U.S. patent application number 11/584112 was filed with the patent office on 2008-09-11 for directed evolution of microorganisms.
Invention is credited to Amy D. Liu, Volker Schellenberger, Olga V. Selifonova.
Application Number | 20080220502 11/584112 |
Document ID | / |
Family ID | 23221711 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080220502 |
Kind Code |
A1 |
Schellenberger; Volker ; et
al. |
September 11, 2008 |
Directed evolution of microorganisms
Abstract
The present invention provides methods for directing the
evolution of microorganisms comprising the use of mutator genes and
growth under conditions of selective pressure. The method discloses
mutator genes which can be used in the methods of the present
invention and provides ATCC deposits which exemplify the evolved
microorganisms produced by the methods.
Inventors: |
Schellenberger; Volker;
(Palo Alto, CA) ; Liu; Amy D.; (Mountain View,
CA) ; Selifonova; Olga V.; (Los Altos, CA) |
Correspondence
Address: |
GENENCOR INTERNATIONAL, INC.;ATTENTION: LEGAL DEPARTMENT
925 PAGE MILL ROAD
PALO ALTO
CA
94304
US
|
Family ID: |
23221711 |
Appl. No.: |
11/584112 |
Filed: |
October 20, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09314847 |
May 19, 1999 |
6365410 |
|
|
11584112 |
|
|
|
|
Current U.S.
Class: |
435/252.33 ;
435/252.3; 435/252.8; 435/254.11; 435/254.2; 435/320.1 |
Current CPC
Class: |
C07K 14/245 20130101;
C12R 1/01 20130101; C12R 1/19 20130101; C12P 7/18 20130101; C12N
15/102 20130101; C12N 9/0006 20130101 |
Class at
Publication: |
435/252.33 ;
435/252.3; 435/254.11; 435/254.2; 435/320.1; 435/252.8 |
International
Class: |
C12N 1/21 20060101
C12N001/21; C12N 1/15 20060101 C12N001/15; C12N 1/19 20060101
C12N001/19; C12N 15/63 20060101 C12N015/63; C12N 1/20 20060101
C12N001/20 |
Claims
1. A method for preparing an evolved microorganism comprising the
steps of: a. culturing a microorganism comprising at least one
heterologous mutator gene for at least 20 doublings under
conditions suitable for selection of an evolved microorganism,
wherein said heterologous mutator gene generates a mutation rate of
at least 5-100,000 fold relative to wild type, and b. restoring
said evolved microorganism to a wild type mutation rate.
2. The method of claim 1 wherein said microorganism further
comprises at least one introduced nucleic acid encoding a
heterologous protein.
3. The method of claim 2 wherein said heterologous protein(s)
includes hormones, enzymes and growth factors.
4. The method of claim 3 wherein said heterologous protein is an
enzyme.
5. The method of claim 4 wherein said enzyme includes hydrolases,
such as protease, esterase, lipase, phenol oxidase, permease,
amylase, pullulanase, cellulase, glucose isomerase, laccase and
protein disulfide isomerase.
6. The method of claim 1 wherein said microorganism further
comprises introduced nucleic acid encoding at least one enzyme
necessary for an enzymatic pathway.
7. The method of claim 6 wherein said enzyme is a reductase or a
dehydrogenase and said enzymatic pathway is for the production of
ascorbic acid or ascorbic acid intermediates.
8. The method of claim 6 wherein said enzyme is glycerol
dehydratase or 1,3-propanediol dehydrogenase and said enzymatic
pathway is for the production of 1,3 propanediol, 1,3 propanediol
precursors or 1,3 propanediol derivatives.
9. The method of claim 6 wherein said enzyme is
glycerol-3-phosphate dehydrogenase or glycerol-3-phosphate
phosphatase and said pathway is for the production of glycerol and
glycerol derivatives.
10. The method of claim 6 wherein said enzymatic pathway is for the
production of amino acids or dyes.
11. The method of claim 1 wherein said microorganism is cultured
for between about 20 to about 100 doublings.
12. The method of claim 1 wherein said microorganism is cultured
for between about 100 to about 500 doublings.
13. The method of claim 1 wherein said microorganism is cultured
for between about 500 to about 2000 doublings.
14. The method of claim 1 wherein said microorganism is cultured
for greater than 2000 doublings.
15. The method of claim 1 wherein said evolved microorganism
comprises from about 3 to about 1000 selected mutations.
16. The method of claim 1 wherein said evolved microorganism
further comprises from about 20 to about 100,000 neutral
mutations
17. The method of claim 1 wherein said evolved microorganism
comprises about 3 to about 1000 selected mutations in about 3 to
about 500 genes.
18. The method of claim 17 wherein said mutations are
non-specific.
19. The method of claim 17 wherein said mutations are specific.
20. The method of claim 1 wherein said mutator gene generates a
mutation rate of at least about 5 fold to about 10,000 fold
relative to wild type.
21. The method of claim 1 wherein said mutator gene generates a
mutation rate of at least about 5 fold to about 1000 fold.
22. The method of claim 1 wherein said mutator gene generates a
mutation rate of about 5 fold to about 1000 fold over wild
type.
23. The method of claim 1 wherein said microorganism comprises a
plasmid comprising the heterologous mutator gene and said step of
restoring said evolved microorganism to a wild type mutation rate
comprises curing the evolved microorganism of said plasmid.
24. The method of claim 23 wherein said plasmid comprises a
temperature sensitive origin of replication.
25. The method of claim 1 wherein said microorganism comprises at
least one copy of the mutator gene in the chromosome and said step
of restoring said evolved microorganism to wild type mutation rate
comprise excision of said mutator gene.
26. The method of claim 1 wherein said mutator gene comprises mutD,
mutT, mutY, mutM, mutH, mutL, mutS or mutU mutations or homologues
thereof.
27. The method of claim 26 wherein said mutator gene comprises mutD
having mutations shown in Table I.
28. The method of claim 1 wherein said conditions suitable for
selection comprise culturing said microorganism in the presence of
at least one organic solvent.
29. The method of claim 28 wherein said organic solvent includes
alcohols, diols, hydrocarbon, mineral oil, mineral oil derived
products, halogenated compounds and aromatic compounds.
30. The method of claim 1 wherein said conditions suitable for
selection comprise culturing said microorganism in the presence of
elevated temperature.
31. The method of claim 30 wherein said elevated temperature is
about 42.degree. C. to about 48.degree. C.
32. The method of claim 1 wherein said conditions suitable for
selection comprise culturing said microorganism in the presence of
high salt.
33. The method of claim 1 wherein said microorganism includes
Gram-positive or a Gram-negative microorganism, fungus, yeast or
eucaryotic.
34. The method of claim 33 wherein said microorganism is an
Enterobacteriaceae.
35. The method of claim 34 wherein said microorganism is an
Eschericia.
36. The method of claim 35 wherein said microorganism is E.
coli.
37. The method of claim 35 wherein said microorganism is E.
blatte.
38. The method of claim 1 wherein said evolved microorganism is E.
coli having ATCC accession number ______.
39. The method of claim 1 wherein said evolved microorganism is E.
blattae having ATCC accession number.
40. An expression vector comprising a mutator gene.
41. The expression vector of claim 40 wherein said mutator gene is
a mutated MutD.
42. The expression vector of claim 40 wherein said mutated MutD has
the mutations as shown in Table I.
43. A host cell comprising the expression vector of claim 40.
44. The host cell of claim 43 that is a Gram-positive or
Gram-negative microorganism.
45. The host cell of claim 44 that is an Enterobacteriaceae.
46. The isolated E. blattae microorganism deposited with the ATCC
and having accession number.
47. The isolated E. coli microorganism deposited with the ATCC and
having accession number.
48. A method for preparing an evolved microorganism comprising the
steps of: a. mutating a DNA repair gene in a microorganism to
obtain a mutated strain, b. culturing the mutated strain for at
least 20 doublings under conditions suitable for selection of an
evolved strain, wherein said mutated strain generates a mutation
rate of at least 5-100,000 fold relative to the wild-type
microorganism, and c. restoring the naturally occurring DNA repair
gene in said evolved microorganism.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to methods for directing the
evolution of microorganisms using mutator genes. Such methods
provide a pool of microbial genetic diversity advantageous for
industrial application, such as for the industrial production of
heterologous proteins, such as hormones, growth factors and
enzymes, and the biocatalytic production of chemicals, vitamins,
amino acids and dyes.
BACKGROUND OF THE INVENTION
[0002] The industrial applicability of microorganisms is restricted
by their physiological limits set by solvent, pH, various solutes,
salts and temperature. Organic solvents are generally toxic to
microorganisms even at low concentrations. The toxicity of solvents
significantly limits use of microorganisms in industrial
biotechnology for production of specialty chemicals and for
bioremediation applications. Solvent molecules incorporate into
bacterial membranes and disrupt membrane structure (Isken and Bont,
1998, Extremophiles 2(3): 229-238); (Pinkart and White, 1997, J.
Bacteriol. 179(13): 4219-4226); (Ramos, Duque et al., 1997, "J.
Biol. Chem. 272(7): 3887-3890); (Alexandre, Rousseaux et al., 1994,
FEMS Microbiol, Lett, 124(1): 17-22); and Kieboom, Dennis et al.,
1998, J. of Bacteriology 180(24): 6769-6772). Classic strain
improvement methods including UV and chemical mutagenesis have been
applied for selection of more tolerant strains (Miller, J., "A
Short Course In Bacterial Genetics," Cold Spring Harbor Laboratory
Press, 1992). A number of studies have been dedicated to
identification and isolation of solvent tolerant mutants among
various bacterial strains. Spontaneous E. coli solvent tolerant
mutants and mutants isolated in the process of
1-methyl-3-nitrosoguanidine (NTG) mutagenesis were obtained from
strain K-12 (Aono, Aibe et al., 1991 Agric. Biol. Chem. 55(7):
1935-1938). The mutants could grow in the presence of
diphenylether, n-hexane, propylbenzene, cyclohexane, n-pentane,
p-xylene. Various Pseudomonas strains were able to adapt and to
grow in a toluene-water two-phase system (Inoue and Horikoshi,
1989, Nature 338: 264-266), with p-xylene (Cruden, Wolfram et al.,
1992, Appl. Environ. Microbiol. 58(9): 2723-2729), styrene and
other organic solvents (Weber, Ooijkaas et al., 1993, Appl.
Environ. Microbiol. 59(10): 3502-3504), (de Bont 1998, Trends in
Biotechnology 16: 493-499). Yomano et al. isolated ethanol tolerant
mutants which increased tolerance from 35 g/l to 50 g/l during 32
consequent transfers (Yomano, York et al., 1998, J. Ind. Microbiol.
Biotechnol. 20(2): 132-138). High temperature evolution using E.
coli has been disclosed in the art (Bennett, 1990, Nature, Vol.
346, 79-81) however the fitness gain was low as compared to the
parent.
[0003] Strains of E. coli that carry mutations in one of the DNA
repair pathways have been described which have a higher random
mutation rate than that of typical wild type strains (see, Miller
supra, pp. 193-211). As reported by Degenen and Cox (J. Bacteriol.,
1974, Vol. 117, No. 2, pp. 477-487), an E. coli strain carrying a
mutD5 allele demonstrates from 100 to 10,000 times the mutation
rate of its wild type parent. Greener et al., "Strategies In
Molecular Biology," 1994, Vol. 7, pp. 32-34, disclosed a mutator
strain that produces on average one mutation per 2000 bp after
growth for about 30 doublings.
[0004] Microorganisms are used industrially to produce desired
proteins, such as hormones, growth factors and enzymes and to
produce chemicals, such as glycerol and 1,3 propanediol (WO
98/21340 published May 22, 1998 and U.S. Pat. No. 5,686,276 issued
Nov. 11, 1997), vitamins, such as ascorbic acid intermediates
(1985, Science 230:144-149), amino acids, and dyes, such as indigo
(U.S. Pat. No. 4,520,103, issued May 28, 1985). In spite of
advances in the art, there remains a need to improve the
microorganisms and methods for producing such desired proteins,
chemicals, amino acids and dyes.
SUMMARY OF THE INVENTION
[0005] The present invention relates generally to methods for
directing the evolution of a microorganism, that is for directing
desired genetic change in a microorganism in response to conditions
of selective pressure. In one aspect, the present invention relates
to methods for evolving microorganisms to grow under extreme
conditions, such as at high temperature, under conditions of pH
extremes, in the presence of solvents, and in the presence of high
salt. In another aspect, the present invention relates to methods
for evolving a microorganism comprising at least one nucleic acid
encoding a desired protein or an enzyme in an enzymatic pathway to
grow under desired conditions.
[0006] The present invention is based, in part, upon the finding
that microorganisms such as wild-type E. coli and E. blattae, can
be evolved into microorganisms capable of growing in the presence
of high solvents, such as DMF and 1,3 propanediol, using methods
described herein. The present invention is also based, in part,
upon the finding that E. coli can be evolved into a microorganism
capable of growing at elevated temperatures using methods described
herein. The present invention is further based, in part, upon the
identification of the optimal mutation rate for a microorganism and
the discovery that the mutation rate can be controlled.
[0007] Accordingly, the present invention provides a method for
preparing an evolved microorganism comprising the steps of
culturing a microorganism comprising at least one heterologous
mutator gene for at least 20 doublings under conditions suitable
for selection of an evolved microorganism, wherein said
heterologous mutator gene generates a mutation rate of at least
about 5 fold to about 100,000 fold relative to wild type, and
restoring said evolved microorganism to a wild type mutation rate.
In one embodiment, the microorganism further comprises at least one
introduced nucleic acid encoding a heterologous protein, said
protein(s) including, but not limited to hormones, enzymes, growth
factors. In another embodiment, the enzyme includes, but is not
limited to hydrolases, such as protease, esterase, lipase, phenol
oxidase, permease, amylase, pullulanase, cellulase, glucose
isomerase, laccase and protein disulfide isomerase. The present
invention encompasses genetic changes in the microorganism as well
as changes in the introduced nucleic acid.
[0008] In yet a further embodiment, the microorganism further
comprises introduced nucleic acid encoding at least one enzyme
necessary for an enzymatic pathway. In one embodiment, the
introduced nucleic acid is heterologous to the microorganism; in
another, the introduced nucleic acid is homologous to the
microorganism. In a further embodiment, the enzyme is a reductase
or a dehydrogenase and said enzymatic pathway is for the production
of ascorbic acid or ascorbic acid intermediates. In an additional
embodiment, the enzyme is glycerol dehydratase or 1,3-propanediol
dehydrogenase and said enzymatic pathway is for the production of
1,3 propanediol, 1,3 propanediol precursors or 1,3 propanediol
derivatives. In another embodiment, the enzyme is
glycerol-3-phosphate dehydrogenase or glycerol-3-phosphate
phosphatase and said pathway is for the production of glycerol and
glycerol derivatives. In a further embodiment, the enzymatic
pathway is for the production of amino acids, such as tryptophane
or lysine or dyes, such as indigo.
[0009] In one embodiment of the present invention, the
microorganism is cultured for between about 20 to about 100
doublings; in another embodiment, the microorganism is cultured for
between about 100 to about 500 doublings; in yet another
embodiment, the microorganism is cultured for between about 500 to
about 2000 doublings and in a further embodiment, the microorganism
is cultured for greater than 2000 doublings. In one embodiment, the
mutator gene generates a mutation rate of at least about 5 fold to
about 10,000 fold relative to wild type; in another embodiment, the
mutator gene generates a mutation rate of a least about 5 fold to
about 1000 fold and in another embodiment, the mutator gene
generates a mutation rate of about 5 fold to about 100 fold over
wild type.
[0010] In one embodiment, an evolved microorganism comprises from
about 3 to about 1000 selected mutations in about 3 to about 500
genes and may further comprises from about 20 to about 100,000
neutral mutations. In one aspect, the mutations generated are
non-specific and in another aspect, the mutations generated are
specific.
[0011] In one embodiment of the present invention, the
microorganism comprises a plasmid comprising the heterologous
mutator gene and said step of restoring said evolved microorganism
to a wild type mutation rate comprises curing the evolved
microorganism of said plasmid. In another embodiment, the plasmid
comprises a temperature sensitive origin of replication and the
curing comprises growing the evolved microorganism at a restrictive
temperature. In a further embodiment, the microorganism comprises
at least one copy of the mutator gene in the chromosome and said
step of restoring said evolved microorganism to a wild type
mutation rate comprises excision or removal of said mutator gene
from the host genome or the replacement of the mutator gene with a
functional (non-mutator) allele of the same gene.
[0012] In one embodiment, the present invention comprises the use
of at least one mutator gene to evolve a microorganism. In another
embodiment, the mutator gene includes but is not limited to a mutD
gene mutation, a mutT gene mutation, a mutY gene mutation, a mutM
gene mutation, a mutH gene mutation, a mutL gene mutation, a mutS
gene mutation or a mutU gene mutation and homologues of these DNA
repair genes which have been mutated as long as the mutated gene
has impaired proofreading function. In a further embodiment, the
mutator gene comprises at least one of the mutD mutations disclosed
herein in Table I.
[0013] In one embodiment of the present invention, conditions
suitable for selection include but are not limited to culturing
said microorganism in the presence of at least one organic solvent,
such as for example, alcohols, diols, hydrocarbon, mineral oil,
mineral oil derived products, halogenated compounds and aromatic
compounds; in the presence of high temperature, such as in the
range of 42.degree.-48.degree. C.; in the presence of high salt,
and in the presence of extreme pH conditions, such as alkaline or
acidic conditions.
[0014] The present invention encompasses methods for evolving gram
positive and gram negative microorganisms as well as yeast, fungus
and eucaryotic cells including hybridomas. In one embodiment, the
gram negative microorganism includes members of Enterobacteriaceae
and in another embodiment comprises Eschericia and in another
embodiment comprises E. coli and E. blatte. In further embodiments
of the present invention, the evolved microorganism includes E.
coli having ATCC accession number ______ and E. blatte having ATCC
accession number ______.
[0015] The present invention also provides expression vectors and
host cells comprising a mutator gene and methods for producing such
vectors and host cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 shows the nucleic acid and amino acid sequence of the
mutD gene. Illustrative examples of mutations of the mutD gene are
provided.
[0017] FIG. 2 provides the nucleic acid sequence for the enzyme
1,3-propanediol dehydrogenase (PDD).
[0018] FIG. 3 provides the amino acid sequence for the enzyme
1,3-propanediol dehydrogenase (PDD).
[0019] FIG. 4 provides a time course for E. coli cultures subjected
to directed evolution and selection under elevated temperature.
[0020] FIG. 5--Glycerol fermentation of E. blattae at pH 7.0.
Culture conditions are described in the text. Plate counts were by
serial dilution and performed in triplicate on Luria agar plates.
Substrate and products were measured by HPLC.
[0021] FIG. 6-Glycerol fermentation of E. blattae strain GEB0314 at
pH 7.0. Culture conditions are described in the text. Plate counts
were by serial dilution and performed in triplicate on Luria agar
plates. Substrate and products were measured by HPLC.
DESCRIPTION OF THE MICROORGANISM DEPOSITS MADE UNDER THE BUDAPEST
TREATY
[0022] Applicants have made the following biological deposits under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Micro-organisms for the Purposes of patent
Procedure:
TABLE-US-00001 International Depositor Identification Depository
Reference Designation Date of Deposit Escherichia coli MM294 ATCC
May 17, 1999 derivative Escherichia blattae 33429 ATCC May 17, 1999
derivative
DETAILED DESCRIPTION
Definitions
[0023] A mutation refers to any genetic change that occurs in the
nucleic acid of a microorganism and may or may not reflect a
phenotypic change within the microorganism. A mutation may comprise
a single base pair change, deletion or insertion; a mutation may
comprise a change, deletion or insertion in a large number of base
pairs; a mutation may also comprise a change in a large region of
DNA, such as through duplication or inversion.
[0024] When many possible different mutations in nucleic acid can
give rise to a particular phenotype, the chance of mutation to that
phenotype will be higher than in a situation where only a few types
of mutations can give rise to a particular phenotype. As used
herein the terms "wild-type mutation" and "spontaneous mutation"
are used interchangeably. The rate of spontaneous mutation is
defined as the probability of a mutation each time the genome is
replicated or doubled. As used herein "mutation rate" is
simultaneous with "frequency" and refers to the absolute number of
mutations/doubling/base pair. As used herein, the term "relative
rate" refers to the ratio of mutation rates of two strains, one of
these is usually a wild type strain. Relative rate indicates how
much more likely it is that a strain will undergo mutation as
compared to the wild type strain. The frequency of spontaneous
mutation of wild type E. coli (the E. coli genome has about
4.6.times.10.sup.6 base pairs) is about 5.times.10.sup.-10
mutations per base pair per doubling (see Drake, 1991). Doubling
refers to the process of reproduction of at least part of a genome
of an organism and usually involves reproduction by binary fission.
As used herein, "doubling" encompasses the reproduction of nucleic
acid within an microorganism achieved by any means.
[0025] As used herein, a "mutator strain" refers to a microorganism
having a higher than naturally occurring rate of spontaneous
mutation. As used herein, "mutator gene" refers to a DNA repair
gene which comprises a mutation and which has impaired proof
reading function. As used herein, the term "mutator plasmid" refers
to a plasmid or expression vector or cassette comprising a mutator
gene. Culturing a microorganism comprising a mutator gene will give
rise to mutational events during genome replication. The present
invention encompasses the use of any DNA repair genes comprising
mutations as long as the mutated DNA repair gene is capable of
introducing mutational events in a microorganisms genome or on a
gene introduced into the microorganism. DNA repair genes include
but are not limited to, mutD, mutT, mutY, mutM, mutH, mutL, mutS or
mutU and homologues of these genes. A homologue as used herein
refers to a functionally related DNA repair gene. In one
embodiment, the mutator gene is a mutD gene (the epsilon subunit of
DNA polymerase III, see Degnen et al., 1974, J. Bacteriol.
117:477-487) comprising mutations that provide an impaired
proofreading function. In one embodiment disclosed herein, the mutD
mutation is introduced into a microorganism on a plasmid.
Illustrative embodiments of MutD mutations are disclosed herein in
Table I. The mutD mutations impair proofreading function of the
epsilon subunit of DNA polymerase III holoenzyme by significant
decrease in the 3'-5' exonuclease activity (Takano et al., 1986,
Mol. Gen. Genet. 205(1):9-13).
[0026] When referring to mutations or genetic changes in an evolved
microorganism, "neutral mutation" refers to a mutation which has
little or no measurable effect on the phenotype of an evolved
strain under a given set of conditions. Examples of "neutral
mutations" include, but are not limited to, silent mutations which
do not lead to a change in the amino acid sequence of the encoded
protein, mutations which affect proteins that are not essential for
growth under a given set of culture conditions, and mutations in
non-coding regions of the chromosome. In one illustrative
embodiment herein, an E. coli strain evolved for high temperature
was characterized as being auxotrophic for three amino acids (ie,
were not able to grow in medium without Cys/Met, Asp/Asn, and Pro)
indicating that there were at least three neutral mutations in the
E. coli in addition to the mutations associated with growth at high
temperature. The term "selected mutation" as used herein refers to
those mutations which are associated with a phenotype of an evolved
strain under a given set of conditions. Being associated with means
that the mutation is directly or indirectly responsible for the
improved or altered phenotype.
[0027] When referring to mutations or genetic changes in a host
cell or microorganism, nonspecific refers to the changes in the
host cell genome which occur randomly throughout the genome and
which potentially can affect all bases and includes frameshifts.
Non-specific mutations encompass changes in single base pairs as
well as changes in a large number of base pairs as well as changes
in large regions of DNA. For example, in one embodiment, an evolved
microorganism which has been exposed to a MutD gene comprising
mutations that impair the proof reading function will comprise
random mutations at a rate of about 5-1000 times over wild type. In
one illustrative embodiment of the method using a mutD mutation,
the evolved strain had at least 3 random mutations. The present
invention encompasses any rate of mutations that provides the
desired phenotype. When referring to genetic changes in a host
cell, specific mutation refers to mutations which can be
characterized or which comprise definable genetic changes, such as
A:T to C:G transversion characteristic of mutT mutations; G:C to
T:A transversion characteristic of mutY and mutM mutations; A:T to
G:C and G:C to A:T transitions and frameshifts characteristic of
mutH, mutL, mutS, uvrD (mutU) mutations; G:C to T:A transversions
characteristic of the mutYmutM double mutation (Miller et al., A
Short Course in Bacterial Genetics, a Laboratory Manual and
Handbook for E. coli and Related Bacteria).
[0028] When referring to a mutator gene, "heterologous" means that
the gene is introduced into the cell via recombinant methods and is
preferably introduced on a plasmid. The mutator gene may also be
introduced into the microorganism genome through recombinant
techniques. The mutator gene introduced into the microorganism may
be a mutation of a naturally occurring DNA repair gene in the cell
or may be foreign to the host microorganism. Referring to nucleic
acid as being "introduced" into a microorganism means that the
nucleic acid is put into the microorganism using standard molecular
biology techniques. An introduced nucleic acid may be the same or
different than nucleic acid naturally occurring in the
microorganism.
[0029] As used herein the term "restoring to wild type mutation
rate" refers to the process whereby a mutator gene is removed from
an evolved microorganism thereby restoring the wild-type mutation
rates. The present invention encompasses any process for removing
the mutator gene from an evolved organism and includes but is not
limited to curing the organism of a resident plasmid comprising the
mutator gene or by excising or otherwise removing the mutator gene
from the host genome such that normal DNA repair function is
restored. Curing refers to methods for producing cells which are
free of a plasmid comprising the mutator gene. A microorganism can
be cured of any resident plasmid using techniques known to the
skilled artisan.
DETAILED DESCRIPTION
[0030] One of the basic tenants of inheritance is that mutations
occur randomly and then are selected by the environment. Mutations
that happen to confer a selective advantage on the organism are
preferentially passed on to future generations. The present
invention relates to methods for directing desired genetic change
in a microorganism, ie directing the evolution of a microorganism,
by exposing the microorganism to a mutator gene, selecting for
acquisition of desired characteristics in the evolved
microorganism, and curing the microorganism of the mutator gene, or
otherwise removing the mutator gene, such that wild type mutation
rates are restored.
[0031] I. Uses of the Invention
[0032] In one aspect of the present invention, the methods are used
to evolve a microorganism to grow under extreme conditions, such as
in the presence of elevated temperature, high solvent, altered pH
or in the presence of high salt. In another aspect of the present
invention, the methods are used to evolve microorganisms which
comprise introduced nucleic acid encoding a heterologous protein or
at least one enzyme in an enzymatic, ie biocatalytic pathway. Such
commercially important proteins include hormones, growth factors
and enzymes. Illustrative biocatalytic pathways include those
disclosed in U.S. Pat. No. 5,686,276, issued Nov. 11, 1997, for the
production of 1,3-propanediol and in 1985, Science 230:144-149 for
the production of ascorbic acid intermediates.
[0033] Methods of the present invention are especially advantageous
for producing improved microorganisms used for the biocatalytic
production of chemicals and vitamins where numerous catalytic
events are taking place either concurrently or sequentially within
the host microorganism. In such complex biocatalytic systems, it is
often difficult to identify the specific molecular events causing
low yields, host toxicity or catalytic failures and therefore
difficult if not impossible to understand which specific genetic
events to alter in order to correct the deficiencies. The methods
of the present invention provide the advantage of allowing the
microorganism to make the required changes in response to selective
pressure.
[0034] Additionally, the methods of the present invention provide
an advantage for obtaining microorganisms comprising desired
phenotypic traits associated with multiple genes, such as the
ability of a microorganism to grow at elevated temperatures. The
use of the mutator gene provides a means for producing genetic
diversity and the simultaneous growth under conditions of selective
pressure allows the microorganism to identify the specific genetic
changes required for survival. The use of mutD gene mutations
allows for very large diversity to be provided to the microorganism
from which to select for the specific genetic changes that provide
a growth advantage. Therefore, the methods disclosed herein avoid
the limited diversity that is often produced with art methods that
begin the directed evolution process with defined sets of genes.
Furthermore, the methods disclosed herein eliminate additional
screening steps often associated with art methods for producing
genetic diversity. A further advantage of the present invention is
that the methods can be applied to microorganisms which have not
been sequenced and for which there may be limited information upon
which to design genetic changes.
[0035] In illustrative embodiments disclosed herein, a mutated mutD
gene residing on a plasmid was introduced via recombinant
techniques into E. coli or E. blatte. The E. coli or E. blatte cell
was then cultured under conditions suitable for growth for a time
sufficient for at least 20 doublings and up to at least about 2000
doublings under conditions of selective pressure. In one example,
E. coli was grown under conditions of increased temperature or in
the presence of DMF and in another E. blattae was growth in the
presence of solvent, such as DMF or 1,3 propanediol. As a result,
E. coli was evolved into a microorganism capable of growing at
temperatures up to about 48.degree. C. or in the presence of 80 g/l
DMF. E. coli evolved to grow at elevated temperatures also became
auxotrophic for three amino acids, Cys/Met, Asp/Asn and Pro. E.
blattae was evolved into a microorganism capable of growing
anaerobically in the presence of at least 105 g/l 1,3-propanediol
and which comprised genetic changes in at least one catalytic
activity associated with 1,3 propanediol production,
1,3-propanediol dehydrogenase, shown in FIG. 3.
[0036] The use of a plasmid comprising a mutator gene, ie, a
mutator plasmid, can be used to control the mutation rate of a
microorganism. As described under Section II below, plasmid
constructs can be designed which provide reduced levels of
expression of a mutator gene thereby providing a means for altering
the ratio of naturally occurring DNA repair genes vs mutator genes.
This provides a means for combining the advantage of mutD mutations
(which results in random mutagenesis) with the advantages of the
other known mutators (lower mutation frequency which leads to a
lower burden on the cells). Additionally, plasmid constructs can be
designed that allow for curing the evolved microorganism of the
mutator gene, such as the use of a temperature sensitive origin,
thereby allowing for a means for turning the mutation events off
and on in the microorganism. For a gram positive microorganism,
such as B. subtilis where the entire genome has been sequenced, the
present invention could encompass the steps of deleting or mutating
a DNA repair gene, evolving the Bacillus, and restoring the
naturally occurring DNA repair system through recombination events.
As disclosed herein, several members of Escherichia, such as E.
coli and E. blatte have been subjected to the directed evolution
methods. Illustrative examples of evolved E. coli and E. blattae
have been deposited with the ATCC and have accession numbers,
______ and ______, respectively.
[0037] The methods of the present invention provide a means to
accomplish long-term evolution of microorganisms. An E. coli strain
comprising a plasmid comprising a mutD mutation was grown for
>1000 doublings without a reduction in mutation rate. The
present invention also provides a means for reducing the functional
genome of an organism. A microorganism can be grown for many
thousands of generations, such that only the genes which are
essential would remain functional. Most of the other genes would
carry random and inactivating mutations.
[0038] The present invention also provides a means for making
non-pathogenic organisms. A pathogenic strain can be evolved into a
mutator strain by introduction of a mutator gene and grown for
extended periods of time. As a result many of the genes that are
involved in pathogenicity would become inactivated and the strain
would be safe to use.
[0039] The present invention also provides a means to streamline
the metabolism of an organism. A strain which has an improved yield
on nutrients or a reduced metabolic rate (maintenance metabolism)
can be produced by methods disclosed herein. Such strains would be
useful production strains for chemicals as well as enzymes. The
present invention provides a means for making microorganisms
mutator strains by introducing a mutator gene, thereby protecting
the microorganism's naturally occurring DNA repair genes from
becoming mutator genes in response to selective pressure. That is,
the introduction of the mutator plasmid into a microorganism
whether via a plasmid or into the genome, protects the cells from
developing a mutator phenotype in response to selective
pressure.
[0040] II. Mutator Genes and Frequency of Mutations
[0041] Mutator genes of the present invention include but are not
limited to, mutations of the DNA repair genes mutD, mutT, mutY,
mutM, mutH, mutL, mutS or mutU or their homologues in other
microorganisms. A description of the DNA repair genes are disclosed
in Miller, supra; mutD is disclosed in Maki et al., 1983, Proc.
Natl. Acad. Sci., U.S.A. 80, 7137-7141 (GenBank accession number
K00985.1 GI: 147678 and FIG. 1); B. subtilis mutS and mutL are
disclosed in Ginetti et al., 1996, Microbiology. August, 142 (Pt
8): 2021-9; Streptococcus pneumoniae hex B repair GC560 gene, mutL
of Salmonella typhimurium and PMS1 of Saccharomyces cerevisiae are
disclosed in Prudhomme et al., 1989, J. Bacteriology, October 171
(10): 5332-8; Streptococcus pneumoniae hexa and mutS of Salmonella
typhimurium and E. coli are disclosed in Priebe et al., J.
Bacteriol, 1988, January; 170(1): 190-6 and Prudhomme et al., 1991,
J. Bacteriol. November; 173(22): 7196-203; human mutS homologue,
hMSH2, and human MutL homologue, hMLH1, are disclosed in Macdonald
et al., 1998, Heptology, July 28(1):90-7; the mut-1 of Neurospora
is disclosed in Dillon et al., 1994, Genetics, September
138(1):61-74 and yeast homologues of mutL and mutS are disclosed in
WO 97/15657. The methods of the present invention comprises the use
of at least one of the mutant DNA repair genes and may involve the
use of more than one. It is preferred that a mutator gene be
dominant to the wild type gene of the microorganism such that
mutations are introduced into the genome of the microorganism. In a
preferred embodiment, the mutator gene is a mutation of the mutD
gene. The nucleic acid and amino acid sequence for mutD is shown in
FIG. 1. One particular mutD mutation, mutD5, is disclosed in
Takano, K., et al., (1986, Mol Gen Genet. 205, 9-13, Structure and
function of dnaQ and mutD mutators of Escherichia coli). Strain
CSH116 was obtained as disclosed in Miller, J. H. (1992, A Short
Course in Bacterial Genetics). This strain is reported to carry the
mutD5 allele. The mutD gene in this strain was found to be very
different from the published mutD5. The mutD gene from strain
CSH116 is designated herein as mutD5'. Table I gives the mutations
found in mutD5 and mutD5'. Further mutations in mutD which result
in increased levels of mutation frequency were identified recently
in Taft-Benz, S. A. et al., (1998, Nucl. Acids Res. 26, 4005-4011,
Mutational analysis of the 3'-5' proofreading exonuclease of
Escherichia coli DNA polymerase III). Table I describes various
mutD mutations useful in the present invention. Table II describes
various promoters used with the mutD mutations and Table III
describes mutator plasmids and the range of available mutation
frequencies in E. coli.
TABLE-US-00002 TABLE I mutations in the coding region of mutD MutD
Clone #amino amino nucleo- amino #nucleotide acid nucleotide acid
tide acid 44 15 C Thr T Ile mutD5' 218 73 T Leu G Trp mutD5 369 123
T Thr C Thr mutD5' 418 138 C Pro T Pro mutD5' 451 151 T Ala C Ala
mutD5' 484 161 G Leu A Arg mutD5' 491 164 C Ala T Val mutD5' 661
220 A Glu C Asp mutD5' 665 222 A Ile C Leu mutD5' 673 225 T Ala A
Ala mutD5' 688 228 C Leu T Leu mutD5' 706 236 A Lys G Lys mutD5'
715 239 T Ser C Ser mutD5' 727 243 A Arg G Arg mutD5'
TABLE-US-00003 TABLE II mutD Mutations Name Mutations wild type
ATGACCGCTATG . . . pOS100 TTGA-CGCTTTG . . . pOS101 GTGACCGCTGTG .
. . pOS102 GTG-CCGCTGTG . . . pOS104 TTGACCGCTTTG . . . pOS105
GTGACCGCTGTGAGCACTT(G)CAATTACACGCCAGATCG TTCTCGATACCGAAAT(C) . . .
pOS106 GTGACCGCT-TG . . .
TABLE-US-00004 TABLE III Mutator (mutD5) and control (mutD)
plasmids and the range of available mutation frequencies in E.
coli. mut. Frequency mutator rate # plasmid genotype ori ab
resistance size (kb) (average) (relative) 1 pMutD5-61 mutD5' pSc
kan 5.97 6.4 .times. 10.sup.-5 ~1000-fold 2 pMutD71-Ts mutD pSc kan
5.97 2.5 .times. 10.sup.-8 wild type 3 pBRmutD68 mutD5' pBR322 kan,
bla 6.16 1.1 .times. 10.sup.-4 (AL data) ~10000-fold 4 pBRmutD727
mutD pBR322 kan, bla 6.16 nd wild type Modified 5 pOS100 mutD5'
pBR322 kan, bla 6.16 2 .times. 10.sup.-5 ~800-fold 6 pOS101 mutD5'
pBR322 kan, bla 6.16 3.8 .times. 10.sup.-6 ~152-fold 7 pOS102
mutD5' pBR322 kan, bla 6.16 1.1 .times. 10.sup.-6 ~44-fold 8 pOS104
mutD5' pSc kan 5.97 4.35 .times. 10.sup.-7 ~17-fold 9 pOS105 mutD5'
pSc kan 5.97 1.1 .times. 10.sup.-6 ~44-fold 10 pOS106 mutD5' pSc
kan 5.97 5 .times. 10.sup.-6 ~200-fold
MutD mutations can introduce all types of base pair changes
including frame shifts (Miller, supra). MutD5 has a reported
relative mutation frequency of 1000-10000 fold in rich medium, ie,
5.times.10.sup.-6 to 5.times.10.sup.-7 mutations per doubling per
base pair (Denegen et al., 1974, J. Bacteriol. 117, 477-478).
Considering that the E. coli genome has 4.6.times.10.sup.6 bp, then
a mutD5 gene will generate 2.3 to 23 mutations per doubling per
genome. In a preferred embodiment of the present invention, mutator
plasmids have been generated which allow for reduced expression
levels of the mutated mutD repair gene such that the mutation rate
relative to wild type is reduced. As illustrated in Table II, the
MutD gene has 2 closely located ATG start codons with 6 nucleotides
between them. The first ATG is considered to be putative. Both ATG
codons were replaced with GTG or TTG codons for reducing mutD5'
expression levels. The space between the 2 ATG codons up to 5
nucleotides was truncated. The plasmids comprising these mutator
genes provide lower mutation rates when introduced in E. coli in
comparison to MutD5' plasmids.
[0042] As a result, the microorganism comprising the plasmid
comprising the mutated mutD gene expressed normal levels of the
functional epsilon subunit coded by naturally occurring mutD and
low amounts of the non-functional epsilon subunit coded by the
mutated mutD5'. Both subunits compete for polymerase III.
Consequently, the microorganism will most of the time have
functional proof-reading but to a certain fraction of time the cell
will copy its DNA without proof-reading, due to the presence of the
mutD mutations. Thus, the frequency of mutagenesis of a
microorganism can be altered by adjusting the expression of the
mutator gene or by altering the ratio of a naturally occurring DNA
repair gene to the corresponding mutated DNA repair gene. The
mutations caused by these plasmid introduced mutator genes should
still be as random as mutations caused by a chromosomal copy of
mutD5. Data generated in Example III indicate that mutation rates
of 5-1000 times over wild type are preferred for most applications.
Other means of controlling the mutation frequency include having
two copies of mutD on the plasmid or integrated into the
microorganism genome and/or using a transmissible heat sensitive
plasmid which could be used to temporarily transform cells into
mutators and then restore them to wild type rates. Yet another way
to adjust the mutation frequency is to identify mutD mutations
which result in moderate mutation frequency due to reduced proof
reading. Such mutants have been recently identified but it is not
known if these mutations preferentially result in a few types of
specific mutations, Taft-Benz et al., 1998, Nucl. Acids. Res.
26:4005-4011. Mutation rates are determined using rifampicin or
streptomycin as disclosed in Horiuchi, et al., 1978, Mol. Gen.
Genet. 163:227-283.
[0043] Mutation rates and a description of the molecular
fingerprint of a microorganism produced by the methods disclosed
herein and claimed are also exemplified by virtue of the
microorganism deposits made with the ATCC under the terms of the
Budapest treaty.
[0044] III. Construction of Mutator Genes and Mutator Plasmids
[0045] Construction of plasmids comprising mutator genes and
transformations of microorganisms can be performed by means deemed
to be routine to the skilled artisan. In one embodiment illustrated
herein, nucleic acid encoding a mutator gene is introduced into a
microorganism on a replicating plasmid, ie, a mutator plasmid,
which is cured or otherwise eliminated from the microorganism after
evolution. In another embodiment disclosed herein, nucleic acid
encoding a mutator gene is introduced into a microorganism's genome
in addition to or as a replacement of a naturally occurring DNA
repair gene.
[0046] Nucleic acid encoding a mutator gene can be isolated from a
naturally occurring source or chemically synthesized as can nucleic
acid encoding a protein or enzyme. Sources for obtaining nucleic
acid encoding DNA repair genes mutD, mutT, muty, mutM, mutH, mutL,
mutS or mutU is provided in Section II. FIG. 1 provides the nucleic
acid and amino acid sequence for mutD and Table I and III provide
preferred mutations for mutD and the mutation rates obtained for
each construct. Once nucleic acid encoding a mutator gene is
obtained, plasmids or other expression vectors comprising the
mutator gene may be constructed using techniques well known in the
art. Molecular biology techniques are disclosed in Sambrook et al.,
Molecular Biology Cloning: A Laboratory Manual, Second Edition
(1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1989) and Brown, T. Current Protocols in Molecular Biology,
Supplements 21, 24, 26 and 29. Nucleic acid encoding a mutator gene
is obtained and transformed into a host cell using appropriate
vectors. A variety of vectors and transformation and expression
cassettes suitable for the cloning, transformation and expression
in bacteria are known by those of skill in the art.
[0047] Typically, the plasmid vector contains sequences directing
transcription and translation of the nucleic acid, a selectable
marker, and sequences allowing autonomous replication or
chromosomal integration. Suitable vectors comprise a region 5' of
the gene which harbors transcriptional initiation controls and a
region 3' of the DNA fragment which controls transcriptional
termination. These control regions may be derived from genes
homologous or heterologous to the host as long as the control
region selected is able to function in the host cell.
[0048] Initiation control regions or promoters, which are useful to
drive expression of the mutator gene. Virtually any promoter
capable of driving expression is suitable for the present
invention. Once suitable cassettes are constructed they are used to
transform the host cell. General transformation procedures are
taught in Current Protocols In Molecular Biology (Vol. 1, edited by
Ausubel et al., John Wiley & Sons, Inc., 1987, Chapter 9) and
include calcium phosphate methods, transformation using PEG,
electroporation and protoplast transformation.
[0049] After subjecting a microorganism to directed evolution using
a mutator plasmid, the microorganism is cured of the mutator
plasmid in order to restore the microorganism to wild-type mutation
rates. Methods for curing a microorganism of a resident plasmid
comprising a mutator gene include transformation of the
microorganism comprising a mutator plasmid with an incompatible
plasmid; electroporation techniques as described in Heery et al.,
1989, Nucl. Acids. Res., 17: 10131; growth with acridine orange or
ethidium bromide in the medium (Jeffrey Miller, 1972, in Curing of
Episomes from E. Coli strains with Acridine Orange from Experiments
in Molecular Genetics, Cold Spring Harbor Laboratories, pg. 140).
In this method, acridine orange is added to 5 ml cultures of an
Enterobacteriaceae strain at 125 .mu.g/ml and allowed to grow
overnight at 37.degree. C. The following day, the cultures are
plated out and individual colonies are used to prepare plasmid
nucleic acid. The nucleic acid is analysed by means known to those
of skill in the art to determine the presence or absence of the
plasmid. For microorganisms comprising a mutator gene in their
genome, techniques known to those of skill in the art can be used
to restore the microorganism back to wild-type mutation rates, such
as excising the mutator gene or replacing the mutator gene with the
naturally occurring DNA repair gene through homologous
recombination techniques.
[0050] IV. Culture Conditions and Selective Pressure
[0051] Once a microorganism has been exposed to a mutator gene, it
is cultured under conditions of desired selective pressure, such as
elevated temperature, pH, salt or in the presence of a solvent,
such as, for example, DMF or 1,3 propanediol. Examples of other
solvents include alcohols, diols, hydrocarbon, mineral oil, mineral
oil derived products, halogenated compounds and aromatic
compounds.
[0052] As the skilled artisan will appreciate, growth conditions
are strain dependent. General growth conditions are disclosed in
Truesdell et al., (1991, Journal of Bacteriology, 173: 6651-6656)
and Sonoyama et al. (1982, Applied and Environmental Microbiology,
Vol. 43, p. 1064-1069). Culture media may be supplemented when
selectable markers are present such as antibiotic resistance genes,
including but not limited to tetracycline, ampicillin or
chloramphenicol.
[0053] For the methods of the present invention, cultures may be
grown aerobically or anaerobically in either liquid medium or solid
medium, depending upon the microorganism and the type of selection.
If cultures are grown in liquid medium, it is preferred to undergo
a number of rounds of replication (20 or more) in order to allow
the survivors of the selection to grow over the wild-type. If
cultures are grown in solid medium, such as on an agar plate, it is
preferred to have a number of repetitive platings in order to pick
the survivors directly and to apply higher selection pressure in
each round and to amplify the population that is able to grow under
the specific conditions of selection.
[0054] The manner and method of carrying out the present invention
may be more fully understood by those of skill in the art by
reference to the following examples, which examples are not
intended in any manner to limit the scope of the present invention
or of the claims directed thereto.
EXAMPLES
Example 1
Construction of mutD and mutD5' Plasmids and Testing in 3 Bacterial
Strains
[0055] The following example illustrates the construction of
plasmids comprising the mutator gene, mutD5'.
[0056] mutD and mutD5' genes were amplified by PCR using mutd1
(5'-CGCCTCCAGCGCGACAATAGCGGCCATC-3') and mutd2
(5'-CCGACTGAACTACCGCTCCGCGTTGTG-3') primers from genomic DNA of E.
coli and E. coli CSH116 (Miller 1992), respectively. The PCR
products were cloned into pCR-Blunt vector (Invitrogen, Carlsbad,
Calif.). Plasmids from clones with the correct orientation were
isolated and digested with SmaI-HindIII restriction enzymes. The
overhang ends were filled using T4 polymerase and cloned into
pMAK705 plasmid digested with SmaI-PvuII. The ligation products
were transformed into JM101 competent cells. The resulted plasmids
had the temperature-sensitive origin of replication, carried
kanamycin resistance marker and were named pMutD-71 (control
plasmid, wild type genotype) and pMutD5-61 (mutator plasmid).
[0057] The plasmids were successfully tested in E. coli MM294
(F.sup.- endA1 hsdR17 (r.sub.k.sup.- m.sub.k.sup.+)supE44 thi-1
relA1) and E blattae ATCC accession number 33429 for evolution of
solvent tolerance. All evolution experiments were performed in LB
medium. Mutation rates were determined by plating aliquots of cell
suspensions on LB plates containing 100 ug/ml rifampicin or
streptomycin. The mutation frequency was calculated by dividing the
number of resistant cells by the total number of plated cells.
Example 2
Evolution of Solvent Tolerance
[0058] The following example illustrates the evolution of solvent
tolerant microorganisms using the mutator plasmids constructed as
in Example 1.
[0059] In order to make evolution experiments quantitative, LB agar
plates supplemented with 50, 60, 70, 80 and 90 g/l DMF and 25 ug/ml
kanamycin were used. The size of every evolving population was
limited to 10.sup.6 cells. After each plating, the number of raised
colonies was counted and 10 were selected for the next plating.
Cells from selected colonies were mixed together and aliquots
containing 10.sup.6 cells were plated on fresh plates containing
the same and higher concentrations of DMF. After 2 consequent
platings the cells were cured of the plasmids by growth at elevated
temperatures. E. blattae 33429 and E. coli MM294 were cured at
41.degree. C. and 43.degree. C., respectively. Three to four
subculturings at indicated temperatures were sufficient for 87-100%
curing. Individual cured clones were selected by parallel growth of
clones in selective and non-selective medium. The curing was also
confirmed by plasmid purification from selected clones and gel
analysis.
[0060] The cured strains were tested for growth with the same DMF
concentrations as their plasmid containing parents. The experiment
demonstrates (1) the advantage of strains harboring mutator
plasmids over strains carrying control plasmids and (2) the
preservation of evolved features in strains cured from mutator
plasmids.
[0061] The results of the short-term evolution are summarized in
Table IV. In the process of 2 platings we obtained E. coli
colonies, which were able to grow on plates containing 20 g/l
higher concentration of DMF than control clones. Analysis of E.
coli MM294 harboring control and mutator plasmids revealed that the
mutation frequency of cells carrying control plasmids was more then
3 orders of magnitude lower in comparison with cells containing
mutator pMutD5-61. Our results showed that hypermutation was very
beneficial for cell survival at elevated DMF concentrations (Table
V). E. blattae 33429 appeared to be more sensitive to DMF.
Population of 10.sup.6 cells raised 968 colonies during 2 plating.
When 10 bigger colonies were mixed and a new aliquots of 10.sup.6
cells were plated on DMF plates supplemented with 70 g/l DMF, more
than 1000 tiny colonies grew on the plates. However, these small
colonies were not viable after transfer on fresh 70 g/l DMF plates.
The mutation frequency of E. blattae 33429(pMutD5-61) dropped from
4.55.times.10.sup.-6 to 1.1.times.10.sup.-7 after second plating on
plates containing 60 g/l DMF (Table V). Plasmid MutD5-61 initially
provided lower mutation frequency in E. blattae in comparison with
E. coli. The E. blatte strain distinctly reduced mutability after
cultivation in the presence of DMF. Although E. coli and E. blattae
strains belong to the family Enterobacteriaceae, the behavior of E.
coli mutD5 gene product could be somewhat different in E. blattae
cell environment. Nevertheless, the benefits of pMutD5 for survival
of E. blattae on 60 g/l DMF plates were obvious. Control cells
carrying pMutD-71 couldn't grow in the presence of DMF above 50
g/l.
[0062] Contrary to E. blattae 33429(pMutD5-61), we did not observed
significant adjustments of mutability in E. coli strains. The
mutation frequency stayed within the same range at the end of
evolution experiment. (Table V).
[0063] Single colonies of evolved cultures were used for curing
experiments. The curing efficiency was 87-100% with E. blattae
33429 and E. coli MM294. The mutation frequencies of cured clones
were similar to wild type control frequencies, and cured clones
preserved their ability to grow at elevated DMF concentration. E.
blattae 33429 cured clones grew with 60 g/l DMF and E. coli MM294
grew with 80 g/l DMF. Initial tolerance of MM294 and E. blattae
33429 was 60 g/l and 50 g/l DMF respectively. The evolved strains
increased their tolerance by 20 g/l and 10 g/l DMF, respectively.
Therefore, sensitivity to DMF is strain dependent.
[0064] The advantage of mutator plasmids for evolution in liquid
culture was tested as well. Within 4 days of solvent tolerance
evolution in liquid medium supplemented with DMF or ethanol, E.
blattae 33429(pMutD5-61) demonstrated growth at higher
concentrations of both solvents in comparison with control
cultures.
[0065] Mutator plasmids can be applied for evolution of bacterial
tolerance to different solvents, various environmental stress and
potentially toxic specialty chemicals of industrial biotechnology.
One advantage of the directed evolution methods disclosed herein is
that the evolution of microorganisms carrying mutator plasmids can
be stopped at any time. Mutator plasmids can be cured from evolving
strains, and therefore, evolved desired features of the whole
strain can be preserved.
TABLE-US-00005 TABLE IV Evolution of solvent tolerance. Colony
formation by resistant clones on LB plates supplemented with
various DMF concentrations. Plating 1 Plating 2 Number of Number of
Strain Genotype DMF(g/l) colonies* colonies* MM294 (pMutD5-61)
Mutator 60 g/l low high density density lawn lawn MM294 (pMutD5-61)
Mutator 70 g/l 11 824 MM294 (pMutD5-61) Mutator 80 g/l 0 4 MM294
(pMutD-71) Wild type 60 g/l 17 low density lawn MM294 (pMutD-71)
Wild type 70 g/l 0 0 EB33429 (pMutD5-61) Mutator 50 g/l low high
density density lawn lawn EB33429 (pMutD5-61) Mutator 60 g/l 0 968
EB33429 (pMutD-71) Wild type 50 g/l 793 high density lawn EB33429
(pMutD-71) Wild type 60 g/l 0 0 *The number of colonies represents
survivors from 10.sup.6 cells plated on LB-DMF plates.
TABLE-US-00006 TABLE V Mutation frequencies of bacteria harboring
mutator and control plasmids. Mutation rate DMF Mutation rate
Strain before the evolution (g/l)* after the evolution
MM294(pMutD5-61) 9.2 .+-. 6.5 .times. 10.sup.-5 80 g/l 4.7 .+-. 4
.times. 10.sup.-5 MM294(pMutD-71) 4.15 .+-. 3.4 .times. 10.sup.-8
60 g/l 2.9 .+-. 2.4 .times. 10.sup.-8 EB33429(pMutD5-61) 4.55 .+-.
3.7 .times. 10.sup.-6 60 g/l 1.13 .+-. 0.9 .times. 10.sup.-7
EB33429(pMutD-71) 2.6 .+-. 2.1 .times. 10.sup.-8 50 g/l 4.7 .+-.
3.8 .times. 10.sup.-8 *Single colonies from LB-DMF plates were
grown in LB medium to OD A.sub.620 = 0.8-1.2. and plated on
LB-Rifampicin or Streptomycin plates at 30.degree. C. The
experiments were done in triplicates.
Example 3
Evolution of High Temperature Strains
[0066] Example 3 illustrates high temperature evolution under
conditions of continuous fermentation in the mode of turbidostat
which allows for fermentation wherein the cell density is
stabilized. Two independent experiments were run with the strains:
A: W1485 (ATCC12435) (=non mutator); B: W1485/pBRmutD68 (same
strain but comprises mutator plasmid). Both strains were gown in
continuous culture in a turbidostat in LB medium for about 1800
doublings. The temperature was controlled by a computer based on
the measured growth rate to maintain a doubling time of about 1 h.
Whenever the culture grew faster the temperature was raised and
vice versa. The time course of both cultures is shown in FIG. 4.
Initially, the culture started from W1485/pBRmutD68 evolved faster
than the culture started from W1485. This indicates the advantage
of the mutator plasmid. However, After about 400 doublings W1485
reached the higher temperature. We also measured the mutation rate
of samples taken from both evolution experiments. Table 6 shows
that the starting clones differed in their mutation frequencies by
a factor of 3000. However, during the evolution experiments the
mutation frequencies converged to within a factor of 2. The
experiment illustrates that the rate of temperature evolution slows
down over the course of the experiment. It can be expected that in
a wild type strain there are a small number of genes which
initially limit growth at elevated temperature. Favorable mutations
in these genes will lead to relatively large gains in fitness.
However, with increasing temperature more and more genes can be
expected to limit growth and the pace of evolution slows down. If
individual mutations result in only very small growth benefits to
their carrier then the populations have to be grown for a
significant number of doublings to enrich the clones carrying these
mutations from the population. As a consequence the optimum
mutation rate for evolution will decrease during the process of
evolution. For Table VI, mutation rates were determined using
rifampicin as given in Miller (1992, supra).
TABLE-US-00007 TABLE VI Mutation rates of strains and populations
used for temperature evolution Strain/population doublings
temperature .degree. C. mutation rate W1485/pBRmutD611 0 45 3142.9
AL018 210 47.22 3428.6 AL019 376 47.50 2028.6 AL038 1811 48.21
1142.9 W1485 0 45 1.0 AL017 231 47.10 0.9 AL035 543 47.91 134.3
AL040 1385 48.57 514.3
Example 4
Directed Evolution of E. blattae and Selection in the Presence of a
Solvent, 1,3-propanediol
[0067] E. Blattae ATCC accession number 33429 was transformed with
plasmid pMutD68 (see Table III) and cultured in media containing 1,
5, 10, 20, and 30 g/l 1,3 propanediol (cultures are designated as
GEBxxx where "xxx" indicates the number of transfers into fresh
media). All directed evolution experiments were carried out under
anaerobic conditions in defined minimal medium with glycerol as a
sole carbon source. E. blattae doesn't require vitamin B.sub.12 for
growth, nevertheless, initial experiments were performed in 2
conditions (1) with B.sub.12, and (2) without B.sub.12 in the
growth medium.
[0068] Within 18-22 h GEB001 reached maximum 1030-1060 mOD
(A.sub.650) at all concentrations of 1,3 propanediol. Therefore, 30
g/l 1,3-PD was not inhibitory for GEB001 growth. Growth rates of
GEB in the presence of 50 g/l were .about.1/2 of growth rates in
the presence of 30 g/l 1,3-PD (590 mOD: 1030 mOD in 22 h). The
threshold of tolerance to 1,3-PD was found between 70 to 80 g/l.
After 10 transfers, GEB010 was able to grow in the presence of 80
g/l 1,3-PD to 350 mOD within 78 h. However, these cells failed to
grow at 80 g/l 1,3-PD concentration after next transfer.
[0069] E. blatte is known in the art to carry the enzymatic pathway
for the production of 1,3 propanediol (Roth, et al., 1986, Annu.
Rev. Microbiol. 50:137-181). In order to determine if E. blatte can
make 1,3-propanediol in addition to the concentrations of 1,3
propanediol added to the medium, GEB011 was grown in medium
supplemented with 2-.sup.13C glycerol and 70 g/l 1,3-PD. The
supernatant was then analyzed by NMR (.sup.13C) and the results
indicated the formation of .about.2.6 g/l .sup.13C 1,3-PD.
Therefore, GEB cells can make 1,3 propanediol in the presence of
1,3-PD.
[0070] The evolution of 1,3-propanediol resistance was faster in
the presence of B12. After 2 months of evolution GEB025 (+B12) was
able to grow with 95-100 g/l 1,3-propanediol. After 3 months of
anaerobic growth under selection in the presence of
1,3-propanediol, GEB028 (-B12) could grow in medium supplemented
with 110 g/l 1,3-propanediol. Analysis of aerobic growth of GEB031
on LB plates supplemented with 85, 95, 105 and 115 g/l
1,3-propanediol showed that cells produce much bigger colonies in
the presence of 85 g/l in comparison with 105 g/l. No growth was
observed at 115 g/l 1,3 propanediol. The results indicate that
after 3 months of applying directed evolutions techniques described
herein to E. blatte, the tolerance to 1,3 propanediol was increased
from 75 g/l to at least 105 g/l under aerobic conditions. The
plasmid was cured from the GEB031 strain by growing at 41.5
degrees. An illustrative clone, GEB031-4 was deposited with the
ATCC and has accession number.
Example 5
Genetic Changes in Evolved E. blattae
[0071] 1,3-propanediol dehydrogenase (PDD) was compared between
wild type E. blattae and the evolved strain GEB031. The PDD from
the evolved strain had a higher Km for 1,3-propanediol.
Materials and Methods
[0072] Strains--Wild type ATCC 33429, E. blattae comprising the
mutant PDD as described in Example 4 and having ATCC accession
number ______. Growth--Cells were grown in a complex medium at 30 C
500 ml in a 2800 ml fernbach with shaking at 225 rpm for 20 hr. The
medium consists of KH2PO4, 5.4 g/L; (NH4)2SO4, 1.2 g/L; MgSO47H2O,
0.4 g/L; yeast GC560 extract, 2.0 g/L; tryptone, 2.0 g/L; and
glycerol, 9.2 g/L in tap water. The pH was adjusted to 7.1 with KOH
before autoclaving (Honda, et al., 1980, J. Bacteriol,
143:1458-1465). Extract Prep--Cells were harvested by
centrifugation with care to avoid anaerobic conditions. Pellets
were resuspended in 100 mM Tricine pH 8.2 containing 50 mM KCl and
1 mM DTT. Cells were disrupted by passage through a French pressure
cell. Crude extracts were clarified by centrifugation at
20K.times.g for 20 min followed by 100K.times.g for 1 hr to yield
the high speed supernatant (HSS) fraction. Assays--the assay for
PDD was performed as described by Johnson, E. A. et al., 1987, J.
Bacteriol. 169:2050-2054. Partial purification of PDD--HSS was
separated on a 16.times.100 Poros 20HQ column. The buffers were A,
50 mM HEPES, pH 7.4 containing 100 uM MnCl and B, A buffer
containing 500 mM KCl. The column was loaded and developed at 10
ml/min. The gradient was 10 CV wash, a linear gradient to 70% B in
10 CV, and 1 CV to 100% B. The activity was detected in the very
early fractions of the gradient. Pooled column fractions of the
33429 strain were used as collected for assays after the addition
of additional of DTT to 1 mM. The active fractions from strain
GEB031 were pooled and concentrated on a PM30 membrane and used as
concentrated after the addition of additional 1 mM DTT.
TABLE-US-00008 Strain GD (U/mg) PDD (U/mg) Ratio GD/PDD 33429 0.64
0.22 2.9 GEB031 0.79 0.08 9.9
[0073] PDD Kinetics--The results are shown below.
TABLE-US-00009 Strain Km (mM Propanediol) Km (uM NAD) 33429 28
57
Example 6
Cloning and Sequencing the 1,3-propanediol dehydrogenase Genes
(dhaT) from E. blattae.
[0074] The dhaT genes were amplified by PCR from genomic DNA from
E. blattae as template DNA using synthetic primers (primer 1 and
primer 2) based on the K. pneumoniae dhaT sequence and
incorporating an XbaI site at the 5' end and a BamHI site at the 3'
end. The product was subcloned into pCR-Blunt II-TOPO (Invitrogen).
The cloning dhaT were then sequenced was standard techniques. The
results of the DNA sequencing are given in SEQ ID NO: 1 and SEQ ID
NO:2.
TABLE-US-00010 Primer I 5'TCTGATACGGGATCCTCAGAATGCCTGGCGGAAAAT3'
Primer 2 5'GCGCCGTCTAGAATTATGAGCTATCGTATGTTTGATTATCTG3'
As will be readily understood by the skilled artisan, nucleic acid
sequence via PCR methods may comprise inadvertent errors. The
present invention encompasses nucleic acid encoding PDD obtainable
from E. blattae having accession number ______.
Example 7
Comparison of Wild-Type E. blattae (ATCC Accession number 33429)
and the Evolved Strain GEB031-4 (ATCC Accession Number ______)
[0075] This example shows that E. blattae subjected to the methods
of the present invention and having ATCC accession number ______
can completely consume 800 mM glycerol during anaerobic
fermentation and does not accumulate 3-hydroxy-propionaldehyde
(3HPA) and does not lose viability. In contrast, the wild-type E.
blattae accumulates 50 mM 3 HPA and becomes non viable after
consuming only 350 mM glycerol.
[0076] The wild-type E. blattae and the evolved E. blattae were
subjected to fermentation in the following medium: 75 g glycerol, 5
g K.sub.2HPO.sub.4.3H.sub.2O, 3 g KH.sub.2PO.sub.4, 2 g
(NH.sub.4).sub.2SO.sub.4 0.4 g MgSO.sub.4.7H.sub.2O, 0.2 g
CaCl.sub.2.2H.sub.2O, 4 mg CoCl.sub.2.2H.sub.2O, 2 g yeast extract,
and 1 g peptone per liter water. The pH was maintained with 20%
NaOH. Both fermentations were run at 30.degree. C. with a N.sub.2
sparge and were inoculated with a stationary grown overnight
preculture.
The wild-type E. blattae accumulated 3HPA and stopped growing and
metabolizing glycerol. The accumulation of 3HPA was high and
reached 50 mM. The cell density did not change with the culture
age, but viability of the cells did. Plate counts demonstrated that
accumulation of 3HPA was toxic. In contrast, the evolved strain did
not accumulate more than about 6 mM 3HPA and did not lose viability
with culture age. After the culture had consumed all of the
glycerol more was added and the culture continued converting
glycerol to 1,3-propanediol. See FIGS. 5 and 6. All references
cited herein, including patents, patent applications, sequences and
publications are hereby incorporated in their entirety by
reference.
Sequence CWU 1
1
151741DNAEscherichia coli 1atgaccgcta tgagcactgc aattacacgc
cagatcgttc tcgataccga aaccaccggt 60atgaaccaga ttggtgcgca ctatgaaggc
cacaagatca ttgagattgg tgccgttgaa 120gtggtgaacc gtcgcctgac
gggcaataac ttccatgttt atctcaaacc cgatcggctg 180gtggatccgg
aagcctttgg cgtacatggt attgccgatg aatttttgct cgataagccc
240acgtttgccg aagtagccga tgagttcatg gactatattc gcggcgcgga
gttggtgatc 300cataacgcag cgttcgatat cggctttatg gactacgagt
tttcgttgct taagcgcgat 360attccgaaga ccaatacttt ctgtaaggtc
accgatagcc ttgcggtggc gaggaaaatg 420tttcccggta agcgcaacag
cctcgatgcg ttatgtgctc gctacgaaat agataacagt 480aaacgaacgc
tgcacggggc attactcgat gcccagatcc ttgcggaagt ttatctggcg
540atgaccggtg gtcaaacgtc gatggctttt gcgatggaag gagagacaca
acagcaacaa 600ggtgaagcaa caattcagcg cattgtacgt caggcaagta
agttacgcgt tgtttttgcg 660acagatgaag agattgcagc tcatgaagcc
cgtctcgatc tggtgcagaa gaaaggcgga 720agttgcctct ggcgagcata a
7412246PRTEscherichia coli 2Met Thr Ala Met Ser Thr Ala Ile Thr Arg
Gln Ile Val Leu Asp Thr 1 5 10 15Glu Thr Thr Gly Met Asn Gln Ile
Gly Ala His Tyr Glu Gly His Lys 20 25 30Ile Ile Glu Ile Gly Ala Val
Glu Val Val Asn Arg Arg Leu Thr Gly 35 40 45Asn Asn Phe His Val Tyr
Leu Lys Pro Asp Arg Leu Val Asp Pro Glu 50 55 60Ala Phe Gly Val His
Gly Ile Ala Asp Glu Phe Leu Leu Asp Lys Pro65 70 75 80Thr Phe Ala
Glu Val Ala Asp Glu Phe Met Asp Tyr Ile Arg Gly Ala 85 90 95Glu Leu
Val Ile His Asn Ala Ala Phe Asp Ile Gly Phe Met Asp Tyr 100 105
110Glu Phe Ser Leu Leu Lys Arg Asp Ile Pro Lys Thr Asn Thr Phe Cys
115 120 125Lys Val Thr Asp Ser Leu Ala Val Ala Arg Lys Met Phe Pro
Gly Lys 130 135 140Arg Asn Ser Leu Asp Ala Leu Cys Ala Arg Tyr Glu
Ile Asp Asn Ser145 150 155 160Lys Arg Thr Leu His Gly Ala Leu Leu
Asp Ala Gln Ile Leu Ala Glu 165 170 175Val Tyr Leu Ala Met Thr Gly
Gly Gln Thr Ser Met Ala Phe Ala Met 180 185 190Glu Gly Glu Thr Gln
Gln Gln Gln Gly Glu Ala Thr Ile Gln Arg Ile 195 200 205Val Arg Gln
Ala Ser Lys Leu Arg Val Val Phe Ala Thr Asp Glu Glu 210 215 220Ile
Ala Ala His Glu Ala Arg Leu Asp Leu Val Gln Lys Lys Gly Gly225 230
235 240Ser Cys Leu Trp Arg Ala 24531164DNAEscherichia blattae
3atgagctatc gtatgtttga ttatctggtt ccaaatgtga acttctttgg cccgggcgcc
60gtttctgttg ttggccagcg ctgccagctg ctggggggta aaaaagccct gctggtgacc
120gataagggcc tgcgcgccat taaagacggt gctgtcgatc agaccgtgaa
gcacctgaaa 180gccgccggta ttgaggtggt cattttcgac ggggtcgagc
cgaacccgaa agacaccaac 240gtgctcgacg gcctggccat gttccgtaaa
gagcagtgcg acatgataat caccgtcggc 300ggcggcagcc cgcacgactg
cggtaaaggc attggtattg cggccaccca cccgggtgat 360ctgtacagct
atgccggtat cgaaacactc accaacccgc tgccgcccat tattgcggtc
420aacaccaccg ccgggaccgc cagcgaagtc acccgccact gcgtgctgac
taacaccaaa 480accaaagtaa aatttgtgat tgtcagctgg cgcaacctgc
cttccgtctc cattaacgat 540ccgctgctga tgatcggcaa gcccgccggg
ctgaccgccg ccaccggtat ggatgccctg 600acccacgcgg tagaggccta
tatctccaaa gacgccaacc cggttaccga tgcctctgct 660attcaggcca
tcaaactgat tgccaccaac ttgcgccagg ccgtcgccct ggggaccaac
720ctcaaagccc gtgaaaacat ggcctgcgcc tctctgctgg ccgggatggc
ctttaacaac 780gccaacctgg gctatgttca cgccatggct caccagctgg
gcggcctgta cgacatggcc 840cacggggtgg cgaacgcggt cctgctgccc
catgtctgcc gctataacct gattgccaac 900ccggaaaaat ttgccgatat
cgccaccttt atgggggaaa acaccaccgg tctttccacc 960atggacgcag
cggagctggc catcagcgcc attgcccgtc tgtctaaaga tgtcgggatc
1020ccgcagcacc tgcgtgaact gggggtaaaa gaggccgact tcccgtacat
ggcagaaatg 1080gccctgaaag acggcaacgc cttctctaac ccgcgcaaag
ggaacgaaaa agagattgcc 1140gacattttcc gccaggcatt ctga
11644387PRTEscherichia blattae 4Met Ser Tyr Arg Met Phe Asp Tyr Leu
Val Pro Asn Val Asn Phe Phe 1 5 10 15Gly Pro Gly Ala Val Ser Val
Val Gly Gln Arg Cys Gln Leu Leu Gly 20 25 30Gly Lys Lys Ala Leu Leu
Val Thr Asp Lys Gly Leu Arg Ala Ile Lys 35 40 45Asp Gly Ala Val Asp
Gln Thr Val Lys His Leu Lys Ala Ala Gly Ile 50 55 60Glu Val Val Ile
Phe Asp Gly Val Glu Pro Asn Pro Lys Asp Thr Asn65 70 75 80Val Leu
Asp Gly Leu Ala Met Phe Arg Lys Glu Gln Cys Asp Met Ile 85 90 95Ile
Thr Val Gly Gly Gly Ser Pro His Asp Cys Gly Lys Gly Ile Gly 100 105
110Ile Ala Ala Thr His Pro Gly Asp Leu Tyr Ser Tyr Ala Gly Ile Glu
115 120 125Thr Leu Thr Asn Pro Leu Pro Pro Ile Ile Ala Val Asn Thr
Thr Ala 130 135 140Gly Thr Ala Ser Glu Val Thr Arg His Cys Val Leu
Thr Asn Thr Lys145 150 155 160Thr Lys Val Lys Phe Val Ile Val Ser
Trp Arg Asn Leu Pro Ser Val 165 170 175Ser Ile Asn Asp Pro Leu Leu
Met Ile Gly Lys Pro Ala Gly Leu Thr 180 185 190Ala Ala Thr Gly Met
Asp Ala Leu Thr His Ala Val Glu Ala Tyr Ile 195 200 205Ser Lys Asp
Ala Asn Pro Val Thr Asp Ala Ser Ala Ile Gln Ala Ile 210 215 220Lys
Leu Ile Ala Thr Asn Leu Arg Gln Ala Val Ala Leu Gly Thr Asn225 230
235 240Leu Lys Ala Arg Glu Asn Met Ala Cys Ala Ser Leu Leu Ala Gly
Met 245 250 255Ala Phe Asn Asn Ala Asn Leu Gly Tyr Val His Ala Met
Ala His Gln 260 265 270Leu Gly Gly Leu Tyr Asp Met Ala His Gly Val
Ala Asn Ala Val Leu 275 280 285Leu Pro His Val Cys Arg Tyr Asn Leu
Ile Ala Asn Pro Glu Lys Phe 290 295 300Ala Asp Ile Ala Thr Phe Met
Gly Glu Asn Thr Thr Gly Leu Ser Thr305 310 315 320Met Asp Ala Ala
Glu Leu Ala Ile Ser Ala Ile Ala Arg Leu Ser Lys 325 330 335Asp Val
Gly Ile Pro Gln His Leu Arg Glu Leu Gly Val Lys Glu Ala 340 345
350Asp Phe Pro Tyr Met Ala Glu Met Ala Leu Lys Asp Gly Asn Ala Phe
355 360 365Ser Asn Pro Arg Lys Gly Asn Glu Lys Glu Ile Ala Asp Ile
Phe Arg 370 375 380Gln Ala Phe385512DNAArtificial Sequencewild type
mutD gene 5atgaccgcta tg 12611DNAArtificial SequencepOS100 mutD
mutated gene 6ttgacgcttt g 11712DNAArtificial SequencepOS101 mutD
mutated gene 7gtgaccgctg tg 12811DNAArtificial SequencepOS102 mutD
mutated gene 8gtgccgctgt g 11912DNAArtificial SequencepOS104 mutD
mutated gene 9ttgaccgctt tg 121055DNAArtificial SequencepOS105 mutD
mutated gene 10gtgaccgctg tgagcacttg caattacacg ccagatcgtt
ctcgataccg aaatc 551111DNAArtificial SequencepOS106 mutD mutated
gene 11gtgaccgctt g 111228DNAArtificial Sequenceprimer 12cgcctccagc
gcgacaatag cggccatc 281327DNAArtificial Sequenceprimer 13ccgactgaac
taccgctccg cgttgtg 271436DNAArtificial Sequenceprimer 14tctgatacgg
gatcctcaga atgcctggcg gaaaat 361542DNAArtificial Sequenceprimer
15gcgccgtcta gaattatgag ctatcgtatg tttgattatc tg 42
* * * * *