U.S. patent application number 11/576448 was filed with the patent office on 2008-09-11 for morphine and morphine precursors.
This patent application is currently assigned to THE RESEARCH FOUNDATION OF STATE UNIVERSITY OF NY. Invention is credited to Patrick Cadet, Kirk J. Mantione, George B. Stefano, Wei Zhu.
Application Number | 20080221143 11/576448 |
Document ID | / |
Family ID | 36143157 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080221143 |
Kind Code |
A1 |
Stefano; George B. ; et
al. |
September 11, 2008 |
Morphine and Morphine Precursors
Abstract
Methods and materials related to the use of morphine, morphine
precursors (e.g., reticuline), and inhibitors of morphine synthesis
or activity to treat diseases, to reduce inflammation, or to
restore normal function are provided.
Inventors: |
Stefano; George B.;
(Melville, NY) ; Cadet; Patrick; (Elmont, NY)
; Mantione; Kirk J.; (Patchogue, NY) ; Zhu;
Wei; (West Babylon, NY) |
Correspondence
Address: |
FISH & RICHARDSON P.C.
PO BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Assignee: |
THE RESEARCH FOUNDATION OF STATE
UNIVERSITY OF NY
Albany
NY
|
Family ID: |
36143157 |
Appl. No.: |
11/576448 |
Filed: |
September 30, 2005 |
PCT Filed: |
September 30, 2005 |
PCT NO: |
PCT/US05/35628 |
371 Date: |
August 31, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60615048 |
Oct 1, 2004 |
|
|
|
60714769 |
Sep 6, 2005 |
|
|
|
Current U.S.
Class: |
514/282 |
Current CPC
Class: |
A61K 31/198 20130101;
A61P 25/28 20180101; A61K 31/472 20130101; A61K 31/7052 20130101;
A61P 43/00 20180101; A61K 31/485 20130101; A23V 2002/00 20130101;
A61K 33/06 20130101; A61P 19/02 20180101; A23V 2002/00 20130101;
A23L 33/10 20160801; A61P 17/00 20180101; A61P 25/18 20180101; A61P
29/00 20180101; A23V 2200/322 20130101; A61K 2300/00 20130101; A23V
2250/0606 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A23V 2250/30 20130101; A23V 2250/1626 20130101; A61K 33/04
20130101; A61K 2300/00 20130101; A61K 31/7052 20130101; A61K 31/198
20130101; A61K 33/06 20130101; A61K 45/06 20130101; A61P 25/00
20180101; A61K 2300/00 20130101; A61P 25/22 20180101; A61K 33/04
20130101; A61P 9/10 20180101; A61P 25/24 20180101; A61P 25/16
20180101; A61K 31/194 20130101; A61K 31/485 20130101; A61P 25/30
20180101 |
Class at
Publication: |
514/282 |
International
Class: |
A61K 31/485 20060101
A61K031/485; A61P 25/00 20060101 A61P025/00 |
Claims
1. A method for inducing nitric oxide release from cells in a
mammal, said method comprising administering, to said mammal, a
composition in an amount, at a frequency more frequent than once a
week, and for a duration longer than one month, wherein said
composition comprises morphine or morphine-6.beta.-glucuronide, and
wherein said amount of said composition results in less than 0.05
mg of said morphine or morphine-6.beta.-glucuronide being
administered to said mammal per kg of body weight of said mammal
per day.
2. The method of claim 1, wherein said cells are immune cells.
3. The method of claim 1, wherein said mammal is a human.
4. The method of claim 1, wherein said composition comprises a
morphine precursor.
5. The method of claim 1, wherein said composition is in the form
of a tablet.
6. The method of claim 1, wherein said composition comprises
selenium.
7. The method of claim 1, wherein said composition comprises
L-arginine.
8. The method of claim 1, wherein said composition comprises a
calcium source.
9. The method of claim 1, wherein said amount of said composition
results in less than 0.025 mg of said morphine or
morphine-6.beta.-glucuronide being administered to said mammal per
kg of body weight of said mammal per day.
10. The method of claim 1, wherein said amount of said composition
results in less than 0.01 mg of said morphine or
morphine-6.beta.-glucuronide being administered to said mammal per
kg of body weight of said mammal per day.
11. The method of claim 1, wherein said frequency is more frequent
than four times a week.
12. The method of claim 1, wherein said frequency is between two
and five times a day.
13. The method of claim 1, wherein said frequency is once a
day.
14. The method of claim 1, wherein said duration is longer than two
months.
15. The method of claim 1, wherein said duration is longer than
three months.
16. The method of claim 1, wherein said composition comprises
morphine.
17. The method of claim 1, wherein said composition comprises
morphine-6.beta.-glucuronide.
18. The method of claim 1, wherein said composition comprises
morphine and morphine-6.beta.-glucuronide.
19. A method for inducing nitric oxide release from cells in a
mammal, said method comprising administering, to said mammal, a
composition in an amount, at a frequency more frequent than once a
week, and for a duration longer than one month, wherein said
composition comprises thebaine or codeine, and wherein said amount
of said composition results in less than 0.05 mg of said thebaine
or codeine being administered to said mammal per kg of body weight
of said mammal per day.
20. The method of claim 19, wherein said cells are immune
cells.
21-124. (canceled)
Description
[0001] Statement as to Federally Sponsored Research Funding for the
work described herein was provided by the federal government, which
may have certain rights in the invention.
BACKGROUND
[0002] 1. Technical Field
[0003] This document relates to methods and materials involved in
using morphine, morphine precursors (e.g., reticuline),
morphine-6.beta.-glucuronide, and inhibitors of morphine synthesis
or activity to treat mammals.
[0004] 2. Background Information
[0005] Many people suffer from conditions such as depression,
neurodegenerative diseases (e.g., Alzheimer's disease),
pro-inflammatory diseases, autoimmune disorders, and
atherosclerosis. In many cases, few, if any, successful treatments
are available for these people.
[0006] Morphine is a powerful analgesic that is routinely used to
reduce pain in humans. For example, surgery patients are typically
instructed to take 5 to 10 mg of morphine per person to alleviate
pain caused by the surgical procedure. In some cases, patients
suffering from extreme pain (e.g., burn victims or cancer patients)
are instructed to take higher doses of morphine. For moderate to
severe pain, the optimal intramuscular dosage is considered to be
10 mg per 70 kg body weight every four hours. The typical dose
range is from 5 to 20 mg every four hours, depending on the
severity of the pain. The oral dose range is between 8 and 20 mg,
but orally administered morphine has substantially less analgesic
potency. Orally administered morphine can exhibit about one-tenth
of the effect produced by subcutaneous injection of morphine since
orally administered morphine is rapidly destroyed as it passes
through the liver after absorption. The intravenous route is used
primarily for severe post-operative pain or in an emergency. In
such cases, the dose range is between 4 and 10 mg, and the
analgesic effect ensues almost immediately.
SUMMARY
[0007] This document provides methods and materials related to
using morphine, morphine-6.beta.-glucuronide, morphine precursors
(e.g., reticuline), inhibitors of morphine synthesis or activity,
and inhibitors of dopamine synthesis to treat diseases, to reduce
inflammation, or to restore normal function. For example, this
document provides compositions containing morphine,
morphine-6.beta.-glucuronide, morphine precursors, inhibitors of
morphine synthesis, inhibitors of morphine activity, inhibitors of
dopamine synthesis, or combinations thereof. This document also
provides methods for using such compositions (e.g., method for
providing a mammal with a long-term, low level of morphine). As
described herein, a long-term, low level of morphine can be
achieved in a mammal by repeatedly administering a low dose of
morphine, by repeatedly administering a morphine precursor, or by
repeatedly administering a combination of morphine and morphine
precursors. In some cases, inhibitors such as dopamine
.beta.-hydroxylase inhibitors can be used to inhibit the dopamine
to norepinephrine step in adrenaline synthesis, which can result in
an endogenous dopamine level increase as well as an endogenous
morphine level increase.
[0008] Providing a mammal with a long-term, low level of morphine
can allow the mammal to experience behavioral changes (e.g., a
general overall calm feeling). In addition, providing a mammal with
a long-term, low level of morphine can allow the mammal to
experience reduced inflammatory responses and can allow the mammal
to maintain an increased, basal level of constitutive nitric oxide
release. In some cases, the compositions provided herein can be
used to down regulate immune, vascular, neural, and
gastrointestinal tissues via nitric oxide produced within a mammal.
For example, the compositions provided herein can be used to reduce
the excited state of inflamed gastrointestinal tissues in mammals
having Crohn's disease.
[0009] The methods and materials provided herein also can be used
to treat (e.g., reduce the severity of symptoms) neural conditions
(e.g., schizophrenia, chronic pain, mania, depression, psychosis,
paranoia, autism, stress, Alzheimer's disease, or Parkinson's
disease), immune conditions (e.g., pro-inflammatory diseases,
autoimmune disorders, histolytic medullary reticulosis, lupus, or
arthritis), vascular conditions (e.g., atherosclerosis or neuronal
vasculopathy), gastrointestinal conditions (e.g., colitis, Crohn's
disease, or irritable bowel syndrome), or addiction (e.g., opiate
addiction). For example, morphine or a morphine precursor such as
reticuline, norlaudanosoline, L-DOPA, or codeine can be used to
treat neural conditions such as neurovascular alterations involving
hypothalamic hormone secretion (e.g., reproductive and growth
hormones).
[0010] As disclosed herein, prolonged treatment with a low dose of
morphine can result the continued positive effects of morphine such
as nitric oxide release, without the need to escalate morphine
dosages with time to achieve the same beneficial effects. In
addition, the use of low doses of morphine can allow patients to
experience the beneficial effects of morphine, while not
experiencing possible negative effects of morphine (e.g., addiction
or powerful analgesia). Likewise, treating patients with a morphine
precursor such as reticuline can allow patients to experience the
beneficial effects of morphine, while not experiencing possible
negative effects of morphine (e.g., addiction or powerful
analgesia). For example, using a morphine precursor such as
reticuline can allow patients to receive a low dose of morphine
indirectly with a reduced risk of overdosing.
[0011] In general, one aspect of this document features a method
for inducing nitric oxide release from cells in a mammal. The
method comprises, or consists essentially of, administering, to the
mammal, a composition in an amount, at a frequency more frequent
than once a week, and for a duration longer than one month, wherein
the composition comprises, or consists essentially of, morphine or
morphine-6.beta.-glucuronide, and wherein the amount of the
composition results in less than 0.05 mg of the morphine or
morphine-6.beta.-glucuronide being administered to the mammal per
kg of body weight of the mammal per day. The cells can be immune
cells. The mammal can be a human. The composition can contain a
morphine precursor. The composition can be in the form of a tablet.
The composition can contain selenium. The composition can contain
arginine (e.g., L-arginine). The composition can contain a calcium
source. The amount of the composition can result in less than 0.025
mg of the morphine or morphine-6.beta.-glucuronide being
administered to the mammal per kg of body weight of the mammal per
day. The e amount of the composition can result in less than 0.01
mg of the morphine or morphine-6.beta.-glucuronide being
administered to the mammal per kg of body weight of the mammal per
day. The frequency can be more frequent than four times a week. The
frequency can be between two and five times a day. The frequency
can be once a day. The duration can be longer than two months. The
duration can be longer than three months. The composition can
contain morphine. The composition can contain
morphine-6.beta.-glucuronide. The composition can contain morphine
and morphine-6.beta.-glucuronide.
[0012] In another embodiment, this document features a method for
inducing nitric oxide release from cells in a mammal. The method
comprises, or consists essentially of, administering, to the
mammal, a composition in an amount, at a frequency more frequent
than once a week, and for a duration longer than one month, wherein
the composition comprises thebaine or codeine, and wherein the
amount of the composition results in less than 0.05 mg of the
thebaine or codeine being administered to the mammal per kg of body
weight of the mammal per day. The cells can be immune cells. The
mammal can be a human. The composition can contain morphine in an
amount that results in less than 0.05 mg of the morphine being
administered to the mammal per kg of body weight of the mammal per
day. The composition can be in the form of a tablet. The
composition can contain selenium. The composition can contain
arginine (e.g., L-arginine). The composition can contain a calcium
source. The amount of the composition can result in less than 0.01
mg of the thebaine or codeine being administered to the mammal per
kg of body weight of the mammal per day. The amount of the
composition can result in less than 0.005 mg of the thebaine or
codeine being administered to the mammal per kg of body weight of
the mammal per day. The frequency can be more frequent than four
times a week. The frequency can be between two and five times a
day. The frequency can be once a day. The duration can be longer
than two months. The duration can be longer than three months. The
composition can contain thebaine. The composition can contain
codeine. The composition can contain thebaine and codeine.
[0013] In another embodiment, this document features a method for
inducing nitric oxide release from cells in a mammal. The method
comprises, or consists essentially of, administering, to the
mammal, a composition in an amount, at a frequency more frequent
than once a week, and for a duration longer than one month, wherein
the composition comprises one or more agents selected from the
group consisting of reticuline, norlaudanosoline, and salutaridine,
and wherein the amount of the composition results in less than 1 mg
of the one or more agents being administered to the mammal per kg
of body weight of the mammal per day. The cells can be immune
cells. The mammal can be a human. The composition can contain
morphine in an amount that results in less than 0.05 mg of the
morphine being administered to the mammal per kg of body weight of
the mammal per day. The composition can be in the form of a tablet.
The composition can contain selenium. The composition can contain
arginine (e.g., L-arginine). The composition can contain a calcium
source. The amount of the composition can result in less than 0.5
mg of the one or more agents being administered to the mammal per
kg of body weight of the mammal per day. The amount of the
composition can result in less than 0.05 mg of the one or more
agents being administered to the mammal per kg of body weight of
the mammal per day. The frequency can be more frequent than four
times a week. The frequency can be between two and five times a
day. The frequency can be once a day. The duration can be longer
than two months. The duration can be longer than three months. The
composition can contain reticuline, norlaudanosoline, and
salutaridine.
[0014] In another embodiment, this document features a method for
inducing nitric oxide release from cells in a mammal. The method
comprises, or consists essentially of, administering, to the
mammal, a composition in an amount, at a frequency more frequent
than once a week, and for a duration longer than one month, wherein
the composition comprises dopamine or L-DOPA, and wherein the
amount of the composition results in less than 1 .mu.g of the
dopamine or L-DOPA being administered to the mammal per kg of body
weight of the mammal per day. The cells can be immune cells. The
mammal can be a human. The composition can contain morphine in an
amount that results in less than 0.05 mg of the morphine being
administered to the mammal per kg of body weight of the mammal per
day. The composition can be in the form of a tablet. The
composition can contain selenium. The composition can contain
arginine (e.g., L-arginine). The composition can contain a calcium
source. The amount of the composition can result in less than 0.5
mg of the one or more agents being administered to the mammal per
kg of body weight of the mammal per day. The amount of the
composition can result in less than 0.05 mg of the one or more
agents being administered to the mammal per kg of body weight of
the mammal per day. The frequency can be more frequent than four
times a week. The frequency can be between two and five times a
day. The frequency can be once a day. The duration can be longer
than two months. The duration can be longer than three months. The
composition can contain reticuline, norlaudanosoline, and
salutaridine.
[0015] In another aspect, this document features a composition
comprising, or consisting essentially of, morphine and selenium.
The composition can contain between 35 .mu.g and 700 .mu.g of
morphine. The composition can contain between 55 .mu.g and 300
.mu.g of selenium. The composition can contain arginine (e.g.,
L-arginine). The composition comprises between 1 mg and 500 mg of
arginine. The composition can contain a calcium source. The
composition can contain between 250 .mu.g and 1.5 g (e.g., between
1 g and 1.3 g) of the calcium source. The calcium source can be
calcium citrate. The composition can contain one or more agents
selected from the group consisting of tyrosine, tyramine,
phenylalanine, 3,4 dihydroxyphenyl pyruvate, dihydroxyphenyl
acetaldehyde, dopamine, L-DOPA, reticuline, norlaudanosoline,
salutaridine, thebaine, and codeine. The composition can contain
one or more agents selected from the group consisting of CYP2D6 and
CYP2D7 inhibitors.
[0016] In another embodiment, this document features a composition
comprising, or consisting essentially of, morphine and arginine
(e.g., L-arginine). The composition can contain between 35 .mu.g
and 700 .mu.g of morphine. The composition can contain between 1 mg
and 500 mg of arginine. The composition can contain a calcium
source. The composition can contain between 250 .mu.g and 1.5 g
(e.g., between 1 g and 1.3 g) of the calcium source. The calcium
source can be calcium citrate. The composition can contain one or
more agents selected from the group consisting of tyrosine,
tyramine, phenylalanine, 3,4 dihydroxyphenyl pyruvate,
dihydroxyphenyl acetaldehyde, dopamine, L-DOPA, reticuline,
norlaudanosoline, salutaridine, thebaine, and codeine. The
composition can contain one or more agents selected from the group
consisting of CYP2D6 and CYP2D7 inhibitors.
[0017] In another embodiment, this document features a composition
for reducing the level of morphine produced in cells, wherein the
composition comprises, or consists essentially of, L-DOPA and
dopamine. The composition can contain between 25 mg and 500 mg
(e.g., 250 mg) of L-DOPA. The composition can contain between 25 mg
and 500 mg (e.g., 250 mg) of dopamine. The composition can contain
an equal amount of L-DOPA and dopamine.
[0018] In another aspect, this document features a method for
increasing production of morphine in a mammal. The method
comprises, or consists essentially of, administering a composition
to the mammal under conditions effective to increase the amount of
morphine produced by cells within the mammal, wherein the
composition comprises one or more agents selected from the group
consisting of reticuline, norlaudanlosoline, salutaridine,
thebaine, and codeine. The cells can be immune cells. The mammal
can be a human. The composition can contain morphine. The
composition can be in the form of a tablet. The composition can
contain selenium. The composition can contain arginine (e.g.,
L-arginine). The composition can contain a calcium source. The
method can include, prior to the administering step, identifying
the mammal as needing an increase in morphine. The method can
include, after the administering step, monitoring the mammal to
confirm an increase in morphine. The method can include
administering the composition to the mammal at a frequency more
frequent than once a month. The method can include administering
the composition to the mammal at a frequency more frequent than
once a week. The method can include administering the composition
to the mammal at a frequency between once and five times a day. The
method can include administering the composition to the mammal at a
frequency more frequent than once a week and for a duration longer
than one month. The duration can be longer than three months.
[0019] In another embodiment, this document features a method for
treating a mammal having a condition selected from the group
consisting of schizophrenia, mania, depression, psychosis, chronic
pain, paranoia, autism, stress, Alzheimer's disease, Parkinson's
disease, pro-inflammatory diseases, autoimmune disorders,
histolytic medullary reticulosis, lupus, arthritis,
atherosclerosis, neuronal vasculopathy, gastrointestinal
conditions, and addiction. The method comprises, or consists
essentially of, administering a composition to the mammal under
conditions wherein the severity of a symptom of the condition is
reduced, wherein the composition comprises one or more agents
selected from the group consisting of reticuline, norlaudanosoline,
salutaridine, thebaine, and codeine. The method can include, prior
to the administering step, identifying the mammal as having the
condition. The method can include, after the administering step,
monitoring the mammal to confirm an reduction is the severity. The
mammal can be a human. The composition can be administered orally.
The composition can be administered to the mammal in an amount such
that the mammal receives between about 1 and 5 mg of at least one
of the one or more agents per kg body weight of the mammal. The
composition can be administered to the mammal at a frequency more
frequent than once a month. The composition can be administered to
the mammal at a frequency between once and 5 times a day or
week.
[0020] In another embodiment, this document features a method for
treating a mammal having a condition selected from the group
consisting of schizophrenia, mania, depression, psychosis, chronic
pain, paranoia, autism, stress, Alzheimer's disease, Parkinson's
disease, pro-inflammatory diseases, autoimmune disorders,
histolytic medullary reticulosis, lupus, arthritis,
atherosclerosis, neuronal vasculopathy, gastrointestinal
conditions, and addiction. The method comprises, or consists
essentially of, administering, to the mammal, a composition in an
amount, at a frequency more frequent than once a week, and for a
duration longer than one month, wherein the composition comprises
morphine or morphine-6.beta.-glucuronide, and wherein the amount of
the composition results in less than 0.05 mg of the morphine or
morphine-6.beta.-glucuronide being administered to the mammal per
kg of body weight of the mammal per day. The method can include,
prior to the administering step, identifying the mammal as having
the condition. The severity of a symptom of the condition can be
reduced at a time point at least one month following an initial
administration of the composition. The method can include, after
the administering step, evaluating the mammal to confirm a
reduction in the severity of a symptom of the condition. The mammal
can be a human. The composition can be administered orally. The
composition can be administered to the mammal at a frequency more
frequent than once a week. The composition can be administered to
the mammal at a frequency between once and 5 times a day or week.
The composition can contain morphine. The composition can contain
morphine-6.beta.-glucuronide. The composition can contain morphine
and morphine-6.beta.-glucuronide.
[0021] In another aspect, this document features a dietary
supplement comprising, or consisting essentially of, selenium,
morphine, and arginine (e.g., L-arginine). The composition can
contain any of the additional components described herein such as a
morphine precursor or a calcium source.
[0022] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present invention, suitable methods and materials are described
below. All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
[0023] Other features and advantages of the invention will be
apparent from the following detailed description, and from the
claims.
DESCRIPTION OF DRAWINGS
[0024] FIG. 1 is an HPLC chromatogram of ganglia extraction. The
top chromatogram of ganglia incubated with 0.5 .mu.g of reticuline
for 1 hour demonstrates a level of 5 ng/mg morphine tissue wet
weight. The middle chromatogram is for control ganglia. The bottom
chromatogram is for a morphine standard (15 ng).
[0025] FIG. 2 is a graph plotting morphine levels for the amount of
reticuline incubated with Mytilus edulis ganglia. Ganglia were
incubated with 1.0, 10, 50, or 100 ng (per ganglion) of reticuline
for 60 minutes. Morphine concentrations were obtained by RIA. One
Way ANOVA analysis demonstrated that the morphine levels in
ganglion incubated with reticuline were significantly higher than
control at 50 and 100 ng of reticuline. One ganglion weighs about
1.7 mg.
[0026] FIG. 3 is a graph plotting morphine levels versus the time
Mytilus edulis ganglia were incubated with reticuline (50
ng/ganglion). The results of morphine concentration were obtained
by RIA. One Way ANOVA analysis demonstrated that the morphine level
in ganglia incubated with reticuline was significantly higher than
control at 60 minutes.
[0027] FIG. 4 is a graph plotting NO release versus time for
ganglia treated with reticuline (10.sup.-7 M) alone, morphine
(10.sup.-6 M) alone, or naloxone (10.sup.-6 M) plus reticuline
(10.sup.-7 M).
[0028] FIG. 5 is a graph plotting morphine levels detected for
Mytilus edulis pedal ganglia treated in vitro with 1.0, 10, 50, or
100 ng of L-dopa or reticuline for 60 minutes. Vehicle treated
ganglia morphine levels before and after the incubation with the
respective precursors was determined (2.1.+-.0.44 and 2.3.+-.0.31
ng/ganglia, respectively). One Way ANOVA analysis revealed that the
morphine levels in ganglion incubated with reticuline (50 and 100
ng) or L-DOPA (50 and 100 ng) were significantly higher than those
measured in control ganglion (P<0.01 for 50 ng amounts, and
P<0.001 for 100 ng amounts). One ganglion weighs about 1.7 mg.
All determinations were replicated four times, and the mean .+-.SEM
is presented.
[0029] FIG. 6 is a graph plotting morphine levels versus the time
Mytilus edulis ganglia were incubated with reticuline or L-DOPA (1
.mu.g/10 ganglia). One Way ANOVA analysis revealed that the
ganglionic morphine levels in ganglia incubated with the morphine
precursors were significantly higher than control at 30 and 60
minutes (P<0.01). All determinations were replicated four times,
and the mean graphed .+-.SEM.
[0030] FIG. 7 is a bar graph plotting the level of morphine
(ng/ganglion) in animals one hour after receiving an injection of
reticuline or L-DOPA (1 .mu.g/animal) into the base of Mytilus
foot. Morphine levels were significantly increased compared to
control levels (P<0.01; One Way ANOVA analysis). All
determinations were replicated four times, and the mean .+-.SEM is
presented.
[0031] FIG. 8 is a graph plotting morphine levels detected for
Mytilus edulis pedal ganglia treated in vitro with 1.0, 10, 50, or
100 ng of norlaudanosoline for 60 minutes. One Way ANOVA analysis
revealed that the morphine levels in ganglion incubated with
norlaudanosoline were significantly higher than control at 50 and
100 ng of norlaudanosoline. All determinations were replicated four
times, and the mean graphed .+-.SEM.
[0032] FIG. 9 is a graph plotting morphine levels versus the time
Mytilus edulis ganglia were incubated with norlaudanosoline (100
ng/ganglia). One Way ANOVA analysis revealed that the morphine
levels in ganglia incubated with norlaudanosoline were
significantly higher than controls at 30 and 60 minutes
(P<0.01). All determinations were replicated four times, and the
mean graphed .+-.SEM.
[0033] FIG. 10 is a Q-TOF analysis of authentic morphine extracted
from HPLC fractions (inset). WBC morphine exhibited the same MS as
authentic material.
[0034] FIG. 11A is a graph plotting the amount of morphine produced
from human WBC obtained from a Buffy coat and incubated with the
indicated amount of tyramine for one hour (P<0.001, One Way
ANOVA at the 10.sup.-7 to 10.sup.-6 M concentrations). FIG. 11B
contains bar graphs plotting the amount of morphine produced from
human WBC obtained from a Buffy coat and incubated with the
indicated amount of norlaudanosoline (THP), reticuline, or L-DOPA
for one hour (P<0.001, One Way ANOVA at the 10.sup.-7 to
10.sup.-6 M concentrations). Each experiment was repeated three
times, and the mean .+-.SEM is presented.
[0035] FIG. 12 is a graph plotting the amount of morphine produced
from human PMNs obtained from a Buffy coat and incubated with
tyramine (T; 10.sup.-6 M) and the indicated amount of bufuralol.
The tyramine-induced morphine levels were diminished significantly
with increasing concentrations of bufuralol (P<0.001, One Way
ANOVA). Each experiment was repeated three times, and the mean
.+-.SEM is presented.
[0036] FIG. 13 is a graph plotting the amount of morphine produced
from human PMNs obtained from a Buffy coat and incubated with
tyramine (T; 10.sup.-6 M), norlaudanosoline (THP; 10.sup.-7 M), or
codeine together with either quinidine (10.sup.-6 M) or paroxetine
(10.sup.-6 M). The tyramine- and THP-induced morphine levels were
diminished by treatment with quinidine (P<0.001, One Way ANOVA
compared to tyramine and THP stimulated morphine levels,
respectively). Each experiment was repeated five times, and the
mean .+-.SEM is presented.
[0037] FIG. 14 is a graph plotting the level of PMN activation for
cells treated as follows: 1, PMN activity level after 60 minutes of
no treatment; 2, PMNs incubated with IL-1.beta.; 3, PMNs incubated
with L-DOPA (10.sup.-6 M); 4, mixed culture with 50% L-DOPA exposed
cells and 50% IL-1.beta. exposed cells for one hour; 5, mixed
culture with 50% L-DOPA exposed cells and 50% IL-1.beta. exposed
cells for one hour (the IL-1.beta. exposed cells were exposed to
naloxone (10.sup.-6 M) five minutes before being added to the mixed
culture). Cells mixed without treatment from the two groups
exhibited only a 6% increase over that of their respective
controls. Each experiment was replicated four times, and the mean
.+-.SEM is presented.
[0038] FIG. 15 is a diagram of the biosynthetic pathways for
producing morphine and catecholamines.
[0039] FIG. 16A is a graph plotting morphine levels in Mytilus
edulis ganglia treated with the indicated amount of tyrosine or
tyramine for 60 minutes. At concentrations of 10.sup.-7 and
10.sup.-6 M, the mean values were statistically significant
(P<0.001) as compared to untreated ganglia. FIG. 16B is a graph
plotting morphine levels versus the time Mytilus edulis ganglia
were incubated with tyrosine or tyramine (10.sup.-6M). At 45- and
60-minute incubations, the mean values were statistically
significant (P<0.001) as compared to untreated ganglia. All
determinations were replicated three times, and the mean graphed
.+-.SEM.
[0040] FIG. 17 is a graph plotting the amount of morphine produced
from Mytilus edulis ganglia incubated with tyramine (T; 10.sup.-6
M) and the indicated amount of quinidine. The tyramine-induced
morphine levels were diminished significantly with increasing
concentrations of quinidine (P<0.001, One Way ANOVA). Each
experiment was repeated five times, and the mean .+-.SEM is
presented.
[0041] FIG. 18 is a graph plotting the amount of morphine produced
from Mytilus edulis ganglia incubated with tyrosine (T; 10.sup.-6
M) and the indicated amount of alpha-methyl-para-tyrosine (AMPT).
The tyrosine-induced morphine levels were diminished significantly
with increasing concentrations of AMPT (P<0.001, One Way ANOVA).
Each experiment was repeated four times, and the mean .+-.SEM is
presented.
[0042] FIG. 19 contains representative HPLC chromatograms
demonstrating ganglionic and hemolymph dopamine (DA) levels can be
modulated by tyramine and quinidine (10.sup.-6 M) exposure.
Ganglia, Panel A: Tyramine injection (100 .mu.g/animal, under foot)
resulted in 9.17.+-.1.21 .mu.g of DA/g. Ganglia, Panel B: Tyramine
and quinidine injections (100 .mu.g/animal) resulted in
2.57.+-.0.32 .mu.g of DA/g. Ganglia, Panel C: PBS injection
resulted in 4.78.+-.0.27 .mu.g of DA/g. Hemolymph, Panel A: PBS
incubation resulted in 10.13.+-.0.34 .mu.g of DA/mL. Hemolymph,
Panel B: Tyramine (100 .mu.g/in L) and quinidine (10 .mu.g/mL)
exposure to pedal ganglia resulted in 10.24 .mu.g of DA/mL.
Hemolymph, Panel C: Tyramine (100 .mu.g/mL) incubation resulted in
16.47.+-.2.28 .mu.g of DA/mL.
[0043] FIG. 20A is a graph plotting the level of DA detected in
ganglia or hemolymph from untreated animals or animals treated with
tyramine (10.sup.-6 M) or tyramine (10.sup.-6 M) plus quinidine
(10.sup.-6 M). Quinidine blocked the increase in endogenous
ganglionic and hemolymph DA levels caused by the exposure of the
pedal ganglia to tyramine alone (P<0.001). FIG. 20B is a graph
plotting the level of morphine detected in ganglia from untreated
animals or animals treated with codiene (10.sup.-6 M) or codiene
plus quinidine (10.sup.-6 M). Quinidine blocked the increase in
endogenous ganglionic morphine levels stimulated by codeine
exposure (T-test, P<0.001). FIG. 20C is a graph plotting the
level of morphine detected in ganglia from untreated animals or
animals treated with norlaudanosoline (THP; 10.sup.-6 M),
reticuline (10.sup.-6 M), or DA (10-.sup.6 M) alone or in
combination with quinidine (10.sup.-6 M). Quinidine blocked the
increase in endogenous ganglionic morphine levels stimulated by
norlaudanosoline, reticuline, or DA exposure (T-test,
P<0.001).
[0044] FIG. 21 is a sequence alignment of a partial sequence of
nucleic acid amplified from Mytilus tissue (bottom strand; SEQ ID
NO:1) aligned with nucleotide position 843 to position 1107 of the
sequence set forth in GenBank accession number M20403 (top strand;
SEQ ID NO:2). The bold letters represent mismatches, n's, and
gaps.
[0045] FIG. 22 is a graph plotting the amount of morphine in
Mytilus edulis pedal ganglia following injection of tyrosine (T;
10.sup.-5 M) or tyramine (Ty; 10.sup.-5 M) into the foot of
healthy, untreated animals or healthy animals having had their
pedal ganglia exposed to AMPT (10.sup.-4 M) or quinidine (10.sup.-4
M) 15 minutes post injection.
[0046] FIG. 23 is a graph plotting the percent of LPS-activated
cells from animals pre-treated once with or without the indicated
amount of morphine.
[0047] FIG. 24 is a graph plotting the percent of LPS-activated
cells from animals pre-treated daily for 4 days with or without the
indicated amount of morphine.
[0048] FIG. 25 is a graph plotting the death rate of
TNF-.alpha.-treated animals pre-treated daily for 4 days with or
without morphine (10.sup.-7 M).
[0049] FIG. 26 is a graph plotting the median of channel
fluorescence of blood samples pre-incubated with 50 nM (solid line)
or 50 .mu.M (dashed line) of morphine for the indicated times prior
to LPS stimulation. Statistical analysis revealed a significant
effect of morphine on NF-.kappa.B nuclear binding at any time
interval when compared with LPS stimulation alone (O-min
morphine).
[0050] FIG. 27 is a graph plotting mu3 opiate receptor activity per
gram of membrane protein (Bmax pg/g of membrane tissue) on the
indicated day for animals treated with saline (control), 1 .mu.M
morphine, or 0.01 .mu.M morphine.
[0051] FIG. 28 is a graph plotting nitric oxide release from pedal
ganglia on the indicated day for animals treated with saline
(control), 10.sup.-6 M morphine, or 10.sup.-8 M morphine.
[0052] FIG. 29 is a graph plotting nitric oxide release from
SH-SY5Y cells treated with 10.sup.-6 M morphine (grey bar),
10.sup.-6 M morphine (black bar), or 10.sup.-8 M morphine (white
bar).
[0053] FIG. 30 contains graphs plotting nitric oxide release from
untreated SH-SY5Y cells challenged with 10.sup.-6 M morphine (grey
bar) prior to measuring nitric oxide release or from SH-SY5Y cells
treated with 10.sup.-6 M morphine (black bar) or 10.sup.-8 M
morphine (white bar). The results in the top, middle, and bottom
panels were for cells treated as indicated for one, two, or seven
days, respectively.
[0054] FIG. 31 is a graph plotting the relative mu3 opiate receptor
gene expression in mononuclear cells (MN) and polymorphonuclear
cells (PMN) treated with 10.sup.-7 M morphine-6-glucuronide alone
or 10.sup.-7 M morphine-6-glucuronide and 10.sup.-6 M CTOP.
[0055] FIG. 32 is a graph plotting band intensities for BACE-1 gene
expression in HTB-11 neuroblastoma cells. Lane 1: untreated cells;
lane 2: 24-hour treatment with 1 .mu.M morphine; lane 3: 24-hour
treatment with 5 .mu.M morphine.
[0056] FIG. 33 is a graph plotting band intensities for BACE-2 gene
expression in HTB-11 neuroblastoma cells treated as follows for 24
hours. Lane 1: untreated; lane 2: 1 .mu.M morphine; lanes 3 and 4:
10 .mu.M and 25 .mu.M A.beta..sub.1-42; lanes 5 and 6: 1 .mu.M
morphine with 10 .mu.M and 25 .mu.M A.beta..sub.1-42.
[0057] FIG. 34 (top) is a graph plotting band intensities for
BACE-1 and BACE-2 gene expression in HTB-11 neuroblastoma cells
treated as follows for 24 hours. Lanes 1 and 4: untreated; lane 2
and 5: 1 .mu.M morphine; lane 3 and 6: 1 .mu.M morphine pre-treated
with 10 .mu.M naloxone for twenty minutes. Lanes 1-3 contain
products amplified with primers specific for BACE-1, while lanes
4-6 contain products amplified with primers specific for BACE-2.
FIG. 34 (bottom) is a graph plotting BACE expression levels
standardized against cyclophilin expression.
[0058] FIG. 35 (top) is a graph plotting band intensities for
BACE-1 and BACE-2 gene expression in HTB-11 neuroblastoma cells
treated as follows for 24 hours. Lanes 1 and 4: untreated; lane 2
and 5: 1 .mu.M morphine; lane 3 and 6: 1 .mu.M morphine pre-treated
with 10 .mu.M L-NAME for twenty minutes. Lanes 1-3 contain products
amplified with primers specific for BACE-1, while lanes 4-6 contain
products amplified with primers specific for BACE-2. FIG. 35
(bottom) is a graph plotting BACE expression levels standardized
against cyclophilin expression.
[0059] FIG. 36 is a graph plotting band intensities for BACE-11
gene expression in HTB-111 neuroblastoma cells treated as follows
for 4 hours. Lane 1: untreated; lane 2, 3, and 4: 1 .mu.M, 5 .mu.M,
and 10 .mu.M SNAP; lane 5: 25 .mu.M A.beta..sub.1-42 with 1 .mu.M
SNAP; lane 6: 25 .mu.M A.beta..sub.1-42 with 10 .mu.M SNAP.
[0060] FIG. 37 is a graph plotting band intensities for BACE-1 gene
expression in HTB-11 neuroblastoma cells treated as follows for 24
hours. Lane 1: untreated; lane 2, 3, and 4: 1 .mu.M, 5 .mu.M, and
10 .mu.M SNAP; lane 5: 25 .mu.M A.beta..sub.1-42 with 1 .mu.M SNAP;
lane 6: 25 .mu.M A.beta..sub.1-42 with 10 .mu.M SNAP.
[0061] FIG. 38 is a graph plotting band intensities for BACE-2 gene
expression in HTB-11 neuroblastoma cells treated as follows for 4
hours. Lane 1: untreated; lane 2, 3, and 4: 1 .mu.M, 5 .mu.M, and
10 .mu.M SNAP; lane 5: 25 .mu.M A.beta..sub.1-42 with 1 .mu.M SNAP;
lane 6: 25 .mu.M A.beta..sub.1-42 with 10 .mu.M SNAP.
[0062] FIG. 39 is a graph plotting band intensities for BACE-2 gene
expression in HTB-11 neuroblastoma cells treated as follows for 24
hours. Lane 1: untreated; lane 2, 3, and 4: 1 .mu.M, 5 .mu.M, and
10 .mu.M SNAP; lane 5: 25 .mu.M A.beta..sub.1-42 with 1 .mu.M SNAP;
lane 6: 25 .mu.M A.beta..sub.1-42 with 10 .mu.M SNAP.
[0063] FIG. 40 is a graph plotting band intensities for BACE-1 and
BACE-2 gene expression in HTB-11 neuroblastoma cells treated as
follows for 2 hours. Lanes 1 and 4: untreated; lane 2 and 5: 1
.mu.M SNAP; lane 3 and 6: 5 .mu.M SNAP. Lanes 1-3 contain products
amplified with primers specific for BACE-1, while lanes 4-6 contain
products amplified with primers specific for BACE-2. FIG. 40
(bottom) is a graph plotting BACE expression levels standardized
against .beta.-actin expression.
[0064] FIG. 41 contains graphs plotting real-time NO release from
SH-SY5Y neuroblastoma cells pre-treated for 1 hour with the
following amounts of A.beta..sub.1-42 and then stimulated using 1
.mu.M M6G at t=0. Panel A: control, 0 A.beta..sub.1-42; Panel B:
1.mu. A.beta..sub.1-42; Panel C: 5 .mu.M A.beta..sub.1-42; Panel D:
10 .mu.M A.beta..sub.1-42; Panel E: 15 .mu.M A.beta..sub.1-42;
Panel F: 25 mM A.beta..sub.1-42; Panel G: control with L-NAME added
4 minutes before M6G.
[0065] FIG. 42 is a diagram of the possible role of NO in
Alzheimer's disease.
[0066] FIG. 43A is a graph plotting NO release from human
neuroblastoma cells treated with morphine sulfate (5 .mu.M) versus
time. FIG. 43B is a bar graph plotting the peak NO release for
human neuroblastoma cells treated with morphine sulfate (5 .mu.M)
or PBS. The control is the peak value of NO release from cells
prior to adding morphine (i.e., basal NO release). The peak value
is 22.3 nM.+-.0.85 (p<0.001 when compared to control).
[0067] FIG. 44A is a graph plotting percent cell viability for
cells receiving the indicated treatment and either 0, 15, 30, 40,
50, or 70 .mu.M of rotenone for 48 hours. FIG. 44B is a bar graph
plotting cell viability for cells treated as indicated. FIG. 44C is
a graph plotting the average form factor measurement for cells
treated as indicated. Photographs 1-6 of FIG. 44 are pictures of
cells corresponding to the treatments indicated in FIG. 44C.
[0068] FIG. 45A is a graph plotting NR1 expression levels, while
FIG. 45B is a graph plotting NR2B expression levels for the
following treatments: treatment #1: control; treatment #2: morphine
(5 .mu.M); treatment #3: rotenone (30 nM, LD.sub.50); treatment #4:
rotenone (40 nM); treatment #5: morphine+rotenone (30 nM); and
treatment #6: morphine+rotenone (40 nM). Rotenone treatment caused
a dose dependent decrease in NR1 expression (p<0.003, both 3 and
4 compared to 1). Morphine increased NR1 expression at LD.sub.50
(P<0.035, 5 compared to 3). Rotenone caused a dose dependent
increase in NR2B expression (p<0.001, 3 compared to 1). Morphine
decreased NR2B expression and counteracted the effects of rotenone
in a dose dependent manner (p<0.042, 5 compared to 3, and
p<0.018, 6 compared to 4, respectively).
[0069] FIG. 46 is a graph plotting proteasomal catalytic X subunit
expression levels in cells treated as indicated for 4 or 24 hours.
Morphine increased the level of expression of the X subunit in a
dose dependent manner. The 5 .mu.M morphine treatment in the
presence of rotenone significantly decreases the expression of the
X subunit and was significant when compared to rotenone alone,
p<0.014 at 4 hours, and p<0.009 at 24 hours. Rotenone also
increased the level of X subunit expression (p<0.006 at 4 hours)
and (p<0.033 at 24 hours). Neuroprotection was observed with the
dose dependent decrease in the level of proteasomal catalytic X
subunit expression being significant at 5 .mu.M of morphine when
compared to treatments with rotenone alone (p<0.01 at 4 hours
and p<0.012 at 24 hours). The values obtained with 5 .mu.M of
morphine plus 30 nM rotenone were not statistically different from
control values.
[0070] FIG. 47 is a graph plotting mRNA expression of the LMP7
immunoproteasome subunit in cells treated as indicated for 24
hours. Although rotenone did not cause significant increase in
expression (p<0.068), there was a significant, dose dependent
decrease in LMP7 expression with morphine administration when
rotenone values were compared to morphine+rotenone values:
p<0.026 with 1 .mu.M morphine and p<0.018 with 5 .mu.M
morphine.
[0071] FIG. 48 contains photographs of Western blots and graphs
plotting the expression levels of 20S proteasome X subunit
polypeptides in cells treated as indicated. Morphine induced a
significant dose dependent increase in expression of X subunit
after 24 hours of treatment, p<0.01 (1 .mu.M morphine compared
to control) and p<0.001 (5 .mu.M morphine compared to control).
Significant neuroprotection was observed with 5 .mu.M morphine when
compared to rotenone control (p<0.028). Furthermore, this
treatment, 5 .mu.M morphine+30 nM rotenone, was not statistically
different from the control (p<0.065).
[0072] FIG. 49A is a graph plotting 26s chymotrypsin activity,
while FIG. 49B is a graph plotting 20S proteasome activity. Cells
were treated with or without morphine (5 .mu.M), rotenone (30 nM),
naloxone (10 .mu.M), and L-NAME (10 .mu.M). A significant decrease
in chymotrypsin 26S activity was caused by rotenone (p<0.043). A
significant increase in chymotrypsin activity was caused by
morphine (5 .mu.M) (p<0.021). Concomitant treatment of morphine
and rotenone resulted in a restoring of chymotrypsin activity to
the point where it was statistically insignificant to the control.
Significant increase in activity of the 20S proteasome upon
exposure to rotenone was observed (p<0.046). Coupled with the
morphine induced decrease in 20S proteasomal function (p<0.050),
there was a significant decrease in 20S activity (p<0.034).
[0073] FIG. 50 is a graph plotting the level of free ubiquitin in
cells treated as indicated using Western blot analysis. A
significant dose dependent increase in the level of free ubiquitin
was observed with morphine treatment (p<0.001 with 5 .mu.M
morphine). A decrease was observed in the level of ubiquitin with
rotenone treatment (p<0.064), and this was reversed with the
administration of morphine (p<0.039 when compared to rotenone
treatment).
[0074] FIG. 51 is a graph plotting the level of LMP7 mRNA
expression in cells treated as indicated. IFN.gamma. (20 ng/mL)
caused in increase in expression of the LMP7 immunoproteasome
subunit (p<0.001). Concomitant morphine administration with
IFN.gamma. produced significant neuroprotection (p<0.034).
[0075] FIG. 52 is a graph plotting the level of LMP7 polypeptide
expression in cells treated as indicated. IFN.gamma. caused an
increase in LMP7 polypeptide expression (p<0.001). Morphine was
able to counteract this effect in concomitant treatment with
IFN.gamma. (p<0.001 compared to IFN.gamma. at both 36 hours and
48 hours).
DETAILED DESCRIPTION
[0076] This document provides methods and materials related to
using morphine, morphine precursors (e.g., tyrosine, tyramine,
phenyl alanine, 3,4 dihydroxyphenyl pyruvate, dihydroxyphenyl
acetaldehyde, dopamine, L-DOPA, reticuline, norlaudanosoline,
salutaridine, thebaine, or codeine), morphine-6.beta.-glucuronide,
inhibitors of morphine synthesis or activity, and inhibitors of
dopamine synthesis to treat diseases, to reduce inflammation, or to
restore normal function. For example, this document provides
compositions containing morphine, morphine precursors,
morphine-6.beta.-glucuronide, inhibitors of morphine synthesis,
inhibitors of morphine activity, inhibitors of dopamine synthesis,
or combinations thereof. This document also provides methods for
using such compositions.
[0077] This document provides compositions containing morphine,
morphine precursors, morphine-6.beta.-glucuronide, or combinations
thereof. Morphine or morphine-6.beta.-glucuronide can be formulated
into compositions designed to deliver a low dose of morphine or
morphine-6.beta.-glucuronide to a mammal. Typically, a low dose of
morphine is a dose that is below that which is given to relieve a
mammal of pain. For example, a low dose of morphine can be between
0.5 and 10 .mu.g (e.g., between 1 and 9 .mu.g, between 1 and 8
.mu.g, between 1 and 7 .mu.g, between 1 and 6 .mu.g, between 1 and
5 .mu.g, between 2 and 10 .mu.g, between 3 and 10 .mu.g, between 4
and 10 .mu.g, or between 5 and 10 .mu.g) per kg of body weight per
day. A low level of morphine-6.beta.-glucuronide can be similar to
those of morphine. For example, a low dose of
morphine-6.beta.-glucuronide can be between 1 and 10 .mu.g (e.g.,
between 1 and 9 .mu.g, between 1 and 8 .mu.g, between 1 and 7
.mu.g, between 1 and 6 .mu.g, between 1 and 5 .mu.g, between 2 and
10 .mu.g, between 3 and 10 .mu.g, between 4 and 10 .mu.g, or
between 5 and 10 .mu.g) per kg of body weight per day. In some
cases, morphine or morphine-6.beta.-glucuronide can be formulated
to deliver between 35 and 700 .mu.g of morphine or
morphine-6.beta.-glucuronide for a 70 kg individual. In some cases,
a low dose can be any amount that is high enough to cause cells
within the mammal to release nitric oxide yet low enough to not
cause the mammal to experience analgesia. Such a dose can be,
without limitation, about 5 .mu.g per kg of body weight per
day.
[0078] When given orally, morphine or morphine-6.beta.-glucuronide
can be formulated into a pill or tablet that contains between 10
and 1000 .mu.g (e.g., between 10 and 900 .mu.g, between 10 and 800
.mu.g, between 10 and 700 .mu.g, between 10 and 600 .mu.g, between
10 and 500 .mu.g, between 30 and 1000 .mu.g, between 35 and 1000
.mu.g, between 40 and 1000 .mu.g, between 50 and 1000 .mu.g,
between 35 to 700 .mu.g, or between 35 and 500 .mu.g) of morphine
or morphine-6.beta.-glucuronide. For example, a tablet can be
designed to contain 100 .mu.g of morphine. In these cases, a mammal
weighing about 70 kg can be instructed to take between one and
three pills or tablets per day. Mammals weighing more or less than
70 kg can be instructed to take the appropriate number of pills or
tablets to achieve a similar final concentration. The term
"morphine" as used herein includes dihydromorphine, morphine
sulfate, morphine hydrochloride, and morphine acetate.
[0079] The compositions provided herein can contain one or more
than one (e.g., two, three, four, five, or more) morphine
precursors without containing morphine or
morphine-6.beta.-glucuronide. Examples of morphine precursors
include, without limitation, tyrosine, tyramine, dopamine, L-DOPA,
3,4 dihydroxyphenyl pyruvate, dihydroxyphenyl acetaldehyde,
phenylalanine, reticuline, norlaudanosoline, salutaridine,
thebaine, and codeine. As described herein, a composition can be
designed to contain tyrosine, tyramine, dopamine, L-DOPA, 3,4
dihydroxyphenyl pyruvate, dihydroxyphenyl acetaldehyde,
phenylalanine, reticuline, norlaudanosoline, salutaridine,
thebaine, codeine, or combinations thereof. Such compositions can
contain any amount of the morphine precursors such as an amount
between 1 and 10 mg per person weighing about 70 kg. For example, a
composition can contain between 1 and 10 mg of reticuline.
[0080] The compositions provided herein can contain one or more
(e.g., two, three, four, five, or more) morphine precursors in
addition to morphine or morphine-6.beta.-glucuronide or in addition
to a combination of morphine and morphine-6.beta.-glucuronide. In
some cases, a composition can contain morphine and reticuline.
Compositions containing morphine and a morphine precursor as well
as compositions containing morphine-6.beta.-glucuronide and a
morphine precursor can contain any amount of the morphine precursor
such as between 0.1 and 100 mg (e.g., between 0.1 and 90 mg,
between 0.1 and 75 mg, between 0.1 and 50 mg, between 0.1 and 25
mg, between 0.1 and 10 mg, between 0.5 and 100 mg, between 1 and
100 mg, between 1 and 50 mg, or between 1 and 10 mg) of the
morphine precursor. For example, a composition can contain between
10 and 100 mg of morphine, between 10 and 100 .mu.g of
morphine-6.beta.-glucuronide, and between 1 and 10 mg of
reticuline.
[0081] A composition (e.g., pill or tablet) designed to deliver a
low dose of morphine, designed to deliver a low dose of
morphine-6.beta.-glucuronide, designed to contain one or more
morphine precursors, or designed to contain any combination thereof
(e.g., both morphine and one or more morphine precursors) can be
formulated to contain additional components such as L-arginine,
selenium, and Ca.sup.++. L-arginine can be included to promote a
cell's ability to release nitric oxide in response to morphine via
nitric oxide synthesis from L-arginine metabolism. Selenium can be
added to enhance mu3 opiate receptor gene expression. Calcium
sources such as calcium citrate or CaCO.sub.3 can be added to help
facilitate the metabolism of L-arginine into nitric oxide via a
calcium-dependent constitutive nitric oxide synthase. To reduce
acid reflux problems in oral applications, CaCO.sub.3 can be used
as a calcium source. In some cases, a pill or tablet designed to
deliver a low dose of morphine can be formulated to contain 35 to
700 .mu.g morphine (e.g., 0.1 mg morphine), 1 mg to 500 mg
L-arginine (e.g., 300 mg L-arginine), 55 .mu.g to 200 .mu.g
selenium (e.g., 100 .mu.g selenium), and 1000 to 1300 mg Ca.sup.++
(e.g., 1000 mg Ca.sup.++). In some cases, a pill or tablet can be
formulated to contain 1 to 10 mg reticuline (e.g., 5 mg
reticuline), 1 mg to 500 mg L-arginine (e.g., 300 mg L-arginine),
55 .mu.g to 200 .mu.g selenium (e.g., 100 .mu.g selenium), and 1000
to 1300 mg Ca.sup.++ (e.g., 1000 mg Ca.sup.++). Other components
that can be included in a composition provided herein include,
without limitation, pharmaceutically acceptable aqueous vehicles,
pharmaceutically acceptable solid vehicles, steroids, antibacterial
agents, anti-inflammatory agents, iumiunosuppressants, dilators,
vaso-constrictors, anti-cholinergics, antihistamines, antioxidant,
and combinations thereof.
[0082] In some cases, a composition (e.g., pill or tablet) designed
to deliver a low dose of morphine, designed to deliver a low dose
of morphine-6:--glucuronide, designed to contain one or more
morphine precursors, or designed to contain any combination thereof
(e.g., both morphine and one or more morphine precursors) can be
formulated to contain one or more inhibitors of morphine synthesis
(e.g., a CYP2D6 or CYP2D7 inhibitor) or activity (e.g., naloxone),
one or more inhibitors of dopamine synthesis or activity, or
combinations thereof. Examples of CYP2D6 inhibitors include,
without limitation, amiodarone, chloroquine, cimetidine,
clomipramine, diphenhydramine, duloxetine, fluoxetine,
hydroxychloroquin, paroxetine, propafenone, propoxyphene, and
quinidine, terbinafine.
[0083] A pharmaceutically acceptable aqueous vehicle can be, for
example, any liquid solution that is capable of dissolving morphine
or a morphine precursor (e.g., reticuline) and is not toxic to the
particular individual receiving the composition. Examples of
pharmaceutically acceptable aqueous vehicles include, without
limitation, saline, water, and acetic acid. Typically,
pharmaceutically acceptable aqueous vehicles are sterile. A
pharmaceutically acceptable solid vehicle can be formulated such
that morphine or a morphine precursor is suitable for oral
administration. For example, capsules or tablets can contain
reticuline in enteric form. The dose supplied by each capsule or
tablet can vary since an effective amount can be reached by
administrating either one or multiple capsules or tablets. Any well
known pharmaceutically acceptable material such as gelatin and
cellulose derivatives can be used as a pharmaceutically acceptable
solid vehicle. In addition, a pharmaceutically acceptable solid
vehicle can be a solid carrier including, without limitation,
starch, sugar, or bentonite. Further, a tablet or pill formulation
of morphine or a morphine precursor can follow conventional
procedures that employ solid carriers, lubricants, and the
like.
[0084] Steroids can be any compound containing a
hydrocyclopentanophenanthrene ring structure. Examples of steroids
include, without limitation, prednisone, dexamethasone, and
hydrocortisone. An antibacterial agent can be any compound that is
active against bacteria, such as penicillin, erythromycin,
neomycin, gentamicin, and clindamycin. An anti-inflammatory agent
can be any compound that counteracts inflammation, such as
ibuprofen and salicylic acid. An immunosuppressant can be any
compound that suppresses or interferes with normal immune function,
such as cyclosporine. A dilator can be any compound that causes the
expansion of an orifice, such as albuterol. A vaso-constrictor can
be any compound that constricts or narrows blood vessels, such as
phenylephrine hydrochloride, cocaine, and epinephrine. An
anti-cholinergic can be any compound that blocks parasympathetic
nerve impulses, such as ipratropium bromide. An anti-histamine can
be any compound that opposes the action of histamine or its release
from cells (e.g., mast cells), such as terfenadine and
astemizole.
[0085] Any method can be used to obtain morphine,
morphine-6.beta.-glucuronide, morphine precursors, or any
additional component of a composition provided herein. In some
cases, the components of the compositions provided herein can be
obtained using common chemical extraction, isolation, or synthesis
techniques. For example, reticuline can be obtained as described
elsewhere (Brochmann-Hanssen and Nielsen, Tetrahedron Lett.,
18:1271-4 (1965) and U.S. Pat. No. 3,894,027). In some cases, the
components of the compositions provided herein can be obtained from
commercial vendors. For example, morphine,
morphine-6.beta.-glucuronide, codeine, norlaudanosoline, and
salutaridine can be ordered from Sigma, Inc.
[0086] Any method can be used to formulate a composition provided
herein. For example, common formulation mixing and preparation
techniques can be used to make a composition having the components
described herein. In addition, the compositions provided herein can
be in any form. For example, a composition provided herein can be
in the form of a solid, liquid, and/or aerosol including, without
limitation, powders, crystalline substances, gels, pastes,
ointments, salves, creams, solutions, suspensions, partial liquids,
sprays, nebulae, mists, atomized vapors, tinctures, pills,
capsules, tablets, and gelcaps. In some cases, the composition can
be a dietary supplement. In some embodiments, a composition
containing morphine, one or more morphine precursors, or a
combination thereof can be prepared for oral administration by
mixing the components with one or more of the following: a filler,
a binder, a disintegrator, a lubricant, and a coloring agent.
Lactose, corn starch, sucrose, glucose, sorbitol, crystalline
cellulose, silicon dioxide, or the like can be used as the filler.
Polyvinyl alcohol, polyvinyl ether, ethyl cellulose, methyl
cellulose, acacia, tragacanth, gelatin, shellac, hydroxypropyl
cellulose, hydroxypropylmethyl cellulose, calcium citrate, dextrin,
or pectin can be used as the binder. Magnesium stearate, talc,
polyethylene glycol, silica, or hardened plant oil can be used as
the lubricant. A pharmaceutically acceptable coloring agent can be
used as the coloring agent. Cocoa powder, mentha water, aromatic
acid, mentha oil, borneol, or powdered cinnamon bark also can be
added. In some cases, a composition containing morphine, one or
more morphine precursors, or a combination thereof can be prepared
for injection by mixing the components with one or more of the
following: a pH adjusting agent, a buffer, a stabilizer, and a
solubilizing agent.
[0087] The compositions provided herein can be administered to any
mammal (e.g., rat, mouse, dog, cat, horse, cow, goat, pig, monkey,
or human). In addition, any route of administration (e.g., oral or
parenteral administration) can be used to administer a composition
provided herein to a mammal. For example, a composition containing
morphine or reticuline can be administered orally or parenterally
(e.g., a subcutaneous, intramuscular, intraorbital, intracapsular,
intraspinal, intrasternal, or intravenous injection).
[0088] While not being limited to any particular mode of action,
the compositions provided herein can be used to increase or
maintain a basal level of nitric oxide release by cells (e.g.,
cells expressing mu3 opiate receptors). The administration of
morphine precursors such as reticuline to a mammal can lead to the
conversion of the morphine precursor into morphine. The morphine
produced from the morphine precursor or the morphine provided
directly by a composition containing morphine or the
morphine-6.beta.-glucuronide provided directly by a composition
containing morphine-6.beta.-glucuronide can activate mu3 opiate
receptors, which are coupled to nitric oxide release, and can down
regulate the activated state of tissues within the mammal making
them less excitable. For example, administering morphine or
reticuline can limit undesired excitation and restore basal
activity levels within a mammal. In addition, certain mammals may
not produce enough endogenous morphine to fulfill the needs of
processes normally using this material to down regulate their
excitatory state (e.g., a run-away pro-inflammatory state, mental
disorders, vascular disorders). Administering a morphine precursor
such as reticuline can provide mammals with the morphine needed to
down regulate excitatory states without administering a controlled
substance. Administering morphine or morphine-6.beta.-glucuronide
directly at a low dose can provide mammals with the morphine needed
to down regulate excitatory states without triggering tolerance to
the administered morphine or morphine-6.beta.-glucuronide. For
example, as described herein, morphine can be administered
chronically (e.g., a long duration) at a low dose without observing
a reduction of morphine's effects (e.g., nitric oxide release) over
time. In addition, administering morphine-6.beta.-glucuronide can
provide mammals with nitric oxide release in the periphery as
opposed to the brain since morphine-6.beta.-glucuronide exhibits a
limited ability to cross the blood brain barrier.
[0089] The compositions provided herein can be administered to a
mammal in any amount, at any frequency, and for any duration.
Typically, a composition provided herein can be administered to a
mammal in an amount, at a frequency, and for a duration effective
to induce nitric oxide release in the mammal. In some cases, a
composition provided herein can be administered to a mammal in an
amount, at a frequency, and for a duration effective to reduce the
severity of a symptom of a disease or condition (e.g.,
schizophrenia, mania, depression, psychosis, chronic pain,
paranoia, autism, stress, Alzheimer's disease, Parkinson's disease,
pro-inflammatory diseases, autoimmune disorders, histolytic
medullary reticulosis, lupus, arthritis, atherosclerosis, neuronal
vasculopathy, or addiction).
[0090] An effective amount of a composition provided herein or of
morphine or of a morphine precursor (e.g., reticuline) can be any
amount that induces cells to release nitric oxide without producing
significant toxicity to the mammal. In some cases, an effective
amount of a composition provided herein or of morphine or of a
morphine precursor (e.g., reticuline) can be any amount that
reduces, prevents, or eliminates a symptom of a disease or
condition upon administration to a mammal without producing
significant toxicity to the mammal. In some cases involving
morphine precursors, an effective amount can be any amount that
results in the production of detectable amounts of morphine within
a tissue sample.
[0091] Again, a composition provided herein can be administered to
a mammal in any amount. In some embodiments, the amount of a
composition provided herein or of morphine or of a morphine
precursor (e.g., reticuline) can be greater than 0.01 mg/kg of body
weight. In some cases, the amount of a composition provided herein
or of morphine or of a morphine precursor (e.g., reticuline) can be
between about 0.01 and about 50 mg/kg (e.g., between about 0.01 and
about 45 mg/kg; between about 0.1 and about 25 mg/kg; or between
about 1 and about 5 mg/kg) of body weight. The effective amount can
vary depending upon the disease to be treated (if any), the site of
administration, and the mammal to be treated. Such effective
amounts can be determined using the methods and materials provided
herein. For example, the level of morphine production can be
assessed using routine experimentation in vitro or in vivo. For
example, a patient having a particular condition can receive 5
mg/kg body weight of reticuline. If the patient fails to respond or
produce morphine, then the amount can be increased by, for example,
ten fold. After receiving this higher concentration, the patient
can be monitored for both responsiveness to the treatment and
toxicity symptoms, and adjustments made accordingly.
[0092] Various factors can influence the actual amount used for a
particular application. For example, the frequency of
administration, duration of treatment, combination of other agents,
site of administration, stage of disease (if present), and the
anatomical configuration of the treated area may require an
increase or decrease in the actual amount administered.
[0093] The frequency of administration of a composition provided
herein can be any frequency. For example, the frequency of
administration can be from about four times a day to about once a
month, or more specifically, from about twice a day to about once a
week. In addition, the frequency of administration can remain
constant or can be variable during the duration of treatment. As
with the amount administered, various factors can influence the
actual frequency of administration used for a particular
application. For example, the amount, duration of treatment,
combination of agents, site of administration, stage of disease (if
present), and the anatomical configuration of the treated area may
require an increase or decrease in administration frequency. In one
embodiment, a composition containing reticuline can be administered
daily at a dose of about 1 to about 5 mg of reticuline per kg of
body weight.
[0094] The duration of administration of a composition provided
herein can be any duration. For example, a duration of
administration of a composition provided herein can be longer than
a week, month, three months, six months, nine months, a year, two
years, or three years. In some cases, an effective duration can be
any duration that reduces, prevents, or eliminates a symptom of a
disease upon administration to a mammal without producing
significant toxicity to the mammal. Such an effective duration can
vary from several days to several weeks, months, or years. In
general, an effective duration for the treatment of an acute
disease can range in duration from several days to several months.
Once administration of the composition is stopped, however, disease
symptoms may return. In such cases, an effective duration for the
prevention of certain conditions can last for as long as the
individual is alive.
[0095] Multiple factors can influence the actual duration used for
a particular treatment or prevention regimen. For example, an
effective duration can vary with the frequency of administration,
the amount administered, combination of multiple agents, site of
administration, state of disease (if present), and anatomical
configuration of the treated area.
[0096] If the administration of a composition provided herein
(e.g., a composition containing reticuline) is toxic, the mammal
can be treated with a combination of L-DOPA and dopamine to inhibit
the production of morphine that results from the administered
composition. For example, a combination of L-DOPA and dopamine can
be used to reduce that amount of morphine produced from a
composition containing a morphine precursor such that only 95, 90,
80, 70, 60, 50, 40, 30, 20, 10, or less percent of the morphine
normally produced following administration of the composition is
actually produced.
[0097] This document also provides methods for inducing nitric
oxide release from cells. Such cells can be in vitro or in vivo. In
addition, the cells can be any type of cell including, without
limitation, neuronal, vascular, respiratory, immune, or digestive
cells. To induce nitric oxide release from cells, the compositions
provided herein can be administered as described herein. For
example, a composition containing morphine can be administered to a
mammal in an amount and at a frequency such that the mammal
receives between 0.5 .mu.g and 10 .mu.g of morphine per kg of body
weight per day for a duration of more than one month (e.g., more
than two, three, four, five, six, seven, eight, nine, or more
months).
[0098] In addition, this document provides methods for treating a
mammal having a disease or condition using a composition provided
herein. Examples of diseases or conditions that can be treated
using the compositions provided herein include, without limitation,
rheumatoid arthritis, systemic lupus erythematosus, systemic
scleroderma, Behcet disease, periarteritis, ulcerative colitis,
Crohn's disease, active chronic hepatitis, glomerular nephritis,
autoimmune diseases, osteoarthritis, gout, atherosclerosis,
psoriasis, atopic dermatitis, pulmonary diseases with granuloma,
encephalitis, endotoxin shock, sepsis, inflammatory colitis,
diabetes, acute myelocytic leukemia, pneumonia, heart
transplantation, encephalomylitis, anorexia, acute hepatitis,
chronic hepatitis, drug-induced hepatic injury, alcoholic
hepatitis, viral hepatitis, jaundice, hepatic cirrhosis, hepatic
insufficiency, atrial myxoma, Castleman syndrome, multiple myeloma,
Rennert T lymphomatosis, mesangial nephritis, renal cell carcinoma,
cytomegaloviral hepatitis, cytomegaloviral retinopathy, adenoviral
cold syndrome, adenoviral pharyngoconjunctival fever, adenoviral
ophthalmia, AIDS, atherosclerosis, arteriosclerosis, vasculopathy
associated with diabetes, mania, depression, chronic pain,
schizophrenia, psychosis, and paranoia. To treat a mammal having
such a disease or condition, the compositions provided herein can
be administered as described herein. For example, a composition
containing morphine can be administered to a mammal in an amount
and at a frequency such that the mammal receives between 0.5 .mu.g
and 10 .mu.g of morphine per kg of body weight per day for a
duration of more than one month (e.g., more than two, three, four,
five, six, seven, eight, nine, or more months). In some cases, the
compositions provided herein can be used to reduce the severity of
a symptom of the disease or condition, or to prevent the
development or onset of the disease or condition.
[0099] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1
Reticuline Exposure to Invertebrate Ganglia Increases Endogenous
Morphine Levels
[0100] The following experiments were performed to determine if
exposing tissues to an opiate alkaloid precursor, reticuline, would
result in increasing endogenous morphine levels.
Material and Methods
[0101] Mytilus edulis collected from the local waters of Long
Island Sound were maintained under laboratory conditions for at
least 14 days prior using in experiments. Mussels were kept in
artificial seawater (Instant Ocean, Aquarium Systems, Mentor, Ohio)
at a salinity of 30 PSU and at a temperature of 18.degree. C. as
previously described (Stefano et al., Electro-Magnetobiol.,
13:123-36 (1994)).
[0102] For reticuline exposure, 400 animals were placed and
maintained in artificial seawater at 24.degree. C., whereas control
animals (100) were exposed to vehicle (PBS). For the biochemical
analysis, groups of 20 animals had their pedal ganglia excised at
different time periods after incubation with reticuline.
[0103] The extraction protocol, using internal or external morphine
standards, was performed in a room where the animals were not
maintained to avoid morphine contamination. Single use siliconized
tubes were used to prevent the loss of morphine. Mytilus edulis
pedal ganglia also were extensively washed (3 times) with PBS (0.01
M NaCl 0.132 mM, NH.sub.4HCO.sub.3 0.132 mM; pH 7.2) prior to
extraction (3 times centrifugation at 1000 rpm, 1 minute, followed
by discarding the PBS) to avoid exogenous morphine contamination.
Tissues were dissolved in 1N HCl and sonicated using a Fisher
scientific sonic dismembrator 60 (Fisher Scientific, USA). The
resulting homogenates were extracted with 5 mL
chloroform/isopropanol 9:1.
[0104] After 5 minutes at room temperature, homogenates were
centrifuged at 3000 rpm for 15 minutes. The three phases were
separated in the following order: 1) The lowest layer corresponding
to the organic phase; 2) The intermediate phase corresponding to
precipitated proteins; and 3) The top aqueous supernatant phase
containing morphine. The supernatant was collected and dried with a
Centrivap Console (Labconco, Kansas City, Mo.). The dried extract
was then dissolved in 0.05% trifluoroacetic acid (TFA) water before
solid phase extraction. Samples were loaded on a Waters Sep-Pak
Plus C-18 cartridge previously activated with 100% acetonitrile and
washed with 0.05% TFA-water. Morphine elution was performed with a
10% acetonitrile solution (water/acetonitrile/TFA, 89.5%:10%:0.05%,
v/v/v). The eluted sample was dried with a Centrivap Console and
dissolved in water prior to high pressure liquid chromatography
(HPLC) analysis.
[0105] The morphine radioimmuno-assay (RIA) determination was a
solid phase, quantitative RIA, wherein .sup.125I-labeled morphine
competes for a fixed time with morphine in the test sample for the
antibody binding site. The commercial kit employed was from
Diagnostic Products Corporation (USA). Because the antibody was
immobilized on the wall of a polypropylene tube, simply decanting
the liquid phase to terminate the competition and to isolate the
antibody-bound fraction of radiolabeled morphine was sufficient.
The material was then counted in a Wallac, 3'', 1480 gamma counter
(Perkin Elmer, USA). Comparison of the counts to a calibration
curve yielded a measure of the morphine present in the test sample,
expressed as nanograms of morphine per milliliter. The calibrators
contained, respectively, 0, 2.5, 10, 25, 75, and 250 nanograms of
morphine per milliliter (ng/mL) in PBS. Reticuline and salutaridine
did not cross-react with the antibody. The detection limit was 0.5
ng/mL.
[0106] The HPLC analyses were performed with a Waters 626 pump
(Waters, Milford, Mass.) and a C-18 Unijet microbore column (BAS).
A flow splitter (BAS) was used to provide the low volumetric
flow-rates required for the microbore column. The split ratio was
1/9. Operating the pump at 0.5 mL/minute, yielded a microbore
column flow-rate of 50 .mu.L/minute. The injection volume was 5
.mu.L. Morphine detection was performed with an amperometric
detector LC-4C (BAS, West Lafayette, Ind.). The microbore column
was coupled directly to the detector cell to minimize the dead
volume. The electrochemical detection system used a glassy
carbon-working electrode (3 mm) and a 0.02 Hz filter (500 mV; range
10 nA). The cell volume was reduced by a 16-.mu.m gasket. The
chromatographic system was controlled by Waters Millennium.sup.32
Chromatography Manager V3.2 software, and the chromatograms were
integrated with Chromatograph software (Waters).
[0107] Morphine was quantified in the tissues as described
elsewhere (Zhu et al., Brain Res. Mol. Brain. Res., 88:155-60
(2001)). Briefly, the mobile phases were: Buffer A: 10 mM sodium
chloride, 0.5 mM EDTA, 100 mM sodium Acetate, pH 5.0; Buffer B: 10
mM sodium chloride, 0.5 mM EDTA, 100 mM sodium Acetate, 50%
acetonitrile, pH 5.0. The injection volume was 5 .mu.L. The running
conditions were: from 0 min 0% buffer B; 10 min, 5% buffer B; at 25
min 50% buffer B; at 30 min 100% buffer B. Both buffers A and B
were filtered through a Waters 0.22 .mu.m filter, and the
temperature of the whole system was maintained at 25.degree. C.
Several HPLC purifications were performed between each sample to
prevent residual morphine contamination remaining on the column.
Furthermore, mantle tissue was run as a negative control,
demonstrating a lack of contamination (Zhu et al., Mol. Brain.
Res., 117:83-90 (2003)).
[0108] For the nitric oxide assay, ten pedal ganglia (per
determination) dissected from M. edulis were bathed in 1 mL sterile
phosphate buffered saline (PBS). Experiments used morphine at a
final concentration of 10.sup.-6 M, naloxone at 10.sup.-6 M, and 1
.mu.g of reticuline. For the opiate receptor antagonist
experiments, ganglia were pretreated with naloxone for 10 minutes
prior to reticuline addition. NO release was monitored with an
NO-selective microprobe manufactured by World Precision Instruments
(Sarasota, Fla.). The sensor was positioned approximately 100 .mu.m
above the respective tissue surface. Calibration of the
electrochemical sensor was performed by use of different
concentrations of a nitrosothiol donor
S-nitroso-N-acetyl-DL-penicillamine (SNAP) as described elsewhere
(Liu et al., Brain Res., 722:125-31 (1996)). The NO detection
system was calibrated daily. The probe was allowed to equilibrate
for 10 minutes in the incubation medium free of tissue before being
transferred to vials containing the ganglia for another 5 minutes.
Manipulation and handling of the ganglia was only performed with
glass instruments. Data was acquired using the Apollo-4000 free
radical analyzer (World Precision Instruments, Sarasota, Fla.). The
experimental values were then transferred to Sigma-Plot and -Stat
(Jandel, Calif.) for graphic representation and evaluation. For
binding experiments, human monocytes served as a positive control
since the mu3 opiate receptor subtype, which is coupled to NO
release, was identified by RT-PCR and Northern blot analysis in
these cells (Cadet et al., J. Immunol., 170:5118-23 (2003)). The
monocytes were obtained from the Long Island Blood Center
(Melville, Long Island) and processed as described elsewhere
(Stefano et al., Proc. Natl. Acad. Sci., 90:11099-103 (1993);
Bilfinger et al., Adv. Neuroimmunol., 3:277-88 (1993); and Magazine
et al., J. Immunol. 156:4845-50 (1996)).
[0109] An additional 100 excised pedal ganglia and the human
monocytes were separately washed and homogenized in 50 volumes of
0.32 M sucrose, pH 7.4, at 4.degree. C. using a Brinkmann polytron
(30 seconds, setting no. 5). The crude homogenate was centrifuged
at 900.times.g for 10 minutes at 4.degree. C., and the supernatant
was reserved on ice. The whitish crude pellet was resuspended by
homogenization (15 seconds, setting no. 5) in 30 volumes of 0.32 M
sucrose/Tris-HCl buffer, pH 7.4, and centrifuged at 900.times.g for
10 minutes. The extraction procedure was repeated one more time,
and the combined supernatants were centrifuged at 900.times.g for
10 minutes. The resulting supernatants (S1') were used immediately.
Prior to the binding experiment, the S1' supernatant was
centrifuged at 30,000.times.g for 15 minutes, and the pellet (P2)
was washed once by centrifugation in 50 volumes of the
sucrose/Tris-HCl. The P2 pellet was then re-suspended with a Dounce
hand-held homogenizer (10 strokes) in 100 volumes of buffer.
Binding analysis was then performed on the cell membrane
suspensions.
[0110] Aliquots of membrane suspension (0.2 mL, 0.12 mg of membrane
protein) were incubated in triplicate at 22.degree. C. for 40
minutes with the appropriate radiolabeled ligand in the presence of
dextrorphan (10 mM) or levorphanol (10 mM) in 10 mM Tris-HCl
buffer, pH 7.4, containing 0.1% BSA and 150 mM KCl. Free ligand was
separated from membrane-bound labeled ligand by filtration under
reduced pressure through GF/B glass fiber filters (Whatman);
filters were presoaked (45 minutes, 4.degree. C.) in buffer
containing 0.5% BSA. The filters were rapidly washed with 2.5 mL
aliquots of the incubation buffer (4.degree. C.), containing 2%
polyethylene glycol 6000 (Baker). They were assayed by liquid
scintillation spectrometry (Packard 460). Stereospecific binding
was defined as binding in the presence of 10 mM dextrorphan minus
binding in the presence of 10 mM levorphanol. Protein concentration
was determined in membrane suspensions (prepared in the absence of
BSA).
[0111] For IC.sub.50 determination (defined as the concentration of
drug which elicits half-maximal inhibition of specific
.sup.3H-dihydromorphine binding (for mu3), an aliquot of the
respective tissue-membrane suspension was incubated with
non-radioactive opioid compounds at 6 different concentrations for
10 minutes at 22.degree. C. and then with .sup.3H-dihydromorphine
for 60 minutes at 4.degree. C. as described elsewhere (Stefano et
al., Proc. Natl. Acad. Sci., 90:11099-103 (1993)). The mean
+/-S.E.M. for three experiments was recorded for each compound.
Tyr-D-Pen-Gly-Phe-D-Pen (DPDPE) and naltrexone were obtained from
Sigma Chemical Co. (St. Louis, Mo.).
Results
[0112] Morphine was identified in the ganglionic extraction by
reverse phase HPLC using a gradient of acetonitrile following
liquid and solid extraction, and was compared to an authentic
standard (FIG. 1). The material exhibited the same retention time
as authentic morphine. The electrochemical detection sensitivity of
morphine was 80 picograms. The concentration of morphine was
1.43.+-.0.41 ng/mg.+-.SEM ganglionic wet weight as determined by
the Chromatogram Manager 3.2 commercial software
(Millemmium.sup.32, Waters, Milford, Mass.) extrapolated from the
peak-area calculated for the external standard. Ganglia incubated
with 50 ng of reticuline for 1 hour exhibited a statistical
increase in their endogenous morphine levels (6.7.+-.0.7 ng/mg
tissue wet weight; P<0.01; FIG. 1).
[0113] The electrochemical results are compatible with the RIA
quantification (FIG. 2), which yields a control ganglionic level of
morphine at 1.33.+-.0.61 ng/mg tissue wet weight .+-.SEM.
Incubation with various concentrations of reticuline increases
ganglionic morphine levels after one hour in a concentration
dependent manner (FIG. 2). Exposure of excised ganglia to 100 ng of
reticuline yields about 14.53.+-.4.6 ng/mg morphine (FIG. 2;
P<0.001). The increase in ganglionic morphine levels occurred
gradually over the 60-minute incubation period, beginning 10
minutes post reticuline addition (FIG. 3). From these studies,
about 24 percent of the added reticuline was converted to morphine.
Blank runs between morphine HPLC determinations did not show a
morphine residue with RIA, nor did any signs of its presence occur
with mantle tissue. Incubation of 50 ng of reticuline with mantle
tissues did not produce detectable morphine.
[0114] Pedal ganglia, which contain mu opiate receptors, respond to
morphine exposure by releasing constitutive nitric oxide synthase
derived NO in a naloxone and L-NAME sensitive manner (Stefano et
al., Brain Res., 763:63-8 (1997) and Cadet et al., Mol. Brain.
Res., 74:242-6 (1999)). In an attempt to substantiate the identity
of newly synthesized morphine further, ganglia were examined for
their ability to release NO in response to reticuline exposure
(FIG. 4; Table 1). Reticuline (10.sup.-7 M) did not stimulate
ganglionic NO release in a manner resembling that of morphine
(10.sup.-6 M), which releases NO seconds after its application to
the ganglia and lasts for 5 minutes (FIG. 4; Table 1). Instead,
with reticuline, there was a three-minute delay, which was followed
by an extended release period occurring over 17 minutes (FIG. 4).
This reticuline-stimulated release occurred because reticuline was
being converted to morphine and the newly synthesized morphine was
responsible for the detected NO release, as indicated by the time
course of morphine increase following reticuline exposure (FIG.
3).
TABLE-US-00001 TABLE 1 NO release from pedal ganglia. NO Peak NO
Peak LIGAND Level (nM) Time (min) Control 0.9 .+-. 0.1 None
Morphine (10.sup.-7 M) 24.3 .+-. 3.1 0.8 .+-. 0.2 Reticuline
(10.sup.-7 M) 17.6 .+-. 3.8 9.2 .+-. 1.5 Salutaridine (10.sup.-7 M)
18.5 .+-. 3.3 8.9 .+-. 1.3 Dihydromorphine (10.sup.-7 M) 23.2 .+-.
3.7 0.9 .+-. 0.3
[0115] The reticuline and salutaridine NO peak time and latency
before NO production rose at 10 nM were statistically different
(P<0.01) from those values recorded for morphine and
dihydromorphine.
[0116] Neither reticuline nor salutaridine exhibited binding
affinity for the pedal ganglia mu3 opiate receptor subtype (Table
2). This finding was farther substantiated using the positive
control of human monocytes from which the mu3 opiate receptor
subtype was cloned. This result indicates that the pre-treatment of
the ganglia with naloxone (10.sup.-6 M) blocking the reticuline
(10.sup.-7 M) stimulated release of NO (FIG. 4) occurs by way of
this precursor being converted to morphine since reticuline does
not have an affinity for the mu3 opiate receptor (Table 2).
TABLE-US-00002 TABLE 2 Displacement of .sup.3H-dihydromorphine
(DHM; nmol-L.sup.-1) by opioid ligands in various tissue membrane
suspensions. Pedal Ganglia Monocytes LIGAND (IC.sup.50; nM)
(IC.sup.50; nM) .delta.-agonists DPDPE >1000 >1000
.mu.-agonists Reticuline >1000 >1000 Salutaridine >1000
>1000 Dihydromorphine 22 .+-. 2.3 19.1 .+-. 3.3 Antagonists
Naltrexone 31 .+-. 7.1 34.6 .+-. 8.2 DPDPE = (D-Pen.sup.2,
D-Pen.sup.5)-enkephalin.
[0117] The results provided herein demonstrate that (1) morphine is
present in Mytilus pedal ganglia; (2) exposing pedal ganglia to
reticuline results in significant increases in ganglionic morphine
levels in a concentration and time dependent manner; (3) reticuline
stimulates ganglionic NO production, following a latency period, in
a manner consistent with it being converted to morphine; and (4)
reticuline does not exhibit an affinity for the mu3 opiate
receptor, also suggesting that NO release occurs because of the
conversion of reticuline into morphine.
Example 2
Mammalian Cells Produce Morphine from Reticuline
[0118] Human cells (NCI-H295R) were adapted from the NCI-H295
pluripotent adrenocortical carcinoma cell line (ATCC CRL-10296),
which is from a carcinoma of the adrenal cortex. The original cells
were adapted to a culture medium that decreased the population
doubling time from 5 days to 2 days. While the original cells grew
in suspension, the adapted cells were selected to grow in a
monolayer. These cells retained the ability to produce adrenal
androgens and were responsive to angiotensin II and potassium ions.
To propagate these cells, the culture medium was a 1:1 mixture of
Dulbecco's modified Eagle's medium and Ham's F12 medium containing
15 mM HEPES, 0.00625 mg/mL insulin, 0.00625 mg/mL transferrin, 6.25
ng/mL selenium, 1.25 mg/mL bovine serum albumin, and 0.00535 mg/mL
linoleic acid, 97.5%; Nu-Serum I, 2.5%. See, e.g., Rainey et al.,
Mol. Cell. Endocrinol., 100:45-50 (1994); Gazdar et al., Cancer
Res., 50:5488-5496 (1990); and Bird et al., Endocrinology,
133:1555-1561 (1993)).
[0119] The cells were subcultured in 6 well cell culture cluster
(Corning Inc.) 24 hours before the experiment. The amount of cells
was determined by Microscope (Nickon inc). Various amounts of
reticuline were added to the cells, and the cells were cultured
with an NAPCO incubator. The incubation was terminated after 24
hours by adding 10 NHCl. Morphine in the cells and culture medium
was detected with an RIA kit purchased from Diagnostic Products
Cooperation, CA, USA.
[0120] The morphine levels in the cells were significantly higher
when incubated with reticuline. One half million cells incubated
with 100 ng of reticuline produced about 28.+-.5.4 ng of morphine.
Control cells only produced about 9.6.+-.3.5 ng of morphine.
Culture media were negative in the test. These results demonstrate
that human cells can produce morphine from reticuline.
Example 3
The Combination of L-DOPA and Dopamine Inhibits Endogenous Morphine
Production
[0121] Mytilus pedal ganglia were obtained and incubated with 10
.mu.g L-DOPA alone, 10 .mu.g dopamine alone, or 10 .mu.g L-DOPA
plus 10 .mu.g dopamine. The control ganglia were not incubated with
L-DOPA or dopamine and exhibited 11.9 ng/mL morphine. The ganglia
incubated with either L-DOPA alone or dopamine alone exhibited 9.31
and 8.82 ng/mL morphine, respectively. In contrast, ganglia
incubated with both L-DOPA and dopamine exhibited 5.52 ng/mL of
morphine. These results demonstrate that treatment with both L-DOPA
and dopamine can reduce morphine production.
Example 4
L-DOPA Increase Production of Morphine
[0122] M. edulis collected from the local waters of Long Island
Sound were maintained at a salinity of 30 PSU and at a temperature
of 18.degree. C. in marine aquaria as described elsewhere (Stefano
et al., Electro-Magnetobiol., 13:123-36 (1994)). For in vitro
ganglionic assays, groups of 10 animals had their pedal ganglia
excised and examined for their morphine levels at different time
periods following the addition of L-DOPA or reticuline and at
different concentrations of these morphine precursors. In vitro
incubation with reticuline served as a positive control since the
results provided in Example 1 demonstrate that reticuline increases
endogenous ganglionic morphine levels. L-DOPA was incubated with
ganglia at concentrations ranging from 1 to 100 ng/mL and at
different times.
[0123] For in vivo precursor injection experiments, the animal's
foot was injected with either reticuline or L-DOPA (0.1 and 11
g/injection, respectively). Chemicals were injected by BD 1 cc
syringes with 26 G needles. Each needle was inserted into that base
of the foot just above the pedal ganglia.
Morphine Determination, Solid Phase Extraction
[0124] The morphine extraction protocol was performed using
dissected and pooled ganglia, obtained from in vitro and in vivo
experiments and run separately, as described herein.
[0125] The dried extract was then dissolved in 0.05%
trifluoroacetic acid (TFA) water before solid phase extraction.
Samples were loaded on a Waters Sep-Pak Plus C-18 cartridge
previously activated with 100% acetonitrile and washed with 0.05%
TFA-water. Morphine elution was performed with a 10% acetonitrile
solution (water/acetonitrile/TFA, 89.5%:10%:0.05%, v/v/v). The
eluted sample was dried with a Centrivap Console and dissolved in
water prior to HPLC analysis.
Radioimmuno-Assay (RIA) Determination
[0126] The morphine RIA determination was a solid phase,
quantitative RIA, wherein .sup.125I-labeled morphine competes for a
fixed time with morphine in the test sample for the antibody
binding site. The commercial kit used was obtained from Diagnostic
Products Corporation (USA). The detection limit was 0.5 ng/mL.
HPLC and Electrochemical Detection of Morphine in Samples
[0127] The HPLC analyses were performed with a Waters 626 pump
(Waters, Milford, Mass.) and a C-18 Unijet microbore column (BAS).
A flow splitter (BAS) was used to provide the low volumetric
flow-rates required for the microbore column. The split ratio was
1/9. Operating the pump at 0.5 mL/min, yielded a microbore column
flow-rate of 50 .mu.L/min. The injection volume was 5 .mu.L.
Morphine detection was performed with an amperometric detector
LC-4C (BAS, West Lafayefte, Ind.). The microbore column was coupled
directly to the detector cell to minimize the dead volume. The
electrochemical detection system used a glassy carbon-working
electrode (3 mm) and a 0.02 Hz filter (500 mV; range 10 nA). The
cell volume was reduced by a 16-.mu.m gasket. The chromatographic
system was controlled by Waters Millennium.sup.32 Chromatography
Manager V3.2 software, and the chromatograms were integrated with
Chromatograph software (Waters).
[0128] Morphine was quantified in the tissues using methods
described elsewhere (Zhu et al., Brain Res. Mol. Brain. Res.,
88:155-60 (2001)). Several HPLC purifications were performed
between each sample to prevent residual morphine contamination
remaining on the column. Mantle tissue was run as a negative
control, demonstrating a lack of contamination. Morphine was not
found in any of the solutions used in these experiments.
Furthermore, animals injected with 5-hydroxytryptophan or ganglia
incubated with this serotonin precursor did not exhibit any changes
in their endogenous ganglionic morphine levels.
Results
[0129] Incubation of pedal ganglia in vitro with various
concentrations of L-DOPA or reticuline increased ganglionic
morphine levels in a time and concentration dependent manner (FIGS.
5 and 6). Control ganglia, exposed to vehicle or
5-hydroxytryptophan (1 .mu.g/gm tissue), a serotonin precursor,
exhibited 2.11.+-.0.44 and 2.11.+-.0.41 ng morphine per ganglion
wet weight, respectively, whereas those exposed to L-DOPA exhibited
3.6.+-.0.45 ng morphine per ganglion, representing a statistically
significant increase (P<0.05). Exposure of excised ganglia to
100 ng of reticuline resulted in about 5.0.+-.0.47 ng morphine per
mg ganglion (FIGS. 5 and 6; P<0.001). The increase in ganglionic
morphine levels, after L-DOPA exposure, occurs gradually over the
60 minute incubation period, beginning 10 minutes post exposure
(FIG. 6). From these results, about 5% of L-DOPA appears to be
converted to morphine. Blank runs between morphine HPLC
determinations as well as running negative tissue controls, i.e.,
mantle, did not reveal a morphine residue with RIA. Analysis of the
marine water and various chemicals used in the protocol also lacked
morphine.
[0130] The following was performed to determine if injection of
these same precursors into intact healthy animals would yield an
increase in morphine levels. Injecting animals with either
reticuline or L-DOPA significantly increased pedal ganglionic
morphine levels after one hour (FIG. 7), demonstrating that
morphine synthesis occurred. Injection of 5-hydroxytryptophan
failed to increase ganglionic morphine levels. These results
demonstrate that reticuline and L-DOPA can be administered to an
animal so that the animal can produce additional morphine.
[0131] The results provided herein also demonstrate that L-DOPA can
be used in both morphinergic as well as dopaminergic pathways.
About 5 percent of L-DOPA, which occurs early in the synthesis
scheme in both pathways, appears to be used for morphine synthesis,
compared to about 25 percent of reticuline, which is closer to the
end product morphine and therefore more dedicated to morphine
synthesis.
[0132] In addition, these results together with the results from
Example 4 appear to indicate that high doses of L-DOPA can inhibit
morphine production, while low doses of L-DOPA can result in
increased morphine production. One possible mechanism is that high
doses of L-DOPA exceeded an inhibitory threshold thereby leading to
inhibition of morphine production. Low L-DOPA doses can by-pass
this inhibitory threshold.
Example 5
Norlaudanosoline Increases Production of Morphine
[0133] Mytilus edulis collected from the local waters of Long
Island Sound were maintained as described elsewhere (Stefano et
al., Electro-Magnetobiol., 13:123-36 (1994)). For the biochemical
analysis, groups of 20 animals had their pedal ganglia excised at
different time periods and incubated with different concentrations
of norlaudanosoline, ranging from 1 to 100 ng/mL.
Morphine Determination, Solid Phase Extraction
[0134] The morphine extraction protocol was performed in pooled
ganglia as described herein. The dried extract was then dissolved
in 0.05% trifluoroacetic acid (TFA) water before solid phase
extraction. Samples were loaded on a Waters Sep-Pak Plus C-18
cartridge previously activated with 100% acetonitrile and washed
with 0.05% TFA-water. Morphine elution was performed with a 10%
acetonitrile solution (water/acetonitrile/TFA, 89.5%:10%:0.05%,
v/v/v). The eluted sample was dried with a Centrivap Console and
dissolved in water prior to HPLC analysis.
Radioimmuno-Assay (RIA) Determination
[0135] The morphine RIA determination was a solid phase,
quantitative RIA, wherein .sup.125I-labeled morphine competes for a
fixed time with morphine in the test sample for the antibody
binding site. The commercial kit used was obtained from Diagnostic
Products Corporation (USA). The detection limit was 0.5 ng/mL.
HPLC and Electrochemical Detection of Morphine in the Sample
[0136] The HPLC analyses were performed with a Waters 626 pump
(Waters, Milford, Mass.) and a C-18 Unijet microbore column (BAS).
A flow splitter (BAS) was used to provide the low volumetric
flow-rates required for the microbore column. The split ratio was
1/9. Operating the pump at 0.5 mL/minute, yielded a microbore
column flow-rate of 50 .mu.L/minute. The injection volume was 5
.mu.L. Morphine detection was performed with an amperometric
detector LC-4C (BAS, West Lafayette, Ind.). The microbore column
was coupled directly to the detector cell to minimize the dead
volume. The electrochemical detection system used a glassy
carbon-working electrode (3 mm) and a 0.02 Hz filter (500 mV; range
10 nA). The cell volume was reduced by a 16-.mu.m gasket. The
chromatographic system was controlled by Waters Millennium32
Chromatography Manager V3.2 software, and the chromatograms were
integrated with Chromatograph software (Waters).
[0137] Morphine was quantified in the tissues using methods
described elsewhere (Zhu et al., Brain Res. Mol. Brain. Res.,
88:155-60 (2001)). Several HPLC purifications were performed
between each sample to prevent residual morphine contamination
remaining on the column. Furthermore, mantle tissue was run as a
negative control, demonstrating a lack of contamination.
Results
[0138] Incubation of the ganglia in vitro with various
concentrations of norlaudanosoline (also called
tetrahydropapoverine (THP)) increased ganglionic morphine levels
after one hour in a concentration and time dependent manner (FIGS.
8 and 9; P<0.01). The increase in in vitro ganglionic morphine
levels, after norlaudanosoline exposure, occurred gradually over
the 60 minute incubation period (FIG. 9). About 20 percent of
norlaudanosoline appears to be converted into morphine. Blank runs
between morphine HPLC determinations as well as running negative
tissue controls, i.e., mantle, did not reveal a morphine residue
with RIA. Analysis of the marine water and various chemicals used
in the protocol also demonstrated a lack of morphine.
Example 6
Producing Morphine in Human Cells
[0139] Human peripheral blood cells were obtained from the Long
Island Blood Services (Melville, N.Y.). ACID lysis buffer (8.29 g
NH.sub.4Cl, 0.15 M; 1 g KHCO.sub.3, 1.0 mM, 37.2 mg Na.sub.2EDTA,
0.1 mM, adding 800 mL H.sub.2O and adjusting the pH to 7.2-7.4 with
1 N HCl; filter sterilized through a 0.2 .mu.m filter and stored at
room temp) was used to remove any red blood cells from the buffy
coat containing leukocytes. Cells were incubated for 5 minutes at
room temperature in lysis buffer, and RPMI media (ATCC) used to
stop the lysis reaction, followed by centrifugation for 10 minutes
at 200 g. The supernatant was decanted, and the pellet washed with
RPMI media. The leukocytes were resuspended in RPMI media by
pipetting.
[0140] Polymorphonuclear cells (PMNs) were isolated (Ficoll-Hypaque
density of 1.077-1.080 g/mL) as described elsewhere (Magazine et
al., J. Immunol., 156:4845 (1996); Stefano et al., Proc. Natl.
Acad. Sci. USA, 89:9316 (1992); and Makman et al., J. Immunol.,
154:1323 (1995)), and the cells were examined microscopically.
Greater than 95 percent of the cells were viable as determined by
trypan blue exclusion.
[0141] A two-way ANOVA was used for statistical analysis after
precursor exposure to the cells. Each experiment was performed 4
times. The mean value was combined with the mean value taken from 4
other replicates. The SEM represents the variation of the mean of
the means. All drugs were purchased from Sigma Chemical CO. (St.
Louis, Mo.), except bufaralol, which was purchased from BD
Biosciences Clontech (Mountain View, Calif.).
[0142] The medium containing the PMNs was then separated after and
before precursor exposure at varying concentrations for 1 hour.
Cells were washed, and the endogenous morphine content was
determined. The medium, devoid of cells, was also examined for the
presence of morphine.
Morphine Determination
[0143] The morphine extraction protocol was performed upon washed
and pelleted WBC and PMN after the incubation period as described
elsewhere (Zhu et al., Brain Res. Mol. Brain. Res., 88:155 (2001);
Zhu et al., Eur. J. Mass Spect., 7:25 (2001); Zhu et al.,
Neuroendocrinol Lett., 23:329 (2002); Zhu et al., Mol. Brain. Res.,
117:83 (2003); and Zhu and Stefano, Neuro. Endocrinol. Lett.,
25:323 (2004)). The dried extract was dissolved in 0.05%
trifluoroacetic acid (TFA) water before solid phase extraction.
Samples were loaded on a Waters Sep-Pak Plus C-18 cartridge
previously activated with 100% acetonitrile and washed with 0.05%
TFA-water. Morphine elution was performed with a 10% acetonitrile
solution (water/acetonitrile/TFA, 89.5%:10%:0.05%, v/v/v). The
eluted sample was dried with a Centrivap Console and dissolved in
water prior to HPLC analysis.
[0144] The HPLC analyses were performed with a Waters 626 pump
(Waters, Milford, Mass.) and a C-18 Unijet microbore column (BAS).
A flow splitter (BAS) was used to provide the low volumetric
flow-rates required for the microbore column. The split ratio was
1/9. Operating the pump at 0.5 mL/min yielded a microbore column
flow-rate of 50 .mu.L/minute. The injection volume was 5 .mu.L.
Morphine detection was performed with an amperometric detector
LC-4C (BAS, West Lafayette, Ind.). The microbore column was coupled
directly to the detector cell to minimize the dead volume. The
electrochemical detection system used a glassy carbon-working
electrode (3 mm) and a 0.02 Hz filter (500 mV; range 10 nA). The
cell volume was reduced by a 16-.mu.m gasket. The chromatographic
system was controlled by Waters Millennium.sup.32 Chromatography
Manager V3.2 software, and the chromatograms were integrated with
Chromatograph software (Waters).
[0145] The level of morphine in the PMN was quantified as described
elsewhere (Zhu et al., Brain Res. Mol. Brain. Res., 88:155 (2001)).
Several blank HPLC purifications were performed between each sample
to prevent residual morphine contamination remaining on the column.
Furthermore, mantle tissue was run as a negative control,
demonstrating a lack of contamination. All solutions, media, etc.
were also examined for any presence of morphine. The results of
these tests revealed a lack of morphine contamination.
Radioimmuno-Assay (RIA) Determination
[0146] The morphine RIA determination was a solid phase,
quantitative RIA, wherein .sup.125I-labeled morphine competes for a
fixed time with morphine in the test sample for the antibody
binding site. The commercial kit used was obtained from Diagnostic
Products Corporation (USA). The detection limit was 0.5 ng/mL.
CYP2D6 Molecular Demonstration
[0147] Human heparinized whole blood obtained from volunteer blood
donors (Long Island Blood Services; Melville, N.Y.) was immediately
separated using 1-Step Polymorphs (Accurate Chemical and Scientific
Corporation, Westbury, N.Y.) gradient medium. Five mL of
heparinized blood was layered over 5 mL of polymorphs in a 14 mL
round-bottom tube and then centrifuged for 35 minutes at
500.times.g in a swinging-bucket rotor at 18.degree. C. After
centrifuigation, the top band at the sample/medium interface
consisting of mononuclear cells (MN) and the lower band consisting
of polymorphonuclear cells (PMN) were harvested in 14 mL tubes and
then washed with PBS (Invitrogen, Carlsbad, Calif.) by
centrifugation for 10 minutes at 400.times.g.
Isolation of Total RNA
[0148] MN and PMN cells (5.times.10.sup.6) were pelleted by
centrifugation, and total RNA was isolated with the RNeasy Protect
Mini Kit (Qiagen, Stanford, Calif.). Pelleted cells were
resuspended in buffer RLT and homogenized by passing the lysate 5
times through a 20-gauge needle fitted to a syringe. The samples
were then processed following the manufacturer's instructions. In
the final step, the RNA was eluted with 50 .mu.L of RNase-free
water by centrifugation for 1 minute at 10,000 rpm.
Reverse Transcription-Coupled Polymerase Chain Reaction
(RT-PCR)
[0149] First-strand cDNA synthesis was performed using random
primers (Invitrogen, Carlsbad, Calif.). 1 .mu.g of total RNA was
denatured at 95.degree. C. and reverse transcribed at 40.degree. C.
for 1 hour using Superscript III Rnase H-RT (Invitrogen, Carlsbad,
Calif.). Ten microliters of the RT product was added to the PCR mix
containing specific primers for the CYP2D6 gene and Platinum Taq
DNA polymerase (Invitrogen, Carlsbad, Calif.). The forward primer
sequence was 5'-AGGTGTGTCTCGAGGAGCCCATTTGGTA-3' (SEQ ID NO:3) and
reverse primer was 5'-GCAGAAAGCCCGACTCCTCCTTCA-3' (SEQ ID NO:4).
The PCR reaction was denatured at 94.degree. C. for 5 minutes
followed by 40 cycles at 95.degree. C. for 1 minute, 60.degree. C.
for 1 minute, and 72.degree. C. for 1 minute, and then an extension
step cycle at 72.degree. C. for 10 minutes. PCR products were
analyzed on a 2% agarose gel (SIGMA, St. Louis, Mo.) stained with
ethidium bromide. The expected sizes of the PCR products were 700
bp, 300 bp, and others as described elsewhere Zhuge and Yu, World
J. Gastroenterol., 10:3356 (2004).
Computer-Assisted Cell Activity Analysis
[0150] PMNs, obtained as described herein, were also processed for
image analysis of cell conformation as described elsewhere (Schon
et al., Adv. Neuroimmunol., 1:252 (1991)). The morphological
measurements of PMNs were based on cell area and perimeter
determinations by the use of image analysis software (Compix, Mars,
Pa.). Form-factor (FF) calculations were performed as described
elsewhere (Stefano et al., Proc. Natl. Acad. Sci. USA, 89:9316
(1992); Stefano et al., Proc. Natl. Acad. Sci. USA, 90:11099
(1993); and Stefano et al., J. Neuroimmunol., 47:189 (1993)). The
observational area used for measurement determinations and
frame-grabbing was 0.4 .mu.m in diameter. The computer-assisted
image analysis system (Zeiss Axiophot fitted with Nomarski and
phase contrast optics) was the same as described elsewhere (Stefano
et al., Proc. Natl. Acad. Sci. USA, 89:9316 (1992); Stefano et al.,
Proc. Natl. Acad. Sci. USA, 90:11099 (1993); and Stefano et al., J.
Neuroimmunol., 47:189 (1993)).
[0151] The cells were analyzed for conformational changes
indicative of either activation (amoeboid and mobile) or inhibition
(round and stationary) ((Stefano et al., Proc. Natl. Acad. Sci.
USA, 89:9316 (1992); Stefano et al., Proc. Natl. Acad. Sci. USA,
90:11099 (1993); and Stefano et al., J. Neuroimmunol., 47:189
(1993)). The lower the FF number, the longer the perimeter and the
more amoeboid the cellular shape. The proportion of activated cells
was determined as described elsewhere ((Stefano et al., Proc. Natl.
Acad. Sci. USA, 89:9316 (1992); Stefano et al., Proc. Natl. Acad.
Sci. USA, 90:11099 (1993); and Stefano et al., J. Neuroimmunol.,
47:189 (1993)).
[0152] All pharmacological agents were purchased from Research
Biochemicals Incorporated (Natick, Mass.) or Sigma (St. Louis,
Mo.).
Results
[0153] In control (vehicle exposed) white blood cells (WBC),
morphine was identified at a level of 12.33.+-.5.64 pg/million
cells .+-.SEM (FIG. 10). These cells were extensively washed in
serum-free RPMI medium, limiting any plasma morphine that may be
found on the cells. It, however, is possible that the cells
nonspecifically accumulated morphine from plasma. In order to
determine if WBC contain morphine due to endogenous synthesis,
cells were incubated with specific morphine precursors, including
the amino acid tyramine. Tyramine, norlaudanosoline (THP),
reticuline, and L-DOPA significantly increased WBC morphine
concentrations above those found in untreated cells (ANOVA test,
P<0.001; FIG. 11). Morphine concentrations in cells incubated
with precursors were 90.25.+-.10.42 pg, 136.04.+-.8.71 pg, and
136.5.+-.12.43 pg/million cells after a one-hour treatment with
THP, reticuline, and L-DOPA, respectively. Furthermore, morphine
concentrations increased with exposure to precursors in a
concentration-dependent manner (FIG. 11). These results demonstrate
that WBC contain low but physiologically significant quantities of
morphine and that exposure of these cells to morphine precursors
can increase morphine synthesis.
[0154] To identify a specific population of WBC capable of
synthesizing morphine, PMNs were examined. Morphine was found in
these cells at a level of 11.2.+-.4.21 pg/million cells (FIG. 12).
Exposing PMNs to morphine precursors including tyramine, at levels
that increased morphine production in WBC, resulted in a
statistically significant increase in morphine concentrations in
PMNs (FIGS. 12 and 13).
[0155] To determine if CYP2D6 is involved in morphine synthesis in
PMNs, PMNs were incubated with tyramine and a CYP2D6 substrate
(bufuralol). Treatment with both tyramine and bufaralol resulted in
significantly diminished synthesis of morphine (P<0.001 compared
to precursor augmentation levels; FIG. 12). In addition, the CYP2D6
inhibitor, quinidine, blocked morphine synthesis when PMNs were
treated with tyramine, THP, or codeine, further demonstrating that
CYP2D6 is involved in the synthesis of morphine (FIG. 13). Further,
CYP2D6 was found to be expressed in PMNs as evidenced by RT-PCR
expression analysis that resulted in an amplified 306 bp fragment
corresponding to the enzyme. Sequence analysis of this fragment
revealed 100 percent homology with human CYP2D6. These results
demonstrate that CYP2D6 is expressed in human PMNs and that it is
involved in morphine synthesis.
[0156] PMN incubation medium was evaluated to determine if morphine
found in PMNs would also be found in the PMN incubation medium
following exposure to morphine precursors. The levels of morphine
detected in media from PMNs (3.times.10.sup.6 cells) treated with
THP (100 .mu.g), reticuline (50 .mu.g), L-DOPA (100 .mu.g), or
L-tyrosine (100 .mu.g) were significantly (One-way ANOVA,
P<0.05) higher than the levels detected in media from untreated
cells (Table 3).
TABLE-US-00003 TABLE 3 Morphine levels in media after the cells
were removed. Control Medium THP Reticuline L-DOPA L-tyrosine 0.726
.+-. 0.13 2.028 .+-. 0.42 2.112 .+-. 0.33 1.234 .+-. 0.26 2.223
.+-. 0.38
[0157] To examine a possible physiologic role of PMN-derived
morphine, precursor-treated PMNs were incubated with other PMNs
that had been exposed to different experimental protocols. After
this incubation, the PMNs were evaluated for their activity level
via computer-assisted image analysis. Untreated PMNs exhibited a
7.3.mu.2.1% level of activation (FF>0.6) compared to a
43.4.mu.5.7% level of activation for cells treated with IL-1.beta.
(2 ng/mL) after one hour. PMNs incubated with L-DOPA (10.sup.-6 M;
10.sup.6 cells) exhibited a 3.7.+-.0.4% level of activation. After
washing PMNs separately and mixing the populations (L-DOPA treated
and IL-1.beta. treated) in a 1:1 ratio, the percent of activated
cells decreased to 12.5.+-.3.7% in the mixed PMN population (FIG.
14). In performing the same experiment but co-treating the
IL-1.beta.-treated cells with naloxone and then mixing them with
the L-DOPA-treated PMNs, the cells exhibited a 35.2.+-.6.3% level
of activation, indicating that morphine mediated the reduced level
of activation since naloxone significantly blocked morphine's
action.
[0158] Taken together, these results demonstrate that normal, human
white blood cells such as PMNs contain endogenous morphine, have
the ability to synthesize morphine, and can release morphine into
their environment. In addition, cells such as PMNs exposed to
morphine precursors can release morphine into their environment,
which can influence the activity state of the same cells as well as
other cells not exposed to the precursors. These results also
demonstrate that WBC express CYP2D6, an enzyme capable of
synthesizing morphine from tyramine, norlaudanosoline, and codeine.
In addition, the results provided herein demonstrate that morphine
can be synthesized by another pathway, via L-DOPA, indicating that
the dopamine and morphine biosynthesis pathways are coupled (FIG.
15). Taken together, the results provided herein demonstrate that
morphine can be made from two starting points, and that inhibiting
either pathway separately results in continued morphine synthesis
apparently because the other pathway can compensate for the
inhibition.
Example 7
Tyrosine and Tyramine Increase Morphine and Dopamine Levels In
Vitro and In Vivo
[0159] Mytilus edulis collected from the local waters of Long
Island Sound were maintained as described herein. For the
biochemical in vitro analysis of either dopamine (DA) or morphine,
groups of 20 animals had their pedal ganglia excised on ice at
different time periods and incubated with different concentrations
of tyrosine or tyramine, ranging from 1 to 100 ng/mL. Ganglia were
maintained in a 50:50 mixture of boiled cell-free artificial sea
water and Instant Ocean (Boston, Mass.). The pedal ganglia were
incubated with and without tyrosine or tyramine in the presence of
quinidine, a CYP2D6 inhibitor, and alpha methyl para tyrosine
(AMPT), which inhibits tyrosine hydroxylase.
[0160] For in vivo treatments, the animal's foot (20 animals per
treatment) was injected with tyrosine (10.sup.- M), tyramine
(10.sup.- M), or saline. Other animals were exposed to the enzyme
inhibitors AMPT or quinidine alone or immediately following the
respective foot injection. After a 1-hour incubation in seawater at
room temperature, ganglionic morphine levels were determined via
the HPLC and RIA methods described herein. All chemicals were
purchased from Sigma (St. Louis, Mo.).
Extraction and HPLC UV Detection of DA
[0161] Dopamine was extracted from both ganglia (20 pedal ganglia
per treatment; replicated 4 times) and hemolymph (10 mL per
treatment; replicated 4 times). After ganglionic dissection,
ganglia were pooled into one eppendorf tube, 1 ml of 1 N HCl was
added, and the tissue was sonicated by sonic dismemberator (Fisher
scientific, USA). Homogenized tissue was then transferred to a 15
mL polypropylene centrifuge tube (Fisher Scientific, PA, USA). 5 mL
of chloroform/isopropanol (9:1, v/v) was added, and the contents of
the tube vigorously vortexed for 5 minutes at room temperature.
Tubes were centrifuged at 4000 rpm for 15 minutes at 4.degree. C.
Supeniatant (water soluble layer) was dispatched into
pre-siliconized 1.5 tubes (Midwest Scientific) and kept at
4.degree. C. for immediate use for HPLC determination or stored at
-80.degree. C. for further analysis.
[0162] HPLC was performed with waters 626 pump and 2487 dual
.lamda. absorbance detector. A Xterra RP18 column with 5.mu. size
particle was used to purify dopamine. Isocratic mobile phase was
applied with one buffer (1 mM CH.sub.3COONH.sub.4, 98% distilled
water and 2% HPLC grade of acetonitrile (Fisher Scientific). Follow
rate was set at 0.5 mL/minute. A concentration curve was obtained
by running different contractions of dopamine. The detection limit
was 0.5 .mu.g/mL.
[0163] CYP2D6 Molecular Demonstration and Isolation of Total
RNA
[0164] Pedal ganglia (100) were immediately processed after
dissection. The ganglia were placed in 1.5 mL tubes and then washed
with PBS (Invitrogen, Carlsbad, Calif.). Total RNA was isolated
using the RNeasy mini kit (Qiagen, Valencia, Calif.). Ganglia were
homogenized in 600 .mu.L buffer RLT. The samples were processed
following the manufacturer's instructions. In the final step, the
RNA was eluted with 50 .mu.L of RNase-free water by centrifugation
for 1 minute at 10,000 rpm.
Reverse Transcription-Coupled Polymerase Chain Reaction
(RT-PCR)
[0165] First-strand cDNA synthesis was performed using random
primers (Invitrogen, Carlsbad, Calif.). 1 .mu.g of total RNA was
denatured at 95.degree. C. and reverse transcribed at 40.degree. C.
for 1 hour using Superscript III Rnase H-RT (Invitrogen, Carlsbad,
Calif.). Ten microliters of the RT product was added to the PCR mix
containing primers for CYP2D6 and CYP2D7 genes and Platinum Taq DNA
polymerase (Invitrogen, Carlsbad, Calif.). The forward primer
sequence was 5'-GGCCAAGGGGAACCCTGAGA-3' (SEQ ID NO:5) and reverse
primer was 5'-GGTCATACCCAGGGGGACGA-3' (SEQ ID NO:6). The PCR
reaction was denatured at 95.degree. C. for 5 minutes followed by
40 cycles at 95.degree. C. for 30 seconds, 60.degree. C. for 30
seconds, and 72.degree. C. for 1 minute, and then an extension step
cycle at 72.degree. C. for 10 minutes. PCR products were analyzed
on a 2% agarose gel (Sigma, St. Louis, Mo.) stained with ethidium
bromide. The expected sizes of the PCR products were 282 bp for
CYP2D6 and 340 bp for CYP2D7.
DNA Sequencing
[0166] After excising the PCR product from the gel, DNA
purification was performed with the Qiaquick gel extraction kit
(Qiagen). The PCR product was dissolved in 35 .mu.L H.sub.2O and
sent to Lark Technologies, Inc. (Houston, Tex.) for direct
sequencing.
Results
[0167] Mytilus pedal ganglia were incubated in vitro with tyrosine
or tyramine, both of which resulted in an increase in ganglionic
morphine levels in a concentration and time dependent manner (FIG.
16; P<0.001, from 1.08.+-.0.27 ng/g ganglionic wet weight to
2.51.+-.0.36 ng/g for tyramine and from 0.96.+-.0.31 ng/g to
2.39.+-.0.64 ng/g for tyrosine). The increase in ganglionic
morphine levels, after tyrosine and tyramine exposure, occurred
gradually over the 60 minute incubation period (FIG. 16B). About 7
percent of tyrosine or tyramine appears to be converted to morphine
under these in vitro conditions. Blank runs between morphine HPLC
determinations as well as running negative tissue controls, e.g.,
mantle, did not reveal a morphine residue with HPLC coupled RIA.
Analysis of the marine water and various chemicals used in the
protocol also demonstrated a lack of morphine.
[0168] Ganglia treated with quinidine and tyramine exhibited less
tyramine-induced morphine production than the levels observed with
ganglia treated with tyramine only (FIG. 17). This inhibition of
morphine production was quinidine concentration dependent (FIG.
17). Likewise, ganglia treated with AMPT and tyrosine exhibited
less tyrosine-induced morphine production than the levels observed
with ganglia treated with tyrosine only (FIG. 18). This inhibition
of morphine production was AMPT concentration dependent (FIG. 18).
Exposure to either enzyme inhibitor alone did not significantly
reduce morphine levels below the level of non-exposed ganglia
(FIGS. 17 and 18). Exposure of pedal ganglia to both enzyme
inhibitors, however, reduced ganglionic morphine levels
significantly (0.23.+-.0.16 ng/g wet weight .+-.SEM; P<0.01)
below that of controls (0.99 and 0.92 ng/g wet weight,
respectively), indicating that both pathways were working
simultaneously, compensating for the other's inhibition.
[0169] To examine the tyramine to dopamine step, dopamine (DA)
levels in ganglia and hemolymph were examined before and after
tyramine addition followed by CYP2D6 inhibition by quinidine.
Tyramine injection significantly increased ganglionic (4.98.+-.0.27
.mu.g/g to 9.17.+-.1.21 .mu.g/g wet weight; P<0.01) and
hemolymph (10.13.+-.1.24 .mu.g/mL to 16.47.+-.1.28 .mu.g/mL,
P<0.05) DA levels (FIGS. 19 and 20). The ganglionic and
hemolymph DA level increases were blocked by quinidine exposure,
demonstrating that the CYP2D6 enzyme was mediating this step.
Ganglia were also exposed to THP, reticuline, DA, or codeine. Each
resulted in significantly enhanced morphine levels, a phenomenon
that was also significantly blocked by quinidine exposure, again
demonstrating a role for CYP2D6 in the second part of the morphine
biosynthetic pathway (FIGS. 15 and 20).
[0170] A molecular analysis was performed to confirm the
pharmacological evidence for the involvement of CYP2D6 in ganglia.
Briefly, RT-PCR was used to amplify a 282 bp fragment from Mytilus
tissue. The sequence of this fragment was found to be about 94
percent similar to the human cytochrome P450, family 2, subfamily
D, polypeptide 6 mRNA sequence set forth in GenBank accession
number M20403 (FIG. 21).
[0171] In in vivo experiments, animals were injected with either
tyrosine (10.sup.-5 M) or tyramine (10.sup.-5 M) in their foot. One
hour after injection, ganglia were dissected and extracted for
morphine analysis. Both precursors significantly enhanced
ganglionic morphine levels compared with control values
(2.46.+-.0.22 ng/g wet weight for tyrosine and 3.28.+-.0.45 ng/g
for tyramine compared to controls 1.02.+-.0.24 ng/g; P<0.001;
FIG. 22). Statistical significance was not be achieved at the
10.sup.-7 to 10.sup.-6 M concentrations, but was achieved at the
10.sup.-5 M concentration (FIG. 22). Additionally, 20 animals per
drug protocol were injected via the foot with either AMPT
(10.sup.-4 M) or quinidine (10.sup.-4 M). These animals did not
exhibit any change in morphine levels even when both AMPT and
quinidine were co-administered. This indicates that basal morphine
levels were being maintained via morphine storage, or the
inhibitors did not reach the ganglia. Compared to controls injected
with saline, the tyrosine and tyramine animals exhibited a
significant decrease in ganglionic morphine levels when the
respective enzyme inhibitors were topically applied to the pedal
ganglia of intact animals after they were injected with the
respective amino acids in the foot (decrease of 30 and 25 percent,
respectively; P<0.01; FIG. 22). In this regard, it was estimated
that only 1-2 percent of the injected amino acids were directed to
morphine biosynthesis.
[0172] Taken together, these results demonstrate that tyrosine and
tyramine are, in part, being converted to dopamine then morphine,
and that this process can be inhibited by altering either or both
CYP2D6 or tyrosine hydroxylase. This process appears to be dynamic
in that the inhibition of one pathway allows the other to continue
with morphine synthesis. Moreover, dopamine and morphine synthesis
appear to be coupled (FIG. 15). In particular, these results
demonstrate that morphine biosynthesis can occur by way of tyrosine
and/or tyramine, making it very likely that morphine synthesis
occurs regardless of circumstances. As demonstrated, neither AMPT
or quinidine when administered alone reduced endogenous morphine
levels below that of controls suggesting the presence of a storage
pool of morphine. Co-administration of AMPT and quinidine reduced
endogenous morphine levels below that of controls. These results
indicate that if one pathway is blocked, the overall pathway
continued because the other complementary pathway to dopamine
remains functional. This coupling to dopaminergic processes can
have biomedical implications. For example, the DA component can
modulate excitatory states, including rage, whereas the
morphinergic component can result in a calming action associated
with relaxation and reward. This association can explain the
calming effect that follows excitatory emotional states.
Example 8
Use of Low Dose Morphine
[0173] The following experiments were performed to evaluate the
ability of low doses of morphine to exert biological effects. Whole
Mytilus animals were treated with saline or morphine (10.sup.-6 to
10.sup.-10 M) by injection. After a five minute incubation,
hemolymph was collected and incubated with LPS (1 .mu.g/mL). Cells
from animals pretreated with morphine from 10.sup.-7 to 10.sup.-10
M did not exhibit a reduction in the level of cell activation that
was observed with LPS-treated cells obtained from saline-treated
animals (FIG. 23). Cells from animals pre-treated with morphine
(10.sup.-6 M) exhibited 19.3.+-.3.8 percent activation. Thus, lower
doses of morphine did little to alter the LPS stimulatory action on
immunocytes when administered in an almost concomitant manner.
[0174] Whole Mytilus animals were treated daily with saline or
morphine (10.sup.-6 to 10.sup.-10 M) by injection for 4 days. After
a five minute incubation, hemolymph was collected and incubated
with LPS (1 .mu.g/mL). Cells from animals pre-treated with morphine
from 10.sup.-7 to 10.sup.-9 M exhibited a reduction in the level of
cell activation that was observed with LPS-treated cells obtained
from saline-treated animals (FIG. 24). Cells from animals
pre-treated with morphine (10.sup.-10 M) did not exhibit a
reduction in the level of cell activation. Thus, lower doses of
morphine (e.g., 10.sup.-7 to 10.sup.-9 M) can limit excitatory
activations and possibly reduce pre-existing activation when given
over time.
[0175] 100 healthy Mytilus animals were treated with 10 U/mL of
TNF-.alpha. by injection. After 4 days, about 20 percent of the
TNF-treated animals died (FIG. 25). Pre-treatment for four days
with daily injections of morphine at a low dose (10.sup.-7 M)
reduced the number of animals that died (FIG. 25). These results
demonstrate that repeated administration of low doses of morphine
can protect against TNF-.alpha.-induced death by apparently
reducing the level of TNF-.alpha.-induced inflammation within the
animals.
[0176] In another experiment, COS-1 cells were transfected with
nucleic acid that directs expression of a human mu3 opiate
receptor. The stably transfected cells were then incubated with
morphine, and the amount of nitric oxide (NO) released from the
cells was measured amperometrically. Cells treated with 10.sup.-7 M
and 10.sup.-8 M of morphine released 9.+-.2 nM and 18.+-.3 nM of
NO, respectively, within 2 minutes of morphine addition. These
results demonstrate that the mu3 opiate receptor mediates morphine
coupled no release.
[0177] In another experiment, human saphenous veins were treated
with morphine and assessed for NO release. Tissue treated with
2.times.10.sup.-7 M morphine released 7.+-.2 nM of NO. When
pre-treated with 10.sup.-6 M of CTOP, an opiate receptor inhibitor
specific for mu receptors, 10 minutes before adding morphine, no NO
release was detected. These results demonstrate that the NO release
was mediated via an opiate receptor.
[0178] Mytilus animals were divided into three groups. The first
group was a control group with each animal being untreated prior to
receiving a single injection of saline. The second and third groups
of animals received daily injections of 1 .mu.M and 0.01 .mu.M of
morphine, respectively, via the foot. Two hours post-injection,
pedal ganglia were obtained from the animals and assessed for mu3
opiate receptor binding densities. This experiment was repeated 5
times, each with a separate set of Mytilus animals.
[0179] Treatment with 1 .mu.M of morphine resulted in reduced mu3
opiate receptor binding, while treatment with 0.01 .mu.M of
morphine did not (FIG. 27). These results demonstrate that low dose
morphine is effective without altering binding site densities.
[0180] 45 Mytilus animals were divided into three groups. The first
group was a control group with each animal receiving a mock
injection of saline. The second and third groups of animals
received daily injections of 1 .mu.M and 0.01 .mu.M of morphine,
respectively, via the foot for up to four days. Two hours
post-injection, NO release was measured. This experiment was
repeated 5 times, each with a separate set of Mytilus animals.
[0181] Animals receiving 1 .mu.M morphine exhibited NO release on
day one (FIG. 28). The level of NO release for animals receiving 1
.mu.M morphine for four days, however, was substantially lower than
the level of NO release observed after one day of treatment with 1
.mu.M morphine. When challenged with 10 .mu.M morphine, animals
receiving 1 .mu.M morphine for four days exhibited about half the
amount of NO release observed with animals receiving 1 .mu.M
morphine for one day. These results demonstrate that animals
receiving repeated administrations of 1 .mu.M morphine develop
tolerance to morphine. Animals receiving 0.01 .mu.M morphine
exhibited NO release on day one at a level similar to that which
was also observed after days two, three, and four (FIG. 28). These
results demonstrate that animals receiving repeated administrations
of 0.01 .mu.M morphine continue to respond to morphine
administration without developing detectable or significant
tolerance to morphine.
[0182] In another experiment, human SH-SY5Y cells were cultured in
96 well plates (250,000 cells per well). The cells were
continuously exposed to 10.sup.-8 M or 10.sup.-6M of morphine
sulfate. At various time points (initial and 1, 2, and 7 days), the
cells were washed in phosphate buffered saline (PBS), placed in 250
.mu.L PBS, and assessed for NO release. NO release was measured
using an Apollo-4000 free radical analyzer with a 30 .mu.m probe.
The probe was calibrated daily with SNAP. Each assay was performed
in quadruplicate. The mean .+-.the standard error were graphed for
each time point. Control cells remained untreated until being
challenged with 10.sup.-6 M morphine.
[0183] Cells treated with a high morphine dose of 10.sup.-6 M lost
their initial levels of NO release, while cells treated with a low
morphine dose of 10.sup.-8 M remained capable of releasing NO in
response to morphine (FIGS. 29 and 30). Cells treated daily with
10.sup.-6 M morphine for six days and given 10.sup.-6 M of morphine
on the seventh day exhibited 3.4 nM of NO release. These results
demonstrate that tolerance occurs only at the high dose.
Example 9
Morphine-6.beta.-glucuronide Increases mu3 Opiate Receptor
Expression Levels
[0184] Human blood cells (mononuclear cells and polymorphonuclear
cells) were incubated with 10.sup.-7 M morphine-6.beta.-glucuronide
(M6G) for 30 minutes and assessed from the relative gene expression
level of mu3 opiate receptor sequences using real time RT-PCR
(Applied Biosystems 5700 SDS). In addition, the cells were either
incubated with or without 10.sup.-6M CTOP 10 minutes prior to
adding M6G.
[0185] Both mononuclear cells and polymorphonuclear cells exhibited
an increase in mu3 opiate receptor expression when treated with M6G
(FIG. 31). In both cases, the increase in mu3 opiate receptor
expression levels was blocked by CTOP pre-treatment (FIG. 31).
These results demonstrate that the increase in mu3 opiate receptor
expression levels is mediated by M6G.
Example 10
Morphine Modulates .beta.-amyloid Metabolism Via Nitric Oxide
Providing a Protective Mechanism for Morphine in Alzheimer's
Disease
[0186] The deposition of intracellular and extracellular
.beta.-amyloid peptide (A.beta.) in the brain is a pathologic
feature of Alzheimer's disease (AD), a prevalent neurodegenerative
disorder. The following experiments were performed to better
understand the role of A.beta. in causing AD's symptoms.
Methods and Materials
[0187] SH-SY5Y human neuroblastoma cells (ATCC, USA) were cultured
in Dulbecco's modified Eagle's medium/Ham's nutrient mixture
(DMEM-F12) (Invitrogen, USA), and HTB-11 human neuroblastoma cells
(ATCC, USA) were cultured in Minimum Essential Medium Alpha Medium
(MEM-.alpha.) (Invitrogen, USA). Cells were kept in a 37.degree. C.
incubator (Napco) gassed with 5% CO.sub.2/95% air. All treatments
were performed under a sterile hood.
[0188] Reverse transcriptase-polymerase chain reaction (RT-PCR) was
performed to analyze the effects of A.beta..sub.1-42, morphine, and
SNAP treatments upon BACE-1 and BACE-2 mRNA expression in SH-SY5Y
and HTB-11 cells. After the treatment time-period, cells were
harvested, and total RNA was extracted using RNeasy RNA Isolation
kit (Qiagen) following the manufacturer's procedures. Total RNA
yield was determined using a Spectrophotometer RNA/DNA calculator
(Pharmacia Biotech). Total RNA concentration was then standardized
for semi-quantitative RT-PCR, which was carried out in a Geneamp
Thermocycler PCR System 9700 (P.E. Applied Biosystems). Primers
used for PCR were as follows: Forward 5'-TGACTGGGAACACCCCATAACT-3'
(SEQ ID NO:7) and reverse 5'-CGAGCGCCTCAGTGTTACTCT-3' (SEQ ID NO:8)
for BACE-1, and forward 5'-AGCCATCCTCCTTGTCTTAATCG-3' (SEQ ID NO:9)
and reverse 5'-TCTGGCGGAAAATAACCTCAA-3' (SEQ ID NO:10) for BACE-2.
The expected product length was 556 bp for both primer sets. PCR
products and a 100 bp DNA marker were then loaded in a 2% agarose
gel stained with ethidium bromide. Gel electrophoresis was
performed using a power-supply (E-C Apparatus Corp.) set at 110V
with constant amperage for 1.5 hours. Gels were then photographed
using a Gel Documentation System (UVP), and bands analyzed using
Gel-Pro Analyzer (MediaCybernetics) on a P4 Windows machine.
Expression levels were standardized to a reference gene,
cyclophilin, using the following primers: forward
5'-TTTCGTGCTCTG-AGCACTGG-3' (SEQ ID NO:11) and reverse
5'-CTTGCCATTCCTGGACCCAA-3' (SEQ ID NO:12).
[0189] The production of NO in SH-SY5Y cells was detected using the
Apollo 4000 Free Radical Analyzer (World Precision Instruments).
SH-SY5Y cells were trypsinized and cultured in a 6-well plate for
48 hours. An L-shaped amperometric NO-specific probe was connected
to the Apollo Analyzer and calibrated using a SNAP+CuCl.sub.2
solution, which releases calculable amounts of NO. Cells were
pretreated with 10 and 25 .mu.M A.beta. for 30 minutes and 24
hours. At the end of the treatment time-point, the media was
removed and replaced with PBS warmed in a 37.degree. C. bath, which
is non-reactive with the probe. The probe was inserted about 1.5 mm
above the cells and allowed to equilibrate for 5 minutes. Then,
morphine-6.beta.-gluconuride (M6G) was added to each plate at a
concentration of 1 .mu.M. M6G attaches to G-protein-coupled mu3
receptors on SH-SY5Y cells, stimulating release of Ca.sup.+2 ions
which activate cNOS (Cadet et al., Frontiers in Bioscience,
9:3176-86 (2004)), thereby normally releasing constitutive NO from
neuroblastoma cells within minutes. The probe was monitored in
real-time for the production of NO "spikes." NO data was recorded
using Free Radical Analyzer (World Precision Instruments). Cells
were then discarded.
[0190] A.beta..sub.1-42, nitro-L-arginine methyl ester (L-NAME),
ethidium bromide, and trypsin-EDTA were purchased from
Sigma-Aldrich, USA. 0.1 M dithiothreitol (DTT), 10.times.
Polymerase Chain Reaction (PCR) buffer, Superscript
reverse-transcription enzyme, TAQ polymerase, 50 .mu.M MgCl.sub.2,
5.times. First Strand Buffer, the custom PCR primers, and random
primers were purchased from Invitrogen, USA, and stored at
-20.degree. C. Phosphate-buffered saline was also purchased from
Invitrogen, USA, and stored at room temperature. Nucleotides
(dNTPs) were purchased from Amershar Pharmacia Biotech, USA, and
stored at 25 .mu.M concentration at -20.degree. C. RNeasy RNA
Isolation reagents and columns were purchased from Qiagen, USA. A
stock solution of the A.beta..sub.1-42 peptide was prepared at 1 mM
concentration and kept frozen at -20.degree. C.
Electrophoresis-grade agarose was purchased from Fisher Biotech,
USA, and stored at room temperature. S-Nitroso-N-acetyl-D,
L-penicillamine (SNAP) used for both cell treatment and NO detector
calibration was purchased from World Precision Instruments,
USA.
Results
[0191] Untreated HTB-11 cells constitutively express BACE-1 and
BACE-2 mRNA. Morphine exposure to these cells down regulates the
expression of BACE-1 after 24 hours in a concentration dependent
manner (1 .mu.M dosage having a greater effect than 5 .mu.M, 44% as
compared to 18%; FIG. 32). Simultaneously, morphine up regulates
the expression of BACE-2 expression in HTB-11 cells, an effect
enhanced in the presence of A.beta..sub.1-42 (FIG. 33). Since
BACE-1 promotes production of A.beta..sub.1-42 and BACE-2 inhibits
it, morphine can be neuroprotective since morphine modulation of
the BACE enzymes would decrease A.beta..sub.1-42 production.
Morphine's effects on both BACE-1 and BACE-2 expression were
blocked by naloxone (FIG. 34), verifying that the neuroprotective
action of morphine is directly related to its binding to the mu3
opiate receptor.
[0192] One of endogenous morphine's primary physiological effects
is cNOS derived NO release via mu3 opiate receptor subtype
coupling. To determine whether morphine's neuroprotective effects
on the A.beta. pathway were NO dependent, HTB-11 cells were treated
with L-NAME, a cNOS inhibitor. L-NAME significantly blocked the
effects of morphine (FIG. 35), indicating that NO release is
involved in morphine's neuroprotective moderation of BACE-1 and -2.
HTB-11 cells were exposed to SNAP, a NO donor, and then analyzed
for BACE expression levels. After 4- and 24-hour exposures, cells
treated with SNAP exhibited reduced BACE-1 expression in a
concentration dependent manner similar to that observed with
morphine, which also was enhanced in the presence of
A.beta..sub.1-42 (FIGS. 36 and 37). SNAP also up regulated in a
concentration dependent manner BACE-2 expression at both the 4- and
24-hour timepoints (FIGS. 38 and 39), as did morphine. In the
presence of A.beta..sub.1-42, SNAP dose-dependently increased
BACE-2 expression (FIGS. 38 and 39).
[0193] To verify the semi-quantitative accuracy of the RT-PCR
procedures and to explore whether the effects of SNAP on BACE
expression occur earlier than four hours, gene expression of BACE-1
and BACE-2 was analyzed in an additional mRNA expression experiment
for two hours (FIG. 40). BACE-1 and BACE-2 expression levels were
altered in cells treated with SNAP for two hours with BACE-1
expression being down-regulated and with BACE-2 expression being
up-regulated. The expression of the reference gene .beta.-actin was
not affected.
[0194] SH-SY5Y neuroblastoma cells normally release NO via cNOS in
response to application of either morphine or its metabolite, M6G.
To determine whether API-42 disrupts this process, SH-SY5Y cells
were pre-treated with varying concentrations of A.beta..sub.1-42
for 1 hour. Following the addition of M6G, the
A.beta..sub.1-42-treated cells exhibited a dose-dependent decrease
in NO release, demonstrating that A.beta..sub.1-42 is
dose-dependently inhibiting the release of constitutive NO (FIG.
41). Pretreatment with L-NAME (10.sup.-4 M), a cNOS inhibitor, for
4 minutes also prevented M6G-induced release of NO, verifying that
M6G was inducing release of NO through cNOS given the rapid time
course of the coupling (FIG. 41; panel G). The reduction of
M6G-induced NO release after A.beta..sub.1-42 treatment suggests
that A.beta..sub.1-42 is either (a) directly inhibiting the
activation of cNOS or (b) interfering with the binding of M6G to
the mu3 opiate receptor, both of which would potentially impact the
level of basal NO in the AD-afflicted human brain. Furthermore,
SH-SY5Y cells release NO at a low level compared to human immune
and vascular tissues (3-4 nM compared to 26-29 nM when treated with
morphine at 10.sup.-6 M).
[0195] These results demonstrate that morphine, in a concentration
and time dependent manner, up regulates BACE-2 expression while
simultaneously down regulating BACE-1 expression. This phenomenon
can be blocked by treating the cells with the opiate receptor
antagonist, naloxone. This morphine-mediated process is coupled to
cNOS-derived NO release, which was ascertained by treating the
tissue with the NOS inhibitor L-NAME. NO alone can mediate this
effect, further substantiating this observation. Additionally, in
the presence of A.beta..sub.1-42, both the morphine and NO effects
are enhanced. A.beta..sub.1-42 alone appears to have the ability to
inhibit cNOS-derived NO release at higher concentrations. A two-way
relationship between A.beta..sub.1-42 and morphine/NO appears to
exist. Morphine/NO modifies the expression of two polypeptides
involved in the production of A.beta., down regulating BACE-1
expression and up regulating BACE-2 expression. In addition, after
long-term incubation, A.beta..sub.1-42 appears to enhance the
ability of NO to modify BACE expression. Taken together, morphine,
via its coupling to NO, appears to be neuroprotective since it
promotes BACE-2 up regulation, which enhances A.beta. catabolism,
avoiding the effect of A.beta. inhibiting NO production.
[0196] The results provided herein can support the following
pathway regarding the origin of AD (FIG. 42). Assuming a deficiency
of endogenous morphine or other cNOS activators/scavengers, a
decrease in levels of basal NO can occur over time. Reduced NO
levels can result in increased BACE-1 expression and reduced BACE-2
expression. More BACE-1 then becomes available to cleave APP into
A.beta., and A.beta. levels increase. A.beta. can then be secreted
out of the cell to aggregate into amyloid plaques, and soluble AD
levels increase within the cell. Internalized A.beta. can inhibit
NO release by the cell, which then can create a vicious cycle
causing NO levels to be further decreased, lessening regulation of
the BACE genes, which again increases the production of A.beta..
Simultaneously, A.beta. can promote a chronic and progressively
increasing inflammatory reaction, initiating both vascular and
neural damage. As the pathology of AD continues, NO levels can
decrease to a point where hypoperfusion of the brain becomes
chronically destructive. In brain cells, oxidative stress can
increase, and neurons can undergo apoptosis. The result can be an
overall decrease in neuronal function, producing memory loss,
cognitive disorders, and other typical symptoms of AD.
Example 11
Modulation of the Ubiquitin-Proteasome Complex Via Morphine Coupled
No Release
[0197] The following experiments were performed to determine if
morphine and NO play a role in the prevention of cellular stress
via protein metabolism. In particular, the following experiments
were performed to determine if morphine, via stimulating the
production of NO, protects neural cells by attenuating the
induction of cellular stress and imbalances in protein
metabolism.
Methods and Materials
[0198] The human SK-N-SH neuroblastoma cell line (ATCC #HTB-11) was
used as a cellular model. Cells were propagated in Minimum
Essential Medium alpha (MEM.alpha.) with 10% fetal bovine serum
(FBS), 2% penicillin/streptomycin, 1.5 g/L NaHCO.sub.3, and 1.0 mM
pyruvic acid. A 5% CO.sub.2 incubator (NAPCO) at 37.degree. C. was
used for maintenance of temperature and pH. A trypsin-EDTA solution
(0.25% trypsin, 0.03% EDTA) was used to aspirate and pellet the
adherent cells (400 G for 5 minutes at room temperature). When
needed, cells were plated in 6- or 12-well plates using a
hemocytometer (2.times.10.sup.5 cells/well in 6-well plates or
1.times.10.sup.5 cells/well in 12-well plates). Experimental
manipulations were performed under sterile conditions under a
lamina airflow hood after cells had adhered to the bottom of the
plates.
[0199] Compounds were weighed accurately using an atomic balance
and eluted with solvent under sterile conditions. Rotenone (Sigma),
a mitochondrial complex I inhibitor, and IFN.gamma. (Endogen) were
used to stimulate oxidative and inflammatory stress. Morphine
sulfate (Sigma) was obtained in solution along with naloxone (a mu3
opiate receptor antagonist) and L-NAME (an NO synthase
inhibitor).
[0200] Cell viability was determined via Trypan blue exclusion. An
inverted light microscope (Nikon) with a phase-contrast filter was
used to observe the cells. Pictures of the cells were taken via a
digital camera (Optronix) attached to the microscope ocular. Images
were uploaded onto ImagePro Plus Software (Applied Biosystems),
where cell viability was calculated based on both the number of
cells covering the field and the cells that present as dead from
the stain. In addition, ImagePro Plus was used for determining
cellular morphology. The area and perimeter were found and used in
the formula (4.pi.*Area)/(Perimeter).sup.2, resulting in a value
between 0 (a straight line) and 1 (a perfect circle).
[0201] Isolation of total RNA was performed via RNA MiniPrep Kit
(QIAGEN). Concentration of RNA was determined via GeneQuant II
Spectrophotometer (Pharmacia Biotech) by multiplying A260 value
with dilution factor and nucleic acid constant (0.04). Agarose gel
electrophoresis (1%) was used to check for RNA quality.
[0202] RT and PCR reactions were performed in GeneAmp PCR System
9700 (Applied Biosystems) using reverse transcriptase and Taq DNA
Polymerase. Forward and reverse gene specific-primers for various
subunits of the 20S proteasome and immunoproteasome were either
obtained from the literature or designed through Primer Express
Software 2.0 (Applied Biosystems) (Table 4). NMDA receptor subunit
primers were also designed (Table 4). NMDA receptor expression was
used as a marker of neurodegenerative disease.
TABLE-US-00004 TABLE 4 Gene Specific Forward and Reverse Primers
Forward Primer Reverse Primer Fragment Primer Name (5'.fwdarw.3')
(5'.fwdarw.3') Size 20S Proteasome CTCGCCTTCAAGTTCCAGCA
TGCAGCAGGTCACTGACATC 483 bp LMP7 Subunit (SEQ ID NO: 13) (SEQ ID
NO: 14) (.beta.5i) 20S Proteasome AGAGACCGCTACCGGTGAACC
TGCAGCAGGTCACTGACATC 245 bp X Subunit (.beta.5) (SEQ ID NO: 15)
(SEQ ID NO: 14) 20S Proteasome AGATACCAACACAACGATATG
CTCTCCAAGTAAGTACGAGC 230 bp C2 Subunit (.alpha.) (SEQ ID NO: 16)
(SEQ ID NO: 17) 20S Proteasome TCAGGTGGTGTTCGTCCATT
TTCAAAGCTTTCCTTTAGGGTT 220 bp C3 Subunit (.alpha.) (SEQ ID NO: 18)
(SEQ ID NO: 19) NMDA NR1 GATGTCTTCCAAGTATGCGGA
GGGAATCTCCTTCTTGACCAG 667 bp Subunit (SEQ ID NO: 20) (SEQ ID NO:
21) NMDA NR2B CCCAGCATTGGCATTGCTGTC CATGATGTTGAGCATTACGGA 394 bp
Subunit (SEQ ID NO: 22) (SEQ ID NO: 23) .beta.-actin
GTGGGGCGCCCCAGGCACCA CTCCTTAATGTCACGCACGATT 557 bp Reference Gene
(SEQ ID NO: 24) (SEQ ID NO: 25)
[0203] All primers were optimized for annealing temperatures and
cycles (Table 5). Gel electrophoresis (2% agarose, 0.01% ethidium
bromide) was performed and analyzed using a UV transilluminator
(UVP) and GelPro Analyzer Software (Applied Biosystems). Relative
band intensity was normalized with .beta.-Actin reference gene.
TABLE-US-00005 TABLE 5 Primer Optimization Denatura- Annealing
Number Primer Name tion 30 sec Extension of Cycles 20S Proteasome
LMP7 95.degree. C. 57.degree. C. 72.degree. C. 32 Subunit
(.beta.5i) 30 sec 1 min 20S Proteasome 57.degree. C. 30 X Subunit
(.beta.5) 20S Proteasome C2 55.degree. C. 35 Subunit (.alpha.) 20S
Proteasome C3 55.degree. C. 35 Subunit (.alpha.) NMDA NR1 Subunit
55.degree. C. 35 NMDA NR2B Subunit 65.degree. C. 35 .beta.-actin
Reference Gene 55.degree. C. 25
[0204] To determine protein concentrations, protein was harvested
using the following buffer: 20 mM Hepes (Sigma), 100 mM NaCl
(Fisher), 10 mM NaF (Sigma), 1% Triton X-100 (Sigma), 1 mM sodium
orthovanadate (Sigma), 10 mM EDTA (Sigma), pH 7.4, 0.1% protease
inhibitor cocktail (Sigma), and ddH.sub.2O. Homogenized samples
were spun in an ultracentrifuge at 10,000 G for 20 minutes at
4.degree. C. Concentration was determined via the Bradford assay
(Bio-Rad) using bovine serum albumin (BSA, Sigma) for standard
curve. To eliminate any potential pipetting error, samples and
standards were read in triplicate.
[0205] Western blotting was performed as follows.
SDS-polyacrylamide gels (12% for separation and 5% for stacking)
were made using the Mini Trans-Blot Cell (Bio-Rad). Based on the
concentrations from the protein concentration determination assay,
the proteins were mixed with 2.times. Protein Loading Buffer (0.2M
DTT) for a final volume of 24 .mu.L. Tris-Glycine Electrophoresis
Buffer (1.times.) was used in SDS-PAGE, and proteins were separated
at constant amperage (35 mA).
[0206] Subsequent protein transfer to a nitrocellulose membrane
involved use of the Mini Trans-Blot Cell apparatus run at constant
voltage (100V) for 40 minutes. Overnight blocking was performed in
5% non-fat dry milk dissolved in TBST buffer at 4.degree. C.
Primary and secondary antibodies were used (Table 6). The primary
incubation lasted for 1 hour and was followed by 4 washes with TBST
buffer, 10 minutes each. The secondary incubation lasted for 1 hour
and was followed by 3 washes with TBST buffer, 15 minutes each.
TABLE-US-00006 TABLE 6 Primary and Secondary Antibodies Type
Dilution Company Primary Antibody 20S Proteasome X Rabbit 1:1000
Affinity (.beta.5) Subunit Polyclonal Bioreagents, Inc.
Immunoproteasome Rabbit 1:1000 Affinity LMP7 (.beta.5i) Subunit
Polyclonal Bioreagents, Inc. Ubiquitin Mouse 1:100 Santa Cruz
(whole molecule) Monoclonal Biotechnologies, Inc. Secondary
Antibody HRP Conjugated Anti-Mouse 1:12500 Pierce, Inc. HRP
Conjugated Anti-Rabbit 1:12500 Sigma-Aldrich, Inc.
[0207] Substrate (Pierce) was administered as a means of
stimulating chemiluminescence. Blots were developed and
subsequently analyzed for relative band intensity using Gel-Pro
software (Applied Biosystems).
[0208] Proteasome function assays were performed in an effort to
examine the modulation in levels of protein degradation.
Fluorometric assays were performed for both the chymotrypsin
activity of the 26S proteasome as well as activity of the whole 20S
proteasome using procedures adapted from Kotamraju et al. (Proc.
Natl. Acad. Sci. USA, 100:10653-8 (2003)). Excitation at 365 nM and
emission at 460 nM of the fluorogenic compound,
4-amido-7-methylcoumarin (AMC), were measured using a
Spectrofluoroscence Detector (McPherson).
[0209] Nitric oxide release was determined upon administration of
morphine sulfate to the neuroblastoma cells through the use of the
Apollo 4000 free radical detector (WPI Sarasota, Fla.). The
amperometric NO probe was calibrated based upon a solution of 0.2M
CuCl.sub.2 using the NO donor, S-nitroso-N-acetyl-L-penicillamine
(SNAP) at concentrations of 10 .mu.M, 20 .mu.M, 40 .mu.M, and 80
.mu.M. To make sure morphine was not reacting with the probe,
negative controls were performed using PBS.
[0210] All data from cell viability and cell morphology experiments
was normalized with the standard error of the mean (.+-.SEM).
RT-PCR data was normalized with .beta.-actin reference gene
expression and, subsequently, .+-.SEM from the average obtained
over the course of three trials. Western blotting involved
densitometric analysis of band intensity based expression of
protein. Functional assays for proteasome activity were normalized
with .+-.SEM for 3 trials. For all experiments, two-variable
t-tests were used to compare levels of significance between
treatments.
Results
[0211] Morphine-stimulated, cNOS-derived NO release occurred in
neuroblastoma cells (FIGS. 43A and B; peak value of 22.3
nM.+-.0.85, p<0.001 compared to baseline 2 .mu.M NO, baseline
was insignificant when compared to negative controls). Naloxone
(10.sup.-6 M) and L-NAME (10.sup.-4 M) blocked the NO release
induced by 10.sup.-6 M morphine (3.2 .mu.M NO and 0.3 .mu.M NO,
respectively).
[0212] Rotenone, an agent inducing oxidative stress at the
intracellular level, stimulated cellular death when used to treat
neuroblastoma cells (LD.sub.50=30 nM). Cell viability experiments
(FIGS. 44A and B) involved a 24-hour pretreatment of morphine
sulfate (5 .mu.M) and a subsequent 48-hour incubation with rotenone
(30 nM). This resulted in a significant level of protection
(p<0.01) between the rotenone-treated cells, which exhibited
about 45% confluency, and the morphine-pretreated cells, which
exhibited an increase to about 78% confluency.
[0213] Cellular morphology was used as an indicator of cell
activation and was calculated via the Form Factor (FF; FF=1 is a
round cell that is immobile and less than 0.7 indicates an
elongated adhering cell; FIG. 44C). The FF determination
demonstrated that morphine produced a neuroprotective effect (cells
were round and inactive) against the toxicity of a 24-hour
pretreatment with rotenone (p<0.003; FIG. 44C). A reversal in
morphine neuroprotection was achieved via treatments with naloxone
(10 .mu.M), an opiate receptor antagonist, and L-NAME (10 .mu.M),
an inhibitor of NO, suggesting that NO was involved with morphine's
protective action.
[0214] The following experiments were designed to determine the
molecular events involved in the protective process. Relative band
intensity was measured in arbitrary units (AU) through a
computer-assisted imaging system. Rotenone was examined for its
ability to induce an imbalance in the expression of a molecular
marker for neurodegenerative disease, the NMDA receptor. A
rotenone-induced imbalance was observed in the NMDA receptor (NR1
and NR2B subunits) mRNA expression, and morphine reversed the
imbalance of this indicator. NR1 expression in controls
(1.57.+-.0.072 AU) was decreased with rotenone to 1.22.+-.0.010 AU
(LD.sub.50, 30-nM) and 1.21.+-.0.028 AU (40 nM; p<0.003 when
compared to control) (FIG. 45A). Morphine (5 .mu.M) significantly
increased NR1 expression to 1.40.+-.0.056 AU at the LD.sub.50 of
rotenone (p<0.035). NR2B expression was 0.98.+-.0.02 in the
control compared to 1.22.+-.0.08 AU and 1.49.+-.0.02 AU (p<0.001
for both compared to control) with 30 nM (LD.sub.50) and 40 DM
rotenone, respectively (FIG. 45B). A significant decrease in NR2B
expression to 1.09.+-.0.06 AU and 1.17.+-.0.04 AU with morphine (5
.mu.M) administration was observed with 30 nM and 40 nM of
rotenone, p<0.042 and p<0.018, respectively, compared to
rotenone values.
[0215] Examination of expression of various subunits of the 20S
proteasome initially involved testing for mRNA expression of the
proteasomal non-catalytic C2 and C3 alpha subunits as well as
catalytic X (.beta.5) subunit since this may be the sight of the
effect. No change in the level of expression of the alpha subunits
was observed.
[0216] Regulation of X subunit expression was observed with
rotenone and morphine, indicating neuroprotection (FIG. 46).
Morphine increased the level of expression of the proteasomal X
subunit in a dose dependent manner at both 4 and 24 hours
(p<0.014 at 4 hours, and p<0.009 from 0.716.+-.0.015 AU
control to 0.868.+-.0.007 AU 5 .mu.M at 24 hours). Morphine (5
.mu.M) induced neuroprotection was observed in a dose dependent
decrease in X subunit expression, which was significant when
compared to treatments with rotenone alone (p<0.01 at 4 hours
and p<0.012 at 24 hours).
[0217] Morphine also stimulated a decrease in mRNA expression of
the LMP7 immunoproteasome subunit, blocking a slight increase in
LMP7 mRNA caused by rotenone (FIG. 47). There was a significant
dose dependent decrease in LMP7 expression from the value of the
rotenone control at 1 .mu.M morphine (p<0.026) and to
0.792.+-.0.001 AU at 5 .mu.M morphine (p<0.018).
[0218] The data above, regarding mRNA expression, was reinforced
through Western blotting detection of the X subunit protein levels.
Relative band intensity was measured in arbitrary units through a
computer-assisted imaging system. A time course with morphine
treatment (FIG. 48A), indicates a dose dependent significant
increase in the level of expression of the X subunit after morphine
administration (1 .mu.M and 5 .mu.M) at 24 hours (p<0.01 with 1
.mu.M compared to control and p<0.001 when 5 .mu.M). The
expression of the X subunit also was examined after concomitant
rotenone treatments and morphine exposure (FIG. 48B). The previous
mRNA results (from FIG. 46) were confirmed by changes in protein
expression, showing evidence of morphine neuroprotection. The
control band intensity of 149 AU increased to 162 AU and 188 AU (1
.mu.M and 5 .mu.M morphine, respectively). Rotenone caused an
increase in expression from control value to 182 AU. There was a
decrease exhibited in morphine-induced neuroprotection from 182 AU
to 168 AU (1 .mu.M morphine) and subsequently to 154 AU
(p<0.028).
[0219] Experiments determining the modulation of the 20S proteasome
and chymotrypsin activity of the 26S proteasome revealed a
differential regulation (FIG. 49). Rotenone decreased the activity
of the chymotrypsin functional 26S active site (control value of
236.+-.4.8 pM to 221.+-.4.8 pM; p<0.043), whereas morphine (5
.mu.M) increased the control value to 277.+-.8.0 pM (p<0.021).
Concomitant treatment of morphine and rotenone resulted in a
restoring of chymotrypsin activity (p<0.050; FIG. 49A). These
results demonstrate that, through the increase in 26S chymotrypsin
activity, morphine was able to prevent the need for increased 20S
activity by decreasing 20S activity (FIG. 49B) involved in
degradation of oxidized and misfolded proteins.
[0220] Western blotting revealed that morphine caused a dose
dependent increase in the levels of free ubiquitin from the control
value of 44 AU to 64 AU and 125 AU (1 .mu.M and 5 .mu.M,
respectively). A slight decrease in free ubiquitin, although not
significant, was observed with rotenone, which was reversed
significantly with concomitant administration of morphine and
rotenone (p<0.039; FIG. 50). The increase in free ubiquitin
expression-ubiquitin not bound to proteins-stimulated by morphine
and subsequent counteraction against the decreased expression
caused by rotenone provides further evidence into the functional
value of morphine neuroprotection.
[0221] To understand the effects of neuroinflammation, interferon
(IFN).gamma. was used to simulate an immune response, i.e.,
proinflammatory. IFN.gamma. did not cause significant cellular
death. However, IFN.gamma. did cause changes in cellular morphology
indicative of the neuroinflammatory stress. A FF increase from
0.54.+-.0.02 to 0.76.+-.0.02 was observed between control and
IFN.gamma. treatments (p<0.014). A decrease in the FF resulted
from concomitant treatment of both morphine and IFN.gamma., (FF
0.76.+-.0.02 to 0.58.+-.0.01 reveals cellular elongation). A
non-significant reversal in morphine neuroprotection was observed
with treatments of naloxone and L-NAME.
[0222] IFN.gamma. induction of LMP7 was examined. IFN-.gamma.
caused an increase in LMP7 expression after 24 hours from the
control value of 0.29.+-.0.01 to 0.93.+-.0.06 (p<0.001),
demonstrating neuroinflammatory stress. Morphine blocked the LMP7
increase induced by IFN.gamma. (p<0.034; FIG. 51).
[0223] Western blotting for the LMP7, after IFN.gamma. stimulated
its expression, revealed that morphine exposure blocked this action
at both 36 and 48 hours (FIG. 52; p<0.001 for comparison between
treatment #2 and treatment #3; p<0.001 for comparison between
treatment #5 and treatment #6).
[0224] These results demonstrates that morphine exerts
neuroprotective actions following the administration of rotenone, a
compound that initiates cellular oxidative stress thereby inducing
a high rate of cell death. Morphine exerts the same protective
mechanism in regard to immune tissues activated by IFN-.gamma.,
which also exerts deleterious actions. Additionally, morphine was
shown to stimulate production of cNOS-derived NO in neuroblastoma
cells. Taken together, morphine appears to exert its protective
actions via constitutive NO release, where NO may act as an
antioxidant.
[0225] Rotenone, an inhibitor of mitochondrial complex I,
stimulates production of ROS and causes cell death. Cells treated
with morphine prior to rotenone exposure, exhibit significant
amelioration of cell death. Moreover, rotenone was able alter the
molecular imbalance between NR1 and NR2B subunits, demonstrating
that cellular stress or oxidative damage occurred. Morphine
corrected this imbalance.
[0226] In regard to the ubiquitin-proteasome complex mRNA and
protein expression, morphine increased X subunit expression in a
dose dependent manner. Interestingly, rotenone also stimulated an
increase in X subunit expression, which was blocked by morphine,
causing a shift in levels of expression back to the control. In
addition, experiments were performed to test for the expression of
LMP7, an immunoproteasome catalytic subunit. These experiments
revealed an increase in LMP7 mRNA expression that was blocked by
morphine, further signifying morphine induced neuroprotection not
only against oxidative stress, but also inflammatory stress as
well.
[0227] Proteasome function assays were performed to observe
proteasome enzymatic activity, i.e., actual protein degradation.
Rotenone caused an increase in activity of the 20S proteasome along
with a decrease in activity of the 26S chymotrypsin active site.
The decreased 26S chymotrypsin activity was most probably due to
increased surface hydrophobicity of oxidized proteins, preventing
intake into the 19S regulatory particle. Thus, 20S activity
increased in order to degrade oxidized proteins. In this regard,
morphine stimulated an increase in 26S chymotrypsin activity and a
decrease in 20S activity. This differential effect may have been
achieved through the nitration of oxidized proteins. NO may have
marked proteins for degradation via the chymotrypsin active site,
specific for nitrated proteins. As more proteins were degraded
through the 26S proteasome, there was a decrease in 20S activity
because of the reduced quantity of oxidized proteins. Thus, from
the proteasome function assays, morphine neuroprotection can be
attributed not only to prevention of ROS, but also through specific
targeting of proteins for degradation at the chymotrypsin active
site on the 26S proteasome.
[0228] Examining free ubiquitin, a marker for protein degradation,
revealed lower levels after treatment with rotenone because more
ubiquitin molecules were used to mark oxidized proteins.
Interestingly, morphine caused a dose dependent increase in
ubiquitin protein expression. This implies that, upon treatment
with morphine, fewer proteins were oxidized and misfolded, further
supporting morphine stimulated neuroprotection.
[0229] Examination of the LMP7 mRNA and protein expression revealed
that morphine inhibited the induction of this immunoproteasome
subunit. Western blotting revealed that IFN-.gamma. caused both a
decrease in X expression, as well as an increase in LMP7
expression. This effect was blocked by morphine after IFN-.gamma.
exposure.
[0230] Taken together, these results demonstrate that morphine, via
NO, produces neuroprotection not just by acting as an antioxidant,
but also by targeting oxidized and misfolded proteins for
degradation via the 26S proteasome. Thus, endogenous morphine
signaling may normally function to overcome cellular stress
processes, revealing a new pharmacological way to treat
neurodegenerative disorders.
OTHER EMBODIMENTS
[0231] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
251264DNAMytilus edulismisc_feature1, 2, 113, 133, 155, 249, 250n=
a, c, g, or t 1nnccaagggg aaccctgaga gcagcttcaa tgatgagaac
ctgcgcatag tggtggctga 60cctgttctct gccgggatgg tgaccacctc gaccacgctg
gcctggggca tcntgctcat 120gatcatacat ctnggatgtg cagcgccggg
tcaanaggag attgactacg tgatagggca 180ggtgcggaga ccagagatgg
gtgaccaggc tacatgccct acaccactgc cgtgattcat 240gaggtgcann
gctttgggga catc 2642265DNAHomo sapiens 2ggccaagggg aaccctgaga
gcagcttcaa tgatgagaac ctgcgcatag tggtggctga 60cctgttctct gccgggatgg
tgaccacctc gaccacgctg gcctggggcc tcctgctcat 120gatcctacat
ccggatgtgc agcgccgtgt ccaacaggag atcgacgacg tgatagggca
180ggtgcggcga ccagagatgg gtgaccaggc tcacatgccc tacaccactg
ccgtgattca 240tgaggtgcag cgctttgggg acatc 265328DNAArtificial
SequencePrimer 3aggtgtgtct cgaggagccc atttggta 28424DNAArtificial
SequencePrimer 4gcagaaagcc cgactcctcc ttca 24520DNAArtificial
SequencePrimer 5ggccaagggg aaccctgaga 20620DNAArtificial
SequencePrimer 6ggtcataccc agggggacga 20722DNAArtificial
SequencePrimer 7tgactgggaa caccccataa ct 22821DNAArtificial
SequencePrimer 8cgagcgcctc agtgttactc t 21923DNAArtificial
SequencePrimer 9agccatcctc cttgtcttaa tcg 231021DNAArtificial
SequencePrimer 10tctggcggaa aataacctca a 211120DNAArtificial
SequencePrimer 11tttcgtgctc tgagcactgg 201220DNAArtificial
SequencePrimer 12cttgccattc ctggacccaa 201320DNAArtificial
SequencePrimer 13ctcgccttca agttccagca 201420DNAArtificial
SequencePrimer 14tgcagcaggt cactgacatc 201521DNAArtificial
SequencePrimer 15agagaccgct accggtgaac c 211621DNAArtificial
SequencePrimer 16agataccaac acaacgatat g 211720DNAArtificial
SequencePrimer 17ctctccaagt aagtacgagc 201820DNAArtificial
SequencePrimer 18tcaggtggtg ttcgtccatt 201922DNAArtificial
SequencePrimer 19ttcaaagctt tcctttaggg tt 222021DNAArtificial
SequencePrimer 20gatgtcttcc aagtatgcgg a 212121DNAArtificial
SequencePrimer 21gggaatctcc ttcttgacca g 212221DNAArtificial
SequencePrimer 22cccagcattg gcattgctgt c 212321DNAArtificial
SequencePrimer 23catgatgttg agcattacgg a 212420DNAArtificial
SequencePrimer 24gtggggcgcc ccaggcacca 202522DNAArtificial
SequencePrimer 25ctccttaatg tcacgcacga tt 22
* * * * *