U.S. patent application number 12/082946 was filed with the patent office on 2008-09-11 for methods and compositions for treating disorders involving excitotoxicity.
Invention is credited to Thomas Engber, Alphonse Galdes, Nagesh Mahanthappa.
Application Number | 20080221037 12/082946 |
Document ID | / |
Family ID | 46327505 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080221037 |
Kind Code |
A1 |
Galdes; Alphonse ; et
al. |
September 11, 2008 |
Methods and compositions for treating disorders involving
excitotoxicity
Abstract
It is shown here that hedgehog polypeptides possess novel
activities beyond phenotype specification. Using cultures derived
from the embryonic day 14.5 (E14.5) rat ventral mesencephalon, we
show that hedgehog is also trophic for dopaminergic neurons and
other neurons which are sensitive to exotoxicity.
Inventors: |
Galdes; Alphonse;
(Lexington, MA) ; Mahanthappa; Nagesh; (Cambridge,
MA) ; Engber; Thomas; (Acton, MA) |
Correspondence
Address: |
ROPES & GRAY LLP
PATENT DOCKETING 39/41, ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Family ID: |
46327505 |
Appl. No.: |
12/082946 |
Filed: |
April 14, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11725144 |
Mar 16, 2007 |
|
|
|
12082946 |
|
|
|
|
10665923 |
Sep 18, 2003 |
|
|
|
11725144 |
|
|
|
|
09325602 |
Jun 3, 1999 |
|
|
|
10665923 |
|
|
|
|
09238243 |
Jan 27, 1999 |
|
|
|
09325602 |
|
|
|
|
10956724 |
Oct 1, 2004 |
|
|
|
09238243 |
|
|
|
|
09579680 |
May 26, 2000 |
6897297 |
|
|
10956724 |
|
|
|
|
PCT/US98/25676 |
Dec 3, 1998 |
|
|
|
09579680 |
|
|
|
|
60067423 |
Dec 3, 1997 |
|
|
|
60099800 |
Sep 10, 1998 |
|
|
|
60089685 |
Jun 17, 1998 |
|
|
|
60078935 |
Mar 20, 1998 |
|
|
|
Current U.S.
Class: |
514/8.3 ;
435/375 |
Current CPC
Class: |
A61K 38/1709 20130101;
A61K 38/17 20130101; A61P 25/00 20180101 |
Class at
Publication: |
514/12 ;
435/375 |
International
Class: |
A61K 38/00 20060101
A61K038/00; C12N 5/06 20060101 C12N005/06; A61P 25/00 20060101
A61P025/00 |
Claims
1. A method for promoting survival and/or functional performance of
neuronal cells susceptible to exotoxicity, comprising contacting
the cells with an amount of a lipophilic modified hedgehog
polypeptide effective to reduce exotoxin-mediated degradation of
the cells.
2. A method for promoting survival of at least one of substantia
nigra neuronal cells, dopaminergic cells, or GABAergic cells
comprising contacting the cells with a trophic amount of a
lipophilic modified hedgehog polypeptide.
3-4. (canceled)
5. A method for the treating a disorder characterized by loss of
dopaminergic and/or GABAergic neurons which comprises administering
to a patient in need thereof a therapeutically effective amount of
lipophilic modified hedgehog polypeptide.
6. A method for the treating or preventing Parkinson's disease
comprising administering to a patient in need thereof a
therapeutically effective amount of lipophilic modified hedgehog
polypeptide.
7. A method for the treating or preventing Huntington's disease
comprising administering to a patient in need thereof a
therapeutically effective amount of lipophilic modified hedgehog
polypeptide.
8. A method for treatment or prophylaxis of a disorder selected
from the group consisting of domoic acid poisoning; spinal cord
trauma; hypoglycemia; mechanical trauma to the nervous system;
senile dementia; Korsakoffs disease; schizophrenia; AIDS dementia,
multi-infarct dementia; mood disorders; depression; chemical
toxicity; neuronal damage associated with uncontrolled seizures,
such as epileptic seizures; neuronal injury associated with HIV and
AIDS; neurodegeneration associated with Down's syndrome;
neuropathic pain syndrome; olivopontocerebral atrophy; amyotrophic
lateral sclerosis; mitochondrial abnormalities; Alzheimer's
disease; hepatic encephalopathy; Tourette's syndrome;
schizophrenia; and drug addiction, comprising administering to a
patient in need thereof a therapeutically effective amount of
lipophilic modified hedgehog polypeptide.
9. The method of claim 1, wherein the hedgehog polypeptide is
modified with one or more sterol moieties.
10. The method of claim 9, wherein the sterol moiety is
cholesterol.
11. The method of claim 1, wherein the hedgehog polypeptide is
modified with one or more fatty acid moieties.
12. The method of claim 11, wherein each fatty acid moiety is
independently selected from the group consisting of myristoyl,
palmitoyl, stearoyl, and arachidoyl.
13. The method of claim 1, wherein the hedgehog polypeptide is
modified with one or more aromatic hydrocarbons.
14. The method of claim 13, wherein each aromatic hydrocarbon is
ondependently selected from the group consisting of benzene,
perylene, phenanthrene, anthracene, naphthalene, pyrene, chrysene,
and naphthacene.
15. The method of claim 1, wherein the hedgehog polypeptide is
odified one or more times with a C7-C30 alkyl or cycloalkyl.
16. The method of claim 6, wherein patient is being treated
prophylactically.
17-21. (canceled)
Description
RELATED APPLICATIONS
[0001] The present application is a continuation-in-part of U.S.
Ser. No. 09/238,243, filed 27 Jan. 1999, the specification of which
is incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0002] The excessive or inappropriate stimulation of excitatory
amino acid receptors can lead to neuronal cell damage or loss by
way of a mechanism known as excitotoxicity. For instance,
excitotoxic action may be responsible for neuronal loss in stroke,
cerebral palsy, epilepsy, ageing and Alzheimer's disease,
Huntington's disease, and other chronic degenerative disorders. The
medical consequences of such neuronal degeneration makes the
abatement of these degenerative neurological processes an important
therapeutic goal.
[0003] The development of neuroprotective agents for the prevention
of neuronal loss in acute conditions such as stroke and epilepsy or
chronic neurodegenerative disorders including Parkinson's disease,
Alzheimer's disease, Huntington's chorea, and motor neuron disease
has in fact focused on drugs that inhibit excitatory amino acid
neurotransmission or exhibit antioxidant properties. Unfortunately,
potent antagonists of the N-methyl-D-aspartate (NMDA) type
glutamate receptor, which is thought to mediate excitotoxic
neuronal injury, e.g., MK-801 or phencyclidine (PCP), share a high
probability of inducing psychotomimetic side effects. Further,
these drugs have been associated with acute neurotoxicity in vitro
and in vivo, precluding their clinical use.
[0004] It is a goal of the present invention to provide
compositions and methods for preventing or ameliorating neuronal
degeneration, e.g., for the abatement of these degenerative
neurological processes.
SUMMARY OF THE INVENTION
[0005] One aspect of the present application relates to a method
for promoting survival and/or functional performance of neuronal
cells susceptible to exotoxicity, comprising contacting the cells,
in vitro or in vivo, with a hedgehog therapeutic or ptc therapeutic
in an amount effective increasing the rate of survival of the
neurons relative to the absence of administration of the hedgehog
therapeutic or ptc therapeutic. In preferred embodiments, the
method is carried out using a lipophilic modified hedgehog
polypeptide effective to reduce exotoxin-mediated degradation of
the cells.
[0006] For instance, the present application provides a method for
promoting the survival of dopaminergic or GABAergic neurons by
contacting the cells, in vitro or in vivo, with a hedgehog
therapeutic or ptc therapeutic in an amount effective to increase
the rate of survival of the neurons relative to the absence of
administration of the hedgehog therapeutic or ptc therapeutic.
[0007] In other embodiments, the present application relates to a
method for promoting the survival of neurons of the substantia
nigra by contacting the cells, in vitro or in vivo, with a hedgehog
therapeutic or ptc therapeutic in an amount effective to increase
the rate of survival of the neurons relative to the absence of
administration of the hedgehog therapeutic or ptc therapeutic.
[0008] In certain embodiments, the subject invention provides a
method for treatment or prophylaxis of a disorder selected from the
group consisting of [0009] domoic acid poisoning; spinal cord
trauma; hypoglycemia; mechanical trauma to the nervous system;
senile dementia; Korsakoffs disease; schizophrenia; AIDS dementia,
multi-infarct dementia; mood disorders; depression; chemical
toxicity; neuronal damage associated with uncontrolled seizures,
such as epileptic seizures; neuronal injury associated with HIV and
AIDS; neurodegeneration associated with Down's syndrome;
neuropathic pain syndrome; olivopontocerebral atrophy; amyotrophic
lateral sclerosis; mitochondrial abnormalities; Alzheimer's
disease; hepatic encephalopathy; Tourette's syndrome;
schizophrenia; and drug addiction, comprising administering to a
patient in need thereof a therapeutically effective amount of a
hedgehog or ptc therapeutic, e.g., a lipophilic modified hedgehog
polypeptide.
[0010] In other embodiments, the subject method can be used for
protecting dopaminergic and/or GABAergic neurons of a mammal from
neurodegeneration; for preventing or treating neurodegenerative
disorder; for treatment of Parkinson's; for treatment of
Huntington's; and/or for treatment of ALS. In embodiments wherein
the patient is treated with a ptc therapeutic, such therapeutics
are preferably small organic molecules which mimic hedgehog effects
on patched-mediated signals.
[0011] When the subject method is carried out using a hedgehog
therapeutic, the hedgehog therapeutic preferably is a polypeptide
including at least a bioactive extracellular portion of a hedgehog
polypeptide, e.g., including at least 50, 100 or 150 amino acid
residues of an N-terminal half of a hedgehog polypeptide. In
preferred embodiments, the hedgehog portion includes at least a
portion of the hedgehog polypeptide corresponding to a 19 kd
fragment of the extracellular domain of a hedgehog polypeptide.
[0012] In preferred embodiments, the hedgehog portion has an amino
acid sequence at least 60, 75, 85, 95 or 100 percent identical with
a hedgehog polypeptide of any of SEQ ID Nos. 10-18 or 20. The
hedgehog portion can beencoded by a nucleic acid which hybridizes
under stringent conditions to a nucleic acid sequence of any of SEQ
ID Nos. 1-9 or 19, e.g., the hedgehog portion can be encoded by a
vertebrate hedgehog gene, especially a human hedgehog gene.
[0013] In certain embodiments, the hedgehog polypeptides of the
present invention are modified by a lipophilic moiety or moieties
at one or more internal sites of the mature, processed
extracellular domain, and may or may not be also derivatized with
lipophilic moieties at the N or C-terminal residues of the mature
polypeptide. In other embodiments, the polypeptide is modified at
the C-terminal residue with a hydrophobic moiety. In still other
embodiments, the polypeptide is modified at the N-terminal residue
with a cyclic (preferably polycyclic)-lipophilic group. Various
combinations of the above are also contemplated.
[0014] In other embodiments, the subject method can be carried out
by administering a gene activation construct, wherein the gene
activation construct is deigned to recombine with a genomic
hedgehog gene of the patient to provide a heterologous
transcriptional regulatory sequence operatively linked to a coding
sequence of the hedgehog gene.
[0015] In still other embodiments, the subject method can be
practiced with the administration of a gene therapy construct
encoding a hedgehog polypeptide. For instance, the gene therapy
construct can be provided in a composition selected from a group
consisting of a recombinant viral particle, a liposome, and a
poly-cationic nucleic acid binding agent,
[0016] In certain embodiments, the polypeptide is purified to at
least 80% by dry weight, and more preferably 90 or 95% by dry
weight.
[0017] Another aspect of the present invention provides an isolated
nucleic acid encoding a polypeptide comprising a hedgehog amino
acid sequence which (i) binds to a patched protein, (ii) regulates
differentiation of neuronal cells, (iii) regulates survival of
differentiated neuronal cells, (iv) regulates proliferation of
chondrocytes, (v) regulates proliferation of testicular germ line
cells, or (vi) functionally replaces drosopholia hedgehog in
transgenic drosophila fly, or a combination thereof.
[0018] In other preferred embodiments, the isolated nucleic acid
encodes a polypeptide having a hedgehog amino acid sequence encoded
by a nucleic acid which hybridizes under stringent conditions to a
nucleic acid sequence selected from the group consisting of SEQ ID
No:1-9, which hedgehog amino acid sequence of the polypeptide
corresponds to a natural proteolytic product of a hedgehog
polypeptide. Such polypeptides preferably (i) binds to a patched
protein, (ii) regulates differentiation of neuronal cells, (iii)
regulates survival of differentiated neuronal cells, (iv) regulates
proliferation of chondrocytes, (v) regulates proliferation of
testicular germ line cells, and/or (vi) functionally replaces
drosopholia hedgehog in transgenic drosophila fly, or a combination
thereof.
[0019] In preferred embodiments, the nucleic acid encodes a
hedgehog amino acid sequence identical to a hedgehog polypeptide
selected from the group consisting of SEQ ID No: 10-18.
[0020] Another preferred embodiment provides an isolated nucleic
acid comprising a coding sequence of a human hedgehog gene,
encoding a bioactive hedgehog polypeptide.
[0021] Still another aspect of the present invention relates to an
expression vector, capable of replicating in at least one of a
prokaryotic cell and eukaryotic cell, comprising a nucleic acid
encoding a Dhh or Ihh polypeptide described above.
[0022] The present invention also provides a host cell transfected
with such expression vectors; as well as methods for producing a
recombinant hedgehog polypeptide by culturing such cells in a cell
culture medium to express a hedgehog polypeptide and isolating said
hedgehog polypeptide from the cell culture.
[0023] Still another aspect of the present invention provides a
recombinant transfection system, e.g., such as may be useful for
gene therapy, comprising (i) a gene construct including the coding
sequence for a human Ihh or Dhh protein, operably linked to a
transcriptional regulatory sequence for causing expression of the
hedgehog polypeptide in eukaryotic cells, and (ii) a gene delivery
composition for delivering said gene construct to a cell and
causing the cell to be transfected with said gene construct. For
instance, the gene delivery composition is selected from a group
consisting of a recombinant viral particle, a liposome, and a
poly-cationic nucleic acid binding agent.
[0024] Another aspect of the present invention provides a
probe/primer comprising a substantially purified oligonucleotide,
said oligonucleotide containing a region of nucleotide sequence
which hybridizes under stringent conditions to at least 10
consecutive nucleotides of sense or antisense sequence of SEQ ID
No. 1-9, or naturally occurring mutants thereof. In preferred
embodiments, the probe/primer includes a label group attached
thereto and able to be detected. The present invention also
provides a test kit for detecting cells which contain a hedgehog
mRNA transcript, and includes such probe/primers.
[0025] Still another embodiment of the present invention provides a
purified preparation of an antisense nucleic acid which
specifically hybridizes to and inhibits expression of a gene
encoding a human Shh, Ihh or Dhh hedgehog polypeptide under
physiological conditions, which nucleic acid is at least one of (i)
a synthetic oligonucleotide, (ii) single-stranded, (iii) linear,
(iv) 20 to 50 nucleotides in length, and (v) a DNA analog resistant
to nuclease degradation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1. Shh and Ptc in the E14.5 rat embryo. Shh (A,
antisense; B, sense control), and ptc (C, antisense; D, sense
control) expression as detected by in situ hybridization with
digoxigenin-labeled riboprobes and alkaline phosphataseconjugated
anti-digoxigenin. The arrow in A and the double-arrow in C
designate the zona limitan intrathalamica Major anatomical
structures and summary diagrams of shh and ptc expression are shown
in E. Scale bar=mm.
[0027] FIG. 2. Shh promotes the survival of TH+ neurons of the
ventral mesencephalon. (A) Timecourse and dose response of the Shh
effect. The number of TH+ neurons in control cultures (O ng/ml Shh)
began to decline dramatically by 5 days in vitro. In cultures
treated withShh at 25 and 50 ng/ml there were significantly greater
numbers of TS+neurons over control-through 24 days in vitro (from 5
to 24 days, p<0.001 at 25 and 50 ng/ml). The 50 ng/ml dose
typically gave a 50-100% increase over controls at all time points
(error bars s.e.m.) P-h'otomicrographs of TH+neurons in 50 ng/ml
Shh treated (B-, -D) and control (C, E) cultures, 2 days (B, C) and
7 days (D, E) post-plating. Note that in addition to an increased
number of TH+-cell bodies, the Shh treated cells-show extensive
neuritic processes. Scale bar=200 um.
[0028] FIG. 3. Transport of 3H-Dopamine. The identity and
functionality of the surviving midbrain neurons was assessed by
their ability to specifically transport dopamine (A) Addition of 25
ng/ml Shh resulted in a 22-fold increase in 3H-DA cell uptake over
controls and lower Shh concentrations. 50 ng/ml Shh gave a 30-fold
increase in 3H-DA uptake (error bars=s.d.) (p<0.005 at 25 and 50
ng/ml). (B) Autoradiography was performed on sister plates to
visualize dopamine transport. Only cells with neuronal morphology
transported 3H-1-DA (inset). Scale-bar=50 .mu.m, inset 15 m.
[0029] FIG. 4. Specificity of Shh activity. (A) QC-PCR gel. Lanes
1-4 are CDNA from midbrain cultures that have been co-amplified
with successive 4-fold dilutions of mimic oligo. Lane 5 is DNA
marker lane. Ptc target is 254 bp and mimic is 100 bp(B)
Representative plot (corresponding to A) of the log concentration
of competitive mimic versus the log of the obtained band densities
of target and mimic PCR substrates demonstrates the linearity of
the amplification reaction. The extrapolated value of ptc message
in the CDNA tested is determined to be equal to the value of mimic
concentration where Log Ds/Dm=0, See main text for details of the
procedure. Doses in ng/ml; Ds=density of test substrate;
Dm/=density of competitive mimic. The r 2 value shows that
determinations made within this range vary within 3%. (C)
Administration of Shh induces ptc expression in a dose response
that parallels the survival curve. The values are expressed as
number of target molecules (log Ds) per total amount of CDNA used
in each reaction as measured by optical density at 260 nm (OD) and
were determined as demonstrated in A and B. At 4 days in vitro Shh
at 5 ng/ml increases ptc expression over control, and 50 ng/ml
increases expression of ptc over the level found in the ventral
mesencephalon at the time of dissection. (D) Affinity purified
anti-Shh antibody inhibited the Shh neurotrophic response (p
5<0.001). Cultures were maintained for 5 days. Shh was added at
a concentration of 50 ng/ml, and in the co-administration of 5 Shh
and anti-Shh ("Shh antibody") Shh-was added at 0 g/ml and anti-Shh
was added as a 5-fold molar excess (error bars s.e.m.).
[0030] FIG. 5. Shh also supports the survival of midbrain-GABA+
neurons. (A) In addition to supporting the survival of TH+ cells in
the midbrain cultures, Shh promotes the survival of
GABA-immunoreactive neurons with a similar dose response (error
bars=s.e.m.) (For T, p, 0.001 at 25 and 50 ng/ml; for GABA,
p<0.001 at 25 and 50 ng/ml). (B) Double level immunofluorescence
of SSH-treated cultures shows that the majority of the GABA+ cells
(Orange) do not overlap with the TH+ cells (green); scale bar=15
m.
[0031] FIG. 6. Shh effects on striatal cultures. (A) At
concentrations of 10 ng/ml and higher, Shh promotes neuronal
survival as gauged by staining for tubulin PIII, and these cells
are exclusively GABA+ (error bars=S.D.) (tubulin PIII, p<0.001
at 25 and 50 ng/ml; GABA, p<0.001 at 25 and 50 ng/ml). Typical
fields of neurons treated with 50 ng/ml Shh stained for tubulin
pill (B) and GABA+ (C) are shown; scale bar=100 gm.
[0032] FIG. 7. Shh effects on ventral spinal cultures. (A) At
concentrations of 25 ng/ml and higher, Shh promotes neuronal
survival as gauged by stating for tubulin PIII. The majority of the
cells stain positively for GABA, while a subset stain for the
nuclear marker of spinal Interneurons, Lim-1/2 (error bars=s.e.m.)
(tubulin pill, p<0.001 at 25 and 50 ng/ml; lim 1/2, p<0.001
at 5, 10, 25, and 50 ng/ml; GABA, p<0.001 at 25 and 50 ng/ml).
Typical staining for Lim--1/2 in the E14 rat spinal cord (B, scale
bar=100 m), and spinal neurons cultured in the presence of 50 ng/ml
Shh (C, scale bar=20 m).
[0033] FIG. 8. Shh protects midbrain TH+ neurons from neurotoxic
insult. Cultures of ventral mesencephalon neurons were cultured in
the indicated concentrations of Shh (ng/ml). MPP+ was added at 4
days in vitro for 48 hours. Cultures were then washed extensively
and cultured for an additional 48 hours to allow clearance of dying
neurons. Protection from MPP+ neurotoxicity could be seen at 5
ng/ml, with the effect saturating at 50 ng/ml. BDNF was used at 10
ng/ml, and GDNF at 20 ng/ml (error bars=s.e.m.) (Shh, p<0.001 at
50 and 250 ng/ml; BDNF no significance; GDNF, p<0.05). Note that
the plating density used in this experiment was twice that used in
FIG. 2.
[0034] FIGS. 9 and 10 are graphs illustrating the effects of Shh on
apomorphine-induced rotational behavior in stably lesioned
mice.
[0035] FIGS. 11A and 11B are graphs illustrating the
neuroprotective effect of Shh against amphetamine challenges.
[0036] FIGS. 12A-B and 13A-D are graphs comparing the restorative
effect of myristoylated Shh (Mz) and unmodified forms of Shh (Gz)
on the rotational behavior of 6-OHDA lesioned mice.
[0037] FIGS. 14A-E, 15A-H and 16 are graphs illustrating the
neuroprotective effect of Shh polypeptides against amphetamine and
apomorphine challenges of 6-OHDA lesioned mice.
[0038] FIG. 17 is a graph demonstrating the dose response for
hedgehog polypeptide constructs in a malonate striatal lesion
model
[0039] FIG. 18 is a graph showing the effect of pretreatment with
myristoylated Shh in a malonate striatal lesion model
DETAILED DESCRIPTION OF THE INVENTION
I. Overview
[0040] Sonic hedgehog (Shh), an axis-determining secreted protein,
is expressed during early vertebrate embryogenesis in the notochord
and ventral neural tube. In this site it plays a role in the
phenotypic specification of ventral neurons along the length of the
CNS. For example, Shh induces the differentiation of motor neurons
in the spinal cord and dopaminergic neurons in the midbrain. Shh
expression, however, persists beyond this induction period. We have
show here that Shh possesses novel activities beyond phenotype
specification.
[0041] Using cultures derived from the embryonic day 14.5 (E14.5)
rat ventral mesencephalon, we show that Shh is also trophic for
dopaminergic neurons. Interestingly, Shh not only promotes
dopaminergic neuron survival, but also promotes the survival of
midbrain GABA-immunoreactive (GABA-ir) neurons. In cultures derived
from the E15-16 striatum, Shh promotes the survival of GABA-ir
interneurons to the exclusion of any other cell type. Cultures
derived from E15-16 ventral spinal cord reveal that Shh is again
trophic for interneurons, many of which are GABA-ir and some of
which express the Lim-1/2 nuclear marker, but does not appear to
support motomeuron survival. Shh does not support survival of
sympathetic or dorsal root ganglion neurons. Finally, using the
midbrain cultures, we show that in the presence of MPP+, a highly
specific neurotoxin, Shh prevents dopaminergic neuron death that
normally would have occurred.
[0042] Moreover, as demonstrated in Examples 2-6, activation of
hedgehog signalling pathway(s) can be used both for restoration of
lesions to dopaminergic cells and other neuronal cells of the
substantia nigra (SN) and ventral termental area (VTA), as well as
for neuroprotection against formation of such lesions. Briefly, as
described in the appended examples, we investigated the
neuroprotective and restorative potential of hedgehog polypeptides
in various animal models of lesions involving nigrostriatal and
mesolimbic dopaminergic pathways. As described in detail below, our
results show that the administration of hedgehog polypeptide can
prevent and partially restore such neuronal damage.
[0043] Further more, as demonstrated in the appended examples,
activation of the hedgehog signaling pathway(s) can be a more
general protective measure against neurotoxic insult, and
particularly for protection against cell death due to
overstimulation by excitatory amino acids.
[0044] One aspect of the present application is directed to
compositions and methods for the prevention and treatment of
degenerations of certain neuronal cells due to exotoxicity. The
invention also specifically contemplates the use of hedgehog
agonists for treating, preventing or ameliorating neuronal loss
associated with neurologic disorders which are due to
overstimulation by the excitatory amino acids. These include acute
neurologic disorders such as domoic acid poisoning; spinal cord
trauma; hypoglycemia; mechanical trauma to the nervous system,
epileptic seizures; and chronic neurologic disorders such as
Huntington's disease, neuronal injury associated with HIV and AIDS,
AIDS dementia, neurodegeneration associated with Down's syndrome,
neuropathic pain syndrome, olivopontocerebral atrophy, amyotrophic
lateral sclerosis, mitochondrial abnormalities, Alzheimer's
disease, hepatic encephalopathy, Tourette's syndrome,
schizophrenia, and dough addiction (see Lipton and Rosenberg, N.
Engl. J. Med. 330: 613-622 (1994)).
[0045] In certain preferred embodiments, the subject invention is
directed to methods and compositions for preventing or ameliorating
degeneration of dopaminergic cells and other neuronal cells of the
substantia nigra (SN) and ventral termental area (VTA), such as
resulting in Parkinson's disease. Based in part on these findings,
we have determined that Shh, and other forms of hedgehog
polypeptides, are useful as a protective agents in the treatment
and prophylaxis for neurodegenerative disorders, particularly those
resulting from the loss of dopaminergic and/or GABA-nergic neurons,
or the general loss tissue from the substantia nigra. As described
with greater detail below, exemplary disorders ("candidate
disorders") include Parkinson's disease.
[0046] In one aspect, the present invention provides pharmaceutical
preparations and methods for preventing/treating lesions involving
exotoxic-dependent degeneration of neurons utilizing, as an active
ingredient, a hedgehog polypeptide or a mimetic thereof.
[0047] However, without wishing to be bound by any particular
theory, the protective/restorative activity of hedgehog
polypeptides observed in the present studies may be due at least in
part to the ability of hedgehog polypeptides to antagonize
(directly or indirectly) patched-mediated regulation of gene
expression and other physiological effects mediated by the patched
gene. The patched gene product, a cell surface protein, is
understood to signal through a pathway which regulates
transcription of a variety of genes involved in neuronal cell
development. In the CNS and other tissue, the introduction of
hedgehog relieves (derepresses) this inhibition conferred by
patched, allowing expression of particular gene programs.
Accordingly, the present invention contemplates the use of other
agents which are capable of mimicking the effect of the hedgehog
polypeptide on patched signalling, e.g., as may be identified from
the drug screening assays described below.
[0048] The subject hedgehog treatments are effective on both human
and animal subjects afflicted with these conditions. Animal
subjects to which the invention is applicable extend to both
domestic animals and livestock, raised either as pets or for
commercial purposes. Examples are dogs, cats, cattle, horses,
sheep, hogs and goats. In terms of treatment, once a patient
experiences symptoms of a candidate disorder, a goal of therapy is
prevention of further loss of neuron function.
[0049] Moreover, the subject method can also be utilized for cell
culture, e.g., for the maintenance of differentiated neurons in
cultures; such as in cultures of dopaminergic and GABA-nergic
neurons. The subject methods and compositions can also be used to
augment the implantion of such neuronal cells in an animal.
II. Definitions
[0050] For convenience, certain terms employed in the
specification, examples, and appended claims are collected
here.
[0051] The term "hedgehog therapeutic" refers to various forms of
hedgehog polypeptides, as well as peptidomimetics, which are
neuroprotective for neuronal cells, and in particulars, enhance the
survival of dopaminergic and GABA-ergic neurons. These include
naturally occurring forms of hedgehog polypeptides, as well as
modified or mutant forms generated by molecular biological
techniques, chemical synthesis, etc. While in preferred embodiments
the hedgehog polypeptide is derived from a vertebrate homolog,
cross-species activity reported in the literature supports the use
of hedgehog peolypeptides from invertebrate organisms as well.
Naturally and non-naturally occurring hedgehog therapeutics
referred to herein as "agonists" mimic or potentiate (collectively
"agonize") the effects of a naturally-occurring hedgehog
polypeptide as a neuroprotective agent. In addition, the term
"hedgehog therapeutic" includes molecules which can activate
expression of an endogenous hedgehog gene. The term also includes
gene therapy constructs for causing expressions of hedgehog
polypeptides in vivo, as for example, expression constructs
encoding recombinant hedgehog polypeptides as well as
trans-activation-constructs for altering the regulatory sequences
of an endogenous hedgehog gene by homologous recombination.
[0052] In particular, the term "hedgehog polypeptide" encompasses
hedgehog polypeptides and peptidyl fragments thereof.
[0053] As used herein the term "bioactive fragment", with reference
to a portions of hedgehog polypeptides, refers to a fragment of a
full-length hedgehog polypeptide, wherein the fragment specifically
agonizes neuroprotective events mediated by wild-type hedgehog
polypeptides. The hedgehog bioactive fragment preferably is a
soluble extracellular portion of a hedgehog polypeptide, where
solubility is with reference to physiologically compatible
solutions. Exemplary bioactive fragments are described in PCT
publications WO 95/18856 and WO 96/17924.
[0054] The term "ptc therapeutic" refers to agents which mimic the
effect of naturally occurring hedgehog polypeptides on patched
signalling. The ptc therapeutic can be, e.g., a peptide, a nucleic
acid, a carbohydrate, a small organic molecule, or natural product
extract (or fraction thereof).
[0055] A "patient" or "subject" to be treated by the subject method
are mammals, including humans.
[0056] An "effective amount" of, e.g., a hedgehog or ptc
therapeutic, with respect to the subject method of treatment,
refers to an amount of the therapeutic in a preparation which, when
applied as part of a desired dosage regimen causes a increase in
survival of a neuronal cell population according to clinically
acceptable standards for the treatment or prevention of a
particular disorder.
[0057] By "prevent degeneration" it is meant reduction in the loss
of cells (such as from apoptosis), or reduction in impairment of
cell function, e.g., release of dopamine in the case of
dopaminergic neurons.
[0058] A "trophic factor", referring to a hedgehog or ptc
therapeutic, is a molecule that directly or indirectly affects the
survival or function of a hedgehog-responsive cell, e.g., a
dopaminergic or GABAergic cell.
[0059] A "trophic amount" of a hedgehog or ptc therapeutic is an
amount sufficient to, under the circumstances, cause an increase in
the rate of survival or the functional performance of a
hedgehog-responsive cell, e.g., a dopaminergic or GABAergic
cell.
[0060] "Homology" and "identity" each refer to sequence similarity
between two polypeptide sequences, with identity being a more
strict comparison. Homology and identity can each be determined by
comparing a position in each sequence which may be aligned for
purposes of comparison. When a position in the compared sequence is
occupied by the same amino acid residue, then the polypeptides can
be referred to as identical at that position; when the equivalent
site is occupied by the same amino acid (e.g., identical) or a
similar amino acid (e.g., similar in steric and/or electronic
nature), then the molecules can be referred to as homologous at
that position. A percentage of homology or identity between
sequences is a function of the number of matching or homologous
positions shared by the sequences. An "unrelated" or
"non-homologous" sequence shares less than 40 percent identity,
though preferably less than 25 percent identity, with an hedghog
sequence.
[0061] In particular, the term "percent identical" refers to
sequence identity between two amino acid sequences or between two
nucleotide sequences. Identity can each be determined by comparing
a position in each sequence which may be aligned for purposes of
comparison. When an equivalent position in the compared sequences
is occupied by the same base or amino acid, then the molecules are
identical at that position; when the equivalent site occupied by
the same or a similar amino acid residue (e.g., similar in steric
and/or electronic nature), then the molecules can be referred to as
homologous (similar) at that position. Expression as a percentage
of homology/similarity or identity refers to a function of the
number of identical or similar amino acids at positions shared by
the compared sequences. Various alignment algorithms and/or
programs may be used, including FASTA, BLAST or ENTREZ. FASTA and
BLAST are available as a part of the GCG sequence analysis package
(University of Wisconsin, Madison, Wis.), and can be used with,
e.g., default settings. ENTREZ is available through the National
Center for Biotechnology Information, National Library of Medicine,
National Institutes of Health, Bethesda, Md. In one embodiment, the
percent identity of two sequences can be determined by the GCG
program with a gap weight of 1, e.g., each amino acid gap is
weighted as if it were a single amino acid or nucleotide mismatch
between the two sequences.
[0062] The term "corresponds to", when referring to a particular
polypeptide or nucleic acid sequence is meant to indicate that the
sequence of interest is identical or homologous to the reference
sequence to which it is said to correspond.
[0063] The terms "recombinant protein", "heterologous protein" and
"exogenous protein" are used interchangeably throughout the
specification and refer to a polypeptide which is produced by
recombinant DNA techniques, wherein generally, DNA encoding the
polypeptide is inserted into a suitable expression construct which
is in turn used to transform a host cell to produce the
heterologous protein. That is, the polypeptide is expressed from a
heterologous nucleic acid.
[0064] A "chimeric protein" or "fusion protein" is a fusion of a
first amino acid sequence encoding a hedgehog polypeptide with a
second amino acid sequence defining a domain foreign to and not
substantially homologous with any domain of hh protein. A chimeric
protein may present a foreign domain which is found (albeit in a
different protein) in an organism which also expresses the first
protein, or it may be an "interspecies", "intergenic", etc. fusion
of protein structures expressed by different kinds of organisms. In
general, a fusion protein can be represented by the general formula
(X).sub.n-(hh).sub.m-(Y).sub.n, wherein hh represents all or a
portion of the hedgehog polypeptide, X and Y each independently
represent an amino acid sequences which are not naturally found as
a polypeptide chain contiguous with the hedgehog sequence, m is an
integer greater than or equal to 1, and each occurrence of n is,
independently, 0 or an integer greater than or equal to 1 (n and m
are preferably no greater than 5 or 10).
[0065] As used herein, the term "vector" refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
has been linked. The term "expression vector" includes plasmids,
cosmids or phages capable of synthesizing, for example, the subject
hedgehog polypeptides encoded by the respective recombinant gene
carried by the vector. Preferred vectors are those capable of
autonomous replication and/expression of nucleic acids to which
they are linked. In the present specification, "plasmid" and
"vector" are used interchangeably as the plasmid is the most
commonly used form of vector. Moreover, the invention is intended
to include such other forms of expression vectors which serve
equivalent functions and which become known in the art subsequently
hereto.
[0066] "Transcriptional regulatory sequence" is a generic term used
throughout the specification to refer to DNA sequences, such as
initiation signals, enhancers, and promoters, as well as
polyadenylation sites, which induce or control transcription of
protein (or antisense) coding sequences with which they are
operably linked. In preferred embodiments, transcription of a
recombinant gene is under the control of a promoter sequence (or
other transcriptional regulatory sequence) which controls the
expression of the recombinant gene in a cell-type in which
expression is intended. It will also be understood that the
recombinant gene can be under the control of transcriptional
regulatory sequences which are the same or which are different from
those sequences which control transcription of the
naturally-occurring form of the regulatory protein.
[0067] The term "operably linked" refers to the arrangement of a
transcriptional regulatory element relative to other transcribable
nucleic acid sequence such that the transcriptional regulatory
element can regulate the rate of transcription from the
transcribable sequence(s).
II. Exemplary Applications of Method and Compositions
[0068] One aspect of the present invention relates to a method of
maintaining a differentiated state, e.g., enhancing survival, of a
neuronal cell responsive to a hedgehog polypeptide, by contacting
the cells with a trophic amount of a hedgehog or ptc therapeutic.
For instance, it is contemplated by the invention that, in light of
the present finding of an apparently trophic effect of hedgehog
polypeptides in the maintenance of differentiated neurons, the
subject method could be used to maintain different neuronal tissue
both in vitro and in vivo. Where the trophic agent is a hedgehog
polypeptide, it can be provided to a cell culture or animal as a
purified protein or secreted by a recombinant cell, or cells or
tissue explants which naturally produce one or more hedgehog
polypeptides. For instance, neural tube explants from embryos,
particularly floorplate tissue, can provide a source for Shh
polypeptide, which source can be implanted in a patient or
otherwise provided, as appropriate, for maintenance of
differentiation.
[0069] A. Cell Culture
[0070] The present method is applicable to cell culture techniques.
In vitro neuronal culture systems have proved to be fundamental and
indispensable tools for the study of neural development, as well as
the identification of neurotrophic factors such as nerve growth
factor (NGF), ciliary trophic factors (CNTF), and brain derived
neurotrophic factor (BDNF). Once a neuronal cell has become
terminally-differentiated it typically will not change to another
terminally differentiated cell-type. However, neuronal cells can
nevertheless readily lose their differentiated state. This is
commonly observed when they are grown in culture from adult tissue,
and when they form a blastema during regeneration. The present
method provides a means for ensuring an adequately restrictive
environment in order to maintain dopaminergic, GABAergic or other
exotoxic-sensitive neuronal cells in differentiated states, and can
be employed, for instance, in cell cultures designed to test the
specific activities of other trophic factors.
[0071] In such embodiments of the subject method, a culture of
differentiated cells, including the neuronal cells can be contacted
with a hedgehog or ptc therapeutic in order to maintain the
integrity of a culture of terminally-differentiated neuronal cells
by preventing loss of differentiation. The source of hedgehog or
ptc therapeutic in the culture can be derived from, for example, a
purified or semi-purified protein composition added directly to the
cell culture media, or alternatively, supported and/or released
from a polymeric device which supports the growth of various
neuronal cells and which has been doped with the protein. The
source of, for example, a trophic hedgehog polypeptide can also be
a cell that is co-cultured with the neuronal cells. Alternatively,
the source can be the neuronal cell itself which has been
engineered to produce a recombinant hedgehog polypeptide. Such
neuronal cultures can be used as convenient assay systems as well
as sources of implantable cells for therapeutic treatments.
[0072] The subject method can be used in conjunction with agents
which induce the differentiation of neuronal precursors, e.g.,
progenitor or stem cells, into dopaminergic neurons, GABAergic
neurons or other neuronal cell-types.
[0073] Cells can be obtained from embryonic, post-natal, juvenile
or adult neural tissue from any animal. By any animal is meant any
multicellular animal which contains nervous tissue. More
particularly, is meant any fish, reptile, bird, amphibian or mammal
and the like. The most preferable donors are mammals, especially
humans and non-human primates, pigs, cows, and rodents.
[0074] Intracerebral neural grafting has emerged recently as an
additional potential to CNS therapy. For example, one approach to
repairing damaged brain tissues involves the transplantation of
cells from fetal or neonatal animals into the adult brain (Dunnett
et al. (1987) J Exp Biol 123:265-289; and Freund et al. (1985) J
Neurosci 5:603-616). Fetal neurons from a variety of brain regions
can be successfully incorporated into the adult brain, and such
grafts can alleviate behavioral defects. For example, movement
disorder induced by lesions of dopaminergic projections to the
basal ganglia can be prevented by grafts of embryonic dopaminergic
neurons. Complex cognitive functions that are impaired after
lesions of the neocortex can also be partially restored by grafts
of embryonic cortical cells. Transplantation of fetal brain cells,
which contain precursors of the dopaminergic neurons, has been
examined with success as a treatment for Parkinson's disease. In
animal models and in patients with this disease, fetal brain cell
transplantations have resulted in the reduction of motor
abnormalities. Furthermore, it appears that the implanted fetal
dopaminergic neurons form synapses with surrounding host neurons.
However, in the art, the transplantation of fetal brain cells is
limited due, for example, to the limited survival time of the
implanted neuronal precursors and differentiated neurons arising
therefrom. The subject invention provides a means for extending the
usefulness of such transplants by enhancing the survival of
dopaminergic and/or GABAergic cells in the transplant.
[0075] In the specific case of Parkinson's disease, intervention by
increasing the activity of hedgehog, by ectopic or endogenous
means, can improve the in vivo survival of fetal and adult
dopaminergic neurons, and thus can provide a more effective
treatment of this disease. Cells to be transplanted for the
treatment of a particular disease can be genetically modified in
vitro so as to increase the expression of hedgehog in the
transplant. In an exemplary embodiment of the invention,
administration of an Shh polypeptide can be used in conjunction
with surgical implantation of tissue in the treatment of
Parkinson's disease.
[0076] In the case of a heterologous donor animal, the animal may
be euthanized, and the brain and specific area of interest removed
using a sterile procedure. Brain areas of particular interest
include any area from which progenitor cells can be obtained which
will provide dopaminergic or GABAergic cells upon differentiation.
These regions include areas of the central nervous system (CNS)
including the substantia nigra pars compacta which is found to be
degenerated in Parkinson's Disease patients.
[0077] Human heterologous neural progenitor cells may be derived
from fetal tissue obtained from elective abortion, or from a
post-natal, juvenile or adult organ donor. Autologous neural tissue
can be obtained by biopsy, or from patients undergoing neurosurgery
in which neural tissue is removed, such as during epilepsy
surgery.
[0078] Cells can be obtained from donor tissue by dissociation of
individual cells from the connecting extracellular matrix of the
tissue. Dissociation can be obtained using any known procedure,
including treatment with enzymes such as trypsin, collagenase and
the like, or by using physical methods of dissociation such as with
a blunt instrument. Dissociation of fetal cells can be carried out
in tissue culture medium, while a preferable medium for
dissociation of juvenile and adult cells is artificial cerebral
spinal fluid (aCSF). Regular aCSF contains 124 mM NaCl, 5 mM KCl
1.3 mM MgCl.sub.2, 2 mM CaCl.sub.2, 26 nM NaHCO.sub.3, and 10 mM
D-glucose. Low Ca.sup.2+ aCSF contains the same ingredients except
for MgCl.sub.2 at a concentration of 3.2 mM and CaCl.sub.2 at a
concentration of 0.1 mM.
[0079] Dissociated cells can be placed into any known culture
medium capable of supporting cell growth, including MOM, DMEM,
RPMI, F-12, and the like, containing supplements which are required
for cellular metabolism such as glutamine and other amino acids,
vitamins, minerals and useful proteins such as transferrin and the
like. Medium may also contain antibiotics to prevent contamination
with yeast, bacteria and fungi such as penicillin, streptomycin,
gentamicin and the like. In some cases, the medium may contain
serum derived from bovine, equine, chicken and the like. A
particularly preferable medium for cells is a mixture of DMEM and
F-12.
[0080] Conditions for culturing should be close to physiological
conditions. The pH of the culture media should be close to
physiological pH, preferably between pH 6-8, more preferably close
to pH 7, even more particularly about pH 7.4. Cells should be
cultured at a temperature close to physiological temperature,
preferably between 30.degree. C.-40.degree. C., more preferably
between 32.degree. C.-38.degree. C., and most preferably between
35.degree. C.-37.degree. C.
[0081] Cells can be grown in suspension or on a fixed substrate,
but proliferation of the progenitors is preferably done in
suspension to generate large numbers of cells by formation of
"neurospheres" (see, for example, Reynolds et al. (1992) Science
255:1070-1709; and PCT Publications WO93/01275, WO94/09119,
WO94/10292, and WO94/16718). In the case of propagating (or
splitting) suspension cells, flasks are shaken well and the
neurospheres allowed to settle on the bottom corner of the flask.
The spheres are then transferred to a 50 ml centrifuge tube and
centrifuged at low speed. The medium is aspirated, the cells
resuspended in a small amount of medium with growth factor, and the
cells mechanically dissociated and resuspended in separate aliquots
of media.
[0082] Cell suspensions in culture medium are supplemented with any
growth factor which allows for the proliferation of progenitor
cells and seeded in any receptacle capable of sustaining cells,
though as set out above, preferably in culture flasks or roller
bottles. Cells typically proliferate within 34 days in a 37.degree.
C. incubator, and proliferation can be reinitiated at any time
after that by dissociation of the cells and resuspension in fresh
medium containing growth factors.
[0083] In the absence of substrate, cells lift off the floor of the
flask and continue to proliferate in suspension forming a hollow
sphere of undifferentiated cells. After approximately 3-10 days in
vitro, the proliferating clusters (neurospheres) are fed every 2-7
days, and more particularly every 24 days by gentle centrifugation
and resuspension in medium containing growth factor.
[0084] After 6-7 days in vitro, individual cells in the
neurospheres can be separated by physical dissociation of the
neurospheres with a blunt instrument, more particularly by
triturating the neurospheres with a pipette. Single cells from the
dissociated neurospheres are suspended in culture medium containing
growth factors, and differentiation of the cells can be induced by
plating (or resuspending) the cells in the presence of a factor
capable of sustaining differentiation, e.g., such as a hedgehog or
ptc therapeutic of the present invention.
[0085] Stem cells useful in the present invention are generally
known. For example, several neural crest cells have been
identified, some of which are multipotent and likely represent
uncommitted neural crest cells. The role of hedgehog polypeptides
employed in the present method to culture such stem cells is to
maintain differentiation a committed progenitor cell and/or a
terminally-differentiated dopaminergic or GABAergic neuronal cell.
The hedgehog polypeptide can be used alone, or can be used
incombination with other neurotrophic factors which act to more
particularly enhance a particular differentiation fate of the
neuronal progenitor cell.
[0086] B. In vivo Applications
[0087] In addition to the implantation of cells cultured in the
presence of a functional hedgehog activity and other in vitro uses
described above, yet another aspect of the present invention
concerns the therapeutic application of a hedgehog or ptc
therapeutic to enhance survival of neurons sensitive to exotoxic
degeneration in vivo, e.g., such as dopaminergic and GABAergic
neurons. The ability of hedgehog polypeptide to maintain neuronal
differentiation indicates that certain of the hedgehog polypeptides
can be reasonably expected to facilitate control of these neuronal
cell-types in adult tissue with regard to maintenance, functional
performance, aging and prevention of degeneration and premature
death which result from loss of differentiation in certain
pathological conditions.
[0088] In light of this understanding, the present invention
specifically contemplates applications of the subject method to the
treatment of (prevention and/or reduction of the severity of)
neurological conditions deriving from exotoxic degeneration of
neuronal cells, including cell death or loss of functional
performance, e.g., such as loss of dopaminergic cells, loss of
GABAergic cells, and/or loss of neurons of the substantia nigra. In
this regard, the subject method is useful in the treatment or
prevention of such neurologic disorders including Parkinson's
disease, domoic acid poisoning, spinal cord trauma; hypoglycemia;
mechanical trauma to the nervous system; senile dementia;
Korsakoffs disease; schizophrenia; AIDS dementia, multi-infarct
dementia; mood disorders; depression; chemical toxicity and
neuronal damage associated with uncontrolled seizures, such as
epileptic seizures; and chronic neurologic disorders such as
Huntington's disease, neuronal injury associated with HIV and AIDS,
AIDS dementia, neurodegeneration associated with Down's syndrome,
neuropathic pain syndrome, olivopontocerebral atrophy, amyotrophic
lateral sclerosis, mitochondrial abnormalities, Alzheimer's
disease, hepatic encephalopathy, Tourette's syndrome,
schizophrenia, and drug addiction.
[0089] The subject hedgehog and ptc therpaeutics can also used to
reduce neurotoxic injury associated with conditions of hypoxia,
anoxia or ischemia which typically follows stroke, cerebrovascular
accident, brain or spinal chord trauma, myocardial infarct,
physical trauma, drownings, suffocation, perinatal asphyxia, or
hypoglycemic events.
[0090] In preferred embodiments, the subject method is used to
reduce the severity or prevent Parkinson's disease or Huntington's
chorea.
[0091] In general, the therapeutic method of the present invention
can be characterized as including a step of administering to an
animal an amount of a ptc or hedgehog therapeutic effective to
enhance the survival of a dopaminergic and/or GABAergic neuronal
cells. The mode of administration and dosage regimens will vary
depending on the severity of the degenerative disorder being
treated, e.g., the dosage may be altered as between a prophylaxis
and treatment. In preferred embodiments, the ptc or hedgehog
therapeutic is administered systemically initially, then locally
for medium to long term care. In certain embodiments, a source of a
hedgehog or ptc therapeutic is stereotactically provided within or
proximate the area of degeneration.
[0092] The subject method may also find particular utility in
treating or preventing the adverse neurological consequences of
surgery. For example, certain cranial surgery can result in
degeneration of neuronal populations for which the subject method
can be applied.
[0093] In other embodiments, the subject method can be used to
prevent or treat neurodegenerative conditions arising from the use
of certain drugs, such as the compound MPTP
(1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine).
[0094] In still other embodiments, the subject method can be used
in the prevention and/or treatment of hypoxia, e.g., as a
neuroprotective agent. For instance, the subject method can be used
prophylactically to lessen the neuronal cell death caused by
altitude-induced hypoxia.
[0095] A method which is "neuroprotective", in the case of
dopaminergic and GABAergic cells, results in diminished loss of
cells of those phenotype relative to that which would occur in the
absence of treatment with a hedgehog or ptc therapeutic.
[0096] (i) Treatment of Parkinson's Disease
[0097] It is now widely appreciated that the primary pathology
underlying Parkinson's disease is degeneration of the dopaminergic
projection from the substantia nigra to the striatum. This
realisation has led to the widespread use of dopamine-replacing
agents such as L-DOPA and apomorphine as symptomatic treatments,
for Parkinson's disease. Over the last three decades, such
therapies have undoubtedly been, successful in increasing the
quality of life of patients suffering from Parkinson's disease,
but, dopamine-replacement treatments do have limitations,
especially following long-term treatment. Problems can include a
wearing-off of anti-parkinsonian efficacy and the appearance of a
range of dyskinesias characterised by chorea and dystonia.
Ultimately, these side-effects can severely limit the usefulness of
dopaminergic treatments.
[0098] As described in the appended examples, hedgehog exerts
trophic and survival-promoting actions on substantia nigra
dopaminergic neurons. In vivo, treatment with exogenous hedgehog,
or other compounds of the present invention, is expected to
stimulate, for example, the dopaminergic phenotype of substantia
nigra neurons and restore functional deficits induced by axotomy or
dopaminergic neurotoxins. Therefore it may be used in the treatment
of Parkinson's disease, a neurodegenerative disease characterized
by the loss of dopaminergic neurons. Thus, in one embodiment, the
subject method comprises administering to an animal affected with
Parkinson's disease, or at risk of developing Parkonson's disease,
an amount of a hedgehog or ptc thereapeutic effective for
protecting or restoring the function of neurons affected by the
Parkinson's condition, e.g., increasing the rate of survival of
dopaminergic neurons in the animal. In preferred embodiments, the
method includes administering to the animal an amount of a hedgehog
or ptc thereapeutic which would otherwise be effective at
protecting the substantia nigra from MPTP-mediated toxicity when
MPTP is administered at a dose of 0.5 mg/kg, more preferably at a
dose of 2 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg or 50 mg/kg and, more
preferably, at a dose of 100 mg/kg.
[0099] (ii) Treatment of Huntington's Disease
[0100] Huntington's disease involves the degeneration of
intrastraital and cortical cholinergic neurons and GABAergic
neurons. Treatment of patients suffering from such degenerative
conditions can include the application of hedgehog or ptc
therapeutics of the present invention, in order to control, for
example, apoptotic events which give rise to loss of GABAergic
neurons (e.g. to enhance survival of existing neurons.
[0101] (iii) Treatment of Amyotrophic Lateral Sclerosis
[0102] Recently it has been reported that in certain ALS patients
and animal models a significant loss of midbrain dopaminergic
neurons occurs in addition to the loss of spinal motor neurons. For
instance, the literature describes degeneration of the
substantia-nigra in some patients with familial amyotrophic lateral
sclerosis. Kostic et al. (1997) Ann Neurol 41:497-504. According
the subject invention, a trophic amount of a hedgehog or ptc
therapeutic can be administered to an animal suffering from, or at
risk of developing, ALS.
[0103] (iv) Treatment of Epilepsy
[0104] Epilepsy is a recurrent paroxysmal disorder of cerebral
function characterized by sudden brief attacks of altered
consciousness, motor activity, sensory phenomena or inappropriate
behavior caused by abnormal excessive discharge of cerebral
neurons. Convulsive seizures, the most common form of attacks,
begin with loss of consciousness and motor control, and tonic or
clonic jerking of all extremities but any recurrent seizure pattern
may be termed epilepsy.
[0105] The term primary or idiopathic epilepsy denotes those cases
where no cause for the seizures can be identified. Secondary or
symptomatic epilepsy designates the disorder when it is associated
with such factors as trauma, neoplasm, infection, developmental
abnormalities, cerebrovascular disease, or various metabolic
conditions. Epileptic seizures are classified as partial seizures
(focal, local seizures) or generalized seizures (convulsive or
nonconvulsive). Classes of partial seizures include simple partial
seizures, complex partial seizures and partial seizures secondarily
generalized. Classes of generalized seizures include absence
seizures, atypical absence seizures, myoclonic seizures, clonic
seizures, tonic seizures, tonic-clonic seizures (grand mal) and
atonic seizures.
[0106] Therapeutics having anticonvulsant properties are used in
the treatment of seizures. Most therapeutics used to abolish or
attenuate seizures act at least through effects that reduce the
spread of excitation from seizure foci and prevent detonation and
disruption of function of normal aggregates of neurons.
Anticonvulsants which have been utilized include phenyloin,
phenobarbital, primidone, carbamazepine, ethosuximide, clonazepam
and valproate. For further details of seizures and their therapy
(see Rall & Schleifer (1985) and The Merck Manual (1992)).
[0107] Due to the involvement of exotoxic-dependent
neurodegeneration which can result from seizure, certain hedgehog
and ptc therpaeutics of the present invention may be useful as part
of a regimen in the treatment of epilepsy, and are preferably used
in conjunction with a treatment including an anticonvulsant
agent.
[0108] (v) Treatment of Reperfusion Injury
[0109] The most direct approach to treating cerebral ischemia is to
restore circulation. However, reperfusion following transient
ischemia can induce additional mechanisms of tissue damage. This
phenomenon is termed "reperfusion injury" and has been found to
play a role in other organ systems as well, including the heart.
Recently, it has been suggested that cerebral ischemic damage is
mediated, to a large extent, via excitotoxic mechanisms. During
ischemia, large elevations in extracellular glutamate occur, often
reaching neurotoxic levels. Accordingly, the subject method can be
used as part of a treatment or prophylaxis for ischemic or epoxic
damage, particularly to alleviate certain effects of reperfusion
injury.
[0110] (vi) Treatment of Glaucoma
[0111] Glaucoma is a complex set of diseases, which results in
damage to axons in the optic nerve and death of the retinal
ganglion cells, concluding in the permanent loss of vision. There
are several mechanism that ultimately causes the axonal damage. For
instance, an increase in intraocular pressure (IOP) overcomes the
perfusion pressure of the optic nerve and results in an ischemic
event which leads to axonal.
[0112] In addition to the primary insult and ensuing cell damage,
there appears to be a secondary degenerative process in glaucoma.
Clinically, patients often continue to lose visual field and optic
nerve head substance even in the presence of what might be
considered normal IOP. In addition, there are forms of glaucoma
which manifest in the presence of normal IOP. It is thought that
chemical mediators may be linked to intensification of cell
degeneration and death in a secondary fashion. Much work has been
done in the last five years which implicates the role of
excitotoxins, such as glutamate, in the secondary damage to retinal
neurons. Accordingly, the subject method can be used as part of a
treatment and/or prophylaxis for glaucoma.
[0113] (vii) Treatment of Hearing Loss
[0114] The mechanism by which aminoglycosides produce permanent
hearing loss is mediated, in part, through an excitotoxic process.
Accordingly, the subject method can be used as part of a treatment
and/or prophylaxis for hearing loss.
[0115] (viii) Conjoint Therapy
[0116] In yet other embodiments, the subject method can be carried
out conjointly with the administration of growth and/or trophic
factors. For instance, the combinatorial therapy can include a
trophic factor such as nerve growth factor, cilliary neurotrophic
growth factor, schwanoma-derived growth factor, glial growth
factor, stiatal-derived neuronotrophic factor, platelet-derived
growth factor, and scatter factor (HGF-SF). Antimitogenic agents
can also be used, as for example, cytosine, arabinoside,
5-fluorouracil, hydroxyurea, and methotrexate.
[0117] (ix) Formulations
[0118] Determination of a therapeutically effective amount and a
prophylactically effective amount of a hedgehog or ptc therapeutic,
e.g., to be adequately neuroprotective, can be readily made by the
physician or veterinarian (the "attending clinician"), as one
skilled in the art, by the use of known techniques and by observing
results obtained under analogous circumstances. The dosages may be
varied depending upon the requirements of the patient in the
judgment of the attending clinician, the severity of the condition
being treated, the risk of further degeneration to the CNS, and the
particular agent being employed. In determining the therapeutically
effective trophic amountor dose, and the prophylactically effective
amount or dose, a number of factors are considered by the attending
clinician, including, but not limited to: the specific cause of the
degenerative state and its likelihood of recurring or worsening;
pharmacodynamic characteristics of the particular agent and its
mode and route of administration; the desirder time course of
treatment; the species of mammal; its size, age, and general
health; the response of the individual patient; the particular
compound administered; the bioavailability characteristics of the
preparation administered; the dose regimen selected; the kind of
concurrent treatment (i.e., the interaction of the hedgehog or ptc
therapeutic with other co-administered therapeutics); and other
relevant circumstances.
[0119] Treatment can be initiated with smaller dosages which are
less than the optimum dose of the agent. Thereafter, the dosage
should be increased by small increments until the optimum effect
under the circumstances is reached. For convenience, the total
daily dosage may be divided and administered in portions during the
day if desired. A; therapeutically effective trophic amount and a
prophylactically effective neuroprotective amount of a hedgehog
polypeptide, for instance, is expected to vary from concentrations
about 0.1 nanogram per kilogram of body weight per day (ng/kg/day)
to about 100 mg/kg/day.
[0120] Potential hedgehog and ptc therapeutics, such as described
below, can be tested by any of number of well known animal disease
models. For instance, regarding Parkinson's Disease, selected
agents can be evaluated in animals treated with MPTP. The compound
MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) and its
metabolite MTP.sup.+ have been used to induce experimental
parkinsonism. MPP.sup.+ kills dopaminergic neurons in the
substantia nigra, yielding a reasonable model of late parkinsonism.
Turski et al., (1991) Nature 349:414.
[0121] Compounds which are determined to be effective for the
prevention or treatment of degeneration of dopaminergic and
GABAergic neurons and the like in animals, e.g., dogs, rodents, may
also be useful in treatment of disorders in humans. Those skilled
in the art of treating in such disorders in humans will be guided,
from the data obtained in animal studies, to the correct dosage and
route of administration of the compound to humans. In general, the
determination of dosage and route of administration in humans is
expected to be similar to that used to determine administration in
animals.
[0122] The identification of those patients who are in need of
prophylactic treatment for disorders marked by degeneration of
dopaminergic and/or GABAergic neurons is well within the ability
and knowledge of one skilled in the art. Certain of the methods for
identification of patients which are at risk and which can be
treated by the subject method are appreciated in the medical arts,
such as family history of the development of a particular disease
state and the presence of risk factors associated with the
development of that disease state in the subject patient. A
clinician skilled in the art can readily identify such candidate
patients, by the use of, for example, clinical tests, physical
examination and medical/family history.
[0123] IV Exemplary Hedgehog Therapeutic Compounds
[0124] The hedgehog therapeutic compositions of the subject method
can be generated by any of a variety of techniques, including
purification of naturally occurring proteins, recombinantly
produced proteins and synthetic chemistry. Polypeptide forms of the
hedgehog therapeutics are preferably derived from vertebrate
hedgehog polypeptides, e.g., have sequences corresponding to
naturally occurring hedgehog polypeptides, or fragments thereof,
from vertebrate organisms. However, it will be appreciated that the
hedgehog polypeptide can correspond to a hedgehog polypeptide (or
fragment thereof) which occurs in any metazoan organism.
[0125] The various naturally-occurring hedgehog polypeptides from
which the subject therapeutics can be derived are characterized by
a signal peptide, a highly conserved N--terminal region, and a more
divergent C-terminal domain. In addition to signal sequence
cleavage in the secretory pathway (Lee, J. J. et al. (1992) Cell
71:33-50; Tabata, T. et al. (1992) Genes Dev. 2635-2645; Chang, D.
E. et al. (1994) Development 120:3339-3353), hedgehog precursor
proteins naturally undergo an internal autoproteolytic cleavage
which depends on conserved sequences in the C-terminal portion (Lee
et al. (1994) Science 266:1528-1537; Porter et al. (1995) Nature
374:363-366). This autocleavage leads to a 19 kD N-terminal peptide
and a C-terminal peptide of 26-28 kD (Lee et al. (1992) supra;
Tabata et al. (1992) supra; Chang et al. (1994) supra; Lee et al.
(1994) supra; Bumcrot, D. A, et al. (1995) Mol. Cell. Biol.
15:2294-2303; Porter et al. (1995) supra; Ekker, S. C. et al.
(1995) Curr. Biol. 5:944-955; Lai, C. J. et al. (1995) Development
121:2349-2360). The N-terminal peptide stays tightly associated
with the surface of cells in which it was synthesized, while the
C-terminal peptide is freely diffusible both in vitro and in vivo
(Lee et al (1994) supra; Bumcrot et al. (1995) supra; Mart', E. et
al. (1995) Development 121:2537-2547; Roelink, H. et al. (1995)
Cell 81:445-455). Cell surface retention of the N-terminal peptide
is dependent on autocleavage, as a truncated form of hedgehog
encoded by an RNA which terminates precisely at the normal position
of internal cleavage is diffusible in vitro (Porter et al. (1995)
supra) and in vivo (Porter, J. A. et al. (1996) Cell 86, 21-34).
Biochemical studies have shown that the autoproteolytic cleavage of
the hedgehog precursor protein proceeds through an internal
thioester intermediate which subsequently is cleaved in a
nucleophilic substitution. It is suggested that the nucleophile is
a small lipophilic molecule, more particularly cholesterol, which
becomes covalently bound to the C-terminal end of the N-peptide
(Porter et al. (1996) supra), tethering it to the cell surface.
[0126] The vertebrate family of hedgehog genes includes at least
four members, e.g., paralogs of the single drosophila hedgehog gene
(SEQ ID No. 19). Three of these members, herein referred to as
Desert hedgehog (Dhh), Sonic hedgehog (Shh) and Indian hedgehog
(Ihh), apparently exist in all vertebrates, including fish, birds,
and mammals. A fourth member, herein referred to as tiggie-winkle
hedgehog (Thh), appears specific to fish. According to the appended
sequence listing, (see also Table 1) a chicken Shh polypeptide is
encoded by SEQ ID No:1; a mouse Dhh polypeptide is encoded by SEQ
ID No:2; a mouse Thh polypeptide is encoded by SEQ ID No:3; a mouse
Shh polypeptide is encoded by SEQ ID No:4a zebrafish Shh
polypeptide is encoded by SEQ ID No:5; a human Shh polypeptide is
encoded by SEQ ID No:6; a human Ihh polypeptide is encoded by SEQ
ID No:7; a human Dhh polypeptide is encoded by SEQ ID No. 8; and a
zebrafish Thh is encoded by SEQ ID No. 9.
TABLE-US-00001 TABLE 1 Guide to hedgehog sequences in Sequence
Listing Nucleotide Amino Acid Chicken Shh SEQ ID No. 1 SEQ ID No.
10 Mouse Dhh SEQ ID No. 2 SEQ ID No. 11 Mouse Ihh SEQ ID No. 3 SEQ
ID No. 12 Mouse Shh SEQ ID No. 4 SEQ ID No. 13 Zebrafish Shh SEQ ID
No. 5 SEQ ID No. 14 Human Shh SEQ ID No. 6 SEQ ID No. 15 Human Ihh
SEQ ID No. 7 SEQ ID No. 16 Human Dhh SEQ ID No. 8 SEQ ID No. 17
Zebrafish Thh SEQ ID No. 9 SEQ ID No. 18 Drosophila HH SEQ ID No.
19 SEQ ID No. 20
[0127] In addition to the sequence variation between the various
hedgehog homologs, the hedgehog polypeptides are apparently present
naturally in a number of different forms, including a pro-form, a
full-length mature form, and several processed fragments thereof.
The pro-form includes an N-terminal signal peptide for directed
secretion of the extracellular domain, while the full-length mature
form lacks this signal sequence.
[0128] As described above, further processing of the mature form
occurs in some instances to yield biologically active fragments of
the protein. For instance, sonic hedgehog undergoes additional
proteolytic processing to yield two peptides of approximately 19
kDa and 27 kDa, the 19 kDa fragment corresponding to an proteolytic
N-terminal portion of the mature protein.
[0129] In addition to proteolytic fragmentation, the vertebrate
hedgehog polypeptides can also be modified post-translationally,
such as by glycosylation and/or addition of lipophilic moieties,
such as stents, fatty acids, etc., though bacterially produced
(e.g. unmodified) forms of the proteins still maintain certain of
the bioactivities of the native protein. Bioactive fragments of
hedgehog polypeptides of the present invention have been generated
and are described in great detail in, e.g., PCT publications WO
95118856 and WO 96/17924.
[0130] There are a wide range of lipophilic moieties with which
hedgehog polypeptides can be derivatived. The term "lipophilic
group", in the context of being attached to a hedgehog polypeptide,
refers to a group having high hydrocarbon content thereby giving
the group high affinity to lipid phases. A lipophilic group can be,
for example, a relatively long chain alkyl or cycloalkyl
(preferably n-alkyl) group having approximately 7 to30 carbons. The
alkyl group may terminate with a hydroxy or primary amine "tail".
To further illustrate, lipophilic molecules include
naturally-occurring and synthetic aromatic and non-aromatic
moieties such as fatty acids, sterols, esters and alcohols, other
lipid molecules, cage structures such as adamantane and
buckminsterfullerenes, and aromatic hydrocarbons such as benzene,
perylene, phenanthrene, anthracene, naphthalene, pyrene, chrysene,
and naphthacene.
[0131] In one embodiment, the hedgehog polypeptide is modified with
one or more sterol moieties, such as cholesterol. See, for example,
PCT publication WO 96/17924. In certain embodiments, the
cholesterol is preferably added to the C-terminal glycine when the
hedgehog polypeptide corresponds to the naturally-occurring
N-terminal proteolytic fragment.
[0132] In another embodiment, the hedgehog polypeptide can be
modified with a fatty acid moiety, such as a myrostoyl, palmitoyl,
stearoyl, or arachidoyl moiety. See, e.g., Pepinsky et al. (1998)
J. Biol. Chem. 273: 14037.
[0133] In addition to those effects seen by cholesterol-addition to
the C-terminus or fatty acid addition to the N-terminus of
extracellular fragments of the protein, at least certain of the
biological activities of the hedgehog gene products are
unexpectedly potentiated by derivativation of the protein with
lipophilic moieties at other sites on the protein and/or by
moieties other than cholesterol or fatty acids. Certain aspects of
the invention are directed to the use of preparations of hedgehog
polypeptides which are modified at sites other than N-terminal or
C-terminal residues of the natural processed form of the protein,
and/or which are modified at such terminal residues with lipophilic
moieties other than a sterol at the C-terminus or fatty acid at the
N-terminus.
[0134] Particularly useful as lipophilic molecules are alicyclic
hydrocarbons, saturated and unsaturated fatty acids and other lipid
and phospholipid moieties, waxes, cholesterol, isoprenoids,
terpenes and polyalicyclic hydrocarbons including adamantane and
buckminsterfiillerenes, vitamins, (C1-C18)-alkyl phosphate
diesters, --O--CH2-CH(OH)--O--(C12-C18)-alkyl, and in particular
conjugates with pyrene derivatives. The lipophilic moiety can be a
lipophilic dye suitable for use in the invention include, but are
not limited to, diphenylhexatriene, Nile Red,
N-phenyl-1-naphthylamine, Prodan, Laurodan, Pyrene, Perylene,
rhodamine, rhodamine B, tetrarethylrhodamine, Texas Red,
sulforhodamine,
1,1'-didodecyl-3,3,3',3'tetramethylindocarbocyariine perchlorate,
octadecyl rhodamine B and the BODIPY dyes available from Molecular
Probes Inc.
[0135] Other exemplary lipophilic moietites include aliphatic
carbonyl radical groups include 1- or 2-adamantylacetyl,
3-methyladamant-1-ylacetyl, 3-methyl-3-bromo-1-adamantylacetyl,
1-decalinacetyl; camphoracetyl, camphaneacetyl, noradamantylacetyl,
norbornaneacetyl, bicyclo[2.2.2.]-oct-5-eneacetyl,
1-methoxybicyclo[2.2.2.]-oct-5-ene-2-carbonyl,
cis-5-norbornene-endo-2,3-dicarbonyl, 5-norbornen-2-ylacetyl,
(1R)-(-)-myrtentaneacetyl, 2-norbornaneacetyl,
anti-3-oxo-tricyclo[2.2.1.0<2,6>]-heptane-7-carbonyl,
decanoyl, dodecanoyl, dodecenoyl, tetradecadienoyl, decynoyl or
dodecynoyl.
[0136] The hedgehog polypeptide can be linked to the hydrophobic
moiety in a number of ways including by chemical coupling means, or
by genetic engineering.
[0137] There are a large number of chemical cross-linking agents
that are known to those skilled in the art. For the present
invention, the preferred cross-linking agents are
heterobifunctional cross-linkers, which can be used to link the
hedgehog polypeptide and hydrophobic moiety in a stepwise manner.
Heterobifunctional cross-linkers provide the ability to design more
specific coupling methods for conjugating to proteins, thereby
reducing the occurrences of unwanted side reactions such as
homo-protein polymers. A wide variety of heterobifunctional
cross-linkers are known in the art. These include: succinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC),
m-Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS); N-succinimidyl
(4-iodoacetyl)aminobenzoate (SLAB), succinimidyl
4-(p-maleimidophenyl) butyrate (SMPB),
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC);
4-succinimidyloxycarbonyl-a-methyl-a-(2 pyridyldithio)-tolune
(SMPT), N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP),
succinimidyl 6-[3-(2-pyridyldithio)propionate]hexanoate (LC-SPDP).
Those cross-linking agents having N-hydroxysuccinimide moieties can
be obtained as the N-hydroxysulfosuccinimide analogs, which
generally have greater water solubility. In addition, those
cross-linking agents having disulfide bridges within the linking
chain can be synthesized instead as the alkyl derivatives so as to
reduce the amount of linker cleavage in vivo.
[0138] In addition to the heterobifunctional cross-linkers, there
exists a number of other cross-linking agents including
homobifunctional and photoreactive cross-linkers. Disuccinimidyl
suberate (DSS), bisaaleimidohexane (BMH) and dimethylpimelimidate-2
HCl (DMP) are examples of useful homobifunctional cross-linking
agents, and bis-[.beta.-(4-azidosalicylamido)ethyl]disulfide
(BASED) and
N-succininidyl-6(4'-azido-2'-nitrophenyl-amino)hexanoate (SANPAH)
are examples of useful photoreactive cross-linkers for use in this
invention. For a recent review of protein coupling techniques, see
Means et al. (1990) Bioconjugate Chemistry 1:2-12, incorporated by
reference herein.
[0139] One particularly useful class of heterobifunctional
cross-linkers, included above, contain the primary amine reactive
group, N-hydroxysuccinimide (NHS), or its water soluble analog
N-hydroxysulfosuccinimide (sulfo-NHS). Primary amines (lysine
epsilon groups) at alkaline pH's are unprotonated and react by
nucleophilic attack on NHS or sulfo-NHS esters. This reaction
results in the formation of an amide bond, and release of NHS or
sulfo-NHS as a by-product.
[0140] Another reactive group useful as part of a
heterobifunctional cross-linker is a thiol reactive group. Common
thiol reactive groups include maleimides, halogens, and pyridyl
disulfides. Maleimides react specifically with free sulfhydryls
(cysteine residues) in minutes, under slightly-acidic to neutral
(pH 6.5-7.5) conditions. Halogens (iodoacetyl functions) react with
--SH groups at physiological pH's. Both of these reactive groups
result in the formation of stable thioether bonds.
[0141] The third component of the heterobifunctional cross-linker
is the spacer arm or bridge. The bridge is the structure that
connects the two reactive ends. The most apparent attribute of the
bridge is its effect on steric hindrance. In some instances, a
longer bridge can more easily span the distance necessary to link
two complex biomolecules. For instance, SMPB has a span of 14.5
angstroms.
[0142] Preparing protein-protein conjugates using
heterobifunctional reagents is a two-step process involving the
amine reaction and the sulfhydryl reaction. For the first step, the
amine reaction, the protein chosen should contain a primary amine.
This can be lysine epsilon amines or a primary alpha amine found at
the N-terminus of most proteins. The protein should not contain
free sulfhydryl groups. In cases where both proteins to be
conjugated contain free sulfhydryl groups, one protein can be
modified so that all sulhydryls are blocked using for instance,
N-ethylmaleimide (see Partis et al. (1983) J. Pro. Chem. 2:263,
incorporated by reference herein). Ellman's Reagent can be used to
calculate the quantity of sulfhydryls in a particular protein (see
for example Ellman et al. (1958) Arch. Biochem. Biophys. 74:443 and
Riddles et al. (1979) Anal. Biochem. 94:75, incorporated by
reference herein).
[0143] The reaction buffer should be free of extraneous amines and
sulfhydryls. The pH of the reaction buffer should be 7.0-7.5. This
pH range prevents maleimide groups from reacting with amines,
preserving the maleimide group for the second reaction with
sulfhydryls.
[0144] The NHS-ester containing cross-linkers have limited water
solubility. They should be dissolved in a minimal amount of organic
solvent (DMF or DMSO) before introducing the cross-linker into the
reaction mixture. The cross-linker/solvent forms an emulsion which
will allow the reaction to occur.
[0145] The sulfo-NHS ester analogs are more water soluble, and can
be added directly to the reaction buffer. Buffers of high ionic
strength should be avoided, as they have a tendency to "salt out"
the sulfo-NHS esters. To avoid loss of reactivity due to
hydrolysis, the cross-linker is added to the reaction mixture
immediately after dissolving the protein solution.
[0146] The reactions can be more efficient in concentrated protein
solutions. The more alkaline the pH of the reaction mixture, the
faster the rate of reaction. The rate of hydrolysis of the NHS and
sulfo-NHS esters will also increase with increasing pH. Higher
temperatures will increase the reaction rates for both hydrolysis
and acylation.
[0147] Once the reaction is completed, the first protein is now
activated, with a sulfhydryl reactive moiety. The activated protein
may be isolated from the reaction mixture by simple gel filtration
or dialysis. To carry out the second step of the cross-linking, the
sulfhydryl reaction, the lipophilic group chosen for reaction with
maleimides, activated halogens, or pyridyl disulfides must contain
a free sulfhydryl. Alternatively, a primary amine may be modified
with to add a sulfhydryl.
[0148] In all cases, the buffer should be degassed to prevent
oxidation of sulfhydryl groups. EDTA may be added to chelate any
oxidizing metals that may be present in the buffer. Buffers should
be free of any sulfhydryl containing compounds.
[0149] Maleimides react specifically with --SH groups at slightly
acidic to neutral pH ranges (6.5-7.5). A neutral pH is sufficient
for reactions involving halogens and pyridyl disulfides. Under
these conditions, maleimides generally react with --SH groups
within a matter of minutes. Longer reaction times are required for
halogens and pyridyl disulfides.
[0150] The first sulfhydryl reactive-protein prepared in the amine
reaction step is mixed with the sulfhydryl-containing lipophilic
group under the appropriate buffer conditions. The conjugates can
be isolated from the reaction mixture by methods such as gel
filtration or by dialysis.
[0151] Exemplary activated lipophilic moieties for conjugation
include: N-(1-pyrene)maleimide; 2,5-dimethoxystilbene-4'-maleimide,
eosin-5-maleimide; fluorescein-5-maleimide;
N-(4-(6-dimethylamino-2-benzofuranyl)phenyl)maleimide;
benzophenone-4-maleimide;
4-dimethylaminophenylazophenyl-4'-maleimide (DABMI),
tetramethylrhodamine-5-maleimide, tetramethylrhodamine-6-maleimide,
Rhodamine Red.TM. C2 maleimide, N-(5-aminopentyl)maleimide,
trifluoroacetic acid salt, N-(2-aminoethyl)maleimide,
trifluoroacetic acid salt, Oregon Green.TM. 488 maleimide,
N-(2-((2-(((4-azido-2,3,5,6-tetrafluoro)benzoyl)amino)ethyl)dithio)ethyl)-
maleimide (TFPAM-SS1),
2-(1-(3-dimethylaminopropyl)-indol-3-yl)-3-(indol-3-yl) maleimide
(bisindolylmaieimide; GF 109203X), BODIPY.RTM. FL
N-(2-aminoethyl)maleimide,
N-(7-dimethylamino-4-methylcoumarin-3-yl)maleimide (DACM),
Alexa.TM. 488 C5 maleimide, Alexa.TM. 594 C5 maleimide, sodium
saltN-(1-pyrene)maleimide, 2,5-dimethoxystilbene-4'-maleimide,
eosin-5-maleimide, fluorescein-5-maleimide,
N-(4-(6-dimethylamino-2-benzofuranyl)phenyl)maleimide,
benzophenone-4-maleimide-4-dimethylaminophenylazophenyl-4'-maleimide,
1-(2-maleimidylethyl).sub.4(5-(4-methoxyphenyl)oxazol-2-yl)pyridinium
methanesulfonate, tetramethylrhodamine-5-maleimide,
tetramethylrhodamine-6-maleimide, Rhodamine Red.TM. C2 maleimide,
N-(5-aminopentyl)maleimide, N-(2-aminoethyl)maleimide,
N-(2-((2-(((4-azido-2,3,5,6-tetrafluoro)benzoyl)amino)ethyl)dithio)ethyl)-
maleimide,
2-(1-(3-dimethylaminopropyl)-indol-3-yl)-3-(indol-3-yl)maleimid- e,
N-(7-dimethylamino-4-methylcoumarin-3-yl)maleimide (DACM),
1H-Benzo[a]fluorene, Benzo[a]pyrene.
[0152] In one embodiment, the hedgehog polypeptide can be
derivatived using pyrene maleimide, which can be purchased from
Molecular Probes (Eugene, Oreg.), e.g., N-(1-pyrene)maleimide or
1-pyrenemethyl iodoacetate (PMA ester). As illustrated in FIG. 1,
the pyrene-derived hedgehog polypeptide had an activity profile
indicating that it was nearly 2 orders of magnitude more active
than the unmodified form of the protein.
[0153] For those embodiments wherein the hydrophobic moiety is a
polypeptide, the modified hedgehog polypeptide of this invention
can be constructed as a fusion protein, containing the hedgehog
polypeptide and the hydrophobic moiety as one contiguous
polypeptide chain.
[0154] In certain embodiments, the lipophilic moiety is an
amphipathic polypeptide, such as magainin, cecropin, attacin,
melittin, gramicidin S, alpha-toxin of Staph aureus, alamethicin or
a synthetic amphipathic polypeptide. Fusogenic coat proteins from
viral particles can also be a convenient source of amphipathic
sequences for the subject hedgehog polypeptides
[0155] Moreover, mutagenesis can be used to create modified hh
polypeptides, e.g., for such purposes as enhancing therapeutic or
prophylactic efficacy, or stability (e.g., ex vivo shelf life and
resistance to proteolytic degradation in vivo). Such modified
peptides can be produced, for instance, by amino acid substitution,
deletion, or addition. Modified hedgehog polypeptides can also
include those with altered post-translational processing relative
to a naturally occurring hedgehog polypeptide, e.g., altered
glycosylation, cholesterolization, prenylation and the like.
[0156] In one embodiment, the hedgehog therapeutic is a polypeptide
encodable by a nucleotide sequence that hybridizes under stringent
conditions to a hedgehog coding sequence represented in one or more
of SEQ ID Nos:1-9 or 19. Appropriate stringency conditions which
promote DNA hybridization, for example, 6.0.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by a
wash of 2.0.times.SSC at 50.degree. C., are known to those skilled
in the art or can be found in Current Protocols in Molecular
Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For
example, the salt concentration in the wash step can be selected
from a low stringency of about 2.0.times.SSC at 50.degree. C. to a
high stringency of about 0.2.times.SSC at 50.degree. C. In
addition, the temperature in the wash step can be increased from
low stringency conditions at room temperature, about 22.degree. C.,
to high stringency conditions at about 65.degree. C.
[0157] As described in the literature, genes for other hedgehog
polypeptides, e.g., from other animals, can be obtained from mRNA
or genomic DNA samples using techniques well known in the art. For
example, a cDNA encoding a hedgehog polypeptide can be obtained by
isolating total mRNA from a cell, e.g. a mammalian cell, e.g. a
human cell, including embryonic cells. Double stranded cDNAs can
then be prepared from the total mRNA, and subsequently inserted
into a suitable plasmid or bacteriophage vector using any one of a
number of known techniques. The gene encoding a hedgehog
polypeptide can also be cloned using established polymerase chain
reaction techniques.
[0158] Preferred nucleic acids encode a hedgehog polypeptide
comprising an amino acid sequence at least 60% homologous, more
preferably 70% homologous and most preferably 80% homologous with
an amino acid sequence selected from the group consisting of SEQ ID
Nos:8-14. Nucleic acids which encode polypeptides at least about
90%, more preferably at least about 95%, and most preferably at
least about 98-99% homology with an amino acid sequence represented
in one of SEQ ID Nos:10-18 or 20 are also within the scope of the
invention.
[0159] Hedgehog polypeptides preferred by the present invention, in
addition to native hedgehog polypeptides, are at least 60%
homologous, more preferably 70% homologous and most preferably 80%
homologous with an amino acid sequence represented by any of SEQ ID
Nos:10-18 or 20. Polypeptides which are at least 90%, more
preferably at least 95%, and most preferably at least about 98-99%
homologous with a sequence selected from the group consisting of
SEQ ID Nos:10-18 or 20 are also within the scope of the invention.
The only prerequisite is that the hedgehog polypeptide is capable
of protecting neuronal cells against degeneration, e.g., the
polypeptide is trophic for a dopaminergic and/or GABAergic
neuron.
[0160] The term "recombinant protein" refers to a polypeptide of
the present invention which is produced by recombinant DNA
techniques, wherein generally, DNA encoding a hedgehog polypeptide
is inserted into a suitable expression vector which is in turn used
to transform a host cell to produce the heterologous protein.
Moreover, the phrase "derived from", with respect to a recombinant
hedgehog gene, is meant to include within the meaning of
"recombinant protein" those proteins having an amino acid sequence
of a native hedgehog polypeptide, or an amino acid sequence similar
thereto which is generated by mutations including substitutions and
deletions (including truncation) of a naturally occurring form of
the protein.
[0161] The method of the present invention can also be carried out
using variant forms of the naturally occurring hedgehog
polypeptides, e.g., mutational variants.
[0162] As is known in the art, hedgehog polypeptides can be
produced by standard biological techniques. For example, a host
cell transfected with a nucleic acid vector directing expression of
a nucleotide sequence encoding the subject polypeptides can be
cultured under appropriate conditions to allow expression of the
peptide to occur. The polypeptide hedgehog may be secreted and
isolated from a mixture of cells and medium containing the
recombinant hedgehog polypeptide. Alternatively, the peptide may be
retained cytoplasmically by removing the signal peptide sequence
from the recombinant hedgehog gene and the cells harvested, lysed
and the protein isolated. A cell culture includes host cells, media
and other byproducts. Suitable media for cell culture are well
known in the art. The recombinant hedgehog polypeptide can be
isolated from cell culture medium, host cells, or both using
techniques known in the art for purifying proteins including
ion-exchange chromatography, gel filtration chromatography,
ultrafiltration, electrophoresis, and immunoaffinity purification
with antibodies specific for such peptide. In a preferred
embodiment, the recombinant hedgehog polypeptide is a fusion
protein containing a domain which facilitates its purification,
such as an hedgehog/GST fusion protein. The host cell may be any
prokaryotic or eukaryotic cell.
[0163] Recombinant hedgehog genes can be produced by ligating
nucleic acid encoding an hedgehog polypeptide, or a portion
thereof, into a vector suitable for expression in either
prokaryotic cells, eukaryotic cells, or both. Expression vectors
for production of recombinant forms of the subject hedgehog
polypeptides include plasmids and other vectors. For instance,
suitable vectors for the expression of a hedgehog polypeptide
include plasmids of the types: pBR322-derived plasmids,
pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived
plasmids and pUC-derived plasmids for expression in prokaryotic
cells, such as E. coli.
[0164] A number of vectors exist for the expression of recombinant
proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2,
and YRP17 are cloning and expression vehicles useful in the
introduction of genetic constructs into S. cerevisiae (see, for
example, Broach et. al. (1983) in Experimental Manipulation of Gene
Expression, ed. M. Inouye Academic Press, p. 83, incorporated by
reference herein). These vectors can replicate in E. coli due the
presence of the pBR322 ori, and in S. cerevisiae due to the
replication determinant of the yeast 2 micron plasmid. In addition,
drug resistance markers such as ampicillin can beused in an
illustrative embodiment, an hedgehog polypeptide is produced
recombinantly utilizing an expression vector generated by
sub-cloning the coding sequenceof one of the hedgehog genes
represented in SEQ ID Nos:1-9 or 19.
[0165] The preferred mammalian expression vectors contain both
prokaryotic sequences, to facilitate the propagation of the vector
in bacteria, and one or more eukaryotic transcription units that
are expressed in eukaryotic cells. The pcDNAI/amp, pcDNAI/neo,
pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, pTk2, pRSVne6, pMSG, pSVT7,
pko-neo and pHyg derived vectors are examples of mammalian
expression vectors suitable for transfection of eukaryotic cells.
Some of these vectors are modified with sequences from bacterial
plasmids, such as pBR322, to facilitate replication and drug
resistance selection in both prokaryotic and eukaryotic cells.
Alternatively, derivatives of viruses such as the bovine
papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived
and p205) can be used for transient expression of proteins in
eukaryotic cells. The various methods employed in the preparation
of the plasmids and transformation of host organisms are well known
in the art. For other suitable expression systems for both
prokaryotic and eukaryotic cells, as Well as general recombinant
procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed.
by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory
Press: 1989) Chapters 16 and 17.
[0166] In some instances, it may be desirable to express the
recombinant hedgehog polypeptide by the use of a baculovirus
expression system. Examples of such baculovirus expression systems
include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941),
pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived
vectors (such as the .beta.-gal containing pBlueBac III).
[0167] When it is desirable to express only a portion of a hedgehog
polypeptide, such as a form lacking a portion of the N-terminus,
i.e. a truncation mutant which lacks the signal peptide, it may be
necessary to add a start codon (ATG) to the oligonucleotide
fragment containing the desired sequence to be expressed. It is
well known in the art that a methionine at the N-terminal position
can be enzymatically cleaved by the use of the enzyme methionine
aminopeptidase (MAP). MAP has been cloned from E. coli (Ben-Bassat
et al. (1987) J. Bacteriol. 169:751-757) and Salmonella typhimurium
and its in vitro activity has been demonstrated on recombinant
proteins (Miller et al. (1987) PNAS 84:2718-1722). Therefore,
removal of an N-terminal methionine, if desired, can be achieved
either in vivo by expressing hedgehog-derived polypeptides in a
host which produces MAP (e.g., E. coli or CM89 or S. cerevisiae),
or in vitro by use of purified MAP (e.g., procedure of Miller et
al., supra).
[0168] Alternatively, the coding sequences for the polypeptide can
be incorporated as a part of a fusion gene including a nucleotide
sequence encoding a different polypeptide. It is widely appreciated
that fusion proteins can also facilitate the expression of
proteins, and accordingly, can be used in the expression of the
hedgehog polypeptides of the present invention. For example,
hedgehog polypeptides can be generated as glutathione-S-transferase
(GST-fusion) proteins. Such GST-fusion proteins can enable easy
purification of the hedgehog polypeptide, as for example by the use
of glutathione-derivatized matrices (see, for example, Current
Protocols in Molecular Biology, eds. Ausubel et al. (N.Y.: John
Wiley & Sons, 1991)). In another embodiment, a fusion gene
coding for a purification leader sequence, such as a
poly-(His)/enterokinase cleavage site sequence, can be used to
replace the signal sequence which naturally occurs at the
N-terminus of the hedgehog polypeptide (e.g. of the pro-form, in
order to permit purification of the poly(His)-hedgehog polypeptide
by affinity chromatography using a Ni.sup.2+ metal resin. The
purification leader sequence can then be subsequently removed by
treatment with enterolinase (e.g., see Hochuli et al. (1987) J.
Chromatography 411:177; and Janknecht et al. PNAS 88:8972).
[0169] Techniques for making fusion genes are known to those
skilled in the art. Essentially, the joining of various DNA
fragments coding for different polypeptide sequences is performed
in accordance with conventional techniques, employing blunt-ended
or stagger-ended termini for ligation, restriction enzyme digestion
to provide for appropriate termini, fillingin of cohesive ends as
appropriate, alkaline phosphatase treatment to avoid undesirable
joining, and enzymatic ligation. In another embodiment, the fusion
gene can be synthesized by conventional techniques including
automated DNA synthesizers. Alternatively, PCR amplification of
gene fragments can be carried out using anchor primers which give
rise to complementary overhangs between two consecutive gene
fragments which can subsequently be annealed to generate a chimeric
gene sequence (see, for example, Current Protocols in Molecular
Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
[0170] Hedgehog polypeptides may also be chemically modified to
create hedgehog derivatives by forming covalent or aggregate
conjugates with other chemical moieties, such as glycosyl groups,
cholesterol, isoprenoids, lipids, phosphate, acetyl groups and the
like. Covalent derivatives of hedgehog polypeptides can be prepared
by linking the chemical moieties to functional groups on amino acid
sidechains of the protein or at the N-terminus or at the C-terminus
of the polypeptide.
[0171] For instance, hedgehog polypeptides can be generated to
include a moiety, other than sequence naturally associated with the
protein, that binds a component of the extracellular matrix and
enhances localization of the analog to cell surfaces. For example,
sequences derived from the fibronectin "type-III repeat", such as a
tetrapeptide sequence R-G-D-S (Pierschbacher et al. (1984) Nature
309:30-3; and Kornblihtt et al. (1985) EMBO 4:1755-9) can be added
to the hedgehog polypeptide to support attachment of the chimeric
molecule to a cell through binding ECM components (Ruoslahti et al.
(1987) Science 238:491-497; Pierschbacher et al. (1987) J. Biol.
Chem. 262:17294-8; Hynes (1987) Cell 48:549-54; and Hynes (1992)
Cell 69:11-25).
[0172] In preferred embodiment, the hedgehog polypeptide is
isolated from, or is otherwise substantially free of, other
cellular proteins, especially other extracellular or cell surface
associated proteins which may normally be associated with the
hedgehog polypeptide. The term "substantially free of other
cellular or extracellular proteins" (also referred to herein as
"contaminating proteins") or "substantially pure or purified
preparations" are defined as encompassing preparations of hedgehog
polypeptides having less than 20% (by dry weight) contaminating
protein, and preferably having less than 5% contaminating protein.
By "purified", it is meant that the indicated molecule is present
in the substantial absence of other biological macromolecules, such
as other proteins. The term "purified" as used herein preferably
means at least 80% by, dry weight, more preferably in the range of
95-99% by weight, and most preferably at least 99.8% by weight, of
biological macromolecules of the same type present (but water,
buffers, and other small molecules, especially molecules having a
molecular weight of less than 5000, can be present). The term
"pure" as used herein preferably has the same numerical limits as
"purified" immediately above.
[0173] As described above for recombinant polypeptides, isolated
hedgehog polypeptides can include all or a portion of the amino
acid sequences represented in any of SEQ ID Nos:10-18 or 20, or a
homologous sequence thereto. Preferred fragments of the subject
hedgehog polypeptides correspond to the N-terminal and C-terminal
proteolytic fragments of the mature protein. Bioactive fragments of
hedgehog polypeptides are described in great detail in PCT
publications WO 95/18856 and WO 96/17924.
[0174] With respect to bioactive fragments of hedgehog polypeptide,
preferred hedgehog therapeutics include at least 50 amino acid
residues of a hedgehog polypeptide, more preferably at least 100,
and even more preferably at least 150.
[0175] Another preferred hedgehog polypeptide which can be included
in the hedgehog therapeutic is an N-terminal fragment of the mature
protein having a molecular weight of approximately 19 kDa.
[0176] Preferred human hedgehog polypeptides include N-terminal
fragments corresponding approximately to residues 24-197 of SEQ ID
No. 15, 28-202 of SEQ ID No. 16, and 23-198 of SEQ ID No. 17. By
"corresponding approximately" it is meant that the sequence of
interest is at most 20 amino acid residues different in length to
the reference sequence, though more preferably at most 5, 10 or 15
amino acid different in length.
[0177] Still other preferred hedgehog polypeptides includes an
amino acid sequence represented by the formula A-B wherein: (i) A
represents all or the portion of the amino acid sequence designated
by residues-1-168 of SEQ ID No:21; and B represents at least one
amino acid residue of the amino acid sequence designated by
residues 169-221 of SEQ ID No:21; (ii) A represents all or the
portion of the amino acid sequence designated by residues 24-193 of
SEQ ID No:15; and B represents at least one amino acid residue of
the amino acid sequence designated by residues 194-250 of SEQ ID
No:15; (iii) A represents all or the portion of the amino acid
sequence designated by residues 25-193 of SEQ ID No:13; and B
represents at least one amino acid residue of the amino acid
sequence designated by residues 194-250 of SEQ ID No:13; (iv) A
represents all or the portion of the amino acid sequence designated
by residues 23-193 of SEQ ID No:11; and B represents at least one
amino acid residue of the amino acid sequence designated by
residues 194-250 of SEQ ID No:11; (v) A represents all or the
portion of the amino acid sequence designated by residues 28-191 of
SEQ ID No:12; and B represents at least one amino acid residue of
the amino acid sequence designated by residues 198-250 of SEQ ID
No:12; (vi) A represents all or the portion of the ammo acid
sequence designated by residues 29-197 of SEQ ID NO:16; and B
represents at least one amino acid residue of the amino acid
sequence designated by residues 198-250 of SEQ ID No:16; or (vii) A
represents all or the portion of the amino acid sequence designated
by residues 23-193 of SEQ ID No. 17, and B represents at least one
amino acid residue of the amino acid sequence designated by
residues 194-250 of SEQ ID No. 17. In certain preferred
embodiments, A and B together represent a contiguous polypeptide
sequence designated sequence, A represents at least 25, 50, 75,
100, 125 or 150 amino acids of the designated sequence, and B
represents at least 5, 10, or 20 amino acid residues of the amino
acid sequence designated by corresponding entry in the sequence
listing, and A and B together preferably represent a contiguous
sequence corresponding to the sequence listing entry. Similar
fragments from other hedgehog also contemplated, e.g., fragments
which correspond to the preferred fragments from the sequence
listing entries which are enumerated above.
[0178] Isolated peptidyl portions of hedgehog polypeptides can be
obtained by screening peptides recombinantly produced from the
corresponding fragment of the nucleic acid encoding such peptides.
In addition, fragments can be chemically synthesized using
techniques known in the art such as conventional Merrifield solid
phase f-Moc or t-Boc chemistry. For example, a hedgehog polypeptide
of the present invention may be arbitrarily divided into fragments
of desired length with no overlap of the fragments, or preferably
divided into overlapping fragments of a desired length. The
fragments can be produced (recombinantly or by chemical synthesis)
and tested to identify those peptidyl fragments which can function
as agonists of a wild-type (e.g., "authentic") hedgehog
polypeptide. For example, Roman et al. (1994) Eur J Biochem
222:65-73 describe the use of competitive-binding assays using
short, overlapping synthetic peptides from larger proteins to
identity binding domains.
[0179] The recombinant hedgehog polypeptides of the present
invention also include homologs of the authentic hedgehog
polypeptides, such as versions of those protein which are resistant
to proteolytic cleavage, as for example, due to mutations which
alter potential cleavage sequences or which inactivate an enzymatic
activity associated with the protein. Hedgehog homologs of the
present invention also include proteins which have been
post-translationally modified in a manner different than the
authentic protein. Exemplary derivatives of hedgehog polypeptides
include polypeptides which lack glycosylation sites (e.g. to
produce an unglycosylated protein), which lack sites for
cholesterolization, and/or which lack N-terminal and/or C-terminal
sequences.
[0180] Modification of the structure of the subject hedgehog
polypeptides can also be for such purposes as enhancing therapeutic
or prophylactic efficacy, or stability (e.g., ex vivo shelf life
and resistance to proteolytic degradation in vivo). Such modified
peptides, when designed to retain at least one activity of the
naturally-occurring form of the protein, are considered functional
equivalents of the hedgehog polypeptides described in more detail
herein. Such modified peptides can be produced, for instance, by
amino acid substitution, deletion, or addition.
[0181] It is well known in the art that certain isolated
replacements of amino acids, e.g., replacement of an amino acid
residue with another related amino acid (i.e. isosteric and/or
isoelectric mutations), can be carried out without major effect on
the biological activity of the resulting molecule. Conservative
replacements are those that take place within a family of amino
acids that are related in their side chains. Genetically encoded
amino acids are can be divided into four families: (1)
acidic=aspartate, glutamate; (2) basic lysine, arginine, histidine;
(3) nonpolar=alanine, valine, leucine, isoleucine, proline,
phenylamine, methionine, tryptophan; and (4) uncharged
polar=glycine, asparagine, glutamine, cysteine, serine, threonine,
tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes
classified jointly as aromatic amino acids. In similar fashion, the
amino acid repertoire can be grouped as (1) acidic=aspartate,
glutamate; (2) basic=lysine, arginine histidine, (3)
aliphatic=glycine, alanine, valine, leucine, isoleucine, serine,
threonine, with serine and threonine optionally be grouped
separately as aliphatic-hydroxyl; (4) aromatic=phenylalanine,
tyrosine, tryptophan; (5) amide=asparagine, glutamine; and (6)
sulfur-containing=cysteine and methionine. (see, for example,
Biochemistry, 2nd ed., Ed. by L. Stryer, WH Freeman and Co.: 1981).
Whether a change in the amino acid sequence of a peptide results in
a functional hedgehog homolog (e.g. functional in the sense that it
acts to mimic or antagonize the wild-type form) can be readily
determined byassessing the ability of the variant peptide to
produce a response in cells in a fashion similar to the wild-type
protein, or competitively inhibit such a response. Polypeptides in
which more than one replacement has taken place can readily be
tested in the same manner.
[0182] It is specifically contemplated that the methods of the
present invention can be carried using homologs of naturally
occurring hedgehog polypeptides. In one embodiment, the invention
contemplates using hedgehog polypeptides generated by combinatorial
mutagenesis. Such methods, as are known in the art, are convenient
for generating both point and truncation mutants, and can be
especially useful for identifying potential variant sequences (e.g.
homologs) that are functional in binding to a receptor for hedgehog
polypeptides. The purpose of screening such combinatorial libraries
is to generate, for example, novel hedgehog homologs which can act
as neuroprotective agents. To illustrate, hedgehog homologs can be
engineered by the present method to provide more efficient binding
to a cognate receptor, such as patched, retaining neuroprotective
activity. Thus, combinatorially-derived homotogs can be generated
to have an increased potency relative to a naturally occurring form
of the protein. Moreover, manipulation of certain domains of
hedgehog by the present method can provide domains more suitable
for use in fusion proteins, such as one that incorporates portions
of other proteins which are derived from the extracellular matrix
and/or which bind extracellular matrix components.
[0183] To further illustrate the state of the art of combinatorial
mutagenesis, it is noted that the review article of Gallop et al.
(1994) J Med Chem 37:1233 describes the general state of the art of
combinatorial libraries as of the earlier 1990's. In particular,
Gallop et al state at page 1239"[s]creenng the analog libraries
aids in determining the minimum size of the active sequence and in
identifying those residues critical for binding and intolerant of
substitution". In addition, the Ladner et al. PCT publication
WO90/02809, the Goeddel et al. U.S. Pat. No. 5,223,408, and the
Markland et al. PCT publication WO92/15679 illustrate specific
techniques which one skilled in the art could utilize to generate
libraries of hedgehog variants which can be rapidly screened to
identify variants/fragments which retained a particular activity of
the hedgehog-polypeptides. These techniques are exemplary of the
art and demonstrate that large libraries of related
variants/truncants can be generated and assayed to isolate
particular variants without undue experimentation. Gustin et al.
(1993) Virology 193:653, and Bass et al. (1990) Proteins.
Structure, Function and Genetics 8:309-314
[0184] also describe other exemplary techniques from the art which
can be adapted as means for generating mutagenic variants of
hedgehog polypeptides.
[0185] Indeed, it is plain from the combinatorial mutagenesis art
that large scale mutagenesis of hedgehog polypeptides, without any
preconceived ideas of which residues were critical to the
biological function, and generate wide arrays of variants having
equivalent biological activity. Indeed, it is the ability of
combinatorial techniques to screen billions of different variants
by high throughout analysis that removes any requirement of a
priori understanding or knowledge of critical residues.
[0186] To illustrate, the amino acid sequences for a population of
hedgehog homologs or other related proteins are aligned, preferably
to promote the highest homology possible. Such a population of
variants can include, for example, hedgehog homologs from one or
more species. Amino acids which appear at each position of the
aligned sequences are selected to create a degenerate set of
combinatorial sequences. In a preferred embodiment, the variegated
library of hedgehog variants is generated by combinatorial
mutagenesis at the nucleic acid level, and is encoded by a
variegated gene library. For instance, a mixture of synthetic
oligonucleotides can be enzymatically ligated into gene sequences
such that the degenerate set of potential hedgehog sequences are
expressible as individual polypeptides, or alternatively, as a set
of larger fusion proteins (e.g. for phage display) containing the
set of hedgehog sequences therein.
[0187] As illustrated in PCT publication WO 95/18856, to analyze
the sequences of a population of variants, the amino acid sequences
of interest can be aligned relative to sequence homology. The
presence or absence of amino acids from an aligned sequence of a
particular variant is relative to a chosen consensus length of a
reference sequence, which can be real or artificial.
[0188] In an illustrative embodiment, alignment of exons 1, 2 and a
portion of exon 3 encoded sequences (e.g. the N-terminal
approximately 221 residues of the mature protein) of each of the
Shh clones produces a degenerate set of Shh polypeptides
represented by the general formula:
TABLE-US-00002 (SEQ ID No:21)
C-G-P-G-R-G-X(1)-G-X-(2)-R-R-H-P-K-K-L-T-P-L-A-Y-
K-Q-F-I-P-N-V-A-E-K-T-L-G-A-S-G-R-Y-E-G-K-I-X(3)-
R-N-S-E-R-F-K-E-L-T-P-N-Y-N-P-D-I-I-F-K-D-E-E-N-T-
G-A-D-R-L-M-T-Q-R-C-K-D-K-L-N-X(4)-L-A-I-S-V-M-N-
X(5)-W-P-G-V-X(6)-L-R-V-T-E-G-W-D-E-D-G-H-H-X(7)-
E-E-S-L-H-Y-E-G-R-A-V-D-I-T-T-S-D-R-D-X(8)-S-K-Y-
G-X(9)-L-X(10)-R-L-A-V-E-A-G-F-D-W-V-Y-Y-E-S-K-A-
H-I-H-C-S-V-K-A-E-N-S-V-A-A-K-S-G-G-C-F-P-G-S-A-
X(11)-V-X(12)-L-X(13)-X(14)-G-G-X(15)-K-X(16)-V-K-
D-L-X(17)-P-G-D-X(18)-V-L-A-A-D-X(19)-X(20)-G-
X(21)-L-X(22)-X(23)-S-D-F-X(24)-X(25)-F-X(26)-D-R,
[0189] wherein each of the degenerate positions "X" can be an amino
acid which occurs in that position in one of the human, mouse,
chicken or zebrafish. Shh clones, or, to expand the library, each X
can also be selected from amongst amino acid residue which would be
conservative substitutions for the amino acids which appear
naturally in each of those positions. For instance, Xaa(1)
represents Gly, Ala, Val, Leu, Ile, Phe, Tyr or Trp; Xaa(2)
represents Arg, H is or Lys; Xaa(3) represents Gly, Ala, Val, Leu,
Ile, Ser or Thr; Xaa(4) represents Gly, Ala, Val, Leu, Ile, Ser or
Thr; Xaa(5)-represents Lys, Arg, His, Asn or Gln; Xaa(6) represents
Lys, Arg or His; Xaa(7) represents Ser, Thr, Tyr, Trp or Phe;
Xaa(8) represents Lys, Arg or H is; Xaa(9) represents Met, Cys, Ser
or Thr; Xaa(10) represents Gly, Ala, Val, Leu, Ile, Ser or Thr,
Xaa(II) represents Leu, Val, Met, Thr or Ser; Xaa(12) represents H
is, Phe, Tyr, Ser, Thr, Met or Cys; Xaa(13) represents Gln, Asn,
Glu, or Asp; Xaa(14) represents H is, Phe, Tyr, Thr, Gln, Asn, Glu
or Asp; Xaa(15) represents Gln, Asn, Glu, Asp, Thr, Ser, Met or
Cys; Xaa(16) represents Ala, Gly, Cys, Leu, Val or Met; Xaa(17)
represents Arg, Lys, Met, Ile, Asn, Asp, Glu, Gln, Ser, Thr or Cys;
Xaa(18) represents Arg, Lys, Met or Ile; Xaa(19) represents Ala,
Gly, Cys, Asp, Glu, Gln, Asn, Ser, Tbr or Met; Xaa(20) represents
Ala, Gly, Cys, Asp, Asn, Glu or Gln; Xaa(21) represents Arg, Lys,
Met, Ile, Asn, Asp, Glu or Gln; Xaa(22) represent Leu, Val, Met or
Ile; Xaa(23) represents Phe, Tyr, Thr, H is or Trp; Xaa(24)
represents Ile, Val, Leu or Met; Xaa(25) represents Met, Cys, Ile,
Leu, Val, Thr or Ser; Xaa(26) represents Leu, Val, Met, Thr or Ser.
In an even more expansive library, each X can be selected from any
amino acid.
[0190] In similar fashion, alignment of each of the human, mouse,
chicken and zebrafish hedgehog clones, can provide a degenerate
polypeptide sequence represented by the general formula:
TABLE-US-00003 (SEQ ID No:22)
C-G-P-G-R-G-X(1)-X(2)-X(3)-R-R-X(4)-X(5)-X(6)-P-K-
X(7)-L-X(8)-P-L-X(9)-Y-K-Q-F-X(10)-P-X(11)-X(12)-
X(13)-E-X(14)-T-L-G-A-S-G-X(15)-X(16)-E-G-X(17)-
X(18)-X(19)-R-X(20)-S-E-R-F-X(21)-X(22)-L-T-P-N-Y-
N-P-D-I-I-F-K-D-E-E-N-X(23)-G-A-D-R-L-M-T-X(24)-R-
C-K-X(25)-X(26)-X(27)-N-X(28)-L-A-I-S-V-M-N-X(29)-
W-P-G-V-X(30)-L-R-V-T-E-G-X(31)-D-E-D-G-H-H-X(32)-
X(33)-X(34)-S-L-H-Y-E-G-R-A-X(35)-D-I-T-T-S-D-R-D-
X(36)-X(37)-K-Y-G-X(38)-L-X(39)-R-L-A-V-E-A-G-F-D-
W-V-Y-Y-E-S-X(40)-X(41)-H-X(42)-H-X(43)-S-V-K- X(44)-X(45),
[0191] wherein, as above, each of the degenerate positions "X" can
be an amino acid which occurs in a corresponding position in one of
the wild-type clones, and may also include amino acid residue which
would be conservative substitutions, or each X can be any amino
acid residue. In an exemplary embodiment, Xaa (1) represents Gly,
Ala, Val, Leu, Ile, Pro, Phe or Tyr; Xaa(2) represents Gly, Ala,
Val, Leu or Ile, Xaa(3) represents Gly, Ala, Val, Leu, Ile, Lys, H
is or Arg; Xaa(4) represents Lys, Arg or His; Xaa(5) represents
Phe, Trp, Tyr or an amino acid gap; Xaa(6) represents Gly, Ala,
Val, Leu, Ile or an amino acid gap; Xaa(7) represents Asn, Gln,
His, Arg or Lys; Xaa(8) represents Gly, Ala, Val, Leu, Ile, Ser or
Thr; Xaa(9) represents Gly, Ala, Val, Leu, Ile, Ser or Thr; Xaa(10)
represents Gly, Ala, Val, Leu, Ile, Ser or Thr, Xaa(11) represents
Ser, Thr, Gln or Asn; Xaa(12) represents Met, Cys, Gly, Ala, Val,
Leu, Ile, Ser or Thr, Xaa(13) represents Gly, Ala, Val, Leu, Ile or
Pro; Xaa(14) represents Arg, H is or Lys; Xaa(15) represents Gly,
Ala, Val, Leu, Ile, Pro, Arg, H is or Lys; Xaa(16) represents Gly,
Ala, Val, Leu, Ile, Phe or Tyr; Xaa(17) represents Arg, H is or
Lys; Xaa(18) represents Gly, Ala, Val, Leu, lie, Ser or Thr;
Xaa(19) represents Thr or Ser; Xaa(20) represents Gly, Ala, Val
Leu, Ile, Asn or Gln; Xaa(21) represents Arg, H is or Lys; Xaa(22)
represents Asp or Glu; Xaa(23) represents Ser or Thr; Xaa(24)
represents Glu, Asp, Gln or Asn; Xaa(25) represents Glu or Asp;
Xaa(26) represents Arg, H is or Lys; Xaa(27) represents Gly, Ala,
Val, Leu or Ile; Xaa(28) represents Gly, Ala, Val, Leu, Ile, Thr or
Ser. Xaa(29) represents Met, Cys, Gln, Asn, Arg, Lys or H is;
Xaa(30) represents Arg, H is or Lys; Xaa(31) represents Trp, Phe,
Tyr, Arg, H is or Lys; Xaa(32) represents Gly, Ala, Val, Leu, Ile,
Ser, Thr, Tyr or Phe; Xaa(33) represents Gln, Asn, Asp or Gly;
Xaa(34) represents Asp or Glu; Xaa(35) represents Gly, Ala, Val,
Leu, or Ile; Xaa(36) represents Arg, His or Lys; Xaa(37) represents
Asn, Gln, Thr or Ser. Xaa(38) represents Gly, Ala, Val, Leu, Ile,
Ser, Ile, Met or Cys; Xaa(39) represents Gly, Ala, Val, Leu, Ile,
Thr or Ser; Xaa(40) represents Arg, H is or Lys; Xaa(41) represents
Asn, Gln, Gly, Ala, Val, Leu r Ile; Xaa(42) represents Gly, Ala,
Val, Leu or Ile; Xaa(43) represents Gly, Ala, Val, Leu, Ile, Ser,
Thr or Cys; Xaa(44) represents Gly, Ala, Val, Leu, Ile, Thr or Ser;
and Xaa(45) represents Asp or Glu.
[0192] There are many ways by which the library of potential
hedgehog homologs can be generated from a degenerate
oligonucleotide sequence. Chemical synthesis of a degenerate gene
sequence can be carried out in an automatic DNA synthesizer, and
the synthetic genes then ligated into an appropriate expression
vector. The purpose of a degenerate set of genes is to provide, in
one mixture, all of the sequences encoding the desired set of
potential hedgehog sequences. The synthesis of degenerate
oligonucleotides is well known in the art (see for example, Narang,
S A (1983) Tetrahedron 39:3; Itakura et al. (1981) Recombinant DNA,
Proc 3rd Cleveland Sympos. Macromolecules, ed. AG Walton,
Amsterdam: Elsevier pp 273-289; Itakura et al. (1984) Annu. Rev.
Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al.
(1983) Nucleic Acid Res. 11:477. Such techniques have been employed
in the directed evolution of other proteins (see, for example,
Scott et al. (1990) Science 249:386-390; Roberts et al. (1992) PNAS
89:2429-2433; Devlin et al. (1990) Science 249: 404-406; Cwirla et
al. (1990) PNAS 87: 6378-6382; as well as U.S. Pat. Nos. 5,223,409,
5,198,346, and 5,096,815).
[0193] A wide range of techniques are known in the art for
screening gene products of combinatorial libraries made by point
mutations, and for screening cDNA libraries for gene products
having a certain property. Such techniques will be generally
adaptable for rapid screening of the gene libraries generated by
the combinatorial mutagenesis of hedgehog homologs. The most widely
used techniques for screening large gene libraries typically
comprises cloning the gene library into replicable expression
vectors, transforming appropriate cells with the resulting library
of vectors, and expressing the combinatorial genes under conditions
in which detection of a desired activity facilitates relatively
easy isolation of the vector encoding the gene whose product was
detected. Each of the illustrative assays described below are
amenable to high through-put analysis as necessary to screen large
numbers of degenerate hedgehog sequences created by combinatorial
mutagenesis techniques.
[0194] In one embodiment, the combinatorial library is designed to
be secreted (e.g. the polypeptides of the library all include a
signal sequence but no transmembrane or cytoplasmic domains), and
is used to transfect a eukaryotic cell that can be co-cultured with
neuronal cells. A functional hedgehog polypeptide secreted by the
cells expressing the combinatorial library will diffuse to
neighboring neuronal cells and induce a particular biological
response, such as protection against cell death when treated with
MPTP. The pattern of protection will resemble a gradient function,
and will allow the isolation (generally after several repetitive
rounds of selection) of cells producing hedgehog homologs active as
neuroprotective agents with respect to the target neuronal
cells
[0195] To illustrate, target neuronal cells are cultured in 24-well
microtitre plates. Other eukaryotic cells are transfected with the
combinatorial hedgehog gene library and cultured in cell culture
inserts (e.g. Collaborative Biomedical Products, Catalog #40446)
that are able to fit into the wells of the microtitre plate. The
cell culture inserts are placed in the wells such that recombinant
hedgehog homologs secreted by the cells in the insert can diffuse
through the porous bottom of the insert and contact the target
cells in the microtitre plate wells. After a period of time
sufficient for functional forms of a hedgehog polypeptide to
produce a measurable response in the target cells, such as
neuroprotection, the inserts are removed and the effect of the
variant hedgehog polypeptides on the target cells determined. Cells
from the inserts corresponding to wells which score positive for
activity can be split and re-cultured on several inserts, the
process being repeated until the active clones are identified.
[0196] In yet another screening assay, the candidate hedgehog gene
products are displayed on the surface of a cell or viral particle,
and the ability of particular cells or viral particles to associate
with a hedgehog-binding moiety (such as the patched protein or
other hedgehog receptor) via this gene product is detected in a
"panning assay". Such panning steps can be carried out on cells
cultured from embryos. For instance, the gene library can be cloned
into the gene for a surface membrane protein of a bacterial cell
and the resulting fusion protein detected by panning (Ladner et
al., WO 88/06630; Fuchs et al. (1991) Bio/Technology 9:1370-1371;
and Goward et al. (1992) TIBS 18:136-140). In a similar fashion,
fluorescently labeled molecules which bind hedgehog can be used to
score for potentially functional hedgehog homologs. Cells can be
visually inspected and separated under a fluorescence microscope,
or, where the morphology of the cell permits, separated by a
fluorescence-activated cell sorter.
[0197] In an alternate embodiment, the gene library is expressed as
a fusion protein on the surface of a viral particle. For instance,
in the filamentous phage system, foreign peptide sequences can be
expressed on the surface of infectious phage, thereby conferring
two significant benefits. First, since these phage can be applied
to affinity matrices at very high concentrations, large number of
phage can be screened at one time. Second, since each infectious
phage displays the combinatorial gene product on its surface, if a
particular phage is recovered from an affinity matrix in low yield,
the phage can be amplified by another round of infection. The group
of almost identical E. coli filamentous phages M13, fd, and fl are
most often used in phage display libraries, as either of the phage
gill or gVIII coat proteins can be used to generate fusion proteins
without disrupting the ultimate packaging of the viral particle
(Ladner et al. PCT publication. WO 90/02909; Garrard et al., PCT
publication WO 92/09690; Marks et al. (1992) J. Biol. Chem.
267:16007-16010; Griffths et al. (1993) EGO J 12:725-734; Clackson
et al. (1991) Nature 352:624-628; and Barbas et al. (1992) PNAS
89:4457=44-61).
[0198] In an illustrative embodiment, the recombinant phage
antibody system (RPAS, Pharamacia Catalog number 27-9400-01) can be
easily modified for use in expressing and screening hedgehog
combinatorial libraries. For instance, the pCANTAB 5 phagemid of
the RPAS kit contains the gene which encodes the phage gIII coat
protein. The hedgehog combinatorial gene library can be cloned into
the phagemid adjacent to the gIII signal sequence such that it will
be expressed as a gi fusion protein. After ligation, the phagemid
is used to transform competent E. coli TG1 cells. Transformed cells
are subsequently infected with M13KO7 helper phage to rescue the
phagemid and its candidate hedgehog gene insert. The resulting
recombinant phage contain phagemid DNA encoding a specific
candidate hedgehog, and display one or more copies of the
corresponding fusion coat protein. The phage-displayed candidate
hedgehog polypeptides. Which are capable of binding an hedgehog
receptor are selected or enriched by panning. For instance, the
phage library can be applied to cells which express the patched
protein and unbound phage washed away from the cells. The bound
phage is then isolated, and if the recombinant phage express at
least one copy of the wild type gIII coat protein, they will retain
their ability to infect E. coli. Thus, successive rounds of
reinfection of E. coli, and panning will greatly enrich for
hedgehog homologs, which can then be screened for further
biological activities in order to differentiate agonists and
antagonists.
[0199] Combinatorial mutagenesis has a potential to generate very
large libraries of mutant proteins, e.g., in the order of 10.sup.26
molecules. Combinatorial libraries of this size may be technically
challenging to screen even with high throughput screening assays
such as phage display. To overcome this problem, a new technique
has been developed recently, recrusive ensemble mutagenesis (REM),
which allows one to avoid the very high proportion of
non-functional proteins in a random library and simply enhances the
frequency of functional proteins, thus decreasing the complexity
required to achieve a useful sampling of sequence space. REM is an
algorithm which enhances the frequency of functional mutants in a
library when an appropriate selection or screening method is
employed (Arkin and Yourvan, 1992, PNAS USA 89:7811-7815; Yourvan
et al., 1992, Parallel Problem Solving from Nature, 2, In Maenmer
and Manderick, eds., Elsevir Publishing Co., Amsterdam, pp.
401-410; Delgrave et al., 1993, Protein Engineering
6(3):327-331).
[0200] The invention also provides for reduction of the hedgehog
polypeptide to generate mimetics, e.g. peptide or non-peptide
agents, which are able to mimic the neuroprotective activity of a
naturally-occurring hedgehog polypeptide. Thus, such mutagenic
techniques as described above are also useful to map the
determinants of the hedgehog polypeptides which participate in
protein-protein interactions involved in, for example, binding of
the subject hedgehog polypeptide to other extracellular matrix
components such as its receptor(s). To illustrate, the critical
residues of a subject hedgehog polypeptide which are involved in
molecular recognition of an hedgehog receptor such as patched can
be determined and used to generate hedgehog-derived peptidomimetics
which competitively bind with that moiety. By employing, for
example, scanning mutagenesis to map the amino acid residues of
each of the subject hedgehog polypeptides which are involved in
binding other extracellular proteins, peptidomimetic compounds can
be generated which mimic those residues of the hedgehog polypeptide
which facilitate the interaction. After distinguishing between
agonist and antagonists, such agonistic mimetics may be used to
mimic the normal function of a hedgehog polypeptide as trophic for
dopaminergic and GABAergic neurons. For instance, non-hydrolyzable
peptide analogs of such residues can be generated using
benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry
and Biology, G. R. Marshall ed., ESCOM Publisher: Leiden,
Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides:
Chemistry and Biology, G. R. Marshall ed, ESCOM Publisher: Leiden,
Netherlands, 1988), substituted gama lactam rings (Garvey et al. in
Peptides: Chemistry and Biology, G. R. Marshall ed., ESCOM
Publisher: Leiden, Netherlands, 1988), keto-methylene
pseudopeptides (Ewenson et al. (1986) J Med Chem 29:295; and
Ewenson et al. in Peptides: Structure and Function (Proceedings of
the 9th American Peptide Symposium) Pierce Chemical Co. Rockland,
Ill., 1985), .beta.-turn dipeptide cores (Nagai et al. (1985)
Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin
Trans 1:1231), and .beta.-aminoalcohols (Gordon et al. (1985)
Biochem Biophys Res Commun 126:419; and Dann et al. (1986) Biochem
Biophys Res Commun 134:71).
[0201] Recombinantly produced forms of the hedgehog polypeptides
can be produced using, e.g, expression vectors containing a nucleic
acid encoding a hedgehog polypeptide, operably linked to at least
one transcriptional regulatory sequence. Operably linked is
intended to mean that the nucleotide sequence is linked to a
regulatory sequence in a manner which allows expression of the
nucleotide sequence. Regulatory sequences are art-recognized and
are selected to direct expression of a hedgehog polypeptide.
Accordingly, the term transcriptional regulatory sequence includes
promoters, enhancers and other expression control elements. Such
regulatory sequences are described in Goeddel; Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego,
Calif. (1990). For instance, any of a wide variety of expression
control sequences, sequences that control the expression of a DNA
sequence when operatively linked to it, may be used in these
vectors to express DNA sequences encoding hedgehog polypeptide.
Such useful expression control sequences, include, for example, a
vital LTR, such as the LTR of the Moloney murine leukemia virus,
the early and late promoters of SV40, adenovirus or cytomegalovirus
immediate early promoter, the lac system, the trp system, the TAC
or TRC system, T7 promoter whose expression is directed by 17 RNA
polymerase, the major operator and promoter regions of phage
.lamda., the control regions for fd coat protein, the promoter for
3-phosphoglycerate kinase or other glycolytic enzymes, the
promoters of acid phosphatase, e.g., PhoS, the promoters of the
yeast .alpha.-mating factors, the polyhedron promoter of the
baculoviis system and other sequences known to control the
expression of genes of prokaryotic or eukaryotic cells or their
viruses, and various combinations thereof. It should be understood
that the design of the expression vector may depend on such factors
as the choice of the host cell to be transformed and/or the type of
protein desired to be expressed. Moreover, the vector's copy
number, the ability to control that copy number and the expression
of any other proteins encoded by the vector, such as antibiotic
markers, should also be considered.
[0202] In addition to providing a ready source of hedgehog
polypeptides for purification, the gene constructs of the present
invention can also be used as, a part of a gene therapy protocol to
deliver nucleic acids encoding a neuroprotective form of a hedgehog
polypeptide. Thus, another aspect of the invention features
expression vectors for in vivo transfection of a hedgehog
polypeptide in particular cell types so as cause ectopic expression
of a hedgehog polypeptide in neuronal tissue.
[0203] Formulations of such expression constructs may be
administered in any biologically effective carrier, e.g. any
formulation or composition capable of effectively delivering the
recombinant gene to cells in vivo. Approaches include insertion of
the hedgehog coding sequence in viral vectors including recombinant
retroviruses, adenovirus, adeno-associated virus, and herpes
simplex virus-1, or recombinant bacterial or eukaryotic plasmids.
Viral vectors transfect cells directly; plasmid DNA can be
delivered with the help of, for example, cationic liposomes
(lipofectin) or derivatized (e.g. antibody conjugated), polylysine
conjugates, gramacidin S, artificial viral envelopes or other such
intracellular carriers, as well as direct injection of the gene
construct or CaPO.sub.4 precipitation carried out in vivo. It will
be appreciated that because transduction of appropriate target
cells represents the critical first step in gene therapy, choice of
the particular gene delivery system will depend on such factors as
the phenotype of the intended target and the route of
administration, e.g. locally or systemically. Furthermore, it will
be recognized that the particular gene construct provided for in
vivo transduction of hedgehog expression are also useful for in
vitro transduction of cells, such as for use in the ex vivo tissue
culture systems described below.
[0204] A preferred approach for in vivo introduction of nucleic
acid into a cell is by use of a viral vector containing nucleic
acid, e.g. a cDNA, encoding the particular form of the hedgehog
polypeptide desired Infection of cells with a viral vector has the
advantage that a large proportion of the targeted cells can receive
the nucleic acid. Additionally, molecules encoded within the viral
vector, e.g., by a cDNA contained in the viral vector, are
expressed efficiently in cells which have taken up viral vector
nucleic acid.
[0205] Retrovirus vectors and adeno-associated virus vectors are
generally understood to be the recombinant gene delivery system of
choice for the transfer of exogenous genes in vivo, particularly
into humans. These vectors provide efficient delivery of genes into
cells, and the transferred nucleic acids are stably integrated into
the chromosomal DNA of the host. A major prerequisite for the use
of retroviruses is to ensure the safety of their use, particularly
with regard to the possibility of the spread of wild-type virus in
the cell population. The development of specialized cell lines
(termed "packaging cells") which produce only replication-defective
retroviuses has increased the utility of retroviruses for gene
therapy, and defective retroviruses are well characterized for use
in gene transfer for gene therapy purposes (for a review see
Miller, A. D. (1990) Blood 76:271). Thus, recombinant retrovirus
can be constructed in which part of the retroviral coding sequence
(gag, pol, env) has been replaced by nucleic acid encoding a
hedgehog polypeptide and renders the retrovirus replication
defective. The replication defective retrovirus is then packaged
into virions which can be used to infect a target cell through the
use of a helper virus by standard techniques. Protocols for
producing recombinant retroviruses and for infecting cells in vitro
or in vivo with such viruses can be found in Current Protocols in
Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing
Associates, (1989), Sections 9.10-9.14 and other standard
laboratory manuals. Examples of suitable retroviruses include pLJ,
pZIP, pWE and pEM which are well known to those skilled in the art.
Examples of suitable packaging virus lines for preparing both
ecotropic and amphotropic retroviral systems include Crip, Cre, 2
and Am. Retroviruses have been used to introduce a variety of genes
into many different cell types, including neuronal cells, in vitro
and/or in vivo (see for example Eglitis, et al. (1985) Science
230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA
85:6460-6464; Wilson et al. (1988) Proc. Natl Acad. Sci. USA
85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA
87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA
88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA
88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van
Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644;
Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992)
Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J.
Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No.
4,980,286, PCT Application WO 89/07136; PCT Application WO
89/02468; PCT Application WO 89/05345; and PCT Application WO
92/07573).
[0206] Furthermore, it has been shown that it is possible to limit
the infection spectrum of retroviruses and consequently of
retroviral-based vectors, by modifying the viral packaging proteins
on the surface of the viral particle (see, for example PCT
publications WO93/25234 and WO94/06920). For instance, strategies
for the modification of the infection spectrum of retroviral
vectors include: coupling antibodies specific for cell surface
antigens to the viral env protein (Roux et al. (1989) PNAS
86:9079-9083; Julan et al (1992) J. Gen Virol 73:3251-3255; and
Goud et al. (1983) Virology 163:251-254); or coupling cell surface
receptor ligands to the viral env proteins (Neda et al. (1991) J
Biol Chem 266:14143-14146). Coupling can be in the form of the
chemical cross-linking with a protein or other variety (e.g.
lactose to convert the env protein to an asialoglycoprotein), as
well as by generating fusion proteins (e.g. single-chain
antibody/env fusion proteins). This technique, while useful to
limit or otherwise direct the infection to certain tissue types,
can also be used to convert an ecotropic vector in to an
amphotropic vector.
[0207] Moreover, use of retroviral gene delivery can be further
enhanced by the use of tissue- or cell-specific transcriptional
regulatory sequences which control expression of the hedgehog gene
of the retroviral vector.
[0208] Another viral gene delivery system useful in the present
method utilities adenovirus-derived vectors. The genome of an
adenovirus can be manipulated such that it encodes and expresses a
gene product of interest but is inactivated in terms of its ability
to replicate in a normal lytic viral life cycle. See for example
Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991)
Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155.
Suitable adenoviral vectors derived from the adenovirus strain Ad
type 5 d1324 or other strains of adenovinis (e.g., Ad2, Ad3, Ad7
etc.) are well known to those skilled in the art. Recombinant
adenoviruses can be advantageous in certain circumstances in that
they can be used to infect a wide variety of cell types, including
neuronal cells (Rosenfeld et al. (1992) cited supra).
[0209] Furthermore, the virus particle is relatively stable and
amenable to purification and concentration, and as above, can be
modified so as to affect the spectrum of infectivity. Additionally,
introduced adenoviral DNA (and foreign DNA contained therein) is
not integrated into the genome of a host cell but remains episomal,
thereby avoiding potential problems that can occur as a result of
insertional mutagenesis in situations where introduced DNA becomes
integrated into the host genome (e.g., retroviral DNA). Moreover,
the carrying capacity of the adenoviral genome for foreign DNA is
large (up to 8 kilobases) relative to other gene delivery vectors
(Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol.
57:267). Most replication-defective adenoviral vectors currently in
use and therefore favored by the present invention are deleted for
all or parts of the viral E1 and E3 genes but retain as much as 80%
of the adenoviral genetic material (see, e.g., Jones et al. (1979)
Cell 16:683; Berkner et al., supra; and Graham et al. in: Methods
in Molecular Biology, E. J. Murray, Ed. (Humana, Clifton, N. J.,
1991) vol. 7. pp. 109-127). Expression of the inserted hedgehog
gene can be under control of, for example, the E1A promoter, the
major late promoter (MLP) and associated leader sequences, the E3
promoter, or exogenously added promoter sequences.
[0210] In addition to viral transfer methods, such as those
illustrated above, non-viral methods can also be employed to cause
expression of a hedgehog polypeptide in the tissue of an animal.
Most nonviral methods of gene transfer rely on normal mechanisms
used by mammalian cells for the uptake and intracellular transport
of macromolecules. In preferred embodiments, non-viral gene
delivery systems of the present invention rely on endocytic
pathways for the uptake of the hedgehog polypeptide gene by the
targeted cell. Exemplary gene delivery systems of this type include
liposomal derived systems, poly-lysine conjugates, and artificial
viral envelopes.
[0211] In clinical settings, the gene delivery systems for the
therapeutic hedgehog gene can be introduced into a patient by any
of a number of methods, each of which is familiar in the art. For
instance, a pharmaceutical preparation of the gene delivery system
can be introduced systemically, e.g. by intravenous injection, and
specific transduction of the protein in the target cells occurs
predominantly from specificity of transfection provided by the gene
delivery vehicle, cell-type or tissue-type expression due to the
transcriptional regulatory sequences controlling expression of the
receptor gene, or a combination thereof. In other embodiments,
initial delivery of the recombinant gene is more limited with
introduction into the animal being quite localized. For example,
the gene delivery vehicle can be introduced y catheter (see U.S.
Pat. No. 5,328,470) or by stereotactic injection (e.g. Chen et al.
(1994) PNAS 91: 3054-4057). A hedgehog expression construct can be
delivered in a gene therapy construct to dermal cells by, e.g.,
electroporation using techniques described, for example, by Dev et
al. ((1994) Cancer Treat Rev 20:105-115).
[0212] The pharmaceutical preparation of the gene therapy construct
can consist essentially of the gene delivery system in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery system can be produced intact from
recombinant cells, e.g. retroviral vectors, the pharmaceutical
preparation can comprise one or more cells which produce the gene
delivery system.
[0213] In yet another embodiment, the hedgehog or ptc therapeutic
can be a "gene activation" construct which, by homologous
recombination with a genomic DNA, alters the transcriptional
regulatory sequences of an endogenous gene. For instance, the gene
activation construct can replace the endogenous promoter of a
hedgehog gene with a heterologous promoter, e.g., one which causes
constitutive expression of the hedgehog gene or which causes
inducible expression of the gene under conditions different from
the normal expression pattern of the gene. Other genes in the
patched signaling pathway can be similarly targeted. A variety of
different formats for the gene activation constructs are available.
See, for example, the Transkaryotic Therapies, Inc PCT publications
WO93/09222, WO95/31560, WO96/29411, WO95/31560 and WO94/12650.
[0214] In preferred embodiments, the nucleotide sequence used as
the gene activation construct can be comprised of (1) DNA from some
portion of the endogenous hedgehog gene (exon sequence, intron
sequence, promoter sequences, etc.) which direct recombination and
(2) heterologous transcriptional regulatory sequence(s) which is to
be operably linked to the coding sequence for the genomic hedgehog
gene upon recombination of the gene activation construct. For use
in generating cultures of hedgehog producing cells, the construct
may further include a reporter gene to detect the presence of the
knockout construct in the cell.
[0215] The gene activation construct is inserted into a cell, and
integrates with the genomic DNA of the cell in such a position so
as to provide the heterologous regulatory sequences in operative
association with the native hedgehog gene. Such insertion occurs by
homologous recombination, i.e., recombination regions of the
activation construct that are homologous to the endogenous hedgehog
gene sequence hybridize to the genomic DNA and recombine with the
genomic sequences so that the construct is incorporated into the
corresponding position of the genomic DNA.
[0216] The terms "recombination region" or "targeting sequence"
refer to a segment (i.e., a portion) of a gene activation construct
having a sequence that is substantially identical to or
substantially complementary to a genomic gene sequence, e.g.,
including 5' flanking sequences of the genomic gene, and can
facilitate homologous recombination between the genomic sequence
and the targeting transgene construct.
[0217] As used herein, the term "replacement region" refers to a
portion of a activation construct which becomes integrated into an
endogenous chromosomal location following homologous recombination
between a recombination region and a genomic sequence.
[0218] The heterologous regulatory sequences, e.g., which are
provided in the replacement region, can include one or more of a
variety elements, including: promoters (such as constitutive or
inducible promoters), enhancers, negative regulatory elements,
locus control regions, transcription factor binding sites, or
combinations thereof. Promoters/enhancers which may be used to
control the expression of the targeted gene in vivo include, but
are not limited to, the cytomegalovirus (CMV) promoter/enhancer
(Karasuyama et al., 1989, J. Exp. Med., 169:13), the human
.beta.-actin promoter (Gunning et al. (1987) PNAS 84:4831-4835),
the glucocorticoid-inducible promoter present in the mouse mammary
tumor virus long terminal repeat (MMTV LTR) (Klessig et al. (1984)
Mol. Cell. Biol. 4:1354-1362), the long terminal repeat sequences
of Moloney murine leukemia virus (MuLV LTR) (Weiss et al. (1985)
RNA Tumor Viruses, Cold Spring Harbor Laboratory, Cold Spring
Harbor, N.Y.), the SV40 early or late region promoter (Bemoist et
al. (1981) Nature 290:304-310; Templeton et al. (1984) Mol. Cell.
Biol., 4:817; and Sprague et al. (1983) J. Virol., 45:773), the
promoter contained in the 3' long terminal repeat of Rous sarcoma
virus (RSV) (Yamamoto et al., 1980, Cell, 22:787-797), the herpes
simplex virus (HSV) thymidine kinase promoter/enhancer (Wagner et
al. (1981) PNAS 82:3567-71), and the herpes simplex virus LAT
promoter (Wolfe et al. (1992) Nature Genetics, 1:379-384).
[0219] In an exemplary embodiment, portions of the 5' flaking
region of the human Shh gene are amplified using primers which add
restriction sites, to generate the following fragments
TABLE-US-00004 (primer 1)
5'-gcgcgcttcgaaGCGAGGCAGCCAGCGAGGGAGAGAGCGAGCGGGCG
AGCCGGAGC-GAGGAAatcgatgcgcgc (primer 2)
5'-gcgcgcagatctGGGAAAGCGCAAGAGAGAGCGCACACGCACACACC
CGCCGCGCG-CACTCGggatccgcgcgc
[0220] As illustrated, primer 1 includes a 5' non-coding region of
the human Shh gene and is flanked by an AsuII and ClaI restriction
sites. Primer 2 includes a portion of the 5' non-coding region
immediately 3' to that present in primer 1. The hedgehog gene
sequence is flanked by XhoII BaHII restriction sites. The purified
amplimers are cut with each of the enzymes as appropriate.
[0221] The vector pcDNA1.1 (Invitrogen) includes a CMV promoter.
The plasmid is cut with AsuII, which cleaves just 3' to the CMV
promoter sequence. The AsuII/ClaI fragment of primer 1 is ligated
to the AsuII cleavage site of the pcDNA vector. The ClaI/AsuII
ligation destroys the AsuII site at the 3' end of a properly
inserted primer 1.
[0222] The vector is then cut with BamHI, and an XhoII/BamHI
fragment of primer 2 is ligated to the BamHI cleavage site. As
above, the BamHI XhoII ligation destroys the BamHI site at the 5'
end of a properly inserted primer 2.
[0223] Individual colonies are selected, cut with AsuII and BamHI,
and the size of the AsuII/BamHI fragment determined. Colonies in
which both the primer 1 and primer 2 sequences are correctly
inserted are further amplified, an cut with AsuII and BamHI to
produce the gene activation construct
TABLE-US-00005 cgaagcgaggcagccagcgagggagagagcgagcgggcgagccggagcga
ggaaATCGAAGGTTCGAATCCTTCCCCCACCACCATCACTTTCAAAAGTC
CGAAAGAATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGC
GAGTAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGA
AGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCC
AGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAAT
TACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC
TTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG
ACGTCAATAATGACGTATGTTCCCATACTAACGCCAATAGGGACTTTCCA
TTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTAC
ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGT
AAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCC
TACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGC
GGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGA
TTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCA
AAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGC
AAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTC
TGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGAC
TCACTATAGGGAGACCCAAGCTTGGTACCGAGCTCGGATCgatctgggaa
agcgcaagagagagcgcacacgcacacacccgccgcgcgcactcgg
In this construct, the flanking primer 1 and primer 2 sequences
provide the recombination region which permits the insertion of the
CMV promoter in front of the coding sequence for the human Shh
gene. Other heterologous promoters (or other transcriptional
regulatory sequences) can be inserted in a genomic hedgehog gene by
a similar method.
[0224] In still other embodiments, the replacement region merely
deletes a negative transcriptional control element of the native
gene, e.g., to activate expression, or ablates a positive control
element, e.g., to inhibit expression of the targeted gene.
V. Exemplary ptc Therapeutic Compounds
[0225] In another embodiment, the subject method is carried out
using a ptc therapeutic composition. Such compositions can be
generated with, for example, compounds which bind to patched and
alter its signal transduction activity, compounds which alter the
binding and/or enzymatic activity of a protein (e.g.,
intracellular) involved in patched signal pathway, and compounds
which alter the level of expression of a hedgehog polypeptide, a
patched protein or a protein involved in the intracellular signal
transduction pathway of patched.
[0226] The availability of purified and recombinant hedgehog
polypeptides facilitates the generation of assay systems which can
be used to screen for drugs, such as small organic molecules, which
are either agonists or antagonists of the normal cellular function
of a hedgehog and/or patched protein, particularly in their role in
the pathogenesis of neuronal cell death. In one embodiment, the
assay evaluates the ability of a compound to modulate binding
between a hedgehog polypeptide and a hedgehog receptor such as
patched. In other embodiments, the assay merely scores for the
ability of a test compound to alter the signal transduction
activity of the patched protein. In this manner, a variety of
hedgehog and/or ptc therapeutics, which will include ones with
neuroprotective activity, can be identified. A variety of assay
formats will suffice and, in light of the present disclosure, will
be comprehended by skilled artisan.
[0227] In many drug screening programs which test libraries of
compounds and natural extracts, high throughput assays are
desirable in order to maximize the number of compounds surveyed in
a given period of time. Assays which are performed in cell-free
systems, such as may be derived with purified or semi-purified
proteins, are often preferred as "primary" screens in that they can
be generated to permit rapid development and relatively easy
detection of an alteration in a molecular target which is mediated
by a test compound. Moreover, the effects of cellular toxicity
and/or bioavailability of the test compound can be generally
ignored in the in vitro system, the assay instead being focused
primarily on the effect of the drug on the molecular target as may
be manifest in an alteration of binding affinity with receptor
proteins.
[0228] Accordingly, in an exemplary screening assay for ptc
therapeutics, the compound of interest is contacted with a mixture
including a hedgehog receptor protein (e.g., a cell expressing the
patched receptor) and a hedgehog polypeptide under conditions in
which it is ordinarily capable of binding the hedgehog polypeptide.
To the mixture is then added a composition containing a test
compound. Detection and quantification of receptor/hedgehog
complexes provides a means for determining the test compound's
efficacy at inhibiting (or potentiating) complex formation between
the receptor protein and the hedgehog polypeptide. Moreover, a
control assay can also be performed to provide a baseline for
comparison. In the control assay, isolated and purified hedgehog
polypeptide is added to the receptor protein, and the formation of
receptor/hedgehog complex is quantitated in the absence of the
test, compound.
[0229] In other embodiments, a ptc therapeutic of the present
invention is one which disrupts the association of patched with
smoothened.
[0230] Agonist and antagonists of neuroprotection can be
distinguished, and the efficacy of the compound can be assessed, by
subsequent testing with neuronal cells.
[0231] In an illustrative embodiment, the polypeptide utilized as a
hedgehog receptor can be generated from the patched protein.
Accordingly, an exemplary screening assay includes all or a
suitable portion of the patched protein which can be obtained from,
for example, the human patched gene (GenBank U43148) or other
vertebrate sources (see GenBank Accession numbers U40074 for
chick-en patched and U46155 for mouse patched), as well as from
drosophila (GenBank Accession number M28999) or other invertebrate
sources. The patched protein can be provided inthe screening assay
as a whole protein (preferably expressed on the surface of a cell),
or alternatively as a fragment of the full length protein which
binds to hedgehog polypeptides, e.g., as one or both of the
substantial extracellular domains (e.g. corresponding to residues
Asn120-Ser438 and/or Arg770-Trp1027 of the human patched protein).
For instance, the patched protein can be provided in soluble form,
as for example a preparation of one of the extracellular domains,
or a preparation of both of the extracellular domains which are
covalently connected by an unstructured linker (see, for example,
Huston et al. (1988) PNAS 85:4879; and U.S. Pat. No. 5,091,513). In
other embodiments, the protein can be provided as part of a
liposomal preparation or expressed on the surface of a cell. The
patched protein can derived from a recombinant gene, e.g., being
ectopically expressed in a heterologous cell. For instance, the
protein can be expressed on oocytes, mammalian cells (e.g., COS,
CHO, 3T3 or the like), or yeast cell by standard recombinant DNA
techniques. These recombinant cells can be used for receptor
binding, signal transduction or gene expression assays. Marigo et
al. (1996) Development 122:1225-1233 illustrates a binding assay of
human hedgehog to chick patched protein ectopically expressed in
Xenopus laevis oocytes. The assay system of Marigo et al. can be
adapted to the present drug screening assays. As illustrated in
that reference, Shh binds to the patched protein in a selective,
saturable, dose-dependent manner, thus demonstrating that patched
is a receptor for Shh.
[0232] Complex formation between the hedgehog polypeptide and a
hedgehog receptor may be detected by a variety of techniques. For
instance, modulation of the formation of complexes can be
quantitated using, for example, detectably labelled proteins such
as radiolabelled, fluorescently labelled, or enzymatically labelled
hedgehog polypeptides, by immunoassay, or by chromatographic
detection.
[0233] Typically, for cell-free assays, it will be desirable to
immobilize either the hedgehog receptor or the hedgehog-polypeptide
to facilitate separation of receptor/hedgehog complexes from
uncomplexed forms of one of the proteins, as well as to accommodate
automation of the assay. In one embodiment, a fusion protein can be
provided which adds a domain that allows the protein to be bound to
a matrix. For example, glutathione-S-transferase/receptor
(GST/receptor) fusion proteins can be adsorbed onto glutathione
sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione
derivatized microtitre plates, which are then combined with the
hedgehog polypeptide, e.g. an .sup.35S-labeled hedgehog
polypeptide, and the test compound and incubated under conditions
conducive to complex formation, e.g. at physiological conditions
for salt and pH, though slightly more stringent conditions may be
desired. Following incubation, the beads are washed to remove any
unbound hedgehog polypeptide, and the matrix bead-bound radiolabel
determined directly (e.g. beads placed in scintillant), or in the
supernatant after the receptor/hedgehog complexes are
dissociated.
[0234] Alternatively, the complexes can be dissociated from the
bead, separated by SDS-PAGE gel, and the level of hedgehog
polypeptide found in the bead fraction quantitated from the gel
using standard electrophoretic techniques.
[0235] Other techniques for immobilizing proteins on matrices are
also available for use in the subject assay. For instance, soluble
portions of the hedgehog receptor protein can be immobilized
utilizing conjugation of biotin and streptavidin. For instance,
biotinylated receptor molecules can be prepared from biotin-NHS
(N-hydroxy-succinimide) using techniques well known in the art
(e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and
immobilized in the wells of streptavidin-coated 96 well plates
(Pierce Chemical). Alternatively, antibodies reactive with the
hedgehog receptor but which do not interfere with hedgehog binding
can be derivatized to the wells of the plate, and the receptor
trapped in the wells by antibody conjugation. As above,
preparations of a hedgehog polypeptide and a test compound are
incubated in the receptor-presenting wells of the plate, and the
amount of receptor/hedgehog complex trapped in the well can be
quantitated. Exemplary methods for detecting such complexes, in
addition to those described above for the GST-immobilized
complexes, include immunodetection of complexes using antibodies
reactive with the hedgehog polypeptide, or which are reactive with
the receptor protein and compete for binding with the hedgehog
polypeptide; as well as enzyme-linked assays which rely on
detecting an enzymatic activity associated with the hedgehog
polypeptide. In the instance of the latter, the enzyme can be
chemically conjugated or provided as a fusion protein with the
hedgehog polypeptide. To illustrate, the hedgehog polypeptide can
be chemically cross-linked or genetically fused with alkaline
phosphatase, and the amount of hedgehog polypeptide trapped in the
complex can be assessed with a chromogenic substrate of the enzyme,
e.g. paranitrophenylphosphate. Likewise, a fusion protein
comprising the hedgehog polypeptide and glutathione-S-transferase
can be provided, and complex formation quantitated by detecting the
GST activity using 1-chloro-2,4-dinitrobenzene (Habig et al (1974)
J Biol Chem 249:7130).
[0236] For processes which rely on immunodetection for quantitating
one of the proteins trapped in the complex, antibodies against the
protein, such as the anti-hedgehog antibodies described herein, can
beused. Alternatively, the protein to be detected in the complex
can be "epitope tagged" in the form of a fusion protein which
includes, in addition to the hedgehog polypeptide or hedgehog
receptor sequence, a second polypeptide for which antibodies are
readily available (e.g. from commercial sources). For instance, the
GST fusion proteins described above can also be used for
quantification of binding using antibodies against the GST moiety.
Other useful epitope tags include myc-epitopes (e.g., see Ellison
et al. (1991) J Biol Chem 266:21150-21157), which includes a
10-residue sequence from c-myc, as well as the pFLAG system
(International Biotechnologies, Inc.) or the pEZZ-protein A system
(Pharamacia, N.J.).
[0237] Where the desired portion of the hedgehog receptor (or other
hedgehog binding molecule) cannot be provided in soluble form,
liposomal vesicles can be used to provide manipulatable and
isolatable sources of the receptor. For example, both authentic and
recombinant forms of the patched protein can be reconstituted in
artificial lipid vesicles (e.g. phosphatidylcholine liposomes) or
in cell membrane-derived vesicles (see, for example, Bear et al.
(1992) Cell 68:809-818; Newton et al. (1983) Biochemistry
22:6110-6117; and Reber et al. (1987) J Biol Chem
262:11369-11374).
[0238] In addition to cell-free assays, such as described above,
the readily available source of hedgehog polypeptides provided by
the art also facilitates the generation of cell-based assays for
identifying small molecule agonists of the neuroprotective activity
of wild-type hedgehog polypeptides. Analogous to the cell-based
assays described above for screening combinatorial libraries,
neuronal cells which are sensitive to hedgehog-dependent
protection, such as dopaminergic and GABAergic neurons, can be
contacted with a hedgehog polypeptide and a test agent of interest,
with the assay scoring for anything from simple binding to the cell
to trophic responses by the target cell in the presence and absence
of the test agent. As with the cell-free assays, agents which
produce a statistically significant change in hedgehog activities
(either inhibition or potentiation) can be identified.
[0239] In other embodiments, the cell-based assay scores for agents
which disrupt association of patched and smoothened proteins, e.g.,
in the cell surface membrane or liposomal preparation.
[0240] In addition to characterizing cells that naturally express
the patched protein, cells which have been genetically engineered
to ectopically express patched can be utilized for drug screening
assays. As an example, cells which either express low levels or
lack expression of the patched protein, e.g. Xenopus laevis
oocytes, COS cells or yeast cells, can be genetically modified
using standard techniques to ectopically express the patched
protein. (see Marigo et al., supra).
[0241] The resulting recombinant cells, e.g., which express a
functional patched receptor, can be utilized in receptor binding
assays to identify agonist or antagonists of hedgehog binding.
Binding assays can be performed using whole cells. Furthermore, the
recombinant cells of the present invention can be engineered to
include other heterologous genes encoding proteins involved in
hedgehog-dependent signal pathways. For example, the gene products
of one or more of smoothened, costal-2 and/or fused can be
co-expressed with patched in the reagent cell, with assays being
sensitive to the functional reconstitution of the hedgehog signal
transduction cascade.
[0242] Alternatively, liposomal preparations using reconstituted
patched protein can be utilized. Patched protein purified from
detergent extracts from both authentic and recombinant origins can
be reconstituted in artificial lipid vesicles (e.g.
phosphatidylcholine liposomes) or in cell membrane-derived vesicles
(see, for example, Bear et al. (1992) Cell 68:809-818; Newton et
al. (1983) Biochemistry 22:6110-6117; and Reber et al. (1987) J
Biol Chem 262:11369-11374). The lamellar structure and size of the
resulting liposomes can be characterized using electron microscopy.
External orientation of the patched protein in the reconstituted
membranes can be demonstrated, for example, by immunoelectron
microscopy. The hedgehog polypeptide binding activity of liposomes
containing patched and liposomes without the protein in the
presence of candidate agents can be compared in order to identify
potential modulators of the hedgehog-patched interaction.
[0243] The hedgehog polypeptide used in these cell-based assays can
be provided as a purified source (natural or recombinant in
origin), or in the form of cells/tissue which express the protein
and which are co-cultured with the target cells. As in the
cell-free assays, where simple binding (rather than induction) is
the hedgehog activity scored for in the assay, the protein can be
labelled by any of the above-mentioned techniques, e.g.,
fluorescently, enzymatically or radioactively, or detected by
immunoassay.
[0244] In addition to binding studies, functional assays can be
used to identified modulators, i.e., agonists of hedgehog or
patched activities. By detecting changes in intracellular signals,
such as alterations in second messengers or gene expression in
patched-expressing cells contacted with a test agent, candidate
antagonists to patched signaling can be identified (e.g., having a
hedgehog-like activity).
[0245] A number of gene products have been implicated in
patched-mediated signal transduction, including patched, the
transcription factor cubitusi interruptus (ci), the
serine/threonine kinase fused (fu) and the gene products of
costat-2, smoothened and suppressor of fused.
[0246] The interaction of a hedgehog polypeptide with patched sets
in motion a cascade involving the activation and inhibition of
downstream effectors, the ultimate consequence of which is, in some
instances, a detectable change in the transcription or translation
of a gene. Potential transcriptional targets' of patched signaling
are the patched gene itself (Hidalgo and Ingham, 1990 Development
110, 291-301; Marigo et al., 1996) and the vertebrate homologs of
the drosophila cubitus interruptus gene, the GLI genes (Hui et al.
(1994) Dev Biol 162:402-413). Patched gene expression has been
shown to be induced in cells of the limb bud and the neural plate
that are responsive to Shh. (Marigo et al. (1996) PNAS, in press;
Marigo et al. (1996) Development 122:1225-1233). The GLI genes
encode putative transcription factors having zinc finger DNA
binding domains (Orenic et al. (1990) Genes & Dev 4:1053-1067;
Kinzler et al. (1990) Mol Cell Biol 10:634-642). Transcription of
the GLI gene has been reported to be upregulated in response to
hedgehog in limb buds, while transcription of the GLI3 gene is,
downregulated in response to hedgehog induction (Marigo et al.
(1996) Development 122.1225-1233). By selecting transcriptional
regulatory sequences from such target genes, e.g. from patched or
GLI genes, that are responsible for the up- or down regulation of
these genes in response to patched signalling, and operatively
linking such promoters to a reporter gene, one can derive a
transcription based assay which is sensitive to the ability of a
specific test compound to modify patched signalling pathways.
Expression of the reporter gene, thus, provides a valuable
screening tool for the development of compounds that act as
antagonists of ptc, e.g., which may be useful as neuroprotective
agents.
[0247] Reporter gene based assays of this invention measure the end
stage of the above described cascade of events, e.g.,
transcriptional modulation. Accordingly, in practicing one
embodiment of the assay, a reporter gene construct is inserted into
the reagent cell in order to generate a detection signal dependent
on ptc signaling. To identify potential regulatory elements
responsive to ptc signaling present in the transcriptional
regulatory sequence of a target gene, nested deletions of genomic
clones of the target gene can be constructed using standard
techniques. See, for example, Current Protocols in Molecular
Biology Ausubel, F. M. et al. (eds.) Greene Publishing Associates,
(1989); U.S. Pat. No. 5,266,488; Sato et al. (1995) J Biol Chem
270:10314-10322; and Kube et al. (1995) Cytokine 7:1-7. A nested
set of DNA fragments from the gene's 5'-flanking region are placed
upstream of a reporter gene, such as the luciferase gene, and
assayed for their ability to direct reporter gene expression in
patched expressing cells. Host cells transiently transfected with
reporter gene constructs can be scored for the induction of
expression of the reporter gene in the presence and absence of
hedgehog to determine regulatory sequences which are responsive to
patched-dependent signalling.
[0248] In practicing one embodiment of the assay, a reporter gene
construct is inserted into the reagent cell in order to generate a
detection signal dependent on second messengers generated by
induction with hedgehog polypeptide. Typically, the reporter gene
construct will include a reporter gene in operative linkage with
one or more transcriptional regulatory elements responsive to the
hedgehog activity, with the level of expression of the reporter
gene providing the hedgehog-dependent detection signal. The amount
of transcription from the reporter gene may be measured using any
method known to those of skill in the art to be suitable. For
example, mRNA expression from the reporter gene may be detected
using RNAse protection or RNA-based PCR, or the protein product of
the reporter gene may be identified by a characteristic stain or an
intrinsic activity. The amount of expression from the reporter gene
is then compared to the amount of expression in either the same
cell in the absence of the test compound (or hedgehog) or it may be
compared with the amount of transcription in a substantially
identical cell that lacks the target receptor protein. Any
statistically or otherwise significant difference in the amount of
transcription indicates that the test compound has in some manner
altered the signal transduction of the patched protein, e.g., the
test compound is a potential ptc therapeutic.
[0249] As described in further detail below, in preferred
embodiments the gene product of the reporter is detected by an
intrinsic activity associated with that product. For instance, the
reporter gene may encode a gene product that, by enzymatic
activity, gives rise to a detection signal based on color,
fluorescence, or luminescence. In other preferred embodiments, the
reporter or marker gene provides a selective growth advantage,
e.g., the reporter gene may enhance cell viability, relieve a cell
nutritional requirement, and/or provide resistance to a drug.
[0250] Preferred reporter genes are those that are readily
detectable. The reporter gene may also be included in the construct
in the form of a fusion gene with a gene that includes desired
transcriptional regulatory sequences or exhibits other desirable
properties. Examples of reporter genes include, but are not limited
to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek
(1979), Nature 282: 864-869) luciferase, and other enzyme detection
systems, such as beta-galactosidase; firefly luciferase (deWet et
al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase
(Engebrecht and Silverman (1984), PNAS 1: 4154-4158; Baldwin et al.
(1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et
al. (1989) Eur. J. Biochem. 182: 231-238, Hall et al. (1983) J.
Mol. Appl. Gen. 2: 101), human placental secreted alkaline
phosphatase (Cullen and Malim (1992) Methods in Enzymol.
216:362-368).
[0251] Transcriptional control elements which may be included in a
reporter gene construct include, but are not limited to, promoters,
enhancers, and repressor and activator binding sites. Suitable
transcriptional regulatory elements may be derived from the
transcriptional regulatory regions of genes whose expression is
induced after modulation of a patched signal transduction pathway.
The characteristics of preferred genes from which the
transcriptional control elements are derived include, but are not
limited to, low or undetectable expression in quiescent cells,
rapid induction at the transcriptional level within minutes of
extracellular simulation, induction that is transient and
independent of new protein synthesis, subsequent shut-off of
transcription requires new protein synthesis, and mRNAs transcribed
from these genes have a short half-life. It is not necessary for
all of these properties to be present.
[0252] In yet other embodiments, second messenger generation can be
measured directly in the detection step, such as mobilization of
intracellular calcium, phospholipid metabolism or adenylate cyclase
activity are quantitated, for instance, the products of
phospholipid hydrolysis IP.sub.3, DAG or cAMP could be measured For
example, recent studies have implicated protein kinase A (PKA) as a
possible component of hedgehog/patched signaling (Hammerschmidt et
al. (1996) Genes & Dev 10:647). High PKA activity has been
shown to antagonize hedgehog signaling in these systems.
Conversely, inhibitors of PKA will mimic and/or potentiate the
action of hedgehog. Although it is unclear whether PKA acts
directly downstream or in parallel with hedgehog signaling, it is
possible that hedgehog signalling occurs via inhibition of PKA
activity. Thus, detection of PKA activity provides a potential
readout for the instant assays.
[0253] In a preferred embodiment, the ptc therapeutic is a PKA
inhibitor. A variety of PKA inhibitors are known in the art,
including both peptidyl and organic compounds. For instance, the
ptc therapeutic can be a 5-isoquinolinesulfonamide, such as
represented in the general formula:
##STR00001##
wherein,
[0254] R.sub.1 and R.sub.2 each can independently represent
hydrogen, and as valence and stability permit a lower allyl, a
lower alkenyl, a lower alkynyl, a carbonyl (such as a carboxyl, an
ester, a formate, or a ketone), a thiocarbonyl (such as a
thioester, a thioacetate, or a thioformate), an amino, an
acylamino, an amido, a cyano, a nitro, an azido, a sulfate, a
sulfonate, a sulfonamido, --(CH.sub.2).sub.m--R.sub.8,
--(CH.sub.2).sub.mOH, --(CH.sub.2).sub.m--O-lower alkyl,
--(CH.sub.2).sub.m--O--lower alkenyl,
--(CH.sub.2).sub.n--O--(CH.sub.2).sub.m--R.sub.8,
--(CH.sub.2).sub.m--SH, --(CH.sub.2).sub.m--S-lower alkyl,
--(CH.sub.2).sub.m--S lower alkenyl,
--(CH.sub.2).sub.n--S--(CH.sub.2).sub.m--R.sub.8, or
[0255] R.sub.1 and R.sub.2 taken together with N form a heterocycle
(substituted or unsubstituted);
[0256] R.sub.3 is absent or represents one or more substitutions to
the isoquinoline ring such as a lower alkyl, a lower alkenyl, a
lower alkynyl, a carbonyl (such as a carboxyl, an ester, a formate,
or a ketone), a thiocarbonyl (such as a thioester, a thioacetate,
or a thioformate), an amino, an acylamino, an amido, a cyano, a
nitro, an azido, a sulfate, a sulfonate, a sulfonamido,
--(CH.sub.2).sub.m--R.sub.8, --(CH.sub.2).sub.m--OH,
--(CH.sub.2).sub.m--O-lower alkyl, --(CH.sub.2), --O-lower alkenyl,
--(CH.sub.2).sub.n--O--(CH.sub.2).sub.m--R.sub.8,
--(CH.sub.2).sub.m--SH, --(CH.sub.2).sub.m--S-lower alkyl,
--(CH.sub.2).sub.m--S-lower alkenyl,
--(CH.sub.2).sub.n--S--(CH.sub.2).sub.m--R.sub.8;
[0257] R.sub.8 represents a substituted or unsubstituted aryl,
aralkyl, cycloalkyl, cycloalkenyl, or heterocycle; and
[0258] n and m are independently for each occurrence zero or an
integer in the range of 1 to 6.
[0259] In a preferred embodiment, the PKA inhibitor is
N-[2-((p-bromocinnamyl)amino)ethyl]-5-isoquinolinesulfonamide
(H-89; Calbiochem Cat. No. 371963), e.g., having the formula:
##STR00002##
[0260] In another embodiment, the PKA inhibitor is
1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H-7; Calbiochem Cat.
No. 371955), e.g., having the formula:
##STR00003##
[0261] In still other embodiments, the PKA inhibitor is KT5720
(Calbiochem Cat. No; 420315), having the structure
##STR00004##
[0262] A variety of nucleoside analogs are also useful as PKA
inhibitors. For example, the subject method can be carried out
cyclic AMP analogs which inhibit the kinase activity of PKA, as for
example, 8-bromo-cAMP or dibutyryl-cAMP
##STR00005##
[0263] Exemplary peptidyl inhibitors of PKA activity include the
PKA Heat Stable Inhibitor (isoform a; see, for example, Calbiochem
Cat. No. 539488, and Wen et al. (1995) J Biol Chem 270:2041).
[0264] Certain hedgehog receptors may stimulate the activity of
phospholipases. Inositol lipids can be extracted and analyzed using
standard lipid extraction techniques. Water soluble derivatives of
all three inositol lipids (IP.sub.1, IP.sub.2, IP.sub.3) can also
be quantitated using radiolabelling techniques or HPLC.
[0265] The mobilization of intracellular calcium or the influx of
calcium from outside the cell may be a response to hedgehog
stimulation or lack there of. Calcium flux in the reagent cell can
be measured using standard techniques. The choice of the
appropriate calcium indicator, fluorescent, bioluminescent,
metallochromic, or Ca.sup.++-sensitive microelectrodes depends on
the cell type and the magnitude and time constat of the event under
study (Borle (1990) Environ Health Perspect 84:45-56). As an
exemplary method of Ca.sup.+ detection, cells could be loaded with
the Ca.sup.++ sensitive fluorescent dye fura-2 or indo-1, using
standard methods, and any change in Ca.sup.++ measured using a
fluorometer.
[0266] In certain embodiments of the assay, it may be desirable to
screen for changes in cellular phosphorylation. As an example, the
drosophila gene fused (fu) which encodes a serine/threonine kinase
has been identified as a potential downstream target in hedgehog
signaling. (Preat et al., 1990 Nature 347, 87-89; Therond et al.
1993, Mech. Dev. 44, 65-80). The ability of compounds to modulate
serine/threonine kinase activation could be screened using colony
immunoblotting (Lyons and Nelson (1984) Proc. Natl. Acad. Sci. USA
81:7426-7430) using antibodies against phosphorylated serine or
threonine residues. Reagents for performing such assays are
commercially available, for example, phosphoserine and
phosphothreonine specific antibodies which measure increases in
phosphorylation of those residues can be purchased from commercial
sources.
[0267] In yet another embodiment, the ptc therapeutic is an
antisense molecule which inhibits expression of a protein involved
in a patched-mediated signal transduction pathway. To illustrate,
by inhibiting the expression of a protein involved in patched
signals, such as fused, costal-2, smoothened and/or Gli genes, or
patched itself the ability of the patched signal pathway(s) to
alter the ability of, e.g., a dopaminergic or GABAergic cell to
maintain its differentiated state can be altered, e.g., potentiated
or repressed.
[0268] As used herein, "antisense" therapy refers to administration
or in situ generation of oligonucleotide probes or their
derivatives which specifically hybridize (e.g. bind) under cellular
conditions with cellular mRNA and/or genomic DNA encoding a
hedgehog polypeptide, patched, or a protein involved in
patched-mediated signal transduction. The hybridization should
inhibit expression of that protein, e.g. by inhibiting
transcription and/or translation. The binding may be by
conventional base pair complementarity, or, for example, in the
case of binding to DNA duplexes, through specific interactions in
the major groove of the double helix. In general, "antisense"
therapy refers to the range of techniques generally employed in the
art, and includes any therapy which relies on specific binding to
oligonucleotide sequences.
[0269] An antisense construct of the present invention can be
delivered, for example, as an expression plasmid which, when
transcribed in the cell, produces RNA which is complementary to at
least a unique portion of the target cellular mRNA. Alternatively,
the antisense construct is an oligonucleotide probe which is
generated ex vivo and which, when introduced into the cell causes
inhibition of expression by hybridizing with the mRNA and/or
genomic sequences of a target gene. Such oligonucleotide probes are
preferably modified oligonucleotide which are resistant to
endogenous nucleases, e.g. exonucleases and/or endonucleases, and
is therefore stable in vivo. Exemplary nucleic acid molecules for
use as antisense oligonucleotides are phosphoramidate,
phosphothioate and methylphosphonate analogs of DNA (see also U.S.
Pat. Nos. 5,176,996; 5,264,564; and 5,256,775). Additionally,
general approaches to constructing oligomers useful in antisense
therapy have been reviewed, for example, by Van der Krol et al.
(1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res
48:2659-2668.
[0270] Several considerations should be taken into account when
constructing antisense oligonucleotides for the use in the methods
of the invention: (1) oligos should have a GC content of 50% or
more; (2) avoid sequences with stretches of 3 or more Gas; and (3)
oligonucleotides should not be longer than 25-26 mers. When testing
an antisense oligonucleotide, a mismatched control can be
constructed. The controls can be generated by reversing the
sequence order of the corresponding antisense oligonucleotide in
order to conserve the same ratio of bases.
[0271] In an illustrative embodiment, the ptc therapeutic can be an
antisense construct for inhibiting the expression of patched, e.g.,
to mimic the inhibition of patched by hedgehog. Exemplary antisense
constructs include:
TABLE-US-00006 5'-GTCCTGGCGCCGCCGCCGCCGTCGCC
5'-TTCCGATGACCGGCCTTTCGCGGTGA 5'-GTGCACGGAAAGGTGCAGGCCACACT
VI. Exemplary Pharmaceutical Preparations of Hedgehog and ptc
Therapeutics
[0272] The source of the hedgehog and ptc therapeutics to be
formulated will depend on the particular form of the agent. Small
organic molecules and peptidyl fragments can be chemically
synthesized and provided in a pure form suitable for
pharmaceutical/cosmetic usage. Products of natural extracts can be
purified according to techniques known in the art. For example, the
Cox et al. U.S. Pat. No. 5,286,654 describes a method for purifying
naturally occurring forms of a secreted protein and can be adapted
for purification of hedgehog polypeptides. Recombinant sources of
hedgehog polypeptides are also available. For example, the gene
encoding hedgehog polypeptides, are known, inter alia, from PCT
publications WO 95/18856 and WO 96/17924.
[0273] Those of skill in treating neural tissues can determine the
effective amount of an hedgehog or ptc therapeutic to be formulated
in a pharmaceutical or cosmetic preparation.
[0274] The hedgehog or ptc therapeutic formulations used in the
method of the invention are most preferably applied in the form of
appropriate compositions. As appropriate compositions there may be
cited all compositions usually employed for systemically or locally
(such as intrathecal) administering drugs. The pharmaceutically
acceptable carrier should be substantially inert, so as not to act
with the active component. Suitable inert carriers include water,
alcohol polyethylene glycol, mineral oil or petroleum gel,
propylene glycol and the like.
[0275] To prepare the pharmaceutical compositions of this
invention, an effective amount of the particular hedgehog or ptc
therapeutic as the active ingredient is combined in intimate
admixture with a pharmaceutically acceptable carrier, which carrier
may take a wide variety of forms depending on the form of
preparation desired for administration. These pharmaceutical
compositions are desirable in unitary dosage form suitable,
particularly, for administration orally, rectally, percutaneously,
or by parenteral injection. For example, in preparing the
compositions in oral dosage form, any of the usual pharmaceutical
media may be employed such as, for example, water, glycols, oils,
alcohols and the like in the case of oral liquid preparations such
as suspensions, syrups, elixirs and solutions; or solid carriers
such as starches, sugars, kaolin, lubricants, binders,
disintegrating agents and the like in the case of powders, pills,
capsules, and tablets. Because of their ease in administration,
tablets and capsules represents the most advantageous oral dosage
unit form, in which case solid pharmaceutical carriers are
obviously employed. For parenteral compositions, the carrier will
usually comprise sterile water, at least in large part, though
other ingredients, for example, to aid solubility, may be included.
Injectable solutions, for example, may be prepared in which the
carrier comprises saline solution, glucose solution or a mixture of
saline and glucose solution. Injectable suspensions may also be
prepared in which case appropriate liquid carriers, suspending
agents and the like may be employed. Also included are solid form
preparations which are intended to be converted, shortly before
use, to liquid form preparations. In the compositions suitable for
percutaneous administration, the carrier optionally comprises a
penetration enhancing agent and or a suitable wetting agent,
optionally combined with suitable additives of any nature in minor
proportions, which additives do not introduce a significant
deleterious effect on the skin.
[0276] It is especially advantageous to formulate the subject
compositions in dosage unit form for ease of administration and
uniformity of dosage. Dosage unit form as used in the specification
and claims herein refers to physically discrete units suitable as
unitary dosages, each unit containing a predetermined quantity of
active ingredient calculated to produce the desired therapeutic
effect in association with the required pharmaceutical carrier.
Examples of such dosage unit forms are tablets (including scored or
coated tablets), capsules, pills, powders packets, wafers,
injectable solutions or suspensions, teaspoonfuls, tablespoonfuls
and the like, and segregated multiples thereof.
[0277] The pharmaceutical preparations of the present invention can
be used, as stated above, for the many applications which can be
considered cosmetic uses. Cosmetic compositions known in the art,
preferably hypoallergic and pH controlled are especially preferred,
and include toilet waters, packs, lotions, skin milks or milky
lotions. The preparations contain, besides the hedgehog or ptc
therapeutic, components usually employed in such preparations.
Examples of such components are oils, fats, waxes, surfactants,
humectants, thickening agents, antioxidants, viscosity stabilizers,
chelating agents, buffers, preservatives, perfumes, dyestuffs,
lower alkanols, and the like. If desired, further ingredients may
be incorporated in the compositions, e.g. antiinflammatory agents,
antibacterials, antifungals, disinfectants, vitamins, sunscreens,
antibiotics, or other anti-acne agents.
[0278] Examples of oils comprise fats and oils such as olive oil
and hydrogenated oils; waxes such as beeswax and lanolin;
hydrocarbons such as liquid paraffin, ceresin, and squalane; fatty
acids such as stearic acid and oleic acid; alcohols such as cetyl
alcohol, stearyl alcohol, lanolin alcohol, and hexadecanol; and
esters such as isopropyl myristate, isopropyl palmitate and butyl
stearate. As examples of surfactants there may be cited anionic
surfactants such as sodium stearate, sodium cetylsulfate,
polyoxyethylene laurylether phosphate, sodium N-acyl glutamate;
cationic surfactants such as stearyldimethylbenzylammonium chloride
and stearyltrimethylammonium chloride; ampholytic surfactants such
as alkylaminoethylglycine hydrocloride solutions and lecithin; and
nonionic surfactants such as glycerin monostearate, sorbitan
monostearate, sucrose fatty acid esters, propylene glycol
monostearate, polyoxyethylene oleylether, polyethylene glycol
monostearate, polyoxyethylene sorbitan monopahmitate,
polyoxyethylene coconut fatty acid monoethanolamide,
polyoxypropylene glycol (e.g. the materials sold under the
trademark "Pluronic"), polyoxyethylene castor oil, and
polyoxyethylene lanolin. Examples of humectants include glycerin,
1,3-butylene glycol, and propylene glycol; examples of lower
alcohols include ethanol and isopropanol; examples of thickening
agents include xanthan gum, hydroxypropyl cellulose, hydroxypropyl
methyl cellulose, polyethylene glycol and sodium carboxymethyl
cellulose; examples of antioxidants, comprise butylated
hydroxytoluene, butylated hydroxyanisole, propyl gallate, citric
acid and ethoxyquin; examples of chelating agents include disodium
edetate and ethanehydroxy diphosphate; examples of buffers comprise
citric acid, sodium citrate, boric acid, borax, and disodium
hydrogen phosphate; and examples of preservatives are methyl
parahydroxybenzoate, ethyl parahydroxybenzoate, dehydroacetic acid,
salicylic acid and benzoic acid.
[0279] For preparing ointments, creams, toilet waters, skin milks,
and the like, typically from 0.01 to 10% in particular from 0.1 to
5% and more in particular from 0.2 to 2.5% of the active
ingredient, e.g., of the hedgehog or ptc therapeutic, will be
incorporated in the compositions. In ointments or creams, the
carrier for example consists of 1 to 20%, in particular 5 to 15% of
a humectant, 0.1 to 10% in particular from 0.5 to 5% of a thickener
and water, or said carrier may consist of 70 to 99%, in particular
20 to 95% of a surfactant, and 0 to 20%, in particular 2.5 to 15%
of a fat; or 80 to 99.9% in particular 90 to 99% of a thickener; or
5 to 15% of a surfactant, 2-15% of a humectant, 0 to 80% of an oil,
very small (<2%) amounts of preservative, coloring agent and/or
perfume, and water. In a toilet water, the carrier for example
consists of 2 to 10% of a lower alcohol, 0.1 to 10% or in
particular 0.5 to 1% of a surfactant, 1 to 20%, in particular 3 to
7% of a humectant, 0 to 5% of a buffer, water and small amounts
(<2%) of preservative, dyestuff and/or perfume. In a skin milk,
the carrier typically consists of 10-50% of oil, 1 to 10% of
surfactant, 50-80% of water and 0 to 3% of preservative and/or
perfume. In the aforementioned preparations, all % symbols refer to
weight by weight percentage.
[0280] Particular compositions for use in the method of the present
invention are those wherein the hedgehog or ptc therapeutic is
formulated in liposome-containing compositions. Liposomes are
artificial vesicles formed by amphiphatic molecules such as polar
lipids, for example, phosphatidyl cholines, ethanolamines and
serines, sphingomyelins, cardiolipins, plasmalogens, phosphatidic
acids and cerebiosides. Liposomes are formed when suitable
amphiphathic molecules are allowed to swell in water or aqueous
solutions to form liquid crystals usually of multilayer structure
comprised of many bilayers separated from each other by aqueous
material (also referred to as coarse liposomes). Another type of
liposome known to be consisting of a single bilayer encapsulating
aqueous material is referred to as a unilamellar vesicle. If
water-soluble materials are included in the aqueous phase during
the swelling of the lipids they become entrapped in the aqueous
layer between the lipid bilayers.
[0281] Water-soluble active ingredients such as, for example,
various salt forms of a hedgehog polypeptide, are encapsulated in
the aqueous spaces between the molecular layers. The lipid soluble
active ingredient of hedgehog or ptc therapeutic, such as an
organic mimetic, is predominantly incorporated into the lipid
layers, although polar head groups may protude from the layer into
the aqueous space. The encapsulation of these compounds can be
achieved by a number of methods. The method most commonly used
involves casting a thin film of phospholipid onto the walls of a
flask by evaporation from an organic solvent. When this film is
dispersed in a suitable aqueous medium, multilamellar liposomes are
formed. Upon suitable sonication, the coarse liposomes form smaller
similarly closed vesicles.
[0282] Water-soluble active ingredients are usually incorporated by
dispersing the cast film with an aqueous solution of the compound.
The unencapsulated compound is then removed by centrifugation,
chromatography, dialysis or other art-known suitable procedures.
The lipid-soluble active ingredient is usually incorporated by
dissolving it in the organic solvent with the phospholipid prior to
casting the film. If the solubility of the material in the lipid
phase is not exceeded or the amount present is not in excess of
that which can be bound to the lipid, liposomes prepared by the
above method usually contain most of the material bound in the
lipid bilayers; separation of the liposomes from unencapsulated
material is not required.
[0283] A particularly convenient method for preparing liposome
formulated forms of hedgehog and ptc therapeutics is the method
described in EP-A-253,619, incorporated herein by reference. In
this method, single bilayered liposomes containing encapsulated
active ingredients are prepared by dissolving the lipid component
in an organic medium, injecting the organic solution of the lipid
component under pressure into an aqueous component while
simultaneously mixing the organic and aqueous components with a
high speed homogenizer or mixing means, whereupon the liposomes are
formed spontaneously.
[0284] The single bilayered liposomes containing the encapsulated
hedgehog or ptc therapeutic can be employed directly or they can be
employed in a suitable pharmaceutically acceptable carrier for
localized administration. The viscosity of the liposomes can be
increased by the addition of one or more suitable thickening agents
such as, for example xanthan gum, hydroxypropyl cellulose,
hydroxypropyl methylcellulose and mixtures thereof. The aqueous
component may consist of water alone or it may contain
electrolytes, buffered systems and other ingredients, such as, for
example, preservatives. Suitable electrolytes which can be employed
include metal salts such as alkali metal and alkaline earth metal
salts.
[0285] The preferred metal salts are calcium chloride, sodium
chloride and potassium chloride. The concentration of the
electrolyte may vary from zero to 260 mM, preferably from 5 mM to
160 mM. The aqueous component is placed in a suitable vessel which
can be adapted to effect homogenization by effecting great
turbulence during the injection of the organic component.
Homogenization of the two components can be accomplished within the
vessel, or, alternatively, the aqueous and organic components may
be injected separately into a mixing means which is located outside
the vessel. In the latter case, the liposomes are formed in the
mixing means and then transferred to another vessel for collection
purpose.
[0286] The organic component consists of a suitable non-toxic,
pharmaceutically acceptable solvent such as, for example ethanol,
glycerol, propylene glycol andpolyethylene glycol, and a suitable
phospholipid which is soluble in the solvent. Suitable
phospholipids which can be employed include lecithin,
phosphatidylcholine, phosphatydylserine, phosphatidylethanol-amine,
phosphatidylinositol, lysophosphatidylcholine and phosphatidyl
glycerol, for example. Other lipophilic additives may be employed
in order to selectively modify the characteristics of the
liposomes. Examples of such other additives include stearylamine,
phosphatidic acid, tocopherol, cholesterol and lanolin
extracts.
[0287] In addition, other ingredients which can prevent oxidation
of the phospholipids may be added to the organic component.
Examples of such other ingredients include tocopherol, butylated
hydroxyanisole, butylated hydroxytoluene, ascorbyl palmitate and
ascorbyl oleate. Preservatives such a benzoic acid, methyl paraben
and propyl paraben may also be added.
[0288] Methods of introduction may also be provided by rechargeable
or biodegradable devices. Various slow release polymeric devices
have been developed and tested in vivo in recent years for the
controlled delivery of drugs, including proteinacious
biopharmaceuticals. A variety of biocompatible polymers (including
hydrogels), including both biodegradable and non-degradable
polymers, can be used to form an implant for the sustained release
of an hh at a particular target site. Such embodiments of the
present invention can be used for the delivery of an exogenously
purified hedgehog polypeptide, which has been incorporated in the
polymeric device, or for the delivery of hedgehog produced by a
cell encapsulated in the polymeric device.
[0289] An essential feature of certain embodiments of the implant
can be the linear release of the therapeutic, which can be achieved
through the manipulation of the polymer composition and form. By
choice of monomer composition or polymerization technique, the
amount of water, porosity and consequent permeability
characteristics can be controlled. The selection of the shape,
size, polymer, and method for implantation can be determined on an
individual basis according to the disorder to be treated and the
individual patient response. The generation of: such implants is
generally known in the art. See, for example, Concise Encyclopedia
of Medical & Dental Materials, ed. by David Williams (MIT
Press: Cambridge, Mass., 1990); and the Sabel et al. U.S. Pat. No.
4,883,666.
[0290] In another embodiment of an implant, a source of cells
producing the therapeutic, e.g., secreting a soluble form of a
hedgehog polypeptide, is encapsulated in implantable hollow fibers
or the like. Such fibers can be pre-spun and subsequently loaded
with the cell source (Aebiseher et al. U.S. Pat. No. 4,892,538;
Aebischer et al. U.S. Pat. No. 5,106,627; Hoffman et al. (1990)
Expt. Neurobiol. 110:39-44; Jaeger et al. (1990) Prog. Brain Res.
82:41-46; and Aebischer et al. (1991) J. Biomech. Eng.
113:178-183), or can be co-extruded with a polymer which acts to
form a polymeric coat about the cells (Lim U.S. Pat. No. 4,391,909;
Sefton U.S. Pat. No. 4,353,888; Sugamori et al. (1989) Trans. Am.
Artif. Intern. Organs 35:791-799; Sefton et al. (1987) Biotehnol.
Bioeng. 29:1135-1143; and Aebischer et al. (1991) Biomaterials
12:50-55).
EXEMPLIFICATION
[0291] The invention now being generally described, it will be more
readily understood by reference to the following examples which are
included merely for purposes of illustration of certain aspects and
embodiments of the present invention, and are not intended to limit
the invention.
Example I
Hedgehog Polypeptides Promote Survival of Specific CNS Neuron
Populations and Protect These Cells From Toxic Insult in Vitro
[0292] In Drosophila, the hedgehog gene was first discovered for
the role it plays in early embryo patterning (Nusslein-Vollard and
Wieschaus, 1980). Further study showed that the product of this
gene is secreted, and as an intercellular signaling protein, plays
a critical role in body segmentation and patterning of imaginal
disc derivatives such as eyes and wings (Lee et al., 1992; Mohler
and Vanie, 1992; Tabata et al., 1992). There re, at present, three
mammalian homologues of Drosophila hedgehog, and Indian hedgehog
(Fietz et al., 1994). During the course of vertebrate development,
these secreted peptide molecules are involved in axial patterning,
and consequently regulate the phenotypic specification of precursor
cells into functional differentiated cells.
[0293] The embryonic expression pattern of Shh has been shown to be
closely linked to the development and differentiation of the entire
ventral neuraxis (Marti et al., 1995). Using naive neural tube
explants derived from the appropriate levels of the rostrocaudal
axis, it has been demonstrated that the induction of spinal motor
neurons (Roelink et al., 1994; Tanabe et al., 1995), midbrain
dopaminergic neurons (Hynes et al., 1995; Wang et al., 1995), and
basal forebrain cholinergic neurons (Ericson et al., 1995) are
dependent upon exposure to Shh. This molecule appears to be crucial
for such patterning and phenotype specification in vivo since mouse
embryos deficient in the expression of functional Shh gene product
manifest a lack of normal ventral patterning in the central nervous
system as well as gross atrophy of the entire cranium (Chiang et
al., 1996).
[0294] In this study we have explored the issue of whether Shh may
have activities at stages in neural development later than those
previously studied. Namely, new have asked whether Shh is trophic
for particular neural populations, and under toxic conditions,
whether Shh is neuroprotective. Using cultures derived from the
embryonic day 14-16 (E14-16) rat, we find that Shh is trophic for
midbrain, striatial, and spinal neurons. In the first case the
factor is trophic for both dopaminergic and GABA-immunoreactive
(GABA-ir) neurons. From the striatum, the surviving neurons are
exclusively GABA-ir, while in the spinal cultures Shh promotes
survival of a heterogeneous population of putative interneurons.
Shh does not support survival of any peripheral nervous system
neurons tested. Finally, we show that Shh protects cultures of
midbrain dopaminergic neurons from the toxic effects of MPP+, a
specific neurotoxin that induces Parkinsonism in vivo. Together,
these observations indicate a novel role for Shh in nervous system
development and its potential role as a therapeutic.
Materials and Methods
[0295] Whole-mount, in situ Hybridization
[0296] Whole-mount in situ hybridization on bisected E14.5
Sprague-Dawley rat embryos was performed with digoxigenin-labeled
(Boehringer-Mannheim) mouse RNA probes as previously described
(Wilkinson, 1992). Bound probe was detected with alkaline
phosphatase-conjugated anti-digoxigenin Fab fragments
(BoehringerMannheiin). The 0.7 kb Shh probes were transcribed using
T3 (antisense) or T7 (sense) RNA polymerase from Hind III
(antisense) or Bam HI (sense) linearized templates as described by
Echelard, et al. (1993). The 0.9 kb Ptc probes were transcribed
using T3 (antisense) or T7 (sense) RNA polymerase from Bam HI
(antisense) or Hind III (sense) linearized templates as described
by Goodrich, et al. (1996).
Shh Protein and anti-Shh Antibody
[0297] Rat sonic hedgehog amino terminal signaling domain (amino
acids 2-198) Porter et al., 1995) was cloned into a baculovirus
expression vector (Invitrogen; San Diego, Calif.) (virus encoding
Shh insert was a gift of Dr. Henk Roelink, University of
Washington, Seattle, Wash.). High Five insect cells (Invitrogen)
were infected with the baculovirus per manufacturer's instructions.
The culture supernatant was batch adsorbed to heparin agarose type
I (Sigma; St. Louis, Mo.) and Shh eluted with PBS containing a
total of 0.75 M NaCl and 0.1-mM--mercaptoethanol. Shh concentration
was determined by the method of Ericson, et al. (1996). E.
coli-derived Shh was obtained as previously described (Wang et al.,
1996) and purified as described above. All samples were sterile
filtered and aliquots frozen in liquid nitrogen. Anti-Shh
polyclonal antibody was a gift from Dr. Andy McMahon (Harvard
University). Preparation of this Reagent, Directed; Against the
Amino Peptide of Shh, is Described by Bumcrot et al. (1995).
Anti-Shh monoclonal antibody (511) was a gift of Dr. Thomas Jessell
(Columbia University), and preparation of this reagent is described
by Ericson et al. (1996).
Dissociation and Culture of Neural Tissue
[0298] E14.5 rat ventral mesencephalon was dissected as described
by Shimoda, et al. (Shimoda et al., 1992). Striatal cultures were
established from E15-16 embryos from the regions identified by
Altman and Bayer (1995) as the striatum and palladium. Spinal
cultures utilized the ventral one-third of the E15-16 spinal cord
(Camu and Henderson, 1992). Tissues were dissociated for
approximately 40 minutes in 0.10-0.25% trypsin-EDTA (Gibco/BRL;
Gaithersburg, Md.), and the digestion stopped using an equal volume
of Ca++/Mg++-free Hanks' buffered saline (Gibco/BRL) containing 3.5
mg/ml soybean trypsin inhibitor (Sigma) and 0.04% DNase (Grade II,
Boehringer Mannheim; Indianapolis, Ind.). Cells were than plated at
2.times.20.sup.5-3.times.20.sup.5 cells/well in the medium of
Krieglstein, et al. (1995) (a modified N2 medium) in 34-well tissue
culture plates (Falcon) coated with poly-L-lysine or
poly-L-ornithine (Sigma) after 2 wash in the same medium. Note that
this procedure results in cultures in which the cells have never
been exposed to serum and stands in contrast to cultures in which
serum has been used to neutralize dissociation proteases, and/or to
initially "prime" the cells prior to serum withdrawal. The
following peptide growth factors were added as indicated in the
results: basic fibroblast growth factor (FGFb), transforming growth
factor 1 (TGF 1), TGF 2, glia derived neurotrophic factor (GDNF),
and brain derived neurotrophic factor (BDNF) (all from PeproTech;
Rocky Hill, N.J.; additional lots of BDNF and GDNF were purchased
from Promega; Madison Wis.). Anti-TGF antibodies were purchased
from R & D Systems. Antibody was added at the time of Shh
addition to the cultures. Cultures were maintained for up to 3
weeks and the medium changed every 4 days.
Immunoctyochemistry and Cell Scoring
[0299] For all cell staining, cultures were fixed with 5%
paraformaldehyde in PBS (plus 0.1% glutaraldehyde if staining for
GABA), and blocked using 3% goat serum, (Sigma), 0.1% Triton X-100,
in PBS. Antibody incubations were performed in the blocking
solutions. Antibodies used in this study were anti-tubulin III
(Sigma), anti-tyrosine hydroxylase (TH) (Boehringer-Mannheim),
anti-GABA (Sigma), and anti-glial fibrillary acidic protein (GFAP)
(Sigma). Primary antibodies were detected using horseradish
peroxidase-, alkaline phosphatase, or fluorochrome-conjugated
secondary antibodies (Vector; Burlingame, Calif.).
Peroxidase-linked secondaries were visualized using a NI/DAB kit
(Zymed; South San Francisco, Calif.) and phosphatase-linked
secondaries using Vector Blue (Vector).
[0300] Cell counting was performed using an Olympus inverted
microscope at a total magnification of 300.times.. Data presented
are representative, and have been confirmed by repeating the
cultures at least 4-10 independent times for each neural population
discussed. Cell numbers are reported as cells/field (the average of
30-40 fields from a total of 5 wells/condition; 4-10 independent
experiments were assessed for each culture condition examined).
Consistency of counting was verified by at least 3 observers.
Errors are reported as standard error of the mean (s.e.m.), and
significance calculated by student's t-test.
Measurement of Dopamine Transport
[0301] To detect the presence of the dopamine transporter (Cerruti
et al., 1993; Ciliax et al., 1995) cultures were incubated with a
mixture consisting of: 5.times.10.sup.-8 M .sup.3H-dopamine
(Amersham; Arlington Heights, Ill.; 48 Cilmmol), 100 .mu.M ascorbic
acid (Sigma), 1 .mu.M fluoxetine (Eli Lilly; Indianapolis, Ind.), 1
.mu.M desmethylimipramine (Sigma), and 10 .mu.M pargyline (Sigma)
in DME-F12. Nonspecific labeling was measured by the addition of
5.times.10.sup.-5M unlabeled dopamine. Cells were incubated for 30
minutes at 37 C., rinsed three times with PBS and processed for
either scintillation counting or autoradiography. For scintillation
counting cells were first lysed with 150 .mu.l of 0.1% SDS and then
added to 500 .mu.l of Microscint 20 Packard; Meriden, Conn.) and
counted in a Packard Instruent Topcount scintillation machine. For
autoradiography, sister plates were coated with NTB-2
autoradiographic emulsion (Kodak; Rochester, N.Y.) that had been
diluted 1:3 with 10% glycerol. The plates were then air dried,
exposed for 1-2 weeks, and developed.
Quantitative-competitive Polymerase Chain Reaction (QC-PCR)
[0302] RNA was isolated from cells and tissue using Trizol
(Gibco/BRL) as prescribed by the manufacturer. Genomic DNA was
removed from the RNA by incubation with 0.5 units of Dnase
(Gibco/BRL, Cat # 28068-015) at room temperature for 25 minutes.
The solution was heated to 75 C. for 20 minutes to inactivate the
DNase. Reverse transcription was carried out using random hexamer
and MULV reverse transcriptase (Gibco/BRL) as suggested by the
manufacturer. All the quantitative RT-PCR internal controls, or
mimics, were synthetic single stranded DNA oligonucleotides
corresponding to the target sequence with an internal deletion from
the central region (Oligos, Etc.; Wilsonville, Oreg.). For actin,
target=28.0 bp, mimic=230 bp; for ptc, target=354 bp, mimic=200 bp.
PCR was performed using the Clontech PCR kit. For actin: annealing
temperature 64 C., oligos GGCTCCGGTATGTGC, GGGGTACTTCAGGGT. For
ptc: annealing temperature 72 C., oligos CATTGGCAGGAGGAGTTGATTGTGG,
AGCACCTTTGAGTGGAGTTTGGGG. In each QC-PCR reaction, four reactions
were set up with equal amounts of sample cDNA in each tube and
5-fold serial dilution of mimic. Also, for each sample an aliquot
of cDNA was saved and amplified along with quantitative PCR as
control for contamination. PCR reactions were carried out in an MJ
Research PTC-200 thermal cycler and the following cycling profile
used: 95 C. for 45 seconds, 64 or 72 C. for 35 seconds, 82 C. for
30 seconds; for 40 cycles. The reaction mixtures were then
fractionated by agarose electrophoresis, negative films obtained,
and the films digitally scanned and quantified by area integration
according to established procedures (Wang et al., 1995, and
references therein). The quantity of target molecules was
normalized to the competing mimic and expressed as a function of
cDNA synthesized and used in each reaction.
N-methyl-4-phenylpyrridinium (MPP+) Administration
[0303] Culture and MPP+ treatment of dopaminergic neurons were
performed as previously described (Hyman et al., 1994; Krieglstein
et al., 1995). MPP+ (Aldrich; St. Louis, Mo.) was added at day 3 of
culture to a final concentration of 3 .mu.M for 58 hours. Cultures
were then washed extensively to remove MPP+, cultured for an
additional 34-48 hours to allow clearance of dying TH+ neurons, and
then processed for immunocytochemistry.
Results
[0304] Shh and Ptc Continue to be Expressed in the Rat CNS After
the Major Period of Dorsoventral Patterning
[0305] Previous studies have shown that shh is expressed in the
vertebrate embryo in the period during which dorsoventral
patterning manifests (approximately E9-10 in the rat). Within the
central nervous system, shh expression persists beyond this period
and can be detected at a very high level in the E1416 rat embryo.
For example, in situ hybridization studies of the E14.5 embryo
(FIGS. 1A and E) reveal that shh is expressed in ventral regions of
the spinal cord, hindbrain, midbrain, and diencephalon. Lower
levels of expression are observed in the ventral striatumn and
septum, while no expression is observed in the cortex within the
limits of detection of this method. Interestingly, a "streak" of
shh expression (FIG. 1A, arrow) is observed to bisect the
diencephalon into rostral and caudal halves. This is likely to be
the zona limitans intrathalamica that separates prosomeres 2 and 3,
and has been previously observed in the studies of shh expression
in the developing chick embryo (Marti, et al., 1995).
[0306] Recent biochemical evidence supports the view that the ptc
gene product can act as a high affinity Shh receptor (Marigo et
al., 1996a; Stone et al., 1996). Ptc shows a complementary pattern
of expression (FIGS. 1C and E), and is observed primarily lateral
and dorsal to the sites of shh expression. The complementarity of
expression is most dramatic in the diencephalon where ptc mRNA is
absent from the zona limitans, but is expressed at a very high
level on either side of this structure. Of further interest is the
observation that rostral of the zonal limitans, ptc expression no
longer seems as restricted to regions immediately dorsal of shh
expression. Again, within the detection limits of this technique,
ptc is not expressed in the cortex. Thus in regions where shh is
expressed, adjacent tissue appears capable of responding to the
gene product as evidenced by expression of the putative
receptor.
Shh Promotes Dopaminergic Neuron Survival
[0307] In the developing midbrain (E9), Shh was first characterized
for its ability to induce the production of dopaminergic neurons.
Thus the trophic potential of Shh was tested on this neuronal
population at a stage when these neurons have already been induced.
Using cultures derived from the E14.5 mesencephalon it was found
that Shh increases the survival of TH+ neurons in a dose dependent
manner (FIG. 2A). These cells exhibited a neuronal morphology (FIG.
2B), and greater than 95% of the TR+ cells were also positive for
the neuron-specific marker, tubulin III (Banejee et al., 1990);
GFAP staining revealed no glial cells (data not shown). Differences
in TH+ neuron survival between control and Shh treated wells could
be observed as early as 5 days. Note that under these stringently
serum-free conditions (i.e. at no time were the cells exposed to
serum), baseline levels of survival are even lower than those
conventionally reported for cultures that have been maintained in
low serum or that have been briefly serum "primed". By 3 weeks in
culture less than 6% of the total TH+ cells plated were present in
the control condition, whereas 35-30% survive at 60 ng/ml of Shh
(from 5 to 24 days p<0.001 at 35 and 60 ng/ml).
[0308] All catecholaminergic neurons express TH, but the presence
of a specific high affinity DA uptake system is indicative of
midbrain dopaminergic neurons (Di Porzio et al., 1980; Denis-Donini
et al., 1984; Cerruti et al., 1993; Ciliax et al., 1995). As
further evidence that the cells supported by Shh: are bone fide
dopaminergic neurons, specific, high affinity dopamine (DA) uptake
was also demonstrated (FIG. 3). Midbrain cultures treated with Shh
transported and retained .sup.3H-DA with a dose response profile
paralleling that of survival curves (FIG. 3A) (p<0.005 at 25 and
50 ng/ml). Emulsion autoradiography also demonstrated that the
cells taking up .sup.3H-DA were neuronal in morphology (FIG. 3B).
In addition, immunohistochemistry for dopamine itself demonstrated
high cellular content (data not shown).
[0309] The observed effect of Shh on increased TH+ neuron number is
unlikely to be due to differentiation of latent progenitor cells
since previous studies demonstrated that the ability of Shh to
induce dopaminergic neurons in explanted tissue is lost at later
stages of development (Hynes et al., 1995; Wang et al., 1995).
Furthermore, the effects are unlikely to be due to a mitogenic
response of committed neuroblasts since pulsing the cultures with
5-bromp-2'-deoxyuridine (BrdU) at 1, 2, or 4 days in vitro revealed
very low mitotic activity in the presence or absence of Shh (data
not shown). Thus in addition to inducing dopaminergic neurons in
the naive mesencephalon, Shh is a trophic factor for these
neurons.
Specificity of Shh Action on Midbrain Neurons: Regulated expression
of Ptc
[0310] Expression of ptc has previously been shown to be regulated
by Shh (Goodrich et al., 1996; Marigo et al., 1996b), and to date,
Shh is the only factor known to transcriptionally upregulate ptc
expression. Therefore, the expression of ptc by mesencephalic
explants would reinforce the view that these cells are capable of
responding to Shh, and upregulation of ptc, in RNA in response to
Shh would strongly indicate the specificity of such a response.
Therefore, quantitative competitive PCR (QC-PCR) was used to
measure the level of ptc expression.
[0311] Ptc mRNA levels were measured at 0, 3, 5, and 7 days of
culture by the method described by Wang, et al. (1995). For each
culture condition at each timepoint, 5 separate cDNA samples were
co-amplified with a different known amount of mimic substrate (DNA
that can be amplified by the same primers but yielding a product of
molecular weight lower than that being sought in the sample). Thus
for each condition and timepoint, a gel like that shown in FIG. 4A
was generated (upper bands correspond to amplified ptc transcripts;
lower bands correspond to amplified mimic). Using a scanning
densitometer to quantify the observed bands, a graph was produced
for each sample (FIG. 4B corresponds to FIG. 4A). When the density
of the target band and the mimic band are equal, the concentration
of the unknown target can be taken to be equal to the known
concentration of mimic. Based on a linear curve fit, the
concentration of mimic at the point at which the density of the
mimic and the target substrate are equal (Log Ds/Dm=0) was taken to
be the concentration of the substrate in the sample; this value was
then normalized to the total amount of cDNA added to the reaction.
These values are plotted in FIG. 4C; correlation coefficients
(r.sup.2) of the curve fits always exceeded 0.95, and thus the
margin of error for the values presented is less than 5%. This
experiment was performed two independent times with independent
cultures and the results were nearly identical.
[0312] As shown in FIG. 4C, significant ptc expression was observed
in the E14.5 ventral mesencephalon (time 0). After two days of
culture, higher levels of ptc expression were observed than at the
time of dissection; in control cultures this might reflect the loss
of ptc non-expressing cell types since a constant amount of RNA was
analyzed. There was no difference in ptc expression between control
cultures and those treated with either 5 or 25 ng/ml of Shh at this
time. However, cultures treated with 50 ng/ml of Shh showed a
20-fold induction of ptc mRNA expression relative to time of
dissection and at least 5-fold over other culture condition. By 5
days of culture, ptc message levels had declined significantly in
comparison to the 3 day level of expression but high levels of
expression were still observed in 50 ng/ml Shh. By 7 days, no ptc
expression was observed in either the control- or 5 ng/ml Shh
treated cultures, although actin could still be detected (data not
shown). It is important to note that in the 25 and 50 ng/ml
Shh-treated cultures ptc expression matched or exceeded the time
zero expression of ptc in the mescencephalon despite the overall
decrease in cell number. These results indicate that: A) ptc is
expressed in the E14.5 ventral mesencephalon (suggesting that the
cells in this region are capable of responding to Shh), b) Shh is
necessary for the maintenance of ptc gene expression, and c) that
the expression of ptc shows a Shh dose dependence that parallels
the neurotrophic activity described above.
Specificity of Shh Action on Midbrain Neurons:
Immunoneutralization
[0313] As further evidence that the trophic activity of Shh
preparation used for these studies, purified from a baculovirus
expression system, was due to Shh and not to a contaminating
factor, antibody neutralization experiments were performed. As
shown in FIG. 4D, a saturating dose of Shh (50 ng/ml) promotes
midbrain neuron survival (p<0.001) while the same dose of Shh in
the presence of a 5-fold molar excess of activity-neutralizgin,
anti-Shh, monoclonal antibody (5E1; Ericson, et al. (1996))
inhibits this, trophic response (p<0.001). In earlier studies
(data not shown), an affinity purified, polyclonal, anti-Shh
antibody dramatically reduced the activity of Shh in the
dopaminergic neuron survival assay (p<0.005), whereas purified
rabbit IgG antibody from preimmune sera had no significant effect.
Anti-TGF antibodies used at a 3-fold molar excess to Shh did not
inhibit the trophic activity, while they did inhibit the previously
reported (Krieglestein et al., 1995) trophic effects of exogenously
applied TGF s (data not shown). Addition of galactosidase,
expressed and purified in a manner identical to Shh, failed to show
any trophic effect (data not shown), and thus renders unlikely the
possibility that an undefined baculovirus protein is responsible
for the observed trophic effects. Finally, Shh purified from an E.
coli expression system (Wang et al., 1995) also had trophic
activity for Th+ cells, while galactosidase purified identically to
Shh from the E. coli expression system gave no such activity even
at concentrations as high as 20 .mu.g/ml (data not shown).
Shh Supports the Survival of Other Midbrain Neurons
[0314] Since the original observations concerning the role of Shh
in midbrain development were concerned with induction of
dopaminergic neurons (Hynes et al., 1995; Want et al., 1995), the
current study initially focused on possible trophic effects on
these neurons. Interestingly, the cultures in which the above
described trophic effects were observed, also demonstrated that the
trophic effect of Shh extended to non-dopaminergic neurons (i.e. TH
neurons). Within the dopaminergic neucleus of the midbrain, the
substantia nigra, GABA is also a major neurotransmitter (Masuko et
al., 1992). Staining for GABA in these cultures (FIG. 5) showed
that GABA+ cells are supported by the presence of Shh with a dose
response profile comparable to TH+ cells. Furthermore, GABA cells
outnumbered TH+ cells by a ratio of approximately 3.1. The two cell
types together account for approximately 95% of the total neurons
as gauged by staining for tubulin III (data not shown), and thus it
is clear that the trophic effect of Shh on midbrain neurons extends
to multiple neuron subtypes (for TH, p<0.001 at 35 and 60 ng/ml;
for GABA, p<0.001 at 35 and 60 ng/ml).
Ssh Effects on Striatal Neurons
[0315] Since Shh is strongly expressed in the ventral and lateral
forebrain (Echelard et al., 1993; Ericson et al., 1995), and that
the Shh knockout mouse exhibits triatal defects (Chiang et al.,
1996), Shh neurotrophic activity was examined in striatum-derived
cultures as well. As assessed after 4 days in vitro FIG. 6), Shh is
a potent trophic factor for neurons cultured from the E15-16
striatum, and shows a dose response comparable to that of the
midbrain. In comparing the number of total neurons (tubulin m+
cells) with that of GABA+ neurons, it is clear that essentially all
of the neurons supported by Shh are GABAergic (FIG. 6) (tubulin
III, p<0.001 at 25 and 50 ng/ml; GABA, p<0.001 at 25 and 50
ng/ml). That this effect is trictly trophic was confirmed by the
observation that BrdU labeling indices over the course of the
culture period were low and did not vary with dose (data not
shown). Closer inspection reveals that the intensity of GABA
staining is variable, and it is thus possible that various subtypes
of GABA+ interneurons (reviewed by Kawaguchi et al., 1995) are all
supported by Shh.
[0316] Shh Effects on Spinal Neurons.
[0317] As a further examination of the postinductive effectives of
Shh on ventral neural tube derivatives, cultures of the E14-15
ventral neural tube were cultured with varying amounts of Shh.
Again, with a dose response identical to that observed in the
mesencephalic and striatal cultures, Shh promotes the survival of
tubulin III+ neurons as scored after 4 days in vitro (FIG. 6A). A
majority, but not all of these cells also stain for GABA, and a
smaller subset stain for a neuclear marker of spinal interneurons,
Lim-1/2 (Tsuchida et al., 1994) (FIG. 6A-C) (tubulin III,
p<0.001 at 25 and 50 ng/ml; Lim-1/2, p<0.001 at 5, 10, 25 and
50 ng/ml; GABA, p 0.001 at 25 and 50 ng/ml). It is important to
note that while there is overlap between the GABA+ and
Lim-1/2+populations, the latter is not merely a subset of the
former since there are Lim-1/2+ cells that do not stain for GABA
Interestingly, immunoreactivity for the low affinity nerve growth
factor receptor (Camu and Henderson, 1992), Islet-1 (Ericson et
al., 1992), or galectin-1 (Hynes et al., 1990), all markers of rat
motorneurons, was not detectable in these cultures, and thus it
appears that Shn is not trophic for spinal motorneurons.
Shh Protects Th+ Cells Against MPP+Toxicity
[0318] The toxin, 5-phenyl-1,2,3,6-tetrahydropterine (MPTP), and
its active metabolite, MPP+, are selectively toxic to mesencephalic
dopamineric neurons (Kopin and Markey, 1988; Fomo et al., 1993).
Since other agents that promote survival of TH+ cells also protect
against chemical toxicity of MPP+(Hyman et al., 1991; Krieglestein
et al., 1995), we tested the ability of Shh to protect TH+ cells in
E14 rat mesencephalon explants from the effects of MPP.sup.+. As
shown in FIG. 8, the presence of Shh in cultures treated for 58
hours with MPP.sup.+ significantly increased the numbers of TH+
cells that were observed in culture after removal of the MPP.sup.+.
MPP+treatment caused a greater than 90% reduction in the numbers of
TH+ cells compared to non-MPP+ treated control cultures, whereas
incubation with Shh protected the Th+ cells so that only a 75%
reduction of TH+ cells occurred after MPP+treatment versus
controls. Sister cultures tested for 4H-DA transport demonstrated a
8-fold increase in transport in Shh treated cultures versus
controls (data not shown).
[0319] Shh was significantly more active in protecting TH+ cells
from the effects of MPPf than the other growth factors tested:
glia-derived neurotrophic factor (GDNF) (Lin et al., 1993) and
brain-derived neurotrophic factor (BDNF) (Hyman et al., 1991) (Shh,
p<0.001 at 60 and 350 ng/ml; BDNF no significance; GDNF,
p<0.05). In the serum free conditions used in these experiments,
none of the other growth factors tested showed as significant a
level of TH+ cell protection from MPP+toxicity as Shh, even when
tested at levels previously shown to be optimal for neuroprotection
(FIG. 8).
Discussion
[0320] Shh is Neurotrophic for a Variety of Ventral Neurons
[0321] The hypothesis that Shh may play roles in the nervous system
in addition to its initial function in neural tube ventralization
was first suggested by the observation that Shh expression in
ventral neural tissue along the entire neuraxis continues well past
the period during which phenotypic specification has occurred
(Echelard et al., 1993). Moreover, preliminary evidence generated
in our laboratory indicates the presence of significant levels of
Shh mRNA in specific regions of the adult human-CNS (e.g. spinal
cord and substantia nigra, P. Jin, unpublished observations). We
report here the first evidence that Shh can indeed exert effects
independent of its induction and patterning activity.
[0322] Unlike its role at earlier stages of neural development,
this novel neurotrophic activity acts on postmitotic neurons rather
than on dividing progenitor cells. While the general trophic effect
is apparent in a number of CNS regions (FIGS. 2 and 6-7), there are
both differences and similarities in the effects observed among the
regions examined. Given the fact that Shh is necessary for the
induction of both spinal motor neurons and midbrain dopaminergic
neurons, one might predict that Shh would be subsequently trophic
for the cells. Strikingly, Shh is a very potent trophic factor for
the midbrain dopaminergic neurons (FIG. 2), but in the cultures of
ventral spinal neurons, no such effect on motor neurons was
observed. Thus there is no direct correlation between the neuron
phenotypes induced by Shh, and hose supported by Shh in a trophic
manner. Interestingly, a coriumon feature among the three CNS
regions examined was the trophic effect for GABAergic neurons (FIG.
6-7). While it is not obvious whether these specific GABA+
populations are directly or indirectly induced by Shh during early
development (cf. Pfaff et al., 1996), it is plausible that the
trophic actions on these neurons are direct.
[0323] It is important to note that the neurotrophic effects
reported herein are not lacking in specificity. For example,
neurons of the peripheral nervous system show no survival in
response to Shh administration, and preliminary studies of cultures
derived from E15-16 dorsal CNS regions (e.g. neocortex and dorsal
spinal cord) show high baseline levels of neuron survival with no
significant response to exogenous Shh application (J.A.0. and
N.K.M., unpublished observation). Thus there appears to be a
general restriction of the trophic effects of Shh to regions of the
CNS specified by Shh, but the actual targets of trophic activity
need not encompass the phenotypes whose induction is Shh-dependent.
Nevertheless, the fact that Shh also protects neurons from toxic
insult (FIG. 8), suggests previously unforeseen therapeutic roles
for Shh as well.
Possible Mechanisms of Shh Action
[0324] As stated above, the neurotrophic effect of Shh observed in
these cultures is not due to the stimulation of proliferation. One
could argue, however, that the observed effects are indirect. In
one scenario, Shh may act on a non-neuronal cell that in turn
responds by secreting a neurotrophic factor. We observed no sign of
astrocytes in any of our neural cultures, either by morphology or
by staining for GFAP. Furthermore, in the purely neuron al cultures
established from the midbrain, ptc is greatly upregulated in
response to Shh, and thus the reported survival effects must be due
to a response by neurons (FIG. 4C).
[0325] In another scenario, it is possible that Shh acts directly
on some or all of the neurons, but the response is to secrete
another factor(s) that actually possesses the survival activity.
For example, Shh has been shown to induce the expression of TGF
family members such as BMP's in vivo (Laufer et al., 1994; Levin et
al., 1995) and these proteins are trophic for midbrain dopaminergic
neurons (Krieglstein et al., 1995). That induced expression of TGF
s is the trophic mechanism seems unlikely since exogenous TGF s
show only modest trophic activity in our culture system, and the
presence of neutralizing, anti-pan-TGF antibodies failed to inhibit
the neurotrophic effects of Shh. Thus, at a minimum, Shh supports
the survival of a subset of ventral CNS neurons. The mechanism by
which Shh supports neuron survival is yet to be determined. While
we favor the hypothesis that these trophic effects are direct, it
remains possible that the survival response is due to Shh-induced
expression of a secondary trophic factor.
[0326] As in the case of many secreted peptide factors, it now
appears that Shh has activities that can vary greatly depending on
the spatiotemporal context in which the factor is expressed. While
it was initially thought that the primary role of Shh inthe CNS is
in early patterning events that are critical to phenotypic
specification, it is now clear that Shh can also contribute to the
survival and maturation of these CNS regions. Interestingly, the
cell types acted upon in these two distinct roles of Shh do not
necessarily overlap. Thus a more thorough understanding of this
multifaceted molecule will require a better understanding of its
patterns of expression beyond early embryogenesis. Moreover, it
will be critical to ascertain the significance of the trophic
effects of Shh in vivo.
REFERENCES CITED IN EXAMPLE 1
[0327] Altman J, Bayer S A (1995) Atlas of prenatal rat brain
development. Boca Raton: CRC Press. [0328] Baneijee A, Roach M C,
Treka P, Luduena R F (1990) Increased microtubule assembly in
bovine brain tubulin lacking; the type III isotype of tubulin. J
Biol Chem 1990:1794-1799. [0329] Bumcrot D A, Takada R, McMahon A P
(1995) Proteolytic processing yields two secreted forms of
Sonic-hedgehog. Mol. Cell. Biol. 25:2194-2303. [0330] Camu W,
Henderson C E (1992) Purification of embryonic rat motoneurons my
panning on a monoclonal antibody to the low-affinity NGF receptor.
J Neurosci Meth 54:59-70. [0331] Cerruti C, Walther D M, Kuhar M J,
Uhl G R (1993) Dopamine transporter mRNA expression is intense in
rat midbrain neurons and modest outside midbrain. Mol Brain Res
28:181-186. [0332] Chiang C, Litingung Y, Lee E, Young K E, Corden
J L, Westphal H, Beachy P A (1996) Cyclopia and defective axial
patterning in mice lacking Sonic hedgehog gene function. Nature
483:407-413. [0333] Ciliax B J, Heilman C, Demchyshyn L L, Pristupa
Z B, Ince E, Hersch S M (1995) The dopamine transporter:
immunochemical characterization and localization in the brain. J
Neurosci 25.1714-1723. [0334] Denis-Donini-S, Glowinsid J,
Prochiantz A (1984) Glial heterogeneity may define the three
dimensional shape of mouse mesencephalic DA neurons. Nature
307:641-643. [0335] Di Poizio U, Daguet M-C, Glowinski J,
Prochiantz A (1980) Effect of striatal cells on in vitro maturation
of mesencephalic dopaminergic neurons grown in serum-free
conditions. Nature 388:370-373. [0336] Echelard Y, Epstein D J,
St-Jacques B, Shen L, Mohler J, McMahon J A, McMahon A P (1993)
Sonic hedgehog, a member of a family of putative signaling
molecules, is implicated in the regulation of CNS polarity. Cell
85:1417-1430. [0337] Ericson J, Mortin S, Kawakami A, Roelink H,
Jessell T M (1996) Two critical periods of sonic hedgehog signaling
required for the specification of motor neuron identity. Cell
87:661-673. [0338] Ericson J, Muhr J, Placzek M, Lints T, Jessell T
M, Edlund T (1995) Sonic hedgehog induces the differentiation of
ventral forebrain neurons: a common signal for ventral patterning
within the neural tube. Cell 81:747-756. [0339] Ericson J, Thor S,
Edlund T, Jessell T M, Yamada T (1992) Early stages of motor neuron
differentiation revealed by expression of homeobox gene IsZ-1.
Science 356:1555-1560. [0340] Fietz M j, Concordet J-P, Barbosa R.
Johnson R, Krauss S, McMahon A P, Tabin C, Ingham P W (1994) The
hedgehog gene family in Drosophila and vertebrate development
Development Suppl.:43-51. [0341] Formo L S, DeLanney L E, Erwin I,
Langston J W (1993) Similarities and differences between
MPTP-induced parkinsonism and Pakinson's disease: neuropathologic
considerations. Adv Neurol 70:600-608. [0342] Goodrich L V, Johnson
R L, Milenkovic L, McMahon J A, Scott M P (1996) Conservation of
the hedgehog/patched signaling pathway from flies to mice:
induction of a mouse patched gene by hedgehog. Genes Dev
20:301-312. [0343] Hyman C, Hofer M, Barde Y-A, Juhasz M,
Yancopoulos G D, Squinto S P, Lindsay R M (1991) BDNF is a
neurotrophic factor for dopaminergic neurons of the substantia
nigra. Nature 450-230-232. [0344] Hyman C, Juhasz M, Jackson C,
Wright P, Ip N Y, Lindsay R M (1994) Overlapping and distinct
actions of the neurotrophins BDNF, NT-3, and NT-4/5 on cultured
dopaminergic and GABAergic neurons of the ventral mesencephalon. J
Neurosci 24:335-347. [0345] Hynes M, Porter J A, Chiang C, Chang D,
Tessier Lavigne M, Beachy P A, Rosenthal A (1995) Induction of
midbrain dopaminergic neurons by Sonic hedgehog. Neuron 25:35-44.
[0346] Hynes M A, Gitt M, Barondes S H, Jessell T M, Buck L B
(1990) Selective expression of an endogenous lactose-binding lectin
gene in subsets of central and peripheral neurons. J Neurosci
20:1004-1013. [0347] Kawaguchi Y, Wilson C J, Augood S J, Emson P C
(1995) Striatal interneurones: chemical, physiological and
morphological characterization. TINS 28:527-535. [0348] Kopin. I J,
Markey S P (1988) MPTP toxicity: implications for research in
Parkinson's disease. Ann Rev Neurosci 21:81-96. [0349] Krieglstein
K, Suter-Crazzolara C, Fischer W H, Unsicker K (1995) TGFP
superfamily members promote survival of midbrain dopaminergic
neurons and protect them against MPP+ toxicity. EMBO J. 24:736-742.
[0350] Laufer E, Nelson C E, Johnson R L, Morgan B A, Tabin C
(1994) Sonic hedgehog and FGF-4 act along a signaling cascade with
a feedback loop to integrate growth and patterning of the
developing limb bud. Cell 89:993-1003. [0351] Lee j j, Von Kessler
D P, Parks S, Beachy P A (1992) Secretion and localized
transcription suggest a role in positional signaling for products
of the segmentation gene hedgehog. Cell 81:33-50. [0352] Levin M,
Johnson R L, Stern C D, Kuehn M, Tabin C (1995) A molecular pathway
determining left-right asymmetry in chick embryogenesis. Cell
82:803-814. [0353] Lin L-F H, Doherty D H, Lile J D, Bektesh S,
Collins F (1993) GDNF: a glial cell line-derived neurotrophic
factor for midbrain dopaminergic neurons. Science 260:130-1132.
[0354] Marigo V, Davey R A, Zuo Y, Cunningham J M, Tabin C J
(1996a) Biochemical evidence that Patched is the Hedgehog receptor.
Nature 484:176-179. [0355] Marigo V, Scott M P, Johnson R L,
Goodrich L V, Tabin C J (1996b) Conservation of hedgehog signaling:
induction of a chicken patched homologue by sonic hedgehog in, the
developing limb. Development 222:1225-1233. [0356] Marti E, Bumerot
D A, Takada R, McMahon A P (1995) Requirement of 19K sonic hedgehog
for induction of distinct ventral cell types in CNS explants.
Nature 375-322-325; [0357] Masuko S, Nakajima S, Nakajima Y-@
(19.9-2): Dissociated high-purity dopaminergic neuron cultures from
the substantia nigra and the ventral segmental area of the
postnatal rat. Neurosci 59:347-364. [0358] Mohler. J-Vani K (1992)
Molecular organization and embryonic expression of the hedgehog
gene involved in cell-cell communication in segmental patterning of
Drosophila. Development 215:957-971. [0359] Nutslein-Volhard C,
Wieschaus E (1980) Mutations affecting segment number and polarity
indrosophila. Nature 387:795-801. [0360] Pfaff S L, Mendelsohn M,
Stewart C L, Edlund T. jessell T M (1996) Requirement for LIM
homeobox gene ISLI in motor neuron generation reveals a motor
neuron-dependent step in interneuron differentiation. Cell
84:309-320. [0361] Porter J A, Ekker S C, Young K E, Von Kessler D
P, Lee j j, Moses D, Beach P A (1995) The product of hedgehog
autoproteolytic cleavage active in local and longrange signaling.
Nature 474:363-366. [0362] Roelink H, Porter J A, Chiang C, Tanabe
Y, Chang D T, Beachy P A, Jessell T M (1994) Floor plate and motor
neuron induction by Vhh-1, a vertebrate homologue of hedgehog
expressed by the notochord. Ceil 86:761-775. [0363] Shimoda K,
Sauve Y, Schwartz J P, Commissiong J W (1992) A high percentage
yield of tyrosine hydroxylase-positive cells from rat E14
mesencephalic cell culture. Brain Res 686:319-331. [0364] Stone D
M, Hynes M, Armanini M, Swanson T A, Gu Q, Johnson R L, Scott M P,
Hooper J E, Sauvage F d, Rosenthal A (1996) The tumor-supressor
gene patched encodes a candidate receptor for Sonic hedgehog.
Nature 484:119-134. [0365] Tabata T, Eaton S, Komberg T B (1992)
The Drosophila hedgehog gene is expressed specifically in posterior
compartment cells and is a target of engrailed regulation. Genes
Dev 7:2635-2645. [0366] Tanabe Y. Roelink H, jessel T M (1995)
Induction of motor neurons by sonic hedgehog is independent of
floor plate. Curr Bio16:651-658. [0367] Tsuchida T, Ensini M,
Morton S B, Baldassare M, Edlund T, jessell T M, Pfaff S L (1994)
Topographic organization of embryonic motor neurons defined by
expression of LIM homeobox genes. Cell 89:957-970. [0368] Wang MZ,
jin P, Bumcrot D A, Marigo V, McMahon A P, Wang E A, Woolf T, Pang
K (1995) Induction of dopaminergic neuron phenotype in the midbrain
by sonic hedgehog polypeptide. Nature Med 2:1184-1188. [0369]
Wilkinson, D. G. (1992). Whole mount in situ hybridization of
vertebrate embryos. [0370] In In Situ Hybridization: A Practical
Approach, D. G. Wilkinson, ed. (Oxford: IRL Press), pp. 75-83.
Example2
Restoration of Function Paradigm-Establishment of a Stable Lesion
Through Administration of 6-OHDA With Subsequent Administration of
Shh
[0371] These experiments analyzed reduction in toxin-induced
asymmetry of nigrostriatal system as examined by apomorphine
induced rotational behaviors.
[0372] Briefly, Fisher 344 rats were injected with 6-OHDA into the
right medial forebrain bundle. Male rats were anesthetized with 400
mg/kg chloral hydrate injected intraperitoneally and placed in a
stereotaxic frame. The skin over the skull was retracted; a burr
hole was then placed in the skull over the lesion site and a needle
attached to a microliter syringe was lowered into the medial
forebrain bundle (4.4 mm posterior to bregma, 1.3 mm lateral, 7.8
mm ventral to thedural surface). 9 ug/4/ul/4 min of
6-hydroxydopamine (6-OHDA) in ascorbate was then injected. The
needle was withdrawn after one additional minute and the surgical
wound was closed with skin clips.
[0373] All lesioned animals exhibited a stable rotation pattern and
turned >300 times contralateral to the lesion after a low dose
of apomorphine. Prior to intracranial injections of Shh (N-terminal
fragment, unmodified, E. coli recombinant) or vehicle, all rates
showed a slight increase in apomorphine-induced rotations as
measured at weekly intervals for the 3 weeks prior to
administration of test solution.
[0374] In order to achieve a more uniform distribution of Shh, two
stereotactically guided injections of 5 ul each were made at
distinct sites within the substanitia nigra. With the incisor bar
positioned to -2.3 mm, the injection coordinates based on bregma
(Paxinos and Watson, 1986) were as follows: Site 1: AP -5.6 mm, ML
-1.87, DV -7.3 mm; site 2: AP -5.6 mm4 mL -2.5 mm, DV -6.8 mm.
Incisions were closed using stainless steel wound clips, and the
animals were allowed to recover for 1 week before subsequent
behavioral testing.
[0375] FIGS. 9 and 10 illustrate the restorative activity of Shh on
apomorphine-induced lesioned rats.
Example 3
Neuroprotective Paradigm-Simultaneous Administration of 6-OHDA and
Shh
[0376] This set of experiments analyzed protection from
toxin-induced asymmetry of the nigrostriatal system as examined by
amphetamine induced rotational behavior.
[0377] Briefly, at day 0, animals were injected with 6-OHDA
unilaterally into their medial forebrain bundle at coordinates -2.8
mm from bregma, 2 mm lateral to the midline and 8.6 mm below the
skull. Similarly, the animals were injected with Shh (N-terminal
fragment, unmodified E. coli recombinant, 10 .mu.g) or vehicle
unilaterally into SNc/VTA at coordinates -4.8 mm from bregma, 1.4
mm lateral to the midline, and 8.2 mm below the skull. Coordinates
according to the atlas of Paxinos and Watson (1986).
[0378] At day 4, the animals were challenged with amphetamines and
ipsiversive rotations were measured. FIGS. 11A and 111B demonstrate
the neuroprotective activity of Shh.
Example 4
Further Animal Studies of Neuroprotective Effect of Shh
[0379] As with example 3, this set of experiments analyzed
protection from toxin-induced asymmetry of the nigrostriatal system
as examined by amphetamine induced rotational behavior.
[0380] At Day 0, 6-OHDA was unilaterally injected into the medial
forebrain bundle at coordinates -2.8 mm from bregma, 2 mm lateral
to the midline and 8.6 mm below the skull. The animals were also
injected, into the lateral SNc at coordinates -4.8 mm from bregma,
1.4 mm lateral to the midline and 8.2 mm below the skull, with
vehicle ("X-treated"), or with one of two doses of Shh (N-terminal
fragment, unmodified E. coli recombinant), 30 .mu.g ("Y-treated")
or 10 .mu.g ("Z-treated"). Coordinates according to the atlas of
Paxinos and Watson (1986).
[0381] At days 4, 7, 14 and 21, the animals were challenged with
amphetamines and ipsiversive rotations were measured. The animals
were also challenged on day 24 with apomorphine. FIGS. 14A-E
demonstrate the dose-dependent neuroprotective activity of Shh.
Example 5
Neuroprotective Activity of lipophilic-modified Shh
[0382] Utilizing the protocol of Example 4, animals were treated
with either vehicle ("C-treated"), or 76 ng ("A-treated") or 760 ng
("B-treated") of a myristoylated N-terminal fragment of Shh. At
days 4, 1, 14 and 21, the animals were challenged with amphetamines
and ipsiversive rotations were measured. The animals were also
challenged on day 24 with apomorphine. FIGS. 15A-H demonstrate the
dose-dependent neuroprotective activity of Shh. FIG. 16 is a
collective graph of the data, specifically the ipsilateral turns
over 21 days after 6-OHDA treatment, and indicates that
myristoylated Shh protects against 6-OHDA lesions.
Example 6
Restoration of Function Paradigm-Comparison of Myristoylated and
Unmyristoylated Shh
[0383] These experiments compared reduction in toxin-induced
asymmetry of the nigrstriatal system, as examined by apomorphine
and amphetamine induced rotational behaviors, for various forms of
hedgehog polypeptides, namely lipid-modified and unmodified forms
of the proteins. See, e.g., Pepinsky et al. (1998) JBC 273:14037
for a discussion of lipid-modified hedgehog polypeptides.
[0384] Animals were prepared in a similar fashion to the 6-OHDA
lesioned rats of Example 2. Briefly, each rat was given a dose of
desipramine HCl (25 mg/kg i.p.) and pargyline (50 mg/kg g i.p.),
and anesthetized with isoflurane in oxygen. After shaving the
scalp, the head was fixed in a stereotaxic frame according to the
atlas of Paxinos and watson (1986). A midline longitudinal incision
was made, and the skin flap retracted to reveal the surface of the
skull. With the aid of an operating microscope, a small burr-hole
was drilled overlaying the left medial forevrain bundle
(stereotaxic coordinates: AP+5.2 mm from interaural line (or AP-3.8
mm from bregma); L1.0 mm). The tip of an injection cannula
(backfilled with injectate) was lowered to a depth of 8.0 mm below
the surface of the brain so that the tip is located in the medial
forebrain bundle, and was left in place for 5 min before the
injection. 6-Hydroxydopamine hydrobromide (1.5 or 6 .mu.g in 2
.mu.l) was injected over 5 nm in, with the cannula left in place
for a further 5 min. After removal of the cannula the burr-hole was
sealed bone wax, and the scalp wound closed with sutures.
Apomorphine (Contrlateral) Circling Tests (Days 14, 22, 30 and
38).
[0385] An 8-channel Rotometry System (Benwick Electronics,
Wimblington, U.K.) was used for the circling tests. Apomorphine HCl
and amphetamine HCl were dissolved in sterile water for injection.
For each test, rats were dosed with apomorphine HCl (0.3 mg/kg
i.p.), placed in a swivel-harness in rotometry bowls (diamter 24
cm), and left in the bowls for 45 min. Clockwise and anticlockwise
rotations were logged automatically.
Amphetamine (Ipsilateral) Circling Tests (Days 15, 23, 31 and
39)
[0386] The rats were placed in a rotometry bowl (as above) prior to
injection of amphetamine HCl (1 mg/kg i.p.). Immediately after
injection, they were placed in the rotometer harness and left in
the bowls for 0.120 min. Clockwise and anticlockwise rotations were
logged automatically.
Microinjection of Shh or Vehicle (Day 21)
[0387] Each rat was anesthetized with halothane (1.3% in oxygen)
and, after shaving the scalp, the head was fixed in a stereotaxic
frame according to the atlas of Paxinos and Watson (1986). A
longitudinal incision was made, offset to the left of the midline,
and the skin flap retracted to reveal the surface of the skull.
With the aid of an operating microscope, a small burr-hole was
drilled overlying the left sunstantia nigra (stereotaxic
coordinates AP -5.6 mm from bregma; L 2.0 mm). The tip of an
injection cannula (backfilled with injectate) was lowered to a
depth of 7.3 mm elow the brain surface so that the tip was located
dorsal to the middle of the substantial nigra, and was left in
place for 5 min before the injection. The injectate (1 .mu.l of
solution Gz or Mz) was injected over 5 min, and the cannula left in
place for a further 5 min. After removal of the cannula, the burr
hole was sealed with bone wax, the scalp wound closed with sutures,
and the anesthesia discontinued.
[0388] FIGS. 12 and 13 demonstrate an increased potency, as a
restorative agent, of a myristoylated form of Shh (Mz) relative to
the unmodified form of the protein (Gz).
Example 7
Evaluating the Efficacy of Human Sonic Hedgehog polypeptide
Constructs in a Rat Model of Huntington's Disease
[0389] Injection of malonate, an inhibitor of the mitochondrial
enzyme succinate dehydrogenase, into the rat striatum (the rodent
equivalent of the primate caudate and putamen) causes degeneration
of striatal medium spiny neurons. In humans, degeneration of medium
spiny neurons in the caudate and putamen is the primary
pathological feature of Huntington's disease. Thus, the
malonate-induced striatal lesion in rats can be used as a model to
test whether human hedgehog polypeptides can prevent the death of
the neurons that degenerate in Huntington's disease.
[0390] Sprague-Dawley rats are injected with various concentrations
of hedgehog polypeptide in the striatum using stereotaxic
techniques. Stereotaxic-injections (2 il) are done under sodium
pentobarbital anesthesia (40 mg/kg) and placed at the following
coordinates: 0.7 mm anterior to bregma, 2.8 mm lateral to the
midline and 5.5 mm ventral to the surface of the skull at bregma.
At various times (usually 48 hr) after injection of hedgehog
polypeptide, rats are anesthetized with isoflurane and given a
stereotaxic injection of malonate (2 mmols in 2 ii) at the same
coordinates in the striatum. Four days after malonate injection,
rats are sacrificed and their brains removed for histological
analysis. Coronal sections are cut through the striatum at a
thickness of 25 im and stained for cytochrome oxidase activity to
distinguish lesioned from unlesioned tissue. The volume of the
lesion in the striatum is measured using image analysis.
[0391] The effect of sonic hedgehog polypeptide constructs given 48
hours before malonate is shown in FIG. 17. Unmodified sonic
hedgehog polypeptide (Shh), myristoylated Shh, ClII-Shh and octyl
maleimide Shh all reduce lesion volume to a similar extent in this
model. However, the hydrophobically modified proteins
(myristoylated Shh, ClII-Shh and octyl maleimide Shh) show an
increase in potency relative to the unmodified sonic hedgehog
polypeptide. FIG. 18 shows the time course for the effect of
pretreatment with myristoylated Shh (0.5 ig in 2 il) in the
malonate striatal lesion model. A statistically significant
reduction in lesion volume is seen when myristoylated Shh is given
2 days before malonate, however myristoylated Shh has a greater
effect when given either 3 or 4 days before malonate. There was not
a statistically significant reduction in lesion volume when
myristoylated Shh was given 1 day, 7 days or immediately (0 days)
before malonate.
[0392] All of the above-cited references and publications are
hereby incorporated by reference.
EQUIVALENTS
[0393] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
3211277DNAGallus sp.CDS(1)..(1275) 1atg gtc gaa atg ctg ctg ttg aca
aga att ctc ttg gtg ggc ttc atc 48Met Val Glu Met Leu Leu Leu Thr
Arg Ile Leu Leu Val Gly Phe Ile 1 5 10 15tgc gct ctt tta gtc tcc
tct ggg ctg act tgt gga cca ggc agg ggc 96Cys Ala Leu Leu Val Ser
Ser Gly Leu Thr Cys Gly Pro Gly Arg Gly 20 25 30att gga aaa agg agg
cac ccc aaa aag ctg acc ccg tta gcc tat aag 144Ile Gly Lys Arg Arg
His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys 35 40 45cag ttt att ccc
aat gtg gca gag aag acc cta ggg gcc agt gga aga 192Gln Phe Ile Pro
Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg 50 55 60tat gaa ggg
aag atc aca aga aac tcc gag aga ttt aaa gaa cta acc 240Tyr Glu Gly
Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr 65 70 75 80cca
aat tac aac cct gac att att ttt aag gat gaa gag aac acg gga 288Pro
Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly 85 90
95gct gac aga ctg atg act cag cgc tgc aag gac aag ctg aat gcc ctg
336Ala Asp Arg Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn Ala Leu
100 105 110gcg atc tcg gtg atg aac cag tgg ccc ggg gtg aag ctg cgg
gtg acc 384Ala Ile Ser Val Met Asn Gln Trp Pro Gly Val Lys Leu Arg
Val Thr 115 120 125gag ggc tgg gac gag gat ggc cat cac tcc gag gaa
tcg ctg cac tac 432Glu Gly Trp Asp Glu Asp Gly His His Ser Glu Glu
Ser Leu His Tyr 130 135 140gag ggt cgc gcc gtg gac atc acc acg tcg
gat cgg gac cgc agc aag 480Glu Gly Arg Ala Val Asp Ile Thr Thr Ser
Asp Arg Asp Arg Ser Lys145 150 155 160tac gga atg ctg gcc cgc ctc
gcc gtc gag gcc ggc ttc gac tgg gtc 528Tyr Gly Met Leu Ala Arg Leu
Ala Val Glu Ala Gly Phe Asp Trp Val 165 170 175tac tac gag tcc aag
gcg cac atc cac tgc tcc gtc aaa gca gaa aac 576Tyr Tyr Glu Ser Lys
Ala His Ile His Cys Ser Val Lys Ala Glu Asn 180 185 190tca gtg gca
gcg aaa tca gga ggc tgc ttc cct ggc tca gcc aca gtg 624Ser Val Ala
Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val 195 200 205cac
ctg gag cat gga ggc acc aag ctg gtg aag gac ctg agc cct ggg 672His
Leu Glu His Gly Gly Thr Lys Leu Val Lys Asp Leu Ser Pro Gly 210 215
220gac cgc gtg ctg gct gct gac gcg gac ggc cgg ctg ctc tac agt gac
720Asp Arg Val Leu Ala Ala Asp Ala Asp Gly Arg Leu Leu Tyr Ser
Asp225 230 235 240ttc ctc acc ttc ctc gac cgg atg gac agc tcc cga
aag ctc ttc tac 768Phe Leu Thr Phe Leu Asp Arg Met Asp Ser Ser Arg
Lys Leu Phe Tyr 245 250 255gtc atc gag acg cgg cag ccc cgg gcc cgg
ctg cta ctg acg gcg gcc 816Val Ile Glu Thr Arg Gln Pro Arg Ala Arg
Leu Leu Leu Thr Ala Ala 260 265 270cac ctg ctc ttt gtg gcc ccc cag
cac aac cag tcg gag gcc aca ggg 864His Leu Leu Phe Val Ala Pro Gln
His Asn Gln Ser Glu Ala Thr Gly 275 280 285tcc acc agt ggc cag gcg
ctc ttc gcc agc aac gtg aag cct ggc caa 912Ser Thr Ser Gly Gln Ala
Leu Phe Ala Ser Asn Val Lys Pro Gly Gln 290 295 300cgt gtc tat gtg
ctg ggc gag ggc ggg cag cag ctg ctg ccg gcg tct 960Arg Val Tyr Val
Leu Gly Glu Gly Gly Gln Gln Leu Leu Pro Ala Ser305 310 315 320gtc
cac agc gtc tca ttg cgg gag gag gcg tcc gga gcc tac gcc cca 1008Val
His Ser Val Ser Leu Arg Glu Glu Ala Ser Gly Ala Tyr Ala Pro 325 330
335ctc acc gcc cag ggc acc atc ctc atc aac cgg gtg ttg gcc tcc tgc
1056Leu Thr Ala Gln Gly Thr Ile Leu Ile Asn Arg Val Leu Ala Ser Cys
340 345 350tac gcc gtc atc gag gag cac agt tgg gcc cat tgg gcc ttc
gca cca 1104Tyr Ala Val Ile Glu Glu His Ser Trp Ala His Trp Ala Phe
Ala Pro 355 360 365ttc cgc ttg gct cag ggg ctg ctg gcc gcc ctc tgc
cca gat ggg gcc 1152Phe Arg Leu Ala Gln Gly Leu Leu Ala Ala Leu Cys
Pro Asp Gly Ala 370 375 380atc cct act gcc gcc acc acc acc act ggc
atc cat tgg tac tca cgg 1200Ile Pro Thr Ala Ala Thr Thr Thr Thr Gly
Ile His Trp Tyr Ser Arg385 390 395 400ctc ctc tac cgc atc ggc agc
tgg gtg ctg gat ggt gac gcg ctg cat 1248Leu Leu Tyr Arg Ile Gly Ser
Trp Val Leu Asp Gly Asp Ala Leu His 405 410 415ccg ctg ggc atg gtg
gca ccg gcc agc tg 1277Pro Leu Gly Met Val Ala Pro Ala Ser 420
42521190DNAMurine sp.CDS(1)..(1188) 2atg gct ctg ccg gcc agt ctg
ttg ccc ctg tgc tgc ttg gca ctc ttg 48Met Ala Leu Pro Ala Ser Leu
Leu Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 15gca cta tct gcc cag
agc tgc ggg ccg ggc cga gga ccg gtt ggc cgg 96Ala Leu Ser Ala Gln
Ser Cys Gly Pro Gly Arg Gly Pro Val Gly Arg 20 25 30cgg cgt tat gtg
cgc aag caa ctt gtg cct ctg cta tac aag cag ttt 144Arg Arg Tyr Val
Arg Lys Gln Leu Val Pro Leu Leu Tyr Lys Gln Phe 35 40 45gtg ccc agt
atg ccc gag cgg acc ctg ggc gcg agt ggg cca gcg gag 192Val Pro Ser
Met Pro Glu Arg Thr Leu Gly Ala Ser Gly Pro Ala Glu 50 55 60ggg agg
gta aca agg ggg tcg gag cgc ttc cgg gac ctc gta ccc aac 240Gly Arg
Val Thr Arg Gly Ser Glu Arg Phe Arg Asp Leu Val Pro Asn 65 70 75
80tac aac ccc gac ata atc ttc aag gat gag gag aac agc ggc gca gac
288Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Ser Gly Ala Asp
85 90 95cgc ctg atg aca gag cgt tgc aaa gag cgg gtg aac gct cta gcc
atc 336Arg Leu Met Thr Glu Arg Cys Lys Glu Arg Val Asn Ala Leu Ala
Ile 100 105 110gcg gtg atg aac atg tgg ccc gga gta cgc cta cgt gtg
act gaa ggc 384Ala Val Met Asn Met Trp Pro Gly Val Arg Leu Arg Val
Thr Glu Gly 115 120 125tgg gac gag gac ggc cac cac gca cag gat tca
ctc cac tac gaa ggc 432Trp Asp Glu Asp Gly His His Ala Gln Asp Ser
Leu His Tyr Glu Gly 130 135 140cgt gcc ttg gac atc acc acg tct gac
cgt gac cgt aat aag tat ggt 480Arg Ala Leu Asp Ile Thr Thr Ser Asp
Arg Asp Arg Asn Lys Tyr Gly145 150 155 160ttg ttg gcg cgc cta gct
gtg gaa gcc gga ttc gac tgg gtc tac tac 528Leu Leu Ala Arg Leu Ala
Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175gag tcc cgc aac
cac atc cac gta tcg gtc aaa gct gat aac tca ctg 576Glu Ser Arg Asn
His Ile His Val Ser Val Lys Ala Asp Asn Ser Leu 180 185 190gcg gtc
cga gcc gga ggc tgc ttt ccg gga aat gcc acg gtg cgc ttg 624Ala Val
Arg Ala Gly Gly Cys Phe Pro Gly Asn Ala Thr Val Arg Leu 195 200
205cgg agc ggc gaa cgg aag ggg ctg agg gaa cta cat cgt ggt gac tgg
672Arg Ser Gly Glu Arg Lys Gly Leu Arg Glu Leu His Arg Gly Asp Trp
210 215 220gta ctg gcc gct gat gca gcg ggc cga gtg gta ccc acg cca
gtg ctg 720Val Leu Ala Ala Asp Ala Ala Gly Arg Val Val Pro Thr Pro
Val Leu225 230 235 240ctc ttc ctg gac cgg gat ctg cag cgc cgc gcc
tcg ttc gtg gct gtg 768Leu Phe Leu Asp Arg Asp Leu Gln Arg Arg Ala
Ser Phe Val Ala Val 245 250 255gag acc gag cgg cct ccg cgc aaa ctg
ttg ctc aca ccc tgg cat ctg 816Glu Thr Glu Arg Pro Pro Arg Lys Leu
Leu Leu Thr Pro Trp His Leu 260 265 270gtg ttc gct gct cgc ggg cca
gcg cct gct cca ggt gac ttt gca ccg 864Val Phe Ala Ala Arg Gly Pro
Ala Pro Ala Pro Gly Asp Phe Ala Pro 275 280 285gtg ttc gcg cgc cgc
tta cgt gct ggc gac tcg gtg ctg gct ccc ggc 912Val Phe Ala Arg Arg
Leu Arg Ala Gly Asp Ser Val Leu Ala Pro Gly 290 295 300ggg gac gcg
ctc cag ccg gcg cgc gta gcc cgc gtg gcg cgc gag gaa 960Gly Asp Ala
Leu Gln Pro Ala Arg Val Ala Arg Val Ala Arg Glu Glu305 310 315
320gcc gtg ggc gtg ttc gca ccg ctc act gcg cac ggg acg ctg ctg gtc
1008Ala Val Gly Val Phe Ala Pro Leu Thr Ala His Gly Thr Leu Leu Val
325 330 335aac gac gtc ctc gcc tcc tgc tac gcg gtt cta gag agt cac
cag tgg 1056Asn Asp Val Leu Ala Ser Cys Tyr Ala Val Leu Glu Ser His
Gln Trp 340 345 350gcc cac cgc gcc ttc gcc cct ttg cgg ctg ctg cac
gcg ctc ggg gct 1104Ala His Arg Ala Phe Ala Pro Leu Arg Leu Leu His
Ala Leu Gly Ala 355 360 365ctg ctc cct ggg ggt gca gtc cag ccg act
ggc atg cat tgg tac tct 1152Leu Leu Pro Gly Gly Ala Val Gln Pro Thr
Gly Met His Trp Tyr Ser 370 375 380cgc ctc ctt tac cgc ttg gcc gag
gag tta atg ggc tg 1190Arg Leu Leu Tyr Arg Leu Ala Glu Glu Leu Met
Gly385 390 39531281DNAMurine sp.CDS(1)..(1233) 3atg tct ccc gcc tgg
ctc cgg ccc cga ctg cgg ttc tgt ctg ttc ctg 48Met Ser Pro Ala Trp
Leu Arg Pro Arg Leu Arg Phe Cys Leu Phe Leu 1 5 10 15ctg ctg ctg
ctt ctg gtg ccg gcg gcg cgg ggc tgc ggg ccg ggc cgg 96Leu Leu Leu
Leu Leu Val Pro Ala Ala Arg Gly Cys Gly Pro Gly Arg 20 25 30gtg gtg
ggc agc cgc cgg agg ccg cct cgc aag ctc gtg cct ctt gcc 144Val Val
Gly Ser Arg Arg Arg Pro Pro Arg Lys Leu Val Pro Leu Ala 35 40 45tac
aag cag ttc agc ccc aac gtg ccg gag aag acc ctg ggc gcc agc 192Tyr
Lys Gln Phe Ser Pro Asn Val Pro Glu Lys Thr Leu Gly Ala Ser 50 55
60ggg cgc tac gaa ggc aag atc gcg cgc agc tct gag cgc ttc aaa gag
240Gly Arg Tyr Glu Gly Lys Ile Ala Arg Ser Ser Glu Arg Phe Lys Glu
65 70 75 80ctc acc ccc aac tac aat ccc gac atc atc ttc aag gac gag
gag aac 288Leu Thr Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu
Glu Asn 85 90 95acg ggt gcc gac cgc ctc atg acc cag cgc tgc aag gac
cgt ctg aac 336Thr Gly Ala Asp Arg Leu Met Thr Gln Arg Cys Lys Asp
Arg Leu Asn 100 105 110tca ctg gcc atc tct gtc atg aac cag tgg cct
ggt gtg aaa ctg cgg 384Ser Leu Ala Ile Ser Val Met Asn Gln Trp Pro
Gly Val Lys Leu Arg 115 120 125gtg acc gaa ggc cgg gat gaa gat ggc
cat cac tca gag gag tct tta 432Val Thr Glu Gly Arg Asp Glu Asp Gly
His His Ser Glu Glu Ser Leu 130 135 140cac tat gag ggc cgc gcg gtg
gat atc acc acc tca gac cgt gac cga 480His Tyr Glu Gly Arg Ala Val
Asp Ile Thr Thr Ser Asp Arg Asp Arg145 150 155 160aat aag tat gga
ctg ctg gcg cgc tta gca gtg gag gcc ggc ttc gac 528Asn Lys Tyr Gly
Leu Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp 165 170 175tgg gtg
tat tac gag tcc aag gcc cac gtg cat tgc tct gtc aag tct 576Trp Val
Tyr Tyr Glu Ser Lys Ala His Val His Cys Ser Val Lys Ser 180 185
190gag cat tcg gcc gct gcc aag aca ggt ggc tgc ttt cct gcc gga gcc
624Glu His Ser Ala Ala Ala Lys Thr Gly Gly Cys Phe Pro Ala Gly Ala
195 200 205cag gtg cgc cta gag aac ggg gag cgt gtg gcc ctg tca gct
gta aag 672Gln Val Arg Leu Glu Asn Gly Glu Arg Val Ala Leu Ser Ala
Val Lys 210 215 220cca gga gac cgg gtg ctg gcc atg ggg gag gat ggg
acc ccc acc ttc 720Pro Gly Asp Arg Val Leu Ala Met Gly Glu Asp Gly
Thr Pro Thr Phe225 230 235 240agt gat gtg ctt att ttc ctg gac cgc
gag cca aac cgg ctg aga gct 768Ser Asp Val Leu Ile Phe Leu Asp Arg
Glu Pro Asn Arg Leu Arg Ala 245 250 255ttc cag gtc atc gag act cag
gat cct ccg cgt cgg ctg gcg ctc acg 816Phe Gln Val Ile Glu Thr Gln
Asp Pro Pro Arg Arg Leu Ala Leu Thr 260 265 270cct gcc cac ctg ctc
ttc att gcg gac aat cat aca gaa cca gca gcc 864Pro Ala His Leu Leu
Phe Ile Ala Asp Asn His Thr Glu Pro Ala Ala 275 280 285cac ttc cgg
gcc aca ttt gcc agc cat gtg caa cca ggc caa tat gtg 912His Phe Arg
Ala Thr Phe Ala Ser His Val Gln Pro Gly Gln Tyr Val 290 295 300ctg
gta tca ggg gta cca ggc ctc cag cct gct cgg gtg gca gct gtc 960Leu
Val Ser Gly Val Pro Gly Leu Gln Pro Ala Arg Val Ala Ala Val305 310
315 320tcc acc cac gtg gcc ctt ggg tcc tat gct cct ctc aca agg cat
ggg 1008Ser Thr His Val Ala Leu Gly Ser Tyr Ala Pro Leu Thr Arg His
Gly 325 330 335aca ctt gtg gtg gag gat gtg gtg gcc tcc tgc ttt gca
gct gtg gct 1056Thr Leu Val Val Glu Asp Val Val Ala Ser Cys Phe Ala
Ala Val Ala 340 345 350gac cac cat ctg gct cag ttg gcc ttc tgg ccc
ctg cga ctg ttt ccc 1104Asp His His Leu Ala Gln Leu Ala Phe Trp Pro
Leu Arg Leu Phe Pro 355 360 365agt ttg gca tgg ggc agc tgg acc cca
agt gag ggt gtt cac tcc tac 1152Ser Leu Ala Trp Gly Ser Trp Thr Pro
Ser Glu Gly Val His Ser Tyr 370 375 380cct cag atg ctc tac cgc ctg
ggg cgt ctc ttg cta gaa gag agc acc 1200Pro Gln Met Leu Tyr Arg Leu
Gly Arg Leu Leu Leu Glu Glu Ser Thr385 390 395 400ttc cat cca ctg
ggc atg tct ggg gca gga agc tgaagggact ctaaccactg 1253Phe His Pro
Leu Gly Met Ser Gly Ala Gly Ser 405 410ccctcctgga actgctgtgc
gtggatcc 128141313DNAMurine sp.CDS(1)..(1311) 4atg ctg ctg ctg ctg
gcc aga tgt ttt ctg gtg atc ctt gct tcc tcg 48Met Leu Leu Leu Leu
Ala Arg Cys Phe Leu Val Ile Leu Ala Ser Ser 1 5 10 15ctg ctg gtg
tgc ccc ggg ctg gcc tgt ggg ccc ggc agg ggg ttt gga 96Leu Leu Val
Cys Pro Gly Leu Ala Cys Gly Pro Gly Arg Gly Phe Gly 20 25 30aag agg
cgg cac ccc aaa aag ctg acc cct tta gcc tac aag cag ttt 144Lys Arg
Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys Gln Phe 35 40 45att
ccc aac gta gcc gag aag acc cta ggg gcc agc ggc aga tat gaa 192Ile
Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg Tyr Glu 50 55
60ggg aag atc aca aga aac tcc gaa cga ttt aag gaa ctc acc ccc aat
240Gly Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr Pro Asn
65 70 75 80tac aac ccc gac atc ata ttt aag gat gag gaa aac acg gga
gca gac 288Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly
Ala Asp 85 90 95cgg ctg atg act cag agg tgc aaa gac aag tta aat gcc
ttg gcc atc 336Arg Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn Ala
Leu Ala Ile 100 105 110tct gtg atg aac cag tgg cct gga gtg agg ctg
cga gtg acc gag ggc 384Ser Val Met Asn Gln Trp Pro Gly Val Arg Leu
Arg Val Thr Glu Gly 115 120 125tgg gat gag gac ggc cat cat tca gag
gag tct cta cac tat gag ggt 432Trp Asp Glu Asp Gly His His Ser Glu
Glu Ser Leu His Tyr Glu Gly 130 135 140cga gca gtg gac atc acc acg
tcc gac cgg gac cgc agc aag tac ggc 480Arg Ala Val Asp Ile Thr Thr
Ser Asp Arg Asp Arg Ser Lys Tyr Gly145 150 155 160atg ctg gct cgc
ctg gct gtg gaa gca ggt ttc gac tgg gtc tac tat 528Met Leu Ala Arg
Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175gaa tcc
aaa gct cac atc cac tgt tct gtg aaa gca gag aac tcc gtg 576Glu Ser
Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val 180 185
190gcg gcc aaa tcc ggc ggc tgt ttc ccg gga tcc gcc acc gtg cac ctg
624Ala Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val His Leu
195 200 205gag cag ggc ggc acc aag ctg gtg aag gac tta cgt ccc gga
gac cgc 672Glu Gln Gly Gly Thr Lys Leu Val Lys Asp Leu Arg Pro Gly
Asp Arg 210 215 220gtg ctg gcg gct gac gac cag ggc cgg ctg ctg tac
agc gac ttc ctc 720Val Leu Ala Ala Asp Asp Gln Gly Arg Leu Leu Tyr
Ser Asp Phe Leu225 230 235 240acc ttc ctg gac cgc gac gaa ggc gcc
aag aag gtc ttc tac gtg atc 768Thr Phe Leu Asp Arg Asp Glu Gly Ala
Lys Lys Val Phe Tyr Val Ile 245 250 255gag acg ctg gag ccg cgc gag
cgc ctg ctg ctc acc gcc gcg cac ctg 816Glu Thr Leu Glu Pro Arg Glu
Arg Leu Leu Leu Thr Ala Ala His Leu 260 265 270ctc ttc gtg gcg ccg
cac aac gac tcg ggg ccc acg ccc ggg cca agc 864Leu Phe Val Ala Pro
His Asn Asp Ser Gly Pro Thr Pro Gly Pro Ser
275 280 285gcg ctc ttt gcc agc cgc gtg cgc ccc ggg cag cgc gtg tac
gtg gtg 912Ala Leu Phe Ala Ser Arg Val Arg Pro Gly Gln Arg Val Tyr
Val Val 290 295 300gct gaa cgc ggc ggg gac cgc cgg ctg ctg ccc gcc
gcg gtg cac agc 960Ala Glu Arg Gly Gly Asp Arg Arg Leu Leu Pro Ala
Ala Val His Ser305 310 315 320gtg acg ctg cga gag gag gag gcg ggc
gcg tac gcg ccg ctc acg gcg 1008Val Thr Leu Arg Glu Glu Glu Ala Gly
Ala Tyr Ala Pro Leu Thr Ala 325 330 335cac ggc acc att ctc atc aac
cgg gtg ctc gcc tcg tgc tac gct gtc 1056His Gly Thr Ile Leu Ile Asn
Arg Val Leu Ala Ser Cys Tyr Ala Val 340 345 350atc gag gag cac agc
tgg gca cac cgg gcc ttc gcg cct ttc cgc ctg 1104Ile Glu Glu His Ser
Trp Ala His Arg Ala Phe Ala Pro Phe Arg Leu 355 360 365gcg cac gcg
ctg ctg gcc gcg ctg gca ccc gcc cgc acg gac ggc ggg 1152Ala His Ala
Leu Leu Ala Ala Leu Ala Pro Ala Arg Thr Asp Gly Gly 370 375 380ggc
ggg ggc agc atc cct gca gcg caa tct gca acg gaa gcg agg ggc 1200Gly
Gly Gly Ser Ile Pro Ala Ala Gln Ser Ala Thr Glu Ala Arg Gly385 390
395 400gcg gag ccg act gcg ggc atc cac tgg tac tcg cag ctg ctc tac
cac 1248Ala Glu Pro Thr Ala Gly Ile His Trp Tyr Ser Gln Leu Leu Tyr
His 405 410 415att ggc acc tgg ctg ttg gac agc gag acc atg cat ccc
ttg gga atg 1296Ile Gly Thr Trp Leu Leu Asp Ser Glu Thr Met His Pro
Leu Gly Met 420 425 430gcg gtc aag tcc agc tg 1313Ala Val Lys Ser
Ser 43551256DNABrachydanio rerioCDS(1)..(1254) 5atg cgg ctt ttg acg
aga gtg ctg ctg gtg tct ctt ctc act ctg tcc 48Met Arg Leu Leu Thr
Arg Val Leu Leu Val Ser Leu Leu Thr Leu Ser 1 5 10 15ttg gtg gtg
tcc gga ctg gcc tgc ggt cct ggc aga ggc tac ggc aga 96Leu Val Val
Ser Gly Leu Ala Cys Gly Pro Gly Arg Gly Tyr Gly Arg 20 25 30aga aga
cat ccg aag aag ctg aca cct ctc gcc tac aag cag ttc ata 144Arg Arg
His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys Gln Phe Ile 35 40 45cct
aat gtc gcg gag aag acc tta ggg gcc agc ggc aga tac gag ggc 192Pro
Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg Tyr Glu Gly 50 55
60aag ata acg cgc aat tcg gag aga ttt aaa gaa ctt act cca aat tac
240Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr Pro Asn Tyr
65 70 75 80aat ccc gac att atc ttt aag gat gag gag aac acg gga gcg
gac agg 288Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly Ala
Asp Arg 85 90 95ctc atg aca cag aga tgc aaa gac aag ctg aac tcg ctg
gcc atc tct 336Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn Ser Leu
Ala Ile Ser 100 105 110gta atg aac cac tgg cca ggg gtt aag ctg cgt
gtg aca gag ggc tgg 384Val Met Asn His Trp Pro Gly Val Lys Leu Arg
Val Thr Glu Gly Trp 115 120 125gat gag gac ggt cac cat ttt gaa gaa
tca ctc cac tac gag gga aga 432Asp Glu Asp Gly His His Phe Glu Glu
Ser Leu His Tyr Glu Gly Arg 130 135 140gct gtt gat att acc acc tct
gac cga gac aag agc aaa tac ggg aca 480Ala Val Asp Ile Thr Thr Ser
Asp Arg Asp Lys Ser Lys Tyr Gly Thr145 150 155 160ctg tct cgc cta
gct gtg gag gct gga ttt gac tgg gtc tat tac gag 528Leu Ser Arg Leu
Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr Glu 165 170 175tcc aaa
gcc cac att cat tgc tct gtc aaa gca gaa aat tcg gtt gct 576Ser Lys
Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val Ala 180 185
190gcg aaa tct ggg ggc tgt ttc cca ggt tcg gct ctg gtc tcg ctc cag
624Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Leu Val Ser Leu Gln
195 200 205gac gga gga cag aag gcc gtg aag gac ctg aac ccc gga gac
aag gtg 672Asp Gly Gly Gln Lys Ala Val Lys Asp Leu Asn Pro Gly Asp
Lys Val 210 215 220ctg gcg gca gac agc gcg gga aac ctg gtg ttc agc
gac ttc atc atg 720Leu Ala Ala Asp Ser Ala Gly Asn Leu Val Phe Ser
Asp Phe Ile Met225 230 235 240ttc aca gac cga gac tcc acg acg cga
cgt gtg ttt tac gtc ata gaa 768Phe Thr Asp Arg Asp Ser Thr Thr Arg
Arg Val Phe Tyr Val Ile Glu 245 250 255acg caa gaa ccc gtt gaa aag
atc acc ctc acc gcc gct cac ctc ctt 816Thr Gln Glu Pro Val Glu Lys
Ile Thr Leu Thr Ala Ala His Leu Leu 260 265 270ttt gtc ctc gac aac
tca acg gaa gat ctc cac acc atg acc gcc gcg 864Phe Val Leu Asp Asn
Ser Thr Glu Asp Leu His Thr Met Thr Ala Ala 275 280 285tat gcc agc
agt gtc aga gcc gga caa aag gtg atg gtt gtt gat gat 912Tyr Ala Ser
Ser Val Arg Ala Gly Gln Lys Val Met Val Val Asp Asp 290 295 300agc
ggt cag ctt aaa tct gtc atc gtg cag cgg ata tac acg gag gag 960Ser
Gly Gln Leu Lys Ser Val Ile Val Gln Arg Ile Tyr Thr Glu Glu305 310
315 320cag cgg ggc tcg ttc gca cca gtg act gca cat ggg acc att gtg
gtc 1008Gln Arg Gly Ser Phe Ala Pro Val Thr Ala His Gly Thr Ile Val
Val 325 330 335gac aga ata ctg gcg tcc tgt tac gcc gta ata gag gac
cag ggg ctt 1056Asp Arg Ile Leu Ala Ser Cys Tyr Ala Val Ile Glu Asp
Gln Gly Leu 340 345 350gcg cat ttg gcc ttc gcg ccc gcc agg ctc tat
tat tac gtg tca tca 1104Ala His Leu Ala Phe Ala Pro Ala Arg Leu Tyr
Tyr Tyr Val Ser Ser 355 360 365ttc ctg tcc ccc aaa act cca gca gtc
ggt cca atg cga ctt tac aac 1152Phe Leu Ser Pro Lys Thr Pro Ala Val
Gly Pro Met Arg Leu Tyr Asn 370 375 380agg agg ggg tcc act ggt act
cca ggc tcc tgt cat caa atg gga acg 1200Arg Arg Gly Ser Thr Gly Thr
Pro Gly Ser Cys His Gln Met Gly Thr385 390 395 400tgg ctt ttg gac
agc aac atg ctt cat cct ttg ggg atg tca gta aac 1248Trp Leu Leu Asp
Ser Asn Met Leu His Pro Leu Gly Met Ser Val Asn 405 410 415tca agc
tg 1256Ser Ser61425DNAHomo
sapienCDS(1)..(1425)MOD_RES(1397)..(1389)a, t, c, g, other or
unknown 6atg ctg ctg ctg gcg aga tgt ctg ctg cta gtc ctc gtc tcc
tcg ctg 48Met Leu Leu Leu Ala Arg Cys Leu Leu Leu Val Leu Val Ser
Ser Leu 1 5 10 15ctg gta tgc tcg gga ctg gcg tgc gga ccg ggc agg
ggg ttc ggg aag 96Leu Val Cys Ser Gly Leu Ala Cys Gly Pro Gly Arg
Gly Phe Gly Lys 20 25 30agg agg cac ccc aaa aag ctg acc cct tta gcc
tac aag cag ttt atc 144Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala
Tyr Lys Gln Phe Ile 35 40 45ccc aat gtg gcc gag aag acc cta ggc gcc
agc gga agg tat gaa ggg 192Pro Asn Val Ala Glu Lys Thr Leu Gly Ala
Ser Gly Arg Tyr Glu Gly 50 55 60aag atc tcc aga aac tcc gag cga ttt
aag gaa ctc acc ccc aat tac 240Lys Ile Ser Arg Asn Ser Glu Arg Phe
Lys Glu Leu Thr Pro Asn Tyr 65 70 75 80aac ccc gac atc ata ttt aag
gat gaa gaa aac acc gga gcg gac agg 288Asn Pro Asp Ile Ile Phe Lys
Asp Glu Glu Asn Thr Gly Ala Asp Arg 85 90 95ctg atg act cag agg tgt
aag gac aag ttg aac gct ttg gcc atc tcg 336Leu Met Thr Gln Arg Cys
Lys Asp Lys Leu Asn Ala Leu Ala Ile Ser 100 105 110gtg atg aac cag
tgg cca gga gtg aaa ctg cgg gtg acc gag ggc tgg 384Val Met Asn Gln
Trp Pro Gly Val Lys Leu Arg Val Thr Glu Gly Trp 115 120 125gac gaa
gat ggc cac cac tca gag gag tct ctg cac tac gag ggc cgc 432Asp Glu
Asp Gly His His Ser Glu Glu Ser Leu His Tyr Glu Gly Arg 130 135
140gca gtg gac atc acc acg tct gac cgc gac cgc agc aag tac ggc atg
480Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Arg Ser Lys Tyr Gly
Met145 150 155 160ctg gcc cgc ctg gcg gtg gag gcc ggc ttc gac tgg
gtg tac tac gag 528Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp
Val Tyr Tyr Glu 165 170 175tcc aag gca cat atc cac tgc tcg gtg aaa
gca gag aac tcg gtg gcg 576Ser Lys Ala His Ile His Cys Ser Val Lys
Ala Glu Asn Ser Val Ala 180 185 190gcc aaa tcg gga ggc tgc ttc ccg
ggc tcg gcc acg gtg cac ctg gag 624Ala Lys Ser Gly Gly Cys Phe Pro
Gly Ser Ala Thr Val His Leu Glu 195 200 205cag ggc ggc acc aag ctg
gtg aag gac ctg agc ccc ggg gac cgc gtg 672Gln Gly Gly Thr Lys Leu
Val Lys Asp Leu Ser Pro Gly Asp Arg Val 210 215 220ctg gcg gcg gac
gac cag ggc cgg ctg ctc tac agc gac ttc ctc act 720Leu Ala Ala Asp
Asp Gln Gly Arg Leu Leu Tyr Ser Asp Phe Leu Thr225 230 235 240ttc
ctg gac cgc gac gac ggc gcc aag aag gtc ttc tac gtg atc gag 768Phe
Leu Asp Arg Asp Asp Gly Ala Lys Lys Val Phe Tyr Val Ile Glu 245 250
255acg cgg gag ccg cgc gag cgc ctg ctg ctc acc gcc gcg cac ctg ctc
816Thr Arg Glu Pro Arg Glu Arg Leu Leu Leu Thr Ala Ala His Leu Leu
260 265 270ttt gtg gcg ccg cac aac gac tcg gcc acc ggg gag ccc gag
gcg tcc 864Phe Val Ala Pro His Asn Asp Ser Ala Thr Gly Glu Pro Glu
Ala Ser 275 280 285tcg ggc tcg ggg ccg cct tcc ggg ggc gca ctg ggg
cct cgg gcg ctg 912Ser Gly Ser Gly Pro Pro Ser Gly Gly Ala Leu Gly
Pro Arg Ala Leu 290 295 300ttc gcc agc cgc gtg cgc ccg ggc cag cgc
gtg tac gtg gtg gcc gag 960Phe Ala Ser Arg Val Arg Pro Gly Gln Arg
Val Tyr Val Val Ala Glu305 310 315 320cgt gac ggg gac cgc cgg ctc
ctg ccc gcc gct gtg cac agc gtg acc 1008Arg Asp Gly Asp Arg Arg Leu
Leu Pro Ala Ala Val His Ser Val Thr 325 330 335cta agc gag gag gcc
gcg ggc gcc tac gcg ccg ctc acg gcc cag ggc 1056Leu Ser Glu Glu Ala
Ala Gly Ala Tyr Ala Pro Leu Thr Ala Gln Gly 340 345 350acc att ctc
atc aac cgg gtg ctg gcc tcg tgc tac gcg gtc atc gag 1104Thr Ile Leu
Ile Asn Arg Val Leu Ala Ser Cys Tyr Ala Val Ile Glu 355 360 365gag
cac agc tgg gcg cac cgg gcc ttc gcg ccc ttc cgc ctg gcg cac 1152Glu
His Ser Trp Ala His Arg Ala Phe Ala Pro Phe Arg Leu Ala His 370 375
380gcg ctc ctg gct gca ctg gcg ccc gcg cgc acg gac cgc ggc ggg gac
1200Ala Leu Leu Ala Ala Leu Ala Pro Ala Arg Thr Asp Arg Gly Gly
Asp385 390 395 400agc ggc ggc ggg gac cgc ggg ggc ggc ggc ggc aga
gta gcc cta acc 1248Ser Gly Gly Gly Asp Arg Gly Gly Gly Gly Gly Arg
Val Ala Leu Thr 405 410 415gct cca ggt gct gcc gac gct ccg ggt gcg
ggg gcc acc gcg ggc atc 1296Ala Pro Gly Ala Ala Asp Ala Pro Gly Ala
Gly Ala Thr Ala Gly Ile 420 425 430cac tgg tac tcg cag ctg ctc tac
caa ata ggc acc tgg ctc ctg gac 1344His Trp Tyr Ser Gln Leu Leu Tyr
Gln Ile Gly Thr Trp Leu Leu Asp 435 440 445agc gag gcc ctg cac ccg
ctg ggc atg gcg gtc aag tcc agc nnn agc 1392Ser Glu Ala Leu His Pro
Leu Gly Met Ala Val Lys Ser Ser Xaa Ser 450 455 460cgg ggg gcc ggg
gga ggg gcg cgg gag ggg gcc 1425Arg Gly Ala Gly Gly Gly Ala Arg Glu
Gly Ala465 470 47571622DNAHomo sapienCDS(51)..(1283) 7catcagccca
ccaggagacc tcgcccgccg ctcccccggg ctccccggcc atg tct 56 Met Ser 1ccc
gcc cgg ctc cgg ccc cga ctg cac ttc tgc ctg gtc ctg ttg ctg 104Pro
Ala Arg Leu Arg Pro Arg Leu His Phe Cys Leu Val Leu Leu Leu 5 10
15ctg ctg gtg gtg ccc gcg gca tgg ggc tgc ggg ccg ggt cgg gtg gtg
152Leu Leu Val Val Pro Ala Ala Trp Gly Cys Gly Pro Gly Arg Val Val
20 25 30ggc agc cgc cgg cga ccg cca cgc aaa ctc gtg ccg ctc gcc tac
aag 200Gly Ser Arg Arg Arg Pro Pro Arg Lys Leu Val Pro Leu Ala Tyr
Lys 35 40 45 50cag ttc agc ccc aat gtg ccc gag aag acc ctg ggc gcc
agc gga cgc 248Gln Phe Ser Pro Asn Val Pro Glu Lys Thr Leu Gly Ala
Ser Gly Arg 55 60 65tat gaa ggc aag atc gct cgc agc tcc gag cgc ttc
aag gag ctc acc 296Tyr Glu Gly Lys Ile Ala Arg Ser Ser Glu Arg Phe
Lys Glu Leu Thr 70 75 80ccc aat tac aat cca gac atc atc ttc aag gac
gag gag aac aca ggc 344Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp
Glu Glu Asn Thr Gly 85 90 95gcc gac cgc ctc atg acc cag cgc tgc aag
gac cgc ctg aac tcg ctg 392Ala Asp Arg Leu Met Thr Gln Arg Cys Lys
Asp Arg Leu Asn Ser Leu 100 105 110gct atc tcg gtg atg aac cag tgg
ccc ggt gtg aag ctg cgg gtg acc 440Ala Ile Ser Val Met Asn Gln Trp
Pro Gly Val Lys Leu Arg Val Thr115 120 125 130gag ggc tgg gac gag
gac ggc cac cac tca gag gag tcc ctg cat tat 488Glu Gly Trp Asp Glu
Asp Gly His His Ser Glu Glu Ser Leu His Tyr 135 140 145gag ggc cgc
gcg gtg gac atc acc aca tca gac cgc gac cgc aat aag 536Glu Gly Arg
Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Arg Asn Lys 150 155 160tat
gga ctg ctg gcg cgc ttg gca gtg gag gcc ggc ttt gac tgg gtg 584Tyr
Gly Leu Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val 165 170
175tat tac gag tca aag gcc cac gtg cat tgc tcc gtc aag tcc gag cac
632Tyr Tyr Glu Ser Lys Ala His Val His Cys Ser Val Lys Ser Glu His
180 185 190tcg gcc gca gcc aag acg ggc ggc tgc ttc cct gcc gga gcc
cag gta 680Ser Ala Ala Ala Lys Thr Gly Gly Cys Phe Pro Ala Gly Ala
Gln Val195 200 205 210cgc ctg gag agt ggg gcg cgt gtg gcc ttg tca
gcc gtg agg ccg gga 728Arg Leu Glu Ser Gly Ala Arg Val Ala Leu Ser
Ala Val Arg Pro Gly 215 220 225gac cgt gtg ctg gcc atg ggg gag gat
ggg agc ccc acc ttc agc gat 776Asp Arg Val Leu Ala Met Gly Glu Asp
Gly Ser Pro Thr Phe Ser Asp 230 235 240gtg ctc att ttc ctg gac cgc
gag ccc cac agg ctg aga gcc ttc cag 824Val Leu Ile Phe Leu Asp Arg
Glu Pro His Arg Leu Arg Ala Phe Gln 245 250 255gtc atc gag act cag
gac ccc cca cgc cgc ctg gca ctc aca ccc gct 872Val Ile Glu Thr Gln
Asp Pro Pro Arg Arg Leu Ala Leu Thr Pro Ala 260 265 270cac ctg ctc
ttt acg gct gac aat cac acg gag ccg gca gcc cgc ttc 920His Leu Leu
Phe Thr Ala Asp Asn His Thr Glu Pro Ala Ala Arg Phe275 280 285
290cgg gcc aca ttt gcc agc cac gtg cag cct ggc cag tac gtg ctg gtg
968Arg Ala Thr Phe Ala Ser His Val Gln Pro Gly Gln Tyr Val Leu Val
295 300 305gct ggg gtg cca ggc ctg cag cct gcc cgc gtg gca gct gtc
tct aca 1016Ala Gly Val Pro Gly Leu Gln Pro Ala Arg Val Ala Ala Val
Ser Thr 310 315 320cac gtg gcc ctc ggg gcc tac gcc ccg ctc aca aag
cat ggg aca ctg 1064His Val Ala Leu Gly Ala Tyr Ala Pro Leu Thr Lys
His Gly Thr Leu 325 330 335gtg gtg gag gat gtg gtg gca tcc tgc ttc
gcg gcc gtg gct gac cac 1112Val Val Glu Asp Val Val Ala Ser Cys Phe
Ala Ala Val Ala Asp His 340 345 350cac ctg gct cag ttg gcc ttc tgg
ccc ctg aga ctc ttt cac agc ttg 1160His Leu Ala Gln Leu Ala Phe Trp
Pro Leu Arg Leu Phe His Ser Leu355 360 365 370gca tgg ggc agc tgg
acc ccg ggg gag ggt gtg cat tgg tac ccc cag 1208Ala Trp Gly Ser Trp
Thr Pro Gly Glu Gly Val His Trp Tyr Pro Gln 375 380 385ctg ctc tac
cgc ctg ggg cgt ctc ctg cta gaa gag ggc agc ttc cac 1256Leu Leu Tyr
Arg Leu Gly Arg Leu Leu Leu Glu Glu Gly Ser Phe His 390 395 400cca
ctg ggc atg tcc ggg gca ggg agc tgaaaggact ccaccgctgc 1303Pro Leu
Gly Met Ser Gly Ala Gly Ser 405 410cctcctggaa ctgctgtact gggtccagaa
gcctctcagc caggagggag ctggccctgg 1363aagggacctg agctggggga
cactggctcc tgccatctcc tctgccatga agatacacca 1423ttgagacttg
actgggcaac accagcgtcc cccacccgcg tcgtggtgta gtcatagagc
1483tgcaagctga gctggcgagg ggatggttgt tgacccctct ctcctagaga
ccttgaggct 1543ggcacggcga ctcccaactc agcctgctct cactacgagt
tttcatactc tgcctccccc 1603attgggaggg cccattccc 162281190DNAHomo
sapienCDS(1)..(1188) 8atg gct ctc ctg acc aat cta ctg ccc ttg tgc
tgc ttg
gca ctt ctg 48Met Ala Leu Leu Thr Asn Leu Leu Pro Leu Cys Cys Leu
Ala Leu Leu 1 5 10 15gcg ctg cca gcc cag agc tgc ggg ccg ggc cgg
ggg ccg gtt ggc cgg 96Ala Leu Pro Ala Gln Ser Cys Gly Pro Gly Arg
Gly Pro Val Gly Arg 20 25 30cgc cgc tat gcg cgc aag cag ctc gtg ccg
cta ctc tac aag caa ttt 144Arg Arg Tyr Ala Arg Lys Gln Leu Val Pro
Leu Leu Tyr Lys Gln Phe 35 40 45gtg ccc ggc gtg cca gag cgg acc ctg
ggc gcc agt ggg cca gcg gag 192Val Pro Gly Val Pro Glu Arg Thr Leu
Gly Ala Ser Gly Pro Ala Glu 50 55 60ggg agg gtg gca agg ggc tcc gag
cgc ttc cgg gac ctc gtg ccc aac 240Gly Arg Val Ala Arg Gly Ser Glu
Arg Phe Arg Asp Leu Val Pro Asn 65 70 75 80tac aac ccc gac atc atc
ttc aag gat gag gag aac agt gga gcc gac 288Tyr Asn Pro Asp Ile Ile
Phe Lys Asp Glu Glu Asn Ser Gly Ala Asp 85 90 95cgc ctg atg acc gag
cgt tgc aag gag agg gtg aac gct ttg gcc att 336Arg Leu Met Thr Glu
Arg Cys Lys Glu Arg Val Asn Ala Leu Ala Ile 100 105 110gcc gtg atg
aac atg tgg ccc gga gtg cgc cta cga gtg act gag ggc 384Ala Val Met
Asn Met Trp Pro Gly Val Arg Leu Arg Val Thr Glu Gly 115 120 125tgg
gac gag gac ggc cac cac gct cag gat tca ctc cac tac gaa ggc 432Trp
Asp Glu Asp Gly His His Ala Gln Asp Ser Leu His Tyr Glu Gly 130 135
140cgt gct ttg gac atc act acg tct gac cgc gac cgc aac aag tat ggg
480Arg Ala Leu Asp Ile Thr Thr Ser Asp Arg Asp Arg Asn Lys Tyr
Gly145 150 155 160ttg ctg gcg cgc ctc gca gtg gaa gcc ggc ttc gac
tgg gtc tac tac 528Leu Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp
Trp Val Tyr Tyr 165 170 175gag tcc cgc aac cac gtc cac gtg tcg gtc
aaa gct gat aac tca ctg 576Glu Ser Arg Asn His Val His Val Ser Val
Lys Ala Asp Asn Ser Leu 180 185 190gcg gtc cgg gcg ggc ggc tgc ttt
ccg gga aat gca act gtg cgc ctg 624Ala Val Arg Ala Gly Gly Cys Phe
Pro Gly Asn Ala Thr Val Arg Leu 195 200 205tgg agc ggc gag cgg aaa
ggg ctg cgg gaa ctg cac cgc gga gac tgg 672Trp Ser Gly Glu Arg Lys
Gly Leu Arg Glu Leu His Arg Gly Asp Trp 210 215 220gtt ttg gcg gcc
gat gcg tca ggc cgg gtg gtg ccc acg ccg gtg ctg 720Val Leu Ala Ala
Asp Ala Ser Gly Arg Val Val Pro Thr Pro Val Leu225 230 235 240ctc
ttc ctg gac cgg gac ttg cag cgc cgg gct tca ttt gtg gct gtg 768Leu
Phe Leu Asp Arg Asp Leu Gln Arg Arg Ala Ser Phe Val Ala Val 245 250
255gag acc gag tgg cct cca cgc aaa ctg ttg ctc acg ccc tgg cac ctg
816Glu Thr Glu Trp Pro Pro Arg Lys Leu Leu Leu Thr Pro Trp His Leu
260 265 270gtg ttt gcc gct cga ggg ccg gcg ccc gcg cca ggc gac ttt
gca ccg 864Val Phe Ala Ala Arg Gly Pro Ala Pro Ala Pro Gly Asp Phe
Ala Pro 275 280 285gtg ttc gcg cgc cgg cta cgc gct ggg gac tcg gtg
ctg gcg ccc ggc 912Val Phe Ala Arg Arg Leu Arg Ala Gly Asp Ser Val
Leu Ala Pro Gly 290 295 300ggg gat gcg ctt cgg cca gcg cgc gtg gcc
cgt gtg gcg cgg gag gaa 960Gly Asp Ala Leu Arg Pro Ala Arg Val Ala
Arg Val Ala Arg Glu Glu305 310 315 320gcc gtg ggc gtg ttc gcg ccg
ctc acc gcg cac ggg acg ctg ctg gtg 1008Ala Val Gly Val Phe Ala Pro
Leu Thr Ala His Gly Thr Leu Leu Val 325 330 335aac gat gtc ctg gcc
tct tgc tac gcg gtt ctg gag agt cac cag tgg 1056Asn Asp Val Leu Ala
Ser Cys Tyr Ala Val Leu Glu Ser His Gln Trp 340 345 350gcg cac cgc
gct ttt gcc ccc ttg aga ctg ctg cac gcg cta ggg gcg 1104Ala His Arg
Ala Phe Ala Pro Leu Arg Leu Leu His Ala Leu Gly Ala 355 360 365ctg
ctc ccc ggc ggg gcc gtc cag ccg act ggc atg cat tgg tac tct 1152Leu
Leu Pro Gly Gly Ala Val Gln Pro Thr Gly Met His Trp Tyr Ser 370 375
380cgg ctc ctc tac cgc tta gcg gag gag cta ctg ggc tg 1190Arg Leu
Leu Tyr Arg Leu Ala Glu Glu Leu Leu Gly385 390
39591251DNABrachydanio rerioCDS(1)..(1248) 9atg gac gta agg ctg cat
ctg aag caa ttt gct tta ctg tgt ttt atc 48Met Asp Val Arg Leu His
Leu Lys Gln Phe Ala Leu Leu Cys Phe Ile 1 5 10 15agc ttg ctt ctg
acg cct tgt gga tta gcc tgt ggt cct ggt aga ggt 96Ser Leu Leu Leu
Thr Pro Cys Gly Leu Ala Cys Gly Pro Gly Arg Gly 20 25 30tat gga aaa
cga aga cac cca aag aaa tta acc ccg ttg gct tac aag 144Tyr Gly Lys
Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys 35 40 45caa ttc
atc ccc aac gtt gct gag aaa acg ctt gga gcc agc ggc aaa 192Gln Phe
Ile Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Lys 50 55 60tac
gaa ggc aaa atc aca agg aat tca gag aga ttt aaa gag ctg att 240Tyr
Glu Gly Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Ile 65 70
75 80ccg aat tat aat ccc gat atc atc ttt aag gac gag gaa aac aca
aac 288Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr
Asn 85 90 95gct gac agg ctg atg acc aag cgc tgt aag gac aag tta aat
tcg ttg 336Ala Asp Arg Leu Met Thr Lys Arg Cys Lys Asp Lys Leu Asn
Ser Leu 100 105 110gcc ata tcc gtc atg aac cac tgg ccc ggc gtg aaa
ctg cgc gtc act 384Ala Ile Ser Val Met Asn His Trp Pro Gly Val Lys
Leu Arg Val Thr 115 120 125gaa ggc tgg gat gag gat ggt cac cat tta
gaa gaa tct ttg cac tat 432Glu Gly Trp Asp Glu Asp Gly His His Leu
Glu Glu Ser Leu His Tyr 130 135 140gag gga cgg gca gtg gac atc act
acc tca gac agg gat aaa agc aag 480Glu Gly Arg Ala Val Asp Ile Thr
Thr Ser Asp Arg Asp Lys Ser Lys145 150 155 160tat ggg atg cta tcc
agg ctt gca gtg gag gca gga ttc gac tgg gtc 528Tyr Gly Met Leu Ser
Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val 165 170 175tat tat gaa
tct aaa gcc cac ata cac tgc tct gtc aaa gca gaa aat 576Tyr Tyr Glu
Ser Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn 180 185 190tca
gtg gct gct aaa tca gga gga tgt ttt cct ggg tct ggg acg gtg 624Ser
Val Ala Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Gly Thr Val 195 200
205aca ctt ggt gat ggg acg agg aaa ccc atc aaa gat ctt aaa gtg ggc
672Thr Leu Gly Asp Gly Thr Arg Lys Pro Ile Lys Asp Leu Lys Val Gly
210 215 220gac cgg gtt ttg gct gca gac gag aag gga aat gtc tta ata
agc gac 720Asp Arg Val Leu Ala Ala Asp Glu Lys Gly Asn Val Leu Ile
Ser Asp225 230 235 240ttt att atg ttt ata gac cac gat ccg aca acg
aga agg caa ttc atc 768Phe Ile Met Phe Ile Asp His Asp Pro Thr Thr
Arg Arg Gln Phe Ile 245 250 255gtc atc gag acg tca gaa cct ttc acc
aag ctc acc ctc act gcc gcg 816Val Ile Glu Thr Ser Glu Pro Phe Thr
Lys Leu Thr Leu Thr Ala Ala 260 265 270cac cta gtt ttc gtt gga aac
tct tca gca gct tcg ggt ata aca gca 864His Leu Val Phe Val Gly Asn
Ser Ser Ala Ala Ser Gly Ile Thr Ala 275 280 285aca ttt gcc agc aac
gtg aag cct gga gat aca gtt tta gtg tgg gaa 912Thr Phe Ala Ser Asn
Val Lys Pro Gly Asp Thr Val Leu Val Trp Glu 290 295 300gac aca tgc
gag agc ctc aag agc gtt aca gtg aaa agg att tac act 960Asp Thr Cys
Glu Ser Leu Lys Ser Val Thr Val Lys Arg Ile Tyr Thr305 310 315
320gag gag cac gag ggc tct ttt gcg cca gtc acc gcg cac gga acc ata
1008Glu Glu His Glu Gly Ser Phe Ala Pro Val Thr Ala His Gly Thr Ile
325 330 335ata gtg gat cag gtg ttg gca tcg tgc tac gcg gtc att gag
aac cac 1056Ile Val Asp Gln Val Leu Ala Ser Cys Tyr Ala Val Ile Glu
Asn His 340 345 350aaa tgg gca cat tgg gct ttt gcg ccg gtc agg ttg
tgt cac aag ctg 1104Lys Trp Ala His Trp Ala Phe Ala Pro Val Arg Leu
Cys His Lys Leu 355 360 365atg acg tgg ctt ttt ccg gct cgt gaa tca
aac gtc aat ttt cag gag 1152Met Thr Trp Leu Phe Pro Ala Arg Glu Ser
Asn Val Asn Phe Gln Glu 370 375 380gat ggt atc cac tgg tac tca aat
atg ctg ttt cac atc ggc tct tgg 1200Asp Gly Ile His Trp Tyr Ser Asn
Met Leu Phe His Ile Gly Ser Trp385 390 395 400ctg ctg gac aga gac
tct ttc cat cca ctc ggg att tta cac tta agt 1248Leu Leu Asp Arg Asp
Ser Phe His Pro Leu Gly Ile Leu His Leu Ser 405 410 415tga
125110425PRTGallus sp. 10Met Val Glu Met Leu Leu Leu Thr Arg Ile
Leu Leu Val Gly Phe Ile 1 5 10 15Cys Ala Leu Leu Val Ser Ser Gly
Leu Thr Cys Gly Pro Gly Arg Gly 20 25 30Ile Gly Lys Arg Arg His Pro
Lys Lys Leu Thr Pro Leu Ala Tyr Lys 35 40 45Gln Phe Ile Pro Asn Val
Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg 50 55 60Tyr Glu Gly Lys Ile
Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr 65 70 75 80Pro Asn Tyr
Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly 85 90 95Ala Asp
Arg Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn Ala Leu 100 105
110Ala Ile Ser Val Met Asn Gln Trp Pro Gly Val Lys Leu Arg Val Thr
115 120 125Glu Gly Trp Asp Glu Asp Gly His His Ser Glu Glu Ser Leu
His Tyr 130 135 140Glu Gly Arg Ala Val Asp Ile Thr Thr Ser Asp Arg
Asp Arg Ser Lys145 150 155 160Tyr Gly Met Leu Ala Arg Leu Ala Val
Glu Ala Gly Phe Asp Trp Val 165 170 175Tyr Tyr Glu Ser Lys Ala His
Ile His Cys Ser Val Lys Ala Glu Asn 180 185 190Ser Val Ala Ala Lys
Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val 195 200 205His Leu Glu
His Gly Gly Thr Lys Leu Val Lys Asp Leu Ser Pro Gly 210 215 220Asp
Arg Val Leu Ala Ala Asp Ala Asp Gly Arg Leu Leu Tyr Ser Asp225 230
235 240Phe Leu Thr Phe Leu Asp Arg Met Asp Ser Ser Arg Lys Leu Phe
Tyr 245 250 255Val Ile Glu Thr Arg Gln Pro Arg Ala Arg Leu Leu Leu
Thr Ala Ala 260 265 270His Leu Leu Phe Val Ala Pro Gln His Asn Gln
Ser Glu Ala Thr Gly 275 280 285Ser Thr Ser Gly Gln Ala Leu Phe Ala
Ser Asn Val Lys Pro Gly Gln 290 295 300Arg Val Tyr Val Leu Gly Glu
Gly Gly Gln Gln Leu Leu Pro Ala Ser305 310 315 320Val His Ser Val
Ser Leu Arg Glu Glu Ala Ser Gly Ala Tyr Ala Pro 325 330 335Leu Thr
Ala Gln Gly Thr Ile Leu Ile Asn Arg Val Leu Ala Ser Cys 340 345
350Tyr Ala Val Ile Glu Glu His Ser Trp Ala His Trp Ala Phe Ala Pro
355 360 365Phe Arg Leu Ala Gln Gly Leu Leu Ala Ala Leu Cys Pro Asp
Gly Ala 370 375 380Ile Pro Thr Ala Ala Thr Thr Thr Thr Gly Ile His
Trp Tyr Ser Arg385 390 395 400Leu Leu Tyr Arg Ile Gly Ser Trp Val
Leu Asp Gly Asp Ala Leu His 405 410 415Pro Leu Gly Met Val Ala Pro
Ala Ser 420 42511396PRTMurine sp. 11Met Ala Leu Pro Ala Ser Leu Leu
Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 15Ala Leu Ser Ala Gln Ser
Cys Gly Pro Gly Arg Gly Pro Val Gly Arg 20 25 30Arg Arg Tyr Val Arg
Lys Gln Leu Val Pro Leu Leu Tyr Lys Gln Phe 35 40 45Val Pro Ser Met
Pro Glu Arg Thr Leu Gly Ala Ser Gly Pro Ala Glu 50 55 60Gly Arg Val
Thr Arg Gly Ser Glu Arg Phe Arg Asp Leu Val Pro Asn 65 70 75 80Tyr
Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Ser Gly Ala Asp 85 90
95Arg Leu Met Thr Glu Arg Cys Lys Glu Arg Val Asn Ala Leu Ala Ile
100 105 110Ala Val Met Asn Met Trp Pro Gly Val Arg Leu Arg Val Thr
Glu Gly 115 120 125Trp Asp Glu Asp Gly His His Ala Gln Asp Ser Leu
His Tyr Glu Gly 130 135 140Arg Ala Leu Asp Ile Thr Thr Ser Asp Arg
Asp Arg Asn Lys Tyr Gly145 150 155 160Leu Leu Ala Arg Leu Ala Val
Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175Glu Ser Arg Asn His
Ile His Val Ser Val Lys Ala Asp Asn Ser Leu 180 185 190Ala Val Arg
Ala Gly Gly Cys Phe Pro Gly Asn Ala Thr Val Arg Leu 195 200 205Arg
Ser Gly Glu Arg Lys Gly Leu Arg Glu Leu His Arg Gly Asp Trp 210 215
220Val Leu Ala Ala Asp Ala Ala Gly Arg Val Val Pro Thr Pro Val
Leu225 230 235 240Leu Phe Leu Asp Arg Asp Leu Gln Arg Arg Ala Ser
Phe Val Ala Val 245 250 255Glu Thr Glu Arg Pro Pro Arg Lys Leu Leu
Leu Thr Pro Trp His Leu 260 265 270Val Phe Ala Ala Arg Gly Pro Ala
Pro Ala Pro Gly Asp Phe Ala Pro 275 280 285Val Phe Ala Arg Arg Leu
Arg Ala Gly Asp Ser Val Leu Ala Pro Gly 290 295 300Gly Asp Ala Leu
Gln Pro Ala Arg Val Ala Arg Val Ala Arg Glu Glu305 310 315 320Ala
Val Gly Val Phe Ala Pro Leu Thr Ala His Gly Thr Leu Leu Val 325 330
335Asn Asp Val Leu Ala Ser Cys Tyr Ala Val Leu Glu Ser His Gln Trp
340 345 350Ala His Arg Ala Phe Ala Pro Leu Arg Leu Leu His Ala Leu
Gly Ala 355 360 365Leu Leu Pro Gly Gly Ala Val Gln Pro Thr Gly Met
His Trp Tyr Ser 370 375 380Arg Leu Leu Tyr Arg Leu Ala Glu Glu Leu
Met Gly385 390 39512411PRTMurine sp. 12Met Ser Pro Ala Trp Leu Arg
Pro Arg Leu Arg Phe Cys Leu Phe Leu 1 5 10 15Leu Leu Leu Leu Leu
Val Pro Ala Ala Arg Gly Cys Gly Pro Gly Arg 20 25 30Val Val Gly Ser
Arg Arg Arg Pro Pro Arg Lys Leu Val Pro Leu Ala 35 40 45Tyr Lys Gln
Phe Ser Pro Asn Val Pro Glu Lys Thr Leu Gly Ala Ser 50 55 60Gly Arg
Tyr Glu Gly Lys Ile Ala Arg Ser Ser Glu Arg Phe Lys Glu 65 70 75
80Leu Thr Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn
85 90 95Thr Gly Ala Asp Arg Leu Met Thr Gln Arg Cys Lys Asp Arg Leu
Asn 100 105 110Ser Leu Ala Ile Ser Val Met Asn Gln Trp Pro Gly Val
Lys Leu Arg 115 120 125Val Thr Glu Gly Arg Asp Glu Asp Gly His His
Ser Glu Glu Ser Leu 130 135 140His Tyr Glu Gly Arg Ala Val Asp Ile
Thr Thr Ser Asp Arg Asp Arg145 150 155 160Asn Lys Tyr Gly Leu Leu
Ala Arg Leu Ala Val Glu Ala Gly Phe Asp 165 170 175Trp Val Tyr Tyr
Glu Ser Lys Ala His Val His Cys Ser Val Lys Ser 180 185 190Glu His
Ser Ala Ala Ala Lys Thr Gly Gly Cys Phe Pro Ala Gly Ala 195 200
205Gln Val Arg Leu Glu Asn Gly Glu Arg Val Ala Leu Ser Ala Val Lys
210 215 220Pro Gly Asp Arg Val Leu Ala Met Gly Glu Asp Gly Thr Pro
Thr Phe225 230 235 240Ser Asp Val Leu Ile Phe Leu Asp Arg Glu Pro
Asn Arg Leu Arg Ala 245 250 255Phe Gln Val Ile Glu Thr Gln Asp Pro
Pro Arg Arg Leu Ala Leu Thr 260 265 270Pro Ala His Leu Leu Phe Ile
Ala Asp Asn His Thr Glu Pro Ala Ala 275 280 285His Phe Arg Ala Thr
Phe Ala Ser His Val Gln Pro Gly Gln Tyr Val 290 295 300Leu Val Ser
Gly Val Pro Gly Leu Gln Pro Ala Arg Val Ala Ala Val305 310 315
320Ser Thr His Val Ala Leu Gly Ser Tyr Ala Pro Leu Thr Arg His Gly
325
330 335Thr Leu Val Val Glu Asp Val Val Ala Ser Cys Phe Ala Ala Val
Ala 340 345 350Asp His His Leu Ala Gln Leu Ala Phe Trp Pro Leu Arg
Leu Phe Pro 355 360 365Ser Leu Ala Trp Gly Ser Trp Thr Pro Ser Glu
Gly Val His Ser Tyr 370 375 380Pro Gln Met Leu Tyr Arg Leu Gly Arg
Leu Leu Leu Glu Glu Ser Thr385 390 395 400Phe His Pro Leu Gly Met
Ser Gly Ala Gly Ser 405 41013437PRTMurine sp. 13Met Leu Leu Leu Leu
Ala Arg Cys Phe Leu Val Ile Leu Ala Ser Ser 1 5 10 15Leu Leu Val
Cys Pro Gly Leu Ala Cys Gly Pro Gly Arg Gly Phe Gly 20 25 30Lys Arg
Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys Gln Phe 35 40 45Ile
Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg Tyr Glu 50 55
60Gly Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr Pro Asn
65 70 75 80Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr Gly
Ala Asp 85 90 95Arg Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn Ala
Leu Ala Ile 100 105 110Ser Val Met Asn Gln Trp Pro Gly Val Arg Leu
Arg Val Thr Glu Gly 115 120 125Trp Asp Glu Asp Gly His His Ser Glu
Glu Ser Leu His Tyr Glu Gly 130 135 140Arg Ala Val Asp Ile Thr Thr
Ser Asp Arg Asp Arg Ser Lys Tyr Gly145 150 155 160Met Leu Ala Arg
Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170 175Glu Ser
Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val 180 185
190Ala Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr Val His Leu
195 200 205Glu Gln Gly Gly Thr Lys Leu Val Lys Asp Leu Arg Pro Gly
Asp Arg 210 215 220Val Leu Ala Ala Asp Asp Gln Gly Arg Leu Leu Tyr
Ser Asp Phe Leu225 230 235 240Thr Phe Leu Asp Arg Asp Glu Gly Ala
Lys Lys Val Phe Tyr Val Ile 245 250 255Glu Thr Leu Glu Pro Arg Glu
Arg Leu Leu Leu Thr Ala Ala His Leu 260 265 270Leu Phe Val Ala Pro
His Asn Asp Ser Gly Pro Thr Pro Gly Pro Ser 275 280 285Ala Leu Phe
Ala Ser Arg Val Arg Pro Gly Gln Arg Val Tyr Val Val 290 295 300Ala
Glu Arg Gly Gly Asp Arg Arg Leu Leu Pro Ala Ala Val His Ser305 310
315 320Val Thr Leu Arg Glu Glu Glu Ala Gly Ala Tyr Ala Pro Leu Thr
Ala 325 330 335His Gly Thr Ile Leu Ile Asn Arg Val Leu Ala Ser Cys
Tyr Ala Val 340 345 350Ile Glu Glu His Ser Trp Ala His Arg Ala Phe
Ala Pro Phe Arg Leu 355 360 365Ala His Ala Leu Leu Ala Ala Leu Ala
Pro Ala Arg Thr Asp Gly Gly 370 375 380Gly Gly Gly Ser Ile Pro Ala
Ala Gln Ser Ala Thr Glu Ala Arg Gly385 390 395 400Ala Glu Pro Thr
Ala Gly Ile His Trp Tyr Ser Gln Leu Leu Tyr His 405 410 415Ile Gly
Thr Trp Leu Leu Asp Ser Glu Thr Met His Pro Leu Gly Met 420 425
430Ala Val Lys Ser Ser 43514418PRTBrachydanio rerio 14Met Arg Leu
Leu Thr Arg Val Leu Leu Val Ser Leu Leu Thr Leu Ser 1 5 10 15Leu
Val Val Ser Gly Leu Ala Cys Gly Pro Gly Arg Gly Tyr Gly Arg 20 25
30Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys Gln Phe Ile
35 40 45Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg Tyr Glu
Gly 50 55 60Lys Ile Thr Arg Asn Ser Glu Arg Phe Lys Glu Leu Thr Pro
Asn Tyr 65 70 75 80Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn Thr
Gly Ala Asp Arg 85 90 95Leu Met Thr Gln Arg Cys Lys Asp Lys Leu Asn
Ser Leu Ala Ile Ser 100 105 110Val Met Asn His Trp Pro Gly Val Lys
Leu Arg Val Thr Glu Gly Trp 115 120 125Asp Glu Asp Gly His His Phe
Glu Glu Ser Leu His Tyr Glu Gly Arg 130 135 140Ala Val Asp Ile Thr
Thr Ser Asp Arg Asp Lys Ser Lys Tyr Gly Thr145 150 155 160Leu Ser
Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr Glu 165 170
175Ser Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser Val Ala
180 185 190Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Leu Val Ser
Leu Gln 195 200 205Asp Gly Gly Gln Lys Ala Val Lys Asp Leu Asn Pro
Gly Asp Lys Val 210 215 220Leu Ala Ala Asp Ser Ala Gly Asn Leu Val
Phe Ser Asp Phe Ile Met225 230 235 240Phe Thr Asp Arg Asp Ser Thr
Thr Arg Arg Val Phe Tyr Val Ile Glu 245 250 255Thr Gln Glu Pro Val
Glu Lys Ile Thr Leu Thr Ala Ala His Leu Leu 260 265 270Phe Val Leu
Asp Asn Ser Thr Glu Asp Leu His Thr Met Thr Ala Ala 275 280 285Tyr
Ala Ser Ser Val Arg Ala Gly Gln Lys Val Met Val Val Asp Asp 290 295
300Ser Gly Gln Leu Lys Ser Val Ile Val Gln Arg Ile Tyr Thr Glu
Glu305 310 315 320Gln Arg Gly Ser Phe Ala Pro Val Thr Ala His Gly
Thr Ile Val Val 325 330 335Asp Arg Ile Leu Ala Ser Cys Tyr Ala Val
Ile Glu Asp Gln Gly Leu 340 345 350Ala His Leu Ala Phe Ala Pro Ala
Arg Leu Tyr Tyr Tyr Val Ser Ser 355 360 365Phe Leu Ser Pro Lys Thr
Pro Ala Val Gly Pro Met Arg Leu Tyr Asn 370 375 380Arg Arg Gly Ser
Thr Gly Thr Pro Gly Ser Cys His Gln Met Gly Thr385 390 395 400Trp
Leu Leu Asp Ser Asn Met Leu His Pro Leu Gly Met Ser Val Asn 405 410
415Ser Ser15475PRTHomo sapienMOD_RES(463)any or unknown amino acid
15Met Leu Leu Leu Ala Arg Cys Leu Leu Leu Val Leu Val Ser Ser Leu 1
5 10 15Leu Val Cys Ser Gly Leu Ala Cys Gly Pro Gly Arg Gly Phe Gly
Lys 20 25 30Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala Tyr Lys Gln
Phe Ile 35 40 45Pro Asn Val Ala Glu Lys Thr Leu Gly Ala Ser Gly Arg
Tyr Glu Gly 50 55 60Lys Ile Ser Arg Asn Ser Glu Arg Phe Lys Glu Leu
Thr Pro Asn Tyr 65 70 75 80Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu
Asn Thr Gly Ala Asp Arg 85 90 95Leu Met Thr Gln Arg Cys Lys Asp Lys
Leu Asn Ala Leu Ala Ile Ser 100 105 110Val Met Asn Gln Trp Pro Gly
Val Lys Leu Arg Val Thr Glu Gly Trp 115 120 125Asp Glu Asp Gly His
His Ser Glu Glu Ser Leu His Tyr Glu Gly Arg 130 135 140Ala Val Asp
Ile Thr Thr Ser Asp Arg Asp Arg Ser Lys Tyr Gly Met145 150 155
160Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr Glu
165 170 175Ser Lys Ala His Ile His Cys Ser Val Lys Ala Glu Asn Ser
Val Ala 180 185 190Ala Lys Ser Gly Gly Cys Phe Pro Gly Ser Ala Thr
Val His Leu Glu 195 200 205Gln Gly Gly Thr Lys Leu Val Lys Asp Leu
Ser Pro Gly Asp Arg Val 210 215 220Leu Ala Ala Asp Asp Gln Gly Arg
Leu Leu Tyr Ser Asp Phe Leu Thr225 230 235 240Phe Leu Asp Arg Asp
Asp Gly Ala Lys Lys Val Phe Tyr Val Ile Glu 245 250 255Thr Arg Glu
Pro Arg Glu Arg Leu Leu Leu Thr Ala Ala His Leu Leu 260 265 270Phe
Val Ala Pro His Asn Asp Ser Ala Thr Gly Glu Pro Glu Ala Ser 275 280
285Ser Gly Ser Gly Pro Pro Ser Gly Gly Ala Leu Gly Pro Arg Ala Leu
290 295 300Phe Ala Ser Arg Val Arg Pro Gly Gln Arg Val Tyr Val Val
Ala Glu305 310 315 320Arg Asp Gly Asp Arg Arg Leu Leu Pro Ala Ala
Val His Ser Val Thr 325 330 335Leu Ser Glu Glu Ala Ala Gly Ala Tyr
Ala Pro Leu Thr Ala Gln Gly 340 345 350Thr Ile Leu Ile Asn Arg Val
Leu Ala Ser Cys Tyr Ala Val Ile Glu 355 360 365Glu His Ser Trp Ala
His Arg Ala Phe Ala Pro Phe Arg Leu Ala His 370 375 380Ala Leu Leu
Ala Ala Leu Ala Pro Ala Arg Thr Asp Arg Gly Gly Asp385 390 395
400Ser Gly Gly Gly Asp Arg Gly Gly Gly Gly Gly Arg Val Ala Leu Thr
405 410 415Ala Pro Gly Ala Ala Asp Ala Pro Gly Ala Gly Ala Thr Ala
Gly Ile 420 425 430His Trp Tyr Ser Gln Leu Leu Tyr Gln Ile Gly Thr
Trp Leu Leu Asp 435 440 445Ser Glu Ala Leu His Pro Leu Gly Met Ala
Val Lys Ser Ser Xaa Ser 450 455 460Arg Gly Ala Gly Gly Gly Ala Arg
Glu Gly Ala465 470 47516411PRTHomo sapien 16Met Ser Pro Ala Arg Leu
Arg Pro Arg Leu His Phe Cys Leu Val Leu 1 5 10 15Leu Leu Leu Leu
Val Val Pro Ala Ala Trp Gly Cys Gly Pro Gly Arg 20 25 30Val Val Gly
Ser Arg Arg Arg Pro Pro Arg Lys Leu Val Pro Leu Ala 35 40 45Tyr Lys
Gln Phe Ser Pro Asn Val Pro Glu Lys Thr Leu Gly Ala Ser 50 55 60Gly
Arg Tyr Glu Gly Lys Ile Ala Arg Ser Ser Glu Arg Phe Lys Glu 65 70
75 80Leu Thr Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu
Asn 85 90 95Thr Gly Ala Asp Arg Leu Met Thr Gln Arg Cys Lys Asp Arg
Leu Asn 100 105 110Ser Leu Ala Ile Ser Val Met Asn Gln Trp Pro Gly
Val Lys Leu Arg 115 120 125Val Thr Glu Gly Trp Asp Glu Asp Gly His
His Ser Glu Glu Ser Leu 130 135 140His Tyr Glu Gly Arg Ala Val Asp
Ile Thr Thr Ser Asp Arg Asp Arg145 150 155 160Asn Lys Tyr Gly Leu
Leu Ala Arg Leu Ala Val Glu Ala Gly Phe Asp 165 170 175Trp Val Tyr
Tyr Glu Ser Lys Ala His Val His Cys Ser Val Lys Ser 180 185 190Glu
His Ser Ala Ala Ala Lys Thr Gly Gly Cys Phe Pro Ala Gly Ala 195 200
205Gln Val Arg Leu Glu Ser Gly Ala Arg Val Ala Leu Ser Ala Val Arg
210 215 220Pro Gly Asp Arg Val Leu Ala Met Gly Glu Asp Gly Ser Pro
Thr Phe225 230 235 240Ser Asp Val Leu Ile Phe Leu Asp Arg Glu Pro
His Arg Leu Arg Ala 245 250 255Phe Gln Val Ile Glu Thr Gln Asp Pro
Pro Arg Arg Leu Ala Leu Thr 260 265 270Pro Ala His Leu Leu Phe Thr
Ala Asp Asn His Thr Glu Pro Ala Ala 275 280 285Arg Phe Arg Ala Thr
Phe Ala Ser His Val Gln Pro Gly Gln Tyr Val 290 295 300Leu Val Ala
Gly Val Pro Gly Leu Gln Pro Ala Arg Val Ala Ala Val305 310 315
320Ser Thr His Val Ala Leu Gly Ala Tyr Ala Pro Leu Thr Lys His Gly
325 330 335Thr Leu Val Val Glu Asp Val Val Ala Ser Cys Phe Ala Ala
Val Ala 340 345 350Asp His His Leu Ala Gln Leu Ala Phe Trp Pro Leu
Arg Leu Phe His 355 360 365Ser Leu Ala Trp Gly Ser Trp Thr Pro Gly
Glu Gly Val His Trp Tyr 370 375 380Pro Gln Leu Leu Tyr Arg Leu Gly
Arg Leu Leu Leu Glu Glu Gly Ser385 390 395 400Phe His Pro Leu Gly
Met Ser Gly Ala Gly Ser 405 41017396PRTHomo sapien 17Met Ala Leu
Leu Thr Asn Leu Leu Pro Leu Cys Cys Leu Ala Leu Leu 1 5 10 15Ala
Leu Pro Ala Gln Ser Cys Gly Pro Gly Arg Gly Pro Val Gly Arg 20 25
30Arg Arg Tyr Ala Arg Lys Gln Leu Val Pro Leu Leu Tyr Lys Gln Phe
35 40 45Val Pro Gly Val Pro Glu Arg Thr Leu Gly Ala Ser Gly Pro Ala
Glu 50 55 60Gly Arg Val Ala Arg Gly Ser Glu Arg Phe Arg Asp Leu Val
Pro Asn 65 70 75 80Tyr Asn Pro Asp Ile Ile Phe Lys Asp Glu Glu Asn
Ser Gly Ala Asp 85 90 95Arg Leu Met Thr Glu Arg Cys Lys Glu Arg Val
Asn Ala Leu Ala Ile 100 105 110Ala Val Met Asn Met Trp Pro Gly Val
Arg Leu Arg Val Thr Glu Gly 115 120 125Trp Asp Glu Asp Gly His His
Ala Gln Asp Ser Leu His Tyr Glu Gly 130 135 140Arg Ala Leu Asp Ile
Thr Thr Ser Asp Arg Asp Arg Asn Lys Tyr Gly145 150 155 160Leu Leu
Ala Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr 165 170
175Glu Ser Arg Asn His Val His Val Ser Val Lys Ala Asp Asn Ser Leu
180 185 190Ala Val Arg Ala Gly Gly Cys Phe Pro Gly Asn Ala Thr Val
Arg Leu 195 200 205Trp Ser Gly Glu Arg Lys Gly Leu Arg Glu Leu His
Arg Gly Asp Trp 210 215 220Val Leu Ala Ala Asp Ala Ser Gly Arg Val
Val Pro Thr Pro Val Leu225 230 235 240Leu Phe Leu Asp Arg Asp Leu
Gln Arg Arg Ala Ser Phe Val Ala Val 245 250 255Glu Thr Glu Trp Pro
Pro Arg Lys Leu Leu Leu Thr Pro Trp His Leu 260 265 270Val Phe Ala
Ala Arg Gly Pro Ala Pro Ala Pro Gly Asp Phe Ala Pro 275 280 285Val
Phe Ala Arg Arg Leu Arg Ala Gly Asp Ser Val Leu Ala Pro Gly 290 295
300Gly Asp Ala Leu Arg Pro Ala Arg Val Ala Arg Val Ala Arg Glu
Glu305 310 315 320Ala Val Gly Val Phe Ala Pro Leu Thr Ala His Gly
Thr Leu Leu Val 325 330 335Asn Asp Val Leu Ala Ser Cys Tyr Ala Val
Leu Glu Ser His Gln Trp 340 345 350Ala His Arg Ala Phe Ala Pro Leu
Arg Leu Leu His Ala Leu Gly Ala 355 360 365Leu Leu Pro Gly Gly Ala
Val Gln Pro Thr Gly Met His Trp Tyr Ser 370 375 380Arg Leu Leu Tyr
Arg Leu Ala Glu Glu Leu Leu Gly385 390 39518416PRTBrachydanio rerio
18Met Asp Val Arg Leu His Leu Lys Gln Phe Ala Leu Leu Cys Phe Ile 1
5 10 15Ser Leu Leu Leu Thr Pro Cys Gly Leu Ala Cys Gly Pro Gly Arg
Gly 20 25 30Tyr Gly Lys Arg Arg His Pro Lys Lys Leu Thr Pro Leu Ala
Tyr Lys 35 40 45Gln Phe Ile Pro Asn Val Ala Glu Lys Thr Leu Gly Ala
Ser Gly Lys 50 55 60Tyr Glu Gly Lys Ile Thr Arg Asn Ser Glu Arg Phe
Lys Glu Leu Ile 65 70 75 80Pro Asn Tyr Asn Pro Asp Ile Ile Phe Lys
Asp Glu Glu Asn Thr Asn 85 90 95Ala Asp Arg Leu Met Thr Lys Arg Cys
Lys Asp Lys Leu Asn Ser Leu 100 105 110Ala Ile Ser Val Met Asn His
Trp Pro Gly Val Lys Leu Arg Val Thr 115 120 125Glu Gly Trp Asp Glu
Asp Gly His His Leu Glu Glu Ser Leu His Tyr 130 135 140Glu Gly Arg
Ala Val Asp Ile Thr Thr Ser Asp Arg Asp Lys Ser Lys145 150 155
160Tyr Gly Met Leu Ser Arg Leu Ala Val Glu Ala Gly Phe Asp Trp Val
165 170 175Tyr Tyr Glu Ser Lys Ala His Ile His Cys Ser Val Lys Ala
Glu Asn 180 185 190Ser Val Ala Ala Lys Ser Gly Gly Cys Phe Pro Gly
Ser Gly Thr Val 195 200 205Thr Leu Gly Asp Gly Thr Arg Lys Pro Ile
Lys Asp Leu Lys Val Gly 210 215 220Asp Arg Val Leu Ala Ala Asp Glu
Lys Gly Asn Val Leu Ile Ser Asp225 230 235
240Phe Ile Met Phe Ile Asp His Asp Pro Thr Thr Arg Arg Gln Phe Ile
245 250 255Val Ile Glu Thr Ser Glu Pro Phe Thr Lys Leu Thr Leu Thr
Ala Ala 260 265 270His Leu Val Phe Val Gly Asn Ser Ser Ala Ala Ser
Gly Ile Thr Ala 275 280 285Thr Phe Ala Ser Asn Val Lys Pro Gly Asp
Thr Val Leu Val Trp Glu 290 295 300Asp Thr Cys Glu Ser Leu Lys Ser
Val Thr Val Lys Arg Ile Tyr Thr305 310 315 320Glu Glu His Glu Gly
Ser Phe Ala Pro Val Thr Ala His Gly Thr Ile 325 330 335Ile Val Asp
Gln Val Leu Ala Ser Cys Tyr Ala Val Ile Glu Asn His 340 345 350Lys
Trp Ala His Trp Ala Phe Ala Pro Val Arg Leu Cys His Lys Leu 355 360
365Met Thr Trp Leu Phe Pro Ala Arg Glu Ser Asn Val Asn Phe Gln Glu
370 375 380Asp Gly Ile His Trp Tyr Ser Asn Met Leu Phe His Ile Gly
Ser Trp385 390 395 400Leu Leu Asp Arg Asp Ser Phe His Pro Leu Gly
Ile Leu His Leu Ser 405 410 415191416DNADrosophila
sp.CDS(1)..(1413) 19atg gat aac cac agc tca gtg cct tgg gcc agt gcc
gcc agt gtc acc 48Met Asp Asn His Ser Ser Val Pro Trp Ala Ser Ala
Ala Ser Val Thr 1 5 10 15tgt ctc tcc ctg gga tgc caa atg cca cag
ttc cag ttc cag ttc cag 96Cys Leu Ser Leu Gly Cys Gln Met Pro Gln
Phe Gln Phe Gln Phe Gln 20 25 30ctc caa atc cgc agc gag ctc cat ctc
cgc aag ccc gca aga aga acg 144Leu Gln Ile Arg Ser Glu Leu His Leu
Arg Lys Pro Ala Arg Arg Thr 35 40 45caa acg atg cgc cac att gcg cat
acg cag cgt tgc ctc agc agg ctg 192Gln Thr Met Arg His Ile Ala His
Thr Gln Arg Cys Leu Ser Arg Leu 50 55 60acc tct ctg gtg gcc ctg ctg
ctg atc gtc ttg ccg atg gtc ttt agc 240Thr Ser Leu Val Ala Leu Leu
Leu Ile Val Leu Pro Met Val Phe Ser 65 70 75 80ccg gct cac agc tgc
ggt cct ggc cga gga ttg ggt cgt cat agg gcg 288Pro Ala His Ser Cys
Gly Pro Gly Arg Gly Leu Gly Arg His Arg Ala 85 90 95cgc aac ctg tat
ccg ctg gtc ctc aag cag aca att ccc aat cta tcc 336Arg Asn Leu Tyr
Pro Leu Val Leu Lys Gln Thr Ile Pro Asn Leu Ser 100 105 110gag tac
acg aac agc gcc tcc gga cct ctg gag ggt gtg atc cgt cgg 384Glu Tyr
Thr Asn Ser Ala Ser Gly Pro Leu Glu Gly Val Ile Arg Arg 115 120
125gat tcg ccc aaa ttc aag gac ctc gtg ccc aac tac aac agg gac atc
432Asp Ser Pro Lys Phe Lys Asp Leu Val Pro Asn Tyr Asn Arg Asp Ile
130 135 140ctt ttc cgt gac gag gaa ggc acc gga gcg gat ggc ttg atg
agc aag 480Leu Phe Arg Asp Glu Glu Gly Thr Gly Ala Asp Gly Leu Met
Ser Lys145 150 155 160cgc tgc aag gag aag cta aac gtg ctg gcc tac
tcg gtg atg aac gaa 528Arg Cys Lys Glu Lys Leu Asn Val Leu Ala Tyr
Ser Val Met Asn Glu 165 170 175tgg ccc ggc atc cgg ctg ctg gtc acc
gag agc tgg gac gag gac tac 576Trp Pro Gly Ile Arg Leu Leu Val Thr
Glu Ser Trp Asp Glu Asp Tyr 180 185 190cat cac ggc cag gag tcg ctc
cac tac gag ggc cga gcg gtg acc att 624His His Gly Gln Glu Ser Leu
His Tyr Glu Gly Arg Ala Val Thr Ile 195 200 205gcc acc tcc gat cgc
gac cag tcc aaa tac ggc atg ctc gct cgc ctg 672Ala Thr Ser Asp Arg
Asp Gln Ser Lys Tyr Gly Met Leu Ala Arg Leu 210 215 220gcc gtc gag
gct gga ttc gat tgg gtc tcc tac gtc agc agg cgc cac 720Ala Val Glu
Ala Gly Phe Asp Trp Val Ser Tyr Val Ser Arg Arg His225 230 235
240atc tac tgc tcc gtc aag tca gat tcg tcg atc agt tcc cac gtg cac
768Ile Tyr Cys Ser Val Lys Ser Asp Ser Ser Ile Ser Ser His Val His
245 250 255ggc tgc ttc acg ccg gag agc aca gcg ctg ctg gag agt gga
gtc cgg 816Gly Cys Phe Thr Pro Glu Ser Thr Ala Leu Leu Glu Ser Gly
Val Arg 260 265 270aag ccg ctc ggc gag ctc tct atc gga gat cgt gtt
ttg agc atg acc 864Lys Pro Leu Gly Glu Leu Ser Ile Gly Asp Arg Val
Leu Ser Met Thr 275 280 285gcc aac gga cag gcc gtc tac agc gaa gtg
atc ctc ttc atg gac cgc 912Ala Asn Gly Gln Ala Val Tyr Ser Glu Val
Ile Leu Phe Met Asp Arg 290 295 300aac ctc gag cag atg caa aac ttt
gtg cag ctg cac acg gac ggt gga 960Asn Leu Glu Gln Met Gln Asn Phe
Val Gln Leu His Thr Asp Gly Gly305 310 315 320gca gtg ctc acg gtg
acg ccg gct cac ctg gtt agc gtt tgg cag ccg 1008Ala Val Leu Thr Val
Thr Pro Ala His Leu Val Ser Val Trp Gln Pro 325 330 335gag agc cag
aag ctc acg ttt gtg ttt gcg cat cgc atc gag gag aag 1056Glu Ser Gln
Lys Leu Thr Phe Val Phe Ala His Arg Ile Glu Glu Lys 340 345 350aac
cag gtg ctc gta cgg gat gtg gag acg ggc gag ctg agg ccc cag 1104Asn
Gln Val Leu Val Arg Asp Val Glu Thr Gly Glu Leu Arg Pro Gln 355 360
365cga gtg gtc aag ttg ggc agt gtg cgc agt aag ggc gtg gtc gcg ccg
1152Arg Val Val Lys Leu Gly Ser Val Arg Ser Lys Gly Val Val Ala Pro
370 375 380ctg acc cgc gag ggc acc att gtg gtc aac tcg gtg gcc gcc
agt tgc 1200Leu Thr Arg Glu Gly Thr Ile Val Val Asn Ser Val Ala Ala
Ser Cys385 390 395 400tat gcg gtg atc aac agt cag tcg ctg gcc cac
tgg gga ctg gct ccc 1248Tyr Ala Val Ile Asn Ser Gln Ser Leu Ala His
Trp Gly Leu Ala Pro 405 410 415atg cgc ctg ctg tcc acg ctg gag gcg
tgg ctg ccc gcc aag gag cag 1296Met Arg Leu Leu Ser Thr Leu Glu Ala
Trp Leu Pro Ala Lys Glu Gln 420 425 430ttg cac agt tcg ccg aag gtg
gtg agc tcg gcg cag cag cag aat ggc 1344Leu His Ser Ser Pro Lys Val
Val Ser Ser Ala Gln Gln Gln Asn Gly 435 440 445atc cat tgg tat gcc
aat gcg ctc tac aag gtc aag gac tac gtg ctg 1392Ile His Trp Tyr Ala
Asn Ala Leu Tyr Lys Val Lys Asp Tyr Val Leu 450 455 460ccg cag agc
tgg cgc cac gat tga 1416Pro Gln Ser Trp Arg His Asp465
47020471PRTDrosophila sp. 20Met Asp Asn His Ser Ser Val Pro Trp Ala
Ser Ala Ala Ser Val Thr 1 5 10 15Cys Leu Ser Leu Gly Cys Gln Met
Pro Gln Phe Gln Phe Gln Phe Gln 20 25 30Leu Gln Ile Arg Ser Glu Leu
His Leu Arg Lys Pro Ala Arg Arg Thr 35 40 45Gln Thr Met Arg His Ile
Ala His Thr Gln Arg Cys Leu Ser Arg Leu 50 55 60Thr Ser Leu Val Ala
Leu Leu Leu Ile Val Leu Pro Met Val Phe Ser 65 70 75 80Pro Ala His
Ser Cys Gly Pro Gly Arg Gly Leu Gly Arg His Arg Ala 85 90 95Arg Asn
Leu Tyr Pro Leu Val Leu Lys Gln Thr Ile Pro Asn Leu Ser 100 105
110Glu Tyr Thr Asn Ser Ala Ser Gly Pro Leu Glu Gly Val Ile Arg Arg
115 120 125Asp Ser Pro Lys Phe Lys Asp Leu Val Pro Asn Tyr Asn Arg
Asp Ile 130 135 140Leu Phe Arg Asp Glu Glu Gly Thr Gly Ala Asp Gly
Leu Met Ser Lys145 150 155 160Arg Cys Lys Glu Lys Leu Asn Val Leu
Ala Tyr Ser Val Met Asn Glu 165 170 175Trp Pro Gly Ile Arg Leu Leu
Val Thr Glu Ser Trp Asp Glu Asp Tyr 180 185 190His His Gly Gln Glu
Ser Leu His Tyr Glu Gly Arg Ala Val Thr Ile 195 200 205Ala Thr Ser
Asp Arg Asp Gln Ser Lys Tyr Gly Met Leu Ala Arg Leu 210 215 220Ala
Val Glu Ala Gly Phe Asp Trp Val Ser Tyr Val Ser Arg Arg His225 230
235 240Ile Tyr Cys Ser Val Lys Ser Asp Ser Ser Ile Ser Ser His Val
His 245 250 255Gly Cys Phe Thr Pro Glu Ser Thr Ala Leu Leu Glu Ser
Gly Val Arg 260 265 270Lys Pro Leu Gly Glu Leu Ser Ile Gly Asp Arg
Val Leu Ser Met Thr 275 280 285Ala Asn Gly Gln Ala Val Tyr Ser Glu
Val Ile Leu Phe Met Asp Arg 290 295 300Asn Leu Glu Gln Met Gln Asn
Phe Val Gln Leu His Thr Asp Gly Gly305 310 315 320Ala Val Leu Thr
Val Thr Pro Ala His Leu Val Ser Val Trp Gln Pro 325 330 335Glu Ser
Gln Lys Leu Thr Phe Val Phe Ala His Arg Ile Glu Glu Lys 340 345
350Asn Gln Val Leu Val Arg Asp Val Glu Thr Gly Glu Leu Arg Pro Gln
355 360 365Arg Val Val Lys Leu Gly Ser Val Arg Ser Lys Gly Val Val
Ala Pro 370 375 380Leu Thr Arg Glu Gly Thr Ile Val Val Asn Ser Val
Ala Ala Ser Cys385 390 395 400Tyr Ala Val Ile Asn Ser Gln Ser Leu
Ala His Trp Gly Leu Ala Pro 405 410 415Met Arg Leu Leu Ser Thr Leu
Glu Ala Trp Leu Pro Ala Lys Glu Gln 420 425 430Leu His Ser Ser Pro
Lys Val Val Ser Ser Ala Gln Gln Gln Asn Gly 435 440 445Ile His Trp
Tyr Ala Asn Ala Leu Tyr Lys Val Lys Asp Tyr Val Leu 450 455 460Pro
Gln Ser Trp Arg His Asp465 47021221PRTArtificial
SequenceDescription of Artificial Sequence degenerate polypeptide
sequence 21Cys Gly Pro Gly Arg Gly Xaa Gly Xaa Arg Arg His Pro Lys
Lys Leu 1 5 10 15Thr Pro Leu Ala Tyr Lys Gln Phe Ile Pro Asn Val
Ala Glu Lys Thr 20 25 30Leu Gly Ala Ser Gly Arg Tyr Glu Gly Lys Ile
Xaa Arg Asn Ser Glu 35 40 45Arg Phe Lys Glu Leu Thr Pro Asn Tyr Asn
Pro Asp Ile Ile Phe Lys 50 55 60Asp Glu Glu Asn Thr Gly Ala Asp Arg
Leu Met Thr Gln Arg Cys Lys 65 70 75 80Asp Lys Leu Asn Xaa Leu Ala
Ile Ser Val Met Asn Xaa Trp Pro Gly 85 90 95Val Xaa Leu Arg Val Thr
Glu Gly Trp Asp Glu Asp Gly His His Xaa 100 105 110Glu Glu Ser Leu
His Tyr Glu Gly Arg Ala Val Asp Ile Thr Thr Ser 115 120 125Asp Arg
Asp Xaa Ser Lys Tyr Gly Xaa Leu Xaa Arg Leu Ala Val Glu 130 135
140Ala Gly Phe Asp Trp Val Tyr Tyr Glu Ser Lys Ala His Ile His
Cys145 150 155 160Ser Val Lys Ala Glu Asn Ser Val Ala Ala Lys Ser
Gly Gly Cys Phe 165 170 175Pro Gly Ser Ala Xaa Val Xaa Leu Xaa Xaa
Gly Gly Xaa Lys Xaa Val 180 185 190Lys Asp Leu Xaa Pro Gly Asp Xaa
Val Leu Ala Ala Asp Xaa Xaa Gly 195 200 205Xaa Leu Xaa Xaa Ser Asp
Phe Xaa Xaa Phe Xaa Asp Arg 210 215 22022167PRTArtificial
SequenceDescription of Artificial Sequence degenerate polypeptide
sequence 22Cys Gly Pro Gly Arg Gly Xaa Xaa Xaa Arg Arg Xaa Xaa Xaa
Pro Lys 1 5 10 15Xaa Leu Xaa Pro Leu Xaa Tyr Lys Gln Phe Xaa Pro
Xaa Xaa Xaa Glu 20 25 30Xaa Thr Leu Gly Ala Ser Gly Xaa Xaa Glu Gly
Xaa Xaa Xaa Arg Xaa 35 40 45Ser Glu Arg Phe Xaa Xaa Leu Thr Pro Asn
Tyr Asn Pro Asp Ile Ile 50 55 60Phe Lys Asp Glu Glu Asn Xaa Gly Ala
Asp Arg Leu Met Thr Xaa Arg 65 70 75 80Cys Lys Xaa Xaa Xaa Asn Xaa
Leu Ala Ile Ser Val Met Asn Xaa Trp 85 90 95Pro Gly Val Xaa Leu Arg
Val Thr Glu Gly Xaa Asp Glu Asp Gly His 100 105 110His Xaa Xaa Xaa
Ser Leu His Tyr Glu Gly Arg Ala Xaa Asp Ile Thr 115 120 125Thr Ser
Asp Arg Asp Xaa Xaa Lys Tyr Gly Xaa Leu Xaa Arg Leu Ala 130 135
140Val Glu Ala Gly Phe Asp Trp Val Tyr Tyr Glu Ser Xaa Xaa His
Xaa145 150 155 160His Xaa Ser Val Lys Xaa Xaa 1652374DNAArtificial
SequenceDescription of Artificial Sequence primer 23gcgcgcttcg
aagcgaggca gccagcgagg gagagagcga gcgggcgagc cggagcgagg 60aaatcgatgc
gcgc 742474DNAArtificial SequenceDescription of Artificial Sequence
primer 24gcgcgcagat ctgggaaagc gcaagagaga gcgcacacgc acacacccgc
cgcgcgcact 60cgggatccgc gcgc 7425996DNAArtificial
SequenceDescription of Artificial Sequence gene activation
construct 25cgaagcgagg cagccagcga gggagagagc gagcgggcga gccggagcga
ggaaatcgaa 60ggttcgaatc cttcccccac caccatcact ttcaaaagtc cgaaagaatc
tgctccctgc 120ttgtgtgttg gaggtcgctg agtagtgcgc gagtaaaatt
taagctacaa caaggcaagg 180cttgaccgac aattgcatga agaatctgct
tagggttagg cgttttgcgc tgcttcgcga 240tgtacgggcc agatatacgc
gttgacattg attattgact agttattaat agtaatcaat 300tacggggtca
ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa
360tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa
tgacgtatgt 420tcccatagta acgccaatag ggactttcca ttgacgtcaa
tgggtggact atttacggta 480aactgcccac ttggcagtac atcaagtgta
tcatatgcca agtacgcccc ctattgacgt 540caatgacggt aaatggcccg
cctggcatta tgcccagtac atgaccttat gggactttcc 600tacttggcag
tacatctacg tattagtcat cgctattacc atggtgatgc ggttttggca
660gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc
tccaccccat 720tgacgtcaat gggagtttgt tttggcacca aaatcaacgg
gactttccaa aatgtcgtaa 780caactccgcc ccattgacgc aaatgggcgg
taggcgtgta cggtgggagg tctatataag 840cagagctctc tggctaacta
gagaacccac tgcttactgg cttatcgaaa ttaatacgac 900tcactatagg
gagacccaag cttggtaccg agctcggatc gatctgggaa agcgcaagag
960agagcgcaca cgcacacacc cgccgcgcgc actcgg 9962626DNAArtificial
SequenceDescription of Artificial Sequence antisense construct
26gtcctggcgc cgccgccgcc gtcgcc 262726DNAArtificial
SequenceDescription of Artificial Sequence antisense construct
27ttccgatgac cggcctttcg cggtga 262826DNAArtificial
SequenceDescription of Artificial Sequence antisense construct
28gtgcacggaa aggtgcaggc cacact 262915DNAArtificial
SequenceDescription of Artificial Sequence primer 29ggctccggta
tgtgc 153015DNAArtificial SequenceDescription of Artificial
Sequence primer 30ggggtacttc agggt 153125DNAArtificial
SequenceDescription of Artificial Sequence primer 31cattggcagg
aggagttgat tgtgg 253225DNAArtificial SequenceDescription of
Artificial Sequence primer 32agcacctttt gagtggagtt tgggg 25
* * * * *