U.S. patent application number 11/735944 was filed with the patent office on 2008-09-11 for methods for identifying compounds that modulate enzymatic activities by employing covalently bonded target-extender complexes with ligand candidates.
Invention is credited to Daniel A. Erianson, Stig Hansen, Robert S. McDowell.
Application Number | 20080220536 11/735944 |
Document ID | / |
Family ID | 29255201 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080220536 |
Kind Code |
A1 |
Erianson; Daniel A. ; et
al. |
September 11, 2008 |
Methods for Identifying Compounds that Modulate Enzymatic
Activities by Employing Covalently Bonded Target-Extender Complexes
with Ligand Candidates
Abstract
The present invention relates to the use of "tethering" to
identify compounds that modulate enzymatic activity.
Inventors: |
Erianson; Daniel A.; (San
Francisco, CA) ; McDowell; Robert S.; (San Francisco,
CA) ; Hansen; Stig; (El Cerrito, CA) |
Correspondence
Address: |
HELLER EHRMAN LLP
4350 La Jolla Village Drive, 7th Floor
San Diego
CA
92122
US
|
Family ID: |
29255201 |
Appl. No.: |
11/735944 |
Filed: |
April 16, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10374499 |
Feb 25, 2003 |
7214487 |
|
|
11735944 |
|
|
|
|
10121216 |
Apr 10, 2002 |
6998233 |
|
|
10374499 |
|
|
|
|
09981547 |
Oct 17, 2001 |
|
|
|
10121216 |
|
|
|
|
09105372 |
Jun 26, 1998 |
6335155 |
|
|
09981547 |
|
|
|
|
09990421 |
Nov 21, 2001 |
6919178 |
|
|
10121216 |
|
|
|
|
60377034 |
May 1, 2002 |
|
|
|
60252294 |
Nov 21, 2000 |
|
|
|
Current U.S.
Class: |
436/501 |
Current CPC
Class: |
G01N 33/573 20130101;
G01N 2500/02 20130101; G01N 2333/916 20130101; C07K 1/1072
20130101 |
Class at
Publication: |
436/501 |
International
Class: |
G01N 33/566 20060101
G01N033/566 |
Claims
1. A method comprising: a) providing a target having a reactive
thiol located outside of a site of interest; b) contacting the
target with an extender thereby forming a target-extender complex
wherein the extender comprises a first functionality that forms a
first covalent bond with the thiol and a second functionality that
is capable of forming a second covalent bond; c) contacting the
target-extender complex with a candidate ligand that comprises a
group that is capable of forming a second covalent bond with the
second functionality; d) forming a second covalent bond between the
target-extender complex and the candidate ligand thereby forming a
target-extender-ligand conjugate; and, e) identifying the candidate
ligand present in the target-extender-ligand conjugate; wherein at
least the second covalent bond formed is a disulfide bond.
2. (canceled)
3. A method for identifying a candidate ligand comprising: a)
providing a target having a first reactive nucleophile located
inside of a site of interest and a second reactive nucleophile
located outside of the site of interest; b) contacting the target
with an extender thereby forming a target-extender complex, the
extender comprising a first functionality and a latent second
functionality, a cleavable linker and a binding determinant wherein
the first functionality forms a first covalent bond with the second
reactive nucleophile and the binding determinant binds to the site
of interest; c) cleaving the extender at the cleavable linker
thereby forming a modified target-extender complex thereby exposing
the second functionality and releasing the binding determinant from
the site of interest; d) contacting the modified target-extender
complex with a candidate ligand that comprises a group that is
capable of forming a second covalent bond with the second
functionality; e) forming a second covalent bond between the
modified target-extender complex and the candidate ligand thereby
forming a target-extender-ligand conjugate; and, f) identifying the
candidate ligand present in the target-extender-ligand
conjugate.
4. (canceled)
5. The method of claim 1, wherein the first covalent bond formed is
a thioether bond and the second covalent bond is a disulfide bond,
whereby the target-extender-ligand complex formed has a thioether
bond between the target and extender and a disulfide bond between
the extender and the ligand candidate.
6. The method of claim 5, wherein the second functionality is a
disulfide.
7. The method of claim 5, wherein the second functionality is a
thioester.
8. The method of claim 1, wherein the first covalent bond formed is
a first disulfide bond and the second covalent bond formed is a
second disulfide bond, whereby the target-extender-ligand complex
formed has a first disulfide bond between the target and the
extender and a second disulfide bond between the extender and the
ligand candidate.
9. The method of claim 8, wherein the second functionality is a
disulfide.
10. The method of claim 8, wherein the second functionality is a
thioester.
11. The method of claim 1 wherein the extender includes a double or
triple bond adjacent to a carbonyl, imide, quinine, CN, NO.sub.2,
--S(.dbd.O)-- or vinyl sulfone.
12. The method of claim 1 wherein the extender is selected from the
group consisting of ##STR00075## where is a binding determinant and
R' is is H or --SR.sup.1 wherein R.sup.1 is where R.sup.1 is
unsubstituted C.sub.1-C.sub.10 aliphatic, substituted
C.sub.1-C.sub.10 aliphatic, unsubstituted aromatic or substituted
aromatic.
13. The method of claim 12 wherein is selected from the group
consisting of unsubstituted C.sub.1-C.sub.20 aliphatic, substituted
C.sub.1-C.sub.20 aliphatic, unsubstituted aryl and substituted
aryl.
14. The method of claim 1, wherein the reactive thiol on the target
is a naturally occurring --SH from a cysteine that is part of a
naturally occurring protein sequence.
15. The method of claim 1 wherein the reactive thiol on the target
is from a cysteine where mutagenesis was used to replace a
naturally occurring amino acid.
16. The method of claim 1 wherein the reactive thiol is a masked a
disulfide.
17. The method of claim 1 wherein the target-extender complex is
contacted with a candidate ligand in the presence of a reducing
agent.
18. The method of claim 17 wherein the reducing agent is selected
from the group consisting of: cysteine, cysteamine, dithiothreitol,
dithioerythritol, glutathione, 2-mercaptoethanol,
3-mercaptoproprionic acid, a phosphine and sodium borohydride.
19. A method comprising: a) providing a target having a reactive
nucleophile located outside of a site of interest; b) contacting
the target with an extender thereby forming a target-extender
complex wherein the extender comprises a first functionality that
reacts with the nucleophile in the target to form a covalent bond
with the nucleophile and a second functionality that is capable of
forming a disulfide bond, wherein the extender is selected from the
group consisting of ##STR00076## where is a binding determinant and
R' is is H or --SR.sup.1 wherein R.sup.1 is is selected from the
group consisting of unsubstituted C.sub.1-C.sub.10 aliphatic,
substituted C.sub.1-C.sub.10 aliphatic, unsubstituted aromatic or
substituted aromatic; c) contacting the target-extender complex
with a candidate ligand that comprises a group that is capable of
forming a disulfide bond; d) forming a disulfide bond between the
target-extender complex and the candidate ligand thereby forming a
target-extender-ligand conjugate; and e) identifying the candidate
ligand present in the target-extender-ligand conjugate.
20. The method of claim 19 wherein the candidate ligand present in
the target-extender-ligand conjugage is identified using mass
spectrometry.
21. The method of claim 19 wherein the candidate ligand present in
the target-extender-ligand conjugage is identified using a labeled
probe.
22. The method of claim 19 wherein the candidate ligand present in
the target-extender-ligand conjugage is identified using a
functional assay.
23. The method of claim 19 wherein the candidate ligand present in
the target-extender-ligand conjugage is identified using
chromatography.
24. A method comprising: a) providing a target having a first
reactive thiol located inside of a site of interest and a second
reactive thiol located outside of the site of interest; b)
contacting the target with an extender thereby forming a
target-extender complex, the extender comprising a first
functionality and a latent second functionality, a cleavable linker
and a binding determinant wherein the first functionality forms a
thioether bond with the second reactive thiol and the binding
determinant binds to the site of interest; c) cleaving the extender
at the cleavable linker thereby forming a modified target-extender
complex by exposing the second functionality and releasing the
binding determinant from the site of interest; d) contacting the
modified target-extender complex with a candidate ligand that
comprises a group that is capable of forming a disulfide bond with
the second functionality; e) forming a disulfide bond between the
modified target-extender complex and the candidate ligand thereby
forming a target-extender-ligand conjugate; and f) identifying the
candidate ligand present in the target-extender-ligand
conjugate.
25. The method of claim 24 wherein the extender includes a double
or triple bond adjacent to a carbonyl, imide, quinine, CN,
NO.sub.2, --S(.dbd.O)-- or vinyl sulfone.
26. The method of claim 24 wherein the extender is selected from
the group consisting of ##STR00077## where is the binding
determinant and R' is is H or --SR.sup.1 wherein R.sup.1 is
selected from the group consisting of unsubstituted
C.sub.1-C.sub.10 aliphatic, substituted C.sub.1-C.sub.10 aliphatic,
unsubstituted aromatic and substituted aromatic.
27. The method of claim 26 wherein is selected from the group
consisting of unsubstituted C.sub.1-C.sub.20 aliphatic, substituted
C.sub.1-C.sub.20 aliphatic, unsubstituted aryl and substituted
aryl.
Description
[0001] This is a continuation of application Ser. No. 10/374,499,
filed Feb. 25, 2003, the entire disclosure of which is hereby
expressly incorporated by reference.
BACKGROUND
[0002] The drug discovery process usually begins with massive
functional screening of compound libraries to identify modest
affinity leads for subsequent medicinal chemistry optimization.
However, not all targets of interest are amenable to such
screening. In some cases, an assay that is amenable to high
throughput screening is not available. In other cases, the target
can have multiple binding modes such that any result from such
screens is ambiguous and difficult to interpret. Still in other
cases, the assay conditions for high throughput assays are such
that they are prone to artifacts. As a result, alternative methods
for ligand discovery are needed that do not necessarily rely on
functional screens.
DESCRIPTION OF THE FIGURES
[0003] FIG. 1 is a schematic illustration of one embodiment of the
tethering method.
[0004] FIG. 2 is a schematic illustration of another embodiment of
the tethering method.
[0005] FIG. 3 is one embodiment of an alignment of the first 298
residues of PTP-1B (SEQ ID NO: 7) and the corresponding residues
for TC-PTP (SEQ ID NO: 8) and LAR (SEQ ID NO: 9). All three PTPs
are human versions of the enzymes.
[0006] FIG. 4 is the mass spectrum of the R47C mutant of PTP-1B
that is modified with an extender comprising a first functionality,
a cleaveable linker with a latent second functionality and a
phosphotyrosine mimetic. FIG. 4A is the spectrum for the R47 mutant
of PTP-1B. FIG. 4B is the specturm for the R47 mutant of PTP-1B
that has been modified with the extender wherein a covalent bond is
formed between the thiol (on residue 47 and the first
functionality). This complex is referred to as the PTP-1B-extender
complex. FIG. 4C is the spectrum wherein the cleavable linker is
cleaved thereby exposing the second functionality (in this case a
thiol) and releasing the phosphotyrosine mimetic. This complex is
referred to as the modified PTP-1B-extender complex.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0007] The present invention relates to the use of "tethering" to
identify compounds that modulate enzymatic activity.
[0008] Unless defined otherwise, technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
References, such as Singleton et al., Dictionary of Microbiology
and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y.
1994), and March, Advanced Organic Chemistry Reactions, Mechanisms
and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992),
provide one skilled in the art with a general guide to many of the
terms used in the present application.
[0009] In one aspect of the present invention, compounds are
provided. Unless explicitly or implicitly indicated otherwise,
these compounds can be in the form of an individual enantiomer,
diasteromer, geometric isomer, or mixtures thereof. In the case of
compounds containing double bonds, these double bonds can be either
Z or E or a mixture thereof, unless otherwise indicated.
DEFINITIONS
[0010] The definition of terms used herein include:
[0011] The term "aliphatic" or "unsubstituted aliphatic" refers to
a straight, branched, cyclic, or polycyclic hydrocarbon and
includes alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and
cycloalkynyl moieties.
[0012] The term "alkyl" or "unsubstituted alkyl" refers to a
saturated hydrocarbon.
[0013] The term "alkenyl" or "unsubstituted alkenyl" refers to a
hydrocarbon with at least one carbon-carbon double bond.
[0014] The term "alkynyl" or "unsubstituted alkynyl" refers to a
hydrocarbon with at least one carbon-carbon triple bond.
[0015] The term "aromatic" or "unsubstituted aromatic" refers to
moieties having at least one aryl group. The term also includes
aliphatic modified aryls such as alkylaryls and the like.
[0016] The term "aryl" or "unsubstituted aryl" refers to mono or
polycyclic unsaturated moieties having at least one aromatic ring.
The term includes heteroaryls that include one or more heteroatoms
within the at least one aromatic ring. Illustrative examples of
aromatics include: phenyl, naphthyl, tetrahydronaphthyl, indanyl,
indenyl, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl,
imidazolyl, thiazolyl, oxazolyl, isooxazoly, thiadiazolyl,
oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, and
the like.
[0017] The term "substituted" when used to modify a moiety refers
to a substituted version of the moiety where at least one hydrogen
atom is substituted with another group including but not limited
to: aliphatic; aryl, alkylaryl, F, Cl, I, Br, --OH; --NO.sub.2;
--CN; --CF.sub.3; --CH.sub.2CF.sub.3; --CH.sub.2Cl; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --OR.sup.x; --C(O)R.sup.x;
--COOR.sup.x; --C(O)N(R.sup.x).sub.2; --OC(O)R.sup.x;
--OCOOR.sup.x; --OC(O)N(R.sup.x).sub.2; --N(R.sup.x).sub.2;
--S(O).sub.2R.sup.x; and --NR.sup.xC(O)R.sup.x where each
occurrence of R.sup.x is independently hydrogen, substituted
aliphatic, unsubstituted aliphatic, substituted aryl, or
unsubstituted aryl. Additionally, substitutions at adjacent groups
on a moiety can together form a cyclic group.
[0018] The term "ligand candidate" or "candidate ligand" refers to
a compound that possesses or has been modified to possess a
reactive group that is capable of forming a covalent bond with a
complimentary or compatible reactive group on a target enzyme. The
reactive group on either the ligand candidate or the target enzyme
can be masked with, for example, a protecting group.
[0019] The phrase "protected thiol" or "masked thiol" as used
herein refers to a thiol that has been reacted with a group or
molecule to form a covalent bond that renders it less reactive and
which may be deprotected to regenerate a free thiol.
[0020] The phrase "reversible covalent bond" as used herein refers
to a covalent bond that can be broken, preferably under conditions
that do not denature the target. Examples include, without
limitation, disulfides, Schiff-bases, thioesters, coordination
complexes, boronate esters, and the like.
[0021] The phrase "reactive group" is a chemical group or moiety
providing a site at which a covalent bond can be made when
presented with a compatible or complementary reactive group.
Illustrative examples are --SH that can react with another --SH or
--SS-- to form a disulfide; an --NH.sub.2 that can react with an
activated --COOH to form an amide; an --NH.sub.2 that can react
with an aldehyde or ketone to form a Schiff base and the like.
[0022] The phrase "reactive nucleophile" as used herein refers to a
nucleophile that is capable of forming a covalent bond with a
compatible functional group on another molecule under conditions
that do not denature or damage the target enzyme. The most relevant
nucleophiles are thiols, alcohols, and amines.
[0023] The phrase "site of interest" refers to any site on a target
enzyme in which a ligand can bind.
The Tethering Method
[0024] Tethering is a method of ligand identification that relies
upon the formation of a covalent bond between a reactive group on a
target and a complimentary reactive group on a potential ligand.
The tethering method is described in U.S. Pat. No. 6,335,155; PCT
Publication Nos. WO 00/00823 and WO 02/42773; U.S. Ser. No.
10/121,216 entitled METHODS FOR LIGAND DISCOVERY by inventors
Daniel Erlanson, Andrew Braisted, and James Wells (corresponding
PCT Application No. US02/13061); and Erlanson et al., Proc. Nat.
Acad. Sci USA 97:9367-9372 (2000), which are all incorporated by
reference. The resulting covalent complex is termed a target-ligand
conjugate. Because the covalent bond is formed at a pre-determined
site on the target (e.g., a native or non-native cysteine), the
stoichiometry and binding location are known for ligands that are
identified by this method.
[0025] Once formed, the ligand portion of the target-ligand
conjugate can be identified using a number of methods. In preferred
embodiments, mass spectrometry is used. Mass spectrometry detects
molecules based on mass-to-charge ratio (m/z) and can resolve
molecules based on their sizes (reviewed in Yates, Trends Genet.
16: 5-8 [2000]). The target-ligand can be detected directly in the
mass spectrometer or fragmented prior to detection. Alternatively,
the compound can be liberated within the mass spectrophotometer and
subsequently identified. Moreover, mass spectrometry can be used
alone or in combination with other means for detection or
identifying the compounds covalently bound to the target. Further
descriptions of mass spectrometry techniques include Fitzgerald and
Siuzdak, Chemistry & Biology 3: 707-715 [1996]; Chu et al., J.
Am. Chem. Soc. 118: 7827-7835 [1996]; Siudzak, Proc. Natl. Acad
Sci. USA 91: 11290-11297 [1994]; Burlingame et al., Anal. Chem. 68:
599R-651R [1996]; Wu et al., Chemistry & Biology 4: 653-657
[1997]; and Loo et al., Am. Reports Med. Chem. 31: 319-325
[1996]).
[0026] Alternatively, the target-compound conjugate can be
identified using other means. For example, one can employ various
chromatographic techniques such as liquid chromatography, thin
layer chromatography and the like for separation of the components
of the reaction mixture so as to enhance the ability to identify
the covalently bound molecule. Such chromatographic techniques can
be employed in combination with mass spectrometry or separate from
mass spectrometry. One can also couple a labeled probe
(fluorescently, radioactively, or otherwise) to the liberated
compound so as to facilitate its identification using any of the
above techniques. In yet another embodiment, the formation of the
new bonds liberates a labeled probe, which can then be monitored. A
simple functional assay, such as an ELISA or enzymatic assay can
also be used to detect binding when binding occurs in an area
essential for what the assay measures. Other techniques that may
find use for identifying the organic compound bound to the target
molecule include, for example, nuclear magnetic resonance (NMR),
surface plasmon resonance (e.g., BIACORE), capillary
electrophoresis, X-ray crystallography, and the like, all of which
will be well known to those skilled in the art.
The Present Invention
[0027] The present invention relates to a form of tethering that
relies on the use of an extender that is attached to a target
outside of a target's site of interest. Because the extender is
attached to the target outside of the site of interest, the
potential for structural or functional perturbation within the site
of interest is minimized. In addition, target mutants can be
assessed for structural and functional integrity using functional
screens.
[0028] In one aspect of the present invention, a method is provided
comprising:
[0029] a) providing a target having a reactive nucleophile located
outside of a site of interest;
[0030] b) contacting the target with an extender thereby forming a
target-extender complex wherein the extender comprises a first
functionality that forms a first covalent bond with the nucleophile
and a second functionality that is capable of forming a second
covalent bond;
[0031] c) contacting the target-extender complex with a candidate
ligand that comprises a group that is capable of forming a second
covalent bond with the second functionality;
[0032] d) forming a second covalent bond between the
target-extender complex and the candidate ligand thereby forming a
target-extender-ligand conjugate; and,
[0033] e) identifying the candidate ligand present in the
target-extender-ligand conjugate.
[0034] In one embodiment, the target comprises a --OH as the
reactive nucleophile and the extender comprises a first
functionality that is capable of forming a covalent bond with the
reactive nucleophile on the target and a second functionality that
is capable of forming a disulfide bond. In another embodiment, the
reactive nucleophile on the target is a --OH from a serine,
threonine, or tyrosine that is part of the naturally occurring
protein sequence. In another embodiment, the reactive nucleophile
on the target is an engineered --OH group where mutagenesis was
used to mutate a naturally occurring amino acid to a serine,
threonine, or tyrosine. In another embodiment, the first
functionality of the extender is a boronic acid and the second
functionality is a --SH or a masked --SH. An illustration of a
masked disulfide is a thioester of the formula --SC(.dbd.O)R.sup.1
or a disulfide of the formula --SSR.sup.1 where R.sup.1 is
unsubstituted C.sub.1-C.sub.10 aliphatic, substituted
C.sub.1-C.sub.10 aliphatic, unsubstituted aromatic, or substituted
aromatic. In one embodiment, the masked disulfide is a thioester of
the formula --SC(.dbd.O)R.sup.1 where R.sup.1 is C.sub.1-C.sub.10
alkyl. In another embodiment, the masked thiol is a disulfide of
the formula --SSR.sup.2R.sup.3 where R.sup.2 is C.sub.1-C.sub.5
alkyl and R.sup.3 is NH.sub.2, OH, or COOH. In another embodiment,
the masked thiol is a disulfide of the formula
--SSCH.sub.2CH.sub.2OH. In yet another embodiment, the masked thiol
is a disulfide of the formula --SSCH.sub.2CH.sub.2NH.sub.2.
[0035] In another embodiment, the target comprises a --SH as the
reactive nucleophile and the extender comprises a first
functionality that is capable of forming a covalent bond with the
reactive nucleophile on the target and a second functionality that
is capable of forming a disulfide bond. In one embodiment, the
reactive nucleophile on the target is a naturally occurring --SH
from a cysteine that is part of the naturally occurring protein
sequence. In another embodiment, the reactive nucleophile on the
target is an engineered --SH group where mutagenesis was used to
mutate a naturally occurring amino acid to a cysteine.
[0036] In another embodiment, the target protein possesses a masked
--SH in the form of a disulfide as the reactive nucleophile. In
another embodiment, the target protein possesses a cysteine where
the thiol is masked as a disulfide. In another embodiment, the
target protein possesses a cysteine where the thiol is masked as a
disulfide bond with another cysteine. In another embodiment, the
target protein possesses a cysteine where the thiol is masked as a
disulfide bond with glutathione. In another embodiment, the target
protein possesses a cysteine where the thiol is masked as a
disulfide of the formula --SSR.sup.1 where R.sup.1 is as previously
described.
[0037] In another embodiment, the first functionality, the second
functionality or both are each independently a --SH or a masked
--SH. An illustrative example of a masked thiol is a thioester of
the formula --SC(.dbd.O)R.sup.1 or a disulfide of the formula
--SSR.sup.1 where R.sup.1 is as previously described. In this
embodiment, the covalent bond formed between the target and the
extender is a disulfide bond and thus is a reversible covalent
bond. In one variation of the method, the target is contacted with
the extender prior to contacting the target-extender complex with
one or more candidate ligands. In another variation, the target is
contacted with a pool comprising the extender and one or more
candidate ligands.
[0038] In another aspect of the present invention, a method is
provided comprising:
[0039] a) providing a target having a reactive thiol located
outside of a site of interest;
[0040] b) contacting the target with an extender thereby forming a
target-extender complex wherein the extender comprises a first
functionality that forms a covalent bond with the reactive thiol
and a second functionality that is capable of forming a disulfide
bond;
[0041] c) contacting the target-extender complex with a candidate
ligand that comprises a group that is capable of forming a
disulfide bond with the second functionality;
[0042] d) forming a disulfide bond between the target-extender
complex and the candidate ligand thereby forming a
target-extender-ligand conjugate; and,
[0043] e) identifying the candidate ligand present in the
target-extender-ligand conjugate.
[0044] In one embodiment, the reactive thiol on the target is a
naturally occurring --SH from a cysteine that is part of the
naturally occurring protein sequence. In another embodiment, the
reactive thiol on the target is an engineered --SH group where
mutagenesis was used to mutate a naturally occurring amino acid to
a cysteine.
[0045] In another embodiment, the target protein possesses a masked
--SH in the form of a disulfide as the reactive thiol. In another
embodiment, the target protein possesses a cysteine where the thiol
is masked as a disulfide. In another embodiment, the target protein
possesses a cysteine where the thiol is masked as a disulfide bond
with another cysteine. In another embodiment, the target protein
possesses a cysteine where the thiol is masked as a disulfide bond
with glutathione. In another embodiment, the target protein
possesses a cysteine where the thiol is masked as a disulfide of
the formula --SSR.sup.1 where R.sup.1 is as previously
described.
[0046] In another embodiment, the covalent bond between the
reactive thiol and the first functionality is an irreversible
covalent bond. In another embodiment, the covalent bond between the
reactive thiol and the first functionality is a reversible covalent
bond.
[0047] In another embodiment, the second functionality is a masked
thiol and the method additionally comprises unmasking the second
functionality subsequent to forming a target-extender complex. In
another embodiment, the second functionality is a thioester and the
method additionally comprises unmasking the thioester by converting
the thioester into a thiol.
[0048] In another embodiment, the target-extender complex is
contacted with a candidate ligand in the presence of a reducing
agent. Illustrative examples of suitable reducing agents include
but are not limited to: cysteine, cysteamine, dithiothreitol,
dithioerythritol, glutathione, 2-mercaptoethanol,
3-mercaptoproprionic acid, a phosphine such as
tris-(2-carboxyethyl-phosphine) ("TCEP"), or sodium borohydride. In
one embodiment, the reducing agent is 2-mercaptoethanol. In another
embodiment, the reducing agent is cysteamine. In another
embodiment, the reducing agent is glutathione. In another
embodiment, the reducing agent is cysteine.
[0049] In another embodiment, the first functionality is a group
that is capable of forming an irreversible covalent bond with the
reactive thiol of the target under conditions that do not denature
the target and the second functionality is a --SH or a masked --SH.
A particularly comprehensive discussion of suitable groups is found
in Powers et al., Chem Rev 102: 4639-4750 (2002) which is
incorporated herein by reference. In one embodiment, the first
functionality is a group capable of undergoing SN2-like addition.
Illustrative example of such extenders include: (i) .alpha.-halo
acids such as
##STR00001##
(ii) fluorophosphonates such as
##STR00002##
(iii) epoxides such as
##STR00003##
(iv) aziridines such as
##STR00004##
##STR00005##
(v) thiiranes such as
##STR00006##
(vi) halomethyl ketones/amides such as
##STR00007##
whereand R are each independently unsubstituted C.sub.1-C.sub.20
aliphatic, substituted C.sub.1-C.sub.20 aliphatic, unsubstituted
aryl, and substituted aryl; R.sup.1 is H, --SR.sup.1 wherein
R.sup.1 has been previously defined; and X is a leaving group.
Illustrative examples of include halogen, N.sub.2, OR,
--P(.dbd.O)Ar2, --NO(C.dbd.O)R, --(C.dbd.O)R, --O(C.dbd.O)R, and
--SR.
[0050] In another embodiment, the first functionality is a group
capable of undergoing SN aryl like addition. Illustrative examples
of suitable groups include 7-halo-2,1,3-benzoxadiazaoles, and
ortho/para nitro substituted halobenzenes such as
##STR00008##
where R' and X are as previously defined.
[0051] In another embodiment, the first functionality is a group
capable of undergoing Michael-type addition. Illustrative examples
of suitable groups include any moiety that includes a double or
triple bond adjacent to an electron withdrawing system such as a
carbonyl, imines, quinines, CN, NO.sub.2, --S(.dbd.O)--, and vinyl
sulfones. Illustrative examples of such extenders include:
##STR00009##
where and R' are as previously defined.
[0052] FIG. 1A illustrates one embodiment of tethering using an
extender that is attached to a target outside of the site of
interest. As shown, a target is provided with a reactive group (in
this case, a thiol) that is located outside of the site of interest
(depicted as a circular indentation). An extender (depicted by an
oval) having a first functionality (X) and a second functionality
(in this case, SR'-- a thiol or a masked thiol where R' is H,
SR.sup.1, SC(.dbd.O)R.sup.1) is attached to the target via a
covalent bond between the target's reactive group and the first
functionality thereby forming a target-extender complex. The second
functionality is used to probe the site of interest by contacting
the target-extender complex with a candidate ligand. If the
candidate ligand possesses an affinity for the site of interest, a
second covalent bond is formed between the target-extender complex
and the candidate ligand thereby forming a target-extender-ligand
conjugate. Ligands with binding affinity for the site of interest
are identified by analyzing the resulting target-extender-ligand
conjugates.
[0053] Once a ligand is identified for the site of interest, it in
turn can be used to probe an adjacent site in situations where such
sites exist. In such a case, the adjacent site becomes a new site
of interest in a subsequent round of tethering.
[0054] One approach for using ligand-binding information in an
extended tether method is illustrated in FIG. 1B. As shown, the
original extender is modified in view of known ligand information.
This information can arise from a previous tether experiment or
other known methods. The modified extender primarily differs from
the original extender by the incorporation of the binding
determinant (depicted by a circle), the portion of the ligand (or
candidate ligand) possessing binding affinity for the original site
of interest, and optionally, the location of the second
functionality. As with the original extender, the modified extender
possesses a first functionality that forms a covalent bond with a
reactive group outside of the site of interest. The second
functionality is located such that it is in a position to probe a
site (depicted by a rectangular indentation) adjacent to the
original site of interest (depicted by a circular indentation). The
modified extender then is used in a similar manner as previously
described. Once a second binding determinant (depicted by a
rectangle) is identified, the first and second binding determinants
are merged into a composite compound. As it can be seen, the
original extender (depicted by an oval) does not need to be
incorporated into the composite compound.
[0055] In another aspect of the present invention, a tethering
method is provided for use where a target includes a reactive
nucleophile within a site of interest and where there is an
advantage to preserving this nucleophile. Typically, this first
reactive nucleophile is an active site residue and scrubbing this
residue (mutating it to an inert amino acid) would not be
compatible with preserving enzymatic function. As with the previous
method, a reactive nucleophile (a second reactive nucleophile)
outside of the site of interest is used for tethering. An extender
is used that attaches to the target via the second reactive
nucleophile outside of the site of interest. The extender attaches
to the second reactive nucleophile instead of the first reactive
nucleophile because the extender also includes a binding
determinant that is specific for the site of interest. This binding
determinant functions as a temporary plug that is subsequently
cleaved revealing a latent functionality. Tethering then proceeds
as previously described using the latent functionality to explore
the now-unplugged site of interest.
[0056] Thus, the method comprises:
[0057] a) providing a target having a first reactive nucleophile
located inside of the site of interest and a second reactive
nucleophile located outside of a site of interest;
[0058] b) contacting the target with an extender thereby forming a
target-extender complex, the extender comprising a first
functionality and a latent second functionality, a cleavable linker
and a binding determinant wherein the first functionality forms a
first covalent bond with the second reactive nucleophile and the
binding determinant binds to the site of interest;
[0059] c) cleaving the extender at the cleavable linker thereby
forming a modified target-extender complex by exposing the second
functionality and releasing the binding determinant from the site
of interest;
[0060] d) contacting the modified target-extender complex with a
candidate ligand that comprises a group that is capable of forming
a second covalent bond with the second functionality;
[0061] e) forming a second covalent bond between the modified
target-extender complex and the candidate ligand thereby forming a
target-extender-ligand conjugate; and,
[0062] f) identifying the candidate ligand present in the
target-extender-ligand conjugate.
[0063] In one embodiment, the first reactive nucleophile is a --OH
and the second reactive nucleohile is a --SH. In another
embodiment, the first reactive nucleophile is a --SH and the second
reactive nucleohile is a --OH. In another embodiment, both the
first and second reactive nucleophiles are each --OH. In another
embodiment, both the first and second reactive nucleophiles are
each --SH.
[0064] In another embodiment, the extender comprises: a) a first
functionality that is capable of forming an irreversible covalent
bond with the second reactive nucleophile on the target; and b) a
latent second functionality that is capable of forming a disulfide
bond.
[0065] FIG. 2 illustrates one embodiment of this form of tethering
wherein the target comprises a first reactive nucleophile in the
site of interest and a second reactive nucleophile outside of the
site of interest. As shown, a target is provided with a site of
interest (depicted as a circular indentation), a first reactive
nucleophile in the site of interest (not pictured), and a second
reactive nucleophile (in this case, a thiol) that is located
outside of the site of interest. An extender, having a first
functionality (X), a latent second functionality, a cleavable
linker and a binding determinant (circle with dots), is attached to
the target via a covalent bond between the target's reactive group
and the first functionality thereby forming a target-extender
complex. The extender is subsequently cleaved to form a modified
target-extender complex revealing the second functionality and
releasing the binding determinant from the site of interest.
Tethering is then performed using the second functionality to probe
the site of interest. The modified target-extender complex is
contacted with one or more candidate ligands. If the candidate
ligand possesses an affinity for the site of interest, a second
covalent bond is formed between the modified target-extender
complex and the candidate ligand thereby forming a
target-extender-ligand conjugate. Ligands with binding affinity for
the site of interest are identified by analyzing the resulting
target-extender-ligand conjugates.
[0066] In general, residues to be mutated to provide a reactive
nucleophile are solvent-accessible. Solvent accessibility may be
calculated from structural models using standard numeric (Lee, B.
& Richards, F M. J. Mol. Biol 55:379-400 (1971); Shrake, A.
& Rupley, J. A. J. Mol. Biol. 79:351-371 (1973)) or analytical
(Connolly, M. L. Science 221:709-713 (1983); Richmond, T. J. J.
Mol. Biol. 178:63-89 (1984)) methods. For example, a potential
cysteine variant is considered solvent-accessible if the combined
surface area of the carbon-beta (C.sub..beta.), or sulfur-gamma
(S.sub..gamma.) is greater than about 20 .ANG..sup.2 when
calculated by the method of Lee and Richards (Lee, B. &
Richards, F. M. J. Mol. Biol 55:379-400 (1971)). This value
represents approximately 33% of the theoretical surface area
accessible to a cysteine side-chain as described by Creamer et al.
(Creamer, T. P. et al. Biochemistry 34:16245-16250 (1995)).
[0067] It is also preferred that the residue to be mutated to
provide a reactive nucleophile not participate in hydrogen-bonding
with backbone atoms or, that at most, it interacts with the
backbone through only one hydrogen bond. Wild-type residues where
the side-chain participates in multiple (>1) hydrogen bonds with
other side-chains are also less preferred. Variants for which all
standard rotamers (.chi..sub.1 angle of -60.degree., 60.degree., or
180.degree.) can introduce unfavorable steric contacts with the N,
C.sub..alpha., C, O, or C.sub..beta. atoms of any other residue are
also less preferred. Unfavorable contacts are defined as
interatomic distances that are less than 80% of the sum of the van
der Waals radii of the participating atoms.
[0068] Other preferred variants are those which, when mutated to a
desired nucleophilic residue would possess a conformation that
provides a vector towards the site of interest. For example, if
mutating a residue to a cysteine, than the cysteine when tethered
as to comprise -Cys-SSR, should possess an allowable conformation
that directs the atoms of R towards the site of interest. Two
general procedures can be used to identify these preferred
variants. In the first procedure, a search is made of unique
structures (Hobohm, U. et al. Protein Science 1:409-417 (1992)) in
the Protein Databank (Berman, H. M. et al. Nucleic Acids Research
28:235-242 (2000)) to identify structural fragments containing a
disulfide-bonded cysteine at position j in which the backbone atoms
of residues j-1, j, and j+1 of the fragment can be superimposed on
the backbone atoms of residues i-1, i, and i+1 of the target
molecule with an RMSD of less than 0.75 squared Angstroms. If
fragments are identified that place the C.sub..beta. atom of the
residue disulfide-bonded to the cysteine at position j closer to
any atom of the site of interest than the C.sub..beta. atom of
residue i (when mutated to cysteine), position i is considered
preferred. In an alternative procedure, the residue at position i
is computationally "mutated" to a cysteine, capped with an S-Methyl
group via a disulfide bond (such that the side chain is
--CH.sub.2SSCH.sub.3), and is placed in the standard rotamer
conformations for cysteine. A residue is considered to be a
suitable candidate for cysteine mutation if it can be substituted
with at least one rotamer that places the methyl carbon of the
S-methyl group closer to the site of interest than the residue's
C.sub..beta. atom.
[0069] In addition to adding residues that provide a reactive
nucleophile, it may be desirable to delete one or more naturally
occurring residues that possess reactive groups. For example,
reactive cysteines can be replaced with other amino acids such as
alanines for example.
[0070] Various recombinant, chemical, synthetic and/or other
techniques can be employed to modify a target for use in tethering.
Such techniques include, for example, site-directed mutagenesis of
the nucleic acid sequence encoding the target polypeptide such that
it encodes a polypeptide with a different number of cysteine
residues. Site-directed mutagenesis using polymerase chain reaction
(PCR) amplification is described in, for example, U.S. Pat. No.
4,683,195 issued 28 Jul. 1987 and Current Protocols In Molecular
Biology, Chapter 15 (Ausubel et al., ed., 1991). Other
site-directed mutagenesis techniques are also well known in the art
and are described, for example, in the following publications:
Ausubel et al., supra, Chapter 8; Molecular Cloning: A Laboratory
Manual., 2nd edition (Sambrook et al., 1989); Zoller et al.,
Methods Enzymol. 100:468-500 (1983); Zoller & Smith, DNA
3:479-488 (1984); Zoller et al., Nucl. Acids Res., 10:6487 (1987);
Brake et al, Proc. Natl. Acad. Sci. USA 81:4642-4646 (1984);
Botstein et al., Science 229:1193 (1985); Kunkel et al., Methods
Enzymol. 154:367-82 (1987), Adelman et al., DNA 2:183 (1983); and
Carter et al., Nucl. Acids Res., 13:4331 (1986). Cassette
mutagenesis (Wells et al., Gene, 34:315 [1985]), and restriction
selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London
SerA, 317:415 [1986]) may also be used.
[0071] Amino acid sequence variants with more than one amino acid
substitution may be generated in one of several ways. If the amino
acids are located close together in the polypeptide chain, they may
be mutated simultaneously, using one oligonucleotide that codes for
all of the desired amino acid substitutions. If, however, the amino
acids are located some distance from one another (e.g. separated by
more than ten amino acids), it is more difficult to generate a
single oligonucleotide that encodes all of the desired changes.
Instead, one of two alternative methods may be employed. In the
first method, a separate oligonucleotide is generated for each
amino acid to be substituted. The oligonucleotides are then
annealed to the single-stranded template DNA simultaneously, and
the second strand of DNA that is synthesized from the template will
encode all of the desired amino acid substitutions. The alternative
method involves two or more rounds of mutagenesis to produce the
desired mutant.
[0072] Synthetic methods for forming a reversible or irreversible
covalent bond between reactive groups on a target and an extender,
a target-extender complex and a ligand, or between two ligands, are
well known in the art, and are described in basic textbooks, such
as, e.g. March, Advanced Organic Chemistry, John Wiley & Sons,
New York, 4.sup.th edition, 1992. Reductive aminations between
aldehydes and ketones and amines are described, for example, in
March et al., supra, at pp. 898-900; alternative methods for
preparing amines at page 1276; reactions between aldehydes and
ketones and hydrazide derivatives to give hydrazones and hydrazone
derivatives such as semicarbazones at pp. 904-906; amide bond
formation at p. 1275; formation of ureas at p. 1299; formation of
thiocarbamates at p. 892; formation of carbamates at p. 1280;
formation of sulfonamides at p. 1296; formation of thioethers at p.
1297; formation of disulfides at p. 1284; formation of ethers at p.
1285; formation of esters at p. 1281; additions to epoxides at p.
368; additions to aziridines at p. 368; formation of acetals and
ketals at p. 1269; formation of carbonates at p. 392; formation of
denamines at p. 1264; metathesis of alkenes at pp. 1146-1148 (see
also Grubbs et al., Acc. Chem. Res. 28:446-453 [1995]); transition
metal-catalyzed couplings of aryl halides and sulfonates with
alkanes and acetylenes, e.g. Heck reactions, at p.p. 717-178; the
reaction of aryl halides and sulfonates with organometallic
reagents, such as organoboron, reagents, at p. 662 (see also
Miyaura et al., Chem. Rev. 95:2457 [1995]); organotin, and
organozinc reagents, formation of oxazolidines (Ede et al.,
Tetrahedron Letts. 28:7119-7122 [1997]); formation of thiazolidines
(Patek et al., Tetrahedron Letts. 36:2227-2230 [1995[); amines
linked through amidine groups by coupling amines through
imidoesters (Davies et al., Canadian J. Biochem.c 50:416-422
[1972]), and the like.
PTPs
[0073] For the purposes of illustration, the above-described
methods are applied to an important class of targets, protein
tyrosin phosphatases ("PTPs"). These methods are described within
the context of the more general extended tethering methods that are
specifically tailored for use with PTPs.
[0074] Tyrosine phosphorylation is reversible and dynamic, and the
equilibrium between phosphorylated and unphosphorylated protein is
governed by the opposing activities of protein tyrosine kinases
("PTKs") that catalyze the addition of a phosphate group and
protein tyrosine phosphatases ("PTPs") that catalyze the reverse
activity or the removal of the added phosphate group. Recent
studies indicate that tyrosine phosphorylation is essential in
controlling normal cell-to-cell communication, cell cycle, cell
growth and proliferation, cell migration, differentiation, gene
transcription, immune response, ion channels, metabolism, and
survival. As a result, PTPs have become targets for drug discovery
efforts as defects in the pathway or an imbalance in the levels of
phosphorylated and unphosphorylated tyrosines in proteins
contributes to many human diseases such as cancer, diabetes,
rheumatoid arthritis and hypertension.
[0075] The hallmark of a PTP is the presence of the PTP signature
motif: (H/V)C(X).sub.5R(S/T) where X is any amino acid residue. See
Zhang, Current Opinions in Chemical Biology 5: 416-423 (2001); and
Zhang, Annual Review of Pharmacology and Toxicology 42: 209-234
(2002). The PTP signature motif is found in a critical loop (termed
the PTP loop or P-loop) in the active site of the catalytic PTP
domain and includes two (cysteine and arginine) of the three
essential catalytic residues. The third catalytic residue is
aspartic acid and is found in the WPD loop (also known as the
flexible loop). In addition, all PTPs are characterized by their
ability to hydrolyze p-nitrophenyl phosphate without the presence
of a metal ion, sensitivity to vanadate, and insensitivity to
okadaic acid.
[0076] PTP's can be categorized into three subfamilies: 1)
tyrosine-specific; 2) dual-specific; and 3) low molecular weight
phosphatases. Tyrosine-specific PTPs can be further divided into
two groups: a) receptor-type PTPs and b) non-receptor type PTPs.
Receptor-type PTPs generally have an extracellular putative
ligand-binding domain, a single transmembrane region, and one or
two cytoplasmic PTP domains. The catalytic domain is termed the PTP
domain. Table 1 includes illustrative examples of receptor-type
PTPs, indications, and references in which the specific receptor
PTP is described in greater detail.
TABLE-US-00001 TABLE 1 PHOSPHATASE INDICATION REFERENCES PTP
.alpha. Diabetes Oncogene 19 (43), 4979-4987 (2000) (AKA leukocyte
common antigen Cancer J. Biol. Chem. 273 (48), 31890-31900 related
polypeptide PTP; TP (1998) alpha; PTPLCA-related Nature 359 (6393),
336-339 (1992) phosphatase) PTP R type C immune system disorders
Nature 409 (6818), 349-354 (2001) (AKA leukocyte common Nature 390
(6660), 629-632 (1997) antigen; CD45) PTP .delta. nervous system
disorders PNAS 92 (25), 11686-11690 (1995) where nerve regeneration
is indicated PTP .epsilon. Cancer J. Biol. Chem. 275 (36),
28216-28221 (2000) EMBO J. 19 (15), 4036-4045 (2000) Oncogene 18
(36), 5024-5031 (1999) LAR. Diabetes PNAS 98 (9), 5187-5192 (2001)
(AKA PTP R type F; Leukocyte Obesity J. Biol. Chem. 274 (15),
10173-10183 antigen related TP; LCA- (1999) homolog) PTP .gamma.
Cancer Genomics 32 (2), 225-235 (1996) PNAS 88 (11), 5036-5040
(1991) PTP .kappa. keratinocyte-mediated Gene 186 (1), 77-82 (1997)
skin. Biochem. Biophys. Res. Commun. 228 (3), 807-812 (1996) J.
Biol. Chem. 270 (24), 14247-14250 (1995) PTP .mu. cellular adhesion
disorders J. Biol. Chem. 276 (18), 14896-14901 (2001) Cell Biol.
122 (4), 961-972 (1993) PTP R type Q nervous system disorders Gene
162 (2), 279-284 (1995) (AKA PTP NCPTPCOM1; where nerve
regeneration J. Biol. Chem. 270 (1), 49-53 (1995) PTPCr1PTPase;
Ch-1 PTPase) is indicated PTP-J Cancer and Biochim. Biophys. Acta
1450 (3), 331-340 (AKA PTPomiron; PTPRO; nervous system disorders
(1999), Oncogene 12 (12), 2555-2562 PTPpi; pancreatic carcinoma
where nerve regeneration (1996) phosphatase-2; PCP-2) is
indicated
[0077] Non-receptor type PTPs contain a single catalytic domain and
various amino- or carboxy-terminal extensions. These extensions
include SH2 domains, PDZ domains, and extra cellular ligand binding
domains. Table 2 includes illustrative examples of non-receptor
type PTPs, indications, and references in which the specific PTP is
described in greater detail.
TABLE-US-00002 TABLE 2 PHOSPHATASE INDICATION REFERENCES PTP-1B
Diabetes J. Biol. Chem. 276 (51), 47771-47774 (2001) Obesity J.
Biol. Chem. 276 (13), 10207-10211 (2001) Science 263 (5152),
1397-1404 (1994) TC-PTP Leukemia J. Biol. Chem. 274 (39),
27768-27775 (1999) (AKA T-cell-PTP) Genomics 16 (3), 619-629 (1993)
PTP-H1 Cancer J. Biol. Chem. 274 (25), 17806-17812 (1999) (AKA
cytoskeletal-associated J. Biol. Chem. 272 (43), 27281-27287 (1997)
PTP) J. Gastroenterol. 29 (6), 727-732 (1994) PTP-MEG1 glutamine
receptor J. Biol. Chem. 275 (21), 16167-16173 (2000) (AKA
megkaryocyte PTP) signaling disorders Proc. Natl. Acad. Sci. U.S.A.
88 (13), 5867-5871 (1991) SHP-1 hematopoiesis EMBO J. 14 (11),
2519-2526 (1995) (AKA SH-PTP1; PTP-1c) disorders Molecular and
cellular biology. 12 (2), 836-846 (1992) LC-PTP immune system J.
Immunol. 163 (3), 1282-1288 (1999) (AKA HEPTP; HePTPase; disorders
J. Biol. Chem. 274 (17), 11693-11700 (1999) hematopoeitic PTP; PTP
NR type stress induced) PTPMEG2 phagocytosis J. Biol. Chem. 277
(4), 2620-2628 (2002) (AKA PTPaseMEG2) disorders Proc. Natl. Acad.
Sci. U.S.A. 89 (7), 2980-2984 (1992) SHP-2 cellular J. Biol. Chem.
275 (7), 5208-5213 (2000) (AKA PTP-1D; PTP-2c; SH- proliferation J.
Biol. Chem. 275 (1), 599-604 (2000) PTP3; SH-PTP2) disorders Proc.
Natl. Acad. Sci. U.S.A. 96 (17), 9677-9682 (1999) Mol. Cell. Biol.
19 (4), 3125-3135 (1999) Proc. Natl. Acad. Sci. U.S.A. 90 (6),
2197-2201 (1993) PTP-G1 Cancer J. Biol. Chem. 276 (26), 24422-24431
(2001) (AKA PTP-PEST) Mol. Cell 6 (6), 1413-1423 (2000) J. Biol.
Chem. 274 (6), 3811-3818 (1999) FEBS Lett. 339 (3), 222-228 (1994)
PTP-1E apoptotic disorders Eur. J. Biochem. 267 (24), 7170-7175
(2000) (AKA PTPL1; Fas-associated J. Biol. Chem. 272 (39),
24333-24338 (1997) phosphatase-1, FAP-1; PTP-BAS;
Apo1/CD95(Fas)-associated phosphatase
[0078] The other two subfamilies of PTPs, dual-specific PTPs and
low molecular weight phosphatases, are not as well characterized in
the literature as the tyrosine-specific PTPs. As its name implies,
dual-specific PTPs can remove phosphates from both
phosphotyrosine-containing proteins and phosphoserine or
phosphothreonine-containing proteins. Illustrative examples of
dual-specific PTPs include Cdc25A, PTEN, and MAP kinase
phosphatases. Finally, low molecular weight phosphatases are so
termed because they generally include only the PTP domain.
[0079] Although the methods that follow are described with
reference to a particular PTP, PTP-1B, they are generally
applicable to all PTPs due to the fact that the three-dimensional
structures of the PTP domain (formed by approximately 240 residues)
of all three subfamilies of PTPs are remarkably similar. The
structural similarity of the PTP domain is striking in view of the
variation in amino acid sequences and the differences in substrate
specificity between the tyrosine-specific PTPs and the
dual-specificity PTPs. A particularly useful publication providing
a structural alignment of the PTP domains of the known PTPs to date
is Andersen et al., Mol Cell Biol 21:7117-7136 (2001) which is
incorporated herein by reference.
[0080] Briefly, all of the PTP domains are composed of a highly
twisted mixed .beta.-sheet flanked by .alpha.-helices on both
sides. Not surprisingly, the active site of the PTP domain is the
most conserved among PTPs and prominently features a pTyr binding
pocket. Because the PTP domain includes the active site, it is
sometimes referred to as the catalytic domain. The diversity of
PTPs in function and overall structure is a consequence of the
presence of diverse noncatalytic regulatory and targeting domains
that are found in the N and C termini that often flank the PTP
domain.
[0081] In one aspect of the present invention, a general method for
using extenders is provided for identifying ligands that bind to
the active site of PTP. In one embodiment, the method uses the
active site cysteine (e.g, C215 in PTP-1B) as the reactive thiol
and comprises:
[0082] a) providing a PTP having active site thiol;
[0083] b) contacting the PTP with an extender thereby forming a
PTP-extender complex wherein the extender comprises a first
functionality that forms a covalent bond with the active site thiol
and a second functionality that is capable of forming a disulfide
bond;
[0084] c) contacting the PTP-extender complex with a candidate
ligand that comprises a group that is capable of forming a
disulfide bond with the second functionality;
[0085] d) forming a disulfide bond between the PTP-extender complex
and the candidate ligand thereby forming a PTP-extender-ligand
conjugate; and, e) identifying the candidate ligand present in the
PTP-extender-ligand conjugate.
[0086] In one embodiment, the PTP is contacted with a candidate
ligand in the presence of a reducing agent. Illustrative examples
of suitable reducing agents include but are not limited to:
cysteine, cysteamine, dithiothreitol, dithioerythritol,
glutathione, 2-mercaptoethanol, 3-mercaptoproprionic acid, a
phosphine such as tris-(2-carboxyethyl-phosphine) ("TCEP"), or
sodium borohydride. In one embodiment, the reducing agent is
2-mercaptoethanol. In another embodiment, the reducing agent is
cysteamine. In another embodiment, the reducing agent is
glutathione. In another embodiment, the reducing agent is
cysteine.
[0087] In another embodiment, the candidate ligand possesses a --SH
group. In another embodiment, the candidate ligand possesses a
masked thiol. In another embodiment, the candidate ligand possesses
a masked thiol in the form of a disulfide of the formula
--SSR.sup.1 where R.sup.1 is unsubstituted C.sub.1-C.sub.10
aliphatic, substituted C.sub.1-C.sub.10 aliphatic, unsubstituted
aromatic or substituted aromatic. In another embodiment, the
candidate ligand possesses a thiol masked as a disulfide of the
formula --SSR.sup.2R.sup.3 wherein R.sup.2 is C.sub.1-C.sub.5 alkyl
(preferably --CH.sub.2--, --CH.sub.2CH.sub.2--, or
--CH.sub.2CH.sub.2CH.sub.2--) and R.sup.3 is NH.sub.2, OH, or COOH.
In another embodiment, the candidate ligand possesses a thiol
masked as a disulfide of the formula --SSCH.sub.2CH.sub.2OH. In yet
another embodiment, the candidate ligand possesses a thiol masked
as a disulfide of the formula --SSCH.sub.2CH.sub.2NH.sub.2.
[0088] Illustrative examples of candidate ligands include:
##STR00010## ##STR00011##
[0089] In another embodiment, the extender comprises a first and
second functionalities as described above and includes a binding
determinant that possesses an inherent binding affinity for the
active site. If the binding determinant does not already include a
first and second functionality, then it can be modified to contain
them. In one method, tethering is used to identify a binding
determinant R.sup.c that is then modified to include a first and
second functionalities. In another method, the binding determinant
is obtained from known substrates of the target or fragments
thereof.
[0090] In another embodiment, the extender comprises a first and
second functionalities as described above and includes a
phosphotyrosine or a phosphotyrosine mimetic as the binding
determinant. Phosphotyrosine mimetics are described for example in
Burke et al., Biopolymers, 60: 32-44 (2001) which is incorporated
herein by reference. In another embodiment, the phosphotyrosine or
phosphotyrosine mimetic is selected from the group consisting
of:
##STR00012## ##STR00013## ##STR00014##
[0091] In another embodiment, the phosphotyrosine or
phosphotyrosine mimetic is selected from the group consisting
of:
##STR00015##
[0092] In another embodiment, the first and second functionalities
of the extender are each independently a --SH or a masked --SH. An
illustrative example of a masked thiol is a thioester of the
formula --SC(.dbd.O)R.sup.1 or a disulfide of the formula
--SSR.sup.1 where R.sup.1 is as previously described. In this
embodiment, the covalent bond formed between the target and the
extender is a disulfide bond and thus is a reversible covalent
bond. In one variation of the method, the target is contacted with
the extender prior to contacting the target-extender complex with
one or more candidate ligands. In another variation, the target is
contacted with a pool comprising the extender and one or more
candidate ligands.
[0093] In another embodiment, the extender comprises an alkylating
agent that additionally comprises a masked thiol that is capable of
forming a covalent bond with a candidate ligand. In one method, the
alkylating agent is a halomethyl-ketone or a halomethyl-acetamide.
Illustrative examples of chloromethyl-ketones include but are not
limited to:
##STR00016##
wherein n is 1-5, more preferably 1-3. In another method, the
alkylating agent is a chloromethyl-ketone. In another method, the
alkylating agent is a chloromethyl-acetamide. Illustrative examples
of chloro-methyl acetamide extenders include but are not limited
to:
##STR00017##
[0094] These chloromethyl ketones and chloromethyl acetamides are
examples of extenders that comprise a first and second
functionalities. Methods for making these extenders are described
in Examples 1-8.
[0095] Scheme 1 illustrates one method for using such extenders to
derive ligands that bind PTPs.
##STR00018##
[0096] As shown, the extender is used to modify the active site
thiol and the masked second functionality, a masked thiol, is
deprotected. The PTP-extender complex then is used in a tethering
experiment and is contacted with a library of candidate ligands.
One embodiment of a tethering method using an extender with PTP-1B
is further described in Example 9. Tethering identifies a binding
determinant R that is specific for a site adjacent to the
phosphotyrosine binding site (in which the active site thiol
resides). As a result, conjugate compounds that are active site
inhibitors of PTPs can be made combining a phosphotyrosine or
phosphotyrosine mimetic with the identified binding determinant R.
Because disulfide bonds are generally not stable, these linkages
are typically replaced when making conjugate compounds.
[0097] Scheme 2 illustrates a variation of this method for making
conjugate compounds using extenders where first functionality is
located off a phenyl ring to aid in the superimposition of the
phosphotyrosine or phosphotyrosine mimetic.
##STR00019##
[0098] synthesis of one such conjugate compound is further
described in Example 10.
[0099] In another aspect of the present invention, the extender
strategy is used without forming a covalent bond in the active site
to minimize potential structural rearrangements therein. Like the
above described methods, the extender comprises a first
functionality that is capable of forming a covalent bond with the
reactive thiol, and a second functionality that is capable of
forming a disulfide.
[0100] This method primarily differs from that described above in
the location of the reactive thiol on the PTP. Instead of using the
active site thiol, a reactive thiol that is located outside of the
active site is used. Optionally, the extender additionally
comprises a phosphotyrosine or a phosphotyrosine mimetic.
[0101] Thus, the method comprises:
[0102] a) providing a PTP having a reactive thiol located outside
of the active site;
[0103] b) contacting the PTP with an extender thereby forming a
PTP-extender complex wherein the extender comprises a first
functionality that forms a covalent bond with the reactive thiol
and a second functionality that is capable of forming a disulfide
bond;
[0104] c) contacting the PTP-extender complex with a candidate
ligand that comprises a group that is capable of forming a
disulfide bond with the second functionality;
[0105] d) forming a disulfide bond between the PTP-extender complex
and the candidate ligand thereby forming a PTP-extender-ligand
conjugate; and,
[0106] e) identifying the candidate ligand present in the
PTP-extender-ligand conjugate.
[0107] In embodiments where the extender includes a phosphotyrosine
or a phosphotyrosine mimetic, a covalent bond is formed between the
reactive thiol (that is located outside of the active site) and the
first functionality thereby forming a PTP-extender complex. A
covalent bond is not formed between the active site cysteine (e.g.
C215 in PTP-1B) because the phosphotyrosine or phosphotyrosine
mimetic binds to the active site, thus preventing the formation of
a covalent bond between the active site thiol and the first
functionality. Consequently, tethering experiments using the second
functionality identify ligands that bind to a site adjacent to the
phosphotyrosine-binding site in the PTP.
[0108] In one embodiment, the PTP is a PTP mutant comprising a
cysteine instead of the naturally occurring amino acid at the
position that corresponds to R47 in human PTP-1B. FIG. 3 shows the
first 298 residues of human PTP-1B aligned with human TC-PTP and
LAR. As it can be seen, the corresponding residue in human TC-PTP
is also an arginine and is an alanine in human LAR. The
corresponding residue in other PTPs can be identified using the
structural alignment disclosed in Andersen et al., Mol Cell Biol
21:7117-7136 (2001).
[0109] If the target includes one or more naturally occurring
cysteines outside of the active site, these cysteines can be
mutated to another residue such as alanine, serine, or valine to
eliminate the possibility of dual labeling. For example, PTP-1B
contains two such cysteine, C32 and C92, that were sufficiently
reactive in tethering experiments that they were mutated to another
amino acid to prevent unwanted labeling. In preferred embodiments,
C32 was mutated to serine and C92 was mutated to alanine. The
cloning of human PTP-1B and the cysteine mutants thereof are
described further in Examples 11 and 12 respectively.
[0110] In another embodiment, the extenders are of the formula:
##STR00020##
where A is a moiety comprising phosphotyrosine or a phosphotyrosine
mimetic, L.sub.1 is a linker, and X is a halide or together with
the adjacent carbon is a carbon-carbon double bond or a
carbon-carbon triple bond. The first functionality is X and the
second functionality is generally located on L.sub.1, although it
can also be located on A. In another embodiment, A is selected from
the group consisting of:
##STR00021## ##STR00022## ##STR00023##
[0111] In another embodiment, A is selected from the group
consisting of:
##STR00024##
[0112] Illustrative examples of such extenders include:
##STR00025##
[0113] Exemplary methods for making these types of extenders are
described in Examples 13-20.
[0114] Similar methods as those outlined by Schemes 1 and 2 can be
used to make conjugate compounds using these extenders. Scheme 3
illustrates one embodiment for such a method.
##STR00026##
[0115] As can be seen, the phosphotyrosine or phosphotyrosine
mimetic is linked with the binding determinant, R, that is
identified from tethering. The portion of the extender that binds
outside of the active site is eliminated from the conjugate
compound. Illustrative examples of conjugate compounds that were
derived using such a strategy are further described in Examples
21-25.
[0116] In another aspect of the present invention, a method of
identifying a novel phosphotyrosine mimetic is provided. The method
uses a PTP having an active site cysteine and a reactive thiol that
is located outside of the active site, and an extender comprising a
first functionality that is capable of forming a covalent bond with
the reactive thiol, a cleavable linker having a latent second
functionality, and a moiety comprising a phosphotyrosine or a
phosphotyrosine mimetic. When the PTP is contacted with the
extender, a covalent bond is formed between the reactive thiol and
the first functionality thereby forming a PTP-extender complex. A
covalent bond is not formed between the active site cysteine (e.g.
C215 in PTP-1B) because the phosphotyrosine or phosphotyrosine
mimetic binds to the active site and acts as a temporary plug, thus
preventing the formation of a covalent bond between the active site
thiol and the first functionality. The cleavable linker is then
cleaved exposing the second functionality and thereby releasing the
phosphotyrosine or phosphotyrosine mimetic, and the second
functionality is used in tethering experiments to identify novel
ligands that bind to the phosphotyrosine-binding site in the
PTP.
[0117] Thus, the method comprises:
[0118] a) providing a PTP having an active site, a cysteine located
in the active site and a reactive thiol located outside of the
active site;
[0119] b) contacting the PTP with an extender thereby forming a
PTP-extender complex, the extender comprising a first functionality
and a latent second functionality, a cleavable linker and a binding
determinant comprising a phosphotyrosine or a phosphotyrosine
mimetic wherein the first functionality forms a first covalent bond
with the reactive thiol and the binding determinant binds to the
active site;
[0120] c) cleaving the extender at the cleavable linker thereby
forming a modified PTP-extender complex by exposing the second
functionality and releasing the binding determinant from the active
site;
[0121] d) contacting the modified PTP-extender complex with a
candidate ligand that comprises a group that is capable of forming
a second covalent bond with the second functionality;
[0122] e) forming a second covalent bond between the modified
PTP-extender complex and the candidate ligand thereby forming a
PTP-extender-ligand conjugate; and,
[0123] f) identifying the candidate ligand present in the
PTP-extender-ligand conjugate.
[0124] In one embodiment, the extender comprises a compound of the
formula
##STR00027##
where A is a moiety comprising phosphotyrosine or a phosphotyrosine
mimetic, L is a cleavable linker, and X is a halide. In another
embodiment, the extender comprises a compound of the formula
##STR00028##
where A is selected from the group consisting of:
##STR00029## ##STR00030##
n is 1-5; m is 2-5; and, X is a halide. In another embodiment, A is
selected from the group consisting of:
##STR00031##
n and m are independently 2 or 3; and X is bromide. Examples 26 and
27 describe the synthesis of two illustrative extenders
##STR00032##
[0125] The latter extender was used in tethering experiments to
identify a novel phosphotyrosine mimetic.
[0126] In another aspect of the present invention, a novel
phosphotyrosine mimetic is provided. In one embodiment, the
phosphotyrosine mimetic includes the moiety.
##STR00033##
[0127] In another embodiment the phosphotyrosine mimetic includes
the moiety
##STR00034##
[0128] In another embodiment, the phosphotyrosine mimetic includes
the moiety
##STR00035##
[0129] All references cited throughout the specification are
expressly incorporated herein by reference. While the present
invention has been described with references to specific
embodiments thereof, it should be understood by those skilled in
the art that various changes may be made and equivalents
substituted to adapt the present invention to a particular
situation. All such changes and modifications are within the scope
of the present invention.
[0130] The invention is further illustrated by the following
non-limiting examples.
EXAMPLE 1
[0131] This example describes the synthesis of the compound
below
##STR00036##
which was made according to Scheme A.
##STR00037##
[0132] Commercially available .alpha.-bromo-p-toluic acid (0.513 g,
2.39 mmol) was reacted with potassium thioacetate (0.27 g, 2.36
mmol) and potassium carbonate (0.33 g, 2.39 mmol) in
N,N-dimethylformamide (DMF, 20 ml) for 16 hours and was then
flooded with 100 ml ethyl acetate (EtOAc), rinsed with 3.times.50
ml 1 M sodium hydrogen sulfate, 50 ml brine, dried over sodium
sulfate, and evaporated to a white crust (0.484 g, 2.3 mmol, 98%,
ES (+) MS m/z=211 (M+H)).
[0133] This acid was dissolved in 10 ml dry tetrahydrofuran (THE),
chilled in an ice-water bath, and treated with 4-methylmorpholine
(NMM, 0.26 ml, 2.37 mmol) and isobutylchloroformate (IBCF, 0.3 ml,
2.31 mmol). The reaction was allowed to proceed for 20 minutes
before being filtered through a medium glass frit and the resultant
solid rinsed with 5 ml THF. The combined pink filtrate was
transferred to a round-bottom flask without ground glass joints and
cooled in an ice water bath. Meanwhile, diazomethane was prepared
by cooling 11 ml of diethyl ether in an ice-water bath, adding 3.2
ml of 40% potassium hydroxide, followed by
1-methyl-3-nitro-1-nitrosoguanidine (1 g, 6.8 mmol). This solution
was allowed to stir for 45 minutes, and then the diazamethane
ethereal layer was carefully decanted into the carbonate solution
above. The reaction mixture was allowed to slowly warm to room
temperature and stirred under nitrogen for two days before being
chilled on ice again. A solution of 4 M HCl in dioxane (1 ml, 4
mmol) was added and the reaction allowed to proceed for 80 minutes.
Residual diazomethane was then quenched with acetic acid (1 ml) and
the reaction was flooded with 100 ml EtOAc, rinsed with 2.times.50
ml saturated sodium hydrogen carbonate, 2.times.50 ml 1 M sodium
hydrogen sulfate, 50 ml brine, dried over sodium sulfate, and
evaporated to dryness. The residue was purified by reverse-phase
chromatography to yield the titled compound as a pale yellow liquid
(0.07 g, 0.29 mmol, 13%, ES (+) MS m/z=243 (M+H)).
EXAMPLE 2
[0134] This example describes the synthesis of the compound
below
##STR00038##
[0135] This compound was made using the method of Example 1 except
that 4-(2-bromoethyl)benzoic acid was used instead of
.alpha.-bromo-p-toluic acid (ES (+) MS m/z=257 (M+H)).
EXAMPLE 3
[0136] This example describes the synthesis of the compound
below
##STR00039##
which was made according to Scheme B.
##STR00040##
[0137] This compound was made starting with commercially available
4-amino benzyl alcohol (1.9 g, 15.4 mmol) which was reacted with
di-tert-butyl-dicarbonate (3.6 g, 16.5 mmol) in 20 ml p-dioxane, 10
ml water, and 10 ml saturated sodium bicarbonate. The reaction was
allowed to proceed at room temperature overnight, whereupon 20 ml
water was added. The reaction mixture was extracted with 3.times.40
ml EtOAc, then the combined organics were rinsed with 40 ml
saturated sodium bicarbonate and 2.times.50 ml brine, dried over
sodium sulfate, filtered, and concentrated to a dark brown liquid
which was purified by flash chromatography on silica gel with 70:30
hexane:EtOAc to yield a light yellow liquid (2.7 g, 12 mmol, 79%,
MS m/z=246 (M+Na)).
[0138] The resulting benzyl alcohol (0.929 g, 4.16 mmol) was
dissolved in 10 ml dry DCM, cooled in an ice-water bath, and
treated with triethylamine (0.7 ml, 5.0 mmol) and methanesulfonyl
chloride (0.35 ml, 4.52 mmol). After 3 hours the reaction was
flooded with 100 ml EtOAc, rinsed with 3.times.50 ml 1 M sodium
hydrogen sulfate, 50 ml brine, dried over sodium sulfate, and
evaporated to a yellow crust (0.859 g, 2.9 mmol, 69%) This was
redissolved in 2.5 ml dry DMF and then potassium thioacetate (0.35
g, 3.06 mmol) was added followed by another 2.5 ml dry DMF. The
reaction was stirred vigorously for 14 hours and then flooded with
100 ml EtOAc, rinsed with 3.times.50 ml 1 M sodium hydrogen
sulfate, 50 ml brine, dried over sodium sulfate, and evaporated to
a light brown solid that was purified by flash chromatography on
silica gel with 90:10 hexane:EtOAc to yield a light reddish-brown
solid (0.385 g, 1.37 mmol, 47%, MS m/z=304 (M+Na)).
[0139] The resulting thioester (0.379 g, 1.35 mmol) was dissolved
in 10 ml dry DCM, chilled in an ice-water bath, and treated with 10
ml trifluoroacetic acid. The reaction was allowed to proceed on ice
for 30 minutes at which time solvents were removed by rotary
evaporation. The residue was then redissolved in 10 ml dry pyridine
and treated with chloroacetic anhydride (0.448 g, 2.62 mmol). The
reaction was allowed to proceed for one hour at room temperature,
then quenched with 10 ml water. The reaction was then flooded with
100 ml EtOAc, rinsed with 2.times.50 ml saturated sodium hydrogen
sulfate, 2.times.50 ml 1 M sodium bicarbonate, 50 ml brine, dried
over sodium sulfate, and evaporated to dryness. The residue was
purified by flash chromatography on silica gel with 70:30
hexane:EtOAc to yield the titled compound as an off-white solid
(0.194 g, 0.753 mmol, 56%, ES (+) MS m/z=280 (M+Na)).
EXAMPLE 4
[0140] This example describes the synthesis of the compound
below
##STR00041##
[0141] This compound was made using the method of Example 3 except
that 4-aminophenethyl alcohol was used instead of 4-amino benzyl
alcohol (ES (+) MS m/z=294 (M+Na)).
EXAMPLE 5
[0142] This example describes the synthesis of the compound
below
##STR00042##
[0143] This compound was made using the method of Example 3 except
that 3-aminobenzyl alcohol was used instead of 4-amino benzyl
alcohol (ES (+) MS m/z=258 (M+H)).
EXAMPLE 6
[0144] This example describes the synthesis of
##STR00043##
which was made according to Scheme C where n=3.
##STR00044##
[0145] This compound was made starting with commercially available
.gamma.-thiobutyrolactone (1.01 g, 9.89 mmol) which was dissolved
in water (10 ml) and THF (15 ml) and sparged with nitrogen. Solid
potassium hydroxide (1.73 g, 30.8 mmol) was added and the reaction
was allowed to proceed at room temperature for 2.5 hours. The
reaction was then cooled in an ice-water bath and acetic anhydride
(5 ml, 53 mmol) was added. The reaction was stirred on ice for 1
hour, then flooded with 100 ml 1 N HCl. The mixture was extracted
with 3.times.30 ml EtOAc, and the combined organics were then
rinsed with 50 ml 1 N HCl and 50 ml brine, dried over sodium
sulfate, filtered, and solvent removed under reduced pressure. The
resulting liquid was chromatographed on silica gel with 1:1
EtOAc:hexane to yield the S-acetyl acid (0.742 g, 4.6 mmol, 46%, ES
(+) MS n/z=185 (M+Na)).
[0146] The resulting acid was converted to the chloromethylketone
as described in Scheme A of Example 1 (where the resulting acid was
used instead of .alpha.-bromo-p-toluic acid), and the final product
was purified on silica gel with 90:10 hexane:EtOAc to yield the
titled compound (0.314 g, 1.61 mmol, 35%, ES (+) MS m/z=217
(M+Na)).
EXAMPLE 7
[0147] This example describes the synthesis of the compound
below
##STR00045##
[0148] This compound was made as described in Scheme A of Example 1
using 3-mercaptopropionic acid instead of .alpha.-bromo-p-toluic
acid (ES (+) MS m/z=203 (M+Na)).
EXAMPLE 8
[0149] This example describes the synthesis of the compound
below
##STR00046##
[0150] This compound was synthesized by reacting commercially
available 1,3-dichloroacetone (1.177 g, 9.27 mmol) with thiolacetic
acid (0.7 ml, 9.8 mmol) and triethylamine (1.4 ml, 10 mmol) in THF
(20 ml) in an ice-water bath. The reaction was allowed to proceed
for one hour, then flooded with 50 ml EtOAc, rinsed with 3.times.35
ml saturated sodium bicarbonate and 35 ml brine, dried over sodium
sulfate, filtered, and solvent removed under reduced pressure to
yield a yellow liquid which was purified twice using flash
chromatography on silica gel, first with 80:20 hexane:EtOAc, then
with 90:10 hexane:EtOAc. The purest fractions were then
concentrated under reduced pressure to a pale yellow liquid
consisting of the titled compound (0.187 g, 1.12 mmol, 12%, ES (+)
MS m/z=167 (M+H)).
EXAMPLE 9
[0151] This example describes one embodiment of a tethering
experiment using a PTP-1B-extender complex or a modified
PTP-1B-extender complex (generically referred to as "the
protein").
[0152] The protein concentration was adjusted to 5 .mu.M and
.beta.-mercaptoethanol (".beta.-ME" was added such that its
concentration was 1 mM. The protein/.beta.-ME solution was then
incubated with a monophore library pool dissolved in DMSO (50 .mu.M
each monophore final) for 1 hour and subjected to LC/MS analysis on
either a Finnigan MAT LCQ or an Applied Biosystems Inc. API Qstar
Pulsar I. Spectra were deconvoluted using either Xcalibur software
package (Finnigan MAT) or Analyst QS software package (Applied
Biosystems Inc.). Relative peak heights were used to roughly
quantitate the fraction of protein conjugated with bound cysteamine
and ligand-candidate hits. Individual ligand candidates that
generated hits were identified by mass and incubated individually
for 1 hour at 50 uM with 5 uM protein, 1 mM .beta.-ME and subjected
to LC/MS analysis.
[0153] For the Finnigan MAT LCQ, the sample was injected (Gilson
215 autosampler and Agilent 1100 HPLC system) with a flow rate of
0.7 ml/min onto a Phenomenex Jupiter C5, 300 Angstrom, 5 mm,
50.times.2 mm column in 50% Solvent A (water/0.05% TFA)/50% Solvent
B (CH.sub.3CN/0.05% TFA) and subjected to a linear gradient to 5%
Solvent A (water/0.05% TFA)/95% Solvent B (CH.sub.3CN/0.05% TFA)
over 0.75 minutes, followed by a linear gradient to 95% Solvent
A/5% Solvent B over 0.25 minutes and then held for 1 min at 95%
Solvent A.
[0154] For the API Qstar Pulsar I, the sample was injected (CTC
Analytics PAL Systems autosampler and Agilent 1100 HPLC system )
t-split to 25 .mu.L/min onto a Phenomenex Jupiter C5, 300 Angstrom,
5 mm, 50.times.2 mm column in 90% Solvent A (water/0.1% formic
acid)/10% Solvent B (CH.sub.3CN/0.1% formic acid) and subjected to
a linear gradient to 10% Solvent A (water/0.1% FA)/90% Solvent B
(CH.sub.3CN/0.1% FA) over 0.60 minutes, held there for 1.70
minutes, then followed by a linear gradient to 90% Solvent A/10%
Solvent B over 0.20 minutes and then held for 0.80 min at 90%
Solvent A.
EXAMPLE 10
[0155] This example describes the synthesis of the compound
below
##STR00047##
which was made according to Scheme D
##STR00048##
[0156] The t-butyl ester of 3-carboxypropyl disulfide was
synthesized using the methods of Wright et al. (Stephen W. Wright,
David L. Hagemean, Ann S. Wright, Lester D. McClure Tetrahedron
Letters 38 (42) 7345-7348 (1997)). This disulfide (122 mg, 0.348
mmol) was reduced with sodium borohydride (17 mg, 0.449 mmol) under
nitrogen for 5 minutes in 3 ml THF and 0.5 ml methanol. Next, the
difluorophosphonyl benzyl chloride (200 mg, 0.64 mmol, synthesized
according to the method of Caplan et al. (J. Chem. Soc. Perkin
Trans. 1, 3 421-437 (2000)) was added in 1 ml THF. The reaction was
allowed to stir for one hour at ambient temperature, at which time
sodium hydroxide (0.07 ml of 10 N solution in water, 0.7 mmol) and
more sodium borohydride (38 mg, 1 mmol) was added with 1 ml
methanol. The reaction was allowed to proceed for three days under
nitrogen, then flooded with 100 ml ethyl acetate, rinsed with
2.times.50 ml 1 M sodium hydrogen sulfate, 50 ml brine, dried over
sodium sulfate, filtered and the solvent removed under reduced
pressure to yield 218 mg of impure gum (ES (+) MS m/z=447
(M+Na)).
[0157] This material (208 mg) was suspended in 10 ml of DCM,
chilled in an ice-water bath, and 10 ml of trifluoroacetic acid
(TFA) was added. The reaction was stirred for 75 minutes and then
solvent was removed under reduced pressure. The material was then
resuspended in 3 ml dry dichloromethane and
(chloromethylene)dimethyl ammonium chloride (71 mg, 0.555 mmol) was
added, along with another 1 ml of DCM. The reaction was stirred at
ambient temperature for 45 minutes, at which point
5-amino-2-hydroxy-3-sulfobenzoic acid (C012504, 128 mg, 0.549 mmol)
and N,N-diisoproylethylamine (0.5 ml, 2.87 mmol) were added. The
reaction was allowed to proceed overnight, at which point it was
flooded with 70 ml 1 N HCl (aqueous) and extracted with 3.times.30
ml EtOAc. The aqueous layer was evaporated to reveal the product
(ES (+) MS m/z=584 (M+H)). This was suspended in 15 ml of dry DCM,
and bromotrimethylsilane (5.5 ml, 42 mmol) was added. After 14
hours the reaction was evaporated to dryness and purified via
reverse-phase HPLC to yield the titled compound (8.1 mg, (ES (+) MS
m/z=556 (M+H)) as an off-white solid.
EXAMPLE 11
Cloning of PTP-1B
[0158] PTP-1B (accession number SWS P18031) is a tyrosine
phosphatase that has a C-terminal domain that is associated to the
endoplasmic reticulum (ER) and a phosphatase domain that faces the
cytoplasm. The proteins that it dephosphorylates are transported to
this location by vesicles. The activity of PTP-1B is regulated by
phosphorylation on serine and protein degradation. PTP-1B is a
negative regulator of insulin signaling, and plays a role in the
cellular response to interferon stimulation. This phosphatase may
play a role in obesity by decreasing the sensitivity of organisms
to leptin, thereby increasing appetite. Additionally, PTP-1B plays
a role in the control of cell growth. A crystal structure has been
solved for PTP-1B [1PTY, Puius, Y. A., et al., Proc Natl Acad Sci
USA 94: 13420-13425 (1997)].
[0159] Full length human PTP-1B is 435 amino acids in length; the
phosphotase domain comprises the first 298 amino acids. Because
truncated portions of PTP-1B comprising the phosphotase domain is
fully active, various truncated versions of PTP-1B are often used.
A cDNA encoding the first 321 amino acids of human PTP-1B was
isolated from human fetal heart total RNA (Clontech).
Oligonucleotide primers corresponding to nucleotides 91 to 114
(Forward) and complementary to nucleotides 1030 to 1053 (Rev) of
the PTP-1B cDNA [Genbank M31724.1, Chernoff, J., et al., Proc.
Natl. Acad. Sci. U.S.A. 87: 2735-2739 (1990)] were synthesized and
used to generate DNA using the polymerase chain reaction.
TABLE-US-00003 Forward SEQ ID NO: 1 GCCCATATGGAGATGGAAAAGGAGTTCGAG
Rev SEQ ID NO: 2 GCGACGCGAATTCTTAATTGTGTGGCTCCAGGATTCGTTT
[0160] The primer Forward incorporates an NdeI restriction site at
the first ATG codon and the primer Rev inserts a UAA stop codon
followed by an EcoRI restriction site after nucleotide 1053. cDNAs
were digested with restriction nucleases NdeI and EcoRI and cloned
into pRSETc (Invitrogen) using standard molecular biology
techniques. The identity of the isolated cDNA was verified by DNA
sequence analysis (methodology is outlined in a later
paragraph).
[0161] A shorter cDNA, PTP-1B 298, encoding amino acid residues
1-298 was generated using oligonuclotide primers Forward and Rev2
and the clone described above as a template in a polymerase chain
reaction.
TABLE-US-00004 Rev2 SEQ ID NO: 3
TGCCGGAATTCCTTAGTCCTCGTGGGAAAGCTCC
EXAMPLE 12
PTP-1B Mutants
[0162] mutants of PTP-1B (amino acids 1-321), PTP-1B 298 (amino
acids 1-298) and PTP-1B 298-2M (with Cys32 and Cys92 changed to Ser
and Ala, respectively) were prepared by the single-stranded DNA
method (modification of Kunkel, 1985). 298-2M was made with the
following oligonucleotides:
TABLE-US-00005 C32S SEQ ID NO: 4 CTTGGCCACTCTAGATGGGAAGTCACT C92A
SEQ ID NO: 5 CCAAAAGTGACCGGCTGTGTTAGGCAA
[0163] The R47C mutant was made with the following
oligonucleotide:
TABLE-US-00006 R47C SEQ ID NO: 6 GGGACTGACGTCACAGTACCTATTTCG
[0164] Oligonucleotides were designed to contain the desired
mutations and 12 bases of flanking sequence on each side of the
mutation. The single-stranded form of the PTP-1B/pRSET, PTP-1B
298/pRSET and PTP-1B 298-2M/pRSET plasmid was prepared by
transformation of double-stranded plasmid into the CJ236 cell line
(1 .mu.l double-stranded plasmid DNA, 2 .mu.l 5.times. KCM salts, 7
.mu.l water, 10 .mu.l PEG-DMSO competent CJ236 cells; incubated on
ice for 20 minutes followed by 25.degree. C. for 10 minutes; plated
on LB/agar with 100 .mu.g/ml ampicillin and incubated at 37.degree.
C. overnight). Single colonies of CJ236 cells were then grown in
100 ml 2YT media to midlog phase; 5 .mu.l VCS helper phage
(Stratagene) were then added and the mixture incubated at
37.degree. C. overnight. Single-stranded DNA was isolated from the
supernatant by precipitation of phage (1/5 volume 20% PEG 8000/2.5M
NaCl; centrifuge at 12K for 15 minutes). Single-stranded DNA was
then isolated from phage using Qiagen single-stranded DNA kit.
[0165] Site-directed mutagenesis was accomplished as follows.
Oligonucleotides were dissolved in TE (10 mM Tris pH 8.0, 1 mM
EDTA) to a concentration of 10 OD and phosphorylated on the 5' end
(2 .mu.l oligonucleotide, 2 .mu.l 10 mM ATP, 2 .mu.l 10.times.
Tris-magnesium chloride buffer, 1 .mu.l 100 mM DTT, 12.5 .mu.l
water, 0.5 .mu.l T4 PNK; incubate at 37.degree. C. for 30 minutes).
Phosphorylated oligonucleotides were then annealed to
single-stranded DNA template (2 .mu.l single-stranded plasmid, 0.6
.mu.l oligonucleotide, 6.4 .mu.l water; heat at 94.degree. C. for 2
minutes, slow cool to room temperature). Double-stranded DNA was
then prepared from the annealed oligonucleotide/template (add 2
.mu.l 10.times. TM buffer, 2 .mu.l 2.5 mM dNTPs, 1 .mu.l 100 mM
DTT, 0.5 .mu.l 10 mM ATP, 4.6 .mu.l water, 0.4 .mu.l T7 DNA
polymerase, 0.2 .mu.l T4 DNA ligase; incubate at room temperature
for two hours). E. coli (XL1 blue, Stratagene) were then
transformed with the double-stranded DNA (5 .mu.l double-stranded
DNA, 5 .mu.l 5.times. KCM, 15 .mu.l water, 25 .mu.l PEG-DMSO
competent cells; incubate 20 minutes on ice, 10 min. at room
temperature), plated onto LB/agar containing 100 .mu.g/ml
ampicillin, and incubated at 37.degree. C. overnight. Approximately
four colonies from each plate were used to inoculate 5 ml 2YT
containing 100 .mu.g/ml ampicillin; these cultures were grown at
37.degree. C. for 18-24 hours. Plasmids were then isolated from the
cultures using Qiagen miniprep kit. These plasmids were sequenced
to determine which clones contained the desired mutation.
[0166] Mutant proteins were expressed as follows. PTP-1B clones
were transformed into BL21 codon plus cells (Stratagene) (1 .mu.l
double-stranded DNA, 2 .mu.l 5.times. KCM, 7 .mu.l water, 10 .mu.l
DMSO competent cells; incubate 20 minutes at 4.degree. C., 10
minutes at room temperature), plated onto LB/agar containing 100
.mu.g/ml ampicillin, and incubated at 37.degree. C. overnight. 2
single colonies were picked off the plates or from frozen glycerol
stocks of these mutants and inoculated in 100 ml 2YT with 50
.mu.g/ml carbenicillin and grown overnight at 37.degree. C. 50 ml
from the overnight cultures were added to 1.5 L of
2YT/carbenicillin (50 .mu.g/ml) and incubated at 37.degree. C. for
3-4 hours until late-log phase (absorbance at 600 nm
.about.0.8-0.9). At this point, protein expression was induced with
the addition of IPTG to a final concentration of 1 mM. Cultures
were incubated at 37.degree. C. for another 4 hours and then cells
were harvested by centrifugation (7K rpm, 7 minutes) and frozen at
-20.degree. C.
[0167] PTP-1B proteins were purified from the frozen cell pellets
as described in the following. First, cells were lysed in a
microfluidizer in 100 ml of buffer containing 20 mM MES pH 6.5, 1
mM EDTA, 1 mM DTT, and 10% glycerol buffer (with 3 passes through a
Microfluidizer [Microfluidics 110S]) and inclusion bodies were
removed by centrifugation (10K rpm, 10 minutes). Purification of
all PTP-1B mutants was performed at 4.degree. C. The supernatants
from the centrifugation were filtered through 0.45 .mu.m cellulose
acetate (5 .mu.l of this material was analyzed by SDS-PAGE) and
loaded onto an SP Sepharose fast flow column (2.5 cm
diameter.times.14 cm long) equilibrated in Buffer A (20 mM MES pH
6.5, 1 mM EDTA, 1 mM DTT, 1% glycerol) at 4 ml/min.
[0168] The protein was then eluted using a gradient of 0-50% Buffer
B over 60 minutes (Buffer B: 20 mM MES pH 6.5, 1 mM EDTA, 1 mM DTT,
1% glycerol, 1 M NaCl). Yield and purity was examined by SDS-PAGE
and, if necessary, PTP-1B was further purified by hydrophobic
interaction chromatography (HIC). Protein was supplemented with
ammonium sulfate until a final concentration of 1.4 M was reached.
The protein solution was filtered and loaded onto an HIC column at
4 ml/min in Buffer A2: 25 mM Tris pH 7.5, 1 mM EDTA, 1.4 M
(NH.sub.4).sub.2SO.sub.4, 1 mM DTT. Protein was eluted with a
gradient of 0-100% Buffer B over 30 minutes (Buffer B2: 25 mM Tris
pH 7.5, 1 mM EDTA, 1 mM DTT, 1% glycerol). Finally, the purified
protein was dialyzed at 4.degree. C. into the appropriate assay
buffer (25 mM Tris pH 8, 100 mM NaCl, 5 mM EDTA, 1 mM DTT, 1%
glycerol). Yields varied from mutant to mutant but typically were
within the range of 3-20 mg/L culture.
EXAMPLE 13
[0169] This example describes the synthesis of the compound
below
##STR00049##
which was made according to Scheme E.
##STR00050##
[0170] Commercially available 2-(4-aminophenyl)-ethylamine (0.69
ml, 5.24 mmol) was reacted with Fmoc-Asp(OtBu)-OSu (2.64 g, 5.19
mmol, Chem-Impex) and triethylamine (0.75 ml, 5.4 mmol) in 20 ml
DCM for 30 minutes. The reaction was flooded with 80 ml DCM, rinsed
with 2.times.50 ml saturated sodium bicarbonate, 50 ml brine, dried
over sodium sulfate, and solvent was removed under reduced pressure
to yield product quantitatively ((+) MS m/z-552 (M+Na)).
[0171] This was converted to the oxalamate using the oxalamating
reagent described by Mosher (Jonathan S. Nimitz and Harry S.
Mosher, J. Org. Chem. 1981 46 211-213) to yield a white foam (3.0
g, 4.61 mmol, 89%, (+) MS m/z=680 (M+Na)).
[0172] The Fmoc protecting group was removed with diethylamine (20
ml, 193 mmol) in DCM (20 ml) by reacting for 16 hours, at which
point the reaction was evaporated to dryness and purified using
flash chromatography on silica gel with 95:5 DCM:MeOH (0.1 M
ammonia) to yield the amine as an off-white foam (1.55 g, 3.55
mmol, 78%, (+) MS m/z=436 (M+Na)).
[0173] The activated acrylamide was synthesized according to Scheme
F.
##STR00051##
[0174] Acrylic acid (0.5 ml, 7.29 mmol) was reacted with
(chloromethylene)dimethyl ammonium chloride (1.12 g, 8.75 mmol) in
20 ml DCM for 25 minutes, followed by addition of
.beta.-alanine-OtBu-hydrochloride (1.6 g, 8.8 mmol) and
diisopropylethylamine (3.0 ml, 17.2 mmol). After 15 hours the
reaction was flooded with DCM (60 ml), rinsed with 2.times.50 ml 1
M sodium hydrogen sulfate, 2.times.50 ml saturated sodium
bicarbonate, 50 ml brine, dried over sodium sulfate, and solvent
removed under reduced pressure to yield product (1.07 g, 5.36 mmol,
73%, (+) MS m/z=222 (M+Na)). This was then redissolved in 20 ml dry
DCM, chilled in an ice-water bath, and reacted with 20 ml
trifluoroacetic acid for 30 minutes. The reaction mixture was then
evaporated to dryness, redissolved in DMF (5 ml), and pyridine (1.2
ml, 14.8 mmol) and pentafluorophenyl trifluoroacetate (1 ml, 5.8
mmol) were added. The reaction was allowed to proceed for 40
minutes, then flooded with EtOAc (75 ml), rinsed with 2.times.25 ml
1 M sodium hydrogen sulfate, 2.times.25 ml saturated sodium
bicarobonate, 25 ml brine, dried over sodium sulfate, filtered,
evaporated to dryness, and purified using flash chromatography with
60:40 hexane:EtOAc to yield a white crystalline solid (0.799 g,
2.58 mmol, 52%, (+) MS m/z=310 (M+H)).
[0175] The activated acrylamide (199 mg, 0.644 mmol) was reacted
with the amine (282 mg, 0.648 mmol) and diisopropylethylamine (0.14
ml, 0.804 mmol) in 5 ml DCM for 14 hours, at which time the
reaction was flooded with 50 ml EtOAc, rinsed with 2.times.25 ml 1
M sodium hydrogen sulfate, 25 ml saturated sodium bicarbonate, 25
ml brine, dried over sodium sulfate, filtered, evaporated to
dryness, and purified using flash chromatography on silica gel with
95:5 DCM:MeOH to yield a colorless resin (288 mg, 0.514 mmol, 79%
(+) MS m/z=561 (M+H)).
[0176] This material was dissolved in 10 ml DCM, chilled in an
ice-water bath, and deprotected with trifluoroacetic acid (10 ml).
The reaction was then removed from the ice-water bath and allowed
to stir at room temperature for 40 minutes before being evaporated
to dryness and purified using reverse-phase HPLC to yield the
titled compound as a white solid (47 mg, (+) MS m/z=449 (M+H)).
EXAMPLE 14
[0177] This example describes the synthesis of the compound
below
##STR00052##
[0178] This compound was made using the method of Example 13 except
that the disulfide linker was used instead of the acrylamide linker
(ES (+) MS m/z=544 (M+H)).
EXAMPLE 15
[0179] This example describes the synthesis of the compound
below
##STR00053##
[0180] This compound was made using the method of Example 3 except
that the brocoacetamide linker was used instead of the acylamide
linker (ES (+) MS m/z=489 (M+H)).
EXAMPLE 16
[0181] This example describes the synthesis of the compound
below
##STR00054##
which was made according to Scheme C.
##STR00055##
[0182] Commercially available Boc-D-Phe(4-nitro)-OH (2.05 g, 6.61
mmol, Chem-Impex) was dissolved in 30 ml dry THF, chilled in an
ice-water bath, and reacted with N-Methylmorpholine (0.74 ml, 6.73
mmol) and isobutyl chloroformate (0.86 ml, 6.63 mmol). The reaction
was stirred on ice for 20 minutes, then filtered through a medium
glass frit and the precipitate rinsed with 2.times.5 ml THF. The
combined filtrates were then cooled in an ice-water bath again and
reduced with sodium borohydride (1.25 g, 33 mmol) along with 7 ml
methanol. The reaction was allowed to proceed for 10 minutes,
quenched with 50 ml 1 M sodium hydrogen sulfate (aqueous), and
extracted with 100 ml EtOAc. The organics were then rinsed with 50
ml 1 M sodium hydrogen sulfate, 50 ml saturated sodium bicarbonate,
and 50 ml brine, dried over sodium sulfate, filtered, and
evaporated to dryness to yield product alcohol (1.82 g, 6.15 mmol,
93%, ES (+) MS m/z-319 (M+Na).
[0183] This alcohol was suspended in 40 ml DCM, chilled in an
ice-water bath, and treated with 25 ml trifluoroacetic acid. The
reaction was warmed to room temperature and allowed to proceed for
25 minutes, and then evaporated to dryness. The material was then
resuspended in 20 ml DCM and reacted with triethylamine (2.6 ml,
18.7 mmol) and Fmoc-Asp(OtBu)-OSu (3.18 g, 6.25 mmol) along with
another 20 ml DCM. The reaction was allowed to proceed for 40
minutes and then flooded with 60 ml DCM, rinsed with 50 ml 1 M
sodium hydrogen sulfate, 50 ml saturated sodium bicarbonate, and 50
ml brine, dried over sodium sulfate, filtered, and solvent removed
under reduced pressure. The residue was purified by flash
chromatography on silica gel using 95:5 DCM:MeOH to yield product
(2.05 g, 3.48 mmol, 57%, ES (+) MS m/z=612 (M+Na).
[0184] The alcohol was dissolved in 50 ml DCM, chilled in an
ice-water bath, and treated with triethylamine (0.56 ml, 4.02 mmol)
and methanesulfonyl chloride (0.3 ml, 3.88 mmol). The reaction was
allowed to proceed on ice for 30 minutes before being flooded with
50 ml DCM, rinsed with 50 ml 1 M sodium hydrogen sulfate, 50 ml
saturated sodium bicarbonate, 50 ml brine, dried over sodium
sulfate, filtered, and the solvent removed under reduced pressure
to yield a yellow solid. This was dissolved in 10 ml DMF and
treated with potassium thioacetate (0.42 g, 3.68 mmol) and 10 ml
more DMF. The reaction was allowed to proceed for 18 hours before
being flooded with 100 ml EtOAc, rinsed with 2.times.50 ml 1 M
sodium hydrogen sulfate, 2.times.50 ml saturated sodium
bicarbonate, 50 ml brine, dried over sodium sulfate, evaporated to
dryness, and purifed using flash chromatography on silica gel with
70:30 hexane:EtOAc to obtain the thioester as a yellow solid (0.588
g, 0.908 mmol, 26%, two steps, ES (+) MS m/z=670 (M+Na).
[0185] The nitro group was selectively reduced by dissolving the
above compound (0.464 g, 0.716 mmol) in 5 ml methanol, chilling in
an ice-water bath, and adding ammonium chloride (0.773 g, 14.5
mmol) and zinc dust (0.244 g, 3.73 mmol) along with another 15 ml
methanol. The reaction was slowly allowed to warm to room
temperature and allowed to proceed overnight under nitrogen, at
which point it was filtered through celite and evaporated. The
residue was redissolved in 100 ml EtOAc, rinsed with 3.times.50 ml
saturated sodium bicarbonate, 50 ml brine, dried over sodium
sulfate, filtered, and evaporated to a yellow foam (0.43 g, 0.696
mmol, 97%, ES (+) MS m/z=618 (M+H)).
[0186] The xalamate was installed as described in Scheme E and
purified using flash chromatography, first with 70:30 hexane:EtOAc,
then 50:50 hexane:EtOAc to yield product as a light yellow foam
(0.280 mg, 0.375 mmol, 54%, ES (+) MS m/z=768 (M+Na).
[0187] The cystamine-based-thiosulfonate was synthesized by
dissolving N-Boc-cysteamine (25.7 g, 145 mmol) in dimethylsulfoxide
(DMSO, 50 ml, 704 mmol) and heating to 70 degrees C. for 4 days
open to the air. The reaction was then flooded with 300 ml EtOAc,
rinsed with 3.times.100 ml water, 100 ml brine, dried over sodium
sulfate, filtered, and evaporated to dryness to produce the
disulfide as a white solid (25 g, 71 mmol, 98%). This was oxidized
to the thiosulfonate by dissolving it in 400 ml DCM, chilling the
reaction in an ice-water bath, and adding meta-chloro-peroxybenzoic
acid (64 g of 77% commercial material from Aldrich, 286 mmol) in
portions over 15 minutes. As precipitate formed 200 ml more DCM was
also added. After 3 hours the reaction was filtered through a glass
frit and the precipitate washed with 3.times.50 ml DCM. The
combined filtrate was rinsed with 2.times.100 ml saturated sodium
bicarbonate, 2.times.100 ml 50% saturated sodium bicarbonate, 100
ml water, and 100 ml brine, dried over sodium sulfate, filtered,
and evaporated to a viscous yellow syrup which slowly solidified to
a hard crystalline solid over the course of a week (14.7 g, 38.2
mmol, 54%, ES (+) MS m/z=407 (M+Na)).
[0188] The thioester was converted to a disulfide by dissolving it
(0.272 g, 0.365 mmol) in 5 ml ethanol and adding the thiosulfonate
described above. This was then sparged under nitrogen, and
hydroxylamine (0.1 ml, 1.63 mmol, 50% in water) was added. The
reaction was allowed to proceed for three hours, at which point it
was flooded with EtOAc (50 ml), rinsed with 3.times.25 ml saturated
sodium bicarbonate, 25 ml brine, dried over sodium sulfate,
filtered, evaporated to dryness, and purified using flash
chromatography on silica gel with 70:30 hexane:EtOAc to yield an
off-white foam (0.179 g, 0.204 mmol, 56%, ES (+) MS m/z=901
(M+Na)).
[0189] The Fmoc group was removed by dissolving the material in 5
ml DCM and reacting it with diethylamine (5 ml, 48 mmol) for 15
hours. The reaction was then evaporated to dryness and purified by
flash chromatography on silica gel with 95:5 DCM:MeOH (0.1 M
ammonia). The amine was obtained as an off-white foam (0.117 g,
0.178 mmol, 89%, ES (+) MS m/z=657 (M+H)).
[0190] The amine (0.114 g, 0.174 mmol) was coupled to the
acrylamide active ester (0.067 g, 0.217 mmol) described earlier
(Scheme E) in DCM (5 ml) with diisopropylethylamine (0.05 ml, 0.287
mmol) for 69 hours. The reaction was then flooded with 50 ml EtOAc,
rinsed with 2.times.25 ml 1 M sodium hydrogen sulfate, 2.times.25
ml saturated sodium bicarbonate, 25 ml brine, dried over sodium
sulfate, filtered, evaporated to dryness, and purified using flash
chromatography on silica gel with 95:5 DCM:MeOH to obtain product
quantitatively (ES (+) MS m/z=782 (M+H)).
[0191] This material was globally deprotected by dissolving it in
DCM (10 ml), chilling it in an ice-water bath, and adding 10 ml
trifluoroacetic acid. The reaction was then warmed to room
temperature and allowed to proceed for 35 minutes before being
evaporated to dryness and purified by reverse-phase HPLC to obtain
the titled compound as a white solid (0.039 g, 0.056 mmol, 32%, ES
(+) MS m/z=569 (M+H)).
EXAMPLE 17
[0192] This example describes the synthesis of the compound
below
##STR00056##
[0193] This compound was made using the method of Example 16 except
that the S-enantiomer of Boc-Phe(4-nitro)-OH was used (ES (+) MS
m/z=569 (M+H)).
EXAMPLE 18
[0194] This example describes the synthesis of the compound
below
##STR00057##
which was made according to Scheme H.
##STR00058##
[0195] This method is similar to the method of Example 13 except
for the following. The H.sub.2N-Phe(4-nitro)-CH.sub.2OH was
conjugated to Boc-Ser(OtBu)-OH using an EDC coupling. This was done
by dissolving Boc-Ser(OtBu)-OH (1.75 g, 6.7 mmol), HOBT (0.99 g,
7.33 mmol) and EDC (1.4 g, 7.3 mmol) in 20 ml dry DMF. The freshly
deprotected H2N-Phe(4-nitro)-CH2OH was then dissolved in 10 ml dry
DMF and N,N-diisopropylethylamine (DIEA, 3.7 ml, 21.2 mmol) was
added. This amine solution was added to the activated acid solution
along with another 10 ml dry DMF, and the reaction was allowed to
stir for 40 minutes at ambient temperature. The reaction was then
flooded with 100 ml EtOAc, rinsed with 2.times.50 ml 1 M sodium
hydrogen sulfate, 2.times.50 ml saturated sodium bicarbonate, and
50 ml saturated sodium chloride, dried over sodium sulfate,
filtered, and evaporated to dryness to yield product which was used
without further purification (ES (+) MS m/z=462 (M+Na)).
[0196] The bromoacetamide portion of the molecule was constructed
as follows. H-.beta.-Ala-OtBu (1.01 g, 5.56 mmol) was dissolved in
40 ml dry DCM, chilled in an ice-water bath, and then DIEA (2.0 ml,
11.5 mmol) and bromoacetylbromide (0.49 ml, 5.63 mmol) were added
and the reaction allowed to proceed on ice for 30 minutes. The
reaction was then flooded with 60 ml DCM, rinsed with 2'50 ml
saturated sodium bicarbonate and 50 ml brine, dried over sodium
sulfate, filtered, and evaporated to dryness. The resulting product
was purified by flash chromatography using 60:40 hexane:EtOAc to
yield a pale yellow liquid (1.198 g, 4.5 mmol, 81%, ES (+) MS
m/z=288 (M+Na)). The t-butyl protecting group was removed by
dissolving the ester in 20 ml dry DCM, chilling the reaction in an
ice-water bath, and adding 20 ml TFA. The reaction was allowed to
stir for 30 minutes and then evaporated to dryness to yield the
free acid as a light tan syrup which was used without further
purification (ES (+) MS m/z=212 (M+H)).
[0197] After installation of the oxalamate functionality, the
Boc-group of the serine was selectively removed by treating the
peptide (97 mg, 0.163 mmol) with neat formic acid (4 ml) at ambient
temperature for 20 minutes. The formic acid was then removed by
rotary evaporation. Meanwhile, the bromoacetamide-containing acid
fragment was activated by dissolving it (89 mg, 0.334 mmol) in 2 ml
dry DCM, adding Villsmeier Reagent (46 mg, 0.359 mmol), and 3 ml
more DCM and allowing the reaction to proceed for 5 minutes. The
freshly deprotected peptide redissolved in DCM was then added along
with DIEA (0.2 ml, 1.15 mmol). The coupling reaction was allowed to
proceed for only 10 minutes, then evaporated to dryness,
redissolved in 50 ml EtOAc, rinsed with 2.times.25 ml 1 M sodium
hydrogen sulfate, 2.times.25 ml saturated sodium bicarbonate, and
25 ml brine, dried over sodium sulfate, filtered, and evaporated to
dryness. The product was purified using flash chromatography, first
with 80:20 EtOAc:hexane, then pure EtOAc, and finally 95:5 DCM:
MeOH. Pure product was obtained as a light yellow foam (20 mg,
0.029 mmol, 18%, ES (+) MS m/z 689 (M+H)).
[0198] This material was dissolved in 10 ml dry DCM and treated
with 10 ml TFA. The reaction was allowed to proceed for 1.75 hours,
at which point it was evaporated to dryness and the product
purified by reverse-phase HPLC to obtain SP-5899 as a white solid
(3.6 mg, 0.0062 mmol, 21%, ES (+) MS m/z=577 (M+H)).
EXAMPLE 19
[0199] This example describes the synthesis of the compound
below
##STR00059##
[0200] This compound was made using the method of Example 16 except
that the S-enantiomer of Boc-Phe(4-nitro)-OH was used (ES (+) MS
m/z=577 (M+H)).
EXAMPLE 20
[0201] This example describes the synthesis of the compound
below
##STR00060##
which was made according to Scheme I.
##STR00061##
[0202] 2-cyanomethyl benzoic acid methyl ester (6.03 g, 34.4 mmol)
was cooled in an ice water bath, to which was added concentrated
sulfuric acid (25 ml) and 70% nitric acid (3 ml). The reaction was
allowed to proceed on ice for 40 minutes, at which point it was
poured onto ice (50 grams) and flooded with water (50 ml) and EtOAc
(50 ml). This mixture was stirred vigorously on ice and then
filtered through a medium glass frit. The precipitate was washed
with 2.times.25 ml EtOAc and dried under reduced pressure to yield
an off-white solid (1.96 g, 8.24 mmol, 24%, ES (+) MS m/z=261
(M+Na)) which was used without further purification.
[0203] The nitrobenzene compound (1.89 g, 7.93 mmol) was
transferred to a teflon-capped glass "bomb," and a solution of 1 M
borane methyl sulfide complex in THF was added (32 ml, 64 mmol).
The bomb was sealed and heated to 65 deg. C. for 14 hours. The bomb
was then cooled in an ice-water bath, carefully opened, and the
reaction very carefully quenched with methanol (10 ml) and
concentrated HCl (10 ml). The solution was then heated to 65 deg.
C. for 30 minutes, after which point the acid was neutralized with
1 N NaOH (140 ml) and the mixture extracted with 4.times.30 ml
EtOAc. The combined organic layers were rinsed with 3.times.50 ml 1
N NaOH and 50 ml saturated NaCl, dried over sodium sulfate,
filtered, and evaporated to dryness to yield the amino alcohol as
an orange liquid (100%, ES (+) MS m/z=197 (M+H)). The remaining
steps were carried out using the corresponding method as described
for the compound in Example 17 to yield the titled compound (ES (+)
MS m/z=577 (M+H)).
EXAMPLE 21
[0204] This example describes the synthesis of the compound
below
##STR00062##
which was made according to Scheme J
##STR00063## ##STR00064## [0205] a) Boc-4-nitro-D-phenylalanine
(5.0 g, 16.11 mmol) was dissolved in 75 mL THF and cooled to
0.degree. C. under a nitrogen atmosphere. N-methylmorpholine (1.81
mL, 16.43 mmol) was added followed by isobutylchloroformate (ICBF)
(2.11 mL, 16.27 mmol). The reaction was stirred at 0.degree. C. for
15 minutes and then filtered through a coarse glass frit funnel.
Sodium borohydride (3.04 g, 80.39 mmol) was added to the filtrate
and the solution stirred for 20 minutes at 0.degree. C. The
reaction was flooded with 100 mL 1 M NaHSO.sub.4 and extracted with
3.times.30 mL EtOAc. The combined organic layers were washed with
30 mL 1 M NaHSO.sub.4, 30 mL saturated NaHCO.sub.3, 30 mL brine,
dried over anhydrous Na.sub.2SO.sub.4, filtered, and the solvent
removed under reduced pressure. The resulting residue was dissolved
in 10 mL DCM and 10 mL TFA was added. The solution was stirred for
1 hour at which point the solvent was removed under reduced
pressure to yield Compound I in quantitative yield, ES (+) MS
m/e=197 (M+H) which was used without further purification. [0206]
b) Compound I (2.98 g, 15.19 mmol) was dissolved in 15 ml, DMF and
DIEA (13.23 mL, 75.95 mmol) was added. This solution was added to a
mixture of Boc-O-(t-butyl) ether)-L-serine (4.36 g, 16.71 mmol),
1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (3.49 g,
18.23 mmol) and 1-hydroxybenzotriazole (2.46 g, 18.23 mmol) in 75
mL DMF. This solution was stirred at ambient temperature for 1 hour
at which point it was flooded with 200 mL EtOAc, rinsed with
2.times.50 mL 1 M NaHSO.sub.4, 2.times.50 mL saturated NaHCO.sub.3,
50 mL brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and
the solvent removed under reduced pressure to yield Compound II
(5.73 g, 13.04 mmol, 86%), ES (+) MS m/e=462 (M+Na) which was used
without further purification. [0207] c) Compound II (5.73 g, 13.04
mmol) was dissolved in 50 mL MeOH and palladium on carbon (2.77 g,
1.30 mmol) was added. The reaction was stirred at ambient
temperature under a hydrogen balloon for 4 hours. The reaction was
filtered through celite and the solvent removed under reduced
pressure to yield Compound III (4.11 g, 10.0 mmol, 77% yield), ES
(+) MS m/e=410 (M+1) which was used without further purification.
[0208] d) Compound III (4.11 g, 10.0 mmol) was dissolved in 30 mL
DCM and mixed with imidazol-1-yl-oxo-acetic acid tert-butyl ester
(1.97 g, 10.04 mmol) in 20 mL DCM. The reaction was stirred at
ambient temperature for 15 hours at which point the DCM was removed
under reduced pressure and the residue redissolved in 50 mL EtOAc.
The reaction was washed with 2.times.10 mL 1 M NaHSO.sub.4,
2.times.10 mL saturated NaHCO.sub.3, 10 mL brine, dried over
anhydrous Na.sub.2SO.sub.4, filtered, and the solvent removed under
reduced pressure to yield Compound IV (4.68, 8.70 mmol, 87%), ES
(+) MS m/e=560 (M+Na) which was used without further purification.
[0209] e) Compound IV (1.0 g, 1.86 mmol) was dissolved in 2 mL MeOH
and lithium hydroxide (0.045 g, 1.86 mmol) in 2 mL water was added.
The solution was stirred for 0.5 hours and then flooded with 30 mL
1 M NaHSO.sub.4 and extracted with 3.times.10 mL EtOAc. The
combined organic layers were washed with 15 mL 1 M NaHSO.sub.4, 15
mL brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and the
solvent removed under reduced pressure. The crude residue was then
dissolved in 5 mL 4:1 Benzene:MeOH and (trimethylsilyl)diazomethane
(0.229 mL, 0.457 mmol) was added drop wise. The solvents were
removed and the residue redissolved in 10 mL DCM. 1 mL TFA was
added and the solution stirred at ambient temperature for 10
minutes. The solvent was removed under reduced pressure to yield
Compound V in quantitative yield, ES (+) MS m/e=396 (M+H) which was
used without further purification. [0210] f) Compound V (0.157 g,
0.398 mmol) was dissolved in 2 mL DCM and triethylamine (TEA)
(0.166 mL, 1.19 mmol) was added followed by acetic anhydride (0.038
mL, 0.398 mmol). The reaction was stirred for 1 hour at ambient
temperature, flooded with 20 mL EtOAc, washed with 2.times.5 mL 1 M
NaHSO.sub.4, 2.times.5 mL saturated NaHCO.sub.3, 5 mL brine, dried
over anhydrous Na.sub.2SO.sub.4, filtered, and the solvent removed
under reduced pressure to yield Compound VI (0.127 g, 0.290 mmol,
73%), ES (+) MS m/e=460 (M+Na) which was used without further
purification. [0211] g) Compound VI (0.127 g. 0.290 mmol) was
dissolved in 2.5 mL DCM and 2.5 mL TFA was added and the reaction
stirred at ambient temperature for 3 hours. The solvent was removed
under reduced pressure and the residue was redissolved in 2.5 mL
MeOH. Lithium hydroxide (0.014 g, 0.58 mmol) in 2.5 mL water was
added and the reaction stirred for 1 hour. The solvent was removed
and the crude residue purified by reverse-phase preparatory HPLC to
afford Compound VII (0.007 g, 0.019 mmol, 7%), ES (+) MS: m/e=368
(M+1).
EXAMPLE 22
[0212] This example describes the synthesis of the compound
below
##STR00065##
which was made according to Scheme K
##STR00066## [0213] a) Compound VIII was prepared according to the
method of Example 21b followed by TFA deprotection (Example 21a)
except starting from N-1-Fmoc-1,3-diaminopropane HCl instead of
Compound I and using Boc-4-nitro-D-phenylalanine instead of
Boc-O-(t-butyl ether)-L-serine, ES (+) MS m/e=525 (M+Na) [0214] b)
Compound IX was prepared by treating Compound VIII according to the
methods of Example 21b, e (TFA deprotection only), f, c, and d. The
resulting residue was then dissolved in 5 mL DCM and 5 mL
diethylamine (DEA) was added. The solution was stirred at ambient
temperature for 16 hours, the solvent removed under reduced
pressure and the residue purified by silica gel chromatography
using CHCl.sub.3:2 M NH.sub.3 in MeOH 9:1, yielding Compound IX
(0.173 g, 0.306 mmol, 38% yield), ES (+) MS m/e=550 (M+1). [0215]
c) Compound X was prepared by treating Compound IX according to the
method of Example 21b followed by the TEA deprotection and HPLC
purification portions of 21h except starting from
2-[3-(trifluoromethyl)phenyl]-1,3-thiazole-4-carboxylic acid
instead of Boc-O-(t-butyl ether)-L-serine, ES (+) MS m/e=693
(M+H).
EXAMPLE 23
[0216] This example describes the synthesis of the compound
below
##STR00067##
which was made according to Scheme L
##STR00068## [0217] a) Compound XI was prepared according to the
methods of Examples 22a-b except starting from
N-1-Fmoc-1,4-diaminobutane HCL instead of
N-1-Fmoc-1,3-diaminopropane HCL, ES (+) MS m/e 564 (M+H). [0218] b)
Compound XI (0.173 g, 0.307 mmol) was dissolved in 1 mL DCM, DIEA
(0.043 mL, 0.307 mmol) was added and this solution was added to
4-biphenylsulfonyl chloride (0.078 g, 0.307 mmol) dissolved in 1 mL
DCM. This mixture was stirred at ambient temperature for 0.5 hour
at which point it was flooded with 20 mL DCM, washed with 2.times.5
mL 1 M NaHSO.sub.4, 5 mL brine, dried over anhydrous
Na.sub.2SO.sub.4, filtered, and the solvent removed under reduced
pressure. The residue was dissolved in 2 mL DCM, 2 mL TFA was added
and the reaction stirred for 0.5 hour. The solvent was removed and
the crude residue purified by reverse-phase preparatory HPLC to
afford Compound XII (0.025 g, 0.037 mmol, 12%), ES (+) MS: m/e=668
(M+1).
EXAMPLE 24
[0219] This example describes the synthesis of the compound
below
##STR00069##
[0220] This compound was prepared essentially according to the
methods of Example 22 except starting from .beta.-alanine benzyl
etser-p-toluenesulfonate salt instead of
N-1-Fmoc-1,3-diaminoproprionic HCl. ES (+) MS m/e=680 (M+H).
EXAMPLE 25
[0221] This example describes the synthesis of the compound
below
##STR00070##
[0222] This compound was prepared according to the method of
Example 24 except using 4-phenyl-M-anisidine hydrochloride instead
of 6-(2-amino-1,3-thiazole-4-yl)-1,2,3,4-tetrahydroquinolin-2-on.
ES (+) MS m/e=634 (M+H).
EXAMPLE 26
[0223] This example describes the synthesis of the following
compound
##STR00071##
which was synthesized according to Scheme M and the procedure
below.
##STR00072##
[0224] Commercially available 4-aminobenzoic acid (2.24 g, 16.3
mmol) was suspended in dichloromethane ("DCM", 40 ml) under
nitrogen and diisopropylethylamine ("DIEA", 2.9 ml, 16.6 mmol) was
added with stirring. After 20 minutes most of the solid had
dissolved, and the oxalamating reagent was added (see e.g.,
Jonathan S. Nimitz and Harry S. Mosher, J. Org. Chem. 46: 211-213
(1981)). After one hour the reaction was diluted with 60 ml DCM,
rinsed with 3.times.50 ml 1 M NaHSO.sub.4 and 50 ml brine, and
evaporated to dryness to yield an off-white solid (3.34 g, 12.6
mmol, 77%, (+) MS m/z=288 (M+Na)).
[0225] This acid (0.440 g, 1.66 mmol) was mixed with
1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride ("EDC",
0.328 g, 1.71 mmol) and 1-hydroxybenzotriazole ("HOBT", 0.225 g,
1.71 mmol) and dissolved in dry dimethylformamide ("DMF", 5 ml) and
stirred at room temperature. Meanwhile, .beta.-alanine was
suspended in dry DCM (10 ml) and DIEA (1.4 ml, 8.0 mmol) and
trimethylsilyl chloride ("TMSCl", 1.0 ml, 7.9 mmol) were added and
the solution refluxed at 50.degree. C. for one hour to yield a
homogeneous golden solution. This was added to the activated acid
along with 5 ml more DMF. The reaction was allowed to proceed for
30 minutes at which time it was flooded with 100 ml EtOAc, rinsed
with 4 times 50 ml 1 M NaHSO4 and 50 ml brine, dried over sodium
sulfate, evaporated to dryness, and purified by flash
chromatography using 95:5:1 DCM:MeOH:AcOH. The product-containing
fractions were coevaporated from toluene to remove acetic acid and
dried to yield a white solid (0.465 g, 1.38 mmol, 83%, (+) MS
m/z=337 (M+H)) consisting of product as well as residual HOBT.
[0226] The thiol was synthesized by mixing 3-aminopropylbromide
hydrobromide (3.98 g, 18.2 mmol) with BOC anhydride (4.01 g, 18.4
mmol), dissolving the mixture in 25 ml water, and adding 18 ml of 1
N NaOH in water. After stirring for 18 hours the reaction was
extracted with 100 ml EtOAc and the organic layer rinsed with
3.times.50 ml 1 M NaHSO4 and 50 ml brine, dried over sodium
sulfate, filtered, and evaporated to dryness to yield the product
bromide as a pale yellow syrup (3.98 g, 16.7 mmol, 92%, (+) MS
m/z=260/262 (M+Na)). This material (0.958 g, 4.02 mmol) was
dissolved in 5 ml dry DMF and treated with potassium thioacetate
(0.484 g, 4.24 mmol) and 5 ml more DMF and allowed to react under
nitrogen for 2 days. To this was then added hydroxylamine (1 ml of
50% in water, 16.3 mmol) and the reaction allowed to proceed for 2
hours, at which point it was flooded with 80 ml EtOAc, rinsed with
2.times.40 ml saturated sodium bicarbonate, 2.times.40 ml 1 M
NaHSO4, and 40 ml brine, dried over sodium sulfate, filtered, and
evaporated to dryness to yield a 1:2 mixture of thiol disulfide as
a pale yellow syrup (0.719 g, 3.76 mmol, 93%, (+) MS m/z=403
(M+Na)). This was fully reduced to the free thiol by dissolving it
(0.499 mg, 1.31 mmol) in 5 ml methanol and adding a solution of
tris(2-carboxyethyl)phosphine hydrochloride in 3 ml 1 M NaOH in
water, along with another 5 ml methanol. After stirring for one
hour under nitrogen, the reaction was flooded with 50 ml EtOAc,
rinsed with 2.times.25 ml saturated sodium bicarbonate, 25 ml 1 M
NaHSO4, and 25 ml brine, dried over sodium sulfate, filtered, and
evaporated to dryness to yield product thiol as an almost colorless
oil (0.466 g, 2.44 mmol, 93%, (+) MS m/z=214 (M+Na)).
[0227] The thiol was conjugated to the acid as follows. First, the
acid (268 mg, 0.796 mmol) was mixed with EDC (162 mg, 0.845 mmol)
and HOBT (108 mg, 799 mmol) and dissolved in 5 ml dry DMF. The
thiol (160 mg, 0.836 mmol) was added along with another 3 ml dry
DMF. Finally, DIEA (0.3 ml, 1.72 mmol) was added and the reaction
allowed to proceed for 45 minutes. The reaction was then flooded
with 50 ml EtOAc, rinsed with 2.times.25 ml 1 M NaHSO4, 2.times.25
ml saturated sodium bicarbonate, and 25 ml brine, dried over sodium
sulfate, filtered, evaporated to dryness, and purified by flash
chromatography using 50:50 EtOAc:hexane to yield pure thioester as
a white foam (186 mg, 0.365 mmol, 46%, (+) MS m/z=510 (M+H)).
[0228] This material (58 mg, 0.114 mmol) was dissolved in 4 ml dry
DCM and TFA (4 ml) was added. The reaction was allowed to stir at
room temperature for 30 minutes, then evaporated to dryness. This
material was then resuspended in 3 ml dry THF and bromoacetyl
bromide (0.03 ml, 0.345 mmol) and DIEA (0.1 ml, 0.574 mmol) was
added, followed by 3 ml dry DMF. After 30 minutes the reaction was
flooded with 50 ml EtOAc, rinsed with 3.times.25 ml 1 M NaHSO4 and
25 ml brine, dried over sodium sulfate, filtered, evaporated to
dryness, and purified by reverse phase chromatography to yield the
desired product (5.2 mg, 0.011 mmol, 10%, (+) MS m/z=496/498
(M+Na)).
EXAMPLE 27
[0229] This example describes the synthesis of the following
compound
##STR00073##
[0230] This compound was synthesized according to the procedure in
Example 3 except for using commercially available N-BOC-cysteamine
as the thiol instead of
##STR00074##
(ES (+) MS m/z=460/462 (M+H)).
EXAMPLE 28
[0231] This example describes the procedure for modifying R47C
mutant of PTP-1B with the extender whose synthesis was described in
Example 27. This extender comprises a first functionality, a
cleavable linker with a latent second functionality and a
phosphotyrosine mimetic.
[0232] Freshly prepared or freshly unfrozen (from -80 deg. C.)
aliquots of PTP-1B R47C (2.times.1.8 ml, 1.7 mg/ml) were treated
with 0.02 ml of freshly prepared or freshly thawed 1 M
dithiothreitol ("DTT"), concentrated in Ultrafree 4 ml 5000 MWCO
units (Millipore), and exchanged into 100 mM Tris buffer (pH 8)
using a Nap-5 column (Pharmacia Biotech). To this solution (1 ml)
was added 0.02 ml of 25 mM extender in dimethylsulfoxide (DMSO)
thereby forming a PTP-1B-extender complex. The solution was
carefully but thoroughly mixed and then centrifuged briefly to
pellet any precipiate. The reaction was allowed to proceed for 15
minutes. After 15 minutes, excess extender was quenched with 0.01
ml 1 M DTT and the thioester was deprotected (thereby exposing the
second functionality, the thiol) with 0.1 ml of 0.5 M hydroxylamine
hydrochloride in 1 M Tris buffer (pH 8) thereby forming a modified
PTP-1B-extender complex. The deprotection was allowed to proceed
for at least 5 hours, after which another 0.02 ml 1 M DTT was
added, the solution was concentrated in Ultrafree-4 ml 5000 MWCO
units (Millipore), and then purified into 100 mM Tris 8 buffer via
Nap-5. The resulting protein was cleanly and quantitatively
modified as shown in FIG. 4.
EXAMPLE 29
[0233] This example describes two illustrative assays to measure
the activity of PTP-1B.
[0234] pNPP Assay: This assay is performed with 5 mM
para-nitrophenyl-phosphate (pNPP) substrate at pH 7 in a 100 ul
total reaction volume. Upon addition of 750 ng PTP, the reaction is
measured over 15 minutes (OD405-OD655) and IC50s determined using 5
minute and 15 minute rates. Compounds are tested at 7
concentrations using 3-fold dilutions. 1 mM pNPP is used for
screening. V.sub.max and K.sub.m are determined to verify
competitive inhibition according to classical Michaelis-Menten
kinetics.
[0235] Insulin Receptor Kinase (IRK) peptide assay: The IRK peptide
corresponds to the triphosphorylated segment of the insulin
receptor kinase activation loop. This assay is performed using 100
uM peptide, 0.5 pmol of PTP-1B protein at pH 7 for 15 minutes at
room temperature. The malachite green reagent, consisting of 3:1
malachite green:ammonium molybdate with 0.5% Tween 20, is added and
the mixture incubated at room temperature for 30 minutes.
Absorbance at 655 nm is measured. Compounds are tested at 7
concentrations using 3-fold dilutions.
Sequence CWU 1
1
9130DNAHomo sapiens 1gcccatatgg agatggaaaa ggagttcgag 30240DNAHomo
sapiens 2gcgacgcgaa ttcttaattg tgtggctcca ggattcgttt 40334DNAHomo
sapiens 3tgccggaatt ccttagtcct cgtgggaaag ctcc 34427DNAHomo sapiens
4cttggccact ctagatggga agtcact 27527DNAHomo sapiens 5ccaaaagtga
ccggctgtgt taggcaa 27627DNAHomo sapiens 6gggactgacg tcacagtacc
tatttcg 277298PRTHomo sapiens 7Met Glu Met Glu Lys Glu Phe Glu Gln
Ile Asp Lys Ser Gly Ser Trp 1 5 10 15Ala Ala Ile Tyr Gln Asp Ile
Arg His Glu Ala Ser Asp Phe Pro Cys 20 25 30Arg Val Ala Lys Leu Pro
Lys Asn Lys Asn Arg Asn Arg Tyr Arg Asp 35 40 45Val Ser Pro Phe Asp
His Ser Arg Ile Lys Leu His Gln Glu Asp Asn 50 55 60Asp Tyr Ile Asn
Ala Ser Leu Ile Lys Met Glu Glu Ala Gln Arg Ser65 70 75 80Tyr Ile
Leu Thr Gln Gly Pro Leu Pro Asn Thr Cys Gly His Phe Trp 85 90 95Glu
Met Val Trp Glu Gln Lys Ser Arg Gly Val Val Met Leu Asn Arg 100 105
110Val Met Glu Lys Gly Ser Leu Lys Cys Ala Gln Tyr Trp Pro Gln Lys
115 120 125Glu Glu Lys Glu Met Ile Phe Glu Asp Thr Asn Leu Lys Leu
Thr Leu 130 135 140Ile Ser Glu Asp Ile Lys Ser Tyr Tyr Thr Val Arg
Gln Leu Glu Leu145 150 155 160Glu Asn Leu Thr Thr Gln Glu Thr Arg
Glu Ile Leu His Phe His Tyr 165 170 175Thr Thr Trp Pro Asp Phe Gly
Val Pro Glu Ser Pro Ala Ser Phe Leu 180 185 190Asn Phe Leu Phe Lys
Val Arg Glu Ser Gly Ser Leu Ser Pro Glu His 195 200 205Gly Pro Val
Val Val His Cys Ser Ala Gly Ile Gly Arg Ser Gly Thr 210 215 220Phe
Cys Leu Ala Asp Thr Cys Leu Leu Leu Met Asp Lys Arg Lys Asp225 230
235 240Pro Ser Ser Val Asp Ile Lys Lys Val Leu Leu Glu Met Arg Lys
Phe 245 250 255Arg Met Gly Leu Ile Gln Thr Ala Asp Gln Leu Arg Phe
Ser Tyr Leu 260 265 270Ala Val Ile Glu Gly Ala Lys Phe Ile Met Gly
Asp Ser Ser Val Gln 275 280 285Asp Gln Trp Lys Glu Leu Ser His Glu
Asp 290 2958296PRTHomo sapiens 8Met Pro Thr Thr Ile Glu Arg Glu Phe
Glu Glu Leu Asp Thr Gln Arg 1 5 10 15Arg Trp Gln Pro Leu Tyr Leu
Glu Ile Arg Asn Glu Ser His Asp Tyr 20 25 30Pro His Arg Val Ala Lys
Phe Pro Glu Asn Arg Asn Arg Asn Arg Tyr 35 40 45Arg Asp Val Ser Pro
Tyr Asp His Ser Arg Val Lys Leu Gln Asn Ala 50 55 60Glu Asn Asp Tyr
Ile Asn Ala Ser Leu Val Asp Ile Glu Glu Ala Gln65 70 75 80Arg Ser
Tyr Ile Leu Thr Gln Gly Pro Leu Pro Asn Thr Cys Cys His 85 90 95Phe
Trp Leu Met Val Trp Gln Gln Lys Thr Lys Ala Val Val Met Leu 100 105
110Asn Arg Ile Val Glu Lys Glu Ser Val Lys Cys Ala Gln Tyr Trp Pro
115 120 125Thr Asp Asp Gln Glu Met Leu Phe Lys Glu Thr Gly Phe Ser
Val Lys 130 135 140Leu Leu Ser Glu Asp Val Lys Ser Tyr Tyr Thr Val
His Leu Leu Gln145 150 155 160Leu Glu Asn Ile Asn Ser Gly Glu Thr
Arg Thr Ile Ser His Phe His 165 170 175Tyr Thr Thr Trp Pro Asp Phe
Gly Val Pro Glu Ser Pro Ala Ser Phe 180 185 190Leu Asn Phe Leu Phe
Lys Val Arg Glu Ser Gly Ser Leu Asn Pro Asp 195 200 205His Gly Pro
Ala Val Ile His Cys Ser Ala Gly Ile Gly Arg Ser Gly 210 215 220Thr
Phe Ser Leu Val Asp Thr Cys Leu Val Leu Met Glu Lys Gly Asp225 230
235 240Asp Ile Asn Ile Lys Gln Val Leu Leu Asn Met Arg Lys Tyr Arg
Met 245 250 255Gly Leu Ile Gln Thr Pro Asp Gln Leu Arg Phe Ser Tyr
Met Ala Ile 260 265 270Ile Glu Gly Ala Lys Cys Ile Lys Gly Asp Ser
Ser Ile Gln Lys Arg 275 280 285Trp Lys Glu Leu Ser Lys Glu Asp 290
2959296PRTHomo sapiens 9Pro Ile Thr Asp Leu Ala Asp Asn Ile Glu Arg
Leu Lys Ala Asn Asp 1 5 10 15Gly Leu Lys Phe Ser Gln Glu Tyr Glu
Ser Ile Asp Pro Gly Gln Gln 20 25 30Phe Thr Trp Glu Asn Ser Asn Leu
Glu Val Asn Lys Pro Lys Asn Arg 35 40 45Tyr Ala Asn Val Ile Ala Tyr
Asp His Ser Arg Val Ile Leu Thr Ser 50 55 60Ile Asp Gly Val Pro Gly
Ser Asp Tyr Ile Asn Ala Asn Tyr Ile Asp65 70 75 80Gly Tyr Arg Lys
Gln Asn Ala Tyr Ile Ala Thr Gln Gly Pro Leu Pro 85 90 95Glu Thr Met
Gly Asp Phe Trp Arg Met Val Trp Glu Gln Arg Thr Ala 100 105 110Thr
Val Val Met Met Thr Arg Leu Glu Glu Lys Ser Arg Val Lys Cys 115 120
125Asp Gln Tyr Trp Pro Ala Arg Gly Thr Glu Thr Cys Gly Leu Ile Gln
130 135 140Val Thr Leu Leu Asp Thr Val Glu Leu Ala Thr Tyr Thr Val
Arg Thr145 150 155 160Phe Ala Leu His Lys Ser Gly Ser Ser Glu Lys
Arg Glu Leu Arg Gln 165 170 175Phe Gln Phe Met Ala Trp Pro Asp His
Gly Val Pro Glu Tyr Pro Thr 180 185 190Pro Ile Leu Ala Phe Leu Arg
Arg Val Lys Ala Cys Asn Pro Leu Asp 195 200 205Ala Gly Pro Met Val
Val His Cys Ser Ala Gly Val Gly Arg Thr Gly 210 215 220Cys Phe Ile
Val Ile Asp Ala Met Leu Glu Arg Met Lys His Glu Lys225 230 235
240Thr Val Asp Ile Tyr Gly His Val Thr Cys Met Arg Ser Gln Arg Asn
245 250 255Tyr Met Val Gln Thr Glu Asp Gln Tyr Val Phe Ile His Glu
Ala Leu 260 265 270Leu Glu Ala Ala Thr Cys Gly His Thr Glu Val Pro
Ala Arg Asn Leu 275 280 285Tyr Ala His Ile Gln Lys Leu Gly 290
295
* * * * *