U.S. patent application number 11/822984 was filed with the patent office on 2008-09-18 for process of making transgenic mammals that produce exogenous proteins in milk and transgenic mammals produced thereby.
This patent application is currently assigned to Sterrenbeld Biotechnologie North America, Inc.. Invention is credited to Lino Baranao, Carlos Alberto Melo.
Application Number | 20080229438 11/822984 |
Document ID | / |
Family ID | 34427057 |
Filed Date | 2008-09-18 |
United States Patent
Application |
20080229438 |
Kind Code |
A1 |
Melo; Carlos Alberto ; et
al. |
September 18, 2008 |
Process of making transgenic mammals that produce exogenous
proteins in milk and transgenic mammals produced thereby
Abstract
The invention relates to a method of producing a protein of
interest, comprising making a non-human transgenic mammal that
produces said protein in its milk, obtaining said milk from the
non-human transgenic mammal and purifying said protein of interest
from the milk. Transgenic bovine animals were generated, which are
able to produce human growth hormone in mammary glands. The method
involves cloning of a genetic construct encoding hGH gene and beta
casein promoter conveniently in an expression vector. It also
includes transfection procedures into fetal bovine somatic cells,
generally fibroblasts, and the nuclear transfer into enucleated
bovine oocytes, generating thus transgenic embryos. The method also
includes other procedures to generate transgenic embryos for the
further expansion of the transgenic herd, such as the subcloning of
transgenic female bovines, the superovulation of transgenic cows
and their insemination with semen from a non-transgenic or a
transgenic male bovine, and the superovulation of non-transgenic
cows and their insemination with semen from a transgenic male
bovine. Afterwards, transgenic embryos give rise to transgenic
cattle that produce human growth hormone in huge amounts in their
milk, from which the hormone is completely purified and analysed to
fulfill all the requirements for the manufacture of a pure
biopharmaceutical product.
Inventors: |
Melo; Carlos Alberto; (Prov.
de Buenos Aires, AR) ; Baranao; Lino; (Ciudad de
Buenos Aires, AR) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Sterrenbeld Biotechnologie North
America, Inc.
Wilmington
DE
|
Family ID: |
34427057 |
Appl. No.: |
11/822984 |
Filed: |
July 11, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10952376 |
Sep 29, 2004 |
|
|
|
11822984 |
|
|
|
|
60556026 |
Mar 25, 2004 |
|
|
|
60556027 |
Mar 25, 2004 |
|
|
|
60506735 |
Sep 30, 2003 |
|
|
|
60506736 |
Sep 30, 2003 |
|
|
|
Current U.S.
Class: |
800/22 ;
435/320.1; 435/458; 800/21 |
Current CPC
Class: |
C12N 15/8509 20130101;
A01K 2227/101 20130101; A01K 67/0275 20130101; A01K 2267/01
20130101; C07K 14/61 20130101; C12N 15/8771 20130101; A01K 2217/05
20130101; C12N 2830/008 20130101 |
Class at
Publication: |
800/22 ;
435/320.1; 435/458; 800/21 |
International
Class: |
C12N 15/01 20060101
C12N015/01; C12N 15/85 20060101 C12N015/85; C12N 15/88 20060101
C12N015/88 |
Claims
1. A plasmid comprising a gene encoding a protein of interest
operably linked to a beta casein promoter and a .beta. lactamase
gene.
2. The plasmid of claim 1, wherein said protein of interest is a
growth hormone.
3. The plasmid of claim 2, wherein said growth hormone is a
mammalian growth hormone.
4. The plasmid of claim 3, wherein said mammalian growth hormone is
human growth hormone, bovine growth hormone, porcine growth
hormone, ovine growth hormone, caprine growth hormone or rodent
growth hormone.
5. The plasmid of claim 4, wherein said mammalian growth hormone is
human growth hormone.
6. The plasmid of claim 5, which is pR.beta.hGH.
7. The plasmid of claim 6, further comprising a neomycin resistance
gene.
8. The plasmid of claim 7, which is pRNeo.
9. The plasmid of claim 8, further comprising a gene encoding a
green fluorescent protein (GFP) operably linked to a
cytomegalovirus (CMV) promoter.
10. The plasmid of claim 9, which is pRNeoGreen.
11. The plasmid of claim 5, wherein the beta casein promoter
comprises 1230 bp of the full-length beta casein promoter and 49 bp
of the first non-coding exon of the beta casein gene.
12. The plasmid of claim 11, further comprising a neomycin
resistance gene.
13. The plasmid of claim 12, which is pVE.beta.cashGH.
14. A linear fragment of the plasmid according to claim 8, wherein
said .beta. lactamase gene was excised by digestion with ApaLI.
15. A linear fragment of the plasmid according to claim 10, wherein
said .beta. lactamase gene was excised by digestion with ApaLI.
16. A linear fragment of the plasmid according to claim 13, wherein
said .beta. lactamase gene was excised by digestion with ApaLI.
17. A plasmid selected from the group consisting of pR.beta.phGH,
prNeo, and pRNeo Green.
18. (canceled)
19. (canceled)
20. A method for transfection of genetic constructs according to
claim 1 into mammalian cells, comprising the combination of
cationic lipids for liposome utilization.
21-61. (canceled)
62. A method of making a non-human transgenic mammal comprising: a)
superovulating a female non-human mammal which is transgenic for
the production of a recombinant growth hormone in its milk; b)
artificially inseminating said mammal with semen obtained from a
male non-human, non-transgenic mammal, to produce embryos; c)
collecting said embryos; d) implanting said embryos in the uterus
of a receptive mammal; and e) monitoring the pregnancy through the
birth of the transgenic mammal.
63. A method of making a non-human transgenic mammal comprising: a)
superovulating a female non-human mammal which is transgenic for
the production of a recombinant growth hormone in its milk; b)
artificially inseminating said mammal with semen obtained from a
male non-human mammal which is transgenic for the production of
said recombinant growth hormone, to produce embryos; c) collecting
said embryos; d) implanting said embryos in the uterus of a
receptive mammal; and e) monitoring the pregnancy through the birth
of the transgenic mammal.
64. A method of making a non-human transgenic mammal comprising: a)
superovulating a female non-human, non-transgenic mammal; b)
artificially inseminating said mammal with semen obtained from a
male non-human mammal which is transgenic for the production of a
recombinant growth hormone, to produce embryos; c) collecting said
embryos; d) implanting said embryos in the uterus of a receptive
mammal; and e) monitoring the pregnancy through the birth of the
transgenic mammal.
65-77. (canceled)
Description
BACKGROUND OF THE INVENTION
[0001] Protein factors and hormones involved in human health care
have been currently produced by pharmaceutical industry by
extraction or by recombinant technology in the last decades.
Expression of genetic constructs involving the desired genes were
successfully expressed in bacteria, yeast or mammalian cell lines.
However, the use of mammalian cell cultures to obtain complex
proteins, such as those which require a proper glycosylation
pattern, involves high cost procedures.
[0002] Recombinant DNA technology has been used increasingly over
the past decade for the production of commercially important
biological materials. To this end, the DNA sequences encoding a
variety of medically important human proteins have been cloned.
These include insulin, plasminogen activator, alphal-antitrypsin
and coagulation factors VIII and IX. At present, even with the
emergent recombinant DNA techniques, these proteins are usually
purified from blood and tissue, an expensive and time consuming
process which may carry the risk of transmitting infectious agents
such as those causing AIDS and hepatitis.
[0003] Although the expression of DNA sequences in bacteria to
produce the desired medically important protein looks an attractive
proposition, in practice the bacteria often prove unsatisfactory as
hosts because in the bacterial cell foreign proteins are unstable
and are not processed correctly.
[0004] Recognizing this problem, the expression of cloned genes in
mammalian tissue culture has been attempted and has in some
instances proved a viable strategy. However, batch fermentation of
animal cells is an expensive and technically demanding process.
[0005] There is therefore a need for a high yield, low cost process
for the production of biological substances such as correctly
modified eukaryotic polypeptides. The absence of agents that are
infectious to humans would be an advantage in such a process.
[0006] The possibility of obtaining transgenic animals, like
cattle, for a desired gene, with the aim of getting large amounts
of a human protein in milk, has been of great interest to the
industry. Several groups in the literature report their success on
producing human serum albumin, alpha anti-trypsin, and some other
examples in transgenic cows or goats.
[0007] Many experiments have been previously performed in mice or
rats, and transgene expression was always preferred to be confined
to the mammary glands since beta casein or lactalbumin promoters
were employed, which respond only to mammary gland transcription
factors in lactating females.
[0008] The expression of a heterologous protein exclusively in milk
is meant to avoid undesired influence on the host animal health and
provide an easy method for purification.
[0009] People are now devoted to set up several systems to improve
the yield of cell transfection or selection, and choose the source
of homologous fetal somatic cell to improve survival and immunity
conditions of cloned animals.
[0010] On the other hand, there is enormous interest in somatic
cell nuclear transfer, mainly to make possible the propagation of
elite domestic animals and engineering of transgenic animals, for
agricultural and biomedical purposes. Briefly, nuclear transfer
(NT) involves the enucleation of a recipient oocyte, followed by
the transfer of donor cell to the perivitelline space in close
apposition of the recipient cytoplast, and their fusion.
Development is induced artificially by chemical or physical
activation. Production of cloned offspring by somatic cell nuclear
transfer has been successfully attained in sheep (Campbell, K. H.,
et al., Nature 380:64-66 (1996), 1996; Wells, D. N., et al., Biol
Reprod 57:385-393 (1997); Wilmut, I., et al, Nature 385:810-813
(1997)); goat (Baguisi, A., et al., Nat Biotechnol 17:456-461
(1999)) and in cow (Cibelli, J. B., et al., Science 280:1256-1258
(1998); Kato, Y., et al., Science 282:2095-2098 (1998); Wells, D.
N., et al., Reprod Fertil Dev 10:369-378 (1998)).
[0011] There are several factors that influence the results of NT
including the methods of enucleation, fusion, activation and
donor-recipient cell cycle synchrony. High efficiencies in
enucleation of recipient oocytes have been achieved using DNA
specific vital dyes to visualize chromatin (Stice, S. L., and
Keefer, C. L., Biol Reprod 48:715-719 (1993); Westhusin, M. E., et
al., J Reprod Fertil 95:475-480 (1992)). Fusion of the donor cell
with the recipient oocyte depends on the accuracy of cell alignment
in the pulse field, contact of the donor cell with the recipient
oocyte and size of the donor cells (Collas, P., et al., Anal
Biochem 208:1-9 (1993)). Activation of NT reconstructed embryo has
been refined and rates of development to blastocysts are equivalent
to in vitro fertilized oocytes (Liu, L., et al., Mol Reprod Dev
49:298-307 (1998)).
[0012] Successful development of NT embryos has been accomplished
using mature oocytes (Willadsen, S. M., Nature 320:63-65 (1986)),
zygotes (McGrath, J., and Solter, D., Dev Biol N Y 4:37-55 (1985)),
and cleavage-stage embryos (Tsunoda, Y., et al., J Reprod Fertil
96:275-281 (1992)) as recipient cytoplasts; however, this is
dependent on the source of the donor nucleus. Compatibility of the
cell cycle between the recipient cytoplasts and the donor cells is
one of the important factors that influence the development of NT
embryos. Appropriate synchronization is necessary to preserve the
ploidy of the reconstituted embryo.
[0013] The mitotic cell cycle has the following consecutive phases:
pre-replication gap (G.sub.1), synthesis of DNA (S), pre-mitotic
gap (G.sub.2) and mitosis (M). During a single cell cycle, all
genomic DNA replicates once prior to mitosis. An interphase donor
nucleus transferred into an enucleate mature oocyte (metaphase II)
undergoes several morphological changes. After fusion, but prior to
donor nuclear envelope breakdown (NEBD), the chromosome condenses
(PCC). These changes are induced by the activity of
maturation/mitosis/meiosis-promoting factor (MPF) and
mitogen-activated protein kinase (MAPK) (Collas, P., and Robl, J.
M., Biol Reprod 45:455-465 (1991)). MPF and MAPK activities are
found in all meiotic and mitotic cells and are highest at metaphase
and in mammalian oocytes these high levels also induce arrest in
metaphase II. Reduction of MPF and MAPK by fertilization or
activation with calcium ionophore is the signal for completion of
meiosis, second polar body emission, sperm nucleus decondensation
and pronuclear formation.
[0014] The direct effect of NEBD and PCC on donor chromatin is
dependent on the cell cycle of the donor nucleus at the time of the
transfer. Diploid G.sub.0/G.sub.1 nuclei condense to form single
chromatids, but tetraploid G.sub.2 nuclei condense to form double
chromatids. However, nuclei in S phase at the time of the transfer
show a characteristic "pulverized" appearance; PCC produces
extensive DNA damage. Therefore, correct ploidy can be produced by
transferring a G.sub.1 or G.sub.0 nuclei into metaphase II oocytes
at the time of activation or before. A second method is to transfer
nuclei in previously activated oocyte, in S phase, in this case is
possible to use a donor cell in G.sub.1, G.sub.0 or S phase.
Because MPF and MAPK are low; the chromatin decondenses, and
undergoes DNA replication without PCC and NEBD.
[0015] A third synchronization scheme has been reported in mice,
where development of a live offspring was produced by embryo
reconstruction using a G.sub.2 or metaphase donor cell and an
enucleated metaphase 2 oocyte (Cheong, H. T., et al., Biol Reprod
48:958-963 (1993); Kwon, O. Y., and Kono, T., Proc Natl Acad Sci
USA 93:13010-13013 (1996)). The extrusion of a polar body from the
NT reconstructed embryo was reported, resulting in single diploid
embryo and a diploid polar body (Kwon, O. Y., and Kono, T., Proc
Natl Acad Sci USA 93:13010-13013 (1996)). However, there is no
report of polar body formation after NT into enucleated MII oocytes
in cattle, sheep or pigs, suggesting differences between species in
the mechanics controlling formation of intact spindles and
extrusion of polar bodies.
[0016] The cell cycle stages of the donor cell and the recipient
have been suggested to be also important to reprogram the donor
cell nuclei. Increasing the time between donor nuclei transfer and
zygotic transcription may improve nucleus reprogramming. For this
reason, several authors activated the oocyte several hours after
fusion (Cibelli, J. B., et al., Science 280:1256-1258 (1998);
Wakayama, T., et al., Nature 394:369-374 (1998); Wells, D. N., et
al., Biol Reprod 60:996-1005 (1999)). Other reports applied
sequential nuclear transfer (Stice, S. L., and Keefer, C. L., Biol
Reprod 48:715-719 (1993)).
[0017] An unexplored procedure to increase the time of donor
nucleus reprogramming is by nuclear transfer before metaphase II.
After germinal vesicle breakdown (GVBD), all the nuclei events are
regulated by a substantial increase in oocyte cytosolic MPF and
MAPK, which prevent reconstruction of the nuclear envelope and
entrance in the S phase until fertilization or activation.
Therefore, a maturing oocyte may be a universal recipient for
metaphase or G.sub.2 donor cell. Even G.sub.1 or G.sub.0 can be
used as donor cells if activation induces an S phase before cell
division.
[0018] When blastomeres in G.sub.2 or M are used as donor cells,
nuclear reprogramming is possible (Cheong, H. T., et al., Biol
Reprod 48:958-963 (1993); Kwon, O. Y., and Kono, T., Proc Natl Acad
Sci USA 93:13010-13013 (1996); Liu, L., et al., Mol Reprod Dev
47:255-264 (1997)). One explanation is that some factors are
displaced from the chromatin as a result of chromosome
condensation. In fact, for nuclear transfer, NEBD and PCC have been
considered morphological signs of nucleus reprogramming.
Additionally, at the time of fertilization sperm chromatin is
extremely condensed, and its volume is considerably smaller than
that of nuclei of somatic cells, and oocyte has the ability to
remove sperm nuclear protein. Oocyte chromosomes, during
sperm-oocyte fusion, are also condensed. It is possible that
condensed chromatin conformation may have some biological
relevance. Consequently, by mimicking this situation by metaphase
nuclear transfer, a metaphase-enucleated recipient could improve NT
result. However, few researchers have used this approach in
domestic animals and using blastomeres as donor cells (Liu, L., et
al., Mol Reprod Dev 47:255-264 (1997)).
[0019] One goal of this invention is to characterize and refine
existing somatic cell nuclear transfer to a reliable and economical
technique to produce genetically identical calves from adult donor
cells.
SUMMARY OF THE INVENTION
[0020] The invention relates to a non-human transgenic mammal
characterized by the production of unexpectedly high levels of a
recombinant growth hormone in its milk. The recombinant growth
hormone may be, but is not limited to, human growth hormone. The
non-human transgenic mammal may be, but is not limited to, an
animal of bovine species.
[0021] The invention further relates to a plasmid that provides the
expression of a protein of interest in the mammary cells of mammals
in which the expression is regulated by the beta casein promoter.
The protein of interest may be, but is not limited to, human growth
hormone.
[0022] The invention also relates to different methods of making a
non-human transgenic mammal that produce a recombinant growth
hormone in its milk. The recombinant growth hormone may be, but is
not limited to, human growth hormone. The non-human transgenic
mammal may be, but is not limited to, an animal of bovine
species.
[0023] The invention also relates to a method of producing a
protein of interest, comprising making a non-human transgenic
mammal that produces said protein in its milk, obtaining said milk
from the non-human transgenic mammal and purifying said protein of
interest from the milk. The protein of interest may be, but is not
limited to, human growth hormone. The non-human transgenic mammal
may be, but is not limited to, an animal of bovine species.
[0024] The invention also relates to a method of producing and
purifying a recombinant growth hormone from the milk of a
transgenic mammal. The recombinant growth hormone may be, but is
not limited to, human growth hormone. The transgenic mammal may be,
but is not limited to, an animal of bovine species.
BRIEF DESCRIPTION OF THE FIGURES
[0025] FIGS. 1A-1B show the daily milk volume collected from a
transgenic cow obtained by the fusion of an enucleated oocyte and a
fibroblast previously transfected with a plasmid containing the
gene which encodes the human growth hormone (hGH) and a promoter
that directs its expression to mammary cells.
[0026] FIGS. 2A-2C show the bacteria count found in the milk
collected from the same transgenic cow.
[0027] FIGS. 3A-3B show the biological activity of the hGH
contained in the milk of the same transgenic cow.
[0028] FIG. 4A shows the daily mass of hGH produced in the milk of
the same transgenic cow. This magnitude and the daily milk volume
collected from the transgenic cow are plotted together in FIG.
4B.
[0029] FIG. 5A shows the concentration of hGH and insulin-like
growth factor-1 (IGF-1) in the serum of the same transgenic cow,
and the daily mass of hGH produced in the milk of the same
transgenic cow. The concentration of hGH in the transgenic cow's
serum and the daily mass of hGH produced in the milk of the
transgenic cow are plotted together in FIG. 5B. In FIG. 5C, the
time profiles of the transgenic cow's serum concentrations of hGH
and IGF-1 are plotted together.
[0030] FIGS. 6A and 6B show the serum concentration of hGH and
insulin-like growth factor-1 (IGF-1) in two transgenic calves
obtained by subcloning of a cow which is transgenic for the
production of hGH in its milk. In FIGS. 6C and 6D, the time
profiles of serum concentrations of hGH and IGF-1 are plotted
together for each of these transgenic calves.
DETAILED DESCRIPTION OF THE INVENTION
[0031] The invention relates to a non-human transgenic mammal
characterized by the production of unexpectedly high levels of a
recombinant growth hormone in its milk. This mammal may be, but is
not limited to, an animal of bovine species. Other species of
transgenic mammals may be, but are not limited to, porcine species,
ovine species, caprine species, or rodent species.
[0032] The recombinant growth hormone can be, but is not limited
to, human growth hormone. This molecule, also known as
somatotropin, is a protein consisting in 191 amino acids, with a
molecular weight of about 22 kD. It is essential for linear growth
and its applications are well established.
[0033] The invention also relates to a transgenic mammal,
characterized by the fact that the recombinant growth hormone
produced in its milk self-stimulates the animal's mammary glands in
order to produce more milk containing said hormone.
[0034] The invention also relates to a plasmid comprising a gene
encoding a protein of interest operably linked to a beta casein
promoter and a .beta. lactamase gene. This protein of interest can
be, but is not limited to, human growth hormone. This plasmid can
be pR.beta.hGH.
[0035] In a further embodiment, the plasmid additionally includes a
neomycin resistance gene for selection of geneticin resistant
cells. An example of such plasmid is pRNeo.
[0036] In a further embodiment, the plasmid includes the gene
coding for a green fluorescent protein such as GFP, which is under
control of the cytomegalovirus (CMV) promoter. An example of such a
plasmid is pRNeoGreen.
[0037] The invention further relates to a plasmid such us those
described above, which has been linearized by restriction
digestion. In particular, use of restriction enzime ApaLI is
employed and the .beta. lactamase gene is excised.
[0038] The deposit procedure under the Budapest Treaty of the
plasmids mentioned above is under way. The name and address of the
depository are DSMZ--Deutsche Sammlung von Mikroorganismen und
Zellkulturen GmbH, Mascheroder Weg 1b, 38124 Braunschweig, Germany.
The correspondent accession numbers will be provided in due
course.
[0039] The invention further relates to the plasmid constructed on
basis of a Neo resistance gene-containing plasmid, into which a
modified shorter beta casein promoter region was inserted upstream
a hGH coding region, such as pVE.beta.cashGH. A linear fragment may
be obtained from the plasmid pVE.beta.cashGH by excising the beta
lactamase gene.
[0040] The invention further relates to a method for the
transfection of genetic constructs using a combination of cationic
lipids for liposome utilization.
[0041] Methods of selection of neomycin resistant cells in
appropriate media are also described, as are methods of selecting
green fluorescent transgenic cells. These cells are picked
carefully, so as to avoid cell damage.
[0042] The invention also relates to a method of nuclear transfer
of cells arrested in G.sub.0, or at different times of the cell
cycle, into enucleated bovine oocytes.
[0043] The invention relates to a method of transgenic embryo
transfer into hormone stimulated cow uteri.
[0044] According to the invention, a method of determining animal
health parameters is disclosed. Analyses are performed on both the
animal's serum and milk in order to determine such parameters.
[0045] The invention further relates to a method of making a
non-human transgenic mammal comprising obtaining a gene which
encodes a growth hormone, cloning the gene into a plasmid whereby
the gene is operably linked to a promoter that will direct the
expression of the gene in mammary cells, resulting in an expression
plasmid, transfecting somatic cells with the expression plasmid so
that the plasmid is incorporated into the genome of the cells,
resulting in transgenic somatic cells, enucleating a mature oocyte,
resulting in an enucleated oocyte, fusing one transgenic somatic
cell with the enucleated oocyte resulting in a monocell embryo,
implanting the embryo in the uterus of a receptive mammal, and
monitoring the pregnancy through the birth of the transgenic
mammal.
[0046] The invention further relates to a method of making a
non-human transgenic mammal comprising extracting somatic cells
from a female mammal which is transgenic for the production of a
recombinant growth hormone in its milk, optionally fibroblasts,
enucleating a mature oocyte, resulting in an enucleated oocyte,
fusing one transgenic somatic cell with the enucleated oocyte
resulting in a monocell embryo, implanting the embryo in the uterus
of a receptive mammal, and monitoring the pregnancy through the
birth of the transgenic mammal.
[0047] The invention further relates to a method of making a
non-human transgenic mammal comprising superovulating a female
non-human mammal which is transgenic for the production of a
recombinant growth hormone in its milk, artificially inseminating
the mammal with semen obtained from a male non-human,
non-transgenic mammal, to produce embryos, collecting the embryos,
implanting the embryos in the uterus of a receptive mammal, and
monitoring the pregnancy through the birth of the transgenic
mammal.
[0048] The invention further relates to a method of making a
non-human transgenic mammal comprising superovulating a female
non-human mammal which is transgenic for the production of a
recombinant growth hormone in its milk, artificially inseminating
the mammal with semen obtained from a male non-human mammal which
is transgenic for the production of said recombinant growth
hormone, to produce embryos, collecting the embryos, implanting the
embryos in the uterus of a receptive mammal, and monitoring the
pregnancy through the birth of the transgenic mammal.
[0049] The invention further relates to a method of making a
non-human transgenic mammal comprising superovulating a female
non-human, non-transgenic mammal, artificially inseminating the
mammal with semen obtained from a male non-human mammal which is
transgenic for the production of a recombinant growth hormone, to
produce embryos, collecting the embryos, implanting the embryos in
the uterus of a receptive mammal, and monitoring the pregnancy
through the birth of the transgenic mammal.
[0050] The recombinant growth hormone may be, but is not limited
to, human growth hormone. The non-human transgenic mammal may be,
but is not limited to, an animal of bovine species.
[0051] The invention further relates to a method to produce a
protein comprising making a non-human transgenic mammal that
produces a protein of interest in unexpectedly high yields in its
milk, obtaining the milk from the non-human transgenic mammal, and
purifying the protein of interest from the milk.
[0052] The invention also relates to a method to produce a protein
of interest in a non-human transgenic mammal made by a process
comprising obtaining a gene which encodes said protein of interest,
cloning the gene into a plasmid whereby the gene is operably linked
to a promoter that will direct the expression of the gene in
mammary cells, resulting in an expression plasmid, transfecting
somatic cells, optionally fibroblasts, with the plasmid so that the
plasmid is incorporated into the genome of said somatic cells,
resulting in transgenic somatic cells, enucleating a mature oocyte,
resulting in an enucleated oocyte, fusing one transgenic somatic
cell with the enucleated oocyte resulting in a monocell embryo,
implanting the embryo in the uterus of a receptive mammal, and
monitoring the pregnancy through the birth of the transgenic
mammal.
[0053] The invention further also relates to a method to produce a
protein of interest in a non-human transgenic mammal made by a
process comprising extracting somatic cells from a female mammal
which is transgenic for the production of said protein of interest
in its milk, optionally fibroblasts, enucleating a mature oocyte,
resulting in an enucleated oocyte, fusing one transgenic somatic
cell with the enucleated oocyte resulting in a monocell embryo,
implanting the embryo in the uterus of a receptive mammal, and
monitoring the pregnancy through the birth of the transgenic
mammal
[0054] The invention also relates to a method to produce a protein
of interest in a non-human transgenic mammal made by a process
comprising superovulating a female non-human mammal which is
transgenic for the production of said protein of interest in its
milk, artificially inseminating the mammal with semen obtained from
a male non-human, non-transgenic mammal, to produce embryos,
collecting the embryos, implanting the embryos in the uterus of a
receptive mammal, and monitoring the pregnancy through the birth of
the transgenic mammal.
[0055] The invention also relates to a method to produce a protein
of interest in a non-human transgenic mammal made by a process
comprising superovulating a female non-human mammal which is
transgenic for the production of said protein of interest in its
milk, artificially inseminating the mammal with semen obtained from
a male non-human mammal which is transgenic for the production of
said protein of interest, to produce embryos, collecting the
embryos, implanting the embryos in the uterus of a receptive
mammal, and monitoring the pregnancy through the birth of the
transgenic mammal.
[0056] The invention also relates to a method to produce a protein
of interest in a non-human transgenic mammal made by a process
comprising superovulating a female non-human, non-transgenic
mammal, artificially inseminating the mammal with semen obtained
from a male non-human mammal which is transgenic for the production
of said protein of interest, to produce embryos, collecting the
embryos, implanting the embryos in the uterus of a receptive
mammal, and monitoring the pregnancy through the birth of the
transgenic mammal.
[0057] The transgenic mammals characterized by the production of
unexpectedly high levels of a protein of interest in their milk,
can be, but are not limited to, animals of bovine species. Other
species of transgenic mammals may be, but are not limited to,
porcine species, ovine species, caprine species or rodent species.
The protein of interest can be, but is not limited to, human growth
hormone.
[0058] The invention further relates to a non-human transgenic
mammal of bovine species that produces recombinant human growth
hormone in its milk, whose genome comprises an integrated plasmid,
said plasmid comprising the human growth hormone gene and a beta
casein promoter that directs expression of said gene in mammary
cells of the mammal.
[0059] The invention further relates to a transgenic mammal that
produces hGH in unexpectedly high levels, yet does not show the
physical growth expected with such a high level of hGH production.
Since transgenic bovines are affected by the presence of human
growth hormones, it would be expected that the animals would grow
beyond non-transgenic growth rates, and to suffer from conditions
such as diabetes mellitus, hypertension, increased risk of
cardiovascular disease and enlargement of body organs, including
the liver, spleen, kidneys and heart. Such high levels of hGH
should render the animal, theoretically, non-viable. However, this
is not the case. A mammal, such as a cow, with alarmingly high
levels of a foreign hormone in its blood, but which is perfectly
healthy and yields an outstanding productivity of a recombinant
protein constitutes an unexpected and innovative contribution.
[0060] The recombinant human growth hormone of the invention is
produced at unexpectedly high levels. The level of human growth
hormone produced is greater than about 1.0 g/L milk. The level of
hGH can be greater than about 2.0 g/L milk. The level of hGH
produced can also be greater than about 3.0 g/L milk. In another
embodiment, the level of hGH produced can be greater than about 4.0
g/L milk. In yet another embodiment, the level of hGH produced can
be greater than about 5.0 g/L milk. In a further embodiment, the
level of hGH produced can be greater than about 6.0 g/L milk. In
yet a further embodiment, the level of hGH produced is about 1.0
g/L milk to about 7.0 g/L milk. In a further embodiment, the level
of hGH produced is about 2.0 g/L milk to about 6.0 g/L milk. In yet
another embodiment, the level of hGH produced is about 2.0 to about
5.0 g/L milk.
[0061] Additionally, the invention relates to a method of purifying
a recombinant growth hormone from the milk of a transgenic mammal,
as well as assays of said hormone. The purification methods can
include chromatography and concentration steps. Different types of
chromatography can be employed and include ion exchange
chromatography, reverse phase chromatography, molecular exclusion
chromatography or affinity chromatography. The ion exchange
chromatography can be anion exchange chromatography. The affinity
chromatography can be immunoaffinity chromatography. Further,
multiple chromatography steps may be performed.
[0062] The invention further relates to a method of purifying a
recombinant growth hormone from milk of a non-human transgenic
mammal that produces a recombinant growth hormone comprising
clarifying the milk of a non-human transgenic mammal, resulting in
a clarified milk, and subjecting the clarified milk to
chromatography, resulting in purified recombinant growth
hormone.
[0063] The invention further relates to a method of purifying a
recombinant growth hormone from milk of a non-human transgenic
mammal that produces a recombinant growth hormone comprising
clarifying the milk of a non-human transgenic mammal, resulting in
a clarified milk, subjecting the clarified milk to expanded-bed
anion exchange chromatography, resulting in an anion exchange
chromatographed material, subjecting the anion exchange
chromatographed material to reverse phase chromatography, resulting
in a reverse phase chromatographed material, subjecting the reverse
phase chromatographed material to anion exchange chromatography,
resulting in an anion exchange chromatographed material, subjecting
the anionic exchange chromatographed material to molecular
exclusion chromatography, resulting in a molecular exclusion
chromatographed material, concentrating the molecular exclusion
chromatographed material, resulting in a concentrated material, and
subjecting the concentrated material to molecular exclusion
chromatography, resulting in pure recombinant growth hormone.
[0064] The invention also relates to a method of purifying a
recombinant growth hormone from milk of a non-human transgenic
mammal that produces a recombinant growth hormone comprising
clarifying milk obtained from a transgenic mammal, resulting
clarified milk, subjecting the clarified milk to immunoaffinity
chromatography, resulting in an immunoaffinity chromatographed
material, subjecting the immunoaffinity chromatographed material to
reverse phase chromatography, resulting in a reverse phase
chromatographed material, subjecting the reverse phase
chromatographed material to anionic exchange chromatography,
resulting in an anionic exchange chromatographed material,
subjecting the anionic exchange chromatographed material to
molecular exclusion chromatography, resulting in a molecular
exclusion chromatographed material, subjecting the molecular
exclusion chromatographed material to concentration, resulting in a
concentrated material, and subjecting the concentrated material to
molecular exclusion chromatography, resulting in pure recombinant
growth hormone.
[0065] The recombinant growth hormone of the purification methods
described above may be, but is not limited to, human growth
hormone. The transgenic mammal may be, but is not limited to, a
mammal of bovine species.
[0066] The following examples are illustrative, but not limiting,
of the method and compositions of the present invention. Other
suitable modifications and adaptations of the variety of conditions
and parameters normally encountered in enzymatic production of
chemicals and protein purification procedures which are obvious to
those skilled in the art are within the spirit and scope of the
invention.
EXAMPLE 1
Construction of Expression Plasmids
[0067] We generated a construct bearing a large portion of the
bovine beta casein gene promoter, including a short fragment of the
5' non-coding beta casein gene region, fused to the coding sequence
of the human growth hormone gene. The beta casein region employed
in different constructs was decreased from 3.8 kbp to about 1.3
kbp. The hGH gene encompasses about 2 to 2.2 kbp depending on
whether the intrinsic polyA signal is included.
[0068] The expression cassette was accommodated in the polylinker
of a usual cloning vector of the pUC or pBS type.
[0069] This promoter ensures the tissue specific and
developmentally regulated expression of genes under its control,
like beta casein, and the heterologous hGH in this case.
[0070] The most representative plasmid is pR.beta.hGH, which
carries the full-length bovine beta casein promoter, fused to the
coding sequence of the human growth hormone gene.
[0071] Other constructs disclosed are mainly derived from the
original one, as depicted, to improve transfected cell selection or
DNA integration efficiency into the bovine cell genome.
[0072] In the first period, co-transfection with a geneticin
resistance gene-containing plasmid was performed to help selection,
but next, other constructs were used, bearing NPT gene for neomycin
resistance in the same vector containing the hGH expression
cassette. An example of such plasmid is pRNeo.
[0073] Another plasmid for constitutive expression of green
fluorescent protein was obtained, which includes the CMV promoter,
an enhancer of vegetal origin (alfalfa), and the green fluorescent
protein gene from the jellyfish A. victoria. An example of such
plasmid is pRNeoGreen.
[0074] Besides, another plasmid was generated. This was constructed
on basis of a Neo resistance gene-containing plasmid, into which a
modified shorter beta casein promoter region was inserted upstream
a hGH coding region. This plasmid is pVE.beta.cashGH.
[0075] Other constructs were generated in which the .beta.
lactamase region was excised by ApaLI restriction and the linear
fragment containing the entire expression cassette was purified
after agarose gel electrophoresis, and gel extraction.
[0076] Constructs were analyzed by restriction enzymes and DNA
sequencing, and their ability to conduct hGH expression was
previously tested in a mammary gland cell line by fluorescent
antibody recognition.
[0077] The preparation of the plasmid pVE.beta.cashGH will be
described in detail as an example of this part involving genetic
constructs.
Preparation of pVE.beta.cashGH
[0078] The aim of this construct is to provide the minimal
extension of beta casein promoter region to direct specific
regulated transcription of the hGH gene fused immediately
downstream, along with its polyA signal in a host organism.
[0079] The use of pVEX as the original vector permits the use of
neomycin resistance gene regulated by a tk promoter already present
in this plasmid. The early SV40 promoter comprising 554 bp was
eliminated by restriction with StuI and NdeI, and the last site
filled in with Klenow, and self-ligation of the resulting
vector.
[0080] Beta casein short promoter was obtained after PCR
amplification of a 1.3 kbp fragment from the 3.8 kbp original gene
promoter region, by using the following oligos as primers:
TABLE-US-00001 PB1 5' TCTACTCGAGGATCATCTATCTGTCCCAAAG (SEQ ID NO:
1) and PB2 5' CTAGGATCCAATGATCTGATTTTGTGG (SEQ ID NO: 2)
This fragment encompasses 1230 bp of the canonical promoter plus 49
bp of the first non coding exon of the beta casein gene.
[0081] The hGH gene fragment was obtained by PCR techniques on the
original bovine genomic hGH clone using the following oligos as
primers:
TABLE-US-00002 PB4 5' CTAGGATCCATGGCTACAGGTAAGCGCC (SEQ ID NO: 3)
and GHTE 5' ATGCTGTGTCTGGACGTCCT (SEQ ID NO: 4)
The beta casein promoter fragment was blunted with Klenow enzyme
and inserted into the BamHI filled-in site of pVEX. After selecting
recombinant clones, we chose a certain direction appropriate to use
the unique HindIII site located downstream in pVEX to insert the
hGH coding region.
[0082] To this aim, the hGH fragment was also blunted and the
plasmid HindIII site was filled in as well. Clones were selected
which contain beta casein promoter and hGH properly fused to
express hGH only under the control of this promoter.
[0083] The size of this plasmid is about 8.5 kbp.
Transfection of Somatic Cells
[0084] The plasmids pR.beta.hGH (along with another plasmid with
the geneticin resistance gene), pRNeo, pRNeoGreen, or
pVE.beta.cashGH were then used for transfecting a primary culture
of somatic cells, using calcium phosphate or liposome method. Fetal
calf fibroblasts were generally employed to be transfected.
[0085] The transfected cells were selected adding geneticin to the
culture. After a period of 2 to 8 weeks, the cells that were
resistant to geneticin were suitable for being used as donor cells
to obtain transgenic clones. Transfected selected cells were
analyzed by PCR to contain the expression cassette, to ensure the
appropriate nuclei transfer to generate transgenic embryos.
EXAMPLE 2
[0086] Oocyte Enucleation and Metaphase Nuclear Transfer in Mature
Enucleated Oocytes
Collection and In vitro Maturation of Bovine Oocytes
[0087] Bovine oocytes were aspirated from slaughterhouse ovaries
and matured in TCM-199+5% FCS at 39.degree. C. for 24 hs. The
maturation medium was equilibrated with CO.sub.2 for at least 2
hours prior to use. Mature oocytes were denuded by vortexing for 2
minutes in warm TL-HEPES with 1 mg/ml bovine testis
hyaluronidase.
Nuclear Transfer with Cumulus Cells
Enucleation
[0088] Oocytes were mechanically enucleated using a Narishige
hydraulic micromanipulators and Nikon Diaphot microscopy.
Enucleation was performed with 20 .mu.m beveled and sharpened
pipettes. Oocytes were previously stained with 5 .mu.g/ml
bisbenzimidine (Hoechst 33342.sup.1) dye for 20 minutes. Metaphases
were enucleated by visualization of the stained chromosomes under
ultraviolet light. Metaphase chromosomes were assessed after
aspiration inside the pipette. A transgenic somatic cell was
transferred into the perivitelline space and tightly opposed to the
enucleated oocyte. .sup.1Sigma Chemical Co., St. Louis, Mo.,
USA.
Fusion
[0089] A transgenic somatic cell and an enucleated oocyte were
manually aligned in the fusion chamber so that the membranes to be
fused were parallel to the electrodes. This was done using a glass
embryo-handling pipette.
Fusion by Electrical Means
[0090] Fusion was performed using one electrical pulse of 180
volts/cm for 15 .mu.s (BTX Electro Cell Manipulator 200).sup.2 and
monitored with a BTX Optimizer-Graphic Pulse Analyzer. The chamber
for pulsing embryos consisted of two 0.5 mm stainless steel wire
electrodes mounted 0.5 mm apart on glass microscope slide.
Presumptive zygotes were monitored for fusion, lysis, and
fragmentation. .sup.2BTX Inc., San Diego, Calif., USA.
Assessment of Developmental Competence
[0091] Zygotes were evaluated at 48 hours after fertilization for
cleavage and after 7 to 9 days for development to morulae or
blastocysts.
EXAMPLE 3
[0092] Cell and Embryo Culture
[0093] Different donor cells, culture systems and oocyte recipient
treatments were tested in an experiment aimed at simplifying
procedures and increasing embryo survival rate in a bovine cloning
program. Three culture systems for reconstructed embryos were used
when adult fibroblasts were used as donor cells: TCM-199+5% FCS,
Menezo+5% FCS (both with VERO cells as co-culture) and SOF without
co-culture but with lower O.sub.2 concentration. SOF medium was
also used to culture reconstructed embryos when donor cell were
genetically and non-genetically modified fetal fibroblasts.
Finally, when genetically modified fetal fibroblasts were used as
donor cells, recipient oocytes were previously treated with
roscovitine (R), to suspend meiosis and optimize recipient
usability. Oocytes were aspirated from slaughterhouse ovaries and
matured in TCM-199+5% FCS at 39.degree. C. for 24 hours. For R
treated group, oocytes were incubated with 25 .mu.M R in TCM 199+5%
FCS for 24 hours at 39.degree. C. prior to the maturation. Mature
oocytes were denuded by vortexing for 3 minutes in TL HEPES with 1
mg/ml bovine testis hyaluronidase. Metaphases were assessed and
oocytes were enucleated by visualization with Hoechst 33342 (5
.mu.g/ml) under UV light (<6 seconds). Adult fibroblasts from an
Angus bull and fetal fibroblasts from a 45-day old Jersey female
fetus were used as donor cells. Transfection with constructs
containing neomycin resistance gene was performed using liposomes.
After selection with geneticin for 10-15 days, donor cells at
G.sub.0/G1 stages were fused to enucleated oocytes by an electrical
pulse. After 3 hours, activation was induced by incubation in
TL-HEPES with 5 .mu.M ionomycin for 4 min and 2 mM 6-DMAP for 3
hours. The oocytes were then washed with TL-HEPES and co-cultured
in either TCM-199+5% FCS+10 g/l albumin or Menezo+2% FCS both with
VERO cells, or in SOF medium and atmosphere of 5% CO.sub.2+5%
O.sub.2+90% N.sub.2. Generally, two blastocysts were transferred
non-surgically per recipient cow, and pregnancies at 30-35 days
determined by ultrasonography. Cleavage (48 hours), development to
blastocysts (days 7 to 9) were recorded and analyzed by Chi-square.
Cleavage rates and development to blastocysts were higher when
embryos were cultured in SOF. However, no differences were observed
in pregnancy rates due to different culture conditions or source of
donor cells. Suspension of meiotic maturation for 24 hours did not
compromise the developmental competence of recipient oocytes.
Therefore, treatment with roscovitine might be used to increase the
availability of oocytes for NT procedures. See Table 1 below.
TABLE-US-00003 TABLE 1 implanted Treatment n Cleavage (%)
Blastocyst (%) recipient Preg. (%) Adult fibroblast 294 156
(53.9).sup.a 22 (7.5).sup.a 13 5 (38.4) TC199 + VERO Adult
fibroblast 324 236 (72.3).sup.bc 29 (8.9).sup.a 17 5 (29.4) Menezo
+ VERO Adult fibroblast 108 81 (75.0).sup.bc 24 (22.2).sup.b 11 5
(45.4) SOF Fetal fibroblast 197 122 (61.9).sup.ab 33 (16.7).sup.ab
16 5 (31.6) SOF Transfected fetal 646 476 (73.7).sup.bc 128
(19.8).sup.b 56 25 (44.6) fibroblast SOF Transfected fetal 228 191
(83.7).sup.c 51 (22.3).sup.b 30 16 (53.3) fibroblast SOF-R Total
1797 1262 (70.2) 287 (15.9) 143 61 (44.5)
Percentages within columns with different superscripts are
different (P<0.05)
[0094] The implanted cows are allowed to normally pass the
pregnancy up to a natural delivery. Eventually a chirurgic approach
(Caesarea) could be used for delivery. The newborns are fed with Ig
rich colostrum during the first 48 hours, and then synthetic, later
natural (all of them free of animal origin compounds) foods are
used.
EXAMPLE 4
Tests Performed on Transgenic Calves and the Recombinant Protein
Produced
[0095] In the current example, we present a full description of the
tests performed on a particular transgenic calf, which was obtained
as a result of the procedure described in Examples 1 to 3, and on
the recombinant protein produced by it. Nonetheless, it should
remain clear that the same set of assays is performed on animals
that are born as a consequence of other methods for obtaining
transgenic calves, such as those that will be described in Examples
5 and 6 below.
[0096] It was proved by means of PCR reactions performed on DNA
purified from the calf's white blood cells, using DNA from
non-transgenic jersey calves as the negative control, that bovine
beta casein promoter and the hGH encoding gene are included in the
transgenic calf cells genome. They can be found together as a
unique DNA fragment different to the homologue beta casein gene of
the animal.
[0097] It was corroborated, by using a Pharmacia automatic
sequencer, that the inserted gene sequence corresponds 100% to the
hGH encoding gene. It includes the introns, secretion signal and
terminator. The bovine beta casein promoter that controls that same
hGH gene expression in our calf was sequenced, too. All those
elements coincide exactly with the expected theoretical sequence
from the genetic construct used to transform the cells out of which
the clones were generated.
[0098] Once known the exactitude of the genetic phase of the
experiment, we passed to prove the recombinant protein produced is
the expected one and coincides in every one of its physical and
chemical characteristics with the natural hGH.
[0099] For this purpose, we had to obtain milk from the calf, since
the beta casein promoter allows the expression of the recombinant
protein only in the mammary glands, when the animal is at its milk
producing time.
[0100] The transgenic calf was then induced by a hormone treatment
to produce milk by the time it completed her tenth month. By that
time the calf weighed 240 kg (approximately 530 lbs).
[0101] The first phase of said treatment involved the combined
administration, by subcutaneous route, of estrogens (estradiol
benzoate, Histeren.RTM., Instituto Rosenbusch) and progestagens
(medroxyprogesterone acetate, Pronal.RTM., Aton), comprising 5
successive applications of each drug, in a dose of 0.1 mg/kg and
0.25 mg/kg, respectively, every 48 hours (i.e., on days 1, 3, 5, 7
and 9, assuming that the treatment commences on day 1).
[0102] The second phase comprised the administration, by
subcutaneous route, of dexamethasone (Decadron, Sidus) and oxytocin
(Orasthin.RTM., Hoechst Marion Roussel); a total amount of 20 mg of
the former being injected over a period comprising days 18 to 20 (a
third of said total mass each day), and 3 applications of 50 IU of
the latter, on days 21 to 23.
[0103] The information above is summarized in Table 2:
TABLE-US-00004 TABLE 2 Day 1 2 3 4 5 6 7 8 9 10 (. . .) 17 18 19 20
21 22 23 Histeren (mg/kg) 0.10 0.10 0.10 0.10 0.10 Pronal (mg/kg)
0.25 0.25 0.25 0.25 0.25 Decadron (mg) 6.66* 6.66* 6.66* Orasthin
(IU) 50 50 50 *Approximately a third of the total mass (20 mg) was
administered each day
[0104] As expected, the cow commenced producing colostrum the day
after the treatment had finished, and then, progressively, the
quality of the produced fluid turned to milk. The collected fluid
was properly stored and thoroughly analyzed.
[0105] Several tests, whose results are shown in FIGS. 1-4, were
performed on the colostrum and milk (for simplicity, both colostrum
and milk will be hereinafter referred to as "milk", except when a
distinction should be made). First, the volume of the collected
milk was measured. The initial milk productivity (first five
lactating days) was approximately 1,650 mL/day. During the first
productive month, two manual milkings per day were performed, one
in the morning and one in the afternoon (the contribution of each
udder to the final volume can be noticed); whereas from the second
month forth, as the production of milk started to increase, three
milkings per day were performed (in the morning, at noon, and in
the afternoon). The daily volumes increased in a more or less
continuous way, until reaching close to the 10,000 mL three months
after the first milking. Detailed information regarding this topic
(FIG. 1A) can be visualized in the curve of daily milk volume vs.
date (FIG. 1B).
[0106] In parallel with the measurements of milk volume,
microbiological assays were performed on the milk, whose results
(FIG. 2A) are shown in the corresponding plots of CFU
(Colony-forming units) per ml vs date and (FIGS. 2B-2C).
[0107] Biological activity (of hGH) was also assessed by a
biological activity assay in vitro in NB2 cells culture (FIGS.
3A-3B). It was proved that the biological activity of the
recombinant hGH produced in the heifer's milk is within the
method's error rank, at the normal values for human natural hGH.
Moreover, the obtained milk was studied by Western blot, in which a
main band, corresponding to intact hGH, was detected. Additional
minor bands corresponding to cleaved variants and aggregates were
also found, as expected in these productive systems.
[0108] With the information regarding the biological activity and
the daily volumes, it was possible to calculate the daily
production of hGH using Equation 1, where mhGH is the daily
produced mass of hGH in milligrams; BA, the biological activity in
International Units; SA, the specific activity of hGH (3 IU/mg);
and V, the daily volume of collected milk. The data is shown in
FIG. 4A. A plot of the daily mass of hGH is shown in FIG. 4B. In
order to establish a visual correlation between the daily mass of
hGH and daily volume of milk, the latter was also plotted in FIG.
4B.
m hGH = BA SA .times. V ( Eq . 1 ) ##EQU00001##
[0109] As it can be observed from this information, the daily mass
of hGH in milk and the daily volume of milk tend to augment as the
cow develops (the former in a greater proportion, though), which
constitutes an upward trend in the recombinant hormone productivity
(grams of hGH per milk liter). It can be noticed that this
productivity passed from around 2 g of hGH per liter (first
milking), when the product was colostrum, to an average amount of 5
g hGH per milk liter from the second lactating month forth. Thus,
an unexpectedly high yield of human growth hormone was obtained as
productivity increased, in a way more or less continuous as the
fluid quality turned from colostrum to milk.
[0110] Although at present the mass of hGH produced per day is
outstanding indeed, it should be noted that, as the cow is not
fully grown yet, the upward trend in mass of recombinant protein
produced per day should continue in the future, until a maximum is
reached.
[0111] In parallel with the tests performed on milk, a different
set of assays were carried out on the cow's serum, whose results
are shown in FIGS. 5A-5C. First, measurements of the concentration
of hGH in the cow's serum were performed. The results (FIG. 5A) are
plotted in a graphic together with the daily mass of hGH in milk,
to allow a comparison of both magnitudes (FIG. 5B).
[0112] The reference range for GH in serum (in humans) is 0.06-5
ng/ml. Assuming a hypothetical similar range for bovines, it can be
noticed that, except for the beginning, the whole curve of hGH in
the transgenic cow's serum versus date lies well over the upper
limit of said range. This fact notwithstanding, it must be taken
into account that, although hGH and the corresponding bovine
hormone (bGH) are very similar regarding their amino acid sequence
and 3D-structure, the former, although fully functional, is not
fully active in cattle.
[0113] Therefore, in order to assess the potential risk to the
cow's health due to these high levels of hGH in its serum,
measurements of serum concentration of IGF-1 (Insulin-like Growth
Factor 1, also known as Somatomedin C) were performed in parallel
(FIG. 5A). Growth hormone performs its functions primarily through
IGF-1, which is made in the liver. Because IGF-1 mediates many of
the in vivo cell division and metabolic effects of growth hormone,
IGF-1 assessment is a valuable diagnostic tool for the indirect
evaluation of suspected growth hormone disorders. Thus, IGF-1
represents a dependable indicator of bioavailable growth hormone.
The results of these analyses are shown in FIG. 5C, together with
the ones corresponding to hGH, to permit the simultaneous
visualization of both magnitudes.
[0114] Moreover, IGF-1 and hGH were measured in the serum of a
group of non-transgenic cows in order to have a control group and
thus to establish a comparison with the data corresponding to the
transgenic cow. The averages of the measurements of both proteins
for the non-transgenic group and the transgenic cow are displayed
in Table 3 below.
TABLE-US-00005 TABLE 3 Averages [IGF-1] in Serum [hGH] in serum
Non-transgenic 123.40 0.28 Transgenic 484.02 656.98
[0115] It is worth noticing that the average serum concentration of
hGH in the non-transgenic group lies within the hypothetical
reference range, whereas the average for the transgenic cow is well
over the upper limit of said range. Besides, it is undoubted that
the average level of IGF-1 in the transgenic animal's serum is
categorically higher than the one corresponding to non-transgenic
cows, which constitutes a fundamental difference.
[0116] Therefore, although the high concentration of hGH in the
transgenic cow's serum (which in humans is known to cause disorders
with severe consequences, such as diabetes mellitus, hypertension,
increased risk of cardiovascular disease and enlargement of body
organs, including the liver, spleen, kidneys and heart) should
render the animal, theoretically, non-viable, this would not be
representing, apparently, an obstacle to its health and well being.
A cow with alarmingly high levels of a foreign hormone in its
blood, but which is perfectly healthy and yields an outstanding
productivity of a recombinant protein constitutes an unexpected and
innovative contribution.
[0117] Another innovative aspect of the present invention is that
the recombinant hGH which enters the cow's bloodstream, stimulates
the mammary gland to produce more milk. This effect is indirectly
achieved, i.e., through the action of IGF-1. This molecule
increases the blood flow through the mammary gland, providing
critical precursors for the synthesis of milk fat, protein, and
lactose. Thus, IGF-1 acts to direct nutrients through the blood to
the cells in the udder where they aid in the production of milk.
Therefore, a self-stimulating animal is attained, since the
recombinant hGH produced in the milk of the transgenic cow is
promoting a sustained increase in the volume of milk produced by
the animal through the stimulation of its mammary gland, with the
corresponding secretion of more hGH in its milk.
EXAMPLE 5
Obtaining Transgenic Calves by Subcloning
[0118] Five samples of tissue from the ear of a transgenic calf
were taken employing a 1.5-mm-diameter needle, whose end had been
previously beveled for this purpose. The samples were shipped under
refrigeration to the laboratory in a PBS-based medium containing
antibiotics and antimycotics.
[0119] Afterwards, the tissue samples were incubated for 72 hours
in MEM medium with 10% bovine fetal serum and antibiotics at
39.degree. C. and atmosphere of 5% CO.sub.2 Eventually, the tissue
samples were removed, and fibroblasts at the periphery of the plate
were allowed to grow until confluence. Once this had been achieved,
the fibroblasts were incubated for at least 5 days without changing
the culture medium in order to attain their synchronization in
G.sub.0 stage, which was assessed by means of visualization with a
microscopy.
[0120] After trypsinization, individual fibroblasts were fused with
enucleated bovines oocytes according to Example 2, and embryos thus
obtained were cultured in SOF medium and atmosphere of 5%
CO.sub.2+5% O.sub.2+90% N.sub.2 up to the stage of blastocyst.
Afterwards, generally two blastocysts were transferred
non-surgically per recipient cow, and pregnancies were determined
at 30-35 days by ultrasonography.
[0121] The implanted cows are allowed to normally pass the
pregnancy up to a natural delivery. Eventually a chirurgic approach
(Caesarea) could be used for delivery. The newborns are fed with Ig
rich colostrum during the first 48 hours, and then synthetic, later
natural (all of them free of animal origin compounds) foods are
used.
[0122] FIGS. 6A and 6B show measurements of serum concentration of
hGH and IGF-1 performed in parallel for two of the transgenic
animals obtained by subcloning of a transgenic cow, and the results
of these analyses are depicted in FIGS. 6C and 6D, respectively, to
permit the simultaneous visualization of both magnitudes for each
animal. Since at present the calves are young, the values for both
hGH and IGF-1 still lie within the respective range of reference,
but it is expected that they will rise the same way they did in the
transgenic cow out of which these two clones were obtained.
EXAMPLE 6
Obtaining Transgenic Calves by Artificial Insemination of a
Superovulated Transgenic Cow
[0123] An alternative approach for obtaining transgenic bovines
will be disclosed in this example. This method comprises
superovulating a transgenic cow by means of a hormonal treatment;
artificially inseminating said cow; recollecting the embryos thus
generated; the implantation of said embryos in surrogate cows; and
the development of the pregnancy up to the birth of the animals. A
description of this procedure is presented below.
Superovulation
[0124] In the morning of day 1 (i.e., the day the procedure
started), 150 .mu.g of prostaglandins (D(+)-clorprostenol,
Arsaprost.RTM., Arsa) were administered to the transgenic cow by
intramuscular route. The animal was subjected to a 4-kg daily diet
containing approximately 15% of proteins (before day 1, the animal
had been given 2 kg of food, with the same content of proteins). In
the morning of day 8, a CIDR (controlled internal drug release)
device of progesterone was placed intravaginally. Besides, 50 mg of
progesterone and estradiol were administered by intramuscular
route. The amount of food the animal was fed rose to 6 kg/day, with
the same content of proteins. Then, two intramuscular injections of
FSH and LH (PLUSET.RTM., Caliper) were administered on days 12, 13
and 14 (one in the morning and the other in the afternoon). The
following day (day 15), the treatment went on with the
administration, by intramuscular route, of two injections of
PLUSET.RTM. (one in the morning and the other in the afternoon) and
two injections of 150 .mu.g of prostaglandins each (same
administration regimen). In the morning of day 16, the CIDR was
removed. The total amount of PLUSET.RTM. administered throughout
the superovulation phase was 350 IU.
Insemination
[0125] This phase comprised three successive administrations (the
first and second, in the morning and in the afternoon of day 17,
respectively, and the last, in the morning of day 18) of semen from
a donor jersey bull, which had been obtained previously and kept
frozen to preserve the viability of the spermatozoids.
[0126] Collection of Embryos and their Implantation in Surrogate
Cows
[0127] The collection of embryos by flushing of both horns of the
cow's uterus with 1 l of DMPBS (Nutricell.RTM.) took place in the
morning of day 26. Immediately afterwards, two embryos were
transferred non-surgically per recipient cow, and pregnancies were
determined at 30-35 days by ultrasonography.
[0128] The implanted cows are allowed to normally pass the
pregnancy up to a natural delivery. Eventually a chirurgic approach
(Caesarea) could be used for delivery. The newborns are fed with Ig
rich colostrum during the first 48 hours, and then synthetic, later
natural (all of them free of animal origin compounds) foods are
used.
[0129] Since the generation of biological offspring obeys Mendel's
law, half of the animals being born as a consequence of the
procedure described above should be transgenic, and, of these, half
should be males and the other half, females. Therefore, there is a
high probability of obtaining a transgenic male (founder animal),
whose semen could be useful for setting up a Master Bank of jersey
transgenic semen to be used for the insemination of superovulated
transgenic/non-transgenic cows in order to expand the transgenic
herd.
EXAMPLE 7
Purification of Recombinant hGH from Milk
[0130] Once verified the approximate molecular weight, the Western
blot results and the biological activity of the recombinant hGH
produced in the calf's milk are correct, an exhaustive purification
process was performed, for it is imperative, when manufacturing a
biopharmaceutical product, that the protein of interest should be
purified to homogeneity, in order to avoid the presence of possible
contaminants in said product. This process comprised the steps of:
obtaining the skim of the milk by means of centrifugation and
dilution of the supernatant obtained to achieve a better solubility
of recombinant hGH eventually retained in the micelles of casein
(clarification);
[0131] and passage of this solution through an expanded-bed anionic
exchange chromatography column (an alternative to this step is the
employ of an immunoaffinity column, see Example 8 below); the
resulting solution is subdued to a reverse phase HPLC (C4) step;
fractions rich in recombinant hGH are afterwards subjected to an
anionic interchange chromatography.
[0132] Purified material is desalted, concentrated and subjected to
molecular exclusion chromatography. This separates by a molecular
weight in order to obtain the pure recombinant hGH.
[0133] The procedure for the purification of human growth hormone
(hGH) from milk comprises the following steps in order: (a)
clarification (b) expanded-bed anionic exchange chromatography, (c)
reverse phase chromatography, (d) anionic exchange chromatography,
(e) molecular exclusion chromatography (desalting), (f)
concentration and (g) molecular exclusion chromatography.
Clarification
[0134] Fresh milk was mixed with a sufficient amount of Tween 80 in
order to obtain a 0.5% solution. After addition of Tween 80, 2 M
Tris-HCl was added to get a pH of 7.3.+-.0.1. Afterwards, the
product was homogenized for 30 minutes, and then centrifugated at
14000 g in order to separate the fat layer. Later, the resulting
solution was diluted with 0.5% Tween 80 up to a conductivity of
less than, or equal to, 1500 .mu.S/cm. The pH was adjusted to
7.3.+-.0.1 with 2 M Tris-HCl and then the product was filtered
through a 0.8 .mu.m pore membrane and stored conveniently.
Expanded-Bed Anionic Exchange Chromatography
[0135] The material resulting from the previous step is
chromatographed using an anionic exchange matrix according to the
following parameters: [0136] 1. Equipment: [0137] A. Column: [0138]
1) Diameter: 5 cm [0139] 2) Bed height: 30 cm (compacted bed)
[0140] 3) Matrix: [0141] a. Streamline Q XL (Amersham) [0142] b.
Volume: 600 ml [0143] 2. Solutions and buffers: [0144] A. 0.5 N
NaOH [0145] B. 20% Ethanol [0146] C. Buffer A: 20 mM Tris.HCl, pH
7.3 [0147] D. Buffer B: 500 mM Tris.HCl, pH 7.3 [0148] E. Buffer C:
20 mM Tris.HCl, 150 mM NaCl, pH 7.3 [0149] F. Buffer D: 20 mM
Tris.HCl, 500 mM NaCl, pH 7.3 [0150] 3. Material to be
chromatographed [0151] A. Clarified milk. [0152] B. Sample
conditions: [0153] 1) Volume: 25.+-.5 l [0154] 2) Conductivity:
.ltoreq.1500 .mu.S/cm [0155] 3) pH: 7.3.+-.0.1
[0156] To equilibrate the column, 1.5 volumes of the column ("vc")
(900 mL) of purified water were passed through it, at a flow of
115.+-.5 cm/hour (descending flow). Afterwards, the following
solutions or buffers in the quantities hereinafter detailed were
sequentially passed through it, at an flow of 230.+-.30 cm/hour
(ascending flow): 3.0 vc (1,800 ml) of 0.5 N NaOH; 3.0 vc (1,800
ml) of purified water; 1.0 vc (600 ml) of Buffer B; and, finally,
3.0 vc (1,800 ml) of Buffer A.
[0157] Once the column was equilibrated, the material to be
chromatographed was loaded. Said loading was performed at
12.+-.3.degree. C. and at a flow of 230.+-.30 cm/hour. Thereafter,
the elution was performed at a 115.+-.15 cm/hour flow and at the
same temperature. Firstly, a sufficient amount of Buffer A was
passed through the column (ascending flow), and secondly the
solutions and buffers hereinafter detailed were passed in the
following order (descending flow): 1.5 vc (900 ml) of Buffer A; 2.0
vc (1,200 ml) of Buffer C; and, finally, 2.0 vc (1,200 ml) of
Buffer D.
[0158] Once the step had finished, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through the column, in order to clean it: 1.5 vc (900 ml) of
purified water; 1.5 vc (900 ml) of 0.5 N NaOH; 2.0 vc.(1,200 ml) of
purified water; 1.0 vc (600 ml) of Buffer B; 1.5 vc (900 ml) of
purified water; and, finally, 1.5 vc (900 ml) of 20% Ethanol.
[0159] The selected hGH containing fractions were assayed for total
proteins (by Bradford method) and for the protein of interest (by
RIA), and stored at 2-8.degree. C.
Reverse Phase Chromatography
[0160] The material resulting from the previous step is
chromatographed according to the following parameters: [0161] 1.
Equipment: [0162] A. Column: [0163] 1) Diameter: 4 cm [0164] 2) Bed
height: 48 cm [0165] 3) Matrix [0166] a. BakerBond Wide-Pore Butyl
(C4) 15 .mu.m prep LC Packing (Baker) [0167] b. Volume: 600 ml
[0168] 2. Solutions and buffers: [0169] A. Mobile Phase 1 (MP1): 30
mM NaHCO.sub.3, pH 7.2:Purified water:Acetonitrile (35:55:10)
[0170] B. Mobile Phase 2 (MP2): 30 mM NaHCO.sub.3, pH 7.2:Purified
water:Acetonitrile (20:10:70) [0171] C. 50% Methanol [0172] 3.
Material to be chromatographed [0173] A. Pool of selected fractions
resulting from the previous step. [0174] B. Sample conditions:
[0175] 1) Volume: 30.+-.15 l [0176] 2) pH: 7.3.+-.0.3
[0177] To equilibrate the column, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through it, at a flow of less than, or equal to, 478
cm/hour: 0.3 vc (180 ml) of 50% methanol; thereafter, a gradient of
50% methanol-MP2 was applied starting from a 100:0 ratio of said
solutions until a 0:100 ratio of said solutions in a total volume
of 1.0 vc (600 ml) was reached; once the gradient was finished, 1.0
vc (600 ml) of MP2 was passed through the column; thereafter, a
gradient of MP2-MP1 was applied starting from a 100:0 ratio of said
solutions until a 0:100 ratio of said solutions in a total volume
of 1.0 vc (600 ml) was reached; and, finally, 2.0 vc (1,200 ml) of
MP1 were passed through the column.
[0178] Once the column was equilibrated, the material to be
chromatographed was filtered through a 0.45 .mu.m pore membrane,
and loaded immediately afterwards. Said loading was performed at
20.+-.5.degree. C. and at a flow of less than, or equal to, 238
cm/hour. Thereafter, the elution was performed at a 478.+-.78
cm/hour flow and at the same temperature, and the solutions and
buffers hereinafter detailed were passed in the following order:
1.0 vc (600 ml) of MP1; a gradient of MP1-MP2, starting from a
65:35 ratio of said solutions until a 45:55 ratio of said solutions
in a total volume of 18.0 vc (9,000 ml) was reached; 1.0 vc (600
ml) of MP1-MP2 in a 45:55 ratio; and, finally, 2.0 vc (1,200 ml) of
MP2.
[0179] Once the step had finished, in order to clean the column, a
gradient of MP2-50% Methanol was applied, starting from a 100:0
ratio of said solutions until a 0:100 ratio of said solutions in a
total volume of 1.0 vc (600 ml) was reached; and, finally, 2.0 vc
(1,200 ml) of 50% methanol were passed through the column.
[0180] The fractions resulting from this chromatography were
assayed by SDS-PAGE homogeneous 20% and for the oxidized hGH, and,
depending on the results, a selection was performed. Afterwards,
the selected hGH containing fractions were assayed for total
proteins (by Bradford method), and stored at 2-8.degree. C.
Anionic Exchange Chromatography
[0181] The material resulting from the previous step is
chromatographed using an anionic exchange matrix, as follows:
[0182] 1. Equipment: [0183] A. Column: [0184] 1) Diameter: 5 cm
[0185] 2) Bed height: 25 cm [0186] 3) Matrix [0187] a. Source 30Q
(Pharmacia) [0188] b. Volume: 500 ml [0189] 2. Solutions and
buffers: [0190] A. 20% Ethanol [0191] B. Solution K: 0.5 N NaOH, 3M
NaCl [0192] C. Solution L: 50 mM Tris, pH 7.50 [0193] D. Solution
M: 0.1 N HCl, 3 M NaCl [0194] E. Mobile Phase 3 (MP3): Solution
L:Acetonitrile (70:30) [0195] F. Mobile Phase 4 (MP4): 50 mM Tris,
0.1 M NaCl, pH 7.50:Acetonitrile (70:30) [0196] 3. Material to be
chromatographed [0197] A. Selected fractions resulting from the
previous step. [0198] B. Sample conditions: [0199] 1) Volume:
4.5.+-.1 l [0200] 2) pH: 7.2.+-.0.2
[0201] To equilibrate and sanitize the column, the following
solutions or buffers in the quantities hereinafter detailed were
sequentially passed through it, at a flow of less than, or equal
to, 183.+-.20 cm/hour: 1.0 vc (500 ml) of purified water; 1.0 vc
(500 ml) of Solution K; 1.0 vc (500 ml) of Solution L; and,
finally, 1.0 vc (500 mL) of MP3.
[0202] Once the column was equilibrated, the material to be
chromatographed loaded. Said loading was performed at
20.+-.5.degree. C. and at a flow of less than, or equal to, 183
cm/hour. Thereafter, the elution was performed at a 183.+-.20
cm/hour flow and at the same temperature, and the solutions and
buffers hereinafter detailed were passed in the following order:
1.0 vc (500 ml) of MP3; a gradient of MP3-MP4, starting from a
15:85 ratio of said solutions until a 25:75 ratio of said solutions
in a total volume of 5.0 vc (2500 ml) was reached; and, finally,
2.0 vc (1000 ml) of MP4 was passed through the column.
[0203] Once the step had finished, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through the column, in order to clean it: a gradient of
MP4-purified water, starting from a 100:0 ratio of said solutions
until a 0:100 ratio of said solutions in a total volume of 0.5 vc
(250 ml) was reached; 0.5 vc (250 ml) of purified water; a gradient
of purified water-Solution K, starting from a 100:0 ratio of said
solutions until a 0:100 ratio of said solutions in a total volume
of 0.5 vc (250 ml) was reached; 1.0 vc (500 ml) of Solution K; a
gradient of Solution K-purified water, starting from a 100:0 ratio
of said solutions until a 0:100 ratio of said solutions in a total
volume of 0.5 vc (250 ml) was reached; 0.5 vc (250 ml) of purified
water; a gradient of purified water-Solution M, starting from a
100:0 ratio of said solutions until a 0:100 ratio of said solutions
in a total volume of 0.5 vc (250 ml) was reached; 1.0 vc (500 ml)
of Solution M; a gradient of Solution M-purified water, starting
from a 100:0 ratio of said solutions until a 0:100 ratio of said
solutions in a total volume of 0.5 vc (250 ml) was reached; 1.0 vc
(500 ml) of purified water; a gradient of purified water-Solution
L, starting from a 100:0 ratio of said solutions until a 0:100
ratio of said solutions in a total volume of 0.5 vc (250 ml) was
reached; 0.5 vc (250 ml); 0.5 vc (250 ml) of Solution L; a gradient
of Solution L-purified water, starting from a 100:0 ratio of said
solutions until a 0:100 ratio of said solutions in a total volume
of 0.5 vc (250 ml) was reached; and, finally, 1.5 vc (750 ml) of
purified water.
[0204] The selected hGH containing fractions were assayed for total
proteins (by Bradford method), and stored at 2-8.degree. C.
Molecular Exclusion Chromatography
[0205] The material resulting from the previous step is
chromatographed using a molecular exclusion matrix, as follows:
[0206] 1. Equipment: [0207] A. Column: [0208] 1) Diameter: 5 cm
[0209] 2) Bed height: 25 cm [0210] 3) Matrix [0211] a. Cellufine
GH25 (Millipore) [0212] b. Volume: 500 ml [0213] 2. Solutions and
buffers: [0214] A. 0.5 N NaOH [0215] B. 20% Ethanol [0216] C.
Buffer C: 150 mM NaH.sub.2PO.sub.4, pH 7.2 [0217] D. Buffer G: 320
mM Glycine, 10 mM NaH.sub.2PO.sub.4, 0.1% Tween 80, pH 6.9 [0218]
3. Material to be chromatographed [0219] A. Selected fractions
resulting from the previous step. [0220] B. Sample conditions:
[0221] 1) Volume: 0.5.+-.0.2 l [0222] 2) pH: 7.5.+-.0.5
[0223] To equilibrate and sanitize the column, the following
solutions or buffers in the quantities hereinafter detailed were
sequentially passed through it, at a flow of less than, or equal
to, 180 cm/hour: 1.0 vc (500 ml) of purified water; 1.0 vc (500 ml)
of 0.5 N NaOH; 0.5 vc (250 ml) of purified water; 0.5 vc (250 ml)
of Buffer C; and, finally, 2.0 vc (1000 ml) of Buffer G.
[0224] Once the column was equilibrated, the material to be
chromatographed was loaded. Said loading was performed at
20.+-.5.degree. C. and at a flow of 183.+-.20 cm/hour. Thereafter,
the elution was performed at the same flow rate and temperature,
and 1.0 vc (500 ml) of Buffer G was passed through the column, as
many times as the number of runs which was necessary to
perform.
[0225] Once the step had finished, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through the column, in order to clean it: 0.5 vc (250 ml) of
purified water; 1.0 vc (500 ml) of 0.5 N NaOH; 0.5 vc (250 ml) of
purified water; 0.5 vc (250 ml) of Buffer C; 0.5 vc (250 ml) of
purified water; and, finally, 1.5 vc (750 ml) of 20% ethanol.
[0226] The selected hGH containing fractions were assayed for total
proteins, and stored at 2-8.degree. C.
Concentration
[0227] The fractions resulting from the previous example were
concentrated according to the conditions described below: [0228] 1.
Equipment: [0229] A. Peristaltic pump: Watson Marlow--Cat. No. 302S
[0230] B. Tubing: Watson Marlow--Cat. No. 902.0080.016 [0231] C.
Concentrator: Prep Scale Millipore--Cat. No. CDU F006LC [0232] 2.
Solutions and buffers: [0233] A. 0.28% Sodium Dodecyl Sulfate (SDS)
[0234] B. 0.06% Triton [0235] C. 0.125 N NaOH [0236] D. Buffer G:
320 mM Glycine, 10 mM NaH.sub.2PO.sub.4, 0.1% Tween 80, pH 6.9
[0237] 3. Material to be processed: [0238] A. Selected fractions
resulting from the previous example. [0239] B. Sample conditions:
[0240] 1) Volume: 1.0.+-.0.5 l [0241] 2) Conductivity: 1200.+-.100
.mu.S/cm [0242] 3) pH: 6.9.+-.0.1
[0243] The equipment was first cleaned, sanitized and equilibrated,
and the following sequence of solutions and buffers were flowed
through the equipment: 2 l of 0.125 N NaOH; 10 l of purified water;
and, finally, 2 l of Buffer G. The equipment was then ready to be
used for concentration on the selected fractions, following the
usual methodology. The concentration procedure was performed until
a protein concentration of 15 mg/ml (assessed by Bradford method)
was reached.
[0244] The selected fractions were filtered through a 0.22 .mu.m
pore membrane, assayed for total proteins (by Bradford method), and
stored at 4.degree. C.
[0245] The conductivity and the pH of the selected fractions were
1,100-1,300 .mu.S/cm and 6.9.+-.0.1, respectively.
Molecular Exclusion Chromatography
[0246] The material resulting from the previous step is
chromatographed using a molecular exclusion matrix, as follows:
[0247] 1. Equipment: [0248] A. Column: [0249] 1) Diameter: 5 cm
[0250] 2) Bed height: 92 cm [0251] 3) Matrix [0252] a. Sephacryl
S-200 High Resolution (Amersham Pharmacia) [0253] b. Volume: 1,800
ml [0254] 2. Solutions and buffers: [0255] A. 0.5 N NaOH [0256] B.
20% Ethanol [0257] C. Buffer H: 320 mM Glycine, 2.2 mM
NaH.sub.2PO.sub.4, 1.8 mM Na.sub.2HPO.sub.4, pH 7.30 [0258] 3.
Material to be chromatographed [0259] A. Fractions selected from
the previous step, concentrated [0260] B. Sample conditions: [0261]
1) Volume: 40.+-.20 ml [0262] 2) Conductivity: 1,200.+-.100
.mu.S/cm [0263] 3) pH: 7.3.+-.0.1
[0264] To equilibrate and sanitize the column, the following
solutions or buffers in the quantities hereinafter detailed were
sequentially passed through it, at a flow of less than 46 cm/hour:
1.0 vc (1,800 ml) of purified water; 1.0 vc (1,800 ml) of 0.5 N
NaOH; and, finally, 2.0 vc (3,600 ml) of Buffer H.
[0265] Once the column was equilibrated, the material to be
chromatographed was loaded. Said loading was performed at
20.+-.5.degree. C. and at a flow of 46.+-.15 cm/hour. Thereafter,
the elution was performed at the same flow rate and temperature,
and 1.0 vc (1,800 ml) of Buffer H was passed through the column, as
many times as the number of runs which was necessary to
perform.
[0266] Once the step had finished, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through the column, in order to clean it: 1.0 vc (1,800 ml)
of purified water; and 1.5 vc (2,700 ml) of 20% ethanol.
[0267] The fractions containing pure hGH were aseptically filtered
through a 0.22 .mu.m pore membrane into sterile, depyrogenated
plastic bottles, assayed for total proteins, and stored at
-20.degree. C.
EXAMPLE 8
Alternative Procedure for the Purification of hGH from Milk
[0268] Instead of the purification method previously described, an
alternative scheme can be employed in order to purify the
recombinant hGH contained in the milk. The main difference between
the procedure described in Example 7 and the alternative one
presented in this example is that the second step of the former
involves expanded-bed anionic exchange chromatography, whereas the
corresponding step of the latter entails immunoaffinity
chromatography. The clarification steps of both procedures are also
slightly different. Since the rest of both purification schemes are
identical, only the first two steps of the alternative procedure
will be described below.
Clarification
[0269] Fresh milk was mixed with a sufficient amount of Tween 80 in
order to obtain a 0.5% solution. After addition of Tween 80, 1 M
Tris was added to get a pH of 7.3.+-.0.3. Afterwards, the product
was homogenized for 30 minutes, and then centrifugated at 14000 g
in order to separate the fat layer. Later, the resulting solution
was diluted 20-fold with Buffer S (50 mM Tris.HCl, 500 mM NaCl,
0.5% Tween 80, pH 7.3), and then filtered through a 0.45 .mu.m pore
membrane and stored conveniently.
Immunoaffinity Chromatography
[0270] The material resulting from the previous step is
chromatographed using an immunoaffinity interaction matrix (Affigel
10 Ester Agarose, manufactured by BioRad, with covalently attached
anti-GH Monoclonal Antibodies, manufactured by Bio Sidus) according
to the following parameters: [0271] 1. Equipment: [0272] A. Column:
[0273] 1) Diameter: 30 cm [0274] 2) Bed height: 15 cm [0275] 3)
Matrix: [0276] a. Affigel 10 Ester Agarose (BioRad), with
covalently attached anti-GH Monoclonal Antibodies (Bio Sidus)
[0277] b. Volume: 10 l [0278] 2. Solutions and buffers: [0279] A.
Buffer A: 50 mM Tris.HCl, 500 mM NaCl, pH 7.2 [0280] B. Buffer B:
100 mM Citric Acid, pH 3.0 [0281] C. Buffer C: 150 mM
NaH.sub.2PO.sub.4, pH 7.2 [0282] D. Buffer D: 50 mM Tris.HCl, 500
mM NaCl, 500 mM Guanidine.HCl, pH 7.2 [0283] E. Buffer E: 50 mM
Tris.HCl, 500 mM NaCl, pH 7.2, 0.2% Sodium Azide, 0.1 g/l
Gentamicine. [0284] 3. Material to be chromatographed [0285] A.
Clarified milk. [0286] B. Sample conditions: [0287] 1) Volume:
30-50 l [0288] 2) Conductivity: 45.+-.15 mS/cm [0289] 3) pH:
7.3.+-.0.3
[0290] To equilibrate and sanitize the column, if it had not been
used in the last seven days, the following solutions or buffers in
the quantities hereinafter detailed were sequentially passed
through it, at a flow of less than 51 cm/hour: 1.0 volume of the
column ("vc") (10 l) of Buffer A; 2.0 vc (20 l) of Buffer D; 2.0 vc
(20 l) of Buffer A; 1.0 vc (10 l) of Buffer B; 2.0 vc (20 l) of
Buffer C; and, finally, 1.0 vc (10 l) of Buffer A.
[0291] On the other hand, if the column had been used in the last
seven days, the following solutions or buffers in the quantities
hereinafter detailed were sequentially passed through it, at a flow
of less than 51 cm/hour: 1.0 vc (10 l) of Buffer C; and, finally,
2.0 vc (20 l) of Buffer A.
[0292] Once the column was equilibrated, the material to be
chromatographed was loaded. Said loading was performed at
5.+-.3.degree. C. and at a flow of less than 51 cm/hour.
Thereafter, the elution was performed at a 42.+-.9 cm/hour flow and
at the same temperature, and the solutions and buffers hereinafter
detailed were passed in the following order: 2.0 vc (20 l) of
Buffer A; and 1.5 vc (15 l) of Buffer B.
[0293] Once the step had finished, the following solutions or
buffers in the quantities hereinafter detailed were sequentially
passed through the column, in order to clean it: 2.0 vc (20 l) of
Buffer D; 2.0 vc (20 l) of Buffer A; and, finally, 2.0 vc (20 l) of
Buffer E.
[0294] The selected hGH containing fractions were assayed for total
proteins (by Bradford method) and for the protein of interest (by
RIA), and stored at 4.degree. C.
EXAMPLE 9
Quality Control of Pure Recombinant hGH
[0295] Two batches of pure recombinant hGH were subjected to a
series of assays to verify that the product is indistinguishable
from natural hGH. Such procedures included, but are not limited to,
SDS/PAGE, Western blot, biological activity in vitro (cells nb2)
and in vivo (hypophysectomized rats), peptide mapping,
determination of the complete aminoacid sequence, isoelectric
focusing (IEF), and reverse-phase and size exclusion HPLC analyses.
The results obtained in all those assays were exactly the same for
both recombinant and natural hGH, which proves that the pure
recombinant hGH corresponds exactly to the natural hGH, being thus
suitable for manufacturing a biopharmaceutical product.
[0296] Having now fully described the invention, it will be
understood by those of ordinary skill in the art that the same can
be performed within a wide and equivalent range of conditions,
formulations and other parameters without affecting the scope of
the invention or any embodiment thereof. All patents and
publications cited herein are fully incorporated by reference
herein in their entirety.
Sequence CWU 1
1
4131DNAArtificialPrimer PB1 1tctactcgag gatcatctat ctgtcccaaa g
31227DNAArtificialPrimer PB2 2ctaggatcca atgatctgat tttgtgg
27328DNAArtificialPrimer PB4 3ctaggatcca tggctacagg taagcgcc
28420DNAArtificialPrimer GHTE 4atgctgtgtc tggacgtcct 20
* * * * *