U.S. patent application number 11/984033 was filed with the patent office on 2008-09-18 for removal promoters and inhibitor for apoptosis cells in vivo.
This patent application is currently assigned to JAPAN SCIENCE AND TECHNOLOGY AGENCY. Invention is credited to Shigekazu Nagata.
Application Number | 20080226556 11/984033 |
Document ID | / |
Family ID | 19166165 |
Filed Date | 2008-09-18 |
United States Patent
Application |
20080226556 |
Kind Code |
A1 |
Nagata; Shigekazu |
September 18, 2008 |
Removal promoters and inhibitor for apoptosis cells in vivo
Abstract
The present invention is to provide a removal promoter for
apoptotic cells which is capable of immediately removing apoptotic
cells in vivo by macrophages, or a removal inhibitor which inhibits
the removal of apoptotic cells in vivo by macrophages. A removal
promoter for apoptotic cells in vivo containing the milk fat
globule-EGF factor 8-L (MFG-E8-L), MFG-E8-L mutant having removal
promotion action for apoptotic cells in vivo by macrophages, or
preferably a recombinant human or mouse MFG-E8-L, or a recombinant
human or mouse MFG-E8-L mutant as an active ingredient is prepared.
Such removal promoters specifically bind to apoptotic cells and
promote the phagocytosis of apoptotic cells by macrophages by
recognizing aminophospholipids such as phosphatidylserine exposed
on apoptotic cell surface. On the other hand, a point mutation
(D89E) MFG-E8-L mutant is used as a removal inhibitor.
Inventors: |
Nagata; Shigekazu; (Osaka,
JP) |
Correspondence
Address: |
FOLEY AND LARDNER LLP;SUITE 500
3000 K STREET NW
WASHINGTON
DC
20007
US
|
Assignee: |
JAPAN SCIENCE AND TECHNOLOGY
AGENCY
|
Family ID: |
19166165 |
Appl. No.: |
11/984033 |
Filed: |
November 13, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10496087 |
Nov 9, 2004 |
|
|
|
PCT/JP02/12053 |
Nov 19, 2002 |
|
|
|
11984033 |
|
|
|
|
Current U.S.
Class: |
424/9.1 ;
435/320.1; 514/1.1; 514/2.4; 530/395; 536/23.1 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 35/00 20180101; A61P 43/00 20180101; C07K 14/705 20130101 |
Class at
Publication: |
424/9.1 ;
536/23.1; 514/8; 530/395; 435/320.1 |
International
Class: |
A61K 49/00 20060101
A61K049/00; C07H 21/00 20060101 C07H021/00; A61K 38/14 20060101
A61K038/14; A61P 43/00 20060101 A61P043/00; C12N 15/63 20060101
C12N015/63; C07K 14/00 20060101 C07K014/00 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 20, 2001 |
JP |
2001-354282 |
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. The removal promoter for apoptotic cells in vivo by macrophages
which contains a recombinant vector including DNA encoding the
MFG-E8-L or MFG-E8-L mutant as an active ingredient.
9. The removal promoter for apoptotic cells in vivo by macrophages
which contains a host cell comprising the expression system which
can express the MFG-E8-L or the MFG-E8-L mutant as an active
ingredient.
10. The removal promoter for apoptotic cells in vivo by macrophages
which contains an antibody against MFG-E8-L or a MFG-E8-L mutant
according to as an active ingredient.
11. (canceled)
12. A removal method for apoptotic cells in vivo by macrophages
comprising administering to a patient in need thereof MFG-E8-L or a
MFG-E8-L mutant.
13. (canceled)
14. (canceled)
15. (canceled)
16. A removal inhibitor for apoptotic cells in vivo by macrophages
comprised of amino acid sequence wherein one or more amino acids
are deleted, substituted or added in the amino acid sequence
comprising MFG-E8-L, and which contains a MFG-E8-L mutant having
removal inhibition action for apoptotic cells in vivo by
macrophages as an active ingredient.
17. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 16 wherein the MFG-E8-L mutant
having removal inhibition action for apoptotic cells is a
recombinant MFG-E8-L mutant.
18. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 17 wherein the recombinant MFG-E8-L
mutant is a recombinant human MFG-E8-L mutant or a recombinant
mouse MFG-E8-L mutant.
19. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 17 wherein the recombinant MFG-E8-L
mutant is a translation product in human cells.
20. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 17 wherein the recombinant MFG-E8-L
mutant is a MFG-E8-L mutant which contains a proline/threonine-rich
domain and two factor VIII-homologous domains (C1 and C2), and
which has a point mutation in RGD motif.
21. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 20 wherein the MFG-E8-L mutant which
has a point mutation is D89E mutant.
22. The removal inhibitor for apoptotic cells in vivo by
macrophages according to claim 16 wherein the MFG-E8-L mutant is
enveloped or embedded in liposome.
23. The removal inhibitor for apoptotic cells in vivo by
macrophages which contains a recombinant vector including DNA
encoding the MFG-E8-L mutant according to claim 16 as an active
ingredient.
24. The removal inhibitor for apoptotic cells in vivo by
macrophages which contains a host cell comprising an expression
system which can express the MFG-E8-L mutant according to claim 16
as an active ingredient.
25. A removal inhibition method for apoptotic cells in vivo by
macrophages wherein the removal inhibitor for apoptotic cells in
vivo according to claim 16 is used.
26. A therapeutic agent for diseases resulting from the incomplete
removal inhibition of apoptotic cells in vivo by macrophages which
contains the removal inhibitor for apoptotic cells in vivo
according to claim 16.
27. A therapeutic method for diseases resulting from the incomplete
removal inhibition of apoptotic cells in vivo by macrophages
wherein the therapeutic agent according to claim 26 is used.
28. A detection agent for apoptotic cells in vivo which contains a
labeled MFG-E8-L or MFG-E8-L mutant having removal promotion action
for apoptotic cells in vivo by macrophages, or an antibody against
them, or a labeled MFG-E8-L mutant having removal inhibition action
for apoptotic cells in vivo by macrophages as an active
ingredient.
29. A detection method for apoptotic cells in vivo wherein a
detection agent for apoptotic cells in vivo which contains a
labeled MFG-E8-L or MFG-E8-L mutant having removal promotion action
for apoptotic cells in vivo by macrophages, or an antibody against
them, or a labeled MFG-E8-L mutant having removal inhibition action
for apoptotic cells in vivo by macrophages as an active ingredient
is used.
30. A screening method for a removal promotion inducing substance
or a removal promotion suppressive substance for apoptotic cells in
vivo by macrophages wherein MFG-E8-L or a MFG-E8-L mutant having
removal promotion action for apoptotic cells in vivo by
macrophages, or an antibody against them is contacted with a test
substance, to evaluate the extent of removal of apoptotic cells in
vivo.
31. A screening method for a removal inhibition inducing substance
or a removal inhibition suppressive substance for apoptotic cells
in vivo by macrophages wherein a MFG-E8-L mutant which has removal
inhibition action for apoptotic cells in vivo by macrophages is
contacted with a test substance, to evaluate the extent of removal
inhibition of apoptotic cells in vivo.
Description
TECHNICAL FIELD
[0001] The present invention relates to compounds that promote or
inhibit the engulfment of cells undergoing apoptosis (hereinafter
referred to as `apoptotic cells`) by macrophages in vivo.
BACKGROUND ART
[0002] Cell death programmed that the cell itself is to positively
bring about death under the physiological condition, namely
apoptosis, is known to be a mechanism equipped to a living body in
order to remove aging cells in immune system and unfavorable cells
for the living body such as morbid cells. Such apoptosis is
characterized in rapid contraction in cell size and change in a
cell nucleus, apoptotic cells usually become apoptotic bodies and
are to be finally engulfed by phagocytes such as macrophages and
the like. For instance, it is well known that cells first contract
and detach from adjacent cells, a chromatin which is a complex of
DNA of nucleus and protein is compressed around a nuclear membrane
to cause concentration of nucleus, and microvillus on the cell
surface is vanished and smoothed at the same time, a protuberances
of various sizes appear and they will gradually be constricted and
torn apart, then fractionated into globular apoptotic bodies of
various sizes enveloped in membrane, and such bodies are engulfed
and eliminated by macrophages or adjacent phagocytes.
[0003] In the meantime, synthetic materials such as aminopterin,
methotrexate, 8-azaguanine, 6-mercaptopurine, 5-fluorouracil,
1-(2-tetrahydrofuryl)-5-fluorouracil, etc., and antibiotics such as
mitomycin C, chromomycin, bleomycin, etc., interferon, CSF
inhibitor, CBF, etc., are known to be used to inhibit the
proliferation of morbid cells such as cancer cells and malignant
tumor cells and to treat diseases resulting from these cells. All
of them act to a certain cell and cause necrosis to remove morbid
cells. Unlike necrosis, which occurs by pathological factor,
apoptosis is known to occur not only by pathological factor but
also by various physiological factors.
[0004] It is reported that apoptosis is accompanied by sequence
change of the cell membrane phospholipids which comprise a cell in
the early stage, and results in the exposure to the cell surface of
phosphatidylserine which is a negatively-charged phospholipid
(Immunol. Today, 14:131-136, 1993; Cirk. Res., 77:1136-1142, 1995).
It is considered that these changes on the cell surface are
recognized bymacrophages and adjacent cells, and phagocytic stages
proceed. It is considered that the exposure of phosphatidylserine
to the cell surface of apoptotic cells plays an important role in
phagocytic mechanism since the above-mentioned phagocytic stages
are inhibited by annexin V which selectively binds to
phosphatidylserine (Biochem. Biophys. Res. Commun., 205:1488-1493,
1994; Proc. Natl. Acad. Sci. USA, 93:1624-1629, 1996). Besides,
detection of early stage of apoptosis is conducted by flowcytometry
using labeled body of annexin V.
[0005] On the otherhand, MFG-E8: milkfat globule-EGF factor 8 is
cloned as a secretory protein derived from mammary epithelia
abundantly contained in breast milk (Biochem. Biophys. Res. Commun.
254 (3), 522-528, 1999), which is known as a secretory glycoprotein
strongly expressing in many other normal tissues or several tumor
cells afterwards. MFG-E8 is comprised of two EGF (epidermal growth
factor) domains from N termini side and a domain which has homology
with C1 and C2 domains of a blood coagulation factor V and VIII.
Homology of MFG-E8 is reported in several mammals including humans
(BA46, lactadherin), mice (MFG-E8), rats (rAGS), pigs (P47), cows
(PAS-6, PAS-7), and endothelial cell-specific cell adhesion
molecule DELL which has similarity in domain structure with MFG-E8
has been cloned, further, MFG-E8 and DEL1 contain RGD sequence
which binds to integrin in their second EGF domain. Besides, C1 and
C2 domains of C termini side are known to bind to phospholipids on
cell membrane. However, many points regarding the relation with
enzymatic activity and its physiological function of MFG-E8 are
still unknown. In order to clear these points, genomic gene of
mouse milk fat globule-EGF factor 8 MFG-E8 and chromosome mapping,
kinetics of gene expression in development stage, intracellular
localization and the like have been considered, and it is
recognized that reproductive rudiment is a main expression part at
the early development stage of MFG-E8, and there is a strong
expression characteristic to neuron or cartilage rudiment at a
later development stage. Further, attempts have been made to
generate MFG-E8 gene deficient mouse in order to investigate the
function of MFG-E8 in vivo.
[0006] Apoptosis plays an important role in maintaining the
homeostasis of living body. It is necessary to remove apoptotic
cells immediately by macrophages in order to protect normal cells
from noxious substance secreted by the cells undergoing apoptosis
(apoptotic cells). For instance, cancer can be treated by
positively inducing apoptosis in cancer cells. Even in such case,
however, it is necessary to remove apoptotic cells immediately. The
object of the present invention is to provide a removal promoter
for apoptotic cells which can immediately remove apoptotic cells in
vivo by macrophages, and a removal inhibitor which inhibits the
removal of apoptotic cells in vivo by macrophages.
[0007] As a result of keen study in order to solve the
above-mentioned issues, the present inventors found that milk fat
globule-EGF factor 8 (MFG-E8-L) binds specifically to apoptotic
cells by recognizing aminophospholipid such as phosphatidylserine
(PS) and the like which are exposed on the cell surface once the
cells started to move toward apoptosis, and MFG-E8-L promote the
phagocytosis of apoptotic cells by macrophages, and that D89E
mutant which is a point mutant derivative of MFG-E8-L inhibits the
phagocytosis of apoptotic cells by macrophages. Thus, the present
invention has been completed.
DISCLOSURE OF THE INVENTION
[0008] The present invention relates to: a removal promoter for
apoptotic cells in vivo by macrophages which contains MFG-E8-L as
an active ingredient ("1"); a removal promoter for apoptotic cells
in vivo by macrophages which is comprised of amino acid sequence
wherein one or more amino acids are deleted, substituted or added
in the amino acid sequence comprising MFG-E8-L, and which contains
MFG-E8-L mutant having removal promotion action for apoptotic cells
in vivo by macrophages as an active ingredient ("2"); the removal
promoter for apoptotic cells in vivo bymacrophages according to "1"
or "2" wherein the MFG-E8-L or the MFG-E8-L mutant which has
removal action for apoptotic cells is a recombinant MFG-E8-L or a
recombinant MFG-E8-L mutant ("3"); the removal promoter for
apoptotic cells in vivo bymacrophages according to "3" wherein the
recombinant MFG-E8-L or the recombinant MFG-E8-L mutant is a
recombinant human or mouse MFG-E8-L, or a recombinant human or
mouse MFG-E8-L mutant ("4"); the removal promoter for apoptotic
cells in vivo by macrophages according to "3" or "4" wherein the
recombinant MFG-E8-L or the recombinant MFG-E8-L mutant is a
translation product in human cells ("5"); the removal promoter for
apoptotic cells in vivo by macrophages according to any one of "3"
to "5" wherein the recombinant MFG-E8-L or the recombinant MFG-E8-L
mutant contains an EGF-2 domain having RGD motif, a
proline/threonine-rich domain, and two factor VIII-homologous
domains (C1 and C2) ("6").
[0009] The present invention further relates to: the removal
promoter for apoptotic cells in vivo bymacrophages according to any
one of "1" to "6" wherein the MFG-E8-L or the MFG-E8-L mutant is
enveloped or embedded in liposome ("7"); the removal promoter for
apoptotic cells in vivo by macrophages which contains a recombinant
vector including DNA encoding the MFG-E8-L or the MFG-E8-L mutant
according to any one of "1" to "6" as an active ingredient ("8");
the removal promoter for apoptotic cells in vivo by macrophages
which contains a host cell comprising the expression system which
can express the MFG-E8-L or the MFG-E8-L mutant according to any
one of "1" to "6" as an active ingredient ("9"); the removal
promoter for apoptotic cells in vivo by macrophages which contains
an antibody against the MFG-E8-L mutant according to any one of "1"
to "6" as an active ingredient ("10"); the removal promoter for
apoptotic cells in vivo by macrophages according to "10" wherein
the antibody against the MFG-E8-L mutant according to any one of
"1" to "6" is an anti-MFG-E8-L monoclonal antibody or an
anti-MFG-E8-L mutant monoclonal antibody ("11").
[0010] The present invention still further relates to: a removal
method for apoptotic cells in vivo by macrophages wherein the
removal promoter for apoptotic cells in vivo according to any one
of "1" to "11" is used ("12"); a therapeutic agent for diseases
resulting from incomplete removal of apoptotic cells in vivo by
macrophages which contains the removal promoter for apoptotic cells
in vivo by macrophages according to any one of "1" to "11" ("13");
an enhancer for biodefense mechanism which contains the removal
promoter for apoptotic cells in vivo according to any one of "1" to
"11" ("14"); a therapeutic method for diseases resulting from
incomplete removal of apoptotic cells in vivo by macrophages
wherein the therapeutic agent according to "13" or the enhancer for
biodefense mechanism according to "14" is used ("15").
[0011] The present invention also relates to: a removal inhibitor
for apoptotic cells in vivo by macrophages comprised of amino acid
sequence wherein one or more amino acids are deleted, substituted
or added in the amino acid sequence comprising MFG-E8-L, and which
contains a MFG-E8-L mutant having removal inhibition action for
apoptotic cells in vivo by macrophages as an active ingredient
("16"); the removal inhibitor for apoptotic cells in vivo by
macrophages according to "16" wherein the MFG-E8-L mutant having
removal inhibition action for apoptotic cells is a recombinant
MFG-E8-L mutant ("17"); the removal inhibitor for apoptotic cells
in vivo by macrophages according to "17" wherein the recombinant
MFG-E8-L mutant is a recombinant human MFG-E8-L mutant or a
recombinant mouse MFG-E8-L mutant ("18"); the removal inhibitor for
apoptotic cells in vivo by macrophages according to "17" or "18"
wherein the recombinant MFG-E8-L mutant is a translation product in
human cells ("19"); the removal inhibitor for apoptotic cells in
vivo by macrophages according to any one of "17" to "19" wherein
the recombinant MFG-E8-L mutant is a MFG-E8-L mutant which contains
a proline/threonine-rich domain and two factor VIII-homologous
domains (C1 and C2), and which has a point mutation in RGD motif
("20"); the removal inhibitor for apoptotic cells in vivo by
macrophages according to "20" wherein the MFG-E8-L mutant which has
a point mutation is D89E mutant ("21").
[0012] The present invention further relates to: the removal
inhibitor for apoptotic cells in vivo by macrophages according to
any one of "16" to "21" wherein the MFG-E8-L mutant is enveloped or
embedded in liposome ("22"); the removal inhibitor for apoptotic
cells in vivo by macrophages which contains a recombinant vector
including DNA encoding the MFG-E8-L mutant according to any one of
"16" to "21" as an active ingredient ("23"); the removal inhibitor
for apoptotic cells in vivo by macrophages which contains a host
cell comprising an expression system which can express the MFG-E8-L
mutant according to any one of "16" to "21" as an active ingredient
("24"); a removal inhibition method for apoptotic cells in vivo by
macrophages wherein the removal inhibitor for apoptotic cells in
vivo according to any one of "16" to "24" is used ("25"); a
therapeutic agent for diseases resulting from the incomplete
removal inhibition of apoptotic cells in vivo by macrophages which
contains the removal inhibitor for apoptotic cells in vivo
according to any one of "16" to "24" ("26"); a therapeutic method
for diseases resulting from the incomplete removal inhibition of
apoptotic cells in vivo by macrophages wherein the therapeutic
agent according to "26" is used ("27"); a detection agent for
apoptotic cells in vivo which contains a labeled MFG-E8-L or
MFG-E8-L mutant having removal promotion action for apoptotic cells
in vivo by macrophages, or an antibody against them, or a labeled
MFG-E8-L mutant having removal inhibition action for apoptotic
cells in vivo by macrophages as an active ingredient ("28"); a
detection method for apoptotic cells in vivo wherein a detection
agent for apoptotic cells in vivo which contains a labeled MFG-E8-L
or MFG-E8-L mutant having removal promotion action for apoptotic
cells in vivo by macrophages, or an antibody against them, or a
labeled MFG-E8-L mutant having removal inhibition action for
apoptotic cells in vivo by macrophages as an active ingredient is
used ("29" ); a screening method for a removal promotion inducing
substance or a removal promotion suppressive substance for
apoptotic cells in vivo by macrophages wherein MFG-E8-L or a
MFG-E8-L mutant having removal promotion action for apoptotic cells
in vivo by macrophages, or an antibody against them is contacted
with a test substance, to evaluate the extent of removal of
apoptotic cells in vivo ("30"); a screening method for a removal
inhibition inducing substance or a removal inhibition suppressive
substance for apoptotic cells in vivo by macrophages wherein a
MFG-E8-L mutant which has removal inhibition action for apoptotic
cells in vivo by macrophages is contacted with a test substance, to
evaluate the extent of removal inhibition of apoptotic cells in
vivo ("31").
BRIEF DESCRIPTION OF DRAWINGS
[0013] FIG. 1 is a photograph showing the experimental results
regarding the establishment of a monoclonal antibody which
increases the phagocytosis for apoptotic cells.
[0014] FIG. 2 is a photograph showing the experimental results
regarding the identification and the expression of MFG-E8.
[0015] FIG. 3 is a drawing showing the experimental results
regarding the binding of MFG-E8 to aminophospholipids exposed on
the apoptotic cells.
[0016] FIG. 4 is a drawing showing the experimental results
regarding the binding of NIH3T3 cell to aminophospholipids via
MFG-E8.
[0017] FIG. 5 is a photograph showing the experimental results
regarding incorporation of apoptotic cells by MFG-E8-L.
BEST MODE OF CARRYING OUT THE INVENTION
[0018] As for a removal promoter for apoptotic cells in vivo by
macrophages of the present invention, there is no particular
limitation as long as it is comprised of milk fat globule-EGF
factor 8-L (MFG-E8-L), or the amino acid sequence wherein one or
more amino acids are deleted, substituted or added in the amino
acid sequence comprising MFG-E8-L, and it contains MFG-E8-L mutant
which has removal promotion action for apoptotic cells in vivo by
macrophages as an active ingredient. The MFG-E8-L means herein a
long chain MFG-E8 (a long form of MFG-E8), and for instance, mouse
MFG-E8-L can be exemplified by MFG-E8-L comprised of 463 amino acid
residues as shown in SEQ ID NO. 1 of the sequence list, and mouse
MFG-E8-L mutant can be further exemplified by MFG-E8-L mutant which
is comprised of the amino acid sequence wherein one or more amino
acids are deleted, substituted or added in the amino acid sequence
shown by SEQ ID NO. 1, and which has removal promotion action for
apoptotic cells in vivo by macrophages. The origin of the
above-mentioned MFG-E8-L or MFG-E8-L mutant is not limited to mice,
the MFG-E8-L or MFG-E8-L mutant derived from humans (also known as;
BA46, lactadherin), rats (also known as; rAGS), pigs (also known
as; P47), cows (also known as; PAS-6, PAS-7) and the like can also
be used. However, human MFG-E8-L can be advantageously used for
removal promotion of apoptotic cells in human living body by
macrophages.
[0019] Further, as for the MFG-E8-L or MFG-E8-L mutant which has
removal promotion action for apoptotic cells by macrophages,
recombinant MFG-E8-L or recombinant MFG-E8-L mutant, or preferably,
recombinant human MFG-E8-L or recombinant mouse MFG-E8-L, or
recombinant human MFG-E8-L mutant or recombinant mouse MFG-E8-L
mutant can be advantageously used. Such recombinant MFG-E8-L or
recombinant MFG-E8-L mutant can be prepared by known method,
however, it is preferable to be a product of genetic translation in
human cells wherein a human cell is used as a host cell. The
structure of MFG-E8-L includes a signal sequence, two EGF domains
(EGF-1 and EGF-2 having RGD motif), a proline/threonine-rich domain
(P/T-rich domain), and two factor VIII-homologous domains (C1 and
C2), however, the one that has a EGF-2 domain having RGD motif, a
proline/threonine-rich domain, and two factor VIII-homologous
domains (C1 and C2) as recombinant MFG-E8-L or MFG-E8-L mutant
which has removal promotion action for apoptotic cells by
macrophages is preferable.
[0020] The removal promoter for apoptotic cells in vivo by
macrophages of the present invention can be exemplified by a
removal promoter for apoptotic cells in vivo wherein the
above-mentioned MFG-E8-L or MFG-E8L mutant which has removal
promotion action for apoptotic cells by macrophages is enveloped or
embedded in liposome. The lipids constituting the liposome membrane
can be eligibly exemplified by cat ionic liposome membrane such as
dimethyl dioctadecyl ammonium bromide (DDAB), dioleoyl
phosphatidylethanolamine (DOPE) and the like. It is also possible
to make a monoclonal antibody, which selectively reacts to
apoptotic cells such as anti-MFG-E8-L monoclonal antibody to be
described hereinafter, bind to liposome membrane including the
above-mentioned MFG-E8-L or MFG-E8-L mutant, and to use it as an
immunoliposome.
[0021] The removal promoter for apoptotic cells in vivo by
macrophages of the present invention can be further exemplified by
a removal promoter for apoptotic cells in vivo which contains
recombinant vector including the DNA encoding the above-mentioned
MFG-E8-L or MFG-E8L mutant which has removal promotion action for
apoptotic cells by macrophages as an active ingredient. As for the
above-mentioned recombinant vector, there is no particular
limitation as long as it is a vector including DNA encoding
MFG-E8-L, for example, mouse MFG-E8 gene comprised of the base
sequence shown by SEQ ID NO. 2, or DNA encoding MFG-E8-L mutant,
however, the one including an expression system which is capable of
expressing MFG-E8-L or MFG-E8-L mutant in a host cell is
preferable; their examples include chromosome-, episome-, and
virus-derived expression systems, or more particularly, vectors
derived from bacterial plasmid, vectors derived from yeast plasmid,
vectors derived from papovavirus such as SV40, vaccinia virus,
adenovirus, chickenpox virus, pseudorabies virus, retrovirus,
vectors derived from bacteriophage or transposon and vectors
derived from the combination of these, e.g. vectors derived from
genetic factors of plasmid and bacteriophage, such as cosmid and
phagemid. The expression systems may contain control sequences that
regulate as well as engender expression.
[0022] The removal promoter for apoptotic cells in vivo by
macrophages of the present invention can be also exemplified by a
removal promoter for apoptotic cells in vivo which contains a host
cell comprising the expression system which is capable of
expressing the above-mentioned MFG-E8-L or MFG-E8-L mutant which
has removal promotion action for apoptotic cells by macrophages as
an active ingredient. The DNA encoding MFG-E8-L or MFG-E8-L mutant,
or a vector including such DNA can be introduced into a host cell
by the methods described in many standard laboratory manuals such
as manuals of Davis et al. (BASIC METHODS IN MOLECULAR BIOLOGY,
1986) and of Sambrook et al. (MOLECULAR CLONING: A LABORATORY
MANUAL, 2.sup.nd Ed., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y., 1989), and the examples include
calcium-phosphate transfection, DEAE-dextran-mediated transfection,
transvection, microinjection, cationic lipid-mediated transfection,
electroporation, transduction, scrape loading, ballistic
introduction, infection, etc. The examples of host cells include
bacterial prokaryotic cells such as E. coli, Streptmyces, Bacillus
Subtilis, Streptcoccus, Staphylococcus, etc., eukaryotic cells such
as yeast, aspergillus, etc., insect cells such as Drosophila S2,
Spodoptera Sf9, etc., animal cells such as L cell, CHO cell, COS
cell, HeLa cell, C127 cell, BALB/c3T3 cell (including mutants
deficient in dihydrofolate reductase, tymidine kinase, etc.), BHK21
cell, HEK293 cell, Bowes malignant melanoma cell, etc. and plant
cells or the like. However, human cells are preferable.
[0023] Further, the removal promoter for apoptotic cells in vivo by
macrophages of the present invention can be exemplified by
antibodies against MFG-E8-L or MFG-E8-L mutant which has removal
promotion action for apoptotic cells in vivo by macrophages. Such
antibodies can be particularly exemplified by immune-specific
antibodies such as monoclonal antibodies, polyclonal antibodies,
chimeric antibodies, single-stranded antibodies, humanized
antibodies, etc. These antibodies can be generated by administering
to an animal (preferably non-human) using the above-mentioned
MFG-E8-L or MFG-E8-L mutant, or a part of them, or
thioglycollate-elicited peritoneal macrophages as described in the
examples, as an antigen, according to the conventional protocols.
Among them, anti-MFG-E8-L monoclonal antibody or anti-MFG-E8-L
mutant monoclonal antibody is preferable in view of its
distinguished removal promotion action for apoptotic cells by
macrophages. The monoclonal antibodies can be prepared, for
instance, by any optional method such as a hybridoma method that
brings antibodies produced by cultured materials of continuous cell
line (Nature 256, 495-497, 1975), a trioma method, a human B-cell
hybridoma method (Immunology Today 4, 72, 1983), an EBV-hybridoma
method (MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan
R. Liss, Inc., 1985), etc. Further, the preparation method for a
single-chain antibody (U.S. Pat. No. 4,946,778) can be adopted to
prepare a single-stranded antibody. Besides, transgenic mice, other
mammals, etc., can be used for expressing humanized antibodies.
[0024] As for the removal method for apoptotic cells in vivo of the
present invention, there is no particular limitation as long as it
is a method wherein the above-mentioned removal promoter for
apoptotic cells in vivo by macrophages is used. Besides, as for the
therapeutic agent for diseases resulting from incomplete removal of
apoptotic cells in vivo by macrophages or an enhancer for
biodefense mechanism, there is no particular limitation as long as
it contains the above-mentioned removal promoter for apoptotic
cells in vivo by macrophages. Such diseases resulting from
incomplete removal of apoptotic cells in vivo by macrophages can be
exemplified by the diseases resulting from reduced apoptotic cells,
such as various types of cancer, various types of autoimmune
diseases, various types of viral diseases and the like. When the
above-mentioned removal promoter for apoptotic cells in vivo is
used as a therapeutic agent or an enhancer for biodefense
mechanism, it is also possible to add various compound ingredients
for dispensing such as ordinary carriers, binding agents,
stabilizing agents, excipients, diluents, pH buffer, disintegrants,
solubilizers, solubilizing agents, isotonic agents and the like,
which are pharmaceutically accepted. Such therapeutic agent or
enhancer for biodefense mechanism can be administered orally or
parenterally. It is possible to administer parenterally in ordinary
administration form, for instance, to inject the formulation such
as solution, emulsion, suspending agent, etc. Or it is also
possible to administer orally in the formulation of powder,
granules, capsules, syrup, suspending agent, etc. For the case of
oral administration, it is preferable to make the removal promoter
for apoptotic cells in vivo a liposome-enveloped/embedded type as
mentioned above. Further, as for the therapeutic method for
diseases resulting from incomplete removal of apoptotic cells in
vivo by macrophages of the present invention, there is no
particular limitation as long as it is a therapeutic method wherein
the above-mentioned therapeutic agent or enhancer for biodefense
mechanism is used.
[0025] As for the removal inhibitor for apoptotic cells in vivo by
macrophages of the present invention, there is no limitation as
long as it is comprised of the amino acid sequence wherein one or
more amino acids are deleted, substituted, or added in the amino
acid sequence comprising MFG-E8-L, and which contains MFG-E8-L
mutant which has removal inhibition action for apoptotic cells in
vivo by macrophages as an active ingredient. However, as for the
MFG-E8-L mutant which has removal inhibition action for apoptotic
cells, recombinant MFG-E8-L mutant, preferably recombinant human
MFG-E8-L mutant or recombinant mouse MFG-E8-L mutant can be
advantageously used. Such recombinant MFG-E8-L mutant can be
prepared according to a known method, however, it is preferable to
be a product of genetic translation in human cells wherein human
cells are used as host cells. As mentioned above, the structure of
MFG-E8-L includes a signal sequence, two EGF domains (EGF-1, and
EGF-2having RGD motif), aproline/threonine-rich domain (P/T-rich
domain), and two factor VIII-homologous domains (C1 and C2),
however, MFG-E8-L mutant which has removal inhibition action for
apoptotic cells can be eligibly exemplified by MFG-E8-L mutant
which has a proline/threonine-rich domain, and two factor
VIII-homologous domains (C1 and C2), and has a point mutation in
RGD motif, for instance, D89 mutant wherein the 89.sup.th amino
acid D (aspartic acid) of mouse MFG-E8-L is substituted by E
(glutamic acid).
[0026] As for the removal inhibitor for apoptotic cells in vivo of
the present invention, it can be exemplified, as in the case of the
above-mentioned removal promoter for apoptotic cells in vivo, by
the above-mentioned removal inhibitor for apoptotic cells in vivo
wherein MFG-E8-L mutant is enveloped or embedded in liposome, the
above-mentioned removal inhibitor for apoptotic cells in vivo
containing recombinant vector including the DNA encoding MFG-E8-L
mutant as an active ingredient, or the above-mentioned removal
inhibitor for apoptotic cells in vivo containing the host cell
including the expression system which is capable of expressing
MFG-E8-L mutant.
[0027] As for the removal inhibition method for apoptotic cells in
vivo of the present invention, there is no particular limitation as
long as it is a method wherein the above-mentioned removal
inhibitor for apoptotic cells in vivo by macrophages of the present
invention is used. There is no limitation either for the
therapeutic agent or therapeutic method for diseases resulting from
incomplete removal of apoptotic cells in vivo by macrophages of the
present invention, as long as the removal inhibitor for apoptotic
cells in vivo by macrophages is used therein.
[0028] As for the detection agent for apoptotic cells in vivo of
the present invention, there is no limitation as long as it
contains the above-mentioned MFG-E8-L or MFG-E8-L mutant which has
removal promotion action for apoptotic cells in vivo by
macrophages, or an antibody against them, or a labeled body of
MFG-E8-L mutant which has removal promotion action for apoptotic
cells in vivo by macrophages, namely, labeled MFG-E8-L, a labeled
MFG-E8-L mutant having the in vivo apoptotic cell removal promotion
action, an labeled anti-MFG-E8-L antibody, a labeled anti-MFG-E8-L
mutant antibody having the in vivo apoptotic cell removal promotion
action, a labeled MFG-E8-L mutant having the in vivo apoptotic
cells removal inhibition action, as an active ingredient. The
above-mentioned labeling body can be particularly exemplified by
the above-mentioned MFG-E8-L, MFG-E8-L mutant or the like which are
labeled with, for instance, fluorescent materials such as FITC
(Fluorescein isocyanate) or tetramethylrhodamine isocyanate, etc.,
radio isotopes such as .sup.125I, .sup.32P, .sup.14C, .sup.35S or
.sup.3H, etc., or enzymes such as alkaline phosphatase, peroxidase,
.beta.-galactosidase or phycoerythrin etc., or which are bound to
known peptide tags such as Myc tag, His tag, FLAG tag, GST tag and
the like, or fusion proteins wherein a fluorescent protein and the
like such as Green Fluorescent Protein (GFP) are fused to the
MFG-E8-L, MFG-E8-L mutant or the like. Such labeling bodies can be
prepared according to conventional method, and it is possible to
detect a cell or tissue developing apoptosis in vivo by using such
labeling bodies. Further, the above-mentioned labeled body is also
useful for purification of MFG-E8-L and the like wherein the
affinity of Ni-NTA and His tag is used, detection of a protein
which interacts with MFG-E8-L, or as a laboratory reagent for the
field of interest in addition to be detection agent for apoptotic
cells/tissues.
[0029] As for the screening method for a removal promotion inducing
substance or removal promotion suppressive substance for apoptotic
cells in vivo by macrophages of the present invention, there is no
particular limitation as long as it is a screening method wherein
MFG-E8-L or MFG-E8-L mutant which has removal promotion action for
apoptotic cells in vivo by macrophages, or an antibody against them
is contacted with a test substance to evaluate the extent of
removal of apoptotic cells in vivo. As for the screening method for
a removal inhibition inducing substance or a removal inhibition
suppressive substance for apoptotic cells in vivo by macrophages of
the present invention, there is no particular limitation either as
long as it is a screening method wherein MFG-E8-L mutant which has
removal inhibition action for apoptotic cells in vivo bymacrophages
is contacted with a test substance to evaluate the extent of
removal inhibition action for apoptotic cells in vivo, and the
cells expressing the above-mentioned MFG-E8-L or MFG-E8-L mutant
can be used as the MFG-E8-L or MFG-E8-L mutant and the like.
[0030] As for the above-mentioned method to evaluate the extent of
removal or removal inhibition of apoptotic cells, for instance, it
can be particularly exemplified by the method wherein phagocytosis
of apoptotic cells by macrophages is measured and observed in vivo
or in vitro in the presence of a test substance and MFG-E8-L and
the like, and compared and evaluated with the case of a control in
the absence of a test substance. The removal promotion inducing
substance or removal inhibition suppressive substance for apoptotic
cells in vivo which can be obtained by such screening method, can
be possibly used as a therapeutic agent for diseases resulting from
incomplete removal of apoptotic cells in vivo by macrophages or
enhancer for biodefense mechanism. On the other hand, removal
promotion suppressive substance or removal inhibition inducing
substance can be possibly used as a therapeutic agent for diseases
resulting from incomplete removal inhibition of apoptotic cells in
vivo by macrophages. The removal promotion inducing substance for
apoptotic cells in vivo can be exemplified by the expression system
of DNA encoding integrin .alpha..sub.v.beta..sub.3 or thioglycolic
acid salt, and the removal promotion suppressive substance for
apoptotic cells in vivo can be exemplified by the expression system
which contains whole or a part of antisense strand of DNA or RNA
encoding MFG-E8-L.
[0031] The present invention will be described in detail with
reference to the following examples, while the technical scope of
the present invention will not be limited to these examples.
EXAMPLE A [Material and Method]
Example A-1 (Establishment of Integrin
.alpha..sub.v.beta..sub.3-Expressing Mouse NIH3T3 Transformant)
[0032] Retrovirus carrying mouse integrin .alpha..sub.v and
.beta..sub.3cDNA (J. Cell Biol. 132, 1161-1176, 1996; J. Cell
Biochem. 81, 320-332, 2001) in pMX vector (Exp. Hematol. 24,
324-329, 1996) is infected with NIH3T3 cell line (ATCC CRL1658),
which is a mouse fibroblast, to establish mouse NIH3T3
transformants expressing integrin .alpha..sub.v and
.beta..sub.3.
Example A-2 (Preparation of Antibody)
[0033] In order to generate a monoclonal antibody,
1.5.times.10.sup.7 of thioglycollate-elicited peritoneal
macrophages were subcutaneously injected into Armenian hamsters
(Oriental Yeast) with 4-week intervals. The last booster was
performed by injecting cells into the footpads. Cells obtained from
popliteal and inguinal lymph nodes were fused with P3X63Ag8U1 mouse
myeloma (ATCC CRL1597) according to ordinary protocol, and
hybridomas were selected in HAT medium. The culture supernatants of
hybridomas were tested by a phagocytosis assay, and positive
hybridomas were cultured in GIT medium (Nihon Seiyaku), and
purified with protein A-sepharose (Amersham-Pharmacia) to obtain
2422 monoclonal antibodies.
[0034] Rabbit antibody against mouse MFG-E8 was prepared at the
Peptide Institute (Minoo-shi, Osaka). In brief,
m-maleimidobenzoyl-N-hydroxysuccinimide ester (Pierce) was used
with a peptide bound to keyhole limpet hemocyanin
(CNSHKKNIFEKPFMAR; SEQ ID NO. 3) to immunize rabbits.
AF-amino-Toyopearl (Tosoh) to which the peptide is bound was used
to affinity-purify the antibody from the rabbit serum.
Example A-3 (Generation of Recombinant MFG-E8)
[0035] Mouse MFG-E8 gene shown by SEQ ID NO. 2 was used to generate
recombinant MFG-E8. MFG-E8 wherein FLAG which is a marker peptide
is bound to its C-terminus was expressed in human 293T cells (ATCC
CRL1573) using pEF-BOS-EX vector (Proc. Natl. Acad. Sci. USA 95,
3461-3466, 1998) according to ordinary protocol. MEG-E8 secreted
into the medium was purified using anti-FLAG M2 affinity gel
(Sigma). The MFG-E8-L structure includes a signal sequence, two EGF
domains (EGF-1 and EGF-2 having RGD motif), a
proline/threonine-rich domain (P/T-rich domain), and two factor
VIII-homologous domains (C1 and C2) (FIG. 3 upper panel).
Therefore, the DNA encoding the following MFG-E8-L mutant was
generated by means of recombinant PCR according to the ordinary
protocol, and expression plasmids were generated using the
above-mentioned PEF-BOS-EX vector. By expressing these expression
vectors in human 293T cells to generate the followings: "MFG-E8-S"
which is a splice variant wherein P/T-rich domain is deleted; "C2
mutant" in which signal sequence is fused with C2-domain in frame;
"C1C2 mutant" in which signal sequence is fused with C1-C2 domain
in frame; "E1E2PT" which is an incomplete form whereon C1 and C2
domains are deleted; "D89E mutant" wherein the aspartic acid on the
89.sup.th position of RGD motif is substituted by glutamic
acid.
Example A-4 (Phagocytosis Assay)
[0036] Twelve-week-old C57BL/6 mice were injected
intra-peritoneally with 3% (w/v) thioglycollate (Sigma). The
thioglycollate-elicited peritoneal macrophages were harvested after
4 days and cultured in DMEM containing 10% FCS. For the
phagocytosis assay, thymocytes from 4-8-week-old ICAD-Sdm mice
(Genes Dev. 14, 549-558, 2000) were incubated at 37.degree. C. for
4 hours with 10 .mu.M dexamethasone in DMEM containing 10% FCS.
Thymocytes (1.times.10.sup.6 cells) were added to
2.5.times.10.sup.5 macrophages grown on 48-well cell culture
plates, phagocytosis was allowed to proceed for 1.5 hours.
Macrophages were detached from such plates, and incubated on ice
for 30 minutes in FACS staining buffer (PBS containing 2% FCS and
0.02% NaN.sub.3) containing 4 .mu.g/ml phycoerythrin-conjugated rat
anti-mouse Mac-1 antibody (BD-PharMingen) in the presence of 2.5
.mu.g/ml rat anti-mouse Fc.gamma.III/II receptors (BD PharMingen).
Such cells were fixed with 1% paraformaldehyde, treated with 0.1%
Triton X-100, and suspended in 100 .mu.l of 100 mM cacodylate
buffer (pH7.2) containing 1 mM CoCl.sub.2 and 0.01% BSA. The TUNEL
reaction was carried out at 37.degree. C. for 45 minutes with 100
unit s/ml terminal deoxynucleotidyl transferase (Takara Shuzo) and
2.5 .mu.M FITC-labeled dUTP (Roche Diagnositics), and analyzed by
flow cytometry using a FACS caliber (Becton-Dickinson).
[0037] Phagocytosis was also evaluated by observing the cells under
a microscope. In brief, peritoneal macrophages (1.times.10.sup.5
cells) or NIH3T3 cells (2.times.10.sup.4 cells) were cultured in
8-well Lab-Tek II chamber slides (Nalge Nunc) that had been coated
with 0.1% gelatin, and phagocytosis of apoptotic thymocytes was
allowed to proceed as described above. After fixation, the cells
were subjected to the TUNEL reaction using an Apoptag kit
(Intergen), and observed by light microscopy.
Example A-5 (Identification of MFG-E8)
[0038] The 2422 monoclonal antibody was covalently linked to
Protein A-Sepharose (2 mg/ml bed volume) using dimethyl
pimelimidate (DMP, Pierce). Molecules recognized by 2422 monoclonal
antibody were purified from mouse P388D1 cells by
immunoprecipitation. In brief, 2.4.times.10.sup.9 cells were lysed
in RIPA buffer (50 mM Hepes-NaOH buffer [pH 7.6] containing 1%
Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate, 150 mM NaCl, 1.5
mM MgCl.sub.2, 1 mM EGTA, 10% glycerol, 1 mM
[p-amidinophenyl]methanesulfonyl fluoride hydrochloride, 1 .mu.g/ml
leupeptin and 1 .mu.g/ml pepstatin). The lysate was pretreated with
3 ml human IgG sepharose, and incubated for 2 hours with 150 .mu.l
2422 monoclonal antibody-Protein A-Sepharose. After washing with
RIPA buffer containing 0.5 M NaCl, proteins bound to the beads were
eluted with 100 mM Triethylamine (pH 11.5) containing 0.1% Triton
X-100, separated by electrophoresis on 10% polyacrylamide gel, and
blotted onto a PVDF membrane. The immobilized protein was reduced,
S-carboxymethylated, and digested with A chromobacter protease I as
described previously (J. Biochem. (Tokyo) 120, 29-34, 1996).
Peptides released from the membrane were analyzed by
matrix-assisted laser desorption/inonization time-of-flight
(MALDI-TOF) mass spectrometry.
Example A-6 (Solid-Phase ELISA and Cell Adhesion Assay)
[0039] The solid phase ELISA for MFG-E8 bound to phospholipids was
carried out as described previously (Biochemistry 36, 5441-5446,
1997). In brief, a solution of phospholipid in methanol (3
.mu.g/ml, 100 .mu.l) was added to 96-well microtiter plates, and
air-dried. The wells were treated with PBS containing 10 mg/ml BSA.
MFG-E8 were added to the wells, and incubated at room temperature
for 1 hour. After washing with PBS containing 0.05% Tween 20,
MFG-E8 bound to the wells was quantified by ELISA with biotinylated
anti-Flag antibody and peroxidase-conjugated streptavidin.
Peroxidase activity was detected using a peroxidase-detecting kit
(Sumitomo Bakelite). To assay the ability of MFG-E8 to link the
cells to phospholipids, MFG-E8 was bound to microtiter plates
coated with phospholipids as described above. In tyrode buffer
containing the cells (4.times.10.sup.4) (5 mM Hepes-NaOH buffer [pH
7.4], 135 mM NaCl, 5.4 mM KCl, 1.0 mM MgCl.sub.2, 10 mM glucose,
and 10 mg/ml BSA) was added to each well, and incubated at room
temperature for 1 hour. The cells that had adhered to the plates
were quantified by a CYQUANT Cell Proliferation Assay kit
(Molecular Probes) using a fluorescent microplate reader (BioLumin
960, Molecular Dynamics) set at excitation wavelength of 485 nm and
emission wavelength of 520 nm.
EXAMPLE B [Results]
Example B-1 (Establishment of Monoclonal Antibody that Enhances the
Phagocytosis of Apoptotic Cells)
[0040] The cells expressing a caspase resistant-mutant of ICAD
which is a inhibitor protein of caspase activated DNase(CAD) do not
undergo apoptotic DNA fragmentation, but their DNA can still be
cleaved when the cells are engulfed bymacrophages (Genes Dev. 14,
549-558, 2000). This system was used to examine the phagocytosis of
apoptotic cells by macrophages. Thymocytes from ICAD-Sdm (a
short-stranded caspase resistant ICAD) mice were untreated or
treated with dexamethasone for 4 hours, and stained with
phycoerythrin-conjugated Annexin V (BD PharMingen) or TUNEL using
FITC-conjugated dUTP. As shown in FIG. 1a, when the thymocytes from
ICAD-Sdm mice were treated with dexamethasone, approximately 50% of
the cells turned Annexin V-positive within 4 hours, however, they
were not stained by TUNEL.
[0041] In the next place, the thioglycollate-elicited mouse
peritoneal macrophages were incubated with freshly prepared or
dexamethasone-treated thymocytes from ICAD-Sdm mice. The cells were
stained with phycoerythrin-conjugated anti-Mac-1 antibody, followed
by TUNEL staining with FITC-dUTP. When the macrophages were
cocultured with ICAD-Sdm thymocytes in the presence of apoptotic
cells instead of freshly prepared thymocytes, approximately 40% of
the Mac-1.sup.+ cells (cell surface antigen Mac-l-expressing cells
of macrophage-like cell line) turned TUNEL-positive (FIG. 1b lower
part). Bafilomycin (100 nM) was added to macrophages 30 minutes
before the incubation with the dexamethasone-treated thymocytes.
Thus, when the macrophages are treated with bafilomycin which
prevents oxidization of lisosome (Proc. Natl. Acad. Sci. USA 85,
7972-7976, 1988), the emergence of TUNEL-positive macrophages was
inhibited. The upper panels of FIG. 1b show the TUNEL-staining
profiles in the Mac-1.sup.+ population. These results suggest that
such macrophages incorporate apoptotic cells specifically, and they
digest their chromosomal DNA.
[0042] In order to identify mediators of this process, the
thioglycollate-elicited mouse peritoneal macrophages were used to
immunize Armenian hamsters, and hybridomas were prepared. It was
found that particular antibody (2422 monoclonal antibody) promotes
the phagocytosis. In brief, phagocytosis was assayed in the
absence, or presence of 12 .mu.g/ml normal hamster IgG, or 2422
monoclonal antibody. The FACS profiles of TUNEL-staining in the
Mac-1.sup.+ population are shown in FIG. 1c. The numbers indicate
the percentage of TUNEL-positive cells in the Mac-1.sup.+
population. These results showed that the percentage of macrophages
which engulf apoptotic cells increased from 44% to 57% in the
presence of 2422 monoclonal antibody. As a result of observation
under a light microscopy (.times.400), it was found that not only
the number of macrophages which engulf apoptotic cells, but also
the number of apoptotic cells engulfed by one macrophage increases
in the presence of 2422 monoclonal antibody, as shown in FIG.
1d.
Example B-2 (Identification of 2422 Monoclonal
Antibody-Recognition-Protein)
[0043] In order to identify proteins recognized by 2422 monoclonal
antibody, the thioglycollate-elicited peritoneal macrophages or the
macrophage cell line P388D1 were surface-labeled with biotin, and
proteins recognized by 2422 monoclonal antibody was
immunoprecipitated. As a result of Western blotting with
streptavidin-peroxidase for an immune precipitate, the bands of 72
kDa and 56 kDa appeared as shown in FIG. 2a. As shown in FIG. 2a,
since P388D1 cell lines express proteins more abundantly than did
peritoneal macrophages, P388D1 cells were cultured on a large
scale, and proteins recognized by 2422 monoclonal antibody were
affinity-purified from cell lysates using such antibody, separated
by electrophoresis on a polyacrylamide gel, transferred to a PVDF
membrane, and stained with Ponceau-S. The results are shown in FIG.
2b. The arrows in FIG. 2b indicate proteins subjected to protein
sequence analysis, and IgG released from protein A-sepharose. As a
result of mass spectrometry of peptides generated from the proteins
of 72 kDa and 56 kDa, it was found that they are mouse MFG-E8
(Proc. Natl. Acad. Sci. USA 87, 8417-8421, 1990; Biochem. Biophys.
Res. Commun. 254. 522-528, 1999).
[0044] Two classes of cDNA (MFG-E8-L and MFG-E8-S) were isolated
from mouse peritoneal macrophages by reverse
transcription-polymerase chain reaction (RT-PCR) using the primer
having mouse MFG-E8 sequence. In the next place, total RNA (7.5
.mu.g) derived from thioglycollate-elicited peritoneal macrophages
and P388D1 cells were separated by electrophoresis on a 1.5%
agarose gel and analyzed by Northern hybridization using
32P-labeled murine MFG-E8 cDNA (FIG. 2c upper panel; in FIG. 2c
lower panel, the filter was stained with 0.05% (w/v) methylene
blue). Northern blotting showed that MFG-E8 mRNA was abundantly
expressed in thioglycollate-elicited peritoneal macrophages and
P388D1 cells. In contrast, little MFG-E8 mRNA was detected in
peritoneal macrophages and thymocytes in the resting period.
Several other macrophage cell lines such as J774A.1 and BAM3 and
the like, and the fibroblast cell line NIH3T3 expressed little
MFG-E8 mRNA (FIG. 2c).
[0045] Total RNA (0.3 .mu.g) from thioglycollate-elicited
peritoneal macrophages and P388D1 were analyzed by RT-PCR. A
portion of the MFG-E8 mRNA is shown schematically in the right
panel of FIG. 2d. Primers used are indicated by arrows: the sense
primer, ATGCAGGTCTCCCGTGTGCT (SEQ ID NO.4: P1) and the anti-sense
primer, GCGGAAATCTGTGAATCAGC (SEQ ID NO 5: P2). The PCR products
were separated by electrophoresis on an agarose gel. RT-PCR
analysis showed that P388D1 cells dominantly express short strand
(MFG-E8-S) as opposed to that MFG-E8 mRNA in the
thioglycollate-elicited peritoneal macrophages mainly encodes long
strand (MFG-E8-L). Therefore, the thioglycollate-elicited
peritoneal macrophages and P388D1 were cultured for 48 hours. The
cell lysates and culture supernatants were immunoprecipitated with
2422 monoclonal antibody, and subjected to Western blotting with
rabbit anti-MFG-E8 antibodies. The results are shown in FIG. 2e.
MFG-E8proteins are indicated by arrows at the right in FIG. 2e. It
is suggested that MFG-E8 is a secretory protein since it has no
putative transmembrane region though it has a signal sequence at
the N-terminus. As shown in these results, the culture supernatant
of thioglycollate-elicited peritoneal macrophages contained a large
amount of MFG-E8 of 74 kDa. On the other hand, P388D1 cells
secreted negligible levels of MFG-E8, although the cell lysates
contained a substantial amount of MFG-E8. It suggests that MFG-E8
expressed in P388D1 cells is not sufficiently secreted. Bands
indicated by * in FIG. 2e are probably degraded products of
MFG-E8.
Example B-3 (Binding of MFG-E8 to Aminophospholipids Exposed on
Apoptotic Cells)
[0046] In order to examine whether MFG-E8 binds to apoptotic cells,
FLAG-conjugated recombinant MFG-E8-L (FIG. 3a) was generated in
human 293T cells, purified to homogeneity. Freshly prepared
wild-type thymocytes (5.times.10.sup.5 cells) or thymocytes treated
with dexamethasone for 4 hours were incubated at 4.degree. C. for
30 minutes with 0.25 .mu.g/ml FLAG-conjugated MFG-E8-L, followed by
double-staining with biotinylated anti-FLAG antibody, and
phycoerythrin-conjugated streptavidin. After fixation, the cells
were subjected to TUNEL staining with FITC-dUTP, and analyzed by
FACS. The results are shown in FIG. 3b. As shown in FIG. 3b,
MFG-E8-L does not bind to freshly isolated thymocytes, but tightly
bound to the thymocytes treated with dexamethasone. If such
thymocytes treated with dexamethasone are double stained with
MFG-E8-L and TUNEL, it can be found that MFG-E8-L specifically
binds to the TUNEL-positive apoptotic cells.
[0047] As mentioned above, MFG-E8-L contains a signal sequence, two
EGF domains, a proline/threonine-rich domain (P/T-rich domain), and
two factor VIII-homologous domains (C1 and C2). MFG-E8-S is encoded
by MFG-E8 mRNA spliced in various forms and its P/T-rich domain is
deleted. In order to study which domain of MFG-E8-L is involved in
binding to apoptotic cells, examination was carried out using
MFG-E8-S and a series of MFG-E8-L mutants. Thymocytes were treated
with dexamethasone for 6 hours, and incubated with 0.25 .mu.g/ml of
various MFG-E8 derivatives. MFG-E8 bound to thymocytes was analyzed
by FACS analysis using FITC-labeled anti-FLAG antibody. The results
are shown in FIG. 3c. Dotted lines in FIG. 3c show the staining
profiles in the absence of MFG-E8. As shown in FIG. 3c, MFG-E8-S,
D89E having point mutation in RGD motif, C1C2 containing C1 domain
and C2 domain only, as well as MFG-E8-L bound to thymocytes in the
presence of apoptotic cells.
[0048] In the meantime, it is known that Annexin V binds to
apoptotic cells by recognizing phosphatidylseline (PS) (Blood 84,
1415-1420, 1994). Therefore, thymocytes treated with dexamethasone
for 6 hours were incubated with 1.25 .mu.g/ml MFG-E8-L or various
mutants, and stained with phycoerythrine-conjugated annexin V. The
results are shown in FIG. 3d. Annexin V-staining profile in the
absence of MFG-E8 is shown by dotted lines in FIG. 3d. As shown in
FIG. 3d, when thymocytes in the presence of apoptotic cells are
pretreated with MFG-E8-L or D89E, binding of Annexin V to apoptotic
cells was largely inhibited. Further, inhibition effect of MFG-E8-L
on binding of Annexin V was dose-dependent, and when treated with
0.25 .mu.g/ml of MFG-E8-L, 50% of binding of Annexin V was
inhibited. On the other hand, binding of Annexin V to apoptotic
cells was not inhibited by the presence of MFG-E8-S or C1C2. This
shows that affinity of MFG-E8-S for apoptotic cells is considerably
lower than that of MFG-E8-L.
[0049] Antagonistic action of MFG-E8-L for binding of Annexin V to
apoptotic cells suggested that MFG-E8-L was bound to PS. Therefore,
bindings of MFG-E8-L to various phospholipids were investigated.
Microtiter plates coated with phosphatidylserine (PS),
phosphatidylethanolamine (PE), phosphatidylcholine (PC), or
phosphatidylinositol (PI) were incubated with increasing
concentrations of MFG-E8-L. MFG-E8-L bound to the wells was
quantified by ELISA using the anti-FLAG antibody. The results are
shown in FIG. 3e. As shown in FIG. 3e, although MFG-E8-L bound to
the plates coated with PS or PE in a saturating manner, MFG-E8-L
did not significantly bind to the plates coated with PC or PI.
[0050] In the next place, binding to phosphatidylseline was also
examined for D89E mutant which is a point mutant derivative of
MFG-E8-L which has antagonistic activity for binding of Annexin V
for apoptotic cells in the same manner as for MFG-E8-L. Microtiter
plates coated with PS were incubated with increasing concentrations
of MFG-E8-L, MFG-E8-S, or C1C2 mutant as well as D89E, and MFG-E8
bound to the wells was quantified by ELISA.
[0051] The results are shown in FIG. 3f. As shown in FIG. 3f, D89E
mutants of MFG-E8-L bound to the plates coated with PS as
efficiently as did the wild-type MFG-E8-L. However, the affinity of
MFG-E8-S and C1C2 mutant for the plates coated with PS was
one-eighth of the affinity of MFG-E8-L. These results showed that
MFG-E8-L is capable of recognizing aminophopholipid via its C1C2
domain, and that P/T-rich domain present in MFG-E8-L is involved in
the affinity of MFG-E8-L against such phospholipids.
Example B-4 (Binding of NIH3T3 Cells to Aminophospholipids Via
MFG-E8)
[0052] In the second EGF domain of MFG-E8, RGD motif which can be
recognized by some members of integrin family which is a cell
transmembrane receptor involved in cell adhesion (Cell 69, 11-25,
1992). Therefore, the possibility that MFG-E8-L acts as a bridge
between apoptotic cells expressing aminophospholipids and
phagocytes expressing integrins was considered. The NIH3T3
transformants expressing the mouse .alpha..sub.v.beta..sub.3
integrin were analyzed by FACS using phycoerythrine-conjugated
hamster anti-mouse integrin .alpha..sub.v or integrin .beta..sub.3
antibodies. The results are shown in FIG. 4a. The FACS staining
profile for the parental NIH3T3 cell is shown by dotted lines in
FIG. 4a. As shown in FIG. 4a, although mouse NIH3T3 parent cells
express .alpha..sub.v and .beta..sub.3 integrins at low level, when
this parent cell line is transformed with .alpha..sub.v and
.beta..sub.3 integrin-expressing vectors it abundantly expressed
both .alpha..sub.v and .beta..sub.3 integrins.
[0053] FACS analysis using FLAG-conjugated MFG-E8 did not show
specific binding between MFG-E8-L and NIH3T3 or its
.alpha..sub.v.beta..sub.3 integrin transformant. Therefore, the
possibility that MFG-E8-L might bind to integrin-expressing cells
after said cells are bound to phospholipids was investigated.
Microtiter wells coated with PS or PE were successively incubated
with three different concentrations (0.1, 1.0 and 2.0 .mu.g/ml) of
MFG-E8-L or D89E, and with NIH3T3 (3T3/WT) or
.alpha..sub.v.beta..sub.3 integrin-expressing transformants
(3T3/.alpha..sub.v.beta..sub.3), and subjected to cell adhesion
assay. The number of cells attached to the wells was quantified as
described in the methods described in Example A-6. The results are
shown in FIG. 4b. As shown in FIG. 4b, NIH3T3parent cells (3T3/WT)
did not bind to the plates coated with PS in the absence of
MFG-E8-L. On the other hand, when the plates coated with PS were
preincubated in the presence of MFG-E8-L, considerable amount of
NIH3T3 cells adhered to the wells. D89E mutant was not capable of
intermediating the adhering of NIH3T3 cells to the wells coated
with PS. It shows that the effect of such MFG-E8-L is caused by its
RGD motif. When NIH3T3 cells (3T3/.alpha..sub.v.beta..sub.3)
expressing .alpha..sub.v.beta..sub.3 integrin were used as a
target, activity of MFG-E8-L against cell adhesion to the wells
coated with PS was more drastic. In brief, approximately 7000 cells
were adhered to the wells pretreated with 1.0 .mu.g/ml MFG-E8-L, as
opposed to only 20 cells were adhered to the wells untreated or
treated with D89E. Binding ability of MFG-E8-L to PE was in similar
efficiency as with the wells coated with PS, and the wells coated
with PE also supported the adhesion of NIH3T3 cell
transformant.
Example B-5 (MFG-E8-L Dependent Incorporation of Apoptotic
Cells)
[0054] In the next place, it was investigated whether it is
possible for MFG-E8-L to stimulate NIH3T3 cells to engulf apoptotic
cells. NIH3T3 (3T3/WT) or its transformant expressing
.alpha..sub.v.beta..sub.3 integrin (3T3/.alpha..sub.v.beta..sub.3)
was incubated in the absence (-) or presence of 0.1 .mu.g/ml of
MFG-E8-L, MFG-E8-S, or D89E with freshly prepared thymocytes from
ICAD-Sdm mice (Dex(-)) or with tymocytes that had been treated for
4 hours with dexamethasone (Dex (+)). The number of NIH3T3 cells
that engulfed more than 3 thymocytes was counted, and the
percentage of these cells to the total number of NIH3T3 cells (150
cells) was determined. The experiments were performed at least
twice in triplicate, and the average number is shown by SD (bars)
in FIG. 5a. As shown in FIG. 5a, when thymocytes freshly prepared
from ICAD-Sdm mice were cocultured with NIH3T3 cells for two hours,
there was no thymocyte which was adhered or engulfed by NIH3T3
cells in the absence or presence of MFG-E8-L, however, when the
thymocytes treated with dexamethasone were cocultured with NIH3T3
cells, approximately 6% of NIH3T3 cells engulfed more than 3
thymocytes. Besides, the presence of MFG-E8-L increased the ratio
of NIH3T3 cells which engulfed more than three thymocytes to
23%.
[0055] In the next place, the NIH3T3 cell transformants expressing
.alpha..sub.v.beta..sub.3 integrin were incubated with apoptotic
thymocytes in the absence (control) or presence of MFG-E8-L or
D89E, and were observed under a light microscopy (.times.200). The
results are shown in FIG. 5b. As shown in FIG. 5b, the influence of
MFG-E8-L on phagocytosis was more clear when NIH3T3 transformant
which expresses .alpha..sub.v.beta..sub.3 integrin was used as a
phagocyte. In this case, the percentage of NIH3T3 transformant
which engulfed more than 3 thymocytes was increased from 9% to 46%
if MFG-E-L is added to the analysis mixture, and approximately 20%
of the cells engulfed more than 6 thymocytes. The effect of
MFG-E8-S or D89E for phagocytosis of NIH3T3 cells was rarely
seen.
[0056] NIH3T3 cell transformants expressing
.alpha..sub.v.beta..sub.3 integrin were cocultured with apoptotic
thymocytes in the presence of increasing concentrations of MFG-E8-L
or D89E, and the percentage of cells that engulfed more than 3
thymocytes was determined. The average number obtained from two
experiments performed in triplicate is plotted with SD (bars)in
FIG. 5c. The result shown in FIG. 5c wherein MFG-E8-L was used with
various concentrations showed that optimal concentration of
MFG-E8-L for increasing phagocytosis existed. With equal to or less
than 0.1 .mu.g/ml, MFG-E8-L enhance the phagocytosis in a
dose-dependent manner, however, with higher concentration,
inhibitory effect appeared. This inhibitory activity disappeared by
adding 2422 monoclonal antibody.
[0057] On the other hand, unlike wild-type MFG-E8-L, D89E mutant
inhibit the phagocytosis of NIH3T3 cells or their transformant in a
large range of concentration (FIG. 5a and 5c). Using this
characterics of D89E, the involvement of MFG-E8-L to phagocytosis
of apoptotic cells by peritoneal macrophages was evaluated.
Thymocytes from ICAD-Sdm mice were treated with dexamethasone for 4
hours, and cocultured with thioglycollate-elicited peritoneal
macrophages in the presence of the indicated concentrations of D89E
shown in FIG. 5d. After the reaction, the cells were stained with
Phycoerythrine-conjugated anti-Mac-i antibody, and TUNEL was
carried out with FITC-dUTP. The FACS profile for TUNEL-positive
cells in the Mac-1.sup.+ cell population is shown in FIG. 5d. The
numbers in FIG. 5d indicate the percentage of TUNEL-positive
macrophages obtained in two independent assays. As shown in FIG.
5d, when thioglycollate-elicited peritoneal macrophages were
cocultured with thymocytes derived from ICAD-Sdm mouse treated with
dexamethasone, approximately 42% of macrophages turned
TUNEL-positive. The emergence of TUNEL-positive cells and
phagocytosis of thymocytes by macrophages were largely inhibited by
D89E in a dose-dependent manner. This showed that MFG-E8-L
expressed in macrophages played an important role in phagocytosis
of apoptotic cells.
EXAMPLE C [Conclusion]
[0058] Many proteins expressed in phagocytes are reported as
receptors involved in engulfment of apoptotic cells (Trends Cell
Biol. 8, 365-372, 1998; Cell Death Differ. 5. 551-562, 1998; Nature
407, 784-788, 2000). However, it was not clear whether these
receptors directly bind to apoptotic cells. The present inventors
showed herein that MFG-E8-L specifically bound to apoptotic cells
by recognizing aminophospholipids such as PS, PE and the like.
Aminophospholipids localized to the inner leaflet of the plasma
membrane in proliferating or resting period exposed on the cell
surface when the cells are triggered to undergo apoptosis (J.
Immunol. 149, 4029-4035, 1992; Exp. Cell Res. 232, 430-434, 1997;
Proc. Natl. Acad. Sci. USA 95, 6349-6354, 1998). The cells which
are made to express PS using liposome transfer method are
recognized and engulfed by phagocytes (J. Biol. Chem. 270.
1071-1077, 2001). These facts show that exposed PS fulfills the
criteria for an "eat me" signal. Most of the molecules reported as
receptors for apoptotic cells bind not only to PS but also to PI
(Cell Death Differ. 5, 551-562, 1998; J. Biol. Chem. 276,
16221-16224, 1995). On the other hand, MFG-E8-L exclusively binds
to PS and PE, supporting the idea that MFG-E8-L specifically
recognize apoptotic cells.
[0059] Integrins have been suggested as a receptor for apoptotic
cells in several systems (Nature 343, 170-173, 1990; Nature 392,
86-89, 1998). However, it has not been clear how these integrins
recognize apoptotic cells since neither .alpha..sub.v.beta..sub.3
nor .alpha..sub.v.beta..sub.5 integrins can bind to PS. It is
considered that this dilemma will be solved by MFG-E8-L, and
integrin can be acknowledged as a receptor for apoptotic cells in
thioglycollate-elicited peritoneal macrophages. Whether other
phagocytes use this system, or other systems such as PSR (Nature
405, 85-90, 2000) or MER (Nature 411, 207-211, 2001) remains to be
studied.
[0060] MFG-E8 was originally identified as one of the most abundant
proteins in the membranes of milkfat globules (Proc. Natl. Acad.
Sci. USA 87, 8417-8421, 1990). Mammary gland undergo massive
involution when suckling and milking ceases (J. Mammary Gland Biol.
Neoplasia 4, 129-136, 1999). During this process, a large number of
epithelial cells are killed by apoptotic cells. It is further
necessary to remove those apoptotic cells by infiltrating
macrophages or viable epithelial cells, to insure the remodeling of
the mammary gland in preparation for the next wave of lactation (J.
Mammary Gland Biol. Neoplasia 4, 203-211, 1999). Identification of
MFG-E8-L as a molecule that recognizes the apoptotic cells would
help to elucidate the molecular mechanism behind involution and
remodeling of mammary gland at the end of lactation.
INDUSTRIAL APPLICABILITY
[0061] According to the present invention, it is possible to
provide a removal promoter which is capable of rapidly removing
apoptotic cells in vivo bymacrophages, or a removal inhibitor which
is capable of inhibiting the removal of apoptotic cells in vivo by
macrophages.
Sequence CWU 1
1
51463PRTMus musculus 1Met Gln Val Ser Arg Val Leu Ala Ala Leu Cys
Gly Met Leu Leu Cys 1 5 10 15Ala Ser Gly Leu Phe Ala Ala Ser Gly
Asp Phe Cys Asp Ser Ser Leu 20 25 30Cys Leu Asn Gly Gly Thr Cys Leu
Thr Gly Gln Asp Asn Asp Ile Tyr 35 40 45Cys Leu Cys Pro Glu Gly Phe
Thr Gly Leu Val Cys Asn Glu Thr Glu 50 55 60Arg Gly Pro Cys Ser Pro
Asn Pro Cys Tyr Asn Asp Ala Lys Cys Leu 65 70 75 80Val Thr Leu Asp
Thr Gln Arg Gly Asp Ile Phe Thr Glu Tyr Ile Cys 85 90 95Gln Cys Pro
Val Gly Tyr Ser Gly Ile His Cys Glu Thr Glu Thr Asn 100 105 110Tyr
Tyr Asn Leu Asp Gly Glu Tyr Met Phe Thr Thr Ala Val Pro Asn 115 120
125Thr Ala Val Pro Thr Pro Ala Pro Thr Pro Asp Leu Ser Asn Asn Leu
130 135 140Ala Ser Arg Cys Ser Thr Gln Leu Gly Met Glu Gly Gly Ala
Ile Ala145 150 155 160Asp Ser Gln Ile Ser Ala Ser Ser Val Tyr Met
Gly Phe Met Gly Leu 165 170 175Gln Arg Trp Gly Pro Glu Leu Ala Arg
Leu Tyr Arg Thr Gly Ile Val 180 185 190Asn Ala Trp Thr Ala Ser Asn
Tyr Asp Ser Lys Pro Trp Ile Gln Val 195 200 205Asn Leu Leu Arg Lys
Met Arg Val Ser Gly Val Met Thr Gln Gly Ala 210 215 220Ser Arg Ala
Gly Arg Ala Glu Tyr Leu Lys Thr Phe Lys Val Ala Tyr225 230 235
240Ser Leu Asp Gly Arg Lys Phe Glu Phe Ile Gln Asp Glu Ser Gly Gly
245 250 255Asp Lys Glu Phe Leu Gly Asn Leu Asp Asn Asn Ser Leu Lys
Val Asn 260 265 270Met Phe Asn Pro Thr Leu Glu Ala Gln Tyr Ile Arg
Leu Tyr Pro Val 275 280 285Ser Cys His Arg Gly Cys Thr Leu Arg Phe
Glu Leu Leu Gly Cys Glu 290 295 300Leu His Gly Cys Ser Glu Pro Leu
Gly Leu Lys Asn Asn Thr Ile Pro305 310 315 320Asp Ser Gln Met Ser
Ala Ser Ser Ser Tyr Lys Thr Trp Asn Leu Arg 325 330 335Ala Phe Gly
Trp Tyr Pro His Leu Gly Arg Leu Asp Asn Gln Gly Lys 340 345 350Ile
Asn Ala Trp Thr Ala Gln Ser Asn Ser Ala Lys Glu Trp Leu Gln 355 360
365Val Asp Leu Gly Thr Gln Arg Gln Val Thr Gly Ile Ile Thr Gln Gly
370 375 380Ala Arg Asp Phe Gly His Ile Gln Tyr Val Ala Ser Tyr Lys
Val Ala385 390 395 400His Ser Asp Asp Gly Val Gln Trp Thr Val Tyr
Glu Glu Gln Gly Ser 405 410 415Ser Lys Val Phe Gln Gly Asn Leu Asp
Asn Asn Ser His Lys Lys Asn 420 425 430Ile Phe Glu Lys Pro Phe Met
Ala Arg Tyr Val Arg Val Leu Pro Val 435 440 445Ser Trp His Asn Arg
Ile Thr Leu Arg Leu Glu Leu Leu Gly Cys 450 455 46021392DNAMus
musculus 2atgcaggtct cccgtgtgct ggccgcgctg tgcggcatgc tactctgcgc
ctctggcctc 60ttcgccgcgt ctggtgactt ctgtgactcc agcctgtgcc tgaacggtgg
cacctgcttg 120acgggccaag acaatgacat ctactgcctc tgccctgaag
gcttcacagg ccttgtgtgc 180aatgagactg agagaggacc atgctcccca
aacccttgct acaatgatgc caaatgtctg 240gtgactttgg acacacagcg
tggggacatc ttcaccgaat acatctgcca gtgccctgtg 300ggctactcgg
gcatccactg tgaaaccgag accaactact acaacctgga tggagaatac
360atgttcacca cagccgtccc caatactgcc gtccccaccc cggcccccac
ccccgatctt 420tccaacaacc tagcctcccg ttgttctaca cagctgggca
tggaaggggg cgccattgct 480gattcacaga tttccgcctc gtctgtgtat
atgggtttca tgggcttgca gcgctggggc 540ccggagctgg ctcgtctgta
ccgcacaggg atcgtcaatg cctggacagc cagcaactat 600gatagcaagc
cctggatcca ggtgaacctt ctgcggaaga tgcgggtatc aggtgtgatg
660acgcagggtg ccagccgtgc cgggagggcg gagtacctga agaccttcaa
ggtggcttac 720agcctcgacg gacgcaagtt tgagttcatc caggatgaaa
gcggtggaga caaggagttt 780ttgggtaacc tggacaacaa cagcctgaag
gttaacatgt tcaacccgac tctggaggca 840cagtacataa ggctgtaccc
tgtttcgtgc caccgcggct gcaccctccg cttcgagctc 900ctgggctgtg
agttgcacgg atgttctgag cccctgggcc tgaagaataa cacaattcct
960gacagccaga tgtcagcctc cagcagctac aagacatgga acctgcgtgc
ttttggctgg 1020tacccccact tgggaaggct ggataatcag ggcaagatca
atgcctggac ggctcagagc 1080aacagtgcca aggaatggct gcaggttgac
ctgggcactc agaggcaagt gacaggaatc 1140atcacccagg gggcccgtga
ctttggccac atccagtatg tggcgtccta caaggtagcc 1200cacagtgatg
atggtgtgca gtggactgta tatgaggagc aaggaagcag caaggtcttc
1260cagggcaact tggacaacaa ctcccacaag aagaacatct tcgagaaacc
cttcatggct 1320cgctacgtgc gtgtccttcc agtgtcctgg cataaccgca
tcaccctgcg cctggagctg 1380ctgggctgtt aa 1392316PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide 3Cys
Asn Ser His Lys Lys Asn Ile Phe Glu Lys Pro Phe Met Ala Arg 1 5 10
15420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4atgcaggtct cccgtgtgct 20520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5gcggaaatct gtgaatcagc 20
* * * * *