U.S. patent application number 11/507751 was filed with the patent office on 2008-09-25 for compositions providing tolerance to multiple herbicides and methods of use thereof.
This patent application is currently assigned to Pioneer Hi-Bred International, Inc.. Invention is credited to Linda A. Castle, Timothy K. Chicoine, Hyeon-Je Cho, Jon S. Claus, Jerry M. Green, Anthony D. Guida, Christine B. Hazel, Matthew J. Heckert, Jeffrey M. Hegstad, James M. Hutchison, Donglong Liu, Albert L. Lu, Billy Fred McCutchen, Wayne J. Mehre, York Moy, Paul D. Olson, Kenneth A. Peeples, David W. Saunders, Mark D. Vogt, Jack Q. Wilkinson, James F. H. Wong.
Application Number | 20080234130 11/507751 |
Document ID | / |
Family ID | 37772256 |
Filed Date | 2008-09-25 |
United States Patent
Application |
20080234130 |
Kind Code |
A1 |
McCutchen; Billy Fred ; et
al. |
September 25, 2008 |
Compositions providing tolerance to multiple herbicides and methods
of use thereof
Abstract
Methods and compositions are provided related to improved plants
that are tolerant to more than one herbicide. Particularly, the
invention provides plants that are tolerant of glyphosate and are
tolerant to at least one ALS inhibitor, and methods of use thereof.
The glyphosate/ALS inhibitor-tolerant plants comprise a
polynucleotide that encodes a polypeptide that confers tolerance to
glyphosate and a polynucleotide that encodes an ALS
inhibitor-tolerant polypeptide. In specific embodiments, a plant of
the invention expresses a GAT polypeptide and an HRA polypeptide.
Methods to control weeds, improve plant yield, and increase
transformation efficiencies are provided.
Inventors: |
McCutchen; Billy Fred;
(College Station, TX) ; Castle; Linda A.;
(Mountain View, CA) ; Chicoine; Timothy K.; (St.
Charles, IA) ; Cho; Hyeon-Je; (Fremont, CA) ;
Claus; Jon S.; (Wilmington, DE) ; Green; Jerry
M.; (Landenberg, PA) ; Guida; Anthony D.;
(Newark, DE) ; Hazel; Christine B.; (Port Deposit,
MD) ; Heckert; Matthew J.; (San Carlos, CA) ;
Hegstad; Jeffrey M.; (Ankeny, IA) ; Hutchison; James
M.; (Wilmington, DE) ; Liu; Donglong;
(Johnston, IA) ; Lu; Albert L.; (Newark, DE)
; Mehre; Wayne J.; (Urbandale, IA) ; Moy;
York; (San Francisco, CA) ; Olson; Paul D.;
(Kalaheo, HI) ; Peeples; Kenneth A.; (Wilmington,
DE) ; Saunders; David W.; (Dallas Center, IA)
; Vogt; Mark D.; (Ankeny, IA) ; Wilkinson; Jack
Q.; (Redwood City, CA) ; Wong; James F. H.;
(Johnston, IA) |
Correspondence
Address: |
ALSTON & BIRD LLP;PIONEER HI-BRED INTERNATIONAL, INC.
BANK OF AMERICA PLAZA, 101 SOUTH TRYON STREET, SUITE 4000
CHARLOTTE
NC
28280-4000
US
|
Assignee: |
Pioneer Hi-Bred International,
Inc.
Johnston
IA
E.I. du Pont de Nemours and Company
Wilmington
DE
|
Family ID: |
37772256 |
Appl. No.: |
11/507751 |
Filed: |
August 22, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60710854 |
Aug 24, 2005 |
|
|
|
60817011 |
Jun 28, 2006 |
|
|
|
Current U.S.
Class: |
504/128 ;
504/130; 504/187; 504/209; 504/227; 504/235; 504/261; 800/278 |
Current CPC
Class: |
C12N 15/8274 20130101;
Y02A 40/146 20180101; C12N 9/1092 20130101; C12N 9/88 20130101;
Y02A 40/162 20180101; C12N 15/8278 20130101; C12N 15/8216 20130101;
C12N 15/8275 20130101; C12N 15/8205 20130101; C12N 15/8271
20130101; C12N 15/8286 20130101; C12N 15/8209 20130101 |
Class at
Publication: |
504/128 ;
504/130; 800/278; 504/187; 504/227; 504/261; 504/235; 504/209 |
International
Class: |
A01N 43/48 20060101
A01N043/48; A01N 43/64 20060101 A01N043/64; A01N 57/18 20060101
A01N057/18; A01N 43/647 20060101 A01N043/647; A01P 13/00 20060101
A01P013/00; C12N 15/11 20060101 C12N015/11; A01N 59/26 20060101
A01N059/26 |
Claims
1. A method for controlling weeds in an area of cultivation
comprising a) planting the area with crop seeds or plants which
comprise i) a first polynucleotide encoding a polypeptide that can
confer tolerance to glyphosate operably linked to a promoter active
in said plant; and, ii) a second polynucleotide encoding an ALS
inhibitor-tolerant polypeptide operably linked to a promoter active
in said plant; b) applying to any crop, crop part, weed or area of
cultivation thereof a combination of herbicides comprising at least
an effective amount of a first herbicide and an effective amount of
a second herbicide, wherein said combination of herbicides does not
include glyphosate and wherein said effective amount of said first
and said second herbicide is tolerated by the crop and controls
weeds.
2. The method of claim 1, wherein said first herbicide comprises an
ALS inhibitor.
3. The method of claim 2, wherein said second herbicide comprises a
second ALS inhibitor.
4. The method of claim 2, wherein said effective amount of the
first ALS inhibitor comprises about 0.1 to about 5000 g
ai/hectare.
5. The method of claim 4, wherein said effective amount of the
first ALS inhibitor comprises about 0.5 to about 350 g ai/hectare
or about 1 to about 150 g ai/hectare.
6. The method of claim 3, wherein said effective amount of the
second ALS inhibitor comprises about 0.1 to about 5000 g
ai/hectare, about 0.5 to about 350 g ai/hectare or about 1 to about
150 g ai/hectare.
7. The method of claim 1, wherein said first polynucleotide encodes
a glyphosate-N-acetyltransferase.
8. The method of claim 1, wherein said first polynucleotide encodes
a glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase
or a glyphosate-tolerant glyphosate oxido-reductase.
9. The method of claim 1, wherein said ALS inhibitor-tolerant
polypeptide comprises a mutated acetolactate synthase
polypeptide.
10. The method of claim 9, wherein said mutated acetolactate
synthase polypeptide comprises HRA.
11. The method of claim 1, wherein said combination of herbicides
comprises an ALS inhibitor selected from the group consisting of a
sulfonylurea, a triazolopyrimidine, a pyrimidinyloxy(thio)benzoate,
an imidazolinone, and a sulfonylaminocarbonyltriazolinone.
12. The method of claim 11, wherein said ALS inhibitor is selected
from the group consisting of: a) Azimsulfuron; b)
Chlorimuron-ethyl; c) Metsulfuron-methyl; d) Nicosulfuron; e)
Rimsulfuron; f) Sulfometuron-methyl; g) Thifensulfuron-methyl; h)
Tribenuron-methyl; i) Amidosulfuron; j) Bensulfuron-methyl; k)
Chlorsulfuron; l) Cinosulfuron; m) Cyclosulfamuron; n)
Ethametsulfuron-methyl; o) Ethoxysulfuron; p) Flazasulfuron; q)
Flupyrsulfuron-methyl; r) Foramsulfuron; s) Imazosulfuron; t)
Iodosulfuron-methyl; u) Mesosulfuron-methyl; v) Oxasulfuron; w)
Primisulfuron-methyl; x) Prosulfuron; y) Pyrazosulfuron-ethyl; z)
Sulfosulfuron; aa) Triasulfuron; bb) Trifloxysulfuron; cc)
Triflusulfuron-methyl; dd) Tritosulfuron; ee) Halosulfuron-methyl;
ff) Flucarbazone; gg) Procarbazone; hh) Cloransulam-methyl; ii)
Flumetsulam; jj) Diclosulam; kk) Florasulam; ll) Imazamox; mm)
Bispyribac; nn) Pyriftalid; oo) Pyribenzoxim; pp) Pyrithiobac; qq)
Pyriminobac-methyl; rr) Imazapyr; ss) Imazethapyr; tt) Imazaquin;
uu) Imazapic; vv) Imazamethabenz-methyl; ww) Imazamox; xx)
Flucetosulfuron; yy) Metosulam; zz) Penoxsulam; and, aaa)
Pyroxsulam.
13. The method of claim 1, wherein said combination of herbicides
comprises at least a triazine or a phosphinic acid.
14. The method of claim 1, wherein said second herbicide and said
first herbicide have different mechanisms of action.
15. The method of claim 1, wherein said second herbicide and said
first herbicide have the same mechanism of action.
16. The method of claim 1, wherein said combination of herbicides
comprises at least an effective amount of a third herbicide.
17. The method of claim 1, wherein said first herbicide is applied
pre-emergence, post-emergence or pre- and post-emergence to the
weeds or the crop; and, said second herbicide is applied
pre-emergence, post-emergence or pre- or post-emergence to the weed
or the crop.
18. The method of claim 1, wherein said first and said second
herbicides are applied together or are applied separately.
19. The method of claim 1, wherein at least said first and said
second herbicides comprise a homogeneous granule blend.
20. The method of claim 1, wherein said method further comprises
applying an agricultural chemical selected from the group
consisting of a fungicide, a nematicide, a growth regulator, a
safener, an adjuvant, an insecticide, and any combination
thereof.
21. The method of claim 20, wherein said agricultural chemical is
applied pre-emergence, post-emergence or pre- and post-emergence to
the weed or the crop.
22. The method of claim 20, wherein said agricultural chemical is
applied together or separately with said first herbicide, said
second herbicide, or said first and said second herbicide.
23. The method of claim 1, wherein the first herbicide comprises a
sulfonylurea and the second herbicide comprises an ALS
inhibitor.
24. The method of claim 1, wherein the first herbicide comprises a
sulfonylurea and the second herbicide comprises an
imidazolinone.
25. The method of claim 23, wherein the effective amount of said
first or said second herbicide provides a safening effect.
26. The method of claim 1, wherein at least one of said first or
said second polynucleotides is operably linked to at least one copy
of the enhancer sequence set forth in SEQ ID NO: 1, 72, 85, 88 or
89 or an enhancer sequence having at least 90% sequence Identity to
SEQ ID NO: 1, 72, 85, 88 or 89, wherein said enhancer sequence
modulates the level of transcription.
27. The method of claim 1, wherein said crop is a dicot.
28. The method of claim 27, wherein said dicot is soybean, canola,
sunflower, cotton, alfalfa, an ornamental, a fruit, a vegetable, a
sugar beet, or an Arabidopsis.
29. The method of claim 1, wherein said plant is a monocot.
30. The method of claim 29, wherein said monocot is maize, wheat,
rice, barley, sorghum, sugar cane, Switchgrass, or rye.
31. The method of claim 1, wherein said crop is maize and said
first herbicide is applied at the V7 stage or later.
32. The method of claim 1, wherein step (b) is performed at least
once prior to step (a).
33. A method for controlling weeds in an area of cultivation
comprising: a) evaluating environmental conditions in an area of
cultivation; b) selecting an effective amount of a combination of
herbicides comprising at least an effective amount of a first
herbicide and an effective amount of a second herbicide, wherein
said combination of herbicides does not include glyphosate and
wherein said effective amount of said first and said second
herbicide is tolerated by a crop and controls weeds; and, c)
applying the combination of herbicides to a crop, crop part, seed
or an area of cultivation of said crop, wherein the crop comprises
a plant having i) a first polynucleotide encoding a polypeptide
that can confer tolerance to glyphosate operably linked to a
promoter active in said plant; and, ii) a second polynucleotide
encoding an ALS inhibitor-tolerant polypeptide operably linked to a
promoter active in said plant.
34. The method of claim 33, wherein said first herbicide comprises
an ALS inhibitor.
35. The method of claim 34, wherein said second herbicide comprises
a second ALS inhibitor.
36. The method of claim 35, wherein said effective amount of the
first or said second ALS inhibitor comprises about 0.1 to about
5000 g ai/hectare.
37. The method of claim 35, wherein said effective amount of the
first or the second ALS inhibitor comprises about 1 to about 150 g
ai/hectare.
38. The method of claim 35, wherein said effective amount of the
first or the second ALS inhibitor comprises about 0.5 to about 350
g ai/hectare.
39. The method of claim 33, wherein said first polynucleotide
encodes a glyphosate-N-acetyltransferase.
40. The method of claim 33, wherein said ALS inhibitor-tolerant
polypeptide comprises a mutated acetolactate synthase
polypeptide.
41. The method of claim 40, wherein said mutated acetolactate
synthase polypeptide comprises HRA.
42. The method of claim 33, wherein said herbicide combination
comprises an ALS inhibitor selected from the group consisting of a
sulfonylurea, a triazolopyrimidine, a pyrimidinyloxy(thio)benzoate,
an imidazolinone, and a sulfonylaminocarbonyltriazolinone.
43. The method of claim 42, wherein said ALS inhibitor is selected
from the group consisting of: a) Azimsulfuron; b)
Chlorimuron-ethyl; c) Metsulfuron-methyl; d) Nicosulfuron; e)
Rimsulfuron; f) Sulfometuron-methyl; g) Thifensulfuron-methyl; h)
Tribenuron-methyl; i) Amidosulfuron; j) Bensulfuron-methyl; k)
Chlorsulfuron; l) Cinosulfuron; m) Cyclosulfamuron; n)
Ethametsulfuron-methyl; o) Ethoxysulfuron; p) Flazasulfuron; q)
Flupyrsulfuron-methyl; r) Foramsulfuron; s) Imazosulfuron; t)
Iodosulfuron-methyl; u) Mesosulfuron-methyl; v) Oxasulfuron; w)
Primisulfuron-methyl; x) Prosulfuron; y) Pyrazosulfuron-ethyl; z)
Sulfosulfuron; aa) Triasulfuron; bb) Trifloxysulfuron; cc)
Triflusulfuron-methyl; dd) Tritosulfuron; ee) Halosulfuron-methyl;
ff) Flucarbazone; gg) Procarbazone; hh) Cloransulam-methyl; ii)
Flumetsulam; jj) Diclosulam; kk) Florasulam; ll) Imazamox; mm)
Bispyribac; nn) Pyriftalid; oo) Pyribenzoxim; pp) Pyrithiobac; qq)
Pyriminobac-methyl; rr) Imazapyr; ss) Imazethapyr; tt) Imazaquin;
uu) Imazapic; vv) Imazamethabenz-methyl; ww) Imazamox. xx)
Flucetosulfuron; yy) Metosulam; zz) Penoxsulam; and, aaa)
Pyroxsulam.
44. The method of claim 33, wherein said second herbicide and said
first herbicide have the same or a different mechanism of
action.
45. The method of claim 33, wherein said first herbicide is applied
pre-emergence, post-emergence or pre- and post-emergence to the
weeds or the crop; and, said second herbicide is applied
pre-emergence, post-emergence or pre- and post-emergence to the
weed or the crop.
46. The method of claim 33, wherein said first and said second
herbicides are applied together or are applied separately.
47. The method of claim 33, wherein at least said first and said
second herbicides comprise a homogeneous granule blend.
48. The method of claim 33, wherein said method further comprises
applying an agricultural chemical selected from the group
consisting of a fungicide, a nematicide, a growth regulator, a
safener, an adjuvant, an insecticide, or any combination
thereof.
49. The method of claim 33, wherein at least one of said first or
said second polynucleotides is operably linked to at least one copy
of the enhancer sequence set forth in SEQ ID NO: 1, 72, 85, 88 or
89, or an enhancer sequence having at least 90% sequence identity
to SEQ ID NO: 1, 72, 85, 88 or 89, wherein said enhancer sequence
modulates the level of transcription.
50. The method of claim 33, wherein said crop is a dicot.
51. The method of claim 50, wherein said dicot is soybean, canola,
sunflower, cotton, alfalfa, an ornamental, a fruit, a vegetable, a
sugar beet, or an Arabidopsis.
52. The method of claim 33, wherein said plant is a monocot.
53. The method of claim 52, wherein said monocot is maize, wheat,
rice, barley, sorghum, sugar cane, Switchgrass, or rye.
54. A method for controlling weeds in an area of cultivation
comprising a) planting the area with crop seeds or plants which
comprise i) a first polynucleotide encoding a polypeptide that can
confer tolerance to glyphosate operably linked to a promoter active
in a plant; and, ii) a second polynucleotide encoding an ALS
inhibitor-tolerant polypeptide operably linked to a promoter active
in a plant; b) applying to any crop, crop part, weed or area of
cultivation thereof an effective amount of a combination of
herbicides selected from the group consisting of: i) the
combination of herbicides comprising glyphosate, imazapyr,
chlorimuron-ethyl, quizalofop, and fomesafen, wherein said
effective amount is tolerated by the crop and controls weeds; or,
ii) the combination of herbicides comprising glyphosate,
chlorimuron-ethyl, and thifensulfuron-methyl, wherein said
effective amount is tolerated by the crop and controls weeds.
55. The method of claim 54, wherein said crop is soybean, corn or
cotton.
56. The method of claim 54, wherein the effective amount of the
combination of herbicides of part (b)(i) comprises glyphosate
comprising about 1110 to about 1130 g ai/hectare; the effective
amount of imazapyr comprises about 7.5 to about 27.5 g ai/hectare;
the effective amount of chlorimuron-ethyl comprises about 7.5 to
about 27.5 g ai/hectare; the effective amount of quizalofop
comprises about 50 to about 70 g ai/hectare; and, the effective
amount of fomesafen comprises about 240 to about 260 g
ai/hectare.
57. A method of selecting cotton which has been transformed with a
first polynucleotide encoding a first polypeptide which confers
glyphosate tolerance and a second polynucleotide encoding an ALS
inhibitor-tolerant polypeptide, said method comprising the step of
growing transformed cotton callus while exposing it to glyphosate
and/or an ALS inhibitor herbicide.
58. The method of claim 57, wherein said polypeptide which confers
glyphosate tolerance comprise GAT and said ALS inhibitor-tolerant
polypeptide comprises HRA.
59. The method of claim 58, wherein the callus is grown while
exposing it to a medium containing chlorsulfuron at a concentration
of 50-200 micrograms per liter.
60. The method of claim 58, wherein the callus is grown while
exposing it to a medium containing glyphosate at a concentration of
up to 450 .mu.M.
61. A method for controlling weeds in an area of cultivation
comprising a) planting the field with crop seeds or plants which
comprise i) a first polynucleotide encoding a polypeptide that can
confer tolerance to glyphosate operably linked to a promoter active
in a plant; and, ii) a second polynucleotide encoding an ALS
inhibitor resistance polypeptide operably linked to a promoter
active in a plant; b) applying to said crop, crop part, seed of
said crop or the area of cultivation thereof an effective amount of
an herbicide, wherein said effective amount is tolerated by the
crop and controls weeds, wherein said herbicide is not glyphosate,
chlorimuron-ethyl, rimsulfuron, tribenuron-methyl or
thifensufuron-methyl.
62. The method of claim 61, wherein said herbicide is selected from
the group consisting of (i) a sulfonylaminocarbonyltriazolinone;
(ii) a triazolopyrimidine; (iii) a pyrimidinyl(thio)benzoate; (iv)
an imidazolinone; (v) a triazine; and (vi) a phosphinic acid.
63. A method for controlling weeds in a field containing a crop
comprising a) planting the field with crop seeds or plants which
comprise i) a first polynucleotide encoding a polypeptide that can
confer tolerance to glyphosate; and, ii) a second polynucleotide
encoding an ALS inhibitor-tolerant polypeptide; b) applying to any
crop and weeds in the field an effective amount of a first
herbicide comprising an ALS inhibitor and an effective amount of at
least one additional agricultural agent selected from the group
consisting of a fungicide, a nematicide, an insecticide, a safener,
or an adjuvant, wherein said effective amount of said ALS inhibitor
herbicide is tolerated by the crop, and, wherein said effective
amount of said combination is not tolerated by a control plant
which does not express both of said first and said second
polypeptide.
64. The method of claim 63, wherein step (b) is performed at least
once prior to step (a).
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 60/710,854, filed on Aug. 24, 2005, and U.S.
Provisional Application No. 60/817,011, filed on Jun. 28, 2006,
each of which is incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] This invention is in the field of molecular biology. More
specifically, this invention pertains to multiple herbicide
tolerances conferred by expression of a sequence that confers
tolerance to glyphosate in conjunction with the expression of at
least one other herbicide tolerance gene.
BACKGROUND OF THE INVENTION
[0003] In the commercial production of crops, it is desirable to
easily and quickly eliminate unwanted plants (i.e., "weeds") from a
field of crop plants. An ideal treatment would be one which could
be applied to an entire field but which would eliminate only the
unwanted plants while leaving the crop plants unharmed. One such
treatment system would involve the use of crop plants which are
tolerant to a herbicide so that when the herbicide was sprayed on a
field of herbicide-tolerant crop plants, the crop plants would
continue to thrive while non-herbicide-tolerant weeds were killed
or severely damaged. Ideally, such treatment systems would take
advantage of varying herbicide properties so that weed control
could provide the best possible combination of flexibility and
economy. For example, individual herbicides have different
longevities in the field, and some herbicides persist and are
effective for a relatively long time after they are applied to a
field while other herbicides are quickly broken down into other
and/or non-active compounds. An ideal treatment system would allow
the use of different herbicides so that growers could tailor the
choice of herbicides for a particular situation.
[0004] Crop tolerance to specific herbicides can be conferred by
engineering genes into crops which encode appropriate herbicide
metabolizing enzymes and/or insensitive herbicide targets. In some
cases these enzymes, and the nucleic acids that encode them,
originate in a plant. In other cases, they are derived from other
organisms, such as microbes. See, e.g., Padgette et al. (1996) "New
weed control opportunities: Development of soybeans with a Roundup
Ready.RTM. gene" and Vasil (1996) "Phosphinothricin-resistant
crops," both in Herbicide-Resistant Crops, ed. Duke (CRC Press,
Boca Raton, Fla.) pp. 54-84 and pp. 85-91. Indeed, transgenic
plants have been engineered to express a variety of herbicide
tolerance genes from a variety of organisms, including a gene
encoding a chimeric protein of rat cytochrome P4507A1 and yeast
NADPH-cytochrome P450 oxidoreductase (Shiota et al. (1994) Plant
Physiol. 106: 17). Other genes that confer tolerance to herbicides
include acetohydroxy acid synthase ("AHAS"), mutations in the
native sequence have been found to confer resistance to multiple
types of herbicides on plants expressing it and has been introduced
into a variety of plants (see, e.g., Hattori et al. (1995) Mol.
Gen. Genet. 246: 419); glutathione reductase and superoxide
dismutase (Aono et al. (1995) Plant Cell Physiol. 36: 1687); and
genes for various phosphotransferases (Datta et al. (1992) Plant
Mol. Biol. 20: 619).
[0005] One herbicide which has been studied extensively is
N-phosphonomethylglycine, commonly referred to as glyphosate.
Glyphosate is a broad spectrum herbicide that kills both broadleaf
and grass-type plants due to inhibition of the enzyme
5-enolpyruvylshikimate-3-phosphate synthase (also referred to as
"EPSP synthase" or "EPSPS"), an enzyme which is part of the
biosynthetic pathway for the production of aromatic amino acids,
hormones, and vitamins. Glyphosate-resistant transgenic plants have
been produced which exhibit a commercially viable level of
glyphosate resistance due to the introduction of a modified
Agrobacterium CP4 EPSPS. This modified enzyme is targeted to the
chloroplast where, even in the presence of glyphosate, it continues
to synthesize EPSP from phosphoenolpyruvic acid ("PEP") and
shikimate-3-phosphate. CP4 glyphosate-resistant soybean transgenic
plants are presently in commercial use (e.g., as sold by Monsanto
under the name "Roundup Ready.RTM.").
[0006] Other herbicides of interest for commercial crop production
include glufosinate (phosphinothricin) and acetolactate synthase
(ALS) chemistry such as the sulfonylurea herbicides. Glufosinate is
a broad spectrum herbicide which acts on the chloroplast glutamate
synthase enzyme. Glufosinate-tolerant transgenic plants have been
produced which carry the bar gene from Streptomyces hygroscopicus.
The enzyme encoded by the bar gene has N-acetylation activity and
modifies and detoxifies glufosinate. Glufosinate-tolerant plants
are presently in commercial use (e.g., as sold by Bayer under the
name "Liberty Link.RTM."). Sulfonylurea herbicides inhibit growth
of higher plants by blocking acetolactate synthase (ALS). Plants
containing particular mutations in ALS are tolerant to the ALS
herbicides including sulfonylureas. Thus, for example, sulfonylurea
herbicides such as Synchrony (a mixture of chlorimuron-ethyl plus
thifensulfuron-methyl) can be used in conjunction with ALS
herbicide-tolerant plants such as the STS.RTM. soybean (Synchrony
tolerant soybean) variety which contains a trait that enhances the
soybean's natural tolerance to soybean sulfonylurea herbicides.
[0007] While a number of herbicide-tolerant crop plants are
presently commercially available, one issue that has arisen for
many commercial herbicides and herbicide/crop combinations is that
individual herbicides typically have incomplete spectrum of
activity against common weed species. For most individual
herbicides which have been in use for some time, populations of
herbicide resistant weed species and biotypes have become more
prevalent (see, e.g., Tranel and Wright (2002) Weed Science 50:
700-712; Owen and Zelaya (2005) Pest Manag. Sci. 61: 301-311).
Transgenic plants which are resistant to more than one herbicide
have been described (see, e.g., WO2005/012515). However,
improvements in every aspect of crop production, weed control
options, extension of residual weed control, and improvement in
crop yield are continuously in demand.
[0008] Particularly, due to local and regional variation in
dominant weed species as well as preferred crop species, a
continuing need exists for customized systems of crop protection
and weed management which can be adapted to the needs of a
particular region, geography, and/or locality. For example, a
continuing need exists for methods of crop protection and weed
management which can reduce: the number of herbicide applications
necessary to control weeds in a field; the amount of herbicide
necessary to control weeds in a field; the amount of tilling
necessary to produce a crop; and/or programs which delay or prevent
the development and/or appearance of herbicide-resistant weeds. A
continuing need exists for methods of crop protection and weed
management which allow the targeted use of particular herbicide
combinations.
SUMMARY OF THE INVENTION
[0009] Methods and compositions relating to improved plants that
are tolerant to more than one herbicide or class or subclass of
herbicides are provided. Compositions include plants that are
tolerant to glyphosate as well as at least one other herbicide or
class or subclass of herbicide, as well as, methods of use thereof.
Additional compositions comprise plants that comprise a
polynucleotide encoding a polypeptide that can confer tolerance to
glyphosate and a polynucleotide encoding an ALS inhibitor-tolerant
polypeptide. In one non-limiting embodiment, compositions comprise
a plant expressing a polynucleotide encoding a GAT
(glyphosate-N-acetyltransferase) polypeptide and are tolerant to at
least one additional herbicide. In some embodiments, a plant of the
invention expresses a GAT polypeptide and an HRA polypeptide.
[0010] Methods for controlling weeds in an area of cultivation
employing the plants of the invention are provided. Further
provided are improved methods of transformation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 provides examples of constructs having 35S enhancer
elements.
[0012] FIG. 2 provides a schematic demonstrating the effect of 35S
enhancers on TX efficiency.
[0013] FIG. 3 provides a schematic demonstrating the effect of 35S
enhancers on T0 efficiency.
[0014] FIG. 4 provides a schematic demonstrating the effect of 35S
enhancers on event copy number.
[0015] FIG. 5 provides a table showing the effect of the 35S
enhancers on T2 efficiency.
[0016] FIG. 6 provides an insecticidal gene evaluation assay.
[0017] FIG. 7 provides a schematic showing the development of a GAT
selection scheme.
[0018] FIG. 8 demonstrates that GAT can be used as a selectable
marker.
[0019] FIG. 9 provides a schematic demonstrating GAT transformation
efficiencies.
DETAILED DESCRIPTION OF THE INVENTION
[0020] The present invention provides methods and compositions for
making and using a plant that is tolerant to more than one
herbicide or class or subclass of herbicide. In some embodiments, a
plant is provided that is tolerant to both glyphosate and at least
one other herbicide (or class or subclass of herbicide) or another
chemical (or class or subclass of another chemical). Such plants
find use, for example, in methods of growing crop plants involving
treatment with multiple herbicides. Thus, the invention provides
improved plants which tolerate treatment with a herbicide or a
combination of herbicides (including a combination of herbicides
which act through different modes of action; i.e., application of
mixtures having 2, 3, 4, or more modes of herbicide action) or a
combination of at least one herbicide and at least one other
chemical, including fungicides, insecticides, plant growth
regulators and the like. In this manner, the invention provides
improved methods of growing crop plants in which weeds are
selectively controlled. In one embodiment, the plants of the
invention comprise a polynucleotide which encodes a polypeptide
that confers tolerance to glyphosate and a polynucleotide encoding
an ALS inhibitor-tolerant polypeptide. As discussed in further
detail below, such plants are referred to herein as "glyphosate/ALS
inhibitor-tolerant plants."
[0021] The plants of the invention display a modified tolerance to
herbicides and therefore allow for the application of herbicides at
rates that would significantly damage plants and further allow for
the application of mixtures of herbicides at lower concentrations
than normally applied but which still continue to selectively
control weeds. In addition, the glyphosate/ALS inhibitor-tolerant
plants of the invention can be used in combination with herbicide
blends technology and thereby make the application of chemical
pesticides more convenient, economical, and effective for the
producer. In the case of the glyphosate/ALS inhibitor-tolerant
crops, the blends technology will provide easily formulated crop
protection products, of ALS herbicides for example, in a dry
granule form that enables delivery of customized mixtures designed
to solve specific problems in conjunction with the glyphosate/ALS
inhibitor-tolerant crop of the invention. With the addition of
robust ALS tolerance afforded by the plants of the invention, the
utility of ALS herbicides is further enabled whereby herbicidal
crop response is eliminated. These uniquely selective herbicide
offerings coupled with glyphosate/ALS inhibitor tolerate crops
disclosed herein can now be designed and customized to meet
ever-changing weed control needs. This breakthrough now enables a
myriad of herbicide blends, including for example ALS inhibitor
blends, that can be customized for improved weed management (since
ALS inhibitor chemistries have different herbicidal attributes)
including increased weed spectrum, the ability to provide specified
residual activity, a second mode of action to combat or delay weed
resistance (complementing glyphosate, glufosinate or the like), as
well as, new offerings that can be designed either or both as
pre-emergence or post-emergence. Blends also afford the ability to
add or tank mix other agrochemicals at normal, labeled use rates
such as additional herbicides with a 3.sup.rd or 4.sup.th mechanism
of action, to fill spectrum holes or even the ability to include
fungicides, insecticides, plant growth regulators and the like
thereby saving costs associated with additional applications. As
discussed in further detail below, the methods of the invention can
be customized for a particular location or region. Improved methods
of transformation are also provided.
I. Glyphosate/ALS Inhibitor-Tolerant Plants
[0022] a. Glyphosate Tolerance
[0023] Plants are provided which comprise a polynucleotide which
encodes a polypeptide that confers tolerance to glyphosate and a
polynucleotide encoding an ALS inhibitor-tolerant polypeptide.
Various sequences which confer tolerance to glyphosate can be
employed in the methods and compositions of the invention.
[0024] In one embodiment, the mechanism of glyphosate resistance is
provided by the expression of a polynucleotide having transferase
activity. As used herein, a "transferase" polypeptide has the
ability to transfer the acetyl group from acetyl CoA to the N of
glyphosate, transfer the propionyl group of propionyl CoA to the N
of glyphosate, or to catalyze the acetylation of glyphosate analogs
and/or glyphosate metabolites, e.g., aminomethylphosphonic acid.
Methods to assay for this activity are disclosed, for example, in
U.S. Publication No. 2003/0083480, U.S. Publication No.
2004/0082770, and U.S. application Ser. No. 10/835,615, filed Apr.
29, 2004, WO2005/012515, WO2002/36782 and WO2003/092360. In one
embodiment, the transferase polypeptide comprises a
glyphosate-N-acetyltransferase "GAT" polypeptide.
[0025] As used herein, a GAT polypeptide or enzyme comprises a
polypeptide which has glyphosate-N-acetyltransferase activity
("GAT" activity), i.e., the ability to catalyze the acetylation of
glyphosate. In specific embodiments, a polypeptide having
glyphosate-N-acetyltransferase activity can transfer the acetyl
group from acetyl CoA to the N of glyphosate. In addition, some GAT
polypeptides transfer the propionyl group of propionyl CoA to the N
of glyphosate. Some GAT polypeptides are also capable of catalyzing
the acetylation of glyphosate analogs and/or glyphosate
metabolites, e.g., aminomethylphosphonic acid. GAT polypeptides are
characterized by their structural similarity to one another, e.g.,
in terms of sequence similarity when the GAT polypeptides are
aligned with one another. Exemplary GAT polypeptides and the
polynucleotides encoding them are known in the art and particularly
disclosed, for example, in U.S. application Ser. No. 10/004,357,
filed Oct. 29, 2001, U.S. application Ser. No. 10/427,692, filed
Apr. 30, 2003, and U.S. application Ser. No. 10/835,615, filed Apr.
29, 2004, each of which is herein incorporated by reference in its
entirety. In some embodiments, GAT polypeptides used in creating
plants of the invention comprise the amino acid sequence set forth
in: SEQ ID NO: 5, 14, 11, 8, 21, 27, 17, 24, 30, 35, 46, 47, 48,
49, 50, 51, 52, 53, 39, 42, 45, or 54. Each of these sequences is
also disclosed in U.S. application Ser. No. 10/835,615, filed Apr.
29, 2004. In some embodiments, the corresponding GAT
polynucleotides that encode these polypeptides are used; these
polynucleotide sequences are set forth in SEQ ID NO: 3, 12, 9, 6,
19, 15, 25, 22, 28, 33, 4, 7, 10, 13, 16, 18, 20, 23, 26, 29, 32,
34, 36, 38, 41, 44, 43, 56, 31, 37, 40, 57, 58, 59, 60, 61, 62, 63,
or 64. Each of these sequences is also disclosed in U.S.
application Ser. No. 10/835,615, filed Apr. 29, 2004. As discussed
in further detail elsewhere herein, the use of fragments and
variants of GAT polynucleotides and other known herbicide-tolerance
polynucleotides and polypeptides encoded thereby is also
encompassed by the present invention.
[0026] In specific embodiments, the glyphosate/ALS
inhibitor-tolerant plants of the invention express a GAT
polypeptide, i.e., a polypeptide having
glyphosate-N-acetyltransferase activity wherein the acetyl group
from acetyl CoA is transferred to the N of glyphosate. Thus, plants
of the invention that have been treated with glyphosate contain the
glyphosate metabolite N-acetylglyphosate ("NAG"). Thus, the
invention also provides plants that contain NAG as well as a method
for producing NAG by treating plants that contain a GAT gene (i.e.,
that express a GAT polypeptide) with glyphosate. The presence of
N-acetylglyphosate can serve as a diagnostic marker for the
presence of an active GAT gene in a plant and can be evaluated by
methods known in the art, for example, by mass spectrometry or by
immunoassay. Generally, the level of NAG in a plant containing a
GAT gene that has been treated with glyphosate is correlated with
the activity of the GAT gene and the amount of glyphosate with
which the plant has been treated.
[0027] The plants of the invention can comprise multiple GAT
polynucleotides (i.e., at least 1, 2, 3, 4, 5, 6 or more). It is
recognized that if multiple GAT polynucleotides are employed, the
GAT polynucleotides may encode GAT polypeptides having different
kinetic parameters, i.e., a GAT variant having a lower K.sub.m can
be combined with one having a higher k.sub.cat. In some
embodiments, the different polynucleotides may be coupled to a
chloroplast transit sequence or other signal sequence thereby
providing polypeptide expression in different cellular
compartments, organelles or secretion of one or more of the
polypeptides.
[0028] The GAT polypeptide encoded by a GAT polynucleotide may have
improved enzymatic activity in comparison to previously identified
enzymes. Enzymatic activity can be characterized using the
conventional kinetic parameters k.sub.cat, K.sub.M, and
k.sub.cat/K.sub.M. k.sub.cat can be thought of as a measure of the
rate of acetylation, particularly at high substrate concentrations;
K.sub.M is a measure of the affinity of the GAT enzyme for its
substrates (e.g., acetyl CoA, propionyl CoA and glyphosate); and
k.sub.cat/K.sub.M is a measure of catalytic efficiency that takes
both substrate affinity and catalytic rate into account.
k.sub.cat/K.sub.m is particularly important in the situation where
the concentration of a substrate is at least partially
rate-limiting. In general, a GAT with a higher k.sub.cat or
k.sub.cat/K.sub.M is a more efficient catalyst than another GAT
with lower k.sub.cat or k.sub.cat/K.sub.M. A GAT with a lower
K.sub.M is a more efficient catalyst than another GAT with a higher
K.sub.M. Thus, to determine whether one GAT is more effective than
another, one can compare kinetic parameters for the two enzymes.
The relative importance of k.sub.cat, k.sub.cat/K.sub.M and K.sub.M
will vary depending upon the context in which the GAT will be
expected to function, e.g., the anticipated effective concentration
of glyphosate relative to the K.sub.M for glyphosate. GAT activity
can also be characterized in terms of any of a number of functional
characteristics, including but not limited to stability,
susceptibility to inhibition, or activation by other molecules.
[0029] Thus, for example, the GAT polypeptide may have a lower
K.sub.M for glyphosate than previously identified enzymes, for
example, less than 1 mM, 0.9 mM, 0.8 mM, 0.7 mM, 0.6 mM, 0.5 mM,
0.4 mM, 0.3 mM, 0.2 mM, 0.1 mM, 0.05 mM, or less. The GAT
polypeptide may have a higher k.sub.cat for glyphosate than
previously identified enzymes, for example, a k.sub.cat of at least
500 min.sup.-1, 1000 min.sup.-1, 1100 min.sup.-1, 1200 min.sup.-1,
1250 min.sup.-1, 1300 min.sup.-1, 1400 min.sup.-1, 1500 min.sup.-1,
1600 min.sup.-1, 1700 min.sup.-1, 1800 min.sup.-1, 1900 min.sup.-1,
or 2000 min.sup.-1 or higher. GAT polypeptides for use in the
invention may have a higher k.sub.cat/K.sub.M for glyphosate than
previously identified enzymes, for example, a k.sub.cat/K.sub.M of
at least 1000 mM.sup.-1 min.sup.-1, 2000 mM.sup.-1 min.sup.-1, 3000
mM.sup.-1 min.sup.-1, 4000 mM.sup.-1 min.sup.-1, 5000 mM.sup.-1
min.sup.-1, 6000 mM.sup.-1 min.sup.-1, 7000 mM.sup.-1 min.sup.-1,
or 8000 mM.sup.-1 min.sup.-1, or higher. The activity of GAT
enzymes is affected by, for example, pH and salt concentration;
appropriate assay methods and conditions are known in the art (see,
e.g., WO2005012515). Such improved enzymes may find particular use
in methods of growing a crop in a field where the use of a
particular herbicide or combination of herbicides and/or other
agricultural chemicals would result in damage to the plant if the
enzymatic activity (i.e., k.sub.cat, K.sub.M, or k.sub.cat/K.sub.M)
were lower.
[0030] Glyphosate-tolerant plants can also be produced by modifying
the plant to increase the capacity to produce a higher level of
5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) as more fully
described in U.S. Pat. Nos. 6,248,876; 5,627,061; 5,804,425;
5,633,435; 5,145,783; 4,971,908; 5,312,910; 5,188,642; 4,940,835;
5,866,775; 6,225,114; 6,130,366; 5,310,667; 4,535,060; 4,769,061;
5,633,448; 5,510,471; Re. 36,449; RE 37,287 E; and 5,491,288; and
international publications WO 97/04103; WO 00/66746; WO 01/66704;
and WO 00/66747, which are incorporated herein by reference in
their entireties for all purposes. Glyphosate resistance can also
be imparted to plants that express a gene that encodes a glyphosate
oxido-reductase enzyme as described more fully in U.S. Pat. Nos.
5,776,760 and 5,463,175, which are incorporated herein by reference
in their entireties for all purposes. Additionally, glyphosate
tolerant plants can be generated through the selection of naturally
occurring mutations that impart tolerance to glyphosate.
[0031] It is recognized that the methods and compositions of the
invention can employ any combination of sequences (i.e., sequences
that act via the same or different modes) that confer tolerance to
glyphosate known in the art to produce plants and plant explants
with superior glyphosate resistance.
[0032] b. Acetolactate Synthase (ALS) Inhibitor Tolerance
[0033] Glyphosate/ALS inhibitor-tolerant plants are provided which
comprise a polynucleotide which encodes a polypeptide that confers
tolerance to glyphosate and further comprise a polynucleotide
encoding an acetolactate synthase (ALS) inhibitor-tolerant
polypeptide. As used herein, an "ALS inhibitor-tolerant
polypeptide" comprises any polypeptide which when expressed in a
plant confers tolerance to at least one ALS inhibitor. A variety of
ALS inhibitors are known and include, for example, sulfonylurea,
imidazolinone, triazolopyrimidines, pryimidinyoxy(thio)benzoates,
and/or sulfonylaminocarbonyltriazolinone herbicide. Additional ALS
inhibitors are known and are disclosed elsewhere herein. It is
known in the art that ALS mutations fall into different classes
with regard to tolerance to sulfonylureas, imidazolinones,
triazolopyrimidines, and pyrimidinyl(thio)benzoates, including
mutations having the following characteristics: (1) broad tolerance
to all four of these groups; (2) tolerance to imidazolinones and
pyrimidinyl(thio)benzoates; (3) tolerance to sulfonylureas and
triazolopyrimidines; and (4) tolerance to sulfonylureas and
imidazolinones.
[0034] Various ALS inhibitor-tolerant polypeptides can be employed.
In some embodiments, the ALS inhibitor-tolerant polynucleotides
contain at least one nucleotide mutation resulting in one amino
acid change in the ALS polypeptide. In specific embodiments, the
change occurs in one of seven substantially conserved regions of
acetolactate synthase. See, for example, Hattori et al. (1995)
Molecular Genetics and Genomes 246:419-425; Lee et al. (1998) EMBO
Journal 7:1241-1248; Mazur et al. (1989) Ann. Rev. Plant Phys.
40:441-470; and U.S. Pat. No. 5,605,011, each of which is
incorporated by reference in their entirety. The ALS
inhibitor-tolerant polypeptide can be encoded by, for example, the
SuRA or SuRB locus of ALS. In specific embodiments, the ALS
inhibitor-tolerant polypeptide comprises the C3 ALS mutant, the HRA
ALS mutant, the S4 mutant or the S4/HRA mutant or any combination
thereof. Different mutations in ALS are known to confer tolerance
to different herbicides and groups (and/or subgroups) of
herbicides; see, e.g., Tranel and Wright (2002) Weed Science
50:700-712. See also, U.S. Pat. Nos. 5,605,011, 5,378,824,
5,141,870, and 5,013,659, each of which is herein incorporated by
reference in their entirety. See also, SEQ ID NO:65 comprising a
soybean HRA sequence; SEQ ID NO:66 comprising a maize HRA sequence;
SEQ ID NO:67 comprising an Arabidopsis HRA sequence; and SEQ ID
NO:86 comprising an HRA sequence used in cotton. The HRA mutation
in ALS finds particular use in one embodiment of the invention. The
mutation results in the production of an acetolactate synthase
polypeptide which is resistant to at least one ALS inhibitor
chemistry in comparison to the wild-type protein. For example, a
plant expressing an ALS inhibitor-tolerant polypeptide may be
tolerant of a dose of sulfonylurea, imidazolinone,
triazolopyrimidines, pyrimidinyloxy(thio)benzoates, and/or
sulfonylaminocarbonyltriazolinone herbicide that is at least 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 70, 80, 100, 125,
150, 200, 500, or 1000 times higher than a dose of the herbicide
that would cause damage to an appropriate control plant. In some
embodiments, an ALS inhibitor-tolerant polypeptide comprises a
number of mutations. Additionally, plants having an ALS inhibitor
polypeptide can be generated through the selection of naturally
occurring mutations that impart tolerance to glyphosate.
[0035] In some embodiments, the ALS inhibitor-tolerant polypeptide
confers tolerance to sulfonylurea and imidazolinone herbicides.
Sulfonylurea and imidazolinone herbicides inhibit growth of higher
plants by blocking acetolactate synthase (ALS), also known as,
acetohydroxy acid synthase (AHAS). For example, plants containing
particular mutations in ALS (e.g., the S4 and/or HRA mutations) are
tolerant to sulfonylurea herbicides. The production of
sulfonylurea-tolerant plants and imidazolinone-tolerant plants is
described more fully in U.S. Pat. Nos. 5,605,011; 5,013,659;
5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373; 5,331,107;
5,928,937; and 5,378,824; and international publication WO
96/33270, which are incorporated herein by reference in their
entireties for all purposes. In specific embodiments, the ALS
inhibitor-tolerant polypeptide comprises a sulfonamide-tolerant
acetolactate synthase (otherwise known as a sulfonamide-tolerant
acetohydroxy acid synthase) or an imidazolinone-tolerant
acetolactate synthase (otherwise known as an imidazolinone-tolerant
acetohydroxy acid synthase).
[0036] A plant of the invention that comprises at least one
sequence which confers tolerance to glyphosate and at least one
sequence which confers tolerance to an ALS inhibitor is referred to
herein as a "glyphosate/ALS inhibitor-tolerant plant." A plant of
the invention that contains at least one GAT polypeptide and at
least one HRA polypeptide is referred to herein as a "GAT-HRA
plant."
[0037] c. Additional Herbicide Tolerance
[0038] In some embodiments, plants are provided having enhanced
tolerance to glyphosate and at least one ALS inhibitor herbicide,
as well as, tolerance to at least one additional herbicide. In
specific embodiments, tolerance to the additional herbicide is due
to the expression of at least one polypeptide imparting tolerance
to the additional herbicide. In some embodiments, a composition of
the invention (e.g., a plant) may comprise two, three, four, five,
six, seven, or more traits which confer tolerance to at least one
herbicide, so that a plant of the invention may be tolerant to at
least two, three, four, five, six, or seven or more different types
of herbicides. Thus, a plant of the invention that is tolerant to
more than two different herbicides may be tolerant to herbicides
that have different modes of action and/or different sites of
action. In some embodiments, all of these traits are transgenic
traits, while in other embodiments, at least one of these traits is
not transgenic.
[0039] In some of these embodiments, each herbicide tolerance gene
confers tolerance to a different herbicide or class or subclass of
herbicides. In some of these embodiments, at least two of the
herbicide tolerance genes confer tolerance to the same herbicide or
to members of the same class or subclass of herbicides.
Accordingly, further provided are plants having a polynucleotide
that encodes a polypeptide which can confer tolerance to glyphosate
and a polynucleotide that encodes an ALS inhibitor-tolerant
polypeptide can further comprise at least one additional
herbicide-tolerance polynucleotide which when expressed imparts
tolerance to an additional herbicide. Such additional herbicides,
include but are not limited to, an acetyl Co-A carboxylase
inhibitor such as quizalofop-P-ethyl, a synthetic auxin such as
quinclorac, a protoporphyrinogen oxidase (PPO) inhibitor herbicide
(such as sulfentrazone), a pigment synthesis inhibitor herbicide
such as a hydroxyphenylpyruvate dioxygenase inhibitor (e.g.,
mesotrione or sulcotrione), a phosphinothricin acetyltransferase or
a phytoene desaturase inhibitor like diflufenican or pigment
synthesis inhibitor. It is understood that the invention is not
bound by the mechanism of action of a herbicide, so long as the
goal of the invention (i.e., herbicide tolerance to glyphosate and
at least on ALS inhibitor) is achieved. Additional herbicides of
interest are disclosed elsewhere herein.
[0040] In some embodiments, the compositions of the invention
further comprise polypeptides conferring tolerance to herbicides
which inhibit the enzyme glutamine synthase, such as
phosphinothricin or glufosinate (e.g., the bar gene or pat gene).
Glutamine synthetase (GS) appears to be an essential enzyme
necessary for the development and life of most plant cells, and
inhibitors of GS are toxic to plant cells. Glufosinate herbicides
have been developed based on the toxic effect due to the inhibition
of GS in plants. These herbicides are non-selective; that is, they
inhibit growth of all the different species of plants present. The
development of plants containing an exogenous phosphinothricin
acetyltransferase is described in U.S. Pat. Nos. 5,969,213;
5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477;
5,646,024; 6,177,616; and 5,879,903, which are incorporated herein
by reference in their entireties for all purposes. Mutated
phosphinothricin acetyltransferase having this activity are also
disclosed.
[0041] In still other embodiments, the compositions of the
invention further comprise polypeptides conferring tolerance to
herbicides which inhibit protox (protoporphyrinogen oxidase).
Protox is necessary for the production of chlorophyll, which is
necessary for all plant survival. The protox enzyme serves as the
target for a variety of herbicidal compounds. These herbicides also
inhibit growth of all the different species of plants present. The
development of plants containing altered protox activity which are
resistant to these herbicides are described in U.S. Pat. Nos.
6,288,306; 6,282,837; and 5,767,373; and international publication
WO 01/12825, which are incorporated herein by reference in their
entireties for all purposes.
[0042] In still other embodiments, compositions of the invention
may comprise polypeptides involving other modes of herbicide
resistance. For example, hydroxyphenylpyruvatedioxygenases are
enzymes that catalyze the reaction in which
para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate.
Molecules which inhibit this enzyme and which bind to the enzyme in
order to inhibit transformation of the HPP into homogentisate are
useful as herbicides. Plants more resistant to certain herbicides
are described in U.S. Pat. Nos. 6,245,968; 6,268,549; and
6,069,115; and international publication WO 99/23886, which are
incorporated herein by reference in their entireties for all
purposes. Mutated hydroxyphenylpyruvatedioxygenase having this
activity are also disclosed.
[0043] d. Fragments and Variants of Sequences that Confer Herbicide
Tolerance
[0044] Depending on the context, "fragment" refers to a portion of
the polynucleotide or a portion of the amino acid sequence and
hence protein encoded thereby. Fragments of a polynucleotide may
encode protein fragments that retain the biological activity of the
original protein and hence confer tolerance to a herbicide. Thus,
fragments of a nucleotide sequence may range from at least about 20
nucleotides, about 50 nucleotides, about 100 nucleotides, and up to
the full-length polynucleotide encoding a herbicide-tolerance
polypeptide.
[0045] A fragment of a herbicide-tolerance polynucleotide that
encodes a biologically active portion of a herbicide-tolerance
polypeptide will encode at least 15, 25, 30, 50, 100, 150, 200, or
250 contiguous amino acids, or up to the total number of amino
acids present in a full-length herbicide-tolerance polypeptide. A
biologically active portion of a herbicide-tolerance polypeptide
can be prepared by isolating a portion of a herbicide-tolerance
polynucleotide, expressing the encoded portion of the
herbicide-tolerance polypeptide (e.g., by recombinant expression in
vitro), and assessing the activity of the encoded portion of the
herbicide-tolerance polypeptide. Polynucleotides that are fragments
of a herbicide-tolerance polynucleotide comprise at least 16, 20,
50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650,
700, 800, 900, 1,000, 1,100, 1,200, 1,300, or 1,400 contiguous
nucleotides, or up to the number of nucleotides present in a
full-length herbicide-tolerance polynucleotide.
[0046] The term "variants" refers to substantially similar
sequences. For polynucleotides, a variant comprises a
polynucleotide having deletions (i.e., truncations) at the 5'
and/or 3' end; deletion and/or addition of one or more nucleotides
at one or more internal sites in the native polynucleotide; and/or
substitution of one or more nucleotides at one or more sites in the
native polynucleotide. As used herein, a "native" polynucleotide or
polypeptide comprises a naturally-occurring nucleotide sequence or
amino acid sequence, respectively. For polynucleotides,
conservative variants include those sequences that, because of the
degeneracy of the genetic code, encode the amino acid sequence of a
herbicide-tolerance polypeptide. Naturally occurring allelic
variants such as these can be identified with the use of well-known
molecular biology techniques, as, for example, with polymerase
chain reaction (PCR) and hybridization techniques. Variant
polynucleotides also include synthetically derived polynucleotides,
such as those generated, for example, by using site-directed
mutagenesis or "shuffling." Generally, variants of a particular
polynucleotide have at least about 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or more sequence identity to that particular polynucleotide as
determined by sequence alignment programs and parameters as
described elsewhere herein.
[0047] Variants of a particular polynucleotide (i.e., the reference
polynucleotide) can also be evaluated by comparison of the percent
sequence identity between the polypeptide encoded by a variant
polynucleotide and the polypeptide encoded by the reference
polynucleotide. Percent sequence identity between any two
polypeptides can be calculated using sequence alignment programs
and parameters described elsewhere herein. Where any given pair of
polynucleotides of the invention is evaluated by comparison of the
percent sequence identity shared by the two polypeptides they
encode, the percent sequence identity between the two encoded
polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or
more sequence identity.
[0048] "Variant" protein is intended to mean a protein derived from
a native and/or original protein by deletion (so-called truncation)
of one or more amino acids at the N-terminal and/or C-terminal end
of the protein; deletion and/or addition of one or more amino acids
at one or more internal sites in the protein; or substitution of
one or more amino acids at one or more sites in the protein.
Variant proteins encompassed by the present invention are
biologically active, that is they continue to possess the desired
herbicide-tolerance activity as described herein. Biologically
active variants of a herbicide-tolerance polypeptide of the
invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or more sequence identity to the amino acid sequence for the
native protein as determined by sequence alignment programs and
parameters described elsewhere herein. A biologically active
variant of a herbicide-tolerance polypeptide may differ from that
polypeptide by as few as 1-15 amino acid residues, as few as 1-10,
such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid
residue. Variant herbicide-tolerance polypeptides, as well as
polynucleotides encoding these variants, are known in the art.
[0049] Herbicide-tolerance polypeptides may be altered in various
ways including amino acid substitutions, deletions, truncations,
and insertions. Methods for such manipulations are generally known
in the art. For example, amino acid sequence variants and fragments
of herbicide-tolerance polypeptides can be prepared by mutations in
the encoding polynucleotide. Methods for mutagenesis and
polynucleotide alterations are well known in the art. See, for
example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-492;
Kunkel et al. (1987) Methods in Enzymol. 154: 367-382; U.S. Pat.
No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in
Molecular Biology (MacMillan Publishing Company, New York) and the
references cited therein. Guidance as to amino acid substitutions
that do not affect biological activity of the protein of interest
may be found in the model of Dayhoff et al. (1978) Atlas of protein
Sequence and Structure (Natl. Biomed. Res. Found., Washington,
D.C.), herein incorporated by reference. Conservative
substitutions, such as exchanging one amino acid with another
having similar properties, may be made. One skilled in the art will
appreciate that the activity of a herbicide-tolerance polypeptide
can be evaluated by routine screening assays. That is, the activity
can be evaluated by determining whether a transgenic plant has an
increased tolerance to a herbicide, for example, as illustrated in
working Example 1, or with an in vitro assay, such as the
production of N-acetylglyphosphate from glyphosate by a GAT
polypeptide (see, e.g., WO 02/36782).
[0050] Variant polynucleotides and polypeptides also encompass
sequences and proteins derived from a mutagenic and recombinogenic
procedure such as DNA shuffling. With such a procedure, one or more
different herbicide-tolerance polypeptide coding sequences can be
manipulated to create a new herbicide-tolerance polypeptide
possessing the desired properties. In this manner, libraries of
recombinant polynucleotides are generated from a population of
related sequence polynucleotides comprising sequence regions that
have substantial sequence identity and can be homologously
recombined in vitro or in vivo. For example, using this approach,
sequence motifs encoding a domain of interest may be shuffled
between a herbicide-tolerance polypeptide and other known genes to
obtain a new gene coding for a protein with an improved property of
interest, such as an increased K.sub.m in the case of an enzyme.
Strategies for such DNA shuffling are known in the art. See, for
example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10751;
Stemmer (1994) Nature 370: 389-391; Crameri et al. (1997) Nature
Biotech. 15: 436-438; Moore et al. (1997) J. Mol. Biol. 272:
336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:
4504-4509; Crameri et al. (1998) Nature 391: 288-291; and U.S. Pat.
Nos. 5,605,793 and 5,837,458.
[0051] The following terms are used to describe the sequence
relationships between two or more polynucleotides or polypeptides:
(a) "reference sequence", (b) "comparison window", (c) "sequence
identity", and, (d) "percentage of sequence identity."
[0052] (a) As used herein, "reference sequence" is a defined
sequence used as a basis for sequence comparison. A reference
sequence may be a subset or the entirety of a specified sequence;
for example, as a segment of a full-length cDNA or gene sequence,
or the complete cDNA or gene sequence.
[0053] (b) As used herein, "comparison window" makes reference to a
contiguous and specified segment of a polynucleotide sequence,
wherein the polynucleotide sequence in the comparison window may
comprise additions or deletions (i.e., gaps) compared to the
reference sequence (which does not comprise additions or deletions)
for optimal alignment of the two polynucleotides. Generally, the
comparison window is at least 20 contiguous nucleotides in length,
and optionally can be 30, 40, 50, 100, or longer. Those of skill in
the art understand that to avoid a high similarity to a reference
sequence due to inclusion of gaps in the polynucleotide sequence a
gap penalty is typically introduced and is subtracted from the
number of matches.
[0054] Methods of alignment of sequences for comparison are well
known in the art. Thus, the determination of percent sequence
identity between any two sequences can be accomplished using a
mathematical algorithm. Non-limiting examples of such mathematical
algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:
11-17; the local alignment algorithm of Smith et al. (1981) Adv.
Appl. Math. 2:482; the global alignment algorithm of Needleman and
Wunsch (1970) J. Mol. Biol. 48: 443-453; the search-for-local
alignment method of Pearson and Lipman (1988) Proc. Natl. Acad.
Sci. 85: 2444-2448; the algorithm of Karlin and Altschul (1990)
Proc. Natl. Acad. Sci. USA 87: 2264-2268, modified as in Karlin and
Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877.
[0055] Computer implementations of these mathematical algorithms
can be utilized for comparison of sequences to determine sequence
identity. Such implementations include, but are not limited to:
CLUSTAL in the PC/Gene program (available from Intelligenetics,
Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP,
BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics
Software Package, Version 10 (available from Accelrys Inc., 9685
Scranton Road, San Diego, Calif., USA). Alignments using these
programs can be performed using the default parameters. The CLUSTAL
program is well described by Higgins et al. (1988) Gene 73: 237-244
(1988); Higgins et al. (1989) CABIOS 5: 151-153; Corpet et al.
(1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS
8: 155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24: 307-331.
The ALIGN program is based on the algorithm of Myers and Miller
(1988) supra. A PAM120 weight residue table, a gap length penalty
of 12, and a gap penalty of 4 can be used with the ALIGN program
when comparing amino acid sequences. The BLAST programs of Altschul
et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of
Karlin and Altschul (1990) supra. BLAST nucleotide searches can be
performed with the BLASTN program, score=100, wordlength=12, to
obtain nucleotide sequences homologous to a nucleotide sequence
encoding a protein of the invention. BLAST protein searches can be
performed with the BLASTX program, score=50, wordlength=3, to
obtain amino acid sequences homologous to a protein or polypeptide
of the invention. To obtain gapped alignments for comparison
purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described
in Altschul et al. (1997) Nucleic Acids Res. 25:3389.
Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an
iterated search that detects distant relationships between
molecules. See Altschul et al. (1997) supra. When utilizing BLAST,
Gapped BLAST, PSI-BLAST, the default parameters of the respective
programs (e.g., BLASTN for nucleotide sequences, BLASTX for
proteins) can be used. BLAST software is publicly available on the
NCBI website. Alignment may also be performed manually by
inspection.
[0056] Unless otherwise stated, sequence identity/similarity values
provided herein refer to the value obtained using GAP Version 10
using the following parameters: % identity and % similarity for a
nucleotide sequence using GAP Weight of 50 and Length Weight of 3,
and the nwsgapdna.cmp scoring matrix; % identity and % similarity
for an amino acid sequence using GAP Weight of 8 and Length Weight
of 2, and the BLOSUM62 scoring matrix; or any equivalent program
thereof. By "equivalent program" is intended any sequence
comparison program that, for any two sequences in question,
generates an alignment having identical nucleotide or amino acid
residue matches and an identical percent sequence identity when
compared to the corresponding alignment generated by GAP Version
10.
[0057] GAP uses the algorithm of Needleman and Wunsch (1970) J.
Mol. Biol. 48: 443-453, to find the alignment of two complete
sequences that maximizes the number of matches and minimizes the
number of gaps. GAP considers all possible alignments and gap
positions and creates the alignment with the largest number of
matched bases and the fewest gaps. It allows for the provision of a
gap creation penalty and a gap extension penalty in units of
matched bases. GAP must make a profit of gap creation penalty
number of matches for each gap it inserts. If a gap extension
penalty greater than zero is chosen, GAP must, in addition, make a
profit for each gap inserted of the length of the gap times the gap
extension penalty. Default gap creation penalty values and gap
extension penalty values in Version 10 of the GCG Wisconsin
Genetics Software Package for protein sequences are 8 and 2,
respectively. For nucleotide sequences the default gap creation
penalty is 50 while the default gap extension penalty is 3. The gap
creation and gap extension penalties can be expressed as an integer
selected from the group of integers consisting of from 0 to 200.
Thus, for example, the gap creation and gap extension penalties can
be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 55, 60, 65 or greater.
[0058] GAP presents one member of the family of best alignments.
There may be many members of this family, but no other member has a
better quality. GAP displays four figures of merit for alignments:
Quality, Ratio, Identity, and Similarity. The Quality is the metric
maximized in order to align the sequences. Ratio is the quality
divided by the number of bases in the shorter segment. Percent
Identity is the percent of the symbols that actually match. Percent
Similarity is the percent of the symbols that are similar. Symbols
that are across from gaps are ignored. A similarity is scored when
the scoring matrix value for a pair of symbols is greater than or
equal to 0.50, the similarity threshold. The scoring matrix used in
Version 10 of the GCG Wisconsin Genetics Software Package is
BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci.
USA 89: 10915).
[0059] (c) As used herein, "sequence identity" or "identity" in the
context of two polynucleotides or polypeptide sequences makes
reference to the residues in the two sequences that are the same
when aligned for maximum correspondence over a specified comparison
window. When percentage of sequence identity is used in reference
to proteins it is recognized that residue positions which are not
identical often differ by conservative amino acid substitutions,
where amino acid residues are substituted for other amino acid
residues with similar chemical properties (e.g., charge or
hydrophobicity) and therefore do not change the functional
properties of the molecule. When sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said
to have "sequence similarity" or "similarity". Means for making
this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., as implemented in the program
PC/GENE (Intelligenetics, Mountain View, Calif.).
[0060] (d) As used herein, "percentage of sequence identity" means
the value determined by comparing two optimally aligned sequences
over a comparison window, wherein the portion of the polynucleotide
sequence in the comparison window may comprise additions or
deletions (i.e., gaps) as compared to the reference sequence (which
does not comprise additions or deletions) for optimal alignment of
the two sequences. The percentage is calculated by determining the
number of positions at which the identical nucleic acid base or
amino acid residue occurs in both sequences to yield the number of
matched positions, dividing the number of matched positions by the
total number of positions in the window of comparison, and
multiplying the result by 100 to yield the percentage of sequence
identity.
[0061] The use of the term "polynucleotide" is not intended to be
limited to polynucleotides comprising DNA. Those of ordinary skill
in the art will recognize that polynucleotides can comprise
ribonucleotides and combinations of ribonucleotides and
deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides
include both naturally occurring molecules and synthetic analogues.
Thus, polynucleotides also encompass all forms of sequences
including, but not limited to, single-stranded forms,
double-stranded forms, hairpins, stem-and-loop structures, and the
like.
[0062] e. Herbicide Tolerance
[0063] A "herbicide" is a chemical that causes temporary or
permanent injury to a plant. Non-limiting examples of herbicides
that can be employed in the various methods and compositions of the
invention are discussed in further detail elsewhere herein. A
herbicide may be incorporated into the plant, or it may act on the
plant without being incorporated into the plant or its cells. An
"active ingredient" is the chemical in a herbicide formulation
primarily responsible for its phytotoxicity and which is identified
as the active ingredient on the product label. Product label
information is available from the U.S. Environmental Protection
Agency and is updated online at the url
oaspub.epa.gov/pestlabl/ppls.own; product label information is also
available online at the url www.cdms.net. The term "acid
equivalent" expresses the rate or quantity as the herbicidally
active parent acid. For example, 2,4-D acid is often formulated in
the form of a sodium or amine salt or an ester as the active
ingredient in formulated products. The active acid equivalent per
gallon of a widely used ester formulation is 3.8 lb a.e./gallon
(about 0.454 kg a.e./L), while the active ingredient per gallon is
6.0 lb ai/gallon (about 0.717 kg ai/L). As used herein, an
"agricultural chemical" is any chemical used in the context of
agriculture.
[0064] "Herbicide-tolerant" or "tolerant" or "crop tolerance" in
the context of herbicide or other chemical treatment as used herein
means that a plant or other organism treated with a particular
herbicide or class or subclass of herbicide or other chemical or
class or subclass of other chemical will show no significant damage
or less damage following that treatment in comparison to an
appropriate control plant. A plant may be naturally tolerant to a
particular herbicide or chemical, or a plant may be
herbicide-tolerant as a result of human intervention such as, for
example, breeding or genetic engineering. An "herbicide-tolerance
polypeptide" is a polypeptide that confers herbicide tolerance on a
plant or other organism expressing it (i.e., that makes a plant or
other organism herbicide-tolerant), and an "herbicide-tolerance
polynucleotide" is a polynucleotide that encodes a
herbicide-tolerance polypeptide. For example, a sulfonylurea
tolerant polypeptide is one that confers tolerance to sulfonylurea
herbicides on a plant or other organism that expresses it, an
imidazolinone tolerant polypeptide is one that confers tolerance to
imidazolinone herbicides on a plant or other organism that
expresses it; and a glyphosate tolerant polypeptide is one that
confers tolerance to glyphosate on a plant or other organism that
expresses it.
[0065] Thus, a plant is tolerant to a herbicide or other chemical
if it shows damage in comparison to an appropriate control plant
that is less than the damage exhibited by the control plant by at
least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 400%, 500%,
600%, 700%, 800%, 900%, or 1000% or more. In this manner, a plant
that is tolerant to a herbicide or other chemical shows "improved
tolerance" in comparison to an appropriate control plant. Damage
resulting from herbicide or other chemical treatment is assessed by
evaluating any parameter of plant growth or well-being deemed
suitable by one of skill in the art. Damage can be assessed by
visual inspection and/or by statistical analysis of suitable
parameters of individual plants or of a group of plants. Thus,
damage may be assessed by evaluating, for example, parameters such
as plant height, plant weight, leaf color, leaf length, flowering,
fertility, silking, yield, seed production, and the like. Damage
may also be assessed by evaluating the time elapsed to a particular
stage of development (e.g., silking, flowering, or pollen shed) or
the time elapsed until a plant has recovered from treatment with a
particular chemical and/or herbicide.
[0066] In making such assessments, particular values may be
assigned to particular degrees of damage so that statistical
analysis or quantitative comparisons may be made. The use of ranges
of values to describe particular degrees of damage is known in the
art, and any suitable range or scale may be used. For example,
herbicide injury scores (also called tolerance scores) can be
assigned as illustrated in Example 1 using the scale set forth in
Table 7. In this scale, a rating of 9 indicates that a herbicide
treatment had no effect on a crop, i.e., that no crop reduction or
injury was observed following the herbicide treatment. Thus, in
this scale, a rating of 9 indicates that the crop exhibited no
damage from the herbicide and therefore that the crop is tolerant
to the herbicide. As indicated above, herbicide tolerance is also
indicated by other ratings in this scale where an appropriate
control plant exhibits a lower score on the scale, or where a group
of appropriate control plants exhibits a statistically lower score
in response to a herbicide treatment than a group of subject
plants.
[0067] Damage caused by a herbicide or other chemical can be
assessed at various times after a plant has been treated with a
herbicide. Often, damage is assessed at about the time that the
control plant exhibits maximum damage. Sometimes, damage is
assessed after a period of time in which a control plant that was
not treated with herbicide or other chemical has measurably grown
and/or developed in comparison to the size or stage at which the
treatment was administered. Damage can be assessed at various
times, for example, at 12 hours or at 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14 days, or three weeks, four weeks, or longer
after the test plant was treated with herbicide. Any time of
assessment is suitable as long as it permits detection of a
difference in response to a treatment of test and control
plants.
[0068] A herbicide does not "significantly damage" a plant when it
either has no effect on a plant or when it has some effect on a
plant from which the plant later recovers, or when it has an effect
which is detrimental but which is offset, for example, by the
impact of the particular herbicide on weeds. Thus, for example, a
crop plant is not "significantly damaged by" a herbicide or other
treatment if it exhibits less than 50%, 40%, 30%, 25%, 20%, 15%,
10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% decrease in at least one
suitable parameter that is indicative of plant health and/or
productivity in comparison to an appropriate control plant (e.g.,
an untreated crop plant). Suitable parameters that are indicative
of plant health and/or productivity include, for example, plant
height, plant weight, leaf length, time elapsed to a particular
stage of development, flowering, yield, seed production, and the
like. The evaluation of a parameter can be by visual inspection
and/or by statistical analysis of any suitable parameter.
Comparison may be made by visual inspection and/or by statistical
analysis. Accordingly, a crop plant is not "significantly damaged
by" a herbicide or other treatment if it exhibits a decrease in at
least one parameter but that decrease is temporary in nature and
the plant recovers fully within 1 week, 2 weeks, 3 weeks, 4 weeks,
or 6 weeks.
[0069] Conversely, a plant is significantly damaged by a herbicide
or other treatment if it exhibits more than a 50%, 60%, 70%, 80%,
90%, 100%, 110%, 120%, 150%, 170% decrease in at least one suitable
parameter that is indicative of plant health and/or productivity in
comparison to an appropriate control plant (e.g., an untreated weed
of the same species). Thus, a plant is significantly damaged if it
exhibits a decrease in at least one parameter and the plant does
not recover fully within 1 week, 2 weeks, 3 weeks, 4 weeks, or 6
weeks.
[0070] Damage resulting from a herbicide or other chemical
treatment of a plant can be assessed by visual inspection by one of
skill in the art and can be evaluated by statistical analysis of
suitable parameters. The plant being evaluated is referred to as
the "test plant." Typically, an appropriate control plant is one
that expresses the same herbicide-tolerance polypeptide(s) as the
plant being evaluated for herbicide tolerance (i.e., the "test
plant") but that has not been treated with herbicide. For example,
in evaluating a herbicide-tolerant plant of the invention that
confers tolerance to glyphosate and an ALS inhibitor, an
appropriate control plant would be a plant that expresses each of
these sequence but is not treated with the herbicide. In some
circumstances, the control plant is one that that has been
subjected to the same herbicide treatment as the plant being
evaluated (i.e., the test plant) but that does not express the
enzyme intended to provide tolerance to the herbicide of interest
in the test plant. One of skill in the art will be able to design,
perform, and evaluate a suitable controlled experiment to assess
the herbicide tolerance of a plant of interest, including the
selection of appropriate test plants, control plants, and
treatments.
[0071] Thus, as used herein, a "test plant or plant cell" is one in
which genetic alteration has been effected as to at least one gene
of interest, or is a plant or plant cell which is descended from a
plant or cell so altered and which comprises the alteration. A
genetic alteration may be introduced into the plant by breeding or
by transformation. "Genetic alteration" is intended to mean a gene
or mutation thereof which confers a phenotype on the plant that
differs from the phenotype of a plant that does not contain the
genetic alteration.
[0072] A "control" or "control plant" or "control plant cell"
provides a reference point for measuring changes in phenotype of
the subject plant or plant cell, and may be any suitable plant or
plant cell. A control plant or plant cell may comprise, for
example: (a) a wild-type plant or cell, i.e., of the same genotype
as the starting material for the genetic alteration which resulted
in the subject plant or cell; (b) a plant or plant cell of the same
genotype as the starting material but which has been transformed
with a null construct (i.e., with a construct which has no known
effect on the trait of interest, such as a construct comprising a
marker gene); (c) a plant or plant cell which is a non-transformed
segregant among progeny of a subject plant or plant cell; (d) a
plant or plant cell which is genetically identical to the subject
plant or plant cell but which is not exposed to the same treatment
(e.g., herbicide treatment) as the subject plant or plant cell; (e)
the subject plant or plant cell itself, under conditions in which
the gene of interest is not expressed; or (f) the subject plant or
plant cell itself, under conditions in which it has not been
exposed to a particular treatment such as, for example, a herbicide
or combination of herbicides and/or other chemicals. In some
instances, an appropriate control plant or control plant cell may
have a different genotype from the subject plant or plant cell but
may share the herbicide-sensitive characteristics of the starting
material for the genetic alteration(s) which resulted in the
subject plant or cell (see, e.g., Green (1998) Weed Technology 12:
474-477; Green and Ulrich (1993) Weed Science 41: 508-516). In some
instances, an appropriate control maize plant comprises a NK603
event (Nielson et al. (2004) European Food Research and Technology
219:421-427 and Ridley et al. (2002) Journal of Agriculture and
Food Chemistry 50: 7235-7243), an elite stiff stalk inbred plant, a
P3162 plant (Pioneer Hi-Bred International), a 39T66 plant (Pioneer
Hi-Bred International), or a 34M91 plant (Pioneer Hi-Bred
International). In some instances, an appropriate control soybean
plant is a "Jack" soybean plant (Illinois Foundation Seed,
Champaign, Ill.).
[0073] Plants of the invention express a polypeptide that confers
tolerance to glyphosate and at least one other polypeptide that
confers tolerance to an ALS inhibitor. A plant of the invention
shows at least one improved property relative to an appropriate
control plant, such as, for example, improved herbicide tolerance,
reduced lodging, increased height, reduced time to maturity, and
improved yield. A plant has an improved property when it exhibits a
statistically significant difference from an appropriate control
plant wherein that difference is in a direction that represents an
improvement over the control plant. For example, a plant has an
improved property when it exhibits an increase in yield that is
statistically significant in comparison to a control plant, and/or
when it exhibits a decrease in damage resulting from treatment with
a herbicide. Techniques for such assessments are known in the art.
Any suitable statistical analysis may be used, such as, for
example, an ANOVA (available as a commercial package from SAS
Institute, Inc., 100 SAS Campus Drive, Cary, N.C.).
[0074] f. Plants
[0075] As used herein, the term "plant" includes plant cells, plant
protoplasts, plant cell tissue cultures from which plants can be
regenerated, plant calli, plant clumps, explants, and plant cells
that are intact in plants or parts of plants such as embryos,
pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels,
ears, cobs, husks, stalks, roots, root tips, anthers, and the like.
Grain is intended to mean the mature seed produced by commercial
growers for purposes other than growing or reproducing the species.
Progeny, variants, and mutants of the regenerated plants are also
included within the scope of the invention, provided that these
parts comprise the introduced polynucleotides. Thus, the invention
provides transgenic seeds produced by the plants of the
invention.
[0076] The present invention may be used for transformation of any
plant species, including, but not limited to, monocots and dicots.
Examples of plant species of interest include, but are not limited
to, corn (Zea mays, also referred to herein as "maize"), Brassica
spp. (e.g., B. napus, B. rapa, B. juncea), particularly those
Brassica species useful as sources of seed oil (also referred to as
"canola"), flax (Linum spp.), alfalfa (Medicago sativa), rice
(Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor,
Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum),
proso millet (Panicum miliaceum), foxtail millet (Setaria italica),
finger millet (Eleusine coracana)), sunflower (Helianthus annuus),
safflower (Carthamus tinctorius), wheat (Triticum aestivum),
soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum
tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium
barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus),
cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos
nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.),
cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa
spp.), avocado (Persea americana), fig (Ficus casica), guava
(Psidium guajava), mango (Mangifera indica), olive (Olea europaea),
papaya (Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgaris), sugarcane (Saccharum spp.), oats, barley,
vegetables, fruits, ornamentals (flowers), sugar cane, conifers,
Arabidopsis.
[0077] Vegetables include tomatoes (Lycopersicon esculentum),
lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris),
lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members
of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C.
cantalupensis), and musk melon (C. melo). Ornamentals include
azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea),
hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa
spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida),
carnation (Dianthus caryophyllus), poinsettia (Euphorbia
pulcherrima), and chrysanthemum.
[0078] Any tree can also be employed. Conifers that may be employed
in practicing the present invention include, for example, pines
such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii),
ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta),
and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga
menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea
glauca); redwood (Sequoia sempervirens); true firs such as silver
fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars
such as Western red cedar (Thuja plicata) and Alaska yellow-cedar
(Chamaecyparis nootkatensis). Hardwood trees can also be employed
including ash, aspen, beech, basswood, birch, black cherry, black
walnut, buckeye, American chestnut, cottonwood, dogwood, elm,
hackberry, hickory, holly, locust, magnolia, maple, oak, poplar,
red alder, redbud, royal paulownia, sassafras, sweetgum, sycamore,
tupelo, willow, yellow-poplar.
[0079] In specific embodiments, plants of the present invention are
crop plants (for example, corn (also referred to as "maize"),
alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut,
sorghum, wheat, millet, tobacco, etc.).
[0080] Other plants of interest include grain plants that provide
seeds of interest, oil-seed plants, and leguminous plants. Seeds of
interest include grain seeds, such as corn, wheat, barley, rice,
sorghum, rye, etc. Oil-seed plants include cotton, soybean,
safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
Leguminous plants include beans and peas. Beans include guar,
locust bean, fenugreek, soybean, garden beans, cowpea, mungbean,
lima bean, fava bean, lentils, chickpea, etc.
[0081] Other plants of interest include Turfgrasses such as, for
example, turfgrasses from the genus Poa, Agrostis, Festuca, Lolium,
and Zoysia. Additional turfgrasses can come from the subfamily
Panicoideae. Turfgrasses can further include, but are not limited
to, Blue gramma (Bouteloua gracilis (H.B.K.) Lag. Ex Griffiths);
Buffalograss (Buchloe dactyloids (Nutt.) Engelm.); Slender creeping
red fescue (Festuca rubra ssp. Litoralis); Red fescue (Festuca
rubra); Colonial bentgrass (Agrostis tenuis Sibth.); Creeping
bentgrass (Agrostis palustris Huds.); Fairway wheatgrass (Agropyron
cristatum (L.) Gaertn.); Hard fescue (Festuca longifolia Thuill.);
Kentucky bluegrass (Poa pratensis L.); Perennial ryegrass (Lolium
perenne L.); Rough bluegrass (Poa trivialis L.); Sideoats grama
(Bouteloua curtipendula Michx. Torr.); Smooth bromegrass (Bromus
inermis Leyss.); Tall fescue (Festuca arundinacea Schreb.); Annual
bluegrass (Poa annua L.); Annual ryegrass (Lolium multiflorum
Lam.); Redtop (Agrostis alba L.); Japanese lawn grass (Zoysia
japonica); bermudagrass (Cynodon dactylon; Cynodon spp. L.C. Rich;
Cynodon transvaalensis); Seashore paspalum (Paspalum vaginatum
Swartz); Zoysiagrass (Zoysia spp. Willd; Zoysia japonica and Z.
matrella var. matrella); Bahiagrass (Paspalum notatum Flugge);
Carpetgrass (Axonopus affinis Chase); Centipedegrass (Eremochloa
ophiuroides Munro Hack.); Kikuyugrass (Pennisetum clandesinum
Hochst Ex Chiov); Browntop bent (Agrostis tenuis also known as A.
capillaris); Velvet bent (Agrostis canina); Perennial ryegrass
(Lolium perenne); and, St. Augustinegrass (Stenotaphrum secundatum
Walt. Kuntze). Additional grasses of interest include switchgrass
(Panicum virgatum).
[0082] g. Stacking of Traits and Additional Traits of Interest
[0083] In some embodiments, the polynucleotide conferring the
glyphosate tolerance and the ALS inhibitor tolerance in the plants
of the invention are engineered into a molecular stack. In other
embodiments, the molecular stack further comprises at least one
additional polynucleotide that confers tolerance to a 3.sup.rd
herbicide. Such sequences are disclosed elsewhere in herein. In one
embodiment, the sequence confers tolerance to glufosinate, and 2 in
a specific embodiment, the sequence comprises pat.
[0084] In other embodiments, the glyphosate/ALS inhibitor-tolerant
plants of the invention comprise one or more trait of interest, and
in more specific embodiments, the plant is stacked with any
combination of polynucleotide sequences of interest in order to
create plants with a desired combination of traits. A trait, as
used herein, refers to the phenotype derived from a particular
sequence or groups of sequences. For example, herbicide-tolerance
polynucleotides may be stacked with any other polynucleotides
encoding polypeptides having pesticidal and/or insecticidal
activity, such as Bacillus thuringiensis toxic proteins (described
in U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756;
5,593,881; Geiser et al. (1986) Gene 48: 109; Lee et al. (2003)
Appl. Environ. Microbiol. 69: 4648-4657 (Vip3A); Galitzky et al.
(2001) Acta Crystallogr. D. Biol. Crystallogr. 57: 1101-1109
(Cry3Bbl); and Herman et al. (2004) J. Agric. Food Chem. 52:
2726-2734 (Cry1F)), lectins (Van Damme et al. (1994) Plant Mol.
Biol. 24: 825, pentin (described in U.S. Pat. No. 5,981,722), and
the like. The combinations generated can also include multiple
copies of any one of the polynucleotides of interest.
[0085] In some embodiments, herbicide-tolerance polynucleotides of
the glyphosate/ALS inhibitor-tolerant plants (i.e., such as plant
comprising GAT and HRA) may be stacked with other
herbicide-tolerance traits to create a transgenic plant of the
invention with further improved properties. Other
herbicide-tolerance polynucleotides that could be used in such
embodiments include those conferring tolerance to glyphosate or to
ALS inhibitors by other modes of action, such as, for example, a
gene that encodes a glyphosate oxido-reductase enzyme as described
more fully in U.S. Pat. Nos. 5,776,760 and 5,463,175. Other traits
that could be combined with herbicide-tolerance polynucleotides of
the glyphosate/ALS inhibitor-tolerant plants (i.e., such as GAT and
HRA sequence) include those derived from polynucleotides that
confer on the plant the capacity to produce a higher level of
5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), for example,
as more fully described in U.S. Pat. Nos. 6,248,876 B1; 5,627,061;
5,804,425; 5,633,435; 5,145,783; 4,971,908; 5,312,910; 5,188,642;
4,940,835; 5,866,775; 6,225,114 B1; 6,130,366; 5,310,667;
4,535,060; 4,769,061; 5,633,448; 5,510,471; Re. 36,449; RE 37,287
E; and 5,491,288; and international publications WO 97/04103; WO
00/66746; WO 01/66704; and WO 00/66747. Other traits that could be
combined with herbicide-tolerance polynucleotides of the
glyphosate/ALS inhibitor-tolerant plants (i.e., such as GAT and HRA
sequences) include those conferring tolerance to sulfonylurea
and/or imidazolinone, for example, as described more fully in U.S.
Pat. Nos. 5,605,011; 5,013,659; 5,141,870; 5,767,361; 5,731,180;
5,304,732; 4,761,373; 5,331,107; 5,928,937; and 5,378,824; and
international publication WO 96/33270.
[0086] In some embodiments, herbicide-tolerance polynucleotides of
the glyphosate/ALS inhibitor-tolerant plants (i.e., such as GAT and
HRA sequence) may be stacked with, for example,
hydroxyphenylpyruvatedioxygenases which are enzymes that catalyze
the reaction in which para-hydroxyphenylpyruvate (HPP) is
transformed into homogentisate. Molecules which inhibit this enzyme
and which bind to the enzyme in order to inhibit transformation of
the HPP into homogentisate are useful as herbicides. Traits
conferring tolerance to such herbicides in plants are described in
U.S. Pat. Nos. 6,245,968 B1; 6,268,549; and 6,069,115; and
international publication WO 99/23886. Other examples of suitable
herbicide-tolerance traits that could be stacked with
herbicide-tolerance polynucleotides of the glyphosate/ALS
inhibitor-tolerant plants (i.e., such GAT and HRA sequences)
include aryloxyalkanoate dioxygenase polynucleotides (which
reportedly confer tolerance to 2,4-D and other phenoxy auxin
herbicides as well as to aryloxyphenoxypropionate herbicides as
described, for example, in WO2005/107437) and dicamba-tolerance
polynucleotides as described, for example, in Herman et al. (2005)
J. Biol. Chem. 280: 24759-24767.
[0087] Other examples of herbicide-tolerance traits that could be
combined with herbicide-tolerance polynucleotides of the
glyphosate/ALS inhibitor-tolerant plants (i.e., GAT and HRA plants)
include those conferred by polynucleotides encoding an exogenous
phosphinothricin acetyltransferase, as described in U.S. Pat. Nos.
5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236;
5,648,477; 5,646,024; 6,177,616; and 5,879,903. Plants containing
an exogenous phosphinothricin acetyltransferase can exhibit
improved tolerance to glufosinate herbicides, which inhibit the
enzyme glutamine synthase. Other examples of herbicide-tolerance
traits that could be combined with the herbicide-tolerance
polynucleotides of the glyphosate/ALS inhibitor-tolerant plants
(i.e., GAT and HRA plants) include those conferred by
polynucleotides conferring altered protoporphyrinogen oxidase
(protox) activity, as described in U.S. Pat. Nos. 6,288,306 B1;
6,282,837 B1; and 5,767,373; and international publication WO
01/12825. Plants containing such polynucleotides can exhibit
improved tolerance to any of a variety of herbicides which target
the protox enzyme (also referred to as "protox inhibitors").
[0088] Other examples of herbicide-tolerance traits that could be
combined with herbicide-tolerance polynucleotides of the
glyphosate/ALS inhibitor-tolerant plants (i.e., GAT and HRA plants)
include those conferring tolerance to at least one herbicide in a
plant such as, for example, a maize plant or horseweed.
Herbicide-tolerant weeds are known in the art, as are plants that
vary in their tolerance to particular herbicides. See, e.g., Green
and Williams (2004) "Correlation of Corn (Zea mays) Inbred Response
to Nicosulfuron and Mesotrione," poster presented at the WSSA
Annual Meeting in Kansas City, Mo., Feb. 9-12, 2004; Green (1998)
Weed Technology 12: 474-477; Green and Ulrich (1993) Weed Science
41: 508-516. The trait(s) responsible for these tolerances can be
combined by breeding or via other methods with herbicide-tolerance
polynucleotides of the glyphosate/ALS inhibitor-tolerant plants
(i.e., GAT and HRA plants) to provide a plant of the invention as
well as methods of use thereof.
[0089] In this manner, the invention provides plants that are more
tolerant to glyphosate and other ALS inhibitor chemistries and also
provides plants that are more tolerant to the herbicide for which
each of the traits discussed above confers tolerance. Accordingly,
the invention provides methods for growing a crop (i.e., for
selectively controlling weeds in an area of cultivation) that
comprise treating an area of interest (e.g., a field or area of
cultivation) with at least one herbicide to which the plant of the
invention is tolerant, such as for example, glyphosate, an ALS
inhibitor chemistry, a mixture of ALS inhibitor chemistries, or a
mixture of glyphosate and ALS inhibitor chemistry. In some
embodiments, methods of the invention further comprise treatment
with additional herbicides to which the plant of the invention is
tolerant. In such embodiments, generally the methods of the
invention permit selective control of weeds without significantly
damaging the crop. As used herein, an "area of cultivation"
comprises any region in which one desires to grow a plant. Such
areas of cultivations include, but are not limited to, a field in
which a plant is cultivated (such as a crop field, a sod field, a
tree field, a managed forest, a field for culturing fruits and
vegetables, etc), a greenhouse, a growth chamber, etc.
[0090] Herbicide-tolerant traits can also be combined with at least
one other trait to produce plants of the present invention that
further comprise a variety of desired trait combinations including,
but not limited to, traits desirable for animal feed such as high
oil content (e.g., U.S. Pat. No. 6,232,529); balanced amino acid
content (e.g., hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801;
5,885,802; and 5,703,409; U.S. Pat. No. 5,850,016); barley high
lysine (Williamson et al. (1987) Eur. J. Biochem. 165: 99-106; and
WO 98/20122) and high methionine proteins (Pedersen et al. (1986)
J. Biol. Chem. 261: 6279; Kirihara et al. (1988) Gene 71: 359; and
Musumura et al. (1989) Plant Mol. Biol. 12:123)); increased
digestibility (e.g., modified storage proteins (U.S. application
Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins (U.S.
application Ser. No. 10/005,429, filed Dec. 3, 2001)); the
disclosures of which are herein incorporated by reference. Desired
trait combinations also include LLNC (low linolenic acid content;
see, e.g., Dyer et al. (2002) Appl. Microbiol. Biotechnol. 59:
224-230) and OLCH (high oleic acid content; see, e.g.,
Fernandez-Moya et al. (2005) J. Agric. Food Chem. 53:
5326-5330).
[0091] Herbicide-tolerant traits of interest can also be combined
with other desirable traits such as, for example, fumonisim
detoxification genes (U.S. Pat. No. 5,792,931), avirulence and
disease resistance genes (Jones et al. (1994) Science 266: 789;
Martin et al. (1993) Science 262: 1432; Mindrinos et al. (1994)
Cell 78: 1089), and traits desirable for processing or process
products such as modified oils (e.g., fatty acid desaturase genes
(U.S. Pat. No. 5,952,544; WO 94/11516)); modified starches (e.g.,
ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch
branching enzymes (SBE), and starch debranching enzymes (SDBE));
and polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321;
beta-ketothiolase, polyhydroxybutyrate synthase, and
acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol.
170:5837-5847) facilitate expression of polyhydroxyalkanoates
(PHAs)); the disclosures of which are herein incorporated by
reference. One could also combine herbicide-tolerant
polynucleotides with polynucleotides providing agronomic traits
such as male sterility (e.g., see U.S. Pat. No. 5,583,210), stalk
strength, flowering time, or transformation technology traits such
as cell cycle regulation or gene targeting (e.g., WO 99/61619, WO
00/17364, and WO 99/25821); the disclosures of which are herein
incorporated by reference.
[0092] In another embodiment, the herbicide-tolerant traits of
interest can also be combined with the Rcg1 sequence or
biologically active variant or fragment thereof. The Rcg1 sequence
is an anthracnose stalk rot resistance gene in corn. See, for
example, U.S. patent application Ser. No. 11/397,153, 11/397,275,
and 11/397,247, each of which is herein incorporated by
reference.
[0093] These stacked combinations can be created by any method
including, but not limited to, breeding plants by any conventional
or TopCross methodology, or genetic transformation. If the
sequences are stacked by genetically transforming the plants, the
polynucleotide sequences of interest can be combined at any time
and in any order. For example, a transgenic plant comprising one or
more desired traits can be used as the target to introduce further
traits by subsequent transformation. The traits can be introduced
simultaneously in a co-transformation protocol with the
polynucleotides of interest provided by any combination of
transformation cassettes. For example, if two sequences will be
introduced, the two sequences can be contained in separate
transformation cassettes (trans) or contained on the same
transformation cassette (cis). Expression of the sequences can be
driven by the same promoter or by different promoters. In certain
cases, it may be desirable to introduce a transformation cassette
that will suppress the expression of the polynucleotide of
interest. This may be combined with any combination of other
suppression cassettes or overexpression cassettes to generate the
desired combination of traits in the plant. It is further
recognized that polynucleotide sequences can be stacked at a
desired genomic location using a site-specific recombination
system. See, for example, WO99/25821, WO99/25854, WO99/25840,
WO99/25855, and WO99/25853, all of which are herein incorporated by
reference.
[0094] Various changes in phenotype are of interest including
modifying the fatty acid composition in a plant, altering the amino
acid content of a plant, altering a plant's pathogen defense
mechanism, and the like. These results can be achieved by providing
expression of heterologous products or increased expression of
endogenous products in plants. Alternatively, the results can be
achieved by providing for a reduction of expression of one or more
endogenous products, particularly enzymes or cofactors in the
plant. These changes result in a change in phenotype of the
transformed plant.
[0095] Genes of interest are reflective of the commercial markets
and interests of those involved in the development of the crop.
Crops and markets of interest change, and as developing nations
open up world markets, new crops and technologies will emerge also.
In addition, as our understanding of agronomic traits and
characteristics such as yield and heterosis increase, the choice of
genes for transformation will change accordingly. General
categories of genes of interest include, for example, those genes
involved in information, such as zinc fingers, those involved in
communication, such as kinases, and those involved in housekeeping,
such as heat shock proteins. More specific categories of
transgenes, for example, include genes encoding important traits
for agronomics, insect resistance, disease resistance, herbicide
resistance, sterility, grain characteristics, and commercial
products. Genes of interest include, generally, those involved in
oil, starch, carbohydrate, or nutrient metabolism as well as those
affecting kernel size, sucrose loading, and the like. Agronomically
important traits such as oil, starch, and protein content can be
genetically altered in addition to using traditional breeding
methods. Modifications include increasing content of oleic acid,
saturated and unsaturated oils, increasing levels of lysine and
sulfur, providing essential amino acids, and also modification of
starch.
[0096] Derivatives of the coding sequences can be made by
site-directed mutagenesis to increase the level of preselected
amino acids in the encoded polypeptide. For example, the gene
encoding the barley high lysine polypeptide (BHL) is derived from
barley chymotrypsin inhibitor, U.S. application Ser. No.
08/740,682, filed Nov. 1, 1996, and WO 98/20133, the disclosures of
which are herein incorporated by reference. Other proteins include
methionine-rich plant proteins such as from sunflower seed (Lilley
et al. (1989) Proceedings of the World Congress on Vegetable
Protein Utilization in Human Foods and Animal Feedstuffs, ed.
Applewhite (American Oil Chemists Society, Champaign, Ill.), pp.
497-502; herein incorporated by reference); corn (Pedersen et al.
(1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359;
both of which are herein incorporated by reference); and rice
(Musumura et al. (1989) Plant Mol. Biol. 12:123, herein
incorporated by reference). Other agronomically important genes
encode latex, Floury 2, growth factors, seed storage factors, and
transcription factors.
[0097] Insect resistance genes may encode resistance to pests that
have great yield drag such as rootworm, cutworm, European Corn
Borer, and the like. Such genes include, for example, Bacillus
thuringiensis toxic protein genes (U.S. Pat. Nos. 5,366,892;
5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al.
(1986) Gene 48: 109); and the like.
[0098] Genes encoding disease resistance traits include
detoxification genes, such as against fumonosin (U.S. Pat. No.
5,792,931); avirulence (avr) and disease resistance (R) genes
(Jones et al. (1994) Science 266: 789; Martin et al. (1993) Science
262: 1432; and Mindrinos et al. (1994) Cell 78: 1089); and the
like.
[0099] Sterility genes can also be encoded in an expression
cassette and provide an alternative to physical detasseling.
Examples of genes used in such ways include male tissue-preferred
genes and genes with male sterility phenotypes such as QM,
described in U.S. Pat. No. 5,583,210. Other genes include kinases
and those encoding compounds toxic to either male or female
gametophytic development.
[0100] The quality of grain is reflected in traits such as levels
and types of oils, saturated and unsaturated, quality and quantity
of essential amino acids, and levels of cellulose. In corn,
modified hordothionin proteins are described in U.S. Pat. Nos.
5,703,049, 5,885,801, 5,885,802, and 5,990,389.
[0101] Commercial traits can also be encoded on a gene or genes
that could increase for example, starch for ethanol production, or
provide expression of proteins. Another important commercial use of
transformed plants is the production of polymers and bioplastics
such as described in U.S. Pat. No. 5,602,321. Genes such as
.beta.-Ketothiolase, PHBase (polyhydroxybutyrate synthase), and
acetoacetyl-CoA reductase (see Schubert et al. (1988) J. Bacteriol.
170: 5837-5847) facilitate expression of polyhydroxyalkanoates
(PHAs).
[0102] Exogenous products include plant enzymes and products as
well as those from other sources including procaryotes and other
eukaryotes. Such products include enzymes, cofactors, hormones, and
the like. The level of proteins, particularly modified proteins
having improved amino acid distribution to improve the nutrient
value of the plant, can be increased. This is achieved by the
expression of such proteins having enhanced amino acid content.
II. Polynucleotide Constructs
[0103] In specific embodiments, one or more of the
herbicide-tolerant polynucleotides employed in the methods and
compositions can be provided in an expression cassette for
expression in the plant or other organism of interest. The cassette
will include 5' and 3' regulatory sequences operably linked to a
herbicide-tolerance polynucleotide. "Operably linked" is intended
to mean a functional linkage between two or more elements. For
example, an operable linkage between a polynucleotide of interest
and a regulatory sequence (e.g., a promoter) is functional link
that allows for expression of the polynucleotide of interest.
Operably linked elements may be contiguous or non-contiguous. When
used to refer to the joining of two protein coding regions, by
"operably linked" is intended that the coding regions are in the
same reading frame. When used to refer to the effect of an
enhancer, "operably linked" indicates that the enhancer increases
the expression of a particular polynucleotide or polynucleotides of
interest. Where the polynucleotide or polynucleotides of interest
encode a polypeptide, the encoded polypeptide is produced at a
higher level.
[0104] The cassette may additionally contain at least one
additional gene to be cotransformed into the organism.
Alternatively, the additional gene(s) can be provided on multiple
expression cassettes. Such an expression cassette is provided with
a plurality of restriction sites and/or recombination sites for
insertion of the herbicide-tolerance polynucleotide to be under the
transcriptional regulation of the regulatory regions. The
expression cassette may additionally contain other genes, including
other selectable marker genes. Where a cassette contains more than
one polynucleotide, the polynucleotides in the cassette may be
transcribed in the same direction or in different directions (also
called "divergent" transcription).
[0105] An expression cassette comprising a herbicide-tolerance
polynucleotide will include in the 5'-3' direction of transcription
a transcriptional and translational initiation region (i.e., a
promoter), a herbicide-tolerance polynucleotide (e.g., a GAT
polynucleotide, a ALS inhibitor-tolerant polynucleotide, an HRA
polynucleotide, or any combination thereof, etc.), and a
transcriptional and translational termination region (i.e.,
termination region) functional in plants or the other organism of
interest. Accordingly, plants having such expression cassettes are
also provided. The regulatory regions (i.e., promoters,
transcriptional regulatory regions, and translational termination
regions) and/or the herbicide-tolerance polynucleotide may be
native (i.e., analogous) to the host cell or to each other.
Alternatively, the regulatory regions and/or the
herbicide-tolerance polynucleotide of the invention may be
heterologous to the host cell or to each other. As used herein,
"heterologous" in reference to a sequence is a sequence that
originates from a foreign species, or, if from the same species, is
substantially modified from its native form in composition and/or
genomic locus by deliberate human intervention. For example, a
promoter operably linked to a heterologous polynucleotide is from a
species different from the species from which the polynucleotide
was derived, or, if from the same (i.e., analogous) species, one or
both are substantially modified from their original form and/or
genomic locus, or the promoter is not the native promoter for the
operably linked polynucleotide.
[0106] While it may be optimal to express polynucleotides using
heterologous promoters, native promoter sequences may be used. Such
constructs can change expression levels and/or expression patterns
of the encoded polypeptide in the plant or plant cell. Expression
levels and/or expression patterns of the encoded polypeptide may
also be changed as a result of an additional regulatory element
that is part of the construct, such as, for example, an enhancer.
Thus, the phenotype of the plant or cell can be altered even though
a native promoter is used.
[0107] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked herbicide-tolerance polynucleotide of interest, may be
native with the plant host, or may be derived from another source
(i.e., foreign or heterologous) to the promoter, the
herbicide-tolerance polynucleotide of interest, the plant host, or
any combination thereof. Convenient termination regions are
available from the Ti-plasmid of A. tumefaciens, such as the
octopine synthase and nopaline synthase termination regions, or can
be obtained from plant genes such as the Solanum tuberosum
proteinase inhibitor II gene. See also Guerineau et al. (1991) Mol.
Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64: 671-674;
Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990)
Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158;
Ballas et al. (1989) Nucleic Acids Res. 17: 7891-7903; and Joshi et
al. (1987) Nucleic Acids Res. 15: 9627-9639.
[0108] A number of promoters can be used in the practice of the
invention, including the native promoter of the polynucleotide
sequence of interest. The promoters can be selected based on the
desired outcome. The polynucleotides of interest can be combined
with constitutive, tissue-preferred, or other promoters for
expression in plants.
[0109] Such constitutive promoters include, for example, the core
promoter of the Rsyn7 promoter and other constitutive promoters
disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV
35S promoter (Odell et al. (1985) Nature 313: 810-812); rice actin
(McElroy et al. (1990) Plant Cell 2: 163-171); the maize actin
promoter; the ubiquitin promoter (see, e.g., Christensen et al.
(1989) Plant Mol. Biol. 12: 619-632; Christensen et al. (1992)
Plant Mol. Biol. 18: 675-689; Callis et al. (1995) Genetics 139:
921-39); pEMU (Last et al. (1991) Theor. Appl. Genet. 81: 581-588);
MAS (Velten et al. (1984) EMBO J. 3: 2723-2730); ALS promoter (U.S.
Pat. No. 5,659,026), and the like. Other constitutive promoters
include, for example, those described in U.S. Pat. Nos. 5,608,149;
5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463;
5,608,142; and 6,177,611. Some promoters show improved expression
when they are used in conjunction with a native 5' untranslated
region and/or other elements such as, for example, an intron. For
example, the maize ubiquitin promoter is often placed upstream of a
polynucleotide of interest along with at least a portion of the 5'
untranslated region of the ubiquitin gene, including the first
intron of the maize ubiquitin gene.
[0110] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. Depending upon the objective, the
promoter may be a chemical-inducible promoter for which application
of the chemical induces gene expression or the promoter may be a
chemical-repressible promoter for which application of the chemical
represses gene expression. Chemical-inducible promoters are known
in the art and include, but are not limited to, the maize In2-2
promoter, which is activated by benzenesulfonamide herbicide
safeners, the maize GST promoter, which is activated by hydrophobic
electrophilic compounds that are used as pre-emergent herbicides,
and the tobacco PR-1a promoter, which is activated by salicylic
acid. Other chemical-regulated promoters of interest include
steroid-responsive promoters (see, for example, the
glucocorticoid-inducible promoter in Schena et al. (1991) Proc.
Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998)
Plant J. 14(2): 247-257) and tetracycline-inducible and
tetracycline-repressible promoters (see, for example, Gatz et al.
(1991) Mol. Gen. Genet. 227: 229-237, and U.S. Pat. Nos. 5,814,618
and 5,789,156), herein incorporated by reference.
[0111] Tissue-preferred promoters can be utilized to target
enhanced herbicide-tolerance polypeptide expression within a
particular plant tissue. Tissue-preferred promoters include
Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al.
(1997) Plant Cell Physiol. 38(7): 792-803; Hansen et al. (1997)
Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic
Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol.
112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):
525-535; Canevascini et al. (1996) Plant Physiol. 112(2): 513-524;
Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam
(1994) Results Probl. Cell Differ. 20: 181-196; Orozco et al.
(1993) Plant Mol. Biol. 23(6): 1129-1138; Matsuoka et al. (1993)
Proc Natl. Acad. Sci. USA 90(20): 9586-9590; and Guevara-Garcia et
al. (1993) Plant J. 4(3): 495-505. Such promoters can be modified,
if necessary, for weak expression.
[0112] Leaf-preferred promoters are known in the art. See, for
example, Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kwon et
al. (1994) Plant Physiol. 105: 357-67; Yamamoto et al. (1994) Plant
Cell Physiol. 35(5): 773-778; Gotor et al. (1993) Plant J. 3:
509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; and
Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):
9586-9590.
[0113] Root-preferred promoters are known and can be selected from
the many available from the literature or isolated de novo from
various compatible species. See, for example, Hire et al. (1992)
Plant Mol. Biol. 20(2): 207-218 (soybean root-specific glutamine
synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):
1051-1061 (root-specific control element in the GRP 1.8 gene of
French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3): 433-443
(root-specific promoter of the mannopine synthase (MAS) gene of
Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1):
11-22 (full-length cDNA clone encoding cytosolic glutamine
synthetase (GS), which is expressed in roots and root nodules of
soybean). See also Bogusz et al. (1990) Plant Cell 2(7): 633-641,
where two root-specific promoters isolated from hemoglobin genes
from the nitrogen-fixing nonlegume Parasponia andersonii and the
related non-nitrogen-fixing nonlegume Trema tomentosa are
described. The promoters of these genes were linked to a
.beta.-glucuronidase reporter gene and introduced into both the
nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and
in both instances root-specific promoter activity was preserved.
Leach and Aoyagi (1991) describe their analysis of the promoters of
the highly expressed rolC and rolD root-inducing genes of
Agrobacterium rhizogenes (see Plant Science (Limerick) 79(1):
69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teeri et al.
(1989) used gene fusion to lacZ to show that the Agrobacterium
T-DNA gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see EMBO J. 8(2): 343-350). The
TR1' gene, fused to nptII(neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant
Mol. Biol. 29(4): 759-772); and rolB promoter (Capana et al. (1994)
Plant Mol. Biol. 25(4): 681-691. See also U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and
5,023,179.
[0114] "Seed-preferred" promoters include both "seed-specific"
promoters (those promoters active during seed development such as
promoters of seed storage proteins) as well as "seed-germinating"
promoters (those promoters active during seed germination). See
Thompson et al. (1989) BioEssays 10: 108, herein incorporated by
reference. Such seed-preferred promoters include, but are not
limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa
zein); mi1ps (myo-inositol-1-phosphate synthase) (see WO 00/11177
and U.S. Pat. No. 6,225,529; herein incorporated by reference).
Gamma-zein is an endosperm-specific promoter. Globulin 1 (Glb-1) is
a representative embryo-specific promoter. For dicots,
seed-specific promoters include, but are not limited to, bean
.beta.-phaseolin, napin, .beta.-conglycinin, soybean lectin,
cruciferin, and the like. For monocots, seed-specific promoters
include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27
kDa zein, gamma-zein, waxy, shrunken 1, shrunken 2, Globulin 1,
etc. See also WO 00/12733, where seed-preferred promoters from end1
and end2 genes are disclosed; herein incorporated by reference.
[0115] Additional promoters of interest include the SCP1 promoter
(U.S. Pat. No. 6,072,050), the HB2 promoter (U.S. Pat. No.
6,177,611) and the SAMS promoter (US20030226166 and SEQ ID NO: 87
and biologically active variants and fragments thereof); each of
which is herein incorporated by reference. In addition, as
discussed elsewhere herein, various enhancers can be used with
these promoters including, for example, the ubiquitin intron (i.e,
the maize ubiquitin intron 1 (see, for example, NCBI sequence
S94464), the omega enhancer or the omega prime enhancer (Gallie et
al. (1989) Molecular Biology of RNA ed. Cech (Liss, New York)
237-256 and Gallie et al. Gene (1987) 60:217-25), or the 35S
enhancer; each of which is incorporated by reference.
[0116] The expression cassette can also comprise a selectable
marker gene for the selection of transformed cells. Selectable
marker genes are utilized for the selection of transformed cells or
tissues. Marker genes include genes encoding antibiotic resistance,
such as those encoding neomycin phosphotransferase II (NEO) and
hygromycin phosphotransferase (HPT), as well as genes conferring
resistance to herbicidal compounds, such as glufosinate ammonium,
bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D).
Additional selectable markers include phenotypic markers such as
.beta.-galactosidase and fluorescent proteins such as green
fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:
610-9 and Fetter et al. (2004) Plant Cell 16: 215-28), cyan
florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:
943-54 and Kato et al. (2002) Plant Physiol 129: 913-42), and
yellow fluorescent protein (PhiYFP from Evrogen, see, Bolte et al.
(2004) J. Cell Science 117: 943-54). For additional selectable
markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:
506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA
89: 6314-6318; Yao et al. (1992) Cell 71: 63-72; Reznikoff (1992)
Mol. Microbiol. 6: 2419-2422; Barkley et al. (1980) in The Operon,
pp. 177-220; Hu et al. (1987) Cell 48: 555-566; Brown et al. (1987)
Cell 49: 603-612; Figge et al. (1988) Cell 52: 713-722; Deuschle et
al. (1989) Proc. Natl. Acad. Aci. USA 86: 5400-5404; Fuerst et al.
(1989) Proc. Natl. Acad. Sci. USA 86: 2549-2553; Deuschle et al.
(1990) Science 248: 480-483; Gossen (1993) Ph.D. Thesis, University
of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:
1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10: 3343-3356;
Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89: 3952-3956;
Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88: 5072-5076;
Wyborski et al. (1991) Nucleic Acids Res. 19: 4647-4653;
Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10: 143-162;
Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:
1591-1595; Kleinschnidt et al. (1988) Biochemistry 27: 1094-1104;
Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al.
(1992) Proc. Natl. Acad. Sci. USA 89: 5547-5551; Oliva et al.
(1992) Antimicrob. Agents Chemother. 36: 913-919; Hlavka et al.
(1985) Handbook of Experimental Pharmacology, Vol. 78
(Springer-Verlag, Berlin); Gill et al. (1988) Nature 334: 721-724.
Such disclosures are herein incorporated by reference. The above
list of selectable marker genes is not meant to be limiting. Any
selectable marker gene can be used in the present invention,
including the GAT gene and/or HRA gene.
[0117] Methods are known in the art of increasing the expression
level of a polypeptide of the invention in a plant or plant cell,
for example, by inserting into the polypeptide coding sequence one
or two G/C-rich codons (such as GCG or GCT) immediately adjacent to
and downstream of the initiating methionine ATG codon. Where
appropriate, the polynucleotides may be optimized for increased
expression in the transformed plant. That is, the polynucleotides
can be synthesized substituting in the polypeptide coding sequence
one or more codons which are less frequently utilized in plants for
codons encoding the same amino acid(s) which are more frequently
utilized in plants, and introducing the modified coding sequence
into a plant or plant cell and expressing the modified coding
sequence. See, for example, Campbell and Gowri (1990) Plant
Physiol. 92: 1-11 for a discussion of host-preferred codon usage.
Methods are available in the art for synthesizing plant-preferred
genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391,
and Murray et al. (1989) Nucleic Acids Res. 17: 477-498, herein
incorporated by reference. Embodiments comprising such
modifications are also a feature of the invention.
[0118] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other such
well-characterized sequences that may be deleterious to gene
expression. The G-C content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. When possible,
the sequence is modified to avoid predicted hairpin secondary mRNA
structures. "Enhancers" such as the CaMV 35S enhancer may also be
used (see, e.g., Benfey et al. (1990) EMBO J. 9: 1685-96), or other
enhancers may be used. For example, the sequence set forth in SEQ
ID NO: 1, 72, 79, 84, 85, 88, or 89 or a biologically active
variant or fragment thereof can be used. See, also, U.S. Utility
application Ser. No. ______, entitled "Methods and Compositions for
the Expression of a Polynucleotide of Interest", filed concurrently
herewith, and herein incorporated by reference in its entirety. The
term "promoter" is intended to mean a regulatory region of DNA
comprising a transcriptional initiation region, which in some
embodiments, comprises a TATA box capable of directing RNA
polymerase II to initiate RNA synthesis at the appropriate
transcription initiation site for a particular coding sequence. The
promoter can further be operably linked to additional regulatory
elements that influence transcription, including, but not limited
to, introns, 5' untranslated regions, and enhancer elements. As
used herein, an "enhancer sequence," "enhancer domain," "enhancer
element," or "enhancer," when operably linked to an appropriate
promoter, will modulate the level of transcription of an operably
linked polynucleotide of interest. Biologically active fragments
and variants of the enhancer domain may retain the biological
activity of modulating (increase or decrease) the level of
transcription when operably linked to an appropriate promoter.
[0119] Fragments of a polynucleotide for the enhancer domain or a
promoter may range from at least about 50 nucleotides, about 100
nucleotides, about 150 nucleotides, about 200 nucleotides, about
250 nucleotides, about 300 nucleotides, about 350 nucleotides,
about 400 nucleotides, about 450 nucleotides, about 500
nucleotides, and up to the full-length nucleotide sequence of the
invention for the enhancer domain of the invention. In other
embodiments, a fragment of the enhancer domain comprises a length
of about 50 to about 100, 100 to about 150, 150 to about 200, 200
to about 250, about 250 to about 300, about 300 to about 350, about
350 to about 400, about 400 to about 450, about 450 to about 500,
about 500 to about 535 nucleotides. Generally, variants of a
particular polynucleotides of the invention will have at least
about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to
that particular polynucleotides as determined by sequence alignment
programs and parameters described elsewhere herein. A biologically
active variant of an enhancer or a promoter may differ from that
sequence by as few as 1-15 nucleic acid residues, as few as 1-10,
such as 6-10, as few as 10, 9, 8, 7, 6, 5, 4, 3, 2, or even 1
nucleic acid residue. Such active variants and fragments will
continue to modulate transcription.
[0120] Multiple copies of the enhancer domain or active variants
and fragments thereof can be operably linked to a promoter. In
specific embodiment, the chimeric transcriptional regulatory
control region comprises at least 1, 2, 3, 4, 5, 6, 7 or more
copies of the enhancer domain. In further embodiments, the enhancer
domain employed does not comprise the sequence set forth in SEQ ID
NO:5. In addition, the enhancer can be orientated in either
orientation (i.e., sense or reverse).
[0121] The distance between the promoter and the enhancer domain
can vary, so long as the chimeric transcriptional regulatory region
continues to direct transcription of the operably linked
polynucleotide of interest in the desired manner. For example, an
enhancer domain can be positioned at least about 10000 to about
15000, about 10000 to about a 9000, about 9000 to about 8000, about
8000 to about 7000, about 7000 to about 6000, about 6000 to about
5000, about 5000 to about 4000, about 4000 to about 3000, about
3000 to about 2000, about 2000 to about 1000, about 1000 to about
500, about 500 to about 250, about 250 to immediately adjacent to
the promoter. It is further recognized that one or more copies of
the enhancer can be placed upstream (5') of the promoter or
alternatively, one or more copies of the enhancer can be located 3'
to the promoter. In specific embodiments, when located 3' of the
promoter, the enhancer is downstream of the terminator region. In
still further embodiments, one or more of the enhancers can be
arranged either in the 5' or 3' orientation (as shown in SEQ ID
NO:1 or 72) or in the 3' to 5' orientation.
[0122] If multiple enhancers are employed, the enhancers can be
positioned in the construct with respect to the promoter such that
the desired affect on expression is achieved. For example, the
enhances can be immediately adjacent to each other or at least
between 1 to 100, 100 to 300, 300 to 500, 500 to 1000 nucleotides
apart.
[0123] It is further recognized that the enhancer employed in the
invention can be positioned in a DNA construct between and operably
linked to a first and a second promoter. In such embodiments, the
enhancer allows for a modulation in expression of both the first
and the second promoters from a divergent direction. Exemplary, but
non-limiting, examples of such DNA constructs comprise in the 5' to
3' or 3' to 5' orientation: a first polynucleotide of interest
operably linked to a first promoter, operably linked to at least
one copy of an enhancer of the invention, operably linked to a
second promoter, operably linked to a second polynucleotide of
interest. In specific embodiments, the enhancer sequence is
heterologous to the first and the second enhancer sequence. In
other embodiments, the first promoter is operably linked to a
polynucleotide encoding an ALS inhibitor and the second promoter is
operably linked to a polynucleotide encoding a polypeptide that
confers tolerance to glyphosate. Such polynucleotides are disclosed
elsewhere herein.
[0124] The expression cassette may additionally contain 5' leader
sequences. Such leader sequences can act to enhance translation.
Translation leaders are known in the art and include: picornavirus
leaders, for example, EMCV leader (Encephalomyocarditis 5'
noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci.
USA 86: 6126-6130); potyvirus leaders, for example, TEV leader
(Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2): 233-238),
MDMV leader (Maize Dwarf Mosaic Virus) (Virology 154: 9-20), and
human immunoglobulin heavy-chain binding protein (BiP) (Macejak et
al. (1991) Nature 353: 90-94); untranslated leader from the coat
protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al.
(1987) Nature 325: 622-625); tobacco mosaic virus leader (TMV)
(Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss,
New York), pp. 237-256); and maize chlorotic mottle virus leader
(MCMV) (Lommel et al. (1991) Virology 81: 382-385). See also,
Della-Cioppa et al. (1987) Plant Physiol. 84: 965-968.
[0125] In preparing the expression cassette, the various
polynucleotide fragments may be manipulated, so as to provide for
sequences to be in the proper orientation and, as appropriate, in
the proper reading frame. Toward this end, adapters or linkers may
be employed to join the fragments or other manipulations may be
involved to provide for convenient restriction sites, removal of
superfluous material such as the removal of restriction sites, or
the like. For this purpose, in vitro mutagenesis, primer repair,
restriction, annealing, resubstitutions, e.g., transitions and
transversions, may be involved. Standard recombinant DNA and
molecular cloning techniques used herein are well known in the art
and are described more fully, for example, in Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor) (also known as
"Maniatis").
[0126] In some embodiments, the polynucleotide of interest is
targeted to the chloroplast for expression. In this manner, where
the polynucleotide of interest is not directly inserted into the
chloroplast, the expression cassette will additionally contain a
nucleic acid encoding a transit peptide to direct the gene product
of interest to the chloroplasts. Such transit peptides are known in
the art. See, for example, Von Heijne et al. (1991) Plant Mol.
Biol. Rep. 9: 104-126; Clark et al. (1989) J. Biol. Chem. 264:
17544-17550; Della-Cioppa et al. (1987) Plant Physiol. 84: 965-968;
Romer et al. (1993) Biochem. Biophys. Res. Commun. 196: 1414-1421;
and Shah et al. (1986) Science 233: 478-481.
[0127] Chloroplast targeting sequences are known in the art and
include the chloroplast small subunit of ribulose-1,5-bisphosphate
carboxylase (Rubisco) (de Castro Silva Filho et al. (1996) Plant
Mol. Biol. 30: 769-780; Schnell et al. (1991) J. Biol. Chem.
266(5): 3335-3342); 5-(enolpyruvyl)shikimate-3-phosphate synthase
(EPSPS) (Archer et al. (1990) J. Bioenerg. Biomemb. 22(6):
789-810); tryptophan synthase (Zhao et al. (1995) J. Biol. Chem.
270(11): 6081-6087); plastocyanin (Lawrence et al. (1997) J. Biol.
Chem. 272(33): 20357-20363); chorismate synthase (Schmidt et al.
(1993) J. Biol. Chem. 268(36): 27447-27457); and the light
harvesting chlorophyll a/b binding protein (LHBP) (Lamppa et al.
(1988) J. Biol. Chem. 263: 14996-14999). See also Von Heijne et al.
(1991) Plant Mol. Biol. Rep. 9: 104-126; Clark et al. (1989) J.
Biol. Chem. 264: 17544-17550; Della-Cioppa et al. (1987) Plant
Physiol. 84: 965-968; Romer et al. (1993) Biochem. Biophys. Res.
Commun. 196: 1414-1421; and Shah et al. (1986) Science 233:
478-481.
[0128] Methods for transformation of chloroplasts are known in the
art. See, for example, Svab et al. (1990) Proc. Natl. Acad. Sci.
USA 87: 8526-8530; Svab and Maliga (1993) Proc. Natl. Acad. Sci.
USA 90: 913-917; Svab and Maliga (1993) EMBO J. 12: 601-606. The
method relies on particle gun delivery of DNA containing a
selectable marker and targeting of the DNA to the plastid genome
through homologous recombination. Additionally, plastid
transformation can be accomplished by transactivation of a silent
plastid-borne transgene by tissue-preferred expression of a
nuclear-encoded and plastid-directed RNA polymerase. Such a system
has been reported in McBride et al. (1994) Proc. Natl. Acad. Sci.
USA 91: 7301-7305.
[0129] The polynucleotides of interest to be targeted to the
chloroplast may be optimized for expression in the chloroplast to
account for differences in codon usage between the plant nucleus
and this organelle. In this manner, the polynucleotide of interest
may be synthesized using chloroplast-preferred codons. See, for
example, U.S. Pat. No. 5,380,831, herein incorporated by
reference.
[0130] "Gene" refers to a polynucleotide that expresses a specific
protein, generally including regulatory sequences preceding (5'
non-coding sequences) and following (3' non-coding sequences) the
coding sequence (i.e., the portion of the sequence that encodes the
specific protein). "Native gene" refers to a gene as found in
nature, generally with its own regulatory sequences. A "transgene"
is a gene that has been introduced into the genome by a
transformation procedure. Accordingly, a "transgenic plant" is a
plant that contains a transgene, whether the transgene was
introduced into that particular plant by transformation or by
breeding; thus, descendants of an originally-transformed plant are
encompassed by the definition.
III. Methods of Introducing
[0131] The plants of the invention are generated by introducing a
polypeptide or polynucleotide into a plant. "Introducing" is
intended to mean presenting to the plant the polynucleotide or
polypeptide in such a manner that the sequence gains access to the
interior of a cell of the plant. The methods of the invention do
not depend on a particular method for introducing a sequence into a
plant, only that the polynucleotide or polypeptides gains access to
the interior of at least one cell of the plant. Methods for
introducing polynucleotide or polypeptides into plants are known in
the art including, but not limited to, stable transformation
methods, transient transformation methods, virus-mediated methods,
and breeding.
[0132] "Stable transformation" is intended to mean that the
nucleotide construct introduced into a plant integrates into the
genome of the plant and is capable of being inherited by the
progeny thereof. "Transient transformation" is intended to mean
that a polynucleotide is introduced into the plant and does not
integrate into the genome of the plant or a polypeptide is
introduced into a plant.
[0133] Transformation protocols as well as protocols for
introducing polypeptides or polynucleotide sequences into plants
may vary depending on the type of plant or plant cell (i.e.,
monocot or dicot) targeted for transformation. Suitable methods of
introducing polypeptides and polynucleotides into plant cells
include microinjection (Crossway et al. (1986) Biotechniques 4:
320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad.
Sci. USA 83: 5602-5606, Agrobacterium-mediated transformation (U.S.
Pat. No. 5,563,055 and U.S. Pat. No. 5,981,840), direct gene
transfer (Paszkowski et al. (1984) EMBO J. 3: 2717-2722), and
ballistic particle acceleration (see, for example, U.S. Pat. Nos.
4,945,050; U.S. Pat. No. 5,879,918; U.S. Pat. No. 5,886,244; and,
5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ
Culture: Fundamental Methods, ed. Gamborg and Phillips
(Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:
923-926); and Lec1 transformation (WO 00/28058). Also see
Weissinger et al. (1988) Ann. Rev. Genet. 22: 421-477; Sanford et
al. (1987) Particulate Science and Technology 5: 27-37 (onion);
Christou et al. (1988) Plant Physiol. 87: 671-674 (soybean); McCabe
et al. (1988) Bio/Technology 6: 923-926 (soybean); Finer and
McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean);
Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta
et al. (1990) Biotechnology 8: 736-740 (rice); Klein et al. (1988)
Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al.
(1988) Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855;
5,322,783; and, 5,324,646; Klein et al. (1988) Plant Physiol. 91:
440-444 (maize); Fromm et al. (1990) Biotechnology 8: 833-839
(maize); protocols published electronically by "IP.com" under the
permanent publication identifiers IPCOM000033402D, IPCOM000033402D,
and IPCOM000033402D and available at the "IP.com" website (cotton);
Hooykaas-Van Slogteren et al. (1984) Nature (London) 311: 763-764;
U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc.
Natl. Acad. Sci. USA 84: 5345-5349 (Liliaceae); De Wet et al.
(1985) in The Experimental Manipulation of Ovule Tissues, ed.
Chapman et al. (Longman, N.Y.), pp. 197-209 (pollen); Kaeppler et
al. (1990) Plant Cell Reports 9: 415-418 and Kaeppler et al. (1992)
Theor. Appl. Genet. 84: 560-566 (whisker-mediated transformation);
D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation);
Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou and
Ford (1995) Annals of Botany 75: 407-413 (rice); Osjoda et al.
(1996) Nature Biotechnology 14: 745-750 (maize via Agrobacterium
tumefaciens); all of which are herein incorporated by
reference.
[0134] In specific embodiments, herbicide-tolerance or other
desirable sequences can be provided to a plant using a variety of
transient transformation methods. Such transient transformation
methods include, but are not limited to, the introduction of the
polypeptide or variants and fragments thereof directly into the
plant or the introduction of a transcript into the plant. Such
methods include, for example, microinjection or particle
bombardment. See, for example, Crossway et al. (1986) Mol. Gen.
Genet. 202: 179-185; Nomura et al. (1986) Plant Sci. 44: 53-58;
Hepler et al. (1994) Proc. Natl. Acad. Sci. 91: 2176-2180 and Hush
et al. (1994) The Journal of Cell Science 107: 775-784, all of
which are herein incorporated by reference. Alternatively, a
herbicide-tolerance polynucleotide can be transiently transformed
into the plant using techniques known in the art. Such techniques
include viral vector system and the precipitation of the
polynucleotide in a manner that precludes subsequent release of the
DNA. Thus, the transcription from the particle-bound DNA can occur,
but the frequency with which it is released to become integrated
into the genome is greatly reduced. Such methods include the use
particles coated with polyethylimine (PEI; Sigma #P3143).
[0135] In other embodiments, polynucleotides may be introduced into
plants by contacting plants with a virus or viral nucleic acids.
Generally, such methods involve incorporating a nucleotide
construct within a viral DNA or RNA molecule. It is recognized that
a polypeptide of interest may be initially synthesized as part of a
viral polyprotein, which later may be processed by proteolysis in
vivo or in vitro to produce the desired recombinant protein.
Further, it is recognized that useful promoters may include
promoters utilized for transcription by viral RNA polymerases.
Methods for introducing polynucleotides into plants and expressing
a polypeptide encoded thereby, involving viral DNA or RNA
molecules, are known in the art. See, for example, U.S. Pat. Nos.
5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et
al. (1996) Molecular Biotechnology 5: 209-221; herein incorporated
by reference.
[0136] Methods are known in the art for the targeted insertion of a
polynucleotide at a specific location in the plant genome. In one
embodiment, the insertion of the polynucleotide at a desired
genomic location is achieved using a site-specific recombination
system. See, for example, WO99/25821, WO99/25854, WO99/25840,
WO99/25855, and WO99/25853, all of which are herein incorporated by
reference. Briefly, a polynucleotide can be contained in transfer
cassette flanked by two non-recombinogenic recombination sites. The
transfer cassette is introduced into a plant having stably
incorporated into its genome a target site which is flanked by two
non-recombinogenic recombination sites that correspond to the sites
of the transfer cassette. An appropriate recombinase is provided
and the transfer cassette is integrated at the target site. The
polynucleotide of interest is thereby integrated at a specific
chromosomal position in the plant genome.
[0137] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick et al. (1986) Plant Cell Reports 5: 81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting progeny having
constitutive expression of the desired phenotypic characteristic
identified. Two or more generations may be grown to ensure that
expression of the desired phenotypic characteristic is stably
maintained and inherited and then seeds harvested to ensure
expression of the desired phenotypic characteristic has been
achieved. In this manner, the present invention provides
transformed seed (also referred to as "transgenic seed") having a
polynucleotide of the invention, for example, an expression
cassette of the invention, stably incorporated into their
genome.
[0138] In specific embodiments, a polypeptide or the polynucleotide
of interest is introduced into the plant cell. Subsequently, a
plant cell having the introduced sequence of the invention is
selected using methods known to those of skill in the art such as,
but not limited to, Southern blot analysis, DNA sequencing, PCR
analysis, or phenotypic analysis. A plant or plant part altered or
modified by the foregoing embodiments is grown under plant forming
conditions for a time sufficient to modulate the concentration
and/or activity of polypeptides in the plant. Plant forming
conditions are well known in the art and discussed briefly
elsewhere herein.
[0139] It is also recognized that the level and/or activity of a
polypeptide of interest may be modulated by employing a
polynucleotide that is not capable of directing, in a transformed
plant, the expression of a protein or an RNA. For example, the
polynucleotides of the invention may be used to design
polynucleotide constructs that can be employed in methods for
altering or mutating a genomic nucleotide sequence in an organism.
Such polynucleotide constructs include, but are not limited to,
RNA:DNA vectors, RNA:DNA mutational vectors, RNA:DNA repair
vectors, mixed-duplex oligonucleotides, self-complementary RNA:DNA
oligonucleotides, and recombinogenic oligonucleobases. Such
nucleotide constructs and methods of use are known in the art. See,
U.S. Pat. Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012;
5,795,972; and 5,871,984; all of which are herein incorporated by
reference. See also, WO 98/49350, WO 99/07865, WO 99/25821, and
Beetham et al. (1999) Proc. Natl. Acad. Sci. USA 96: 8774-8778;
herein incorporated by reference.
[0140] It is therefore recognized that methods of the present
invention do not depend on the incorporation of the entire
polynucleotide into the genome, only that the plant or cell thereof
is altered as a result of the introduction of the polynucleotide
into a cell. In one embodiment of the invention, the genome may be
altered following the introduction of the polynucleotide into a
cell. For example, the polynucleotide, or any part thereof, may
incorporate into the genome of the plant. Alterations to the genome
of the present invention include, but are not limited to,
additions, deletions, and substitutions of nucleotides into the
genome. While the methods of the present invention do not depend on
additions, deletions, and substitutions of any particular number of
nucleotides, it is recognized that such additions, deletions, or
substitutions comprises at least one nucleotide.
[0141] Plants of the invention may be produced by any suitable
method, including breeding. Plant breeding can be used to introduce
desired characteristics (e.g., a stably incorporated transgene or a
genetic variant or genetic alteration of interest) into a
particular plant line of interest, and can be performed in any of
several different ways. Pedigree breeding starts with the crossing
of two genotypes, such as an elite line of interest and one other
elite inbred line having one or more desirable characteristics
(i.e., having stably incorporated a polynucleotide of interest,
having a modulated activity and/or level of the polypeptide of
interest, etc.) which complements the elite plant line of interest.
If the two original parents do not provide all the desired
characteristics, other sources can be included in the breeding
population. In the pedigree method, superior plants are selfed and
selected in successive filial generations. In the succeeding filial
generations the heterozygous condition gives way to homogeneous
lines as a result of self-pollination and selection. Typically in
the pedigree method of breeding, five or more successive filial
generations of selfing and selection is practiced: F1.fwdarw.F2;
F2.fwdarw.F3; F3.fwdarw.F4; F4.fwdarw.F.sub.5, etc. After a
sufficient amount of inbreeding, successive filial generations will
serve to increase seed of the developed inbred. In specific
embodiments, the inbred line comprises homozygous alleles at about
95% or more of its loci. Various techniques known in the art can be
used to facilitate and accelerate the breeding (e.g., backcrossing)
process, including, for example, the use of a greenhouse or growth
chamber with accelerated day/night cycles, the analysis of
molecular markers to identify desirable progeny, and the like.
[0142] In addition to being used to create a backcross conversion,
backcrossing can also be used in combination with pedigree breeding
to modify an elite line of interest and a hybrid that is made using
the modified elite line. As discussed previously, backcrossing can
be used to transfer one or more specifically desirable traits from
one line, the donor parent, to an inbred called the recurrent
parent, which has overall good agronomic characteristics yet lacks
that desirable trait or traits. However, the same procedure can be
used to move the progeny toward the genotype of the recurrent
parent but at the same time retain many components of the
non-recurrent parent by stopping the backcrossing at an early stage
and proceeding with selfing and selection. For example, an F1, such
as a commercial hybrid, is created. This commercial hybrid may be
backcrossed to one of its parent lines to create a BC1 or BC2.
Progeny are selfed and selected so that the newly developed inbred
has many of the attributes of the recurrent parent and yet several
of the desired attributes of the non-recurrent parent. This
approach leverages the value and strengths of the recurrent parent
for use in new hybrids and breeding.
[0143] Therefore, an embodiment of this invention is a method of
making a backcross conversion of an inbred line of interest
comprising the steps of crossing a plant from the inbred line of
interest with a donor plant comprising at least one mutant gene or
transgene conferring a desired trait (e.g., herbicide tolerance),
selecting an F1 progeny plant comprising the mutant gene or
transgene conferring the desired trait, and backcrossing the
selected F1 progeny plant to a plant of the inbred line of
interest. This method may further comprise the step of obtaining a
molecular marker profile of the inbred line of interest and using
the molecular marker profile to select for a progeny plant with the
desired trait and the molecular marker profile of the inbred line
of interest. In the same manner, this method may be used to produce
an F1 hybrid seed by adding a final step of crossing the desired
trait conversion of the inbred line of interest with a different
plant to make F1 hybrid seed comprising a mutant gene or transgene
conferring the desired trait.
[0144] Recurrent selection is a method used in a plant breeding
program to improve a population of plants. The method entails
individual plants cross pollinating with each other to form
progeny. The progeny are grown and the superior progeny selected by
any number of selection methods, which include individual plant,
half-sib progeny, full-sib progeny, selfed progeny and topcrossing.
The selected progeny are cross-pollinated with each other to form
progeny for another population. This population is planted and
again superior plants are selected to cross pollinate with each
other. Recurrent selection is a cyclical process and therefore can
be repeated as many times as desired. The objective of recurrent
selection is to improve the traits of a population. The improved
population can then be used as a source of breeding material to
obtain inbred lines to be used in hybrids or used as parents for a
synthetic cultivar. A synthetic cultivar is the resultant progeny
formed by the intercrossing of several selected inbreds.
[0145] Mass selection is a useful technique when used in
conjunction with molecular marker enhanced selection. In mass
selection seeds from individuals are selected based on phenotype
and/or genotype. These selected seeds are then bulked and used to
grow the next generation. Bulk selection requires growing a
population of plants in a bulk plot, allowing the plants to
self-pollinate, harvesting the seed in bulk and then using a sample
of the seed harvested in bulk to plant the next generation. Instead
of self pollination, directed pollination could be used as part of
the breeding program.
[0146] Mutation breeding is one of many methods that could be used
to introduce new traits into an elite line. Mutations that occur
spontaneously or are artificially induced can be useful sources of
variability for a plant breeder. The goal of artificial mutagenesis
is to increase the rate of mutation for a desired characteristic.
Mutation rates can be increased by many different means including
temperature, long-term seed storage, tissue culture conditions,
radiation such as X-rays, Gamma rays (e.g., cobalt 60 or cesium
137), neutrons, (product of nuclear fission of uranium 235 in an
atomic reactor), Beta radiation (emitted from radioisotopes such as
phosphorus 32 or carbon 14), or ultraviolet radiation (preferably
from 2500 to 2900 nm), or chemical mutagens (such as base analogues
(5-bromo-uracil), related compounds (8-ethoxy caffeine),
antibiotics (streptonigrin), alkylating agents (sulfur mustards,
nitrogen mustards, epoxides, ethyleneamines, sulfates, sulfonates,
sulfones, lactones), azide, hydroxylamine, nitrous acid, or
acridines. Once a desired trait is observed through mutagenesis the
trait may then be incorporated into existing germplasm by
traditional breeding techniques, such as backcrossing. Details of
mutation breeding can be found in "Principals of Cultivar
Development" Fehr, 1993 Macmillan Publishing Company the disclosure
of which is incorporated herein by reference. In addition,
mutations created in other lines may be used to produce a backcross
conversion of elite lines that comprises such mutations.
IV. Methods of Modulating Expression
[0147] In some embodiments, the activity and/or level of the
polypeptide is modulated (i.e., increased or decreased). An
increase in the level and/or activity of the polypeptide can be
achieved by providing the polypeptide to the plant. As discussed
elsewhere herein, many methods are known the art for providing a
polypeptide to a plant including, but not limited to, direct
introduction of the polypeptide into the plant, introducing into
the plant (transiently or stably) a polynucleotide construct
encoding a polypeptide having the desired activity. It is also
recognized that the methods of the invention may employ a
polynucleotide that is not capable of directing, in the transformed
plant, the expression of a protein or an RNA. Thus, the level
and/or activity of a polypeptide may be modulated by altering the
gene encoding the polypeptide or its promoter. See, e.g., Kmiec,
U.S. Pat. No. 5,565,350; Zarling et al., PCT/US93/03868. Therefore
mutagenized plants that carry mutations in genes, where the
mutations increase expression of the gene or increase the activity
of the encoded polypeptide are provided.
[0148] In other embodiments, the activity and/or level of a
polypeptide is reduced or eliminated by introducing into a plant a
polynucleotide that inhibits the level or activity of the
polypeptide. The polynucleotide may inhibit the expression of the
polypeptide directly, by preventing translation of the
corresponding messenger RNA, or indirectly, by encoding a
polypeptide that inhibits the transcription or translation of a
gene encoding the protein. Methods for inhibiting or eliminating
the expression of a gene in a plant are well known in the art, and
any such method may be used in the present invention to inhibit the
expression of a gene in a plant. In other embodiments of the
invention, the activity of a polypeptide is reduced or eliminated
by transforming a plant cell with a sequence encoding a polypeptide
that inhibits the activity of the polypeptide. In other
embodiments, the activity of a polypeptide may be reduced or
eliminated by disrupting the gene encoding the polypeptide. The
invention encompasses mutagenized plants that carry mutations in
genes of interest, where the mutations reduce expression of the
gene or inhibit the activity of the encoded polypeptide.
[0149] Reduction of the activity of specific genes (also known as
gene silencing or gene suppression) is desirable for several
aspects of genetic engineering in plants. Many techniques for gene
silencing are well known to one of skill in the art, including, but
not limited to, antisense technology (see, e.g., Sheehy et al.
(1988) Proc. Natl. Acad. Sci. USA 85: 8805-8809; and U.S. Pat. Nos.
5,107,065; 5,453,566; and 5,759,829); cosuppression (e.g., Taylor
(1997) Plant Cell 9: 1245; Jorgensen (1990) Trends Biotech. 8(12):
340-344; Flavell (1994) Proc. Natl. Acad. Sci. USA 91: 3490-3496;
Finnegan et al. (1994) Bio/Technology 12: 883-888; and Neuhuber et
al. (1994) Mol. Gen. Genet. 244: 230-241); RNA interference (Napoli
et al. (1990) Plant Cell 2: 279-289; U.S. Pat. No. 5,034,323; Sharp
(1999) Genes Dev. 13: 139-141; Zamore et al. (2000) Cell 101:
25-33; and Montgomery et al. (1998) Proc. Natl. Acad. Sci. USA 95:
15502-15507), virus-induced gene silencing (Burton et al. (2000)
Plant Cell 12: 691-705; and Baulcombe (1999) Curr. Op. Plant Bio.
2: 109-113); target-RNA-specific ribozymes (Haseloff et al. (1988)
Nature 334: 585-591); hairpin structures (Smith et al. (2000)
Nature 407: 319-320; WO 99/53050; WO 02/00904; WO 98/53083; Chuang
and Meyerowitz (2000) Proc. Natl. Acad. Sci. USA 97: 4985-4990;
Stoutjesdijk et al. (2002) Plant Physiol. 129: 1723-1731;
Waterhouse and Helliwell (2003) Nat. Rev. Genet. 4: 29-38;
Pandolfini et al. BMC Biotechnology 3: 7, U.S. Patent Publication
No. 20030175965; Panstruga et al. (2003) Mol. Biol. Rep. 30:
135-140; Wesley et al. (2001) Plant J. 27: 581-590; Wang and
Waterhouse (2001) Curr. Opin. Plant Biol. 5: 146-150; U.S. Patent
Publication No. 20030180945; and WO 02/00904, all of which are
herein incorporated by reference); ribozymes (Steinecke et al.
(1992) EMBO J. 11: 1525; and Perriman et al. (1993) Antisense Res.
Dev. 3: 253); oligonucleotide-mediated targeted modification (e.g.,
WO 03/076574 and WO 99/25853); Zn-finger targeted molecules (e.g.,
WO 01/52620; WO 03/048345; and WO 00/42219); transposon tagging
(Maes et al. (1999) Trends Plant Sci. 4: 90-96; Dharmapuri and
Sonti (1999) FEMS Microbiol. Lett. 179: 53-59; Meissner et al.
(2000) Plant J. 22: 265-274; Phogat et al. (2000) J. Biosci. 25:
57-63; Walbot (2000) Curr. Opin. Plant Biol. 2: 103-107; Gai et al.
(2000) Nucleic Acids Res. 28: 94-96; Fitzmaurice et al. (1999)
Genetics 153: 1919-1928; Bensen et al. (1995) Plant Cell 7: 75-84;
Mena et al. (1996) Science 274: 1537-1540; and U.S. Pat. No.
5,962,764); each of which is herein incorporated by reference; and
other methods or combinations of the above methods known to those
of skill in the art.
[0150] It is recognized that antisense constructions complementary
to at least a portion of the messenger RNA (mRNA) for a
polynucleotide of interest can be constructed. Antisense
nucleotides are constructed to hybridize with the corresponding
mRNA. Modifications of the antisense sequences may be made as long
as the sequences hybridize to and interfere with expression of the
corresponding mRNA. In this manner, antisense constructions having
at least 70%, optimally 80%, more optimally 85% sequence identity
to the corresponding antisensed sequences may be used. Furthermore,
portions of the antisense nucleotides may be used to disrupt the
expression of the target gene. Generally, sequences of at least 50
nucleotides, 100 nucleotides, 200 nucleotides, 300, 400, 450, 500,
550, or greater may be used.
[0151] Polynucleotides may also be used in the sense orientation to
suppress the expression of endogenous genes in plants. Methods for
suppressing gene expression in plants using polynucleotides in the
sense orientation are known in the art. The methods generally
involve transforming plants with a DNA construct comprising a
promoter that drives expression in a plant operably linked to at
least a portion of a polynucleotide that corresponds to the
transcript of the endogenous gene. Typically, such a nucleotide
sequence has substantial sequence identity to the sequence of the
transcript of the endogenous gene, generally greater than about
65%, 85%, or 95% sequence identity. See, U.S. Pat. Nos. 5,283,184
and 5,034,323; herein incorporated by reference. Thus, many methods
may be used to reduce or eliminate the activity of a polypeptide.
More than one method may be used to reduce the activity of a single
polypeptide. In addition, combinations of methods may be employed
to reduce or eliminate the activity of a polypeptide.
[0152] In one embodiment, the expression level of a polypeptide may
be measured directly, for example, by assaying for the level of the
polynucleotide or polypeptide or a known metabolite in the plant
(e.g., by assaying for the level of N-acetylglyphosate ("NAG") in a
plant containing a GAT gene), or indirectly, for example, by
evaluating the plant containing it for the trait to be conferred by
the polypeptide, e.g., herbicide resistance.
V. Methods of Controlling Weeds
[0153] Methods are provided for controlling weeds in an area of
cultivation, preventing the development or the appearance of
herbicide resistant weeds in an area of cultivation, producing a
crop, and increasing crop safety. The term "controlling," and
derivations thereof, for example, as in "controlling weeds" refers
to one or more of inhibiting the growth, germination, reproduction,
and/or proliferation of; and/or killing, removing, destroying, or
otherwise diminishing the occurrence and/or activity of a weed.
[0154] The glyphosate/ALS inhibitor plants of the invention display
a modified tolerance to herbicides and therefore allow for the
application of one or more herbicides at rates that would
significantly damage control plants and further allow for the
application of combinations of herbicides at lower concentrations
than normally applied which still continue to selectively control
weeds. In addition, the glyphosate/ALS inhibitor-tolerant plants of
the invention can be used in combination with herbicide blends
technology and thereby make the application of chemical pesticides
more convenient, economical, and effective for the producer.
[0155] The methods of the invention comprise planting the area of
cultivation with glyphosate/ALS inhibitor-tolerant crop seeds or
plants of the invention, and in specific embodiments, applying to
any crop, crop part, weed or area of cultivation thereof an
effective amount of a herbicide of interest. It is recognized that
the herbicide can be applied before or after the crop is planted in
the area of cultivation. Such herbicide applications can include an
application of glyphosate, an ALS inhibitor chemistry, or any
combination thereof. In specific embodiments, a mixture of ALS
inhibitor chemistry in combination with glyphosate is applied to
the glyphosate/ALS inhibitor-tolerant plant, wherein the effective
concentration of at least two of the ALS inhibitor chemistries
would significantly damage an appropriate control plant. In one
non-limiting embodiment, the herbicide comprises at least one of a
sulfonylaminocarbonyltriazolinone; a triazolopyrimidine; a
pyrimidinyl(thio)benzoate; an imidazolinone; a triazine; and/or a
phosphinic acid.
[0156] In another non-limiting embodiment, the combination of
herbicides comprises glyphosate, imazapyr, chlorimuron-ethyl,
quizalofop, and fomesafen, wherein said effective amount is
tolerated by the crop and controls weeds. As disclosed elsewhere
herein, any effective amount of these herbicides can be applied. In
specific embodiments, this combination of herbicides comprises an
effective amount of glyphosate comprising about 1110 to about 1130
g ai/hectare; an effective amount of imazapyr comprising about 7.5
to about 27.5 g ai/hectare; an effective amount of
chlorimuron-ethyl comprising about 7.5 to about 27.5 g ai/hectare;
an effective amount of quizalofop comprising about 50 to about 70 g
ai/hectare; and, an effective amount of fomesafen comprising about
240 to about 260 g ai/hectare.
[0157] In other embodiments, at least a combination of two
herbicides are applied, wherein the combination does not include
glyphosate. In other embodiments, at least one ALS inhibitor and
glyphosate is applied to the plant. More details regarding the
various herbicide combinations that can be employed in the methods
of the invention are discussed elsewhere herein.
[0158] In one embodiment, the method of controlling weeds comprises
planting the area with a glyphosate/ALS inhibitor-tolerant crop
seeds or plant and applying to the crop, crop part, seed of said
crop or the area under cultivation, an effective amount of a
herbicide, wherein said effective amount comprises
[0159] i) an amount that is not tolerated by a first control crop
when applied to the first control crop, crop part, seed or the area
of cultivation, wherein said first control crop expresses a first
polynucleotide that confers tolerance to glyphosate and does not
express a second polynucleotide that encodes an ALS
inhibitor-tolerant polypeptide;
[0160] ii) an amount that is not tolerated by a second control crop
when applied to the second crop, crop part, seed or the area of
cultivation, wherein said second control crop expresses the second
polynucleotide and does not express the first polynucleotide;
and,
[0161] iii) an amount that is tolerated when applied to the
glyphosate/ALS inhibitor-tolerant crop, crop part, seed, or the
area of cultivation thereof. The herbicide can comprise a
combination of herbicides that either includes or does not include
glyphosate. In specific embodiments, the combination of herbicides
comprises ALS inhibitor chemistries as discussed in further detail
below.
[0162] In another embodiment, the method of controlling weeds
comprises planting the area with a glyphosate/ALS
inhibitor-tolerant crop seeds or plant and applying to the crop,
crop part, seed of said crop or the area under cultivation, an
effective amount of a herbicide, wherein said effective amount
comprises a level that is above the recommended label use rate for
the crop, wherein said effective amount is tolerated when applied
to the glyphosate/ALS inhibitor-tolerant crop, crop part, seed, or
the area of cultivation thereof. The herbicide applied can comprise
a combination of herbicides that either includes or does not
include glyphosate. In specific embodiments, the combination of
herbicides comprises at least one ALS inhibitor chemistries as
discussed in further detail below. Further herbicides and
combinations thereof that can be employed in the various methods of
the invention are discussed in further detail below.
[0163] In another non-limiting embodiment, the herbicide applied in
any method disclosed herein does not comprise glyphosate,
chlorimuron-methyl, rimsulfuron, tribenuron-methyl or
thifensufuron-methyl.
[0164] a. Types of Herbicides
[0165] Any herbicide can be applied to the glyphosate/ALS
inhibitor-tolerant crop, crop part, or the area of cultivation
containing said crop plant. Classifications of herbicides (i.e.,
the grouping of herbicides into classes and subclasses) is
well-known in the art and includes classifications by HRAC
(Herbicide Resistance Action Committee) and WSSA (the Weed Science
Society of America) (see also, Retzinger and Mallory-Smith (1997)
Weed Technology 11: 384-393). An abbreviated version of the HRAC
classification (with notes regarding the corresponding WSSA group)
is set forth below in Table 1.
[0166] Herbicides can be classified by their mode of action and/or
site of action and can also be classified by the time at which they
are applied (e.g., preemergent or postemergent), by the method of
application (e.g., foliar application or soil application), or by
how they are taken up by or affect the plant. For example,
thifensulfuron-methyl and tribenuron-methyl are applied to the
foliage of a crop (e.g., maize) and are generally metabolized
there, while rimsulfuron and chlorimuron-ethyl are generally taken
up through both the roots and foliage of a plant. "Mode of action"
generally refers to the metabolic or physiological process within
the plant that the herbicide inhibits or otherwise impairs, whereas
"site of action" generally refers to the physical location or
biochemical site within the plant where the herbicide acts or
directly interacts. Herbicides can be classified in various ways,
including by mode of action and/or site of action (see, e.g., Table
1).
[0167] Often, a herbicide-tolerance gene that confers tolerance to
a particular herbicide or other chemical on a plant expressing it
will also confer tolerance to other herbicides or chemicals in the
same class or subclass, for example, a class or subclass set forth
in Table 1. Thus, in some embodiments of the invention, a
transgenic plant of the invention is tolerant to more than one
herbicide or chemical in the same class or subclass, such as, for
example, an inhibitor of PPO, a sulfonylurea, or a synthetic
auxin.
[0168] Typically, the plants of the present invention can tolerate
treatment with different types of herbicides (i.e., herbicides
having different modes of action and/or different sites of action)
as well as with higher amounts of herbicides than previously known
plants, thereby permitting improved weed management strategies that
are recommended in order to reduce the incidence and prevalence of
herbicide-tolerant weeds. Specific herbicide combinations can be
employed to effectively control weeds.
[0169] The invention thereby provides a transgenic crop plant which
can be selected for use in crop production based on the prevalence
of herbicide-tolerant weed species in the area where the transgenic
crop is to be grown. Methods are known in the art for assessing the
herbicide tolerance of various weed species. Weed management
techniques are also known in the art, such as for example, crop
rotation using a crop that is tolerant to a herbicide to which the
local weed species are not tolerant. A number of entities monitor
and publicly report the incidence and characteristics of
herbicide-tolerant weeds, including the Herbicide Resistance Action
Committee (HRAC), the Weed Science Society of America, and various
state agencies (see, e.g., see, for example, herbicide tolerance
scores for various broadleaf weeds from the 2004 Illinois
Agricultural Pest Management Handbook), and one of skill in the art
would be able to use this information to determine which crop and
herbicide combinations should be used in a particular location.
[0170] These entities also publish advice and guidelines for
preventing the development and/or appearance of and controlling the
spread of herbicide tolerant weeds (see, e.g., Owen and Hartzler
(2004), 2005 Herbicide Manual for Agricultural Professionals, Pub.
WC 92 Revised (Iowa State University Extension, Iowa State
University of Science and Technology, Ames, Iowa); Weed Control for
Corn, Soybeans, and Sorghum, Chapter 2 of "2004 Illinois
Agricultural Pest Management Handbook" (University of Illinois
Extension, University of Illinois at Urbana-Champaign, Ill.)); Weed
Control Guide for Field Crops, MSU Extension Bulletin E434
(Michigan State University, East Lansing, Mich.)).
TABLE-US-00001 TABLE 1 Abbreviated version of HRAC Herbicide
Classification I. ALS Inhibitors (WSSA Group 2) A. Sulfonylureas 1.
Azimsulfuron 2. Chlorimuron-ethyl 3. Metsulfuron-methyl 4.
Nicosulfuron 5. Rimsulfuron 6. Sulfometuron-methyl 7.
Thifensulfuron-methyl 8. Tribenuron-methyl 9. Amidosulfuron 10.
Bensulfuron-methyl 11. Chlorsulfuron 12. Cinosulfuron 13.
Cyclosulfamuron 14. Ethametsulfuron-methyl 15. Ethoxysulfuron 16.
Flazasulfuron 17. Flupyrsulfuron-methyl 18. Foramsulfuron 19.
Imazosulfuron 20. Iodosulfuron-methyl 21. Mesosulfuron-methyl 22.
Oxasulfuron 23. Primisulfuron-methyl 24. Prosulfuron 25.
Pyrazosulfuron-ethyl 26. Sulfosulfuron 27. Triasulfuron 28.
Trifloxysulfuron 29. Triflusulfuron-methyl 30. Tritosulfuron 31.
Halosulfuron-methyl 32. Flucetosulfuron B.
Sulfonylaminocarbonyltriazolinones 1. Flucarbazone 2. Procarbazone
C. Triazolopyrimidines 1. Cloransulam-methyl 2. Flumetsulam 3.
Diclosulam 4. Florasulam 5. Metosulam 6. Penoxsulam 7. Pyroxsulam
D. Pyrimidinyloxy(thio)benzoates 1. Bispyribac 2. Pyriftalid 3.
Pyribenzoxim 4. Pyrithiobac 5. Pyriminobac-methyl E. Imidazolinones
1. Imazapyr 2. Imazethapyr 3. Imazaquin 4. Imazapic 5.
Imazamethabenz-methyl 6. Imazamox II. Other Herbicides-Active
Ingredients/ Additional Modes of Action A. Inhibitors of Acetyl CoA
carboxylase (ACCase) (WSSA Group 1) 1. Aryloxyphenoxypropionates
(`FOPs`) a. Quizalofop-P-ethyl b. Diclofop-methyl c.
Clodinafop-propargyl d. Fenoxaprop-P-ethyl e. Fluazifop-P-butyl f.
Propaquizafop g. Haloxyfop-P-methyl h. Cyhalofop-butyl i.
Quizalofop-P-ethyl 2. Cyclohexanediones (`DIMs`) a. Alloxydim b.
Butroxydim c. Clethodim d. Cycloxydim e. Sethoxydim f. Tepraloxydim
g. Tralkoxydim B. Inhibitors of Photosystem II-HRAC Group C1/WSSA
Group 5 1. Triazines a. Ametryne b. Atrazine c. Cyanazine d.
Desmetryne e. Dimethametryne f. Prometon g. Prometryne h. Propazine
i. Simazine j. Simetryne k. Terbumeton l. Terbuthylazine m.
Terbutryne n. Trietazine 2. Triazinones a. Hexazinone b. Metribuzin
c. Metamitron 3. Triazolinone a. Amicarbazone 4. Uracils a.
Bromacil b. Lenacil c. Terbacil 5. Pyridazinones a. Pyrazon 6.
Phenyl carbamates a. Desmedipham b. Phenmedipham C. Inhibitors of
Photosystem II-HRAC Group C2/WSSA Group 7 1. Ureas a. Fluometuron
b. Linuron c. Chlorobromuron d. Chlorotoluron e. Chloroxuron f.
Dimefuron g. Diuron h. Ethidimuron i. Fenuron j. Isoproturon k.
Isouron l. Methabenzthiazuron m. Metobromuron n. Metoxuron o.
Monolinuron p. Neburon q. Siduron r. Tebuthiuron 2. Amides a.
Propanil b. Pentanochlor D. Inhibitors of Photosystem II-HRAC Group
C3/WSSA Group 6 1. Nitriles a. Bromofenoxim b. Bromoxynil c.
Ioxynil 2. Benzothiadiazinone (Bentazon) a. Bentazon 3.
Phenylpyridazines a. Pyridate b. Pyridafol E.
Photosystem-I-electron diversion (Bipyridyliums) (WSSA Group 22) 1.
Diquat 2. Paraquat F. Inhibitors of PPO (protoporphyrinogen
oxidase) (WSSA Group 14) 1. Diphenylethers a. Acifluorfen-Na b.
Bifenox c. Chlomethoxyfen d. Fluoroglycofen-ethyl e. Fomesafen f.
Halosafen g. Lactofen h. Oxyfluorfen 2. Phenylpyrazoles a.
Fluazolate b. Pyraflufen-ethyl 3. N-phenylphthalimides a.
Cinidon-ethyl b. Flumioxazin c. Flumiclorac-pentyl 4. Thiadiazoles
a. Fluthiacet-methyl b. Thidiazimin 5. Oxadiazoles a. Oxadiazon b.
Oxadiargyl 6. Triazolinones a. Carfentrazone-ethyl b. Sulfentrazone
7. Oxazolidinediones a. Pentoxazone 8. Pyrimidindiones a.
Benzfendizone b. Butafenicil 9. Others a. Pyrazogyl b. Profluazol
G. Bleaching: Inhibition of carotenoid biosynthesis at the phytoene
desaturase step (PDS) (WSSA Group 12) 1. Pyridazinones a.
Norflurazon 2. Pyridinecarboxamides a. Diflufenican b. Picolinafen
3. Others a. Beflubutamid b. Fluridone c. Flurochloridone d.
Flurtamone H. Bleaching: Inhibition of 4-
hydroxyphenyl-pyruvate-dioxygenase (4-HPPD) (WSSA Group 28) 1.
Triketones a. Mesotrione b. Sulcotrione 2. Isoxazoles a.
Isoxachlortole b. Isoxaflutole 3. Pyrazoles a. Benzofenap b.
Pyrazoxyfen c. Pyrazolynate 4. Others a. Benzobicyclon I.
Bleaching: Inhibition of carotenoid biosynthesis (unknown target)
(WSSA Group 11 and 13) 1. Triazoles (WSSA Group 11) a. Amitrole 2.
Isoxazolidinones (WSSA Group 13) a. Clomazone 3. Ureas a.
Fluometuron 3. Diphenylether a. Aclonifen J. Inhibition of EPSP
Synthase 1. Glycines (WSSA Group 9) a. Glyphosate b. Sulfosate K.
Inhibition of glutamine synthetase 1. Phosphinic Acids a.
Glufosinate-ammonium b. Bialaphos L. Inhibition of DHP
(dihydropteroate) synthase (WSSA Group 18) 1 Carbamates a. Asulam
M. Microtubule Assembly Inhibition (WSSA Group 3) 1.
Dinitroanilines a. Benfluralin b. Butralin c. Dinitramine d.
Ethalfluralin e. Oryzalin
f. Pendimethalin g. Trifluralin 2. Phosphoroamidates a.
Amiprophos-methyl b. Butamiphos 3. Pyridines a. Dithiopyr b.
Thiazopyr 4. Benzamides a. Pronamide b. Tebutam 5.
Benzenedicarboxylic acids a. Chlorthal-dimethyl N. Inhibition of
mitosis/microtubule organization WSSA Group 23) 1. Carbamates a.
Chlorpropham b. Propham c. Carbetamide O. Inhibition of cell
division (Inhibition of very long chain fatty acids as proposed
mechanism; WSSA Group 15) 1. Chloroacetamides a. Acetochlor b.
Alachlor c. Butachlor d. Dimethachlor e. Dimethanamid f.
Metazachlor g. Metolachlor h. Pethoxamid i. Pretilachlor j.
Propachlor k. Propisochlor l. Thenylchlor 2. Acetamides a.
Diphenamid b. Napropamide c. Naproanilide 3. Oxyacetamides a.
Flufenacet b. Mefenacet 4. Tetrazolinones a. Fentrazamide 5. Others
a. Anilofos b. Cafenstrole c. Indanofan d. Piperophos P. Inhibition
of cell wall (cellulose) synthesis 1. Nitriles (WSSA Group 20) a.
Dichlobenil b. Chlorthiamid 2. Benzamides (isoxaben (WSSA Group
21)) a. Isoxaben 3. Triazolocarboxamides (flupoxam) a. Flupoxam Q.
Uncoupling (membrane disruption): (WSSA Group 24) 1. Dinitrophenols
a. DNOC b. Dinoseb c. Dinoterb R. Inhibition of Lipid Synthesis by
other than ACC inhibition 1. Thiocarbamates (WSSA Group 8) a.
Butylate b. Cycloate c. Dimepiperate d. EPTC e. Esprocarb f.
Molinate g. Orbencarb h. Pebulate i. Prosulfocarb j. Benthiocarb k.
Tiocarbazil l. Triallate m. Vernolate 2. Phosphorodithioates a.
Bensulide 3. Benzofurans a. Benfuresate b. Ethofumesate 4.
Halogenated alkanoic acids (WSSA Group 26) a. TCA b. Dalapon c.
Flupropanate S. Synthetic auxins (IAA-like) (WSSA Group 4) 1.
Phenoxycarboxylic acids a. Clomeprop b. 2,4-D c. Mecoprop 2.
Benzoic acids a. Dicamba b. Chloramben c. TBA 3. Pyridine
carboxylic acids a. Clopyralid b. Fluroxypyr c. Picloram d.
Tricyclopyr 4. Quinoline carboxylic acids a. Quinclorac b.
Quinmerac 5. Others (benazolin-ethyl) a. Benazolin-ethyl T.
Inhibition of Auxin Transport 1. Phthalamates; semicarbazones (WSSA
Group 19) a. Naptalam b. Diflufenzopyr-Na U. Other Mechanism of
Action 1. Arylaminopropionic acids a. Flamprop-M-methyl/- isopropyl
2. Pyrazolium a. Difenzoquat 3. Organoarsenicals a. DSMA b. MSMA 4.
Others a. Bromobutide b. Cinmethylin c. Cumyluron d. Dazomet e.
Daimuron-methyl f. Dimuron g. Etobenzanid h. Fosamine i. Metam j.
Oxaziclomefone k. Oleic acid l. Pelargonic acid m. Pyributicarb
[0171] In one embodiment, one ALS inhibitor or at least two ALS
inhibitors are applied to the glyphosate/ALS inhibitor-tolerant
crop or area of cultivation. In one non-limiting embodiment, the
combination of ALS herbicides does not include glyphosate. The ALS
inhibitor can be applied at any effective rate that selectively
controls weeds and does not significantly damage the crop. In
specific embodiments, at least one ALS inhibitor is applied at a
level that would significantly damage an appropriate control plant.
In other embodiments, at least one ALS inhibitor is applied above
the recommended label use rate for the crop. In still other
embodiments, a mixture of ALS inhibitors is applied at a lower rate
than the recommended use rate and weeds continue to be selectively
controlled. Herbicides that inhibit acetolactate synthase (also
known as acetohydroxy acid synthase) and are therefore useful in
the methods of the invention include sulfonylureas as listed in
Table 1, including agriculturally suitable salts (e.g., sodium
salts) thereof; sulfonylaminocarbonyltriazolinones as listed in
Table 1, including agriculturally suitable salts (e.g., sodium
salts) thereof; triazolopyrimidines as listed in Table 1, including
agriculturally suitable salts (e.g., sodium salts) thereof;
pyrimidinyloxy(thio)benzoates as listed in Table 1, including
agriculturally suitable salts (e.g., sodium salts) thereof; and
imidazolinones as listed in Table 1, including agriculturally
suitable salts (e.g., sodium salts) there. In some embodiments,
methods of the invention comprise the use of a sulfonylurea which
is not chlorimuron-ethyl, chlorsulfuron, rimsulfuron,
thifensulfuron-methyl, or tribenuron-methyl.
[0172] In still further methods, glyphosate, in combination with
another herbicide of interest, can be applied to the glyphosate/ALS
inhibitor-tolerant plants or their area of cultivation.
Non-limiting examples of glyphosate formations are set forth in
Table 2. In specific embodiments, the glyphosate is in the form of
a salt, such as, ammonium, isopropylammonium, potassium, sodium
(including sesquisodium) or trimesium (alternatively named
sulfosate). In still further embodiments, a mixture of a
synergistically effective amount of a combination of glyphosate and
an ALS inhibitor (such as a sulfonylurea) is applied to the
glyphosate/ALS inhibitor-tolerant plants or their area of
cultivation.
TABLE-US-00002 TABLE 2 Glyphosate formulations comparisons. Active
Acid Acid ingredient equivalent Apply: equivalent Herbicide by
Registered per per fl oz/ per Trademark Manufacturer Salt gallon
gallon acre acre Roundup Original Monsanto Isopropylamine 4 3 32
0.750 Roundup Original II Monsanto Isopropylamine 4 3 32 0.750
Roundup Original MAX Monsanto Potassium 5.5 4.5 22 0.773 Roundup
UltraMax Monsanto Isopropylamine 5 3.68 26 0.748 Roundup UltraMax
II Monsanto Potassium 5.5 4.5 22 0.773 Roundup Weathermax Monsanto
Potassium 5.5 4.5 22 0.773 Touchdown Syngenta Diammomium 3.7 3 32
0.750 Touchdown HiTech Syngenta Potassium 6.16 5 20 0.781 Touchdown
Total Syngenta Potassium 5.14 4.17 24 0.782 Durango Dow
AgroSciences Isopropylamine 5.4 4 24 0.750 Glyphomax Dow
AgroSciences Isopropylamine 4 3 32 0.750 Glyphomax Plus Dow
AgroSciences Isopropylamine 4 3 32 0.750 Glyphomax XRT Dow
AgroSciences Isopropylamine 4 3 32 0.750 Gly Star Plus Albaugh/Agri
Star Isopropylamine 4 3 32 0.750 Gly Star 5 Albaugh/Agri Star
Isopropylamine 5.4 4 24 0.750 Gly Star Original Albaugh/Agri Star
Isopropylamine 4 3 32 0.750 Gly-Flo Micro Flo Isopropylamine 4 3 32
0.750 Credit Nufarm Isopropylamine 4 3 32 0.750 Credit Extra Nufarm
Isopropylamine 4 3 32 0.750 Credit Duo Nufarm Isopro.+ 4 3 32 0.750
monoamm. Credit Duo Extra Nufarm Isopro.+ 4 3 32 0.750 monoamm.
Extra Credit 5 Nufarm Isopropylamine 5 3.68 26 0.748 Cornerstone
Agriliance Isopropylamine 4 3 32 0.750 Cornerstone Plus Agriliance
Isopropylamine 4 3 32 0.750 Glyfos Cheminova Isopropylamine 4 3 32
0.750 Glyfos X-TRA Cheminova Isopropylamine 4 3 32 0.750 Rattler
Helena Isopropylamine 4 3 32 0.750 Rattler Plus Helena
Isopropylamine 4 3 32 0.750 Mirage UAP Isopropylamine 4 3 32 0.750
Mirage Plus UAP Isopropylamine 4 3 32 0.750 Glyphosate 41% Helm
Agro USA Isopropylamine 4 3 32 0.750 Buccaneer Tenkoz
Isopropylamine 4 3 32 0.750 Buccaneer Plus Tenkoz Isopropylamine 4
3 32 0.750 Honcho Monsanto Isopropylamine 4 3 32 0.750 Honcho Plus
Monsanto Isopropylamine 4 3 32 0.750 Gly-4 Univ. Crop Prot. Alli.
Isopropylamine 4 3 32 0.750 Gly-4 Plus Univ. Crop Prot. Alli.
Isopropylamine 4 3 32 0.750 ClearOut 41 Chemical Products
Isopropylamine 4 3 32 0.750 Tech. ClearOut 41 Plus Chemical
Products Isopropylamine 4 3 32 0.750 Tech. Spitfire Control
Soultions Isopropylamine 4 3 32 0.750 Spitfire Plus Control
Soultions Isopropylamine 4 3 32 0.750 Glyphosate 4 FarmerSaver.com
Isopropylamine 4 3 32 0.750 FS Glyphosate Plus Growmark
Isopropylamine 4 3 32 0.750 Glyphosate Original Griffin, LLC.
Isopropylamine 4 3 32 0.750
[0173] Thus, in some embodiments, a transgenic plant of the
invention is used in a method of growing a glyphosate/ALS
inhibitor-tolerant crop by the application of herbicides to which
the plant is tolerant. In this manner, treatment with a combination
of one of more herbicides which include, but are not limited to:
acetochlor, acifluorfen and its sodium salt, aclonifen, acrolein
(2-propenal), alachlor, alloxydim, ametryn, amicarbazone,
amidosulfuron, aminopyralid, amitrole, ammonium sulfamate,
anilofos, asulam, atrazine, azimsulfuron, beflubutamid, benazolin,
benazolin-ethyl, bencarbazone, benfluralin, benfuresate,
bensulfuron-methyl, bensulide, bentazone, benzobicyclon,
benzofenap, bifenox, bilanafos, bispyribac and its sodium salt,
bromacil, bromobutide, bromofenoxim, bromoxynil, bromoxynil
octanoate, butachlor, butafenacil, butamifos, butralin, butroxydim,
butylate, cafenstrole, carbetamide, carfentrazone-ethyl, catechin,
chlomethoxyfen, chloramben, chlorbromuron, chlorflurenol-methyl,
chloridazon, chlorimuron-ethyl, chlorotoluron, chlorpropham,
chlorsulfuron, chlorthal-dimethyl, chlorthiamid, cinidon-ethyl,
cinmethylin, cinosulfuron, clethodim, clodinafop-propargyl,
clomazone, clomeprop, clopyralid, clopyralid-olamine,
cloransulam-methyl, CUH-35 (2-methoxyethyl
2-[[[4-chloro-2-fluoro-5-[(1-methyl-2-propynyl)oxy]phenyl](3-fluoro-benzo-
yl)amino]carbonyl]-1-cyclohexene-1-carboxylate), cumyluron,
cyanazine, cycloate, cyclosulfamuron, cycloxydim, cyhalofop-butyl,
2,4-D and its butotyl, butyl, isoctyl and isopropyl esters and its
dimethylammonium, diolamine and trolamine salts, daimuron, dalapon,
dalapon-sodium, dazomet, 2,4-DB and its dimethylammonium, potassium
and sodium salts, desmedipham, desmetryn, dicamba and its
diglycolammonium, dimethylammonium, potassium and sodium salts,
dichlobenil, dichlorprop, diclofop-methyl, diclosulam, difenzoquat
metilsulfate, diflufenican, diflufenzopyr, dimefuron, dimepiperate,
dimethachlor, dimethametryn, dimethenamid, dimethenamid-P,
dimethipin, dimethylarsinic acid and its sodium salt, dinitramine,
dinoterb, diphenamid, diquat dibromide, dithiopyr, diuron, DNOC,
endothal, EPTC, esprocarb, ethalfluralin, ethametsulfuron-methyl,
ethofumesate, ethoxyfen, ethoxysulfuron, etobenzanid,
fenoxaprop-ethyl, fenoxaprop-P-ethyl, fentrazamide, fenuron,
fenuron-TCA, flamprop-methyl, flamprop-M-isopropyl,
flamprop-M-methyl, flazasulfuron, florasulam, fluazifop-butyl,
fluazifop-P-butyl, flucarbazone, flucetosulfuron, fluchloralin,
flufenacet, flufenpyr, flufenpyr-ethyl, flumetsulam,
flumiclorac-pentyl, flumioxazin, fluometuron, fluoroglycofen-ethyl,
flupyrsulfuron-methyl and its sodium salt, flurenol,
flurenol-butyl, fluridone, fluorochloridone, fluoroxypyr,
flurtamone, fluthiacet-methyl, fomesafen, foramsulfuron,
fosamine-ammonium, glufosinate, glufosinate-ammonium, glyphosate
and its salts such as ammonium, isopropylammonium, potassium,
sodium (including sesquisodium) and trimesium (alternatively named
sulfosate), halosulfuron-methyl, haloxyfop-etotyl,
haloxyfop-methyl, hexazinone, HOK-201
(N-(2,4-difluorophenyl)-1,5-dihydro-N-(1-methylethyl)-5-oxo-1-[(t-
etrahydro-2H-pyran-2-yl)methyl]-4H-1,2,4-triazole-4-carboxamide),
imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin,
imazaquin-ammonium, imazethapyr, imazethapyr-ammonium,
imazosulfuron, indanofan, iodosulfuron-methyl, ioxynil, ioxynil
octanoate, ioxynil-sodium, isoproturon, isouron, isoxaben,
isoxaflutole, isoxachlortole, lactofen, lenacil, linuron, maleic
hydrazide, MCPA and its salts (e.g., MCPA-dimethylammonium,
MCPA-potassium and MCPA-sodium, esters (e.g., MCPA-2-ethylhexyl,
MCPA-butotyl) and thioesters (e.g., MCPA-thioethyl), MCPB and its
salts (e.g., MCPB-sodium) and esters (e.g., MCPB-ethyl), mecoprop,
mecoprop-P, mefenacet, mefluidide, mesosulfuron-methyl, mesotrione,
metam-sodium, metamifop, metamitron, metazachlor,
methabenzthiazuron, methylarsonic acid and its calcium,
monoammonium, monosodium and disodium salts, methyldymron,
metobenzuron, metobromuron, metolachlor, S-metholachlor, metosulam,
metoxuron, metribuzin, metsulfuron-methyl, molinate, monolinuron,
naproanilide, napropamide, naptalam, neburon, nicosulfinuron,
norflurazon, orbencarb, oryzalin, oxadiargyl, oxadiazon,
oxasulfuron, oxaziclomefone, oxyfluorfen, paraquat dichloride,
pebulate, pelargonic acid, pendimethalin, penoxsulam, pentanochlor,
pentoxazone, perfluidone, pethoxyamid, phenmedipham, picloram,
picloram-potassium, picolinafen, pinoxaden, piperofos,
pretilachlor, primisulfuron-methyl, prodiamine, profoxydim,
prometon, prometryn, propachlor, propanil, propaquizafop,
propazine, propham, propisochlor, propoxycarbazone, propyzamide,
prosulfocarb, prosulfuron, pyraclonil, pyraflufen-ethyl,
pyrasulfotole, pyrazogyl, pyrazolynate, pyrazoxyfen,
pyrazosulfuron-ethyl, pyribenzoxim, pyributicarb, pyridate,
pyriftalid, pyriminobac-methyl, pyrimisulfan, pyrithiobac,
pyrithiobac-sodium, pyroxsulam, quinclorac, quinmerac,
quinoclamine, quizalofop-ethyl, quizalofop-P-ethyl,
quizalofop-P-tefuryl, rimsulfuron, sethoxydim, siduron, simazine,
simetryn, sulcotrione, sulfentrazone, sulfometuron-methyl,
sulfosulfuron, 2,3,6-TBA, TCA, TCA-sodium, tebutam, tebuthiuron,
tefuryltrione, tembotrione, tepraloxydim, terbacil, terbumeton,
terbuthylazine, terbutryn, thenylchlor, thiazopyr, thiencarbazone,
thifensulfuron-methyl, thiobencarb, tiocarbazil, topramezone,
tralkoxydim, tri-allate, triasulfuron, triaziflam,
tribenuron-methyl, triclopyr, triclopyr-butotyl,
triclopyr-triethylammonium, tridiphane, trietazine,
trifloxysulfuron, trifluralin, triflusulfuron-methyl, tritosulfuron
and vernolate.
[0174] Other suitable herbicides and agricultural chemicals are
known in the art, such as, for example, those described in WO
2005/041654. Other herbicides also include bioherbicides such as
Alternaria destruens Simmons, Colletotrichum gloeosporiodes (Penz.)
Penz. & Sacc., Drechsiera monoceras (MTB-951), Myrothecium
verrucaria (Albertini & Schweinitz) Ditmar: Fries, Phytophthora
palmivora (Butyl.) Butyl. and Puccinia thlaspeos Schub.
Combinations of various herbicides can result in a
greater-than-additive (i.e., synergistic) effect on weeds and/or a
less-than-additive effect (i.e. safening) on crops or other
desirable plants. In certain instances, combinations of glyphosate
with other herbicides having a similar spectrum of control but a
different mode of action will be particularly advantageous for
preventing the development of resistant weeds. Herbicidally
effective amounts of any particular herbicide can be easily
determined by one skilled in the art through simple
experimentation.
[0175] Herbicides may be classified into groups and/or subgroups as
described herein above with reference to their mode of action, or
they may be classified into groups and/or subgroups in accordance
with their chemical structure.
[0176] Sulfonamide herbicides have as an essential molecular
structure feature a sulfonamide moiety (--S(O).sub.2NH--). As
referred to herein, sulfonamide herbicides particularly comprise
sulfonylurea herbicides, sulfonylaminocarbonyltriazolinone
herbicides and triazolopyrimidine herbicides. In sulfonylurea
herbicides the sulfonamide moiety is a component in a sulfonylurea
bridge (--S(O).sub.2NHC(O)NH(R)--). In sulfonylurea herbicides the
sulfonyl end of the sulfonylurea bridge is connected either
directly or by way of an oxygen atom or an optionally substituted
amino or methylene group to a typically substituted cyclic or
acyclic group. At the opposite end of the sulfonylurea bridge, the
amino group, which may have a substituent such as methyl (R being
CH.sub.3) instead of hydrogen, is connected to a heterocyclic
group, typically a symmetric pyrimidine or triazine ring, having
one or two substituents such as methyl, ethyl, trifluoromethyl,
methoxy, ethoxy, methylamino, dimethylamino, ethylamino and the
halogens. In sulfonylaminocarbonyltriazolinone herbicides, the
sulfonamide moiety is a component is a sulfonylaminocarbonyl bridge
(--S(O).sub.2NHC(O)--). In sulfonylamino-carbonyltriazolinone
herbicides the sulfonyl end of the sulfonylaminocarbonyl bridge is
typically connected to substituted phenyl ring. At the opposite end
of the sulfonylaminocarbonyl bridge, the carbonyl is connected to
the 1-position of a triazolinone ring, which is typically
substituted with groups such as alkyl and alkoxy. In
triazolopyrimidine herbicides the sulfonyl end of the sulfonamide
moiety is connected to the 2-position of a substituted
[1,2,4]triazolopyrimidine ring system and the amino end of the
sulfonamide moiety is connected to a substituted aryl, typically
phenyl, group or alternatively the amino end of the sulfonamide
moiety is connected to the 2-position of a substituted
[1,2,4]triazolopyrimidine ring system and the sulfonyl end of the
sulfonamide moiety is connected to a substituted aryl, typically
pyridinyl, group.
[0177] Representative of the sulfonylurea herbicides useful in the
present invention are those of the formula:
##STR00001##
wherein: [0178] J is selected from the group consisting of
[0178] ##STR00002## ##STR00003## [0179] J is
R.sup.13SO.sub.2N(CH.sub.3)--; [0180] R is H or CH.sub.3; [0181]
R.sup.1 is F, Cl, Br, NO.sub.2, C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 haloalkyl, C.sub.3-C.sub.4 cycloalkyl,
C.sub.2-C.sub.4 haloalkenyl, C.sub.1-C.sub.4 alkoxy,
C.sub.1-C.sub.4 haloalkoxy, C.sub.2-C.sub.4 alkoxyalkoxy,
CO.sub.2R.sup.14, C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20, CH.sub.2CN or L; [0182] R.sup.2
is H, F, Cl, Br, I, CN, CH.sub.3, OCH.sub.3, SCH.sub.3, CF.sub.3 or
OCF.sub.2H; [0183] R.sup.3 is Cl, NO.sub.2, CO.sub.2CH.sub.3,
CO.sub.2CH.sub.2CH.sub.3, C(O)CH.sub.3, C(O)CH.sub.2CH.sub.3,
C(O)-cyclopropyl, SO.sub.2N(CH.sub.3).sub.2, SO.sub.2CH.sub.3,
SO.sub.2CH.sub.2CH.sub.3, OCH.sub.3 or OCH.sub.2CH.sub.3; [0184]
R.sup.4 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2 haloalkyl,
C.sub.1-C.sub.2 alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br,
NO.sub.2, CO.sub.2R.sup.14, C(O)NR.sup.15R.sup.16,
SO.sub.2NR.sup.17R.sup.18, S(O).sub.nR.sup.19, C(O)R.sup.20 or L;
[0185] R.sup.5 is H, F, Cl, Br or CH.sub.3; [0186] R.sup.6 is
C.sub.1-C.sub.3 alkyl optionally substituted with 0-3 F, 0-1 Cl and
0-1 C.sub.3-C.sub.4 alkoxyacetyloxy, or R.sup.6 is C.sub.1-C.sub.2
alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br, CO.sub.2R.sup.14,
C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20 or L; [0187] R.sup.7 is H, F, Cl,
CH.sub.3 or CF.sub.3; [0188] R.sup.8 is H, C.sub.1-C.sub.3 alkyl or
pyridinyl; [0189] R.sup.9 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2
alkoxy, F, Cl, Br, NO.sub.2, CO.sub.2R.sup.14,
SO.sub.2NR.sup.17R.sup.18, S(O).sub.nR.sup.19, OCF.sub.2H,
C(O)R.sup.20, C.sub.2-C.sub.4 haloalkenyl or L; [0190] R.sup.10 is
H, Cl, F, Br, C.sub.1-C.sub.3 alkyl or C.sub.1-C.sub.2 alkoxy;
[0191] R.sup.11 is H, C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2
alkoxy, C.sub.2-C.sub.4 haloalkenyl, F, Cl, Br, CO.sub.2R.sup.14,
C(O)NR.sup.15R.sup.16, SO.sub.2NR.sup.17R.sup.18,
S(O).sub.nR.sup.19, C(O)R.sup.20 or L; [0192] R.sup.12 is halogen,
C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.3 alkylsulfonyl; [0193]
R.sup.13 is C.sub.1-C.sub.4 alkyl; [0194] R.sup.14 is allyl,
propargyl or oxetan-3-yl; or R.sup.14 is C.sub.1-C.sub.3 alkyl
optionally substituted by at least one member independently
selected from halogen, C.sub.1-C.sub.2 alkoxy and CN; [0195]
R.sup.15 is H, C.sub.1-C.sub.3 alkyl or C.sub.1-C.sub.2 alkoxy;
[0196] R.sup.16 is C.sub.1-C.sub.2 alkyl; [0197] R.sup.17 is H,
C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.2 alkoxy, allyl or
cyclopropyl; [0198] R.sup.18 is H or C.sub.1-C.sub.3 alkyl; [0199]
R.sup.19 is C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.3 haloalkyl, allyl
or propargyl; [0200] R.sup.20 is C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 haloalkyl or C.sub.3-C.sub.5 cycloalkyl optionally
substituted by halogen; [0201] n is 0, 1 or 2; [0202] L is
[0202] ##STR00004## [0203] L.sup.1 is CH.sub.2, NH or O; [0204]
R.sup.21 is H or C.sub.1-C.sub.3 alkyl; [0205] X is H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4
haloalkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4
haloalkylthio, C.sub.1-C.sub.4 alkylthio, halogen, C.sub.2-C.sub.5
alkoxyalkyl, C.sub.2-C.sub.5 alkoxyalkoxy, amino, C.sub.1-C.sub.3
alkylamino or di(C.sub.1-C.sub.3 alkyl)amino; [0206] Y is H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4
haloalkoxy, C.sub.1-C.sub.4 alkylthio, C.sub.1-C.sub.4
haloalkylthio, C.sub.2-C.sub.5 alkoxyalkyl, C.sub.2-C.sub.5
alkoxyalkoxy, amino, C.sub.1-C.sub.3 alkylamino, di(C.sub.1-C.sub.3
alkyl)amino, C.sub.3-C.sub.4 alkenyloxy, C.sub.3-C.sub.4
alkynyloxy, C.sub.2-C.sub.5 alkylthioalkyl, C.sub.2-C.sub.5
alkylsulfinylalkyl, C.sub.2-C.sub.5 alkylsulfonylalkyl,
C.sub.1-C.sub.4 haloalkyl, C.sub.2-C.sub.4 alkynyl, C.sub.3-C.sub.5
cycloalkyl, azido or cyano; and [0207] Z is CH or N;
[0208] provided that (i) when one or both of X and Y is C.sub.1
haloalkoxy, then Z is CH; and (ii) when X is halogen, then Z is CH
and Y is OCH.sub.3, OCH.sub.2CH.sub.3, N(OCH.sub.3)CH.sub.3,
NHCH.sub.3, N(CH.sub.3).sub.2 or OCF.sub.2H. Of note is the present
single liquid herbicide composition comprising one or more
sulfonylureas of Formula I wherein when R.sup.6 is alkyl, said
alkyl is unsubstituted.
[0209] Representative of the triazolopyrimidine herbicides
contemplated for use in this invention are those of the
formula:
##STR00005##
wherein: [0210] R.sup.22 and R.sup.23 each independently halogen,
nitro, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 haloalkyl,
C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkoxy or
C.sub.2-C.sub.3 alkoxycarbonyl; [0211] R.sup.24 is H, halogen,
C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy; [0212] W is
--NHS(O).sub.2-- or --S(O).sub.2NH--; [0213] Y.sup.1 is H,
C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy; [0214] Y.sup.2 is
H, F, Cl, Br, C.sub.1-C.sub.2 alkyl or C.sub.1-C.sub.2 alkoxy;
[0215] Y.sup.3 is H, F or methoxy; [0216] Z.sup.1 is CH or N; and
[0217] Z.sup.2 is CH or N; provided that at least one of Y.sup.1
and Y.sup.2 is other than H.
[0218] In the above Markush description of representative
triazolopyrimidine herbicides, when W is --NHS(O).sub.2-- the
sulfonyl end of the sulfonamide moiety is connected to the
[1,2,4]triazolopyrimidine ring system, and when W is
--S(O).sub.2NH-- the amino end of the sulfonamide moiety is
connected to the [1,2,4]triazolopyrimidine ring system.
[0219] In the above recitations, the term "alkyl", used either
alone or in compound words such as "alkylthio" or "haloalkyl"
includes straight-chain or branched alkyl, such as, methyl, ethyl,
n-propyl, i-propyl, or the different butyl isomers. "Cycloalkyl"
includes, for example, cyclopropyl, cyclobutyl and cyclopentyl.
"Alkenyl" includes straight-chain or branched alkenes such as
ethenyl, 1-propenyl, 2-propenyl, and the different butenyl isomers.
"Alkenyl" also includes polyenes such as 1,2-propadienyl and
2,4-butadienyl. "Alkynyl" includes straight-chain or branched
alkynes such as ethynyl, 1-propynyl, 2-propynyl and the different
butynyl isomers. "Alkynyl" can also include moieties comprised of
multiple triple bonds such as 2,5-hexadiynyl. "Alkoxy" includes,
for example, methoxy, ethoxy, n-propyloxy, isopropyloxy and the
different butoxy isomers. "Alkoxyalkyl" denotes alkoxy substitution
on alkyl. Examples of "alkoxyalkyl" include CH.sub.3OCH.sub.2,
CH.sub.3OCH.sub.2CH.sub.2, CH.sub.3CH.sub.2OCH.sub.2,
CH.sub.3CH.sub.2CH.sub.2CH.sub.2OCH.sub.2 and
CH.sub.3CH.sub.2OCH.sub.2CH.sub.2. "Alkoxyalkoxy" denotes alkoxy
substitution on alkoxy. "Alkenyloxy" includes straight-chain or
branched alkenyloxy moieties. Examples of "alkenyloxy" include
H.sub.2C.dbd.CHCH.sub.2O, (CH.sub.3)CH.dbd.CHCH.sub.2O and
CH.sub.2.dbd.CHCH.sub.2CH.sub.2O. "Alkynyloxy" includes
straight-chain or branched alkynyloxy moieties. Examples of
"alkynyloxy" include HC.ident.CCH.sub.2O and
CH.sub.3C.ident.CCH.sub.2O. "Alkylthio" includes branched or
straight-chain alkylthio moieties such as methylthio, ethylthio,
and the different propylthio isomers. "Alkylthioalkyl" denotes
alkylthio substitution on alkyl. Examples of "alkylthioalkyl"
include CH.sub.3SCH.sub.2, CH.sub.3SCH.sub.2CH.sub.2,
CH.sub.3CH.sub.2SCH.sub.2,
CH.sub.3CH.sub.2CH.sub.2CH.sub.2SCH.sub.2 and
CH.sub.3CH.sub.2SCH.sub.2CH.sub.2; "alkylsulfinylalkyl" and
"alkylsulfonyl-alkyl" include the corresponding sulfoxides and
sulfones, respectively. Other substituents such as "alkylamino",
"dialkylamino" are defined analogously.
[0220] The total number of carbon atoms in a substituent group is
indicated by the "C.sub.i-C.sub.j" prefix where i and j are numbers
from 1 to 5. For example, C.sub.1-C.sub.4 alkyl designates methyl
through butyl, including the various isomers. As further examples,
C.sub.2 alkoxyalkyl designates CH.sub.3OCH.sub.2; C.sub.3
alkoxyalkyl designates, for example, CH.sub.3CH(OCH.sub.3),
CH.sub.3OCH.sub.2CH.sub.2 or CH.sub.3CH.sub.2OCH.sub.2; and C.sub.4
alkoxyalkyl designates the various isomers of an alkyl group
substituted with an alkoxy group containing a total of four carbon
atoms, examples including CH.sub.3CH.sub.2CH.sub.2OCH.sub.2 and
CH.sub.3CH.sub.2OCH.sub.2CH.sub.2.
[0221] The term "halogen", either alone or in compound words such
as "haloalkyl", includes fluorine, chlorine, bromine or iodine.
Further, when used in compound words such as "haloalkyl", said
alkyl may be partially or fully substituted with halogen atoms
which may be the same or different. Examples of "haloalkyl" include
F.sub.3C, ClCH.sub.2, CF.sub.3CH.sub.2 and CF.sub.3CCl.sub.2. The
terms "haloalkoxy", "haloalkylthio", and the like, are defined
analogously to the term "haloalkyl". Examples of "haloalkoxy"
include CF.sub.3O, CCl.sub.3CH.sub.2O, HCF.sub.2CH.sub.2CH.sub.2O
and CF.sub.3CH.sub.2O. Examples of "haloalkylthio" include
CCl.sub.3S, CF.sub.3S, CCl.sub.3CH.sub.2S and
ClCH.sub.2CH.sub.2CH.sub.2S.
[0222] The following sulfonylurea herbicides illustrate the
sulfonylureas useful for this invention: amidosulfuron
(N-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]-sulfonyl]-N-met-
hylmethanesulfonamide), azimsulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-1-methyl-4-(2-methyl-2H-
-tetrazol-5-yl)-1H-pyrazole-5-sulfonamide),
bensulfuron-methyl(methyl
2-[[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]methyl]-
benzoate), chlorimuron-ethyl (ethyl
2-[[[[(4-chloro-6-methoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-be-
nzoate), chlorsulfuron
(2-chloro-N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]-carbonyl]benz-
enesulfonamide), cinosulfuron
(N-[[(4,6-dimethoxy-1,3,5-triazin-2-yl)amino]carbonyl]-2-(2-methoxyethoxy-
)benzenesulfonamide), cyclosulfamuron
(N-[[[2-(cyclopropylcarbonyl)phenyl]amino]sulfonyl]-N.sup.1-(4,6-dimethox-
ypyrimidin-2-yl)urea), ethametsulfuron-methyl(methyl
2-[[[[[4-ethoxy-6-(methylamino)-1,3,5-triazin-2-yl]amino]carbonyl]amino]s-
ulfonyl]benzoate), ethoxysulfuron
(2-ethoxyphenyl[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]sulfamate),
flazasulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(trifluoromethyl)-2-p-
yridinesulfonamide), flucetosulfuron
(1-[3-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-2-p-
yridinyl]-2-fluoropropyl methoxyacetate), flupyrsulfuron-methyl
(methyl
2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-6-(trif-
luoromethyl)-3-pyridinecarboxylate), foramsulfuron
(2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-4-(for-
mylamino)-N,N-dimethylbenzamide), halosulfuron-methyl(methyl
3-chloro-5-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]-carbonyl]amino]sulfony-
l]-1-methyl-1H-pyrazole-4-carboxylate), imazosulfuron
(2-chloro-N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]imidazo[1,2-a]p-
yridine-3-sulfonamide), iodosulfuron-methyl(methyl
4-iodo-2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]-
sulfonyl]benzoate), mesosulfuron-methyl(methyl
2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-4-[[(me-
thylsulfonyl)-amino]methyl]benzoate), metsulfuron-methyl(methyl
2-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]sulfony-
l]benzoate), nicosulfuron
(2-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-N,N-di-
methyl-3-pyridinecarboxamide), oxasulfuron (3-oxetanyl
2-[[[[(4,6-dimethyl-2-pyrimidinyl)-amino]carbonyl]amino]sulfonyl]benzoate-
), primisulfuron-methyl(methyl
2-[[[[[4,6-bis(trifluoromethoxy)-2-pyrimidinyl]amino]carbonyl]amino]sulfo-
nyl]benzoate), prosulfuron
(N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]-2-(3,3,3-trif-
luoropropyl)benzenesulfonamide), pyrazosulfuron-ethyl (ethyl
5-[[[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-1-methy-
l-1H-pyrazole-4-carboxylate), rimsulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-3-(ethylsulfonyl)-2-pyr-
idinesulfonamide), sulfometuron-methyl (methyl
2-[[[[(4,6-dimethyl-2-pyrimidinyl)amino]carbonyl]amino]sulfonyl]-benzoate-
), sulfosulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]carbonyl]-2-(ethylsulfonyl)imidaz-
o[1,2-a]pyridine-3-sulfonamide), thifensulfuron-methyl (methyl
3-[[[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carbonyl]amino]sulfony-
l]-2-thiophenecarboxylate), triasulfuron
(2-(2-chloroethoxy)-N-[[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)amino]carb-
onyl]benzenesulfonamide), tribenuron-methyl (methyl
2-[[[[N-(4-methoxy-6-methyl-1,3,5-triazin-2-yl)-N-methylamino]carbonyl]-a-
mino]sulfonyl]benzoate), trifloxysulfuron
(N-[[(4,6-dimethoxy-2-pyrimidinyl)amino]-carbonyl]-3-(2,2,2-trifluoroetho-
xy)-2-pyridinesulfonamide), triflusulfuron-methyl (methyl
2-[[[[[4-dimethylamino)-6-(2,2,2-trifluoroethoxy)-1,3,5-triazin-2-yl]amin-
o]-carbonyl]amino]sulfonyl]-3-methylbenzoate) and tritosulfuron
(N-[[[4-methoxy-6-(trifluoromethyl)-1,3,5-triazin-2-yl]amino]carbonyl]-2--
(trifluoromethyl)benzene-sulfonamide).
[0223] The following triazolopyrimidine herbicides illustrate the
triazolopyrimidines useful for this invention:
cloransulam-methyl(methyl
3-chloro-2-[[(5-ethoxy-7-fluoro-[1,2,4]triazolo[1,5-c]pyrimidin-2-yl)sulf-
onyl]amino]benzoate, diclosulam
(N-(2,6-dichlorophenyl)-5-ethoxy-7-fluoro[1,2,4]triazolo[1,5-c]pyrimidine-
-2-sulfonamide, florasulam
(N-(2,6-difluorophenyl)-8-fluoro-5-methoxy[1,2,4]triazolo[1,5-c]pyrimidin-
e-2-sulfonamide), flumetsulam
(N-(2,6-difluorophenyl)-5-methyl[1,2,4]triazolo[1,5-a]pyrimidine-2-sulfon-
amide), metosulam
(N-(2,6-dichloro-3-methylphenyl)-5,7-dimethoxy[1,2,4]triazolo[1,5-a]pyrim-
idine-2-sulfonamide), penoxsulam
(2-(2,2-difluoroethoxy)-N-(5,8-dimethoxy[1,2,4]triazolo[1,5-c]pyrimidin-2-
-yl)-6-(trifluoromethyl)benzenesulfonamide) and pyroxsulam
(N-(5,7-dimethoxy[1,2,4]triazolo[1,5-a]pyrimidin-2-yl)-2-methoxy-4-(trifl-
uoromethyl)-3-pyridinesulfonamide).
[0224] The following sulfonylaminocarbonyltriazolinone herbicides
illustrate the sulfonylaminocarbonyltriazolinones useful for this
invention: flucarbazone
(4,5-dihydro-3-methoxy-4-methyl-5-oxo-N-[[2-(trifluoromethoxy)phenyl]sulf-
onyl]-1H-1,2,4-triazole-1-carboxamide) and procarbazone (methyl
2-[[[(4,5-dihydro-4-methyl-5-oxo-3-propoxy-1H-1,2,4-triazol-1-yl)carbonyl-
]amino]sulfonyl]benzoate).
[0225] Additional herbicides include phenmedipham, triazolinones,
and the herbicides disclosed in WO2006/012981, herein incorporated
by reference in its entirety.
[0226] The methods further comprise applying to the crop and the
weeds in the field a sufficient amount of at least one herbicide to
which the crop seeds or plants is tolerant, such as, for example,
glyphosate, a hydroxyphenylpyruvatedioxygenase inhibitor (e.g.,
mesotrione or sulcotrione), a phytoene desaturase inhibitor (e.g.,
diflufenican), a pigment synthesis inhibitor, sulfonamide,
imidazolinone, bialaphos, phosphinothricin, azafenidin,
butafenacil, sulfosate, glufosinate, triazolopyrimidine,
pyrimidinyloxy(thio)benzoate, or sulonylaminocarbonyltriazolinone,
an acetyl Co-A carboxylase inhibitor such as quizalofop-P-ethyl, a
synthetic auxin such as quinclorac, or a protox inhibitor to
control the weeds without significantly damaging the crop
plants.
[0227] b. Effective Amount of a Herbicide
[0228] Generally, the effective amount of herbicide applied to the
field is sufficient to selectively control the weeds without
significantly affecting the crop. "Weed" as used herein refers to a
plant which is not desirable in a particular area. Conversely, a
"crop plant" as used herein refers to a plant which is desired in a
particular area, such as, for example, a soybean plant. Thus, in
some embodiments, a weed is a non-crop plant or a non-crop species,
while in some embodiments, a weed is a crop species which is sought
to be eliminated from a particular area, such as, for example, an
inferior and/or non-transgenic maize plant in a field planted with
transgenic maize, or a soybean plant in a field planted with corn.
Weeds can be either classified into two major groups: monocots and
dicots.
[0229] Many plant species can be controlled (i.e., killed or
damaged) by the herbicides described herein. Accordingly, the
methods of the invention are useful in controlling these plant
species where they are undesirable (i.e., where they are weeds).
These plant species include crop plants as well as species commonly
considered weeds, including but not limited to species such as:
blackgrass (Alopecurus myosuroides), giant foxtail (Setaria
faberi), large crabgrass (Digitaria sanguinalis), Surinam grass
(Brachiaria decumbens), wild oat (Avena fatua), common cocklebur
(Xanthium pensylvanicum), common lambsquarters (Chenopodium album),
morning glory (Ipomoea coccinea), pigweed (Amaranthus spp.),
velvetleaf (Abutilion theophrasti), common barnyardgrass
(Echinochloa crus-galli), bermudagrass (Cynodon dactylon), downy
brome (Bromus tectorum), goosegrass (Eleusine indica), green
foxtail (Setaria viridis), Italian ryegrass (Lolium multiflorum),
Johnsongrass (Sorghum halepense), lesser canarygrass (Phalaris
minor), windgrass (Apera spica-venti), wooly cupgrass (Erichloa
villosa), yellow nutsedge (Cyperus esculentus), common chickweed
(Stellaria media), common ragweed (Ambrosia artemisiifolia), Kochia
scoparia, horseweed (Conyza canadensis), rigid ryegrass (Lolium
rigidum), goosegrass (Eleucine indica), hairy fleabane (Conyza
bonariensis), buckhorn plantain (Plantago lanceolata), tropical
spiderwort (Commelina benghalensis), field bindweed (Convolvulus
arvensis), purple nutsedge (Cyperus rotundus), redvine (Brunnichia
ovata), hemp sesbania (Sesbania exaltata), sicklepod (Senna
obtusifolia), Texas blueweed (Helianthus ciliaris), and Devil's
claws (Proboscidea louisianica). In other embodiments, the weed
comprises a herbicide-resistant ryegrass, for example, a glyphosate
resistant ryegrass, a paraquat resistant ryegrass, a
ACCase-inhibitor resistant ryegrass, and a non-selective herbicide
resistant ryegrass. In some embodiments, the undesired plants are
proximate the crop plants.
[0230] As used herein, by "selectively controlled" is intended that
the majority of weeds in an area of cultivation are significantly
damaged or killed, while if crop plants are also present in the
field, the majority of the crop plants are not significantly
damaged. Thus, a method is considered to selectively control weeds
when at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more
of the weeds are significantly damaged or killed, while if crop
plants are also present in the field, less than 45%, 40%, 35%, 30%,
25%, 20%, 15%, 10%, 5%, or 1% of the crop plants are significantly
damaged or killed.
[0231] In some embodiments, a glyphosate/ALS inhibitor-tolerant
plant of the invention is not significantly damaged by treatment
with a particular herbicide applied to that plant at a dose
equivalent to a rate of at least 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100, 110, 120, 150, 170, 200, 300, 400, 500,
600, 700, 800, 800, 1000, 2000, 3000, 4000, 5000 or more grams or
ounces (1 ounce=29.57 ml) of active ingredient or commercial
product or herbicide formulation per acre or per hectare, whereas
an appropriate control plant is significantly damaged by the same
treatment.
[0232] In specific embodiments, an effective amount of an ALS
inhibitor herbicide comprises at least about 0.1, 1, 5, 10, 25, 50,
75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 750,
800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, or more grams or
ounces (1 ounce=29.57 ml) of active ingredient per hectare. In
other embodiments, an effective amount of an ALS inhibitor
comprises at least about 0.1-50, about 25-75, about 50-100, about
100-110, about 110-120, about 120-130, about 130-140, about
140-150, about 150-200, about 200-500, about 500-600, about
600-800, about 800-1000, or greater grams or ounces (1 ounce=29.57
ml) of active ingredient per hectare. Any ALS inhibitor, for
example, those listed in Table 1 can be applied at these
levels.
[0233] In other embodiments, an effective amount of a sulfonylurea
comprises at least 0.1, 1, 5, 10, 25, 50, 75, 100, 150, 200, 250,
300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 5000 or more
grams or ounces (1 ounce=29.57 ml) of active ingredient per
hectare. In other embodiments, an effective amount of a
sulfonylurea comprises at least about 0.1-50, about 25-75, about
50-100, about 100-110, about 110-120, about 120-130, about 130-140,
about 140-150, about 150-160, about 160-170, about 170-180, about
190-200, about 200-250, about 250-300, about 300-350, about
350-400, about 400-450, about 450-500, about 500-550, about
550-600, about 600-650, about 650-700, about 700-800, about
800-900, about 900-1000, about 1000-2000, or more grams or ounces
(1 ounce=29.57 ml) of active ingredient per hectare. Representative
sulfonylureas that can be applied at this level are set forth in
Table 1.
[0234] In other embodiments, an effective amount of a
sulfonylaminocarbonyltriazolinones, triazolopyrimidines,
pyrimidinyloxy(thio)benzoates, and imidazolinones can comprise at
least about 0.1, 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300,
350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950,
1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1500, 1550,
1600, 1650, 1700, 1800, 1850, 1900, 1950, 2000, 2500, 3500, 4000,
4500, 5000 or greater grams or ounces (1 ounce=29.57 ml) active
ingredient per hectare. In other embodiments, an effective amount
of a sulfonyluminocarbonyltriazolines, triazolopyrimidines,
pyrimidinyloxy(thio)benzoates, or imidazolinones comprises at least
about 0.1-50, about 25-75, about 50-100, about 100-110, about
110-120, about 120-130, about 130-140, about 140-150, about
150-160, about 160-170, about 170-180, about 190-200, about
200-250, about 250-300, about 300-350, about 350-400, about
400-450, about 450-500, about 500-550, about 550-600, about
600-650, about 650-700, about 700-800, about 800-900, about
900-1000, about 1000-2000, or more grams or ounces (1 ounce=29.57
ml) active ingredient per hectare.
[0235] Additional ranges of the effective amounts of herbicides can
be found, for example, in various publications from University
Extension services. See, for example, Bernards et al. (2006) Guide
for Weed Management in Nebraska
(www.ianrpubs.url.edu/sendlt/ec130); Regher et al. (2005) Chemical
Weed Control for Fields Crops, Pastures, Rangeland, and
Noncropland, Kansas State University Agricultural Extension Station
and Corporate Extension Service; Zollinger et al. (2006) North
Dakota Weed Control Guide, North Dakota Extension Service, and the
Iowa State University Extension at www.weeds.iastate.edu, each of
which is herein incorporated by reference.
[0236] In some embodiments of the invention, glyphosate is applied
to an area of cultivation and/or to at least one plant in an area
of cultivation at rates between 8 and 32 ounces of acid equivalent
per acre, or at rates between 10, 12, 14, 16, 18, 20, 22, 24, 26,
28, and 30 ounces of acid equivalent per acre at the lower end of
the range of application and between 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, and 32 ounces of acid equivalent per acre at the higher
end of the range of application (1 ounce=29.57 ml). In other
embodiments, glyphosate is applied at least at 1, 5, 10, 20, 30,
40, 50, 60, 70, 80, 90 or greater ounce of active ingredient per
hectare (1 ounce=29.57 ml). In some embodiments of the invention, a
sulfonylurea herbicide is applied to a field and/or to at least one
plant in a field at rates between 0.04 and 1.0 ounces of active
ingredient per acre, or at rates between 0.1, 0.2, 0.4, 0.6, and
0.8 ounces of active ingredient per acre at the lower end of the
range of application and between 0.2, 0.4, 0.6, 0.8, and 1.0 ounces
of active ingredient per acre at the higher end of the range of
application. (1 ounce=29.57 ml)
[0237] As is known in the art, glyphosate herbicides as a class
contain the same active ingredient, but the active ingredient is
present as one of a number of different salts and/or formulations.
However, herbicides known to inhibit ALS vary in their active
ingredient as well as their chemical formulations. One of skill in
the art is familiar with the determination of the amount of active
ingredient and/or acid equivalent present in a particular volume
and/or weight of herbicide preparation.
[0238] In some embodiments, an ALS inhibitor herbicide is employed.
Rates at which the ALS inhibitor herbicide is applied to the crop,
crop part, seed or area of cultivation can be any of the rates
disclosed herein. In specific embodiments, the rate for the ALS
inhibitor herbicide is about 0.1 to about 5000 g ai/hectare, about
0.5 to about 300 g ai/hectare, or about 1 to about 150 g
ai/hectare.
[0239] Generally, a particular herbicide is applied to a particular
field (and any plants growing in it) no more than 1, 2, 3, 4, 5, 6,
7, or 8 times a year, or no more than 1, 2, 3, 4, or 5 times per
growing season.
[0240] By "treated with a combination of" or "applying a
combination of" herbicides to a crop, area of cultivation or field"
is intended that a particular field, crop or weed is treated with
each of the herbicides and/or chemicals indicated to be part of the
combination so that desired effect is achieved, i.e., so that weeds
are selectively controlled while the crop is not significantly
damaged. In some embodiments, weeds which are susceptible to each
of the herbicides exhibit damage from treatment with each of the
herbicides which is additive or synergistic. The application of
each herbicide and/or chemical may be simultaneous or the
applications may be at different times, so long as the desired
effect is achieved. Furthermore, the application can occur prior to
the planting of the crop.
[0241] The proportions of herbicides used in the methods of the
invention with other herbicidal active ingredients in herbicidal
compositions are generally in the ratio of 5000:1 to 1:5000, 1000:1
to 1:1000, 100:1 to 1:100, 10:1 to 1:10 or 5:1 to 1:5 by weight.
The optimum ratios can be easily determined by those skilled in the
art based on the weed control spectrum desired. Moreover, any
combinations of ranges of the various herbicides disclosed in Table
3 can also be applied in the methods of the invention.
[0242] Thus, in some embodiments, the invention provides improved
methods for selectively controlling weeds in a field wherein the
total herbicide application may be less than 90%, 85%, 80%, 75%,
70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%,
5%, or 1% of that used in other methods. Similarly, in some
embodiments, the amount of a particular herbicide used for
selectively controlling weeds in a field may be less than 90%, 85%,
80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%,
15%, 10%, 5%, or 1% of the amount of that particular herbicide that
would be used in other methods, i.e., methods not utilizing a plant
of the invention.
[0243] In some embodiments, a glyphosate/ALS inhibitor-tolerant
plant of the invention benefits from a synergistic effect wherein
the herbicide tolerance conferred by a polypeptide that confers
resistance to glyphosate (i.e., GAT) and at least an ALS
inhibitor-tolerant polypeptide is greater than expected from simply
combining the herbicide tolerance conferred by each gene separately
to a transgenic plant containing them individually. See, e.g.,
McCutchen et al. (1997) J. Econ. Entomol. 90: 1170-1180; Priesler
et al. (1999) J. Econ. Entomol. 92: 598-603. As used herein, the
terms "synergy," "synergistic," "synergistically" and derivations
thereof, such as in a "synergistic effect" or a "synergistic
herbicide combination" or a "synergistic herbicide composition"
refer to circumstances under which the biological activity of a
combination of herbicides, such as at least a first herbicide and a
second herbicide, is greater than the sum of the biological
activities of the individual herbicides. Synergy, expressed in
terms of a "Synergy Index (SI)," generally can be determined by the
method described by F. C. Kull, et al., Applied Microbiology 9, 538
(1961). See also Colby S. R., "Calculating Synergistic and
Antagonistic Responses of Herbicide Combinations," Weeds 15, 20-22
(1967).
[0244] In other instances, the herbicide tolerance conferred on a
glyphosate/ALS inhibitor-tolerant plant of the invention is
additive; that is, the herbicide tolerance profile conferred by the
herbicide tolerance genes is what would be expected from simply
combining the herbicide tolerance conferred by each gene separately
to a transgenic plant containing them individually. Additive and/or
synergistic activity for two or more herbicides against key weed
species will increase the overall effectiveness and/or reduce the
actual amount of active ingredient(s) needed to control said weeds.
Where such synergy is observed, the plant of the invention may
display tolerance to a higher dose or rate of herbicide and/or the
plant may display tolerance to additional herbicides or other
chemicals beyond those to which it would be expected to display
tolerance. For example, a plant containing a GAT gene and an HRA
gene may show tolerance to organophosphate compounds such as
insecticides and/or inhibitors of 4-hydroxyphenylpyruvate
dioxygenase.
[0245] Thus, for example, glyphosate/ALS inhibitor-tolerant plants
of the invention can exhibit greater than expected tolerance to
various herbicides, including but not limited to glyphosate, ALS
inhibitor chemistries, and sulfonylurea herbicides. The
glyphosate/ALS inhibitor-tolerant plants of the invention may show
tolerance to a particular herbicide or herbicide combination that
is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%,
20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
80%, 90%, 100%, 125%, 150%, 175%, 200%, 300%, 400%, or 500% or more
higher than the tolerance of an appropriate control plant that
contains only a single herbicide tolerance gene which confers
tolerance to the same herbicide or herbicide combination. Thus,
glyphosate/ALS inhibitor-tolerant plants of the invention may show
decreased damage from the same dose of herbicide in comparison to
an appropriate control plant, or they may show the same degree of
damage in response to a much higher dose of herbicide than the
control plant. Accordingly, in specific embodiments, a particular
herbicide used for selectively containing weeds in a field is more
than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%,
80%, 90%, 100% or greater than the amount of that particular
herbicide that would be used in other methods, i.e., methods not
utilizing a plant of the invention.
[0246] In the same manner, in some embodiments, a glyphosate/ALS
inhibitor-tolerant plant of the invention shows improved tolerance
to a particular formulation of a herbicide active ingredient in
comparison to an appropriate control plant. Herbicides are sold
commercially as formulations which typically include other
ingredients in addition to the herbicide active ingredient; these
ingredients are often intended to enhance the efficacy of the
active ingredient. Such other ingredients can include, for example,
safeners and adjuvants (see, e.g., Green and Foy (2003) "Adjuvants:
Tools for Enhancing Herbicide Performance," in Weed Biology and
Management, ed. Inderjit (Kluwer Academic Publishers, The
Netherlands)). Thus, a glyphosate/ALS inhibitor-tolerant plant of
the invention can show tolerance to a particular formulation of a
herbicide (e.g., a particular commercially available herbicide
product) that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
12%, 15%, 17%, 20%, 22%, 25%, 27%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 300%, 400%,
500%, 600%, 700%, 800%, 900%, 1000%, 1100%, 1200%, 1300%, 1400%,
1500%, 1600%, 1700%, 1800%, 1900%, or 2000% or more higher than the
tolerance of an appropriate control plant that contains only a
single herbicide tolerance gene which confers tolerance to the same
herbicide formulation.
[0247] In some embodiments, a glyphosate/ALS inhibitor-tolerant
plant of the invention shows improved tolerance to a herbicide or
herbicide class to which the at least one other herbicide tolerance
gene confers tolerance as well as improved tolerance to at least
one other herbicide or chemical which has a different mechanism or
basis of action than either glyphosate or the herbicide
corresponding to said at least one other herbicide tolerance gene.
This surprising benefit of the invention finds use in methods of
growing crops that comprise treatment with various combinations of
chemicals, including, for example, other chemicals used for growing
crops. Thus, for example, a glyphosate/ALS inhibitor-tolerant maize
plant of the invention (i.e., a GAT/HRA plant) may also show
improved tolerance to chlorpyrifos, a systemic organophosphate
insecticide which interferes with the ability of maize to
metabolize herbicide via interference with the cytochrome P450
gene. Thus, the invention also provides a transgenic plant
comprising a sequence that confers tolerance to glyphosate (i.e., a
GAT gene) and a sulfonylurea herbicide tolerance gene which shows
improved tolerance to chemicals which affect the cytochrome P450
gene, and methods of use thereof. In some embodiments,
glyphosate/ALS inhibitor-tolerant plants of the invention
comprising, for example, a GAT gene and a sulfonylurea herbicide
tolerance gene also show improved tolerance to dicamba. In these
embodiments, the improved tolerance to dicamba may be evident in
the presence of glyphosate and a sulfonylurea herbicide.
[0248] In other methods, a herbicide combination is applied over a
glyphosate/ALS inhibitor-tolerant plant of the invention, where the
herbicide combination produces either an additive or a synergistic
effect for controlling weeds. Such combinations of herbicides can
allow the application rate to be reduced, a broader spectrum of
undesired vegetation to be controlled, improved control of the
undesired vegetation with fewer applications, more rapid onset of
the herbicidal activity, or more prolonged herbicidal activity.
[0249] An "additive herbicidal composition" has a herbicidal
activity that is about equal to the observed activities of the
individual components. A "synergistic herbicidal combination" has a
herbicidal activity higher than what can be expected based on the
observed activities of the individual components when used alone.
Accordingly, the presently disclosed subject matter provides a
synergistic herbicide combination, wherein the degree of weed
control of the mixture exceeds the sum of control of the individual
herbicides. In some embodiments, the degree of weed control of the
mixture exceeds the sum of control of the individual herbicides by
any statistically significant amount including, for example, about
1% to 5%, about 5% to about 10%, about 10% to about 20%, about 20%
to about 30%, about 30% to 40%, about 40% to about 50%, about 50%
to about 60%, about 60% to about 70%, about 70% to about 80%, about
80% to about 90%, about 90% to about 100%, about 100% to 120% or
greater. Further, a "synergistically effective amount" of a
herbicide refers to the amount of one herbicide necessary to elicit
a synergistic effect in another herbicide present in the herbicide
composition. Thus, the term "synergist," and derivations thereof,
refer to a substance that enhances the activity of an active
ingredient (ai), i.e., a substance in a formulation from which a
biological effect is obtained, for example, a herbicide.
[0250] Accordingly, in some embodiments, the presently disclosed
subject matter provides a method for controlling weeds in an area
of cultivation. In some embodiments, the method comprises: (a)
planting the area with crop seeds or crop plants, wherein the crop
seeds or crop plants comprise: (i) a first polynucleotide encoding
a polypeptide that can confer tolerance to glyphosate operably
linked to a promoter active in the crop seeds or crop plants; and
(ii) a second polynucleotide encoding an ALS inhibitor-tolerant
polypeptide operable linked to a promoter active in the crop seeds
or crop plants; and (b) applying to the weed, the crop plants, a
crop part, the area of cultivation, or a combination thereof, an
effective amount of a herbicide composition comprising at least one
of a synergistically effective amount of glyphosate and a
synergistically effective amount of an ALS inhibitor (for example,
but not limited to, a sulfonylurea herbicide), or agriculturally
suitable salts thereof, wherein at least one of: (i) the
synergistically effective amount of the glyphosate is lower than an
amount of glyphosate required to control the weeds in the absence
of the sulfonylurea herbicide; (ii) the synergistically effective
amount of the ALS inhibitor herbicide is lower than an amount of
the ALS inhibitor required to control the weeds in the absence of
glyphosate; and (iii) combinations thereof; and wherein the
effective amount of the herbicide composition is tolerated by the
crop seeds or crop plants and controls the weeds in the area of
cultivation.
[0251] As described in more detail hereinabove, in some
embodiments, the first polynucleotide encodes a
glyphosate-N-acetyltransferase. More particularly, in some
embodiments, the first polynucleotide encodes a glyphosate-tolerant
5-enolpyruvylshikimate-3-phosphate synthase or a
glyphosate-tolerant glyphosate oxido-reductase. Further, as also
described in more detail hereinabove, the ALS inhibitor-tolerant
polypeptide comprises a mutated acetolactate synthase polypeptide.
In some embodiments, the mutated acetolactate synthase polypeptide
comprises HRA.
[0252] In some embodiments, the herbicide composition used in the
presently disclosed method for controlling weeds comprises a
synergistically effective amount of glyphosate and a sulfonylurea
herbicide. In further embodiments, the presently disclosed
synergistic herbicide composition comprises glyphosate and a
sulfonylurea herbicide selected from the group consisting of
metsulfuron-methyl, chlorsulfuron, and triasulfuron.
[0253] In particular embodiments, the synergistic herbicide
combination further comprises an adjuvant such as, for example, an
ammonium sulfate-based adjuvant, e.g., ADD-UP.RTM. (Wenkem S.A.,
Halfway House, Midrand, South Africa). In additional embodiments,
the presently disclosed synergistic herbicide compositions comprise
an additional herbicide, for example, an effective amount of a
pyrimidinyloxy(thio)benzoate herbicide. In some embodiments, the
pyrimidinyloxy(thio)benzoate herbicide comprises bispyribac, e.g.,
(VELOCITY.RTM., Valent U.S.A. Corp., Walnut Creek, Calif., United
States of America), or an agriculturally suitable salt thereof.
[0254] In some embodiments of the presently disclosed method for
controlling undesired plants, the glyphosate is applied
pre-emergence, post-emergence or pre- and post-emergence to the
undesired plants or plant crops; and the ALS inhibitor herbicide
(i.e., the sulfonylurea herbicide) is applied pre-emergence,
post-emergence or pre- and post-emergence to the undesired plants
or plant crops. In other embodiments, the glyphosate and the ALS
inhibitor herbicide (i.e., the sulfonylurea herbicide) are applied
together or are applied separately. In yet other embodiments, the
synergistic herbicide composition is applied, e.g. step (b) above,
at least once prior to planting the crop(s) of interest, e.g., step
(a) above.
[0255] While the glyphosate/ALS inhibitor-tolerant plants of the
invention are tolerant to many herbicides, they are not tolerant to
several herbicides, such as, for example, dinitroaniline, ACCase,
and chloroacetamide herbicides. Thus, methods of the invention that
comprise the control of weeds may also make use of these treatments
to control glyphosate/ALS inhibitor-tolerant plants, such as, for
example, "volunteer" glyphosate/ALS inhibitor-tolerant plants crops
that arise in a field that has been planted or replanted with a
different crop.
[0256] Weeds that can be difficult to control with glyphosate alone
in fields where a crop is grown (such as, for example, a soybean
crop) include but are not limited to the following: horseweed
(e.g., Conyza canadensis); rigid ryegrass (e.g., Lolium rigidum);
goosegrass (e.g., Eleusine indica); Italian ryegrass (e.g., Lolium
multiflorum); hairy fleabane (e.g., Conyza bonariensis); buckhorn
plantain (e.g., Plantago lanceolata); common ragweed (e.g.,
Ambrosia artemisifolia); morning glory (e.g., Ipomoea spp.);
waterhemp (e.g., Amaranthus spp.); field bindweed (e.g.,
Convolvulus arvensis); yellow nutsedge (e.g., Cyperus esculentus);
common lambsquarters (e.g., Chenopodium album); wild buckwheat
(e.g., Polygonium convolvulus); velvetleaf (e.g., Abutilon
theophrasti); kochia (e.g., Kochia scoparia); and Asiatic dayflower
(e.g., Commelina spp.). In areas where such weeds are found, the
glyphosate/ALS inhibitor-tolerant plants of the invention (GAT-HRA
plants) are particularly useful in allowing the treatment of a
field (and therefore any crop growing in the field) with
combinations of herbicides that would cause unacceptable damage to
crop plants that did not contain both of these polynucleotides.
Plants of the invention that are tolerant to glyphosate and other
herbicides such as, for example, sulfonylurea, imidazolinone,
triazolopyrimidine, pyrimidinyl(thio)benzoate, and/or
sulfonylaminocarbonyltriazolinone herbicides in addition to being
tolerant to at least one other herbicide with a different mode of
action or site of action are particularly useful in situations
where weeds are tolerant to at least two of the same herbicides to
which the plants are tolerant. In this manner, plants of the
invention make possible improved control of weeds that are tolerant
to more than one herbicide.
[0257] For example, some commonly used treatments for weed control
in fields where current commercial crops (including, for example,
soybeans) are grown include glyphosate and, optionally, 2,4-D; this
combination, however, has some disadvantages. Particularly, there
are weed species that it does not control well and it also does not
work well for weed control in cold weather. Another commonly used
treatment for weed control in soybean fields is the sulfonylurea
herbicide chlorimuron-ethyl, which has significant residual
activity in the soil and thus maintains selective pressure on all
later-emerging weed species, creating a favorable environment for
the growth and spread of sulfonylurea-resistant weeds. However, the
glyphosate/ALS inhibitor-tolerant plants (i.e., GAT-HRA plants of
the invention), including glyphosate/ALS inhibitor-tolerant soybean
plants (i.e., GAT-HRA soybean plants), can be treated with
herbicides (e.g., chlorimuron-ethyl) and combinations of herbicides
that would cause unacceptable damage to standard plant varieties.
Thus, for example, fields containing the glyphosate/ALS
inhibitor-tolerant soybean plant (i.e., GAT-HRA soybean plants) can
be treated with sulfonylurea, imidazolinone, triazolopyrimidines,
pyrimidinyl(thio)benzoates, and/or
sulfonylaminocarbonyltriazonlinone such as the sulfonylurea
chlorimuron-ethyl, either alone or in combination with other
herbicides. For example, fields containing soybean plants of the
invention can be treated with a combination of glyphosate and
tribenuron-methyl (available commercially as Express.RTM.). This
combination has several advantages for weed control under some
circumstances, including the use of herbicides with different modes
of action and the use of herbicides having a relatively short
period of residual activity in the soil. A herbicide having a
relatively short period of residual activity is desirable, for
example, in situations where it is important to reduce selective
pressure that would favor the growth of herbicide-tolerant weeds.
Of course, in any particular situation where weed control is
required, other considerations may be more important, such as, for
example, the need to prevent the development of and/or appearance
of weeds in a field prior to planting a crop by using a herbicide
with a relatively long period of residual activity. The
glyphosate/ALS inhibitor-tolerant soybean plants can also be
treated with herbicide combinations that include at least one of
nicosulfuron, metsulfuron-methyl, tribenuron-methyl,
thifensulfuron-methyl, and/or rimsulfuron. Treatments that include
both tribenuron-methyl and thifensulfuron-methyl may be
particularly useful.
[0258] Other commonly used treatments for weed control in fields
where current commercial varieties of crops (including, for
example, soybeans) are grown include the sulfonylurea herbicide
thifensulfuron-methyl (available commercially as Harmony GT.RTM.).
However, one disadvantage of thifensulfuron-methyl is that the
higher application rates required for consistent weed control often
cause injury to a crop growing in the same field. The
glyphosate/ALS inhibitor-tolerant plants of the invention,
including soybean plants, can be treated with a combination of
glyphosate and thifensulfuron-methyl, which has the advantage of
using herbicides with different modes of action. Thus, weeds that
are resistant to either herbicide alone are controlled by the
combination of the two herbicides, and the glyphosate/ALS
inhibitor-tolerant plants of the invention are not significantly
damaged by the treatment.
[0259] Other herbicides which are used for weed control in fields
where current commercial varieties of crops (including, for
example, soybeans) are grown are the triazolopyrimidine herbicide
cloransulam-methyl (available commercially as FirstRate.RTM.) and
the imidazolinone herbicide imazaquin (available commercially as
Sceptor.RTM.). When these herbicides are used individually they may
provide only marginal control of weeds. However, fields containing
the glyphosate/ALS inhibitor-tolerant plants of the invention,
including soybean plants, can be treated, for example, with a
combination of glyphosate (e.g., Roundup.RTM. (glyphosate
isopropylamine salt)), imazapyr (currently available commercially
as Arsenal.RTM.), chlorimuron-ethyl (currently available
commercially as Classic.RTM.), quizalofop-P-ethyl (currently
available commercially as Assure II.RTM.), and fomesafen (currently
available commercially as Flexstar.RTM.). This combination has the
advantage of using herbicides with different modes of action. Thus,
weeds that are tolerant to just one or several of these herbicides
are controlled by the combination of the five herbicides, and the
glyphosate/ALS inhibitor-tolerant plants of the invention are not
significantly damaged by treatment with this herbicide combination.
This combination provides an extremely broad spectrum of protection
against the type of herbicide-tolerant weeds that might be expected
to arise and spread under current weed control practices.
[0260] Fields containing the glyphosate/ALS inhibitor-tolerant
plants of the invention (i.e., GAT/HRA plants), including soybean
plants, may also be treated, for example, with a combination of
herbicides including glyphosate, rimsulfuron, and dicamba or
mesotrione. This combination may be particularly useful in
controlling weeds which have developed some tolerance to herbicides
which inhibit ALS. Another combination of herbicides which may be
particularly useful for weed control includes glyphosate and at
least one of the following: metsulfuron-methyl (commercially
available as Ally.RTM.)), imazapyr (commercially available as
Arsenal.RTM.), imazethapyr, imazaquin, and sulfentrazone. It is
understood that any of the combinations discussed above or
elsewhere herein may also be used to treat areas in combination
with any other herbicide or agricultural chemical.
[0261] Some commonly-used treatments for weed control in fields
where current commercial crops (including, for example, maize) are
grown include glyphosate (currently available commercially as
Roundup.RTM.), rimsulfuron (currently available commercially as
Resolve.RTM. or Matrix.RTM.), dicamba (commercially available as
Clarity.RTM.), atrazine, and mesotrione (commercially available as
Callisto.RTM.). These herbicides are sometimes used individually
due to poor crop tolerance to multiple herbicides. Unfortunately,
when used individually, each of these herbicides has significant
disadvantages. Particularly, the incidence of weeds that are
tolerant to individual herbicides continues to increase, rendering
glyphosate less effective than desired in some situations.
Rimsulfuron provides better weed control at high doses which can
cause injury to a crop, and alternatives such as dicamba are often
more expensive than other commonly-used herbicides. However,
glyphosate/ALS inhibitor-tolerant plants (i.e., GAT-HRA plants) of
the invention, including glyphosate/ALS inhibitor-tolerant maize
plants, can be treated with herbicides and combinations of
herbicides that would cause unacceptable damage to standard plant
varieties, including combinations of herbicides that comprise
rimsulfuron and/or dicamba. Other suitable combinations of
herbicides for use with glyphosate/ALS inhibitor-tolerant plants of
the invention include glyphosate, sulfonylurea, imidazolinone,
triazolopyrimidine, pyrimidinyloxy(thio)benzoates, and/or
sulfonylaminocarbonyltriazonlinone herbicides, including, for
example, and at least one of the following: metsulfuron-methyl,
tribenuron-methyl, chlorimuron-ethyl, imazethapyr, imazapyr, and
imazaquin.
[0262] For example, glyphosate/ALS inhibitor-tolerant maize plants
(i.e. GAT/HRA plants) can be treated with a combination of
glyphosate and rimsulfuron, or a combination or rimsulfuron and at
least one other herbicide. Glyphosate/ALS inhibitor plants (i.e.,
GAT-HRA plants) can also be treated with a combination of
glyphosate, rimsulfuron, and dicamba, or a combination of
glyphosate, rimsulfuron, and at least one other herbicide. In some
embodiments, the at least one other herbicide has a different mode
of action than both glyphosate and rimsulfuron. The combination of
glyphosate, rimsulfuron, and dicamba has the advantage that these
herbicides have different modes of action and short residual
activity, which decreases the risk of incidence and spread of
herbicide-tolerant weeds.
[0263] Some commonly-used treatments for weed control in fields
where current commercial crops (including, for example, cotton) are
grown include glyphosate (currently available commercially as
Roundup.RTM.), chlorimuron-ethyl, tribenuron-methyl, rimsulfuron
(currently available commercially as Resolve.RTM. or Matrix.RTM.),
imazethapyr, imazapyr, and imazaquin. Unfortunately, when used
individually, each of these herbicides has significant
disadvantages. Particularly, the incidence of weeds that are
tolerant to individual herbicides continues to increase, rendering
each individual herbicide less effective than desired in some
situations. However, glyphosate/ALS inhibitor-tolerant plants of
the invention, including cotton plants, can be treated with a
combination of herbicides that would cause unacceptable damage to
standard plant varieties, including combinations of herbicides that
include at least one of those mentioned above.
[0264] c. Methods of Herbicide Application
[0265] In the methods of the invention, a herbicide may be
formulated and applied to an area of interest such as, for example,
a field or area of cultivation, in any suitable manner. A herbicide
may be applied to a field in any form, such as, for example, in a
liquid spray or as solid powder or granules. In specific
embodiments, the herbicide or combination of herbicides that are
employed in the methods comprise a tankmix or a premix. A herbicide
may also be formulated, for example, as a "homogenous granule
blend" produced using blends technology (see, e.g., U.S. Pat. No.
6,022,552, entitled "Uniform Mixtures of Pesticide Granules"). The
blends technology of U.S. Pat. No. 6,022,552 produces a
nonsegregating blend (i.e., a "homogenous granule blend") of
formulated crop protection chemicals in a dry granule form that
enables delivery of customized mixtures designed to solve specific
problems. A homogenous granule blend can be shipped, handled,
subsampled, and applied in the same manner as traditional premix
products where multiple active ingredients are formulated into the
same granule.
[0266] Briefly, a "homogenous granule blend" is prepared by mixing
together at least two extruded formulated granule products. In some
embodiments, each granule product comprises a registered
formulation containing a single active ingredient which is, for
example, a herbicide, a fungicide, and/or an insecticide. The
uniformity (homogeneity) of a "homogenous granule blend" can be
optimized by controlling the relative sizes and size distributions
of the granules used in the blend. The diameter of extruded
granules is controlled by the size of the holes in the extruder
die, and a centrifugal sifting process may be used to obtain a
population of extruded granules with a desired length distribution
(see, e.g., U.S. Pat. No. 6,270,025).
[0267] A homogenous granule blend is considered to be "homogenous"
when it can be subsampled into appropriately sized aliquots and the
composition of each aliquot will meet the required assay
specifications. To demonstrate homogeneity, a large sample of the
homogenous granule blend is prepared and is then subsampled into
aliquots of greater than the minimum statistical sample size (see
Example 4).
[0268] In non-limiting embodiments, the glyphosate/ALS
inhibitor-tolerant plant (i.e., a GAT-HRA plant), including a
soybean plant, can be treated with herbicides (e.g.,
chlorimuron-ethyl and combinations of other herbicides that without
the glyphosate/ALS inhibitor-tolerant crop would have caused
unacceptable crop response to plant varieties without the
glyphosate/ALS inhibitor genetics). Thus, for example, fields
planted with and containing glyphosate/ALS inhibitor-tolerant
soybean, corn or cotton varieties (i.e., GAT/HRA plants) can be
treated with sulfonylurea, imidazolinone, triazolopyrimidine,
pyrimidinyl(thio)benzoate, and/or
sulfonylaminocarbonyltriazonlinone herbicides, either alone or in
combination with other herbicides. Since ALS inhibitor chemistries
have different herbicidal attributes, blends of ALS plus other
chemistries will provide superior weed management strategies
including varying and increased weed spectrum, the ability to
provide specified residual activity (SU/ALS inhibitor chemistry
with residual activity leads to improved foliar activity which
leads to a wider window between glyphosate applications, as well
as, an added period of control if weather conditions prohibit
timely application).
[0269] Blends also afford the ability to add other agrochemicals at
normal, labeled use rates such as additional herbicides (a
3.sup.rd/4.sup.th mechanism of action), fungicides, insecticides,
plant growth regulators and the like thereby saving costs
associated with additional applications.
[0270] Any herbicide formulation applied over the glyphosate/ALS
inhibitor-tolerant plant can be prepared as a "tank-mix"
composition. In such embodiments, each ingredient or a combination
of ingredients can be stored separately from one another. The
ingredients can then be mixed with one another prior to
application. Typically, such mixing occurs shortly before
application. In a tank-mix process, each ingredient, before mixing,
typically is present in water or a suitable organic solvent. For
additional guidance regarding the art of formulation, see T. S.
Woods, "The Formulator's Toolbox--Product Forms for Modern
Agriculture" Pesticide Chemistry and Bioscience, The
Food-Environment Challenge, T. Brooks and T. R. Roberts, Eds.,
Proceedings of the 9th International Congress on Pesticide
Chemistry, The Royal Society of Chemistry, Cambridge, 1999, pp.
120-133. See also U.S. Pat. No. 3,235,361, Col. 6, line 16 through
Col. 7, line 19 and Examples 10-41; U.S. Pat. No. 3,309,192, Col.
5, line 43 through Col. 7, line 62 and Examples 8, 12, 15, 39, 41,
52, 53, 58, 132, 138-140, 162-164, 166, 167 and 169-182; U.S. Pat.
No. 2,891,855, Col. 3, line 66 through Col. 5, line 17 and Examples
1-4; Klingman, Weed Control as a Science, John Wiley and Sons,
Inc., New York, 1961, pp 81-96; and Hance et al., Weed Control
Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989,
each of which is incorporated herein by reference in their
entirety.
[0271] The methods of the invention further allow for the
development of herbicide combinations to be used in with the
glyphosate/ALS inhibitor-tolerant plants. In such methods, the
environmental conditions in an area of cultivation are evaluated.
Environmental conditions that can be evaluated include, but are not
limited to, ground and surface water pollution concerns, intended
use of the crop, crop tolerance, soil residuals, weeds present in
area of cultivation, soil texture, pH of soil, amount of organic
matter in soil, application equipment, and tillage practices. Upon
the evaluation of the environmental conditions, an effective amount
of a combination of herbicides can be applied to the crop, crop
part, seed of the crop or area of cultivation.
[0272] d. Timing of Herbicide Application
[0273] In some embodiments, the herbicide applied to the
glyphosate/ALS inhibitor-tolerant plants of the invention serves to
prevent the initiation of growth of susceptible weeds and/or serve
to cause damage to weeds that are growing in the area of interest.
In some embodiments, the herbicide or herbicide mixture exert these
effects on weeds affecting crops that are subsequently planted in
the area of interest (i.e., field or area of cultivation). In the
methods of the invention, the application of the herbicide
combination need not occur at the same time. So long as the field
in which the crop is planted contains detectable amounts of the
first herbicide and the second herbicide is applied at some time
during the period in which the crop is in the area of cultivation,
the crop is considered to have been treated with a mixture of
herbicides according to the invention. Thus, methods of the
invention encompass applications of herbicide which are
"preemergent," "postemergent," "preplant incorporation" and/or
which involve seed treatment prior to planting.
[0274] In one embodiment, methods are provided for coating seeds.
The methods comprise coating a seed with an effective amount of a
herbicide or a combination of herbicides (as disclosed elsewhere
herein). The seeds can then be planted in an area of cultivation.
Further provided are seeds having a coating comprising an effective
amount of a herbicide or a combination of herbicides (as disclosed
elsewhere herein).
[0275] "Preemergent" refers to a herbicide which is applied to an
area of interest (e.g., a field or area of cultivation) before a
plant emerges visibly from the soil. "Postemergent" refers to a
herbicide which is applied to an area after a plant emerges visibly
from the soil. In some instances, the terms "preemergent" and
"postemergent" are used with reference to a weed in an area of
interest, and in some instances these terms are used with reference
to a crop plant in an area of interest. When used with reference to
a weed, these terms may apply to only a particular type of weed or
species of weed that is present or believed to be present in the
area of interest. While any herbicide may be applied in a
preemergent and/or postemergent treatment, some herbicides are
known to be more effective in controlling a weed or weeds when
applied either preemergence or postemergence. For example,
rimsulfuron has both preemergence and postemergence activity, while
other herbicides have predominately preemergence (metolachlor) or
postemergence (glyphosate) activity. These properties of particular
herbicides are known in the art and are readily determined by one
of skill in the art. Further, one of skill in the art would readily
be able to select appropriate herbicides and application times for
use with the transgenic plants of the invention and/or on areas in
which transgenic plants of the invention are to be planted.
"Preplant incorporation" involves the incorporation of compounds
into the soil prior to planting.
[0276] Thus, the invention provides improved methods of growing a
crop and/or controlling weeds such as, for example, "pre-planting
burn down," wherein an area is treated with herbicides prior to
planting the crop of interest in order to better control weeds. The
invention also provides methods of growing a crop and/or
controlling weeds which are "no-till" or "low-till" (also referred
to as "reduced tillage"). In such methods, the soil is not
cultivated or is cultivated less frequently during the growing
cycle in comparison to traditional methods; these methods can save
costs that would otherwise be incurred due to additional
cultivation, including labor and fuel costs.
[0277] The methods of the invention encompass the use of
simultaneous and/or sequential applications of multiple classes of
herbicides. In some embodiments, the methods of the invention
involve treating a plant of the invention and/or an area of
interest (e.g., a field or area of cultivation) and/or weed with
just one herbicide or other chemical such as, for example, a
sulfonylurea herbicide.
[0278] The time at which a herbicide is applied to an area of
interest (and any plants therein) may be important in optimizing
weed control. The time at which a herbicide is applied may be
determined with reference to the size of plants and/or the stage of
growth and/or development of plants in the area of interest, e.g.,
crop plants or weeds growing in the area. The stages of growth
and/or development of plants are known in the art. For example,
soybean plants normally progress through vegetative growth stages
known as V.sub.E (emergence), V.sub.C (cotyledon), V.sub.1
(unifoliate), and V.sub.2 to V.sub.N. Soybeans then switch to the
reproductive growth phase in response to photoperiod cues;
reproductive stages include R.sub.1 (beginning bloom), R.sub.2
(full bloom), R.sub.3 (beginning pod), R.sub.4 (full pod), R.sub.5
(beginning seed), R.sub.6 (full seed), R.sub.7 (beginning
maturity), and R.sub.8 (full maturity). Corn plants normally
progress through the following vegetative stages VE (emergence); V1
(first leaf); V2 (second leaf); V3 (third leaf); V(n) (Nth/leaf);
and VT (tasseling). Progression of maize through the reproductive
phase is as follows: R1 (silking); R2 (blistering); R3 (milk); R4
(dough); R5 (dent); and R6 (physiological maturity). Cotton plants
normally progress through V.sub.E (emergence), V.sub.C (cotyledon),
V.sub.1 (first true leaf), and V.sub.2 to V.sub.N. Then,
reproductive stages beginning around V.sub.14 include R.sub.1
(beginning bloom), R.sub.2 (full bloom), R.sub.3 (beginning boll),
R.sub.4 (cutout, boll development), R.sub.5 (beginning maturity,
first opened boll), R.sub.6 (maturity, 50% opened boll), and
R.sub.7 (full maturity, 80-90% open bolls). Thus, for example, the
time at which a herbicide or other chemical is applied to an area
of interest in which plants are growing may be the time at which
some or all of the plants in a particular area have reached at
least a particular size and/or stage of growth and/or development,
or the time at which some or all of the plants in a particular area
have not yet reached a particular size and/or stage of growth
and/or development.
[0279] In some embodiments, the glyphosate/ALS inhibitor-tolerant
plants of the invention show improved tolerance to postemergence
herbicide treatments. For example, plants of the invention may be
tolerant to higher doses of herbicide, tolerant to a broader range
of herbicides (i.e., tolerance to more ALS inhibitor chemistries),
and/or may be tolerant to doses of herbicide applied at earlier or
later times of development in comparison to an appropriate control
plant. For example, in some embodiments, the glyphosate/ALS
inhibitor-tolerant plants of the invention show an increased
resistance to morphological defects that are known to result from
treatment at particular stages of development. Thus, for example, a
phenomenon known as "ear pinch" often results when maize plants are
treated with herbicide at a stage later than V5, V6, V7, V8, V9,
V10, V11, V12, V13, or a later stage, whereas the glyphosate/ALS
inhibitor-tolerant plants of the invention show a decreased
incidence of "ear pinch" when treated at the same stage. Thus, the
glyphosate/ALS inhibitor-tolerant plants of the invention find use
in methods involving herbicide treatments at later stages of
development than were previously feasible. Thus, plants of the
invention may be treated with a particular herbicide that causes
morphological defects in a control plant treated at the same stage
of development, but the glyphosate/ALS inhibitor-tolerant plants of
the invention will not be significantly damaged by the same
treatment.
[0280] Different chemicals such as herbicides have different
"residual" effects, i.e., different amounts of time for which
treatment with the chemical or herbicide continues to have an
effect on plants growing in the treated area. Such effects may be
desirable or undesirable, depending on the desired future purpose
of the treated area (e.g., field or area of cultivation). Thus, a
crop rotation scheme may be chosen based on residual effects from
treatments that will be used for each crop and their effect on the
crop that will subsequently be grown in the same area. One of skill
in the art is familiar with techniques that can be used to evaluate
the residual effect of a herbicide; for example, generally,
glyphosate has very little or no soil residual activity, while
herbicides that act to inhibit ALS vary in their residual activity
levels. Residual activities for various herbicides are known in the
art, and are also known to vary with various environmental factors
such as, for example, soil moisture levels, temperature, pH, and
soil composition (texture and organic matter). The glyphosate/ALS
inhibitor-tolerant plants of the invention find particular use in
methods of growing a crop where improved tolerance to residual
activity of a herbicide is beneficial.
[0281] For example, in one embodiment, the glyphosate/ALS
inhibitor-tolerant plants of the invention have an improved
tolerance to glyphosate as well as to ALS inhibitor chemistries
(such as sulfonylurea herbicides) when applied individually, and
further provide improved tolerance to combinations of herbicides
such as glyphosate and/or ALS inhibitor chemistries. Moreover, the
transgenic plants of the invention provide improved tolerance to
treatment with additional chemicals commonly used on crops in
conjunction with herbicide treatments, such as safeners, adjuvants
such as ammonium sulfonate and crop oil concentrate, and the
like.
[0282] e. Safeners and Adjuvants
[0283] The term "safener" refers to a substance that when added to
a herbicide formulation eliminates or reduces the phytotoxic
effects of the herbicide to certain crops. One of ordinary skill in
the art would appreciate that the choice of safener depends, in
part, on the crop plant of interest and the particular herbicide or
combination of herbicides included in the synergistic herbicide
composition. Exemplary safeners suitable for use with the presently
disclosed herbicide compositions include, but are not limited to,
those disclosed in U.S. Pat. Nos. 4,808,208; 5,502,025; 6,124,240
and U.S. Patent Application Publication Nos. 2006/0148647;
2006/0030485; 2005/0233904; 2005/0049145; 2004/0224849;
2004/0224848; 2004/0224844; 2004/0157737; 2004/0018940;
2003/0171220; 2003/0130120; 2003/0078167, the disclosures of which
are incorporated herein by reference in their entirety. The methods
of the invention can involve the use of herbicides in combination
with herbicide safeners such as benoxacor, BCS
(1-bromo-4-[(chloromethyl)sulfonyl]benzene), cloquintocet-mexyl,
cyometrinil, dichlormid, 2-(dichloromethyl)-2-methyl-1,3-dioxolane
(MG 191), fenchlorazole-ethyl, fenclorim, flurazole, fluxofenim,
furilazole, isoxadifen-ethyl, mefenpyr-diethyl, methoxyphenone
((4-methoxy-3-methylphenyl)(3-methylphenyl)-methanone), naphthalic
anhydride (1,8-naphthalic anhydride) and oxabetrinil to increase
crop safety. Antidotally effective amounts of the herbicide
safeners can be applied at the same time as the compounds of this
invention, or applied as seed treatments. Therefore an aspect of
the present invention relates to the use of a mixture comprising
glyphosate, at least one other herbicide, and an antidotally
effective amount of a herbicide safener.
[0284] Seed treatment is particularly useful for selective weed
control, because it physically restricts antidoting to the crop
plants. Therefore a particularly useful embodiment of the present
invention is a method for selectively controlling the growth of
weeds in a field comprising treating the seed from which the crop
is grown with an antidotally effective amount of safener and
treating the field with an effective amount of herbicide to control
weeds. Antidotally effective amounts of safeners can be easily
determined by one skilled in the art through simple
experimentation. An antidotally effective amount of a safener is
present where a desired plant is treated with the safener so that
the effect of a herbicide on the plant is decreased in comparison
to the effect of the herbicide on a plant that was not treated with
the safener; generally, an antidotally effective amount of safener
prevents damage or severe damage to the plant treated with the
safener. One of skill in the art is capable of determining whether
the use of a safener is appropriate and determining the dose at
which a safener should be administered to a crop.
[0285] In specific embodiments, the herbicide or herbicide
combination applied to the plant of the invention acts as a
safener. In this embodiment, a first herbicide or a herbicide
mixture is applied at an antidotally effect amount to the plant.
Accordingly, a method for controlling weeds in an area of
cultivation is provided. The method comprises planting the area
with crop seeds or plants which comprise a first polynucleotide
encoding a polypeptide that can confer tolerance to glyphosate
operably linked to a promoter active in a plant; and, a second
polynucleotide encoding an ALS inhibitor-tolerant polypeptide
operably linked to a promoter active in a plant. A combination of
herbicides comprising at least an effective amount of a first and a
second herbicide is applied to the crop, crop part, weed or area of
cultivation thereof. The effective amount of the herbicide
combination controls weeds; and, the effective amount of the first
herbicide is not tolerated by the crop when applied alone when
compared to a control crop that has not been exposed to the first
herbicide; and, the effective amount of the second herbicide is
sufficient to produce a safening effect, wherein the safening
effect provides an increase in crop tolerance upon the application
of the first and the second herbicide when compared to the crop
tolerance when the first herbicide is applied alone.
[0286] In specific embodiments, the combination of safening
herbicides comprises a first ALS inhibitor and a second ALS
inhibitor. In other embodiments, the safening effect is achieved by
applying an effective amount of a combination of glyphosate and at
least one ALS inhibitor chemistry. In still other embodiments, a
safening affect is achieved when the glyphosate/ALS
inhibitor-tolerant crops, crop part, crop seed, weed, or area of
cultivation is treated with at least one herbicide from the
sulfonylurea family of chemistries in combination with at least one
herbicide from the ALS family of chemistries (such as, for example,
an imidazolinone).
[0287] Such mixtures provides increased crop tolerance (i.e., a
decrease in herbicidal injury). This method allows for increased
application rates of the chemistries post or pre-treatment. Such
methods find use for increased control of unwanted or undesired
vegetation. In still other embodiments, a safening affect is
achieved when the glyphosate/ALS inhibitor-tolerant crops, crop
part, crop seed, weed, or area of cultivation is treated with at
least one herbicide from the sulfonylurea family of chemistry in
combination with at least one herbicide from the imidazolinone
family. This method provides increased crop tolerance (i.e., a
decrease in herbicidal injury). In specific embodiments, the
sulfonylurea comprises rimsulfuron and the imidazolinone comprises
imazethapyr. In other embodiments, glyphosate is also applied to
the crop, crop part, or area of cultivation.
[0288] As used herein, an "adjuvant" is any material added to a
spray solution or formulation to modify the action of an
agricultural chemical or the physical properties of the spray
solution. See, for example, Green and Foy (2003) "Adjuvants: Tools
for Enhancing Herbicide Performance," in Weed Biology and
Management, ed. Inderjit (Kluwer Academic Publishers, The
Netherlands). Adjuvants can be categorized or subclassified as
activators, acidifiers, buffers, additives, adherents,
antiflocculants, antifoamers, defoamers, antifreezes, attractants,
basic blends, chelating agents, cleaners, colorants or dyes,
compatibility agents, cosolvents, couplers, crop oil concentrates,
deposition agents, detergents, dispersants, drift control agents,
emulsifiers, evaporation reducers, extenders, fertilizers, foam
markers, formulants, inerts, humectants, methylated seed oils, high
load COCs, polymers, modified vegetable oils, penetrators,
repellants, petroleum oil concentrates, preservatives, rainfast
agents, retention aids, solubilizers, surfactants, spreaders,
stickers, spreader stickers, synergists, thickeners, translocation
aids, uv protectants, vegetable oils, water conditioners, and
wetting agents.
[0289] f. Additional Agricultural Chemicals
[0290] In addition, methods of the invention can comprise the use
of a herbicide or a mixture of herbicides, as well as, one or more
other insecticides, fungicides, nematocides, bactericides,
acaricides, growth regulators, chemosterilants, semiochemicals,
repellents, attractants, pheromones, feeding stimulants or other
biologically active compounds or entomopathogenic bacteria, virus,
or fungi to form a multi-component mixture giving an even broader
spectrum of agricultural protection. Examples of such agricultural
protectants which can be used in methods of the invention include:
insecticides such as abamectin, acephate, acetamiprid, amidoflumet
(S-1955), avermectin, azadirachtin, azinphos-methyl, bifenthrin,
bifenazate, buprofezin, carbofuran, cartap, chlorfenapyr,
chlorfluazuron, chlorpyrifos, chlorpyrifos-methyl, chromafenozide,
clothianidin, cyflumetofen, cyfluthrin, beta-cyfluthrin,
cyhalothrin, lambda-cyhalothrin, cypermethrin, cyromazine,
deltamethrin, diafenthiuron, diazinon, dieldrin, diflubenzuron,
dimefluthrin, dimethoate, dinotefuran, diofenolan, emamectin,
endosulfan, esfenvalerate, ethiprole, fenothiocarb, fenoxycarb,
fenpropathrin, fenvalerate, fipronil, flonicamid, flubendiamide,
flucythrinate, tau-fluvalinate, flufenerim (UR-50701),
flufenoxuron, fonophos, halofenozide, hexaflumuron, hydramethylnon,
imidacloprid, indoxacarb, isofenphos, lufenuron, malathion,
metaflumizone, metaldehyde, methamidophos, methidathion, methomyl,
methoprene, methoxychlor, metofluthrin, monocrotophos,
methoxyfenozide, nitenpyram, nithiazine, novaluron, noviflumuron
(XDE-007), oxamyl, parathion, parathion-methyl, permethrin,
phorate, phosalone, phosmet, phosphamidon, pirimicarb, profenofos,
profluthrin, pymetrozine, pyrafluprole, pyrethrin, pyridalyl,
pyriprole, pyriproxyfen, rotenone, ryanodine, spinosad,
spirodiclofen, spiromesifen (BSN 2060), spirotetramat, sulprofos,
tebufenozide, teflubenzuron, tefluthrin, terbufos,
tetrachlorvinphos, thiacloprid, thiamethoxam, thiodicarb,
thiosultap-sodium, tralomethrin, triazamate, trichlorfon and
triflumuron; fungicides such as fungicides such as acibenzolar,
aldimorph, amisulbrom, azaconazole, azoxystrobin, benalaxyl,
benomyl, benthiavalicarb, benthiavalicarb-isopropyl, binomial,
biphenyl, bitertanol, blasticidin-S, Bordeaux mixture (Tribasic
copper sulfate), boscalid/nicobifen, bromuconazole, bupirimate,
buthiobate, carboxin, carpropamid, captafol, captan, carbendazim,
chloroneb, chlorothalonil, chlozolinate, clotrimazole, copper
oxychloride, copper salts such as copper sulfate and copper
hydroxide, cyazofamid, cyflunamid, cymoxanil, cyproconazole,
cyprodinil, dichlofluanid, diclocymet, diclomezine, dicloran,
diethofencarb, difenoconazole, dimethomorph, dimoxystrobin,
diniconazole, diniconazole-M, dinocap, discostrobin, dithianon,
dodemorph, dodine, econazole, etaconazole, edifenphos,
epoxiconazole, ethaboxam, ethirimol, ethridiazole, famoxadone,
fenamidone, fenarimol, fenbuconazole, fencaramid, fenfuram,
fenhexamide, fenoxanil, fenpiclonil, fenpropidin, fenpropimorph,
fentin acetate, fentin hydroxide, ferbam, ferfurazoate, ferimzone,
fluazinam, fludioxonil, flumetover, fluopicolide, fluoxastrobin,
fluquinconazole, fluquinconazole, flusilazole, flusulfamide,
flutolanil, flutriafol, folpet, fosetyl-aluminum, fuberidazole,
furalaxyl, furametapyr, hexaconazole, hymexazole, guazatine,
imazalil, imibenconazole, iminoctadine, iodicarb, ipconazole,
iprobenfos, iprodione, iprovalicarb, isoconazole, isoprothiolane,
kasugamycin, kresoxim-methyl, mancozeb, mandipropamid, maneb,
mapanipyrin, mefenoxam, mepronil, metalaxyl, metconazole,
methasulfocarb, metiram, metominostrobin/fenominostrobin,
mepanipyrim, metrafenone, miconazole, myclobutanil, neo-asozin
(ferric methanearsonate), nuarimol, octhilinone, ofurace,
orysastrobin, oxadixyl, oxolinic acid, oxpoconazole, oxycarboxin,
paclobutrazol, penconazole, pencycuron, penthiopyrad, perfurazoate,
phosphonic acid, phthalide, picobenzamid, picoxystrobin, polyoxin,
probenazole, prochloraz, procymidone, propamocarb,
propamocarb-hydrochloride, propiconazole, propineb, proquinazid,
prothioconazole, pyraclostrobin, pryazophos, pyrifenox,
pyrimethanil, pyrifenox, pyrolnitrine, pyroquilon, quinconazole,
quinoxyfen, quintozene, silthiofam, simeconazole, spiroxamine,
streptomycin, sulfur, tebuconazole, techrazene, tecloftalam,
tecnazene, tetraconazole, thiabendazole, thifluzamide, thiophanate,
thiophanate-methyl, thiram, tiadinil, tolclofos-methyl,
tolyfluanid, triadimefon, triadimenol, triarimol, triazoxide,
tridemorph, trimoprhamide tricyclazole, trifloxystrobin, triforine,
triticonazole, uniconazole, validamycin, vinclozolin, zineb, ziram,
and zoxamide; nematocides such as aldicarb, oxamyl and fenamiphos;
bactericides such as streptomycin; acaricides such as amitraz,
chinomethionat, chlorobenzilate, cyhexatin, dicofol, dienochlor,
etoxazole, fenazaquin, fenbutatin oxide, fenpropathrin,
fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad;
and biological agents including entomopathogenic bacteria, such as
Bacillus thuringiensis subsp. Aizawai, Bacillus thuringiensis
subsp. Kurstaki, and the encapsulated delta-endotoxins of Bacillus
thuringiensis (e.g., Cellcap, MPV, MPVII); entomopathogenic fungi,
such as green muscardine fungus; and entomopathogenic virus
including baculovirus, nucleopolyhedro virus (NPV) such as HzNPV,
AfNPV; and granulosis virus (GV) such as CpGV. The weight ratios of
these various mixing partners to other compositions (e.g.,
herbicides) used in the methods of the invention typically are
between 100:1 and 1:100, or between 30:1 and 1:30, between 10:1 and
1:10, or between 4:1 and 1:4.
[0291] The present invention also pertains to a composition
comprising a biologically effective amount of a herbicide of
interest or a mixture of herbicides, and an effective amount of at
least one additional biologically active compound or agent and can
further comprise at least one of a surfactant, a solid diluent or a
liquid diluent. Examples of such biologically active compounds or
agents are: insecticides such as abamectin, acephate, acetamiprid,
amidoflumet (S-1955), avermectin, azadirachtin, azinphos-methyl,
bifenthrin, binfenazate, buprofezin, carbofuran, chlorfenapyr,
chlorfluazuron, chlorpyrifos, chlorpyrifos-methyl, chromafenozide,
clothianidin, cyfluthrin, beta-cyfluthrin, cyhalothrin,
lambda-cyhalothrin, cypermethrin, cyromazine, deltamethrin,
diafenthiuron, diazinon, diflubenzuron, dimethoate, diofenolan,
emamectin, endosulfan, esfenvalerate, ethiprole, fenothicarb,
fenoxycarb, fenpropathrin, fenvalerate, fipronil, flonicamid,
flucythrinate, tau-fluvalinate, flufenerim (UR-50701),
flufenoxuron, fonophos, halofenozide, hexaflumuron, imidacloprid,
indoxacarb, isofenphos, lufenuron, malathion, metaldehyde,
methamidophos, methidathion, methomyl, methoprene, methoxychlor,
monocrotophos, methoxyfenozide, nithiazin, novaluron, noviflumuron
(XDE-007), oxamyl, parathion, parathion-methyl, permethrin,
phorate, phosalone, phosmet, phosphamidon, pirimicarb, profenofos,
pymetrozine, pyridalyl, pyriproxyfen, rotenone, spinosad,
spiromesifin (BSN 2060), sulprofos, tebufenozide, teflubenzuron,
tefluthrin, terbufos, tetrachlorvinphos, thiacloprid, thiamethoxam,
thiodicarb, thiosultap-sodium, tralomethrin, trichlorfon and
triflumuron; fungicides such as acibenzolar, azoxystrobin, benomyl,
blasticidin-S, Bordeaux mixture (tribasic copper sulfate),
bromuconazole, carpropamid, captafol, captan, carbendazim,
chloroneb, chlorothalonil, copper oxychloride, copper salts,
cyflufenamid, cymoxanil, cyproconazole, cyprodinil,
(S)-3,5-dichloro-N-(3-chloro-1-ethyl-1-methyl-2-oxopropyl)-4-methylbenzam-
ide (RH 7281), diclocymet (S-2900), diclomezine, dicloran,
difenoconazole,
(S)-3,5-dihydro-5-methyl-2-(methylthio)-5-phenyl-3-(phenyl-amino)-4H-imid-
azol-4-one (RP 407213), dimethomorph, dimoxystrobin, diniconazole,
diniconazole-M, dodine, edifenphos, epoxiconazole, famoxadone,
fenamidone, fenarimol, fenbuconazole, fencaramid (SZX0722),
fenpiclonil, fenpropidin, fenpropimorph, fentin acetate, fentin
hydroxide, fluazinam, fludioxonil, flumetover (RPA 403397),
flumorf/flumorlin (SYP-L190), fluoxastrobin (HEC 5725),
fluquinconazole, flusilazole, flutolanil, flutriafol, folpet,
fosetyl-aluminum, furalaxyl, furametapyr (S-82658), hexaconazole,
ipconazole, iprobenfos, iprodione, isoprothiolane, kasugamycin,
kresoxim-methyl, mancozeb, maneb, mefenoxam, mepronil, metalaxyl,
metconazole, metomino-strobin/fenominostrobin (SSF-126),
metrafenone (AC375839), myclobutanil, neo-asozin (ferric
methane-arsonate), nicobifen (BAS 510), orysastrobin, oxadixyl,
penconazole, pencycuron, probenazole, prochloraz, propamocarb,
propiconazole, proquinazid (DPX-KQ926), prothioconazole (JAU 6476),
pyrifenox, pyraclostrobin, pyrimethanil, pyroquilon, quinoxyfen,
spiroxamine, sulfur, tebuconazole, tetraconazole, thiabendazole,
thifluzamide, thiophanate-methyl, thiram, tiadinil, triadimefon,
triadimenol, tricyclazole, trifloxystrobin, triticonazole,
validamycin and vinclozolin; nematocides such as aldicarb, oxamyl
and fenamiphos; bactericides such as streptomycin; acaricides such
as amitraz, chinomethionat, chlorobenzilate, cyhexatin, dicofol,
dienochlor, etoxazole, fenazaquin, fenbutatin oxide, fenpropathrin,
fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad;
and biological agents including entomopathogenic bacteria, such as
Bacillus thuringiensis subsp. Aizawai, Bacillus thuringiensis
subsp. Kurstaki, and the encapsulated delta-endotoxins of Bacillus
thuringiensis (e.g., Cellcap, MPV, MPVII); entomopathogenic fungi,
such as green muscardine fungus; and entomopathogenic virus
including baculovirus, nucleopolyhedro virus (NPV) such as HzNPV,
AfNPV; and granulosis virus (GV) such as CpGV. Methods of the
invention may also comprise the use of plants genetically
transformed to express proteins toxic to invertebrate pests (such
as Bacillus thuringiensis delta-endotoxins). In such embodiments,
the effect of exogenously applied invertebrate pest control
compounds may be synergistic with the expressed toxin proteins.
[0292] General references for these agricultural protectants
include The Pesticide Manual, 13th Edition, C. D. S. Tomlin, Ed.,
British Crop Protection Council, Farnham, Surrey, U.K., 2003 and
The BioPesticide Manual, 2.sup.nd Edition, L. G. Copping, Ed.,
British Crop Protection Council, Farnham, Surrey, U.K., 2001.
[0293] In certain instances, combinations with other invertebrate
pest control compounds or agents having a similar spectrum of
control but a different mode of action will be particularly
advantageous for resistance management. Thus, compositions of the
present invention can further comprise a biologically effective
amount of at least one additional invertebrate pest control
compound or agent having a similar spectrum of control but a
different mode of action. Contacting a plant genetically modified
to express a plant protection compound (e.g., protein) or the locus
of the plant with a biologically effective amount of a compound of
this invention can also provide a broader spectrum of plant
protection and be advantageous for resistance management.
[0294] Thus, methods of the invention employ a herbicide or
herbicide combination and may further comprise the use of
insecticides and/or fungicides, and/or other agricultural chemicals
such as fertilizers. The use of such combined treatments of the
invention can broaden the spectrum of activity against additional
weed species and suppress the proliferation of any resistant
biotypes.
[0295] Methods of the invention can further comprise the use of
plant growth regulators such as aviglycine,
N-(phenylmethyl)-1H-purin-6-amine, ethephon, epocholeone,
gibberellic acid, gibberellin A.sub.4 and A.sub.7, harpin protein,
mepiquat chloride, prohexadione calcium, prohydrojasmon, sodium
nitrophenolate and trinexapac-methyl, and plant growth modifying
organisms such as Bacillus cereus strain BP01.
VI. Use as Selectable Markers and Methods of Transformation
[0296] In some embodiments of the invention, a construct of the
invention comprising a GAT polynucleotide or an ALS
inhibitor-tolerant polypeptide functions as a selectable marker,
e.g., in a plant, bacteria, actinomycete, yeast, algae or other
fungi. For example, an organism that has been transformed with a
vector including a GAT polynucleotide can be selected based on its
ability to grow in the presence of glyphosate. Alternatively, an
organism that has been transformed with a vector comprising an
ALS-inhibitor-tolerant polynucleotide can be selected based on its
ability to grown in the presence of an ALS inhibitor. In some
embodiments of the invention, a construct of the invention
comprising a GAT polynucleotide and another herbicide-tolerance
polynucleotide (i.e., an polynucleotide encoding an ALS
inhibitor-tolerant polypeptide, a polynucleotide encoding an HRA
polypeptide, etc.) functions as a selectable marker, e.g., in a
plant, bacteria, actinomycete, yeast, algae or other fungi. For
example, an organism that has been transformed with a vector
including a GAT polynucleotide and another herbicide-tolerance
polynucleotide can be selected based on its ability to grow in the
presence of glyphosate and the appropriate other herbicide. As
demonstrated in Example 10 and FIG. 7, such methods of selection
allow one to evaluate expression of any polynucleotide of interest
at, for example, early stages in the transformation process in
order to identify potential problems with expression. While any
polynucleotide of interest can be employed, in specific
embodiments, an insecticidal gene is used.
[0297] A construct of the invention comprising a GAT polynucleotide
and/or a polynucleotide encoding an ALS inhibitor-tolerant
polypeptide may exhibit a very high transformation efficiency, such
as an efficiency of at least 20%, 30%, 40%, 50%, or 60% or higher.
In this manner, improved methods of transformation are provided.
Moreover, when a construct of the invention comprises a GAT
polynucleotide and/or ALS inhibitor-tolerant polynucleotide, the
transformants that are obtained may exhibit a very high frequency
of tolerance to glyphosate or ALS inhibitor, so that, for example,
at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the
transformants are tolerant to glyphosate and/or an ALS inhibitor.
As used herein "transformation efficacy" is defined as the
percentage of the T0 events that were resistant to a specific
concentration of selection agent, such as glyphosate and/or an ALS
inhibitor chemistry. When a construct of the invention comprises a
GAT polynucleotide and/or ALS inhibitor-tolerant polynucleotide
operably linked to an enhancer such as, for example, a 35S
enhancer, the transformants that are obtained may exhibit a very
high frequency of tolerance to glyphosate and/or ALS inhibitor, so
that for example, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,
or 100% of the transformants are tolerant to glyphosate or ALS
inhibitor. In addition, when a construct of the invention comprises
a GAT polynucleotide and/or an ALS inhibitor-tolerant
polynucleotide, the frequency of transformation events in which
only a single copy of the construct is inserted into the genome may
be as high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90%, or
higher. When a construct of the invention comprises a GAT
polynucleotide and/or ALS inhibitor-tolerant polynucleotide
operably linked to an enhancer such as, for example, a 35S
enhancer, the frequency of transformation events in which only a
single copy of the construct is inserted into the genome may be as
high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90%, or higher. In
this manner, the invention also provides improved methods of
transformation. It is recognized that when an enhancer is employed
in the construct (such as S.sup.35 enhancer) multiple copies could
be used, including 1, 2, 3, 4, 5, 6 or more. In such methods, the
transformants may be selected using glyphosate and/or an ALS
inhibitor, or they may be selected using another compound, such as
another herbicide for which the transformed construct contains a
tolerance trait.
VII. Kits
[0298] The invention further provides a kit comprising at least one
nucleic acid construct which comprises a polynucleotide which
encodes a polypeptide that can confer glyphosate tolerance and/or a
polynucleotide encoding an ALS inhibitor-tolerant polypeptide for
use in creating a glyphosate/ALS inhibitor plant of the invention.
In specific embodiments, the kit can comprise a polynucleotide
encoding GAT or the kit can comprise a polynucleotide encoding GAT
and a polynucleotide encoding an ALS inhibitor-tolerant
polynucleotide (i.e., HRA). In some aspects a construct of the
invention will comprise a T-DNA sequence. The construct can
optionally include a regulatory sequence (e.g., a promoter)
operably linked to the polynucleotide conferring glyphosate
resistance, where the promoter is heterologous with respect to the
polynucleotide and effective to cause sufficient expression of the
encoded polypeptide to enhance the glyphosate tolerance of a plant
cell transformed with the nucleic acid construct.
[0299] The article "a" and "an" are used herein to refer to one or
more than one (i.e., to at least one) of the grammatical object of
the article. By way of example, "an element" means one or more
element.
[0300] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0301] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
EXPERIMENTAL
Example 1
GAT-HRA Maize Plants are Tolerant of Various Herbicides and
Agricultural Chemicals
[0302] For Agrobacterium-mediated transformation of maize with an
expression cassette containing a GAT polynucleotide (SEQ ID NO:4)
and an HRA polynucleotide (SEQ ID NO:66) operably linked to a
constitutive promoter, the method of Zhao is employed (U.S. Pat.
No. 5,981,840, and PCT patent publication WO98/32326; the contents
of which are hereby incorporated by reference). Expression
cassettes were made that comprised a GAT polynucleotide and an HRA
polynucleotide. In some expression cassettes, the GAT and HRA
polynucleotides were operably linked to at least one copy of a 35S
enhancer [SEQ ID NO:72]. In some expression cassettes, the GAT and
HRA polynucleotides were operably linked to two or three copies of
the 35S enhancer of SEQ ID NO:1. In some expression cassettes, the
GAT polynucleotide was operably linked to a ubiquitin promoter and
the HRA polynucleotide was operably linked to the native maize
acetolactate synthase (ALS) promoter.
[0303] Briefly, immature embryos are isolated from maize and the
embryos contacted with a suspension of Agrobacterium, where the
bacteria are capable of transferring the GAT and HRA sequence to at
least one cell of at least one of the immature embryos (step 1: the
infection step). In this step the immature embryos are immersed in
an Agrobacterium suspension for the initiation of inoculation. The
embryos are co-cultured for a time with the Agrobacterium (step 2:
the co-cultivation step). The immature embryos are cultured on
solid medium following the infection step. Following this
co-cultivation period an optional "resting" step is contemplated.
In this resting step, the embryos are incubated in the presence of
at least one antibiotic known to inhibit the growth of
Agrobacterium without the addition of a selective agent for plant
transformants (step 3: resting step). The immature embryos are
cultured on solid medium with antibiotic, but without a selecting
agent, for elimination of Agrobacterium and for a resting phase for
the infected cells. Next, inoculated embryos are cultured on medium
containing a selective agent and growing transformed callus is
recovered (step 4: the selection step). The immature embryos are
cultured on solid medium with a selective agent resulting in the
selective growth of transformed cells. The callus is then
regenerated into plants (step 5: the regeneration step), and calli
grown on selective medium are cultured on solid medium to
regenerate the plants.
Evaluation of Herbicide Tolerance
[0304] GAT-HRA maize plants were evaluated for tolerance to
glyphosate and other herbicides. One protocol used in this
evaluation was as follows. At the V2 stage (Ritchie and Hanway
(1982), "How a corn plant develops" Spec. Rep. 48. (Coop. Ext.
Ser., Iowa State Univ., Ames, Iowa)), plant heights were measured
and herbicides were applied by spray application. Ten to fourteen
days after the spray application, the transgenic plants were
evaluated for injury symptoms and measured for plant height again
in order to determine plant growth rates. In one series of tests,
GAT-HRA maize and control plants were treated (postemergence) with
one of the following herbicides: tribenuron (as Express.RTM., at
application rates of 0 and 200 grams active ingredient per hectare
(g ai/ha)); chlorimuron (as Classic.RTM., at 0 and 200 g ai/ha);
imazapyr (as Arsenal.RTM., at 0 and 200 g ai/ha);
metsulfuron-methyl (as Ally.RTM., at 0.5 oz ai/ac (36.9 ml ai/ha)
or 35 g ai/ha). For each treatment, the GAT-HRA maize showed no
significant damage from the treatment, while the control maize was
severely damaged or killed.
[0305] GAT-HRA maize plants were also treated with various other
herbicides and combinations of herbicides as well as other
agricultural chemicals, including: glyphosate (as WeatherMax.RTM.,
at an application rate of 64.4 oz ai/ac (4.7 L ai/ha)); rimsulfuron
(as Matrix.RTM., at an application rate of 1.9 oz ai/ac (140 ml
ai/ha)); sulfometuron-methyl (as Ojust.RTM., at an application rate
of 4.5 oz ai/ac (332 ml ai/ha)); Basis.RTM. (a combination of
rimsulfuron and thifensulfuron-methyl, at an application rate of
1.4 oz ai/ac (103 ml ai/ha)); and chlorpyrifos (as Lorsban.RTM., at
an application rate of 14.4 oz ai/ac (1.06 L ai/ha)). Plants were
then evaluated at various times after treatment, such as 10 or 14
days after treatment. Tolerant plants were those which showed
little or no damage following treatment with a herbicide or
herbicide combination. This evaluation identified GAT-HRA plants
which were tolerant to multiple sulfonylurea and glyphosate
chemistries. GAT-HRA plants did not exhibit any significant
differences in growth or seed set (i.e., yield) in comparison to
control plants. Leaf samples were taken from GAT-HRA plants and
used in quantitative PCR analysis and other analyses to determine
the number and arrangement of copies of the GAT and HRA
polynucleotides that had been integrated into the plant genome.
[0306] Other protocols for evaluation included treatment with
imidazolinone herbicides, such as the commercial herbicide
Lightning.RTM. (a combination of imazapyr and imazethapyr), which
was applied to GAT-HRA maize at the V2 leaf stage at four times the
field label rate (250 g ai/ha). Plants were evaluated fourteen days
after the herbicide application, and four of the six transgenic
events tested showed no symptoms of injury from the herbicide.
Another protocol for evaluation included treatment with
imidazolinone herbicides as well as sulfonylurea and glyphosate
herbicides. In these tests, GAT-HRA maize was treated with various
combinations of Lightning.RTM. (imazapyr and imazethapyr),
Basis.RTM. (rimsulfuron and thifensulfuron-methyl) and
WeatherMAX.RTM. (glyphosate potassium salt). These herbicides were
applied at the V2 stage as follows: Lightning.RTM. at twice the
field label rate (1.8 oz ai/ac (133 ml ai/ha)), Basis.RTM. at twice
the field label rate (0.5 oz ai/ac (36.9 ml ai/ha)) and
WeatherMax.RTM. at four times the field label rate (43 oz ai/ac).
Fourteen days after the treatment application, the plants were
evaluated. Plants containing eleven of the twelve transgenic events
showed no herbicide injury symptoms. "Field label rate" refers to
the application rate specified on the product label. Where the
application rate for a particular situation is a range of rates, as
used herein, the term "field label rate" indicates the upper end of
that range. Product label information for pesticides is available
from the U.S. Environmental Protection Agency and is updated online
at the url oaspub.epa.gov/pestlabl/ppls.own; product label
information is also available online at the url www.cdms.net.
[0307] Further tests confirmed that the multiple herbicide
tolerance of these GAT-HRA maize plants was stably inherited. T1
seed was harvested from 20 transgenic T0 plants that showed
excellent herbicide tolerance in greenhouse evaluations. As is
known in the art, the tolerance of plants to herbicide can vary
with the environment, and herbicide treatments in a greenhouse
environment can have a greater impact on treated plants than
herbicide treatments in the field. Accordingly, the T1 seed was
further evaluated under field conditions. T1 plants were sprayed at
the V4 leaf stage with four different herbicide treatment
combinations including sulfonylurea and glyphosate herbicides. In
some tests, a transgenic control line was used that was known to be
tolerant of glyphosate but susceptible to other herbicides. The
tested T1 plants also showed excellent herbicide tolerance under
field conditions, confirming the stable inheritance of the
herbicide tolerance.
Evaluation of Tolerance to Range of Herbicides
[0308] GAT-HRA maize plants were then evaluated to determine
whether they were also tolerant to other herbicides. A test of both
preemergent and postemergent herbicide application was conducted.
Specifically, seven corn seeds of each line to be evaluated were
planted 1 cm deep in 5.5 inch square plastic containers of Tama
silt loam soil. Treatments described in Tables 3 and 4 were applied
before any watering. A week after emergence, seedlings were thinned
so that each container had two uniform plants. Corn seedlings were
watered and fertilized for rapid growth and grown with a 16-h light
photoperiod. When the natural light intensity fell below 500
.mu.E/m.sup.2/s, it was supplemented by metal halide lights with
160 .mu.E/m.sup.2/s photosynthetically active radiation.
Temperature was maintained at 28.+-.2.degree. C. during the day and
22.+-.2.degree. C. at night. Relative humidity generally ranged
from 50 to 90%.
[0309] The studies of preemergence herbicide application used
commercial herbicide formulations. Spray mixtures were prepared
using deionized water at room temperature and were stirred for at
least 15 minutes. Treatments were sprayed 1 to 2 h after
preparation. All treatments were applied in a spray volume of 374
L/ha with a flat fan nozzle at 51 cm with spray pressure set at 138
kPa with a high pH, basic blend adjuvant to ensure solubilization.
Plants were visually evaluated for injury and fresh shoots were
weighed 4 weeks after treatment (results shown in Table 1). Crop
injury was also estimated visually on a scale ranging from 0% to
100%, where 0% signifies no injury and 100% signifies plant death.
Results are shown in Table 3 and are expressed as the mean of four
replications.
TABLE-US-00003 TABLE 3 Preemergence Effect of 34 ALS Herbicides on
Fresh Weight of GAT-HRA and Parent Inbred Corn patent Hetero- elite
stiff zygous stalk GAT- ALS Inhibitor inbred HRA Class Herbicide
Treatment* Fresh Weight (g) Untreated 36.7 47.0 Imidazolin- 200
g/ha Imazamethabenz-methyl 36.2 48.5 one 200 g/ha Imazethapyr 24.4
50.0 200 g/ha Imazamox 0.8 47.5 200 g/ha Imazapyr 0.3 44.2 200 g/ha
Imazaquin 1.5 45.4 Pyrimidinyl- 200 g/ha Pyriminobac methyl 30.4
39.9 thio- 200 g/ha Pyrithiobac Na.sup.+ 0.0 48.6 benzoate
Sulfonyl- 200 g/ha Flucarbazone Na.sup.+ 0.0 48.8 amino- 200 g/ha
Propoxycarbazone Na.sup.+ 0.6 46.7 carbonyl- triazolinone
Sulfonylurea 200 g/ha Amidosulfuron 14.2 47.7 200 g/ha Azimsulfuron
0.0 49.1 200 g/ha Bensulfuron-methyl 28.4 39.9 200 g/ha
Chlorimuron-ethyl 9.3 39.4 200 g/ha Chlorsulfuron 0.0 48.4 200 g/ha
Ethametsulfuron-methyl 1.6 50.1 200 g/ha Ethoxysulfuron 28.1 40.0
200 g/ha Flupyrsulfuron-methyl Na.sup.+ 23.6 45.8 200 g/ha
Foramsulfuron 30.6 39.1 200 g/ha Halosulfuron-methyl 28.9 40.1 200
g/ha Iodosulfuron-methyl Na.sup.+ 24.4 52.5 200 g/ha
Metsulfuron-methyl 0.0 41.1 200 g/ha Nicosulfuron 33.6 50.3 200
g/ha Primisulfuron-methyl 19.5 37.9 200 g/ha Prosulfuron 20.9 43.3
200 g/ha Rimsulfuron 29.8 45.3 200 g/ha Sulfometuron-methyl 0.0
47.3 200 g/ha Sulfosulfuron 1.0 50.6 200 g/ha Thifensulfuron-methyl
15.2 36.0 200 g/ha Triasulfuron 14.1 47.7 200 g/ha
Tribenuron-methyl 32.1 46.8 200 g/ha Trifloxysulfuron Na.sup.+ 0.0
50.8 200 g/ha Triflusulfuron-methyl 26.3 53.5 Triazolo- 200 g/ha
Chloransulam-methyl 5.5 44.9 pyrimidine 200 g/ha Flumetsulam 24.6
39.1
TABLE-US-00004 TABLE 4 Preemergence Effect of 34 ALS Herbicides on
Visual Injury to GAT-HRA and Parent Inbred Corn Patent Hetero-
elite stiff zygous stalk GAT- inbred HRA ALS Class Herbicide
Treatment* % Visual Injury Imidazolin- 200 g/ha
Imazamethabenz-methyl 61 15 one 200 g/ha Imazethapyr 69 20 200 g/ha
Imazamox 99 13 200 g/ha Imazapyr 99 30 200 g/ha Imazaquin 99 28
Pyrimidinyl- 200 g/ha Pyriminobac-methyl 83 20 thio- 200 g/ha
Pyrithiobac Na.sup.+ 100 0 benzoate Sulfonyl- 200 g/ha Flucarbazone
Na.sup.+ 100 40 amino- 200 g/ha Propoxycarbazone Na.sup.+ 100 100
carbonyl- triazolinone Sulfonylurea 200 g/ha Amidosulfuron 97 25
200 g/ha Azimsulfuron 100 40 200 g/ha Bensulfuron-methyl 23 10 200
g/ha Chlorimuron-ethyl 100 10 200 g/ha Chlorsulfuron 100 33 200
g/ha Ethametsulfuron-methyl 100 88 200 g/ha Ethoxysulfuron 63 25
200 g/ha Flupyrsulfuron-methyl Na.sup.+ 87 90 200 g/ha
Foramsulfuron 5 7 200 g/ha Halosulfuron-methyl 30 15 200 g/ha
Iodosulfuron-methyl Na.sup.+ 92 5 200 g/ha Metsulfuron-methyl 100 0
200 g/ha Nicosulfuron 43 0 200 g/ha Primisulfuron-methyl 68 7 200
g/ha Prosulfuron 68 9 200 g/ha Rimsulfuron 74 0 200 g/ha
Sulfometuron-methyl 100 6 200 g/ha Sulfosulfuron 100 18 200 g/ha
Thifensulfuron-methyl 88 3 200 g/ha Triasulfuron 89 12 200 g/ha
Tribenuron-methyl 66 25 200 g/ha Trifloxysulfuron Na.sup.+ 100 0
200 g/ha Triflusulfuron-methyl 100 5 Triazolo- 200 g/ha
Chloransulam-methyl 3 3 pyrimidine 200 g/ha Flumetsulam 13 13
[0310] The studies of postemergence herbicide application also used
commercial herbicide formulations. Specifically, four corn seeds of
each line to be evaluated were planted 1 cm deep in 5.5 inch square
plastic containers of synthetic growth medium. Very young
transgenic seedlings were pretreated with glyphosate to eliminate
segregants which were sensitive to glyphosate. Plants injured by
the glyphosate treatment were removed and containers were thinned
to two uniform plants each. Extra containers were planted so that
only containers with two uniform and uninjured plants were used in
the experiment. Corn seedlings were watered and fertilized for
rapid growth and grown with a 16-h light photoperiod. When the
natural light intensity fell below 500 .mu.E/m.sup.2/s, it was
supplemented by metal halide lights with 160 .mu.E/m.sup.2/s
photosynthetically active radiation. Temperature was maintained at
28.+-.2.degree. C. during the day and 22.+-.2.degree. C. at night.
Relative humidity generally ranged from 50 to 90%.
[0311] Postemergence studies used commercial herbicide formulations
and were applied two weeks after planting. Spray mixtures of
herbicides were prepared using deionized water at room temperature
and were stirred for at least 15 minutes. Treatments were sprayed 1
to 2 h after preparation. All ALS herbicide treatments were applied
in a spray volume of 374 L/ha with a flat fan nozzle at 51 cm with
spray pressure set at 138 kPa and included a high pH, basic blend
adjuvant to ensure solubilization and foliar penetration.
Glyphosate and glufosinate herbicide preparations included adjuvant
systems in their commercial formulations to ensure high foliar
activity. Fresh shoots were weighed 2 weeks after treatment (data
shown in Table 5), and plants were visually evaluated for injury on
a scale from 0% to 100% on which 0% indicates no injury and 100%
indicates plant death (data shown in Table 6). Results are
expressed in Tables 5 and 6 as the mean of four replications.
TABLE-US-00005 TABLE 5 Postemergence Effect of 34 ALS Herbicides on
Fresh Weight of GAT-HRA and Parent Inbred Corn Hetero- Parent elite
zygous stiff stalk GAT- inbred HRA ALS Class Herbicide Treatment*
Fresh Weight (g) Untreated 76.4 98.8 Imidazolinone 200 g/ha
Imazamethabenz-methyl 66.9 95.0 200 g/ha Imazethapyr 6.4 93.4 200
g/ha Imazamox 2.2 90.9 200 g/ha Imazapyr 2.3 97.8 200 g/ha
Imazaquin 4.4 113.3 Pyrimidinylthio- 200 g/ha Pyriminobac-methyl
7.6 95.2 benzoate 200 g/ha Pyrithiobac Na.sup.+ 2.8 87.9
Sulfonylaminocarbonyltriazolinone 200 g/ha Flucarbazone Na.sup.+
3.1 86.0 200 g/ha Propoxycarbazone Na.sup.+ 1.9 101.2 Sulfonylurea
200 g/ha Amidosulfuron 32.0 107.4 200 g/ha Azimsulfuron 1.5 87.9
200 g/ha Bensulfuron-methyl 9.0 103.3 200 g/ha Chlorimuron-ethyl
10.1 95.5 200 g/ha Chlorsulfuron 1.7 105.2 200 g/ha
Ethametsulfuron-methyl 5.6 98.0 200 g/ha Ethoxysulfuron 24.3 79.3
200 g/ha Flupyrsulfuron-methyl 5.2 95.5 Na.sup.+ 200 g/ha
Foramsulfuron 62.5 80.6 200 g/ha Halosulfuron-methyl 58.1 94.5 200
g/ha Iodosulfuron-methyl Na.sup.+ 3.5 95.0 200 g/ha
Metsulfuron-methyl 1.9 75.5 200 g/ha Nicosulfuron 62.7 94.7 200
g/ha Primisulfuron-methyl 16.6 101.0 200 g/ha Prosulfuron 53.6 91.3
200 g/ha Rimsulfuron 12.6 99.2 200 g/ha Sulfometuron-methyl 2.0
104.5 200 g/ha Sulfosulfuron 4.0 105.5 200 g/ha
Thifensulfuron-methyl 4.2 86.6 200 g/ha Triasulfuron 6.4 90.3 200
g/ha Tribenuron-methyl 1.8 90.8 200 g/ha Trifloxysulfuron Na.sup.+
1.0 86.6 200 g/ha Triflusulfuron-methyl 2.1 110.9
Triazolopyrimidine 200 g/ha Chloransulam-methyl 6.8 104.4 200 g/ha
Flumetsulam 12.8 103.8 Glycine 3472 g ae/ha Glyphosate 1.0 97.4
Phosphinic Acid 1870 g/ha Glufosinate ammonium 2.4 112.3
TABLE-US-00006 TABLE 6 Postemergence Effect of 34 ALS Herbicides on
GAT-HRA and Parent Inbred Corn Hetero- Parent elite zygous stiff
stalk GAT- inbred HRA ALS Class Herbicide Treatment* % Visual
Injury Imidazolinone 200 g/ha Imazamethabenz-methyl 11 16 200 g/ha
Imazethapyr 97 9 200 g/ha Imazamox 100 4 200 g/ha Imazapyr 100 1
200 g/ha Imazaquin 100 2 Pyrimidinylthio- 200 g/ha
Pyriminobac-methyl 93 4 benzoate 200 g/ha Pyrithiobac Na.sup.+ 100
9 Sulfonylaminocarbonyltriazolinone 200 g/ha Flucarbazone Na.sup.+
100 14 200 g/ha Propoxycarbazone Na.sup.+ 100 9 Sulfonylurea 200
g/ha Amidosulfuron 71 8 200 g/ha Azimsulfuron 100 20 200 g/ha
Bensulfuron-methyl 93 14 200 g/ha Chlorimuron-ethyl 93 15 200 g/ha
Chlorsulfuron 100 13 200 g/ha Ethametsulfuron-methyl 96 6 200 g/ha
Ethoxysulfuron 88 15 200 g/ha Flupyrsulfuron-methyl 95 4 Na.sup.+
200 g/ha Foramsulfuron 28 8 200 g/ha Halosulfuron-methyl 14 8 200
g/ha Iodosulfuron-methyl Na.sup.+ 100 1 200 g/ha Metsulfuron-methyl
100 14 200 g/ha Nicosulfuron 24 0 200 g/ha Primisulfuron-methyl 75
5 200 g/ha Prosulfuron 25 29 200 g/ha Rimsulfuron 91 10 200 g/ha
Sulfometuron-methyl 100 2 200 g/ha Sulfosulfuron 97 3 200 g/ha
Thifensulfuron-methyl 98 10 200 g/ha Triasulfuron 97 6 200 g/ha
Tribenuron-methyl 100 8 200 g/ha Trifloxysulfuron Na.sup.+ 100 29
200 g/ha Triflusulfuron-methyl 100 8 Triazolopyrimidine 200 g/ha
Chloransulam-methyl 96 3 200 g/ha Flumetsulam 85 3 Glycine 3472 g
ae/ha Glyphosate 100 10 Phosphinic Acid 1870 g/ha Glufosinate
ammonium 99 1
Additional Tests Including Other Agricultural Chemicals
[0312] Other protocols were used to evaluate whether GAT-HRA
plants, in addition to being more tolerant to various herbicides
than control plants, were also more tolerant to other agricultural
chemicals than control plants. For example, one protocol included
treatment of GAT-HRA maize with the sulfonylurea herbicides
rimsulfuron and thifensulfuron-methyl in addition to treatment with
the organophosphate insecticide chlorpyrifos (Lorsban.RTM.). In
this test, plants were evaluated 14 days after treatment, and all
20 GAT-HRA transgenic plants showed good to excellent tolerance to
these chemicals while the control plants showed significant damage
as a result of the treatments (see Table 8). Herbicide injury
scores (also called tolerance scores) were assigned on a plot basis
on a 1 to 9 scale with a rating of 9 indicating that plants
exhibited no injury symptoms and a rating of 1 indicating complete
plant death. A rating of 5 indicates moderate leaf injury. The
scale used here is further explained in Table 7 below.
TABLE-US-00007 TABLE 7 Herbicide injury scale (1 to 9 scale scoring
system) for maize Main Rating categories Detailed description 9 No
Effect No crop reduction or injury 8 Slight Slight crop
discoloration or stunting 7 Effect Some crop discoloration,
stunting, or stunt loss 6 Crop injury more pronounced, but not
lasting 5 Moderate Moderate injury, crop usually recovers 4 Effect
Crop injury more lasting, recovery doubtful 3 Lasting crop injury,
no recovery 2 Severe Heavy crop injury and stand loss 1 Effect Crop
nearly destroyed - A few surviving plants
TABLE-US-00008 TABLE 8 GAT HRA Transgenic Maize Plants Show
Excellent Tolerance to an Herbicide as Measured by Tolerance Scores
V4 Tolerance Scores Basis .RTM. (rimsulfuron and thifensulfuron-
Basis .RTM. methyl), 1.0 oz (rimsulfuron and ai/ac (73.9 ml
thifensulfuron- ai/ha); Lorsban .RTM. methyl), 1.0 oz
(chlorpyrifos), ai/ac (73.9 ml 14.4 oz ai/ac ai/ha); (1.06 L
ai/ha); WeatherMax .RTM. WeatherMax .RTM. WeatherMax .RTM.
WeatherMax .RTM. (glyphosate) 10.7 oz (glyphosate) 10.7 oz
(glyphosate) 10.7 oz (glyphosate) 42.9 oz Expression ai/ac (790 ml
ai/ac (790 ml ai/ac (790 ml ai/ac (3.17 L Transgenic Event cassette
ai/ha) ai/ha) ai/ha) ai/ha) 2 4 9 9 9 7 4 3 9 9 9 9 3 3 9 9 9 5 10
3 8 9 9 7 Glyphosate 5.5 2.5 9 8.5 tolerant non-GAT HRA Control
[0313] Fourteen days after the spray application, the 20 transgenic
plants were also measured for plant height on a plot basis. Plant
heights of the same four most tolerant GAT HRA events along with
the non-GAT HRA control were collected. The four transgenic events
showed uniform plant growth on all the herbicide treatments. The
non-GAT HRA control showed a reduction in plant growth with the
sulfonylurea treatments. The average plot height results from these
measurements are shown in Table 9.
TABLE-US-00009 TABLE 9 GAT HRA Transgenic Maize Plants Show
Excellent Tolerance to an Insecticide as Measured by Average Plant
Height V4 Average Plant Heights (inches) Basis .RTM. (rimsulfuron
and thifensulfuron- Basis .RTM. methyl), 1.0 oz (rimsulfuron and
ai/ac (73.9 ml thifensulfuron- ai/ha); Lorsban .RTM. methyl), 1.0
oz (chlorpyrifos), ai/ac (73.9 ml 14.4 oz ai/ac ai/ha); (1.06 L
ai/ha); WeatherMax .RTM. WeatherMax .RTM. WeatherMax .RTM.
WeatherMax .RTM. (glyphosate) 10.7 oz (glyphosate) 10.7 oz
(glyphosate) 10.7 oz (glyphosate) 42.9 oz Transgenic Expression
ai/ac (790 ml ai/ac (790 ml ai/ac (790 ml ai/ac (3.17 L Event
cassette ai/ha) ai/ha) ai/ha) ai/ha) 2 4 16 14 14 13 4 3 15 14 15
14 3 3 15 14 14 14 10 3 15 15 15 14 Glyphosate 10 7.5 14.5 14
tolerant non-GAT HRA Control
Comparison of Response of GAT-HRA Plants to a Range of Herbicide
Doses
[0314] GAT-HRA maize plants were produced using various expression
cassettes and assayed as described above for tolerance to multiple
sulfonylurea chemistries in combination with glyphosate (see Table
10).
TABLE-US-00010 TABLE 10 GAT HRA Maize Produced Using Various
Expression Cassettes Is Tolerant to Multiple Sulfonylurea
Chemistries Average Average number Average growth of inserts
Percentage growth of non- integrated Total Number of highly sprayed
sprayed in highly number of events Spray Expression tolerant plants
plants tolerant of events with no Treatment cassette events
(inches) (inches) events evaluated injury Matrix .RTM. 3 25% 5.2
5.1 2.0 56 14 (rimsulfuron) 1.9 oz ai/ac (140 ml ai/ha), WeatherMax
.RTM. (glyphosate) 64.4 oz ai/ac (4.7 L ai/ha) Matrix .RTM. 4 31%
5.2 5.1 1.6 51 16 (rimsulfuron) 1.9 oz ai/ac (140 ml ai/ha),
WeatherMax .RTM. (glyphosate) 64.4 oz ai/ac (4.7 L ai/ha) Matrix
.RTM. 5 27% 4.8 5.3 1.7 63 17 (rimsulfuron) 1.9 oz ai/ac (140 ml
ai/ha), WeatherMax .RTM. (glyphosate) 64.4 oz ai/ac (4.7 L ai/ha)
Matrix .RTM. 6 41% 4.5 5.0 1.4 182 75 (rimsulfuron) 1.9 oz ai/ac
(140 ml ai/ha), WeatherMax .RTM. (glyphosate) 64.4 oz ai/ac (4.7 L
ai/ha) Basis .RTM. 9 59% 2.6 3.1 1.4 27 16 (rimsulfuron and
thifensulfuron- methyl) 1.4 oz ai/ac (103 ml ai/ha), Lorsban .RTM.
(chlorpyrifos) 14.4 oz ai/ac (1.06 L ai/ha), WeatherMax .RTM.
(glyphosate) 64.4 oz ai/ac (4.7 L ai/ha) Oust .RTM. 9 71% 4.2 4.8
1.1 146 104 (sulfometuron- methyl) 4.5 oz ai/ac (322 ml ai/ac),
WeatherMax .RTM. (glyphosate) 64.4 oz ai/ac (4.7 L ai/ha)
Example 2
GAT-HRA Soybean Plants are Tolerant of Various Herbicides and
Agricultural Chemicals
Transformation and Regeneration of Transgenic Plants
[0315] Soybean embryos were bombarded with an expression cassette
containing GAT (SEQ ID NO:68) and HRA polynucleotides (SEQ ID
NO:65) operably linked to a constitutive promoter, as follows. The
promoter used for the GAT sequence is the SCP1 promoter, and the
promoter used for the HRA sequence is the SAMS promoter. The 2
promoter/gene combinations are arranged in a tandem orientation
with the HRA promoter/gene downstream of the GAT promoter/gene. To
induce somatic embryos, cotyledons less than 4 mm in length
dissected from surface-sterilized, immature seeds of the soybean
variety Jack were cultured in the light or dark at 26.degree. C. on
an appropriate agar medium for six to ten weeks. Somatic embryos
producing secondary embryos were then excised and placed into a
suitable liquid medium. After repeated selection for clusters of
somatic embryos that multiplied as early, globular-staged embryos,
the suspensions were maintained as described below. Here, the
herbicide-tolerance traits that should be possessed by the
transformed plants were used as selectable markers.
[0316] Soybean embryogenic suspension cultures were maintained in
35 ml liquid media on a rotary shaker, 150 rpm, at 26.degree. C.
with fluorescent lights on a 16:8 hour day/night schedule. Cultures
were subcultured every two weeks by inoculating approximately 35 mg
of tissue into 35 ml of liquid medium.
[0317] Soybean embryogenic suspension cultures were then
transformed by the method of particle gun bombardment (Klein et al.
(1987) Nature (London) 327: 70-73, U.S. Pat. No. 4,945,050).
[0318] To 50 .mu.l of a 60 mg/ml 1 .mu.m gold particle suspension
was added (in order): 5 .mu.l DNA (1 .mu.g/.mu.l), 20 .mu.l
spermidine (0.1 M), and 50 .mu.l CaCl.sub.2 (2.5 M). The particle
preparation was then agitated for three minutes, spun in a
microfuge for 10 seconds and the supernatant removed. The
DNA-coated particles were then washed once in 400 .mu.l 70% ethanol
and resuspended in 40 .mu.l of anhydrous ethanol. The DNA/particle
suspension were sonicated three times for one second each. Five
microliters of the DNA-coated gold particles were then loaded on
each macro carrier disk.
[0319] Approximately 150-200 mg of a two-week-old suspension
culture was placed in an empty 60.times.15 mm Petri dish and the
residual liquid removed from the tissue with a pipette. For each
transformation experiment, approximately 5-10 plates of tissue were
normally bombarded. Membrane rupture pressure was set at 1100 psi
(77.356 kg/cm), and the chamber was evacuated to a vacuum of 28
inches mercury. The tissue was placed approximately 8.89 cm away
from the retaining screen and bombarded three times. Following
bombardment, the tissue was divided in half and placed back into
liquid and cultured as described above.
[0320] Five to seven days post bombardment, the liquid media was
exchanged with fresh media, and eleven to twelve days
post-bombardment with fresh media containing 30-50 mg/L hygromycin
and 100 ng/ml chlorsulfuron was used as a selection agent. This
selective media was refreshed weekly. Seven to eight weeks
post-bombardment, green, transformed tissue was observed growing
from untransformed, necrotic embryogenic clusters. Isolated green
tissue was removed and inoculated into individual flasks to
generate new, clonally propagated, transformed embryogenic
suspension cultures. Each new culture derived from a separate area
of transformed tissue was treated as an independent transformation
event; the individual culture as well as the initial (T0) plant(s)
derived from a single area of transformed tissue as well as its
descendants were generally to represent a single "event." These
suspensions were then subcultured and maintained as clusters of
immature embryos or regenerated into whole plants by maturation and
germination of individual somatic embryos.
Herbicide Treatments
[0321] Young regenerated transgenic plants were sprayed with
1.times. glyphosate (1.times. rate of glyphosate is 1120 g/ha of
glyphosate isopropylamine) to cull segregants. Four replications
were performed for each treatment. Plants were then treated with
various herbicides, including glyphosate and ALS-inhibitor
herbicides. When treated with tribenuron-methyl herbicide, the GAT-
and HRA-containing transgenic soybeans treated at 0 and 35 g/ha
showed no significant damage, while herbicide-treated
non-transgenic control soybeans were killed by the treatment.
Plants were then treated with glyphosate at 8.times. and
tribenuron-methyl at 35 g/ha as well as rimsulfuron at 35 g/ha, and
similar results were obtained.
[0322] Six soybean seeds from each variety to be assayed were
planted 1 cm deep in 5.5 (13.97 cm) inch square plastic container
of a synthetic growth medium. Very young transgenic seedlings were
pretreated with glyphosate to eliminate segregants that were not
tolerant to glyphosate; plants injured by this treatment were
removed. When possible, containers were thinned to two uniform
plants. Non-transgenic lines were thinned to two uniform plants per
container. Soybean seedlings were watered and fertilized for rapid
growth. The plants were grown with a 16-h light photoperiod, and
when natural light intensity fell below 500 .mu.E/m.sup.2/s it was
supplemented with metal halide lights with 160 .mu.E/m.sup.2/s
photosynthetically active radiation. Temperature was maintained at
28.+-.2.degree. C. during the day and 22.+-.2.degree. C. at night.
Relative humidity generally ranged from 50 to 90%.
[0323] These postemergence studies used commercial herbicide
formulations and were applied approximately two weeks after
planting. Spray mixtures were made using deionized water at room
temperature and were stirred for at least 15 minutes. Treatments
were sprayed 1 to 2 h after preparation. The 35 g/ha rimsulfuron
and tribenuron-methyl herbicide treatments were applied in a spray
volume of 374 L/ha with a flat fan nozzle at 51 cm with spray
pressure set at 138 kPa and included a high pH, basic blend
adjuvant to ensure solubilization and foliar penetration. The
commercial formulation of glyphosate treatment was also applied in
a spray volume of 374 L/ha with a flat fan nozzle at 51 cm with
spray pressure set at 138 kPa. Plants were visually evaluated for
injury on a scale of 0% being no injury and 100% being plant death.
Results are expressed below in Table 11 as the mean of four
replications.
TABLE-US-00011 TABLE 11 Postemergence Effect of Glyphosate and Two
Sulfonylurea Herbicides on GAT-HRA Soybeans Tribenuron- Line #
Glyphosate methyl Rimsulfuron (and (8960 g/ha) (35 g/ha) (35 g/ha)
Event # mean) % Visual Injury 64 Mean 14 43 73 47 10 34 73 41 20 55
73 60 Mean 15 55 83 41 13 38 80 70 9 40 80 35 9 49 85 11 11 71 83
22 11 45 76 75 14 69 86 79 18 69 86 07 19 46 84 77 19 56 90 46 20
49 78 82 20 61 90 84 22 71 83 61 Mean 20 54 82 99 10 34 79 47 15 36
78 62 6 43 71 49 9 54 84 02 10 41 80 14 10 65 90 18 10 69 89 51 10
60 83 02B 10 40 70 05 11 55 78 60 16 45 73 34 23 76 90 24 60 63 90
33 84 80 95 59 Mean 38 59 87 28 37 60 86 21 40 58 88 STS .RTM. Mean
100 87 97 25 100 87 97 46 100 88 97 Wild Type Mean 100 97 97 82 100
97 97 Jack 100 97 97
Example 3
Transgenic GAT-HRA Cotton is Tolerant of Several Herbicides
[0324] Cotton (Gossypium hirsutum) Coker 312 was transformed with a
GAT polynucleotide (gat 4621) together with an Hra polynucleotide
(SEQ ID NO:86) both operably linked to strong, constitutive plant
viral promoters. The promoter linked to gat4621 contains a
duplicated portion of the Strawberry Vein Banding Virus transcript
promoter (Wang et al. Virus Genes 20: 11-17, 2000; Genbank X97304).
The Hra gene was driven by a duplicated portion of the Mirabilis
Mosaic Caulimovirus full-length transcript promoter (U.S. Pat. No.
6,420,547; Dey and Maiti, Transgenics 3:61-70, 1999). The
transformation procedure used Agrobacterium tumefaciens containing
an expression cassette with the genes to be transferred and
cotyledon explant derived callus with some capacity to undergo
embryogenesis. The callus was exposed to Agrobacterium for 48-72
hours. The callus was then exposed to selection for transformed
cells on 50-200 .mu.g/l chlorosulfuron and/or 50-450 .mu.M
glyphosate in solid medium. Glyphosate can also be used in a
concentration range of about 5 to about 450 .mu.M. Selection was
applied until somatic embryos formed, and selection was again
applied at the embryo germination step, and optionally during
rooting of plantlets. Over 450 GAT-HRA transformation events were
produced using selection with both chlorsulfuron and
glyphosate.
[0325] Transformed cotton plants were rooted and then transferred
to soil for further growth. Plants were then subjected to herbicide
spray treatments in a greenhouse. In one treatment, glyphosate was
sprayed over the top of plants at the 4-6 leaf stage of development
at an application rate of 1.5 lb acid equivalent per acre (2.58 Kg
acid equivalent per hectare). Untransformed Coker 312 control
plants were dead 2 weeks after glyphosate application. In contrast,
approximately 50% of the GAT-HRA transgenic plants (each
corresponding to a separate transformation event) showed no
deleterious symptoms from the glyphosate treatment 14 days after
application. Plants transformed with both GAT and HRA were further
subjected to an "over the top" application of the sulfonylurea
herbicide rimsulfuron at a rate of 16 g active ingredient/hectare.
Again, approximately 35% of the transgenic plants showed no
deleterious symptoms from the dual herbicide application 14 days
after the rimsulfuron application and 28 days after the glyphosate
application. Untransformed Coker 312 plants showed severe damage
from the rimsulfuron application, even in the absence of any
glyphosate application. In further experiments 32 g ai/ha
rimsulfuron were applied to the cotton.
[0326] The presence of each of the GAT and HRA polynucleotides was
further confirmed in the herbicide-resistant transgenic plants
using polymerase chain reaction ("PCR") assays and using Western
blot analysis to detect the expressed GAT and HRA polypeptides.
Example 4
Formulation of Homogenous Granule Blends
[0327] A herbicidal composition useful for the present invention
may be formulated in any suitable manner, for example, as a
"homogeneous granule blend" (see, e.g., U.S. Pat. No. 6,022,552,
entitled "Uniform Mixtures of Pesticide Granules"). A herbicidal
composition formulated as a homogeneous granule blend according to
U.S. Pat. No. 6,022,552 can be prepared by shaking or otherwise
mixing two or more groups of substantially cylindrical granules
typically made by extrusion or pelletization, wherein one group has
an active ingredient content comprising at least one herbicide, and
one or more other groups have a different active ingredient content
or inert content, the granules within each group having
substantially uniform diameters and longitudinal lengths of from 1
to 8 times the diameter with the average length of the granules
being from 1.5 to 4 times the diameter, and the average diameter of
each group differing from another group by no more than 30%. In
some embodiments, each granule group comprises a registered
formulation product containing a single active ingredient, which is
for example, a herbicide, fungicide, and/or an insecticide.
"Substantially cylindrical" is rod like or tubular wherein the
cross-sectional shape may be circular, octagonal, rectangular, or
any other conceivable shape and wherein the longitudinal surface is
spiral, curved, or straight. The difference in average diameter is
calculated by subtracting the average diameter of the granules in
the group having the smaller diameter from the average diameter of
the granules in the group having the larger diameter, then dividing
the calculated difference by the average diameter of the granules
in the group having the smaller diameter, and finally multiplying
the calculated quotient by 100%.
[0328] The uniformity of a "homogenous granule blend" can be
optimized by controlling the relative sizes and size distributions
of the granules used in the blend. Density differences are
comparatively unimportant (see, e.g., Rhodes (1990) Principles of
Powder Technology, pp. 71-76 (John Wiley & Sons)). The diameter
of extruded granules is controlled by the size of the holes in the
extruder die, and a centrifugal sifting process may be used to
obtain a population of extruded granules with a desired length
distribution (see, e.g., U.S. Pat. No. 6,270,025). Preferably the
average diameter of each granule group differs from another group
by no more than 20%, more preferably by no more than 10%. Also
preferably the longitudinal length of each group is form 1.5 to 4
times the diameter of the granules.
[0329] The active ingredient in each formulation has an associated
tolerance for variability based on guidelines of the Food and
Agriculture Organization of the United Nations (FAO), as shown
below in Table 12.
TABLE-US-00012 TABLE 12 FAO Nominal Concentration Guidelines for
Active Ingredient in a Formulation Nominal Concentration FAO Range
(as % of (= N) Nominal) N .ltoreq. 2.5% .+-.25% 2.5% .ltoreq. N
.ltoreq. 10% .+-.10% 10% .ltoreq. N .ltoreq. 25% .+-.6% 25%
.ltoreq. N .ltoreq. 50% .+-.5% N > 50% .+-.25 g/kg
[0330] The active ingredient content in a homogenous granule blend
is determined based on the active ingredient content of the
component granules and the ratio in which the component granules
are mixed. Homogenous granule blends are manufactured assuming that
the nominal values of active ingredients of the blend components
are correct. Because of the real-life variability associated with
assays of active ingredients as well as variability in mixing and
sampling, procedures were developed to calculate ranges for the
active ingredient content in a homogenous granule blend, as
follows. [0331] 1. Define the registered FAO specifications for
each of the blend components ("% AI in Component"). [0332] 2. Apply
the FAO tolerance to establish manufacturing limits for the amount
of each component in the blend ("% Component in Blend"). [0333] 3.
Calculate the maximum limit for the active ingredient in the blend
("% AI in the Blend") by multiplying the maximum limit for "% AI in
Component" with the maximum limit for "% Component in Blend." The
minimum and nominal calculations are similarly done.
[0334] Examples of the calculations for several homogenous granule
blend products follow. The last column in each example table shows
the standard FAO assay range that would apply to a traditional
premix product containing the same active ingredient content as the
homogenous granule blend in the example. The broader range for the
homogenous granule blend product ("% AI in Blend") allows for the
variability introduced by using a registered product with an
associated range of active ingredient content as a component in the
product.
TABLE-US-00013 TABLE 13 Calculations for product "DPX-CDQ73 39.1WG"
Homogenous Granule Blend* % Al in % Component in Compare to FAO
Components Blend % Al in Blend tolerance for a (A) (B) (A .times.
B) premix % metsulfuro- % Ally 20 PX in % metsulfuron- %
metsulfuron- methyl in Ally DPX-CDQ73 methyl in DPX- methyl in 20PX
Blend CDQ73 Blend traditional premix 21.2 max 66.7 max 14.4 max
13.8 max 20.0 .+-. 6% 65.2 .+-. 25 g/kg 13.0 nominal 13.0 nominal
18.8 min 62.7 min 11.8 min 12.3 min % tribenuron- % Quantum 75PX %
tribenuron- % tribenuron- methyl in in DPX-CDQ73 methyl in DPX-
methyl in Quantum 75PX Blend CDQ73 Blend traditional premix 77.5
max 36.5 max 28.3 max 27.4 max 75 .+-. 25 g/kg 34.8 .+-. 5% 26.1
nominal 26.1 nominal 72.5 min 33.1 min 24.0 min 24.8 min *= A blend
of 65.2% Ally 20PX and 34.8% Quantum 75PX. This blend is sold
commercially as BiPlay and DP911.
TABLE-US-00014 TABLE 14 Calculations for "DPX-CDQ74 51.5WG"
Homogenous Granule Blend** % Al in % Component in Compare to FAO
Components Blend % Al in Blend tolerance for a (A) (B) (A .times.
B) premix % metsulfuron- % Ally 20 PX in % metsulfuron- %
metsulfuron- methyl in Ally DPX-CDQ73 methyl in DPX- methyl in 20PX
Blend CDQ73 Blend traditional premix 21.2 max 44.9 max 9.5 max 9.4
max 20.0 .+-. 6% 42.8 .+-. 5% 8.6 nominal 8.6 nominal 18.8 min 40.7
min 7.7 min 7.7 min % % thifensulfuron- Harmony 75PX %
thifensulfuron- % thifensulfuron- methyl in in DPX-CDQ74 methyl in
DPX- methyl in Harmony 75PX Blend CDQ74 Blend traditional premix
77.5 max 59.7 max 46.3 max 45.0 max 75 .+-. 25 g/kg 57.2 .+-. 25
g/kg 42.9 nominal 42.9 nominal 72.5 min 54.7 min 39.7 min 40.8 min
**= A blend of 42.8% Ally 20PX and 57.2% Harmony 75PX. This blend
is sold commercially as Finish and DP928.
TABLE-US-00015 TABLE 15 "DPX-FKU22 60WG" Homogenous Granule
Blend*** % Al in % Component in Compare to FAO Components Blend %
Al in Blend tolerance for a (A) (B) (A .times. B) premix %
flupyrsulfuron methyl in % Lexus 50PX in % flupyrsulfuron %
flupyrsulfuron Lexus DPX-FKU22 methyl in DPX- methyl in 50PX Blend
FKU22 Blend traditional premix 52.5 max 62.5 max 32.8 max 31.5 max
50.0 .+-. 5% 60.0 .+-. 25 g/kg 30.0 nominal 30.0 nominal 47.5 min
57.5 min 27.3 min 28.5 min % tribenuron- % Quantum 75PX %
tribenuron- % tribenuron- methyl in in DPX-FKU22 methyl in DPX-
methyl in Quantum 75PX Blend FKU22 Blend traditional premix 77.5
max 42.0 max 32.6 max 31.5 max 75 .+-. 25 g/kg 40.0 .+-. 5% 30.0
nominal 30.0 nominal 72.5 min 38.0 min 27.6 min 28.5 min ***= A
blend of 60% Lexus 50PX and 40% Quantum 75PX. This blend is sold
commercially as DP953.
[0335] Procedures were also developed to determine whether a
particular homogenous granule blend falls within the desired
ranges. Homogenous granule blends are random mixtures of granules;
therefore, in order to accurately represent the composition, a
certain number of granules must be evaluated. The minimum number of
granules for the sample can be estimated using a statistical
equation (see Rhodes (1990), Principles of Powder Technology (John
Wiley & Sons), pp. 71-76),
s.sup.2=P(100-P)/n
where s=standard deviation for the component proportion in the
blend, P=weight percent of the component, and n=number of granules
in the sample (.about.400 1-mm diameter granules=1 gram). The
sample size required to represent the blend composition for a
particular chosen level of variability can be obtained by solving
for n and converting this value to grams by dividing `n` by the
average number of 1-mm paste extruded granules in a 1-gram sample
(e.g., 400).
[0336] If the standard deviation in this calculation is based on
the FAO tolerance for the amount of a component in a particular
granule blend, a minimum sample size for that granule blend can be
calculated. For 95% confidence, the tolerance around the "%
component in the blend" is set as 2 standard deviations. It is
understood that this is a theoretical statistical estimate.
[0337] For a granule blend to be a feasible commercial product, the
statistical sample size must be equivalent to or smaller than the
smallest amount that would be measured by a farmer or applicator,
typically a hectare dose. Examples of a sample size calculation for
the granule blends discussed above is shown below.
TABLE-US-00016 TABLE 16 Minimum statistical sample size calculation
for DPX-CDQ73 39.1WG Blend P Statistical Blend (% component FOA
tolerance for Minimum Component in Blend) % component Sample Size
Ally 20PX 65.2 .+-.25 g/kg 4 grams (.+-.3.8% relative) Quantum 75PX
34.8 .+-.5% relative 8 grams
Detailed calculation for minimum sample size for DPX-CDQ73 39.1 WG
Blend: [0338] For the minor blend component (Quantum 75PX) the FAO
tolerance of .+-.5% relative gives a range of: 5%.times.34.8=1.7
[0339] For 95% confidence, 2 standard deviations are set at=1.7
giving a standard deviation of s=0.85 for the calculation:
[0339] s.sup.2=P(1-P)/n=(0.85)2=(65.2.times.34.8)/n [0340] n=3140
granules=7.8 grams (based on 400 granules/gram)
[0341] The calculated minimum statistical sample size of about 8
grams is less than the product use rate of 38 g/ha.
[0342] A homogenous granule blend is considered to be "homogenous"
when it can be subsampled into appropriately sized aliquots and the
composition of each aliquot will meet the required assay
specifications. To demonstrate homogeneity, a large sample of the
homogenous granule blend is prepared and is then subsampled into
aliquots of greater than the minimum statistical sample size. A
second sample of the blend is prepared and subjected to a simulated
transportation test (ASTM D 4728-87, Standard Method for Random
Vibration Testing of Shipping Containers) and then subsampled into
aliquots. The aliquots are analyzed for active ingredient using
liquid chromatography. The simulated transportation test shakes the
bottle at specific frequencies for a standard amount of time,
giving the granules an opportunity to move about. When the granule
blend components are not appropriately sized, segregation occurs
and the aliquot compositions vary unacceptably.
[0343] Aliquot analysis data from the homogeneity tests for
DPX-CDQ73 39.1WG Blend are shown below in Table 17. All data points
tested in the granule blend aliquots fell within their respective
calculated specification ranges, indicating that the blend was
homogenous.
TABLE-US-00017 TABLE 17 Analysis of DPX-CDQ73 39.1WG Blend as made
after simulated shipment. % % % metsulfuron- % tribenuron-
metsulfuron- tribenuron- methyl in methyl in methyl in methyl in
DPX- DPX-CDQ73 Aliquot DPX- DPX- CDQ73 Blend Blend after (20 CDQ73
CDQ73 after simulated simulated grams) Blend Blend shipment
shipment Proposed 11.8-14.4 24.0-28.3 11.8-14.4 24.0-28.3 assay
range 1 13.43 25.95 13.83 26.84 2 13.87 25.05 13.84 24.43 3 13.79
25.88 13.28 27.2 4 13.36 26.8 13.67 26.25 5 13.49 27.37 13.57
27.33
[0344] Homogenous granule blends have been manufactured in a batch
process using a roll-type mixer. Once mixed, the granule blend is
dispensed into appropriate containers (bottles, bags, etc.) for
commercial sale. Testing of the manufactured homogenous granule
blend DPX-CDQ73 WG showed that all data for the different batches
of blend were within the respective proposed assay ranges for
active ingredient.
Example 5
Evaluation of Levels of Glyphosate and ALS Inhibitor Herbicide
Efficacy Among Soybean Plants Carrying Different GAT and HRA
Sequences
[0345] Three GAT7 events in soybean were compared to four selected
GAT11 soybean events to determine if differences could be detected
for tolerance to high rates of glyphosate+sulfonylurea treatments.
Across the treatment combinations, the GAT7 construct had
significantly less spray response compared to the GAT11 constructs
at 7, 14, and 28 DAS. Within the 8.times. Touchdowng.RTM.+1.times.
Resolve.RTM.+2.times. Express.RTM. treatment, and the 8.times.
Touchdown.RTM.+2.times. Resolve.RTM.+4.times. Express.RTM.
treatment, GAT7 event EAFS 3560.4.3 had the lowest spray response
scores compared to all other events at 7, 14, and 28 DAS.
Materials and Methods
[0346] For each treatment, three replications of two 12 foot plots
of three selected GAT7 events and four selected GAT11 events were
grown in a RCB design (blocked by treatment) at two locations in
Hawaii. Individual lines, events, and construct tested are listed
below in Table 18.
TABLE-US-00018 TABLE 18 Entry Name GAT Event Construct Construct
Description JH12862353 GAT11 EAFS 3861.2.3 PHP22021A
H2B:GAT4618::3(35Senh) +:SCP:HRA (DV) JH12862357 GAT11 EAFS
3862.2.5 PHP22021A H2B:GAT4618::3(35Senh) +:SCP:HRA (DV) JH12862359
GAT11 EAFS 3862.2.5 PHP22021A H2B:GAT4618::3(35Senh) +:SCP:HRA (DV)
JH12862360 GAT11 EAFS 3862.2.5 PHP22021A H2B:GAT4618::3(35Senh)
+:SCP:HRA (DV) JH12862361 GAT11 EAFS 3862.2.5 PHP22021A
H2B:GAT4618::3(35Senh) +:SCP:HRA (DV) JH12862364 GAT11 EAFS
3862.4.2 PHP22021A H2B:GAT4618::3(35Senh) +:SCP:HRA (DV) JH12862365
GAT11 EAFS 3862.4.2 PHP22021A H2B:GAT4618::3(35Senh) +:SCP:HRA (DV)
JH12862405 GAT11 EAFS 3876.8.15 PHP22117A
H2B:GAT4621::3(35Senh)+:SCP:HRA (DV) JH12862406 GAT11 EAFS
3876.8.15 PHP22117A H2B:GAT4621::3(35Senh)+:SCP:HRA (DV) JH12862528
GAT7 EAFS 3560.4.3 PHP20163A SCP:GAT4601::SAMS:HRA JH12862529 GAT7
EAFS 3559.2.1 PHP20163A SCP:GAT4601::SAMS:HRA JH12862531 GAT7 EAFS
3561.1.1 PHP20163A SCP:GAT4601::SAMS:HRA
The three different treatments applied at the V3 growth stage were;
1. 8.times. Touchdown.RTM. Hi-Tech (8630.55 g/ha a.i.
glyphosate)+1.times. Resolved (35.0 g/ha a.i. rimsulfuron)+2.times.
Express.RTM. (17.5 g/ha tribenuron), 2. 8.times. Touchdown.RTM.
Hi-Tech (8630.55 g/ha a.i. glyphosate)+2.times. Resolve.RTM. (70.0
g/ha a.i. rimsulfuron)+4.times. Express.RTM. (35.0 g/ha
tribenuron), and 3. Unsprayed Control. All spray treatments also
contained a 1.times. non-ionic surfactant and ammonium sulfate. At
7, 14, and 28 days after spraying, plots were given a visual spray
damage rating based upon observed chlorosis, necrosis, and/or plant
stunting (0%=no observed effect to 100%=entire plot deceased).
Visual rating data were subject to ANOVA and mean separation using
SAS.
Results and Discussion
[0347] Across the three treatments, the round of GAT (7 vs. 11),
DNA construct, event, treatment, GAT*treatment,
construct*treatment, and event*treatment were significantly
different at 7 DAS and 14 DAS (data not shown). At 28 DAS, the GAT
round, construct, event, treatment, GAT*treatment, and
event*treatment effects were significantly different (data not
shown). The GAT7 lines had significantly less response noted across
the three treatments at 7, 14, and 28 DAS (data not shown).
[0348] Within the 8.times. Touchdown.RTM.+1.times.
Resolve.RTM.+2.times. Express.RTM. treatment, the GAT7 construct
PHP20163A had significantly lower spray response ratings compared
to GAT11 construct PHP22021A at 7, 14, and 28 DAS (data not shown).
PHP20163A had significantly more tolerance to this treatment
compared to PHP22117A only at 28 DAS (data not shown). Among the
events compared, GAT7 event EAFS 3560.4.3 had the most initial
tolerance observed at 7 and 14 DAS, and had the best recovery score
at 28 DAS (data not shown). In examining the differences between
least squares means (LSMeans), each of the three GAT7 events had
significantly less spray response at 7 DAS compared to GAT11 EAFS
3861.2.3 and GAT11 EAFS 3862.2.5, and were rated statistically
similar to GAT11 EAFS 3862.2.5 and GAT11 EAFS 3876.8.1 (data not
shown). At 14 DAS, the 3 GAT7 events had significantly less
response scores compared to GAT11 EAFS 3862.4.2, but only GAT7 EAFS
3560.4.3 had significantly less response compared to EAFS 3861.2.3
and EAFS 3862.2.5 (data not shown). At 28 DAS, all three GAT7
events had significantly better recovery compared to GAT11 events
EAFS 3861.2.3, EAFS 3862.4.2, and EAFS 3876.8.1 (data not shown).
In addition, GAT7 event EAFS 3560.4.3 had significantly less spray
response compared to GAT11 event EAFS 3862.2.5 at 28 DAS (data not
shown).
[0349] In examining the 8.times. Touchdown.RTM.+2.times.
Resolve.RTM.+4.times. Express.RTM. treatment, GAT7 PHP20163A had
significantly less response compared to GAT11 PHP22021 at 7, 14,
and 28 DAS, and PHP20163A had significantly less response compared
to GAT11 PHP22117A at 28 DAS (data not shown). Among the events,
GAT7 EAFS 3560.4.3 had significantly better tolerance compared to
all other events at 7 and 14 DAS, and GAT7 EAFS 3559.2.1 and EAFS
3560.4.3 had significantly lower spray response compared to all
other events at 28 DAS (data not shown). Comparing the differences
in LSMeans, at 7 DAS and 14 DAS, GAT7 EAFS 3560.4.3 had
significantly less response compared to all the GAT 11 events (data
not shown). The other 2 GAT7 events were significantly lower in
response compared to GAT 11 event EAFS 3862.4.2 at 7 and 14 DAS
(data not shown). At 28 DAS, GAT7 events EAFS 3559.2.1 and EAFS
3560.4.3 had significantly better recovery compared to all the
GAT11 events (data not shown). GAT7 event EAFS 3561.1.1 was only
significantly better than GAT11 event EAFS 3862.4.2 (data not
shown).
Example 6
Robustness Trial Data Analysis in Soybean
[0350] The interactions between sulfonylurea and imidazolinone
under field trial conditions have been studied. Antagonism between
the sulfonylurea and imidazolinone chemistries has been seen in the
past on commercial STS.RTM. soybean varieties. An SU like
thifensulfuron on STS.RTM. soy is normally safe. Add an IMI like
imazethapyr (Pursuit) and the mixture becomes_less safe
(antagonized the crop safety). In the case of GAT Rd7, rimsulfuron
causes crop phyto. Add an IMI like Pursuit and the mixture became
more safe (antagonized the crop injury). The filed trials described
below show there is an increased crop safety when normally
injurious amounts of, for example, rimsulfuron were mixed with, for
example, imazethapyr, a normally "safe" imidazolinone herbicide.
Example 6A comprises a field trial that demonstrates this effect.
Example 6B provides greenhouse data that confirms the field trial
data.
Example 6A
[0351] The T6 generation of soybean of the lead GAT7 event (SEQ ID
NO:68) also having HRA (SEQ ID NO:65) [SCP:GAT7::SAMS:ALS] was
compared to 92B25 to determine levels of robustness when sprayed
with different combinations and rates of sulfonylurea,
chlorpyrifos, and/or imazethapyr chemistries. Across all the
treatment combinations except 16.times. Harmony.RTM. (no
significance detected), GAT7 had significantly lower spray response
compared to STS.RTM. at 7, 14, and 28 days after spraying (DAS).
Application of 1.times. Resolve.RTM. with and without Lorsban.RTM.
created a large response from GAT7 and STS.RTM. at 7 DAS. The GAT7
was able to significantly recover from these treatments at 14 and
28 DAS, while the STS.RTM. line remained heavily damaged. The GAT7
line had significantly less spray response to 4.times. Pursuit.RTM.
compared to the STS.RTM. line at 7 DAS, while both lines were not
statistically different at 14 and 28 DAS. When 1.times.
Resolve.RTM.+4.times. Pursuit.RTM. was applied, the GAT7 line had
significantly higher tolerance compared to the STS.RTM. line at 7,
14, and 28 DAS. At 7, 14, and 28 DAS 16.times. Harmony.RTM., there
was not a large response observed from either the GAT7 or STS.RTM.
line. Data from the treatments combining 16.times. Harmony.RTM.
with 4.times. Pursuit.RTM. or 16.times. Harmony.RTM. with 4.times.
Express.RTM. indicated GAT7 had significantly lower spray response
compared to the STS.RTM. line at 7, 14, and 28 DAS. In addition,
the 7, 14, and 28 DAS data from 0.25.times. Resolve.RTM.+1.5.times.
Express.RTM. treatment showed GAT7 had significantly higher
tolerance compared to STS.RTM.. In general, the data from this
study indicate GAT7 provides significantly higher tolerance
compared to STS.RTM. across multiple herbicide and insecticide
chemistries.
Materials and Methods
[0352] For each treatment, three replications of two 12 foot plots
of the lead GAT7 event (EAFS 3560.4.3; GEID=JH12862528) and 92B25
(STS.RTM.) were grown in a RCB design (blocked by treatment) at two
locations in Hawaii. The nine different treatments applied at the
V3 growth stage were; 1. 1.times. Resolve.RTM. (2 oz) (35.0 g/ha
a.i. rimsulfuron), 2. 1.times. Resolve.RTM. (35.0 g/ha a.i.
rimsulfuron)+1.times. Lorsban.RTM. 4E (560.0 g/ha a.i.
chlorpyrifos), 3. 4.times. Pursuits (211.8 g/ha a.i. imazethapyr),
4. 1.times. Resolve.RTM. (35.0 g/ha a.i. rimsulfuron)+4.times.
Pursuit.RTM. (211.8 g/ha a.i. imazethapyr), 5. 16.times.
Harmony.RTM. GT (70.0 gms/ha a.i. thifensulfuron), 6. 16.times.
Harmony.RTM. (70.0 gms/ha a.i. thifensulfuron)+4.times.
Pursuit.RTM. (211.8 g/ha a.i. imazethapyr), 7. 16.times.
Harmony.RTM. (70.0 gms/ha a.i. thifensulfuron)+4.times.
Express.RTM. (35.0 g/ha a.i. tribenuron) 8. 0.25.times.
Resolve.RTM. (2,157 g/ha a.i. glyphosate)+1.5.times. Express.RTM.
(13.1 g/ha a.i. tribenuron) 9. Unsprayed Control. All spray
treatments also contained a 1.times. non-ionic surfactant and
ammonium sulfide. At 7, 14, and 28 days after spraying, plots were
given a visual spray damage rating based upon observed chlorosis,
necrosis, and/or plant stunting (0%=no observed effect to
100%=entire plot deceased). Visual rating data were subject to
ANOVA and mean separation using SAS.
Results and Discussion
[0353] Across all treatments at 7 and 14 DAS, the location, GEID,
treatments, and GEID*treatment effects were significantly different
(data not shown). The GAT7 line was scored significantly lower than
the STS.RTM. line across all treatments at 7 and 14 DAS (data not
shown). At 28 DAS, the GEID, loc*GEID, treatments, and
GEID*treatment effects were significantly different (data not
shown). Over all the treatments, the GAT7 line was scored with
significantly less spray damage compared to the STS.RTM. line at 28
DAS (data not shown).
[0354] The 1.times. Resolve.RTM. (rimsulfuron) treatment created a
large response from both the GAT7 (70%); and STS.RTM. (83%) lines
at 7 DAS (data not shown). At 14 DAS, the GAT7 line (74%) had
significantly less response compared to the STS.RTM. line (93%)
(data not shown). By 28 DAS, the GAT7 was able to recover and was
scored with significantly less damage compared to the STS.RTM. line
(32% vs. 93%) (data not shown).
[0355] When date from the Lorsban.RTM. (chlorpyrifos)+1.times.
Resolve.RTM. treatment are examined, the GAT7 line did not have
significantly less response compared to the response of the
STS.RTM. line until 14 and 28 DAS (data not shown). At 28 DAS, the
GAT7 line sprayed with Lorsban.RTM. and Resolve.RTM. (56%) did not
recover as quickly compared to only the 1.times. Resolve.RTM. (32%)
treatment on the GAT7 line (data not shown).
[0356] Application of 4.times. Pursuit.RTM. (imazethapyr) provided
a large response from the STS.RTM. line (72%) at 7 DAS, while the
GAT7 line (29%) had significantly less response (data not shown).
At 14 DAS and 28 DAS, the difference between GAT7 and STS.RTM. was
not significant (data not shown).
[0357] A tank mix of 1.times. Resolve.RTM.+4.times. Pursuit.RTM.
resulted in significantly less spray response for the GAT7 line
compared to the STS.RTM. line at 7, 14, and 28 DAS (data not
shown). The 1.times. Resolve.RTM.V+4.times. Pursuit.RTM. treatment
on GAT7 was scored with less damage overall at 7, 14, and 28 DAS
compared to the 1.times. Resolve.RTM. only and 1.times.
Resolve.RTM.+Lorsban.RTM. treatment (data not shown). Using a
pairwise comparison of these treatments on only the GAT7 line, the
1.times. Resolve.RTM.+4.times. Pursuit.RTM. treatment was scored
significantly less than the 1.times. Resolve.RTM.+Lorsban.RTM.
treatment at 14 and 28 DAS. In addition, a pairwise comparison of
the 1.times. Resolve.RTM.+4.times. Pursuit.RTM. treatment compared
to the 1.times. Resolve.RTM. treatment on GAT7 was only
significantly less at 14 DAS.
[0358] Application of 16.times. Harmony.RTM. did not create a large
response from the GAT7 or STS.RTM. lines at the three rating dates
(data not shown). GAT7 was not significantly different from
STS.RTM. for all the 16.times. Harmony.RTM. scores (data not
shown). The treatment applying 4.times. Pursuits mixed with
16.times. Harmony.RTM. did create significantly lower response
scores for the GAT7 line compared to the STS.RTM. line at 7, 14,
and 28 DAS (data not shown). The mixture of 4.times. Express.RTM.
with 16.times. Harmony.RTM. was scored significantly lower for the
GAT7 line compared to the STS.RTM. line at 7, 14, and 28 DAS (data
not shown). In general, the GAT7 line provided excellent overall
tolerance to the 16.times. Harmony.RTM., 16.times.
Harmony.RTM.+4.times. Pursuit.RTM., and 16.times.
Harmony.RTM.+4.times. Express.RTM. treatments at all the scoring
dates.
[0359] A mixture of 0.25.times. Resolve.RTM.+1.5.times.
Express.RTM. created a crop response from the GAT7 line at 7 DAS
(53%) and 14 DAS (47%) that was not as evident at 28 DAS (12%)
(data not shown). The STS.RTM. line had significantly higher
response compared to GAT7 at 7 DAS (79%) and 14 DAS (90%) (data not
shown). The STS.RTM. line did not recover at 28 DAS (87%) and had
significantly more response compared to the GAT7 line (data not
shown). Examining only the GAT7 line, a pairwise comparison of the
0.25.times. Resolve.RTM.+1.5.times. Express.RTM. treatment had
significantly less response observed compared to the 1.times.
Resolve.RTM. treatment at 7, 14, and 28 DAS.
TABLE-US-00019 TABLE 19 Summary of Treatment Protocols TRT
TREATMENT COMPONENT FORMULATION RATE UNIT TIMING 1 Resolve 2 oz A
>DPX-E9636 (WG 25.00 PC) WG 25.00 PC 2.00 OMA 01 POSPOS B
SURFACTANT - NON-IONIC (SL) SL 1.00 PR 0.25 PMV 01 POSPOS C
>AMSUL (GR 100 PC) GR 100.00 PC 2.00 LMA 01 POSPOS 2 Resolve +
Lorsban A >DPX-E9636 (WG 25.00 PC) WG 25.00 PC 2.00 OMA 01
POSPOS B LORSBAN 4E (EC) EC 4.00 LG 1.00 PMA 01 POSPOS C SURFACTANT
- NON-IONIC (SL) SL 1.00 PR 0.25 PMV 01 POSPOS D >AMSUL (GR 100
PC) GR 100.00 PC 2.00 LMA 01 POSPOS 3 Pursuit A PURSUIT DG (70WG)
WG 70.00 PC 4.32 OMA 01 POSPOS B SURFACTANT - NON-IONIC (SL) SL
1.00 PR 0.25 PMV 01 POSPOS C >AMSUL (GR 100 PC) GR 100.00 PC
2.00 LMA 01 POSPOS 4 Resolve + Pursuit A >DPX-E9636 (WG 25.00
PC) WG 25.00 PC 2.00 OMA 01 POSPOS B PURSUIT DG (70WG) WG 70.00 PC
4.32 OMA 01 POSPOS C SURFACTANT - NON-IONIC (SL) SL 1.00 PR 0.25
PMV 01 POSPOS D >AMSUL (GR 100 PC) GR 100.00 PC 2.00 LMA 01
POSPOS 5 Harmony GT 1.33 oz A >HARMONY GT PX (75% EXTRUDED WG
75.00 PC 1.33 OMA 01 POSPOS WG) B SURFACTANT - NON-IONIC (SL) SL
1.00 PR 0.25 PMV 01 POSPOS C >AMSUL (GR 100 PC) GR 100.00 PC
2.00 LMA 01 POSPOS 6 GT + Pursuit A >HARMONY GT PX (75% EXTRUDED
WG 75.00 PC 1.33 OMA 01 POSPOS WG) B PURSUIT DG (70WG) WG 70.00 PC
2.16 OMA 01 POSPOS C SURFACTANT - NON-IONIC (SL) SL 1.00 PR 0.25
PMV 01 POSPOS D >AMSUL (GR 100 PC) GR 100.00 PC 2.00 LMA 01
POSPOS 7 Harmony GT 1.33 + EX 0.67 A >HARMONY GT PX (75%
EXTRUDED WG 75.00 PC 1.33 OMA 01 POSPOS WG) B >EXPRESS PX (75%
EXTRUDED WG) WG 75.00 PC 0.67 OMA 01 POSPOS C SURFACTANT -
NON-IONIC (SL) SL 1.00 PR 0.25 PMV 01 POSPOS D >AMSUL (GR 100
PC) GR 100.00 PC 2.00 LMA 01 POSPOS 8 Resolve 0.5 + Express 0.25 A
>DPX-E9636 (WG 25.00 PC) WG 25.00 PC 0.50 OMA 01 POSPOS B
>EXPRESS PX (75% EXTRUDED WG) WG 75.00 PC 0.25 OMA 01 POSPOS C
SURFACTANT - NON-IONIC (SL) SL 1.00 PR 0.25 PMV 01 POSPOS D
>AMSUL (GR 100 PC) GR 100.00 PC 2.00 LMA 01 POSPOS 999 UNTREATED
CHECK A UNTREATED CHECK NA 0.00 NA 0.00 NA 00 UNTRCHK > =
SUPPLEMENTAL CHEMICAL TIMINGS: 00 = UNTRCHK, UNTREATED TIMING 01 =
POSPOS, POSTEMERGENCE V2-3 RATE UNITS: LMA = POUNDS MATERIAL/ACRE
NA = NOT APPLICABLE OMA = OZ (DRY) MATERIAL/ACRE PMA = PINTS
MATERIAL/ACRE PMV = % MATERIAL VOL TO VOL DESIGN: RANDOMIZED
COMPLETE BLOCK DESIGN NO. REPS: 3 PLOT SIZE: 5 .times. 10 FEET PLOT
AREA: 50 SQUARE FEET OBSERVATIONS/RATING: Crop Response 7, 14 &
28 DAT
Example 6B
[0360] Example 6B provides greenhouse data that confirms the field
trial data provided above in Example 6A. Soybeans comprising the
lead GAT7 event and also having HRA were used in the studies.
TABLE-US-00020 TABLE 20 Summary of treatment conditions Rimsulfuron
Imazethapyr Rate Rate Replicates Test Plant (g ai/ha) (g ai/ha)
Treatment # A B C D Mean GAT/HRA 0 0 1 53.91 53.16 59.21 55.43
Soybeans 140 2 48.8 52.97 54.45 61.67 54.47 280 3 49.06 53.65 39.74
61.06 50.88 560 4 56.46 52.98 57.76 55.76 55.74 1024 5 51.34 53.89
45.64 51.47 50.59 35 0 6 21.09 20.45 27.11 20.83 22.37 140 7 18.18
18.79 26.03 22.15 21.29 280 8 26.45 15.59 14.53 26.5 20.77 560 9
22.2 22.97 26.8 20.65 23.16 1024 10 24.56 30.53 28.04 19.95 25.77
70 0 11 18.33 24.56 15.83 19.75 19.62 140 12 16.71 23.1 27.27 21.44
22.13 280 13 27.43 34.8 32.26 21.65 29.04 560 14 28.84 26.17 28.12
31.95 28.77 1024 15 32.51 25.19 34.18 29.96 30.46 140 0 16 20.09
12.5 13.96 23.32 17.47 140 17 21.69 24.38 16.15 17.27 19.87 280 18
23.77 21.72 27.16 26.22 24.72 560 19 30.39 34.67 21.46 28.41 28.73
1024 20 35.19 30.68 26 35.19 31.77 280 0 21 18.14 17.76 20.01 14.3
17.55 140 22 15.67 16.62 18.29 15.91 16.62 280 23 15.83 21.36 20.3
24.67 20.52 560 24 23.9 19.22 28.67 24.7 24.12 1024 25 30.93 28.76
24.69 36.65 30.26 Jack 0 0 1 50.93 60.34 53.87 46.89 53.01 Soybeans
70 2 45.88 42.49 41.6 37.47 41.86 140 3 38.09 38.57 28.06 42.33
36.76 280 4 35.25 33.01 42.97 41.4 38.16 560 5 39.2 37.15 38.6
29.67 36.16 0.5 0 6 26.27 18.24 21.48 16.09 20.52 70 7 15.12 13.93
11.01 7.12 11.80 140 8 12.68 6.92 10.82 12.51 10.73 280 9 12.86
7.14 12.16 9.61 10.44 560 10 12.74 10.68 12.71 11.06 11.80 1 0 11
5.8 7.64 7.13 9.21 7.45 70 12 8.05 6.76 8.42 7.48 7.68 140 13 7.57
6.54 7.49 10 7.90 280 14 6.84 7.92 7.25 8.37 7.60 560 15 12.51
10.59 9.57 7.16 9.96 2 0 16 4.09 5.37 4.3 11.58 6.34 70 17 3.36
6.57 4.83 7.67 5.61 140 18 6.12 6.55 5.59 6.09 6.09 280 19 5.87
4.89 5.48 6.24 5.62 560 20 5.35 7.73 8.9 5.48 6.87 4 0 21 4.12 4.48
2.93 3.46 3.75 70 22 2.75 2.94 11.64 4.21 5.39 140 23 3.29 3.23
4.24 3.59 280 24 4.46 5.9 3.92 3.65 4.48 560 25 4.67 5.01 2.77 4.1
4.14
TABLE-US-00021 TABLE 21 Summary of greenhouse results. Rimsulfuron
Mean - Rate Imazethap yr Replicates Standard Initial % Growth Test
Plant (g ai/ha) Rate (g ai/ha) Treatment # A B C D Mean Deviation
Weight Reduction GAT/HRA 0 0 1 53.91 53.16 59.21 55.43 3.30 49.28 0
Soybeans 140 2 48.8 52.97 54.45 61.67 54.47 5.36 48.33 2 280 3
49.06 53.65 39.74 61.06 50.88 8.92 44.73 9 560 4 56.46 52.98 57.76
55.76 55.74 2.02 49.60 -1 1024 5 51.34 53.89 45.64 51.47 50.59 3.50
44.44 10 35 0 6 21.09 20.45 27.11 20.83 22.37 3.17 16.23 67 140 7
18.18 18.79 26.03 22.15 21.29 3.61 15.14 69 280 8 26.45 15.59 14.53
26.5 20.77 6.60 14.62 70 560 9 22.2 22.97 26.8 20.65 23.16 2.61
17.01 65 1024 10 24.56 30.53 28.04 19.95 25.77 4.59 19.63 60 70 0
11 18.33 24.56 15.83 19.75 19.62 3.67 13.47 73 140 12 16.71 23.1
27.27 21.44 22.13 4.37 15.99 68 280 13 27.43 34.8 32.26 21.65 29.04
5.80 22.89 54 560 14 28.84 26.17 28.12 31.95 28.77 2.40 22.63 54
1024 15 32.51 25.19 34.18 29.96 30.46 3.92 24.32 51 140 0 16 20.09
12.5 13.96 23.32 17.47 5.10 11.32 77 140 17 21.69 24.38 16.15 17.27
19.87 3.84 13.73 72 280 18 23.77 21.72 27.16 26.22 24.72 2.46 18.57
62 560 19 30.39 34.67 21.46 28.41 28.73 5.51 22.59 54 1024 20 35.19
30.68 26 35.19 31.77 4.39 25.62 48 280 0 21 18.14 17.76 20.01 14.3
17.55 2.38 11.41 77 140 22 15.67 16.62 18.29 15.91 16.62 1.18 10.48
79 280 23 15.83 21.36 20.3 24.57 20.52 3.61 14.37 71 560 24 23.9
19.22 28.67 24.7 24.12 3.88 17.98 64 1024 25 30.93 28.75 24.69
36.65 30.26 4.99 24.11 51
Example 7
Methods of Transformation Employing a GAT sequence in Maize
I. Preparation of Agrobacterium Master Plate
[0361] 1. Obtain engineered Agrobacterium tumefaciens strain with
GAT components (SEQ ID NO: 70 or SEQ ID NO:55) and stored in
-80.degree. C. degree freezer as a 50% glycerol stock. The
transcriptional control region used was the 3.times.35S ENH (-)
operably linked to the ZmUbi PRO-5UTR-ZmUbi intron 1 promoter (SEQ
ID NO:78). This transcriptional control region (SEQ ID NO:78) is
set forth below denoting the location of the various regions of the
regulatory region: a) the 35S enhancer (3.times.) in the reverse
direction has a single underline; b) the UBI promoter has a double
underline, and c) the UBI intron is in italics.
TABLE-US-00022 (SEQ ID NO:78)
atcacatcaatccacttgctttgaagacgtggttggaacgtcttcttttt
ccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggca
gaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgta
ggagccaccttccttttccactatcttcacaataaagtgacagatagctg
ggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtc
tcaattgccctttggtcttctgagactgtatctttgatatttttggagta
gacaagcgtgtcgtgctccaccatgttgacgaagattttcttcttgtcat
tgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagt
tctgttaggtcctctatttgaatctttgactccatggacggtatcgataa
gctagcttgatatcacatcaatccacttgctttgaagacgtggttggaac
gtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggac
cactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatga
tggcatttgtaggagccaccttccttttccactatcttcacaataaagtg
acagatagctgggcaatggaatccgaggaggtttccggatattacccttt
gttgaaaagtctcaattgccctttggtcttctgagactgtatctttgata
tttttggagtagacaagcgtgtcgtgctccaccatgttgacgaagatttt
cttcttgtcattgagtcgtaagagactctgtatgaactgttcgccagtct
ttacggcgagttctgttaggtcctctatttgaatctttgactccatgatc
gaattatcacatcaatccacttgctttgaagacgtggttggaacgtcttc
tttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgt
cggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcat
ttgtaggagccaccttccttttccactatcttcacaataaagtgacagat
agctgggcaatggaatccgaggaggtttccggatattaccctttgttgaa
aagtctcaattgccctttggtcttctgagactgtatctttgatatttttg
gagtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttctt
gtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacgg
cgagttctgttaggtcctctatttgaatctttgactccatgggaattcct
gcagcccagcttgcatgcctgcagtgcagcgtgacccggtcgtgcccctc
tctagagataatgagcattgcatgtctaagttataaaaaattaccacata
ttttttttgtcacacttgtttgaagtgcagtttatctatctttatacata
tatttaaactttactctacgaataatataatctatagtactacaataata
tcagtgttttagagaatcatataaatgaacagttagacatggtctaaagg
acaattgagtattttgacaacaggactctacagttttatctttttagtgt
gcatgtgttctcctttttttttgcaaatagcttcacctatataatacttc
atccattttattagtacatccatttagggtttagggttaatggtttttat
agactaatttttttagtacatctattttattctattttagcctctaaatt
aagaaaactaaaactctattttagtttttttatttaataatttagatata
aaatagaataaaataaagtgactaaaaattaaacaaataccctttaagaa
attaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccag
cctgttaaacgccgtcgacgagtctaacggacaccaaccagcgaaccagc
agcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctg
cctctggacccctctcgagagttccgctccaccgttggacttgctccgct
gtcggcatccagaaattgcgtggcggagcggcagacgtgagccggcacgg
caggcggcctcctcctcctctcacggcaccggcagctacgggggattcct
ttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagac
accccctccacaccctctttccccaacctcgtgttgttcggagcgcacac
acacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaa
ggtacgccgctcgtcctcccccccccccctctctaccttctctagatcgg
cgttccggtccatggttagggcccggtagttctacttctgttcatgtttg
tgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacgg
atgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttc
tctttggggaatcctgggatggctctagccgttccgcagacgggatcgat
ttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcct
ttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgct
tttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctag
atcggagtagaattctgtttcaaactacctggtggatttattaattttgg
atctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatg
gatggaaatatcgatctaggataggtatacatgttgatgcgggttttact
gatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtg
tggttgggcggtcgttcattcgttctagatcggagtagaatactgtttca
aactacctggtgtatttattaattttggaactgtatgtgtgtgtcataca
tcttcatagttacgagtttaagatggatggaaatatcgatctaggatagg
tatacatgttgatgtgggttttactgatgcatatacatgatggcatatgc
agcatctattcatatgctctaaccttgagtacctatctattataataaac
aagtatgttttataattattttgatcttgatatacttggatgatggcata
tgcagcagctatatgtggatttttttagccctgccttcatacgctattta
tttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgtt acttctgca
2. Prepare master plate from a glycerol stock by streaking the
bacteria to produce single colonies on #800 medium and incubate the
bacteria at 28.degree. C. in the dark for 3-4 days. 3. Prepare a
working plate by streaking 1 colony from the master plate across
#810 media. Incubate bacteria at 28.degree. C. in the dark for 1-2
days.
II. Preparation of Bacteria for Embryo Infection
[0362] 1. Prepare liquid culture of Agrobacterium 1 day prior to
embryo isolation. Set up a flask with 30 mls of 557A medium, 30
.mu.l of 2% acetosyringone and 30 .mu.l of 5% spectinomycin. [0363]
2. Inoculate with 1 loopful of Agrobacterium from 810 medium and
place on shaker (200 rpm) in dark room at 28.degree. C. overnight.
[0364] 3. On morning of infection, take samples of the liquid
culture of Agrobacterium and make a 1/4 dilution with 557A. Use the
diluted liquid culture to take OD reading using visible light at
550 nm. [0365] 4. Make dilutions to Agrobacterium culture as
appropriate according the OD reading to maintain OD reading between
0.2-0.8 during embryo isolation. [0366] 5. When preparing
Agrobacterium for infection, repeat OD reading of liquid culture.
Using the OD reading calculate the number of mls required to obtain
5 E 10 cfu/ml (cfu=colony forming unit) by using the formula
EXPONENT (1.755*(lnOD)+21.77) as derived from a standard curve.
Pipet the calculated amount of Agrobacterium liquid culture into 14
ml tube and centrifuge at 4500 rpm at 4-20.degree. C. for ten
minutes. Remove the supernatant and resuspend Agrobacterium in
appropriate amount of 100 uM acetosyringone solution in 561Q.
III. Immature Embryo Isolation
[0366] [0367] 1. Harvest GS3 ears at 9-11 days after pollination
with embryo size of 1-2 mm in length. [0368] 2. Sterilize ear in
50% bleach and 1 drop Tween for 20-30 minutes. Rinse 3-5 times in
sterile water [0369] 3. Isolate embryos from kernels and place in
microtube containing 2 mls 561Q.
IV Agrobacterium Infection of Embryos
[0369] [0370] 1. Remove 561Q with pipette from the microtube with
isolated embryos and add 1 ml of Agrobacterium suspension at OD
described above. [0371] 2. Mix by vortexing for about 30 seconds.
[0372] 3. Allow 5 minutes for infection at room temperature.
V. Co-Cultivation
[0372] [0373] 1. After removing liquid medium, transfer embryos and
orient the embryos with embryonic axis down on the surface of 562P
co-cultivation medium. [0374] 2. Place embryos in 20.degree. C.
incubator for 3 days. Transfer to 28.degree. C. for 3 additional
days.
VI. Selection of Transgenic Putative Callus Events
[0374] [0375] 1. After co-cultivation, transfer embryos to 563I
selection medium containing 1 mM glyphosate. Culture the embryos at
28.degree. C. in dark. [0376] 2. Every 14-21 days transfer embryos
to fresh 563I medium. The selection process may last about 2 months
until actively growing putative callus events can be identified.
Maintain putative callus events on 563I medium and sample callus
for PCR.
VII. Regeneration of T0 Plants
[0376] [0377] 1. Transfer callus events to 287I medium containing
0.1 mM Glyphosate until somatic embryos mature. Culture the callus
at 28.degree. C. in dark. [0378] 2. Transfer mature embryos to 273I
embryo germination medium containing 0.1 mM glyphosate in plates.
Culture the plates at 28.degree. C. in light. [0379] 3. When shoots
and roots emerge, transfer individual plants to 273I containing 0.1
mM Glyphosate in tubes. Culture the tubes at 28.degree. C. in
light. [0380] 4. Plantlets with established shoots and roots shall
be transferred to greenhouse for further growth and production of
T1 seed.
Example 8
Effect of 35S enhancer on Transformation Efficiency and Efficacy of
GAT and ALS in Maize
Materials and Methods
[0381] Four 35S enhancer constructs (PHP20118, PHP20120, PHP20122,
PHP20124) and one non-35S construct (PHP19288) were used to produce
events to evaluate the effect of 35S enhancer on transformation
efficiency and efficacy of GAT (SEQ ID NO:70) (FIG. 1). The
differences between the four 35S enhancer constructs are the copy
numbers of the 35S enhancer and the orientations of the 35S
enhancer in the constructs. A summary of each 35S enhancer
construct is provided below.
PHP20118 comprises 35S ENH(+):ZmUBI PRO-5UTR-UBI INTRON1 (+ denotes
forward direction of 35S enhancer). This transcriptional control
region (SEQ ID NO:80) is set forth below denoting the location of
the various regions of the regulatory region: a) the 35S enhancer
in the forward direction has a single underline; b) the UBI
promoter has a double underline, and c) the UBI intron is in
italics.
TABLE-US-00023 (SEQ ID NO:80)
cccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaa
gactggcgaacagttcatacagagtctcttacgactcaatgacaagaaga
aaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaat
atcaaagatacagtctcagaagaccaaagggcaattgagacttttcaaca
aagggtaatatccggaaacctcctcggattccattgcccagctatctgtc
actttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccat
cattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtgg
tcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacg
ttccaaccacgtcttcaaagcaagtggattgatgtgatatcaagcttatc
gataccgtcgacctcgagggggggcccagcttgcatgcctgcagtgcagc
gtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaag
ttataaaaaattaccacatattttttttgtcacacttgtttgaagtgcag
tttatctatctttatacatatatttaaactttactctacgaataatataa
tctatagtactacaataatatcagtgttttagagaatcatataaatgaac
agttagacatggtctaaaggacaattgagtattttgacaacaggactcta
cagttttatctttttagtgtgcatgtgttctcctttttttttgcaaatag
cttcacctatataatacttcatccattttattagtacatccatttagggt
ttagggttaatggtttttatagactaatttttttagtacatctattttat
tctattttagcctctaaattaagaaaactaaaactctattttagtttttt
tatttaataatttagatataaaatagaataaaataaagtgactaaaaatt
aaacaaataccctttaagaaattaaaaaaactaaggaaacatttttcttg
tttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacgg
acaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacg
gcacggcatctctgtcgctgcctctggacccctctcgagagttccgctcc
accgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcg
gcagacgtgagccggcacggcaggcggcctcctcctcctctcacggcacc
ggcagctacgggggattcctttcccaccgctccttcgctttcccttcctc
gcccgccgtaataaatagacaccccctccacaccctctttccccaacctc
tcgttgttcggagcgcacacacacacaaccagatctcccccaaatccacc
gctcggcacctccgcttcaaggtacgccgctcgtcctcccccccccccct
ctctaccttctctagatcggcgttccggtccatggttagggcccggtagt
tctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtg
ctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgat
tgctaacttgccagtgtttctctttggggaatcctgggatggctctagcc
gttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagg
gtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttg
tcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtc
tggttgggcggtcgttctagatcggagtagaattctgtttcaaactacct
ggtggatttattaattttggatctgtatgtgtgtgccatacatattcata
gttacgaattgaagatgatggatggaaatatcgatctaggataggtatac
cagttgatgcgggttttactgatgcatatacagagatgctttttgttcgc
ttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagat
cggagtagaatactgtttcaaactacctggtgtatttattaattttggaa
ctgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggatgg
aaatatcgatctaggataggtatacatgttgatgtgggttttactgatgc
atatacatgatggcatatgcagcatctattcatatgctctaaccttgagt
acctatctattataataaacaagtatgttttataattattttgatcttga
tatacttggatgatggcatatgcagcagctatatgtggatttttttagcc
ctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgc
tcaccctgttgtttgggttacttctgca
[0382] PHP20122 comprises 3.times.35S ENH (+):ZmUBI PRO-5UTR-UBI
INTRON1 (+ denotes forward direction of 35S enhancer). This
transcriptional control region (SEQ ID NO:81) is set forth below
denoting the location of the various regions of the regulatory
region: a) the 35S enhancer in the forward direction has a single
underline; b) the UBI promoter has a double underline, and c) the
UBI intron is in italics.
TABLE-US-00024 (SEQ ID NO: 81)
cccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaa
gactggcgaacagttcatacagagtctcttacgactcaatgacaagaaga
aaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaat
atcaaagatacagtctcagaagaccaaagggcaattgagacttttcaaca
aagggtaatatccggaaacctcctcggattccattgcccagctatctgtc
actttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccat
cattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtgg
tcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacg
ttccaaccacgtcttcaaagcaagtggattgatgtgataattcgatcatg
gagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactgg
cgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatct
tcgtcaacatggtggagcacgacacgcttgtctactccaaaaatatcaaa
gatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggt
aatatccggaaacctcctcggattccattgcccagctatctgtcacttta
ttgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgc
gataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaa
agatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaa
ccacgtcttcaaagcaagtggattgatgtgatatcaagcttatcgatacc
gccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaa
gactggcgaacagttcatacagagtctcttacgactcaatgacaagaaga
aaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaat
atcaaagatacagtctcagaagaccaaagggcaattgagacttttcaaca
aagggtaatatccggaaacctcctcggattccattgcccagctatctgtc
actttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccat
cattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtgg
tcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacg
ttccaaccacgtcttcaaagcaagtggattgatgtgatgtctgcagtgca
gcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtcta
agttataaaaaattaccacatattttttttgtcacacttgtttgaagtgc
agtttatctatctttatacatatatttaaactttactctacgaataatat
aatctatagtactacaataatatcagtgttttagagaatcatataaatga
acagttagacatggtctaaaggacaattgagtattttgacaacaggactc
tacagttttatctttttagtgtgcatgtgttctcctttttttttgcaaat
agcttcacctatataatacttcatccattttattagtacatccatttagg
gtttagggttaatggtttttatagactaatttttttagtacatctatttt
attctattttagcctctaaattaagaaaactaaaactctattttagtttt
tttatttaataatttagatataaaatagaataaaataaagtgactaaaaa
ttaaacaaataccctttaagaaattaaaaaaactaaggaaacatttttct
tgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaac
ggacaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcaga
cggcacggcatctctgtcgctgcctctggacccctctcgagagttccgct
ccaccgttggacttgctccgctgtcggcatccagaaattgcgtggcggag
cggcagacgtgagccggcacggcaggcggcctcctcctcctctcacggca
ccggcagctacgggggattcctttcccaccgctccttcgctttcccttcc
tcgcccgccgtaataaatagacaccccctccacaccctctttccccaacc
tcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatcca
cccgtcggcacctccgcttcaaggtacgccgctcgtcctccccccccccc
ctctctaccttctctagatcggcgttccggtccatggttagggcccggta
gttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccg
tgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctg
attgctaacttgccagtgtttctctttggggaatcctgggatggctctag
ccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcata
gggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtt
tgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtgg
tctggttgggcggtcgttctagatcggagtagaattctgtttcaaactac
ctggtggatttattaattttggatctgtatgtgtgtgccatacatattca
tagttacgaattgaagatgatggatggaaatatcgatctaggataggtat
acatgttgatgcgggttttactgatgcatatacagagatgctttttgttc
gcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctag
atcggagtagaatactgtttcaaactacctggtgtatttattaattttgg
aactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatggat
ggaaatatcgatctaggataggtatacatgttgatgtgggttttactgat
gcatatacatgatggcatatgcagcatctattcatatgctctaaccttga
gtacctatctattataataaacaagtagttttataattattttgatcttg
atatacttggatgatggcatatgcagcagctatatgtggatttttttagc
cctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatg
ctcaccctgttgtttggtgttacttctgca
[0383] PHP20120 comprises 35S ENH (-):ZmUBI PRO-5UTR-UBI INTRON1 (-
denotes reverse direction of 35S enhancer). This transcriptional
control region (SEQ ID NO:82) is set forth below denoting the
location of the various regions of the regulatory region: a) the
35S enhancer in the reverse direction has a single underline; b)
the UBI promoter has a double underline, and c) the UBI intron is
in italics.
TABLE-US-00025 (SEQ ID NO:82)
atcacatcaatccacttgctttgaagacgtggttggaacgtcttcttttt
ccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggca
gaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgta
ggagccaccttccttttccactatcttcacaataaagtgacagatagctg
ggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtc
tcaattgccctttggtcttctgagactgtatctttgatatttttggagta
gacaagcgtgtcgtgctccaccatgttgacgaagattttcttcttgtcat
tgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagt
tctgttaggtcctctatttgaatctttgactccatgggaattcctgcagc
ccagcttgcatgcctgcagtgcagcgtgacccggtcgtgcccctctctag
agataatgagcattgcatgtctaagttataaaaaattaccacatattttt
tttgtcacacttgtttgaagtgcagtttatctatctttatacatatattt
aaactttactctacgaataatataatctatagtactacaataatatcagt
gttttagagaatcatataaatgaacagttagacatggtctaaaggacaat
tgagtattttgacaacaggactctacagttttatctttttagtgtgcatg
tgttctccttttttttgcaaatagcttcacctatataatacttcatccat
tttattagtacatccatttagggtttagggttaatggtttttatagacta
atttttttagtacatctattttattctattttagcctctaaattaagaaa
actaaaactctattttagtttttttatttaataatttagatataaaatag
aataaaataaagtgactaaaaattaaacaaataccctttaagaaattaaa
aaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgtt
aaacgccgtcgacgagtctaacggacaccaaccagcgaaccagcagcgtc
gcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctg
gacccctctcgagagttccgctccaccgttggacttgctccgctgtcggc
atccagaaattgcgtggcggagcggcagacgtgagccggcacggcaggcg
gcctcctcctcctctcacggcaccggcagctacgggggattcctttccca
ccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccc
tccacaccctctttccccaacctcgtgttgttcggagcgcacacacacac
aaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtacg
ccgctcgtcctcccccccccccctctcaccttctcagatcggcgttccgg
tccatggttagggcccggtagttctacttctgttcatgtttgtgttagat
ccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacc
tgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggg
gaatcctgggatggctctagccgttccgcagacgggatcgatttcatgat
tttttttgtttcgttgcatagggtttggtttgcccttttcctttatttca
atatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttg
tcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagt
agaattctgtttcaaactacctggtggatttattaattttggatctgtat
gtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaa
tatcgatctaggataggtatacatgttgatgcgggttttactgatgcata
tacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttggg
cggtcgttcattcgttctagatcggagtagaatactgtttcaaactacct
ggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcata
gttacgagtttaagatggatggaaatatcgatctaggataggtatacatg
ttgatgtgggttttactgatgcatatacatgatggcatatgcagcatcta
ttcatatgctctaaccttgagtacctatctattataataaacaagtatgt
tttataattattttgatcttgatatacttggatgatggcatatgcagcag
ctatatgtggatttttttagccctgccttcatacgctatttatttgcttg
gtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgc a
[0384] PHP20124 comprises 3.times.35S ENH (-): ZmUBI PRO-5UTR-UBI
INTRON1 (- denotes reverse direction of 35S enhancer). This
transcriptional control region (SEQ ID NO:83) is set forth below
denoting the location of the various regions of the regulatory
region: a) the 35S enhancer in the reverse direction has a single
underline; b) the UBI promoter has a double underline, and c) the
UBI intron is in italics.
TABLE-US-00026 (SEQ ID NO:83)
atcacatcaatccacttgctttgaagacgtggttggaacgtcttcttttt
ccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggca
gaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgta
ggagccaccttccttttccactatcttcacaataaagtgacagatagctg
ggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtc
tcaattgccctttggtcttctgagactgtatctttgatatttttggagta
gacaagcgtgtcgtgctccaccatgttgacgaagattttcttcttgtcat
tgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagt
tctgttaggtcctctatttgaatctttgactccatggacggtatcgataa
gctagcttgatatcacatcaatccacttgctttgaagacgtggttggaac
gtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggac
cactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatga
tggcatttgtaggagccaccttccttttccactatcttcacaataaagtg
acagatagctgggcaatggaatccgaggaggtttccggatattacccttt
gttgaaaagtctcaattgccctttggtcttctgagactgtatctttgata
tttttggagtagacaagcgtgtcgtgctccaccatgttgacgaagatttt
cttcttgtcattgagtcgtaagagactctgtatgaactgttcgccagtct
ttacggcgagttctgttaggtcctctatttgaatctttgactccatgatc
gaattatcacatcaatccacttgcttgctttgaagacgtggttggaacgt
cttctttttccacgatgctcctcgtgggtgggggtccatctttgggacca
ctgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatg
gcatttgtaggagccaccttccttttccactatcttcacaataaagtgac
agatagctgggcaatggaatccgaggaggtttccggatattaccctttgt
tgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatt
tttggagtagacaagcgtgtcgtgctccaccatgttgacgaagattttct
tcttgtcattgagtcgtaagagactctgtatgaactgttcgccagtcttt
acggcgagttctgttaggtcctctatttgaatctttgactccatgggaat
tcctgcagcccagcttgcatgcctgcagtgcagcgtgacccggtcgtgcc
cctctctagagataatgagcattgcatgtctaagttataaaaaattacca
catattttttttgtcacacttgtttgaagtgcagtttatctatctttata
catatatttaaactttactctacgaataatataatctatagtactacaat
aatatcagtgttttagagaatcatataaatgaacagttagacatggtcta
aaggacaattgagtattttgacaacaggactctacagttttatcttttta
gtgtgcatgtgttctcctttttttttgcaaatagcttcacctatataata
cttcatccattttattagtacatccatttagggtttagggttaatggttt
ttatagactaatttttttagtacatctattttattctattttagcctcta
aattaagaaaactaaaactctattttagtttttttatttaataatttaga
tataaaatagaataaaataaagtgactaaaaattaaacaaatacccttta
agaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatg
ccagcctgttaaacgccgtcgacgagtctaacggacaccaaccagcgaac
cagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtc
gctgcctctggacccctctcgagagttccgctccaccgttggaccttgct
ccgctgtcggcatccagaaattgcgtggcggagcggcagacgtgagccgg
cacggcaggcggcctcctcctcctctcacggcaccggcagctacggggga
ttcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaa
tagacaccccctccacaccctctttccccaacctcgtgttgttcggagcg
cacacacacacaaccagatctcccccaaatccacccgtcggcacctccgc
ttcaaggtacgccgctcgtcctcccccccccccctctctaccttctcaga
tcggcgttccggtccatggttagggcccggtagttctacttctgttcatg
tttgtgttagatccgtgtttgtgttagatccgtgcgctagcgttcgtaca
cggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgt
ttctctttggggaatcctgggatggctctagccgttccgcagacgggatc
gatttcatgattttttttgtttcgttgcatagggtttggtttgccctttt
cctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcat
gcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttc
tagatcggagtagaattctgtttcaaactacctggtggatttattaattt
tggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatg
atggatggaaatatcgatctaggataggtatacatgttgatgcgggtttt
actgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtg
gtgtggttgggcggtcgttcattcgttctagatcggagtagaatactgtt
tcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcat
acatcttcatagttacgagtttaagatggatggaaatatcgatctaggat
aggtatacatgttgatgtgggttttactgatgcatatacatgatggcata
tgcagcatctattcatatgctctaaccttgagtacctatctattataata
aacaagtatgttttataattattttgatcttgatatacttggatgatggc
atatgcagcagctatatgtggatttttttagccctgccttcatacgctat
ttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggt gttacttctgca
[0385] The transformation experiments were conducted side-by-side
using the same embryos from the same ears. Immature embryos of GS3
line were aseptically removed from each ear and divided into five
portions. Each portion of the embryos was then infected with A.
tumefaciens strain LBA4404 containing the expression cassettes from
each of the five constructs, respectively. After 6 days
co-cultivation, the embryos were transferred to fresh selection
medium containing glyphosate. The transformed cells, which survived
the glyphosate selection, proliferated and produced somatic
embryogenic calli. After about two months subculture, the calli
were then manipulated to regenerate whole transgenic plants with
glyphosate presence and were transferred to the greenhouse. T0
plants were then subjected to glyphosate spray at 6.times. (156
oz/ac) Roundup Ready UltraMax.TM. at V3 or V4 stage in the
greenhouse. Positive plants were sampled for quantitative PCR for
copy number and western for expression. T0 plants were then crossed
with inbred lines to obtain seeds for further evaluation.
Results
[0386] Transformation efficiency was measured as the percentage of
the infected embryos that produced resistant calli after selection.
The average transformation efficiencies for PHP19288, PHP20118,
PHP20120, PHP20122, and PHP20124 were 58%, 63%, 59%, 57%, and 51%,
respectively. The data indicated that all constructs had quite high
and similar transformation efficiencies, although PHP20118 showed a
slight increase (FIG. 3).
[0387] T0 plant efficacy was defined as the percentage of the T0
events that were completely resistant to the 6.times. glyphosate
spray. The efficacy of the non-35S construct (PHP19288) was 48.1%.
In contrast, the efficacies of the 35S enhancer constructs
(PHP20118, PHP20120, PHP20122, and PHP20124) were 96.6%, 93.5%,
89.1%, and 91.1%, respectively (FIG. 4). The data showed that all
35S enhancer constructs significantly increased the plant efficacy
against glyphosate.
[0388] Another significant improvement of using 35S enhancer was in
integration pattern of the transgene. The percentage of the tested
events that were single copy for the non-35S enhancer construct was
only 38%, but for the four 35S enhancer constructs (PHP20118,
PHP20120, PHP20122, and PHP20124) single copy events represented
65%, 63%, 71%, and 88% of the events, respectively (FIG. 4).
[0389] A subset of events from all five constructs were sampled by
Western analysis to look any comparative differences in GAT
expression between non 35S and 35S events. This analysis showed
that events from the non-35S enhancer construct had very low levels
of GAT expression whereas the majority of the events from the 35S
enhancer constructs showed very high levels of GAT expression (FIG.
5).
Example 9
Using 35S Enhancer GAT in Developing a Novel Callus-Based
Gene/Construct Evaluation System
Materials and Methods
[0390] This assay is being developed to improve the evaluation of
expression of an insecticidal gene at a very early stage in the
transformation process in order to identify potential problems with
expression. The basis of this assay is the use of the glyphosate
acetyl transferase (GAT) gene (SEQ ID NO:55) as a selectable
marker. Both GAT and the insecticidal test gene will be driven by a
strong constitutive promoter and linked in the same construct. The
promoter employed comprised the ZmUBI PRO-5UTR-UBI INTRON1 with the
3.times.35S enhancer as described above in Example 7. As a result
it is expected that selection on high levels of glyphosate will
identify high insecticidal test gene expressors. The callus tissue
from these putative high expressors will then be used in insect
bioassays to determine whether the gene product is functional.
Those constructs showing efficacy can be advanced into
transformation. If the construct does not show efficacy then follow
up biochemical and molecular analyses can be conducted to identify
the problem and the gene will be redesigned and retested in the
system (FIG. 6).
Results
[0391] The assay is currently under development. Preliminary data
has shown that the activity of an efficacious insect control gene
can be detected at the callus stage. The correlation between the
callus activity and the plant efficacy is currently being
evaluated.
Example 10
GAT as a Selectable Marker
Materials and Method
[0392] Agrobacterium mediated transformation was used to introduce
the GAT (SEQ ID NO:55) expression cassette into the corn genome.
The GAT expression cassette comprises, promoter comprising ZmUBI
PRO-5UTR-UBI INTRON1 with the 3.times.35S enhancer (as described
above in Example 1) operably linked to the gat gene, and pinII
terminator. Agrobacterium tumefaciens, strain LBA4404, was
pathogenically disarmed by removing its native T-DNA. Instead, the
T-DNA site on the Ti plasmid contained the GAT expression
cassette.
[0393] Immature embryos of maize were aseptically removed from the
developing caryopsis and treated with A. tumefaciens strain LBA4404
containing GAT expression cassettes. After a period of embryo and
Agrobacterium co-cultivation on solid culture medium without
glyphosate presence, the embryos were transferred to fresh
selection medium that contained antibiotics and glyphosate. The
antibiotics kill any remaining Agrobacterium. The selection medium
is stimulatory to maize somatic embryogenesis and selective for
those cells that contain an integrated gat gene. Therefore, callus
that survives glyphosate to proliferate and produce embryogenic
tissue is presumably genetically transformed. Callus samples were
taken for molecular analysis to verify the presence of the
transgene by PCR. The embryonic tissue is then manipulated to
regenerate transgenic plants in the presence of glyphosate that are
then transferred to the greenhouse. T0 plants are sprayed with
glyphosate at different concentrations. Positive plants are sampled
for molecular analysis for transgene copy number and crossed with
inbred lines to obtain seeds from the initially transformed
plants.
[0394] A glyphosate kill curve was established by testing
non-transformed embryos response on media with different levels of
glyphosate. GS3 embryos were isolated from an immature ear and
placed onto media containing glyphosate at 0.0, 0.5, 1.0, and 2.0
mM. After about 40 days culture, the response of the embryos were
observed and recorded. Similarly, infected GS3 embryos with the GAT
construct were placed onto media containing glyphosate at 0.0, 0.5,
1.0, and 2.0 mM. After about 40 days culture, the response of the
infected embryos were observed and recorded (FIG. 7).
[0395] A side-by-side experiment was conducted to compare the
transformation efficiencies of GAT, bar and mopat. Immature embryos
of GS3 line were aseptically removed from each ear and divided into
three portions. Each portion of the embryos was then infected with
A. tumefaciens strain LBA4404 containing the expression cassettes
of GAT, bar, or mopat respectively. After co-cultivation, the
embryos infected with GAT construct were selected on routine
glyphosate medium and the embryos infected with bar or mopat
constructs were selected on routine glufosinate medium. The
subcultures were done every 2 weeks. At about 50 days selection the
responses of the embryos were observed and recorded.
Results
[0396] From the glyphosate kill curve experiment, all embryos on
medium with 0.0 mM glyphosate initiated healthy callus, while about
half of the embryos on medium with 0.5 mM glyphosate showed callus
initiation. There was very little callus growth with embryos on
media containing 1.0 and 2.0 mm glyphosate. This indicated that 0.5
mM is not enough to inhibit all embryos growth, but 1 mM or 2 mM is
strong enough to kill the non-transformed embryos. In the infected
embryo experiment, more callus was grown on media with 0.0 and 0.5
mM glyphosate, but some embryos initiated resistant callus on media
with 1.0 mM or 2.0 mM glyphosate. Western or PCR analysis has
confirmed that these resistant calli were transformed. Currently,
GAT has performed consistently as an effective selectable marker
with excellent transformation efficiency in both GS3 and introEF09B
genotypes (FIG. 10 and Table 45).
TABLE-US-00027 TABLE 22 GAT transformation efficiency in introEF09B
txn % based on # selectable # infected # events events to genotype
construct marker embryos to GH GH EFWWBTX GATHRA GAT 1332 354 27%
EFWWCTX GATHRA GAT 136 47 35% EFWWETX GATHRA GAT 1109 158 14%
EFWWZTX GATHRA GAT 1790 502 28% 4367 1061 24%
In the side-by-side experiment to compare GAT, bar and mopat, GAT
gave the best transformation efficiency at about 64%, bar at 34%,
and mopat at 30%. Calli with GAT selection seem to grow faster that
those selected on glufosinate (FIG. 8).
Example 11
Interaction Between Glyphosate, Metsulfuron-Methyl and Two
Additives on the Control of Ryegrass
[0397] The example was conducted on non-glyphosate resistant
ryegrass. As provided in Table 23, all treatments that included
glyphosate [180 g a.i. L ha.sup.-1 (0.5 L glyphosate (SCAT.RTM.))]
plus metsulfuron-methyl (BRUSH-OFF.RTM.) (5 and 10 g ha.sup.-1)
gave 100% control of the ryegrass. Metsulfuron-methyl
(BRUSH-OFF.RTM.) on its own did nothing accept stunt the ryegrass
plants slightly. Although 15 of the 16 plants (12%) in the 0.5 L
ha.sup.-1 glyphosate (SCAT.RTM.) treatment eventually died, they
took much longer to die. These results indicate that there was
possible synergism between glyphosate (SCAT.RTM.) and
metsulfuron-methyl (BRUSH-OFF.RTM.). The two additives, e.g.,
ADD-UP and VELOCITY, made no difference in the degree of control
with any of the treatments.
TABLE-US-00028 TABLE 23 Interaction Between Glyphosate,
metsulfuron-methyl and Two Additives on the Control of Ryegrass
Control Trial Treatment/ha.sup.-1 (%) 1 glyphosate (SCAT .RTM.) 0.5
L 94 2 Metsulfuron-methyl (BRUSH-OFF .RTM.) 5 g 0 3
Metsulfuron-methyl (BRUSH-OFF .RTM.) 10 g 0 4 glyphosate (SCAT
.RTM.) 0.5 L + metsulfuron-methyl (BRUSH-OFF .RTM.) 5 g 100 5
glyphosate (SCAT .RTM.) 0.5 L + metsulfuron-methyl (BRUSH-OFF
.RTM.) 100 10 g 6 glyphosate (SCAT .RTM.) 0.5 L +
metsulfuron-methyl (BRUSH-OFF .RTM.) 5 g 100 + ammonium
sulfate-based adjuvant (ADD-UP .RTM.) 1% 7 glyphosate (SCAT .RTM.)
0.5 L + metsulfuron-methyl (BRUSH-OFF .RTM.) 100 10 g + ammonium
sulfate-based adjuvant (ADD-UP .RTM.) 1% 8 glyphosate (SCAT .RTM.)
0.5 L + metsulfuron-methyl (BRUSH-OFF .RTM.) 5 g 100 +
bispyribac-sodium (VELOCITY .RTM.) 1% 9 glyphosate (SCAT .RTM.) 0.5
L + metsulfuron-methyl (BRUSH-OFF .RTM.) 100 10 g +
bispyribac-sodium (VELOCITY .RTM.) 1% 10 Control 0
[0398] Biotype: non-glyphosate resistant ryegrass (70-04) [0399]
Population profile: Rup 0.25 control (%) 6.25 Rup 0.5 control (%)
81.25 Rup 1.0 control (%) 93.75 [0400] Growth Stage: 5-6 leaf stage
[0401] Conditions: hot and sunny [0402] Volume rate: 200 L
ha.sup.-1
Example 12
Interaction Between Glyphosate, Metsulfuron-Methyl and Two
Additives on the Control of Hairy Fleabane (Conyza bonariensis)
[0403] This example included the same treatments as used in Example
11, except the treatments were carried out on a glyphosate
sensitive biotype of Kleinskraalhans (Conyza bonariensis).
Glyphosate on its own gave poor control, killing only 1 out of 16
plants (12%). In this example, however, ammonium sulfate-based
adjuvant (ADD-UP.RTM.) performed better than bispyribac-sodium
(VELOCITY.RTM.) with the mixture.
TABLE-US-00029 TABLE 24 Interaction Between Glyphosate,
metsulfuron-methyl and Two Additives on the Control of Hairy
Fleabane (Conyza bonariensis) Trial Treatment/ha.sup.-1 Control (%)
1 glyphosate (ROUNDUP .RTM.) 0.5 L 12 2 Metsulfuron-methyl
(BRUSH-OFF .RTM.) 5 g 100 3 Metsulfuron-methyl (BRUSH-OFF .RTM.) 10
g 100 4 glyphosate (ROUNDUP .RTM.) 0.5 L + 100 metsulfuron-methyl
(BRUSH-OFF .RTM.) 5 g 5 glyphosate (ROUNDUP .RTM.) 0.5 L + 100
metsulfuron-methyl (BRUSH-OFF .RTM.) 10 g 6 glyphosate (ROUNDUP
.RTM.) 0.5 L + metsulfuron-methyl (BRUSH- 100 OFF .RTM.) 5 g +
ammonium sulfate-based adjuvant (ADD-UP .RTM.) 1% 7 glyphosate
(ROUNDUP .RTM.) 0.5 L + metsulfuron-methyl (BRUSH- 100 OFF .RTM.)
10 g + ammonium sulfate-based adjuvant (ADD-UP .RTM.) 1% 8
glyphosate (ROUNDUP .RTM.) 0.5 L + metsulfuron-methyl (BRUSH- 75
OFF .RTM.) 5 g + bispyribac-sodium (VELOCITY .RTM.) 1% 9 glyphosate
(ROUNDUP .RTM.) 0.5 L + metsulfuron-methyl (BRUSH- 100 OFF .RTM.)
10 g + bispyribac-sodium (VELOCITY .RTM.) 1% 10 Control 0
[0404] Biotype: Non-glyphosate resistant Conyza
(Welgevallen-paraquat resistant) [0405] Growth Stage: 10-15 leaf
stage [0406] Conditions: Cool and sunny [0407] Volume rate: 200 L
ha.sup.-1 [0408] glyphosate (ROUNDUP): 360 g a.i. L.sup.-1
Example 13
Interaction Between Glyphosate, Metsulfuron-Methyl and Two
Additives on the Control of Glyphosate, Paraquat, and
ACCase-Inhibitor Resistant Ryegrass
[0409] This example was conducted on one of the most resistant
ryegrass types in the world, ryegrass resistant to non-selective
herbicides, e.g., Fairview (Tulbagh), which is resistant to
glyphosate, paraquat, and ACCase-inhibitors. In this example, the
addition of metsulfuron-methyl (BRUSH-OFF.RTM.) at 5 and 10 g
ha.sup.-1, with 1% ammonium sulfate-based adjuvant (ADD-UP.RTM.) to
0.5 L Roundup improved control by 44% (e.g., 50% to 94%). Further,
ammonium sulfate-based adjuvant (ADD-UP.RTM.) was superior to
bispyribac-sodium (VELOCITY.RTM.) as an additive.
TABLE-US-00030 TABLE 25 Interaction Between Glyphosate,
metsulfuron-methyl and Two Additives on the Control of Glyphosate,
Paraquat, and ACCase-Inhibitor Resistant Ryegrass Trial
Treatment/ha.sup.-1 Control (%) 1 glyphosate (ROUNDUP .RTM.) 0.5 L
50 2 glyphosate (ROUNDUP .RTM.) 0.5 L + 69 metsulfuron-methyl
(BRUSH-OFF .RTM.) 5 g 3 glyphosate (ROUNDUP .RTM.) 0.5 L + 88
metsulfuron-methyl (BRUSH-OFF .RTM.) 10 g 4 glyphosate (ROUNDUP
.RTM.) 0.5 L + metsulfuron-methyl 94 (BRUSH-OFF .RTM.) 5 g +
ammonium sulfate-based adjuvant (ADD- UP .RTM.) 1% 5 glyphosate
(ROUNDUP .RTM.) 0.5 L + metsulfuron-methyl 94 (BRUSH-OFF .RTM.) 10
g + ammonium sulfate-based adjuvant (ADD-UP .RTM.) 1% 6 glyphosate
(ROUNDUP .RTM.) 0.5 L + metsulfuron-methyl 69 (BRUSH-OFF .RTM.) 5 g
+ bispyribac-sodium (VELOCITY .RTM.) 1% 7 glyphosate (ROUNDUP
.RTM.) 0.5 L + metsulfuron-methyl 75 (BRUSH-OFF .RTM.) 10 g +
bispyribac-sodium (VELOCITY .RTM.) 1%
[0410] Biotype: Fairview (Tulbagh) resistant to glyphosate,
paraquat, and ACCase-inhibitors. [0411] Growth Stage: 10-15 leaf
stage [0412] Conditions: Cool and sunny [0413] 15 Volume rate: 200
L ha.sup.-1 [0414] glyphosate (ROUNDUP): 360 g ai L.sup.-1
Example 14
Interaction Between Glyphosate and Representative SU's on the
Control of Glyphosate, Paraquat, and ACCase-Inhibitor Resistant
Ryegrass
[0415] In this example, four different SU's were applied together
with glyphosate (SCAT.RTM.) on the resistant ryegrass. The results
as to the best SU partner for glyphosate were inconclusive, but the
average benefit of applying an SU with glyphosate on herbicide
resistant ryegrass was 39% (e.g., 34% control with glyphosate
(SCAT.RTM.) only and 57-83% control with glyphosate (SCAT.RTM.)
plus metsulfuron-methyl (BRUSH-OFF.RTM.), chlorsulfuron
(GLEAN.RTM.), or triasulfuron (LOGRAN.RTM.)).
TABLE-US-00031 TABLE 26 Interaction Between Glyphosate and
Representative SU's on the Control of Glyphosate, Paraquat, and
ACCase-Inhibitor Resistant Ryegrass Control Trial
Treatment/ha.sup.-1 (%) 1 Control 0 2 glyphosate (SCAT .RTM.) 6 L
34 3 glyphosate (SCAT .RTM.) 6 L + metsulfuron-methyl 67 (BRUSH-OFF
.RTM.) 10 g 4 glyphosate (SCAT .RTM.) 6 L + chlorsulfuron 75 (GLEAN
.RTM.) 15 g 5 glyphosate (SCAT .RTM.) 6 L + triasulfuron 83 (LOGRAN
.RTM.) 71/2 g 6 glyphosate (SCAT .RTM.) 6 L + triasulfuron 67
(LOGRAN .RTM.) 15 g
[0416] Biotype: Fairview (Tulbagh) resistant to glyphosate,
paraquat, and ACCase-inhibitors. [0417] Growth Stage: 4 leaf stage
[0418] Conditions: Cool and sunny [0419] Volume rate: 200 L
ha.sup.-1 [0420] All treatments sprayed with 1% ADD-UP
Example 15
GAT has No Yield Impact on Soybean Isolines
[0421] Isolines from twelve selected SCP:GAT7::SAMS:ALS events were
yield tested in 3 Iowa environments in 2004 and 6 midwest
environments in 2005. When yield data for these environments is
combined together, there is no significant yield difference between
GAT7 positive lines and GAT7 negative lines across the construct,
and within a specific event. For the three lead events (EAFS
3559.2.1, EAFS 3560.4.3, EAFS 3561.1.1), there were no statistical
yield differences detected when GAT7 positive lines were compared
to GAT7 negative sister lines. Overall, the data for the lines
tested indicate that presence of the GAT7 transgene does not appear
to impact final yield.
Materials and Methods
[0422] 2004 D test Materials and Methods:
[0423] The variety Jack was transformed with the constituative
promoter (SCP1) driving expression of glyphosate acetyl transferase
round 7 (GAT7), linked to the selectable marker insert SAMS:ALS.
Forty initial events of SCP:GAT7::SAMS:ALS were advanced to the T2
generation. Zygosity of the advanced T2 lines was initially
determined by screening 12 random plants per line for PCR
amplification of the GAT insert. 454 lines were tentatively
selected to be either homozygous positive or homozygous negative
for GAT. Selected lines were blocked by event and grown in D level
yield tests (1 replication of two 10 foot rows) at Cedar Falls
(planted Jun. 5, 2004), Dallas Center (planted Jun. 4, 2004), and
Johnston, Iowa (planted Jun. 9, 2004) during 2004. Twelve remnant
T3 seed of each line was screened using either glyphosate spray at
the V3 growth stage, or soaking remnant seed in sulfonylurea
solution. Based upon the glyphosate treatment or SU seed soak, 342
SCP:GAT7::ALS lines from 30 events were confirmed to be homozygous
positive or homozygous negative. Maturity scores were collected for
all entries at the Dallas Center and Johnston locations. Yield data
was collected and subject to multiple regression, ANOVA, and mean
separation using SAS.
2005 C test Materials and Methods
[0424] Based upon yield performance and herbicide efficacy scores
in 2004, 12 GAT7 events were advanced for C level yield testing in
2005. From these selected twelve events, 28 positive and 23
negative isolines were selected. 2005 C tests were designed as a
randomized complete block (by event) and grown at Cedar Falls,
Iowa; Johnston, Iowa; Stuart, Iowa; Monmouth, Ill.; Princeton,
Ill.; and Napoleon, Ohio. Maturity scores and yield data were
collected and subject to multiple regression, ANOVA and mean
separation using PRISM and/or SAS.
Results and Discussion
[0425] When 2004 yield data for the selected lines tested was
subject to ANOVA, the location, events, location*event, and GAT
(positive or negative) variables were significantly different (data
not shown). A mean of all positive lines was not significantly
lower for yield compared to a mean of all negative lines tested in
2004. In 2005, the location, event, location*event, GAT, and
GAT*location variables were significantly different (data not
shown). A mean of all positive lines tested was not significantly
different from a mean of all negative lines tested in 2005 (data
not shown). When the 2004 and 2005 data are combined, the year,
location, event, year*event, location*event, year*GAT, and
location*GAT variables are significantly different (data not
shown). A mean of all GAT positive lines was not significantly
different from a mean of all GAT negative lines tested across the 9
midwest environments (data not shown).
[0426] Based upon 2004 yield, herbicide efficacy, and molecular
analyses, 3 lead GAT7 events were selected for potential regulatory
and product development experiments. When the 2005 isoline yield
data is combined with 2004 data, the locations were significantly
different within EAFS 3559.2.1 (data not shown). Positive GAT lines
within EAFS 3559.2.1 were not significantly different for yield
compared to negative sister isolines (data not shown). Within EAFS
3560.4.3, the 9 locations and location*GAT interaction were
significantly different. However, GAT positive isolines were not
significantly different for yield when compared to GAT negative
isolines within the same event (data not shown). Within event EAFS
3561.1.1, the locations were significantly different, while the GAT
score and location*GAT interaction were not significantly different
(data not shown). Within EAFS 3561.1.1, GAT positive lines were not
significantly different for yield compared to GAT negative sister
lines (data not shown).
[0427] Multiple regression of yield.times.maturity for the 6
environments tested in 2005 was performed on the 3 lead events to
determine overall yield potential. In general, GAT positive and GAT
negative lines within each of the 3 lead events appear to be random
(data not shown). This suggests that yield does not appear to be
significantly altered when the GAT7 transgene is present.
[0428] A modified t-test was completed to compare the GAT7 positive
lines to a mean of the GAT7 negative lines within each specific
event at each location tested (data not shown). Across the 9
locations tested, there is no apparent yield disadvantage for GAT7
positive lines compared to GAT7 negative sister lines within the
same event. For the 3 lead events, GAT positive lines are within
2.6% of the negative mean, indicating overall yield parity exists
in all environments tested (data not shown). ANOVA and LSD analyses
performed on the individual lines indicate no distinct differences
among lines tested in each event, except for EAFS 3560.3.2 (data
not shown). Overall, there does not appear to be a yield difference
between GAT7 positive lines and GAT7 negative lines.
Example 16
GAT Soybeans have Tolerance to Glyphosate, and Glyphosate+SU
Treatments
[0429] The objectives of this experiment was to evaluate the
sulfonylurea (SU) herbicide tolerance of the lead GAT7 events in
direct comparison to the tolerance of STS, and to determine if
differences in tolerance could be detected among the lead GAT7
events across different glyphosate (Gly), Gly+SU and SU treatments.
Across all the treatments, the four lead GAT7 events were rated
with significantly less crop damage response compared to
untransformed Jack and STS at 7 days after spraying, and again at
14 days after spraying. Among the 4 lead GAT7 events, there were
some response differences detected, with EAFS 3560.4.3 performing
the best over all the treatments, and EAFS 3560.3.2 showing the
most herbicide response. In general, it appears there is a
significantly better tolerance to several SU chemistries for the
SAMS:ALS construct compared to STS. In addition, the GAT7 events
tested had good tolerance to variable rates of glyphosate,
sulfonylurea, and glyphosate plus sulfonylurea chemistry
treatments.
Materials and Methods
[0430] GAT round 7 (GAT7) transgenic events from construct
PHP20163A were evaluated in 2004 for herbicide efficacy
(JHM464TGATEFF) and yield potential (JHD4______GAT7 tests). Based
upon these preliminary results and commercialization potential,
four lead events were selected for additional efficacy testing in
2005 experiment JHM5G030. 92M90 was selected as a STS variety to
compare directly with the SAMS:ALS construct in the GAT7 events.
Variety Jack was utilized as an untransformed negative control.
[0431] Selected lines were grown in experiment JHM5G030 in two
replications of paired twelve foot rows, with eleven different
treatments applied. Lines were blocked by event and treatment to
provide side-by-side comparison of the eleven different spray
treatments, with a 2 row border between each treatment to catch any
spray drift. Spray treatments (at V3 unless specified) were OX
(control), 35.03 g/ha ai Synchrony, 140.11 g/ha ai Synchrony, 8.75
g/ha ai tribenuron, 35.0 g/ha ai tribenuron, 8.75 g/ha ai
rimsulfuron, 35.0 g/ha ai rimsulfuron, 3360.0 g/ha ai glyphosate,
3360.0 g/ha ai glyphosate at V3 followed by 3360.0 g/ha ai
glyphosate at R1, 3360.0 g/ha ai glyphosate plus 35.0 g/ha ai
tribenuron (tank mix) and 3360.0 g/ha ai glyphosate plus 70.0 g/ha
ai rimsulfuron (tank mix). Lines were given a 100 (complete
susceptibility, 100% damage) to 0 (complete tolerance, 0% damage)
visual rating at 7 days after treatment and again at 14 days after
treatment. Visual ratings were based upon overall degree of
chlorosis, necrosis, and plant stunting (if evident) in the treated
rows compared to the respective unsprayed control rows. Rating data
at 7 and 14 days after spraying were subject to ANOVA and mean
separation using SAS.
Results and Discussion
[0432] When all spray rating data for the different treatments at 7
and 14 days after application were subject to ANOVA, the events and
treatments were significantly different, while the replication was
not significantly different (data not shown). Jack had
significantly higher spray response (damage scores) compared to STS
and the GAT events at 7 and 14 days after spraying (DAS) (data not
shown). The 4 GAT lines were scored with significantly less damage
than Jack and STS for all the treatments at both 7 and 14 days
after spray application (data not shown).
[0433] In examining individual treatments, the control plot
appeared to have some spray drift evident, as both the Jack plot
and STS plot were rated with significantly higher spray damage
scores compared to the 4 GAT events at 7 DAS (data not shown) and
14 DAS (data not shown). Spray drift would potentially confound the
results of the other plots, but was hopefully somewhat minimized by
the use of a 2 row border between treatments.
[0434] Within the 8.75 g/ha ai rimsulfuron treatment, the 4 GAT
events were scored with significantly less spray damage compared to
Jack and STS at both 7 DAS (data not shown) and 14 DAS (data not
shown). Among the 4 GAT events, there was no statistical difference
noted at both rating times (data not shown). Examining the 35.0
g/ha ai rimsulfuron treatment, the 4 GAT events were scored with
significantly less spray damage compared to Jack and STS at both 7
DAS (data not shown) and 14 DAS (data not shown). GAT7 Event EAFS
3560.4.3 was scored with less damage compared to GAT7 events EAFS
3559.2.1 and EAFS 3561.1.1 at both 7 DAS (data not shown) and 14
DAS (v).
[0435] After the 35.03 g/ha ai Synchrony treatment, the 4 GAT
events were scored with significantly less spray damage compared to
Jack and STS at both 7 DAS (data not shown) and 14 DAS (data not
shown). Among the 4 GAT events, there was no statistical difference
noted at both 7 DAS (data not shown) and 14 DAS (data not shown).
In examining the 140.11 g/ha ai Synchrony treatment, the 4 GAT
events were scored with significantly less spray damage compared to
Jack and STS at both 7 DAS (data not shown) and 14 DAS (data not
shown). GAT7 events EAFS 3560.4.3 and EAFS 3561.1.1 were scored
with less damage compared to GAT7 events EAFS 3559.2.1 and EAFS
3560.3.2 at 7 DAS (data not shown). At 14 DAS the 140.11 g/ha ai
Synchrony treatment, GAT7 events EAFS 3560.4.2, EAFS 3559.2.1, and
EAFS 3561.1.1 were rated with no damage, while EAFS 3560.3.2 was
scored similar to STS (data not shown).
[0436] In examining the 8.75 g/ha ai tribenuron treatment, the 4
GAT7 events had significantly less visual damage compared to STS
and Jack at 7 DAS (data not shown) and 14 DAS (data not shown). The
GAT7 events were not statistically different at 7 DAS (data not
shown), but Evens EAFS 3560.4.3 and EAFS 3559.2.1 had significantly
lower damage compared to EAFS 3560.3.2 at 14 DAS (data not shown).
For the 35.0 g/ha ai tribenuron treatment, the 4 GAT7 events were
rated with significantly less spray response compared to Jack and
STS at 7 DAS (data not shown) and 14 DAS (data not shown). The 4
GAT events were not statistically different from each other at 7
DAS (data not shown), but the EAFS 3560.3.2 was rated with
significantly more spray damage than the other 3 GAT7 events at 14
DAS (data not shown).
[0437] For the 3360.0 g/ha ai glyphosate and 3360.0 g/ha ai
glyphosate at V3 followed by 3360.0 g/ha ai glyphosate at R1
treatments, the Jack and STS varieties were destroyed after 7 days,
as expected (data not shown). The 4 GAT7 events did not have any
observed spray damage for the 3360.0 g/ha ai glyphosate treatment
at 7 DAS (data not shown) and 14 DAS (data not shown). Minimal
spray damage was recorded for the 4 GAT7 events at 7 DAS for the
treatment (data not shown), and events EAFS 3560.4.3 and EAFS
3559.2.1 were rated significantly better than EAFS 3560.3.2 at 14
DAS (data not shown).
[0438] Two tank-mix treatments of glyphosate plus a sulfonylurea
herbicide provided similar results at 7 DAS and 14 DAS. For the
3360.0 g/ha ai glyphosate plus 70.0 g/ha ai rimsulfuron treatment,
the 4 GAT events had a similar herbicide response at 7 DAS of about
40% damage (data not shown), and approximately 35% damage at 14 DAS
(data not shown). Less of an overall crop response was observed for
the 3360.0 g/ha ai glyphosate plus 35.0 g/ha ai tribenuron
treatment, and the 4 GAT events were not statistically different at
7 DAS (data not shown), and 14 DAS (data not shown).
[0439] The mean of visual ratings at 7 DAS and 14 DAS were graphed
for the four lead GAT events, Jack, and the STS line to allow
visual interpretation of the data (data not shown). For the
Rimsulfuron treatments, there was a crop response observed with the
4 lead GAT events, with EAFS 3560.4.3 having the most tolerance
noted (data not shown). The response of the GAT7 events was
significantly less than the STS and Jack controls for both
Rimsulfuron treatments at 7 DAS and 14 DAS (data not shown).
[0440] In examining the mean response scores to the 1.times. and
140.11 g/ha ai Synchrony treatments, there was no apparent damage
for GAT7 events EAFS 3560.4.3 and EAFS 3561.1.1, and minimal
response of GAT 7 events EAFS 3559.2.1 and EAFS 3560.3.2 (data not
shown). All GAT events had significantly less crop response
compared to Jack and the STS line (data not shown).
[0441] The four GAT7 events had significantly less crop response to
1.times. and 35.0 g/ha ai tribenuron applications at 7 DAS and 14
DAS when compared to Jack and STS (data not shown). Among the GAT7
events, EAFS 3560.4.3 performed the best, while EAFS 3560.3.2
appeared to show the most response overall (data not shown).
[0442] For the 3360.0 g/ha ai glyphosate application, there was no
apparent crop response for all 4 GAT7 events at 7 DAS and 14 DAS
(data not shown). For the 3360.0 g/ha ai glyphosate at V3 followed
by 3360.0 g/ha ai glyphosate at R1, there were no statistical
differences noted among the four GAT7 events at 7 DAS, but EAFS
3560.4.3 and EAFS 3559.2.1 appeared to have less response compared
to EAFS 3561.1.1 and EAFS 3560.3.2 at 14 DAS (data not shown).
[0443] Of the two tank mix treatments, the 70.0 g/ha ai rimsulfuron
plus 3360.0 g/ha ai glyphosate caused a higher level of crop damage
response compared to the 35.0 g/ha ai tribenuron plus 3360.0 g/ha
ai glyphosate treatment (data not shown). Among the four lead GAT7
events, there were no statistical differences observed for the
visual ratings at 7 DAS and 14 DAS (data not shown).
[0444] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0445] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the appended
claims.
Sequence CWU 1
1
891534DNACauliflower mosaic virusenhancer(0)...(0)enhancer element
of 35S promoter 1ccctgtcctc tccaaatgaa atgaacttcc ttatatagag
gaagggtctt gcgaagctta 60gtgggattgt gcgtcatccc ttacgtcagt ggagatatca
catcaatcca cttgctttga 120agacgtggtt ggaacgtctt ctttttccac
gatgctcctc gtgggtgggg gtccatcttt 180gggaccactg tcggcagagg
catcttcaac gatggccttt cctttatcgc aatgatggca 240tttgtaggag
ccaccttcct tttccactat cttcacaata aagtgacaga tagctgggca
300atggaatccg aggaggtttc cggatattac cctttgttga aaagtctcaa
ttgccctttg 360gtcttctgag actgtatctt tgatattttt ggagtagaca
agcgtgtcgt gctccaccat 420gttgacgaag attttcttct tgtcattgag
tcgtaagaga ctctgtatga actgttcgcc 480agtctttacg gcgagttctg
ttaggtcctc tatttgaatc tttgactcca tggg 53427565DNACauliflower mosaic
viruspromoter(0)...(0)S35 promoter PHP24279 from left boarder to
right boarder 2tttacccgcc aatatatcct gtcaaacact gatagtttaa
actgaaggcg ggaaacgaca 60atctgatcat gagcggagaa ttaagggagt cacgttatga
cccccgccga tgacgcggga 120caagccgttt tacgtttgga actgacagaa
ccgcaacgtt gaaggagcca ctcagcaagc 180tgggcccccc ctcgaggtcg
gccgcattcg caaaacacac ctagactaga tttgttttgc 240taacccaatt
gatattaatt atatatgatt aatatttata tgtatatgga tttggttaat
300gaaatgcatc tggttcatca aagaattata aagacacgtg acattcattt
aggataagaa 360atatggatga tctctttctc ttttattcag ataactagta
attacacata acacacaact 420ttgatgccca cattatagtg attagcatgt
cactatgtgt gcatcctttt atttcataca 480ttaattaagt tggccaatcc
agaagatgga caagtctagg ttaactgact agctagtcag 540tacacagtcc
tgccatcacc atccaggatc atatccttga aagccccacc actagggatc
600ataggcaaca catgctcctg gtgtgggacg attatatcca agaggtacgg
ccctggagtc 660tcgagcatct tctttatcgc tgcgcggact tcgttcttct
ttgtcacacg gaccgctgga 720atgttgaacc ctttggcgat cgtcacgaaa
tctggatata tctcactttc attctctggg 780tttcccaagt atgtgtgcgc
tctgttggcc ttatagaacc tgtcctccaa ctgcaccacc 840atccccaggt
gctggttgtt tagcacaaag accttcactg ggaggttctc aattcggatc
900atagctagct cctgaacgtt catgagaaag ctaccatctc catcgatgtc
aacaacagtg 960acacctgggt ttgccacaga agcaccagca gcagccggca
aaccaaatcc catagcccca 1020agaccagctg aagacaacca ctgccttggc
cgcttgtaag tgtagtactg tgccgcccac 1080atctggtgct gcccaacacc
tgtgccgatg atggcctcgc ctttcgtcag ctcatcaaga 1140acctgaatag
catattgtgg ctggatctcc tcattagatg ttttataccc aagggggaat
1200tccctcttct gctgatccaa ctcatcgttc catgagccaa agtcaaagct
cttctttgat 1260gtgcttcctt caagaagagc attcatgccc tgcaaagcaa
gcttaacatc tgcacagatg 1320gacacatgtg gctgcttgtt cttgccaatc
tcagccggat caatatcaac gtgcacaatc 1380ttagccctgc ttgcaaaagc
ctcaatcttc cctgtcacgc gatcatcaaa ccgcacacca 1440agtgcaagca
acagatcggc cttatccact gcataatttg catacaccgt cccatgcata
1500cctagcatgc gcagagacag tgggtcgtcg ctggggaagt tgccgaggcc
cataagagta 1560gttgtgaccg ggattccagt cagctccaca aagcgtcgca
actcctcacc agatgctgcg 1620cagccaccgc ccacataaag aacagggcgc
cgcgattcac caacaagacg cagcacctgc 1680tcaagcaact cagtcgcagg
gggcttggga aggcgcgcaa tgtacccagg cagactcatg 1740ggcttgtccc
agacaggcac cgccatctgc tgctggatgt ccttggggat gtcgacaagc
1800accggccctg gtcgaccaga ggaggcgagg aagaaagcct cctgcacgac
gcgggggatg 1860tcgtcgacgt cgaggaccag gtagttgtgc ttggtgatgg
agcgggtgac ctcgacgatg 1920ggcgtctcct ggaaggcgtc ggtgccaatc
atgcgtcgcg ccacctgtcc cgtgatggcg 1980accatgggga cggaatcgag
cagcgcgtcg gcgagcgcgg agactaggtt ggtggcgccg 2040gggccggagg
tggcgatgca gacgccgacg cggcccgagg agcgcgcgta gccggaggcg
2100gcaaaggcct ccccttgctc gtggcggaag aggtggttgg cgatgacggg
ggagcgggtg 2160agtgcctggt ggatctccat ggacgcgccg ccggggtagg
cgaagacgtc gcggacgccg 2220cagcgctcga gggactcgac gaggatgtca
gcacccttgc ggggctcggt ggggccccac 2280ggccggagcg gggtggccgg
gggagccatc ggcatggcgg gtgacgccgc tgagcacctg 2340atgggcgcgg
cgagggcgcg gcgggtggcc aggaggtgcg cccggcgcct cgccttgggc
2400gcagcggtag tggcgccagt gagcgcggta gacgcggcgg cggcggtggc
catggttgcg 2460gcggctgtct cggaggcggc gcgagggttt ggggtgggtg
ccacggacac ggagtgggag 2520aaagggggat gtgcgtggag gcctccctgc
ttttgttcag aggatgtgtg gctcagatgg 2580tgatgggaat gggactcgca
agacgacgac gacacgtccg tcgcccgaat acgtacacgc 2640tacagaccgg
acggtggggc ctgtcgacgt gggaccgacg tgtcggcctg gattacaaac
2700gtggtgtcca ccgagtgctg gtacacgaca gcgtgcgtca aggaggtttt
gaactgttcc 2760gttaaaaaaa gaggggagat tttggacttg actgtggacg
acggtgcatg tcatcggagt 2820acagacggta ctgacacaag gggcccagac
aagggaatcc aaacgggtcg cacccacctg 2880ccaggctgcc acccgcaatc
cgcaacaggg aaaccgggca cagcccacaa ccacaagatg 2940agcagctgcg
gcgacagcgt caggcccggt gtcggtgtta gggatggcac cctttggctc
3000cccgtatccg tccccgcgac aaaaaaattt cccgcgggga ttcccacgaa
ctcttgcgag 3060agacatttct tccccatccc cgttccccac ggggataaat
ccccatcggg gatcctctag 3120agtcgacctg caggcatgca agcttcggtc
cgcggccagc ttgctaaccc gggccccccc 3180tcgaggtcat cacatcaatc
cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc 3240acgatgctcc
tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttca
3300acgatggcct ttcctttatc gcaatgatgg catttgtagg agccaccttc
cttttccact 3360atcttcacaa taaagtgaca gatagctggg caatggaatc
cgaggaggtt tccggatatt 3420accctttgtt gaaaagtctc aattgccctt
tggtcttctg agactgtatc tttgatattt 3480ttggagtaga caagcgtgtc
gtgctccacc atgttgacga agattttctt cttgtcattg 3540agtcgtaaga
gactctgtat gaactgttcg ccagtcttta cggcgagttc tgttaggtcc
3600tctatttgaa tctttgactc catggacggt atcgataagc tagcttgata
tcacatcaat 3660ccacttgctt tgaagacgtg gttggaacgt cttctttttc
cacgatgctc ctcgtgggtg 3720ggggtccatc tttgggacca ctgtcggcag
aggcatcttc aacgatggcc tttcctttat 3780cgcaatgatg gcatttgtag
gagccacctt ccttttccac tatcttcaca ataaagtgac 3840agatagctgg
gcaatggaat ccgaggaggt ttccggatat taccctttgt tgaaaagtct
3900caattgccct ttggtcttct gagactgtat ctttgatatt tttggagtag
acaagcgtgt 3960cgtgctccac catgttgacg aagattttct tcttgtcatt
gagtcgtaag agactctgta 4020tgaactgttc gccagtcttt acggcgagtt
ctgttaggtc ctctatttga atctttgact 4080ccatgatcga attatcacat
caatccactt gctttgaaga cgtggttgga acgtcttctt 4140tttccacgat
gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat
4200cttcaacgat ggcctttcct ttatcgcaat gatggcattt gtaggagcca
ccttcctttt 4260ccactatctt cacaataaag tgacagatag ctgggcaatg
gaatccgagg aggtttccgg 4320atattaccct ttgttgaaaa gtctcaattg
ccctttggtc ttctgagact gtatctttga 4380tatttttgga gtagacaagc
gtgtcgtgct ccaccatgtt gacgaagatt ttcttcttgt 4440cattgagtcg
taagagactc tgtatgaact gttcgccagt ctttacggcg agttctgtta
4500ggtcctctat ttgaatcttt gactccatgg gaattcctgc agcccgggat
ctaggagctt 4560gcatgcctgc agtgcagcgt gacccggtcg tgcccctctc
tagagataat gagcattgca 4620tgtctaagtt ataaaaaatt accacatatt
ttttttgtca cacttgtttg aagtgcagtt 4680tatctatctt tatacatata
tttaaacttt actctacgaa taatataatc tatagtacta 4740caataatatc
agtgttttag agaatcatat aaatgaacag ttagacatgg tctaaaggac
4800aattgagtat tttgacaaca ggactctaca gttttatctt tttagtgtgc
atgtgttctc 4860cttttttttt gcaaatagct tcacctatat aatacttcat
ccattttatt agtacatcca 4920tttagggttt agggttaatg gtttttatag
actaattttt ttagtacatc tattttattc 4980tattttagcc tctaaattaa
gaaaactaaa actctatttt agttttttta tttaataatt 5040tagatataaa
atagaataaa ataaagtgac taaaaattaa acaaataccc tttaagaaat
5100taaaaaaact aaggaaacat ttttcttgtt tcgagtagat aatgccagcc
tgttaaacgc 5160cgtcgacgag tctaacggac accaaccagc gaaccagcag
cgtcgcgtcg ggccaagcga 5220agcagacggc acggcatctc tgtcgctgcc
tctggacccc tctcgagagt tccgctccac 5280cgttggactt gctccgctgt
cggcatccag aaattgcgtg gcggagcggc agacgtgagc 5340cggcacggca
ggcggcctcc tcctcctctc acggcaccgg cagctacggg ggattccttt
5400cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat aaatagacac
cccctccaca 5460ccctctttcc ccaacctcgt gttgttcgga gcgcacacac
acacaaccag atctccccca 5520aatccacccg tcggcacctc cgcttcaagg
tacgccgctc gtcctccccc ccccccctct 5580ctaccttctc tagatcggcg
ttccggtcca tggttagggc ccggtagttc tacttctgtt 5640catgtttgtg
ttagatccgt gtttgtgtta gatccgtgct gctagcgttc gtacacggat
5700gcgacctgta cgtcagacac gttctgattg ctaacttgcc agtgtttctc
tttggggaat 5760cctgggatgg ctctagccgt tccgcagacg ggatcgattt
catgattttt tttgtttcgt 5820tgcatagggt ttggtttgcc cttttccttt
atttcaatat atgccgtgca cttgtttgtc 5880gggtcatctt ttcatgcttt
tttttgtctt ggttgtgatg atgtggtctg gttgggcggt 5940cgttctagat
cggagtagaa ttctgtttca aactacctgg tggatttatt aattttggat
6000ctgtatgtgt gtgccataca tattcatagt tacgaattga agatgatgga
tggaaatatc 6060gatctaggat aggtatacat gttgatgcgg gttttactga
tgcatataca gagatgcttt 6120ttgttcgctt ggttgtgatg atgtggtgtg
gttgggcggt cgttcattcg ttctagatcg 6180gagtagaata ctgtttcaaa
ctacctggtg tatttattaa ttttggaact gtatgtgtgt 6240gtcatacatc
ttcatagtta cgagtttaag atggatggaa atatcgatct aggataggta
6300tacatgttga tgtgggtttt actgatgcat atacatgatg gcatatgcag
catctattca 6360tatgctctaa ccttgagtac ctatctatta taataaacaa
gtatgtttta taattatttt 6420gatcttgata tacttggatg atggcatatg
cagcagctat atgtggattt ttttagccct 6480gccttcatac gctatttatt
tgcttggtac tgtttctttt gtcgatgctc accctgttgt 6540ttggtgttac
ttctgcaggt cgaccgccgg ggatccacac gacaccatgg ctattgaggt
6600taagcctatc aacgcagagg atacctatga ccttaggcat agagtgctca
gaccaaacca 6660gcctatcgaa gcctgcatgt ttgagtctga ccttactagg
agtgcatttc accttggtgg 6720attctacgga ggtaaactga tttccgtggc
ttcattccac caagctgagc actctgaact 6780tcaaggtaag aagcagtacc
agcttagagg tgtggctacc ttggaaggtt atagagagca 6840gaaggctggt
tccagtctcg tgaaacacgc tgaagagatt ctcagaaaga gaggtgctga
6900catgatctgg tgtaatgcca ggacatctgc ttcaggatac tacaggaagt
tgggattcag 6960tgagcaagga gaggtgttcg atactcctcc agttggacct
cacatcctga tgtataagag 7020gatcacataa ctagctagtc agttaaccta
gacttgtcca tcttctggat tggccaactt 7080aattaatgta tgaaataaaa
ggatgcacac atagtgacat gctaatcact ataatgtggg 7140catcaaagtt
gtgtgttatg tgtaattact agttatctga ataaaagaga aagagatcat
7200ccatatttct tatcctaaat gaatgtcacg tgtctttata attctttgat
gaaccagatg 7260catttcatta accaaatcca tatacatata aatattaatc
atatataatt aatatcaatt 7320gggttagcaa aacaaatcta gtctaggtgt
gttttgcgaa ttcagtacat taaaaacgtc 7380cgcaatgtgt tattaagttg
tctaagcgtc aatttgttta caccacaata tatcctgcca 7440ccagccagcc
aacagctccc cgaccggcag ctcggcacaa aatcaccact cgatacaggc
7500agcccatcag tccgggacgg cgtcagcggg agagccgttg taaggcggca
gactttgctc 7560atgtt 75653441DNAArtificial SequenceOptimized GAT
sequence-- D_S00341806_GAT20-8H12 3atg ata gag gta aaa ccg att aac
gca gag gat acc tat gaa cta agg 48Met Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15cat aga gtc ctc aga cca
aac cag ccg ata gaa gcg tgt atc ttt gaa 96His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Ile Phe Glu 20 25 30agc gat tta atg cgt
ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Met Arg
Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aga ctg att tcc
gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192Arg Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc cag
aaa cag tac cag ctt cga ggt atg gct acc ttg gaa ggt 240Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly 65 70 75 80tat
cgt gag cag aag gcg gga tcc agt cta gtt aaa cac gct gaa gaa 288Tyr
Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90
95att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca
336Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr
100 105 110tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag
gga gag 384Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln
Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg
atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu
Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*1454441DNAArtificial SequenceOptimized GAT sequence-- GAT4604SR
4atg ata gag gtg aaa ccg att aac gca gag gat acc tat gaa cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atc ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Ile Phe
Glu 20 25 30agc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aga ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tct gaa ctt 192Arg Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga ggt atg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac cta
ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aaa
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Lys
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *1455146PRTArtificial SequenceOptimized GAT sequence --
D_S00341806_GAT20- 8H12 5Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Glu Leu Arg 1 5 10 15His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Ile Phe Glu 20 25 30Ser Asp Leu Met Arg Gly Ala
Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Arg Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly65 70 75 80Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95Ile Leu
Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105
110Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140Ile Thr1456441DNAArtificial SequenceOptimized
GAT sequence-- D_S00398097_GAT22-18C5 6atg ata gag gta aaa ccg att
aac gca gag gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile
Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga
cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg
Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta acg
cgt ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr
Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att
tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192Lys Leu Ile
Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc
cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly
Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75
80tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa
288Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu
85 90 95att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg
aca 336Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg
Thr 100 105 110tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag
cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac atc
ctg atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*1457449DNAArtificial SequenceOptimized GAT sequence-- GAT4609SR
7atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta acg cgt ggt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tct gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc cag aaa cag tat cag ctt cga ggt gtg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg gga acc agt cta
gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gtg gac cta
ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Val Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105
110tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag
384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat
aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140atc aca taa ggcgcgcc 449Ile Thr
*1458146PRTArtificial SequenceOptimized GAT sequence --
D_S00398097_GAT22- 18C5 8Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser Asp Leu Thr Arg Gly Ala
Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75 80Tyr Arg Glu
Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu 85 90 95Ile Leu
Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105
110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140Ile Thr1459441DNAArtificial SequenceOptimized
GAT sequence-- D_S00397944_22-16D8 9atg ata gag gta aaa ccg att aac
gca gag gat acc tat gaa cta agg 48Met Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15cat aga gtc ctc aga cca
aac cag ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta ctg cgt
ggt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Leu Arg
Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc
gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192Lys Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc cag
aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat
cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288Tyr
Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu 85 90
95att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg cgg aca
336Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr
100 105 110tcc gcc tca ggc tac tac aga aag tta ggc ttt agc gag cag
gga gag 384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln
Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg
atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu
Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14510449DNAArtificial SequenceOptimized GAT sequence -- GAT4610R
10atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta ctg cgt ggt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
acg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Thr Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga ggt gtg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg gga acc agt cta
gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac atg
ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Met
Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga
aag tta ggc ttt agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
ggcgcgcc 449Ile Thr *14511146PRTArtificial SequenceOptimized GAT
sequence-- D_S00397944_22-16D8 11Met Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser Asp Leu Leu Arg
Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75 80Tyr
Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu 85 90
95Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr
100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln
Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu
Met Tyr Lys Arg 130 135 140Ile Thr14512441DNAArtificial
SequenceOptimized GAT sequence--D_S00397832_GAT22-15B4 12atg ata
gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg 48Met Ile
Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10
15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat
96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp
20 25 30agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc tac ggg
ggc 144Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly
Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac acg
gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr
Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc
ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr
Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta gtt
aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val
Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gtg gac cta ctt
tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly Val Asp Leu Leu
Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aaa aag
tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Lys Lys
Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg cca
gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro Pro
Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14513449DNAArtificial SequenceOptimized GAT sequence --
GAT4611R 13atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac
cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp
Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg
tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Asp 20 25 30agc gat tta atg cgt agt gca ttt cac tta ggc
ggc ttc tac ggg ggc 144Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly
Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag
gcc gag cac acg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln
Ala Glu His Thr Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga
ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg
Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt
tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly
Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg
gtg gac cta ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly
Val Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc
tac tac aaa aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly
Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc
gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa ggcgcgcc 449Ile Thr *14514146PRTArtificial
SequenceOptimized GAT sequence -- D_S00397832_GAT22- 15B4 14Met Ile
Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10
15His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp
20 25 30Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly
Gly 35 40 45Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr
Glu Leu 50 55 60Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr
Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val
Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Val Asp Leu Leu
Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Lys Lys
Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro
Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140Ile
Thr14515441DNAArtificial SequenceOptimized GAT sequence --
GAT24-5H5 15atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac
cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp
Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg
tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Asp 20 25 30aac gat tta atg cgt agt gca ttt cac tta ggc
ggc ttc cac ggg ggc 144Asn Asp Leu Met Arg Ser Ala Phe His Leu Gly
Gly Phe His Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag
gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln
Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag tat cag ctt cga
ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg
Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt
tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly
Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg
gcg gac atg ctt tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly
Ala Asp Met Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc
tac tac aga aag ttg ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly
Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc
gac acg ccg ccg gta gga cct cac atc ctg atg tat aaa agg 432Val Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa 441Ile Thr *14516441DNAArtificial SequenceOptimized
GAT sequence -- GAT4614SR 16atg ata gag gta aaa ccg att aac gca gaa
gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag
ccg ata gaa gcg tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Asp 20 25 30aac gat tta atg cgt agt gca
ttt cac tta ggc ggc ttc cac ggg ggc 144Asn Asp Leu Met Arg Ser Ala
Phe His Leu Gly Gly Phe His Gly Gly 35 40 45aaa ctg att tcc gtc gct
tca ttc cac cag gcc gag cac tct gaa ctt 192Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag
tat cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag
cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta
cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 336Ile Leu
Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr 100 105
110tcc gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag
384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125gta ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat
aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140atc aca taa 441Ile Thr *14517146PRTArtificial
SequenceOptimized GAT sequence -- 24-5H5 17Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Asn Asp Leu
Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln
Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14518441DNAArtificial
SequenceOptimized GAT sequence -- GAT4614VSR 18atg ata gag gtg aaa
ccg att aac gca gaa gat acc tat gac cta agg 48Met Ile Glu Val Lys
Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc
ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gat 96His Arg Val
Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30aac gat
tta atg cgt agt gca ttt cac tta ggc ggc ttc cac ggg ggc 144Asn Asp
Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly 35 40 45aaa
ctg att tcc gtc gct tca ttc cac cag gcc gag cac tct gaa ctt 192Lys
Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55
60caa ggc cag aaa cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt
240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly
65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct
gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala
Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac atg ctt tgg tgt aat
gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn
Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga aag ttg ggc ttc
agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe
Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg ccg gta gga cct
cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro
His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14519441DNAArtificial SequenceOptimized GAT sequence -- GAT23-2H11
19atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta
agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30ggc gat tta atg cgt ggt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Gly Asp Leu Met Arg Gly Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga ggt gtg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtt aaa cat gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgc aag agg ggg gcg gac cta
ctt tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14520441DNAArtificial SequenceOptimized GAT sequence --
GAT4615R 20atg ata gag gta aaa ccg att aac gca gag gat acc tat gac
cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp
Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg
tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Glu 20 25 30ggc gat tta atg cgt ggt gca ttt cac tta ggc
ggc ttc tac ggg ggc 144Gly Asp Leu Met Arg Gly Ala Phe His Leu Gly
Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag
gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln
Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt cga
ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg
Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt
tcc agt cta gtt aaa cat gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly
Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgc aag agg ggg
gcg gac cta ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly
Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc
tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly
Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc
gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa 441Ile Thr *14521146PRTArtificial SequenceOptimized
GAT sequence -- 23-2H11 21Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Gly Asp Leu Met Arg Gly Ala
Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75 80Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95Ile Leu
Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105
110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140Ile Thr14522441DNAArtificial SequenceOptimized
GAT sequence -- GAT24-15C3 22atg ata gag gta aaa ccg att aac gca
gag gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala
Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac
cag ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn
Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta acg cgt agt
gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Ser
Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc
gct tca ttc cac cag gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val
Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60cag ggc cag aaa
cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys
Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt
gag cag aag gcg gga acc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg
Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala Glu Glu 85 90 95att
cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336Ile
Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105
110tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag
384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat
aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140atc aca taa 441Ile Thr *14523441DNAArtificial
SequenceOptimized GAT sequence -- GAT4616R 23atg ata gag gta aaa
ccg att aac gca gag gat acc tat gac cta agg 48Met Ile Glu Val Lys
Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc
ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val
Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat
tta acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp
Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa
ctg att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192Lys
Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55
60cag ggc cag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt
240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly
65 70 75 80tat cgt gag cag aag gcg gga acc agt cta gtt aaa cac gct
gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu Val Lys His Ala
Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac cta ctt tgg tgt aat
gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn
Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga aag tta ggc ttc
agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe
Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct
cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro
His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14524146PRTArtificial SequenceOptimized GAT sequence -- 24-15C3
24Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Thr Ser Leu
Val Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140Ile
Thr14525441DNAArtificial SequenceOptimized GAT sequence -
GAT23-6H10 25atg ata gag gta aaa ccg att aac gca gag gat acc tat
gaa cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr
Glu Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa
gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu
Ala Cys Met Phe Glu 20 25 30agc gat tta acg cgt ggt gca ttt cac cta
ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Gly Ala Phe His Leu
Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac
cag gcc gag cac acg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His
Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctt
cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu
Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg
ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala
Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg
ggg gcg gac cta ctt tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg
Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca
ggc tac tac aga aag tta ggc ttc agc gag cag ggg gag 384Ser Ala Ser
Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta
ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432Val
Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa 441Ile Thr *14526441DNAArtificial SequenceOptimized
GAT sequence -- GAT4617R 26atg ata gag gta aaa ccg att aac gca gag
gat acc tat gaa cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Glu Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag
ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta acg cgt ggt gca
ttt cac cta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Gly Ala
Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct
tca ttc cac cag gcc gag cac acg gaa ctt 192Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc cag aaa cag
tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag
cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta
cgt aag agg ggg gcg gac cta ctt tgg tgt aat gcg agg aca 336Ile Leu
Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105
110tcc gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag ggg gag
384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat
aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140atc aca ta a 441Ile Thr14527146PRTArtificial
SequenceOptimized GAT sequence -- 23-6H10 27Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser Asp Leu
Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln
Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14528441DNAArtificial
SequenceOptimized GAT sequence--GAT25-8H7 28atg ata gag gta aaa ccg
att aac gca gag gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc
aga cca aac cag ccg ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta
acg cgt agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu
Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg
att tcc gtc gct tca ttc cac cag gcc gag cac tcg gaa ctt 192Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa
ggc aag aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70
75 80tat cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa
gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu
Glu 85 90 95att cta cgt aag agg ggg gcg gac atg att tgg tgt aat gcg
cgg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala
Arg Thr 100 105 110tct gcc tca ggc tac tac aga aag tta ggc ttc agc
gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser
Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac
atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His
Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14529441DNAArtificial SequenceOptimized GAT sequence--GAT4618SR
29atg ata gag gta aaa ccg att aac gca gag gat acc tat gac cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tct gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc aag aaa cag tac cag ctt cga ggt gtg gct
acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac atg
att tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Met
Ile Trp Cys Asn Ala Arg Thr 100 105 110tct gcc tca ggc tac tac aga
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14530146PRTArtificial SequenceOptimized GAT sequence --
encodes 25-8H7
30Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met
Ile Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140Ile
Thr14531146PRTArtificial SequenceOptimized GAT sequence --con alt e
31Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Xaa Leu Arg 1
5 10 15His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Asp 20 25 30Xaa Asp Leu Thr Arg Xaa Ala Phe His Leu Gly Gly Phe Xaa
Gly Gly 35 40 45Lys Leu Xaa Ser Val Ala Ser Phe His Xaa Ala Xaa His
Xaa Glu Leu 50 55 60Gln Gly Xaa Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Xaa Ser Leu
Val Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Xaa Asp Xaa
Xaa Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Xaa
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro
Pro Val Gly Pro His Xaa Leu Met Tyr Lys Arg 130 135 140Ile
Thr14532441DNAArtificial SequenceOptimized GAT sequence--GAT4618VSR
32atg ata gag gtg aaa ccg att aac gca gag gat acc tat gac cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tct gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc aag aaa cag tac cag ctt cga ggt gtg gct
acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gcg gac atg
att tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Ala Asp Met
Ile Trp Cys Asn Ala Arg Thr 100 105 110tct gcc tca ggc tac tac aga
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14533441DNAArtificial SequenceOptimized GAT sequence
33atg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc cag aaa cag tat cag ctt cga ggc gtg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtc aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gtg gac cta
ctt tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly Val Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta ggt cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14534441DNAArtificial SequenceOptimized GAT
sequence--GAT4619SR 34atg ata gag gta aaa ccg att aac gca gaa gat
acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp
Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg
ata gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn Gln Pro
Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta acg cgt agt gca ttt
cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Ser Ala Phe
His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca
ttc cac cag gcc gag cac tct gaa ctt 192Lys Leu Ile Ser Val Ala Ser
Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag tat
cag ctt cga ggc gtg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr
Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag
aag gcg ggt tcc agt cta gtc aaa cac gct gaa gaa 288Tyr Arg Glu Gln
Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt
aag agg ggg gtg gac cta ctt tgg tgt aat gcg agg aca 336Ile Leu Arg
Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc
gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser
Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120
125gta ttc gac acg ccg cca gta ggt cct cac atc ctg atg tat aaa agg
432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg
130 135 140atc aca taa 441Ile Thr *14535146PRTArtificial
SequenceOptimized GAT sequence encoding 25-19C8 35Met Ile Glu Val
Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg
Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser
Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40
45Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu
50 55 60Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu
Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His
Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys
Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly
Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly
Pro His Ile Leu Met Tyr Lys Arg 130 135 140Ile
Thr14536441DNAArtificial SequenceOptimized GAT sequence--GAT4619VSR
36atg ata gag gtg aaa ccg att aac gca gaa gat acc tat gac cta agg
48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1
5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg ttt
gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe
Glu 20 25 30agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc tac
ggg ggc 144Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr
Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag gcc gag cac
tct gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His
Ser Glu Leu 50 55 60caa ggc cag aaa cag tat cag ctt cga ggc gtg gct
acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala
Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt tcc agt cta
gtc aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu
Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg gtg gac cta
ctt tgg tgt aat gcg agg aca 336Ile Leu Arg Lys Arg Gly Val Asp Leu
Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc tac tac aga
aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly Tyr Tyr Arg
Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc gac acg ccg
cca gta ggt cct cac atc ctg atg tat aaa agg 432Val Phe Asp Thr Pro
Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140atc aca taa
441Ile Thr *14537441DNAArtificial SequenceOptimized GAT
sequence--D_S00397832_GAT22-15B4 37atg ata gag gta aaa ccg att aac
gca gaa gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca
aac cag ccg ata gaa gcg tgt atg ttt gat 96His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30agc gat tta atg cgt
agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Met Arg
Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc
gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192Lys Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc cag
aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat
cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr
Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90
95att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca
336Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr
100 105 110tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag
gga gag 384Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln
Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg
atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu
Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14538452DNAArtificial SequenceOptimized GAT sequence--GAT4611A
38atg gcg ata gag gta aaa ccg att aac gca gaa gat acc tat gac cta
48Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu 1
5 10 15agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg
ttt 96Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met
Phe 20 25 30gat agc gat tta atg cgt agt gca ttt cac tta ggc ggc ttc
tac ggg 144Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe
Tyr Gly 35 40 45ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag
cac acg gaa 192Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu
His Thr Glu 50 55 60ctt caa ggc cag aaa cag tac cag ctt cga ggt gtg
gct acc ttg gaa 240Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val
Ala Thr Leu Glu 65 70 75 80ggt tat cgt gag cag aag gcg ggt tcc agt
cta gtt aaa cac gct gaa 288Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser
Leu Val Lys His Ala Glu 85 90 95gaa att cta cgt aag agg ggg gtg gac
cta ctt tgg tgt aat gcg cgg 336Glu Ile Leu Arg Lys Arg Gly Val Asp
Leu Leu Trp Cys Asn Ala Arg 100 105 110aca tcc gcc tca ggc tac tac
aaa aag tta ggc ttc agc gag cag gga 384Thr Ser Ala Ser Gly Tyr Tyr
Lys Lys Leu Gly Phe Ser Glu Gln Gly 115 120 125gag gta ttc gac acg
ccg cca gta gga cct cac atc ctg atg tat aaa 432Glu Val Phe Asp Thr
Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys 130 135 140agg atc aca
taaggcgcgc c 452Arg Ile Thr145 39147PRTArtificial SequenceOptimized
GAT sequence--22-15B4 M1MA 39Met Ala Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Asp Leu 1 5 10 15Arg His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Met Phe 20 25 30Asp Ser Asp Leu Met Arg
Ser Ala Phe His Leu Gly Gly Phe Tyr Gly 35 40 45Gly Lys Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Thr Glu 50 55 60Leu Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu65 70 75 80Gly Tyr
Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu 85 90 95Glu
Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg 100 105
110Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly
115 120 125Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met
Tyr Lys 130 135 140Arg Ile Thr14540441DNAArtificial
SequenceOptimized GAT sequence 40atg ata gag gta aaa ccg att aac
gca gaa gat acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn
Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca
aac cag ccg ata gaa gcg tgt atg ttt gat 96His Arg Val Leu Arg Pro
Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30agc gat tta atg cgt
agt gca ttt cac tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Met Arg
Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc
gtc gct tca ttc cac cag gcc gag cac acg gaa ctt 192Lys Leu Ile Ser
Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc cag
aaa cag tac cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Gln
Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat
cgt gag cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr
Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90
95att cta cgt aag agg ggg gtg gac cta ctt tgg tgt aat gcg cgg aca
336Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys Asn Ala Arg Thr
100 105 110tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag
gga gag 384Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln
Gly Glu 115 120 125gta ttc gac acg ccg cca gta gga cct cac atc ctg
atg tat aaa agg 432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu
Met Tyr Lys Arg 130 135 140atc aca taa 441Ile Thr
*14541455DNAArtificial SequenceOptimized GAT sequence--GAT4611AA
41atg gcg gcc ata gag gta aaa ccg att aac gca gaa gat acc tat gac
48Met Ala Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp 1
5 10 15cta agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt
atg 96Leu Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys
Met 20 25 30ttt gat agc gat tta atg cgt agt gca ttt cac tta ggc ggc
ttc tac 144Phe Asp Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly
Phe Tyr 35 40 45ggg ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc
gag cac acg 192Gly Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala
Glu His Thr
50 55 60gaa ctt caa ggc cag aaa cag tac cag ctt cga ggt gtg gct acc
ttg 240Glu Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr
Leu 65 70 75 80gaa ggt tat cgt gag cag aag gcg ggt tcc agt cta gtt
aaa cac gct 288Glu Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val
Lys His Ala 85 90 95gaa gaa att cta cgt aag agg ggg gtg gac cta ctt
tgg tgt aat gcg 336Glu Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu
Trp Cys Asn Ala 100 105 110cgg aca tcc gcc tca ggc tac tac aaa aag
tta ggc ttc agc gag cag 384Arg Thr Ser Ala Ser Gly Tyr Tyr Lys Lys
Leu Gly Phe Ser Glu Gln 115 120 125gga gag gta ttc gac acg ccg cca
gta gga cct cac atc ctg atg tat 432Gly Glu Val Phe Asp Thr Pro Pro
Val Gly Pro His Ile Leu Met Tyr 130 135 140aaa agg atc aca taa
ggcgcgcc 455Lys Arg Ile Thr *14542148PRTArtificial
SequenceOptimized GAT sequence--22-15B4 M1MAA 42Met Ala Ala Ile Glu
Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp 1 5 10 15Leu Arg His
Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met 20 25 30Phe Asp
Ser Asp Leu Met Arg Ser Ala Phe His Leu Gly Gly Phe Tyr 35 40 45Gly
Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr 50 55
60Glu Leu Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu65
70 75 80Glu Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His
Ala 85 90 95Glu Glu Ile Leu Arg Lys Arg Gly Val Asp Leu Leu Trp Cys
Asn Ala 100 105 110Arg Thr Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly
Phe Ser Glu Gln 115 120 125Gly Glu Val Phe Asp Thr Pro Pro Val Gly
Pro His Ile Leu Met Tyr 130 135 140Lys Arg Ile
Thr14543444DNAArtificial SequenceOptimized GAT sequence-- GAT4620
43atg gct att gag gtt aaa cct att aac gca gag gat acc tat gac cta
48Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu 1
5 10 15agg cat aga gtc ctc aga cca aac cag ccg ata gaa gcg tgt atg
ttt 96Arg His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met
Phe 20 25 30gaa agc gat tta acg cgt agt gca ttt cac tta ggc ggc ttc
tac ggg 144Glu Ser Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe
Tyr Gly 35 40 45ggc aaa ctg att tcc gtc gct tca ttc cac cag gcc gag
cac tct gaa 192Gly Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu
His Ser Glu 50 55 60ctt caa ggc aag aaa cag tac cag ctt cga ggt gtg
gct acc ttg gaa 240Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val
Ala Thr Leu Glu 65 70 75 80ggt tat cgt gag cag aag gcg ggt tcc agt
cta gtt aaa cac gct gaa 288Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser
Leu Val Lys His Ala Glu 85 90 95gaa att cta cgt aag agg ggg gcg gac
atg att tgg tgt aat gcg agg 336Glu Ile Leu Arg Lys Arg Gly Ala Asp
Met Ile Trp Cys Asn Ala Arg 100 105 110aca tct gcc tca ggc tac tac
aga aag tta ggc ttc agc gag cag gga 384Thr Ser Ala Ser Gly Tyr Tyr
Arg Lys Leu Gly Phe Ser Glu Gln Gly 115 120 125gag gta ttc gac acg
ccg cca gta gga cct cac atc ctg atg tat aaa 432Glu Val Phe Asp Thr
Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys 130 135 140agg atc aca
taa 444Arg Ile Thr *14544444DNAArtificial SequenceOptimized GAT
sequence -- GAT4618A 44atg gcg ata gag gta aaa ccg att aac gca gag
gat acc tat gac cta 48Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Asp Leu 1 5 10 15agg cat aga gtc ctc aga cca aac cag
ccg ata gaa gcg tgt atg ttt 96Arg His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe 20 25 30gaa agc gat tta acg cgt agt gca
ttt cac tta ggc ggc ttc tac ggg 144Glu Ser Asp Leu Thr Arg Ser Ala
Phe His Leu Gly Gly Phe Tyr Gly 35 40 45ggc aaa ctg att tcc gtc gct
tca ttc cac cag gcc gag cac tcg gaa 192Gly Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu 50 55 60ctt caa ggc aag aaa cag
tac cag ctt cga ggt gtg gct acc ttg gaa 240Leu Gln Gly Lys Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu 65 70 75 80ggt tat cgt gag
cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa 288Gly Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu 85 90 95gaa att cta
cgt aag agg ggg gcg gac atg att tgg tgt aat gcg cgg 336Glu Ile Leu
Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg 100 105 110aca
tct gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga 384Thr
Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly 115 120
125gag gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa
432Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys
130 135 140agg atc aca taa 444Arg Ile Thr *14545147PRTArtificial
SequenceOptimized GAT sequence--25-8H7 M1MA 45Met Ala Ile Glu Val
Lys Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu 1 5 10 15Arg His Arg
Val Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe 20 25 30Glu Ser
Asp Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly 35 40 45Gly
Lys Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu 50 55
60Leu Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu65
70 75 80Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala
Glu 85 90 95Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn
Ala Arg 100 105 110Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe
Ser Glu Gln Gly 115 120 125Glu Val Phe Asp Thr Pro Pro Val Gly Pro
His Ile Leu Met Tyr Lys 130 135 140Arg Ile Thr14546146PRTArtificial
SequenceOptimized GAT sequence -- R12G1 46Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser Asp Leu
Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14547146PRTArtificial
SequenceOptimized GAT sequence--R12G2 47Met Ile Glu Val Lys Pro Ile
Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu Arg
Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu 20 25 30Ser Asp Leu Thr
Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu Ile
Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln Gly
Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14548146PRTArtificial
SequenceOptimized GAT sequence-- R12G3 48Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Asn Asp Leu
Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14549146PRTArtificial
SequenceOptimized GAT sequence -- R12G4 49Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Ser Asp Leu
Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14550146PRTArtificial
SequenceOptimized GAT sequence -- R12G5 50Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Ser Asp Leu
Thr Arg Gly Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14551146PRTArtificial
SequenceOptimized GAT sequence -- R12G6 51Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Asn Asp Leu
Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60Gln
Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14552146PRTArtificial
SequenceOptimized GAT sequence -- R12G7 52Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Asn Asp Leu
Met Arg Gly Ala Phe His Leu Gly Gly Phe His Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln
Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14553146PRTArtificial
SequenceOptimized GAT sequence -- R12G8 53Met Ile Glu Val Lys Pro
Ile Asn Ala Glu Asp Thr Tyr Asp Leu Arg 1 5 10 15His Arg Val Leu
Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Asn Asp Leu
Met Arg Ser Ala Phe His Leu Gly Gly Phe His Gly Gly 35 40 45Lys Leu
Ile Ser Val Ala Ser Phe His Gln Ala Glu His Thr Glu Leu 50 55 60Gln
Gly Gln Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65 70 75
80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu
85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg
Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu
Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His Ile
Leu Met Tyr Lys Arg 130 135 140Ile Thr14554146PRTArtificial
SequenceOptimized GAT sequence -- con alt e 54Met Ile Glu Val Lys
Pro Ile Asn Ala Glu Asp Thr Tyr Xaa Leu Arg 1 5 10 15His Arg Val
Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Asp 20 25 30Xaa Asp
Leu Thr Arg Xaa Ala Phe His Leu Gly Gly Phe Xaa Gly Gly 35 40 45Lys
Leu Xaa Ser Val Ala Ser Phe His Xaa Ala Xaa His Xaa Glu Leu 50 55
60Gln Gly Xaa Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly65
70 75 80Tyr Arg Glu Gln Lys Ala Gly Xaa Ser Leu Val Lys His Ala Glu
Glu 85 90 95Ile Leu Arg Lys Arg Gly Xaa Asp Xaa Xaa Trp Cys Asn Ala
Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Xaa Lys Leu Gly Phe Ser
Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro Val Gly Pro His
Xaa Leu Met Tyr Lys Arg 130 135 140Ile Thr14555444DNAArtificial
SequenceOptimized GAT sequence -- GAT4621 55atg gct att gag gtt aag
cct atc aac gca gag gat acc tat gac ctt 48Met Ala Ile Glu Val Lys
Pro Ile Asn Ala Glu Asp Thr Tyr Asp Leu 1 5 10 15agg cat aga gtg
ctc aga cca aac cag cct atc gaa gcc tgc atg ttt 96Arg His Arg Val
Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe 20 25 30gag tct gac
ctt act agg agt gca ttt cac ctt ggt gga ttc tac gga 144Glu Ser Asp
Leu Thr Arg Ser Ala Phe His Leu Gly Gly Phe Tyr Gly 35 40 45ggt aaa
ctg att tcc gtg gct tca ttc cac caa gct gag cac tct gaa 192Gly Lys
Leu Ile Ser Val Ala Ser Phe His Gln Ala Glu His Ser Glu 50 55 60ctt
caa ggt aag aag cag tac cag ctt aga ggt gtg gct acc ttg gaa 240Leu
Gln Gly Lys Lys Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu 65 70
75
80ggt tat aga gag cag aag gct ggt tcc agt ctc gtg aaa cac gct gaa
288Gly Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu
85 90 95gag att ctc aga aag aga ggt gct gac atg atc tgg tgt aat gcc
agg 336Glu Ile Leu Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala
Arg 100 105 110aca tct gct tca gga tac tac agg aag ttg gga ttc agt
gag caa gga 384Thr Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser
Glu Gln Gly 115 120 125gag gtg ttc gat act cct cca gtt gga cct cac
atc ctg atg tat aag 432Glu Val Phe Asp Thr Pro Pro Val Gly Pro His
Ile Leu Met Tyr Lys 130 135 140agg atc aca taa 444Arg Ile Thr *145
56147PRTArtificial SequenceOptimized GAT sequence -- GAT4621,
encodes 25- 8H7 M1MA 56Met Ala Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Asp Leu 1 5 10 15Arg His Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe 20 25 30Glu Ser Asp Leu Thr Arg Ser Ala
Phe His Leu Gly Gly Phe Tyr Gly 35 40 45Gly Lys Leu Ile Ser Val Ala
Ser Phe His Gln Ala Glu His Ser Glu 50 55 60Leu Gln Gly Lys Lys Gln
Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu65 70 75 80Gly Tyr Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu 85 90 95Glu Ile Leu
Arg Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg 100 105 110Thr
Ser Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly 115 120
125Glu Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys
130 135 140Arg Ile Thr14557441DNAArtificial SequenceOptimized GAT
sequence -- R12G1 57atg ata gag gta aaa ccg att aac gca gag gat acc
tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr
Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata
gaa gcg tgt atg ttt gaa 96His Arg Val Leu Arg Pro Asn Gln Pro Ile
Glu Ala Cys Met Phe Glu 20 25 30agc gat tta acg cgt ggt gca ttt cac
tta ggc ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Gly Ala Phe His
Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc
cac cag gcc gag cac act gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe
His Gln Ala Glu His Thr Glu Leu 50 55 60caa ggc aag aaa cag tac cag
ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr Gln
Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag
gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys
Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag
agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys
Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr 100 105 110tct gcc
tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser Ala
Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120
125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg
432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg
130 135 140atc aca taa 441Ile Thr *14558441DNAArtificial
SequenceOptimized GAT sequence -- R12G2 58atgatagagg taaaaccgat
taacgcagag gatacctatg acctaaggca tagagtcctc 60agaccaaacc agccgataga
agcgtgtatg tttgaaagcg atttaacgcg tagtgcattt 120cacttaggcg
gcttctacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag
180cacactgaac ttcaaggcaa gaaacagtac cagcttcgag gtgtggctac
cttggaaggt 240tatcgtgagc agaaggcggg ttccagtcta gttaaacacg
ctgaagaaat tctacgtaag 300aggggggcgg acatgatttg gtgtaatgcg
cggacatctg cctcaggcta ctacagaaag 360ttaggcttca gcgagcaggg
agaggtattc gacacgccgc cagtaggacc tcacatcctg 420atgtataaaa
ggatcacata a 44159441DNAArtificial SequenceOptimized GAT
sequence--R12G3 59atg ata gag gta aaa ccg att aac gca gag gat acc
tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr
Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata
gaa gcg tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln Pro Ile
Glu Ala Cys Met Phe Asp 20 25 30aac gat tta acg cgt ggt gca ttt cac
tta ggc ggc ttc tac ggg ggc 144Asn Asp Leu Thr Arg Gly Ala Phe His
Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc
cac cag gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe
His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc aag aaa cag tac cag
ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr Gln
Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag
gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys
Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag
agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys
Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr 100 105 110tct gcc
tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser Ala
Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120
125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg
432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg
130 135 140atc aca taa 441Ile Thr *14560441DNAArtificial
SequenceOptimized GAT sequence -- R12G4 60atgatagagg taaaaccgat
taacgcagag gatacctatg aactaaggca tagagtcctc 60agaccaaacc agccgataga
agcgtgtatg tttgatagcg atttaacgcg tagtgcattt 120cacttaggcg
gcttctacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag
180cactcggaac ttcaaggcaa gaaacagtac cagcttcgag gtgtggctac
cttggaaggt 240tatcgtgagc agaaggcggg ttccagtcta gttaaacacg
ctgaagaaat tctacgtaag 300aggggggcgg acatgatttg gtgtaatgcg
cggacatctg cctcaggcta ctacagaaag 360ttaggcttca gcgagcaggg
agaggtattc gacacgccgc cagtaggacc tcacatcctg 420atgtataaaa
ggatcacata a 44161441DNAArtificial SequenceOptimized GAT sequence
-- R12G5 61atg ata gag gta aaa ccg att aac gca gag gat acc tat gaa
cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu
Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg ata gaa gcg
tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Asp 20 25 30agc gat tta acg cgt ggt gca ttt cac tta ggc
ggc ttc tac ggg ggc 144Ser Asp Leu Thr Arg Gly Ala Phe His Leu Gly
Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca ttc cac cag
gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser Phe His Gln
Ala Glu His Ser Glu Leu 50 55 60caa ggc aag aaa cag tac cag ctt cga
ggt gtg gct acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr Gln Leu Arg
Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg ggt
tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly
Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt aag agg ggg
gcg gac atg att tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly
Ala Asp Met Ile Trp Cys Asn Ala Arg Thr 100 105 110tct gcc tca ggc
tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly
Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc
gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa 441Ile Thr *14562441DNAArtificial SequenceOptimized
GAT sequence -- R12G6 62atg ata gag gta aaa ccg att aac gca gag gat
acc tat gac cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp
Thr Tyr Asp Leu Arg 1 5 10 15cat aga gtc ctc aga cca aac cag ccg
ata gaa gcg tgt atg ttt gat 96His Arg Val Leu Arg Pro Asn Gln Pro
Ile Glu Ala Cys Met Phe Asp 20 25 30aac gat tta acg cgt agt gca ttt
cac tta ggc ggc ttc tac ggg ggc 144Asn Asp Leu Thr Arg Ser Ala Phe
His Leu Gly Gly Phe Tyr Gly Gly 35 40 45aaa ctg att tcc gtc gct tca
ttc cac cag gcc gag cac tcg gaa ctt 192Lys Leu Ile Ser Val Ala Ser
Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc aag aaa cag tac
cag ctt cga ggt gtg gct acc ttg gaa ggt 240Gln Gly Lys Lys Gln Tyr
Gln Leu Arg Gly Val Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag
aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa 288Tyr Arg Glu Gln
Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu 85 90 95att cta cgt
aag agg ggg gcg gac atg att tgg tgt aat gcg cgg aca 336Ile Leu Arg
Lys Arg Gly Ala Asp Met Ile Trp Cys Asn Ala Arg Thr 100 105 110tct
gcc tca ggc tac tac aga aag tta ggc ttc agc gag cag gga gag 384Ser
Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120
125gta ttc gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg
432Val Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg
130 135 140atc aca taa 441Ile Thr *14563441DNAArtificial
SequenceOptimized GAT sequence -- R12G7 63atgatagag gta aaa ccg att
aac gca gaa gat acc tat gac cta agg cat 51Val Lys Pro Ile Asn Ala
Glu Asp Thr Tyr Asp Leu Arg His 1 5 10aga gtc ctc aga cca aac cag
ccg ata gaa gcg tgt atg ttt gat aac 99Arg Val Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Asp Asn 15 20 25 30gat tta atg cgt ggt
gca ttt cac tta ggc ggc ttc cac ggg ggc aaa 147Asp Leu Met Arg Gly
Ala Phe His Leu Gly Gly Phe His Gly Gly Lys 35 40 45ctg att tcc gtc
gct tca ttc cac cag gcc gag cac act gaa ctt caa 195Leu Ile Ser Val
Ala Ser Phe His Gln Ala Glu His Thr Glu Leu Gln 50 55 60ggc cag aaa
cag tat cag ctt cga ggt gtg gct acc ttg gaa ggt tat 243Gly Gln Lys
Gln Tyr Gln Leu Arg Gly Val Ala Thr Leu Glu Gly Tyr 65 70 75cgt gag
cag aag gcg ggt tcc agt cta gtt aaa cac gct gaa gaa att 291Arg Glu
Gln Lys Ala Gly Ser Ser Leu Val Lys His Ala Glu Glu Ile 80 85 90cta
cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg cgg aca tcc 339Leu
Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr Ser 95 100
105 110gcc tca ggc tac tac aga aag ttg ggc ttc agc gag cag gga gag
gta 387Ala Ser Gly Tyr Tyr Arg Lys Leu Gly Phe Ser Glu Gln Gly Glu
Val 115 120 125ttc gac acg ccg ccg gta gga cct cac atc ctg atg tat
aaa agg atc 435Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg Ile 130 135 140aca taa 441Thr *64441DNAArtificial
SequenceOptimized GAT sequence -- R12G8 64atgatagagg taaaaccgat
taacgcagaa gatacctatg acctaaggca tagagtcctc 60agaccaaacc agccgataga
agcgtgtatg tttgataacg atttaatgcg tagtgcattt 120cacttaggcg
gcttccacgg gggcaaactg atttccgtcg cttcattcca ccaggccgag
180cacactgaac ttcaaggcca gaaacagtat cagcttcgag gtgtggctac
cttggaaggt 240tatcgtgagc agaaggcggg ttccagtcta gttaaacacg
ctgaagaaat tctacgtaag 300aggggggcgg acatgctttg gtgtaatgcg
cggacatccg cctcaggcta ctacagaaag 360ttgggcttca gcgagcaggg
agaggtattc gacacgccgc cggtaggacc tcacatcctg 420atgtataaaa
ggatcacata a 441653936DNAGlycine maxmisc_feature(0)...(0)HRA
sequence 65atgctacgca cacaacacaa tggcggccac cgcttccaga accacccgat
tctcttcttc 60ctcttcacac cccaccttcc ccaaacgcat tactagatcc accctcccgt
gtgttgtgtt 120accgccggtg gcgaaggtct tggtgggcta agagaagaag
gagaagtgtg gggtggaagg 180ggtttgcgta atgatctagg tgggagggtc
tctctcatca aaccctcacc aaacccaacc 240acgctctcaa aatcaaatgt
tccatctcca aaccccccac ggcggcgccc ttcaccaagg 300aagcgccgag
agagagtagt ttgggagtgg tttgggttgg tgcgagagtt ttagtttaca
360aggtagaggt ttggggggtg ccgccgcggg aagtggttcc ttcgcggcac
cacggagccc 420ttcgtgtcac ggttcgcctc cggcgaacct cgcaagggcg
cggacatcct tgtggaggcg 480ctggagaggc agggcgtgac gacggtgttg
gtgcctcggg aagcacagtg ccaagcggag 540gccgcttgga gcgttcccgc
gcctgtagga acacctccgc gacctctccg tcccgcactg 600ctgccacatc
gcgtaccccg gcggtgcgtc gatggagatc caccaggcgc tcacgcgctc
660cgccgccatc cgcaacgtgc tcccgcgcca cgagcagggc ggcgtcttag
cgcatggggc 720cgccacgcag ctacctctag gtggtccgcg agtgcgcgag
gcggcggtag gcgttgcacg 780agggcgcggt gctcgtcccg ccgcagaacg
ccgccgaagg ctacgcgcgt tcctccggcc 840tccccggcgt ctgcattgcc
acctccggcc ccggcgccac caacctcgtg agcggcctcg 900ccgacgctgc
ggcggcttcc gatgcgcgca aggaggccgg aggggccgca gacgtaacgg
960tggaggccgg ggccgcggtg gttggagcac tcgccggagc ggctgcgatt
aatggacagc 1020gtcccagtcg tcgccatcac cggccaggtc gcccgccgga
tgatcggcac cgacgccttc 1080caagaaaccc cgatcgtgga ggtgagcaaa
ttacctgtcg cagggtcagc agcggtagtg 1140gccggtccag cgggcggcct
actagccgtg gctgcggaag gttctttggg gctagcacct 1200ccactcgtga
tccatcacga agcacaacta cctcatcctc gacgtcgacg acatcccccg
1260cgtcgtcgcc gaggctttct tcgtcgccac ctccggccgc cccggtccct
aggtagtgct 1320tcgtgttgat ggagtaggag ctgcagctgc tgtagggggc
gcagcagcgg ctccgaaaga 1380agcagcggtg gaggccggcg gggccagggg
tcctcatcga cattcccaaa gacgttcagc 1440agcaactcgc cgtgcctaat
tgggacgagc ccgttaacct ccccggttac ctcgccaggc 1500tgcccaggcc
aggagtagct gtaagggttt ctgcaagtcg tcgttgagcg gcacggatta
1560accctgctcg ggcaattgga ggggccaatg gagcggtccg acgggtcccc
ccccgccgag 1620gcccaattgg aacacattgt cagactcatc atggaggccc
aaaagcccgt tctctacgtc 1680ggcggtggca gtttgaattc cagtgctggg
ggggcggctc cgggttaacc ttgtgtaaca 1740gtctgagtag tacctccggg
ttttcgggca agagatgcag ccgccaccgt caaacttaag 1800gtcacgacaa
ttgaggcgct ttgttgaact cactggtatt cccgttgcta gcactttaat
1860gggtcttgga acttttccta ttggtgatga atattccctt cagatgcttt
aactccgcga 1920aacaacttga gtgaccataa gggcaacgat cgtgaaatta
cccagaacct tgaaaaggat 1980aaccactact tataagggaa gtctacgagg
gtatgcatgg tactgtttat gctaactatg 2040ctgttgacaa tagtgatttg
ttgcttgcct ttggggtaag gtttgatgac cgtgttactg 2100ggaagcttcc
catacgtacc atgacaaata cgattgatac gacaactgtt atcactaaac
2160aacgaacgga aaccccattc caaactactg gcacaatgac ccttcgaaga
ggcttttgct 2220agtagggcta agattgttca cattgatatt gattctgccg
agattgggaa gaacaagcag 2280gcgcacgtgt cggtttgcgc ggatttgact
ccgaaaacga tcatcccgat tctaacaagt 2340gtaactataa ctaagacggc
tctaaccctt cttgttcgtc cgcgtgcaca gccaaacgcg 2400cctaaactag
ttggccttga agggaattaa tatgattttg gaggagaaag gagtggaggg
2460taagtttgat cttggaggtt ggagagaaga gattaatgtg cagaaacatc
aaccggaact 2520tcccttaatt atactaaaac ctcctctttc ctcacctccc
attcaaacta gaacctccaa 2580cctctcttct ctaattacac gtctttgtca
agtttccatt gggttacaag acattccagg 2640acgcgatttc tccgcagcat
gctatcgagg ttcttgatga gttgactaat ggagatgcta 2700ttgttagtgt
tcaaaggtaa cccaatgttc tgtaaggtcc tgcgctaaag aggcgtcgta
2760cgatagctcc aagaactact caactgatta cctctacgat aacaatcaac
tggggttggg 2820cagcatcaaa tgtgggctgc gcagttttac aagtacaaga
gaccgaggca gtggttgacc 2880tcagggggtc ttggagccat gggttttgtg
accccaaccc gtcgtagttt acacccgacg 2940cgtcaaaatg ttcatgttct
ctggctccgt caccaactgg agtcccccag aacctcggta 3000cccaaaacga
ttgcctgcgg ctattggtgc tgctgttgct aaccctgggg ctgttgtggt
3060tgacattgat ggggatggta gtttcatcat gaatgttcag gagttggcct
aacggacgcc 3120gataaccacg acgacaacga ttgggacccc gacaacacca
actgtaacta cccctaccat 3180caaagtagta cttacaagtc ctcaaccgca
ctataagagt ggagaatctc ccagttaaga 3240tattgttgtt gaacaatcag
catttgggta tggtggttca gttggaggat aggttctaca 3300agtccaatgt
gatattctca cctcttagag ggtcaattct ataacaacaa cttgttagtc
3360gtaaacccat accaccaagt caacctccta tccaagatgt tcaggttaag
agctcacacc 3420tatcttggag atccgtctag cgagagcgag atattcccaa
acatgctcaa gtttgctgat 3480gcttgtggga taccggcagc gcgagtgatc
tcgagtgtgg atagaacctc taggcagatc 3540gctctcgctc tataagggtt
tgtacgagtt caaacgacta cgaacaccct atggccgtcg 3600cgctcactcg
aagaaggaag agcttagagc ggcaattcag agaatgttgg acacccctgg
3660cccctacctt cttgatgtca ttgtgcccca tcaggagcat gtgttgccgc
ttcttccttc 3720tcgaatctcg ccgttaagtc tcttacaacc tgtggggacc
ggggatggaa gaactacagt 3780aacacggggt agtcctcgta cacaacggga
tgattcccag taatggatcc ttcaaggatg 3840tgataactga gggtgatggt
agaacgaggt acctactaag ggtcattacc taggaagttc 3900ctacactatt
gactcccact accatcttgc tccatg 3936663834DNAZea
Maysmisc_feature(0)...(0)HRA sequence 66cagtacacag tcctgccatc
accatccagg atcatatcct tgaaagcccc accactaggg 60atcataggca acacatgtca
tgtgtcagga cggtagtggt aggtcctagt ataggaactt
120tcggggtggt gatccctagt atccgttgtg tagctcctgg tgtgggacga
ttatatccaa 180gaggtacggc cctggagtct cgagcatctt ctttatcgct
gcgcggactt cgttcttctt 240tgtcacacgg accgaggacc acaccctgct
aatataggtt ctccatgccg ggacctcaga 300gctcgtagaa gaaatagcga
cgcgcctgaa gcaagaagaa acagtgtgcc tgcgctggaa 360tgttgaaccc
tttggcgatc gtcacgaaat ctggatatat ctcactttca ttctctgggt
420ttcccaagta tgtgtgcgct ctgttggcct tagcgacctt acaacttggg
aaaccgctag 480cagtgcttta gacctatata gagtgaaagt aagagaccca
aagggttcat acacacgcga 540gacaaccgga attagaacct gtcctccaac
tgcaccacca tccccaggtg ctggttgttt 600agcacaaaga ccttcactgg
gaggttctca attcggatca tagctagctc ctatcttgga 660caggaggttg
acgtggtggt aggggtccac gaccaacaaa tcgtgtttct ggaagtgacc
720ctccaagagt taagcctagt atcgatcgag gagaacgttc atgagaaagc
taccatctcc 780atcgatgtca acaacagtga cacctgggtt tgccacagaa
gcaccagcag cagccggcaa 840accaaatccc atcttgcaag tactctttcg
atggtagagg tagctacagt tgttgtcact 900gtggacccaa acggtgtctt
cgtggtcgtc gtcggccgtt tggtttaggg taagccccaa 960gaccagctga
agacaaccac tgccttggcc gcttgtaagt gtagtactgt gccgcccaca
1020tctggtgctg cccaacacct gtgccgatga tgtcggggtt ctggtcgact
tctgttggtg 1080acggaaccgg cgaacattca catcatgaca cggcgggtgt
agaccacgac gggttgtgga 1140cacggctact acgcctcgcc tttcgtcagc
tcatcaagaa cctgaatagc atattgtggc 1200tggatctcct cattagatgt
tttataccca agggggaatt ccctcttctg ctcggagcgg 1260aaagcagtcg
agtagttctt ggacttatcg tataacaccg acctagagga gtaatctaca
1320aaatatgggt tcccccttaa gggagaagac gagatccaac tcatcgttcc
atgagccaaa 1380gtcaaagctc ttctttgatg tgcttccttc aagaagagca
ttcatgccct gcaaagcaag 1440cttaacatct gcctaggttg agtagcaagg
tactcggttt cagtttcgag aagaaactac 1500acgaaggaag ttcttctcgt
aagtacggga cgtttcgttc gaattgtaga cgacagatgg 1560acacatgtgg
ctgcttgttc ttgccaatct cagccggatc aatatcaacg tgcacaatct
1620tagccctgct tgcaaaagcc tcaatcttcc cttgtctacc tgtgtacacc
gacgaacaag 1680aacggttaga gtcggcctag ttatagttgc acgtgttaga
atcgggacga acgttttcgg 1740agttagaagg gagtcacgcg atcatcaaac
cgcacaccaa gtgcaagcaa cagatcggcc 1800ttatccactg cataatttgc
atacaccgtc ccatgcatac ctagcatgcg cacagtgcgc 1860tagtagtttg
gcgtgtggtt cacgttcgtt gtctagccgg aataggtgac gtattaaacg
1920tatgtggcag ggtacgtatg gatcgtacgc gtgagacagt gggtcgtcgc
tggggaagtt 1980gccgaggccc ataagagtag ttgtgaccgg gattccagtc
agctccacaa agcgtcgcaa 2040ctcctcacca gactctgtca cccagcagcg
accccttcaa cggctccggg tattctcatc 2100aacactggcc ctaaggtcag
tcgaggtgtt tcgcagcgtt gaggagtggt cttgctgcgc 2160agccaccgcc
cacataaaga acagggcgcc gcgattcacc aacaagacgc agcacctgct
2220caagcaactc agtcgcaggg ggcttgggaa ggacgacgcg tcggtggcgg
gtgtatttct 2280tgtcccgcgg cgctaagtgg ttgttctgcg tcgtggacga
gttcgttgag tcagcgtccc 2340ccgaaccctt cccgcgcaat gtacccaggc
agactcatgg gcttgtccca gacaggcacc 2400gccatctgct gctggatgtc
cttggggatg tcgacaagca ccggccctgg tcgcgcgtta 2460catgggtccg
tctgagtacc cgaacagggt ctgtccgtgg cggtagacga cgacctacag
2520gaacccctac agctgttcgt ggccgggacc aggaccagag gaggcgagga
agaaagcctc 2580ctgcacgacg cgggggatgt cgtcgacgtc gaggaccagg
tagttgtgct tggtgatgga 2640gcgggtgacc tcctggtctc ctccgctcct
tctttcggag gacgtgctgc gccccctaca 2700gcagctgcag ctcctggtcc
atcaacacga accactacct cgcccactgg aggacgatgg 2760gcgtctcctg
gaaggcgtcg gtgccaatca tgcgtcgcgc cacctgtccc gtgatggcga
2820ccatggggac ggaatcgagc agcgcgtcgg cgctgctacc cgcagaggac
cttccgcagc 2880cacggttagt acgcagcgcg gtggacaggg cactaccgct
ggtacccctg ccttagctcg 2940tcgcgcagcc gcagcgcgga gactaggttg
gtggcgccgg ggccggaggt ggcgatgcag 3000acgccgacgc ggcccgagga
gcgcgcgtag ccggaggcgg caaaggcctc cctcgcgcct 3060ctgatccaac
caccgcggcc ccggcctcca ccgctacgtc tgcggctgcg ccgggctcct
3120cgcgcgcatc ggcctccgcc gtttccggag ggcttgctcg tggcggaaga
ggtggttggc 3180gatgacgggg gagcgggtga gtgcctggtg gatctccatg
gacgcgccgc cggggtaggc 3240gaagacgtcg cggaacgagc accgccttct
ccaccaaccg ctactgcccc ctcgcccact 3300cacggaccac ctagaggtac
ctgcgcggcg gccccatccg cttctgcagc gcgacgccgc 3360agcgctcgag
ggactcgacg aggatgtcag cacccttgcg gggctcggtg gggccccacg
3420gccggagcgg ggtggccggg ggagccatcg gcctgcggcg tcgcgagctc
cctgagctgc 3480tcctacagtc gtgggaacgc cccgagccac cccggggtgc
cggcctcgcc ccaccggccc 3540cctcggtagc cgatggcggg tgacgccgct
gagcacctga tgggcgcggc gagggcgcgg 3600cgggtggcca ggaggtgcgc
ccggcgcctc gccttgggcg cagcggtagt ggtaccgccc 3660actgcggcga
ctcgtggact acccgcgccg ctcccgcgcc gcccaccggt cctccacgcg
3720ggccgcggag cggaacccgc gtcgccatca cccgccagtg agcgcggtag
acgcggcggc 3780ggcggtggcc atggcggtca ctcgcgccat ctgcgccgcc
gccgccaccg gtac 3834674278DNAArabidopsismisc_feature(0)...(0)HRA
sequence 67aaatacgttt tatgcaacct acgcaccctg cgctaccatc cctagagctg
cagcttattt 60ttacaacaat taccaacaac aacaaacaac aaacaacatt acaattacta
tttacatgga 120tgcgtgggac gcgatggtag ggatctcgac gtcgaataaa
aatgttgtta atggttgttg 180ttgtttgttg tttgttgtaa tgttaatgat
aaatgtatta cagtcgaccc gggatccatg 240gcggcggcaa caacaacaac
aacaacatct tcttcgatct ccttctccac caaaccatct 300ccttcctcct
ccaaattaat gtcagctggg ccctaggtac cgccgccgtt gttgttgttg
360ttgttgtaga agaagctaga ggaagaggtg gtttggtaga ggaaggagga
ggtttacacc 420attaccaatc tccagattct ccctcccatt ctccctaaac
cccaacaaat catcctcctc 480ctcccgccgc cgcggtatca aatccagctc
tccctcgtgg taatggttag aggtctaaga 540gggagggtaa gagggatttg
gggttgttta gtaggaggag gagggcggcg gcgccatagt 600ttaggtcgag
agggagctcc atctccgccg tgctcaacac aaccaccaat gtcacaacca
660ctccctctcc aaccaaacct accaaacccg aaacattcat ctcccgattc
gctccagagg 720tagaggcggc acgagttgtg ttggtggtta cagtgttggt
gagggagagg ttggtttgga 780tggtttgggc tttgtaagta gagggctaag
cgaggtgatc aaccccgcaa aggcgctgat 840atcctcgtcg aagctttaga
acgtcaaggc gtagaaaccg tattcgctta ccctggaggt 900gcatcaatgg
agattcctag ttggggcgtt tccgcgacta taggagcagc ttcgaaatct
960tgcagttccg catctttggc ataagcgaat gggacctcca cgtagttacc
tctaagacca 1020agccttaacc cgctcttcct caatccgtaa cgtccttcct
cgtcacgaac aaggaggtgt 1080attcgcagca gaaggatacg ctcgatcctc
aggtaatggt tcggaattgg gcgagaagga 1140gttaggcatt gcaggaagga
gcagtgcttg ttcctccaca taagcgtcgt cttcctatgc 1200gagctaggag
tccattacca ggtatctgta tagccacttc aggtcccgga gctacaaatc
1260tcgttagcgg attagccgat gcgttgttag atagtgttcc tcttgtagca
atcacatggt 1320ccatagacat atcggtgaag tccagggcct cgatgtttag
agcaatcgcc taatcggcta 1380cgcaacaatc tatcacaagg agaacatcgt
tagtgtggac aagtcgctcg tcgtatgatt 1440ggtacagatg cgtttcaaga
gactccgatt gttgaggtaa cgcgttcgat tacgaagcat 1500aactatcttg
tgatggcctg ttcagcgagc agcatactaa ccatgtctac gcaaagttct
1560ctgaggctaa caactccatt gcgcaagcta atgcttcgta ttgatagaac
actaccatgt 1620tgaagatatc cctaggatta ttgaggaagc tttcttttta
gctacttctg gtagacctgg 1680acctgttttg gttgatgttc ctaaagatat
tcaacataca acttctatag ggatcctaat 1740aactccttcg aaagaaaaat
cgatgaagac catctggacc tggacaaaac caactacaag 1800gatttctata
agttgtacag cttgcgattc ctaattggga acaggctatg agattacctg
1860gttatatgtc taggatgcct aaacctccgg aagattctca tttggagcag
attgtttgtc 1920gaacgctaag gattaaccct tgtccgatac tctaatggac
caatatacag atcctacgga 1980tttggaggcc ttctaagagt aaacctcgtc
taacaaaggt tgatttctga gtctaagaag 2040cctgtgttgt atgttggtgg
tggttgtttg aattctagcg atgaattggg taggtttgtt 2100gagcttacgg
ggatcctcca actaaagact cagattcttc ggacacaaca tacaaccacc
2160accaacaaac ttaagatcgc tacttaaccc atccaaacaa ctcgaatgcc
cctaggctgt 2220tgcgagtacg ttgatggggc tgggatctta tccttgtgat
gatgagttgt cgttacatat 2280gcttggaatg catgggactg tgtatgcaaa
ttacgcgaca acgctcatgc aactaccccg 2340accctagaat aggaacacta
ctactcaaca gcaatgtata cgaaccttac gtaccctgac 2400acatacgttt
aatgcgtgtg gagcatagtg atttgttgtt ggcgtttggg gtaaggtttg
2460atgatcgtgt cacgggtaag cttgaggctt ttgctagtag ggctaagatt
gttcatacac 2520ctcgtatcac taaacaacaa ccgcaaaccc cattccaaac
tactagcaca gtgcccattc 2580gaactccgaa aacgatcatc ccgattctaa
caagtaattg atattgactc ggctgagatt 2640gggaagaata agactcctca
tgtgtctgtg tgtggtgatg ttaagctggc tttgcaaggg 2700atgaatatga
ttcttgtaac tataactgag ccgactctaa cccttcttat tctgaggagt
2760acacagacac acaccactac aattcgaccg aaacgttccc tacttatact
aagaacagag 2820ccgagcggag gagcttaagc ttgattttgg agtttggagg
aatgagttga acgtacagaa 2880acagaagttt ccgttgagct ttaagacgtt
tggggatctc ggctcgcctc ctcgaattcg 2940aactaaaacc tcaaacctcc
ttactcaact tgcatgtctt tgtcttcaaa ggcaactcga 3000aattctgcaa
acccctagct attcctccac agtatgcgat taaggtcctt gatgagttga
3060ctgatggaaa agccataata agtactggtg tcgggcaaca tcaaatgtgg
gcggcgtcga 3120taaggaggtg tcatacgcta attccaggaa ctactcaact
gactaccttt tcggtattat 3180tcatgaccac agcccgttgt agtttacacc
cgccgccagt tctacaatta caagaaacca 3240aggcagtggc tatcatcagg
aggccttgga gctatgggat ttggacttcc tgctgcgatt 3300ggagcgtctg
ttgctagtca agatgttaat gttctttggt tccgtcaccg atagtagtcc
3360tccggaacct cgatacccta aacctgaagg acgacgctaa cctcgcagac
aacgataccc 3420tgatgcgata gttgtggata ttgacggaga tggaagcttt
ataatgaatg tgcaagagct 3480agccactatt cgtgtagaga atcttccagt
gaaggttggg actacgctat caacacctat 3540aactgcctct accttcgaaa
tattacttac acgttctcga tcggtgataa gcacatctct 3600tagaaggtca
cttccaactt ttattaaaca accagcatct tggcatggtt atgcaattgg
3660aagatcggtt ctacaaagct aaccgagctc acacatttct cggggatccg
gctcagtgaa 3720aataatttgt tggtcgtaga accgtaccaa tacgttaacc
ttctagccaa gatgtttcga 3780ttggctcgag tgtgtaaaga gcccctaggc
cgagtcgagg acgagatatt cccgaacatg 3840ttgctgtttg cagcagcttg
cgggattcca gcggcgaggg tgacaaagaa agcagatctc 3900cgagaagcta
ttcagactcc tgctctataa gggcttgtac aacgacaaac gtcgtcgaac
3960gccctaaggt cgccgctccc actgtttctt tcgtctagag gctcttcgat
aagtctcaat 4020gctggataca ccaggacctt acctgttgga tgtgatttgt
ccgcaccaag aacatgtgtt 4080gccgatgatc ccgagtggtg gcactttcaa
cgatgtgtta cgacctatgt ggtcctggaa 4140tggacaacct acactaaaca
ggcgtggttc ttgtacacaa cggctactag ggctcaccac 4200cgtgaaagtt
gctacacata acggaaggag atggccggat taaatacgta ttgccttcct
4260ctaccggcct aatttatg 427868442DNAArtificial Sequenceoptimized
GAT sequence (GAT4601) 68c atg ata gag gtg aaa ccg att aac gca gag
gat acc tat gaa cta agg 49Met Ile Glu Val Lys Pro Ile Asn Ala Glu
Asp Thr Tyr Glu Leu Arg 1 5 10 15cat aga ata ctc aga cca aac cag
ccg ata gaa gcg tgt atg ttt gaa 97His Arg Ile Leu Arg Pro Asn Gln
Pro Ile Glu Ala Cys Met Phe Glu 20 25 30agc gat tta ctt cgt ggt gca
ttt cac tta ggc ggc ttt tac agg ggc 145Ser Asp Leu Leu Arg Gly Ala
Phe His Leu Gly Gly Phe Tyr Arg Gly 35 40 45aaa ctg att tcc ata gct
tca ttc cac cag gcc gag cac tcg gaa ctc 193Lys Leu Ile Ser Ile Ala
Ser Phe His Gln Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag
tac cag ctc cga ggt atg gct acc ttg gaa ggt 241Gln Gly Gln Lys Gln
Tyr Gln Leu Arg Gly Met Ala Thr Leu Glu Gly65 70 75 80tat cgt gag
cag aaa gcg gga tca act cta gtt aaa cac gct gaa gaa 289Tyr Arg Glu
Gln Lys Ala Gly Ser Thr Leu Val Lys His Ala Glu Glu 85 90 95atc ctt
cgt aag agg ggg gcg gac atg ctt tgg tgt aat gcg agg aca 337Ile Leu
Arg Lys Arg Gly Ala Asp Met Leu Trp Cys Asn Ala Arg Thr 100 105
110tcc gcc tca ggc tac tac aaa aag tta ggc ttc agc gag cag gga gag
385Ser Ala Ser Gly Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu
115 120 125ata ttt gac acg ccg cca gta gga cct cac atc ctg atg tat
aaa agg 433Ile Phe Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr
Lys Arg 130 135 140atc aca taa 442Ile Thr *14569146PRTArtificial
Sequence 69Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu
Leu Arg 1 5 10 15His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Glu 20 25 30Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly
Gly Phe Tyr Arg Gly 35 40 45Lys Leu Ile Ser Ile Ala Ser Phe His Gln
Ala Glu His Ser Glu Leu 50 55 60Gln Gly Gln Lys Gln Tyr Gln Leu Arg
Gly Met Ala Thr Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly
Ser Thr Leu Val Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly
Ala Asp Met Leu Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly
Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Ile Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140Ile Thr14570441DNAArtificial Sequenceoptimized GAT sequence
(GAT4602) 70atg ata gag gtg aaa ccg att aac gca gag gat acc tat gaa
cta agg 48Met Ile Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu
Leu Arg 1 5 10 15cat aga ata ctc aga cca aac cag ccg ata gaa gcg
tgt atg ttt gaa 96His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala
Cys Met Phe Glu 20 25 30agc gat tta ctt cgt ggt gca ttt cac tta ggc
ggc tat tac ggg ggc 144Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly
Gly Tyr Tyr Gly Gly 35 40 45aaa ctg att tcc ata gct tca ttc cac cag
gcc gag cac tca gaa ctc 192Lys Leu Ile Ser Ile Ala Ser Phe His Gln
Ala Glu His Ser Glu Leu 50 55 60caa ggc cag aaa cag tac cag ctc cga
ggt atg gct acc ttg gaa ggt 240Gln Gly Gln Lys Gln Tyr Gln Leu Arg
Gly Met Ala Thr Leu Glu Gly 65 70 75 80tat cgt gag cag aag gcg gga
tcg agt cta att aaa cac gct gaa gaa 288Tyr Arg Glu Gln Lys Ala Gly
Ser Ser Leu Ile Lys His Ala Glu Glu 85 90 95att ctt cgt aag agg ggg
gcg gac ttg ctt tgg tgt aat gcg cgg aca 336Ile Leu Arg Lys Arg Gly
Ala Asp Leu Leu Trp Cys Asn Ala Arg Thr 100 105 110tcc gcc tca ggc
tac tac aaa aag tta ggc ttc agc gag cag gga gag 384Ser Ala Ser Gly
Tyr Tyr Lys Lys Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125gta ttc
gac acg ccg cca gta gga cct cac atc ctg atg tat aaa agg 432Val Phe
Asp Thr Pro Pro Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135
140atc aca taa 441Ile Thr *14571146PRTArtificial Sequence 71Met Ile
Glu Val Lys Pro Ile Asn Ala Glu Asp Thr Tyr Glu Leu Arg 1 5 10
15His Arg Ile Leu Arg Pro Asn Gln Pro Ile Glu Ala Cys Met Phe Glu
20 25 30Ser Asp Leu Leu Arg Gly Ala Phe His Leu Gly Gly Tyr Tyr Gly
Gly 35 40 45Lys Leu Ile Ser Ile Ala Ser Phe His Gln Ala Glu His Ser
Glu Leu 50 55 60Gln Gly Gln Lys Gln Tyr Gln Leu Arg Gly Met Ala Thr
Leu Glu Gly65 70 75 80Tyr Arg Glu Gln Lys Ala Gly Ser Ser Leu Ile
Lys His Ala Glu Glu 85 90 95Ile Leu Arg Lys Arg Gly Ala Asp Leu Leu
Trp Cys Asn Ala Arg Thr 100 105 110Ser Ala Ser Gly Tyr Tyr Lys Lys
Leu Gly Phe Ser Glu Gln Gly Glu 115 120 125Val Phe Asp Thr Pro Pro
Val Gly Pro His Ile Leu Met Tyr Lys Arg 130 135 140Ile
Thr14572438DNAcauliflower mosaic virusenhancer(0)...(0)35S enhancer
72cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa
60cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg
120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga
agaccaaagg 180gcaattgaga cttttcaaca aagggtaata tccggaaacc
tcctcggatt ccattgccca 240gctatctgtc actttattgt gaagatagtg
gaaaaggaag gtggctccta caaatgccat 300cattgcgata aaggaaaggc
catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360ggacccccac
ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag
420caagtggatt gatgtgat 43873534DNAcauliflower mosaic
viruspromoter(0)...(0)S35 enhancer with minimial core promoter
73cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa
60cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg
120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga
agaccaaagg 180gcaattgaga cttttcaaca aagggtaata tccggaaacc
tcctcggatt ccattgccca 240gctatctgtc actttattgt gaagatagtg
gaaaaggaag gtggctccta caaatgccat 300cattgcgata aaggaaaggc
catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360ggacccccac
ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag
420caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc
ccactaagct 480tcgcaagacc cttcctctat ataaggaagt tcatttcatt
tggagaggac aggg 5347452DNAcauliflower mosaic
viruspromoter(0)...(0)mimimal core promoter 74gcaagaccct tcctctatat
aaggaagttc atttcatttg gagaggacag gg 5275162DNAcauliflower mosaic
virus 75catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac
ccacgaggag 60catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt
gatgtgatat 120ctccactgac gtaagggatg acgcacaatc ccactaagct tc
1627644DNAcauliflower mosaic virus 76atctccactg acgtaaggga
tgacgcacaa tcccactaag cttc 44771991DNAArtificial Sequencepromoter
sequence comprising ZmUBI PRO-5'UTR- ZMUBI INTRON 1 77gcagtgcagc
gtgacccggt cgtgcccctc tctagagata atgagcattg catgtctaag 60ttataaaaaa
ttaccacata ttttttttgt cacacttgtt tgaagtgcag tttatctatc
120tttatacata tatttaaact ttactctacg aataatataa tctatagtac
tacaataata 180tcagtgtttt agagaatcat ataaatgaac agttagacat
ggtctaaagg acaattgagt 240attttgacaa caggactcta cagttttatc
tttttagtgt gcatgtgttc tccttttttt 300ttgcaaatag cttcacctat
ataatacttc atccatttta ttagtacatc catttagggt 360ttagggttaa
tggtttttat agactaattt ttttagtaca tctattttat tctattttag
420cctctaaatt aagaaaacta aaactctatt ttagtttttt tatttaataa
tttagatata 480aaatagaata aaataaagtg actaaaaatt aaacaaatac
cctttaagaa attaaaaaaa 540ctaaggaaac atttttcttg tttcgagtag
ataatgccag cctgttaaac gccgtcgacg 600agtctaacgg acaccaacca
gcgaaccagc agcgtcgcgt cgggccaagc gaagcagacg 660gcacggcatc
tctgtcgctg cctctggacc cctctcgaga gttccgctcc accgttggac
720ttgctccgct gtcggcatcc agaaattgcg tggcggagcg gcagacgtga
gccggcacgg 780caggcggcct cctcctcctc tcacggcacc ggcagctacg
ggggattcct ttcccaccgc 840tccttcgctt tcccttcctc gcccgccgta
ataaatagac accccctcca caccctcttt 900ccccaacctc gtgttgttcg
gagcgcacac acacacaacc agatctcccc caaatccacc 960cgtcggcacc
tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct ctctaccttc
1020tctagatcgg cgttccggtc catggttagg gcccggtagt tctacttctg
ttcatgtttg 1080tgttagatcc gtgtttgtgt tagatccgtg ctgctagcgt
tcgtacacgg atgcgacctg 1140tacgtcagac acgttctgat tgctaacttg
ccagtgtttc tctttgggga atcctgggat 1200ggctctagcc gttccgcaga
cgggatcgat ttcatgattt tttttgtttc gttgcatagg 1260gtttggtttg
cccttttcct ttatttcaat atatgccgtg cacttgtttg tcgggtcatc
1320ttttcatgct tttttttgtc ttggttgtga tgatgtggtc tggttgggcg
gtcgttctag 1380atcggagtag aattctgttt caaactacct ggtggattta
ttaattttgg atctgtatgt 1440gtgtgccata catattcata gttacgaatt
gaagatgatg gatggaaata tcgatctagg 1500ataggtatac atgttgatgc
gggttttact gatgcatata cagagatgct ttttgttcgc 1560ttggttgtga
tgatgtggtg tggttgggcg gtcgttcatt cgttctagat cggagtagaa
1620tactgtttca aactacctgg tgtatttatt aattttggaa ctgtatgtgt
gtgtcataca 1680tcttcatagt tacgagttta agatggatgg aaatatcgat
ctaggatagg tatacatgtt 1740gatgtgggtt ttactgatgc atatacatga
tggcatatgc agcatctatt catatgctct 1800aaccttgagt acctatctat
tataataaac aagtatgttt tataattatt ttgatcttga 1860tatacttgga
tgatggcata tgcagcagct atatgtggat ttttttagcc ctgccttcat
1920acgctattta tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt
gtttggtgtt 1980acttctgcag g 1991783359DNAArtificial Sequence3X35S
ENH operbably linked to the ZmUbi PRO-5UTR-ZmUbi intron 1 promoter
; 35S enhancer in the reverse direction 78atcacatcaa tccacttgct
ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60cctcgtgggt gggggtccat
ctttgggacc actgtcggca gaggcatctt caacgatggc 120ctttccttta
tcgcaatgat ggcatttgta ggagccacct tccttttcca ctatcttcac
180aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata
ttaccctttg 240ttgaaaagtc tcaattgccc tttggtcttc tgagactgta
tctttgatat ttttggagta 300gacaagcgtg tcgtgctcca ccatgttgac
gaagattttc ttcttgtcat tgagtcgtaa 360gagactctgt atgaactgtt
cgccagtctt tacggcgagt tctgttaggt cctctatttg 420aatctttgac
tccatggacg gtatcgataa gctagcttga tatcacatca atccacttgc
480tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg
tgggggtcca 540tctttgggac cactgtcggc agaggcatct tcaacgatgg
cctttccttt atcgcaatga 600tggcatttgt aggagccacc ttccttttcc
actatcttca caataaagtg acagatagct 660gggcaatgga atccgaggag
gtttccggat attacccttt gttgaaaagt ctcaattgcc 720ctttggtctt
ctgagactgt atctttgata tttttggagt agacaagcgt gtcgtgctcc
780accatgttga cgaagatttt cttcttgtca ttgagtcgta agagactctg
tatgaactgt 840tcgccagtct ttacggcgag ttctgttagg tcctctattt
gaatctttga ctccatgatc 900gaattatcac atcaatccac ttgctttgaa
gacgtggttg gaacgtcttc tttttccacg 960atgctcctcg tgggtggggg
tccatctttg ggaccactgt cggcagaggc atcttcaacg 1020atggcctttc
ctttatcgca atgatggcat ttgtaggagc caccttcctt ttccactatc
1080ttcacaataa agtgacagat agctgggcaa tggaatccga ggaggtttcc
ggatattacc 1140ctttgttgaa aagtctcaat tgccctttgg tcttctgaga
ctgtatcttt gatatttttg 1200gagtagacaa gcgtgtcgtg ctccaccatg
ttgacgaaga ttttcttctt gtcattgagt 1260cgtaagagac tctgtatgaa
ctgttcgcca gtctttacgg cgagttctgt taggtcctct 1320atttgaatct
ttgactccat gggaattcct gcagcccagc ttgcatgcct gcagtgcagc
1380gtgacccggt cgtgcccctc tctagagata atgagcattg catgtctaag
ttataaaaaa 1440ttaccacata ttttttttgt cacacttgtt tgaagtgcag
tttatctatc tttatacata 1500tatttaaact ttactctacg aataatataa
tctatagtac tacaataata tcagtgtttt 1560agagaatcat ataaatgaac
agttagacat ggtctaaagg acaattgagt attttgacaa 1620caggactcta
cagttttatc tttttagtgt gcatgtgttc tccttttttt ttgcaaatag
1680cttcacctat ataatacttc atccatttta ttagtacatc catttagggt
ttagggttaa 1740tggtttttat agactaattt ttttagtaca tctattttat
tctattttag cctctaaatt 1800aagaaaacta aaactctatt ttagtttttt
tatttaataa tttagatata aaatagaata 1860aaataaagtg actaaaaatt
aaacaaatac cctttaagaa attaaaaaaa ctaaggaaac 1920atttttcttg
tttcgagtag ataatgccag cctgttaaac gccgtcgacg agtctaacgg
1980acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc gaagcagacg
gcacggcatc 2040tctgtcgctg cctctggacc cctctcgaga gttccgctcc
accgttggac ttgctccgct 2100gtcggcatcc agaaattgcg tggcggagcg
gcagacgtga gccggcacgg caggcggcct 2160cctcctcctc tcacggcacc
ggcagctacg ggggattcct ttcccaccgc tccttcgctt 2220tcccttcctc
gcccgccgta ataaatagac accccctcca caccctcttt ccccaacctc
2280gtgttgttcg gagcgcacac acacacaacc agatctcccc caaatccacc
cgtcggcacc 2340tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct
ctctaccttc tctagatcgg 2400cgttccggtc catggttagg gcccggtagt
tctacttctg ttcatgtttg tgttagatcc 2460gtgtttgtgt tagatccgtg
ctgctagcgt tcgtacacgg atgcgacctg tacgtcagac 2520acgttctgat
tgctaacttg ccagtgtttc tctttgggga atcctgggat ggctctagcc
2580gttccgcaga cgggatcgat ttcatgattt tttttgtttc gttgcatagg
gtttggtttg 2640cccttttcct ttatttcaat atatgccgtg cacttgtttg
tcgggtcatc ttttcatgct 2700tttttttgtc ttggttgtga tgatgtggtc
tggttgggcg gtcgttctag atcggagtag 2760aattctgttt caaactacct
ggtggattta ttaattttgg atctgtatgt gtgtgccata 2820catattcata
gttacgaatt gaagatgatg gatggaaata tcgatctagg ataggtatac
2880atgttgatgc gggttttact gatgcatata cagagatgct ttttgttcgc
ttggttgtga 2940tgatgtggtg tggttgggcg gtcgttcatt cgttctagat
cggagtagaa tactgtttca 3000aactacctgg tgtatttatt aattttggaa
ctgtatgtgt gtgtcataca tcttcatagt 3060tacgagttta agatggatgg
aaatatcgat ctaggatagg tatacatgtt gatgtgggtt 3120ttactgatgc
atatacatga tggcatatgc agcatctatt catatgctct aaccttgagt
3180acctatctat tataataaac aagtatgttt tataattatt ttgatcttga
tatacttgga 3240tgatggcata tgcagcagct atatgtggat ttttttagcc
ctgccttcat acgctattta 3300tttgcttggt actgtttctt ttgtcgatgc
tcaccctgtt gtttggtgtt acttctgca 3359791343DNAcauliflower mosaic
virusenhancer(0)...(0)35S ehancer 3X in reverse direction
79atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct
60cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc
120ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca
ctatcttcac 180aataaagtga cagatagctg ggcaatggaa tccgaggagg
tttccggata ttaccctttg 240ttgaaaagtc tcaattgccc tttggtcttc
tgagactgta tctttgatat ttttggagta 300gacaagcgtg tcgtgctcca
ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360gagactctgt
atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg
420aatctttgac tccatggacg gtatcgataa gctagcttga tatcacatca
atccacttgc 480tttgaagacg tggttggaac gtcttctttt tccacgatgc
tcctcgtggg tgggggtcca 540tctttgggac cactgtcggc agaggcatct
tcaacgatgg cctttccttt atcgcaatga 600tggcatttgt aggagccacc
ttccttttcc actatcttca caataaagtg acagatagct 660gggcaatgga
atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc
720ctttggtctt ctgagactgt atctttgata tttttggagt agacaagcgt
gtcgtgctcc 780accatgttga cgaagatttt cttcttgtca ttgagtcgta
agagactctg tatgaactgt 840tcgccagtct ttacggcgag ttctgttagg
tcctctattt gaatctttga ctccatgatc 900gaattatcac atcaatccac
ttgctttgaa gacgtggttg gaacgtcttc tttttccacg 960atgctcctcg
tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg
1020atggcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt
ttccactatc 1080ttcacaataa agtgacagat agctgggcaa tggaatccga
ggaggtttcc ggatattacc 1140ctttgttgaa aagtctcaat tgccctttgg
tcttctgaga ctgtatcttt gatatttttg 1200gagtagacaa gcgtgtcgtg
ctccaccatg ttgacgaaga ttttcttctt gtcattgagt 1260cgtaagagac
tctgtatgaa ctgttcgcca gtctttacgg cgagttctgt taggtcctct
1320atttgaatct ttgactccat ggg 1343802479DNAArtificial Sequence35S
ENH(+)ZmUBI PRO-5UTR-UBI INTRON1 ; 35S enhancer in the forward
direction 80cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa
gactggcgaa 60cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt
caacatggtg 120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata
cagtctcaga agaccaaagg 180gcaattgaga cttttcaaca aagggtaata
tccggaaacc tcctcggatt ccattgccca 240gctatctgtc actttattgt
gaagatagtg gaaaaggaag gtggctccta caaatgccat 300cattgcgata
aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat
360ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac
gtcttcaaag 420caagtggatt gatgtgatat caagcttatc gataccgtcg
acctcgaggg ggggcccagc 480ttgcatgcct gcagtgcagc gtgacccggt
cgtgcccctc tctagagata atgagcattg 540catgtctaag ttataaaaaa
ttaccacata ttttttttgt cacacttgtt tgaagtgcag 600tttatctatc
tttatacata tatttaaact ttactctacg aataatataa tctatagtac
660tacaataata tcagtgtttt agagaatcat ataaatgaac agttagacat
ggtctaaagg 720acaattgagt attttgacaa caggactcta cagttttatc
tttttagtgt gcatgtgttc 780tccttttttt ttgcaaatag cttcacctat
ataatacttc atccatttta ttagtacatc 840catttagggt ttagggttaa
tggtttttat agactaattt ttttagtaca tctattttat 900tctattttag
cctctaaatt aagaaaacta aaactctatt ttagtttttt tatttaataa
960tttagatata aaatagaata aaataaagtg actaaaaatt aaacaaatac
cctttaagaa 1020attaaaaaaa ctaaggaaac atttttcttg tttcgagtag
ataatgccag cctgttaaac 1080gccgtcgacg agtctaacgg acaccaacca
gcgaaccagc agcgtcgcgt cgggccaagc 1140gaagcagacg gcacggcatc
tctgtcgctg cctctggacc cctctcgaga gttccgctcc 1200accgttggac
ttgctccgct gtcggcatcc agaaattgcg tggcggagcg gcagacgtga
1260gccggcacgg caggcggcct cctcctcctc tcacggcacc ggcagctacg
ggggattcct 1320ttcccaccgc tccttcgctt tcccttcctc gcccgccgta
ataaatagac accccctcca 1380caccctcttt ccccaacctc gtgttgttcg
gagcgcacac acacacaacc agatctcccc 1440caaatccacc cgtcggcacc
tccgcttcaa ggtacgccgc tcgtcctccc ccccccccct 1500ctctaccttc
tctagatcgg cgttccggtc catggttagg gcccggtagt tctacttctg
1560ttcatgtttg tgttagatcc gtgtttgtgt tagatccgtg ctgctagcgt
tcgtacacgg 1620atgcgacctg tacgtcagac acgttctgat tgctaacttg
ccagtgtttc tctttgggga 1680atcctgggat ggctctagcc gttccgcaga
cgggatcgat ttcatgattt tttttgtttc 1740gttgcatagg gtttggtttg
cccttttcct ttatttcaat atatgccgtg cacttgtttg 1800tcgggtcatc
ttttcatgct tttttttgtc ttggttgtga tgatgtggtc tggttgggcg
1860gtcgttctag atcggagtag aattctgttt caaactacct ggtggattta
ttaattttgg 1920atctgtatgt gtgtgccata catattcata gttacgaatt
gaagatgatg gatggaaata 1980tcgatctagg ataggtatac atgttgatgc
gggttttact gatgcatata cagagatgct 2040ttttgttcgc ttggttgtga
tgatgtggtg tggttgggcg gtcgttcatt cgttctagat 2100cggagtagaa
tactgtttca aactacctgg tgtatttatt aattttggaa ctgtatgtgt
2160gtgtcataca tcttcatagt tacgagttta agatggatgg aaatatcgat
ctaggatagg 2220tatacatgtt gatgtgggtt ttactgatgc atatacatga
tggcatatgc agcatctatt 2280catatgctct aaccttgagt acctatctat
tataataaac aagtatgttt tataattatt 2340ttgatcttga tatacttgga
tgatggcata tgcagcagct atatgtggat ttttttagcc 2400ctgccttcat
acgctattta tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt
2460gtttggtgtt acttctgca 2479813331DNAArtificial Sequence3X35S ENH
(+)ZmUBI PRO-5UTR-UBI INTRON1; 35S enhancer in the forward
direction 81cccatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa
gactggcgaa 60cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt
caacatggtg 120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata
cagtctcaga agaccaaagg 180gcaattgaga cttttcaaca aagggtaata
tccggaaacc tcctcggatt ccattgccca 240gctatctgtc actttattgt
gaagatagtg gaaaaggaag gtggctccta caaatgccat 300cattgcgata
aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat
360ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac
gtcttcaaag 420caagtggatt gatgtgataa ttcgatcatg gagtcaaaga
ttcaaataga ggacctaaca 480gaactcgccg taaagactgg cgaacagttc
atacagagtc tcttacgact caatgacaag 540aagaaaatct tcgtcaacat
ggtggagcac gacacgcttg tctactccaa aaatatcaaa 600gatacagtct
cagaagacca aagggcaatt gagacttttc aacaaagggt aatatccgga
660aacctcctcg gattccattg cccagctatc tgtcacttta ttgtgaagat
agtggaaaag 720gaaggtggct cctacaaatg ccatcattgc gataaaggaa
aggccatcgt tgaagatgcc 780tctgccgaca gtggtcccaa agatggaccc
ccacccacga ggagcatcgt ggaaaaagaa 840gacgttccaa ccacgtcttc
aaagcaagtg gattgatgtg atatcaagct tatcgatacc 900gccatggagt
caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa
960cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt
caacatggtg 1020gagcacgaca cgcttgtcta ctccaaaaat atcaaagata
cagtctcaga agaccaaagg 1080gcaattgaga cttttcaaca aagggtaata
tccggaaacc tcctcggatt ccattgccca 1140gctatctgtc actttattgt
gaagatagtg gaaaaggaag gtggctccta caaatgccat 1200cattgcgata
aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat
1260ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac
gtcttcaaag 1320caagtggatt gatgtgatgt ctgcagtgca gcgtgacccg
gtcgtgcccc tctctagaga 1380taatgagcat tgcatgtcta agttataaaa
aattaccaca tatttttttt gtcacacttg 1440tttgaagtgc agtttatcta
tctttataca tatatttaaa ctttactcta cgaataatat 1500aatctatagt
actacaataa tatcagtgtt ttagagaatc atataaatga acagttagac
1560atggtctaaa ggacaattga gtattttgac aacaggactc tacagtttta
tctttttagt 1620gtgcatgtgt tctccttttt ttttgcaaat agcttcacct
atataatact tcatccattt 1680tattagtaca tccatttagg gtttagggtt
aatggttttt atagactaat ttttttagta 1740catctatttt attctatttt
agcctctaaa ttaagaaaac taaaactcta ttttagtttt 1800tttatttaat
aatttagata taaaatagaa taaaataaag tgactaaaaa ttaaacaaat
1860accctttaag aaattaaaaa aactaaggaa acatttttct tgtttcgagt
agataatgcc 1920agcctgttaa acgccgtcga cgagtctaac ggacaccaac
cagcgaacca gcagcgtcgc 1980gtcgggccaa gcgaagcaga cggcacggca
tctctgtcgc tgcctctgga cccctctcga 2040gagttccgct ccaccgttgg
acttgctccg ctgtcggcat ccagaaattg cgtggcggag 2100cggcagacgt
gagccggcac ggcaggcggc ctcctcctcc tctcacggca ccggcagcta
2160cgggggattc ctttcccacc gctccttcgc tttcccttcc tcgcccgccg
taataaatag 2220acaccccctc cacaccctct ttccccaacc tcgtgttgtt
cggagcgcac acacacacaa 2280ccagatctcc cccaaatcca cccgtcggca
cctccgcttc aaggtacgcc gctcgtcctc 2340cccccccccc ctctctacct
tctctagatc ggcgttccgg tccatggtta gggcccggta 2400gttctacttc
tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc
2460gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact
tgccagtgtt 2520tctctttggg gaatcctggg atggctctag ccgttccgca
gacgggatcg atttcatgat 2580tttttttgtt tcgttgcata gggtttggtt
tgcccttttc ctttatttca atatatgccg 2640tgcacttgtt tgtcgggtca
tcttttcatg cttttttttg tcttggttgt gatgatgtgg 2700tctggttggg
cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt
2760tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa
ttgaagatga 2820tggatggaaa tatcgatcta ggataggtat acatgttgat
gcgggtttta ctgatgcata 2880tacagagatg ctttttgttc gcttggttgt
gatgatgtgg tgtggttggg cggtcgttca 2940ttcgttctag atcggagtag
aatactgttt caaactacct ggtgtattta ttaattttgg 3000aactgtatgt
gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg
3060atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat
gatggcatat 3120gcagcatcta ttcatatgct ctaaccttga gtacctatct
attataataa acaagtatgt 3180tttataatta ttttgatctt gatatacttg
gatgatggca tatgcagcag ctatatgtgg 3240atttttttag ccctgccttc
atacgctatt tatttgcttg gtactgtttc ttttgtcgat 3300gctcaccctg
ttgtttggtg ttacttctgc a 3331822454DNAArtificial Sequence35S ENH
(-)ZmUBI PRO-5UTR-UBI INTRON1 ; 35S enhancer in the reverse
direction 82atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt
ccacgatgct 60cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt
caacgatggc 120ctttccttta tcgcaatgat ggcatttgta ggagccacct
tccttttcca ctatcttcac 180aataaagtga cagatagctg ggcaatggaa
tccgaggagg tttccggata ttaccctttg 240ttgaaaagtc tcaattgccc
tttggtcttc tgagactgta tctttgatat ttttggagta 300gacaagcgtg
tcgtgctcca ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa
360gagactctgt atgaactgtt cgccagtctt tacggcgagt tctgttaggt
cctctatttg 420aatctttgac tccatgggaa ttcctgcagc ccagcttgca
tgcctgcagt gcagcgtgac 480ccggtcgtgc ccctctctag agataatgag
cattgcatgt ctaagttata aaaaattacc 540acatattttt tttgtcacac
ttgtttgaag tgcagtttat ctatctttat acatatattt 600aaactttact
ctacgaataa tataatctat agtactacaa taatatcagt gttttagaga
660atcatataaa tgaacagtta gacatggtct aaaggacaat tgagtatttt
gacaacagga 720ctctacagtt ttatcttttt agtgtgcatg tgttctcctt
tttttttgca aatagcttca 780cctatataat acttcatcca ttttattagt
acatccattt agggtttagg gttaatggtt 840tttatagact aattttttta
gtacatctat tttattctat tttagcctct aaattaagaa 900aactaaaact
ctattttagt ttttttattt aataatttag atataaaata gaataaaata
960aagtgactaa aaattaaaca aatacccttt aagaaattaa aaaaactaag
gaaacatttt 1020tcttgtttcg agtagataat gccagcctgt taaacgccgt
cgacgagtct aacggacacc 1080aaccagcgaa ccagcagcgt cgcgtcgggc
caagcgaagc agacggcacg gcatctctgt 1140cgctgcctct ggacccctct
cgagagttcc gctccaccgt tggacttgct ccgctgtcgg 1200catccagaaa
ttgcgtggcg gagcggcaga cgtgagccgg cacggcaggc ggcctcctcc
1260tcctctcacg gcaccggcag ctacggggga ttcctttccc accgctcctt
cgctttccct 1320tcctcgcccg ccgtaataaa tagacacccc ctccacaccc
tctttcccca acctcgtgtt 1380gttcggagcg cacacacaca caaccagatc
tcccccaaat ccacccgtcg gcacctccgc 1440ttcaaggtac gccgctcgtc
ctcccccccc cccctctcta ccttctctag atcggcgttc 1500cggtccatgg
ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt
1560tgtgttagat ccgtgctgct agcgttcgta cacggatgcg acctgtacgt
cagacacgtt 1620ctgattgcta acttgccagt gtttctcttt ggggaatcct
gggatggctc tagccgttcc 1680gcagacggga tcgatttcat gatttttttt
gtttcgttgc atagggtttg gtttgccctt 1740ttcctttatt tcaatatatg
ccgtgcactt gtttgtcggg tcatcttttc atgctttttt 1800ttgtcttggt
tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc
1860tgtttcaaac tacctggtgg atttattaat tttggatctg tatgtgtgtg
ccatacatat 1920tcatagttac gaattgaaga tgatggatgg aaatatcgat
ctaggatagg tatacatgtt 1980gatgcgggtt ttactgatgc atatacagag
atgctttttg ttcgcttggt tgtgatgatg 2040tggtgtggtt gggcggtcgt
tcattcgttc tagatcggag tagaatactg tttcaaacta 2100cctggtgtat
ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga
2160gtttaagatg gatggaaata tcgatctagg ataggtatac atgttgatgt
gggttttact 2220gatgcatata catgatggca tatgcagcat ctattcatat
gctctaacct tgagtaccta 2280tctattataa taaacaagta
tgttttataa ttattttgat cttgatatac ttggatgatg 2340gcatatgcag
cagctatatg tggatttttt tagccctgcc ttcatacgct atttatttgc
2400ttggtactgt ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgca
2454833359DNAArtificial Sequence3X35S ENH (-) ZmUBI PRO-5UTR-UBI
INTRON1 ; 35S enhancer in the reverse direction 83atcacatcaa
tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct 60cctcgtgggt
gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc
120ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca
ctatcttcac 180aataaagtga cagatagctg ggcaatggaa tccgaggagg
tttccggata ttaccctttg 240ttgaaaagtc tcaattgccc tttggtcttc
tgagactgta tctttgatat ttttggagta 300gacaagcgtg tcgtgctcca
ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360gagactctgt
atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg
420aatctttgac tccatggacg gtatcgataa gctagcttga tatcacatca
atccacttgc 480tttgaagacg tggttggaac gtcttctttt tccacgatgc
tcctcgtggg tgggggtcca 540tctttgggac cactgtcggc agaggcatct
tcaacgatgg cctttccttt atcgcaatga 600tggcatttgt aggagccacc
ttccttttcc actatcttca caataaagtg acagatagct 660gggcaatgga
atccgaggag gtttccggat attacccttt gttgaaaagt ctcaattgcc
720ctttggtctt ctgagactgt atctttgata tttttggagt agacaagcgt
gtcgtgctcc 780accatgttga cgaagatttt cttcttgtca ttgagtcgta
agagactctg tatgaactgt 840tcgccagtct ttacggcgag ttctgttagg
tcctctattt gaatctttga ctccatgatc 900gaattatcac atcaatccac
ttgctttgaa gacgtggttg gaacgtcttc tttttccacg 960atgctcctcg
tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg
1020atggcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt
ttccactatc 1080ttcacaataa agtgacagat agctgggcaa tggaatccga
ggaggtttcc ggatattacc 1140ctttgttgaa aagtctcaat tgccctttgg
tcttctgaga ctgtatcttt gatatttttg 1200gagtagacaa gcgtgtcgtg
ctccaccatg ttgacgaaga ttttcttctt gtcattgagt 1260cgtaagagac
tctgtatgaa ctgttcgcca gtctttacgg cgagttctgt taggtcctct
1320atttgaatct ttgactccat gggaattcct gcagcccagc ttgcatgcct
gcagtgcagc 1380gtgacccggt cgtgcccctc tctagagata atgagcattg
catgtctaag ttataaaaaa 1440ttaccacata ttttttttgt cacacttgtt
tgaagtgcag tttatctatc tttatacata 1500tatttaaact ttactctacg
aataatataa tctatagtac tacaataata tcagtgtttt 1560agagaatcat
ataaatgaac agttagacat ggtctaaagg acaattgagt attttgacaa
1620caggactcta cagttttatc tttttagtgt gcatgtgttc tccttttttt
ttgcaaatag 1680cttcacctat ataatacttc atccatttta ttagtacatc
catttagggt ttagggttaa 1740tggtttttat agactaattt ttttagtaca
tctattttat tctattttag cctctaaatt 1800aagaaaacta aaactctatt
ttagtttttt tatttaataa tttagatata aaatagaata 1860aaataaagtg
actaaaaatt aaacaaatac cctttaagaa attaaaaaaa ctaaggaaac
1920atttttcttg tttcgagtag ataatgccag cctgttaaac gccgtcgacg
agtctaacgg 1980acaccaacca gcgaaccagc agcgtcgcgt cgggccaagc
gaagcagacg gcacggcatc 2040tctgtcgctg cctctggacc cctctcgaga
gttccgctcc accgttggac ttgctccgct 2100gtcggcatcc agaaattgcg
tggcggagcg gcagacgtga gccggcacgg caggcggcct 2160cctcctcctc
tcacggcacc ggcagctacg ggggattcct ttcccaccgc tccttcgctt
2220tcccttcctc gcccgccgta ataaatagac accccctcca caccctcttt
ccccaacctc 2280gtgttgttcg gagcgcacac acacacaacc agatctcccc
caaatccacc cgtcggcacc 2340tccgcttcaa ggtacgccgc tcgtcctccc
ccccccccct ctctaccttc tctagatcgg 2400cgttccggtc catggttagg
gcccggtagt tctacttctg ttcatgtttg tgttagatcc 2460gtgtttgtgt
tagatccgtg ctgctagcgt tcgtacacgg atgcgacctg tacgtcagac
2520acgttctgat tgctaacttg ccagtgtttc tctttgggga atcctgggat
ggctctagcc 2580gttccgcaga cgggatcgat ttcatgattt tttttgtttc
gttgcatagg gtttggtttg 2640cccttttcct ttatttcaat atatgccgtg
cacttgtttg tcgggtcatc ttttcatgct 2700tttttttgtc ttggttgtga
tgatgtggtc tggttgggcg gtcgttctag atcggagtag 2760aattctgttt
caaactacct ggtggattta ttaattttgg atctgtatgt gtgtgccata
2820catattcata gttacgaatt gaagatgatg gatggaaata tcgatctagg
ataggtatac 2880atgttgatgc gggttttact gatgcatata cagagatgct
ttttgttcgc ttggttgtga 2940tgatgtggtg tggttgggcg gtcgttcatt
cgttctagat cggagtagaa tactgtttca 3000aactacctgg tgtatttatt
aattttggaa ctgtatgtgt gtgtcataca tcttcatagt 3060tacgagttta
agatggatgg aaatatcgat ctaggatagg tatacatgtt gatgtgggtt
3120ttactgatgc atatacatga tggcatatgc agcatctatt catatgctct
aaccttgagt 3180acctatctat tataataaac aagtatgttt tataattatt
ttgatcttga tatacttgga 3240tgatggcata tgcagcagct atatgtggat
ttttttagcc ctgccttcat acgctattta 3300tttgcttggt actgtttctt
ttgtcgatgc tcaccctgtt gtttggtgtt acttctgca 3359841340DNAArtificial
Sequence3X35S enhancer in the forward direction 84cccatggagt
caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60cagttcatac
agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg
120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga
agaccaaagg 180gcaattgaga cttttcaaca aagggtaata tccggaaacc
tcctcggatt ccattgccca 240gctatctgtc actttattgt gaagatagtg
gaaaaggaag gtggctccta caaatgccat 300cattgcgata aaggaaaggc
catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360ggacccccac
ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag
420caagtggatt gatgtgataa ttcgatcatg gagtcaaaga ttcaaataga
ggacctaaca 480gaactcgccg taaagactgg cgaacagttc atacagagtc
tcttacgact caatgacaag 540aagaaaatct tcgtcaacat ggtggagcac
gacacgcttg tctactccaa aaatatcaaa 600gatacagtct cagaagacca
aagggcaatt gagacttttc aacaaagggt aatatccgga 660aacctcctcg
gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag
720gaaggtggct cctacaaatg ccatcattgc gataaaggaa aggccatcgt
tgaagatgcc 780tctgccgaca gtggtcccaa agatggaccc ccacccacga
ggagcatcgt ggaaaaagaa 840gacgttccaa ccacgtcttc aaagcaagtg
gattgatgtg atatcaagct tatcgatacc 900gccatggagt caaagattca
aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 960cagttcatac
agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg
1020gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga
agaccaaagg 1080gcaattgaga cttttcaaca aagggtaata tccggaaacc
tcctcggatt ccattgccca 1140gctatctgtc actttattgt gaagatagtg
gaaaaggaag gtggctccta caaatgccat 1200cattgcgata aaggaaaggc
catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 1260ggacccccac
ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag
1320caagtggatt gatgtgatgt 134085438DNAcauliflower mosaic virus
85atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt ccacgatgct
60cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt caacgatggc
120ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca
ctatcttcac 180aataaagtga cagatagctg ggcaatggaa tccgaggagg
tttccggata ttaccctttg 240ttgaaaagtc tcaattgccc tttggtcttc
tgagactgta tctttgatat ttttggagta 300gacaagcgtg tcgtgctcca
ccatgttgac gaagattttc ttcttgtcat tgagtcgtaa 360gagactctgt
atgaactgtt cgccagtctt tacggcgagt tctgttaggt cctctatttg
420aatctttgac tccatggg 43886657PRTGossypium hirsutum 86Met Ala Pro
His Asn Thr Met Ala Ala Thr Ala Ser Arg Thr Thr Arg 1 5 10 15Phe
Ser Ser Ser Ser Ser His Pro Thr Phe Pro Lys Arg Ile Thr Arg 20 25
30Ser Thr Leu Pro Leu Ser His Gln Thr Leu Thr Lys Pro Asn His Ala
35 40 45Leu Lys Ile Lys Cys Ser Ile Ser Lys Pro Pro Thr Ala Ala Pro
Phe 50 55 60Thr Lys Glu Ala Pro Thr Thr Glu Pro Phe Val Ser Arg Phe
Ala Ser65 70 75 80Gly Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu
Ala Leu Glu Arg 85 90 95Gln Gly Val Thr Thr Val Phe Ala Tyr Pro Gly
Gly Ala Ser Met Glu 100 105 110Ile His Gln Ala Leu Thr Arg Ser Ala
Ala Ile Arg Asn Val Leu Pro 115 120 125Arg His Glu Gln Gly Gly Val
Phe Ala Ala Glu Gly Tyr Ala Arg Ser 130 135 140Ser Gly Leu Pro Gly
Val Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr145 150 155 160Asn Leu
Val Ser Gly Leu Ala Asp Ala Leu Met Asp Ser Val Pro Val 165 170
175Val Ala Ile Thr Gly Gln Val Ala Arg Arg Met Ile Gly Thr Asp Ala
180 185 190Phe Gln Glu Thr Pro Ile Val Glu Val Ser Arg Ser Ile Thr
Lys His 195 200 205Asn Tyr Leu Ile Leu Asp Val Asp Asp Ile Pro Arg
Val Val Ala Glu 210 215 220Ala Phe Phe Val Ala Thr Ser Gly Arg Pro
Gly Pro Val Leu Ile Asp225 230 235 240Ile Pro Lys Asp Val Gln Gln
Gln Leu Ala Val Pro Asn Trp Asp Glu 245 250 255Pro Val Asn Leu Pro
Gly Tyr Leu Ala Arg Leu Pro Arg Pro Pro Ala 260 265 270Glu Ala Gln
Leu Glu His Ile Val Arg Leu Ile Met Glu Ala Gln Lys 275 280 285Pro
Val Leu Tyr Val Gly Gly Gly Ser Phe Asn Ser Ser Ala Glu Leu 290 295
300Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu
Met305 310 315 320Gly Leu Gly Thr Phe Pro Ile Gly Asp Glu Tyr Ser
Leu Gln Met Leu 325 330 335Gly Met His Gly Thr Val Tyr Ala Asn Tyr
Ala Val Asp Asn Ser Asp 340 345 350Leu Leu Leu Ala Phe Gly Val Arg
Phe Asp Asp Arg Val Thr Gly Lys 355 360 365Leu Glu Ala Phe Ala Ser
Arg Ala Lys Ile Val His Ile Asp Ile Asp 370 375 380Ser Ala Glu Ile
Gly Lys Asn Lys Gln Ala His Val Ser Val Cys Ala385 390 395 400Asp
Leu Lys Leu Ala Leu Lys Gly Ile Asn Met Ile Leu Glu Glu Lys 405 410
415Gly Val Glu Gly Lys Phe Asp Leu Gly Gly Trp Arg Glu Glu Ile Asn
420 425 430Val Gln Lys His Lys Phe Pro Leu Gly Tyr Lys Thr Phe Gln
Asp Ala 435 440 445Ile Ser Pro Gln His Ala Ile Glu Val Leu Asp Glu
Leu Thr Asn Gly 450 455 460Asp Ala Ile Val Ser Thr Gly Val Gly Gln
His Gln Met Trp Ala Ala465 470 475 480Gln Phe Tyr Lys Tyr Lys Arg
Pro Arg Gln Trp Leu Thr Ser Gly Gly 485 490 495Leu Gly Ala Met Gly
Phe Gly Leu Pro Ala Ala Ile Gly Ala Ala Val 500 505 510Ala Asn Pro
Gly Ala Val Val Val Asp Ile Asp Gly Asp Gly Ser Phe 515 520 525Ile
Met Asn Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro 530 535
540Val Lys Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Val
Gln545 550 555 560Leu Glu Asp Arg Phe Tyr Lys Ser Asn Arg Ala His
Thr Tyr Leu Gly 565 570 575Asp Pro Ser Ser Glu Ser Glu Ile Phe Pro
Asn Met Leu Lys Phe Ala 580 585 590Asp Ala Cys Gly Ile Pro Ala Ala
Arg Val Thr Lys Lys Glu Glu Leu 595 600 605Arg Ala Ala Ile Gln Arg
Met Leu Asp Thr Pro Gly Pro Tyr Leu Leu 610 615 620Asp Val Ile Val
Pro His Gln Glu His Val Leu Pro Met Ile Pro Ser625 630 635 640Asn
Gly Ser Phe Lys Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Arg 645 650
655Tyr871309DNAGlycine maxpromoter(0)...(0)SAM promoter
87ctagatcaaa ctcacatcca aacataacat ggatatcttc cttaccaatc atactaatta
60ttttgggtta aatattaatc attattttta agatattaat taagaaatta aaagattttt
120taaaaaaatg tataaaatta tattattcat gatttttcat acatttgatt
ttgataataa 180atatattttt tttaatttct taaaaaatgt tgcaagacac
ttattagaca tagtcttgtt 240ctgtttacaa aagcattcat catttaatac
attaaaaaat atttaatact aacagtagaa 300tcttcttgtg agtggtgtgg
gagtaggcaa cctggcattg aaacgagaga aagagagtca 360gaaccagaag
acaaataaaa agtatgcaac aaacaaatca aaatcaaagg gcaaaggctg
420gggttggctc aattggttgc tacattcaat tttcaactca gtcaacggtt
gagattcact 480ctgacttccc caatctaagc cgcggatgca aacggttgaa
tctaacccac aatccaatct 540cgttacttag gggcttttcc gtcattaact
cacccctgcc acccggtttc cctataaatt 600ggaactcaat gctcccctct
aaactcgtat cgcttcagag ttgagaccaa gacacactcg 660ttcatatatc
tctctgctct tctcttctct tctacctctc aaggtacttt tcttctccct
720ctaccaaatc ctagattccg tggttcaatt tcggatcttg cacttctggt
ttgctttgcc 780ttgctttttc ctcaactggg tccatctagg atccatgtga
aactctactc tttctttaat 840atctgcggaa tacgcgttgg actttcagat
ctagtcgaaa tcatttcata attgcctttc 900tttcttttag cttatgagaa
ataaaatcac ttttttttta tttcaaaata aaccttgggc 960cttgtgctga
ctgagatggg gtttggtgat tacagaattt tagcgaattt tgtaattgta
1020cttgtttgtc tgtagttttg ttttgttttc ttgtttctca tacattcctt
aggcttcaat 1080tttattcgag tataggtcac aataggaatt caaactttga
gcaggggaat taatcccttc 1140cttcaaatcc agtttgtttg tatatatgtt
taaaaaatga aacttttgct ttaaattcta 1200ttataacttt ttttatggct
gaaatttttg catgtgtctt tgctctctgt tgtaaattta 1260ctgtttaggt
actaactcta ggcttgttgt gcagtttttg aagtataac 1309881344DNAArtificial
Sequence3X 35S enhancer in forward direction 88cccatggagt
caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 60cagttcatac
agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg
120gagcacgaca cgcttgtcta ctccaaaaat atcaaagata cagtctcaga
agaccaaagg 180gcaattgaga cttttcaaca aagggtaata tccggaaacc
tcctcggatt ccattgccca 240gctatctgtc actttattgt gaagatagtg
gaaaaggaag gtggctccta caaatgccat 300cattgcgata aaggaaaggc
catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 360ggacccccac
ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag
420caagtggatt gatgtgataa ttcgatcatg gagtcaaaga ttcaaataga
ggacctaaca 480gaactcgccg taaagactgg cgaacagttc atacagagtc
tcttacgact caatgacaag 540aagaaaatct tcgtcaacat ggtggagcac
gacacgcttg tctactccaa aaatatcaaa 600gatacagtct cagaagacca
aagggcaatt gagacttttc aacaaagggt aatatccgga 660aacctcctcg
gattccattg cccagctatc tgtcacttta ttgtgaagat agtggaaaag
720gaaggtggct cctacaaatg ccatcattgc gataaaggaa aggccatcgt
tgaagatgcc 780tctgccgaca gtggtcccaa agatggaccc ccacccacga
ggagcatcgt ggaaaaagaa 840gacgttccaa ccacgtcttc aaagcaagtg
gattgatgtg atatcaagct agcttatcga 900taccgtccat ggagtcaaag
attcaaatag aggacctaac agaactcgcc gtaaagactg 960gcgaacagtt
catacagagt ctcttacgac tcaatgacaa gaagaaaatc ttcgtcaaca
1020tggtggagca cgacacgctt gtctactcca aaaatatcaa agatacagtc
tcagaagacc 1080aaagggcaat tgagactttt caacaaaggg taatatccgg
aaacctcctc ggattccatt 1140gcccagctat ctgtcacttt attgtgaaga
tagtggaaaa ggaaggtggc tcctacaaat 1200gccatcattg cgataaagga
aaggccatcg ttgaagatgc ctctgccgac agtggtccca 1260aagatggacc
cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt
1320caaagcaagt ggattgatgt gatg 1344891344DNAArtificial Sequence3X
35S enhancer in reverse direction 89catcacatca atccacttgc
tttgaagacg tggttggaac gtcttctttt tccacgatgc 60tcctcgtggg tgggggtcca
tctttgggac cactgtcggc agaggcatct tcaacgatgg 120cctttccttt
atcgcaatga tggcatttgt aggagccacc ttccttttcc actatcttca
180caataaagtg acagatagct gggcaatgga atccgaggag gtttccggat
attacccttt 240gttgaaaagt ctcaattgcc ctttggtctt ctgagactgt
atctttgata tttttggagt 300agacaagcgt gtcgtgctcc accatgttga
cgaagatttt cttcttgtca ttgagtcgta 360agagactctg tatgaactgt
tcgccagtct ttacggcgag ttctgttagg tcctctattt 420gaatctttga
ctccatggac ggtatcgata agctagcttg atatcacatc aatccacttg
480ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg
gtgggggtcc 540atctttggga ccactgtcgg cagaggcatc ttcaacgatg
gcctttcctt tatcgcaatg 600atggcatttg taggagccac cttccttttc
cactatcttc acaataaagt gacagatagc 660tgggcaatgg aatccgagga
ggtttccgga tattaccctt tgttgaaaag tctcaattgc 720cctttggtct
tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc
780caccatgttg acgaagattt tcttcttgtc attgagtcgt aagagactct
gtatgaactg 840ttcgccagtc tttacggcga gttctgttag gtcctctatt
tgaatctttg actccatgat 900cgaattatca catcaatcca cttgctttga
agacgtggtt ggaacgtctt ctttttccac 960gatgctcctc gtgggtgggg
gtccatcttt gggaccactg tcggcagagg catcttcaac 1020gatggccttt
cctttatcgc aatgatggca tttgtaggag ccaccttcct tttccactat
1080cttcacaata aagtgacaga tagctgggca atggaatccg aggaggtttc
cggatattac 1140cctttgttga aaagtctcaa ttgccctttg gtcttctgag
actgtatctt tgatattttt 1200ggagtagaca agcgtgtcgt gctccaccat
gttgacgaag attttcttct tgtcattgag 1260tcgtaagaga ctctgtatga
actgttcgcc agtctttacg gcgagttctg ttaggtcctc 1320tatttgaatc
tttgactcca tggg 1344
* * * * *
References