Polypeptide having an activity to support proliferation or survival of hematopoietic stem cell and hematopoietic progenitor cell, and DNA coding for the same

Abstract

A gene encoding a polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells is isolated by comparing expressed genes between cells which support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells and cells which do not support the proliferation or survival. Proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells is supported by using stromal cells in which the isolated gene is expressed or a gene product of the isolated gene.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 10/478,926, filed Jun. 17, 2004, which is a 35 U.S.C. .sctn.371 filing of PCT/JP02/05807, filed Jun. 11, 2002, from which priority is claimed pursuant to 35 U.S.C. .sctn.120, which in turn claims benefit under 35 U.S.C. .sctn. 119(e)(1) of provisional Patent Application No. 60/297,286, filed Jun. 11, 2001, which applications are hereby incorporated by reference in their entireties

BACKGROUND OF THE INVENTION

[0002] 1. Field of the Invention

[0003] The present invention relates to a polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, a DNA coding the polypeptide, and a pharmaceutical composition comprising the polypeptide as active ingredient.

[0004] 2. Description of the Related Art

[0005] Fully differentiated mature hematopoietic cells have limited short lives. Homeostasis of the blood is maintained due to supply of the mature blood cells caused by continuous differentiation of hematopoietic progenitor cells. The hematopoietic progenitor cells are giving rise from more undifferentiated hematopoietic stem cells. The hematopoietic stem cells have potential of differentiating into all of the differentiation lineages (totipotency) and have potential of self-renew with retaining the totipotency so as to supply the hematopoietic cells through life. That is, the hematopoietic stem cells are known to generate totipotent stem cells by the self-renew and to differentiate in parts to a variety of the mature blood cells through the hematopoietic progenitor cells.

[0006] This differentiation of the blood cells is regulated by a variety of cytokines. Erythropoietin is known to promote the differentiation of the erythrocytic lineages. G-CSF and thrombopoietin are also known to promote the differentiation of the neutrophils, and the megakaryocytes and the platelet productive cells, respectively. However, a factor required for the self-renew of the hematopoietic stem cell with retaining the totipotency has not been clear. Although SCF/MGF (Williams, D. E., Cell, 63: 167-174, 1990; Zsebo, K. M., Cell, 63: 213-224, 1990), SCGF (WO98/08869), and the like are reported as growth factors for the hematopoietic stem cells, none of them have potency to sufficiently retain the totipotency of the hematopoietic stem cells. Although attempts to culture the hematopoietic stem cells in the presence of combinations of known cytokines, a system for efficient amplification of the hematopoietic stem cells was not realized (Miller, C. L., Proc. Natl. Acad. Sci. USA, 94: 13648-13653, 1997; Yagi, M., Proc. Natl. Acad. Sci. USA, 96: 8126-8131, 1999; Shih, C. C., Blood, 94: 5 1623-1636, 1999).

[0007] On the other hand, attempts to allow the hematopoietic stem cells to survive or proliferate without differentiation by using stromal cells which supply an environment suitable for survival or proliferation of the hematopoietic stem cells were reported (Moore K. A., Blood, 89: 12, 4337-4347, 1997). In addition, WO99/03980 discloses a stromal cell line capable of supporting proliferation or survival of hematopoietic stem cells and hematopoietic progenitor cells, which are established from an AGM (Aorta-Gonad-Mesonephros) region of a fetal mouse.

[0008] It is postulated that there should be more peptides that efficiently facilitate hematopoietic stem cell and progenitor cell amplification by themselves or in combination with stromal cells or stimulating factors such as cytokines, in addition to known factors affecting hematopoietic cells.

SUMMARY OF THE INVENTION

[0009] Since the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells in vitro can be supported by co-culture of stromal cells and hematopoietic stem cells and hematopoietic progenitor cells, the stromal cells are expected to produce factors supporting the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells. An object of the present invention is to provide a factor supporting the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, which is derived from the stromal cells.

[0010] The inventor of the present invention has assumed that the mouse stromal cells produce factors supporting the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, as mentioned above. Attention is given that there are two kinds of stromal cells. One has a ability to support the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells (hereafter sometimes referred to as "activity to support hematopoietic stem cells"). The other does not have the activity to support hematopoietic stem cells. The inventor of the present invention has assumed that this difference in the ability is due to the fact that expression of genes encoding the factors is increased in the supporting stromal cells and that the expression is low in non-supporting stromal cells. Thus the inventor think it can be found the factors supporting the proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells among the genes expressed higher in the supporting cells compared to in the non-supporting cells. In this context, the inventor has identified genes of which expressions are high in AGM-s3-A9 cell line which has the activity to support hematopoietic stem cells, and low or undetected in AGM-s3-A7 cell line which does not have the activity to support hematopoietic stem cells, and has determined the activities to support hematopoietic stem cells, of cells in which these gene groups are highly expressed. As a result, the present invention has been completed.

[0011] That is, the present invention provides the followings.

[0012] (1) A DNA coding for a polypeptide of the following (A) or (B):

[0013] (A) a polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 23 and SEQ ID NO: 25; or

[0014] (B) a polypeptide which comprises an amino acid sequence including deletion, substitution or insertion of one or several amino acids in the amino acid sequence as defined in (A), and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0015] (2) The DNA according to (1), which is a DNA of the following (a) or (b):

[0016] (a) a DNA which comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of nucleotides 1 to 444 of SEQ ID NO: 18, the nucleotide sequence of nucleotides 630 to 1358 of SEQ ID NO: 22, and the nucleotide sequence of nucleotides 132 to 506 of SEQ ID NO: 24; or

[0017] (b) a DNA which is hybridizable with a DNA comprising the nucleotide sequence as defined in (a) or a prove prepared from said DNA, under the stringent condition, and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0018] (3) The DNA according to (2), the stringent condition is 6.times.SSC, 5.times.Denhardt, 0.5% SDS and 68.degree. C. (SSC: 3 M NaCl, 0.3 M sodium citrate; 50.times.Denhardt: 1% BSA, 1% polyvinyl pyrrolidone, 1% Ficoll 400), or 6.times.SSC, 5.times.Denhardt, 0.5% SDS, 50% formamide and 42.degree. C.

[0019] (4) A expression vector which comprises the DNA of any one of (1) to (3) in such a manner that the DNA can be expressed.

[0020] (5) A cell into which the DNA of any one of (1) to (3) is introduced in such a manner that the DNA can be expressed.

[0021] (6) A polypeptide which is an expression product of the DNA of any one of (1) to (3), the polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0022] (7) The polypeptide according to (6), which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 23 and SEQ ID NO: 25, or an amino acid sequence including deletion, substitution or insertion of one or several amino acids in the amino acid sequence.

[0023] (8) The polypeptide according to (6) or (7), which is modified with one or more modifying agents selected from the group consisting of polyethylene glycol (PEG), dextran, poly(N-vinyl-pyrrolidone), polypropylene glycol homopolymer, copolymer of polypropylene oxide/ethylene oxide, polyoxyethylated polyol and polyvinyl alcohol.

[0024] (9) An monoclonal antibody which binds to the polypeptide of any one of (6) to (8).

[0025] (10) A method for supporting proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, comprising the step of co-culturing stromal cells in which a DNA coding for a polypeptide of the following (A) or (B) is expressed, with hematopoietic stem cells or progenitor cells,

[0026] (A) a polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NO: 29; or

[0027] (B) a polypeptide which comprises an amino acid sequence including deletion, substitution or insertion of one or several amino acids in the amino acid sequence as defined in (A), and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0028] (11) The method according to (10), wherein the DNA is a DNA of the following (a) or (b):

[0029] (a) a DNA which comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of nucleotides 1 to 1671 of SEQ ID NO: 8, the nucleotide sequence of nucleotides 1 to 1674 of SEQ ID NO: 10, the nucleotide sequence of nucleotides 1 to 366 of SEQ ID NO: 12, the nucleotide sequence of nucleotides 84 to 1121 of SEQ ID NO: 14, the nucleotide sequence of nucleotides 1 to 1035 of SEQ ID NO: 16, the nucleotide sequence of nucleotides 1 to 444 of SEQ ID NO: 18, the nucleotide sequence of nucleotides 1 to 444 of SEQ ID NO: 20, the nucleotide sequence of nucleotides 630 to 1358 of SEQ ID NO: 22, the nucleotide sequence of nucleotides 132 to 506 of SEQ ID NO: 24, the nucleotide sequence of nucleotides 1 to 2487 of SEQ ID NO: 26, and the nucleotide sequence of nucleotides 1 to 2496 of SEQ ID NO: 28; or

[0030] (b) a DNA which is hybridizable with a DNA comprising the nucleotide sequence as defined in (a) or a prove prepared from said DNA, under the stringent condition, and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0031] (12) A method for supporting proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, comprising the step of culturing hematopoietic stem cells or progenitor cells in the presence of a polypeptide of the following (A) or (B), said polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells when the hematopoietic stem cells or hematopoietic progenitor cells are cultured in the presence of the polypeptide,

[0032] (A) a polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NO: 29; or

[0033] (B) a polypeptide which comprises an amino acid sequence including deletion, substitution or insertion of one or several amino acids in the amino acid sequence as defined in (A), and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0034] (13) A pharmaceutical composition having an effect to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, which comprises an effective amount of a polypeptide of the following (A) or (B), said polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells when hematopoietic stem cells or hematopoietic progenitor cells are cultured in the presence of the polypeptide,

[0035] (A) a polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, and SEQ ID NO: 29; or

[0036] (B) a polypeptide which comprises an amino acid sequence including deletion, substitution or insertion of one or several amino acids in the amino acid sequence as defined in (A), and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0037] Terms used in this specification are defined as follows.

[0038] A hematopoietic stem cell is defined as a cell having totipotency, that is, ability to differentiate into all the cell lineages of the blood cells, and having a potency of self-renew with retaining the totipotency. A hematopoietic progenitor cell is defined as a cell which can differentiate a single cell lineage of the blood cell or plural cell lineages but cannot differentiate into all of the cell lineages. A stromal cell is defined as a cell which can be co-cultured together with the hematopoietic stem cells to construct a hematopoietic environment simulating in vivo hematopoietic environment in vitro. Cells derived from any origin can be used as long as the cells can be co-cultured with the hematopoietic cells in vitro.

[0039] Erythrocyte progenitor cells hardly survive and proliferate in in vitro culture environments and rapidly disappear. If the survival and proliferation of the erythrocyte progenitor cells are observed, continuous production of the erythrocyte progenitor cells is predicted to occur due to the survival and proliferation of the more immature hematopoietic stem cells or the hematopoietic progenitor cells. Therefore, in an assessment system of human hematopoietic stem cells, proliferation of hematopoietic stem cells or immature hematopoietic progenitor cells can be determined by using the survival and proliferation of the erythrocyte progenitor cells (BFU-E, CFU-E, and CFU-E mix) as an index.

BRIEF EXPLANATION OF THE DRAWINGS

[0040] FIG. 1 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-s3 subclone A9, A7, or D11 cells for two weeks.

[0041] FIG. 2 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-s3 subclone A9, A7, or OP9 cells for two weeks.

[0042] FIG. 3 shows time course of donor derived lymphoid lineage cells or myeloid lineage cells reconstitution in irradiated recipient mice that received the hematopoietic stem cells co-cultured with stromal cells.

[0043] FIG. 4 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A9 cells in which a gene SCR-2 is highly expressed (A9/SCR-2), AGM-S3-A9 cells into which a control vector is introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.

[0044] FIG. 5 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A7 cells in which a gene SCR-2 is highly expressed (A7/SCR-2), AGM-S3-A7 cells into which a control vector is introduced (A7/pMXIG) or AGM-S3-A7 cells (A7) for two weeks.

[0045] FIG. 6 shows time course of donor derived lymphoid lineage cells or myeloid lineage cells reconstitution in peripheral blood of irradiated recipient mice that received the hematopoietic stem cells co-cultured with AGM-S3-A7 cells in which a gene SCR-3 is highly expressed (A7/SCR-3), AGM-S3-A7 cells into which a control vector is introduced (A7/pMXIG) or AGM-S3-A7 cells.

[0046] FIG. 7 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A9 cells in which a gene SCR-4 is highly expressed (A9/SCR-4), AGM-S3-A9 cells into which a control vector is introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.

[0047] FIG. 8 shows time course of donor derived lymphoid lineage cells or myeloid lineage cells reconstitution in peripheral blood of irradiated recipient mice that received the hematopoietic stem cells co-cultured with AGM-S3-A7 cells in which a gene SCR-5 is highly expressed (A7/SCR-5), AGM-S3-A7 cells into which a control vector is introduced (A7/pMXIG) or AGM-S3-A7 cells.

[0048] FIG. 9 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A9 cells in which a gene SCR-6 is highly expressed (A9/SCR-6), AGM-S3-A9 cells into which a control vector is introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.

[0049] FIG. 10 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A9 cells in which a gene SCR-7 is highly expressed (A9/SCR-7), AGM-S3-A9 cells into which a control vector is introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.

[0050] FIG. 11 shows proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells determined by a clonogenic assay after co-culture of CD34-positive hematopoietic stem cells with AGM-S3-A9 cells in which a gene SCR-8 is highly expressed (A9/SCR-8), AGM-S3-A9 cells into which a control vector is introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks.

DETAILED DESCRIPTION OF THE INVENTION

[0051] Hereafter, the present invention will be described in detail below.

[0052] The following genes are those identified as genes of which expressions are high in AGM-s3-A9 cell line which has the activity to support hematopoietic stem cells, and low or undetected in AGM-s3-A7 cell line which does not have the activity to support hematopoietic stem cells, and determined to have the activities to support hematopoietic stem cells, of cells in which these gene groups are highly expressed.

[0053] Gene SCR-2

[0054] The gene is the same gene as a mouse gene, Mus musculus glypican-1 (GPC-1) of a GenBank accession number AF185613.

[0055] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 8. Only the amino acid sequence is shown in SEQ ID NO: 9.

[0056] The human amino acid sequence of GPC-1 is recorded in GenBank under an accession number P35052, and the human nucleotide sequence of GPC-1 is recorded in GenBank database under an accession number AX020122. It is predicted that the similar activity is detected in the human gene.

[0057] The nucleotide sequence of the gene from human and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 10. Only the amino acid sequence is shown in SEQ ID NO: 11.

[0058] Glypican is a major hepran sulfate proteoglycan existing on a cell surface, and have a characteristic structure such as cysteine rich globular domain, short glycosaminoglycan binding domain, glycosylphosphatidyl-inositol membrane binding domain. Six family genes from glypican-1 to glypican-6 have been found (J Biol Chem 1999 Sep. 17; 274(38):26968-77, Glypican-6, a new member of the glypican family of cell surface heparan sulfate proteoglycans. Veugelers M, De Cat B, Ceulemans H, Bruystens A M, Coomans C, Durr J, Vermeesch J, Marynen P, David G).

[0059] With respect to biological activities of GPC-1, there are a number of reports: To regulate growth stimulating activity of heparin binding growth factors (fibroblast growth factor 2 (FGF2), heparin-binding EGF-like growth factor (HB-EGF)) to promote proliferation of cancer cells showing autocrine proliferation by stimulation by the growth factors (J Clin Invest 1998 Nov. 1; 102(9):1662-73, The cell-surface heparan sulfate proteoglycan glypican-1 regulates growth factor action in pancreatic carcinoma cells and is overexpressed in human pancreatic cancer, Kleeff J, Ishiwata T, Kumbasar A, Friess H, Buchler M W, Lander A D, Korc M).

[0060] To bind HGF (hepatocyte growth factor) to promote reactivity with cytokines, of antigen-specific B cells. To participate in association of a cell with an adhesive molecule to involve in invasion of the cell (J Biol Chem 1998 Aug. 28; 273(35):22825-32, Heparan sulfate proteoglycans as adhesive and anti-invasive molecules. Syndecans and glypican have distinct functions, Liu W, Litwack E D, Stanley M J, Langford J K, Lander A D, Sanderson R D). These findings show that GPC-1 involves in activity expression of various cell-stimulating factors. Also, there is a report that expression of the glypican family gene in bone marrow is confirmed (Biochem J 1999 Nov. 1; 343 Pt 3:663-8, Expression of proteoglycan core proteins in human bone marrow stroma, Schofield K P, Gallagher J T, David G reports, it is not described about effects of GPC-1 on hematopoietic stem cells or hematopoietic progenitor cells.

[0061] Gene SCR-3

[0062] The gene is the same gene as mouse genes, Mus musculus chemokine MMRP2 mRNA of a GenBank accession number U15209, Mus musculus C10-like chemokine mRNA of U19482 and mouse macrophage inflammatory protein-1gamma mRNA of U49513.

[0063] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 12. Only the amino acid sequence is shown in SEQ ID NO: 13.

[0064] Gene SCR-4

[0065] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 14. Only the amino acid sequence is shown in SEQ ID NO: 15.

[0066] It has been found that the sequence has a high homology to Homo sapiens clone 25077 mRNA of a GenBank accession number AF131820, and that it is considered to be a mouse ortholog. This sequence is described in WO 00/66784.

[0067] The nucleotide sequence of the gene from human and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 16. Only the amino acid sequence is shown in SEQ ID NO: 17.

[0068] Gene SCR-5

[0069] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 18. Only the amino acid sequence is shown in SEQ ID NO: 19.

[0070] It has been found that the sequence has a high homology with Homo sapiens esophageal cancer related gene 4 protein (ECRG4) mRNA of a GenBank accession number AF325503, and that it is considered to be a mouse ortholog of AF325503.

[0071] The nucleotide sequence of the gene from human and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 20. Only the amino acid sequence is shown in SEQ ID NO: 21.

[0072] Gene SCR-6

[0073] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 22. Only the amino acid sequence is shown in SEQ ID NO: 23.

[0074] Gene SCR-7

[0075] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 24. Only the amino acid sequence is shown in SEQ ID NO: 25.

[0076] Gene SCR-8

[0077] The gene is the same gene as Mus musculus mRNA for ADAM23 of a GenBank accession number AB009673.

[0078] The nucleotide sequence of the gene from mouse and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 26. Only the amino acid sequence is shown in SEQ ID NO: 27.

[0079] The sequence has a high homology with a sequence described by JP 11155574-A and the sequence described by JP 11155574-A is considered to be a human ortholog.

[0080] The nucleotide sequence of the gene from human and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 28. Only the amino acid sequence is shown in SEQ ID NO: 29.

[0081] Polypeptides which are products of these genes have an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells. The expression that a polypeptide has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells means that proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells is supported in the presence of the polypeptide or in the presence of stroma cells expressing the polypeptide.

[0082] Therefore, the present invention provides use of the polypeptides and DNAs encoding the polypeptides and novel polypeptides among the polypeptides and DNAs encoding the novel polypeptides.

[0083] A stem cell proliferation-supporting factor which is a polypeptide encoded by the DNA can be produced by introducing the DNA into a suitable host to prepare a transformant cell, and allowing the DNA to be expressed in the transformant cell.

[0084] The DNA may encode the above described factors which have amino acid sequences including substitution, deletion or insertion of one or several amino acids, as long as the activity of the stem cell proliferation-supporting factor to be encoded is not lost. DNAs encoding substantially equivalent polypeptides to this stem cell proliferation-supporting factor can be obtained by modifying the nucleotide sequences so as to include substitution, deletion, insertion, addition, or inversion of amino acid residues in a specific region using site-directed mutagenesis.

[0085] The DNAs including the above described mutation can be expressed in appropriate cells and the activity to support hematopoietic stem cells, of the expressed products can be examined, so that the DNAs encoding the polypeptide having functions which are substantially equivalent to this stem cell proliferation-supporting factor are obtained. In addition, the DNAs encoding substantially equivalently active protein as this stem cell proliferation-supporting factor can be obtained by isolating DNAs which hybridize with DNAs including, for example, the nucleotide sequence as described in SEQ ID NO: 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or 28 from the cells having the DNA, or probes prepared from these DNAs under the stringent condition; and which encode proteins possessing the activity to support hematopoietic stem cells. The length of the probe is usually 30 to 1000 nucleotides. The stringent condition is, for example, one in which DNAs having homology (determinable with homology search in the compare function of DNASIS version 3.7 (Hitachi Software Engineering)) at not less than 70%, preferably at not less than 80%, are hybridized each other and DNAs having less homology than those are not hybridized each other. The above described stringent condition may be 6.times.SSC, 5.times.Denhardt, 0.5% SDS, 68.degree. C. (SSC; 3 M NaCl, 0.3 M sodium citrate) (50.times.Denhardt; 1% BSA, 1% polyvinyl pyrrolidone, 1% Ficoll 400) or 6.times.SSC, 5.times.Denhardt, 0.5% SDS, 50% Formamide, 42.degree. C., or the like.

[0086] Microorganisms such as Escherichia coli and yeast, culture cells derived from animals or plants, and the like are used for host cells for expressing the DNA. Preferably, culture cells derived from mammals are used as the host cells. In the case that prokaryotic cells are used as the host cells, the expression is preferably performed in a condition in which a signal peptide region is replaced with a leader sequence suitable for the prokaryotic cells such as .beta.-lactamase (bla), alkaline phosphatase (phoA), and outer membrane protein A (ompA) and the like, or in a form in which a methionine residue is added to the N-terminal site of the mature protein.

[0087] The introduction of the DNA to the host cell can be carried out by, for example, incorporating the DNA into a vector suitable for the host in an expressible form, and introducing the resultant recombinant vector to the host cell.

[0088] Examples of the culture cells derived from mammals include CHO cell, 293 cell, COS7 cell, and the like. Gene expression regulatory sequence such as a promoter to express the DNA may be originated from the gene itself, or may be derived from other genes such as cytomegalovirus promoter and elongation factor 1 promoter and the like.

[0089] Examples of a vector for animal culture cells include plasmid vectors, retrovirus vectors, adenovirus vectors (Neering, S. J., Blood, 88: 1147, 1996), herpes virus vectors (Dilloo, D., Blood, 89: 119, 1997), HIV vectors, and the like.

[0090] In order to introduce the recombinant vector into culture cells, the conventional methods which are usually employed for transformation of culture cells such as calcium phosphate transfection, the liposome method, the DEAE dextran method, the electroporation method and the microinjection method are employed.

[0091] The polypeptides of the present invention also comprise polypeptides having amino acid sequences in which one or several amino acids are substituted, deleted or inserted in the amino acid sequence represented in SEQ ID NO: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 or 29, and having activity to support hematopoietic stem cells in addition to the polypeptides having the amino acid sequence represented in SEQ ID NO: 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 or 29. That is, even if mouse and human stem cell proliferation-supporting factors are modified by substitution, deletion, insertion or the like, polypeptides holding essential functions as a stem cell proliferation-supporting factor can be considered to be substantially equivalent to the stem cell proliferation-supporting factor.

[0092] These modified stem cell proliferation-supporting factors can be obtained by treating DNA encoding the stem cell proliferation-supporting factor or host cells including the above mentioned DNA with a mutagen, or by mutating the above mentioned DNA so as to substitute, delete, or insert an amino acid at a specific site using site-directed mutagenesis. The residual of the activity to support the hematopoietic stem cells in the obtained mutant polypeptide is confirmed by tranferring hematopoietic stem cells cultured in the presence of the mutant polypeptides into irradiated mice, and monitoring peripheral hematological cellularity over time, as in the examples described below.

[0093] As for the amino acid deletion, the polypeptide may be a fragment which lacks an amino acid sequence at the N-terminal end and/or the C-terminal end. The fragment lacking the amino acid sequence at the N-terminal end and/or the C-terminal end can be obtained by a usual method, and the hematopoietic stem cell-supporting activity of the fragment can be determined by a similar way to that described with respect to the mutated polypeptide. In particular, if there is a portion predicted as a signal sequence or a transmembrane region in the amino acid sequence, a fragment having the hematopoietic stem cell-supporting activity is predicted by using it as an index. For example, a protein encoded by human SCR-8 is a transmembrane protein of type I passing through the membrane once, and it is therefore predicted that even if it made to be a soluble protein lacking the transmembrane region, it has the activity to support to proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells. The transmembrane region can be predicted with a known program based on the amino acid sequence. For example, if it is predicted with a program called PSORT II (available through the Internet, URL: http://psort.nibb.ac.jp/index.html), the transmembrane region is amino acids at positions 790 to 806 in SEQ ID NO: 29, and it is predicted that even if a fragment up to position 789, the fragment has activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

[0094] Since the nucleotide sequences of the above described DNAs have been clarified by the present invention, the DNAs can be also obtained by isolating the corresponding DNAs from mouse or human cDNA or chromosome DNA libraries using PCR in which the oligonucleotides prepared based on these nucleotide sequences are used as primers or using hybridization in which the oligonucleotides prepared based on these nucleotide sequences are used as probes.

[0095] In order to complete the present invention, the DNAs of the present invention have been isolated from cDNA library of AGM-s3-A9 cells which are a mouse stromal cell line having the activity to support the hematopoietic stem cells, using SBH (Sequencing By Hybridization) method (Drmanac, S., Nat. Biotechnol., 16, 54, 1998; Drmanac, R., Methods. Enzymol., 303, 165, 1999) as described below. The mouse stromal cell lines having the activity to support the hematopoietic stem cells can be obtained using the method disclosed in WO99/03980 or from Cell Bank of Institute of Physical and Chemical Research (RIKEN) or ATCC.

[0096] An outline of SBH method will be described below. Probes having eight or nine nucleotides whose sequences are different from each other are prepared. When the nucleotide sequences corresponding to those of the probe exist in a targeted gene, the probes can hybridize with the gene. The hybridization can be easily detected with utilization of radio isotope- or fluorescence-labelled probes. Each clone in the library is picked up, and blotted on a membrane. Then, the repeated hybridizations are performed with the each of above described probes, so that one can identify the combination of probes that hybridize to each clone. Since the combination of hybridized probes depends on genes, the combination of probes which hybridize to an identical gene is the same. That is, the same gene can be identified as one group (cluster) according to the combination of the hybridized probes. The number of clones of each gene in the cDNA library can be determined by classifying each clone in the library based on patterns of the hybridized probes and counting the classified clones. Thus, frequency of expression of each gene in the library can be determined.

[0097] cDNA libraries are prepared from cells having an activity to support the hematopoietic stem cells and from cells not having the activity. Clustering is performed for the cDNA libraries. Statuses of expressed genes among cells are compared, so that the genes highly expressed with specificity to the supporting cells are selected. The expression statuses of these genes in each of above described cells are further examined by Northern blot analysis, so that genes which are highly expressed in the cells having the activity to support the hematopoietic stem cells are obtained.

[0098] The above mentioned genes are the genes which are highly expressed with specificity to the supporting cells and which are obtained through the above described process. Full-length genes have been cloned from the cDNA library derived from AGM-s3-A9 cell.

[0099] Further, in order to determine an ability of gene products to support hematopoiesis, a gene fragment including gene ORF was transferred into stromal cells using a retrovirus vector, and the change in the activity to support the hematopoietic stem cells of the stromal cells was determined. Specifically, after the stromal cells into which the gene was not introduced or into which a control vector was introduced and those into which the gene was introduced were each co-cultured with the mouse hematopoietic stem cells, the hematopoietic cells were transplanted into irradiated mice. The engraftment of the co-cultured hematopoietic cells in recipient mice were examined. As a result, the mice into which the hematopoietic stem cells co-cultured with the gene-introduced cells were transplanted, showed increased chimerism after the transplantation compared with co-culture with the cells into which the gene was not introduced. This result shows that in the gene-expressed stromal cells, an activity to support the proliferation or survival of the hematopoietic stem cells or the hematopoietic progenitor cells is increased or imparted. As a result, it has become evident that expression of the above described genes has a function to increase the above described activity in the stromal cells or impart the activity to the stromal cells. Therefore, it is revealed that products of the genes affect hematopoietic stem cells or hematopoietic progenitor cells to show an activity to support the survival or the proliferation thereof, or affect stromal cells to show an activity to increase an activity to support the hematopoietic stem cells therein or impart the activity thereto.

[0100] The polypeptides of the present invention can be used as a medicine to proliferate or support human hematopoietic stem cells or human hematopoietic progenitor cells when they affect hematopoietic stem cells or hematopoietic progenitor cells to show an activity to support survival or proliferation thereof, in other words, the polypeptides have an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells if the hematopoietic stem cells or the hematopoietic progenitor cells are cultured in the presence of the polypeptides. The pharmaceutical composition can be used for supporting proliferation or survival of human hematopoietic stem cells or human hematopoietic progenitor cells in vitro. For hematopoietic stem cell transplantation therapies such as peripheral blood stem cell transplantation and cord blood stem cell transplantation, a sufficient amount of the hematopoietic stem cells sometimes cannot be collected and the transplantation may not be performed. Even if the enough amount of the stem cells can not be collected, the enough amount of the hematopoietic stem cells can be obtained and transplanted by amplification of the hematopoietic stem cells in vitro using this polypeptides. That is, the hematopoietic stem cells can be amplified without differentiation by culturing the hematopoietic stem cells in culture medium including these polypeptides. It may be considered the hematopoietic stem cells are able to be amplified more efficiently with addition of a variety of cytokines to the medium.

[0101] When the hematopoietic stem cells or the hematopoietic progenitor cells are cultured in the medium including the polypeptides of the present invention, the hematopoietic stem cells or the hematopoietic progenitor cells used may be isolated one of these cell types alone or may be both of the cell types. In addition, the cells may include at least the hematopoietic stem cells or the hematopoietic progenitor cells, and include other hematopoietic cells. Further, it can be used a fraction containing hematopoietic stem cells or progenitor cells fractionated from the cell population that contain the hematopoietic stem cells or progenitor cells.

[0102] Examples of sources of the hematopoietic stem cells and the hematopoietic progenitor cells in the method of the present invention include a fetal liver, bone marrow, fetal bone marrow, peripheral blood, the peripheral blood from persons whose stem cells are mobilized by administration of cytokines and/or antitumor drugs, cord blood, and the like of mammals such as human and mouse and the like. Any sources may be used as long as the tissue includes the hematopoietic stem cells.

[0103] A culture method using petri dishes and flasks for culture may be employed to culture the hematopoietic stem cells or the hematopoietic progenitor cells. The cultivation of the hematopoietic stem cells and/or progenitor cells may be improved by mechanically controlling medium composition, pH, and the like, and using a bioreactor capable of high density cultivation (Schwartz, Proc. Natl. Acad. Sci. U.S.A., 88: 6760, 1991; Koller, M. R., Bio/Technology, 11: 358, 1993; Koller, M. R., Blood, 82: 378, 1993; Palsson, B. O., Bio/Technology, 11: 368, 1993).

[0104] The stromal cells in which DNAs encoding the polypeptide of the present invention can be obtained as described with respect to the expression of the DNAs.

[0105] The co-culture of the stromal cells and the hematopoietic cells can be performed simply after the collection of the bone marrow cells without further separation. Furthermore, co-culture can be performed by separating components such as stromal cells, hematopoietic cells and other cell populations from collected bone marrow and combining them with the hematopoietic cells and stromal cells which are not from the individual from which the bone marrow is collected. Furthermore, after stromal cells are cultured to grow to the stromal cells, hematopoietic cells can be added to perform co-culture with the hematopoietic stem cells. At this time, cell stimulating factors can added to the culture system of stromal cells to more effectively support proliferation and survival. Concrete examples of the cell stimulating factor include a growth factor which is typically a cytokine such as SCF (stem cell factor), IL-3 (interleukin 3), GM-CSF (granulocyte/macrophage colony-stimulating factor), IL-6 (interleukin 6), TPO (thrombopoietin), G-CSF (granulocyte colony-stimulating factor), TGF-b (transforming growth factor-b), MIP-1a (Davatelis, G., J. Exp. Med. 167: 1939, 1988); a differentiation and proliferation control factor such as hematopoietic hormones such as EPO (erythropoietin), chemokine, Wnt gene product, and notch ligand; and a development control factor.

[0106] In addition, when the polypeptide of the present invention affects hematopoietic stem cells or hematopoietic progenitor cells to show an activity to support survival or proliferation thereof, in other words, the polypeptide has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells if the hematopoietic stem cells or the hematopoietic progenitor cells are cultured in the presence of the polypeptide, the proliferation and the survival of the hematopoietic stem cells or the hematopoietic progenitor cells can be retained by allowing the recombinant polypeptide of the present invention alone or in combination with the cell stimulating factors to affect hematopoietic stem cells or hematopoietic progenitor cells, without stromal cells. Examples of the cell stimulating factors used in this case are above described cell stimulating factors and the like.

[0107] Medium used for the culture is not specially restricted as long as the proliferation or the survival of the hematopoietic stem cells or the hematopoietic progenitor cells is not harmed. Preferable media are, for example, MEM-.alpha. medium (GIBCO BRL), SF-02 medium (Sanko Junyaku), Opti-MEM medium (GIBCO BRL), IMDM medium (GIBCO BRL), and PRMI1640 medium (GIBCO BRL). A culture temperature is usually ranging from 25 to 39.degree. C., and preferably ranging from 33 to 39.degree. C. Examples of additives to the medium are fetal bovine serum, human serum, horse serum, insulin, transferrin, lactoferrin, ethanolamine, sodium selenite, monothiolglycerol, 2-mercaptoethanol, bovine serum albumin, sodium pyruvate, polyethylene glycol, a variety of vitamins, and a variety of amino acids. A concentration of CO.sub.2 is usually ranging from four to six percent, and preferably five percent.

[0108] Since the hematopoietic stem cells can differentiate into all the hematopoietic cell lineages, the hematopoietic stem cells can be amplified and differentiated into a specific cell type in vitro, and then the specific cells can be transplanted. For example, when erythrocytes are necessary, after the cultivation of the patient's stem cells to amplify them, the hematopoietic cells whose main component is the erythrocyte can be artificially produced using an erythrocyte differentiation induction-promoting factor such as EPO.

[0109] The hematopoietic stem cells or the hematopoietic progenitor cells cultured using the polypeptides of the present invention can be used as a graft for blood cell transplantation replacing the conventional bone marrow transplantation or cord blood transplantation. Transplantation of the hematopoietic stem cells is superior to the conventional blood cell transplantation therapy, since the engraftment can last semipermanently.

[0110] The transplantation of the hematopoietic stem cells can be employed as therapy for a variety of diseases in addition to combination therapy with total body X-ray irradiation therapy or advanced chemotherapy for leukemia. For example, when therapy accompanied with myelosuppression as an adverse reaction, such as chemotherapy, radiation therapy, and the like is performed for the patient with solid cancer, the patient can get benefit of early recovery and stronger chemotherapy than the conventional one can be performed to improve the therapeutic effect of the chemotherapy by collecting the bone marrow before the therapy, allowing the hematopoietic stem cells or the hematopoietic progenitor cells to be amplified in vitro and returning the amplified cells to the patient after the therapy. In addition, by allowing the hematopoietic stem cells or the hematopoietic progenitor cells obtained according to the present invention to be differentiated into a variety of hematopoietic cells and transplanting these cells into a patient with hypoplasia of a given hematopoietic cells, the patient's deficient status can be improved. In addition, this therapy can improve dyshemopoietic anemia to develop anemia such as aplastic anemia caused by bone marrow hypoplasia. Furthermore, examples of diseases in which the transplantation of the hematopoietic stem cells according to the present invention is effective include immunodeficiency syndrome such as chronic granulomatous disease, duplicated immunodeficiency syndrome, agammaglobulinemia, Wiskott-Aldrich syndrome, acquired immunodeficiency syndrome (AIDS), and the like, thalassemia, hemolytic anemia due to an enzyme defect, congenital anemia such as sicklemia, Gaucher's disease, lysosomal storage disease such as mucopolysaccharidosis, adrenoleukodegeneracy, a variety of cancers and tumors, and the like.

[0111] Transplantation of the hematopoietic stem cells may be performed in the same manner as the conventional bone marrow transplantation or cord blood transplantation other than the differences of the cells used.

[0112] The source of the hematopoietic stem cells which may be used for the above described hematopoietic stem cell transplantation is not restricted to the bone marrow, and the above described fetal liver, the fetal bone marrow, the peripheral blood, the peripheral blood with stem cells mobilized by administration of cytokines and/or antitumor drugs, the cord blood, and the like may be used.

[0113] The graft may be a composition including buffer solution and the like in addition to the hematopoietic stem cells and the hematopoietic progenitor cells produced by the method according to the present invention.

[0114] The hematopoietic stem cells or the hematopoietic progenitor cells produced according to the present invention may be used for ex vivo gene therapy. Because of the low frequency of recombination of target genes to the chromosome because the stem cells are in the resting state, differentiation of the stem cells during the culture period, and the like, the gene therapy to the hematopoietic stem cells has been hard to be established. However, the present invention can amplify the stem cells without differentiation, so that efficacy of gene transfer is expected to be remarkably improved. In this gene therapy, a foreign gene (a gene for therapy) is transferred into the hematopoietic stem cells or the hematopoietic progenitor cells, and then the obtained gene-transferred cells are used. The foreign gene to be transferred is appropriately selected according to disease. Examples of diseases in which the target cells of the gene therapy are the hematopoietic cells include immunodeficiency syndrome such as chronic granulomatous disease, duplicated immunodeficiency syndrome, agammaglobulinemia, Wiskott-Aldrich syndrome, acquired immunodeficiency syndrome (AIDS), and the like, thalassemia, hemolytic anemia due to an enzyme defect, congenital anemia such as sicklemia, Gaucher's disease, lysosomal storage disease such as mucopolysaccharidosis, adrenoleukodegeneracy, a variety of cancers and tumors, and the like.

[0115] A usual method used for transfer of a gene into animal cells is employed for the transfer of the gene for the therapy into the hematopoietic stem cells or the hematopoietic progenitor cells. Examples include a method using a vector for animal cells derived from virus utilized for a gene therapy such as retrovirus vectors such as Moloney mouse leukemia virus, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus vectors, and HIV vectors (with respect to a vector for gene therapy, see Verma, I. M., Nature, 389: 239, 1997); calcium phosphate transfection, DEAE-dextran transfection, electroporation, the liposome method, the lipofection method, the microinjection method, and the like. Among them, the method using the retrovirus vector, the adeno-associated virus vector, or the HIV vector is preferable, since permanent expression of a gene is expected due to insertion into the chromosome DNA of a target cell.

[0116] For example, the adeno-associated virus (AAV) vector can be prepared as follows. First, a vector plasmid in which a gene for therapy is inserted into ITR (inverted terminal repeat) at both ends of wild-type adeno-associated virus DNA and a helper plasmid for supplementing virus proteins are transfected into 293 cell line. Next, adenovirus as helper virus is infected, so that virus particles including the AAV vector are produced. Alternatively, instead of adenovirus, a plasmid which expresses adenovirus gene having helper function may be transfected. The hematopoietic stem cells or the hematopoietic progenitor cells are infected with the obtained virus particles. Preferably, appropriate promoter, enhancer, insulator and the like are inserted into the upstream region of the target gene in the vector DNA, so that the expression of the gene is regulated. When a marker gene such as a drug resistant gene is used in addition to the gene for therapy, cells into which the gene for therapy are transferred are easily selected. The gene for therapy may be a sense gene or an antisense gene.

[0117] A composition for gene therapy may include a buffer solution and a novel active ingredient and the like in addition to the hematopoietic stem cells or the hematopoietic progenitor cells by the method according to the present invention.

[0118] A vector for gene therapy can be produced by incorporating the DNA of the present invention in an expression vector using a usual method. This vector for gene therapy is useful to treat diseases which need survival and proliferation of the human hematopoietic stem cells. That is, the vector for gene therapy is transferred into the hematopoietic stem cells and the cells are cultured in vitro, so that the hematopoietic stem cells or the hematopoietic progenitor cells can proliferate dominatingly. The proliferation of hematopoietic stem cells in vivo can be caused by returning these hematopoietic stem cells thus treated. The proliferation of hematopoietic stem cells in vivo can significantly promoted by introducing this vector for gene therapy into the body. Alternatively, the bone marrow cells derived from a patient are cultured as it is and this vector for gene therapy is transferred thereto, so that the hematopoietic stem cells or the hematopoietic progenitor cells can be proliferated in a culture system. Alternatively, this vector for gene therapy is transferred into the stromal cells and mesenchaymal stem cells obtained by isolating and culturing stromal cells from the bone marrow, so that the activity to support the hematopoietic stem cells can be added or increased.

[0119] As shown in Examples, since it is possible that by introducing the DNA of the present invention into the stromal cells without the activity to support the hematopoietic stem cells, this activity can be imparted, stromal cells having the activity to support the hematopoietic stem cells can be prepared by gene transfer to stromal cells derived from human or mouse. The stromal cells expressing the DNA of the present invention and the hematopoietic stem cells or the hematopoietic progenitor cells are co-cultured, so that the hematopoietic stem cells or the hematopoietic progenitor cells can survive and proliferate so as to be useful for a variety treatment.

[0120] Since the hematopoietic stem cells or the hematopoietic progenitor cells can survive and proliferate by expression of the DNA of the present invention in the stromal cell, an activity to support the hematopoietic stem cells of the stromal cells can be determined using the expression of the DNA of the present invention as an index. The expression of the DNA of the present invention in the stromal cells can be confirmed using an antibody against a polypeptide encoded by the DNA of the present invention. Also, PCR primers can be prepared based on nucleotide sequences, and RNA is prepared from the stromal cells of interest, and RT-PCR is performed, so that the expression of the DNA of the present invention can be confirmed. The antibody will be described below.

[0121] The pharmaceutical composition of the present invention can be administered to human. The pharmaceutical composition having an activity to proliferate or to support the human hematopoietic stem cells or the hematopoietic progenitor cells can be produced by mixing medically acceptable diluent, stabilizer, carrier, and/or other additives with the polypeptides of the present invention. At this time, in order to increase the stability of the protein in vivo, the polypeptides of the present invention may be modified by a modifying agent. Examples of the modifying agent include polyethylene glycol (PEG), dextran, poly(N-vinyl-pyrrolidone), polypropylene glycol homopolymer, polypropylene oxide/ethylene oxide copolymer, polyoxyethylated polyol, polyvinyl alcohol, and the like. The modification of the protein with PEG can be performed by, for example, a method in which activated ester derivatives of PEG is reacted with the protein, a method in which aldehyde derivatives at the terminal portion of PEG is reacted with the protein in the presence of a reducing agent, and the like. Japanese Patent Application Laid-Open No. 10-510980 discloses such protein modification in detail.

[0122] When the pharmaceutical composition of the present invention is administered to human, recovery from hematological suppression due to an adverse drug reaction of carcinostatics; early recovery of hematopoietic cells at bone marrow transplantation, peripheral blood stem cell transplantation, or cord blood transplantation; and recovery of hematopoietic function at pancytopenia such as aplastic anemia (AA) and myelodysplastic syndrome (MDS) are expected.

[0123] The antibodies of the present invention react specifically to the above described polypeptides of the present invention. The antibodies of the present invention may be monoclonal antibodies or polyclonal antibodies as long as they react specifically to the above described polypeptides.

[0124] The antibodies of the present invention can be prepared according to usual methods. For example, the antibodies can be prepared either in vivo method in which animals are additionally immunized by an antigen together with adjuvant once or several times at an interval of several weeks or in vitro method in which immune cells are isolated and sensitized in an appropriate culture system. Examples of immune cells which can produce the antibodies of the present invention include splenic cells, tonsillar cells, lymph gland cells, and the like.

[0125] The whole polypeptide according to the present invention is not necessarily used as an antigen. A part of this polypeptide may be used as an antigen. When the antigen is a short peptide, particularly, a peptide made of about 20 amino acid residues, it may be used by binding it to a carrier protein having high antigenicity such as keyhole lympet hemocyanin or bovine serum albumin using chemical modification and the like. Alternatively, the antigen may be used by covalently binding it to peptide having branching skeleton such as lysine core MAP peptide instead of the carrier protein (Posnett et al., J. Biol. Chem., 263, 1719-1725, 1988; Lu et al., Mol. Immunol., 28, 623-630, 1991; Briand et al., J. Immunol. Methods, 156, 255-265, 1992).

[0126] Examples of adjuvant include Freund's complete adjuvant, Freund's incomplete adjuvant, aluminum hydroxide gel, and the like. Antigen-given animals are, for example, mouse, rat, rabbit, sheep, goat, chicken, bovine, horse, guinea pig, hamster, and the like. The blood is collected from these animals and the serum is separated. Then, immunoglobulin is purified from the serum using an ammonium sulfate precipitation method, anion exchange chromatography, protein A chromatography, or protein G chromatography to obtain polyclonal antibodies.

[0127] With respect to chicken, antibodies can be purified from an egg. Monoclonal antibodies can be prepared by purification from supernatant of culture of hybridoma cells which are made by fusion of the immune cells sensitized in vitro, or immune cells from the above described animals with parent cells capable of cultivation, or ascites from animals which received intraperitoneal administration of hybridoma cells. Examples of parent cells include X63, NS-1, P3U1, X63.653, SP2/O, Y3, SK0-007, GM1500, UC729-6, HM2.0, NP4-1 cell lines, and the like. Preparation may be performed by cultivating the immortalized antibody-forming cells obtained by sensitization in vitro, or infection of a proper virus such as EB virus to the immune cells of the above described animals.

[0128] In addition to these cell engineering methods, the antibodies can be obtained using gene engineering methods. For example, the antibody gene obtained from the in vitro sensitized cells or immune cells derived from the above described animals is amplified by PCR (polymerase chain reaction) and isolated, and the amplified genes are transferred into microorganisms such as E. coli to produce the antibodies. Alternatively, the antibodies may be expressed on surfaces of phages as fused proteins.

[0129] By measuring polypeptides in vivo using the antibodies of the present invention, the relationship between the polypeptides and pathological status of a variety of diseases can be clarified. Moreover, the antibodies can be used for diagnosis and treatment of diseases, and efficient affinity purification of the polypeptides.

[0130] The present invention provides polypeptides having an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells by effecting thereon, or an activity to impart an activity to support the hematopoietic stem cells to stromal cells by effecting thereon, and also provides DNAs encoding thereof. The polypeptides of the present invention can efficiently maintain the proliferation or the survival of the hematopoietic stem cells or the hematopoietic progenitor cells.

BEST MODE FOR CARRYING OUT THE INVENTION

[0131] Hereafter, the present invention will be described in detail by reference to examples.

Example 1 Preparation of Fragment of Gene which is Specifically Expressed in Hematopoietic Stem Cell-Supporting Cells

[0132] (I) Preparation of Stromal Cell Line Derived from Mouse AGM (1) Isolation of AGM Region from Fetal Mouse

[0133] C3H/HeNSLc mice of both genders (purchased from Japan SLC INC.) were kept under a SPF (specific pathogen-free) environment. One or two female mice and one male mouse were placed in the same cage over a night. In the next morning, the female mice in which the existence of a vaginal plug was observed were transferred to other cages and kept. The day when the existence of the vaginal plug was observed was defined to be the 0.5th day of pregnancy. On the 10.5th day of the pregnancy, after mouse was sacrificed by cervical dislocation, fetuses were extirpated. Isolation of AGM regions was performed according to the method by Godin et al. (Godin, I., Proc. Natl. Acad. Sci. U.S.A., 92: 773-777, 1995) and the method by Medvinsky et al. (Medvinsky, A. L., Blood, 87: 557-565, 1996). The fetuses were placed in a culture dishes to which PBS(-) (phosphate buffered saline) (produced by Nissui Seiyaku) was added in a volume just sufficient to cover the fetuses. After the AGM regions were carefully excised so as not to include other regions under a stereoscopic microscope, they were put in another 24-well culture dish (Nunc).

(2) Establishment of Cell Lines Derived from AGM

[0134] One drop of MEM medium (Sigma) containing 10% FCS (Hyclone) was added to the AGM regions in the 24-well culture dish (Nunc), and AGM regions were cultured in an incubator overnight. The culture was performed in the MEM medium (Sigma) containing 10% FCS (Hyclone) at 37.degree. C., in an atmosphere of 5% CO.sub.2, and at a humidity of 100%. When the cells of the AGM regions adhered to the culture dish due to overnight cultivation, two milliliters of MEM medium containing 10% FCS was further added. Stromal cells began to appear around the AGM region tissue fragment after the continuous cultivation. After one-week cultivation, adhesive cells were separated by trypsin treatment (0.05% trypsin in PBS containing 0.53 mM EDTA (Gibco BRL) at 37.degree. C. for three to five minutes). The stromal cells were then washed twice with the medium, and seeded on 6-well culture dish (Nunc). On the next day, the cells which did not adhere to the culture dish and the medium were removed, and then, fresh medium was added. Two weeks after transfer to the 6-well culture dish, cells were .gamma.-ray-irradiated at 900 Rad to eliminate endogenous hematopoietic cells. An attempt of the direct cell cloning by limiting dilution from this culture system was made, but no cell proliferation was observed and the cloning ended in failure. Then, after the number of seeded cells in one well was increased and cells were adapted so as to be able to proliferate from a small number of cells, the cells were cloned by limiting dilution.

[0135] Specifically, the AGM was extirpated and cultured in the same manner as described above. The culture system two weeks after the .gamma.-ray radiation was trypsinized (0.05% trypsin in PBS containing 0.53 mM EDTA at 37.degree. C. for three to five minutes) to suspend the cells, and the cells were seeded in a 24-well culture dish at 50 to 100 cells/well. After the culture was continued for three weeks, the cells were seeded in a 96-well culture dish (Nunc) by means of limiting dilution, at 0.3 cells/well. The cells which were grown from the well in which only one cell was seeded were allowed to enlarge culture. As a result, the cells were successfully cloned to obtain fibroblast-like cells and cobble stone-like cells.

[0136] A CD34-positive cell fraction derived from the human cord blood was co-cultured with the fibroblast-like cells for two weeks to examine the presence of colony-forming cells during the culture. Colony-forming cells could not be found in the co-culture system with the fibroblast-like cells. Then, the similar examination was performed for seven cell clones showing the cobble-stone-like form. Three clones having an activity to support proliferation of human hematopoietic stem cells were obtained and were named AGM-s1, AGM-s2, and AGM-s3.

(II) Preparation of Hematopoietic Stem Cells from Mouse Bone Marrow

[0137] Bone marrow was collected from a femur of C57BL/6-Ly5.1 pep (eight- to ten-week age, and male) (the gift from Professor K. Nakauchi, University of Tsukuba), and suspended in PBS. After the mouse bone marrow mononuclear cells were concentrated by specific gravity centrifugation according to the usual method (S. Kouzu, Fundamental techniques for immunology, YODOSHA, 1995), the cells were suspended in staining buffer (PBS containing 5% FCS and 0.05% NaN.sub.3), and a hematopoietic stem cell fraction was obtained as follows (Osawa, M. et al., Science 273: 242-245, 1996).

[0138] An FITC-conjugated anti-CD34 antibody, a phycoerythrin-conjugated anti-Sca-1 antibody, an allophycocyanin anti-c-Kit antibody (all purchased from Pharmingen) and six biotylated anti-differentiation antigen antibodies (CD45R, CD4, CD8, Gr-1, Ter119, and CD11c, all purchased from Pharmingen) as molecular markers (Lin), were added to a suspension of the bone marrow mononuclear cells and incubated for 20 min on ice to cause reaction. After the cells were washed twice with staining buffer, CD34-negative, Sca-1-positive, c-Kit-positive, and Lin-negative cells were isolated on a cell sorter (FACS Vantage, Becton Dickinson).

(III) Subcloning of Mouse Stromal Cell Line and Determination of Activity to Support Hematopoietic Stem Cells of a Variety of Cell Lines

(1) Subcloning of Mouse Stromal Cell Line

1) Isolation of AGM-s3 Subclone

[0139] Stromal cell line AGM-s3 derived from AGM, which was subcultured in MEM.alpha. medium (GIBCO BRL) including inactivated 10% FCS (bovine fetal serum, Hyclone), was suspended in PBS containing 5% FCS (PBS-FCS). Clone sorting was performed in a 96-well culture dish (Falcon) at one cell/well using a cell sorter (FACS Vantage; Becton Dickinson). Among cells in the 96 wells, cultures of the cells which grew were expanded, so that thirteen kinds of AGM-s3 subclones were obtained. The activity to support the hematopoietic cells of these AGM-s3 subclones were examined.

2) Isolation of Human Cord Blood CD34-Positive Stem Cell

[0140] The human cord blood was collected at normal delivery according to the criteria approved by Ethics committee of Kirin Beer Iyaku Tansaku Kenkyusho. The cord blood was collected using a heparin-added syringe so as not to coagulate. The heparin treated cord blood was overlaid on Lymphoprep (NYCOMED PHARMA), and mononuclear cells were separated by specific gravity centrifugation (at 400 G, at room temperature, and for 30 minutes). Erythrocytes contaminated in the mononuclear cell fraction were lyzed by treatment with an ammonium chloride buffer solution (0.83% NH.sub.4Cl-Tris HCl, 20 mM, pH 6.8) at room temperature for two minutes. After the mononuclear cells were washed with PBS-FCS, ten milligrams of human IgG was added thereto and the mixture was allowed to stand on ice for ten minutes. Then, the cells were further washed with PBS-FCS. Biotinylated antibodies against the antigens specific to the human differentiated blood cells, that is, the antibodies against CD2, CD11c (purified from ATCC hybridoma), CD19 (Pharmingen), CD15, and CD41 (Leinco Technologies Inc.), and Glycophorin A (Cosmo Bio) were added thereto, and the mixture was allowed to stand on ice for 20 min. After washing with PBS-FCS, the cells were suspended in one milliliter of PBS containing 5% FCS, 10 mM EDTA, and 0.05% NaN.sub.3 (PBS-FCS-EDTA-NaN.sub.3). Streptavidin-bound magnetic beads (BioMag. Per Septive Diagnostics) were added thereto, and the mixture was allowed to stand on ice for 40 min. The differentiated blood cells which expressed differentiation antigens were removed using a magnetic separator (Dynal MPC-1 Dynal). An FITC-labeled anti-CD34 antibody (Immunotech S.A., Marseilles, France) was added to the remaining differentiated blood cell antigen-negative cell fraction. After incubation on ice for 20 min., a CD34-positive fraction was recovered using a cell sorter. This cell population was defined as a hematopoietic stem cell population derived from the human cord blood.

3) Co-Culture of the Human Hematopoietic Stem Cells and AGM-s3 Subclone

[0141] After 13 kinds of AGM-s3 subclones and stromal cell line MS-5 derived from the mouse bone marrow were each seeded in a 24-well culture dish (Falcon) at 1.times.10.sup.4 cells/well, and cells were cultured in one milliliter of MEM.alpha. medium containing 10% FCS and allowed to grow until the cells covered all over the bottom surfaces of the wells. CD34-positive hematopoietic stem cells derived from the human cord blood were placed on the above described stromal cells at 500 cells/well, and co-cultured in one milliliter of MEM.alpha. medium containing 10% FCS. One week after the start of the co-culture, one milliliter of the same medium was further added. Two weeks after the start of the co-culture, the stromal cells and the human blood cells were trypsinized (0.05% trypsin in PBS containing 0.5 mM EDTA (GIBCO BRL) at 37.degree. C.; standing for two to five min.) to simultaneously separate them from the culture dish. An activity to support the hematopoietic stem cells was determined with a clonogenic assay.

4) Assessment of Proliferation Statuses of the Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0142] The cells which proliferated in the above described co-culture system were appropriately diluted, and subjected to one milliliter of methylcellulose culture system to be analyzed. The analysis using the methylcellulose culture system was performed using a 6-well culture dish (Falcon) in MethoCult H4230 (Stem Cell Technologies Inc.) to which 10 ng/ml of human SCF, human IL-3, human IL-6, human G-CSF, and human TPO, and 2 IU/ml of EPO were added. All of a variety of the above described hematopoietic factors were recombinants and pure. After two-week culture, developed colonies were observed under a microscope to count numbers of CFU-GM (granulocyte-macrophage colony-forming unit), BFU-E (erythroid burst forming unit), and CFU-E mix (erythrocyte mixed colony-forming unit).

[0143] FIG. 1 shows the result of two-week co-culture of the CD34-positive hematopoietic stem cells and the AGM-s3 subclone A9, A7, or D11. As a result of the co-culture, A9 and D11 subclones among 13 kinds of AGM-s3 subclones supported proliferation of all three series of CFU-GM, BFU-E, and CFU-E mix. Especially, although BFU-E and CFU-E mix, that is, the progenitor cells of erythrocytes were hardly to be supported in usual, their proliferations were observed in the co-culture system with A9 or D11 cells. The results showed that proliferation or maintenance of the hematopoietic stem cells or the hematopoietic progenitor cells occurred in the co-culture with A9 or D11 cells and the progenitor cells of the erythrocyte were continuously supplied. In contrast, although cellular morphology of A7 was similar to that of A9, A7 did not support CFU-GM, BFU-E, and CFU-E mix.

5) Comparison of an Activity to Support the Human Hematopoietic Stem Cells Between A9 and a Stromal Cell Line OP9 Derived from Mouse Fetus

[0144] Comparison of an activity to support the CD34-positive hematopoietic stem cells derived from the human cord blood between AGM-s3 subclones A9 and A7, and a stromal cell line OP9 derived from mouse fetus (RCB1124, the Cell Development Bank of RIKEN) were performed with CFU-GM, BFU-E, CFU-E and CFU-E mix as indexes, using the above described determination system. FIG. 2 shows the result of the two-week co-culture. In the A7 cell culture system, CFU-GM, BFU-E, and CFU-E were significantly decreased and CFU-E mix was completely disappeared. In contrast, with OP9 cells, a variety of blood cell progenitor cells including CFU-E mix were supported, although the supporting ability was less than that of A9 cells. Therefore, it has been found that OP9 cells possess the activity to support the hematopoietic stem cells.

(2) Assessment of Activity to Support the Hematopoietic Stem Cells in a Variety of Cell Lines

[0145] The above described stromal cell lines (AGM-s3-A9, AGM-s3-A7, and AGM-s3-G1), 3T3Swiss (ATCC), OP9, and NIH3T3 (ATCC) were seeded in a 24-well culture dish (Falcon) at 5.times.10.sup.4 cells/well. The cell lines were cultured in MEM.alpha. medium (GIBCO BRL) containing inactivated 10% FCS (bovine fetal serum, Hyclone) for one day and allowed to proliferate until the cells covered all over the bottom surfaces of the wells. Then, the medium was replaced to one milliliter of fresh medium, thirty cells of the mouse hematopoietic stem cells (derived from C57BL/6-Ly5.1) obtained in the above (II) were placed on this cell layer, and co-culture was started.

[0146] On seventh day of the cultivation, the cells were trypsinized (0.05% trypsin in PBS containing 0.5 mM EDTA (GIBCO BRL) at 37.degree. C. for two to five minutes) to separate and recover all the cells on the culture dish. The recovered whole cells of each cell line and 200,000 cells of whole bone marrow cells (derived from C57BL/6-Ly5.2 mouse, Charles River) were transplanted into C57BL/6-Ly5.2 mice (eight weeks age and male, Charles River) irradiated with X-ray at 8.5 Gy through the tail vein. After the transplantation, peripheral blood was collected from orbit at intervals, and the ratio in number of cells derived from the C57BL/6-Ly5.1 prep mouse was determined with FACS. The peripheral blood was analyzed according to the usual method (S. Kouzu, Fundamental techniques for immunology, YODOSHA, 1995). Three hundreds and fifty .mu.L of distilled water was added to 50 .mu.L of the peripheral blood, and the mixture was allowed to stand for 30 seconds so as to lyze the erythrocytes. Then, PBS at twice concentrations was added and the mixture was centrifuged to recover white blood cells. After the cells were washed once using the staining buffer (PBS containing 5% FCS and 0.05% NaN.sub.3), anti-CD16 antibody, anti-Ly5.1 (CD45.1) antibody labeled with FITC, anti-Gr-1 and anti-CD11c antibodies labeled with phycoerythrin, and anti-CD45R (B220) and anti-CD90 (Thy1) antibodies labeled with allophycocyanin (all of these were purchased from Pharmingen) were added. After these cells were allowed to stand for reaction in the ice bath for 30 minutes, they were washed with the staining buffer and FACS analysis was performed.

[0147] Change in the number of cells capable of reconstitution during the hematopoietic stem cell culture was determined by calculating the proportions of Ly5.1-positive cells in the Gr-1- or CD11c-positive cells (myeloid cells) and Ly5.1-positive cells in the CD90- or CD45R-positive cells (lymphoid cells) in the peripheral blood at intervals after transplantation.

[0148] FIG. 3 shows the results. When the cells were co-cultured with AGM-s3-A9 cells, OP9 cells, or 3T3Swiss cells, high chimerism of donor cells were maintained after the transplantation. Therefore, these stromal cells were considered to have a high activity to support the hematopoietic stem cells. In contrast, when the cells were co-cultured with AGM-s3-A7 cells, AGM-s3-G1 cells, or NIH3T3 cells, high chimerism derived from the transplanted cells was not observed. Therefore, these stromal cells were low in an activity to support the hematopoietic stem cells or the hematopoietic progenitor cells.

(IV) Identification of Sequences of Genes which Specifically Express in Hematopoietic Stem Cell-Supporting Cells

[0149] AGM-s3-A9 cells, AGM-s3-A7 cells and OP9 cells were each dissolved in 20 mL of ISOGEN (Nippon gene, Japan) and total RNAs were prepared according to the attachment. Messenger RNAs were prepared from one milligram of the total RNAs according to the protocol of the mRNA purification kit (Amersham Pharmacia, U.S.A.). cDNAs were synthesized from the mRNAs and cDNA libraries (hereinafter, also called as AGM-s3-A9 cDNA, AGM-s3-A7 cDNA and OP9 cDNA, respectively) were constructed using pSPORT1 (GIBCO Lifetech, U.S.A.). A clone harboring a cDNA fragment which highly expresses specifically to AGM-s3-A9 cells or OP9 cells compared with AGM-s3-A7 cells was obtained from the libraries with SBH method (Hyseq, U.S.A.). A nucleotide sequence of the obtained clone was determined using ABI377 DNA sequencer (Perkin Elmer, U.S.A.).

[0150] As a result, it has been found that expression of genes comprising nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or parts thereof in AGM-s3-A9 or OP9 cells is higher than that in AGM-s3-A7 cells. These genes were named as SCR-2, SCR-3, SCR-4, SCR-5, SCR-6, SCR-7 and SCR-8, respectively.

Example 2 Cloning of SCR-2 and Activity Determination

[0151] By searching GenBank database for the nucleotide sequence shown in SEQ ID NO: 1 with BLAST, it has been found that SCR-2 is the same gene as a mouse gene, Mus musculus glypican-1 (Gpc-1) of an accession number AF185613. The nucleotide sequence of ORF (Open Reading Frame) of SCR-2 and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 8. Only the amino acid sequence is shown in SEQ ID NO: 9.

[0152] The human nucleotide sequence of Gpc-1 is recorded in GenBank database under an accession number AX020122. The nucleotide sequence of ORF of AX020122 and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 10. Only the amino acid sequence is shown in SEQ ID NO: 11.

[0153] Determination of the activity to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-2

[0154] Based on the nucleotide sequence of SCR-2 ORF, SCR-2Fsal1 and SCR-2Reco primers having the following nucleotide sequences were prepared, and PCR was performed using OP9 cDNA as a template.

TABLE-US-00001 SCR-2Fsal (SEQ ID NO: 30) CCGGTCGACCACCatggaactccggacccgaggctgg SCR-2Reco (SEQ ID NO: 31) CCGAATTCttaccgccacctgggcctggctgc

[0155] An amplified fragment was digested with restriction enzymes EcoRI and SalI. After electrophoresis, a DNA fragment was purified using JETSORB (Genomed, Germany). The purified DNA fragment was ligated with pMX-IRES-GFP vector digested with EcoRI and XhoI (gift form Professor T. Kitamura, TOKYO UNIV. INST. OF MEDICAL SCIENCE, Japan). The pMX-IRES-GFP vector is a plasmid obtained by inserting sequences encoding IRES (Internal Ribosome Entry Site) and GFP (Green Fluorescence Protein) into the retrovirus vector pMX. IRES (Internal Ribosome Entry Site) enables ribosome to access to the middle of the mRNA. Therefore, two genes can be expressed from one mRNA by ligation of upward and downward genes separated by IRES in one transcription unit during the construction of an expression vector. With respect to the above-described plasmid, SCR-2 cDNA was inserted in the upward site and GFP (Green Fluorescence Protein) was inserted in the downward site. Thus, the expression of SCR-2 could be monitored by detecting the expression status of GFP using FACS.

[0156] The obtained recombinant vector was introduced into E. coli DH5a, and was seeded on LB agar medium containing 100 .mu.g/ml of ampicillin, so that independent colonies were formed. After the isolated colony was cultured in 100 mL of LB medium containing 100 .mu.g/ml of ampicillin, plasmid was purified using QIAGENtip100 (QIAGEN, U.S.A.). The sequence of the inserted gene was determined using a conventional method, so that the sequence was confirmed to be identical to the nucleotide sequence of SCR-2 ORF.

(2) Preparation of Stromal Cells Highly Expressing SCR-2

[0157] BOSC23 cells were seeded on a collagen type I-coated 60-mm dish (Asahi technoglass) at 2.times.10.sup.6 cells/dish, and cultured in DMEM medium containing 10% FCS at 37.degree. C., under an atmosphere of 5% CO.sub.2, and at a humidity of 100%. Twelve to 18 hours after the start of the culture, the medium was replaced by two milliliters of OPTI MEM medium (GIBCO BRL).

[0158] About 3 .mu.g of plasmid obtained by inserting SCR-2 into the above described pMX-IRES-GFP was added to 18 .mu.l of LIPOFECTAMINE Reagent (GIBCO BRL) diluted with 100 .mu.l of OPTI MEM medium, and the mixture was allowed to stand at room temperature for 30 min. The prepared DNA solution was added to the prepared BOSC23 cell culture solution. After about five hours, two milliliters of DMEM medium containing 20% FCS (GIBCO BRL) was added.

[0159] After about 24 hours, the medium was replaced by 4 ml of DMEM containing 10% FCS. Further, after about 48 hours, the culture medium was harvested. After the culture medium was filtrated through 0.45-.mu.m filter, the filtrate was centrifuged at 1,200 g for 16 hours and the supernatant was removed to obtain the virus precipitation.

[0160] AGM-s3-A7 or AGM-s3-A9 cells were cultured in one milliliter of MEM.alpha. medium containing 10% FCS (GIBCO BRL) on a 24-well culture dish (FALCON) at 1.times.10.sup.4 cells/well. After 12 to 18 hours, the virus precipitation was suspended in one milliliter of MEM.alpha. medium containing 10% FCS, and the stromal cell culture medium was replaced by the virus suspension. Next, POLYBRENE (Sigma, SEQUA-BRENE) was added to be 10 .mu.g/ml. After the culture dish was centrifuged at 700 g for 45 minutes, the cells were cultured at 37.degree. C., under an atmosphere of 5% CO.sub.2, and at a humidity of 100%. After 48 hours, the medium was replaced by one milliliter of MEM.alpha. medium containing 10% FCS. After 24 hours, the cells were subcultured on a 6-well culture dish (FALCON) and cultured in three milliliters of MEM.alpha. medium containing 10% FCS. Forty-eight hours after the subculturing, GFP expression in the stromal cells was detected using a cell sorter (FACS Vantage, Becton Dickinson) to indirectly confirm that not less than 80% of cells expressed SCR-2.

[0161] Also, the same procedures were repeated by using pMX-IRES-GFP vector instead of the plasmid obtained by inserting SCR-2 into PMX-IRES-GFP to prepare stromal cells into which a control vector was introduced.

(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells Highly Expressing SCR-2, and Determination of Proliferation Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0162] In the same manner as described in (III) (1) 3) to 4) of Example 1, AGM-s3-A9 or AGM-s3-A7 cells in which SCR-2 was highly expressed through retrovirus, AGM-s3-A9 or AGM-s3-A7 cells into which a control vector was introduced, or AGM-s3-A9 or AGM-s3-A7 cells were co-cultured with CD34-positive hematopoietic stem cells derived from human cord blood, and proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells are determined.

[0163] FIG. 4 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A9 cells in which SCR-2 was highly expressed (A9/SCR-2), AGM-S3-A9 cells into which a control vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks. Also, FIG. 5 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A7 cells in which SCR-2 was highly expressed, AGM-S3-A7 cells into which a control vector was introduced or AGM-S3-A7 cells for two weeks. As a result, by the co-culture with AGM-S3-A9 cells in which SCR-2 was highly expressed or AGM-S3-A7 cells in which SCR-2 was highly expressed, increases of BFU-E and CFU-C were observed. Therefore, it has been revealed that the activity to support hematopoietic stem cells or hematopoietic progenitor cells, of AGM-S3-A9 or AGM-S3-A7 increases by allowing SCR-2 to be highly expressed. From the results, it has been revealed that a gene product of SCR-2 has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Example 3 Cloning of SCR-3 and Activity Determination

[0164] By searching GenBank database for the nucleotide sequence shown in SEQ ID NO: 2 with BLAST, it has been found that SCR-3 is the same gene as mouse genes, Mus musculus chemokine MMRP2 mRNA of an accession number U15209, Mus musculus C10-like chemokine mRNA of U19482 and mouse macrophage inflammatory protein-1gamma mRNA of U49513. The nucleotide sequence of SCR-3 ORF and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 12. Only the amino acid sequence is shown in SEQ ID NO: 13.

[0165] Determination of the activity of SCR-3 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-3

[0166] Based on the nucleotide sequence of SCR-3 ORF, SCR-3FxhoI and SCR-3Reco primers having the following nucleotide sequences were prepared, and PCR was performed using AGM-s3-A9 cDNA as a template. An amplified fragment was inserted to the retrovirus vector PMX-IRES-GFP in the same manner as described in (1) of Example 2.

TABLE-US-00002 SCR-3FxhoI (SEQ ID NO: 32) ccgCTCGAGccaccATGAAGCCTTTTCATACTGCC SCR-3Reco (SEQ ID NO: 33) tccGAATTCttattgtttgtaggtccgtgg

(2) Preparation of Stromal Cells Highly Expressing SCR-3

[0167] AGM-s3-A7 cells in which SCR-3 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Determination of Activity to Support Hematopoietic Stem Cells of Stromal Cells in which SCR-3 is Highly Expressed

[0168] In the same manner as described in (III) (2) of Example 1, determination of the activity to support hematopoietic stem cells was performed except that AGM-S3-A7 cells, AGM-S3-A7 cells in which SCR-3 was highly expressed through retrovirus, and AGM-S3-A7 cells into which a control vector was introduced were seeded in a 24-well culture dish (Falcon) at 1.times.10.sup.5 cells/well.

[0169] The results are shown in FIG. 6. Hematopoietic cells co-cultured with AGM-s3-A7 cells in which SCR-3 was highly expressed (A7/SCR-3) showed high chimerism in recipient individuals after the transplantation compared with the parent cell lines or hematopoietic cells co-cultured with the cells into which a control vector was introduced. The high chimerism was observed in myeloid and lymphoid cells two months after the transplantation. Therefore, it is revealed that hematopoietic stem cells and hematopoietic progenitor cells which can reconstitute the hematopoietic system in bodies of irradiated mice have maintained and amplified superiorly to the co-culture with cells into which SCR-3 is not introduced, during the co-culture period. From the results, it is revealed that an activity of stromal cells to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells is increased by high expression of SCR-3. Therefore, it is revealed that a gene product of SCR-3 has an activity to affect hematopoietic stem cells or hematopoietic progenitor cells to support survival or proliferation thereof or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Example 4 Cloning of SCR-4 and Activity Determination

[0170] By searching GenBank database for the nucleotide sequence shown in SEQ ID NO: 3 with BLAST, it has been found that SCR-4 has a high homology to Homo sapiens clone 25077 mRNA of an accession number AF131820, and that SCR-4 is a mouse ortholog. This sequence is described in WO 00/66784.

[0171] The nucleotide sequence of ORF of AF131820 and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 16. Only the amino acid sequence is shown in SEQ ID NO: 17.

[0172] The nucleotide sequence of ORF of SCR-4 and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 14. Only the amino acid sequence is shown in SEQ ID NO: 15.

[0173] Determination of the activity of SCR-4 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Human SCR-4

[0174] From 3 .mu.g of mRNA derived from fetal liver (CLONETEC, U.S.A.), cDNA was synthesized by using oligo-dT primer and reverse transcriptase (SuperscriptII, GIBCO-BRL). Using the cDNA as a template, the ORF region of human SCR-4 was amplified by PCR with HSCR-4FxhoI and HSCR-4RecoRV primers having the following nucleotide sequences. An amplified fragment was digested with XhoI and inserted to the retrovirus vector pMX-IRES-GFP in the same manner as described in (1) of Example 2. For the insertion, the pMX-IRES-GFP was digested with a restriction enzyme EcoRI, blunt-ended with KOD DNA synthase (TOYOBO, Japan) and digested with a restriction enzyme XhoI.

TABLE-US-00003 HSCR-4FxhoI (SEQ ID NO: 34) CCGCTCGAGCCACCatgttggctgcaaggctggtgt HSCR-4RecoRV (SEQ ID NO: 35) CCGGATATCtcatttctttctgttgcctcca

(2) Preparation of Stromal Cells Highly Expressing Human SCR-4

[0175] AGM-s3-A9 cells in which human SCR-4 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Co-culture of Human Hematopoietic Stem Cells and Stromal Cells Highly Expressing Human SCR-4, and Determination of Proliferation Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0176] In the same manner as described in (III) (1) 3) to 4) of Example 1, AGM-s3-A9 cells in which SCR-4 was highly expressed through retrovirus, AGM-s3-A9 cells into which a control vector was introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive hematopoietic stem cells derived from human cord blood, and proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells are determined.

[0177] FIG. 6 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A9 cells in which human SCR-4 was highly expressed, AGM-S3-A9 cells into which a control vector was introduced or AGM-S3-A9 cells for two weeks. As a result, the co-culture with AGM-S3-A9 cells in which human SCR-4 was highly expressed, increases of BFU-E and CFU-C were observed. Therefore, it has been revealed that the activity to support hematopoietic stem cells or hematopoietic progenitor cells, of AGM-S3-A9 increases by allowing human SCR-4 to be highly expressed. From the results, it has been revealed that human SCR-4 has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells or an activity to affect stromal cells to impart a hematopoietic cell-supporting activity to the stromal cells.

Example 5 Cloning of SCR-5 and Activity Determination

[0178] In the nucleotide sequence of SEQ ID NO: 4 obtained by the SBH analysis, the presence of ORF was predicted. The nucleotide sequence of ORF and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 18. Only the amino acid sequence is shown in SEQ ID NO: 19.

[0179] By searching GenBank database for the nucleotide sequence of SEQ ID NO: 18 with BLAST, it has been found that SCR-5 has a high homology with Homo sapiens esophageal cancer related gene 4 protein (ECRG4) mRNA of an accession number AF325503, and that SCR-5 is a mouse ortholog of AF325503. The nucleotide sequence of ORF of AF325503 and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 20. Only the amino acid sequence is shown in SEQ ID NO: 21.

[0180] Determination of the activity of SCR-5 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-5

[0181] Based on the nucleotide sequence of SCR-5 ORF, SCR-5FxhoI and SCR-5Rblunt primers having the following nucleotide sequences were prepared for retrovirus cloning, and PCR was performed using DNA having the nucleotide sequence shown in SEQ ID NO: 23 as a template. An amplified fragment was digested with a restriction enzyme XhoI and inserted to the retrovirus vector pMX-IRES-GFP in the same manner as described in (1) of Example 2. For the insertion, the pMX-IRES-GFP was digested with a restriction enzyme EcoRI, blunt-ended with KOD DNA synthase (TOYOBO, Japan) and digested with a restriction enzyme XhoI.

TABLE-US-00004 SCR-5FxhoI ccgCTCGAGccaccatgagcacctcgtctgcgcg (SEQ ID NO: 36) SCR-5Rblunt tccGTTAACttaatagtcatcatagttca (SEQ ID NO: 37)

(2) Preparation of Stromal Cells Highly Expressing SCR-5

[0182] AGM-s3-A7 cells in which SCR-5 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Determination of Activity to Support Hematopoietic Stem Cells of Stromal Cells in which SCR-5 is Highly Expressed

[0183] In the same manner as described in (3) of Example 3, determination of the activity to support hematopoietic stem cells was performed.

[0184] The results are shown in FIG. 8. Hematopoietic cells co-cultured with AGM-s3-A7 cells in which SCR-5 was highly expressed (A7/SCR-5) showed high chimerism in recipient individuals after the transplantation compared with the parent cell lines or hematopoietic cells co-cultured with the cells into which a control vector was introduced. The high chimerism was observed in myeloid and lymphoid cells two months after the transplantation. Therefore, it is revealed that hematopoietic stem cells and hematopoietic progenitor cells which can reconstitute the hematopoietic system in bodies of irradiated mice have maintained and amplified superiorly to the co-culture with cells into which SCR-5 is not introduced, during the co-culture period. From the results, it is revealed that an activity of stromal cells to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells is increased by high expression of SCR-5. Therefore, it is revealed that a gene product of SCR-5 has an activity to affect hematopoietic stem cells or hematopoietic progenitor cells to support survival or proliferation thereof or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Example 6 Cloning of SCR-6 and Activity Determination

[0185] Based on the nucleotide sequence of SEQ ID NO: 5, a probe was prepared and AGM-s3-A9 cDNA was screened by hybridization to obtain a gene containing ORF of mouse SCR-6.

[0186] AGM-s3-A9 cells (1.4.times.10.sup.8 cells) were dissolved in 20 mL of ISOGEN (Nippon gene, Japan) and total RNAs were prepared according to the attachment. Messenger RNAs were prepared from one milligram of the total RNAs according to the protocol of the mRNA purification kit (Amersham Pharmacia, U.S.A.). By using SMART cDNA library construction kit (CLONTECH, U.S.A.), cDNA libraries divided to 15 fractions were prepared from the 2 .mu.g of the prepared mRNAs according to the attachment. The libraries contained about 400,000 of independent clones in total. For each fraction, PCR was performed under the following conditions to identify a fraction containing SCR-6 cDNA.

[0187] Based on the sequence of a partial fragment of the mouse SCR-6 gene, the following primers were prepared, and PCR was performed with 35 cycles of 94.degree. C., 30 seconds, 55.degree. C., 30 seconds and 72.degree. C., 1 minute, by using each fraction of AGM-s3-A9 cDNA libraries as a template.

TABLE-US-00005 SCR-6F AGCTCATTACTGTATATTTA (SEQ ID NO: 22; 1971-1990) (SEQ ID NO: 38) SCR-6R GCTATATTTCATAAGTCATC (SEQ ID NO: 22; 2330-2349) (SEQ ID NO: 39)

[0188] The PCR product was subjected to 2% agarose gel electrophoresis and a fraction from which the PCR product having the expected size was obtained was identified. For each of two fractions among the positive fractions, 50,000 plaques were seeded on two 15-cm petri dishes and incubated 37.degree. C. for 10 hours. Then, plaques of each petri dish were replicated to a sheet of Biodyne nylon filter (Pall, U.S.A.). The replicated nylon filter was subjected to DNA fixation treatment according to the attachment, and screening with .sup.32P-labeled DNA probe was performed.

[0189] The probe was prepared as follows. PCR was performed with 35 cycles of 94.degree. C., 30 seconds, 55.degree. C., 30 seconds and 72.degree. C., 1 minute, by using SCR-6F and SCR-6R and the plasmid containing a partial fragment of the mouse SCR-6 gene as a template. The PCR product was subjected to 2% agarose gel electrophoresis and the amplified fragment was purified by JETSORB. By using 25 ng of the obtained PCR fragment, .sup.32P-labeled DNA probe was prepared with Megaprime labeling kit (Amersham Pharmacia, U.S.A.).

[0190] Hybridization and washing were performed with ExpressHybSolution (CLONETECH, U.S.A.) according to the attachment. An X-ray film was exposed to the filter and developed with a Fuji film auto developer to analyze the result. A plaque at a position corresponding to the resultant strongly exposed portion was scraped from the petri dish, and seeded again so that about 200 of plaques should appear on 10-cm petri dish. Screening was again performed according to the above-mentioned method to isolate a single plaque. The obtained clone was transfected to E. coli strain BM25.8 according to the attachment of SMART cDNA library construction kit, and the transfected cells were cultured on LB agar medium containing 50 .mu.g/ml ampicilin to form colonies. A single colony of the transfected E. coli was inoculated to 3 ml of LB medium containing 50 .mu.g/ml ampicilin and cultured at 30.degree. C. overnight. Plasmid was extracted with RPM kit (BIO101, U.S.A.) to obtain about 10 mg of plasmid.

[0191] Sequencing the both ends of the inserted fragment with an ABI377 DNA sequencer by using .lamda.Trip1Ex5'LD-Insert Screening Amplimer (CTCGGGAAGCGCGCCATTGTGTTGGT (SEQ ID NO: 40); CLONTECH, U.S.A.) revealed that it included cDNA containing the nucleotide sequence from nucleotide 1 of SEQ ID NO: 5. The full-length nucleotide sequence was also determined with the ABI377 DNA sequencer. The nucleotide sequence and the amino acid sequence deduced from a nucleotide sequence predicted as ORF in the nucleotide sequence are shown in SEQ ID NO: 22. Only the amino acid sequence is shown in SEQ ID NO: 23.

[0192] Determination of the activity of SCR-6 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-6

[0193] Based on the nucleotide sequence of SCR-6 ORF, SCR-6FxhoI and SCR-6Reco primers having the following sequences were prepared for retrovirus cloning, and PCR was performed by using DNA having the nucleotide sequence shown in SEQ ID NO: 22 as a template. An amplified fragment was inserted to the retrovirus vector pMX-IRES-GFP in the same manner as described in (1) of Example 2.

TABLE-US-00006 SCR-6FxhoI ccgctcgagccaccATGCGTTTTTGCCTCTTCTC (SEQ ID NO: 41) SCR-6Reco cggaattcTTATTGGTTCACTCTGTCTG (SEQ ID NO: 42)

(2) Preparation of Stromal Cells Highly Expressing SCR-6

[0194] AGM-s3-A9 cells in which SCR-6 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells Highly Expressing SCR-6, and Determination of Proliferation Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0195] In the same manner as described in (III) (1) 3) to 4) of Example 1, AGM-s3-A9 cells in which SCR-6 was highly expressed through retrovirus, AGM-s3-A9 cells into which a control vector was introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive hematopoietic stem cells derived from human cord blood, and proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells are determined.

[0196] FIG. 9 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A9 cells in which SCR-6 was highly expressed (A9/SCR-9), AGM-S3-A9 cells into which a control vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks. As a result, the co-culture with AGM-S3-A9 cells in which SCR-6 was highly expressed, increases of BFU-E and CFU-C were observed. Therefore, it has been revealed that the activity to support hematopoietic stem cells or hematopoietic progenitor cells, of AGM-S3-A9 increases by allowing SCR-6 to be highly expressed. From the results, it has been revealed that the gene product of SCR-6 has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Example 7 Cloning of SCR-7 and Activity Determination

[0197] In the nucleotide sequence of SEQ ID NO: 6 obtained by the SBH analysis, the presence of ORF was predicted. The nucleotide sequence of ORF and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 24. Only the amino acid sequence is shown in SEQ ID NO: 25.

[0198] Determination of the activity of SCR-7 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-7

[0199] Based on the nucleotide sequence of SCR-7 ORF, SCR-7FsalI and SCR-7Reco primers having the following nucleotide sequences were prepared for retrovirus cloning, and PCR was performed using DNA having the nucleotide sequence shown in SEQ ID NO: 24 as a template. An amplified fragment was inserted to the retrovirus vector pMX-IRES-GFP in the same manner as described in (1) of Example 2.

TABLE-US-00007 SCR-7FSalI acgcgtcgacccaccATGCCCCGCTACGAGTTG (SEQ ID NO: 43) SCR-7Reco attGAATTCTCACTTCTTCCTCCTCTTTG (SEQ ID NO: 44)

(2) Preparation of Stromal Cells Highly Expressing SCR-7

[0200] AGM-s3-A9 cells in which SCR-7 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells Highly Expressing SCR-7, and Determination of Proliferation Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0201] In the same manner as described in (III) (1) 3) to 4) of Example 1, AGM-s3-A9 cells in which SCR-7 was highly expressed through retrovirus, AGM-s3-A9 cells into which a control vector was introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive hematopoietic stem cells derived from human cord blood, and proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells are determined.

[0202] FIG. 10 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A9 cells in which SCR-7 was highly expressed (A9/SCR-7), AGM-S3-A9 cells into which a control vector was introduced (A9/pMXIG) or AGM-S3-A9 cells (A9) for two weeks. As a result, the co-culture with AGM-S3-A9 cells in which SCR-7 was highly expressed, increases of BFU-E and CFU-C were observed. Therefore, it has been revealed that the activity to support hematopoietic stem cells or hematopoietic progenitor cells, of AGM-S3-A9 increases by allowing SCR-7 to be highly expressed. From the results, it has been revealed that the gene product of SCR-7 has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Example 8 Cloning of SCR-8 and Activity Determination

[0203] By searching GenBank database for the nucleotide sequence shown in SEQ ID NO: 7 with BLAST, it has been found that SCR-8 is the same gene as Mus musculus mRNA for ADAM23 of an accession number AB009673. The nucleotide sequence of SCR-8 ORF and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 26. Only the amino acid sequence is shown in SEQ ID NO: 27.

[0204] Also, the sequence encoding Human MDC3 protein [Homo sapiens] described by JP 11155574-A has a homology of not less than 90% with SCR-8 and, therefore, is a human ortholog of SCR-8. The nucleotide sequence of this ORF and the amino acid sequence deduced from the nucleotide sequence are shown in SEQ ID NO: 28. Only the amino acid sequence is shown in SEQ ID NO: 29.

[0205] Determination of the activity of SCR-8 to support the hematopoietic stem cells or hematopoietic progenitor cells was performed as follows.

(1) Construction of Retrovirus Vector for Expression of Mouse SCR-8

[0206] Based on the nucleotide sequence of SCR-8 ORF, SCR-8FxhoI and SCR-8Reco primers having the following nucleotide sequences were prepared, and PCR was performed using AGM-s3-A9 cDNA as a template. An amplified fragment was inserted to the retrovirus vector pMX-IRES-GFP in the same manner as described in (1) of Example 2.

TABLE-US-00008 SCR-8FxhoI (SEQ ID NO: 45) ccgctcgagccaccATGAAGCCGCCCGGCAGCATC SCR-8Reco (SEQ ID NO: 46) cggaattcTCAGATGGGGCCTTGCTGAGT

(2) Preparation of Stromal Cells Highly Expressing SCR-8

[0207] AGM-s3-A9 cells in which SCR-8 was highly expressed were prepared by using the above retrovirus vector in the same manner as (2) of Example 2.

(3) Co-Culture of Human Hematopoietic Stem Cells and Stromal Cells Highly Expressing SCR-8, and Determination of Proliferation Statuses of Hematopoietic Stem Cells and Hematopoietic Progenitor Cells by Clonogenic Assay

[0208] In the same manner as described in (III) (1) 3) to 4) of Example 1, AGM-s3-A9 cells in which SCR-8 was highly expressed through retrovirus, AGM-s3-A9 cells into which a control vector was introduced, or AGM-s3-A9 cells were co-cultured with CD34-positive hematopoietic stem cells derived from human cord blood, and proliferation statuses of hematopoietic stem cells and hematopoietic progenitor cells are determined.

[0209] FIG. 11 shows results when the CD34-positive hematopoietic stem cells were co-cultured with AGM-S3-A9 cells in which SCR-8 was highly expressed, AGM-S3-A9 cells into which a control vector was introduced or AGM-S3-A9 cells for two weeks. As a result, the co-culture with AGM-S3-A9 cells in which SCR-8 was highly expressed, increases of BFU-E and CFU-C were observed. Therefore, it has been revealed that the activity to support hematopoietic stem cells or hematopoietic progenitor cells, of AGM-S3-A9 increases by allowing SCR-8 to be highly expressed. From the results, it has been revealed that the gene product of SCR-8 has an activity to support survival or proliferation of hematopoietic stem cells or hematopoietic progenitor cells or an activity to affect stromal cells to enhance a hematopoietic cell-supporting activity of the stromal cells or impart the activity to the stromal cells.

Sequence CWU 1

1

461343DNAMus musculus 1cctatggcgg caacgacgtg gacttccagg atgctagtga tgacggcagt ggctccggca 60gcggtggcgg atgcccagat gacacctgtg gccggagggt cagcaagaag agttccagct 120cccggacccc cttgacccat gccctccccg gcctgtcaga acaggaggga cagaagacct 180cagctgccac ctgcccagag ccccacagct tcttcctgct cttcctcgtc accttggtcc 240ttgcggcagc caggcccagg tggcggtaac tgccccctat cccagacagt aactctgagt 300gctgcggcag ggtgcatgga ggggtccctc cctccttgag tcg 3432546DNAMus musculus 2tgtaccccag ggacttcctg atcctcttac atgtataaat agcaagaccg ggccaggaac 60agcaagcagt ctgaaggcca gctgggtctg cccactaaga agatgaagcc ttttcatact 120gccctctcct tcctcattct tacaactgct cttggaatct gggcccagat cacacatgca 180acagagacaa aagaagtcca gagcagtctg aaggcacagc aagggcttga aattgaaatg 240tttcacatgg gctttcaaga ctcttcagat tgctgcctgt cctataactc acggattcag 300tgttcaagat ttataggtta ttttcccacc agtggtgggt gtaccaggcc gggcatcatc 360tttatcagca agagggggtt ccaggtctgt gccaacccca gtgatcggag agttcagaga 420tgcattgaaa gattggagca aaactcacaa ccacggacct acaaacaata acatttgctt 480gaagagaagg gtgtgaactg ccagctactt tctttggtct tccccagtga ccacctaagt 540ggctct 54631223DNAMus musculus 3gtgacccgga agggagcccc gtggtagagg tgaccggagc tgagcatttc agatctgctt 60agtaaaccgg tgtatcgccc accatgttgg ctgcaaggct tgtgtgtctc cggacactac 120cttccagggt tttccagccc actttcatca ccaaggcctc tccacttgtg aagaattcca 180tcacaaagaa ccaatggctc gtaacaccca gcagggaata tgctaccaag acaagaatta 240ggactcaccg tgggaaaact ggacaagaac tgaaagaggc agccttggaa ccatcaatgg 300aaaaaatctt taaaatcgat caaatgggaa ggtggtttgt tgctggagga gcagctgttg 360gtcttggagc gctctgctac tatggcttgg gaatgtctaa tgagattgga gctatcgaaa 420aggctgtaat ttggcctcag tatgtaaagg atagaattca ttctacttac atgtacttag 480caggaaggta ttgtttaaca gctttgtctg ccttggcagt agccagaaca cctgctctca 540tgaacttcat gatgacaggc tcttgggtga caattggtgc gacctttgca gccatgattg 600gagctggaat gcttgtacac tcaatatcat atgagcagag cccaggccca aagcatctgg 660cttggatgct gcattctggt gtgatgggtg cagttgtggc tcctctgacg atcttagggg 720ggcctcttct cctgagagcc gcatggtaca ccgctggtat tgtgggaggc ctctctactg 780tggccatgtg tgcgcctagt gagaagtttc tgaacatggg agcacccctg ggagtgggcc 840tgggtcttgt ctttgcgtct tctctggggt ctatgtttct tccccctacc tctgtggctg 900gtgccactct gtactcagtg gcaatgtatg gtggattagt tcttttcagc atgttccttc 960tgtatgatac tcagaaagta atcaaacgtg cagaaataac acccatgtat ggagctcaaa 1020agtatgatcc catcaattcg atgttgacaa tctacatgga tacattaaat atatttatgc 1080gagttgcaac tatgctagca actggaagca acagaaagaa atgaagtaac cgcttgtgat 1140gtctccgctc actgatgtct tgcttgttta ataggagcag atagtcatta cagtttgcat 1200cagcagaatt cccgcgcggc cgc 12234839DNAMus musculus 4gctgtgcctg gcatcagtct tgccctctcc cctttggcca cgcggccctt ctcagcgatt 60tgcagcagac ccgcagggca gtgtgcctcg gtggcattga actgaagctt ggctctcggc 120ctggcctgct ggctagttgc ccaccctgtg ggtcccgccc agagcaagga tactggagct 180ttcgcctgcc tcactgagcc tgggtctcca ctccagtcat ccctccagct actttgcagc 240actctgtcgc catgagcacc tcgtctgcgc ggcctgcagt cctggccctt gccgggctgg 300ctctgctcct tctgctgtgc ctgggtccag atggcataag tggaaacaaa ctcaagaaga 360tgctccagaa acgagaagga cctgtcccgt caaagactaa tgtagctgta gccgagaaca 420cagcaaagga attcctaggt ggcctgaagc gtgccaaacg acagctgtgg gaccgtacgc 480ggcctgaggt acagcagtgg taccagcagt tcctctacat gggctttgat gaggctaaat 540ttgaagatga tgtcaactat tggctaaaca gaaatcgaaa cggccatgac tactatggtg 600actactacca gcgtcattat gatgaagatg cggccattgg tccccacagc cgggaaagct 660tcaggcatgg agccagtgtg aactatgatg actattaagc ttcctgaggt gcccacagag 720cttgtgcctg cttcagtagg ccttctctac ctataccacg tgaccatcag gctaaaggaa 780agaatataag tgctttttgc atttcatgca tgtgcttaac gatatgtctc acttaaaaa 83951420DNAMus musculus 5cctgtgccta ttttgatgga tggcaatgct aagcaagcaa gcactgttca cttgtgactt 60tcatttctca cactgtgcac tgtcaaagac aaatgtgcat ggaaaaatgt ttagtgtcac 120ctcatggcgt tctcagcatc agtgaccttc aaacggtcct acaatgagac tgtgttctag 180ctaggggtat gctgtggaaa ttcctgctac atttcatctt agtgctaaca tgtacagatt 240ctgctgcgct acattcaaag ctcattactg tatatttatg ctttctctgt gtaacaagtt 300atacctgata agatgtcact ttgtttctag tgattcttaa ccatggtctg gtacatggct 360attctagttt tggaaattaa caagtgtttt gttgcctctt gttttctttt gttcctatca 420tttttggcgg gggttgggtg ggcttgattc taaccgtaag tataggataa gctagttttg 480tatatagagt caaatgactg atgtcagagg atcagtgctg atagaacttc cccagttcat 540gtcacgatac acacagagag aaagcagcat gaggcatctt gccatcagaa gccaaatttc 600ttttgagtcc caaaattgat gacttatgaa atatagctga aaacaagatt tgggtgtagt 660tacttgtatt tattatacaa tttccaatta catttttttt caaactcaaa ataacccatg 720actttgagtg ataggtcact tggcaatgtt cttgaattac tggggaagct gttgtcacta 780agataatgag agagaaaata gaatggcttc gcccaagtga gagccacatc ttacatttct 840ctgttgaatc ggaatcaact atattagaac agaagcctga tagaagcttt ctagttaaca 900cacacaaggc catggtttca aaaacatctt tgtcccctta ggtcagtttg tccttagatt 960atgaattggc aggttctaat tgcattattt ccctggctga tccaggaaaa agttagaaca 1020aaataagttg catagttttg aggaaacatc caaagcaagg cgaagccttt ccttgccttg 1080cattggcaaa actacctctt tagcatttat gttgattcag aaacatcttg ctgatatgtg 1140tagatgtttt aagcttcatt gtgaaaatat tgatgcaaga taagccatat atgaatgttg 1200tattcaactt tagggcttga aattaatcct aaagtgttca cctctctcca tgtctattta 1260cactctgttc ctatttacta agagggtagg ggtctcctta atatcatact tcattgttaa 1320taagtcaatg cttgttatgt ttcttggctg ttgtttttgt gcattaaaaa ctcaaaattg 1380gaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 14206763DNAMus musculus 6cccgccctcg cgaccccggc tctcctggac tcggcgccgc caacctgggc gatgccccgc 60tacgagttgg ctttgattct gaaagccatg cggcggccag agaccgctgc tgctttgaaa 120cgtacaatag aatccctgat ggaccgagga gccatagtga ggaacttgga aagcctgggt 180gagcgtgcgc tcccctacag gatctcgagt cacagccagc agcacagccg aggagggtat 240ttcctggtgg atttttatgc tccgacaagt gctgtggaga acatactgga acacttggcg 300cgagacattg acgtggttag accaaatatt gtgaaacacc ctctgaccca ggaagtaaaa 360gagtgtgacg gcatagtccc agtcccactt gaagaaaaac tgtattcaac aaagaggagg 420aagaagtgag aagattcacc agattctggc cttatattta atcctaaggg cactatgggt 480gctgctaggt tgttgtctag gatactttag cccatgacca ttttgctgca ggaggtagaa 540actgctggcc gagacctgcc ctgatgtctc tgctgagatt tcatcccact tgtggggttt 600gtcgggagtg ggggtgttca cagtaccact gtagcgtttc caagagcaaa atgtttgtca 660ttcacacttg gttgtcttgc aagcctatat ggaacactgg gagcagagta ataaacatga 720ctttatcaac actggaaaaa aaaaaaaaaa aaaaaaaaaa aaa 76371300DNAMus musculus 7ggtatgcagt ctttcgcttg aatttgctgt ttgtttatat agtaataaca gcgctatcta 60taaggcttac tggccttatt cctggttcca taagacacag gctgtacccc tttactgaat 120ggcatgggct cagcttggag gaaagtcaga ggaaattcag ataacttggt atctcttcct 180gtcgttgcaa tgtttcgggg tccacttcac tatgagatac caagcagctg ccaacctcac 240catactcatt tcgttacaat ttctgaggca ccgtggtgac ttgatccgac atacgaccac 300gtcagttaca aaccagatct ttatggttaa cttttgaaca tttcacaaac aacattgtaa 360atgtgcgatg ttatgtttta aatcagacca cagtggtccc caaatattat gtacatatga 420caaatgtcag tgtaactttt tgttacactg acagtttcat aggtaaacaa acctacgctc 480caatgttaaa ttatgcttgt gtatgtaaaa tacacaagca ttgggctatg tgtgtacgga 540catgagggta gtgcaatcgt actgtacgaa atgggtcaga atcattttca gtggtgttag 600gttatgtagt ttcagactcc atgctgcatt ttctcttgca catgccatcc atttgcttat 660tttggagtgt gagtattcct tcttattaat ttgaattcaa agcacaagcc tcccattgtt 720caacattacc caacaagagt gtccagtgat gaccgagtta tctcacctgc tatactttta 780ctgcaataat taatgacacc tggatgagga ggcgtgcgct gacttcattg ttcacccggg 840atagtgcatg agcccactga attagagctg cttctaccag caaaagtgag cagtacacat 900aggtgcatgt ttgaaacatg aatcacatag agctatggag ttttgccaag tgatgtgttt 960tctttttctt ttttcttttt ttttcttttt cttctttttt ttccttttct tcttcttctt 1020cttttttttt ttttttacta tgcaaagatg ggaaatgcac aaacttccaa gacatgtctg 1080aagaacttta caatacttga attttttctt taatcatccc atcacattta tggcattgat 1140gcttccattg tatttttctt ttgtcccttc aacttcaatg gtttgtaatt tcaatgcaca 1200acctaacttt tgtttgcagt aacttccaat cctattggct gcctggaacg gagattctgt 1260catcctacac gcatctttta gttgactgtg cataaaagtt 130081674DNAMus musculusCDS(1)..(1671) 8atg gaa ctc cgg acc cga ggc tgg tgg ctg ctg tgc gcg gcc gcc gcg 48Met Glu Leu Arg Thr Arg Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15ctg gtc gtc tgc gcc cgc ggg gac ccc gcc agc aag agc cgg agc tgc 96Leu Val Val Cys Ala Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys 20 25 30agc gaa gtc cgc cag atc tac ggg gct aag ggc ttt agc ctg agc gat 144Ser Glu Val Arg Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp 35 40 45gtg ccc cag gca gag atc tcg ggt gag cac ctg cgg atc tgc ccc cag 192Val Pro Gln Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro Gln 50 55 60ggc tac act tgc tgt acc agt gag atg gag gag aat ttg gcc aac cac 240Gly Tyr Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala Asn His65 70 75 80agc cga atg gag ctg gag agc gca ctc cat gac agc agc cgc gcc ctg 288Ser Arg Met Glu Leu Glu Ser Ala Leu His Asp Ser Ser Arg Ala Leu 85 90 95cag gcc aca ctg gcc acc cag ctg cat ggc atc gat gac cac ttc cag 336Gln Ala Thr Leu Ala Thr Gln Leu His Gly Ile Asp Asp His Phe Gln 100 105 110cgc ctg ctg aat gac tcg gag cgc aca ctg cag gag gct ttc cct ggg 384Arg Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Glu Ala Phe Pro Gly 115 120 125gcc ttt ggg gac ctg tat acg cag aac act cgt gcc ttc cgg gac cta 432Ala Phe Gly Asp Leu Tyr Thr Gln Asn Thr Arg Ala Phe Arg Asp Leu 130 135 140tat gtt gag ctg cgc ctc tac tac cgt ggg gcc aac ctg cac ctt gag 480Tyr Val Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu His Leu Glu145 150 155 160gag acg ctg gcc gag ttc tgg gca cgg ctg ctg gag cgc ctc ttc aag 528Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys 165 170 175cag ctg cac ccc cag ctg ctg cct gat gac tac ctg gac tgc ctg ggc 576Gln Leu His Pro Gln Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu Gly 180 185 190aag cag gcg gag gca ctg cgg ccg ttt gga gat gcc cct cga gaa ctg 624Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Asp Ala Pro Arg Glu Leu 195 200 205cgc ctg cgg gcc acc cgt gcc ttt gtg gct gca cgt tcc ttt gtg cag 672Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val Gln 210 215 220ggc ctg ggt gtg gcc agt gat gta gtc cgg aag gtg gcc cag gta cct 720Gly Leu Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val Pro225 230 235 240ctg gcc cca gaa tgt tct cgg gcc atc atg aag ttg gtc tac tgt gct 768Leu Ala Pro Glu Cys Ser Arg Ala Ile Met Lys Leu Val Tyr Cys Ala 245 250 255cat tgc cgg gga gtc ccg ggc gcc cgg ccc tgc ccc gac tat tgc cga 816His Cys Arg Gly Val Pro Gly Ala Arg Pro Cys Pro Asp Tyr Cys Arg 260 265 270aat gtg ctc aaa ggc tgc ctt gcc aac cag gcc gac ctg gat gcc gag 864Asn Val Leu Lys Gly Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala Glu 275 280 285tgg agg aac ctc ctg gac tcc atg gtg ctc atc act gac aag ttc tgg 912Trp Arg Asn Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe Trp 290 295 300ggc ccg tcg ggt gcg gag agt gtc att ggc ggt gtg cac gtg tgg ctg 960Gly Pro Ser Gly Ala Glu Ser Val Ile Gly Gly Val His Val Trp Leu305 310 315 320gcg gag gcc atc aac gcc ctc cag gac aac aag gac aca ctc aca gct 1008Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn Lys Asp Thr Leu Thr Ala 325 330 335aag gtc atc cag gcc tgt gga aac ccc aag gtc aat ccc cac ggc tct 1056Lys Val Ile Gln Ala Cys Gly Asn Pro Lys Val Asn Pro His Gly Ser 340 345 350ggg ccc gag gag aag cgt cgc cgt ggc aaa ttg gca ctg cag gag aag 1104Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Leu Gln Glu Lys 355 360 365ccc tcc aca ggt act ctg gaa aaa ctg gtc tct gag gcc aag gcc cag 1152Pro Ser Thr Gly Thr Leu Glu Lys Leu Val Ser Glu Ala Lys Ala Gln 370 375 380ctc cga gac att cag gac ttc tgg atc agc ctc cca ggg aca ctg tgc 1200Leu Arg Asp Ile Gln Asp Phe Trp Ile Ser Leu Pro Gly Thr Leu Cys385 390 395 400agt gag aag atg gcc atg agt cct gcc agt gat gac cgc tgc tgg aat 1248Ser Glu Lys Met Ala Met Ser Pro Ala Ser Asp Asp Arg Cys Trp Asn 405 410 415gga att tcc aag ggc cgg tac cta cca gag gtg atg ggt gac ggg ctg 1296Gly Ile Ser Lys Gly Arg Tyr Leu Pro Glu Val Met Gly Asp Gly Leu 420 425 430gcc aac cag atc aac aac cct gag gtg gaa gtg gac atc acc aag cca 1344Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys Pro 435 440 445gac atg acc atc cgc cag cag att atg cag ctc aag atc atg acc aac 1392Asp Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr Asn 450 455 460cgt tta cgt ggc gcc tat ggc ggc aac gac gtg gac ttc cag gat gct 1440Arg Leu Arg Gly Ala Tyr Gly Gly Asn Asp Val Asp Phe Gln Asp Ala465 470 475 480agt gat gac ggc agt ggc tcc ggc agc ggt ggc gga tgc cca gat gac 1488Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Gly Gly Cys Pro Asp Asp 485 490 495acc tgt ggc cgg agg gtc agc aag aag agt tcc agc tcc cgg acc ccc 1536Thr Cys Gly Arg Arg Val Ser Lys Lys Ser Ser Ser Ser Arg Thr Pro 500 505 510ttg acc cat gcc ctc ccc ggc ctg tca gaa cag gag gga cag aag acc 1584Leu Thr His Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys Thr 515 520 525tca gct gcc acc tgc cca gag ccc cac agc ttc ttc ctg ctc ttc ctc 1632Ser Ala Ala Thr Cys Pro Glu Pro His Ser Phe Phe Leu Leu Phe Leu 530 535 540gtc acc ttg gtc ctt gcg gca gcc agg ccc agg tgg cgg taa 1674Val Thr Leu Val Leu Ala Ala Ala Arg Pro Arg Trp Arg545 550 5559557PRTMus musculus 9Met Glu Leu Arg Thr Arg Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15Leu Val Val Cys Ala Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys 20 25 30Ser Glu Val Arg Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp 35 40 45Val Pro Gln Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro Gln 50 55 60Gly Tyr Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala Asn His65 70 75 80Ser Arg Met Glu Leu Glu Ser Ala Leu His Asp Ser Ser Arg Ala Leu 85 90 95Gln Ala Thr Leu Ala Thr Gln Leu His Gly Ile Asp Asp His Phe Gln 100 105 110Arg Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Glu Ala Phe Pro Gly 115 120 125Ala Phe Gly Asp Leu Tyr Thr Gln Asn Thr Arg Ala Phe Arg Asp Leu 130 135 140Tyr Val Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu His Leu Glu145 150 155 160Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys 165 170 175Gln Leu His Pro Gln Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu Gly 180 185 190Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Asp Ala Pro Arg Glu Leu 195 200 205Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val Gln 210 215 220Gly Leu Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val Pro225 230 235 240Leu Ala Pro Glu Cys Ser Arg Ala Ile Met Lys Leu Val Tyr Cys Ala 245 250 255His Cys Arg Gly Val Pro Gly Ala Arg Pro Cys Pro Asp Tyr Cys Arg 260 265 270Asn Val Leu Lys Gly Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala Glu 275 280 285Trp Arg Asn Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe Trp 290 295 300Gly Pro Ser Gly Ala Glu Ser Val Ile Gly Gly Val His Val Trp Leu305 310 315 320Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn Lys Asp Thr Leu Thr Ala 325 330 335Lys Val Ile Gln Ala Cys Gly Asn Pro Lys Val Asn Pro His Gly Ser 340 345 350Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Leu Gln Glu Lys 355 360 365Pro Ser Thr Gly Thr Leu Glu Lys Leu Val Ser Glu Ala Lys Ala Gln 370 375 380Leu Arg Asp Ile Gln Asp Phe Trp Ile Ser Leu Pro Gly Thr Leu Cys385 390 395 400Ser Glu Lys Met Ala Met Ser Pro Ala Ser Asp Asp Arg Cys Trp Asn 405 410 415Gly Ile Ser Lys Gly Arg Tyr Leu Pro Glu Val Met Gly Asp Gly Leu 420 425 430Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys Pro 435 440 445Asp Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr Asn 450 455 460Arg Leu Arg Gly Ala Tyr Gly Gly

Asn Asp Val Asp Phe Gln Asp Ala465 470 475 480Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Gly Gly Cys Pro Asp Asp 485 490 495Thr Cys Gly Arg Arg Val Ser Lys Lys Ser Ser Ser Ser Arg Thr Pro 500 505 510Leu Thr His Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys Thr 515 520 525Ser Ala Ala Thr Cys Pro Glu Pro His Ser Phe Phe Leu Leu Phe Leu 530 535 540Val Thr Leu Val Leu Ala Ala Ala Arg Pro Arg Trp Arg545 550 555101677DNAHomo sapiensCDS(1)..(1674) 10atg gag ctc cgg gcc cga ggc tgg tgg ctg cta tgt gcg gcc gca gcg 48Met Glu Leu Arg Ala Arg Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15ctg gtc gcc tgc gcc cgc ggg gac ccg gcc agc aag agc cgg agc tgc 96Leu Val Ala Cys Ala Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys 20 25 30ggc gag gtc cgc cag atc tac gga gcc aag ggc ttc agc ctg agc gac 144Gly Glu Val Arg Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp 35 40 45gtg ccc cag gcg gag atc tcg ggt gag cac ctg cgg atc tgt ccc cag 192Val Pro Gln Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro Gln 50 55 60ggc tac acc tgc tgc acc agc gag atg gag gag aac ctg gcc aac cgc 240Gly Tyr Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala Asn Arg65 70 75 80agc cat gcc gag ctg gag acc gcg ctc cgg gac agc agc cgc gtc ctg 288Ser His Ala Glu Leu Glu Thr Ala Leu Arg Asp Ser Ser Arg Val Leu 85 90 95cag gcc atg ctt gcc acc cag ctg cgc agc ttc gat gac cac ttc cag 336Gln Ala Met Leu Ala Thr Gln Leu Arg Ser Phe Asp Asp His Phe Gln 100 105 110cac ctg ctg aac gac tcg gag cgg acg ctg cag gcc acc ttc ccc ggc 384His Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Ala Thr Phe Pro Gly 115 120 125gcc ttc gga gag ctg tac acg cag aac gcg agg gcc ttc cgg gac ctg 432Ala Phe Gly Glu Leu Tyr Thr Gln Asn Ala Arg Ala Phe Arg Asp Leu 130 135 140tac tca gag ctg cgc ctg tac tac cgc ggt gcc aac ctg cac ctg gag 480Tyr Ser Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu His Leu Glu145 150 155 160gag acg ctg gcc gag ttc tgg gcc cgc ctg ctc gag cgc ctc ttc aag 528Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys 165 170 175cag ctg cac ccc cag ctg ctg ctg cct gat gac tac ctg gac tgc ctg 576Gln Leu His Pro Gln Leu Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu 180 185 190ggc aag cag gcc gag gcg ctg cgg ccc ttc ggg gag gcc ccg aga gag 624Gly Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Glu Ala Pro Arg Glu 195 200 205ctg cgc ctg cgg gcc acc cgt gcc ttc gtg gct gct cgc tcc ttt gtg 672Leu Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val 210 215 220cag ggc ctg ggc gtg gcc agc gac gtg gtc cgg aaa gtg gct cag gtc 720Gln Gly Leu Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val225 230 235 240ccc ctg ggc ccg gag tgc tcg aga gct gtc atg aag ctg gtc tac tgt 768Pro Leu Gly Pro Glu Cys Ser Arg Ala Val Met Lys Leu Val Tyr Cys 245 250 255gct cac tgc ctg gga gtc ccc ggc gcc agg ccc tgc cct gac tat tgc 816Ala His Cys Leu Gly Val Pro Gly Ala Arg Pro Cys Pro Asp Tyr Cys 260 265 270cga aat gtg ctc aag ggc tgc ctt gcc aac cag gcc gac ctg gac gcc 864Arg Asn Val Leu Lys Gly Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala 275 280 285gag tgg agg aac ctc ctg gac tcc atg gtg ctc atc acc gac aag ttc 912Glu Trp Arg Asn Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe 290 295 300tgg ggt aca tcg ggt gtg gag agt gtc atc ggc agc gtg cac acg tgg 960Trp Gly Thr Ser Gly Val Glu Ser Val Ile Gly Ser Val His Thr Trp305 310 315 320ctg gcg gag gcc atc aac gcc ctc cag gac aac agg gac acg ctc acg 1008Leu Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn Arg Asp Thr Leu Thr 325 330 335gcc aag gtc atc cag ggc tgc ggg aac ccc aag gtc aac ccc cag ggc 1056Ala Lys Val Ile Gln Gly Cys Gly Asn Pro Lys Val Asn Pro Gln Gly 340 345 350cct ggg cct gag gag aag cgg cgc cgg ggc aag ctg gcc ccg cgg gag 1104Pro Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Pro Arg Glu 355 360 365agg cca cct tca ggc acg ctg gag aag ctg gtc tct gaa gcc aag gcc 1152Arg Pro Pro Ser Gly Thr Leu Glu Lys Leu Val Ser Glu Ala Lys Ala 370 375 380cag ctc cgc gac gtc cag gac ttc tgg atc agc ctc cca ggg aca ctg 1200Gln Leu Arg Asp Val Gln Asp Phe Trp Ile Ser Leu Pro Gly Thr Leu385 390 395 400tgc agt gag aag atg gcc ctg agc act gcc agt gat gac cgc tgc tgg 1248Cys Ser Glu Lys Met Ala Leu Ser Thr Ala Ser Asp Asp Arg Cys Trp 405 410 415aac ggg atg gcc aga ggc cgg tac ctc ccc gag gtc atg ggt gac ggc 1296Asn Gly Met Ala Arg Gly Arg Tyr Leu Pro Glu Val Met Gly Asp Gly 420 425 430ctg gcc aac cag atc aac aac ccc gag gtg gag gtg gac atc acc aag 1344Leu Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys 435 440 445ccg gac atg acc atc cgg cag cag atc atg cag ctg aag atc atg acc 1392Pro Asp Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr 450 455 460aac cgg ctg cgc agc gcc tac aac ggc aac gac gtg gac ttc cag gac 1440Asn Arg Leu Arg Ser Ala Tyr Asn Gly Asn Asp Val Asp Phe Gln Asp465 470 475 480gcc agt gac gac ggc agc ggc tcg ggc agc ggt gat ggc tgt ctg gat 1488Ala Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Asp Gly Cys Leu Asp 485 490 495gac ctc tgc ggc cgg aag gtc agc agg aag agc tcc agc tcc cgg acg 1536Asp Leu Cys Gly Arg Lys Val Ser Arg Lys Ser Ser Ser Ser Arg Thr 500 505 510ccc ttg acc cat gcc ctc cca ggc ctg tca gag cag gaa gga cag aag 1584Pro Leu Thr His Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys 515 520 525acc tcg gct gcc agc tgc ccc cag ccc ccg acc ttc ctc ctg ccc ctc 1632Thr Ser Ala Ala Ser Cys Pro Gln Pro Pro Thr Phe Leu Leu Pro Leu 530 535 540ctc ctc ttc ctg gcc ctt aca gta gcc agg ccc cgg tgg cgg taa 1677Leu Leu Phe Leu Ala Leu Thr Val Ala Arg Pro Arg Trp Arg545 550 55511558PRTHomo sapiens 11Met Glu Leu Arg Ala Arg Gly Trp Trp Leu Leu Cys Ala Ala Ala Ala1 5 10 15Leu Val Ala Cys Ala Arg Gly Asp Pro Ala Ser Lys Ser Arg Ser Cys 20 25 30Gly Glu Val Arg Gln Ile Tyr Gly Ala Lys Gly Phe Ser Leu Ser Asp 35 40 45Val Pro Gln Ala Glu Ile Ser Gly Glu His Leu Arg Ile Cys Pro Gln 50 55 60Gly Tyr Thr Cys Cys Thr Ser Glu Met Glu Glu Asn Leu Ala Asn Arg65 70 75 80Ser His Ala Glu Leu Glu Thr Ala Leu Arg Asp Ser Ser Arg Val Leu 85 90 95Gln Ala Met Leu Ala Thr Gln Leu Arg Ser Phe Asp Asp His Phe Gln 100 105 110His Leu Leu Asn Asp Ser Glu Arg Thr Leu Gln Ala Thr Phe Pro Gly 115 120 125Ala Phe Gly Glu Leu Tyr Thr Gln Asn Ala Arg Ala Phe Arg Asp Leu 130 135 140Tyr Ser Glu Leu Arg Leu Tyr Tyr Arg Gly Ala Asn Leu His Leu Glu145 150 155 160Glu Thr Leu Ala Glu Phe Trp Ala Arg Leu Leu Glu Arg Leu Phe Lys 165 170 175Gln Leu His Pro Gln Leu Leu Leu Pro Asp Asp Tyr Leu Asp Cys Leu 180 185 190Gly Lys Gln Ala Glu Ala Leu Arg Pro Phe Gly Glu Ala Pro Arg Glu 195 200 205Leu Arg Leu Arg Ala Thr Arg Ala Phe Val Ala Ala Arg Ser Phe Val 210 215 220Gln Gly Leu Gly Val Ala Ser Asp Val Val Arg Lys Val Ala Gln Val225 230 235 240Pro Leu Gly Pro Glu Cys Ser Arg Ala Val Met Lys Leu Val Tyr Cys 245 250 255Ala His Cys Leu Gly Val Pro Gly Ala Arg Pro Cys Pro Asp Tyr Cys 260 265 270Arg Asn Val Leu Lys Gly Cys Leu Ala Asn Gln Ala Asp Leu Asp Ala 275 280 285Glu Trp Arg Asn Leu Leu Asp Ser Met Val Leu Ile Thr Asp Lys Phe 290 295 300Trp Gly Thr Ser Gly Val Glu Ser Val Ile Gly Ser Val His Thr Trp305 310 315 320Leu Ala Glu Ala Ile Asn Ala Leu Gln Asp Asn Arg Asp Thr Leu Thr 325 330 335Ala Lys Val Ile Gln Gly Cys Gly Asn Pro Lys Val Asn Pro Gln Gly 340 345 350Pro Gly Pro Glu Glu Lys Arg Arg Arg Gly Lys Leu Ala Pro Arg Glu 355 360 365Arg Pro Pro Ser Gly Thr Leu Glu Lys Leu Val Ser Glu Ala Lys Ala 370 375 380Gln Leu Arg Asp Val Gln Asp Phe Trp Ile Ser Leu Pro Gly Thr Leu385 390 395 400Cys Ser Glu Lys Met Ala Leu Ser Thr Ala Ser Asp Asp Arg Cys Trp 405 410 415Asn Gly Met Ala Arg Gly Arg Tyr Leu Pro Glu Val Met Gly Asp Gly 420 425 430Leu Ala Asn Gln Ile Asn Asn Pro Glu Val Glu Val Asp Ile Thr Lys 435 440 445Pro Asp Met Thr Ile Arg Gln Gln Ile Met Gln Leu Lys Ile Met Thr 450 455 460Asn Arg Leu Arg Ser Ala Tyr Asn Gly Asn Asp Val Asp Phe Gln Asp465 470 475 480Ala Ser Asp Asp Gly Ser Gly Ser Gly Ser Gly Asp Gly Cys Leu Asp 485 490 495Asp Leu Cys Gly Arg Lys Val Ser Arg Lys Ser Ser Ser Ser Arg Thr 500 505 510Pro Leu Thr His Ala Leu Pro Gly Leu Ser Glu Gln Glu Gly Gln Lys 515 520 525Thr Ser Ala Ala Ser Cys Pro Gln Pro Pro Thr Phe Leu Leu Pro Leu 530 535 540Leu Leu Phe Leu Ala Leu Thr Val Ala Arg Pro Arg Trp Arg545 550 55512369DNAMus musculusCDS(1)..(366) 12atg aag cct ttt cat act gcc ctc tcc ttc ctc att ctt aca act gct 48Met Lys Pro Phe His Thr Ala Leu Ser Phe Leu Ile Leu Thr Thr Ala1 5 10 15ctt gga atc tgg gcc cag atc aca cat gca aca gag aca aaa gaa gtc 96Leu Gly Ile Trp Ala Gln Ile Thr His Ala Thr Glu Thr Lys Glu Val 20 25 30cag agc agt ctg aag gca cag caa ggg ctt gaa att gaa atg ttt cac 144Gln Ser Ser Leu Lys Ala Gln Gln Gly Leu Glu Ile Glu Met Phe His 35 40 45atg ggc ttt caa gac tct tca gat tgc tgc ctg tcc tat aac tca cgg 192Met Gly Phe Gln Asp Ser Ser Asp Cys Cys Leu Ser Tyr Asn Ser Arg 50 55 60att cag tgt tca aga ttt ata ggt tat ttt ccc acc agt ggt ggg tgt 240Ile Gln Cys Ser Arg Phe Ile Gly Tyr Phe Pro Thr Ser Gly Gly Cys65 70 75 80acc agg ccg ggc atc atc ttt atc agc aag agg ggg ttc cag gtc tgt 288Thr Arg Pro Gly Ile Ile Phe Ile Ser Lys Arg Gly Phe Gln Val Cys 85 90 95gcc aac ccc agt gat cgg aga gtt cag aga tgc att gaa aga ttg gag 336Ala Asn Pro Ser Asp Arg Arg Val Gln Arg Cys Ile Glu Arg Leu Glu 100 105 110caa aac tca caa cca cgg acc tac aaa caa taa 369Gln Asn Ser Gln Pro Arg Thr Tyr Lys Gln 115 12013122PRTMus musculus 13Met Lys Pro Phe His Thr Ala Leu Ser Phe Leu Ile Leu Thr Thr Ala1 5 10 15Leu Gly Ile Trp Ala Gln Ile Thr His Ala Thr Glu Thr Lys Glu Val 20 25 30Gln Ser Ser Leu Lys Ala Gln Gln Gly Leu Glu Ile Glu Met Phe His 35 40 45Met Gly Phe Gln Asp Ser Ser Asp Cys Cys Leu Ser Tyr Asn Ser Arg 50 55 60Ile Gln Cys Ser Arg Phe Ile Gly Tyr Phe Pro Thr Ser Gly Gly Cys65 70 75 80Thr Arg Pro Gly Ile Ile Phe Ile Ser Lys Arg Gly Phe Gln Val Cys 85 90 95Ala Asn Pro Ser Asp Arg Arg Val Gln Arg Cys Ile Glu Arg Leu Glu 100 105 110Gln Asn Ser Gln Pro Arg Thr Tyr Lys Gln 115 120141223DNAMus musculusCDS(84)..(1121) 14gtgacccgga agggagcccc gtggtagagg tgaccggagc tgagcatttc agatctgctt 60agtaaaccgg tgtatcgccc acc atg ttg gct gca agg ctt gtg tgt ctc cgg 113 Met Leu Ala Ala Arg Leu Val Cys Leu Arg 1 5 10aca cta cct tcc agg gtt ttc cag ccc act ttc atc acc aag gcc tct 161Thr Leu Pro Ser Arg Val Phe Gln Pro Thr Phe Ile Thr Lys Ala Ser 15 20 25cca ctt gtg aag aat tcc atc aca aag aac caa tgg ctc gta aca ccc 209Pro Leu Val Lys Asn Ser Ile Thr Lys Asn Gln Trp Leu Val Thr Pro 30 35 40agc agg gaa tat gct acc aag aca aga att agg act cac cgt ggg aaa 257Ser Arg Glu Tyr Ala Thr Lys Thr Arg Ile Arg Thr His Arg Gly Lys 45 50 55act gga caa gaa ctg aaa gag gca gcc ttg gaa cca tca atg gaa aaa 305Thr Gly Gln Glu Leu Lys Glu Ala Ala Leu Glu Pro Ser Met Glu Lys 60 65 70atc ttt aaa atc gat caa atg gga agg tgg ttt gtt gct gga gga gca 353Ile Phe Lys Ile Asp Gln Met Gly Arg Trp Phe Val Ala Gly Gly Ala75 80 85 90gct gtt ggt ctt gga gcg ctc tgc tac tat ggc ttg gga atg tct aat 401Ala Val Gly Leu Gly Ala Leu Cys Tyr Tyr Gly Leu Gly Met Ser Asn 95 100 105gag att gga gct atc gaa aag gct gta att tgg cct cag tat gta aag 449Glu Ile Gly Ala Ile Glu Lys Ala Val Ile Trp Pro Gln Tyr Val Lys 110 115 120gat aga att cat tct act tac atg tac tta gca gga agg tat tgt tta 497Asp Arg Ile His Ser Thr Tyr Met Tyr Leu Ala Gly Arg Tyr Cys Leu 125 130 135aca gct ttg tct gcc ttg gca gta gcc aga aca cct gct ctc atg aac 545Thr Ala Leu Ser Ala Leu Ala Val Ala Arg Thr Pro Ala Leu Met Asn 140 145 150ttc atg atg aca ggc tct tgg gtg aca att ggt gcg acc ttt gca gcc 593Phe Met Met Thr Gly Ser Trp Val Thr Ile Gly Ala Thr Phe Ala Ala155 160 165 170atg att gga gct gga atg ctt gta cac tca ata tca tat gag cag agc 641Met Ile Gly Ala Gly Met Leu Val His Ser Ile Ser Tyr Glu Gln Ser 175 180 185cca ggc cca aag cat ctg gct tgg atg ctg cat tct ggt gtg atg ggt 689Pro Gly Pro Lys His Leu Ala Trp Met Leu His Ser Gly Val Met Gly 190 195 200gca gtt gtg gct cct ctg acg atc tta ggg ggg cct ctt ctc ctg aga 737Ala Val Val Ala Pro Leu Thr Ile Leu Gly Gly Pro Leu Leu Leu Arg 205 210 215gcc gca tgg tac acc gct ggt att gtg gga ggc ctc tct act gtg gcc 785Ala Ala Trp Tyr Thr Ala Gly Ile Val Gly Gly Leu Ser Thr Val Ala 220 225 230atg tgt gcg cct agt gag aag ttt ctg aac atg gga gca ccc ctg gga 833Met Cys Ala Pro Ser Glu Lys Phe Leu Asn Met Gly Ala Pro Leu Gly235 240 245 250gtg ggc ctg ggt ctt gtc ttt gcg tct tct ctg ggg tct atg ttt ctt 881Val Gly Leu Gly Leu Val Phe Ala Ser Ser Leu Gly Ser Met Phe Leu 255 260 265ccc cct acc tct gtg gct ggt gcc act ctg tac tca gtg gca atg tat 929Pro Pro Thr Ser Val Ala Gly Ala Thr Leu Tyr Ser Val Ala Met Tyr 270 275 280ggt gga tta gtt ctt ttc agc atg ttc ctt ctg tat gat act cag aaa 977Gly Gly Leu Val Leu Phe Ser Met Phe Leu Leu Tyr Asp Thr Gln Lys 285 290 295gta atc aaa cgt gca gaa ata aca ccc atg tat gga gct caa aag tat 1025Val Ile Lys Arg Ala Glu Ile Thr Pro Met Tyr Gly Ala Gln Lys Tyr 300 305 310gat ccc atc aat tcg atg ttg aca atc tac atg gat aca tta aat ata 1073Asp Pro Ile Asn Ser Met Leu Thr Ile Tyr Met Asp Thr Leu Asn Ile315 320 325 330ttt atg cga gtt gca act atg cta gca act gga agc aac aga aag aaa 1121Phe Met Arg Val Ala Thr Met Leu Ala Thr Gly Ser Asn Arg Lys Lys 335 340 345tgaagtaacc gcttgtgatg tctccgctca ctgatgtctt gcttgtttaa taggagcaga 1181tagtcattac agtttgcatc agcagaattc

ccgcgcggcc gc 122315346PRTMus musculus 15Met Leu Ala Ala Arg Leu Val Cys Leu Arg Thr Leu Pro Ser Arg Val1 5 10 15Phe Gln Pro Thr Phe Ile Thr Lys Ala Ser Pro Leu Val Lys Asn Ser 20 25 30Ile Thr Lys Asn Gln Trp Leu Val Thr Pro Ser Arg Glu Tyr Ala Thr 35 40 45Lys Thr Arg Ile Arg Thr His Arg Gly Lys Thr Gly Gln Glu Leu Lys 50 55 60Glu Ala Ala Leu Glu Pro Ser Met Glu Lys Ile Phe Lys Ile Asp Gln65 70 75 80Met Gly Arg Trp Phe Val Ala Gly Gly Ala Ala Val Gly Leu Gly Ala 85 90 95Leu Cys Tyr Tyr Gly Leu Gly Met Ser Asn Glu Ile Gly Ala Ile Glu 100 105 110Lys Ala Val Ile Trp Pro Gln Tyr Val Lys Asp Arg Ile His Ser Thr 115 120 125Tyr Met Tyr Leu Ala Gly Arg Tyr Cys Leu Thr Ala Leu Ser Ala Leu 130 135 140Ala Val Ala Arg Thr Pro Ala Leu Met Asn Phe Met Met Thr Gly Ser145 150 155 160Trp Val Thr Ile Gly Ala Thr Phe Ala Ala Met Ile Gly Ala Gly Met 165 170 175Leu Val His Ser Ile Ser Tyr Glu Gln Ser Pro Gly Pro Lys His Leu 180 185 190Ala Trp Met Leu His Ser Gly Val Met Gly Ala Val Val Ala Pro Leu 195 200 205Thr Ile Leu Gly Gly Pro Leu Leu Leu Arg Ala Ala Trp Tyr Thr Ala 210 215 220Gly Ile Val Gly Gly Leu Ser Thr Val Ala Met Cys Ala Pro Ser Glu225 230 235 240Lys Phe Leu Asn Met Gly Ala Pro Leu Gly Val Gly Leu Gly Leu Val 245 250 255Phe Ala Ser Ser Leu Gly Ser Met Phe Leu Pro Pro Thr Ser Val Ala 260 265 270Gly Ala Thr Leu Tyr Ser Val Ala Met Tyr Gly Gly Leu Val Leu Phe 275 280 285Ser Met Phe Leu Leu Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu 290 295 300Ile Thr Pro Met Tyr Gly Ala Gln Lys Tyr Asp Pro Ile Asn Ser Met305 310 315 320Leu Thr Ile Tyr Met Asp Thr Leu Asn Ile Phe Met Arg Val Ala Thr 325 330 335Met Leu Ala Thr Gly Ser Asn Arg Lys Lys 340 345161038DNAHomo sapiensCDS(1)..(1035) 16atg ttg gct gca agg ctg gtg tgt ctc cgg aca cta cct tct agg gtt 48Met Leu Ala Ala Arg Leu Val Cys Leu Arg Thr Leu Pro Ser Arg Val1 5 10 15ttc cac cca gct ttc acc aag gcc tcc cct gtt gtg aag aat tcc atc 96Phe His Pro Ala Phe Thr Lys Ala Ser Pro Val Val Lys Asn Ser Ile 20 25 30acg aag aat caa tgg ctg tta aca cct agc agg gaa tat gcc acc aaa 144Thr Lys Asn Gln Trp Leu Leu Thr Pro Ser Arg Glu Tyr Ala Thr Lys 35 40 45aca aga att ggg atc cgg cgt ggg aga act ggc caa gaa ctc aaa gag 192Thr Arg Ile Gly Ile Arg Arg Gly Arg Thr Gly Gln Glu Leu Lys Glu 50 55 60gca gca ttg gaa cca tcg atg gaa aaa ata ttt aaa att gat cag atg 240Ala Ala Leu Glu Pro Ser Met Glu Lys Ile Phe Lys Ile Asp Gln Met65 70 75 80gga aga tgg ttt gtt gct gga ggg gct gct gtt ggt ctt gga gca ttg 288Gly Arg Trp Phe Val Ala Gly Gly Ala Ala Val Gly Leu Gly Ala Leu 85 90 95tgc tac tat ggc ttg gga ctg tct aat gag att gga gct att gaa aag 336Cys Tyr Tyr Gly Leu Gly Leu Ser Asn Glu Ile Gly Ala Ile Glu Lys 100 105 110gct gta att tgg cct cag tat gtc aag gat aga att cat tcc acc tat 384Ala Val Ile Trp Pro Gln Tyr Val Lys Asp Arg Ile His Ser Thr Tyr 115 120 125atg tac tta gca ggg agt att ggt tta aca gct ttg tct gcc ata gca 432Met Tyr Leu Ala Gly Ser Ile Gly Leu Thr Ala Leu Ser Ala Ile Ala 130 135 140atc agc aga acg cct gtt ctc atg aac ttc atg atg aga ggc tct tgg 480Ile Ser Arg Thr Pro Val Leu Met Asn Phe Met Met Arg Gly Ser Trp145 150 155 160gtg aca att ggt gtg acc ttt gca gcc atg gtt gga gct gga atg ctg 528Val Thr Ile Gly Val Thr Phe Ala Ala Met Val Gly Ala Gly Met Leu 165 170 175gta cga tca ata cca tat gac cag agc cca ggc cca aag cat ctt gct 576Val Arg Ser Ile Pro Tyr Asp Gln Ser Pro Gly Pro Lys His Leu Ala 180 185 190tgg ttg cta cat tct ggt gtg atg ggt gca gtg gtg gct cct ctg aca 624Trp Leu Leu His Ser Gly Val Met Gly Ala Val Val Ala Pro Leu Thr 195 200 205ata tta ggg ggt cct ctt ctc atc aga gct gca tgg tac aca gct ggc 672Ile Leu Gly Gly Pro Leu Leu Ile Arg Ala Ala Trp Tyr Thr Ala Gly 210 215 220att gtg gga ggc ctc tcc act gtg gcc atg tgt gcg ccc agt gaa aag 720Ile Val Gly Gly Leu Ser Thr Val Ala Met Cys Ala Pro Ser Glu Lys225 230 235 240ttt ctg aac atg ggt gca ccc ctg gga gtg ggc ctg ggt ctc gtc ttt 768Phe Leu Asn Met Gly Ala Pro Leu Gly Val Gly Leu Gly Leu Val Phe 245 250 255gtg tcc tca ttg gga tct atg ttt ctt cca cct acc acc gtg gct ggt 816Val Ser Ser Leu Gly Ser Met Phe Leu Pro Pro Thr Thr Val Ala Gly 260 265 270gcc act ctt tac tca gtg gca atg tac ggt gga tta gtt ctt ttc agc 864Ala Thr Leu Tyr Ser Val Ala Met Tyr Gly Gly Leu Val Leu Phe Ser 275 280 285atg ttc ctt ctg tat gat acc cag aaa gta atc aag cgt gca gaa gta 912Met Phe Leu Leu Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu Val 290 295 300tca cca atg tat gga gtt caa aaa tat gat ccc att aac tcg atg ctg 960Ser Pro Met Tyr Gly Val Gln Lys Tyr Asp Pro Ile Asn Ser Met Leu305 310 315 320agt atc tac atg gat aca tta aat ata ttt atg cga gtt gca act atg 1008Ser Ile Tyr Met Asp Thr Leu Asn Ile Phe Met Arg Val Ala Thr Met 325 330 335ctg gca act gga ggc aac aga aag aaa tga 1038Leu Ala Thr Gly Gly Asn Arg Lys Lys 340 34517345PRTHomo sapiens 17Met Leu Ala Ala Arg Leu Val Cys Leu Arg Thr Leu Pro Ser Arg Val1 5 10 15Phe His Pro Ala Phe Thr Lys Ala Ser Pro Val Val Lys Asn Ser Ile 20 25 30Thr Lys Asn Gln Trp Leu Leu Thr Pro Ser Arg Glu Tyr Ala Thr Lys 35 40 45Thr Arg Ile Gly Ile Arg Arg Gly Arg Thr Gly Gln Glu Leu Lys Glu 50 55 60Ala Ala Leu Glu Pro Ser Met Glu Lys Ile Phe Lys Ile Asp Gln Met65 70 75 80Gly Arg Trp Phe Val Ala Gly Gly Ala Ala Val Gly Leu Gly Ala Leu 85 90 95Cys Tyr Tyr Gly Leu Gly Leu Ser Asn Glu Ile Gly Ala Ile Glu Lys 100 105 110Ala Val Ile Trp Pro Gln Tyr Val Lys Asp Arg Ile His Ser Thr Tyr 115 120 125Met Tyr Leu Ala Gly Ser Ile Gly Leu Thr Ala Leu Ser Ala Ile Ala 130 135 140Ile Ser Arg Thr Pro Val Leu Met Asn Phe Met Met Arg Gly Ser Trp145 150 155 160Val Thr Ile Gly Val Thr Phe Ala Ala Met Val Gly Ala Gly Met Leu 165 170 175Val Arg Ser Ile Pro Tyr Asp Gln Ser Pro Gly Pro Lys His Leu Ala 180 185 190Trp Leu Leu His Ser Gly Val Met Gly Ala Val Val Ala Pro Leu Thr 195 200 205Ile Leu Gly Gly Pro Leu Leu Ile Arg Ala Ala Trp Tyr Thr Ala Gly 210 215 220Ile Val Gly Gly Leu Ser Thr Val Ala Met Cys Ala Pro Ser Glu Lys225 230 235 240Phe Leu Asn Met Gly Ala Pro Leu Gly Val Gly Leu Gly Leu Val Phe 245 250 255Val Ser Ser Leu Gly Ser Met Phe Leu Pro Pro Thr Thr Val Ala Gly 260 265 270Ala Thr Leu Tyr Ser Val Ala Met Tyr Gly Gly Leu Val Leu Phe Ser 275 280 285Met Phe Leu Leu Tyr Asp Thr Gln Lys Val Ile Lys Arg Ala Glu Val 290 295 300Ser Pro Met Tyr Gly Val Gln Lys Tyr Asp Pro Ile Asn Ser Met Leu305 310 315 320Ser Ile Tyr Met Asp Thr Leu Asn Ile Phe Met Arg Val Ala Thr Met 325 330 335Leu Ala Thr Gly Gly Asn Arg Lys Lys 340 34518447DNAMus musculusCDS(1)..(444) 18atg agc acc tcg tct gcg cgg cct gca gtc ctg gcc ctt gcc ggg ctg 48Met Ser Thr Ser Ser Ala Arg Pro Ala Val Leu Ala Leu Ala Gly Leu1 5 10 15gct ctg ctc ctt ctg ctg tgc ctg ggt cca gat ggc ata agt gga aac 96Ala Leu Leu Leu Leu Leu Cys Leu Gly Pro Asp Gly Ile Ser Gly Asn 20 25 30aaa ctc aag aag atg ctc cag aaa cga gaa gga cct gtc ccg tca aag 144Lys Leu Lys Lys Met Leu Gln Lys Arg Glu Gly Pro Val Pro Ser Lys 35 40 45act aat gta gct gta gcc gag aac aca gca aag gaa ttc cta ggt ggc 192Thr Asn Val Ala Val Ala Glu Asn Thr Ala Lys Glu Phe Leu Gly Gly 50 55 60ctg aag cgt gcc aaa cga cag ctg tgg gac cgt acg cgg cct gag gta 240Leu Lys Arg Ala Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80cag cag tgg tac cag cag ttc ctc tac atg ggc ttt gat gag gct aaa 288Gln Gln Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys 85 90 95ttt gaa gat gat gtc aac tat tgg cta aac aga aat cga aac ggc cat 336Phe Glu Asp Asp Val Asn Tyr Trp Leu Asn Arg Asn Arg Asn Gly His 100 105 110gac tac tat ggt gac tac tac cag cgt cat tat gat gaa gat gcg gcc 384Asp Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ala Ala 115 120 125att ggt ccc cac agc cgg gaa agc ttc agg cat gga gcc agt gtg aac 432Ile Gly Pro His Ser Arg Glu Ser Phe Arg His Gly Ala Ser Val Asn 130 135 140tat gat gac tat taa 447Tyr Asp Asp Tyr14519148PRTMus musculus 19Met Ser Thr Ser Ser Ala Arg Pro Ala Val Leu Ala Leu Ala Gly Leu1 5 10 15Ala Leu Leu Leu Leu Leu Cys Leu Gly Pro Asp Gly Ile Ser Gly Asn 20 25 30Lys Leu Lys Lys Met Leu Gln Lys Arg Glu Gly Pro Val Pro Ser Lys 35 40 45Thr Asn Val Ala Val Ala Glu Asn Thr Ala Lys Glu Phe Leu Gly Gly 50 55 60Leu Lys Arg Ala Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80Gln Gln Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys 85 90 95Phe Glu Asp Asp Val Asn Tyr Trp Leu Asn Arg Asn Arg Asn Gly His 100 105 110Asp Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ala Ala 115 120 125Ile Gly Pro His Ser Arg Glu Ser Phe Arg His Gly Ala Ser Val Asn 130 135 140Tyr Asp Asp Tyr14520447DNAHomo sapiensCDS(1)..(444) 20atg gct gcc tcc ccc gcg cgg cct gct gtc ctg gcc ctg acc ggg ctg 48Met Ala Ala Ser Pro Ala Arg Pro Ala Val Leu Ala Leu Thr Gly Leu1 5 10 15gcg ctg ctc ctg ctc ctg tgc tgg ggc cca ggt ggc ata agt gga aat 96Ala Leu Leu Leu Leu Leu Cys Trp Gly Pro Gly Gly Ile Ser Gly Asn 20 25 30aaa ctc aag ctg atg ctt caa aaa cga gaa gca cct gtt cca act aag 144Lys Leu Lys Leu Met Leu Gln Lys Arg Glu Ala Pro Val Pro Thr Lys 35 40 45act aaa gtg gcc gtt gat gag aat aaa gcc aaa gaa ttc ctt ggc agc 192Thr Lys Val Ala Val Asp Glu Asn Lys Ala Lys Glu Phe Leu Gly Ser 50 55 60ctg aag cgc cag aag cgg cag ctg tgg gac cgg act cgg ccc gag gtg 240Leu Lys Arg Gln Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80cag cag tgg tac cag cag ttt ctc tac atg ggc ttt gac gaa gcg aaa 288Gln Gln Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys 85 90 95ttt gaa gat gac atc acc tat tgg ctt aac aga gat cga aat gga cat 336Phe Glu Asp Asp Ile Thr Tyr Trp Leu Asn Arg Asp Arg Asn Gly His 100 105 110gaa tac tat ggc gat tac tac caa cgt cac tat gat gaa gac tct gca 384Glu Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ser Ala 115 120 125att ggt ccc cgg agc ccc tac ggc ttt agg cat gga gcc agc gtc aac 432Ile Gly Pro Arg Ser Pro Tyr Gly Phe Arg His Gly Ala Ser Val Asn 130 135 140tac gat gac tac taa 447Tyr Asp Asp Tyr14521148PRTHomo sapiens 21Met Ala Ala Ser Pro Ala Arg Pro Ala Val Leu Ala Leu Thr Gly Leu1 5 10 15Ala Leu Leu Leu Leu Leu Cys Trp Gly Pro Gly Gly Ile Ser Gly Asn 20 25 30Lys Leu Lys Leu Met Leu Gln Lys Arg Glu Ala Pro Val Pro Thr Lys 35 40 45Thr Lys Val Ala Val Asp Glu Asn Lys Ala Lys Glu Phe Leu Gly Ser 50 55 60Leu Lys Arg Gln Lys Arg Gln Leu Trp Asp Arg Thr Arg Pro Glu Val65 70 75 80Gln Gln Trp Tyr Gln Gln Phe Leu Tyr Met Gly Phe Asp Glu Ala Lys 85 90 95Phe Glu Asp Asp Ile Thr Tyr Trp Leu Asn Arg Asp Arg Asn Gly His 100 105 110Glu Tyr Tyr Gly Asp Tyr Tyr Gln Arg His Tyr Asp Glu Asp Ser Ala 115 120 125Ile Gly Pro Arg Ser Pro Tyr Gly Phe Arg His Gly Ala Ser Val Asn 130 135 140Tyr Asp Asp Tyr145223132DNAMus musculusCDS(630)..(1358) 22gggggtctgc atctccatcg gaaagtgcgc tggccacatc ccttcggcct ccgggcagtg 60ttctgtctcc cttagctcag gcagcgagaa acttcagctg tgaagtggtg gtggagagag 120ccctgggagc agcgactgga cccggacacc aagaagagag tggacgcgcc cctcgactag 180gaatcgctct cgcaggcgga gacccagcat ctcagcgcct gcggtcgcgc ttgcccggcc 240gcgcgctttt gctaggcgcc gccagccccg aaggaccctc ggggtccgcg gacccttctg 300cagccggcgg aatcctaaag ctgccaagag ctcccggcgg gtgtcggcaa actttttccg 360agcccacgtg ctgaccaaac agcccggctc gcttccagag cctggcatgg agcgccgcgc 420ctaggcacgc cgtgcagccc gagagacgcg agcgcacggt tcaccgtgga gggagagatg 480ctcatcgagc caaattgatc attgcagccc cagggcagtg acatctgtct ctgagtcctc 540cctaggagcg cgacccgcac tgtctccttc caggagcccg tcatttcctc gacttttgag 600aggtgtctct ccccagcccg accgtccag atg cgt ttt tgc ctc ttc tca ttt 653 Met Arg Phe Cys Leu Phe Ser Phe 1 5gcc ctc atc att ctg aac tgt atg gat tac agc cag tgc caa ggc aac 701Ala Leu Ile Ile Leu Asn Cys Met Asp Tyr Ser Gln Cys Gln Gly Asn 10 15 20cga tgg aga cgc aat aag cga gct agt tat gta tca aat ccc att tgc 749Arg Trp Arg Arg Asn Lys Arg Ala Ser Tyr Val Ser Asn Pro Ile Cys25 30 35 40aag ggt tgt ttg tct tgt tcg aag gac aat ggt tgc agc cga tgt caa 797Lys Gly Cys Leu Ser Cys Ser Lys Asp Asn Gly Cys Ser Arg Cys Gln 45 50 55cag aag ttg ttc ttt ttc ctt cga aga gaa gga atg cgt cag tat gga 845Gln Lys Leu Phe Phe Phe Leu Arg Arg Glu Gly Met Arg Gln Tyr Gly 60 65 70gag tgc ctg cat tcc tgc cca tca ggg tat tat gga cac cga gcc cca 893Glu Cys Leu His Ser Cys Pro Ser Gly Tyr Tyr Gly His Arg Ala Pro 75 80 85gat atg aac aga tgt gca cga tgc aga ata gaa aac tgt gat tct tgc 941Asp Met Asn Arg Cys Ala Arg Cys Arg Ile Glu Asn Cys Asp Ser Cys 90 95 100ttt agc aaa gac ttt tgt acg aag tgc aaa gta ggc ttt tat ttg cat 989Phe Ser Lys Asp Phe Cys Thr Lys Cys Lys Val Gly Phe Tyr Leu His105 110 115 120aga ggc cgc tgc ttt gat gaa tgt cca gat ggt ttt gca ccg tta gat 1037Arg Gly Arg Cys Phe Asp Glu Cys Pro Asp Gly Phe Ala Pro Leu Asp 125 130 135gag act atg gaa tgt gta gaa ggt tgt gaa gtt ggt cat tgg agc gaa 1085Glu Thr Met Glu Cys Val Glu Gly Cys Glu Val Gly His Trp Ser Glu 140 145 150tgg gga acg tgt agc aga aac aac cgc acg tgt gga ttt aaa tgg ggt 1133Trp Gly Thr Cys Ser Arg Asn Asn Arg Thr Cys Gly Phe Lys Trp Gly 155 160 165ctg gaa acc aga aca cgg cag att gtt aaa aag cca gca aaa gac aca 1181Leu Glu Thr Arg Thr Arg Gln Ile Val Lys Lys Pro Ala Lys Asp Thr 170 175 180ata cca tgt ccg acc att gcg gag tcc agg aga tgc aag atg gcc atg

1229Ile Pro Cys Pro Thr Ile Ala Glu Ser Arg Arg Cys Lys Met Ala Met185 190 195 200agg cac tgt cca gga gga aag aga aca cca aag gca aaa gag aag aga 1277Arg His Cys Pro Gly Gly Lys Arg Thr Pro Lys Ala Lys Glu Lys Arg 205 210 215aac aag aag aag agg cgg aag ctg att gag aga gcc caa gag cag cac 1325Asn Lys Lys Lys Arg Arg Lys Leu Ile Glu Arg Ala Gln Glu Gln His 220 225 230agc gtc ttc ctc gct aca gac aga gtg aac caa taaaatacaa gaaatagctg 1378Ser Val Phe Leu Ala Thr Asp Arg Val Asn Gln 235 240gggcattttg aggttttctg ttttgtttat gttgttgttt tgcaaaagtg cacaaagcta 1438ctctccagtc cacactggtg gacagcattc ctgatcctct gaccagtatc cattttcagt 1498aatgctgcag agggaggtgc ccaagcatgg actcagcgtt atttatgctt tgattggaat 1558ctggggcctg tgatggcagg agcttgttga gctgagtcag cgggagctga tgcatctgta 1618ctcttgtgat gagcacagtg tgtcataaga acctgtccct ggcacggtgg acccacagga 1678ggcacaaggc tgtagatcac caccagagaa tgcacctgtg cctattttga tggatggcaa 1738tgctaagcaa gcaagcactg ttcacttgtg actttcattt ctcacactgt gcactgtcaa 1798agacaaatgt gcatggaaaa atgtttagtg tcacctcatg gcgttctcag catcagtgac 1858cttcaaacgg tcctacaatg agactgtgtt ctagctaggg gtatgctgtg gaaattcctg 1918ctacatttca tcttagtgct aacatgtaca gattctgctg cgctacattc aaagctcatt 1978actgtatatt tatgctttct ctgtgtaaca agttatacct gataagatgt cactttgttt 2038ctagtgattc ttaaccatgg tctggtacat ggctattcta gttttggaaa ttaacaagtg 2098ttttgttgcc tcttgttttc ttttgttcct atcatttttg gcgggggttg ggtgggcttg 2158attctaaccg taagtatagg ataagctagt tttgtatata gagtcaaatg actgatgtca 2218gaggatcagt gctgatagaa cttccccagt tcatgtcacg atacacacag agagaaagca 2278gcatgaggca tcttgccatc agaagccaaa tttcttttga gtcccaaaat tgatgactta 2338tgaaatatag ctgaaaacaa gatttgggtg tagttacttg tatttattat acaatttcca 2398attacatttt ttttcaaact caaaataacc catgactttg agtgataggt cacttggcaa 2458tgttcttgaa ttactgggga agctgttgtc actaagataa tgagagagaa aatagaatgg 2518cttcgcccaa gtgagagcca catcttacat ttctctgttg aatcggaatc aactatatta 2578gaacagaagc ctgatagaag ctttctagtt aacacacaca aggccatggt ttcaaaaaca 2638tctttgtccc cttaggtcag tttgtcctta gattatgaat tggcaggttc taattgcatt 2698atttccctgg ctgatccagg aaaaagttag aacaaaataa gttgcatagt tttgaggaaa 2758catccaaagc aaggcgaagc ctttccttgc cttgcattgg caaaactacc tctttagcat 2818ttatgttgat tcagaaacat cttgctgata tgtgtagatg ttttaagctt cattgtgaaa 2878atattgatgc aagataagcc atatatgaat gttgtattca actttagggc ttgaaattaa 2938tcctaaagtg ttcacctctc tccatgtcta tttacactct gttcctattt actaagaggg 2998taggggtctc cttaatatca tacttcattg ttaataagtc aatgcttgtt atgtttcttg 3058gctgttgttt ttgtgcatta aaaactcaaa attggaaaaa aaaaaaaaaa aaaaaaaaaa 3118aaaaaaaaaa aaaa 313223243PRTMus musculus 23Met Arg Phe Cys Leu Phe Ser Phe Ala Leu Ile Ile Leu Asn Cys Met1 5 10 15Asp Tyr Ser Gln Cys Gln Gly Asn Arg Trp Arg Arg Asn Lys Arg Ala 20 25 30Ser Tyr Val Ser Asn Pro Ile Cys Lys Gly Cys Leu Ser Cys Ser Lys 35 40 45Asp Asn Gly Cys Ser Arg Cys Gln Gln Lys Leu Phe Phe Phe Leu Arg 50 55 60Arg Glu Gly Met Arg Gln Tyr Gly Glu Cys Leu His Ser Cys Pro Ser65 70 75 80Gly Tyr Tyr Gly His Arg Ala Pro Asp Met Asn Arg Cys Ala Arg Cys 85 90 95Arg Ile Glu Asn Cys Asp Ser Cys Phe Ser Lys Asp Phe Cys Thr Lys 100 105 110Cys Lys Val Gly Phe Tyr Leu His Arg Gly Arg Cys Phe Asp Glu Cys 115 120 125Pro Asp Gly Phe Ala Pro Leu Asp Glu Thr Met Glu Cys Val Glu Gly 130 135 140Cys Glu Val Gly His Trp Ser Glu Trp Gly Thr Cys Ser Arg Asn Asn145 150 155 160Arg Thr Cys Gly Phe Lys Trp Gly Leu Glu Thr Arg Thr Arg Gln Ile 165 170 175Val Lys Lys Pro Ala Lys Asp Thr Ile Pro Cys Pro Thr Ile Ala Glu 180 185 190Ser Arg Arg Cys Lys Met Ala Met Arg His Cys Pro Gly Gly Lys Arg 195 200 205Thr Pro Lys Ala Lys Glu Lys Arg Asn Lys Lys Lys Arg Arg Lys Leu 210 215 220Ile Glu Arg Ala Gln Glu Gln His Ser Val Phe Leu Ala Thr Asp Arg225 230 235 240Val Asn Gln24843DNAMus musculusCDS(132)..(506) 24ggccattatg gccgggggct ttcgccgtcc gggagctgac cggccgtgtt cctctctcgt 60cttcctctgc gccccgcgtc cccgccctcg cgaccccggc tctcctggac tcggcgccgc 120caacctgggc g atg ccc cgc tac gag ttg gct ttg att ctg aaa gcc atg 170 Met Pro Arg Tyr Glu Leu Ala Leu Ile Leu Lys Ala Met 1 5 10cgg cgg cca gag acc gct gct gct ttg aaa cgt aca ata gaa tcc ctg 218Arg Arg Pro Glu Thr Ala Ala Ala Leu Lys Arg Thr Ile Glu Ser Leu 15 20 25atg gac cga gga gcc ata gtg agg aac ttg gaa agc ctg ggt gag cgt 266Met Asp Arg Gly Ala Ile Val Arg Asn Leu Glu Ser Leu Gly Glu Arg30 35 40 45gcg ctc ccc tac agg atc tcg agt cac agc cag cag cac agc cga gga 314Ala Leu Pro Tyr Arg Ile Ser Ser His Ser Gln Gln His Ser Arg Gly 50 55 60ggg tat ttc ctg gtg gat ttt tat gct ccg aca agt gct gtg gag aac 362Gly Tyr Phe Leu Val Asp Phe Tyr Ala Pro Thr Ser Ala Val Glu Asn 65 70 75ata ctg gaa cac ttg gcg cga gac att gac gtg gtt aga cca aat att 410Ile Leu Glu His Leu Ala Arg Asp Ile Asp Val Val Arg Pro Asn Ile 80 85 90gtg aaa cac cct ctg acc cag gaa gta aaa gag tgt gac ggc ata gtc 458Val Lys His Pro Leu Thr Gln Glu Val Lys Glu Cys Asp Gly Ile Val 95 100 105cca gtc cca ctt gaa gaa aaa ctg tat tca aca aag agg agg aag aag 506Pro Val Pro Leu Glu Glu Lys Leu Tyr Ser Thr Lys Arg Arg Lys Lys110 115 120 125tgagaagatt caccagattc tggccttata tttaatccta agggcactat gggtgctgct 566aggttgttgt ctaggatact ttagcccatg accattttgc tgcaggaggt agaaactgct 626ggccgagacc tgccctgatg tctctgctga gatttcatcc cacttgtggg gtttgtcggg 686agtgggggtg ttcacagtac cactgtagcg tttccaagag caaaatgttt gtcattcaca 746cttggttgtc ttgcaagcct atatggaaca ctgggagcag agtaataaac atgactttat 806caacactgga aaaaaaaaaa aaaaaaaaaa aaaaaaa 84325125PRTMus musculus 25Met Pro Arg Tyr Glu Leu Ala Leu Ile Leu Lys Ala Met Arg Arg Pro1 5 10 15Glu Thr Ala Ala Ala Leu Lys Arg Thr Ile Glu Ser Leu Met Asp Arg 20 25 30Gly Ala Ile Val Arg Asn Leu Glu Ser Leu Gly Glu Arg Ala Leu Pro 35 40 45Tyr Arg Ile Ser Ser His Ser Gln Gln His Ser Arg Gly Gly Tyr Phe 50 55 60Leu Val Asp Phe Tyr Ala Pro Thr Ser Ala Val Glu Asn Ile Leu Glu65 70 75 80His Leu Ala Arg Asp Ile Asp Val Val Arg Pro Asn Ile Val Lys His 85 90 95Pro Leu Thr Gln Glu Val Lys Glu Cys Asp Gly Ile Val Pro Val Pro 100 105 110Leu Glu Glu Lys Leu Tyr Ser Thr Lys Arg Arg Lys Lys 115 120 125262490DNAMus musculusCDS(1)..(2487) 26atg aag ccg ccc ggc agc atc tcc cgg cgg ccg acc ctg acg ggt tgc 48Met Lys Pro Pro Gly Ser Ile Ser Arg Arg Pro Thr Leu Thr Gly Cys1 5 10 15agc ctt ccc ggc gcc tcc tgc ggc ccc ggc cgc tgc ccc gcc ggc ccg 96Ser Leu Pro Gly Ala Ser Cys Gly Pro Gly Arg Cys Pro Ala Gly Pro 20 25 30gtg ccg gcc cgc gcg ccg ccc tgc cgc ctg ctc ctc gtc ctt ctc ctg 144Val Pro Ala Arg Ala Pro Pro Cys Arg Leu Leu Leu Val Leu Leu Leu 35 40 45cta cct gcg ctc gcc acc tca tcc cgg ccc cgt gcc cgg ggg gcc gct 192Leu Pro Ala Leu Ala Thr Ser Ser Arg Pro Arg Ala Arg Gly Ala Ala 50 55 60gcg ccc agc gct ccg cac tgg aat gaa act gca gaa aaa acc ctg gga 240Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu Lys Thr Leu Gly65 70 75 80gtc ctg gca gat gaa gac aac aca ttg caa caa aat agc agc agc aga 288Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn Ser Ser Ser Arg 85 90 95aat acc agc tac agc agt gca gtg caa aaa gaa atc aca ctg cct tca 336Asn Thr Ser Tyr Ser Ser Ala Val Gln Lys Glu Ile Thr Leu Pro Ser 100 105 110aga ctg gtg tat tac atc aac cag gac tca gaa agc ccc tat cat gtt 384Arg Leu Val Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro Tyr His Val 115 120 125ctt gac aca aag gcc aga cac caa cag aaa cac aat aag gct gtg cat 432Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn Lys Ala Val His 130 135 140ctg gcc cag gca agc ttc cag atc gaa gct ttc ggc tcc aag ttc att 480Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser Lys Phe Ile145 150 155 160ctt gac ctc aca ctg aac aat ggt ttg cta tct tct gac tac gtg gag 528Leu Asp Leu Thr Leu Asn Asn Gly Leu Leu Ser Ser Asp Tyr Val Glu 165 170 175atc cac tat gaa gac ggg aag cag atg tac tct aag ggt gga gag cac 576Ile His Tyr Glu Asp Gly Lys Gln Met Tyr Ser Lys Gly Gly Glu His 180 185 190tgt tac tac cac gga agc atc aga ggc gtc aag gat tcc agg gtg gct 624Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser Arg Val Ala 195 200 205cta tcg acc tgc aat gga ctc cat ggc atg ttt gag gat gac acc ttt 672Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp Asp Thr Phe 210 215 220gtg tat atg ata gag cct ctg gaa ctg act gat gat gag aaa agc aca 720Val Tyr Met Ile Glu Pro Leu Glu Leu Thr Asp Asp Glu Lys Ser Thr225 230 235 240ggc cga ccg cac ata atc cag aaa acc ttg gca gga cag tat tct aag 768Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly Gln Tyr Ser Lys 245 250 255cag atg aag aat ctc agc aca gat ggc agt gac cag tgg cct ttg cta 816Gln Met Lys Asn Leu Ser Thr Asp Gly Ser Asp Gln Trp Pro Leu Leu 260 265 270cct gaa tta caa tgg ctg aga aga agg aaa aga gcg gtc aat cca tct 864Pro Glu Leu Gln Trp Leu Arg Arg Arg Lys Arg Ala Val Asn Pro Ser 275 280 285cgt ggt gtg ttt gaa gaa atg aag tat ttg gag ctt atg att gtt aat 912Arg Gly Val Phe Glu Glu Met Lys Tyr Leu Glu Leu Met Ile Val Asn 290 295 300gat cac aag acg tat aag aag cac cgc tct tct cac gcg cat acc aac 960Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala His Thr Asn305 310 315 320aac ttc gca aag tct gtg gtc aac ctt gta gat tct att tac aag gaa 1008Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile Tyr Lys Glu 325 330 335cag ctc aac acc agg gtt gtc ctg gtg gct gtc gag acc tgg acc gag 1056Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr Trp Thr Glu 340 345 350aag gat cac att gac atc acc atc aac ccc gtg cag atg cta cat gac 1104Lys Asp His Ile Asp Ile Thr Ile Asn Pro Val Gln Met Leu His Asp 355 360 365ttc tcc aag tac cgg cag cga atc aaa cag cac gct gac gcg gtc cac 1152Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln His Ala Asp Ala Val His 370 375 380ctc atc tcg cgc gtg aca ttc cat tat aag aga agc agt ctg agt tac 1200Leu Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser Leu Ser Tyr385 390 395 400ttt gga ggc gtg tgt tct cga ata aga ggg gtt ggt gtg aat gag tat 1248Phe Gly Gly Val Cys Ser Arg Ile Arg Gly Val Gly Val Asn Glu Tyr 405 410 415ggt ctt cca atg gcg gtg gca caa gta tta tca cag agc ctg gct caa 1296Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser Leu Ala Gln 420 425 430aac ctt gga atc cag tgg gaa cct tcg agc agg aag cca aaa tgt gaa 1344Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro Lys Cys Glu 435 440 445tgc ata gag tcc tgg ggc ggc tgc atc atg gaa gaa aca ggg gtg tcc 1392Cys Ile Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr Gly Val Ser 450 455 460cac tct cga aag ttc tca aag tgc agc att ttg gag tac aga gac ttt 1440His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu Tyr Arg Asp Phe465 470 475 480tta cag aga ggt ggc gga gca tgt ctt ttc aat agg cca act aag ctg 1488Leu Gln Arg Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro Thr Lys Leu 485 490 495ttt gag ccc acg gaa tgt gga aat gga tat gtg gag gcc ggg gag gaa 1536Phe Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala Gly Glu Glu 500 505 510tgc gac tgt ggt ttc cat gtg gaa tgc tat gga gtt tgc tgt aag aag 1584Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Val Cys Cys Lys Lys 515 520 525tgt tcg ctc tcc aat ggg gcc cac tgc agt gac ggc ccc tgc tgt aac 1632Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro Cys Cys Asn 530 535 540aac acc tca tgt ctt ttt cag tca cga ggg tat gaa tgt cgg gat gcc 1680Asn Thr Ser Cys Leu Phe Gln Ser Arg Gly Tyr Glu Cys Arg Asp Ala545 550 555 560gta aac agc tgt gat atc acc gag tac tgc act gga gac tct ggc cag 1728Val Asn Ser Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp Ser Gly Gln 565 570 575tgc cca ccg aac ctc cat aaa caa gat ggc tat agc tgc aat caa aat 1776Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ser Cys Asn Gln Asn 580 585 590cag ggt cgc tgc tac aat ggc gag tgc aag aca agg gac aat caa tgc 1824Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp Asn Gln Cys 595 600 605cag tac atc tgg ggg aca aag gct gcg ggg tca gac aag ttc tgc tat 1872Gln Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys Phe Cys Tyr 610 615 620gaa aag ctg aac acg gaa ggc acc gag aag ggc aat tgt gga aag gat 1920Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys Gly Lys Asp625 630 635 640gga gac cgg tgg atc ccg tgc agc aag cat gat gtg ttc tgt gga ttt 1968Gly Asp Arg Trp Ile Pro Cys Ser Lys His Asp Val Phe Cys Gly Phe 645 650 655ctg ctt tgc acc aat ctt acc cga gct cca cgt atc ggt caa ctt caa 2016Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly Gln Leu Gln 660 665 670gga gag atc atc ccg act tcc ttc tat cat caa ggc cga gtg att gac 2064Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg Val Ile Asp 675 680 685tgc agt ggt gct cat gta gtt tta gac gat gat aca gac gtg ggt tac 2112Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr Asp Val Gly Tyr 690 695 700gtt gaa gat ggg act ccg tgt ggc ccc tcc atg atg tgc tta gat cgg 2160Val Glu Asp Gly Thr Pro Cys Gly Pro Ser Met Met Cys Leu Asp Arg705 710 715 720aag tgc cta cag att caa gcc ctg aat atg agc agc tgc cca ctt gac 2208Lys Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys Pro Leu Asp 725 730 735tca agg ggt aaa gtc tgc tcc ggc cac ggg gtg tgt agc aac gaa gcc 2256Ser Arg Gly Lys Val Cys Ser Gly His Gly Val Cys Ser Asn Glu Ala 740 745 750acc tgc atc tgt gat ttc act tgg gca ggc aca gac tgc agc atc cgg 2304Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys Ser Ile Arg 755 760 765gat cca gtt cgg aac ccc aac ccc cct aag gat gaa ggc cct aag ggt 2352Asp Pro Val Arg Asn Pro Asn Pro Pro Lys Asp Glu Gly Pro Lys Gly 770 775 780cct agc gcc acc aat ctc ata ata ggc tcc atc gct ggt gcc atc ctg 2400Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly Ala Ile Leu785 790 795 800gta gca gct att gtc ctt ggg ggc aca ggc tgg gga ttt aaa aac gtc 2448Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly Phe Lys Asn Val 805 810 815aag aag agg aga ttc gat ccc act cag caa ggc ccc atc tga 2490Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln Gly Pro Ile 820 82527829PRTMus musculus 27Met Lys Pro Pro Gly Ser Ile Ser Arg Arg Pro Thr Leu Thr Gly Cys1 5 10 15Ser Leu Pro Gly Ala Ser Cys Gly Pro Gly Arg Cys Pro Ala Gly Pro 20 25 30Val Pro Ala Arg Ala Pro Pro Cys Arg Leu Leu Leu Val Leu Leu Leu 35 40 45Leu Pro Ala Leu Ala Thr Ser Ser Arg Pro Arg Ala Arg Gly Ala Ala 50 55 60Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu Lys Thr Leu Gly65 70 75 80Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln

Asn Ser Ser Ser Arg 85 90 95Asn Thr Ser Tyr Ser Ser Ala Val Gln Lys Glu Ile Thr Leu Pro Ser 100 105 110Arg Leu Val Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro Tyr His Val 115 120 125Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn Lys Ala Val His 130 135 140Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser Lys Phe Ile145 150 155 160Leu Asp Leu Thr Leu Asn Asn Gly Leu Leu Ser Ser Asp Tyr Val Glu 165 170 175Ile His Tyr Glu Asp Gly Lys Gln Met Tyr Ser Lys Gly Gly Glu His 180 185 190Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser Arg Val Ala 195 200 205Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp Asp Thr Phe 210 215 220Val Tyr Met Ile Glu Pro Leu Glu Leu Thr Asp Asp Glu Lys Ser Thr225 230 235 240Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly Gln Tyr Ser Lys 245 250 255Gln Met Lys Asn Leu Ser Thr Asp Gly Ser Asp Gln Trp Pro Leu Leu 260 265 270Pro Glu Leu Gln Trp Leu Arg Arg Arg Lys Arg Ala Val Asn Pro Ser 275 280 285Arg Gly Val Phe Glu Glu Met Lys Tyr Leu Glu Leu Met Ile Val Asn 290 295 300Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala His Thr Asn305 310 315 320Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile Tyr Lys Glu 325 330 335Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr Trp Thr Glu 340 345 350Lys Asp His Ile Asp Ile Thr Ile Asn Pro Val Gln Met Leu His Asp 355 360 365Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln His Ala Asp Ala Val His 370 375 380Leu Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser Leu Ser Tyr385 390 395 400Phe Gly Gly Val Cys Ser Arg Ile Arg Gly Val Gly Val Asn Glu Tyr 405 410 415Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser Leu Ala Gln 420 425 430Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro Lys Cys Glu 435 440 445Cys Ile Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr Gly Val Ser 450 455 460His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu Tyr Arg Asp Phe465 470 475 480Leu Gln Arg Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro Thr Lys Leu 485 490 495Phe Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala Gly Glu Glu 500 505 510Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Val Cys Cys Lys Lys 515 520 525Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro Cys Cys Asn 530 535 540Asn Thr Ser Cys Leu Phe Gln Ser Arg Gly Tyr Glu Cys Arg Asp Ala545 550 555 560Val Asn Ser Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp Ser Gly Gln 565 570 575Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ser Cys Asn Gln Asn 580 585 590Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp Asn Gln Cys 595 600 605Gln Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys Phe Cys Tyr 610 615 620Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys Gly Lys Asp625 630 635 640Gly Asp Arg Trp Ile Pro Cys Ser Lys His Asp Val Phe Cys Gly Phe 645 650 655Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly Gln Leu Gln 660 665 670Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg Val Ile Asp 675 680 685Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr Asp Val Gly Tyr 690 695 700Val Glu Asp Gly Thr Pro Cys Gly Pro Ser Met Met Cys Leu Asp Arg705 710 715 720Lys Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys Pro Leu Asp 725 730 735Ser Arg Gly Lys Val Cys Ser Gly His Gly Val Cys Ser Asn Glu Ala 740 745 750Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys Ser Ile Arg 755 760 765Asp Pro Val Arg Asn Pro Asn Pro Pro Lys Asp Glu Gly Pro Lys Gly 770 775 780Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly Ala Ile Leu785 790 795 800Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly Phe Lys Asn Val 805 810 815Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln Gly Pro Ile 820 825282499DNAHomo sapiensCDS(1)..(2496) 28atg aag ccg ccc ggc agc agc tcg cgg cag ccg ccc ctg gcg ggc tgc 48Met Lys Pro Pro Gly Ser Ser Ser Arg Gln Pro Pro Leu Ala Gly Cys1 5 10 15agc ctt gcc ggc gct tcc tgc ggc ccc caa cgc ggc ccc gcc ggc tcg 96Ser Leu Ala Gly Ala Ser Cys Gly Pro Gln Arg Gly Pro Ala Gly Ser 20 25 30gtg cct gcc agc gcc ccg gcc cgc acg ccg ccc tgc cgc ctg ctt ctc 144Val Pro Ala Ser Ala Pro Ala Arg Thr Pro Pro Cys Arg Leu Leu Leu 35 40 45gtc ctt ctc ctg ctg cct ccg ctc gcc gcc tcg tcc cgg ccc cgc gcc 192Val Leu Leu Leu Leu Pro Pro Leu Ala Ala Ser Ser Arg Pro Arg Ala 50 55 60tgg ggg gct gct gcg ccc agc gct ccg cat tgg aat gaa act gca gaa 240Trp Gly Ala Ala Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu65 70 75 80aaa aat ttg gga gtc ctg gca gat gaa gac aat aca ttg caa cag aat 288Lys Asn Leu Gly Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn 85 90 95agc agc agt aat atc agt tac agc aat gca atg cag aaa gaa atc aca 336Ser Ser Ser Asn Ile Ser Tyr Ser Asn Ala Met Gln Lys Glu Ile Thr 100 105 110ctg cct tca aga ctc ata tat tac atc aac caa gac tcg gaa agc cct 384Leu Pro Ser Arg Leu Ile Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro 115 120 125tat cac gtt ctt gac aca aag gca aga cac cag caa aaa cat aat aag 432Tyr His Val Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn Lys 130 135 140gct gtc cat ctg gcc cag gca agc ttc cag att gaa gcc ttc ggc tcc 480Ala Val His Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser145 150 155 160aaa ttc att ctt gac ctc ata ctg aac aat ggt ttg ttg tct tct gat 528Lys Phe Ile Leu Asp Leu Ile Leu Asn Asn Gly Leu Leu Ser Ser Asp 165 170 175tat gtg gag att cac tac gaa aat ggg aaa cca cag tac tct aag ggt 576Tyr Val Glu Ile His Tyr Glu Asn Gly Lys Pro Gln Tyr Ser Lys Gly 180 185 190gga gag cac tgt tac tac cat gga agc atc aga ggc gtc aaa gac tcc 624Gly Glu His Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser 195 200 205aag gtg gct ctg tca acc tgc aat gga ctt cat ggc atg ttt gaa gat 672Lys Val Ala Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp 210 215 220gat acc ttc gtg tat atg ata gag cca cta gag ctg gtt cat gat gag 720Asp Thr Phe Val Tyr Met Ile Glu Pro Leu Glu Leu Val His Asp Glu225 230 235 240aaa agc aca ggt cga cca cat ata atc cag aaa acc ttg gca gga cag 768Lys Ser Thr Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly Gln 245 250 255tat tct aag caa atg aag aat ctc act atg gaa aga ggt gac cag tgg 816Tyr Ser Lys Gln Met Lys Asn Leu Thr Met Glu Arg Gly Asp Gln Trp 260 265 270ccc ttt ctc tct gaa tta cag tgg ttg aaa aga agg aag aga gca gtg 864Pro Phe Leu Ser Glu Leu Gln Trp Leu Lys Arg Arg Lys Arg Ala Val 275 280 285aat cca tca cgt ggt ata ttt gaa gaa atg aaa tat ttg gaa ctt atg 912Asn Pro Ser Arg Gly Ile Phe Glu Glu Met Lys Tyr Leu Glu Leu Met 290 295 300att gtt aat gat cac aaa acg tat aag aag cat cgc tct tct cat gca 960Ile Val Asn Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala305 310 315 320cat acc aac aac ttt gca aag tcc gtg gtc aac ctt gtg gat tct att 1008His Thr Asn Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile 325 330 335tac aag gag cag ctc aac acc agg gtt gtc ctg gtg gct gta gag acc 1056Tyr Lys Glu Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr 340 345 350tgg act gag aag gat cag att gac atc acc acc aac cct gtg cag atg 1104Trp Thr Glu Lys Asp Gln Ile Asp Ile Thr Thr Asn Pro Val Gln Met 355 360 365ctc cat gag ttc tca aaa tac cgg cag cgc att aag cag cat gct gat 1152Leu His Glu Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln His Ala Asp 370 375 380gct gtg cac ctc atc tcg cgg gtg aca ttt cac tat aag aga agc agt 1200Ala Val His Leu Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser385 390 395 400ctg agt tac ttt gga ggt gtc tgt tct cgc aca aga gga gtt ggt gtg 1248Leu Ser Tyr Phe Gly Gly Val Cys Ser Arg Thr Arg Gly Val Gly Val 405 410 415aat gag tat ggt ctt cca atg gca gtg gca caa gta tta tcg cag agc 1296Asn Glu Tyr Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser 420 425 430ctg gct caa aac ctt gga atc caa tgg gaa cct tct agc aga aag cca 1344Leu Ala Gln Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro 435 440 445aaa tgt gac tgc aca gaa tcc tgg ggt ggc tgc atc atg gag gaa aca 1392Lys Cys Asp Cys Thr Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr 450 455 460ggg gtg tcc cat tct cga aaa ttt tca aag tgc agc att ttg gag tat 1440Gly Val Ser His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu Tyr465 470 475 480aga gac ttt tta cag aga gga ggt gga gcc tgc ctt ttc aac agg cca 1488Arg Asp Phe Leu Gln Arg Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro 485 490 495aca aag cta ttt gag ccc acg gaa tgt gga aat gga tac gtg gaa gct 1536Thr Lys Leu Phe Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala 500 505 510ggg gag gag tgt gat tgt ggt ttt cat gtg gaa tgc tat gga tta tgc 1584Gly Glu Glu Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Leu Cys 515 520 525tgt aag aaa tgt tcc ctc tcc aac ggg gct cac tgc agc gac ggg ccc 1632Cys Lys Lys Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro 530 535 540tgc tgt aac aat acc tca tgt ctt ttt cag cca cga ggg tat gaa tgc 1680Cys Cys Asn Asn Thr Ser Cys Leu Phe Gln Pro Arg Gly Tyr Glu Cys545 550 555 560cgg gat gct gtg aac gag tgt gat att act gaa tat tgt act gga gac 1728Arg Asp Ala Val Asn Glu Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp 565 570 575tct ggt cag tgc cca cca aat ctt cat aag caa gac gga tat gca tgc 1776Ser Gly Gln Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ala Cys 580 585 590aat caa aat cag ggc cgc tgc tac aat ggc gag tgc aag acc aga gac 1824Asn Gln Asn Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp 595 600 605aac cag tgt cag tac atc tgg gga aca aag gct gca ggg tct gac aag 1872Asn Gln Cys Gln Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys 610 615 620ttc tgc tat gaa aag ctg aat aca gaa ggc act gag aag gga aac tgc 1920Phe Cys Tyr Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys625 630 635 640ggg aag gat gga gac cgg tgg att cag tgc agc aaa cat gat gtg ttc 1968Gly Lys Asp Gly Asp Arg Trp Ile Gln Cys Ser Lys His Asp Val Phe 645 650 655tgt gga ttc tta ctc tgt acc aat ctt act cga gct cca cgt att ggt 2016Cys Gly Phe Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly 660 665 670caa ctt cag ggt gag atc att cca act tcc ttc tac cat caa ggc cgg 2064Gln Leu Gln Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg 675 680 685gtg att gac tgc agt ggt gcc cat gta gtt tta gat gat gat acg gat 2112Val Ile Asp Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr Asp 690 695 700gtg ggc tat gta gaa gat gga acg cca tgt ggc ccg tct atg atg tgt 2160Val Gly Tyr Val Glu Asp Gly Thr Pro Cys Gly Pro Ser Met Met Cys705 710 715 720tta gat cgg aag tgc cta caa att caa gcc cta aat atg agc agc tgt 2208Leu Asp Arg Lys Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys 725 730 735cca ctc gat tcc aag ggt aaa gtc tgt tcg ggc cat ggg gtg tgt agt 2256Pro Leu Asp Ser Lys Gly Lys Val Cys Ser Gly His Gly Val Cys Ser 740 745 750aat gaa gcc acc tgc att tgt gat ttc acc tgg gca ggg aca gat tgc 2304Asn Glu Ala Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys 755 760 765agt atc cgg gat cca gtt agg aac ctt cac ccc ccc aag gat gaa gga 2352Ser Ile Arg Asp Pro Val Arg Asn Leu His Pro Pro Lys Asp Glu Gly 770 775 780ccc aag ggt cct agt gcc acc aat ctc ata ata ggc tcc atc gct ggt 2400Pro Lys Gly Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly785 790 795 800gcc atc ctg gta gca gct att gtc ctt ggg ggc aca ggc tgg gga ttt 2448Ala Ile Leu Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly Phe 805 810 815aaa aat gtc aag aag aga agg ttc gat cct act cag caa ggc ccc atc 2496Lys Asn Val Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln Gly Pro Ile 820 825 830tga 249929832PRTHomo sapiens 29Met Lys Pro Pro Gly Ser Ser Ser Arg Gln Pro Pro Leu Ala Gly Cys1 5 10 15Ser Leu Ala Gly Ala Ser Cys Gly Pro Gln Arg Gly Pro Ala Gly Ser 20 25 30Val Pro Ala Ser Ala Pro Ala Arg Thr Pro Pro Cys Arg Leu Leu Leu 35 40 45Val Leu Leu Leu Leu Pro Pro Leu Ala Ala Ser Ser Arg Pro Arg Ala 50 55 60Trp Gly Ala Ala Ala Pro Ser Ala Pro His Trp Asn Glu Thr Ala Glu65 70 75 80Lys Asn Leu Gly Val Leu Ala Asp Glu Asp Asn Thr Leu Gln Gln Asn 85 90 95Ser Ser Ser Asn Ile Ser Tyr Ser Asn Ala Met Gln Lys Glu Ile Thr 100 105 110Leu Pro Ser Arg Leu Ile Tyr Tyr Ile Asn Gln Asp Ser Glu Ser Pro 115 120 125Tyr His Val Leu Asp Thr Lys Ala Arg His Gln Gln Lys His Asn Lys 130 135 140Ala Val His Leu Ala Gln Ala Ser Phe Gln Ile Glu Ala Phe Gly Ser145 150 155 160Lys Phe Ile Leu Asp Leu Ile Leu Asn Asn Gly Leu Leu Ser Ser Asp 165 170 175Tyr Val Glu Ile His Tyr Glu Asn Gly Lys Pro Gln Tyr Ser Lys Gly 180 185 190Gly Glu His Cys Tyr Tyr His Gly Ser Ile Arg Gly Val Lys Asp Ser 195 200 205Lys Val Ala Leu Ser Thr Cys Asn Gly Leu His Gly Met Phe Glu Asp 210 215 220Asp Thr Phe Val Tyr Met Ile Glu Pro Leu Glu Leu Val His Asp Glu225 230 235 240Lys Ser Thr Gly Arg Pro His Ile Ile Gln Lys Thr Leu Ala Gly Gln 245 250 255Tyr Ser Lys Gln Met Lys Asn Leu Thr Met Glu Arg Gly Asp Gln Trp 260 265 270Pro Phe Leu Ser Glu Leu Gln Trp Leu Lys Arg Arg Lys Arg Ala Val 275 280 285Asn Pro Ser Arg Gly Ile Phe Glu Glu Met Lys Tyr Leu Glu Leu Met 290 295 300Ile Val Asn Asp His Lys Thr Tyr Lys Lys His Arg Ser Ser His Ala305 310 315 320His Thr Asn Asn Phe Ala Lys Ser Val Val Asn Leu Val Asp Ser Ile 325 330 335Tyr Lys Glu Gln Leu Asn Thr Arg Val Val Leu Val Ala Val Glu Thr 340 345 350Trp Thr Glu Lys Asp Gln Ile Asp Ile Thr Thr Asn Pro Val Gln Met 355 360 365Leu His Glu Phe Ser Lys Tyr Arg Gln Arg Ile Lys Gln His Ala Asp 370 375

380Ala Val His Leu Ile Ser Arg Val Thr Phe His Tyr Lys Arg Ser Ser385 390 395 400Leu Ser Tyr Phe Gly Gly Val Cys Ser Arg Thr Arg Gly Val Gly Val 405 410 415Asn Glu Tyr Gly Leu Pro Met Ala Val Ala Gln Val Leu Ser Gln Ser 420 425 430Leu Ala Gln Asn Leu Gly Ile Gln Trp Glu Pro Ser Ser Arg Lys Pro 435 440 445Lys Cys Asp Cys Thr Glu Ser Trp Gly Gly Cys Ile Met Glu Glu Thr 450 455 460Gly Val Ser His Ser Arg Lys Phe Ser Lys Cys Ser Ile Leu Glu Tyr465 470 475 480Arg Asp Phe Leu Gln Arg Gly Gly Gly Ala Cys Leu Phe Asn Arg Pro 485 490 495Thr Lys Leu Phe Glu Pro Thr Glu Cys Gly Asn Gly Tyr Val Glu Ala 500 505 510Gly Glu Glu Cys Asp Cys Gly Phe His Val Glu Cys Tyr Gly Leu Cys 515 520 525Cys Lys Lys Cys Ser Leu Ser Asn Gly Ala His Cys Ser Asp Gly Pro 530 535 540Cys Cys Asn Asn Thr Ser Cys Leu Phe Gln Pro Arg Gly Tyr Glu Cys545 550 555 560Arg Asp Ala Val Asn Glu Cys Asp Ile Thr Glu Tyr Cys Thr Gly Asp 565 570 575Ser Gly Gln Cys Pro Pro Asn Leu His Lys Gln Asp Gly Tyr Ala Cys 580 585 590Asn Gln Asn Gln Gly Arg Cys Tyr Asn Gly Glu Cys Lys Thr Arg Asp 595 600 605Asn Gln Cys Gln Tyr Ile Trp Gly Thr Lys Ala Ala Gly Ser Asp Lys 610 615 620Phe Cys Tyr Glu Lys Leu Asn Thr Glu Gly Thr Glu Lys Gly Asn Cys625 630 635 640Gly Lys Asp Gly Asp Arg Trp Ile Gln Cys Ser Lys His Asp Val Phe 645 650 655Cys Gly Phe Leu Leu Cys Thr Asn Leu Thr Arg Ala Pro Arg Ile Gly 660 665 670Gln Leu Gln Gly Glu Ile Ile Pro Thr Ser Phe Tyr His Gln Gly Arg 675 680 685Val Ile Asp Cys Ser Gly Ala His Val Val Leu Asp Asp Asp Thr Asp 690 695 700Val Gly Tyr Val Glu Asp Gly Thr Pro Cys Gly Pro Ser Met Met Cys705 710 715 720Leu Asp Arg Lys Cys Leu Gln Ile Gln Ala Leu Asn Met Ser Ser Cys 725 730 735Pro Leu Asp Ser Lys Gly Lys Val Cys Ser Gly His Gly Val Cys Ser 740 745 750Asn Glu Ala Thr Cys Ile Cys Asp Phe Thr Trp Ala Gly Thr Asp Cys 755 760 765Ser Ile Arg Asp Pro Val Arg Asn Leu His Pro Pro Lys Asp Glu Gly 770 775 780Pro Lys Gly Pro Ser Ala Thr Asn Leu Ile Ile Gly Ser Ile Ala Gly785 790 795 800Ala Ile Leu Val Ala Ala Ile Val Leu Gly Gly Thr Gly Trp Gly Phe 805 810 815Lys Asn Val Lys Lys Arg Arg Phe Asp Pro Thr Gln Gln Gly Pro Ile 820 825 8303037DNAArtificial Sequenceprimer 30ccggtcgacc accatggaac tccggacccg aggctgg 373132DNAArtificial Sequenceprimer 31ccgaattctt accgccacct gggcctggct gc 323235DNAArtificial Sequenceprimer 32ccgctcgagc caccatgaag ccttttcata ctgcc 353330DNAArtificial Sequenceprimer 33tccgaattct tattgtttgt aggtccgtgg 303436DNAArtificial Sequenceprimer 34ccgctcgagc caccatgttg gctgcaaggc tggtgt 363531DNAArtificial Sequenceprimer 35ccggatatct catttctttc tgttgcctcc a 313634DNAArtificial Sequenceprimer 36ccgctcgagc caccatgagc acctcgtctg cgcg 343729DNAArtificial Sequenceprimer 37tccgttaact taatagtcat catagttca 293820DNAArtificial Sequenceprimer 38agctcattac tgtatattta 203920DNAArtificial Sequenceprimer 39gctatatttc ataagtcatc 204026DNAArtificial Sequenceprimer 40ctcgggaagc gcgccattgt gttggt 264134DNAArtificial Sequenceprimer 41ccgctcgagc caccatgcgt ttttgcctct tctc 344228DNAArtificial Sequenceprimer 42cggaattctt attggttcac tctgtctg 284333DNAArtificial Sequenceprimer 43acgcgtcgac ccaccatgcc ccgctacgag ttg 334429DNAArtificial Sequenceprimer 44attgaattct cacttcttcc tcctctttg 294535DNAArtificial Sequenceprimer 45ccgctcgagc caccatgaag ccgcccggca gcatc 354629DNAArtificial Sequenceprimer 46cggaattctc agatggggcc ttgctgagt 29

Claims

1. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide, wherein the polypeptide comprises: (a) the amino acid sequence of SEQ ID NO:19; (b) the amino acid sequence of SEQ ID NO:25; or (c) the amino acid sequence of (a) or (b) which includes a deletion, substitution or insertion of one or several amino acids and which has an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

2. The DNA molecule of claim 1, wherein the DNA molecule comprises a nucleotide sequence of (a) nucleotides 1 to 444 of SEQ ID NO: 18, (b) nucleotides 132 to 506 of SEQ ID NO: 24, or (c) a nucleotide sequence that hybridizes to a nucleotide sequence as defined in (a) or (b) under one of the following stringent conditions: (1) wash in 6.times.SSC, 5.times.Denhardt, 0.5% SDS at 68.degree. C. or (2) wash in 6.times.SSC, 5.times.Denhardt, 0.5% SDS 50% formamide at 42.degree. C.; and wherein the nucleotide sequence of (c) encodes a polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

3. The DNA molecule of claim 1, wherein the DNA molecule comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 19 or the amino acid sequence of SEQ ID NO:25.

4. An expression vector comprising the DNA of claim 1 and a gene expression regulatory sequence.

5. An isolated cell comprising the DNA molecule of claim 4.

6. An isolated polypeptide encoded by the DNA molecule of claim 1, the polypeptide having an activity to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells.

7. The polypeptide of claim 6, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:19 or 25.

8. The polypeptide of claim 6, which is modified with one or more modifying agents selected from the group consisting of polyethylene glycol (PEG), dextran, poly(N-vinyl-pyrrolidone), polypropylene glycol homopolymer, copolymer of polypropylene oxide/ethylene oxide, polyoxyethylated polyol and polyvinyl alcohol.

9. An antibody which binds to the polypeptide of claim 6.

10. The antibody of claim 9, wherein the antibody is a monoclonal antibody.

11. A method for supporting proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, comprising the step of co-culturing stromal cells which express the DNA molecule of claim 2 with CD-34-positive hematopoietic stem cells, under conditions that support proliferation or survival of said hematopoietic stem cells or hematopoietic progenitor cells.

12. The method of claim 10, wherein the DNA molecule encodes a polypeptide comprising the sequence of SEQ ID NO: 19 or 25.

13. A method for supporting proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, comprising the step of culturing CD-34-positive hematopoietic stem cells or erythroid progenitor cells in the presence of a polypeptide according to claim 6, under conditions that support proliferation or survival of said hematopoietic stem cells or hematopoietic progenitor cells.

14. A method for supporting proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, comprising the step of culturing CD-34-positive hematopoietic stem cells or erythroid progenitor cells in the presence of a polypeptide according to claim 7, under conditions that support proliferation or survival of said hematopoietic stem cells or hematopoietic progenitor cells.

15. A composition having an effect to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, which comprises an effective amount of a polypeptide according to claim 6.

16. A composition having an effect to support proliferation or survival of hematopoietic stem cells or hematopoietic progenitor cells, which comprises an effective amount of a polypeptide according to claim 7.

17. A composition comprising the polypeptide of claim 6.

18. A composition comprising the polypeptide of claim 7.