries
the genes pagA, lef; and cya that encode the protective antigen
(PA), lethal factor (LF), and edema factor (EF), respectively. The
term "protective antigen" is derived because of this protein's
ability to elicit a protective immune response against anthrax.
None of these proteins is toxic when administered individually to
cells or animals. However, PA in combination with EF, known as
edema toxin, causes edema. Similarly, PA in combination with LF
forms lethal toxin (LT) (1, 5).
[0695] PA is the primary immunogen and key component of human
vaccines produced and licensed in the United Kingdom and United
States. The current U.S. vaccine (BioThrax; BioPort Corp.) consists
of an alum-absorbed, formalin-treated culture supernatant of a
toxigenic, nonencapsulated strain of B. anthracis. The British
anthrax vaccine is produced from supernatant of a static culture of
the Sterne strain, a nonencapsulated toxigenic variant of B.
anthracis, adsorbed to aluminum salts. These vaccines contain
predominantly PA, but also small quantities of LF and trace amounts
of EF (31). These traces of LF and EF may contribute to the vaccine
side effects, such as local pain and edema (19), and relatively
high rates of local and systemic reactions, including inflammation,
flu-like symptoms, malaise, rash, arthralgia, and headache (14,
29). Therefore, an effective expression system that can provide a
clean, safe, and efficacious vaccine is required. Recombinant PA
has been expressed in Escherichia coli (15), Lactobacillus casei
(32), and Salmonella enterica serovar Typhimurium (6). Expression
of PA in plants through chloroplast transformation has several
advantages over bacterial and mammalian expression systems. Foreign
proteins have been expressed at extraordinarily high levels in
transgenic chloroplasts due to the presence of 10,000 copies of the
chloroplast genomes per cell. These include AT-rich proteins such
as Cry2a (67% AT) at 47% of the total soluble protein (TSP) (11),
cholera toxin B chain fusion protein (59% AT) at 33% TSP (23), and
human serum albumin (66% AT) up to 11.1% TSP (12). Therefore, we
first tested the feasibility of expressing PA in transgenic
chloroplasts (30), but no further studies were possible because no
tag was used in that study to facilitate purification. In addition
to high levels of transgene expression, there are several other
advantages to chloroplast genetic engineering. Several genes can be
introduced in a single trans-formation event to facilitate
development of multivalent vaccines (11, 28). Gene silencing is a
common concern in nuclear transformation, but this has not been
observed in transgenic chloroplasts in spite of hyperexpression of
transgenes (11).
[0696] There is minimal risk of animal or human pathogens
contaminating the vaccine as seen with mammalian expression
systems. Additionally, chloroplast expression systems minimize
cross-pollination of the transgene due to the maternal inheritance
of the chloroplast genome (8). In this study, we expressed PA with
a histidine tag in transgenic chloroplasts, characterized the
resultant transgenic plants, and performed immunization studies. We
compared the efficacy of the plant-derived PA with that of PA
derived from B. anthracis in both in vitro and in vivo studies.
Materials and Methods
[0697] Construction of pLD-VK1 vector for chloroplast
transformation. The six histidine tag and the factor Xa cleavage
site with NdeI and XhoI restriction sites were introduced N
terminal to pagA using PCR (FIG. 52a). The PCR-amplified region was
sequenced and shown to match corresponding pagA database sequences
(accession no. AY700758). The PCR product was then cloned into
pCR2.1 vector containing the psbA 5' untranslated region (UTR).
Finally, the fragment containing the 5' UTR, His tag, and pagA was
cloned into tobacco universal vector pLD-ctv to produce pLD-VK1
(FIG. 52a).
[0698] Leaf bombardment and selection protocol. Microprojectiles
coated with plasmid DNA (pLD-VK1) were bombarded into Nicotiana
tabacum var. petit Havana leaves using the biolistic device
PDS1000/He (Bio-Rad) as described elsewhere (9). Following
incubation at 24.degree. C. in the dark for 2 days, the leaves were
cut into small (-5 mm by 5 mm) pieces and placed abaxial side up
(five pieces/plate) on selection medium (RMOP [regeneration medium
of plants] containing 500 mg/liter spectinomycin dihydrochloride
[9]). Spectinomycin-resistant shoots obtained after about 6 weeks
were cut into small pieces (-2 mm by 2 mm) and placed on plates
containing the same selection medium.
[0699] Confirmation of transgene integration into the chloroplast
genome. To confirm the transgene cassette integration into the
chloroplast genome, PCR was performed using the primer pairs 3P
(5'-AAAACCCGTCCTCEGTTCGGATTGC-3') and 3 M
(5'-CCGCGTTGTTTCATCAAG-CCTTACG-3') (10), and to confirm the
integration of gene of interest, PCR was performed using primer
pairs 5P (5'-CTGTAGAAGTC-ACCATTGTTGTGC-3') and 2 M (5'-TGACT
GCCCACCTGA-GAGCGGACA-3') (10). Southern blot analysis. Two
micrograms of plant DNA per sample (isolated using DNeasy kit)
digested with BglII was separated on a 0.7% (wt/vol) agarose gel
and transferred to a nylon membrane. The chloroplast vector DNA
digested with BglII and BamHI generated a 0.8-kb probe homologous
to the flanking sequences. Hybridization was performed using the
Ready-To-Go protocol (Pharmacia).
[0700] Immunoblot analysis. Transformed and untransformed leaves
(100 mg) were ground in liquid nitrogen and resuspended in 500
.mu.l of extraction buffer (200 mM Tris-HCl, pH 8.0, 100 mM NaCl,
10 mM EDTA, 2 mM phenylmethylsulfonylfluoride). Leaf crude
extracts, boiled (4 min) or unboiled, in sample buffer (B31o-Rad)
were subjected to sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). Thirty percent acrylamide Bis solution
(Bio-Rad) was used to make the 10% gels. The gel was run in
1.times. electrode buffer (10.times.electrode buffer is 30.3 g Tris
base, 144.0 g glycine, and 10.0 g SDS added to 1,000 ml distilled
water). The separated proteins were then transferred to
nitrocellulose, and Western blot analyses was performed using
anti-PA primary antibody (Immunochemical labs) diluted in
phosphate-buffered saline (PBS)--0.1% Tween--3% milk powder (PTM)
(1:20,000) and secondary horseradish peroxidase (HRP)-conjugated
goat anti-mouse immunoglobulin G (IgG) (Sigma) diluted in PTM
(1:5,000) followed by washing with PBS and finally incubated with
Lumiphos WB (Pierce) as a substrate for HRP at room temperature for
5 min for chemiluminescence.
[0701] ELISA for PA. Leaf samples (100 mg of young, mature, or old
leaves) were collected from plants exposed to regular (16 h of
light and 8 h of dark) or continuous illumination. The extraction
buffer (15 mM Na.sub.2CO.sub.3, 35 mM NaHCO3, 3 mM NaN3, pH 9.6,
0.1% Tween, 5 mM phenylmethylsulfonyl fluoride) was used to isolate
plant protein. All dilutions were made in the coating buffer (15
mMNa2CO3, 35 rnMNaHCO3, 3 mMNaN3, pH 9.6). Antibodies were used at
dilutions similar to those in the Western blotting protocol. Wells
were then loaded with 100 .mu.l of 3,3,5,5-tetramethylbenzidine
(TMB; American Qualex) substrate and incubated for 10 to 15 min at
room temperature. The reaction was terminated by adding 50 .mu.l of
2 NH2SO4 per well, and the plate was read on a plate reader (Dynex
Technologies) at 450 nm.
[0702] Purification of His-tagged PA by affinity chromatography.
His affinity chromatography using nickel-chelate-charged columns
(Amersham Biosciences) was used to purify His-tagged PA as per the
manufacturer's protocol. The buffers used for purification include
the following: binding buffer, 20 mM Na2HPO4, 0.5 M NaCl, 10 mM
imidazole, pH 7.4; elution buffer, 20 mM Na.sub.2HPO4, 0.5 M NaCl,
0.5 M imidazole, pH 7.4; and Ni-loading eluent, 100 mM NiSO4
solution (Sigma). Protein samples were analyzed for PA using
enzyme-linked immunosorbent assay (ELISA). Eluate fractions
containing purified PA were pooled together and dialyzed against
PBS, pH 7.4, using dialysis cassettes (molecular weight, 10,000;
Pierce) and concentrated using Centricon
10,000-molecularweight-cutoff ultrafiltration units (Millipore)
following the manufacturer's protocols.
[0703] Macrophage lysis assay. Macrophage lysis assays were
performed on the crude leaf extracts, partially purified
chloroplast-derived PA, and B. anthracis-derived PA. RAW264.7
macrophage cells were plated in 96-well plates in 120 .mu.l
Dulbecco's modified Eagle's medium and grown to 50% confluence. The
plant samples or solutions containing 20 .mu.g/ml of the purified
PA proteins were diluted serially 3.14-fold in a separate 96-well
plate and then transferred onto the RAW264.7 cells in such a way
that the top row had plant extract at a 1:50 dilution and PA at 0.4
.mu.g/ml. Cells were incubated with LT for 2.5 h, and the cell
viability was assessed by addition of MTT
[3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide]
(Sigma, St. Louis, Mo.) at a final concentration of 0.5 mg/ml.
Cells were then further incubated with MTT for 40 min, and the blue
pigment produced by viable cells was dissolved by aspirating the
medium and adding 50 .mu.l/well of a mixture containing 0.5%
(wt/vol) SDS and 25 mM HCl in 90% (vol/vol) isopropanol and shaking
the plates for 5 min prior to reading at 570 nm using a microplate
reader. Control plates received medium with no LF to test toxicity
of plant material and buffers.
[0704] Immunization studies in mice. The immunization studies were
conducted in accordance with federal and institutional guidelines.
Seven groups of five female 6- to 7-week-old BALB/c mice (Charles
River) were immunized subcutaneously (s.c.; 5 .mu.g PA) at two
sites (100 .mu.l per site) on day 0. The groups include mice
immunized with (i) chloroplast-derived PA (CpPA) with adjuvant,
(ii) chloroplast-derived PA (CPPA) alone, (iii) Std.PA derived from
B. anthracis with adjuvant, (iv) Std-PA alone (26), (v) PA plant
leaf crude extract with adjuvant, or (vi) wild-type plant leaf
crude extract with adjuvant and (vii) unimmunized mice. The
measurement of PA adsorbed to alhydrogel was done as described
previously (20). Booster doses were administered on day 14, day 28,
and day 140. Blood was drawn from the retro-orbital plexus 15 days
after the third and fourth doses (i.e., on days 43 and 155 of
post-initial immunization). The blood samples were allowed to stay
undisturbed for 2 h at room temperature, stored at 4.degree. C.
overnight, and centrifuged at 3,000 rpm for 10 min to extract the
serum.
[0705] ELISA to detect the anti-PA IgG antibodies in the serum
samples. Ninety-six well microtiter ELISA plates were coated with
100 .mu.l/well of PA standard at a concentration of 2.0_ml in PBS,
pH 7.4. The plates were stored overnight at 4.degree. C. The serum
samples from the mouse were serially diluted (1:100 to 1:640,000).
Plates were incubated with 100 PI of diluted serum samples for 1 h
at 37.degree. C. followed by washing with PBS-Tween. The plates
were then incubated for 1 h at 37.degree. C. with 100 .mu.l of
HRP-conjugated goat anti-mouse IgG (1:5,000 dilution of 1-mg/ml
stock). TMB was used as the substrate, and the reaction was stopped
by adding 50 .mu.l of 2 M sulfuric acid. The plates were read on a
plate reader (Dynex Technologies) at 450 nm. Titer values were
calculated using a cutoff value equal to an absorbance difference
of 0.5 between immunized and unimmunized mice (25).
[0706] Toxin neutralization assays. Sera from immunized mice were
tested for neutralization in the macrophage cytotoxicity assay
described above. LT (PA plus LF) was added at 50 ng/ml in
Dulbecco's modified Eagle's medium to 96-well plates (100
.mu.l/well, except 150 .mu.l in first well). Serum from each mouse
was diluted directly into the LT plates starting at 1:150 and
proceeding in 3.14-fold dilutions. Each serum was tested in
triplicate. Following a 30-min incubation of sera with toxin, 90
.mu.l of the mixture was moved to a 96-well plate containing
RAW264.7 cells grown to 90% confluence and incubated for 5 h at
37.degree. C. MTT was then added (final concentration, 0.5 mg/mil),
and cell death was assessed as described above. Neutralization
curves were plotted, and 50% effective concentrations (EC50s) were
calculated for the averaged data from each mouse serum using
GraphPad Prism 4.0 software.
[0707] Toxin challenge in mice. Groups of five mice with various
immunization treatments described above were injected
intraperitoneally with 150 .mu.g LT (150 .mu.g LF plus 150 .mu.g
PA) in sterile PBS (1 ml). Mice were monitored every 8 h for signs
of malaise and mortality.
Results and Discussion
[0708] Chloroplast vector design. The pLD-VK1 vector (FIG. 52a)
contains homologous sequences that facilitate recombination of the
pag gene cassette between the trnI and trnA genes of the native
chloroplast genome (9). The constitutive 16S rRNA promoter
regulates expression of the aadA (aminoglycoside 3'
adenyltransferase) gene. The pagA gene is regulated by the psbA
promoter and 5' and 3' UTRs. The psbA 5'UTR has several sequences
for ribosomal binding that act as a scaffold for the
light-regulated proteins involved in ribosomal binding to enhance
translation (12), and the psbA 3'UTR serves to stabilize the
transcript.
[0709] Demonstration of transgene integration. Several shoots
appeared 5 to 6 weeks after the bombardment of tobacco leaves with
gold particles coated with the pLD-VK1 plasmid DNA (FIG. 52a).
There are three genetic events that can lead to survival of shoots
on the selective medium: chloroplast integration, nuclear
integration, or spontaneous mutation of the 16S rRNA gene to confer
resistance to spectinomycin in the ribosome. True chloroplast
transformants were distinguished from nuclear transformants and
spontaneous spectinomycin resistance mutants by PCR. Previously
described primers, 3P and 3M, were used to test for chloroplast
integration of transgenes (9). The 3P primer anneals to the native
chloroplast genome within the 16S rRNA gene. The 3M primer anneals
to the aadA gene (FIG. 52a). Nuclear transformants could be
distinguished because 3P will not anneal and mutants were
identified because 3M will not anneal. Thus, the 3P and 3M primers
will only yield a product (1.65 kb) from true chloroplast
integrants (FIG. 52c).
[0710] The integration of the transgenes was further tested by
using the 5P and 2M primer pairs for PCR analysis. The 5P and 2M
primers anneal to the internal region of the aadA gene and the
internal region of the trnA gene, respectively, as shown in FIG.
52a (9). The product size of a positive clone is 3.9 kb for PA,
while the mutants and the control do not show any product. FIG. 52d
shows the result of the 5P/2M PCR analysis. After PCR analysis
using both primer pairs, the transgenic plants were subsequently
transferred through different rounds of selection to obtain mature
plants and reach homoplasmy.
[0711] Southern blot analysis of transgenic plants. The plants that
tested positive by PCR analysis were moved through three rounds of
selection and were then evaluated by Southern analysis. The
flanking sequence probe (0.81 kb, FIG. 52b) allowed detection of
the site-specific integration of the gene cassette into the
chloroplast genome (9). FIG. 52a shows the BglII sites used for the
restriction digestion of the chloroplast DNA for pLD-VK1. The
transformed chloroplast genome digested with BglII produced
fragments of 5.2 kb and 3.0 kb for pLDVK1 (FIG. 52e), while the
untransformed chloroplast genome that had been digested with BglII
formed a 4.4-kb fragment. The flanking sequence probe can also show
if homoplasmy of the chloroplast genome had been achieved through
the three rounds of selection. The plants expressing PA showed
slight degree of heteroplasmy in one or two transgenic lines, as
few of the wild-type genomes were not transformed. This is not
uncommon and could be eliminated by germinating seeds on stringent
selection medium containing 500 .mu.g/ml spectinomycin. The
gene-specific probe with a size of approximately 0.52 kb was used
to show the specific gene integration producing a 3-kb fragment
containing the pagA gene as shown in FIG. 52f.
[0712] Immunoblot detection of PA expression. To determine whether
the transgenic plants were producing PA, immunoblot analysis was
performed on leaf extracts. Probing blots with anti-PA monoclonal
antibody revealed ful-length 83-kDa protein (FIG. 53a). PA has
protease-sensitive sequences at residues 164 and 314 that are
easily cleaved by trypsin and chymotrypsin, respectively, resulting
in polypeptides of 63 kDa and 20 kDa (for trypsin) or 47 kDa and 37
kDa (for chymotrypsin).
[0713] The absence of these or other such bands demonstrates that
PA is intact within the chloroplast (FIG. 53a). The supernatant
samples from wild-type plants did not show any band, indicating
that anti-PA antibodies did not cross-react with any plant proteins
in the crude extract.
[0714] Quantification of PA using ELISA. The PA protein expression
levels of pLD-VK1 plants of T0 generation reached up to 4.5% of TSP
in mature leaves under normal illumination conditions (16 h of
light and 8 h of dark, FIG. 53b). The psbA regulatory sequences,
including the promoters and UTRs, have been shown to enhance
translation and accumulation of foreign proteins under continuous
light (12). Therefore, the pLD-VK1 transgenic lines were exposed to
continuous light an expression patterns were determined on days 1,
3, 5, and 7 (FIG. 53b). PA expression levels reached a maximum of
14.2% of the TSP in mature leaves at the end of day 5 and the
expression levels declined to 11.7% TSP on day 7. The larger amount
of PA in mature leaves is probably due to the high number of
chloroplasts in mature leaves and the high copy number of
chloroplast genomes (up to 10,000 copies per cell). The decrease in
PA expression in bleached old leaves could be due to degradation of
the proteins during senescence. These results show that
approximately 1.8 mg PA can be obtained per gram fresh weight of
mature leaf upon exposure to 5-day continuous illumination. Thus,
approximately 150 mg of PA can be obtained from a single plant and
with 8,000 tobacco plants on an acre of land, 1.2 kg of PA can be
obtained per single cutting of tobacco plant (petit Havana variety,
Table 1). Upon three cuttings in a year, a total of 3.6 kg of PA
can be obtained. Assuming a loss of 50% during purification and 5
fig PA per dose (current vaccine dose is in a range of 1.75 to 7
.mu.g PA) (17), a total of 360 million doses of vaccine can be
obtained per acre of land. The commercial cultivar yields 40 metric
tons biomass of fresh leaves as opposed to 2.2 tons in experimental
cultivar petit Havana (7). Therefore, the commercial cultivar is
expected to give 18-fold-higher yields than the experimental
cultivar. Thus an acre of land grown with transgenic tobacco plants
would yield vaccine sufficient for a very large population.
Functional Analysis of PA with Macrophage Cytotoxicity Assay.
[0715] FIG. 54a shows the Coomassie-stained gel of crude leaf
extracts and various purification fractions and the absence of PA
in the flowthrough. The expression level of PA is so high that it
can be observed in a Coomassie-stained gel even in crude plant
extracts. FIG. 54b is a Coomassie-stained gel showing fractions of
purified and concentrated chloroplast derived PA used for
immunization studies. Supernatant samples from crude extracts of
plant leaves expressing PA and partially purified
chloroplast-derived PA were tested for functionality in vitro using
the well-defined macrophage lysis assay (16). The transgenic plants
were shown to produce fully functional PA (FIG. 55). Crude extracts
of wild-type tobacco plant and plant extraction buffer were used as
negative controls. The crude extract of plant leaves expressing PA
had activity equal to that of a 20-11 g/ml solution of purified B.
anthracis-derived PA. These results show that the PA expressed in
plants has high functional activity.
[0716] Immunization of BALB/c mice. Having confirmed that the
chloroplast-derived PA has in vitro biological activity comparable
to that of the B. anthracis-derived PA, we proceeded further to
investigate the functionality in vivo. For this, seven groups each
consisting of five mice were injected s.c. with 5 .mu.g of the
antigen on days 0, 14, 28, and 140. The group I and group 2 mice,
immunized with chloroplast-derived partially purified PA and with
B. anthracis-derived fully purified PA, respectively, both adsorbed
to alhydrogel adjuvant, showed comparable IgG immune titers of
about 1:300,000 (FIG. 56a). These observations are comparable to
those of earlier studies where anti-PA titers up to 1:250,000 were
observed in guinea pigs immunized with PA along with adjuvant (4).
The observation that the chloroplast-derived PA and PA derived from
B. anthracis show comparable immune responses suggests that the
plant-derived PA has been properly folded and was fully functional.
The group that received partially purified chloroplast-derived PA
without adjuvant showed titers ranging from 1:10,000 to 1:40,000,
while the mice that received PA derived from B. anthracis without
adjuvant showed titers of 1:80,000 to 1:160,000. Previous studies
showed that mice immunized s.c. with recombinant PA (rPA) derived
from B. anthracis along with the adjuvant had significant antibody
titers, while no significant immune response was observed in the
group immunized with PA alone (13). Similarly, guinea pigs
immunized s.c. with rPA derived from B. subtilis did not elicit a
significant IgG immune response, while rPA with alhydrogel adjuvant
showed significant levels of IgG titers above 1:15,000 (20). Taken
together, these studies show that PA alone may not be a potent
immunogen to elicit a significant immune response and therefore all
currently used anthrax vaccines contain an adjuvant.
[0717] The difference between the immune responses between the two
groups immunized with chloroplast-derived PA and B.
anthracis-derived PA could be due to differences in the purities of
the proteins. The level of purity was extremely high in PA derived
from B. anthracis because of the use of anion-exchange and gel
filtration chromatography and fast protein liquid chromatography
(FPLC) to eliminate the breakdown products of the PA (21), whereas
chloroplast-derived PA was purified by affinity chromatography
without using protease inhibitors. In the presence of adjuvant, PA
binds to the alhydrogel via electrostatic forces (21), making it
more stable against proteolytic degradation. Differences in the
titer values of the groups that received PA with and without
adjuvant were probably due to depot effect (2) and due to the
alhydrogel's nonspecific priming of the immune system. The group
that received transgenic plant crude extracts expressing PA with
adjuvant showed IgG titers ranging from 1:40,000 to 1:80,000. In
spite of significant levels of impurities in the crude extract,
this group showed good immune titers, confirming high expression
levels of PA in transgenic leaves.
[0718] Toxin neutralization assay of serum samples. In order to
evaluate the functionality of the IgG antibodies produced in
response to the immunization, sera from the mice were tested for
their ability to neutralize PA and thereby protect macrophages
against LT killing. Toxin neutralization assays were performed on
two different sets of sera. The first set was drawn 15 days after
the third immunization dose (day 43 of postinitial immunization),
and the second set was drawn 15 days after the fourth immunization
dose (day 155 of post-initial immunization). Sera obtained after
the third dose (FIG. 56b) showed similar neutralization titers for
the mice immunized with chloroplast-derived PA or B.
anthracis-derived PA when both proteins were administered with
adjuvant (1:10,000 to 1:100,000). These observations are in
agreement with the results obtained in earlier studies where
neutralization titers of 20,000 to 70,000 were obtained when guinea
pigs were immunized with PA derived from B. anthracis along with
adjuvant (4). However, titers were slightly higher for B.
anthracis-derived PA used in conjunction with adjuvant in bleeds
after the fourth immunization (FIG. 56c). The mice immunized with
chloroplast-derived PA alone showed significantly smaller
neutralization titers (between 1:100 and 1:1,000) than the mice
immunized with B. anthracis-derived PA alone (1:10,000 to 1:200,000
after the third immunization and 1:10,000 to 1:50,000 after the
fourth immunization, FIGS. 56b and c). Mice immunized with the
crude extracts of PA-expressing leaves showed strong neutralization
titers, ranging from 1:500 to 1:7500, with the exception of a
single mouse after the fourth immunization (FIG. 56c). Control mice
immunized with wild-type plant leaf crude extract or PBS did not
show any immune response or neutralization ability. Generally, the
average neutralization titers compared among different groups
showed similar distribution patterns to that of the average anti-PA
immune titers determined by the ELISA. These results show that
there is good correlation between the anti-PA antibody levels and
neutralization titers.
[0719] Toxin challenge of BALB/c mice. We proceeded to test the
immunized mice for their ability to survive challenge with
1.5.times.100% lethal dose (LDI00) of LT (22). Mice immunized with
the chloroplast or B. anthracis-derived PA with adjuvant survived
the toxin challenge. Mice immunized with crude extracts of plants
expressing PA showed a significant survival rate of 80%, confirming
high PA expression levels. In this group, 4 out of 5 mice showed
neutralization titers above 1:1,000. These studies demonstrate the
immunoprotective properties of chloroplast-derived PA against
anthrax LT challenge. The single mouse in this group that showed a
neutralization titer below 1:150 may have been the one to succumb.
None of the mice immunized with chloroplast-derived PA without
adjuvant survived (FIG. 57), as expected from their low
neutralization titers (FIGS. 56b and c). The comparison of
neutralization titers to mouse challenge survival for all the
groups seems to indicate neutralization titers at and above 1:1,000
result in protection against challenge with greater than LD100
doses of LT. These results prove the immunogenic and
immunoprotective properties of plant-derived B. anthracis PA. Prior
studies did not investigate functionality of plant-derived PA in
animal studies (3, 30). The production of anti-PA IgG antibodies
combined with in vitro neutralization and toxin challenge studies
shows that immunization with transgenic chloroplast-derived PA is
highly effective. Plant-derived recombinant PA is free of EF and LF
and easy to produce, without the need for expensive fermenters.
Even with 50% loss during purification, 1 acre of transgenic plants
can produce 360 million doses of functional anthrax vaccine. Our
studies open the door for possible oral immunization through
feeding of edible plant parts like carrot roots, which should
effectively stimulate the mucosal immune system as well as a
systemic immune response, thereby offering better protection
against pathogens that attack through mucosa. Delivering vaccines
in edible plants can potentially eliminate existing vaccine
purification and processing steps, cold storage and transportation
requirements, and the need for health professionals for vaccine
delivery. Although foreign genes have been expressed in
chromoplasts of edible plant parts (18), there is no report of
expressing vaccine antigens in non-green plastids present within
edible tissues so far. In addition to maternal inheritance of
transgenes engineered via the chloroplast genomes (8), cytoplasmic
male sterility has been developed as another fail-safe mechanism
for biological containment of transgenes (27). Furthermore,
successful engineering of several foreign operons via the
chloroplast genome (24) has opened the door for development of
multivalent vaccines.
REFERENCES
[0720] 1. Ascenzi, P., P. Visca, G. Ippolito, A. Spallarossa, M.
Bolognesi, and C. Montecucco. 2002. Anthrax toxin: a tripartite
lethal combination. FEBS Lett. 531:384-388. [0721] 2. Audibert, F.
2003. Adjuvants for vaccines, a quest. Int. Immunopharmacol.
3:1187-1193. [0722] 3. Aziz, M. A., S. Singh, P. Anand Kumar, and
R. Bhatnagar. 2002. Expression of protective antigen in transgenic
plants: a step towards edible vaccine against anthrax. Biochem.
Biophys. Res. Coinuun. 299:345-351. [0723] 4. Cohen, S., I.
Mendelson, Z. Altboum, D. Kobiler, E. Elhanany, T. Bino, M.
Leitner, I. Inbar, H. Rosenberg, Y. Gozes, R. Barak, M. Fisher, C.
Kronman, B. Velan, and A. Shafferman. 2000. Attenuated
nontoxinogenic and nonencapsulated recombinant Bacillus anthracis
spore vaccines protect against anthrax. Infect. Immun.
68:4549-4558. [0724] 5. Collier, R. J., and J. A. Young. 2003.
Anthrax toxin. Annu. Rev. Cell Dev. Biol. 19:45-70. [0725] 6.
Coulson, N. M., M. Fulop, and R. W. Titball. 1994. Bacillus
anthracis protective antigen, expressed in Salmonella typhimurium
SL 3261, affords protection against anthrax spore challenge.
Vaccine 12:1395-1401. [0726] 7. Cramer, C. L., J. G. Boothe, and K.
K. Oishi. 1999. Transgenic plants for therapeutic proteins: linking
upstream and down stream strategies. Curr. Top. Microbiol. Immunol.
240:95-118. [0727] 8. Daniell, H.2002. Molecular strategies for
gene containment in transgenic crops. Nat. Biotechnol. 20:581-587.
[0728] 9. Daniell, H., A. Dhingra, and O. N. Ruiz. 2004.
Chloroplast genetic engineering to confer desired plant traits.
Methods Mol. Biol. 286:111-137. [0729] 10. Daniell, H., S. B. Lee,
T. Panchal, and P. O. Wiebe. 2001. Expression of cholera toxin B
subunit gene and assembly as functional oligomers in transgenic
tobacco chloroplasts. J. Mol. Biol. 311:1001-1009. [0730] 11.
DeCosa, B., W. Moar, S. B. Lee, M. Miller, and H. Daniell. 2001.
Overexpression of the Btcry2Aa2 operon in chloroplasts leads to
formation of insecticidal crystals. Nat. Biotechnol. 19:71-74.
[0731] 12. Fernandez-San Millan, A., A. M. Mingeo-Castel, M.
Miller, and H. Daniell. 2003. A chloroplast transgenic approach to
hyper-express and purify human serum albumin, a protein highly
susceptible to proteolytic degradation. Plant Biotechnol. J.
1:71-79. [0732] 13. Gaur, R., P. K. Gupta, A. C. Banerjea, and Y.
Singh. 2002. Effect of nasal immunization with protective antigen
of Bacillus anthracis on protective immune response against anthrax
toxin. Vaccine 20:2836-2839. [0733] 14. Geier, D. A., and R. M.
Geier. 2002. Anthrax vaccination and joint related adverse
reactions in light of biological warfare scenarios. Clin. Exp.
Rheumatol. 20:217-220. [0734] 15. Gupta, P., S. M. Waheed, and R.
Bhatnagar. 1999. Expression and purification of the recombinant
protective antigen of Bacillus anthracis. Protein Expr. Purif.
16:369-376. [0735] 16. Hanna, P. C., D. Acosta, and R. J. Collier.
1993. On the role of macrophages in anthrax. Proc. Natl. Acad. Sci.
USA 90:10198-10201. [0736] 17. Kaufmann, A. F., M. I. Meltzer, and
G. P. Schnid. 1997. The economic impact of a bioterrorist attack:
are prevention and postattack intervention programs justifiable?
Emerg. Infect. Dis. 3:83-94. [0737] 18. Kumar, S., A. Dhingra, and
H. Daniell. 2004. Plastid-expressed betainealdehyde dehydrogenase
gene in carrot cultured cells, roots, and leaves confers enhanced
salt tolerance. Plant Physiol. 136:2843-2854. [0738] 19. Leppla, S.
H., J. B. Robbins, R. Schneerson, and J. Shiloach. 2002.
Development of an improved vaccine for anthrax. J. Clin. Investig.
109:141-144. [0739] 20. McBride, B. W., A. Mogg, J. L. Telfer, M.
S. Lever, J. Miller, P. C. Turnbull, and L. Baillie. 1998.
Protective efficacy of a recombinant protective antigen against
Bacillus anthracis challenge and assessment of immunological
markers. Vaccine 16:810-817. [0740] 21. Miller, J., B. W. McBride,
R. J. Manchee, P. Moore, and L. W. J. Baillie. 1998. Production and
purification of recombinant protective antigen and protective
efficacy against Bacillus anthracis. Lett. Appl. Microbiol.
26:5660. [0741] 22. Moayeri, M., N. W. Martinez, J. Wiggins, H. A.
Young, and S. H. Leppla. 2004. Mouse susceptibility to anthrax
lethal toxin is influenced by genetic factors in addition to those
controlling macrophage sensitivity. Infect. Immun. 72:4439-4447.
[0742] 23. Molina, A., S. Herva-Stubbs, H. Daniell, A. M.
Mingo-Castel, and J. Veramendi. [0743] 2004. High yield expression
of a viral peptide animal vaccine in transgenic tobacco
chloroplasts. Plant Biotechnol. J. 2:141-153. [0744] 24.
Quesada-Vargas, T., 0. N. Ruiz, and H. Daniell. 2005.
Characterization of heterologous multigene operons in transgenic
chloroplasts: transcription, processing, translation. Plant
Physiol. 138:1746-1762. [0745] 25. Quinn, C. P., V. A. Semenova, C.
M. Elie, S. Romero-Steiner, C. Greene et al. 2002. Specific,
sensitive, and quantitative enzyme-linked immunosorbent assay for
human immunoglobulin G antibodies to anthrax toxin protective
antigen. Emerg. Infect. Dis. 8:1103-1110. [0746] 26. Ramirez, D.
M., S. R. Leppla, R. Schneerson, and J. Shiloach. 2002. Production,
recovery and immunogenicity of the protective antigen from a
recombinant strain of Bacillus anthracis. J. Ind. Microbiol.
Biotechnol. 28: 232-238. [0747] 27. Ruiz, O. N., and R. Daniell.
2005. Engineering cytoplasmic male sterility via the chloroplast
genome. Plant Physiol. 138:1232-1246. [0748] 28. Ruiz, O. N., H.
Hussein, N. Terry, and H. Daniell. 2003. Phytoremediation of
organomercurial compounds via chloroplast genetic engineering.
Plant Physiol. 132:1344-1352. [0749] 29. Sever, J. L., A. L.
Brenner, A. D. Gale, J. M. Lyle, L. H. Moulton et al. 2002. Safety
of anthrax vaccine: a review by the Anthrax Vaccine Expert
Committee (AVEC) of adverse events reported to the Vaccine Adverse
Event Reporting System (VAERS). Pharmacoepidemiol. Drug Saf 11:
189-202. [0750] 30. Watson, J., V. Koya, S. H. Leppla, and H.
Daniell. 2004. Expression of Bacillus anthracis protective antigem
in transgenic chloroplasts of tobacco, a non-food/feed crop.
Vaccine 22:4374-4384. [0751] 31. Whiting, G. C., S. Rijpkema, T.
Adams and M. J. Corbel. 2004. Characterisation of adsorbed anthrax
vaccine by two-dimensional gel electrophoresis. Vaccine
22:4245-4251. [0752] 32. Zegers, N. D., E. Kluter, H. van Der Stap,
E. van Dura, P. van Dalen, M. Shaw, and L. Baillie. 1999.
Expression of the protective antigen of Bacillus anthracis by
Lactobacillus casei: towards the development of an oral vaccine
against anthrax. J. Appl. Microbiol. 87:309-314.
[0753] Finally, while various embodiments of the present invention
have been shown and described herein, it will be obvious that such
embodiments are provided by way of example only. Numerous
variations, changes and substitutions may be made without departing
from the invention herein. Accordingly, it is intended that the
invention be limited only by the spirit and scope of the appended
claims. The teachings of all patents and other references cited
herein are incorporated herein by reference in their entirety to
the extent they are not inconsistent with the teachings herein.
* * * * *
References