Binding Phenol Oxidizing Enzyme-Peptide Complexes

Abstract

The present application relates to peptides which bind to a target stain, phenol oxidizing enzyme-binding peptide complexes wherein the binding peptide is attached to the C-terminus of the phenol oxidizing enzyme or is inserted or substituted into the phenol oxidizing enzyme. In a preferred embodiment the phenol oxidizing enzyme is a laccase specifically Stachybotrys oxidase B and variants thereof. The invention provides expression vectors comprising the phenol oxidizing enzyme-binding peptide complex as well as host cells comprising the vectors.

Description

FIELD OF THE INVENTION

[0001] The present invention relates to peptides which bind to a selective target stain and relates to a phenol oxidizing enzyme-peptide complex, which includes the binding peptide conjugated with a phenol-oxidizing enzyme. The phenol oxidizing enzyme-peptide complex may be used in enzymatic compositions, particularly detergent compositions to specifically target stains.

BACKGROUND OF THE INVENTION

[0002] Phenol oxidizing enzymes function by catalyzing redox reactions, i.e., the transfer of electrons from an electron donor (usually a phenolic compound) to molecular oxygen (which acts as an electron acceptor) which is reduced to H.sub.2O or H.sub.2O.sub.2. While being capable of using a wide variety of different phenolic compounds as electron donors, phenol oxidizing enzymes are very specific for molecular oxygen as the electron acceptor.

[0003] Phenol oxidizing enzymes can be utilized for a wide variety of applications, including in the detergent industry, the paper and pulp industry, the textile industry, and the food industry. Phenol oxidizing enzymes are specifically used for their color modifying ability for example for pulp and paper bleaching, for bleaching the color of stains on fabric, and for anti-dye transfer in detergent and textile applications. While the prior art does teach various phenol oxidizing enzymes useful in the above mentioned applications, there remains a need for new and more effective phenol oxidizing enzymes having stain bleaching ability, anti-dye transfer properties, and selective stain removal ability. It is a purpose of the present application to create phenol oxidizing enzyme-peptide complexes with increased binding ability to target stains when compared to the corresponding phenol oxidizing enzyme without the binding peptide. A further purpose of the present invention is to provide a phenol oxidizing enzyme-peptide complex having bleaching ability and particularly to provide a phenol oxidizing enzyme-peptide complex having an ability to remove stains obtained from carotenoid chromophore containing compounds such as those found in tomato and paprika.

SUMMARY OF THE INVENTION

[0004] In one aspect the invention pertains to a binding peptide having an amino acid sequence illustrated in any one of SEQ ID NOS: 2 through 433 wherein the peptide binds to a colored substance and particularly to a stain from a carotenoid compound. In one preferred embodiment the binding peptides are the peptides listed in Table 1. In another preferred embodiment the binding peptides are the peptides designated as SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304 and 317. In yet another preferred embodiment the binding peptides further include a cysteine amino acid residue added to each end of the binding peptide.

[0005] In a second aspect, the invention pertains to a binding peptide comprising a repeatable motif of 3 to 6 amino acids. In one preferred embodiment, the repeatable motif is selected from the group consisting of SAPA, TAPP, APAL, PPP, PPPP, SSPH, SSP, SSK, SPT, LPAQ, PPPL, PTPL, SPTT, PLVP, PLP, YTKP, SLH, SLLNA, SPL, SNLA, SPLTQ, TTT, AARND, AARN, ARND, LSPG, NPNN, NLAT, NTS, PHSM, PPWM, PTSP, TGGA, YLPS, YTKP, PGSL, APS, TPV, TTTS and LNAT, wherein the binding peptide has 6 to 15 amino acid residues and binds to a carotenoid compound stain on a fabric.

[0006] In a third aspect, the invention pertains to polynucleotides encoding the binding peptides.

[0007] In a fourth aspect, the invention pertains to a phenol oxidizing enzyme-peptide complex comprising a phenol oxidizing enzyme and a peptide comprising an amino acid sequence illustrated in any one of SEQ ID NOS: 2 through 433 or a peptide having a repeatable motif as illustrated in Table 2, wherein the complex binds to a colored substance and particularly to a carotenoid compound. In one embodiment the phenol oxidizing enzyme-peptide complex comprises a binding peptide selected from the group consisting of SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304, and 317. In one preferred embodiment the phenol oxidizing enzyme is a laccase and most preferably the laccase is obtainable from a Stachybotrys species. In a further preferred embodiment the laccase has the amino acid sequence illustrated in SEQ ID NO: 1. In yet another preferred embodiment the laccase-peptide complex comprises a variant of sequence SEQ ID NO: 1, wherein said variant differs from SEQ ID NO: 1 in at least one of the positions 48, 67, 70, 76, 83, 98, 115, 119, 134, 171, 175, 177, 179, 188, 236, 246, 253, 269, 272, 296, 302, 308, 318, 329, 331, 346, 348, 349, 365, 390, 391, 394, 404, 415, 423, 425, 428, 434, 465, 479, 481, 483, 499, 550, 562, 570, and 573 or sequence positions corresponding thereto and wherein said complex is capable of modifying the color associated with colored compounds. In another preferred embodiment the binding peptide is attached to the C-terminus of the phenol oxidizing enzyme. In yet another embodiment the binding peptide is combined with the phenol oxidizing enzyme in an internal site, preferably by insertion or substitution.

[0008] In a fifth aspect, the invention pertains to expression vectors and host cells incorporating the expression vectors comprising a polynucleotide encoding a phenol oxidizing enzyme-peptide complex or a polynucleotide encoding a binding peptide according to the invention. In one preferred embodiment the host cell is a fungal cell.

[0009] In a sixth aspect, the invention pertains to a method of enhancing the binding of a laccase enzyme to a target stain and particularly to a carotenoid compound stain. The method includes obtaining a binding peptide of the invention, combining the peptide with a laccase to form a laccase-peptide complex, and exposing a target stain to the laccase-peptide complex under suitable conditions to allow the complex to bind with the target stain.

[0010] In a seventh aspect, the invention pertains to detergent and enzyme compositions comprising one or more surfactants and/or additives and the phenol oxidizing enzyme-peptide complex of the invention, wherein said complex selectively binds to a target stain during a wash cycle that includes agitation. In one preferred embodiment the phenol oxidizing enzyme is a laccase. In another preferred embodiment the compositions include one or more enzymes other than laccase.

[0011] In an eighth aspect, the invention pertains to a method for producing a host cell comprising a polynucleotide encoding a laccase-peptide complex, comprising (a) obtaining a polynucleotide encoding a laccase having at least 68% identity to the amino acid sequence disclosed in SEQ ID NO: 1; (b) obtaining a polynucleotide encoding a binding peptide having an amino acid sequence as illustrated in any one SEQ ID NOS: 2-433; conjugating the polynucleotide of (a) with (b); introducing said conjugated polynucleotide into a host cell; and growing said host cell under conditions suitable for the production of said laccase-peptide complex.

[0012] In a ninth aspect, the invention pertains to a method of using a binding peptide to target a stain on a textile comprising obtaining a binding peptide as illustrated in any one of SEQ ID NOS: 2-433; and exposing said binding peptide to a target stain, wherein said binding peptide binds to said stain and not to said textile.

[0013] In a tenth aspect, the invention pertains to a method of enhancing the selectivity of a phenol oxidizing enzyme to a target stain which comprises, derivatizing a laccase with a binding peptide as illustrated in any one of SEQ ID NOS: 2-433 to form a laccase-peptide complex; and exposing the laccase-peptide complex to a target stain, wherein selectivity of the laccase-peptide complex to the target stain is greater than the selectivity of the a non-derivatized laccase having the same amino acid sequence as the laccase of the laccase-peptide complex.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIGS. 1A-1E disclose the amino acid sequence of peptides represented by SEQ ID NOS: 2-433 according to the invention. These peptides bind to tomato or paprika stains on cotton using a cyclic 7-mer (FIGS. 1A and 1C), a linear 12-mer (FIGS. 1B and 1D) or mixed population (FIG. 1E) of a phage random peptide library as further discussed in the examples.

[0015] FIG. 2 illustrates the amino acid sequence (SEQ ID NO: 1) for the enzyme designated herein as the Stachybotrys phenol oxidase B having MUCL accession number 38898. (Also reference is made to U.S. Pat. No. 6,168,936)

[0016] FIG. 3 provides an illustration of the vector pGAPT which was used for the expression of Stachybotrys phenol oxidase B (SEQ ID NO: 1) and variants thereof in either derivatized form (as a laccase-peptide complex) or in nonderivatized form (the laccase backbone with no binding peptide combination) in Aspergillus niger. Base 1 to 1134 contains Aspergillus niger glucoamylase gene promoter. Base 1227 to 1485 and 3079 to 3100 contains Aspergillus niger glucoamylase terminator. Aspergillus nidulans pyrG gene was inserted from 1486 to 3078 as a marker for fungal transformation. The rest of the plasmid contains pUC18 sequence for propagation in E. coli. Nucleic acid encoding the Stachybotrys phenol oxidase B of SEQ ID NO: 1 was cloned into the BGI II and Xba I restriction sites.

[0017] FIG. 4 illustrates the scheme for C-terminus insertion of a binding peptide in Stachybotrys phenol oxidase B.

[0018] FIG. 5 illustrates the preferential binding of peptide, YGYLPSR (SEQ ID NO: 16) to tomato stained cotton swatches as compared to unsoiled cotton swatches.

[0019] FIG. 6 illustrates the oxidation of ABTS by laccase-peptide complexes:

TABLE-US-00001 (a) SEQ ID NO: 1 - IERSAPATAPPP (SEQ ID NO: 92); (b) SEQ ID NO: 1 - KASAPAL (SEQ ID NO: 24); (c) SEQ ID NO: 1 - C-C derivative of SEQ ID NO: 24; and (d) non-derivatized SEQ ID NO: 1.

[0020] FIG. 7 illustrates the difference in binding of a derivatized laccase (A) with the corresponding non-derivatized laccase (B) on tomato stained and non-stained cotton swatches. The laccase is provided at a concentration of 1.00 mg/ml, 0.10 mg/ml and 0.01 mg/ml. The derivatized laccase is the M254F/E346V/E348Q variant attached at the C-terminus to YGYLPSR (SEQ ID NO: 16) and the non-derivatized laccase is the M254F/E346V/E348Q variant.

DETAILED DESCRIPTION OF THE INVENTION

General Terms

[0021] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For the purpose of the present invention, the following terms are used to describe the invention herein.

[0022] The term "peptide" refers to an oligomer in which the monomer units are amino acids (typically, but not limited to L-amino acids) linked by an amide bond. Peptides may be two or more amino acids in length. Peptides that are greater than 100 amino acids in length are generally referred to as polypeptides. However, the terms, peptide, polypeptide and protein may be used interchangeably. Standard abbreviations for amino acids are used herein and reference is made to Singleton et al., (1987) Dictionary of Microbiology and Molecular Biology, 2nd Ed. page 35.

[0023] "Percent sequence identity" with respect to peptide or polynucleotide sequences refers to the percentage of residues that are identical in the two sequences. Thus 95% amino acid sequence identity means that 95% of the amino acids in the sequences are identical. Percent identity can be determined by direct comparison of the sequence information provided between two sequences and can be determined by various commercially available computer programs such as BESTFIT, FASTA, TFASTA and BLAST.

[0024] A "binding peptide" according to the invention is a peptide that binds to a target with a binding affinity of at least about 10.sup.-2 M, at least about 10.sup.-3 M, at least about 10.sup.-4 M, at least about 10.sup.-5 M and preferably between about 10.sup.-2 M to 10.sup.-15 M, between about 10.sup.-2 M to 10.sup.-10 M and between about 10.sup.-2 M to 10.sup.-9 M.

[0025] The binding affinity of a peptide for its target or the binding affinity of a phenol oxidizing enzyme-peptide complex for its target may be described by the dissociation constant (K.sub.D). K.sub.D is defined by k.sub.off/k.sub.on. The k.sub.off value defines the rate at which a bound-target complex breaks apart or separates. This term is sometimes referred to in the art as the kinetic stability of the peptide-target complex or the ratio of any other measurable quantity that reflects the ratio of binding affinity such as an enzyme-linked immunosorbent assay (ELISA) signal. K.sub.on describes the rate at which the target and the peptide (or the enzyme-peptide complex) combine to form a bound-target complex. In one aspect, the k.sub.off value for the bound-target complex will be less that about 10.sup.-2 sec.sup.-1, less that about 10.sup.-3 sec.sup.-1, less than about 10.sup.-4 sec.sup.-1 and also less than about 10.sup.-5 sec.sup.-1.

[0026] Selectivity is defined herein as enhanced binding of a peptide or protein to a target compared to the binding of the peptide or protein to a non-target. Selectivity may also be defined as the enhanced binding of a derivatized phenol oxidizing enzyme (a phenol oxidizing enzyme-binding peptide) to a target compared to the binding of a non-derivatized phenol oxidizing enzyme (a phenol oxidizing enzyme without the binding peptide) to the target. Selectivity may be in the range of about 1.25:1 to 25:1; about 1.5:1 to 15:1; about 1.5:1 to 10:1; and about 1.5:1 to 5:1. Preferably the selectively is at least 4:1, 3:1 or 2:1 for either a) the binding of a peptide to a target compared to the binding of the peptide to a non-target or b) the binding of a derivatized phenol oxidizing enzyme to a target compared to the binding of the nonderivatized phenol oxidizing enzyme to the target.

[0027] As used herein a phenol oxidizing enzyme refers to those enzymes which are capable of catalyzing redox reactions wherein the electron donor is usually a phenolic compound and which are specific for molecular oxygen or hydrogen peroxide as the electron acceptor. Examples of such enzymes are laccases (EC1.10.3.2), bilirubin oxidases (EC1.3.3.5), phenol oxidases (EC 1.14.18.1) and catechol oxidases (EC 1.10.3.1). Preferred phenol oxidizing enzymes are laccases. The phenol oxidizing enzymes useful according to the invention may be naturally occurring or recombinant enzymes.

[0028] A recombinant phenol oxidizing enzyme is one in which a nucleic acid sequence encoding the enzyme is modified to produce a variant nucleic acid sequence which encodes the substitution, deletion or insertion of one or more amino acids in the naturally occurring amino acid sequence. Phenol oxidizing enzyme variants may include the mature form of the enzyme variant, as well as the pro- and prepro-forms of such variants and post-translational modification such as glycosylation.

[0029] A "phenol oxidizing enzyme-peptide complex" means a phenol oxidizing enzyme combined with a binding peptide according to the invention, and is also referred to as a derivatized enzyme. A "laccase-peptide complex" means a laccase enzyme combined with a binding peptide according to the invention. The binding peptide may be combined with the phenol oxidizing enzyme by various means, for example; the binding peptide may be attached to the carbon (C)-terminus or the amino (N)-terminus of the enzyme. The binding peptide may replace an internal sequence of the enzyme or be inserted into an internal sequence of the enzyme or any combination thereof. Additionally, more than one copy of the same or different binding peptide may be combined with the phenol oxidizing enzyme of interest. A non-derivatized phenol oxidizing enzyme is one wherein a binding peptide has not been combined with the phenol oxidizing enzyme.

[0030] A preferred target of the binding peptides and phenol oxidizing enzyme-peptide complexes of the invention is a stain. A stain is defined herein as a colored compound which undergoes oxidation by phenol oxidizing enzymes. A coloured compound is a substance that adds colour to a textile or to substances which result in the visual appearances of stains. Targeted classes of coloured substances which may appear as a stain include the following;

[0031] a) porphyrin derived structures, such as heme in blood stain or chlorophyll in plants;

[0032] b) tannins and polyphenols (see P. Ribereau-Gayon, Plant Phenolics, Ed. Oliver & Boyd, Edinburgh, 1972, pp. 169-198) which occur in tea stains, wine stains, banana stains, and peach stains;

[0033] c) carotenoids and carotenoid derivatives, which are the red, orange and yellow pigments occurring in fruits and vegetables such as tomato, mango, carrots, paprika and leafy green vegetables. Commonly known carotenoids include alpha and beta carotene, lycopene, lutein, zeaxanthin, and cryptoxantin. These compounds include the oxygenated carotenoids, xanthophylls. Reference is made to G. E. Bartley et al., The Plant Cell (1995), Vol. 7, 1027-1038, Biochemical Nomenclature and Related Documents, 2nd Ed. Portland Press (1992), pages 226-238, and Pure Appl. Chem, (1974) 41:407-431). The carotenoids, carotenoid derivatives and oxygenated carotenoids are herein collectively referred to as carotenoids;

[0034] d) anthocyanins, the highly coloured molecules which occur in many fruits and flowers (P. Ribereau-Gayon, Plant Phenolics, Ed. Oliver & Boyd, Edinburgh, 1972, 135-169); and

[0035] e) Maillard reaction products, the yellow/brown coloured substances which appear upon heating of mixtures of carbohydrate molecules in the presence of protein/peptide structures, such as found in cooking oil.

[0036] A coloured compound may also be a dye that is incorporated into a fiber by chemical reaction, adsorption or dispersion. Examples include direct Blue dyes, acid Blue dyes, reactive Blue dyes, and reactive Black dyes.

[0037] Particularly preferred targets of the invention include carotenoid stains as defined above. A stain may occur on a fabric or other surface material. Nonlimiting examples of fabric include, cotton, wool, silk, polyester, rayon, linen, nylon and blends thereof. Nonlimiting examples of a surface material include, ceramic, glass, wood and paper.

[0038] The phrase "modify the colour associated with a coloured compound" means that the coloured compound is changed through oxidation, either directly or indirectly, such that the colour appears modified i.e. the colour visually appears to be increased, decreased, decoloured, bleached or removed, particularly bleached.

[0039] As used herein the term "enhancer" or "mediator" refers to any compound that is able to modify the colour associated with a coloured compound in association with a phenol oxidizing enzyme or a compound which increases the oxidative activity of the phenol oxidizing enzyme. The enhancing agent is typically an organic compound.

[0040] As used herein, Stachybotrys refers to any Stachybotrys species which produces a phenol oxidizing enzyme and particularly a laccase enzyme capable of modifying the colour associated with coloured compounds. The present invention encompasses derivatives of natural isolates of Stachybotrys including progeny, mutants or variants as long as the derivative is able to produce a phenol oxidizing enzyme, and particularly a laccase, capable of modifying the colour associated with coloured compounds.

[0041] As used in the specification and claims, the singular "a", "an" and "the" include the plural references unless the context clearly dictates otherwise. For example, the term a vector may include a plurality of vectors.

[0042] The following references describe the general techniques employed herein: Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY; and Ausubel et al. (1987) Current Protocols in Molecular Biology, Greene-Publishing & Wiley Interscience NY (Supplemented through 1999).

[0043] The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference in their entirety.

B. Binding Peptides

[0044] The binding peptides of the invention may be obtained using methods well known in the art. Preferably the binding peptides are identified by using random peptide libraries which are screened using techniques including phage display, biopanning and acid elution. These techniques are described in various references such as, Scott and Smith (1990) Science 249:386; Smith and Scott (1993) Methods Enzymol. 217:228; Cwirla et al., (1990) Proc. Natl. Acad. Sci. USA 87:6378; Parmley et al., (1988) Gene 73:305; Balass et al., (1996) Anal. Biochem., 243:264 and Huls et al., (1996) Nature Biotechnol., 7:276).

[0045] While a random peptide library is a preferred library used to identify binding peptides according to the invention, the binding peptides useful in the invention are not limited to identification using a random peptide library. Binding peptides of the invention may be identified from use of synthetic peptide libraries, peptide loop libraries, antibody libraries and protein libraries. Those skilled in the art are aware of commercially available libraries from sources such as New England BioLabs and Dyax Corporation.

[0046] Display methods that may be used to screen for binding peptides include phage display, yeast display and ribosome display. Once the peptide library is screened, the peptides that bind to a specific target may be identified by various means well-known in the art including, acid elution, polymerase chain reaction (PCR), sequencing, and other well-known methods.

[0047] Preferably the binding peptides of the invention are between 4 and 50 amino acids in length, also between 4-25 amino acids in length, between 4-20 amino acids in length and between 6-15 amino acids in length.

[0048] The binding peptides according to the invention include the peptides listed in FIG. 1A-E (SEQ ID NOS: 2-433). These peptides bind to carotenoid compounds and particularly to carotenoid stains on a textile obtained from tomato and paprika. In one embodiment, preferred binding peptides are listed in Table 1.

TABLE-US-00002 TABLE 1 SLLNATK SEQ ID NO: 4 YGYLPSR SEQ ID NO: 16 KASAPAL SEQ ID NO: 24 IERSAPATAPPP SEQ ID NO: 92 HVQILQLAAPAL SEQ ID NO: 94 YHTPSTGGASPV SEQ ID NO: 104 SSDVPQAARNDA SEQ ID NO: 105 QIWHPHNYPGSL SEQ ID NO: 120 TTAPPTT SEQ ID NO: 198 STPGSLQ SEQ ID NO: 233 PSMLNAT SEQ ID NO: 247 RLSDPMH SEQ ID NO: 256 QTTNSNMAPALS SEQ ID NO: 279 LPAQYQTIPGSL SEQ ID NO: 293 AARNDQVSHMHM SEQ ID NO: 300 DLFSAHHTGGAL SEQ ID NO: 304 YLPSTFAPPLPL SEQ ID NO: 317

[0049] Particularly preferred binding peptides are SEQ ID NOS: 4, 16, 24, 92, 256 and 317.

[0050] In a further embodiment, the binding peptides according to the invention may include cysteine residues on each end of the peptide. These binding peptides are more specifically referred to herein as binding peptide C-C derivatives. For example, the binding peptide PSMLNAT may also exist in the form CPSMLNATC and is considered a binding peptide according to the invention. When a binding peptide according to the invention is used as an internal replacement or insert for internal loops or turns in the phenol oxidizing enzyme, the binding peptide may be used in the C-C derivative form or non C-C derivative form. While any of the peptides listed in FIGS. 1A-1E may include the C-C derivatized form, particularly preferred are the peptides listed in FIG. 1A and FIG. 1C.

[0051] Additionally, a linker molecule (also sometimes referred to as a spacer moiety in the prior art) may be added to either end of a binding peptide (L-P or P-L). The linker molecule may enhance the binding of the peptide to its target. A linker molecule may be for example, a short peptide, such as the amino acid triad GGH or GGHGG, a carbon chain, such as (CH.sub.2).sub.n wherein n equals 1 to 10, a polymer, such as PEG (CH.sub.2--O).sub.n wherein n equals 2-20, a sugar, a lipid or the like. In one embodiment the linker is GGH or GGHGG. In another embodiment the linker is attached to Ni-GGH or Ni-GGHGG.

[0052] The linker molecule may be attached to the binding peptide alone or the linker molecule may be part of the enzyme-peptide complex. For example when the linker is placed between the binding peptide and the enzyme (E-L-P) or when the linker is attached to the peptide at the non-enzyme complexed end (E-P-L).

[0053] Non-limiting specific examples of the linker attached to the binding peptide alone include:

TABLE-US-00003 a) Ni-GGH-[SLLNATK, (SEQ ID NO: 4)]; b) Ni-GGH-[YGYLPSR, (SEQ ID NO: 16)]; c) Ni-GGH-[KASAPAL, (SEQ ID NO: 24)]; d) Ni-GGHGG-[RLSDPMH, (SEQ ID NO: 256)]; e) Ni-GGHGG-[YGYLPRS, (SEQ ID NO: 16)]; and the like.

[0054] Non-limiting specific examples of the linker attached to the enzyme-binding peptide complex wherein the linker is attached to the C-terminus of the enzyme include:

TABLE-US-00004 a) SEQ ID NO: 1-Ni-GGH-[SLLNATK, (SEQ ID NO: 4)]; b) the 254 variant SEQ ID NO: 1-Ni-GGH-[KASAPAL, (SEQ ID NO: 24)]; c) the 254/346/348 variant of SEQ ID NO: 1-Ni- GGHGG-[SLLNATK, (SEQ ID NO: 4)]; d) the 254/346/348 variant of SEQ ID NO: 1-Ni- GGHGG-[IERSAPATAPPP, (SEQ ID NO: 92)]and the like.

[0055] The linker molecules may be attached to any of the binding peptides represented as SEQ ID NOS: 2-433.

[0056] The invention further includes binding peptides having at least 60% but less than 100% amino acid sequence identity to the binding peptides listed in FIG. 1. For example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99% amino acid sequence identity. A peptide having at least 60% sequence identity to a binding peptide listed in FIG. 1 will also have a binding affinity for the same target in the range of 10.sup.-2M to 10.sup.-15M, generally at least about 10.sup.-2M, at least about 10.sup.-3M, at least about 10.sup.-4M and at least about 10.sup.-5M.

[0057] Repeatable motifs (also referred to herein as consensus sequences) have been observed in a number of the binding peptides listed in FIG. 1. Repeatable motifs include at least three amino acid residues and may include four, five or six amino acid residues in common with the binding peptide listed in FIG. 1.

[0058] Repeatable motifs of the binding peptides include the following amino acid residues as listed in Table 2. Also included in Table 2 are sequence identifiers for representative binding peptides of FIG. 1 which include said repeatable motif.

TABLE-US-00005 TABLE 2 Binding Binding CONSENSUS Peptide CONSENSUS Peptide SEQUENCE SEQ ID NO: SEQUENCE SEQ ID NO: AARND 105, 300 PPWM 208, 249 APAL 24, 94, 279 SAPA 24, 92 AARN 105, 300 LNAT 4, 247 ARND 105, 300 LSPG 103, 240 SPL 132, 289, 326, PPPP 127, 153, 156, 372, 375, 425 179, 186 LTQ 179, 289, 327, PAR 141, 290, 374, 425 391 NTSI 14, 124 TAPP 92, 198 PTSP 95, 242 TGGA 104, 304 PSST 56, 227 NPNN 204, 223 SLLNA 4, 77 PGN(C) 48, 240 SSP 38, 190, 326, PLP 164, 310, 317, 375, 399, 419 332, 385 SPLTQ 289, 425 PLVP 112, 186, 332 TATHL 103, 142 PPPF 179, 197 NTS 14, 18, 41, PQSP 292, 412 124 SPT 49, 118, 245, PSAT 158, 232 410 LPAQ 163, 293, 365 PART 374, 391 PGSL 120, 233, 293 PPSSP 190, 419 PHSM 221, 315, 330 YTKP 145, 303, 427 PLTQ 289, 327 ALH(C) 234, 263 PPPL 136, 295, 369 ALSA 310, 380 YLPS 16, 317 (C)APS 20, 72, 211, 259 PSTH 127, 333 (C)ISD 12, 44 PTPL 112, 353, 417 (C)KAS 24, 66 PTTT 93, 422 (C)KLN 27, 207 QLQL 108, 143 (C)KPT 22, 217 RLAQ 110, 334 (C)LQS 30, 193, 275 (C)TTT 93, 215, 246, (C)SLH 2, 32, 98, 254, 328 196, 301, 314 SIMN 297, 344 (C)SSK 15, 31, 100, 150 SNLA 237, 428 SAQN 119, 152 SPTT 118, 410 HSML 42, 315 SPV(C) 3, 292 IPST 108, 333 SSPV 294, 433 KAPS 176, 211 TFAP 161, 317 LNAN 27, 174 TFPL 185, 281 LPLK 231, 375 LPQR 49, 100 TIPG 293, 328 LSSS 286,392 TPV(C) 163, 214, 294 LVPL 185, 291 TSHT 316 NLAT 242, 339 TSLL 77, 246 NPTS 57, 94 TSLM 232, 357 VASA 310, 329 TSPP 242, 326 NFSN 176, 372 ESFS 372, 391 AITA 133, 141 DVST 393, 402 PPSL 148, 182 IPLP 332, 385 NFSN 176,372 PSLP 149, 399 NPKT 235, 382 SFTK 75, 259 PPRA 341, 359 SGLA 320, 331 SSPH 37, 398, 418 SSPL 326, 375 THPL 38, 358 TQPP 179, 347 TPSS 338, 429 SPPW 326, 329 PRLT 364, 431 SRSP 166, 177 KHPP 340, 418 MHTT 169, 227 STVL 392, 428 TTTT 246, 422 GLAS 50, 330 SNLSP 123, 395

[0059] Preferred repeatable motifs include SAPA, TAPP, APAL, PPP, PPPP, SSPH, SSP, SSK, SPT, LPAQ, PPPL, PTPL, SPTT, PLVP, PLP, YTKP, SLH, SLLNA, SPL, SNLA, SPLTQ, TTT, AARND, AARN, ARND, LSPG, NPNN, NLAT, NTS, PHSM, PPWM, PTSP, TGGA, YLPS, YTKP, PGSL, APS, TPV, TTTS and LNAT. In one embodiment preferred repeatable motifs include SAPA, TAPP, APAL, PPPP, SSPH, LPAQ, PPPL, PTPL, SPTT, PLVP, YTKP, SNLA, AARN, ARND, LSPG, NPNN, NLAT, PHSM, PPWM, PTSP, TGGA, YLPS, YTKP, PGSL, TTTS and LNAT. In another embodiment preferred repeatable motifs are SAPA, TAPP, APAL, PHSM, YLPS, AARND, ARND, SLLNA, PPPP, SNLA and NLAT.

[0060] The repeatable motif may also include a cysteine residue at the beginning and/or end of the motif, for example SPV (SPVC); TPV (TPVC); SLH (CSLH); LOS (CLQS) and KAS (CKAS). Particularly preferred are (C)SLH, (C)TTT, (C)SSK, (C)LQS, and TPV(C).

[0061] In general, the repeatable motifs may occur alone in a binding peptide, as multiple motifs in the same binding peptide, in sequential order, or overlapping one another. For example the binding peptide HVQILQLAAPAL (SEQ ID NO: 94) includes the repeatable motif APAL. The binding peptide YGYLPSR (SEQ ID NO: 16) includes the repeatable motif YLPS. The binding peptides SLLNATK (SEQ ID NO: 3) and PSMLNAT (SEQ ID NO: 247) include the repeatable motif LNAT. The binding peptide TTAPPTT (SEQ ID NO: 198) includes the repeatable motif TAPP. The binding peptides INTPHSM (SEQ ID NO: 221), SPHSMLQNPSGP (SEQ ID NO: 315) and VASANPHSMTSW (SEQ ID NO: 330) include the repeatable motif PHSM. The binding peptides VASANPHSMTSW (SEQ ID NO: 330), ESFSVTWLPART (SEQ ID NO: 391), and LPAQYQTIPGSL (SEQ ID NO: 297) include multiple motifs, two repeatable motifs, in the same sequence. The binding peptide IERSAPATAPPP (SEQ ID NO: 92) includes two repeatable motifs (SAPA and TAPP) in sequential order. The binding peptide KASAPAL (SEQ ID NO: 24) includes two overlapping repeatable motifs (SAPA and APAL).

[0062] Peptides other than the peptides illustrated in FIG. 1, which have a repeatable motif as illustrated in Table 2, are referred to herein as homologous motif binding peptides. Homologous motif binding peptides will include 6-25 amino acid residues and preferably will include 6-15 amino acid residues. Further the homologous motif binding peptides will bind to a target with a binding affinity similar or greater to the binding affinity of the binding peptides of FIG. 1 having the same repeatable motif. Preferably the target will be a stain, preferably a carotenoid stain and the binding affinity will be at least about 10.sup.-2M, about 10.sup.-3M, about 10.sup.-4M, about 10.sup.-6M and generally between about 10.sup.-2M and 10.sup.-9M. A homologous motif binding peptide will include not only a repeatable motif as defined herein, but will have between 20% and 95% amino acid sequence identity with a sequence illustrated in FIG. 1 having the same repeatable motif, that is at least 25% sequence identity, at least 30% sequence identity, at least 40% sequence, at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity or at least 95% sequence identity to a binding peptide illustrated in FIG. 1 which includes the same repeatable motif. Preferably if the homologous motif binding peptide is a 7 amino acid residue peptide, the homologous motif binding peptide will have at least 30% sequence identity with a binding peptide illustrated in FIG. 1 having the same repeatable motif when the peptides are aligned with no gaps. If the homologous motif binding peptide is a 12 amino acid residue peptide, the peptide will have at least 25% sequence identity with a binding peptide illustrated in FIGS. 1A-1E having the same repeatable motif when the peptides are aligned with no gaps.

[0063] In one embodiment, the binding peptides having identical repeatable motifs will bind to stains with structurally and/or biochemically related chromophores with about the same binding affinity. Preferably in one aspect, the homologous motif binding peptides including one or more repeatable motifs will bind to the carotenoids, such as lycopene and beta-carotene. In another aspect, the homologous motif binding peptides having one or more identical repeatable motifs will bind to the carotenoids such as the xanthophylls and particularly to casporubins and capsoxanthins.

[0064] Additionally binding peptides of the invention may include peptides having sequence clusters. A sequence cluster is defined herein as including a repeatable motif followed by 1 or 2 identical amino acid residues, wherein the repeatable motif and the identical amino acid residues are separated by 1 to 10, preferably 1 to 3 amino acids residues. Numerous examples of sequence clusters may be found in FIG. 1. Two such examples are SEQ ID NOS: 103 and 142 wherein the repeatable motif TATHL is separated from the amino acid residue P by one amino acid residue and SEQ ID NOS: 93 and 422 wherein the repeatable motif PTTT is separated from the amino acid residue T by three amino acid residues.

[0065] The binding peptides according to the invention may be made by various well known techniques in the art and include recombinant genetic engineering, chemical synthesis, PCR, and amplification.

C. Polynucleotides Encoding the Binding Peptides

[0066] The present invention encompasses polynucleotides which encode binding peptides according to the invention. Specifically polynucleotides include nucleic acid sequences encoding peptides illustrated in FIG. 1 (SEQ ID NOS: 2-433) and their C-C derivatives. Particularly preferred polynucleotides encode the binding peptides illustrated in Table 1 and their C-C derivatives. Additionally, polynucleotides which encode homologous motif binding peptides having identical repeatable motifs as those listed in Table 2 are part of the invention. As will be understood by the skilled artisan, due to the degeneracy of the genetic code, a variety of polynucleotides can encode a binding peptide of the invention such as those disclosed in FIG. 1, the C-C derivatives or a homologous motif binding peptide including a repeatable motif as illustrated in Table 2. The present invention encompasses all such polynucleotides.

[0067] A polynucleotide which encodes a binding peptide of the invention may be obtained by standard procedures known in the art, for example, by chemical synthesis, by PCR and by direct isolation and amplification.

D. Phenol Oxidizing Enzymes

[0068] In one embodiment the phenol oxidizing enzyme of the invention is a fungal phenol oxidizing enzyme. Phenol oxidizing enzymes are known to be produced by a wide variety of fungi and include but are not limited to species of the genii Aspergillus, Neurospora, Podospora, Botrytis, Pleurotus, Fomes, Coprinus, Phlebia, Trametes, Polyporus, Rhizoctonia, Bipolaris, Curvularia, Amerosporium, Lentinus, Myrothecium, Chaetomium, Humicola, Trichoderma, Myceliophthora, Scytalidium and Stachybotrys.

[0069] Preferred phenol oxidizing enzymes and particularly laccases are derived from Stachybotrys including S. chartarum, S. parvispora, S. kampalensis, S. theobromae, S. bisbyi, S. cylindrospora, S. dichroa, S. oenanthes and S. nilagerica; Myceliophthora including M. thermophilum; Coprinus including C. cinereus; Polyporus including P. pinsitus; Rhizoctonia including R. solani; Bipolaris including B. spicifera; Curvularia including C. pallescens; Amerosporium including A. atrum; and Scytalidium including S. thermophilum.

[0070] Many of the phenol oxidizing enzymes useful according to the invention may be obtained or produced from phenol oxidizing producing microorganisms in publicly available databases such as Belgian Coordinated Collections of Microorganisms, Mycothaque de l'Universita Catholiquede Louvain (MUCL). Illustrative is Stachybotrys strains (such as S. parvispora having accession number MUCL 38996, S. chartarum having accession number MUCL 38898, and S. chartarum having accession number MUCL 30782). These microorganisms may be grown under aerobic conditions in nutrient medium containing assimilable carbon and nitrogen together with other essential nutrients. The medium can be composed in accordance with principles well-known in the art.

[0071] During cultivation, the phenol oxidizing enzyme producing strains secrete the enzyme extracellularly. This permits the isolation and purification (recovery) of the enzyme to be achieved by, for example, separation of cell mass from a culture broth (e.g. by filtration or centrifugation). The resulting cell-free culture broth can be used as such or, if desired, may first be concentrated (e.g. ultrafiltration). If desired, the phenol oxidizing enzyme can then be separated from the cell-free broth and purified to the desired degree by conventional methods, e.g. by column chromatography.

[0072] The phenol oxidizing enzymes according to the present invention may be isolated and purified from the culture broth into which they are extracellularly secreted by concentration of the supernatant of the host culture, followed by hydrophobic interaction chromatography or anion exchange chromatography.

[0073] Numerous references are available on suitable phenol oxidizing enzymes which may be combined or derivatized with the binding peptides of the invention, and reference is made to WO 98/38286; WO 99/49020; WO 00/37654; WO 01/21809; and U.S. Pat. No. 6,168,936;

[0074] The phenol oxidizing enzyme comprising the enzyme-peptide complex may be a recombinant enzyme of a naturally occurring phenol oxidizing enzyme and methods for introducing mutations into phenol oxidizing enzymes encoding DNA sequences are known and reference is made to U.S. Pat. No. 4,760,025; U.S. Pat. No. 5,770,419; U.S. Pat. No. 5,985,818; U.S. Pat. No. 6,060,442; WO 98/27197 and WO 98/27198.

[0075] In an illustrative embodiment, a laccase enzyme which may be combined with a binding peptide to form a phenol oxidizing enzyme-peptide complex according to the invention is obtainable from any Stachybotrys species which produces a laccase capable of modifying the color associated with colored compounds. A preferred phenol oxidizing enzyme is Stachybotrys oxidase B having the amino acid sequence shown in SEQ ID NO: 1 and enzymatically active variants thereof. Typical variant enzymes in accordance with the invention will have at least 60% and less than 100% sequence identity to the amino acid sequence of SEQ ID NO: 1. That is at least 60% and less than 100%; at least 65% and less than 100%; at least 70% and less than 100%; at least 75% and less than 100%; at least 80% and less than 100%; at least 85% and less than 100%; at least 90% and less than 100%; at least 95% and less than 100%; and at least 97% and less than 100% sequence identity to the amino acid sequence disclosed in SEQ ID NO: 1.

[0076] The present invention encompasses laccase variants where the variant comprises a sequence that differs from that of SEQ ID NO: 1 in at least one of the following positions: 48, 67, 70, 76, 83, 98, 115, 119, 134, 171, 175, 177, 179, 188, 236, 246, 253, 254, 269, 272, 296, 302, 308, 318, 329, 331, 346, 348, 349, 365, 390, 391, 394, 404, 415, 423, 425, 428, 434, 465, 479, 481, 483, 499, 550, 562, 570, and 573 or sequence positions corresponding thereto. These amino acid position numbers refer to those assigned to the Stachybotrys oxidase B enzyme sequence presented in SEQ ID NO: 1.

[0077] Preferred variants include a sequence that differs from that of SEQ ID NO: 1 in at least one of the following positions 188, 254, 272, 346, 348, 394, and 425. One such variant includes an amino acid substitution in position 254 (the 254 variant) substituted with F, N, L, K, A, I, E, S, H, V, T, P, G or C, preferably F. In a further embodiment, the 254 variant is combined with at least one further substitution selected from the group consisting of positions 48, 67, 70, 76, 83, 98, 115, 119, 134, 171, 175, 177, 179, 188, 236, 246, 253, 269, 272, 296, 302, 308, 318, 329, 331, 346, 348, 349, 365, 390, 391, 394, 404, 415, 423, 425, 428, 434, 465, 479, 481, 483, 499, 550, 562, 570, and 573. Preferably the additional substituted positions are selected from 76, 188, 272, 302, 346, 348, 394 and 425. Further preferred variants include the following amino acid substitution sets: [0078] (a) 76/188/254/302, (76/188/254/302 variant); [0079] (b) 76/254/302, (76/254/302 variant); [0080] (c) 254/394, (254/394 variant); [0081] (d) 254/346/348, (254/346/348 variant) and specifically 254F/E346V/E348Q, (M254F/E346V/E348Q variant); [0082] (e) 188/254/346/348/394, (88/254/346/348/394 variant); and [0083] (f) 171/179/188/254/346/348/394, (171/179/1881254/346/348/394 variant).

[0084] Still other preferred variants of SEQ ID NO: 1 include the substitution of amino acid residues at positions 394/425, (394/425 variant) specifically D394N/V425M. The 394/425 variant may further include an amino acid substitution in at least one of the positions 76, 254 and 302.

[0085] Yet another preferred variant of SEQ ID NO: 1 includes an amino acid substitution in position 272, (272 variant), and additionally a substitution of amino acid position 272 combined with a substitution at position 254, specifically M254F/S272L.

[0086] Polynucleotides encoding a phenol oxidizing enzyme and specifically a laccase, may be obtained by standard procedures known in the art for example, by cloned DNA (e.g. a DNA "library"), by chemical synthesis, by cDNA cloning, by PCR or by the cloning of genomic DNA or fragments thereof, purified from a desired cell, such as a Stachybotrys species. Nucleic acid sequences derived from genomic DNA may contain regulatory regions in addition to coding regions. These methods are well known and reference is made to Sambrook et al., 1989, Molecular cloning, A Laboratory Manual, 2d Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Benton and Davies, 1977, Science 196: 180; Grunstein and Hogness 1975, Proc. Natl. Acad. Sci. USA 72:3961; and U.S. Pat. Nos. 4,683,202 and 6,168,936. In one embodiment, preferred polynucleotides encode the laccase as illustrated in SEQ ID NO: 1.

E. Making the Phenol Oxidizing Enzyme-Peptide Complex

[0087] The phenol oxidizing enzyme-peptide complex (also referred to as the derivatized phenol oxidizing enzyme) may be constructed by methods well known in the art including use of PCR. A binding peptide according to the invention may a) be inserted into a phenol oxidizing enzyme, b) replace an internal loop or turn, c) be attached to the carbon or nitrogen terminus of the enzyme or d) include a combination of the above. For example, a combination of formats can include a binding peptide combined with a phenol oxidizing enzyme at the C terminus end of the phenol oxidizing enzyme and a binding peptide inserted into an internal loop of the enzyme wherein the binding peptide is the same or different at each location. More specifically, as a non-limiting example, the binding peptide SEQ ID NO: 16 may be attached to the C-terminus of a laccase having SEQ ID NO: 1 and may also be inserted into an internal loop of the laccase enzyme. In a preferred embodiment the binding peptide is attached to the carbon terminus.

F. Expression Systems

[0088] The present invention provides host cells, expression methods and systems for the production of the phenol oxidizing enzyme-peptide complex in host microorganisms, such as fungus, yeast and bacteria.

[0089] Molecular biology techniques are disclosed in Sambrook et al., Molecular Biology Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). A polynucleotide encoding a phenol oxidizing enzyme-peptide complex is obtained and transformed into a host cell using appropriate vectors. A variety of vectors and transformation and expression cassettes suitable for the cloning, transformation and expression in fungus, yeast, plants and bacteria are known by those of skill in the art.

[0090] Typically, the vector or cassette contains sequences directing transcription and translation of the phenol oxidizing enzyme-peptide complex, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. These control regions may be derived from genes homologous or heterologous to the host as long as the control region selected is able to function in the host cell.

[0091] Initiation control regions or promoters, which are useful to drive expression of the phenol oxidizing enzymes in a host cell are known to those skilled in the art. Virtually any promoter capable of driving these phenol oxidizing enzymes is suitable for the present invention. Nucleic acid encoding the phenol oxidizing enzyme is linked operably through initiation codons to selected expression control regions for effective expression of the oxidative or reducing enzymes. Once suitable cassettes are constructed they are used to transform the host cell.

[0092] Suitable hosts include fungus, yeast, plants and bacteria. In one embodiment the host cell is a filamentous fungus including a Aspergillus species, a Trichoderma species and a Mucor species. In a further embodiment, the fungus includes Trichoderma reesei, Aspergillus niger and Aspergillus oryzae. In yet another embodiment, the host cell is a yeast which includes Saccharomyces, Pichia, Hansenula, Schizosaccharomyces, Kluyveromyces and Yarrowia species. In yet another embodiment the host cell is a gram positive bacteria such as a Bacillus species or a gram negative bacteria such as a Escherichia species

[0093] General transformation procedures are taught in Current Protocols In Molecular Biology (vol. 1, edited by Ausubel et al., John Wiley & Sons, Inc. 1987, Chapter 9) and include calcium phosphate methods, transformation using PEG and electroporation. For Aspergillus and Trichoderma, PEG and Calcium mediated protoplast transformation can be used (Finkelstein, D B 1992 Transformation. In Biotechnology of Filamentous Fungi. Technology and Products (eds. by Finkelstein & Bill) 113-156. Electroporation of protoplast is disclosed in Finkelestein, D B 1992 Transformation. In Biotechnology of Filamentous Fungi. Technology and Products (eds. by Finkelstein & Bill) 113-156. Microprojection bombardment on conidia is described in Fungaro et al. (1995) Transformation of Aspergillus nidulans by microprojection bombardment on intact conidia. FEMS Microbiology Letters 125 293-298. Agrobacterium mediated transformation is disclosed in Groot et al. (1998) Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nature Biotechnology 16 839-842. For transformation of Saccharomyces, lithium acetate mediated transformation and PEG and calcium mediated protoplast transformation as well as electroporation techniques are known by those of skill in the art.

[0094] As discussed above for the production of phenol oxidizing enzymes, the phenol oxidizing enzyme-peptide complex may be produced by cultivation of a host cell which includes a polynucleotide encoding the phenol oxidizing-peptide complex under aerobic conditions in nutrient media containing assimilable carbon and nitrogen together with other essential nutrient. These conditions are well known in the art.

[0095] Host cells that contain the coding sequence for a phenol oxidizing enzyme-peptide complex of the present invention and express the phenol oxidizing enzyme may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridization and protein bioassay or immunoassay techniques which include membrane-based, solution-based, or chip-based technologies for the detection and/or quantification of the nucleic acid or protein.

[0096] Once a phenol oxidizing enzyme-peptide complex is encoded the derivatized enzyme may be isolated and purified from the host cell by well-known techniques such as, cell separation and concentration of the cell free broth by ultrafiltration, ammonium sulfate fractionation, purification by gel filtration, ion exchange or hydrophobic interaction chromatography, PEG extraction and crystallization.

[0097] One example of purification includes small-scale purification (e.g., less than 1 g) of derivatized enzyme using hydrophobic interaction chromatography. Samples may be filtered and loaded onto a column containing 20HP2 resin (Perceptives Biosystems), hooked up to a BioCad workstation (Perceptives Biosystems). The column may be washed with ammonium sulfate in buffer. Elution of the derivatized phenol oxidizing enzyme activity can be performed using a salt gradient ranging from 35% to 0% of a 3M ammonium sulfate solution in 30 mM Mes Bis Tris Propane buffer at pH 5.4. The fractions enriched in the derivatized phenol oxidizing enzyme activity can be monitored using UV absorbance at 280 nm and a qualitative ABTS activity assay. The samples can be pooled, concentrated and diafiltered against water. Derivatized samples purified according to this method are estimated to be at least about 70% pure.

F. Applications

1. Enzyme and Detergent Compositions

[0098] A phenol oxidizing enzyme-peptide complex of the present invention may be used to produce, for example, enzymatic compositions for use in detergent or cleaning compositions; such as for removing food stains on fabrics; and in textiles, that is in the treatment, processing, finishing, polishing, or production of fibers.

[0099] Enzymatic compositions may also comprise additional components, such as for example, for formulation or as performance enhancers. For example, detergent compositions may comprise, in addition to the phenol oxidizing enzyme-peptide complex, conventional detergent ingredients such as surfactants, builders and further enzymes such as, for example, proteases, amylases, lipases, cutinases, cellulases or peroxidases (U.S. Pat. No. 4,689,297). Other ingredients include enhancers, stabilizing agents, bactericides, optical brighteners and perfumes. The enzymatic compositions may take any suitable physical form, such as a powder, an aqueous or non-aqueous liquid, a paste or a gel. Reference is made to U.S. Pat. No. 3,929,678; U.S. Pat. No. 4,760,025; U.S. Pat. No. 5,011,681; WO 96/06930; WO 95/01426 and McCutheon's Detergents and Emulsifiers, North American Ed. (1986) Allured Publishing Co.

[0100] A phenol oxidizing enzyme-peptide complex of the present invention can act to modify the color associated with dyes or colored compounds in the presence or absence of enhancers depending upon the characteristics of the compound. If a compound is able to act as a direct substrate for the phenol oxidizing enzyme, the phenol oxidizing enzyme will modify the color associated with a dye or colored compound in the absence of an enhancer, although an enhancer may still be preferred for optimum phenol oxidizing enzyme activity. For other colored compounds unable to act as a direct substrate for the phenol oxidizing enzyme or not directly accessible to the phenol oxidizing enzyme, an enhancer may be required for optimum phenol oxidizing enzyme activity and modification of the color.

[0101] Enhancers are described in for example WO 95/01426, WO 96/06930, and WO 97/11217. Enhancers include but are not limited to phenothiazine-10-propionic acid (PTP), 10-methylphenothiazine (MPT), phenoxazine-10-propionic acid (PPO), 10-methylphenoxazine (MPO), 10-ethylphenothiazine-4-carboxylic acid (EPC) acetosyringone, syringaldehyde, methylsyringate, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate (ABTS), 2,6 dimethoxyphenol (2,6-DMP), and guaiacol (2-methoxyphenol).

[0102] Phenol oxidizing enzymes and their use in enzyme and detergent compositions is well known. However, a main advantage of the phenol oxidizing enzyme-peptide complex according to the invention is the binding of the complex to a target stain comprising a carotenoid compound.

2. Other Applications

[0103] The phenol oxidizing enzyme-peptide complexes may also be useful in applications other than enzyme and detergent compositions for stain removal. In one preferred embodiment the peptides according to the invention bind preferentially to carotenoid compounds. Therefore, other applications may include personal care applications, for example in skin cosmetics as skin tanners, food industry applications, for example as fruit ripening agents or in diagnostic uses, such as in pharmaceutical applications, for example to localize the presence of carotenoids in tissue.

[0104] Having thus described the binding peptides and the phenol oxidizing enzyme-peptide complexes of the present invention, the following examples are now presented for the purposes of illustration and are neither meant to be, nor should they be, read as being restrictive. Dilutions, quantities, etc. which are expressed herein in terms of percentages are, unless otherwise specified, percentages given in terms of percent weight per volume (w/v). As used herein, dilutions, quantities, etc., which are expressed in terms of % (v/v), refer to percentage in terms of volume per volume. Temperatures referred to herein are given in degrees centigrade (C).

EXPERIMENTAL

Example 1

Selection of the Binding Peptides on Stained Cotton

[0105] While a number of selection techniques may be used to screen for binding peptides, the majority of the binding peptides according to the invention were selected according to the method described herein below.

[0106] 10 microliters of a commercially (New England Biolabs) available phage display library either a cyclic 7-mer (at 2.10E13 pfu/ml) or a linear 12-mer (at 4.10E12 pfu/ml) were pre-incubated with a cotton swatch in a pre-blocked and washed 96 well plate in the presence of a 150 .mu.l TBS solution (at 2.10E-5 g/l for the cyclic 7-mer, 2.10E-3 g/l for the linear 12-mer) of detergent, pH 10 for 20 minutes using gentle shaking. The solution was pipetted off and added to a second cotton swatch for 20 minutes under gentle shaking. This process was repeated a third time. The solution was pipetted off and added to a tomato (Textile Innovators, NC) or paprika (Test Fabrics, PA) stained swatch for 60 minutes under gentle agitation. The solution was drawn off and discarded. The stained swatch was washed 5.times. for 5 minutes each with 200 .mu.l of TBST (TBS containing 0.1% Tween 20). The swatch was transferred to an empty well using sterile tips, washed as described above, and transferred to another empty well. 15 .mu.l of a glycine 0.2M solution pH 2.2 was added to the stained swatch and the plate was shaken for less than 10 minutes. This solution was neutralized by the addition of 100 .mu.l of a Tris HCL 1M solution, pH 9.1 for 10 minutes. The solution, which constitutes the acid eluted peptide population was pipetted off and stored at 4.degree. C. until further use.

[0107] 4.times.20 .mu.l of the acid eluted phage peptide population was used to infect 4.times.400 .mu.l E. coli (New England BioLabs) grown to an OD at 610 nm of 0.3 to 0.65 from a 100.times. dilution in LB of an overnight culture. The cells were plated on 4.times.140 mm LB plates in the presence of IPTG (Sigma) (40 .mu.l at 20 mg/ml per plate) and Xgal (Sigma) (40 .mu.l at 40 mg/ml of DMF per plate) added to 5 mls of melted top agarose, and left to incubate overnight at 37.degree. C. The 4 plates were scraped with a sterile glass microscope slide and the scrapings were pushed through an 18.5 gage needle of a 60 ml syringe into a sterile conical tube; 50 ml of TBS was added to the tube and the capped tube was left to shake on a rocker at room temperature for at least 14 hrs. The contents of the tube were centrifuged at 10,000 rpm for 30 minutes in sterile Oakridge tubes at 4.degree. C. The supernatant was collected and the phage precipitated by adding 1/6 volume of a 20% polyethylene glycol (PEG)/2.5 M NaCl solution. This was left to incubate at 4.degree. C. for at least 4 hours and preferably overnight. The solution was then spun at 10,000 rpm for 30 minutes at 4.degree. C. and the supernatant discarded. The pellet was resuspended in 1 ml of TBS and transferred to a sterile Eppendorff tube. The phage was reprecipitated with 1/6 volume of a 20% PEG/2.5 M NaCl solution with incubation on ice for at least 1 hour. This was followed by another centrifugation at 10,000 rpm for 10 min at 4.degree. C. The supernatant was discarded, the tube re-spun briefly, and residual supernatant removed. The pellet was resuspended in 200 .mu.l TBS/0.02% NaN.sub.3, spun to remove insoluble material and transferred.

[0108] The amplified phage peptide populations from the first round of deselection on cotton/selection of stained cotton swatches were submitted to another round of deselection and selection as described above. For the cyclic 7-mer peptide library 2.10E-4 g/l TBS was used, and for the linear 12-mer peptide library 2.10E-2 g/l TBS was used. After acid elution and amplification of the phage, a third round of biopanning was performed. The third round used 2.10E-3 g/l TBS of detergent for the cyclic 7-mer phage peptides and 2.10E-1 g/l TBS for the linear 12-mer phage peptides. After acid elution and amplification a fourth round of biopanning was used and 2 g/l of detergent dissolved in water in one experiment and TBS in another were used for both types of phage peptides. The phage peptides were acid eluted and amplified from the fourth round of biopanning and selected in a fifth round of biopanning wherein the Tween 20 concentration was increased from 0.1% to 0.8% in the wash conditions. Additionally a round of selection on tomato and paprika was performed using the phage peptides from the third round as described above. In this fourth round 2 g/l of detergent in water in the wash conditions was used. One skilled in the art is well aware that various parameters as described hereinabove may be varied without affecting the nature of the invention. The above described method is one method which may be used to screen for binding peptides of the invention.

Example 2

Identification and Sequencing of the Phage Peptide Population

[0109] 225 .mu.l of a 1/100 dilution of an overnight culture of E. coli cells in LB broth were incubated with phage plaques using sterile toothpicks in a sterile 96-well V-bottom plate. A replica plate was made for glycerol stocks of the phage peptides. The plates were covered with porous Qiagen plate sealers and shaken for 4 hours at 37.degree. C. at 280 rpm in a humidified shaker box and then spun at 4000 rpm for 30 min at 4.degree. C. 160 .mu.l of the phage peptides supernatant was transferred to another 96-well V-bottom plate containing 64 .mu.l of 20% PEG/2.5 M NaCl. The plates were left to shake for 5 minutes and then left to stand for 10 minutes. The glycerol stock plate was prepared by adding 100 .mu.l phage supernatant to 150 .mu.l 75% glycerol solution in a sterile 96 well plate which was then sealed with parafilm, labeled, and stored at -70.degree. C. until further use.

[0110] The PEG precipitated phage plate was centrifuged at 4000 rpm for 20 minutes at 4.degree. C. The plate was inverted rapidly to remove excess PEG/NaCl and left upside down on a clean paper towel to drain residual fluid. 60 .mu.l of iodide salt solution (10 mM Tris.HCl, pH 8.0, 1 mM EDTA, 4 M NaI) were added to each well and the phage pellets thoroughly resuspended by shaking the plate vigorously for 5 minutes. 150 .mu.l of 100% EtOH were added and the plate was spun at 4000 rpm for 20 minutes at 4.degree. C., the supernatants discarded and the plate blotted. The pellets were washed with 225 .mu.l of 70% EtOH without disturbing the pellets; the plate was inverted and left to air-dry for at least 30 minutes. The pellets were resuspended in 30 .mu.l of Tris.HCl 10 mM, pH 8.5 buffer by shaking the plate for 30 minutes at full speed. 1 .mu.l of g96 reverse primer (obtained from New England BioLabs, 3.4 pmole per tube) was added to 11 .mu.l of DNA pellet sample and the contents submitted for sequencing on a ABI Applied Biosystem 373XL.

[0111] FIGS. 1A-1E (SEQ ID NOS: 2-433) illustrate the amino acid sequence of numerous binding peptides determined according to the method herein described. Various repeatable motifs were found in these peptides by visual and computer analyzed methods and repeatable motifs of 3 to 5 amino acid residues are reported in Table 2 along with some representative sequence identifiers for binding peptides illustrated in FIGS. 1A-1E which include the repeatable motif.

Example 3

Sites for Attachment and Substitution of Binding Peptides

[0112] A. Insertion into the C-Terminus of Stachybotrys Oxidase B:

Primer Design--

Reverse Primer:

TABLE-US-00006 [0113] (SEQ ID NO: 434) 3' ACTACGGCGACTCCTCNNNNNNNNNNNNNNNNNNNNNATTAGATCTG GGG 5'

wherein the 16 bp overlap with the polynucleotide sequence encoding SEQ ID NO: 1 is underlined, the section of N's symbolizes the polynucleotide encoding a binding peptide of the invention; the ATT stop codon is in bold letters, and the Xba I restriction site is doubled underlined. In a specific example the polynucleotide TTCCGGAGTCGAGGACGAAAC (SEQ ID NO: 435) encoding binding peptide KASAPAL (SEQ ID NO: 24) was added to the C-terminus. Forward Primer HM 358 was used for all PCR reactions.

TABLE-US-00007 5' AAGGATCCATCAACATGATCAGCCAAG 3' (SEQ ID NO: 436)

[0114] Various 7-mer, 7-mer with cysteines and 12-mer binding peptides illustrated in FIGS. 1A-1E were inserted into the C-terminus of Stachybotrys phenol oxidase B (FIG. 2), and reference is made to FIGS. 3 and 4. Primers were designed as described above. The insertion location was just past E583 at the C-terminus of Stachybotrys phenol oxidase B. (Also see FIG. 1 of WO 01/21809). PCR was used for insertion of sequences. 3'-5' peptide primers were designed specifically for the reaction. Ten microliters of diluted DNA were added to a mixture which contained 0.2 mM of each nucleotide (A, G, C and T), 1.times. reaction buffer, 1.7 microgram of peptide insertion reverse primer and the common forward primer in a 100 .mu.l reaction in an eppendorf tube. After a 5 minute incubation at 100.degree. C., 2.5 units of Taq DNA polymerase was added to the reaction mix. The PCR reaction was begun at 95.degree. C. for 1 minute, followed by primer annealing to the template at 50.degree. C. for 1 minute and extension was done at 72.degree. C. for 1 minute. The cycle was repeated 30 times with an additional cycle extension at 68.degree. C. for 7 minutes, The final PCR product size was 975 bp. Stachybotrys phenol oxidase B (SEQ ID NO: 1) and specific variants thereof M254F and M254F/E346V/E348Q were used as the template for PCR. The fragment was purified with the Qiagen PCR Purification kit. After purification, the fragment was digested with the restriction enzymes BsrG I and Xba I in a joint digestion. The Xba I site was introduced in the PCR reaction. The BsrG I site was located 75 bp downstream from the beginning of the PCR product at 1312. Also digested was the nonderivatized Stachybotrys B phenol oxidase/pGAPT (without a binding peptide insertion or substitution) in the pGAPT expression vector. Stachybotrys B phenol oxidase/pGAPT was also digested with BsrG I and XbaI in order to facilitate cloning of the PCR product into Stachybotrys B phenol oxidase. The digested PCR product was ethanol precipitated to clean and purify the fragment and the digested Stachybotrys B phenol oxidase/pGAPT sample was run on a gel to separate the two fragments produced by the reaction (BsrG I and Xba I are both single cutters in Stachybotrys B phenol oxidase/pGAPT). The larger of the fragments was 5.8 kb while the smaller of the fragments was 945 bp long. The 5.8 kb fragment was excised from the gel and purified using the Bio 101 Geneclean III kit. The purified PCR fragment and 5.8 kb Stachybotrys B phenol oxidase/pGAPT fragment were then ligated together. The ligated DNA was then transformed into Invitrogen Top10 E. coli. Individual colonies from the transformation plate were picked and cultured in LB+50 ppm carb. overnight. The plasmid DNA was then isolated and purified using the Qiagen Miniprep kit. The isolated DNA was sequenced to check if peptide sequences were inserted, in the correct location and were the correct sequence. Sequencing was also done earlier in the process after PCR to check insertion of peptide sequences. After PCR was run, the products were ligated into the Invitrogen pCR2.1 cloning vector and sequenced. Samples were then transformed into Aspergillus niger.

[0115] In addition to KASAPAL (SEQ ID NO: 24), the above procedure was repeated with 98 of the peptides listed in FIGS. 1A-1E. The specific peptides and corresponding sequence identifiers are listed in Table 3 below. Some of the binding were attached using the C-C derivative form. Corresponding 3'-5' primers for the peptides were mixed together and PCR was run with that primer mixture and the 5'-3' primer.

TABLE-US-00008 TABLE 3 SLLNATK (SEQ ID NO: 4) YGYLPSR (SEQ ID NO: 16) IERSAPATAPPP (SEQ ID NO: 92) VSSPHIY (SEQ ID NO: 38) MTHPLVH (SEQ ID NO: 39) HTFLQTH (SEQ ID NO: 40) NTSYQYR (SEQ ID NO: 41) GHSMLTN (SEQ ID NO: 42) MTPAKPS (SEQ ID NO: 43) ISDYPNP (SEQ ID NO: 44) DIQRMML (SEQ ID NO: 45) FVLPPVS (SEQ ID NO: 46) TMGTLLA (SEQ ID NO: 47) HIRAPGN (SEQ ID NO: 48) HTSPTSH (SEQ ID NO: 49) SSDLPPY (SEQ ID NO: 50) WGLASQL (SEQ ID NO: 51) PNSHPHW (SEQ ID NO: 52) PTRATPS (SEQ ID NO: 53) PHPTNLA (SEQ ID NO: 54) QISQSQI (SEQ ID NO: 55) PSSTWHP (SEQ ID NO: 56) ITWDHIN (SEQ ID NO: 57) SPNPTST (SEQ ID NO: 58) QTSALSR (SEQ ID NO: 59) ERRPSKA (SEQ ID NO: 60) SMFSKAA (SEQ ID NO: 61) GHRPHAIKPPPP (SEQ ID NO: 130 SDYSSAATYYGH (SEQ ID NO: 131 SSTSPLLPHMLL (SEQ ID NO: 132 TSEHTLASKYQS (SEQ ID NO: 133 SHGIATSETTSN (SEQ ID NO: 134 MNPSSSQHKNSH (SEQ ID NO: 135 PWASITPPPLLR (SEQ ID NO: 136) QNLQPPQGFTLG (SEQ ID NO: 137) TTSFSEGILIRS (SEQ ID NO: 138) NVPTSNTHFGLH (SEQ ID NO: 139) TGSMRLWTLQTQ (SEQ ID NO: 140) SPARSTVGPYEL (SEQ ID NO: 141) SHAITATHLEPS (SEQ ID NO: 142) LQLQLLPYAFPV (SEQ ID NO: 143) NNLAFTPSGTLR (SEQ ID NO: 144) HFAYTKPMRIPQ (SEQ ID NO: 145) SSWLHDLPVLPL (SEQ ID NO: 146) SVTYQNYGMNTM (SEQ ID NO: 147) YAHAGKTTFLLG (SEQ ID NO: 148) HPPSLPNNVVHP (SEQ ID NO: 149) HLSRFESLMHLM (SEQ ID NO: 150) WLHLPGSAQNHL (SEQ ID NO: 151) RNRPHIIRPPPP (SEQ ID NO: 152) HVQILQLAAPAL (SEQ ID NO: 94) YHTPSTGGASPV (SEQ ID NO: 104) SSDVPQAARNDA (SEQ ID NO: 105) EATFHKD (SEQ ID NO: 255) RLSDPMH (SEQ ID NO: 256) TDFFGRV (SEQ ID NO: 257) GQNPMKS (SEQ ID NO: 258) TAPSFTK (SEQ ID NO: 259) FDSKNTP (SEQ ID NO: 260) QQLNTPR (SEQ ID NO: 261) HIPSALL (SEQ ID NO: 262) ELTPALH (SEQ ID NO: 263) TPPTKKQ (SEQ ID NO: 264) SGIPRNS (SEQ ID NO: 265) VQPVTRY (SEQ ID NO: 266) KGMHTTD (SEQ ID NO: 267) PMWGTHL (SEQ ID NO: 268) NAAKLEQ (SEQ ID NO: 269) PQEALQL (SEQ ID NO: 270) SRDMHPH (SEQ ID NO: 271) GPETPYQ (SEQ ID NO: 272) SLVQSLE (SEQ ID NO: 273) NLTPMAR (SEQ ID NO: 274) LQSPPLK (SEQ ID NO: 275) QKHAFRS (SEQ ID NO: 276) PWQIKLT (SEQ ID NO: 277) QIWHPHNYPGSL (SEQ ID NO: 120) SSPLQTSPPWPY (SEQ ID NO: 326) KAIGMSTGPLTQ (SEQ ID NO: 327) LHVTTTIPGGLR (SEQ ID NO: 328) SVPSPSPPWSRP (SEQ ID NO: 329) VASANPHSMTSW (SEQ ID NO: 330) QDATSRFSGLAS (SEQ ID NO: 331) AEAITAIPLPVP (SEQ ID NO: 332) MDPFATIPSTHP (SEQ ID NO: 333) EGNARLAQSLIQ (SEQ ID NO: 334) MHSPFCSSPCSP (SEQ ID NO: 335) SGMPPTITWTRP (SEQ ID NO: 336) WEATPNFMSKII (SEQ ID NO: 337) AVSLVPPNLATH (SEQ ID NO: 338) VPNMTPSSYLSA (SEQ ID NO: 339) LQPQTWSWARGA (SEQ ID NO: 340) TEPTVKHPPLRI (SEQ ID NO: 341) VALPNQPPRAGL (SEQ ID NO: 342) GLGYWVMPAPTS (SEQ ID NO: 343) HNLYMTPPSIMN (SEQ ID NO: 344) HAEKILSSPGPA (SEQ ID NO: 345) HNMLPPRCCLLP (SEQ ID NO: 346)

B. Insertion and Substitution into Stachybotrys Oxidase B and Variants Thereof:

TABLE-US-00009 (1) Primer Design (7-mer, Insertion) (SEQ ID NO: 447) 5' NNNNNNNNNNNNNNNNNNNNNCCTTTCCCCGAGGGCGG 3' (SEQ ID NO: 448) 3' GGTTGGAGGCTCTACAANNNNNNNNNNNNNNNNNNNNN 5'

wherein the overlap with the polynucleotide sequence encoding SEQ ID NO: 1 is underlined and the section of N's indicates the binding peptide coding region.

TABLE-US-00010 (2) Primer Design (7-mer, Substitution) (SEQ ID NO: 449) 5' GAGGGCGGCAACNNNNNNNNNNNNNNNNNNNNNGATGACGAGACTT TCACC 3' (SEQ ID NO: 450) 3' AAGGGGCTCCCGCCGTTGNNNNNNNNNNNNNNNNNNNNNCTACTGC TCTG 5'

wherein the overlap with the polynucleotide sequence encoding SEQ ID NO: 1 is underlined and the section of N's indicates the binding peptide coding region. In a specific example the primers for insertion of binding peptide sequence SSLNATK (SEQ ID NO: 4) are:

TABLE-US-00011 Forward Primer (SEQ ID NO: 451) 5' TCCCTTCTTAACGCTACTAAGACCTTCTCGGATGTCGAG 3' Reverse Primer (SEQ ID NO: 452) 3' CCTGTTAGTTGCCTCAAAGGGAAGAATTGCGATGATTC 5' In a specific example the primers for substitution of binding peptide sequence SSLNATK (SEQ ID NO: 4) are: Forward Primer (SEQ ID NO: 453) 5' GAGGGCGGCAACTCCCTTCTTAACGCTACTAAGGATGACGAGACTTT CACC 3' Reverse Primer (SEQ ID NO: 454) 3' AAGGGGCTCCCGCCGTTGAGGGAAGAATTGCGATGATTCCTACTGCT CTG 5'

[0116] Three sites within Stachybotrys B phenol oxidase (SEQ ID NO: 1) were chosen for 7-mer and 12-mer peptide insertion: site A located between V379 and P380; site B located between V412 and T413; and site C located between L422 and R423. The amino acid sequence W387, D388, P389, A390, N391, P392, and T393 was chosen for the site of 7-mer peptide substitution. All of the peptides were inserted into the Stachybotrys B phenol oxidase sequence using mutagenesis PCR. The PCR reaction allowed the peptide coding sequence to be inserted/substituted into the Stachybotrys B phenol oxidase/pGAPT plasmid without the need for cloning procedures such as restriction digest and ligation. After PCR was run, the plasmid was sequenced to verify the insertion/substitution reaction. PCR was run with the Stachybotrys B phenol oxidase/pGAPT full plasmid as the template for the reaction. The DNA was diluted 1:10 to 74.4 ng/.mu.l and either 1.8 or 3.7 .mu.l was added to the reaction, which also contained 0.2 mM of each nucleotide, 1.times. reaction buffer, and 182 nanograms of primer. 2.5 units of Stratagene PFU Turbo polymerase was added to the reaction mixture. The PCR reaction was done at 95.degree. C. for 35 seconds followed by primer annealing to the template at 55.degree. C. for 1 minute 5 seconds. Extension was done at 68.degree. C. for 15 minutes and 30 seconds. The cycle was repeated 16 times. After the full length plasmid PCR product was purified with the Qiagen PCR purification kit, samples were sequenced for confirmation of peptide insertion/substitution. Successfully inserted or substituted peptides sequences in pGAPT plasmid were transformed into Aspergillus niger for expression.

Example 4

Expression of Laccase-peptide complexes by Aspergillus Host Cells

[0117] The DNA fragment containing nucleic acid encoding the Stachybotrys phenol oxidase B (SEQ ID NO: 1) with the introduced binding peptide followed by a stop codon and an Xba I site was isolated by PCR. The PCR fragment was cloned into the plasmid vector pCR2.1 and subjected to nucleic acid sequencing for verification. The DNA fragment was cloned into the BsrG I to Xba I site to create a plasmid pGAPT (see FIGS. 3 and 4). The pGAPT plasmid was co-transformed with a pHELP1 plasmid (Current Genetics 24:520-524 (1993)) in Aspergillus niger to generate transformants containing the replicating plasmid. This process was performed for each of the binding peptide listed in Table 3 Transformants were selected on plates without uridine and grown for 3 days. Spores from the transformants were resuspended in 200 .mu.l of Robosoy media in a 96-well plate and grown for 30.degree. C. for 4 days. Samples were filtered and analyzed for laccase expression.

Example 5

Purification of Laccase from Fermentation Cultures

[0118] Samples obtained as described in Example 4 were purified using small-scale hydrophobic interaction chromatography. Fermentation cultures were filtered over miracloth to separate the cells from the broth. The filtrate was further filtered through a 0.2 .mu.m Steritop (GP) filter unit. The material was loaded onto a column containing the HIC resin 20 HP2 (Perkin Elmer), connected to a BioCad/Sprint workstation (Perkin Elmer) after the resin had been equilibrated with 1.05 M ammonium sulfate in 30 mM Mes, Bis-tris Propane, pH 5.4 buffer. After washing the column to an ammonium sulfate concentration of 0.75M, the enzyme-peptide complex was eluted using ammonium sulfate gradient going from 0.75M to 0.0M over 5CVs. All fractions were quickly checked for ABTS activity using a qualitative assay in which 50 .mu.L of fraction were added to 100 .mu.L of an ABTS solution (4.5 mM) in a 96 well titer plate; apparition of a teal green color in less than 10 sec indicated the enriched presence of laccase. Reference is made to U.S. Pat. No. 6,168,936 and WO 01/21809. In parallel, the fractions were loaded onto a SDS gel (Nu PAGE, 4-12%, Invitrogen) to assess the purity of the fractions. The enriched and purified fractions were pooled, concentrated using a Pellicon XL unit (MWCO: 8000 Da, Millipore), further concentrated and diafiltered against Milli-Q water using YM-10 centripreps until the permeate reached a conductivity of around 5 .mu.S. The enriched fraction was then frozen at -70.degree. C. in 1 ml aliquots until further use. The purity of the enzyme obtained as described was often superior to 80-90%.

Example 6

Preferential Binding of the Binding Peptide YGYLPSR (SEQ ID NO: 16) to Tomato Stain

[0119] The following stock solutions were prepared:

2 g/L Lever "Multi Acao" detergent (Unilever, Brazil) [0120] 10 mM NiSO.sub.4 [0121] 2 mM (GGHGGYGYLPSR) (SEQ ID NO: 455), (referred to as stained peptide (STP) #1) [0122] 2 mM (GGHGGCYGYLPSRC) (SEQ ID NO:456), (referred to as stained peptide (STP) #2) [0123] 10 mM GGH [0124] OPD (o-phenylene diamine, Sigma P-8287 10 mg tablet/22.5 mL buffer (50 mM HEPES, pH 8.0) [0125] 100 mM H.sub.2O.sub.2 stock

[0126] Appropriate amounts of NiSO.sub.4 and GGHGGYGYLPSR (SEQ ID NO: 455) stock solutions were mixed to prepare 0.125-1.0 mM Ni-(STP #1) solutions. The resulting solutions were mixed for at least 10 minutes before use to form the Ni-peptide complex. Appropriate amounts of NiSO.sub.4 and GGHGGCYGYLPSRC (SEQ ID NO: 456) stock solutions were mixed to prepare 0.125-1.0 mM Ni-(STP #2) solutions. The resulting solutions were mixed for at least 10 minutes before use to form the Ni-peptide complex. Appropriate amounts of NiSO.sub.4 and GGH stock solutions were mixed to prepare 0.125-1.0 mM Ni-GGH solutions. The resulting solutions were mixed for at least 10 minutes before use to form the Ni-peptide complex.

[0127] An appropriate number of tomato stained cotton swatches and unstained cotton swatches were added to a 96 well plate. 100 .mu.L nickel peptide stock solutions were added to the 96 well plate with the swatches and the resulting mixture incubated for 90 minutes at room temperature with gentle shaking. After incubation, the solution was removed with suction and each swatch rinsed 2 times in 200 .mu.L dH.sub.2O by shaking for 3 minutes. 200 .mu.L OPD solution and 50 .mu.L of H.sub.2O.sub.2 solution were added to each well and the plate place on a shaker at moderate speed. The mixture was allowed to incubate overnight and then 200 .mu.L was transferred from each well to a new 96 well plate. Absorbance was read at 430 nm.

[0128] FIG. 5 shows a comparison of binding to tomato stain vs. unsoiled cotton from a starting concentration of 0.5 mM Ni-peptide. The NiGGH values were adjusted for higher activity by dividing by 3; to bring the absorbance values in line with the other Ni-peptide values and provide an equal basis of comparison. The plot shows Ni-SEQ ID NO: 455, binds to tomato stain about 4.times. more than to cotton, Ni-SEQ ID NO: 456, binds to tomato stain about 3.times. more than to cotton, and NiGGH shows no preferential binding.

Example 7

Laccase-Peptide Complex Binding

[0129] Four samples were used to test the binding ability and other properties of 3 laccase-peptide complexes according to the invention. As discussed above, the laccase-peptide complex comprised a binding peptide that was attached to the laccase at the C-terminus. The samples included (a) SEQ ID NO: 1--IERSAPATAPPP (SEQ ID NO: 92); (b) SEQ ID NO: 1--KASAPAL (SEQ ID NO: 24); (c) SEQ ID NO: 1--the C-C derivative of KASAPAL (SEQ ID NO: 24); and nonderivatized laccase SEQ ID NO: 1.

[0130] A 96 well plate was filled with cotton swatches stained with tomato (Textile Innovators). 90 .mu.L of 83.5 mM sodium carbonate, pH 10 buffer were added to the swatches. 50 .mu.L of purified enzyme dilutions, protein concentrations of 0.6 mg/ml, 0.3 mg/ml and 0.1 mg/ml, were added and the plate was left to incubate at room temperature for an hour using mild shaking. The solution was pipetted off and the swatches rinsed with 500 .mu.L of MilliQ water using strong agitation for 5 min. The rinse pipetted off; the swatches received 150 .mu.L of an ABTS solution (4.5 mM in 50 mM sodium acetate, pH 5). Qualitative estimation of binding of the complex was observed and evaluated by visual determination of the dark green color caused by ABTS oxidation (FIG. 6). As observed the results indicate the superior binding on a protein basis of the laccase-peptide complex versus the original nonderivatized laccase.

[0131] Additionally a guaiacol assay and protein concentration were determined as outlined below with results represented in Table 4.

TABLE-US-00012 TABLE 4 Av Guaiacol Av Guaiacol Guaiacol Protein Av ABTS pH 8.5 pH 10.0 Ratio Concentration SAMPLE U/ml U/ml U/ml 10/8.5 Mg/ml SEQ ID NO: 16.13 6.375 8.348 1.31 0.623 1-IERSAPATAPPP (SEQ ID NO: 92) SEQ ID NO: 18.48 8.462 11.735 1.39 1.23 1-KASAPAL (SEQ ID NO: 24) SEQ ID NO: 21.25 11.119 14.173 1.28 0.657 1-C-SEQ ID NO: 24-C SEQ ID NO: 1 12.55 7.326 7.731 1.06 1.19

[0132] The guaiacol assay is also useful for determining phenol oxidizing activity, especially at higher pH levels. The following reagents are used: 50 mM Tris-HCl buffer pH 8.5 (To make 1 L: dissolve 7.8 g of Tris-HCL in 1 L of DI water. Mix gently. Calibrate pH probes and adjust pH to 8.5. Buffer should be filter sterilized using a 0.2 um filter); 50 mM Guaiacol in Milli-Q-H.sub.2O (To make 20 mL of 50 mM Guaiacol: dissolve 124 uL of Guaiacol (Sigma catalog number 6-5502) in Milli-Q-H.sub.20. Guaiacol is light sensitive; solutions containing Guaiacol should be kept away from light by shielding container. This reagent solution should be made fresh daily for quality purposes.

[0133] The reagents are combined as follows:

TABLE-US-00013 Guaiacol stock solution final [conc] 750 .mu.L of pH 8.5 Tris-HCl 50 mM buffer 42 mM Tris-HCl 100 .mu.L of 50 mM Guaiacol 5.6 mM Guaiacol

[0134] The enzyme-peptide complex sample is diluted in water, if necessary. 750 .mu.L of Tris-HCl buffer, 100 .mu.L of guaiacol, and 50 .mu.L of enzyme are added to a disposable 1.5 mL cuvette. The reaction is allowed to proceed for 30 seconds at ambient room temperature of 21.degree. C. and a reading is taken every 2 seconds using a spectrophotometer at a lambda of 470 nm. Before the first reading, mix the reaction solution well in the cuvette.

[0135] The following calculation can be carried out:

Specific activity=((.DELTA.OD units/min)/(0.050 mL))/([protein] mg/mL)

=.DELTA.OD units/min/mg protein

[0136] Protein concentration can be estimated, for example, using the BCA protein assay (See, e.g., Smith, P. K., et al (1985) "Measurement of protein using bicinchoninic acid." Anal. Biochem. 150: 76-85).

[0137] In an exemplary procedure, employing the Pierce BCA Protein Assay Reagent Kit (Product Cat. 23225) (Pierce; Rockford, Ill.) [Reference: Pierce Protein Assay Reagent Kit Instructions (for protein assay)]: [0138] 1) Prepare Pierce BCA Protein kit Working Reagent (WR): [0139] a) Mix 50 parts of Reagent A (Sodium carbonate, sodium bicarbonate, BCA detection reagent and sodium tartarate in 0.1 M NaOH) with 1 part of Reagent B (4% CuSO.sub.4.5H.sub.2O) [0140] 2) Prepare BSA std.s using 2 mg/mL BSA std. stock soln. [0141] See Mfrs. Instructions (diln.s prepared in Milli-Q water) Chill 20% TCA thoroughly: [0142] 1) 50 uL of Sample/Std.s & 50 uL of 20% TCA>mix>put on ice for 20 min. [0143] 2) Centrifuge for 10 minutes>Decant>Dry in Speed Vac [0144] Speed Vac: Bring to speed>turn on vac.>run .about.2 min.>turn vac. off>stop and remove samples [0145] 3) Resuspend in 50 uL of WR [0146] 4) Add 1 mL WR to each tube [0147] 5) Incubate at 37.degree. for 30 minutes [0148] 6) Cool to Rm. Temp. and read at 562 nm

Plot Standards and Determine Protein Concentrations:

[0148] [0149] 1) Do Scatter plot on Standards [0150] 2) Determine trend line [0151] 3) Display equation and R.sup.2 value: [0152] use the equation to determine protein conc.: y=mx+b [0153] where: y=562 nm reading, and x=ug/mL

[0154] Protein determination in connection with unpurified complexes can be done by way of a different protocol; for example, the protein can be quantified via densitometry on Coomassie stained SDS gels.

Example 8

Binding of Laccase-YGYLPSR (SEQ ID NO: 16) to Tomato

[0155] Tomato stained cotton swatches (Textile Innovators Corp.) and non-stained cotton swatches (Textile Innovators Corp.) were placed in wells of a 96 well titer plate, previously blocked with a solution of BSA in PBS (Superblock, Pierce), for 2 days at room temperature and rinsed three times with MilliQ water (with 150 ul per well), Dilutions (100 ul) of SEQ ID NO:1, variant M254F/E346V/E348Q-YGYLPSR (SEQ ID NO: 16) or the same variant without SEQ ID NO: 16 (1 mg/ml, 0.1 mg/ml and 0.01 mg/ml) in a commercial detergent solution were added in duplicate to the non-stained cotton swatches and to the tomato stained cotton swatches. Incubation was at 1 hr at room temperature with moderate shaking. The incubation solution was pipetted off and the swatches were washed twice with 150 ul MilliQ water for 1 minute with moderate shaking. 150 ul of a 4.5 mM solution of ABTS in sodium acetate 50 mM, pH 5 buffer were added to each swatch. After 5 minutes incubation under moderate agitation, 100 ul of the ABTS solutions were placed in an empty 96 well plate and the absorbance at 420 nm was read (end point assay) against blanks containing only the original ABTS substrate solution, The average absorbance (n=2) for each concentration of laccase for each type of swatch is depicted in FIG. 7.

[0156] The results indicate the derivatized laccase (the M254F/E346V/E348Q variant--SEQ ID NO:16), designated as (A) bound at least 4 to 6 times greater to tomato stained swatches than to non-stained cotton swatches. The results also indicate the nonderivatized laccase (the M254F/E346V/E348Q variant), designated as (B) bound 2 times better to cotton swatches than to tomato stained swatches, and further the nonderivatized laccase (B) bound 2 to 3 times better to cotton swatches than the derivatized laccase (A).

[0157] Binding and bleaching experiments were performed with stained tomato cotton swatches, as outlined herein above, for the laccase-peptide complex, variant M254F/E346V/E348Q-SLLNATK (SEQ ID NO: 4) and the corresponding non-derivatized laccase (variant M254F/E346V/E348Q). The laccase-peptide complex resulted in improved bleaching and enhanced binding on a protein basis. (Data not shown)

Sequence CWU 1

1

5591583PRTStachybotrys chartarum 1Met Ile Ser Gln Ala Ile Gly Ala Val Ala Leu Gly Leu Ala Val Ile1 5 10 15Gly Gly Ser Ser Val Asp Ala Arg Ser Val Ala Gly Arg Ser Thr Asp 20 25 30Met Pro Ser Gly Leu Thr Lys Arg Gln Thr Gln Leu Ser Pro Pro Leu 35 40 45Ala Leu Tyr Glu Val Pro Leu Pro Ile Pro Pro Leu Lys Ala Pro Asn 50 55 60Thr Val Pro Asn Pro Asn Thr Gly Glu Asp Ile Leu Tyr Tyr Glu Met65 70 75 80Glu Ile Arg Pro Phe Ser His Gln Ile Tyr Pro Asp Leu Glu Pro Ala85 90 95Asn Met Val Gly Tyr Asp Gly Met Ser Pro Gly Pro Thr Ile Ile Val100 105 110Pro Arg Gly Thr Glu Ser Val Val Arg Phe Val Asn Ser Gly Glu Asn115 120 125Thr Ser Pro Asn Ser Val His Leu His Gly Ser Phe Ser Arg Ala Pro130 135 140Phe Asp Gly Trp Ala Glu Asp Thr Thr Gln Pro Gly Glu Tyr Lys Asp145 150 155 160Tyr Tyr Tyr Pro Asn Arg Gln Ala Ala Arg Met Leu Trp Tyr His Asp165 170 175His Ala Met Ser Ile Thr Ala Glu Asn Ala Tyr Met Gly Gln Ala Gly180 185 190Val Tyr Met Ile Gln Asp Pro Ala Glu Asp Ala Leu Asn Leu Pro Ser195 200 205Gly Tyr Gly Glu Phe Asp Ile Pro Leu Val Leu Thr Ala Lys Arg Tyr210 215 220Asn Ala Asp Gly Thr Leu Phe Ser Thr Asn Gly Glu Val Ser Ser Phe225 230 235 240Trp Gly Asp Val Ile Gln Val Asn Gly Gln Pro Trp Pro Met Leu Asn245 250 255Val Gln Pro Arg Lys Tyr Arg Phe Arg Phe Leu Asn Ala Ala Val Ser260 265 270Arg Ser Phe Ala Leu Tyr Leu Ala Thr Ser Glu Asp Ser Glu Thr Arg275 280 285Leu Pro Phe Gln Val Ile Ala Ala Asp Gly Gly Leu Leu Glu Gly Pro290 295 300Val Asp Thr Asp Thr Leu Tyr Ile Ser Met Ala Glu Arg Trp Glu Val305 310 315 320Val Ile Asp Phe Ser Thr Phe Ala Gly Gln Ser Ile Asp Ile Arg Asn325 330 335Leu Pro Gly Ala Asp Gly Leu Gly Val Glu Pro Glu Phe Asp Asn Thr340 345 350Asp Lys Val Met Arg Phe Val Val Asp Glu Val Leu Glu Ser Pro Asp355 360 365Thr Ser Glu Val Pro Ala Asn Leu Arg Asp Val Pro Phe Pro Glu Gly370 375 380Gly Asn Trp Asp Pro Ala Asn Pro Thr Asp Asp Glu Thr Phe Thr Phe385 390 395 400Gly Arg Ala Asn Gly Gln Trp Thr Ile Asn Gly Val Thr Phe Ser Asp405 410 415Val Glu Asn Arg Leu Leu Arg Asn Val Pro Arg Asp Thr Val Glu Ile420 425 430Trp Arg Leu Glu Asn Asn Ser Asn Gly Trp Thr His Pro Val His Ile435 440 445His Leu Val Asp Phe Arg Val Leu Ser Arg Ser Thr Ala Arg Gly Val450 455 460Glu Pro Tyr Glu Ala Ala Gly Leu Lys Asp Val Val Trp Leu Ala Arg465 470 475 480Arg Glu Val Val Tyr Val Glu Ala His Tyr Ala Pro Phe Pro Gly Val485 490 495Tyr Met Leu His Cys His Asn Leu Ile His Glu Asp His Asp Met Met500 505 510Ala Ala Phe Asn Val Thr Val Leu Gly Asp Tyr Gly Tyr Asn Tyr Thr515 520 525Glu Phe Ile Asp Pro Met Glu Pro Leu Trp Arg Pro Arg Pro Phe Leu530 535 540Leu Gly Glu Phe Glu Asn Gly Ser Gly Asp Phe Ser Glu Leu Ala Ile545 550 555 560Thr Asp Arg Ile Gln Glu Met Ala Ser Phe Asn Pro Tyr Ala Gln Ala565 570 575Asp Asp Asp Ala Ala Glu Glu58027PRTArtificial Sequencesynthetic binding peptide 2Thr Gly Met Ser Leu His His1 537PRTArtificial Sequencesynthetic binding peptide 3Pro Leu Thr Thr Ser Pro Val1 547PRTArtificial Sequencesynthetic binding peptide 4Ser Leu Leu Asn Ala Thr Lys1 557PRTArtificial Sequencesynthetic binding peptide 5Gln Asn Glu His Asn Leu Ala1 567PRTArtificial Sequencesynthetic binding peptide 6Pro Phe Asn Thr Leu Asp Arg1 577PRTArtificial Sequencesynthetic binding peptide 7Arg Asn Tyr Thr Gly Ala Ala1 587PRTArtificial Sequencesynthetic binding peptide 8Leu Pro Gly Pro Ser His Phe1 597PRTArtificial Sequencesynthetic binding peptide 9Ser Lys Asn Glu Gly Arg Thr1 5107PRTArtificial Sequencesynthetic binding peptide 10Trp Tyr Ala Asn Lys Thr Met1 5117PRTArtificial Sequencesynthetic binding peptide 11Phe Pro Lys Thr Thr Pro Ile1 5127PRTArtificial Sequencesynthetic binding peptide 12Ile Ser Asp Phe Lys Phe Met1 5137PRTArtificial Sequencesynthetic binding peptide 13Gly Asn Ser Ala Trp Phe Phe1 5147PRTArtificial Sequencesynthetic binding peptide 14Asn Thr Ser Ile Gln Arg Asn1 5157PRTArtificial Sequencesynthetic binding peptide 15Ser Ser Lys Trp His Tyr Asn1 5167PRTArtificial Sequencesynthetic binding peptide 16Tyr Gly Tyr Leu Pro Ser Arg1 5177PRTArtificial Sequencesynthetic binding peptide 17Thr Pro Ser Tyr Trp Gln Asp1 5187PRTArtificial Sequencesynthetic binding peptide 18Asn Thr Ser Arg Leu Phe His1 5197PRTArtificial Sequencesynthetic binding peptide 19Ser Gln Gln Gln Arg Gln Tyr1 5207PRTArtificial Sequencesynthetic binding peptide 20Ala Pro Ser Glu Asn Gln Val1 5217PRTArtificial Sequencesynthetic binding peptide 21Lys Tyr Leu Asn Asp Gln Arg1 5227PRTArtificial Sequencesynthetic binding peptide 22Lys Pro Thr Ala Thr Asn Ile1 5237PRTArtificial Sequencesynthetic binding peptide 23Ala Pro Pro Ala Gln Gly Ser1 5247PRTArtificial Sequencesynthetic binding peptide 24Lys Ala Ser Ala Pro Ala Leu1 5257PRTArtificial Sequencesynthetic binding peptide 25Lys Ser Asp His Trp Lys Asn1 5267PRTArtificial Sequencesynthetic binding peptide 26Leu Val Asn Lys His Gln Ser1 5277PRTArtificial Sequencesynthetic binding peptide 27Lys Leu Asn Ala Asn Asn Phe1 5287PRTArtificial Sequencesynthetic binding peptide 28Thr Gln His Met Lys Lys Ala1 5297PRTArtificial Sequencesynthetic binding peptide 29Ser His Ser Pro Tyr Ser Arg1 5307PRTArtificial Sequencesynthetic binding peptide 30Leu Gln Ser His Lys Asp His1 5317PRTArtificial Sequencesynthetic binding peptide 31Ser Ser Lys Ser Leu Ala Val1 5327PRTArtificial Sequencesynthetic binding peptide 32His Asp Ser Leu His Gly Lys1 5337PRTArtificial Sequencesynthetic binding peptide 33Thr Asp Trp Asn Gly Trp His1 5347PRTArtificial Sequencesynthetic binding peptide 34Val Pro Trp Leu Thr Asn Ser1 5357PRTArtificial Sequencesynthetic binding peptide 35Leu Ser Pro Gln Asp Arg Tyr1 5367PRTArtificial Sequencesynthetic binding peptide 36Leu Thr His Gly Pro Lys His1 5377PRTArtificial Sequencesynthetic binding peptide 37His Leu Asn Gln His His Thr1 5387PRTArtificial Sequencesynthetic binding peptide 38Val Ser Ser Pro His Ile Tyr1 5397PRTArtificial Sequencesynthetic binding peptide 39Met Thr His Pro Leu Val His1 5407PRTArtificial Sequencesynthetic binding peptide 40His Thr Phe Leu Gln Thr His1 5417PRTArtificial Sequencesynthetic binding peptide 41Asn Thr Ser Tyr Gln Tyr Arg1 5427PRTArtificial Sequencesynthetic binding peptide 42Gly His Ser Met Leu Thr Asn1 5437PRTArtificial Sequencesynthetic binding peptide 43Met Thr Pro Ala Lys Pro Ser1 5447PRTArtificial Sequencesynthetic binding peptide 44Ile Ser Asp Tyr Pro Asn Pro1 5457PRTArtificial Sequencesynthetic binding peptide 45Asp Ile Gln Arg Met Met Leu1 5467PRTArtificial Sequencesynthetic binding peptide 46Phe Val Leu Pro Pro Val Ser1 5477PRTArtificial Sequencesynthetic binding peptide 47Thr Met Gly Thr Leu Leu Ala1 5487PRTArtificial Sequencesynthetic binding peptide 48His Ile Arg Ala Pro Gly Asn1 5497PRTArtificial Sequencesynthetic binding peptide 49His Thr Ser Pro Thr Ser His1 5507PRTArtificial Sequencesynthetic binding peptide 50Ser Ser Asp Leu Pro Pro Tyr1 5517PRTArtificial Sequencesynthetic binding peptide 51Trp Gly Leu Ala Ser Gln Leu1 5527PRTArtificial Sequencesynthetic binding peptide 52Pro Asn Ser His Pro His Trp1 5537PRTArtificial Sequencesynthetic binding peptide 53Pro Thr Arg Ala Thr Pro Ser1 5547PRTArtificial Sequencesynthetic binding peptide 54Pro His Pro Thr Asn Leu Ala1 5557PRTArtificial Sequencesynthetic binding peptide 55Gln Ile Ser Gln Ser Gln Ile1 5567PRTArtificial Sequencesynthetic binding peptide 56Pro Ser Ser Thr Trp His Pro1 5577PRTArtificial Sequencesynthetic binding peptide 57Ile Thr Trp Asp His Ile Asn1 5587PRTArtificial Sequencesynthetic binding peptide 58Ser Pro Asn Pro Thr Ser Thr1 5597PRTArtificial Sequencesynthetic binding peptide 59Gln Thr Ser Ala Leu Ser Arg1 5607PRTArtificial Sequencesynthetic binding peptide 60Glu Arg Arg Pro Ser Lys Ala1 5617PRTArtificial Sequencesynthetic binding peptide 61Ser Met Phe Ser Lys Ala Ala1 5627PRTArtificial Sequencesynthetic binding peptide 62Gln Pro Thr Leu Gly Gln Met1 5637PRTArtificial Sequencesynthetic binding peptide 63Thr Arg Thr Met Asn Phe Thr1 5647PRTArtificial Sequencesynthetic binding peptide 64Lys Pro Trp Asn Ala Glu Lys1 5657PRTArtificial Sequencesynthetic binding peptide 65Arg Ala Asp Thr Ser Gly His1 5667PRTArtificial Sequencesynthetic binding peptide 66Lys Ala Ser Val Ala Gln Gln1 5677PRTArtificial Sequencesynthetic binding peptide 67Ser Gly Leu Trp Pro Gly Phe1 5687PRTArtificial Sequencesynthetic binding peptide 68Asn Arg Ser Ala Glu Gly Val1 5697PRTArtificial Sequencesynthetic binding peptide 69Ser Thr Arg Leu Thr Thr Glu1 5707PRTArtificial Sequencesynthetic binding peptide 70Pro Pro His Gly Ala Leu Arg1 5717PRTArtificial Sequencesynthetic binding peptide 71Asn Gly Thr Trp Ser Ala Lys1 5727PRTArtificial Sequencesynthetic binding peptide 72Ala Pro Ser Arg Met Met Ile1 5737PRTArtificial Sequencesynthetic binding peptide 73Asn Thr Leu Trp Gln Ser Pro1 5747PRTArtificial Sequencesynthetic binding peptide 74Lys His Thr His Met Thr Ala1 5757PRTArtificial Sequencesynthetic binding peptide 75Ser Phe Thr Lys Asn Asn Trp1 5767PRTArtificial Sequencesynthetic binding peptide 76Lys His Ser Ser Leu Thr Thr1 5777PRTArtificial Sequencesynthetic binding peptide 77Ser Thr Ser Leu Leu Asn Ala1 5787PRTArtificial Sequencesynthetic binding peptide 78Lys Tyr Gln Tyr Lys His Ala1 5797PRTArtificial Sequencesynthetic binding peptide 79Pro Tyr Ser His Ser Arg Phe1 5807PRTArtificial Sequencesynthetic binding peptide 80Glu Ser Ala Arg Trp Ser Leu1 5817PRTArtificial Sequencesynthetic binding peptide 81Leu Pro Gln Ile Gln Arg Ile1 5827PRTArtificial Sequencesynthetic binding peptide 82Asn Pro Asp Leu Arg His Asn1 5837PRTArtificial Sequencesynthetic binding peptide 83Leu Pro Thr Pro Lys Ala His1 5847PRTArtificial Sequencesynthetic binding peptide 84Thr Gln Thr Ser Leu Thr Lys1 5857PRTArtificial Sequencesynthetic binding peptide 85Phe Ser Leu Tyr Asp Ala Thr1 5867PRTArtificial Sequencesynthetic binding peptide 86Pro Val His Thr His Asn Trp1 5877PRTArtificial Sequencesynthetic binding peptide 87Ser Met Tyr Val Glu Gly Asn1 5887PRTArtificial Sequencesynthetic binding peptide 88Thr Ser Gln His Tyr Arg Ser1 5897PRTArtificial Sequencesynthetic binding peptide 89His Tyr Thr Thr Asp Arg His1 59012PRTArtificial Sequencesynthetic binding peptide 90Ser Phe Gly His Ser Thr Phe Trp His Pro Val Leu1 5 109112PRTArtificial Sequencesynthetic binding peptide 91Thr Pro Pro Ile Tyr Trp His Arg Met Ala Asp Thr1 5 109212PRTArtificial Sequencesynthetic binding peptide 92Ile Glu Arg Ser Ala Pro Ala Thr Ala Pro Pro Pro1 5 109312PRTArtificial Sequencesynthetic binding peptide 93Asn Pro Thr Thr Thr Tyr Lys Met Thr Pro Thr Met1 5 109412PRTArtificial Sequencesynthetic binding peptide 94His Val Gln Ile Leu Gln Leu Ala Ala Pro Ala Leu1 5 109512PRTArtificial Sequencesynthetic binding peptide 95His Val Thr Asn Pro Thr Ser Pro Arg Pro Val Ala1 5 109612PRTArtificial Sequencesynthetic binding peptide 96Thr Pro Trp Met Gln Asn Thr Ile Tyr Arg Pro His1 5 109712PRTArtificial Sequencesynthetic binding peptide 97Leu Pro Ser Leu Leu Val Ser His Leu Phe Asp Met1 5 109812PRTArtificial Sequencesynthetic binding peptide 98Ser Phe Pro Gly Lys Phe Leu Ser Leu His Thr Ser1 5 109912PRTArtificial Sequencesynthetic binding peptide 99Tyr Lys Asn Ala Ile Pro Glu Asp Leu Arg Glu Leu1 5 1010012PRTArtificial Sequencesynthetic binding peptide 100Ser Gly Glu Phe Asn Gln Trp Pro Ser Ser Lys Pro1 5 1010112PRTArtificial Sequencesynthetic binding peptide 101Ser Tyr Leu Asn His Leu Pro Gln Arg Pro Leu Ser1 5 1010212PRTArtificial Sequencesynthetic binding peptide 102Ala Gly Asn Tyr Met Phe Leu Gly Tyr Arg Ser Leu1 5 1010312PRTArtificial Sequencesynthetic binding peptide 103Thr Ala Thr His Leu Ser Pro Gly Ala Trp Arg Pro1 5 1010412PRTArtificial Sequencesynthetic binding peptide 104Tyr His Thr Pro Ser Thr Gly Gly Ala Ser Pro Val1 5 1010512PRTArtificial Sequencesynthetic binding peptide 105Ser Ser Asp Val Pro Gln Ala Ala Arg Asn Asp Ala1 5 1010612PRTArtificial Sequencesynthetic binding peptide 106Leu Ser Lys Lys Ile Thr Thr Asp Glu Trp Phe Ala1 5 1010712PRTArtificial Sequencesynthetic binding peptide 107Ser Gln Ile Lys His Pro His Ala Ser Ser Ser Ile1 5 1010812PRTArtificial Sequencesynthetic binding peptide 108Ser Met Gln Leu Gln Leu Ile Pro Ser Thr Pro Thr1 5 1010912PRTArtificial Sequencesynthetic binding peptide 109Tyr Asp His Asn Tyr Thr Met Asn Asn Ala Leu Asn1 5 1011012PRTArtificial Sequencesynthetic binding peptide 110Asn Ala Phe Glu Thr Gln Arg Leu Ala Gln Leu Gly1 5 1011112PRTArtificial Sequencesynthetic binding peptide 111Ala Gln Ala Ser Arg Ile Asn Thr Tyr Pro Pro Thr1 5 1011212PRTArtificial Sequencesynthetic binding peptide 112His Gln Thr Ser Asn Gly Pro Thr Pro Leu Val Pro1 5 1011312PRTArtificial Sequencesynthetic binding peptide 113Thr Phe Thr Pro Tyr Ala Tyr Gln Ser Asn Met Ser1 5 1011412PRTArtificial Sequencesynthetic binding peptide 114Thr Thr Leu Thr Tyr Asn Trp Lys Ser Ala His Gln1 5 1011512PRTArtificial Sequencesynthetic binding peptide 115Glu Met Val Ser Lys Lys Thr Leu Thr Ser Val Leu1 5 1011612PRTArtificial Sequencesynthetic binding peptide 116Glu Leu Val Lys Asn Pro Tyr Thr Arg Ser Leu Thr1 5 1011712PRTArtificial Sequencesynthetic binding peptide 117Leu Pro Pro Gln Pro Pro Phe Ile Thr Thr Met Leu1 5 1011812PRTArtificial Sequencesynthetic binding peptide 118Ser Pro Thr Thr Leu Val Gln Met Pro Trp Pro Arg1 5 1011912PRTArtificial Sequencesynthetic binding peptide 119Ser Ala Gln Asn Gly Val Ile Ser Tyr Asp Leu Gly1 5 1012012PRTArtificial Sequencesynthetic binding peptide 120Gln Ile Trp His Pro His Asn Tyr Pro Gly Ser Leu1 5 1012112PRTArtificial Sequencesynthetic binding peptide 121Thr Asn Gln Leu His Arg Thr His Pro Ser Gly Gln1 5 1012212PRTArtificial Sequencesynthetic binding peptide 122Asn Asp His Arg Glu Val Arg Thr Arg Leu Phe Leu1 5 1012312PRTArtificial Sequencesynthetic binding peptide 123His Ser Phe Arg Val Thr Ser Asn Leu Ser Pro Pro1 5 1012412PRTArtificial Sequencesynthetic binding peptide 124Tyr Asn Thr Ser Ile Met Gln Lys Ala Val Ser Pro1 5 1012512PRTArtificial Sequencesynthetic binding peptide 125Ala Ser Pro Asn Thr His Thr Pro Ala Ala Arg Ala1 5 1012612PRTArtificial Sequencesynthetic binding peptide 126Thr Leu Tyr Gln

Asp Gln Lys Gln Lys Gln Arg Phe1 5 1012712PRTArtificial Sequencesynthetic binding peptide 127Glu Ile Leu Tyr Met Pro Pro Ser Thr His Ala Leu1 5 1012812PRTArtificial Sequencesynthetic binding peptide 128Thr Pro Phe Ile Tyr Leu Lys Ser Ser Ser Leu Pro1 5 1012912PRTArtificial Sequencesynthetic binding peptide 129Asp Ile Pro Ser Phe Glu Thr Ile Pro Pro Arg Pro1 5 1013012PRTArtificial Sequencesynthetic binding peptide 130Gly His Arg Pro His Ala Ile Lys Pro Pro Pro Pro1 5 1013112PRTArtificial Sequencesynthetic binding peptide 131Ser Asp Tyr Ser Ser Ala Ala Thr Tyr Tyr Gly His1 5 1013212PRTArtificial Sequencesynthetic binding peptide 132Ser Ser Thr Ser Pro Leu Leu Pro His Met Leu Leu1 5 1013312PRTArtificial Sequencesynthetic binding peptide 133Thr Ser Glu His Thr Leu Ala Ser Lys Tyr Gln Ser1 5 1013412PRTArtificial Sequencesynthetic binding peptide 134Ser His Gly Ile Ala Thr Ser Glu Thr Thr Ser Asn1 5 1013512PRTArtificial Sequencesynthetic binding peptide 135Met Asn Pro Ser Ser Ser Gln His Lys Asn Ser His1 5 1013612PRTArtificial Sequencesynthetic binding peptide 136Pro Trp Ala Ser Ile Thr Pro Pro Pro Leu Leu Arg1 5 1013712PRTArtificial Sequencesynthetic binding peptide 137Gln Asn Leu Gln Pro Pro Gln Gly Phe Thr Leu Gly1 5 1013812PRTArtificial Sequencesynthetic binding peptide 138Thr Thr Ser Phe Ser Glu Gly Ile Leu Ile Arg Ser1 5 1013912PRTArtificial Sequencesynthetic binding peptide 139Asn Val Pro Thr Ser Asn Thr His Phe Gly Leu His1 5 1014012PRTArtificial Sequencesynthetic binding peptide 140Thr Gly Ser Met Glu Leu Trp Thr Leu Gln Thr Gln1 5 1014112PRTArtificial Sequencesynthetic binding peptide 141Ser Pro Ala Arg Ser Thr Val Gly Pro Tyr Glu Leu1 5 1014212PRTArtificial Sequencesynthetic binding peptide 142Ser His Ala Ile Thr Ala Thr His Leu Glu Pro Ser1 5 1014312PRTArtificial Sequencesynthetic binding peptide 143Leu Gln Leu Gln Leu Leu Pro Tyr Ala Phe Pro Val1 5 1014412PRTArtificial Sequencesynthetic binding peptide 144Asn Asn Leu Ala Phe Thr Pro Ser Gly Thr Leu Arg1 5 1014512PRTArtificial Sequencesynthetic binding peptide 145His Phe Ala Tyr Thr Lys Pro Met Arg Ile Pro Gln1 5 1014612PRTArtificial Sequencesynthetic binding peptide 146Ser Ser Trp Leu His Asp Leu Pro Val Leu Pro Leu1 5 1014712PRTArtificial Sequencesynthetic binding peptide 147Ser Val Thr Tyr Gln Asn Tyr Gly Met Asn Thr Met1 5 1014812PRTArtificial Sequencesynthetic binding peptide 148Tyr Ala His Ala Gly Lys Thr Thr Phe Leu Leu Gly1 5 1014912PRTArtificial Sequencesynthetic binding peptide 149His Pro Pro Ser Leu Pro Asn Asn Val Val His Pro1 5 1015012PRTArtificial Sequencesynthetic binding peptide 150Ser Ser Lys Asn Pro Leu Ala Asp Asn Pro Arg Gln1 5 1015112PRTArtificial Sequencesynthetic binding peptide 151His Leu Ser Arg Phe Glu Ser Leu Met His Leu Met1 5 1015212PRTArtificial Sequencesynthetic binding peptide 152Trp Leu His Leu Pro Gly Ser Ala Gln Asn His Leu1 5 1015312PRTArtificial Sequencesynthetic binding peptide 153Arg Asn Arg Pro His Ile Ile Arg Pro Pro Pro Pro1 5 1015412PRTArtificial Sequencesynthetic binding peptide 154Thr Lys Asn Trp Met Pro His Gln Asp Ala Pro Leu1 5 1015512PRTArtificial Sequencesynthetic binding peptide 155Gln Asn Gln Leu Asp Met Thr Lys Leu Thr Met Leu1 5 1015612PRTArtificial Sequencesynthetic binding peptide 156Asn Pro Pro Pro Pro Thr Pro Pro Pro Ala Pro Pro1 5 1015712PRTArtificial Sequencesynthetic binding peptide 157Ser Tyr Thr Gln Ile Leu Ala His Pro Lys His Ala1 5 1015812PRTArtificial Sequencesynthetic binding peptide 158Gln Thr Gly Gln Ala His Gln Gln Pro Ser Ala Thr1 5 1015912PRTArtificial Sequencesynthetic binding peptide 159Asn Ile Pro Tyr Leu Ala Met Pro Thr Lys Arg Met1 5 1016012PRTArtificial Sequencesynthetic binding peptide 160Leu Arg Ser Asp Gln Tyr Phe His His Thr Thr Leu1 5 1016112PRTArtificial Sequencesynthetic binding peptide 161His Leu Tyr Arg Asn Asn Asp Thr Phe Ala Pro Arg1 5 1016212PRTArtificial Sequencesynthetic binding peptide 162Gly Ser Val Gly Tyr Met Arg Pro Pro Lys Val Tyr1 5 1016312PRTArtificial Sequencesynthetic binding peptide 163Leu Pro Ala Gln Met Thr Pro Val Ser Val Val Arg1 5 1016412PRTArtificial Sequencesynthetic binding peptide 164Gln Gln Leu Ile Asn Tyr Ser Met Pro Leu Pro Met1 5 1016512PRTArtificial Sequencesynthetic binding peptide 165Tyr Pro Thr Phe Ser Tyr Val Ser Pro Glu Val Thr1 5 1016612PRTArtificial Sequencesynthetic binding peptide 166Thr Tyr Thr Ser Gln Ser Arg Ser Pro Ala Asp Asp1 5 1016712PRTArtificial Sequencesynthetic binding peptide 167Ala Tyr Trp Asp Phe Ile Gln Ala Lys Gln Ala Met1 5 1016812PRTArtificial Sequencesynthetic binding peptide 168Gly Leu Gln Thr Ile Asp Leu Asn Leu Tyr Asn Ala1 5 1016912PRTArtificial Sequencesynthetic binding peptide 169Thr Ile Met His Thr Thr Val Pro Gly His Leu Gln1 5 1017012PRTArtificial Sequencesynthetic binding peptide 170Ile Thr Gln Thr Arg Phe Ile Ala Ala Pro Leu His1 5 1017112PRTArtificial Sequencesynthetic binding peptide 171His Val Leu Arg His Pro Gly Asn Pro Asn Thr Phe1 5 1017212PRTArtificial Sequencesynthetic binding peptide 172Ala His His Asp Asp Lys His Ser Ala Pro Asp Thr1 5 1017312PRTArtificial Sequencesynthetic binding peptide 173Asp Pro Ser Asn Lys Arg Tyr Pro Gln Ser Tyr Lys1 5 1017412PRTArtificial Sequencesynthetic binding peptide 174Leu Asn Ala Asn Leu Pro Ala Asn Ser Val Leu Ala1 5 1017512PRTArtificial Sequencesynthetic binding peptide 175Asn Ile Asn Lys His Tyr Phe Gln Ser Pro Ile Met1 5 1017612PRTArtificial Sequencesynthetic binding peptide 176Thr Gly Met Lys Ala Pro Ser Gly Ile Tyr Thr Gly1 5 1017712PRTArtificial Sequencesynthetic binding peptide 177Gln Val Asn Phe Ser Asn His Ser Ser Arg Ser Pro1 5 1017812PRTArtificial Sequencesynthetic binding peptide 178Asn Ser Pro Met Gln Ala Leu His Asp Pro His Ser1 5 1017912PRTArtificial Sequencesynthetic binding peptide 179Val Glu Asn Leu Thr Gln Pro Pro Pro Pro Phe Gly1 5 1018012PRTArtificial Sequencesynthetic binding peptide 180Gln Thr Leu Asn Met Glu Pro Arg Ser Tyr Ser Asn1 5 1018112PRTArtificial Sequencesynthetic binding peptide 181Ile Ala Pro Gly Gly Ser Ile Lys Ala Pro Pro Arg1 5 1018212PRTArtificial Sequencesynthetic binding peptide 182Asp Ser Leu Thr Ser Asn Ser Gln Pro Pro Ser Ser1 5 1018312PRTArtificial Sequencesynthetic binding peptide 183Thr Pro Pro Ser Leu Tyr Tyr Leu Gly Pro Leu Pro1 5 1018412PRTArtificial Sequencesynthetic binding peptide 184Gln Pro Met Leu Phe Gly Leu Arg Gly Ala Phe Ala1 5 1018512PRTArtificial Sequencesynthetic binding peptide 185His Asn Ala Met Leu Pro Gln Tyr Leu Leu Leu Ser1 5 1018612PRTArtificial Sequencesynthetic binding peptide 186Ser Phe Asn Tyr Ala Thr Phe Pro Leu Val Pro Leu1 5 1018712PRTArtificial Sequencesynthetic binding peptide 187Leu Met Ala Arg Leu Pro Asp Thr Tyr Thr Gln Val1 5 1018812PRTArtificial Sequencesynthetic binding peptide 188Thr Ala Pro Ile Ala Ser Leu Thr Tyr Pro Leu Ile1 5 1018912PRTArtificial Sequencesynthetic binding peptide 189Thr His His Phe Gln Met Pro Pro Pro Pro Met Leu1 5 1019012PRTArtificial Sequencesynthetic binding peptide 190Met Asp Leu Gln Pro Pro Ser Ser Pro Arg Ser Thr1 5 1019112PRTArtificial Sequencesynthetic binding peptide 191Lys Met Met Ser Asn Ser Leu Thr Leu Arg Leu Pro1 5 1019212PRTArtificial Sequencesynthetic binding peptide 192Thr Pro Pro Gln Glu Leu Ile Thr Ala Ser Arg Ala1 5 1019312PRTArtificial Sequencesynthetic binding peptide 193Tyr Asn Lys Pro Leu Leu Gln Ser Gln Thr Leu Leu1 5 1019412PRTArtificial Sequencesynthetic binding peptide 194His Ser Leu Ala Gly Ile Ala Arg Met Leu Met Glu1 5 101957PRTArtificial Sequencesynthetic binding peptide 195Ser Ala Ala Gln Leu Asn Met1 51967PRTArtificial Sequencesynthetic binding peptide 196Ser Leu His Gln Ser Asn Tyr1 51977PRTArtificial Sequencesynthetic binding peptide 197Leu Gly Pro Pro Pro Phe Arg1 51987PRTArtificial Sequencesynthetic binding peptide 198Thr Thr Ala Pro Pro Thr Thr1 51997PRTArtificial Sequencesynthetic binding peptide 199Pro Ser His Gln Gln Gln Val1 52007PRTArtificial Sequencesynthetic binding peptide 200Pro Thr Phe Ile Lys Ser Asn1 52017PRTArtificial Sequencesynthetic binding peptide 201Ser Tyr Pro Leu Ala Ser Arg1 52027PRTArtificial Sequencesynthetic binding peptide 202Ser Lys Ile Ser Val Thr Leu1 52037PRTArtificial Sequencesynthetic binding peptide 203Thr Asn Ala Ser Pro Leu His1 52047PRTArtificial Sequencesynthetic binding peptide 204Pro Leu Asn Pro Asn Asn Met1 52057PRTArtificial Sequencesynthetic binding peptide 205Ser Gly Arg Pro Tyr Glu Thr1 52067PRTArtificial Sequencesynthetic binding peptide 206Gly Trp Thr Met Ala Gln Arg1 52077PRTArtificial Sequencesynthetic binding peptide 207Lys Leu Asn Asp Met Leu Leu1 52087PRTArtificial Sequencesynthetic binding peptide 208Arg Thr Thr Pro Pro Trp Met1 52097PRTArtificial Sequencesynthetic binding peptide 209Tyr Gln Ser Met Ser Tyr Ser1 52107PRTArtificial Sequencesynthetic binding peptide 210Thr Ser Gly Pro Ser Pro Met1 52117PRTArtificial Sequencesynthetic binding peptide 211His Ala Lys Ala Pro Ser Thr1 52127PRTArtificial Sequencesynthetic binding peptide 212Pro His Ser Arg Gly Leu Ala1 52137PRTArtificial Sequencesynthetic binding peptide 213Gln Gln Ser Trp Pro Pro Phe1 52147PRTArtificial Sequencesynthetic binding peptide 214Pro Asn Asn Ser Thr Pro Val1 52157PRTArtificial Sequencesynthetic binding peptide 215Thr Thr Thr Trp Trp His Val1 52167PRTArtificial Sequencesynthetic binding peptide 216Phe Ser Gln Ser Asp Pro Trp1 52177PRTArtificial Sequencesynthetic binding peptide 217Lys Pro Thr Val Asp Arg Asn1 52187PRTArtificial Sequencesynthetic binding peptide 218Asp Thr Trp Thr His Ser Ser1 52197PRTArtificial Sequencesynthetic binding peptide 219Lys Asp Met Pro Thr Gln Phe1 52207PRTArtificial Sequencesynthetic binding peptide 220Ile Ser Asn Asn Thr His Asn1 52217PRTArtificial Sequencesynthetic binding peptide 221Ile Asn Thr Pro His Ser Met1 52227PRTArtificial Sequencesynthetic binding peptide 222Lys Asp Gly Asn Pro Gly Tyr1 52237PRTArtificial Sequencesynthetic binding peptide 223Lys Asn Pro Asn Asn Asp Arg1 52247PRTArtificial Sequencesynthetic binding peptide 224Ser Ser Trp Pro Ala Met Pro1 52257PRTArtificial Sequencesynthetic binding peptide 225Asp Asn Gln Ala Phe Gly Leu1 52267PRTArtificial Sequencesynthetic binding peptide 226Pro His Lys Asp Pro Gln Arg1 52277PRTArtificial Sequencesynthetic binding peptide 227Thr Lys Cys Pro Ser Ser Thr1 52287PRTArtificial Sequencesynthetic binding peptide 228Glu Ala Asn Thr Gln Thr Ala1 52297PRTArtificial Sequencesynthetic binding peptide 229His Gln Met Ser Ser Gln Thr1 52307PRTArtificial Sequencesynthetic binding peptide 230Thr Ser Asn His Gln Ser Ser1 52317PRTArtificial Sequencesynthetic binding peptide 231Leu Pro Leu Lys Asn Ser Ala1 52327PRTArtificial Sequencesynthetic binding peptide 232Pro Ser Ala Thr Ser Leu Met1 52337PRTArtificial Sequencesynthetic binding peptide 233Ser Thr Pro Gly Ser Leu Gln1 52347PRTArtificial Sequencesynthetic binding peptide 234His His Gln Asn Ala Leu His1 52357PRTArtificial Sequencesynthetic binding peptide 235Asp Pro Leu Arg Gln Thr Thr1 52367PRTArtificial Sequencesynthetic binding peptide 236Asn Pro Lys Thr Asn Val Ser1 52377PRTArtificial Sequencesynthetic binding peptide 237Ser Asn Leu Ala Pro Met Leu1 52387PRTArtificial Sequencesynthetic binding peptide 238Phe Thr Ala Met Asn Asn Ser1 52397PRTArtificial Sequencesynthetic binding peptide 239Glu Pro His Ala Arg Ser Met1 52407PRTArtificial Sequencesynthetic binding peptide 240Asn Ser Leu Ser Pro Gly Asn1 52417PRTArtificial Sequencesynthetic binding peptide 241Glu His Asn Arg Gln Lys Asn1 52427PRTArtificial Sequencesynthetic binding peptide 242Thr Pro Thr Ser Pro Pro Gly1 52437PRTArtificial Sequencesynthetic binding peptide 243Asn Leu Ala Thr Ser Asn Ala1 52447PRTArtificial Sequencesynthetic binding peptide 244Asn Ser Thr Asp Arg Ser Thr1 52457PRTArtificial Sequencesynthetic binding peptide 245Ser Pro Thr Ala Ala Gln Ser1 52467PRTArtificial Sequencesynthetic binding peptide 246Thr Thr Thr Thr Ser Leu Leu1 52477PRTArtificial Sequencesynthetic binding peptide 247Pro Ser Met Leu Asn Ala Thr1 52487PRTArtificial Sequencesynthetic binding peptide 248Asn Thr His Ser Gly Lys Pro1 52497PRTArtificial Sequencesynthetic binding peptide 249His Pro Pro Trp Met Ser Gln1 52507PRTArtificial Sequencesynthetic binding peptide 250Thr Arg Ser Thr His Thr Thr1 52517PRTArtificial Sequencesynthetic binding peptide 251Gly Arg His Pro Leu Met Asn1 52527PRTArtificial Sequencesynthetic binding peptide 252Thr Gln Lys Glu His Gln Arg1 52537PRTArtificial Sequencesynthetic binding peptide 253Ala Leu Lys Glu Ala Leu Ser1 52547PRTArtificial Sequencesynthetic binding peptide 254His Thr Thr Thr Ser His His1 52557PRTArtificial Sequencesynthetic binding peptide 255Glu Ala Thr Phe His Lys Asp1 52567PRTArtificial Sequencesynthetic binding peptide 256Arg Leu Ser Asp Pro Met His1 52577PRTArtificial Sequencesynthetic binding peptide 257Thr Asp Phe Phe Gly Arg Val1 52587PRTArtificial Sequencesynthetic binding peptide 258Gly Gln Asn Pro Met Lys Ser1 52597PRTArtificial Sequencesynthetic binding peptide 259Thr Ala Pro Ser Phe Thr Lys1 52607PRTArtificial Sequencesynthetic binding peptide 260Phe Asp Ser Lys Asn Thr Pro1 52617PRTArtificial Sequencesynthetic binding peptide 261Gln Gln Leu Asn Thr Pro Arg1 52627PRTArtificial Sequencesynthetic binding peptide 262His Ile Pro Ser Ala Leu Leu1 52637PRTArtificial Sequencesynthetic binding peptide 263Glu Leu Thr Pro Ala Leu His1 52647PRTArtificial Sequencesynthetic binding peptide 264Thr Pro Pro Thr Lys Lys Gln1 52657PRTArtificial Sequencesynthetic binding peptide 265Ser Gly Ile Pro Arg Asn Ser1 52667PRTArtificial Sequencesynthetic binding peptide 266Val Gln Pro Val Thr Arg Tyr1 52677PRTArtificial Sequencesynthetic binding peptide 267Lys Gly Met His Thr Thr Asp1 52687PRTArtificial Sequencesynthetic binding peptide 268Pro Met Trp Gly Thr His Leu1 52697PRTArtificial Sequencesynthetic binding peptide 269Asn Ala Ala Lys Leu Glu Gln1 52707PRTArtificial Sequencesynthetic binding peptide 270Pro Gln Glu Ala Leu Gln Leu1 52717PRTArtificial Sequencesynthetic binding peptide 271Ser Arg Asp Met His Pro His1 52727PRTArtificial Sequencesynthetic binding peptide 272Gly Pro Glu Thr Pro Tyr Gln1 52737PRTArtificial Sequencesynthetic binding peptide 273Ser Leu Val Gln Ser Leu Glu1 52747PRTArtificial Sequencesynthetic binding peptide 274Asn Leu Thr Pro Met Ala Arg1 52757PRTArtificial Sequencesynthetic binding peptide 275Leu Gln Ser Pro Pro Leu Lys1 52767PRTArtificial Sequencesynthetic binding

peptide 276Gln Lys His Ala Phe Arg Ser1 52777PRTArtificial Sequencesynthetic binding peptide 277Pro Trp Gln Ile Lys Leu Thr1 527812PRTArtificial Sequencesynthetic binding peptide 278Gly Met Glu Pro Met His Tyr Tyr Ser Arg His Leu1 5 1027912PRTArtificial Sequencesynthetic binding peptide 279Gln Thr Thr Asn Ser Asn Met Ala Pro Ala Leu Ser1 5 1028012PRTArtificial Sequencesynthetic binding peptide 280Thr Pro Pro Ala Thr Leu Val His Trp Ala Asp Pro1 5 1028112PRTArtificial Sequencesynthetic binding peptide 281Met Gln Asn Leu His Glu Met Ala Trp Thr Ile Gln1 5 1028212PRTArtificial Sequencesynthetic binding peptide 282Lys Ser Leu Thr Phe Pro Leu Thr Ala Thr Gln Thr1 5 1028311PRTArtificial Sequencesynthetic binding peptide 283Val Ser His Lys Thr Gly Asn Thr Tyr Ser Arg1 5 1028412PRTArtificial Sequencesynthetic binding peptide 284Lys Val Asn Ile Pro His Ile His Asp Arg Ile Ala1 5 1028512PRTArtificial Sequencesynthetic binding peptide 285Gln Ile Pro Arg Leu Ile Pro His Pro Leu Ala Met1 5 1028612PRTArtificial Sequencesynthetic binding peptide 286Tyr Gln Asn Lys Ile His Ser Arg Thr Ile Ala His1 5 1028711PRTArtificial Sequencesynthetic binding peptide 287Glu Ser Arg Leu Ser Ser Ser Pro Trp Ser Leu1 5 1028811PRTArtificial Sequencesynthetic binding peptide 288Ala Ser Ser His Asp Gln His Ser Thr Glu Gly1 5 1028912PRTArtificial Sequencesynthetic binding peptide 289Ser Pro Leu Thr Gln Tyr Asn Thr Pro Arg His Pro1 5 1029012PRTArtificial Sequencesynthetic binding peptide 290Ile Lys Ser Gln Ala Asp Pro Ala Arg Leu Tyr Ile1 5 1029112PRTArtificial Sequencesynthetic binding peptide 291Asn Lys Thr Pro Asn Ser Met Thr Pro Ile Phe Met1 5 1029212PRTArtificial Sequencesynthetic binding peptide 292Ala Pro Pro Gln Ser Pro Val Tyr Leu Val Pro Leu1 5 1029312PRTArtificial Sequencesynthetic binding peptide 293Leu Pro Ala Gln Tyr Gln Thr Ile Pro Gly Ser Leu1 5 1029412PRTArtificial Sequencesynthetic binding peptide 294Ser Ser Val Pro Met Asp Val Leu Thr Pro Val Val1 5 1029512PRTArtificial Sequencesynthetic binding peptide 295Ala Leu Gly Ser Met Thr Trp Ser Pro Pro Pro Leu1 5 1029612PRTArtificial Sequencesynthetic binding peptide 296Gln Gly Ser His Asn Ser Ser Ser Ala Ile Ser Trp1 5 1029712PRTArtificial Sequencesynthetic binding peptide 297Ser Ser Ile Met Asn Thr Ala Val Leu Gly His Asp1 5 1029812PRTArtificial Sequencesynthetic binding peptide 298Ser Thr Leu Trp Tyr Arg Ser Asp Met Thr His Gly1 5 1029912PRTArtificial Sequencesynthetic binding peptide 299Ala Ser Thr Val Tyr Gln Pro Tyr Val Val His Ala1 5 1030012PRTArtificial Sequencesynthetic binding peptide 300Ala Ala Arg Asn Asp Gln Val Ser His Met His Met1 5 1030112PRTArtificial Sequencesynthetic binding peptide 301Glu Val Phe Gln Asn Trp Pro Gln Ser Leu His Lys1 5 1030212PRTArtificial Sequencesynthetic binding peptide 302Gln Ala Leu Thr His Pro Met Thr Lys Pro Pro Thr1 5 1030312PRTArtificial Sequencesynthetic binding peptide 303Ser Tyr Thr Lys Pro Asp Gln His Ala Leu Ala Phe1 5 1030412PRTArtificial Sequencesynthetic binding peptide 304Asp Leu Phe Ser Ala His His Thr Gly Gly Ala Leu1 5 1030512PRTArtificial Sequencesynthetic binding peptide 305Leu Val Gly His Gln Leu Asn Leu His Ala Leu Arg1 5 1030612PRTArtificial Sequencesynthetic binding peptide 306His Gly Glu Val Ala Arg Leu Val Pro Phe Arg Gly1 5 1030710PRTArtificial Sequencesynthetic binding peptide 307Ala Cys Lys Leu Glu Met Gly Leu Ser Cys1 5 1030812PRTArtificial Sequencesynthetic binding peptide 308Ser Ala Ile Pro Thr Met Gly Arg His Ala His Pro1 5 1030912PRTArtificial Sequencesynthetic binding peptide 309Gln Ser Thr Tyr Ser Asn Ile Gly Arg Asp Asp Ser1 5 1031012PRTArtificial Sequencesynthetic binding peptide 310Lys Ala Leu Ser Ala Ser Glu Pro Leu Pro Gln Gly1 5 1031112PRTArtificial Sequencesynthetic binding peptide 311Val Ala Ser Arg Leu Thr Gly Ser Val Ala Ser Ala1 5 1031212PRTArtificial Sequencesynthetic binding peptide 312Ser Ile Gly Glu Leu Ser Gly Pro Val Arg His Gln1 5 1031312PRTArtificial Sequencesynthetic binding peptide 313Gln Gln Asn Pro Tyr Ile Pro Ser Ser Val Thr Arg1 5 1031412PRTArtificial Sequencesynthetic binding peptide 314Asn Val Phe Met Gly Ser Leu His Ala Ser Leu Val1 5 1031512PRTArtificial Sequencesynthetic binding peptide 315Ser Pro His Ser Met Leu Gln Asn Pro Ser Gly Pro1 5 1031612PRTArtificial Sequencesynthetic binding peptide 316Asn Glu Glu Leu Thr Ser His Thr Asn Gln His Leu1 5 1031712PRTArtificial Sequencesynthetic binding peptide 317Tyr Leu Pro Ser Thr Phe Ala Pro Pro Leu Pro Leu1 5 1031812PRTArtificial Sequencesynthetic binding peptide 318Ser Val Gln Gly Ser Pro Leu Asp Ser Thr Asn His1 5 1031912PRTArtificial Sequencesynthetic binding peptide 319Phe Ser Thr Asp Asp Ser Pro Phe Pro Phe Ala Ala1 5 1032012PRTArtificial Sequencesynthetic binding peptide 320Val Gln Gln Ala Thr Ser Gly Leu Ala Arg Pro His1 5 1032112PRTArtificial Sequencesynthetic binding peptide 321Ser Asp Gln Ala Ser Leu Leu Asp Gly Trp Arg Phe1 5 1032212PRTArtificial Sequencesynthetic binding peptide 322Asn Thr Leu Met Ile Asn Pro Thr Gln Ala His Leu1 5 1032312PRTArtificial Sequencesynthetic binding peptide 323Ala His Glu Gly Arg Asn Tyr Gly Leu Val Ile Lys1 5 1032412PRTArtificial Sequencesynthetic binding peptide 324Gly Asp Ser Thr Leu Phe Asn Thr Trp Gln Ser Ser1 5 1032512PRTArtificial Sequencesynthetic binding peptide 325Ile Val Arg Val Thr Asp Gly Thr Pro Ser Pro Gly1 5 1032612PRTArtificial Sequencesynthetic binding peptide 326Ser Ser Pro Leu Gln Thr Ser Pro Pro Trp Pro Tyr1 5 1032712PRTArtificial Sequencesynthetic binding peptide 327Lys Ala Ile Gly Met Ser Thr Gly Pro Leu Thr Gln1 5 1032812PRTArtificial Sequencesynthetic binding peptide 328Leu His Val Thr Thr Thr Ile Pro Gly Gly Leu Arg1 5 1032912PRTArtificial Sequencesynthetic binding peptide 329Ser Val Pro Ser Pro Ser Pro Pro Trp Ser Arg Pro1 5 1033012PRTArtificial Sequencesynthetic binding peptide 330Val Ala Ser Ala Asn Pro His Ser Met Thr Ser Trp1 5 1033112PRTArtificial Sequencesynthetic binding peptide 331Gln Asp Ala Thr Ser Arg Phe Ser Gly Leu Ala Ser1 5 1033212PRTArtificial Sequencesynthetic binding peptide 332Ala Glu Ala Ile Thr Ala Ile Pro Leu Pro Val Pro1 5 1033312PRTArtificial Sequencesynthetic binding peptide 333Met Asp Pro Phe Ala Thr Ile Pro Ser Thr His Pro1 5 1033412PRTArtificial Sequencesynthetic binding peptide 334Glu Gly Asn Ala Arg Leu Ala Gln Ser Leu Ile Gln1 5 1033512PRTArtificial Sequencesynthetic binding peptide 335Met His Ser Pro Phe Cys Ser Ser Pro Cys Ser Pro1 5 1033612PRTArtificial Sequencesynthetic binding peptide 336Ser Gly Met Pro Pro Thr Ile Thr Trp Thr Arg Pro1 5 1033712PRTArtificial Sequencesynthetic binding peptide 337Trp Glu Ala Thr Pro Asn Phe Met Ser Lys Ile Ile1 5 1033812PRTArtificial Sequencesynthetic binding peptide 338Ala Val Ser Leu Val Pro Pro Asn Leu Ala Thr His1 5 1033912PRTArtificial Sequencesynthetic binding peptide 339Val Pro Asn Met Thr Pro Ser Ser Tyr Leu Ser Ala1 5 1034012PRTArtificial Sequencesynthetic binding peptide 340Leu Gln Pro Gln Thr Trp Ser Trp Ala Arg Gly Ala1 5 1034112PRTArtificial Sequencesynthetic binding peptide 341Thr Glu Pro Thr Val Lys His Pro Pro Leu Arg Ile1 5 1034212PRTArtificial Sequencesynthetic binding peptide 342Val Ala Leu Pro Asn Gln Pro Pro Arg Ala Gly Leu1 5 1034312PRTArtificial Sequencesynthetic binding peptide 343Gly Leu Gly Tyr Trp Val Met Pro Ala Pro Thr Ser1 5 1034412PRTArtificial Sequencesynthetic binding peptide 344His Asn Leu Tyr Met Thr Pro Pro Ser Ile Met Asn1 5 1034512PRTArtificial Sequencesynthetic binding peptide 345His Ala Glu Lys Ile Leu Ser Ser Pro Gly Pro Ala1 5 1034612PRTArtificial Sequencesynthetic binding peptide 346His Asn Met Leu Pro Pro Arg Cys Cys Leu Leu Pro1 5 103477PRTArtificial Sequencesynthetic binding peptide 347Thr Gln Pro Pro Gly Ser Ser1 53487PRTArtificial Sequencesynthetic binding peptide 348Met Lys Pro Gln Leu Ser Thr1 534912PRTArtificial Sequencesynthetic binding peptide 349His Ser Leu Phe Tyr Ser Trp Gly Pro Ser Leu Asp1 5 1035012PRTArtificial Sequencesynthetic binding peptide 350Val Arg Met Gln Met Asn Thr Gly Leu Pro Gln Arg1 5 103517PRTArtificial Sequencesynthetic binding peptide 351Pro His Thr Asn Glu Ile Val1 53527PRTArtificial Sequencesynthetic binding peptide 352Pro Tyr Met Gln Leu Arg Asn1 53537PRTArtificial Sequencesynthetic binding peptide 353Ala Arg Pro Thr Pro Leu Leu1 535412PRTArtificial Sequencesynthetic binding peptide 354Leu Asp Thr Ile Asp Thr Asn Pro Pro Val His Ser1 5 103557PRTArtificial Sequencesynthetic binding peptide 355Pro Thr His Pro Leu Pro Thr1 53567PRTArtificial Sequencesynthetic binding peptide 356Asn Ser Trp Cys Ala Ala Thr1 535712PRTArtificial Sequencesynthetic binding peptide 357Ile Pro Thr Ser Leu Met Ala His Pro His Pro Ala1 5 103587PRTArtificial Sequencesynthetic binding peptide 358Gln Gly Gln Ser Gln Gln Ser1 53597PRTArtificial Sequencesynthetic binding peptide 359Asn Ala Pro Ala Met Lys Leu1 53607PRTArtificial Sequencesynthetic binding peptide 360Thr Leu Trp Pro Pro Arg Ala1 536111PRTArtificial Sequencesynthetic binding peptide 361Gly Gln Gln Asp Arg Arg Glu Pro Ile Ile Ile1 5 103627PRTArtificial Sequencesynthetic binding peptide 362Arg Ile Pro Ala Glu Lys Val1 53637PRTArtificial Sequencesynthetic binding peptide 363Met Pro Ser Pro Thr Tyr Gln1 53647PRTArtificial Sequencesynthetic binding peptide 364Lys Ser Thr Trp Gln Gly Leu1 536512PRTArtificial Sequencesynthetic binding peptide 365Ser Leu Pro Ala Gln Pro Arg Leu Thr His Leu Trp1 5 1036612PRTArtificial Sequencesynthetic binding peptide 366His Trp Asn Thr Ala Ala Leu Asn His Met Arg Phe1 5 1036712PRTArtificial Sequencesynthetic binding peptide 367Thr His Gln Thr Thr Glu Leu Leu Pro Arg Ala Ser1 5 1036812PRTArtificial Sequencesynthetic binding peptide 368Val Leu Ala Leu Val Lys Thr Ser Leu Asn Glu Pro1 5 1036912PRTArtificial Sequencesynthetic binding peptide 369Gly Thr Tyr Asn Leu Pro Asn Pro Pro Pro Pro Leu1 5 103707PRTArtificial Sequencesynthetic binding peptide 370Leu Pro Asn Arg Thr Pro Val1 53717PRTArtificial Sequencesynthetic binding peptide 371Gly Gly Thr Cys Phe Leu Ala1 537212PRTArtificial Sequencesynthetic binding peptide 372Arg Thr Glu Ser Phe Ser Pro Leu Ser Phe Ser Ser1 5 1037312PRTArtificial Sequencesynthetic binding peptide 373Glu Thr Val Ser Asn Phe Ser Asn Val Ser Thr Lys1 5 103747PRTArtificial Sequencesynthetic binding peptide 374Ser Glu Pro Ala Arg Thr Pro1 537512PRTArtificial Sequencesynthetic binding peptide 375Gly Ser Ser Pro Leu Pro Leu Lys Phe Thr Gly Pro1 5 1037612PRTArtificial Sequencesynthetic binding peptide 376Ile Pro Asn His Tyr Thr His Tyr Ala Ser Pro Pro1 5 103777PRTArtificial Sequencesynthetic binding peptide 377Thr Trp Gly Gln Pro His Gly1 537812PRTArtificial Sequencesynthetic binding peptide 378Leu Lys Ala Gln Glu Phe Lys Ala Thr Pro Pro Val1 5 1037912PRTArtificial Sequencesynthetic binding peptide 379Ala Pro Arg Ser Asp Ser Leu Ile Leu Ser Pro Ser1 5 1038012PRTArtificial Sequencesynthetic binding peptide 380Leu Arg Pro Pro Thr Ala Leu Ser Ala Ala Leu His1 5 103817PRTArtificial Sequencesynthetic binding peptide 381Leu Arg Asp Thr His Ala Ile1 538212PRTArtificial Sequencesynthetic binding peptide 382Phe Asn Met Thr Thr Phe Ser Leu Ala Arg Ser Ser1 5 1038312PRTArtificial Sequencesynthetic binding peptide 383Phe Asn Pro Lys Thr Pro Lys Ile Ala Pro Asn Ile1 5 103847PRTArtificial Sequencesynthetic binding peptide 384Thr Leu Pro Asn Val Leu Arg1 538512PRTArtificial Sequencesynthetic binding peptide 385Ser Arg Asn Ile Pro Leu Pro Ser His Phe Leu Ser1 5 103867PRTArtificial Sequencesynthetic binding peptide 386Ser Arg Pro Gly Ser Pro Val1 538712PRTArtificial Sequencesynthetic binding peptide 387Asn Leu Asn Arg Gln Pro Val Met Lys His Trp Pro1 5 1038812PRTArtificial Sequencesynthetic binding peptide 388Phe Gln Thr Thr Ala Thr Arg Leu Gly Phe Ala Pro1 5 1038912PRTArtificial Sequencesynthetic binding peptide 389Leu Ser Val Ser Pro Arg Met Thr Pro Phe Val Thr1 5 1039012PRTArtificial Sequencesynthetic binding peptide 390Lys Ser His Thr Ser Met Glu Gln Leu Asn Ser Gln1 5 1039112PRTArtificial Sequencesynthetic binding peptide 391Glu Ser Phe Ser Val Thr Trp Leu Pro Ala Arg Thr1 5 1039212PRTArtificial Sequencesynthetic binding peptide 392Gly Gln Trp Gln Ala Asp Arg Leu Arg Ser Leu Pro1 5 1039312PRTArtificial Sequencesynthetic binding peptide 393Phe Asp Val Ser Thr Val Leu Ser Ser Ser Thr His1 5 1039412PRTArtificial Sequencesynthetic binding peptide 394Gln Val Asp Gly Thr Asn Asp Thr Arg Pro Ser Arg1 5 1039512PRTArtificial Sequencesynthetic binding peptide 395Lys Ala Ser Asn Leu Ser Pro Ile Leu Gly Leu Pro1 5 1039612PRTArtificial Sequencesynthetic binding peptide 396Ala Asn His Trp Ile Ala Ser Pro Tyr Trp Ser Leu1 5 1039712PRTArtificial Sequencesynthetic binding peptide 397Thr Val Gly Thr His Ser Met Arg Thr Pro Arg Cys1 5 1039812PRTArtificial Sequencesynthetic binding peptide 398Tyr Phe Gln Ala Thr Glu Leu Ser Pro Asn Asn Pro1 5 103997PRTArtificial Sequencesynthetic binding peptide 399Ser Ser Pro His Leu Thr Glu1 540012PRTArtificial Sequencesynthetic binding peptide 400Lys Tyr Pro Glu Asn Met Glu Val Ile Arg Pro Phe1 5 104017PRTArtificial Sequencesynthetic binding peptide 401Thr Ser Ser Gly Ser Asn Leu1 540212PRTArtificial Sequencesynthetic binding peptide 402Ser Pro Ser Leu Pro Arg Met Asp Val Ser Thr Pro1 5 1040312PRTArtificial Sequencesynthetic binding peptide 403Ile Thr Leu Pro His Ala Ala Met His Arg Ala Tyr1 5 1040412PRTArtificial Sequencesynthetic binding peptide 404His Tyr Phe Pro Asn Pro Leu Ser Ala His Pro Pro1 5 104057PRTArtificial Sequencesynthetic binding peptide 405Met Val Pro Ser Tyr Met Arg1 54067PRTArtificial Sequencesynthetic binding peptide 406Thr Glu Pro His Lys Ala Asn1 540712PRTArtificial Sequencesynthetic binding peptide 407Ala Ser Ala Gln His Lys Val Asn Phe Pro Arg Trp1 5 104087PRTArtificial Sequencesynthetic binding peptide 408Pro His His Ser Arg Ala Arg1 54097PRTArtificial Sequencesynthetic binding peptide 409Ser Leu His Tyr Asn Gln Ala1 54107PRTArtificial Sequencesynthetic binding peptide 410Ser Pro Thr Thr Gly Gln Ser1

54117PRTArtificial Sequencesynthetic binding peptide 411Pro Tyr Leu Pro Ser Ile Pro1 54127PRTArtificial Sequencesynthetic binding peptide 412Pro Ser Leu Pro Ser Ile Pro1 54137PRTArtificial Sequencesynthetic binding peptide 413Lys His Pro Gln Ser Pro Pro1 54147PRTArtificial Sequencesynthetic binding peptide 414Pro Pro Arg Tyr Ala Glu Leu1 54157PRTArtificial Sequencesynthetic binding peptide 415Ser Gln Leu Ala Leu Gln Gln1 54167PRTArtificial Sequencesynthetic binding peptide 416Asp Ser Asn Ser Ile Gln Val1 54177PRTArtificial Sequencesynthetic binding peptide 417Asn Trp His Pro Thr Leu Pro1 54187PRTArtificial Sequencesynthetic binding peptide 418Ser Pro Thr Leu Pro Pro Pro1 541912PRTArtificial Sequencesynthetic binding peptide 419Ser Lys His Pro Pro Ser Ser Pro His Gln Ser Pro1 5 104207PRTArtificial Sequencesynthetic binding peptide 420His Asp Trp Ala His Pro Leu1 54217PRTArtificial Sequencesynthetic binding peptide 421Met Thr Ser His Thr Gln Ala1 542212PRTArtificial Sequencesynthetic binding peptide 422Glu Pro Thr Thr Thr Thr Leu Pro Thr Val Gly Arg1 5 104237PRTArtificial Sequencesynthetic binding peptide 423Gln Ala His Asn Phe Thr Ser1 542412PRTArtificial Sequencesynthetic binding peptide 424Lys Val Ser Arg Glu Asn Tyr Thr Leu Val Ala Leu1 5 1042512PRTArtificial Sequencesynthetic binding peptide 425Thr Val Leu Ser Pro Leu Thr Gln Thr Leu Tyr Phe1 5 1042612PRTArtificial Sequencesynthetic binding peptide 426Ile Thr Phe Asp Arg Thr Gln Gln Arg Val Asp Asp1 5 104276PRTArtificial Sequencesynthetic binding peptide 427Tyr Thr Lys Pro Tyr Pro1 542812PRTArtificial Sequencesynthetic binding peptide 428His Tyr Ser Ser Gln Ser Asn Leu Ala Asp Ser His1 5 104297PRTArtificial Sequencesynthetic binding peptide 429Ser Thr Val Leu Leu Thr Asp1 54307PRTArtificial Sequencesynthetic binding peptide 430Leu Thr Pro Ser Ser Ala Pro1 54317PRTArtificial Sequencesynthetic binding peptide 431Asp Met Pro Pro Trp Arg Asp1 543212PRTArtificial Sequencesynthetic binding peptide 432His Ala Pro Phe Pro Arg Leu Thr Glu Ile Ser Gln1 5 104337PRTArtificial Sequencesynthetic binding peptide 433Val Asp Leu Ser Ser Val Pro1 543450DNAArtificial Sequencesynthetic binding peptide 434actacggcga ctcctcnnnn nnnnnnnnnn nnnnnnnatt agatctgggg 5043521DNAArtificial Sequencesynthetic binding peptide 435ttccggagtc gaggacgaaa c 2143627DNAArtificial Sequencesynthetic binding peptide 436aaggatccat caacatgatc agccaag 2743738DNAArtificial Sequenceprimer 437nnnnnnnnnn nnnnnnnnnn ncctttcccc gagggcgg 3843838DNAArtificial Sequenceprimer 438nnnnnnnnnn nnnnnnnnnn naacatctcg gaggttgg 3843951DNAArtificial Sequenceprimer 439gagggcggca acnnnnnnnn nnnnnnnnnn nnngatgacg agactttcac c 5144050DNAArtificial Sequenceprimer 440gtctcgtcat cnnnnnnnnn nnnnnnnnnn nngttgccgc cctcggggaa 5044139DNAArtificial Sequenceprimer 441tcccttctta acgctactaa gaccttctcg gatgtcgag 3944238DNAArtificial Sequenceprimer 442cttagtagcg ttaagaaggg aaactccgtt gattgtcc 3844351DNAArtificial Sequenceprimer 443gagggcggca actcccttct taacgctact aaggatgacg agactttcac c 5144450DNAArtificial Sequenceprimer 444gtctcgtcat ccttagtagc gttaagaagg gagttgccgc cctcggggaa 5044512PRTArtificial Sequencestained peptide (STP) #1 445Gly Gly His Gly Gly Tyr Gly Tyr Leu Pro Ser Arg1 5 1044614PRTArtificial Sequencestained peptide (STP) #2 446Gly Gly His Gly Gly Cys Tyr Gly Tyr Leu Pro Ser Arg Cys1 5 104474PRTArtificial Sequencesynthetic binding peptide 447Ala Ala Arg Asn14485PRTArtificial Sequencesynthetic binding peptide 448Ala Ala Arg Asn Asp1 54494PRTArtificial Sequencesynthetic binding peptide 449Ala Ile Thr Ala14504PRTArtificial Sequencesynthetic binding peptide 450Ala Leu His Cys14514PRTArtificial Sequencesynthetic binding peptide 451Ala Leu Ser Ala14524PRTArtificial Sequencesynthetic binding peptide 452Ala Pro Ala Leu14534PRTArtificial Sequencesynthetic binding peptide 453Ala Arg Asn Asp14544PRTArtificial Sequencesynthetic binding peptide 454Cys Ala Pro Ser14554PRTArtificial Sequencesynthetic binding peptide 455Cys Ile Ser Asp14564PRTArtificial Sequencesynthetic binding peptide 456Cys Lys Ala Ser14574PRTArtificial Sequencesynthetic binding peptide 457Cys Lys Leu Asn14584PRTArtificial Sequencesynthetic binding peptide 458Cys Lys Pro Thr14594PRTArtificial Sequencesynthetic binding peptide 459Cys Leu Gln Ser14609PRTArtificial Sequencesynthetic binding peptide 460Cys Pro Ser Met Leu Asn Ala Thr Cys1 54614PRTArtificial Sequencesynthetic binding peptide 461Cys Ser Leu His14624PRTArtificial Sequencesynthetic binding peptide 462Cys Ser Ser Lys14634PRTArtificial Sequencesynthetic binding peptide 463Cys Thr Thr Thr14644PRTArtificial Sequencesynthetic binding peptide 464Asp Val Ser Thr14654PRTArtificial Sequencesynthetic binding peptide 465Glu Ser Phe Ser14665PRTArtificial Sequencesynthetic binding peptide 466Gly Gly His Gly Gly1 54674PRTArtificial Sequencesynthetic binding peptide 467Gly Leu Ala Ser14684PRTArtificial Sequencesynthetic binding peptide 468His Ser Met Leu14694PRTArtificial Sequencesynthetic binding peptide 469Ile Pro Leu Pro14704PRTArtificial Sequencesynthetic binding peptide 470Ile Pro Ser Thr14714PRTArtificial Sequencesynthetic binding peptide 471Lys Ala Pro Ser14724PRTArtificial Sequencesynthetic binding peptide 472Lys His Pro Pro14734PRTArtificial Sequencesynthetic binding peptide 473Leu Asn Ala Asn14744PRTArtificial Sequencesynthetic binding peptide 474Leu Asn Ala Thr14754PRTArtificial Sequencesynthetic binding peptide 475Leu Pro Ala Gln14764PRTArtificial Sequencesynthetic binding peptide 476Leu Pro Leu Lys14774PRTArtificial Sequencesynthetic binding peptide 477Leu Pro Gln Arg14784PRTArtificial Sequencesynthetic binding peptide 478Leu Ser Pro Gly14794PRTArtificial Sequencesynthetic binding peptide 479Leu Ser Ser Ser14804PRTArtificial Sequencesynthetic binding peptide 480Leu Val Pro Leu14814PRTArtificial Sequencesynthetic binding peptide 481Met His Thr Thr14824PRTArtificial Sequencesynthetic binding peptide 482Asn Phe Ser Asn14834PRTArtificial Sequencesynthetic binding peptide 483Leu Asn Ala Thr14844PRTArtificial Sequencesynthetic binding peptide 484Asn Pro Lys Thr14854PRTArtificial Sequencesynthetic binding peptide 485Asn Pro Asn Asn14864PRTArtificial Sequencesynthetic binding peptide 486Asn Pro Thr Ser14874PRTArtificial Sequencesynthetic binding peptide 487Asn Thr Ser Ile14884PRTArtificial Sequencesynthetic binding peptide 488Pro Ala Arg Thr14894PRTArtificial Sequencesynthetic binding peptide 489Pro Gly Asn Cys14904PRTArtificial Sequencesynthetic binding peptide 490Pro Gly Ser Leu14914PRTArtificial Sequencesynthetic binding peptide 491Pro His Ser Met14924PRTArtificial Sequencesynthetic binding peptide 492Pro Leu Thr Gln14934PRTArtificial Sequencesynthetic binding peptide 493Pro Leu Val Pro14944PRTArtificial Sequencesynthetic binding peptide 494Pro Pro Pro Phe14954PRTArtificial Sequencesynthetic binding peptide 495Pro Pro Pro Pro14964PRTArtificial Sequencesynthetic binding peptide 496Pro Pro Arg Ala14974PRTArtificial Sequencesynthetic binding peptide 497Pro Pro Ser Leu14985PRTArtificial Sequencesynthetic binding peptide 498Pro Pro Ser Ser Pro1 54994PRTArtificial Sequencesynthetic binding peptide 499Pro Pro Trp Met15004PRTArtificial Sequencesynthetic binding peptide 500Pro Gln Ser Pro15014PRTArtificial Sequencesynthetic binding peptide 501Pro Arg Leu Thr15024PRTArtificial Sequencesynthetic binding peptide 502Pro Ser Ala Thr15034PRTArtificial Sequencesynthetic binding peptide 503Pro Ser Leu Pro15044PRTArtificial Sequencesynthetic binding peptide 504Pro Ser Ser Thr15054PRTArtificial Sequencesynthetic binding peptide 505Pro Ser Thr His15064PRTArtificial Sequencesynthetic binding peptide 506Pro Thr Pro Leu15074PRTArtificial Sequencesynthetic binding peptide 507Pro Thr Ser Pro15084PRTArtificial Sequencesynthetic binding peptide 508Pro Thr Thr Thr15094PRTArtificial Sequencesynthetic binding peptide 509Gln Leu Gln Leu15104PRTArtificial Sequencesynthetic binding peptide 510Arg Leu Ala Gln15114PRTArtificial Sequencesynthetic binding peptide 511Ser Ala Pro Ala15124PRTArtificial Sequencesynthetic binding peptide 512Ser Ala Gln Asn15134PRTArtificial Sequencesynthetic binding peptide 513Ser Phe Thr Lys15144PRTArtificial Sequencesynthetic binding peptide 514Ser Gly Leu Ala15154PRTArtificial Sequencesynthetic binding peptide 515Ser Ile Met Asn15165PRTArtificial Sequencesynthetic binding peptide 516Ser Leu Leu Asn Ala1 55174PRTArtificial Sequencesynthetic binding peptide 517Ser Asn Leu Ala15185PRTArtificial Sequencesynthetic binding peptide 518Ser Asn Leu Ser Pro1 55195PRTArtificial Sequencesynthetic binding peptide 519Ser Pro Leu Thr Gln1 55204PRTArtificial Sequencesynthetic binding peptide 520Ser Pro Pro Trp15214PRTArtificial Sequencesynthetic binding peptide 521Ser Pro Thr Thr15224PRTArtificial Sequencesynthetic binding peptide 522Ser Pro Val Cys15234PRTArtificial Sequencesynthetic binding peptide 523Ser Arg Ser Pro15244PRTArtificial Sequencesynthetic binding peptide 524Ser Ser Pro His15254PRTArtificial Sequencesynthetic binding peptide 525Ser Ser Pro Leu15264PRTArtificial Sequencesynthetic binding peptide 526Ser Ser Val Pro15274PRTArtificial Sequencesynthetic binding peptide 527Ser Thr Val Leu15284PRTArtificial Sequencesynthetic binding peptide 528Thr Ala Pro Pro15295PRTArtificial Sequencesynthetic binding peptide 529Thr Ala Thr His Leu1 55304PRTArtificial Sequencesynthetic binding peptide 530Thr Phe Ala Pro15314PRTArtificial Sequencesynthetic binding peptide 531Thr Phe Pro Leu15324PRTArtificial Sequencesynthetic binding peptide 532Thr Gly Gly Ala15334PRTArtificial Sequencesynthetic binding peptide 533Thr His Pro Leu15344PRTArtificial Sequencesynthetic binding peptide 534Thr Ile Pro Gly15354PRTArtificial Sequencesynthetic binding peptide 535Thr Pro Ser Ser15364PRTArtificial Sequencesynthetic binding peptide 536Thr Pro Val Cys15374PRTArtificial Sequencesynthetic binding peptide 537Thr Gln Pro Pro15384PRTArtificial Sequencesynthetic binding peptide 538Thr Ser His Thr15394PRTArtificial Sequencesynthetic binding peptide 539Thr Ser Leu Leu15404PRTArtificial Sequencesynthetic binding peptide 540Thr Ser Leu Met15414PRTArtificial Sequencesynthetic binding peptide 541Thr Ser Pro Pro15424PRTArtificial Sequencesynthetic binding peptide 542Thr Thr Thr Ser15434PRTArtificial Sequencesynthetic binding peptide 543Thr Thr Thr Thr15444PRTArtificial Sequencesynthetic binding peptide 544Val Ala Ser Ala15454PRTArtificial Sequencesynthetic binding peptide 545Tyr Leu Pro Ser15464PRTArtificial Sequencesynthetic binding peptide 546Tyr Thr Lys Pro15473PRTArtificial Sequencesynthetic binding peptide 547Pro Pro Pro15483PRTArtificial Sequencesynthetic binding peptide 548Ser Ser Pro15493PRTArtificial Sequencesynthetic binding peptide 549Ser Ser Lys15503PRTArtificial Sequencesynthetic binding peptide 550Ser Pro Thr15514PRTArtificial Sequencesynthetic binding peptide 551Pro Pro Pro Leu15523PRTArtificial Sequencesynthetic binding peptide 552Pro Leu Pro15533PRTArtificial Sequencesynthetic binding peptide 553Ser Leu His15543PRTArtificial Sequencesynthetic binding peptide 554Ser Pro Leu15553PRTArtificial Sequencesynthetic binding peptide 555Thr Thr Thr15564PRTArtificial Sequencesynthetic binding peptide 556Asn Cys Ala Thr15573PRTArtificial Sequencesynthetic binding peptide 557Asn Thr Ser15583PRTArtificial Sequencesynthetic binding peptide 558Ala Pro Ser15593PRTArtificial Sequencesynthetic binding peptide 559Thr Pro Val1

Claims

1. A binding peptide having the amino acid sequence illustrated in any one of SEQ ID NOS: 2 through 433 wherein said peptide binds to a carotenoid compound.

2. The binding peptide of claim 1, wherein said peptide is selected from the group consisting of SEQ ID NOS: 4, 16, 24, 77, 92, 94, 104, 105, 120, 198, 233, 237, 243, 247, 256, 279, 293, 300, 304, 317, 340, and 428.

3. The binding peptide of claim 2, wherein said peptide is selected from the group consisting of SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304, and 317.

4. The binding peptide of claim 1, further comprising a cysteine amino acid residue added to each end of the binding peptide.

5. A binding peptide comprising a repeatable motif selected from the group consisting of SAPA, TAPP, APAL, PPP, PPPP, SSPH, SSP, SSK, SPT, LPAQ, PPPL, PTPL, SPTT, PLVP, PLP, YTKP, SLH, SLLNA, SPL, SNLA, SPLTQ, TTT, AARND, AARN, ARND, LSPG, NPNN, NLAT, NTS, PHSM, PPWM, PTSP, TGGA, YLPS, YTKP, PGSL, APS, TPV, TTTS and LNAT, wherein said binding peptide has 6 to 15 amino acid residues and binds to a carotenoid stain on a fabric.

6. A polynucleotide sequence encoding the binding peptide of claim 1.

7. A polynucleotide sequence encoding the binding peptide of claim 5.

8. A phenol oxidizing enzyme-peptide complex comprising a phenol oxidizing enzyme and a peptide comprising the amino acid sequence illustrated in any one of SEQ ID NOS: 2 through 433.

9. The phenol oxidizing enzyme-peptide complex of claim 8, wherein the binding peptide is selected from the group consisting of SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304, and 317.

10. The phenol oxidizing enzyme-peptide complex of claim 8, wherein the peptide is attached to the phenol-oxidizing enzyme at the C-terminus.

11. A laccase-peptide complex comprising a laccase obtainable from a Stachybotrys species and a peptide comprising an amino acid sequence illustrated in any one of SEQ ID NOS: 2 through 433.

12. The laccase-peptide complex of claim 11, wherein the peptide has an amino acid sequence illustrated in any one of SEQ ID NOs: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304, and 317.

13. The laccase-peptide complex of claim 11, wherein the laccase has the amino acid sequence illustrated in SEQ ID NO: 1 or a variant thereof, said variant having at least 75% sequence identity to the amino acid sequence illustrated in SEQ ID NO: 1 and said variant is capable of modifying the color associated with colored compounds.

14. The laccase-peptide complex of claim 13 comprising a variant of SEQ ID NO: 1, wherein said variant differs from SEQ ID NO: 1 in at least one of the positions 48, 67, 70, 76, 83, 98, 115, 119, 134, 171, 175, 177, 179, 188, 236, 246, 253, 269, 272, 296, 302, 308, 318, 329, 331, 346, 348, 349, 365, 390, 391, 394, 404, 415, 423, 425, 428, 434, 465, 479, 481, 483, 499, 550, 562, 570, and 573 or sequence positions corresponding thereto and wherein said complex is capable of modifying the color associated with colored compounds.

15. The laccase-peptide complex of claim 18, wherein the laccase variant comprises a sequence that differs from that of SEQ ID NO: 1 in at least one of the positions 188, 254, 272, 346, 348, 394 and 425 or sequence positions corresponding thereto.

16. An expression vector comprising a polynucleotide encoding the phenol oxidizing enzyme-peptide complex of claim 8.

17. A host cell comprising the vector of claim 16.

18. A laccase-peptide complex comprising a peptide having the amino acid sequence illustrated in any one of SEQ ID NOs:2-433 and a laccase, wherein said laccase comprises the amino acid sequence illustrated in SEQ ID NO: 1 or a variant thereof, wherein said variant differs in at least one of the positions 188, 254, 272, 346, 348, 394 and 425 of SEQ ID NO: 1.

19. A method of enhancing the binding of a laccase enzyme to a target stain comprising; a) obtaining a peptide according to claim 1, b) combining said peptide with a laccase to form a laccase-peptide complex, and c) exposing a target stain to the laccase-peptide complex under suitable conditions to allow the complex to bind with the target stain.

20. The method according to claim 19, wherein the target stain is a carotenoid compound.

21. The method according to claim 19, wherein the peptide is selected from the group consisting of SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 279, 293, 300, 304, and 317.

22. The method according to claim 19, wherein the laccase is an enzymatically active laccase having the amino acid sequence illustrated in SEQ ID NO: 1 or a variant thereof, said variant having at least 75% sequence identity to the amino acid sequence illustrated in SEQ ID NO: 1 and which differs in at least one of the positions 48, 67, 70, 76, 83, 98, 115, 119, 134, 171, 175, 177, 179, 188, 236, 246, 253, 269, 272, 296, 302, 308, 318, 329, 331, 346, 348, 349, 365, 390, 391, 394, 404, 415, 423, 425, 428, 434, 465, 479, 481, 483, 499, 550, 562, 570, and 573 or sequence positions corresponding thereto and wherein said variant is capable of modifying the color associated with a targeted stain.

23. A detergent composition comprising a) one or more surfactants and b) the phenol oxidizing enzyme-peptide complex of claim 8, wherein said complex selectively binds to a target stain during a wash cycle that includes agitation.

24. An enzymatic composition comprising a) one or more surfactants and b) the phenol oxidizing enzyme-peptide complex of claim 8.

25. A method for bleaching a carotenoid stain on a fabric or surface comprising contacting the stain with the enzyme composition of claim 24.

26. A method for producing a host cell comprising a polynucleotide encoding a laccase-peptide complex, comprising the steps of: (a) obtaining a polynucleotide encoding a laccase having at least 68% identity to the amino acid sequence disclosed in SEQ ID NO: 1; (b) obtaining a polynucleotide encoding a binding peptide having an amino acid sequence as illustrated in any one SEQ ID NOS: 2-433; (c) conjugating the polynucleotide of step (a) with (b); (d) introducing said conjugated polynucleotide into the host cell; and (e) growing said host cell under conditions suitable for the production of said laccase-peptide complex.

27. A method of using a binding peptide to target a stain on a textile comprising a) obtaining a binding peptide as illustrated in any one of SEQ ID NOS: 2-433; b) exposing said binding peptide to a target stain, wherein said binding peptide binds to said stain and not to said textile.

28. The method according to claim 27, wherein the binding peptide is, selected from the group consisting of SEQ ID NOS: 4, 16, 24, 92, 94, 104, 105, 120, 198, 233, 247, 256, 279, 293, 300, 304, and 317.

29. A method of enhancing the selectivity of a phenol oxidizing enzyme to a target stain which comprises, a) derivatizing a laccase with a binding peptide as illustrated in any one of SEQ ID NOS: 2-433 to form a laccase-peptide complex; and b) exposing the laccase-peptide complex to a target stain, wherein selectivity of the laccase-peptide complex to the target stain is greater than the selectivity of a nonderivatized laccase having the same amino acid sequence as the laccase of the laccase-peptide complex.

30. The method according to claim 29, wherein the stain is a carotenoid compound stain.