U.S. patent application number 11/983052 was filed with the patent office on 2008-09-18 for novel cancer associated protein.
This patent application is currently assigned to UCB Pharma S.A.. Invention is credited to Jonathan Alexander Terrett.
Application Number | 20080226644 11/983052 |
Document ID | / |
Family ID | 26246193 |
Filed Date | 2008-09-18 |
United States Patent
Application |
20080226644 |
Kind Code |
A1 |
Terrett; Jonathan
Alexander |
September 18, 2008 |
Novel cancer associated protein
Abstract
The present invention relates to a novel polypeptide (BCMP 101)
compositions comprising the polypeptide, including vaccines, and
antibodies that are immunospecific for the polypeptide. The use of
the polypeptide in the diagnosis, prophylaxis and treatment of
cancer, in particular breast cancer is also provided.
Inventors: |
Terrett; Jonathan Alexander;
(Abingdon, GB) |
Correspondence
Address: |
KLAUBER & JACKSON
411 HACKENSACK AVENUE
HACKENSACK
NJ
07601
US
|
Assignee: |
UCB Pharma S.A.
|
Family ID: |
26246193 |
Appl. No.: |
11/983052 |
Filed: |
November 6, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10736227 |
Dec 15, 2003 |
7297760 |
|
|
11983052 |
|
|
|
|
PCT/GB02/02782 |
Jun 14, 2002 |
|
|
|
10736227 |
|
|
|
|
Current U.S.
Class: |
424/139.1 ;
435/243; 435/320.1; 435/6.16; 435/7.23; 514/1.1; 514/44R; 530/300;
530/387.3; 530/387.9; 530/388.8; 530/391.1; 530/391.7;
536/23.1 |
Current CPC
Class: |
C07K 14/705 20130101;
A61P 35/00 20180101 |
Class at
Publication: |
424/139.1 ;
536/23.1; 435/320.1; 435/243; 435/6; 435/7.23; 530/387.9;
530/388.8; 530/387.3; 530/391.1; 530/391.7; 514/12; 514/44;
530/300 |
International
Class: |
G01N 33/574 20060101
G01N033/574; C12N 15/11 20060101 C12N015/11; C12N 15/63 20060101
C12N015/63; C12N 1/00 20060101 C12N001/00; C12Q 1/68 20060101
C12Q001/68; A61P 35/00 20060101 A61P035/00; C07K 2/00 20060101
C07K002/00; A61K 31/7088 20060101 A61K031/7088; A61K 38/17 20060101
A61K038/17; C07K 16/30 20060101 C07K016/30; A61K 39/395 20060101
A61K039/395 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 15, 2001 |
GB |
0114643.0 |
Mar 6, 2002 |
GB |
0205264.5 |
Claims
1-3. (canceled)
4. An isolated or recombinant nucleic acid molecule, said isolated
or recombinant nucleic acid molecule comprising: a) a nucleic acid
sequence set out in SEQ ID NO:2 or an RNA transcribed therefrom; b)
a nucleic acid sequence encoding a derivative of an amino acid
sequence set out in SEQ ID NO: 1, wherein said derivative comprises
an amino acid sequence set out in SEQ ID NO: 1 having one or more
substitutions, deletions or insertions; c) a nucleic acid sequence
encoding a fragment of a amino acid sequence set out in SEQ ID
NO:1; d) a nucleic acid sequence complementary to a nucleic acid
sequence of a) or b); e) a nucleic acid sequence encoding a
polypeptide, wherein said polypeptide is identical to an amino acid
sequence of a), b) or c); or f) a nucleic acid sequence having
substantial identity to a nucleic acid sequence of a), b), c) and
d).
5. A vector comprising at least one nucleic acid molecule of claim
4.
6. A host cell comprising the vector of claim 5.
7. A method for screening and/or diagnosing breast cancer or
monitoring and/or assessing breast cancer treatment in a subject,
said method comprising detecting and/or quantifying an amount of a
polypeptide of claim 1 or a nucleic acid molecule of claim 4 in a
biological sample of said subject.
8. An antibody capable of binding specifically to a polypeptide of
claim 1.
9. The antibody of claim 8, wherein the antibody is a monoclonal
antibody, a bispecific antibody, a chimeric antibody, or a
humanised antibody.
10. The antibody of claim 9, wherein the antibody is conjugated to
a therapeutic moiety, said therapeutic moiety selected from the
group consisting of a second antibody or a fragment or derivative
thereof, a cytotoxic agent and a cytokine.
11. A method of screening for agents capable of interacting with at
least one polypeptide of claim 1, said method comprising: (a)
contacting a polypeptide of claim 1 with a candidate agent; and (b)
determining if the candidate agent interacts with said polypeptide,
wherein determination of an interaction of a candidate agent with
said polypeptide identifies a candidate agent capable of
interacting with at least one polypeptide of claim 1.
12. The method according to claim 11, wherein the determination of
an interaction of a candidate agent with the polypeptide comprises
quantitatively detecting binding of the candidate agent to said
polypeptide.
13. A method of screening for agents capable of modulating i)
expression and/or activity of a polypeptide of claim 1, or ii)
expression of a nucleic acid molecule of claim 4, said method
comprising: a) comparing the expression and/or activity of said
polypeptide or the expression of said nucleic acid molecule in the
presence of a candidate agent with the expression and/or activity
of said polypeptide or the expression of said nucleic acid molecule
in the absence of the candidate agent or in the presence of a
control agent; and b) determining whether the presence of the
candidate agent modulates the expression and/or activity of said
polypeptide or the expression of said nucleic acid molecule.
14. The method of claim 13 wherein the expression and/or activity
level of said polypeptide or the expression level of said nucleic
acid molecule is compared to a predetermined reference range.
15. The method of claim 13 wherein step (b) further comprises
selecting an agent capable of modulating the expression and/or
activity of said polypeptide or the expression of said nucleic acid
molecule and testing said agent for use as a therapeutic or
prophylactic anti-breast cancer agent.
16. An agent identified by the method of claim 13, wherein said
agent alters the expression and/or activity of said polypeptide or
the expression of said nucleic acid molecule.
17-19. (canceled)
20. A method for prophylaxis and/or treatment of breast cancer in a
subject, said method comprising administering to said subject a
therapeutically effective amount of: a) at least one polypeptide of
claim 1; b) at least one nucleic acid molecule of claim 4f); d) at
least one antibody capable of binding specifically to said at least
one polypeptide; and e) at least one agent capable of modulating
the expression and/or activity of said at least one polypeptide or
the expression of said nucleic acid molecule.
21. (canceled)
Description
RELATED APPLICATIONS
[0001] The present application is a Continuation of co-pending PCT
Application No. PCT/GB02/02782 filed Jun. 14, 2002, which in turn,
claims priority from Great Britain Application Serial No.
0114643.0, filed on Jun. 15, 2001 and Great Britain Application
Serial No. 0205264.5, filed on Mar. 6, 2002. Applicants claim the
benefits of 35 U.S.C. .sctn.120 as to the PCT application and
priority under 35 U.S.C. .sctn.119 as to the said Great Britain
applications, and the entire disclosures of both applications are
incorporated herein in their entireties.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a novel polypeptide (BCMP
101) compositions comprising the polypeptide, including vaccines,
and antibodies that are immunospecific for the polypeptide. The use
of the polypeptide in the diagnosis, prophylaxis and treatment of
cancer, in particular breast cancer is also provided.
Breast Cancer
[0003] Breast cancer is the most frequently diagnosed non-skin
cancer among women in the United States. It is second only to lung
cancer in cancer-related deaths. In the UK, breast cancer is by far
the commonest cancer in women, with 34,600 new cases in 1998
(Cancer Research Campaign, http://www.crc.org.uk, UK, 2000).
Ninety-nine percent of breast cancers occur in women. The risk of
developing breast cancer steadily increases with age; the lifetime
risk of developing breast cancer is estimated to be 1 in 8 for
women in the US. The annual cost of breast cancer treatment in the
United States is approximately $10 billion (Fuqua, et. al. 2000,
American Association for Cancer Research, www.aacr.org, USA).
Breast cancer incidence has been rising over the past five decades,
but recently it has slowed. This may reflect a period of earlier
detection of breast cancers by mammography. A number of established
factors can increase a woman's risk of having the disease. These
include older age, history of prior breast cancer, significant
radiation exposure, strong family history of breast cancer, upper
socioeconomic class, nulliparity, early menarche, late menopause,
or age at first pregnancy greater than 30 years. Prolonged use of
oral contraceptives earlier in life appears to increase risk
slightly. Prolonged postmenopausal oestrogen replacement increases
the risk 20 to 40%. It has been speculated that a decrease in the
age at menarche, changing birth patterns, or a rise in the use of
exogenous estrogens has contributed to the increase in breast
cancer incidence (Fuqua, et. al. 2000, American Association for
Cancer Research, www.aacr.org, USA).
Causes of Breast Cancer
[0004] Breast cancer is a heterogeneous disease. Although female
hormones play a significant role in driving the origin and
evolution of many breast tumours, there are a number of other
recognised and unknown factors involved. Perturbations in oncogenes
identified include amplification of the HER-2 and the epidermal
growth factor receptor genes, and over-expression of cyclin D1.
Over-expression of these oncogenes has been associated with a
significantly poorer prognosis. Similarly, genetic alterations or
the loss of tumour suppressor genes, such as the p53 gene, have
been well documented in breast cancer and are also associated with
a poorer prognosis. Researchers have identified two genes, called
BRCA1 and BRCA2, which are predictive of pre-menopausal familial
breast cancer. Genetic risk assessment is now possible, which may
enhance the identification of candidates for chemoprevention trials
(Fuqua, et al. 2000, American Association for Cancer Research,
www.aacr.org, USA).
Diagnosis
[0005] Early diagnosis of breast cancer is vital to secure the most
favourable outcome for treatment. Many countries with advanced
healthcare systems have instituted screening programs for breast
cancer. This typically takes the form of regular x-ray of the
breast (mammography) during the 50-60 year old age interval where
greatest benefit for this intervention has been shown. Some
authorities have advocated the extension of such programs beyond 60
and to the 40-49 age group. Health authorities in many countries
have also promoted the importance of regular breast
self-examination by women. Abnormalities detected during these
screening procedures and cases presenting as symptomatic would
typically be confirmed by aspiration cytology, core needle biopsy
with a stereotactic or ultrasound technique for nonpalpable
lesions, or incisional or excisional biopsy. At the same time other
information relevant to treatment options and prognosis, such as
oestrogen (ER) and progesterone receptor (PR) status would
typically be determined (National Cancer Institute, USA, 2000,
Breast Cancer PDQ, www.nci.org).
Disease Staging and Prognosis
[0006] Staging of breast cancer is the key to choosing the optimum
treatment for each patient and to select those patients who will
fare well with less intensive forms of therapy from those for whom
intensive therapy is essential. Currently the process of staging
involves lump and axillary lymph node biopsies, combined with
extensive histopathology. Patients can be incorrectly staged with
consequent over- or under-treatment. As such, there is a need for
new markers that can be correlated with disease stage and used to
reliably guide treatment decisions. Such new markers would not only
benefit patients and health care providers by selecting the optimum
treatment, but could provide significant cost and time benefits in
the histology lab.
[0007] Some breast tumours become refractory to treatments, as the
cancer cells develop resistance to chemotherapy drugs or lose their
hormone sensitivity, leading to recurrent or metastatic disease
which is often incurable. More recently, attention has focussed on
the development of immunological therapies, (Green, M. C., et al.
Cancer Treat. Rev. 26, 269-286 (2000); Davis, I. D., et al.
Immunol. Cell Biol. 78, 179-195 (2000); Knuth, A., et al. Cancer
Chemother Pharmacol. 46, S46-51 (2000); Shiku, H., et al. Cancer
Chemother. Pharmacol. 46, S77-82 (2000); Saffran, D. C., et al.
Cancer Metastasis Rev. 18, 437-449 (1999)), such as cancer vaccines
and monoclonal antibodies (mAbs), as a means of initiating and
targeting a host immune response against tumour cells. In 1998 the
FDA approved the use of Herceptin.TM. (Stebbing, J., et al. Cancer
Treat. Rev. 26, 287-290 (2000); Dillman, R. O. Cancer Biother.
Radiopharm. 14, 5-10 (1999); Miller, K. D., et al. Invest. New
Drugs 17, 417-427 (1999)), a mAb that recognises the erbB2/HER2-neu
receptor protein, as a treatment for metastatic breast cancer. In
combination with chemotherapy, Herceptin.TM. has been shown to
prolong the time to disease progression, when compared to patients
receiving chemotherapy alone (Baselga, J., et al. Cancer Res. 58,
2825-2831 (1998)). Herceptin.TM., however, is only effective in
treating the 10-20% of patients whose tumours over-express the
erbB2 protein. Thus, the identification of other suitable targets
or antigens for immunotherapy of breast cancer has become
increasingly important.
[0008] An ideal protein target for cancer immunotherapy should have
a restricted expression profile in normal tissues and be
over-expressed in tumours, such that the immune response will be
targeted to tumour cells and not against other organs. In addition,
the protein target should be exposed on the cell surface, where it
will be accessible to therapeutic agents. Tumour antigens have been
identified for a number of cancer types, by using techniques such
as differential screening of cDNA (Hubert, R. S., et al. Proc.
Natl. Acad, Sci. USA 96, 14523-14528 (1999); Lucas, S., et al. Int.
J. Cancer 87, 55-60 (2000)), and the purification of cell-surface
proteins that are recognised by tumour-specific antibodies
(Catimel, B., et al. J. Biol. Chem. 271, 25664-25670 (1996)).
Proteomics may be used as an alternative approach to identifying
breast tumour antigens (EP 1208381, EP 1159618).
[0009] The present invention is based on the identification of a
novel protein (BCMP 101) as a target for cancer therapy and
diagnosis.
[0010] BCMP 101 was identified and cloned from MDA-MB-468 breast
cancer cell membranes. Expression of BCMP 101 in normal human
tissue showed that the highest levels of expression were found in
mammary, kidney and bladder tissue. Expression of BCMP 101 was
elevated in kidney cancer cell lines in comparison to normal
tissues. Furthermore, elevated levels of BCMP 101 gene expression
were also observed in tumour tissue from a set of seven matched
normal and tumour samples from breast cancer patients. The BCMP 101
sequence (FIG. 1, SEQ ID NO: 1) matches GenBank entry (available
at: http://www.ncbi.nlm.nih.gov/): CAD10629-NSE2 protein [Homo
sapiens]--a novel NS-containing protein), which was published after
the priority date of this application.
SUMMARY OF THE INVENTION
[0011] Thus, the present invention provides a polypeptide which:
[0012] a) comprises or consists of the amino acid sequence shown in
FIG. 1 (SEQ ID NO: 1); [0013] b) is a derivative having one or more
amino acid substitutions, modifications, deletions or insertions
relative to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 1);
or [0014] c) is a fragment of a polypeptide as defined in a) or b)
above, which is at least ten amino acids long.
[0015] In the present application, the term "polypeptides of the
invention" is used to refer to all polypeptides described in a) to
c) above.
[0016] Polypeptides of the invention may be in substantially pure,
isolated or recombinant form, and may be fused to other moieties.
In particular, fusions of the polypeptides of the invention with
localisation-reporter proteins such as the Green Fluorescent
Protein (U.S. Pat. Nos. 5,625,048, 5,777,079, 6,054,321 and
5,804,387) or the DsRed fluorescent protein (Matz, M. V. et al.,
Nature Biotech. 17:969-973.) are specifically contemplated by the
present invention. The polypeptides of the invention may be
provided in substantially pure form; that is to say, they are free,
to a substantial extent, from other polyeptides. Thus, a
polypeptide of the invention may be provided in a composition in
which it is the predominant component present (i.e. it is present
at a level of at least 50%; preferably at least 75%, at least 80%,
at least 85%, at least 90%, or at least 95%; when determined on a
weight/weight basis excluding solvents or carriers).
[0017] In order to more fully appreciate the present invention,
polypeptides within the scope of a)-c) above will now be discussed
in greater detail. It will be apparent to one skilled in the art
that polypeptides according to the invention include BCMP 101 (SEQ
ID NO: 1), and derivatives, fragments and modified forms
thereof.
Polypeptides Within the Scope of a)
[0018] A polypeptide within the scope of a), may consist of the
particular amino acid sequence given in FIG. 1 (SEQ ID NO: 1) or
may have an additional N-terminal and/or an additional C-terminal
amino acid sequence relative to the sequence given in FIG. 1 (SEQ
ID NO: 1).
[0019] Additional N-terminal or C-terminal sequences may be
provided for various reasons. Techniques for providing such
additional sequences are well known in the art.
[0020] Additional sequences may be provided in order to alter the
characteristics of a particular polypeptide. This can be useful in
improving expression or regulation of expression in particular
expression systems. For example, an additional sequence may provide
some protection against proteolytic cleavage. This has been done
for the hormone Somatostatin by fusing it at its N-terminus to part
of the .beta. galactosidase enzyme (Itakwa et al., Science 198:
105-63 (1977)).
[0021] Additional sequences can also be useful in altering the
properties of a polypeptide to aid in identification or
purification. For example, a fusion protein may be provided in
which a polypeptide is linked to a moiety capable of being isolated
by affinity chromatography. The moiety may be an antigen or an
epitope and the affinity column may comprise immobilised antibodies
or immobilised antibody fragments which bind to said antigen or
epitope (desirably with a high degree of specificity). The fusion
protein can usually be eluted from the column by addition of an
appropriate eluant.
[0022] Additional N-terminal or C-terminal sequences may, however,
be present simply as a result of a particular technique used to
obtain a polypeptide of the present invention and need not provide
any particular advantageous characteristic to the polypeptide of
the present invention. Such polypeptides are within the scope of
the present invention.
[0023] Whatever additional N-terminal or C-termninal sequence is
present, it is preferred that the resultant polypeptide should
exhibit the immunological or biological activity of the polypeptide
having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 1).
Polypeptides Within the Scope of b)
[0024] Turning now to the polypeptides defined in b) above, it will
be appreciated by the person skilled in the art that these
polypeptides are derivatives of the polypeptide given in a) above.
Such derivatives preferably exhibit the immunological or biological
activity of the polypeptide having the amino acid sequence shown in
FIG. 1 (SEQ ID NO: 1). It will be appreciated by one skilled in the
art that derivatives can include post-translational modifications,
for example but without limitation, phosphorylation, glycosylation
and farnesylation.
[0025] Alterations in the amino acid sequence of a polypeptide,
which do not affect the function of a polypeptide, can occur. These
include amino acid deletions, insertions and substitutions and can
result from alternative splicing and/or the presence of multiple
translation start sites and/or stop sites. Polymorphisms may arise
as a result of the infidelity of the translation process. Thus
changes in amino acid sequence may be tolerated which do not affect
the polypeptide's biological or immunological function.
[0026] The skilled person will appreciate that various changes can
often be made to the amino acid sequence of a polypeptide which has
a particular activity to produce derivatives (sometimes known as
variants or "muteins") having at least a proportion of said
activity, and preferably having a substantial proportion of said
activity. Such derivatives of the polypeptides described in a)
above are within the scope of the present invention and are
discussed in greater detail below. They include allelic and
non-allelic derivatives.
[0027] An example of a derivative of the polypeptide of the
invention is a polypeptide as defined in a) above, apart from the
substitution of one or more amino acids with one or more other
amino acids. The skilled person is aware that various amino acids
have similar properties. One or more such amino acids of a
polypeptide can often be substituted by one or more other such
amino acids without eliminating a desired activity of that
polypeptide.
[0028] Thus, the amino acids glycine, alanine, valine, leucine and
isoleucine can often be substituted for one another (amino acids
having aliphatic side chains). Of these possible substitutions, it
is preferred that glycine and alanine are used to substitute for
one another (since they have relatively short side chains) and that
valine, leucine and isoleucine are used to substitute for one
another (since they have larger aliphatic side chains which are
hydrophobic).
[0029] Other amino acids which can often be substituted for one
another include: [0030] phenylalanine, tyrosine and tryptophan
(amino acids having aromatic side chains); [0031] lysine, arginine
and histidine (amino acids having basic side chains); [0032]
aspartate and glutamate (amino acids having acidic side chains);
[0033] asparagine and glutamine (amino acids having amide side
chains); [0034] cysteine and methionine (amino acids having
sulphur-containing side chains); and [0035] aspartic acid and
glutamic acid can substitute for phospho-serine and
phospho-threonine, respectively (amino acids with acidic side
chains).
[0036] Substitutions of this nature are often referred to as
"conservative" or "semi-conservative" amino acid substitutions.
[0037] Amino acid deletions or insertions may also be made relative
to the amino acid sequence given in a) (SEQ ID NO: 1) above. Thus,
for example, amino acids which do not have a substantial effect on
the biological and/or immunological activity of the polypeptide, or
at least which do not eliminate such activity, may be deleted. Such
deletions can be advantageous since the overall length and the
molecular weight of a polypeptide can be reduced whilst still
retaining activity. This can enable the amount of polypeptide
required for a particular purpose to be reduced--for example,
dosage levels can be reduced.
[0038] Amino acid insertions relative to the sequence given in a)
(SEQ ID NO: 1) above can also be made. This may be done to alter
the properties of a polypeptide of the invention (e.g. to assist in
identification, purification or expression, as explained above in
relation to fusion proteins).
[0039] Amino acid changes relative to the sequence given in a) (SEQ
ID NO: 1) above can be made using any suitable technique e.g. by
using site-directed mutagenesis (Hutchinson et al., 1978, J. Biol.
Chem. 253:6551).
[0040] It should be appreciated that amino acid substitutions or
insertions within the scope of the present invention can be made
using naturally occurring or non-naturally occurring amino acids.
Whether or not natural or synthetic amino acids are used, it is
preferred that only L-amino acids are present.
[0041] Whatever amino acid changes are made (whether by means of
substitution, modification, insertion or deletion), preferred
polypeptides of the present invention have at least 50% sequence
identity with a polypeptide as defined in a) above, more preferably
the degree of sequence identity is at least 75%. Sequence
identities of at least 80%, at least 85%, at least 90%, at least
95%, at least 98% or at least 99% are most preferred.
[0042] The term identity can be used to describe the similarity
between two polypeptide sequences. The degree of amino acid
sequence identity can be calculated using a program such as
"bestfit" (Smith and Waterman, Advances in Applied Mathematics,
482-489 (1981)) to find the best segment of similarity between any
two sequences. The alignment is based on maximising the score
achieved using a matrix of amino acid similarities, such as that
described by Schwarz and Dayhof (1979) Atlas of Protein Sequence
and Structure, Dayhof, M. O., Ed pp 353-358.
[0043] A software package well known in the art for carrying out
this procedure is the CLUSTAL program. It compares the amino acid
sequences of two polypeptides and finds the optimal alignment by
inserting spaces in either sequence as appropriate. The amino acid
identity or similarity (identity plus conservation of amino acid
type) for an optimal alignment can also be calculated using a
software package such as BLASTX. This program aligns the largest
stretch of similar sequence and assigns a value to the fit. For any
one pattern comparison, several regions of similarity may be found,
each having a different score. One skilled in the art will
appreciate that two polypeptides of different lengths may be
compared over the entire length of the longer fragment.
Alternatively small regions may be compared. Normally sequences of
the same length are compared for a useful comparison to be
made.
[0044] Where high degrees of sequence identity are present there
will be relatively few differences in amino acid sequence. Thus for
example they may be less than 20, less than 10, or even less than 5
differences.
Polypeptides Within the Scope of c)
[0045] As discussed supra, it is often advantageous to reduce the
length of a polypeptide, provided that the resultant reduced length
polypeptide still has a desired activity or can give rise to useful
antibodies. Feature c) of the present invention therefore covers
fragments of polypeptides a) or b) above.
[0046] The skilled person can determine whether or not a particular
fragment has activity using the techniques disclosed above.
Fragments are at least 10 amino acids long, preferred fragments may
be at least 20, at least 30, at least 40, at least 50, at least 75
or at least 100 amino acids long. Preferably, the fragments are
less than 150 amino acids long.
[0047] As will be discussed below, the polypeptides of the
invention will find use in an immunotherapeutic approach to breast
and/or kidney cancer. The skilled person will appreciate that for
the preparation of one or more polypeptides of the invention, the
preferred approach will be based on recombinant DNA techniques.
[0048] A polypeptide of the invention may be useful as antigenic
material, and may be used in the production of vaccines for
treatment or prophylaxis of cancer, in particular breast cancer
and/or kidney cancer. Such material can be "antigenic" and/or
"immunogenic". Generally, "antigenic" is taken to mean that the
polypeptide is capable of being used to raise antibodies or indeed
is capable of inducing an antibody response in a subject.
"Immunogenic" is taken to mean that the polypeptide is capable of
eliciting an immune response in a subject. Thus, in the latter
case, the polypeptide may be capable of not only generating an
antibody response but, in addition, non-antibody based immune
responses.
[0049] It is well known that is possible to screen an antigenic
polypeptide to identify epitopic regions, i.e. those regions which
are responsible for the polypeptide's antigenicity or
immunogenicity. Methods well known to the skilled person can be
used to test fragments and/or homologues and/or derivatives for
antigenicity. Thus, the fragments for use in the present invention
may include one or more such epitopic regions or be sufficiently
similar to such regions to retain their antigenic/immunogenic
properties. Thus, for fragments for use according to the present
invention the degree of identity is perhaps irrelevant, since they
may be 100% identical to a particular part of a polypeptide of the
invention. The key issue may be that the fragment retains the
antigenic/immunogenic properties of the polypeptide from which it
is derived.
[0050] Homologues, derivatives and fragments may possess at least a
degree of the antigenicity/immunogenicity of the polypeptide from
which they are derived.
[0051] Thus, in a further aspect, the present invention provides
the use of a polypeptide of the invention in the production of a
composition for the treatment or prophylaxis of cancer,
particularly breast cancer and/or kidney cancer, wherein the
composition is a vaccine. The vaccine optionally comprises one or
more suitable adjuvants. Examples of adjuvants well-known in the
art include inorganic gels, such as aluminium hydroxide, and
water-in-oil emulsions, such as incomplete Freund's adjuvant. Other
useful adjuvants will be well known to the skilled person.
[0052] In yet further aspects, the present invention provides:
[0053] (a) the use of a polypeptide of the invention in the
preparation of an immunogenic composition, preferably a vaccine;
[0054] (b) the use of such an immunogenic composition in inducing
an immune response in a subject; [0055] (c) a method for the
treatment or prophylaxis of cancer, particularly breast and/or
kidney cancer in a subject, or of vaccinating a subject against
cancer which comprises the step of administering to the subject an
effective amount of a polypeptide of the invention, preferably as a
vaccine; and [0056] (d) a method for monitoring/assessing breast
and/or kidney cancer treatment in a patient, which comprises the
step of determining the presence or absence and/or quantifying at
least one polypeptide, at least one nucleic acid molecule or at
least one antibody of the invention in a biological sample.
[0057] As will be discussed below, the polypeptides of the
invention will find use in an immunotherapeutic approach to cancer,
particularly breast cancer and/or kidney cancer. The skilled person
will appreciate that for the preparation of one or more such
polypeptides, the preferred approach will be based on recombinant
DNA techniques. In addition, nucleic acid molecules encoding the
polypeptides or fragments thereof may be used in their own
right.
[0058] Thus, in a further aspect, the present invention provides an
isolated or recombinant nucleic acid molecule which: [0059] d)
comprises or consists of the DNA sequence shown in FIG. 1 (SEQ ID
NO:2) or its RNA equivalent; [0060] e) a sequence which codes for a
derivative or fragment of a polypeptide shown in FIG. 1 (SEQ ID NO:
1); [0061] f) a sequence which is complementary to the sequences of
d) or e); [0062] g) a sequence which codes for the same
polypeptide, as the sequences of d), e) or f); or [0063] h) a
sequence which shows substantial identity with any of those of d),
e), f) and g).
[0064] These nucleic acid molecules are now discussed in greater
detail.
[0065] The term identity can also be used to describe the
similarity between two individual DNA sequences. The `bestfit`
program (Smith and Waterman, Advances in applied Mathematics,
482-489 (1981)) is one example of a type of computer software used
to find the best segment of similarity between two nucleic acid
sequences, whilst the GAP program enables sequences to be aligned
along their whole length and finds the optimal alignment by
inserting spaces in either sequence as appropriate. It is preferred
if sequences which show substantial identity with any of those of
d), e), f) and g) have e.g. at least 50%, at least 75%, at least
80%, at least 85%, at least 90% or 95% sequence identity.
[0066] It is preferred that if the nucleic acid molecule is a
fragment of the sequence given in FIG. 1 (SEQ ID NO: 2), that it
does not correspond to the following fragments: bp558-1054,
bp80-565 or bp 45-547, according to the nucleotide numbering of
FIG. 1 (SEQ ID NO: 2).
[0067] In a further aspect, the present invention provides a method
for the prophylaxis and/or treatment of cancer, in particular
breast and/or kidney cancer, in a subject, which comprises
administering to said subject a therapeutically effective amount of
at least one nucleic acid as defined above.
[0068] In yet another aspect, the present invention provides the
use of at least one nucleic acid as defined above in the
preparation of a composition for use in the prophylaxis and/or
treatment of cancer, in particular breast and/or kidney cancer.
[0069] The polypeptides of the invention can be coded for by a
large variety of nucleic acid molecules, taking into account the
well known degeneracy of the genetic code. All of these molecules
are within the scope of the present invention. They can be inserted
into vectors and cloned to provide large amounts of DNA or RNA for
further study. Suitable vectors may be introduced into host cells
to enable the expression of polypeptides of the invention using
techniques known to the person skilled in the art.
[0070] The term `RNA equivalent` when used above indicates that a
given RNA molecule has a sequence which is complementary to that of
a given DNA molecule, allowing for the fact that in RNA `U`
replaces `T` in the genetic code. The nucleic acid molecule may be
in isolated, recombinant or chemically synthetic form.
[0071] Techniques for cloning, expressing and purifying
polypeptides are well known to the skilled person. DNA constructs
can readily be generated using methods well known in the art. These
techniques are disclosed, for example in J. Sambrook et al,
Molecular Cloning 3.sup.rd Edition, Cold Spring Harbour Laboratory
Press (2000); in Old & Primrose Principles of Gene Manipulation
5th Edition, Blackwell Scientific Publications (1994); and in
Stryer Biochemistry 4th Edition, W H Freeman and Company (1995).
Modifications of DNA constructs and the polypeptides expressed such
as the addition of promoters, enhancers, signal sequences, leader
sequences, translation start and stop signals and DNA stability
controlling regions, or the addition of fusion partners may then be
facilitated.
[0072] Normally the DNA construct will be inserted into a vector,
which may be of phage or plasmid origin. Expression of the
polypeptide is achieved by the transformation or transfection of
the vector into a host cell which may be of eukaryotic or
prokaryotic origin. Such vectors and suitable host cells form
additional aspects of the present invention.
[0073] The nucleotides of the present invention, including DNA and
RNA, and comprising a sequence encoding a polypeptide of the
invention, may be synthesised using methods known in the art, such
as using conventional chemical approaches or polymerase chain
reaction (PCR) amplification. The nucleotides of the present
invention also permit the identification and cloning of the gene
encoding a polypeptide as defined herein from any species, for
instance by screening cDNA libraries, genomic libraries or
expression libraries.
[0074] Knowledge of the nucleic acid structure can be used to raise
antibodies and for gene therapy. Techniques for this are well-known
by those skilled in the art, as discussed in more detail
herein.
[0075] By using appropriate expression systems, polypeptides of the
invention may be expressed in glycosylated or non-glycosylated
form. Non-glycosylated forms can be produced by expression in
prokaryotic hosts, such as E. coli.
[0076] Polypeptides comprising N-terminal methionine may be
produced using certain expression systems, whilst in others the
mature polypeptide will lack this residue. Preferred techniques for
cloning, expressing and purifying a polypeptide of the invention
are summarised below:
[0077] Polypeptides may be prepared under native or denaturing
conditions and then subsequently refolded. Baculoviral expression
vectors include secretory plasmids (such as pACGP67 from
Pharmingen), which may have an epitope tag sequence cloned in frame
(e.g. myc, V5 or His) to aid detection and allow for subsequent
purification of the polypeptide. Mammalian expression vectors may
include pCDNA3 and pSecTag (both Invitrogen), and pREP9 and pCEP4
(Invitrogen). E. coli systems include the pBad series (His
tagged--Invitrogen) or pGex series (Pharmacia).
[0078] In addition to nucleic acid molecules coding for
polypeptides of the invention, referred to herein as "coding"
nucleic acid molecules, the present invention also includes
complementary nucleic acid molecules. Thus, for example, both
strands of a double stranded nucleic acid molecule are included
within the scope of the present invention (whether or not they are
associated with one another). Also included are mRNA molecules and
complementary DNA Molecules (e.g. cDNA molecules).
[0079] Nucleic acid molecules which can hybridise to any of the
nucleic acid molecules discussed above are also covered by the
present invention. Such nucleic acid molecules are referred to
herein as "hybridising" nucleic acid molecules. Hybridising nucleic
acid molecules can be useful as probes or primers, for example.
[0080] Desirably such hybridising molecules are at least 10
nucleotides in length and preferably are at least 25 or at least 50
nucleotides in length. The hybridising nucleic acid molecules
preferably hybridise to nucleic acids within the scope of d) (SEQ
ID NO: 2), e), f), g) or h) above specifically.
[0081] Desirably the hybridising molecules will hybridise to such
molecules under stringent hybridisation conditions. One example of
stringent hybridisation conditions is where attempted hybridisation
is carried out at a temperature of from about 35.degree. C. to
about 65.degree. C. using a salt solution which is about 0.9 molar.
However, the skilled person will be able to vary such conditions as
appropriate in order to take into account variables such as probe
length, base composition, type of ions present, etc. For a high
degree of selectivity, relatively stringent conditions are used to
form the duplexes, such as low salt or high temperature conditions.
As used herein, "highly stringent conditions" means hybridisation
to filter-bound DNA in 0.5 M NaHPO.sub.4, 7% sodium dodecyl
sulphate (SDS), 1 mM EDTA at 65 .degree. C., and washing in
0.1.times.SSC/0.1% SDS at 68.degree. C. (Ausubel F. M. et al.,
eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green
Publishing Associates, Inc., and John Wiley & Sons, Inc., New
York, at p. 2.10.3). For some applications, less stringent
conditions for duplex formation are required. As used herein
"moderately stringent conditions" means washing in
0.2.times.SSC/0.1% SDS at 42.degree. C. (Ausubel et al., 1989,
supra). Hybridisation conditions can also be rendered more
stringent by the addition of increasing amounts of formamide, to
destabilise the hybrid duplex. Thus, particular hybridisation
conditions can be readily manipulated, and will generally be chosen
depending on the desired results. In general, convenient
hybridisation temperatures in the presence of 50% formamide are:
42.degree. C. for a probe which is 95 to 100% identical to the
fragment of a gene encoding a polypeptide as defined herein,
37.degree. C. for 90 to 95% identity and 32.degree. C. for 70 to
90% identity. In the preparation of genomic libraries, DNA
fragments are generated, some of which will encode parts or the
whole of a polypeptide as defined herein. The DNA may be cleaved at
specific sites using various restriction enzymes. Alternatively,
one may use DNAse in the presence of manganese to fragment the DNA,
or the DNA can be physically sheared, as for example, by
sonication. The DNA fragments can then be separated according to
size by standard techniques, including but not limited to agarose
and polyacrylamide gel electrophoresis, column chromatography and
sucrose gradient centrifugation. The DNA fragments can then be
inserted into suitable vectors, including but not limited to
plasmids, cosmids, bacteriophages lambda or T.sub.4, and yeast
artificial chromosomes (YACs). (See, for example, Sambrook et al.,
2000, Molecular Cloning, A Laboratory Manual, 3.sup.rd Ed., Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Glover,
D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press,
Ltd., Oxford, U.K. Vol. I, II; Ausubel F. M. et al., eds., 1989,
Current Protocols in Molecular Biology, Vol. I, Green Publishing
Associates, Inc., and John Wiley & sons, Inc., New York). The
genomic library may be screened by nucleic acid hybridisation to
labelled probe (Benton & Davis, 1977, Science 196:180;
Grunstein & Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A.
72:3961).
[0082] Manipulation of the DNA encoding a polypeptide is a
particularly powerful technique for both modifying proteins and for
generating large quantities of protein for purification purposes.
This may involve the use of PCR techniques to amplify a desired
nucleic acid sequence. Thus the sequence data provided herein can
be used to design primers for use in PCR so that a desired sequence
can be targeted and then amplified to a high degree.
[0083] Typically, primers will be at least five nucleotides long
and will generally be at least ten nucleotides long (e.g. fifteen
to twenty-five nucleotides long). In some cases, primers of at
least thirty or at least thirty-five nucleotides in length may be
used.
[0084] As a further alternative chemical synthesis may be used.
This may be automated. Relatively short sequences may be chemically
synthesised and ligated together to provide a longer sequence.
[0085] In addition to being used as primers and/or probes,
hybridising nucleic acid molecules of the present invention can be
used as anti-sense molecules to alter the expression of
polypeptides of the present invention by binding to complementary
nucleic acid molecules. This technique can be used in anti-sense
therapy.
[0086] As used herein, an "antisense" nucleic acid refers to a
nucleic acid capable of hybridising by virtue of some sequence
complementarity to a portion of an RNA (preferably mRNA) encoding a
polypeptide of the invention. The antisense nucleic acid may be
complementary to a coding and/or non-coding region of a mRNA
encoding a polypeptide of the invention. Such antisense nucleic
acids have utility as compounds that inhibit expression, and can be
used in the treatment or prevention of cancer, in particular breast
cancer and/or kidney cancer.
[0087] In a specific embodiment, expression of a polypeptide of the
invention is inhibited by use of antisense nucleic acids. The
present invention provides the therapeutic or prophylactic use of
nucleic acids comprising at least six nucleotides that are
antisense to a gene or cDNA encoding a polypeptide of the
invention.
[0088] A hybridising nucleic acid molecule of the present invention
may have a high degree of sequence identity along its length with a
nucleic acid molecule within the scope of d)-h) above (e.g. at
least 50%, at least 75%, at least 80%, at least 85% or at least 90%
or 95% sequence identity). As will be appreciated by the skilled
person, the higher the sequence identity a given single stranded
nucleic acid molecule has with another nucleic acid molecule, the
greater the likelihood that it will hybridise to a nucleic acid
molecule which is complementary to that other nucleic acid molecule
under appropriate conditions.
[0089] In view of the foregoing description the skilled person will
appreciate that a large number of nucleic acids are within the
scope of the present invention. Unless the context indicates
otherwise, nucleic acid molecules of the present invention may have
one or more of the following characteristics: [0090] 1) they may be
DNA or RNA; [0091] 2) they may be single or double stranded; [0092]
3) they may be provided in recombinant form, e.g. covalently linked
to a 5' and/or a 3' flanking sequence to provide a molecule which
does not occur in nature; [0093] 4) they may be provided without 5'
and/or 3' flanking sequences which normally occur in nature; [0094]
5) they may be provided in substantially pure form. Thus they may
be provided in a form which is substantially free from
contaminating proteins and/or from other nucleic acids; and [0095]
6) they may be provided with introns or without introns (e.g. as
cDNA).
[0096] If desired, a gene encoding a polypeptide of the invention,
a related gene, or related nucleic acid sequences or subsequences,
including complementary sequences, can also be used in
hybridisation assays. A nucleotide encoding a polypeptide of the
invention, or subsequences thereof comprising at least 8
nucleotides, can be used as a hybridisation probe. Hybridisation
assays can be used for detection, prognosis, diagnosis, or
monitoring of conditions, disorders, or disease states, associated
with aberrant expression of genes encoding a polypeptide as defined
herein, or for differential diagnosis of patients with signs or
symptoms suggestive of cancer, in particular breast cancer and/or
kidney cancer. In particular, such a hybridisation assay can be
carried out by a method comprising contacting a patient sample
containing nucleic acid with a nucleic acid probe capable of
hybridising to a DNA or RNA that encodes a polypeptide of the
invention, under conditions such that hybridisation can occur, and
detecting or measuring any resulting hybridisation. Nucleotides can
be used for therapy of patients having cancer, in particular breast
cancer and/or kidney cancer, as described below.
[0097] In another embodiment, a preparation of oligonucleotides
comprising 10 or more consecutive nucleotides complementary to a
nucleotide sequence encoding a polypeptide of the invention or
fragment thereof for use as vaccines for the treatment of cancer,
in particular breast cancer and/or kidney cancer. Such preparations
may include adjuvants or other vehicles.
[0098] In a specific embodiment, nucleic acids comprising a
sequence encoding a polypeptide of the invention, are administered
to promote polypeptide function by way of gene therapy. Gene
therapy refers to administration to a subject of an expressed or
expressible nucleic acid. In this embodiment, the nucleic acid
produces its encoded protein that mediates a therapeutic effect by
promoting polypeptide function. Any of the methods for gene therapy
available in the art can be used according to the present
invention.
[0099] In a preferred aspect, the compound comprises a nucleic acid
of the invention, such as a nucleic acid encoding a polypeptide of
the invention, said nucleic acid being part of an expression vector
that expresses a polypeptide of the invention in a suitable host.
In particular, such a nucleic acid has a promoter operably linked
to the polypeptide coding region, said promoter being inducible or
constitutive (and, optionally, tissue-specific). In another
particular embodiment, a nucleic acid molecule is used in which the
coding sequences and any other desired sequences are flanked by
regions that promote homologous recombination at a desired site in
the genome, thus providing for intrachromosomal expression of the
nucleic acid (Koller & Smithies, 1989, Proc. Natl. Acad. Sci.
USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438).
[0100] Delivery of the nucleic acid into a patient may be direct,
in which case the patient is directly exposed to the nucleic acid
or nucleic acid-carrying vector; this approach is known as in vivo
gene therapy. Alternatively, delivery of the nucleic acid into the
patient may be indirect, in which case cells are first transformed
with the nucleic acid in vitro and then transplanted into the
patient; this approach is known as ex vivo gene therapy.
[0101] As described herein, BCMP101 is associated with cancer, in
particular breast and kidney cancer and as such provides a means of
detection/diagnosis. Thus, in another aspect, the present invention
provides a method of screening for and/or diagnosis of cancer, in
particular breast cancer and/or kidney cancer in a subject which
comprises the step of detecting and/or quantifying the amount of a
polypeptide or nucleic acid molecule of the invention in a
biological sample obtained from said subject. In a further
embodiment, antibodies which recognise the polypeptides of the
invention are used to detect the amount of a polypeptide as
described herein in a biological sample.
[0102] In one embodiment, binding of antibody in tissue sections
can be used to detect aberrant polypeptide localisation or an
aberrant level of polypeptide. In a specific embodiment, antibody
to a polypeptide of the invention can be used to assay a patient
tissue (e.g., a breast biopsy) for the level of the polypeptide
where an aberrant level of polypeptide is indicative of cancer, in
particular breast cancer and/or kidney cancer. As used herein, an
"aberrant level" means a level that is increased compared with the
level in a subject free from cancer or a reference level.
[0103] Suitable immunoassays include, without limitation,
competitive and non-competitive assay systems using techniques such
as western blots, radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion assays, agglutination assays, complement-fixation
assays, immunoradiometric assays, fluorescent immunoassays and
protein A immunoassays.
[0104] In another aspect, the present invention provides a method
for the prophylaxis and/or treatment of cancer, in particular
breast cancer and/or kidney cancer, in a subject, which comprises
administering to said subject a therapeutically effective amount of
an antibody which binds to at least one polypeptide of the
invention.
[0105] A convenient means for such detection/quantifying will
involve the use of antibodies. Thus, the polypeptides of the
invention also find use in raising antibodies. Thus, in a further
aspect, the present invention provides antibodies, which bind to a
polypeptide of the invention and the use of these antibodies in the
preparation of a composition for use in the prophylaxis and/or
treatment of cancer in particular breast cancer and/or kidney
cancer. In particular, the preparation of vaccines and/or
compositions comprising or consisting of antibodies is a preferred
embodiment of this aspect of the invention.
[0106] Preferred antibodies bind specifically to polypeptides of
the present invention so that they can be used to purify and/or
inhibit the activity of such polypeptides.
[0107] Thus, the polypeptide of the invention, may be used as an
immunogen to generate antibodies which immunospecifically bind such
an immunogen. Antibodies of the invention include, but are not
limited to polyclonal, monoclonal, bispecific, humanised or
chimeric antibodies, single chain antibodies, Fab fragments and
F(ab') fragments, fragments produced by a Fab expression library,
anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments
of any of the above. The term "antibody" as used herein refers to
immunoglobulin molecules and immunologically active portions of
immunoglobulin molecules, i.e., molecules that contain an antigen
binding site that specifically binds an antigen. The immunoglobulin
molecules of the invention can be of any class (e.g., IgG, IgE,
IgM, IgD and IgA) or subclass of immunoglobulin molecule.
[0108] In the production of antibodies, screening for the desired
antibody can be accomplished by techniques known in the art, e.g.
ELISA (enzyme-linked immunosorbent assay). For example, to select
antibodies which recognise a specific domain of a polypeptide of
the invention, one may assay generated hybridomas for a product
which binds to a polypeptide fragment containing such domain. For
selection of an antibody that specifically binds a first
polypeptide homologue but which does not specifically bind to (or
binds less avidly to) a second polypeptide homologue, one can
select on the basis of positive binding to the first polypeptide
homologue and a lack of binding to (or reduced binding to) the
second polypeptide homologue.
[0109] For preparation of monoclonal antibodies (mAbs) directed
toward a polypeptide of the invention, any technique which provides
for the production of antibody molecules by continuous cell lines
in culture may be used. For example, the hybridoma technique
originally developed by Kohler and Milstein (1975, Nature
256:495-497), as well as the trioma technique, the human B-cell
hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72),
and the EBV-hybridoma technique to produce human monoclonal
antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of
any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any
subclass thereof. The hybridoma producing the mAbs of the invention
may be cultivated in vitro or in vivo. In an additional embodiment
of the invention, mAbs can be produced in germ-free animals
utilising known technology (PCT/US90/02545).
[0110] The mAbs include but are not limited to human mAbs and
chimeric mAbs (e.g., human-mouse chimeras). A chimeric antibody is
a molecule in which different portions are derived from different
animal species, such as those having a human immunoglobulin
constant region and a variable region derived from a murine mAb.
(See, e.g., U.S. Pat. No, 4,816,567; and U.S. Pat. No. 4,816397)
Humanised antibodies are antibody molecules from non-human species
having one or more complementarity determining regions (CDRs) from
the non-human species and a framework region from a human
immunoglobulin molecule. (See, e.g., U.S. Pat. No. 5,585,089).
[0111] Chimeric and humanised mAbs can be produced by recombinant
DNA techniques known in the art, for example using methods
described in WO 87/02671; EP 184,187; EP 171,496; EP 173,494; WO
86/01533; U.S. Pat. No. 4,816,567; EP 125,023; Better et al., 1988,
Science 240:1041-1043; Liu et al., 1987, Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al., 1987, J. Immunol. 139:3521-3526; Sun et
al., 1987, Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.,
1987, Canc. Res. 47:999-1005; Wood et al., 1985, Nature
314:446-449; and Shaw et al., 1988, J. Natl. Cancer Inst.
80:1553-1559; Morrison, 1985, Science 229:1202-1207; Oi et al.,
1986, Bio/Techniques 4:214; U.S. Pat. No. 5,225,539; Jones et al.,
1986, Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534;
and Beidler et al., 1988, J. Immunol. 141:4053-4060.
[0112] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Such antibodies can be
produced using transgenic mice which are incapable of expressing
endogenous immunoglobulin heavy and light chain genes, but which
can express human heavy and light chain genes. The transgenic mice
are immunised in the normal fashion with a selected antigen, e.g.,
all or a portion of a polypeptide of the invention. mAbs directed
against the antigen can be obtained using conventional hybridoma
technology. The human immunoglobulin transgenes harboured by the
transgenic mice rearrange during B cell differentiation, and
subsequently undergo class switching and somatic mutation. Thus,
using such a technique, it is possible to produce therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this
technology for producing human antibodies, see Lonberg and Huszar
(1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of
this technology for producing human antibodies and human mAbs and
protocols for producing such antibodies, see, e.g., U.S. Pat. No.
5,625,126; U.S. Pat. No. 5,633,425; U.S. Pat. No. 5,569,825; U.S.
Pat. No. 5,661,016; and U.S. Pat. No. 5,545,806.
[0113] Completely human antibodies which recognise a selected
epitope can be generated using a technique referred to as "guided
selection". In this approach a selected non-human mAb, e.g., a
mouse antibody, is used to guide the selection of a completely
human antibody recognising the same epitope. (Jespers et al. (1994)
Bio/technology 12:899-903).
[0114] The antibodies of the present invention can also be
generated using various phage display methods known in the art. In
phage display methods, functional antibody domains are displayed on
the surface of phage particles which carry the polynucleotide
sequences encoding them. In particular, such phage can be utilised
to display antigen-binding domains expressed from a repertoire or
combinatorial antibody library (e.g., human or murine). Phage
expressing an antigen binding domain that binds the antigen of
interest can be selected or identified with antigen, e.g., using
labelled antigen or antigen bound or captured to a solid surface or
bead. Phage used in these methods are typically filamentous phage
including fd and M13 binding domains expressed from phage with Fab,
Fv or disulphide stabilised Fv antibody domains recombinantly fused
to either the phage gene III or gene VIII protein. Phage display
methods that can be used to make the antibodies of the present
invention include those disclosed in Brinkman et al., J. Immunol.
Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods
184:177-186 (1995); Kettleborough et al., Eur. J. Immunol.
24:952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et
al., Advances in Immunology 57:191-280 (1994); PCT/GB91/01134; WO
90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO
95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409;
5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and
5,969,108.
[0115] As described in the above references, after phage selection,
the antibody coding regions from the phage can be isolated and used
to generate whole antibodies, including human antibodies, or any
other desired antigen binding fragment, and expressed in any
desired host, including mammalian cells, insect cells, plant cells,
yeast, and bacteria, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2
fragments can also be employed using methods known in the art such
as those disclosed in WO 92/22324; Mullinax et al., BioTechniques
12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and
Better et al., Science 240:1041-1043 (1988).
[0116] Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. No. 4,946,778 and U.S. Pat. No. 5,258,498; Huston et al.,
Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS
90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040
(1988).
[0117] The invention further provides for the use of bispecific
antibodies, which can be made by methods known in the art.
Traditional production of full-length bispecific antibodies is
based on the coexpression of two immunoglobulin heavy chain-light
chain pairs, where the two chains have different specificities
(Milstein et al., 1983, Nature 305:537-539). Because of the random
assortment of immunoglobulin heavy and light chains, these
hybridomas (quadromas) produce a potential mixture of 10 different
antibody molecules, of which only one has the correct bispecific
structure. Purification of the correct molecule, which is usually
done by affinity chromatography steps, is rather cumbersome, and
the product yields are low. Similar procedures are disclosed in WO
93/08829, and in Traunecker et al., 1991, EMBO J. 10:3655-3659.
[0118] According to a different and more preferred approach,
antibody variable domains with the desired binding specificities
(antibody-antigen combining sites) are fused to inmunoglobulin
constant domain sequences. The fusion preferably is with an
immunoglobulin heavy chain constant domain, comprising at least
part of the hinge, CH2, and CH3 regions. It is preferred to have
the first heavy-chain constant region (CH1) containing the site
necessary for light chain binding, present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. This provides for great flexibility in adjusting the
mutual proportions of the three polypeptide fragments in
embodiments when unequal ratios of the three polypeptide chains
used in the construction provide the optimum yields. It is,
however, possible to insert the coding sequences for two or all
three polypeptide chains in one expression vector when the
expression of at least two polypeptide chains in equal ratios
results in high yields or when the ratios are of no particular
significance.
[0119] In a preferred embodiment of this approach, the bispecific
antibodies are composed of a hybrid immunoglobulin heavy chain with
a first binding specificity in one arm, and a hybrid immunoglobulin
heavy chain-light chain pair (providing a second binding
specificity) in the other arm. It was found that this asymmetric
structure facilitates the separation of the desired bispecific
compound from unwanted immunoglobulin chain combinations, as the
presence of an immunoglobulin light chain in only one half of the
bispecific molecule provides for a facile way of separation. This
approach is disclosed in WO 94/04690. For further details for
generating bispecific antibodies see, for example, Suresh et al.,
Methods in Enzymology, 1986, 121:210.
[0120] The invention provides functionally active fragments,
derivatives or analogs of the anti-polypeptide immunoglobulin
molecules. "Functionally active" means that the fragment,
derivative or analogue is able to elicit anti-anti-idiotype
antibodies (i.e., tertiary antibodies) that recognise the same
antigen that is recognised by the antibody from which the fragment,
derivative or analogue is derived. Specifically, in a preferred
embodiment the antigenicity of the idiotype of the immunoglobulin
molecule may be enhanced by deletion of framework and CDR sequences
that are C-terminal to the CDR sequence that specifically
recognises the antigen. To determine which CDR sequences bind the
antigen, synthetic peptides containing the CDR sequences can be
used in binding assays with the antigen by any binding assay method
known in the art.
[0121] The present invention provides antibody fragments such as,
but not limited to, F(ab')2 fragments and Fab fragments. Antibody
fragments which recognise specific epitopes may be generated by
known techniques. F(ab')2 fragments consist of the variable region,
the light chain constant region and the CH1 domain of the heavy
chain and are generated by pepsin digestion of the antibody
molecule. Fab fragments are generated by reducing the disulphide
bridges of the F(ab')2 fragments. The invention also provides heavy
chain and light chain dimers of the antibodies of the invention, or
any minimal fragment thereof such as Fvs or single chain antibodies
(SCAs) (e.g., as described in U.S. Pat. No. 4,946,778; Bird, 1988,
Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; and Ward et al., 1989, Nature 334:544-54), or any
other molecule with the same specificity as the antibody of the
invention. Single chain antibodies are formed by linking the heavy
and light chain fragments of the Fv region via an amino acid
bridge, resulting in a single chain polypeptide. Techniques for the
assembly of functional Fv fragments in E. coli may be used (Skerra
et al., 1988, Science 242:1038-1041).
[0122] In other embodiments, the invention provides fusion
polypeptides of the immunoglobulins of the invention (or
functionally active fragments thereof), for example in which the
immunoglobulin is fused via a covalent bond (e.g., a peptide bond),
at either the N-terminus or the C-terminus to an amino acid
sequence of another polypeptide (or portion thereof, preferably at
least 10, 20 or 50 amino acid portion of the polypeptide) that is
not the immunoglobulin. Preferably the immunoglobulin, or fragment
thereof, is covalently linked to the other polypeptide at the
N-terminus of the constant domain. As stated above, such fusion
polypeptides may facilitate purification, increase half-life in
vivo, and enhance the delivery of an antigen across an epithelial
barrier to the immune system.
[0123] The immunoglobulins of the invention include analogues and
derivatives that are either modified, i.e., by the covalent
attachment of any type of molecule as long as such covalent
attachment that does not impair immunospecific binding. For
example, but not by way of limitation, the derivatives and
analogues of the immunoglobulins include those that have been
further modified, e.g., by glycosylation, acetylation, pegylation,
phosphylation, amidation, derivatisation by known
protecting/blocking groups, proteolytic cleavage, linkage to a
cellular ligand or other protein, etc. Any of numerous chemical
modifications may be carried out by known techniques, including,
but not limited to specific chemical cleavage, acetylation,
formylation, etc. Additionally, the analogue or derivative may
contain one or more non-classical amino acids.
[0124] The foregoing antibodies can be used in methods known in the
art relating to the localisation and activity of the polypeptides
of the invention, e.g., for imaging or radioimaging these
polypeptides, measuring levels thereof in appropriate biological
samples, in diagnostic methods, etc. and for radiotherapy.
[0125] The antibodies of the invention can be produced by any
method known in the art for the synthesis of antibodies, in
particular, by chemical synthesis or by recombinant expression, and
are preferably produced by recombinant expression technique.
[0126] Recombinant expression of antibodies, or fragments,
derivatives or analogs thereof, requires construction of a nucleic
acid that encodes the antibody. If the nucleotide sequence of the
antibody is known, a nucleic acid encoding the antibody may be
assembled from chemically synthesised oligonucleotides (e.g., as
described in Kutmeier et al., 1994, BioTechniques 17:242), which,
briefly, involves the synthesis of overlapping oligonucleotides
containing portions of the sequence encoding antibody, annealing
and ligation of those oligonucleotides, and then amplification of
the ligated oligonucleotides by PCR.
[0127] Alternatively, the nucleic acid encoding the antibody may be
obtained by cloning the antibody. If a clone containing the nucleic
acid encoding the particular antibody is not available, but the
sequence of the antibody molecule is known, a nucleic acid encoding
the antibody may be obtained from a suitable source (e.g., an
antibody cDNA library, or cDNA library generated from any tissue or
cells expressing the antibody) by PCR amplification using synthetic
primers hybridizable to the 3' and 5' ends of the sequence or by
cloning using an oligonucleotide probe specific for the particular
gene sequence.
[0128] If an antibody molecule that specifically recognises a
particular antigen is not available (or a source for a cDNA library
for cloning a nucleic acid encoding such an antibody), antibodies
specific for a particular antigen may be generated by any method
known in the art, for example, by immunising an animal, such as a
rabbit, to generate polyclonal antibodies or, more preferably, by
generating monoclonal antibodies. Alternatively, a clone encoding
at least the Fab portion of the antibody may be obtained by
screening Fab expression libraries (e.g., as described in Huse et
al., 1989, Science 246:1275-1281) for clones of Fab fragments that
bind the specific antigen or by screening antibody libraries (See,
e.g., Clackson et al., 1991, Nature 352:624; Hane et al., 1997
Proc. Natl. Acad. Sci. USA 94:4937).
[0129] Once a nucleic acid encoding at least the variable domain of
the antibody molecule is obtained, it may be introduced into a
vector containing the nucleotide sequence encoding the constant
region of the antibody molecule (see, e.g., WO 86/05807; WO
89/01036; and U.S. Pat. No. 5,122,464). Vectors containing the
complete light or heavy chain for co-expression with the nucleic
acid to allow the expression of a complete antibody molecule are
also available. Then, the nucleic acid encoding the antibody can be
used to introduce the nucleotide substitution(s) or deletion(s)
necessary to substitute (or delete) the one or more variable region
cysteine residues participating in an intrachain disulphide bond
with an amino acid residue that does not contain a sulfhydyl group.
Such modifications can be carried out by any method known in the
art for the introduction of specific mutations or deletions in a
nucleotide sequence, for example, but not limited to, chemical
mutagenesis, in vitro site directed mutagenesis (Hutchinson et al.,
1978, J. Biol. Chem. 253:6551), PCR based methods, etc.
[0130] In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad.
Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda
et al., 1985, Nature 314:452-454) by splicing genes from a mouse
antibody molecule of appropriate antigen specificity together with
genes from a human antibody molecule of appropriate biological
activity can be used. As described supra, a chimeric antibody is a
molecule in which different portions are derived from different
animal species, such as those having a variable region derived from
a murine mAb and a human antibody constant region, e.g., humanised
antibodies.
[0131] Once a nucleic acid encoding an antibody of the invention
has been obtained, the vector for the production of the antibody
may be produced by recombinant DNA technology using techniques well
known in the art. Thus, methods for preparing the polypeptides of
the invention by expressing nucleic acid containing the antibody
molecule sequences are described herein. Methods which are well
known to those skilled in the art can be used to construct
expression vectors containing an antibody molecule coding sequences
and appropriate transcriptional and translational control signals.
These methods include, for example, in vitro recombinant DNA
techniques, synthetic techniques, and in vivo genetic
recombination. See, for example, the techniques described in
Sambrook et al. (1990, Molecular Cloning, A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) and
Ausubel et al. (eds., 1998, Current Protocols in Molecular Biology,
John Wiley & Sons, NY).
[0132] The expression vector is transferred to a host cell by
conventional techniques and the transfected cells are then cultured
by conventional techniques to produce an antibody of the
invention.
[0133] The host cells used to express a recombinant antibody of the
invention may be either bacterial cells such as E. coli, or,
preferably, eukaryotic cells, especially for the expression of
whole recombinant antibody molecule. In particular, mammalian cells
such as Chinese hamster ovary cells (CHO); in conjunction with a
vector such as the major intermediate early gene promoter element
from human cytomegalovirus is an effective expression system for
antibodies (Foecking et al., 1986, Gene 45:101; Cockett et al.,
1990, Bio/Technology 8:2).
[0134] A variety of host-expression vector systems may be utilised
to express an antibody molecule of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, express the
antibody molecule of the invention in situ. These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with recombinant bacteriophage DNA, plasmid
DNA or cosmid DNA expression vectors containing antibody coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing antibody coding
sequences; insect cell systems infected with recombinant virus
expression vectors (e.g., baculovirus) containing the antibody
coding sequences; plant cell systems infected with recombinant
virus expression vectors (e.g., cauliflower mosaic virus, CaMV;
tobacco mosaic virus, TMV) or transformed with recombinant plasmid
expression vectors (e.g., Ti plasmid) containing antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, HEK 293,
3T3 cells) harbouring recombinant expression constructs containing
promoters derived from the genome of mammalian cells (e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
[0135] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
antibody molecule being expressed. For example, when a large
quantity of such a polypeptide is to be produced, for the
generation of pharmaceutical compositions comprising an antibody
molecule, vectors which direct the expression of high levels of
fusion polypeptide products that are readily purified may be
desirable. Such vectors include, but are not limited, to the E.
coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791), in which the antibody coding sequence may be ligated
individually into the vector in frame with the lac Z coding region
so that a fusion polypeptide is produced; pIN vectors (Inouye &
Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke &
Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like. pGEX
vectors may also be used to express foreign polypeptides as fusion
polypeptides with glutathione S-transferase (GST). In general, such
fusion polypeptides are soluble and can easily be purified from
lysed cells by adsorption and binding to a matrix
glutathione-agarose beads followed by elution in the presence of
free glutathione. The pGEX vectors are designed to include thrombin
or factor Xa protease cleavage sites so that the cloned target gene
product can be released from the GST moiety.
[0136] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The antibody
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter). In mammalian host cells, a number of viral-based
expression systems (e.g., an adenovirus expression system) may be
utilised.
[0137] As discussed above, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of polypeptide products may be important for the function of the
polypeptide.
[0138] For long-term, high-yield production of recombinant
antibodies, stable expression is preferred. For example, cells
lines that stably express an antibody of interest can be produced
by transfecting the cells with an expression vector comprising the
nucleotide sequence of the antibody and the nucleotide sequence of
a selectable (e.g., neomycin or hygromycin), and selecting for
expression of the selectable marker. Such engineered cell lines may
be particularly useful in screening and evaluation of agents that
interact directly or indirectly with the antibody molecule.
[0139] The expression levels of the antibody molecule can be
increased by vector amplification (for a review, see Bebbington and
Hentschel, The use of vectors based on gene amplification for the
expression of cloned genes in mammalian cells in DNA cloning, Vol.
3. (Academic Press, New York, 1987)). When a marker in the vector
system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number
of copies of the marker gene. Since the amplified region is
associated with the antibody gene, production of the antibody will
also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257).
[0140] The host cell may be co-transfected with two expression
vectors of the invention, the first vector encoding a heavy chain
derived polypeptide and the second vector encoding a light chain
derived polypeptide. The two vectors may contain identical
selectable markers which enable equal expression of heavy and light
chain polypeptides. Alternatively, a single vector may be used
which encodes both heavy and light chain polypeptides. In such
situations, the light chain should be placed before the heavy chain
to avoid an excess of toxic free heavy chain (Proudfoot, 1986,
Nature 322:52; Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2197).
The coding sequences for the heavy and light chains may comprise
cDNA or genomic DNA.
[0141] Once the antibody molecule of the invention has been
recombinantly expressed, it may be purified by any method known in
the art for purification of an antibody molecule, for example, by
chromatography (e.g., ion exchange chromatography, affinity
chromatography such as with protein A or specific antigen, and
sizing column chromatography), centrifugation, differential
solubility, or by any other standard technique for the purification
of polypeptides.
[0142] Alternatively, any fusion polypeptide may be readily
purified by utilising an antibody specific for the fusion
polypeptide being expressed. For example, a system described by
Janknecht et al. allows for the ready purification of non-denatured
fusion polypeptides expressed in human cell lines (Janknecht et
al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-897). In this system,
the gene of interest is subcloned into a vaccinia recombination
plasmid such that the open reading frame of the gene is
translationally fused to an amino-terminal tag consisting of six
histidine residues. The tag serves as a matrix binding domain for
the fusion polypeptide. Extracts from cells infected with
recombinant vaccinia virus are loaded onto Ni.sup.2+ nitriloacetic
acid-agarose columns and histidine-tagged proteins are selectively
eluted with imidazole-containing buffers.
[0143] In a preferred embodiment, antibodies of the invention or
fragments thereof are eonjugated to a diagnostic or therapeutic
moiety. The antibodies can be used for diagnosis or to determine
the efficacy of a given treatment regimen. Detection can be
facilitated by coupling the antibody to a detectable substance.
Examples of detectable substances include various enzymes,
prosthetic groups, fluorescent materials, luminescent materials,
bioluminescent materials, radioactive nuclides, positron emitting
metals (for use in positron emission tomography), and
nonradioactive paramagnetic metal ions. See generally U.S. Pat. No.
4,741,900 for metal ions which can be conjugated to antibodies for
use as diagnostics according to the present invention. Suitable
enzymes include horseradish peroxidase, alkaline phosphatase,
beta-galactosidase, or acetylcholinesterase; suitable prosthetic
groups include streptavidin, avidin and biotin; suitable
fluorescent materials include umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine
fluorescein, dansyl chloride and phycoerythrin; suitable
luminescent materials include luminol; suitable bioluminescent
materials include luciferase, luciferin, and aequorin; and suitable
radioactive nuclides include .sup.125I, .sup.131I, .sup.111In and
.sup.99Tc.
[0144] Antibodies of the invention or fragments thereof can be
conjugated to a therapeutic agent or drug moiety to modify a given
biological response. The therapeutic agent or drug moiety is not to
be construed as limited to classical chemical therapeutic agents.
For example, the drug moiety may be a protein or polypeptide
possessing a desired biological activity. Such proteins may
include, for example, a toxin such as abrin, ricin A, pseudomonas
exotoxin, or diphtheria toxin; a polypeptide such as tumour
necrosis factor, .alpha.-interferon, .beta.-interferon, nerve
growth factor, platelet derived growth factor, tissue plasminogen
activator, a thrombotic agent or an anti-angiogenic agent, e.g.,
angiostatin or endostatin; or, a biological response modifier such
as a lymphokine, interleukin-1 (IL-1), interleukin-2 (IL-2),
interleukin-6 (IL-6), granulocyte macrophage colony stimulating
factor (GM-CSF), granulocyte colony stimulating factor (G-CSF),
nerve growth factor (NGF) or other growth factor.
[0145] Techniques for conjugating such therapeutic moieties to
antibodies are well known, see, e.g., Arnon et al., "Monoclonal
Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in
Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe,
"Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical
Applications, Pinchera et al. (eds.), pp. 475-506 (1985);
"Analysis, Results, And Future Prospective Of The Therapeutic Use
Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.),
pp. 303-16 (Academic Press 1985), and Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev., 62:119-58 (1982).
[0146] Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described in U.S.
Pat. No. 4,676,980.
[0147] An antibody with or without a therapeutic moiety conjugated
to it can be used as a therapeutic that is administered alone or in
combination with cytotoxic factor(s) and/or cytokine(s).
[0148] Polyclonal antibodies can be raised by stimulating their
production in a suitable animal host (e.g. a chicken, mouse, rat,
guinea pig, rabbit, sheep, goat or monkey) when the polypeptide of
the present invention is injected into the animal. If necessary, an
adjuvant may be administered together with the polypeptide of the
invention. The antibodies can then be purified by virtue of their
binding to a polypeptide of the invention.
[0149] Monoclonal antibodies can be produced from hybridomas. These
can be formed by fusing myeloma cells and spleen cells which
produce the desired antibody in order to form an immortal cell
line. This is the well known Kohler & Milstein technique
(Nature 256 52-55 (1975)).
[0150] A further aspect of the invention provides methods of
screening for agents that modulate (e.g., upregulate or
downregulate) a characteristic of, e.g., the expression or the
enzymatic or binding activity, of a polypeptide of the
invention.
[0151] The invention provides methods for identifying active agents
(e.g., chemical compounds, proteins, or peptides) that bind to a
polypeptide of the invention and/or have a stimulatory or
inhibitory effect on the expression or activity of a polypeptide of
the invention. Examples of candidate agents, include, but are not
limited to, nucleic acids (e.g., DNA and RNA), carbohydrates,
lipids, proteins, peptides, peptidomimetics, agonists, antagonists,
small molecules and other drugs. Active agents can be obtained
using any of the numerous suitable approaches in combinatorial
library methods known in the art, including: biological libraries;
spatially addressable parallel solid phase or solution phase
libraries; synthetic library methods requiring deconvolution; the
"one-bead one-compound" library method; and synthetic library
methods using affinity chromatography selection. The biological
library approach is limited to peptide libraries, while the other
four approaches are applicable to peptide, non-peptide oligomer or
small molecule libraries of compounds (Lam, 1997, Anticancer Drug
Des. 12:145; U.S. Pat. No. 5,738,996; and U.S. Pat. No.
5,807,683)
[0152] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al., 1993, Proc.
Natl. Acad. Sci. USA 90:6909; Erb et al., 1994, Proc. Natl. Acad.
Sci. USA 91:11422; Zuckermann et al., 1994, J. Med. Chem. 37:2678;
Cho et al., 1993, Science 261:1303; Carrell et al., 1994, Angew.
Chem. Int. Ed. Engl. 33:2059; Carell et al., 1994, Angew. Chem.
Int. Ed. Engl. 33:2061; and Gallop et al., 1994, J. Med. Chem.
37:1233.
[0153] Libraries of compounds may be presented, e.g., presented in
solution (e.g., Houghten, 1992, Bio/Techniques 13:412-421), or on
beads (Lam, 1991, Nature 354:82-84), chips (Fodor, 1993, Nature
364:555-556), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat.
Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al.,
1992, Proc. Natl. Acad. Sci. USA 89:1865-1869) or phage (Scott and
Smith, 1990, Science 249:386-390; Devlin, 1990, Science
249:404-406; Cwirla et al., 1990, Proc. Natl. Acad. Sci. USA
87:6378-6382; and Felici, 1991, J. Mol. Biol. 222:301-310).
[0154] In one embodiment, agents that interact with (i.e., bind to)
a polypeptide of the invention are identified in a cell-based assay
system. In accordance with this embodiment, cells expressing a
polypeptide of the invention are contacted with a candidate agent
or a control agent and the ability of the candidate agent to
interact with said polypeptide is determined. If desired, this
assay may be used to screen a plurality (e.g. a library) of
candidate agents. The cell, for example, can be of prokaryotic
origin (e.g., E. coli) or eukaryotic origin (e.g., yeast or
mammalian). Further, the cells can express the polypeptide of the
invention endogenously or be genetically engineered to express said
polypeptide. In some embodiments, the polypeptide of the invention
or the candidate agent is labelled, for example with a radioactive
label (such as .sup.32P, .sup.35S or .sup.125I) or a fluorescent
label (such as fluorescein isothiocyanate, rhodamine,
phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde or
fluorescamine) to enable detection of an interaction between a
polypeptide and a candidate agent. The ability of the candidate
agent to interact directly or indirectly with the polypeptide of
the invention can be determined by methods known to those of skill
in the art. For example, but without limitation, the interaction
between a candidate agent and a polypeptide of the invention can be
determined by flow cytometry, a scintillation assay,
immunoprecipitation or western blot analysis.
[0155] In another embodiment, agents that interact with (i.e., bind
to) a polypeptide of the invention are identified in a cell-free
assay system. In accordance with this embodiment, a native or
recombinant polypeptide of the invention is contacted with a
candidate agent or a control agent and the ability of the candidate
agent to interact with said polypeptide is determined. If desired,
this assay may be used to screen a plurality (e.g. a library) of
candidate agents. Preferably, the polypeptide is first immobilised,
by, for example, contacting the polypeptide with an immobilised
antibody which specifically recognises and binds it, or by
contacting a purified preparation of polypeptide with a surface
designed to bind proteins. The polypeptide may be partially or
completely purified (e.g., partially or completely free of other
polypeptides) or part of a cell lysate. Further, the polypeptide
may be a fusion polypeptide comprising the polypeptide of the
invention and a domain such as glutathionine-S-transferase.
Alternatively, the polypeptide can be biotinylated using techniques
well known to those of skill in the art (e.g., biotinylation kit,
Pierce Chemicals; Rockford, Ill.). The ability of the candidate
agent to interact with the polypeptide can be can be duplicated by
methods known to those of skill in the art.
[0156] In another embodiment, a cell-based assay system is used to
identify active agents that bind to and/or modulate the activity of
a protein, such as an enzyme, or a biologically active portion
thereof, which is responsible for the production or degradation of
the polypeptide of the invention or is responsible for the
post-translational modification of the polypeptide. In a primary
screen, a plurality (e.g., a library) of agents are contacted with
cells that naturally or recombinantly express: (i) a polypeptide of
the invention; and (ii) a protein that is responsible for
processing of the polypeptide in order to identify compounds that
modulate the production, degradation, or post-translational
modification of the polypeptide. If desired, active agents
identified in the primary screen can then be assayed in a secondary
screen against cells naturally or recombinantly expressing the
specific polypeptide of interest. The ability of the candidate
agent to modulate the production, degradation or post-translational
modification of a polypeptide can be determined by methods known to
those of skill in the art, including without limitation, flow
cytometry, a scintillation assay, immunoprecipitation and western
blot analysis.
[0157] In another embodiment, agents that competitively interact
with a polypeptide of the invention are identified in a competitive
binding assay. In accordance with this embodiment, cells expressing
the polypeptide are contacted with a candidate agent and as agent
known to interact with the polypeptide; the ability of the
candidate agent to competitively interact with the polypeptide is
then determined. Alternatively, agents that competitively interact
with a polypeptide of the invention are identified in a cell-free
assay system by contacting said polypeptide with a candidate agent
and an agent known to interact with the polypeptide. As stated
above, the ability of the candidate agent to interact with a
polypeptide of the invention can be determined by methods known to
those of skill in the art. These assays, whether cell-based or
cell-free, can be used to screen a plurality (e.g., a library) of
candidate agents.
[0158] In another embodiment, agents that modulate (i.e.,
upregulate or downregulate) the expression of a polypeptide of the
invention are identified by contacting cells (e.g., cells of
prokaryotic origin or eukaryotic origin) expressing the polypeptide
with a candidate agent or a control agent (e.g., phosphate buffered
saline (PBS)) and determining the expression of the polypeptide, or
mRNA encoding the polypeptide. The level of expression of a
selected polypeptide, or mRNA encoding polypeptide, in the presence
of the candidate agent is compared to the level of expression of
the polypeptide or mRNA encoding the polypeptide in the absence of
the candidate agent (e.g., in the presence of a control agent). The
candidate agent can then be identified as a modulator of the
expression of the polypeptide based on this comparison. For
example, when expression of the polypeptide, or mRNA encoding the
polypeptide, is significantly greater in the presence of the
candidate agent than in its absence, the candidate agent is
identified as a stimulator of expression of the polypeptide, or
mRNA encoding the polypeptide. Alternatively, when expression of
the polypeptide, or mRNA encoding the polypeptide, is significantly
less in the presence of the candidate agent than in its absence,
the candidate agent is identified as an inhibitor of the expression
of the polypeptide or mRNA encoding the polypeptide. The level of
expression of a polypeptide of the invention or the mRNA that
encodes it can be determined by methods known to those of skill in
the art based on the present description. For example, mRNA
expression can be assessed by Northern blot analysis or RT-PCR, and
protein levels can be assessed by western blot analysis.
[0159] In another embodiment, active agents that modulate the
activity of a polypeptide of the invention are identified by
contacting a preparation containing the polypeptide, or cells
(e.g., prokaryotic or eukaryotic cells) expressing the polypeptide
with a candidate agent or a control agent and determining the
ability of the candidate agent to modulate (e.g., stimulate or
inhibit) the activity of polypeptide. The activity of a polypeptide
can be assessed by detecting its effect on a "downstream effector"
for example, but without limitation, induction of a cellular signal
transduction pathway of the polypeptide, detecting catalytic or
enzymatic activity of the target on a suitable substrate, detecting
the induction of a reporter gene (e.g., a regulatory element that
is responsive to a polypeptide of the invention and is operably
linked to a nucleic acid encoding a detectable marker, e.g.,
luciferase), or detecting a cellular response, for example,
cellular differentiation, or cell proliferation as the case may be,
based on the present description, techniques known to those of
skill in the art can be used for measuring these activities (see,
e.g., U.S. Pat. No. 5,401,639). The candidate agent can then be
identified as a modulator of the activity of a polypeptide of the
invention by comparing the effects of the candidate agent to the
control agent. Suitable control agents include phosphate buffered
saline (PBS) and normal saline (NS).
[0160] In another embodiment, active agents that modulate (i.e.,
upregulate or downregulate) the expression, activity or both the
expression and activity of a polypeptide of the invention are
identified in an animal model. Examples of suitable animals
include, but are not limited to, mice, rats, rabbits, monkeys,
guinea pigs, dogs and cats. Preferably, the animal used represents
a model of breast cancer and/or kidney cancer. In accordance with
this embodiment, the candidate agent or a control agent is
administered (e.g., orally, rectally or parenterally such as
intraperitoneally or intravenously) to a suitable animal and the
effect on the expression, activity or both expression and activity
of the polypeptide is determined. Changes in the expression of a
polypeptide can be assessed by any suitable method described above,
based on the present description.
[0161] In yet another embodiment, a polypeptide of the invention is
used as a "bait protein" in a two-hybrid assay or three-hybrid
assay to identify other proteins that bind to or interact with the
polypeptide (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al.
(1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Bio/Techniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and WO 94/10300). As
those skilled in the art will appreciate, such binding proteins are
also likely to be involved in the propagation of signals by the
polypeptides of the invention as, for example, upstream or
downstream elements of a signalling pathway involving the
polypeptides of the invention.
[0162] Thus, the present invention provides assays for use in drug
discovery in order to identify or verify the efficacy of agents for
treatment or prevention of cancer, in particular breast cancer
and/or kidney cancer. Candidate agents can be assayed for their
ability to modulate levels of a polypeptide of the invention, in a
subject having breast cancer and/or kidney cancer. Active agents
able to modulate levels of a polypeptide of the invention in a
subject having breast cancer and/or kidney cancer towards levels
found in subjects free from breast cancer and/or kidney cancer, or
to produce similar changes in experimental animal models of breast
cancer and/or kidney cancer, can be used as lead agents for further
drug discovery, or used therapeutically. Expression of a
polypeptide of the invention can be assayed by, for example,
immunoassays, gel electrophoresis followed by visualization,
detection of activity, or any other method taught herein or known
to those skilled in the art. Such assays can be used to screen
candidate drugs, in clinical monitoring or in drug development,
where abundance of a polypeptide of the invention can serve as a
surrogate marker for clinical disease.
[0163] One skilled in the art will also appreciate that a
polypeptide of the invention above may be used in a method for the
structure-based design of an agent, in particular a small molecule
which acts to modulate (e.g. stimulate or inhibit) the activity of
said polypeptide, said method comprising: [0164] 1) determining the
three-dimensional structure of said polypeptide; [0165] 2) deducing
the three-dimensional structure of the likely reactive or binding
site(s) of the agent; [0166] 3) synthesizing candidate agents that
are predicted to react or bind to the deduced reactive or binding
site; and [0167] 4) testing whether the candidate agent is able to
modulate the activity of said polypeptide.
[0168] It will be appreciated that the method described above is
likely to be an iterative process.
[0169] This invention further provides novel active agents
identified by the above-described screening methods and uses
thereof for treatments as described herein.
[0170] As used herein, the term "active agent" refers to the
polypeptides of the invention and nucleic acid molecules encoding
the polypeptides, antibodies against the polypeptides and agents
which modulate the expression and/or activity of the polypeptides
of the invention. Preferably, the active agent is a small
molecule.
[0171] As discussed herein, active agents of the invention find use
in the treatment or prophylaxis of breast and/or kidney cancer.
[0172] Thus, in an additional aspect, the present invention
provides a pharmaceutical composition comprising at least one
active agent of the invention, optionally together with one or more
pharmaceutically acceptable excipients, carriers or diluents. In
one aspect, the pharmaceutical composition is for use as a vaccine
and so any additional components will be acceptable for vaccine
use. In addition, the skilled person will appreciate that one or
more suitable adjuvants may be added to such vaccine
preparations.
[0173] The composition will usually be supplied as part of a
sterile, pharmaceutical composition which will normally include a
pharmaceutically acceptable carrier. This pharmaceutical
composition may be in any suitable form, (depending upon the
desired method of administering it to a patient).
[0174] It may be provided in unit dosage form, will generally be
provided in a sealed container and may be provided as part of a
kit. Such a kit would normally (although not necessarily) include
instructions for use. It may include a plurality of said unit
dosage forms.
[0175] The pharmaceutical composition may be adapted for
administration by any appropriate route, for example by the oral
(including buccal or sublingual), rectal, nasal, topical (including
buccal, sublingual or transdermal), vaginal or parenteral
(including subcutaneous, intramuscular, intravenous or intradermal)
route. Such compositions may be prepared by any method known in the
art of pharmacy, for example by admixing the active ingredient with
the carrier(s) or excipient(s) under sterile conditions.
[0176] Pharmaceutical compositions adapted for oral administration
may be presented as discrete units such as capsules or tablets; as
powders or granules; as solutions, syrups or suspensions (in
aqueous or non-aqueous liquids; or as edible foams or whips; or as
emulsions).
[0177] Suitable excipients for tablets or hard gelatine capsules
include lactose, maize starch or derivatives thereof, stearic acid
or salts thereof.
[0178] Suitable excipients for use with soft gelatine capsules
include for example vegetable oils, waxes, fats, semi-solid, or
liquid polyols etc.
[0179] For the preparation of solutions and syrups, excipients
which may be used include for example water, polyols and sugars.
For the preparation of suspensions, oils (e.g. vegetable oils) may
be used to provide oil-in-water or water-in-oil suspensions.
[0180] Pharmaceutical compositions adapted for transdermal
administration may be presented as discrete patches intended to
remain in intimate contact with the epidermis of the recipient for
a prolonged period of time. For example, the active ingredient may
be delivered from the patch by iontophoresis as generally described
in Pharmaceutical Research, 3(6):318 (1986).
[0181] Pharmaceutical compositions adapted for topical
administration may be formulated as ointments, creams, suspensions,
lotions, powders, solutions, pastes, gels, sprays, aerosols or
oils. When formulated in an ointment, the active ingredient may be
employed with either a paraffinic or a water-miscible ointment
base. Alternatively, the active ingredient may be formulated in a
cream with an oil-in-water cream base or a water-in-oil base.
Pharmaceutical compositions adapted for topical administration to
the eye include eye drops wherein the active ingredient is
dissolved or suspended in a suitable carrier, especially an aqueous
solvent. Pharmaceutical compositions adapted for topical
administration in the mouth include lozenges, pastilles and mouth
washes.
[0182] Pharmaceutical compositions adapted for rectal
administration may be presented as suppositories or enemas.
[0183] Pharmaceutical compositions adapted for nasal administration
wherein the carrier is a solid include a coarse powder having a
particle size for example in the range 20 to 500 microns which is
administered in the manner in which snuff is taken, i.e. by rapid
inhalation through the nasal passage from a container of the powder
held close up to the nose. Suitable compositions wherein the
carrier is a liquid, for administration as a nasal spray or as
nasal drops, include aqueous or oil solutions of the active
ingredient.
[0184] Pharmaceutical compositions adapted for administration by
inhalation include fine particle dusts or mists which may be
generated by means of various types of metered dose pressurised
aerosols, nebulizers or insufflators.
[0185] Pharmaceutical compositions adapted for vaginal
administration may be presented as pessaries, tampons, creams,
gels, pastes, foams or spray compositions.
[0186] Pharmaceutical compositions adapted for parenteral
administration include aqueous and non-aqueous sterile injection
solution which may contain anti-oxidants, buffers, bacteriostats
and solutes which render the composition substantially isotonic
with the blood of the intended recipient; and aqueous and
non-aqueous sterile suspensions which may include suspending agents
and thickening agents. Excipients which may be used for injectable
solutions include water, alcohols, polyols, glycerine and vegetable
oils, for example. The compositions may be presented in unit-dose
or multi-dose containers, for example sealed ampoules and vials,
and may be stored in a freeze-dried (lyophilised) condition
requiring only the addition of the sterile liquid carried, for
example water for injections, immediately prior to use.
Extemporaneous injection solutions and suspensions may be prepared
from sterile powders, granules and tablets.
[0187] The pharmaceutical compositions may contain preserving
agents, solubilising agents, stabilising agents, wetting agents,
emulsifiers, sweeteners, colorants, odorants, salts (polypeptides
of the present invention may themselves be provided in the form of
a pharmaceutically acceptable salt), buffers, coating agents or
antioxidants. They may also contain therapeutically active agents
in addition to the polypeptide of the present invention.
[0188] Dosages of the active agent of the present invention can
vary between wide limits, depending upon the disease or disorder to
be treated, the age and condition of the individual to be treated,
etc. and a physician will ultimately determine appropriate dosages
to be used. This dosage may be repeated as often as appropriate. If
side effects develop the amount and/or frequency of the dosage can
be reduced, in accordance with normal clinical practice.
[0189] In a further aspect, the present invention provides a method
for the prophylaxis and/or treatment of breast and/or kidney cancer
in a subject, which comprises administering to said subject a
therapeutically effective amount of at least active agent of the
invention.
[0190] In another aspect, the present invention provides the use of
at least one polypeptide or fragment thereof, nucleic acid molecule
or antibody of the invention in the preparation of a medicament for
use in the prophylaxis and/or treatment of breast and/or kidney
cancer. In particular, the preparation of vaccines and/or
compositions comprising or consisting of antibodies is a preferred
embodiment of this aspect of the invention.
[0191] In the context of the present invention, the biological
sample can be obtained from any source, such as a serum sample or a
tissue sample, e.g. breast or kidney tissue. When looking for
evidence of metastasis, one would look at major sites of breast
metastasis such as lymph nodes, liver, lung and/or bone and of
kidney metastasis, such as lymph nodes, lung and/or bone.
[0192] Preferred features of each aspect of the invention are as
for each of the other aspects mutatis mutandis. The prior art
documents mentioned herein are incorporated by reference to the
fullest extent permitted by law.
[0193] The invention will now be described with reference to the
following examples, which should not in any way be construed as
limiting the scope of the present invention. The examples refer to
the figures in which:
[0194] FIG. 1: shows the predicted amino acid sequence (SEQ ID NO:
1) and the nucleic acid sequence (SEQ ID NO: 2) of BCMP 101. The
tandem mass spectrum is in bold and italicised. MALDI mass spectra
are in bold and underlined. The peptide sequence used to raise the
polyclonal antibody against BCMP 101 is shaded.
[0195] FIG. 2: shows tissue distribution of BCMP 101 mRNA. Levels
of mRNA in normal tissues (including kidney) and two kidney cancer
cell lines (Wilm's tumour cell line G-401 and human embryonic
kidney cell line 293) were quantified by real time RT-PCR. mRNA
levels are expressed as the number of copies ng.sup.-1 cDNA.
[0196] FIG. 3: shows the expression of BCMP 101 mRNA in normal and
tumour breast tissues. Levels of BCMP 101 mRNA in matched normal
and tumour tissues from seven breast cancer patients were measured
by real time RT-PCR. mRNA levels are expressed as the number of
copies ng.sup.-1 cDNA.
[0197] FIG. 4: compares expression of BCMP 101 mRNA in
metastatic/non-metastatic breast tumour tissues. A=Samples 1-23,
which are derived from tumour samples not involving metastasis to
the lymph nodes. B=Samples 26-50, which are derived from tumour
samples involving metastases to variable numbers of lymph nodes.
C=8 samples from normal breast tissues (reduction mammoplasties).
mRNA levels are expressed as the number of copies ng.sup.-1 cDNA.
There is a statistically significant difference between all tumour
samples and normal samples (T-test, p<0.05).
[0198] FIG. 5: in situ RT PCR analysis of BCMP 101 expression in
sections of invasive ductal breast cancer tissue (upper panel), and
consecutive negative control section in which the BCMP 101 primers
have been replaced with primers to a control gene (Prostate
Specific Antigen) (lower panel). Note the high BCMP 101 expression
(dark staining) in a portion of epithelial hyperplasia (typical of
breast carcinoma), flanked with two arrowheads in the upper
panel.
[0199] FIG. 6: cellular localisation of BCMP 101 in breast cancer
cell lines. Fluorescence microscopy showing expression of
C-terminal SuperGlo.TM. AFP-tagged BCMP101 in MDA-MB-468 (A) and
T-47D (B) cell lines. Membrane localisation is indicated by white
arrowheads. Magnification using .times.60 oil immersion
objective.
[0200] FIG. 7: immunohistochemical localisation of BCMP 101 protein
expression in breast carcinoma tissue sections. BCMP 101
immunostaining in carcinoma cells is indicated by arrowheads.
EXAMPLE 1
Identification and Cloning of BCMP 101
[0201] Protein BCMP101 Was Isolated from MDA-MB-468 Cell
Membranes.
[0202] The breast carcinoma cell line MDA-MB-468 (ATCC:HTB-132) was
cultured and integral membranes were extracted with the Tx 114
detergent. These were subsequently analysed by two-dimensional gel
electrophoresis as described in U.S. Pat. Nos. 6,064,754 and
6,278,794.
Mass Spectrometry
[0203] Proteins excised from the 2D gel were digested with trypsin
and analysed by MALDI-TOF-MS (Voyager STR, Applied Biosystems)
using a 337 nm wavelength laser for desorption and the reflectron
mode of analysis. Selected masses for BCMP 101 were further
characterised by tandem mass spectrometry using a QTOF-MS equipped
with a nanospray ion source, (Micromass UK Ltd.). Prior to MALDI
analysis the samples were desalted and concentrated using C18 Zip
Tips.TM. (Millipore). Samples for tandem MS were purified using a
nano LC system (LC Packings) incorporating C18 SPE material.
[0204] Using the SEQUEST search program (Eng et al., 1994, J. Am.
Soc. Mass Spectrom. 5:976-989), uninterpreted tandem mass spectra
of tryptic digest peptides were searched against a database of
public domain proteins constructed of protein entries in the
non-redundant database held by the National Centre for
Biotechnology Information (NCBI) which is accessible at
http://www.ncbi.nlm.nih.gov/ and also constructed of Expressed
Sequence Tags entries
(http://www.ncbi.nlm.nih.gov/dbEST/index.html). As a result of
database searching, the following amino acid sequence of a tryptic
digest peptide of BCMP 101 was determined from a match to a tryptic
digest peptide in a conceptual translation of EST AI472043:
NSESFAAWCR (SEQ ID NO: 3, shown in FIG. 1).
[0205] EST AI472043 corresponds to base pairs 558-1054 of the DNA
sequence in FIG. 1. ESTs AI684699 (corresponding to bp 80-565) and
AI827549 (corresponding to bp 45-547) were used to establish the
full length ORF (note that AI827549 includes the in frame stop
codon just upstream of the ATG). The sense primer used to amplify
the full length clone was designed to genomic sequences in entry
AC021396 (see below Example 3 on chromosomal localisation). The
identified protein had a pI of 5.3 and a MW of 39940Da as measured
by 2-D gel analysis as described above, the predicted pI and MW for
this protein is 5.34 and 34474 respectively.
A Full Length Clone Was Amplified By PCR from MDA-MB-468 cDNA
Preparation of Total RNA and cDNA Synthesis
[0206] Total RNA was prepared from cultured cells and tissue
samples using Trizol reagent (Life Technologies), according to the
manufacturer's instructions, and resuspended in RNAse-free water at
a concentration of 1 .mu.g/.mu.l. 1 to 5 .mu.g total RNA were used
as a template for cDNA synthesis using an oligo dT primer and the
Superscript II reverse transcription kit (Life Technologies). cDNAs
were column purified (Qiagen) and eluted at a concentration of 10
ng/.mu.l.
Cloning of BCMP 101 cDNA
[0207] The predicted full length BCMP101 ORF was amplified by PCR
from MDA-MB-468 cDNAs, using the following primers:
TABLE-US-00001 Sense, 5'TGTGCAAATGACCCTGGAGTTG 3'; (SEQ ID NO: 4)
Antisense, 5'GGCTGCTACTGCAAACAGTTCC 3'. (SEQ ID NO: 5)
[0208] Reactions contained 10 ng cDNA and reagents for PCR
(Clontech, Advantage-GC 2 PCR kit), and used the following cycling
parameters: 1 cycle of 94.degree. C. for 3 minutes, followed by 40
cycles of 94.degree. C. for 30 seconds, 65.degree. C. for 30
seconds, 72.degree. C. for 90 seconds. The PCR products were column
purified (Qiagen), cloned into a T/A vector (Invitrogen) and the
nucleotide sequence subsequently verified (University of Oxford,
Sequencing Facility, UK).
[0209] The BCMP 101 sequence (FIG. 1, SEQ ID NO: 1) matches the
following GenBank entry (available at:
http://www.ncbi.nlm.nih.gov/): CAD10629-NSE2 protein [Homo
sapiens]--A novel NS-containing protein (released Oct. 24,
2001)).
EXAMPLE 2
Expression of BCMP 101 mRNA in Human Tissues
[0210] Real time quantitative RT-PCR was used (Heid, C. A.,
Stevens, J., Livak, K. J. & Williams, P. M. Real time
quantitative PCR. Genome Res. 6, 986-994 (1996); Morrison, T. B.,
Weis, J. J. & Wittwer, C. T. Quantification of low-copy
transcripts by continuous SYBR Green I monitoring during
amplification. Biotechniques 24, 954-958 (1998)) to analyse the
distribution of BCMP 101 mRNA in normal human tissues and kidney
cancer cell lines (FIG. 2). Note the 40-fold difference between the
right-hand scale, used for kidney cancer cell lines, and the
left-hand scale, used for normal human tissues, which includes
normal kidney.
Quantification of BCMP 101 mRNA by RT-PCR
[0211] Real time RT-PCR was used to quantitatively measure BCMP 101
expression in normal human tissue mRNAs (Clontech), kidney cancer
cell line mRNAs (Ambion), breast cancer tissues removed during
surgery, and normal breast tissue removed during breast reduction
mammoplasty. Ethical approval for the normal and tumour breast
samples was obtained at surgery (University of Oxford, UK). The
primers used for PCR were as follows:
TABLE-US-00002 sense, 5'GGTCAACGATCTGTACCGCTAC 3', (SEQ ID NO: 6)
antisense, 5'GCCGATCTTGAACTCGCGCTTG 3'. (SEQ ID NO: 7)
[0212] Reactions containing 10 ng cDNA, prepared as described
above, SYBR green sequence detection reagents (PE Biosystems) and
sense and antisense primers were assayed on an ABI7700 sequence
detection system (PE Biosystems). The PCR conditions were 1 cycle
at 50.degree. C. for 2 min, 1 cycle at 95.degree. C. for 10 min,
and 40 cycles of 95.degree. C. for 15 s, 65.degree. C. for 1 min.
The accumulation of PCR product was measured in real time as the
increase in SYBR green fluorescence, and the data were analysed
using the Sequence Detector program v1.6.3 (PE Biosystems).
Standard curves relating initial template copy number to
fluorescence and amplification cycle were generated using the
amplified PCR product as a template, and were used to calculate
BCMP 101 copy number in each sample.
[0213] Overall, the distribution of BCMP 101 mRNA was low in normal
tissues, with the highest levels of expression in mammary gland,
kidney and bladder (130-240 copies ng.sup.-1 cDNA) (FIG. 2). In
contrast, BCMP 101 mRNA was detected at a high level in two kidney
cancer cell lines, Human Embryonic Kidney cell line 293 and Wilm's
tumour G-401 cell line (3300 and 11,000 copies ng.sup.-1 cDNA
respectively) (FIG. 2).
[0214] Since BCMP 101 was identified in the MDA-MB-468 breast
cancer-derived cell line we measured the distribution of BCMP 101
mRNA in patient matched adjacent normal and tumour breast tissue
samples from seven breast cancer patients (FIG. 3). BCMP 101
expression was increased in all tumour samples relative to their
matched normal tissues, with four of the samples showing a 4-fold
or greater increase in expression. The difference between the
paired normal and tumour sample sets was highly statistically
significant, with a p-value of 0.014. Thus, BCMP 101 shows a
restricted pattern of expression in normal human tissues, and is
elevated in some breast tumours, suggesting that this protein has
potential as a therapeutic target.
[0215] To further examine the expression of this gene in breast
cancer tissues, the quantification of BCMP 101 mRNA levels was
extended to a further set of 40 tumour samples, 20 from patients
with lymph node metastasis and 20 from patients with no lymph node
metastasis (FIG. 4). BCMP 101 mRNA expression was elevated in the
majority of the carcinoma samples, relative to the normal breast
tissue controls, however, there was no significant association of
expression with lymph node metastasis.
EXAMPLE 3
Chromosomal Localisation
[0216] A Blast search (http://www.ncbi.nlm.nih.gov/BLAST/) with the
BCMP 101 cDNA sequence (FIG. 1) against htgs (High-Throughput
Genome Sequences), returns the following GenBank clone: AC021396,
mapped to chromosome 8q23.
[0217] Furthermore, a gene responsible for Polycystic Kidney
Disease (PKD) in a rat model of autosomal dominant PKD has been
identified on rat chromosome 5 (Location of the first genetic
locus, PKDr1, controlling autosomal dominant polycystic kidney
disease in Han:SPRD cy/+ rat, Bihoreau M T, Ceccherini I, Browne J,
Kranzlin B, Romeo G, Lathrop G M, James M R, Gretz N., Hum Mol
Genet April 1997;6(4):609-13). A detailed linkage mapping of rat
chromosome 5 placed this PKD locus about 25 cM from the
proenkephalin gene, which in human is located on 8q23-q24.
[0218] A subsequent Blast search of the human genome
(http://www.ensembl.org) with the BCMP 101 cDNA sequence maps the
gene to GenBank clone AC021396 on chromosome 8, band q24.21.
EXAMPLE 4
In Situ RT-PCR
[0219] To further illustrate the involvement of BCMP 101 in breast
cancer, in situ RT-PCR analysis of BCMP 101 expression has been
carried out on sections of invasive ductal breast carcinoma
tissues.
[0220] Formalin fixed, paraffin embedded breast tissues from
patients with ductal carcinoma was sectioned (5 microM thick) onto
glass slides (provided by Human Research Tissue Bank, Department of
Cellular Pathology, Peterborough District Hospital, Thorpe Road,
Peterborough PE3 6DA). Briefly, the tissue was de-waxed in xylene,
gradually rehydrated through alcohol and washed in phosphate
buffered saline (PBS) before being permeablised in 0.01% Triton
X-100 for 3 minutes followed by treatment with Proteinase K for 30
minutes at 37.degree. C.
[0221] Direct in situ RT PCR was carried out in a GeneAmp In Situ
PCR System 1000 (Perkin Elmer Biosystems) using a GeneAmp
Thermostable rTth RT PCR kit (Perkin Elmer Biosystems). The primers
used to amplify BCMP 101 were as follows:
TABLE-US-00003 sense, 5'-TTCACCTCTCCGCGGGTAGCCT-3', (SEQ ID NO: 8)
antisense, 5'-GGAAGTTACCCACATATACGGC-3'. (SEQ ID NO: 9)
[0222] The thermal cycling parameters were; 1 cycle of 94.degree.
C. for 2.5 minutes followed by 20 cycles of 94.degree. C. for 40
seconds, 60.degree. C. for 50 seconds, and 72.degree. C. for 30
seconds. Amplified product was detectable through the direct
incorporation of alkali stable Digoxigenin-11-dUTP (Roche
Diagnostics Ltd.) which was added to the reaction mix. After
washing in PBS an anti-Digoxigenin-Gold antibody (Roche Diagnostics
Ltd.) was incubated on the tissue section for 30 minutes at room
temperature, this was followed by a silver enhancement step (Roche
Diagnostics Ltd. silver enhancement reagents) during which time the
amplified expression product became visible by light microscopy.
The tissue was counter-stained with hematoxylin (Dako Ltd.) and
images were captured by a digital camera attached to a light
microscope (.times.10 objective).
[0223] In the paired images of FIG. 5 the upper panel demonstrates
BCMP 101 expression in the breast cancer tissue, the lower panel
represents a negative control consecutive section where the BCMP101
primers have been replaced with primers to a control gene (Prostate
Specific Antigen). It is clearly apparent from these Figures that
BCMP 101 is specifically expressed in the cancerous ductal
epithelial cells of this breast cancer tissue (compare with
surrounding breast tissue and negative control experiment). For
example, a portion of epithelial hyperplasia (typical of breast
carcinoma) has been flanked with two arrowheads (upper panel); this
shows that the area of dark staining (representing BCMP101
expression) is restricted to the cancer cells.
EXAMPLE 5
Cellular Localisation of BCMP 101 in Breast Cancer Cell Lines
[0224] C-terminal tagging with SuperGlo.TM. green fluorescent
protein (GFP) was used to determine the cellular localisation of
BCMP 101 in MDA-MB-468 and T-47D cell lines.
[0225] The BCMP 101 full length ORF was PCR cloned into the
pQBI25/50-fN1 vector (Qbiogene) resulting in an in-frame addition
of the SuperGlo.TM. (sg)GFP protein to the C-terminus of the
expressed protein. Transient transfection of sgGFP-tagged BCMP 101
cDNA into MDA-MB-468 and T-47D cell lines was achieved using
Superfect.TM. transfection reagent (Qiagen) according to the
manufacturers instructions. Transfected cells were washed in
phosphate buffered saline (PBS), fixed in 4% paraformaldehyde for
30 minutes, then washed again in PBS before being mounted in an
aqueous-based fluorescent mounting medium (Dako Ltd.). Fluorescence
images were captured using a DC300F digital camera attached to a
DMIRE2 fluorescence microscope (Leica Microsystems (UK) Ltd.)
[0226] Analysis of the cellular location of GFP-tagged BCMP 101
demonstrated high expression in the Golgi and endoplasmic reticulum
as well as significant expression associated with the plasma
membrane in both MDA-MB-468 and T-47D cell lines (FIG. 6).
Particularly high levels of BCMP101 plasma membrane localisation
was observed in areas of cell-cell contact (FIG. 6B)). These data
suggest a role for BCMP 101 in the transduction of a cellular
signal mediated by cell-cell contact.
EXAMPLE 6
BCMP 101 Expression in Breast Cancer Tissues By
Immunohistochemistry
[0227] Immunohistochemical analysis was used to determine the
protein expression of BCMP 101 in sections of breast carcinoma
tissues.
[0228] Immunohistochemical analysis was carried out on frozen
sections of a breast tumour (from Peterborough Tissue Bank, ref. No
6574--Human Research Tissue Bank, Department of Cellular Pathology,
Peterborough District Hospital, Thorpe Road, Peterborough PE3
6DA-http://www.tissuebank.co.uk/).
[0229] Frozen sections were thawed at room temperature for 30 min,
and fixed in acetone at 4 degrees C. for 10 min. The sections were
subsequently washed twice in PBS.
[0230] Endogenous hydrogen peroxidase activity was quenched by
treating the slides in 3% hydrogen peroxidase/PBS for 10 mins,
followed by 2 washes in PBS. The tissue was blocked in 10% donkey
serum/PBS for 1 hour before addition of 2 microg/ml primary
polyclonal antibody (in 2.5% donkey serum).
[0231] The BCMP 101 polyclonal antibody was raised in rabbits
immunised with a specific peptide (Abcam Ltd., Cambridge, UK). The
peptide sequence was chosen for synthesis based on plots of
hydrophobicity, antigenicity, surface probability. The peptide was
synthesised using Fmoc chemistry with a cysteine residue added to
the end to enable specific thiol reactive coupling of Keyhole
Limpet Haemocyanin prior to immunisation. The BCMP 101 peptide used
was: SYKEVPTADPTGVDR (SEQ ID NO: 10, this sequence is shaded in
FIG. 1).
[0232] Western blot analysis of T-47D and MDA-MB-468 cell lysates
was used to confirm that the antibody cross-reacted with a single
band of the predicted size. Following 3 washes in PBS the tissue
sections were incubated with biotin conjugated secondary antibodies
(Biotin-SP-conjugated AffiniPure.TM. Donkey anti-rabbit, Jackson
ImmunoResearch) diluted at 1:200 (2.5 microg/ml in 2.5% donkey
serum/PBS) for 1 hour. Slides were washed 3 times in PBS and the
tissue incubated with Streptavidin-HRP (Jackson ImmunoResearch)
diluted 1:100 (5 microg/ml in 2.5% donkey serum/PBS), followed by
three 5 min washes in PBS. Antibody signal was detected using DAB
substrate solution (Dako Ltd.) according to the manufacturers
instructions.
[0233] Immunohistochemical analysis of BCMP 101 expression
demonstrated very low levels in multiple normal tissues. In
contrast, high levels of BCMP 101 immunoreactivity were detected in
the carcinoma cells of the breast cancer tissue (FIG. 7).
EXAMPLE 7
Yeast Two-Hybrid Study of BCMP 101 Interacting Factors
Construction of Prey Plasmids
[0234] Random-primed cDNA was prepared, ligated into an appropriate
vector using methods known in the art, and transformed into
electrocompetent cells as described in WO 00/66722 and WO
02/12290.
[0235] cDNA was collected from the cells (above) and transformed
into yeast strain YHGX13 (MATalpha Gal4delta Gal80delta
ade2-101::KAN.sup.R, his3, leu2-3, -112, trpl-901, ura3-52
URA3::UASGAL1-LacZ, Met) as described in the above Patent
Applications.
Construction of Bait Plasmids
[0236] Bait fragments were cloned into appropriate vectors using
methods known in the art. Amplification, PCR and screening the
collection with the two-hybrid system in yeast was as described in
WO 00/66722. Where the number of His+ cell clones <285 the
process stamp overlay protocol below is used on all colonies. If
the number of His+ cell clones >285 and <5000: then process
via the overlay and then the stamp overlay protocols on all blue
colonies (see WO 00/66722 sections 2.B and 2.C).
The Stamp Overlay Assay
[0237] His+ colonies were grown overnight at 30.degree. C. in
microtiter plates containing DO-Leu-Trp-His+Tetracyclin medium with
shaking. The day after the overnight culture, the 96 colonies were
stamped on a 15 cm plate of DO-Leu-Trp-His. 4 control yeast
colonies were spotted on the same plate. After 2 days of growing at
30.degree. C., an overlay assay was performed on this plate with 80
ml of overlay mixture (see WO 00/66722 section 2.B.). After 2 hours
of incubation, the plate was photographed with a CCD camera. The
blue intensity was quantified by Genetools.TM. software (SYNGENE)
and normalised to the control spots. Positive clones were
identified and plasmids rescued and transformed into
electrocompetent cells as described in WO 02/12290 and WO
00/66722.
Protein-Protein Interactions
[0238] Identification of prey nucleotide sequences was as described
(WO 02/12290 and WO 00/66722) or alternatively, prey nucleotide
sequences were compared with one another and those which share
identity over a significant region (60 nt) were grouped together
to, form a contiguous sequence (Contig) whose identity was
ascertained in the same manner as for individual prey fragments (WO
02/12290 and WO 00/66722). Selected Interacting Domains were
determined also as described in the latter applications.
Major BCMP 101 Interacting Factors
[0239] BCMP 101 interacts with alpha-1 catenin (Swiss-Prot
accession P35221) and membrane components of clathrin coated
vesicles AP1M2 (GenBank accession NP.sub.--005489) and AP47
(GenBank accession NP.sub.--115882).
[0240] Alpha-1 catenin associates with the cytoplasmic domains of
multiple plasma membrane localised cadherins and as such are
thought to play an important role in cell-cell adhesion.
Interestingly, alpha-1 catenin is mutated in the invasive human
colon cancer cell family HCT-8 and is therefore an invasion
suppressor gene in human colon cancer (Vermeulen, S. J., Nollet,
F., Teugels, E., Vennekens, K. M., Malfait, F., Philippe, J.,
Speleman, F., Bracke, M. E., van Roy, F. M. & Mareel, M. M. The
alphaE-catenin gene (CTNNA1) acts as an invasion-suppressor gene in
human colon cancer cells. Oncogene 18, 905-915 (1999)). Additional
evidence supports an interaction between BCMP101 and alpha-1
catenin in breast cancer cells. Firstly, alpha-1 catenin was
identified in a proteomic analysis of the same breast cancer cell
line (MDA-MB468) as the one described above in Example 1. Secondly,
association of BCMP 101 with alpha-1 catenin accounts for the
plasma membrane localisation of GFP-tagged BCMP 101 seen in breast
cancer cell lines (FIG. 6A), and in particular the observation that
BCMP 101 was plasma membrane associated at sites of cell-cell
contact (FIG. 6B). Thus BCMP 101 is associated with a complex of
membrane proteins with a known role in tumour progression.
[0241] FIG. 6 also shows some cytosolic and Golgi localisation of
GFP tagged BCMP 101. This is consistent with the interaction of
BCMP 101 with AP1M2 and AP47 which are part of the AP-1 adaptor
complex which is recruited from the cytosol onto the trans-Golgi
network membrane, where it co-assembles with clathrin into a coat
that drives vesicle budding involved in trafficking proteins to
other cell membranes including the plasma membrane.
Sequence CWU 1
1
101310PRTHomo sapiens 1Met Gly Asn Gln Val Glu Lys Leu Thr His Leu
Ser Tyr Lys Glu Val1 5 10 15Pro Thr Ala Asp Pro Thr Gly Val Asp Arg
Asp Asp Gly Pro Arg Ile 20 25 30Gly Val Ser Tyr Ile Phe Ser Asn Asp
Asp Glu Asp Val Glu Pro Gln 35 40 45Pro Pro Pro Gln Gly Pro Asp Gly
Gly Gly Leu Pro Asp Gly Gly Asp 50 55 60Gly Pro Pro Pro Pro Gln Pro
Gln Pro Tyr Asp Pro Arg Leu His Glu65 70 75 80Val Glu Cys Ser Val
Phe Tyr Arg Asp Glu Cys Ile Tyr Gln Lys Ser 85 90 95Phe Ala Pro Gly
Ser Ala Ala Leu Ser Thr Tyr Thr Pro Glu Asn Leu 100 105 110Leu Asn
Lys Cys Lys Pro Gly Asp Leu Val Glu Phe Val Ser Gln Ala 115 120
125Gln Tyr Pro His Trp Ala Val Tyr Val Gly Asn Phe Gln Val Val His
130 135 140Leu His Arg Leu Glu Val Ile Asn Ser Phe Leu Thr Asp Ala
Ser Gln145 150 155 160Gly Arg Arg Gly Arg Val Val Asn Asp Leu Tyr
Arg Tyr Lys Pro Leu 165 170 175Ser Ser Ser Ala Val Val Arg Asn Ala
Leu Ala His Val Gly Ala Lys 180 185 190Glu Arg Glu Leu Ser Trp Arg
Asn Ser Glu Ser Phe Ala Ala Trp Cys 195 200 205Arg Tyr Gly Lys Arg
Glu Phe Lys Ile Gly Gly Glu Leu Arg Ile Gly 210 215 220Lys Gln Pro
Tyr Arg Leu Gln Ile Gln Leu Ser Ala Gln Arg Ser His225 230 235
240Thr Leu Glu Phe Gln Ser Leu Glu Asp Leu Ile Met Glu Lys Arg Arg
245 250 255Asn Asp Gln Ile Gly Arg Ala Ala Val Leu Gln Glu Leu Ala
Thr His 260 265 270Leu His Pro Ala Glu Pro Glu Glu Gly Asp Ser Asn
Val Ala Arg Thr 275 280 285Thr Pro Pro Pro Gly Arg Pro Pro Ala Pro
Ser Ser Glu Glu Glu Asp 290 295 300Gly Glu Ala Val Ala His305
31021054DNAHomo sapiens 2tgtgcaaatg accctggagt tggtttcgct
ttctcccctt gcggcggtgt gaacgtgtgt 60ccgcagcgtg atgggcaacc aggtggagaa
attgacccac ctaagttaca aggaagttcc 120cacggccgac ccgactggcg
tggaccggga cgacgggccc cgcattgggg tctcctacat 180tttctccaat
gacgatgagg acgtggagcc gcagccgccg cctcaggggc cagatggcgg
240cggcttgccc gacggtgggg acgggccgcc gccgccccag ccgcagccct
acgatccgcg 300gctgcacgag gtggaatgct ccgtgttcta ccgggacgaa
tgcatctacc agaagagctt 360cgcgccgggc tcggcggcgc tgagtaccta
cacgcccgag aacctgctca acaagtgcaa 420gccgggcgat ctggtggagt
tcgtgtcgca ggctcagtac ccgcactggg ccgtatatgt 480gggtaacttc
caggtggtgc acctgcaccg gctggaggtg attaacagct tcctgactga
540cgccagccag ggccgtcgcg gccgcgtggt caacgatctg taccgctaca
agccgctaag 600ctccagcgcc gtggtgcgca acgcgctggc gcacgtgggt
gccaaggagc gcgagctgag 660ctggcgcaac tcggagagtt tcgccgcctg
gtgccgctac ggcaagcgcg agttcaagat 720cggcggcgag ctgcgcatcg
gcaagcagcc ctaccggctg cagattcagc tgtcggcgca 780gcgcagccac
acgctcgagt tccagagtct agaggacctg atcatggaga agcgacgcaa
840cgaccagatc gggcgcgcgg ccgtgctgca ggagctcgcc acgcacctgc
acccggcgga 900gccggaggag ggcgacagca acgtggcgcg gactacgccg
cctcccgggc gcccccctgc 960gcccagctcc gaggaggagg acggagaggc
agtggcacac tgatgggcga gctgagcgca 1020gagctgcgaa ggggaactgt
ttgcagtagc agcc 1054310PRTHomo sapiens 3Asn Ser Glu Ser Phe Ala Ala
Trp Cys Arg1 5 10422DNAArtificial SequencePrimer 4tgtgcaaatg
accctggagt tg 22522DNAArtificial SequencePrimer 5ggctgctact
gcaaacagtt cc 22622DNAArtificial SequencePrimer 6ggtcaacgat
ctgtaccgct ac 22722DNAArtificial SequencePrimer 7gccgatcttg
aactcgcgct tg 22822DNAArtificial SequencePrimer 8ttcacctctc
cgcgggtagc ct 22922DNAArtificial SequencePrimer 9ggaagttacc
cacatatacg gc 221015PRTHomo sapiens 10Ser Tyr Lys Glu Val Pro Thr
Ala Asp Pro Thr Gly Val Asp Arg1 5 10 15
* * * * *
References