U.S. patent application number 12/033691 was filed with the patent office on 2008-09-18 for incrementally truncated nucleic acids and methods of making same.
Invention is credited to Stephen J. Benkovic, Stefan Lutz, Andrew E. Nixon, Marc Ostermeier.
Application Number | 20080227650 12/033691 |
Document ID | / |
Family ID | 39763304 |
Filed Date | 2008-09-18 |
United States Patent
Application |
20080227650 |
Kind Code |
A1 |
Benkovic; Stephen J. ; et
al. |
September 18, 2008 |
Incrementally Truncated Nucleic Acids and Methods of Making
Same
Abstract
A series of methods that utilize the incremental truncation of
nucleic acids are described to create a plurality of modified
nucleic acids and hybrid polypeptides. A plurality of substantially
all possible single base-pair deletions of a given nucleic acid
sequence is created. A method of making shuffled incremental
truncated nucleic acids, which is independent of nucleic acid
sequence homology, is also described. These methods can be used in
protein engineering, protein folding, protein evolution, and the
chemical synthesis of novel hybrid proteins and polypeptides.
Inventors: |
Benkovic; Stephen J.; (State
College, PA) ; Ostermeier; Marc; (Baltimore, MD)
; Lutz; Stefan; (State College, PA) ; Nixon;
Andrew E.; (Quincy, MA) |
Correspondence
Address: |
WELSH & KATZ, LTD
120 S RIVERSIDE PLAZA, 22ND FLOOR
CHICAGO
IL
60606
US
|
Family ID: |
39763304 |
Appl. No.: |
12/033691 |
Filed: |
February 19, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09718465 |
Nov 15, 2000 |
7332308 |
|
|
12033691 |
|
|
|
|
Current U.S.
Class: |
506/1 ; 435/91.2;
536/22.1 |
Current CPC
Class: |
C12N 15/1058 20130101;
C12N 15/102 20130101; C12N 15/1027 20130101 |
Class at
Publication: |
506/1 ; 435/91.2;
536/22.1 |
International
Class: |
C40B 10/00 20060101
C40B010/00; C07H 21/00 20060101 C07H021/00; C12P 19/30 20060101
C12P019/30 |
Goverment Interests
STATEMENT OF GOVERNMENTAL RIGHTS
[0002] This invention was made with United States Government
support in the form of a grant from the National Institute of
Health, Grant No. GM24129 and a National Institute of Health
postdoctoral fellowship Grant No. GM18560. The United States
Government has certain rights in this invention.
Claims
1. A method of making a plurality of expression products of an
incrementally truncated nucleic acid comprising the steps of: a)
providing a parent nucleic acid; b) serially removing nucleotides
from one or both termini of said nucleic acid to form truncated
parent nucleic acids whose length decreases incrementally over
time; c) stopping said serial nucleotide removal at a plurality of
different times to form a plurality of incrementally truncated
nucleic acids; and d) expressing said plurality of incrementally
truncated nucleic acids to form a plurality of truncated nucleic
acid expression products.
2. An incrementally truncated nucleic acid made by the process of
claim 1.
3. A truncated nucleic acid expression product made by the process
of claim 1.
4. The method of claim 1 wherein said parent nucleic acid comprises
a library of nucleic acids.
5. A method of making a plurality of incrementally truncated hybrid
nucleic acids comprising the steps of: a) providing a first and
second parent nucleic acid; b) serially removing nucleotides from
one or both termini of said first and second parent nucleic acids
to form truncated first and second parent nucleic acids whose
length decreases incrementally over time; c) stopping said serial
nucleotide removal at a plurality of different times to form a
plurality of incrementally truncated first and second parent
nucleic acids; and d) linking separate incrementally truncated
first parent nucleic acids to separate incrementally truncated
second parent nucleic acids to form a plurality of incrementally
truncated hybrid nucleic acids.
6. A method of making a plurality of transformed incrementally
truncated hybrid nucleic acids comprising the step of transforming
said plurality of incrementally truncated hybrid nucleic acids of
claim 5 into a plurality of hosts to form a plurality of
transformed incrementally truncated hybrid nucleic acids.
7. An incrementally truncated hybrid nucleic acid made by the
process of claim 5.
8. A transformed incrementally truncated hybrid nucleic acid made
by the process of claim 6.
9. The method of claim 5 wherein said parent nucleic acids comprise
a library of nucleic acids.
10. A method of making a plurality of first variant incrementally
truncated hybrid nucleic acids comprising the steps of: a)
providing a first and second parent nucleic acid; b) serially
removing nucleotides from one or both termini of said first and
second parent nucleic acids to form truncated first and second
parent nucleic acids whose length decreases incrementally over
time; c) stopping said serial nucleotide removal at a plurality of
different times to form a plurality of incrementally truncated
first and second parent nucleic acids; d) linking separate
incrementally truncated first parent nucleic acids to separate
incrementally truncated second parent nucleic acids to form a
plurality of first variant incrementally truncated hybrid nucleic
acids, wherein said incrementally truncated first parent nucleic
acids form the N-terminal coding sequence of each of said first
variant incrementally truncated hybrid genes.
11. A method of making a plurality of transformed first variant
incrementally truncated hybrid nucleic acids comprising the step of
transforming the first variant incrementally truncated hybrid
nucleic acids of claim 10 into a plurality of hosts to form a
plurality of transformed first variant incrementally truncated
hybrid nucleic acids.
12. A first variant incrementally truncated hybrid nucleic acid
made according to the method of claim 10.
13. A transformed first variant incrementally truncated hybrid
nucleic acid made according to the method of claim 11.
14. The method of claim 10 wherein said parent nucleic acids
comprise a library of nucleic acids.
15. A method of making a plurality of second variant incrementally
truncated hybrid nucleic acids comprising the steps of: a)
providing a first and second parent nucleic acid; b) serially
removing nucleotides from one or both termini of said first and
second parent nucleic acids to form truncated first and second
parent nucleic acids whose length decreases incrementally over
time; c) stopping said serial nucleotide removal at a plurality of
different times to form a plurality of incrementally truncated
first and second parent nucleic acids; d) linking separate
incrementally truncated first parent nucleic acids to separate
incrementally truncated second parent nucleic acids to form a
plurality of second variant incrementally truncated hybrid nucleic
acids, wherein said incrementally truncated second parent nucleic
acids form the N-terminal coding sequence of each of said second
variant incrementally truncated hybrid genes.
16. A method of making a plurality of transformed second variant
incrementally truncated hybrid nucleic acids comprising the step of
transforming the second variant incrementally truncated hybrid
nucleic acids of claim 15 into a plurality of hosts to form a
plurality of transformed second variant incrementally truncated
hybrid nucleic acids.
17. A second variant incrementally truncated hybrid nucleic acid
made according to the method of claim 15.
18. A transformed second variant incrementally truncated hybrid
nucleic acid made according to the method of claim 16.
19. The method of claim 15 wherein said parent nucleic acids
comprise a library of nucleic acids.
20. A method of making a plurality of shuffled incrementally
truncated nucleic acids comprising the steps of: a) providing
isolated nucleic acid inserts from a plurality of incremental
truncation modified nucleic acids; b) recombining said isolated
nucleic acid inserts for a time period and under conditions
suitable to form a plurality of shuffled incrementally truncated
hybrid nucleic acids.
21. A method of making a plurality of transformed shuffled
incrementally truncated nucleic acids comprising the step of
transforming the plurality of shuffled incrementally truncated
nucleic acids of claim 20 into a plurality of hosts to make a
plurality of transformed shuffled incrementally truncated nucleic
acids.
22. A shuffled incrementally truncated nucleic acid made according
to the process of claim 20.
23. A transformed shuffled incrementally truncated nucleic acid
made according to the process of claim 21.
24. A method of making a plurality of analog-containing
incrementally truncated nucleic acids comprising the steps of: a)
providing a plurality of nucleotide analog-containing parent
nucleic acids; and b) removing nucleotides from said plurality of
nucleotide analog-containing parent nucleic acids with a nuclease
enzyme that does not depolymerize nucleotide analogs incorporated
into a nucleic acid under conditions and for a time period
sufficient to form a plurality of analog-containing incrementally
truncated nucleic acids.
25. A method of making a plurality of transformed analog-containing
incrementally truncated nucleic acids comprising the step of
transforming the plurality of analog-containing incrementally
truncated nucleic acids of claim 24 into a plurality of hosts to
form a plurality of transformed analog-containing incrementally
truncated nucleic acids.
26. The method of claim 24 wherein said plurality of nucleotide
analog-containing parent nucleic acids comprises a plurality of
nucleotide analog-containing incremental truncation modified
nucleic acids.
27. The method of claim 26 wherein said plurality of nucleotide
analog-containing incremental truncation modified nucleic acids
comprises a plurality of nucleotide analog-containing shuffled
incrementally truncated hybrid nucleic acids.
28. The method of claim 24 wherein said nuclease enzyme that does
not depolymerize nucleotide analogs incorporated into a nucleic
acid is exonuclease III.
29. A method of creating a plurality of circular permutation
incremental truncation hybrid nucleic acids comprising the steps
of: a) providing first and second nucleic acids; b) inserting a
plurality of circularly permuted nucleic acid fragments containing
a randomly located restriction enzyme site between said first and
second nucleic acids to form a plurality of circular permutation
hybrids; c) reacting said plurality of circular permutation hybrids
with a restriction enzyme that recognizes and specifically
hydrolyzes said randomly located restriction enzyme site to form a
plurality of circular permutation incremental truncation
substrates; d) removing nucleotides from both ends of said
restriction enzyme site to form a plurality of circular permutation
incrementally truncated hybrid nucleic acids; e) stopping said
serial nucleotide removal to form a plurality of circular
permutation incrementally truncated hybrid nucleic acids having a
gap; and f) closing said gap to form a plurality of circular
permutation incremental truncation hybrid nucleic acids.
30. A method of making a plurality of transformed circular
permutation incremental truncation hybrid nucleic acids comprising
the step of transforming said plurality of circular permutation
incremental truncation hybrid nucleic acids of claim 29 into a
plurality of hosts to form a plurality of transformed circular
permutation incremental truncation hybrid nucleic acids.
31. A plurality of truncated nucleic acid expression products.
32. A plurality of incrementally truncated hybrid nucleic
acids.
33. A plurality of first variant incrementally truncated hybrid
nucleic acids.
34. A plurality of second variant incrementally truncated hybrid
nucleic acids.
35. A plurality of shuffled incrementally truncated hybrid nucleic
acids.
36. A plurality of nucleotide analog-containing incrementally
truncated nucleic acids.
37. A plurality of circular permutation incremental truncation
hybrid nucleic acids.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority of Provisional Application
No. 60/135,429 (filed May 21, 1999) and Provisional Application No.
60/172,525 (filed Dec. 17, 1999), and is a continuation-in-part of
U.S. patent application Ser. No. 09/575,345 filed May 19, 2000, all
of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0003] The present invention is generally directed to nucleic acid
and polypeptide mixtures, and more specifically to methods for
incrementally truncating nucleic acids for the creation of hybrid
nucleic acids and hybrid polypeptides, as well as the hybrid
nucleic acids and polypeptides themselves.
BACKGROUND OF THE INVENTION
[0004] Protein mutagenesis has long been used as a tool for
structure/function studies of proteins. With the advent of modern
DNA manipulation techniques and advancements in protein structure
determination, large numbers of protein sequences and structures
are available that can be sorted into groups or superfamilies based
on structural similarity. Such groupings demonstrate that proteins
that are structurally similar often catalyze similar reactions and
have active sites with shared amino acid residues. Further, these
groupings facilitate identification of side chain residues that are
important in binding and catalysis, and allow for their
modification so as to yield proteins with altered properties.
[0005] Such structure-based rational approaches to protein
engineering, through introduction of point mutations, exchange of
secondary structural elements, and exchange of whole domains or
subunits, have given rise to enzymes that have altered substrate
specificities, catalytic properties and oligomeric states. Although
few protein-engineering failures have been published, the
difficulty in rationally engineering an enzyme to have a specific
function is widely appreciated. Any alteration introduced into a
wildtype protein can disrupt the fine balance that nature has
achieved, often in unpredictable ways, and consequently give rise
to proteins that are unstable, fail to fold properly and lack
catalytic activity. As a result of the difficulties encountered
using strict rational design approaches, there is an increasing
trend towards the use of molecular biology strategies that mimic
evolutionary processes. These strategies are known as "directed
evolution."
[0006] Most directed evolution strategies incorporate some method
of introducing random mutations into a gene followed by screening
or selection for a desired property. The cycle is then repeated
several times until the desired property is achieved or until
further cycling produces no improvement in the desired property.
Early methodologies utilized point mutations generated by
error-prone PCR, chemical mutagenesis or mutator strains of E.
coli. This type of approach is something akin to an asexual
evolutionary process with non-beneficial and beneficial mutations
becoming fixed. Such strategies have been particularly successful
in achieving improvements in thermostability, altering substrate
specificity, and improving activity in organic solvents. However,
because directed evolution is a stepwise process, only relatively
small steps in sequence space can occur. Thus, the utility of
current directed evolution methodologies to evolve novel catalytic
sites, which presumably require large excursions in sequence space,
is limited.
[0007] The advent of methods for recombination, which more closely
approximates the natural evolutionary process, has had an enormous
impact on directed evolution. In various methods for recombination,
such as DNA shuffling, parental genes are fragmented and
subsequently reassembled by PCR to reconstitute the full-length
genes. During this reassembly process, novel combinations of the
parental genes arise along with new point mutations. This
recombination or shuffling approach generates a large library of
mutant genes wherein genes that exhibit a desired function can be
obtained by using an appropriate selection or screening system.
[0008] Although it is true that shuffling of families of genes with
DNA homology can create hybrid proteins with new properties, such
molecular breeding is only feasible for genes with sufficient
genetic homology and, for this reason, is unlikely to evolve
entirely novel function. It is important to realize that the
primary rationale for success in the shuffling of families of genes
is the similarity of the three-dimensional structures of the
proteins they encode, not the degree of DNA homology. Successful
directed evolution on homologous families might be equally or
better served by the creation of genes with crossovers between
family members at regions of little or no genetic homology.
However, current DNA shuffling methodologies only produce
crossovers within regions of sufficient homology and within
significant stretches of identity. Furthermore, crossovers are
biased towards those regions of highest identity.
[0009] The increasing numbers of protein structures available and
the study of enzyme structural families have shown that many
proteins with little or no DNA homology can have high protein
structural homology. Constructing hybrids of such structural
homologues may well be an important strategy for engineering novel
activities; however, no combinatorial approach for the construction
of such hybrids has been reported.
[0010] Work by some of the inventors focused on the
inter-conversion of formyltetrahydrofolate-utilizing enzymes.
Active hybrids were created by engineering a functional hybrid
enzyme through fusing domains from two enzymes, expressed on
separate vectors, that overall had very little genetic homology.
Discrete domain fusions were made between the glycinamide
ribonucleotide (GAR) binding domain of the E. coli purN gene (GAR
transformylase) and the formyl-tetrahydrofolate binding and
catalytic domain of the E. coli purU gene (formyltetrahydro-folate
hydrolase). Although a hybrid enzyme was created that had the
desired property (GAR transformylase activity), this activity was
low. Ostermeier, Nixon, Shim, and Benkovic, Proc. Natl. Acad. Sci.,
USA, 96: 3562-3567 (1999), incorporated herein by reference in its
entirety.
[0011] There is therefore a need for a method of making hybrid
genes without regard to sequence homology. There is a demand for
simple, straightforward generation of single-base truncations of
nucleic acids. There is also demand for a controllable method for
creating hybrid genes that span most, if not all possible truncated
portions. There is also a great demand for using such hybrid gene
formation to develop new methods of creating novel hybrid proteins
with modified characteristics or functionalities.
[0012] The present invention provides such methods. The present
invention permits the creation of nucleic acid hybrids without
regard for sequence homology. The present invention also provides a
straightforward, controllable method of creating individual and
pluralities of hybrid truncated nucleic acids, and concomitant
individual and pluralities of hybrid polypeptides, in which the
hybrids cover most, if not substantially all, possible combinations
of bases.
[0013] Still further benefits and advantages will be apparent to
the skilled worker from the disclosures that follow.
BRIEF SUMMARY OF THE INVENTION
[0014] The present invention is directed to a method of making
incremental truncation modified nucleic acids. The incremental
truncation modified nucleic acids can be expressed, or can be
joined to other nucleic acid sequences, such as stop codons,
inteins, recombination-prone sites, dimerization domains, and/or
other incremental truncation modified nucleic acids to yield
nucleic acid sequences that encode novel hybrid polypeptides.
[0015] In one aspect, the present invention is directed to a method
of making a plurality of expression products of an incrementally
truncated nucleic acid comprising the following steps. First, a
parent nucleic acid is provided. Nucleotides are then serially
removed from one or both termini of the parent nucleic acid to form
truncated parent nucleic acids whose length decreases incrementally
over time. The serial nucleotide removal is stopped at a plurality
of different times to form a plurality of incrementally truncated
nucleic acids. The plurality of incrementally truncated nucleic
acids is then expressed in a suitable host to form a plurality of
truncated nucleic acid expression products.
[0016] The present invention is further directed to an individual
incrementally truncated nucleic acid made by the above process. The
present invention is still further directed to an individual
truncated nucleic acid expression product made by the above
process.
[0017] In another aspect, the present invention is directed to a
method of making a plurality of incrementally truncated hybrid
nucleic acids comprising the following steps. First, a first and
second parent nucleic acid is provided. Nucleotides are then
serially removed from one or both termini of the first and second
parent nucleic acids to form truncated first and second parent
nucleic acids whose length decreases incrementally over time. The
serial nucleotide removal is stopped at a plurality of different
times to form a plurality of incrementally truncated first and
second nucleic acids. Then, separate incrementally truncated first
nucleic acids are linked to separate incrementally truncated second
nucleic acids to form a plurality of incrementally truncated hybrid
nucleic acids.
[0018] The order in which the incrementally truncated first nucleic
acids are linked to the incrementally truncated second nucleic
acids can be altered. Thus, for example, the incrementally
truncated first nucleic acid can be linked so that it encodes the
N-terminal portion of the incrementally truncated hybrid nucleic
acid expression product. In this case, the incrementally truncated
second nucleic acid encodes the C-terminal portion of the
expression product. The incrementally truncated hybrid nucleic acid
thus formed is referred to herein as a first variant incrementally
truncated hybrid nucleic acid.
[0019] Alternatively, the incrementally truncated second nucleic
acid can be linked so that it encodes the N-terminal portion of the
incrementally truncated hybrid nucleic acid expression product. In
this alternative, the incrementally truncated first nucleic acid
encodes the C-terminal portion of the expression product. The
incrementally truncated hybrid nucleic acid thus formed is referred
to herein as a second variant incrementally truncated hybrid
nucleic acid.
[0020] The present invention is further directed to a method of
making a plurality of transformed incrementally truncated hybrid
nucleic acids comprising the step of transforming the plurality of
incrementally truncated hybrid nucleic acids into a plurality of
hosts to form a plurality of transformed incrementally truncated
hybrid nucleic acids. The present invention is further directed to
an individual incrementally truncated hybrid nucleic acid made by
the above process. The present invention is still further directed
to an individual transformed incrementally truncated hybrid nucleic
acid made by the above process.
[0021] In yet another aspect, the present invention is directed to
a method of making a plurality of shuffled incrementally truncated
nucleic acids comprising the following steps. First, isolated
nucleic acid inserts of a plurality of incremental truncation
modified nucleic acids are provided. The isolated nucleic acid
inserts are recombined for a time period and under conditions
suitable to form a plurality of shuffled incrementally truncated
nucleic acids.
[0022] In a preferred embodiment, the recombining comprises mixing
the isolated nucleic acid inserts with a nucleic acid fragmenting
enzyme for a time period and under conditions suitable to form a
mixture of nucleic acid fragments of the plurality of incremental
truncation modified genes. The nucleic acid fragments of the
mixture are then joined with a nucleic acid ligating enzyme.
[0023] Preferably, the nucleic acid fragmenting enzyme is an
endonuclease. A preferred endonuclease is DNase. The DNase is
preferably DNase I. Preferably, the nucleic acid ligating enzyme is
a ligase. A preferred ligase is DNA ligase.
[0024] The present invention is further directed to a method of
making a plurality of transformed shuffled incrementally truncated
nucleic acids comprising the step of transforming the plurality of
shuffled incrementally truncated nucleic acids into a plurality of
hosts to make a plurality of transformed shuffled incrementally
truncated nucleic acids. The present invention is still further
directed to an individual shuffled incrementally truncated nucleic
acid made according to the above process. The present invention is
still further directed to an individual transformed shuffled
incrementally truncated nucleic acid made according to the above
process.
[0025] In a still further aspect, the present invention is directed
to a method of making a plurality of analog-containing
incrementally truncated nucleic acids comprising the following
steps. First, a plurality of nucleotide analog-containing parent
nucleic acids is provided. Nucleotides are then removed from the
plurality of nucleotide analog-containing parent nucleic acids with
a nuclease enzyme that does not depolymerize nucleotide analogs
incorporated into a nucleic acid under conditions and for a time
period sufficient to form a plurality of analog-containing
truncated nucleic acids.
[0026] Preferably, the plurality of nucleotide analog-containing
parent nucleic acids is a plurality of nucleotide analog-containing
incremental truncation modified nucleic acids. A preferred
plurality of nucleotide analog-containing incremental truncation
modified nucleic acids is a plurality of nucleotide
analog-containing shuffled incrementally truncated hybrid nucleic
acids.
[0027] Preferably, the nuclease enzyme that does not depolymerize
incorporated nucleotide analogs is an exonuclease. A preferred
exonuclease is exonuclease III. Preferably, the nucleotide analog
is a phosphorothioate-containing nucleotide.
[0028] The present invention is further directed to a method of
making a plurality of transformed nucleotide analog-containing
truncated nucleic acids comprising the step of transforming the
plurality of nucleotide analog-containing truncated nucleic acids
into a plurality of hosts to form a plurality of transformed
nucleotide analog-containing truncated nucleic acids.
[0029] In yet a further aspect, the present invention is directed
to a method of creating a circular permutation incremental
truncation hybrid nucleic acid comprising the following steps.
First and second nucleic acids are provided. A plurality of
circularly permuted nucleic acid fragments containing a randomly
located restriction enzyme site is inserted between the first and
second nucleic acids to form a plurality of circular permutation
hybrids. The plurality of circular permutation hybrids is reacted
with a restriction enzyme that recognizes and specifically
hydrolyzes the randomly located restriction enzyme site for a time
period and under conditions sufficient to form a plurality of
circular permutation incremental truncation substrates. Nucleotides
are then removed from both ends of the restriction enzyme site to
form a plurality of circular permutation incrementally truncated
hybrid nucleic acids. The nucleotide removal is stopped to form a
plurality of circular permutation incrementally truncated hybrid
nucleic acids having a gap. The gap is then closed to form a
plurality of circular permutation incremental truncation hybrid
nucleic acids.
[0030] The present invention is further directed to a method of
making a plurality of transformed circular permutation incremental
truncation hybrid nucleic acids comprising the step of transforming
the plurality of circular permutation incremental truncation hybrid
nucleic acids into a plurality of hosts to form a plurality of
transformed circular permutation incremental truncation hybrid
nucleic acids.
[0031] As used herein, the phrase "incremental truncation modified
nucleic acids" refers to incrementally truncated nucleic acids,
incrementally truncated hybrid nucleic acids, shuffled
incrementally truncated nucleic acids, nucleotide analog-containing
incrementally truncated nucleic acids, and circular permutation
incremental truncation hybrid nucleic acids.
[0032] In a still further aspect, the present invention is directed
to a plurality of expressed truncated parent nucleic acid
products.
[0033] In another aspect, the present invention is directed to a
plurality of incrementally truncated hybrid nucleic acids.
[0034] In a further aspect, the present invention is directed to a
plurality of first variant incrementally truncated hybrid nucleic
acids.
[0035] In a still further aspect, the present invention is directed
to a plurality of second variant incrementally truncated hybrid
nucleic acids.
[0036] In yet another aspect, the present invention is directed to
a plurality of shuffled incrementally truncated nucleic acids.
[0037] In a further aspect, the present invention is directed to a
plurality of analog-containing incrementally truncated nucleic
acids.
[0038] In a still further aspect, the present invention is directed
to a plurality of circularly permuted incrementally truncated
hybrid nucleic acids.
BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In the drawings forming a portion of this disclosure:
[0040] FIG. 1 schematically demonstrates the creation of an
incremental truncation library;
[0041] FIG. 2 is a depiction of exemplary vectors used for
incremental truncation;
[0042] FIG. 3 schematically demonstrates the creation of a seamless
ITCHY library;
[0043] FIG. 4 schematically demonstrates the preparation of a
fusion peptide using a trans-intein;
[0044] FIG. 5 schematically demonstrates the creation of a SCRATCHY
library (created by shuffling two ITCHY libraries);
[0045] FIG. 6 is a depiction of a parental incremental truncation
plasmid and construction of an incremental truncation library using
nucleotide analogs;
[0046] FIGS. 7A-7G show the construction of ITCHY libraries between
two individual genes or gene fragments located on a single plasmid
by simultaneous incremental truncation using nucleotide analogs by
a method called THIO-ITCHY;
[0047] FIG. 8 is an illustration of the CP-ITCHY principle;
[0048] FIG. 9 (as FIGS. 9A and 9B) shows the creation of CP-ITCHY
libraries. FIG. 9A is a description of a vector (pDIM-N5) for
creating CP-ITCHY libraries, as well as includes the following DNA
sequences: SEQ ID NO:6 aaggagacagtccatatg, SEQ ID NO:7
ggatccgatatcagatct and SEQ ID NO:8 actagtgct; FIG. 9B is an example
of a CP insert and construction of a CP-ITCHY library;
[0049] FIG. 10 is a depiction of exemplary vectors used for the
creation of SCRATCHY libraries, as well as includes the following
DNA sequences: SEQ ID NO:9 gagctcatcgactcgagacactatagctaactaagatct,
SEQ ID NO:10 ggaactagtatt and SEQ ID NO:11 atgcat;
[0050] FIG. 11 is a depiction of an exemplary vector used for the
creation of a THIO-ITCHY library, as well as includes the following
DNA sequences: SEQ ID NO:6 aaggagacagtccatatg, SEQ ID NO:12
ggatccgatatctagaagcttactgcagcgctcgagatatcagatct, and SEQ ID NO:13
actagtgctacc.
DETAILED DESCRIPTION OF THE INVENTION
[0051] Through the methods of the present invention, fusions of
substantially all different combinations of lengths of two nucleic
acids such as genes, gene fragments, PCR products, mRNAs, or cDNAs
can be created. It is to be understood, however, that these
biological systems cannot insure that all combinations of the
various lengths of nucleic acids of interest will always be
created. Nevertheless, because of the number of different hybrids
that can be created according to the methods of the present
invention, a great majority of the theoretical fusions can be
created.
[0052] Importantly, one aspect of the invention involves various
methods that circumvent homology limitations of methods of nucleic
acid recombination by rearranging nucleic acids independent of
their sequence homology. These rearranged nucleic acid sequences,
sometimes referred to herein as hybrid nucleic acids, can encode
hybrid polypeptides that have novel functional or catalytic
properties. Of course, the present invention is also useful for
creating hybrid polypeptides from nucleic acids with high degrees
of sequence homology. The present invention, because it is
independent of nucleic acid sequence homology, is applicable to
potentially any desired gene, gene fragment, PCR product, and the
like for the creation of hybrid polypeptides.
[0053] In one aspect, the present invention contemplates a method
of making a plurality of expression products of an incrementally
truncated parent nucleic acid comprising the following steps. A
parent nucleic acid is first provided. Nucleotides are serially
removed from one or both termini of the nucleic acid to form
truncated parent nucleic acids whose length decreases incrementally
over time. The serial nucleotide removal is then stopped at a
plurality of different times to form a plurality of incrementally
truncated nucleic acids. The plurality of incrementally truncated
parent nucleic acids is expressed to form a plurality of expressed
truncated parent nucleic acids.
[0054] As provided in various embodiments of the present invention,
the parent nucleic acid can be selected from the group consisting
of a gene, a portion of a gene, a gene fragment, a PCR product, an
mRNA, a cDNA, and/or a mutant of a gene. It is to be understood
that the nucleic acid can be composed of DNA or RNA. Moreover, the
nucleic acid can be either single stranded or double stranded.
Furthermore, it is not necessary that the nucleic acid be derived
from the coding region of a gene, although in some embodiments of
the invention, the nucleic acid is illustratively the coding region
of a gene.
[0055] Moreover, the parent nucleic acid of various embodiments of
the present invention can be a plurality or library of nucleic
acids, such as a plurality or library of genes, gene portions, gene
fragments, PCR products, mRNAs, cDNAs, or gene mutants.
[0056] In certain embodiments of the invention, it is preferable
that the serial removal of nucleotides from a particular parent
nucleic acid to form a particular modified or truncated nucleic
acid have an interval of truncation lasting for about 1 to about
480 seconds, but preferably lasting less than 240 seconds, even
more preferably less than 120 seconds, yet even more preferably
less than 60 seconds, and most preferably the interval of
truncation lasts 30 seconds.
[0057] It is also preferable, in certain embodiments of the
invention, that the modified nucleic acid be formed by incremental
truncation of the parent nucleic acid under conditions suitable to
ensure reduction of nucleotides at a predetermined rate. It is
preferable that this predetermined rate be less than about 50
nucleotides per minute and even more preferably less than about 10
nucleotides per minute. "Progressive truncation" or "serial
nucleotide removal" of the parent nucleic acid includes the
activity of subsequent removal of nucleotides during the truncation
process.
[0058] It is preferred in the truncation step of certain
embodiments of the invention that the serial reduction of
nucleotides occurs in a progressive and controlled manner, that is,
to ensure that relatively small groups of nucleotides are removed
during the truncation process.
[0059] Incremental truncation can proceed on one or both termini of
a given nucleic acid. Thus, for a given linear nucleic acid, one or
both termini can be suitable substrates for the particular enzyme
used to remove nucleotides from the parent nucleic acid. Thus, for
example, if the particular enzyme is exonuclease III (Exo III),
nucleotides are removed from the 3'-hydroxyl termini of duplex DNA
only if the duplex DNA has blunt ends or a 5'-overhang. Generally,
duplex DNA with a short (1-3 nucleotide) 3'-overhang is a weaker
substrate for this enzyme. Generally, duplex DNA with a 3'-overhang
longer than about 3 nucleotides is a poor or unacceptable substrate
for this enzyme.
[0060] Other enzymes are known that can utilize different nucleic
acid substrates, such as single stranded or double stranded nucleic
acid, RNA or DNA, 5'-overhangs, 3'-overhangs, blunt ends, and
combinations thereof. Exemplary enzymes include exonuclease III,
DNase I, nuclease BAL-31, S1 nuclease, mung bean nuclease, and
ribonuclease H.
[0061] Incremental truncation by the process of controlled
digestion of nucleic acids is utilized for the ultimate creation of
novel fusion polypeptides. For example, during this digestion in
some methods of the invention, small aliquots are frequently
removed and the digestion quenched. Thus by taking a plurality of
samples over a plurality of different times, a plurality of
truncated nucleic acids is formed that preferably contains most, if
not substantially all possible single nucleotide or base pair
deletions of a given piece of nucleic acid. These incremental
truncation modified nucleic acids are then used to code for novel
fusion polypeptides.
[0062] For the average size gene, the separate construction of all
possible one-nucleotide truncations would require the assembly of
hundreds of plasmids, a labor intensive and time consuming task.
The present invention permits the construction of a plurality of
incremental truncation modified nucleic acids containing most, if
not substantially all possible truncations of a gene, gene
fragment, a portion of a gene of interest, a PCR product, an mRNA,
a cDNA, a mutant of said gene of interest, and the like in a single
experiment as depicted in FIG. 1.
[0063] FIG. 1 shows the generalized procedure for incremental
truncation. In one embodiment of the invention, incremental
truncation is performed on exonuclease-susceptible DNA such as
linear DNA containing a gene that has one end (terminus) protected
from digestion and the other end (terminus) susceptible to
digestion. In other embodiments of the invention, incremental
truncation by serial removal of nucleotides from a nucleic acid
proceeds from both ends (termini) of the nucleic acid. As discussed
elsewhere herein, serial removal of nucleotides from the terminus
of a nucleic acid depends primarily upon whether a particular
terminus is an appropriate substrate for the nuclease enzyme that
serially removes the nucleotides.
[0064] Workers in the art will appreciate that many of the
techniques involved in the present invention make use of
recombinant nucleic acid technology, using cloning vehicles and
other tools of genetic engineering in the process of making the
constructs of the present invention. Many of these basic techniques
are described in Maniatis, Fritsch and Sambrook in Molecular
Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold
Spring Harbor, N.Y., 1982, which is hereby incorporated by
reference in its entirety.
[0065] Referring now to FIG. 1, serial removal of nucleotides from
one gene terminus is accomplished, for example, by (as shown in
step 1) digestion of plasmid DNA with two restriction enzymes. A
first restriction enzyme produces a 3' overhang (RE3'; that is
resistant to Exo III digestion) and a second restriction enzyme
produces a 5' overhang (RE5'; that is susceptible to Exo III
digestion, i.e., is an appropriate substrate for Exo III).
[0066] Step 2 illustrates one embodiment in which the digestion
with exonuclease III proceeds under conditions such that the
digestion rate is slow enough that the removal of aliquots at
frequent intervals results in a plurality of incrementally
truncated parent nucleic acids with sequential, one-nucleotide
deletions.
[0067] In step 3, the ends of the DNA are blunted by treatment with
a single stranded nuclease (such as S1 nuclease or mung bean
nuclease) and the Klenow fragment so that unimolecular ligation
results in the desired plurality of incrementally truncated genes.
For some applications, additional DNA manipulations are required
before recircularizing the vector.
[0068] Any enzyme that can digest nucleic acids in a controllable,
directional manner can be utilized in the methodologies described
herein. In the following examples, Exo III has been used and
exhibits the desired properties. Exo III has been previously shown
to be useful in the creation of large truncations of linear DNA and
for techniques in the sequencing of large genes. However, previous
techniques utilized the digestion rate of Exo III at 37.degree. C.
(approximately 500 bases per minute), which is much too fast for
some embodiments of the invention in which incremental truncation
resulting in one-nucleotide base deletions are desired.
[0069] The fact that the digestion rate of a given nuclease enzyme
can be affected by a variety of methods and conditions, such as
lowering the incubation temperature, altering the digestion buffer
composition, inclusion of a nuclease inhibitor or lowering the
ratio of enzyme to nucleic acid, is advantageous to the present
invention. Embodiments of the present invention modulate conditions
affecting the digestion rate of particular nuclease enzymes so that
the degradation is slowed, thus permitting incremental truncation
where potentially every nucleotide base can be deleted. The
modulation of nuclease enzyme activity is well known to workers of
ordinary skill in the art.
[0070] The plurality of incrementally truncated nucleic acids, and
other incremental truncation modified nucleic acids, can be
expressed according to methods well known in the art. For example,
expression of the polypeptides encoded by the truncated nucleic
acids can be accomplished by an in vitro transcription/translation
system. In other embodiments, vectors containing the incrementally
truncated nucleic acids can be transformed into an appropriate host
for in vivo expression.
[0071] The nucleic acids to be expressed can include the necessary
regulatory sequences for either in vitro or in vivo expression. For
example, promoter sequences, start codons, termination codons, and
other similar regulatory sequences can be included in a particular
expression vector, based upon the nature of the particular
truncated nucleic acid made according to the methods of the present
invention.
[0072] Transformation of vectors into appropriate hosts is well
known in the art. Various methods for the introduction of vectors
into host cells are known, including introduction into CaCl.sub.2
competent cells, electroporation, direct injection, and the like.
Any of these methods is suitable for transforming the plurality of
incremental truncation modified nucleic acids into a plurality of
particular hosts.
[0073] It is possible that more than one construct can be
transformed into the same host. This possibility is minimized by,
for example, well known techniques such as limiting dilution, use
of appropriate vectors such as phagemids, or use of appropriate
selection methods.
[0074] Techniques for selecting and/or screening transformants are
well known in the art. It is to be understood that when selection
is referred to herein, the use of screening methods is not ruled
out, and vice versa. Generally, both selection and screening
methods are used to identify a particular construct of the present
invention. However, simply because only the term "selection," or a
variant thereof is referred to, a worker of ordinary skill in the
art will understand that "selection" often requires "screening,"
and that "screening" often requires "selection."
[0075] For example, a particular vector can carry a kanamycin
resistance gene. If such a vector is transformed into a
kanamycin-sensitive host, those host cells carrying the vector can
be selected by plating the transformants onto a
kanamycin-containing growth medium.
[0076] Detecting the expression of a particular incremental
truncation modified nucleic acid requires screening the selected
transformants for a particular activity or functionality. Such
screening depends intimately upon the activity or functionality
sought. Thus, if the incrementally truncated nucleic acid is to
encode some particular enzymatic activity, an appropriate screen
for that enzymatic activity is conducted. Examples of selection and
screening of a plurality of transformed hosts are presented
below.
[0077] A variety of truncated nucleic acids can be used to form a
plurality of polypeptides that originate from a plurality of
differentially modified parent nucleic acids. This plurality of
differentially modified parent nucleic acids or polypeptides is
sometimes referred to as a library, although the term "plurality"
is meant to be broader than, and encompass, the term "library." In
certain exemplary embodiments herein, a plurality of incremental
truncation modified nucleic acids is sometimes referred to as an
incremental truncation library, or ITL.
[0078] In general, the members of a library have certain common
characteristics. Thus, for example, a library of incremental
truncation modified nucleic acids is composed of a plurality of
constructs that share common nucleic acid sequences. The difference
among the members of the library is the length of each
construct.
[0079] A plurality of incremental truncation modified nucleic acids
does not necessarily possess common characteristics, and therefore
is not necessarily a library.
[0080] Similarly, a library of hybrid polypeptides of the present
invention is composed of a plurality of polypeptides that share
common amino acid residue sequences, with the difference among
library members being the length of the polypeptide.
[0081] In some instances, each member of the library of
polypeptides possesses the predetermined characteristic. In this
embodiment the libraries are preferably screened or assayed to look
for desired activity.
[0082] A plurality of polypeptides or hybrid polypeptides of the
present invention does not necessarily possess common
characteristics such as sequence similarity of functional
similarity, and therefore is not necessarily a library.
[0083] Once a particular incremental truncation modified nucleic
acid construct of the present invention is selected and screened,
the construct can be further characterized. For example, the
incremental truncation modified nucleic acid can be isolated from a
host cell and sequenced using techniques well known in the art.
Similarly, the polypeptide expressed by the incremental truncation
modified nucleic acid construct can be isolated and sequenced using
techniques well known in the art.
[0084] In another aspect, the present invention is directed to a
method of making a plurality of incrementally truncated hybrid
nucleic acids comprising the following steps. A first and second
parent nucleic acid is provided. Nucleotides are serially removed
from one or both termini of the first and second parent nucleic
acids to form truncated first and second parent nucleic acids whose
length decreases incrementally over time. The serial nucleotide
removal is stopped at a plurality of different times to form a
plurality of incrementally truncated first and second parent
nucleic acids. Separate incrementally truncated first parent
nucleic acids are linked to separate incrementally truncated second
parent nucleic acids to form a plurality of incrementally truncated
hybrid nucleic acids.
[0085] The first and second parent nucleic acids can be chosen
independent of homology. The term "independent of homology" is
meant to connote that the process of choosing the starting parent
nucleic acids is not dependent on homology between nucleic acids.
That is, the process can succeed whether or not a substantial
degree of homology exists. However, nucleic acids with a high
degree of homology, such as homologous genes, can also be employed
and this is not excluded by the phrase "independent of
homology."
[0086] The step of joining can include the step of fusing and/or
ligating as described herein. The truncation should be done in a
controlled manner that can be time and/or temperature dependent, or
otherwise modulated as discussed elsewhere herein.
[0087] The plurality of incrementally truncated hybrid nucleic
acids includes a plurality of different combined incrementally
truncated first and second nucleic acids that can be used later to
express polypeptides having different characteristics. Therefore,
the plurality of incrementally truncated hybrid nucleic acids can
be transformed into a plurality of appropriate hosts, as described
elsewhere herein, to form a plurality of transformed incrementally
truncated hybrid nucleic acids. This plurality of transformed
incrementally truncated hybrid nucleic acids can include a library
of transformed incrementally truncated hybrid nucleic acids.
[0088] The plurality of incrementally truncated nucleic acids is
used to express polypeptides (sometimes referred to herein as
hybrid polypeptides) that can have a predetermined characteristic
or activity. As is well known in the art, the in vivo expression of
a particular nucleic acid sequence depends upon the use of
appropriate expression vectors transformed into appropriate hosts.
Conditions for appropriate in vitro expression of a given construct
are also well known in the art.
[0089] Therefore, the polypeptides that are produced by the
constructs of the present invention can be selected and/or screened
to determine the presence or absence of a predetermined
characteristic or activity. It is a preferable aspect of the
present embodiment that the selected constructs are screened for
activity as well as for the predetermined characteristic.
[0090] An important aspect of the present invention is that the
hybrid polypeptides that are formed are designed to incorporate
inteins or other cleavage producing portions of a protein or
polypeptide. These cleavage sites permit the protein or polypeptide
to be spliced and recombined to form still further modified hybrid
polypeptides that can have a suitable activity.
[0091] As used herein, a desired characteristic or desired
functionality can include any of the following traits: the absence
of a characteristic, function or property; a known and/or unknown
function; an increase or a decrease in activity; and novel or
unexpected activities.
[0092] One theory on the evolution of enzymes posits that catalytic
function arises from the interaction of protein fragments that
eventually become condensed to a single gene product. The reverse
of this process (also referred to as protein fragment
complementation) is to convert an existing monomeric enzyme into
its functional heterodimer. The use of a plurality of incrementally
truncated nucleic acid hybrids, or incremental truncation libraries
(ITL), in conjunction with a suitable screen or selection, such as
utilizing an auxotrophic host or antibiotic selection, can
determine points in the backbone polypeptide chain that can be
broken. The two resulting protein fragments still retain the
ability to fold and associate into an active heterodimer when a
functional selection mechanism is utilized. Importantly, several
embodiments of the present invention permit this process of reverse
evolution to be performed in vitro in a reasonable amount of
time.
[0093] Various features of exemplary vectors utilized for the
applications of incremental truncation are shown in FIG. 2. As
shown in this figure, plasmids N and C are two compatible vectors
with origins of replication belonging to different compatibility
groups and bearing genes coding for different antibiotic
resistances. For some applications, it is advantageous that the two
vectors are phagemids (e.g., that they also contain a phage origin
of replication) for packaging into phage particles.
[0094] The nucleic acid sequences to be truncated (shown as A and B
in FIG. 2) are positioned downstream from a promoter.
[0095] The identity of some features of the exemplary vectors is
shown in FIG. 1 and depends on the specific application of the
method. The X1 and X2 segments (when used) represent the piece of
DNA that the ITLs of A or B are fused to in the unimolecular
ligation step. The use of `RE` designates a unique restriction
enzyme site. RE5' and RE3' indicate that digestion with the
restriction enzyme produces a 5' or 3' overhang respectively. A 5'
overhang is susceptible to Exo III digestion whereas a 3' overhang
is not susceptible.
[0096] An illustration of an application of the principles
represented in FIG. 2 involves dividing the gene for a protein (P)
into two non-active, overlapping fragments: A (containing the
N-terminus of P) and B (containing the C-terminus of P) which are
cloned into vectors suitable for incremental truncation.
[0097] For this illustration, X1 is a series of stop codons in all
three frames, X2 is the start codon ATG, and T is a stop codon in
frame with B. After linearizing the vector with restriction enzymes
RE3' and RE5' and subsequent incremental truncation, unimolecular
ligation results in the 3' end of the ITL of A being fused to a
series of stop codons in all three frames and the 5' end of the ITL
library of B being fused to a start codon.
[0098] Although two-thirds of the ITL library of A have 1-3 foreign
amino acids on the end and two-thirds of the ITL library of B are
out of frame, one-third of each library is in-frame and not code
for any foreign amino acids. Crossing the ITL libraries of A and B
by, for example, transforming both libraries into appropriate E.
coli cells in which the library constructs are expressed, has each
cell producing a different combination of an N-terminal fragment
and a C-terminal fragment of the original protein, P.
[0099] Active members of this crossed ITL library can be identified
by screening or selection. This methodology has been applied to E.
coli glycinamide ribonucleotide transformylase, as reported in
Ostermeier et al., Proc. Natl. Acad. Sci. USA, 96:3562-3567 (1999),
whose disclosure is incorporated by reference herein in its
entirety.
[0100] Identifying points for functional bisection of an enzyme has
applications in enzyme evolution and protein folding, because such
bisection points potentially identify ancestral fusion points as
well as independent folding units. Such dissection of enzymes into
smaller fragments also subverts impediments in the chemical
synthesis of enzymes: enzymes too large to be chemically
synthesized as a monomer can be synthesized as fragments, thus
permitting the introduction of unique side chain functions.
Moreover, the identification of functional structural motifs,
subdomains, or domains facilitates the construction of hybrid
proteins and the creation of proteins with novel activities (e.g.,
antibiotics with improved effectiveness).
[0101] The construction of crossed ITLs of protein structural
homologues illustrates one combinatorial approach to domain
swapping made feasible by the methods of the present invention.
[0102] Bisection of a protein in the manner described above can
potentially lead to problems with association of the two fragments,
particularly between structural homologues. The two protein
fragments can be unable or have little tendency to associate. The
addition of tight binding dimerization domains by using a
dimerization motif can circumvent this issue.
[0103] This type of facilitated association of protein fragments
permits the creation of structural-homologue heterodimers. Hybrid
proteins can be created such that an ITL of the catalytic machinery
of one enzyme (A) is fused to one dimerization domain (X1) and a
ITL of a substrate binding domain (B) is fused to a second
dimerization domain (X2). Such A-X1 and B-X2 fusion libraries can
then be crossed into appropriate E. coli cells in which the fusion
library constructs are expressed, as described above for example,
and the functional association of the two subunits A and B are
facilitated by the dimerization of X1 and X2. Although not
necessary, X1 and X2 should preferably be different (e.g., they
form a heterodimer) so as to avoid homodimerization of A-X1:X1-A
and B-X2:X2-B in lieu of heterodimerization (A-X1:X2-B).
[0104] Structures such as anti-parallel helixes, parallel
helix-turn-helixes and inactive intein domains can also be
preferable to avoid the necessity of long linkers. This type of
approach permits scanning for novel activities across families of
proteins in one experiment, as A and B need not be a discrete genes
but can be a library of family members, or a plurality of nucleic
acids.
[0105] One advantage to this approach is the ability to access very
large libraries (about 10.sup.11) if vectors N and C are phagemids
and can be packaged into phage particles. Because phage infection
is a very efficient method of introducing vectors into E. coli, the
library size is limited primarily by the number of E. coli cells in
the culture. For example, if each individual A-X1 and B-X2 library
has a library size of 2.times.10.sup.6, then the crossed library of
these two has a maximum library size of 4.times.10.sup.12. If a
liter of 10.sup.11 E. coli cells is infected with phagemid
containing each of the ITL-dimer libraries, and 30 percent of the
cells become infected with both vectors, then the crossed library
size is 3.times.10.sup.10. Although the ability to use selection on
such large libraries can be problematic, such methodology still
makes facile the creation of smaller, manageable libraries.
[0106] In hybrid polypeptides created by domain swapping, it can be
difficult to predict exactly which fusion-points will produce a
polypeptide with desired properties. The use of incremental
truncation in the creation of hybrid polypeptide libraries solves
this problem by a stochastic method.
[0107] A novel feature of this method is that it is not dependent
upon homology on the nucleic acid level or any knowledge of the
structure of either enzyme (or protein). Theoretically, all
possible combinations of two genes or two different nucleic acid
sequences can be created and, with the use of a suitable screen or
selection, active hybrids can be identified. Variations or
embodiments of this methodology, which are sometimes referred to
herein as Incremental Truncation for the Creation of Hybrid
enzYmes, or "ITCHY", are outlined herein.
[0108] Seamed ITCHY libraries are created for example, referring to
FIG. 2 wherein X1 and X2 are identical restriction sites (RE2) and
T is a stop codon in frame with B. The individual ITLs of A and B
are constructed as in protein fragment complementation discussed
above (e.g., linearization of the plasmid DNA with RE3' and RE5'
followed by incremental truncation and recircularization).
[0109] Next, the ITL of B is cloned into plasmid N bearing the ITL
of A between the RE2 and RE1 sites using identical restriction
sites on plasmid C. The resulting ITCHY library is seamed because
it contains the restriction enzyme site RE2 (seam) at the junction
of the two gene fragments and thus code for foreign amino acids.
One third of the library has B in frame with A. If a linker is
desired between the two genes, it can be included in either X1 or
X2 such that it is between RE2 and the truncated gene.
[0110] Seamless ITCHY Libraries are useful for avoiding the seam at
the interface between the two truncated nucleic acids. This method,
however, depends on the cloning of fragments with one blunt end, so
the library size can be less than in a seamed ITCHY.
[0111] For example, the linearized versions of vectors N and C from
FIG. 2 are prepared by digestion with RE3' and RE5' as shown in
step 1 of FIG. 3. Incremental truncation proceeds as in FIG. 1. In
step 2 of FIG. 3, the linear ITLs are digested with RE1 and the
indicated fragments are isolated. In step 3 of FIG. 3, ligation of
the fragments containing the ITL of B into the vector containing
the ITL of A proceeds by a sticky end ligation at the site of the
asterisk and a blunt end ligation between the truncated genes.
[0112] Generally, incremental truncation proceeds as in protein
fragment complementation above, except that before the vector is
recircularized, plasmids N and C are digested with RE1 (FIG. 3).
Vector N (containing the ITL of A) is isolated away from fragment
X1 and the ITL of B is isolated from the rest of the vector C. The
ITL of B is then ligated into vector N (containing the ITL of A) by
a sticky/blunt ligation.
[0113] The blunt end ligation is what produces the seamless fusion
of the two incrementally truncated genes or nucleic acid sequences.
The sticky end ligation (at RE1) provides directionality and
improved cloning efficiency (compared to a blunt end ligation). As
in a seamed ITCHY, one-third of the library has B in frame with
A.
[0114] Unlike a seamed ITCHY, a seamless ITCHY is not easily
amenable to linker incorporation. For example, seamless ITCHY
libraries have been created consisting of up to 7,600,000 fusions
(2,530,000 in-frame fusions) between the incremental truncation
libraries of two genes. This library size is the theoretical
minimum necessary to have all possible fusions between two ITLs
whose members contain between 0 and 2,757 deleted bases.
[0115] In another aspect of this method, the order in which the two
genes or nucleic acid sequences are joined is varied. In a first
variant, the plurality of first incrementally truncated nucleic
acids (also sometimes referred to herein as the ITL of A) forms the
coding region for the N-terminus of the expressed hybrid protein or
polypeptide. In a second variant, the plurality of second
incrementally truncated nucleic acids (also sometimes referred to
herein as the ITL of B) forms the coding region for the N-terminus
of the expressed hybrid protein or polypeptide.
[0116] In this manner, a seamed or seamless plurality of
incrementally truncated hybrid genes can have, as the N-terminal,
either the first or second incrementally truncated nucleic acid.
The interchangeability of the incrementally truncated nucleic acid
portions of the incrementally truncated hybrid nucleic acids
increases the number of potential nucleic acid combinations that
can be created.
[0117] Post-translational protein recombination events can further
increase the number of potential hybrid polypeptides that can be
created according to methods of the present invention. Protein
splicing is a post-translational event involving precise excision
of an intein fragment from precursor protein sequences. Although
most inteins described to date have been cis-inteins (encoded on
one polypeptide), recently engineered and naturally occurring
trans-inteins have been described.
[0118] The ability of trans-inteins to fuse potentially any two
polypeptides is well suited for the creation of hybrid enzyme or
protein libraries. A fusion example is shown in FIG. 4.
[0119] In FIG. 4, fusion proteins of an ITL of A and the N-intein
(I.sub.N) and of an ITL of B and the C-intein (I.sub.C) associate
in solution via the interaction of I.sub.N and I.sub.C. The intein
heterodimer (I.sub.N:I.sub.C) directs the splicing reaction
resulting in the joining of A to B with a native peptide bond and
the release of I.sub.N:I.sub.C.
[0120] Generally, in this embodiment, incremental truncation is
performed as in the protein fragment complementation described
above, resulting in a fusion of an ITL of A to one half of the
trans-intein (I.sub.N) and an ITL of B to the other half of the
trans-intein (I.sub.C). If desired, a linker can be incorporated so
that either A or B or both are fused to a linker after incremental
truncation. Both vectors (containing an ITL fused to an intein or
linker-intein) can then be introduced into the same cell and hybrid
polypeptide created in vivo as a result of the intein's activity.
All the hybrid polypeptide products produced using trans-inteins
will necessarily have one residue from the intein at the fusion
point.
[0121] As in the use of dimerization domains for protein fragment
complementation discussed above, one advantage in the use of
trans-inteins is that very large hybrid enzyme libraries can be
prepared. These libraries are theoretically be much larger than
even those made by genetic fusions above (ITCHY libraries).
[0122] The successful creation of functional hybrids between two or
more genes was historically thought to require a sufficient degree
of homology on the DNA level. Current methods of in vitro and in
vivo recombination of genes (such as DNA shuffling) depend on the
genes having a sufficient degree of homology. However, many
interspecies homologues have sequence homology below that which
traditional in vitro and in vivo recombination methods can be
efficiently performed. That is, on the nucleotide level, there is
about 30-40 percent sequence identity.
[0123] Proteins with little or no sequence identity, however, can
have strong structural homology. The recombination of such genes,
for example within a fold superfamily, can result in hybrid
proteins with interesting and useful properties. Furthermore,
recombination between genes with higher homology at loci of little
or no homology can result in hybrid proteins with interesting and
useful properties.
[0124] Thus, in another aspect of the present invention, a method
of recombining nucleic acids that does not require any sequence
identity is provided. In this aspect, a method of making a
plurality of shuffled incrementally truncated nucleic acids is
provided, comprising the following steps. Isolated nucleic acid
inserts are provided, preferably of approximately the same length,
from a plurality of incremental truncation modified nucleic acids.
These isolated nucleic acid inserts are recombined for a time
period and under conditions suitable to form a plurality of
shuffled incrementally truncated nucleic acids.
[0125] In a preferred embodiment, the recombining involves mixing
the isolated nucleic acid inserts with a nucleic acid fragmenting
enzyme for a time period and under conditions suitable to form a
mixture of nucleic acid fragments of the plurality of incremental
truncation modified genes. The nucleic acid fragments of the
mixture are joined with a nucleic acid ligating enzyme for a time
period and under conditions suitable to form a plurality of
shuffled incrementally truncated nucleic acids.
[0126] This shuffling method uses, as a preferred starting point,
either seamed or (preferably) seamless ITCHY libraries as outlined
above. More preferably, the starting point is a plurality of first
variant incrementally truncated hybrid nucleic acid and a plurality
of second variant incrementally truncated hybrid nucleic acids. In
other preferred embodiments, the starting point is a plurality of
analog-containing incrementally truncated nucleic acid, or a
plurality of circular permutation incremental truncation hybrid
nucleic acids.
[0127] Whereas crossover points between genes in traditional DNA
shuffling are defined and confined by the regions of identity,
shuffled ITCHY library crossover points are defined by the
fusion-points. An ITCHY library theoretically has many, if not
substantially all possible crossover points; thus there is no
theoretical limitation on the location of crossover points in the
resulting hybrid enzyme library. It follows then, that shuffled
ITCHY libraries (which are sometimes referred to herein as SCRATCHY
libraries) of nucleic acids of high identity can create more
diverse libraries than traditional DNA recombination methods.
[0128] With reference to FIG. 5, a SCRATCHY library can be created
by making two ITCHY libraries: one library formed with gene A on
the N-terminus creating A-B fusions, and one library formed with
gene B on the N-terminus creating B-A fusions.
[0129] Next, DNA fragments of each of the A-B and B-A fusions are
isolated. These DNA fragments need not be, but preferably are
approximately the same size as the original genes. This can be done
by gel electrophoresis or capillary electrophoresis after
restriction enzyme digestion (and judicious location of restriction
sites) or after PCR with primers near or just outside the ends of
fused genes. This step attempts to ensure that the pool of DNA to
be shuffled contains fusions at points on the primary and
three-dimensional structures that are near each other (i.e., limit
crossover points to `intelligent` locations).
[0130] Thus, the SCRATCHY methodology is preferably done with genes
A and B being roughly the same size. This DNA with "intelligent"
crossover points can then be amplified by PCR to obtain enough
sample to perform DNA recombination, or shuffling. The two
libraries (that include A-B and B-A PCR products of approximately
the same size as the original genes) are then mixed, can then be
subsequently digested with DNase I, and can be followed by a method
for in vitro or in vivo recombination.
[0131] Such methods for in vitro or in vivo recombination include
the following methods. DNA shuffling is exemplified by Stemmer,
Proc. Natl. Acad. Sci. USA 91:10747-10751 (1994), whose disclosure
is incorporated in its entirety herein by reference.
[0132] Molecular breeding, also known as family DNA shuffling or
sexual PCR, is exemplified by Crameri et al., Nature 391:288-291
(1998), whose disclosure is incorporated in its entirety herein by
reference.
[0133] Staggered extension process (StEP) is exemplified by Zhao et
al., Nature Biotech. 16:258-261 (1998), whose disclosure is
incorporated in its entirety herein by reference.
[0134] Random-priming in vitro recombination is exemplified by Shao
et al., Nucl. Acids Res. 26(2):681-683 (1998), whose disclosure is
incorporated in its entirety herein by reference.
[0135] DNA reassembly by interrupting synthesis is exemplified by
U.S. Pat. No. 5,965,408, issued Oct. 12, 1999 to Short, whose
disclosure is incorporated in its entirety herein by reference.
[0136] Random chimeragenesis on a transient template (RACHITT.TM.)
(Enchira Biotechnology Corp.; The Woodlands, Tex.) is exemplified
by W. M. Coco et al., "A Novel Method of Gene Family Shuffling
Relieves Simultaneous Bottlenecks in a Highly Engineered Pathway,"
presented at the Society of Industrial Microbiology 2000 Annual
Meeting, July 23-27, San Diego, Calif., whose disclosure is
incorporated in its entirety herein by reference.
[0137] PCR-mediated recombination is exemplified by Judo et al.,
Nucl. Acids Res. 26(7):1819-1825 (1998).
[0138] Recombination can also occur by in vivo recombination
methods, which are well known in the art.
[0139] FIG. 5 shows an example of non-homologous shuffling or
recombination of ITCHY libraries, wherein step 1 illustrates that
individual A-B and B-A ITCHY libraries are constructed, for
example, as shown in FIG. 3.
[0140] Step 2 illustrates that either through use of outside
restriction enzymes or outside PCR primers, those members of the
ITCHY libraries that are approximately the same size as the
original genes are isolated by gel or capillary electrophoresis. In
step 3, these selected ITCHY library members are mixed and
fragmented by digestion with DNase I as in traditional methods of
DNA recombination. In step 4, reassembly of the random fragments
can proceed by template switching that can result in full-length
genes with multiple crossovers.
[0141] The number of hybrids appearing "in frame" decreases
exponentially with total number of crossovers. For example, the
original ITCHY libraries only have one-third of the hybrids
in-frame. A resulting member of the SCRATCHY library with two
crossovers only has a 1 in 9 chance of being completely in-frame,
with three crossovers having only 1 in 27 completely in-frame.
[0142] This circumstance can be addressed by pre-selecting the
original ITCHY libraries for hybrids in frame. For example, if gene
B is fused in frame to a reporter gene with a selectable phenotype,
then all in frame ITCHY library members with in-frame crossover
points can be selected. The reporter gene need not be a part of the
final SCRATCHY library because it can be easily removed in the PCR
steps prior to DNase I digestion. In-frame fusions have been
selected for in two different ITCHY libraries by this method using
the neomycin resistance gene as the reporter gene.
[0143] Another embodiment of the invention includes the pairing of
(a) an analog of a ribonucleotide or deoxyribonucleotide (sometimes
referred to herein as a nucleotide analog) that can be randomly
incorporated into double-stranded nucleic acids by a nucleic acid
polymerase and (b) an enzyme with 3' to 5' exonuclease activity
that is not capable of excising the incorporated nucleotide
analog.
[0144] In this aspect, the present invention provides a method of
making a plurality of analog-containing incrementally truncated
hybrid nucleic acids comprising the following steps. A plurality of
nucleotide analog-containing parent nucleic acids is provided.
Nucleotides are removed from the plurality of nucleotide
analog-containing parent nucleic acids with a nuclease enzyme that
does not depolymerize nucleotide analogs incorporated into a
nucleic acid. The nuclease enzyme is used under conditions and for
a time period sufficient to form a plurality of analog-containing
truncated nucleic acids.
[0145] The plurality of nucleotide analog-containing parent nucleic
acids preferably comprises a plurality of nucleotide
analog-containing incremental truncation modified nucleic acids.
More preferably, the plurality of nucleotide analog-containing
parent nucleic acids comprises a plurality of nucleotide
analog-containing shuffled incrementally truncated nucleic
acids.
[0146] As noted, the nucleotide analog is capable of being
incorporated into a nascent nucleic acid strand using a nucleic
acid polymerase such as DNA polymerase or RNA polymerase. For
example, a parent nucleic acid is provided, and nucleotides are
then removed from one or both termini of the parent nucleic acid to
form truncated parent nucleic acids. Complementary nucleic acid
strands are resynthesized on the truncated parent nucleic acids
with a nucleic acid polymerizing enzyme in the presence of
nucleoside triphosphates (NTPs or dNTPs) and nucleotide analogs
under conditions and for a time period sufficient to form a
plurality of nucleotide analog-containing parent nucleic acids.
[0147] In another example of incorporation of nucleotide analogs
into a nucleic acid, a parent nucleic acid can be amplified using
well-known PCR techniques. The PCR amplification is done in the
presence of nucleoside triphosphates (NTPs or dNTPs) and nucleotide
analogs under conditions and for a time period sufficient to form a
plurality of nucleotide analog-containing parent nucleic acids.
[0148] The parent nucleic acid into which nucleotide analogs are
incorporated can comprise an incremental truncation modified
nucleic acid, thereby forming a plurality of nucleotide
analog-containing incremental truncation modified nucleic acid.
[0149] The nucleotide analog is resistant to depolymerization by an
enzyme that depolymerizes nucleic acids, such as an exonuclease.
The nucleotide analog is resistant to depolymerization because it
is not recognized by an exonuclease, or it forms internucleotide
bonds that are substantially resistant to cleavage by an
exonuclease. For example, nucleotide analogues can have
pseudophosphate bonds that are resistant to exonuclease or
endonuclease cleavage, but that still allow their incorporation
into a nascent nucleic acid chain.
[0150] Such nucleotide analogs are well known in the art. Exemplary
pseudophosphate bonds include, but are not limited to,
methylphosphonate, phosphomorpholidate, phosphorothioate,
phosphorodithioate and phosphoroselenoate bonds.
[0151] Additionally, exonuclease- and/or endonuclease-resistant
polynucleotides can be obtained by blocking the 3'- and/or
5'-terminal nucleotides with substituent groups such as acridine,
caps such as 5-methylguanosine or poly(A) tails, as are well known
in the art. See, e.g., Cohen (ed.), Oligodeoxynucleotides, CRC
Press, Boca Raton, Fla. (1989); Gait (ed.), Oligonucleotide
Synthesis: A Practical Approach, IRL Press, Oxford, England
(1984).
[0152] Preferred pseudophosphate bonds are phosphorothioate
bonds.
[0153] A preferred nucleotide analog is a
phosphorothioate-containing nucleotide.
[0154] This embodiment of the invention provides for: (i) the
creation of an incremental truncation library without requiring the
labor intensive, time consuming process of taking timed aliquots
during exonuclease digestion; (ii) the creation of ITCHY libraries
on a single vector avoiding purification of desired fragments;
(iii) the controlled incorporation of point mutations into
incremental truncation or ITCHY libraries during a
polymerase-catalyzed fill-in reaction; (iv) minimizing the biases
in truncation length inherent in the other embodiments previously
discussed; and (v) minimizing the number of steps required and the
time required to construct an incremental truncation or ITCHY
library.
[0155] With reference to FIG. 6, the parental ITCHY plasmid is
linearized by digestion with a pair of restriction endonucleases
(RE's) that cut at unique sites in the plasmid, and thus generate a
recessive 3'-terminus (or flush ended terminus) (Y) at the end to
be truncated, and an hydrolysis-resistant terminus (RE 2)
including, but not limited to a recessive 5'-terminus, at the other
end.
[0156] Primary nuclease treatment can be carried out by an enzyme
with 3' to 5' exonuclease activity, including, but not limited to
Exo III. The same enzyme can then be used to perform the primary
digestion of the linearized plasmid. The reaction conditions (such
as temperature and salt concentration) are used to adjust the
reaction rate. For example, at 22.degree. C. and at a salt
concentration of 100 millimolar NaCl a digestion rate of
approximately 10 nucleobases/minute results for exonuclease
III.
[0157] The linearized plasmid is incubated with the 3' to 5'
exonuclease to generate a single-stranded overhang. Shown as X in
FIG. 6C, the length of the truncated region and the digestion or
cutback rate (as discussed above) determine the incubation time
required. In contrast to other methods to generate incremental
truncation libraries described herein, only a single timepoint need
be taken in order to obtain a full range of truncated products.
[0158] The single-stranded portion of the plasmid, produced by
nuclease treatment, is used as the template for the resynthesis of
the complementary DNA strand. In one embodiment, the reaction
requires an enzyme with 5'-3' polymerization activity, appropriate
metal ions, and nucleoside triphosphates. The nucleoside
triphosphates in the reaction are preferably a mixture of the
natural deoxyribonucleotides (dATP, dCTP, dGTP, dTTP) or
ribonucleotides (ATP, CTP, GTP, UTP) and nucleotide analogs (shown
as S in FIG. 6D), which is referred to as spiking the reaction. The
nucleotide analogs are incorporated at random during the synthesis
of the complementary strand as depicted by three representative
sequences shown in FIG. 6D.
[0159] The polymerization can be catalyzed by a DNA polymerase,
including for example the Klenow fragment of Escherichia coli DNA
polymerase I, Taq DNA polymerase, T4 DNA polymerase, Vent.TM. DNA
polymerase, and Pfu DNA polymerase. Preferably, a polymerase that
lacks 3' to 5' exonuclease activity is used. Utilizing a
thermostable enzyme, such as Taq DNA polymerase, has the advantage
of reducing the formation of secondary structure within the
single-stranded sequence, which could interfere with primer
extension.
[0160] Preferably, appropriate metal ions, including but not
limited to magnesium and manganese, are present in the
complementary strand extension reaction. A single metal ion or a
mixture of two or more metal ions can be added to the reaction
mixture to vary the fidelity of the extension according to methods
known in the art.
[0161] Thereafter, all four natural deoxyribonucleoside
triphosphates (dATP, dGTP, dCTP, and dTTP) or ribonucleoside
triphosphates (ATP, GTP, CTP, UTP), as well as the nucleotide
analogs (including but not limited to .alpha.-phosphorothioate
deoxynucleoside triphosphates) are mixed in a concentration ratio,
determined by the length of the primary nuclease treatment (shown
as X in FIG. 6C) so as to incorporate, on average, a single
nucleotide analog over the entire length of the resynthesized
complementary strand. The ratio for the nucleotide triphosphates to
analogs can be calculated by the following equation:
1 X .delta. [ C ] = [ S ] X = length of primary nuclease digestion
.delta. = correction factor [ C ] = concentration of dNTPs [ S ] =
concentration of .alpha. - S - dNTPs ( 1 ) ##EQU00001##
[0162] The correction factor .delta. is readily determined
experimentally for the individual nucleotide analog that is used in
the spiking reaction. The correction factor reflects the efficiency
by which the nucleotide analog is utilized by the polymerase in
comparison to the natural nucleoside triphosphates.
[0163] To illustrate the above equation, a primary digestion with
Exo III over approximately 300 nucleotides (X=300) would set the
concentrations of the reactant as following: at a concentration of
200 micromolar for each dNTP ([C]) and .delta.=1, the concentration
of each .alpha.-S-dNTPs ([S]) would be 0.67 micromolar.
[0164] The reaction mixture is then incubated at a temperature
appropriate for double-strand synthesis by the enzyme. The
temperature therefore can, but need not necessarily, be set at the
manufacturer-recommended activity optimum, giving access to
additional random mutations under suboptimal reaction
conditions.
[0165] As noted above, PCR amplification can be used to incorporate
nucleotide analogs into nucleic acids to form nucleotide
analog-containing parent nucleic acids. The same considerations as
discussed above in the context of primer extension apply here as
well. However, PCR amplification provides certain advantages. For
example, only nanogram quantities of starting nucleic acids are
required for PCR amplification. In addition, PCR manipulations
require less "hands-on" time.
[0166] In addition, consideration must be given to the length of
the starting nucleic acids and to the potential for introduction of
point mutations throughout the amplified DNA. These point mutations
can be desirable, because they increase the diversity of the
starting parental nucleic acids and concomitantly in the final
truncated products. These point mutations can also disrupt or
modulate other functional elements on the starting nucleic acids.
Therefore, in some cases, subcloning of the truncation library into
a separate expression system is necessary.
[0167] Where further mutational diversity is desired in PCR
amplification, the fidelity of the polymerase during primer
extension (as well as amplification) can be varied by partial
substitution of magnesium with manganese. Reaction buffer
composition and reaction temperature can also be modulated to
increase mutation frequency to desirable levels. See, Cadwell and
Joyce, PCR Methods and Applications, 3:S136-S140 (1994).
[0168] After completion of double-strand synthesis as shown in FIG.
6D (or PCR amplification, as discussed above), the analog-spiked
linearized plasmid is incubated with an enzyme with 3' to 5'
exonuclease activity (that carries out a second nuclease treatment)
that is unable to hydrolyze the nucleic acid beyond the analog,
such as Exo III, for example. Based on the random incorporation of
the analog during the previous resynthesis of the complementary
nucleic acid strand, the hydrolysis is terminated at the position
of the nucleotide analog over the entire length of X, as shown by
the three representative sequences shown in FIG. 6E, for
example.
[0169] The reaction conditions for the second nuclease treatment
are somewhat less critical than those of the first nuclease
treatment. The RE2-site is protected from hydrolysis and the
digestion by the 3' to 5' exonuclease is automatically terminated
upon encountering the nucleotide analog in the nucleic acid
strand.
[0170] With reference to FIG. 6F, after the second nuclease
treatment, the single-stranded portions of the plasmid are degraded
upon addition of a nuclease that specifically hydrolyses
single-stranded nucleic acid, for example S1 nuclease or mung bean
nuclease, thereby providing blunt ends.
[0171] To improve the cyclization efficiency, the plasmid can be
briefly incubated with a nucleic acid polymerase, preferentially
the Klenow fragment of E. coli DNA polymerase I, in the presence of
appropriate metal ions and the natural deoxyribonucleoside or
ribonucleoside triphosphates, as is well known.
[0172] The blunt-ended truncated library can then be recyclized as
shown in FIG. 6G, using chemical or enzymatic methods, including
for example nucleic acid ligases such as T.sub.4 DNA ligase, at the
conditions recommended by the manufacturers.
[0173] The following discussion further demonstrates the
construction of fusion protein libraries between two nucleic acid
sequences (for example, individual genes or gene fragments),
located on a single plasmid, as shown in FIG. 7A, by simultaneous
incremental truncation.
[0174] Under these specific conditions, the linearization can be
achieved with a single restriction endonuclease that produces a
recessive 3'-termini or a flush-ended termini as symbolized by "Y"
in FIG. 7B.
[0175] Upon incubation with a 3' to 5' exonuclease, (for example
Exo III) gene or gene fragment A and B are hydrolyzed
simultaneously over the distance X, generating a stretch of
single-stranded nucleic acid. The length of X can be controlled by
the reaction conditions, including but not limited to such elements
as the enzyme, the composition of the reaction buffer, the reaction
temperature, and the incubation period.
[0176] Resynthesis of the complementary nucleic acid strand by a
nucleic acid polymerase, (for example the Klenow fragment of E.
coli DNA polymerase I, or Taq DNA polymerase) in the presence of
appropriate metal ions and a mixture of natural deoxyribonucleoside
or ribonucleoside triphosphates and nucleotide analogs (symbolized
S) in the appropriate ratio (see the above equation (1) for
guidelines to determine the calculation of the required nucleotide
analog concentration) leads to the random incorporation of
nucleotide analogs in both directions over the entire stretch (X)
of the resynthesized complementary nucleic acid strand, as shown in
FIG. 7D. As mentioned elsewhere herein, a series of variables can
be used to further randomize the nucleic acid at this stage,
including such elements as the type of nucleic acid polymerase, the
reaction buffer composition, the metal ion(s) present in the
reaction mixture, and the reaction conditions in general.
[0177] After completion of double-strand synthesis (FIG. 7D), the
nucleotide analog-spiked linearized plasmid is incubated with an
enzyme with 3' to 5' exonuclease activity that is unable to
depolymerize the nucleic acid beyond the nucleotide analog (e.g.,
Exo III). Based on the random incorporation of the nucleotide
analog during the previous resynthesis of the complementary nucleic
acid strand, the simultaneous hydrolysis in both directions will be
terminated at the random positions of the nucleotide analog, as
depicted by three representative sequences shown in FIG. 7D.
[0178] The reaction conditions for the second nuclease treatment
represented in FIG. 7E, are less critical. The digestion by the 3'
to 5' exonuclease will automatically be terminated upon
encountering the nucleotide analog in the nucleic acid strand.
[0179] Following the second nuclease treatment, all single-stranded
portions of the plasmid are degraded upon addition of a nuclease
that specifically hydrolyses single-stranded nucleic acid, such as
S1 nuclease or mung bean nuclease (FIG. 7F).
[0180] To improve the cyclization efficiency, the plasmid can be
briefly incubated with a nucleic acid polymerase, preferentially
the Klenow-fragment of E. coli DNA polymerase I, in the presence of
appropriate metal ions and the natural deoxyribonucleoside or
ribonucleoside triphosphates.
[0181] The blunt-ended truncated library is recyclized using
chemical or enzymatic methods, including but not limited to nucleic
acid ligases, preferentially T4 DNA ligase, at the conditions
recommended by the manufacturers (FIG. 7G).
[0182] In a further embodiment, as discussed above, the spiking
with nucleotide analogs can be carried out by PCR amplification. A
parental nucleic acid (such as DNA) target is amplified with 5' and
3' outside primers in the presence of NTPs or dNTPs and one or more
nucleotide analogs, using a nucleic acid polymerase (including but
not limited to Taq DNA polymerase) preferentially with no
exonuclease activity. The ratio between natural base and analog is
such that on average only a single analog is incorporated per
region to be truncated. Reaction conditions (for example reaction
buffer composition, reaction temperature, metal ions (for example
magnesium and manganese)) can be varied to affect the fidelity of
the primer extension and lead to customizable levels of random
mutagenesis during amplification according to methods known in the
art.
[0183] A unique restriction site that affords protection to
truncation is located at the end of the PCR product that is not to
be truncated. Following restriction digestion with this restriction
enzyme, the amplification product is incubated with an enzyme with
3' to 5' exonuclease activity that is unable to hydrolyze the
nucleic acid beyond the analog (for example exonuclease III).
Alternatively, it may be desirable for the truncation to be
performed simultaneously from both ends if for example the
restriction enzyme digestion is omitted.
[0184] The single-stranded portion of the amplification product is
degraded with nuclease that specifically hydrolyzes single-stranded
nucleic acid, for example S1 nuclease or mung bean nuclease
generating blunt ends. To further increase the ratio of blunt ends,
the amplification product is briefly incubated with a nucleic acid
polymerase, preferentially the Klenow fragment of E. coli DNA
polymerase I, in the presence of appropriate metal ions and the
natural nucleotides.
[0185] The fragment nucleic acid library can then be cloned into a
suitable vector, which may or may not contain a previously prepared
nucleic acid library, according to methods known to the art.
[0186] In another aspect, the present invention provides a method
of creating a circular permutation incremental truncation hybrid
nucleic acid comprising the following steps. Isolated first and
second nucleic acids are provided. A plurality of circularly
permuted nucleic acid fragments, each of which contains a randomly
located restriction enzyme site, is inserted between the first and
second nucleic acids to form a plurality of circular permutation
hybrids. The plurality of circular permutation hybrids is reacted
with a restriction enzyme that recognizes and specifically
hydrolyzes the randomly located restriction enzyme site for a time
period and under conditions sufficient to form a plurality of
circular permutation incremental truncation substrates. Nucleotides
are then removed from both ends of the restriction enzyme site to
form a plurality of circular permutation incrementally truncated
hybrids. The nucleotide removal is then stopped to form a plurality
of circular permutation incrementally truncated hybrid nucleic
acids having a gap. The gap is then closed to form a plurality of
circular permutation incremental truncation hybrid nucleic
acids.
[0187] This method is sometimes referred to herein as circular
permutated ITCHY (CP-ITCHY). CP-ITCHY is a modification of
previously described methods that offers a number of advantages.
The general principle of this method is represented in FIG. 8. The
two nucleic acids (for example, two genes denominated gene 1 and
gene 2) are preferably of approximately the same length (N).
[0188] In this embodiment, it is desired to make a plurality or
library of possible fusions between N-terminal fragments of gene 1
and C-terminal fragments of gene 2, preferably at or near where the
two genes align. The region chosen to make the fusions is therefore
preferably between position A and position A+x.
[0189] A vector is constructed containing the indicated fragments
of the two nucleic acid sequences (e.g., two genes), from position
1 to position A+x of gene 1 and position A to position N of gene 2.
A piece of DNA (CP-insert, also referred to herein as a circularly
permuted insert or circularly permuted nucleic acid fragment) is
inserted between these two nucleic acid fragments. This inserted
nucleic acid fragment is of length x with a unique restriction site
y bases from the fragment of gene 1.
[0190] If the vector is opened up at this unique restriction site
and the nucleic acid is truncated with Exo III in both directions
for the amount of time necessary to truncate x bases, truncation
will arrive at position (A+x+y)-x=A+y in gene 1 and position
(A-(x-y))+x=A+y in gene 2. If the DNA of length x is a plurality of
nucleic acid fragments containing this restriction site located
randomly between y=0 and y=x, then truncation of this vector for x
bases in each direction will result in a plurality of most, if not
substantially all, possible fusions between gene 1 and 2 between A
and A+x at or near where the two genes align.
[0191] As noted, between the two (preferably overlapping) fragments
of the two nucleic acid sequences to be fused is located a piece of
DNA (CP-insert) of length equal to the overlap in the two
fragments. The CP-insert has a unique restriction site randomly
located within. This restriction site is the start of truncation in
both directions.
[0192] A sample vector for creating CP-ITCHY libraries is shown in
FIG. 9a. The vector has an antibiotic resistance gene (ampicillin;
Ap) as well as the two nucleic acid sequences (in this example, the
gene fragments PurN[1-202] and GART[20-203]) cloned downstream of a
suitable promoter (lac P/O). Between the two gene fragments is
located a unique restriction enzyme site that produces blunt ends
(EcoRV). This is the site of the insertion of a circularly permuted
nucleic acid fragment.
[0193] The methodology for creating the CP-insert and the CP-ITCHY
library is described in FIG. 9b. The CP-ITCHY library is prepared
by amplifying by PCR, or similar technique, a piece of DNA equal in
length to the overlap between the two gene fragments and creating a
unique restriction site at both ends (in this case XbaI) and
cloning this DNA fragment into a suitable vector such as pUC19. The
DNA is multiplied and excised from pUC19 using XbaI and treated
with ligase under dilute conditions such that a significant amount
of closed circular DNA is formed.
[0194] The closed circular DNA is linearized at random sites by
digestion with very dilute amounts of DNase I. The gaps, nicks
and/or termini of the resulting randomly linearized DNA are
repaired using a DNA polymerase and DNA ligase and cloned into the
EcoRV site of pDIM-N5 by blunt end ligation. The result is a
plurality of circular permutation hybrids comprising randomly
located XbaI sites between the two gene fragments. This plurality
of circular permutation hybrids is the source DNA for incremental
truncation.
[0195] The plurality of circular permutation hybrids is digested
with XbaI to linearize the vectors, and digested with Exo III for
the length of time described in FIG. 8. After this digestion, two
ends are left, separated by a gap. The single stranded overhangs
are removed by mung bean nuclease, the ends are blunted with the
Klenow fragment and ligation of the treated ends under diluted
conditions to close the gap between the ends results in the
CP-ITCHY library (or a plurality of circular permutation
incremental truncation hybrid nucleic acids).
[0196] The principle advantages of CP-ITCHY are (a) only one vector
is required, (b) truncation occurs in both directions
simultaneously, (c) does not require extensive time point sampling,
(d) biases the library considerably towards fusions at or near
where the sequences align (i.e., where it is most likely to produce
active fusions), and (e) the method does not require certain
time-consuming manipulations such as extracting DNA from agarose
electrophoretic gels.
[0197] Particular incremental truncation modified nucleic acids, or
incrementally truncated polypeptides or proteins, or hybrid
polypeptides or proteins, made by the methods of the present
invention, are also contemplated herein. Thus, once a particular
incremental truncation modified nucleic acid construct is made
according to a method of the present invention, it is contemplated
that such construct can be transformed into an appropriate host for
further manipulation.
[0198] The transformed constructs themselves therefore constitute
one aspect of the present invention. The transformed constructs can
be selected or screened, as described elsewhere herein, to give
rise to a particular transformed incremental truncation modified
nucleic acid having the desired characteristics. This particular
transformed incremental truncation modified nucleic acid is
contemplated in one aspect of the present invention.
[0199] The constructs themselves, once selected or screened, can be
expressed as truncated polypeptides or hybrid polypeptides.
Expression of truncated polypeptides or hybrid polypeptides in vivo
or in vitro is discussed elsewhere herein. A particular expressed
truncated polypeptide or hybrid polypeptide is also contemplated as
an aspect of the present invention.
[0200] Pluralities and libraries of the various hybrid nucleic
acids and hybrid polypeptides are contemplated as further aspects
of the present invention. Thus, the present invention contemplates
a plurality of expressed truncated parent nucleic acid products. In
another aspect, the present invention contemplates a plurality of
incrementally truncated hybrid nucleic acids. In a still further
aspect, the present invention contemplates a plurality of first
variant incrementally truncated hybrid nucleic acids. In yet
another aspect, the present invention contemplates a plurality of
second variant incrementally truncated hybrid nucleic acids. In a
still further aspect, the present invention contemplates a
plurality of shuffled incrementally truncated hybrid nucleic acids.
In a yet further aspect, the present invention contemplates a
plurality of analog-containing incrementally truncated nucleic
acids. In a still further aspect, the present invention
contemplates a plurality of circularly permuted incrementally
truncated hybrid nucleic acids.
[0201] Various kits that are generally useful for producing or
constructing the various incremental truncation modified nucleic
acids and/or hybrid polypeptides described herein are also
contemplated. Additional kits may be useful for making incremental
truncation libraries and/or for producing a plurality of truncated
recombinant plasmids. Useful components of such kits can include
the following components:
[0202] (a) a purified exonuclease reagent (such as Exo III) that
removes nucleotide bases in a target nucleic acid fragment;
[0203] (b) a recombinant vector molecule such as a plasmid or a
bacteriophage vector (particularly useful ones include pDIMN2,
pDIMC8, pDIMN5, pDIMN6, pDIMC9 some of which are described in
Ostermeier M, Shim J H, and Benkovic S J, Nat. Biotechnol.,
17(12):1205-9 (1999), which is incorporated herein by reference in
its entirety) [additional useful features of the recombinant vector
molecules as described in (b) above, can include restriction sites,
potential sequencing primer binding sites, a multiple cloning site,
an antibiotic resistance marker, and/or a regulatable
promoter];
[0204] (c) a single-strand specific nuclease enzyme such as mung
bean nuclease or S1 nuclease;
[0205] (d) buffer solutions useful in the kits can include
exonuclease digestion buffers, a single-strand specific nuclease
digestion buffer, a single-strand specific nuclease termination
(stop) buffer, an exonuclease termination (stop) buffer, a nucleic
acid polymerase buffer and/or a nucleic acid ligase buffer;
[0206] (e) nucleic acid polymerases useful in the kits can include
a DNA polymerase such as the Klenow fragment or Taq DNA polymerase
or an RNA polymerase;
[0207] (f) further elements of the kits may include a mixture of
NTPs or dNTPs at a specific concentration; nucleotide analogs; a
nucleic acid ligase such as T4 DNA ligase or other suitable ligase;
and a suitable host for selecting a protein of desired
functionality.
[0208] It is to be understood that such a kit is useful for any of
the methods of the present invention. The choice of particular
components is dependent upon the particular method the kit is
designed to carry out.
[0209] In particularly preferred embodiments, the kit can be
packaged in a single enclosure including instructions for
performing the methods of the present invention. In some
embodiments, the reagents are provided in containers and are of a
strength suitable for direct use or use after dilution.
[0210] In one preferred embodiment, a kit includes a purified
exonuclease reagent, a vector, and appropriate buffers. A preferred
buffer is an exonuclease digestion buffer. A further preferred
buffer is an exonuclease termination buffer.
[0211] In a further preferred embodiment, a kit includes a purified
exonuclease reagent, a vector, a single-strand specific nuclease,
and appropriate buffers. Preferred buffers include an exonuclease
digestion buffer and a single-strand specific nuclease digestion
buffer. Further preferred buffers include an exonuclease
termination buffer and a single-strand specific nuclease
termination buffer.
[0212] In a still further preferred embodiment, a kit includes a
purified exonuclease reagent, a polymerase, a nucleotide analog,
and appropriate buffers. A preferred buffer is an exonuclease
digestion buffer. A further preferred buffer is an exonuclease
termination buffer. A still further preferred buffer is a
polymerase buffer. A preferred nucleotide analog is a
phosphorothioate-containing nucleotide analog. The kit further
optionally contains a mixture of NTPs or dNTPs.
EXAMPLES
Example 1
Protein Fragment Complementation by Incremental Truncation
[0213] Two overlapping fragments of the E. coli purN gene (which
encodes glycinamide ribonucleotide formyltransferase) were cloned
into compatible vectors pDIM-N2 and pDIM-C6. The N-terminus
fragment (purN[1-144]) consists of the DNA coding for residues
1-144 and the C-terminus fragment (purN[63-212]) consists of the
DNA coding for residues 63-212.
[0214] Phagemids pDIM-N2 and pDIM-C6 were constructed by a series
of oligo replacements into vectors pMOpelB.H and pMOpelB.L designed
for creating very large Fab antibody libraries. These antibody
vectors were derived from pBP107 (Posner et al., Gene 128:111-117
(1993)) and pTC01 (Collet et al., Proc. Natl. Acad. Sci. USA
89:10026-10030 (1992)), respectively.
[0215] Two micrograms of PstI/XbaI-digested pDIM-N2 or
SacI/XhoI-digested pDIM-C6 were equilibrated at 12.degree. C. in 60
microliters of 66 millimolar Tris, pH 8.0/0.66 millimolar
MgCl.sub.2. At time zero, 200 units of exonuclease III were added.
One-microliter samples were removed every 30 seconds thereafter for
30 minutes and added to a tube incubating at 4.degree. C.
containing 180 microliters of S1 nuclease buffer (41 millimolar
K-acetate, pH 4.6/365 millimolar NaCl/1.4 millimolar ZnSO.sub.4/6.8
percent glycerol), and 25 units of S1 nuclease.
[0216] After all samples were collected, the tube was incubated at
room temperature for 30 minutes. Subsequently, 24 microliters of S1
stop buffer (0.3 molar Tris/50 millimolar EDTA) were added, and the
tube was incubated at 72.degree. C. for 20 minutes to fully
inactivate S1 nuclease as well as Exo III. After an ethanol
precipitation with ammonium acetate, the DNA was resuspended in 88
microliters of water and digested with either NsiI (pDIM-N2) or
NcoI (PDIM-C6). After a second ethanol precipitation, the pDIM-C6
DNA was incubated with 2.5 units of the Klenow fragment (in 2
millimolar Tris, pH 8.0/10 millimolar MgCl.sub.2 containing 0.125
millimolar each dATP, dCTP, dGTP, and dTTP) for 5 minutes at
37.degree. C.
[0217] For pDIM-N2, the DNA was first incubated in the same buffer
with the dNTPs for 3 minutes at 37.degree. C. to use the Klenow
fragment's 3'-to-5' exonuclease activity to blunt the 3' overhang
left by NsiI digestion. Subsequently pDIM-N2 DNA was incubated with
the dNTPs as above.
[0218] After heat inactivation of the Klenow fragment by incubation
at 75.degree. C. for 20 minutes, 400 microliters of ligase mix (50
millimolar Tris.HCl, pH 7.6/10 millimolar MgCl.sub.2/1 millimolar
ATP/5 percent PEG-800/1 millimolar DTT) containing 15 units of DNA
ligase were added for unimolecular blunt end ligation overnight at
room temperature. The DNA was concentrated by ethanol precipitation
into 30 microliters of water and was electroporated into JS5 cells
(Bio-Rad) by six electroporations of 5 microliters of DNA each.
After recovery at 37.degree. C. for one hour in 6 milliliters of
SOB medium (2 percent Bacto-Tryptone/0.5 percent Bacto-Yeast
extract/10 millimolar NaCl/2.5 millimolar KCl/10 millimolar
MgSO.sub.4) containing 2 percent glucose, the cells were plated
onto a 243.times.243 millimeter TY medium plate (0.8 percent
Bacto-Tryptone/0.5 percent Bacto-Yeast extract/0.5 percent NaCl/1.5
percent agar) containing 2 percent glucose and either ampicillin
(100 micrograms/milliliter) or chloramphenicol (50
micrograms/milliliter). After growth overnight (about 16 hours) at
37.degree. C., the library was recovered from the plate into 20
milliliters of 2.times.TY/2 percent glucose/15 percent glycerol,
concentrated by centrifugation, and frozen in small aliquots.
[0219] The N-terminal and C-terminal truncation libraries were
packaged into phage particles with the use of helper phage and
infected into a 10 milliliter culture of exponentially growing E.
coli strain TX680F' (constructed by mating TX680 with XL-1 blue) at
a titer such that approximately 1-5 percent of the cells became
infected with both plasmids. Infection proceeded for 30 minutes at
37.degree. C. without shaking.
[0220] The cells were then centrifuged, washed once with 10
milliliters of selective medium (M9 salts, 0.2 percent glucose,
0.06 percent caseine, 2 micrograms per milliliter of thiamine, 40
micrograms per milliliter of kanamycin), and resuspended in 2
milliliters of selective media. The culture was shaken at
37.degree. C. for 2 hours before plating dilutions on selective
plates with 0.3 millimolar isopropyl B-D-thiogalactoside. Plates
were incubated at 37.degree. C. for up to 48 hours.
[0221] Randomly chosen colonies that appeared within 28 hours were
restreaked on selective plates to affirm complementation and ensure
isolation of a single positive. From these plates, positives were
restreaked onto rich plates (TY) containing ampicillin and
chloramphenicol. Colonies from the rich plates were tested for PurN
recombination by a PCR screen by using primers for the beginning
and end of the purN gene. The plasmid DNA from those positives that
were not recombinants was isolated and transformed at very dilute
concentrations into E. coli strain DH5.alpha. so that the two
plasmids could be isolated and sequenced. The plasmid DNA from
these DH5.alpha. transformants were retransformed back into the
auxotroph (both separately and together) to confirm complementation
resulted from PurN heterodimers. After complementation was
confirmed, sequencing of the truncated genes was performed by the
Nucleic Acid Facility at the Pennsylvania State University.
[0222] Cells from overnight (approximately 16 hours) cultures in LB
media (supplemented with 2 percent glucose, 100 micrograms per
milliliter of ampicillin, 50 micrograms per milliliter of
chloramphenicol, and 12.5 micrograms per milliliter of
tetracycline) were washed once in 5 volumes of minimal growth
medium [M9 salts, 0.2 percent glucose, 2 micrograms per milliliter
of thiamine, all 20 amino acids at recommended levels (Gerhardt, et
al., Methods for General and Molecular Bacteriology, Am. Soc.
Microbiol., Washington, D.C. (1994)), 40 micrograms per milliliter
of kanamycin, 12.5 micrograms per milliliter of tetracycline, and
0.3 millimolar isopropyl .beta.-D-thiogalactoside] and diluted
1,000-fold into 50 milliliters of minimal growth medium in 250
milliliter flasks. Cultures were shaken at 200 revolutions per
minute at 37.degree. C., and growth was monitored by removing 1
milliliter samples at various times and measuring the OD at 600
nanometers. Doubling time was calculated during early exponential
phase (OD.sub.600=0.02-0.10). Because the lag times for auxotrophic
cells expressing either wild-type monomer PurN or the heterodimers
were essentially identical (approximately 2.5 hours), the growth
rates measured cannot have been the result of a recombination
event.
Example 2
Incremental Truncation for the Creation of Hybrid Enzymes
[0223] Phagemids pDIM-N2 and pDIM-C6 are described elsewhere
herein. Phagemid pDIM-C8 is identical to pDIM-C6 except for the
substitution of a BglII site for the BamHI site and the
substitution of a NsiI site for a PstI site 10 base pairs
downstream from the SpeI site.
[0224] Incremental Truncation:
[0225] Incremental truncation was performed essentially as
described above in Example 1, with the following modifications.
Supercoiled pDIM-N2 and pDIM-C8 were linearized by digestion with
XbaI/PstI and SacI/XhoI, respectively. The Exo III digestion was
performed at 22.degree. C. in 60 microliters of 66 millimolar Tris
(pH 8.0), 0.66 millimolar MgCl.sub.2, 100 millimolar NaCl. After
inactivation of Exo III and S1 nuclease, the ethanol-precipitated
DNA was resuspended in 70 microliters of water. After the addition
of 10 microliters of 0.125 micromolar each dNTP, 2.5 units of
Klenow fragment (in 2 millimolar Tris.HCl, 10 millimolar
MgCl.sub.2, pH 8.0) were added, and the mixture was incubated for 5
minutes at 37.degree. C. followed by heat inactivation of Klenow
fragment at 72.degree. C. for 20 minutes.
[0226] The DNA was digested with NsiI (15 units) at 37.degree. C.
for 2 hours, and the desired fragments were isolated by gel
electrophoresis using Elutrap.RTM. (Schleicher & Schuell;
Keene, N. H.), combined, and concentrated by ethanol precipitation.
Ligation was carried out at 15.degree. C. overnight (approximately
16 hours) in a total volume of 20 microliters using 6 Weiss units
of T4 DNA ligase. The ligated DNA was desalted by ethanol
precipitation into 30 microliters of water and was electroporated
into DH5.alpha. cells by six electroporations of 5 microliters DNA
each or into DH5.alpha.-E (Life Technologies; Rockville, Md.) by
two electroporations of 4 microliters each. Libraries were
recovered and stored as described in Example 1.
[0227] Selection of Active Hybrids:
[0228] Plasmid DNA of the ITCHY and DNA shuffling libraries was
transformed into TX680F', recovered, and frozen as described above.
In a 250 microliter shake flask, 50 microliters of
2.times.TY/Amp/Kan/0.2 percent glucose were inoculated with 10
microliters of the frozen library (greater than 10.sup.8 colony
forming units) and grown at 37.degree. C. until OD.sub.600nm=0.2.
Cells from 10 milliliters of culture were pelleted by
centrifugation, washed once with 10 milliliters of selective
medium, and resuspended in 2 milliliters of selective medium. After
2 hours of shaking at 37.degree. C., approximately
2.5.times.10.sup.6 colony forming units (rich medium) were plated
onto selective plates containing 0.3 millimolar
isopropylthiogalactoside. Plates were incubated at 37.degree. C.
for up to 48 hours. Randomly chosen colonies were processed and
sequenced, and complementation was verified as described above.
[0229] Kinetic Characterization:
[0230] Kinetic characterization using GAR and fDDF were performed
as described in Shim & Benkovic, Biochemistry 37:8776-8782
(1998). Wild-type E. coli PurN was prepared as described in Almassy
et al., Proc. Natl. Acad. Sci. USA 89:6114-6118 (1992). The
PurN-GART fusions were prepared by the same method using the vector
isolated from the positive (pDIM-N2) and TX680F' cells. Fusion
concentrations were estimated by densitometry of SDS-PAGE
separation of the most active gel filtration fraction. Purified
GARS-AIRS-GART was a gift from L. T. Gooljarsingh (The Pennsylvania
State University, University Park, Pa.).
Example 3
Creation of a Circular Permuted Incremental Truncation Hybrid
Library
[0231] Materials and Methods
[0232] All enzymes used were from New England Biolabs (Beverley,
Mass.) unless otherwise indicated.
[0233] Plasmid Constructs:
[0234] Phagemid pDIM-N5 was created by replacing the short
BamHI-NsiI fragment of pDIM-N2 with an oligonucleotide as described
in FIG. 9. Phagemid pDIM-N5-PurN[1-202*]/GART[20-203] contains a
fragment of the E. coli purN gene that encodes amino acid residues
1-202 (with the mutation D144A) between the NdeI and BamHI sites of
pDIM-N5 and a fragment of the human GART gene that encodes amino
acid residues 20-203 between the BglII and SpeI sites of pDIM-N5.
The vector has a stop codon between codon 202 of purN and the BamHI
site.
[0235] Creation of the Circularly Permuted Insert:
[0236] A 528 basepair fragment of the E. coli purK gene was
amplified by PCR using oligos Xba-for
TABLE-US-00001 (SEQ ID NO: 1)
(.sup.5'-TTAGGCCGTCTAGAGCGTCAGGCAGGCGAACCG-3') and Xba-528 (SEQ ID
NO:2) (.sup.5'-GCGGAAAATCTAGACTGGTGCGCAAAATACCG-3')
[0237] such that it was flanked by XbaI sites (underlined). This
fragment was digested with XbaI and cloned into the unique XbaI
site of pUC19 to create pUC19-Xba528. Seventy micrograms of
pCU19-Xba528 were digested with 1500 units XbaI and the shorter
fragment isolated by gel electrophoresis using QIAEX.RTM. II
(QIAGEN; Valenicia, Calif.). Six micrograms of this fragment were
treated with 200 Weiss units T4 DNA Ligase in a total volume of 1.7
milliliters of ligase buffer (50 millimolar Tris-HCl (pH 7.5), 10
millimolar MgCl.sub.2, 10 millimolar dithiothreitol, 1 millimolar
ATP, 25 micrograms per milliliter bovine serum albumin) for 18
hours at 16.degree. C. The ligation mixture was diluted with water
up to 4 milliliters and concentrated approximately fifty-fold using
Centricon-30.TM. spin columns (Millipore, Bedford, Mass.). The DNA
was then digested with 600 units Exo III (Promega; Madison, Wis.)
in Exo III buffer (66 millimolar Tris-HCl, pH 8, 0.66 millimolar
MgCl.sub.2) in a volume of 200 microliters for 30 minutes at
37.degree. C. to remove any unligated linear DNA. Exo III was
inactivated by incubation at 72.degree. C. for 20 minutes. The
circular DNA was desalted using QIAEX.RTM. II into a final volume
of 50 microliters EB buffer (10 millimolar Tris-HCl, pH 8.5).
[0238] A series of test digestions was performed to determine the
concentration of DNase I that provided the highest yield of linear
product. The DNase I (RNase-free from Roche Molecular Biochemicals,
Indianapolis, Ind.) was prepared by creating a working stock of 1
unit per microliter in 50 millimolar Tris-HCl, pH7.5 and 50 percent
glycerol that was stored at -20.degree. C. On the day of use, the
working stock was diluted into 50 millimolar Tris-HCl (pH 7.5), 1
millimolar MnCl.sub.2 and 50 micrograms per milliliter bovine serum
albumin. For this study, 30 microliters of circular DNA were
digested with 0.83 milliunits DNase I at 22.degree. C. for 15
minutes in 50 millimolar Tris-HCl (pH 7.5) and 1 millimolar
MnCl.sub.2 in a volume of 400 microliters. The digestion was
stopped by the addition of 20 microliters 50 millimolar EDTA, pH
8.0 and desalted using QIAquick.TM. columns (QIAGEN) into 50
microliters of EB buffer. The linearized DNA was repaired using 3
units T4 DNA polymerase and 6 Weiss units T4 DNA ligase in ligase
buffer that included 125 micromolar each dNTP. The repaired,
linearized DNA (i.e., the circularly permuted insert) was isolated
by agarose gel electrophoresis using QIAEX.RTM. II into 20
microliters of EB buffer.
[0239] The vector was prepared by digesting 10 micrograms of
pDIM-N5-PurN[1-202*]/GART[20-203] with 50 units of EcoRV in 100
microliters for 2.5 hours. Subsequently, 90 microliters of water,
10 microliters CIAP buffer (500 millimolar Tris-HCl (pH 9.3), 10
millimolar MgCl.sub.2, 1 millimolar ZnCl.sub.2, 10 millimolar
spermidine) and 7 units of calf intestinal alkaline phosphatase
(Promega) were added and the solution incubated for an additional 1
hour at 37.degree. C. To inactivate the alkaline phosphatase, 2
microliters of 500 millimolar EDTA, pH 8.0 was added and the DNA
incubated at 72.degree. C. for 15 minutes. The DNA was purified by
agarose gel electrophoresis using QIAEX.RTM. II into a total of 50
microliters of EB buffer.
[0240] One hundred nanograms of EcoRV-treated, dephosphorylated
vector were ligated to 10 microliters of circularly permuted insert
with 30 Weiss units of T4 DNA ligase in a volume of 15 microliters
at 22.degree. C. for about 20 hours. Eight electroporations of 1
microliter ligation mix into 50 microliters of DH5.alpha.-E
electrocompetent cells (rated at approximately 10.sup.10
transformants per microgram of DNA) resulted in a library of
1.1.times.10.sup.6 transformants on a 243.times.243 mm plate. The
library was recovered and stored as previously described.
Ostermeier, M. et al., Proc. Natl. Acad. Sci. USA 96:3562-3567
(1999).
[0241] PCR Characterization of Circularly Permuted Insert:
[0242] Individual colonies resulting from plating a dilution of the
frozen library were analyzed by PCR to determine the location of
the XbaI site in individual members of the library. Because it is
unknown for any given colony which orientation the circularly
permuted insert exists, three oligos were used in the PCR reaction:
Xba-for, Xba-528 and PurN-for
TABLE-US-00002 (SEQ ID NO:3)
(5'-GATATACATATGAATATTGTGGTGCTTATTTCC-3'),
[0243] an oligo that annealed to the beginning of the purN gene.
Depending on which orientation the circularly permuted insert was
ligated, either (PurN-for and Xba-528) or (PurN-for and Xba-for)
would produce an exponential amplification. The size of the PCR
product was determined by agarose gel electrophoresis and the
location of the XbaI site was then determined by subtracting the
size of purN[1-202*].
[0244] Incremental Truncation:
[0245] A plasmid prep (QIAGEN.RTM. Midiprep; QIAGEN) on 40 percent
of the frozen library yielded 54 micrograms of supercoiled plasmid.
The plasmid DNA (20 micrograms) was digested with 40 units of XbaI
for 1.5 hours at 37.degree. C. The linearized vector was isolated
from uncut vector and vector not containing the circularly permuted
insert by agarose gel electrophoresis using QIAEX.RTM. II.
[0246] Exo III digestion was performed on 4 micrograms of
linearized vector at 22.degree. C. in 120 microliters of 66
millimolar Tris (pH 8.0)/0.66 millimolar MgCl.sub.2/50 millimolar
NaCl using 800 units of Exo III. Twenty-four microliter aliquots
were removed at 24, 25, 26, 27 and 28 minutes and added to 72
microliters of 40.5 millimolar potassium acetate (pH 4.6), 338
millimolar NaCl, 1.35 millimolar ZnSO.sub.4, 6.76 percent glycerol
at 4.degree. C. to quench the digestion. After all the samples had
been quenched, 0.5 milliliters of QIAquick.TM. buffer PB (QIAGEN)
were added and the DNA purified using the QIAquick.TM. protocol
with one modification: after the addition of the wash PE buffer the
samples were incubated for 5 minutes at room temperature before
spinning to insure removal of any salt.
[0247] The DNA was eluted from the QIAquick.TM. column using 47
microliters of EB buffer. To this eluate, 5 microliters of
10.times. mung bean buffer (500 millimolar sodium acetate (pH 5.0),
300 millimolar NaCl, 10 millimolar ZnCl.sub.2) and 0.4 units mung
bean nuclease were added and the solution incubated at 30.degree.
C. for 30 minutes. Next, 0.25 milliliters of QIAquick.TM. buffer PB
(QIAGEN) were added and the DNA purified using the QIAquick.TM.
protocol with the modification listed above.
[0248] The DNA was eluted from the QIAquick.TM. column using 47
microliters of buffer EB. To this eluate, 5 microliters of dNTP mix
(0.125 millimolar each dNTP) and 5 microliters of 10.times.EcoPol
buffer (100 millimolar Tris-HCl (pH 7.5), 50 millimolar.
MgCl.sub.2, 75 millimolar dithiothreitol) were added and the
solution equilibrated to 37.degree. C. Next, one unit of Klenow DNA
polymerase was added. Following a five-minute incubation at
37.degree. C., the Klenow-containing composition was heat
inactivated at 75.degree. C. for 20 minutes. To this solution was
added 98.7 microliters of water, 20 microliters of 10.times.
ligation buffer, 20 microliters of 50 percent PEG and 1.33
microliters of T4 DNA ligase (8 Weiss units) and the solution was
incubated at room temperature overnight (about 16 hours).
[0249] The DNA was concentrated by ethanol precipitation (with
ammonium acetate as salt) into 10 microliters of water. A single
electroporation of 3 microliters of DNA into 50 microliters of
TX680F' electrocompetent cells (rated at 1.times.10.sup.8
transformants per microgram pUC19) resulted in a library of
approximately 1.times.10.sup.6 for each time point.
[0250] Selection of Active Fusions:
[0251] Active PurN-GART fusions were identified by complementation
of a GAR transformylase auxotrophic E. coli strain (TX680F') as
previously described above.
[0252] Results
[0253] The mathematical description of the basis of circularly
permuted ITCHY (CP-ITCHY) is shown in FIG. 8. In this method, both
gene fragments to be truncated are located on a single vector (FIG.
9) between which is inserted a piece of DNA that has a randomly
located unique restriction site (XbaI) and is preferably equal in
length to the length of overlap between the two gene fragments.
This library of constructs containing a randomly located
restriction enzyme site is constructed by a method involving the
circular permutation of a piece of DNA (FIG. 9B). In other methods
of the invention, variation in truncation length is created by
truncating for various lengths of time from a fixed point on the
DNA. In this method, variation in truncation length is created by
truncating for one length of time from various points on the
DNA.
[0254] Description of Model System:
[0255] As shown elsewhere, methods of the invention can be used to
identify active fusions between an N-terminal fragment of PurN (E.
coli glycinamide ribonucleotide formyltransferase) and a C-terminal
fragment of GART (human glycinamide ribonucleotide
formyltransferase). Ostermeier, M., et al., Nature Biotech.
17:1205-1209 (1999). Although the study was designed to search for
active hybrids fused anywhere between amino acid residues 54 and
144, all of the active hybrids were only found to be fused between
amino acid residues 100 and 144, almost all of them fused exactly
where the sequences align.
[0256] This model system was used to test a method of making a
plurality of circularly permuted incrementally truncated hybrids
(sometimes referred to herein as CP-ITCHY) and at the same time
expand the range of search to between amino acid residues 20 and
144. An expanded range of incremental truncation was sought to
extend from 270 basepairs to over 500 basepairs. However, fragments
of PurN larger than PurN[1-144] may be active by themselves. In
order to expand the range of truncation, without having fusions
between PurN and GART active solely due to PurN residues, fragments
of PurN were used in which residue 144 had been mutated from
aspartate to alanine, a mutation that inactivates PurN. Shim, J. H.
and Benkovic, S. J. Biochem. 38:10024-10031 (1999). Thus the
fragments used were GART [20-203] and PurN[1-202*], with the star
symbolizing the mutation. This gives a range of overlap between the
two fragments of 182 amino acid residues (546 basepairs), almost
the entire length of the two genes. However, because of the D144A
mutation in PurN[1-202*], active fusions between 145 and 202 were
not expected to be found.
[0257] Library of Circular Permutation Hybrids:
[0258] Fragments purN[1-202*] and GART[20-203] were cloned into
phagemid pDIM-N5 as shown in FIG. 9A. This phagemid was linearized
by digestion between the two gene fragments with EcoRV, treated
with alkaline phosphatase and purified by agarose gel
electrophoresis in preparation for cloning in the circularly
permuted insert.
[0259] A fragment of the purK gene was amplified such that it was
flanked with XbaI sites. The length of the purK fragment was such
that once it was circularly permuted and cloned into pDIM-N5, the
distance between the end of the end of purN[1-202*] and the
beginning of GART[20-203] would be equal to the overlap between the
purN[1-202*] and GART[20-203] in a sequence alignment.
[0260] Although in principal the PCR product can be used directly
in the circular permutation scheme, better results were obtained by
first cloning it into the XbaI site of pUC19, digesting it out with
XbaI and isolating the fragment by agarose gel electrophoresis. The
fragment of purK with XbaI overhangs was cyclized by ligation under
dilute concentrations of DNA, so that the major product was closed,
circular DNA.
[0261] Because a small amount of linear starting material was
sometimes found after cyclization, the ligase-treated DNA was
incubated with Exo III to remove the linear DNA, which would
unproductively bias the incremental truncation library. Next, the
circular DNA was digested with the amount of DNase I that gave the
highest yield of linear DNA (e.g., the amount of DNase I necessary
to produce, on average, one double-stranded break in the circular
DNA). This DNase I-digested DNA was treated with T4 DNA ligase and
T4 DNA polymerase in the presence of dNTPs to repair gaps and nicks
in the linearized product and to produce blunt ends. This
blunt-end, circularly permuted DNA was inserted into pDIM-N5 that
had been treated with EcoRV and alkaline phosphatase by ligation at
22.degree. C.
[0262] Electroporation into DH5.alpha.-E resulted in a library of
1.1.times.10.sup.6 transformants, making it all but certain that
the approximately 500 possible circular permutations were present.
To confirm a random distribution of XbaI sites in the library, PCR
was performed on randomly selected colonies. As expected, the
location of the XbaI site was essentially random.
[0263] General Improvements to Incremental Truncation:
[0264] Two changes to the earlier examples are noted. First, mung
bean nuclease was used instead of S1 nuclease for removing the
single stranded tail after Exo III digestion. It has been found
that S1 nuclease periodically would fail to remove the single
stranded tail from all of the DNA molecules and this primarily
accounted for the bias towards shorter truncations noted
previously. It appears that this occasional failure correlated most
with the DNA to be truncated, and S1 nuclease is suspected to be
sensitive to some impurity in plasmid DNA preps.
[0265] The second improvement was replacing the heat inactivation
and ethanol precipitation with a DNA affinity column (QIAquick.TM.)
to purify the DNA away from Exo III and the single stranded
nuclease. This significantly improved the yield and quality of the
truncated DNA.
[0266] CP-ITCHY Library:
[0267] Plasmid from the circular permutation hybrid library was
digested with XbaI and purified by agarose gel electrophoresis in
preparation for truncation. Using control digestions on this DNA,
it was found that under the conditions used (4 micrograms of DNA in
120 microliters of 66 millimolar Tris (pH 8.0)/0.66 millimolar
MgCl.sub.2/50 millimolar NaCl with 800 units of Exo III at
22.degree. C.) the rate of Exo III digestion was approximately 21
basepairs per minute in each direction. Thus, to digest 546
basepairs in each direction requires a digestion time of 26
minutes.
[0268] The XbaI-digested DNA was digested with Exo III for 24, 25,
26, 27 or 28 minutes before quenching in a high salt, low pH
buffer. These five libraries are subsequently referred to as CP-24,
CP-25, etc. The DNA was desalted and purified away from the Exo III
using a QIAquick.TM. affinity column. After treatment with mung
bean nuclease to remove the single stranded tail, the DNA was
treated with the Klenow fragment to assure blunt ends. Ligation at
22.degree. C. under dilute conditions circularized the truncated
DNA library.
[0269] The DNA was concentrated by ethanol precipitation into 10
microliters and 3 microliters of this was electroporated into 50
microliters of electrocompetent TX680F' cells (determined to
transform with pUC19 at 1.times.10.sup.8 transformants per
microgram). The size of the five libraries (the number of
transformants) ranged from 9.times.10.sup.5 to
1.1.times.10.sup.6.
[0270] The size distribution in the five libraries was determined
by agarose gel electrophoresis of PCR reactions on 55 randomly
selected members of the five libraries using PurN forward and GART
reverse primers. This method creates a library biased towards those
fusions that are about the same size as the original genes, whereas
other methods of the invention provide a more flat
distribution.
[0271] Selection of Active Fusions:
[0272] Active members of the five libraries were identified by
complementation of an E. coli auxotroph grown at 37.degree. C. as
previously described. Ostermeier, M. et al., Nature Biotech.
17:1205-1209 (1999). As expected, the highest frequency of active
fusions was found in CP-26. However, owing to the size of the
standard deviation in truncation length, which increases linearly
with the length of truncation as 22 basepairs per 100 basepairs
truncated (Hoheisel, J. D. Anal. Biochem. 209:238-246 (1993)),
active fusions were found in the other four libraries as well. The
frequency of fusions in CP-26 is approximately four-fold higher
than that which would be expected in a method of making a plurality
of incrementally truncated hybrid genes. The frequency of positives
expected in such a so-called TV-ITCHY library over the same size
range was estimated by taking the frequency in a smaller library
where truncations occurred over 270 basepairs (Ostermeier, M. et
al., Nature Biotech. 17:1205-1209 (1999)) and, knowing that no new
fusions are found outside the range of this library when the
truncation range is 546 basepairs (see below), dividing by the
ratio of the theoretical library sizes for truncations of 546 and
270 basepairs (546.sup.2/270.sup.2).
[0273] Twenty random active fusions were sequenced. Like the 20
randomly selected active members of TV-ITCHY library IT-B (which
identified eleven different DNA sequences and seven different
proteins) (Ostermeier, M. et al., Nature Biotech. 17:1205-1209
(1999)), CP-ITCHY identifies a variety of different fusion points
(ten different DNA sequences and six different proteins) at
homologous and non-homologous locations. Three of the six proteins
identified by CP-ITCHY are newly identified active fusions.
[0274] Temperature Sensitive Fusions:
[0275] CP-ITCHY libraries CP-24 and CP-27 were also tested for
complementation of the auxotroph at 22.degree. C. The frequency of
positives at 22.degree. C. was found to be 8.0- and 5.4-fold
higher, respectively, than the frequency of positives at 37.degree.
C. Of ten randomly chosen positives of CP-24 selected at 22.degree.
C., five were found to be unable to grow at 37.degree. C. The gene
fusions from all ten positives were sequenced. The five temperature
sensitive fusions were fused in a region between amino acid
residues 80 and 90, a region where no active fusions had previously
been identified. The five non-temperature sensitive fusions were
fused in regions previously identified by selection at 37.degree.
C.
Example 4
Creation of a Shuffled Incrementally Truncated Gene Library
[0276] A. Overview:
[0277] The E. coli PurN and FMT proteins are both
formyltransferases that transfer the formyl group from
formyltetrahydrofolate to their substrate. The substrate for PurN
is glycinamide ribonucleotide and the substrate for FMT is
methionyl-tRNA. The N-terminal domain of FMT has been shown to be
structurally homologous to PurN and both PurN and FMT contain
identical key active site residues (N106, H108 and D144 for PurN
and N109, H111 and D147 for FMT). This is suggestive of a common
ancestral protein. However, the DNA sequence homology between the
two is very low (approximately 30-35 percent, depending on how the
alignment is performed), too low to perform in vitro recombination
between the two genes. PurN and FMT were used to create a shuffled
incrementally truncated hybrid gene (sometimes referred to herein
as SCRATCHY) library of PurN-FMT hybrids with more than one
crossover.
[0278] B. Creating the ITCHY Libraries:
[0279] Vectors for creating SCRATCHY libraries are shown in FIG.
10. Two ITCHY libraries were made between fragments of purN and FMT
by the TV-ITCHY method. In the first library (N-F), the starting
N-terminal gene fragment was PurN[1-164] and the starting
C-terminal gene fragment was FMT[89-214]. In the second library
(F-N), the starting N-terminal gene fragment was FMT[1-167] and the
starting C-terminal gene fragment was PurN[86-212]. In both
libraries the PurN fragment contained the following point mutations
in the three key active site residues: N106W, H108R and D144L. For
diagnostic purposes, a silent mutation was made in codon 107 such
that a BamHI restriction site was created within codons 106-108.
The DNA homology in the region of overlap between these fragments
is 34 percent. Both N-F and F-N ITCHY libraries were designed such
that between 0 and 300 bases were deleted from each of the
fragments listed above. Based on the number of transformants,
library N-F had 3.7.times.10.sup.5 members and library F-N had
5.5.times.10.sup.5 members.
[0280] C. Selection for In-Frame Fusions:
[0281] In each of the libraries, the C-terminal gene fragment was
fused in-frame to the neomycin resistance gene. Thus, each ITCHY
library member has a fusion of a fragment of PurN and a fragment of
FMT, to the C-terminus of which is fused the neomycin resistance
gene. Only those fusions of PurN and FMT fragments that are
in-frame will make a tri-fusion protein containing the neomycin
resistance protein. Thus, in-frame fusions of PurN and FMT
fragments can be selected for by plating the library on kanamycin.
This was performed by plating 2.5.times.10.sup.7 colony forming
units of libraries N-F and F-N on 243.times.243 mm TY plate
containing 20 micrograms per milliliter of kanamycin. These
kanamycin-selected libraries are referred to as N-F-k and F-N-k
respectively. The lawn of colonies was recovered from these plates
and sequencing showed that 14 of 15 randomly chosen library members
were fused in-frame. Combining this result with results from two
other PurN-FMT libraries, in which 8 of 8 members were in-frame,
demonstrates that the method enriches the percentage of in-frame
fusions in the library from 33 percent to 96 percent. The value of
such enrichment is clear when one compares a hypothetical SCRATCHY
library member with four ITCHY crossovers from shuffling of the
kanamycin-selected library to that of the unselected library. The
former has an (0.96).sup.4=85 percent, and the latter has a
(0.33).sup.4=1 percent, chance of being entirely in-frame. The
N-F-k and F-N-k libraries exhibit a very diverse set of fusion
points.
[0282] D. Selection for Desired Size Fusions:
[0283] After selection for in-frame fusions, the libraries were
selected for size as follows. Plasmid DNA from N-F-k and F-N-k was
digested with SacI and SpeI. DNA of the desired size (i.e., such
that the fusion of purN and FMT are approximately the same size as
the PurN gene) was isolated by agarose gel electrophoresis of four
micrograms of each digested plasmid. Gel electrophoresis was
performed on a 15.times.25 centimeter gel at low voltage for 8
hours to maximize separation. It was estimated based on the size of
the gel slice that the DNA recovered from the gel contained a
fusion of PurN and FMT of 636 basepairs (N-F-k) or 648 (F-N-k) plus
or minus 10-15 basepairs.
[0284] E. In Vitro Recombination:
[0285] To obtain enough material to perform in vitro recombination
and to reintroduce a stop codon at the C-terminus of the PurN-FMT
and FMT-PurN fusions, PCR was performed on the DNA recovered from
the agarose gel. A 1:1 mix of Taq and Pfu polymerases was used in
this and subsequent PCR reactions to control the number of point
mutations to approximately one per gene. The amplified DNA was
recombined in vitro using an established protocol (Zhao, H. and
Arnold, F. H. Nucleic Acids Res. 25:1307-1308 (1997)) using four
different DNaseI dilutions and with an annealing temperature of
50.degree. C. during the reassembly step. For the amplification
with outside primers, the DNA was fixed at the 5' and 3' ends of
the shuffled gene as from purN. Thus, the libraries predominantly
consist of genes with 0, 2, 4, 6, etc., crossovers. The shuffled
gene was cloned between the NdeI and SpeI sites of vector pDIM-N5
to create four libraries, one for each of the four DNaseI
digestions. These library sizes varied from 2.0.times.10.sup.6 to
2.8.times.10.sup.6.
[0286] Twenty random members from one of the libraries were
sequenced. Fifteen had no crossovers (reassembled PurN with the
active site mutations) and one had a single crossover (i.e. it was
an FMT-PurN fusion). Four of the 20 members had two crossovers
indicating that this library had approximately 400,000 members in
which a piece of FMT had been inserted within PurN. The size of the
FMT piece in these four ranged from 36 to 160 basepairs. Each of
the eight crossovers were unique and were in regions of low
homology, making it most probable that they resulted from being
present in the original ITCHY libraries and not from recombination.
The crossovers showed a range of size selection that was between 8
basepairs larger and 9 basepairs smaller than the desired size. The
number of point mutations per gene ranged between zero and two and
averaged 0.8 per gene.
Example 5
Creation of an Analog-Containing Incrementally Truncated Hybrid
Gene Library
Materials and Methods
[0287] All enzymes used were purchased from New England Biolabs
(Beverly, Mass.) unless otherwise indicated. The
.alpha.-phosphorothioate nucleotides (racemic mixtures, as well as
S-stereoisomers) used in the studies had previously been
synthesized (Chen and Benkovic, Nucl. Acids Res. 11:3737-3751
(1983)). Racemic mixtures of .alpha.-S dNTPs are also commercially
available from Promega (Madison, Wis.) and Amersham/Pharmacia
(Piscataway, N.J.). DNA samples were purified by using the
QIAquick.RTM. Gel and PCR purification kit (QIAGEN; Valencia,
Calif.). Where indicated, reactions were quenched by addition of PB
buffer, supplied with the QIAquick.RTM. PCR purification kit. The
DNA was eluted from the spin columns, using 50 microliters of the
provided EB-buffer (10 millimolar Tris (pH 8.5)).
[0288] Plasmid Construction:
[0289] Plasmid pDIM-PGX (FIG. 11) was constructed from
pDIM-N2(PurN[1-144]). Initially, the f1 region in
pDIM-N2(PurN[1-144]) was removed by restriction digest with KpnI
and NaeI. The overhangs were filled in by Klenow treatment and the
plasmid was cyclized, generating pDIM-N2 (.DELTA.f1,PurN[1-144]).
Next, the human GAR transformylase fragment [54-203] was prepared
by PCR, carrying a 28-nucleotide linker region as a 5'-overhang,
flanked by BamHI and BglII sites (FIG. 11). Upon digestion with
BamHI/SpeI, the hGART fragment was ligated into pDIM-N2
(.DELTA.f1,PurN[1-144]) and transformed into E. coli DH5.alpha.-E
(Gibco-Life Technologies; Rockville, Md.). The resulting plasmid
pDIM-PGX was isolated by large-scale plasmid prep (QIAGEN;
Valencia, Calif.) and characterized by restriction analysis and DNA
sequencing. Twenty micrograms of PDIM-PGX in 200 microliters of
NEB-buffer #2 were linearized by restriction digest with HindIII
(60 units) and purified by agarose gel electrophoresis.
[0290] DNA Spiking by Exonuclease/Klenow Treatment:
[0291] Three micrograms of linearized DNA were mixed with 6
microliters of exo III buffer (10.times.; Promega) and the volume
adjusted to 60 microliters with water. The solution was
pre-incubated for 15 minutes at 22.degree. C., followed by addition
of exonuclease III (260 units; Promega) and incubation at room
temperature for 6 minutes. The average cutback rate under the
described conditions was 50 bases/minute. The reaction was quenched
with EDTA (1 microliter of 0.5 molar stock, pH 8) and the DNA
QIAquick.RTM.-purified.
[0292] Resynthesis of the complementary DNA strands of the
exonuclease-treated plasmid (50 microliters) was performed by
incubation with Klenow fragment (exo.sup.-) (3.75 units) in
Tris-HCl (10 millimolar, pH7.5), MgCl.sub.2 (5 millimolar),
containing dNTPs (199 micromolar each) and .alpha.S-dNTPs (5
micromolar each; either S-isomer or racemic mixture) in a final
volume of 150 microliters for 10 minutes at 37.degree. C. The
reaction mixture was quenched by addition of PB-buffer and the DNA
QIAquick.RTM.-purified.
[0293] DNA Spiking by PCR:
[0294] .alpha.-Phosphorothioate nucleotides were incorporated
directly during PCR amplification of the linearized pDIM-PGX. Ten
nanograms of linearized plasmid were amplified with primers A:
TABLE-US-00003 (SEQ ID NO:4)
(.sup.5'-TCCGGAGCTTCTAGATATCGGATCCTTAGTCC-.sup.3') and B: (SEQ ID
NO:5) (.sup.5'-AGGCCTCTGCAGCGCTCGAGATATCAG-.sup.3')
(1 micromolar each) in 50 microliters of reaction mixture (Taq DNA
polymerase buffer (Promega), supplemented with MgCl.sub.2 (1
millimolar), dNTPs (180 micromolar each), .alpha.S-dNTPs (20
micromolar each), and 2.5 units Taq DNA polymerase (Promega)). PCR
program: 5 minutes, 94.degree. C.; followed by 30 cycles of 30
seconds, 94.degree. C.; 30 seconds, 56.degree. C.; 4 minutes and 30
seconds, 72.degree. C.; followed by 10 minutes, 72.degree. C. After
purification with the QIAquick.RTM. kit, the amount of DNA was
quantified by OD.sub.260 for adjustment of the amount of
exonuclease in the following step.
[0295] Creation of an Incremental Truncation Library:
[0296] The solution of spike DNA (50 microliters) from either
protocol (PCR amplification or Exonuclease/Klenow treatment) was
mixed with exonuclease III (120 units per microgram of 5'-end DNA;
Promega) in the manufacturer's buffer (5.5 microliters, 10.times.;
Promega) and incubated for 30 minutes at 37.degree. C. After
quenching the reaction with PB-buffer and
QIAquick.RTM.-purification of the DNA, the single-stranded
5'-overhang was removed upon incubation with mung bean nuclease
(2.3 units per microgram of DNA) in the manufacturer's buffer (30
minutes at 30.degree. C.). The DNA was again
QIAquick.RTM.-purified.
[0297] To improve the ligation efficiency, the plasmid library was
blunt-ended with Klenow-fragment (4.5 units) in 6 microliters of
Klenow buffer (Tris-HCl (100 millimolar, pH7.5), MgCl.sub.2 (50
millimolar)) and dNTPs (final concentration of 140 micromolar per
nucleotide) for 10 minutes at 37.degree. C. The DNA was
QIAquick.RTM.-purified.
[0298] In the final step, the plasmid library was cyclized by
intramolecular ligation using T4 DNA ligase (24 units; Promega) in
the manufacturer's buffer and 36 microliters of PEG (50 percent)
(final volume: 400 microliters) overnight (approximately 16 hours)
at 4.degree. C. Prior to transformation into E. coli DH5.alpha.-E
(Life Technologies, Rockville Md.; approximately 10.sup.10
transformants per microgram of DNA), the DNA was concentrated and
desalted by using QIAquick.RTM. spin columns.
[0299] Selection of the THIO-ITCHY Libraries:
[0300] The incremental truncation library in DH5.alpha.-E was
recovered and stored as described elsewhere herein. Following
transformation into the auxotrophic E. coli strain TX680F',
selection of active hybrids was carried out as described elsewhere
herein.
Results
[0301] The creation of a nucleotide analog-containing incrementally
truncated hybrid gene library was shown using the N-terminal gene
fragment of E. coli glycinamide ribonucleotide transformylase (PurN
[1-144]) and the C-terminal portion of the human glycinamide
ribonucleotide transformylase (hGART [54-203]). Both enzymes
catalyze the transfer of a formyl-group in the de-novo purine
biosynthesis pathway. Despite their high overall structure
homology, the two sequences share only 50 percent identity on the
DNA level.
Creation of a THIO-ITCHY Library:
[0302] The use of .alpha.-thiophosphate nucleotides introduces
several changes in the design of the vector containing the parental
gene fragments. For example, the two genes are cloned in series
within the same vector, rather than on two separate plasmids as in
other embodiments of the invention (FIG. 11). This change permits
the simultaneous truncation of both gene fragments, because
fragment size-distribution of the truncation library is no longer
dependent on the length or time interval of exonuclease digestion.
Furthermore, the requirement for multiple, strategically placed
restriction sites has been eliminated. Only a single unique
cleavage site between the two gene fragments, such as the cloning
site(s) of the target DNA, is required. Consequently the
single-vector design simplifies the library construction in the
final step of the protocol, allowing a single intramolecular
ligation to recircularize the incremental truncation library.
[0303] As described, the THIO-ITCHY protocol consists of the
following basic steps. The method starts with the linearization of
the parental vector, using the unique restriction between the
parental gene fragments. Gel-purification of the digestion product
was found preferable to remove trace amounts of incompletely
digested vector which otherwise gets carried through the remaining
protocol and upon transformation leads to a bias in the
library.
[0304] The next step involves the random incorporation of
nucleotide analogs such as phosphorothioate-containing analogs into
a target nucleic acid sequence. Nucleotide analogs can be
incorporated into a target sequence using, for example, primer
extension (sometimes referred to herein as Exonuclease/Klenow
treatment) or PCR amplification.
Incorporation of Nucleotide Analogs
[0305] by Primer Extension
[0306] Using exonuclease III, the two ends of the linearized
plasmid, encoding the overlapping region between amino acid
position 54 and 144 (270 basepairs) of PurN and hGART, were
converted into single-stranded DNA. Exonuclease III, under
carefully chosen reaction conditions, allows the controlled 3' to
5' hydrolysis of double stranded-DNA. At 22.degree. C. in low salt
buffer, the enzyme hydrolyzes approximately 50 basepairs per
minute. The hydrolysis was quenched efficiently upon addition of
EDTA. The application of QIAquick.RTM. spin columns to purify the
DNA intermediate from protein and EDTA proved simple and very
efficient.
[0307] The single-stranded DNA portion then served as template for
the polymerase-catalyzed resynthesis of the complementary DNA
strand. Using a mixture of the four standard dNTPs, spiked with
small amounts of dNTP analogs such as .alpha.S-dNTPs, leads to the
random incorporation of the nucleotide analogs over the entire
stretch of the resynthesized DNA. Several DNA polymerases including
Klenow fragment, T4 DNA polymerase, Taq DNA polymerase, Vent.TM.
DNA polymerase, and Pfu DNA polymerase, have been shown to
successfully utilize thiophosphate analogs during template-directed
DNA synthesis (Nakamaye et al., Nucl. Acids Res. 16:9947-9959
(1988); Burgers and Epstein, J. Biol. Chem. 254:6889-6893 (1979)).
However, none of the 3'-5' exonuclease activities of Klenow, T4,
Vent.TM., and Pfu DNA polymerase is capable of hydrolyzing the
thiophosphate linkage. Idling, taking place during the primer
extension reaction as a result of the polymerase's exonuclease
activity, would lead to accumulation of thiophosphates at the
3'-ends of the resynthesized strands, biasing the resulting library
towards full-length fragment sizes. Exonuclease-deficient variants
of these polymerases are therefore preferentially employed during
the synthesis of the complementary strand.
[0308] Another important consideration during the fill-in reaction
is the ratio between dNTPs and dNTP analogs, ultimately responsible
for the diversity of the incremental truncation library. In theory,
incorporation of a single dNMP analog over the length of the
single-stranded DNA segment is desirable. In mathematical terms,
the .alpha.S-dNTP to dNTP concentration ratio is inversely
proportional to the length of the single-stranded DNA segment X
scaled by a correction factor .delta. (see equation elsewhere
herein). The correction factor represents the relative
incorporation rates of dNTPs and .alpha.S-dNTPs. To a first
approximation, the comparable incorporation efficiency of
phosphorothioates versus natural nucleotides by E. coli DNA
polymerase I and Taq DNA polymerase indicates no apparent
discrimination (.delta.=1).
[0309] However, earlier studies showed that only the S-isomeric
form of .alpha.S-dNTPs is utilized by DNA polymerases while the
R-isomer acts as a mediocre, competitive inhibitor of the enzyme.
Burgers and Epstein, J. Biol. Chem. 254:6889-6893 (1979). The lower
overall efficiency of incorporation of phosphorothioate nucleotides
by DNA polymerases in comparison to natural dNTPs must therefore be
considered. This, as well as other unspecific effects have lead to
an experimentally determined correction factor (.delta.=7.5) for
Klenow fragment (exo.sup.-).
[0310] Incorporation of Nucleotide Analogs by PCR Amplification
[0311] Alternatively, introduction of nucleotide analogs by PCR
amplification of the entire vector sequence has also been shown.
While following the same guidelines for dNTP/.alpha.S-dNTP ratios
and polymerases as described elsewhere herein for primer extension,
PCR amplification requires only nanogram quantities of the initial
construct and requires less hands-on time.
[0312] The size of the plasmid and the error frequency of the
utilized DNA polymerase are also factors to be considered. Although
random mutagenesis in the target DNA may be desirable, the approach
inevitably introduces point mutations over the entire length of the
plasmid that could disrupt or otherwise modulate other essential
functions of the plasmid. Consequently, subcloning of the
truncation library into a separate expression system can be
performed, especially for larger constructs or under deliberately
chosen highly mutagenic conditions.
[0313] Tag DNA polymerase, which has the lowest known error
frequency of commercially available exonuclease-deficient DNA
polymerases, was utilized to amplify and spike the linearized
pDIM-PGX. The observed error frequency was 5.times.10.sup.-4, based
on sequencing data from functional hybrids.
[0314] Creating the Truncation Libraries from Nucleotide-Analog
Spiked DNA
[0315] The DNA into which nucleotide analogs are incorporated is
then incubated a second time with exonuclease III under conditions
of maximum activity (approximately 450 basepairs per minute). Upon
incubation with nucleases such as exonuclease III, only the
randomly incorporated thiophosphate internucleotide linkages halt
the degradation and protect the remaining plasmid from further
hydrolysis. In control experiments, plasmid DNA containing only
standard nucleotides was removed with great than 99 percent
efficiency, based on the number of colonies formed upon ligation
and transformation of these samples.
[0316] The single-stranded 5'-overhang that remains after
exonuclease treatment was removed upon incubation with mung bean
nuclease. The use of mung bean nuclease has proven very efficient
and reliable, in contrast to initial studies with S1 nuclease
(which gave inconsistent data). Although direct ligation of the
mung bean-treated DNA was successfully performed, the additional
blunt-ending step by Klenow treatment increased the number of
transformants seven-fold.
[0317] Following the described protocol, a THIO-ITCHY library of
PurN/hGART hybrid enzymes was generated, consisting of
approximately 2-8.times.10.sup.5 independent members. PCR analysis
of the gene fusion product from randomly chosen library members
indicated a linear size distribution over the expected range of
truncation. In addition, the distribution of crossovers between the
parental gene fragments, as well as the fragments size variation in
the naive library, were investigated by DNA sequencing of several
plasmids from randomly chosen colonies. Their PurN/hGART fragment
sizes and crossover points were established and plotted. Seven of
the characterized sequences were found to be located in the desired
sequence space between amino acid residue 54 and 144 while two
library members were within the range of the standard deviation of
the initial exonuclease digestion. Two samples were found outside
the expected sequence space. The random distribution over the
sampled sequence space indicates no apparent bias towards
particular regions within the gene fragments, and most important,
towards constructs composed of equal sized fragments. Such would be
indicative for carried-over plasmid from the initial exonuclease
treatment as a result of the synchronized hydrolysis of both
5'-ends by exonuclease. The data show that the random incorporation
of nucleotide analogs, followed by the exonuclease step, results in
a random fragment size recombination between the two genes.
Selection of Functional Hybrid Enzymes
[0318] For the selection of catalytically active hybrid enzymes,
the plasmid library was recovered and transformed into the
auxotroph E. coli strain TX680F'. Upon plating the transformants on
minimum plates, only those bacteria grow whose expressed hybrid
enzymes are capable of complementing the disrupted host-GAR
transformylase. Selection was performed by incubating the plates at
37.degree. C., as well as under less stringent selection conditions
at room temperature. The lower incubation temperature yielded
approximately four times the number of colonies found at 37.degree.
C. Although the majority of the constructs from the room
temperature plate also grow at 37.degree. C., additional
temperature-sensitive hybrid enzymes were found. As described
elsewhere herein, the fusion points of the temperature-sensitive
hybrids were exclusively located in the region between amino acid
80 and 100. Furthermore, sequence analysis of the naive libraries
identified an in-frame fusion construct (PurN 1-72/GART 73-203) in
the lower overlapping region (amino acid residues 55-80).
Considering the absence of functional hybrid enzymes in that
region, the result could indicate a structural inflexibility of
that particular region.
[0319] Thirty-one colonies, expressing functional hybrid enzymes,
were picked and analyzed by PCR and DNA sequencing. All constructs
except one were exactly aligned fusions. Crossovers between the
parental gene fragments occurred within regions of different levels
of homology. Sequence analysis identified fourteen distinct DNA
fusion constructs, four of which were previously unknown. No
mutations were identified in the gene fusions created using primer
extension for nucleotide analog incorporation. In contrast, DNA
sequence analysis of ten functional hybrids created using
nucleotide analog incorporation by PCR amplification showed four
point mutations in three of the sequences. Two of the mutations
were silent (E44, R168) and the other two occurred in the same
construct (PurN 1-110/GAR 111-203; A145T/K157R).
[0320] In the 31 sequences analyzed, the entire range of functional
crossovers from amino acid residue position 80 to 144 is
represented and evenly distributed in the library. The frequency of
functional hybrids per library size is similar to other embodiments
of the present invention.
[0321] While the foregoing has been set forth in considerable
detail, the examples are presented for elucidation and not for
limitation. Modifications and improvements, including equivalents,
of the technology disclosed above which are within the purview and
abilities of those in the art are included within the scope of the
claims appended hereto. It will be readily apparent to those
skilled in the art that numerous modifications, alterations and
changes can be made with respect to the specifics of the above
description without departing from the inventive concept described
herein. Accordingly, all such variances should be viewed as being
within the scope of the present invention as set forth in the
claims below.
Sequence CWU 1
1
13133DNAEscherichia coli 1ttaggccgtc tagagcgtca ggcaggcgaa ccg
33232DNAEscherichia coli 2gcggaaaatc tagactggtg cgcaaaatac cg
32333DNAArtificial SequenceDescription of Artificial Sequence Probe
for determining the location of the XBaI site. 3gatatacata
tgaatattgt ggtgcttatt tcc 33432DNAArtificial SequenceDescription of
Artificial Sequence Primers for amplification of the linearized
pDIM-PGX. 4tccggagctt ctagatatcg gatccttagt cc 32527DNAArtificial
SequenceDescription of Artificial Sequence Primers for
amplification of the linearized pDIM-PGX. 5aggcctctgc agcgctcgag
atatcag 27618DNAArtificial SequenceDescription of Artificial
Sequence Restriction endonuclease Ndel. 6aaggagacag tccatatg
18718DNAArtificial SequenceDescription of Artificial
SequenceRestriction endonuclease BamHl, EcoRV and Bg/ll.
7ggatccgata tcagatct 1889DNAArtificial SequenceDescription of
Artificial Sequence Restriction endonuclease Spel. 8actagtgct
9939DNAArtificial SequenceDescription of Artificial Sequence
Restriction endonuclease Sacl, Xhol and Bg/ll. 9gagctcatcg
actcgagaca ctatagctaa ctaagatct 391012DNAArtificial
SequenceDescription of Artificial Sequence Restriction endonuclease
Spel. 10ggaactagta tt 12116DNAArtificial SequenceDescription of
Artificial Sequence Restriction endonuclease Nsil. 11atgcat
61247DNAArtificial SequenceDescription of Artificial Sequence
Restriction endonuclease BamHi, Xbal, Pstl, Xhol and Bg/11
12ggatccgata tctagaagct tactgcagcg ctcgagatat cagatct
471312DNAArtificial SequenceDescription of Artificial Sequence
Restriction endonuclease Spel 13actagtgcta cc 12
* * * * *