U.S. patent application number 12/124758 was filed with the patent office on 2008-10-09 for ubiquitin regulatory nucleic acids, vectors, and methods of using same.
This patent application is currently assigned to MS TECHNOLOGIES, LLC. Invention is credited to Brad Atchinson, Janell Eby, Bruce Held, Carol Lewnau, Vaithilingam Sekar.
Application Number | 20080250529 12/124758 |
Document ID | / |
Family ID | 39561101 |
Filed Date | 2008-10-09 |
United States Patent
Application |
20080250529 |
Kind Code |
A1 |
Sekar; Vaithilingam ; et
al. |
October 9, 2008 |
Ubiquitin regulatory nucleic acids, vectors, and methods of using
same
Abstract
The invention is directed to a soybean polyubiquitin promoter,
polyubiquitin terminator, sequences which hybridize to same and
functional fragments thereof. The regulatory element of the
invention provide improved expression in plants of operably linked
nucleotide sequences. Expression vectors with the regulatory
element is the subject of the invention, which may further include
an operably linked nucleotide sequence. The invention is further
directed to transformed plant tissue including the nucleotide
sequence and to transformed plants and seeds thereof. The
regulatory element is useful for driving a nucleotide sequence, for
example a gene, or antisense expression or the like for the purpose
of imparting agronomically useful traits such as, but not limited
to, increase in yield, disease resistance, insect resistance,
herbicide tolerance, drought tolerance and salt tolerance in
plants.
Inventors: |
Sekar; Vaithilingam; (Ames,
IA) ; Lewnau; Carol; (Ames, IA) ; Eby;
Janell; (Ames, IA) ; Atchinson; Brad; (Ames,
IA) ; Held; Bruce; (Ames, IA) |
Correspondence
Address: |
PATRICIA A. SWEENEY
1835 PLEASANT ST.
WEST DES MOINES
IA
50265
US
|
Assignee: |
MS TECHNOLOGIES, LLC
West Point
IA
|
Family ID: |
39561101 |
Appl. No.: |
12/124758 |
Filed: |
May 21, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11733861 |
Apr 11, 2007 |
|
|
|
12124758 |
|
|
|
|
60909846 |
Apr 3, 2007 |
|
|
|
Current U.S.
Class: |
800/278 ;
435/320.1; 536/24.1; 800/298 |
Current CPC
Class: |
C12N 15/8216
20130101 |
Class at
Publication: |
800/278 ;
536/24.1; 435/320.1; 800/298 |
International
Class: |
C12N 15/11 20060101
C12N015/11; C12N 15/82 20060101 C12N015/82; A01H 5/00 20060101
A01H005/00 |
Claims
1. An isolated regulatory element comprising a nucleotide sequence
selected from the group consisting of: (a) the nucleotide sequence
of SEQ ID NO: 4; and (b) a sequence comprising a functional
fragment of the nucleotide sequence set forth in SEQ ID NO: 4,
which fragment retains polyadenylation activity.
2. An isolated regulatory element comprising the nucleotide
sequence of SEQ ID NO: 4.
3. An isolated regulatory element comprising a functional fragment
of the nucleotide sequence set forth in SEQ ID NO: 4, which
fragment retains polyadenylation activity.
4. An expressional cassette comprising a regulatory element, the
regulatory element comprising a nucleotide sequence selected from
the group consisting of: (a) the nucleotide sequence of SEQ ID NO:
4; and (b) a sequence comprising a functional fragment of the
nucleotide sequence set forth in SEQ ID NO: 4, which fragment
retains polyadenylation activity.
5. An expression cassette comprising a regulatory element and a
first nucleotide sequence operably linked to the regulatory
element, said regulatory element comprising the nucleotide sequence
of SEQ ID NO: 4.
6. An expression cassette comprising a regulatory element and a
first nucleotide sequence operably linked to the regulatory
element, said regulatory element comprising a functional fragment
of the nucleotide sequence of SEQ ID NO: 4 that terminates
transcription of the first nucleotide sequence.
7. A vector comprising the expression cassette of claim 6.
8. A plant comprising the expression cassette of claim 6.
9. A plant cell comprising the expression cassette of claim 6.
10. A plant cell comprising a heterologous sequence, the sequence
selected from the group consisting of: (a) the nucleotide sequence
of SEQ ID NO: 4; and (b) a sequence comprising a functional
fragment of the nucleotide sequence set forth in SEQ ID NO: 4,
which fragment retains promoter activity.
11. A plant comprising a heterologous sequence, the sequence
selected from the group consisting of: (a) the nucleotide sequence
of SEQ ID NO: 4; and (b) a sequence comprising a functional
fragment of the nucleotide sequence set forth in SEQ ID NO: 4,
which fragment retains polyadenylation activity.
12. A method for expressing a nucleotide sequence in a plant cell,
the method comprising: (a) transforming a plant cell with a first
nucleotide sequence operably linked to a second nucleotide
sequence, the first nucleotide sequence selected from the group
consisting of: (i) the nucleotide sequence of SEQ ID NO: 4; and
(ii) a sequence comprising a functional fragment of the nucleotide
sequence set forth in SEQ ID NO: 4, which fragment retains
polyadenylation activity, and (b) growing the plant cell to produce
a plant having the first and second nucleotide sequence such that
the second nucleotide sequence is expressed in the plant.
Description
REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of previously filed and
copending application U.S. Ser. No. 11/773,861, filed Jul. 5, 2007,
which claims priority to previously filed application U.S. Ser. No.
60/909,846, filed Apr. 3, 2007, now abandoned, the contents of each
are incorporated in their entirety.
BACKGROUND OF THE INVENTION
[0002] The expression of a heterologous nucleotide sequence in a
plant cell is impacted by regulatory nucleic acids. Promoters and
terminators are two types of regulatory elements that impact
expression of such operably linked sequences. Promoters are vital
molecular tools that have been applied widely in plant
biotechnology to control the expression of introduced genes. A
promoter is a nucleic acid sequence to which RNA polymerase must
bind if it is to transcribe the linked gene into messenger RNA and
ultimately produce protein. A promoter may affect a structural gene
operationally associated with the promoter in different ways. For
example, it may enhance or repress expression of an associated
structural gene, subject that gene to developmental regulation, or
contribute to the tissue-specific regulation of that gene. There
are different types of promoters used dependent upon the function
desired. Constitutive promoters provide for expression throughout
all tissues of the plant, where tissue preferred promoters will
express at a higher rate in a (or a few) select tissue of the
plant. Inducible promoters are those which induce the regulatory
affect of the promoter in response to a stimulus, which can be, for
example, chemical, temperature, stress, wounding or other stimuli.
The linked nucleotide sequence can perform any of a wide variety of
functions desired, whether it is repressing or initiating
expression of a trait or protein of interest, providing for
over-expression, modifying metabolic and developmental pathways
within the plant tissue, or the like.
[0003] Several promoters of plant and plant pathogen (bacterial and
viral) origin have been used to direct transgene expression in
plants. Prominent examples include the French bean beta-phaseolin
promoter (Bustos et al., 1989), the mannopine synthase promoter of
Agrobacterium tumefaciens (Leung et al., 1991), and the 35S
promoter of cauliflower mosaic virus (Guilley et al., 1982). These
and several other promoters in widespread use in plants were
originally developed and utilized in dicot species. Despite the
desire to identify constitutive promoters capable of driving a
relatively high level of gene expression in most tissues of the
plant, there remain few to choose from and there is an ongoing need
to identify promoters for use in expressing linked sequences.
[0004] Terminator sequences also play an important role in
regulation of gene expression. The 3' terminus of an isolated
nucleotide sequence is the site as which transcription stops. A
terminator region can be native with the promoter used, can be
native with the linked heterologous sequences or derived from
another source.
[0005] Ubiquitin is a 76 amino acid polypeptide found in all
eukaryotes and has been studied for its role in a wide range of
cellular functions. Promoters of the ubiquitin gene have been
isolated. For example, in U.S. Pat. Nos. 5,510,474, 5,614,399,
6,054,574 and 6,020,190 to Quail is described ubiquitin promoters
which include a heat shock element and intron. Jilka et al.
describe another maize ubiquitin type promoter at U.S. Pat. No.
6,977,325. Xia et al. identified a soybean genomic clone containing
a ubiquitin gene (Xia et al., 1994). Analysis of the nucleotide
sequence of this clone revealed the presence of a translational
start site, a translational stop codon, a 915-bp open reading frame
encoding polyubiquitin (arranged as three tandem 228-bp
head-to-tail repeats and a fourth terminal repeat containing 231
bp), a putative polyadenylation signal motif. However, no
transcription initiation site was identified. These sequences are
reported at GenBank accession numbers D16248.1 and D2823.1. Also,
Finer et al. have discussed analysis of a soybean ubiquitin
promoter, but did not provide a sequence (Finer et al., 2006). Thus
there remains a need for the identification of structure and
function of promoters and terminators, and a high expressing
regulatory region would be especially desirable.
[0006] All references cited herein are incorporated herein by
reference.
SUMMARY OF THE INVENTION
[0007] Glycine max polyubiquitin gene regulatory regions has been
identified, and function as a promoter and terminator demonstrated.
The invention is further directed to sequences which hybridize to
same under highly stringent circumstances and functional fragments.
In an embodiment, the regulatory element is used to regulate high
level, constitutive expression of linked nucleotide sequences. A
terminator region is used to further regulate expression of linked
sequences.
DESCRIPTION OF THE DRAWINGS
[0008] FIG. 1A shows the promoter sequence of the invention with
exogenous sequences including EcoRI, SbfI, ApaI and SacI
restriction sites and the Kozak translation initiation consensus
sequence (SEQ ID NO: 1). FIG. 1B shows the 911 base pair promoter
sequence (SEQ ID NO: 2).
[0009] FIG. 2A shows the terminator sequence of the invention with
additional exogenous sequence including XbaI, SbfI and XhoI
restriction sites (SEQ ID NO: 3). FIG. 2B shows the 322 base pair
terminator sequence (SEQ ID NO: 4).
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0010] Nucleotide sequences are described herein that regulate
transcription with high constitutive expression in plant cells.
These novel nucleotide sequences are those natively associated with
the ubiquitin gene of Glycine max. The promoter element is the 911
base pair sequence shown in FIG. 1B (SEQ ID NO: 2). It includes the
sequences up to but not including the translation start site, ATG.
The terminator element is the 322 base pair sequence shown in FIG.
2B (SEQ ID NO: 4). The construction of this promoter provides a
general method for the discovery of novel sequences with utility as
promoters. The present invention is also directed to DNA molecules
including said promoter, such as a DNA construct comprising the
promoter operably linked to one or more genes or antisense DNA. The
invention is further directed to transformed plant tissue including
the DNA molecule and to transformed plants and seeds thereof. The
promoter is useful for driving nucleotide sequences, for example, a
gene or antisense expression for the purpose of imparting
agronomically useful traits such as, but not limited to, increase
in yield, disease resistance, insect resistance, herbicide
tolerance, drought tolerance and salt tolerance in plants.
Nucleotide sequences are described herein that regulate
transcription with high constitutive expression in plant cells.
[0011] A recombinant host may be any prokaryotic or eukaryotic cell
that contains either a cloning vector or an expression vector. This
term also includes those prokaryotic or eukaryotic cells that have
been genetically engineered to contain the cloned gene(s) in the
chromosome or genome of the host cell. The promoter is, in an
embodiment, particularly useful for the expression of nucleotide
sequences in plants. It can be used in any plant species, including
a dicotyledonous plant, such as, by way of example but not
limitation, tobacco, tomato, potato, soybean, cotton, canola,
sunflower or alfalfa. Alternatively, the plant may be a
monocotyledonous plant, by way of example but not limitation,
maize, wheat, rye, rice, oat, barley, turfgrass, sorghum, millet or
sugarcane.
[0012] The nucleotide sequences of the invention can be used to
isolate corresponding sequences from other organisms, particularly
other plants, or to synthesize synthetic sequences. In this manner,
methods such as polymerase chain reaction (PCR), hybridization,
synthetic gene construction and the like can be used to identify or
generate such sequences based on their sequence homology to the
sequences set forth herein. Sequences identified, isolated or
constructed based on their sequence identity to the whole of or any
portion of the promoter sequences set forth is encompassed by the
present invention. Synthesis of sequences suitably employed in the
present invention can be effected by means of mutually priming long
oligonucleotides. See for example, Wosnick et al. (1987). In a PCR
approach, oligonucleotide primers can be designed for use in PCR
reactions to amplify corresponding DNA sequences from cDNA or
genomic DNA extracted from any plant of interest. Methods for
designing PCR primers and PCR cloning are generally known in the
art and are disclosed (Sambrook et al., 1989; Innis et al., 1990;
Innis et al., 1995; Innis et al., 1999). Moreover, current
techniques which employ the PCR reaction permit the synthesis of
genes as large as 1.8 kilobases in length. See Adang et al. (1993)
and Bambot et al. (1993). Known methods of PCR include, but are not
limited to, methods using paired primers, nested primers,
degenerate primers, gene-specific primers, vector-specific primers,
partially-mismatched primers, and the like. In addition, genes can
readily be synthesized by conventional automated techniques.
[0013] In hybridization techniques, all or part of a known
nucleotide sequence is used as a probe that selectively hybridizes
to other corresponding nucleotide sequences present in a population
of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or
cDNA libraries) from a chosen organism. The hybridization probes
may be genomic DNA fragments, cDNA fragments, RNA fragments, or
other oligonucleotides, and may be labeled with a detectable group
such as .sup.32P, or any other detectable marker. Thus, for
example, probes for hybridization can be made by labeling synthetic
oligonucleotides based on the DNA sequences of the invention.
Methods for preparation of probes for hybridization and for
construction of cDNA and genomic libraries are generally known in
the art and are disclosed (Sambrook et al., 1989).
[0014] For example, the promoter sequence disclosed herein, or one
or more portions thereof, may be used as a probe capable of
specifically hybridizing to corresponding sequences. To achieve
specific hybridization under a variety of conditions, such probes
include sequences that are unique among the sequences to be
screened and are preferably at least about 10 nucleotides in
length, and most preferably at least about 20 nucleotides in
length. Such sequences may alternatively be used to amplify
corresponding sequences from a chosen plant by PCR. This technique
may be used to isolate sequences from a desired plant or as a
diagnostic assay to determine the presence of sequences in a plant.
Hybridization techniques include hybridization screening of DNA
libraries plated as either plaques or colonies (Sambrook et al.,
1989).
[0015] Hybridization of such sequences may be carried out under
stringent conditions. By "stringent conditions" or "stringent
hybridization conditions" is intended conditions under which a
probe will hybridize to its target sequence to a detectably greater
degree than to other sequences (e.g., at least 2-fold over
background). Stringent conditions are sequence-dependent and will
be different in different circumstances. By controlling the
stringency of the hybridization and/or washing conditions, target
sequences that are 100% complementary to the probe can be
identified (homologous probing). Alternatively, stringency
conditions can be adjusted to allow some mismatching in sequences
so that lower degrees of similarity are detected (heterologous
probing). Generally, a probe is less than about 1000 nucleotides in
length, preferably less than 500 nucleotides in length.
[0016] Typically, stringent conditions will be those in which the
salt concentration is less than about 1.5 M Na.sup.+ ion, typically
about 0.01 to 1.0 M Na.sup.+ ion concentration (or other salts) at
pH 7.0 to 8.3 and the temperature is at least about 30.degree. C.
for short probes (e.g., 10 to 50 nucleotides) and at least about
60.degree. C. for long probes (e.g., greater than 50 nucleotides).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulfate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C. Exemplary high stringency conditions include
hybridization in 50% formamide, 1.0 M NaCl, 0.1% SDS at 37.degree.
C., and a wash in 0.1.times.SSC at 60 to 65.degree. C.
[0017] In general, sequences that correspond to the nucleotide
sequences of the present invention and hybridize to the nucleotide
sequence disclosed herein will be at least 50% homologous, 70%
homologous, and even 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% homologous or more with the disclosed
sequence. That is, the sequence similarity between probe and target
may range, sharing at least about 50%, about 70%, and even about
85% or more sequence similarity.
[0018] Specificity is also the function of post-hybridization
washes, the critical factors being the ionic strength and
temperature of the final wash solution. For DNA-DNA hybrids, the
T.sub.m can be approximated from the equation T.sub.m=81.5.degree.
C.+16.6 (logM)+0.41(% GC)-0.61(% form.)-500/L, where M is the
molarity of monovalent cations, % GC is the percentage of guanosine
and cytosine nucleotides in the DNA, % form. is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs (Meinkoth and Wahl, 1984). The T.sub.m is the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridizes to a perfectly matched
probe. T.sub.m is reduced by about 1.degree. C. for each 1% of
mismatching; thus, T.sub.m, hybridization, and/or wash conditions
can be adjusted for sequences of the desired identity to hybridize.
For example, if sequences with 90% identity are sought, the T.sub.m
can be decreased 10.degree. C. Generally, stringent conditions are
selected to be about 5.degree. C. lower than the thermal melting
point (T.sub.m) for the specific sequence and its complement at a
defined ionic strength and pH. However, severely stringent
conditions can utilize a hybridization and/or wash at 1, 2, 3, or
4.degree. C. lower than the thermal melting point (T.sub.m);
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point (T.sub.m); low stringency conditions can utilize a
hybridization and/or wash at 11 to 20.degree. C. lower than the
thermal melting point (T.sub.m). Using the equation, hybridization
and wash compositions, and desired T.sub.m, those of ordinary skill
will understand that variations in the stringency of hybridization
and/or wash solutions are inherently described. If the desired
degree of mismatching results in a T.sub.m of less than 45.degree.
C. (aqueous solution) or 32.degree. C. (formamide solution), it is
preferred to increase the SSC concentration so that a higher
temperature can be used. An extensive guide to the hybridization of
nucleic acids is found (1997) Ausubel et al, Short Protocols in
Molecular Biology, page 2-40, Third Edit. (1997) and Sambrook et
al. (1989).
[0019] Thus, isolated sequences that have regulatory element
activity and which hybridize under stringent conditions to the
promoter sequences disclosed herein, or to fragments thereof, are
encompassed by the present invention.
[0020] The following terms are used to describe the sequence
relationships between two or more nucleic acids or polynucleotides:
(a) "reference sequence", (b) "comparison window", (c) "sequence
identity" and (d) "percentage of sequence identity."
[0021] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length promoter sequence, or
the complete promoter sequence.
[0022] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two sequences. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to accurately reflect the similarity to a
reference sequence due to inclusion of gaps in the polynucleotide
sequence a gap penalty is typically introduced and is subtracted
from the number of matches.
[0023] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent identity
between any two sequences can be accomplished using a mathematical
algorithm. Preferred, non-limiting examples of such mathematical
algorithms are the algorithm of Myers and Miller (1988), the local
homology algorithm of Smith and Waterman (1981), the homology
alignment algorithm of Needleman and Wunsch (1970), the
search-for-similarity-method of Pearson and Lipman (1988) and the
algorithm of Karlin and Altschul (1990), modified as in Karlin and
Altschul (1993).
[0024] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from lntelligenetics,
Mountain View, Calif., USA); the ALIGN program (Version 2.0) and
GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics
Software Package, Version 8 (available from Genetics Computer Group
(GCG), 575 Science Drive, Madison, Wis., USA). Alignments using
these programs can be performed using the default parameters. The
CLUSTAL program is well described by Higgins and Sharp (1988),
Higgins and Sharp (1989), Corpet (1988), Huang et al. (1992) and
Pearson (1994). The ALIGN program is based on the algorithm of
Myers and Miller (1988). The BLAST programs of Altschul et al.
(1990) are based on the algorithm of Karlin and Altschul (1990). To
obtain gapped alignments for comparison purposes, Gapped BLAST (in
BLAST 2.0) can be utilized as described in Altschul et al. (1997).
Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an
iterated search that detects distant relationships between
molecules, see Altschul et al. (1997). When utilizing BLAST, Gapped
BLAST or PSI-BLAST, the default parameters of the respective
programs (e.g. BLASTN for nucleotide sequences, BLASTX for
proteins) can be used, see the World Wide Web site
ncbi.nlm.nih.gov. Alignment may also be performed manually by
inspection.
[0025] For purposes of the present invention, comparison of
nucleotide sequences for determination of percent sequence identity
to the promoter sequences disclosed herein is preferably made using
the BlastN program (version 1.4.7 or later) with its default
parameters or any equivalent program. By "equivalent program" is
intended any sequence comparison program that, for any two
sequences in question, generates an identical or similar alignment
of nucleotide matches and percent sequence identity when compared
to the corresponding alignment generated by the preferred
program.
[0026] (c) As used herein, "sequence identity" or "identity" in the
context of two nucleic acid sequences makes reference to the
residues in the two sequences that are the same when aligned for
maximum correspondence over a specified comparison window.
[0027] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base occurs
in both sequences to yield the number of matched positions,
dividing the number of matched positions by the total number of
positions in the window of comparison, and multiplying the result
by 100 to yield the percentage of sequence identity.
[0028] Identity to the sequence of the present invention would mean
a polynucleotide sequence having at least 65% sequence identity,
more preferably at least 70% sequence identity, more preferably at
least 75% sequence identity, more preferably at least 80% identity,
more preferably at least 85% 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity.
[0029] In accordance with one embodiment, a novel promoter is
constructed by the following steps. The sequence of a known or
newly discovered promoter is compared with known nucleic acid
sequences, such as sequences in genomic databases. In one
embodiment, this comparison is made in the GenBank database using a
program such as FASTA (Genetics Computer Group, Madison, Wis.).
Additional suitable databases and comparison programs are known to
a person of skill in the art. Segments of sequence similar to the
query sequence, i.e., the known or newly discovered promoter, are
identified and selected. Segments are considered similar if they
have between 60% and 100% sequence identity over the segment being
examined. These segments can be 20-100 bases in length, although
smaller or longer segments can also be selected. The selected
sequences are aligned in linear order according to the sequence of
the promoter being modified. The resultant promoter is a hybrid
promoter comprised of sequences similar to but different from the
original promoter. The short segments that make up the synthetic
hybrid promoter may be parts of promoters or regulatory regions
from other genes. The synthetic hybrid promoter is then constructed
and empirically tested in a test expression system to determine its
quantitative and qualitative characteristics. If the synthetic
hybrid promoter has maintained or improved activity, it may be used
directly. If the synthetic hybrid promoter has a lower activity,
the sequence of the synthetic hybrid promoter is further modified
by replacing some of the bases to generate a new hybrid promoter.
The new hybrid promoter is again constructed and tested to
determine if it has the desired maintained or improved activity.
This procedure can be performed as often as necessary to derive the
final hybrid promoter having the desired activity.
[0030] The invention is further to "functional variants" of the
regulatory sequence disclosed. Functional variants include, for
example, regulatory sequences of the invention having one or more
nucleotide substitutions, deletions or insertions and wherein the
variant retains promoter activity, particularly the ability to
drive expression preferentially to the embryo of a plant.
Functional variants can be created by any of a number of methods
available to one skilled in the art, such as by site-directed
mutagenesis, induced mutation, identified as allelic variants,
cleaving through use of restriction enzymes, or the like. Activity
can likewise be measured by any variety of techniques, including
measurement of reporter activity as is described at U.S. Pat. No.
6,844,484, Northern blot analysis, or similar techniques. The '484
patent describes the identification of functional variants of
different promoters.
[0031] The invention further encompasses a "functional fragment,"
that is, a regulatory sequence fragment formed by one or more
deletions from a larger regulatory element. For example, the 5'
portion of a promoter up to the TATA box near the transcription
start site can be deleted without abolishing promoter activity, as
described by Opsahl-Sorteberg, H-G. et al., 2004. Such fragments
should retain promoter activity, particularly the ability to drive
expression of operably linked nucleotide sequences. Activity can be
measured by Northern blot analysis, reporter activity measurements
when using transcriptional fusions, and the like. See, for example,
Sambrook et al. (1989). Functional fragments can be obtained by use
of restriction enzymes to cleave the naturally occurring regulatory
element nucleotide sequences disclosed herein; by synthesizing a
nucleotide sequence from the naturally occurring DNA sequence; or
can be obtained through the use of PCR technology See particularly,
Mullis et al. (1987) and Erlich, ed. (1989).
[0032] For example, a routine way to remove part of a DNA sequence
is to use an exonuclease in combination with DNA amplification to
produce unidirectional nested deletions of double stranded DNA
clones. A commercial kit for this purpose is sold under the trade
name Exo-Size.TM. (New England Biolabs, Beverly, Mass.). Briefly,
this procedure entails incubating exonuclease III with DNA to
progressively remove nucleotides in the 3' to 5' direction at 5'
overhangs, blunt ends or nicks in the DNA template. However,
exonuclease III is unable to remove nucleotides at 3', 4-base
overhangs. Timed digests of a clone with this enzyme produces
unidirectional nested deletions.
[0033] By "promoter" is meant a regulatory element of DNA capable
of regulating the transcription of a sequence linked thereto. It
usually comprises a TATA box capable of directing RNA polymerase II
to initiate RNA synthesis at the appropriate transcription
initiation site for a particular coding sequence. The promoter is
the minimal sequence sufficient to direct transcription in a
desired manner. The term "regulatory element" is also used to refer
to the sequence capable of "regulatory element activity," that is,
initiating transcription in a desired manner. Therefore the
invention is directed to the regulatory element described herein
including those sequences which hybridize to same and have identity
to same, as indicated, and fragments and variants of same which
have regulatory activity.
[0034] The promoter of the invention may also be used in
conjunction with another promoter. In one embodiment, the plant
selection marker and the nucleotide sequence of interest can be
both functionally linked to the same promoter. In another
embodiment, the plant selection marker and the nucleotide sequence
of interest can be functionally linked to different promoters. In
yet third and fourth embodiments, the expression vector can contain
two or more nucleotide sequences of interest that can be linked to
the same promoter or different promoters. For example, the promoter
described here can be used to drive the gene of interest and the
selectable marker, or a different promoter used for one or the
other. These other promoter elements can be those that are
constitutive or sufficient to render promoter-dependent gene
expression controllable as being cell-type specific,
tissue-specific or time or developmental stage specific, or being
inducible by external signals or agents. Such elements may be
located in the 5' or 3' regions of the gene. Although the
additional promoter may be the endogenous promoter of a structural
gene of interest, the promoter can also be a foreign regulatory
sequence. Promoter elements employed to control expression of
product proteins and the selection gene can be any plant-compatible
promoters. These can be plant gene promoters, such as, for example,
a ubiquitin promoter (European patent application no. 0 342 926);
the promoter for the small subunit of ribulose-1,5-bis-phosphate
carboxylase (ssRUBISCO) (Coruzzi et al., 1984; Broglie et al.,
1984); or promoters from the tumor-inducing plasmids from
Agrobacterium tumefaciens, such as the nopaline synthase, octopine
synthase and mannopine synthase promoters (Velten and Schell, 1985)
that have plant activity; or viral promoters such as the
cauliflower mosaic virus (CaMV) 19S and 35S promoters (Guilley et
al., 1982; Odell et al., 1985), the figwort mosaic virus FLt
promoter (Maiti et al., 1997) or the coat protein promoter of TMV
(Grdzelishvili et al., 2000).
[0035] The range of available plant compatible promoters includes
tissue specific and inducible promoters. An inducible regulatory
element is one that is capable of directly or indirectly activating
transcription of one or more DNA sequences or genes in response to
an inducer. In the absence of an inducer the DNA sequences or genes
will not be transcribed. Typically the protein factor that binds
specifically to an inducible regulatory element to activate
transcription is present in an inactive form which is then directly
or indirectly converted to the active form by the inducer. The
inducer can be a chemical agent such as a protein, metabolite,
growth regulator, herbicide or phenolic compound or a physiological
stress imposed directly by heat, cold, salt, or toxic elements or
indirectly through the actin of a pathogen or disease agent such as
a virus. A plant cell containing an inducible regulatory element
may be exposed to an inducer by externally applying the inducer to
the cell or plant such as by spraying, watering, heating or similar
methods. Any inducible promoter can be used in the instant
invention. See Ward et al. (1993). Exemplary inducible promoters
include ecdysone receptor promoters, U.S. Pat. No. 6,504,082;
promoters from the ACE1 system which responds to copper (Mett et
al. (1993)); In2-1 and In2-2 gene from maize which respond to
benzenesulfonamide herbicide safeners (U.S. Pat. No. 5,364,780);
the maize GST promoter, which is activated by hydrophobic
electrophilic compounds that are used as pre-emergent herbicides;
and the tobacco PR-1a promoter, which is activated by salicylic
acid. Other chemical-regulated promoters of interest include
steroid-responsive promoters (see, for example, the
glucocorticoid-inducible promoter in Schena et al. (1991) and
McNellis et al. (1998)) and tetracycline-inducible and
tetracycline-repressible promoters (see, for example, Gatz et al.
(1991), and U.S. Pat. Nos. 5,814,618 and 5,789,156). Alternatively,
plant promoters such as heat shock promoters for example soybean
hsp 17.5-E (Gurley et al., 1986); or ethanol-inducible promoters
(Caddick et al., 1998) may be used. See International Patent
Application No. WO 91/19806 for a review of illustrative plant
promoters suitably employed in the present invention.
[0036] Tissue-preferred promoters can be utilized to target
enhanced transcription and/or expression within a particular plant
tissue. Promoters may express in the tissue of interest, along with
expression in other plant tissue, may express strongly in the
tissue of interest and to a much lesser degree than other tissue,
or may express highly preferably in the tissue of interest.
Tissue-preferred promoters include, for example, those described in
Yamamoto et al. (1997); Kawamata et al. (1997); Hansen et al.
(1997); Russell et al. (1997); Rinehart et al. (1996); Van Camp et
al. (1996); Canevascini et al. (1996); Yamamoto et al. (1994); Lam
(1994); Orozco et al. (1993); and Matsuoka et al. (1993).
[0037] A promoter can additionally comprise other recognition
sequences generally positioned upstream or 5' to the TATA box,
referred to as upstream promoter elements, which influence the
transcription initiation rate. Using the promoter sequences
disclosed here, it is possible to isolate and identify further
regulatory elements in the 5' region upstream from the particular
promoter region identified. Thus the promoter region disclosed is
generally further defined by comprising upstream regulatory
elements such as those responsible for high level and temporal
expression of the coding sequence, enhancers and the like. In the
same manner, the promoter elements which enable low to high level
expression can be identified, isolated, and used with other core
promoters to confirm embryo-preferred expression. By core promoter
is meant the sequence sometimes referred to as the TATA box (or
similar sequence) which is common to promoters in most genes
encoding proteins. Thus the upstream promoter of the ubiquitin
promoter can optionally be used in conjunction with its own or core
promoters from other sources.
[0038] The promoter of the invention may be combined with any
number of other components to be introduced into the plant,
including combined with a nucleotide sequence of interest to be
expressed in the plant. The "nucleotide sequence of interest"
refers to a nucleotide sequence that encodes for a desired
polypeptide or protein but also may refer to nucleotide sequences
that do not constitute an entire gene, and which do not necessarily
encode a polypeptide or protein. For example, when used in a
homologous recombination process, the promoter may be placed in a
construct with a sequence that targets an area of the chromosome in
the plant but may not encode a protein. Use of antisense versions
of a nucleic acid sequence is another example where use of a
sequence may not result in an encoded protein. If desired, the
nucleotide sequence of interest can be optimized for plant
translation by optimizing the codons used for plants and the
sequence around the translational start site for plants. Sequences
resulting in potential mRNA instability can also be avoided.
[0039] In general, the methods available for construction of
recombinant genes, optionally comprising various modifications for
improved expression, can differ in detail. However, conventionally
employed methods include PCR amplification, or the designing and
synthesis of overlapping, complementary synthetic oligonucleotides,
which are annealed and ligated together to yield a gene with
convenient restriction sites for cloning, or subcloning from
another already cloned source, or cloning from a library. The
methods involved are standard methods for a molecular biologist
(Sambrook et al., 1989). An expression vector is a DNA molecule
comprising a gene or antisense DNA that is expressed in a host
cell. Typically, gene expression is placed under the control of
certain regulatory elements, including constitutive or inducible
promoters, tissue-specific regulatory elements, and enhancers.
[0040] One skilled in the art readily appreciates that the promoter
can be used with any of a variety of nucleotide sequences
comprising the nucleotide sequence of interest to be expressed in
plants. In referring to an operably linked nucleotide sequence is
intended a functional linkage between a promoter and another
sequence where the promoter initiates and mediates transcription of
the nucleotide sequence. For example, the nucleotide sequence of
interest may encode a protein that is useful for industrial or
pharmaceutical purposes or the like, or to impact the plant itself,
such as through expression of a protein that provides disease
resistance, insect resistance, herbicide resistance, or impacts
agronomic traits as well as grain quality traits. DNA sequences
native to plants as well as non-native DNA sequences can be
transformed into plants and used to modulate levels of native or
non-native proteins. One or more of such sequences and/or
expression cassettes may be transformed into a plant cell (in
referring to a plant cell, it is intended to include cells without
plant membranes, such as protoplasts).
[0041] Such nucleotide sequences include, but are not limited to,
those examples provided below:
1. Genes That Confer Resistance to Pests or Disease
[0042] (A) Plant Disease Resistance Genes. Plant defenses are often
activated by specific interaction between the product of a disease
resistance gene (R) in the plant and the product of a corresponding
avirulence (Avr) gene in the pathogen. A plant variety can be
transformed with cloned resistance gene to engineer plants that are
resistant to specific pathogen strains. Examples of such genes
include, the tomato Cf-9 gene for resistance to Cladosporium fulvum
(Jones et al., 1994), tomato Pto gene, which encodes a protein
kinase, for resistance to Pseudomonas syringae pv. tomato (Martin
et al., 1993), and Arabidopsis RSSP2 gene for resistance to
Pseudomonas syringae (Mindrinos et al., 1994).
[0043] (B). A Bacillus thuringiensis protein, a derivative thereof
or a synthetic polypeptide modeled thereon, such as, a nucleotide
sequence of a Bt .delta.-endotoxin gene (Geiser et al., 1986).
Moreover, DNA molecules encoding .delta.-endotoxin genes can be
purchased from American Type Culture Collection (Rockville, Md.),
under ATCC accession numbers. 40098, 67136, 31995 and 31998.
[0044] (C) A lectin, such as, nucleotide sequences of several
Clivia miniata mannose-binding lectin genes (Van Damme et al.,
1994).
[0045] (D) A vitamin binding protein, such as avidin and avidin
homologs which are useful as larvicides against insect pests. See
U.S. Pat. No. 5,659,026.
[0046] (E) An enzyme inhibitor, e.g., a protease inhibitor or an
amylase inhibitor. Examples of such genes include, a rice cysteine
proteinase inhibitor (Abe et al., 1987), a tobacco proteinase
inhibitor I (Huub et al., 1993), and an .alpha.-amylase inhibitor
Sumitani et al., 1993).
[0047] (F) An insect-specific hormone or pheromone such as an
ecdysteroid and juvenile hormone a variant thereof, a mimetic based
thereon, or an antagonist or agonist thereof, such as, baculovirus
expression of cloned juvenile hormone esterase, an inactivator of
juvenile hormone (Hammock et al., 1990).
[0048] (G) An insect-specific peptide or neuropeptide which, upon
expression, disrupts the physiology of the affected pest. Examples
of such genes include, an insect diuretic hormone receptor (Regan,
1994), an allostatin identified in Diploptera punctata (Pratt,
1989), insect-specific, paralytic neurotoxins (U.S. Pat. No.
5,266,361).
[0049] (H) An insect-specific venom produced in nature by a snake,
a wasp, etc., such as, a scorpion insectotoxic peptide (Pang,
1992).
[0050] (I) An enzyme responsible for a hyperaccumulation of
monoterpene, a sesquiterpene, a steroid, hydroxamic acid, a
phenylpropanoid derivative or another non-protein molecule with
insecticidal activity.
[0051] (J) An enzyme involved in the modification, including the
post-translational modification, of a biologically active molecule;
for example, glycolytic enzyme, a proteolytic enzyme, a lipolytic
enzyme, a nuclease, a cyclase, a transaminase, an esterase, a
hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase,
an elastase, a chitinase and a glucanase, whether natural or
synthetic. Examples of such genes include, a callas gene (PCT
published application WO93/02197), chitinase-encoding sequences
(which can be obtained, for example, from the ATCC under accession
numbers 3999637 and 67152), tobacco hookworm chitinase (Kramer et
al., 1993) and parsley ubi4-2 polyubiquitin gene (Kawalleck et al.,
1993).
[0052] (K) A molecule that stimulates signal transduction. Examples
of such molecules include, nucleotide sequences for mung bean
calmodulin cDNA clones (Botella et al., 1994) and a nucleotide
sequence of a maize calmodulin cDNA clone (Griess et al.,
1994).
[0053] (L) A hydrophobic moment peptide. See U.S. Pat. Nos.
5,659,026 and 5,607,914, the latter teaches synthetic antimicrobial
peptides that confer disease resistance.
[0054] (M) A membrane permease, a channel former or a channel
blocker, such as, a cecropin-.beta. lytic peptide analog (Jaynes et
al., 1993) which renders transgenic tobacco plants resistant to
Pseudomonas solanacearum.
[0055] (N) A viral-invasive protein or a complex toxin derived
there from. For example, the accumulation of viral coat proteins in
transformed plant cells imparts resistance to viral infection
and/or disease development effected by the virus from which the
coat protein gene is derived, as well as by related viruses. Coat
protein-mediated resistance has been conferred upon transformed
plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco
streak virus, potato virus X, potato virus Y, tobacco etch virus,
tobacco rattle virus and tobacco mosaic virus. See, for example,
Beachy et al. (1990).
[0056] (O) An insect-specific antibody or an immunotoxin derived
there from. Thus, an antibody targeted to a critical metabolic
function in the insect gut would inactive an affected enzyme,
killing the insect. For example, Taylor et al. (1994) shows
enzymatic inactivation in transgenic tobacco via production of
single-chain antibody fragments.
[0057] (P) A virus-specific antibody. See, for example, Tavladoraki
et al. (1993), which shows that transgenic plants expressing
recombinant antibody genes are protected from virus attack.
[0058] (Q) A developmental-arrestive protein produced in nature by
a pathogen or a parasite. Thus, fungal endo .alpha.-1,4-D
polygalacturonases facilitate fungal colonization and plant
nutrient release by solubilizing plant cell wall
homo-.alpha.-1,4-D-galacturonase (Lamb et al., 1992). The cloning
and characterization of a gene which encodes a bean
endopolygalacturonase-inhibiting protein is described by Toubart et
al. (1992).
[0059] (R) A developmental-arrestive protein produced in nature by
a plant, such as, the barley ribosome-inactivating gene has an
increased resistance to fungal disease (Longemann et al.,
1992).
2. Genes That Confer Resistance to a Herbicide
[0060] (A) A herbicide that inhibits the growing point or meristem,
such as an imidazalinone or a sulfonylurea. Exemplary genes in this
category code for mutant ALS (Lee et al., 1988) and AHAS enzyme
(Miki et al., 1990).
[0061] (B) Glyphosate (resistance imparted by mutant EPSP synthase
and aroA genes, respectively) and other phosphono compounds such as
glufosinate (PAT and bar genes), and pyridinoxy or phenoxy
proprionic acids and cyclohexones (ACCase inhibitor encoding
genes). See, for example, U.S. Pat. No. 4,940,835, which discloses
the nucleotide sequence of a form of EPSP which can confer
glyphosate resistance. A DNA molecule encoding a mutant aroA gene
can be obtained under ATCC accession number 39256, and the
nucleotide sequence of the mutant gene is disclosed in U.S. Pat.
No. 4,769,061. European patent application No. 0 333 033 and U.S.
Pat. No. 4,975,374 disclose nucleotide sequences of glutamine
synthetase genes which confer resistance to herbicides such as
L-phosphinothricin. The nucleotide sequence of a
phosphinothricinacetyl-transferase gene is provided in European
application No. 0 242 246. De Greef et al. (1989) describes the
production of transgenic plants that express chimeric bar genes
coding for phosphinothricin acetyl transferase activity. Exemplary
of genes conferring resistance to phenoxy proprionic acids and
cyclohaexones, such as sethoxydim and haloxyfop, are the Accl-S1,
Accl-S2 and Accl-S3 genes described by Marshall et al. (1992).
[0062] (C) A herbicide that inhibits photosynthesis, such as a
triazine (psbA and gs+ genes) and a benzonitrile (nitrilase gene).
Przibilla et al. (1991) describes the use of plasmids encoding
mutant psbA genes to transform Chlamydomonas. Nucleotide sequences
for nitrilase genes are disclosed in U.S. Pat. No. 4,810,648, and
DNA molecules containing these genes are available under ATCC
accession numbers 53435, 67441 and 67442. Cloning and expression of
DNA coding for a glutathione S-transferase is described by Hayes et
al. (1992).
3. Genes That Confer or Contribute to a Value-Added Trait
[0063] (A) Modified fatty acid metabolism, for example, by
transforming maize or Brassica with an antisense gene or
stearoyl-ACP desaturase to increase stearic acid content of the
plant (Knultzon et al., 1992).
[0064] (B) Decreased phytate content [0065] (1) Introduction of a
phytase-encoding gene would enhance breakdown of phytate, adding
more free phosphate to the transformed plant, such as the
Aspergillus niger phytase gene (Hartingsveldt et al., 1993). [0066]
(2) A gene could be introduced that reduces phytate content. In
maize, this, for example, could be accomplished by cloning and then
reintroducing DNA associated with the single allele which is
responsible for maize mutants characterized by low levels of phytic
acid (Raboy et al., 1990).
[0067] (C) Modified carbohydrate composition effected, for example,
by transforming plants with a gene coding for an enzyme that alters
the branching pattern of starch. Examples of such enzymes include,
Streptococcus mucus fructosyltransferase gene (Shiroza et al.,
1988), Bacillus subtilis levansucrase gene (Steinmetz et al.,
1985), Bacillus licheniformis .alpha.-amylase (Pen et al., 1992),
tomato invertase genes (Elliot et al., 1993), barley amylase gene
(Sogaard et al., 1993), and maize endosperm starch branching enzyme
II (Fisher et al., 1993).
[0068] The nucleotide sequence of interest can also be a nucleotide
sequence used to target an area of the plant genome through
homologous recombination. The promoter may be placed in a construct
with such sequence, which sequence will not necessarily encode a
protein. The sequence recombines in the genome and the promoter may
be placed at the desired site targeted by the sequences to regulate
the desired endogenous nucleotide sequence.
[0069] Further, the promoter can be used to drive mRNA that can be
used for a silencing system, such as antisense, and in that
instance, no protein is produced. Nellen et al. (1993); Alexander
et al. (1988). Means of increasing or inhibiting a protein are well
known to one skilled in the art and, by way of example, may
include, transgenic expression, antisense suppression, use of
hairpin formations, co-suppression methods including but not
limited to: RNA interference, gene activation or suppression using
transcription factors and/or repressors, mutagenesis including
transposon tagging, directed and site-specific mutagenesis,
chromosome engineering and, homologous recombination. In the case
of use with homologous recombination, no in vivo construct will be
required. A few of the myriad of examples of such systems available
include use of the Mu transposon, Chandler et al. (1994); RNA
interference (U.S. Pat. No. 5,034,323); use of hairpins, Smith et
al. (2000) and ribozymes (Steinecke et al. (1992); and zinc-finger
targeted molecules, WO 01/52620. Clearly many options are available
for impacting a targeted protein.
[0070] A terminator region may also be included in the vector. An
embodiment of the invention is the terminator sequence of the
soybean ubiquitin gene, SEQ ID NO: 4. In referring to a terminator
sequence is meant a nucleotide sequence that signals the end of
transcription. Convenient termination regions are available from
the Ti-plasmid of A. tumefaciens, such as the octopine synthase
(MacDonald et al., 1991) and nopaline synthase termination regions.
Examples of various other terminators include the pin II terminator
from the protease inhibitor II gene from potato (An et al., 1989).
See also, Guerineau et al. (1991); Proudfoot (1991); Sanfacon et
al. (1991); Mogen et al. (1990); Munroe et al. (1990); Ballas et
al. (1989); and Joshi et al. (1987).
[0071] In one embodiment, the expression vector also contains a
nucleotide sequence encoding a selectable or scoreable marker that
is operably or functionally linked to a promoter that controls
transcription initiation, which can be the promoter of the
invention or another promoter. For a general description of plant
expression vectors and reporter genes, see Gruber et al. (1993).
For example, the selective gene is a glufosinate-resistance
encoding DNA or phosphinothricin acetyl transferase (pat) or a
maize optimized pat gene, or bar gene can be used under the control
of the CaMV 35S or other promoter. Such pat genes confer resistance
to the herbicide bialaphos (Gordon-Kamm et al., 1990; Wohllenben et
al. 1988). Other examples, without intending to be limiting, are
hygromycin phosphotransferase, EPSP synthase and dihydropteroate
encoding genes. See Miki et al. (1993). Scorable or screenable
markers may also be employed, where presence of the sequence
produces a visual and/or measurable product. Examples include a
.beta.-glucuronidase, or uidA gene (GUS), which encodes an enzyme
for which various chromogenic substrates are known (for example,
U.S. Pat. Nos. 5,268,463 and 5,599,670) The expression vector can
optionally also contain a signal sequence located between the
promoter and the gene of interest and/or after the gene of
interest. A signal sequence is a nucleotide sequence, translated to
give an amino acid sequence, which is used by a cell to direct the
protein or polypeptide of interest to be placed in a particular
place within or outside the eukaryotic cell. One example of a plant
signal sequence is the barley .alpha.-amylase secretion signal
(Rogers, 1985). Many signal sequences are known in the art. See,
for example Becker et al. (1992), Fontes et al. (1991), Matsuoka
and Nakamura (1991), Gould et al. (1989), Creissen et al. (1992),
Kalderon et al. (1984) and Stiefel et al. (1990).
[0072] Leader sequences can be included to enhance translation.
Various available leader sequences may be substituted or added.
Translation leaders are known in the art and include, for example:
picomavirus leaders, for example, EMCV leader (encephalomyocarditis
5' noncoding region) (Elroy-Stein et al. (1989); potyvirus leaders,
for example, TEV leader (Tobacco Etch Virus) (Gallie et al.
(1995)); human immunoglobulin heavy-chain binding protein (BiP)
(Macejak et al. (1991)); untranslated leader from the coat protein
mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987));
tobacco mosaic virus leader (TMV) (Gallie. (1987)); and maize
chlorotic mottle virus leader (MCMV) (Lommel et al. (1991)). See
also, Della-Cioppa et al. (1987). Other methods known to enhance
translation can also be utilized, for example, introns, and the
like. Obviously, many variations on the promoters, selectable
markers, signal sequences, leader sequences, termination sequences,
introns, enhancers and other components of the vector are available
to one skilled in the art.
[0073] Where appropriate, the nucleotide sequence (s) may be
optimized for increased expression in the transformed plant. That
is, the genes can be synthesized using plant-preferred codons for
improved expression. See, for example, Campbell and Gowri (1990)
for a discussion of host-preferred codon usage. Methods are
available in the art for synthesizing plant-preferred genes. See,
for example, U.S. Pat. Nos. 5,380,831, 5,436,391, and Murray et al.
(1989). Additional sequence modifications are known to enhance gene
expression in a plant. These include elimination of sequences
encoding spurious polyadenylation signals, exon-intron splice site
signals, transposon-like repeats, and other such well-characterized
sequences that may be deleterious to gene expression. The G-C
content of the sequence may be adjusted to levels average for a
given cellular host, as calculated by reference to known genes
expressed in the host cell. When possible, the sequence is modified
to avoid predicted hairpin secondary mRNA structures.
[0074] In preparing the nucleotide construct, the various
nucleotide sequence fragments can be manipulated, so as to provide
for the nucleotide sequences in the proper orientation and, as
appropriate, in the proper reading frame. Toward this end, adapters
or linkers can be employed to join the nucleotide sequence
fragments or other manipulations may be involved to provide for
convenient restriction sites, removal of superfluous nucleotide
sequences, removal of restriction sites, or the like. For this
purpose, in vitro mutagenesis, primer repair, restriction,
annealing, resubstitutions, e.g., transitions and transversions,
may be involved.
[0075] Methods for introducing expression vectors into plant tissue
available to one skilled in the art are varied and will depend on
the plant selected. Procedures for transforming a wide variety of
plant species are well known and described throughout the
literature. See, for example, Miki and McHugh (2004); Klein et al.
(1992); and Weising et al. (1988). For example, the DNA construct
may be introduced into the genomic DNA of the plant cell using
techniques such as microprojectile-mediated delivery (Klein et al.
1992), electroporation (Fromm et al., 1985), polyethylene glycol
(PEG) precipitation (Mathur and Koncz, 1998), direct gene transfer
(WO 85/01856 and EP-A-275 069), in vitro protoplast transformation
(U.S. Pat. No. 4,684,611), and microinjection of plant cell
protoplasts or embryogenic callus (Crossway, 1985). Agrobacterium
transformation methods of Ishida et al. (1996) and also described
in U.S. Pat. No. 5,591,616 are yet another option. Co-cultivation
of plant tissue with Agrobacterium tumefaciens is a variation,
where the DNA constructs are placed into a binary vector system
(Ishida et al., 1996). The virulence functions of the Agrobacterium
tumefaciens host will direct the insertion of the construct into
the plant cell DNA when the cell is infected by the bacteria. See,
for example, Fraley et al. (1983). Agrobacterium is primarily used
in dicots, but monocots including maize can be transformed by
Agrobacterium. See, for example, U.S. Pat. No. 5,550,318. In one of
many variations on the method, Agrobacterium infection of corn can
be used with heat shocking of immature embryos (Wilson et al. U.S.
Pat. No. 6,420,630) or with antibiotic selection of Type II callus
(Wilson et al., U.S. Pat. No. 6,919,494).
[0076] Rice transformation is described by Hiei et al. (1994) and
Lee et al. (1991). Standard methods for transformation of canola
are described by Moloney et al. (1989). Corn transformation is
described by Fromm et al. (1990) and Gordon-Kamm et al. (1990).
Wheat can be transformed by techniques similar to those used for
transforming corn or rice. Sorghum transformation is described by
Casas et al. (1993) and barley transformation is described by Wan
and Lemaux (1994). Soybean transformation is described in a number
of publications, including U.S. Pat. No. 5,015,580.
[0077] In one preferred method, use of aerosol beam technology for
introduction of nucleotide sequences into cells is employed.
Aerosol beam technology employs the jet expansion of an inert gas
as it passes from a region of higher gas pressure to a region of
lower gas pressure through a small orifice. The expanding gas
accelerates aerosol droplets containing the molecules to be
introduced into a cell or tissue. Aerosol droplets produced are
typically less than 0.1 micron in diameter at the point of impact
with the target cells. DNA carried in aerosol droplets of this
small size penetrates cells only because of the speeds attained by
the aerosol droplets. Speeds achieved by the aerosol beam method of
the invention are supersonic and can reach 2000 meters/second. In a
preferred embodiment, the process includes (I) culturing a source
of cells, (II) optionally, pretreating cells to yield tissue with
increased capacity for uptake and integration by aerosol beam
technology, (III) transforming said tissue with an exogenous
nucleotide sequence by the aerosol beam method of the invention,
(IV) optionally, identifying or selecting for transformed tissue,
(V) optionally regenerating transgenic plants from the transformed
cells or tissue, and (VI) optionally, producing progeny of said
transgenic plants. This process is described in detail at Held et
al., U.S. Pat. Nos. 6,809,232; 7,067,716; and 7,026,286 (these
references, as all cited references, are incorporated herein by
reference).
[0078] In accordance with the present invention, a transgenic plant
can be produced that contains an introduced soybean ubiqutin
promoter. It can be combined with any one of the components set
forth above.
[0079] In a further embodiment, plant breeding can be used to
introduce the nucleotide sequences into other plants once
transformation has occurred. This can be accomplished by any means
known in the art for breeding plants such as, for example, cross
pollination of the transgenic plants that are described above with
other plants, and selection for plants from subsequent generations
which contain the nucleic acid and/or express the amino acid
sequence or trait. The plant breeding methods used herein are well
known to one skilled in the art. For a discussion of plant breeding
techniques, see Poehlman and Sleper (1995). Many crop plants useful
in this method are bred through techniques that take advantage of
the plant's method of pollination. A plant is self-pollinating if
pollen from one flower is transferred to the same or another flower
of the same plant. A plant is cross-pollinating if the pollen comes
from a flower on a different plant. For example, in Brassica, the
plant is normally self-sterile and can only be cross-pollinated
unless, through discovery of a mutant or through genetic
intervention, self-compatibility is obtained. In self-pollinating
species, such as rice, oats, wheat, barley, peas, beans, soybeans,
tobacco and cotton, the male and female plants are anatomically
juxtaposed. During natural pollination, the male reproductive
organs of a given flower pollinate the female reproductive organs
of the same flower. Maize plants (Zea mays L.) can be bred by both
self-pollination and cross-pollination techniques. Maize has male
flowers, located on the tassel, and female flowers, located on the
ear, on the same plant. It can self or cross-pollinate.
[0080] Pollination can be by any means, including but not limited
to hand, wind or insect pollination, or mechanical contact between
the male fertile and male sterile plant. For production of hybrid
seeds on a commercial scale in most plant species pollination by
wind or by insects is preferred. Stricter control of the
pollination process can be achieved by using a variety of methods
to make one plant pool male sterile, and the other the male fertile
pollen donor. This can be accomplished by hand detassling,
cytoplasmic male sterility, or control of male sterility through a
variety of methods well known to the skilled breeder. Examples of
more sophisticated male sterility systems include those described
by Brar et al., U.S. Pat. Nos. 4,654,465 and 4,727,219 and
Albertsen et al., U.S. Pat. Nos. 5,859,341 and 6,013,859.
[0081] Backcrossing methods may be used to introduce the gene into
the plants. This technique has been used for decades to introduce
traits into a plant. An example of a description of this and other
plant breeding methodologies that are well known can be found in
references such as Poehlman et al. (1995). In a typical backcross
protocol, the original variety of interest (recurrent parent) is
crossed to a second variety (nonrecurrent parent) that carries the
single gene of interest to be transferred. The resulting progeny
from this cross are then crossed again to the recurrent parent and
the process is repeated until a plant is obtained wherein
essentially all of the desired morphological and physiological
characteristics of the recurrent parent are recovered in the
converted plant, in addition to the single transferred gene from
the nonrecurrent parent.
EXAMPLES
[0082] The following is presented as illustrative of an embodiment
of the invention and does not limit the scope of the invention as
otherwise set forth.
Example 1
Isolation of Soybean Ubiquitin Promoter and Terminator
[0083] Soybean genomic DNA was isolated using the DNeasy Plant Mini
Kit (Qiagen, Valencia, Calif.) and used as a template for
polymerase chain reaction (PCR) amplification with primers. Primers
were designed as set forth below--based on the Xia et al., supra,
sequence for soybean ubiquitin gene SOYSUBI3 (GenBank accession
D28123.1)--and contained restriction enzyme sites corresponding to
the restriction enzyme sites on the selected expression vector:
promoter forward primer gmup5 (39-mer):
EcoRI SbfI
TABLE-US-00001 [0084] (SEQ ID NO: 5)
gaattcctgcagggcccaatataacaacgacgtcgtaac
promoter reverse primer gmup3n (40-mer):
SacI zoK
TABLE-US-00002 [0085] (SEQ ID NO: 6)
gagctcggcggcctgtcgagtcaacaatcacagataaatc
The restrictions sites are shown above along with the "Kozak"
sequence, with the consensus sequence for translational initiation
region indicated in italics (Kozak, M. (1987)). The PCR products
were electrophoresed on a 0.8% agarose gel and the 911-bp amplicon
was excised from the gel. The purified amplicon was ligated into
the pGEM T-easy Vector System (Promega, Madison, Wis.) and the
ligation mixture was introduced into competent E. coli DH.alpha.
cells. Transformants were selected on Luria agar plates
supplemented with ampicillin (100 .mu.g/ml) and a recombinant clone
containing the 911-bp promoter (named pGEM/gmubipro) was identified
by EcoRI/SacI digestion of the plasmid DNAs prepared from selected
putative recombinants.
[0086] The 911-base pair insert in pgmubipro was sequenced (at the
DNA Facility, Iowa State University). The nucleotide sequence is
shown in FIG. 1B (SEQ ID NO: 2). The sequence was compared using
GAP analysis to the the Xia et al. sequence and was found to share
96% identity to SOYSUBI3 sequence, Genbank D28123 and 90% identity
to SOYSUBI1, GenBank D16248, a partial earlier reported sequence. A
comparison with an Arabidopsis polyubiquitin3 promoter, showed
about 38% identity (Bevan et al. Genbank AL163002) and comparison
with the maize polyubiquitin promoter (Quail et al, U.S. Pat. No.
6,020,190) showed about 39% identity. The promoter appeared to be
an intronless type promoter based upon NetGene2 predictions (Center
for Biological Sequence Analysis, the Technical University of
Denmark, DK-2800, Lyngby, Denmark.
[0087] The same procedure was used to isolate the
terminator(gmubiter), using the following primers prepared based on
Xia et al., GenBank sequence D28123:
terminator forward primer (41-mer):
XhoI SbfI
TABLE-US-00003 [0088] (SEQ ID NO: 7)
ctcgagcctgcaggatgatcaccatccttcacacaactcatccc
terminator reverse primer (41-mer):
XhoI SbfI
TABLE-US-00004 [0089] (SEQ ID NO: 8)
ctcgagcctgcagggaattcgaaggatgatcaccatccttc
[0090] The sequence identified is shown in FIG. 2B (SEQ ID NO: 4).
A GAP analysis with SOYSUBI3, showed 100% identity, and 86-90%
identity to SOYSUB1.
Example 2
Construction of Plasmids Used in Soybean Transformation
[0091] Plasmid pSTgmubipro-gus-nos was constructed as follows: The
gmubipromoter was taken as a EcoRI/SacI fragment from the
pGEM/gmubipro construct and was introduced into EcoRI/SacI digested
pSLJ4k1 to generate p4k1-gmubipro-GUS-Nos. (Plasmid pSLJ4k1 had the
GUS reporter gene under the control of the CaMV 35S promoter and
the nopaline syntase-nos-terminator and was obtained from the
Sainsbury Laboratory at the John Innes Center, England). Plasmid
pSTBMuNos consisted of a MuA promoter, 0.25 kb nopaline syntase 3'
end (nos) in a pUC18 backbone. The MuA promoter was removed from
the plasmid pSTBMuNos by EcoRI and XbaI double digestion and was
replaced by the EcoRIIXbaI fragment from p4k1-gmubipro-GUS-Nos
which contained the gmubipro/GUS unit. This generated the
pgmubipro-GUS-Nos construct. The Nos terminator in
pgmubipro-GUS-Nos was removed as a XbaI/XhoI fragment and was
replaced by a XbaI/XhoI fragment containing the gmubiter unit.
Example 3
Transformation of Cotledonary Explants of Soybean
[0092] Cotyledonary nodes were prepared from 5-7-day-old seedlings
as described by Paz et al. The plasmids described above were
introduced into cells of the explants by aersol beam injection. To
evaluate the transient expression potential of the newly
constructed promoter/terminator, GUS activity staining was
performed on the nodes 24 hours after the aerosol beam
treatment.
[0093] The above plasmids were also introduced into embryogenic
callus tissues (that were initiated from immature cotyledons) by
the aerosol beam injection technology to obtain stable transgenic
soybean plants.
[0094] The embryogenic soybean callus was transferred after a
culture passage of about 28 to 30 days from stock culture medium
according to U.S. Pat. No. 6,809,232 to the center of a target
plate containing the same medium. Embryogenic soybean callus can
survive being held in a vacuum for at least 10 minutes. After one
to three days' growth on the target plate, the soybean embryogenic
callus is exposed to an aerosol beam of the plasmid. After beaming,
the tissue is spread out on a fresh plate (to minimize the risk of
contamination) of the same medium. Whole plants were obtained from
the transformed tissues according to U.S. Pat. No. 6,809,232.
[0095] Briefly, the treatment of target tissue with the aerosol
beam apparatus was performed as follows: 1) place petri dish with
tissue on the stage and close vacuum chamber; 2) start the vacuum
pump; 3) start the syringe pump; 4) set the nebulizing gas
pressure; 5) set the entrainment gas pressure, and by this time the
correct vacuum in the chamber is reached; and 6) start the movement
of the stage and let the system run for the time needed to complete
the run. After the run is completed, shut down the stage, vacuum,
syringe pump, nebulizing gas, entrainment gas, and remove target
tissue from the chamber.
[0096] The aerosol was produced by a microflow nebulizer such as
the HEN from J.E. Meinhard Associates Inc., or the MCN100 style M4
nebulizer from Cetac Technologies Inc. (Liu and Montaser, 1994;
Tan, et al., 1992). The nebulizing gas was high purity
compressed-helium which was regulated with an ACCU-TROL gas
regulator--876X model RS-7-4 and filtered through an Arrow F300-02
IT filter. When HEN and the MCN100 microflow nebulizers were used,
the nebulizing pressure was preferably 20-30 psi but worked within
the range from about 10 psi to about 40 psi. The entrainment gas
filled the entrainment tube and entrained the aerosol droplets in a
straight line. Unfiltered, high purity compressed helium was used
as the entrainment gas and was regulated by an Arrow R262 regulator
to produce slight positive pressure as measured by a Gilmont model
65 mm gauge. The entrainment housing contained a nucleospot to
reduce electrostatic charges and was maintained at a temperature of
about 42.degree. C. to about 55.degree. C., and most preferably
about 55.degree. C. This reduced coalescing of the aerosol droplets
and was controlled by two Omega CN9000 series temperature
controllers. The sample flow rate to the nebulizer was controlled
by a Harvard 11 infusion only syringe pump. The flow rate was 1 to
1200 .mu.l/min using a sterile Becton Dickinson 1 cc plastic
syringe with a 0.2 micron filter attached. The sample contained 10
mM Tris buffer (pH 7.0) or a carbohydrate molecule (for example 1
g/l sucrose) and the molecules to be delivered.
Example 4
Analysis of GUS Expression
[0097] Assays were performed to determine GUS activity resulting
from expression of the uidA reporter gene (Jefferson et al., 1987).
Representative tissue samples were collected and were incubated
overnight at 37.degree. C. with Jefferson's buffer containing 0.5
mgm.sup.-1 X-gluc (Jefferson et al., 1987). Blue staining indicated
GUS activity. Following the transformation GUS expression was
assessed in the cotyledonary tissue. Strong GUS activity was
detected in the transformed explants. Analysis using the 35S
promoter/GUS reporter/OCS terminator construct and the soybean
ubiquitin promoter/GUS reporter/ soybean ubiquitin terminator
construct revealed comparable expression level (comparable GUS
staining) for the two constructs studied.
[0098] GUS activity was measured in the leaf, stem, and root
tissues of T.sub.1 soybean plants transformed with the soybean
ubiquitin promoter/GUS reporter/ soybean ubiquitin terminator
construct. Tissues from two independent events were used in the GUS
activity assays. Intense blue staining in all the tested tissues
(from both events) was observed. The leaf, stem, and root tissues
taken from a transgenic plant that did not contain the soybean
ubiquitin promoter/GUS reporter/soybean ubiquitin terminator
construct, on the other hand, did not stain blue in the GUS
activity assays. These results demonstrate the ability of the
soybean ubiquitin promoter to direct the expression of the
.beta.-glucuronidase enzyme in all the tissues.
[0099] As can be seen, the invention can be practiced with a number
of variations known to one skilled in the art and achieves it
objectives
REFERENCES
[0100] Abe et al. (1987) J. Biol. Chem. 262:16793 [0101] Adang et
al. (1993), Plant Molec. Biol. 21:1131. [0102] Altschul, S. F.,
Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990) Basic
local alignment search tool. J. Mol. Biol. 215, 403-410. [0103]
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang,
Z., Miller, W. and Lipman, D. J. (1997) Nucleic Acids Res. 25,
3389-3402. [0104] Alexander et al. (1988) Gene 72:45-50 [0105] An,
G., Mitra, A., Choi, H. K., Costa, M. A., An, K., Thornburg, R. W.
and Ryan, C. A. (1989) Functional analysis of the 3' control region
of the potato wound-inducible proteinase inhibitor II gene. Plant
Cell 1, 115-122. [0106] Ausubel et al, (1997) Short Protocols in
Molecular Biology, page 2-40, Third Edit. [0107] Ballas et al.
(1989) Nucleic Acids Res. 17:7891-7903 [0108] Bambot et al. (1993).
PCR Methods and Applications 2:266 [0109] Beachy et al. (1990) Ann.
Rev. Phytopathol. 28:451 [0110] Becker, T. W., Templeman, T. S.,
Viret, J. F. and Bogorad, L. (1992) The cab-m7 gene: a
light-inducible, mesophyll-specific gene of maize. Plant Mol. Biol.
20, 49-60. [0111] Broglie, R., Coruzzi, G., Fraley, R. T., Rogers,
S. G., Horsch, R. B., Niedermeyer, J. G., Fink, C. L. and Chua, N.
H. (1984) Light-regulated expression of a pea
ribulose-1,5-bisphosphate carboxylase small subunit gene in
transformed plant cells. Science 224, 838-843. [0112] Bustos, M.
M., Guiltinan, M. J., Jordano, J., Begum, D., Kalkan, F. A. and
Hall, T. C. (1989) Regulation of beta-glucuronidase expression in
transgenic tobacco plants by an A/T-rich, cis-acting sequence found
upstream of a French bean beta-phaseolin gene. Plant Cell 1,
839-853. [0113] Caddick M. X., Greenland, A. J., Jepson, I.,
Krause, K. P., Qu, N., Riddell, K. V., Salter, M. G., Schuch, W.,
Sonnewald, U. and Tomsett, A. B. (1998) An ethanol inducible gene
switch for plants used to manipulate carbon metabolism. Nat.
Biotechnol. 16, 177-180. [0114] Campbell and Gowri (1990) Plant
Physiol. 92: 1-11 [0115] Canevascini et al. (1996) Plant Physiol.
112(2): 513-524 [0116] Casas, A. M., Kononowicz, A. K., Zehr, U.
B., Tomes, D. T., Axtell, J. D., Butler, L. G., Bressan, R. A. and
Hasegawa P. M. (1993) Transgenic sorghum plants via microprojectile
bombardment. Proc. Natl. Acad. Sci. USA 90, 11212-11216. [0117]
Chandler, (1994) The Maize handbook ch. 118 Springer-Verlag [0118]
Corpet, F. (1988) Multiple sequence alignment with hierarchical
clustering. Nucleic Acids Res. 16, 10881-10890. [0119] Coruzzi, G.,
Broglie, R., Edwards, C. and Chua, N. H. (1984) Tissue-specific and
light-regulated expression of a pea nuclear gene encoding the small
subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J. 3,
1671-1679. [0120] Creissen, G., Edwards, E. A., Enard, C., Wellbum,
A. and Mullineaux, P. (1992) Molecular characterization of
glutathione reductase cDNA from pea (Pisum sativum L.). Plant J. 2,
129-131. [0121] Crossway, A. (1985) Mol. Gen. Genet. 202, 179-185.
[0122] De Greef et al. (1989) Bio/Technology 7:61. [0123]
Della-Cioppa et al. (1987) Plant Physiology 84:965-968. [0124]
Elliott et al. (1993) Plant Molec. Biol. 21:515 [0125] Elroy-Stein
et al. (1989) Proc. Natl. Acad. Sci USA 86:6126-6130. [0126]
Erlich, ed. (1989) PCR Technology (Stockton Press, New York).
[0127] Finer et al. "Characterization of soybean promoters through
evaluation of GFP expression in transgenic soybean" The 11.sup.th
Biennial Conference on the Molecular & Cellular Biology of the
Soybean, Aug. 5-8, 2006, University of Nebraska, Lincoln, Neb.
fisher et al. (1993) Plant Physiol. 102:1045. [0128] Fontes, E. B.,
Shank, B. B., Wrobel, R. L., Moose, S. P., OBrian, G. R., Wurtzel,
E. T. and Boston, R. S. (1991) Characterization of an
immunoglobulin binding protein homolog in the maize floury-2
endosperm mutant. Plant Cell 3, 483-496. [0129] Fraley, R. T.,
Rogers, S. G., Horsch, R. B., Sanders, P. R., Flick, J. S., Adams,
S. P., Bittner, M. L., Brand, L. A., Fink, C. L., Fry, J. S.,
Galluppi, G. R., Goldberg, S. B., Hoffmann, N. L. and Woo, S. C.
(1983) Expression of bacterial genes in plant cells. Proc. Natl.
Acad. Sci. USA, 80, 4803-4807. [0130] Fromm, M., Taylor, L. P. and
Walbot, V. (1985) Expression of genes transferred into monocot and
dicot plant cells by electroporation. Proc. Natl. Acad. Sci. USA
82, 5824-5828. [0131] Fromm, M. E., Morrish, F., Armstrong, C.,
Williams, R., Thomas, J. and Klein, T. M. (1990) Inheritance and
expression of chimeric genes in the progeny of transgenic maize
plants. Biotechnology (NY) 8, 833-839. [0132] Gallie et al. (1987)
The 5' leader sequence of tobacco mosaic virus RNA enhances the
expression of foreign gene transcripts in vitro and in vivo.
Nucleic Acids Res. 15(8):3257-73 [0133] Gallie et al. (1995) The
tobacco etch viral 5' leader and poly(A) tail are functionally
synergistic regulators of translation. Gene 165 (2):233-8. [0134]
Gatz et al. (1991) Mol. Gen. Genet. 227:229-237 [0135] Gordon-Kamm,
W., Dilkes, B. P., Lowe, K., Hoerster, G., Sun, X., Ross, M.,
Church, L., Bunde, C., Farrell, J., Hill, P., Maddock, S., Snyder,
J., Sykes, L., Li, Z., Woo, Y. M., Bidney, D. and Larkins, B. A.
(1990) Transformation of maize cells and regeneration of fertile
transgenic plants. Plant Cell 2, 603-618. [0136] Gould, S. J.,
Keller, G. A., Hosken, N., Wilkinson, J. and Subramani, S. (1989) A
conserved tripeptide sorts proteins to peroxisomes. J. Cell. Biol.
108, 1657-1664. [0137] Grdzelishvili, V. Z., Chapman, S. N.,
Dawson, W. O. and Lewandowski, D. J. (2000) Mapping of the tobacco
mosaic virus movement protein and coat protein subgenomic RNA
promoters in vivo. Virology 275, 177-192. [0138] Griess et al.
(1994) Plant Physiol. 104:1467. [0139] Gruber et al. (1993) Vectors
for plant transformation. In: Glick, B. R. and Thompson J. E.
(Eds.) Methods in Plant Molecular Biology and Biotechnology, CRC
Press, pp. 89-119. [0140] Guerineau et al. (1991) Mol. Gen. Genet.
262:141-144 [0141] Guevara-Garcia et al. (1993) Plant J. 4(3):
495-505 [0142] Guilley, H., Dudley, R. K., Jonard, G., Balazs, E.
and Richards, K. E. (1982) Transcription of Cauliflower mosaic
virus DNA: detection of promoter sequences, and characterization of
transcripts. Cell 30, 763-773. [0143] Gurley, W. B., Czamecka, E.,
Nagao, R. T. and Key, J. L. (1986) Upstream sequences required for
efficient expression of a soybean heat shock gene. Mol. Cell. Biol.
6, 559-565. [0144] Hammock et al. 91990) Nature 344:458. [0145]
Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343 [0146] Hayes et
al. (1992) Biochem. J. 285:173 [0147] Hiei, Y., Ohta, S., Komari,
T. and Kumashiro, T. (1994) Efficient transformation of rice (Oryza
sativs L.) mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA. Plant J. 6, 271-282. Higgins, D. G. and
Sharp, P. M. (1988) CLUSTAL: a package for performing multiple
sequence alignment on a microcomputer. Gene 73, 237-244. [0148]
Higgins, D. G. and Sharp, P. M. (1989) Fast and sensitive multiple
sequence alignments on a microcomputer. Comput. Appl. Biosci. 5,
151-153. [0149] Huang, X., Miller, W., Schwartz, S. and Hardison,
R. C. (1992) Parallelization of a local similarity algorithm.
Comput. Appl. Biosci. 8, 155-65. [0150] Huub et al. (1993) Plant
Molec. Biol. 21:985. [0151] Innis, M., Gelfand, D., Sninsky, J. and
White, T. (1990) PCR Protocols: A Guide to Methods and
Applications. Academic Press, New York. [0152] Innis, M., Gelfand,
D. and Sninsky, J. (1995) PCR Strategies. Academic Press, New York.
[0153] Innis, M., Gelfand, D. and Sninsky, J. (1999) PCR
Applications: Protocols for Functional Genomics. Academic Press,
New York. [0154] Ishida, Y., Saito, H., Ohta, S., Hiei, Y., Komari,
T. and Kumashiro, T. (1996) High efficiency transformation of maize
(Zea mays L.) mediated by Agrobacterium tumefaciens. Nat.
Biotechnol. 14, 745-750. [0155] Jaynes et al. (1993) Plant. Sci.
89:43. [0156] Jefferson, R. A., Kavanagh, T. A. and Bevan, M. W.
(1987) GUS fusions: beta-glucuronidase as a sensitive and versatile
gene fusion marker in higher plants. EMBO J. 6, 3901-7. [0157]
Jobling et al. (1987) Nature 325:622-625 [0158] Joshi et al. (1987)
Nucleic Acid Res. 15:9627-9639 [0159] Kalderon, D., Roberts, B. L.,
Richardson, W. D. and Smith A. E. (1984) A short amino acid
sequence able to specify nuclear location. Cell 39, 499-509. [0160]
Karlin, S. and Altschul, S. F. (1990) Methods for assessing the
statistical significance of molecular sequence features by using
general scoring schemes. Proc. Natl. Acad. Sci. USA 87, 2264-2268.
[0161] Karlin, S. and Altschul, S. F. (1993) Applications and
statistics for multiple high-scoring segments in molecular
sequences. Proc. Natl. Acad. Sci. USA 90, 5873-5877. [0162]
Kawalleck et al. (1993) Plant Molec. Biol. 21:673. [0163] Kawamata
et al. (1997) Plant Cell Physiol. 38(7): 792-803 [0164] Klein, T.
M., Arentzen, R., Lewis, P.A. and Fitzpatrick-McElligott, S. (1992)
Transformation of microbes, plants and animals by particle
bombardment. Biotechnology (NY) 10, 286-291. [0165] Knultzon et al.
(1992) Proc. Nat. Acad. Sci. USA 89:2624. [0166] Kozak, M. (1987) J
Mol Biol. 196:947-950 [0167] Kramer et al. (1993) Insect. Molec.
Biol. 23:691 [0168] Lam (1994) Results Probl. Cell Differ. 20:
181-196; [0169] Lee et al. (1988) EMBO J. 7:1241 [0170] Lee, N.,
Wang, Y., Yang, J., Ge, K., Huang, S., Tan, J. and Testa, D. (1991)
Efficient transformation and regeneration of rice small cell
groups. Proc. Nat. Acad. Sci. USA 88, 6389-6393. [0171] Leung, J.,
Fukuda, H., Wing, D., Schell, J. and Masterson, R. (1991)
Functional analysis of cis-elements, auxin response and early
developmental profiles of the mannopine synthase bi-directional
promoter. Mol. Gen. Genet. 230, 463-474. [0172] Lommel et al.
(1991) Virology 81:382-385. [0173] Longemann et al. (1992)
Bio/Technology 10:3305. [0174] Macejak et al. (1991) Nature
353:90-94 [0175] MacDonald et al. (1991) Characterization of the
polyadenylation signal from the T-DNA-encoded octopine synthase
gene 19(20)5575-5581 [0176] Maiti, I. B., Gowda, S., Kiernan, J.,
Ghosh, S. K. and Shepherd, R. J. (1997) Promoter/leader deletion
analysis and plant expression vectors with the figwort mosaic virus
(FMV) full length transcript (FLt) promoter containing single or
double enhancer domains. Transgenic Res. 6, 143-156. [0177]
Marshall et al. (1992) Theor. Appl. Genet. 83:435. [0178] Martin et
al. (1993) Science 262:1432. [0179] Mathur, J. and Koncz, C. (1998)
PEG-mediated protoplast transformation with naked DNA. Methods Mol.
Biol. 82, 267-276. [0180] Matsuoka, K. and Nakamura, K. (1991)
Propeptide of a precursor to a plant vacuolar protein required for
vacuolar targeting. Proc. Natl. Acad. Sci. USA 88, 834-838. [0181]
Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20): 9586-9590
[0182] McNellis et al. (1998) Plant J. 14(2):247-257) [0183]
Meinkoth, J. and Wahl, G. (1984) Hybridization of nucleic acids
immobilized on solid supports. Anal. Biochem. 138, 267-284. [0184]
Mett et al. PNAS 90: 4567-4571 (1993) [0185] Miki et al. (1990)
Theor. Appl. Genet. 80:449. [0186] Miki et al. (1993) "Procedures
for Introducing Foreign DNA into Plants" in Methods in Plant
Molecular Biology and biotechnology Glick et al. (eds) CRC Press,
pp. 67-88. [0187] Miki, B. and McHugh, S. (2004) Selectable marker
genes in transgenic plants: applications, alternatives and
biosafety. J. Biotechnol. 107, 193-232. [0188] Mindrinos et al.
(1994) Cell 78:1089. [0189] Mogen et al. (1990) Plant Cell
2:1261-1272 [0190] Moloney, M. et al. (1989) High efficiency
transformation of Brassica napus using Agrobacterium vectors. Plant
Cell Reports 8, 238-242. [0191] Mullis et al. (1987) Methods
Enzymol. 155:335-350 [0192] Munroe et al. (1990) Gene 91:151-158
[0193] Murray et al. (1989) Nucleic Acids Res. 17:477-498 [0194]
Myers, E. W. and Miller, W. (1988) Optimal alignments in linear
space. Comput. Appl. Biosci. 4, 11-17. [0195] Needleman, S. B. and
Wunsch, C. D. (1970) A general method applicable to the search for
similarities in the amino acid sequence of two proteins. J. Mol.
Biol. 48, 443-453. [0196] Nellen et al. (1993) TIBS 18:419-423
[0197] Odell, J. T., Nagy, F. and Chua, N. H. (1985) Identification
of DNA sequences required for activity of the cauliflower mosaic
virus 35S promoter. Nature 313, 810-812. [0198] Opsahl-Sorteberg,
H-G. et al., "Identification of a 49-bp fragment of the HvLTP2
promoter directing aleruone cell specific expression" Gene
341:49-58 (2004). [0199] Orozco et al. (1993) Plant Mol Biol.
23(6): 1129-1138 [0200] Pang et al. (1992) Gene 116:165. [0201]
Pearson, W. R. and Lipman, D. J. (1988) Improved tools for
biological sequence comparison. Proc. Natl. Acad. Sci. USA 85,
2444-2448. [0202] Pearson, W. R. (1994) Using the FASTA program to
search protein and DNA sequence databases. Methods Mol. Biol. 24,
307-331. [0203] Pen et al. (1992) Bio/Technology 10:292 [0204]
Poehlman, J. M. and Sleper, D. A. (1995) Breeding field crops,
4.sup.th Edition, Iowa State University Press. [0205] Pratt et al.
(1989) Biochem. Biophys. Res. Comm. 163:1243. [0206] Proudfoot
(1991) Cell 64:671-674 [0207] Przibilla et al. (1991) Plant Cell
3:169. [0208] Raboy et al. (1990) Maydica 35:383. [0209] Rinehart
et al. (1996) Plant Physiol. 112(3): 1331-1341 [0210] Russell et
al. (1997) Transgenic Res. 6(2): 157-168 [0211] Rogers, J. C.
(1985) Two barley alpha-amylase gene families are regulated
differently in aleurone cells. J. Biol. Chem. 260, 3731-3738.
[0212] Russell, D. A. and Fromm, M. E. (1997) Tissue-specific
expression in transgenic maize of four endosperm promoters from
maize and rice. Transgenic Res. 6, 157-168. [0213] Sambrook, J.,
Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2.sup.nd Edition. Cold Spring Harbor Laboratory
Press, Plainview, N.Y. [0214] Sanfacon et al. (1991) Genes Dev.
5:141-149 [0215] Schena et al. (1991) Proc. Natl. Acad. Sci. USA
88:10421-10425 [0216] Shiroza et al. (1988) J. Bacteriol. 170:810.
[0217] Smith, T. F. and Waterman, M. S. (1981) Adv. Appl. Math. 2,
482-489. [0218] Smith et al. (2000) nature 407:319-320 [0219]
Sogaard et al. (1993) J. Biol. Chem. 268(30)22480-4. [0220]
Steinecke et al. (1992) EMBOL J. 11: 1525. [0221] Steinmetz et al.
(1985) Mol. Gen. Genel. 200:220 [0222] Stiefel, V., Ruiz-Avila, L.,
Raz, R., Pilar Valles, M., Gomez, J., Pages, M.,
Martinez-Izquierdo, J. A., Ludevid, M. D., Langdale, J. A., Nelson,
T., et al. (1990) Expression of a maize cell wall
hydroxyproline-rich glycoprotein gene in early leaf and root
vascular differentiation. Plant Cell 2, 785-793. [0223] Sumitani et
al. (1993) Biosci. Biotech. Biochem. 57:1243 [0224] Tavladoraki et
al. (1993) nature 266:469 [0225] Taylor et al. (1994) Abstract
#497, Seventh Int'l Symposium on Molecular Plant-Microbe
Interations. [0226] Toubart et al. (1992) Plant J. 2:367. [0227]
Van Camp et al. (1996) Plant Physiol. 112(2): 525-535. [0228] Van
Damme et al. (1994) Plant Molec. Biol. 24:825. [0229] Velten, J.
and Schell, J. (1985) Selection-expression plasmid vectors for use
in genetic transformation of higher plants. Nucleic Acids Res. 13,
6981-6998.
[0230] Wan, Y. and Lemaux, P. G. (1994) Generation of large numbers
of independently transformed fertile barley plants. Plant Physiol.
104, 37-48. [0231] Ward et al. Plant Mol. Biol. 22: 361-366 (1993)
[0232] Weising, K., Schell, J. and Kahl, G. (1988) Foreign genes in
plants: transfer, structure, expression, and applications. Annu.
Rev. Genet. 22, 421-477. [0233] Wohlleben, W., Arnold, W., Broer,
I., Hillemann, D., Strauch, E. and Puhler, A. (1988) Nucleotide
sequence of the phosphinothricin N-acetyltransferase gene from
Streptomyces virochromogenes Tu494 and its expression in Nicotiana
tabacum. Gene 70, 25-37. [0234] Wosnicket al. (1987). Gene 60:115.
[0235] Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778
[0236] Yamamoto et al. (1997) Plant J. 12(2) 255-265 [0237] Xia et
al. Plant Physiol. (1994) 104:805-806
Sequence CWU 1
1
81940DNAGlycine maxmodified_base(671)a, c, g, t, unknown or other
1gaattcctgc agggcccaat ataacaacga cgtcgtaaca gataaagcga agcttgaagg
60tgcatgtgac tccgtcaaga ttacggaacc gccaactacc acgcaaattg caattctcaa
120tttcctagaa ggactctccg aaaatgcatc caataccaaa tattacccgt
gtcataggca 180ccaagtgaca ccatacatga acacgcgtca caatatgact
ggagaagggt tccacacctt 240atgctataaa acgccccaca cccctcctcc
ttccttcgca gttcaattcc aatatattcc 300attctctctg tgtatttccc
tacctctccc ttcaaggtta gtcgatttct tctgtttttc 360ttcttcgttc
tttccatgaa ttgtgtatgt tctttgatca atacgatgtt gatttgattg
420tgttttgttt ggtttcatcg atcttcaatt ttcataatca gattcagctt
ttattatctt 480tacaacaacg tccttaattt gatgattctt taatcgtaga
tttgctctaa ttagagcttt 540ttcatgtcag atccctttac aacaagcctt
aattgttgat tcattaatcg tagattaggg 600cttttttcat tgattacttc
agatccgtta aacgtaacca tagatcaggg ctttttcatg 660aattacttca
natccgttaa acaacagcct tattttttat acttctgtgg tttttcaaga
720aattgttcag atccgttgac aaaaagcctt attcgttgat tctatatcgt
ttttcgagag 780atattgctca gatctgttag caactgcctt gtttgttgat
tctattgccg tggattaggg 840ttttttttca cgagattgct tcagatccgt
acttaagatt acgtaatgga ttttgattct 900gatttatctg tgattgttga
ctcgacaggc cgccgagctc 9402911DNAGlycine maxmodified_base(654)a, c,
g, t, unknown or other 2aatataacaa cgacgtcgta acagataaag cgaagcttga
aggtgcatgt gactccgtca 60agattacgga accgccaact accacgcaaa ttgcaattct
caatttccta gaaggactct 120ccgaaaatgc atccaatacc aaatattacc
cgtgtcatag gcaccaagtg acaccataca 180tgaacacgcg tcacaatatg
actggagaag ggttccacac cttatgctat aaaacgcccc 240acacccctcc
tccttccttc gcagttcaat tccaatatat tccattctct ctgtgtattt
300ccctacctct cccttcaagg ttagtcgatt tcttctgttt ttcttcttcg
ttctttccat 360gaattgtgta tgttctttga tcaatacgat gttgatttga
ttgtgttttg tttggtttca 420tcgatcttca attttcataa tcagattcag
cttttattat ctttacaaca acgtccttaa 480tttgatgatt ctttaatcgt
agatttgctc taattagagc tttttcatgt cagatccctt 540tacaacaagc
cttaattgtt gattcattaa tcgtagatta gggctttttt cattgattac
600ttcagatccg ttaaacgtaa ccatagatca gggctttttc atgaattact
tcanatccgt 660taaacaacag ccttattttt tatacttctg tggtttttca
agaaattgtt cagatccgtt 720gacaaaaagc cttattcgtt gattctatat
cgtttttcga gagatattgc tcagatctgt 780tagcaactgc cttgtttgtt
gattctattg ccgtggatta gggttttttt tcacgagatt 840gcttcagatc
cgtacttaag attacgtaat ggattttgat tctgatttat ctgtgattgt
900tgactcgaca g 9113342DNAGlycine max 3tctagagctc gttgtgtaat
gttggatgtg ttcccaaaac atttgaagaa ctttgatgtt 60taatgggtct gtaataatgt
cccttgaaaa taagttcggt ttgtgttgaa ctcaattgtg 120tcccattaat
aatagtactc taatatccca cctacgtttg ttatgaatgt gtgaaatatg
180aaatgattaa ttgtcatatc gtgttgtttt aatttgttct gaattggcta
gaggggactt 240aatatggatt ttttattcga tttgtgtggt cttccatgct
tgtcatgaag gaaaaacagg 300gatgagttgt gtgaaggatg gtgatcatcc
tgcaggctcg ag 3424322DNAGlycine max 4gctcgttgtg taatgttgga
tgtgttccca aaacatttga agaactttga tgtttaatgg 60gtctgtaata atgtcccttg
aaaataagtt cggtttgtgt tgaactcaat tgtgtcccat 120taataatagt
actctaatat cccacctacg tttgttatga atgtgtgaaa tatgaaatga
180ttaattgtca tatcgtgttg ttttaatttg ttctgaattg gctagagggg
acttaatatg 240gattttttat tcgatttgtg tggtcttcca tgcttgtcat
gaaggaaaaa cagggatgag 300ttgtgtgaag gatggtgatc at
322539DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5gaattcctgc agggcccaat ataacaacga cgtcgtaac
39640DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6gagctcggcg gcctgtcgag tcaacaatca cagataaatc
40744DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7ctcgagcctg caggatgatc accatccttc acacaactca tccc
44841DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8ctcgagcctg cagggaattc gaaggatgat caccatcctt c
41
* * * * *