U.S. patent application number 11/628586 was filed with the patent office on 2008-09-18 for targeting pseudotyped retroviral vectors.
This patent application is currently assigned to Regents of the University of California. Invention is credited to Irvin S.Y. Chen, Kouki Morizono.
Application Number | 20080227736 11/628586 |
Document ID | / |
Family ID | 35463452 |
Filed Date | 2008-09-18 |
United States Patent
Application |
20080227736 |
Kind Code |
A1 |
Chen; Irvin S.Y. ; et
al. |
September 18, 2008 |
Targeting Pseudotyped Retroviral Vectors
Abstract
The present invention relates to retroviral vectors,
particularly lentiviral vectors, pseudotyped with Sindbis envelope
and targeted to specific cell types via a targeting moiety linked
to the envelope.
Inventors: |
Chen; Irvin S.Y.; (Palos
Verdes Estates, CA) ; Morizono; Kouki; (Los Angeles,
CA) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Assignee: |
Regents of the University of
California,
|
Family ID: |
35463452 |
Appl. No.: |
11/628586 |
Filed: |
June 3, 2005 |
PCT Filed: |
June 3, 2005 |
PCT NO: |
PCT/US05/19624 |
371 Date: |
August 28, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60577248 |
Jun 3, 2004 |
|
|
|
Current U.S.
Class: |
514/44R ;
435/320.1; 435/325; 435/455; 435/5; 435/91.4 |
Current CPC
Class: |
C12N 2830/008 20130101;
C12N 15/867 20130101; A61K 39/39558 20130101; A61K 2039/5256
20130101; A61P 25/00 20180101; C12N 2770/36122 20130101; C07K
2319/33 20130101; C12N 2740/16043 20130101; C12N 2740/16045
20130101; C12N 2740/10045 20130101; C12N 15/63 20130101; A61K 48/00
20130101; C12N 15/86 20130101; C12N 2740/10043 20130101; A61K
39/395 20130101; C12N 2810/855 20130101; C12N 2810/609
20130101 |
Class at
Publication: |
514/44 ;
435/320.1; 435/325; 435/91.4; 435/455; 435/6 |
International
Class: |
A61K 31/70 20060101
A61K031/70; C12N 15/00 20060101 C12N015/00; C12N 5/06 20060101
C12N005/06; C12Q 1/68 20060101 C12Q001/68; A61P 25/00 20060101
A61P025/00; C12P 19/34 20060101 C12P019/34; C12N 15/87 20060101
C12N015/87 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] This invention was made with Government support under Grant
Nos. 5R01 DK54912-06 and 5R01AI39975-01, awarded by the National
Institutes of Health. The Government has certain rights in this
invention.
Claims
1. A pseudotyped, targeted retroviral vector comprising: a) a
mutated Sindbis envelope comprising Sindbis envelope proteins E1,
E2, and E3, wherein at least one of E1, E2, or E3 is mutated as
compared to a wild-type sequence; b) a targeting moiety linked to
the Sindbis envelope.
2. The vector of claim 1, further comprising a retroviral-based
nucleic acid genome.
3. The vector of claim 1, wherein the vector nucleic acid comprises
a heterologous gene operably linked to a promoter.
4. The vector of claim 3, wherein the promoter is a tissue-specific
promoter.
5. The vector of claim 4, wherein the tissue-specific promoter is a
PSE-BC promoter.
6. The vector of claim 1, wherein the targeting moiety specifically
binds to a target protein selected from the group consisting of
P-glycoprotein, Her2/Neu, erythropoietin (EPO), epidermal growth
factor receptor (EGFR), vascular endothelial growth factor receptor
(VEGF-R), cadherin, carcinoembryonic antigen (CEA), CD4, CD8, CD19,
CD20, CD33, CD34, CD45, CD117 (c-kit), CD133, HLA-A, HLA-B, HLA-C,
chemokine receptor 5 (CCR5), stem cell marker ABCG2 transporter,
ovarian cancer antigen CA125, an integrin, prostate specific
antigen (PSA), prostate stem cell antigen (PSCA), dendritic
cell-specific intercellular adhesion molecule 3-grabbing
nonintegrin (DC-SIGN), thyroglobulin, granulocyte-macrophage colony
stimulating factor (GM CSF), myogenic differentiation promoting
factor-1 (MyoD-1), Leu-7 (CD57), LeuM-1, cell
proliferation-associated human nuclear antigen defined by the
monoclonal antibody Ki-67 (Ki-67), HIV gp120, and transferrin
receptor.
7. The vector of claim 6, wherein the targeting moiety is an
antibody.
8. The vector of claim 7, wherein the targeting moiety is an
antibody directed against prostate stem cell antigen (PSCA).
9. The vector of claim 7, wherein the targeting moiety is an
antibody directed against P-glycoprotein (P-gp).
10. The vector of claim 7, wherein the targeting moiety is an
antibody directed against a transferrin receptor.
11. The vector of claim 1, wherein the targeting moiety is
covalently linked to the Sindbis envelope.
12. The vector of claim 1, wherein the targeting moiety is
non-covalently linked to the Sindbis envelope.
13. The vector of claim 1, wherein the targeting moiety is
covalently linked to the E2 or the E3 protein of the Sindbis
envelope.
14. The vector of claim 1, wherein the targeting moiety is
non-covalently linked to the E2 or the E3 protein of the Sindbis
envelope.
15. The vector of claim 14, wherein the targeting moiety is
non-covalently linked to the E2 protein Sindbis envelope via the ZZ
domain of protein A.
16. The vector of claim 1, wherein E2 protein is mutated at one
amino acid position.
17. The vector of claim 1, wherein E2 protein is mutated at two or
more amino acid positions.
18. The vector of claim 1, wherein E3 protein is mutated at one
amino acid position.
19. The vector of claim 1, wherein E3 protein is mutated at two or
more amino acid positions.
20. The vector of claim 1, wherein the mutated Sindbis envelope is
encoded by a sequence listed in Table 1.
21. The vector of claim 1, wherein the mutated Sindbis envelope is
encoded by m168 which has a mutation in Sindbis virus envelope
protein E2.
22. The vector of claim 21, further comprising a mutation in
Sindbis envelope protein E1.
23. A packaging system comprising a cell comprising nucleic acids
encoding the pseudotyped, targeted retroviral vector of claim
1.
24. The packaging system of claim 23, wherein the vector further
comprises a retroviral-based nucleic acid genome.
25. The packaging system of claim 24, wherein the Sinbis envelope
proteins E1, E2, and E3 and the retroviral-based nucleic acid
genome are encoded on the same nucleic acid.
26. The packaging cell of claim 24, wherein the Sinbis envelope
proteins E1, E2, and E3 and the retroviral-based nucleic acid
genome are encoded on separate nucleic acids.
27. An expression vector comprising a nucleic acid encoding Sindbis
envelope proteins E1, E2, and E3, wherein at least one of E, E2, or
E3 is mutated as compared to a wild-type sequence.
28. A method of making the pseudotyped, targeted retroviral vector
of claim 1, the method comprising the step of expressing in a cell
a nucleic acid comprising Sindbis envelope proteins E1, E2, and
E3.
29. The method of claim 28, wherein the vector further comprises a
retroviral-based nucleic acid genome.
30. The method of claim 29, wherein the Sindbis envelope proteins
E1, E2, and E3 and the retroviral based nucleic acid genome are
encoded on the same nucleic acid.
31. The method of claim 29, wherein the Sindbis envelope proteins
E1, E2, and E3 and the retroviral based nucleic acid genome are
encoded on separate nucleic acids.
32. The method of claim 28, further comprising the step of
isolating a virus particle from the cell.
33. A method of transducing cells with a heterologous gene, the
method comprising the step of contacting the cell with the
pseudotyped, targeted retroviral vector of claim 1.
34. The method of claim 33, wherein the cells are in a subject and
the vector is administered intravenously.
35. The method of claim 33, wherein the cells are transduced ex
vivo.
36. The method of claim 33, wherein the cells are transduced in
vivo.
37. The method of claim 33, wherein the cells are transduced in
vitro.
38. A method of treating or preventing a disease state, the method
comprising the step of contacting a cell with the pseudotyped,
targeted retroviral vector of claim 1.
39. The method of claim 38, wherein the cell is contacted in
vivo.
40. The method of claim 38, wherein the cell is contacted ex
vivo.
41. The method of claim 38, wherein the cell is contacted in
vitro.
42. A method of diagnosing a disease state, the method comprising
the step of contacting a cell with the pseudotyped, targeted
retroviral vector of claim 1.
43. The method of claim 42, wherein the cell is contacted in
vivo.
44. The method of claim 42, wherein the cell is contacted ex
vivo.
45. The method of claim 42, wherein the cell is contacted in
vitro.
46. A method of delivering a pseudotyped, targeted retroviral
vector across the blood brain barrier in a subject, the method
comprising the step of contacting a cell with the pseudotyped,
targeted retroviral vector of claim 10.
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent Application No. 60/577,248, filed Jun. 3, 2004, the
disclosure of which is hereby incorporated herein by reference in
its entirety for all purposes.
FIELD OF THE INVENTION
[0003] The present invention relates to lentiviral vectors
pseudotyped with Sindbis envelope and targeted to specific cell
types via a targeting moiety linked to the envelope.
BACKGROUND OF THE INVENTION
[0004] Clinically effective gene therapy protocols for various
diseases would ideally utilize procedures for efficient and
specific targeting of therapeutic genes to affected cells while
maintaining stable transduction and long term expression. This
would be accomplished by direct injection into the bloodstream
followed by homing of the vector to the desired target cells or
organs. Thus, there have been many attempts to develop targeted
gene transduction systems based upon various viral vectors.
Adenovirus and adeno-associated virus vectors have been used in
targeted gene delivery strategies because of their simple binding
and entry mechanisms. (Nicklin and Baker, Curr Gene Ther. 2,
273-293 (2002)) Although these vectors have been used successfully
in vitro, for targeting to specific cells, their usefulness in vivo
has been limited by their natural tropism (Muller et al., Nat.
Blotechnol. 21, 1040-1046 (2003)), especially to liver cells
(Martin et al., Mol. Ther. 8, 485-494 (2003)).
[0005] Oncoretroviral- and lentiviral-based vectors have several
properties that make them ideal for use in gene therapy (Sandrin et
al., Curr. Top. Microbiol. Immunol. 281:137-78, 137-178 (2003)).
Efficient integration of retroviral DNA into the host genome
enables stable long-term transgene expression. Unlike
oncoretroviral vectors, lentiviral vectors are capable of
transducing non-dividing cells. The application of specific
targeting with retroviral vectors has been problematic and the few
studies of retroviral vector targeting in living animals are not
efficient (Martin et al., Mol. Ther. 5, 269-274 (2002); Jiang and
Domburg, Gene Ther. 6, 1982-1987 (1999)). Inserting ligands,
peptides or single chain antibodies into the retroviral receptor
binding envelope subunit has been the most common approach used to
alter and/or restrict the host range of retroviral vectors (Han et
al., Proc Natl. Acad Sci U.S.A. 92, 9747-9751 (1995); Jiang et al.,
J. Virol. 72, 10148-10156 (1998); Marin et al., J. Virol. 70,
2957-2962 (1996); Martin et al., J. Virol. 73, 6923-6929 (1999);
Nilson et al., Gene Ther. 3, 280-286 (1996); Somia et al., Proc
Natl. Acad Sci U.S.A. 92, 7570-7574 (1995); Valsesia-Wittmann et
al., J Virol 68, 4609-4619 (1994)). Another approach is bridging
virus vector and cells by antibodies or ligands (Boerger et al.,
Proc Natl Acad Sci U.S.A. 96, 9867-9872 (1999); Roux et al., Proc
Natl Acad Sci U.S.A. 86, 9079-9083 (1989)). In general, most
strategies have suffered from inconsistent specificity and low
viral titers as a result of modification of the retroviral envelope
(Han et al., Proc Natl. Acad Sci U.S.A. 92, 9747-9751 (1995); Marin
et al., J. Virol. 70, 2957-2962 (1996); Nilson et al., Gene Ther.
3, 280-286 (1996); Somia et al., Proc Natl. Acad Sci U.S.A. 92,
7570-7574 (1995); Valsesia-Wittmann et al., J. Virol 68, 4609-4619
(1994); Kasahara et al., Science 266, 1373-1376 (1994)). The
modified envelope proteins appear to have specific binding activity
but low fusion activity resulting in inefficient entry into cells
(Martin et al., J. Virol. 73, 6923-6929 (1999); Zhao et al., Proc
Natl. Acad Sci U.S.A. 96, 4005-4010 (1999)). In the absence of
specific targeting, current strategies depend upon direct injection
to a localized site (Akporiaye and Hersh, Curr. Opin. Mol. Ther. 1,
443-453 (1999)) or, as in the case of the only successful treatment
of a heritable disease, X-linked SCID, ex vivo isolation,
purification and transduction of target hematopoietic cells (Kohn
et al., Nat. Med. 1, 1017-1023 (1995); Cavazzana-Calvo et al.,
Science 288, 669-672 (2000)).
[0006] Sindbis virus is a member of the Alphavirus genius
(Schlesinger and Schlesinger, Fundamental Virology 523-539, Raven,
Philadelphia (1996)). In mature Sindbis virions the plus-stranded
RNA viral genome is complexed with the capsid protein to form an
icosahedral nucleocapsid surrounded by a lipid bilayer embedded
with two integral membrane glycoproteins, E1 and E2, that form a
heterodimer and function as a unit. E1 and E2 are anchored in the
membrane independently. E2 binds to the host cell receptor. E1 can
mediate membrane fusion as long as it is exposed to the low pH of
the endosome and in the absence of a specific interaction with a
receptor. Monoclonal antibodies capable of neutralizing virus
infection are usually E2 specific, and mutation of E2 is frequently
associated with altered host range and virulence. E2 can be
modified substantially yet retain viral infectivity. This property
of E2 has been exploited to develop Sindbis virus vectors that
target specific cells (Ohno et al., Nat. Biotechnol. 15, 763-767
(1997)). However, since Sindbis virus vectors are cytotoxic (Tseng
et al. Systemic tumor targeting and killing by Sindbis viral
vectors, Nat. Biotechnol. (2003)) and unable to stably transduce
their target cells, they cannot be used where stable expression is
desired.
[0007] We previously found that the Sindbis virus envelope (with E1
and E2) is able to pseudotype oncoretroviruses and lentiviruses
(Morizono et al., J. Virol., September; 75.(17.):8015.-20. 75,
8016-8020 (2001)). We used the flexibility of the Sindbis virus E2
protein to our advantage in developing oncoretroviral and
lentiviral vectors with the capacity to target specific cells. We
previously reported an oncoretroviral and lentiviral gene targeting
system based on antibody-mediated specific binding of a modified
Sindbis virus envelope (ZZ SINDBIS) that encoded the ZZ domain of
protein A. We demonstrated that monoclonal antibodies directed to
cell surface antigens can be used to redirect the target
specificity of these vectors when pseudotyped with the modified
Sindbis envelope. Of particular note, the vectors maintained high
viral titers, which could be further increased by simple
ultracentrifugation.
[0008] Sindbis virus has a broad natural host range. The
high-affinity laminin receptor (Wang et al., J. Virol. 66,
4992-5001 (1992)) and heparin sulfate are among the known receptors
(Klimstra et al., J, Virol. 72, 7357-7366 (1998)). Their wide
distribution and highly conserved nature may be in part responsible
for the residual non-specific tropism observed with the ZZ SINDBIS
pseudotyped vector. Accordingly, there exists a need for targeted
retroviral vectors with decreased binding of endogenous receptors.
The present invention fulfills this and other needs.
BRIEF SUMMARY OF THE INVENTION
[0009] In order to further reduce the natural tropism of the
Sindbis virus envelope and thereby increase the specificity of
targeted gene transduction in vivo, we screened a panel of E2
mutants. We identified several mutants within E2 that reduced the
endogenous tropism of E2. We utilized our modified ZZ SINDBIS
envelope, designated m168, and a lentiviral reporter vector to
target P-glycoprotein (P-gp) expressing melanoma cells in the lungs
of a murine model for metastatic melanoma. We demonstrate specific
targeting of metastatic tumor cells through direct injection of the
vector into the bloodstream.
[0010] The present invention therefore provides targeted lentiviral
vectors that are pseudotyped with mutated Sindbis envelopes. In
particular, mutations in the E2 protein and are used to alter viral
titer, specificity, specificity index, tropism, and susceptibility
to host immune response. The pseudotyped, targeted lentiviral
vectors of the invention are used to transduce heterologous genes
into a cell and can be used for in vivo and ex vivo therapeutic
applications, as well as for diagnostic and research tool
applications.
[0011] Accordingly, in a first aspect, the invention provides a
pseudotyped, targeted retroviral vector comprising: [0012] a) a
mutated Sindbis envelope comprising Sindbis envelope proteins E1,
E2, and E3, wherein at least one of E1, E2, or E3 is mutated as
compared to a wild-type sequence; [0013] b) a targeting moiety
linked to the Sindbis envelope.
[0014] In certain embodiments, the vector further comprises a
retroviral-based nucleic acid genome. In certain embodiments, the
retroviral-based nucleic acid genome is a lentivirus or an
oncoretrovirus genome. The genome can also optionally comprise a
heterologous gene.
[0015] In certain embodiments, the vector is isolated. Typically,
one or more of the E1, E2, or E3 proteins can be mutated at one or
more amino acid positions. In one preferred embodiment, the vector
comprises the following envelope protein mutations in comparison to
wild-type Sindbis virus envelope proteins: (i) deletion of E3 amino
acids 61-64; (ii) E2 KE159-160AA; and (iii) E2 SLKQ68-71AAAA (SEQ
ID NOs: 3-4). In a further embodiment, the vector additionally
comprises the envelope protein mutation E1 AK226-227SG. The vectors
can also have a protein binding domain that specifically binds a
protein of interest (i.e., a targeting moiety, including an
antibody, an integrin, a transferrin receptor). In certain
embodiments, the targeting moiety is an antibody.
[0016] The invention further encompasses a packaging system
comprising a cell comprising one or more nucleic acids encoding the
pseudotyped, targeted retroviral vectors described herein. In a
related aspect, the invention provides expression vectors
comprising one or more nucleic acids encoding Sindbis envelope
proteins E1, E2, and E3, wherein at least one of E1, E2 or E3 is
mutated as compared to a wild-type sequence.
[0017] In another aspect, the invention provides methods of making
the pseudotyped, targeted retroviral vectors of the invention, the
methods comprising the steps of expressing in a cell one or more
nucleic acids comprising Sindbis envelope proteins E1, E2, and E3.
The vector can optionally comprise a nucleic acid comprising the
retroviral based nucleic acid genome. The Sindbis envelope proteins
E1, E2 and E3 and the retroviral-based nucleic acid genome can be
encoded on the same or separate nucleic acids.
[0018] In a related aspect, the invention also provides methods of
transducing cells with a heterologous gene; methods of treating or
preventing a disease state; and methods of diagnosing a disease
state, the methods comprising the step of contacting the cell with
the pseudotyped, targeted retroviral vectors described herein. In
certain embodiments the cells are contacted in vitro, ex vivo, or
in vivo. The pseudotyped, targeted retroviral vectors are typically
administered intravenously.
[0019] In a another aspect, the invention provides a method for
delivering a pseudotyped, targeted retroviral vector across the
blood brain barrier in a subject, the method comprising the step of
contacting a cell with a pseudotyped, targeted retroviral vector of
the present invention, wherein the targeting moiety specifically
binds to a transferrin receptor.
DEFINITIONS
[0020] "Sindbis envelope," "ZZSINDBIS," and "m168" refer to a viral
envelope comprising the Sindbis E1, E2, and E3 proteins. The terms
"Sindbis E1 protein," "Sindbis E2 protein" and "Sindbis E3 protein"
or a nucleic acid encoding "Sindbis E1 protein," "Sindbis E2
protein" and "Sindbis E3 protein" refer to nucleic acids and
polypeptide polymorphic variants, alleles, mutants, and
interspecies homologs that: (1) have a nucleotide sequence that has
greater than about 60% nucleotide sequence identity, 65%, 70%, 75%,
80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or
99% or greater nucleotide sequence identity, preferably over a
region of at least about 25, 50, 100, 200, 500, 1000, or more
nucleic acids, up to the full length sequence, to the nucleotide
sequence of E1, E2, and/or E3; (2) bind to antibodies, e.g.,
polyclonal or monoclonal antibodies, raised against an immunogen
comprising an amino acid sequence of an E1, E2, and/or E3 protein,
and conservatively modified variants thereof; (3) specifically
hybridize under stringent hybridization conditions to an anti-sense
strand corresponding to a nucleic acid sequence of E1, E2, and/or
E3 and conservatively modified variants thereof; (4) encode a
protein having an amino acid sequence that has greater than about
60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%,
preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater
nucleotide sequence identity, preferably over a region of at least
about 25, 50, 100, 200, 500, 1000, or more amino acids, to a E1,
E2, and/or E3 protein. The nucleic acids and proteins of the
invention include both naturally occurring or recombinant
molecules, as well as point mutations, including randomly generated
point mutations and those generated by site-directed mutagenesis.
E1, E2, and E3 are encoded by a polyprotein, the amino acid
sequence of which is provided, e.g., by Accession No. VHWVB,
VHWVB2, and P03316; the nucleic acid sequence is provided, e.g., by
Accession No. SVU90536 and V01403 (see also Rice & Strauss,
Proc. Nat'l Acad. Sci. USA 78:2062-2066 (1981); and Strauss et al.,
Virology 133:92-110 (1984)). Other Togaviridae family envelopes,
e.g., from the Alphavirus genus, e.g., Semliki Forest Virus, Ross
River Virus, and equine encephalitis virus, can also be used to
pseudotype the vectors of the invention. The envelope protein
sequences for such Alphaviruses are known in the art.
[0021] "Pseudotype" refers to a virus particle, where the envelope
or capsid includes heterologous viral proteins.
[0022] "Nucleic acid genome" refers to the genomic or nucleic acid
component of a virus particle, which encodes the genome of the
virus particle, including any proteins required for replication
and/or integration of the genome, if required, and optionally a
heterologous protein operably linked to a promoter, the promoter
being either native to the protein or heterologous (viral or
non-viral). The nucleic acid genome can be based on any virus, and
have an RNA or DNA genome, either single stranded or double
stranded. Preferably, the nucleic acid genome is from the family
Retroviridae.
[0023] "Lentiviral vector" refers to viruses comprising nucleic
acid genomes based on viruses of the Lentiviral genus of the family
Retroviridae. Optionally, the vector encodes a heterologous
gene.
[0024] "Retroviral vectors," as used herein, refer to viruses based
on viruses of the Retroviridae family. In their wild-type form,
retroviral vectors typically contain a genomic nucleic acid. The
pseudotyped, targeted retroviral vectors of the invention can
optionally comprise a nucleic acid genome. The vectors of the
invention can also comprise a heterologous gene.
[0025] "Targeting moiety" refers to a heterologous protein linked,
either covalently or non-covalently, to a pseudotyped virus
particle, typically linked to an envelope protein, e.g., E1, E2, or
E3. The targeting moiety binds to a protein on the cell surface of
a selected cell type. Representative targeting moieties include
antibodies and receptor ligands.
[0026] A viral "envelope" protein, or "Env" protein, as used
herein, refers to any polypeptide sequence that resides on the
surface lipid bilayer of a retroviral virion whose function is to
mediate the adsorption to and the penetration of host cells
susceptible to infection. A retroviral envelope is formed by a
cell-derived lipid bilayer into which proteins encoded by the env
region of the viral genome are inserted. Envelope proteins are
typically glycoproteins and usually comprise a transmembrane (TM)
and a surface (SU) component linked together by disulfide bonds.
Virus structure is described in detail in, for example, Coffin, et
al., Retroviruses, 1997, Cold Spring Harbor Laboratory Press.
[0027] A viral "capsid," as used herein, refers to the principal
structural protein of the virion core derived from the central
region of the Gag polyprotein. The capsid protein in a mature viral
particle forms a shell surrounding the ribonucleoprotein complex
that contains the genomic nucleic acid. This shell, which includes
additional proteins, is also referred to as a capsid. A capsid
shell can exist as a component of a virion without surrounding a
genomic nucleic acid.
[0028] A "virion" refers to a retrovirus body, including the outer
lipid bilayer which surrounds a capsid shell which in turn
surrounds a genomic nucleic acid, when present. A virion of the
invention, can, but need not, have a genomic nucleic acid.
[0029] "Mutated Sindbis envelope" refers to a point mutation,
insertion, or deletion in the amino acid sequence of a wild-type
Sindbis E1, E2, or E3 protein. The E1, E2, or E3 protein can have
one or more mutations. In addition, combinations of mutations in
E1, E2, and E3 are encompassed by the invention, e.g., mutations in
E1 and E2, or in E2 and E3, or E3 and E1, or E1, E2, and E3.
Exemplary wild type sequences of E1, E2, and E3 proteins from
Sindbis strains include Accession No. VHWVB, VHWVB2, and
P03316.
[0030] "Biological sample" includes sections of tissues such as
biopsy and autopsy samples, and frozen sections taken for
histologic purposes. Such samples include blood and blood fractions
or products (e.g., serum, plasma, platelets, red blood cells, and
the like), sputum, tissue, cultured cells, e.g., primary cultures,
explants, and transformed cells, stool, urine, etc. A biological
sample is typically obtained from a eukaryotic organism, most
preferably a mammal such as a primate e.g., chimpanzee or human;
cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit;
bird; reptile; or fish.
[0031] The terms "identical" or percent "identity," in the context
of two or more nucleic acids or polypeptide sequences, refer to two
or more sequences or subsequences that are the same or have a
specified percentage of amino acid residues or nucleotides that are
the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher
identity over a specified region, when compared and aligned for
maximum correspondence over a comparison window or designated
region) as measured using a BLAST or BLAST 2.0 sequence comparison
algorithms with default parameters described below, or by manual
alignment and visual inspection (see, e.g., NCBI web site
http://www.ncbi.nlm.nih.gov/BLAST/or the like). Such sequences are
then said to be "substantially identical." This definition also
refers to, or may be applied to, the compliment of a test sequence.
The definition also includes sequences that have deletions and/or
additions, as well as those that have substitutions. As described
below, the preferred algorithms can account for gaps and the like.
Preferably, identity exists over a region that is at least about 25
amino acids or nucleotides in length, or more preferably over a
region that is 50-100 amino acids or nucleotides in length.
[0032] For sequence comparison, typically one sequence acts as a
reference sequence, to which test sequences are compared. When
using a sequence comparison algorithm, test and reference sequences
are entered into a computer, subsequence coordinates are
designated, if necessary, and sequence algorithm program parameters
are designated. Preferably, default program parameters can be used,
or alternative parameters can be designated. The sequence
comparison algorithm then calculates the percent sequence
identities for the test sequences relative to the reference
sequence, based on the program parameters.
[0033] A "comparison window", as used herein, includes reference to
a segment of any one of the number of contiguous positions selected
from the group consisting of from 20 to 600, usually about 50 to
about 200, more usually about 100 to about 150 in which a sequence
may be compared to a reference sequence of the same number of
contiguous positions after the two sequences are optimally aligned.
Methods of alignment of sequences for comparison are well-known in
the art. Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by manual
alignment and visual inspection (see, e.g., Current Protocols in
Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0034] A preferred example of algorithm that is suitable for
determining percent sequence identity and sequence similarity are
the BLAST and BLAST 2.0 algorithms, which are described in Altschul
et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J.
Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0
are used, with the parameters described herein, to determine
percent sequence identity for the nucleic acids and proteins of the
invention. Software for performing BLAST analyses is publicly
available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/). This algorithm involves first
identifying high scoring sequence pairs (HSPs) by identifying short
words of length W in the query sequence, which either match or
satisfy some positive-valued threshold score T when aligned with a
word of the same length in a database sequence. T is referred to as
the neighborhood word score threshold (Altschul et al., supra).
These initial neighborhood word hits act as seeds for initiating
searches to find longer HSPs containing them. The word hits are
extended in both directions along each sequence for as far as the
cumulative alignment score can be increased. Cumulative scores are
calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always >0) and N
(penalty score for mismatching residues; always <0). For amino
acid sequences, a scoring matrix is used to calculate the
cumulative score. Extension of the word hits in each direction are
halted when: the cumulative alignment score falls off by the
quantity X from its maximum achieved value; the cumulative score
goes to zero or below, due to the accumulation of one or more
negative-scoring residue alignments; or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a wordlength (W) of 11, an
expectation (E) of 10, M=5, N=-4 and a comparison of both strands.
For amino acid sequences, the BLASTP program uses as defaults a
wordlength of 3, and expectation (E) of 10, and the BLOSUM62
scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10,
M=5, N=-4, and a comparison of both strands.
[0035] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in either single- or
double-stranded form, and complements thereof. The term encompasses
nucleic acids containing known nucleotide analogs or modified
backbone residues or linkages, which are synthetic, naturally
occurring, and non-naturally occurring, which have similar binding
properties as the reference nucleic acid, and which are metabolized
in a manner similar to the reference nucleotides. Examples of such
analogs include, without limitation, phosphorothioates,
phosphoramidates, methyl phosphonates, chiral-methyl phosphonates,
2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
[0036] Unless otherwise indicated, a particular nucleic acid
sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and
complementary sequences, as well as the sequence explicitly
indicated. Specifically, degenerate codon substitutions may be
achieved by generating sequences in which the third position of one
or more selected (or all) codons is substituted with mixed-base
and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.
19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608
(1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The
term nucleic acid is used interchangeably with gene, cDNA, mRNA,
oligonucleotide, and polynucleotide.
[0037] A particular nucleic acid sequence also implicitly
encompasses "splice variants." Similarly, a particular protein
encoded by a nucleic acid implicitly encompasses any protein
encoded by a splice variant of that nucleic acid. "Splice
variants," as the name suggests, are products of alternative
splicing of a gene. After transcription, an initial nucleic acid
transcript may be spliced such that different (alternate) nucleic
acid splice products encode different polypeptides. Mechanisms for
the production of splice variants vary, but include alternate
splicing of exons. Alternate polypeptides derived from the same
nucleic acid by read-through transcription are also encompassed by
this definition. Any products of a splicing reaction, including
recombinant forms of the splice products, are included in this
definition. An example of potassium channel splice variants is
discussed in Leicher, et al., J. Biol. Chem. 273(52):35095-35101
(1998).
[0038] The terms "polypeptide," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid
residues. The terms apply to amino acid polymers in which one or
more amino acid residue is an artificial chemical mimetic of a
corresponding naturally occurring amino acid, as well as to
naturally occurring amino acid polymers and non-naturally occurring
amino acid polymer.
[0039] The term "amino acid" refers to naturally occurring and
synthetic amino acids, as well as amino acid analogs and amino acid
mimetics that function in a manner similar to the naturally
occurring amino acids. Naturally occurring amino acids are those
encoded by the genetic code, as well as those amino acids that are
later modified, e.g., hydroxyproline, .gamma.-carboxyglutamate, and
O-phosphoserine. Amino acid analogs refers to compounds that have
the same basic chemical structure as a naturally occurring amino
acid, i.e., an .alpha. carbon that is bound to a hydrogen, a
carboxyl group, an amino group, and an R group, e.g., homoserine,
norleucine, methionine sulfoxide, methionine methyl sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified
peptide backbones, but retain the same basic chemical structure as
a naturally occurring amino acid. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the
general chemical structure of an amino acid, but that functions in
a manner similar to a naturally occurring amino acid.
[0040] Amino acids may be referred to herein by either their
commonly known three letter symbols or by the one-letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
Nucleotides, likewise, may be referred to by their commonly
accepted single-letter codes.
[0041] "Conservatively modified variants" applies to both amino
acid and nucleic acid sequences. With respect to particular nucleic
acid sequences, conservatively modified variants refers to those
nucleic acids which encode identical or essentially identical amino
acid sequences, or where the nucleic acid does not encode an amino
acid sequence, to essentially identical sequences. Because of the
degeneracy of the genetic code, a large number of functionally
identical nucleic acids encode any given protein. For instance, the
codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
Thus, at every position where an alanine is specified by a codon,
the codon can be altered to any of the corresponding codons
described without altering the encoded polypeptide. Such nucleic
acid variations are "silent variations," which are one species of
conservatively modified variations. Every nucleic acid sequence
herein which encodes a polypeptide also describes every possible
silent variation of the nucleic acid. One of skill will recognize
that each codon in a nucleic acid (except AUG, which is ordinarily
the only codon for methionine, and TGG, which is ordinarily the
only codon for tryptophan) can be modified to yield a functionally
identical molecule. Accordingly, each silent variation of a nucleic
acid which encodes a polypeptide is implicit in each described
sequence with respect to the expression product, but not with
respect to actual probe sequences.
[0042] As to amino acid sequences, one of skill will recognize that
individual substitutions, deletions or additions to a nucleic acid,
peptide, polypeptide, or protein sequence which alters, adds or
deletes a single amino acid or a small percentage of amino acids in
the encoded sequence is a "conservatively modified variant" where
the alteration results in the substitution of an amino acid with a
chemically similar amino acid. Conservative substitution tables
providing functionally similar amino acids are well known in the
art. Such conservatively modified variants are in addition to and
do not exclude polymorphic variants, interspecies homologs, and
alleles of the invention.
[0043] The following eight groups each contain amino acids that are
conservative substitutions for one another: 1) Alanine (A), Glycine
(G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N),
Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I),
Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F),
Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8)
Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins
(1984)).
[0044] A "label" or a "detectable moiety" is a composition
detectable by spectroscopic, photochemical, biochemical,
immunochemical, chemical, or other physical means. For example,
useful labels include .sup.32P, fluorescent dyes, electron-dense
reagents, enzymes (e.g., as commonly used in an ELISA), biotin,
digoxigenin, or haptens and proteins which can be made detectable,
e.g., by incorporating a radiolabel into the peptide or used to
detect antibodies specifically reactive with the peptide.
[0045] The term "recombinant" when used with reference, e.g., to a
cell, or nucleic acid, protein, or vector, indicates that the cell,
nucleic acid, protein or vector, has been modified by the
introduction of a heterologous nucleic acid or protein or the
alteration of a native nucleic acid or protein, or that the cell is
derived from a cell so modified. Thus, for example, recombinant
cells express genes that are not found within the native
(non-recombinant) form of the cell or express native genes that are
otherwise abnormally expressed, under expressed or not expressed at
all.
[0046] The term "heterologous" when used with reference to portions
of a nucleic acid indicates that the nucleic acid comprises two or
more subsequences that are not found in the same relationship to
each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated
genes arranged to make a new functional nucleic acid, e.g., a
promoter from one source and a coding region from another source.
Similarly, a heterologous protein indicates that the protein
comprises two or more subsequences that are not found in the same
relationship to each other in nature (e.g., a fusion protein).
[0047] The phrase "stringent hybridization conditions" refers to
conditions under which a probe will hybridize to its target
subsequence, typically in a complex mixture of nucleic acids, but
to no other sequences. Stringent conditions are sequence-dependent
and will be different in different circumstances. Longer sequences
hybridize specifically at higher temperatures. An extensive guide
to the hybridization of nucleic acids is found in Tijssen,
Techniques in Biochemistry and Molecular Biology--Hybridization
with Nucleic Probes, "Overview of principles of hybridization and
the strategy of nucleic acid assays" (1993). Generally, stringent
conditions are selected to be about 5-10.degree. C. lower than the
thermal melting point (T.sub.m) for the specific sequence at a
defined ionic strength pH. The T.sub.m is the temperature (under
defined ionic strength, pH, and nucleic concentration) at which 50%
of the probes complementary to the target hybridize to the target
sequence at equilibrium (as the target sequences are present in
excess, at T.sub.m, 50% of the probes are occupied at equilibrium).
Stringent conditions may also be achieved with the addition of
destabilizing agents such as formamide. For selective or specific
hybridization, a positive signal is at least two times background,
preferably 10 times background hybridization. Exemplary stringent
hybridization conditions can be as following: 50% formamide,
5.times.SSC, and 1% SDS, incubating at 42.degree. C., or,
5.times.SSC, 1% SDS, incubating at 65.degree. C., with wash in
0.2.times.SSC, and 0.1% SDS at 65.degree. C.
[0048] Nucleic acids that do not hybridize to each other under
stringent conditions are still substantially identical if the
polypeptides which they encode are substantially identical. This
occurs, for example, when a copy of a nucleic acid is created using
the maximum codon degeneracy permitted by the genetic code. In such
cases, the nucleic acids typically hybridize under moderately
stringent hybridization conditions. Exemplary "moderately stringent
hybridization conditions" include a hybridization in a buffer of
40% formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
1.times.SSC at 45.degree. C. A positive hybridization is at least
twice background. Those of ordinary skill will readily recognize
that alternative hybridization and wash conditions can be utilized
to provide conditions of similar stringency. Additional guidelines
for determining hybridization parameters are provided in numerous
reference, e.g., and Current Protocols in Molecular Biology, ed.
Ausubel, et al.
[0049] For PCR, a temperature of about 36.degree. C. is typical for
low stringency amplification, although annealing temperatures may
vary between about 32.degree. C. and 48.degree. C. depending on
primer length. For high stringency PCR amplification, a temperature
of about 62.degree. C. is typical, although high stringency
annealing temperatures can range from about 50.degree. C. to about
65.degree. C., depending on the primer length and specificity.
Typical cycle conditions for both high and low stringency
amplifications include a denaturation phase of 90.degree.
C.-95.degree. C. for 30 sec-2 min., an annealing phase lasting 30
sec.-2 min., and an extension phase of about 72.degree. C. for 1-2
min. Protocols and guidelines for low and high stringency
amplification reactions are provided, e.g., in Innis et al. (1990)
PCR Protocols, A Guide to Methods and Applications, Academic Press,
Inc. N.Y.).
[0050] "Antibody" refers to a polypeptide comprising a framework
region from an immunoglobulin gene or fragments thereof that
specifically binds and recognizes an antigen. The recognized
immunoglobulin genes include the kappa, lambda, alpha, gamma,
delta, epsilon, and mu constant region genes, as well as the myriad
immunoglobulin variable region genes. Light chains are classified
as either kappa or lambda. Heavy chains are classified as gamma,
mu, alpha, delta, or epsilon, which in turn define the
immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
Typically, the antigen-binding region of an antibody will be most
critical in specificity and affinity of binding.
[0051] An exemplary immunoglobulin (antibody) structural unit
comprises a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each
chain defines a variable region of about 100 to 110 or more amino
acids primarily responsible for antigen recognition. The terms
variable light chain (V.sub.L) and variable heavy chain (V.sub.H)
refer to these light and heavy chains respectively.
[0052] Antibodies exist, e.g., as intact immunoglobulins or as a
number of well-characterized fragments produced by digestion with
various peptidases. Thus, for example, pepsin digests an antibody
below the disulfide linkages in the hinge region to produce
F(ab)'.sub.2, a dimer of Fab which itself is a light chain joined
to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)'.sub.2 may be
reduced under mild conditions to break the disulfide linkage in the
hinge region, thereby converting the F(ab)'.sub.2 dimer into an
Fab' monomer. The Fab' monomer is essentially Fab with part of the
hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill will appreciate that
such fragments may be synthesized de novo either chemically or by
using recombinant DNA methodology. Thus, the term antibody, as used
herein, also includes antibody fragments either produced by the
modification of whole antibodies, or those synthesized de novo
using recombinant DNA methodologies (e.g., single chain Fv) or
those identified using phage display libraries (see, e.g.,
McCafferty et al., Nature 348:552-554 (1990))
[0053] For preparation of antibodies, e.g., recombinant,
monoclonal, or polyclonal antibodies, many technique known in the
art can be used (see, e.g., Kohler & Milstein, Nature
256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983);
Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy,
Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology
(1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988);
and Goding, Monoclonal Antibodies: Principles and Practice (2d ed.
1986)). The genes encoding the heavy and light chains of an
antibody of interest can be cloned from a cell, e.g., the genes
encoding a monoclonal antibody can be cloned from a hybridoma and
used to produce a recombinant monoclonal antibody. Gene libraries
encoding heavy and light chains of monoclonal antibodies can also
be made from hybridoma or plasma cells. Random combinations of the
heavy and light chain gene products generate a large pool of
antibodies with different antigenic specificity (see, e.g., Kuby,
Immunology (3.sup.rd ed. 1997)). Techniques for the production of
single chain antibodies or recombinant antibodies (U.S. Pat. No.
4,946,778, U.S. Pat. No. 4,816,567) can be adapted to produce
antibodies to polypeptides of this invention. Also, transgenic
mice, or other organisms such as other mammals, may be used to
express humanized or human antibodies (see, e.g., U.S. Pat. Nos.
5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016,
Marks et al., Bio/Technology 10:779-783 (1992); Lonberg et al.,
Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994);
Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger,
Nature Biotechnology 14:826 (1996); and Lonberg & Huszar,
Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage
display technology can be used to identify antibodies and
heteromeric Fab fragments that specifically bind to selected
antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990);
Marks et al., Biotechnology 10:779-783 (1992)). Antibodies can also
be made bispecific, i.e., able to recognize two different antigens
(see, e.g., WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659
(1991); and Suresh et al., Methods in Enzymology 121:210 (1986)).
Antibodies can also be heteroconjugates, e.g., two covalently
joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No.
4,676,980, WO 91/00360; WO 92/200373; and EP 03089).
[0054] Methods for humanizing or primatizing non-human antibodies
are well known in the art. Generally, a humanized antibody has one
or more amino acid residues introduced into it from a source which
is non-human. These non-human amino acid residues are often
referred to as import residues, which are typically taken from an
import variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (see, e.g., Jones et
al., Nature 321:522-525 (1986); Riechmann et al., Nature
332:323-327 (1988); Verhoeyen et al., Science 239:1534-1536 (1988)
and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992)), by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such humanized
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0055] A "chimeric antibody" is an antibody molecule in which (a)
the constant region, or a portion thereof, is altered, replaced or
exchanged so that the antigen binding site (variable region) is
linked to a constant region of a different or altered class,
effector function and/or species, or an entirely different molecule
which confers new properties to the chimeric antibody, e.g., an
enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the
variable region, or a portion thereof, is altered, replaced or
exchanged with a variable region having a different or altered
antigen specificity.
[0056] In one embodiment, the antibody is conjugated to an
"effector" moiety. The effector moiety can be any number of
molecules, including labeling moieties such as radioactive labels
or fluorescent labels, or can be a therapeutic moiety. In one
aspect the antibody modulates the activity of the protein.
[0057] The phrase "specifically (or selectively) binds" to an
antibody or "specifically (or selectively) immunoreactive with,"
when referring to a protein or peptide, refers to a binding
reaction that is determinative of the presence of the protein,
often in a heterogeneous population of proteins and other
biologics. Thus, under designated immunoassay conditions, the
specified antibodies bind to a particular protein at least two
times the background and more typically more than 10 to 100 times
background. Specific binding to an antibody under such conditions
requires an antibody that is selected for its specificity for a
particular protein. For example, polyclonal antibodies can be
selected to obtain only those polyclonal antibodies that are
specifically immunoreactive with the selected antigen and not with
other proteins. This selection may be achieved by subtracting out
antibodies that cross-react with other molecules. A variety of
immunoassay formats may be used to select antibodies specifically
immunoreactive with a particular protein. For example, solid-phase
ELISA immunoassays are routinely used to select antibodies
specifically immunoreactive with a protein (see, e.g., Harlow &
Lane, Antibodies, A Laboratory Manual (1988) for a description of
immunoassay formats and conditions that can be used to determine
specific immunoreactivity).
[0058] By "therapeutically effective dose" herein is meant a dose
that produces effects for which it is administered. The exact dose
will depend on the purpose of the treatment, and will be
ascertainable by one skilled in the art using known techniques
(see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3,
1992); Lloyd, The Art, Science and Technology of Pharmaceutical
Compounding (1999); and Pickar, Dosage Calculations (1999)).
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1. Schematic representation of FUhLucW, FUIntronRW and
CCRMDRsc1. FUhLucW and FUIntronRW have the CMV enhancer and
CCRMDRsc1 has the RSV enhancer/promoter substituted for the U3
region of the 5' LTR. AU3 denotes a deletion in the U3 region of
the 3' LTR that renders the 5' LTR of the integrated provirus
transcriptionally inactive. FUhLucW and FUIntronRW have the
Ubiqutin-C promoter as an internal promoter to express humanized
Firefly luciferase or humanized Renilla luciferase respectively.
CCRMDRsc1 has the CMV promoter as internal promoter to express
MDRsc1 (P-glycoprotein). All vectors have the central polypurine
tract (cPPT). FUhLucW and FUIntronRW contain the Woodchuck
hepatitis virus post transcriptional element (WRE). CCRMDRsc1 has
the human hepatitis virus post-transcriptional element (PRE).
FUIntronRW has a chimeric intron derived from phRL-CMV.
[0060] FIG. 2. HIV vector pseudotyped by ZZ SINDBIS has
non-specific infectivity in the absence of target specific antibody
in vitro and in vivo. a) 293T cells (2.times.10.sup.5) were
infected with TRIP GFP (ZZ SINDBIS) (34 ng of HIV p24) with or
without anti-HLA (1 .mu.g/ml). For comparison of titers, cells were
infected with TRIP GFP (VSV-G) (8 ng of HIV p24). Three days after
infection, EGFP expression was analyzed by flow cytometry. The
titers of TRIP GFP (ZZ SINDBIS) and TRIP GFP (VSV-G) with 1
.mu.g/ml of anti-HLA were 3.times.10.sup.5 and 1.3.times.10.sup.6
EGFP transduction units/100 ng HIV p24. (b) FUhLucW (VSV-G) (15 pg
HIV p24), FUhLucW (Sindbis) (30 .mu.g HIV p24) and FUhLucW (ZZ
SINDBIS) (30 .mu.g HIV p24) were injected intravenously through the
tail vein. Five days after injection, mice were anesthetized and
injected intraperitonially with 30 .mu.g of D-luciferin. The
reporter gene (Firefly luciferase) expression was imaged using a
CCCD camera for 1 min prior to imaging. The acquisition time was
determined to avoid saturation of the signal.
[0061] FIG. 3. Anti-SINDBIS virus antibody blocked non-specific
background infectivity of the ZZ SINDBIS pesudotyped lentiviral
vector. TRIP GFP (VSV-G) (3 ng HIV p24), TRIP GFP (Sindbis) (35 ng
HIV p24) and TRIP GFP (ZZ SINDBIS 103 ng HIV p24) were incubated
with anti-Sindbis virus antibody (0.1% volume) or control antibody
for 1 hour at 4.degree. C. The viruses were used for infection of
293T cells (2.times.10.sup.5).
[0062] FIG. 4. Schematic representation of mutated domains and
mutants.
[0063] FIG. 5. Analysis of the m168 mutant by flow cytometry and
Western blotting. (a) 293T cells (1.times.10.sup.5) were infected
with 200 .mu.l of unconcentrated TRIP GFP (ZZ SINDBIS) (24 ng HIV
p24) or TRIP GFP (m168) (40 ng HIV p24) with or without anti-HLA (1
.mu.g/ml). Three days after infection, EGFP expression was analyzed
by flow cytometry. (b) SDS-PAGE and Western blotting of ZZ SINDBIS
and m168 pseudotyped virions. Ultracentrifuged samples of HIV
vectors (FUhLucW) pseudotyped by ZZ SINDBIS or m168 were lysed and
subjected to SDS-polyacrylamide gel electrophoresis and Western
blotting as described in the Methods section. The amount of virus
for each sample was normalized by the amount of HIV p24 antigen (5
ng/sample). Viral proteins were detected with anti-Sindbis virus
mouse immune ascites fluid. The band at approximately 65 kD in the
ZZ SINDBIS lane is the chimeric E2 protein. The band at
approximately 75 kD in the m168 lane is chimeric E2 protein with
uncleaved E3 protein.
[0064] FIG. 6. The m168 pseudotyped lentiviral vector has reduced
non-specific infectivity in vivo. FUhLucW (ZZ SINDBIS) (30 .mu.g
HIV p24) and FUhLucW (m168) were each injected into 3 mice via the
tail vein. Five days after injection, mice were anesthetized and
injected intraperitonially with D-luciferin (30 .mu.g). The
reporter gene (Firefly luciferase) expression was imaged in the
dorsal and abdominal aspects of the mice using a CCCD camera for 1
min. The acquisition time was determined to avoid saturation of the
signal.
[0065] FIG. 7. The m168 pseudotyped lentiviral vector mediates
antibody-directed targeted gene transduction after systemic
injection into mouse. Renilla luciferase expressing B16F10MDR5
(2.times.10.sup.5 cells in 150 .mu.l of PBS) were injected into
mice via the tail vein. Thirty minutes later, FUhLucW (ZZ SINDBIS)
or FUhLucW (m168) to which we had added anti P-glycoprotein
monoclonal antibody or isotype (IgG2a) control antibody (10
.mu.g/ml) was injected into the tail vein. The amount of each virus
used for injection was normalized to the amount of HIV p24 (36
.mu.g of HIV p24 in 150 .mu.l PBS). Ten days later, the level of
metastasis in the lungs of mice that had received B16F10MDR5 was
investigated by CCCD imaging to determine the level of Renilla
luciferase expression as described in the Methods section. Twelve
days after cell and virus injection, virus infection was determined
by imaging the expression level of Firefly luciferase reporter gene
as described in the Methods section.
[0066] FIG. 8. Nucleic acid sequence encoding ZZ SINDBIS.
[0067] FIG. 9. Nucleic acid sequence encoding m168.
[0068] FIG. 10. Immunohistochemical analysis of metastasized tumors
targeted by FUGW (m168) with anti-P-Glycoprotein. Frozen sections
were prepared from the lungs of mice injected with B16F10 MDR5
cells and FUGW (m168) plus anti-P-Glycoprotein. Serial 10 .mu.m
sections were prepared and processed. a) Slides were stained for
hematoxylin-eosin (HE). b) An adjacent serial section (to that
shown in (a)) was stained for transgene expression (EGFP) and
nuclei (DAPI). c) Another adjacent serial section was stained for
melanoma antigen (S-100) and nuclei (DAPI). d) A EGFP and S-100
positive colony stained with HE is pictured at a higher
magnification to show the morphology of the colony.
[0069] FIG. 11. Confocal microscopy analysis of frozen liver
sections prepared from mice which had been injected with B16F10
MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and
anti-P-Glycoprotein. The sections were stained for Kupffer cell
marker F4/80 (red) and EGFP (green).
[0070] FIG. 12. a) Flow cytometric analysis of Mac-1 expression on
splenocytes of NOD/SCID mice. b) Flow cytometric analysis of EGFP
expression in splenocytes isolated from mice injected with
B16F10MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and
anti-P-Glycoprotein. The cells were stained to determine Mac-1
expression. EGFP expression in Mac-1 positive and negative
population was analyzed.
[0071] FIG. 13. (a) B16F10MDR5 cells were injected into mice via
the tail vein. Twelve days later, FUhLucW (m168), to which we had
added anti-P-glycoprotein monoclonal antibody or isotype control
antibody, or FUhLucW (VSV-G) was injected into the tail vein. The
amount of each virus used for injection was normalized to the
amount of HIV p24 (2.5 .mu.g of HIV p24 in 250 .mu.l PBS). Fifteen
days after virus injection, virus infection was determined by
imaging the level of Firefly luciferase reporter gene expression.
(b) The mice were sacrificed immediately after whole body imaging
and each organ was isolated to image luciferase expression.
[0072] FIG. 14. Prostate cells can be targeted in vitro through the
prostate stem cell antigen. LPSCA4 cells were derived from LNCaP
cells after stable transfection of the prostate stem cell antigen
(PSCA). 1.times.10.sup.5 LNCaP and LPSCA4 cells were infected with
FUGW pseudotyped with m168 envelope (12 ng HIV-1 p24) without Ab
targeting, or with .alpha.HLA or 1G8 mAb (1G8 mAB recognizes PSCA
(Saffran, et al., Proc Natl Acad Sci (2001) 98:2658-2663)). Three
days after infection, eGFP expression was analyzed by flow
cytometry (ten thousand events acquired per sample). The x-axis
indicates eGFP fluorescence intensity. Percentage and mean
flourescence intensity of the positive population (R2) is indicated
in each plot. Infection of LPSCA4 cells targeted with 1G8 is
comparable to infection targeted with .alpha.HLA, whereas in LNCaP
cells targeting with 1G8 antibody gives background levels similar
to those without any antibody targeting.
[0073] FIG. 15. Transcription from the PSE-BC promoter in vitro in
prostate cell lines (A) and non-prostate cell lines (B).
1.times.10.sup.5 cells were infected with lentivirus vectors
expressing eGFP under the control of the ubiquitin-C promoter
(FUGW) or the PSE-BC promoter (FPGW) pseudotyped with VSV G (40 ng
of HIV-1 p24). Three days after infection eGFP expression was
analyzed by flow cytometry (ten thousand events acquired per
sample). The x-axis indicates eGFP fluorescence intensity.
Percentage and mean fluorescence intensity of the positive
population (R2) is indicated in each plot. Expression from the
PSE-BC promoter is comparable to ubiquitin-C promoter in prostate
cell lines and up to 30 times lower in non-prostate cell lines.
[0074] FIG. 16. New targeting envelope (2.2), comprised of m168+E1
AK226-227SG, mediated transferrin receptor (TfR) targeted gene
transduction more efficiently than previous targeting envelope
(m168). 4.times.10.sup.4 HUVEC cells were infected with lentiviral
vector (40 ng HIV-1 p24) pseudotyped with m168 envelope protein or
2.2 envelope protein with or without anti-transferrin receptor
antibody (2 .mu.g/ml). The lentiviral vector carried EGFP as
reporter gene. Three days after infection, EGFP expression was
analyzed by flow cytometry. The X-axis indicates EGFP fluorescence
intensity. Percentage of the positive population is indicated in
each plot.
[0075] FIG. 17. Targeting envelope mediates targeted gene
transduction to CNS via transferrin receptor (TfR). Lentiviral
vector (3 .mu.g HIV-1 p24) pseudotyped with 2.2 envelope protein
was injected into NOD/SCID mice via the tail vein with or without
anti-transferrin receptor antibody (50 .mu.g/ml). The lentiviral
vector carried Firefly luciferase as reporter gene. Five days after
injection, mice were anesthetized and injected intraperitoneally
with D-luciferin (30 ng). The reporter gene expression was imaged
using a CCCD camera. Luciferase expression from the brain and
spinal column was confirmed by removing the skin from the back
after sacrifice.
DETAILED DESCRIPTION
[0076] Targeted gene transduction to specific tissues and organs
via intravenous injection would be the ultimate preferred method of
gene delivery. Here, we report successful targeting in a living
animal via intravenous injection of a lentiviral vector pseudotyped
with a modified chimeric Sindbis virus envelope. After intravenous
administration into mice, the previously reported parental vector
has non-specific infectivity in liver and spleen due to the
residual natural tropism of Sindbis virus. Mutagenesis of domains
within the Sindbis envelope ablated regions necessary for this
natural tropism. M168 pseudotypes had significantly less
non-specific infectivity to liver and spleen and these pseudotypes
have high titer and high targeting specificity. A murine cancer
model for metastatic melanoma was utilized to test specific
targeting with m168. Human P-glycoprotein was ectopically expressed
on the surface of melanoma cells and targeted by the m168
pseudotyped lentiviral vector conjugated with anti P-glycoprotein
antibody. M168 pseudotypes successfully targeted metastatic
melanoma cells growing in the lung after systemic administration
via tail vein injection. This targeting technology has applications
not only for cancers but also for genetic, infectious and
autoimmune diseases.
[0077] The present invention therefore provides a pseudotyped virus
or viral vector comprising an envelope comprising Sindbis E1, E2,
and E3 proteins linked to a targeting moiety. The vector optionally
further comprises a viral nucleic acid genome from the Retroviridae
family, preferably the lentiviral genus. The vector can also
optionally comprise a heterologous gene.
[0078] Structurally, at least one of the E1, E2, or E3 proteins has
one or more mutations (preferably point mutations) in comparison to
a wild type sequence in order to provide altered titer,
specificity, specificity index, tropism, or host immune reaction.
Combinations of mutated E1, E2, and E3 are also contemplated by the
invention. Functionally, the mutated Sinbis viral envelope proteins
of the present invention have a decreased ability to bind to
endogenous receptors, including glycosaminoglycans (e.g., heparin
sulfate). In certain embodiments, the pseudotyped virus vectors are
isolated.
[0079] In certain embodiments, the pseudotyped viruses comprise one
or more of the following mutations in a wild-type Sindbis or the
Sindbis ZZ envelope sequence (SEQ ID NO:2): m1 (deletion of E3
amino acids 61-64), m2 (E2 R1D), m3 (m1+m2), m4 (deletion of E2
amino acids 68-71), m5 (E2 S114 P), m6 (E2 KE159-160AA), m7 (E2
E216A T218A), m8 (E2 SLKQ68-71AAAA), m9 (E3 RSKRS60-64AAAAA), m16
(m1+m6), m17 (m1+m7), m18 (m1+m8) or E1 AK226-227SG. In one
embodiment, the mutation is exemplified by the m168 sequence (SEQ
ID NO:4), which comprises the mutations m1 (deletion of E3 amino
acids 61-64), m6 (E2 KE159-160AA), and m8 (E2 SLKQ68-71AAAA). In
another embodiment, the m168 sequence comprises a further mutation
in the E1 domain that makes the m168 titer 2-10 fold higher. The
sequence "aagccttccgccaag" on the sequence of m168 was modified to
"aagccttcctccggg" (SEQ ID NOs: 5 and 6). In this embodiment, the
m168 sequence is further modified to eliminate cholesterol
dependence for cell entry, (e.g. E1 AK226-227SG).
[0080] Mutations into one or more of the Sindbis viral envelope
protein sequences can be introduced using any known methods in the
art. Mutations can be targeted or random. For example, targeted
mutations can be introduced using site-directed mutagenesis, for
instance employing overlapping PCR or overlap extension PCR (see,
for example, Aiyar, et al., Methods Mol Biol (1996) 57:177-91; and
Pogulis, et al., Methods Mol Biol (1996) 57:167-76). Alternatively,
mutations can be introduced by taking advantage of the error prone
replication process of Sindbis viruses, which lack proof-reading
and mismatch repair activities, and recombination between
quasispecies in a virus population, for instance, by using a
replication competent virus (see, Domingo and Holland, Annu Rev
Microbiol (1997) 51:151-178). Mutant Sindbis virus envelope
proteins of particular interest have a diminished ability to bind
to endogenous receptors and therefore demonstrate decreased
background infectivity in comparison to wild-type sequences.
Preferably, the mutated Sinbis virus envelope proteins of the
present invention have a decreased ability to bind to
glycosaminoglycans (GAGs), including heparin sulfate (HS), in
comparison to wild-type sequences.
[0081] The targeting moiety is covalently or non-covalently linked
to the E1, E2, or E3 protein, preferably the E2 or E3 protein, or
is linked to another portion of the envelope. In one embodiment,
the targeting moiety is linked to E1, E2, or E3 via non-covalent
interactions with a protein binding domain, where the protein
binding domain is fused with E1, E2, or E3. In one embodiment, the
protein binding domain is fused with E2 or E3. Exemplary protein
binding domains include, e.g., the ZZ domain of protein A,
streptavidin, avidin, a leucine zipper, a STAT protein N terminal
domain, an FK506 binding protein, integrin binding sequence
"4C-RGD" (CDCRGDCFC encoded by tgcgactgtagaggcgactgtttctgc), and
transferrin receptor targeting sequence "B6" (GHKAKGPRK encoded by
ggacataaagctaagggtcctagaaag) (see, e.g., O'Shea, Science 254: 539
(1991), Barahmand-Pour et al., Curr. Top. Microbiol. Immunol.
211:121-128 (1996); Klemm et al., Annu. Rev. Immunol. 16:569-592
(1998); Klemm et al., Annu. Rev. Immunol. 16:569-592 (1998); Ho et
al, Nature 382:822-826 (1996); Pomeranz et al., Biochem. 37:965
(1998); and Xia, et al., J Virol (2000) 74:11359-66). In another
embodiment, the targeting moiety is a fusion protein with either
the E1, E2, or E3 protein. In one embodiment, the targeting moiety
is fused with the E2 or the E3 protein. The targeting moiety can
be, e.g., an antibody, such as a monoclonal or single chain
antibody that specifically binds to an antigen or a cell surface
molecule, or a ligand or binding partner of a cell surface
molecule.
[0082] The targeting moiety can target normal or diseased tissue.
For example, the targeting antigen can be directed to a transferrin
receptor for delivery of the present vectors across the blood-brain
barrier. The targeting moiety also can be directed to marker
proteins indicative of diseases including cancers (e.g., breast,
lung, ovarian, prostate, colon, lymphoma, leukemia, and melanoma);
autoimmune disease (e.g., myasthenia gravis, multiple sclerosis,
systemic lupus erythymatosis, rheumatoid arthritis, and diabetes
mellitus); infectious disease, including infection by HIV, HCV,
HBV, CMV, and HPV; and genetic diseases including sickle cell
anemia, cystic fibrosis, Tay-Sachs, .beta.-thalassemia,
neurofibromatosis, polycystic kidney disease, hemophilia, etc. In
certain embodiments, the targeting moiety targets a cell surface
antigen specific to a particular cell or tissue type, e.g.,
lymphocytes, myocytes, keratinocytes, neurons, hepatocytes, lung,
kidney, muscle, vascular, thyroid, ocular, breast, ovarian, testis,
prostate tissue.
[0083] Exemplary antigens and cell surface molecules for targeting
include, e.g., P-glycoprotein, Her2/Neu, erythropoietin (EPO),
epidermal growth factor receptor (EGFR), vascular endothelial
growth factor receptor (VEGF-R), cadherin, carcinoembryonic antigen
(CEA), CD4, CD8, CD19, CD20, CD33, CD34, CD45, CD117 (c-kit),
CD133, HLA-A, HLA-B, HLA-C, chemokine receptor 5 (CCR5), stem cell
marker ABCG2 transporter, ovarian cancer antigen CA125,
immunoglobulins, integrins, prostate specific antigen (PSA),
prostate stem cell antigen (PSCA), dendritic cell-specific
intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN),
thyroglobulin, granulocyte-macrophage colony stimulating factor
(GM-CSF), myogenic differentiation promoting factor-1 (MyoD-1),
Leu-7 (CD57), LeuM-1, cell proliferation-associated human nuclear
antigen defined by the monoclonal antibody Ki-67 (Ki-67), viral
envelope proteins, HIV gp120, transferrin receptor, etc. Any cell
surface protein, known in the art or yet to be identified,
preferentially expressed on a particular cell or tissue type can
find use as a potential target for the pseudotyped, targeted vector
of the invention.
[0084] The pseudotyped, targeted vectors of the invention can
optionally comprise a genomic nucleic acid. The nucleic acid genome
can be from any suitable virus and in one embodiment, is derived
from the Retroviridae family of viruses, e.g., from the lentiviral
genus: HIV1, HIV2, SIV, FIV, BIV, Visna, CAEV, and EIAV; and from
oncogenic retroviruses or oncoretroviruses, e.g., avian
sarcoma/leucosis viruses (ASLV); mammalian C-type viruses (murine
leukemia viruses (MuLV); feline leukemia viruses (FeLV)); B-type
viruses (mouse mammary tumor viruses (MMTV); D-type viruses; and
HTLV-BLV group of viruses (human T cell leukemia viruses (HTLV).
Preferably, the oncogenic retroviruses lack an oncogene.
Retroviruses are reviewed in Coffin, et al., Retroviruses, 1997,
Cold Spring Harbor Laboratory Press. The nucleic acid genome is
based on any suitable virus, and contains genetic components and
encodes proteins so that the genome can be replicated and
transcribed. However, vectors of the present invention can be
replication competent or replication incompetent. In one
embodiment, the nucleic acid genome is from the family Retroviridae
and contains genetic components and encodes proteins so that it can
be reverse transcribed and integrated into the host genome.
Optionally, the genome is replication incompetent so that it cannot
make productive, infectious viral particles. In certain
embodiments, the genome is replication competent. Retroviral
nucleic acid genomes known to those of skill in the art can be used
in the invention, or made according to methods known to those of
skill in the art (see, Coffin, et al, supra). Within the genome,
the E1, E2, E3 and optional heterologous gene sequences can be
encoded as individual polypeptides, or one or more fusion proteins.
The E1, E2, E3 and optional heterologous gene sequences can be on
the same or separate nucleic acid sequences. The nucleic acid
genome can be RNA or DNA.
[0085] Vectors that do not comprise a genomic nucleic acid find use
in the targeted delivery of a desired protein. For example, a
protein to be delivered can be expressed as a fusion protein with a
viral protein that is incorporated into a viral capsid. Viral
proteins that are incorporated into a capsid shell, including, for
example, the virion-associated regulatory proteins, viral protein r
(VPR), viral protein x (VPX); and integrase, are well known in the
art. See, for example, Wu, et al., J Virol (1995) 69:3389-98; and
Katz, et al., Virology (1996) 217:178-90.
[0086] The genome also optionally comprises a heterologous gene
operably linked to a promoter, either a viral promoter or a
heterologous promoter. The heterologous gene can be a marker gene,
a cytotoxic gene, a gene encoding an inhibitory sequence or protein
for therapeutic applications, or a gene encoding a wild type
protein for gene therapy applications. Exemplary marker genes
include luciferase, a fluorescent protein (green fluorescent
protein, red fluorescent protein, yellow fluorescent protein), and
.beta.-galactosidase. Exemplary cytotoxic genes include ricin,
tumor necrosis factor (TNF) and apoptin. Exemplary inhibitory
sequences include those that encode antisense RNA, small inhibitory
RNA, oligonucleotide aptamers, and antibodies. Exemplary wild-type
proteins for gene therapy applications include glial cell-derived
neurotrophic factor (GDNF), Factor VIII, adenosine deaminase (ADA),
hypoxanthine guanine phosphoribosyl transferase, LDL receptor,
cystic fibrosis (CF) transmembrane conductance regulators (CFTR),
hexosaminidase gene (HEXA), hemoglobin, .beta.-globin,
proliferative kidney disease 1 gene (PKD1) and tumor suppressor
genes including neurofibromatosis gene (NF1 and NF2), breast cancer
marker genes (BRCA1 and BRCA2), retinoblastoma gene (Rb),
von-Hippel Lindau gene (VHL). Additional heterologous genes of use
in the present invention are described in, for example, Strachan
and Read, Human Genetics 2, 2.sup.nd Ed., 1999, BIOS Scientific
Publishers Ltd.; Gene Therapy in Inflammatory Diseases, Evans and
Robbing, eds., 2000, Springer Verlag; Vascular Disease: Molecular
Biology and Gene Therapy Protocols, Baker, ed., 1999, Human Press;
Cancer Gene Therapy, Curiel and Douglas, 2005, Human Press; Gene
Therapy for Autoimmune Diseases, 2004, Kluwer Academic Pub.; and
Progress In Gene Technology And Skin Gene Therapy: Special Issue
Cells Tissues Organs 2004, Hengge, ed., 2004, S Karger Pub.
[0087] The promoter can be a constitutive promoter (e.g.,
ubiquitin, actin) or an inducible promoter (e.g. metallothionein).
In certain embodiments, the promoter allows for preferential
expression of a heterologous gene in tissues of interest, including
for example, prostate tissue (e.g., a prostate specific antigen
(PSA) promoter (PSE-BC; see, Adams, et al., Nat Med (2002)
8:891-897; and Wu, et al., Gene Ther (2001) 8:1416-1426); testis
tissue (Grimes, Gene (2004) 343:11-22; cardiovascular tissue (Beck,
et al., Curr Gene Ther (2004) 4:457-467; breast tissue (e.g., a
mammoglobin promoter; see, Goedegebuure, et al., Curr Cancer Drug
Targets (2004) 4:531-542); thyroid tissue (e.g., a thyroglobulin
promoter; see, DeGroot, and Zhang, Curr Drug Targets Immune Endocr
Metabol Disord (2004) 4:235-44); a gastrointestinal tissue (e.g.,
UDP glucuronosyltransferase promoter; see, Gregory, et al., Toxicol
Appl Pharmacol (2004) 199:354-63); and cervical tissue (see, Rein,
et al., J. Gene Med (2004) 6:1281-9). Tissue specific promoters of
use in cancer gene therapy are reviewed in Saukkonen and Hemminki,
Expert Opin Biol Ther (2004) 4:683-96. Tissue specific promoters of
use in the gene therapy treatment of prostate cancer are reviewed
in Shiradawa, et al., Mol Urol (2000) 4:73-82. Additional tissue
specific promoters of use in the present vectors and methods
include those reviewed in Hart, Semin Oncol (1996) 23:154-8.
[0088] Packaging cells and systems, packaging techniques and
vectors for packaging the nucleic acid genome into the pseudotyped
viral particle are also known to those of skill in the art and can
be made according to methods known to those of skill in the art
(see, for example, Polo, et al, Proc Natl Acad Sci USA, (1999)
96:4598-4603). Methods of packaging include using packaging cells
that permanently express the envelope components, or by transiently
transfecting cells with plasmids encoding the components of the
vector, or by using an adenoviral system that encodes the
components of the vector. Virus packaging cells and kits are
commercially available, for example, from BD Sciences/Clontech in
Mountain View, Calif.).
[0089] The pseudotyped virus of the invention can be used for
diagnostic and therapeutic applications, as well as for research
tool applications. Diagnostic applications include both in vitro,
ex vivo, and in vivo uses, e.g., in vivo imaging. Therapeutic
applications include both in vivo, in vitro, and ex vivo uses. For
example, a virus particle of the invention can be administered to a
subject via IV injection to treat or prevent cancers, e.g., breast,
lung, ovarian, prostate, colon, lymphoma, leukemia, and melanoma;
autoimmune disease such as myasthenia gravis, multiple sclerosis,
systemic lupus erythymatosis, rheumatoid arthritis, and diabetes
mellitus; infectious disease such as infection by HIV, HCV, HBV,
CMV, and HPV; and genetic diseases such as sickle cell anemia,
cystic fibrosis, Tay-Sachs, .beta.-thalassemia, neurofibromatosis,
polycystic kidney disease, hemophilia, etc. For in vivo
applications, preferably the targeting moiety is covalently linked.
The virus particles of the invention can also be administered ex
vivo, e.g., to whole bone marrow by targeting CD34+ cells with the
targeting moiety. In this embodiment, the targeting moiety can be
covalently or non-covalently linked (e.g., via protein A or its ZZ
domain). The virus particles can be used for diagnostic
applications with heterologous marker genes, and can be used as
research tools to transduce specific cell types. The targeted
Sindbis envelope of the invention can also be used to target cell
to cell interactions, by expressing the targeted envelope in a cell
such as a lympohocyte, and then allowing the cell to contact the
targeted cell in vivo, in vitro, or ex vivo.
[0090] The present invention also provides methods of purifying the
virus from cells. In one embodiment, the virus is purified from
cells by the following method: Virus is filtered through
0.22-microM-pore-size filter before concentration. Virus (30 mL)
was loaded onto sucrose cushion (7 mL) and spinned using SW32
(Beckman) roter. 20% Sucrose (wt/wt) in 1.times.PBS with 1 mM EDTA
was used for cushion. The spinning condition is 40000.times.g for
90 min at 4 degree. The supernatant is discarded and pellet is
resuspended in 300 microL of Hanks Balanced Salt Solution. The
concentrated virus is filtered again using same size filter before
administration into animal.
[0091] The present invention also provides methods of transducing
cells with the virus, as follows: some primarily hematopoietic
cells are resistant to gene transduction (primary T cells and stem
cell) in vitro. However changing the pH of the medium (7.4 to 5.5)
during gene transduction makes gene transduction efficiency higher.
(3-20 fold). This method is useful for ex vivo and in vitro
transduction of some cell types.
Pharmaceutical Compositions And Administration
[0092] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered (e.g., nucleic
acid, protein, virus or transduced cell), as well as by the
particular method used to administer the composition. Accordingly,
there are a wide variety of suitable formulations of pharmaceutical
compositions of the present invention (see, e.g., Remington's
Pharmaceutical Sciences, 17.sup.th ed., 1989). Administration can
be in any convenient manner, e.g., by injection, oral
administration, inhalation, transdermal application, or rectal
administration.
[0093] In the practice of this invention, compositions can be
administered, for example, by intravenous infusion, orally,
topically, intraperitoneally, intravesically or intrathecally.
Parenteral administration and intravenous administration are the
preferred methods of administration. The formulations of commends
can be presented in unit-dose or multi-dose sealed containers, such
as ampules and vials.
[0094] Injection solutions and suspensions can be prepared from
sterile powders, granules, and tablets of the kind previously
described. Cells transduced by nucleic acids for ex vivo therapy
can also be administered intravenously or parenterally as described
above.
[0095] The dose administered to a patient, in the context of the
present invention should be sufficient to effect a beneficial
therapeutic response in the patient over time. The dose will be
determined by the efficacy of the particular vector employed and
the condition of the patient, as well as the body weight or surface
area of the patient to be treated. The size of the dose also will
be determined by the existence, nature, and extent of any adverse
side-effects that accompany the administration of a particular
vector, or transduced cell type in a particular patient.
[0096] In determining the effective amount of the vector to be
administered in the treatment or prophylaxis of conditions owing to
diminished or aberrant expression of the protein, the physician
evaluates circulating plasma levels of the vector, vector
toxicities, progression of the disease, and the production of
anti-vector antibodies. In general, the dose equivalent of a naked
nucleic acid from a vector is from about 1 .mu.g to 100 .mu.g for a
typical 70 kilogram patient, and doses of vectors are calculated to
yield an equivalent amount of therapeutic nucleic acid.
[0097] For administration, compounds and transduced cells of the
present invention can be administered at a rate determined by the
LD-50 of the inhibitor, vector, or transduced cell type, and the
side-effects of the inhibitor, vector or cell type at various
concentrations, as applied to the mass and overall health of the
patient. Administration can be accomplished via single or divided
doses.
EXAMPLES
[0098] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1
Targeted Lentiviral Vectors with Mutated Sindbis Envelopes
Methods
[0099] Plasmid construction. All mutants of pIntron ZZ SINDBIS were
generated using a site directed mutagenesis kit (Stratagene, La
Jolla, Calif.). Initially, the envelope region of pIntronZZ SINDBIS
was cloned into pBS-SKII. Mutagenesis was performed using various
oligonucleotide corresponding to the mutations (Table 1) following
the manufacturer's protocol. The mutations were confirmed by
sequence analysis. The sequenced regions were then cloned back into
pIntron ZZSINBIS. CCR MDRsc1 was constructed from
pRRL-cPPTCMV-X-PRE (kindly provided by Dr. William Osborne) (Barry
et al., Hum. Gene Ther. 12, 1103-1108 (2001)) and ha-MDRsc (kindly
provided by Dr. Brian Sorrentino) (Bunting et al., Blood 92,
2269-2279 (1998)). FUhLucW was constructed from FUGW (kindly
provided by Dr. David Baltimore) and pGL3-Basic (Promega, Madison,
Wis.). FUIntronRW was constructed from FUGW and phRL-CMV
(Promega).
TABLE-US-00001 TABLE 1 Sindbis Envelope Mutations * Selectivity
Index ** Titer (% of ZZ SINDBIS) Mutant Domain Details of mutation
293T HepG2 293T HepG2 ZZ SINDBIS 9 4.9 100 100 m1 R1 deletion of E3
a.a. 61-64 21 11.4 38 69 m2 R1 E2 R1D 7.5 4.6 85 97 m3 R1 m1 + m2
21 9.8 30 64 m9 R1 E3 RSKRS60-64AAAAA 32 9.2 47 71 m4 R2 deletion
of E2 a.a. 68-71 11 5.3 30 59 m8 R2 E2 SLKQ68-71AAAA 17 5.7 101 78
m5 R3 E2 S114P *** *** *** *** m6 R4 E2 K159A E160A 10 4.9 113 95
m7 R5 E2 E216A T218A 11 4.6 111 86 1st combination of mutations ZZ
SINDBIS 34 6.9 100 100 m1 R1 deletion of E3 a.a. 61-64 132 13.2 40
109 m16 R1 + 4 m1 + m6 151 14.9 53 115 m17 R1 + 5 m1 + m7 80 12.0
21 87 m18 R1 + 2 m1 + m8 120 15.4 42 105 2nd combination of
mutations ZZ SINDBIS 42 6.3 100 100 m1 R1 deletion of E3 a.a. 61-64
127 14.8 68 133 m168 R1 + 2 + 4 m1 + m6 + m8 125 18.6 89 143 The
results are average of three independent infection and flow
cytrometry. a.a. is abbreviation of amino acid * Selectivity index
was calculated as follows: (% EGFP + cells infected in the presence
of anti-HLA monoclonal antibody)/(% EGFP + infected in the absence
of antibody) ** Titer was calculated as follows: (% EGFP positive
cells infected by lentiviral pseudotyped by each mutant in the
presence of anti-HLA monoclonal antibody)/(% EGFP positive cells
infected by lentiviral vector pseudotyped by ZZ SINDBIS in the
presence of anti-HLA monoclonal antibody) .times. 100 *** m5 did
not have any infectivity.
[0100] Cells. Hep G2 cells and B16F10 cells were purchased from
ATCC and cultured in DMEM (Invitrogen, Carlsbad, Calif.) containing
FCS (10%) (Hycione, Logan, Utah), penicillin (100 units/ml) and
streptomycin (100 .mu.g/ml). 293T cells were grown in IMDM (HRH
Biosciences, Lenexa, Kans.) containing FCS (10%), penicillin (100
units/ml) and streptomycin (100 .mu.g/ml). B16F10MDR 5 cells were
generated by stable gene transduction of CCRMDRsc1 (VSV-G). After
lentiviral gene transduction, cells were cloned by limiting
dilution. The clones were analyzed for the expression of MDR-1
(P-gp) by flow cytometry. The clone designated B16F10MDR5 showed
the highest level of the expression of the MDR-1 gene and was used
for all further experiments.
[0101] Virus production. All lentivirus vectors were produced by
calcium phosphate-mediated transient transfection of 293T cells.
293 T cells (1.8.times.10.sup.7) were transfected with pCMVR8.2DVPR
(12.5 .mu.g), the appropriate lentiviral vector plasmid (12.5
.mu.g), and pHCMVG (5 .mu.g) or pIntron SINDBIS, pIntron ZZ SINDBIS
or mutants derived thereof (10 .mu.g). For in vitro screening of
the mutant pIntron ZZ SINDBIS, TRIP GFP (kindly provided by Dr.
Pierre Charneau) (Zennou et al., Cell, 101, 173-185 (2000)) was
used as the lentiviral vector plasmid. CCRMDRsci was used as the
lentiviral vector and pHCMVG as the envelope plasmid for generation
of the MDR-1 expressing lentiviral vector. The Renilla luciferase
expressing lentiviral vector was generated using FUIntronRW as the
lentiviral vector plasmid and pHCMVG as the envelope plasmid.
FUhLucW was used as the lentivirus vector for generation of the
humanized Firefly luciferase expressing lentivirus vector.
[0102] Antibodies. Anti-HLA ABC was purchased from Sigma (St.
Louis, Mo.). Anti-P-gp (multiple drug resistant gene-1 product) was
purchased from Kamiya Biomedical Company (Seattle, Wash.).
Anti-Sindbis virus ascites fluid and control ascites fluid were
purchased from ATCC. Anti-mouse IL-2 receptor beta-chain (TM-Beta
1) was kindly provided by Dr. Masayukiso Miyasaka.
[0103] In vitro infection of cells. 293T cells (5.times.10.sup.4)
and HepG2 cells (5.times.10.sup.4) were seeded on 24-well plates
the day before infection. The cells were incubated with 200 .mu.l
of unconcentrated HIV vector (TRIP GFP) pseudotyped by ZZ SINDBIS
or its mutants with or without anti-HLA (1 .mu.g/ml) for 2 hours at
37.degree. C. with 5% CO.sub.2. The virus was removed and replaced
with fresh medium (1 ml). Three days post infection; the cells were
trypsinized and analyzed by flow cytometry. Background infectivity
of TRIP GFP (ZZ SINDBIS) was blocked by anti-Sindbis virus ascites
fluid. Anti-Sindbis virus ascites fluid or control acites fluid was
added to unconcentrated TRIP GFP (VSV-G), TRIP GFP (Sindbis) or
TRIP GFP (ZZ SINDBIS) (0.1% volume) and incubated for 1 hour at
4.degree. C. The virus was used for infection of 293T cells and
infectivity was analyzed as previously described.
[0104] Immunoblot assay. The HIV vectors (FUhLucW) pseudotyped with
ZZ SINDBIS or m168 were concentrated 100-fold by
ultracentrifugation and resuspended in PBS. The concentrated virus
was mixed with equal volume of electrophoresis loading buffer
[glycerol (20%), .beta.-mercaptoethanol (10%), sodium dodecyl
sulfate (4%), Tris-HCl pH 6.8 (125 mM), bromophenol blue (0.02%)]
and boiled for 5 min. The amount of virus sample was normalized to
the amount of HIV p24 (5 .mu.g of p24/lane). The samples were
subjected to electrophoresis through an SDS polyacrylamide gel
(10%) as described previously (Morizono et al., J. Virol.,
September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). Immunoblot
analysis was performed with anti-Sindbis virus ascites fluid and
horseradish peroxidase-conjugated anti-mouse antibody (Santa Cruz
Biotechnology, Santa Cruz, Calif.). The protein bands were
visualized by enhanced chemiluminescence (Pierce, Rockford,
Ill.).
[0105] In vivo analysis of background infection. HIV vector
(FUhLucW) pseudotyped by VSV-G, Sindbis virus, ZZ SINDBIS or m168
were injected into the tail vein of 6-week old female NOD/SCID
mouse. The amount injected for each virus was normalized to the
amount of HIV p24 (30 pg of HIV p24 in 300 .mu.l PBS). Five days
post injection, the mice were anesthetized and injected with
D-luciferin (3 mg/mouse) (Xenogen, Alameda, Calif.)
intraperitonially. CCCD images were obtained using a cooled IVIS
CCD camera (Xenogen), and analyzed with IGOR-PRO Living Image
Software. The data acquisition was performed 20 min after
D-luciferin injection for 1 min. Mice were sacrificed by CO.sub.2
narcosis after CCCD imaging. The organs from each mouse were
excised and genomic DNA was isolated using a Dneasy kit (QIAGEN,
Valencia, Calif.) following the manufacturer's protocol.
Quantitation of the vector copy number and cell number in the DNA
isolate was performed by using SYBRgreen real time PCR kit (QIAGEN)
and an ABI PRISM 7700 sequence detector (Perkin Elmer, Wellesley,
Mass.). The primers for the analysis of vector copy number (Firefly
Luciferase) were Fluc-a (gagatacgccctggttcctg) and Fluc-b
(gcatacgacgattctgtgatttg). The standard for quantitation of vector
copy number was FUhLucW. The primers for the analysis of cell
number (mouse beta actin) were beta-actin-F
(caactccatcatgaagtgtgac) and beta-actin-R (ccacacggagtacttgcgctc).
The standard for the analysis of cell number was made using genomic
DNA isolated from normal mouse peripheral blood mononuclear
cell.
[0106] Targeted infection of melanoma cells in vitro. B16F10MDR5
cells (1.times.10.sup.4) were seeded on 48-well plate at the day
before infection. The cells were incubated with FUhLucW (ZZ
SINDBIS) or FUhLucW (m168) (10 ng HIV p24) with or without
anti-P-gap antibody (1 .mu.g/ml) for 2 hours at 37.degree. C. with
5% CO.sub.2. The virus was subsequently removed and replaced with
fresh medium (500 .mu.l). Three days post infection, cells were
lysed in passive lysis buffer (Promega) and Firefly luciferase
activity was measured following the manufacturer's protocol.
[0107] Targeted infection of melanoma cells in vivo. To express
Renilla luciferase as a marker, the human P-gp expressing mouse
cell line, B16F10MDR5, was transduced by the lentiviral vector
FUIntronRW (VSV-G). One day prior to subsequent cell and virus
injection, TMbeta-1 (1 mg) was injected into 6-week old female
NOD/SCID mice. Renilla luciferase expressing B16F10MDR5
(2.times.10.sup.5 cells in 150 .mu.l of PBS) were injected into
mouse via the tail vein. Thirty minutes later, FUhLucW (ZZ SINDBIS)
or FUhLucW (m168), to which we had added anti P-glycoprotein
monoclonal antibody or Isotype (IgG2a) control antibody (10
.mu.g/ml) was injected into the tail vein. The amount of each virus
used for injection was normalized to the amount of HIV p24 (36 pg
of HIV p24 in 150 .mu.l PBS). Ten days after cells and virus
injection, lung metastasis of B16F10MDR5 was determined by imaging
the Renilla luciferase. Mice were anesthetized and coelenterazine
(20 .mu.g) (Prolume, Pinetop, Ariz.) was injected via the tail
vein. Data acquisition was performed directly following
coelenterazine injection for 1 min. Twelve days after cell and
virus injection, virus infection was determined by imaging the
expression of Firefly luciferase reporter gene. Mice were
anesthetized and injected intraperitonially with D-luciferin (6
mg/mouse). Imaging was performed as previously described. Mice were
sacrificed after imaging using D-Luciferin. To isolate tumor cells,
whole lung was isolated, ground and passed through a cell strainer
(BD, San Jose, Calif.). The cells were cultured for 10 days in DMEM
supplemented with FCS (20%), penicillin (100 units/ml) and
streptomycin (100>ag/ml). Cultured cells were trypsinized,
counted, stained by anti-P-Glycoprotein monoclonal antibody
conjugated to PE (BD) and analyzed by flow cytometry. More than 99%
of cells expressed P-gp demonstrating that nearly all of the cells
we harvested were B16F10MDR5 cells. Cells were not recovered from
control mice that did not receive tumor cells. One million cells
were then harvested and lysed in passive lysis buffer (200 .mu.l)
(Promega) and analyzed for Firefly luciferase activity following
the manufacturer's protocol. Genomic DNA was isolated using a
DNeasy kit (QIAGEN). The primers and standard for quantitation of
vector copy number were the same as those used to quantitate the
background level of infection as previously described. Quantitation
of the cell number was performed using primers for murine
beta-actin as described above and the standard was generated by
using known numbers of B16F10MDR5 cells.
Results
[0108] We previously demonstrated specific targeting of our ZZ
SINDBIS lentiviral vector and murine retroviral vectors to
CD4.sup.+ and HLA.sup.+, cells using monoclonal antibodies specific
for CD4 and HLA (Morizono et al., J. Virol., September;
75.(17.):8015.-20. 75, 8016-8020 (2001)). These vectors
demonstrated an approximately 30-fold selectivity for infection of
target cells in the presence of the specific cell surface
monoclonal antibody. Our goal is to utilize these vectors for
direct targeting of gene therapy vectors to specific target cells
via direct injection in the bloodstream. We utilized lentiviral
vectors bearing two distinct types of reporter genes to assess
transduction efficiency (FIG. 1). The EGFP-expressing virus vector
allowed a quantitative assessment of infectivity in vitro as
monitored by flow cytometry (Zennou et al., Cell, 101, 173-185
(2000)). We utilized both Firefly and Renilla luciferase-expressing
virus vectors and non-invasive cooled charged-coupled device (CCCD)
imaging to quantitate the level of specific targeting of vectors in
live mice (Bhaumik and Gambhir, Proc Natl. Acad. Sci. U.S.A. 99,
377-382 (2002)).
HIV Vector Pseudotyped by ZZ Sindbis has Non-Specific Infectivity
In Vivo.
[0109] FIG. 2a shows the typical enhancement in infectivity of the
ZZ SINDBIS pseudotyped virus vector in vitro using a monoclonal
antibody directed to HLA. We observed approximately a 30-fold
enhancement of EGFP.sup.+ cells in the presence of anti-HLA
antibody relative to that seen in the absence of monoclonal
antibody. As a comparison, VSV-G envelope pseudotyped virus
infected cells at a high level in the absence of antibody. The
titer of ZZ SINDBIS virus is usually about 5-fold lower than that
of VSV-G pseudotyped virus but, like VSV-G pseudotypes can be
further concentrated at least 100-fold by ultracentrifugation.
[0110] ZZ SINDBIS pseudotyped virus vectors expressing Firefly
luciferase were utilized to quantitate the level and specificity of
targeting in transduced cells in the organs of live mice. We used a
lentiviral vector containing the Ubiquitin-C promoter for in vivo
experiments since this vector has been shown to express well in all
mouse tissues (Lois et al., Science, 295, 868-872 (2002)). ZZ
SINDBIS virus vectors were injected into the tail vein in the
absence of monoclonal antibody. The expression of virus was
monitored by luciferase expression utilizing CCCD imaging (FIG.
2b). Lentiviral vectors pseudotyped with each of the envelopes,
VSV-G, wild type Sindbis, and ZZ SINDBIS infected both liver and
spleen. VSV-G and wild type Sindbis pseudotypes resulted in a
strong signal. Although ZZ SINDBIS gave a weaker signal, consistent
with its infectivity in vitro, there was still clear expression in
liver and spleen. Injection of recombinant luciferase did not show
a signal in major organs, indicating that the signal observed with
ZZ SINDBIS was due to infection of cells in the organs (data not
shown). We verified infection of Sindbis and ZZ SINDBIS in the
liver and spleen by quantitative DNA PCR analysis (Table 2).
TABLE-US-00002 TABLE 2 Copy Number of Lentiviral Vector/10.sup.4
Cells Vector Liver Heart Spleen Kidney Lung Ovary No vector *<
*< *< *< *< *< SINDBIS 569 *< 1407 *< *<
*< ZZ SINDBIS 75 *< 538 *< *< *< ZZ SINDBIS 397
*< 520 *< *< *< ZZ SINDBIS 146 *< 295 *< *<
*< m168 26 *< 36 *< *< *< m168 66 *< 15 *<
*< *< m168 38 *< 28 *< *< *< Genomic DNA from
each organ was isolated and analyzed as described in materials and
methods. *< represents undetectable The threshold for the copy
number for detection from each organ was as below. Liver: 11
copies/10.sup.4 cells. Heart: 26 copies/10.sup.4 cells. Spleen: 3
copies/10.sup.4 cells. Kidney: 3.3 copies/10.sup.4 cells. Lung: 8.3
copies/10.sup.4 cells. Ovary: 13 copies/10.sup.4 cells.
The Non-Specific Infectivity of ZZ Sindbis Pseudotypes is Due to
Sindbis Envelope Sequences.
[0111] We further investigated the nature of the non-specific
background infectivity of ZZ SINDBIS pseudotypes. A mouse
polyclonal antibody which neutralizes wild type Sindbis virus
infectivity was utilized to demonstrate that the background
infectivity was the result of Sindbis virus domains and not the ZZ
protein A sequences (FIG. 3). Using flow cytometry we determined
that the level of GFP.sup.+ cells in the wild type and ZZ SINDBIS
virus pseudotypes was substantially reduced in the presence of the
anti-Sindbis antibody. Infectivity of VSV-G pseudotypes was not
blocked nor was infection with the control antibody. These results
indicate that Sindbis virus domains within the Sindbis virus
envelope are responsible for the non-specific infectivity of ZZ
SINDBIS pseudotypes. Thus, we undertook a structure-function
analysis of the Sinbis virus envelope through site-directed
mutagenesis of ZZ SINDBIS with the aim of ablating residual
background infectivity.
[0112] Identification of a ZZ SINDBIS E2 mutant with enhanced cell
targeting specificity. We first determined the regions responsible
for the residual infectivity of our ZZ SINDBIS envelope. The
domains we targeted for mutagenesis have previously been reported
to affect binding to target cells, block epitopes for neutralizing
antibody and function in Sindbis virus tropism (Klimstra et al., J,
Virol. 72, 7357-7366 (1998); London et al., Proc Natl. Acad Sci
U.S.A. 89, 207-211 (1992); Klimstra et al., J. Virol. 73, 6299-6306
(1999); Byrnes and Griffin, J. Virol. 74, 644-651 (2000); Pence et
al., Virology 175, 41-49 (1990); Gardner et al., J. Virol 74,
11849-11857 (2000); Dubuisson and Rice, Journal of Virology 67,
3363-3374 (1993); Polo and Johnston, J. Virol. 65, 6358-6361
(1991); Lee et al., J. Virol. 76, 6302-6310 (2002)). All these
domains were located in the E2 protein of the Sindbis virus
envelope (FIG. 4). We analyzed E2 mutant pseudotyped virus vectors
for infectivity in 293T cells using flow cytometry. The infectivity
of mutants was tested on two different cell types, 293T, a human
kidney cell line used for standard titration of virus stocks and
HepG2 cells, derived from a human hepatocellular carcinoma (Table
1). We tested infectivity in HepG2 cells, because of the background
infectivity we observed in liver cells in vivo. We identified
several E2 mutants with reduced levels of nonspecific infectivity
and thus, an enhanced selectivity for targeting. Since some of
these mutations also reduced the titer of viruses produced, we
combined the mutations conferring enhanced selectivity with other
mutations that enhanced infectivity. Five domains of Sindbis E2
previously reported to affect the infectivity of Sindbis virus were
analyzed for their level of infectivity. Mutation ml in domain R1
enhanced the selectivity on 293T cells relative to wild type ZZ
SINDBIS virus. However, this mutation also resulted in a decrease
in virus titer. Mutations in domain R4 enhanced the titer without
altering the specificity. Combining mutation m1 and m6 resulted in
partial restoration of the titer and maintenance of the higher
selectivity of ml. A double mutant of m1 and m8 resulted in
enhanced selectivity on HepG2 liver cells. The combination of
mutations of m1, m6, and m8 in domains R1, R2, and R4,
respectively, resulted in a pseudotyped virus with enhanced
selectivity on 293T and HepG2 liver cells while maintaining
stability during concentration by ultracentrifugation high viral
titers. This mutant ZZ SINDBIS envelope was termed m168. Our data
is consistent with previous studies that demonstrate the role of
the R1 and R2 domains for heparin sulfate binding and the R5 domain
for rescue of the reduced titer of an R1 mutant in replication
competent Sindbis virus (Heidner et al., J. Virol. 68, 2683-2692
(1994)). Identification of a neurotropic strain of Sindbis virus
suggested use of an alternative receptor in neuronal cells (Lee et
al., J. Virol. 76, 6302-6310 (2002)). m168 also displayed a higher
level of specificity than ZZ SINDBIS (>20-fold) in the
neuroblastoma cell line, NB41A3 (data not shown).
Enhanced Specificity of the Modified m168 ZZ Sindbis Pseudotyped
Virus In Vitro.
[0113] A representative experiment illustrating enhanced
specificity of m168 infection in 293T cells, in the presence of an
HLA monoclonal antibody is shown in FIG. 5a. In the absence of
antibody the background level of infectivity is reduced when
compared to the ZZ SINDBIS virus and the levels of infectivity and
stability are maintained. A Western blot of m168 pseudotyped
virions shows the E2 envelope protein expressed from wild type ZZ
SINDBIS and m168 (FIG. 5b). Note that the m168 envelope protein is
larger as a result of mutation ml that prevents cleavage of E2 and
E3. This mutant was used in subsequent experiments.
m168 ZZ SINDBIS Pseudotyped Virus Displays Reduced Non-Specific
Infectivity in Mice.
[0114] The ultimate goal of these studies is to develop a gene
transfer vector capable of delivery directly into the bloodstream
to target specific tissues or cells. The ability of the genetically
modified M168 lentiviral pseudotypes to infect target cells in live
mice was tested. First, we determined the level of non-specific
infectivity in the absence of targeting antibody. Viruses bearing
luciferase reporter genes were injected via the tail vein into SCID
mice and the location of the infectivity was assessed using a CCCD
camera to determine the level of luciferase expression in the mice.
Consistent with the in vitro results, the modified m168 ZZ SINDBIS
pseudotyped virus displayed a substantially lower infectivity in
the liver and spleen of inoculated animals, relative to the
parental ZZ SINDBIS pseudotyped virus (FIG. 6). Because the
intensity of the CCCD imaging for luciferase expression can be
influenced by a number of variables such as depth of tissue and
positioning of the animal during imaging, we confirmed these
results by isolation of organs and PCR analysis for vector DNA
sequences (Table 2). These results confirm that infectivity in
liver and spleen is substantially reduced. Of note, we could not
detect infection in ovaries indicating that transduction of our
vector into germ line cells was unlikely to occur. Having
successfully reduced the background infectivity, we tested the
ability of these m168 pseudotypes to target cancer cells in the
presence of monoclonal antibody directed to a tumor specific cell
surface antigen, P-gp in mice.
m168 Virus Specifically Targets P-gp Expressing Melanoma Cells in
NOD/SCID Mice.
[0115] Malignant melanoma is an aggressive human tumor that
metastasizes to multiple tissues including remote skin, soft
tissue, lympho node and lung (Allen and Coit, Curr. Opin. Oncol.
14, 221-226 (2002)). Several intrinsic properties of tumor cells
contribute to the development of resistance to chemotherapeutic
drugs. Increased expression of the multi-drug resistant (MDR) genes
causes overproduction of the transmembrane transport protein P-gp
(Ambudkar et al., Oncogene. 22, 7468-7485 (2003)). P-gp transports
neutral and cationic hydrophobic compounds across the cell
membrane. Selection for tumor cells that are resistant to natural
product amphiphilic anticancer drugs can induce expression of P-gp.
Elevated levels of P-gp have been found in many solid tumors of the
colon, kidney, liver and lung that had not been exposed to
chemotherapy accompanied by development of the multi-drug
resistance. One study demonstrated that 33 to 76% of the melanoma
cell lines derived from primary tumors or metastases of untreated
patients scored positive for P-gP (Berger et al., Int. J. Cancer
59, 717-723 (1994)).
[0116] We selected a murine model for human malignant metastatic
melanoma where the tumor cells migrate through the bloodstream to
engraft and form tumors in the lungs. We engineered the murine
melanoma cells to express the human MDRsc1 gene (the vector is
shown in FIG. 1) in order to provide a cell surface molecule for
targeting. This served as our live animal model system that allowed
us to stringently test whether our mutant E2 virus vector can
target P-gp on the surface of the melanoma cells within live
animals.
[0117] First, we demonstrated the specificity of the targeting for
the P-gp expressing melanoma cells in vitro. A Firefly luciferase
reporter gene was used to quantitate transduction of the melanoma
cells by flow cytometry. Our results demonstrate that P-gp can be
specifically targeted on the surface of the melanoma cells. In the
presence of monoclonal antibody, infection of the melanoma cells is
significantly greater than the original ZZ SINDBIS pseudotyped
vector (Table 3). The P-gp transducing vector does not
significantly infect cells that do not bear P-gp (data not shown).
Thus, this combination of tumor cells and transducing vector was
utilized for vector targeting in live mice.
TABLE-US-00003 TABLE 3 Luciferase Assay of Melanomas Vector Copy#/
Virus Antibody RLU 10.sup.4 cells .sctn.In vitro transduction -- --
<200* FUhLucW (ZZ SINDBIS) -- 302 FUhLucW (ZZ SINDBIS) Anti
P-Glycoprotein 1667 FUhLucW (m168) -- 203 FUhLucW (m168) Anti
P-Glycoprotein 1295 .dagger.In vivo transduction by systemic virus
injection -- -- <200* <19 FUhLucW (m168) control antibody 405
<19 FUhLucW (m168) control antibody 233 <19 FUhLucW (m168)
control antibody 296 <19 FUhLucW (m168) Anti P-Glycoprotein 2737
87 FUhLucW (m168) Anti P-Glycoprotein 2397 50 FUhLucW (m168) Anti
P-Glycoprotein 3104 65 FUhLucW (ZZ SINDBIS) Anti P-Glycoprotein
1834 77 FUhLucW (ZZ SINDBIS) Anti P-Glycoprotein 115 <19 Cells
are harvested and analyzed for firefly luciferase expression and
copy number of vector as described in materials and methods.
.sctn.The value of RLU for in vitro transduction is Relative
Luciferase Unit/10.sup.4 cells. .dagger.The value of RLU for in
vivo transduction is Relative Luciferase Unit/10.sup.3 cells. *The
values of background (uninfected cells) ranged from 100 to 200.
[0118] The tumor cells were first marked in vitro by transducing
with a vector expressing Renilla luciferase. This allowed us to
differentially identify the location of vector expression in the
tumor cells. The localization of vector expression and tumor cells
in the mice was visualized using different substrates for the two
luciferase genes, Firefly and Renilla, respectively (FIG. 7).
Following injection, the tumor cells migrate to the lungs and can
be visualized by CCCD imaging for Renilla luciferase. The virus
bearing m168 and anti P-gp antibody was injected via the tail vein.
Vectors injected in the absence of anti P-gp antibody, show no
signal for Firefly luciferase. In contrast, when virus is
pseudotyped with m168 bearing anti P-Gp antibody, the luciferase
expression of Firefly luciferase (m168 virus vector) co-localizes
in the lung with that of Renilla luciferase (tumor melanoma
cells).
[0119] The co-localization in the lungs of Firefly and Renilla
luciferase expression representing tumor and virus infection,
respectively, was confirmed to be a result of infection of the
melanoma cells by the targeting vector. Lung tissue was isolated
and melanoma cells cultured. Firefly luciferase activity,
representing expression from the vector, was observed predominately
in those tumor cells isolated from animals in which anti P-gp
targeted virus was used for the infection (Table 3). Quantitative
real time PCR analysis confirmed these results. Interestingly, m168
pseudotype vectors demonstrate a higher level of infection in
melanoma cells in vivo compared to the parental ZZ SINDBIS, most
likely due to less nonspecific trapping in other mouse tissues.
[0120] The targeting of micrometastatic tumors was also visualized
by immunohistochemistry (see, FIG. 10). Tumor micro-nodules are
observed in the lungs at Day 6 following transplant with
morphologic characteristics of melanoma and positive for melanoma
antigen S-10037. About 1% of these nodules were also positive for
EGFP, consistent with the previous PCR analysis (see, Table 2 of K.
Morizono et al., Nature Med (2005) 11:346-352, hereby incorporated
herein by reference in its entirety for all purposes).
[0121] Rare transduced cells in the spleen and liver were
identified as macrophages and related Kupffer cells, respectively,
by flow cytometry and immunohistochemistry (FIGS. 11, 12a and
12b).
Targeting of Established Melanoma Tumors.
[0122] In another set of experiments, we tested the ability of the
m168 vector to target established tumors. The same protocols as
above were utilized except that tumors were allowed to form for 12
days prior to intravenous injection of the targeting vector. In
this model system, visible tumors are evident at 8 days after
inoculation and death occurs within 16 days after inoculation.
Animals were visualized by CCCD imaging 3 days following
intravenous injection for both the location of tumors and the
specificity of targeting. Specific targeting to the tumors in the
lungs of the animals was observed only following intravenous
injection with m168 pseudotypes plus P-gp antibody (see, FIG. 13a).
No non-specific infection was observed in the lungs in the absence
of tumor and the infection to tumors in the lungs was dependent
upon the presence of P-gp antibody. The transduction of organs was
confirmed by isolation of specific organs following sacrifice (see
FIG. 13b). The reduced signal intensity in lungs of this experiment
relative to targeting of micrometastatic cells (compare mice of
FIG. 13a with mice of FIG. 7) is due to limited growth of
transduced cells (3 days versus 12 days after transduction) prior
to imaging. For comparison, intravenous injection of VSVG
pseudotypes show infection of a broad number of tissues without
specificity for the tumors consistent with previously published
studies (Sawai and Meruelo, Biochem Biophys Res Commun (1998)
248:315-323).
Discussion
[0123] We developed a gene therapy targeting strategy that for the
first time allows production of a high titer virus that can be
directed to specific cells and tissues. Most importantly, the high
titer and specificity of this vector system makes it suitable for
applications within living animals.
[0124] We took advantage of several aspects of the Sindbis virus
envelope in designing our vector system. The Sindbis envelope
consists of a cell derived lipid bilayer embedded with two integral
membrane glycoproteins, E1 and E2, which mediate membrane fusion
and receptor binding, respectively. Following binding of E2 to its
receptor and endocytosis, E1 leads to fusion in a pH dependent
fashion independent of E2. E1 and E2 are anchored in the cell
membrane independently via transmembrane domains; an attribute that
likely accounts for the high level of envelope stability and
maintenance of function in chimeric molecules. Previous studies
indicated that the Sindbis virus E2 envelope protein could be
modified substantially yet retain infectivity (Dubuisson and Rice,
Journal of Virology 67, 3363-3374 (1993)). Sindbis virus vectors
with chimeric E2 envelopes were capable of targeting cells in vitro
(Ohno et al., Nat. Biotechnol. 15, 763-767 (1997)).
[0125] Although Sindbis is an RNA virus, we previously created a
DNA vector expressing the Sindbis envelope and demonstrated that it
could be used to express functional envelope and form pseudotypes
with both the HIV-1- and MuLV-based vectors (Morizono et al., J.
Virol., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). When
the Sindbis virus envelope is modified to encode the ZZ domain of
protein A, monoclonal antibodies directed to cell surface antigens
can be used to redirect the target specificity of the retroviral
vectors. Here, we substantially modified the Sindbis E2 envelope to
further increase the specificity of infectivity to a degree
sufficient to achieve the high level of specificity required for in
vivo infection. In such a context, the virus would encounter
multiple cell types and thus, an increased potential for
non-specific infectivity. Although the parental (first generation)
ZZ SINDBIS pseudotyped vector retains infectivity in the liver and
spleen, the pseudotypes bearing modified Sindbis virus envelope
show a substantially decreased level of infectivity in these
organs.
[0126] Although we have not investigated the specific cellular
receptors responsible for the non-specific infectivity of the
parental ZZ SINDBIS virus, our results indicate that background
infectivity is likely due to changes within the Sindbis envelope
domains and not the ZZ domain. Some of the mutations we
characterized are known to abolish binding of the Sindbis virus
envelope to heparin sulfate and thus, are likely responsible for
the decreased nonspecific infectivity and resultant enhanced
selectivity of these viruses (Klimstra et al., J. Virol. 73,
6299-6306 (1999); Byrnes and Griffin, J. Virol. 74, 644-651
(2000)). The phenotypes of these mutants are consistent with a
previous report that characterized the role of the heparin sulfate
binding domain in non-specific transduction of a targeting
adenovirus vector in mice (Smith et al., Hum. Gene Ther. 14,
777-787 (2003); Koizumi et al., J. Viral. 77, 13062-13072 (2003)).
By reducing the non-specific infectivity, it was possible for us to
redirect the target cell specificity of the virus to a specific
human tumor cell antigen, P-gp, which is expressed on the surface
of murine melanoma cells.
[0127] Once a melanoma acquires the ability to invade tissues,
continue to proliferate and escape immune surveillance metastatic
spread is likely to occur. Metastatic competent tumor cells migrate
from the site of the primary lesion and subsequently grow at
distant anatomical sites including the liver and lungs. Pulmonary
metastases are the most common site of visceral metastasis with
between 15% and 35% of recurrence occurring in this location (Allen
and Coit, Curr. Opin. Oncol. 14, 221-226 (2002)). Only 4% of
patients with pulmonary metastases survive 5 years. The murine
melanoma model we chose to evaluate the specificity of our mutants
mimics the progression of human melanoma to a metastatic stage
often found in the lung. This system was ideal for testing specific
targeting of our modified ZZ virus vectors to metastatic tumor
cells by directly injecting them into the bloodstream of mice.
[0128] Targeting P-gp as a tumor antigen can be useful not only for
metastatic melanoma, but for many other tumors, which express this
gene and are thus rendered resistant to multiple chemotherapeutic
drugs (Ambudkar et al., Oncogene. 22, 7468-7485 (2003)). However,
P-gp is also expressed on some normal cells, thus the targeting of
tumor cells that express P-gp would be most successful in those
situations where the P-gp was significantly over-expressed in the
tumor cells.
[0129] Although non-covalent interactions via the protein A ZZ
domain would be useful in ex vivo applications, in an animal or
patient with an immunocompetent humoral immune system, the presence
of circulating antibodies would compete for the monoclonal
antibodies of the targeting vector. Thus, clinical in vivo
applications use chimeric, recombinant single chain antibody
sequences or specific ligand and/or peptide sequences. Human
chorionic gonadotropin sequences have been successfully recombined
into chimeric Sindbis envelope to target Sindbis virus based
vectors (Sawai and Meruelo, Biochem. Biophys. Res. Commun. 248,
315-323 (1998)). To date, we have tested these pseudotypes with
over ten specific monoclonal antibodies. Any specific ligand or
affinity reagent incorporated into the Sindbis envelope can be used
to target a cell surface molecule specific to a given cell or
tissue type.
[0130] The applications of a specific targeting gene therapy vector
are broad. In the melanoma model, for example, one could introduce
specific suicide genes to kill tumor cells and/or immunomodulatory
genes to enhance immune response directed to metastatic legions.
Early treatment of metastatic cells is of significant therapeutic
value. In theory, metastases could be targeted well before they
grow to a size to be visualized by current technologies. Residual
tumor cells following localized treatment with radiation and/or
surgery could also be targeted and eliminated.
[0131] The targeting of gene therapy vectors to specific cells and
tissues at specific sites in the body has numerous applications.
Current applications of gene therapy require either ex vivo
purification of cells followed by transduction of the purified
target cells and/or injection directly into localized sites, both
of which require extensive technical manipulation (Kohn et al.,
Nat. Med. 1, 1017-1023 (1995); Cavazzana-Calvo et al., Science 288,
669-672 (2000)). Direct injection into the bloodstream and
infection to specified regions would facilitate the application of
gene therapy to many diseases. Since most diseases, both acquired
and hereditary, either originate in specific cells or manifest
their clinical phenotypes in specific tissues, the gene therapeutic
vectors could be delivered where they would be most effective. For
example, gene therapy utilizing hematopoeitic progenitor cells
currently require purification of the hematopoeitic stem cells
followed by transduction ex vivo. Specific targeting vectors can be
developed that target antigens specific for hematopoeitic stem
cells and thus, allow direct introduction of therapeutic genes into
the stem cells through bone marrow and/or systemic injection after
progenitor cell mobilization. As evidenced by our ability to target
the melanoma tumor cells prior to establishment of visible tumors
in the lungs, targeting vectors that circulate and home to specific
cells could allow early therapeutic intervention in the case of
diseases such as cancer, and residual cells of chronic or latent
infections by infectious agents. This system could also be applied
to treatment of pulmonary diseases such as cystic fibrosis and
alpha-1 antitrypsin deficiency, caused by mutations in the CFTR (CF
transmembrane conductance regulator) and alpha-1 antitrypsin genes
respectively (West and Rodman, Chest 119, 613-617 (2001)). In
principle, the CFTR and alpha-1 anti trypsin genes could be
delivered efficiently to lung cells by a simple intravenous
injection.
[0132] Finally, targeting of specific cells and tissues would
greatly enhance the safety of gene therapeutic applications.
Inappropriate expression due to inadvertent infection of irrelevant
cells or tissues is one cause for concern in gene therapy
applications and has resulted in serious adverse effects in some
clinical trials (Lehrman, S., Nature 401, 517-518 (1999)).
Targeting to specific cells would lessen the possibility of adverse
side effects. In addition, insertional mutagenesis of the
retroviral vector, if it does occur, would be limited to a much
smaller subset of cells, thus diminishing the possibility of events
leading to the initiation and/or progression of malignant
transformation (Hacein-Bey-Abina et al., Science 302, 415-419
(2003)). It is important to note that this targeting system has
broad applicability for use with other retroviral vectors. Although
we utilized lentiviral vectors in this study, we previously
demonstrated that the Sindbis ZZ pseudotypes will also form readily
with MuLV vectors, more commonly utilized in most existing gene
therapy clinical applications for a variety of diseases.
Example 2
Targeting Prostate Cancer Cells through the Prostate Stem Cell
Antigen (PSCA)
[0133] Prostate cancer is the most common cancer diagnosis and the
second leading cause of cancer-related death in American men.
Prostate cancer mortality frequently results from metastasis to
bone and hormone-independent tumor growth. Physiologically relevant
prostate cancer models exist, such as the LAPC-9 xenograft model
(see, Craft, et al., Cancer Res (2000) 60:2541-2546). LAPC-9 cells
were derived from a human bone metastasis, and are able to form a
prostate cancer xenograft that can be propagated in SCID mice, and
expresses prostate specific antigen and wild-type androgen receptor
(Id.). Hormone independent outgrowths can be selected after
castration of the mice, and micrometastasis can eventually be
detected in half of the mice, recapitulating the clinical
progression of human prostate cancer (Klein, et al., Nature Med
(1997) 3:402-408).
[0134] We generated vectors that specifically deliver genes to
prostate cancer in a living animal, and validated our vectors in
the LAPC-9 model system. First, we found a candidate surface
molecule in prostate cancer cells that our engineered Sindbis
envelopes could target. Prostate stem cell antigen (PSCA) is a
prostate-specific gene with 30% homology to stem cell antigen 2, a
member of the Thy-1/Ly-6 family of glycosylphosphatidylinositol
(GPI)-anchored cell surface antigens. PSCA encodes a 123-aa protein
with an amino-terminal signal sequence, a carboxyl-terminal
GPI-anchoring sequence, and multiple N-glycosylation sites (Gu, et
al., Oncogene (2000) 19:1288-96; and Reiter, et al., Proc Natl Acad
Sci USA (1998) 95:1735-1740). PSCA mRNA expression is
prostate-specific in normal male tissues and is highly up-regulated
in both androgen-dependent and -independent prostate cancer
xenografts. PSCA is expressed in over 80% of prostate cancers,
among them the LAPC-9 xenograft (Saffran, et al., Proc Natl Acad
Sci (2001) 98:2658-2663), and is a promising therapeutic target.
Thus, we targeted Sindbis pseudotyped lentiviral vectors with an
anti-PSCA mAb, 1G8 (Saffran, supra). Although PSCA is widely
expressed in human prostate cancers, expression is very low or
undetectable in prostate cancer cell lines. We obtained a LNCaP
derivative cell line stably transfected with PSCA (R. Reiter,
UCLA), LPSCA4, and analyzed the ability of 1G8 to mediate infection
of FUGW (that expresses EGFP from ubiquitin C promoter) pseudotyped
with m168 (FIG. 14). LPSCA4 was very effectively infected by FUGW
with both .alpha.HLA and 1G8 antibodies, whereas the parental LNCaP
cells could only be infected with .alpha.HLA. 1G8 did not mediate
infection into LNCaP cells, as levels were comparable to background
infection in the absence of targeting antibody.
Example 3
Combining Cell Surface Targeting with Selective Cell to Increase
Efficiency of Specific Targeting
[0135] The ubiquitin-C promoter in the FUGW lentiviral vector
(Morizono, et al., Nature Medicine (2005) 11:346-352; and Lois, et
al., Science (2002) 295:868-872), with a chimeric prostate specific
antigen (PSA) promoter, designated (PSE-BC), to produce the
construct FPGW. The key regulatory elements of the PSA enhancer
include a proximal promoter (-541 to +12) comprising two binding
sites for the androgen receptor (AREI and II) and a distal
enhancer, which contains a 390-bp androgen responsive core region
(Schuur, et al., J Biol Chem (1996) 8:1416-1426; and Cleutjens, et
al., J Biol Chem (1996) 271:6379-6388). The core region contains a
cluster of closely spaced androgen response elements (AREs) and
sites for other transcription factors. The androgen receptor (AR)
binds cooperatively to the enhancer and mediates synergistic
transcription, and other factors within and outside of the enhancer
contribute to prostate specificity (Reid, et al., J Biol Chem
(2001) 276:2943-2952); and Huang, et al., (1999) J Biol Chem (1999)
274: 25756-25768). The PSE-BC promoter was generated by duplication
of the PSA enhancer core and insertion of this duplicated element
closer to the proximal promoter (200 bp upstream). After these
modifications PSE-BC produced 20-fold higher expression levels than
the parental construct, yet retained androgen inducibility and
tissue specificity (Wu, et al, Gene Ther (2001) 8:1416-1426).
[0136] To assess the specificity of expression we infected prostate
and non-prostate cell lines and primary cells with either FUGW or
FPGW. Expression from the PSE-BC promoter was potent as the
ubiquitin-C promoter in prostate cell lines, and specific to
prostate cells, although some background expression could be
detected in a hepatoma cell line (HepG2), primary fibroblasts and
endothelial cells (FIG. 15). Of note, no expression from the PSE-BC
promoter could be detected in primary macrophages in vitro.
Example 4
Targeting CNS Tissue By Conjugation To Anti-Transferrin Receptor
Antibody
[0137] Successfully Targeted Transduction of Human Umbilical Vein
Endothelial Cells (HUVEC) via TfR using TfR Monoclonal
Antibodies.
[0138] Transferrin receptor (TfR) is highly expressed on brain
capillary endothelial cells and has been used by Pardridge and
co-workers as a means to deliver therapeutic reagents into the
brain (Pardridge, Neuron (2002) 36:555-558; and Pardridge, Nat Rev
Drug Discov (2002) 1:131-139. We determined that TfR could serve as
a receptor for targeted infection by testing infection with m168
pseudotypes conjugated with antibodies directed to human TfR
expressed on human umbilical vein endothelial cells (HUVEC). There
are several available monoclonal antibodies directed to different
or unknown epitopes of TfR (Panaccio, et al., Immunol Cell Biol
(1987) 65:461-472; Esserman, et al., Blood (1989) 74:2718-2729; and
Takahashi, et al, Blood (1991) 77:826-832). Our results demonstrate
successful infection of HUVEC with TfR antibody, but not in the
absence of TfR antibody. However the levels of infectivity were low
compared to targeting to other cell surface molecules such as CD4,
HLA, and P-gp in other cell types. (FIG. 16)
[0139] It was reported that a single mutation within the E1
envelope protein renders Sindbis virus replication to be
independent of a requirement for cholesterol (Lu, et al., J Virol
(1999) 73:4272-4278). A similar mutation was also identified in
Semliki Forest virus (Vashishtha, et al., J Cell Biol (1998)
140:91-99). The mechanism of this cholesterol independent
replication is unclear. Since the E1 protein is responsible for
fusion of Sindbis envelope to induce entry into the cell, we
reasoned that this mutation in the context of our targeting vector
would work in concert with antibody mediated binding to enhance the
infectivity of the targeting viruses. Our results show that this is
the case. Introduction of the cholesterol independent mutation (E1
AK226-227SG) into the targeting Sindbis envelope (termed 2.2)
enhanced infectivity of lentiviral pseudotypes 8-fold over that of
m168 pseudotypes targeted to TfR (FIG. 16). These results
demonstrate that efficient targeting to TfR can be obtained in cell
culture.
Targeting to the CNS in Living Mice.
[0140] Using the modified vector described above we tested its
ability to target TfR, particularly TfR expressing cells of the
brain capillary endothelium. Mice were injected intravenously with
anti-TfR conjugated vector through the tail vein. Five (5) days
after injection mice were analyzed for location of transduced cells
by optical imaging for expression of the luciferase reporter gene.
We observed a distribution of luciferase activity in the body
consistent with successful targeting to the CNS. Intense optical
signals were observed in regions corresponding to the brain and
spinal column. These results were confirmed after sacrifice by
removing the skin and muscle from the back of the animals
confirming luciferase expression from the brain and spinal column
(FIG. 17). Control mice injected with vector in the absence of TfR
antibody did not show a signal in the CNS, consistent with typical
control animals utilized in the experiments targeting P-gp on
melanoma (Morizono, et al, supra). It is noteworthy that although
TfR is expressed on multiple cells and tissues in the body (Gatter,
et al., J Clin Pathol (1983) 36:539-45; Lu, et al., Acta Pathol Jpn
(1989) 39:759-764; and Soyer, et al., J Cutan Pathol (1987)
14:1-5), the major sites of transduction were observed in the
regions corresponding to the central nervous system. Without being
bound to any theory, this may be due to a higher density of
transferrin receptor and/or enhanced rates of internalization of
transferrin receptor in these regions (Pardridge, Neuron, supra;
and Pardridge, Nat Rev Drug Discov, supra).
[0141] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference in their entirety for all
purposes.
Sequence CWU 1
1
1613339DNASindbis virusZZSINBIS Sindbis virus ZZ envelope protein
mutant 1atggcgtccg cagcaccact ggtcacggca atgtgtttgc tcggaaatgt
gagcttccca 60tgcgaccgcc cgcccacatg ctatacccgc gaaccttcca gagccctcga
catccttgaa 120gagaacgtga accatgaggc ctacgatacc ctgctcaatg
ccatattgcg gtgcggatcg 180tctggcagaa gcaaaagaag cgtcattgac
gactttaccc tgaccagccc ctacttgggc 240acatgctcgt actgccacca
tactgtaccg tgcttcagcc ctgttaagat cgagcaggtc 300tgggacgaag
cggacgataa caccatacgc atacagactt ccgcccagtt tggatacgac
360caaagcggag cagcaagcgc aaacaagtac cgctacatgt cgcttaagca
ggtaaccgac 420aacaaattca acaaagaaca acaaaacgcg ttctatgaga
tcttacattt acctaactta 480aacgaagaac aacgaaacgc cttcatccaa
agtttaaaag atgacccaag ccaaagcgct 540aaccttttag cagaagctaa
aaagctaaat gatgctcagg cgccgaaagt agacaacaaa 600ttcaacaaag
aacaacaaaa cgcgttctat gagatcttac atttacctaa cttaaacgaa
660gaacaacgaa acgccttcat ccaaagttta aaagatgacc caagccaaag
cgctaacctt 720ttagcagaag ctaaaaagct aaatgatgct caggcgccga
aagtagacgc gaattcgagc 780tcggtacccg gggatccggt aaccaccgtt
aaagaaggca ccatggatga catcaagatt 840agcacctcag gaccgtgtag
aaggcttagc tacaaaggat actttctcct cgcaaaatgc 900cctccagggg
acagcgtaac ggttagcata gtgagtagca actcagcaac gtcatgtaca
960ctggcccgca agataaaacc aaaattcgtg ggacgggaaa aatatgatct
acctcccgtt 1020cacggtaaaa aaattccttg cacagtgtac gaccgtctga
aagaaacaac tgcaggctac 1080atcactatgc acaggccgag accgcacgct
tatacatcct acctggaaga atcatcaggg 1140aaagtttacg caaagccgcc
atctgggaag aacattacgt atgagtgcaa gtgcggcgac 1200tacaagaccg
gaaccgtttc gacccgcacc gaaatcactg gttgcaccgc catcaagcag
1260tgcgtcgcct ataagagcga ccaaacgaag tgggtcttca actcaccgga
cttgatcaga 1320catgacgacc acacggccca agggaaattg catttgcctt
tcaagttgat cccgagtacc 1380tgcatggtcc ctgttgccca cgcgccgaat
gtaatacatg gctttaaaca catcagcctc 1440caattagata cagaccactt
gacattgctc accaccagga gactaggggc aaacccggaa 1500ccaaccactg
aatggatcgt cggaaagacg gtcagaaact tcaccgtcga ccgagatggc
1560ctggaataca tatggggaaa tcatgagcca gtgagggtct atgcccaaga
gtcagcacca 1620ggagaccctc acggatggcc acacgaaata gtacagcatt
actaccatcg ccatcctgtg 1680tacaccatct tagccgtcgc atcagctacc
gtggcgatga tgattggcgt aactgttgca 1740gtgttatgtg cctgtaaagc
gcgccgtgag tgcctgacgc catacgccct ggccccaaac 1800gccgtaatcc
caacttcgct ggcactcttg tgctgcgtta ggtcggccaa tgctgaaacg
1860ttcaccgaga ccatgagtta cttgtggtcg aacagtcagc cgttcttctg
ggtccagttg 1920tgcatacctt tggccgcttt catcgttcta atgcgctgct
gctcctgctg cctgcctttt 1980ttagtggttg ccggcgccta cctggcgaag
gtagacgcct acgaacatgc gaccactgtt 2040ccaaatgtgc cacagatacc
gtataaggca cttgttgaaa gggcagggta tgccccgctc 2100aatttggaga
tcactgtcat gtcctcggag gttttgcctt ccaccaacca agagtacatt
2160acctgcaaat tcaccactgt ggtcccctcc ccaaaaatca aatgctgcgg
ctccttggaa 2220tgtcagccgg ccgctcatgc agactatacc tgcaaggtct
tcggaggggt ctaccccttt 2280atgtggggag gagcgcaatg tttttgcgac
agtgagaaca gccagatgag tgaggcgtac 2340gtcgaattgt cagcagattg
cgcgtctgac cacgcgcagg cgattaaggt gcacactgcc 2400gcgatgaaag
taggactgcg tattgtgtac gggaacacta ccagtttcct agatgtgtac
2460gtgaacggag tcacaccagg aacgtctaaa gacttgaaag tcatagctgg
accaatttca 2520gcatcgttta cgccattcga tcataaggtc gttatccatc
gcggcctggt gtacaactat 2580gacttcccgg aatatggagc gatgaaacca
ggagcgtttg gagacattca agctacctcc 2640ttgactagca aggatctcat
cgccagcaca gacattaggc tactcaagcc ttccgccaag 2700aacgtgcatg
tcccgtacac gcaggcctca tcaggatttg agatgtggaa aaacaactca
2760ggccgcccac tgcaggaaac cgcacctttc gggtgtaaga ttgcagtaaa
tccgctccga 2820gcggtggact gttcatacgg gaacattccc atttctattg
acatcccgaa cgctgccttt 2880atcaggacat cagatgcacc actggtctca
acagtcaaat gtgaagtcag tgagtgcact 2940tattcagcag acttcggcgg
gatggccacc ctgcagtatg tatccgaccg cgaaggtcaa 3000tgccccgtac
attcgcattc gagcacagca actctccaag agtcgacagt acatgtcctg
3060gagaaaggag cggtgacagt acactttagc accgcgagtc cacaggcgaa
ctttatcgta 3120tcgctgtgtg ggaagaagac aacatgcaat gcagaatgta
aaccaccagc tgaccatatc 3180gtgagcaccc cgcacaaaaa tgaccaagaa
tttcaagccg ccatctcaaa aacatcatgg 3240agttggctgt ttgccctttt
cggcggcgcc tcgtcgctat taattatagg acttatgatt 3300tttgcttgca
gcatgatgct gactagcaca cgaagatga 333921112PRTSindbis virusZZSINDBIS
Sindbis virus ZZ envelope protein mutant 2Met Ala Ser Ala Ala Pro
Leu Val Thr Ala Met Cys Leu Leu Gly Asn1 5 10 15Val Ser Phe Pro Cys
Asp Arg Pro Pro Thr Cys Tyr Thr Arg Glu Pro20 25 30Ser Arg Ala Leu
Asp Ile Leu Glu Glu Asn Val Asn His Glu Ala Tyr35 40 45Asp Thr Leu
Leu Asn Ala Ile Leu Arg Cys Gly Ser Ser Gly Arg Ser50 55 60Lys Arg
Ser Val Ile Asp Asp Phe Thr Leu Thr Ser Pro Tyr Leu Gly65 70 75
80Thr Cys Ser Tyr Cys His His Thr Val Pro Cys Phe Ser Pro Val Lys85
90 95Ile Glu Gln Val Trp Asp Glu Ala Asp Asp Asn Thr Ile Arg Ile
Gln100 105 110Thr Ser Ala Gln Phe Gly Tyr Asp Gln Ser Gly Ala Ala
Ser Ala Asn115 120 125Lys Tyr Arg Tyr Met Ser Leu Lys Gln Val Thr
Asp Asn Lys Phe Asn130 135 140Lys Glu Gln Gln Asn Ala Phe Tyr Glu
Ile Leu His Leu Pro Asn Leu145 150 155 160Asn Glu Glu Gln Arg Asn
Ala Phe Ile Gln Ser Leu Lys Asp Asp Pro165 170 175Ser Gln Ser Ala
Asn Leu Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala180 185 190Gln Ala
Pro Lys Val Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala195 200
205Phe Tyr Glu Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg
Asn210 215 220Ala Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser
Ala Asn Leu225 230 235 240Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala
Gln Ala Pro Lys Val Asp245 250 255Ala Asn Ser Ser Ser Val Pro Gly
Asp Pro Val Thr Thr Val Lys Glu260 265 270Gly Thr Met Asp Asp Ile
Lys Ile Ser Thr Ser Gly Pro Cys Arg Arg275 280 285Leu Ser Tyr Lys
Gly Tyr Phe Leu Leu Ala Lys Cys Pro Pro Gly Asp290 295 300Ser Val
Thr Val Ser Ile Val Ser Ser Asn Ser Ala Thr Ser Cys Thr305 310 315
320Leu Ala Arg Lys Ile Lys Pro Lys Phe Val Gly Arg Glu Lys Tyr
Asp325 330 335Leu Pro Pro Val His Gly Lys Lys Ile Pro Cys Thr Val
Tyr Asp Arg340 345 350Leu Lys Glu Thr Thr Ala Gly Tyr Ile Thr Met
His Arg Pro Arg Pro355 360 365His Ala Tyr Thr Ser Tyr Leu Glu Glu
Ser Ser Gly Lys Val Tyr Ala370 375 380Lys Pro Pro Ser Gly Lys Asn
Ile Thr Tyr Glu Cys Lys Cys Gly Asp385 390 395 400Tyr Lys Thr Gly
Thr Val Ser Thr Arg Thr Glu Ile Thr Gly Cys Thr405 410 415Ala Ile
Lys Gln Cys Val Ala Tyr Lys Ser Asp Gln Thr Lys Trp Val420 425
430Phe Asn Ser Pro Asp Leu Ile Arg His Asp Asp His Thr Ala Gln
Gly435 440 445Lys Leu His Leu Pro Phe Lys Leu Ile Pro Ser Thr Cys
Met Val Pro450 455 460Val Ala His Ala Pro Asn Val Ile His Gly Phe
Lys His Ile Ser Leu465 470 475 480Gln Leu Asp Thr Asp His Leu Thr
Leu Leu Thr Thr Arg Arg Leu Gly485 490 495Ala Asn Pro Glu Pro Thr
Thr Glu Trp Ile Val Gly Lys Thr Val Arg500 505 510Asn Phe Thr Val
Asp Arg Asp Gly Leu Glu Tyr Ile Trp Gly Asn His515 520 525Glu Pro
Val Arg Val Tyr Ala Gln Glu Ser Ala Pro Gly Asp Pro His530 535
540Gly Trp Pro His Glu Ile Val Gln His Tyr Tyr His Arg His Pro
Val545 550 555 560Tyr Thr Ile Leu Ala Val Ala Ser Ala Thr Val Ala
Met Met Ile Gly565 570 575Val Thr Val Ala Val Leu Cys Ala Cys Lys
Ala Arg Arg Glu Cys Leu580 585 590Thr Pro Tyr Ala Leu Ala Pro Asn
Ala Val Ile Pro Thr Ser Leu Ala595 600 605Leu Leu Cys Cys Val Arg
Ser Ala Asn Ala Glu Thr Phe Thr Glu Thr610 615 620Met Ser Tyr Leu
Trp Ser Asn Ser Gln Pro Phe Phe Trp Val Gln Leu625 630 635 640Cys
Ile Pro Leu Ala Ala Phe Ile Val Leu Met Arg Cys Cys Ser Cys645 650
655Cys Leu Pro Phe Leu Val Val Ala Gly Ala Tyr Leu Ala Lys Val
Asp660 665 670Ala Tyr Glu His Ala Thr Thr Val Pro Asn Val Pro Gln
Ile Pro Tyr675 680 685Lys Ala Leu Val Glu Arg Ala Gly Tyr Ala Pro
Leu Asn Leu Glu Ile690 695 700Thr Val Met Ser Ser Glu Val Leu Pro
Ser Thr Asn Gln Glu Tyr Ile705 710 715 720Thr Cys Lys Phe Thr Thr
Val Val Pro Ser Pro Lys Ile Lys Cys Cys725 730 735Gly Ser Leu Glu
Cys Gln Pro Ala Ala His Ala Asp Tyr Thr Cys Lys740 745 750Val Phe
Gly Gly Val Tyr Pro Phe Met Trp Gly Gly Ala Gln Cys Phe755 760
765Cys Asp Ser Glu Asn Ser Gln Met Ser Glu Ala Tyr Val Glu Leu
Ser770 775 780Ala Asp Cys Ala Ser Asp His Ala Gln Ala Ile Lys Val
His Thr Ala785 790 795 800Ala Met Lys Val Gly Leu Arg Ile Val Tyr
Gly Asn Thr Thr Ser Phe805 810 815Leu Asp Val Tyr Val Asn Gly Val
Thr Pro Gly Thr Ser Lys Asp Leu820 825 830Lys Val Ile Ala Gly Pro
Ile Ser Ala Ser Phe Thr Pro Phe Asp His835 840 845Lys Val Val Ile
His Arg Gly Leu Val Tyr Asn Tyr Asp Phe Pro Glu850 855 860Tyr Gly
Ala Met Lys Pro Gly Ala Phe Gly Asp Ile Gln Ala Thr Ser865 870 875
880Leu Thr Ser Lys Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu Leu
Lys885 890 895Pro Ser Ala Lys Asn Val His Val Pro Tyr Thr Gln Ala
Ser Ser Gly900 905 910Phe Glu Met Trp Lys Asn Asn Ser Gly Arg Pro
Leu Gln Glu Thr Ala915 920 925Pro Phe Gly Cys Lys Ile Ala Val Asn
Pro Leu Arg Ala Val Asp Cys930 935 940Ser Tyr Gly Asn Ile Pro Ile
Ser Ile Asp Ile Pro Asn Ala Ala Phe945 950 955 960Ile Arg Thr Ser
Asp Ala Pro Leu Val Ser Thr Val Lys Cys Glu Val965 970 975Ser Glu
Cys Thr Tyr Ser Ala Asp Phe Gly Gly Met Ala Thr Leu Gln980 985
990Tyr Val Ser Asp Arg Glu Gly Gln Cys Pro Val His Ser His Ser
Ser995 1000 1005Thr Ala Thr Leu Gln Glu Ser Thr Val His Val Leu Glu
Lys Gly Ala1010 1015 1020Val Thr Val His Phe Ser Thr Ala Ser Pro
Gln Ala Asn Phe Ile Val1025 1030 1035 1040Ser Leu Cys Gly Lys Lys
Thr Thr Cys Asn Ala Glu Cys Lys Pro Pro1045 1050 1055Ala Asp His
Ile Val Ser Thr Pro His Lys Asn Asp Gln Glu Phe Gln1060 1065
1070Ala Ala Ile Ser Lys Thr Ser Trp Ser Trp Leu Phe Ala Leu Phe
Gly1075 1080 1085Gly Ala Ser Ser Leu Leu Ile Ile Gly Leu Met Ile
Phe Ala Cys Ser1090 1095 1100Met Met Leu Thr Ser Thr Arg Arg1105
111033327DNASindbis virusm168 Sindbis virus ZZ envelope protein
mutant 3atggcgtccg cagcaccact ggtcacggca atgtgtttgc tcggaaatgt
gagcttccca 60tgcgaccgcc cgcccacatg ctatacccgc gaaccttcca gagccctcga
catccttgaa 120gagaacgtga accatgaggc ctacgatacc ctgctcaatg
ccatattgcg gtgcggatcg 180tctggcagcg tcattgacga ctttaccctg
accagcccct acttgggcac atgctcgtac 240tgccaccata ctgtaccgtg
cttcagccct gttaagatcg agcaggtctg ggacgaagcg 300gacgataaca
ccatacgcat acagacttcc gcccagtttg gatacgacca aagcggagca
360gcaagcgcaa acaagtaccg ctacatggcg gctgcggcgg taaccgacaa
caaattcaac 420aaagaacaac aaaacgcgtt ctatgagatc ttacatttac
ctaacttaaa cgaagaacaa 480cgaaacgcct tcatccaaag tttaaaagat
gacccaagcc aaagcgctaa ccttttagca 540gaagctaaaa agctaaatga
tgctcaggcg ccgaaagtag acaacaaatt caacaaagaa 600caacaaaacg
cgttctatga gatcttacat ttacctaact taaacgaaga acaacgaaac
660gccttcatcc aaagtttaaa agatgaccca agccaaagcg ctaacctttt
agcagaagct 720aaaaagctaa atgatgctca ggcgccgaaa gtagacgcga
attcgagctc ggtacccggg 780gatccggtaa ccaccgttaa agaaggcacc
atggatgaca tcaagattag cacctcagga 840ccgtgtagaa ggcttagcta
caaaggatac tttctcctcg caaaatgccc tccaggggac 900agcgtaacgg
ttagcatagt gagtagcaac tcagcaacgt catgtacact ggcccgcaag
960ataaaaccaa aattcgtggg acgggaaaaa tatgatctac ctcccgttca
cggtaaaaaa 1020attccttgca cagtgtacga ccgtctggca gcaacaactg
caggctacat cactatgcac 1080aggccgagac cgcacgctta tacatcctac
ctggaagaat catcagggaa agtttacgca 1140aagccgccat ctgggaagaa
cattacgtat gagtgcaagt gcggcgacta caagaccgga 1200accgtttcga
cccgcaccga aatcactggt tgcaccgcca tcaagcagtg cgtcgcctat
1260aagagcgacc aaacgaagtg ggtcttcaac tcaccggact tgatcagaca
tgacgaccac 1320acggcccaag ggaaattgca tttgcctttc aagttgatcc
cgagtacctg catggtccct 1380gttgcccacg cgccgaatgt aatacatggc
tttaaacaca tcagcctcca attagataca 1440gaccacttga cattgctcac
caccaggaga ctaggggcaa acccggaacc aaccactgaa 1500tggatcgtcg
gaaagacggt cagaaacttc accgtcgacc gagatggcct ggaatacata
1560tggggaaatc atgagccagt gagggtctat gcccaagagt cagcaccagg
agaccctcac 1620ggatggccac acgaaatagt acagcattac taccatcgcc
atcctgtgta caccatctta 1680gccgtcgcat cagctaccgt ggcgatgatg
attggcgtaa ctgttgcagt gttatgtgcc 1740tgtaaagcgc gccgtgagtg
cctgacgcca tacgccctgg ccccaaacgc cgtaatccca 1800acttcgctgg
cactcttgtg ctgcgttagg tcggccaatg ctgaaacgtt caccgagacc
1860atgagttact tgtggtcgaa cagtcagccg ttcttctggg tccagttgtg
catacctttg 1920gccgctttca tcgttctaat gcgctgctgc tcctgctgcc
tgcctttttt agtggttgcc 1980ggcgcctacc tggcgaaggt agacgcctac
gaacatgcga ccactgttcc aaatgtgcca 2040cagataccgt ataaggcact
tgttgaaagg gcagggtatg ccccgctcaa tttggagatc 2100actgtcatgt
cctcggaggt tttgccttcc accaaccaag agtacattac ctgcaaattc
2160accactgtgg tcccctcccc aaaaatcaaa tgctgcggct ccttggaatg
tcagccggcc 2220gctcatgcag actatacctg caaggtcttc ggaggggtct
acccctttat gtggggagga 2280gcgcaatgtt tttgcgacag tgagaacagc
cagatgagtg aggcgtacgt cgaattgtca 2340gcagattgcg cgtctgacca
cgcgcaggcg attaaggtgc acactgccgc gatgaaagta 2400ggactgcgta
ttgtgtacgg gaacactacc agtttcctag atgtgtacgt gaacggagtc
2460acaccaggaa cgtctaaaga cttgaaagtc atagctggac caatttcagc
atcgtttacg 2520ccattcgatc ataaggtcgt tatccatcgc ggcctggtgt
acaactatga cttcccggaa 2580tatggagcga tgaaaccagg agcgtttgga
gacattcaag ctacctcctt gactagcaag 2640gatctcatcg ccagcacaga
cattaggcta ctcaagcctt ccgccaagaa cgtgcatgtc 2700ccgtacacgc
aggcctcatc aggatttgag atgtggaaaa acaactcagg ccgcccactg
2760caggaaaccg cacctttcgg gtgtaagatt gcagtaaatc cgctccgagc
ggtggactgt 2820tcatacggga acattcccat ttctattgac atcccgaacg
ctgcctttat caggacatca 2880gatgcaccac tggtctcaac agtcaaatgt
gaagtcagtg agtgcactta ttcagcagac 2940ttcggcggga tggccaccct
gcagtatgta tccgaccgcg aaggtcaatg ccccgtacat 3000tcgcattcga
gcacagcaac tctccaagag tcgacagtac atgtcctgga gaaaggagcg
3060gtgacagtac actttagcac cgcgagtcca caggcgaact ttatcgtatc
gctgtgtggg 3120aagaagacaa catgcaatgc agaatgtaaa ccaccagctg
accatatcgt gagcaccccg 3180cacaaaaatg accaagaatt tcaagccgcc
atctcaaaaa catcatggag ttggctgttt 3240gcccttttcg gcggcgcctc
gtcgctatta attataggac ttatgatttt tgcttgcagc 3300atgatgctga
ctagcacacg aagatga 332741108PRTSindbis virusm168 Sindbis virus ZZ
envelope protein mutant 4Met Ala Ser Ala Ala Pro Leu Val Thr Ala
Met Cys Leu Leu Gly Asn1 5 10 15Val Ser Phe Pro Cys Asp Arg Pro Pro
Thr Cys Tyr Thr Arg Glu Pro20 25 30Ser Arg Ala Leu Asp Ile Leu Glu
Glu Asn Val Asn His Glu Ala Tyr35 40 45Asp Thr Leu Leu Asn Ala Ile
Leu Arg Cys Gly Ser Ser Gly Ser Val50 55 60Ile Asp Asp Phe Thr Leu
Thr Ser Pro Tyr Leu Gly Thr Cys Ser Tyr65 70 75 80Cys His His Thr
Val Pro Cys Phe Ser Pro Val Lys Ile Glu Gln Val85 90 95Trp Asp Glu
Ala Asp Asp Asn Thr Ile Arg Ile Gln Thr Ser Ala Gln100 105 110Phe
Gly Tyr Asp Gln Ser Gly Ala Ala Ser Ala Asn Lys Tyr Arg Tyr115 120
125Met Ala Ala Ala Ala Val Thr Asp Asn Lys Phe Asn Lys Glu Gln
Gln130 135 140Asn Ala Phe Tyr Glu Ile Leu His Leu Pro Asn Leu Asn
Glu Glu Gln145 150 155 160Arg Asn Ala Phe Ile Gln Ser Leu Lys Asp
Asp Pro Ser Gln Ser Ala165 170 175Asn Leu Leu Ala Glu Ala Lys Lys
Leu Asn Asp Ala Gln Ala Pro Lys180 185 190Val Asp Asn Lys Phe Asn
Lys Glu Gln Gln Asn Ala Phe Tyr Glu Ile195 200 205Leu His Leu Pro
Asn Leu Asn Glu Glu Gln Arg Asn Ala Phe Ile Gln210 215 220Ser Leu
Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu Ala225 230 235
240Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Val Asp Ala Asn Ser
Ser245 250 255Ser Val Pro Gly Asp Pro Val Thr Thr Val Lys Glu Gly
Thr Met Asp260 265 270Asp Ile Lys Ile Ser Thr Ser Gly Pro Cys Arg
Arg Leu Ser Tyr Lys275 280 285Gly Tyr Phe Leu Leu Ala Lys Cys Pro
Pro Gly Asp Ser Val Thr Val290 295 300Ser Ile Val Ser Ser Asn Ser
Ala Thr Ser Cys Thr Leu Ala Arg Lys305 310
315 320Ile Lys Pro Lys Phe Val Gly Arg Glu Lys Tyr Asp Leu Pro Pro
Val325 330 335His Gly Lys Lys Ile Pro Cys Thr Val Tyr Asp Arg Leu
Ala Ala Thr340 345 350Thr Ala Gly Tyr Ile Thr Met His Arg Pro Arg
Pro His Ala Tyr Thr355 360 365Ser Tyr Leu Glu Glu Ser Ser Gly Lys
Val Tyr Ala Lys Pro Pro Ser370 375 380Gly Lys Asn Ile Thr Tyr Glu
Cys Lys Cys Gly Asp Tyr Lys Thr Gly385 390 395 400Thr Val Ser Thr
Arg Thr Glu Ile Thr Gly Cys Thr Ala Ile Lys Gln405 410 415Cys Val
Ala Tyr Lys Ser Asp Gln Thr Lys Trp Val Phe Asn Ser Pro420 425
430Asp Leu Ile Arg His Asp Asp His Thr Ala Gln Gly Lys Leu His
Leu435 440 445Pro Phe Lys Leu Ile Pro Ser Thr Cys Met Val Pro Val
Ala His Ala450 455 460Pro Asn Val Ile His Gly Phe Lys His Ile Ser
Leu Gln Leu Asp Thr465 470 475 480Asp His Leu Thr Leu Leu Thr Thr
Arg Arg Leu Gly Ala Asn Pro Glu485 490 495Pro Thr Thr Glu Trp Ile
Val Gly Lys Thr Val Arg Asn Phe Thr Val500 505 510Asp Arg Asp Gly
Leu Glu Tyr Ile Trp Gly Asn His Glu Pro Val Arg515 520 525Val Tyr
Ala Gln Glu Ser Ala Pro Gly Asp Pro His Gly Trp Pro His530 535
540Glu Ile Val Gln His Tyr Tyr His Arg His Pro Val Tyr Thr Ile
Leu545 550 555 560Ala Val Ala Ser Ala Thr Val Ala Met Met Ile Gly
Val Thr Val Ala565 570 575Val Leu Cys Ala Cys Lys Ala Arg Arg Glu
Cys Leu Thr Pro Tyr Ala580 585 590Leu Ala Pro Asn Ala Val Ile Pro
Thr Ser Leu Ala Leu Leu Cys Cys595 600 605Val Arg Ser Ala Asn Ala
Glu Thr Phe Thr Glu Thr Met Ser Tyr Leu610 615 620Trp Ser Asn Ser
Gln Pro Phe Phe Trp Val Gln Leu Cys Ile Pro Leu625 630 635 640Ala
Ala Phe Ile Val Leu Met Arg Cys Cys Ser Cys Cys Leu Pro Phe645 650
655Leu Val Val Ala Gly Ala Tyr Leu Ala Lys Val Asp Ala Tyr Glu
His660 665 670Ala Thr Thr Val Pro Asn Val Pro Gln Ile Pro Tyr Lys
Ala Leu Val675 680 685Glu Arg Ala Gly Tyr Ala Pro Leu Asn Leu Glu
Ile Thr Val Met Ser690 695 700Ser Glu Val Leu Pro Ser Thr Asn Gln
Glu Tyr Ile Thr Cys Lys Phe705 710 715 720Thr Thr Val Val Pro Ser
Pro Lys Ile Lys Cys Cys Gly Ser Leu Glu725 730 735Cys Gln Pro Ala
Ala His Ala Asp Tyr Thr Cys Lys Val Phe Gly Gly740 745 750Val Tyr
Pro Phe Met Trp Gly Gly Ala Gln Cys Phe Cys Asp Ser Glu755 760
765Asn Ser Gln Met Ser Glu Ala Tyr Val Glu Leu Ser Ala Asp Cys
Ala770 775 780Ser Asp His Ala Gln Ala Ile Lys Val His Thr Ala Ala
Met Lys Val785 790 795 800Gly Leu Arg Ile Val Tyr Gly Asn Thr Thr
Ser Phe Leu Asp Val Tyr805 810 815Val Asn Gly Val Thr Pro Gly Thr
Ser Lys Asp Leu Lys Val Ile Ala820 825 830Gly Pro Ile Ser Ala Ser
Phe Thr Pro Phe Asp His Lys Val Val Ile835 840 845His Arg Gly Leu
Val Tyr Asn Tyr Asp Phe Pro Glu Tyr Gly Ala Met850 855 860Lys Pro
Gly Ala Phe Gly Asp Ile Gln Ala Thr Ser Leu Thr Ser Lys865 870 875
880Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu Leu Lys Pro Ser Ala
Lys885 890 895Asn Val His Val Pro Tyr Thr Gln Ala Ser Ser Gly Phe
Glu Met Trp900 905 910Lys Asn Asn Ser Gly Arg Pro Leu Gln Glu Thr
Ala Pro Phe Gly Cys915 920 925Lys Ile Ala Val Asn Pro Leu Arg Ala
Val Asp Cys Ser Tyr Gly Asn930 935 940Ile Pro Ile Ser Ile Asp Ile
Pro Asn Ala Ala Phe Ile Arg Thr Ser945 950 955 960Asp Ala Pro Leu
Val Ser Thr Val Lys Cys Glu Val Ser Glu Cys Thr965 970 975Tyr Ser
Ala Asp Phe Gly Gly Met Ala Thr Leu Gln Tyr Val Ser Asp980 985
990Arg Glu Gly Gln Cys Pro Val His Ser His Ser Ser Thr Ala Thr
Leu995 1000 1005Gln Glu Ser Thr Val His Val Leu Glu Lys Gly Ala Val
Thr Val His1010 1015 1020Phe Ser Thr Ala Ser Pro Gln Ala Asn Phe
Ile Val Ser Leu Cys Gly1025 1030 1035 1040Lys Lys Thr Thr Cys Asn
Ala Glu Cys Lys Pro Pro Ala Asp His Ile1045 1050 1055Val Ser Thr
Pro His Lys Asn Asp Gln Glu Phe Gln Ala Ala Ile Ser1060 1065
1070Lys Thr Ser Trp Ser Trp Leu Phe Ala Leu Phe Gly Gly Ala Ser
Ser1075 1080 1085Leu Leu Ile Ile Gly Leu Met Ile Phe Ala Cys Ser
Met Met Leu Thr1090 1095 1100Ser Thr Arg Arg110553327DNASindbis
virusm168 mutant (E1 AK226-227SG) Sindbis virus ZZ envelope protein
mutant, m168 with mutation in E1 domain 5atggcgtccg cagcaccact
ggtcacggca atgtgtttgc tcggaaatgt gagcttccca 60tgcgaccgcc cgcccacatg
ctatacccgc gaaccttcca gagccctcga catccttgaa 120gagaacgtga
accatgaggc ctacgatacc ctgctcaatg ccatattgcg gtgcggatcg
180tctggcagcg tcattgacga ctttaccctg accagcccct acttgggcac
atgctcgtac 240tgccaccata ctgtaccgtg cttcagccct gttaagatcg
agcaggtctg ggacgaagcg 300gacgataaca ccatacgcat acagacttcc
gcccagtttg gatacgacca aagcggagca 360gcaagcgcaa acaagtaccg
ctacatggcg gctgcggcgg taaccgacaa caaattcaac 420aaagaacaac
aaaacgcgtt ctatgagatc ttacatttac ctaacttaaa cgaagaacaa
480cgaaacgcct tcatccaaag tttaaaagat gacccaagcc aaagcgctaa
ccttttagca 540gaagctaaaa agctaaatga tgctcaggcg ccgaaagtag
acaacaaatt caacaaagaa 600caacaaaacg cgttctatga gatcttacat
ttacctaact taaacgaaga acaacgaaac 660gccttcatcc aaagtttaaa
agatgaccca agccaaagcg ctaacctttt agcagaagct 720aaaaagctaa
atgatgctca ggcgccgaaa gtagacgcga attcgagctc ggtacccggg
780gatccggtaa ccaccgttaa agaaggcacc atggatgaca tcaagattag
cacctcagga 840ccgtgtagaa ggcttagcta caaaggatac tttctcctcg
caaaatgccc tccaggggac 900agcgtaacgg ttagcatagt gagtagcaac
tcagcaacgt catgtacact ggcccgcaag 960ataaaaccaa aattcgtggg
acgggaaaaa tatgatctac ctcccgttca cggtaaaaaa 1020attccttgca
cagtgtacga ccgtctggca gcaacaactg caggctacat cactatgcac
1080aggccgagac cgcacgctta tacatcctac ctggaagaat catcagggaa
agtttacgca 1140aagccgccat ctgggaagaa cattacgtat gagtgcaagt
gcggcgacta caagaccgga 1200accgtttcga cccgcaccga aatcactggt
tgcaccgcca tcaagcagtg cgtcgcctat 1260aagagcgacc aaacgaagtg
ggtcttcaac tcaccggact tgatcagaca tgacgaccac 1320acggcccaag
ggaaattgca tttgcctttc aagttgatcc cgagtacctg catggtccct
1380gttgcccacg cgccgaatgt aatacatggc tttaaacaca tcagcctcca
attagataca 1440gaccacttga cattgctcac caccaggaga ctaggggcaa
acccggaacc aaccactgaa 1500tggatcgtcg gaaagacggt cagaaacttc
accgtcgacc gagatggcct ggaatacata 1560tggggaaatc atgagccagt
gagggtctat gcccaagagt cagcaccagg agaccctcac 1620ggatggccac
acgaaatagt acagcattac taccatcgcc atcctgtgta caccatctta
1680gccgtcgcat cagctaccgt ggcgatgatg attggcgtaa ctgttgcagt
gttatgtgcc 1740tgtaaagcgc gccgtgagtg cctgacgcca tacgccctgg
ccccaaacgc cgtaatccca 1800acttcgctgg cactcttgtg ctgcgttagg
tcggccaatg ctgaaacgtt caccgagacc 1860atgagttact tgtggtcgaa
cagtcagccg ttcttctggg tccagttgtg catacctttg 1920gccgctttca
tcgttctaat gcgctgctgc tcctgctgcc tgcctttttt agtggttgcc
1980ggcgcctacc tggcgaaggt agacgcctac gaacatgcga ccactgttcc
aaatgtgcca 2040cagataccgt ataaggcact tgttgaaagg gcagggtatg
ccccgctcaa tttggagatc 2100actgtcatgt cctcggaggt tttgccttcc
accaaccaag agtacattac ctgcaaattc 2160accactgtgg tcccctcccc
aaaaatcaaa tgctgcggct ccttggaatg tcagccggcc 2220gctcatgcag
actatacctg caaggtcttc ggaggggtct acccctttat gtggggagga
2280gcgcaatgtt tttgcgacag tgagaacagc cagatgagtg aggcgtacgt
cgaattgtca 2340gcagattgcg cgtctgacca cgcgcaggcg attaaggtgc
acactgccgc gatgaaagta 2400ggactgcgta ttgtgtacgg gaacactacc
agtttcctag atgtgtacgt gaacggagtc 2460acaccaggaa cgtctaaaga
cttgaaagtc atagctggac caatttcagc atcgtttacg 2520ccattcgatc
ataaggtcgt tatccatcgc ggcctggtgt acaactatga cttcccggaa
2580tatggagcga tgaaaccagg agcgtttgga gacattcaag ctacctcctt
gactagcaag 2640gatctcatcg ccagcacaga cattaggcta ctcaagcctt
cctccgggaa cgtgcatgtc 2700ccgtacacgc aggcctcatc aggatttgag
atgtggaaaa acaactcagg ccgcccactg 2760caggaaaccg cacctttcgg
gtgtaagatt gcagtaaatc cgctccgagc ggtggactgt 2820tcatacggga
acattcccat ttctattgac atcccgaacg ctgcctttat caggacatca
2880gatgcaccac tggtctcaac agtcaaatgt gaagtcagtg agtgcactta
ttcagcagac 2940ttcggcggga tggccaccct gcagtatgta tccgaccgcg
aaggtcaatg ccccgtacat 3000tcgcattcga gcacagcaac tctccaagag
tcgacagtac atgtcctgga gaaaggagcg 3060gtgacagtac actttagcac
cgcgagtcca caggcgaact ttatcgtatc gctgtgtggg 3120aagaagacaa
catgcaatgc agaatgtaaa ccaccagctg accatatcgt gagcaccccg
3180cacaaaaatg accaagaatt tcaagccgcc atctcaaaaa catcatggag
ttggctgttt 3240gcccttttcg gcggcgcctc gtcgctatta attataggac
ttatgatttt tgcttgcagc 3300atgatgctga ctagcacacg aagatga
332761108PRTSindbis virusm168 mutant (E1 AK226-227SG) Sindbis virus
ZZ envelope protein mutant, m168 with mutation in E1 domain 6Met
Ala Ser Ala Ala Pro Leu Val Thr Ala Met Cys Leu Leu Gly Asn1 5 10
15Val Ser Phe Pro Cys Asp Arg Pro Pro Thr Cys Tyr Thr Arg Glu Pro20
25 30Ser Arg Ala Leu Asp Ile Leu Glu Glu Asn Val Asn His Glu Ala
Tyr35 40 45Asp Thr Leu Leu Asn Ala Ile Leu Arg Cys Gly Ser Ser Gly
Ser Val50 55 60Ile Asp Asp Phe Thr Leu Thr Ser Pro Tyr Leu Gly Thr
Cys Ser Tyr65 70 75 80Cys His His Thr Val Pro Cys Phe Ser Pro Val
Lys Ile Glu Gln Val85 90 95Trp Asp Glu Ala Asp Asp Asn Thr Ile Arg
Ile Gln Thr Ser Ala Gln100 105 110Phe Gly Tyr Asp Gln Ser Gly Ala
Ala Ser Ala Asn Lys Tyr Arg Tyr115 120 125Met Ala Ala Ala Ala Val
Thr Asp Asn Lys Phe Asn Lys Glu Gln Gln130 135 140Asn Ala Phe Tyr
Glu Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln145 150 155 160Arg
Asn Ala Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala165 170
175Asn Leu Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro
Lys180 185 190Val Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe
Tyr Glu Ile195 200 205Leu His Leu Pro Asn Leu Asn Glu Glu Gln Arg
Asn Ala Phe Ile Gln210 215 220Ser Leu Lys Asp Asp Pro Ser Gln Ser
Ala Asn Leu Leu Ala Glu Ala225 230 235 240Lys Lys Leu Asn Asp Ala
Gln Ala Pro Lys Val Asp Ala Asn Ser Ser245 250 255Ser Val Pro Gly
Asp Pro Val Thr Thr Val Lys Glu Gly Thr Met Asp260 265 270Asp Ile
Lys Ile Ser Thr Ser Gly Pro Cys Arg Arg Leu Ser Tyr Lys275 280
285Gly Tyr Phe Leu Leu Ala Lys Cys Pro Pro Gly Asp Ser Val Thr
Val290 295 300Ser Ile Val Ser Ser Asn Ser Ala Thr Ser Cys Thr Leu
Ala Arg Lys305 310 315 320Ile Lys Pro Lys Phe Val Gly Arg Glu Lys
Tyr Asp Leu Pro Pro Val325 330 335His Gly Lys Lys Ile Pro Cys Thr
Val Tyr Asp Arg Leu Ala Ala Thr340 345 350Thr Ala Gly Tyr Ile Thr
Met His Arg Pro Arg Pro His Ala Tyr Thr355 360 365Ser Tyr Leu Glu
Glu Ser Ser Gly Lys Val Tyr Ala Lys Pro Pro Ser370 375 380Gly Lys
Asn Ile Thr Tyr Glu Cys Lys Cys Gly Asp Tyr Lys Thr Gly385 390 395
400Thr Val Ser Thr Arg Thr Glu Ile Thr Gly Cys Thr Ala Ile Lys
Gln405 410 415Cys Val Ala Tyr Lys Ser Asp Gln Thr Lys Trp Val Phe
Asn Ser Pro420 425 430Asp Leu Ile Arg His Asp Asp His Thr Ala Gln
Gly Lys Leu His Leu435 440 445Pro Phe Lys Leu Ile Pro Ser Thr Cys
Met Val Pro Val Ala His Ala450 455 460Pro Asn Val Ile His Gly Phe
Lys His Ile Ser Leu Gln Leu Asp Thr465 470 475 480Asp His Leu Thr
Leu Leu Thr Thr Arg Arg Leu Gly Ala Asn Pro Glu485 490 495Pro Thr
Thr Glu Trp Ile Val Gly Lys Thr Val Arg Asn Phe Thr Val500 505
510Asp Arg Asp Gly Leu Glu Tyr Ile Trp Gly Asn His Glu Pro Val
Arg515 520 525Val Tyr Ala Gln Glu Ser Ala Pro Gly Asp Pro His Gly
Trp Pro His530 535 540Glu Ile Val Gln His Tyr Tyr His Arg His Pro
Val Tyr Thr Ile Leu545 550 555 560Ala Val Ala Ser Ala Thr Val Ala
Met Met Ile Gly Val Thr Val Ala565 570 575Val Leu Cys Ala Cys Lys
Ala Arg Arg Glu Cys Leu Thr Pro Tyr Ala580 585 590Leu Ala Pro Asn
Ala Val Ile Pro Thr Ser Leu Ala Leu Leu Cys Cys595 600 605Val Arg
Ser Ala Asn Ala Glu Thr Phe Thr Glu Thr Met Ser Tyr Leu610 615
620Trp Ser Asn Ser Gln Pro Phe Phe Trp Val Gln Leu Cys Ile Pro
Leu625 630 635 640Ala Ala Phe Ile Val Leu Met Arg Cys Cys Ser Cys
Cys Leu Pro Phe645 650 655Leu Val Val Ala Gly Ala Tyr Leu Ala Lys
Val Asp Ala Tyr Glu His660 665 670Ala Thr Thr Val Pro Asn Val Pro
Gln Ile Pro Tyr Lys Ala Leu Val675 680 685Glu Arg Ala Gly Tyr Ala
Pro Leu Asn Leu Glu Ile Thr Val Met Ser690 695 700Ser Glu Val Leu
Pro Ser Thr Asn Gln Glu Tyr Ile Thr Cys Lys Phe705 710 715 720Thr
Thr Val Val Pro Ser Pro Lys Ile Lys Cys Cys Gly Ser Leu Glu725 730
735Cys Gln Pro Ala Ala His Ala Asp Tyr Thr Cys Lys Val Phe Gly
Gly740 745 750Val Tyr Pro Phe Met Trp Gly Gly Ala Gln Cys Phe Cys
Asp Ser Glu755 760 765Asn Ser Gln Met Ser Glu Ala Tyr Val Glu Leu
Ser Ala Asp Cys Ala770 775 780Ser Asp His Ala Gln Ala Ile Lys Val
His Thr Ala Ala Met Lys Val785 790 795 800Gly Leu Arg Ile Val Tyr
Gly Asn Thr Thr Ser Phe Leu Asp Val Tyr805 810 815Val Asn Gly Val
Thr Pro Gly Thr Ser Lys Asp Leu Lys Val Ile Ala820 825 830Gly Pro
Ile Ser Ala Ser Phe Thr Pro Phe Asp His Lys Val Val Ile835 840
845His Arg Gly Leu Val Tyr Asn Tyr Asp Phe Pro Glu Tyr Gly Ala
Met850 855 860Lys Pro Gly Ala Phe Gly Asp Ile Gln Ala Thr Ser Leu
Thr Ser Lys865 870 875 880Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu
Leu Lys Pro Ser Ser Gly885 890 895Asn Val His Val Pro Tyr Thr Gln
Ala Ser Ser Gly Phe Glu Met Trp900 905 910Lys Asn Asn Ser Gly Arg
Pro Leu Gln Glu Thr Ala Pro Phe Gly Cys915 920 925Lys Ile Ala Val
Asn Pro Leu Arg Ala Val Asp Cys Ser Tyr Gly Asn930 935 940Ile Pro
Ile Ser Ile Asp Ile Pro Asn Ala Ala Phe Ile Arg Thr Ser945 950 955
960Asp Ala Pro Leu Val Ser Thr Val Lys Cys Glu Val Ser Glu Cys
Thr965 970 975Tyr Ser Ala Asp Phe Gly Gly Met Ala Thr Leu Gln Tyr
Val Ser Asp980 985 990Arg Glu Gly Gln Cys Pro Val His Ser His Ser
Ser Thr Ala Thr Leu995 1000 1005Gln Glu Ser Thr Val His Val Leu Glu
Lys Gly Ala Val Thr Val His1010 1015 1020Phe Ser Thr Ala Ser Pro
Gln Ala Asn Phe Ile Val Ser Leu Cys Gly1025 1030 1035 1040Lys Lys
Thr Thr Cys Asn Ala Glu Cys Lys Pro Pro Ala Asp His Ile1045 1050
1055Val Ser Thr Pro His Lys Asn Asp Gln Glu Phe Gln Ala Ala Ile
Ser1060 1065 1070Lys Thr Ser Trp Ser Trp Leu Phe Ala Leu Phe Gly
Gly Ala Ser Ser1075 1080 1085Leu Leu Ile Ile Gly Leu Met Ile Phe
Ala Cys Ser Met Met Leu Thr1090 1095 1100Ser Thr Arg
Arg1105715DNAArtificial SequenceDescription of Artificial
Sequencem168 sequence modified for mutant (E1 AK226-227SG) Sindbis
virus ZZ envelope protein mutant, m168 with mutation in E1 domain
7aagccttccg ccaag 15815DNAArtificial SequenceDescription of
Artificial Sequencem168 sequence modified in mutant (E1
AK226-227SG) Sindbis virus ZZ envelope protein mutant, m168 with
mutation in E1 domain 8aagccttcct ccggg 1599PRTArtificial
SequenceDescription of Artificial Sequencesynthetic integrin
binding sequence "4C-RGD" 9Cys Asp Cys Arg Gly Asp Cys Phe Cys1
51027DNAArtificial SequenceDescription of Artificial
Sequencesynthetic integrin binding sequence "4C-RGD" 10tgcgactgta
gaggcgactg tttctgc
27119PRTArtificial SequenceDescription of Artificial
Sequencesynthetic transferrin receptor targeting sequence "B6"
11Gly His Lys Ala Lys Gly Pro Arg Lys1 51227DNAArtificial
SequenceDescription of Artificial Sequencesynthetic transferrin
receptor targeting sequence "B6" 12ggacataaag ctaagggtcc tagaaag
271320DNAArtificial SequenceDescription of Artificial
SequenceFluc-a PCR primer for analysis of vector copy number
(Firefly Luciferase) 13gagatacgcc ctggttcctg 201423DNAArtificial
SequenceDescription of Artificial SequenceFluc-b PCR primer for
analysis of vector copy number (Firefly Luciferase) 14gcatacgacg
attctgtgat ttg 231522DNAArtificial SequenceDescription of
Artificial Sequencebeta-actin-F PCR primer for analysis of cell
number (mouse beta actin) 15caactccatc atgaagtgtg ac
221621DNAArtificial SequenceDescription of Artificial
Sequencebeta-actin-R PCR primer for analysis of cell number (mouse
beta actin) 16ccacacggag tacttgcgct c 21
* * * * *
References