U.S. patent application number 11/981753 was filed with the patent office on 2008-10-16 for assays for measuring nucleic acid binding proteins and enzyme activities.
This patent application is currently assigned to BioVeris Corporation. Invention is credited to Jeffrey A. Heroux, John H. Kenten, Maura C. Kibbey.
Application Number | 20080254494 11/981753 |
Document ID | / |
Family ID | 22565373 |
Filed Date | 2008-10-16 |
United States Patent
Application |
20080254494 |
Kind Code |
A1 |
Heroux; Jeffrey A. ; et
al. |
October 16, 2008 |
Assays for measuring nucleic acid binding proteins and enzyme
activities
Abstract
Processes for measuring DNA or RNA binding proteins, specific
nucleic acids, as well as enzyme activities using labeled nucleic
acids of labeled protein/peptide molecules are provided.
Inventors: |
Heroux; Jeffrey A.;
(Middletown, MD) ; Kibbey; Maura C.; (Darnestown,
MD) ; Kenten; John H.; (Gaithersburg, MD) |
Correspondence
Address: |
FOLEY & LARDNER LLP
777 EAST WISCONSIN AVENUE
MILWAUKEE
WI
53202-5306
US
|
Assignee: |
BioVeris Corporation
|
Family ID: |
22565373 |
Appl. No.: |
11/981753 |
Filed: |
October 31, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09976437 |
Oct 15, 2001 |
|
|
|
11981753 |
|
|
|
|
09157808 |
Sep 17, 1998 |
6312896 |
|
|
09976437 |
|
|
|
|
Current U.S.
Class: |
435/23 |
Current CPC
Class: |
C12Q 1/68 20130101; C12Q
1/68 20130101; C12Q 2522/101 20130101; C12Q 2521/301 20130101 |
Class at
Publication: |
435/23 |
International
Class: |
C12Q 1/37 20060101
C12Q001/37 |
Claims
1.-2. (canceled)
3. A method for assaying a sample for the presence of an enzyme
activity that cleaves peptides or proteins, the method comprising:
a) mixing at least one predetermined peptide or protein containing
at least one electrochemiluminescent label with a sample which may
contain a peptide or protein-cleaving enzyme; b) incubating the
mixture of step (a) under conditions which allow cleavage of said
peptide or protein; and c) analyzing the incubated mixture for the
presence of cleaved peptide or protein.
4. The method of claim 3, wherein the electrochemiluminescent label
comprises ruthenium, osmium or rhenium.
5. The method of claim 3, wherein the electrochemiluminescent label
comprises a bipyridyl or phenanthrolyl-containing complex of
ruthenium.
6. The method of claim 3, wherein the electrochemiluminescent label
comprises RuBpy.
7. The method of claim 3, wherein analyzing the incubated mixture
comprises measuring the amount of cleaved peptide or protein in the
incubated mixture.
8. The method of claim 3, wherein the peptide- or protein-cleaving
enzyme is a protease.
9. The method of claim 3, wherein the peptide- or protein-cleaving
enzyme is a peptidase.
10. The method of claim 3, wherein the electrochemiluminescent
label is linked to the protein or peptide by a covalent bond, or a
specific interaction with a binding group.
11. The method of claim 3, wherein analyzing the incubated mixture
comprises analyzing an incubated mixture, which includes an ECL
coreactant.
12. The method of claim 11, wherein the ECL coreactant comprises a
tertiary amine.
13. The method of claim 3, wherein the peptide or protein has a
capture moiety attached thereto.
14. The method of claim 13, wherein the capture moiety is selected
from the group consisting of antibody, antigen, receptor, ligand,
and a nucleic acid base pairing polymer.
15. A method of detecting an inhibitor of a peptide- or
protein-cleaving enzyme, comprising: a) combining to form a mixture
i) at least one predetermined peptide or protein containing at
least one electrochemiluminescent label, ii) at least one
predetermined peptide- or protein-cleaving enzyme, and iii) a
sample, wherein the sample may contain an inhibitor of the peptide-
or protein-cleaving enzyme; b) incubating the mixture of step (a)
under conditions which allow cleavage of said peptide or protein;
and c) analyzing the incubated mixture for the presence of cleaved
peptide or protein.
16. The method of claim 15, wherein the electrochemiluminescent
label is linked to the protein or peptide by a covalent bond, or a
specific interaction with a binding group.
17. The method of claim 15, wherein the electrochemiluminescent
label comprises a bipyridyl or phenanthrolyl-containing complex of
ruthenium.
18. The method of claim 15, wherein analyzing the incubated mixture
comprises measuring the amount of cleaved peptide or protein in the
incubated mixture.
19. The method of claim 15, wherein the peptide- or
protein-cleaving enzyme is a protease.
20. The method of claim 15, wherein the peptide- or
protein-cleaving enzyme is a peptidase.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 09/976,437, filed on Oct. 15, 2001; which is a divisional of
U.S. application Ser. No. 09/157,808, filed on Sep. 17, 1998, now
U.S. Pat. No. 6,312,896; the entire contents of which are hereby
incorporated by reference in this application.
BACKGROUND
[0002] The ability to measure the activity or amount of an analyte
in a biological sample is critical in the fields of life sciences
research and medical diagnostics. A broad class of important assays
are assays that measure the activity of enzymes that catalyze the
synthesis or cleavage of polypeptides or polynucleotides (or,
similarly, assays for substrates, products or inhibitors of these
enzymes). These enzymes include proteases, nucleases, polymerases,
ligases and the like. Another broad class of important assays
measure the interaction of nucleic acids with proteins or other
nucleic acids.
[0003] Enzymatic activity may be measured through the use of
synthetic enzyme substrates that show changes in color or
fluorescence when acted upon by the enzyme. This approach, however,
requires the design and synthesis of a custom reagent for every
enzyme; a process that can be laborious, time consuming, and
expensive. In addition, it is often desirable to measure the
activity of an enzyme on its natural substrate.
[0004] A possibly more generic approach for measuring protease or
nuclease activity is the Scintillation Proximity Assay (SPA); see,
e.g., U.S. Pat. No. 4,568,649 and Published PCT Application
WO90/03844. SPA uses small microspheres that are derivatized in
such a way as to bind specific molecules. If a radioactive molecule
is brought into close proximity to the bead a scintillant
incorporated in the microsphere is excited and subsequently emits
light. Radioactive molecules not bound to the microspheres excite
the scintillant to a much lesser extent than radioactive molecules
bound to the beads and, therefore, produce a weaker light signal. A
number of assay formats have been described using SPA detection
technology including protease (Wilkinson et al., Pharm. Res. (1993)
10, 562) and ribonuclease protection assays (Kenrick, et al., Nucl.
Acids Res. (1997) 25, 2947).
[0005] While SPA has proved useful for these and other classes of
assays, the technique has several disadvantages. The primary
problem with SPA is the requirement for radioactive reagents.
Because of the severe cost, safety, environmental, and regulatory
issues associated with the use of radioisotopes, there is a clear
need for alternative assay techniques that do not use radioactive
materials. The background signal associated with the SPA approach
is relatively high due to the inability of the assay format to
totally discriminate the signal that is generated from free from
that generated from bound radioactivity. In addition, the
sensitivity of SPA has been found to be limited; there is a need
for more sensitive assay techniques. As a result of the high
background signal and low to moderate sensitivity, SPA approaches
generally possess relatively low signal to noise ratios which, in
many cases, can adversely effect assay performance.
[0006] The most common method for measuring the specific
interaction of proteins with nucleic acids is the gel shift or
electrophoretic mobility shift assay. This approach has been widely
used for the study of sequence-specific binding proteins,
especially transcription factors. The basis for the approach is
that complexes of DNA and protein have a reduced or "shifted"
mobility during non-denaturing gel electrophoresis. DNA duplexes,
containing a specific protein binding sequence, are end labeled
(generally with a radioactive label) and incubated with a sample
containing the specific binding protein. The sample is subsequently
analyzed by electrophoresis and the specific complexes are detected
following autoradiographic analysis of exposed film. The amount of
specific binding protein is determined semi-quantitatively by
measuring the amount of the specific protein-DNA complex. This
approach has been largely relegated to the world of basic
exploratory research, primarily because of the inherent limitations
of gel electrophoresis: i) the technique is complex and can usually
only be carried out by highly trained lab technicians; ii) the
technique is slow and laborious and is, therefore, not suited to
the high throughput screening of large numbers of samples; and iii)
the technique is, at best, semi-quantitative in nature. In
addition, the use of radioactivity has also posed as an obstacle to
some for the use of this technique. Although non-radioactive
approaches have recently emerged, these approaches are accompanied
by significant increases in labor.
Electrochemiluminescent Detection Technology
[0007] Numerous methods and systems have been developed for the
detection and quantitation of molecules of interest in biochemical
and biological samples. Methods and systems which are capable of
measuring trace amounts of microorganisms, pharmaceuticals,
hormones, viruses, antibodies, nucleic acids and other proteins are
of great value to researchers and clinicians.
[0008] A very substantial body of art has been developed based upon
binding reactions, e.g., antigen-antibody reactions, nucleic acid
hybridization techniques, protein-ligand systems as well as for
formats for measuring a variety of enzymatic activities. The high
degree of specificity in many biochemical and biological assay
systems has led to many methods and systems of value in research
and diagnostics. Typically, the existence of an analyte or enzyme
of interest is indicated by the presence or absence of an
observable "label" attached to one or more of the binding molecules
or starting substrates.
[0009] Electrochemiluminescent (ECL) assays provide a sensitive and
precise measurement of the presence and concentration of an analyte
of interest. Such techniques use labels or other reactants that can
be induced to luminesce when electrochemically oxidized or reduced
in an appropriate chemical environment. Such
electrochemiluminescence is triggered by a voltage impressed on a
working electrode at a particular time and in a particular manner.
The light produced by the label is measured and indicates the
presence or quantity of the analyte. For a more complete
description of such ECL techniques, reference is made to U.S. Pat.
No. 5,714,089, U.S. Pat. No. 5,591,581, U.S. Pat. No. 5,597,910,
U.S. Pat. No. 5,679,519, PCT published application WO90/05296, PCT
published application WO92/14139, PCT published application
WO90/05301; PCT published application WO96/24690, PCT published
application U.S. Pat. No. 9,503,190, PCT published application
WO96/06946, PCT published application WO96/33411, PCT published
application WO87/06706, PCT published application WO96/39534, PCT
published application WO93/10267, PCT published application
WO96/41175, PCT published application WO98/12539, PCT published
application WO96/28538, PCT published application WO96/21039, PCT
published application WO97/33176, PCT published application
WO96/17248, and PCT published application WO96/40978, and U.S.
patent application. Ser. No. 09/023,483. The disclosures of the
aforesaid applications are hereby incorporated by reference in
their entirety. Reference is also made to two reviews on ECL
technology: Blackburn et al. (Clinical Chemistry, 1991, 37,
1534-1539) and a 1994 review of the analytical applications of ECL
by Knight, et al. (Analyst, 1994, 119: 879-890) and the references
cited therein. The disclosure of the aforesaid articles are hereby
also incorporated by reference in their entirety.
SUMMARY
[0010] The present application describes processes for measuring
DNA or RNA binding proteins, specific nucleic acids, as well as
enzyme activities using labeled nucleic acids or labeled
protein/peptide molecules. As used herein, the term "measuring" or
"measure" means detecting and/or quantitating.
[0011] This application provides a method for measuring the amount
or activity of an enzyme in a sample that catalyzes the cleavage of
a molecule into two or more products, the method comprising the
following steps: i) mixing a sample which may contain the enzyme
with a substrate of the enzyme, an ECL label, and a solid phase,
wherein the substrate is linked to the ECL label and is linked or
capable of being linked to the solid phase and wherein the enzyme
is capable of cleaving the substrate to form at least one product
that is linked to an ECL label but that is not linked or capable of
being linked to the solid phase; ii) inducing the mixture to emit
electrochemiluminescence and iii) measuring the
electrochemiluminescence so as to measure the amount or activity of
the enzyme. The invention also includes analogous methods for
measuring the amount or activity of substrates or inhibitors of
enzymes that catalyze the cleavage of an enzyme into two or more
products.
[0012] One embodiment includes a method for measuring the amount or
activity of an enzyme that catalyzes the joining of two or more
substrates to form a product, the method comprising the following
steps: i) mixing a sample which may contain the enzyme with two
substrates of the enzyme, an ECL label, and a solid phase, wherein
one of the substrates is linked or capable of being linked to the
solid phase and another of the substrates is not linked or capable
of being linked to the solid phase but is linked to the ECL label
and wherein the enzyme is capable of forming a product that is
linked to the ECL label and linked or capable of being linked to
the solid phase; ii) inducing the mixture to emit
electrochemiluminescence and iii) measuring the
electrochemiluminescence so as to measure the activity or amount of
the enzyme. The invention also includes analogous methods for
measuring the amount or activity of substrates or inhibitors of
enzymes that catalyze the joining of two or more substrates to form
a product.
[0013] Another embodiment includes a method for measuring enzyme
activities that cleave nucleic acid molecules in a sample, which
comprises, mixing at least one or more single- or double-stranded
nucleic acid molecules containing one or more ECL labels, adding a
sample which may contain a nucleic acid-cleaving enzyme, and
incubating under conditions which allow cleavage of the nucleic
acid sequence, contacting this mixture with at least one solid
phase, preferentially inducing ECL from ECL labels in solution or
on the solid phase and measuring the ECL emission so as to measure
the amount of cleaving activity in the sample. This invention
includes a method for detecting and/or quantitating enzyme
activities that cleave peptide or protein molecules in a sample,
which comprises, mixing at least one or more peptide or protein
molecules containing one or more ECL labels, contacting this
mixture with at least one solid phase, adding a sample which may
contain a peptide- or protein-cleaving enzyme, inducing ECL from
ECL labels in solution and/or on the solid phase and measuring the
ECL emission so as to measure the amount of cleaving activity in
the sample.
[0014] Another embodiment includes a method for measuring enzyme
activities that covalently join nucleic acid molecules in a sample,
which comprises, mixing at least one or more single- or
double-stranded nucleic acid molecules containing one or more ECL
labels, adding a sample which may contain a nucleic acid-joining
enzyme, incubating under conditions which allow the joining of the
nucleic acid sequences, contacting this mixture with at least one
solid phase, inducing ECL from ECL labels in solution and/or on the
solid phase and measuring the ECL emission so as to measure the
amount of joining activity in the sample.
[0015] Another embodiment includes a method for measuring enzyme
activities that covalently join nucleic acid molecules in a sample,
which comprises, mixing at least one or more single- or
double-stranded nucleic acid molecules containing one or more ECL
labels, contacting one or more of the labeled nucleic acid
molecules with at least one solid phase, adding a sample which may
contain a nucleic acid-joining enzyme, incubating under conditions
which allow the joining of the nucleic acid sequences, inducing ECL
from ECL labels in solution and/or on the solid phase and measuring
the ECL emission so as to measure the amount of joining activity in
the sample.
[0016] Another embodiment includes a method for measuring nucleic
acid binding proteins in a sample, which comprises the following
steps: i) contacting the sample with one or more single- and/or
double-stranded nucleic acid molecules containing a specific
protein binding nucleotide sequence; ii) incubating under
conditions which allow the specific binding of the nucleic acid
binding proteins to the protein binding nucleotide sequence; iii)
adding a nucleic acid cleaving reagent or enzyme; iv) incubating
the sample under conditions that allow for the cleavage of the
nucleic acid; and v) measuring the extent of nucleic acid
cleavage.
[0017] Another embodiment includes a method for detecting and/or
quantitating nucleic acid binding proteins in a sample, which
comprises, mixing at least one or more single- or double-stranded
nucleic acid molecules containing a specific protein binding
nucleotide sequence and containing one or more labels, contacting
one or more of the labeled nucleic acid molecules with at least one
solid phase, adding a sample which may contain one or more nucleic
acid binding proteins, and incubating under conditions which allow
the specific binding of the proteins to the protein binding
nucleotide sequence, adding a nucleic acid cleaving reagent or
enzyme, and incubating the sample under conditions that allow for
the cleavage of the nucleic acid molecules, and measuring the
amount of labeled nucleic acid on the solid phase and/or in the
solution phase.
[0018] Another embodiment includes a method for measuring nucleic
acid binding proteins in a sample, which comprises the following
steps: i) contacting the sample with one or more single- and/or
double-stranded nucleic acid molecules containing a specific
protein binding nucleotide sequence and containing a number of
modified nucleotides that are resistant to nuclease digestion; ii)
incubating under conditions which allow the specific binding of the
proteins to the protein binding nucleotide sequence; iii) adding a
nucleic acid cleaving reagent or enzyme; iv) incubating the sample
under conditions that allow for the cleavage of the nucleic acid
molecules; v) and measuring the extent of nucleic acid
cleavage.
[0019] Another embodiment includes a method for measuring nucleic
acid binding proteins in a sample, which comprises the following
steps: i) mixing at least one or more single- or double-stranded
nucleic acid molecules containing a specific protein binding
nucleotide sequence and containing a number of modified nucleotides
that are resistant to nuclease digestion, and containing one or
more labels; ii) contacting one or more of the labeled nucleic acid
molecules with at least one solid phase; iii) adding a sample which
may contain one or more nucleic acid binding proteins, and
incubating under conditions which allow the specific binding of the
proteins to the labeled nucleic acid sequences; iv) adding a
nucleic acid cleaving reagent or enzyme, and incubating the sample
under conditions that allow for the cleavage of the nucleic acid
molecules, and measuring the amount of label on the solid phase
and/or in solution.
[0020] Another embodiment includes a method for measuring nucleic
acid binding proteins in a sample, which comprises the following
steps: mixing at least one or more single- or double-stranded
nucleic acid molecules containing a specific protein binding
nucleotide sequence, and containing a number of modified
nucleotides that are resistant to nuclease digestion, and
containing one or more labels; adding a sample which may contain
one or more nucleic acid binding proteins, and incubating under
conditions which allow the specific binding of the proteins to the
labeled nucleic acid sequences; adding a nucleic acid cleaving
reagent or enzyme, and incubating the sample under conditions that
allow for the cleavage of the nucleic acid molecules; contacting
one or more of the labeled nucleic acid molecules with at least one
solid; and measuring the amount of labeled nucleic acid on the
solid phase and/or in solution.
[0021] Another embodiment includes a method for measuring nucleic
acid binding proteins in a sample, which comprises the following
steps: mixing at least one or more single- or double-stranded
nucleic acid molecules containing a specific protein binding
nucleotide, and containing a number of modified nucleotides that
are resistant to nuclease digestion, and containing one or more
labels; contacting one or more of the labeled nucleic acid
molecules with at least one solid phase; adding a sample which may
contain one or more nucleic acid binding proteins, and incubating
under conditions which allow the specific binding of the proteins
to the labeled nucleic acid sequences; adding a nucleic acid
cleaving reagent or enzyme, and incubating the sample under
conditions that allow for the cleavage of the nucleic acid
molecules; and measuring the amount of labeled nucleic acid on the
solid phase and/or in solution.
[0022] Another embodiment includes a method for measuring specific
nucleic acid sequences in a sample, which comprises, mixing at
least one or more predetermined single-stranded nucleic acid
molecules containing one or more ECL labels, contacting one or more
of the labeled nucleic acid molecules with at least one solid
phase, adding a sample which may contain one or more of the
specific nucleic acid sequences, incubating under conditions which
allow the specific binding of the sample nucleic acid sequences to
the labeled nucleic acid sequences, adding a nucleic acid cleaving
reagent or enzyme, incubating the sample under conditions that
allow for the cleavage of the nucleic acid molecules, and detecting
and/or quantitating the amount of labeled nucleic acid on the solid
phase and/or in solution.
[0023] Another embodiment also includes a method for measuring
specific nucleic acid sequences in a sample, which comprises,
mixing at least one or more predetermined single-stranded nucleic
acid and containing one or more ECL labels, adding a sample which
may contain one or more of the specific nucleic acid sequences,
incubating under conditions which allow the specific binding of the
sample nucleic acid sequences to the labeled nucleic acid
sequences, adding a nucleic acid cleaving reagent or enzyme,
incubating the sample under conditions that allow for the cleavage
of the nucleic acid molecules, contacting one or more of the
labeled nucleic acid molecules with at least one solid phase,
measuring the amount of labeled nucleic acid on the solid phase
and/or in solution.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 shows, schematically, an enzyme cleaving a substrate,
which is linked to a solid phase and a label, to form a first
product linked to the label and a second product linked to the
solid phase.
[0025] FIG. 2 shows, schematically, an enzyme joining a substrate
linked to a solid phase with a substrate linked to a label,
thereby, forming a product linked to both the label and solid
phase.
[0026] FIGS. 3(a), (b) and (c) show, schematically, three methods
by which a substrate linked to a label and a binding reagent A can
be contacted with an cleaving enzyme and a binding reagent B (on a
solid phase) so as to form a first product linked to the label and
a second product linked to the solid phase (by an A:B linkage).
[0027] FIGS. 4(a), (b) and (c) show, schematically, three methods
by which a first substrate, linked to a binding reagent A, and a
second substrate, linked to a label, can be contacted with a
joining enzyme and a binding reagent B (on a solid phase) so as to
form a product linked to both the label and the solid phase (by an
A:B linkage).
[0028] FIGS. 5(a), (b), (c), (d), (e), and (f) illustrate six
different embodiments of a method for measuring the activity of
cleaving enzymes.
[0029] FIGS. 6(a), (b), (c), (d) and (e) illustrate five different
embodiments of a method for measuring the activity of joining
enzymes.
[0030] FIG. 7 illustrates a method for measuring the interaction of
a nucleic acid nucleic acid binding protein.
[0031] FIG. 8 illustrates a method for measuring the activity of
nucleic acid cleaving enzyme.
[0032] FIG. 9 the ECL signal measured in an ECL-based protease
assay as a function of the concentration of proteinase K.
DETAILED DESCRIPTION
[0033] The present application relates to assays for enzymes that
cleave a substrate into two or more products and/or join two or
more substrates to form a product. The invention also includes
assays for substrates and inhibitors of such enzymes. The enzyme
activity is typically measured by the ability of the enzyme to
modulate the ECL signal generated from an ECL label attached to a
substrate molecule. The invention also includes reagents and kits
for carrying out the methods of the invention. A kit for carrying
out the methods of the invention can comprise, in one or more
containers, at least two of the following components: enzyme,
substrate, solid phase, buffers appropriate for carrying out the
enzymatic reaction (e.g., mixtures of pH buffering substances,
detergents, salts, metal ions, cofactors, proteins, sugars,
excipients, and the like), solutions appropriate for carrying out
an ECL measurement, solutions appropriate for cleaning and/or
conditioning an ECL measuring device, ECL labels, calibration
solutions containing known concentrations of an enzyme, calibration
solutions containing a known concentration of an enzyme inhibitor,
and calibration solutions for calibrating the response of an ECL
measuring instrument. Suitable containers for such a kit include,
but are not limited to vials, bottles, boxes, tubes blister packs,
cartridges, syringes, microtiter plates, ampules, and the like.
[0034] As illustrated in FIG. 1, an enzyme 101 that catalyzes a
cleavage reaction can be assayed through the use of a substrate 102
that is linked to both a solid phase 103 and an ECL label 104, so
that the enzyme acts to separate the ECL label from the solid
phase. The activity of the enzyme can be measured by an ECL
measurement of the reduction of the number of ECL labels on the
solid phase and/or an ECL measurement of the increase in the number
of ECL labels in solution. In a different embodiment, illustrated
in FIG. 2, an enzyme 201 that catalyzes the joining of two or more
substrates is assayed through the use of a substrate 202 that is
linked to a solid phase 204 and another substrate 203 that is
linked to an ECL label 205, so that the enzyme acts to join the two
substrates and, therefore, link the ECL label to the solid phase.
The activity of the enzyme can be measured by an ECL measurement of
the increase of the number of ECL labels on the solid phase and/or
an ECL measurement of the decrease in the number of ECL labels in
solution.
The Solid Phase and Linking of Substrates
[0035] The term "solid phase" is understood to encompass a wide
variety of materials including solids, semi-solids, gels, films,
membranes, meshes, felts, composites, particles, and the like. The
solid phase can be non-porous or porous. Suitable solid phases
include those developed and/or used as solid phases in solid phase
binding assays (see, e.g., chapter 9 of Immunoassay, E. P.
Diamandis and T. K. Christopoulos eds., Academic Press: New York,
1996, hereby incorporated by reference).
[0036] Methods for linking substrate molecules (e.g., polypeptides,
polynucleotides, and polysaccharides) to solid phases are well
known and include methods used for immobilizing reagents on solid
phases for solid phase binding assays or for affinity
chromatography (see, e.g., Diamandis and Christopoulos cited above,
and Hermanson, Greg T., Immobilized Affinity Ligand Techniques,
Academic Press: San Diego, 1992, hereby incorporated by reference).
These methods include the non-specific adsorption of molecules on
the reagents on the solid phase as well as the formation of a
covalent bond between the reagent and the solid phase.
Alternatively, a substrate can be linked to a solid phase through a
specific interaction with a binding group present on the solid
phase (e.g., an antibody against a peptide substrate or a nucleic
acid complementary to a sequence present on a nucleic acid
substrate). In an advantageous embodiment, a substrate or product
labeled with a binding reagent A (also referred to as a capture
moiety) is contacted with a second binding reagent B present on the
surface of a solid phase, so as to link the substrate to the solid
phase through an A:B linkage. This approach is illustrated in FIGS.
3a-c (for assays of the activity of substrate cleaving enzymes) and
FIGS. 4a-c (for assays of the activity of substrate joining
enzymes). FIGS. 3a-c show that a substrate 302, linked to both a
label 304 and a binding reagent A, can be contacted with a cleaving
enzyme 301 prior to the formation of the A:B linkage (FIG. 3a),
during the formation of the A:B linkage (FIG. 3b), or
alternatively, after the formation of the A:B linkage (FIG. 3c)
linking binding reagent A with a second binding reagent B present
on the surface of the solid phase 303. Analogously, FIGS. 4a-c show
that substrate 402, linked to a binding reagent A, and substrate
403, linked to a label 405, can be contacted with a joining enzyme
401 prior to the formation of the A:B linkage (FIG. 4a), during the
formation of the A:B linkage (FIG. 4b), or alternatively, after the
formation of the A:B linkage (FIG. 4c) linking binding reagent A
with a second binding reagent B present on the surface of the solid
phase 404. Many examples of A:B pairs that can be used to link
molecules to a solid phase are known in the art, e.g.,
antibody-hapten pairs, receptor-ligand pairs, complementary nucleic
acid pairs, metal-metal ligand pairs, etc. In an especially
advantageous embodiment, the A:B linkage is a biotin streptavidin
interaction.
[0037] Solid phases particularly useful for ECL binding assays have
been described previously. One class of advantageous solid phases
for ECL assays are particles. See published PC applications
WO90/0530, WO89/04302, WO92/14138 and WO96/15440, said applications
hereby incorporated by reference, for a description of
particle-based reagents, methodology, and instrumentation for
carrying out ECL binding assays using particles as a solid phase.
These reagents, methodology and instrumentation can be adapted for
use in ECL-based enzyme assays according to this invention. In an
especially advantageous embodiment, magnetic particles (e.g.,
magnetic particles sold by Dynal, Seradyne, or Immunicon) are used
as the solid phase. These particles can be collected at an ECL
working electrode through the application of a magnetic field so as
to preferentially cause the excitation of ECL from ECL labels
linked to the particle, relative to ECL labels that are free in
solution. Thus the amount of label on the solid phase can be
measured in the presence of free label, labeled substrate, or
labeled product in solution. Labels linked to magnetic particles
can be induced to emit ECL preferentially (relative to labels in
solution) by using a magnetic field to hold the particles on the
electrode while free labels in solution are washed away.
Alternatively, the labels in solution can be measured
preferentially (relative to labels on magnetic particles) by
capturing the magnetic particles on a magnet distant from the
electrode used to induce ECL. There are several commercial
instruments available that are capable of measuring the ECL emitted
from magnetic particles collected, through the use of a magnetic
field, at an electrode (e.g., ORIGEN, IGEN International; Elecsys,
Boehringer-Mannheim; PicoLumi, Easai).
[0038] In an alternative embodiment, the solid phase is or
comprises an electrode for ECL measurements. The use of such solid
phase for ECL-based binding assays is described in PCT published
application WO98/12539, hereby incorporated by reference in its
entirety. The solid phases, instrumentation and methodology
described in the above mentioned application can be adapted for use
in the ECL-based enzyme assays of the present invention. Likewise,
the methodology described in the above mentioned application for
linking binding reagents to ECL electrodes can be applied to the
substrates and products of the current application. Suitable solid
phases include metal electrodes (e.g., gold and platinum), carbon
electrodes (e.g., electrodes comprising glassy carbon, carbon
black, graphite, carbon fibers, carbon nanotubes, and/or packed
beds of carbon fibers or nanotubes), and organic polymer-based
electrodes. An especially advantageous solid phase comprises a
composite of carbon nanotubes in a polymer, e.g., a commercial
plastic. Substrates and/or products can be linked to these and
other solid phases by known methods including direct adsorption,
covalent coupling, attachment to a film or coating on the solid
phase (e.g., molecules can be immobilized on gold electrodes by
attachment to a film of thiols coordinated to the gold surface, or
silicon electrodes by attachment to a film of silanes covalently
attached to silanols on the silicon surface), or by the formation
of a specific A:B linkage (as was previously described in the
present application). Advantageously, ECL labels in proximity to an
electrode surface (e.g., labels linked to enzyme substrates or
products present on the surface of the electrode) can be
preferentially induced to emit ECL, relative to ECL labels that are
free in solution. Thus the amount of label on the solid phase can
be measured in the presence of free label, labeled substrate, or
labeled product in solution. ECL labels in proximity to an
electrode surface can even more preferentially be induced to emit
ECL (relative to ECL labels in solution) by washing away the
unbound label prior to inducing an ECL response. Alternatively, a
solid phase distant from the electrode can be used to
preferentially induce ECL from labels not on the solid phase.
[0039] Substrates can be immobilized on different regions of one or
more solid phases to form a patterned array of substrates. Such a
patterned array having two or more regions comprising substrates
that differ in structure from each other could be used to
simultaneously measure the activity of two or more enzymes (the
substrates are chosen for their known specificity for a particular
enzyme of interest). A similar patterned array of a library of
substrates can be used to determine the substrate specificity of a
particular enzyme. By the application of solutions containing an
enzyme and an inhibitor to defined regions on a patterned array of
substrates, large numbers of inhibitors can be rapidly screened for
inhibitory ability. The measurement of the ECL from a patterned
array can be conducted by imaging with an array of light detectors
so that the ECL signal from different regions can be distinguished
and independently measured. Alternatively, the substrates can be
patterned on an array of independent electrodes so that labels in a
particular region can be selectively induced to emit ECL by the
selective application of voltage to selected electrodes. In this
alternative embodiment, imaging is not necessary.
ECL Labels
[0040] An ECL label is a chemical substance that, when
electrochemically oxidized or reduced under appropriate conditions,
emits light. The term "ECL label" or "electrochemiluminescent
label" refers to the substance itself, to a chemical derivative
that has been modified to allow attachment to substrate or other
reagent, or to a chemical derivative that is attached to a
substrate or other reagent. The term "ECL label" also refers to the
various products and/or intermediates formed from the label during
the ECL-generating reaction. Numerous ECL labels have been reported
in the literature (see the review by Knight et al., Analyst, 119,
879, 1994). Useful ECL labels include polyaromatic hydrocarbons
(e.g., 9,10-diphenylanthracene, rubrene, phenanthrene, pyrene, and
sulfonated derivatives thereof), organometallic complexes (e.g.,
complexes containing lanthanides, ruthenium, osmium, rhenium,
platinum, chromium, and/or palladium), organic laser dyes, and
chemiluminescent species (e.g., diacyl hydrazides such as luminol,
acridinium esters, luiferase, and lucigenin). The ECL signal can be
advantageously increased by using labels comprising a polymer or
particle platform linked to a plurality of individual ECL labels
(see, e.g., U.S. Pat. No. 5,679,519). Advantageous ECL labels are
luminol and polypyridyl (especially bipyridyl or
phenanthrolyl)-containing complexes of ruthenium, osmium or rhenium
(see, e.g., the complexes described in U.S. Pat. No. 5,714,089,
U.S. Pat. No. 5,591,581, U.S. Pat. No. 5,597,910, and published PCT
application WO87/06706. The most advantageous ECL labels are
ruthenium tris-bipyridyl (RuBpy) and its derivatives. The term
"RuBpy" refers to the substance itself, to a chemical deri
attachment to substrate or other reagent substrate (e.g.,
derivatives comprising one or more of the following substituents:
alkyl groups, amines, carboxylic acids, active esters or other
activated carboxylic acid derivatives, phosphoramidites,
hydrazides, alcohols, .alpha.,.beta.-unsaturated carbonyls,
aldehydes, ketones, halides or other leaving groups, thiols,
disulfides and the like), or to a chemical derivative that is
attached to a substrate or other reagent. The term "RuBpy" also
refers to the various products and/or intermediates formed from the
label during the ECL-generating reaction. RuBpy includes ruthenium
tris-bipyridyl coupled to a variety of different types of
biomolecules to form highly ECL active conjugates. The ECL
generated by oxidizing or reducing an ECL label at an electrode is
known, for many ECL labels, to be dramatically increased by the
addition of another species (the ECL coreactant) that is also
oxidized or reduced at the electrode (generally, to give a reactive
species that participates in a highly energetic reaction with the
oxidation or reduction product of the ECL label). For example,
hydrogen peroxide acts as an ECL coreactant for luminol. There are
several classes of useful ECL coreactants for RuBpy, its
derivatives, and the analogous osmium complexes, including:
persulfate, oxalate, pyruvate (and other .alpha.-keto carboxylic
acids), and amines (especially, tertiary amines). An advantageous
method for inducing ECL from RuBpy-containing substances in
biological assays is oxidation of the ECL label in the presence of
a solution containing tripropylamine.
The Enzymes
[0041] The term "enzyme" is understood to cover all polypeptides
(or analogs thereof) with catalytic activity (including naturally
occurring enzymes, genetically modified enzymes, chemically
modified enzymes, catalytic antibodies, enzyme fragments and
synthetic polypeptides), as well as nucleic acids (or analogs
thereof) with catalytic activity (including ribosomes, ribosomal
RNA, and ribozymes), synthetic enzyme models or mimics (for
example, synthetic molecules designed to mimic the catalytic site
of an enzyme), and enzyme cofactors that retain catalytic activity
in the absence of a protein component. The enzymes that can be
measured by this technique include enzymes that cleave a substrate
molecule into two or more products and/or enzymes that join two or
more substrates into a product. The enzymes can have both joining
and cleaving activity, as in the following examples: i) a cleaving
or joining enzyme that also catalyzes the reverse reaction (e.g.,
under appropriate conditions, proteases such as trypsin can
catalyze the formation of amide bonds) and ii) the enzyme (e.g., a
transferase) catalyzes the transfer of a moiety from a first
substrate (i.e., cleaving the moiety from the first substrate) to a
second substrate (i.e., joining the moiety to the second
substrate). Advantageously, the enzymes break or form a covalent
bond. Especially advantageous enzymes are enzymes that break or
form a covalent bond type from the following list: amide bond,
ester bond, phosphodiester bond (e.g., the bond linking nucleotides
in a polynucleotide), and disulfide bond. Some examples of classes
of enzymes that can be measured include the following: amidases,
proteases, peptidases, glycosidases, saccharases, glycopeptidases,
nucleases (including ribonucleases and deoxyribonucleases),
endonucleases (including restriction endonucleases), exonucleases,
ribosomes, ribosomal RNA, ribozymes, self-splicing molecules such
as introns or inteins, esterases, phosphodiesterases,
phosphorylases, AP endonucleases, polymerases (e.g., DNA or RNA
polymerases), nucleic acid repair proteins, amino peptidases,
carboxy peptidases, aminoacyl-tRNA synthetases, ADP-ribosyl
transferases, proteases of the complement pathway, proteases of the
thrombolytic pathways, transferases, endoglycosidases,
exoglycosidases, lipases, endoproteinases, glutathione
S-transferases, polysaccharide or oligosaccharide synthases (e.g.
glycosyl transferases or glycogen synthases), ligases,
ubiquitin-protein ligases, trans-glutaminases, integrases, and DNA
glycosylases (e.g., uracil-DNA glycosylases). The invention is not
limited to enzymes that catalyze the formation or cleavage of
covalent bonds; the invention also covers enzymes that catalyze the
formation or cleavage of non-covalent bonds or binding
interactions, e.g., enzymes that catalyze the hybridization or
dehybridization of nucleic acids (RecA and the like), proteins that
catalyze or promote the association of proteins (e.g., Factor Va),
peptides, and/or nucleic acids to form a complex, and proteins that
catalyze the association of the peptide subunits of a protein to
form a protein. The enzyme can catalyze a reaction that indirectly
leads to the joining or cleavage of substrate molecules, e.g., the
enzyme can catalyze a change in a substrate (e.g., phosphorylation
of a protein) that induces the substrate to bind to a second
molecule (e.g., a receptor specific for the phosphorylated
substrate). Similarly, the enzyme could catalyze a change in a
substrate (e.g., phosphorylation of a protein or modification of a
nucleic acid, that could target the substrate for degradation by a
second enzyme or reagent). In another such embodiment, the enzyme
converts a substrate from an inactive form to a catalytically
active form capable of cleaving or joining activity (e.g., Factor
Xa can be measured from its ability to convert the inactive
prothrombin into the catalytically active cleaving enzyme thrombin,
which is in turn measured through its ability to cleave a peptide
substrate). The invention is not only limited to measuring the
activity of joining or cleaving enzymes but can also be used to
measure the activity of other reagents with similar activity, e.g.,
metal complexes or oxidizing agents, photoactive cleaving or
crosslinking agents, alkylating agents, acids, bases and the like
that, that cleave bonds in nucleic acids, proteins, or
polysaccharides (see, e.g., the following publications, hereby
incorporated by reference: Grant et al. Biochemistry, 1996, 35,
12313-12319; U.S. Pat. No. 4,980,473; and Biochemistry, G. Zubay,
Ed., Addison-Wesley: Massachusetts, 1983).
The Substrates
[0042] The "substrates" that can be measured by the invention
include substrates that are cleaved by an enzyme into two or more
products and/or substrates that are joined by an enzyme into a
product. Advantageously, the substrates comprise polypeptides,
polysaccharides, nucleic acids, amino acids, nucleotides, and/or
sugars. The terms polypeptides and polysaccharides are understood
to encompass, respectively, oligopeptides and oligonucleotides. The
term nucleic acids is understood to encompass oligonucleotides and
polynucleotides. The substrates can comprise analogs of
polypeptides, polysaccharides, nucleic acids, amino acids,
nucleotides, and/or sugars, e.g., i) polypeptides comprising
unnatural amino acids, N-methyl amide linkages, and/or non-amide
linkages; ii) nucleic acid analogs comprising non-phosphodiester
linkages e.g., amide bonds (i.e., peptide nucleic acids--PNAs),
phosphorothioate linkages, and/or methyl phosphonate linkages; or
iii) polysaccharides comprising non-glycosidic linkages (e.g.,
thioglycosides). In some embodiments, the substrates can be
polypeptides, polynucleotides, or polysaccharides that comprise
both natural and unatural monomer units; the catalytic activity of
cleaving or joining enzymes can by this method be restricted to the
natural components of the substrate. The number of unnatural
monomer units in a substrate is advantageously between 1 and 999.
In assays of the activity of enzymes that take modified nucleic
acids or proteins as substrates (e.g., proteases specific for
phosphorylated proteins or peptides, protesases specific for
ubiquitinated proteins or peptides, DNA repair enzymes, etc.), the
substrates can include the modified sites recognized by the enzymes
(e.g., phosphorylated amino acids, ubiquinated amino acids,
methylated nucleotide base, alkylated nucleotide bases, oxidized
bases (e.g., 8-hydroxyguanine), cross-linked nucleic acid strands,
thymidine dimers, 6+4 photoproducts, nucleic acids with apurinic or
apyrimidinic sites, etc).
[0043] Substrates, advantageously, have functional groups (e.g.,
amino groups, carboxylic acids, active esters, acid halides,
hydroxyls, ketones, aldehydes, olefins, .alpha.,.beta.-unsaturated
carbonyls, a-halocarbonyls, hydrazides, imidazoles, thiols,
disulfides, halides or other leaving groups, photoactivatable
groups, etc.) that allow for the convenient chemical linkage of the
substrate to i) ECL labels, ii) solid phases, and/or iii) binding
groups (e.g., biotin) that allow attachment to complementary
binding groups (e.g., streptavidin) on a solid phase. For a list of
some useful linking chemistries and reagents, see the Pierce
Chemical Company Catalog and Handbook for 1994-1995 (Pierce
Chemical Co., Rockford, Ill.) and Hermanson, Greg T. Bioconjugate
Techniques Academic Press: New York, 1996, said publications hereby
incorporated by reference. The labeling and/or immobilization of
the substrate can be achieved by chemical treatment of the
substrate molecule with functional groups present on the label
and/or solid phase (e.g., amino groups, carboxylic acids, active
esters, acid halides, hydroxyls, ketones, aldehydes, olefins,
.alpha.,.beta.-unsaturated carbonyls, .alpha.-halocarbonyls,
hydrazides, imidazoles, thiols, disulfides, halides,
photoactivatable groups, etc.). By using standard coupling
chemistries known in the art, it is possible to conveniently
label/immobilize the natural substrate of an enzyme (the cost,
labor, and uncertainty of using unnatural or synthetic substrates
can be avoided). Control over the sites of labeling/immobilization
can be achieved by using coupling chemistries specific for a
particular functionality on a substrate (e.g., an oligonucleotide
that is 5'-modified with an amino group and 3'-modified with a
thiol group can be specifically labeled at the 5' position with the
NHS ester of biotin, and specifically labeled at the 3' position
with a maleimide derivative of RuBpy). In an alternative
embodiment, the substrate is chemically or enzymatically
synthesized using labeled (and/or chemically modified) components
so as to introduce labels (and/or points of attachment). For
example, labeled or chemically modified amino acids can be
introduced into defined positions of a polypeptide by solid phase
synthesis. Similarly, labeled or chemically modified nucleotides
(or phosphoramidites) can be introduced into defined positions of a
polynucleotide by solid phase synthesis. In one embodiment, the
solid phase support used in the synthesis of substrates by solid
phase synthesis is also used as the solid phase of the ECL enzyme
assay. In a different example, a polynucleotide substrate is
synthesized through a polymerase reaction run in the presence of
labeled and/or chemically modified nucleotides.
Cleaving Enzymes
[0044] The activity of cleaving enzyme is determined by measuring
the effect of the enzyme on the concentrations or amounts of an ECL
label in solution or on a solid phase. FIGS. 5a-f illustrate
different embodiments of the invention. The illustrated embodiments
are similar in that the enzyme 501 cleaves at least one linkage in
a substrate 502, the linkage linking one or more ECL labels 503
with a solid phase (or alternatively a moiety capable of being
immobilized on a solid phase) 504. The enzyme can cleave one
linkage in the substrate (FIGS. 5a,c,e) or more than one linkage
(FIGS. 5b,d). The substrate can comprise one ECL label (FIGS. 5a,b)
or more than one ECL label (FIGS. 5d-f). The products can include
more than one solution-phase product comprising an ECL label (FIGS.
5d-e) as well as solution-phase products not comprising an ECL
label (FIG. 5b). An individual product can comprise more than one
ECL label (FIG. 5c). The reactions can require additional
substrates that are not shown and/or could form additional products
that are not shown. FIG. 5f shows an assay for an enzyme with
transferase activity; the cleaved portion of the substrate is
transferred to a second substrate 505.
Joining Enzymes
[0045] The activity of a joining enzyme is also determined by
measuring the effect of the enzyme on the concentrations or amounts
of an ECL label in solution or on a solid phase. FIGS. 6a-e
illustrate different embodiments of the invention. The illustrated
embodiments are similar in that the enzyme 601 forms at least one
linkage joining substrates 602, the linkage linking one or more ECL
labels 603 with a solid phase (or alternatively a moiety capable of
being immobilized on a solid phase) 604. The enzyme can form one
linkage in the product (FIGS. 6a,c,e) or more than one linkage
(FIGS. 6b,d). The product can comprise one ECL label (FIGS. 6a,b)
or more than one ECL label (FIGS. 6d-f). The substrates can include
more than one solution-phase substrate comprising an ECL label
(FIGS. 6d-e) as well as solution-phase substrates not comprising an
ECL label (FIG. 6b). An individual substrate can comprise more than
one ECL label (FIG. 6c). The reactions can require additional
substrates that are not shown and or form additional products that
are not shown.
[0046] Joining activity can be measured that joins a plurality of
substrates to form a large aggregate. For example, thrombin can be
measured by using a substrate mixture containing fibrinogen labeled
with an ECL label and fibrinogen linked to a solid phase (or
alternatively to a capture moiety). The enzyme activity converts
the fibrinogen into a fibrin clot comprising a plurality of fibrin
monomers; the clot comprises both ECL labels and links to one or
more solid phases (or one or more capture moieties). The thrombin
activity is, therefore, directly related to the quantity of ECL
labels on a solid phase or linked to a capture moiety. The fibrin
clot dissociates in dilute acid, but the transglutaminase A.sub.2
crosslinks the fibrin clot to form an acid-stable clot.
Transglutaminase A.sub.2 in a sample can, therefore, be measured by
treating the sample with a thrombin induced clot (prepared as in
the abovementioned thrombin assay) as a substrate and measuring the
quantity of ECL labels on the solid phase after treatment of the
clot with dilute acid. Transglutaminase A.sub.2 also joins other
proteins to fibrin during clot formation (e.g.,
alpha.sub.2-antiplasmin and Factor V). By analogy to the general
scheme for measuring joining enzymes, transgluminase can be
measured, e.g., by its activity for joining fibrin labeled with an
ECL-label and .alpha.sub.2-antiplasmin into a clot. See Blood:
Principles and Practice of Hematology, R. Handin et al., Eds., J.
B. Lippencott Co.: Philadelphia, 1995, hereby incorporated by
reference, for more information on joining and cleaving enzymes
present in blood).
Enzyme Assays
[0047] The present methods can be used to assay an enzyme of
interest. Generally, such an assay involves mixing a sample
containing an unknown quantity of the enzyme with a predetermined
quantity of one or more substrates and determining the amount or
activity of the enzyme through a measurement of ECL. The invention
can also be used to measure conditions or factors that can
influence the activity of an enzyme, e.g., temperature, pH, enzyme
inhibitors, denaturing compounds, enzyme activators, enzyme
deactivators and the like.
Enzyme Inhibition Assays
[0048] The present methods can also be used to assay an enzyme
inhibitor and/or to measure the inhibitory ability of test
compound. Generally, such an assay involves mixing a sample of
unknown inhibitory ability (e.g., a sample containing an unknown
quantity of a known inhibitor or a sample containing a test
compound) with a predetermined quantity of an enzyme and one or
more substrates, and determining the ability of the sample to
inhibit the enzyme through a measurement of ECL.
Assays for Enzyme Substrates
[0049] The present methods can also be used to assay an enzyme
substrate. Generally, such an assay involves mixing a sample
containing an unknown quantity of an enzyme substrate with a
predetermined quantity of an enzyme (and, if required, one or more
additional substrates) and measuring the formation of product
through an ECL measurement. The invention can also be used to
determine if a substance is accepted as a substrate by an enzyme.
Generally, such an assay involves mixing a sample containing a
possible enzyme substrate with a predetermined quantity of an
enzyme (and, if required, one or more additional substrates) and
measuring the formation of product through an ECL measurement.
[0050] Furthermore, the invention can be used to monitor a second
reaction (in addition to the enzyme reaction) that modulates the
amount of an enzyme substrate and/or the ability of a substrate to
act as a substrate in the enzyme reaction. The ECL enzyme assay is
used, e.g., to measure the presence of substrates, products, or
catalysts of the second reaction. In one such embodiment, the
ability of a substance to act as a substrate for an enzyme is
modulated as the result of a binding reaction (i.e., said second
reaction is a binding reaction). In the case of nucleic acids as
substrates for nucleases, these binding reactions include: the
binding of a single stranded nucleic acid with a complementary
nucleic acid sequence; the binding of a double stranded nucleic
acid with a triple helix forming molecule such as a nucleic acid, a
peptide nucleic acid (PNA), a minor or major groove binding peptide
(e.g., distamycin and polyamides containing hydroxypyrrole,
imidazole and/or pyrrole such as those described in White et al.
Nature, 1998, 391, 468, hereby incorporated by reference), and/or a
nucleic acid binding protein. In one example, the ability of a
ribonuclease specific for single stranded RNA to cleave a first RNA
sequence is modulated by the presence of a complementary sequence
that can participate in a hybridization reaction with the first
sequence; this effect provides the basis for the measurement of the
complementary sequence in a sample. In a second example, the
binding of a nucleic acid binding protein to a nucleic acid can
block the ability of a nuclease to cleave the nucleic acid; this
effect can be used to determine the quantity, binding ability, or
specificity of a nucleic acid binding protein in a sample. The
effect can also be used to measure the ability of a sample (or
components of a sample) to inhibit the interaction between a
nucleic acid and a nucleic acid binding protein.
[0051] Enzymes (e.g., proteases specific for phosphorylated
proteins or peptides, protesases specific for ubiquitinated
proteins or peptides, DNA repair enzymes, etc.), that take modified
nucleic acids or proteins as substrates (e.g., phosphorylated amino
acids, ubiquinated amino acids, methylated nucleotide base,
alkylated nucleotide bases, oxidized bases such as 8
hydroxyguanine, cross-linked nucleic acid strands, thymidine
dimers, 6+4 photoproducts, nucleic acids with apurinic or
apyrimidinic sites, etc.) can be used to measure these substrates
and, therefore, to measure enzymes, drugs, reagents, toxins, and/or
conditions that cause or repair these modifications (e.g., the
causation or repair of said modifications can be the above
mentioned second reaction).
Kits for Carrying out the Present Methods
[0052] The present application also provides reagents and kits for
carrying out the methods of the invention. A kit for carrying out
the methods of the invention can comprise, in one or more
containers, at least two of the following components: enzyme,
substrate, solid phase, buffers appropriate for carrying out the
enzymatic reaction (e.g., mixtures of pH buffering substances,
detergents, salts, metal ions, cofactors, proteins, sugars,
excipients, and the like), solutions appropriate for carrying out
an ECL measurement, solutions appropriate for cleaning and/or
conditioning an ECL measuring device, calibration solutions
containing known concentrations of an enzyme, calibration solutions
containing a known concentration of an enzyme inhibitor, and
calibration solutions for calibrating the response of an ECL
measuring instrument. These components can be supplied in dry
and/or liquid form. Kits for measuring the interaction between
nucleic acids and a nucleic acid binding protein can additionally
include one or more of the following components: nucleic acid
substrate, nucleic acid binding protein, calibration solutions
containing known amounts of a DNA binding protein, calibration
solutions containing a known amount of a nucleic acid substrate, or
calibration solutions containing a known amount of an inhibitor of
a protein-nucleic acid interaction.
Assay Formats
A. Method for Assay in a Sample for the Presence of a Nucleic Acid
Binding Protein
[0053] In one embodiment of the present methods, the interaction of
a nucleic acid binding protein with a nucleic acid is measured
using a nuclease or chemical protection approach. This approach
makes use of the ability of a nucleic acid binding protein, when
bound to a nucleic acid, to protect (fully or partially) the
phosphodiester backbone of the nucleic acid from cleavage by a
nucleic acid cleaving enzyme or reagent. The binding of the protein
to the nucleic acid can be monitored by measuring the extent of the
cleavage reaction (e.g., by measuring the decrease in the amount of
substrate and/or the increase in the amount of product). The
protection of a nucleic acid by a nucleic acid binding protein can
be used to measure the amount of a nucleic acid binding protein in
a sample, to measure the affinity of a binding protein for a
nucleic acid sequence, to screen for peptides or proteins capable
of binding a specific sequence, to screen for a nucleic acid
sequence that is bound by a specific protein, and/or to screen for
inhibitor substances that inhibit the interaction. The method is
easily adaptable to use in high throughput screening. Libraries of
compounds (e.g., substrates, proteins, peptides, inhibitors)
include libraries of more than 100 compounds, or advantageously,
libraries of more than 10,000 compounds, or most advantageously,
libraries with more than 1,000,000 compounds.
[0054] The proteins or peptides that can be measured by this method
include, but are not limited to, proteins that bind nucleic acids
to regulate nucleic acid translation, transcription, reproduction,
editing, localization, degradation, repair, etc. They also include
triple helix-forming nucleic acid sequences, nucleic acid binding
toxins, antibiotics, and regulatory proteins from bacteria,
viruses, and other sources. The proteins or peptides can be from
natural sources or man-made. The proteins can bind to specific
nucleic acid sequences or alternatively can have limited or no
sequence specificity.
[0055] Advantageously, the cleaving enzyme or reagent shows a
greater than 20 fold preference for the unprotected nucleic acid
vs. the protected nucleic acid. Enzymatic cleavage reagents (e.g.
nucleases) can be selected by screening for enzymes according to
their selectivity for the unprotected nucleic acid substrate of an
assay. Non-enzymatic cleavage reagents include transition metal
complexes capable of oxidizing nucleic acid (advantageously linked
to a nucleic acid binding moiety or intercalater), photoactivated
cleaving reagents, acids, bases, and the reagents used for cleaving
DNA in Maxam-Gilbert sequencing (e.g., dimethylsulfate/heat/alkali,
dimethylsulfate/acid/alkali, hydrazine/piperidine). In an alternate
embodiment, the nucleic acid binding protein protects the nucleic
acid from a chemical, enzymatic and/or photochemical modification
for example, methylation, alkylation (e.g., by a cancer therapeutic
agent), oxidation (e.g., to form 8-hydroxyguanine), base excision,
strand cross linking, formation of thymidine dimers, formation of
6+4 photoproducts, etc.) that make the nucleic acid more
susceptible to a second enzyme or reagent that, e.g., cleaves
nucleic acids (e.g., a methylated nucleic acid specific nuclease or
an AP endonuclease).
[0056] The predetermined (except in the case of an enzyme activity
with random specificity) nucleic acid substrates can be single or
double stranded or comprise regions of both. Advantageously, the
nucleic acid substrate is 4-1000 kilobases in length, more
advantageously 4-100 kilobases in length, and most advantageously
4-30 kilobases in length. The nucleic acid substrate comprises a
protein binding site, for example a sequence specific for a protein
of interest; the substrate also comprises a site capable of being
cleaved by a nucleic acid cleaving enzyme or reagent.
Advantageously, the binding protein, nucleic acid substrate, and/or
the cleaving enzyme/reagent are chosen so that the cleavage site
lies within the protein binding site and the protective effect is
maximized. In some cases there can be additional cleavage sites
(e.g., sites falling outside of the protein binding site)) that are
not sufficiently protected by the binding protein. These additional
cleavage sites are advantageously protected from cleavage by the
use of nucleic acid analogs that are resistant to cleavage, e.g.,
nucleotides that are linked by amide bonds (e.g., peptide nucleic
acids), phosphorothioate bonds, or methyl phosphonate bonds. In an
advantageous embodiment, the region of the nucleic acid within the
protein binding site comprises nucleotides linked by phosphodiester
bonds (advantageously such a region comprises from 2-100, more
advantageously from 2-50, and most advantageously 4-14 nucleotides
linked by phosphodiester bonds); the region outside the protein
binding site comprises nucleotides linked by phosphorothioate
bonds. Advantageously, a nucleic acid containing unnatural
nucleotides comprises from 1 to 999 unnatural nucleotides.
[0057] The measurements of the decrease in the amount of substrate
or the increase in the amount of product can be measured by any
technique that can be used to measure a nucleic acid of e.g., a
particular size, sequence, composition, and/or charge. For example
substrates or products can be measured by chemical analysis (e.g.,
mass spectrometry, chromatography, electrophoresis, NMR, nucleic
acid sequencing, etc.) or by hybridization (e.g., Northern blots,
southern blots, solid phase binding assays, fluorescence energy
transfer methods such as the use of molecular beacons, etc.--see,
e.g., Nonradioactive Labeling and Detection of Molecules, Kessler,
C., ed., Springer-Verlag: Berlin, 1992 and Keller, G. H.; Manak, M.
M. DNA Probes, 2nd Ed., MacMillan Publishers Ltd.: London, 1993,
each of these books, hereby, incorporated by reference).
Nucleic Acid Substrates that Comprise a Detectable Label and are
Linked (or Capable of Being Linked) to a Solid Phase.
[0058] In one embodiment of the assays for nucleic acid-protein
interactions, the nucleic acid substrate comprises one or more
detectable labels and is also linked to a solid phase (or,
alternatively, comprises one or more moieties capable of being
captured at a solid phase, e.g., biotin, a specific nucleic acid
sequence, a hapten, a ligand, etc.). The nucleic acid substrate is
constructed in such a way that one or more of the labels are
separated from the solid phase (or, alternatively, the capture
moieties) by a sequence of nucleotides that comprise both a protein
binding sequence and a site capable of being cleaved by a nuclease.
The regions of the nucleic acid outside the protein binding site
can advantageously comprise nucleotides linked by
cleavage-resistant linkages (e.g., phosphorothioate linkages) to
prevent cleavage of the nucleic acid in regions that can't be
protected by the nucleic acid binding protein. In a protein binding
assay, the nucleic acid substrate is mixed with the protein sample,
advantageously in a buffer that promotes the association of the
protein with the nucleic acid. The sample is subsequently mixed
with a nucleic acid-cleaving enzyme, advantageously for a defined
length of time and at a defined temperature. The amount of the
detectable label on the solid phase or free in solution is then
measured (if necessary, after capturing the capture moieties by
contacting the mixture with a solid phase) to determine the extent
of substrate cleavage and therefore the amount of protein-nucleic
acid complex that formed. The binding of the protein to the nucleic
acid results in an increase in the label on the solid phase and a
decrease in the label in solution. Detectable labels that can be
used include, but are not limited to, enzymes, radioisotopes,
fluorescent labels, chemiluminescent labels, ECL labels,
bioluminescent labels, electrochemically detectable labels,
magnetic labels, optically detectable particles such as colloidal
gold, etc. In one embodiment of the invention, an array of labeled
nucleic acids is immobilized on a solid phase (advantageously an
electrode), e.g., to determine the consensus sequence of one or
more nucleic acid binding proteins in a sample. In this example,
detectable labels on array elements comprising a consensus sequence
are protected from treatment with a nuclease and remain largely on
the solid phase, while detectable labels on array elements without
a consensus sequence are cleaved off by treatment with a
nuclease.
Nucleic Acid Substrates that Comprise an ECL Label and are Linked
(or Capable of Being Linked) to a Solid Phase.
[0059] In a advantageous embodiment of the assays for nucleic
acid-protein interactions (illustrated in FIG. 7), the nucleic acid
substrate comprises one or more ECL labels and is also linked to a
solid phase (or, alternatively, comprises one or more moieties
capable of being captured at a solid phase, e.g., biotin, a
specific nucleic acid sequence, a hapten, a ligand, etc.).
Advantageous ECL labels include luminol and bipyridyl- or
phenanthrolyl-containing complexes of Ru, Os and Re. An especially
advantageous label is RuBpy. The nucleic acid substrate is
constructed in such a way that one or more of the labels are
separated from the solid phase (or, alternatively, the capture
moieties) by a sequence of nucleotides that comprise both a protein
binding sequence and a site capable of being cleaved by a nuclease.
The regions of the nucleic acid outside the protein binding site
can advantageously comprise nucleotides linked by
cleavage-resistant linkages such as phosphorothioate linkages to
prevent cleavage of the nucleic acid in regions that can't be
protected by the nucleic acid binding protein. In a protein binding
assay, the nucleic acid substrate is mixed with the protein sample,
advantageously in a buffer that promotes the association of the
protein with the nucleic acid. The sample is subsequently mixed
with a nucleic acid-cleaving enzyme, advantageously for a defined
length of time and at a defined temperature. The amount of the
detectable ECL label on the solid phase or free in solution is then
measured (if necessary, after capturing the capture moieties by
contacting the mixture with a solid phase) to determine the extent
of substrate cleavage and therefore the amount of protein-nucleic
acid complex that formed. The binding of the protein to the nucleic
acid results in an increase in the label on the solid phase and a
decrease in the label in solution. In one advantageous embodiment,
the solid phase is a magnetic bead and the ECL label on the solid
phase is measured after using a magnetic field to capture the beads
on an electrode for inducing ECL, e.g., through the use of an
ORIGEN analyzer. In a different advantageous embodiment, the solid
phase is an electrode (e.g., a composite comprising carbon
nanotubes in polymeric matrix) and the ECL label on the solid phase
is measured by applying a potential at the electrode so as to
induce the ECL labels to electrochemiluminesce. These measurements
of ECL labels are, highly quantitative, sensitive, and precise.
Advantageously the assay has a detection limit (for measuring a
nucleic acid binding protein, its nucleic acid partner, or an
inhibitor of the interaction) of less than 1 mmol, more
advantageously, the detection limit is less than 1 pmol, even more
advantageously, the detection limit is less than 1 fmol, even more
advantageously, the detection limit is less than 1 amol.
Nucleic Acid Substrates for Measuring DNA-Protein Interactions by
the Fluorescence Resonance Energy Transfer (FRET) Technique.
[0060] In another advantageous embodiment of the assays for nucleic
acid-protein interactions, the nucleic acid substrate is linked to
one or more fluorescence energy donors and one or more fluorescence
energy acceptors (one with skill in the art of FRET assays can
select appropriate donors and acceptors and appropriate substrate
structures for a particular assay so as to produce efficient energy
transfer from donor to acceptor). In one embodiment of a FRET assay
for measuring protein-nucleic acid interactions, the nucleic acid
substrate is constructed in such a way that at least one of the
donors is separated from at least one of the acceptors by a
sequence of nucleotides that comprise both a protein binding
sequence and a site capable of being cleaved by a nuclease. The
regions of the nucleic acid outside the protein binding site can
advantageously comprise nucleotides linked by cleavage-resistant
linkages such as phosphorothioate linkages to prevent cleavage of
the nucleic acid in regions that can't be protected by the nucleic
acid binding protein. In a protein binding assay, the nucleic acid
substrate is mixed with the protein sample, advantageously in a
buffer that promotes the association of the protein with the
nucleic acid. The sample is subsequently mixed with a nucleic
acid-cleaving enzyme, advantageously for a defined length of time
and at a defined temperature. The cleavage of the substrate leads
to a decrease in the amount of fluorescence energy transfer due to
an increase in the distance between the donor and acceptor
moieties. This decrease in energy transfer can be measured by
measuring the increase in the fluorescence intensity from the donor
and/or by measuring the decrease in intensity of the acceptor
(resulting from excitation of the donor). The more nucleic acid
binding protein that is present, the less cleavage is observed and,
therefore, the lower the fluorescence signal due to the donor and
the higher the fluorescence signal due to the acceptor.
B. Method for Assaying a Sample for the Presence of an Enzyme
Activity that Joins Nucleic Acids
[0061] In another embodiment of the present invention, an enzyme of
interest that forms nucleic acid linkages between nucleic acids
and/or nucleotides is measured in a sample by combining the sample
with at least one, advantageously two, predetermined (except in the
case of an enzyme activity with random specificity) nucleic acid
(and/or nucleotide) substrates, wherein at least one of said
substrates comprises one or more ECL labels (advantageously luminol
or bipyridyl- or phenanthroline-containing complexes of Ru or Os,
most advantageously RuBpy) and at least one other of said substrate
is linked to a solid phase (advantageously, a magnetic bead or an
electrode). The nucleic acid substrates can be single or double
stranded or comprise regions of both. Advantageously, the nucleic
acid substrate is 4-1000 kilobases in length, more advantageously
4-100 kilobases in length, and most advantageously 4-30 kilobases
in length. The substrates are designed or prepared so that the
enzymatic reaction links at least one ECL label on a substrate to a
solid phase. The extent of enzymatic joining is determined by a
measurement of the ECL labels that couple to the solid phase.
Increased enzymatic activity leads to an increase in the coupling
of the ECL labels to the solid phase and, therefore, an increase in
ECL signal. Alternatively, the extent of enzymatic cleavage can be
determined by a measurement of the ECL labels that remain free in
solution (e.g., the ECL from ECL labels in solution can be
preferentially measured at an electrode in the presence of ECL
labels present on particulate solid phases in suspension). In this
alternative embodiment, increased enzymatic activity results in a
decrease in ECL signal.
[0062] These measurements of ECL labels are highly quantitative,
sensitive, and precise. Advantageously the assay has a detection
limit (for measuring a nucleic acid cleaving enzyme, its
substrates, or an inhibitor of the enzyme) of less than 1 nmol,
more advantageously, the detection limit is less than 1 pmol, even
more advantageously, the detection limit is less than 1 fmol, even
more advantageously, the detection limit is less than 1 amol.
[0063] Advantageously, the enzyme sample is contacted with the
nucleic acid and/or nucleotide substrates for a defined period of
time under defined conditions (e.g., temperature, pH, etc.) prior
to the ECL measurement. In alternate embodiments, the nucleic acid
and/or nucleotide substrates do not include substrates that are
linked to a solid phase but include substrates that comprise
moieties that can be captured on a solid phase (e.g., biotin,
specific nucleic acid sequences, ligands or haptens). The substrate
can be captured on a solid phase by contacting the substrate with a
solid phase comprising groups capable of binding to said moieties;
this contacting can be accomplished prior to, during, and/or after
the sample is contacted with the enzyme sample. In a different
embodiment, the substrate is non-specifically captured on a solid
phase.
[0064] Classes of nucleic acid joining enzymes that can be measured
include polymerase, enzymes that covalently join nucleic acid
molecules including proteins involved with DNA recombination (e.g.
integrases & recombinases), as well as DNA and RNA ligases.
[0065] An example of a format of the type mentioned herein is that
of a strand transfer assay for the enzyme integrase. In this
format, a viral-specific donor DNA sequence that comprises a biotin
is attached to magnetic beads via a biotin-streptavidin
interaction. This configuration allows one to pre-bind. the donor
with integrase and wash the unbound enzyme prior to the addition of
target DNA linked to RuBpy. The integrase first randomly nicks the
RuBpy-labeled target molecules. DNA strand transfer catalyzed by
integrase leads to the formation of a covalent bond between the 3'
end of the biotinylated donor molecule and the 5' end of the nicked
RuBpy-labeled target molecule leading to an increase in the ECL
signal from RuBpy on the magnetic beads, as measured using an
ORIGEN analyzer.
C. Method for Assaying a Sample for an Enzyme Activity that Cleaves
Nucleic Acids that Results in a Decrease in ECL Signal
[0066] In an embodiment of the present invention, an enzyme of
interest that cleaves nucleic acids (e.g., a nuclease, Dnase,
Rnase, or restriction endonuclease) is measured in a sample by
combining the sample with a predetermined (except in the case of an
enzyme activity with random specificity) nucleic acid substrate
capable of being cleaved by the enzyme of interest, wherein said
substrate comprises one or more ECL labels (advantageously
bipyridyl- or phenanthroline-containing complexes of Ru or Os, most
advantageously RuBpy) and said substrate is linked to a solid phase
(advantageously a magnetic bead or an electrode). The enzyme can be
specific for a specific nucleic acid sequence or structure, or can
have limited or no specificity. The nucleic acid substrate can be
single stranded or double stranded or have regions of both.
Advantageously, the nucleic acid substrate is 4-1000 kilobases in
length, more advantageously 4-100 kilobases in length, and most
advantageously 4-30 kilobases in length. The substrate is designed
or prepared so that the enzymatic reaction decouples at least one
ECL label on a substrate molecule (advantageously, all the ECL
labels on the substrate) from the solid phase. The extent of
enzymatic cleavage is determined by a measurement of the ECL labels
remaining on the solid phase. Increased enzymatic activity leads to
an increase in the decoupling of the ECL labels from the solid
phase and, therefore, a decrease in ECL signal. Alternatively, the
extent of enzymatic cleavage can be determined by a measurement of
the ECL labels released from the solid phase into solution (e.g.,
the ECL from ECL labels in solution can be preferentially measured
at an electrode in the presence of ECL labels present on
particulate solid phases in suspension). In this alternative
embodiment, increased enzymatic activity results in an increase in
ECL signal.
[0067] These measurements of ECL labels are highly quantitative,
sensitive, and precise. Advantageously the assay has a detection
limit (for measuring a nucleic acid cleaving enzyme, its nucleic
acid substrate, or an inhibitor of the enzyme) of less than 1 nmol,
more advantageously, the detection limit is less than 1 pmol, even
more advantageously, the detection limit is less than 1 fmol, even
more advantageously, the detection limit is less than 1 amol.
Advantageously, the sample is contacted with the nucleic acid
substrate for a defined period of time under defined conditions
(e.g., temperature, pH, etc.) prior to the ECL measurement. In
alternate embodiments, the protein or peptide substrate is not
linked to a solid phase but comprises moieties that can be captured
on a solid phase (e.g., biotin, specific nucleic acid sequences, or
haptens); one of these embodiments in illustrated in FIG. 8. The
substrate can be captured on a solid phase by contacting the
substrate with a solid phase comprising groups capable of binding
to said moieties; this contacting can be accomplished prior to,
during, and/or after the sample is contacted with the enzyme
sample. In a different embodiment, the substrate is
non-specifically captured on a solid phase.
[0068] A protocol for an ECL-based assay for measuring the
enzymatic cleavage of viral specific sequences by viral integrase
is described in detail below. Integrase is a retroviral enzyme that
possesses several distinct catalytic activities including those
that promote processing and strand transfer functions. The
processing activity functions to cleave the DNA copy of the
retroviral genome in a sequence-specific fashion between the GA and
CT bases of a GACT sequence. This activity is necessary for the
integration of the viral DNA into the host genome. The assay
measures the cleavage of a double stranded nucleic acid substrate
(advantageously having a length of between 18-30 bases) comprising
a GACT sequence on one of the 3' ends, a biotin on one end, and a
RuBpy label on the other end.
[0069] The substrate (advantageously, at a concentration of between
0.1 and 200 uM) in a buffered solution (advantageously, at a pH of
between 6.5-8.0 and containing a cation such as manganese or
magnesium at a concentration of between 10-100 mM) is combined with
the integrase sample and incubated (advantageously, at a
temperature between 24-37.degree. C. for between 5-1000 min.).
Streptavidin-coated magnetic particles (advantageously, between
5-50 ug or Streptavidin DynaBeads) are then added and the
suspension mixed for 10 min. The ECL from RuBpy remaining on the
magnetic beads or released into solution is measured on an ORIGEN
analyzer (IGEN International) running, respectively, in magnetic
capture or solution phase modes. The integrase activity is directly
related to the ECL from RuBpy released into solution and correlates
with a drop in ECL from RuBpy on the magnetic beads.
D. Method for Assaying a Sample for the Presence of an Enzyme
Activity that Cleaves Peptides or Proteins
[0070] In another embodiment of the present invention, an enzyme of
interest that cleaves peptides or proteins (e.g., a protease or a
peptidase) is measured in a sample by combining the sample with a
predetermined (except in the case of an enzyme activity with random
specificity) protein or peptide substrate capable of being cleaved
by the enzyme of interest, wherein said substrate comprises one or
more ECL labels (advantageously, bipyridyl- or
phenanthroline-containing complexes of Ru or Os, most
advantageously RuBpy) and said substrate is linked to a solid phase
(advantageously a magnetic bead or an electrode). The enzyme can be
specific for a specific protein or peptide sequence or structure,
or can have limited or no specificity. The substrate is designed or
prepared so that the enzymatic reaction decouples at least one ECL
label on a substrate molecule (advantageously all the ECL labels on
the substrate) from the solid phase. Advantageously, the substrate
is 4-1000 amino acids in length, more advantageously 4-100 amino
acids in length, and most advantageously 4-40 amino acids in
length. The extent of enzymatic cleavage is determined by a
measurement of the ECL labels remaining on the solid phase.
Increased enzymatic activity leads to an increase in the decoupling
of the ECL labels from the solid phase and, therefore, a decrease
in ECL signal. Alternatively, the extent of enzymatic cleavage can
be determined by a measurement of the ECL labels released from the
solid phase into solution (e.g., the ECL from ECL labels in
solution can be preferentially measured at an electrode in the
presence of ECL labels present on particulate solid phases kept in
suspension). In this alternative embodiment, increased enzymatic
activity results in an increase in ECL signal.
[0071] These measurements of ECL labels are highly quantitative,
sensitive, and precise. Advantageously the assay has a detection
limit (for measuring a protein cleaving enzyme, its substrate, or
an inhibitor of the enzyme) of less than 1 nmol, more
advantageously, the detection limit is less than 1 pmol, even more
advantageously, the detection limit is less than 1 fmol, even more
advantageously, the detection limit is less than 1 amol.
[0072] Advantageously, the sample is contacted with the protein or
peptide substrate for a defined period of time under defined
conditions (e.g., temperature, pH, etc.) prior to the ECL
measurement. In alternate embodiments, the protein or peptide
substrate is not linked to a solid phase but comprises moieties
that can be captured on a solid phase (e.g., biotin, specific
nucleic acid sequences, or haptens). The substrate can be captured
on a solid phase by contacting the substrate with a solid phase
comprising groups capable of binding to said moieties; this
contacting can be accomplished prior to, during, and/or after the
sample is contacted with the enzyme sample. In a different
embodiment, the substrate is non-specifically captured on a solid
phase.
E. Method for Assaying for the Presence of a Specific Nucleic Acid
Sequence
[0073] In another embodiment of the present invention, a nucleic
acid sequence of interest in a sample is measured by combining the
sample with a predetermined (with respect to at least 10
nucleotides) nucleic acid probe (advantageously 8 to 10,000
nucleotides, more advantageously 15 to 1000 nucleotides) comprising
a sequence complementary (or partially complementary) to the
sequence of interest, said probe comprising an ECL label
(advantageously a bipyridyl- or phenanthroline-containing complex
of Ru or Os, most advantageously RuBpy) and a moiety capable of
being captured on a solid phase (advantageously, biotin, a specific
nucleic acid sequence, or a hapten). This combining is
advantageously carried out in a buffer solution and a temperature
(advantageously 0-100.degree. C., most advantageously, 4-70.degree.
C.) that promotes the specific hybridization of the sequence of
interest with its complementary sequence. The sample is then
incubated with a nucleic acid-cleaving enzyme specific for
single-stranded nucleic acid molecules (e.g., RNase A, mung bean
nuclease, or nuclease S.sub.1). The resulting mixture is contacted
with a solid phase capable of capturing said moiety and the
captured ECL labels are measured by ECL (e.g., on an ORIGEN
analyzer, IGEN International. The ECL signal increases with the
amount of labeled nucleic acid hybridized to the sequence of
interest and thus serves as a direct measure of the quantity of
specific sequence found in the nucleic acid sample preparation. In
an alternate embodiment, the ECL labeled probe is directly linked
to a solid phase and the solid phase is present during the binding
and cleavage reactions. In another alternate embodiment, a nuclease
specific for double stranded nucleic acids is used (e.g., nuclease
BAL 31 or exonuclease III); in this embodiment, specific
hybridization leads to a decrease in ECL signal from ECL labels on
the solid phase.
[0074] These measurements of ECL labels are highly quantitative,
sensitive, and precise. Advantageously the assay has a detection
limit (for measuring a nucleic acid sequence) of less than 1 nmol,
more advantageously, the detection limit is less than 1 pmol, even
more advantageously, the detection limit is less than 1 fmol, even
more advantageously, the detection limit is less than 1 amol.
EXAMPLES
[0075] The following Examples are illustrative, but not limiting of
the compositions and methods of the present invention. Other
suitable modifications and adaptations of a variety of conditions
and parameters normally encountered which are obvious to those
skilled in the art are within the spirit and scope of this
invention.
Example 1
DNase Protection Assay for the Assessment of DNA-Protein
Interactions
[0076] This example illustrates the use of the invention to measure
protein-DNA interactions, specifically, the binding of the
transcription factor NFk.beta. with its consensus DNA sequence. A
schematic depicting the assay format can be found in the detailed
description of the invention. DNAse 1 and NFk.beta. were purchased
from Promega Corp. A DNA substrate containing a consensus DNA
sequence for NFk was prepared by Midland Certified Reagent Co. by
solid phase synthesis. The sequence of the substrate is shown
below. The nucleotides shown in brackets were linked by
phosphorothioate linkages; the other linkages were standard
phosphodiester bonds. One of the strands of the double stranded DNA
substrate was labeled at the 5'-end with RuBpy and at the 3'-end
with biotin using standard labeling techniques.
TABLE-US-00001 (SEQ ID NO 1)
5'-RuBpy-[AGTTGAGG]GGACTTT[CCCAGGC]-Biotin-3' (SEQ ID NO 2)
TCAACTCCCCTGAAAGGGTCCG-3'
[0077] The labeled DNA substrate (50 fmol), poly dI-dC (1 ug, to
reduce non-specific protein-DNA interactions) and varying amounts
of recombinant NFk.beta. (p50 subunit) were combined in a 20 uL
volume and incubated for 30 min. at room temperature. Dnase 1 (2
Units in a volume of 2 uL, Promega Corp.) was then added and the
incubation was continued for an additional 30 min. at room
temperature. The reaction was terminated and the biotin-labeled DNA
sequences captured by in the addition of 10.mu.g of streptavidin
Dynabeads (IGEN, International) in 0.3 ml PBS-1 containing 0.2 M
EDTA, followed by incubation for 15 minutes. The reaction mixture
was introduced into an ORIGEN Analyzer (IGEN International) running
in Magnetic Capture Mode and the ECL signal from RuBpy on the
magnetic beads was determined in the presence of a solution
containing tripropylamine (ORIGEN Assay Buffer, IGEN
International). A control was also run in the absence of Dnase to
determine the ECL signal obtained from the uncleaved substrate.
Table 1 shows that the addition of Dnase to unprotected DNA gave a
>20 fold reduction in signal. The addition of NFk.beta. gave a
dose dependent increase in signal relative to that obtained from
unprotected DNA, the magnitude of which approached, for high
concentrations of NFk.beta., the signal obtained in the absence of
DNAse. The experiment was repeated with an DNA substrate with the
same nucleotide sequence but containing only phosphodiester
linkages and similar results were obtained.
TABLE-US-00002 TABLE I Dnase NFkB (p50 subunit) ECL Signal 0 0
2591957 2 U 0 96862 2 U 7 ng 1729305 2 U 3.5 ng 1383572 2 U 1.75 ng
709996 2 U 0.87 ng 425194
[0078] The specificity of the assay was determined by replacing the
specific binding protein NFk.beta. with other DNA binding proteins
specific for sequences not present on the DNA substrate (the
phosphorothioate containing substrate was used). Table II shows
only the specific binding protein, NFk.beta., was able to confer
nuclease protection to the DNA substrate containing the NFk.beta.
consensus sequence. The DNA binding proteins AP-1, AP-2, and SP-1
showed no ability to protect against nuclease attack.
TABLE-US-00003 TABLE II Transcription Factor DNase Added ECL Signal
None No 2334309 None Yes 54041 NFkB Yes 1209953 AP-1 Yes 32303 AP-2
Yes 32289 SP-1 Yes 38880
[0079] The DNAse protection assay was able to specifically detect
the binding of the NFk.beta. consensus sequence to NFk.beta.
present in nuclear extracts. We replaced the recombinant NFk.beta.
used in the previous experiments with the NFk.beta. activity
present in 1 uL of the nuclear extract from HeLa cells (Promega
Corp.). Table III gives the specific ECL signal obtained from the
assay (given as the difference between the ECL signal for the assay
and the ECL signal measured for unprotected DNA) and shows that the
nuclear extract was able to protect the DNA substrate from
cleavage. The protection was due to a specific interaction between
NFk.beta. and its consensus sequence. Table III also shows that a
specific competitor of the interaction (a 100 fold excess of
unlabeled DNA containing the NFk.beta. consensus sequence) reversed
the protective effect of the cellular extract. In contrast, non
specific sequences (100 fold excesses of unlabeled DNA containing
the consensus sequences for AP-1 or SP-1) had no effect. The use of
a DNA substrate having only phosphodiester bonds (i.e., no
phosphorothioate) gave similar specificity although the specific
ECL signals were lower.
TABLE-US-00004 TABLE III Determination of NFk.beta. Binding
Activity in HeLa Cell Extract Competitor Sequence Used Specific ECL
Signal None 744155 SP-1 665826 AP-1 829931 NFkB 0
[0080] A similar experiment was conducted using a dual labeled SP-1
consensus whose sequence is given below.
TABLE-US-00005 (SEQ ID NO 3)
5'-Ruthenium-GATCGAACTGACCGCCCGCGGCCCGT-Biotin-3' (SEQ ID NO 4)
CTAGCTTGACTGGCGGGCGCCGGGCA
[0081] Table IV not only show the ability to measure SP-1 binding
activity in a complex protein preparation, but also demonstrates
that only the specific competitor sequence was able to successfully
compete in the binding reaction.
TABLE-US-00006 TABLE IV Determination of SP-1 Binding Activity in
HeLa Cell Extract Competitor Sequence Used ECL Signal None 1385846
SP-1 0 AP-1 1172548 NFkB 1323636
Example 2-ECL-based Assay for the Measurement of Protease
Activity
[0082] This assay system consists of a ruthenylated (RuBpy-labeled)
substrate immobilized on paramagnetic beads and the enzyme of
interest. The RuBpy label is released by the action of the enzyme.
The ECL of the free label is measured using the ORIGEN Analyzer
(IGEN International).
[0083] Dynabead.RTM. M280 Sheep anti-mouse IgG coated beads (IGEN
International, Inc.) were RuBpy-labeled at a 200:1 challenge ratio
of RuBpy to IgG to introduce RuBpy groups on the immobilized IgG
molecules. The labeling was carried out using a derivative of RuBpy
linked to an NHS ester (TAG-NHS, IGEN International) according to
established procedures. The beads were then washed three times,
thirty minutes each, at 4.degree. C. with equal volumes of PBS, pH
7.8, and once overnight at 4.degree. C. Replicate test samples were
prepared with 100.mu.l of solutions containing known amounts of
Proteinase K (Sigma) in phosphate buffered saline, pH 7.8 and
25.mu.l of 1.2 mg/ml TAG labeled Sheep anti-mouse beads. The
samples were shaken for 30 minutes at 37.degree. C. The reaction
was quenched by the addition of 1 mL of a solution containing
tripropylamine (ORIGEN Assay Buffer, IGEN International, Inc.) and
the protease activity was quantitated on the ORIGEN 1.5 Analyzer
with the solution phase default settings (i.e., the beads are kept
in suspension so as to preferentially measure ECL at the electrode
from RuBpy groups in solution) except for high vortex speed. FIG. 9
shows the ECL signal as a function of the concentration of
Proteinase K; the figure shows that the ECL signal is directly
related to the concentration of enzyme.
Example 3
ECL-Based Assay for the Measurement of Factor Xa Activity
[0084] Factor Xa is a serine protease that cleaves the site
adjacent to the arginine in the amino acid sequence IEGRX. The
assay uses a peptide substrate that is labeled at the N-terminus
with RuBpy and at a lysine at the carboxy terminus with biotin
(RuBpy-IEGRGUEUEK-Biotin). Streptavidin-coated Dynabeads (IGEN
International) were used to capture the labeled-peptide. The
captured peptide is incubated with a sample containing the
protease. Increasing amounts of protease in the sample led to
increased rates of cleavage and (for a given amount of time) less
RuBpy on the beads and more RuBpy in solution. The reaction
products were analyzed on an ECL measurement instrument (ORIGEN
Analyzer, IGEN International). The measurements were carried out in
Solution Mode (i.e., the samples were analyzed under conditions
that did not lead to significant settling of the bead suspension on
the electrode; under these conditions the ECL signal was primarily
due ECL labels released into solution and increased with increasing
protease activity). The measurement can, alternatively, be carried
out in Bead Capture Mode (i.e., a magnetic field is used to collect
the magnetic beads are collected on the electrode surface; under
these conditions, the ECL signal is primarily due to ECL labels on
the solid phase and decreases with increased protease
activity).
[0085] The protocol used was as follows: Factor Xa protease (1.28
Units in 5 uL) was combined with 20 uL of streptavidin Dynabeads
(precoated with labeled substrate) and 175 uL of reaction buffer
(50 mM tris, pH 8.0, 200 mM NaCl, 6 mM CaCl.sub.2) and incubated at
37.degree. C. for varying amounts of time. At the end of the
predetermined incubation time, a 5 uL aliquot of the reaction
mixture was combined with 345 uL of a tripropylamine containing
buffer (ORIGEN Assay Buffer, IGEN International) and the mixture
analyzed on an ORIGEN analyzer in Solution Mode. As a negative
control, the experiments were repeated for the same times without
protease. For an incubation time of 0 min. (i.e., the reaction was
not allowed to occur), the measured ECL signal was approximately
the same as the negative control. After 45 min. of incubation, the
ratio of the ECL signal to that of the negative control was
4:1.
[0086] It will be readily apparent to those skilled in the art that
numerous modifications and additions may be made to both the
present invention, the disclosed device, and the related system
without departing from the invention disclosed.
Sequence CWU 1
1
4122DNAArtificial Sequencemisc_difference(1)..(8)Nucleotides are
linked by phophorothioate linkages 1agttgagggg actttcccag gc
22222DNAArtificial SequenceDescription of Artificial Sequence
Artificial sequence containing consensus sequence for human NFkB
2gcctgggaaa gtcccctcaa ct 22326DNAArtificial SequenceDescription of
Artificial SequenceArtificial sequence containing consensus
sequence for human SP-1 3gatcgaactg accgcccgcg gcccgt
26426DNAArtificial SequenceDescription of Artificial Sequence
Artificial sequence containing consensus sequence for human SP-1
4acgggccgcg ggcggtcagt tcgatc 26
* * * * *