U.S. patent application number 12/136927 was filed with the patent office on 2008-10-23 for soluble interleukin-1 receptor accessory molecule.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Daniel P. Bednarik, Henrik S. Olsen, Craig A. Rosen.
Application Number | 20080261252 12/136927 |
Document ID | / |
Family ID | 34810412 |
Filed Date | 2008-10-23 |
United States Patent
Application |
20080261252 |
Kind Code |
A1 |
Bednarik; Daniel P. ; et
al. |
October 23, 2008 |
Soluble Interleukin-1 Receptor Accessory Molecule
Abstract
The present invention relates to a novel soluble IL-1 receptor
accessory molecule (IL-1R AcM) protein which is a member of the Ig
superfamily. In particular, isolated nucleic acid molecules are
provided encoding the human IL-1R AcM protein. IL-1R AcM
polypeptides are also provided as are vectors, host cells and
recombinant methods for producing the same. Screening methods are
further provided for identifying agonist and antagonists of IL-1
signal transduction. The invention further relates to methods for
treating physiologic and pathologic disease conditions with IL-1R
AcM antagonists.
Inventors: |
Bednarik; Daniel P.;
(Highland, MD) ; Olsen; Henrik S.; (Gaithersburg,
MD) ; Rosen; Craig A.; (Laytonsville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
34810412 |
Appl. No.: |
12/136927 |
Filed: |
June 11, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11066006 |
Feb 25, 2005 |
7390880 |
|
|
12136927 |
|
|
|
|
08917710 |
Aug 26, 1997 |
6974682 |
|
|
11066006 |
|
|
|
|
60024581 |
Aug 26, 1996 |
|
|
|
Current U.S.
Class: |
435/7.92 ;
435/331; 530/387.3; 530/387.9; 530/391.3 |
Current CPC
Class: |
C07H 21/04 20130101;
C07K 14/7155 20130101 |
Class at
Publication: |
435/7.92 ;
530/387.9; 530/387.3; 530/391.3; 435/331 |
International
Class: |
G01N 33/53 20060101
G01N033/53; C07K 16/18 20060101 C07K016/18; C12N 5/06 20060101
C12N005/06 |
Claims
1. An isolated antibody or fragment thereof that specifically binds
to a protein selected from the group consisting of: (a) a
polypeptide whose amino acid sequence consists of amino acid
residues -17 to 339 of SEQ ID NO:2; (b) a polypeptide whose amino
acid sequence consists of amino acid residues 1 to 339 of SEQ ID
NO:2; (c) a polypeptide comprising the full-length IL-1R AcM
polypeptide encoded by cDNA clone contained in ATCC.TM. Deposit No.
97666; (d) a polypeptide comprising the mature IL-1R AcM
polypeptide encoded by cDNA clone contained in ATCC.TM. Deposit No.
97666; (e) a polypeptide whose amino acid sequence consists of a
portion of SEQ ID NO:2, wherein said portion is at least 30
contiguous amino acid residues in length; and (f) a polypeptide
whose amino acid sequence consists of a portion of SEQ ID NO:2,
wherein said portion is at least 50 contiguous amino acid residues
in length.
2. The antibody or fragment thereof of claim 1 that specifically
binds protein (a).
3. The antibody or fragment thereof of claim 1 that specifically
binds protein (b).
4. The antibody or fragment thereof of claim 1 that specifically
binds protein (c).
5. The antibody or fragment thereof of claim 1 that specifically
binds protein (d).
6. The antibody or fragment thereof of claim 1 that specifically
binds protein (e).
7. The antibody or fragment thereof of claim 1 that specifically
binds protein (f).
8. The antibody or fragment thereof of claim 2 that specifically
binds protein (b).
9. The antibody or fragment thereof of claim 3 wherein said protein
bound by said antibody or fragment thereof is glycosylated.
10. The antibody or fragment thereof of claim 3 wherein said
antibody or fragment thereof is human.
11. The antibody or fragment thereof of claim 3 wherein said
antibody or fragment thereof is polyclonal.
12. The antibody or fragment thereof of claim 3 wherein said
antibody or fragment thereof is monoclonal.
13. The antibody or fragment thereof of claim 3 which is selected
from the group consisting of: (a) a chimeric antibody or fragment
thereof; (b) a humanized antibody or fragment thereof; (c) a single
chain antibody; and (d) a Fab fragment.
14. The antibody or fragment thereof of claim 3 which is
labeled.
15. The antibody or fragment thereof of claim 3 wherein said
antibody or fragment thereof specifically binds to said protein in
a Western blot or an ELISA.
16. An isolated cell that produces the antibody or fragment thereof
of claim 3.
17. A hybridoma that produces the antibody or fragment thereof of
claim 3.
18. A method of detecting IL-1R AcM protein in a biological sample
comprising: (a) contacting the biological sample with the antibody
or fragment thereof of claim 3; and (b) detecting the IL-1R AcM
protein in the biological sample.
19. An isolated antibody or fragment thereof that specifically
binds a IL-1R AcM protein purified from a cell culture wherein said
IL-1R AcM protein is encoded by a polynucleotide encoding amino
acids -17 to 339 of SEQ ID NO:2.
20. The antibody or fragment thereof of claim 19 wherein said
antibody or fragment thereof is monoclonal.
21. The antibody or fragment thereof of claim 19 wherein said
antibody or fragment thereof is polyclonal.
22. The antibody or fragment thereof of claim 19 wherein said
antibody or fragment thereof is human.
23. The antibody or fragment thereof of claim 19 which is selected
from the group consisting of: (a) a chimeric antibody or fragment
thereof; (b) a humanized antibody or fragment thereof; (c) a single
chain antibody; and (d) a Fab fragment.
24. The antibody or fragment thereof of claim 19 wherein said
antibody or fragment thereof specifically binds to said protein in
a Western blot or an ELISA.
25. The antibody or fragment thereof of claim 19 wherein the amino
acid sequence of said IL-1R AcM protein consists of amino acid
residues 1 to 339 of SEQ ID NO:2.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/066,006, filed Feb. 25, 2005, which is a divisional of
U.S. patent application Ser. No. 08/917,710, filed Aug. 26, 1997,
which claims the benefit of the filing date of provisional
application 60/024,581 filed on Aug. 26, 1996, each of which is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a novel soluble
Interleukin-1 receptor accessory molecule (IL-1R AcM). IL-1R AcM is
a member of the Ig superfamily by analysis of its putative
extracellular domain and bears limited homology throughout the
protein to both Type I and Type II IL-1 receptors. More
specifically, isolated nucleic acid molecules are provided encoding
a human microvascular endothelial-derived soluble IL-1R AcM. The
IL-1R AcM polypeptides are also provided. The present invention
further relates to screening methods for putative agonists and
antagonists of IL-1 signal transduction.
[0003] Interleukin 1 (IL-1) is a polypeptide cytokine with multiple
diverse effects on immunological and inflammatory processes. While
many of the roles of IL-1 in inflammation and the immune response
have been well characterized, the molecular basis of these
responses remains unclear (reviewed by Dinarello, Blood, 77:
1627-1652). IL-1 is produced by a diversity of cell types and
elicits a wide variety of physiological effects in hematopoetic and
nonhematopoetic cells. Thus, IL-1 has biological effects on
hematopoietic cells, the digestive tract, bone, cartilage and
connective tissue, vascular cells, the skin, the endocrine system,
the gonads, and on neural tissue. In addition, IL-1 is produced by
malignant cells. (Pimentel, Handbook of Growth Factors: Volume III
Hematopoietic Growth Factors and Cytokines, pp. 35-53, CRC Press,
Boca Raton, Fla. 1994).
[0004] The IL-1 family of proteins comprises three members:
IL-1.alpha. and IL-1.beta. (capable of inducing IL-1 biological
responses) and IL-1ra (a pure receptor antagonist). These ligands
bind to two distinct and separate receptors: the Type I and Type II
IL-1 receptors (IL-1Rs). The 80-kD Type I IL-1R is found mainly on
T cells and fibroblasts (Sims, J. E., et al., Science 241:585-589
(1988); Chizzonite, R., et al., Proc. Natl. Acad. Sci. USA
86:8029-8033 (1989); Sims, J. E., et al., Proc. Natl. Acad, Sci.
USA 86:8946-8950 (1989)). The 68-kD Type II IL-1R is found
predominantly on B cells and neutrophils (Chizzonite, R., et al.,
Proc. Natl. Acad. Sci. USA 86:8029-8033 (1989); Sims, J. E., et
al., Proc. Natl. Acad. Sci. USA 86:8946-8950 (1989); McMahan, C.
J., et al., EMBO J. 10:2821-2832 (1991)). Both receptor types
contain a large cytoplasmic region, a single transmembrane domain,
and three extracellular Ig-like domains, a structural organization
that classifies them as members of the Ig superfamily. The Type I
IL-1R has a cytoplasmic tail of approximately 200 amino acids,
while the Type II IL-1R cytoplasmic tail is only 29 amino acids.
The agonists IL-1.alpha. and IL-1.beta. bind to the extracellular
domains of both receptors, although with different affinities
(reviewed in Dower et al., Cellular and Molecular Mechanisms of
Inflammation, pp. 137-172, Academic Press, Orlando Fla.).
[0005] The relative importance of the Type I and Type II IL-1Rs in
IL-1 signaling has been recently clarified. A critical role for the
Type I IL-1R in IL-1-induced activation of NF-.kappa.B, IL-6, and
IL-8 secretion, and cell adhesion molecule expression has been
demonstrated by several groups (Stylianou, E., et al., J. Biol.
Chem. 267:15836-15841 (1992); Colotta, F., et al., Science
261:472-475 (1993); Sims, J. E., et al., Proc. Natl. Acad. Sci. USA
90:6155-6159 (1993)). In contrast, the Type II IL-1R appears to be
dispensable for IL-1 signaling and may act as a decoy receptor
(Stylianou, E., et al., J. Biol. Chem. 267:15836-15841 (1992);
Colotta, F., et al., Science 261:472-475 (1993); Sims, J. E., et
al., Proc. Natl. Acad. Sci. USA 90:6155-6159 (1993)). While it
appears clear that the Type I IL-1R is necessary for IL-1 signal
transduction, it is uncertain if it is the only cell-surface
molecule involved in IL-1 signaling.
[0006] It has been assumed that the functional Type I IL-1R is a
single chain receptor (Curtis, B. M., et al., Proc. Natl. Acad.
Sci. USA, 86:3045-3049 (1989)). However, affinity cross-linking of
IL-1 to cells expressing natural IL-1 receptor has yielded complex
patterns of cross-linked proteins (Dower, et al., Cellular and
Molecular Mechanisms of Inflammation, pp. 137-172, Academic Press,
Orlando Fla. (1990); Dinarello, et al., Immunol. Today, 10:
49-51(1989)). These cross-linking studies detect molecular mass
complexes consistent with both the Type I and Type II IL-1Rs
cross-linked to IL-1. In addition, in some studies, higher
molecular mass complexes (>200 kD) are apparent (Kupper, T. S.,
et al., J. Clin. Invest. 82:1787-1792 (1988); Dinarello, C. A., et
al., Immunol. Today 10:49-51 (1989); Solari, R., Cytokine 2:21-28
(1990); Mancilla, J., et al., Lymph. Cytokine Res. 11:197-205
(1992)). Some reports have interpreted these higher molecular mass
complexes to be dimers of receptor-ligand complexes. Others have
concluded that these high molecular mass complexes maybe indicative
of a multi-subunit IL-1 receptor complex.
[0007] Only two IL-1R accessory proteins are have been identified.
Studies initiated to identify components of a potential IL-1
receptor complex suggest that there is a cell-surface protein in
close association with the IL-1R that may play a role in IL-1
receptor binding and signaling. A murine IL-1 receptor accessory
protein (mulL-1R AcP) has been cloned and expressed (Greenfeder et
al. J. Biol. Chem, 270: 13757-13765 (1995)). This protein was
present in brain, lung, spleen, and thymus tissues. A search of the
GenBank data base with the mulL-1R AcP cDNA sequence revealed
significant homology (82%) to a cDNA isolated from human infant
brain (accession no. T08277) (Adams, M. D., et al., Nature Genet.
4:373-380 (1993)). No other significant homologies were found in
GenBank. The reported sequence for this partial cDNA is 396 bp long
and represents one of 1600 cDNAs that were sequenced from a library
made to contain only expressed sequence tags. The regions to
overlap with the muL-1R AcP sequence is nucleotides 893-1286 of the
muIL-R AcP, which include the transmembrane domain. Although Adams
et al. (Adams, M. D., et al., Nature Genet. 4:373-380 (1993))
assigned no function to this partial cDNA, it is likely that it
encodes a portion of a human homologue of mulIL-1R AcP. Using the
mulIL-1R AcP cDNA has >95% homology to the partial sequence of
Adams et al and .about.90% homology to the muL-1R AcP cDNA. This
partial cDNA was isolated as an expressed gene in infant brain.
This was consistent with Northern analysis results of Greenfeder et
al. demonstrating that mulIL-1R AcP mRNA is constitutively
expressed at high levels in mouse brain.
[0008] The discovery of IL-1R accessory molecule has a number of
implications for IL-1 receptor biology. First, while muIL-1R AcM
may not bind IL-1 directly, the accessory molecule forms a complex
with the muType I IL-1R allowing IL-1.beta. to bind with higher
affinity than the muType I IL-1R alone (Greenfeder, et al. J. Biol.
Chem, 270: 13757-13765 (1995)). Thus, the presence or absence of
the accessory molecule in different cell lines determined whether
the low or the higher affinity site was detected, suggesting that
the low affinity site corresponds to the muType I IL-1R alone,
while the higher affinity site represents a complex of the muType I
IL-1R with the muIL-1R AcM. (Greenfeder, et al. J. Biol. Chem,
270:13757-13765 (1995)). In this respect, the IL-1R AcM would be
analogous to affinity conversion and signal transduction subunits
such as gp 130 in the IL-6 system (Hibi, M., et al., Cell
63:1149-1157 (1990)), the common .beta. chain of the IL-3,
granulocyte/macrophage colony-stimulating factor, and IL-5
receptors (Kitamura, T., et al., Cell 66:1165-1174 (1991)), and the
.gamma..sub.c subunit first identified as part of the IL-2 receptor
(reviewed in Minami, et al., Annu. Rev. Immunol. 11: 245-267
(1993)).
[0009] Second, the possible existence of a multi-subunit IL-1
receptor complex contradicts a previous hypothesis that the Type I
IL-1R is the entire functional receptor for IL-1 signaling (Dower,
S. K. & Sims, J. E., Cellular and Molecular Mechanisms of
Inflammation, Academic Press, Orlando, Fla. (1990), pp. 137-172;
Curtis, B. M., et al., Proc. Natl. Acad. Sci. USA, 86:3045-3049
(1989)). This hypothesis was based on the observation that CHO
cells expressing recombinant murine Type I IL-1R were more
sensitive than control CHO cells to low concentrations of IL-1, and
that the increase in sensitivity was proportional to the number of
murine Type I IL-1Rs (Curtis, B. M., et al., Proc. Natl. Acad. Sci.
USA, 86:3045-3049 (1989)). An alternative explanation for these
results is that the endogenous hamster IL-1R, was able to form a
functional receptor complex with the mu Type I IL-1R, thus
enhancing IL-1 signaling in the transfected cells (Greenfeder, et
al. J. Biol. Chem, 270: 13757-13765 (1995)).
[0010] Third, the discovery of the accessory protein provides an
intriguing explanation for the antagonist activity of IL-1ra
despite its high affinity binding to the Type I IL-1R. The
inability of IL-1ra to interact with the muIL-1R AcP, the putative
signal transducing subunit of the IL-1R complex, would result in
the absence of a biological response.
BRIEF SUMMARY OF THE INVENTION
[0011] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding the soluble IL-1R
AcM polypeptide having the amino acid sequence as shown in FIG. 1A
(SEQ ID NO:2) or the amino acid sequence encoded by the cDNA clone
deposited as ATCC.TM. Deposit Number 97666 on Jul. 25, 1996. The
nucleotide sequence determined by sequencing the deposited IL-1R
AcM clone, which is shown in FIGS. 1A-B (SEQ ID NO:1), contains an
open reading frame encoding a polypeptide of 356 amino acid
residues, including an initiation codon at positions 303-305, with
a leader sequence of about 17 amino acid residues, and a predicted
molecular weight of about 42 kDa. The amino acid sequence of the
mature IL-1R AcM protein is amino acid residues 18-356 shown in
FIGS. 1A-B or 1-339 shown in SEQ ID NO:2.
[0012] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of soluble IL-1R AcM polypeptides or
peptides by recombinant techniques.
[0013] The invention further provides an isolated soluble IL-1R AcM
polypeptide having amino acid sequence encoded by a polynucleotide
described herein.
[0014] The soluble IL-1R AcM may not bind IL-1 directly, however,
the accessory molecule forms a complex with the Type I IL-1R that
binds IL-1.beta. with higher affinity than the Type I IL-1R alone.
Thus, the presence or absence of the accessory molecule in
different cell lines determines whether the low or the higher
affinity site is detected suggesting that the low affinity site
corresponds to the Type I IL-1R alone, while the higher affinity
site represents a complex of the Type I IL-1R with the IL-1R AcM.
The present invention further provides a screening method for
identifying IL-1 receptor agonists and antagonists, which involves:
(a) providing a polypeptide comprising a Type I IL-1 receptor and a
polypeptide comprising IL-1R AcM or IL-1R AcM fragment, wherein
IL-1R and IL-1R AcM or IL-1R and the IL-1R AcM fragment form a
complex; (b) providing a candidate compound; (c) providing a
polypeptide comprising IL-1 or a functional Il-1 fragment; and (d)
determining the binding affinity of said complex for IL-1 whereby
an increased binding affinity of said complex for IL-1 in the
presence of said compound is indicative that said compound is an
agonist for IL-1 signal transduction and a decreased binding
affinity of said complex for IL-1 in the presence of said compound
is indicative that said compound is an antagonist of IL-1 signal
transduction.
BRIEF DESCRIPTION OF THE FIGURES
[0015] FIGS. 1A-B shows the nucleotide [SEQ ID NO:1] and deduced
amino acid [SEQ ID NO:2] sequences of soluble IL-1R AcM. The
protein has a leader sequence of about 17 amino acid residues
(underlined) and a deduced molecular weight of about 42 kDa. The
predicted amino acid sequence of the mature soluble IL-1R AcM
protein is also shown in FIG. 1A [SEQ ID NO:2].
[0016] FIGS. 2A and B shows the regions of similarity between the
amino acid sequences of the soluble IL-1R AcM protein (HMEEJ22) and
mouse interleukin 1 receptor accessory protein [SEQ ID NO:3] and
between the amino acid sequences of the soluble IL-1R AcM protein
(HMEEJ22) and the partial cDNA isolated from human infant brain
(Adams, M. D., et al., Nature Genet. 4:373-380 (1993)) [SEQ ID
NO:4].
[0017] FIG. 3 shows an analysis of the IL-1R AcM amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown. The amino acid sequence of
the IL-1R AcM protein is shown with the amino acids that border
each peak from the "Antigenic Index--Jameson-Wolf" plot displayed
as underlined characters.
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding soluble IL-1R AcM
polypeptide, having the amino acid sequence shown in FIG. 1A [SEQ
ID NO:2], which was determined by sequencing a cloned cDNA. The
soluble IL-1R AcM protein of the present invention shares sequence
homology with mouse interleukin 1 receptor accessory protein (FIG.
2A) [SEQ ID NO:3]. The nucleotide sequence shown in FIGS. 1A-B [SEQ
ID NO:1] was obtained by sequencing the HMEEJ22 clone, which was
deposited on Jul. 25, 1996 at the American Type Culture Collection,
Patent Depository, 10801 University Boulevard, Manassas, Va.
20110-2209, and given accession number 97666. The deposited clone
is inserted in the pBluescript SK(-) plasmid (Stratagene, La Jolla,
Calif.).
[0019] Accordingly, in one embodiment of the present invention,
isolated nucleic acid molecules are provided which encode the
soluble IL-1R AcM protein. The IL-1R AcM is a novel member of the
Ig superfamily.
Nucleic Acid Molecules
[0020] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0021] Using the information provided herein, such as the
nucleotide sequence in FIGS. 1A-B, a nucleic acid molecule of the
present invention encoding a soluble IL-1R AcM polypeptide may be
obtained using standard cloning and screening procedures, such as
those for cloning cDNAs using mRNA as starting material.
Illustrative of the invention, the nucleic acid molecule described
in FIGS. 1A-B [SEQ ID NO:1] was discovered in a cDNA library
derived from human microvascular endothelial cells. The determined
nucleotide sequence of the soluble IL-1R AcM cDNA of FIGS. 1A-B
[SEQ ID NO:1] contains an open reading frame encoding a protein of
356 amino acid residues, with an initiation codon at positions
303-306 of the nucleotide sequence in FIGS. 1A-B [SEQ ID NO:1], a
predicted leader sequence of about 17 amino acid residues, and a
deduced molecular weight of about 42 kDa. The amino acid sequence
of the predicted mature soluble IL-1R AcM is amino acid residue 18
to residue 356 shown in FIG. 1A or amino acids 1-339 shown in SEQ
ID NO:2. The soluble IL-1R AcM protein shown in FIG. 1A [SEQ ID
NO:2] is about 94% similar and 85% identical to mouse interleukin 1
accessory protein (FIG. 2A). In addition, the nucleotides 1060 to
1353 of soluble IL-1R AcM protein shown in FIG. 1A [SEQ ID NO:2] is
about 99% similar and 98% identical to the first 294 nucleotides
partial cDNA isolated from human infant brain by Adams, M. D., et
al., Nature Genet. 4:373-380 (1993) [SEQ ID NO:4] (FIG. 2B). The
partial cDNA isolated by Adams was 396 nucleotides in length.
[0022] The present invention also provides the mature form(s) of
the soluble IL-1R AcM protein of the present invention. According
to the signal hypothesis, proteins secreted by mammalian cells have
a signal or secretory leader sequence which is cleaved from the
mature protein once export of the growing protein chain across the
rough endoplasmic reticulum has been initiated. Most mammalian
cells and even insect cells cleave secreted proteins with the same
specificity. However, in some cases, cleavage of a secreted protein
is not entirely uniform, which results in two or more mature
species on the protein. Further, it has long been known that the
cleavage specificity of a secreted protein is ultimately determined
by the primary structure of the complete protein, that is, it is
inherent in the amino acid sequence of the polypeptide. Therefore,
the present invention provides a nucleotide sequence encoding the
mature soluble IL-1 R AcM polypeptides having the amino acid
sequence encoded by the cDNA clone identified as ATCC.TM. Deposit
No. 97666 and as shown in SEQ ID NO:2. By the mature soluble IL-1R
AcM protein having the amino acid sequence encoded by the cDNA
clone contained in the host identified as ATCC.TM. Deposit 97666 is
meant the mature form(s) of the soluble IL-1R AcM protein produced
by expression in a mammalian cell (e.g., COS cells, as described
below) of the complete open reading frame encoded by the human DNA
sequence of the clone contained in the vector. As indicated below,
the mature soluble IL-1R AcM having the amino acid sequence encoded
by the cDNA clone contained in ATCC.TM. Deposit No. 97666 may or
may not differ from the predicted "mature" soluble IL-1R AcM
protein shown in SEQ ID NO:2 (amino acids from about 1 to about
339) depending on the accuracy of the predicted cleavage site based
on computer analysis.
[0023] Methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are
available. For instance, the methods of McGeoch (Virus Res.
3:271-286 (1985)) and von Heinje (Nucleic Acids Res. 14:4683-4690
(1986)) can be used. The accuracy of predicting the cleavage points
of known mammalian secretory proteins for each of these methods is
in the range of 75-80%. von Heinje, supra. However, the two methods
do not always produce the same predicted cleavage point(s) for a
given protein.
[0024] In the present case, the predicted amino acid sequence of
the complete soluble IL-1 R AcM polypeptides of the present
invention were analyzed by a computer program ("PSORT") (K. Nakai
and M. Kanehisa, Genomics 14:897-911 (1992)), which is an expert
system for predicting the cellular location of a protein based on
the amino acid sequence. As part of this computational prediction
of localization, the methods of McGeoch and von Heinje are
incorporated. The analysis by the PSORT program predicted the
cleavage site between amino acids -1 and 1 in SEQ ID NO:2.
Thereafter, the complete amino acid sequences were further analyzed
by visual inspection, applying a simple form of the (-1, -3) rule
of von Heinje. von Heinje, supra. Thus, the leader sequence for the
soluble IL-1R AcM protein is predicted to consist of amino acid
residues from about -17 to about -1 in SEQ ID NO:2, while the
mature soluble IL-1R AcM protein is predicted to consist of
residues from about 1 to about 339.
[0025] As one of ordinary skill would appreciate, due to the
possibilities of sequencing errors discussed above, as well as the
variability of cleavage sites for leaders in different known
proteins, the actual soluble IL-1R AcM polypeptide encoded by the
deposited cDNA comprises about 356 amino acids, but may be anywhere
in the range of 345-370 amino acids; and the actual leader sequence
of this protein is about 17 amino acids, but may be anywhere in the
range of about 10 to about 20 amino acids.
[0026] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA or RNA may be the coding
strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
[0027] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically.
[0028] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) with
an initiation codon at positions 303-306 of the nucleotide sequence
shown in FIGS. 1A-B [SEQ ID NO:1]; DNA molecules comprising the
coding sequence for the mature soluble IL-1R AcM protein shown in
FIG. 1A (last 339 amino acids) [SEQ ID NO:2]; and DNA molecules
which comprise a sequence substantially different from those
described above but which, due to the degeneracy of the genetic
code, still encode the soluble IL-1R AcM protein. Of course, the
genetic code is well known in the art. Thus, it would be routine
for one skilled in the art to generate the degenerate variants
described above.
[0029] In addition, the invention provides nucleic acid molecules
having nucleotide sequences related to extensive portions of SEQ ID
NO:1 which have been determined from the following related cDNA
clones: HE8MI45R (SEQ ID NO:5), HWEBD79F (SEQ ID NO:6), HSJBY21R
(SEQ ID NO:7), HCE4Z93R (SEQ ID NO:8), HTEBZ03RA (SEQ ID NO:9).
[0030] Sequences of public ESTs that relate to a portion of SEQ ID
NO:1 have the following GenBank Accession Numbers: T70598 (SEQ ID
NO:10), W85847 (SEQ ID NO:11), T83863 (SEQ ID NO:12), T08277 (SEQ
ID NO:13), T70863 (SEQ ID NO:14), H80590 (SEQ ID NO:15), H80533
(SEQ ID NO:16), R35902 (SEQ ID NO:17), T91161 (SEQ ID NO:18),
D79417 (SEQ ID NO:19), R35903 (SEQ ID NO:20), R78680 (SEQ ID NO:21)
and W85846 (SEQ ID NO:22).
[0031] In another aspect, the invention provides isolated nucleic
acid molecules encoding the soluble IL-1R AcM polypeptide having an
amino acid sequence encoded by the cDNA clone contained in the
plasmid deposited as ATCC.TM. Deposit No. 97666 on Jul. 25, 1996.
In a further embodiment, nucleic acid molecules are provided
encoding the mature soluble IL-1R AcM polypeptide or the
full-length soluble IL-1R AcM polypeptide lacking the N-terminal
methionine. The invention also provides an isolated nucleic acid
molecule will encode the mature polypeptide encoded by the
above-described deposited cDNA clone. The invention further
provides an isolated nucleic acid molecule having the nucleotide
sequence shown in FIGS. 1A-B [SEQ ID NO:1] or the nucleotide
sequence of the soluble IL-1R AcM cDNA contained in the
above-described deposited clone, or a nucleic acid molecule having
a sequence complementary to one of the above sequences. Such
isolated molecules, particularly DNA molecules, are useful as
probes for gene mapping, by in situ hybridization with chromosomes,
and for detecting expression of the soluble IL-1R AcM gene in human
tissue, for instance, by Northern blot analysis.
[0032] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having the nucleotide sequence
of the deposited cDNA or the nucleotide sequence shown in SEQ ID
NO:1 is intended fragments at least about 15 nt, and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably, at least about 40 nt in
length which are useful as diagnostic probes and primers as
discussed herein. Of course, larger fragments 50, 75, 100, 125,
150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450,
475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775,
800, 825, 850, 875, 900, 925, 950, 975, 1000, 1500 or 2100 nt in
length are also useful according to the present invention as are
fragments corresponding to most, if not all, of the nucleotide
sequence of the deposited cDNA or as shown in SEQ ID NO:1. By a
fragment at least 20 nt in length, for example, is intended
fragments which include 20 or more contiguous bases from the
nucleotide sequence of the deposited cDNA or the nucleotide
sequence as shown in SEQ ID NO:1.
[0033] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clone contained in ATCC.TM.
Deposit 97666. By "stringent hybridization conditions" is intended
overnight incubation at 42.degree. C. in a solution comprising: 50%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times.Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times.SSC at about
65.degree. C.
[0034] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0035] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
the deposited cDNA or the nucleotide sequence as shown in SEQ ID
NO:1). Of course, a polynucleotide which hybridizes only to a poly
A sequence (such as the 3' terminal poly(A) tract of the soluble
IL-1R AcM cDNA shown in SEQ ID NO:1), or to a complementary stretch
of T (or U) resides, would not be included in a polynucleotide of
the invention used to hybridize to a portion of a nucleic acid of
the invention, since such a polynucleotide would hybridize to any
nucleic acid molecule containing a poly (A) stretch or the
complement thereof (e.g., practically any double-stranded cDNA
clone).
[0036] Since a soluble IL-1R AcM cDNA clone has been deposited and
its determined nucleotide sequence is provided in FIGS. 1A-B [SEQ
ID NO:1], generating polynucleotides which hybridize to a portion
of the soluble IL-1R AcM cDNA molecule would be routine to the
skilled artisan. For example, restriction endonuclease cleavage or
shearing by sonication of the soluble IL-1R AcM cDNA clone could
easily be used to generate DNA portions of various sizes which are
polynucleotides that hybridize to a portion of the soluble IL-1R
AcM cDNA molecule. Alternatively, the hybridizing polynucleotides
of the present invention could be generated synthetically according
to known techniques. Of course, a polynucleotide which hybridizes
only to a poly A sequence (such as the 3' terminal poly(A) tract of
the soluble IL-1R AcM cDNA shown in FIG. 1B [SEQ ID NO:1]), or to a
complementary stretch of T (or U) resides, would not be included in
a polynucleotide of the invention used to hybridize to a portion of
a nucleic acid of the invention, since such a polynucleotide would
hybridize to any nucleic acid molecule containing a poly (A)
stretch or the complement thereof (e.g., practically any
double-stranded cDNA clone).
[0037] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the soluble IL-1R AcM protein. In particular, isolated nucleic acid
molecules are provided encoding polypeptides comprising the
following amino acid residues in FIG. 1A (SEQ ID NO:2), which the
present inventors have determined are antigenic regions of the
soluble IL-1R AcM protein: In particular, such nucleic acid
fragments of the present invention include nucleic acid molecules
encoding: a polypeptide comprising amino acid residues from about 6
to about 15 in SEQ ID NO:2; a polypeptide comprising amino acid
residues from about 57 to about 66 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 70 to about 79 in SEQ ID
NO:2; a polypeptide comprising amino acid residues from about 106
to about 112 in SEQ ID NO:2; a polypeptide comprising amino acid
residues from about 115 to about 124 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 129 to about 135 in SEQ
ID NO:2; a polypeptide comprising amino acid residues from about
158 to about 172 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 180 to about 187 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 207 to about
215 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 231 to about 244 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 247 to about 255 in SEQ
ID NO:2; a polypeptide comprising amino acid residues from about
268 to about 276 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 285 to about 295 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 303 to about
310 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 319 to about 330 in SEQ ID NO:2; and a polypeptide
comprising amino acid residues from about 333 to about 339 in SEQ
ID NO:2. Methods for generating such epitope-bearing portions of
soluble IL-1R AcM are described in detail below.
[0038] As indicated, nucleic acid molecules of the present
invention which encode a soluble IL-1R AcM polypeptide may include,
but are not limited to those encoding the amino acid sequence of
the mature polypeptide, by itself; the coding sequence for the
mature polypeptide and additional sequences, such as those encoding
the about 17 amino acid leader or secretory sequence, such as a
pre-, or pro- or prepro-protein sequence; the coding sequence of
the mature polypeptide, with or without the aforementioned
additional coding sequences, together with additional, non-coding
sequences, including for example, but not limited to introns and
non-coding 5' and 3' sequences, such as the transcribed,
non-translated sequences that play a role in transcription, mRNA
processing, including splicing and polyadenylation signals, for
example--ribosome binding and stability of mRNA; an additional
coding sequence which codes for additional amino acids, such as
those which provide additional functionalities. Thus, the sequence
encoding the polypeptide may be fused to a marker sequence, such as
a sequence encoding a peptide which facilitates purification of the
fused polypeptide. In certain preferred embodiments of this aspect
of the invention, the marker amino acid sequence is a
hexa-histidine peptide, such as the tag provided in a pQE vector
(Qiagen, Inc.), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for
convenient purification of the fusion protein. The "HA" tag is
another peptide useful for purification which corresponds to an
epitope derived from the influenza hemagglutinin protein, which has
been described by Wilson et al., Cell 37: 767 (1984). As discussed
below, other such fusion proteins include the soluble IL-1R AcM
fused to Fc at the N- or C-terminus.
[0039] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the soluble IL-1R AcM protein.
Variants may occur naturally, such as a natural allelic variant. By
an "allelic variant" is intended one of several alternate forms of
a gene occupying a given locus on a chromosome of an organism.
Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques.
[0040] Such variants include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions
or additions may involve one or more nucleotides. The variants may
be altered in coding regions, non-coding regions, or both.
Alterations in the coding regions may produce conservative or
non-conservative amino acid substitutions, deletions or additions.
Especially preferred among these are silent substitutions,
additions and deletions, which do not alter the properties and
activities of the soluble IL-1R AcM protein or portions thereof.
Also especially preferred in this regard are conservative
substitutions. Most highly preferred are nucleic acid molecules
encoding the mature protein having the amino acid sequence shown in
FIG. 1A [SEQ ID NO:2] or the mature soluble IL-1R AcM amino acid
sequence encoded by the deposited cDNA clone.
[0041] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 90% identical, and more preferably at
least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide
sequence encoding the polypeptide having the amino acid sequence in
SEQ ID NO:2; (b) a nucleotide sequence encoding the polypeptide
having the amino acid sequence in SEQ ID NO:2, but lacking the
N-terminal methionine; (c) a nucleotide sequence encoding the
polypeptide having the amino acid sequence at positions from about
1 to about 339 in SEQ ID NO:2; (d) a nucleotide sequence encoding
the polypeptide having the amino acid sequence encoded by the cDNA
clone contained in ATCC.TM. Deposit No. 97666; (e) a nucleotide
sequence encoding the mature soluble IL-1R AcM polypeptide having
the amino acid sequence encoded by the cDNA clone contained in
ATCC.TM. Deposit No. 97666; or (f) a nucleotide sequence
complementary to any of the nucleotide sequences in (a), (b), (c),
(d) or (e).
[0042] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding a soluble IL-1R AcM polypeptide is intended that the
nucleotide sequence of the polynucleotide is identical to the
reference sequence except that the polynucleotide sequence may
include up to five point mutations per each 100 nucleotides of the
reference nucleotide sequence encoding the soluble IL-1R AcM
polypeptide. In other words, to obtain a polynucleotide having a
nucleotide sequence at least 95% identical to a reference
nucleotide sequence, up to 5% of the nucleotides in the reference
sequence may be deleted or substituted with another nucleotide, or
a number of nucleotides up to 5% of the total nucleotides in the
reference sequence may be inserted into the reference sequence.
These mutations of the reference sequence may occur at the 5' or 3'
terminal positions of the reference nucleotide sequence or anywhere
between those terminal positions, interspersed either individually
among nucleotides in the reference sequence or in one or more
contiguous groups within the reference sequence.
[0043] As a practical matter, whether any particular nucleic acid
molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to,
for instance, the nucleotide sequence shown in FIGS. 1A-B or to the
nucleotides sequence of the deposited cDNA clone can be determined
conventionally using known computer programs such as the Bestfit
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, Wis. 53711. Bestfit uses the local homology
algorithm of Smith and Waterman, Advances in Applied Mathematics 2:
482-489 (1981), to find the best segment of homology between two
sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for
instance, 95% identical to a reference sequence according to the
present invention, the parameters are set, of course, such that the
percentage of identity is calculated over the full length of the
reference nucleotide sequence and that gaps in homology of up to 5%
of the total number of nucleotides in the reference sequence are
allowed.
[0044] The present application is directed to nucleic acid
molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in FIGS. 1A-B [SEQ ID NO:1] or to the
nucleic acid sequence of the deposited cDNA, irrespective of
whether they encode a polypeptide having soluble IL-1R AcM
activity. This is because even where a particular nucleic acid
molecule does not encode a polypeptide having soluble IL-1R AcM
activity, one of skill in the art would still know how to use the
nucleic acid molecule, for instance, as a hybridization probe or a
polymerase chain reaction (PCR) primer. Uses of the nucleic acid
molecules of the present invention that do not encode a polypeptide
having soluble IL-1R AcM activity include, inter alia, (1)
isolating the soluble IL-1R AcM gene or allelic variants thereof in
a cDNA library; (2) in situ hybridization (e.g., "FISH") to
metaphase chromosomal spreads to provide precise chromosomal
location of the soluble IL-1R AcM gene, as described in Verma et
al., Human Chromosomes: A Manual of Basic Techniques, Pergamon
Press, New York (1988); and (3) Northern Blot analysis for
detecting soluble IL-1R AcM mRNA expression in specific
tissues.
[0045] Preferred, however, are nucleic acid molecules having
sequences at least 90%, 95%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in FIGS. 1A-B [SEQ ID NO:1] or to the
nucleic acid sequence of the deposited cDNA which do, in fact,
encode a polypeptide having soluble IL-1R AcM protein activity. By
"a polypeptide having soluble IL-1R AcM activity" is intended
polypeptides exhibiting activity similar, but not necessarily
identical, to an activity of the soluble IL-1R AcM protein of the
invention (either the full-length protein or, preferably, the
mature protein), as measured in a particular biological assay.
Assays of IL-1R AcM protein activity are well-known to those in the
art. These assays can be used to measure IL-1R AcM protein activity
of partially purified or purified native or recombinant protein.
For example, an equilibrium and competitive binding studies using
CHO stable cell lines (Greenfeder et al., J. Biol. Chem. 270:
13757-13765 (1995)) can be performed to detect IL-1R AcM
activity.
[0046] For this assay, a CHO-IR/AcM cell line is established by
simultaneous cotransfection of two expression vectors such that
both IL-1R and IL-1R AcM or a candidate IL-1R AcMare expressed at
about a 1:10 ratio of molecules/cell. In addition, control cell
lines which express only IL-1R or IL-1R AcM are also established.
To establish the stable cell lines, CHO-dhfr.sup.- cells are
maintained in DMEM with 10% fetal bovine serum, 25 mM HEPES, pH
7.0, 0.1 mML glutamine, 1.times.HT supplement (0.1 mM hypoxanthine,
0.016 mM thymidine) (Boehringer Mannheim), 50 .mu.g/ml gentamicin,
1.times.penicillin/streptomycin/fungizone (JRH Biosciences). Cells
are transfected with pSV2-dhfr (Subramani, et al. Mol. Cell. Biol.
1: 845-864 (1981)) either alone or in combination with expression
vectors containing IL-1R, IL-1R AcM protein and a candidate IL-1R
AcM protein by the CaPO.sub.4 method following the manufacturer's
directions (Stratagene). After three days, cells are transferred to
medium lacking HT and allowed to grow an additional two weeks.
Transfectants are then subjected to gene amplification by growth in
increasing doses of methotrexate (0.1-1.0 .mu.M). Clones are
isolated by limiting dilution and screened by equilibrium binding
with .sup.125I-labeled IL-1, anti-IL-1R antibody or anti-IL-1R AcM
antibody
[0047] To characterize the number and affinities of IL-1.beta.
binding sites, each of the above generated cell lines are analyzed
by equilibrium binding with .sup.125I-labeled IL-1.beta..
Equilibrium binding of .sup.125I-labeled IL-1 to the cells can
performed as described by Mizel, et al. J. Immunol. 138: 2906-2912
(1987). .sup.125I labeling of IL-1.beta. can be performed by
methods well known to those skilled in the art, for example, as
described by Chizzonite, et al. J. Immunol. 147:1548-1556
(1991).
[0048] The activity of the accessory protein, IL-1R AcM, can be
examined in the binding of IL-1.beta. to a CHO-IR/AcM cell line
obtained above. It is desirable for this cell line to express an
excess amount of IL-1R AcM protein relative to IL-1R. Cell lines
bearing only IL-1R AcM protein do not bind IL-1, and cell lines
bearing only IL-R will bind IL-1.beta. with low affinity (i.e.,
approximately K.sub.D 1.0-3.3 nM). A CHO-IR/AcM cell line, bearing
both the IL-1R and IL-1R AcM results in IL-1R having a higher
affinity binding site (i.e., approximately K.sub.D 0.02-0.8 nM).
Thus, one can monitor the presence of IL-1R AcM activity by testing
whether the putative accessory protein interacts with the IL-1R so
as to generate a high affinity IL-1.beta. binding site. The IL-1R
AcM protein of the present invention can serve as a reference for
the assay for IL-1R AcM activity associated with the high affinity
IL-1R binding state.
[0049] In addition to the above described assay, one can evaluate
whether a candidate polypeptide has IL-1R AcM activity by
performing simple binding kinetics can be measured to determine
receptor affinity for the ligand (i.e., IL-1.beta.). Binding
kinetic analysis experiments are well known to those skilled in the
art (Chizzonite et al., Proc. Natl. Acad. Sci. 86:8029-8033 (1989);
Mizel, et al., J. Immunol. 138:2906-2912 (1987)). One can monitor
the presence of IL-1R AcM activity by testing whether the putative
accessory protein interacts with the IL-1R so as to result in high
affinity binding of IL-1.beta. to the receptor. The IL-1R AcM
protein of the present invention can serve as a reference for the
assay for IL-1R AcM activity associated with the high affinity
IL-1R binding state.
[0050] Thus, "a polypeptide having soluble IL-1R AcM protein
activity" includes polypeptides that exhibit IL-1R AcM activity, in
the above-described assay. Although the degree of activity need not
be identical to that of the IL-1R AcM protein, preferably, "a
polypeptide having IL-1R AcM protein activity" will exhibit
substantially similar activity as compared to the IL-1R AcM protein
(i.e., the candidate polypeptide will exhibit greater activity or
not more than about tenfold less and, preferably, not more than
about ten-fold less activity relative to the reference IL-1R AcM
protein).
[0051] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid
sequence of the deposited cDNA or the nucleic acid sequence shown
in FIGS. 1A-B [SEQ ID NO:1] will encode a polypeptide "having
soluble IL-1R AcM protein activity." In fact, since degenerate
variants of these nucleotide sequences all encode the same
polypeptide, this will be clear to the skilled artisan even without
performing the above described comparison assay. It will be further
recognized in the art that, for such nucleic acid molecules that
are not degenerate variants, a reasonable number will also encode a
polypeptide having soluble IL-1R AcM protein activity. This is
because the skilled artisan is fully aware of amino acid
substitutions that are either less likely or not likely to
significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid).
[0052] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that are suprisingly tolerant of amino acid
substitutions.
Vectors and Host Cells
[0053] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of soluble IL-1R AcM polypeptides or fragments
thereof by recombinant techniques.
[0054] Recombinant constructs may be introduced into host cells
using well known techniques such infection, transduction,
transfection, transvection, electroporation and transformation. The
vector may be, for example, a phage, plasmid, viral or retroviral
vector. Retroviral vectors may be replication competent or
replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells.
[0055] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0056] Preferred are vectors comprising cis-acting control regions
to the polynucleotide of interest. Appropriate trans-acting factors
may be supplied by the host, supplied by a complementing vector or
supplied by the vector itself upon introduction into the host.
[0057] In certain preferred embodiments in this regard, the vectors
provide for specific expression, which may be inducible and/or cell
type-specific. Particularly preferred among such vectors are those
inducible by environmental factors that are easy to manipulate,
such as temperature and nutrient additives.
[0058] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors, e.g., vectors
derived from bacterial plasmids, bacteriophage, yeast episomes,
yeast chromosomal elements, viruses such as baculoviruses, papova
viruses, vaccinia viruses, adenoviruses, fowl pox viruses,
pseudorabies viruses and retroviruses, and vectors derived from
combinations thereof, such as cosmids and phagemids.
[0059] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will preferably include a translation
initiating at the beginning and a termination codon (UAA, UGA or
UAG) appropriately positioned at the end of the polypeptide to be
translated.
[0060] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the above-described host cells are known in the
art.
[0061] Among vectors preferred for use in bacteria include pA2,
pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors,
Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A,
pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic
vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from
Stratagene; and pSVK3, pBPV, pMSG and pSVL available from
Pharmacia. Other suitable vectors will be readily apparent to the
skilled artisan.
[0062] Among known bacterial promoters suitable for use in the
present invention include the E. coli lacI and lacZ promoters, the
T3 and T7 promoters, the gpt promoter, the lambda PR and PL
promoters and the trp promoter. Suitable eukaryotic promoters
include the CMV immediate early promoter, the HSV thymidine kinase
promoter, the early and late SV40 promoters, the promoters of
retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and
metallothionein promoters, such as the mouse metallothionein-I
promoter.
[0063] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0064] Transcription of the DNA encoding the polypeptides of the
present invention by higher eukaryotes may be increased by
inserting an enhancer sequence into the vector. Enhancers are
cis-acting elements of DNA, usually about from 10 to 300 bp that
act to increase transcriptional activity of a promoter in a given
host cell-type. Examples of enhancers include the SV40 enhancer,
which is located on the late side of the replication origin at bp
100 to 270, the cytomegalovirus early promoter enhancer, the
polyoma enhancer on the late side of the replication origin, and
adenovirus enhancers.
[0065] For secretion of the translated protein into the lumen of
the endoplasmic reticulum, into the periplasmic space or into the
extracellular environment, appropriate secretion signals may be
incorporated into the expressed polypeptide. The signals may be
endogenous to the polypeptide or they may be heterologous
signals.
[0066] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
may be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine
techniques in the art. A preferred fusion protein comprises a
heterologous region from immunoglobulin that is useful to
solubilize receptors. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in fusion protein is thoroughly advantageous for use in therapy and
diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc pat
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, shIL5-receptor has been fused with Fc portions for the purpose
of high-throughput screening assays to identify antagonists of
hIL-5. See, D. Bennett et al., Journal of Molecular Recognition,
Vol. 8 52-58 (1995) and K. Johanson et al., The Journal of
Biological Chemistry, Vol. 270, No. 16, pp 9459-9471 (1995).
[0067] The soluble IL-1R AcM protein can be recovered and purified
from recombinant cell cultures by well-known methods including
ammonium sulfate or ethanol precipitation, acid extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is
employed for purification. Polypeptides of the present invention
include naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
IL-1R AcM Polypeptides and Fragments
[0068] The invention further provides an isolated soluble IL-1R AcM
polypeptide having the amino acid sequence encoded by the deposited
cDNA, or the amino acid sequence in FIG. 1A [SEQ ID NO:2], or a
peptide or polypeptide comprising a portion of the above
polypeptides. The terms "peptide" and "oligopeptide" are considered
synonymous (as is commonly recognized) and each term can be used
interchangeably as the context requires to indicate a chain of at
least to amino acids coupled by peptidyl linkages. The word
"polypeptide" is used herein for chains containing more than ten
amino acid residues. All oligopeptide and polypeptide formulas or
sequences herein are written from left to right and in the
direction from amino terminus to carboxy terminus.
[0069] It will be recognized in the art that some amino acid
sequences of the soluble IL-1R AcM polypeptide can be varied
without significant effect of the structure or function of the
protein. If such differences in sequence are contemplated, it
should be remembered that there will be critical areas on the
protein which determine activity. In general, it is possible to
replace residues which form the tertiary structure, provided that
residues performing a similar function are used. In other
instances, the type of residue may be completely unimportant if the
alteration occurs at a non-critical region of the protein.
[0070] Thus, the invention further includes variations of the
soluble IL-1R AcM polypeptide which show substantial soluble IL-1R
AcM polypeptide activity or which include regions of soluble IL-1R
AcM protein such as the protein portions discussed below. Such
mutants include deletions, insertions, inversions, repeats, and
type substitutions. As indicated above, guidance concerning which
amino acid changes are likely to be phenotypically silent can be
found in Bowie, J. U., et al., "Deciphering the Message in Protein
Sequences: Tolerance to Amino Acid Substitutions," Science
247:1306-1310 (1990).
[0071] Thus, the fragment, derivative or analog of the polypeptide
of SEQ ID NO:2, or that encoded by the deposited cDNA, may be (i)
one in which one or more of the amino acid residues are substituted
with a conserved or non-conserved amino acid residue (preferably a
conserved amino acid residue) and such substituted amino acid
residue may or may not be one encoded by the genetic code, or (ii)
one in which one or more of the amino acid residues includes a
substituent group, or (iii) one in which the mature polypeptide is
fused with another compound, such as a compound to increase the
half-life of the polypeptide (for example, polyethylene glycol), or
(iv) one in which the additional amino acids are fused to the
mature polypeptide, such as an IgG Fc fusion region peptide or
leader or secretory sequence or a sequence which is employed for
purification of the mature polypeptide or a proprotein sequence.
Such fragments, derivatives and analogs are deemed to be within the
scope of those skilled in the art from the teachings herein.
[0072] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the
soluble IL-1R AcM protein. The prevention of aggregation is highly
desirable. Aggregation of proteins not only results in a loss of
activity but can also be problematic when preparing pharmaceutical
formulations, because they can be immunogenic. (Pinckard et al.,
Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes
36:838-845 (1987); Cleland et al. Crit. Rev. Therapeutic Drug
Carrier Systems 10:307-377 (1993)).
[0073] The replacement of amino acids can also change the
selectivity of binding to or interaction with cell surface
receptors. Ostade et al., Nature 361:266-268 (1993) describes
certain mutations resulting in selective binding of TNF-.alpha. to
only one of the two known types of TNF receptors. Thus, the soluble
IL-1R AcM of the present invention may include one or more amino
acid substitutions, deletions or additions, either from natural
mutations or human manipulation.
[0074] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0075] Of course, the number of amino acid substitutions a skilled
artisan would make depends on many factors, including those
described above. Generally speaking, the number of substitutions
for any given soluble IL-1R AcM polypeptide will not be more than
50, 40, 30, 25, 20, 15, 10, 5 or 3.
[0076] Amino acids in the soluble IL-1R AcM protein of the present
invention that are essential for function can be identified by
methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting
mutant molecules are then tested for biological activity such as
receptor binding or in vitro, or in vitro proliferative activity.
Sites that are critical for ligand-receptor binding or interaction
can also be determined by structural analysis such as
crystallization, nuclear magnetic resonance or photoaffinity
labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992) and de Vos
et al. Science 255:306-312 (1992)).
[0077] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell. For example, a recombinantly produced version of the
soluble IL-1R AcM polypeptide can be substantially purified by the
one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
[0078] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA including the leader, the
mature polypeptide encoded by the deposited the cDNA minus the
leader (i.e., the mature protein), a polypeptide comprising amino
acids about -17 to about 339 in SEQ ID NO:2; a polypeptide
comprising amino acids about -16 to about 339 in SEQ ID NO:2; a
polypeptide comprising amino acids about 1 to about 339 in SEQ ID
NO:2; as well as polypeptides which are at least 80% identical,
more preferably at least 90% or 95% identical, still more
preferably at least 96%, 97%, 98% or 99% identical to those
described above and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0079] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of a
soluble IL-1R AcM polypeptide is intended that the amino acid
sequence of the polypeptide is identical to the reference sequence
except that the polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the reference amino
acid of the soluble IL-1R AcM polypeptide. In other words, to
obtain a polypeptide having an amino acid sequence at least 95%
identical to a reference amino acid sequence, up to 5% of the amino
acid residues in the reference sequence may be deleted or
substituted with another amino acid, or a number of amino acids up
to 5% of the total amino acid residues in the reference sequence
may be inserted into the reference sequence. These alterations of
the reference sequence may occur at the amino or carboxy terminal
positions of the reference amino acid sequence or anywhere between
those terminal positions, interspersed either individually among
residues in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0080] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequence shown in FIG. 1A [SEQ ID NO:2] or to the
amino acid sequence encoded by deposited cDNA clone can be
determined conventionally using known computer programs such the
Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, Wis. 53711. When using Bestfit or any other
sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0081] The polypeptide of the present invention could be used as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0082] As described in detail below, the polypeptides of the
present invention can also be used to raise polyclonal and
monoclonal antibodies, which are useful in assays for detecting
soluble IL-1R AcM protein expression as described below or as
agonists and antagonists capable of enhancing or inhibiting soluble
IL-1R AcM protein function. Further, such polypeptides can be used
in the yeast two-hybrid system to "capture" soluble IL-1R AcM
protein binding proteins which are also candidate agonist and
antagonist according to the present invention. The yeast two hybrid
system is described in Fields and Song, Nature 340:245-246
(1989).
[0083] In another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide of the invention.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. These immunogenic epitopes are believed to be confined
to a few loci on the molecule. On the other hand, a region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." The number of immunogenic epitopes of a
protein generally is less than the number of antigenic epitopes.
See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1983).
[0084] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Learner, R. A.
(1983) Antibodies that react with predetermined sites on proteins.
Science 219:660-666. Peptides capable of eliciting protein-reactive
sera are frequently represented in the primary sequence of a
protein, can be characterized by a set of simple chemical rules,
and are confined neither to immunodominant regions of intact
proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl
terminals.
[0085] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. See, for instance, Wilson et al., Cell 37:767-778
(1984) at 777.
[0086] Antigenic epitope-bearing peptides and polypeptides of the
invention designed according to the above guidelines preferably
contain a sequence of at least seven, more preferably at least nine
and most preferably between about 15 to about 30 amino acids
contained within the amino acid sequence of a polypeptide of the
invention.
[0087] Non-limiting examples of antigenic polypeptides or peptides
that can be used to generate soluble IL-1R AcM-specific antibodies
include the following: a polypeptide comprising amino acid residues
from about 6 to about 15 in SEQ ID NO:2; a polypeptide comprising
amino acid residues from about 57 to about 66 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 70 to about
79 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 106 to about 112 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 115 to about 124 in SEQ
ID NO:2; a polypeptide comprising amino acid residues from about
129 to about 135 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 158 to about 172 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 180 to about
187 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 207 to about 215 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 231 to about 244 in SEQ
ID NO:2; a polypeptide comprising amino acid residues from about
247 to about 255 in SEQ ID NO:2; a polypeptide comprising amino
acid residues from about 268 to about 276 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 285 to about
295 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 303 to about 310 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 319 to about 330 in SEQ
ID NO:2; and a polypeptide comprising amino acid residues from
about 333 to about 339 in SEQ ID NO:2.
[0088] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. Houghten, R.
A. (1985) General method for the rapid solid-phase synthesis of
large numbers of peptides: specificity of antigen-antibody
interaction at the level of individual amino acids. Proc. Natl.
Acad. Sci. USA 82:5131-5135. This "Simultaneous Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Pat. No.
4,631,211 to Houghten et al. (1986).
[0089] As one of skill in the art will appreciate, soluble IL-1R
AcM polypeptides of the present invention and the epitope-bearing
fragments thereof described above can be combined with parts of the
constant domain of immunoglobulins (IgG), resulting in chimeric
polypeptides. These fusion proteins facilitate purification and
show an increased half-life in vivo. This has been shown, e.g., for
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins (EPA 394,827;
Traunecker et al., Nature 331:84-86 (1988)). Fusion proteins that
have a disulfide-linked dimeric structure due to the IgG part can
also be more efficient in binding and neutralizing other molecules
than the monomeric soluble IL-1R AcM protein or protein fragment
alone (Fountoulakis et al., J. Biochem 270:3958-3964 (1995)).
Screening Applications of Soluble IL-1R AcM
[0090] The present inventors believe that soluble IL-1R AcM is
involved in IL-1 activity and that it forms a complex with the Type
I IL-1R allowing IL-1.beta. to bind with higher affinity than to
the Type I IL-1R alone. Thus, the presence or absence of the
accessory molecule in different cell lines may determine whether
the low or the high affinity site in the Type I IL-1R is formed.
The low affinity site corresponds to the Type I IL-1R alone, while
the higher affinity site represents a complex of the Type I IL-1R
with the IL-1R AcM. Given that IL-1 has many diverse effects on
immunologic and inflammatory process and that IL-1 elicits a wide
variety of effects in hematic and nonhematic cells, it would be of
interest to identify agonist and antagonist for IL-1 activity.
IL-1R AcM may to be necessary for IL-1 signal transduction events
and may to be required for the formation of a high affinity IL-1R
binding state. Stable cell lines established by simultaneous
cotransfection of two expression vectors such that both IL-1R and
IL-1R AcM are expressed at a 1:10 ratio of molecules/cell and
control cell lines which express only IL-1R or IL-1R AcM could be
used in screening assays to identify potential agonists and
antagonists for IL-1. Thus, the present invention further provides
a screening method of identifying IL-1 receptor agonists, which
involves: (a) providing a host cell containing recombinant genes
which express a polypeptide comprising a Type I IL-1 receptor and a
polypeptide comprising IL-1R AcM or a IL-1R AcM fragment, wherein
IL-1R and IL-1R AcM or an IL-1R AcM fragment form a complex; (b)
administering a candidate agonist to said cell; and (c) determining
the binding affinity of said complex for said candidate agonist
relative to the binding of said comples for IL-1.
[0091] To characterize candidate IL-1R agonist binding to IL-1R,
each of the cell lines are analyzed by equilibrium binding with
.sup.125I-labeled IL-1.beta.. Equilibrium binding of
.sup.125I-labeled IL-1.beta. to the cells can performed as
described by Mizel, et al. J. Immunol. 138: 2906-2912 (1987) and
Greenfeder et al., J. Biol. Chem. 270:13757-13765 (1995). The
activity of the candidate agonist, can be examined relative to the
binding of IL-1.beta. to a CHO-IR/AcM cell line (as described,
supra). It is desirable for this cell line to express an excess
amount of IL-1R AcM protein relative to IL-1R. Cell lines bearing
only IL-1R AcM protein will not bind IL-1.beta. and cell lines
bearing only IL-R bind IL-1.beta. with low affinity (i.e., on the
order of K.sub.D 1.0-3.3nM). A CHO-IR/AcM cell line, bearing both
the IL-1R and IL-1R AcM results in the IL-1R having a higher
affinity binding site (i.e., on the order of K.sub.D 0.02-0.8 nM).
Thus, one can monitor the relative binding affinity of the
candidate agonist relative to the IL-1.beta.. The presence of the
IL-1R AcM protein of the present invention in the cell line used
for agonist screening ensures that the IL1-R is in a high affinity
binding state.
[0092] In a further aspect, the invention provides a screening
method of identifying an IL-1 signal transduction antagonist. The
results of Greenfeder, et al. (J. Biol. Chem, 270: 13757-13765
(1995)) suggest that the antagonist IL-1ra prevents or disrupts
formation of a complex between muIL-1R and muIL-1R AcP. Thus, the
screening method for identifying other antagonist of signal
transduction which involves: (a) providing a host cell containing
recombinant genes which express a polypeptide comprising a Type I
IL-1 receptor and a polypeptide comprising IL-1R AcM or an IL-1R
AcM fragment, wherein IL-1R and IL-1R AcM or IL-1R and the IL-1R
AcM fragment form a complex; (b) administering a candidate
antagonist to said cell; and (c) determining the whether said
candidate antagonist disrupts or prevents formation of a complex
between IL-1R and IL-1R AcM or IL-1R and the IL-1R AcM
fragment.
[0093] In this antagonist screening assay, one can measure the
formation of complex between IL-1R and IL-1R AcM by
immunoprecipitating labeled protein complexes cross-linked to
IL-1.beta., IL-1ra or the candidate antagonist. Using an anti-Type
I IL-1R mAb or an anti-IL-1R AcM mAb, a protein complex of >200
kDa range will be observed for the cross linking reaction when
IL-1.beta. is used as a ligand indicating formation of an IL-1
binding complex. In addition, these antibodies will
immunoprecipitate labeled IL1.beta.. However, when labeled IL-1ra
or a candidate antagonist is used as ligand, the anti-IL-1R AcM mAb
will not immunoprecipitate the labeled agonist. Rather, the
anti-IL-1R AcM antibody will only precipitate an IL-1ra or a
candidate antagonist complex in the 100-120 kDa range indicating
that the IL-1R and IL-1R AcM have not formed a complex.
Alternative Screening Assay
[0094] The present invention further provides a screening method
for identifying IL-1 receptor agonists and antagonists, which
involves: (a) providing a polypeptide comprising a Type I IL-1
receptor and a polypeptide comprising IL-1R AcM or IL-1R AcM
fragment, wherein IL-1R and IL-1R AcM or IL-1R and the IL-1R AcM
fragment form a complex; (b) providing a candidate compound; (c)
providing a polypeptide comprising IL-1 or a functional IL-1
fragment; and (d) determining the binding affinity of said complex
for IL-1 whereby an increased binding affinity of said complex for
IL-1 in the presence of said compound is indicative that said
compound is an agonist for IL-1 signal transduction and a decreased
binding affinity of said complex for IL-1 in the presence of said
compound is indicative that said compound is an antagonist of IL-1
signal transduction.
Candidate Agonists and Antagonists
[0095] Candidate antagonists and agonist according to the present
invention include IL-1ra, polypeptides and antibodies that either
enhance or inhibit formation of the IL-1R IL-1R AcM complex. For
example, an antibody that inhibits the murine IL-1R-IL-1R accessory
protein complex is described in Greenfeder, et al. J. Biol. Chem,
270: 13757-13765 (1995). In addition, antibodies directed against
murine Type I IL-1 receptors which block IL-1 activity are
described in Chizzonite et al. Proc. Natl Acad Sci USA 86:8029
(1989); Lewis et al. Eur. J. Immunol. 20:207 (1990); Dinarello,
Int. J. Clin. Lab. Res. 24:61-79 (1994). In addition, a point
mutation in IL-1ra converts IL-1ra from an antagonist to a partial
agonist of IL-1 activity in Ju et al. Proc. Natl. Acad. Sci USA
88:2658-2662 (1991). Others have developed recombinant IL-1 mutants
with altered activities (Dinarello Blood 77:1627-1652; Gehrke et
al. J. Biol. Chem. 265:5922-5925 (1990)). Thus, methods are known
in the art for developing candidate IL-1R agonists and antagonists
for screening in the present invention.
[0096] Methods for determining agonist or antagonist activity are
known in the art (Ju et al. Proc. Natl. Acad. Sci USA 88:2658-2662
(1991); Dinarello Blood 77:1627-1652; Gehrke et al. J. Biol. Chem.
265:5922-5925 (1990)). Methods for determining whether a candidate
agonist or antagonist enhances or interferes with the formation of
the IL-1 receptor complex between IL-1R and IL-1R AcM is disclosed
in Greenfeder et al., J. Biol. Chem. 270:13757-13765 (1995).
[0097] Administration of the candidate agonist or antagonist can be
exogenous or endogenous and the candidate agonist or antagonist can
be obtained from natural or recombinant sources. In addition, the
screening method further provides for host cells containing
recombinant genes expressing IL-1R and IL-1R AcM, as described
above.
[0098] By "a host cell containing recombinant genes" is intended
host cells which one or more of the recombinant constructs
described herein have been introduced or a progeny of such host
cells.
[0099] In addition, the invention provides antibodies directed to
this accessory molecule which inhibit the interaction of IL-1R with
IL-1R AcM thereby modulating IL-1 response of the cells. These
antibodies could be useful for immunoprecipitating cross-linked
complexes for the antagonist screening assay as well as showing
that the stable cell lines are in fact expressing the Type I IL-1R
and IL-1R AcM proteins. Methods for obtaining these antibodies are
set forth below.
[0100] Soluble IL-1R AcM protein-specific antibodies for use in the
present invention can be raised against the intact soluble IL-1R
AcM protein or an antigenic polypeptide portion thereof, which may
presented together with a carrier protein, such as an albumin, to
an animal system (such as rabbit or mouse) or, if it is long enough
(at least about 25 amino acids), without a carrier.
[0101] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (Mab) is meant to include intact molecules as well as
antibody portions (such as, for example, Fab and F(ab').sub.2
portions) which are capable of specifically binding to soluble
IL-1R AcM protein. Fab and F(ab').sub.2 portions lack the Fc
portion of intact antibody, clear more rapidly from the
circulation, and may have less non-specific tissue binding of an
intact antibody (Wahl et al., J. Nuc. Med. 24:316-325 (1983)).
Thus, these portions are preferred.
[0102] The antibodies of the present invention may be prepared by
any of a variety of methods. For example, cells expressing the
soluble IL-1R AcM protein or an antigenic portion thereof can be
administered to an animal in order to induce the production of sera
containing polyclonal antibodies. In a preferred method, a
preparation of soluble IL-1R AcM protein is prepared and purified
as described above to render it substantially free of natural
contaminants. Such a preparation is then introduced into an animal
in order to produce polyclonal antisera of greater specific
activity.
[0103] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or soluble IL-1R AcM protein
binding portions thereof). Such monoclonal antibodies can be
prepared using hybridoma technology (Kohler et al., Nature 256:495
(1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et
al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., In:
Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp.
563-681 (1981)). In general, such procedures involve immunizing an
animal (preferably a mouse) with a soluble IL-1R AcM protein
antigen or, more preferably, with a soluble IL-1R AcM
protein-expressing cell. Suitable cells can be recognized by their
capacity to bind soluble IL-1R AcM protein antibody. Such cells may
be cultured in any suitable tissue culture medium; however, it is
preferable to culture cells in Earle's modified Eagle's medium
supplemented with 10% fetal bovine serum (inactivated at about
56.degree. C.), and supplemented with about 10 .mu.g/l of
nonessential amino acids, about 1,000 U/ml of penicillin, and about
100 .mu.g/ml of streptomycin. The splenocytes of such mice are
extracted and fused with a suitable myeloma cell line. Any suitable
myeloma cell line may be employed in accordance with the present
invention; however, it is preferable to employ the parent myeloma
cell line (SP.sub.2O), available from the American Type Culture
Collection, Rockville, Md. After fusion, the resulting hybridoma
cells are selectively maintained in HAT medium, and then cloned by
limiting dilution as described by Wands et al. (Gastroenterology
80:225-232 (1981)). The hybridoma cells obtained through such a
selection are then assayed to identify clones which secrete
antibodies capable of binding the soluble IL-1R AcM antigen.
[0104] Alternatively, additional antibodies capable of binding to
the soluble IL-1R AcM protein antigen may be produced in a two-step
procedure through the use of anti-idiotypic antibodies. Such a
method makes use of the fact that antibodies are themselves
antigens, and therefore it is possible to obtain an antibody which
binds to a second antibody. In accordance with this method, soluble
IL-1R AcM protein specific antibodies are used to immunize an
animal, preferably a mouse. The splenocytes of such an animal are
then used to produce hybridoma cells, and the hybridoma cells are
screened to identify clones which produce an antibody whose ability
to bind to the soluble IL-1R AcM protein-specific antibody can be
blocked by the soluble IL-1R AcM protein antigen. Such antibodies
comprise anti-idiotypic antibodies to the soluble IL-1R AcM
protein-specific antibody and can be used to immunize an animal to
induce formation of further soluble IL-1R AcM protein-specific
antibodies.
[0105] It will be appreciated that Fab and F(ab').sub.2 and other
portions of the antibodies of the present invention may be used
according to the methods disclosed herein. Such portions are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab portions) or pepsin (to produce F(ab').sub.2
portions). Alternatively, soluble IL-1R AcM protein-binding
portions can be produced through the application of recombinant DNA
technology or through synthetic chemistry.
[0106] Where in vivo imaging is used to detect enhanced levels of
soluble IL-1R AcM protein for diagnosis in humans, it may be
preferable to use "humanized" chimeric monoclonal antibodies. Such
antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described
above. Methods for producing chimeric antibodies are known in the
art. See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).
[0107] Further suitable labels for the soluble IL-1R AcM
protein-specific antibodies of the present invention are provided
below. Examples of suitable enzyme labels include malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase,
yeast-alcohol dehydrogenase, alpha-glycerol phosphate
dehydrogenase, triose phosphate isomerase, peroxidase, alkaline
phosphatase, asparaginase, glucose oxidase, beta-galactosidase,
ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase,
glucoamylase, and acetylcholine esterase.
[0108] Examples of suitable radioisotopic labels include .sup.3H,
.sup.111In, .sup.125I, .sup.131I, .sup.32P, .sup.35S, .sup.14C,
.sup.51Cr, .sup.57To, .sup.58Co, .sup.59Fe, .sup.75Se, .sup.152Eu,
.sup.90Y, .sup.67Cu, .sup.217Ci, .sup.211At, .sup.212Pb, .sup.47Sc,
.sup.109Pd, etc. .sup.111In is a preferred isotope where in vivo
imaging is used since its avoids the problem of dehalogenation of
the .sup.125I or .sup.131I-labeled monoclonal antibody by the
liver. In addition, this radionucleotide has a more favorable gamma
emission energy for imaging (Perkins et al., Eur. J. Nucl. Med.
10:296-301 (1985); Carasquillo et al., J. Nucl. Med. 28:281-287
(1987)). For example, .sup.111In coupled to monoclonal antibodies
with 1-(P-isothiocyanatobenzyl)-DPTA has shown little uptake in
non-tumorous tissues, particularly the liver, and therefore
enhances specificity of tumor localization (Esteban et al., J.
Nucl. Med. 28:861-870 (1987)).
[0109] Examples of suitable non-radioactive isotopic labels include
.sup.157Gd, .sup.55Mn, .sup.162Dy, .sup.52Tr, and .sup.56Fe.
[0110] Examples of suitable fluorescent labels include an
.sup.152Eu label, a fluorescein label, an isothiocyanate label, a
rhodamine label, a phycoerythrin label, a phycocyanin label, an
allophycocyanin label, an o-phthaldehyde label, and a fluorescamine
label.
[0111] Examples of suitable toxin labels include diphtheria toxin,
ricin, and cholera toxin.
[0112] Examples of chemiluminescent labels include a luminal label,
an isoluminal label, an aromatic acridinium ester label, an
imidazole label, an acridinium salt label, an oxalate ester label,
a luciferin label, a luciferase label, and an aequorin label.
[0113] Examples of nuclear magnetic resonance contrasting agents
include heavy metal nuclei such as Gd, Mn, and Fe.
[0114] Typical techniques for binding the above-described labels to
antibodies are provided by Kennedy et al. (Clin. Chim. Acta 70:1-31
(1976)), and Schurs et al. (Clin. Chim. Acta 81:1-40 (1977)).
Coupling techniques mentioned in the latter are the glutaraldehyde
method, the periodate method, the dimaleimide method, the
m-maleimidobenzyl-N-hydroxy-succinimide ester method, all of which
methods are incorporated by reference herein.
Chromosome Assays
[0115] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. Moreover, there is a
current need for identifying particular sites on the chromosome.
Few chromosome marling reagents based on actual sequence data
(repeat polymorphisms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes according
to the present invention is an important first step in correlating
those sequences with genes associated with disease.
[0116] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of a soluble IL-1R
AcM protein gene. This can be accomplished using a variety of well
known techniques and libraries, which generally are available
commercially. The genomic DNA then is used for in situ chromosome
mapping using well known techniques for this purpose. Typically, in
accordance with routine procedures for chromosome mapping, some
trial and error may be necessary to identify a genomic probe that
gives a good in situ hybridization signal.
[0117] In addition, in some cases, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes. Only those
hybrids containing the human gene corresponding to the primer will
yield an amplified portion.
[0118] PCR mapping of somatic cell hybrids is a rapid procedure for
assigning a particular DNA to a particular chromosome. Using the
present invention with the same oligonucleotide primers,
sublocalization can be achieved with panels of portions from
specific chromosomes or pools of large genomic clones in an
analogous manner. Other mapping strategies that can similarly be
used to map to its chromosome include in situ hybridization,
prescreening with labeled flow-sorted chromosomes and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0119] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
probes from the cDNA as short as 50 or 60 bp. For a review of this
technique, see Verma et al., Human Chromosomes: A Manual Of Basic
Techniques, Pergamon Press, New York (1988).
[0120] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance In Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0121] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0122] With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a chromosomal
region associated with the disease could be one of between 50 and
500 potential causative genes. This assumes 1 megabase mapping
resolution and one gene per 20 kb.
Therapeutic Uses of Soluble IL-1R AcM
[0123] IL-1 has an important role in modulating the proliferation,
maturation, and functional activation of hematopoietic cells,
including lymphoid and nonlymphoid cells. IL-1 may have an
important function in the regulation liver metabolism and be
responsible for some of the marked changes in hepatic protein
synthesis that occur in the acute phase response to inflammation or
tissue injury. IL-1 is also involved in the regulation of bone
remodulation, may be involved in the pathogenesis of chronic
inflammatory joint diseases, such as rheumatoid arthritis,
osteoarthritis, and may also play a role in the mechanisms of
articular cartilage destruction hat occurs in degradative
arthropathies. Human IL-1 is capable of increasing collagen protein
and mRNA levels in cultured normal human dermal fibroblasts, thus,
IL-1 may have a role in the early stages of scleroderma and other
fibrotic diseases. IL-1 is capable of inducing a proliferative
response in fibroblasts. In addition, IL-1 may have important
effects on vascular cells, including endothelial cells and vascular
smooth muscle cells. IL-1 may be involved in the pathogenesis of
certain skin diseases, including chronic diseases such as psoriasis
and epithelial fungus infections. IL-1 may have important effects
on the functions of the hypothalamus-pituitary axis and thyroid
gland. IL-1 has an important role in the regulation of insulin
secretion by .beta. cells in the pancreatic islets of Langerhans.
Finally, IL-1 has important effects on the gonads and may play a
role in the physiology of neural tissues. (Reviewed in Pimentel,
Handbook of Growth Factors: Volume III Hematopoietic Growth Factors
and Cytokines, pp. 35-53, CRC Press, Boca Raton, Fla. 1994).
Antibody Therapy
[0124] In view of the wide range of roles that IL-1 plays in
physiologic and pathologic processes, regulating the action of IL-1
by abrogating signal transduction from the IL-1 binding complex is
expected to be useful for therapeutic purposes. For example,
recombinant IL-1ra blocks the activity of exogenously administered
IL-1 in a variety of animal models. When rabbits or baboons are
injected with IL-1 they develope hypertension which is prevented by
a prior injection of IL-1ra (Ohlsson et al. Nature 348: 550 (1990);
Fischer et al. Am. J. Physiol. 261: R442 (1991)). In animal
studies, IL-1R blockade significantly reduces the severity of
diseases, including those associated with infections, inflammation
and metabolic disturbances (Arend, W. P. J. Clin. Invest 88:1445
(1991); Dinarello et al. Immunol. Today 12: 404 (1991)). In Table 1
of Dinarello, Int. J. Clin. Lab. Res. 24:61-79 (1994) (which is
incorporated herein by reference) different models are listed
wherein a specific reduction in IL-1R activity has been employed to
reduce the disease severity.
[0125] In addition, studies with human subjects have also
demonstrated that blockade of IL-1R is effective where the severity
of disease is high. For example, dramatic results have been seen in
patients with septic shock. In clinical trials there was a
statistically significant reduction in mortality. (Dinarello, Int.
J. Clin. Lab. Res. 24:61-79 (1994))
[0126] In another clinical trial, rheumatoid arthritis patients
treated with IL-1ra, in addition to other non-steroidal
anti-inflammatory drugs, had a significant reduction in the number
and severity of painful and swollen joints. These results
demonstrate an improvement in the clincal disease of these
patients. (Dinarello, Int. J. Clin. Lab. Res. 24:61-79 (1994))
[0127] Similarly, antibodies produced to the murine Type I IL-1R
have been used to block IL-1 effects in vitro and in vivo.
(Chizzonite et al. Proc. Natl Acad Sci USA 86:8029 (1989); Lewis et
al. Eur. J. Immunol. 20:207 (1990)). For example, in animal models
of infection and inflammation, administration of anti-IL-1R
antibodies have reduced disease severity (Dinarello, Int. J. Clin.
Lab. Res. 24:61-79 (1994)). The advantage of the anti-IL-1R
antibodies is that they block IL-1 effects for several hours to
days, whereas IL-1ra blood levels need to be sustained at
sufficiently high levels to block IL-1 effects (Dinarello, Int. J.
Clin. Lab. Res. 24:61-79 (1994)).
[0128] Given that IL-1R AcM is involved in IL-1 signal
transduction, antibodies directed against IL-1R AcM are expected to
behave as agonists or antagonist of IL-1 activity. For example, an
antibody directed against the murine IL-1R accessory protein
blocked the binding of IL-1.beta. to murine Type I IL-1R
(Greenfeder et al. J. Biol. Chem, 270: 13757-13765 (1995)). Thus,
antibodies directed against the IL-1R AcM of the present invention
that abrogate IL-1 activity can be used therapuetically to reduce
the severity of diseases associated with IL-1.
[0129] Thus, the present invention is further directed
antibody-based therapies which involve administering an anti-IL-1R
AcM antibody to a mammalian, preferably human, patient for treating
one or more of above-described disorders. Methods for producing
anti-IL-1R AcM polyclonal and monoclonal antibodies are described
in detail above. Such antibodies can may be provided in
pharmaceutically acceptable compositions as known in the art or as
described herein.
[0130] A summary of the ways in which the antibodies of the present
invention may be used therapeutically includes binding IL-1R AcM
locally or systemically in the body or by direct cytotoxicity of
the antibody, e.g., as mediated by complement (CDC) or by effector
cells (ADCC). Some of these approaches are described in more detail
below. Armed with the teachings provided herein, one of ordinary
skill in the art will know how to use the antibodies of the present
invention for diagnostic, monitoring or therapeutic purposes
without undue experimentation.
[0131] The pharmaceutical compositions of the present invention may
be administered by any means that achieve their intended purpose.
Amounts and regimens for the administration of antibodies, their
fragments or derivatives can be determined readily by those with
ordinary skill in the clinical art of treating colon cancer and
related disease.
[0132] For example, administration may be by parenteral,
subcutaneous, intravenous, intramuscular, intraperitoneal,
transdermal, or buccal routes. Alternatively, or concurrently,
administration may be by the oral route. The dosage administered
will be dependent upon the age, health, and weight of the
recipient, kind of concurrent treatment, if any, frequency of
treatment, and the nature of the effect desired.
[0133] Compositions within the scope of this invention include all
compositions wherein the antibody, fragment or derivative is
contained in an amount effective to achieve its intended purpose.
While individual needs vary, determination of optimal ranges of
effective amounts of each component is within the skill of the art.
The effective dose is a function of the individual chimeric or
monoclonal antibody, the presence and nature of a conjugated
therapeutic agent (see below), the patient and his clinical status,
and can vary from about 10 .mu.g/kg body weight to about 5000 mg/kg
body weight. The preferred dosages comprise 0.1 to 500 mg/kg body
wt.
[0134] In addition to the pharmacologically active compounds, the
new pharmaceutical compositions may contain suitable
pharmaceutically acceptable carriers comprising excipients and
auxiliaries which facilitate processing of the active compounds
into preparations which can be used pharmaceutically. Preferably,
the preparations, contain from about 0.01 to 99 percent, preferably
from about 20 to 75 percent of active compound(s), together with
the excipient.
[0135] Similarly, preparations of an IL-1R AcM antibody or fragment
of the present invention for parenteral administration, such as in
detectably labeled form for imaging or in a free or conjugated form
for therapy, include sterile aqueous or non-aqueous solutions,
suspensions, and emulsions. Examples of non-aqueous solvents are
propylene glycol, polyethylene glycol, vegetable oil such as olive
oil, and injectable organic esters such as ethyl oleate. Aqueous
carriers include water, alcoholic/aqueous solutions, emulsions or
suspensions, including saline and buffered media, parenteral
vehicles including sodium chloride solution, Ringer's dextrose,
dextrose and sodium chloride, lactated Ringer's, or fixed oils.
Intravenous vehicles include fluid and nutrient replenishers, such
as those based on Ringer's dextrose, and the like. Preservatives
and other additives may also be present, such as, for example,
antimicrobials, anti-oxidants, chelating agents, and inert gases
and the like. See, generally, Remington's Pharmaceutical Science,
16th ed., Mack Publishing Co., Easton, Pa., 1980.
[0136] In particular, the antibodies, fragments and derivatives of
the present invention are useful for treating a subject having or
developing IL-1R AcM related disorders as described herein. Such
treatment comprises parenterally administering a single or multiple
doses of the antibody, fragment or derivative, or a conjugate
thereof.
[0137] The antibodies of this invention may be advantageously
utilized in combination with other monoclonal or chimeric
antibodies, or with lymphokines or hemopoietic growth factors,
etc., which serve to increase the number or activity of effector
cells which interact with the antibodies.
[0138] Since it appear to be necessary to block nearly all IL-1R's
to block IL-1 activity, it is preferred to use high affinity and/or
potent in vivo IL-1R AcM-inhibiting and/or neutralizing antibodies,
fragments or regions thereof, for both IL-1R AcM immunoassays and
therapy of IL-1 related disorders. Such antibodies, fragments, or
regions, will preferably have an affinity for human IL-1R AcM,
expressed as Ka, of at least 10.sup.8 M.sup.-1, more preferably, at
least 10.sup.9 M.sup.-1, such as 5.times.10.sup.8 M.sup.-1,
8.times.10.sup.8 M.sup.-1, 2.times.10.sup.9 M.sup.-1,
4.times.10.sup.9 M.sup.-1, 6.times.10.sup.9 M.sup.-1,
8.times.10.sup.9 M.sup.-1.
[0139] Preferred for human therapeutic use are high affinity murine
and murine/human or human/human chimeric antibodies, and fragments,
regions and derivatives having potent in vivo IL-1-inhibiting
and/or neutralizing activity, according to the present invention,
e.g., that block IL-1-induced IL-6 secretion, and mitogenic
activity, in vivo, in situ, and in vitro.
[0140] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Expression and Purification of IL-1R AcM in E. coli
[0141] The DNA sequence encoding the mature soluble IL-1R AcM
protein in the deposited cDNA clone is amplified using PCR
oligonucleotide primers specific to the amino acid carboxyl
terminal sequence of the soluble IL-1R AcM protein and to vector
sequences 3' to the gene. Additional nucleotides containing
restriction sites BamHI and SalI to facilitate cloning are added to
the 5' and 3' sequences, respectively.
[0142] The 5' oligonucleotide primer has the sequence 5'
GGATCCATGACACTTCTGTGGTGTG 3' (SEQ ID NO:23) containing the
underlined BamHI restriction site, followed by 16 nucleotides
complementary to bp 1834-1853 of the antisense strand of the IL-1R
AcM protein coding sequence set out in FIG. 1 (SEQ ID NO:1).
[0143] The 3' primer has the sequence 5' GTCGACTCACTGACCGCATCT 3'
(SEQ ID NO:24) containing the underlined SalI restriction site,
followed by 15 nucleotides complementary to bp 1056-1071 of the
sense strand of the IL-1R AcM protein coding sequence set out in
FIGS. 1A-B (SEQ ID NO:1), and a stop codon.
[0144] The restrictions sites are convenient to restriction enzyme
sites in the bacterial expression vector pQE-9, which is used for
bacterial expression in these examples. (Qiagen, Chatsworth,
Calif., 91311).
[0145] The amplified IL-1R AcM protein DNA and the vector pQE-9 are
both digested with BamHI and SalI and the digested DNAs are
subsequently ligated together. Insertion of the IL-1R AcM protein
DNA into the pQE-9 restricted vector places the IL-1R AcM protein
coding region downstream of and operably linked to the vector's
promoter and in-frame with an initiating AUG appropriately
positioned for translation of IL-1R AcM protein.
[0146] The ligation mixture is transformed into competent E. coli
cells using standard procedures. Such procedures are described, for
example, in Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989). E. coli strain M15/rep4, containing multiple
copies of the plasmid pREP4, which expresses lac repressor and
confers kanamycin resistance ("Kanr"), is used in carrying out the
illustrative example described here. This strain, which is only one
of many that are suitable for expressing IL-1R AcM protein, is
available commercially from Qiagen.
[0147] Transformants are identified by their ability to grow on LB
plates in the presence of ampicillin. Plasmid DNA is isolated from
resistant colonies and the identity of the cloned DNA is confirmed
by restriction analysis.
[0148] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml).
[0149] The O/N culture is used to inoculate a large culture, at a
dilution of approximately 1:100 to 1:250. The cells are grown to an
optical density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-B-D-thiogalactopyranoside ("IPTG") are then added to a
final concentration of 1 mM to induce transcription from lac
repressor sensitive promoters, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
are then harvested by centrifugation and disrupted, by standard
methods. Inclusion bodies are purified from the disrupted cells
using routine collection techniques, and protein are solubilized
from the inclusion bodies into 8M urea. The 8M urea solution
containing the solubilized protein is passed over a PD-10 column in
2.times.phosphate buffered saline ("PBS"), thereby removing the
urea, exchanging the buffer and refolding the protein. The protein
is purified by a further step of chromatography to remove
endotoxin. Then, it is sterile filtered. The sterile filtered
protein preparation is stored in 2.times.PBS at a concentration of
95 micrograms per mL.
[0150] Analysis of the preparation by standard methods of
polyacrylamide gel electrophoresis reveals that the preparation
contains about 95% monomer IL-1R AcM protein having the expected
molecular weight of approximately 42 kDa.
Example 2
Cloning and Expression in Mammalian Cells
[0151] Most of the vectors used for the transient expression of the
IL-R AcM protein gene sequence in mammalian cells should carry the
SV40 origin of replication. This allows the replication of the
vector to high copy numbers in cells (e.g., COS cells) which
express the T antigen required for the initiation of viral DNA
synthesis. Any other mammalian cell line can also be utilized for
this purpose.
[0152] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of trancription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular signals
can also be used (e.g., human actin promoter). Suitable expression
vectors for use in practicing the present invention include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala,
Sweden), pRSVcat (ATCC.TM. 37152), pSV2dhfr (ATCC.TM. 37146) and
pBC12MI (ATCC.TM. 67109). Mammalian host cells that could be used
include, human Hela, 283, H9 and Jurkart cells, mouse NIH3T3 and
C127 cells, Cos 1, Cos 7 and CV1, African green monkey cells, quail
QC1-3 cells, mouse L cells and Chinese hamster ovary cells.
[0153] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
[0154] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
is a useful marker to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10: 169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) cells are often used for the production of
proteins.
[0155] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular
and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the
CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)). Multiple
cloning sites, e.g., with the restriction enzyme cleavage sites
BamHI, XbaI and Asp718, facilitate the cloning of the gene of
interest. The vectors contain in addition the 3' intron, the
polyadenylation and termination signal of the rat preproinsulin
gene.
Example 2(a)
Cloning and Expression in COS Cells
[0156] The expression plasmid, pIL-1R AcM HA, is made by cloning a
cDNA encoding IL-R AcM into the expression vector pcDNAI/Amp (which
can be obtained from Invitrogen, Inc.).
[0157] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron, and a polyadenylation
signal arranged so that a cDNA conveniently can be placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker.
[0158] A DNA fragment encoding the IL-1R AcM protein and an HA tag
fused in frame to its 3' end is cloned into the polylinker region
of the vector so that recombinant protein expression is directed by
the CMV promoter. The HA tag corresponds to an epitope derived from
the influenza hemagglutinin protein described by Wilson et al.,
Cell 37: 767 (1984). The fusion of the HA tag to the target protein
allows easy detection of the recombinant protein with an antibody
that recognizes the HA epitope.
[0159] The plasmid construction strategy is as follows. The IL-1R
AcM cDNA of the deposited clone is amplified using primers that
contain convenient restriction sites, much as described above
regarding the construction of expression vectors for expression of
IL-R AcM in E. coli. To facilitate detection, purification and
characterization of the expressed IL-1R AcM, one of the primers
contains a hemagglutinin tag ("HA tag") as described above.
[0160] Suitable primers include the following, which are used in
this example. The 5' primer, containing the underlined BamHI site,
an AUG start codon and 5 codons of the 5' coding region has the
following sequence:
TABLE-US-00002 (SEQ ID NO:25) 5'GGATCCATCCGCCATCATGACACTTCTGTGGTGTG
3'.
[0161] The 3' primer, containing the underlined XbaI site, a stop
codon, 9 codons thereafter forming the hemagglutinin HA tag, and 12
bp of 3' coding sequence (at the 3' end) has the following
sequence:
TABLE-US-00003 (SEQ ID NO:26)
5'TCTAGAAAAGCGTAGTCTGGGACGTCGTATGGGTACTGACCGCATC T 3'.
[0162] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037), and the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis and gel
sizing for the presence of the IL-1R AcM-encoding fragment.
[0163] For expression of recombinant IL-1R AcM, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of IL-1R AcM by the vector.
[0164] Expression of the IL-1R AcM HA fusion protein is detected by
radiolabelling and immunoprecipitation, using methods described in,
for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and the lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5,
as described by Wilson et al. cited above. Proteins are
precipitated from the cell lysate and from the culture media using
an HA-specific monoclonal antibody. The precipitated proteins then
are analyzed by SDS-PAGE gels and autoradiography. An expression
product of the expected size is seen in the cell lysate, which is
not seen in negative controls.
Example 2(b)
Cloning and Expression in CHO Cells
[0165] The vector pC1 is used for the expression of IL-1R AcM
protein. Plasmid pC1 is a derivative of the plasmid pSV2-dhfr
[ATCC.TM. Accession No. 37146]. Both plasmids contain the mouse
DHFR gene under control of the SV40 early promoter. Chinese hamster
ovary--or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by
overproducing the target enzyme, DHFR, as a result of amplification
of the DHFR gene. If a second gene is linked to the DHFR gene it is
usually co-amplified and over-expressed. It is state of the art to
develop cell lines carrying more than 1,000 copies of the genes.
Subsequently, when the methotrexate is withdrawn, cell lines
contain the amplified gene integrated into the chromosome(s).
[0166] Plasmid pC1 contains for the expression of the gene of
interest a strong promoter of the long terminal repeat (LTR) of the
Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular
Biology, March 1985:438-4470) plus a fragment isolated from the
enhancer of the immediate early gene of human cytomegalovirus (CMV)
(Boshart et al., Cell 41:521-530, 1985). Downstream of the promoter
are the following single restriction enzyme cleavage sites that
allow the integration of the genes: BamHI, Pvull, and Nrul. Behind
these cloning sites the plasmid contains translational stop codons
in all three reading frames followed by the 3' intron and the
polyadenylation site of the rat preproinsulin gene. Other high
efficient promoters can also be used for the expression, e.g., the
human .beta.-actin promoter, the SV40 early or late promoters or
the long terminal repeats from other retroviruses, e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g.,
from the human growth hormone or globin genes can be used as
well.
[0167] Stable cell lines carrying a gene of interest integrated
into the chromosomes can also be selected upon co-transfection with
a selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
[0168] The plasmid pC1 is digested with the restriction enzyme
BamHI and then dephosphorylated using calf intestinal phosphates by
procedures known in the art. The vector is then isolated from a 1%
agarose gel.
[0169] The DNA sequence encoding IL-1R AcM, ATCC.TM. 97666, is
amplified using PCR oligonucleotide primers corresponding to the 5'
and 3' sequences of the gene: The 5' primer has the sequence
5'GACTGGATCCGCCATCATGACACTTCTGTGGTGTG 3' (SEQ ID NO:27) containing
the underlined BamH1 restriction enzyme site followed by 19 bases
of the sequence of IL-1R AcM of FIGS. 1A-B (SEQ ID NO:1). Inserted
into an expression vector, as described below, the 5' end of the
amplified fragment encoding human IL-1R AcM provides an efficient
signal peptide. An efficient signal for initiation of translation
in eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 (1987) is appropriately located in the vector portion
of the construct.
[0170] The 3' primer has the sequence 5' GAATTCCTCACTGACCGCATCT 3'
(SEQ ID NO:28) containing the EcoRI restriction followed by
nucleotides complementary to the last 15 nucleotides of the IL-1R
AcM coding sequence set out in FIGS. 1A-B (SEQ ID NO:1), including
the stop codon.
[0171] The amplified fragments are isolated from a 1% agarose gel
as described above and then digested with the endonucleases BamHI
and EcoRI and then purified again on a 1% agarose gel.
[0172] The isolated fragment and the dephosphorylated vector are
then ligated with T4 DNA ligase. E. coli HB101 cells are then
transformed and bacteria identified that contained the plasmid pC1
inserted in the correct orientation using the restriction enzyme
BamHI. The sequence of the inserted gene is confirmed by DNA
sequencing.
Transfection of CHO-DHFR-cells
[0173] Chinese hamster ovary cells lacking an active DHFR enzyme
are used for transfection. 5 .mu.g of the expression plasmid C1 are
cotransfected with 0.5 .mu.g of the plasmid pSVneo using the
lipofecting method (Felgner et al., supra). The plasmid pSV2-neo
contains a dominant selectable marker, the gene neo from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) and cultivated from 10-14 days. After this period, single
clones are trypsinized and then seeded in 6-well petri dishes using
different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200
nM, 400 nM, 800 nM). Clones growing at the highest concentrations
of methotrexate are then transferred to new 6-well plates
containing even higher concentrations of methotrexate (1 .mu.M, 2
.mu.M, 5 .mu.M, 10 mM, 20 mM). The same procedure is repeated until
clones grow at a concentration of 100 .mu.M.
[0174] The expression of the desired gene product is analyzed by
Western blot analysis and SDS-PAGE or by reverse phase HPLC
analysis.
Example 3
Cloning and Expression of the Soluble IL-1R AcM Protein in a
Baculovirus Expression System
[0175] The cDNA sequence encoding the soluble IL-1R AcM protein in
the deposited clone was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene: The 5' primer
has the sequence 5' GACTGGATCCGCCATCATGACACTTCTGTGGTGTG 3' (SEQ ID
NO:29) containing the underlined BamHI restriction enzyme site
followed by 19 bases (bp 1834-1853) complementary to the antisense
strand of the soluble IL-1R AcM protein coding sequence of FIGS.
1A-B (SEQ ID NO: 1). Inserted into an expression vector, as
described below, the 5' end of the amplified fragment encoding
soluble IL-1R AcM protein receptor provides an efficient signal
peptide. An efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 (1987), may be located, as appropriate, in the vector
portion of the construct.
[0176] For the full length gene, the 3' primer has the full length
sequence 5' GAC TGG TAC CCA TAG AAA TCA TGT GTA TAC C 3' (SEQ ID
NO:30), containing the underlined Asp718 restriction followed by 25
nucleotides complementary to bp 2049-2070 of the sense strand of
the soluble IL-1R AcM protein set out in FIGS. 1A-B [SEQ ID NO:1],
and a stop codon.
[0177] The amplified fragment was isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with BamHI and Asp718
and again is purified on a 1% agarose gel. This fragment is
designated herein "F2".
[0178] The vector pA2 is used to express the soluble IL-1R AcM
protein in the baculovirus expression system, using standard
methods, such as those described in Summers et al., A Manual of
Methods for Baculovirus Vectors and Insect Cell Culture Procedures,
Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
This expression vector contains the strong polyhedrin promoter of
the Autographa califomica nuclear polyhedrosis virus (AcMNPV)
followed by convenient restriction sites. For an easy selection of
recombinant virus the beta-galactosidase gene from E. coli is
inserted in the same orientation as the polyhedrin promoter and is
followed by the polyadenylation signal of the polyhedrin gene. The
polyhedrin sequences are flanked at both sides by viral sequences
for cellmediated homologous recombination with wild-type viral DNA
to generate viable virus that express the cloned
polynucleotide.
[0179] Many other baculovirus vectors could be used in place of
pA2, such as pAc373, pVL941 and pAcIM1 provided, as those of skill
readily will appreciate, that construction provides appropriately
located signals for transcription, translation, trafficking and the
like, such as an in-frame AUG and a signal peptide, as required.
Such vectors are described, for example, in Luckow et al., Virology
170:31-39 (1989). Suitable vectors will be readily apparent to the
skilled artisan.
[0180] The plasmid was digested with the restriction enzymes BamHI
and Asp718 and then was dephosphorylated using calf intestinal
phosphatase, using routine procedures known in the art. The DNA was
then isolated from a 1% agarose gel using a commercially available
kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.). This vector DNA
is designated herein "V2".
[0181] Fragment F2 and the dephosphorylated plasmid V2 were ligated
together with T4 DNA ligase. E. coli HB 101 cells were transformed
with ligation mix and spread on culture plates. Bacteria were
identified that contain the plasmid with the human soluble IL-1R
AcM protein gene by digesting DNA from individual colonies using
BamHI and Asp718 and then analyzing the digestion product by gel
electrophoresis. The sequence of the cloned fragment was confirmed
by DNA sequencing. This plasmid is designated herein as
pA2HG16302.
[0182] 5 .mu.g of plasmid pA2HG16302 was co-transfected with 1.0
.mu.g of a commercially available linearized baculovirus DNA
("BaculoGold.TM. baculovirus DNA", Pharmingen, San Diego, Calif.),
using the lipofection method described by Felgner et al., Proc.
Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 .mu.g of BaculoGold.TM.
virus DNA and 5 .mu.g of the plasmid pA2HG16302 were mixed in a
sterile well of a microliter plate containing 50 .mu.l of serum
free Grace's medium (Life Technologies Inc., Gaithersburg, Md.).
Afterwards, 10 .mu.l Lipofectin plus 90 .mu.l Grace's medium were
added, mixed and incubated for 15 minutes at room temperature. Then
the transfection mixture was added drop-wise to Sf9 insect cells
(ATCC.TM. CRL 1711) seeded in a 35 mm tissue culture plate with I
ml Grace's medium without serum. The plate was rocked back and
forth to mix the newly added solution. The plate is then incubated
for 5 hours at 27.degree. C. After 5 hours the transfection
solution was removed from the plate and 1 ml of Grace's insect
medium supplemented with 10% fetal calf serum is added. The plate
is put back into an incubator and cultivation is continued at
27.degree. C. for four days.
[0183] After four days the supernatant was collected and a plaque
assay was performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg,
Md.) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
Md., at pages 9-10.
[0184] Four days after serial dilution, the virus was added to the
cells. After appropriate incubation, blue stained plaques are
picked with the tip of an Eppendorf pipette. The agar containing
the recombinant viruses was then resuspended in an Eppendorf tube
containing 200 .mu.l of Grace's medium. The agar is removed by a
brief centrifugation and the supernatant containing the recombinant
baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
Four days later the supernatants of these culture dishes are
harvested and then they were stored at 4.degree. C. A clone
containing properly inserted soluble IL-1R AcM cDNA was identified
by DNA analysis including restriction mapping and sequencing. This
clone is designated herein as pA2HG16302.
[0185] Sf9 cells are grown in Grace's medium supplemented with 10%
heat-inactivated FBS. The cells are infected with the recombinant
baculovirus A2HG16302 at a multiplicity of infection ("MOI") of
about 2 (about 1 to about 3). Six hours later the medium is removed
and is replaced with SF900 II medium minus methionine and cysteine
(available from Life Technologies Inc., Gaithersburg, Md.). 42
hours later, 5 .mu.Ci of .sup.35S methionine and 5 MCi .sup.35S
cysteine (available from Amersham) are added. The cells are further
incubated for 16 hours and then they are harvested by
centrifugation, lysed and the labeled proteins are visualized by
SDS-PAGE and autoradiography.
Example 4
Tissue Distribution of Soluble IL-1R AcM Protein Expression
[0186] Northern blot analysis is carried out to examine the levels
of expression of the gene encoding the IL-1R AcM protein in human
tissues, using methods described by, among others, Sambrook et al.,
cited above. A cDNA probe containing the entire nucleotide sequence
of the IL-1R AcM protein of the present invention (SEQ ID NO:1) is
labeled with .sup.32P using the rediprime.TM. DNA labeling system
(Amersham Life Science), according to manufacturer's instructions.
After labelling, the probe was purified using a CHROMA SPIN-100.TM.
column (Clontech Laboratories, Inc.), according to manufacturer's
protocol number PT1200-1. The purified labelled probe is then used
to examine various human tissues for the expression of the gene
encoding the IL-1R AcM protein.
[0187] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) are obtained
from Clontech and were examined with labelled probe using
ExpressHyb.TM. Hybridization Solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0188] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples.
[0189] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the appended claims.
[0190] The entire disclosure of each document cited in this
application is hereby incorporated herein by reference.
Sequence CWU 1
1
* * * * *