U.S. patent application number 11/926042 was filed with the patent office on 2008-09-11 for methods and compositions for detecting target sequences.
This patent application is currently assigned to THIRD WAVE TECHNOLOGIES, INC.. Invention is credited to Jorge Garces, Jeff G. Hall, Andrew A. Lukowiak, WuPo Ma.
Application Number | 20080220425 11/926042 |
Document ID | / |
Family ID | 32074833 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080220425 |
Kind Code |
A1 |
Ma; WuPo ; et al. |
September 11, 2008 |
Methods and Compositions for Detecting Target Sequences
Abstract
The present invention relates to compositions and methods for
the detection and characterization of nucleic acid sequences and
variations in nucleic acid sequences. The present invention relates
to methods for amplifying a synthetic DNA from a target nucleic
acid, forming a nucleic acid cleavage structure on the synthetic
DNA, and detecting cleavage of the nucleic acid cleavage structure
as an indicator of the preset of the target nucleic acid.
Inventors: |
Ma; WuPo; (Madison, WI)
; Garces; Jorge; (Waunakee, WI) ; Hall; Jeff
G.; (Waunakee, WI) ; Lukowiak; Andrew A.;
(Stoughton, WI) |
Correspondence
Address: |
Casimir Jones, S.C.
440 Science Drive, Suite 203
Madison
WI
53711
US
|
Assignee: |
THIRD WAVE TECHNOLOGIES,
INC.
Madison
WI
|
Family ID: |
32074833 |
Appl. No.: |
11/926042 |
Filed: |
October 28, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11837468 |
Aug 10, 2007 |
|
|
|
11926042 |
|
|
|
|
10356861 |
Feb 3, 2003 |
7256020 |
|
|
11837468 |
|
|
|
|
10290386 |
Nov 7, 2002 |
7195871 |
|
|
10356861 |
|
|
|
|
09713601 |
Nov 15, 2000 |
6913881 |
|
|
10290386 |
|
|
|
|
09350309 |
Jul 9, 1999 |
6348314 |
|
|
09713601 |
|
|
|
|
08756386 |
Nov 26, 1996 |
5985557 |
|
|
09350309 |
|
|
|
|
08682853 |
Jul 12, 1996 |
6001567 |
|
|
08756386 |
|
|
|
|
08599491 |
Jan 24, 1996 |
5846717 |
|
|
08682853 |
|
|
|
|
09381212 |
Feb 8, 2000 |
6872816 |
|
|
PCT/US98/05809 |
Mar 24, 1998 |
|
|
|
09713601 |
|
|
|
|
60344946 |
Nov 7, 2001 |
|
|
|
60361060 |
Feb 27, 2002 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/6.1;
435/6.17; 435/6.18 |
Current CPC
Class: |
C07K 2319/02 20130101;
C12N 9/1252 20130101; C12Q 1/6869 20130101; C12N 2710/16122
20130101; C12Q 1/6865 20130101; C12N 9/22 20130101; C12Q 1/6865
20130101; C12Q 1/6869 20130101; A61K 38/00 20130101; C12Q 1/6844
20130101; C12Q 1/6844 20130101; C12Q 2525/307 20130101; C12Q
2521/301 20130101; C12Q 2521/301 20130101; C12Q 2521/301 20130101;
C12Q 2525/307 20130101; C12Q 2521/337 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for detecting a target nucleic acid, comprising: a)
providing a sample comprising: i) synthetic DNA amplified from
target nucleic acid by loop-mediated isothermal amplification; ii)
oligonucleotides capable of forming an invasive cleavage structure
with said synthetic DNA; and iii) an agent for cleaving an invasive
cleavage structure; b) exposing said sample to conditions wherein
said oligonucleotides form an invasive cleavage structure with said
synthetic DNA, wherein said invasive cleavage structure is cleaved
by said agent; and c) detecting cleavage of an invasive cleavage
structure by said agent, thereby detecting the presence of said
target nucleic acid.
2. The method of claim 1, wherein said synthetic DNA comprises a
first region and a second region, said second region downstream of
and contiguous to said first region, and wherein said
oligonucleotides comprise first and second oligonucleotides,
wherein at least a portion of said first oligonucleotide is
completely complementary to said first portion of said synthetic
DNA and wherein said second oligonucleotide comprises a 3' portion
and a 5' portion, wherein said 5' portion is completely
complementary to said second portion of said synthetic DNA.
3. The method of claim 1, wherein said detecting cleavage of an
invasive cleavage structure comprises detection selected from the
group consisting of detection of fluorescence, mass, fluorescence
energy transfer, radioactivity, luminescence, phosphorescence,
fluorescence polarization, and charge.
4. The method of claim 1, wherein said agent comprises a
thermostable 5' nuclease.
5. The method of claim 4, wherein said thermostable 5' nuclease
comprises a FEN-1 endonuclease.
6. The method of claim 1, wherein said polymerase comprises a
polymerase from Bacillus stearothermophilus.
7. The method of claim 1, wherein said target nucleic acid is
selected from the group consisting of DNA and RNA.
8. A method for detecting a target nucleic acid, comprising: a)
providing a mixture comprising: i) a sample suspected of containing
a target nucleic acid; and ii) detection reagents, said detection
reagents comprising: (a) primers configured to produce amplified
synthetic DNA from said target nucleic acid by loop-mediated
isothermal amplification; (b) a polymerase for amplifying synthetic
DNA from said target nucleic acid by loop-mediated isothermal
amplification; (c) oligonucleotides capable of forming an invasive
cleavage structure with said synthetic DNA; and (d) an agent for
cleaving an invasive cleavage structure; b) exposing said mixture
to conditions wherein, if said target nucleic acid is present,
synthetic DNA is amplified from said target nucleic acid using said
primers and said polymerase, and wherein said oligonucleotides form
an invasive cleavage structure with said synthetic DNA, and wherein
said invasive cleavage structure is cleaved by said agent; and c)
detecting the cleavage of an invasive cleavage structure by said
agent, thereby detecting the presence of said target nucleic
acid.
9. The method of claim 8, wherein said synthetic DNA comprises a
first region and a second region, said second region downstream of
and contiguous to said first region, and wherein said
oligonucleotides comprise first and second oligonucleotides,
wherein at least a portion of said first oligonucleotide is
completely complementary to said first portion of said synthetic
DNA and wherein said second oligonucleotide comprises a 3' portion
and a 5' portion, wherein said 5' portion is completely
complementary to said second portion of said synthetic DNA.
10. The method of claim 8, wherein said detecting cleavage of an
invasive cleavage structure comprises detection selected from the
group consisting of detection of fluorescence, mass, fluorescence
energy transfer, radioactivity, luminescence, phosphorescence,
fluorescence polarization, and charge.
11. The method of claim 8, wherein said agent comprises a
thermostable 5' nuclease.
12. The method of claim 11, wherein said thermostable 5' nuclease
comprises a FEN-1 endonuclease.
13. The method of claim 8, wherein said polymerase comprises a
polymerase from Bacillus stearothermophilus.
14. The method of claim 8, wherein said target nucleic acid
selected from the group consisting of DNA and RNA.
15. A nucleic acid treatment kit comprising primers configured to
produce amplified synthetic DNA from a target nucleic acid by
loop-mediated isothermal amplification, and oligonucleotides
capable of forming an invasive cleavage structure with said
synthetic DNA.
16. The kit of claim 15, further comprising a thermostable 5'
nuclease.
17. The kit of claim 16, wherein said thermostable 5' nuclease
comprises a FEN-1 endonuclease.
18. The kit of claim 15, further comprising a polymerase for
amplifying synthetic DNA from said target nucleic acid by
loop-mediated isothermal amplification.
19. The kit of claim 18, wherein said polymerase comprises a
polymerase from Bacillus stearothermophilus.
20. The kit of claim 15, further comprising a target nucleic acid.
Description
[0001] The present application is a continuation U.S. application
Ser. No. 11/837,468, filed Aug. 10, 2007, which is of
continuation-in-part U.S. application Ser. No. 10/356,861, filed
Feb. 3, 2003, now U.S. Pat. No. 7,256,020, which is a
continuation-in-in part of U.S. application Ser. No. 10/290,386,
now U.S. Pat. No. 7,175,871, which claims priority to U.S.
Provisional Application 60/344,946 filed Nov. 7, 2001, and to U.S.
Provisional Application 60/361,060 filed Feb. 27, 2002, each hereby
incorporated by reference in their entireties. U.S. application
Ser. No. 10/290,386 is a continuation-in-part of application Ser.
No. 09/713,601, filed Nov. 15, 2000, which issued as U.S. Pat. No.
6,913,881, which is a continuation-in-part of U.S. application Ser.
No. 09/350,309, filed Jul. 9, 1999, now U.S. Pat. No. 6,348,314,
which is a divisional of U.S. application Ser. No. 08/756,386,
filed Nov. 29, 1996, now U.S. Pat. No. 5,985,557, which is a
continuation-in-part of U.S. application Ser. No. 08/682,853, filed
Jul. 12, 1996, now U.S. Pat. No. 6,001,567, which is a
continuation-in-part of U.S. application Ser. No. 08/599,491, filed
Jan. 24, 1996, now U.S. Pat. No. 5,846,717. U.S. application Ser.
No. 09/713,601 is also a continuation-in-part of application Ser.
No. 09/381,212, filed Feb. 8, 2000, now issued as U.S. Pat. No.
6,872,816, which is a national entry of PCT Application No.
PCT/US98/05809, filed Mar. 24, 1998, which claims priority to U.S.
application Ser. No. 08/823,516, filed Mar. 24, 1997, which issued
as U.S. Pat. No. 5,994,069 on Nov. 30, 1999, which is a
continuation-in-part of PCT Application No. PCT/US97/01072, filed
on Jan. 22, 1997, which claims priority to U.S. application Ser.
No. 08/759,038, filed Dec. 2, 1996, which issued as U.S. Pat. No.
6,090,543 on Jul. 18, 2000, and to U.S. appl. Ser. Nos. 08/756,386,
08/682,853, and 08/599,491.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions and methods
for the detection and characterization of nucleic acid sequences
and variations in nucleic acid sequences. The present invention
relates to methods for forming a nucleic acid cleavage structure on
a target sequence and cleaving the nucleic acid cleavage structure
in a site-specific manner. For example, in some embodiments, a 5'
nuclease activity from any of a variety of enzymes is used to
cleave the target-dependent cleavage structure, thereby indicating
the presence of specific nucleic acid sequences or specific
variations thereof.
BACKGROUND OF THE INVENTION
[0003] Methods for the detection and characterization of specific
nucleic acid sequences and sequence variations have been used to
detect the presence of viral or bacterial nucleic acid sequences
indicative of an infection, to detect the presence of variants or
alleles of genes associated with disease and cancers. These methods
also find application in the identification of sources of nucleic
acids, as for forensic analysis or for paternity
determinations.
[0004] Various methods are known to the art that may be used to
detect and characterize specific nucleic acid sequences and
sequence variants. Nonetheless, with the completion of the nucleic
acid sequencing of the human genome, as well as the genomes of
numerous pathogenic organisms, the demand for fast, reliable,
cost-effective and user-friendly tests for the detection of
specific nucleic acid sequences continues to grow. Importantly,
these tests must be able to create a detectable signal from samples
that contain very few copies of the sequence of interest. The
following discussion examines two levels of nucleic acid detection
assays currently in use: I. Signal Amplification Technology for
detection of rare sequences; and II. Direct Detection Technology
for quantitative detection of sequences.
I. Signal Amplification Technology Methods For Amplification
[0005] The "Polymerase Chain Reaction" (PCR) comprises the first
generation of methods for nucleic acid amplification. However,
several other methods have been developed that employ the same
basis of specificity, but create signal by different amplification
mechanisms. These methods include the "Ligase Chain Reaction"
(LCR), "Self-Sustained Synthetic Reaction" (3SR/NASBA), and
"Q.beta.-Replicase" (Q.beta.).
[0006] Polymerase Chain Reaction (PCR)
[0007] The polymerase chain reaction (PCR), as described in U.S.
Pat. Nos. 4,683,195, 4,683,202, and 4,965,188 to Mullis and Mullis
et al. (the disclosures of which are hereby incorporated by
reference), describe a method for increasing the concentration of a
segment of target sequence in a mixture of genomic DNA without
cloning or purification. This technology provides one approach to
the problems of low target sequence concentration. PCR can be used
to directly increase the concentration of the target to an easily
detectable level. This process for amplifying the target sequence
involves introducing a molar excess of two oligonucleotide primers
that are complementary to their respective strands of the
double-stranded target sequence to the DNA mixture containing the
desired target sequence. The mixture is denatured and then allowed
to hybridize. Following hybridization, the primers are extended
with polymerase so as to form complementary strands. The steps of
denaturation, hybridization, and polymerase extension can be
repeated as often as needed, in order to obtain relatively high
concentrations of a segment of the desired target sequence.
[0008] The length of the segment of the desired target sequence is
determined by the relative positions of the primers with respect to
each other, and, therefore, this length is a controllable
parameter. Because the desired segments of the target sequence
become the dominant sequences (in terms of concentration) in the
mixture, they are said to be "PCR-amplified."
[0009] Ligase Chain Reaction (LCR or LAR)
[0010] The ligase chain reaction (LCR; sometimes referred to as
"Ligase Amplification Reaction" (LAR) described by Barany, Proc.
Natl. Acad. Sci., 88:189 (1991); Barany, PCR Methods and Applic.,
1:5 (1991); and Wu and Wallace, Genomics 4:560 (1989) has developed
into a well-recognized alternative method for amplifying nucleic
acids. In LCR, four oligonucleotides, two adjacent oligonucleotides
which uniquely hybridize to one strand of target DNA, and a
complementary set of adjacent oligonucleotides, that hybridize to
the opposite strand are mixed and DNA ligase is added to the
mixture. Provided that there is complete complementarity at the
junction, ligase will covalently link each set of hybridized
molecules. Importantly, in LCR, two probes are ligated together
only when they base-pair with sequences in the target sample,
without gaps or mismatches. Repeated cycles of denaturation,
hybridization and ligation amplify a short segment of DNA. LCR has
also been used in combination with PCR to achieve enhanced
detection of single-base changes. Segev, PCT Public. No. W09001069
A1 (1990). However, because the four oligonucleotides used in this
assay can pair to form two short ligatable fragments, there is the
potential for the generation of target-independent background
signal. The use of LCR for mutant screening is limited to the
examination of specific nucleic acid positions.
[0011] Self-Sustained Synthetic Reaction (3SR/NASBA)
[0012] The self-sustained sequence replication reaction (3SR)
(Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with
an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a
transcription-based in vitro amplification system (Kwok et al,
Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially
amplify RNA sequences at a uniform temperature. The amplified RNA
can then be utilized for mutation detection (Fahy et al., PCR Meth.
Appl., 1:25-33 [1991]). In this method, an oligonucleotide primer
is used to add a phage RNA polymerase promoter to the 5' end of the
sequence of interest. In a cocktail of enzymes and substrates that
includes a second primer, reverse transcriptase, RNase H, RNA
polymerase and ribo- and deoxyribonucleoside triphosphates, the
target sequence undergoes repeated rounds of transcription, cDNA
synthesis and second-strand synthesis to amplify the area of
interest. The use of 3SR to detect mutations is kinetically limited
to screening small segments of DNA (e.g., 200-300 base pairs).
[0013] Q-Beta (Q.beta.) Replicase
[0014] In this method, a probe that recognizes the sequence of
interest is attached to the replicatable RNA template for Q.beta.
replicase. A previously identified major problem with false
positives resulting from the replication of unhybridized probes has
been addressed through use of a sequence-specific ligation step.
However, available thermostable DNA ligases are not effective on
this RNA substrate, so the ligation must be performed by T4 DNA
ligase at low temperatures (37.degree. C.). This prevents the use
of high temperature as a means of achieving specificity as in the
LCR, the ligation event can be used to detect a mutation at the
junction site, but not elsewhere.
[0015] Table 1 below, lists some of the features desirable for
systems useful in sensitive nucleic acid diagnostics, and
summarizes the abilities of each of the major amplification methods
(See also, Landgren, Trends in Genetics 9:199 [1993]).
[0016] A successful diagnostic method must be very specific. A
straight-forward method of controlling the specificity of nucleic
acid hybridization is by controlling the temperature of the
reaction. While the 3SR/NASBA, and Q.beta. systems are all able to
generate a large quantity of signal, one or more of the enzymes
involved in each cannot be used at high temperature (i.e.,
>55.degree. C.). Therefore the reaction temperatures cannot be
raised to prevent non-specific hybridization of the probes. If
probes are shortened in order to make them melt more easily at low
temperatures, the likelihood of having more than one perfect match
in a complex genome increases. For these reasons, PCR and LCR
currently dominate the research field in detection
technologies.
TABLE-US-00001 TABLE 1 {PRIVATE} Method PCR & 3SR Feature PCR
LCR LCR NASBA Q.beta. Amplifies Target + + + + Recognition of
Independent + + + + + Sequences Required Performed at High Temp. +
+ Operates at Fixed Temp. + + Exponential Amplification + + + + +
Generic Signal Generation + Easily Automatable
[0017] The basis of the amplification procedure in the PCR and LCR
is the fact that the products of one cycle become usable templates
in all subsequent cycles, consequently doubling the population with
each cycle. The final yield of any such doubling system can be
expressed as: (1+X).sup.n=y, where "X" is the mean efficiency
(percent copied in each cycle), "n" is the number of cycles, and
"y" is the overall efficiency, or yield of the reaction (Mullis,
PCR Methods Applic., 1:1 [1991]). If every copy of a target DNA is
utilized as a template in every cycle of a polymerase chain
reaction, then the mean efficiency is 100%. If 20 cycles of PCR are
performed, then the yield will be 2.sup.20, or 1,048,576 copies of
the starting material. If the reaction conditions reduce the mean
efficiency to 85%, then the yield in those 20 cycles will be only
1.85.sup.20, or 220,513 copies of the starting material. In other
words, a PCR running at 85% efficiency will yield only 21% as much
final product, compared to a reaction running at 100% efficiency. A
reaction that is reduced to 50% mean efficiency will yield less
than 1% of the possible product.
[0018] In practice, routine polymerase chain reactions rarely
achieve the theoretical maximum yield, and PCRs are usually run for
more than 20 cycles to compensate for the lower yield. At 50% mean
efficiency, it would take 34 cycles to achieve the million-fold
amplification theoretically possible in 20, and at lower
efficiencies, the number of cycles required becomes prohibitive. In
addition, any background products that amplify with a better mean
efficiency than the intended target will become the dominant
products.
[0019] Also, many variables can influence the mean efficiency of
PCR, including target DNA length and secondary structure, primer
length and design, primer and dNTP concentrations, and buffer
composition, to name but a few. Contamination of the reaction with
exogenous DNA (e.g., DNA spilled onto lab surfaces) or
cross-contamination is also a major consideration. Reaction
conditions must be carefully optimized for each different primer
pair and target sequence, and the process can take days, even for
an experienced investigator. The laboriousness of this process,
including numerous technical considerations and other factors,
presents a significant drawback to using PCR in the clinical
setting. Indeed, PCR has yet to penetrate the clinical market in a
significant way. The same concerns arise with LCR, as LCR must also
be optimized to use different oligonucleotide sequences for each
target sequence. In addition, both methods require expensive
equipment, capable of precise temperature cycling.
[0020] Many applications of nucleic acid detection technologies,
such as in studies of allelic variation, involve not only detection
of a specific sequence in a complex background, but also the
discrimination between sequences with few, or single, nucleotide
differences. One method for the detection of allele-specific
variants by PCR is based upon the fact that it is difficult for Taq
polymerase to synthesize a DNA strand when there is a mismatch
between the template strand and the 3' end of the primer. An
allele-specific variant may be detected by the use of a primer that
is perfectly matched with only one of the possible alleles; the
mismatch to the other allele acts to prevent the extension of the
primer, thereby preventing the amplification of that sequence. This
method has a substantial limitation in that the base composition of
the mismatch influences the ability to prevent extension across the
mismatch, and certain mismatches do not prevent extension or have
only a minimal effect (Kwok et al., Nucl. Acids Res., 18:999
[1990]).)
[0021] A similar 3'-mismatch strategy is used with greater effect
to prevent ligation in the LCR (Barany, PCR Meth. Applic., 1:5
[1991]). Any mismatch effectively blocks the action of the
thermostable ligase, but LCR still has the drawback of
target-independent background ligation products initiating the
amplification. Moreover, the combination of PCR with subsequent LCR
to identify the nucleotides at individual positions is also a
clearly cumbersome proposition for the clinical laboratory.
II. Direct Detection Technology
[0022] When a sufficient amount of a nucleic acid to be detected is
available, there are advantages to detecting that sequence
directly, instead of making more copies of that target, (e.g., as
in PCR and LCR). Most notably, a method that does not amplify the
signal exponentially is more amenable to quantitative analysis.
Even if the signal is enhanced by attaching multiple dyes to a
single oligonucleotide, the correlation between the final signal
intensity and amount of target is direct. Such a system has an
additional advantage that the products of the reaction will not
themselves promote further reaction, so contamination of lab
surfaces by the products is not as much of a concern. Traditional
methods of direct detection including Northern and Southern
blotting and RNase protection assays usually require the use of
radioactivity and are not amenable to automation. Recently devised
techniques have sought to eliminate the use of radioactivity and/or
improve the sensitivity in automatable formats. Two examples are
the "Cycling Probe Reaction" (CPR), and "Branched DNA" (bDNA)
[0023] The cycling probe reaction (CPR) (Duck et al., BioTech.,
9:142 [1990]), uses a long chimeric oligonucleotide in which a
central portion is made of RNA while the two termini are made of
DNA. Hybridization of the probe to a target DNA and exposure to a
thermostable RNase H causes the RNA portion to be digested. This
destabilizes the remaining DNA portions of the duplex, releasing
the remainder of the probe from the target DNA and allowing another
probe molecule to repeat the process. The signal, in the form of
cleaved probe molecules, accumulates at a linear rate. While the
repeating process increases the signal, the RNA portion of the
oligonucleotide is vulnerable to RNases that may be carried through
sample preparation.
[0024] Branched DNA (bDNA), described by Urdea et al., Gene
61:253-264 (1987), involves oligonucleotides with branched
structures that allow each individual oligonucleotide to carry 35
to 40 labels (e.g., alkaline phosphatase enzymes). While this
enhances the signal from a hybridization event, signal from
non-specific binding is similarly increased.
[0025] While both of these methods have the advantages of direct
detection discussed above, neither the CPR or bDNA methods can make
use of the specificity allowed by the requirement of independent
recognition by two or more probe (oligonucleotide) sequences, as is
common in the signal amplification methods described in Section I.
above. The requirement that two oligonucleotides must hybridize to
a target nucleic acid in order for a detectable signal to be
generated confers an extra measure of stringency on any detection
assay. Requiring two oligonucleotides to bind to a target nucleic
acid reduces the chance that false "positive" results will be
produced due to the non-specific binding of a probe to the target.
The further requirement that the two oligonucleotides must bind in
a specific orientation relative to the target, as is required in
PCR, where oligonucleotides must be oppositely but appropriately
oriented such that the DNA polymerase can bridge the gap between
the two oligonucleotides in both directions, further enhances
specificity of the detection reaction. However, it is well known to
those in the art that even though PCR utilizes two oligonucleotide
probes (termed primers) "non-specific" amplification (i.e.,
amplification of sequences not directed by the two primers used) is
a common artifact. This is in part because the DNA polymerase used
in PCR can accommodate very large distances, measured in
nucleotides, between the oligonucleotides and thus there is a large
window in which non-specific binding of an oligonucleotide can lead
to exponential amplification of inappropriate product. The LCR, in
contrast, cannot proceed unless the oligonucleotides used are bound
to the target adjacent to each other and so the full benefit of the
dual oligonucleotide hybridization is realized.
[0026] An ideal direct detection method would combine the
advantages of the direct detection assays (e.g., easy
quantification and minimal risk of carry-over contamination) with
the specificity provided by a dual oligonucleotide hybridization
assay.
SUMMARY OF THE INVENTION
[0027] The present invention relates to compositions and methods
for the detection and characterization of nucleic acid sequences
and variations in nucleic acid sequences. The present invention
relates to methods for forming a nucleic acid cleavage structure on
a target sequence and cleaving the nucleic acid cleavage structure
in a site-specific manner. For example, in some embodiments, a 5'
nuclease activity of any of a variety of enzymes is used to cleave
the target-dependent cleavage structure, thereby indicating the
presence of specific nucleic acid sequences or specific variations
thereof.
[0028] The present invention provides structure-specific cleavage
agents (e.g., nucleases) from a variety of sources, including
mesophilic, psychrophilic, thermophilic, and hyperthermophilic
organisms. The preferred structure-specific nucleases are
thermostable. Thermostable structure-specific nucleases are
contemplated as particularly useful in that they operate at
temperatures where nucleic acid hybridization is extremely
specific, allowing for allele-specific detection (including
single-base mismatches). In one embodiment, the thermostable
structure-specific nucleases are thermostable 5' nucleases
comprising altered polymerases derived from the native polymerases
of Thermus species, including, but not limited to Thermus
aquaticus, Thermus flavus, and Thermus thermophilus. However, the
invention is not limited to the use of thermostable 5' nucleases.
Thermostable structure-specific nucleases from the FEN-1, RAD2 and
XPG class of nucleases are also preferred.
[0029] The present invention provides a method for detecting a
target sequence (e.g., a mutation, polymorphism, etc), comprising
providing a sample suspected of containing the target sequence;
oligonucleotides capable of forming an invasive cleavage structure
in the presence of the target sequence; and an agent for detecting
the presence of an invasive cleavage structure; and exposing the
sample to the oligonucleotides and the agent. In some embodiments,
the method further comprises the step of detecting a complex
comprising the agent and the invasive cleavage structure (directly
or indirectly). In some embodiments, the agent comprises a cleavage
agent. In some preferred embodiments, the exposing of the sample to
the oligonucleotides and the agent comprises exposing the sample to
the oligonucleotides and the agent under conditions wherein an
invasive cleavage structure is formed between the target sequence
and the oligonucleotides if the target sequence is present in the
sample, wherein the invasive cleavage structure is cleaved by the
cleavage agent to form a cleavage product. In some embodiments, the
method further comprises the step of detecting the cleavage
product. In some embodiments, the target sequence comprises a first
region and a second region, the second region downstream of and
contiguous to the first region, and wherein the oligonucleotides
comprise first and second oligonucleotides, wherein at least a
portion of the first oligonucleotide is completely complementary to
the first portion of the target sequence and wherein the second
oligonucleotide comprises a 3' portion and a 5' portion, wherein
the 5' portion is completely complementary to the second portion of
said target nucleic acid.
[0030] The present invention also provides a kit for detecting such
target sequences, said kit comprising oligonucleotides capable of
forming an invasive cleavage structure in the presence of the
target sequence. In some embodiments, the kit further comprises an
agent for detecting the presence of an invasive cleavage structure
(e.g., a cleavage agent). In some embodiments, the oligonucleotides
comprise first and second oligonucleotides, said first
oligonucleotide comprising a 5' portion complementary to a first
region of the target nucleic acid and said second oligonucleotide
comprising a 3' portion and a 5' portion, said 5' portion
complementary to a second region of the target nucleic acid
downstream of and contiguous to the first portion. In some
preferred embodiments, the target sequence comprises human
cytomegalovirus viral DNA; sequence containing polymorphisms in the
human apolipoprotein E gene (ApoE); sequence containing mutations
in the human hemochromatosis (HH) gene; sequence containing
mutations in human MTHFR; sequence containing prothrombin 20210GA
polymorphism; sequence containing HR-2 mutation in human factor V
gene; sequence containing single nucleotide polymorphisms in human
TNF-.alpha. gene, and sequence containing the Leiden mutation in
human factor V gene. In some preferred embodiments, kits comprise
oligonucleotides for detecting two or more target sequences. For
example, information on two or more mutations may provide medically
relevant information such that kits allowing detection of the
plurality of mutations would be desired (e.g., Factor V and HR-2
detection). In some preferred embodiments kits are probed
containing a probe oligonucleotide comprising a sequence of SEQ ID
NOs: 197, 198, 199, 200, 208, 209, 211, 212, 217, 218, 223, 224,
229, 232, 236, 237, 241, 242, or 244. In still other embodiments,
kits provide oligonucleotide sets, the sets including one or more
of the oligonucleotides: SEQ ID NOs:195, 197, and 198 for ApoE
detection; 196, 199, and 200 for ApoE detection; 202, 208, and 209
for HH detection; 203, 211, and 212 for HH detection; 216, 217, and
218 for MTHFR detection; 222, 223, and 224 for prothrombin
polymorphism detection; 228, 229, 231, and 232 for HR-2 detection;
235, 236, and 237 for TNF-.alpha. detection; 240, 241, and 242 for
Factor V detection; and 243, 244, 246, and 247 for MRSA
detection.
[0031] The present invention also provides methods for detecting
the presence of a target nucleic acid molecule by detecting
non-target cleavage products comprising providing: a cleavage
agent; a source of target nucleic acid, the target nucleic acid
comprising a first region and a second region, the second region
downstream of and contiguous to the first region; a first
oligonucleotide, wherein at least a portion of the first
oligonucleotide is completely complementary to the first portion of
the target nucleic acid; and a second oligonucleotide comprising a
3' portion and a 5' portion, wherein the 5' portion is completely
complementary to the second portion of the target nucleic acid;
mixing the cleavage agent, the target nucleic acid, the first
oligonucleotide and the second oligonucleotide to create a reaction
mixture under reaction conditions such that at least the portion of
the first oligonucleotide is annealed to the first region of said
target nucleic acid and wherein at least the 5' portion of the
second oligonucleotide is annealed to the second region of the
target nucleic acid so as to create a cleavage structure, and
wherein cleavage of the cleavage structure occurs to generate
non-target cleavage product; and detecting the cleavage of the
cleavage structure.
[0032] The detection of the cleavage of the cleavage structure can
be carried out in any manner. In some embodiments, the detection of
the cleavage of the cleavage structure comprises detecting the
non-target cleavage product. In yet other embodiments, the
detection of the cleavage of the cleavage structure comprises
detection of fluorescence, mass, or fluorescence energy transfer.
Other detection methods include, but are not limited to detection
of radioactivity, luminescence, phosphorescence, fluorescence
polarization, and charge. In some embodiments, detection is carried
out by a method comprising providing the non-target cleavage
product; a composition comprising two single-stranded nucleic acids
annealed so as to define a single-stranded portion of a protein
binding region; and a protein; and exposing the non-target cleavage
product to the single-stranded portion of the protein binding
region under conditions such that the protein binds to the protein
binding region. In some embodiments, the protein comprises a
nucleic acid producing protein, wherein the nucleic acid producing
protein binds to the protein binding region and produces nucleic
acid. In some embodiments, the protein binding region is a
template-dependent RNA polymerase binding region (e.g., a T7 RNA
polymerase binding region). In other embodiments, the detection is
carried out by a method comprising providing the non-target
cleavage product; a single continuous strand of nucleic acid
comprising a sequence defining a single strand of an RNA polymerase
binding region; a template-dependent DNA polymerase; and a
template-dependent RNA polymerase; exposing the non-target cleavage
product to the RNA polymerase binding region under conditions such
that the non-target cleavage product binds to a portion of the
single strand of the RNA polymerase binding region to produce a
bound non-target cleavage product; exposing the bound non-target
cleavage product to the template-dependent DNA polymerase under
conditions such that a double-stranded RNA polymerase binding
region is produced; and exposing the double-stranded RNA polymerase
binding region to the template-dependent RNA polymerase under
conditions such that RNA transcripts are produced. In some
embodiments, the method further comprises the step of detecting the
RNA transcripts. In some embodiments, the template-dependent RNA
polymerase is T7 RNA polymerase.
[0033] The present invention is not limited by the nature of the 3'
portion of the second oligonucleotide. In some preferred
embodiments, the 3' portion of the second oligonucleotide comprises
a 3' terminal nucleotide not complementary to the target nucleic
acid. In some embodiments, the 3' portion of the second
oligonucleotide consists of a single nucleotide not complementary
to the target nucleic acid.
[0034] Any of the components of the method may be attached to a
solid support. For example, in some embodiments, the first
oligonucleotide is attached to a solid support. In other
embodiments, the second oligonucleotide is attached to a solid
support.
[0035] The cleavage agent can be any agent that is capable of
cleaving invasive cleavage structures. In some preferred
embodiments, the cleavage agent comprises a structure-specific
nuclease. In particularly preferred embodiments, the
structure-specific nuclease comprises a thermostable
structure-specific nuclease (e.g., a thermostable 5' nuclease).
Thermostable structure-specific nucleases include, but are not
limited to, those having an amino acid sequence homologous to a
portion of the amino acid sequence of a thermostable DNA polymerase
derived from a thermophilic organism (e.g., Thermus aquaticus,
Thermus flavus, and Thermus thermophilus). In other embodiments,
the thermostable structure-specific nucleases is from the FEN-1,
RAD2 or XPG class of nucleases, a chimerical structures containing
one or more portions of any of the above cleavage agents.
[0036] The method is not limited by the nature of the target
nucleic acid. In some embodiments, the target nucleic acid is
single stranded or double stranded DNA or RNA. In some embodiments,
double stranded nucleic acid is rendered single stranded (e.g., by
heat) prior to formation of the cleavage structure. In some
embodiment, the source of target nucleic acid comprises a sample
containing genomic DNA. Sample include, but are not limited to,
blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph,
sputum and semen.
[0037] In some embodiments, the target nucleic acid comprises
genomic DNA or mRNA. In other embodiments, the target nucleic acid
comprises synthetic DNA or RNA. In some preferred embodiments,
synthetic DNA or RNA within a sample is created using a purified
polymerase. In some preferred embodiments, creation of synthetic
DNA using a purified polymerase comprises the use of PCR. In some
preferred embodiments, creation of synthetic DNA comprises use of
the methods and compositions for amplification using RNA-DNA
composite primers (e.g., as disclosed in U.S. Pat. No. 6,251,639,
herein incorporated by reference in its entirety). In other
preferred embodiments, creation of synthetic DNA using a purified
DNA polymerase suitable for use with the methods of the present
invention comprises use of rolling circle amplification, (e.g., as
in U.S. Pat. Nos. 6,210,884, 6,183,960 and 6,235,502, herein
incorporated by reference in their entireties). In other preferred
embodiments, creation of synthetic DNA comprises amplification
using nucleic acids comprising loop-forming sequences, e.g.,
"LAMP", as described in U.S. Pat. No. 6,410,278, herein
incorporated by reference in its entirety. See also Notomi, et al.,
Nucleic Acids Research, Vol. 28, No. 12 E63-e63 (2000), herein
incorporated by reference in its entirety.
[0038] The present invention is not limited by the particular
sequences formed in the creation of synthetic DNA. In some
embodiments, the synthetic DNA sequence comprises at least a
portion copied (e.g., by template-directed synthesis using a
template-dependent polymerase) from a natural nucleic acid (e.g.,
genomic DNA, mRNA, etc.). In other embodiments, the creation of
synthetic DNA comprises copying or replication of a probe sequence,
e.g., in response to the presence of a target genomic DNA or mRNA
sequence.
[0039] In some preferred embodiments, creation of synthetic DNA
comprises copying genomic DNA by priming from a plurality of sites
on a genomic DNA sample. In some embodiments, priming from a
plurality of sites on a genomic DNA sample comprises using short
(e.g., fewer than about 8 nucleotides) oligonucleotide primers. In
other embodiments, priming from a plurality of sites on a genomic
DNA comprises extension of 3' ends in nicked, double-stranded
genomic DNA (i.e., where a 3' hydroxyl group has been made
available for extension by breakage or cleavage of one strand of a
double stranded region of DNA). Some examples of making synthetic
DNA using a purified polymerase on nicked genomic DNAs, suitable
for use with the methods and compositions of the present invention,
are provided in U.S. Pat. No. 6,117,634, issued Sep. 12, 2000, and
U.S. Pat. No. 6,197,557, issued Mar. 6, 2001, and in PCT
application WO 98/39485, each incorporated by reference herein in
their entireties for all purposes.
[0040] In some embodiments, the present invention provides a method
for detecting a target sequence, comprising providing a sample
containing nucleic acid suspected of containing a target sequence;
amplifying the target sequence to generate an amplification product
under conditions such that the amplification product comprises
substantially non-target nucleic acid sequences; and exposing the
amplification product to oligonucleotides capable of forming an
invasive cleavage structure with the amplification product when the
nucleic acid contains the target sequence and an agent for
detecting the presence of an invasive cleavage structure. In some
embodiments, the amplifying comprises the formation of a circular
nucleic acid. In some embodiments, the presence of said circular
nucleic acid is indicative of the presence of the target sequence.
In some embodiments, the circular nucleic acid is formed by the
annealing of a probe oligonucleotide that forms an invasive
cleavage structure in the presence of the target sequence, and
wherein the probe oligonucleotide comprises one or more mismatches
with said target nucleic acid. In other embodiments, the circular
nucleic acid is formed by the extension of an oligonucleotide
complementary to the target nucleic acid. In some embodiments, the
nucleic acid suspected of containing a target sequence is selected
from the group consisting of DNA and RNA (e.g., a viral DNA or
RNA). The present invention also provides a kit comprising reagents
for performing such methods.
[0041] In some embodiments, the present invention provides methods
for detecting a target sequence, comprising: providing a) a sample
containing synthetic DNA amplified from genomic DNA, said genomic
DNA suspected of containing said target sequence; b)
oligonucleotides capable of forming an invasive cleavage structure
in the presence of said target sequence; and c) exposing the sample
to the oligonucleotides and the agent. In some embodiments, the
agent comprises a cleavage agent. In some particularly preferred
embodiments, the method of the invention further comprises the step
of detecting said cleavage product.
[0042] In some particularly preferred embodiments, the genomic DNA
is nicked double stranded genomic DNA, and the synthetic DNA is
amplified by extension of 3' ends in said nicked double-stranded
genomic DNA suspected of containing the target sequence.
[0043] In other particularly preferred embodiments, the synthetic
DNA amplified from genomic DNA is amplified by extension of
multiple primers on said genomic DNA suspected of containing said
target sequence.
[0044] In some preferred embodiments, the exposing of the sample to
the oligonucleotides and the agent comprises exposing the sample to
the oligonucleotides and the agent under conditions wherein an
invasive cleavage structure is formed between said target sequence
and said oligonucleotides if said target sequence is present in
said sample, wherein said invasive cleavage structure is cleaved by
said cleavage agent to form a cleavage product.
[0045] In some particularly preferred embodiments, the target
sequence comprises a first region and a second region, said second
region downstream of and contiguous to said first region, and said
oligonucleotides comprise first and second oligonucleotides, said
wherein at least a portion of said first oligonucleotide is
completely complementary to said first portion of said target
sequence and wherein said second oligonucleotide comprises a 3'
portion and a 5' portion, wherein said 5' portion is completely
complementary to said second portion of said target nucleic
acid.
[0046] In some embodiments, the target sequence is selected from
the group consisting of human cytomegalovirus viral DNA;
polymorphisms in human apolipoprotein E gene; mutations in human
hemochromatosis gene; mutations in human MTHFR; prothrombin 20210GA
polymorphism; HR-2 mutation in human factor V gene; single
nucleotide polymorphisms in human TNF-.alpha. gene, and Leiden
mutation in human factor V gene.
[0047] In other embodiments, synthetic DNA suitable for use with
the methods and compositions of the present invention is made using
a purified polymerase on multiply-primed genomic DNA, as provided,
e.g., in U.S. Pat. Nos. 6,291,187, and 6,323,009, and in PCT
applications WO 01/88190 and WO 02/00934, each herein incorporated
by reference in their entireties for all purposes. In these
embodiments, amplification of DNA such as genomic DNA is
accomplished using a DNA polymerase, such as the highly processive
.PHI.29 polymerase (as described, e.g., in U.S. Pat. Nos. 5,198,543
and 5,001,050, each herein incorporated by reference in their
entireties for all purposes) in combination with
exonuclease-resistant random primers, such as hexamers.
[0048] In some embodiments, the present invention provides methods
for detecting a target sequence, comprising: providing a) a sample
containing DNA amplified by extension of multiple primers on
genomic DNA, said genomic DNA suspected of containing said target
sequence; b) oligonucleotides capable of forming an invasive
cleavage structure in the presence of said target sequence; and c)
exposing the sample to the oligonucleotides and the agent. In some
embodiments, the agent comprises a cleavage agent. In some
preferred embodiments, said primers are random primers. In
particularly preferred embodiments, said primers are exonuclease
resistant. In some particularly preferred embodiments, the method
of the invention further comprises the step of detecting said
cleavage product.
[0049] In some preferred embodiments, the exposing of the sample to
the oligonucleotides and the agent comprises exposing the sample to
the oligonucleotides and the agent under conditions wherein an
invasive cleavage structure is formed between said target sequence
and said oligonucleotides if said target sequence is present in
said sample, wherein said invasive cleavage structure is cleaved by
said cleavage agent to form a cleavage product.
[0050] In some preferred embodiments, the exposing of the sample to
the oligonucleotides and the agent comprises exposing the sample to
the oligonucleotides and the agent under conditions wherein an
invasive cleavage structure is formed between said target sequence
and said oligonucleotides if said target sequence is present in
said sample, wherein said invasive cleavage structure is cleaved by
said cleavage agent to form a cleavage product.
[0051] In some particularly preferred embodiments, the target
sequence comprises a first region and a second region, said second
region downstream of and contiguous to said first region, and said
oligonucleotides comprise first and second oligonucleotides, said
wherein at least a portion of said first oligonucleotide is
completely complementary to said first portion of said target
sequence and wherein said second oligonucleotide comprises a 3'
portion and a 5' portion, wherein said 5' portion is completely
complementary to said second portion of said target nucleic
acid.
[0052] In some embodiments, the target sequence is selected from
the group consisting of human cytomegalovirus viral DNA;
polymorphisms in human apolipoprotein E gene; mutations in human
hemochromatosis gene; mutations in human MTHFR; prothrombin 20210GA
polymorphism; HR-2 mutation in human factor V gene; single
nucleotide polymorphisms in human TNF-.alpha. gene, and Leiden
mutation in human factor V gene.
[0053] Synthetic DNAs produced using a purified polymerase on
multiply primed or nicked genomic DNA also find use in detection
assays that include, but are not limited to, enzyme mismatch
cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684,
5,958,692, 5,851,770, herein incorporated by reference in their
entireties); polymerase chain reaction; branched hybridization
methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264,
5,124,246, and 5,624,802, herein incorporated by reference in their
entireties); rolling circle replication (e.g., U.S. Pat. Nos.
6,210,884, 6,183,960 and 6,235,502, herein incorporated by
reference in their entireties); NASBA (e.g., U.S. Pat. No.
5,409,818, herein incorporated by reference in its entirety);
molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, herein
incorporated by reference in its entirety); E-sensor technology
(Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and
6,063,573, herein incorporated by reference in their entireties);
cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711,
5,011,769, and 5,660,988, herein incorporated by reference in their
entireties); Dade Behring signal amplification methods (e.g., U.S.
Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and
5,792,614, herein incorporated by reference in their entireties);
ligase chain reaction (Barnay Proc. Natl. Acad. Sci. USA 88, 189-93
(1991)); and sandwich hybridization methods (e.g., U.S. Pat. No.
5,288,609, herein incorporated by reference in its entirety).
[0054] In some embodiments, the reaction conditions for the method
comprise providing a source of divalent cations. In some preferred
embodiments, the divalent cation is selected from the group
comprising Mn.sup.2+ and Mg.sup.2+ ions. In some embodiments, the
reaction conditions for the method comprise providing the first and
the second oligonucleotides in concentration excess compared to the
target nucleic acid.
[0055] In some embodiments, the method further comprises providing
a third oligonucleotide complementary to a third portion of said
target nucleic acid upstream of the first portion of the target
nucleic acid, wherein the third oligonucleotide is mixed with the
reaction mixture.
[0056] The present invention also provides a method for detecting
the presence of a target nucleic acid molecule by detecting
non-target cleavage products comprising providing: a cleavage
agent; a source of target nucleic acid, the target nucleic acid
comprising a first region and a second region, the second region
downstream of and contiguous to the first region; a plurality of
first oligonucleotides, wherein at least a portion of the first
oligonucleotides is completely complementary to the first portion
of the target nucleic acid; a second oligonucleotide comprising a
3' portion and a 5' portion, wherein said 5' portion is completely
complementary to the second portion of the target nucleic acid;
mixing the cleavage agent, the target nucleic acid, the plurality
of first oligonucleotides and second oligonucleotide to create a
reaction mixture under reaction conditions such that at least the
portion of a first oligonucleotide is annealed to the first region
of the target nucleic acid and wherein at least the 5' portion of
the second oligonucleotide is annealed to the second region of the
target nucleic acid so as to create a cleavage structure, and
wherein cleavage of the cleavage structure occurs to generate
non-target cleavage product, wherein the conditions permit multiple
cleavage structures to form and be cleaved from the target nucleic
acid; and detecting the cleavage of said cleavage structures. In
some embodiments, the conditions comprise isothermal conditions
that permit the plurality of first oligonucleotides to dissociate
from the target nucleic acid. While the present invention is
limited by the number of cleavage structure formed on a particular
target nucleic acid, in some preferred embodiments, two or more (3,
4, 5, . . . , 10, . . . , 10000, . . . ) of the plurality of first
oligonucleotides form cleavage structures with a particular target
nucleic acid, wherein the cleavage structures are cleaved to
produce the non-target cleavage products.
[0057] The present invention also provides methods where a cleavage
product from the above methods is used in a further invasive
cleavage reaction. For example, the present invention provides a
method comprising providing a cleavage agent; a first target
nucleic acid, the first target nucleic acid comprising a first
region and a second region, the second region downstream of and
contiguous to the first region; a first oligonucleotide, wherein at
least a portion of the first oligonucleotide is completely
complementary to the first portion of the first target nucleic
acid; a second oligonucleotide comprising a 3' portion and a 5'
portion, wherein the 5' portion is completely complementary to the
second portion of the first target nucleic acid; a second target
nucleic acid, said second target nucleic acid comprising a first
region and a second region, the second region downstream of and
contiguous to the first region; and a third oligonucleotide,
wherein at least a portion of the third oligonucleotide is
completely complementary to the first portion of the second target
nucleic acid; generating a first cleavage structure wherein at
least said portion of the first oligonucleotide is annealed to the
first region of the first target nucleic acid and wherein at least
the 5' portion of the second oligonucleotide is annealed to the
second region of the first target nucleic acid and wherein cleavage
of the first cleavage structure occurs via the cleavage agent
thereby cleaving the first oligonucleotide to generate a fourth
oligonucleotide, said fourth oligonucleotide comprising a 3'
portion and a 5' portion, wherein the 5' portion is completely
complementary to the second portion of the second target nucleic
acid; generating a second cleavage structure under conditions
wherein at least said portion of the third oligonucleotide is
annealed to the first region of the second target nucleic acid and
wherein at least the 5' portion of the fourth oligonucleotide is
annealed to the second region of the second target nucleic acid and
wherein cleavage of the second cleavage structure occurs to
generate a cleavage fragment; and detecting the cleavage of the
second cleavage structure. In some preferred embodiments, the 3'
portion of the fourth oligonucleotide comprises a 3' terminal
nucleotide not complementary to the second target nucleic acid. In
some embodiments, the 3' portion of the third oligonucleotide is
covalently linked to the second target nucleic acid. In some
embodiments, the second target nucleic acid further comprises a 5'
region, wherein the 5' region of the second target nucleic acid is
the third oligonucleotide. The present invention further provides
kits comprising: a cleavage agent; a first oligonucleotide
comprising a 5' portion complementary to a first region of a target
nucleic acid; and a second oligonucleotide comprising a 3' portion
and a 5' portion, said 5' portion complementary to a second region
of the target nucleic acid downstream of and contiguous to the
first portion. In some embodiments, the 3' portion of the second
oligonucleotide comprises a 3' terminal nucleotide not
complementary to the target nucleic acid. In preferred embodiments,
the 3' portion of the second oligonucleotide consists of a single
nucleotide not complementary to the target nucleic acid. In some
embodiments, the kit further comprises a solid support. For
example, in some embodiments, the first and/or second
oligonucleotide is attached to said solid support. In some
embodiments, the kit further comprises a buffer solution. In some
preferred embodiments, the buffer solution comprises a source of
divalent cations (e.g., Mn.sup.2+ and/or Mg.sup.2+ ions). In some
specific embodiments, the kit further comprises a third
oligonucleotide complementary to a third portion of the target
nucleic acid upstream of the first portion of the first target
nucleic acid. In yet other embodiments, the kit further comprises a
target nucleic acid. In some embodiments, the kit further comprises
a second target nucleic acid. In yet other embodiments, the kit
further comprises a third oligonucleotide comprising a 5' portion
complementary to a first region of the second target nucleic acid.
In some specific embodiments, the 3' portion of the third
oligonucleotide is covalently linked to the second target nucleic
acid. In other specific embodiments, the second target nucleic acid
further comprises a 5' portion, wherein the 5' portion of the
second target nucleic acid is the third oligonucleotide. In still
other embodiments, the kit further comprises an ARRESTOR molecule
(e.g., ARRESTOR oligonucleotide).
[0058] The present invention further provides a composition
comprising a cleavage structure, the cleavage structure comprising:
a) a target nucleic acid, the target nucleic acid having a first
region, a second region, a third region and a fourth region,
wherein the first region is located adjacent to and downstream from
the second region, the second region is located adjacent to and
downstream from the third region and the third region is located
adjacent to and downstream from the fourth region; b) a first
oligonucleotide complementary to the fourth region of the target
nucleic acid; c) a second oligonucleotide having a 5' portion and a
3' portion wherein the 5' portion of the second oligonucleotide
contains a sequence complementary to the second region of the
target nucleic acid and wherein the 3' portion of the second
oligonucleotide contains a sequence complementary to the third
region of the target nucleic acid; and d) a third oligonucleotide
having a 5' portion and a 3' portion wherein the 5' portion of the
third oligonucleotide contains a sequence complementary to the
first region of the target nucleic acid and wherein the 3' portion
of the third oligonucleotide contains a sequence complementary to
the second region of the target nucleic acid.
[0059] The present invention is not limited by the length of the
four regions of the target nucleic acid. In one embodiment, the
first region of the target nucleic acid has a length of 11 to 50
nucleotides. In another embodiment, the second region of the target
nucleic acid has a length of one to three nucleotides. In another
embodiment, the third region of the target nucleic acid has a
length of six to nine nucleotides. In yet another embodiment, the
fourth region of the target nucleic acid has a length of 6 to 50
nucleotides.
[0060] The invention is not limited by the nature or composition of
the of the first, second, third and fourth oligonucleotides; these
oligonucleotides may comprise DNA, RNA, PNA and combinations
thereof as well as comprise modified nucleotides, universal bases,
adducts, etc. Further, one or more of the first, second, third and
the fourth oligonucleotides may contain a dideoxynucleotide at the
3' terminus.
[0061] In one preferred embodiment, the target nucleic acid is not
completely complementary to at least one of the first, the second,
the third and the fourth oligonucleotides. In a particularly
preferred embodiment, the target nucleic acid is not completely
complementary to the second oligonucleotide.
[0062] As noted above, the present invention contemplates the use
of structure-specific nucleases in detection methods. In one
embodiment, the present invention provides a method of detecting
the presence of a target nucleic acid molecule by detecting
non-target cleavage products comprising: a) providing: i) a
cleavage means, ii) a source of target nucleic acid, the target
nucleic acid having a first region, a second region, a third region
and a fourth region, wherein the first region is located adjacent
to and downstream from the second region, the second region is
located adjacent to and downstream from the third region and the
third region is located adjacent to and downstream from the fourth
region; iii) a first oligonucleotide complementary to the fourth
region of the target nucleic acid; iv) a second oligonucleotide
having a 5' portion and a 3' portion wherein the 5' portion of the
second oligonucleotide contains a sequence complementary to the
second region of the target nucleic acid and wherein the 3' portion
of the second oligonucleotide contains a sequence complementary to
the third region of the target nucleic acid; iv) a third
oligonucleotide having a 5' and a 3' portion wherein the 5' portion
of the third oligonucleotide contains a sequence complementary to
the first region of the target nucleic acid and wherein the 3'
portion of the third oligonucleotide contains a sequence
complementary to the second region of the target nucleic acid; b)
mixing the cleavage means, the target nucleic acid, the first
oligonucleotide, the second oligonucleotide and the third
oligonucleotide to create a reaction mixture under reaction
conditions such that the first oligonucleotide is annealed to the
fourth region of the target nucleic acid and wherein at least the
3' portion of the second oligonucleotide is annealed to the target
nucleic acid and wherein at least the 5' portion of the third
oligonucleotide is annealed to the target nucleic acid so as to
create a cleavage structure and wherein cleavage of the cleavage
structure occurs to generate non-target cleavage products, each
non-target cleavage product having a 3'-hydroxyl group; and c)
detecting the non-target cleavage products.
[0063] The invention is not limited by the nature of the target
nucleic acid. In one embodiment, the target nucleic acid comprises
single-stranded DNA. In another embodiment, the target nucleic acid
comprises double-stranded DNA and prior to step c), the reaction
mixture is treated such that the double-stranded DNA is rendered
substantially single-stranded. In another embodiment, the target
nucleic acid comprises RNA and the first and second
oligonucleotides comprise DNA.
[0064] The invention is not limited by the nature of the cleavage
means. In one embodiment, the cleavage means is a
structure-specific nuclease; particularly preferred
structure-specific nucleases are thermostable structure-specific
nucleases. In one preferred embodiment, the thermostable
structure-specific nuclease is encoded by a DNA sequence selected
from the group consisting of SEQ ID NOS: 1-3, 9, 10, 12, 21, 30,
31, 101, 106, 110, 114, 129, 131, 132, 137, 140, 141, 142, 143,
144, 145, 147, 150, 151, 153, 155, 156, 157, 158, 161, 163, 178,
180, and 182.
[0065] In another preferred embodiment, the thermostable
structure-specific nuclease is a nuclease from the FEN-1/RAD2/XPG
class of nucleases. In another preferred embodiment the
thermostable structure specific nuclease is a chimerical
nuclease.
[0066] In an alternative preferred embodiment, the detection of the
non-target cleavage products comprises electrophoretic separation
of the products of the reaction followed by visualization of the
separated non-target cleavage products.
[0067] In another preferred embodiment, one or more of the first,
second, and third oligonucleotides contain a dideoxynucleotide at
the 3' terminus. When dideoxynucleotide-containing oligonucleotides
are employed, the detection of the non-target cleavage products
preferably comprises: a) incubating the non-target cleavage
products with a template-independent polymerase and at least one
labeled nucleoside triphosphate under conditions such that at least
one labeled nucleotide is added to the 3'-hydroxyl group of the
non-target cleavage products to generate labeled non-target
cleavage products; and b) detecting the presence of the labeled
non-target cleavage products. The invention is not limited by the
nature of the template-independent polymerase employed; in one
embodiment, the template-independent polymerase is selected from
the group consisting of terminal deoxynucleotidyl transferase (TdT)
and poly A polymerase. When TdT or polyA polymerase are employed in
the detection step, the second oligonucleotide may contain a 5' end
label, the 5' end label being a different label than the label
present upon the labeled nucleoside triphosphate. The invention is
not limited by the nature of the 5' end label; a wide variety of
suitable 5' end labels are known to the art and include biotin,
fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3
amidite, Cy5 amidite and digoxigenin.
[0068] In another embodiment, detecting the non-target cleavage
products comprises: a) incubating the non-target cleavage products
with a template-independent polymerase and at least one nucleoside
triphosphate under conditions such that at least one nucleotide is
added to the 3'-hydroxyl group of the non-target cleavage products
to generate tailed non-target cleavage products; and b) detecting
the presence of the tailed non-target cleavage products. The
invention is not limited by the nature of the template-independent
polymerase employed; in one embodiment, the template-independent
polymerase is selected from the group consisting of terminal
deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT
or polyA polymerase are employed in the detection step, the second
oligonucleotide may contain a 5' end label. The invention is not
limited by the nature of the 5' end label; a wide variety of
suitable 5' end labels are known to the art and include biotin,
fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3
amidite, Cy5 amidite and digoxigenin.
[0069] In a preferred embodiment, the reaction conditions comprise
providing a source of divalent cations; particularly preferred
divalent cations are Mn.sup.2+ and Mg.sup.2+ ions.
[0070] The present invention further provides a method of detecting
the presence of a target nucleic acid molecule by detecting
non-target cleavage products comprising: a) providing: i) a
cleavage means, ii) a source of target nucleic acid, the target
nucleic acid having a first region, a second region and a third
region, wherein the first region is located adjacent to and
downstream from the second region and wherein the second region is
located adjacent to and downstream from the third region; iii) a
first oligonucleotide having a 5' and a 3' portion wherein the 5'
portion of the first oligonucleotide contains a sequence
complementary to the second region of the target nucleic acid and
wherein the 3' portion of the first oligonucleotide contains a
sequence complementary to the third region of the target nucleic
acid; iv) a second oligonucleotide having a length between eleven
to fifteen nucleotides and further having a 5' and a 3' portion
wherein the 5' portion of the second oligonucleotide contains a
sequence complementary to the first region of the target nucleic
acid and wherein the 3' portion of the second oligonucleotide
contains a sequence complementary to the second region of the
target nucleic acid; b) mixing the cleavage means, the target
nucleic acid, the first oligonucleotide and the second
oligonucleotide to create a reaction mixture under reaction
conditions such that at least the 3' portion of the first
oligonucleotide is annealed to the target nucleic acid and wherein
at least the 5' portion of the second oligonucleotide is annealed
to the target nucleic acid so as to create a cleavage structure and
wherein cleavage of the cleavage structure occurs to generate
non-target cleavage products, each non-target cleavage product
having a 3'-hydroxyl group; and c) detecting the non-target
cleavage products. In a preferred embodiment the cleavage means is
a structure-specific nuclease, preferably a thermostable
structure-specific nuclease.
[0071] The invention is not limited by the length of the various
regions of the target nucleic acid. In a preferred embodiment, the
second region of the target nucleic acid has a length between one
to five nucleotides. In another preferred embodiment, one or more
of the first and the second oligonucleotides contain a
dideoxynucleotide at the 3' terminus. When
dideoxynucleotide-containing oligonucleotides are employed, the
detection of the non-target cleavage products preferably comprises:
a) incubating the non-target cleavage products with a
template-independent polymerase and at least one labeled nucleoside
triphosphate under conditions such that at least one labeled
nucleotide is added to the 3'-hydroxyl group of the non-target
cleavage products to generate labeled non-target cleavage products;
and b) detecting the presence of the labeled non-target cleavage
products. The invention is not limited by the nature of the
template-independent polymerase employed; in one embodiment, the
template-independent polymerase is selected from the group
consisting of terminal deoxynucleotidyl transferase (TdT) and poly
A polymerase. When TdT or polyA polymerase is employed in the
detection step, the second oligonucleotide may contain a 5' end
label, the 5' end label being a different label than the label
present upon the labeled nucleoside triphosphate. The invention is
not limited by the nature of the 5' end label; a wide variety of
suitable 5' end labels are known to the art and include biotin,
fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3
amidite, Cy5 amidite and digoxigenin.
[0072] In another embodiment, detecting the non-target cleavage
products comprises: a) incubating the non-target cleavage products
with a template-independent polymerase and at least one nucleoside
triphosphate under conditions such that at least one nucleotide is
added to the 3'-hydroxyl group of the non-target cleavage products
to generate tailed non-target cleavage products; and b) detecting
the presence of the tailed non-target cleavage products. The
invention is not limited by the nature of the template-independent
polymerase employed; in one embodiment, the template-independent
polymerase is selected from the group consisting of terminal
deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT
or polyA polymerase are employed in the detection step, the second
oligonucleotide may contain a 5' end label. The invention is not
limited by the nature of the 5' end label; a wide variety of
suitable 5' end labels are known to the art and include biotin,
fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3
amidite, Cy5 amidite and digoxigenin.
[0073] The novel detection methods of the invention may be employed
for the detection of target DNAs and RNAs including, but not
limited to, target DNAs and RNAs comprising wild type and mutant
alleles of genes, including genes from humans or other animals that
are or may be associated with disease or cancer. In addition, the
methods of the invention may be used for the detection of and/or
identification of strains of microorganisms, including bacteria,
fungi, protozoa, ciliates and viruses (and in particular for the
detection and identification of RNA viruses, such as HCV).
[0074] The present invention further provides improved enzymatic
cleavage means. In one embodiment, the present invention provides a
thermostable structure-specific nuclease having an amino acid
sequence selected from the group consisting of SEQ ID NOS:102, 107,
130, 132, 179, 181, 183, 184, 185, 186, 187, and 188. In another
embodiment, the nuclease is encoded by a DNA sequence selected from
the group consisting of SEQ ID NOS:101, 106, 129 131, 178, 180, and
182.
[0075] The present invention also provides a recombinant DNA vector
comprising DNA having a nucleotide sequence encoding a
structure-specific nuclease, the nucleotide sequence selected from
the group consisting of SEQ ID NOS:101, 106, 129 131, 137, 140,
141, 142, 143, 144, 145, 147, 150, 151, 153, 155, 156, 157, 158,
161, 163, 178, 180, and 182. In a preferred embodiment, the
invention provides a host cell transformed with a recombinant DNA
vector comprising DNA having a nucleotide sequence encoding a
structure-specific nuclease, the nucleotide sequence selected from
the group consisting of SEQ ID NOS:101, 106, 129, 131, 178, 180,
and 182. The invention is not limited by the nature of the host
cell employed. The art is well aware of expression vectors suitable
for the expression of nucleotide sequences encoding
structure-specific nucleases which can be expressed in a variety of
prokaryotic and eukaryotic host cells. In a preferred embodiment,
the host cell is an Escherichia coli cell.
[0076] The present invention provides purified FEN-1 endonucleases.
In one embodiment, the present invention provides Pyrococcus woesei
FEN-1 endonuclease. In a preferred embodiment, the purified
Pyrococcus woesei FEN-1 endonuclease has a molecular weight of
about 38.7 kilodaltons (the molecular weight may be conveniently
estimated using SDS-PAGE as described in Ex. 28).
[0077] The present invention further provides an isolated
oligonucleotide encoding a Pyrococcus woesei FEN-1 endonuclease,
the oligonucleotide having a region capable of hybridizing to an
oligonucleotide sequence selected from the group consisting of SEQ
ID NOS:116-119. In a preferred embodiment, the oligonucleotide
encoding the purified Pyrococcus woesei FEN-1 endonuclease is
operably linked to a heterologous promoter. The present invention
is not limited by the nature of the heterologous promoter employed;
in a preferred embodiment, the heterologous promoter is an
inducible promoter (the promoter chosen will depend upon the host
cell chosen for expression as is known in the art). The invention
is not limited by the nature of the inducible promoter employed.
Preferred inducible promoters include the -P.sub.L promoter, the
tac promoter, the trp promoter and the trc promoter.
[0078] In another preferred embodiment, the invention provides a
recombinant DNA vector comprising an isolated oligonucleotide
encoding a Pyrococcus woesei (Pwo) FEN-1 endonuclease, the
oligonucleotide having a region capable of hybridizing to an
oligonucleotide sequence selected from the group consisting of SEQ
ID NOS:116-119. Host cells transformed with these recombinant
vectors are also provided. In a preferred embodiment, the invention
provides a host cell transformed with a recombinant DNA vector
comprising DNA having a region capable of hybridizing to an
oligonucleotide sequence selected from the group consisting of SEQ
ID NOS:116-119; these vectors may further comprise a heterologous
promoter operably linked to the Pwo FEN-1-encoding polynucleotides.
The invention is not limited by the nature of the host cell
employed. The art is well aware of expression vectors suitable for
the expression of Pwo FEN-1-encoding polynucleotides that can be
expressed in a variety of prokaryotic and eukaryotic host cells. In
a preferred embodiment, the host cell is an Escherichia coli
cell.
[0079] In yet another embodiment, the invention provides an
isolated oligonucleotide comprising a gene encoding a Pyrococcus
woesei FEN-1 endonuclease having a molecular weight of about 38.7
kilodaltons. In another embodiment, the encoding a Pyrococcus
woesei FEN-1 endonuclease is operably linked to a heterologous
promoter. The present invention is not limited by the nature of the
heterologous promoter employed; in a preferred embodiment, the
heterologous promoter is an inducible promoter (the promoter chosen
will depend upon the host cell chosen for expression as is known in
the art). The invention is not limited by the nature of the
inducible promoter employed. Preferred inducible promoters include
the -P.sub.L promoter, the tac promoter, the trp promoter and the
trc promoter.
[0080] The invention further provides recombinant DNA vectors
comprising DNA having a nucleotide sequence encoding FEN-1
endonucleases. In one preferred embodiment, the present invention
provides a Pyrococcus woesei FEN-1 endonuclease having a molecular
weight of about 38.7 kilodaltons. Still further, a host cell
transformed with a recombinant DNA vector comprising DNA having a
nucleotide sequence encoding FEN-1 endonuclease. In a preferred
embodiment, the host cell is transformed with a recombinant DNA
vector comprising DNA having a nucleotide sequence encoding a
Pyrococcus woesei FEN-1 endonuclease having a molecular weight of
about 38.7 kilodaltons is provided. The invention is not limited by
the nature of the host cell employed. The art is well aware of
expression vectors suitable for the expression of Pwo
FEN-1-encoding polynucleotides that can be expressed in a variety
of prokaryotic and eukaryotic host cells. In a preferred
embodiment, the host cell is an Escherichia coli cell.
[0081] Thus, the present invention provides multiple purified FEN-1
endonucleases, both purified native forms of the endonucleases, as
well as recombinant endonucleases. In preferred embodiments, the
purified FEN-1 endonucleases are obtained from archaebacterial or
eubacterial organisms. In particularly preferred embodiments, the
FEN-1 endonucleases are obtained from organisms selected from the
group consisting of Archaeoglobus fulgidus and Methanobacterium
thermoautotrophicum. In a preferred embodiment, the purified FEN-1
endonucleases have molecular weights of about 39 kilodaltons (the
molecular weight may be conveniently estimated using SDS-PAGE as
described in Ex. 28).
[0082] The present invention further provides isolated
oligonucleotides encoding Archaeoglobus fulgidus and
Methanobacterium thermoautotrophicum FEN-1 endonucleases, the
oligonucleotides each having a region capable of hybridizing to at
least a portion of an oligonucleotide sequence, wherein the
oligonucleotide sequence is selected from the group consisting of
SEQ ID NOS:170, 171, 172, and 173. In some preferred embodiment,
the oligonucleotides encoding the Archaeoglobus fulgidus and
Methanobacterium thermoautotrophicum FEN-1 endonucleases are
operably linked to heterologous promoters. However, it is not
intended that the present invention be limited by the nature of the
heterologous promoter employed. It is contemplated that the
promoter chosen will depend upon the host cell chosen for
expression as is known in the art. In some preferred embodiments,
the heterologous promoter is an inducible promoter.
[0083] The invention is not limited by the nature of the inducible
promoter employed. Preferred inducible promoters include the
-P.sub.L promoter, the tac promoter, the trp promoter and the trc
promoter.
[0084] In another preferred embodiment, the invention provides
recombinant DNA vectors comprising isolated oligonucleotides
encoding Archaeoglobus fulgidus or Methanobacterium
thermoautotrophicum FEN-1 endonucleases, each oligonucleotides
having a region capable of hybridizing to at least a portion of an
oligonucleotide sequence, wherein the oligonucleotide sequence is
selected from the group consisting of SEQ ID NOS:170, 171, 172, and
173. The present invention further provides host cells transformed
with these recombinant vectors. In a preferred embodiment, the
invention provides a host cell transformed with a recombinant DNA
vector comprising DNA having a region capable of hybridizing to at
least a portion of an oligonucleotide sequence, wherein the
oligonucleotide sequence is selected from the group consisting of
SEQ ID NOS:170, 171, 172 and 173. In some embodiments, these
vectors may further comprise a heterologous promoter operably
linked to the FEN-1-encoding polynucleotides. The invention is not
limited by the nature of the host cell employed. The art is well
aware of expression vectors suitable for the expression of
FEN-1-encoding polynucleotides which can be expressed in a variety
of prokaryotic and eukaryotic host cells. In a preferred
embodiment, the host cell is an Escherichia coli cell.
[0085] The present invention further provides chimeric
structure-specific nucleases. In one embodiment, the present
invention provides chimeric endonucleases comprising amino acid
portions derived from the endonucleases selected from the group of
FEN-1, XPG and RAD homologs. In a preferred embodiment, the
chimeric endonucleases comprise amino acid portions derived from
the FEN-1 endonucleases selected from the group of Pyrococcus
furiosus, Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus
fulgidus and Methanobacterium thermoautotrophicum. In a more
preferred embodiment, the chimeric FEN-1 endonucleases have
molecular weights of about 39 kilodaltons (the molecular weight may
be conveniently estimated using SDS-PAGE as described in Ex.
28).
[0086] The present invention further provides isolated
oligonucleotides encoding chimeric endonucleases. In one
embodiment, the oligonucleotides encoding the chimeric
endonucleases comprise nucleic acid sequences derived from the
genes selected from the group of FEN-1, XPG and RAD homologs. In a
preferred embodiment the oligonucleotides encoding the chimeric
endonucleases comprise nucleic acid sequences derived from the
genes encoding the FEN-1 endonucleases selected from the group of
Pyrococcus furiosus, Methanococcus jannaschi, Pyrococcus woesei,
Archaeoglobus fulgidus and Methanobacterium thermoautotrophicum. In
a particularly preferred embodiment, the genes for the chimeric
endonucleases are operably linked to heterologous promoters. The
present invention is not limited by the nature of the heterologous
promoter employed. It is contemplated that the promoter chosen will
depend upon the host cell selected for expression, as is known in
the art. In preferred embodiments, the heterologous promoter is an
inducible promoter. The invention is not limited by the nature of
the inducible promoter employed. Preferred inducible promoter
include the -P.sub.L promoter, the tac promoter, the trp promoter
and the trc promoter.
[0087] In another preferred embodiment, the invention provides
recombinant DNA vectors comprising isolated oligonucleotides
encoding the chimeric endonucleases described above. In one
embodiment, the recombinant DNA vectors comprise isolated
oligonucleotides encoding nucleic acid sequences derived from the
genes selected from the group of FEN-1, XPG and RAD homologs. In a
preferred embodiment, the recombinant DNA vectors comprise isolated
oligonucleotides encoding the chimeric endonucleases comprising
nucleic acid sequences derived from the genes encoding the FEN-1
endonucleases selected from the group of Pyrococcus furiosus,
Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus fulgidus
and Methanobacterium thermoautotrophicum. These vectors may further
comprise a heterologous promoter operably linked to the chimeric
nuclease-encoding polynucleotides.
[0088] Host cells transformed with these recombinant vectors are
also provided. The invention is not limited by the nature of the
host cell employed. The art is well aware of expression vectors
suitable for the expression of FEN-1-encoding polynucleotides which
can be expressed in a variety of prokaryotic and eukaryotic host
cells. In a preferred embodiment, the host cell is an Escherichia
coli cell.
[0089] The present invention further provides mixtures comprising a
first structure-specific nuclease, wherein the first nuclease
consists of a purified FEN-1 endonuclease and a second
structure-specific nuclease. In preferred embodiments, the second
structure-specific nuclease of the mixture is selected from the
group consisting Pyrococcus woesei FEN-1 endonuclease, Pyrococcus
furiosus FEN-1, Methanococcus jannaschii FEN-1 endonuclease,
Methanobacterium thermoautotrophicum FEN-1 endonuclease,
Archaeoglobus fulgidus FEN-1, and chimerical FEN-1 endonucleases.
In alternative embodiments, the purified FEN-1 endonuclease of the
mixture is selected from the group consisting Pyrococcus woesei
FEN-1 endonuclease, Pyrococcus furiosus FEN-1 endonuclease,
Methanococcus jannaschii FEN-1 endonuclease, Methanobacterium
thermoautotrophicum FEN-1 endonuclease, Archaeoglobus fulgidus
FEN-1, and chimerical FEN-1 endonucleases. In yet other preferred
embodiments of the mixture, the second nuclease is a 5' nuclease
derived from a thermostable DNA polymerase altered in amino acid
sequence such that it exhibits reduced DNA synthetic activity from
that of the wild-type DNA polymerase but retains substantially the
same 5' nuclease activity of the wild-type DNA polymerase. In some
preferred embodiments of the mixture, the second nuclease is
selected from the group consisting of the Cleavase.RTM. BN enzyme,
Thermus aquaticus DNA polymerase, Thermus thermophilus DNA
polymerase, Escherichia coli Exo III, Saccharomyces cerevisiae
Rad1/Rad10 complex.
[0090] The present invention also provides methods for treating
nucleic acid, comprising: a) providing a purified FEN-1
endonuclease; and a nucleic acid substrate; b) treating the nucleic
acid substrate under conditions such that the substrate forms one
or more cleavage structures; and c) reacting the endonuclease with
the cleavage structures so that one or more cleavage products are
produced. In some embodiments, the purified FEN-1 endonuclease is
selected from the group consisting Pyrococcus woesei FEN-1
endonuclease, Pyrococcus furiosus FEN-1 endonuclease, Methanococcus
jannaschii FEN-1 endonuclease, Methanobacterium thermoautotrophicum
FEN-1 endonuclease, Archaeoglobus fulgidus FEN-1, and chimerical
FEN-1 endonucleases. In other embodiments, the method further
comprises providing a structure-specific nuclease derived from a
thermostable DNA polymerase altered in amino acid sequence such
that it exhibits reduced DNA synthetic activity from that of the
wild-type DNA polymerase but retains substantially the same 5'
nuclease activity of the wild-type DNA polymerase.
[0091] In alternative embodiments of the methods, a portion of the
amino acid sequence of the second nuclease is homologous to a
portion of the amino acid sequence of a thermostable DNA polymerase
derived from a eubacterial thermophile of the genus Thermus. In yet
other embodiments, the thermophile is selected from the group
consisting of Thermus aquaticus, Thermus flavus and Thermus
thermophilus. In some alternative embodiments, the
structure-specific nuclease is selected from the group consisting
of the Cleavase.RTM. BN enzyme, Thermus aquaticus DNA polymerase,
Thermus thermophilus DNA polymerase, Escherichia coli Exo III,
Saccharomyces cerevisiae Rad1/Rad10 complex. In some preferred
embodiments, the structure-specific nuclease is the Cleavase.RTM.
BN nuclease. In yet other embodiments, the nucleic acid of step (a)
is substantially single-stranded. In further embodiments, the
nucleic acid is selected from the group consisting of RNA and DNA.
In yet further embodiments, the nucleic acid of step (a) is double
stranded.
[0092] In other embodiments of the methods, the treating of step
(b) comprises: rendering the double-stranded nucleic acid
substantially single-stranded; and exposing the single-stranded
nucleic acid to conditions such that the single-stranded nucleic
acid has secondary structure. In some preferred embodiments, the
double stranded nucleic acid is rendered substantially
single-stranded by the use of increased temperature. In alternative
preferred embodiments, the method further comprises the step of
detecting the one or more cleavage products.
[0093] The present invention also provides methods for treating
nucleic acid, comprising: a) providing: a first structure-specific
nuclease consisting of a purified FEN-1 endonuclease in a solution
containing manganese; and a nucleic acid substrate; b) treating the
nucleic acid substrate with increased temperature such that the
substrate is substantially single-stranded; c) reducing the
temperature under conditions such that the single-stranded
substrate forms one or more cleavage structures; d) reacting the
cleavage means with the cleavage structures so that one or more
cleavage products are produced; and e) detecting the one or more
cleavage products. In some embodiments of the methods, the purified
FEN-1 endonuclease is selected from the group consisting Pyrococcus
woesei FEN-1 endonuclease, Pyrococcus furiosus FEN-1 endonuclease,
Methanococcus jannaschii FEN-1 endonuclease, Methanobacterium
thermoautotrophicum FEN-1 endonuclease, Archaeoglobus fulgidus
FEN-1, and chimerical FEN-1 endonucleases. In alternative
embodiments, the methods further comprise providing a second
structure-specific nuclease. In some preferred embodiments, the
second nuclease is selected from the group consisting of the
Cleavase.RTM. BN enzyme, Thermus aquaticus DNA polymerase, Thermus
thermophilus DNA polymerase, Escherichia coli Exo III, and the
Saccharomyces cerevisiae Rad1/Rad10 complex. In yet other preferred
embodiments, the second nuclease is a 5' nuclease derived from a
thermostable DNA polymerase altered in amino acid sequence such
that it exhibits reduced DNA synthetic activity from that of the
wild-type DNA polymerase but retains substantially the same 5'
nuclease activity of the wild-type DNA polymerase. In yet other
embodiments, the nucleic acid is selected from the group consisting
of RNA and DNA. In further embodiments, the nucleic acid of step
(a) is double stranded.
[0094] In some embodiments, the invention provides methods for
detecting a target nucleic acid, comprising a) providing a sample
comprising synthetic DNA amplified from target nucleic acid by
loop-mediated isothermal amplification, oligonucleotides capable of
forming an invasive cleavage structure with said synthetic DNA, and
an agent for cleaving an invasive cleavage structure, b) exposing
the sample to conditions wherein the oligonucleotides form an
invasive cleavage structure with the synthetic DNA, wherein the
invasive cleavage structure is cleaved by the agent, and detecting
cleavage of an invasive cleavage structure by the agent, thereby
detecting the presence of the target nucleic acid sequence. In some
embodiments, the synthetic DNA comprises a first region and a
second region, the second region downstream of and contiguous to
the first region, wherein the oligonucleotides comprise first and
second oligonucleotides, wherein at least a portion of the first
oligonucleotide is completely complementary to the first portion of
the synthetic DNA, and wherein the second oligonucleotide comprises
a 3' portion and a 5' portion, wherein the 5' portion is completely
complementary to the second portion of said synthetic DNA.
[0095] Detection is not limited to any particular method or means.
In some embodiments, detecting cleavage of an invasive cleavage
structure comprises detection selected from the group consisting of
detection of fluorescence, mass, fluorescence energy transfer,
radioactivity, luminescence, phosphorescence, fluorescence
polarization, and charge.
[0096] In some embodiments, the agent comprises a structure
specific nuclease and in some embodiments, the structure specific
nuclease comprises a 5' nuclease. In certain preferred embodiments,
the 5' nuclease is thermostable, and in particularly preferred
embodiments, the thermostable 5' nuclease comprises a FEN-1
endonuclease.
[0097] In some embodiments, the polymerase comprises a DNA
polymerase and in certain preferred embodiments, the polymerase
comprises a polymerase from Bacillus stearothermophilus.
[0098] In preferred embodiments, the target nucleic acid is
selected from the group consisting of DNA and RNA.
[0099] In some embodiments, the present invention provides a method
for detecting a target nucleic acid, comprising a) providing a
mixture comprising a sample suspected of containing a target
nucleic acid and detection reagents, said detection reagents
comprising primers configured to produce amplified synthetic DNA
from said target nucleic acid by loop-mediated isothermal
amplification, a polymerase for amplifying a synthetic DNA from
said target nucleic acid by loop-mediated isothermal amplification,
oligonucleotides capable of forming an invasive cleavage structure
with said synthetic DNA, and an agent for cleaving an invasive
cleavage structure, b) exposing the mixture to conditions wherein,
if the target nucleic acid is present, synthetic DNA is amplified
from said target nucleic acid using said primers and said
polymerase, and wherein the oligonucleotides form an invasive
cleavage structure with the synthetic DNA, and wherein the invasive
cleavage structure is cleaved by the agent, and c) detecting the
cleavage of an invasive cleavage structure by the agent, thereby
detecting the presence of the target nucleic acid.
[0100] In some embodiments, the synthetic DNA comprises a first
region and a second region, the second region downstream of and
contiguous to the first region, the oligonucleotides comprise first
and second oligonucleotides, wherein at least a portion of the
first oligonucleotide is completely complementary to the first
portion of the synthetic DNA and wherein the second oligonucleotide
comprises a 3' portion and a 5' portion, wherein the 5' portion is
completely complementary to the second portion of the synthetic
DNA.
[0101] Detection is not limited to any particular method or means.
In some embodiments, detecting cleavage of an invasive cleavage
structure comprises detection selected from the group consisting of
detection of fluorescence, mass, fluorescence energy transfer,
radioactivity, luminescence, phosphorescence, fluorescence
polarization, and charge.
[0102] In some embodiments, the agent comprises a structure
specific nuclease and in some embodiments, the structure specific
nuclease comprises a 5' nuclease. In certain preferred embodiments,
the 5' nuclease is thermostable, and in particularly preferred
embodiments, the thermostable 5' nuclease comprises a FEN-1
endonuclease.
[0103] In some embodiments, the polymerase comprises a DNA
polymerase and in certain preferred embodiments, the polymerase
comprises a polymerase from Bacillus stearothermophilus.
[0104] In preferred embodiments, the target nucleic acid is
selected from the group consisting of DNA and RNA.
[0105] The present invention also provides nucleic acid treatment
kits, comprising: a) a composition comprising at least one purified
FEN-1 endonuclease; and b) a solution containing manganese. In some
embodiments of the kits, the purified FEN-1 endonuclease is
selected from the group consisting Pyrococcus woesei FEN-1
endonuclease, Pyrococcus furiosus FEN-1 endonuclease, Methanococcus
jannaschii FEN-1 endonuclease, Methanobacterium thermoautotrophicum
FEN-1 endonuclease, Archaeoglobus fulgidus FEN-1, and chimerical
FEN-1 endonucleases. In other embodiments, the kits further
comprise at least one second structure-specific nuclease. In some
preferred embodiments, the second nuclease is a 5' nuclease derived
from a thermostable DNA polymerase altered in amino acid sequence
such that it exhibits reduced DNA synthetic activity from that of
the wild-type DNA polymerase but retains substantially the same 5'
nuclease activity of the wild-type DNA polymerase. In yet other
embodiments of the kits, the portion of the amino acid sequence of
the second nuclease is homologous to a portion of the amino acid
sequence of a thermostable DNA polymerase derived from a
eubacterial thermophile of the genus Thermus. In further
embodiments, the thermophile is selected from the group consisting
of Thermus aquaticus, Thermus flavus and Thermus thermophilus. In
yet other preferred embodiments, the kits further comprise reagents
for detecting the cleavage products.
[0106] In some embodiments the nucleic acid treatment kit
comprising primers configured to produce amplified synthetic DNA
from a target nucleic acid by loop-mediated isothermal
amplification, and oligonucleotides capable of forming an invasive
cleavage structure with said synthetic DNA, and an agent for
cleaving an invasive cleavage structure. In some embodiments, the
kit further comprises a structure specific nuclease and in some
embodiments, the structure specific nuclease comprises a 5'
nuclease. In certain preferred embodiments, the 5' nuclease is
thermostable, and in particularly preferred embodiments, the
thermostable 5' nuclease comprises a FEN-1 endonuclease.
[0107] In some embodiments, the kit further comprises a polymerase
suitable for amplifying synthetic DNA from said target nucleic acid
by loop-mediated isothermal amplification. In certain embodiments,
the kit comprises a DNA polymerase and in certain preferred
embodiments, the polymerase comprises a polymerase from Bacillus
stearothermophilus.
[0108] In some embodiments, the kit further comprises a target
nucleic acid.
[0109] The present invention also provides methods for improving
the methods and enzymes disclosed herein. For example, the present
invention provides methods of improving enzymes for any intended
purpose (e.g., use in cleavage reactions, amplification reactions,
binding reactions, or any other use) comprising the step of
providing an enzyme disclosed herein and modifying the enzyme
(e.g., altering the amino acid sequence, adding or subtracting
sequence, adding post-translational modifications, adding any other
component whether biological or not, or any other modification).
Likewise, the present invention provides methods for improving the
methods disclosed herein comprising, conducting the method steps
with one or more changes (e.g., change in a composition provided in
the method, change in the order of the steps, or addition or
subtraction of steps).
DEFINITIONS
[0110] To facilitate an understanding of the present invention, a
number of terms and phrases are defined below:
[0111] As used herein, the terms "complementary" or
"complementarity" are used in reference to polynucleotides (i.e., a
sequence of nucleotides such as an oligonucleotide or a target
nucleic acid) related by the base-pairing rules. For example, for
the sequence "5'-A-G-T-3'," is complementary to the sequence
"3'-T-C-A-5'." Complementarity may be "partial," in which only some
of the nucleic acids' bases are matched according to the base
pairing rules. Or, there may be "complete" or "total"
complementarity between the nucleic acids. The degree of
complementarity between nucleic acid strands has significant
effects on the efficiency and strength of hybridization between
nucleic acid strands. This is of particular importance in
amplification reactions, as well as detection methods which depend
upon binding between nucleic acids. Either term may also be used in
reference to individual nucleotides, especially within the context
of polynucleotides. For example, a particular nucleotide within an
oligonucleotide may be noted for its complementarity, or lack
thereof, to a nucleotide within another nucleic acid strand, in
contrast or comparison to the complementarity between the rest of
the oligonucleotide and the nucleic acid strand.
[0112] The term "homology" and "homologous" refers to a degree of
identity. There may be partial homology or complete homology. A
partially homologous sequence is one that is less than 100%
identical to another sequence.
[0113] As used herein, the term "hybridization" is used in
reference to the pairing of complementary nucleic acids.
Hybridization and the strength of hybridization (i.e., the strength
of the association between the nucleic acids) is influenced by such
factors as the degree of complementary between the nucleic acids,
stringency of the conditions involved, and the T.sub.m of the
formed hybrid. "Hybridization" methods involve the annealing of one
nucleic acid to another, complementary nucleic acid, i.e., a
nucleic acid having a complementary nucleotide sequence. The
ability of two polymers of nucleic acid containing complementary
sequences to find each other and anneal through base pairing
interaction is a well-recognized phenomenon. The initial
observations of the "hybridization" process by Marmur and Lane,
Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc.
Natl. Acad. Sci. USA 46:461 (1960) have been followed by the
refinement of this process into an essential tool of modern
biology.
[0114] With regard to complementarity, it is important for some
diagnostic applications to determine whether the hybridization
represents complete or partial complementarity. For example, where
it is desired to detect simply the presence or absence of pathogen
DNA (such as from a virus, bacterium, fungi, mycoplasma, protozoan)
it is only important that the hybridization method ensures
hybridization when the relevant sequence is present; conditions can
be selected where both partially complementary probes and
completely complementary probes will hybridize. Other diagnostic
applications, however, may require that the hybridization method
distinguish between partial and complete complementarity. It may be
of interest to detect genetic polymorphisms. For example, human
hemoglobin is composed, in part, of four polypeptide chains. Two of
these chains are identical chains of 141 amino acids (alpha chains)
and two of these chains are identical chains of 146 amino acids
(beta chains). The gene encoding the beta chain is known to exhibit
polymorphism. The normal allele encodes a beta chain having
glutamic acid at the sixth position. The mutant allele encodes a
beta chain having valine at the sixth position. This difference in
amino acids has a profound (most profound when the individual is
homozygous for the mutant allele) physiological impact known
clinically as sickle cell anemia. It is well known that the genetic
basis of the amino acid change involves a single base difference
between the normal allele DNA sequence and the mutant allele DNA
sequence.
[0115] The complement of a nucleic acid sequence as used herein
refers to an oligonucleotide which, when aligned with the nucleic
acid sequence such that the 5' end of one sequence is paired with
the 3' end of the other, is in "antiparallel association." Certain
bases not commonly found in natural nucleic acids may be included
in the nucleic acids of the present invention and include, for
example, inosine and 7-deazaguanine. Complementarity need not be
perfect; stable duplexes may contain mismatched base pairs or
unmatched bases. Those skilled in the art of nucleic acid
technology can determine duplex stability empirically considering a
number of variables including, for example, the length of the
oligonucleotide, base composition and sequence of the
oligonucleotide, ionic strength and incidence of mismatched base
pairs.
[0116] As used herein, the term "T.sub.m" is used in reference to
the "melting temperature." The melting temperature is the
temperature at which a population of double-stranded nucleic acid
molecules becomes half dissociated into single strands. Several
equations for calculating the T.sub.m of nucleic acids are well
known in the art. As indicated by standard references, a simple
estimate of the T.sub.m value may be calculated by the equation:
T.sub.m=81.5+0.41(% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative
Filter Hybridization, in Nucleic Acid Hybridization (1985). Other
references (e.g., Allawi, H. T. & SantaLucia, J., Jr.
Thermodynamics and NMR of internal G.T mismatches in DNA.
Biochemistry 36, 10581-94 (1997) include more sophisticated
computations which take structural and environmental, as well as
sequence characteristics into account for the calculation of
T.sub.m.
[0117] As used herein the term "stringency" is used in reference to
the conditions of temperature, ionic strength, and the presence of
other compounds, under which nucleic acid hybridizations are
conducted. With "high stringency" conditions, nucleic acid base
pairing will occur only between nucleic acid fragments that have a
high frequency of complementary base sequences. Thus, conditions of
"weak" or "low" stringency are often required when it is desired
that nucleic acids which are not completely complementary to one
another be hybridized or annealed together.
[0118] "High stringency conditions" when used in reference to
nucleic acid hybridization comprise conditions equivalent to
binding or hybridization at 42 C in a solution consisting of
5.times.SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS,
5.times.Denhardt's reagent and 100 .mu.g/ml denatured salmon sperm
DNA followed by washing in a solution comprising 0.1.times.SSPE,
1.0% SDS at 42 C when a probe of about 500 nucleotides in length is
employed.
[0119] "Medium stringency conditions" when used in reference to
nucleic acid hybridization comprise conditions equivalent to
binding or hybridization at 42 C in a solution consisting of
5.times.SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS,
5.times.Denhardt's reagent and 100 .mu.g/ml denatured salmon sperm
DNA followed by washing in a solution comprising 1.0.times.SSPE,
1.0% SDS at 42 C when a probe of about 500 nucleotides in length is
employed.
[0120] "Low stringency conditions" comprise conditions equivalent
to binding or hybridization at 42 C in a solution consisting of
5.times.SSPE (43.8 g/l NaCl, 6.9 g/l NaH.sub.2PO.sub.4H.sub.2O and
1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS,
5.times.Denhardt's reagent [50.times.Denhardt's contains per 500
ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)]
and 100 g/ml denatured salmon sperm DNA followed by washing in a
solution comprising 5.times.SSPE, 0.1% SDS at 42 C when a probe of
about 500 nucleotides in length is employed.
[0121] The term "gene" refers to a DNA sequence that comprises
control and coding sequences necessary for the production of an RNA
having a non-coding function (e.g., a ribosomal or transfer RNA), a
polypeptide or a precursor. The RNA or polypeptide can be encoded
by a full length coding sequence or by any portion of the coding
sequence so long as the desired activity or function is
retained.
[0122] The term "wild-type" refers to a gene or a gene product that
has the characteristics of that gene or gene product when isolated
from a naturally occurring source. A wild-type gene is that which
is most frequently observed in a population and is thus arbitrarily
designated the "normal" or "wild-type" form of the gene. In
contrast, the term "modified", "mutant" or "polymorphic" refers to
a gene or gene product which displays modifications in sequence and
or functional properties (i.e., altered characteristics) when
compared to the wild-type gene or gene product. It is noted that
naturally-occurring mutants can be isolated; these are identified
by the fact that they have altered characteristics when compared to
the wild-type gene or gene product.
[0123] The term "recombinant DNA vector" as used herein refers to
DNA sequences containing a desired heterologous sequence. For
example, although the term is not limited to the use of expressed
sequences or sequences that encode an expression product, in some
embodiments, the heterologous sequence is a coding sequence and
appropriate DNA sequences necessary for either the replication of
the coding sequence in a host organism, or the expression of the
operably linked coding sequence in a particular host organism. DNA
sequences necessary for expression in prokaryotes include a
promoter, optionally an operator sequence, a ribosome binding site
and possibly other sequences. Eukaryotic cells are known to utilize
promoters, polyadenlyation signals and enhancers.
[0124] The term "LTR" as used herein refers to the long terminal
repeat found at each end of a provirus (i.e., the integrated form
of a retrovirus). The LTR contains numerous regulatory signals
including transcriptional control elements, polyadenylation signals
and sequences needed for replication and integration of the viral
genome. The viral LTR is divided into three regions called U3, R
and U5.
[0125] The U3 region contains the enhancer and promoter elements.
The U5 region contains the polyadenylation signals. The R (repeat)
region separates the U3 and U5 regions and transcribed sequences of
the R region appear at both the 5' and 3' ends of the viral
RNA.
[0126] The term "oligonucleotide" as used herein is defined as a
molecule comprising two or more deoxyribonucleotides or
ribonucleotides, preferably at least 5 nucleotides, more preferably
at least about 10-15 nucleotides and more preferably at least about
15 to 30 nucleotides. The exact size will depend on many factors,
which in turn depend on the ultimate function or use of the
oligonucleotide. The oligonucleotide may be generated in any
manner, including chemical synthesis, DNA replication, reverse
transcription, PCR, or a combination thereof.
[0127] Because mononucleotides are reacted to make oligonucleotides
in a manner such that the 5' phosphate of one mononucleotide
pentose ring is attached to the 3' oxygen of its neighbor in one
direction via a phosphodiester linkage, an end of an
oligonucleotide is referred to as the "5' end" if its 5' phosphate
is not linked to the 3' oxygen of a mononucleotide pentose ring and
as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of
a subsequent mononucleotide pentose ring. As used herein, a nucleic
acid sequence, even if internal to a larger oligonucleotide, also
may be said to have 5' and 3' ends. A first region along a nucleic
acid strand is said to be upstream of another region if the 3' end
of the first region is before the 5' end of the second region when
moving along a strand of nucleic acid in a 5' to 3' direction.
[0128] When two different, non-overlapping oligonucleotides anneal
to different regions of the same linear complementary nucleic acid
sequence, and the 3' end of one oligonucleotide points towards the
5' end of the other, the former may be called the "upstream"
oligonucleotide and the latter the "downstream" oligonucleotide.
Similarly, when two overlapping oligonucleotides are hybridized to
the same linear complementary nucleic acid sequence, with the first
oligonucleotide positioned such that its 5' end is upstream of the
5' end of the second oligonucleotide, and the 3' end of the first
oligonucleotide is upstream of the 3' end of the second
oligonucleotide, the first oligonucleotide may be called the
"upstream" oligonucleotide and the second oligonucleotide may be
called the "downstream" oligonucleotide.
[0129] The term "primer" refers to an oligonucleotide that is
capable of acting as a point of initiation of synthesis when placed
under conditions in which primer extension is initiated. An
oligonucleotide "primer" may occur naturally, as in a purified
restriction digest or may be produced synthetically.
[0130] A primer is selected to be "substantially" complementary to
a strand of specific sequence of the template. A primer must be
sufficiently complementary to hybridize with a template strand for
primer elongation to occur. A primer sequence need not reflect the
exact sequence of the template. For example, a non-complementary
nucleotide fragment may be attached to the 5' end of the primer,
with the remainder of the primer sequence being substantially
complementary to the strand. Non-complementary bases or longer
sequences can be interspersed into the primer, provided that the
primer sequence has sufficient complementarity with the sequence of
the template to hybridize and thereby form a template primer
complex for synthesis of the extension product of the primer.
[0131] The term "label" as used herein refers to any atom or
molecule that can be used to provide a detectable (preferably
quantifiable) signal, and that can be attached to a nucleic acid or
protein. Labels may provide signals detectable by fluorescence,
radioactivity, colorimetry, gravimetry, X-ray diffraction or
absorption, magnetism, enzymatic activity, and the like. A label
may be a charged moiety (positive or negative charge) or
alternatively, may be charge neutral. Labels can include or consist
of nucleic acid or protein sequence, so long as the sequence
comprising the label is detectable.
[0132] The term "cleavage structure" as used herein, refers to a
structure that is formed by the interaction of at least one probe
oligonucleotide and a target nucleic acid, forming a structure
comprising a duplex, the resulting structure being cleavable by a
cleavage means, including but not limited to an enzyme. The
cleavage structure is a substrate for specific cleavage by the
cleavage means in contrast to a nucleic acid molecule that is a
substrate for non-specific cleavage by agents such as
phosphodiesterases which cleave nucleic acid molecules without
regard to secondary structure (i.e., no formation of a duplexed
structure is required).
[0133] The term "folded cleavage structure" as used herein, refers
to a region of a single-stranded nucleic acid substrate containing
secondary structure, the region being cleavable by an enzymatic
cleavage means. The cleavage structure is a substrate for specific
cleavage by the cleavage means in contrast to a nucleic acid
molecule which is a substrate for non-specific cleavage by agents
such as phosphodiesterases which cleave nucleic acid molecules
without regard to secondary structure (i.e., no folding of the
substrate is required).
[0134] As used herein, the term "folded target" refers to a nucleic
acid strand that contains at least one region of secondary
structure (i.e., at least one double stranded region and at least
one single-stranded region within a single strand of the nucleic
acid). A folded target may comprise regions of tertiary structure
in addition to regions of secondary structure.
[0135] The term "cleavage means" or "cleavage agent" as used herein
refers to any means that is capable of cleaving a cleavage
structure, including but not limited to enzymes. The cleavage means
may include native DNAPs having 5' nuclease activity (e.g., Taq DNA
polymerase, E. coli DNA polymerase I) and, more specifically,
modified DNAPs having 5' nuclease but lacking synthetic activity.
"Structure-specific nucleases" or "structure-specific enzymes" are
enzymes that recognize specific secondary structures in a nucleic
molecule and cleave these structures. The cleavage means of the
invention cleave a nucleic acid molecule in response to the
formation of cleavage structures; it is not necessary that the
cleavage means cleave the cleavage structure at any particular
location within the cleavage structure.
[0136] The cleavage means is not restricted to enzymes having
solely 5' nuclease activity. The cleavage means may include
nuclease activity provided from a variety of sources including the
Cleavase enzymes, the FEN-1 endonucleases (including RAD2 and XPG
proteins), Taq DNA polymerase and E. coli DNA polymerase I.
[0137] The term "thermostable" when used in reference to an enzyme,
such as a 5' nuclease, indicates that the enzyme is functional or
active (i.e., can perform catalysis) at an elevated temperature,
i.e., at about 55.degree. C. or higher.
[0138] The term "cleavage products" as used herein, refers to
products generated by the reaction of a cleavage means with a
cleavage structure (i.e., the treatment of a cleavage structure
with a cleavage means).
[0139] The term "target nucleic acid" refers to a nucleic acid
molecule containing a sequence that has at least partial
complementarity with at least a probe oligonucleotide and may also
have at least partial complementarity with an INVADER
oligonucleotide. The target nucleic acid may comprise single- or
double-stranded DNA or RNA.
[0140] The term "probe oligonucleotide" refers to an
oligonucleotide that interacts with a target nucleic acid to form a
cleavage structure in the presence or absence of an INVADER
oligonucleotide. When annealed to the target nucleic acid, the
probe oligonucleotide and target form a cleavage structure and
cleavage occurs within the probe oligonucleotide.
[0141] The term "non-target cleavage product" refers to a product
of a cleavage reaction that is not derived from the target nucleic
acid. As discussed above, in the methods of the present invention,
cleavage of the cleavage structure generally occurs within the
probe oligonucleotide. The fragments of the probe oligonucleotide
generated by this target nucleic acid-dependent cleavage are
"non-target cleavage products."
[0142] The term "INVADER oligonucleotide" refers to an
oligonucleotide that hybridizes to a target nucleic acid at a
location near the region of hybridization between a probe and the
target nucleic acid, wherein the INVADER oligonucleotide comprises
a portion (e.g., a chemical moiety, or nucleotide-whether
complementary to that target or not) that overlaps with the region
of hybridization between the probe and target. In some embodiments,
the INVADER oligonucleotide contains sequences at its 3' end that
are substantially the same as sequences located at the 5' end of a
probe oligonucleotide.
[0143] The term "substantially single-stranded" when used in
reference to a nucleic acid substrate means that the substrate
molecule exists primarily as a single strand of nucleic acid in
contrast to a double-stranded substrate which exists as two strands
of nucleic acid which are held together by inter-strand base
pairing interactions.
[0144] As used herein, the term "substantially non-target nucleic
acid sequences" refers to sequences containing less than 50%
homology to target sequence (e.g., less than 40%, preferably less
than 30%, even more preferably less than 20%, and still more
preferably less than 10%). In some embodiments, "substantially
non-target nucleic acid sequences" contain mismatches and/or
additional sequences (e.g., contains less than 10, preferably 9,
even more preferably 8, still more preferably 7, and yet more
preferably, less than 6 contiguous bases that identically match the
target sequences).
[0145] The term "sequence variation" as used herein refers to
differences in nucleic acid sequence between two nucleic acids. For
example, a wild-type structural gene and a mutant form of this
wild-type structural gene may vary in sequence by the presence of
single base substitutions and/or deletions or insertions of one or
more nucleotides. These two forms of the structural gene are said
to vary in sequence from one another. A second mutant form of the
structural gene may exist. This second mutant form is said to vary
in sequence from both the wild-type gene and the first mutant form
of the gene.
[0146] The term "liberating" as used herein refers to the release
of a nucleic acid fragment from a larger nucleic acid fragment,
such as an oligonucleotide, by the action of, for example, a 5'
nuclease such that the released fragment is no longer covalently
attached to the remainder of the oligonucleotide.
[0147] The term "K.sub.m" as used herein refers to the
Michaelis-Menten constant for an enzyme and is defined as the
concentration of the specific substrate at which a given enzyme
yields one-half its maximum velocity in an enzyme catalyzed
reaction.
[0148] The term "nucleotide analog" as used herein refers to
modified or non-naturally occurring nucleotides such as 7-deaza
purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs
include base analogs and comprise modified forms of
deoxyribonucleotides as well as ribonucleotides.
[0149] The term "polymorphic locus" is a locus present in a
population that shows variation between members of the population
(e.g., the most common allele has a frequency of less than 0.95).
In contrast, a "monomorphic locus" is a genetic locus at little or
no variations seen between members of the population (generally
taken to be a locus at which the most common allele exceeds a
frequency of 0.95 in the gene pool of the population).
[0150] The term "microorganism" as used herein means an organism
too small to be observed with the unaided eye and includes, but is
not limited to bacteria, virus, protozoans, fungi, and
ciliates.
[0151] The term "microbial gene sequences" refers to gene sequences
derived from a microorganism.
[0152] The term "bacteria" refers to any bacterial species
including eubacterial and archaebacterial species.
[0153] The term "virus" refers to obligate, ultramicroscopic,
intracellular parasites incapable of autonomous replication (i.e.,
replication requires the use of the host cell's machinery).
[0154] The term "multi-drug resistant" or multiple-drug resistant"
refers to a microorganism which is resistant to more than one of
the antibiotics or antimicrobial agents used in the treatment of
said microorganism.
[0155] The term "sample" in the present specification and claims is
used in its broadest sense. On the one hand it is meant to include
a specimen or culture (e.g., microbiological cultures). On the
other hand, it is meant to include both biological and
environmental samples. A sample may include a specimen of synthetic
origin.
[0156] Biological samples may be animal, including human, fluid,
solid (e.g., stool) or tissue, as well as liquid and solid food and
feed products and ingredients such as dairy items, vegetables, meat
and meat by-products, and waste. Biological samples may be obtained
from all of the various families of domestic animals, as well as
feral or wild animals, including, but not limited to, such animals
as ungulates, bear, fish, lagamorphs, rodents, etc.
[0157] Environmental samples include environmental material such as
surface matter, soil, water and industrial samples, as well as
samples obtained from food and dairy processing instruments,
apparatus, equipment, utensils, disposable and non-disposable
items. These examples are not to be construed as limiting the
sample types applicable to the present invention.
[0158] The term "source of target nucleic acid" refers to any
sample that contains nucleic acids (RNA or DNA). Particularly
preferred sources of target nucleic acids are biological samples
including, but not limited to blood, saliva, cerebral spinal fluid,
pleural fluid, milk, lymph, sputum and semen.
[0159] An oligonucleotide is said to be present in "excess"
relative to another oligonucleotide (or target nucleic acid
sequence) if that oligonucleotide is present at a higher molar
concentration that the other oligonucleotide (or target nucleic
acid sequence). When an oligonucleotide such as a probe
oligonucleotide is present in a cleavage reaction in excess
relative to the concentration of the complementary target nucleic
acid sequence, the reaction may be used to indicate the amount of
the target nucleic acid present. Typically, when present in excess,
the probe oligonucleotide will be present at least a 100-fold molar
excess; typically at least 1 pmole of each probe oligonucleotide
would be used when the target nucleic acid sequence was present at
about 10 fmoles or less.
[0160] A sample "suspected of containing" a first and a second
target nucleic acid may contain either, both or neither target
nucleic acid molecule.
[0161] The term "charge-balanced" oligonucleotide refers to an
oligonucleotide (the input oligonucleotide in a reaction) that has
been modified such that the modified oligonucleotide bears a
charge, such that when the modified oligonucleotide is either
cleaved (i.e., shortened) or elongated, a resulting product bears a
charge different from the input oligonucleotide (the
"charge-unbalanced" oligonucleotide) thereby permitting separation
of the input and reacted oligonucleotides on the basis of charge.
The term "charge-balanced" does not imply that the modified or
balanced oligonucleotide has a net neutral charge (although this
can be the case). Charge-balancing refers to the design and
modification of an oligonucleotide such that a specific reaction
product generated from this input oligonucleotide can be separated
on the basis of charge from the input oligonucleotide.
[0162] For example, in an INVADER oligonucleotide-directed cleavage
assay in which the probe oligonucleotide bears the sequence: 5'
TTCTTTTCACCAGCGAGACGGG 3' (i.e., SEQ ID NO:61 without the modified
bases) and cleavage of the probe occurs between the second and
third residues, one possible charge-balanced version of this
oligonucleotide would be: 5' Cy3-AminoT-Amino-TCTTTTCACCAGCGAGAC
GGG 3'. This modified oligonucleotide bears a net negative charge.
After cleavage, the following oligonucleotides are generated: 5'
Cy3-AminoT-Amino-T 3' and 5' CTTTTCACCAGCGAGACGGG 3' (residues 3-22
of SEQ ID NO:61). 5' Cy3-AminoT-Amino-T 3' bears a detectable
moiety (the positively-charged Cy3 dye) and two amino-modified
bases. The amino-modified bases and the Cy3 dye contribute positive
charges in excess of the negative charges contributed by the
phosphate groups and thus the 5' Cy3-AminoT-Amino-T
3'oligonucleotide has a net positive charge. The other, longer
cleavage fragment, like the input probe, bears a net negative
charge. Because the 5' Cy3-AminoT-Amino-T 3'fragment is separable
on the basis of charge from the input probe (the charge-balanced
oligonucleotide), it is referred to as a charge-unbalanced
oligonucleotide. The longer cleavage product cannot be separated on
the basis of charge from the input oligonucleotide as both
oligonucleotides bear a net negative charge; thus, the longer
cleavage product is not a charge-unbalanced oligonucleotide.
[0163] The term "net neutral charge" when used in reference to an
oligonucleotide, including modified oligonucleotides, indicates
that the sum of the charges present (i.e., R--NH3+ groups on
thymidines, the N3 nitrogen of cytosine, presence or absence or
phosphate groups, etc.) under the desired reaction or separation
conditions is essentially zero. An oligonucleotide having a net
neutral charge would not migrate in an electrical field.
[0164] The term "net positive charge" when used in reference to an
oligonucleotide, including modified oligonucleotides, indicates
that the sum of the charges present (i.e., R--NH3+ groups on
thymidines, the N3 nitrogen of cytosine, presence or absence or
phosphate groups, etc.) under the desired reaction conditions is +1
or greater. An oligonucleotide having a net positive charge would
migrate toward the negative electrode in an electrical field.
[0165] The term "net negative charge" when used in reference to an
oligonucleotide, including modified oligonucleotides, indicates
that the sum of the charges present (i.e., R--NH3+ groups on
thymidines, the N3 nitrogen of cytosine, presence or absence or
phosphate groups, etc.) under the desired reaction conditions is -1
or lower. An oligonucleotide having a net negative charge would
migrate toward the positive electrode in an electrical field.
[0166] The term "polymerization means" or "polymerization agent"
refers to any agent capable of facilitating the addition of
nucleoside triphosphates to an oligonucleotide. Preferred
polymerization means comprise DNA and RNA polymerases.
[0167] The term "ligation means" or "ligation agent" refers to any
agent capable of facilitating the ligation (i.e., the formation of
a phosphodiester bond between a 3'-OH and a 5' P located at the
termini of two strands of nucleic acid). Preferred ligation means
comprise DNA ligases and RNA ligases.
[0168] The term "reactant" is used herein in its broadest sense.
The reactant can comprise, for example, an enzymatic reactant, a
chemical reactant or light (e.g., ultraviolet light, particularly
short wavelength ultraviolet light is known to break
oligonucleotide chains). Any agent capable of reacting with an
oligonucleotide to either shorten (i.e., cleave) or elongate the
oligonucleotide is encompassed within the term "reactant."
[0169] The term "adduct" is used herein in its broadest sense to
indicate any compound or element that can be added to an
oligonucleotide. An adduct may be charged (positively or
negatively) or may be charge-neutral. An adduct may be added to the
oligonucleotide via covalent or non-covalent linkages. Examples of
adducts include, but are not limited to, indodicarbocyanine dye
amidites, amino-substituted nucleotides, ethidium bromide, ethidium
homodimer, (1,3-propanediamino)propidium,
(diethylenetriamino)propidium, thiazole orange,
(N-N'-tetramethyl-1,3-propanediamino)propyl thiazole orange,
(N-N'-tetramethyl-1,2-ethanediamino)propyl thiazole orange,
thiazole orange-thiazole orange homodimer (TOTO), thiazole
orange-thiazole blue heterodimer (TOTAB), thiazole orange-ethidium
heterodimer 1 (TOED1), thiazole orange-ethidium heterodimer 2
(TOED2) and fluorescein-ethidium heterodimer (FED), psoralens,
biotin, streptavidin, avidin, etc.
[0170] Where a first oligonucleotide is complementary to a region
of a target nucleic acid and a second oligonucleotide has
complementary to the same region (or a portion of this region) a
"region of overlap" exists along the target nucleic acid. The
degree of overlap will vary depending upon the nature of the
complementarity (see, e.g., region "X" in FIGS. 29 and 67 and the
accompanying discussions).
[0171] As used herein, the term "purified" or "to purify" refers to
the removal of contaminants from a sample. For example, recombinant
Cleavase nucleases are expressed in bacterial host cells and the
nucleases are purified by the removal of host cell proteins; the
percent of these recombinant nucleases is thereby increased in the
sample.
[0172] The term "recombinant DNA molecule" as used herein refers to
a DNA molecule that comprises of segments of DNA joined together by
means of molecular biological techniques.
[0173] The term "recombinant protein" or "recombinant polypeptide"
as used herein refers to a protein molecule that is expressed from
a recombinant DNA molecule.
[0174] As used herein the term "portion" when in reference to a
protein (as in "a portion of a given protein") refers to fragments
of that protein. The fragments may range in size from four amino
acid residues to the entire amino acid sequence minus one amino
acid (e.g., 4, 5, 6, . . . , n-1).
[0175] The term "nucleic acid sequence" as used herein refers to an
oligonucleotide, nucleotide or polynucleotide, and fragments or
portions thereof, and to DNA or RNA of genomic or synthetic origin
which may be single or double stranded, and represent the sense or
antisense strand. Similarly, "amino acid sequence" as used herein
refers to peptide or protein sequence.
[0176] The term "peptide nucleic acid" ("PNA") as used herein
refers to a molecule comprising bases or base analogs such as would
be found in natural nucleic acid, but attached to a peptide
backbone rather than the sugar-phosphate backbone typical of
nucleic acids. The attachment of the bases to the peptide is such
as to allow the bases to base pair with complementary bases of
nucleic acid in a manner similar to that of an oligonucleotide.
These small molecules, also designated anti gene agents, stop
transcript elongation by binding to their complementary strand of
nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63
[1993]).
[0177] As used herein, the terms "purified" or "substantially
purified" refer to molecules, either nucleic or amino acid
sequences, that are removed from their natural environment,
isolated or separated, and are at least 60% free, preferably 75%
free, and most preferably 90% free from other components with which
they are naturally associated. An "isolated polynucleotide" or
"isolated oligonucleotide" is therefore a substantially purified
polynucleotide.
[0178] An isolated oligonucleotide (or polynucleotide) encoding a
Pyrococcus woesei (Pwo) FEN-1 endonuclease having a region capable
of hybridizing to SEQ ID NO:116 is an oligonucleotide containing
sequences encoding at least the amino-terminal portion of Pwo FEN-1
endonuclease. An isolated oligonucleotide (or polynucleotide)
encoding a Pwo FEN-1 endonuclease having a region capable of
hybridizing to SEQ ID NO:117 is an oligonucleotide containing
sequences encoding at least the carboxy-terminal portion of Pwo
FEN-1 endonuclease. An isolated oligonucleotide (or polynucleotide)
encoding a Pwo FEN-1 endonuclease having a region capable of
hybridizing to SEQ ID NOS:118 and 119 is an oligonucleotide
containing sequences encoding at least portions of Pwo FEN-1
endonuclease protein located internal to either the amino or
carboxy-termini of the Pwo FEN-1 endonuclease protein.
[0179] As used herein, the term "fusion protein" refers to a
chimeric protein containing the protein of interest (e.g., Cleavase
BN/thrombin nuclease and portions or fragments thereof) joined to
an exogenous protein fragment (the fusion partner which consists of
a non Cleavase BN/thrombin nuclease protein). The fusion partner
may enhance solubility of recombinant chimeric protein (e.g., the
Cleavase BN/thrombin nuclease) as expressed in a host cell, may
provide an affinity tag (e.g., a his-tag) to allow purification of
the recombinant fusion protein from the host cell or culture
supernatant, or both. If desired, the fusion protein may be removed
from the protein of interest (e.g., Cleavase BN/thrombin nuclease
or fragments thereof) by a variety of enzymatic or chemical means
known to the art.
[0180] As used herein, the terms "chimeric protein" and "chimerical
protein" refer to a single protein molecule that comprises amino
acid sequences portions derived from two or more parent proteins.
These parent molecules may be from similar proteins from
genetically distinct origins, different proteins from a single
organism, or different proteins from different organisms. By way of
example but not by way of limitation, a chimeric structure-specific
nuclease of the present invention may contain a mixture of amino
acid sequences that have been derived from FEN-1 genes from two or
more of the organisms having such genes, combined to form a
non-naturally occurring nuclease. The term "chimerical" as used
herein is not intended to convey any particular proportion of
contribution from the naturally occurring genes, nor limit the
manner in which the portions are combined. Any chimeric
structure-specific nuclease constructs having cleavage activity as
determined by the testing methods described herein are improved
cleavage agents within the scope of the present invention.
[0181] The term "continuous strand of nucleic acid" as used herein
is means a strand of nucleic acid that has a continuous, covalently
linked, backbone structure, without nicks or other disruptions. The
disposition of the base portion of each nucleotide, whether
base-paired, single-stranded or mismatched, is not an element in
the definition of a continuous strand. The backbone of the
continuous strand is not limited to the ribose-phosphate or
deoxyribose-phosphate compositions that are found in naturally
occurring, unmodified nucleic acids. A nucleic acid of the present
invention may comprise modifications in the structure of the
backbone, including but not limited to phosphorothioate residues,
phosphonate residues, 2' substituted ribose residues (e.g.,
2'-O-methyl ribose) and alternative sugar (e.g., arabinose)
containing residues.
[0182] The term "continuous duplex" as used herein refers to a
region of double stranded nucleic acid in which there is no
disruption in the progression of basepairs within the duplex (i.e.,
the base pairs along the duplex are not distorted to accommodate a
gap, bulge or mismatch with the confines of the region of
continuous duplex). As used herein the term refers only to the
arrangement of the basepairs within the duplex, without implication
of continuity in the backbone portion of the nucleic acid strand.
Duplex nucleic acids with uninterrupted basepairing, but with nicks
in one or both strands are within the definition of a continuous
duplex.
[0183] The term "duplex" refers to the state of nucleic acids in
which the base portions of the nucleotides on one strand are bound
through hydrogen bonding the their complementary bases arrayed on a
second strand. The condition of being in a duplex form reflects on
the state of the bases of a nucleic acid. By virtue of base
pairing, the strands of nucleic acid also generally assume the
tertiary structure of a double helix, having a major and a minor
groove. The assumption of the helical form is implicit in the act
of becoming duplexed.
[0184] The term "duplex dependent protein binding" refers to the
binding of proteins to nucleic acid that is dependent on the
nucleic acid being in a duplex, or helical form.
[0185] The term "duplex dependent protein binding sites or regions"
as used herein refers to discrete regions or sequences within a
nucleic acid that are bound with particular affinity by specific
duplex-dependent nucleic acid binding proteins. This is in contrast
to the generalized duplex-dependent binding of proteins that are
not site-specific, such as the histone proteins that bind chromatin
with little reference to specific sequences or sites.
[0186] The term "protein binding region" as used herein refers to a
nucleic acid region identified by a sequence or structure as
binding to a particular protein or class of proteins. It is within
the scope of this definition to include those regions that contain
sufficient genetic information to allow identifications of the
region by comparison to known sequences, but which might not have
the requisite structure for actual binding (e.g., a single strand
of a duplex-depending nucleic acid binding protein site). As used
herein "protein binding region" excludes restriction endonuclease
binding regions.
[0187] The term "complete double stranded protein binding region"
as used herein refers to the minimum region of continuous duplex
required to allow binding or other activity of a duplex-dependent
protein. This definition is intended to encompass the observation
that some duplex dependent nucleic acid binding proteins can
interact with full activity with regions of duplex that may be
shorter than a canonical protein binding region as observed in one
or the other of the two single strands. In other words, one or more
nucleotides in the region may be allowed to remain unpaired without
suppressing binding. As used here in, the term "complete double
stranded binding region" refers to the minimum sequence that will
accommodate the binding function. Because some such regions can
tolerate non-duplex sequences in multiple places, although not
necessarily simultaneously, a single protein binding region might
have several shorter sub-regions that, when duplexed, will be fully
competent for protein binding.
[0188] The term "template" refers to a strand of nucleic acid on
which a complementary copy is built from nucleoside triphosphates
through the activity of a template-dependent nucleic acid
polymerase. Within a duplex the template strand is, by convention,
depicted and described as the "bottom" strand. Similarly, the
non-template strand is often depicted and described as the "top"
strand.
[0189] The term "template-dependent RNA polymerase" refers to a
nucleic acid polymerase that creates new RNA strands through the
copying of a template strand as described above and which does not
synthesize RNA in the absence of a template. This is in contrast to
the activity of the template-independent nucleic acid polymerases
that synthesize or extend nucleic acids without reference to a
template, such as terminal deoxynucleotidyl transferase, or Poly A
polymerase.
[0190] The term "ARRESTOR" refers to an agent added to or included
in an invasive cleavage reaction in order to stop one or more
reaction components from participating in a subsequent action or
reaction. This may be done by sequestering or inactivating some
reaction component (e.g., by binding or base-pairing a nucleic acid
component, or by binding to a protein component). The term
"ARRESTOR oligonucleotide" refers to an oligonucleotide included in
an invasive cleavage reaction in order to stop or arrest one or
more aspects of any reaction (e.g., the first reaction and/or any
subsequent reactions or actions; it is not intended that the
ARRESTOR oligonucleotide be limited to any particular reaction or
reaction step). This may be done by sequestering some reaction
component (e.g., base-pairing to another nucleic acid, or binding
to a protein component). However, it is not intended that the term
be so limited as to just situations in which a reaction component
is sequestered.
DESCRIPTION OF THE DRAWINGS
[0191] FIG. 1 is a comparison of the nucleotide structure of the
DNAP genes isolated from Thermus aquaticus (SEQ ID NO:1), Thermus
flavus (SEQ ID NO:2) and Thermus thermophilus (SEQ ID NO:3); the
consensus sequence (SEQ ID NO:7) is shown at the top of each
row.
[0192] FIG. 2 is a comparison of the amino acid sequence of the
DNAP isolated from Thermus aquaticus (SEQ ID NO:4), Thermus flavus
(SEQ ID NO:5), and Thermus thermophilus (SEQ ID NO:6); the
consensus sequence (SEQ ID NO:8) is shown at the top of each
row.
[0193] FIGS. 3A-G are a set of diagrams of wild-type and
synthesis-deficient DNAPTaq genes.
[0194] FIG. 4A depicts the wild-type Thermus flavus polymerase
gene.
[0195] FIG. 4B depicts a synthesis-deficient Thermus flavus
polymerase gene.
[0196] FIG. 5 depicts a structure which cannot be amplified using
DNAPTaq; this Figure shows SEQ ID NO:17 (primer) and SEQ ID NO:15
(hairpin).
[0197] FIG. 6 is a ethidium bromide-stained gel demonstrating
attempts to amplify a bifurcated duplex using either DNAPTaq or
DNAPStf (i.e., the Stoffel fragment of DNAPTaq).
[0198] FIG. 7 is an autoradiogram of a gel analyzing the cleavage
of a bifurcated duplex by DNAPTaq and lack of cleavage by
DNAPStf.
[0199] FIGS. 8A-B are a set of autoradiograms of gels analyzing
cleavage or lack of cleavage upon addition of different reaction
components and change of incubation temperature during attempts to
cleave a bifurcated duplex with DNAPTaq.
[0200] FIGS. 9A-B are an autoradiogram displaying timed cleavage
reactions, with and without primer.
[0201] FIGS. 10A-B are a set of autoradiograms of gels
demonstrating attempts to cleave a bifurcated duplex (with and
without primer) with various DNAPs.
[0202] FIG. 11A shows the substrate and oligonucleotides (19-12
[SEQ ID NO:18] and 30-12 [SEQ ID NO:19]) used to test the specific
cleavage of substrate DNAs targeted by pilot oligonucleotides (SEQ
ID NO:27).
[0203] FIG. 11B shows an autoradiogram of a gel showing the results
of cleavage reactions using the substrates and oligonucleotides
shown FIG. 12A.
[0204] FIG. 12A shows the substrate and oligonucleotide (30-0 [SEQ
ID NO:20]) used to test the specific cleavage of a substrate RNA
targeted by a pilot oligonucleotide (SEQ ID NO:254).
[0205] FIG. 12B shows an autoradiogram of a gel showing the results
of a cleavage reaction using the substrate and oligonucleotide
shown in FIG. 13A.
[0206] FIG. 13 is a diagram of vector pTTQ18 (SEQ ID NO:255).
[0207] FIG. 14 is a diagram of vector pET-3c (SEQ ID NO:256).
[0208] FIGS. 15A-E depicts a set of molecules which are suitable
substrates for cleavage by the 5' nuclease activity of DNAPs (SEQ
ID NOS:15 and 17 are depicted in FIG. 15E).
[0209] FIG. 16 is an autoradiogram of a gel showing the results of
a cleavage reaction run with synthesis-deficient DNAPs.
[0210] FIG. 17 is an autoradiogram of a PEI chromatogram resolving
the products of an assay for synthetic activity in
synthesis-deficient DNAPTaq clones.
[0211] FIG. 18A depicts the substrate molecule (SEQ ID NOS: 257 and
22) used to test the ability of synthesis-deficient DNAPs to cleave
short hairpin structures. FIG. 18B shows an autoradiogram of a gel
resolving the products of a cleavage reaction run using the
substrate shown in FIG. 19A.
[0212] FIG. 19 provides the complete 206-mer duplex sequence (SEQ
ID NO:27) employed as a substrate for the 5' nucleases of the
present invention FIGS. 20A and B show the cleavage of linear
nucleic acid substrates (based on the 206-mer of FIG. 21) by wild
type DNAPs and 5' nucleases isolated from Thermus aquaticus and
Thermus flavus.
[0213] FIG. 21A shows the "nibbling" phenomenon detected with the
DNAPs of the present invention.
[0214] FIG. 21B shows that the "nibbling" of FIG. 25A is 5'
nucleolytic cleavage and not phosphatase cleavage.
[0215] FIGS. 22A and 22B show schematic representations of
single-stranded and duplex substrates, and demonstrate that the
"nibbling" phenomenon is duplex dependent.
[0216] FIG. 23 is a schematic showing how "nibbling" can be
employed in a detection assay.
[0217] FIGS. 24A and B demonstrates that "nibbling" can be target
directed.
[0218] FIG. 25 provides a schematic drawing of a target nucleic
acid with an INVADER oligonucleotide and a probe oligonucleotide
annealed to the target.
[0219] FIG. 26 provides a schematic showing the S-60 hairpin
oligonucleotide (SEQ ID NO:29) with the annealed P-15
oligonucleotide (SEQ ID NO:30).
[0220] FIG. 27 is an autoradiogram of a gel showing the results of
a cleavage reaction run using the S-60 hairpin in the presence or
absence of the P-15 oligonucleotide.
[0221] FIG. 28A-C provides schematic diagrams showing three
different arrangements of target-specific oligonucleotides and
their hybridization to a target nucleic acid which also has a probe
oligonucleotide annealed thereto (SEQ ID NOS:31-35).
[0222] FIG. 29 is the image generated by a fluorescence imager
showing that the presence of an INVADER oligonucleotide causes a
shift in the site of cleavage in a probe/target duplex.
[0223] FIG. 30 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run using the three target-specific oligonucleotides
diagrammed in FIG. 28.
[0224] FIG. 31 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence or absence of non-target nucleic acid
molecules.
[0225] FIG. 32 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence of decreasing amounts of target nucleic
acid.
[0226] FIG. 33 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence or absence of saliva extract using
various thermostable 5' nucleases or DNA polymerases.
[0227] FIG. 34 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run using various 5' nucleases.
[0228] FIG. 35 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run using two target nucleic acids which differ by a single
basepair at two different reaction temperatures.
[0229] FIG. 36A provides a schematic showing the effect of elevated
temperature upon the annealing and cleavage of a probe
oligonucleotide along a target nucleic acid wherein the probe
contains a region of noncomplementarity with the target.
[0230] FIG. 36B provides a schematic showing the effect of adding
an upstream oligonucleotide upon the annealing and cleavage of a
probe oligonucleotide along a target nucleic acid wherein the probe
contains a region of noncomplementarity with the target.
[0231] FIG. 37 provides a schematic showing an arrangement of a
target-specific INVADER oligonucleotide (SEQ ID NO:39) and a
target-specific probe oligonucleotide (SEQ ID NO:38) bearing a 5'
Cy3 label along a target nucleic acid (SEQ ID NO:31).
[0232] FIG. 38 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence of increasing concentrations of KCl.
[0233] FIG. 39 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence of increasing concentrations of
MnCl.sub.2 or MgCl.sub.2.
[0234] FIG. 40 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run in the presence of increasing amounts of genomic DNA or
tRNA.
[0235] FIG. 41 is the image generated by a fluorescence imager
showing the products of INVADER oligonucleotide-directed cleavage
assays run use a HCV RNA target.
[0236] FIGS. 42A and 42B are images generated by a fluorescence
imager showing the products of INVADER oligonucleotide-directed
cleavage assays run using a HCV RNA target and demonstrate the
stability of RNA targets under INVADER oligonucleotide-directed
cleavage assay conditions.
[0237] FIG. 43 is the image generated by a fluorescence imager
showing the sensitivity of detection and the stability of RNA in
INVADER oligonucleotide-directed cleavage assays run using a HCV
RNA target.
[0238] FIG. 44 is the image generated by a fluorescence imager
showing thermal degradation of oligonucleotides containing or
lacking a 3' phosphate group.
[0239] FIG. 45 depicts the structure of amino-modified
oligonucleotides 70 and 74.
[0240] FIG. 46 depicts the structure of amino-modified
oligonucleotide 75
[0241] FIG. 47 depicts the structure of amino-modified
oligonucleotide 76.
[0242] FIG. 48 is the image generated by a fluorescence imager scan
of an IEF gel showing the migration of substrates 70, 70 dp, 74, 74
dp, 75, 75 dp, 76 and 76 dp.
[0243] FIG. 49A provides a schematic showing an arrangement of a
target-specific INVADER oligonucleotide (SEQ ID NO:50) and a
target-specific probe oligonucleotide (SEQ ID NO:51) bearing a 5'
Cy3 label along a target nucleic acid (SEQ ID NO:52).
[0244] FIG. 49B is the image generated by a fluorescence imager
showing the detection of specific cleavage products generated in an
invasive cleavage assay using charge reversal (i.e., charge based
separation of cleavage products).
[0245] FIG. 50 is the image generated by a fluorescence imager
which depicts the sensitivity of detection of specific cleavage
products generated in an invasive cleavage assay using charge
reversal.
[0246] FIG. 51 depicts a first embodiment of a device for the
charge-based separation of oligonucleotides.
[0247] FIG. 52 depicts a second embodiment of a device for the
charge-based separation of oligonucleotides.
[0248] FIG. 53 shows an autoradiogram of a gel showing the results
of cleavage reactions run in the presence or absence of a primer
oligonucleotide; a sequencing ladder is shown as a size marker.
[0249] FIGS. 54A-D depict four pairs of oligonucleotides; in each
pair shown, the upper arrangement of a probe annealed to a target
nucleic acid lacks an upstream oligonucleotide and the lower
arrangement contains an upstream oligonucleotide (SEQ ID NOS:32 and
54-58 are shown in FIGS. 54A-D).
[0250] FIG. 55 shows the chemical structure of several positively
charged heterodimeric DNA-binding dyes.
[0251] FIG. 56 is a schematic showing alternative methods for the
tailing and detection of specific cleavage products in the context
of the INVADER oligonucleotide-directed cleavage assay.
[0252] FIG. 57 provides a schematic drawing of a target nucleic
acid with an INVADER oligonucleotide, a miniprobe, and a stacker
oligonucleotide annealed to the target.
[0253] FIG. 58 provides a space-filling model of the 3-dimensional
structure of the T5 5'-exonuclease.
[0254] FIG. 59A-E provides an alignment of the amino acid sequences
of several FEN-1 nucleases including the Methanococcus jannaschii
FEN-1 protein (MJAFEN1.PRO), the Pyrococcus furiosus FEN-1 protein
(PFUFEN1.PRO), the human FEN-1 protein (HUMFEN1.PRO), the mouse
FEN-1 protein (MUSFEN1.PRO), the Saccharomyces cerevisiae YKL510
protein (YST510.PRO), the Saccharomyces cerevisiae RAD2 protein
(YSTRAD2.PRO), the Shizosaccharomyces pombe RAD13 protein
(SPORAD13.PRO), the human XPG protein (HUMXPG.PRO), the mouse XPG
protein (MUSXPG.PRO), the Xenopus laevis XPG protein (XENXPG.PRO)
and the C. elegans RAD2 protein (CELRAD2.PRO) (SEQ ID NOS:135-145,
respectively); portions of the amino acid sequence of some of these
proteins were not shown in order to maximize the alignment between
proteins (specifically, amino acids 122 to 765 of the YSTRAD2
sequence were deleted; amino acids 122 to 746 of the SPORAD13
sequence were deleted; amino acids 122 to 757 of the HUMXPG
sequence were deleted; amino acids 122 to 770 of the MUSXPG
sequence were deleted; and amino acids 122 to 790 of the XENXPG
sequence were deleted). The numbers to the left of each line of
sequence refers to the amino acid residue number; dashes represent
gaps introduced to maximize alignment.
[0255] FIG. 60 is a schematic showing the S-33 (SEQ ID NO:84) and
11-8-0 (SEQ ID NO:85) oligonucleotides in a folded configuration;
the cleavage site is indicated by the arrowhead.
[0256] FIG. 61 shows a Coomassie stained SDS-PAGE gel showing the
thrombin digestion of CLEAVASE BN/thrombin.
[0257] FIG. 62 is the image generated by a fluorescence imager
showing the products produced by the cleavage of the S-60 hairpin
using CLEAVASE BN/thrombin (before and after thrombin
digestion).
[0258] FIG. 63 is the image generated by a fluorescence imager
showing the products produced by the cleavage of circular M13 DNA
using CLEAVASE BN/thrombin.
[0259] FIG. 64 is an SDS-PAGE gel showing the migration of purified
CLEAVASE BN nuclease, Pfu FEN-1, Pwo FEN-1 and Mja FEN-1.
[0260] FIG. 65 is the image generated by a fluorescence imager
showing the products produced by the cleavage of the S-33 and
11-8-0 oligonucleotides by CLEAVASE BN and the Mja FEN-1
nucleases.
[0261] FIG. 66 is the image generated by a fluorescence imager
showing the products produced by the incubation of an
oligonucleotide either having or lacking a 3'-OH group with TdT
(SEQ ID NO:258) FIG. 67 is the image generated by a fluorescence
imager showing the products produced the incubation of cleavage
products with TdT.
[0262] FIG. 68 is a photograph of a Universal GeneComb.TM. card
showing the capture and detection of cleavage products on a
nitrocellulose support.
[0263] FIG. 69 is the image generated by a fluorescence imager
showing the products produced using the CLEAVASE A/G and Pfu FEN-1
nucleases and a fluorescein-labeled probe.
[0264] FIG. 70 is the image generated by a fluorescence imager
showing the products produced using the CLEAVASE A/G and Pfu FEN-1
nucleases and a Cy3-labeled probe.
[0265] FIG. 71 is the image generated by a fluorescence imager
showing the products produced using the CLEAVASE A/G and Pfu FEN-1
nucleases and a TET-labeled probe.
[0266] FIGS. 72A and 72B are images generated by a fluorescence
imager showing the products produced using the CLEAVASE A/G and Pfu
FEN-1 nucleases and probes having or lacking a 5' positive charge;
the gel shown in FIG. 83A was run in the standard direction and the
gel shown in FIG. 84B was run in the reverse direction.
[0267] FIG. 73 shows the structure of 3-nitropyrrole and
5-nitroindole.
[0268] FIG. 74 shows the sequence of oligonucleotides 109, 61 and
67 (SEQ ID NOS:97, 50 and 51) annealed into a cleavage structure as
well as the sequence of oligonucleotide 67 (SEQ ID NO:51) and a
composite of SEQ ID NOS:98, 99, 101 and 102.
[0269] FIG. 75A-C show images generated by a fluorescence imager
showing the products produced in an INVADER
oligonucleotide-directed cleavage assay performed at various
temperatures using a miniprobe which is either completely
complementary to the target or contains a single mismatch with the
target.
[0270] FIG. 76 shows the sequence of oligonucleotides 166 (SEQ ID
NO:103), 165 (SEQ ID NO:104), 161 (SEQ ID NO:106), 162 (SEQ ID
NO:105) and 164 (SEQ ID NO:107) as well as a cleavage
structure.
[0271] FIG. 77 shows the image generated by a fluorescence imager
showing the products produced in an INVADER
oligonucleotide-directed cleavage assay performed using ras gene
sequences as the target.
[0272] FIGS. 78A-C show the sequence of the S-60 hairpin (SEQ ID
NO:29) (A), and the P-15 oligonucleotide (SEQ ID NO:30) (shown
annealed to the S-60 hairpin in B) and the image generated by a
fluorescence imager showing the products produced by cleavage of
the S-60 hairpin in the presence of various INVADER
oligonucleotides.
[0273] FIG. 79 shows the structure of various 3' end
substituents.
[0274] FIG. 80 is a composite graph showing the effect of probe
concentration, temperature and a stacker oligonucleotide on the
cleavage of miniprobes.
[0275] FIG. 81 shows the sequence of the IT-2 oligonucleotide (SEQ
ID NO:115; shown in a folded configuration) as well as the sequence
of the IT-1 (SEQ ID NO:116) and IT-A (SEQ ID NO:117)
oligonucleotides.
[0276] FIG. 82 shows the image generated by a fluorescence imager
showing the products produced by cleavage of the oligonucleotides
shown in FIG. 92 by CLEAVASE A/G nuclease.
[0277] FIG. 83 shows the image generated by a fluorescence imager
which provides a comparison of the rates of cleavage by the Pfu
FEN-1 and Mja FEN-1 nucleases.
[0278] FIG. 84 shows the image generated by a fluorescence imager
which depicts the detection of RNA targets using a miniprobe and
stacker oligonucleotides.
[0279] FIGS. 85A-C provide schematics showing particular
embodiments of the present invention wherein a T7 promoter region
and copy template annealed with either no oligonucleotide (A), a
complete promoter oligonucleotide (B) or a complete promoter
oligonucleotide with a 3' tail (C); one strand of the T7 promoter
region is indicated by the hatched line.
[0280] FIGS. 86A-D provide schematics showing particular
embodiments of the present invention wherein a T7 promoter region
and copy template annealed with either a cut probe(A), a partial
promoter oligonucleotide (B), an uncut oligonucleotide (C) or both
an uncut probe and a partial promoter oligonucleotide (D).
[0281] FIG. 87 provides a schematic illustrating one embodiment of
the present invention wherein a template-dependent DNA polymerase
is used to extend a cut probe to complete a T7 promoter region and
thereby allow transcription.
[0282] FIGS. 88A and 88B provide schematic diagrams illustrating
that an uncut probe combined with a partial promoter
oligonucleotide does not permit transcription while a cut probe
combined with a partial promoter oligonucleotide generates a
complete (but nicked) promoter which supports transcription.
[0283] FIG. 89 shows the image generated by a fluorescence imager
which shows that primer extension can be used to complete a partial
promoter formed by a cut probe (lanes 1-5) and that annealing a cut
probe generated in an invasive cleavage assay can complete a
partial T7 promoter to permit transcription (lanes 6-9).
[0284] FIGS. 90A-C provide schematics showing particular
embodiments of the present invention which illustrate that the use
of a partial promoter oligonucleotide with a paired 5' tail can be
used to block transcription from a composite promoter formed by the
annealing of an uncut probe.
[0285] FIG. 91 shows the image generated by a fluorescence imager
which shows that transcription from a "leaky" branched T7 composite
promoter can be shut down by the use of a downstream partial
promoter oligonucleotide having a paired 5' tail.
[0286] FIG. 92 shows the image generated by a fluorescence imager
which shows that the location of the nick site in a nicked
composite T7 promoter can effect the efficiency of
transcription.
[0287] FIG. 93 A-C are schematics showing the nucleic acids tested
in reactions 1-4 of FIG. 93D; these schematics show SEQ ID
NOS:123-125. FIG. 93D shows the image generated by a fluorescence
imager, which shows that the presence of an unpaired 3' tail on a
full-length promoter oligonucleotide decreases but does not abolish
transcription.
[0288] FIG. 94 is a schematic which illustrates one embodiment of
the present invention where a composite T7 promoter region is
created by the binding of the cut probe oligonucleotide downstream
of the partial promoter oligo.
[0289] FIGS. 95A-D provide schematics showing particular
embodiments of the present invention which show various ways in
which a composite promoter can be formed wherein the nick is
located in the template (or bottom) strand.
[0290] FIG. 96 is a schematic which illustrates one embodiment of
the present invention where the cut probe from an initial invasive
cleavage reaction is employed as the INVADER oligonucleotide in a
second invasive cleavage reaction.
[0291] FIG. 97 is a schematic which illustrates one embodiment of
the present invention where the cut probe from an initial invasive
cleavage reaction is employed as an integrated INVADER-target
complex in a second invasive cleavage reaction.
[0292] FIG. 98 shows the nucleotide sequence of the PR1 probe (SEQ
ID NO:119), the IT3 INVADER-Target oligonucleotide (SEQ ID NO:118),
the IT3-8, IT3-6, IT3-4, IT3-3 and IT3-0 oligonucleotides (SEQ ID
NOS:147-151, respectively).
[0293] FIGS. 99A-E depict structures that may be employed to
determine the ability of an enzyme to cleave a probe in the
presence and the absence of an upstream oligonucleotide. FIG. 99
displays the sequence of oligonucleotide 89-15-1 (SEQ ID NO:152),
oligonucleotide 81-69-5 (SEQ ID NO:156), oligonucleotide 81-69-4
(SEQ ID NO 155), oligonucleotide 81-69-3 (SEQ ID NO:154),
oligonucleotide 81-69-2 (SEQ ID NO:153) and a portion of M13mp18
(SEQ ID NO:163).
[0294] FIG. 100 shows the image generated by a fluorescence imager
which shows the dependence of Pfu FEN-1 on the presence of an
overlapping upstream oligonucleotide for specific cleavage of the
probe.
[0295] FIG. 101a shows the image generated by a fluorescence imager
which compares the amount of product generated in a standard (i.e.,
a non-sequential invasive cleavage reaction) and a sequential
invasive cleavage reaction.
[0296] FIG. 101b is a graph comparing the amount of product
generated in a standard or basic (i.e., a non-sequential invasive
cleavage reaction) and a sequential invasive cleavage reaction
("invader sqrd") (y axis=fluorescence units; x axis=attomoles of
target).
[0297] FIG. 102 shows the image generated by a fluorescence imager
which shows that the products of a completed sequential invasive
cleavage reaction cannot cross contaminant a subsequent similar
reaction.
[0298] FIG. 103 shows the sequence of the oligonucleotide employed
in an invasive cleavage reaction for the detection of HCMV viral
DNA; FIG. 103 shows the sequence of oligonucleotide 89-76 (SEQ ID
NO:161), oligonucleotide 89-44 (SEQ ID NO:160) and nucleotides
3057-3110 of the HCMV genome (SEQ ID NO:162).
[0299] FIG. 104 shows the image generated by a fluorescence imager
which shows the sensitive detection of HCMV viral DNA in samples
containing human genomic DNA using an invasive cleavage
reaction.
[0300] FIG. 105 is a schematic which illustrates one embodiment of
the present invention, where the cut probe from an initial invasive
cleavage reaction is employed as the INVADER oligonucleotide in a
second invasive cleavage reaction, and where an ARRESTOR
oligonucleotide prevents participation of remaining uncut first
probe in the cleavage of the second probe.
[0301] FIG. 106 is a schematic which illustrates one embodiment of
the present invention, where the cut probe from an initial invasive
cleavage reaction is employed as an integrated INVADER-target
complex in a second invasive cleavage reaction, and where an
ARRESTOR oligonucleotide prevents participation of remaining uncut
first probe in the cleavage of the second probe.
[0302] FIG. 107 shows three images generated by a fluorescence
imager showing that two different lengths of 2' O-methyl, 3'
terminal amine-modified ARRESTOR oligonucleotide both reduce
non-specific background cleavage of the secondary probe when
included in the second step of a reaction where the cut probe from
an initial invasive cleavage reaction is employed as an integrated
INVADER-target complex in a second invasive cleavage reaction.
[0303] FIG. 108A shows two images generated by a fluorescence
imager showing the effects on nonspecific and specific cleavage
signal of increasing concentrations of primary probe in the first
step of a reaction where the cut probe from an initial invasive
cleavage reaction is employed as the INVADER oligonucleotide in a
second invasive cleavage reaction.
[0304] FIG. 108B shows two images generated by a fluorescence
imager showing the effects on nonspecific and specific cleavage
signal of increasing concentrations of primary probe in the first
step of a reaction, and inclusion of a 2' O-methyl, 3' terminal
amine-modified ARRESTOR oligonucleotide in the second step of a
reaction where the cut probe from an initial invasive cleavage
reaction is employed as the INVADER oligonucleotide in a second
invasive cleavage reaction.
[0305] FIG. 108C shows a graph generated using the spreadsheet
Microsoft Excel software, comparing the effects on nonspecific and
specific cleavage signal of increasing concentrations of primary
probe in the first step of a reaction, in the presence or absence
of a 2' O-methyl, 3' terminal amine-modified ARRESTOR
oligonucleotide in the second step of a reaction where the cut
probe from an initial invasive cleavage reaction is employed as the
INVADER oligonucleotide in a second invasive cleavage reaction.
[0306] FIG. 109A shows two images generated by a fluorescence
imager showing the effects on nonspecific and specific cleavage
signal of including an unmodified ARRESTOR oligonucleotide in the
second step of a reaction where the cut probe from an initial
invasive cleavage reaction is employed as the INVADER
oligonucleotide in a second invasive cleavage reaction.
[0307] FIG. 109B shows two images generated by a fluorescence
imager showing the effects on nonspecific and specific cleavage
signal of including a 3' terminal amine modified ARRESTOR, a
partially 2' O-methyl substituted, 3' terminal amine modified
ARRESTOR oligonucleotide, or an entirely 2' O-methyl, 3' terminal
amine modified ARRESTOR oligonucleotide in the second step of a
reaction where the cut probe from an initial invasive cleavage
reaction is employed as the INVADER oligonucleotide in a second
invasive cleavage reaction.
[0308] FIG. 110A shows two images generated by a fluorescence
imager comparing the effects on nonspecific and specific cleavage
signal of including an ARRESTOR oligonucleotides of different
lengths in the second step of a reaction where the cut probe from
an initial invasive cleavage reaction is employed as the INVADER
oligonucleotide in a second invasive cleavage reaction.
[0309] FIG. 110B shows two images generated by a fluorescence
imager comparing the effects on nonspecific and specific cleavage
signal of including an ARRESTOR oligonucleotides of different
lengths in the second step of a reaction where the cut probe from
an initial invasive cleavage reaction is employed as the INVADER
oligonucleotide in a second invasive cleavage reaction, and in
which a longer variant of the secondary probe used in the reactions
in FIG. 110A is tested.
[0310] FIG. 110C shows a schematic diagram of a primary probe (SEQ
ID NO:175) aligned with several ARRESTOR oligonucleotides of
different lengths. The region of the primary probe that is
complementary to the HBV target sequence is underlined. The
ARRESTOR oligonucleotides are aligned with the probe by
complementarity probe (SEQ ID NOS:179-182).
[0311] FIG. 111 shows two images generated by a fluorescence imager
comparing the effects on nonspecific and specific cleavage signal
of including ARRESTOR oligonucleotides of different lengths in the
second step of a reaction where the cut probe from an initial
invasive cleavage reaction is employed as the INVADER
oligonucleotide in a second invasive cleavage reaction, using
secondary probes of two different lengths.
[0312] FIG. 112 A provides a schematic diagram that illustrates one
embodiment of the present invention wherein the cut probe from an
initial invasive cleavage reaction is employed as the INVADER
oligonucleotide in a second invasive cleavage reaction using a FRET
cassette. The region indicated as "N" is the overlap required for
cleavage in this embodiment. 112B diagrams how a mismatch between
the probe and the target strand at position "N" disrupts the
overlap, thereby suppressing cleavage of the probe.
[0313] FIG. 113A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:195), probe oligonucleotide (SEQ ID
NO:197) and FRET cassette (SEQ ID NO:201) for the detection of the
Apo E 112 arg allele (SEQ ID NO:191). The flap released from the
probe (SEQ ID NO:259) is shown annealed to the FRET cassette.
[0314] FIG. 113B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:195), probe oligonucleotide (SEQ ID
NO:198) and FRET cassette (SEQ ID NO:201) for the detection of the
Apo E 112 cys allele (SEQ ID NO:192). The flap released from the
probe (SEQ ID NO:260) is shown annealed to the FRET cassette.
[0315] FIG. 113C shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:196), probe oligonucleotide (SEQ ID
NO:199) and FRET cassette (SEQ ID NO:201) for the detection of the
Apo E 158 arg allele (SEQ ID NO:193). The flap released from the
probe (SEQ ID NO:259) is shown annealed to the FRET cassette.
[0316] FIG. 113D shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:196), probe oligonucleotide (SEQ ID
NO:200) and FRET cassette (SEQ ID NO:201) for the detection of the
Apo E 158 cys allele (SEQ ID NO:194). The flap released from the
probe (SEQ ID NO:260) is shown annealed to the FRET cassette.
[0317] FIG. 14A provides a bar graph showing the detection of the
arg and cys alleles at the Apo E 112 locus in 2 synthetic controls
and 5 samples of human genomic DNA.
[0318] FIG. 14B provides a bar graph showing the detection of the
arg and cys alleles at the Apo E 158 locus in 2 synthetic controls
and 5 samples of human genomic DNA.
[0319] FIG. 115A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:202), probe oligonucleotide (SEQ ID
NO:208) and FRET cassette (SEQ ID NO: 210) for the detection of the
wild-type C282 allele of the human HFE gene (SEQ ID NO:204). The
flap released from the probe (SEQ ID NO:261) is shown annealed to
the FRET cassette.
[0320] FIG. 115B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:202), probe oligonucleotide (SEQ ID
NO:209) and FRET cassette (SEQ ID NO:210) for the detection of the
C282Y mutant allele of the human HFE gene (SEQ ID NO:205). The flap
released from the probe (SEQ ID NO:262) is shown annealed to the
FRET cassette.
[0321] FIG. 115C shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:203), probe oligonucleotide (SEQ ID
NO:211) and FRET cassette (SEQ ID NO:206) for the detection of the
wild-type H63 allele of the human HFE gene (SEQ ID NO:206). The
flap released from the probe (SEQ ID NO:263) is shown annealed to
the FRET cassette.
[0322] FIG. 115D shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:203), probe oligonucleotide (SEQ ID
NO:212) and FRET cassette (SEQ ID NO:213) for the detection of the
H63D mutant allele of the human HFE gene (SEQ ID NO:207). The flap
released from the probe (SEQ ID NO:264) is shown annealed to the
FRET cassette.
[0323] FIG. 116 provides a bar graph showing the analysis of the
C282Y (first set of eight tests, left to right) and H63D (second
set of eight tests, left to right) mutations in the human HFE gene,
each tested in 2 synthetic controls and 5 samples of human genomic
DNA.
[0324] FIG. 117A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:216), probe oligonucleotide (SEQ ID
NO:217) and FRET cassette (SEQ ID NO:225) for the detection of the
wild-type allele at position 677 of the human MTHFR gene (SEQ ID
NO:214). The flap released from the probe (SEQ ID NO:259) is shown
annealed to the FRET cassette.
[0325] FIG. 117B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:216), probe oligonucleotide (SEQ ID
NO:218) and FRET cassette (SEQ ID NO:225) for the detection of the
mutant allele at position 677 of the human MTHFR gene (SEQ ID
NO:215). The flap released from the probe (SEQ ID NO:260) is shown
annealed to the FRET cassette.
[0326] FIG. 118 provides a bar graph showing the analysis of the
C677T mutation in the human MTHFR gene in 3 synthetic control
samples and 3 samples of human genomic DNA.
[0327] FIG. 119A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:222), probe oligonucleotide (SEQ ID
NO:223) and FRET cassette (SEQ ID NO: 225) for the detection of the
wild-type allele at position 20210 of the human prothrombin gene
(SEQ ID NO:220). The flap released from the probe (SEQ ID NO:259)
is shown annealed to the FRET cassette.
[0328] FIG. 119B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:222), probe oligonucleotide (SEQ ID
NO:224) and FRET cassette (SEQ ID NO:225) for the detection of the
mutant allele at position 20210 of the human prothrombin gene (SEQ
ID NO:221). The flap released from the probe (SEQ ID NO:260) is
shown annealed to the FRET cassette.
[0329] FIG. 120 provides a bar graph showing the analysis of the
A20210G mutation in the human prothrombin gene in 2 synthetic
control samples and 3 samples of human genomic DNA.
[0330] FIG. 121A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:228), probe oligonucleotide (SEQ ID
NO:229) and FRET cassette (SEQ ID NO:230) for the detection of the
R-2 mutant allele of the human factor V gene (SEQ ID NO:226). The
flap released from the probe (SEQ ID NO:263) is shown annealed to
the FRET cassette.
[0331] FIG. 121B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:231), probe oligonucleotide (SEQ ID
NO:232) and FRET cassette (SEQ ID NO: 230) for the detection of the
human .alpha.-actin gene (SEQ ID NO:227). The flap released from
the probe (SEQ ID NO:265) is shown annealed to the FRET
cassette.
[0332] FIG. 122 provides a bar graph showing the detection of the
R-2 mutant (HR-2) of the human factor V gene, compared to the
detection of the internal control (IC), the .alpha.-actin gene, 3
synthetic control samples and 2 samples of human genomic DNA.
[0333] FIG. 123A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:235), probe oligonucleotide (SEQ ID
NO:236) and FRET cassette (SEQ ID NO:225) for the detection of the
wild-type allele at position -308 in the promoter of the human
TNF-.alpha. gene (SEQ ID NO:233). The flap released from the probe
(SEQ ID NO:266) is shown annealed to the FRET cassette.
[0334] FIG. 123B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:235), probe oligonucleotide (SEQ ID
NO:237) and FRET cassette (SEQ ID NO:225) for the detection of the
mutant allele at position -308 in the promoter of the human
TNF-.alpha. gene (SEQ ID NO:234). The flap released from the probe
(SEQ ID NO:267) is shown annealed to the FRET cassette.
[0335] FIG. 124 provides a bar graph showing the analysis of the
-308 mutation in the promoter of the human TNF-.alpha. gene in 3
synthetic control samples and 3 samples of human genomic DNA.
[0336] FIG. 125A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:240), probe oligonucleotide (SEQ ID
NO:241) and FRET cassette (SEQ ID NO: 225) for the detection of the
wild-type allele at codon position 506 of the human factor V gene
(SEQ ID NO:238). The flap released from the probe (SEQ ID NO:259)
is shown annealed to the FRET cassette.
[0337] FIG. 125B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:240), probe oligonucleotide (SEQ ID
NO:242) and FRET cassette (SEQ ID NO:225) for the detection of the
A506G mutant allele of the human factor V gene (SEQ ID NO:239). The
flap released from the probe (SEQ ID NO:260) is shown annealed to
the FRET cassette.
[0338] FIG. 126 provides a bar graph showing the analysis of the
A506G mutation in the human factor V gene in 3 synthetic control
samples and 6 samples of human genomic DNA.
[0339] FIG. 127A shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:243), probe oligonucleotide (SEQ ID
NO:244) and FRET cassette (SEQ ID NO:245) for the detection of the
mecA gene associated with methicillin resistance in S. aureus (SEQ
ID NO:252). The flap released from the probe (SEQ ID NO:268) is
shown annealed to the FRET cassette.
[0340] FIG. 127B shows a schematic diagram of an INVADER
oligonucleotide (SEQ ID NO:246), probe oligonucleotide (SEQ ID
NO:247) and FRET cassette (SEQ ID NO:245) for the detection of the
nuc gene, a species-specific gene that distinguishes S. aureus from
S. haemolyticus (SEQ ID NO:253). The flap released from the probe
(SEQ ID NO:269) is shown annealed to the FRET cassette.
[0341] FIG. 128 provides a bar graph showing the detection of the
mecA gene, compared to the detection of the S. aureus-specific nuc
gene in DNA from methicillin-sensitive S. aureus (MSSA),
methicillin-resistant S. aureus (MRSA), S. haemolyticus, and
amplified control targets for the mecA and nuc target
sequences.
[0342] FIG. 129 shows a schematic of a cINVADER assay used in some
embodiments of the present invention.
[0343] FIG. 130 (SEQ ID NO:270) shows a schematic of the ECCE
INVADER assay used in some embodiments of the present
invention.
[0344] FIGS. 131A and 131B provide schematic diagrams of a LAMP
amplification procedure (e.g., as described in U.S. Pat. No.
6,410,278, and in Nucleic Acids Research, 2000, Vol. 28, No. 12
E63-e63). FIG. 131A shows the configuration of the LAMP primers on
a target nucleic acid. FIG. 131B provides a schematic
representation of the amplification mechanism of LAMP. This method
relies on auto-cycling strand displacement DNA synthesis that is
performed by a DNA polymerase with high strand displacement
activity and a set of two specially designed inner and two outer
primers (see, e.g., FIG. 131A). In the initial steps of the LAMP
reaction, all four primers are used, but later during the cycling
reaction, only the inner primers are used for strand displacement
DNA synthesis. The inner primers are called the forward inner
primer (FIP) and the backward inner primer (BIP), respectively, and
each contains two distinct sequences corresponding to the sense and
antisense sequences of the target DNA, one for priming in the first
stage and the other for self-priming in later stages. For ease of
explanation, the sequences (typically 23-24 nt) inside both ends of
the target region for amplification in a DNA are designated F2c and
B2, respectively. Two inner sequences (typically 23-24 nt)
approximately 40 nt from the ends of F2c and B2 are designated F1c
and B1 and two sequences (approx. 17-21 nt) outside the ends of F2c
and B2 are designated F3c and B3. Given this structure, the
sequences of FIP and BIP were designed as follows (see FIG. 131A):
FIP contains F1c, a spacer (e.g., TTTT) and the sequence (F2)
complementary to F2c. BIP contains the sequence (B1c) complementary
to B1, a spacer and B2. The two outer primers consist of B3 and the
sequence (F3) complementary to F3c, respectively. A DNA sample
containing the target sequence and the four primers is heat
denatured and rapidly cooled on ice. The LAMP reaction is then
initiated by addition of the Bst DNA polymerase large fragment and
carried out at 65.degree. C. for 1 h.
[0345] FIG. 132 diagrams designs for LAMP primers and Invader assay
oligonucleotides to detect Factor II and Factor V alleles.
[0346] FIG. 133 shows the result of 2-step reactions to detect
Factor II and Factor V alleles, in which LAMP was conducted in the
absence of Invader assay reagents, followed by detection from 1 ul
of LAMP reaction in a 1 or 5 min Invader assay.
[0347] FIG. 134 shows the results of testing the LAMP+Invader assay
combination (one-step reaction) in either LAMP buffer or Invader
Plus buffer.
[0348] FIG. 135 shows the results of testing the one-step in
additional reaction conditions.
[0349] FIG. 136 diagrams designs for LAMP primers and Invader assay
oligonucleotides to detect mrsA59 of C. trachomatis.
[0350] FIG. 137 shows results of one step "LAMP+Invader" assays in
detection of mrsA59.
[0351] FIG. 138 shows results of testing the presence of LAMP
amplification by spiking completed reactions into separate Invader
assay reactions (left panel) and by agarose gel electrophoresis
(right panel).
[0352] FIG. 139 diagrams designs for LAMP primers and Invader assay
oligonucleotides to detect pmpA765 of C. trachomatis.
[0353] FIG. 140 shows results of one step "LAMP+Invader" assays in
detection of pmpA765.
[0354] FIG. 141 shows the results of experiments spiking the
LAMP-Invader reaction products into Invader reactions, however,
showed saturated signal generation with DNA target down to 100
copies (left panel), and agarose gel analysis confirming LAMP
amplified products starting at 100 copy-level (right panel)
[0355] FIG. 142 provides a table showing exemplary nucleic acid
sequences for LAMP primers and Invader assay oligonucleotides used
to detect Factor V, Factor II, mrsA59 and pmpA765.
DESCRIPTION OF THE INVENTION
[0356] Introduction:
[0357] The present invention relates to methods and compositions
for treating nucleic acid, and in particular, methods and
compositions for detection and characterization of nucleic acid
sequences and sequence changes.
[0358] In preferred embodiments, the present invention relates to
means for cleaving a nucleic acid cleavage structure in a
site-specific manner. While the present invention provides a
variety of cleavage agents, in some embodiments, the present
invention relates to a cleaving enzyme having 5' nuclease activity
without interfering nucleic acid synthetic ability. In other
embodiments, the present invention provides novel polymerases
(e.g., thermostable polymerases) possessing altered polymerase
and/or nucleases activities.
[0359] For example, in some embodiments, the present invention
provides 5' nucleases derived from thermostable DNA polymerases
that exhibit altered DNA synthetic activity from that of native
thermostable DNA polymerases. The 5' nuclease activity of the
polymerase is retained while the synthetic activity is reduced or
absent. Such 5' nucleases are capable of catalyzing the
structure-specific cleavage of nucleic acids in the absence of
interfering synthetic activity. The lack of synthetic activity
during a cleavage reaction results in nucleic acid cleavage
products of uniform size.
[0360] The novel properties of the nucleases of the invention form
the basis of a method of detecting specific nucleic acid sequences.
This method relies upon the amplification of the detection molecule
rather than upon the amplification of the target sequence itself as
do existing methods of detecting specific target sequences.
[0361] DNA polymerases (DNAPs), such as those isolated from E. coli
or from thermophilic bacteria of the genus Thermus as well as other
organisms, are enzymes that synthesize new DNA strands. Several of
the known DNAPs contain associated nuclease activities in addition
to the synthetic activity of the enzyme.
[0362] Some DNAPs are known to remove nucleotides from the 5' and
3' ends of DNA chains (Kornberg, DNA Replication, W.H. Freeman and
Co., San Francisco, pp. 127-139 [1980]). These nuclease activities
are usually referred to as 5' exonuclease and 3' exonuclease
activities, respectively. For example, the 5' exonuclease activity
located in the N-terminal domain of several DNAPs participates in
the removal of RNA primers during lagging strand synthesis during
DNA replication and the removal of damaged nucleotides during
repair. Some DNAPs, such as the E. coli DNA polymerase (DNAPEcl),
also have a 3' exonuclease activity responsible for proof-reading
during DNA synthesis (Kornberg, supra).
[0363] A DNAP isolated from Thermus aquaticus, termed Taq DNA
polymerase (DNAPTaq), has a 5' exonuclease activity, but lacks a
functional 3' exonucleolytic domain (Tindall and Kunkell, Biochem.,
27:6008 [1988]). Derivatives of DNAPEcl and DNAPTaq, respectively
called the Klenow and Stoffel fragments, lack 5' exonuclease
domains as a result of enzymatic or genetic manipulations (Brutlag
et al., Biochem. Biophys. Res. Commun., 37:982 [1969]; Erlich et
al., Science 252:1643 [1991]; Setlow and Kornberg, J. Biol. Chem.,
247:232 [1972]).
[0364] The 5' exonuclease activity of DNAPTaq was reported to
require concurrent synthesis (Gelfand, PCR Technology--Principles
and Applications for DNA Amplification, H. A. Erlich, [Ed.],
Stockton Press, New York, p. 19 [1989]). Although mononucleotides
predominate among the digestion products of the 5' exonucleases of
DNAPTaq and DNAPEcl, short oligonucleotides (<12 nucleotides)
can also be observed implying that these so-called 5' exonucleases
can function endonucleolytically (Setlow, supra; Holland et al.,
Proc. Natl. Acad. Sci. USA 88:7276 [1991]).
[0365] In WO 92/06200, Gelfand et al. show that the preferred
substrate of the 5' exonuclease activity of the thermostable DNA
polymerases is displaced single-stranded DNA. Hydrolysis of the
phosphodiester bond occurs between the displaced single-stranded
DNA and the double-helical DNA with the preferred exonuclease
cleavage site being a phosphodiester bond in the double helical
region. Thus, the 5' exonuclease activity usually associated with
DNAPs is a structure-dependent single-stranded endonuclease and is
more properly referred to as a 5' nuclease. Exonucleases are
enzymes that cleave nucleotide molecules from the ends of the
nucleic acid molecule. Endonucleases, on the other hand, are
enzymes that cleave the nucleic acid molecule at internal rather
than terminal sites. The nuclease activity associated with some
thermostable DNA polymerases cleaves endonucleolytically but this
cleavage requires contact with the 5' end of the molecule being
cleaved. Therefore, these nucleases are referred to as 5'
nucleases.
[0366] When a 5' nuclease activity is associated with a eubacterial
Type A DNA polymerase, it is found in the one third N-terminal
region of the protein as an independent functional domain. The
C-terminal two-thirds of the molecule constitute the polymerization
domain that is responsible for the synthesis of DNA. Some Type A
DNA polymerases also have a 3' exonuclease activity associated with
the two-third C-terminal region of the molecule.
[0367] The 5' exonuclease activity and the polymerization activity
of DNAPs can be separated by proteolytic cleavage or genetic
manipulation of the polymerase molecule. The Klenow or large
proteolytic cleavage fragment of DNAPEcl contains the polymerase
and 3' exonuclease activity but lacks the 5' nuclease activity. The
Stoffel fragment of DNAPTaq (DNAPStf) lacks the 5' nuclease
activity due to a genetic manipulation that deleted the N-terminal
289 amino acids of the polymerase molecule (Erlich et al., Science
252:1643 [1991]). WO 92/06200 describes a thermostable DNAP with an
altered level of 5' to 3' exonuclease. U.S. Pat. No. 5,108,892
describes a Thermus aquaticus DNAP without a 5' to 3' exonuclease.
Thermostable DNA polymerases with lessened amounts of synthetic
activity are available (Third Wave Technologies, Madison, Wis.) and
are described in U.S. Pat. Nos. 5,541,311, 5,614,402, 5,795,763,
5,691,142, and 5,837,450, herein incorporated by reference in their
entireties.
[0368] The present invention provides 5' nucleases derived from
thermostable Type A DNA polymerases that retain 5' nuclease
activity but have reduced or absent synthetic activity. The ability
to uncouple the synthetic activity of the enzyme from the 5'
nuclease activity proves that the 5' nuclease activity does not
require concurrent DNA synthesis as was previously reported
(Gelfand, PCR Technology, supra).
[0369] In addition to the 5'-exonuclease domains of the DNA
polymerase I proteins of Eubacteria, described above, 5' nucleases
have been found associated with bacteriophage, eukaryotes and
archaebacteria. Overall, all of the enzymes in this family display
very similar substrate specificities, despite their limited level
of sequence similarity. Consequently, enzymes suitable for use in
the methods of the present invention may be isolated or derived
from a wide array of sources.
[0370] A mammalian enzyme with functional similarity to the
5'-exonuclease domain of E. coli Pol I was isolated nearly 30 years
ago (Lindahl, et al., Proc Natl Acad Sci USA 62(2): 597-603
[1969]). Later, additional members of this group of enzymes called
flap endonucleases (FEN1) from Eukarya and Archaea were shown to
possess a nearly identical structure specific activity (Harrington
and Lieber. Embo J 13(5), 1235-46 [1994]; Murante et al., J Biol
Chem 269(2), 1191-6 [1994]; Robins, et al., J Biol Chem 269(46),
28535-8 [1994]; Hosfield, et al., J. Biol Chem 273(42), 27154-61
[1998]), despite limited sequence similarity. The substrate
specificities of the FEN1 enzymes, and the eubacterial and related
bacteriophage enzymes have been examined and found to be similar
for all enzymes (Lyamichev, et al., Science 260(5109), 778-83
[1993], Harrington and Lieber, supra, Murante, et al., supra,
Hosfield, et al, supra, Rao, et al., J Bacteriol 180(20), 5406-12
[1998], Bhagwat, et al., J. Biol Chem 272(45), 28523-30 [1997],
Garforth and Sayers, Nucleic Acids Res 25(19), 3801-7 [1997]).
[0371] Using preformed substrates, many of the studies cited above
determined that these nucleases leave a gap upon cleavage, leading
the authors to speculate that DNA polymerase must then act to fill
in that gap to generate a ligatable nick. A number of other 5'
nucleases have been shown to leave a gap or overlap after cleavage
of the same or similar flap substrates. It has since been
determined that that all the structure-specific 5'-exonucleases
leave a nick after cleavage if the substrate has an overlap between
the upstream and downstream duplexes (Kaiser et al, J. Biol. Chem.
274(30):21387-21394 [1999]). While duplexes having several bases of
overlapping sequence can assume several different conformations
through branch migration, it was determined that cleavage occurs in
the conformation where the last nucleotide at the 3' end of the
upstream strand is unpaired, with the cleavage rate being
essentially the same whether the end of the upstream primer is A,
C, G, or T. It was determined to be positional overlap between the
3' end of the upstream primer and downstream duplex, rather then
sequence overlap, that is required for optimal cleavage. In
addition to allowing these enzymes to leave a nick after cleavage,
the single base of overlap causes the enzymes to cleave several
orders of magnitude faster than when a substrate lacks overlap
(Kaiser et al., supra).
[0372] Any of the 5' nucleases described above may find application
in one or more embodiments of the methods described herein. FEN1
nucleases of particular utility in the methods of present invention
include but are not limited to those of Methanococcus jannaschi and
Methanobacterium thermoautotrophicum; particularly preferred FEN1
enzymes are from Archaeoglobus fulgidus, Pyrococcus furiosus and
Archaeoglobus veneficus.
The detailed description of the invention is presented in the
following sections: [0373] I. Detection of Specific Nucleic Acid
Sequences Using 5' Nucleases in an INVADER Directed Cleavage Assay;
[0374] II. Effect of ARRESTOR Oligonucleotides on Signal and
Background in Sequential Invasive Cleavage Reactions. [0375] III.
Signal Enhancement By Incorporating The Products Of An Invasive
Cleavage Reaction Into A Subsequent Invasive Cleavage Reaction;
[0376] IV. Fractionation Of Specific Nucleic Acids By Selective
Charge Reversal; [0377] V. Signal Enhancement By Tailing Of
Reaction Products In The INVADER oligonucleotide-directed Cleavage
Assay; [0378] VI. Signal Enhancement By Completion Of An Activated
Protein Binding Site; [0379] VII. Generation of 5' Nucleases
Derived From Thermostable DNA Polymerases; [0380] VIII. Improved
Enzymes For Use In INVADER oligonucleotide-directed Cleavage
Reactions; [0381] IX. The INVADER assay for direct detection and
measurement of specific analytes.
I. Detection of Specific Nucleic Acid Sequences Using 5' Nucleases
in an INVADER Directed Cleavage Assay
[0382] 1. INVADER Assay Reaction Design
[0383] The present invention provides means for forming a nucleic
acid cleavage structure that is dependent upon the presence of a
target nucleic acid and cleaving the nucleic acid cleavage
structure so as to release distinctive cleavage products. 5'
nuclease activity, for example, is used to cleave the
target-dependent cleavage structure and the resulting cleavage
products are indicative of the presence of specific target nucleic
acid sequences in the sample. When two strands of nucleic acid, or
oligonucleotides, both hybridize to a target nucleic acid strand
such that they form an overlapping invasive cleavage structure, as
described below, invasive cleavage can occur. Through the
interaction of a cleavage agent (e.g., a 5' nuclease) and the
upstream oligonucleotide, the cleavage agent can be made to cleave
the downstream oligonucleotide at an internal site in such a way
that a distinctive fragment is produced. Such embodiments have been
termed the INVADER assay (Third Wave Technologies) and are
described in U.S. Pat. Nos. 5,846,717, 5,985,557, 5,994,069,
6,001,567, and 6,090,543, U.S. patent application Ser. No.
09/713,601, and PCT Publications WO 97/27214 and WO 98/42873,
herein incorporated by reference in their entireties.
[0384] The present invention further provides assays in which the
target nucleic acid is reused or recycled during multiple rounds of
hybridization with oligonucleotide probes and cleavage of the
probes without the need to use temperature cycling (i.e., for
periodic denaturation of target nucleic acid strands) or nucleic
acid synthesis (i.e., for the polymerization-based displacement of
target or probe nucleic acid strands). When a cleavage reaction is
run under conditions in which the probes are continuously replaced
on the target strand (e.g. through probe-probe displacement or
through an equilibrium between probe/target association and
disassociation, or through a combination comprising these
mechanisms, [The kinetics of oligonucleotide replacement. Luis P.
Reynaldo, Alexander V. Vologodskii, Bruce P. Neri and Victor I.
Lyamichev. J. Mol. Biol. 97: 511-520 (2000)], multiple probes can
hybridize to the same target, allowing multiple cleavages, and the
generation of multiple cleavage products.
[0385] By the extent of its complementarity to a target nucleic
acid strand, an oligonucleotide may be said to define a specific
region of said target. In an invasive cleavage structure, the two
oligonucleotides define and hybridize to regions of the target that
are adjacent to one another (i.e., regions without any additional
region of the target between them). Either or both oligonucleotides
may comprise additional portions that are not complementary to the
target strand. In addition to hybridizing adjacently, in order to
form an invasive cleavage structure, the 3' end of the upstream
oligonucleotide must comprise an additional moiety. When both
oligonucleotides are hybridized to a target strand to form a
structure and such a 3' moiety is present on the upstream
oligonucleotide within the structure, the oligonucleotides may be
said to overlap, and the structure may be described as an
overlapping, or invasive cleavage structure.
[0386] In one embodiment, the 3' moiety of the invasive cleavage
structure is a single nucleotide. In this embodiment the 3' moiety
may be any nucleotide (i.e., it may be, but it need not be
complementary to the target strand). In a preferred embodiment the
3' moiety is a single nucleotide that is not complementary to the
target strand. In another embodiment, the 3' moiety is a
nucleotide-like compound (i.e., a moiety having chemical features
similar to a nucleotide, such as a nucleotide analog or an organic
ring compound; See e.g., U.S. Pat. No. 5,985,557). In yet another
embodiment the 3' moiety is one or more nucleotides that duplicate
in sequence one or more nucleotides present at the 5' end of the
hybridized region of the downstream oligonucleotide. In a further
embodiment, the duplicated sequence of nucleotides of the 3' moiety
is followed by a single nucleotide that is not further duplicative
of the downstream oligonucleotide sequence, and that may be any
other nucleotide. In yet another embodiment, the duplicated
sequence of nucleotides of the 3' moiety is followed by a
nucleotide-like compound, as described above.
[0387] The downstream oligonucleotide may have, but need not have,
additional moieties attached to either end of the region that
hybridizes to the target nucleic acid strand. In a preferred
embodiment, the downstream oligonucleotide comprises a moiety at
its 5' end (i.e., a 5' moiety). In a particularly preferred
embodiment, said 5' moiety is a 5' flap or arm comprising a
sequence of nucleotides that is not complementary to the target
nucleic acid strand.
[0388] When an overlapping cleavage structure is formed, it can be
recognized and cleaved by a nuclease that is specific for this
structure (i.e., a nuclease that will cleave one or more of the
nucleic acids in the overlapping structure based on recognition of
this structure, rather than on recognition of a nucleotide sequence
of any of the nucleic acids forming the structure). Such a nuclease
may be termed a "structure-specific nuclease". In some embodiments,
the structure-specific nuclease is a 5' nuclease. In a preferred
embodiment, the structure-specific nuclease is the 5' nuclease of a
DNA polymerase. In another preferred embodiment, the DNA polymerase
having the 5' nuclease is synthesis-deficient. In another preferred
embodiment, the 5' nuclease is a FEN-1 endonuclease. In a
particularly preferred embodiment, the 5' nuclease is
thermostable.
[0389] In some embodiments, said structure-specific nuclease
preferentially cleaves the downstream oligonucleotide. In a
preferred embodiment, the downstream oligonucleotide is cleaved one
nucleotide into the 5' end of the region that is hybridized to the
target within the overlapping structure. Cleavage of the
overlapping structure at any location by a structure-specific
nuclease produces one or more released portions or fragments of
nucleic acid, termed "cleavage products".
[0390] In some embodiments, cleavage of an overlapping structure is
performed under conditions wherein one or more of the nucleic acids
in the structure can disassociate (i.e. un-hybridize, or melt) from
the structure. In one embodiment, full or partial disassociation of
a first cleavage structure allows the target nucleic acid to
participate in the formation of one or more additional overlapping
cleavage structures. In a preferred embodiment, the first cleavage
structure is partially disassociated. In a particularly preferred
embodiment only the oligonucleotide that is cleaved disassociates
from the first cleavage structure, such that it may be replaced by
another copy of the same oligonucleotide. In some embodiments, said
disassociation is induced by an increase in temperature, such that
one or more oligonucleotides can no longer hybridize to the target
strand. In other embodiments, said disassociation occurs because
cleavage of an oligonucleotide produces only cleavage products that
cannot bind to the target strand under the conditions of the
reaction. In a preferred embodiment, conditions are selected
wherein an oligonucleotide may associate with (i.e., hybridize to)
and disassociate from a target strand regardless of cleavage, and
wherein the oligonucleotide may be cleaved when it is hybridized to
the target as part of an overlapping cleavage structure. In a
particularly preferred embodiment, conditions are selected such
that the number of copies of the oligonucleotide that can be
cleaved when part of an overlapping structure exceeds the number of
copies of the target nucleic acid strand by a sufficient amount
that when the first cleavage structure disassociates, the
probability that the target strand will associate with an intact
copy of the oligonucleotide is greater than the probability that
that it will associate with a cleaved copy of the
oligonucleotide.
[0391] In some embodiments, cleavage is performed by a
structure-specific nuclease that can recognize and cleave
structures that do not have an overlap. In a preferred embodiment,
cleavage is performed by a structure-specific nuclease having a
lower rate of cleavage of nucleic acid structures that do not
comprise an overlap, compared to the rate of cleavage of structures
comprising an overlap. In a particularly preferred embodiment,
cleavage is performed by a structure-specific nuclease having less
than 1% of the rate of cleavage of nucleic acid structures that do
not comprise an overlap, compared to the rate of cleavage of
structures comprising an overlap.
[0392] In some embodiments it is desirable to detect the cleavage
of the overlapping cleavage structure. Detection may be by analysis
of cleavage products or by analysis of one or more of the remaining
uncleaved nucleic acids. For convenience, the following discussion
will refer to the analysis of cleavage products, but it will be
appreciated by those skilled in the art that these methods may as
easily be applied to analysis of the uncleaved nucleic acids in an
invasive cleavage reaction. Any method known in the art for
analysis of nucleic acids, nucleic acid fragments or
oligonucleotides may be applied to the detection of cleavage
products.
[0393] In one embodiment, the cleavage products may be identified
by chemical content, e.g., the relative amounts of each atom, each
particular type of reactive group or each nucleotide base (Chargaff
et al., J. Biol. Chem. 177: 405 [1949]) they contain. In this way,
a cleavage product may be distinguished from a longer nucleic acid
from which it was released by cleavage, or from other nucleic
acids.
[0394] In another embodiment, the cleavage products may be
distinguished by a particular physical attribute, including but not
limited to length, mass, charge, or charge-to-mass ratio. In yet
another embodiment, the cleavage product may be distinguished by a
behavior that is related to a physical attribute, including but not
limited to rate of rotation in solution, rate of migration during
electrophoresis, coefficient of sedimentation in centrifugation,
time of flight in MALDI-TOF mass spectrometry, migration rate or
other behavior in chromatography, melting temperature from a
complementary nucleic acid, or precipitability from solution.
[0395] Detection of the cleavage products may be through release of
a label. Such labels may include, but are not limited to one or
more of any of dyes, radiolabels such as .sup.32P or .sup.35S,
binding moieties such as biotin, mass tags, such as metal ions or
chemical groups, charge tags, such as polyamines or charged dyes,
haptens such as digoxygenin, luminogenic, phosphorescent or
fluorogenic moieties, and fluorescent dyes, either alone or in
combination with moieties that can suppress or shift emission
spectra, such as by fluorescence resonance energy transfer (FRET)
or collisional fluorescence energy transfer.
[0396] In some embodiments, analysis of cleavage products may
include physical resolution or separation, for example by
electrophoresis, hybridization or by selective binding to a
support, or by mass spectrometry methods such as MALDI-TOF. In
other embodiments, the analysis may be performed without any
physical resolution or separation, such as by detection of
cleavage-induced changes in fluorescence as in FRET-based analysis,
or by cleavage-induced changes in the rotation rate of a nucleic
acid in solution as in fluorescence polarization analysis.
[0397] Cleavage products can be used subsequently in any reaction
or read-out method that can make use of oligonucleotides. Such
reactions include, but are not limited to, modification reactions,
such as ligation, tailing with a template-independent nucleic acid
polymerase and primer extension with a template-dependent nucleic
acid polymerase. The modification of the cleavage products may be
for purposes including, but not limited to, addition of one or more
labels or binding moieties, alteration of mass, addition of
specific sequences, or for any other purpose that would facilitate
analysis of either the cleavage products or analysis of any other
by-product, result or consequence of the cleavage reaction.
[0398] Analysis of the cleavage products may involve subsequent
steps or reactions that do not modify the cleavage products
themselves. For example, cleavage products may be used to complete
a functional structure, such as a competent promoter for in vitro
transcription or another protein binding site. Analysis may include
the step of using the completed structure for or to perform its
function. One or more cleavage products may also be used to
complete an overlapping cleavage structure, thereby enabling a
subsequent cleavage reaction, the products of which may be detected
or used by any of the methods described herein, including the
participation in further cleavage reactions.
[0399] Certain preferred embodiments of the invasive cleavage
reactions are provided in the following descriptions. As
exemplified by the diagram in FIG. 29, the methods of the present
invention employ at least a pair of oligonucleotides that interact
with a target nucleic acid to form a cleavage structure for a
structure-specific nuclease. In some embodiments, the cleavage
structure comprises i) a target nucleic acid that may be either
single-stranded or double-stranded (when a double-stranded target
nucleic acid is employed, it may be rendered single stranded, e.g.,
by heating); ii) a first oligonucleotide, termed the "probe," that
defines a first region of the target nucleic acid sequence by being
the complement of that region (regions X and Z of the target as
shown in FIG. 29); iii) a second oligonucleotide, termed the
"INVADER," the 5' part of which defines a second region of the same
target nucleic acid sequence (regions Y and X in FIG. 29), adjacent
to and downstream of the first target region (regions X and Z), and
the second part of which overlaps into the region defined by the
first oligonucleotide (region X depicts the region of overlap). The
resulting structure is diagrammed in FIG. 29.
[0400] While not limiting the invention or the instant discussion
to any particular mechanism of action, the diagram in FIG. 29
represents the effect on the site of cleavage caused by this type
of arrangement of a pair of oligonucleotides. The design of such a
pair of oligonucleotides is described below in detail. In FIG. 29,
the 3' ends of the nucleic acids (i.e., the target and the
oligonucleotides) are indicated by the use of the arrowheads on the
ends of the lines depicting the strands of the nucleic acids (and
where space permits, these ends are also labeled "3''"). It is
readily appreciated that the two oligonucleotides (the INVADER and
the probe) are arranged in a parallel orientation relative to one
another, while the target nucleic acid strand is arranged in an
anti-parallel orientation relative to the two oligonucleotides.
Further, it is clear that the INVADER oligonucleotide is located
upstream of the probe oligonucleotide and that with respect to the
target nucleic acid strand, region Z is upstream of region X and
region X is upstream of region Y (that is, region Y is downstream
of region X and region X is downstream of region Z). Regions of
complementarity between the opposing strands are indicated by the
short vertical lines. While not intended to indicate the precise
location of the site(s) of cleavage, the area to which the site of
cleavage within the probe oligonucleotide is shifted by the
presence of the INVADER oligonucleotide in this embodiment is
indicated by the solid vertical arrowhead. An alternative
representation of the target/INVADER/probe cleavage structure is
shown in FIG. 32c. Neither diagram (i.e., FIG. 29 or FIG. 32c) is
intended to represent the actual mechanism of action or physical
arrangement of the cleavage structure and further it is not
intended that the method of the present invention be limited to any
particular mechanism of action.
[0401] It can be considered that the binding of these
oligonucleotides in this embodiment divides the target nucleic acid
into three distinct regions: one region that has complementarity to
only the probe (shown as "Z"); one region that has complementarity
only to the INVADER oligonucleotide (shown as "Y"); and one region
that has complementarity to both oligonucleotides (shown as "X").
As discussed above, in some preferred embodiments of the present
invention, the overlap may comprise moieties other than overlapping
complementary bases. Thus, in some embodiments, the region shown as
"X" can represent a region where there is a physical, but not
sequence, overlap between the INVADER and probe oligonucleotides,
i.e., in these latter embodiments, there is not a region of the
target nucleic acid between regions "Z" and "Y" that has
complementarity to both oligonucleotides.
[0402] a) Oligonucleotide Design
[0403] Design of these oligonucleotides (i.e., the INVADER
oligonucleotide and the probe) is accomplished using practices that
are standard in the art. For example, sequences that have self
complementarity, such that the resulting oligonucleotides would
either fold upon themselves, or hybridize to each other at the
expense of binding to the target nucleic acid, are generally
avoided.
[0404] One consideration in choosing a length for these
oligonucleotides is the complexity of the sample containing the
target nucleic acid. For example, the human genome is approximately
3.times.10.sup.9 basepairs in length. Any 10-nucleotide sequence
will appear with a frequency of 1:4.sup.10, or 1:1048,576 in a
random string of nucleotides, which would be approximately 2,861
times in 3 billion basepairs. Clearly, an oligonucleotide of this
length would have a poor chance of binding uniquely to a 10
nucleotide region within a target having a sequence the size of the
human genome. If the target sequence were within a 3 kb plasmid,
however, such an oligonucleotide might have a very reasonable
chance of binding uniquely. By this same calculation it can be seen
that an oligonucleotide of 16 nucleotides (i.e., a 16-mer) is the
minimum length of a sequence that is mathematically likely to
appear once in 3.times.10.sup.9 basepairs. This level of
specificity may also be provided by two or more shorter
oligonucleotides if they are configured to bind in a cooperative
fashion (i.e., such that they can produce the intended complex only
if both or all are bound to their intended target sequences),
wherein the combination of the short oligonucleotides provides the
desired specificity. In one such embodiment, the cooperativity
between the shorter oligonucleotides is by a coaxial stacking
effect that can occur when the oligonucleotides hybridize to
adjacent sites on a target nucleic acid. In another embodiment, the
shorter oligonucleotides are connected to one another, either
directly, or by one or more spacer regions. The short
oligonucleotides thus connected may bind to distal regions of the
target and may be used to bridge across regions of secondary
structure in a target. Examples of such bridging oligonucleotides
are described in PCT Publication WO 98/50403, herein incorporated
by reference in its entirety.
[0405] A second consideration in choosing oligonucleotide length is
the temperature range in which the oligonucleotides will be
expected to function. A 16-mer of average base content (50% G-C
bases) will have a calculated T.sub.m of about 41.degree. C.,
depending on, among other things, the concentration of the
oligonucleotide and its target, the salt content of the reaction
and the precise order of the nucleotides. As a practical matter,
longer oligonucleotides are usually chosen to enhance the
specificity of hybridization. Oligonucleotides 20 to 25 nucleotides
in length are often used, as they are highly likely to be specific
if used in reactions conducted at temperatures which are near their
T.sub.ms (within about 5.degree. C. of the T.sub.m). In addition,
with calculated T.sub.ms in the range of 50 to 70.degree. C., such
oligonucleotides (i.e., 20 to 25-mers) are appropriately used in
reactions catalyzed by thermostable enzymes, which often display
optimal activity near this temperature range.
[0406] The maximum length of the oligonucleotide chosen is also
based on the desired specificity. One must avoid choosing sequences
that are so long that they are either at a high risk of binding
stably to partial complements, or that they cannot easily be
dislodged when desired (e.g., failure to disassociate from the
target once cleavage has occurred or failure to disassociate at a
reaction temperature suitable for the enzymes and other materials
in the reaction).
[0407] The first step of design and selection of the
oligonucleotides for the INVADER oligonucleotide-directed cleavage
is in accordance with these sample general principles. Considered
as sequence-specific probes individually, each oligonucleotide may
be selected according to the guidelines listed above. That is to
say, each oligonucleotide will generally be long enough to be
reasonably expected to hybridize only to the intended target
sequence within a complex sample, usually in the 20 to 40
nucleotide range. Alternatively, because the INVADER
oligonucleotide-directed cleavage assay depends upon the concerted
action of these oligonucleotides, the composite length of the 2
oligonucleotides which span/bind to the X, Y, Z regions may be
selected to fall within this range, with each of the individual
oligonucleotides being in approximately the 13 to 17 nucleotide
range. Such a design might be employed if a non-thermostable
cleavage means were employed in the reaction, requiring the
reactions to be conducted at a lower temperature than that used
when thermostable cleavage means are employed. In some embodiments,
it may be desirable to have these oligonucleotides bind multiple
times within a single target nucleic acid (e.g., to bind to
multiple variants or multiple similar sequences within a target).
It is not intended that the method of the present invention be
limited to any particular size of the probe or INVADER
oligonucleotide.
[0408] The second step of designing an oligonucleotide pair for
this assay is to choose the degree to which the upstream "INVADER"
oligonucleotide sequence will overlap into the downstream "probe"
oligonucleotide sequence, and consequently, the sizes into which
the probe will be cleaved. A key feature of this assay is that the
probe oligonucleotide can be made to "turn over," that is to say
probe can be made to depart to allow the binding and cleavage of
other copies of the probe molecule, without the requirements of
thermal denaturation or displacement by polymerization. While in
one embodiment of this assay probe turnover may be facilitated by
an exonucleolytic digestion by the cleavage agent, it is central to
the present invention that the turnover does not require this
exonucleolytic activity. For example, in some embodiments, a
reaction temperature and reaction conditions are selected so as to
create an equilibrium wherein the probe hybridizes and
disassociates from the target. In other embodiments, temperature
and reaction conditions are selected so that unbound probe can
initiate binding to the target strand and physically displace bound
probe. In still other embodiments, temperature and reaction
conditions are selected such that either or both mechanisms of
probe replacement may occur in any proportion. The method of the
present invention is not limited to any particular mechanism of
probe replacement. By any mechanism, when the probe is bound to the
target to form a cleavage structure, cleavage can occur. The
continuous cycling of the probe on and off of the target allows
multiple probes to bind and be cleaved for each copy of a target
nucleic acid.
[0409] i) Choosing the Amount of Sequence Overlap
[0410] One way of accomplishing such turnover, where the INVADER
oligonucleotide and probe oligonucleotide share a region of
complementarity, can be envisioned by considering the diagram in
FIG. 29. It can be seen that the T.sub.m of each oligonucleotide
will be a function of the full length of that oligonucleotide:
i.e., the T.sub.m of the INVADER oligonucleotide=T.sub.m(Y+X), and
the T.sub.m of the probe=T.sub.m(X+Y) for the probe. When the probe
is cleaved the X region is released, leaving the Z section. If the
T.sub.m of Z is less than the reaction temperature, and the
reaction temperature is less than the T.sub.m(X+Z), then cleavage
of the probe will lead to the departure of Z, thus allowing a new
(X+Z) to hybridize. It can be seen from this example that the X
region must be sufficiently long that the release of X will drop
the T.sub.m of the remaining probe section below the reaction
temperature: a G-C rich X section may be much shorter than an A-T
rich X section and still accomplish this stability shift.
[0411] In other embodiments described herein, probe turn over is
not related to a change in T.sub.m caused by cleavage of the probe,
but rather is related to the association and disassociation
behavior of the probe in the selected conditions, regardless of
cleavage. Thus, it is not intended that the present invention be
limited to the use of probes that, upon cleavage, yield products
having a T.sub.ms below the reaction temperature, as described
above.
[0412] ii) Non-Sequence Overlaps
[0413] It has been determined that the relationship between the 3'
end of the upstream oligonucleotide and the desired site of
cleavage on the probe should be carefully designed. It is known
that the preferred site of cleavage for the types of
structure-specific endonucleases employed herein is one basepair
into a duplex (Lyamichev et al., supra). It was previously believed
that the presence of an upstream oligonucleotide or primer allowed
the cleavage site to be shifted away from this preferred site, into
the single stranded region of the 5' arm (Lyamichev et al., supra
and U.S. Pat. No. 5,422,253). In contrast to this previously
proposed mechanism, and while not limiting the present invention to
any particular mechanism, it is believed that the nucleotide
immediately 5', or upstream of the cleavage site on the probe
(including miniprobe and mid-range probes) should be able to
basepair with the target for efficient cleavage to occur. In the
case of the present invention, this would be the nucleotide in the
probe sequence immediately upstream of the intended cleavage site.
In addition, as described herein, it has been observed that in
order to direct cleavage to that same site in the probe, the
upstream oligonucleotide should have its 3' base (i.e., nt)
immediately upstream of the intended cleavage site of the probe. In
embodiments where the INVADER and probe oligonucleotides share a
sequence overlap, this places the 3' terminal nucleotide of the
upstream oligonucleotide and the base of the probe oligonucleotide
5' of the cleavage site in competition for pairing with the
corresponding nucleotide of the target strand.
[0414] To examine the outcome of this competition (i.e. which base
is paired during a successful cleavage event), substitutions were
made in the probe and INVADER oligonucleotides such that either the
probe or the INVADER oligonucleotide were mismatched with the
target sequence at this position. The effects of both arrangements
on the rates of cleavage were examined. When the INVADER
oligonucleotide is unpaired at the 3' end, the rate of cleavage was
not reduced. If this base was removed, however, the cleavage site
was shifted upstream of the intended site. In contrast, if the
probe oligonucleotide was not base-paired to the target just
upstream of the site to which the INVADER oligonucleotide was
directing cleavage, the rate of cleavage was dramatically reduced,
suggesting that when a competition exists, the probe
oligonucleotide was the molecule to be base-paired in this
position.
[0415] It appears that the 3' end of the upstream INVADER
oligonucleotide is unpaired during cleavage, and yet is important
for accurate positioning of the cleavage. To examine which part(s)
of the 3' terminal nucleotide are required for the positioning of
cleavage, INVADER oligonucleotides were designed that terminated on
this end with nucleotides that were altered in a variety of ways.
Sugars examined included 2' deoxyribose with a 3' phosphate group,
a dideoxyribose, 3' deoxyribose, 2' O-methyl ribose, arabinose and
arabinose with a 3' phosphate. Abasic ribose, with and without 3'
phosphate were tested. Synthetic "universal" bases such at
3-nitropyrrole and 5-3 nitroindole on ribose sugars were tested.
Finally, a base-like aromatic ring structure, acridine, linked to
the 3' end the previous nucleotide without a sugar group was
tested. The results obtained support the conclusion that the
aromatic ring of the base (at the 3' end of the INVADER
oligonuceotide) is an important moiety for accomplishing the
direction of cleavage to the desired site within the downstream
probe. The 3' terminal moiety of the INVADER oligonucleotide need
not be a base that is complementary to the target nucleic acid.
[0416] iii) Miniprobes and Mid-Range Probes;
[0417] As discussed above, the INVADER oligonucleotide-directed
cleavage assay may be performed using INVADER and probe
oligonucleotides that have a length of about 13-25 nucleotides
(typically 20-25 nucleotides). It is also contemplated that the
oligonucleotides may themselves be composed of shorter
oligonucleotide sequences that align along a target strand but that
are not covalently linked. This is to say that there is a nick in
the sugar-phosphate backbone of the composite oligonucleotide, but
that there is no disruption in the progression of base-paired
nucleotides in the resulting duplex. When short strands of nucleic
acid align contiguously along a longer strand the hybridization of
each is stabilized by the hybridization of the neighboring
fragments because the basepairs can stack along the helix as though
the backbone was in fact uninterrupted. This cooperativity of
binding can give each segment a stability of interaction in excess
of what would be expected for the segment hybridizing to the longer
nucleic acid alone. One application of this observation has been to
assemble primers for DNA sequencing, typically about 18 nucleotides
long, from sets of three hexamer oligonucleotides that are designed
to hybridize in this way (Kotler et al. Proc. Natl. Acad. Sci. USA
90:4241 [1993]). The resulting doubly-nicked primer can be extended
enzymatically in reactions performed at temperatures that might be
expected to disrupt the hybridization of hexamers, but not of
18-mers.
[0418] The use of composite or split oligonucleotides is applied
with success in the INVADER-directed cleavage assay. For example,
the probe oligonucleotide may be split into two oligonucleotides
that anneal in a contiguous and adjacent manner along a target
oligonucleotide as diagrammed in FIG. 57. In this Figure, the
downstream oligonucleotide (analogous to the probe of FIG. 25) is
assembled from two smaller pieces: a short segment of 6-10 nts
(termed the "miniprobe"), that is to be cleaved in the course of
the detection reaction, and an oligonucleotide that hybridizes
immediately downstream of the miniprobe (termed the "stacker"),
that serves to stabilize the hybridization of the probe. To form
the cleavage structure, an upstream oligonucleotide (the INVADER
oligonucleotide) is provided to direct the cleavage activity to the
desired region of the miniprobe. Assembly of the probe from
non-linked pieces of nucleic acid (i.e., the miniprobe and the
stacker) allows regions of sequences to be changed without
requiring the re-synthesis of the entire proven sequence, thus
improving the cost and flexibility of the detection system. In
addition, the use of unlinked composite oligonucleotides makes the
system more stringent in its requirement of perfectly matched
hybridization to achieve signal generation, allowing this to be
used as a sensitive means of detecting mutations or changes in the
target nucleic acid sequences.
[0419] As illustrated in FIG. 57, in one embodiment, the methods of
the present invention employ at least three oligonucleotides that
interact with a target nucleic acid to form a cleavage structure
for a structure-specific nuclease. More specifically, the cleavage
structure comprises i) a target nucleic acid that may be either
single-stranded or double-stranded (when a double-stranded target
nucleic acid is employed, it may be rendered single-stranded, e.g.,
by heating); ii) a first oligonucleotide, termed the "stacker,"
that defines a first region of the target nucleic acid sequence by
being the complement of that region (region W of the target as
shown in FIG. 57); iii) a second oligonucleotide, termed the
"miniprobe," that defines a second region of the target nucleic
acid sequence by being the complement of that region (regions X and
Z of the target as shown in FIG. 57); iv) a third oligonucleotide,
termed the "INVADER," the 5' part of which defines a third region
of the same target nucleic acid sequence (regions Y and X in FIG.
57), adjacent to and downstream of the second target region
(regions X and Z), and the second or 3' part of which overlaps into
the region defined by the second oligonucleotide (region X depicts
the region of overlap). The resulting structure is diagrammed in
FIG. 57. As described above for embodiments that do not employ a
stacker, the region shown as "X" can represent a region where there
is a physical, but not sequence, overlap between the INVADER and
probe oligonucleotides.
[0420] While not limiting the invention or the instant discussion
to any particular mechanism of action, the diagram in FIG. 57
represents the effect on the site of cleavage caused by this type
of arrangement of three oligonucleotides. The design of these three
oligonucleotides is described below in detail. In FIG. 57, the 3'
ends of the nucleic acids (i.e., the target and the
oligonucleotides) are indicated by the use of the arrowheads on the
ends of the lines depicting the strands of the nucleic acids (and
where space permits, these ends are also labeled "3'"). It is
readily appreciated that the three oligonucleotides (the INVADER,
the miniprobe and the stacker) are arranged in a parallel
orientation relative to one another, while the target nucleic acid
strand is arranged in an anti-parallel orientation relative to the
three oligonucleotides. Further it is clear that the INVADER
oligonucleotide is located upstream of the miniprobe
oligonucleotide and that the miniprobe olignuceotide is located
upstream of the stacker oligonucleotide and that with respect to
the target nucleic acid strand, region W is upstream of region Z,
region Z is upstream of upstream of region X and region X is
upstream of region Y (that is region Y is downstream of region X,
region X is downstream of region Z and region Z is downstream of
region W). Regions of complementarity between the opposing strands
are indicated by the short vertical lines. While not intended to
indicate the precise location of the site(s) of cleavage, the area
to which the site of cleavage within the miniprobe oligonucleotide
is shifted by the presence of the INVADER oligonucleotide is
indicated by the solid vertical arrowhead. FIG. 57 is not intended
to represent the actual mechanism of action or physical arrangement
of the cleavage structure and further it is not intended that the
method of the present invention be limited to any particular
mechanism of action.
[0421] It can be considered that the binding of these
oligonucleotides divides the target nucleic acid into four distinct
regions: one region that has complementarity to only the stacker
(shown as "W"); one region that has complementarity to only the
miniprobe (shown as "Z"); one region that has complementarity only
to the INVADER oligonucleotide (shown as "Y"); and one region that
has complementarity to both the INVADER and miniprobe
oligonucleotides (shown as "X"). As discussed above, the INVADER
oligonucleotide may also be employed such that a physical overlap
rather than a sequence overlap with the probe is provided.
[0422] In addition to the benefits cited above, the use of a
composite design for the oligonucleotides that form the cleavage
structure allows more latitude in the design of the reaction
conditions for performing the INVADER-directed cleavage assay. When
a longer probe (e.g., 16-25 nt), as described above, is used for
detection in reactions that are performed at temperatures below the
T.sub.m of that probe, the cleavage of the probe may play a
significant role in destabilizing the duplex of which it is a part,
thus allowing turnover and reuse of the recognition site on the
target nucleic acid. In contrast, reaction temperatures that are at
or above the T.sub.m of the probe mean that the probe molecules are
hybridizing and releasing from the target quite rapidly even
without cleavage of the probe. When an upstream INVADER
oligonucleotide and a cleavage means are provided the probe will be
specifically cleaved, but the cleavage will not be necessary to the
turnover of the probe. When a long probe (e.g., 16-25 nt) is used
in this way the temperatures required to achieve this state is
high, around 65 to 70.degree. C. for a 25-mer of average base
composition. Requiring the use of such elevated temperatures limits
the choice of cleavage agents to those that are very thermostable,
and may contribute to background in the reactions, depending of the
means of detection, through thermal degradation of the probe
oligonucleotides. With miniprobes, this latter mechanism of probe
replacement may be accomplished at a lower temperature. Thus,
shorter probes are preferred for embodiments using lower reaction
temperatures.
[0423] The miniprobe of the present invention may vary in size
depending on the desired application. In one embodiment, the probe
may be relatively short compared to a standard probe (e.g., 16-25
nt), in the range of 6 to 10 nucleotides. When such a short probe
is used, reaction conditions can be chosen that prevent
hybridization of the miniprobe in the absence of the stacker
oligonucleotide. In this way a short probe can be made to assume
the statistical specificity and selectivity of a longer sequence.
In the event of a perturbation in the cooperative binding of the
miniprobe and stacker nucleic acids, as might be caused by a
mismatch within the short sequence that is otherwise complementary
to the target nucleic acid or at the junction between the
contiguous duplexes, this cooperativity can be lost, dramatically
reducing the stability of the shorter duplex (i.e., that of the
miniprobe), and thus reducing the level of cleaved product in the
assay of the present invention.
[0424] It is also contemplated that probes of intermediate size may
be used. Such probes, in the 11 to 15 nucleotide range, may blend
some of the features associated with the longer probes as
originally described, these features including the ability to
hybridize and be cleaved absent the help of a stacker
oligonucleotide. At temperatures below the expected T.sub.m of such
probes, the mechanisms of turnover may be as discussed above for
probes in the 20 nt range, and be dependent on the removal of the
sequence in the `X` region for destabilization and cycling.
[0425] The mid-range probes may also be used at elevated
temperatures, at or above their expected T.sub.m, to allow melting
rather than cleavage to promote probe turnover. In contrast to the
longer probes described above, however, the temperatures required
to allow the use of such a thermally driven turnover are much lower
(about 40 to 60.degree. C.), thus preserving both the cleavage
means and the nucleic acids in the reaction from thermal
degradation. In this way, the mid-range probes may perform in some
instances like the miniprobes described above. In a further
similarity to the miniprobes, the accumulation of cleavage signal
from a mid-range probe may be helped under some reaction conditions
by the presence of a stacker.
[0426] To summarize, a standard long probe usually does not benefit
from the presence of a stacker oligonucleotide downstream (the
exception being cases where such an oligonucleotide may also
disrupt structures in the target nucleic acid that interfere with
the probe binding), and it may be used in conditions requiring
several nucleotides to be removed to allow the oligonucleotide to
release from the target efficiently. If temperature of the reaction
is used to drive exchange of the probes, standard probes may
require use of a temperature at which nucleic acids and enzymes are
at higher risk of thermal degradation.
[0427] The miniprobe is very short and performs optimally in the
presence of a downstream stacker oligonucleotide. The miniprobes
are well suited to reactions conditions that use the temperature of
the reaction to drive rapid exchange of the probes on the target
regardless of whether any bases have been cleaved. In reactions
with sufficient amount of the cleavage means, the probes that do
bind will be rapidly cleaved before they melt off.
[0428] The mid-range or midiprobe combines features of these probes
and can be used in reactions like those favored by long probes,
with longer regions of overlap ("X" regions) to drive probe
turnover at lower temperature. In a preferred embodiment, the
midrange probes are used at temperatures sufficiently high that the
probes are hybridizing to the target and releasing rapidly
regardless of cleavage. The mid-range probe may have enhanced
performance in the presence of a stacker under some
circumstances.
[0429] The distinctions between the mini-, midi- (i.e., mid-range)
and long probes are not contemplated to be inflexible and based
only on length. The performance of any given probe may vary with
its specific sequence, the choice of solution conditions, the
choice of temperature and the selected cleavage means.
[0430] It is shown in Example 17 that the assemblage of
oligonucleotides that comprises the cleavage structure of the
present invention is sensitive to mismatches between the probe and
the target. The site of the mismatch used in Ex. 17 provides one
example and is not intended to be a limitation in location of a
mismatch affecting cleavage. It is also contemplated that a
mismatch between the INVADER oligonucleotide and the target may be
used to distinguish related target sequences. In the
3-oligonucleotide system, comprising an INVADER, a probe and a
stacker oligonucleotide, it is contemplated that mismatches may be
located within any of the regions of duplex formed between these
oligonucleotides and the target sequence. In a preferred
embodiment, a mismatch to be detected is located in the probe. In a
particularly preferred embodiment, the mismatch is in the probe, at
the basepair immediately upstream (i.e., 5') of the site that is
cleaved when the probe is not mismatched to the target.
[0431] In another preferred embodiment, a mismatch to be detected
is located within the region `Z` defined by the hybridization of a
miniprobe. In a particularly preferred embodiment, the mismatch is
in the miniprobe, at the basepair immediately upstream (i.e., 5')
of the site that is cleaved when the miniprobe is not mismatched to
the target.
[0432] b) Design of the Reaction Conditions
[0433] Target nucleic acids that may be analyzed using the methods
of the present invention that employ a 5' nuclease or other
appropriate cleavage agents include both RNA and DNA. Such nucleic
acids may be obtained using standard molecular biological
techniques. For example, nucleic acids (RNA or DNA) may be isolated
from a tissue sample (e.g., a biopsy specimen), tissue culture
cells, samples containing bacteria and/or viruses (including
cultures of bacteria and/or viruses), etc. The target nucleic acid
may also be transcribed in vitro from a DNA template or may be
chemically synthesized or amplified in by polymerase chain
reaction. Furthermore, nucleic acids may be isolated from an
organism, either as genomic material or as a plasmid or similar
extrachromosomal DNA, or they may be a fragment of such material
generated by treatment with a restriction endonuclease or other
cleavage agent, or a shearing force, or it may be synthetic.
[0434] Assembly of the target, probe, and INVADER oligonucleotide
nucleic acids into the cleavage reaction of the present invention
uses principles commonly used in the design of
oligonucleotide-based enzymatic assays, such as dideoxynucleotide
sequencing and polymerase chain reaction (PCR). As is done in these
assays, the oligonucleotides are provided in sufficient excess that
the rate of hybridization to the target nucleic acid is very rapid.
These assays are commonly performed with 50 fmoles to 2 pmoles of
each oligonucleotide per microliter of reaction mixture, although
they are not necessarily limited to this range In the Examples
described herein, amounts of oligonucleotides ranging from 250
fmoles to 5 pmoles per microliter of reaction volume were used.
These values were chosen for the purpose of ease in demonstration
and are not intended to limit the performance of the present
invention to these concentrations. Other (e.g., lower)
oligonucleotide concentrations commonly used in other molecular
biological reactions are also contemplated.
[0435] It is desirable that an INVADER oligonucleotide be
immediately available to direct the cleavage of each probe
oligonucleotide that hybridizes to a target nucleic acid. In some
embodiments described herein, the INVADER oligonucleotide is
provided in excess over the probe oligonucleotide. While this is an
effective means of making the INVADER oligonucleotide immediately
available in such embodiments it is not intended that the practice
of the present invention be limited to conditions wherein the
INVADER oligonucleotide is in excess over the probe, or to any
particular ratio of INVADER-to-probe (e.g., in some preferred
embodiments described herein, the probe is provided in excess over
the INVADER oligonucleotide). Another means of assuring the
presence of an INVADER oligonucleotide whenever a probe binds to a
target nucleic acid is to design the INVADER oligonucleotide to
hybridize more stably to the target, i.e., to have a higher T.sub.m
than the probe. This can be accomplished by any of the means of
increasing nucleic acid duplex stability discussed herein (e.g., by
increasing the amount of complementarity to the target nucleic
acid).
[0436] Buffer conditions should be chosen that will be compatible
with both the oligonucleotide/target hybridization and with the
activity of the cleavage agent. The optimal buffer conditions for
nucleic acid modification enzymes, and particularly DNA
modification enzymes, generally included enough mono- and di-valent
salts to allow association of nucleic acid strands by base-pairing.
If the method of the present invention is performed using an
enzymatic cleavage agent other than those specifically described
here, the reactions may generally be performed in any such buffer
reported to be optimal for the nuclease function of the cleavage
agent. In general, to test the utility of any cleavage agent in
this method, test reactions are performed wherein the cleavage
agent of interest is tested in the MOPS/MnCl.sub.2/KCl buffer or
Mg-containing buffers described herein and in whatever buffer has
been reported to be suitable for use with that agent, in a
manufacturer's data sheet, a journal article, or in personal
communication.
[0437] The products of the INVADER oligonucleotide-directed
cleavage reaction are fragments generated by structure-specific
cleavage of the input oligonucleotides. The resulting cleaved
and/or uncleaved oligonucleotides may be analyzed and resolved by a
number of methods including, but not limited to, electrophoresis
(on a variety of supports including acrylamide or agarose gels,
paper, etc.), chromatography, fluorescence polarization, mass
spectrometry and chip hybridization. In some Examples the invention
is illustrated using electrophoretic separation for the analysis of
the products of the cleavage reactions. However, it is noted that
the resolution of the cleavage products is not limited to
electrophoresis. Electrophoresis is chosen to illustrate the method
of the invention because electrophoresis is widely practiced in the
art and is easily accessible to the average practitioner. In other
Examples, the invention is illustrated without electrophoresis or
any other resolution of the cleavage products.
[0438] The probe and INVADER oligonucleotides may contain a label
to aid in their detection following the cleavage reaction. The
label may be a radioisotope (e.g., a .sup.32P or .sup.35S-labelled
nucleotide) placed at either the 5' or 3' end of the
oligonucleotide or alternatively, the label may be distributed
throughout the oligonucleotide (i.e., a uniformly labeled
oligonucleotide). The label may be a nonisotopic detectable moiety,
such as a fluorophore, that can be detected directly, or a reactive
group that permits specific recognition by a secondary agent. For
example, biotinylated oligonucleotides may be detected by probing
with a streptavidin molecule that is coupled to an indicator (e.g.,
alkaline phosphatase or a fluorophore) or a hapten such as
dioxigenin may be detected using a specific antibody coupled to a
similar indicator. The reactive group may also be a specific
configuration or sequence of nucleotides that can bind or otherwise
interact with a secondary agent, such as another nucleic acid, and
enzyme, or an antibody.
[0439] c) Optimization of Reaction Conditions
[0440] The INVADER oligonucleotide-directed cleavage reaction is
useful to detect the presence of specific nucleic acids. In
addition to the considerations listed above for the selection and
design of the INVADER and probe oligonucleotides, the conditions
under which the reaction is to be performed may be optimized for
detection of a specific target sequence.
[0441] One objective in optimizing the INVADER
oligonucleotide-directed cleavage assay is to allow specific
detection of the fewest copies of a target nucleic acid. To achieve
this end, it is desirable that the combined elements of the
reaction interact with the maximum efficiency, so that the rate of
the reaction (e.g., the number of cleavage events per minute) is
maximized. Elements contributing to the overall efficiency of the
reaction include the rate of hybridization, the rate of cleavage,
and the efficiency of the release of the cleaved probe.
[0442] The rate of cleavage will be a function of the cleavage
means chosen, and may be made optimal according to the
manufacturer's instructions when using commercial preparations of
enzymes or as described in the examples herein. The other elements
(rate of hybridization, efficiency of release) depend upon the
execution of the reaction, and optimization of these elements is
discussed below.
[0443] Three elements of the cleavage reaction that significantly
affect the rate of nucleic acid hybridization are the concentration
of the nucleic acids, the temperature at which the cleavage
reaction is performed and the concentration of salts and/or other
charge-shielding ions in the reaction solution.
[0444] The concentrations at which oligonucleotide probes are used
in assays of this type are well known in the art, and are discussed
above. One example of a common approach to optimizing an
oligonucleotide concentration is to choose a starting amount of
oligonucleotide for pilot tests; 0.01 to 2 .mu.M is a concentration
range used in many oligonucleotide-based assays. When initial
cleavage reactions are performed, the following questions may be
asked of the data: Is the reaction performed in the absence of the
target nucleic acid substantially free of the cleavage product?; Is
the site of cleavage specifically positioned in accordance with the
design of the INVADER oligonucleotide?; Is the specific cleavage
product easily detected in the presence of the uncleaved probe (or
is the amount of uncut material overwhelming the chosen
visualization method)?
[0445] A negative answer to any of these questions would suggest
that the probe concentration is too high, and that a set of
reactions using serial dilutions of the probe should be performed
until the appropriate amount is identified. Once identified for a
given target nucleic acid in a give sample type (e.g., purified
genomic DNA, body fluid extract, lysed bacterial extract), it
should not need to be re-optimized. The sample type is important
because the complexity of the material present may influence the
probe concentration optimum.
[0446] Conversely, if the chosen initial probe concentration is too
low, the reaction may be slow, due to inefficient hybridization.
Tests with increasing quantities of the probe will identify the
point at which the concentration exceeds the optimum (e.g., at
which it produces an undesirable effect, such as background
cleavage not dependent on the target sequence, or interference with
detection of the cleaved products). Since the hybridization will be
facilitated by excess of probe, it is desirable, but not required,
that the reaction be performed using probe concentrations just
below this point.
[0447] The concentration of INVADER oligonucleotide can be chosen
based on the design considerations discussed above. In some
embodiments, the INVADER oligonucleotide is in excess of the probe
oligonucleotide. In a preferred embodiment, the probe
oligonucleotide is in excess of the INVADER oligonucleotide.
[0448] Temperature is also an important factor in the hybridization
of oligonucleotides. The range of temperature tested will depend in
large part on the design of the oligonucleotides, as discussed
above. Where it is desired to have a reaction be run at a
particular temperature (e.g., because of an enzyme requirement, for
convenience, for compatibility with assay or detection apparatuses,
etc.), the oligonucleotides that function in the reaction can be
designed to optimally perform at the desired reaction temperature.
Each INVADER reaction includes at least two target
sequence-specific oligonucleotides for the primary reaction: an
upstream INVADER oligonucleotide and a downstream probe
oligonucleotide. In some preferred embodiments, the INVADER
oligonucleotide is designed to bind stabily at the reaction
temperature, while the probe is designed to freely associate and
disassociate with the target strand, with cleavage occurring only
when an uncut probe hybridizes adjacent to an overlapping INVADER
oligonucleotide. In preferred embodiments, the probe includes a 5'
flap that is not complementary to the target, and this flap is
released from the probe when cleavage occurs. The released flap can
be detected directly or indirectly. In some preferred embodiments,
as discussed in detail below, the released flap participate as in
INVADER oligonucleotide in a secondary reaction.
[0449] Optimum conditions for the INVADER assay are generally those
that allow specific detection of the smallest amount of a target
nucleic acid. Such conditions may be characterized as those that
yield the highest target-dependent signal in a given timeframe, or
for a given amount of target nucleic acid, or that allow the
highest rate of probe cleavage (i.e., probes cleaved per minute).
To select a probe sequence that will perform optimally at a
pre-selected reaction temperature, the melting temperature
(T.sub.m) of its analyte specific region (ASR, the region that is
complementary to the target nucleic acid) is calculated using the
nearest-neighbor model and published parameters for DNA duplex
formation (SantaLucia, J., Proc Natl Acad Sci USA 95, 1460-5
(1998), Allawi, H. T. & SantaLucia, J., Jr. Biochemistry 36,
10581-94 (1997). However, there are several differences between the
conditions under which the published parameters were measured and
the conditions under which the INVADER assay is run in preferred
embodiments. The salt concentrations are often different than the
solution conditions in which the nearest-neighbor parameters were
obtained (1M NaCl and no divalent metals). One can compensate for
this factor by varying the value provided for the salt
concentration within the melting temperature calculations. In
addition to the salt concentration, the presence of and
concentration of the enzyme influences the optimal reaction
temperature, and an additional adjustment should be made to the
calculated T.sub.m to determine the optimal temperature at which to
perform a reaction. By observing the optimal temperature for a
number of INVADER reactions (i.e., the temperature at which the
rate of signal accumulation is highest) it has been possible to
further alter the value for salt concentration within these
calculations to allow the algorithm for T.sub.m calculation to be
modified to instead provide an optimal cleavage reaction
temperature for a given probe sequence. This additional adjustment
is termed a "salt correction". As used herein, the term "salt
correction" refers to a variation made in the value provided for a
salt concentration, for the purpose of reflecting the effect on a
T.sub.m calculation for a nucleic acid duplex of a non-salt
parameter or condition affecting said duplex. Variation of the
values provided for the strand concentrations will also affect the
outcome of these calculations. By using a value of 0.5 M NaCl
[SantaLucia, J., Proc Natl Acad Sci USA 95, 1460-5 (1998)] and
strand concentrations of about 1 .mu.M of the probe and 1 fM
target, the algorithm used for calculating probe-target melting
temperature has been adapted for use in predicting optimal INVADER
assay reaction temperature. For a set of about 30 probes, the
average deviation between optimal assay temperatures calculated by
this method and those experimentally determined was about
1.5.degree. C.
[0450] As noted above, the concentration of the cleavage agent can
affect the actual optimum temperature for a cleavage reaction.
Additionally, different cleavage agents, even if used at identical
concentrations, can affect reaction temperature optima differently
(e.g., the difference between the calculated probe T.sub.m and the
observed optimal reaction temperature may be greater for one enzyme
than for another). Determination of appropriate salt corrections
for reactions using different enzymes or concentrations of enzymes,
or for any other variation made in reaction conditions, involves a
two step process of a) measuring reaction temperature optima under
the new reaction conditions, and varying the salt concentration
within the T.sub.m algorithm to produce a calculated temperature
matching or closely approximating the observed optima. Measurement
of an optimum reaction temperature generally involves performing
reactions at a range of temperatures selected such that the range
allows observation of an increase in performance as an optimal
temperature is approached (either by increasing or decreasing
temperatures), and a decrease in performance when an optimal
temperature has been passed, thereby allowing identification of the
optimal temperature or temperature range [see, for example, V. I.
Lyamichev, et al., Biochemistry 39, No. 31: 9523-9532 (2000)].
[0451] The length of the downstream probe analyte-specific region
(ASR) is defined by the temperature selected for running the
reaction, e.g., 63.degree. C. in the experiments described in
Examples 54 through 60. To select a probe sequence based on a
desired reaction temperature, the probe sequence is selected in the
following way (as illustrated for the design of a probe for the
detection of a sequence difference at a particular location).
Starting from the position of the variant nucleotide on the target
DNA (position N, FIG. 112); the target base that is paired to the
probe nucleotide 5' of the intended cleavage site), an iterative
procedure is used by which the length of the ASR is increased by
one base pair until a calculated optimal reaction temperature
(T.sub.m plus salt correction to compensate for enzyme and any
other reaction conditions effects) matching the desired reaction
temperature is reached. The non-complementary arm of the probe is
preferably selected (by a similar iterative process) to allow the
secondary reaction to cycle at the same reaction temperature, and
the entire probe design (ASR and 5' noncomplementary arm) is
screened using programs such as mfold [Zuker, M. Science 244, 48-52
(1989)] or Oligo 5.0 [Rychlik, W. & Rhoads, R. E. Nucleic Acids
Res 17, 8543-51 (1989)] for the possible formation of dimer
complexes or secondary structures that could interfere with the
reaction. The same principles are also followed for INVADER
oligonucleotide design. The following describes design of an
INVADER assay embodiment wherein the 3' end of the INVADER
oligonucleotide, at position N on the target DNA, is designed to
have a nucleotide not complementary to either allele suspected of
being contained in the sample to be tested. The mismatch does not
adversely affect cleavage [Lyamichev, V. et al. Nature
Biotechnology 17, 292-296 (1999)], and it can enhance probe
cycling, presumably by minimizing coaxial stabilization effects
between the two probes. Briefly, starting from the position N,
additional residues complementary to the target DNA starting from
residue N-1 are then added in the upstream direction until the
stability of the INVADER-target hybrid exceeds that of the probe
(and therefore the planned assay reaction temperature). In
preferred embodiments, the stability of the INVADER-target hybrid
exceeds that of the probe by 15-20.degree. C.
[0452] In some embodiments, where the released cleavage fragment
from a primary reaction is to be used in a secondary reaction, one
should also consider the reaction conditions of the secondary
reaction in designing the oligonucleotides for the primary reaction
(e.g., the sequence of the released non-complementary 5' flap of
the probe in the primary reaction can be designed to optimally
function in a secondary reaction). For example, as described in
detail below, in some embodiments, a secondary reaction is used
where the released cleavage fragment from a primary reaction
hybridizes to a synthetic cassette to form a secondary cleavage
reaction. In some preferred embodiments, the cassette comprises a
fluorescing moiety and a quenching moiety, wherein cleavage of the
secondary cleavage structure separates the fluorescing moiety from
the quenching moiety, resulting in a detectable signal (e.g., FRET
detection). The secondary reaction can be configured a number of
different ways. For example, in some embodiments, the synthetic
cassette comprises two oligonucleotides: an oligonucleotide that
contains the FRET moieties and a FRET/INVADER oligonucleotide
bridging oligonucleotide that allows the INVADER oligonucleotide
(i.e., the released flap from the primary reaction) and the FRET
oligonucleotide to hybridize thereto, such that a cleavage
structure is formed. In some embodiments, the synthetic cassette is
provided as a single oligonucleotide, comprising a hairpin
structure (i.e., the FRET oligonucleotide is connected at its 3'
end to the bridging oligonucleotide by a loop). The loop may be
nucleic acid, (e.g., a string of nucleotides, such as the four T
residues depicted in several Figures, including 113A) or a
non-nucleic acid spacer or linker. The linked molecules may
together be described as a FRET cassette. In the secondary reaction
using a FRET cassette the released flap from the primary reaction,
which acts as an INVADER oligonucleotide, should be able to
associate and disassociate with the FRET cassette freely, so that
one released flap can direct the cleavage of multiple FRET
cassettes. It is one aspect of the assay design that all of the
probe sequences may be selected to allow the primary and secondary
reactions to occur at the same optimal temperature, so that the
reaction steps can run simultaneously. In an alternative
embodiment, the probes may be designed to operate at different
optimal temperatures, so that the reactions steps are not
simultaneously at their temperature optima. As noted above, the
same iterative process used to select the ASR of the probe can be
used in the design of the portion of the primary probe that
participates in a secondary reaction.
[0453] Another determinant of hybridization efficiency is the salt
concentration of the reaction. In large part, the choice of
solution conditions will depend on the requirements of the cleavage
agent, and for reagents obtained commercially, the manufacturer's
instructions are a resource for this information. When developing
an assay utilizing any particular cleavage agent, the
oligonucleotide and temperature optimizations described above
should be performed in the buffer conditions best suited to that
cleavage agent.
[0454] A "no enzyme" control allows the assessment of the stability
of the labeled oligonucleotides under particular reaction
conditions, or in the presence of the sample to be tested e.g., in
assessing the sample for contaminating nucleases). In this manner,
the substrate and oligonucleotides are placed in a tube containing
all reaction components, except the enzyme and treated the same as
the enzyme-containing reactions. Other controls may also be
included. For example, a reaction with all of the components except
the target nucleic acid will serve to confirm the dependence of the
cleavage on the presence of the target sequence.
[0455] d) Selection of a Cleavage Agent
[0456] As demonstrated in a number of the Examples, some 5'
nucleases do not require an upstream oligonucleotide to be active
in a cleavage reaction. Although cleavage may be slower without the
upstream oligonucleotide, it may still occur (Lyamichev et al.,
Science 260:778 [1993], Kaiser et al., J. Biol. Chem., 274:21387
[1999]). When a DNA strand is the template or target strand to
which probe oligonucleotides are hybridized, the 5' nucleases
derived from DNA polymerases and some flap endonucleases (FENs),
such as that from Methanococcus jannaschii, can cleave quite well
without an upstream oligonucleotide providing an overlap (Lyamichev
et al., Science 260:778 [1993], Kaiser et al., J. Biol. Chem.,
274:21387 [1999], and U.S. Pat. No. 5,843,669, herein incorporated
by reference in its entirety). These nucleases may be selected for
use in some embodiments of the INVADER assay, e.g., in embodiments
wherein cleavage of the probe in the absence of an INVADER
oligonucleotide gives a different cleavage product, which does not
interfere with the intended analysis, or wherein both types of
cleavage, INVADER oligonucleotide-directed and INVADER
oligonucleotide-independent, are intended to occur.
[0457] In other embodiments it is preferred that cleavage of the
probe be dependent on the presence of an upstream INVADER
oligonucleotide, and enzyme having this requirement would be used.
Other FENs, such as those from Archeaoglobus fulgidus (Afu) and
Pyrococcus furiosus (Pfu), cleave an overlapped structure on a DNA
target at so much greater a rate than they do a non-overlapping
structure (i.e., either missing the upstream oligonucleotide or
having a non-overlapping upstream oligonucleotide) that they can be
viewed as having an essentially absolute requirement for the
overlap (Lyamichev et al., Nat. Biotechnol., 17:292 [1999], Kaiser
et al., J. Biol. Chem., 274:21387 [1999]). When an RNA target is
hybridized to DNA oligonucleotide probes to form a cleavage
structure, many FENs cleave the downstream DNA probe poorly,
regardless of the presence of an overlap. On such an RNA-containing
structure, the 5' nucleases derived from DNA polymerases have a
strong requirement for the overlap, and are essentially inactive in
its absence.
[0458] e) Probing for Multiple Alleles
[0459] The INVADER oligonucleotide-directed cleavage reaction is
also useful in the detection and quantification of individual
variants or alleles in a mixed sample population. By way of
example, such a need exists in the analysis of tumor material for
mutations in genes associated with cancers. Biopsy material from a
tumor can have a significant complement of normal cells, so it is
desirable to detect mutations even when present in fewer than 5% of
the copies of the target nucleic acid in a sample. In this case, it
is also desirable to measure what fraction of the population
carries the mutation. Similar analyses may also be done to examine
allelic variation in other gene systems, and it is not intended
that the method of the present invention by limited to the analysis
of tumors.
[0460] As demonstrated below, in one embodiment, reactions can be
performed under conditions that prevent the cleavage of probes
bearing even a single-nucleotide difference mismatch within the
region of the target nucleic acid termed "Z" in FIG. 29, but that
permit cleavage of a similar probe that is completely complementary
to the target in this region. In a preferred embodiment, a mismatch
is positioned at the nucleotide in the probe that is 5' of the site
where cleavage occurs in the absence of the mismatch.
[0461] In other embodiments, the INVADER assay may be performed
under conditions that have a tight requirement for an overlap
(e.g., using the Afu FEN for DNA target detection or the 5'
nuclease of DNA polymerase for RNA target detection, as described
above), providing an alternative means of detecting single
nucleotide or other sequence variations. In one embodiment, the
probe is selected such that the target base suspected of varying is
positioned at the 5' end of the target-complementary region of this
probe. The upstream INVADER oligonucleotide is positioned to
provide a single base of overlap. If the target and the probe
oligonucleotide are complementary at the base in question, the
overlap forms and cleavage can occur. This embodiment is diagrammed
in FIG. 112. However, if the target does not complement the probe
at this position, that base in the probe becomes part of a
non-complementary 5' arm, no overlap between the INVADER
oligonucleotide and probe oligonucleotide exists, and cleavage is
suppressed.
[0462] It is also contemplated that different sequences may be
detected in a single reaction. Probes specific for the different
sequences may be differently labeled. For example, the probes may
have different dyes or other detectable moieties, different
lengths, or they may have differences in net charges of the
products after cleavage. When differently labeled in one of these
ways, the contribution of each specific target sequence to final
product can be tallied. This has application in detecting the
quantities of different versions of a gene within a mixture.
Different genes in a mixture to be detected and quantified may be
wild type and mutant genes (e.g., as may be found in a tumor
sample, such as a biopsy). In this embodiment, one might design the
probes to precisely the same site, but one to match the wild-type
sequence and one to match the mutant. Quantitative detection of the
products of cleavage from a reaction performed for a set amount of
time will reveal the ratio of the two genes in the mixture. Such
analysis may also be performed on unrelated genes in a mixture.
This type of analysis is not intended to be limited to two genes.
Many variants within a mixture may be similarly measured.
[0463] Alternatively, different sites on a single gene may be
monitored and quantified to verify the measurement of that gene. In
this embodiment, the signal from each probe would be expected to be
the same.
[0464] It is also contemplated that multiple probes may be used
that are not differently labeled, such that the aggregate signal is
measured. This may be desirable when using many probes designed to
detect a single gene to boost the signal from that gene. This
configuration may also be used for detecting unrelated sequences
within a mix. For example, in blood banking it is desirable to know
if any one of a host of infectious agents is present in a sample of
blood. Because the blood is discarded regardless of which agent is
present, different signals on the probes would not be required in
such an application of the present invention, and may actually be
undesirable for reasons of confidentiality.
[0465] Just as described for the two-oligonucleotide system, above,
the specificity of the detection reaction will be influenced by the
aggregate length of the target nucleic acid sequences involved in
the hybridization of the complete set of the detection
oligonucleotides. For example, there may be applications in which
it is desirable to detect a single region within a complex genome.
In such a case the set of oligonucleotides may be chosen to require
accurate recognition by hybridization of a longer segment of a
target nucleic acid, often in the range of 20 to 40 nucleotides. In
other instances it may be desirable to have the set of
oligonucleotides interact with multiple sites within a target
sample. In these cases one approach would be to use a set of
oligonucleotides that recognize a smaller, and thus statistically
more common, segment of target nucleic acid sequence.
[0466] In one preferred embodiment, the INVADER and stacker
oligonucleotides may be designed to be maximally stable, so that
they will remain bound to the target sequence for extended periods
during the reaction. This may be accomplished through any one of a
number of measures well known to those skilled in the art, such as
adding extra hybridizing sequences to the length of the
oligonucleotide (up to about 50 nts in total length), or by using
residues with reduced negative charge, such as phosphorothioates or
peptide-nucleic acid residues, so that the complementary strands do
not repel each other to degree that natural strands do. Such
modifications may also serve to make these flanking
oligonucleotides resistant to contaminating nucleases, thus further
ensuring their continued presence on the target strand during the
course of the reaction. In addition, the INVADER and stacker
oligonucleotides may be covalently attached to the target (e.g.,
through the use of psoralen cross-linking).
[0467] f) Signal Enhancement Through Pre-Amplification
[0468] The present invention further provides methods of increasing
reaction signal by amplifying target nucleic acid prior to
detection. In preferred embodiments, target amplification does not
require amplification of the target sequence itself. For example,
in some embodiments, target nucleic acid is amplified using by the
generation of a looped structure using the INVADER assay (the
cINVADER assay; See e.g., FIG. 129). In the cINVADER assay, a
nucleic acid is annealed to the target sequence such that a looped
structure with overlapping ends is formed. In some embodiments, as
desired (e.g., so as to avoid making a copy of the target
sequence), the target sequence and the annealed nucleic acid
comprises several mismatches (e.g., two or more in a region of
overlap of approximately 15-40 nucleotides). In some embodiments,
the ends of the annealed nucleic acid overlap to form an INVADER
assay invasive cleavage structure. In some embodiments, the
cleavage structure is cleaved to generate the annealed gapped
structure shown in the upper right panel of FIG. 129. The ends are
next ligated to form a circular structure. In some embodiments, the
circular nucleic acid structure is amplified. The circular nucleic
acid may be amplified using any suitable method, including, but not
limited to rolling circle amplification methods (See e.g., U.S.
Pat. Nos. 6,210,884, 6,183,960 and 6,235,502, herein incorporated
by reference in their entireties). Following amplification, the
amplified circle, which is only present when target nucleic acid is
present, is detected using any suitable method (e.g., the INVADER
assay, amplification with a primer directed to the ligated region,
or hybridization of a probe to the ligated region).
[0469] In other embodiments, target nucleic acid is amplified using
the "extension with limited nucleotide cleavage-circularization
extension" or ECCE INVADER assay (See e.g., FIG. 130). In the ECCE
assay, an ECCE oligonucleotide is designed with a small number of
nucleic acids complementary to the target sequence. In some
embodiments, it is necessary to exclude a particular nucleotide (in
the case of the exemplary reaction shown in FIG. 130, "c" is
excluded) in order to facilitate subsequent reaction steps. The
target is next annealed to the ECCE oligonucleotide and reverse
transcription is performed to extend the ECCE oligonucleotide
(panels 2 and 3 of FIG. 130). Extension is dependent on the
presence of target nucleic acid in the reaction. In some
embodiments, the length of the extension is limited by only adding
one or two dNTPs to the reverse transcription reaction. In the next
step, a bridge oligonucleotide complementary to the extended ECCE
oligonucleotide is added resulting in formation of an INVADER
cleavage structure (panel 4 of FIG. 130). The structure is cleaved
and the resulting nick is ligated to form a circular nucleic acid.
A primer complementary to the ECCE oligonucleotide upstream of the
ligation site is added. An extension reaction is next performed to
produce extension products complementary to the circularized ECCE
oligonucleotide. These extension products may be detected using any
suitable method (e.g., an INVADER assay).
[0470] In some embodiments, the amplification of target methods
described herein provide the opportunity to add a pre-designed
sequence of any length and of any base composition. This sequence
can be designed to facilitate any type of amplification or other
detection method designed and provides the further advantage of
detection of non-target sequence. In some embodiments, this
sequence is designed to differ from the original target sequence or
any target sequence to help reduce background. In other
embodiments, the sequence contains multiple copies of a desired
sequence to facilitate detection of the sequence.
II. Effect of ARRESTOR Molecules on Signal and Background in
Sequential Invasive Cleavage Reactions.
[0471] As described above, and demonstrated in Example 36, the
concentration of the probe that is cleaved can be used to increase
the rate of signal accumulation, with higher concentrations of
probe yielding higher final signal. However, the presence of large
amounts of residual uncleaved probe can present problems for
subsequent use of the cleaved products for detection or for further
amplification. If the subsequent step is a simple detection (e.g.,
by gel resolution), the excess uncut material may cause background
by streaking or scattering of signal, or by overwhelming a detector
(e.g., over-exposing a film in the case of radioactivity, or
exceeding the quantitative detection limits of a fluorescence
imager). This can be overcome by partitioning the product from the
uncut probe (e.g., by using the charge reversal method described in
Example 22 and discussed in detail below).
[0472] In more complex detection methods, the cleaved product may
be intended to interact with another entity to indicate cleavage.
As noted above, the cleaved product can be used in any reaction
that makes use of oligonucleotides, such as hybridization, primer
extension, ligation, or the direction of invasive cleavage. In each
of these cases, the fate of the residual uncut probe should be
considered in the design of the reaction. In a primer extension
reaction, the uncut probe can hybridize to a template for
extension. If cleavage is required to reveal the correct 3' end for
extension, the hybridized uncut probe will not be extended. It may,
however, compete with the cleaved product for the template. If the
template is in excess of the combination of cleaved and uncleaved
probe, then both of the latter should be able to find a copy of
template for binding. If, however, the template is limiting, any
competition may reduce the portion of the cleaved probe that can
find successfully bind to the available template. If a vast excess
of probe was used to drive the initial reaction, the remainder may
also be in vast excess over the cleavage product, and thus may
provide a very effective competitor, thereby reducing the amount of
the final reaction (e.g., extension) product for ultimate
detection.
[0473] The participation of the uncut probe material in a secondary
reaction can also contribute to background in these reactions.
While the presentation of a cleaved probe for a subsequent reaction
may represent an ideal substrate for the enzyme to be used in the
next step, some enzymes may also be able to act, albeit
inefficiently, on the uncut probe as well. It was shown in Example
43 that transcription can be promoted from a nicked promoter even
when one side of the nick has additional unpaired nucleotides
(termed a "branched promoter" in that Example). Similarly, when the
subsequent reaction is to be an invasive cleavage, the uncleaved
probe may bind to the elements intended to form the second cleavage
structure with the cleaved probe. Two of the possible
configurations are shown schematically in FIGS. 105 and 106. The
right hand structure in the second step in each Figure shows a
possible configuration formed by the secondary reaction elements
(e.g., secondary targets and/or probes) and the uncleaved primary
probe. In each of these cases, it was found that some of the 5'
nucleases described herein can catalyze some measure of cleavage of
these defective structures. Even at a low level, this aberrant
cleavage can be misinterpreted as positive target-specific cleavage
signal.
[0474] With these negative effects of the surfeit of uncut probe
considered, there is clearly a need for some method of preventing
these interactions. As noted above, it is possible to partition the
cleaved product from the uncut probe after the primary reaction by
traditional methods. However, these methods are often time
consuming, may be expensive (e.g., disposable columns, gels, etc.),
and may increase the risk for sample mishandling or contamination.
It is far preferable to configure the sequential reactions such
that the original sample need not be removed to a new vessel for
subsequent reaction.
[0475] The present invention provides a method for reducing
interactions between the primary probe and other reactants. This
method provides a means of specifically diverting the uncleaved
probes from participation in the subsequent reactions. The
diversion is accomplished by the inclusion in the next reaction
step an agent designed to specifically interact with the uncleaved
primary probe. While the primary probe in an invasive cleavage
reaction is discussed for reasons of convenience, it is
contemplated that the ARRESTOR molecules may be used at any
reaction step within a chain of invasive cleavage steps, as needed
or desired for the design of an assay. It is not intended that the
ARRESTOR molecules of the present invention be limited to any
particular step.
[0476] The method of diverting the residual uncut probes from a
primary reaction makes use of agents that can be specifically
designed or selected to bind to the uncleaved probe molecules with
greater affinity than to the cleaved probes, thereby allowing the
cleaved probe species to effectively compete for the elements of
the subsequent reaction, even when the uncut probe is present in
vast excess. These agents have been termed "ARRESTOR molecules,"
due to their function of stopping or arresting the primary probe
from participation in the later reaction. In various Examples
below, an oligonucleotide is provided as an ARRESTOR
oligonucleotide in an invasive cleavage assay. It can be
appreciated that any molecule or chemical that can discriminate
between the full-length uncut probe and the cleaved probe, and that
can bind or otherwise disable the uncleaved probe preferentially
may be configured to act as an ARRESTOR molecules within the
meaning of the present invention. For example, antibodies can be
derived with such specificity, as can the "aptamers" that can be
selected through multiple steps of in vitro amplification (e.g.,
"SELEX," U.S. Pat. Nos. 5,270,163 and 5,567,588; herein
incorporated by reference) and specific rounds of capture or other
selection means.
[0477] In one embodiment, the ARRESTOR molecule is an
oligonucleotide. In another embodiment the ARRESTOR
oligonucleotides is a composite oligonucleotide, comprising two or
more short oligonucleotides that are not covalently linked, but
that bind cooperatively and are stabilized by co-axial stacking. In
a preferred embodiment, the oligonucleotide is modified to reduce
interactions with the cleavage agents of the present invention.
When an oligonucleotide is used as an ARRESTOR oligonucleotide, it
is intended that it not participate in the subsequent reactive
step. Consideration of the schematic diagrams in FIGS. 105 and 106,
particularly the right-most Figure in step 2b of each Figure, will
show that the binding of the ARRESTOR oligonucleotide to the
primary probe may, either with the participation of the secondary
target, or without such participation, create a bifurcated
structure that is a substrate for cleavage by the 5' nucleases used
in some embodiments of the methods of the present invention.
Formation of such structures would lead to some level of unintended
cleavage that could contribute to background, reduce specific
signal or compete for the enzyme. It is preferable to provide
ARRESTOR oligonucleotides that will not create such cleavage
structures. One method of doing this is to add to the ARRESTOR
oligonucleotides such modifications as have been found to reduce
the activity of INVADER oligonucleotides, as the INVADER
oligonucleotides occupy a similar position within a cleavage
structure (i.e., the 3' end of the INVADER oligonucleotide
positions the site of cleavage of an unpaired 5' arm). Modification
of the 3' end of the INVADER oligonucleotides was examined for the
effects on cleavage in Example 35; a number of the modifications
tested were found to be significantly debilitating to the function
of the INVADER oligonucleotide. Other modifications not described
herein may be easily characterized by performing such a test using
the cleavage enzyme to be used in the reaction for which the
ARRESTOR oligonucleotide is intended.
[0478] In a preferred embodiment, the backbone of an ARRESTOR
oligonucleotide is modified. This may be done to increase the
resistance to degradation by nucleases or temperature, or to
provide duplex structure that is a less favorable substrate for the
enzyme to be used (e.g., A-form duplex vs. B-form duplex). In
particularly preferred embodiment, the backbone modified
oligonucleotide further comprises a 3' terminal modification. In a
preferred embodiment, the modifications comprise 2' O-methyl
substitution of the nucleic acid backbone, while in a particularly
preferred embodiment, the 2' O-methyl modified oligonucleotide
further comprises a 3' terminal amine group.
[0479] The purpose of the ARRESTOR oligonucleotide is to allow the
minority population of cleaved probe to effectively compete with
the uncleaved probe for binding whatever elements are to be used in
the next step. While an ARRESTOR oligonucleotide that can
discriminate between the two probe species absolutely (i.e.,
binding only to uncut and never to cut) may be of the greatest
benefit in some embodiments, it is envisioned that in many
applications, including the sequential INVADER assays described
herein, the ARRESTOR oligonucleotide of the present invention may
perform the intended function with only partial discrimination.
When the ARRESTOR oligonucleotide has some interaction with the
cleaved probe, it may prevent detection of some portion of these
cleavage products, thereby reducing the absolute level of signal
generated from a given amount of target material. If this same
ARRESTOR oligonucleotide has the simultaneous effect of reducing
the background of the reaction (i.e., from non-target specific
cleavage) by a factor that is greater than the factor of reduction
in the specific signal, then the significance of the signal (i.e.,
the ratio of signal to background), is increased, even with the
lower amount of absolute signal. Any potential ARRESTOR molecule
design may be tested in a simple fashion by comparing the levels of
background and specific signals from reactions that lack ARRESTOR
molecules to the levels of background and specific signal from
similar reactions that include ARRESTOR oligonucleotides. Each of
the reactions described in Examples 49-53 demonstrate the use of
such comparisons, and these can easily be adapted by those skilled
in the art to other ARRESTOR molecules and target embodiments. What
constitutes an acceptable level of tradeoff of absolute signal for
specificity will vary for different applications (e.g., target
levels, read-out sensitivity, etc.), and can be determined by any
individual user using the methods of the present invention.
III. Signal Enhancement by Incorporating the Products of an
Invasive Cleavage Reaction into a Subsequent Invasive Cleavage
Reaction
[0480] As noted above, the oligonucleotide product released by the
invasive cleavage can be used subsequently in any reaction or
read-out method that uses oligonucleotides in the size range of a
cleavage product. In addition to the reactions involving primer
extension and transcription, described herein, another enzymatic
reaction that makes use of oligonucleotides is the invasive
cleavage reaction. The present invention provide means of using the
oligonucleotide released in a primary invasive cleavage reaction as
a component to complete a cleavage structure to enable a secondary
invasive cleavage reaction. One possible configuration of a primary
cleavage reaction supplying a component for a secondary cleavage
structure is diagrammed in FIG. 96. Is not intended that the
sequential use of the invasive cleavage product be limited to a
single additional step. It is contemplated that many distinct
invasive cleavage reactions may be performed in sequence.
[0481] The polymerase chain reaction uses a DNA replication method
to create copies of a targeted segment of nucleic acid at a
logarithmic rate of accumulation. This is made possible by the fact
that when the strands of DNA are separated, each individual strand
contains sufficient information to allow assembly of a new
complementary strand. When the new strands are synthesized the
number of identical molecules has doubled. Within 20 iterations of
this process, the original may be copied 1 million-fold, making
very rare sequences easily detectable. The mathematical power of a
doubling reaction has been incorporated into a number of
amplification assays, several of which are cited in Table 1.
[0482] By performing multiple, sequential invasive cleavage
reactions the method of the present invention captures an
exponential mathematical advantage without producing additional
copies of the target analyte. In a simple invasive cleavage
reaction the yield, Y, is simply the turnover rate, K, multiplied
by the time of the reaction, t (i.e., Y=(K)(t)). If Y is used to
represent the yield of a simple reaction, then the yield of a
compound (i.e., a multiple, sequential reaction), assuming that
each of the individual invasive cleavage steps has the same
turnover rate, can be simply represented as Y.sup.n, where n is the
number of invasive cleavage reactions that have been performed in
the series. If the yields of each step differ the ultimate yield
can be represented as the product of the multiplication of the
yields of each individual reaction in the series. For example, if a
primary invasive cleavage reaction can produce one thousand
products in 30 minutes, and each of those products can in turn
participate in 1000 additional reactions, there will be 1000.sup.2
copies (1000.times.1000) of the ultimate product in a second
reaction. If a third reaction is added to the series, then the
theoretical yield will be 1000.sup.3 (1000.times.1000.times.1000).
In the methods of the present invention the exponent comes from the
number of invasive cleavage reactions in the cascade. This can be
contrasted to the amplification methods described above (e.g., PCR)
in which Y is limited to 2 by the number of strands in duplex DNA,
and the exponent n is the number of cycles performed, so that many
iterations are necessary to accumulate large amounts of
product.
[0483] To distinguish the exponential amplifications described
above from those of the present invention, the former can be
considered reciprocating reactions because the products the
reaction feed back into the same reaction (e.g., event one leads to
some number of events 2, and each event 2 leads back to some number
of events 1). In contrast, the events of the present invention are
sequential (e.g., event 1 leads to some number of events 2; each
event 2 leads to some number of events 3, etc., and no event can
contribute to an event earlier in the chain).
[0484] The sensitivity of the reciprocating methods is also one of
the greatest weaknesses when these assays are used to determine if
a target nucleic acid sequence is present or absent in a sample.
Because the product of these reactions is detectable copies of the
starting material, contamination of a new reaction with the
products of an earlier reaction can lead to false positive results,
(i.e., the apparent detection of the target nucleic acid in samples
that do not actually contain any of that target analyte).
Furthermore, because the concentration of the product in each
positive reaction is so high, amounts of DNA sufficient to create a
strong false positive signal can be communicated to new reactions
very easily either by contact with contaminated instruments or by
aerosol. In contrast to the reciprocating methods, the most
concentrated product of the sequential reaction (i.e., the product
released in the ultimate invasive cleavage event) is not capable of
initiating a like reaction or cascade if carried over to a fresh
test sample. This is a marked advantage over the exponential
amplification methods described above because the reactions of the
present invention may be performed without the costly containment
arrangements (e.g., either by specialized instruments or by
separate laboratory space) required by any reciprocating reaction.
While the products of a penultimate event may be inadvertently
transferred to produce a background of the ultimate product in the
absence of the a target analyte, the contamination would need to be
of much greater volume to give an equivalent risk of a false
positive result.
[0485] When the term sequential is used it is not intended to limit
the invention to configurations in which that one invasive cleavage
reaction or assay must be completed before the initiation of a
subsequent reaction for invasive cleavage of a different probe.
Rather, the term refers to the order of events as would occur if
only single copies of each of the oligonucleotide species were used
in an assay. The primary invasive cleavage reaction refers to that
which occurs first, in response to the formation of the cleavage
structure on the target nucleic acid. Subsequent reactions may be
referred to as secondary, tertiary and so forth, and may involve
artificial "target" strands that serve only to support assembly of
a cleavage structure, and which are unrelated to the nucleic acid
analyte of interest. While the complete assay may, if desired, be
configured with each step of invasive cleavage separated either in
space (e.g., in different reaction vessels) or in time (e.g., using
a shift in reaction conditions, such as temperature, enzyme
identity or solution condition, to enable the later cleavage
events), it is also contemplated that all of the reaction
components may be mixed so that secondary reactions may be
initiated as soon as product from a primary cleavage becomes
available. In such a format, primary, secondary and subsequent
cleavage events involving different copies of the cleavage
structures may take place simultaneously.
[0486] Several levels of this sort of linear amplification can be
envisioned, in which each successive round of cleavage produces an
oligonucleotide that can participate in the cleavage of a different
probe in subsequent rounds. The primary reaction would be specific
for the analyte of interest with secondary (and tertiary, etc.)
reactions being used to generate signal while still being dependent
on the primary reaction for initiation.
[0487] The released product may perform in several capacities in
the subsequent reactions. One of the possible variations is shown
in FIG. 96, in which the product of one invasive cleavage reaction
becomes the INVADER oligonucleotide to direct the specific cleavage
of another probe in a second reaction. In FIG. 96, the first
invasive cleavage structure is formed by the annealing of the
INVADER oligonucleotide ("Invader") and the probe oligonucleotide
("Probe 1") to the first target nucleic acid ("Target 1"). The
target nucleic acid is divided into three regions based upon which
portions of the INVADER and probe oligonucleotides are capable of
hybridizing to the target (as discussed above and as shown in FIG.
25). Region 1 (region Y in FIG. 25) of the target has
complementarity to only the INVADER oligonucleotide; region 3
(region Z in FIG. 25) of the target has complementarity to only the
probe; and region 2 (region X in FIG. 25) of the target has
complementarity to both the INVADER and probe oligonucleotides. It
is noted that the sequential invasive cleavage reaction diagrammed
in FIG. 96 employs an INVADER and a probe oligonucleotide; the
sequential cleavage reaction is not limited to the use of such a
first cleavage structure. The first cleavage structure in the
sequential reaction may also employ an INVADER oligonucleotide, a
mini probe and a stacker oligonucleotide as discussed above.
Further, as discussed above, the overlap in any or all of the
cleavage structures in the sequential reactions may comprise
moieties other than overlapping complementary bases, such that the
region shown as "X" represents a region where there is a physical
rather than sequence overlap between the INVADER and probe
oligonucleotides
[0488] In FIG. 96, cleavage of Probe 1 releases the "Cut Probe 1"
(indicated by the hatched line in both the cleaved and uncleaved
Probe 1 in FIG. 96). The released Probe 1 is then used as the
INVADER oligonucleotide in second cleavage. The second cleavage
structure is formed by the annealing of the Cut Probe 1, a second
probe oligonucleotide ("Probe 2") and a second target nucleic acid
("Target 2") In some embodiments, Probe 2 and the second target
nucleic acid are covalently connected, preferably at their 3' and
5' ends, respectively, thus forming a hairpin stem and loop, termed
herein a "cassette". The loop may be nucleic acid, (e.g., a string
of nucleotides, such as the four T residues depicted in several
Figures, including 113A) or a non-nucleic acid spacer or linker.
Inclusion of an excess of the cassette molecule allows each Cut
Probe 1 to serve as an INVADER to direct the cleavage of multiple
copies of the cassette.
[0489] Probe 2 may be labeled (e.g., as indicated by the star in
FIG. 96) and detection of cleavage of the second cleavage structure
may be accomplished by detecting the labeled cut Probe 2; the label
may a radioisotope (e.g., .sup.32P, .sup.35S), a fluorophore (e.g.,
fluorescein), a reactive group capable of detection by a secondary
agent (e.g., biotin/streptavidin), a positively charged adduct
which permits detection by selective charge reversal (as discussed
in Section IV above), etc. Alternatively, the cut Probe 2 may used
in a tailing reaction, or to complete or activate a protein binding
site, or may be detected or used by any of the means for detecting
or using an oligonucleotide described herein.
[0490] Another possible configuration for performing a sequential
invasive cleavage reaction is diagrammed in FIG. 97. In this
embodiment, probe oligonucleotides that are cleaved in the primary
reaction can be designed to fold back on themselves (i.e., they
contain a region of self-complementarity) to create a molecule that
can serve as both the INVADER and target oligonucleotide (termed
here an "IT" complex). The IT complex then enables cleavage of a
different probe present in the secondary reaction. Inclusion of an
excess of the secondary probe molecule ("Probe 2"), allows each IT
molecule to serve as the platform for the generation of multiple
copies of cleaved secondary probe. In FIG. 97, the regions of
self-complementarity contained within the 5' portion of the INVADER
oligonucleotide is indicated by the hatched ovals; the arrow
between these two ovals indicates that these two regions can
self-pair (as shown in the "Cut Probe 1"). The target nucleic acid
is divided into three regions based upon which portions of the
INVADER and probe oligonucleotides are capable of hybridizing to
the target (as discussed above and it is noted that the target may
be divided into four regions if a stacker oligonucleotide is
employed). The second cleavage structure is formed by the annealing
of the second probe ("Probe 2") to the fragment of Probe 1 ("Cut
Probe 1") that was released by cleavage of the first cleavage
structure. The Cut Probe 1 forms a hairpin or stem/loop structure
near its 3' terminus by virtue of the annealing of the regions of
self-complementarity contained within Cut Probe 1 (this
self-annealed Cut Probe 1 forms the IT complex). The IT complex
(Cut Probe 1) is divided into three regions. Region 1 of the IT
complex has complementarity to the 3' portion of Probe 2; region 2
has complementarity to both the 3' end of Cut Probe 1 and to the 5'
portion of Probe 2 (analogous to the region of overlap "X" shown in
FIG. 25); and region 3 contains the region of self-complementarity
(i.e., region 3 is complementary to the 3' portion of the Cut Probe
1). Note that with regard to the IT complex (i.e., Cut Probe 1),
region 1 is located upstream of region 2 and region 2 is located
upstream of region 3. As for other embodiments of invasive
cleavage, the region shown as "2" can represent a region where
there is a physical, but not sequence, overlap between the INVADER
portion of the Cut Probe 1 and the Probe 2 oligonucleotide.
[0491] The cleavage products of the secondary invasive cleavage
reaction (i.e., Cut Probe 2) can either be detected, or can in turn
be designed to constitute yet another integrated INVADER-target
complex to be used with a third probe molecule, again unrelated to
the preceding targets.
[0492] The present invention is not limited to the configurations
diagrammed in FIGS. 96 and 97. It is envisioned that the
oligonucleotide product of a primary cleavage reaction may fill the
role of any of the oligonucleotides described herein (e.g., it may
serve as a target strand without an attached INVADER
oligonucleotide-like sequence, or it may serve as a stacker
oligonucleotide, as described above), to enhance the turnover rate
seen in the secondary reaction by stabilizing the probe
hybridization through coaxial stacking.
[0493] Secondary cleavage reactions in some preferred embodiments
of the present invention include the use of FRET cassettes such as
those described in Examples 54 through 62. Such molecules provide
both a secondary target and a FRET labeled cleavable sequence,
allowing homogeneous detection (i.e., without product separation or
other manipulation after the reaction) of the sequential invasive
cleavage reaction. Other preferred embodiments use a secondary
reaction system in which the FRET probe and synthetic target are
provided as separate oligonucleotides.
[0494] In a preferred embodiment, each subsequent reaction is
facilitated by (i.e., is dependent upon) the product of the
previous cleavage, so that the presence of the ultimate product may
serve as an indicator of the presence of the target analyte.
However, cleavage in the second reaction need not be dependent upon
the presence of the product of the primary cleavage reaction; the
product of the primary cleavage reaction may merely measurably
enhance the rate of the second cleavage reaction.
[0495] In summary, the INVADER assay cascade (i.e., sequential
invasive cleavage reactions) of the present invention is a
combination of two or more linear assays that allows the
accumulation of the ultimate product at an exponential rate, but
without significant risk of carryover contamination. It is an
important to note that background that does not arise from
sequential cleavage, such as thermal breakage of the secondary
probe, generally increases linearly with time. In contrast, signal
generation from a 2-step sequential reaction follows quadratic
kinetics. Thus, collection of data as a time course, either by
taking time points or through the use of an instrument that allows
real-time detection during the INVADER assay reaction incubations,
provides the attractive capability of discriminating between the
true signal and any background solely on the basis of quadratic
versus linear increases in signal over time. For example, when
viewed graphically, the real signal will appear as a quadratic
curve, while any accumulating background will be linear, and thus
easy to distinguish, even if the absolute level of the background
signal (e.g., fluorescence in a FRET detection format) is
substantial.
[0496] The sequential invasive cleavage amplification of the
present invention can be used as an intermediate boost to any of
the detection methods (e.g., gel based analysis by either standard
or by charge reversal), polymerase tailing, and incorporation into
a protein binding region, described herein. When used is such
combinations the increased production of a specific cleavage
product in the invasive cleavage assay reduces the burdens of
sensitivity and specificity on the read-out systems, thus
facilitating their use.
[0497] In addition to enabling a variety of detection platforms,
the cascade strategy is suitable for multiplex analysis of
individual analytes (i.e., individual target nucleic acids) in a
single reaction. The multiplex format can be categorized into two
types. In one case, it is desirable to know the identity (and
amount) of each of the analytes that can be present in a clinical
sample, or the identity of each of the analytes as well as an
internal control. To identify the presence of multiple individual
analytes in a single sample, several distinct secondary
amplification systems may be included. Each probe cleaved in
response to the presence of a particular target sequence (or
internal control) can be designed to trigger a different cascade
coupled to different detectable moieties, such as different
sequences to be extended by DNA polymerase or different dyes in an
FRET format. The contribution of each specific target sequence to
final product can thereby be tallied, allowing quantitative
detection of different genes or alleles in a sample containing a
mixture of genes or alleles.
[0498] In the second configuration, it is desirable to determine if
any of several analytes are present in a sample, but the exact
identity of each does not need to be known. For example, in blood
banking it is desirable to know if any one of a host of infectious
agents is present in a sample of blood. Because the blood is
discarded regardless of which agent is present, different signals
on the probes would not be required in such an application of the
present invention, and may actually be undesirable for reasons of
confidentiality. In this case, the 5' arms (i.e., the 5' portion
which will be released upon cleavage) of the different
analyte-specific probes would be identical and would therefore
trigger the same secondary signal cascade. A similar configuration
would permit multiple probes complementary to a single gene to be
used to boost the signal from that gene or to ensure inclusivity
when there are numerous alleles of a gene to be detected.
[0499] In the primary INVADER reaction, there are two potential
sources of background. The first is from INVADER-independent
cleavage of probe annealed to the target, to itself, or to one of
the other oligonucleotides present in the reaction. It can be seen
by consideration of FIGS. 96 and 97 that the probes of the primary
cleavage reactions depicted are designed to have regions of
complementarity to the other oligonucleotides involved in the
subsequent reactions, and, as depicted in FIG. 97, to other regions
of the same molecule. The use of an enzyme that cannot efficiently
cleave a structure that lacks a primer (e.g., that cannot cleave
the structures diagrammed in FIG. 16A or 16 D) is preferred for
this reason. As shown in FIGS. 99 and 100, the enzyme Pfu FEN-1
gives no detectable cleavage in the absence of the upstream
oligonucleotide or even in the presence of an upstream
oligonucleotide that fails to invade the probe-target complex. This
indicates that the Pfu FEN-1 endonuclease is a suitable enzyme for
use in the methods of the present invention.
[0500] Other structure-specific nucleases may be suitable as a
well. As discussed in the first example, some 5' nucleases can be
used in conditions that significantly reduce this
primer-independent cleavage. For example, it has been shown that
when the 5' nuclease of DNAPTaq is used to cleave hairpins the
primer-independent cleavage is markedly reduced by the inclusion of
a monovalent salt in the reaction (Lyamichev, et al., [1993],
supra).
[0501] Test for INVADER Oligonucleotide-Independent Cleavage
[0502] A simple test can be performed for any enzyme in combination
with any reaction buffer to gauge the amount of INVADER
oligonucleotide-independent cleavage to be expected from that
combination. A small hairpin-like test molecule that can be used
with or without a primer hybridized to a 3' arm, the S-60 molecule,
is depicted in FIG. 30. The S-60 and the oligonucleotide P15 are a
convenient set of molecules for testing the suitability of an
enzyme for application in the present invention and conditions for
using these molecules are described in Example 11. Other similar
hairpins may be used. A cleavage structure may be assembled from
separate oligonucleotides as diagrammed in FIGS. 99a-e. Reactions
using these structures to examine the activity of the Pfu FEN-1
enzyme in the presence or absence of an upstream overlapping
oligonucleotide are described in Example 45 and the results are
displayed in FIG. 100. To test any particular combination of enzyme
and cleavage conditions, similar reactions can be assembled.
Outside of the variables of reaction conditions to be tested for
any particular enzyme (e.g., salt sensitivities, divalent cation
requirements) the test reactions should accommodate any known
limitations of the test enzyme. For example, the test reactions
should be performed at a temperature that is within the operating
temperature range of the candidate enzyme, if known.
[0503] It is not necessary that multiple lengths of overlap be
demonstrated for each candidate enzyme, but the activity of the
enzyme in the absence of an upstream oligonucleotide (sequence or
physical overlap) (as shown in FIG. 99a) and in the presence of an
oligonucleotide that does not overlap (FIG. 99b) should be
assessed. It is preferable that structures lacking an upstream
oligonucleotide be cleaved at less than one half of the rate seen
in the presence of an upstream overlapping oligonucleotide. It is
more preferable that these structures be cleaved at less than about
on tenth the rate of the invasive cleavage structure. It is most
preferred that cleavage of these structures occur at less than one
percent the rate of the invasive cleavage structure.
[0504] If the cleaved product is to serve as an upstream
oligonucleotide in a subsequent cleavage reaction, as diagrammed in
FIG. 96, the most rapid reaction will be achieved if the other
components of the second cleavage structure (i.e., Target 2 and
Probe 2 in FIG. 96) are provided in excess compared to the amount
of first cleavage product, so that cleavage may proceed immediately
after the upstream oligonucleotide (i.e, Cut Probe 1 in FIG. 96) is
made available. To provide an abundance of the second target strand
or cassette (Target 2 in FIG. 96) one may use an isolated natural
nucleic acid, such as bacteriophage M13 DNA, or one may use a
synthetic oligonucleotide. If a synthetic oligonucleotide is chosen
as the second target sequence, the sequence employed should be
examined for regions of unintended self-complementarity (similar
considerations apply to short isolated natural nucleic acids such
as restriction enzyme fragments or PCR products; natural nucleic
acid targets whose 3' end is located .gtoreq.100 nucleotides
downstream of the probe binding site on the target strand are
generally long enough to obviate the design considerations
discussed below). Specifically, it should be determined that the 3'
end of the synthetic oligonucleotide may not hybridize to the
target strand (i.e., intra-strand hybridization) upstream of the
probe, triggering unintended cleavage. Simple examination of the
sequence of the synthetic oligonucleotide should reveal if the 3'
end has sufficient complementarity to the region of the target
upstream of the probe binding site to pose a problem (i.e, it would
reveal whether the synthetic oligonucleotide can form a hairpin at
its 3' end which could act as an invading oligonucleotide to cause
cleavage of the 2.sup.nd probe in the absence of the hybridization
of the intended INVADER oligonucleotide (i.e., the cleavage product
from the first invasive cleavage reaction)). If 3 or more of the
last 4 to 7 nucleotides (the 3' terminal region) of the synthetic
target can basepair upstream of the probe such that there is an
overlap with the probe-target duplex, or such that the duplexes
formed by the synthetic target strand with its own 3' terminal
region and with the probe abut without a gap and the 3' terminal
region has an additional 1 or 2 nucleotides unpaired at the extreme
3' end of the synthetic target, then the sequence of the synthetic
target oligonucleotide should be modified. The sequence may be
changed to disrupt the interaction of the 3' terminal region or to
increase the distance between the probe binding site and the
regions to which the 3' terminus is binding. Alternatively, the 3'
end may be modified to reduce its ability to direct cleavage (e.g.,
by adding a 3' phosphate during synthesis) (see Ex. 35, Table 3) or
by adding several additional nucleotides that will not basepair in
a self-complementary manner (i.e., they will not participate in the
formation of a hairpin structure).
[0505] When the product of a first invasive cleavage reaction is
designed to form a target that can fold on itself to direct
cleavage of a second probe, the IT complex as diagrammed in FIG.
97, the design of the sequence used to form the stem/loop of the IT
complex should be considered. To be factored into the design of
such a probe are 1) the length of the region of
self-complementarity, 2) the type of overlap (i.e., what 3' moiety)
and, if an overlap in sequence is selected, the length of the
region of overlap (region "X" in FIG. 25) and 3) the stability of
the hairpin or stem/loop structure as predicted by both
Watson-Crick base pairing and by the presence or absence of a
particularly stable loop sequence (e.g., a tetraloop [Tinoco et
al., supra], or a triloop [Hirao et al., supra]). It is desirable
that this sequence have nucleotides that can base pair
(intrastrand), so that the second round of invasive cleavage may
occur, but that the structure not be so strong that its presence
will prevent the cleavage of the probe in the primary reaction
(i.e., Probe 1 in FIG. 96). As shown herein, the presence of a
secondary structure in the 5' arm of a cleavage structure cleaved
by a structure-specific nuclease may inhibit cleavage by some
structure-specific nucleases (Ex. 1).
[0506] The length of the region of self-complementarity within
Probe 1 determines the length of the region of the duplex upstream
of Probe 2 in the second cleavage structure (see FIG. 97).
Different enzymes have different length requirements for this
duplex to effect invasive cleavage efficiently. For example, the
Pfu FEN-1 and Mja FEN-1 enzymes have been tested for the effect of
this duplex length using the set of target/INVADER oligonucleotide
molecules depicted in FIG. 98 (i.e., SEQ ID NOS:118, 119, 147-151).
The invasive cleavage reactions were performed as described in
Example 38, using 1 pM IT3 (SEQ ID NO:118), 2 .mu.M probe PR1 (SEQ
ID NO:119) for 5 min, and the rates of cleavage are shown in Table
2.
TABLE-US-00002 TABLE 2 {PRIVATE} Pfu FEN-1 Turnover, Mja FEN-1
Turnover, per Length of Duplex per min. min. 0 0 0 3 1 29 4 10 57 6
44 51 8 45 46
[0507] The data shown in Table 2 demonstrate that the Pfu FEN-1
enzyme can be used with stems of 3 or 4 bases, but that the rate of
cleavage is maximized when the stem is greater than 4 basepairs in
length. Table 2 shows that the Mja FEN-1 enzyme can cleave
efficiently using shorter stems; however, as this enzyme can also
cleave a probe in the absence of an upstream oligonucleotide, Mja
FEN-1 is not preferred for use in the sequential invasive cleavage
methods of the present invention.
[0508] A similar test can be performed using any candidate enzyme
to determine how much self-complementarity may be designed into the
Probe 1. The use of a shorter stem means that the overall probe may
be shorter. This is beneficial because shorter probes are less
costly to synthesize, and because shorter probes will have fewer
sequences that might form unintended intrastrand structures. In
assessing the activity of a candidate enzyme on the structures such
as those shown in FIG. 98 it is not required that the stem length
chosen allow the maximum rate of cleavage to occur. For example, in
considering the case of Pfu FEN-1, the advantages of using a 4
basepair stem (e.g., cost or sequence limitations), with a cleavage
rate of 10 cleavages per minute, may outweigh the rate advantage of
using a longer 6 basepair stem (44 cleavages/min.), in the context
of a particular experiment. It is within the scope of the present
invention that some elements chosen for use in the assay be
sub-optimal for performance of that particular element, if the use
of a sub-optimal design benefits the objectives of that particular
experiment as a whole.
[0509] In designing oligonucleotides to be employed as a probe
that, once cleaved, forms a stem-loop structure as diagrammed in
FIG. 97 (i.e., Probe 1 in FIG. 97), it has been found that the
stability of the loop is not a factor in the efficiency of cleavage
of either Probe 1 or Probe 2. Loops tested have included stable
triloops, loops of 3 and 4 nucleotides that were not predicted to
be particularly stable (i.e., the stability is determined by the
duplex sequence and not by additional stabilizing interactions
within the loop), and large loops of up to about 25
nucleotides.
IV. Fractionation of Specific Nucleic Acids by Selective Charge
Reversal
[0510] Some nucleic acid-based detection assays involve the
elongation and/or shortening of oligonucleotide probes. For
example, as described herein, the primer-directed,
primer-independent, and INVADER-directed cleavage assays, as well
as the "nibbling" assay all involve the cleavage (i.e., shortening)
of oligonucleotides as a means for detecting the presence of a
target nucleic sequence. Examples of other detection assays that
involve the shortening of an oligonucleotide probe include the
"TaqMan" or nick-translation PCR assay described in U.S. Pat. No.
5,210,015 to Gelfand et al. (the disclosure of which is herein
incorporated by reference), the assays described in U.S. Pat. Nos.
4,775,619 and 5,118,605 to Urdea (the disclosures of which are
herein incorporated by reference), the catalytic hybridization
amplification assay described in U.S. Pat. No. 5,403,711 to Walder
and Walder (the disclosure of which is herein incorporated by
reference), and the cycling probe assay described in U.S. Pat. Nos.
4,876,187 and 5,011,769 to Duck et al. (the disclosures of which
are herein incorporated by reference). Examples of detection assays
that involve the elongation of an oligonucleotide probe (or primer)
include the polymerase chain reaction (PCR) described in U.S. Pat.
Nos. 4,683,195 and 4,683,202 to Mullis and Mullis et al. (the
disclosures of which are herein incorporated by reference) and the
ligase chain reaction (LCR) described in U.S. Pat. Nos. 5,427,930
and 5,494,810 to Birkenmeyer et al. and Barany et al. (the
disclosures of which are herein incorporated by reference). The
above examples are intended to be illustrative of nucleic
acid-based detection assays that involve the elongation and/or
shortening of oligonucleotide probes and do not provide an
exhaustive list.
[0511] Typically, nucleic acid-based detection assays that involve
the elongation and/or shortening of oligonucleotide probes require
post-reaction analysis to detect the products of the reaction. It
is common that the specific reaction product(s) must be separated
from the other reaction components, including the input or
unreacted oligonucleotide probe. One detection technique involves
the electrophoretic separation of the reacted and unreacted
oligonucleotide probe. When the assay involves the cleavage or
shortening of the probe, the unreacted product will be longer than
the reacted or cleaved product. When the assay involves the
elongation of the probe (or primer), the reaction products will be
greater in length than the input. Gel-based electrophoresis of a
sample containing nucleic acid molecules of different lengths
separates these fragments primarily on the basis of size. This is
due to the fact that in solutions having a neutral or alkaline pH,
nucleic acids having widely different sizes (i.e., molecular
weights) possess very similar charge-to-mass ratios and do not
separate (Andrews, Electrophoresis, 2nd Edition, Oxford University
Press (1986), pp. 153-154]. The gel matrix acts as a molecular
sieve and allows nucleic acids to be separated on the basis of size
and shape (e.g., linear, relaxed circular or covalently closed
supercoiled circles).
[0512] Unmodified nucleic acids have a net negative charge due to
the presence of negatively charged phosphate groups contained
within the sugar-phosphate backbone of the nucleic acid. Typically,
the sample is applied to gel near the negative pole and the nucleic
acid fragments migrate into the gel toward the positive pole with
the smallest fragments moving fastest through the gel.
[0513] The present invention provides a novel means for
fractionating nucleic acid fragments on the basis of charge. This
novel separation technique is related to the observation that
positively charged adducts can affect the electrophoretic behavior
of small oligonucleotides because the charge of the adduct is
significant relative to charge of the whole complex. In addition to
the use of positively charged adducts (e.g., Cy3 and Cy5
fluorescent dyes, the positively charged heterodimeric DNA-binding
dyes shown in FIG. 66, etc.), the oligonucleotide may contain amino
acids (particularly useful amino acids are the charged amino acids:
lysine, arginine, asparate, glutamate), modified bases, such as
amino-modified bases, and/or a phosphonate backbone (at all or a
subset of the positions). In other embodiments, as discussed
further below, a neutral dye or detection moiety (e.g., biotin,
streptavidin, etc.) may be employed in place of a positively
charged adduct, in conjunction with the use of amino-modified bases
and/or a complete or partial phosphonate backbone.
[0514] This observed effect is of particular utility in assays
based on the cleavage of DNA molecules. Using the assays described
herein as an example, when an oligonucleotide is shortened through
the action of a CLEAVASE enzyme or other cleavage agent, the
positive charge can be made to not only significantly reduce the
net negative charge, but to actually override it, effectively
"flipping" the net charge of the labeled entity. This reversal of
charge allows the products of target-specific cleavage to be
partitioned from uncleaved probe by extremely simple means. For
example, the products of cleavage can be made to migrate towards a
negative electrode placed at any point in a reaction vessel, for
focused detection without gel-based electrophoresis; Example 24
provides examples of devices suitable for focused detection without
gel-based electrophoresis. When a slab gel is used, sample wells
can be positioned in the center of the gel, so that the cleaved and
uncleaved probes can be observed to migrate in opposite directions.
Alternatively, a traditional vertical gel can be used, but with the
electrodes reversed relative to usual DNA gels (i.e., the positive
electrode at the top and the negative electrode at the bottom) so
that the cleaved molecules enter the gel, while the uncleaved
disperse into the upper reservoir of electrophoresis buffer.
[0515] An important benefit of this type of readout is the absolute
nature of the partition of products from substrates (i.e., the
separation is virtually 100%). This means that an abundance of
uncleaved probe can be supplied to drive the hybridization step of
the probe-based assay, yet the unconsumed (i.e., unreacted) probe
can, in essence, be subtracted from the result to reduce background
by virtue of the fact that the unreacted probe will not migrate to
the same pole as the specific reaction product.
[0516] Through the use of multiple positively charged adducts,
synthetic molecules can be constructed with sufficient modification
that the normally negatively charged strand is made nearly neutral.
When so constructed, the presence or absence of a single phosphate
group can mean the difference between a net negative or a net
positive charge. This observation has particular utility when one
objective is to discriminate between enzymatically generated
fragments of DNA, which lack a 3' phosphate, and the products of
thermal degradation, which generally retain a 3' phosphate (and
thus two additional negative charges). Examples 22 and 23
demonstrate the ability to separate positively charged reaction
products from a net negatively charged substrate oligonucleotide.
As discussed in these examples, oligonucleotides may be transformed
from net negative to net positively charged compounds. In Example
23, the positively charged dye, Cy3 was incorporated at the 5' end
of a 22-mer (SEQ ID NO:50) which also contained two
amino-substituted residues at the 5' end of the oligonucleotide;
this oligonucleotide probe carries a net negative charge. After
cleavage, which occurred 2 nucleotides into the probe, the
following labeled oligonucleotide was released:
5'-Cy3-AminoT-AminoT-3' (in addition to unlabeled fragment
comprising the remaining 20 nucleotides of SEQ ID NO:50). This
short fragment bears a net positive charge while the remainder of
the cleaved oligonucleotide and the unreacted or input
oligonucleotide bear net negative charges.
[0517] The present invention contemplates embodiments wherein the
specific reaction product produced by any cleavage of any
oligonucleotide can be designed to carry a net positive charge
while the unreacted probe is charge neutral or carries a net
negative charge. The present invention also contemplates
embodiments where the released product may be designed to carry a
net negative charge while the input nucleic acid carries a net
positive charge. Depending on the length of the released product to
be detected, positively charged dyes may be incorporated at the one
end of the probe and modified bases may be placed along the
oligonucleotide such that upon cleavage, the released fragment
containing the positively charged dye carries a net positive
charge. Amino-modified bases may be used to balance the charge of
the released fragment in cases where the presence of the positively
charged adduct (e.g., dye) alone is not sufficient to impart a net
positive charge on the released fragment. In addition, the
phosphate backbone may be replaced with a phosphonate backbone at a
level sufficient to impart a net positive charge (this is
particularly useful when the sequence of the oligonucleotide is not
amenable to the use of amino-substituted bases); FIGS. 45 and 46
show the structure of short oligonucleotides containing a
phosphonate group on the second T residue). An oligonucleotide
containing a fully phosphonate-substituted backbone would be charge
neutral (absent the presence of modified charged residues bearing a
charge or the presence of a charged adduct) due to the absence of
the negatively charged phosphate groups. Phosphonate-containing
nucleotides (e.g., methylphosphonate-containing nucleotides are
readily available and can be incorporated at any position of an
oligonucleotide during synthesis using techniques which are well
known in the art.
[0518] In essence, the invention contemplates the use of
charge-based separation to permit the separation of specific
reaction products from the input oligonucleotides in nucleic
acid-based detection assays. The foundation of this novel
separation technique is the design and use of oligonucleotide
probes (typically termed "primers" in the case of PCR) which are
"charge balanced" so that upon either cleavage or elongation of the
probe it becomes "charge unbalanced," and the specific reaction
products may be separated from the input reactants on the basis of
the net charge.
[0519] In the context of assays that involve the elongation of an
oligonucleotide probe (i.e., a primer), such as is the case in PCR,
the input primers are designed to carry a net positive charge.
Elongation of the short oligonucleotide primer during
polymerization will generate PCR products that now carry a net
negative charge. The specific reaction products may then easily be
separated and concentrated away from the input primers using the
charge-based separation technique described herein (the electrodes
will be reversed relative to the description in Example 23 as the
product to be separated and concentrated after a PCR will carry a
negative charge).
V. Signal Enhancement by Tailing of Reaction Products in the
INVADER Oligonucleotide-Directed Cleavage Assay
[0520] It has been determined that when oligonucleotide probes are
used in cleavage detection assays at elevated temperature, some
fraction of the truncated probes will have been shortened by
nonspecific thermal degradation, and that such breakage products
can make the analysis of the target-specific cleavage data more
difficult. The thermal degradation that creates a background ladder
of bands when the probes of the present invention are treated at
high temperature for more than a few minutes occurs as a two step
process. In the first step the N-glycosyl bond breaks, leaving an
abasic site in the DNA strand. At the abasic site the DNA chain is
weakened and undergoes spontaneous cleavage through a
beta-elimination process. It has been determined that purine bases
are about 20 times more prone to breakage than pyrimidine bases
(Lindahl, Nature 362:709 [1993]). This suggests that one way of
reducing background in methods using oligonucleotides at elevated
temperatures is to select target sequences that allow the use of
pyrimidine-rich probes. It is preferable, where possible, to use
oligonucleotides that are entirely composed of pyrimidine residues.
If only one or a few purines are used, the background breakage will
appear primarily at the corresponding sites, and these bands (due
to thermal breakdown) may be mistaken for the intended cleavage
products if care is not taken in the data analysis (i.e., proper
controls must be run).
[0521] Background cleavage due to thermal breakdown of probe
oligonucleotides can, when not resolved from specific cleavage
products, reduce the accuracy of quantitation of target nucleic
acids based on the amount of accumulated product in a set
timeframe. One means of distinguishing the specific from the
nonspecific products is disclosed above, and is based on
partitioning the products of these reactions by differences in the
net charges carried by the different molecular species in the
reaction. As was noted in that discussion, the thermal breakage
products usually retain 3' phosphates after breakage, while the
enzyme-cleaved products do not. The two negative charges on the
phosphate facilitate charge-based partition of the products.
[0522] The absence of a 3' phosphate on the desired subset of the
probe fragments may be used to advantage in enzymatic assays as
well. Nucleic acid polymerases, both non-templated (e.g., terminal
deoxynucleotidyl transferase, polyA polymerase) and
template-dependent (e.g., Pol I-type DNA polymerases), require an
available 3' hydroxyl by which to attach further nucleotides. This
enzymatic selection of 3' end structure may be used as an effective
means of partitioning specific from non-specific products.
[0523] In addition to the benefits of the partitioning described
above, the addition of nucleotides to the end of the specific
product of an INVADER oligonucleotide-specific cleavage offers an
opportunity to either add label to the products, to add capturable
tails to facilitate solid-support based readout systems, or to do
both of these things at the same time. Some possible embodiments of
this concept are illustrated in FIG. 56.
[0524] In FIG. 56, an INVADER cleavage structure comprising an
INVADER oligonucleotide containing a blocked or non-extendible 3'
end (e.g., a 3' dideoxynucleotide) and a probe oligonucleotide
containing a blocked or non-extendable 3' end (the open circle at
the 3' end of the oligonucleotides represents a non-extendible
nucleotide) and a target nucleic acid is shown; the probe
oligonucleotide may contain a 5' end label such as a biotin or a
fluorescein (indicated by the stars) label (cleavage structures
which employ a 5' biotin-labeled probe or a 5' fluorescein-labeled
probe are shown below the large diagram of the cleavage structure
to the left and the right, respectively). Following cleavage of the
probe (the site of cleavage is indicated by the large arrowhead),
the cleaved biotin-labeled probe is extended using a
template-independent polymerase (e.g., TdT) and fluoresceinated
nucleotide triphosphates. The fluorescein tailed cleaved probe
molecule is then captured by binding via its 5' biotin label to
streptavidin and the fluorescence is then measured. Alternatively,
following, cleavage of a 5'-fluoresceinated probe, the cleaved
probe is extended using a template-independent polymerase (e.g.,
TdT) and dATP. The polyadenylated (A-tailed) cleaved probe molecule
is then captured by binding via the polyA tail to oligo dT attached
to a solid support.
[0525] The examples described in FIG. 56 are based on the use of
TdT to tail the specific products of INVADER-directed cleavage. The
description of the use of this particular enzyme is presented by
way of example and is not intended as a limitation (indeed, when
probe oligonucleotides comprising RNA are employed, cleaved RNA
probes may be extended using polyA polymerase). It is contemplated
that an assay of this type can be configured to use a
template-dependent polymerase, as described above. While this would
require the presence of a suitable copy template distinct from the
target nucleic acid, on which the truncated oligonucleotide could
prime synthesis, it can be envisaged that a probe that before
cleavage would be unextendible, due to either mismatch or
modification of the 3' end, could be activated as a primer when
cleaved by an INVADER oligonucleotide-directed cleavage. A template
directed tailing reaction also has the advantage of allowing
greater selection and control of the nucleotides incorporated.
[0526] The use of nontemplated tailing does not require the
presence of any additional nucleic acids in the detection reaction,
avoiding one step of assay development and troubleshooting. In
addition, the use of non-templated synthesis eliminated the step of
hybridization, potentially speeding up the assay. Furthermore, the
TdT enzyme is fast, able to add at least >700 nucleotides to
substrate oligonucleotides in a 15 minute reaction.
[0527] As mentioned above, the tails added can be used in a number
of ways. It can be used as a straight-forward way of adding labeled
moieties to the cleavage product to increase signal from each
cleavage event. Such a reaction is depicted in the left side of
FIG. 66. The labeled moieties may be anything that can, when
attached to a nucleotide, be added by the tailing enzyme, such as
dye molecules, haptens such as digoxigenin, or other binding groups
such as biotin.
[0528] In a preferred embodiment the assay includes a means of
specifically capturing or partitioning the tailed INVADER
oligonucleotide-directed cleavage products in the mixture. It can
be seen that target nucleic acids in the mixture may be tailed
during the reaction. If a label is added, it is desirable to
partition the tailed INVADER oligonucleotide-directed cleavage
products from these other labeled molecules to avoid background in
the results. This is easily done if only the cleavage product is
capable of being captured. For example, consider a cleavage assay
of the present invention in which the probe used has a biotin on
the 5' end and is blocked from extension on the 3' end, and in
which a dye is added during tailing. Consider further that the
products are to be captured onto a support via the biotin moiety,
and the captured dye measured to assess the presence of the target
nucleic acid. When the label is added by tailing, only the
specifically cleaved probes will be labeled. The residual uncut
probes can still bind in the final capture step, but they will not
contribute to the signal. In the same reaction, nicks and cuts in
the target nucleic acid may be tailed by the enzyme, and thus
become dye labeled. In the final capture these labeled targets will
not bind to the support and thus, although labeled, they will not
contribute to the signal. If the final specific product is
considered to consist of two portions, the probe-derived portion
and the tail portion, it can be seen from this discussion that it
is particularly preferred that, when the probe-derived portion is
used for specific capture, whether by hybridization,
biotin/streptavidin, or other method, that the label be associated
with the tail portion. Conversely, if a label is attached to the
probe-derived portion, then the tail portion may be made suitable
for capture, as depicted on the right side of FIG. 66. Tails may be
captured in a number of ways, including hybridization, biotin
incorporation with streptavidin capture, or by virtue if the fact
that the longer molecules bind more predictably and efficiently to
a number of nucleic acid minding matrices, such as nitrocellulose,
nylon, or glass, in membrane, paper, resin, or other form. While
not required for this assay, this separation of functions allows
effective exclusion from signal of both unreacted probe and tailed
target nucleic acid.
[0529] In addition to the supports described above, the tailed
products may be captured onto any support that contains a suitable
capture moiety. For example, biotinylated products are generally
captured with avidin-treated surfaces. These avidin surfaces may be
in microtitre plate wells, on beads, on dipsticks, to name just a
few of the possibilities. Such surfaces can also be modified to
contain specific oligonucleotides, allowing capture of product by
hybridization. Capture surfaces as described herein are generally
known to those skilled in the art and include nitrocellulose
dipsticks (e.g., GENECOMB, BioRad, Hercules, Calif.).
VI. Signal Enhancement by Completion of an Activated Protein
Binding Site
[0530] In addition to the DNA polymerase tailing reaction described
above, the present invention also contemplates the use of the
products of the invasive cleavage reaction to form activated
protein binding sites, such as RNA polymerase promoter duplexes,
thereby allowing the interaction of the completed site to be used
as an indicator of the presence of the nucleic acid that is the
target of the invasive cleavage reaction. By way of example, when
an RNA polymerase promoter duplex is activated by being made
complete (i.e., double-stranded over that portion of the promoter
region required for polymerase binding) through the hybridization
of the oligonucleotide product of the invasive cleavage reaction,
the synthesis of RNA can be used as such an indicator.
[0531] It is not intended that the transcription reaction of the
present invention be limited to the use of any particular RNA
polymerase or RNA polymerase promoter region. Promoter sequences
are well characterized for several bacteriophage, including
bacteriophage SP6, T7 and T3. In addition, promoter sequences have
been well characterized for a number of both eukaryotic and
prokaryotic RNA polymerases. In a preferred embodiment, the
promoter used enables transcription from one of the bacteriophage
RNA polymerases. In a particularly preferred embodiment, the
promoter used enables transcription by T7 RNA polymerase. Means of
performing transcription in vitro are well known in the art and
commercial kits are available for performing transcription with
eukaryotic, prokaryotic or bacteriophage RNA polymerases (e.g.,
from Promega Corp., Madison, Wis.).
[0532] The protein binding regions of the present invention are not
limited to the bacteriophage RNA polymerase promoters described
above. Other promoter sequences that are contemplated are those of
prokaryotes and eukaryotes. For example, many strains of bacteria
and fungi are used for the expression of heterologous proteins. The
minimal promoters required for transcription by the RNA polymerases
of organisms such as yeast and other fungi, eubacteria, nematodes,
and cultured mammalian cells are well described in the literature
and in the catalogs of commercial suppliers of DNA vectors for the
expression of foreign proteins in these organisms.
[0533] The binding sites for other types of nucleic acid (e.g.,
DNA) binding proteins are contemplated for use in the present
invention. For example, proteins involved in the regulation of
genes exert their effects by binding to the DNA in the vicinity of
the promoter from which the RNA from that gene is transcribed. The
lac operator of E. coli is one example of a particularly well
characterized and commonly used gene regulation system in which the
lac repressor protein binds to specific sequences that overlap, and
thus block, the promoter for the genes under the repressor's
control (Jacob and Monod, Cold Spring Harbor Symposium on
Quantitative Biol. XXVI: 193-211 [1961]). Many similar systems have
been described in bacteria, including the trp and AraC regulatory
systems. Given the large amount of information available about
bacterial promoters, the steps described below for the design of
suitable partial promoters for the bacteriophage RNA polymerases
can be readily adapted to the design of detection systems based on
these other promoters.
[0534] As noted above, many of the bacterial promoters are under
the control of a repressor or other regulatory protein. It is
considered to be within the scope of the present invention to
include the creation of composite binding sites for these
regulatory proteins through the provision of a nucleic acid
fragment (e.g., a non-target cleavage product generated in an
invasive cleavage reaction). The binding of the regulatory protein
to the completed protein binding region (e.g., the composite
binding region) can be assessed by any one of a number of means,
including slowed electrophoretic migration of either the protein or
the DNA fragment, or by a conformational change in the protein or
DNA upon binding. In addition, transcription from a downstream
promoter can be monitored for up- or down-regulation as a result of
the binding of the regulatory protein to the completed protein
binding region.
[0535] In addition to the bacterial systems described above, many
genes in eukaryotic systems have also been found to be under the
control of specific proteins that bind to specific regions of
duplex DNA. Examples include, but are not limited to, the OCT-1,
OCT-2 and AP-4 proteins in mammals and the GAL4 and GCN4 proteins
in yeast. Such regulatory proteins usually have a structural motif
associated with duplex nucleic acid binding, such as a
helix-turn-helix, a zinc finger or a leucine zipper [for review,
see, Molecular and Cellular Biology, Wolfe (Ed.), Wadsworth
Publishing Co., Belmont, Calif., pp. 694-715 [1993]).
[0536] For simplicity the test reaction described here will refer
to T7 RNA polymerase, and its promoter. This is not intended to
limit the invention to the use of this RNA polymerase, and those
skilled in the art of molecular biology would be able to readily
adapt this described test to the examination of any of the DNA
binding proteins, RNA polymerases and their binding or promoter
sites discussed above.
[0537] It is known in the art that active T7 promoters can be
formed by the hybridization of two oligonucleotides, each
comprising either the top or bottom strand of the promoter
sequence, such that a complete un-nicked duplex promoter is formed
(Milligan et al., Nucl. Acids Res., 15:21, 8783-8798 (1987)]. The
present invention shows that one way of making the initiation of
transcription dependent on the products of an invasive cleavage
reaction is to design the probe for the cleavage reaction such that
a portion of an RNA polymerase promoter is released as product. The
remaining DNA piece or pieces required to assemble a promoter
duplex may either be provided as elements in the reaction mixture,
or they may be produced by other invasive cleavage events. If the
oligonucleotide pieces are designed to comprise appropriate regions
of complementarity they may base pair to form a complete promoter
duplex composed of three or more nucleic acid fragments, as
depicted in FIG. 88B. A promoter assembled in this way will have
nicks in the backbone of one or both strands. In one embodiment,
these nicks may be covalently closed through the use of a DNA
ligase enzyme. In a preferred embodiment, the nicks are positioned
such that transcription can proceed without ligation. In selecting
the site of a nick created by the assembly of the partial promoter
fragment, at least one nick should be within the recognized
promoter region for the RNA polymerase to be used. When a
bacteriophage promoter is used, a nick should be between
nucleotides -17 and -1, measured from the site of transcription
initiation at +1. In a preferred embodiment, a nick will be between
nucleotides -13 and -8. In a particularly preferred embodiment, a
nick will be between nucleotides -12 and -10 on the non-template
strand of the bacteriophage promoter.
[0538] When nicks are to be left unrepaired (i.e., not covalently
closed with a DNA ligase) it is important to assess the effect of
the nick location on the level of transcription from the assembled
promoter. A simple test is to combine the oligonucleotides that
comprise the separate portions of the promoter with an
oligonucleotide that comprises one entire strand of the promoter to
be assembled, thereby forming a duplex promoter with a nick in one
strand. If the nick is in the top, or non-template strand of the
promoter, then the oligonucleotide that comprises the complete
promoter is made to include additional non-promoter sequence on its
5' end to serve as a template to be copied in the transcription.
This arrangement is depicted in FIG. 88B. Alternatively, if the
nick is to be in the bottom, or template strand of the promoter,
then the partial promoter oligonucleotide that covers the +1
position, the transcription start site, will include the additional
template sequence. This arrangement is depicted in FIGS. 95A-D
(this Figure shows several different embodiments in which a cut
probe or non-target cleavage product is used to form a composite
promoter which contains one or more nicks on the template strand).
In either case, the separate oligonucleotides are combined to form
the complete promoter, and the assembly is used in a transcription
reaction to create RNA.
[0539] To measure the effect of the nick, a substantially identical
promoter fragment is created by hybridization of two
oligonucleotides that each comprise one strand of the full-length
promoter to create an un-nicked version of the same promoter. These
two molecular assemblies are tested in parallel transcription
reactions and the amount of the expected RNA that is produced in
each reaction is measured for both size and yield. A preferred
method of assessing the size of the RNA is by electrophoresis with
subsequent visualization. If a labeled nucleotide (e.g.,
.sup.32P-GTP, or fluorescein-UTP) is used in the transcription, the
RNA can be detected and quantitated by autoradiography,
fluorescence imaging or by transfer to support membrane with
subsequent detection (e.g., by antibody or hybridization probing).
Alternatively, if unlabeled RNA is produced the amounts may be
determined by other methods known in the art, such as by
spectrophotometry or by electrophoresis with subsequent staining
and comparison to known standards.
[0540] If the size of the RNA is as predicted by the template
sequence, or if it matches that produced from the control promoter,
it can be presumed to have initiated transcription at the same site
in the complex, and to have produced essentially the same RNA
product. If the product is much shorter then transcription is
either initiating at an internal site or is terminating prematurely
(Schenborn and Mierendorf, Nucl. Acids Res., 13:17, 6223 [1985];
and Milligan et al., supra.). While this does not indicate that the
assembly tested is completely unsuitable for the assay, the partial
transcripts will reduce the gross amount of RNA created, perhaps
compromising the signal from the assay, and such products would
require further characterization (e.g., finger printing or
sequencing) to identify the nucleotide content of the product. It
is preferred that the size of the RNA produced matches that of the
RNA produced in the control reaction.
[0541] The yield of the reaction is also examined. It is not
necessary that the level of transcription matches that of the
control reaction. In some instances (see Ex. 41, below) the nicked
promoter may have an enhanced rate of transcription, while in other
arrangements transcription may be reduced (relative to the rate
from the un-nicked promoter assembly). It is only required that the
amount of product be within the detection limits of the method to
be used with the test promoter.
[0542] It is reported that transcription from a bacteriophage
promoter can produce 200 to 1000 copies of each transcription
template (template plus active promoter) in a reaction. These
levels of transcription are not required by the present invention.
Reactions in which one RNA is produced for each template are also
contemplated.
[0543] The test described above will allow a promoter with a nick
in any position to be assessed for utility in this assay. It is an
objective of this invention to provide one or more of the
oligonucleotides that comprise a partial promoter region through
invasive cleavage event(s). In this embodiment, the partial
promoter sequences are attached to the probe oligonucleotide in the
invasive cleavage assay, and are released by cleavage at specific
site, as directed by the INVADER oligonucleotide. It is also
intended that transcription be very poor or nonexistent in the
absence of the correctly cleaved probe. To assess the success of
any oligonucleotide design at meeting these objectives, several
transcription reaction tests can be performed.
[0544] For a promoter assembly that will have a nick on the
non-template strand, several partial assemblies that should be
tested are shown in FIGS. 86 A-D. By way of example, but not by way
of limitation, this Figure depicts the tests for a nicked promoter
in which the upstream, or 5' portion of the non-template strand is
to be provided by the invasive cleavage assay. This fragment is
seen in FIG. 86A labeled as "cut probe". Transcription reactions
incubated in the presence of the duplex shown in FIG. 86A will test
the ability of the upstream partial promoter to allow initiation of
transcription when hybridized to a bottom strand, termed a "copy
template." Similarly, a reaction performed in the presence of the
duplex depicted in FIG. 86B will test the ability of the partial
promoter fragment nearest the initiation site (the +1 site, as
indicated in FIG. 85B) to support transcription of the copy
template. It is an important feature of the present invention that
neither of these partial promoter duplexes be able to support
transcription at the same level as would by seen in transcription
from an intact promoter as depicted in FIG. 85B. It is preferred
that neither of these partial promoters be sufficient to initiate
detectable transcription in the time course of an average
transcription reaction (i.e., within about an hour of
incubation).
[0545] FIGS. 86C and 86D depict two other duplex arrangements
designed to test the effect of uncut probe within the transcription
reaction. FIG. 86C depicts the duplex formed between only the uncut
probe and the copy template, while FIG. 86D includes the other
portion of the promoter. The 3' region of the probe is not
complementary to the promoter sequence and therefore produces an
unpaired branch in the middle of the promoter. It is an important
feature of the present invention that neither of these branched
promoter duplexes be able to support transcription at the same
level as would by seen in transcription from an intact promoter as
depicted in FIG. 85B. It is preferred that neither of these
branched promoters be sufficient to initiate detectable
transcription in the time course of an average transcription
reaction (i.e., within about an hour of incubation).
[0546] In one embodiment of the transcription system of the present
invention, the initiation of transcription from the copy template
in the absence of a complete promoter, or in the presence of a
branched promoter, is prevented by the judicious placement of the
nick or nicks in the composite promoter. For example, as shown in
the examples below, placement of a nick between the -12 and -11
nucleotides of the non-template strand of the bacteriophage T7
promoter allows transcription to take place only when the probe has
been successfully cut, as in an invasive cleavage reaction.
However, in some instances where the invasive cleavage reaction is
to provide the upstream portion of the non-template strand of the
promoter (e.g., as depicted in FIG. 88B) it may be necessary or
desirable to place the nick on that strand in a particular position
for reasons other than providing an optimal composite promoter
(i.e., one that is inactive in the absence of any one of the
promoter pieces). It may be necessary or desirable to place the
nick in such a way that the creation of a branched complete
promoter (FIG. 86D) has an undesirable level of transcription,
reducing dependence of RNA production on the success of the
invasive cleavage step. It is shown in the examples below that
transcription from such a branched promoter can be suppressed by a
modification of the downstream non-template promoter piece, shown
as the "Partial Promoter Oligonucleotide" in FIGS. 86, 88, 90 and
95D. As depicted in FIG. 90, the partial promoter oligonucleotide
can be provided with a 5' "tail" of nucleotides that are not
complementary to the template strand of the promoter, but that are
complementary to the 3' portion of the probe oligonucleotide that
would be removed in the invasive cleavage reaction. When uncut
probe hybridizes to the copy template with the bound 5' tailed
partial promoter oligonucleotide, the 5' tail can basepair to the
3' region of the probe, forming a three-way junction as depicted in
FIG. 90A. This can effectively shut off transcription, as shown
below. When a cut probe hybridizes, as shown in FIG. 90B, a
promoter with a small branch is formed, and it is shown herein that
such a branched promoter can initiate transcription. Furthermore,
if care is taken in selecting the sequence of the 5' tail (i.e., if
the first unpaired base is the same nucleotide at the 3' nucleotide
of the cut probe, so that they compete for hybridization to the
same template strand base), the resulting branched structure may
also be cleaved by one of the structure specific nucleases of the
present invention, creating the un-branched promoter depicted in
FIG. 90C, in some instances enhancing transcription over that seen
with the FIG. 90B promoter.
[0547] The promoter duplex that is intended to be created, in this
embodiment, by the successful execution of the INVADER directed
cleavage assay will include both the "cut probe" and the partial
promoter oligonucleotide depicted in FIGS. 86A and B, aligned on a
single copy template nucleic acid. The testing of the efficiency of
transcription of such a nicked promoter segment in comparison to
the intact promoter is described above. All of the oligonucleotides
described for these test molecules may be created using standard
synthesis chemistries.
[0548] The set of test molecules depicted in FIG. 86 is designed to
assess the transcription capabilities of the variety of structures
that may be present in reactions in which the 5' portion of the
non-template strand of the promoter is to be supplied by the
INVADER directed cleavage. It is also envisioned that a different
portion of partial promoter may be supplied by the invasive
cleavage reaction (e.g., the downstream segment of the non-template
strand of the promoter), as is shown in FIG. 94. Portions of the
template strand of the promoter may also be provided by the cut
probe, as shown in FIGS. 95A-D. An analogous set of test molecules,
including "cut" and uncut versions of the probe to be used in the
invasive cleavage assay may be created to test any alternative
design, whether the nick is to be located on the template or non
template strand of the promoter.
[0549] The transcription-based visualization methods of the present
invention may also be used in a multiplex fashion. Reactions can be
constructed such that the presence of one particular target leads
to transcription from one type of promoter, while the presence of a
different target sequence (e.g., a mutant or variant) or another
target suspected of being present, may lead to transcription from a
different (i.e., a second) type of promoter. In such an embodiment,
the identity of the promoter from which transcription was initiated
could be deduced from the type or size of the RNA produced.
[0550] By way of example, but not by way of limitation, the
bacteriophage promoters can be compared with such an application in
view. The promoters for the phage T7, T3 and SP6 are quite similar,
each being about 15 to 20 basepairs long, and sharing about 45%
identity between -17 and -1 nucleotides, relative to the start of
transcription. Despite these similarities, the RNA polymerases from
these phage are highly specific for their cognate promoters, such
that the other promoters may be present in a reaction, but will not
be transcribed (Chamberlin and Ryan, Enzymes XV:87-108 [1982]).
Because these promoters are similar in size and in the way in which
they are recognized by their polymerases (Li et al., Biochem.
35:3722 [1996]) similar nicked versions of the promoters may be
designed for use in the methods of the present invention by analogy
to the examples described herein which employ the T7 promoter.
Because of the high degree of specificity of the RNA polymerases,
these nicked promoters may be used together to detect multiple
targets in a single reaction. There are many instances in which it
would be highly desirable to detect multiple nucleic acid targets
in a single sample, including cases in which multiple infectious
agents may be present, or in which variants of a single type of
target may need to be identified. Alternatively, it is often
desirable to use a combination of probes to detect both a target
sequence and an internal control sequence, to gauge the effects of
sample contaminants on the output of the assay. The use of multiple
promoters allows the reaction to be assessed for both the
efficiency of the invasive cleavage and the robustness of the
transcription.
[0551] As stated above, the phage promoters were described in
detail as an example of suitable protein binding regions (e.g.,
which can be used to generate a composite promoter) for use in the
methods of the present invention. The invention is not limited to
the use of phage RNA polymerase promoter regions, in particular,
and RNA polymerase promoter regions, in general. Suitably specific,
well characterized promoters are also found in both prokaryotic and
eukaryotic systems.
[0552] The RNA that is produced in a manner that is dependent of
the successful detection of the target nucleic acid in the invasive
cleavage reaction may be detected in any of several ways. If a
labeled nucleotide is incorporated into the RNA during
transcription, the RNA may be detected directly after fractionation
(e.g., by electrophoresis or chromatography). The labeled RNA may
also be captured onto a solid support, such as a microtitre plate,
a bead or a dipstick (e.g., by hybridization, antibody capture, or
through an affinity interaction such as that between biotin and
avidin). Capture may facilitate the measuring of incorporated
label, or it may be an intermediate step before probe hybridization
or similar detection means. If the maximum amount of label is
desired to be incorporated into each transcript, it is preferred
that the copy template be very long, around 3 to 10 kilobases, so
that each RNA molecule will carry many labels. Alternatively, it
may be desired that a single site or a limited number of sites
within the transcript be specifically labeled. In this case, it may
be desirable to have a short copy template with only one or a few
residues that would allow incorporation of the labeled
nucleotide.
[0553] The copy template may also be selected to produce RNAs that
perform specified functions. In a simple case, if an
duplex-dependent intercalating fluorophore is to be used to detect
the RNA product, it may be desirable to transcribe an RNA that is
known to form duplexed secondary structures, such as a ribosomal
RNA or a tRNA. In another embodiment, the RNA may be designed to
interact specifically, or with particular affinity, with a
different substance. It has been shown that a process of
alternating steps of selection (e.g., by binding to a target
substance) and in vitro amplification (e.g., by PCR) can be used to
identify nucleic acid ligands with novel and useful properties
(Tuerk and Gold, Science 249:505 [1990]). This system has been used
to identify RNAs, termed ligands or aptamers, that bind tightly and
specifically to proteins and to other types of molecules, such as
antibiotics (Wang et al., Biochem. 35:12338 [1996]) and hormones.
RNAs can even be selected to bind to other RNAs through
non-Watson-Crick interactions (Schmidt et al., Ann. N.Y. Acad. Sci.
782:526 [1996]). A ligand RNA may be used to either inactivate or
enhance the activity of a molecule to which it binds. Any RNA
segment identified through such a process may also be produced by
the methods of the present invention, so that the observation of
the activity of the RNA ligand may be used as a specific sign of
the presence of the target material in the invasive cleavage
reaction. The ligand binding to its specific partner may also be
used as another way of capturing a readout signal to a solid
support.
[0554] The product RNA might also be designed to have a catalytic
function (e.g., to act as a ribozyme), allowing cleavage another
molecule to be indicative of the success of the primary invasive
cleavage reaction (Uhlenbeck, Nature 328:596 [1987]). In yet
another embodiment, the RNA may be made to encode a peptide
sequence. When coupled to an in vitro translation system (e.g., the
S-30 system derived from E. coli [Lesley, Methods Mol. Biol.,
37:265 (1985)], or a rabbit reticulocyte lysate system [Dasso and
Jackson, Nucleic Acids Res. 17:3129 (1989)], available from
Promega), the production of the appropriate protein may be
detected. In a preferred embodiment, the proteins produced include
those that allow either calorimetric or luminescent detection, such
as beta-galactosidase (lac-Z) or luciferase, respectively.
[0555] The above discussion focused on the use of the present
transcription visualization methods in the context of the
INVADER-directed cleavage assay (i.e., the non-target cleavage
products produced in the INVADER assay were used to complete and
activate a protein binding region, such as a promoter region).
However, the transcription visualization methods are not limited to
this context. Any assay that produces an oligonucleotide product
having relatively discrete ends can be used in conjunction with the
present transcription visualization methods. For example, the
homogenous assay described in U.S. Pat. No. 5,210,015, particularly
when conducted under conditions where polymerization cannot occur,
produces short oligonucleotide fragments as the result of cleavage
of a probe. If this assay is conducted under conditions where
polymerization occurs, the site of cleavage of the probe may be
focused through the use of nucleotide analogs that have uncleavable
linkages at particular positions within the probe. These short
oligonucleotides can be employed in a manner analogous to the cut
probe or non-target cleavage products produced in the invasive
cleavage reactions of the present invention. Additional assays that
generate suitable oligonucleotide products are known to the art.
For example, the non-target cleavage products produced in assays
such as the "Cycling Probe Reaction" (Duck et al., BioTech., 9:142
[1990] and U.S. Pat. Nos. 4,876,187 and 5,011,769, herein
incorporated by reference), in which shorter oligonucleotides are
released from longer oligonucleotides after hybridization to a
target sequence would be suitable, as would short restriction
fragments released in assays where a probe is designed to be
cleaved when successfully hybridized to an appropriate restriction
recognition sequence (U.S. Pat. No. 4,683,194, herein incorporated
by reference).
[0556] Assays that generate short oligonucleotides having "ragged"
(i.e., not discrete) 3' ends can also be employed with success in
the transcription reactions of the present invention when the
oligonucleotide provided by this non-transcription reaction are
used to provide a portion of the promoter region located downstream
of the other oligonucleotide(s) that are required to complete the
promoter region (that is a 3' tail or unpaired extension can be
tolerated when the oligonucleotide is being used as the "Cut Probe"
is in FIGS. 94 and 95A).
VII. Generation of 5' Nucleases Derived from Thermostable DNA
Polymerases
[0557] The 5' nucleases of the invention form the basis of a novel
detection assay for the identification of specific nucleic acid
sequences. FIG. 1A provides a schematic of one embodiment of the
detection method of the present invention. The target sequence is
recognized by two distinct oligonucleotides in the triggering or
trigger reaction. In a preferred embodiment, one of these
oligonucleotides is provided on a solid support. The other can be
provided free in solution. In FIG. 1A the free oligonucleotide is
indicated as a "primer" and the other oligonucleotide is shown
attached to a bead designated as type 1. The target nucleic acid
aligns the two oligonucleotides for specific cleavage of the 5' arm
(of the oligonucleotide on bead 1) by the 5' nucleases of the
present invention (not shown in FIG. 1A). The site of cleavage
(indicated by a large solid arrowhead) is controlled by the
position of the 3' end of the "primer" relative to the downstream
fork of the oligonucleotide on bead 1.
[0558] Successful cleavage releases a single copy of what is
referred to as the alpha signal oligonucleotide. This
oligonucleotide may contain a detectable moiety (e.g.,
fluorescein). On the other hand, it may be unlabeled.
[0559] In one embodiment of the detection method, two more
oligonucleotides are provided on solid supports. The
oligonucleotide shown in FIG. 1A on bead 2 has a region that is
complementary to the alpha signal oligonucleotide (indicated as
alpha prime) allowing for hybridization. This structure can be
cleaved by the 5' nucleases of the present invention to release the
beta signal oligonucleotide. The beta signal oligonucleotide can
then hybridize to type 3 beads having an oligonucleotide with a
complementary region (indicated as beta prime). Again, this
structure can be cleaved by the 5' nucleases of the present
invention to release a new alpha oligonucleotide.
[0560] Up to this point, the amplification has been linear. To
increase the power of the method, it is desired that the alpha
signal oligonucleotide hybridized to bead type 2 be liberated after
release of the beta oligonucleotide so that it may go on to
hybridize with other oligonucleotides on type 2 beads. Similarly,
after release of an alpha oligonucleotide from type 3 beads, it is
desired that the beta oligonucleotide be liberated.
[0561] With the liberation of signal oligonucleotides by such
techniques, each cleavage results in a doubling of the number of
signal oligonucleotides. In this manner, detectable signal can
quickly be achieved.
[0562] FIG. 1B provides a schematic of a second embodiment of the
detection method of the present invention. Again, the target
sequence is recognized by two distinct oligonucleotides in the
triggering or trigger reaction and the target nucleic acid aligns
the two oligonucleotides for specific cleavage of the 5' arm by the
DNAPs of the present invention (not shown in FIG. 1B). In this
specific example, the first oligonucleotide is completely
complementary to a portion of the target sequence. The second
oligonucleotide is partially complementary to the target sequence;
the 3' end of the second oligonucleotide is fully complementary to
the target sequence while the 5' end is non-complementary and forms
a single-stranded arm. The non-complementary end of the second
oligonucleotide may be a generic sequence that can be used with a
set of standard hairpin structures (described below). The detection
of different target sequences would require unique portions of two
oligonucleotides: the entire first oligonucleotide and the 3' end
of the second oligonucleotide. The 5' arm of the second
oligonucleotide can be invariant or generic in sequence.
[0563] The second part of the detection method allows the annealing
of the fragment of the second oligonucleotide liberated by the
cleavage of the first cleavage structure formed in the triggering
reaction (called the third or trigger oligonucleotide) to a first
hairpin structure. This first hairpin structure has a
single-stranded 5' arm and a single-stranded 3' arm. The third
oligonucleotide triggers the cleavage of this first hairpin
structure by annealing to the 3' arm of the hairpin thereby forming
a substrate for cleavage by the 5' nuclease of the present
invention. The cleavage of this first hairpin structure generates
two reaction products: 1) the cleaved 5' arm of the hairpin called
the fourth oligonucleotide, and 2) the cleaved hairpin structure
that now lacks the 5' arm and is smaller in size than the uncleaved
hairpin. This cleaved first hairpin may be used as a detection
molecule to indicate that cleavage directed by the trigger or third
oligonucleotide occurred. Thus, this indicates that the first two
oligonucleotides found and annealed to the target sequence thereby
indicating the presence of the target sequence in the sample.
[0564] The detection products may be amplified by having the fourth
oligonucleotide anneal to a second hairpin structure. This hairpin
structure has a 5' single-stranded arm and a 3' single-stranded
arm. The fourth oligonucleotide generated by cleavage of the first
hairpin structure anneals to the 3' arm of the second hairpin
structure thereby creating a third cleavage structure recognized by
the 5' nuclease. The cleavage of this second hairpin structure also
generates two reaction products: 1) the cleaved 5' arm of the
hairpin called the fifth oligonucleotide, and 2) the cleaved second
hairpin structure which now lacks the 5' arm and is smaller in size
than the uncleaved hairpin. In one embodiment, the fifth
oligonucleotide is similar or identical in sequence to the third
nucleotide. The cleaved second hairpin may be viewed as a detection
molecule that amplifies the signal generated by the cleavage of the
first hairpin structure. Simultaneously with the annealing of the
forth oligonucleotide, the third oligonucleotide is dissociated
from the cleaved first hairpin molecule so that it is free to
anneal to a new copy of the first hairpin structure. The
disassociation of the oligonucleotides from the hairpin structures
may be accomplished by heating or other means suitable to disrupt
base-pairing interactions. As described above, conditions may be
selected that allow the association and disassociation of
hybridized oligonucleotides without temperature cycling.
[0565] If fifth oligonucleotide is similar or identical in sequence
to the third oligonucleotide, further amplification of the
detection signal is achieved by annealing the fifth oligonucleotide
to another molecule of the first hairpin structure. Cleavage is
then performed and the oligonucleotide that is liberated then is
annealed to another molecule of the second hairpin structure.
Successive rounds of annealing and cleavage of the first and second
hairpin structures, provided in excess, are performed to generate a
sufficient amount of cleaved hairpin products to be detected.
[0566] As discussed above for other embodiments of detection using
structure-specific nuclease cleavage, any method known in the art
for analysis of nucleic acids, nucleic acid fragments or
oligonucleotides may be applied to the detection of these cleavage
products.
[0567] The hairpin structures may be attached to a solid support,
such as an agarose, styrene or magnetic bead, via the 3' end of the
hairpin. A spacer molecule may be placed between the 3' end of the
hairpin and the bead, if so desired. The advantage of attaching the
hairpin structures to a solid support is that this prevents the
hybridization of the two hairpin structures to one another over
regions which are complementary. If the hairpin structures anneal
to one another, this would reduce the amount of hairpins available
for hybridization to the primers released during the cleavage
reactions. If the hairpin structures are attached to a solid
support, then additional methods of detection of the products of
the cleavage reaction may be employed. These methods include, but
are not limited to, the measurement of the released single-stranded
5' arm when the 5' arm contains a label at the 5' terminus. This
label may be radioactive, fluorescent, biotinylated, etc. If the
hairpin structure is not cleaved, the 5' label will remain attached
to the solid support. If cleavage occurs, the 5' label will be
released from the solid support.
[0568] The 3' end of the hairpin molecule may be blocked through
the use of dideoxynucleotides. A 3' terminus containing a
dideoxynucleotide is unavailable to participate in reactions with
certain DNA modifying enzymes, such as terminal transferase.
Cleavage of the hairpin having a 3' terminal dideoxynucleotide
generates a new, unblocked 3' terminus at the site of cleavage.
This new 3' end has a free hydroxyl group that can interact with
terminal transferase thus providing another means of detecting the
cleavage products.
[0569] The hairpin structures are designed so that their
self-complementary regions are very short (generally in the range
of 3-8 base pairs). Thus, the hairpin structures are not stable at
the high temperatures at which this reaction is performed
(generally in the range of 50-75.degree. C.) unless the hairpin is
stabilized by the presence of the annealed oligonucleotide on the
3' arm of the hairpin. This instability prevents the polymerase
from cleaving the hairpin structure in the absence of an associated
primer thereby preventing false positive results due to
non-oligonucleotide directed cleavage.
VIII. Improved Enzymes for Use in INVADER Oligonucleotide-Directed
Cleavage Reactions
[0570] A cleavage structure is defined herein as a structure that
is formed by the interaction of a probe oligonucleotide and a
target nucleic acid to form a duplex, the resulting structure being
cleavable by a cleavage agent, including but not limited to an
enzyme. The cleavage structure is further defined as a substrate
for specific cleavage by the cleavage means in contrast to a
nucleic acid molecule that is a substrate for nonspecific cleavage
by agents such as phosphodiesterases. Examples of some possible
cleavage structures are shown in FIG. 15. In considering
improvements to enzymatic cleavage agents, one may consider the
action of said enzymes on any of these structures, and on any other
structures that fall within the definition of a cleavage structure.
The cleavage sites indicated on the structures in FIG. 15 are
presented by way of example. Specific cleavage at any site within
such a structure is contemplated.
[0571] Improvements in an enzyme may be an increased or decreased
rate of cleavage of one or more types of structures. Improvements
may also result in more or fewer sites of cleavage on one or more
of said cleavage structures. In developing a library of new
structure-specific nucleases for use in nucleic acid cleavage
assays, improvements may have many different embodiments, each
related to the specific substrate structure used in a particular
assay.
[0572] As an example, one embodiment of the INVADER
oligonucleotide-directed cleavage assay of the present invention
may be considered. In the INVADER oligonucleotide-directed cleavage
assay, the accumulation of cleaved material is influenced by
several features of the enzyme behavior. Not surprisingly, the
turnover rate, or the number of structures that can be cleaved by a
single enzyme molecule in a set amount of time, is very important
in determining the amount of material processed during the course
of an assay reaction. If an enzyme takes a long time to recognize a
substrate (e.g., if it is presented with a less-than-optimal
structure), or if it takes a long time to execute cleavage, the
rate of product accumulation is lower than if these steps proceeded
quickly. If these steps are quick, yet the enzyme "holds on" to the
cleaved structure, and does not immediately proceed to another
uncut structure, the rate will be negatively affected.
[0573] Enzyme turnover is not the only way in which enzyme behavior
can negatively affect the rate of accumulation of product. When the
means used to visualize or measure product is specific for a
precisely defined product, products that deviate from that
definition may escape detection, and thus the rate of product
accumulation may appear to be lower than it is. For example, if one
had a sensitive detector for trinucleotides that could not see di-
or tetranucleotides, or any sized oligonucleotide other that 3
residues, in the INVADER-directed cleavage assay of the present
invention any errant cleavage would reduce the detectable signal
proportionally. It can be seen from the cleavage data presented
here that, while there is usually one site within a probe that is
favored for cleavage, there are often products that arise from
cleavage one or more nucleotides away from the primary cleavage
site. These are products that are target-dependent, and are thus
not non-specific background. Nevertheless, if a subsequent
visualization system can detect only the primary product, these
represent a loss of signal. One example of such a selective
visualization system is the charge reversal readout presented
herein, in which the balance of positive and negative charges
determines the behavior of the products. In such a system the
presence of an extra nucleotide or the absence of an expected
nucleotide can excluded a legitimate cleavage product from ultimate
detection by leaving that product with the wrong balance of charge.
It can be easily seen that any assay that can sensitively
distinguish the nucleotide content of an oligonucleotide, such as
standard stringent hybridization, suffers in sensitivity when some
fraction of the legitimate product is not eligible for successful
detection by that assay.
[0574] These discussions suggest two highly desirable traits in any
enzyme to be used in the method of the present invention. First,
the more rapidly the enzyme executes an entire cleavage reaction,
including recognition, cleavage and release, the more signal it may
potentially created in the INVADER oligonucleotide-directed
cleavage assay. Second, the more successful an enzyme is at
focusing on a single cleavage site within a structure, the more of
the cleavage product can be successfully detected in a selective
read-out.
[0575] The rationale cited above for making improvements in enzymes
to be used in the INVADER oligonucleotide-directed cleavage assay
are meant to serve as an example of one direction in which
improvements might be sought, but not as a limit on either the
nature or the applications of improved enzyme activities. As
another direction of activity change that would be appropriately
considered improvement, the DNAP-associated 5' nucleases may be
used as an example. In creating some of the polymerase-deficient 5'
nucleases described herein it was found that the those that were
created by deletion of substantial portions of the polymerase
domain, as depicted in FIG. 4, assumed activities that were weak or
absent in the parent proteins. These activities included the
ability to cleave the non-forked structure shown in FIG. 15D, a
greatly enhanced ability to exonucleolytically remove nucleotides
from the 5' ends of duplexed strands, and a nascent ability to
cleave circular molecules without benefit of a free 5' end.
[0576] In addition to the 5' nucleases derived from DNA
polymerases, the present invention also contemplates the use of
structure-specific nucleases that are not derived from DNA
polymerases. For example, a class of eukaryotic and archaebacterial
endonucleases have been identified which have a similar substrate
specificity to 5' nucleases of Pol I-type DNA polymerases. These
are the FEN1 (Flap EndoNuclease), RAD2, and XPG (Xeroderma
Pigmentosa-complementation group G) proteins. These proteins are
involved in DNA repair, and have been shown to favor the cleavage
of structures that resemble a 5' arm that has been displaced by an
extending primer during polymerization, similar to the model
depicted in FIG. 15B. Similar DNA repair enzymes have been isolated
from single cell and higher eukaryotes and from archaea, and there
are related DNA repair proteins in eubacteria. Similar 5' nucleases
have also been associated with bacteriophage such as T5 and T7.
[0577] Recently, the 3-dimensional structures of DNAPTaq and T5
phage 5'-exonuclease (FIG. 58) were determined by X-ray diffraction
(Kim et al., Nature 376:612 [1995]; and Ceska et al, Nature 382:90
[1995]). The two enzymes have very similar 3-dimensional structures
despite limited amino acid sequence similarity. The most striking
feature of the T5 5'-exonuclease structure is the existence of a
triangular hole formed by the active site of the protein and two
alpha helices (FIG. 58). This same region of DNAPTaq is disordered
in the crystal structure, indicating that this region is flexible,
and thus is not shown in the published 3-dimensional structure.
However, the 5' nuclease domain of DNAPTaq is likely to have the
same structure, based its overall 3-dimensional similarity to T5
5'-exonuclease, and that the amino acids in the disordered region
of the DNAPTaq protein are those associated with alpha helix
formation. The existence of such a hole or groove in the 5'
nuclease domain of DNAPTaq was predicted based on its substrate
specificity (Lyamichev et al., supra).
[0578] It has been suggested that the 5' arm of a cleavage
structure must thread through the helical arch described above to
position said structure correctly for cleavage (Ceska et al.,
supra). One of the modifications of 5' nucleases described herein
opened up the helical arch portion of the protein to allow improved
cleavage of structures that cut poorly or not at all (e.g.,
structures on circular DNA targets that would preclude such
threading of a 5' arm). The gene construct that was chosen as a
model to test this approach was the one called CLEAVASE BN, which
was derived from DNAPTaq but does not contain the polymerase domain
(Ex. 2). It comprises the entire 5' nuclease domain of DNAP Taq,
and thus should be very close in structure to the T5 5'
exonuclease. This 5' nuclease was chosen to demonstrate the
principle of such a physical modification on proteins of this type.
The arch-opening modification of the present invention is not
intended to be limited to the 5' nuclease domains of DNA
polymerases, and is contemplated for use on any structure-specific
nuclease that includes such an aperture as a limitation on cleavage
activity. The present invention contemplates the insertion of a
thrombin cleavage site into the helical arch of DNAPs derived from
the genus Thermus as well as 5' nucleases derived from DNAPs
derived from the genus Thermus. The specific example shown herein
using the CLEAVASE BN/thrombin nuclease merely illustrates the
concept of opening the helical arch located within a nuclease
domain. As the amino acid sequence of DNAPs derived from the genus
Thermus are highly conserved, the teachings of the present
invention enable the insertion of a thrombin site into the helical
arch present in these DNAPs and 5' nucleases derived from these
DNAPs.
[0579] The opening of the helical arch was accomplished by
insertion of a protease site in the arch. This allowed
post-translational digestion of the expressed protein with the
appropriate protease to open the arch at its apex. Proteases of
this type recognize short stretches of specific amino acid
sequence. Such proteases include thrombin and factor Xa. Cleavage
of a protein with such a protease depends on both the presence of
that site in the amino acid sequence of the protein and the
accessibility of that site on the folded intact protein. Even with
a crystal structure it can be difficult to predict the
susceptibility of any particular region of a protein to protease
cleavage. Absent a crystal structure it must be determined
empirically.
[0580] In selecting a protease for a site-specific cleavage of a
protein that has been modified to contain a protease cleavage site,
a first step is to test the unmodified protein for cleavage at
alternative sites. For example, DNAPTaq and CLEAVASE BN nuclease
were both incubated under protease cleavage conditions with factor
Xa and thrombin proteases. Both nuclease proteins were cut with
factor Xa within the 5' nuclease domain, but neither nuclease was
digested with large amounts of thrombin. Thus, thrombin was chosen
for initial tests on opening the arch of the CLEAVASE BN
enzyme.
[0581] In the protease/CLEAVASE modifications described herein the
factor Xa protease cleaved strongly in an unacceptable position in
the unmodified nuclease protein, in a region likely to compromise
the activity of the end product. Other unmodified nucleases
contemplated herein may not be sensitive to the factor Xa, but may
be sensitive to thrombin or other such proteases. Alternatively,
they may be sensitive to these or other such proteases at sites
that are immaterial to the function of the nuclease sought to be
modified. In approaching any protein for modification by addition
of a protease cleavage site, the unmodified protein should be
tested with the proteases under consideration to determine which
proteases give acceptable levels of cleavage in other regions.
[0582] Working with the cloned segment of DNAPTaq from which the
CLEAVASE BN protein is expressed, nucleotides encoding a thrombin
cleavage site were introduced in-frame near the sequence encoding
amino acid 90 of the nuclease gene. This position was determined to
be at or near the apex of the helical arch by reference to both the
3-dimensional structure of DNAPTaq, and the structure of T5 5'
exonuclease. The encoded amino acid sequence, LVPRGS, was inserted
into the apex of the helical arch by site-directed mutagenesis of
the nuclease gene. The proline (P) in the thrombin cleavage site
was positioned to replace a proline normally in this position in
CLEAVASE BN because proline is an alpha helix-breaking amino acid,
and may be important for the 3-dimensional structure of this arch.
This construct was expressed, purified and then digested with
thrombin. The digested enzyme was tested for its ability to cleave
a target nucleic acid, bacteriophage M13 genomic DNA, that does not
provide free 5' ends to facilitate cleavage by the threading
model.
[0583] While the helical arch in this nuclease was opened by
protease cleavage, it is contemplated that a number of other
techniques could be used to achieve the same end. For example, the
nucleotide sequence could be rearranged such that, upon expression,
the resulting protein would be configured so that the top of the
helical arch (amino acid 90) would be at the amino terminus of the
protein, the natural carboxyl and amino termini of the protein
sequence would be joined, and the new carboxyl terminus would lie
at natural amino acid 89. This approach has the benefit that no
foreign sequences are introduced and the enzyme is a single amino
acid chain, and thus may be more stable that the cleaved 5'
nuclease. In the crystal structure of DNAPTaq, the amino and
carboxyl termini of the 5'-exonuclease domain lie in close
proximity to each other, which suggests that the ends may be
directly joined without the use of a flexible linker peptide
sequence as is sometimes necessary. Such a rearrangement of the
gene, with subsequent cloning and expression could be accomplished
by standard PCR recombination and cloning techniques known to those
skilled in the art.
[0584] The present invention also contemplates the use of nucleases
isolated from organisms that grow under a variety of conditions.
The genes for the FEN-1/XPG class of enzymes are found in organisms
ranging from bacteriophage to humans to the extreme thermophiles of
Kingdom Archaea. For assays in which high temperature is to be
used, it is contemplated that enzymes isolated from extreme
thermophiles may exhibit the thermostability required of such an
assay. For assays in which it might be desirable to have peak
enzyme activity at moderate temperature or in which it might be
desirable to destroy the enzyme with elevated temperature, those
enzymes from organisms that favor moderate temperatures for growth
may be of particular value.
[0585] An alignment of a collection of FEN-1 proteins sequenced by
others is shown in FIGS. 59A-E (SEQ ID NOS:135-145). It can be seen
from this alignment that there are some regions of conservation in
this class of proteins, suggesting that they are related in
function, and possibly in structure. Regions of similarity at the
amino acid sequence level can be used to design primers for in
vitro amplification (PCR) by a process of back translating the
amino acid sequence to the possible nucleic acid sequences, then
choosing primers with the fewest possible variations within the
sequences. These can be used in low stringency PCR to search for
related DNA sequences. This approach permits the amplification of
DNA encoding a FEN-1 nuclease without advance knowledge of the
actual DNA sequence.
[0586] It can also be seen from this alignment that there are
regions in the sequences that are not completely conserved. The
degree of difference observed suggests that the proteins may have
subtle or distinct differences is substrate specificity. In other
words, they may have different levels of cleavage activity on the
cleavage structures of the present invention. When a particular
structure is cleaved at a higher rate than the others, this is
referred to a preferred substrate, while a structure that is
cleaved slowly is considered a less preferred substrate. The
designation of preferred or less preferred substrates in this
context is not intended to be a limitation of the present
invention. It is contemplated that some embodiments the present
invention will make use of the interactions of an enzyme with a
less preferred substrate. Candidate enzymes are tested for
suitability in the cleavage assays of the present invention using
the assays described below.
[0587] 1. Structure Specific Nuclease Assay
[0588] Testing candidate nucleases for structure-specific
activities in these assays is done in much the same way as
described for testing modified DNA polymerases in Example 2, but
with the use of a different library of model structures. In
addition to assessing the enzyme performance in primer-independent
and primer-directed cleavage, a set of synthetic hairpins are used
to examine the length of duplex downstream of the cleavage site
preferred by the enzyme.
[0589] The FEN-1 and XPG 5' nucleases used in the present invention
should be tested for activity in the assays in which they are
intended to be used, including but not limited to the
INVADER-directed cleavage detection assay of the present invention
and the CFLP method of characterizing nucleic acids (the CFLP
method is described in U.S. Pat. Nos. 5,843,654, 5,843,669,
5,719,028, and 5,888,780 and PCT Publication WO 96/15267; the
disclosures of which are incorporated herein by reference). The
INVADER assay uses a mode of cleavage that has been termed "primer
directed" of "primer dependent" to reflect the influence of the an
oligonucleotide hybridized to the target nucleic acid upstream of
the cleavage site. In contrast, the CFLP reaction is based on the
cleavage of folded structure, or hairpins, within the target
nucleic acid, in the absence of any hybridized oligonucleotide. The
tests described herein are not intended to be limited to the
analysis of nucleases with any particular site of cleavage or mode
of recognition of substrate structures. It is contemplated that
enzymes may be described as 3' nucleases, utilizing the 3' end as a
reference point to recognize structures, or may have a yet a
different mode of recognition. Further, the use of the term 5'
nucleases is not intended to limit consideration to enzymes that
cleave the cleavage structures at any particular site. It refers to
a general class of enzymes that require some reference or access to
a 5' end to effect cleavage of a structure.
[0590] A set of model cleavage structures have been created to
allow the cleavage ability of unknown enzymes on such structures to
be assessed. Each of the model structures is constructed of one or
more synthetic oligonucleotides made by standard DNA synthesis
chemistry. Examples of such synthetic model substrate structures
are shown in FIGS. 26 and 60. These are intended only to represent
the general folded configuration desirable is such test structures.
While a sequence that would assume such a structure is indicated in
the Figures, there are numerous other sequence arrangements of
nucleotides that would be expected to fold in such ways. The
essential features to be designed into a set of oligonucleotides to
perform the tests described herein are the presence or absence of a
sufficiently long 3' arm to allow hybridization of an additional
nucleic acid to test cleavage in a "primer-directed" mode, and the
length of the duplex region. In the set depicted in FIG. 60, the
duplex lengths of the S-33 and the 11-8-0 structures are 12 and 8
basepairs, respectively. This difference in length in the test
molecules facilitates detection of discrimination by the candidate
nuclease between longer and shorter duplexes. Additions to this
series expanding the range of duplex molecules presented to the
enzymes, both shorter and longer, may be used. The use of a
stabilizing DNA tetraloop (Antao et al., Nucl. Acids Res., 19:5901
[1991]) or triloop (Hiraro et al., Nuc. Acids Res., 22:576 [1994])
at the closed end of the duplex helps ensure formation of the
expected structure by the oligonucleotide.
[0591] The model substrate for testing primer directed cleavage,
the "S-60 hairpin" (SEQ ID NO:40) is described in Example 11. In
the absence of a primer this hairpin is usually cleaved to release
5' arm fragments of 18 and 19 nucleotides length. An
oligonucleotide, termed P-14 (5'-CGAGAGACCACGCT-3'; SEQ ID NO:108),
that extends to the base of the duplex when hybridized to the 3'
arm of the S-60 hairpin gives cleavage products of the same size,
but at a higher rate of cleavage.
[0592] To test invasive cleavage a different primer is used, termed
P-15 (5'-CGAGAGACCACGCTG-3'; SEQ ID NO:30). In a successful
invasive cleavage the presence of this primer shifts the site of
cleavage of S-60 into the duplex region, usually releasing products
of 21 and 22 nucleotides length.
[0593] The S-60 hairpin may also be used to test the effects of
modifications of the cleavage structure on either primer-directed
or invasive cleavage. Such modifications include, but are not
limited to, use of mismatches or base analogs in the hairpin duplex
at one, a few or all positions, similar disruptions or
modifications in the duplex between the primer and the 3' arm of
the S-60, chemical or other modifications to one or both ends of
the primer sequence, or attachment of moieties to, or other
modifications of the 5' arm of the structure. In all of the
analyses using the S-60 or a similar hairpin described herein,
activity with and without a primer may be compared using the same
hairpin structure.
[0594] The assembly of these test reactions, including appropriate
amounts of hairpin, primer and candidate nuclease are described in
Example 2. As cited therein, the presence of cleavage products is
indicated by the presence of molecules which migrate at a lower
molecular weight than does the uncleaved test structure. When the
reversal of charge of a label is used the products will carry a
different net charge than the uncleaved material. Any of these
cleavage products indicate that the candidate nuclease has the
desired structure-specific nuclease activity. By "desired
structure-specific nuclease activity" it is meant only that the
candidate nuclease cleaves one or more test molecules. It is not
necessary that the candidate nuclease cleave at any particular rate
or site of cleavage to be considered successful cleavage.
IX. The INVADER Assay for Direct Detection and Measurement of
Specific Analytes.
[0595] The following description provides illustrative examples of
target sequence detection through the use of the compositions and
methods of the present invention. These example include the
detection of human cytomegalovirus viral DNA, single nucleotide
polymorphisms in the human apolipoprotein E gene, mutations in the
human hemochromatosis gene, mutations in the human MTHFR,
prothrombin 20210GA polymorphism, the HR-2 mutation in the human
Factor V gene, single nucleotide polymorphisms in the human
TNF-.alpha. Gene, and Leiden mutation in the human Factor V gene.
Included in these descriptions are novel nucleic acid compositions
for use in the detection of such sequence. Examples 54-61 below
provide details on the design and execution of these illustrative
embodiments.
[0596] A. Detection of Human Cytomegalovirus Viral DNA by Invasive
Cleavage
[0597] Human cytomegalovirus (HCMV) causes, or is associated with,
a wide variety of diseases in humans (Table 3). More than 90% of
bone marrow or kidney transplant recipients (immunocompromised
hosts) develop HCMV infections, most of which are due to
reactivation of latent virus by immunosuppressive drugs, as well as
transmission of virus by latently infected donor tissue or blood
(Ackerman et al., Transplant. Proc., 20(S1):468 [1988]; and
Peterson et al., Medicine 59:283 [1980]).
TABLE-US-00003 TABLE 3 {PRIVATE} Diseases Caused By Human
Cytomegalovirus cytomegalic inclusion heterophil-negative disease
in neonates mononucleosis interstitial pneumonia pneumonitis
retinitis hepatitis pancreatitis meningoencephalitis
gastrointestinal disease disseminated infection
[0598] There are instances in which rapid, sensitive, and specific
diagnosis of HCMV disease is imperative. In recent years, the
number of patients undergoing organ and tissue transplantations has
increased markedly. HCMV is the most frequent cause of death in
immunocompromised transplant recipients, thereby confirming the
need for rapid and reliable laboratory diagnosis. Lymphocytes,
monocytes, and possibly arterial endothelial or smooth muscle
cells, are sites of HCMV latency. Therefore, prevention of HCMV
infections in immunocompromised individuals (e.g., transplant
recipients) includes use of HCMV-negative blood products and
organs. Additionally, HCMV can be spread transplacentally, and to
newborns by contact with infected cervical secretions during birth.
Thus, a rapid, sensitive, and specific assay for detecting HCMV in
body fluids or secretions may be desirable as a means to monitor
infection, and consequently, determine the necessity of cesarean
section.
[0599] Diagnosis of HCMV infection may be performed by conventional
cell culture using human fibroblasts; shell vial centrifugation
culture utilizing monoclonal antibodies and immunofluorescent
staining techniques; serological methods; the HCMV antigenemia
assay which employs a monoclonal antibody to detect HCMV antigen in
peripheral blood leukocytes (PBLs); or by nucleic acid
hybridization assays. These various methods have their advantages
and limitations. Conventional cell culture is sensitive but slow,
as cytopathic effect (CPE) may take 30 or more days to develop.
Shell vial centrifugation is more rapid but still requires 24-48
hours for initial results. Both culture methods are affected by
antiviral therapy. In immunocompromised patients, the ability to
mount IgG and/or IgM antibody responses to HCMV infection are
impaired, and serological methods are thus not reliable in this
setting. Alternatively, IgM antibodies may be persistent for months
after infection is resolved, and thus their presence may not be
indicative of active infection. The HCMV antigenemia assay is labor
intensive and is not applicable to specimens other than PBLs.
[0600] Recent advances in molecular biology have spurred the use of
DNA probes in attempts to provide a more rapid, sensitive and
specific assay for detecting HCMV in clinical specimens. For
example, radiolabeled DNA probes have been used to hybridize to
tissue cultures infected with or by HCMV, or in clinical samples
suspected of containing HCMV ("hybridization assays"). However,
probing of tissue cultures requires at least 18-24 hours for growth
to amplify the antigen (HCMV) to be detected, if present, and
additional time for development of autoradiographic detection
systems. Using hybridization assays for assaying clinical specimens
for HCMV may lack sensitivity, depending upon the titer of virus
and the clinical sample assayed. Detection of HCMV in clinical
samples has been reported using the polymerase chain reaction (PCR)
to enzymatically amplify HCMV DNA. Methods using PCR compare
favorably with virus isolation, in situ hybridization assays, and
Southern blotting; See, e.g., Bamborschke et al., J. Neurol.,
239:205 [1992]; Drouet et al., J. Virol. Meth., 45:259 [1993];
Einsele et al., Blood 77:1104-1110 [1991]; Einsele et al., Lancet
338:1170 [1991]; Lee et al., Aust. NZ J. Med., 22:249 [1992];
Miller et al., J. Clin. Microbiol., 32:5 [1994]; Rowley et al.,
Transplant. 51:1028 [1991]; Spector et al. J. Clin. Microbiol.,
30:2359 [1992]; and Stanier et al., Mol. Cell. Probes 8:51 [1992]).
Others, comparing the HCMV antigenemia assay with PCR methods, have
found PCR methods as efficient or slightly more efficient in the
detection of HCMV (van Dorp et al. (1992) Transplant. 54:661; Gerna
et al. (1991) J. Infect. Dis. 164:488; Vleiger et al. (1992) Bone
Marrow Transplant. 9:247; Zipeto et al. (1992) J. Clin. Microbiol.
30:527]. In addition, PCR methods have exhibited great sensitivity
when specimens other than PBLs are assayed (Natori et al.,
Kansenshogaku Zasshi 67:1011 [1993]; Peterson et al., Medicine
59:283 [1980]; Prosch et al., J. Med. Virol., 38:246 [1992];
Ratnamohan et al., J. Med. Virol. 38:252 [1992]). However, because
of the dangers of false positive reactions, these PCR-based
procedures require rigid controls to prevent contamination and
carry over (Ehrlich et al., in PCR-Based Diagnostics in Infectious
Diseases, Ehrlich and Greenberg (eds), Blackwell Scientific
Publications, [1994], pp. 3-18). Therefore, there exists a need for
a rapid, sensitive, and specific assay for HCMV that has a reduced
risk of false positive result due to contamination by reaction
product carried over from other samples.
[0601] As shown herein, the INVADER-directed cleavage assay is
rapid, sensitive and specific. Because the accumulated products do
not contribute to the further accumulation of signal, reaction
products carried over from one standard (i.e., non-sequential)
INVADER-directed cleavage assay to another cannot promote false
positive results. The use of multiple sequential INVADER-directed
cleavage assays will further boost the sensitivity of HCMV
detection without sacrifice of these advantages.
[0602] B. Detection of Single Nucleotide Polymorphisms in the Human
Apolipoprotein E Gene
[0603] Apolipoprotein E (ApoE) performs various functions as a
protein constituent of plasma lipoproteins, including its role in
cholesterol metabolism. It was first identified as a constituent of
liver-synthesized very low density lipoproteins which function in
the transport of triglycerides from the liver to peripheral
tissues. There are three major isoforms of ApoE, referred to as
ApoE2, ApoE3 and ApoE4 which are products of three alleles at a
single gene locus. Three homozygous phenotypes (Apo-E2/2, E3/3, and
E4/4) and three heterozygous phenotypes (ApoE3/2, E4/3 and E4/2)
arise from the expression of any two of the three alleles. The most
common phenotype is ApoE3/3 and the most common allele is E3. See
Mahley, R. W., Science 240:622-630 (1988).
[0604] The amino acid sequences of the three types differ only
slightly. ApoE4 differs from ApoE3 in that in ApoE4 arginine is
substituted for the normally occurring cysteine at amino acid
residue 112. The most common form of ApoE2 differs from ApoE3 at
residue 158, where cysteine is substituted for the normally
occurring arginine. See Mahley, Science, supra.
[0605] The frequency of the apoE4 allele has been shown to be
markedly increased in sporadic Alzheimer's Disease (AD) (Poirier,
J. et al., 1993, Apolipoprotein E phenotype and Alzheimer's
Disease, Lancet, 342:697-699; Noguchi, S. et al., 1993, Lancet
(letter), 342:737) and late onset familial Alzheimer's disease (AD)
(Corder, E. H. et al., 1993, Science, 261:921-923; Payami, H. et
al., 1993, Lancet (letter), 342:738). This gene dosage effect was
observed in both sporadic and familial cases (i.e., as age of onset
increases, E4 allele copy number decreases). Women, who are
generally at a greater risk of developing Alzheimer's disease, show
increased E4 allele frequency when compared to age matched men.
[0606] C. Detection of Mutations in the Human Hemochromatosis
Gene
[0607] Hereditary hemochromatosis (HH) is an inherited disorder of
iron metabolism wherein the body accumulates excess iron. In
symptomatic individuals, this excess iron leads to deleterious
effects by being deposited in a variety of organs leading to their
failure, and resulting in cirrhosis, diabetes, sterility, and other
serious illnesses.
[0608] HH is inherited as a recessive trait; heterozygotes are
asymptomatic and only homozygotes are affected by the disease. It
is estimated that approximately 10% of individuals of Western
European descent carry an HH gene mutation and that there are about
one million homozygotes in the United States. Although ultimately
HH produces debilitating symptoms, the majority of homozygotes have
not been diagnosed. Indeed, it has been estimated that no more than
10,000 people in the United States have been diagnosed with this
condition. The symptoms are often confused with those of other
conditions, and the severe effects of the disease often do not
appear immediately. It would be desirable to provide a method to
identify persons who are ultimately destined to become symptomatic
in order to intervene in time to prevent excessive tissue damage.
One reason for the lack of early diagnosis is the inadequacy of
presently available diagnostic methods to ascertain which
individuals are at risk.
[0609] Although blood iron parameters can be used as a screening
tool, a confirmed diagnosis often employs HLA typing, which is
tedious, nonspecific, and expensive and/or liver biopsy which is
undesirably invasive and costly. Accordingly, others have attempted
to develop inexpensive and noninvasive diagnostics both for
detection of homozygotes having existing disease, in that
presymptomatic detection would guide intervention to prevent organ
damage, and for identification of carriers. The need for such
diagnostics is documented for example, in Finch, C. A. West J Med
(1990) 153:323-325; McCusick, V. et al. Mendelian Inheritance in
Man 11th ed., Johns Hopkins University Press (Baltimore, 1994) pp.
1882-1887; Report of the Joint World Health Organization/HH
Foundation/French HH Association Meeting, 1993.
[0610] D. Detection of Mutations in the Human MTHFR
[0611] Folic acid derivatives are coenzymes for several critical
single-carbon transfer reactions, including reactions in the
biosynthesis of purines, thymidylate and methionine.
Methylenetetrahydrofolate reductase (MTHFR; EC 1.5.1.20) catalyzes
the NADPH-linked reduction of 5,10-methylenetetrahydrofolate to
5-methyltetrahydrofolate, a co-substrate for methylation of
homocysteine to methionine. The porcine liver enzyme, a
flavoprotein, has been purified to homogeneity; it is a homodimer
of 77-kDa subunits. Partial proteolysis of the porcine peptide has
revealed two spatially distinct domains: an N-terminal domain of 40
kDa and a C-terminal domain of 37 kDa. The latter domain contains
the binding site for the allosteric regulator
S-adenosylmethionine.
[0612] Hereditary deficiency of MTHFR, an autosomal recessive
disorder, is the most common inborn error of folic acid metabolism.
A block in the production of methyltetrahydrofolate leads to
elevated homocysteine with low to normal levels of methionine.
Patients with severe deficiencies of MTHFR (0-20% activity in
fibroblasts) can have variable phenotypes. Developmental delay,
mental retardation, motor and gait abnormalities, peripheral
neuropathy, seizures and psychiatric disturbances have been
reported in this group, although at least one patient with severe
MTHFR deficiency was asymptomatic. Pathologic changes in the severe
form include the vascular changes that have been found in other
conditions with elevated homocysteine, as well as reduced
neurotransmitter and methionine levels in the CNS. A milder
deficiency of MTHFR (35-50% activity) has been described in
patients with coronary artery disease. Genetic heterogeneity is
likely, considering the diverse clinical features, the variable
levels of enzyme activity, and the differential heat inactivation
profiles of the reductase in patients' cells. Methods to detect the
MTHFR mutation include: AS-PCR (Hessner, et al. Br J Haematol 106,
237-9 (1999)) and PCR-RFLP (Nature Genetics, Frosst et al. 1995:10;
111-113).
[0613] E. Detection of Prothrombin 20210GA Polymorphism and the
Factor V Leiden Polymorphism
[0614] The coagulation cascade is a complex series of zymogen
activations, inactivations and feed back loops involving numerous
enzymes and their cofactors. The entire cascade, from tissue injury
or venous trauma to clotting has been well described (refs). The
cascade culminates in the conversion of prothrombin (Factor II) to
thrombin. This is catalyzed by the activated form of factor X,
factor Xa and its cofactor, activated factor V, factor Va. Thrombin
then converts fibrinogen to fibrin and promotes fibrin
cross-linking and clot formation by activating factor XIII. In
addition to the above stated functions, thrombin a serine protease,
can also activate factor V in a positive feed-back loop. Factor Va
is a pro-coagulant cofactor in the clotting cascade, and when clot
formation is sufficient, is inactivated by activated protein C
(APC).
[0615] Venous thrombosis is the obstruction of the circulation by
clots that have been formed in the veins or have been released from
a thrombus formed elsewhere. The most frequent sites of clot
formation are the deep veins of the legs, but it also may occur in
veins in the brain, retina, liver and mesentery. Factors other than
heritable defects that can play a role in the development of
thrombosis include recent surgery, malignant disorders, pregnancy
and labor and long term immobilization.
[0616] Studies of hereditary thrombophilia, defined as an increased
tendency towards venous thrombotic disease in relatively young
adults, have provided insights into the genetic factors that
regulate thrombosis. In 1993, Dahlback et al. (Proc Natl Acad Sci
USA 1993; 90:1004-1008) described an insensitivity to APC, a
critical anti-coagulant in the clotting cascade, in three unrelated
families with hereditary thrombophilia. The anticoagulant property
of APC resides in its capacity to inactivate the activated
cofactors Va and VIIIa by limited proteolysis (ref 3). This
inactivation of cofactors Va and VIIIa results in reduction of the
rate of formation of thrombin, the end product of the cascade. This
observation was confirmed by other investigators (ref) and the term
"APC resistance" was coined to describe this particular phenotype
in thrombophilic patients. In a subsequent study of 20 families
with thrombophilia and APC resistance, an autosomal dominant
pattern of inheritance was observed (17). Bertina et al (Nature,
1994, May 5; 369 (6475):64-7) then demonstrated that the phenotype
of APC resistance is associated with heterozygosity or homozygosity
for a single point mutation at nucleotide 1691 in exon 10 of the
factor V gene. This single base change, a guanine to adenine
substitution, yields a mutant factor V molecule wherein the
arginine at position 506 is replaced with glutamine. This form of
the factor V molecule, characterized at Leiden University,
(Bertenia et al) is known as the FV Q506 or FV Leiden mutation, and
is inactivated less efficiently by APC than the wild type protein.
It has been postulated that the prolonged circulation of activated
factor V promotes a hypercoagulable state and increases the risk of
thrombosis. Subsequent analysis of various patient groups
exhibiting symptoms of venous thrombosis indicate that the factor V
Leiden mutation is the single most common heritable factor
contributing to an increased risk of venous thrombosis.
[0617] In 1996, studies by Poort et al. (Blood. 1996:88; 3698-703)
revealed the second most common heritable factor contributing to
increase thrombotic risk. In studying the sequence of the
prothrombin gene in selected patients with a documented familial
history of venous thrombophilia, the Poort group identified a
single point mutation in the 3' untranslated region. This G to A
transition at position 20210 is strongly correlated with elevated
plasma prothrombin levels, and was also shown to be associated with
an almost threefold increased risk of venous thrombosis (abstract,
Howard)
[0618] The first reported case of a thrombophilia pateint
genetically homozygous for the G to A polymorphism in the 3'
untranslated region was by Howard, et al (Blood Coagulation
Fibrinolysis 1997 July; 8(5):316-9). The patient, a healthy young
Mexican male presented with a myocardial infarction, venous
thrombosis and embolism. The patient was found to be homozygous for
the prothrombin mutation and heterozygous for the Factor V Leiden
mutation, supporting the doublehit theory for thrombophilia in
young patients.
[0619] Studies by Hessner et al. show that the prothrombin 20210GA
genotype was nearly 5 times as prevalent in the symptomoatic FVL
carriers than in a random Caucasian control group (British Journal
of Haematology, 1999, 106), and that allele frequencies for the
prothrombin and Factor V mutants vary among different ethnic
backgrounds (Thromb Haemostat 1999; 81: 733-8). The above
discussion confirms that early detection of the factor V Leiden
mutation and the factor II prothrombin mutation are paramount in
hereditary thrombotic risk assessment. The nature of these two
mutations, that is, a single base change in the nucleic acid
sequence, make them amenable to a variety of nucleic acid detection
methods known to the art, though the demand for faster, more
reliable, cost-effective and user-friendly tests for the detection
of specific nucleic acid sequences continues to grow. The most
common methods to test for these mutations include PCR/RFLP, AS-PCR
and functional, coagulation assay.
[0620] F. Detection of the HR-2 Mutation in the Human Factor V
Gene
[0621] The R-2 polymorphism is located in exon 13 of the factor V
gene, and is the result of an A to G transition at base 4070,
replacing the wild-type amino acid histine with the mutant argenine
in the mature protein. The R-2 polymorphism is one of a set of
mutations termed collectively HR-2. The HR-2 haplotype is defined
by 6 nucleotide base substitutions in exons 13 and 16 of the factor
V gene. The haplotype is associated with an increased functional
resistance to activated protein C both in normal subjects and in
thrombophilic patients. When present as a compound heterozygote in
conjunction with the factor V Leiden mutation, clinical symptoms
are comparable to those seen in patients homozygous for the factor
V Leiden mutation, and include increased risk of deep vein
thrombosis.
[0622] G. Detection of Single Nucleotide Polymorphisms in the Human
TNF-.alpha.Gene
[0623] The human cytokine tumor necrosis factor alpha (TNF-alpha)
has been shown to be a major factor in graft rejection; the more
TNF-alpha present in the system, the greater the rejection response
to transplanted tissue. Mutations in TNF-alpha have also been
correlated with cerebral malaria (Nature 1994; 371:508-510),
fulminas purpura (J Infect Dis. 1996; 174:878-880), and
mucocutaneous leishmaniaisis (J Exp Med. 1995; 182:1259-1264). The
mutation detected in this example is located in the promoter region
of the TNF-alpha gene at position minus 308. The wild-type guanine
(G) is replaced with a mutant adenine (A). This result of this
promoter mutation is the enhancement of transcription of TNF-alpha
by 6-7 fold. Methods to detect mutations in TNF-alpha include
sequencing, denaturing gradient gel electorphoresis, PCR methods,
and methods involving both PCR and post-PCR hybridization with
specific oligos.
[0624] H. Detection of Methicillin Resistant Staphylococcus
aureus
[0625] Staphylococcus aureus is recognized as one of the major
causes of infections in humans occurring in both in the hospital
and in the community at large. One of the most serious concerns in
treating any bacterial infection is the increasing resistance to
antibiotics. The growing incidence of methicillin-resistant S.
aureus (MRSA) infections worldwide has underscored the importance
of both early detection of the infective agent, and defining a
resistance profile such that proper treatment can be given. The
primary mechanism for resistance to methicillin involves the
production of a protein called PBP2a, encoded by the mecA gene. The
mecA gene not specific to Staphalococcus aureus, but is of
extraspecies origin. The mecA gene is however, indicative of
methicillin resistance and is used as a marker for the detection of
resistant bacteria. So, to identify methicillin resistant S. aureus
via nucleic acid techniques, both the mecA gene and at least one
species specific gene must be targeted. A particular species
specific gene, the nuclease or nuc gene is used in the following
example. Methods used to detect MRSA include time consuming and
laborious culturing and coagulation assays and growth assays on
antibiotic media. Molecular approaches include a Cycling Probe.TM.
assay, the Velogene.TM. Kit from Alexon-Trend (Ramsey, Minn. cat
#818-48), anti-body test which bind the PBP2a protein, bDNA Assay
(Chiron, Emeryville, Calif.), all of which tests only for the
presence of the mecA gene and are not Staph. aureus specific.
EXAMPLES
[0626] The following examples serve to illustrate certain preferred
embodiments and aspects of the present invention and are not to be
construed as limiting the scope thereof.
[0627] In the disclosure which follows, the following abbreviations
apply: Afu (Archaeoglobus fulgidus); Mth (Methanobacterium
thermoautotrophicum); Mja (Methanococcus jannaschii); Pfu
(Pyrococcus furiosus); Pwo (Pyrococcus woesei); Taq (Thermus
aquaticus); Taq DNAP, DNAPTaq, and Taq Pol I (T. aquaticus DNA
polymerase I); DNAPStf (the Stoffel fragment of DNAPTaq); DNAPEcl
(E. coli DNA polymerase I); Tth (Thermus thermophilus); Ex.
(Example); Fig. (Figure); .degree. C. (degrees Centigrade); g
(gravitational field); hr (hour); min (minute); olio
(oligonucleotide); r.times.n (reaction); vol (volume); w/v (weight
to volume); v/v (volume to volume); BSA (bovine serum albumin);
CTAB (cetyltrimethylammonium bromide); HPLC (high pressure liquid
chromatography); DNA (deoxyribonucleic acid); p (plasmid); .mu.l
(microliters); ml (milliliters); .mu.g (micrograms); mg
(milligrams); M (molar); mM (milliMolar); .mu.M (microMolar);
pmoles (picomoles); amoles (attomoles); zmoles (zeptomoles); nm
(nanometers); kdal (kilodaltons); OD (optical density); EDTA
(ethylene diamine tetra-acetic acid); FITC (fluorescein
isothiocyanate); SDS (sodium dodecyl sulfate); NaPO.sub.4 (sodium
phosphate); NP-40 (Nonidet P-40); Tris
(tris(hydroxymethyl)-aminomethane); PMSF
(phenylmethylsulfonylfluoride); TBE (Tris-Borate-EDTA, i.e., Tris
buffer titrated with boric acid rather than HCl and containing
EDTA); PBS (phosphate buffered saline); PPBS (phosphate buffered
saline containing 1 mM PMSF); PAGE (polyacrylamide gel
electrophoresis); Tween (polyoxyethylene-sorbitan); ATCC (American
Type Culture Collection, Rockville, Md.); Coriell (Coriell Cell
Repositories, Camden, N.J.); DSMZ (Deutsche Sammlung von
Mikroorganismen und Zellculturen, Braunschweig, Germany); Ambion
(Ambion, Inc., Austin, Tex.); Boehringer (Boehringer Mannheim
Biochemical, Indianapolis, Ind.); MJ Research (MJ Research,
Watertown, Mass.; Sigma (Sigma Chemical Company, St. Louis, Mo.);
Dynal (Dynal A. S., Oslo, Norway); Gull (Gull Laboratories, Salt
Lake City, Utah); Epicentre (Epicentre Technologies, Madison,
Wis.); Lampire (Biological Labs., Inc., Coopersberg, Pa.); MJ
Research (MJ Research, Watertown, Mass.); National Biosciences
(National Biosciences, Plymouth, Minn.); NEB (New England Biolabs,
Beverly, Mass.); Novagen (Novagen, Inc., Madison, Wis.); Perkin
Elmer (Perkin-Elmer/ABI, Norwalk, Conn.); Promega (Promega, Corp.,
Madison, Wis.); Stratagene (Stratagene Cloning Systems, La Jolla,
Calif.); Clonetech (Clonetech, Palo Alto, Calif.) Pharmacia
(Pharmacia, Piscataway, N.J.); Milton Roy (Milton Roy, Rochester,
N.Y.); Amersham (Amersham International, Chicago, Ill.); and USB
(U.S. Biochemical, Cleveland, Ohio). Glen Research (Glen Research,
Sterling, Va.); Coriell (Coriell Cell Repositories, Camden, N.J.);
Gentra (Gentra, Minneapolis, Minn.); Third Wave Technologies (Third
Wave Technologies, Madison, Wis.); PerSeptive Biosystems
(PerSeptive Biosystems, Framington, Mass.); Microsoft (Microsoft,
Redmond, Wash.); Qiagen (Qiagen, Valencia, Calif.); Molecular
Probes (Molecular Probes, Eugene, Oreg.); VWR (VWR Scientific,);
Advanced Biotechnologies (Advanced Biotechnologies, INC., Columbia,
Md.); and Perkin elmer (Perkin Elmer,).
Example 1
Characteristics of Native Thermostable DNA Polymerases
[0628] A. 5' Nuclease Activity of DNAPTaq
[0629] During the polymerase chain reaction (PCR) (Saiki et al.,
Science 239:487 [1988]; Mullis and Faloona, Meth. Enzymol., 155:335
[1987]), DNAPTaq is able to amplify many, but not all, DNA
sequences. One sequence that cannot be amplified using DNAPTaq is
shown in FIG. 5 (Hairpin structure is SEQ ID NO:15, FIG. 5 also
shows a primer: SEQ ID NO:17) This DNA sequence has the
distinguishing characteristic of being able to fold on itself to
form a hairpin with two single-stranded arms, which correspond to
the primers used in PCR.
[0630] To test whether this failure to amplify is due to the 5'
nuclease activity of the enzyme, the abilities of DNAPTaq and
DNAPStf to amplify this DNA sequence during 30 cycles of PCR were
compared. Synthetic oligonucleotides were obtained from The
Biotechnology Center at the University of Wisconsin-Madison. The
DNAPTaq and DNAPStf were from Perkin Elmer (i.e., AMPLITAQ DNA
polymerase and the Stoffel fragment of AMPLITAQ DNA polymerase).
The substrate DNA comprised the hairpin structure shown in FIG. 6
cloned in a double-stranded form into pUC19. The primers used in
the amplification are listed as SEQ ID NOS:16-17. Primer SEQ ID
NO:17 is shown annealed to the 3' arm of the hairpin structure in
FIG. 5. Primer SEQ ID NO:16 is shown as the first 20 nucleotides in
bold on the 5' arm of the hairpin in FIG. 5.
[0631] Polymerase chain reactions comprised 1 ng of supercoiled
plasmid target DNA, 5 pmoles of each primer, 40 .mu.M each dNTP,
and 2.5 units of DNAPTaq or DNAPStf, in a 50 .mu.l solution of 10
mM Tris.Cl pH 8.3. The DNAPTaq reactions included 50 mM KCl and 1.5
mM MgCl.sub.2. The temperature profile was 95.degree. C. for 30
sec., 55.degree. C. for 1 min. and 72.degree. C. for 1 min.,
through 30 cycles. Ten percent of each reaction was analyzed by gel
electrophoresis through 6% polyacrylamide (cross-linked 29:1) in a
buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA.
[0632] The results are shown in FIG. 6. The expected product was
made by DNAPStf (indicated simply as "S") but not by DNAPTaq
(indicated as "T"). It was concluded that the 5' nuclease activity
of DNAPTaq is responsible for the lack of amplification of this DNA
sequence.
[0633] To test whether the 5' unpaired nucleotides in the substrate
region of this structured DNA are removed by DNAPTaq, the fate of
the end-labeled 5' arm during four cycles of PCR was compared using
the same two polymerases (FIG. 7). The hairpin templates, such as
the one described in FIG. 5, were made using DNAPStf and a
.sup.32P-5'-end-labeled primer. The 5'-end of the DNA was released
as a few large fragments by DNAPTaq but not by DNAPStf. The sizes
of these fragments (based on their mobilities) show that they
contain most or all of the unpaired 5' arm of the DNA. Thus,
cleavage occurs at or near the base of the bifurcated duplex. These
released fragments terminate with 3' OH groups, as evidenced by
direct sequence analysis, and the abilities of the fragments to be
extended by terminal deoxynucleotidyl transferase.
[0634] FIGS. 8-10 show the results of experiments designed to
characterize the cleavage reaction catalyzed by DNAPTaq. Unless
otherwise specified, the cleavage reactions comprised 0.01 pmoles
of heat-denatured, end-labeled hairpin DNA (with the unlabeled
complementary strand also present), 1 pmole primer (complementary
to the 3' arm) and 0.5 units of DNAPTaq (estimated to be 0.026
pmoles) in a total volume of 10 .mu.l of 10 mM Tris-Cl, ph 8.5, 50
mM KCl and 1.5 mM MgCl.sub.2. As indicated, some reactions had
different concentrations of KCl, and the precise times and
temperatures used in each experiment are indicated in the
individual Figures. The reactions that included a primer used the
one shown in FIG. 5 (SEQ ID NO:17). In some instances, the primer
was extended to the junction site by providing polymerase and
selected nucleotides.
[0635] Reactions were initiated at the final reaction temperature
by the addition of either the MgCl.sub.2 or enzyme. Reactions were
stopped at their incubation temperatures by the addition of 8 .mu.l
of 95% formamide with 20 mM EDTA and 0.05% marker dyes. The T.sub.m
calculations listed were made using the Oligo.TM. primer analysis
software from National Biosciences, Inc. These were determined
using 0.25 .mu.M as the DNA concentration, at either 15 or 65 mM
total salt (the 1.5 mM MgCl.sub.2 in all reactions was given the
value of 15 mM salt for these calculations).
[0636] FIG. 8 is an autoradiogram containing the results of a set
of experiments and conditions on the cleavage site. FIG. 8A is a
determination of reaction components that enable cleavage.
Incubation of 5'-end-labeled hairpin DNA was for 30 minutes at
55.degree. C., with the indicated components. The products were
resolved by denaturing polyacrylamide gel electrophoresis and the
lengths of the products, in nucleotides, are indicated. FIG. 8B
describes the effect of temperature on the site of cleavage in the
absence of added primer. Reactions were incubated in the absence of
KCl for 10 minutes at the indicated temperatures. The lengths of
the products, in nucleotides, are indicated.
[0637] Surprisingly, cleavage by DNAPTaq requires neither a primer
nor dNTPs (See FIG. 8A). Thus, the 5' nuclease activity can be
uncoupled from polymerization. Nuclease activity requires magnesium
ions, though manganese ions can be substituted, albeit with
potential changes in specificity and activity. Neither zinc nor
calcium ions support the cleavage reaction. The reaction occurs
over a broad temperature range, from 25.degree. C. to 85.degree.
C., with the rate of cleavage increasing at higher
temperatures.
[0638] Still referring to FIG. 8, the primer is not elongated in
the absence of added dNTPs. However, the primer influences both the
site and the rate of cleavage of the hairpin. The change in the
site of cleavage (FIG. 8A) apparently results from disruption of a
short duplex formed between the arms of the DNA substrate. In the
absence of primer, the sequences indicated by underlining in FIG. 5
could pair, forming an extended duplex. Cleavage at the end of the
extended duplex would release the 11 nucleotide fragment seen on
the FIG. 8A lanes with no added primer. Addition of excess primer
(FIG. 8A, lanes 3 and 4) or incubation at an elevated temperature
(FIG. 8B) disrupts the short extension of the duplex and results in
a longer 5' arm and, hence, longer cleavage products.
[0639] The location of the 3' end of the primer can influence the
precise site of cleavage. Electrophoretic analysis revealed that in
the absence of primer (FIG. 8B), cleavage occurs at the end of the
substrate duplex (either the extended or shortened form, depending
on the temperature) between the first and second base pairs. When
the primer extends up to the base of the duplex, cleavage also
occurs one nucleotide into the duplex. However, when a gap of four
or six nucleotides exists between the 3' end of the primer and the
substrate duplex, the cleavage site is shifted four to six
nucleotides in the 5' direction.
[0640] FIG. 9 describes the kinetics of cleavage in the presence
(FIG. 9A) or absence (FIG. 9B) of a primer oligonucleotide. The
reactions were run at 55.degree. C. with either 50 mM KCl (FIG. 9A)
or 20 mM KCl (FIG. 9B). The reaction products were resolved by
denaturing polyacrylamide gel electrophoresis and the lengths of
the products, in nucleotides, are indicated. "M", indicating a
marker, is a 5' end-labeled 19-nt oligonucleotide. Under these salt
conditions, FIGS. 9A and 9B indicate that the reaction appears to
be about twenty times faster in the presence of primer than in the
absence of primer. This effect on the efficiency may be
attributable to proper alignment and stabilization of the enzyme on
the substrate.
[0641] The relative influence of primer on cleavage rates becomes
much greater when both reactions are run in 50 mM KCl. In the
presence of primer, the rate of cleavage increases with KCl
concentration, up to about 50 mM. However, inhibition of this
reaction in the presence of primer is apparent at 100 mM and is
complete at 150 mM KCl. In contrast, in the absence of primer the
rate is enhanced by concentration of KCl up to 20 mM, but it is
reduced at concentrations above 30 mM. At 50 mM KCl, the reaction
is almost completely inhibited. The inhibition of cleavage by KCl
in the absence of primer is affected by temperature, being more
pronounced at lower temperatures.
[0642] Recognition of the 5' end of the arm to be cut appears to be
an important feature of substrate recognition. Substrates that lack
a free 5' end, such as circular M13 DNA, cannot be cleaved under
any conditions tested. Even with substrates having defined 5' arms,
the rate of cleavage by DNAPTaq is influenced by the length of the
arm. In the presence of primer and 50 mM KCl, cleavage of a 5'
extension that is 27 nucleotides long is essentially complete
within 2 minutes at 55.degree. C. In contrast, cleavages of
molecules with 5' arms of 84 and 188 nucleotides are only about 90%
and 40% complete after 20 minutes. Incubation at higher
temperatures reduces the inhibitory effects of long extensions
indicating that secondary structure in the 5' arm or a heat-labile
structure in the enzyme may inhibit the reaction. A mixing
experiment, run under conditions of substrate excess, shows that
the molecules with long arms do not preferentially tie up the
available enzyme in non-productive complexes. These results may
indicate that the 5' nuclease domain gains access to the cleavage
site at the end of the bifurcated duplex by moving down the 5' arm
from one end to the other. Longer 5' arms would be expected to have
more adventitious secondary structures (particularly when KCl
concentrations are high), which would be likely to impede this
movement.
[0643] Cleavage does not appear to be inhibited by long 3' arms of
either the substrate strand target molecule or pilot nucleic acid,
at least up to 2 kilobases. At the other extreme, 3' arms of the
pilot nucleic acid as short as one nucleotide can support cleavage
in a primer-independent reaction, albeit inefficiently. Fully
paired oligonucleotides do not elicit cleavage of DNA templates
during primer extension.
[0644] The ability of DNAPTaq to cleave molecules even when the
complementary strand contains only one unpaired 3' nucleotide may
be useful in optimizing allele-specific PCR. PCR primers that have
unpaired 3' ends could act as pilot oligonucleotides to direct
selective cleavage of unwanted templates during preincubation of
potential template-primer complexes with DNAPTaq in the absence of
nucleoside triphosphates.
[0645] B. 5' Nuclease Activities of Other DNAPs
[0646] To determine whether other 5' nucleases in other DNAPs would
be suitable for the present invention, an array of enzymes, several
of which were reported in the literature to be free of apparent 5'
nuclease activity, were examined. The ability of these other
enzymes to cleave nucleic acids in a structure-specific manner was
tested using the hairpin substrate shown in FIG. 5 under conditions
reported to be optimal for synthesis by each enzyme.
[0647] DNAPEcl and DNAP Klenow were obtained from Promega; the DNAP
of Pyrococcus furious ("Pfu", Bargseid et al., Strategies 4:34
[1991]) was from Stratagene; the DNAP of Thermococcus litoralis
("Tli", Vent.TM.(exo-), Perler et al., Proc. Natl. Acad. Sci. USA
89:5577 [1992] was from New England Biolabs; the DNAP of Thermus
flavus ("Tfl", Kaledin et al., Biokhimiya 46:1576 [1981] was from
Epicentre Technologies; and the DNAP of Thermus thermophilus
("Tth", Carballeira et al., Biotechn., 9:276 [1990]; Myers et al.,
Biochem., 30:7661 (1991)] was from U.S. Biochemicals.
[0648] 0.5 units of each DNA polymerase was assayed in a 20 .mu.l
reaction, using either the buffers supplied by the manufacturers
for the primer-dependent reactions, or 10 mM Tris.Cl, pH 8.5, 1.5
mM MgCl.sub.2, and 20 mM KCl. Reaction mixtures were at held
72.degree. C. before the addition of enzyme.
[0649] FIG. 10 is an autoradiogram recording the results of these
tests. FIG. 10A demonstrates reactions of endonucleases of DNAPs of
several thermophilic bacteria. The reactions were incubated at
55.degree. C. for 10 minutes in the presence of primer or at
72.degree. C. for 30 minutes in the absence of primer, and the
products were resolved by denaturing polyacrylamide gel
electrophoresis. The lengths of the products, in nucleotides, are
indicated. FIG. 10B demonstrates endonucleolytic cleavage by the 5'
nuclease of DNAPEcl. The DNAPEcl and DNAP Klenow reactions were
incubated for 5 minutes at 37.degree. C. Note the light band of
cleavage products of 25 and 11 nucleotides in the DNAPEcl lanes
(made in the presence and absence of primer, respectively). FIG. 8A
also demonstrates DNAPTaq reactions in the presence (+) or absence
(-) of primer. These reactions were run in 50 mM and 20 mM KCl,
respectively, and were incubated at 55.degree. C. for 10
minutes.
[0650] Referring to FIG. 10A, DNAPs from the eubacteria Thermus
thermophilus and Thermus flavus cleave the substrate at the same
place as DNAPTaq, both in the presence and absence of primer. In
contrast, DNAPs from the archaebacteria Pyrococcus furiosus and
Thermococcus litoralis are unable to cleave the substrates
endonucleolytically. The DNAPs from Pyrococcus furious and
Thermococcus litoralis share little sequence homology with
eubacterial enzymes (Ito et al., Nucl. Acids Res. 19:4045 (1991);
Mathur et al., Nucl. Acids. Res. 19:6952 (1991); see also Perler et
al.). Referring to FIG. 10B, DNAPEcl also cleaves the substrate,
but the resulting cleavage products are difficult to detect unless
the 3' exonuclease is inhibited. The amino acid sequences of the 5'
nuclease domains of DNAPEcl and DNAPTaq are about 38% homologous
(Gelfand, supra).
[0651] The 5' nuclease domain of DNAPTaq also shares about 19%
homology with the 5' exonuclease encoded by gene 6 of bacteriophage
T7 (Dunn et al., J. Mol. Biol., 166:477 [1983]). This nuclease,
which is not covalently attached to a DNAP polymerization domain,
is also able to cleave DNA endonucleolytically, at a site similar
or identical to the site that is cut by the 5' nucleases described
above, in the absence of added primers.
[0652] C. Transcleavage
[0653] The ability of a 5' nuclease to be directed to cleave
efficiently at any specific sequence was demonstrated in the
following experiment. A partially complementary oligonucleotide
termed a "pilot oligonucleotide" was hybridized to sequences at the
desired point of cleavage. The non-complementary part of the pilot
oligonucleotide provided a structure analogous to the 3' arm of the
template (see FIG. 5), whereas the 5' region of the substrate
strand became the 5' arm. A primer was provided by designing the 3'
region of the pilot so that it would fold on itself creating a
short hairpin with a stabilizing tetra-loop (Antao et al., Nucl.
Acids Res. 19:5901 [1991). Two pilot oligonucleotides are shown in
FIG. 11A. Oligonucleotides 19-12 (SEQ ID NO:18), 30-12 (SEQ ID
NO:19) and 30-0 (SEQ ID NO:20) are 31, 42 or 30 nucleotides long,
respectively. However, oligonucleotides 19-12 (SEQ ID NO:18) and
34-19 (SEQ ID NO:19) have only 19 and 30 nucleotides, respectively,
that are complementary to different sequences in the substrate
strand. The pilot oligonucleotides are calculated to melt off their
complements at about 50.degree. C. (19-12) and about 75.degree. C.
(30-12). Both pilots have 12 nucleotides at their 3' ends, which
act as 3' arms with base-paired primers attached.
[0654] To demonstrate that cleavage could be directed by a pilot
oligonucleotide, a single-stranded target DNA with DNAPTaq was
incubated in the presence of two potential pilot oligonucleotides.
The transcleavage reactions, where the target and pilot nucleic
acids are not covalently linked, includes 0.01 pmoles of single
end-labeled substrate DNA, 1 unit of DNAPTaq and 5 pmoles of pilot
oligonucleotide in a volume of 20 .mu.l of the same buffers. These
components were combined during a one minute incubation at
95.degree. C., to denature the PCR-generated double-stranded
substrate DNA, and the temperatures of the reactions were then
reduced to their final incubation temperatures. Oligonucleotides
30-12 and 19-12 can hybridize to regions of the substrate DNAs that
are 85 and 27 nucleotides from the 5' end of the targeted
strand.
[0655] FIG. 19 shows the complete 206-mer sequence (SEQ ID NO:27).
The 206-mer was generated by PCR. The M13/pUC 24-mer reverse
sequencing (-48) primer and the M13/pUC sequencing (-47) primer
from NEB (catalogue nos. 1233 and 1224 respectively) were used (50
pmoles each) with the pGEM3z(f+) plasmid vector (Promega) as
template (10 ng) containing the target sequences. The conditions
for PCR were as follows: 50 .mu.M of each dNTP and 2.5 units of Taq
DNA polymerase in 100 .mu.l of 20 mM Tris-Cl, pH 8.3, 1.5 mM
MgCl.sub.2, 50 mM KCl with 0.05% Tween-20 and 0.05% NP-40.
Reactions were cycled 35 times through 95.degree. C. for 45
seconds, 63.degree. C. for 45 seconds, then 72.degree. C. for 75
seconds. After cycling, reactions were finished off with an
incubation at 72.degree. C. for 5 minutes. The resulting fragment
was purified by electrophoresis through a 6% polyacrylamide gel
(29:1 cross link) in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM
EDTA, visualized by ethidium bromide staining or autoradiography,
excised from the gel, eluted by passive diffusion, and concentrated
by ethanol precipitation.
[0656] Cleavage of the substrate DNA occurred in the presence of
the pilot oligonucleotide 19-12 at 50.degree. C. (FIG. 11B, lanes 1
and 7) but not at 75.degree. C. (lanes 4 and 10). In the presence
of oligonucleotide 30-12 cleavage was observed at both
temperatures. Cleavage did not occur in the absence of added
oligonucleotides (lanes 3, 6 and 12) or at about 80.degree. C. even
though at 50.degree. C. adventitious structures in the substrate
allowed primer-independent cleavage in the absence of KCl (FIG.
11B, lane 9). A non-specific oligonucleotide with no
complementarity to the substrate DNA did not direct cleavage at
50.degree. C., either in the absence or presence of 50 mM KCl
(lanes 13 and 14). Thus, the specificity of the cleavage reactions
can be controlled by the extent of complementarity to the substrate
and by the conditions of incubation.
[0657] D. Cleavage of RNA
[0658] A shortened RNA version of the sequence used in the
transcleavage experiments discussed above was tested for its
ability to serve as a substrate in the reaction. The RNA is cleaved
at the expected place, in a reaction that is dependent upon the
presence of the pilot oligonucleotide. The RNA substrate, made by
T7 RNA polymerase in the presence of (.alpha.-.sup.32P)UTP,
corresponds to a truncated version of the DNA substrate used in
FIG. 11B. Reaction conditions were similar to those in used for the
DNA substrates described above, with 50 mM KCl; incubation was for
40 minutes at 55.degree. C. The pilot oligonucleotide used is
termed 30-0 (SEQ ID NO:20) and is shown in FIG. 12A.
[0659] The results of the cleavage reaction is shown in FIG. 13B.
The reaction was run either in the presence or absence of DNAPTaq
or pilot oligonucleotide as indicated in FIG. 12B.
[0660] Strikingly, in the case of RNA cleavage, a 3' arm is not
required for the pilot oligonucleotide. It is very unlikely that
this cleavage is due to previously described RNaseH, which would be
expected to cut the RNA in several places along the 30 base-pair
long RNA-DNA duplex. The 5' nuclease of DNAPTaq is a
structure-specific RNaseH that cleaves the RNA at a single site
near the 5' end of the heteroduplexed region.
[0661] It is surprising that an oligonucleotide lacking a 3' arm is
able to act as a pilot in directing efficient cleavage of an RNA
target because such oligonucleotides are unable to direct efficient
cleavage of DNA targets using native DNAPs. However, some 5'
nucleases of the present invention (for example, clones E, F and G
of FIG. 4) can cleave DNA in the absence of a 3' arm. In other
words, a non-extendable cleavage structure is not required for
specific cleavage with some 5' nucleases of the present invention
derived from thermostable DNA polymerases.
[0662] Tests were then conducted to determine whether cleavage of
an RNA template by DNAPTaq in the presence of a fully complementary
primer could help explain why DNAPTaq is unable to extend a DNA
oligonucleotide on an RNA template, in a reaction resembling that
of reverse transcriptase. Another thermophilic DNAP, DNAPTth, is
able to use RNA as a template, but only in the presence of Mn++, so
it was predicted that this enzyme would not cleave RNA in the
presence of this cation. Accordingly, an RNA molecule was incubated
with an appropriate pilot oligonucleotide in the presence of
DNAPTaq or DNAPTth, in buffer containing either Mg++ or Mn++. As
expected, both enzymes cleaved the RNA in the presence of Mg++.
However, DNAPTaq, but not DNAPTth, degraded the RNA in the presence
of Mn++. It was concluded that the 5' nuclease activities of many
DNAPs may contribute to their inability to use RNA as
templates.
Example 2
Generation of 5' Nucleases from Thermostable DNA Polymerases
[0663] Thermostable DNA polymerases were generated which have
reduced synthetic activity, an activity that is an undesirable
side-reaction during DNA cleavage in the detection assay of the
invention, yet have maintained thermostable nuclease activity. The
result is a thermostable polymerase which cleaves nucleic acids DNA
with extreme specificity.
[0664] Type A DNA polymerases from eubacteria of the genus Thermus
share extensive protein sequence identity (90% in the
polymerization domain, using the Lipman-Pearson method in the DNA
analysis software from DNAStar, WI) and behave similarly in both
polymerization and nuclease assays. Therefore, the genes for the
DNA polymerase of Thermus aquaticus (DNAPTaq) and Thermus flavus
(DNAPTfl) are used as representatives of this class. Polymerase
genes from other eubacterial organisms, such as Thermus
thermophilus, Thermus sp., Thermotoga maritima, Thermosipho
africanus and Bacillus stearothermophilus are equally suitable. The
DNA polymerases from these thermophilic organisms are capable of
surviving and performing at elevated temperatures, and can thus be
used in reactions in which temperature is used as a selection
against non-specific hybridization of nucleic acid strands.
[0665] The restriction sites used for deletion mutagenesis,
described below, were chosen for convenience. Different sites
situated with similar convenience are available in the Thermus
thermophilus gene and can be used to make similar constructs with
other Type A polymerase genes from related organisms.
[0666] A. Creation of 5' Nuclease Constructs
[0667] 1. Modified DNAPTaq Genes
[0668] The first step was to place a modified gene for the Taq DNA
polymerase on a plasmid under control of an inducible promoter. The
modified Taq polymerase gene was isolated as follows: The Taq DNA
polymerase gene was amplified by polymerase chain reaction from
genomic DNA from Thermus aquaticus, strain YT-1 (Lawyer et al.,
supra), using as primers the oligonucleotides described in SEQ ID
NOS:13-14. The resulting fragment of DNA has a recognition sequence
for the restriction endonuclease EcoRI at the 5' end of the coding
sequence and a BglII sequence at the 3' end. Cleavage with BglII
leaves a 5' overhang or "sticky end" that is compatible with the
end generated by BamHI. The PCR-amplified DNA was digested with
EcoRI and BamHI. The 2512 bp fragment containing the coding region
for the polymerase gene was gel purified and then ligated into a
plasmid which contains an inducible promoter.
[0669] In one embodiment of the invention, the pTTQ18 vector, which
contains the hybrid trp-lac (tac) promoter, was used (Stark, Gene
5:255 [1987]) and shown in FIG. 13. The tac promoter is under the
control of the E. coli lac repressor. Repression allows the
synthesis of the gene product to be suppressed until the desired
level of bacterial growth has been achieved, at which point
repression is removed by addition of a specific inducer,
isopropyl-.beta.-D-thiogalactopyranoside (IPTG). Such a system
allows the expression of foreign proteins that may slow or prevent
growth of transformants.
[0670] Bacterial promoters, such as tac, may not be adequately
suppressed when they are present on a multiple copy plasmid. If a
highly toxic protein is placed under control of such a promoter,
the small amount of expression leaking through can be harmful to
the bacteria. In another embodiment of the invention, another
option for repressing synthesis of a cloned gene product was used.
The non-bacterial promoter, from bacteriophage T7, found in the
plasmid vector series pET-3 was used to express the cloned mutant
Taq polymerase genes (FIG. 15; Studier and Moffatt, J. Mol. Biol.,
189:113 [1986]). This promoter initiates transcription only by T7
RNA polymerase. In a suitable strain, such as BL21(DE3)pLYS, the
gene for this RNA polymerase is carried on the bacterial genome
under control of the lac operator. This arrangement has the
advantage that expression of the multiple copy gene (on the
plasmid) is completely dependent on the expression of T7 RNA
polymerase, which is easily suppressed because it is present in a
single copy.
[0671] For ligation into the pTTQ18 vector (FIG. 13), the PCR
product DNA containing the Taq polymerase coding region (mutTaq,
clone 4B, SEQ ID NO:21) was digested with EcoRI and BglII and this
fragment was ligated under standard "sticky end" conditions
(Sambrook et al. Molecular Cloning, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, pp. 1.63-1.69 [1989]) into the EcoRI and
BamHI sites of the plasmid vector pTTQ18. Expression of this
construct yields a translational fusion product in which the first
two residues of the native protein (Met-Arg) are replaced by three
from the vector (Met-Asn-Ser), but the remainder of the natural
protein would not change. The construct was transformed into the
JM109 strain of E. coli and the transformants were plated under
incompletely repressing conditions that do not permit growth of
bacteria expressing the native protein. These plating conditions
allow the isolation of genes containing pre-existing mutations,
such as those that result from the infidelity of Taq polymerase
during the amplification process.
[0672] Using this amplification/selection protocol, a clone
(depicted in FIG. 3B) containing a mutated Taq polymerase gene
(mutTaq, clone 3B) was isolated. The mutant was first detected by
its phenotype, in which temperature-stable 5' nuclease activity in
a crude cell extract was normal, but polymerization activity was
almost absent (approximately less than 1% of wild type Taq
polymerase activity).
[0673] DNA sequence analysis of the recombinant gene showed that it
had changes in the polymerase domain resulting in two amino acid
substitutions: an A to G change at nucleotide position 1394 causes
a Glu to Gly change at amino acid position 465 (numbered according
to the natural nucleic and amino acid sequences, SEQ ID NOS:1 and
4) and another A to G change at nucleotide position 2260 causes a
Gln to Arg change at amino acid position 754. Because the Gln to
Gly mutation is at a nonconserved position and because the Glu to
Arg mutation alters an amino acid that is conserved in virtually
all of the known Type A polymerases, this latter mutation is most
likely the one responsible for curtailing the synthesis activity of
this protein. The nucleotide sequence for the FIG. 3B construct is
given in SEQ ID NO:21. The enzyme encoded by this sequence is
referred to as CleavaseR A/G.
[0674] Subsequent derivatives of DNAPTaq constructs were made from
the mutTaq gene, thus, they all bear these amino acid substitutions
in addition to their other alterations, unless these particular
regions were deleted. These mutated sites are indicated by black
boxes at these locations in the diagrams in FIG. 3. In FIG. 3, the
designation "3' Exo" is used to indicate the location of the 3'
exonuclease activity associated with Type A polymerases which is
not present in DNAPTaq. All constructs except the genes shown in
FIGS. 3E, F and G were made in the pTTQ18 vector.
[0675] The cloning vector used for the genes in FIGS. 3E and F was
from the commercially available pET-3 series, described above.
Though this vector series has only a BamHI site for cloning
downstream of the T7 promoter, the series contains variants that
allow cloning into any of the three reading frames. For cloning of
the PCR product described above, the variant called pET-3c was used
(FIG. 14). The vector was digested with BamHI, dephosphorylated
with calf intestinal phosphatase, and the sticky ends were filled
in using the Klenow fragment of DNAPEcl and dNTPs. The gene for the
mutant Taq DNAP shown in FIG. 3B (mutTaq, clone 3B) was released
from pTTQ18 by digestion with EcoRI and SalI, and the "sticky ends"
were filled in as was done with the vector. The fragment was
ligated to the vector under standard blunt-end conditions (Sambrook
et al, Molecular Cloning, supra), the construct was transformed
into the BL21 (DE3)pLYS strain of E. coli, and isolates were
screened to identify those that were ligated with the gene in the
proper orientation relative to the promoter. This construction
yields another translational fusion product, in which the first two
amino acids of DNAPTaq (Met-Arg) are replaced by 13 from the vector
plus two from the PCR primer
(Met-Ala-Ser-Met-Thr-Gly-Gly-Gln-Gln-Met-Gly-Arg-Ile-Asn-Ser) (SEQ
ID NO:24).
[0676] In these experiments, the goal was to generate enzymes that
lacked the ability to synthesize DNA, but retained the ability to
cleave nucleic acids with a 5' nuclease activity. The act of
primed, templated synthesis of DNA is actually a coordinated series
of events, so it is possible to disable DNA synthesis by disrupting
one event while not affecting the others. These steps include, but
are not limited to, primer recognition and binding, dNTP binding
and catalysis of the inter-nucleotide phosphodiester bond. Some of
the amino acids in the polymerization domain of DNAPEcI have been
linked to these functions, but the precise mechanisms are as yet
poorly defined.
[0677] One way of destroying the polymerizing ability of a DNA
polymerase is to delete all or part of the gene segment that
encodes that domain for the protein, or to otherwise render the
gene incapable of making a complete polymerization domain.
Individual mutant enzymes may differ from each other in stability
and solubility both inside and outside cells. For instance, in
contrast to the 5' nuclease domain of DNAPEcI, which can be
released in an active form from the polymerization domain by gentle
proteolysis (Setlow and Kornberg, J. Biol. Chem., 247:232 [1972]),
the Thermus nuclease domain, when treated similarly, becomes less
soluble and the cleavage activity is often lost.
[0678] Using the mutant gene shown in FIG. 3B as starting material,
several deletion constructs were created. All cloning technologies
were standard (Sambrook et al, supra) and are summarized briefly,
as follows:
[0679] FIG. 3C: The mutTaq construct was digested with PstI, which
cuts once within the polymerase coding region, as indicated, and
cuts immediately downstream of the gene in the multiple cloning
site of the vector. After release of the fragment between these two
sites, the vector was re-ligated, creating an 894-nucleotide
deletion, and bringing into frame a stop codon 40 nucleotides
downstream of the junction. The nucleotide sequence of this 5'
nuclease (clone 4C) is given in SEQ ID NO:9.
[0680] FIG. 3D: The mutTaq construct was digested with NheI, which
cuts once in the gene at position 2047. The resulting
four-nucleotide 5' overhanging ends were filled in, as described
above, and the blunt ends were re-ligated. The resulting
four-nucleotide insertion changes the reading frame and causes
termination of translation ten amino acids downstream of the
mutation. The nucleotide sequence of this 5' nuclease (clone 3D) is
given in SEQ ID NO:10.
[0681] FIG. 3E: The entire mutTaq gene was cut from pTTQ18 using
EcoRI and SalI and cloned into pET-3c, as described above. This
clone was digested with BstXI and XcmI, at unique sites that are
situated as shown in FIG. 3E. The DNA was treated with the Klenow
fragment of DNAPEcl and dNTPs, which resulted in the 3' overhangs
of both sites being trimmed to blunt ends. These blunt ends were
ligated together, resulting in an out-of-frame deletion of 1540
nucleotides. An in-frame termination codon occurs 18 triplets past
the junction site. The nucleotide sequence of this 5' nuclease
(clone 3E) is given in SEQ ID NO:11, with the appropriate leader
sequence given in SEQ ID NO:25. It is also referred to as
Cleavase.RTM. BX.
[0682] FIG. 3F: The entire mutTaq gene was cut from pTTQ18 using
EcoRI and SalI and cloned into pET-3c, as described above. This
clone was digested with BstXI and BamHI, at unique sites that are
situated as shown in the diagram. The DNA was treated with the
Klenow fragment of DNAPEcl and dNTPs, which resulted in the 3'
overhang of the BstXI site being trimmed to a blunt end, while the
5' overhang of the BamHI site was filled in to make a blunt end.
These ends were ligated together, resulting in an in-frame deletion
of 903 nucleotides. The nucleotide sequence of the 5' nuclease
(clone 3F) is given in SEQ ID NO:12. It is also referred to as
Cleavase.RTM. BB.
[0683] FIG. 3G: This polymerase is a variant of that shown in FIG.
4E. It was cloned in the plasmid vector pET-21 (Novagen). The
non-bacterial promoter from bacteriophage T7, found in this vector,
initiates transcription only by T7 RNA polymerase. See Studier and
Moffatt, supra. In a suitable strain, such as (DES)pLYS, the gene
for this RNA polymerase is carried on the bacterial genome under
control of the lac operator. This arrangement has the advantage
that expression of the multiple copy gene (on the plasmid) is
completely dependent on the expression of T7 RNA polymerase, which
is easily suppressed because it is present in a single copy.
Because the expression of these mutant genes is under this tightly
controlled promoter, potential problems of toxicity of the
expressed proteins to the host cells are less of a concern.
[0684] The pET-21 vector also features a "His*Tag", a stretch of
six consecutive histidine residues that are added on the carboxy
terminus of the expressed proteins. The resulting proteins can then
be purified in a single step by metal chelation chromatography,
using a commercially available (Novagen) column resin with
immobilized Ni.sup.++ ions. The 2.5 ml columns are reusable, and
can bind up to 20 mg of the target protein under native or
denaturing (guanidine*HCl or urea) conditions.
[0685] E. coli (DES)pLYS cells are transformed with the constructs
described above using standard transformation techniques, and used
to inoculate a standard growth medium (e.g., Luria-Bertani broth).
Production of T7 RNA polymerase is induced during log phase growth
by addition of IPTG and incubated for a further 12 to 17 hours.
Aliquots of culture are removed both before and after induction and
the proteins are examined by SDS-PAGE. Staining with Coomassie Blue
allows visualization of the foreign proteins if they account for
about 3-5% of the cellular protein and do not co-migrate with any
of the major protein bands. Proteins that co-migrate with major
host protein must be expressed as more than 10% of the total
protein to be seen at this stage of analysis.
[0686] Some mutant proteins are sequestered by the cells into
inclusion bodies. These are granules that form in the cytoplasm
when bacteria are made to express high levels of a foreign protein,
and they can be purified from a crude lysate, and analyzed by
SDS-PAGE to determine their protein content. If the cloned protein
is found in the inclusion bodies, it must be released to assay the
cleavage and polymerase activities. Different methods of
solubilization may be appropriate for different proteins, and a
variety of methods are known (See e.g., Builder & Ogez, U.S.
Pat. No. 4,511,502 (1985); Olson, U.S. Pat. No. 4,518,526 (1985);
Olson & Pai, U.S. Pat. No. 4,511,503 (1985); and Jones et al.,
U.S. Pat. No. 4,512,922 (1985), all of which are hereby
incorporated by reference).
[0687] The solubilized protein is then purified on the Ni.sup.++
column as described above, following the manufacturers instructions
(Novagen). The washed proteins are eluted from the column by a
combination of imidazole competitor (1 M) and high salt (0.5 M
NaCl), and dialyzed to exchange the buffer and to allow denature
proteins to refold. Typical recoveries result in approximately 20
.mu.g of specific protein per ml of starting culture. The DNAP
mutant is referred to as the CLEAVASE BN nuclease and the sequence
is given in SEQ ID NO:26 (the amino acid sequence of the CLEAVASE
BN nuclease is obtained by translating the DNA sequence of SEQ ID
NO:26).
[0688] 2. Modified DNAPTfl Gene
[0689] The DNA polymerase gene of Thermus flavus was isolated from
the "T. flavus" AT-62 strain obtained from the American Type Tissue
Collection (ATCC 33923). This strain has a different restriction
map then does the T. flavus strain used to generate the sequence
published by Akhmetzjanov and Vakhitov, supra. The published
sequence is listed as SEQ ID NO:2. No sequence data has been
published for the DNA polymerase gene from the AT-62 strain of T.
flavus.
[0690] Genomic DNA from T. flavus was amplified using the same
primers used to amplify the T. aquaticus DNA polymerase gene (SEQ
ID NOS:13-14). The approximately 2500 base pair PCR fragment was
digested with EcoRI and BamHI. The over-hanging ends were made
blunt with the Klenow fragment of DNAPEcl and dNTPs. The resulting
approximately 1800 base pair fragment containing the coding region
for the N-terminus was ligated into pET-3c, as described above.
This construct, clone 4B, is depicted in FIG. 4B. The wild type T.
flavus DNA polymerase gene is depicted in FIG. 4A. The 4B clone has
the same leader amino acids as do the DNAPTaq clones 4E and F which
were cloned into pET-3c; it is not known precisely where
translation termination occurs, but the vector has a strong
transcription termination signal immediately downstream of the
cloning site.
[0691] B. Growth and Induction of Transformed Cells
[0692] Bacterial cells were transformed with the constructs
described above using standard transformation techniques and used
to inoculate 2 mls of a standard growth medium (e.g., Luria-Bertani
broth). The resulting cultures were incubated as appropriate for
the particular strain used, and induced if required for a
particular expression system. For all of the constructs depicted in
FIGS. 3 and 4, the cultures were grown to an optical density (at
600 nm wavelength) of 0.5 OD.
[0693] To induce expression of the cloned genes, the cultures were
brought to a final concentration of 0.4 mM IPTG and the incubations
were continued for 12 to 17 hours. Then, 50 .mu.l aliquots of each
culture were removed both before and after induction and were
combined with 20 .mu.l of a standard gel loading buffer for sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Subsequent staining with Coomassie Blue (Sambrook et al., supra)
allows visualization of the foreign proteins if they account for
about 3-5% of the cellular protein and do not co-migrate with any
of the major E. coli protein bands. Proteins that do co-migrate
with a major host protein must be expressed as more than 10% of the
total protein to be seen at this stage of analysis.
[0694] C. Heat Lysis And Fractionation
[0695] Expressed thermostable proteins (i.e., the 5' nucleases),
were isolated by heating crude bacterial cell extracts to cause
denaturation and precipitation of the less stable E. coli proteins.
The precipitated E. coli proteins were then, along with other cell
debris, removed by centrifugation. Then, 1.7 mls of the culture
were pelleted by microcentrifugation at 12,000 to 14,000 rpm for 30
to 60 seconds. After removal of the supernatant, the cells were
resuspended in 400 .mu.l of buffer A (50 mM Tris-HCl, pH 7.9, 50 mM
dextrose, 1 mM EDTA), re-centrifuged, then resuspended in 80 .mu.l
of buffer A with 4 mg/ml lysozyme. The cells were incubated at room
temperature for 15 minutes, then combined with 80 .mu.l of buffer B
(10 mM Tris-HCl, pH 7.9, 50 mM KCl, 1 mM EDTA, 1 mM PMSF, 0.5%
Tween-20, 0.5% Nonidet-P40).
[0696] This mixture was incubated at 75.degree. C. for 1 hour to
denature and precipitate the host proteins. This cell extract was
centrifuged at 14,000 rpm for 15 minutes at 4.degree. C., and the
supernatant was transferred to a fresh tube. An aliquot of 0.5 to 1
.mu.l of this supernatant was used directly in each test reaction,
and the protein content of the extract was determined by subjecting
7 .mu.l to electrophoretic analysis, as above. The native
recombinant Taq DNA polymerase (Engelke, Anal. Biochem., 191:396
[1990]), and the double point mutation protein shown in FIG. 3B are
both soluble and active at this point.
[0697] The foreign protein may not be detected after the heat
treatments due to sequestration of the foreign protein by the cells
into inclusion bodies. These are granules that form in the
cytoplasm when bacteria are made to express high levels of a
foreign protein, and they can be purified from a crude lysate, and
analyzed SDS PAGE to determine their protein content. Many methods
have been described in the literature, and one approach is
described below.
[0698] D. Isolation and Solubilization of Inclusion Bodies
[0699] A small culture was grown and induced as described above. A
1.7 ml aliquot was pelleted by brief centrifugation, and the
bacterial cells were resuspended in 100 .mu.l of Lysis buffer (50
mM Tris-HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl). Then, 2.5 .mu.l of 20
mM PMSF were added for a final concentration of 0.5 mM, and
lysozyme was added to a concentration of 1.0 mg/ml. The cells were
incubated at room temperature for 20 minutes, deoxycholic acid was
added to 1 mg/ml (1 .mu.l of 100 mg/ml solution), and the mixture
was further incubated at 37.degree. C. for about 15 minutes or
until viscous. DNAse I was added to 10 .mu.g/ml and the mixture was
incubated at room temperature for about 30 minutes or until it was
no longer viscous.
[0700] From this mixture the inclusion bodies were collected by
centrifugation at 14,000 rpm for 15 minutes at 4.degree. C., and
the supernatant was discarded. The pellet was resuspended in 100
.mu.l of lysis buffer with 10 mM EDTA (pH 8.0) and 0.5% Triton
X-100. After 5 minutes at room temperature, the inclusion bodies
were pelleted as before, and the supernatant was saved for later
analysis. The inclusion bodies were resuspended in 50 .mu.l of
distilled water, and 5 .mu.l was combined with SDS gel loading
buffer (which dissolves the inclusion bodies) and analyzed
electrophoretically, along with an aliquot of the supernatant.
[0701] If the cloned protein is found in the inclusion bodies, it
may be released to assay the cleavage and polymerase activities and
the method of solubilization must be compatible with the particular
activity. Different methods of solubilization may be appropriate
for different proteins, and a variety of methods are discussed in
Molecular Cloning (Sambrook et al., supra). The following is an
adaptation used for several of the isolates used in the development
of the present invention.
[0702] Twenty .mu.l of the inclusion body-water suspension were
pelleted by centrifugation at 14,000 rpm for 4 minutes at room
temperature, and the supernatant was discarded. To further wash the
inclusion bodies, the pellet was resuspended in 20 .mu.l of lysis
buffer with 2M urea, and incubated at room temperature for one
hour. The washed inclusion bodies were then resuspended in 2 .mu.l
of lysis buffer with 8 M urea; the solution clarified visibly as
the inclusion bodies dissolved. Undissolved debris was removed by
centrifugation at 14,000 rpm for 4 minutes at room temperature, and
the extract supernatant was transferred to a fresh tube.
[0703] To reduce the urea concentration, the extract was diluted
into KH.sub.2PO.sub.4. A fresh tube was prepared containing 180
.mu.l of 50 mM KH.sub.2PO.sub.4, pH 9.5, 1 mM EDTA and 50 mM NaCl.
A 2 .mu.l aliquot of the extract was added and vortexed briefly to
mix. This step was repeated until all of the extract had been added
for a total of 10 additions. The mixture was allowed to sit at room
temperature for 15 minutes, during which time some precipitate
often forms. Precipitates were removed by centrifugation at 14,000
rpm, for 15 minutes at room temperature, and the supernatant was
transferred to a fresh tube. To the 200 .mu.l of protein in the
KH.sub.2PO.sub.4 solution, 140-200 .mu.l of saturated
(NH.sub.4).sub.2SO.sub.4 were added, so that the resulting mixture
was about 41% to 50% saturated (NH.sub.4).sub.2SO.sub.4. The
mixture was chilled on ice for 30 minutes to allow the protein to
precipitate, and the protein was then collected by centrifugation
at 14,000 rpm, for 4 minutes at room temperature. The supernatant
was discarded, and the pellet was dissolved in 20 .mu.l Buffer C
(20 mM HEPES, pH 7.9, 1 mM EDTA, 0.5% PMSF, 25 mM KCl and 0.5% each
of Tween-20 and Nonidet P 40). The protein solution was centrifuged
again for 4 minutes to pellet insoluble materials, and the
supernatant was removed to a fresh tube. The protein contents of
extracts prepared in this manner were visualized by resolving 1-4
.mu.l by SDS-PAGE; 0.5 to 1 .mu.l of extract was tested in the
cleavage and polymerization assays as described.
[0704] E. Protein Analysis for Presence of Nuclease and Synthetic
Activity
[0705] The 5' nucleases described above and shown in FIGS. 3 and 4
were analyzed by the following methods.
[0706] 1. Structure Specific Nuclease Assay
[0707] A candidate modified polymerase is tested for 5' nuclease
activity by examining its ability to catalyze structure-specific
cleavages. By the term "cleavage structure" as used herein, is
meant a nucleic acid structure which is a substrate for cleavage by
the 5' nuclease activity of a DNAP.
[0708] The polymerase is exposed to test complexes that have the
structures shown in FIG. 15. Testing for 5' nuclease activity
involves three reactions: 1) a primer-directed cleavage (FIG. 15B)
is performed because it is relatively insensitive to variations in
the salt concentration of the reaction and can, therefore, be
performed in whatever solute conditions the modified enzyme
requires for activity; this is generally the same conditions
preferred by unmodified polymerases; 2) a similar primer-directed
cleavage is performed in a buffer which permits primer-independent
cleavage (i.e., a low salt buffer), to demonstrate that the enzyme
is viable under these conditions; and 3) a primer-independent
cleavage (FIG. 15A) is performed in the same low salt buffer.
[0709] The bifurcated duplex is formed between a substrate strand
and a template strand as shown in FIG. 15. By the term "substrate
strand" as used herein, is meant that strand of nucleic acid in
which the cleavage mediated by the 5' nuclease activity occurs. The
substrate strand is always depicted as the top strand in the
bifurcated complex which serves as a substrate for 5' nuclease
cleavage (FIG. 15). By the term "template strand" as used herein,
is meant the strand of nucleic acid which is at least partially
complementary to the substrate strand and which anneals to the
substrate strand to form the cleavage structure. The template
strand is always depicted as the bottom strand of the bifurcated
cleavage structure (FIG. 15). If a primer (a short oligonucleotide
of 19 to 30 nucleotides in length) is added to the complex, as when
primer-dependent cleavage is to be tested, it is designed to anneal
to the 3' arm of the template strand (FIG. 15B). Such a primer
would be extended along the template strand if the polymerase used
in the reaction has synthetic activity.
[0710] The cleavage structure may be made as a single hairpin
molecule, with the 3' end of the target and the 5' end of the pilot
joined as a loop as shown in FIG. 15E. A primer oligonucleotide
complementary to the 3' arm is also required for these tests so
that the enzyme's sensitivity to the presence of a primer may be
tested.
[0711] Nucleic acids to be used to form test cleavage structures
can be chemically synthesized, or can be generated by standard
recombinant DNA techniques. By the latter method, the hairpin
portion of the molecule can be created by inserting into a cloning
vector duplicate copies of a short DNA segment, adjacent to each
other but in opposing orientation. The double-stranded fragment
encompassing this inverted repeat, and including enough flanking
sequence to give short (about 20 nucleotides) unpaired 5' and 3'
arms, can then be released from the vector by restriction enzyme
digestion, or by PCR performed with an enzyme lacking a 5'
exonuclease (e.g., the Stoffel fragment of AMPLITAQ DNA polymerase,
Vent.TM. DNA polymerase).
[0712] The test DNA can be labeled on either end, or internally,
with either a radioisotope, or with a non-isotopic tag. Whether the
hairpin DNA is a synthetic single strand or a cloned double strand,
the DNA is heated prior to use to melt all duplexes. When cooled on
ice, the structure depicted in FIG. 16E is formed, and is stable
for sufficient time to perform these assays.
[0713] To test for primer-directed cleavage (Reaction 1), a
detectable quantity of the test molecule (typically 1-100 fmol of
.sup.32P-labeled hairpin molecule) and a 10 to 100-fold molar
excess of primer are placed in a buffer known to be compatible with
the test enzyme. For Reaction 2, where primer-directed cleavage is
performed under condition which allow primer-independent cleavage,
the same quantities of molecules are placed in a solution that is
the same as the buffer used in Reaction 1 regarding pH, enzyme
stabilizers (e.g., bovine serum albumin, nonionic detergents,
gelatin) and reducing agents (e.g., dithiothreitol,
2-mercaptoethanol) but that replaces any monovalent cation salt
with 20 mM KCl; 20 mM KCl is the demonstrated optimum for
primer-independent cleavage. Buffers for enzymes, such as DNAPEcl,
that usually operate in the absence of salt are not supplemented to
achieve this concentration. To test for primer-independent cleavage
(Reaction 3) the same quantity of the test molecule, but no primer,
are combined under the same buffer conditions used for Reaction
2.
[0714] All three test reactions are then exposed to enough of the
enzyme that the molar ratio of enzyme to test complex is
approximately 1:1. The reactions are incubated at a range of
temperatures up to, but not exceeding, the temperature allowed by
either the enzyme stability or the complex stability, whichever is
lower, up to 80.degree. C. for enzymes from thermophiles, for a
time sufficient to allow cleavage (10 to 60 minutes). The products
of Reactions 1, 2 and 3 are resolved by denaturing polyacrylamide
gel electrophoresis, and visualized by autoradiography or by a
comparable method appropriate to the labeling system used.
Additional labeling systems include chemiluminescence detection,
silver or other stains, blotting and probing and the like. The
presence of cleavage products is indicated by the presence of
molecules which migrate at a lower molecular weight than does the
uncleaved test structure. These cleavage products indicate that the
candidate polymerase has structure-specific 5' nuclease
activity.
[0715] To determine whether a modified DNA polymerase has
substantially the same 5' nuclease activity as that of the native
DNA polymerase, the results of the above-described tests are
compared with the results obtained from these tests performed with
the native DNA polymerase. By "substantially the same 5' nuclease
activity" it is meant that the modified polymerase and the native
polymerase will both cleave test molecules in the same manner. It
is not necessary that the modified polymerase cleave at the same
rate as the native DNA polymerase.
[0716] Some enzymes or enzyme preparations may have other
associated or contaminating activities that may be functional under
the cleavage conditions described above and that may interfere with
5' nuclease detection. Reaction conditions can be modified in
consideration of these other activities, to avoid destruction of
the substrate, or other masking of the 5' nuclease cleavage and its
products. For example, the DNA polymerase I of E. coli (Pol I), in
addition to its polymerase and 5' nuclease activities, has a 3'
exonuclease that can degrade DNA in a 3' to 5' direction.
Consequently, when the molecule in FIG. 15E is exposed to this
polymerase under the conditions described above, the 3' exonuclease
quickly removes the unpaired 3' arm, destroying the bifurcated
structure required of a substrate for the 5' exonuclease cleavage
and no cleavage is detected. The true ability of Pol I to cleave
the structure can be revealed if the 3' exonuclease is inhibited by
a change of conditions (e.g., pH), mutation, or by addition of a
competitor for the activity. Addition of 500 pmoles of a
single-stranded competitor oligonucleotide, unrelated to the FIG.
15E structure, to the cleavage reaction with Pol I effectively
inhibits the digestion of the 3' arm of the FIG. 15E structure
without interfering with the 5' exonuclease release of the 5' arm.
The concentration of the competitor is not critical, but should be
high enough to occupy the 3' exonuclease for the duration of the
reaction.
[0717] Similar destruction of the test molecule may be caused by
contaminants in the candidate polymerase preparation. Several sets
of the structure specific nuclease reactions may be performed to
determine the purity of the candidate nuclease and to find the
window between under and over exposure of the test molecule to the
polymerase preparation being investigated.
[0718] The above described modified polymerases were tested for 5'
nuclease activity as follows: Reaction 1 was performed in a buffer
of 10 mM Tris-Cl, pH 8.5 at 20.degree. C., 1.5 mM MgCl.sub.2 and 50
mM KCl and in Reaction 2 the KCl concentration was reduced to 20
mM. In Reactions 1 and 2, 10 fmoles of the test substrate molecule
shown in FIG. 15E were combined with 1 pmole of the indicated
primer and 0.5 to 1.0 .mu.l of extract containing the modified
polymerase (prepared as described above). This mixture was then
incubated for 10 minutes at 55.degree. C. For all of the mutant
polymerases tested these conditions were sufficient to give
complete cleavage. When the molecule shown in FIG. 15E was labeled
at the 5' end, the released 5' fragment, 25 nucleotides long, was
conveniently resolved on a 20% polyacrylamide gel (19:1
cross-linked) with 7 M urea in a buffer containing 45 mM
Tris-borate pH 8.3, 1.4 mM EDTA. Clones 3C-F and 4B exhibited
structure-specific cleavage comparable to that of the unmodified
DNA polymerase. Additionally, clones 3E, 3F and 3G have the added
ability to cleave DNA in the absence of a 3' arm as discussed
above. Representative cleavage reactions are shown in FIG. 16.
{PRIVATE}
[0719] For the reactions shown in FIG. 16, the mutant polymerase
clones 3E (Taq mutant) and 4B (Tfl mutant) were examined for their
ability to cleave the hairpin substrate molecule shown in FIG. 15E.
The substrate molecule was labeled at the 5' terminus with
.sup.32P. Ten fmoles of heat-denatured, end-labeled substrate DNA
and 0.5 units of DNAPTaq (lane 1) or 0.5 .mu.l of 3E or 4B extract
(FIG. 16, lanes 2-7, extract was prepared as described above) were
mixed together in a buffer containing 10 mM Tris-Cl, pH 8.5, 50 mM
KCl and 1.5 mM MgCl.sub.2. The final reaction volume was 10 .mu.l.
Reactions shown in lanes 4 and 7 contain in addition 50 .mu.M of
each dNTP. Reactions shown in lanes 3, 4, 6 and 7 contain 0.2 .mu.M
of the primer oligonucleotide (complementary to the 3' arm of the
substrate and shown in FIG. 15E). Reactions were incubated at
55.degree. C. for 4 minutes. Reactions were stopped by the addition
of 8 .mu.l of 95% formamide containing 20 mM EDTA and 0.05% marker
dyes per 10 .mu.l reaction volume. Samples were then applied to 12%
denaturing acrylamide gels. Following electrophoresis, the gels
were autoradiographed. FIG. 16 shows that clones 3E and 4B exhibit
cleavage activity similar to that of the native DNAPTaq. Note that
some cleavage occurs in these reactions in the absence of the
primer. When long hairpin structure, such as the one used here
(FIG. 15E), are used in cleavage reactions performed in buffers
containing 50 mM KCl a low level of primer-independent cleavage is
seen. Higher concentrations of KCl suppress, but do not eliminate,
this primer-independent cleavage under these conditions.
[0720] 2. Assay for Synthetic Activity
[0721] The ability of the modified enzyme or proteolytic fragments
is assayed by adding the modified enzyme to an assay system in
which a primer is annealed to a template and DNA synthesis is
catalyzed by the added enzyme. Many standard laboratory techniques
employ such an assay. For example, nick translation and enzymatic
sequencing involve extension of a primer along a DNA template by a
polymerase molecule.
[0722] In a preferred assay for determining the synthetic activity
of a modified enzyme an oligonucleotide primer is annealed to a
single-stranded DNA template (e.g., bacteriophage M13 DNA), and the
primer/template duplex is incubated in the presence of the modified
polymerase in question, deoxynucleoside triphosphates (dNTPs) and
the buffer and salts known to be appropriate for the unmodified or
native enzyme. Detection of either primer extension (by denaturing
gel electrophoresis) or dNTP incorporation (by acid precipitation
or chromatography) is indicative of an active polymerase. A label,
either isotopic or non-isotopic, is preferably included on either
the primer or as a dNTP to facilitate detection of polymerization
products. Synthetic activity is quantified as the amount of free
nucleotide incorporated into the growing DNA chain and is expressed
as amount incorporated per unit of time under specific reaction
conditions.
[0723] Representative results of an assay for synthetic activity is
shown in FIG. 17. The synthetic activity of the mutant DNAPTaq
clones 3B-F was tested as follows: A master mixture of the
following buffer was made: 1.2.times.PCR buffer (1.times.PCR buffer
contains 50 mM KCl, 1.5 mM MgCl.sub.2, 10 mM Tris-Cl, pH 8.5 and
0.05% each Tween 20 and Nonidet P40), 50 .mu.M each of dGTP, dATP
and dTTP, 5 .mu.M dCTP and 0.125 .mu.M .alpha.-.sup.32P-dCTP at 600
Ci/mmol. Before adjusting this mixture to its final volume, it was
divided into two equal aliquots. One received distilled water up to
a volume of 50 .mu.l to give the concentrations above. The other
received 5 .mu.g of single-stranded M13mp18 DNA (approximately 2.5
pmol or 0.05 .mu.M final concentration) and 250 pmol of M13
sequencing primer (5 .mu.M final concentration) and distilled water
to a final volume of 50 .mu.l. Each cocktail was warmed to
75.degree. C. for 5 minutes and then cooled to room temperature.
This allowed the primers to anneal to the DNA in the DNA-containing
mixtures.
[0724] For each assay, 4 .mu.l of the cocktail with the DNA was
combined with 1 .mu.l of the mutant polymerase, prepared as
described, or 1 unit of DNAPTaq (Perkin Elmer) in 1 .mu.l of
dH.sub.2O. A "no DNA" control was done in the presence of the
DNAPTaq (FIG. 17, lane 1), and a "no enzyme" control was done using
water in place of the enzyme (lane 2). Each reaction was mixed,
then incubated at room temperature (approx. 22.degree. C.) for 5
minutes, then at 55.degree. C. for 2 minutes, then at 72.degree. C.
for 2 minutes. This step incubation was done to detect
polymerization in any mutants that might have optimal temperatures
lower than 72.degree. C. After the final incubation, the tubes were
spun briefly to collect any condensation and were placed on ice.
One .mu.l of each reaction was spotted at an origin 1.5 cm from the
bottom edge of a polyethyleneimine (PEI) cellulose thin layer
chromatography plate and allowed to dry. The chromatography plate
was run in 0.75 M NaH.sub.2PO.sub.4, pH 3.5, until the buffer front
had run approximately 9 cm from the origin. The plate was dried,
wrapped in plastic wrap, marked with luminescent ink, and exposed
to X-ray film. Incorporation was detected as counts that stuck
where originally spotted, while the unincorporated nucleotides were
carried by the salt solution from the origin.
[0725] Comparison of the locations of the counts with the two
control lanes confirmed the lack of polymerization activity in the
mutant preparations. Among the modified DNAPTaq clones, only clone
3B retains any residual synthetic activity as shown in FIG. 17.
Example 3
5' Nucleases Derived from Thermostable DNA Polymerases can Cleave
Short Hairpin Structures with Specificity
[0726] The ability of the 5' nucleases to cleave hairpin structures
to generate a cleaved hairpin structure suitable as a detection
molecule was examined. The structure and sequence of the hairpin
test molecule is shown in FIG. 18A (SEQ ID NO:15). The
oligonucleotide (labeled "primer" in FIG. 18A, SEQ ID NO:22) is
shown annealed to its complementary sequence on the 3' arm of the
hairpin test molecule. The hairpin test molecule was single-end
labeled with .sup.32P using a labeled T7 promoter primer in a
polymerase chain reaction. The label is present on the 5' arm of
the hairpin test molecule and is represented by the star in FIG.
18A.
[0727] The cleavage reaction was performed by adding 10 fmoles of
heat-denatured, end-labeled hairpin test molecule, 0.2 .mu.M of the
primer oligonucleotide (complementary to the 3' arm of the
hairpin), 50 .mu.M of each dNTP and 0.5 units of DNAPTaq (Perkin
Elmer) or 0.5 .mu.l of extract containing a 5' nuclease (prepared
as described above) in a total volume of 10 .mu.l in a buffer
containing 10 mM Tris-Cl, pH 8.5, 50 mM KCl and 1.5 mM MgCl.sub.2.
Reactions shown in lanes 3, 5 and 7 were run in the absence of
dNTPs.
[0728] Reactions were incubated at 55.degree. C. for 4 minutes.
Reactions were stopped at 55.degree. C. by the addition of 8 .mu.l
of 95% formamide with 20 mM EDTA and 0.05% marker dyes per 10 .mu.l
reaction volume. Samples were not heated before loading onto
denaturing polyacrylamide gels (10% polyacrylamide, 19:1
crosslinking, 7 M urea, 89 mM Tris-borate, pH 8.3, 2.8 mM EDTA).
The samples were not heated to allow for the resolution of
single-stranded and re-duplexed uncleaved hairpin molecules.
[0729] FIG. 18B shows that altered polymerases lacking any
detectable synthetic activity cleave a hairpin structure when an
oligonucleotide is annealed to the single-stranded 3' arm of the
hairpin to yield a single species of cleaved product (FIG. 18B,
lanes 3 and 4). 5' nucleases, such as clone 3D, shown in lanes 3
and 4, produce a single cleaved product even in the presence of
dNTPs. 5' nucleases that retain a residual amount of synthetic
activity (less than 1% of wild type activity) produce multiple
cleavage products as the polymerase can extend the oligonucleotide
annealed to the 3' arm of the hairpin thereby moving the site of
cleavage (clone 3B, lanes 5 and 6). Native DNATaq produces even
more species of cleavage products than do mutant polymerases
retaining residual synthetic activity and additionally converts the
hairpin structure to a double-stranded form in the presence of
dNTPs due to the high level of synthetic activity in the native
polymerase (FIG. 18B, lane 8).
Example 4
Cleavage of Linear Nucleic Acid Substrates
[0730] From the above, it should be clear that native (i.e., "wild
type") thermostable DNA polymerases are capable of cleaving hairpin
structures in a specific manner and that this discovery can be
applied with success to a detection assay. In this example, the
mutant DNAPs of the present invention are tested against three
different cleavage structures shown in FIG. 20A. Structure 1 in
FIG. 20A is simply single stranded 206-mer (the preparation and
sequence information for which was discussed in Example 1C).
Structures 2 and 3 are duplexes; structure 2 is the same hairpin
structure as shown in FIG. 11A (bottom), while structure 3 has the
hairpin portion of structure 2 removed.
[0731] The cleavage reactions comprised 0.01 pmoles of the
resulting substrate DNA, and 1 pmole of pilot oligonucleotide in a
total volume of 10 .mu.l of 10 mM Tris-Cl, pH 8.3, 100 mM KCl, 1 mM
MgCl.sub.2. Reactions were incubated for 30 minutes at 55.degree.
C., and stopped by the addition of 8 .mu.l of 95% formamide with 20
mM EDTA and 0.05% marker dyes. Samples were heated to 75.degree. C.
for 2 minutes immediately before electrophoresis through a 10%
polyacrylamide gel (19:1 cross link), with 7M urea, in a buffer of
45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA.
[0732] The results were visualized by autoradiography and are shown
in FIG. 20B with the enzymes indicated as follows: I is native Taq
DNAP; II is native Tfl DNAP; III is CLEAVASE BX shown in FIG. 3E;
IV is CLEAVASE BB shown in FIG. 3F; V is the mutant shown in FIG.
4B; and VI is CLEAVASE BN shown in FIG. 3G.
[0733] Structure 2 was used to "normalize" the comparison. For
example, it was found that it took 50 ng of Taq DNAP and 300 ng of
CLEAVASE BN to give similar amounts of cleavage of Structure 2 in
thirty (30) minutes. Under these conditions native Taq DNAP is
unable to cleave Structure 3 to any significant degree. Native Tfl
DNAP cleaves Structure 3 in a manner that creates multiple
products.
[0734] By contrast, all of the mutants tested cleave the linear
duplex of Structure 3. This finding indicates that this
characteristic of the mutant DNA polymerases is consistent of
thermostable polymerases across thermophilic species.
Example 5
5' Exonucleolytic Cleavage ("Nibbling") By Thermostable DNAPs
[0735] It has been found that thermostable DNAPs, including those
of the present invention, have a true 5' exonuclease capable of
nibbling the 5' end of a linear duplex nucleic acid structures. In
this Example, the 206 base pair DNA duplex substrate is again
employed (See, Example 1C). In this case, it was produced by the
use of one .sup.32P-labeled primer and one unlabeled primer in a
polymerase chain reaction. The cleavage reactions comprised 0.01
pmoles of heat-denatured, end-labeled substrate DNA (with the
unlabeled strand also present), 5 pmoles of pilot oligonucleotide
(see pilot oligos in FIG. 11A) and 0.5 units of DNAPTaq or 0.5.mu.
of CLEAVASE BB in the E. coli extract (see above), in a total
volume of 10 .mu.l of 10 mM Tris.Cl, pH 8.5, 50 mM KCl, 1.5 mM
MgCl.sub.2.
[0736] Reactions were initiated at 65.degree. C. by the addition of
pre-warmed enzyme, then shifted to the final incubation temperature
for 30 minutes. The results are shown in FIG. 21A. Samples in lanes
1-4 are the results with native Taq DNAP, while lanes 5-8 shown the
results with CLEAVASE BB. The reactions for lanes 1, 2, 5, and 6
were performed at 65.degree. C. and reactions for lanes 3, 4, 7,
and 8 were performed at 50.degree. C. and all were stopped at
temperature by the addition of 8 .mu.l of 95% formamide with 20 mM
EDTA and 0.05% marker dyes. Samples were heated to 75.degree. C.
for 2 minutes immediately before electrophoresis through a 10%
acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of
45 mM Tris.Borate, pH 8.3, 1.4 mM EDTA. The expected product in
reactions 1, 2, 5, and 6 is 85 nucleotides long; in reactions 3 and
7, the expected product is 27 nucleotides long. Reactions 4 and 8
were performed without pilot, and should remain at 206 nucleotides.
The faint band seen at 24 nucleotides is residual end-labeled
primer from the PCR.
[0737] The surprising result is that CLEAVASE BB under these
conditions causes all of the label to appear in a very small
species, suggesting the possibility that the enzyme completely
hydrolyzed the substrate. To determine the composition of the
fastest-migrating band seen in lanes 5-8 (reactions performed with
the deletion mutant), samples of the 206 base pair duplex were
treated with either T7 gene 6 exonuclease (USB) or with calf
intestine alkaline phosphatase (Promega), according to
manufacturers' instructions, to produce either labeled
mononucleotide (lane a of FIG. 21B) or free .sup.32P-labeled
inorganic phosphate (lane b of FIG. 21B), respectively. These
products, along with the products seen in lane 7 of panel A were
resolved by brief electrophoresis through a 20% acrylamide gel
(19:1 cross-link), with 7 M urea, in a buffer of 45 mM Tris-Borate,
pH 8.3, 1.4 mM EDTA. CLEAVASE BB is thus capable of converting the
substrate to mononucleotides.
Example 6
Nibbling is Duplex Dependent
[0738] The nibbling by CLEAVASE BB is duplex dependent. In this
Example, internally labeled, single strands of the 206-mer were
produced by 15 cycles of primer extension incorporating
.alpha.-.sup.32P labeled dCTP combined with all four unlabeled
dNTPs, using an unlabeled 206-bp fragment as a template. Single and
double stranded products were resolved by electrophoresis through a
non-denaturing 6% polyacrylamide gel (29:1 cross-link) in a buffer
of 45 mM Tris.Borate, pH 8.3, 1.4 mM EDTA, visualized by
autoradiography, excised from the gel, eluted by passive diffusion,
and concentrated by ethanol precipitation.
[0739] The cleavage reactions comprised 0.04 pmoles of substrate
DNA, and 2 .mu.l of CLEAVASE BB (in an E. coli extract as described
above) in a total volume of 40 .mu.l of 10 mM Tris.Cl, pH 8.5, 50
mM KCl, 1.5 mM MgCl.sub.2. Reactions were initiated by the addition
of pre-warmed enzyme; 10 .mu.l aliquots were removed at 5, 10, 20,
and 30 minutes, and transferred to prepared tubes containing 8
.mu.l of 95% formamide with 30 mM EDTA and 0.05% marker dyes.
Samples were heated to 75.degree. C. for 2 minutes immediately
before electrophoresis through a 10% acrylamide gel (19:1
cross-linked), with 7 M urea, in a buffer of 45 mM Tris.Borate, pH
8.3, 1.4 mM EDTA. Results were visualized by autoradiography as
shown in FIG. 22. Clearly, the cleavage by CLEAVASE BB depends on a
duplex structure; no cleavage of the single strand structure is
detected whereas cleavage of the 206-mer duplex is complete.
Example 7
Nibbling Can be Target Directed
[0740] The nibbling activity of the DNAPs of the present invention
can be employed with success in a detection assay. One embodiment
of such an assay is shown in FIG. 23. In this assay, a labeled
oligo is employed that is specific for a target sequence. The oligo
is in excess of the target so that hybridization is rapid. In this
embodiment, the oligo contains two fluorescein labels whose
proximity on the oligo causes their emission to be quenched. When
the DNAP is permitted to nibble the oligo the labels separate and
are detectable. The shortened duplex is destabilized and
disassociates. Importantly, the target is now free to react with an
intact labeled oligo. The reaction can continue until the desired
level of detection is achieved. An analogous, although different,
type of cycling assay has been described employing lambda
exonuclease. See C. G. Copley and C. Boot, BioTechniques 13:888
(1992).
[0741] The success of such an assay depends on specificity. In
other words, the oligo must hybridize to the specific target. It is
also preferred that the assay be sensitive; the oligo ideally
should be able to detect small amounts of target. FIG. 24A shows a
5'-end .sup.32P-labeled primer bound to a plasmid target sequence.
In this case, the plasmid was pUC19 (commercially available) which
was heat denatured by boiling two (2) minutes and then quick
chilling. The primer is a 21-mer (SEQ ID NO:28). The enzyme
employed was CLEAVASE BX (a dilution equivalent to
5.times.10.sup.-3 .mu.l extract) in 100 mM KCl, 10 mM Tris-Cl, pH
8.3, 2 mM MnCl.sub.2. The reaction was performed at 55.degree. C.
for sixteen (16) hours with or without genomic background DNA (from
chicken blood). The reaction was stopped by the addition of 8 .mu.l
of 95% formamide with 20 mM EDTA and marker dyes.
[0742] The products of the reaction were resolved by PAGE (10%
polyacrylamide, 19:1 cross link, 1.times.TBE) as seen in FIG. 24B.
Lane "M" contains the labeled 21-mer. Lanes 1-3 contain no specific
target, although Lanes 2 and 3 contain 100 ng and 200 ng of genomic
DNA, respectively. Lanes 4, 5 and 6 all contain specific target
with either 0 ng, 100 ng, or 200 ng of genomic DNA, respectively.
It is clear that conversion to mononucleotides occurs in Lanes 4, 5
and 6 regardless of the presence or amount of background DNA. Thus,
the nibbling can be target directed and specific.
Example 8
Cleavase Purification
[0743] As noted above, expressed thermostable proteins (i.e., the
5' nucleases), were isolated by crude bacterial cell extracts. The
precipitated E. coli proteins were then, along with other cell
debris, removed by centrifugation. In this Example, cells
expressing the BN clone were cultured and collected (500 grams).
For each gram (wet weight) of E. coli, 3 ml of lysis buffer (50 mM
Tris-HCl, pH 8.0, 1 mM EDTA, 100 .mu.M NaCl) was added. The cells
were lysed with 200 .mu.g/ml lysozyme at room temperature for 20
minutes. Thereafter deoxycholic acid was added to make a 0.2% final
concentration and the mixture was incubated 15 minutes at room
temperature.
[0744] The lysate was sonicated for approximately 6-8 minutes at
0.degree. C. The precipitate was removed by centrifugation (39,000
g for 20 minutes). Polyethyleneimine was added (0.5%) to the
supernatant and the mixture was incubated on ice for 15 minutes.
The mixture was centrifuged (5,000 g for 15 minutes) and the
supernatant was retained. This was heated for 30 minutes at
60.degree. C. and then centrifuged again (5,000 g for 15 minutes)
and the supernatant was again retained.
[0745] The supernatant was precipitated with 35% ammonium sulfate
at 4.degree. C. for 15 minutes. The mixture was then centrifuged
(5,000 g for 15 minutes) and the supernatant was removed. The
precipitate was then dissolved in 0.25M KCl, 20 Tris pH 7.6, 0.2%
Tween and 0.1 EDTA) and then dialyzed against Binding Buffer
(8.times. Binding Buffer comprises: 40 mM imidazole, 4M NaCl, 160
mM Tris-HCl, pH 7.9).
[0746] The solubilized protein is then purified on the Ni.sup.++
column (Novagen). The Binding Buffer is allows to drain to the top
of the column bed and load the column with the prepared extract. A
flow rate of about 10 column volumes per hour is optimal for
efficient purification. If the flow rate is too fast, more
impurities will contaminate the eluted fraction.
[0747] The column is washed with 25 ml (10 volumes) of 1.times.
Binding Buffer and then washed with 15 ml (6 volumes) of 1.times.
Wash Buffer (8.times. Wash Buffer comprises: 480 mM imidazole, 4 M
NaCl, 160 mM Tris-HCl, pH 7.9). The bound protein was eluted with
15 ml (6 volumes) of 1.times. Elute Buffer (4.times. Elute Buffer
comprises: 4 mM imidazole, 2 M NaCl, 80 mM Tris-HCl, pH 7.9).
Protein is then reprecipitated with 35% ammonium sulfate as above.
The precipitate was then dissolved and dialyzed against: 20 mM
Tris, 100 mM KCl, 1 mM EDTA). The solution was brought up to 0.1%
each of Tween 20 and NP-40 and stored at 4.degree. C.
Example 9
The Use of Various Divalent Cations in the Cleavage Reaction
Influences the Nature of the Resulting Cleavage Products
[0748] In comparing the 5' nucleases generated by the modification
and/or deletion of the C-terminal polymerization domain of Thermus
aquaticus DNA polymerase (DNAPTaq), as diagrammed in FIG. 3B-G,
significant differences in the strength of the interactions of
these proteins with the 3' end of primers located upstream of the
cleavage site (as depicted in FIG. 5) were noted. In describing the
cleavage of these structures by Pol I-type DNA polymerases (See,
Example 1, and Lyamichev et al., Science 260:778 [1993]), it was
observed that in the absence of a primer, the location of the
junction between the double-stranded region and the single-stranded
5' and 3' arms determined the site of cleavage, but in the presence
of a primer, the location of the 3' end of the primer became the
determining factor for the site of cleavage. It was postulated that
this affinity for the 3' end was in accord with the synthesizing
function of the DNA polymerase.
[0749] Structure 2, shown in FIG. 20A, was used to test the effects
of a 3' end proximal to the cleavage site in cleavage reactions
comprising several different solutions (e.g., solutions containing
different salts [KCl or NaCl], different divalent cations
[Mn.sup.2+ or Mg.sup.2+], etc.) as well as the use of different
temperatures for the cleavage reaction. When the reaction
conditions were such that the binding of the enzyme (e.g., a DNAP
comprising a 5' nuclease, a modified DNAP or a 5' nuclease) to the
3' end (of the pilot oligonucleotide) near the cleavage site was
strong, the structure shown is cleaved at the site indicated in
FIG. 20A. This cleavage releases the unpaired 5' arm and leaves a
nick between the remaining portion of the target nucleic acid and
the folded 3' end of the pilot oligonucleotide. In contrast, when
the reaction conditions are such that the binding of the DNAP
(comprising a 5' nuclease) to the 3' end was weak, the initial
cleavage was as described above, but after the release of the 5'
arm, the remaining duplex is digested by the exonuclease function
of the DNAP.
[0750] One way of weakening the binding of the DNAP to the 3' end
is to remove all or part of the domain to which at least some of
this function has been attributed. Some of 5' nucleases created by
deletion of the polymerization domain of DNAPTaq have enhanced true
exonuclease function, as demonstrated in Example 5.
[0751] The affinity of these types of enzymes (i.e., 5' nucleases
associated with or derived from DNAPs) for recessed 3' ends may
also be affected by the identity of the divalent cation present in
the cleavage reaction. It was demonstrated by Longley et al. (Nucl.
Acids Res., 18:7317 [1990]) that the use of MnCl.sub.2 in a
reaction with DNAPTaq enabled the polymerase to remove nucleotides
from the 5' end of a primer annealed to a template, albeit
inefficiently. Similarly, by examination of the cleavage products
generated using Structure 2 from FIG. 20A, as described above, in a
reaction containing either DNAPTaq or the CLEAVASE BB nuclease, it
was observed that the substitution of MnCl.sub.2 for MgCl.sub.2 in
the cleavage reaction resulted in the exonucleolytic "nibbling" of
the duplex downstream of the initial cleavage site. While not
limiting the invention to any particular mechanism, it is thought
that the substitution of MnCl.sub.2 for MgCl.sub.2 in the cleavage
reaction lessens the affinity of these enzymes for recessed 3'
ends.
[0752] In all cases, the use of MnCl.sub.2 enhances the 5' nuclease
function, and in the case of the CLEAVASE BB nuclease, a 50- to
100-fold stimulation of the 5' nuclease function is seen. Thus,
while the exonuclease activity of these enzymes was demonstrated
above in the presence of MgCl.sub.2, the assays described below
show a comparable amount of exonuclease activity using 50 to
100-fold less enzyme when MnCl.sub.2 is used in place of
MgCl.sub.2. When these reduced amounts of enzyme are used in a
reaction mixture containing MgCl.sub.2, the nibbling or exonuclease
activity is much less apparent than that seen in Examples 5-7.
[0753] Similar effects are observed in the performance of the
nucleic acid detection assay described in Examples 10-39 below when
reactions performed in the presence of either MgCl.sub.2 or
MnCl.sub.2 are compared. In the presence of either divalent cation,
the presence of the INVADER oligonucleotide (described below)
forces the site of cleavage into the probe duplex, but in the
presence of MnCl.sub.2 the probe duplex can be further nibbled
producing a ladder of products that are visible when a 3' end label
is present on the probe oligonucleotide. When the INVADER
oligonucleotide is omitted from a reaction containing Mn.sup.2+,
the probe is nibbled from the 5' end. Mg.sup.2+-based reactions
display minimal nibbling of the probe oligonucleotide. In any of
these cases, the digestion of the probe is dependent upon the
presence of the target nucleic acid. In the examples below, the
ladder produced by the enhanced nibbling activity observed in the
presence of Mn.sup.2+ is used as a positive indicator that the
probe oligonucleotide has hybridized to the target sequence.
Example 10
Invasive 5' Endonucleolytic Cleavage by Thermostable 5' Nucleases
in the Absence of Polymerization
[0754] As described in the Examples above, 5' nucleases cleave near
the junction between single-stranded and base-paired regions in a
bifurcated duplex, usually about one base pair into the base-paired
region. In this Example, it is shown that thermostable 5'
nucleases, including those of the present invention (e.g., CLEAVASE
BN nuclease, CLEAVASE A/G nuclease), have the ability to cleave a
greater distance into the base paired region when provided with an
upstream oligonucleotide bearing a 3' region that is homologous to
a 5' region of the subject duplex, as shown in FIG. 26.
[0755] FIG. 26 shows a synthetic oligonucleotide that was designed
to fold upon itself and that consists of the following sequence:
5'-GTTCTCTGCTCTCTGGTCGCTG TCTCGCTTGTGAAACAAGCGAGACAGCGTGGTCTCTCG-3'
(SEQ ID NO:29). This oligonucleotide is referred to as the "S-60
Hairpin." The 15 basepair hairpin formed by this oligonucleotide is
further stabilized by a "tri-loop" sequence in the loop end (i.e.,
three nucleotides form the loop portion of the hairpin) (Hiraro et
al., Nucleic Acids Res., 22(4):576 [1994]). FIG. 26 also show the
sequence of the P-15 oligonucleotide and the location of the region
of complementarity shared by the P-15 and S-60 hairpin
oligonucleotides. The sequence of the P-15 oligonucleotide is
5'-CGAGAGACCACGCTG-3' (SEQ ID NO:30). As discussed in detail below,
the solid black arrowheads shown in FIG. 26 indicate the sites of
cleavage of the S-60 hairpin in the absence of the P-15
oligonucleotide and the hollow arrow heads indicate the sites of
cleavage in the presence of the P-15 oligonucleotide. The size of
the arrow head indicates the relative utilization of a particular
site.
[0756] The S-60 hairpin molecule was labeled on its 5' end with
biotin for subsequent detection. The S-60 hairpin was incubated in
the presence of a thermostable 5' nuclease in the presence or the
absence of the P-15 oligonucleotide. The presence of the full
duplex that can be formed by the S-60 hairpin is demonstrated by
cleavage with the CLEAVASE BN 5' nuclease, in a primer-independent
fashion (i.e., in the absence of the P-15 oligonucleotide). The
release of 18 and 19-nucleotide fragments from the 5' end of the
S-60 hairpin molecule showed that the cleavage occurred near the
junction between the single and double stranded regions when
nothing is hybridized to the 3' arm of the S-60 hairpin (FIG. 27,
lane 2).
[0757] The reactions shown in FIG. 27 were conducted as follows.
Twenty fmole of the 5' biotin-labeled hairpin DNA (SEQ ID NO:29)
was combined with 0.1 ng of CLEAVASE BN enzyme and 1 .mu.l of 100
mM MOPS (pH 7.5) containing 0.5% each of Tween-20 and NP-40 in a
total volume of 9 .mu.l. In the reaction shown in lane 1, the
enzyme was omitted and the volume was made up by addition of
distilled water (this served as the uncut or no enzyme control).
The reaction shown in lane 3 of FIG. 27 also included 0.5 pmole of
the P15 oligonucleotide (SEQ ID NO:30), which can hybridize to the
unpaired 3' arm of the S-60 hairpin (SEQ ID NO:29), as diagrammed
in FIG. 26.
[0758] The reactions were overlaid with a drop of mineral oil,
heated to 95.degree. C. for 15 seconds, then cooled to 37.degree.
C., and the reaction was started by the addition of 1 .mu.l of 10
mM MnCl.sub.2 to each tube. After 5 minutes, the reactions were
stopped by the addition of 6 .mu.l of 95% formamide containing 20
mM EDTA and 0.05% marker dyes. Samples were heated to 75.degree. C.
for 2 minutes immediately before electrophoresis through a 15%
acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of
45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA.
[0759] After electrophoresis, the gel plates were separated
allowing the gel to remain flat on one plate. A 0.2 mm-pore
positively-charged nylon membrane (NYTRAN, Schleicher and Schuell,
Keene, N.H.), pre-wetted in H.sub.2O, was laid on top of the
exposed gel. All air bubbles were removed. Two pieces of 3 mM
filter paper (Whatman) were then placed on top of the membrane, the
other glass plate was replaced, and the sandwich was clamped with
binder clips. Transfer was allowed to proceed overnight. After
transfer, the membrane was carefully peeled from the gel and
allowed to air dry. After complete drying, the membrane was washed
in 1.2.times. Sequenase Images Blocking Buffer (United States
Biochemical) using 0.3 ml of buffer/cm.sup.2 of membrane. The wash
was performed for 30 minutes at room temperature. A
streptavidin-alkaline phosphatase conjugate (SAAP, United States
Biochemical) was added to a 1:4000 dilution directly to the
blocking solution, and agitated for 15 minutes. The membrane was
rinsed briefly with H.sub.2O and then washed three times for 5
minutes per wash using 0.5 ml/cm.sup.2 of 1.times.SAAP buffer (100
mM Tris-HCl, pH 10, 50 mM NaCl) with 0.1% sodium dodecyl sulfate
(SDS). The membrane was rinsed briefly with H.sub.2O between each
wash. The membrane was then washed once in 1.times.SAAP buffer
containing 1 mM MgCl.sub.2 without SDS, drained thoroughly and
placed in a plastic heat-sealable bag. Using a sterile pipet, 5 mls
of CDP-Star.TM. (Tropix, Bedford, Mass.) chemiluminescent substrate
for alkaline phosphatase were added to the bag and distributed over
the entire membrane for 2-3 minutes. The CDP-Star.TM.-treated
membrane was exposed to XRP X-ray film (Kodak) for an initial
exposure of 10 minutes.
[0760] The resulting autoradiograph is shown in FIG. 27. In FIG.
27, the lane labeled "M" contains the biotinylated P-15
oligonucleotide, which served as a marker. The sizes (in
nucleotides) of the uncleaved S-60 hairpin (60 nuc; lane 1), the
marker (15 nuc; lane "M") and the cleavage products generated by
cleavage of the S-60 hairpin in the presence (lane 3) or absence
(lane 2) of the P-15 oligonucleotide are indicated.
[0761] Because the complementary regions of the S-60 hairpin are
located on the same molecule, essentially no lag time should be
needed to allow hybridization (i.e., to form the duplex region of
the hairpin). This hairpin structure would be expected to form long
before the enzyme could locate and cleave the molecule. As
expected, cleavage in the absence of the primer oligonucleotide was
at or near the junction between the duplex and single-stranded
regions, releasing the unpaired 5' arm (FIG. 27, lane 2). The
resulting cleavage products were 18 and 19 nucleotides in
length.
[0762] It was expected that stability of the S-60 hairpin with the
tri-loop would prevent the P-15 oligonucleotide from promoting
cleavage in the "primer-directed" manner described in Example 1
above, because the 3' end of the "primer" would remain unpaired.
Surprisingly, it was found that the enzyme seemed to mediate an
"invasion" by the P-15 primer into the duplex region of the S-60
hairpin, as evidenced by the shifting of the cleavage site 3 to 4
basepairs further into the duplex region, releasing the larger
products (22 and 21 nuc.) observed in lane 3 of FIG. 27.
[0763] The precise sites of cleavage of the S-60 hairpin are
diagrammed on the structure in FIG. 26, with the solid black
arrowheads indicating the sites of cleavage in the absence of the
P-15 oligonucleotide and the hollow arrow heads indicating the
sites of cleavage in the presence of P-15.
[0764] These data show that the presence on the 3' arm of an
oligonucleotide having some sequence homology with the first
several bases of the similarly oriented strand of the downstream
duplex can be a dominant factor in determining the site of cleavage
by 5' nucleases. Because the oligonucleotide that shares some
sequence homology with the first several bases of the similarly
oriented strand of the downstream duplex appears to invade the
duplex region of the hairpin, it is referred to as an "INVADER"
oligonucleotide. As shown in the Examples below, an INVADER
oligonucleotide appears to invade (or displace) a region of
duplexed nucleic acid regardless of whether the duplex region is
present on the same molecule (i.e., a hairpin) or whether the
duplex is formed between two separate nucleic acid strands.
Example 11
The INVADER Oligonucleotide Shifts the Site of Cleavage in a
Pre-Formed Probe/Target Duplex
[0765] In Example 10, it was demonstrated that an INVADER
oligonucleotide could shift the site at which a 5' nuclease cleaves
a duplex region present on a hairpin molecule. In this Example, the
ability of an INVADER oligonucleotide to shift the site of cleavage
within a duplex region formed between two separate strands of
nucleic acid molecules was examined.
[0766] A single-stranded target DNA comprising the single-stranded
circular M13mp19 molecule and a labeled (fluorescein) probe
oligonucleotide were mixed in the presence of the reaction buffer
containing salt (KCl) and divalent cations (Mg.sup.2+ or Mn.sup.2+)
to promote duplex formation. The probe oligonucleotide refers to a
labeled oligonucleotide that is complementary to a region along the
target molecule (e.g., M13mp19). A second oligonucleotide
(unlabeled) was added to the reaction after the probe and target
had been allowed to anneal. The second oligonucleotide binds to a
region of the target that is located downstream of the region to
which the probe oligonucleotide binds. This second oligonucleotide
contains sequences that are complementary to a second region of the
target molecule. If the second oligonucleotide contains a region
that is complementary to a portion of the sequences along the
target to which the probe oligonucleotide also binds, this second
oligonucleotide is referred to as an INVADER oligonucleotide (see
FIG. 28c).
[0767] FIG. 32 depicts the annealing of two oligonucleotides to
regions along the M13mp19 target molecule (bottom strand in all
three structures shown). In FIG. 28 only a 52 nucleotide portion of
the M13mp19 molecule is shown; this 52 nucleotide sequence is
listed in SEQ ID NO:31. The probe oligonucleotide contains a
fluorescein label at the 3' end; the sequence of the probe is
5'-AGAAAGGAAGGGAAGAAAGCGAAAGG-3' (SEQ ID NO:32). In FIG. 28,
sequences comprising the second oligonucleotide, including the
INVADER oligonucleotide are underlined. In FIG. 28a, the second
oligonucleotide, which has the sequence 5'-GACGGGGAAAGCCGGCGAACG-3'
(SEQ ID NO:33), is complementary to a different and downstream
region of the target molecule than is the probe oligonucleotide
(labeled with fluorescein or "Fluor"); there is a gap between the
second, upstream oligonucleotide and the probe for the structure
shown in FIG. 28a. In FIG. 28b, the second, upstream
oligonucleotide, which has the sequence 5'-GAAAGCCGGCGAACGTGGCG-3'
(SEQ ID NO:34), is complementary to a different region of the
target molecule than is the probe oligonucleotide, but in this
case, the second oligonucleotide and the probe oligonucleotide abut
one another (that is the 3' end of the second, upstream
oligonucleotide is immediately adjacent to the 5' end of the probe
such that no gap exists between these two oligonucleotides). In
FIG. 28c, the second, upstream oligonucleotide
(5'-GGCGAACGTGGCGAGAAAGGA-3' [SEQ ID NO:35]) and the probe
oligonucleotide share a region of complementarity with the target
molecule. Thus, the upstream oligonucleotide has a 3' arm that has
a sequence identical to the first several bases of the downstream
probe. In this situation, the upstream oligonucleotide is referred
to as an "INVADER" oligonucleotide.
[0768] The effect of the presence of an INVADER oligonucleotide
upon the pattern of cleavage in a probe/target duplex formed prior
to the addition of the INVADER was examined. The INVADER
oligonucleotide and the enzyme were added after the probe was
allowed to anneal to the target and the position and extent of
cleavage of the probe were examined to determine a) if the INVADER
was able to shift the cleavage site to a specific internal region
of the probe, and b), if the reaction could accumulate specific
cleavage products over time, even in the absence of thermal
cycling, polymerization, or exonuclease removal of the probe
sequence.
[0769] The reactions were carried out as follows. Twenty .mu.l each
of two enzyme mixtures were prepared, containing 2 .mu.l of
CLEAVASE A/G nuclease extract (prepared as described in Example 2),
with or without 50 pmole of the INVADER oligonucleotide (SEQ ID
NO:35), as indicated, per 4 .mu.l of the mixture. For each of the
eight reactions shown in FIG. 29, 150 fmole of M13mp19
single-stranded DNA (available from Life Technologies, Inc.) was
combined with 5 pmoles of fluorescein labeled probe (SEQ ID NO:32),
to create the structure shown in FIG. 28c, but without the INVADER
oligonucleotide present (the probe/target mixture). One half (4
tubes) of the probe/target mixtures were combined with 1 .mu.l of
100 mM MOPS, pH 7.5 with 0.5% each of Tween-20 and NP-40, 0.5 .mu.l
of 1 M KCl and 0.25 .mu.l of 80 mM MnCl.sub.2, and distilled water
to a volume of 6 .mu.l. The second set of probe/target mixtures
were combined with 1 .mu.l of 100 mM MOPS, pH 7.5 with 0.5% each of
Tween-20 and NP-40, 0.5 .mu.l of 1 M KCl and 0.25 .mu.l of 80 mM
MgCl.sub.2. The second set of mixtures therefore contained
MgCl.sub.2 in place of the MnCl.sub.2 present in the first set of
mixtures.
[0770] The mixtures (containing the probe/target with buffer, KCl
and divalent cation) were covered with a drop of CHILLOUT
evaporation barrier and were brought to 60.degree. C. for 5 minutes
to allow annealing. Four .mu.l of the above enzyme mixtures without
the INVADER oligonucleotide was added to reactions whose products
are shown in lanes 1, 3, 5 and 7 of FIG. 29. Reactions whose
products are shown lanes 2, 4, 6, and 8 of FIG. 29 received the
same amount of enzyme mixed with the INVADER oligonucleotide (SEQ
ID NO:35). Reactions 1, 2, 5 and 6 were incubated for 5 minutes at
60.degree. C. and reactions 3, 4, 7 and 8 were incubated for 15
minutes at 60.degree. C.
[0771] All reactions were stopped by the addition of 8 .mu.l of 95%
formamide with 20 mM EDTA and 0.05% marker dyes. Samples were
heated to 90.degree. C. for 1 minute immediately before
electrophoresis through a 20% acrylamide gel (19:1 cross-linked),
containing 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4
mM EDTA. Following electrophoresis, the reaction products and were
visualized by the use of an Hitachi FMBIO fluorescence imager, the
output of which is seen in FIG. 29. The very low molecular weight
fluorescent material seen in all lanes at or near the salt front in
FIG. 29 and other fluoro-imager Figures is observed when
fluorescently-labeled oligonucleotides are electrophoresed and
imaged on a fluoro-imager. This material is not a product of the
cleavage reaction.
[0772] The use of MnCl.sub.2 in these reactions (lanes 1-4)
stimulates the true exonuclease or "nibbling" activity of the
CLEAVASE enzyme, as described in Example 6, as is clearly seen in
lanes 1 and 3 of FIG. 29. This nibbling of the probe
oligonucleotide (SEQ ID NO:32) in the absence of INVADER
oligonucleotide (SEQ ID NO:35) confirms that the probe
oligonucleotide is forming a duplex with the target sequence. The
ladder-like products produced by this nibbling reaction may be
difficult to differentiate from degradation of the probe by
nucleases that might be present in a clinical specimen. In
contrast, introduction of the INVADER oligonucleotide (SEQ ID
NO:35) caused a distinctive shift in the cleavage of the probe,
pushing the site of cleavage 6 to 7 bases into the probe,
confirming the annealing of both oligonucleotides. In presence of
MnCl.sub.2, the exonuclease "nibbling" may occur after the
INVADER-directed cleavage event, until the residual duplex is
destabilized and falls apart.
[0773] In a magnesium based cleavage reaction (lanes 5-8), the
nibbling or true exonuclease function of the CLEAVASE A/G is enzyme
suppressed (but the endonucleolytic function of the enzyme is
essentially unaltered), so the probe oligonucleotide is not
degraded in the absence of the INVADER (FIG. 29, lanes 5 and 7).
When the INVADER is added, it is clear that the INVADER
oligonucleotide can promote a shift in the site of the
endonucleolytic cleavage of the annealed probe. Comparison of the
products of the 5 and 15 minute reactions with INVADER (lanes 6 and
8 in FIG. 29) shows that additional probe hybridizes to the target
and is cleaved. The calculated melting temperature (T.sub.m) of the
portion of probe that is not invaded (i.e., nucleotides 9-26 of SEQ
ID NO:32) is 56.degree. C., so the observed turnover (as evidenced
by the accumulation of cleavage products with increasing reaction
time) suggests that the full length of the probe molecule, with a
calculated T.sub.m of 76.degree. C., is must be involved in the
subsequent probe annealing events in this 60.degree. C.
reaction.
Example 12
The Overlap of the 3' INVADER Oligonucleotide Sequence with the 5'
Region of the Probe Causes a Shift in the Site of Cleavage
[0774] In Example 11, the ability of an INVADER oligonucleotide to
cause a shift in the site of cleavage of a probe annealed to a
target molecule was demonstrated. In this Example, experiments were
conducted to examine whether the presence of an oligonucleotide
upstream from the probe was sufficient to cause a shift in the
cleavage site(s) along the probe or whether the presence of
nucleotides on the 3' end of the INVADER oligonucleotide that have
the same sequence as the first several nucleotides at the 5' end of
the probe oligonucleotide were required to promote the shift in
cleavage.
[0775] To examine this point, the products of cleavage obtained
from three different arrangements of target-specific
oligonucleotides are compared. A diagram of these oligonucleotides
and the way in which they hybridize to a test nucleic acid,
M13mp19, is shown in FIG. 28. In FIG. 28a, the 3' end of the
upstream oligonucleotide (SEQ ID NO:33) is located upstream of the
5' end of the downstream "probe" oligonucleotide (SEQ ID NO:32)
such that a region of the M13 target that is not paired to either
oligonucleotide is present. In FIG. 28b, the sequence of the
upstream oligonucleotide (SEQ ID NO:34) is immediately upstream of
the probe (SEQ ID NO:32), having neither a gap nor an overlap
between the sequences. FIG. 28c diagrams the arrangement of the
substrates used in the assay of the present invention, showing that
the upstream "INVADER" oligonucleotide (SEQ ID NO:35) has the same
sequence on a portion of its 3' region as that present in the 5'
region of the downstream probe (SEQ ID NO:32). That is to say,
these regions will compete to hybridize to the same segment of the
M113 target nucleic acid.
[0776] In these experiments, four enzyme mixtures were prepared as
follows (planning 5 .mu.l per digest): Mixture 1 contained 2.25
.mu.l of CLEAVASE A/G nuclease extract (prepared as described in
Example 2) per 5 .mu.l of mixture, in 20 mM MOPS, pH 7.5 with 0.1%
each of Tween 20 and NP-40, 4 mM MnCl.sub.2 and 100 mM KCl. Mixture
2 contained 11.25 units of Taq DNA polymerase (Promega) per 5 .mu.l
of mixture in 20 mM MOPS, pH 7.5 with 0.1% each of Tween 20 and
NP-40, 4 mM MnCl.sub.2 and 100 mM KCl. Mixture 3 contained 2.25
.mu.l of CLEAVASE A/G nuclease extract per 5 .mu.l of mixture in 20
mM Tris-HCl, pH 8.5, 4 mM MgCl.sub.2 and 100 mM KCl. Mixture 4
contained 11.25 units of Taq DNA polymerase per 5 .mu.l of mixture
in 20 mM Tris-HCl, pH 8.5, 4 mM MgCl.sub.2 and 100 mM KCl.
[0777] For each reaction, 50 fmole of M13mp19 single-stranded DNA
(the target nucleic acid) was combined with 5 pmole of the probe
oligonucleotide (SEQ ID NO:32 which contained a fluorescein label
at the 3' end) and 50 pmole of one of the three upstream
oligonucleotides diagrammed in FIG. 28 (i.e., one of SEQ ID
NOS:33-35), in a total volume of 5 .mu.l of distilled water. The
reactions were overlaid with a drop of ChillOut.TM. evaporation
barrier and warmed to 62.degree. C. The cleavage reactions were
started by the addition of 5 .mu.l of an enzyme mixture to each
tube, and the reactions were incubated at 62.degree. C. for 30 min.
The reactions shown in lanes 1-3 of FIG. 30 received Mixture 1;
reactions 4-6 received Mixture 2; reactions 7-9 received Mixture 3
and reactions 10-12 received Mixture 4.
[0778] After 30 minutes at 62.degree. C., the reactions were
stopped by the addition of 8 .mu.l of 95% formamide with 20 mM EDTA
and 0.05% marker dyes. Samples were heated to 75.degree. C. for 2
minutes immediately before electrophoresis through a 20% acrylamide
gel (19:1 cross-linked), with 7 M urea, in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA.
[0779] Following electrophoresis, the products of the reactions
were visualized by the use of an Hitachi FMBIO fluorescence imager,
the output of which is seen in FIG. 30. The reaction products shown
in lanes 1, 4, 7 and 10 of FIG. 30 were from reactions that
contained SEQ ID NO:33 as the upstream oligonucleotide (see FIG.
28a). The reaction products shown in lanes 2, 5, 8 and 11 of FIG.
30 were from reactions that contained SEQ ID NO:34 as the upstream
oligonucleotide (see FIG. 28b). The reaction products shown in
lanes 3, 6, 9 and 12 of FIG. 30 were from reactions that contained
SEQ ID NO:35, the INVADER oligonucleotide, as the upstream
oligonucleotide (see FIG. 28c).
[0780] Examination of the Mn.sup.2+ based reactions using either
CLEAVASE A/G nuclease or DNAPTaq as the cleavage agent (lanes 1
through 3 and 4 through 6, respectively) shows that both enzymes
have active exonuclease function in these buffer conditions. The
use of a 3' label on the probe oligonucleotide allows the products
of the nibbling activity to remain labeled, and therefore visible
in this assay. The ladders seen in lanes 1, 2, 4 and 5 confirm that
the probe hybridize to the target DNA as intended. These lanes also
show that the location of the non-invasive oligonucleotides have
little effect on the products generated. The uniform ladder created
by these digests would be difficult to distinguish from a ladder
causes by a contaminating nuclease, as one might find in a clinical
specimen. In contrast, the products displayed in lanes 3 and 6,
where an INVADER oligonucleotide was provided to direct the
cleavage, show a very distinctive shift, so that the primary
cleavage product is smaller than those seen in the non-invasive
cleavage. This product is then subject to further nibbling in these
conditions, as indicated by the shorter products in these lanes.
These INVADER-directed cleavage products would be easily
distinguished from a background of non-specific degradation of the
probe oligonucleotide.
[0781] When Mg.sup.2+ is used as the divalent cation the results
are even more distinctive. In lanes 7, 8, 10 and 11 of FIG. 30,
where the upstream oligonucleotides were not invasive, minimal
nibbling is observed. The products in the DNAPTaq reactions show
some accumulation of probe that has been shortened on the 5' end by
one or two nucleotides consistent with previous examination of the
action of this enzyme on nicked substrates (Longley et al., supra).
When the upstream oligonucleotide is invasive, however, the
appearance of the distinctively shifted probe band is seen. These
data clearly indicated that it is the invasive 3' portion of the
upstream oligonucleotide that is responsible for fixing the site of
cleavage of the downstream probe.
[0782] Thus, the above results demonstrate that it is the presence
of the free or initially non-annealed nucleotides at the 3' end of
the INVADER oligonucleotide that mediate the shift in the cleavage
site, not just the presence of an oligonucleotide annealed upstream
of the probe. Nucleic acid detection assays that employ the use of
an INVADER oligonucleotide are termed "INVADER-directed cleavage"
assays.
Example 13
INVADER-Directed Cleavage Recognizes Single and Double Stranded
Target Molecules in a Background of Non-Target DNA Molecules
[0783] For a nucleic acid detection method to be broadly useful, it
must be able to detect a specific target in a sample that may
contain large amounts of other DNA, (e.g., bacterial or human
chromosomal DNA). The ability of the INVADER directed cleavage
assay to recognize and cleave either single- or double-stranded
target molecules in the presence of large amounts of non-target DNA
was examined. In these experiments a model target nucleic acid,
M13, in either single or double stranded form (single-stranded
M13mp18 is available from Life Technologies, Inc and
double-stranded M13mp19 is available from NEB), was combined with
human genomic DNA (Novagen) and then utilized in INVADER-directed
cleavage reactions. Before the start of the cleavage reaction, the
DNAs were heated to 95.degree. C. for 15 minutes to completely
denature the samples, as is standard practice in assays, such as
polymerase chain reaction or enzymatic DNA sequencing, which
involve solution hybridization of oligonucleotides to
double-stranded target molecules.
[0784] For each of the reactions shown in lanes 2-5 of FIG. 31, the
target DNA (25 fmole of the ss DNA or 1 pmole of the ds DNA) was
combined with 50 pmole of the INVADER oligonucleotide (SEQ ID
NO:35); for the reaction shown in lane 1 the target DNA was
omitted. Reactions 1, 3 and 5 also contained 470 ng of human
genomic DNA. These mixtures were brought to a volume of 10 .mu.l
with distilled water, overlaid with a drop of ChillOut.TM.
evaporation barrier, and brought to 95.degree. C. for 15 minutes.
After this incubation period, and still at 95.degree. C., each tube
received 10 .mu.l of a mixture comprising 2.25 .mu.l of CLEAVASE
A/G nuclease extract (prepared as described in Example 2) and 5
pmole of the probe oligonucleotide (SEQ ID NO:32), in 20 mM MOPS,
pH 7.5 with 0.1% each of Tween 20 and NP-40, 4 mM MnCl.sub.2 and
100 mM KCl. The reactions were brought to 62.degree. C. for 15
minutes and stopped by the addition of 12 .mu.l of 95% formamide
with 20 mM EDTA and 0.05% marker dyes. Samples were heated to
75.degree. C. for 2 minutes immediately before electrophoresis
through a 20% acrylamide gel (19:1 cross-linked), with 7 M urea, in
a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The products of
the reactions were visualized by the use of an Hitachi FMBIO
fluorescence imager. The results are displayed in FIG. 31.
[0785] In FIG. 31, lane 1 contains the products of the reaction
containing the probe (SEQ ID NO:32), the INVADER oligonucleotide
(SEQ ID NO:35) and human genomic DNA. Examination of lane 1 shows
that the probe and INVADER oligonucleotides are specific for the
target sequence, and that the presence of genomic DNA does not
cause any significant background cleavage.
[0786] In FIG. 31, lanes 2 and 3 contain reaction products from
reactions containing the single-stranded target DNA (M13mp18), the
probe (SEQ ID NO:32) and the INVADER oligonucleotide (SEQ ID NO:35)
in the absence or presence of human genomic DNA, respectively.
Examination of lanes 2 and 3 demonstrate that the INVADER detection
assay may be used to detect the presence of a specific sequence on
a single-stranded target molecule in the presence or absence of a
large excess of competitor DNA (human genomic DNA).
[0787] In FIG. 31, lanes 4 and 5 contain reaction products from
reactions containing the double-stranded target DNA (M13mp19), the
probe (SEQ ID NO:32) and the INVADER oligonucleotide (SEQ ID NO:35)
in the absence or presence of human genomic DNA, respectively.
Examination of lanes 4 and 5 show that double stranded target
molecules are eminently suitable for INVADER-directed detection
reactions. The success of this reaction using a short duplexed
molecule, M13mp19, as the target in a background of a large excess
of genomic DNA is especially noteworthy as it would be anticipated
that the shorter and less complex M13 DNA strands would be expected
to find their complementary strand more easily than would the
strands of the more complex human genomic DNA. If the M13 DNA
reannealed before the probe and/or INVADER oligonucleotides could
bind to the target sequences along the M13 DNA, the cleavage
reaction would be prevented. In addition, because the denatured
genomic DNA would potentially contain regions complementary to the
probe and/or INVADER oligonucleotides it was possible that the
presence of the genomic DNA would inhibit the reaction by binding
these oligonucleotides thereby preventing their hybridization to
the M13 target. The above results demonstrate that these
theoretical concerns are not a problem under the reaction
conditions employed above.
[0788] In addition to demonstrating that the INVADER detection
assay may be used to detect sequences present in a double-stranded
target, these data also show that the presence of a large amount of
non-target DNA (470 ng/20 .mu.l reaction) does not lessen the
specificity of the cleavage. While this amount of DNA does show
some impact on the rate of product accumulation, probably by
binding a portion of the enzyme, the nature of the target sequence,
whether single- or double-stranded nucleic acid, does not limit the
application of this assay.
Example 14
Signal Accumulation in the INVADER-Directed Cleavage Assay as a
Function of Target Concentration
[0789] To investigate whether the INVADER-directed cleavage assay
could be used to indicate the amount of target nucleic acid in a
sample, the following experiment was performed. Cleavage reactions
were assembled that contained an INVADER oligonucleotide (SEQ ID
NO:35), a labeled probe (SEQ ID NO:32) and a target nucleic acid,
M13mp19. A series of reactions, which contained smaller and smaller
amounts of the M13 target DNA, was employed in order to examine
whether the cleavage products would accumulate in a manner that
reflected the amount of target DNA present in the reaction.
[0790] The reactions were conducted as follows. A master mix
containing enzyme and buffer was assembled. Each 5 .mu.l of the
master mixture contained 25 ng of CLEAVASE BN nuclease in 20 mM
MOPS (pH 7.5) with 0.1% each of Tween 20 and NP-40, 4 mM MnCl.sub.2
and 100 mM KCl. For each of the cleavage reactions shown in lanes
4-13 of FIG. 32, a DNA mixture was generated that contained 5
pmoles of the fluorescein-labeled probe oligonucleotide (SEQ ID
NO:32), 50 pmoles of the INVADER oligonucleotide (SEQ ID NO:35) and
100, 50, 10, 5, 1, 0.5, 0.1, 0.05, 0.01 or 0.005 fmoles of
single-stranded M13mp19, respectively, for every 5 .mu.l of the DNA
mixture. The DNA solutions were covered with a drop of CHILLOUT
evaporation barrier and brought to 61.degree. C. The cleavage
reactions were started by the addition of 5 .mu.l of the enzyme
mixture to each of tubes (final reaction volume was 101). After 30
minutes at 61.degree. C., the reactions were terminated by the
addition of 8 .mu.l of 95% formamide with 20 mM EDTA and 0.05%
marker dyes. Samples were heated to 90.degree. C. for 1 minute
immediately before electrophoresis through a 20% denaturing
acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer
containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA. To provide
reference (i.e., standards), 1.0, 0.1 and 0.01 pmole aliquots of
fluorescein-labeled probe oligonucleotide (SEQ ID NO:32) were
diluted with the above formamide solution to a final volume of 18
.mu.l. These reference markers were loaded into lanes 1-3,
respectively of the gel. The products of the cleavage reactions (as
well as the reference standards) were visualized following
electrophoresis by the use of a Hitachi FMBIO fluorescence imager.
The results are displayed in FIG. 32.
[0791] In FIG. 32, boxes appear around fluorescein-containing
nucleic acid (i.e., the cleaved and uncleaved probe molecules) and
the amount of fluorescein contained within each box is indicated
under the box. The background fluorescence of the gel (see box
labeled "background") was subtracted by the fluoro-imager to
generate each value displayed under a box containing cleaved or
uncleaved probe products (the boxes are numbered 1-14 at top left
with a V followed by a number below the box). The lane marked "M"
contains fluoresceinated oligonucleotides, which served as
markers.
[0792] The results shown in FIG. 32, demonstrate that the
accumulation of cleaved probe molecules in a fixed-length
incubation period reflects the amount of target DNA present in the
reaction. The results also demonstrate that the cleaved probe
products accumulate in excess of the copy number of the target.
This is clearly demonstrated by comparing the results shown in lane
3, in which 10 fmole (0.01 pmole) of uncut probe are displayed with
the results shown in 5, where the products that accumulated in
response to the presence of 10 fmole of target DNA are displayed.
These results show that the reaction can cleave hundreds of probe
oligonucleotide molecules for each target molecule present,
dramatically amplifying the target-specific signal generated in the
INVADER-directed cleavage reaction.
Example 15
Effect of Saliva Extract on the INVADER-Directed Cleavage Assay
[0793] For a nucleic acid detection method to be useful in a
medical (i.e., a diagnostic) setting, it must not be inhibited by
materials and contaminants likely to be found in a typical clinical
specimen. To test the susceptibility of the INVADER-directed
cleavage assay to various materials, including but not limited to
nucleic acids, glycoproteins and carbohydrates, likely to be found
in a clinical sample, a sample of human saliva was prepared in a
manner consistent with practices in the clinical laboratory and the
resulting saliva extract was added to the INVADER-directed cleavage
assay. The effect of the saliva extract upon the inhibition of
cleavage and upon the specificity of the cleavage reaction was
examined.
[0794] One and one-half milliliters of human saliva were collected
and extracted once with an equal volume of a mixture containing
phenol:chloroform:isoamyl alcohol (25:24:1). The resulting mixture
was centrifuged in a microcentrifuge to separate the aqueous and
organic phases. The upper, aqueous phase was transferred to a fresh
tube. One-tenth volumes of 3 M NaOAc were added and the contents of
the tube were mixed. Two volumes of 100% ethyl alcohol were added
to the mixture and the sample was mixed and incubated at room
temperature for 15 minutes to allow a precipitate to form. The
sample was centrifuged in a microcentrifuge at 13,000 rpm for 5
minutes and the supernatant was removed and discarded. A milky
pellet was easily visible. The pellet was rinsed once with 70%
ethanol, dried under vacuum and dissolved in 200 .mu.l of 10 mM
Tris-HCl, pH 8.0, 0.1 mM EDTA (this constitutes the saliva
extract). Each .mu.l of the saliva extract was equivalent to 7.5
.mu.l of saliva. Analysis of the saliva extract by scanning
ultraviolet spectrophotometry showed a peak absorbance at about 260
nm and indicated the presence of approximately 45 ng of total
nucleic acid per .mu.l of extract.
[0795] The effect of the presence of saliva extract upon the
following enzymes was examined: CLEAVASE BN nuclease, CLEAVASE A/G
nuclease and three different lots of DNAPTaq: AmpliTaq.RTM. (Perkin
Elmer; a recombinant form of DNAPTaq), AmpliTaq.RTM. LD
(Perkin-Elmer; a recombinant DNAPTaq preparation containing very
low levels of DNA) and Taq DNA polymerase (Fischer). For each
enzyme tested, an enzyme/probe mixture was made comprising the
chosen amount of enzyme with 5 pmole of the probe oligonucleotide
(SEQ ID NO:32) in 10 .mu.l of 20 mM MOPS (pH 7.5) containing 0.1%
each of Tween 20 and NP-40, 4 mM MnCl.sub.2, 100 mM KCl and 100
.mu.g/ml BSA. The following amounts of enzyme were used: 25 ng of
CLEAVASE BN prepared as described in Example 8; 2 .mu.l of CLEAVASE
A/G nuclease extract prepared as described in Example 2; 2.25 .mu.l
(11.25 polymerase units) the following DNA polymerases:
AmpliTaq.RTM. DNA polymerase (Perkin Elmer); AmpliTaq.RTM. DNA
polymerase LD (low DNA; from Perkin Elmer); Taq DNA polymerase
(Fisher Scientific).
[0796] For each of the reactions shown in FIG. 33, except for that
shown in lane 1, the target DNA (50 fmoles of single-stranded
M13mp19 DNA) was combined with 50 pmole of the INVADER
oligonucleotide (SEQ ID NO:35) and 5 pmole of the probe
oligonucleotide (SEQ ID NO:32); target DNA was omitted in reaction
1 (lane 1). Reactions 1, 3, 5, 7, 9 and 11 included 1.5 .mu.l of
saliva extract. These mixtures were brought to a volume of 5 .mu.l
with distilled water, overlaid with a drop of CHILLOUT evaporation
barrier and brought to 95.degree. C. for 10 minutes. The cleavage
reactions were then started by the addition of 5 .mu.l of the
desired enzyme/probe mixture; reactions 1, 4 and 5 received
CLEAVASE A/G nuclease. Reactions 2 and 3 received CLEAVASE BN;
reactions 6 and 7 received AmpliTaq.RTM.; reactions 8 and 9
received AmpliTaq.RTM. LD; and reactions 10 and 11 received Taq DNA
Polymerase from Fisher Scientific.
[0797] The reactions were incubated at 63.degree. C. for 30 minutes
and were stopped by the addition of 6 .mu.l of 95% formamide with
20 mM EDTA and 0.05% marker dyes. Samples were heated to 75.degree.
C. for 2 minutes immediately before electrophoresis through a 20%
acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of
45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The products of the
reactions were visualized by the use of an Hitachi FMBIO
fluorescence imager, and the results are displayed in FIG. 33.
[0798] A pairwise comparison of the lanes shown in FIG. 33 without
and with the saliva extract, treated with each of the enzymes,
shows that the saliva extract has different effects on each of the
enzymes. While the CLEAVASE BN nuclease and the AmpliTaq.RTM. are
significantly inhibited from cleaving in these conditions, the
CLEAVASE A/G nuclease and AmpliTaq.RTM. LD display little
difference in the yield of cleaved probe. The preparation of Taq
DNA polymerase from Fisher Scientific shows an intermediate
response, with a partial reduction in the yield of cleaved product.
From the standpoint of polymerization, the three DNAPTaq variants
should be equivalent; these should be the same protein with the
same amount of synthetic activity. It is possible that the
differences observed could be due to variations in the amount of
nuclease activity present in each preparation caused by different
handling during purification, or by different purification
protocols. In any case, quality control assays designed to assess
polymerization activity in commercial DNAP preparations would be
unlikely to reveal variation in the amount of nuclease activity
present. If preparations of DNAPTaq were screened for full 5'
nuclease activity (i.e., if the 5' nuclease activity was
specifically quantitated), it is likely that the preparations would
display sensitivities (to saliva extract) more in line with that
observed using CLEAVASE A/G nuclease, from which DNAPTaq differs by
a very few amino acids.
[0799] It is worthy of note that even in the slowed reactions of
CLEAVASE BN and the DNAPTaq variants there is no noticeable
increase in non-specific cleavage of the probe oligonucleotide due
to inappropriate hybridization or saliva-borne nucleases.
Example 16
Comparison of Additional 5' Nucleases in the INVADER-Directed
Cleavage Assay
[0800] A number of eubacterial Type A DNA polymerases (i.e., Pol I
type DNA polymerases) have been shown to function as structure
specific endonucleases (See, Example 1, and Lyamichev et al.,
supra). In this Example, it was demonstrated that the enzymes of
this class can also be made to catalyze the INVADER-directed
cleavage of the present invention, albeit not as efficiently as the
CLEAVASE enzymes.
[0801] CLEAVASE BN nuclease and CLEAVASE A/G nuclease were tested
along side three different thermostable DNA polymerases: Thermus
aquaticus DNA polymerase (Promega), Thermus thermophilus and
Thermus flavus DNA polymerases (Epicentre). The enzyme mixtures
used in the reactions shown in lanes 1-11 of FIG. 34 contained the
following, each in a volume of 5 .mu.l: Lane 1: 20 mM MOPS (pH 7.5)
with 0.1% each of Tween 20 and NP-40, 4 mM MnCl.sub.2, 100 mM KCl;
Lane 2: 25 ng of CLEAVASE BN nuclease in the same solution
described for lane 1; Lane 3: 2.25 .mu.l of CLEAVASE A/G nuclease
extract (prepared as described in Example 2), in the same solution
described for lane 1; Lane 4: 2.25 .mu.l of CLEAVASE A/G nuclease
extract in 20 mM Tris-Cl, (pH 8.5), 4 mM MgCl.sub.2 and 100 mM KCl;
Lane 5: 11.25 polymerase units of Taq DNA polymerase in the same
buffer described for lane 4; Lane 6: 11.25 polymerase units of Tth
DNA polymerase in the same buffer described for lane 1; Lane 7:
11.25 polymerase units of Tth DNA polymerase in a 2.times.
concentration of the buffer supplied by the manufacturer,
supplemented with 4 mM MnCl.sub.2; Lane 8: 11.25 polymerase units
of Tth DNA polymerase in a 2.times. concentration of the buffer
supplied by the manufacturer, supplemented with 4 mM MgCl.sub.2;
Lane 9: 2.25 polymerase units of Tfl DNA polymerase in the same
buffer described for lane 1; Lane 10: 2.25 polymerase units of Tfl
polymerase in a 2.times. concentration of the buffer supplied by
the manufacturer, supplemented with 4 mM MnCl.sub.2; Lane 11: 2.25
polymerase units of Tfl DNA polymerase in a 2.times. concentration
of the buffer supplied by the manufacturer, supplemented with 4 mM
MgCl.sub.2.
[0802] Sufficient target DNA, probe and INVADER for all 11
reactions was combined into a master mix. This mix contained 550
fmoles of single-stranded M13mp19 target DNA, 550 pmoles of the
INVADER oligonucleotide (SEQ ID NO:35) and 55 pmoles of the probe
oligonucleotide (SEQ ID NO:32), each as depicted in FIG. 28c, in 55
.mu.l of distilled water. Five .mu.l of the DNA mixture was
dispensed into each of 11 labeled tubes and overlaid with a drop of
CHILLOUT evaporation barrier. The reactions were brought to
63.degree. C. and cleavage was started by the addition of 5 .mu.l
of the appropriate enzyme mixture. The reaction mixtures were then
incubated at 63.degree. C. temperature for 15 minutes. The
reactions were stopped by the addition of 8 .mu.l of 95% formamide
with 20 mM EDTA and 0.05% marker dyes. Samples were heated to
90.degree. C. for 1 minute immediately before electrophoresis
through a 20% acrylamide gel (19:1 cross-linked), with 7 M urea, in
a buffer of 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA. Following
electrophoresis, the products of the reactions were visualized by
the use of an Hitachi FMBIO fluorescence imager, and the results
are displayed in FIG. 34. Examination of the results shown in FIG.
34 demonstrates that all of the 5' nucleases tested have the
ability to catalyze INVADER-directed cleavage in at least one of
the buffer systems tested. Although not optimized here, these
cleavage agents are suitable for use in the methods of the present
invention.
Example 17
The INVADER-Directed Cleavage Assay can Detect Single Base
Differences in Target Nucleic Acid Sequences
[0803] The ability of the INVADER-directed cleavage assay to detect
single base mismatch mutations was examined. Two target nucleic
acid sequences containing CLEAVASE enzyme-resistant
phosphorothioate backbones were chemically synthesized and purified
by polyacrylamide gel electrophoresis. Targets comprising
phosphorothioate backbones were used to prevent exonucleolytic
nibbling of the target when duplexed with an oligonucleotide. A
target oligonucleotide, which provides a target sequence that is
completely complementary to the INVADER oligonucleotide (SEQ ID
NO:35) and the probe oligonucleotide (SEQ ID NO:32), contained the
following sequence:
5'-CCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGC-3' (SEQ ID NO:36). A
second target sequence containing a single base change relative to
SEQ ID NO:36 was synthesized: 5'-CCTTTCGCTCTCTTCCCTTCCTTTCTCGCC
ACGTTCGCCGGC-3 (SEQ ID NO:37; the single base change relative to
SEQ ID NO:36 is shown using bold and underlined type). The
consequent mismatch occurs within the "Z" region of the target as
represented in FIG. 25.
[0804] To discriminate between two target sequences that differ by
the presence of a single mismatch), INVADER-directed cleavage
reactions were conducted using two different reaction temperatures
(55.degree. C. and 60.degree. C.). Mixtures containing 200 fmoles
of either SEQ ID NO:36 or SEQ ID NO:37, 3 pmoles of
fluorescein-labeled probe oligonucleotide (SEQ ID NO:32), 7.7
pmoles of INVADER oligonucleotide (SEQ ID NO:35) and 2 .mu.l of
CLEAVASE A/G nuclease extract (prepared as described in Example 2)
in 9 .mu.l of 10 mM MOPS (pH 7.4) with 50 mM KCl were assembled,
covered with a drop of CHILLOUT evaporation barrier and brought to
the appropriate reaction temperature. The cleavage reactions were
initiated by the addition of 1 .mu.l of 20 mM MgCl.sub.2. After 30
minutes at either 55.degree. C. or 60.degree. C., 10 .mu.l of 95%
formamide with 20 mM EDTA and 0.05% marker dyes was added to stop
the reactions. The reaction mixtures where then heated to
90.degree. C. for one minute prior to loading 4 .mu.l onto 20%
denaturing polyacrylamide gels. The resolved reaction products were
visualized using a Hitachi FMBIO fluorescence imager. The resulting
image is shown in FIG. 35.
[0805] In FIG. 35, lanes 1 and 2 show the products from reactions
conducted at 55.degree. C.; lanes 3 and 4 show the products from
reactions conducted at 60.degree. C. Lanes 1 and 3 contained
products from reactions containing SEQ ID NO:36 (perfect match to
probe) as the target. Lanes 2 and 4 contained products from
reactions containing SEQ ID NO:37 (single base mis-match with
probe) as the target. The target that does not have a perfect
hybridization match (i.e., complete complementarity) with the probe
will not bind as strongly (i.e., the T.sub.m of that duplex will be
lower than the T.sub.m of the same region if perfectly matched).
The results presented here show that reaction conditions can be
varied to either accommodate the mis-match (e.g., by lowering the
temperature of the reaction) or to exclude the binding of the
mismatched sequence (e.g., by raising the reaction
temperature).
[0806] The results shown in FIG. 35 demonstrate that the specific
cleavage event that occurs in INVADER-directed cleavage reactions
can be eliminated by the presence of a single base mis-match
between the probe oligonucleotide and the target sequence. Thus,
reaction conditions can be chosen so as to exclude the
hybridization of mismatched INVADER-directed cleavage probes
thereby diminishing or even eliminating the cleavage of the probe.
In an extension of this assay system, multiple cleavage probes,
each possessing a separate reporter molecule (i.e., a unique
label), could also be used in a single cleavage reaction, to
simultaneously probe for two or more variants in the same target
region. The products of such a reaction would allow not only the
detection of mutations that exist within a target molecule, but
would also allow a determination of the relative concentrations of
each sequence (i.e., mutant and wild type or multiple different
mutants) present within samples containing a mixture of target
sequences. When provided in equal amounts, but in a vast excess
(e.g., at least a 100-fold molar excess; typically at least 1 pmole
of each probe oligonucleotide would be used when the target
sequence was present at about 10 fmoles or less) over the target
and used in optimized conditions. As discussed above, any
differences in the relative amounts of the target variants will not
affect the kinetics of hybridization, so the amounts of cleavage of
each probe will reflect the relative amounts of each variant
present in the reaction.
[0807] The results shown in the Example clearly demonstrate that
the INVADER-directed cleavage reaction can be used to detect single
base difference between target nucleic acids.
Example 18
The INVADER-Directed Cleavage Reaction is Insensitive to Large
Changes in Reaction Conditions
[0808] The results shown above demonstrated that the
INVADER-directed cleavage reaction can be used for the detection of
target nucleic acid sequences and that this assay can be used to
detect single base difference between target nucleic acids. These
results demonstrated that 5' nucleases (e.g., CLEAVASEBN, CLEAVASE
A/G, DNAPTaq, DNAPTth, DNAPTfl) could be used in conjunction with a
pair of overlapping oligonucleotides as an efficient way to
recognize nucleic acid targets. In the experiments below it is
demonstrated that invasive cleavage reaction is relatively
insensitive to large changes in conditions thereby making the
method suitable for practice in clinical laboratories.
[0809] The effects of varying the conditions of the cleavage
reaction were examined for their effect(s) on the specificity of
the invasive cleavage and the on the amount of signal accumulated
in the course of the reaction. To compare variations in the
cleavage reaction a "standard" INVADER cleavage reaction was first
defined. In each instance, unless specifically stated to be
otherwise, the indicated parameter of the reaction was varied,
while the invariant aspects of a particular test were those of this
standard reaction. The results of these tests are either shown in
FIGS. 38-40, or the results described below.
[0810] a) The Standard INVADER-Directed Cleavage Reaction
[0811] The standard reaction was defined as comprising 1 fmole of
M13mp18 single-stranded target DNA (NEB), 5 pmoles of the labeled
probe oligonucleotide (SEQ ID NO:38), 10 pmole of the upstream
INVADER oligonucleotide (SEQ ID NO:39) and 2 units of CLEAVASE A/G
in 10 .mu.l of 10 mM MOPS, pH 7.5 with 100 mM KCl, 4 mM MnCl.sub.2,
and 0.05% each Tween-20 and Nonidet-P40. For each reaction, the
buffers, salts and enzyme were combined in a volume of 5 .mu.l; the
DNAs (target and two oligonucleotides) were combined in 5 .mu.l of
dH.sub.2O and overlaid with a drop of CHILLOUT evaporation barrier.
When multiple reactions were performed with the same reaction
constituents, these formulations were expanded proportionally.
[0812] Unless otherwise stated, the sample tubes with the DNA
mixtures were warmed to 61.degree. C., and the reactions were
started by the addition of 5 .mu.l of the enzyme mixture. After 20
minutes at this temperature, the reactions were stopped by the
addition of 8 .mu.l of 95% formamide with 20 mM EDTA and 0.05%
marker dyes. Samples were heated to 75.degree. C. for 2 minutes
immediately before electrophoresis through a 20% acrylamide gel
(19:1 cross-linked), with 7 M urea, in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA. The products of the reactions
were visualized by the use of an Hitachi FMBIO fluorescence imager.
In each case, the uncut probe material was visible as an intense
black band or blob, usually in the top half of the panel, while the
desired products of INVADER specific cleavage were visible as one
or two narrower black bands, usually in the bottom half of the
panel. Under some reaction conditions, particularly those with
elevated salt concentrations, a secondary cleavage product is also
visible (thus generating a doublet). Ladders of lighter grey bands
generally indicate either exonuclease nibbling of the probe
oligonucleotide or heat-induced, non-specific breakage of the
probe.
[0813] FIG. 37 depicts the annealing of the probe and INVADER
oligonucleotides to regions along the M13mp18 target molecule (the
bottom strand). In FIG. 37 only a 52 nucleotide portion of the
M13mp18 molecule is shown; this 52 nucleotide sequence is listed in
SEQ ID NO:31 (this sequence is identical in both M13mp18 and
M13mp19). The probe oligonucleotide (top strand) contains a Cy3
amidite label at the 5' end; the sequence of the probe is
5'-AGAAAGGAAGGGAAGAAAGCGAAAGGT-3' (SEQ ID NO:38. The bold type
indicates the presence of a modified base (2'-O--CH.sub.3). Cy3
amidite (Pharmacia) is a indodicarbocyanine dye amidite that can be
incorporated at any position during the synthesis of
oligonucleotides; Cy3 fluoresces in the yellow region (excitation
and emission maximum of 554 and 568 nm, respectively). The INVADER
oligonucleotide (middle strand) has the following sequence:
5'-GCCGGCGAACGTGGCGAGAAAGGA-3' (SEQ ID NO:39).
[0814] b) KCl Titration
[0815] FIG. 38 shows the results of varying the KCl concentration
in combination with the use of 2 mM MnCl.sub.2, in an otherwise
standard reaction. The reactions were performed in duplicate for
confirmation of observations; the reactions shown in lanes 1 and 2
contained no added KCl, lanes 3 and 4 contained KCl at 5 mM, lanes
5 and 6 contained 25 mM KCl, lanes 7 and 8 contained 50 mM KCl,
lanes 9 and 10 contained 100 mM KCl and lanes 11 and 12 contained
200 mM KCl. These results show that the inclusion of KCl allows the
generation of a specific cleavage product. While the strongest
signal is observed at the 100 mM KCl concentration, the specificity
of signal in the other reactions with KCl at or above 25 mM
indicates that concentrations in the full range (i.e., 25-200 mM)
may be chosen if it is so desirable for any particular reaction
conditions.
[0816] As shown in FIG. 38, the INVADER-directed cleavage reaction
requires the presence of salt (e.g., KCl) for effective cleavage to
occur. In other reactions, it has been found that KCl can inhibit
the activity of certain CLEAVASE enzymes when present at
concentrations above about 25 mM. For example, in cleavage
reactions using the S-60 oligonucleotide shown in FIG. 26, in the
absence of primer, the CLEAVASE BN enzyme loses approximately 50%
of its activity in 50 mM KCl. Therefore, the use of alternative
salts in the INVADER-directed cleavage reaction was examined. In
these experiments, the potassium ion was replaced with either
Na.sup.+ or Li.sup.+ or the chloride ion was replaced with glutamic
acid. The replacement of KCl with alternative salts is described
below in Sections c-e.
[0817] c) NaCl Titration
[0818] NaCl was used in place of KCl at 75, 100, 150 or 200 mM, in
combination with the use 2 mM MnCl.sub.2, in an otherwise standard
reaction. These results showed that NaCl can be used as a
replacement for KCl in the INVADER-directed cleavage reaction, with
like concentration giving like results, (i.e., the presence of
NaCl, like KCl, enhances product accumulation).
[0819] d) LiCl Titration
[0820] LiCl was used in place of KCl in otherwise standard
reactions. Concentrations tested were 25, 50, 75, 100, 150 and 200
mM LiCl. The results demonstrated that LiCl can be used as a
suitable replacement for KCl in the INVADER-directed cleavage
reaction (i.e., the presence of LiCl, like KCl, enhances product
accumulation), in concentrations of about 100 mM or higher.
[0821] e) KGlu Titration
[0822] The results of using a glutamate salt of potassium (KGlu) in
place of the more commonly used chloride salt (KCl) in reactions
performed over a range of temperatures were examined. KGlu has been
shown to be a highly effective salt source for some enzymatic
reactions, showing a broader range of concentrations that permit
maximum enzymatic activity (Leirmo et al, Biochem., 26:2095
[1987]). The ability of KGlu to facilitate the annealing of the
probe and INVADER oligonucleotides to the target nucleic acid was
compared to that of LiCl. In these experiments, the reactions were
run for 15 minutes, rather than the standard 20 minutes, in
standard reactions that replaced KCl 200 mM, 300 mM or 400 mM KGlu.
The reactions were run at 65.degree. C., 67.degree. C., 69.degree.
C. or 71.degree. C. The results showed demonstrated that KGlu was
very effective as a salt in the invasive cleavage reactions, with
full activity apparent even at 400 mM KGlu, though at the lowest
temperature cleavage was reduced by about 30% at 300 mM KGlu, and
by about 90% to 400 mM KGlu.
[0823] f) MnCl.sub.2 And MgCl.sub.2 Titration and Ability to
Replace MnCl.sub.2 with MgCl.sub.2
[0824] In some instances it may be desirable to perform the
invasive cleavage reaction in the presence of Mg.sup.2+, either in
addition to, or in place of Mn.sup.2+ as the necessary divalent
cation required for activity of the enzyme employed. For example,
some common methods of preparing DNA from bacterial cultures or
tissues use MgCl.sub.2 in solutions that are used to facilitate the
collection of DNA by precipitation. In addition, elevated
concentrations (i.e., greater than 5 mM) of divalent cation can be
used to facilitate hybridization of nucleic acids, in the same way
that the monovalent salts were used above, thereby enhancing the
invasive cleavage reaction. In this experiment, the tolerance of
the invasive cleavage reaction was examined for 1) the substitution
of MgCl.sub.2 for MnCl.sub.2 and for the ability to produce
specific product in the presence of increasing concentrations of
MgCl.sub.2 and MnCl.sub.2.
[0825] FIG. 39 shows the results of either varying the
concentration of MnCl.sub.2 from 2 mM to 8 mM, replacing the
MnCl.sub.2 with MgCl.sub.2 at 2 to 4 mM, or of using these
components in combination in an otherwise standard reaction. The
reactions analyzed in lanes 1 and 2 contained 2 mM each MnCl.sub.2
and MgCl.sub.2, lanes 3 and 4 contained 2 mM MnCl.sub.2 only, lanes
5 and 6 contained 3 mM MnCl.sub.2, lanes 7 and 8 contained 4 mM
MnCl.sub.2, lanes 9 and 10 contained 8 mM MnCl.sub.2. The reactions
analyzed in lanes 11 and 12 contained 2 mM MgCl.sub.2 and lanes 13
and 14 contained 4 mM MgCl.sub.2. These results show that both
MnCl.sub.2 and MgCl.sub.2 can be used as the necessary divalent
cation to enable the cleavage activity of the CLEAVASE A/G enzyme
in these reactions and that the invasive cleavage reaction can
tolerate a broad range of concentrations of these components.
[0826] In addition to examining the effects of the salt environment
on the rate of product accumulation in the invasive cleavage
reaction, the use of reaction constituents shown to be effective in
enhancing nucleic acid hybridization in either standard
hybridization assays (e.g., blot hybridization) or in ligation
reactions was examined. These components may act as volume
excluders, increasing the effective concentration of the nucleic
acids of interest and thereby enhancing hybridization, or they may
act as charge-shielding agents to minimize repulsion between the
highly charged backbones of the nucleic acids strands. The results
of these experiments are described in Sections g and h below.
[0827] g) Effect of CTAB Addition
[0828] The polycationic detergent cetyltrietheylammonium bromide
(CTAB) has been shown to dramatically enhance hybridization of
nucleic acids (Pontius and Berg, Proc. Natl. Acad. Sci. USA 88:8237
[1991]). The effect of adding the detergent CTAB in concentrations
from 100 mM to 1 mM to invasive cleavage reactions in which 150 mM
LiCl was used in place of the KCl in otherwise standard reactions
was also investigated. These results showed that 200 mM CTAB may
have a very moderate enhancing effect under these reaction
conditions, and the presence of CTAB in excess of about 500 .mu.M
was inhibitory to the accumulation of specific cleavage
product.
[0829] h) Effect of PEG Addition
[0830] The effect of adding polyethylene glycol (PEG) at 4.8 or 12%
(w/v) concentrations to otherwise standard reactions was also
examined. The effects of increasing the reaction temperature of the
PEG-containing reactions was examined by performing duplicate sets
of PEG titration reactions at 61.degree. C. and 65.degree. C. The
results showed that at all percentages tested, and at both
temperatures tested, the inclusion of PEG substantially eliminated
the production of specific cleavage product.
[0831] In addition to, the presence of 1.times.Denhardts in the
reaction mixture was found to have no adverse effect upon the
cleavage reaction (50.times.Denhardts contains per 500 ml: 5 g
Ficoll, 5 g polyvinylpyrrolidone, 5 g BSA). Further, the presence
of each component of Denhardt's was examined individually (i.e.,
Ficoll alone, polyvinylpyrrolidone alone, BSA alone) for the effect
upon the INVADER-directed cleavage reaction; no adverse effect was
observed.
[0832] i) Effect of the Addition of Stabilizing Agents
[0833] Another approach to enhancing the output of the invasive
cleavage reaction is to enhance the activity of the enzyme
employed, either by increasing its stability in the reaction
environment or by increasing its turnover rate. Without regard to
the precise mechanism by which various agents operate in the
invasive cleavage reaction, a number of agents commonly used to
stabilize enzymes during prolonged storage were tested for the
ability to enhance the accumulation of specific cleavage product in
the invasive cleavage reaction.
[0834] The effects of adding glycerol at 15% and of adding the
detergents Tween-20 and Nonidet-P40 at 1.5%, alone or in
combination, in otherwise standard reactions were also examined.
The results demonstrated that under these conditions these adducts
had little or no effect on the accumulation of specific cleavage
product.
[0835] The effects of adding gelatin to reactions in which the salt
identity and concentration were varied from the standard reaction
were also investigated. The results demonstrated that in the
absence of salt the gelatin had a moderately enhancing effect on
the accumulation of specific cleavage product, but when either salt
(KCl or LiCl) was added to reactions performed under these
conditions, increasing amounts of gelatin reduced the product
accumulation.
[0836] j) Effect of Adding Large Amounts of Non-Target Nucleic
Acid
[0837] In detecting specific nucleic acid sequences within samples,
it is important to determine if the presence of additional genetic
material (i.e., non-target nucleic acids) will have a negative
effect on the specificity of the assay. In this experiment, the
effect of including large amounts of non-target nucleic acid,
either DNA or RNA, on the specificity of the invasive cleavage
reaction was examined. The data was examined for either an
alteration in the expected site of cleavage, or for an increase in
the nonspecific degradation of the probe oligonucleotide.
[0838] FIG. 40 shows the effects of adding non-target nucleic acid
(e.g., genomic DNA or tRNA) to an invasive cleavage reaction
performed at 65.degree. C., with 150 mM LiCl in place of the KCl in
the standard reaction. The reactions assayed in lanes 1 and 2
contained 235 and 470 ng of genomic DNA, respectively. The
reactions analyzed in lanes 3, 4, 5 and 6 contained 100 ng, 200 ng,
500 ng and 1 .mu.g of tRNA, respectively. Lane 7 represents a
control reaction that contained no added nucleic acid beyond the
amounts used in the standard reaction. The results shown in FIG. 40
demonstrate that the inclusion of non-target nucleic acid in large
amounts could visibly slow the accumulation of specific cleavage
product (while not limiting the invention to any particular
mechanism, it is thought that the additional nucleic acid competes
for binding of the enzyme with the specific reaction components).
In additional experiments it was found that the effect of adding
large amounts of non-target nucleic acid can be compensated for by
increasing the enzyme in the reaction. The data shown in FIG. 40
also demonstrate that a key feature of the invasive cleavage
reaction, the specificity of the detection, was not compromised by
the presence of large amounts of non-target nucleic acid.
[0839] In addition to the data presented above, invasive cleavage
reactions were run with succinate buffer at pH 5.9 in place of the
MOPS buffer used in the "standard" reaction; no adverse effects
were observed.
[0840] The data shown in FIGS. 38-40 and described above
demonstrate that the invasive cleavage reaction can be performed
using a wide variety of reaction conditions and is therefore
suitable for practice in clinical laboratories.
Example 19
Detection of RNA Targets by INVADER-Directed Cleavage
[0841] In addition to the clinical need to detect specific DNA
sequences for infectious and genetic diseases, there is a need for
technologies that can quantitatively detect target nucleic acids
that are composed of RNA. For example, a number of viral agents,
such as hepatitis C virus (HCV) and human immunodeficiency virus
(HIV) have RNA genomic material, the quantitative detection of
which can be used as a measure of viral load in a patient sample.
Such information can be of critical diagnostic or prognostic
value.
[0842] Hepatitis C virus (HCV) infection is the predominant cause
of post-transfusion non-A, non-B (NANB) hepatitis around the world.
In addition, HCV is the major etiologic agent of hepatocellular
carcinoma (HCC) and chronic liver disease world wide. The genome of
HCV is a small (9.4 kb) RNA molecule. In studies of transmission of
HCV by blood transfusion it has been found the presence of HCV
antibody, as measured in standard immunological tests, does not
always correlate with the infectivity of the sample, while the
presence of HCV RNA in a blood sample strongly correlates with
infectivity. Conversely, serological tests may remain negative in
immunosuppressed infected individuals, while HCV RNA may be easily
detected (Cuthbert, Clin. Microbiol. Rev., 7:505 [1994]).
[0843] The need for and the value of developing a probe-based assay
for the detection the HCV RNA is clear. The polymerase chain
reaction has been used to detect HCV in clinical samples, but the
problems associated with carry-over contamination of samples has
been a concern. Direct detection of the viral RNA without the need
to perform either reverse transcription or amplification would
allow the elimination of several of the points at which existing
assays may fail.
[0844] The genome of the positive-stranded RNA hepatitis C virus
comprises several regions including 5' and 3' noncoding regions
(i.e., 5' and 3' untranslated regions) and a polyprotein coding
region that encodes the core protein (C), two envelope
glycoproteins (E1 and E2/NS1) and six nonstructural glycoproteins
(NS2-NS5b). Molecular biological analysis of the HCV genome has
showed that some regions of the genome are very highly conserved
between isolates, while other regions are fairly rapidly
changeable. The 5' noncoding region (NCR) is the most highly
conserved region in the HCV. These analyses have allowed these
viruses to be divided into six basic genotype groups, and then
further classified into over a dozen sub-types (the nomenclature
and division of HCV genotypes is evolving; see Altamirano et al.,
J. Infect. Dis., 171:1034 (1995) for a recent classification
scheme).
[0845] In order to develop a rapid and accurate method of detecting
HCV present in infected individuals, the ability of the
INVADER-directed cleavage reaction to detect HCV RNA was examined.
Plasmids containing DNA derived from the conserved 5'-untranslated
region of six different HCV RNA isolates were used to generate
templates for in vitro transcription. The HCV sequences contained
within these six plasmids represent genotypes 1 (four sub-types
represented; 1a, 1b, 1c, and .DELTA.1c), 2, and 3. The nomenclature
of the HCV genotypes used herein is that of Simmonds et al. (as
described in Altamirano et al., supra). The .DELTA.1c subtype was
used in the model detection reaction described below.
[0846] a) Generation of Plasmids Containing HCV Sequences
[0847] Six DNA fragments derived from HCV were generated by RT-PCR
using RNA extracted from serum samples of blood donors; these PCR
fragments were a gift of Dr. M. Altamirano (University of British
Columbia, Vancouver). These PCR fragments represent HCV sequences
derived from HCV genotypes 1a, 1b, 1c, .DELTA.1c, 2c and 3a.
[0848] The RNA extraction, reverse transcription and PCR were
performed using standard techniques (Altamirano et al, supra).
Briefly, RNA was extracted from 100 .mu.l of serum using guanidine
isothiocyanate, sodium lauryl sarkosate and phenol-chloroform
(Inchauspe et al., Hepatol., 14:595 [1991]). Reverse transcription
was performed according to the manufacturer's instructions using a
GeneAmp rTh reverse transcriptase RNA PCR kit (Perkin-Elmer) in the
presence of an external antisense primer, HCV342. The sequence of
the HCV342 primer is 5'-GGTTTTTCTTTGAGGTTTAG-3' (SEQ ID NO:40).
Following termination of the RT reaction, the sense primer HCV7
(5'-GCGACACTCCACCATAGAT-3' [SEQ ID NO:41]) and magnesium were added
and a first PCR was performed. Aliquots of the first PCR products
were used in a second (nested) PCR in the presence of primers HCV46
(5'-CTGTCTTCACGCAGAAAGC-3' [SEQ ID NO:42]) and HCV308 [5'-GCACGGT
CTACGAGACCTC-3' [SEQ ID NO:43]). The PCRs produced a 281 bp product
that corresponds to a conserved 5' noncoding region (NCR) region of
HCV between positions -284 and -4 of the HCV genome (Altramirano et
al., supra).
[0849] The six 281 bp PCR fragments were used directly for cloning
or they were subjected to an additional amplification step using a
50 .mu.l PCR comprising approximately 100 fmoles of DNA, the HCV46
and HCV308 primers at 0.1 .mu.M, 100 .mu.M of all four dNTPs and
2.5 units of Taq DNA polymerase in a buffer containing 10 mM
Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl.sub.2 and 0.1% Tween 20.
The PCRs were cycled 25 times at 96.degree. C. for 45 sec.,
55.degree. C. for 45 sec. and 72.degree. C. for 1 min. Two
microliters of either the original DNA samples or the reamplified
PCR products were used for cloning in the linear pT7Blue T-vector
(Novagen) according to manufacturer's protocol. After the PCR
products were ligated to the pT7Blue T-vector, the ligation
reaction mixture was used to transform competent JM 109 cells
(Promega). Clones containing the pT7Blue T-vector with an insert
were selected by the presence of colonies having a white color on
LB plates containing 40 .mu.g/ml X-Gal, 40 .mu.g/ml IPTG and 50
.mu.g/ml ampicillin. Four colonies for each PCR sample were picked
and grown overnight in 2 ml LB media containing 50 .mu.g/ml
carbenicillin. Plasmid DNA was isolated using the following
alkaline miniprep protocol. Cells from 1.5 ml of the overnight
culture were collected by centrifugation for 2 min. in a
microcentrifuge (14K rpm), the supernatant was discarded and the
cell pellet was resuspended in 50 .mu.l TE buffer with 10 .mu.g/ml
RNAse A (Pharmacia). One hundred microliters of a solution
containing 0.2 N NaOH, 1% SDS was added and the cells were lysed
for 2 min. The lysate was gently mixed with 100 .mu.l of 1.32 M
potassium acetate, pH 4.8, and the mixture was centrifuged for 4
min. in a microcentrifuge (14K rpm); the pellet comprising cell
debris was discarded. Plasmid DNA was precipitated from the
supernatant with 200 .mu.l ethanol and pelleted by centrifugation a
microcentrifuge (14K rpm). The DNA pellet was air dried for 15 min.
and was then redissolved in 50 .mu.l TE buffer (10 mM Tris-HCl, pH
7.8, 1 mM EDTA).
[0850] b) Reamplification of HCV Clones to Add the Phage T7
Promoter for Subsequent In Vitro Transcription
[0851] To ensure that the RNA product of transcription had a
discrete 3' end it was necessary to create linear transcription
templates that stopped at the end of the HCV sequence. These
fragments were conveniently produced using the PCR to reamplify the
segment of the plasmid containing the phage promoter sequence and
the HCV insert. For these studies, the clone of HCV type .DELTA.1c
was reamplified using a primer that hybridizes to the T7 promoter
sequence: 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO:44; "the T7
promoter primer") (Novagen) in combination with the 3' terminal
HCV-specific primer HCV308 (SEQ ID NO:43). For these reactions, 1
.mu.l of plasmid DNA (approximately 10 to 100 ng) was reamplified
in a 200 .mu.l PCR using the T7 and HCV308 primers as described
above with the exception that 30 cycles of amplification were
employed. The resulting amplicon was 354 bp in length. After
amplification the PCR mixture was transferred to a fresh 1.5 ml
microcentrifuge tube, the mixture was brought to a final
concentration of 2 M NH.sub.4OAc, and the products were
precipitated by the addition of one volume of 100% isopropanol.
Following a 10 min. incubation at room temperature, the
precipitates were collected by centrifugation, washed once with 80%
ethanol and dried under vacuum. The collected material was
dissolved in 100 .mu.l nuclease-free distilled water (Promega).
[0852] Segments of RNA were produced from this amplicon by in vitro
transcription using the RiboMAX.TM. Large Scale RNA Production
System (Promega) in accordance with the manufacturer's
instructions, using 5.3 .mu.g of the amplicon described above in a
100 .mu.l reaction. The transcription reaction was incubated for
3.75 hours, after which the DNA template was destroyed by the
addition of 5-6 .mu.l of RQ1 RNAse-free DNAse (1 unit/.mu.l)
according to the RiboMAX.TM. kit instructions. The reaction was
extracted twice with phenol/chloroform/isoamyl alcohol (50:48:2)
and the aqueous phase was transferred to a fresh microcentrifuge
tube. The RNA was then collected by the addition of 10 .mu.l of 3M
NH.sub.4OAc, pH 5.2 and 110 .mu.l of 100% isopropanol. Following a
5 min. incubation at 4.degree. C., the precipitate was collected by
centrifugation, washed once with 80% ethanol and dried under
vacuum. The sequence of the resulting RNA transcript (HCV1.1
transcript) is listed in SEQ ID NO:45.
[0853] c) Detection of the HCV1.1 Transcript in the
INVADER-Directed Cleavage Assay
[0854] Detection of the HCV1.1 transcript was tested in the
INVADER-directed cleavage assay using an HCV-specific probe
oligonucleotide (5'-CCGGTCGTCCTGGCAAT XCC-3' [SEQ ID NO:46]); X
indicates the presence of a fluorescein dye on an abasic linker)
and an HCV-specific INVADER oligonucleotide (5'-GTTTATCCAAGAAAGGAC
CCGGTC-3' [SEQ ID NO:47]) that causes a 6-nucleotide invasive
cleavage of the probe.
[0855] Each 10 .mu.l of reaction mixture comprised 5 pmole of the
probe oligonucleotide (SEQ ID NO:46) and 10 pmole of the INVADER
oligonucleotide (SEQ ID NO:47) in a buffer of 10 mM MOPS, pH 7.5
with 50 mM KCl, 4 mM MnCl.sub.2, 0.05% each Tween-20 and
Nonidet-P40 and 7.8 units RNasin.RTM. ribonuclease inhibitor
(Promega). The cleavage agents employed were CLEAVASE A/G (used at
5.3 ng/10 .mu.l reaction) or DNAPTth (used at 5 polymerase units/10
.mu.l reaction). The amount of RNA target was varied as indicated
below. When RNAse treatment is indicated, the target RNAs were
pre-treated with 10 .mu.g of RNase A (Sigma) at 37.degree. C. for
30 min. to demonstrate that the detection was specific for the RNA
in the reaction and not due to the presence of any residual DNA
template from the transcription reaction. RNase-treated aliquots of
the HCV RNA were used directly without intervening
purification.
[0856] For each reaction, the target RNAs were suspended in the
reaction solutions as described above, but lacking the cleavage
agent and the MnCl.sub.2 for a final volume of 10 .mu.l, with the
INVADER and probe at the concentrations listed above. The reactions
were warmed to 46.degree. C. and the reactions were started by the
addition of a mixture of the appropriate enzyme with MnCl.sub.2.
After incubation for 30 min. at 46.degree. C., the reactions were
stopped by the addition of 8 .mu.l of 95% formamide, 10 mM EDTA and
0.02% methyl violet (methyl violet loading buffer). Samples were
then resolved by electrophoresis through a 15% denaturing
polyacrylamide gel (19:1 cross-linked), containing 7 M urea, in a
buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Following
electrophoresis, the labeled reaction products were visualized
using the FMBIO-100 Image Analyzer (Hitachi), with the resulting
imager scan shown in FIG. 41.
[0857] In FIG. 41, the samples analyzed in lanes 1-4 contained 1
pmole of the RNA target, the reactions shown in lanes 5-8 contained
100 fmoles of the RNA target and the reactions shown in lanes 9-12
contained 10 fmoles of the RNA target. All odd-numbered lanes
depict reactions performed using CLEAVASE A/G enzyme and all
even-numbered lanes depict reactions performed using DNAPTth. The
reactions analyzed in lanes 1, 2, 5, 6, 9 and 10 contained RNA that
had been pre-digested with RNase A. These data demonstrate that the
invasive cleavage reaction efficiently detects RNA targets and
further, the absence of any specific cleavage signal in the
RNase-treated samples confirms that the specific cleavage product
seen in the other lanes is dependent upon the presence of input
RNA.
Example 20
The Fate of the Target RNA in the INVADER-Directed Cleavage
Reaction
[0858] In this Example, the fate of the RNA target in the
INVADER-directed cleavage reaction was examined. As shown above in
Example 1D, when RNAs are hybridized to DNA oligonucleotides, the
5' nucleases associated with DNA polymerases can be used to cleave
the RNAs; such cleavage can be suppressed when the 5' arm is long
or when it is highly structured (Lyamichev et al., Science 260:778
[1993], and U.S. Pat. No. 5,422,253, the disclosure of which is
herein incorporated by reference). In this experiment, the extent
to which the RNA target would be cleaved by the cleavage agents
when hybridized to the detection oligonucleotides (i.e., the probe
and INVADER oligonucleotides) was examined using reactions similar
to those described in Example 20, performed using
fluorescein-labeled RNA as a target.
[0859] Transcription reactions were performed as described in
Example 19 with the exception that 2% of the UTP in the reaction
was replaced with fluorescein-12-UTP (Boehringer Mannheim) and 5.3
.mu.g of the amplicon was used in a 100 .mu.l reaction. The
transcription reaction was incubated for 2.5 hours, after which the
DNA template was destroyed by the addition of 5-6 .mu.l of RQ1
RNAse-free DNAse (1 unit/.mu.l) according to the RiboMAX.TM. kit
instructions. The organic extraction was omitted and the RNA was
collected by the addition of 10 .mu.l of 3M NaOAc, pH 5.2 and 110
.mu.l of 100% isopropanol. Following a 5 min. incubation at
4.degree. C., the precipitate was collected by centrifugation,
washed once with 80% ethanol and dried under vacuum. The resulting
RNA was dissolved in 100 .mu.l of nuclease-free water. Half (i.e.,
50%) of the sample was purified by electrophoresis through a 8%
denaturing polyacrylamide gel (19:1 cross-linked), containing 7 M
urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The
gel slice containing the full-length material was excised and the
RNA was eluted by soaking the slice overnight at 4.degree. C. in
200 .mu.l of 10 mM Tris-Cl, pH 8.0, 0.1 mM EDTA and 0.3 M NaOAc.
The RNA was then precipitated by the addition of 2.5 volumes of
100% ethanol. After incubation at -20.degree. C. for 30 min., the
precipitates were recovered by centrifugation, washed once with 80%
ethanol and dried under vacuum. The RNA was dissolved in 25 .mu.l
of nuclease-free water and then quantitated by UV absorbance at 260
nm.
[0860] Samples of the purified RNA target were incubated for 5 or
30 min. in reactions that duplicated the CLEAVASE A/G and DNAPTth
INVADER reactions described in Example 20 with the exception that
the reactions lacked probe and INVADER oligonucleotides. Subsequent
analysis of the products showed that the RNA was very stable, with
a very slight background of non-specific degradation, appearing as
a gray background in the gel lane. The background was not dependent
on the presence of enzyme in the reaction.
[0861] INVADER detection reactions using the purified RNA target
were performed using the probe/INVADER pair described in Example 19
(SEQ ID NOS:46 and 47). Each reaction included 500 fmole of the
target RNA, 5 pmoles of the fluorescein-labeled probe and 10 pmoles
of the INVADER oligonucleotide in a buffer of 10 mM MOPS, pH 7.5
with 150 mM LiCl, 4 mM MnCl.sub.2, 0.05% each Tween-20 and
Nonidet-P40 and 39 units RNAsin.RTM. (Promega). These components
were combined and warmed to 50.degree. C. and the reactions were
started by the addition of either 53 ng of CLEAVASE A/G or 5
polymerase units of DNAPTth. The final reaction volume was 10
.mu.l. After 5 min at 50.degree. C., 5 .mu.l aliquots of each
reaction were removed to tubes containing 4 .mu.l of 95% formamide,
10 mM EDTA and 0.02% methyl violet. The remaining aliquot received
a drop of CHILLOUT evaporation barrier and was incubated for an
additional 25 min. These reactions were then stopped by the
addition of 4 .mu.l of the above formamide solution. The products
of these reactions were resolved by electrophoresis through
separate 20% denaturing polyacrylamide gels (19:1 cross-linked),
containing 7 M urea, in a buffer of 45 mM Tris-Borate, pH 8.3, 1.4
mM EDTA. Following electrophoresis, the labeled reaction products
were visualized using the FMBIO-100 Image Analyzer (Hitachi), with
the resulting imager scans shown in FIGS. 42A (5 min reactions) and
42B (30 min. reactions).
[0862] In FIG. 53 the target RNA is seen very near the top of each
lane, while the labeled probe and its cleavage products are seen
just below the middle of each panel. The FMBIO-100 Image Analyzer
was used to quantitate the fluorescence signal in the probe bands.
In each panel, lane 1 contains products from reactions performed in
the absence of a cleavage agent, lane 2 contains products from
reactions performed using CLEAVASE A/G and lane 3 contains products
from reactions performed using DNAPTth.
[0863] Quantitation of the fluorescence signal in the probe bands
revealed that after a 5 min. incubation, 12% or 300 fmole of the
probe was cleaved by the CLEAVASE A/G and 29% or 700 fmole was
cleaved by the DNAPTth. After a 30 min. incubation, CLEAVASE A/G
had cleaved 32% of the probe molecules and DNAPTth had cleaved 70%
of the probe molecules. (The images shown in FIGS. 42A and 42B were
printed with the intensity adjusted to show the small amount of
background from the RNA degradation, so the bands containing strong
signals are saturated and therefore these images do not accurately
reflect the differences in measured fluorescence)
[0864] The data shown in FIG. 42 clearly shows that, under invasive
cleavage conditions, RNA molecules are sufficiently stable to be
detected as a target and that each RNA molecule can support many
rounds of probe cleavage.
Example 21
Titration of Target RNA in the INVADER-Directed Cleavage Assay
[0865] One of the primary benefits of the INVADER-directed cleavage
assay as a means for detection of the presence of specific target
nucleic acids is the correlation between the amount of cleavage
product generated in a set amount of time and the quantity of the
nucleic acid of interest present in the reaction. The benefits of
quantitative detection of RNA sequences was discussed in Example
19. In this Example, the quantitative nature of the detection assay
was demonstrated through the use of various amounts of target
starting material. In addition to demonstrating the correlation
between the amounts of input target and output cleavage product,
these data graphically show the degree to which the RNA target can
be recycled in this assay
[0866] The RNA target used in these reactions was the
fluorescein-labeled material described in Example 20 (i.e., SEQ ID
NO:45). Because the efficiency of incorporation of the
fluorescein-12-UTP by the T7 RNA polymerase was not known, the
concentration of the RNA was determined by measurement of
absorbance at 260 nm, not by fluorescence intensity. Each reaction
comprised 5 pmoles of the fluorescein-labeled probe (SEQ ID NO:46)
and 10 pmoles of the INVADER oligonucleotide (SEQ ID NO:47) in a
buffer of 10 mM MOPS, pH 7.5 with 150 mM LiCl, 4 mM MnCl.sub.2,
0.05% each Tween-20 and Nonidet-P40 and 39 units of RNAsin.RTM.
(Promega). The amount of target RNA was varied from 1 to 100
fmoles, as indicated below. These components were combined,
overlaid with CHILLOUT evaporation barrier and warmed to 50.degree.
C.; the reactions were started by the addition of either 53 ng of
CLEAVASE A/G or 5 polymerase units of DNAPTth, to a final reaction
volume of 10 .mu.l. After 30 minutes at 50.degree. C., reactions
were stopped by the addition of 8 .mu.l of 95% formamide, 10 mM
EDTA and 0.02% methyl violet. The unreacted markers in lanes 1 and
2 were diluted in the same total volume (18 .mu.l). The samples
were heated to 90.degree. C. for 1 minute and 2.5 .mu.l of each of
these reactions were resolved by electrophoresis through a 20%
denaturing polyacrylamide gel (19:1 cross link) with 7M urea in a
buffer of 45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA, and the labeled
reaction products were visualized using the FMBIO-100 Image
Analyzer (Hitachi), with the resulting imager scans shown in FIG.
43.
[0867] In FIG. 43, lanes 1 and 2 show 5 pmoles of uncut probe and
500 fmoles of untreated RNA, respectively. The probe is the very
dark signal near the middle of the panel, while the RNA is the thin
line near the top of the panel. These RNAs were transcribed with a
2% substitution of fluorescein-12-UTP for natural UTP in the
transcription reaction. The resulting transcript contains 74 U
residues, which would give an average of 1.5 fluorescein labels per
molecule. With one tenth the molar amount of RNA loaded in lane 2,
the signal in lane 2 should be approximately one seventh
(0.15.times.) the fluorescence intensity of the probe in lane 1.
Measurements indicated that the intensity was closer to one
fortieth, indicating an efficiency of label incorporation of
approximately 17%. Because the RNA concentration was verified by
A260 measurement this does not alter the experimental observations
below, but it should be noted that the signal from the RNA and the
probes does not accurately reflect the relative amounts in the
reactions.
[0868] The reactions analyzed in lanes 3 through 7 contained 1, 5,
10, 50 and 100 fmoles of target, respectively, with cleavage of the
probe accomplished by CLEAVASE A/G. The reactions analyzed in lanes
8 through 12 repeated the same array of target amounts, with
cleavage of the probe accomplished by DNAPTth. The boxes seen
surrounding the product bands show the area of the scan in which
the fluorescence was measured for each reaction. The number of
fluorescence units detected within each box is indicated below each
box; background florescence was also measured.
[0869] It can be seen by comparing the detected fluorescence in
each lane that the amount of product formed in these 30 minute
reactions can be correlated to the amount of target material. The
accumulation of product under these conditions is slightly enhanced
when DNAPTth is used as the cleavage agent, but the correlation
with the amount of target present remains. This demonstrates that
the INVADER assay can be used as a means of measuring the amount of
target RNA within a sample.
[0870] Comparison of the fluorescence intensity of the input RNA
with that of the cleaved product shows that the INVADER-directed
cleavage assay creates signal in excess of the amount of target, so
that the signal visible as cleaved probe is far more intense than
that representing the target RNA. This further confirms the results
described in Example 20, in which it was demonstrated that each RNA
molecule could be used many times.
Example 22
Detection of DNA by Charge Reversal
[0871] The detection of specific targets is achieved in the
INVADER-directed cleavage assay by the cleavage of the probe
oligonucleotide. In addition to the methods described in the
preceding Examples, the cleaved probe may be separated from the
uncleaved probe using the charge reversal technique described
below. This novel separation technique is related to the
observation that positively charged adducts can affect the
electrophoretic behavior of small oligonucleotides because the
charge of the adduct is significant relative to charge of the whole
complex. Observations of aberrant mobility due to charged adducts
have been reported in the literature, but in all cases found, the
applications pursued by other scientists have involved making
oligonucleotides larger by enzymatic extension. As the negatively
charged nucleotides are added on, the positive influence of the
adduct is reduced to insignificance. As a result, the effects of
positively charged adducts have been dismissed and have received
infinitesimal notice in the existing literature.
[0872] This observed effect is of particular utility in assays
based on the cleavage of DNA molecules. When an oligonucleotide is
shortened through the action of a CLEAVASE enzyme or other cleavage
agent, the positive charge can be made to not only significantly
reduce the net negative charge, but to actually override it,
effectively "flipping" the net charge of the labeled entity. This
reversal of charge allows the products of target-specific cleavage
to be partitioned from uncleaved probe by extremely simple means.
For example, the products of cleavage can be made to migrate
towards a negative electrode placed at any point in a reaction
vessel, for focused detection without gel-based electrophoresis.
When a slab gel is used, sample wells can be positioned in the
center of the gel, so that the cleaved and uncleaved probes can be
observed to migrate in opposite directions. Alternatively, a
traditional vertical gel can be used, but with the electrodes
reversed relative to usual DNA gels (i.e., the positive electrode
at the top and the negative electrode at the bottom) so that the
cleaved molecules enter the gel, while the uncleaved disperse into
the upper reservoir of electrophoresis buffer.
[0873] An additional benefit of this type of readout is that the
absolute nature of the partition of products from substrates means
that an abundance of uncleaved probe can be supplied to drive the
hybridization step of the probe-based assay, yet the unconsumed
probe can be subtracted from the result to reduce background.
[0874] Through the use of multiple positively charged adducts,
synthetic molecules can be constructed with sufficient modification
that the normally negatively charged strand is made nearly neutral.
When so constructed, the presence or absence of a single phosphate
group can mean the difference between a net negative or a net
positive charge. This observation has particular utility when one
objective is to discriminate between enzymatically generated
fragments of DNA, which lack a 3' phosphate, and the products of
thermal degradation, which retain a 3' phosphate (and thus two
additional negative charges).
[0875] a) Characterization of the Products of Thermal Breakage of
DNA Oligonucleotides
[0876] Thermal degradation of DNA probes results in high background
that can obscure signals generated by specific enzymatic cleavage,
decreasing the signal-to-noise ratio. To better understand the
nature of DNA thermal degradation products, the 5'
tetrachloro-fluorescein (TET)-labeled oligonucleotides 78 (SEQ ID
NO:48) and 79 (SEQ ID NO:49) (100 pmole each) were incubated in 50
.mu.l 10 mM NaCO.sub.3 (pH 10.6), 50 mM NaCl at 90.degree. C. for 4
hours. To prevent evaporation of the samples, the reaction mixture
was overlaid with 50 .mu.l of CHILLOUT liquid wax. The reactions
were then divided in two equal aliquots (A and B). Aliquot A was
mixed with 25 .mu.l of methyl violet loading buffer and Aliquot B
was dephosphorylated by addition of 2.5 .mu.l of 100 mM MgCl.sub.2
and 1 .mu.l of 1 unit/.mu.l Calf Intestinal Alkaline Phosphatase
(CIAP) (Promega), with incubation at 37.degree. C. for 30 min.
after which 25 .mu.l of methyl violet loading buffer was added. One
microliter of each sample was resolved by electrophoresis through a
12% polyacrylamide denaturing gel and imaged as described in
Example 21; a 585 nm filter was used with the FMBIO Image Analyzer.
The resulting imager scan is shown in FIG. 44.
[0877] In FIG. 44, lanes 1-3 contain the TET-labeled
oligonucleotide 78 and lanes 4-6 contain the TET-labeled
oligonucleotides 79. Lanes 1 and 4 contain products of reactions
that were not heat treated. Lanes 2 and 5 contain products from
reactions that were heat treated and lanes 3 and 6 contain products
from reactions that were heat treated and subjected to phosphatase
treatment.
[0878] As shown in FIG. 44, heat treatment causes significant
breakdown of the 5'-TET-labeled DNA, generating a ladder of
degradation products (FIG. 44, lanes 2, 3, 5 and 6). Band
intensities correlate with purine and pyrimidine base positioning
in the oligonucleotide sequences, indicating that backbone
hydrolysis may occur through formation of abasic intermediate
products that have faster rates for purines than for pyrimidines
(Lindahl and Karlstrom, Biochem., 12:5151 [1973]).
[0879] Dephosphorylation decreases the mobility of all products
generated by the thermal degradation process, with the most
pronounced effect observed for the shorter products (FIG. 44, lanes
3 and 6). This demonstrates that thermally degraded products
possess a 3' end terminal phosphoryl group that can be removed by
dephosphorylation with CIAP. Removal of the phosphoryl group
decreases the overall negative charge by 2. Therefore, shorter
products that have a small number of negative charges are
influenced to a greater degree upon the removal of two charges.
This leads to a larger mobility shift in the shorter products than
that observed for the larger species.
[0880] The fact that the majority of thermally degraded DNA
products contain 3' end phosphate groups and CLEAVASE
enzyme-generated products do not allowed the development of simple
isolation methods for products generated in the INVADER-directed
cleavage assay. The extra two charges found in thermal breakdown
products do not exist in the specific cleavage products. Therefore,
if one designs assays that produce specific products that contain a
net positive charge of one or two, then similar thermal breakdown
products will either be negative or neutral. The difference can be
used to isolate specific products by reverse charge methods as
shown below.
[0881] b) Dephosphorylation of Short Amino-Modified
Oligonucleotides Can Reverse the Net Charge of the Labeled
Product
[0882] To demonstrate how oligonucleotides can be transformed from
net negative to net positively charged compounds, the four short
amino-modified oligonucleotides labeled 70, 74, 75 and 76 and shown
in FIGS. 45-47 were synthesized (FIG. 45 shows both
oligonucleotides 70 and 74). All four modified oligonucleotides
possess Cy-3 dyes positioned at the 5'-end, which individually are
positively charged under reaction and isolation conditions
described in this Example. Compounds 70 and 74 contain two amino
modified thymidines that, under reaction conditions, display
positively charged R--NH.sub.3.sup.+ groups attached at the C5
position through a C.sub.10 or C.sub.6 linker, respectively.
Because compounds 70 and 74 are 3'-end phosphorylated, they consist
of four negative charges and three positive charges. Compound 75
differs from 74 in that the internal C.sub.6 amino modified
thymidine phosphate in 74 is replaced by a thymidine methyl
phosphonate. The phosphonate backbone is uncharged and so there are
a total of three negative charges on compound 75. This gives
compound 75 a net negative one charge. Compound 76 differs from 70
in that the internal amino modified thymidine is replaced by an
internal cytosine phosphonate. The pK.sub.a of the N3 nitrogen of
cytosine can be from 4 to 7. Thus, the net charges of this
compound, can be from -1 to 0 depending on the pH of the solution.
For the simplicity of analysis, each group is assigned a whole
number of charges, although it is realized that, depending on the
pK.sub.a of each chemical group and ambient pH, a real charge may
differ from the whole number assigned. It is assumed that this
difference is not significant over the range of pHs used in the
enzymatic reactions studied here.
[0883] Dephosphorylation of these compounds, or the removal of the
3' end terminal phosphoryl group, results in elimination of two
negative charges and generates products that have a net positive
charge of one. In this experiment, the method of isoelectric
focusing (IEF) was used to demonstrate a change from one negative
to one positive net charge for the described substrates during
dephosphorylation.
[0884] Substrates 70, 74, 75 and 76 were synthesized by standard
phosphoramidite chemistries and deprotected for 24 hours at
22.degree. C. in 14 M aqueous ammonium hydroxide solution, after
which the solvent was removed in vacuo. The dried powders were
resuspended in 200 .mu.l of H.sub.2O and filtered through 0.2 .mu.m
filters. The concentration of the stock solutions was estimated by
UV-absorbance at 261 nm of samples diluted 200-fold in H.sub.2O
using a spectrophotometer (Spectronic Genesys 2, Milton Roy,
Rochester, N.Y.).
[0885] Dephosphorylation of compounds 70 and 74, 75 and 76 was
accomplished by treating 10 .mu.l of the crude stock solutions
(ranging in concentration from approximately 0.5 to 2 mM) with 2
units of CIAP in 100 .mu.l of CIAP buffer (Promega) at 37.degree.
C. for 1 hour. The reactions were then heated to 75.degree. C. for
15 min. in order to inactivate the CIAP. For clarity,
dephosphorylated compounds are designated `dp`. For example, after
dephosphorylation, substrate 70 becomes 70dp.
[0886] To prepare samples for IEF experiments, the concentration of
the stock solutions of substrate and dephosphorylated product were
adjusted to a uniform absorbance of 8.5.times.10.sup.-3 at 532 nm
by dilution with water. Two microliters of each sample were
analyzed by IEF using a PhastSystem electrophoresis unit
(Pharmacia) and PhastGel IEF 3-9 media (Pharmacia) according to the
manufacturer's protocol. Separation was performed at 15.degree. C.
with the following program: pre-run; 2,000 V, 2.5 mA, 3.5 W, 75 Vh;
load; 200 V, 2.5 mA, 3.5 W, 15 Vh; run; 2,000 V; 2.5 mA; 3.5 W, 130
Vh. After separation, samples were visualized by using the FMBIO
Image Analyzer (Hitachi) fitted with a 585 nm filter. The resulting
imager scan is shown in FIG. 48.
[0887] FIG. 48 shows results of IEF separation of substrates 70,
74, 75 and 76 and their dephosphorylated products. The arrow
labeled "Sample Loading Position" indicates a loading line, the `+`
sign shows the position of the positive electrode and the `-` sign
indicates the position of the negative electrode.
[0888] The results shown in FIG. 48 demonstrate that substrates 70,
74, 75 and 76 migrated toward the positive electrode, while the
dephosphorylated products 70dp, 74dp, 75dp and 76dp migrated toward
negative electrode. The observed differences in mobility direction
was in accord with predicted net charge of the substrates (minus
one) and the products (plus one). Small perturbations in the
mobilities of the phosphorylated compounds indicate that the
overall pIs vary. This was also true for the dephosphorylated
compounds. The presence of the cytosine in 76 dp, for instance,
moved this compound further toward the negative electrode, which
was indicative of a higher overall pI relative to the other
dephosphorylated compounds. It is important to note that additional
positive charges can be obtained by using a combination of natural
amino modified bases (70dp and 74dp) along with uncharged
methylphosphonate bridges (products 75dp and 76dp).
[0889] The results shown above demonstrate that the removal of a
single phosphate group can flip the net charge of an
oligonucleotide to cause reversal in an electric field, allowing
easy separation of products, and that the precise base composition
of the oligonucleotides affect absolute mobility but not the
charge-flipping effect.
Example 23
Detection of Specific Cleavage Products in the INVADER-Directed
Cleavage Reaction by Charge Reversal
[0890] In this Example the ability to isolate products generated in
the INVADER-directed cleavage assay from all other nucleic acids
present in the reaction cocktail was demonstrated using charge
reversal. This experiment utilized the following Cy3-labeled
oligonucleotide: 5'-Cy3-AminoT-AminoT-CTTTTCACCAGCGAGACGGG-3' (SEQ
ID NO:50; termed "oligo 61"). Oligo 61 was designed to release upon
cleavage a net positively charged labeled product. To test whether
or not a net positively charged 5'-end labeled product would be
recognized by the CLEAVASE enzymes in the INVADER-directed cleavage
assay format, probe oligo 61 (SEQ ID NO:50) and invading
oligonucleotide 67 (SEQ ID NO:51) were chemically synthesized on a
DNA synthesizer (ABI 391) using standard phosphoramidite
chemistries and reagents obtained from Glen Research (Sterling,
Va.).
[0891] Each assay reaction comprised 100 fmoles of M 13mp18 single
stranded DNA, 10 pmoles each of the probe (SEQ ID NO:50) and
INVADER (SEQ ID NO:51) oligonucleotides, and 20 units of CLEAVASE
A/G in a 10 .mu.l solution of 10 mM MOPS, pH 7.4 with 100 mM KCl.
Samples were overlaid with mineral oil to prevent evaporation. The
samples were brought to either 50.degree. C., 55.degree. C.,
60.degree. C., or 65.degree. C. and cleavage was initiated by the
addition of 1 .mu.l of 40 mM MnCl.sub.2. Reactions were allowed to
proceed for 25 minutes and then were terminated by the addition of
10 .mu.l of 95% formamide containing 20 mM EDTA and 0.02% methyl
violet. The negative control experiment lacked the target M13mp18
and was run at 60.degree. C. Five microliters of each reaction were
loaded into separate wells of a 20% denaturing polyacrylamide gel
(cross-linked 29:1) with 8 M urea in a buffer containing 45 mM
Tris-Borate (pH 8.3) and 1.4 mM EDTA. An electric field of 20 watts
was applied for 30 minutes, with the electrodes oriented as
indicated in FIG. 49B (i.e., in reverse orientation). The products
of these reactions were visualized using the FMBIO fluorescence
imager and the resulting imager scan is shown in FIG. 49B.
[0892] FIG. 49A provides a schematic illustration showing an
alignment of the INVADER (SEQ ID NO:50) and probe (SEQ ID NO:51)
along the target M13mp18 DNA; only 53 bases of the M13mp18 sequence
is shown (SEQ ID NO:52). The sequence of the INVADER
oligonucleotide is displayed under the M13mp18 target and an arrow
is used above the M13mp18 sequence to indicate the position of the
INVADER relative to the probe and target. As shown in FIG. 49A, the
INVADER and probe oligonucleotides share a 2 base region of
overlap.
[0893] In FIG. 49B, lanes 1-6 contain reactions performed at
50.degree. C., 55.degree. C., 60.degree. C., and 65.degree. C.,
respectively; lane 5 contained the control reaction (lacking
target). In FIG. 49B, the products of cleavage are seen as dark
bands in the upper half of the panel; the faint lower band seen
appears in proportion to the amount of primary product produced
and, while not limiting the invention to a particular mechanism,
may represent cleavage one nucleotide into the duplex. The
uncleaved probe does not enter the gel and is thus not visible. The
control lane showed no detectable signal over background (lane 5).
As expected in an invasive cleavage reaction, the rate of
accumulation of specific cleavage product was
temperature-dependent. Using these particular oligonucleotides and
target, the fastest rate of accumulation of product was observed at
55.degree. C. (lane 2) and very little product observed at
65.degree. C. (lane 4).
[0894] When incubated for extended periods at high temperature, DNA
probes can break non-specifically (i.e., suffer thermal
degradation) and the resulting fragments contribute an interfering
background to the analysis. The products of such thermal breakdown
are distributed from single-nucleotides up to the full length
probe. In this experiment, the ability of charge based separation
of cleavage products (i.e., charge reversal) would allow the
sensitive separation of the specific products of target-dependent
cleavage from probe fragments generated by thermal degradation was
examined.
[0895] To test the sensitivity limit of this detection method, the
target M13mp18 DNA was serially diluted ten fold over than range of
1 fmole to 1 amole. The INVADER and probe oligonucleotides were
those described above (i.e., SEQ ID NOS:50 and 51). The invasive
cleavage reactions were run as described above with the following
modifications: the reactions were performed at 55.degree. C., 250
mM or 100 mM KGlu was used in place of the 100 mM KCl and only 1
pmole of the INVADER oligonucleotide was added. The reactions were
initiated as described above and allowed to progress for 12.5
hours. A negative control reaction that lacked added M13 ml8 target
DNA was also run. The reactions were terminated by the addition of
10 .mu.l of 95% formamide containing 20 mM EDTA and 0.02% methyl
violet, and 5 .mu.l of these mixtures were electrophoresed and
visualized as described above. The resulting imager scan is shown
in FIG. 50.
[0896] In FIG. 50, lane 1 contains the negative control; lanes 2-5
contain reactions performed using 100 mM KGlu; lanes 6-9 contain
reactions performed using 250 mM KGlu. The reactions resolved in
lanes 2 and 6 contained 1 fmole of target DNA; those in lanes 3 and
7 contained 100 amole of target; those in lanes 4 and 8 contained
10 amole of target and those in lanes 5 and 9 contained 1 amole of
target. The results shown in FIG. 50 demonstrate that the detection
limit using charge reversal to detect the production of specific
cleavage products in an invasive cleavage reaction is at or below 1
attomole or approximately 6.02.times.10.sup.5 target molecules. No
detectable signal was observed in the control lane, which indicates
that non-specific hydrolysis or other breakdown products do not
migrate in the same direction as enzyme-specific cleavage products.
The excitation and emission maxima for Cy3 are 554 and 568,
respectively, while the FMBIO Imager Analyzer excites at 532 and
detects at 585. Therefore, the limit of detection of specific
cleavage products can be improved by the use of more closely
matched excitation source and detection filters.
Example 24
Devices and Methods for the Separation and Detection of Charged
Reaction Products
[0897] This Example is directed at methods and devices for
isolating and concentrating specific reaction products produced by
enzymatic reactions conducted in solution whereby the reactions
generate charged products from either a charge neutral substrate or
a substrate bearing the opposite charge borne by the specific
reaction product. The methods and devices of this Example allow
isolation of, for example, the products generated by the
INVADER-directed cleavage assay of the present invention.
[0898] The methods and devices of this Example are based on the
principle that when an electric field is applied to a solution of
charged molecules, the migration of the molecules toward the
electrode of the opposite charge occurs very rapidly. If a matrix
or other inhibitory material is introduced between the charged
molecules and the electrode of opposite charge such that this rapid
migration is dramatically slowed, the first molecules to reach the
matrix will be nearly stopped, thus allowing the lagging molecules
to catch up. In this way a dispersed population of charged
molecules in solution can be effectively concentrated into a
smaller volume. By tagging the molecules with a detectable moiety
(e.g., a fluorescent dye), detection is facilitated by both the
concentration and the localization of the analytes. This Example
illustrates two embodiments of devices contemplated by the present
invention; of course, variations of these devices will be apparent
to those skilled in the art and are within the spirit and scope of
the present invention.
[0899] FIG. 51 depicts one embodiment of a device for concentrating
the positively-charged products generated using the methods of the
present invention. As shown in FIG. 51, the device comprises a
reaction tube (10) that contains the reaction solution (11). One
end of each of two thin capillaries (or other tubes with a hollow
core) (13A and 13B) are submerged in the reaction solution (11).
The capillaries (13A and 13B) may be suspended in the reaction
solution (11) such that they are not in contact with the reaction
tube itself, one appropriate method of suspending the capillaries
is to hold them in place with clamps (not shown). Alternatively,
the capillaries may be suspended in the reaction solution (11) such
that they are in contact with the reaction tube itself. Suitable
capillaries include glass capillary tubes commonly available from
scientific supply companies (e.g., Fisher Scientific or VWR
Scientific) or from medical supply houses that carry materials for
blood drawing and analysis. Though the present invention is not
limited to capillaries of any particular inner diameter, tubes with
inner diameters of up to about 1/8 inch (approximately 3 mm) are
particularly preferred for use with the present invention; for
example, Kimble No. 73811-99 tubes (VWR Scientific) have an inner
diameter of 1.1 mm and are a suitable type of capillary tube.
Although the capillaries of the device are commonly composed of
glass, any nonconductive tubular material, either rigid or
flexible, that can contain either a conductive material or a
trapping material is suitable for use in the present invention. One
example of a suitable flexible tube is Tygon.RTM. clear plastic
tubing (Part No. R3603; inner diameter= 1/16 inch; outer diameter
1/8 inch).
[0900] As illustrated in FIG. 51, capillary 13A is connected to the
positive electrode of a power supply (20) (e.g., a controllable
power supply available through the laboratory suppliers listed
above or through electronics supply houses like Radio Shack) and
capillary 13B is connected to the negative electrode of the power
supply (20). Capillary 13B is filled with a trapping material (14)
capable of trapping the positively-charged reaction products by
allowing minimal migration of products that have entered the
trapping material (14). Suitable trapping materials include, but
are not limited to, high percentage (e.g., about 20%) acrylamide
polymerized in a high salt buffer (0.5 M or higher sodium acetate
or similar salt); such a high percentage polyacrylamide matrix
dramatically slows the migration of the positively-charged reaction
products. Alternatively, the trapping material may comprise a
solid, negatively-charged matrix, such as negatively-charged latex
beads, that can bind the incoming positively-charged products. It
should be noted that any amount of trapping material (14) capable
of inhibiting any concentrating the positively-charged reaction
products may be used. Thus, while the capillary 13B in FIG. 51 only
contains trapping material in the lower, submerged portion of the
tube, the trapping material (14) can be present in the entire
capillary (13B); similarly, less trapping material (14) could be
present than that shown in FIG. 51 because the positively-charged
reaction products generally accumulate within a very small portion
of the bottom of the capillary (13B). The amount of trapping
material need only be sufficient to make contact with the reaction
solution (11) and have the capacity to collect the reaction
products. When capillary 13B is not completely filled with the
trapping material, the remaining space is filled with any
conductive material (15); suitable conductive materials are
discussed below.
[0901] By comparison, the capillary (13A) connected to the positive
electrode of the power supply 20 may be filled with any conductive
material (15; indicated by the hatched lines in FIG. 51). This may
be the sample reaction buffer (e.g., 10 mM MOPS, pH 7.5 with 150 mM
LiCl, 4 mM MnCl.sub.2), a standard electrophoresis buffer (e.g., 45
mM Tris-Borate, pH 8.3, 1.4 mM EDTA), or the reaction solution (11)
itself. The conductive material (15) is frequently a liquid, but a
semi-solid material (e.g., a gel) or other suitable material might
be easier to use and is within the scope of the present invention.
Moreover, that trapping material used in the other capillary (i.e.,
capillary 13B) may also be used as the conductive material.
Conversely, it should be noted that the same conductive material
used in the capillary (13A) attached to the positive electrode may
also be used in capillary 13B to fill the space above the region
containing the trapping material (14) (see FIG. 51).
[0902] The top end of each of the capillaries (13A and 13B) is
connected to the appropriate electrode of the power supply (20) by
electrode wire (18) or other suitable material. Fine platinum wire
(e.g., 0.1 to 0.4 mm, Aesar Johnson Matthey, Ward Hill, Mass.) is
commonly used as conductive wire because it does not corrode under
electrophoresis conditions. The electrode wire (18) can be attached
to the capillaries (13A and 13B) by a nonconductive adhesive (not
shown), such as the silicone adhesives that are commonly sold in
hardware stores for sealing plumbing fixtures. If the capillaries
are constructed of a flexible material, the electrode wire (18) can
be secured with a small hose clamp or constricting wire (not shown)
to compress the opening of the capillaries around the electrode
wire. If the conducting material (15) is a gel, an electrode wire
(18) can be embedded directly in the gel within the capillary.
[0903] The cleavage reaction is assembled in the reaction tube (10)
and allowed to proceed therein as described in proceeding Examples
(e.g., Examples 22-23). Though not limited to any particular volume
of reaction solution (11), a preferred volume is less than 10 ml
and more preferably less than 0.1 ml. The volume need only be
sufficient to permit contact with both capillaries. After the
cleavage reaction is completed, an electric field is applied to the
capillaries by turning on the power source (20). As a result, the
positively-charged products generated in the course of the
INVADER-directed cleavage reaction that employs an oligonucleotide,
which when cleaved, generates a positively charged fragment
(described in Ex. 23) but when uncleaved bears a net negative
charge, migrate to the negative capillary, where their migration is
slowed or stopped by the trapping material (14), and the
negatively-charged uncut and thermally degraded probe molecules
migrate toward the positive electrode. Through the use of this or a
similar device, the positively-charged products of the invasive
cleavage reaction are separated from the other material (i.e.,
uncut and thermally degraded probe) and concentrated from a large
volume. Concentration of the product in a small amount of trapping
material (14) allows for simplicity of detection, with a much
higher signal-to-noise ratio than possible with detection in the
original reaction volume. Because the concentrated product is
labeled with a detectable moiety like a fluorescent dye, a
commercially-available fluorescent plate reader (not shown) can be
used to ascertain the amount of product. Suitable plate readers
include both top and bottom laser readers. Capillary 13B can be
positioned with the reaction tube (10) at any desired position so
as to accommodate use with either a top or a bottom plate reading
device.
[0904] In the alternative embodiment of the present invention
depicted in FIG. 52, the procedure described above is accomplished
by utilizing only a single capillary (13B). The capillary (13B)
contains the trapping material (14) described above and is
connected to an electrode wire (18), which in turn is attached to
the negative electrode of a power supply (20). The reaction tube
(10) has an electrode (25) embedded into its surface such that one
surface of the electrode is exposed to the interior of the reaction
tube (10) and another surface is exposed to the exterior of the
reaction tube. The surface of the electrode (25) on the exterior of
the reaction tube is in contact with a conductive surface (26)
connected to the positive electrode of the power supply (20)
through an electrode wire (18). Variations of the arrangement
depicted in FIG. 52 are also contemplated by the present invention.
For example, the electrode (25) may be in contact with the reaction
solution (11) through the use of a small hole in the reaction tube
(10); furthermore, the electrode wire (18) can be directly attached
to the electrode wire (18), thereby eliminating the conductive
surface (26).
[0905] As indicated in FIG. 52, the electrode (25) is embedded in
the bottom of a reaction tube (10) such that one or more reaction
tubes may be set on the conductive surface (26). This conductive
surface could serve as a negative electrode for multiple reaction
tubes; such a surface with appropriate contacts could be applied
through the use of metal foils (e.g., copper or platinum, Aesar
Johnson Matthey, Ward Hill, Mass.) in much the same way contacts
are applied to circuit boards. Because such a surface contact would
not be exposed to the reaction sample directly, less expensive
metals, such as the copper could be used to make the electrical
connections.
[0906] The above devices and methods are not limited to separation
and concentration of positively charged oligonucleotides. As will
be apparent to those skilled in the art, negatively charged
reaction products may be separated from neutral or positively
charged reactants using the above device and methods with the
exception that capillary 13B is attached to the positive electrode
of the power supply (20) and capillary 13A or alternatively,
electrode 25, is attached to the negative electrode of the power
supply (20).
Example 25
Primer-Directed and Primer Independent Cleavage Occur at the Same
Site when the Primer Extends to the 3' Side of a Mismatched
"Bubble" in the Downstream Duplex
[0907] As discussed above in Example 1, the presence of a primer
upstream of a bifurcated duplex can influence the site of cleavage,
and the existence of a gap between the 3' end of the primer and the
base of the duplex can cause a shift of the cleavage site up the
unpaired 5' arm of the structure (see also Lyamichev et al., supra
and U.S. Pat. No. 5,422,253). The resulting non-invasive shift of
the cleavage site in response to a primer is demonstrated in FIGS.
8, 9 and 10, in which the primer used left a 4-nucleotide gap
(relative to the base of the duplex). In FIGS. 8-10, all of the
"primer-directed" cleavage reactions yielded a 21 nucleotide
product, while the primer-independent cleavage reactions yielded a
25 nucleotide product. The site of cleavage obtained when the
primer was extended to the base of the duplex, leaving no gap was
examined. The results are shown in FIG. 53 (FIG. 53 is a
reproduction of FIG. 2C in Lyamichev et al. These data were derived
from the cleavage of the structure shown in FIG. 5, as described in
Example 1. Unless otherwise specified, the cleavage reactions
comprised 0.01 pmoles of heat-denatured, end-labeled hairpin DNA
(with the unlabeled complementary strand also present), 1 pmole
primer (complementary to the 3' arm shown in FIG. 5 and having the
sequence: 5'-GAATTCGATTTAGGTGACAC TATAGAATACA [SEQ ID NO:53]) and
0.5 units of DNAPTaq (estimated to be 0.026 pmoles) in a total
volume of 10 .mu.l of 10 mM Tris-Cl, pH 8.5, and 1.5 mM MgCl.sub.2
and 50 mM KCl. The primer was omitted from the reaction shown in
the first lane of FIG. 53 and included in lane 2. These reactions
were incubated at 55.degree. C. for 10 minutes. Reactions were
initiated at the final reaction temperature by the addition of
either the MgCl.sub.2 or enzyme. Reactions were stopped at their
incubation temperatures by the addition of 8 .mu.l of 95% formamide
with 20 mM EDTA and 0.05% marker dyes.
[0908] FIG. 53 is an autoradiogram that indicates the effects on
the site of cleavage of a bifurcated duplex structure in the
presence of a primer that extends to the base of the hairpin
duplex. The size of the released cleavage product is shown to the
left (i.e., 25 nucleotides). A dideoxynucleotide sequencing ladder
of the cleavage substrate is shown on the right as a marker (lanes
3-6).
[0909] These data show that the presence of a primer that is
adjacent to a downstream duplex (lane 2) produces cleavage at the
same site as seen in reactions performed in the absence of the
primer (lane 1). (See FIGS. 8A and B, 9B and 10A for additional
comparisons). When the 3' terminal nucleotides of the upstream
oligonucleotide can base pair to the template strand but are not
homologous to the displaced strand in the region immediately
upstream of the cleavage site (i.e., when the upstream
oligonucleotide is opening up a "bubble" in the duplex), the site
to which cleavage is apparently shifted is not wholly dependent on
the presence of an upstream oligonucleotide.
[0910] As discussed above in the Background, and in Table 1, the
requirement that two independent sequences be recognized in an
assay provides a highly desirable level of specificity. In the
invasive cleavage reactions of the present invention, the INVADER
and probe oligonucleotides must hybridize to the target nucleic
acid with the correct orientation and spacing to enable the
production of the correct cleavage product. When the distinctive
pattern of cleavage is not dependent on the successful alignment of
both oligonucleotides in the detection system these advantages of
independent recognition are lost.
Example 26
Invasive Cleavage and Primer-Directed Cleavage when there is Only
Partial Homology in the "X" Overlap Region
[0911] While not limiting the present invention to any particular
mechanism, invasive cleavage occurs when the site of cleavage is
shifted to a site within the duplex formed between the probe and
the target nucleic acid in a manner that is dependent on the
presence of an upstream oligonucleotide that shares a region of
overlap with the downstream probe oligonucleotide. In some
instances, the 5' region of the downstream oligonucleotide may not
be completely complementary to the target nucleic acid. In these
instances, cleavage of the probe may occur at an internal site
within the probe even in the absence of an upstream oligonucleotide
(in contrast to the base-by-base nibbling seen when a fully paired
probe is used without an INVADER). Invasive cleavage is
characterized by an apparent shifting of cleavage to a site within
a downstream duplex that is dependent on the presence of the
INVADER oligonucleotide.
[0912] A comparison between invasive cleavage and primer-directed
cleavage may be illustrated by comparing the expected cleavage
sites of a set of probe oligonucleotides having decreasing degrees
of complementarity to the target strand in the 5' region of the
probe (i.e., the region that overlaps with the INVADER). A simple
test, similar to that performed on the hairpin substrate above (Ex.
25), can be performed to compare invasive cleavage with the
non-invasive primer-directed cleavage described above. Such a set
of test oligonucleotides is diagrammed in FIG. 54. The structures
shown in FIG. 54 are grouped in pairs, labeled "a", "b", "c", and
"d". Each pair has the same probe sequence annealed to the target
strand (SEQ ID NO:54), but the top structure of each pair is drawn
without an upstream oligonucleotide, while the bottom structure
includes this oligonucleotide (SEQ ID NO:55). The sequences of the
probes shown in FIGS. 54a-54d are listed in SEQ ID NOS:32, 56, 57
and 58, respectively. Probable sites of cleavage are indicated by
the black arrowheads. (It is noted that the precise site of
cleavage on each of these structures may vary depending on the
choice of cleavage agent and other experimental variables. These
particular sites are provided for illustrative purposes only.)
[0913] To conduct this test, the site of cleavage of each probe is
determined both in the presence and the absence of the upstream
oligonucleotide, in reaction conditions such as those described in
Example 18. The products of each pair of reactions are then be
compared to determine whether the fragment released from the 5' end
of the probe increases in size when the upstream oligonucleotide is
included in the reaction.
[0914] The arrangement shown in FIG. 54a, in which the probe
molecule is completely complementary to the target strand, is
similar to that shown in FIG. 28. Treatment of the top structure
with the 5' nuclease of a DNA polymerase would cause exonucleolytic
nibbling of the probe (i.e., in the absence of the upstream
oligonucleotide). In contrast, inclusion of an INVADER
oligonucleotide would cause a distinctive cleavage shift similar,
to those observed in FIG. 29.
[0915] The arrangements shown in FIGS. 54b and 54c have some amount
of unpaired sequence at the 5' terminus of the probe (3 and 5
bases, respectively). These small 5' arms are suitable cleavage
substrate for the 5' nucleases and would be cleaved within 2
nucleotide's of the junction between the single stranded region and
the duplex. In these arrangements, the 3' end of the upstream
oligonucleotide shares identity with a portion of the 5' region of
the probe that is complementary to the target sequence (that is the
3' end of the INVADER has to compete for binding to the target with
a portion of the 5' end of the probe). Therefore, when the upstream
oligonucleotide is included it is thought to mediate a shift in the
site of cleavage into the downstream duplex (although the present
invention is not limited to any particular mechanism of action),
and this would, therefore, constitute invasive cleavage. If the
extreme 5' nucleotides of the unpaired region of the probe were
able to hybridize to the target strand, the cleavage site in the
absence of the INVADER might change but the addition of the INVADER
oligonucleotide would still shift the cleavage site to the proper
position.
[0916] Finally, in the arrangement shown in FIG. 54d, the probe and
upstream oligonucleotides share no significant regions of homology,
and the presence of the upstream oligonucleotide would not compete
for binding to the target with the probe. Cleavage of the
structures shown in FIG. 54d would occur at the same site with or
without the upstream oligonucleotide, and is thus would not
constitute invasive cleavage.
[0917] By examining any upstream oligonucleotide/probe pair in this
way, it can easily be determined whether the resulting cleavage is
invasive or merely primer-directed. Such analysis is particularly
useful when the probe is not fully complementary to the target
nucleic acid, so that the expected result may not be obvious by
simple inspection of the sequences.
Example 27
Modified CLEAVASE Enzymes
[0918] In order to develop nucleases having useful activities for
the cleavage of nucleic acids the following modified nucleases were
produced.
[0919] a) CLEAVASE BN/Thrombin Nuclease
[0920] i) Cloning and Expression of CLEAVASE BN/Thrombin
Nuclease
[0921] Site directed mutagenesis was used to introduce a protein
sequence recognized by the protease thrombin into the region of the
CLEAVASE BN nuclease that is thought to form the helical arch of
the protein through which the single-stranded DNA that is cleaved
must presumably pass. Mutagenesis was carried out using the
Transformer.TM. mutagenesis kit (Clonetech, Palo Alto, Calif.)
according to manufacturer's protocol using the mutagenic
oligonucleotide 5'-GGGAAAGTCCTCGCAGCCGCGCG GGACGAGCGTGGGGGCCCG (SEQ
ID NO:59). After mutagenesis, the DNA was sequenced to verify the
insertion of the thrombin cleavage site. The DNA sequence encoding
the CLEAVASE BN/thrombin nuclease is provided in SEQ ID NO:60; the
amino acid sequence of CLEAVASE BN/thrombin nuclease is provided in
SEQ ID NO:61.
[0922] A large scale preparation of the thrombin mutant (i.e.,
CLEAVASE BN/thrombin) was done using E. coli cells overexpressing
the CLEAVASE BN/thrombin nuclease as described in Example 28.
ii) Thrombin Cleavage of CLEAVASE BN/Thrombin
[0923] Six point four (6.4) mg of the purified CLEAVASE BN/thrombin
nuclease was digested with 0.4 U of thrombin (Novagen) for 4 hours
at 23.degree. C. or 37.degree. C. Complete digestion was verified
by electrophoresis on a 15% SDS polyacrylamide gel followed by
staining with Coomassie Brilliant Blue R. Wild-type CLEAVASE BN
nuclease was also digested with thrombin as a control. The
resulting gel is shown in FIG. 61.
[0924] In FIG. 61, lane 1 contains molecular weight markers
(Low-Range Protein Molecular Weight Markers; Promega), lane 2
contains undigested CLEAVASE BN/throbin nuclease, lanes 3 and 4
contain CLEAVASE BN/thrombin nuclease digested with thrombin at
23.degree. C. for 2 and 4 hours, respectively, and lanes 5 and 6
contain CLEAVASE BN/thrombin nuclease digested with thrombin at
37.degree. C. for 2 and 4 hours, respectively. These results show
that the CLEAVASE BN/thrombin nuclease has an apparent molecular
weight of 36.5 kilodaltons and demonstrate that CLEAVASE
BN/thrombin nuclease is efficiently cleaved by thrombin. In
addition, the thrombin cleavage products have approximate molecular
weights of 27 kilodaltons and 9 kilodaltons, the size expected
based upon the position of the inserted thrombin site in the
CLEAVASE BN/thrombin nuclease.
[0925] To determine the level of hairpin cleavage activity in
digested and undigested CLEAVASE BN/thrombin nuclease, dilutions
were made and used to cleave a test hairpin containing a 5'
fluoroscein label. Varying amounts of digested and undigested
CLEAVASE BN/thrombin nuclease were incubated with 5 .mu.M
oligonucleotide S-60 hairpin (SEQ ID NO:29; see FIG. 26) in 10 mM
MOPS (pH 7.5), 0.05% Tween-20, 0.05% NP-40, and 1 mM MnCl.sub.2 for
5 minutes at 60.degree. C. The digested mixture was electrophoresed
on a 20% acrylamide gel and visualized on a Hitachi FMBIO 100
fluoroimager. The resulting image is shown in FIG. 62.
[0926] In FIG. 62, lane 1 contains the no enzyme control, lane 2
contains reaction products produced using 0.01 ng of CLEAVASE BN
nuclease, lanes 3, 4, and 5 contain reaction products produced
using 0.01 ng, 0.04 ng, and 4 ng of undigested CLEAVASE BN/thrombin
nuclease, respectively, and lanes 6, 7, and 8 contain reaction
products produced using 0.01 ng, 0.04 ng, and 4 ng of
thrombin-digested CLEAVASE BN/thrombin nuclease, respectively. The
results shown in FIG. 62 demonstrated that the insertion of the
thrombin cleavage site reduced cleavage activity about 200-fold
(relative to the activity of CLEAVASE BN nuclease), but that
digestion with thrombin did not reduce the activity
significantly.
[0927] M13 single-stranded DNA was used as a substrate for cleavage
by CLEAVASE BN nuclease and digested and undigested CLEAVASE
BN/thrombin nuclease. Seventy nanograms of single-stranded M13 DNA
(NEB) was incubated in 10 mM MOPS, pH 7.5, 0.05% Tween-20, 0.05%
NP-40, 1 mM MgCl.sub.2 or 1 mM MnCl.sub.2, with 8 ng of CLEAVASE BN
nuclease, undigested CLEAVASE BN/thrombin nuclease, or digested
CLEAVASE BN/thrombin nuclease for 10 minutes at 50.degree. C.
Reaction mixtures were electrophoresed on a 0.8% agarose gel and
then stained with a solution containing 0.5 .mu.g/ml ethidium
bromide (EtBr) to visualize DNA bands. A negative image of the
EtBr-stained gel is shown in FIG. 63.
[0928] In FIG. 63, lane 1 contains the no enzyme control, lane 2
contains reaction products produced using CLEAVASE BN nuclease and
1 mM MgCl.sub.2, lane 3 contains reaction products produced using
CLEAVASE BN nuclease and 1 mM MnCl.sub.2, lane 4 contains reaction
products produced using undigested CLEAVASE BN/thrombin nuclease
and 1 mM MgCl.sub.2, lane 5 contains reaction products produced
using undigested CLEAVASE BN/thrombin nuclease and 1 mM MnCl.sub.2,
lane 6 contains reaction products produced using thrombin-digested
CLEAVASE BN/thrombin nuclease and 1 mM MgCl.sub.2, and lane 7
contains reaction products produced using thrombin-digested
CLEAVASE BN/thrombin nuclease and 1 mM MnCl.sub.2. The results
shown in FIG. 63 demonstrated that the CLEAVASE BN/thrombin
nuclease had an enhanced ability to cleave circular DNA (and thus a
reduced requirement for the presence of a free 5' end) as compared
to the CLEAVASE BN nuclease.
[0929] It can be seen from these data that the helical arch of
these proteins can be opened without destroying the enzyme or its
ability to specifically recognize cleavage structures. The CLEAVASE
BN/thrombin mutant has an increased ability to cleave without
reference to a 5' end, as discussed above. The ability to cleave
such structures will allow the cleavage of long molecules, such as
genomic DNA that, while often not circular, may present many
desirable cleavage sites that are at a far removed from any
available 5' end. Cleavage structures may be made at such sites
either by folding of the strands (i.e., CFLP.RTM. cleavage) or by
the introduction of structure-forming oligonucleotides (U.S. Pat.
No. 5,422,253). 5' ends of nucleic acids can also be made
unavailable because of binding of a substance too large to thread
through the helical arch. Such binding moieties may include
proteins such as streptavidin or antibodies, or solid supports such
as beads or the walls of a reaction vessel. A cleavage enzyme with
an opening in the loop of the helical arch will be able to cleave
DNAs that are configured in this way, extending the number of ways
in which reactions using such enzymes can be formatted.
[0930] b) CLEAVASE DN Nuclease
[0931] i) Construction and Expression of CLEAVASE DN Nuclease
[0932] A polymerization deficient mutant of Taq DNA polymerase,
termed CLEAVASE DN nuclease, was constructed. CLEAVASE DN nuclease
contains an asparagine residue in place of the wild-type aspartic
acid residue at position 785 (D785N).
[0933] DNA encoding the CLEAVASE DN nuclease was constructed from
the gene encoding for CLEAVASE A/G (mutTaq, Ex. 2) in two rounds of
site-directed mutagenesis. First, the G at position 1397 and the G
at position 2264 of the CLEAVASE A/G gene (SEQ ID NO:21) were
changed to A at each position to recreate a wild-type DNAPTaq gene.
As a second round of mutagenesis, the wild type DNAPTaq gene was
converted to the CLEAVASE DN gene by changing the G at position
2356 to A. These manipulations were performed as follows.
[0934] DNA encoding the CLEAVASE A/G nuclease was recloned from
pTTQ18 plasmid (Ex. 2) into the pTrc99A plasmid (Pharmacia) in a
two step procedure. First, the pTrc99A vector was modified by
removing the G at position 270 of the pTrc99A map, creating the
pTrc99G cloning vector. To this end, pTrc99A plasmid DNA was cut
with NcoI and the recessive 3' ends were filled-in using the Klenow
fragment of E. coli polymerase I in the presence of all four dNTPs
at 37.degree. C. for 15 min. After inactivation of the Klenow
fragment by incubation at 65.degree. C. for 10 min, the plasmid DNA
was cut with EcoRI, the ends were again filled-in using the Klenow
fragment in the presence of all four dNTPs at 37.degree. C. for 15
min. The Klenow fragment was then inactivated by incubation at
65.degree. C. for 10 min. The plasmid DNA was ethanol precipitated,
recircularized by ligation, and used to transform E. coli JM109
cells (Promega). Plasmid DNA was isolated from single colonies and
deletion of the G at position 270 of the pTrc99A map was confirmed
by DNA sequencing.
[0935] As a second step, DNA encoding the CLEAVASE A/G nuclease was
removed from the pTTQ18 plasmid using EcoRI and SalI and the DNA
fragment carrying the CLEAVASE A/G nuclease gene was separated on a
1% agarose gel and isolated with Geneclean II Kit (Bio 101, Vista,
Calif.). The purified fragment was ligated into the pTrc99G vector,
which had been cut with EcoRI and SalI. The ligation mixture was
used to transform competent E. coli JM109 cells (Promega). Plasmid
DNA was isolated from single colonies and insertion of the CLEAVASE
A/G nuclease gene was confirmed by restriction analysis using EcoRI
and SalI.
[0936] Plasmid DNA pTrcAG carrying the CLEAVASE A/G nuclease gene
cloned into the pTrc99A vector was purified from 200 ml of JM109
overnight culture using QIAGEN Plasmid Maxi kit (QIAGEN,
Chatsworth, Calif.) according to manufacturer's protocol. pTrcAG
plasmid DNA was mutagenized using two mutagenic primers, E465 (SEQ
ID NO:62) (Integrated DNA Technologies, Iowa) and R754Q (SEQ ID
NO:63) (Integrated DNA Technologies), and the selection primer
Trans Oligo AlwNI/SpeI (Clontech, Palo Alto, Calif., catalog
#6488-1) according to Transformer.TM. Site-Directed Mutagenesis Kit
protocol (Clontech) to produce a restored wild-type DNAPTaq gene
(pTrcWT).
[0937] pTrcWT plasmid DNA carrying the wild-type DNAPTaq gene
cloned into the pTrc99A vector was purified from 200 ml of JM109
overnight culture using QIAGEN Plasmid Maxi kit (QIAGEN,
Chatsworth, Calif.) according to manufacturer's protocol. pTrcWT
was then mutagenized using the mutagenic primer D785N (SEQ ID
NO:64) (Integrated DNA Technologies) and the selection primer
Switch Oligo SpeI/AlwNI (Clontech, catalog #6373-1) according to
Transformer.TM. Site-Directed Mutagenesis Kit protocol (Clontech)
to create a plasmid containing DNA encoding the CLEAVASE DN
nuclease. The DNA sequence encoding the CLEAVASE DN nuclease is
provided in SEQ ID NO:65; the amino acid sequence of CLEAVASE DN
nuclease is provided in SEQ ID NO:66.
[0938] A large scale preparation of the CLEAVASE DN nuclease was
done using E. coli cells overexpressing the CLEAVASE DN nuclease as
described in Example 28.
[0939] c) CLEAVASE DA Nuclease and CLEAVASE DV Nuclease
[0940] Two polymerization deficient mutants of Taq DNA polymerase,
termed CLEAVASE DA nuclease and CLEAVASE DV nuclease, were
constructed. The CLEAVASE DA nuclease contains a alanine residue in
place of the wild-type aspartic acid residue at position 610
(D785A). The CLEAVASE DV nuclease contains a valine residue in
place of the wild-type aspartic acid residue at position 610
(D610V).
[0941] i) Construction and Expression of the CLEAVASE DA and
CLEAVASE DV Nucleases
[0942] To construct vectors encoding the CLEAVASE DA and DV
nucleases, the CLEAVASE A/G nuclease gene contained within pTrcAG
was mutagenized with two mutagenic primers, R754Q (SEQ ID NO:63)
and D610AV (SEQ ID NO:67) and the selection primer Trans Oligo
AlwNI/SpeI (Clontech, catalog #6488-1) according to the
Transformer.TM. Site-Directed Mutagenesis Kit protocol (Clontech,)
to create a plasmid containing DNA encoding the CLEAVASE DA
nuclease or CLEAVASE DV nuclease. The D610AV oligonucleotide was
synthesized to have a purine, A or G, at position 10 from the 5'
end of the oligonucleotide. Following mutagenesis, plasmid DNA was
isolated from single colonies and the type of mutation present, DA
or DV, was determined by DNA sequencing. The DNA sequence encoding
the CLEAVASE DA nuclease is provided in SEQ ID NO:68; the amino
acid sequence of CLEAVASE DA nuclease is provided in SEQ ID NO:69.
The DNA sequence encoding the CLEAVASE DV nuclease is provided in
SEQ ID NO:70; the amino acid sequence of CLEAVASE DV nuclease is
provided in SEQ ID NO:71.
[0943] Large scale preparations of the CLEAVASE DA and CLEAVASE DV
nucleases was done using E. coli cells overexpressing the CLEAVASE
DA nuclease or the CLEAVASE DV nuclease as described in Example
28.
Example 28
Cloning and Expression of Thermostable FEN-1 Endonucleases
[0944] Sequences encoding thermostable FEN-1 proteins derived from
three Archaebacterial species were cloned and overexpressed in E.
coli. This Example involved a) cloning and expression of a FEN-1
endonuclease from Methanococcus jannaschii; b) cloning and
expression of a FEN-1 endonuclease from Pyrococcus furiosus; c)
cloning and expression of a FEN-1 endonuclease from Pyrococcus
woesei; d) cloning and expression of a FEN-1 endonuclease from
Archaeoglobus fulgidus; e) large scale preparation of recombinant
thermostable FEN-1 proteins; and f) activity assays using FEN-1
endonucleases.
[0945] a) Cloning and Expression of a FEN-1 Endonuclease from
Methanococcus jannaschii
[0946] DNA encoding the FEN-1 endonuclease from Methanococcus
jannaschii (M. jannaschii) was isolated from M. jannaschii cells
and inserted into a plasmid under the transcriptional control of an
inducible promoter as follows. Genomic DNA was prepared from 1 vial
of live M. jannaschii bacteria (DSMZ, Deutsche Sammlung von
Mikroorganismen und Zellkulturen, Braunschweig, Germany # 2661)
with the DNA XTRAX kit (Gull Laboratories, Salt Lake City, Utah)
according to the manufacturer's protocol. The final DNA pellet was
resuspended in 100 .mu.l of TE (10 mM Tris HCl, pH 8.0, 1 mM EDTA).
One microliter of the DNA solution was employed in a PCR using the
Advantage.TM. cDNA PCR kit (Clonetech); the PCR was conducted
according to manufacturer's recommendations. The 5'-end primer (SEQ
ID NO:72) is complementary to the 5' end of the Mja FEN-1 open
reading frame with a one base substitution to create an NcoI
restriction site (a fragment of the M. jannaschii genome that
contains the gene encoding M. jannaschii (Mja) FEN-1 is available
from GenBank as accession # U67585). The 3'-end primer (SEQ ID
NO:73) is complementary to a sequence about 15 base pairs
downstream from the 3' end of the Mja FEN-1 open reading frame with
2 base substitutions to create a SalI restriction enzyme site. The
sequences of the 5'-end and 3'-end primers are: 5'-GGGATACCA
TGGGAGTGCAGTTTGG-3' (SEQ ID NO:72) and 5'-GGTAAATTTTTCTCGTCGA
CATCCCAC-3' (SEQ ID NO:73), respectively. The PCR reaction resulted
in the amplification (i.e., production) of a single major band
about 1 kilobase in length. The open reading frame (ORF) encoding
the Mja FEN-1 endonuclease is provided in SEQ ID NO:74; the amino
acid sequence encoded by this ORF is provided in SEQ ID NO:75.
[0947] Following the PCR amplification, the entire reaction was
electrophoresed on a 1.0% agarose gel and the major band was
excised from the gel and purified using the Geneclean II kit
(Bio101, Vista, Calif.) according to manufacturer's instructions.
Approximately 1 .mu.g of the gel-purified Mja FEN-1 PCR product was
digested with NcoI and SalI. After digestion, the DNA was purified
using the Geneclean II kit according to manufacturer's
instructions. One microgram of the pTrc99a vector (Pharmacia) was
digested with NcoI and SalI in preparation for ligation with the
digested PCR product. One hundred nanograms of digested pTrc99a
vector and 250 ng of digested Mja FEN-1 PCR product were combined
and ligated to create pTrc99-MJFEN1. pTrc99-MJFEN1 was used to
transform competent E. coli JM109 cells (Promega) using standard
techniques.
[0948] b) Cloning and Expression of a FEN-1 Endonuclease from
Pyrococcus furiosus
[0949] DNA encoding the Pyrococcus furiosus (P. furiosus) FEN-1
endonuclease was obtained by PCR amplification using a plasmid
containing DNA encoding the P. furiosus (Pfu) FEN-1 endonuclease
(obtained from Dr. Frank Robb, Center of Marine Biotechnology,
Baltimore, Md.). DNA sequences encoding a portion of the Pfu FEN-1
endonuclease can be obtained from GenBank as accession Nos.
AA113505 and W36094. The amplified Pfu FEN-1 gene was inserted into
the pTrc99a expression vector (Pharmacia) to place the Pfu FEN-1
gene under the transcriptional control of the inducible trc
promoter. The PCR amplification was conducted as follows. One
hundred microliter reactions contained 50 mM Tris HCl, pH 9.0, 20
mM (NH.sub.4).sub.2SO.sub.4, 2 mM MgCl.sub.2, 50 .mu.M dNTPs, 50
pmole each primer, 1 U Tfl polymerase (Epicentre Technologies,
Madison, Wis.) and 1 ng of FEN-1 gene-containing plasmid DNA. The
5'-end primer (SEQ ID NO:76) is complementary to the 5' end of the
Pfu FEN-1 open reading frame but with two substitutions to create
an NcoI site and the 3'-end primer (SEQ ID NO:77) is complementary
to a region located about 30 base pairs downstream of the FEN-1
open reading frame with two substitutions to create a PstI site.
The sequences of the 5'-end and 3'-end primers are:
5'-GAGGTGATACCATG GGTGTCC-3' (SEQ ID NO:76) and
5'-GAAACTCTGCAGCGCGTCAG-3' (SEQ ID NO:77), respectively. The PCR
reaction resulted in the amplification of a single major band about
1 kilobase in length. The open reading frame (ORF) encoding the Pfu
FEN-1 endonuclease is provided in SEQ ID NO:78; the amino acid
sequence encoded by this ORF is provided in SEQ ID NO:79.
[0950] Following the PCR amplification, the entire reaction was
electrophoresed on a 1.0% agarose gel and the major band was
excised from the gel and purified using the Geneclean II kit
(Bio101) according to manufacturer's instructions. Approximately 1
.mu.g of gel purified Pfu FEN-1 PCR product was digested with NcoI
and PstI. After digestion, the DNA was purified using the Geneclean
II kit according to manufacturer's instructions. One microgram of
the pTrc99a vector was digested with NcoI and PstI prior to
ligation with the digested PCR product. One hundred nanograms of
digested pTrc99a and 250 ng of digested Pfu FEN-1 PCR product were
combined and ligated to create pTrc99-PFFEN1. pTrc99-PFFEN1 was
used to transform competent E. coli JM109 cells (Promega) using
standard techniques.
[0951] c) Cloning and Expression of a FEN-1 Endonuclease from
Pyrococcus woesei
[0952] For the cloning of DNA encoding the Pyrococcus woesei (Pwo)
FEN-1 endonuclease, DNA was prepared from lyophilized P. woesei
bacteria (DSMZ # 3773) as described (Zwickl et al., J. Bact.,
172:4329 [1990]) with several changes. Briefly, one vial of P.
woesei bacteria was rehydrated and resuspended in 0.5 ml of LB
(Luria broth). The cells were centrifuged at 14,000.times.g for 1
min and the cell pellet was resuspended in 0.45 ml of TE. Fifty
microliters of 10% SDS was added and the mixture was incubated at
RT for 5 min. The cell lysate was then extracted three time with
1:1 phenol:chloroform and three times with chloroform. Five hundred
microliters of isopropanol was added to the extracted lysate and
the DNA was pelleted by centrifugation at 14,000.times.g for 10
min. The DNA pellet was washed in 0.5 ml of 70% ethanol and the DNA
was pelleted again by centrifugation at 14,000.times.g for 5 min.
The DNA pellet was dried and resuspended in 100 .mu.l of TE and
used for PCR reactions without further purification.
[0953] To generate a P. woesei FEN-1 gene fragment for cloning into
an expression vector, low stringency PCR was attempted with primers
complementary to the ends of the P. furiosus FEN-1 gene open
reading frame. The sequences of the 5'-end and 3'-end primers are
5'-GATACCATGGGTGTCCCAATTGGTG-3' (SEQ ID NO:80) and
5'-TCGACGTCGACTTATCTCTTGAACCAACTTTCAAGGG-3' (SEQ ID NO:81),
respectively. The high level of sequence similarity of protein
homologs (i.e., proteins other than FEN-1 proteins) from P.
furiosus and P. woesei suggested that there was a high probability
that the P. woesei FEN-1 gene could be amplified using primers
containing sequences complementary to the P. furiosus FEN-1 gene.
However, this approach was unsuccessful under several different PCR
conditions.
[0954] The DNA sequence of FEN-1 genes from P. furiosus and M.
jannaschii were aligned and blocks of sequence identity between the
two genes were identified. These blocks were used to design
internal primers (i.e., complementary to sequences located internal
to the 5' and 3' ends of the ORF) for the FEN-1 gene that are
complementary to the P. furiosus FEN-1 gene in those conserved
regions. The sequences of the 5'- and 3'-internal primers are
5'-AGCGAGGGAGAGGCCCAAGC-3' (SEQ ID NO:82) and
5'-GCCTATGCCCTTTATTCCTCC-3' (SEQ ID NO:83), respectively. A PCR
employing these internal primers was conducted using the
Advantage.TM. PCR kit and resulted in production of a major band of
300 bp.
[0955] Since the PCR with the internal primers was successful,
reactions were attempted that contained mixtures of the internal
(SEQ ID NOS:82 and 83) and external (SEQ ID NOS:80 and 81) primers.
A reaction containing the 5'-end external primer (SEQ ID NO:80) and
3'-end internal primer (SEQ ID NO:83) resulted in the production of
a 600 bp band and a reaction containing the 5'-end internal primer
(SEQ ID NO:82) and 3'-end external primer (SEQ ID NO:81) resulted
in the production of a 750 bp band. These overlapping DNA fragments
were gel-purified and combined with the external primers (SEQ ID
NOS:80 and 81) in a PCR reaction. This reaction generated a 1 kb
DNA fragment containing the entire Pwo FEN-1 gene open reading
frame. The resulting PCR product was gel-purified, digested, and
ligated exactly as described above for the Mja FEN-1 gene PCR
product. The resulting plasmid was termed pTrc99-PWFEN1.
pTrc99-PWFEN1 was used to transform competent E. coli JM109 cells
(Promega) using standard techniques.
[0956] d) Cloning and Expression of a FEN-1 Endonuclease from
Archaeoglobus fulgidus
[0957] The preliminary Archaeoglobus fulgidus (Afu) chromosome
sequence of 2.2 million bases was downloaded from the TIGR (The
Institute for Genomic Research) world wide web site, and imported
into a software program (MacDNAsis), used to analyze and manipulate
DNA and protein sequences. The unannotated sequence was translated
into all 6 of the possible reading frames, each comprising
approximately 726,000 amino acids. Each frame was searched
individually for the presence of the amino acid sequence "VFDG"
(valine, phenylalanine, aspartic acid, glycine), a sequence that is
conserved in the FEN-1 family. The amino acid sequence was found in
an open reading frame that contained other amino acid sequences
conserved in the FEN-1 genes and that was approximately the same
size as the other FEN-1 genes. The ORF DNA sequence is shown in SEQ
ID NO:164, while the ORF protein sequence is shown in SEQ ID
NO:165. Based on the position of this amino acid sequence within
the reading frame, the DNA sequence encoding a putative FEN-1 gene
was identified.
[0958] The sequence information was used to design oligonucleotide
primers that were used for PCR amplification of the FEN-1-like
sequence from A. fulgidus genomic DNA. Genomic DNA was prepared
from A. fulgidus as described in Ex. 29a for M. janaschii, except
that one vial (approximately 5 ml of culture) of live A. fulgidus
bacteria from DSMZ (DSMZ #4304) was used. One microliter of the
genomic DNA was used for PCR reaction as described in Ex. 29a. The
5' end primer is complementary to the 5' end of the Afu FEN-1 gene
except it has a 1 base pair substitution to create an Nco I site.
The 3' end primer is complentary to the 3' end of the Afu FEN-1
gene downstream from the FEN-1 ORF except it contains a 2 base
substitution to create a Sal I site. The sequences of the 5' and 3'
end primers are 5'-CCGTCAACATTTACCATGGGTGCGGA-3' (SEQ ID NO:166)
and 5'-CCGCCACCTCGTAGTCGACATCCTTTTCGTG (SEQ ID NO:167),
respectively.
[0959] Cloning of the resulting fragment was as described for the
PfuFEN1 gene, above, to create the plasmid pTrc99-AFFEN1. The
pTrcAfuHis plasmid was constructed by modifying pTrc99-AFFEN.sup.1,
by adding a histidine tail to facilitate purification. To add this
histidine tail, standard PCR primer-directed mutagenesis methods
were used to insert the coding sequence for six histidine residues
between the last amino acid codon of the pTrc99-AFFEN1 coding
region and the stop codon. The resulting plasmid was termed
pTrcAfuHis. The protein was then expressed as described in Example
28(e), and purified by binding to a Ni++ affinity column, as
described in Example 8.
[0960] e) Large Scale Preparation of Recombinant Thermostable FEN-1
Proteins
[0961] The Mja, Pwo and Pfu FEN-1 proteins were purified by the
following technique, which is derived from a Taq DNA polymerase
preparation protocol (Engelke et al., Anal. Biochem., 191:396
[1990]) as follows. E. coli cells (strain JM109) containing either
pTrc99-PFFEN1, pTrc99-PWFEN1, or pTrc99-MJFEN1 were inoculated into
3 ml of LB (Luria Broth) containing 100 .mu.g/ml ampicillin and
grown for 16 hrs at 37.degree. C. The entire overnight culture was
inoculated into 200 ml or 350 ml of LB containing 100 .mu.g/ml
ampicillin and grown at 37.degree. C. with vigorous shaking to an
A.sub.600 of 0.8. IPTG (1 M stock solution) was added to a final
concentration of 1 mM and growth was continued for 16 hrs at
37.degree. C.
[0962] The induced cells were pelleted and the cell pellet was
weighed. An equal volume of 2.times.DG buffer (100 mM Tris-HCl, pH
7.6, 0.1 mM EDTA) was added and the pellet was resuspended by
agitation. Fifty mg/ml lysozyme (Sigma, St. Louis, Mo.) was added
to 1 mg/ml final concentration and the cells were incubated at room
temperature for 15 min. Deoxycholic acid (10% solution) was added
dropwise to a final concentration of 0.2% while vortexing. One
volume of H.sub.2O and 1 volume of 2.times.DG buffer was added and
the resulting mixture was sonicated for 2 minutes on ice to reduce
the viscosity of the mixture. After sonication, 3 M
(NH.sub.4).sub.2SO.sub.4 was added to a final concentration of 0.2
M and the lysate was centrifuged at 14000.times.g for 20 min at
4.degree. C. The supernatant was removed and incubated at
70.degree. C. for 60 min at which time 10% polyethylimine (PEI) was
added to 0.25%. After incubation on ice for 30 min., the mixture
was centrifuged at 14,000.times.g for 20 min at 4.degree. C. At
this point, the supernatant was removed and the FEN-1 proteins was
precipitated by the addition of (NH.sub.4).sub.2SO.sub.4 as
follows.
[0963] For the Pwo and the Pfu FEN-1 preparations, the FEN-1
protein was precipitated by the addition of 2 volumes of 3 M
(NH.sub.4).sub.2SO.sub.4. The mixture was incubated overnight at
room temperature for 16 hrs and the protein was centrifuged at
14,000.times.g for 20 min at 4.degree. C. The protein pellet was
resuspended in 0.5 ml of Q buffer (50 mM Tris-HCl, pH 8.0, 0.1 mM
EDTA, 0.1% Tween 20). For the Mja FEN-1 preparation, solid
(NH.sub.4).sub.2SO.sub.4 was added to a final concentration of 3 M
(.about.75% saturated), the mixture was incubated on ice for 30
min, and the protein was spun down and resuspended as described
above.
[0964] The resuspended protein preparations were quantitated by
determination of the A.sub.279 and aliquots containing 2-4 .mu.g of
total protein were electrophoresed on a 10% SDS polyacrylamide gel
(29:1 acrylamide:bis-acrylamide) in standard Laemmli buffer
[Laemmli, Nature 277:680 [1970]) and stained with Coomassie
Brilliant Blue R; the results are shown in FIG. 64.
[0965] In FIG. 64, lane 1 contains molecular weight markers
(Mid-Range Protein Molecular Weight Markers; Promega); the size of
the marker proteins is indicated to the left of the gel. Lane 2
contains purified CLEAVASE BN nuclease; lanes 3-5 contain extracts
prepared from E. coli expressing the Pfu, Pwo and Mja FEN-1
nucleases, respectively. The calculated (i.e., using a translation
of the DNA sequence encoding the nuclease) molecular weight of the
Pfu FEN-1 nuclease is 38,714 daltons and the calculated molecular
weight for the Mja FEN-1 nuclease is 37,503 Daltons. The Pwo and
Pfu FEN-1 proteins co-migrated on the SDS-PAGE gel and therefore,
the molecular weight of the Pwo FEN-1 nuclease was estimated to be
38.7 kDa.
[0966] f) Activity Assays Using FEN-1 Endonucleases
[0967] i) Mixed Hairpin Assay
[0968] The CLEAVASE BN nuclease has an approximately 60-fold
greater affinity for a 12 base pair stem-loop structure than an 8
base pair stem-loop DNA structure. As a test for activity
differences between the CLEAVASE BN nuclease and the FEN-1
nucleases, a mixture of oligonucleotides having either a 8 or a 12
bp stem-loop (see FIG. 60, which depicts the S-33 and 11-8-0
oligonucleotides) was incubated with an extract prepared from E.
coli cells overexpressing the Mja FEN-1 nuclease (prepared as
described above). Reactions contained 0.05 .mu.M of
oligonucleotides S-33 (SEQ ID NO:84) and 11-8-0 (SEQ ID NO:85)
(both oligonucleotides contained 5'-fluorescein labels), 10 mM
MOPS, pH 7.5, 0.05% Tween-20, 0.05% NP-40, 1 mM MnCl.sub.2.
Reactions were heated to 90.degree. C. for 10 seconds, cooled to
55.degree. C., then 1 .mu.l of crude extract (Mja FEN-1) or
purified enzyme (CLEAVASE BN nuclease) was added and the mixtures
were incubated at 55.degree. C. for 10 minutes; a no enzyme control
was also run. The reactions were stopped by the addition of
formamide/EDTA, the samples were electrophoresed on a denaturing
20% acrylamide gel and visualized on a Hitachi FMBIO 100
fluoroimager. The resulting image is shown in FIG. 65.
[0969] In FIG. 65, lane 1 contains the reaction products generated
by the CLEAVASE BN nuclease, lane 2 contains the reaction products
from the no enzyme control reaction and lane 3 contains the
reaction products generated by the Mja FEN-1 nuclease. The data
shown in FIG. 76 demonstrates that the CLEAVASE BN nuclease
strongly prefers the S33 structure (12 bp stem-loop) while the Mja
FEN-1 nuclease cleaves structures having either an 8 or a 12 bp
stem-loop with approximately the same efficiency. This shows that
the Mja FEN-1 nuclease has a different substrate specificity than
the CLEAVASE BN nuclease, a useful feature for INVADER assays or
CFLP.RTM. analysis as discussed in the DESCRIPTION OF THE
INVENTION
Example 29
Terminal Deoxynucleotidyl Transferase Selectively Extends the
Products of INVADER-Directed Cleavage
[0970] The majority of thermal degradation products of DNA probes
will have a phosphate at the 3'-end. To investigate if the
template-independent DNA polymerase, terminal deoxynucleotide
transferase (TdT) can tail or polymerize the aforementioned 3'-end
phosphates (i.e., add nucleotide triphosphates to the 3' end) the
following experiment was performed.
[0971] To create a sample containing a large percentage of thermal
degradation products, the 5' fluorescein-labeled oligonucleotide
34-078-01 (SEQ ID NO:86) (200 pmole) was incubated in 100 .mu.l 10
mM NaCO.sub.3 (pH 10.6), 50 mM NaCl at 95.degree. C. for 13 hours.
To prevent evaporation, the reaction mixture was overlaid with 60
.mu.l ChillOut.TM. 14 liquid wax. The reaction mixture was then
divided into two equal aliquots (A and B). Aliquot A was mixed with
one-tenth volume 3M NaOAc followed by three volumes ethanol and
stored at -20.degree. C. Aliquot B was dephosphorylated by the
addition of 0.5 .mu.l of 1M MgCl.sub.2 and 1 .mu.l of 1 unit/.mu.l
Calf Intestine Alkaline Phosphatase (CIAP) (Promega), with
incubation at 37.degree. C. for 30 minutes. An equal volume of
phenol:chloroform: isomayl:alcohol (24:24:1) was added to the
sample followed by vortexing for one minute and then centrifugation
5 minutes at maximum speed in a microcentrifuge to separate the
phases. The aqueous phase was removed to a new tube to which
one-tenth volume 3M NaOAc, and three volumes ethanol was added
followed by storage at -20.degree. C. for 30 minutes. Both aliquots
(A and B) were then centrifuged for 10 minutes at maximum speed in
a microcentrifuge to pellet the DNA. The pellets were then washed
two times each with 80% ethanol and then desiccated to dryness. The
dried pellets were then dissolved in 70 .mu.l ddH.sub.2O each.
[0972] The TdT reactions were conducted as follows. Six mixes were
assembled, all mixes contained 10 mM Tris OAc (pH 7.5), 10 mM
MgOAc, 50 mM KCl, and 2 mM dATP. Mixes 1 and 2 contained one pmole
of untreated 34-078-01 (SEQ ID NO:86), mixes 3 and 4 contained 2
.mu.l of aliquot A (above), mixes 5 and 6 contained 2 .mu.l of
aliquot B (above). To each 9 .mu.l of mixes 1, 3 and 5, 1 .mu.l
ddH.sub.2O was added, to each 9 .mu.l of mixes 2, 4, and 6, 1 .mu.l
of 20 units/.mu.l TdT (Promega) was added. The mixes were incubated
at 37.degree. C. for 1 hour and then the reaction was terminated by
the addition of 5 .mu.l 95% formamide with 10 mM EDTA and 0.05%
marker dyes. Five microliters of each mixture was resolved by
electrophoresis through a 20% denaturing acrylamide gel (19:1
cross-linked) with 7 M urea, in a buffer containing 45 mM
Tris-Borate (pH 8.3), 1.4 mM EDTA, and imaged using with the FMBIO
Image Analyzer with a 505 nm filter. The resulting imager scan is
shown in FIG. 66.
[0973] In FIG. 66, lanes 1, 3 and 5 contain untreated 34-078-01
(SEQ ID NO:86), heat-degraded 34-078-01, and heat-degraded,
dephosphorylated, 34-078-01, respectively incubated in the absence
of TdT. Lanes 2, 4 and 6 contain, untreated 34-078-01,
heat-degraded 34-078-01, and heat-degraded, dephosphorylated,
34-078-01, respectively incubated in the presence of TdT.
[0974] As shown in FIG. 66, lane 4, TdT was unable to extend
thermal degradation products that contain a 3'-end phosphate group,
and selectively extends molecules that have a 3'-end hydroxyl
group.
Example 30
Specific TdT Tailing of the Products of INVADER-Directed Cleavage
with Subsequent Capture and Detection on Nitrocellulose
Supports
[0975] When TdT is used to extend the specific products of
cleavage, one means of detecting the tailed products is to
selectively capture the extension products on a solid support
before visualization. This Example demonstrates that the cleavage
products can be selectively tailed by the use of TdT and
deoxynucleotide triphosphates, and that the tailed products can be
visualized by capture using a complementary oligonucleotide bound
to a nitrocellulose support.
[0976] To extend the cleavage product produced in an
INVADER-directed cleavage reaction, the following experiment was
performed. Three reaction mixtures were assembled, each in a buffer
of 10 mM MES (pH 6.5), 0.5% Tween-20, 0.5% NP-40. The first mixture
contained 5 fmols of target DNA-M 13mp18, 10 pmols of probe oligo
32-161-2 (SEQ ID NO:87; this probe oligonucleotide contains 3' ddC
and a Cy3 amidite group near the 3' end), and 5 pmols of INVADER
oligonucleotide 32 161-1 (SEQ ID NO:88; this oligo contains a 3'
ddC). The second mixture contained the probe and INVADER
oligonucleotides without target DNA. The third mixture was the same
as the first mixture, and contained the same probe sequence, but
with a 5' fluorescein label (oligo 32-161-4 [SEQ ID NO:89; this
oligo contains a 3' ddC, 5' fluorescein label, and a Cy3 dye group
near the 3' end]), so that the INVADER-directed cleavage products
could be detected before and after cleavage by fluorescence
imaging. The probe only control sample contained 10 pmols of oligo
32-161-2 (SEQ ID NO:87). Each 3 .mu.l of enzyme mix contained 5 ng
of CLEAVASE DN nuclease in 7.5 mM MgCl.sub.2. The TdT mixture (per
each 4 .mu.l) contained: 10 U of TdT (Promega), 1 mM CoCl.sub.2, 50
mM KCl, and 100 .mu.M of dTTP. The INVADER cleavage reaction
mixtures described above were assembled in thin wall tubes, and the
reactions were initiated by the addition of 3 .mu.l of CLEAVASE DN
enzyme mix. The reactions were incubated at 65.degree. C. for 20
min. After cooling to 37.degree. C., 4 .mu.l of the TdT mix was
added and the samples were incubated for 4 min at 37.degree. C.,
Biotin-16-dUTP was then added to 100 .mu.M and the samples were
incubated for 50 min at 37.degree. C. The reactions were terminated
by the addition of 1 .mu.l of 0.5 M EDTA.
[0977] To test the efficiency of tailing the products were run on
an acrylamide gel. Four microliters of each reaction mixture was
mixed with 2.6 .mu.l of 95% formamide, 10 mM EDTA and 0.05% methyl
violet and heated to 90.degree. C. for 1 min, and 3 .mu.l were
loaded on a 20% denaturing acrylamide gel (19:1 cross-linked) with
7 M urea, in buffer containing 45 mM Tris-Borate (pH 8.3), 1.4 mM
EDTA. A marker (.PHI.X174-HinfI [fluorescein labeled]) also was
loaded. After electrophoresis, the gel was analyzed using a
FMBIO-100 Image Analyzer (Hitachi) equipped with a 505 nm filter.
The resulting scan is shown in FIG. 67.
[0978] In FIG. 67, lane 1 contained the probe 32-161-2 only,
without any treatment. Lanes 2 and 3 contained the products of
reactions run without target DNA, without or with subsequent TdT
tailing, respectively. Lanes 4 and 5 contained the products of
reactions run with target DNA, probe oligo 32-161-2 (SEQ ID NO:87)
and INVADER oligo 32-161-1 (SEQ ID NO:88), without or with
subsequent TdT tailing, respectively. Lanes 6 and 7 show the
products of reactions containing target DNA, probe oligo 32-161-4
(SEQ ID NO:89) and INVADER oligo 32-161-1 (SEQ ID NO:88), without
or with subsequent TdT tailing, respectively. Lane M contains the
marker .PHI.X174-HinfI.
[0979] The reaction products in lanes 4 and 5 are the same as those
seen in lanes 6 and 7, except that the absence of a 5' fluorescein
on the probe prevents detection of the relased 5' product
(indicated as "A" near the bottom of the gel) or the TdT extended
5' product (indicated as "B", near the top of the gel). The
Cy3-labeled 3' portion of the cleaved probe is visible in all of
these reactions (indicated as "C", just below the center of the
gel).
[0980] To demonstrate detection of target-dependent
INVADER-directed cleavage products on a solid support, the
reactions from lanes 3 and 5 were tested on the Universal GENECOMB
(Bio-Rad), which is a standard nitrocellulose matrix on a rigid
nylon backing styled in a comb format, as depicted in FIG. 68.
Following the manufacturer's protocol, with one modification: 10
.mu.l of the INVADER-directed cleavage reactions were used instead
the recommended 10% of a PCR. To capture the cleavage products, 2.5
pmols of the capture oligo 59-28-1 (SEQ ID NO:90) were spotted on
each tooth. The capture and visualization steps were conducted
according to the manufacturer's directions. The results are shown
in FIG. 68.
[0981] In FIG. 68, teeth numbered 6 and 7 show the capture results
of reactions performed without and with target DNA present. Tooth 8
shows the kit positive control.
[0982] The darkness of the spot seen on tooth 7, when compared to
tooth 6, clearly indicates that products of INVADER-directed
cleavage assays may be specifically detected on solid supports.
While the Universal GENECOMB was used to demonstrate solid support
capture in this instance, other support capture methods known to
those skilled in the art would be equally suitable. For example,
beads or the surfaces of reaction vessels may easily be coated with
capture oligonucleotides so that they can then be used in this
step. Alternatively, similar solid supports may easily be coated
with streptavidin or antibodies for the capture of biotin- or
hapten-tagged products of the cleavage/tailing reaction. In any of
these embodiments, the products may be appropriately visualized by
detecting the resulting fluorescence, chemiluminescence,
colorimetric changes, radioactive emissions, optical density change
or any other distinguishable feature of the product.
Example 31
Comparison of the Effects of Invasion Length and 5' Label of the
Probe on INVADER-Directed Cleavage by the CLEAVASE A/G and Pfu
FEN-1 Nucleases
[0983] To investigate the effect of the length of invasion as well
as the effect of the type of dye on ability of Pfu FEN-1 and the
CLEAVASE A/G nuclease to cleave 5' arms, the following experiment
was performed. Three probes of similar sequences labeled with
either fluorescein, TET, or Cy3, were assembled in reactions with
three INVADER oligonucleotides that created overlapping target
hybridization regions of eight, five, and three bases along the
target nucleic acid, M 13mp18.
[0984] The reactions were conducted as follows. All conditions were
performed in duplicate. Enzyme mixes for Pfu FEN-1 and the CLEAVASE
A/G nuclease were assembled. Each 2 .mu.l of the Pfu FEN-1 mix
contained 100 ng of Pfu FEN-1 (prepared as described in Ex. 28) and
7.5 mM MgCl.sub.2. Each 2 .mu.l of the CLEAVASE A/G mix contained
5.3 ng of the CLEAVASE A/G nuclease and 4.0 mM MnCl.sub.2. Six
master mixes containing buffer, M13mp18, and INVADER
oligonucleotides were assembled. Each 7 .mu.l of mixes 1-3
contained 1 fmol M13mp18, 10 pmoles INVADER oligonucleotide
(34-078-4 [SEQ ID NO:39], 24-181-2 [SEQ ID NO:91], or 24-181-1 [SEQ
ID NO:92], in 10 mM MOPS (pH 7.5), 150 mM LiCl. Each 7 .mu.l of
mixes 4-6 contained 1 fmol of M13mp18, 10 pmoles of INVADER
oligonucleotide [34-078-4 (SEQ ID NO:39), 24-181-2 (SEQ ID NO:91),
or 24-181-1 (SEQ ID NO:92)] in 10 mM Tris (pH 8.0). Mixtures 1-6
were then divided into three mixtures each, to which was added
either the fluorescein-labeled probe (oligo 34-078-01; SEQ ID
NO:86), the Cy3-labeled probe (oligo 43-20; SEQ ID NO:93) or the
TET-labeled probe (oligo 90; SEQ ID NO:32 containing a 5' TET
label). Each 7 .mu.l of all mixtures contained 10 pmoles of
corresponding probe. The DNA solutions described above were covered
with 10 .mu.l of CHILLOUT evaporation barrier and brought to
68.degree. C.
[0985] The reactions made from mixes 1-3 were started with 2 .mu.l
of the CLEAVASE A/G nuclease mix, and the reactions made from mixes
4-6 were started with 2 .mu.l of the Pfu FEN-1 mix. After 30
minutes at 68.degree. C., the reactions were terminated by the
addition of 8 .mu.l of 95% formamide with 10 mM EDTA and 0.05%
marker dyes. Samples were heated to 90.degree. C. for 1 minute
immediately before electrophoresis through a 20% denaturing
acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer
containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA. The products of
the cleavage reactions were visualized following electrophoresis by
the use of a Hitachi FMBIO fluorescence imager. Results from the
fluorescein-labeled probe are shown in FIG. 69, results from the
Cy3-labeled probe in FIG. 70, and results from the TET-labeled
probe in FIG. 71. In each of these Figures, the products of
cleavage by CLEAVASE A/G are shown in lanes 1-6 and the products of
cleavage by PfuFEN-1 are shown in lanes 7-12. In each in case the
uncut material appears as a very dark band near the top of the gel,
indicated by a "U" on the left. The products of cleavage directed
by INVADER oligonucleotides with 8, 5 or 3 bases of overlap (i.e.,
the "X" region was 8, 5, or 3 nt long) are shown in the first,
second and third pair of lanes in each set, respectively and the
released labeled 5' ends from these reactions are indicated by the
numbers 8, 5, and 3 on the left. Note that in the cleavage
reactions shown in FIG. 70 the presence of the positively charged
Cy3 dye causes the shorter products to migrate more slowly than the
larger products. These products do not contain any additional
positive charges (e.g., amino modifications as used in Example 23),
and thus still carry a net negative charge, and migrate towards the
positive electrode in a standard electrophoresis run.
[0986] It can be seen from these data that the CLEAVASE A/G and Pfu
FEN-1 structure-specific nucleases respond differently to both dye
identity and to the size of the piece to be cleaved from the probe.
The Pfu FEN-1 nuclease showed much less variability in response to
dye identity than did the CLEAVASE A/G nuclease, showing that any
dye wold be suitable for use with this enzyme. In contrast, the
amount of cleavage catalyzed by the CLEAVASE A/G nuclease varied
substantially with dye identity. Use of the fluorescein dye gave
results very close to those seen with the Pfu FEN-1 nuclease, while
the use of either Cy3 or TET gave dramatically reduced signal when
compared to the Pfu FEN-1 reactions. The one exception to this was
in the cleavage of the 3 nt product carrying a TET dye (lanes 5 and
6, FIG. 71), in which the CLEAVASE A/G nuclease gave cleavage at
the same rate as the Pfu FEN-1 nuclease. These data indicate that,
while CLEAVASE A/G may be used to cleave probes labeled with these
other dyes, the Pfu FEN-1 nuclease is a preferred nuclease for
cleavage of Cy3- and TET-labeled probes.
Example 32
Examination of the Effects of a 5' Positive Charge on the Rate of
Invasive Cleavage Using the CLEAVASE A/G or Pfu FEN-1 Nucleases
[0987] To investigate whether the positive charges on 5' end of
probe oligonucleotides containing a positively charged adduct(s)
(i.e., charge reversal technology or CRT probes as described in Ex.
23 and 24 have an effect on the ability of the CLEAVASE A/G or Pfu
FEN-1 nucleases to cleave the 5' arm of the probe, the following
experiment was performed.
[0988] Two probe oligonucleotides having the following sequences
were utilized in INVADER reactions: Probe 34-180-1:
(N-Cy3)T.sub.NH2T.sub.NH2CCAGAGCCTAATTTGCC AGT(N-fluorescein)A,
where N represents a spacer containing either the Cy3 or
fluorescein group (SEQ ID NO:94) and Probe 34-180-2:
5'-(N-TET)TTCCAGAGCC TAATTTGCCAGT-(N-fluorescein)A, where N
represents a spacer containing either the TET or fluorescein group
(SEQ ID NO:95). Probe 34-180-1 has amino-modifiers on the two 5'
end T residues and a Cy3 label on the 5' end, creating extra
positive charges on the 5' end. Probe 34-180-2 has a TET label on
the 5' end, with no extra positive charges. The fluorescein label
on the 3' end of probe 34-180-1 enables the visualization of the 3'
cleaved products and uncleaved probes together on an acrylamide gel
run in the standard direction (i.e., with the DNA migrating toward
the positive electrode). The 5' cleaved product of probe 34-180-1
has a net positive charge and will not migrate in the same
direction as the uncleaved probe, and is thus visualized by
resolution on a gel run in the opposite direction (i.e.; with this
DNA migrating toward the negative electrode).
[0989] The cleavage reactions were conducted as follows. All
conditions were performed in duplicate. Enzyme mixes for the Pfu
FEN-1 and CLEAVASE A/G nucleases were assembled. Each 2 .mu.l of
the Pfu FEN-1 mix contained 100 ng of Pfu FEN-1 (prepared as
described in Ex. 28) and 7.5 mM MgCl.sub.2. Each 2 .mu.l of the
CLEAVASE A/G nuclease mix contained 26.5 ng of CLEAVASE A/G
nuclease and 4.0 mM MnCl.sub.2. Four master mixes containing
buffer, M13mp18, and INVADER oligonucleotides were assembled. Each
7 .mu.l of mix 1 contained 5 fmol M13mp18, 10 pmoles INVADER
oligonucleotide 123 (SEQ ID NO:96) in 10 mM HEPES (pH 7.2). Each 7
.mu.l of mix 2 contained 1 fmol M13mp18, 10 pmoles INVADER
oligonucleotide 123 in 10 mM HEPES (pH 7.2). Each 7 .mu.l of mix 3
contained 5 fmol M13mp18, 10 pmoles INVADER oligonucleotide 123 in
10 mM HEPES (pH 7.2), 250 mM KGlu. Each 7 .mu.l of mix 4 contained
1 fmol M13mp18, 10 pmoles INVADER oligonucleotide 123 in 10 mM
HEPES (pH 7.2), 250 mM KGlu. For every 7 .mu.l of each mix, 10
pmoles of either probe 34-180-1 (SEQ ID NO:94) or probe 34-180-2
(SEQ ID NO:95) was added. The DNA solutions described above were
covered with 10 .mu.l of CHILLOUT evaporation barrier and brought
to 65.degree. C. The reactions made from mixes 1-2 were started by
the addition of 2 .mu.l of the Pfu FEN-1 mix, and the reactions
made from mixes 3-4 were started by the addition of 2 .mu.l of the
CLEAVASE A/G nuclease mix. After 30 minutes at 65.degree. C., the
reactions were terminated by the addition of 8 .mu.l of 95%
formamide containing 10 mM EDTA. Samples were heated to 90.degree.
C. for 1 minute immediately before electrophoresis through a 20%
denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in a
buffer containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA and a 20%
native acrylamide gel (29:1 cross-linked) in a buffer containing 45
mM Tris-Borate (pH 8.3), 1.4 mM EDTA.
[0990] The products of the cleavage reactions were visualized
following electrophoresis by the use of a Hitachi FMBIO
fluorescence imager. The resulting images are shown in FIG. 72.
FIG. 72A shows the denaturing gel, which was run in the standard
electrophoresis direction, and FIG. 72B shows the native gel, which
was run in the reverse direction. The reaction products produced by
Pfu FEN-1 and CLEAVASE A/G nucleases are shown in lanes 1-8 and
9-16, respectively. The products from the 5 fmol M13mp18 and 1 fmol
M13mp18 reactions are shown in lanes 1-4, 9-12 (5 fmol) and 5-8,
13-16 (1 fmol). Probe 34-180-1 is in lanes 1-2, 5-6, 9-10, 13-14
and probe 34-180-2 is in lanes 3-4, 7-8, 11-12, 15-16.
[0991] The fluorescein-labeled 3' end fragments from all cleavage
reactions are shown in FIG. 72A, indicated by a "3'" mark at the
left. The 3 nt 5' TET-labeled products are not visible in this
Figure, while the 5' Cy3-labeled products are shown in FIG.
72B.
[0992] The 3' end bands in FIG. 72A can be used to compare the
rates of cleavage by the different enzymes in the presence of the
different 5' end labels. It can be seen from this band that
regardless of the amount of target nucleic acid present, both the
Pfu FEN-1 and the CLEAVASE A/G nucleases show more product from the
5' TET-labeled probe. With the Pfu FEN-1 nuclease this preference
is modest, with only an approximately 25 to 40% increase in signal.
In the case of the CLEAVASE A/G nuclease, however, there is a
strong preference for the 5' TET label. Therefore, although when
the charge reversal method is used to resolve the products, a
substantial amount of product is observed from the CLEAVASE A/G
nuclease-catalyzed reactions, the Pfu FEN-1 nuclease is a preferred
enzyme for cleavage of Cy3-labeled probes.
Example 33
The Use of Universal Bases in the Detection of Mismatches by
INVADER Directed Cleavage
[0993] The term "degenerate base" refers to a base on a nucleotide
that does not hydrogen bond in a standard "Watson-Crick" fashion to
a specific base complement (i.e., A to T and G to C). For example,
the inosine base can be made to pair via one or two hydrogen bonds
to all of the natural bases (the "wobble" effect) and thus is
called degenerate. Alternatively, a degenerate base may not pair at
all; this type of base has been referred to as a "universal" base
because it can be placed opposite any nucleotide in a duplex and,
while it cannot contribute stability by base-pairing, it does not
actively destabilize by crowding the opposite base. Duplexes using
these universal bases are stabilized by stacking interactions only.
Two examples of universal bases, 3-nitropyrrole and 5-nitroindole,
are shown in FIG. 73. In hybridization, placement of a
3-nitropyrrole three bases from a mismatch position enhances the
differential recognition of one base mismatches. The enhanced
discrimination seems to come from the destabilizing effect of the
unnatural base (i.e., an altered T.sub.m in close proximity to the
mismatch). To test this same principle as a way of sensitively
detecting mismatches using the INVADER-directed cleavage assay,
INVADER oligonucleotides were designed using the universal bases
shown in FIG. 73, in the presence or absence of a natural mismatch.
In these experiments, the use of single nitropyrrole bases or pairs
of nitroindole bases that flank the site of the mismatch were
examined.
[0994] The target, probe and INVADER oligonucleotides used in these
assays are shown in FIG. 74. A 43 nucleotide oligonucleotide (oligo
109; SEQ ID NO:97) was used as the target. The probe
oligonucleotide (oligo 61; SEQ ID NO:50) releases a net positively
charged labeled product upon cleavage. In FIG. 74, the INVADER
oligonucleotide is shown schematically above the target
oligonucleotide as an arrow; the large arrowhead indicates the
location of the mismatch between the INVADER oligos and the target.
Under the target oligonucleotide, the completely complementary, all
natural (i.e., no universal bases) INVADER oligo (oligo 67; SEQ ID
NO:51) and a composite of INVADER oligos containing universal bases
("X") on either side of the mismatch ("M") are shown. The following
INVADER oligos were employed: oligo 114 (SEQ ID NO:98), which
contains a single nt mismatch; oligo 115 (SEQ ID NO:99), which
contains two 5-nitroindole bases and no mismatch; oligo 116 (SEQ ID
NO:100), which contains two 5-nitroindole bases and a single nt
mismatch; oligo 112 (SEQ ID NO:101), which contains one
3-nitropyrrole base and no mismatch; oligo 113 (SEQ ID NO:102),
which contains one 5-nitropyrrole base and a single nt mismatch;
and oligo 67 (SEQ ID NO:51), which is completely complementary to
the target.
[0995] The INVADER-directed cleavage reactions were carried out in
10 .mu.l of 10 mM MOPS (pH 7.2), 100 mM KCl, containing 1 .mu.M of
the appropriate invading oligonucleotide (oligos 67, 112-116), 10
nM synthetic target 109, 1 .mu.M Cy-3 labeled probe 61 and 2 units
of CLEAVASE DV (prepared as described in Ex. 27). The reactions
were overlayed with Chill-Out.RTM. liquid wax, brought to the
appropriate reaction temperature, 52.degree. C., 55.degree. C., or
58.degree. C. and initiated with the addition of 1 .mu.l of 40 mM
MnCl.sub.2. Reactions were allowed to proceed for 1 hour and were
stopped by the addition of 10 .mu.l formamide. One fourth of the
total volume of each reaction was loaded onto 20% non-denaturing
polyacrylamide gels, which were electrophoresed in the reverse
direction. The products were visualized using an Hitachi FMBIO-100
fluorescent scanner using a 585 nm filter. The resulting images are
shown in FIGS. 75A-C. In each panel, lanes 1-6 contain reactions
products from reactions using INVADER oligo 67, 114, 115, 116, 112
and 113, respectively. Reactions run at 52.degree. C., 55.degree.
C. and 58.degree. C. are shown in Panels A, B and C,
respectively.
[0996] These data show that two flanking 5-nitroindoles display a
significantly greater differentiation then does the one
3-nitropyrrole system, or the all natural base hybridization, and
this increased sensitivity is not temperature dependent. This
demonstrates that the use of universal bases is a useful means of
sensitively detecting single base mismatches between the target
nucleic acid and the complex of detection oligonucleotides of the
present invention.
Example 34
Detection of Point Mutations in the Human Ras Oncogene Using a
Miniprobe
[0997] It is demonstrated herein that very short probes can be used
for sensitive detection of target nucleic acid sequences (Ex. 37).
In this Example, it is demonstrated that the short probes work very
poorly when mismatched to the target, and thus can be used to
distinguish a given nucleic acid sequence from a close relative
with only a single base difference. To test this system synthetic
human ras oncogene target sequences were created that varied from
each other at one position. Oligonucleotide 166 (SEQ ID NO:103)
provided the wild-type ras target sequence. Oligonucleotide 165
(SEQ ID NO:104) provided the mutant ras target sequence. The
sequence of these oligonucleotides are shown in FIG. 76, and the
site of the sequence variation in the site corresponding to codon
13 of the ras gene is indicated. The INVADER oligonucleotide (oligo
162) has the sequence:
5'-G.sub.SC.sub.ST.sub.SC.sub.SA.sub.SA.sub.SG.sub.SG.sub.SC.sub.SACTCTTG-
CC TACGA-3' (SEQ ID NO:105), where the "S" indicates thiol linkages
(i.e., these are 2'-deoxynucleotide-5'-O-(1-thiomonophates)). The
miniprobe (oligo 161) has the sequence: 5'-(N-Cy3)
T.sub.NH2T.sub.NH2CACCAG-3' (SEQ ID NO:106) and is designed to
detect the mutant ras target sequence (i.e., it is completely
complementary to oligo 165). The stacker oligonucleotide (oligo
164) has the sequence:
5'-C.sub.ST.sub.SC.sub.SC.sub.SA.sub.SA.sub.SC.sub.S
T.sub.SA.sub.SCCACAAGTTTATATTCAG-3' (SEQ ID NO:107). A schematic
showing the assembly of these oligonucleotides into a cleavage
structure is depicted in FIG. 76.
[0998] Each cleavage reaction contained 100 nM of both the invading
(oligo 162) and stacking (oligo 164) oligonucleotides, 10 .mu.M
Cy3-labeled probe (oligo 161) and 100 .mu.M of either oligo 165 or
oligo 166 (target DNA) in 10 .mu.l of 10 mM HEPES (pH 7.2), 250 mM
KGlu, 4 mM MnCl.sub.2. The DNA mixtures were overlaid with mineral
oil, heated to 90.degree. C. for 15 sec then brought to a reaction
temperature of 47.degree., 50.degree., 53.degree. or 56.degree. C.
Reactions were initiated by the addition of 1 .mu.l of 100 ng/.mu.l
Pfu FEN-1. Reactions were allowed to proceed for 3 hours and
stopped by the addition of 10 .mu.l formamide. One fourth of the
total volume od each reaction was loaded onto a 20% non-denaturing
polyacrylamide gel, which was electrophoresed in the reverse
direction. The gel was scanned using an Hitachi FMBIO-100
fluorescent scanner fitted with a 585 nm filter, and the resulting
image is shown in FIG. 77.
[0999] In FIG. 77, for each reaction temperature tested, the
products from reactions containing either the mutant ras target
sequence (oligo 165) or the wild-type (oligo 166) are shown.
[1000] These data demonstrate that the miniprobe can be used to
sensitively discriminate between sequences that differ by a single
nucleotide. The miniprobe was cleaved to produce a strong signal in
the presence of the mutant target sequence, but little or no
miniprobe was cleaved in the presence of the wild-type target
sequence. Furthermore, the discrimination between closely related
targets is effective over a temperature range of at least
10.degree. C., which is a much broader range of temperature than
can usually be tolerated when the selection is based on
hybridization alone (e.g., hybridization with ASOs). This suggests
that the enzyme may be a factor in the discrimination, with the
perfectly matched miniprobe being the preferred substrate when
compared to the mismatched miniprobe. Thus, this system provides
sensitive and specific detection of target nucleic acid
sequences.
Example 35
Effects of 3' End Identity on Site of Cleavage of a Model
Oligonucleotide Structure
[1001] As described in the Examples above, structure-specific
nucleases cleave near the junction between single-stranded and
base-paired regions in a bifurcated duplex, usually about one base
pair into the base-paired region. It was shown in Example 10 that
thermostable 5' nucleases, including those of the present invention
(e.g., CLEAVASE BN nuclease, CLEAVASE A/G nuclease), have the
ability to cleave a greater distance into the base paired region
when provided with an upstream oligonucleotide bearing a 3' region
that is homologous to a 5' region of the subject duplex, as shown
in FIG. 26. It has also been determined that the 3' terminal
nucleotide of the INVADER oligonucleotide may be unpaired to the
target nucleic acid, and still shift cleavage the same distance
into the down stream duplex as when paired. It is shown in this
Example that it is the base component of the nucleotide, not the
sugar or phosphate, that is necessary to shift cleavage.
[1002] FIGS. 78A and B shows a synthetic oligonucleotide that was
designed to fold upon itself, and that consists of the following
sequence: 5'-GTTCTCTGCTCTCTGGTC
GCTGTCTCGCTTGTGAAACAAGCGAGACAGCGTGGTCTCTCG-3' (SEQ ID NO:29). This
oligonucleotide is referred to as the "S-60 Hairpin." The 15
basepair hairpin formed by this oligonucleotide is further
stabilized by a "tri-loop" sequence in the loop end (i.e., three
nucleotides form the loop portion of the hairpin) (Hiraro et al.,
Nucleic Acids Res., 22(4): 576 [1994]). FIG. 78B shows the sequence
of the P-15 oligonucleotide (SEQ ID NO:30) and the location of the
region of complementarity shared by the P-15 and S-60 hairpin
oligonucleotides. In addition to the P-15 oligonucleotide shown,
cleavage was also tested in the presence of the P-14
oligonucleotide (SEQ ID NO:108) (P-14 is one base shorter on the 3'
end as compared to P-15), the P-14 with an abasic sugar (P-14d; SEQ
ID NO:109) and the P14 with an abasic sugar with a 3' phosphate
(P-14dp; SEQ ID NO:10). A P-15 oligo with a 3' phosphate, P-15p
(SEQ ID NO:111) was also examined. The black arrows shown in FIG.
78 indicate the sites of cleavage of the S-60 hairpin in the
absence (top structure; A) or presence (bottom structure; B) of the
P-15 oligonucleotide.
[1003] The S-60 hairpin molecule was labeled on its 5' end with
fluorescein for subsequent detection. The S-60 hairpin was
incubated in the presence of a thermostable 5' nuclease in the
presence or the absence of the P-15 oligonucleotide. The presence
of the full duplex that can be formed by the S-60 hairpin is
demonstrated by cleavage with the CLEAVASE BN 5' nuclease, in a
primer-independent fashion (i.e., in the absence of the P-15
oligonucleotide). The release of 18 and 19-nucleotide fragments
from the 5' end of the S-60 hairpin molecule showed that the
cleavage occurred near the junction between the single and double
stranded regions when nothing is hybridized to the 3' arm of the
S-60 hairpin (FIG. 27, lane 2).
[1004] The reactions shown in FIG. 78C were conducted in 10 .mu.l
1.times.CFLP buffer with 1 mM MnCl.sub.2 and 50 mM K-Glutamate, in
the presence of 0.02 .mu.M S-60, 0.5 .mu.M INVADER oligonucleotide
and 0.01 ng per .mu.l CLEAVASE BN nuclease. Reactions were
incubated at 40.degree. C. for 5 minutes and stopped by the
addition of 8 .mu.l of stop buffer (95% formamide, 20 mM EDTA,
0.02% methyl violet). Samples were heated to 75.degree. C. for 2
min immediately before electrophoresis through a 15% acrylamide gel
(19:1 cross-linked), with 7 M urea, in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then analyzed with a
FMBIO-100 Image Analyzer (Hitachi) equipped with 505 nm filter. The
resulting image is shown in FIG. 78C.
[1005] In FIG. 78C lane 1 contains products from the no enzyme
control; lane 2 contains products from a reaction run in the
absence of an INVADER oligo; lanes 3-6 contain products from
reactions run the presence of the P-14d, P-14dp, P-15 and P-15p
INVADER oligos, respectively.
[1006] From the data shown in FIG. 78C, it can be seen that the use
of the P-15 INVADER oligonucleotide produces a shift in the
cleavage site, while the P14 INVADER oligonucleotide with either a
ribose (P14d) or a phosphorylated ribose (P14dp) did not This
indicates that the 15th residue of the INVADER oligonucleotide must
have the base group attached to promote the shift in cleavage.
Interestingly, the addition of phosphate to the 3' end of the P15
oligonucleotide apparently reversed the shifting of cleavage site.
The cleavage in this lane may in fact be cleavage in the absence of
an INVADER oligonucleotide as is seen in lane 2. In experiments
with 5' dye-labeled INVADER oligonucleotides with 3' phosphate
groups these oligonucleotides have been severely retarded in gel
migration, suggesting that either the enzyme or another constituent
of the reaction (e.g., BSA) is able to bind the 3' phosphate
irrespective of the rest of the cleavage structure. If the INVADER
oligonucleotides are indeed being sequestered away from the
cleavage structure, the resulting cleavage of the S-60 hairpin
would occur in a "primer-independent" fashion, and would thus not
be shifted.
[1007] In addition to the study cited above, the effects of other
substituents on the 3' ends of the INVADER oligonucleotides were
investigated in the presence of several different enzymes, and in
the presence of either Mn++ or Mg++. The effects of these 3' end
modifications on the generation of cleaved product are summarized
in the following table. All of modifications were made during
standard oligonucleotide synthesis by the use of controlled pore
glass (CPG) synthesis columns with the listed chemical moiety
provided on the support as the synthesis starting residue. All of
these CPG materials were obtained from Glen Research Corp.
(Sterling, Va.).
[1008] FIG. 79 provides the structures for the 3' end substituents
used in these experiments.
TABLE-US-00004 TABLE 4 {PRIVATE} Modification Studies At 3' End Of
INVADER Oligo Effect on INVADER Rxn. (As Extension By INVADER)
Enzyme:Condition - 3'-End Modification Terminal Transferase Effect
3' phosphate no A:5 - inhibits reaction, Glen part # 20-2900-42 no
detectable activity 3' acridine yes, poorly A:5 - decrease in
activity, <10% Glen part # 20-2973-42 B:5 - decrease in
activity, <10% B:4 - decrease in activity, <10% C:1 -
decrease in activity, <10% C:2 - decrease in activity, ~20% C:4
- decrease in activity, ~50% C:3 - decrease in activity, <5% 3'
carboxylate no A:1 - decrease in activity, ~50% Glen part #
20-4090-42 activity shift in cleavage site C:3 - reduces rate,
<10% activity 3' nitropyrole yes A:5 - increase in activity, ~2X
Glen part # 20-2143-42 3' nitroindole yes A:5 - decrease in
activity, ~33% Glen part # 20-2144-42 activity 3' arabinose yes A:5
- decrease in activity, ~50% Glen part # 10-4010-90 activity
3'dideoxyUTP- no A:5 - decrease in activity, ~40% flourescein
activity 3' phosphate no A:5 - inhibits reaction, Glen part #
20-2900-42 no detectable activity 3'-3' linkage no A:1 - equivalent
cleavage Glen part # 20-0002-01 activity shift in cleavage site C:3
- decrease in activity, ~25% activity 3' glyceryl yes, very poorly
C:3 - decrease in activity, ~30% Glen part # 20-2902-42 activity
loss of specificity of cleavage (2 sites) 3' amino modifier C7 yes
C:3 - decrease in activity, ~30% Glen part # 20-2957-42 activity
loss of specificity, multiple sites 3'deoxy, 2'OH yes, very poorly
A:5 - decrease in activity, <20% Glen part # 20-2104-42 activity
B:5 - decrease in activity, <20% activity B:3 - decrease in
activity, <20% activity C:1 - equivalent activity C:2 -
equivalent activity C:4 - ? increase in activity C:3 - decrease in
activity, ~40% activity Enzymes: A) CLEAVASE DV nuclease B)
CLEAVASE BN nuclease C) Pfu FEN-1 Condition: 1) 4 mM MnCl.sub.2,
150 mM LiCl 2) 4 mM MnCl.sub.2, 50 mM KCl 3) 7.5 mM MgCl.sub.2, no
monovalent 4) 4 mM MgCl.sub.2, 50 mM KCl 5) 10 mM MgOAc, 50 mM
KCl
[1009] It can be seen from these data that many different
modifications can be used on the 3' end of the INVADER
oligonucleotide without detriment. In various embodiments of the
present invention, such 3' end modifications may be used to block,
facilitate, or otherwise alter the hybridization characteristics of
the INVADER oligonucleotide, (e.g., to increase discrimination
against mismatches, or to increase tolerance of mismatches, or to
tighten the association between the INVADER oligonucleotide and the
target nucleic acid). Some substituents may be used to alter the
behavior of the enzyme in recognizing and cleaving within the
assembled complex.
[1010] Altered 3' ends may also be used to prevent extension of the
INVADER oligonucleotide by either template-dependent or
template-independent nucleic acid polymerases. The use of otherwise
unmodified dideoxynucleotides (i.e., without attached dyes or other
moieties) are a particularly preferred means of blocking extension
of INVADER oligonucleotides, because they do not decrease cleavage
activity, and they are absolutely unextendable.
Example 36
Effect of Probe Concentration, Temperature and a Stacker
Oligonucleotide on the Cleavage of Miniprobes by INVADER-Directed
Cleavage
[1011] The stacker oligonucleotides employed to form cleavage
structures may serve two purposes in the detection of a nucleic
acid target using a miniprobe. The stacker oligonucleotide may help
stabilize the interaction of the miniprobe with the target nucleic
acid, leading to greater accumulation of cleaved probe. In
addition, the presence of this oligo in the complex elongates the
duplex downstream of the cleavage site, which may enhance the
cleavage activity of some of the enzymes of the present invention.
An example of different preferences for the length of this duplex
by different structure-specific nucleases is seen in the comparison
of the CLEAVASE BN nuclease and the Mja FEN-1 nuclease cleavage of
8 bp and 12 bp duplex regions in FIG. 65. Increased affinity of the
enzyme for the cleavage structure also results in increased
accumulation of cleaved probe during reactions done for a set
amount of time.
[1012] The amount of miniprobe binding to the target is also
affected by the concentration of the miniprobe in the reaction
mixture. Even when a miniprobe is only marginally likely to
hybridize (e.g., when the reaction is performed at temperatures in
excess of the expected melting temperature of the probe/target
duplex), the amount of probe on the target at any given time can be
increased by using high concentrations of the miniprobe.
[1013] The need for a stacker oligonucleotide to enhance cleavage
of the miniprobe was examined at both low and high probe
concentrations. The reactions were carried out in 10 .mu.l of 10 mM
HEPES (pH 7.2), 250 mM KGIu, 4 mM MnCl.sub.2, containing 100 nM of
both the invading (oligo 135; SEQ ID NO:112) and stacking
oligonucleotides (oligo 147; SEQ ID NO:113) and 100 .mu.M ssM13
DNA. The reactions were overlayed with mineral oil, heated to
90.degree. C. for 15 sec then brought to the reaction temperature.
Reactions were performed at 35.degree., 40.degree., 45.degree.,
50.degree., 55.degree., 60.degree., and 65.degree. C. The cleavage
reactions were initiated by the addition of 1 .mu.l of 100 ng/.mu.l
Pfu FEN-1 and 1 .mu.l of varying concentrations of Cy-3 labeled 142
miniprobe oligonucleotide (SEQ ID NO:114). Reactions were allowed
to proceed for 1 hour and stopped by the addition of 10 .mu.l
formaldehyde. One fourth of the total volume of each reaction was
loaded onto 20% non-denaturing polyacrylamide gels, which were
electrophoresed in the reverse direction. Gels were visualized
using an Hitachi FMBIO-100 fluorescent scanner using a 585 nm
filter. The fluorescence in each product band was measured and the
graph shown in FIG. 80 was created using a Microsoft Excel
spreadsheet.
[1014] The data summarized in FIG. 80 showed that the concentration
of the miniprobe had a significant effect on the final measure of
product, showing dramatic increases as the concentration was
raised. Increases in the concentration of the miniprobe also
shifted the optimum reaction temperature upward. It is known in the
art that the concentration of the complementary strands in a
hybridization will affect the apparent T.sub.m of the duplex formed
between them. More significantly to the methods and compositions of
the present invention is the fact that the presence of the stacker
oligonucleotide has a profound influence on the cleavage rate of
the miniprobe at all probe concentrations. At each of the probe
concentrations the presence of the stacker as much as doubled the
signal from the cleavage product. This demonstrated the utility of
using the stacker oligonucleotide in combination with the
miniprobes described herein.
Example 37
The Presence of a Mismatch in the INVADER Oligonucleotide Decreases
the Cleavage Activity of the CLEAVASE A/G Nuclease
[1015] In any nucleic acid detection assay it is of additional
benefit if the assay can be made to sensitively detect minor
differences between related nucleic acids. In the following
experiment, model cleavage substrates were used that were identical
except for the presence or absence of a mismatch near the 3' end of
the INVADER oligonucleotide when hybridized to the model target
nucleic acid. The effect of a mismatch in this region on the
accumulation of cleaved probe was then assessed.
[1016] To demonstrate the effect of the presence of a mismatch in
the INVADER oligonucleotide on the ability of the CLEAVASE A/G
nuclease to cleave the probe oligonucleotide in an INVADER assay
the following experiment was conducted. Cleavage of the test
oligonucleotide IT-2 (SEQ ID NO:115) in the presence of INVADER
oligonucleotides IT-1 (SEQ ID NO:116) and IT-1A4 (SEQ ID NO:117).
Oligonucleotide IT-1 is fully complementary to the 3' arm of IT-2,
whereas oligonucleotide IT-1A4 has a T->A substitution at
position 4 from the 3' end that results in an A/A mismatch in the
INVADER-target duplex. Both the matched and mismatched INVADER
oligonucleotides would be expected to hybridize at the temperature
at which the following reaction was performed. FIG. 81 provides a
schematic showing IT-1 annealed to the folded IT-2 structure and
showing IT-1A4 annealed to the folded IT-2 structure.
[1017] The reactions were conducted as follows. Test
oligonucleotide IT-2 (0.1 .mu.M), labeled at the 5' end with
fluorescein (Integrated DNA Technologies), was incubated with 0.26
ng/.mu.l CLEAVASE AG in 10 .mu.l of CFLP.RTM. buffer with 4 mM
MgCl.sub.2, in the presence of 1 .mu.M IT-1 or IT-1A4 at 40.degree.
C. for 10 min; a no enzyme control was also run. Samples were
overlaid with 15 .mu.l Chill-Out.RTM. liquid wax to prevent
evaporation. Reactions were stopped by addition of 4 .mu.l stop
buffer (95% formamide, 20 mM EDTA, 0.02% methyl violet). The
cleavage products were separated on a 20% denaturing polyacrylamide
gel and analyzed with the FMBIO-100 Image Analyzer (Hitachi)
equipped with 505 nm filter. The resulting image is shown in FIG.
82.
[1018] In FIG. 82, lane 1 contains reaction products from the no
enzyme control and shows the migration of the uncut IT-2 oligo;
lanes 2-4 contain products from reactions containing no INVADER
oligo, the IT-1 INVADER oligo and the IT-1A4 INVADER oligo,
respectively.
[1019] These data show that cleavage is markedly reduced by the
presence of the mismatch, even under conditions in which the
mismatch would not be expected to disrupt hybridization. This
demonstrates that the INVADER oligonucleotide binding region is one
of the regions within the complex in which can be used for mismatch
detection, as revealed by a drop in the cleavage rate.
Example 38
Comparison of the Activity of the Pfu FEN-1 and Mja EN-1 Nucleases
in the INVADER Reaction
[1020] To compare the activity of the Pfu FEN-1 and the Mja FEN-1
nucleases in INVADER reaction the following experiment was
performed. A test oligonucleotide IT3 (SEQ ID NO:118) that forms an
INVADER-Target hairpin structure and probe oligonucleotide PR1 (SEQ
ID NO:119) labeled at the 5' end with fluorescein (Integrated DNA
Technologies) were employed in INVADER assays using either the Pfu
FEN-1 or the Mja FEN-1 nucleases.
[1021] The assays were conducted as follows. Pfu FEN-1 (13
ng/.mu.l) and Mja FEN-1 (10 ng/.mu.l) (prepared as described in Ex.
28) were incubated with the IT3 (0.1 nM) and PR1 (2 and 5 .mu.M)
oligonucleotides in 10 .mu.L CFLP.RTM. buffer, 4 mM MgCl.sub.2, 20
mg/ml tRNA at 55.degree. C. for 41 min. Samples were overlaid with
15 .mu.l Chill-Out.RTM. evaporation barrier to prevent evaporation.
Reactions were stopped by addition of 70 .mu.l stop buffer (95%
formamide, 20 mM EDTA, 0.02% methyl violet). Reaction products (1
.mu.l) were separated on a 20% denaturing polyacrylamide gel,
visualized using a fluoroimager and the bands corresponding to the
probe and the product were quantitiated. The resulting image is
shown in FIG. 83. In FIG. 83, the turnover rate per target per
minute is shown below the image for each nuclease at each
concentration of probe and target tested.
[1022] It was demonstrated in Example 32 that the use of the Pfu
FEN-1 structure-specific nuclease in the INVADER-directed cleavage
reaction resulted in a faster rate of product accumulation than did
the use of the CLEAVASE A/G. The data presented here demonstrates
that the use of Mja FEN-1 nuclease with the fluorescein labeled
probe further increases the amount of product generated by an
average of about 50%, demonstrating that, in addition to the Pfu
FEN-1 nuclease, the Mja FEN-1 nuclease is a preferred
structure-specific nuclease for the detection of nucleic acid
targets by the method of the present invention.
Example 39
Detection of RNA Target Nucleic Acids Using Miniprobe and Stacker
Oligonucleotides
[1023] In addition to the detection of the M113 DNA target material
described above, a miniprobe/stacker system was designed to detect
the HCV-derived RNA sequences described in Example 19. A probe of
intermediate length, either a long mid-range or a short standard
probe, was also tested. The miniprobe used (oligo 42-168-1) has the
sequence: 5'-TET-CCGGTCGTCCTGG-3' (SEQ ID NO:120), the stacker
oligonucleotide used (oligo 32-085) with this miniprobe has the
sequence: 5'-CAATTCCGGTGTACTACCGGTTCC-3' (SEQ ID NO:121). The
slightly longer probe, used without a stacker (oligo 42-088), has
the sequence: 5'-TET-CCGGTCGTCCTGGCAA-3' (SEQ ID NO:122). The
INVADER oligonucleotide used with both probes has the sequence:
5'-GTTTATCCAAGAAAGGACCCGGTC-3' (SEQ ID NO:47). The reactions
included 50 fmole of target RNA, 10 pmole of the INVADER
oligonucleotide and 5 pmole of the miniprobe oligonucleotide in 10
.mu.l of buffer containing 10 mM MES, pH 6.5 with 150 mM LiCl, 4 mM
MnCl.sub.2, 0.05% each Tween-20 and NP-40, and 39 units of RNAsin
(Promega). When used, 10 pmoles of the stacker oligonucleotide was
added. These components were combined, overlaid with CHILLOUT
evaporation barrier, and warmed to 50.degree. C.; the reactions
were started by the addition of 5 polymerase units of DNAPTth, to a
final reaction volume of 10 .mu.l. After 30 minutes at 50.degree.
C., reactions were stopped by the addition of 8 .mu.l of 95%
formamide, 10 mM EDTA and 0.02% methyl violet. The samples were
heated to 90.degree. C. for 1 minute and 2.5 .mu.l of each of these
reactions were resolved by electrophoresis through a 20% denaturing
polyacrylamide (19:1 cross link) with 7M urea in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA, and the labeled reaction products
were visualized using the FMBIO-100 Image Analyzer (Hitachi). The
resulting image is shown in FIG. 84.
[1024] In FIG. 84, lanes 1 and 2 show the products of reactions
containing the HCV INVADER oligonucleotide and the longer probe
(oligo 42-088), without and with the target RNA present,
respectively. Lanes 3, 4, and 5 show the products of reactions
containing the INVADER oligonucleotide and the shorter probe (oligo
42-168-1). Lane 3 is a control reaction without target RNA present,
while lanes 4 and 5 have the target, but are without or with the
stacker oligonucleotide, respectively.
[1025] Under these conditions the slightly longer (16 nt) probe
oligonucleotide was cleaved quite easily without the help of a
stacker oligonucleotide. In contrast, the shorter probe (13 nt)
required the presence of the stacker oligonucleotide to produce
detectable levels of cleavage. These data show that the miniprobe
system of target detection by INVADER-directed cleavage is equally
applicable to the detection of RNA and DNA targets. In addition,
the comparison of the cleavage performance of longer and shorter
probes in the absence of a stacker oligonucleotide give one example
of the distinction between the performance of the miniprobe/stacker
system and the performance of the mid-range and long probes in the
detection of nucleic acid targets.
Example 40
Effect of an Unpaired 3' Tail on Transcription From a Complete
(Un-Nicked) Promoter
[1026] In designing the method of transcription-based visualization
of the products of INVADER-directed cleavage, it was first
necessary to assess the effect of a 3' tail on the efficiency of
transcription from a full length promoter. The duplexes tested in
this Example are shown at the bottom of FIG. 93, and are shown
schematically in FIGS. 85A-C.
[1027] Transcription reactions were performed using the
MEGAshortscript.TM. system from Ambion, Inc. (Austin, Tex.), in
accordance with the manufacturer's instructions with the exception
that a fluorescein labeled ribonucleotide was added. Each DNA
sample was assembled in 4 .mu.l of RNAse-free dH.sub.2O. Reactions
1-3 each contained 10 pmole of the copy template oligo 150 (SEQ ID
NO:123); reaction 2 contained 10 pmole of the promoter oligo 151
(SEQ ID NO:124); sample 3 contained 10 pmole of the 3' tailed
promoter oligo 073-065 (SEQ ID NO:125); sample 4 had no added DNA.
To each sample, 6 .mu.l of a solution containing 1 .mu.l of
10.times. Transcription Buffer, 7.5 mM each rNTP, 0.125 mM
fluorescein-12-UTP (Boehringer) and 1 .mu.l T7 MEGAshortscript.TM.
Enzyme Mix was added. The samples were then incubated at 37.degree.
C. for 1 hour. One microliter of RNase-free DNase 1 (2 U/.mu.l) was
added to each sample and the samples were incubated an additional
15 minutes at 37.degree. C. The reactions were then stopped by the
addition of 10 .mu.l of a solution of 95% formamide, 5 mM
Na.sub.2EDTA, with loading dyes. All samples were heated to
95.degree. C. for 2 minutes and 4 .mu.l of each sample were
resolved by electrophoresis through a 20% denaturing acrylamide gel
(19:1 cross-linked) with 7M urea, in a buffer containing 45 mM
Tris-Borate (pH 8.3), 1.4 mM EDTA. The gel was analyzed with a
FMBIO II fluorescence image analyzer, and the resulting image is
shown in FIG. 93. The RNA produced by successful transcription
appears near the middle of the panel, as indicated ("RNA").
[1028] Examination of the products of transcription shown in lanes
2 and 3 show that the presence of the 3' tail on the full-length
promoter has an adverse affect on the efficiency of transcription,
but does not shut it off completely. Because the objective of the
transcription-based visualization assays of the present invention
is to discriminate between uncleaved probe and the shorter products
of the invasive cleavage assay (cut probe), these data indicate
that production of a full-length promoter in the cleavage reaction
would be difficult to resolve from the background created by
transcription from promoters containing the uncleaved probe if no
other oligonucleotides were included in the assay. Means of
suppressing transcription from such a branched promoter are
discussed in the Description of the Invention and discussed below
in Ex. 43.
Example 41
Examination of the Influence of the Position of the Nick on the
Efficiency of Transcription From Partial and Complete Composite
Bacteriophage T7 Promoters
[1029] In the Description of the Invention, the procedure for
testing prospective promoter pieces for suitability in an invasive
cleavage-linked assay is described. One aspect of the test is to
examine the effect a chosen nick site has on the efficiency of
transcription from the final composite promoter. In addition, the
individual pieces of nicked promoter are tested for transcription
activity in the presence of the full-length un-nicked strand. In
this experiment, a comparison on these points is made between a
composite promoter having a nick in the non-template strand between
nucleotides -11 and -10 relative to the initiation site (+1), and a
promoter having a nick on the same strand, but positioned between
nucleotides -8 and -7. The Figure numbers for the schematic
representations of the contents of each reaction are indicated
below each lane (e.g., 85A=FIG. 85A). The site where the nick would
be in a fully assembled composite promoter using the reaction
oligonucleotides is also indicated below each lane ("-11/-10" and
"-8/-7").
[1030] Transcription reactions were performed using the
MEGAshortscript.TM. system, in accordance with the manufacturer's
instructions, but with the exception that a fluorescein labeled
ribonucleotide was added. Each DNA sample was assembled in 4 .mu.l
of RNAse-free dH.sub.2O. Reaction 1 had no added DNA. Reactions 2-9
each contained 10 pmole of the copy template oligo 150 (SEQ ID
NO:123). Reactions 3 and 4 contained 10 pmole of the -11 "cut"
probe (oligo 073-061-01; SEQ ID NO:127) or 20 pmole of the -10
partial promoter oligo 073-061-02 (SEQ ID NO:130), respectively,
and reaction 5 contained both. Reactions 6 and 7 contained either
the 10 pmole of the -8 "cut" probe (oligo 073-062-01; SEQ ID
NO:126) or 20 pmoles of the -7 partial promoter oligo 073-062-02
(SEQ ID NO:129), respectively, and reaction 8 contained them both.
Reaction 9 contained 10 pmole of the intact promoter oligo 151 (SEQ
ID NO:124).
[1031] The transcription reactions were initiated, incubated,
terminated and the reaction products were resolved and imaged as
described in Ex. 40. The resulting image is shown in FIG. 92. The
reaction numbers correspond to the lane numbers above the image.
The RNA created by successful transcription appears in the upper
third of the image. Comparison to the positive control reaction
(r.times.n. 9) shows that the full-length RNA produced by each of
the composite promoters is the same size as that produced in the
control reaction, indicated that transcription initiated at the
same site in each reaction.
[1032] In FIG. 92, lanes 3, 4, and 5 compare transcription from the
two species of partially assembled promoters (see schematics in
FIGS. 86A and B) and the fully assembled composite promoter (FIG.
88B) having a nick between nucleotides -11 and -10 relative to the
start of transcription. It can be seen from these data that neither
partial promoter (lanes 3 and 4) is able to support transcription
of the copy template, but that the composite promoter (lane 5) with
this nick site is strongly transcribed. Surprisingly, comparison to
the control reaction (lane 9) shows that the presence of a nick at
this site (-11/-10) actually enhances transcription. While not
limiting the present invention to any particular mechanism, it is
believed that the enhancement of transcription is a result of both
suppressing the formation of the shorter abortive transcripts and
by allowing greater accumulation of the full length product. This
result is highly reproducible.
[1033] In FIG. 92, lanes 6, 7, and 8 compare transcription a
similar set of partial and complete promoters in which the nick is
shifted 3 residues closer to the transcription start site.
Examination of lane 6 shows that the presence of 3 extra bases on
the -8"cut" probe (compared to the -11 "cut" probe in lane 3) allow
this partial promoter to initiate transcription. This indicates
that the -8/-7 site would be a poor choice for use in this
embodiment of the present invention.
[1034] This experiment demonstrates the process for determining the
suitable placement of a nick within a promoter assembly to achieve
the desired result. Similar tests can easily be designed for
testing other nicks within the bacteriophage T7 promoter tested in
this Example, or for testing suitable nick placement in any desired
phage, prokaryotic or eukaryotic promoter.
Example 42
Detection of the Products of INVADER-Directed Cleavage Through
Transcription from a Composite Promoter
[1035] The Examples described above indicate that a small
oligonucleotide can be used to complete assembly of a composite T7
promoter, thereby enabling transcription from that promoter.
Earlier Examples demonstrate that the invasive cleavage reaction
can be used release specific small oligonucleotide products from
longer probe oligonucleotides. In this Example, it is demonstrated
that these two observations can be combined, and that the products
of the invasive cleavage reaction can be used to complete a
promoter and enable subsequent transcription. The schematic
representations of the composite promoters tested in this Example
are shown in FIG. 88.
[1036] Two invasive cleavage reactions were set up, one without
(r.times.n. 1) and one with (r.times.n. 2) input target DNA. The
reactions (1 and 2) comprised 10 mM MOPS (pH 7.5), 0.05% Tween-20,
0.05% NP-40 and 20 pmoles probe oligo 073-067-01 (SEQ ID NO: 132)
and 10 pmoles INVADER oligo 073-073-02 (SEQ ID NO:134) in a volume
of 14 .mu.l. Reaction 2 also included 100 fmoles M13mp18 ssDNA. The
samples were placed at 60.degree. C. and 6 .mu.l of a solution
containing 20 ng of Mja FEN-1 and 40 mM Mg.sub.2Cl were added to
each sample to start the reactions. The samples were incubated at
60.degree. C. for 30 minutes and stopped by the addition of 3 .mu.l
of 2.5M NaOAc, 83 mM Na.sub.2EDTA (pH 8.0). Each sample was
transferred to a 1.5 ml microcentrifuge tube and then the DNAs were
precipitated by the addition of 60 .mu.l of chilled 100% ethanol,
and were stored at -20.degree. C. for 20 minutes. The pellets were
collected by microcentrifugation, washed once with 80% ethanol to
remove excess salt, then dried under vacuum. The product of this
invasive cleavage reaction is a 12 nt oligonucleotide having the
sequence: 5'-CGAAATTAATAC-3' (SEQ ID NO:128), termed the -12 cut
probe (same sequence as oligo 073-073-03).
[1037] For transcription, the dried samples were each dissolved in
4 .mu.l of a solution containing 1 pmole copy template oligo 150
and 2 pmoles -11 partial promoter oligo 073-073-012 (SEQ ID
NO:131). Control samples 3 and 4 each contained 1 pmole of the copy
template oligo 150; sample 3 also contained 1 pmole probe oligo
073-067-01 (SEQ ID NO:132) and 2 pmoles -11 partial promoter oligo
073-073-012 (see structure 88A); sample 4 contained 1 pmole -12
"cut" probe oligo 073-073-03 (SEQ ID NO:128) and 2 pmoles -11
partial promoter oligo 073-073-012 (see structure 88B). These are
the structures that would be expected to exist in the transcription
reactions from the two invasive cleavage reactions described
above.
[1038] The transcription reactions were initiated, incubated,
terminated and the products were resolved and imaged as described
in Ex. 40. The resulting image is shown in the right half of FIG.
89 (lanes 6-9). Samples 3 and 4 appear in lanes 6 and 7,
respectively, and the reactions 1 and 2 from the invasive cleavage
reaction products (indicated by the use of the lower case "i"),
appear in lanes 8 and 9, respectively. The number of the Fig.
showing the schematic representation of the expected promoter
structure in each reaction is indicated above each lane, and the
placement of the nick is also indicated. The uppercase letters
indicate which structure in the particular Figure to examine for
each reaction. The lowercase "i" above lanes 8 and 9 indicate that
these transcriptions were derived from actual invasive cleavage
reactions. These products are compared to the RNA produced in the
control reaction in lane 5, the procedure for which is described in
Ex. 44. The RNA created by successful transcription appears in the
upper third of the panel (indicated by "RNA").
[1039] The reaction shown in lane 6 shows no transcription. This
demonstrates that a nick between nucleotides -12 and -11 in the
on-template strand of the T7 promoter eliminates transcription if
the promoter is assembled from uncut probe such as the 3' end of
the probe forms a branch within the promoter sequence. This is in
contrast to the results seen with the -11/-10 nick examined below.
Further, the transcript apparent in lane 7 shows that an unbranched
promoter with a nick at the same site (-12/-11) produces the
correct RNA, with few abortive initiation products (see lanes 2 and
5 of FIG. 89, described in Ex. 44). The reactions in lanes 8 and 9
demonstrate that the same effect is observed when the invasive
cleavage reaction is the sole source of the upstream piece (-12 cut
probe) of the T7 promoter. It is worthy of note that the promoter
that is transcribed in lane 8 is made complete by the presence of 1
pmole of a synthetic "cut" probe oligo, without any uncut probe in
the mixture, while the promoter that is transcribed in lane 9 is
completed by the product of an invasive cleavage reaction that had
only 100 fmole of target DNA in it. This reaction also included the
residual uncut probe (up to approx. 10 pmoles), which may compete
for binding at the same site. Nonetheless, the transcriptions from
the invasive cleavage reaction products are only slightly reduced
in efficiency, and are just as free of background as is the "no
target" sample (lane 8). This Example clearly demonstrates that the
cleavage products from the invasive cleavage reaction can be used
in combination with a partial promoter oligo to promote the
production of RNA, without background transcription generated by
the presence of the uncut probe. This RNA product is clearly
dependent on the presence of the target material in the invasive
cleavage reaction.
Example 43
Shutting Down Transcription from a "Leaky" Branched T7 Composite
Promoter Through the Use of a Downstream Partial Promoter
Oligonucleotide having a 5' Tail
[1040] The previous Example demonstrated that placement of a nick
in the non-template strand of a bacteriophage T7 promoter between
the -12 and -11 nucleotides, relative to the transcription start
site, prevents transcription of the branched promoter while
allowing transcription when the composite promoter is assembled
using the cut probe. When the nick is placed in other locations in
the T7 promoter, transcription may be initiated from either
promoter, although it is usually less efficient from the branched
promoter. This Example demonstrates that the addition of a 5' tail
that can base pair to the uncut probe (FIG. 90A) to the downstream
partial promoter piece effectively blocks transcription from that
promoter, but does not prevent transcription when a cut probe
completes the promoter (FIG. 90B).
[1041] Two invasive cleavage reactions were set up, one without
(r.times.n. 7) and one with (r.times.n. 8) input target DNA. The
reactions (7 and 8) comprised 10 mM MOPS (pH 7.5), 0.05% Tween-20,
0.05% NP-40 and 20 pmoles probe oligo 073-067-01 (SEQ ID NO:132)
and 10 pmoles INVADER oligo 073-067-02 (SEQ ID NO:133) in a volume
of 14 .mu.l. Reaction 8 also included 100 fmoles M13mp18 ssDNA. The
samples were placed at 60.degree. C. and 6 .mu.l of a solution
containing 20 ng of Mja FEN-1 and 40 mM Mg.sub.2Cl were added to
each sample to start the reactions. The samples were incubated at
60.degree. C. for 30 minutes and then stopped by the addition of 3
.mu.l of 2.5M NaOAc, 83 mM Na.sub.2EDTA (pH 8.0). Each sample was
transferred to a 1.5 ml microcentrifuge tube and the DNAs were
precipitated, washed and dried as described in Ex. 42. The product
of this invasive cleavage reaction is 13 nt oligonucleotide
sequence, 5'-CGAAATTAATACG-3' (SEQ ID NO:127), termed the -11 cut
probe (same sequence as oligo 073-061-01 which is referred to as
the -11 "cut" probe to indicate it was not generated in an invasive
cleavage reaction).
[1042] In the transcription reactions, all of the DNAs were
dissolved in 4 .mu.l of RNase-free dH.sub.2O. Sample 1 had no added
DNA, samples 2-8 contained 1 pmole of the copy template oligo 150
(SEQ ID NO:123). In addition, sample 3 contained 1 pmole of -11
"cut" probe oligo 073-061-01 (SEQ ID NO:127) and 2 pmoles of -10
partial promoter oligo 073-061-02 (SEQ ID NO:130), sample 4
contained 1 pmole of probe oligo 073-067-01 and 2 pmoles of -10
partial promoter oligo 073-061-02. Control sample 5 contained 1
pmole of probe oligo 073-067-01 and 2 pmoles of partial promoter
w/5' tail oligo 073-074 (5'-TACTGACTCACTATAGGGTCTTCTATGGAG GTC-3'
(SEQ ID NO:146) (see structure in FIG. 90A) and sample 6 contained
1 pmole of -11 "cut" probe oligo 073-061-01 and 2 pmoles of partial
promoter w/5' tail oligo 073-074 (see structure in FIG. 90B). These
are the structures (i.e., 90A and 90B) that would be expected to
exist in the transcription reactions from the two invasive cleavage
reactions described above.
[1043] The dried samples 7 and 8 from the invasive cleavage (above)
were each dissolved in 4 .mu.l of dH.sub.2O containing 1 pmole copy
template oligo 150 and 2 pmoles partial promoter w/5' tail oligo
073-074. The transcription reactions were initiated, incubated,
terminated and the reaction products were resolved and imaged as
described in Ex. 40. The resulting image is shown in FIG. 91.
[1044] In FIG. 91 the lane numbers correspond to the sample
numbers; the number of the Figure showing the schematic
representation of the expected promoter structure in each reaction
is indicated above each lane ("88" and "90"), and the placement of
the nick is also indicated ("-11/-10"). The upper-case letters
indicate which structure in the particular Figure to examine for
each reaction. The lower case "i" above lanes 7 and 8 indicates
that these transcriptions were derived from actual invasive
cleavage reactions. The RNA created by successful transcription
appears in the upper third of the panel, as indicated ("RNA").
[1045] The control reactions in lanes 1 and 2, having either no DNA
or having the only the copy template, produced no RNA as expected.
The product in lane 4 demonstrates that the branched T7 promoter
with a nick in the non-template strand between nucleotides -11 and
-10 can support transcription, albeit not as efficiently as the
un-branched promoter with the nick at the same site (lane 3).
Examination of lane 5 shows that the use of a partial promoter
oligonucleotide with a short 5' tail that can basepair to the uncut
probe as depicted in FIG. 90A, effectively suppresses this
transcription but allows transcription when the probe does not have
a 3' tail (lane 6; schematic FIG. 90B). The reactions in lanes 7
and 8 demonstrate that the same effect as observed when the
invasive cleavage reaction is the sole source of the upstream piece
(-11 cut probe, SEQ ID NO:127) of the T7 promoter. It is worthy of
note that the promoter that is transcribed in sample 6 is made
complete by the presence of 1 pmole of a synthetic "cut probe",
without any uncut probe in the mixture, while the promoter that is
transcribed in sample 8 is completed by the product of an invasive
cleavage reaction that had only 100 fmole of target DNA in it. This
reaction also included the residual uncut probe (up to
approximately 19 pmoles), which may compete for binding at the same
site. Nonetheless, the transcriptions from the invasive cleavage
reaction products are just as strong and just as free of background
in the "no target" samples.
[1046] This Example clearly demonstrates that the cleavage products
from the invasive cleavage reaction can be used in combination with
a partial promoter oligonucleotide having a 5' tail to promote the
production of RNA, without background transcription generated by
the uncut probe. This RNA product is clearly dependent on the
presence of the target material in the invasive cleavage
reaction.
Example 44
Creation of a Complete Bacteriophage T7 Promoter by DNA
Polymerase-Mediated Extension of a Cut Probe Comprising a Partial
T7 Promoter
[1047] As demonstrated in the Examples above, transcription cannot
occur from the T7 promoter unless a complete promoter region is
present. In the above Examples, a complete promoter containing a
nick in one strand was created by annealing a cut probe generated
from an invasive cleavage reaction to a copy template that was
annealed to a partial promoter oligo. An alternative means of
creating a complete promoter in a manner dependent upon detection
of a target sequence in an invasive cleavage reaction is to anneal
the cut probe to a copy template devoid of a partial promoter
oligo. The 3'-OH present at the end of the annealed cut probe is
then extended by a DNA polymerase to create a complete and
un-nicked promoter that is transcription-competent.
[1048] In this Example, the promoter was made complete through the
use of primer extension, rather that by the co-hybridization of
another oligonucleotide. The reaction steps are diagrammed
schematically in FIG. 87. Two invasive cleavage reactions were set
up, one without (r.times.n. 1) and one with (r.times.n. 2) input
target DNA. The reactions (1 and 2) comprised 10 mM MOPS (pH 7.5),
0.05% Tween-20, 0.05% NP-40 and 20 pmoles probe oligo 073-067-01
(SEQ ID NO:132) and 10 pmoles INVADER oligo 073-073-02 (SEQ ID
NO:134) in a volume of 14 .mu.l. Reaction 2 also included 100
fmoles M13mp18 ssDNA. The samples were placed at 60.degree. C. and
6 .mu.l of a solution containing 20 ng of Mja FEN-1 and 40 mM
Mg.sub.2Cl were added to each sample to start the reactions. The
samples were incubated at 60.degree. C. for 30 minutes and stopped
by the addition of 3 .mu.l of 2.5M NaOAc, 83 mM Na.sub.2EDTA (pH
8.0). Each sample was transferred to a 1.5 ml microcentrifuge tube
and then the DNAs were precipitated, washed and dried as described
in Ex. 42. The product of this invasive cleavage reaction is the 12
nt oligonucleotide sequence: 5'-CGAAATTAATAC-3' (SEQ ID NO:128),
termed the -12 cut probe (same sequence as oligo 073-073-03 which
is referred to as the -12 "cut" probe to indicate it was not
generated in an invasive cleavage reaction).
[1049] To allow extension of these products using a
template-dependent DNA polymerase, a 20 .mu.l solution containing
20 mM Tris-HCl (pH 8.5), 1.5 mM Mg.sub.2Cl, 50 mM KCl, 0.05%
Tween-20, 0.05% NP-40, 25 .mu.M each dNTP, 0.25 units Taq DNA
polymerase (Boehringer) and 2 .mu.M copy template oligo 150 (SEQ ID
NO:123) was added to each of the dried cleavage samples. The
samples were incubated at 30.degree. C. for 1 hr. The primer
extension reactions were stopped by the addition of 3 .mu.l of 2.5M
NaOAc with 83 mM Na.sub.2EDTA (pH 8.0)/sample. Each sample was
transferred to a 1.5 ml microcentrifuge tube and the DNAs were
precipitated, washed and dried as described in Ex. 42.
[1050] Samples 1 and 2 were then dissolved in 4 .mu.l RNase-free
dH.sub.2O, Samples 3, 4 and 5 are control reactions: sample 3 was 4
.mu.l of RNase-free dH.sub.2O without added DNA, sample 4 contained
1 pmole of the copy template oligo 150 (SEQ ID NO:123) in 4 .mu.l
of RNase-free dH.sub.2O, and sample 5 contained 1 pmole of the same
copy template and 1 pmole of the complete promoter oligo 151 (SEQ
ID NO:124) in RNase-free dH.sub.2O.
[1051] Transcription reactions were performed using the
MEGAshortscript.TM. system, in accordance with the manufacturer's
instructions, but with the addition of a fluorescein labeled
ribonucleotide. To each sample, 6 .mu.l of a solution containing 1
.mu.l of 10.times. Transcription Buffer, 7.5 mM each rNTP, 0.125 mM
fluorescein-12-UTP (Boehringer) and 1 .mu.l T7 MEGAshortscript.TM.
Enzyme Mix was added. The samples were incubated at 37.degree. C.
for 1 hour. One .mu.l of RNase-free DNase 1 (2 U/.mu.l) was added
to each sample and they were incubated an additional 15 minutes at
37.degree. C. The reactions were stopped by the addition of 10
.mu.l of a solution of 95% formamide, 5 mM NaEDTA, with loading
dyes. All samples were heated to 95.degree. C. for 2 minutes and
four .mu.l of each sample were resolved by electrophoresis through
a 20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea,
in a buffer containing 45 mM Tris-Borate (pH 8.3), 1.4 mM EDTA. The
results were imaged using the Molecular Dynamics Fluoroimager 595,
with excitation at 488 nm and, emission detected at 530 nm.
[1052] The resulting image is shown in lanes 1 through 5 of FIG.
89; the lane numbers correspond to the sample numbers. The Figure
numbers corresponding to the schematic representations of the
promoters transcribed in each reaction as indicated above the
lanes. The RNA product from successful transcription appears in the
upper third of the panel, as indicated ("RNA"). Unincorporated
labeled nucleotide appears as a dense signal near the bottom
("NTPs"). Short transcription products caused by aborted initiation
events (Milligan and Uhlenbeck, Methods Enzymol., 180:51 [1989])
appear as bands just above the free nucleotide in the lanes showing
active transcription (i.e., lanes 2 and 5).
[1053] It can clearly be seen from the data in lanes 1 and 2 that
the transcription is dependent on the presence of the target
material in the invasive cleavage reaction. It is shown elsewhere
(see lane 3, FIG. 92) that the product of the cleavage reaction is
not in itself sufficient to allow transcription from the copy
template. Thus, the action of the DNA polymerase in extending the
hybridized cut probe across the promoter is a necessary step in
enabling the transcription in this embodiment. These data clearly
demonstrate that both template-dependent extension by DNA
polymerase, and extension followed by transcription are suitable
methods of visualizing the products of the invasive cleavage assay.
As discussed in the Description of the Invention, the products of
thermal breakdown that possess 3' terminal phosphates would not be
extended, and would thus be precluded from contributing to
background transcription.
Example 45
Test for the Dependence of an Enzyme on the Presence of an Upstream
Oligonucleotide
[1054] When choosing a structure-specific nuclease for use in a
sequential invasive cleavage reaction it is preferable that the
enzyme have little ability to cleave a probe 1) in the absence of
an upstream oligonucleotide, and 2) in the absence of overlap
between the upstream oligonucleotide and the downstream labeled
probe oligonucleotide. FIGS. 99a-e depicts the several structures
that can be used to examine the activity of an enzyme that is
confronted with each of these types of structures. The structure a
(FIG. 99a) shows the alignment of a probe oligonucleotide with a
target site on bacteriophage M13 DNA (M13 sequences shown in FIG.
99 are provided in SEQ ID NO:163) in the absence of an upstream
oligonucleotide. Structure b (FIG. 99b) is provided with an
upstream oligonucleotide that does not contain a region of overlap
with the labeled probe (the label is indicated by the star). In
structures c, d and e (FIGS. 99c-e) the upstream oligonucleotides
have overlaps of 1, 3 or 5 nucleotides, respectively, with the
downstream probe oligonucleotide and each of these structures
represents a suitable invasive cleavage structure. The enzyme Pfu
FEN-1 was tested for activity on each of these structures and all
reactions were performed in duplicate.
[1055] Each reaction comprised 1 .mu.M 5' TET labeled probe
oligonucleotide 89-15-1 (SEQ ID NO:152), 50 nM upstream
oligonucleotide (either oligo 81-69-2 [SEQ ID NO:153], oligo
81-69-3 [SEQ ID NO:154], oligo 81-69-4 [SEQ ID NO:155], oligo
81-69-5 [SEQ ID NO:156], or no upstream oligonucleotide), 1 fmol
M13 target DNA, 10 mg/ml tRNA and 10 ng of Pfu FEN-1 in 10 .mu.l of
10 mM MOPS (pH 7.5), 7.5 mM MgCl.sub.2 with 0.05% each of Tween 20
and Nonidet P-40.
[1056] All of the components except the enzyme and the MgCl.sub.2
were assembled in a final volume of 8 .mu.l and were overlaid with
10 .mu.l of Chill-Out.TM. liquid wax. The samples were heated to
the reaction temperature of 69.degree. C. The reactions were
started by the addition of the Pfu FEN-1 and MgCl.sub.2, in a 2
.mu.l volume. After incubation at 69.degree. C. for 30 minutes, the
reactions were stopped with 10 .mu.l of 95% formamide, 10 mM EDTA,
0.02% methyl violet. Samples were heated to 90.degree. C. for 1 min
immediately before electrophoresis through a 20% denaturing
acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of
45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then analyzed
with a FMBIO-100 Hitachi FMBIO fluorescence imager. The resulting
image is displayed in FIG. 100.
[1057] In FIG. 100, lanes labeled "a" contain the products
generated from reactions conducted without an upstream
oligonucleotide (structure a), lanes labeled "b" contain an
upstream oligonucleotide that does not invade the probe/target
duplex (structure b). Lanes labeled "c", "d" and "e" contain the
products generated from reactions conducted using an upstream
oligonucleotide that invades the probe/target duplex by 1, 3 or 5
bases, respectively. The size (in nucleotides) of the uncleaved
probe and the cleavage products is indicated to the left of the
image in FIG. 100.
[1058] As shown in FIG. 100, cleavage of the probe was not
detectable when structures a and b were utilized. In contrast,
cleavage products were generated when invasive cleavage structures
were utilized (structures c-e). These data show that the Pfu FEN-1
enzyme requires an overlapping upstream oligonucleotide for
specific cleavage of the probe.
[1059] Any enzyme may be examined for its suitability for use in a
sequential invasive cleavage reaction by examining the ability of
the test enzyme to cleave structures a-e (it is understood by those
in the art that the specific oligonucleotide sequences shown in
FIGS. 99a-e need not be employed in the test reactions; these
structures are merely illustrative of suitable test structures).
Desirable enzymes display little or no cleavage of structures a and
b and display specific cleavage of structures c-e (i.e., they
generate cleavage products of the size expected from the degree of
overlap between the two oligonucleotides employed to form the
invasive cleavage structure).
Example 46
Use of the Products of a First Invasive Cleavage Reaction to Enable
a Second Invasive Cleavage Reaction with a Net Gain in
Sensitivity
[1060] As discussed in the Description of The Invention above, the
detection sensitivity of the invasive cleavage reaction can be
increased by the performing a second round of invasive cleavage
using the products of the first reaction to complete the cleavage
structure in the second reaction (shown schematically in FIG. 96).
In this Example, the use of a probe that, when cleaved in a first
invasive cleavage reaction, forms an integrated INVADER oligo and
target molecule for use in a second invasive cleavage reaction, is
illustrated (shown schematically in FIG. 97).
[1061] A first probe was designed to contain some internal
complementarity so that when cleaved in a first invasive cleavage
reaction the product ("Cut Probe 1") could form a target strand
comprising an integral INVADER oligonucleotide, as depicted in FIG.
97. A second probe was provided in the reaction that would be
cleaved at the intended site when hybridized to the newly formed
target/INVADER (FIG. 97). To demonstrate the gain in signal due to
the performance of sequential invasive cleavages, a standard
invasive cleavage assay, as described above, was performed in
parallel.
[1062] All reactions were performed in duplicate. Each standard
(i.e., non-sequential) invasive cleavage reaction comprised 1 .mu.M
5' fluorescein-labeled probe oligo 073-182 (5'
Fl-AGAAAGGAAGGGAAGAAAGCGAA-3'; SEQ ID NO:157), 10 nM upstream oligo
81-69-4 (5'-CTTGACGGGGAAAGCCGGCGAACGTGGCGA-3'; SEQ ID NO:155), 10
to 100 attomoles of M13 target DNA, 10 mg/ml tRNA and 10 ng of Pfu
FEN-1 in 10 .mu.l of 10 mM MOPS (pH 7.5), 8 mM MgCl.sub.2 with
0.05% each of Tween 20 and Nonidet P-40. All of the components
except the enzyme and the MgCl.sub.2 were assembled in a volume of
7 .mu.l and were overlaid with 10 .mu.l of Chill-Out.TM. liquid
wax. The samples were heated to the reaction temperature of
62.degree. C. The reactions were started by the addition of the Pfu
FEN-1 and MgCl.sub.2, in a 2 .mu.l volume. After incubation at
62.degree. C. for 30 minutes, the reactions were stopped with 10
.mu.l of 95% formamide, 10 mM EDTA, 0.02% methyl violet.
[1063] Each sequential invasive cleavage reaction comprised 1 .mu.M
5' fluorescein-labeled oligonucleotide 073-191 (the first probe or
"Probe 1", 5' Fl-TGGAGGTCAAAACATCG ATAAGTCGAAGAAAGGAAGGGAAGAAAT-3';
SEQ ID NO:158), 10 nM upstream oligonucleotide 81-69-4
(5'-CTTGACGGGGAAA GCCGGCGAACGTGGCGA-3'; SEQ ID NO:155), 1 .mu.M of
5' fluorescein labeled oligonucleotide 106-32 (the second probe or
"Probe 2", 5' Fl-TGTTTTGACCT CCA-3'; SEQ ID NO:159), 1 to 100 amol
of M13 target DNA, 10 mg/ml tRNA and 10 ng of Pfu FEN-1 in 10 .mu.l
of 10 mM MOPS (pH 7.5), 8 mM MgCl.sub.2 with 0.05% each of Tween 20
and Nonidet P-40. All of the components except the enzyme and the
MgCl.sub.2 were assembled in a volume of 8 .mu.l and were overlaid
with 10 .mu.l of Chill-Out.TM. liquid wax. The samples were heated
to the reaction temperature of 62.degree. C. (this temperature is
the optimum temperature for annealing of Probe 1 to the first
target). The reactions were started by the addition of Pfu FEN-1
and MgCl.sub.2, in a 2 .mu.l volume. After incubation at 62.degree.
C. for 15 minutes, the temperature was lowered to 58.degree. C.
(this temperature is the optimum temperature for annealing of Probe
2 to the second target) and the samples were incubated for another
15 min. Reactions were stopped by the addition of 10 .mu.l of 95%
formamide, 20 mM EDTA, 0.02% methyl violet.
[1064] Samples from both the standard and the sequential invasive
cleavage reactions were heated to 90.degree. C. for 1 min
immediately before electrophoresis through a 20% denaturing
acrylamide gel (19:1 cross-linked), with 7 M urea, in a buffer of
45 mM Tris-Borate, pH 8.3, 1.4 mM EDTA. The gel was then analyzed
with a Molecular Dynamics FluorImager 595. The resulting image is
displayed in FIG. 101a. A graph showing measure of fluorescence
intensity for each of the product bands is shown in FIG. 101b.
[1065] In FIG. 101a, lanes 1-5 contain the products generated in
standard invasive cleavage reactions that contained either no
target (lane 1), 10 amol of target (lanes 2 and 3) or with 100 amol
of target (lanes 4 and 5). The uncleaved probe is seen as a dark
band in each lane about half way down the panel and the cleavage
products appear as a smaller black band near the bottom of the
panel, the position of the cleavage product is indicated by an
arrow head to the left of FIG. 101a. The gray ladder of bands seen
in lanes 1-5 is due to the thermal degradation of the probe as
discussed above and is not related to the presence or absence of
the target DNA. The remaining lanes display products generated in
sequential invasive cleavage reactions that contained 1 amol of
target (lanes 6 and 7), 10 amol of target (lanes 8 and 9) and 100
amol of target (lanes 10 and 11). The uncleaved first probe (Probe
1; labeled "1 uncut") is seen near the top of the panel, while the
cleaved first probe is indicated as "1: cut". Similarly, the
uncleaved and cleaved second probe are indicated as "2: uncut" and
2: cut," respectively.
[1066] The graph shown in FIG. 101b compares the amount of product
generated from the standard reaction ("Series 1") to the amount of
product generated from the second step of the sequential reaction
("Series 2"). The level of background fluorescence measured from a
reaction that lacked target DNA was subtracted from each
measurement. It can be seen from the table located below the graph
that the signal from the standard invasive cleavage assay that
contained 100 attomoles of target DNA was nearly identical to the
signal from the sequential invasive cleavage assay in which 1
attomole of target was present, indicating that the inclusion of a
second cleavage structure increases the sensitivity of the assay
100 to 200-fold. This boost in signal allows easy detection of
target nucleic acids at the sub attomole level using the sequential
invasive cleavage assay, while the standard assay, when performed
using this enzyme for only 30 minutes, does not generate detectable
product in the presence of 10 attomoles of target.
[1067] When the amount of target was decreased by 10 or 100 fold in
the sequential invasive cleavage assay, the intensity of the signal
was decreased by the same proportion. This indicates that the
quantitative capability of the invasive cleavage assay is retained
even when reactions are performed in series, thus providing a
nucleic acid detection method that is both sensitive and
quantitative.
[1068] While in this Example, the two probes used had different
optimal hybridization temperatures (i.e., the temperature
empiracally determined to give the greatest turnover rate in the
given reaction conditions), the probes may also be selected (i.e.,
designed) to have the same optimal hybridization temperature so
that a temperature shift during incubation is not necessary.
Example 47
The Products of a Completed Sequential Invasive Cleavage Reaction
Cannot Cross Contaminate Subsequent Similar Reactions
[1069] As discussed in the Description of the Invention, the serial
nature of the multiple invasive cleavage events that occur in the
sequential invasive cleavage reaction, in contrast to the
reciprocating nature of the polymerase chain reaction and similar
doubling assays, means that the sequential invasive cleavage
reaction is not subject to contamination by the products of like
reactions because the products of the first cleavage reaction do
not participate in the generation of new signal in the second
cleavage reaction. If a large amount of a completed reaction were
to be added to a newly assembled reaction, the background that
would be produced would come from the amount of target that was
also carried in, combined with the amount of already-cleaved probe
that was carried in. In this Example, it is demonstrated that a
very large portion of a primary reaction must be introduced into
the secondary reaction to create significant signal.
[1070] A first or primary sequential invasive cleavage reaction was
performed as described above using 100 amol of target DNA. A second
set of 5 reactions were assembled as described in Ex. 46 with the
exception that portions of the first reaction were introduced and
no additional target DNA was included. These secondary reactions
were initiated and incubated as described above, and included 0,
0.01, 0.1, 1, or 10% of the first reaction material. A control
reaction including 100 amol of target was included in the second
set also. The reactions were stopped, resolved by electrophoresis
and visualized as described above, and the resulting image is
displayed in FIG. 102. The primary probe, uncut second probe and
the cut 2nd probe are indicated on the left as "1: cut", 2: uncut"
and 2: cut", respectively.
[1071] In FIG. 102, lane 1 shows the results of the first reaction
with the accumulated product at the bottom of the panel, and lane 2
show a 1:10 dilution of the same reaction, to demonstrate the level
of signal that could be expected from that level of contamination,
without further amplification. Lanes 3 through 7 show the results
of the secondary cleavage reactions that contained 0, 0, 1, 0.1 or
0.01% of the first reaction material added as contaminant,
respectively and lane 8 shows a control reaction that had 100 amol
of target DNA added to verify the activity of the system in the
secondary reaction. The signal level in lane 4 is as would be
expected when 10% of the pre-cleaved material is transferred (as in
lane 2) and 10% of the transferred target material from the lane 1
reaction is allowed to further amplify. At all levels of further
dilution the signal is not readily distinguished from background.
These data demonstrate that while a large-scale transfer from one
reaction to another may be detectable, cross contamination by the
minute quantities that would be expected from aerosol or from
equipment contamination would not be easily mistaken for a false
positive result. These data also demonstrate that when the products
of one reaction are deliberately carried over into a fresh sample,
these products do not participate in the new reaction, and thus do
not affect the level of target-dependent signal that may be
generated in that reaction.
Example 48
Detection of Human Cytomegalovirus Viral DNA by Invasive
Cleavage
[1072] The previous Example demonstrates the ability of the
invasive cleavage reaction to detect minute quantities of viral DNA
in the presence of human genomic DNA. In this Example, the probe
and INVADER oligonucleotides were designed to target the 3104-3061
region of the major immediate early gene of human cytomegalovirus
(HCMV) as shown in FIG. 103. In FIG. 103, the INVADER oligo (89-44;
SEQ ID NO:160) and the fluorescein (Fl)-labeled probe oligo (89-76;
SEQ ID NO:161) are shown annealed along a region of the HCMV genome
corresponding to nucleotides 3057-3110 of the viral DNA (SEQ ID
NO:162). The probe used in this Example is a poly-pyrimidine probe
and as shown herein the use of a poly-pyrimidine probe reduces
background signal generated by the thermal breakage of probe
oligos.
[1073] The genomic viral DNA was purchased from Advanced
Biotechnologies, Incorporated (Columbia, Md.). The DNA was
estimated (but not certified) by personnel at Advanced
Biotechnologies to be at a concentration of 170 amol
(1.times.10.sup.8 copies) per microliter. The reactions were
performed in quadruplicate. Each reaction comprised 1 .mu.M 5'
fluorescein labeled probe oligonucleotide 89-76 (SEQ ID NO:161),
100 nM INVADER oligonucleotide 89-44 (SEQ ID NO:160), 1 ng/ml human
genomic DNA, and one of five concentrations of target HCMV DNA in
the amounts indicated above each lane in FIG. 104, and 10 ng of Pfu
FEN-1 in 10 .mu.l of 10 mM MOPS (pH 7.5), 6 mM MgCl.sub.2 with
0.05% each of Tween 20 and Nonidet P-40. All of the components
except the labeled probe, enzyme and MgCl.sub.2 were assembled in a
final volume of 7 .mu.l and were overlaid with 10 .mu.l of
Chill-Out.TM. liquid wax. The samples were heated to 95.degree. C.
for 5 min, then reduced to 62.degree. C. The reactions were started
by the addition of probe, Pfu FEN-1 and MgCl.sub.2, in a 3 .mu.l
volume. After incubation at 62.degree. C. for 60 minutes, the
reactions were stopped with 10 .mu.l of 95% formamide, 10 mM EDTA,
0.02% methyl violet. Samples were heated to 90.degree. C. for 1 min
immediately before electrophoresis through a 20% acrylamide gel
(19:1 cross-linked), with 7 M urea, in a buffer of 45 mM
Tris-Borate, pH 8.3, 1.4 mM EDTA. Gels were then analyzed with a
Molecular Dynamics FluorImager 595.
[1074] The resulting image is displayed in FIG. 104. The replicate
reactions were run in groups of four lanes with the target HCMV DNA
content of the reactions indicated above each set of lanes (0-170
amol). The uncleaved probe is seen in the upper third of the panel
("Uncut 89-76") while the cleavage products are seen in the lower
two-thirds of the panel ("Cut 89-76"). It can be seen that the
intensity of the accumulated cleavage product is proportional to
the amount of the target DNA in the reaction. Furthermore, it can
be clearly seen in reactions that did not contain target DNA ("no
target") that the probe is not cleaved, even in a background of
human genomic DNA. While 10 ng of human genomic DNA was included in
each of the reactions shown in FIG. 104, inclusion of genomic DNA
up to 200 ng has slight impact on the amount of product
accumulated. The data did not suggest that 200 ng per 10 .mu.l of
reaction mixture represented the maximum amount of genomic DNA that
could be tolerated without a significant reduction in signal
accumulation. For reference, this amount of DNA exceeds what might
be found in 0.2 ml of urine (a commonly tested amount for HCMV in
neonates) and is equivalent to the amount that would be found in
about 5 .mu.l of whole blood.
[1075] These results demonstrate that the standard (i.e.,
non-sequential) invasive cleavage reaction is a sensitive, specific
and reproducible means of detecting viral DNA. It can also be seen
from these data that the use of a poly-pyrimidine probe reduces the
background from thermal breakage of the probe, as discussed in
Example 22. Detection of 1.7 amol of target is roughly equivalent
to detection of 106 copies of the virus. This is equivalent to the
number of viral genomes that might be found in 0.2 mls of urine
from a congenitally infected neonate (102 to 106 genome equivalents
per 0.2 mls; Stagno et al., J. Infect. Dis., 132:568 [1975]). Use
of the sequential invasive cleavage assay would permit detection of
even fewer viral DNA molecules, facilitating detection in blood (10
to 105 viral particles per ml; Pector et al., J. Clin. Microbiol.,
30:2359 [1992]), which carries a much larger amount of heterologous
DNA.
[1076] From the above it is clear that the invention provides
reagents and methods to permit the detection and characterization
of nucleic acid sequences and variations in nucleic acid sequences.
The INVADER-directed cleavage reaction and the sequential
INVADER-directed cleavage reaction of the present invention provide
ideal direct detection methods that combine the advantages of the
direct detection assays (e.g., easy quantification and minimal risk
of carry-over contamination) with the specificity provided by a
dual or tri oligonucleotide hybridization assay.
[1077] As indicated in the Description of the Invention, the use of
sequential invasive cleavage reactions can present the problem of
residual uncut first, or primary, probe interacting with the
secondary target, and either competing with the cut probe for
binding, or creating background through low level cleavage of the
resulting structure. This is shown diagramatically in FIGS. 105 and
106. In FIG. 105, the reaction depicted makes use of the cleavage
product from the first cleavage structure to form an INVADER
oligonucleotide for a second cleavage reaction. The structure
formed between the secondary target, the secondary probe and the
uncut primary probe is depicted in FIG. 105, as the right hand
structure shown in step 2a. This structure is recognized and
cleaved by the 5' nucleases, albeit very inefficiently (i.e., at
less than about 1% in most reaction conditions). Nonetheless, the
resulting product is indistinguishable from the specific product,
and thus may lead to a false positive result. The same effect can
occur when the cleaved primary probe creates and integrated
INVADER/target (IT) molecule, as described in Example 46; the
formation of the undesirable complex is depicted schematically in
FIG. 106, as the right hand structure shown in step 2a.
[1078] The improvements provided by the inclusion of ARRESTOR
oligonucleotides of various compositions in each of these types of
sequential INVADER assays are demonstrated in the following
Examples. These ARRESTOR oligonucleotides are configured to bind
the residual uncut probe from the first cleavage reaction in the
series, thereby increasing the efficacy of and reducing the
non-specific background in the subsequent reaction(s).
Example 49
"ARRESTOR" Oligonucleotides Improve Sensitivity of Multiple
Sequential Invasive Cleavage Assays
[1079] In this Example, the effect of including an ARRESTOR
oligonucleotide on the generation of signal using the IT probe
system depicted in FIGS. 97 and 106 is demonstrated. The ARRESTOR
oligonucleotide hybridizes to the primary probe, mainly in the
portion that recognizes the target nucleic acid during the first
cleavage reaction. In addition to examining the effects of adding
an ARRESTOR oligonucleotide, the effects of using ARRESTOR
oligonucleotides that extended in complementarity different
distances into the region of the primary probe that composes the
secondary IT structure were also investigated. These effects were
compared in reactions that included the target DNA over a range of
concentrations, or that lacked target DNA, in order to demonstrate
the level of nonspecific (i.e., not related to target nucleic acid)
background in each set of reaction conditions.
[1080] The target DNA for these reactions was a fragment that
comprised the full length of the hepatitis B genome from strain of
serotype adw. This material was created using the polymerase chain
reaction from plasmid pAM6 (ATCC #45020D). The PCRs were conducted
using a vector-based forward primer, oligo # 156-022-001
(5'-ggcgaccacacccgtcctgt-3'; SEQ ID NO:168) and a reverse primer,
oligo #156-022-02 (5'-ccacgatgcgtccggcgtag-3'; SEQ ID NO:169) to
amplify the full length of the HBV insert, an amplicon of about 3.2
kb. The cycling conditions included a denaturation of the plasmid
at 95.degree. C. for 5 minutes, followed by 30 cycles of 95.degree.
C., 30 seconds; 60.degree. C., 40 seconds; and 72.degree. C., 4
minutes. This was followed by a final extension at 72.degree. C.
for 10 minutes. The resulting amplicon, termed pAM6#2, was adjusted
to 2 M NH.sub.4OAc, and collected by precipitation with
isopropanol. After drying in vacuo, DNA was dissolved in 10 mM Tris
pH 0.0, 0.1 mM EDTA. The concentration was determined by OD.sub.200
measurement, and by INVADER assay with comparison to a standard of
known concentration.
[1081] The INVADER reactions were conducted as follows. Five master
mixes, termed "A," "B," "C," "D," and "E," were assembled; all
mixes contained 12.5 mM MOPS, pH 7.5, 500 fmoles primary INVADER
oligo #218-55-05 (SEQ ID NO:171), 10 ng human genomic DNA (Novagen)
and 30 ng AfuFEN1 enzyme, for every 8 .mu.l of mix. Mix A contained
no added HBV genomic amplicon DNA; mix B contained 600 molecules of
HBV genomic amplicon DNA pAM6 #2; mix C contained 6,000 molecules
pAM6 #2; mix D contained 60,000 molecules pAM6 #2; and mix E
contained 600,000 molecules pAM6 #2. The mixes were aliquotted to
the reaction tubes, 8 .mu.l/tube: mix A to tubes 1, 2, 11, 12, 21
and 22; mix B to tubes 3, 4, 13, 14, 23 and 24; mix C to tubes 5,
6, 15, 16, and 26; mix D to tubes 7, 8, 17, 18, 27 and 28; and mix
E to tubes 9, 10, 19, 20, 29 and 30. The samples were incubated at
95.degree. C. for 4 minutes to denature the HBV genomic amplicon
DNA. The reactions were then cooled to 67.degree. C., and 2 .mu.l
of a mix containing 37.5 mM MgCl.sub.2 and 2.5 pmoles 218-95-06
(SEQ ID NO:183) for every 2 .mu.l, was added to each sample. The
samples were incubated at 67.degree. C. for 60 minutes. Three
secondary reaction master mixes were prepared, all mixes contained
10 pmoles of secondary probe oligonucleotide #228-48-04 (SEQ ID
NO:173) for every 2 .mu.l of mix. Mix 2A contained no additional
oligonucleotide, mix 2B contained 5 pmoles "ARRESTOR" oligo #
218-95-03 (SEQ ID NO:184) and mix 2C contained 5 pmoles of
"ARRESTOR" oligo # 218-95-01 (SEQ ID NO:174). After the 60 minute
incubation at 67.degree. C. (the primary reaction described above),
2 .mu.l of the secondary reaction mix was added to each sample: Mix
2A was added to samples #1-10; Mix 2B was added to samples #11-20;
and Mix 2C was added to samples #21-30. The temperature was
adjusted to 52.degree. C. and the samples were incubated for 30
minutes at 52.degree. C. The reactions were then stopped by the
addition of 10 .mu.l of a solution of 95% formamide, 5 mM EDTA and
0.02% crystal violet. All samples were heated to 95.degree. C. for
2 minutes, and 4 .mu.l of each sample were resolved by
electrophoresis through 20% denaturing acrylamide gel (19:1
cross-linked) with 7 M urea, in a buffer containing 45 mM
Tris-Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using
the Molecular Dynamics Fluoroimager 595, excitation 488, emission
530. The resulting images are shown in FIG. 107.
[1082] In FIG. 107, Panel A shows the results of the target
titration when no ARRESTOR oligonucleotide was included in the
secondary reaction; Panel B shows the results of the same target
titration using an ARRESTOR oligonucleotide that extended 2 nt into
the non-target complementary region of the primary probe; and Panel
C shows the results of the same target titration using an ARRESTOR
oligonucleotide that extended 4 nt into the non-target
complementary region of the primary probe. The product of the
secondary cleavage reaction is seen as a band near the bottom of
each panel. The first two lanes of each panel (i.e., 1 and 2, 11
and 12, 21 and 22) lacked target DNA, and the signal the
co-migrates with the product band represents the nonspecific
background under each set of conditions.
[1083] It can be seen by visual inspection of these panels that the
background signal is both reduced, and made more predictable, by
the inclusion of either species of ARRESTOR oligonucleotides. In
addition to reducing the background in the no-target control lanes,
the background reduction in the reactions that had the more dilute
amounts of target included is reduced, leading to a signal that is
a more accurate reflection of the target contained within the
reaction, thus improving the quantitative range of the multiple,
sequential invasive cleavage reaction.
[1084] To quantify the impact of including the ARRESTOR
oligonucleotide in the secondary cleavage reaction under these
conditions, the average product band signal from the reactions
having the largest amount of target (i.e., averages of the signals
from lanes 9 and 10, lanes 19 and 20, and lanes 29 and 30), were
compared to the averaged signal from the no-target control lanes
for each panel, determine the "fold over background," the factor of
signal amplification over background, under each set of conditions.
For the reactions without the ARRESTOR oligonucleotide, Panel A,
the fold over background was 5.3; for Panel B, the fold over
background was 12.7; and for Panel C, the fold over background was
13.4, indicating that in this system inclusion of any ARRESTOR
oligonucleotide at least doubled the specificity of the signal over
the ARRESTOR oligonucleotide-less reactions, and that the ARRESTOR
oligonucleotide that extended slightly farther into the non-target
complementary region may be slightly more effective, at least in
this embodiment of the system. This clearly shows the benefits of
using an ARRESTOR oligonucleotide to enhance the specificity of
these reactions, an advantage that is of particular benefit at low
levels of target nucleic acid.
Example 50
"ARRESTOR" Oligonucleotides Allow use of Higher Concentrations of
Primary Probe Without Increasing Background Signal
[1085] It was demonstrated in Example 36, that increasing the
concentration of the probe in the invasive cleavage reaction could
dramatically increase the amount of signal generated for a given
amount of target DNA. While not intending to limit the explanation
to any specific mechanism, this is believed to be caused by the
fact that increased concentration of probe increases the rate at
which the cleaved probe is supplanted by an uncleaved copy, thereby
increasing the apparent turnover rate of the cleavage reaction.
Unfortunately, this effect could not heretofore be applied in the
primary cleavage reaction of a multiple sequential INVADER assay
because the residual uncleaved primary probe can hybridize to the
secondary target, in competition with the cleaved molecules,
thereby reducing the efficacy of the secondary reaction. Elevated
concentrations of primary probe exacerbate this problem. Further,
the resulting complexes, as described above, can be cleaved at a
low level, contributing to background. Therefore, increasing the
primary probe can have the double negative effect of both slowing
the secondary reaction and increasing the level of this form of non
target-specific background. The use of an ARRESTOR oligonucleotide
to sequester or neutralize the residual primary probe allows this
concentration-enhancing effect to be applied to these sequential
reactions.
[1086] To demonstrate this effect, two sets of reactions were
conducted. In the first set of reactions, the reactions were
conducted using a range of primary probe concentrations, but no
ARRESTOR oligonucleotide was supplied in the secondary reaction. In
the second set of reactions, the same probe concentrations were
used, but an ARRESTOR oligonucleotide was added for the secondary
reactions.
[1087] All reactions were performed in duplicate. Primary INVADER
reactions were done in a final volume of 10 .mu.l and contained: 10
mM MOPS, pH 7.5, 7.5 mM MgCl.sub.2, 500 fm of primary INVADER
(218-55-05; SEQ ID NO:171); 30 ng of AfuFEN1 enzyme and 10 ng of
human genomic DNA. 100 zeptomoles of HBV pAM6 #2 amplicon was
included in all even numbered reactions (by reference to FIGS. 108A
and B). Reactions included 10 pmoles, 20 pmoles, 50 pmoles, 100
pmoles or 150 pmoles of primary probe (218-55-02; SEQ ID NO:170).
MOPS, target and INVADER oligonucleotides were combined to a final
volume of 7 .mu.l. Samples were heat denatured at 95.degree. C. for
5 minutes, then cooled to 67.degree. C. During the 5 minute
denaturation, MgCl.sub.2, probe and enzyme were combined. The
primary INVADER reactions were initiated by the addition of 3 .mu.l
of MgCl.sub.2, probe and enzyme mix, to the final concentrations
indicated above. Reactions were incubated for 30 minutes at
67.degree. C. The reactions were then cooled to 52.degree. C., and
each primary INVADER reaction received the following secondary
reaction components in a total volume of 4 .mu.l: 2.5 pmoles
secondary target (oligo number 218-95-04; SEQ ID NO:172); 10 pmoles
secondary probe (oligo number 228-48-04; SEQ ID NO:173). The
reactions that included the ARRESTOR oligonucleotide had either 40
pmoles, 80 pmoles, 200 pmoles, 400 pmoles or 600 pmoles of ARRESTOR
oligonucleotide (oligo number 218-95-01; SEQ ID NO:174), added at a
4-fold molar excess over the primary probe amount for each
reaction, with this mix. Reactions were then incubated at
52.degree. C. for 30 minutes. The reactions were stopped by the
addition of 10 .mu.l of a solution of 95% formamide, 10 mM EDTA and
0.02% crystal violet. All samples were heated to 95.degree. C. for
1 minute, and 4 .mu.l of each sample were resolved by
electrophoresis through 20% denaturing acrylamide gel (19:1
cross-linked) with 7 M urea, in a buffer containing 45 mM
Tris-Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using
the Molecular Dynamics Fluoroimager 595, excitation 488, emission
530. The resulting images for the reactions either without or with
an ARRESTOR oligonucleotide are shown in FIGS. 108A and 108B,
respectively. The products of cleavage of the secondary probe are
seen as a band near the bottom of each panel.
[1088] In FIG. 108A, lane sets 1 and 2 show results with 10 pmoles
of primary probe; 3 and 4 had 20 pmoles; 5 and 6 had 50 pmoles; 7
and 8 had 100 pmoles; and 9 and 10 had 150 pmoles. It can be seen
by visual examination, that the increases in the amount of primary
probe have the combined effect of slightly increasing the
background in the no-target lanes (odd numbers) while reducing the
specific signal in the presence of target (even numbered lanes),
and therefore the reducing the specificity of the reaction if
viewed as the measure of "fold over background," demonstrating that
the approach of increasing signal by increasing probe cannot be
applied in these sequential reactions.
[1089] In FIG. 108B, lane sets 1 and 2 show results with 10 pmoles
of primary probe; while 3 and 4 had 20 pmoles; 5 and 6 had 50
pmoles; 7 and 8 had 100 pmoles; and 9 and 10 had 150 pmoles. In
addition, each reaction included 4-fold molar excess of the
ARRESTOR oligonucleotide added before the secondary cleavage
reaction. It can be seen by visual examination that the background
in the no-target lanes (odd numbers) is lower in all cases, while
the specific signal in the presence of target (even numbered lanes)
increases with increased amounts of primary probe, leading to a
greater "fold over background" sensitivity at this target
level.
[1090] To quantitatively compare these effects, the fluorescence
signal from the products of both non-specific and specific cleavage
were measured. The results are depicted graphically in FIG. 108C,
graphed as a measure of the percentage of the secondary probe
cleaved during the reaction, compared to the amount of primary
probe used. Examination of the plots from the no-target reactions
confirms that the background in the absence of the ARRESTOR
oligonucleotide is, in general, roughly two-fold higher, and that
both increase slightly with the increasing probe amounts. The
specific signals however, diverge between the two sets of reaction
more dramatically. While the signal in the no-ARRESTOR
oligonucleotide reactions decreases steadily as primary probe was
increased, the signal in the ARRESTOR oligonucleotide reactions
continued to increase. At the highest primary probe concentrations
tested, the no-ARRESTOR oligonucleotide reactions had specific
signal that was only 1.7 fold over background, while the ARRESTOR
oligonucleotide reactions detected the 100 zmoles (60,000 copies)
of target with a signal 6.5 fold over background, thus
demonstrating the improvement in the sequential invasive cleavage
reaction when an ARRESTOR oligonucleotide is included.
Example 51
Modified Backbones Improve Performance of ARRESTOR Oligonucleotides
All Natural "ARRESTOR" Oligo with No 3'-Amine
[1091] The reactions described in the previous two Examples used
ARRESTOR oligonucleotides that were constructed using 2' O-methyl
ribose backbone, and that included a positively charged amine group
on the 3' terminal nucleotide. The modifications were made
specifically to reduce enzyme interaction with the primary
probe/ARRESTOR oligonucleotide complex. During the development of
the present invention, it was determined that the 2' O-methy
modified oligonucleotides are somewhat resistant to cleavage by the
5' nucleases, just as they are slowly degraded by nucleases when
used in antisense applications (See e.g., Kawasaki et al., J. Med.
Chem., 36:831 [1993]).
[1092] Further, as demonstrated in Example 35, the presence of an
amino group on the 3' end of an oligonucleotide reduces its ability
to direct invasive cleavage. To reduce the possibility that the
ARRESTOR oligonucleotide would form a cleavage structure in this
way, an amino group was included in the design of the experiments
described in this and other Examples.
[1093] Initial designs of the ARRESTOR oligonucleotides (sometimes
referred to as "blockers") did not include these modifications, and
these molecules were found to provide no benefit in reducing
background cleavage in the sequential invasive cleavage assay and,
in fact, sometimes contributed to background by inducing cleavage
at an unanticipated site, presumably by providing some element to
an alternative cleavage structure. The effects of natural and
modified ARRESTOR oligonucleotide on the background noise in these
reactions are examined in this Example.
[1094] The efficacy of an "all-natural ARRESTOR oligonucleotide
(i.e., an ARRESTOR oligonucleotide that did not contain any base
analogs or modifications) was examined by comparison to an
identical reactions that lacked ARRESTOR oligonucleotide. All
reactions were performed in duplicate, and were conducted as
follows. Two master mixes were assembled, each containing 12.5 mM
MOPS, pH 7.5, 500 fmoles primary INVADER oligonucleotide #218-55-05
(SEQ ID NO:171), 10 ng human genomic DNA (Novagen) and 30 ng
AfuFEN1 enzyme for every 8 .mu.l of mix. Mix A contained no added
HBV genomic amplicon DNA, mix B contained 600,000 molecules of HBV
genomic amplicon DNA, pAM6 #2. The mixes were distributed to the
reaction tubes, in aliquots of 8 .mu.l/tube as follows: mix A to
tubes 1, 2, 5 and 6; and mix B to tubes 3, 4, 7 and 8. The samples
were incubated at 95.degree. C. for 4 minutes to denature the HBV
genomic amplicon DNA. The reactions were then cooled to 67.degree.
C. and 2 ul of a mix containing 37.5 mM MgCl.sub.2 and 10 pmoles
218-55-02B (SEQ ID NO:185) for every 2 .mu.l, was added to each
sample. The samples were then incubated at 67.degree. C. for 30
minutes. Two secondary reaction master mixes were prepared, each
containing 10 pmoles of secondary probe oligo #228-48-04N (SEQ ID
NO:178) and 2.5 pmoles of secondary target oligonucleotide
#218-95-04 (SEQ ID NO:172) for every 3 .mu.l of mix. Mix 2A
contained no additional oligonucleotide, while mix 2B contained 50
pmoles of the natural "ARRESTOR" oligonucleotide #241-62-02 (SEQ ID
NO:186). After the initial 30 minute incubation at 67.degree. C.,
the temperature was adjusted to 52.degree. C., and 3 .mu.l of a
secondary reaction mix was added to each sample, as follows: Mix 2A
was added to samples #1-4; and Mix 2B was added to samples #5-8.
The samples were then incubated for 30 minutes at 52.degree. C. The
reactions were then stopped by the addition of 10 .mu.l of a
solution of 95% formamide, 10 mM EDTA and 0.02% crystal violet.
[1095] All of the samples were heated to 95.degree. C. for 2
minutes, and 4 .mu.l of each sample were resolved by
electrophoresis through a 20% denaturing acrylamide gel (19:1
cross-linked) with 7 M urea, in a buffer containing 45 mM
Tris-Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using
the Molecular Dynamics Fluoroimager 595, excitation 488, emission
530. The resulting image is shown in FIG. 109A.
[1096] To compare the effects of the various modifications made to
the ARRESTOR oligonucleotides, reactions were performed using
ARRESTOR oligonucleotides having all natural bases, but including a
3' terminal amine; ARRESTOR oligonucleotide having the 3' portion
composed of 2' O-methyl nucleotides, plus the 3' terminal amine;
and ARRESTOR oligonucleotide composed entirely of 2' O-methyl
nucleotides, plus the 3' terminal amine. These were compared to
reactions performed without an ARRESTOR oligonucleotide. The
reactions were conducted as follows. Two master mixes were
assembled, all mixes contained 14.3 mM MOPS, pH 7.5, 500 fmoles
primary INVADER oligo #218-55-05 (SEQ ID NO:171) and 10 ng human
genomic DNA (Novagen) for every 7 .mu.l of mix. Mix A contained no
added HBV genomic amplicon DNA, mix B contained 600,000 molecules
of HBV genomic amplicon DNA, pAM6 #2. The mixes were distributed to
the reaction tubes, at 7 .mu.l/tube: mix A to tubes 1, 2, 5, 6, 9,
10, 13 and 14; and mix B to tubes 3, 4, 7, 8, 11, 12, 15 and 16.
The samples were warmed to 95.degree. C. for 4 minutes to denature
the HBV DNA. The reactions were then cooled to 67.degree. C. and 3
.mu.l of a mix containing 25 mM MgCl.sub.2, 25 pmoles 218-55-02B
(SEQ ID NO:185) and 30 ng AfuFEN1 enzyme per 3 .mu.l, were added to
each sample. The samples were then incubated at 67.degree. C. for
30 minutes. Four secondary reaction master mixes were prepared; all
mixes contained 10 pmoles of secondary probe oligonucleotide
#228-48-04B (SEQ ID NO:190) and 2.5 pmoles of secondary target
oligonucleotide #218-95-04 (SEQ ID NO:172) for every 3 .mu.l of
mix. Mix 2A contained no additional oligonucleotide, while mix 2B
contained 100 pmoles of the natural+amine ARRESTOR oligonucleotide
# 241-62-01 (SEQ ID NO:187), mix 2C contained 100 pmoles of
partially O-methyl+amine oligonucleotide # 241-62-03 (SEQ ID
NO:188) and mix 2D contained 100 pmoles of all O-methyl+amine
oligonucleotide # 241-64-01 (SEQ ID NO:189). After the initial 30
minute incubation at 67.degree. C., the temperature was adjusted to
52.degree. C. and 3 .mu.l of a secondary reaction mix was added to
each sample, as follows: mix 2A was added to samples #1-4; mix 2B
was added to samples #5-8; mix 2C was added to samples #9-12; and
mix 2D was added to samples #13-16. The samples were incubated for
30 minutes at 52.degree. C., then stopped by the addition of 10
.mu.l of a solution of 95% formamide, 10 mM NaEDTA, and 0.2%
crystal violet.
[1097] All samples were heated to 95.degree. C. for 2 minutes, and
4 .mu.l of each sample were resolved by electrophoresis through a
20% denaturing acrylamide gel (19:1 cross-linked) with 7 M urea, in
a buffer containing 45 mM Tris-Borate (pH8.3) and 1.4 mM EDTA. The
results were imaged using the Molecular Dynamics Fluoroimager 595,
excitation 488, emission 530. The resulting image is shown in FIG.
109B.
[1098] In FIG. 109A, the left hand panel shows the reactions that
lacked an ARRESTOR oligonucleotide, while the right hand panel
shows the data from reactions that included the all natural
ARRESTOR oligonucleotide. The first two lanes of each panel are
from no-target controls, the second set of lanes contained target.
The products of cleavage are visible in the bottom one/fourth of
each panel. The position at which the specific reaction products
should run is indicated by arrows on left and right.
[1099] It can be seen by examination of these data, that the
reactions run in the absence of ARRESTOR oligonucleotide show
reproducible quality between the replicates, and show significant
cleavage only when target is present. In contrast, the addition of
another unmodified oligonucleotide into the reactions causes great
variation between the replicate lanes (e.g., lanes 5 and 6 were
provided with the same reactants, but produced markedly different
results). The introduction of the all natural ARRESTOR
oligonucleotide produced, rather than reduced, background in these
no-target lanes, and increased cleavage at other sites (i.e., the
bands other that those indicated by the arrows flanking the
panels). For these reasons the modifications that are described
above, the effects of which are shown on FIG. 109B, were
incorporated.
[1100] The first 4 lanes of FIG. 109B show the products of
duplicate reactions without an ARRESTOR oligonucleotide, plus or
minus the HBV target (lanes 1, 2, and lanes 3, 4, respectively);
The next 4 lanes, 5, 6 and 7, 8 used a natural ARRESTOR
oligonucleotide having a 3' terminal amine; lanes 9, 10 and 11, 12
used the ARRESTOR oligonucleotide with a 3' portion composed of 2'
O-methyl nucleotides, and having a 3' terminal amine; lanes 13, 14
and 15, 16 used the ARRESTOR oligonucleotide composed entirely of
2' O-methyl nucleotides and having a 3' terminal amine. The
products of cleavage of the secondary probe are visible in the
lower one third of each panel.
[1101] Visual inspection of these data shows that the addition of
the 3' terminal amine to the natural ARRESTOR oligonucleotide
suppresses the aberrant cleavage seen in FIG. 109A, but this
ARRESTOR oligonucleotide does not improve the performance of the
reaction, as compared to the no-ARRESTOR oligonucleotide controls.
In contrast, the use of the 2' O-methyl nucleotides in the body of
the ARRESTOR oligonucleotide does reduce background, whether
partially or completely substituted. To quantify the relative
effects of these modifications, the fluorescence from each of the
co-migrating product bands was measured, the signals from the
duplicate lanes were averaged and the "fold over background" was
calculated for each reaction containing target nucleic acid.
[1102] When ARRESTOR oligonucleotide was omitted, the target
specific signal (lanes 3, 4) was 27-fold over the no target
background; the natural ARRESTOR oligonucleotide+amine gave a
signal of 17-fold over background; the partial 2' O-methyl+amine
gave a signal of 47-fold over background; and the completely 2'
O-methyl+amine gave a signal of 33 fold over background.
[1103] These Figures show that both modifications can have a
beneficial effect on the specificity of the multiple, sequential
invasive cleavage assay. They also show that the use of the 2'
O-methyl substituted backbone, either partial or entire, markedly
improves the specificity of these reactions. It is intended that in
various embodiments of the present inventon, that any number of
modifications that make either the ARRESTOR oligonucleotide or the
complex it forms with the primary target resistant to nucleases
will provide similar enhancement.
Example 52
Effect of ARRESTOR Oligonucleotide Length on Signal Enhancement in
Multiple Sequential Invasive Cleavage Assays
[1104] As noted in the Description of the Invention, the optimal
length for an ARRESTOR oligonucleotide depends upon the design of
the other nucleic acid elements of the INVADER reaction,
particularly on the design of the primary probe. In this Example,
the effects of varying the length of the ARRESTOR oligonucleotide
were explored in systems using two different secondary probes. A
schematic diagram showing these ARRESTOR oligonucleotides aligned
as they would hybridize to the primary probe oligonucleotide is
provided in FIG. 110C. In this Figure, the region of the primary
probe that recognizes the target nucleic acid is shown underlined;
the non-underlined portion, plus the first underlined base is the
portion that is released by the first cleavage, and goes on to
participate in the second or subsequent cleavage structure.
[1105] All reactions were performed in duplicate. The INVADER
reactions were done in a final volume of 10 .mu.l final volume
containing 10 mM MOPS, pH 7.5, mM MgCl.sub.2, 500 fmoles of primary
INVADER 241-95-01, (SEQ ID NO:176), 25 pmoles of primary probe
241-95-02 (SEQ ID NO:175), 30 ng of AfuFEN1 enzyme, and 10 ng of
human genomic DNA, and if included, 1 amoles of HBV amplicon pAM 6
#2. MOPS, target DNA, and INVADER oligonucleotides were combined to
a final volume of 7 .mu.l. Samples were heat denatured at
95.degree. C. for 5 minutes, then cooled to 67.degree. C. During
the 5 minute denaturation, MgCl.sub.2, probe and enzyme were
combined. The primary INVADER reactions were initiated by the
addition of 3 .mu.l of MgCl.sub.2, probe and enzyme mix, to the
final concentrations indicated above. Reactions were incubated for
30 minutes at 67.degree. C. The reaction were then cooled to
52.degree. C., and each primary INVADER reaction received the
following secondary reaction components in a total volume of 3
.mu.l: 2.5 pmoles secondary target 241-95-07 (SEQ ID NO:177), 10
pmoles of either secondary probe 228-48-04 (SEQ ID NO:173), or
228-48-04N (SEQ ID NO:178) and 100 pmoles of an ARRESTOR
oligonucleotide, either 241-95-03 (SEQ ID NO:179), 241-95-04 (SEQ
ID NO:180), 241-95-05 (SEQ ID NO:181) or 241-95-06 (SEQ ID NO:182).
The ARRESTOR oligonucleotide were omitted from some reactions as
controls for ARRESTOR oligonucleotide effects.
[1106] The reactions were incubated at 52.degree. C. for 34
minutes, and were then stopped by the addition of 10 .mu.l of 95%
formamide, 10 mM EDTA, and 0.02% crystal violet. All samples were
heated to 95.degree. C. for 1 minute, and 4 .mu.l of each sample
were resolved by electrophoresis through 20% denaturing acrylamide
gel (19:1 cross-linked) with 7 M urea, in a buffer containing 45 mM
Tris-Borate (pH8.3) and 1.4 mM EDTA. The results were imaged using
the Molecular Dynamics Fluoroimager 595, excitation 488, emission
530. The resulting images for the reactions with the shorter and
longer secondary probes are shown in FIGS. 110A and 110B,
respectively.
[1107] In each Figure, the products of cleavage are visible as
bands in the bottom half of each lane. The first 4 lanes of each
Figure show the products of duplicate reactions without an ARRESTOR
oligonucleotide, plus or minus the HBV target (lanes sets 1 and 2
respectively); in the next 4 lanes, sets 3 and 4 used the shortest
ARRESTOR 241-95-03 (SEQ ID NO:179); lanes 5 and 6 used 241-95-04
(SEQ ID NO:180); lanes 7 and 8 used 241-95-05 (SEQ ID NO:181); and
lanes 9 and 10 used 241-95-06 (SEQ ID NO:182).
[1108] The principal background of concern is the band that appears
in the "no target" control lanes (odd numbers; this band
co-migrates with the target-specific signal near the bottom of each
gel panel). Visual inspection shows that the shortest ARRESTOR
oligonucleotide was the least effective at suppressing this
background, and that the efficacy was increased when the ARRESTOR
oligonucleotide extended further into the portion that participates
in the subsequent cleavage reaction. Even with this difference in
effect, it can be seen from these data that there is much latitude
in the design of the ARRESTOR oligonucleotide. The choice of
lengths will be influenced by the temperature at which the reaction
making use of the ARRESTOR oligonucleotide is performed, the
lengths of the duplexes formed between the primary probe and the
target, the primary probe and the secondary target, and the
relative concentrations of the different nucleic acid species in
the reactions.
Example 53
Effect of ARRESTOR Oligonucleotide Concentration on Signal
Enhancement in Multiple Sequential Invasive Cleavage Assays
[1109] In examining the effects of including ARRESTOR
oligonucleotides in these cleavage reactions, it was of interest to
determine if the concentration of the ARRESTOR oligonucleotide in
excess of the primary probe concentration would have an effect on
yields of either non-specific or specific signal, and if the length
of the ARRESTOR oligonucleotide would be a factor. These two
variable were investigated in the following Example.
[1110] All reactions were performed in duplicate. The primary
INVADER reactions were done in a final volume of 10 .mu.l and
contained 10 mM MOPS, pH 7.5; 7.5 mM MgCl.sub.2, 500 fmoles of
primary INVADER 241-95-01 (SEQ ID NO:176), 25 pmoles of primary
probe 241-95-02 (SEQ ID NO:175), 30 ng of AfuFEN1 enzyme, and 10 ng
of human genomic DNA. Where included, the target DNA was 1 amole of
HBV amplicon pAM 6 #2, as described above. MOPS, target and INVADER
were combined to a final volume of 7 .mu.l. The samples were heat
denatured at 95.degree. C. for 5 minutes, then cooled to 67.degree.
C. During the 5 minute denaturation, MgCl.sub.2, probe and enzyme
were combined. The primary INVADER reactions were initiated by the
addition of 3 .mu.l of MgCl.sub.2, probe and enzyme mix. The
reactions were incubated for 30 minutes at 67.degree. C. The
reactions were then cooled to 52.degree. C. and each primary
INVADER reaction received the following secondary reaction
components: 2.5 pmoles secondary target 241-95-07 (SEQ ID NO:177),
10 pmoles secondary probe 228-48-04 (SEQ ID NO:173); and, if
included, 50, 100 or 200 pmoles of either ARRESTOR oligonucleotide
241-95-03 (SEQ ID NO:179) or 241-95-05 (SEQ ID NO:181), in a total
volume of 3 .mu.l. Reactions were then incubated at 52.degree. C.
for 35 minutes. Reactions were stopped by the addition of 10 .mu.l
of 95% formamide, 10 mM EDTA, and 0.02% crystal violet. All of the
samples were heated to 95.degree. C. for 1 minute, and 4 .mu.l of
each sample were resolved by electrophoresis through 20% denaturing
acrylamide gel (19:1 cross-linked) with 7 M urea, in a buffer
containing 45 mM Tris-Borate (pH8.3), and 1.4 mM EDTA. The results
were imaged using the Molecular Dynamics Fluoroimager 595,
excitation 488, emission 530. The resulting images are shown as a
composite image in FIG. 111.
[1111] Each of the duplicate reactions were loaded on the gel in
adjacent lanes and are labeled with a single lane number. All odd
numbered lanes were no-target controls. Lanes 1 and 2 had no
ARRESTOR oligonucleotide added; lanes 3-8 show results from
reactions containing the shorter ARRESTOR oligonucleotide,
241-95-03 (SEQ ID NO:179); lanes 9-14 show results from reactions
containing the longer ARRESTOR oligonucleotide, 241-95-05 (SEQ ID
NO:181). The products of cleavage from the secondary reaction are
visible in the bottom one third of each panel. Visual inspection of
these data (i.e., comparison of the specific products to the
background bands) shows that both ARRESTOR oligonucleotides have
some beneficial effect at all concentration.
[1112] To quantify the relative effects of ARRESTOR oligonucleotide
length and concentration, the fluorescence from each of the
co-migrating product bands was measured, the signals from the
duplicate lanes were averaged and the "fold over background"
(signal+target/signal-target) was calculated for each reaction
containing target nucleic acid. The reaction lacking an ARRESTOR
oligonucleotide yielded a signal approximately 27-fold over
background. Inclusion of the shorter ARRESTOR oligonucleotide at
50, 100 or 200 pmoles produced products at 42, 51 and 60-fold over
background, respectively. This shows that while the short arrestr
at the lowest concentration seems to be less effective than the
longer ARRESTOR oligonucleotides (See, previous Example) this can
be compensated for by increasing the concentration of ARRESTOR
oligonucleotide, and thereby the ARRESTOR oligonucleotide:primary
probe ratio.
[1113] In contrast, inclusion of the longer ARRESTOR
oligonucleotide at 50, 100 or 200 pmoles produced products at 60,
32 and 24 fold over background, respectively. At the lowest
concentration, the efficacy of this longer ARRESTOR oligonucleotide
relative to the shorter ARRESTOR oligonucleotide is consistent with
the previous Example. Increasing the concentration, however,
decreased the yield of specific product, suggesting a competition
effect with some element of the secondary cleavage reaction.
[1114] These data show that the ARRESTOR oligonucleotides can be
used to advantage in a number of specific reaction designs. The
choice of concentration will be influenced by the temperature at
which the reaction making use of the ARRESTOR oligonucleotide is
performed, the lengths of the duplexes formed between the primary
probe and the target, the primary probe and the secondary target,
and between the primary probe and the ARRESTOR oligonucleotide.
[1115] Selection of oligonucleotides for target nucleic acids other
than the HBV shown here, (e.g., oligonucleotide composition and
length), and the optimization of cleavage reaction conditions in
accord with the models provided here follow routine methods and
common practice well known to those skilled in the methods of
molecular biology.
[1116] Example 45 demonstrated that some enzymes require an overlap
between an upstream INVADER oligonucleotide and a downstream probe
oligonucleotide to create a cleavage structure (FIG. 100). It has
also been determined that the 3' terminal nucleotide of the INVADER
oligonucleotide need not be complementary to the target strand,
even if it is the only overlapping base in the INVADER
oligonucleotide (e.g., as with the HCMV probes shown in FIG. 103).
The requirement for an overlap can serve as a convenient basis for
detecting single base polymorphisms (SNPs) or mutations in a
nucleic acid sample.
[1117] For detection of single base variations, at least two
oligonucleotides (e.g., a probe and an INVADER oligonucleotide)
hybridize in tandem to the target nucleic acid to form the
overlapping structure recognized by the CLEAVASE enzyme to be used
in the reaction. An unpaired "flap" is included on the 5' end of
the probe. The enzyme recognizes the overlap and cleaves off the
unpaired flap, releasing it as a target-specific product. Enzymes
that have a strong preference for an overlapping structure, i.e.,
that cleave the overlapping structure at a much greater rate than
they cleave a non-overlapping structure include the FEN-1 enzymes
from Archaeoglobus fulgidus and Pyrococcus furiosus and such
enzymes are particularly preferred in the detection of mutations
and SNPs. In the secondary reaction, the released flap serves as an
INVADER oligonucleotide to create another overlapping cleavage
structure (e.g., as shown in FIG. 96). In the following examples,
the released flap creates this overlapping structure in conjunction
with a FRET cassette, a single oligonucleotide having a region of
self-complementarity to form a hairpin (FIG. 112A) When the FRET
cassette is cleaved to release its 5' nucleotide, the fluorescent
dye (F) and the quencher (Q) on the cassette are separated and a
detectable fluorescence signal is produced. If the probe and the
target sequence do not match perfectly at the cleavage site (e.g.,
as in FIG. 112B), the overlapped structure does not form, cleavage
is suppressed, and no fluorescence will be produced.
[1118] The reactions may be performed under conditions in which the
probes and FRET cassettes turn over continuously without
temperature cycling or cleavage. When an uncut probe hybridizes to
the target next to an overlapping INVADER oligonucleotide, the
probe can be cleaved to produce a target-specific product, which in
turn enables the cleavage of many FRET cassettes.
[1119] The following eight examples demonstrate the design and
application of the sequential INVADER assay with FRET cassette
detection to analysis of SNPs and mutations in a variety of nucleic
acid samples.
Example 54
Detection of Single Nucleotide Polymorphisms in the Human
Apolipoprotein E Gene this Example describes an assay for the
detection of SNPs in the human
[1120] Apolipoprotein E gene. Probe and INVADER oligonucleotides
were designed to target single nucleotide polymorphisms (SNPs) at
two positions in the human apolipoprotein E (apoE) gene. Three
different alleles exist for the apoE gene, epsilon 2, epsilon 3,
and epsilon 4, which code for 3 different isoforms of the apoE
protein, termed E2, E3 and E4. The different isoforms vary in at
amino acid positions 112 or 158 (see Table A), and each variation
is caused by a single base change in the corresponding codon.
TABLE-US-00005 TABLE A 112 158 ISOFORM codon amino acid codon amino
acid E2 TGC cys TGC cys E3 TGC cys CGC arg E4 CGC arg CGC arg
[1121] INVADER and probe oligonucleotides were designed using the
algorithm described above (detailed description of the invention),
with the probe set selected to operate at 63.degree. C. As shown in
FIGS. 113 A-D, one INVADER oligonucleotide and two unlabelled,
probe oligonucleotides, one for each variant at a given locus, were
designed for each codon. For codon 112, the probes were designed to
detect either the C nucleotide (to code for arginine; SEQ ID
NO:197) or a T nucleotide (to code for cysteine; SEQ ID NO:198).
For codon 158, the probes were designed to detect either a C
nucleotide (to code for arginine; SEQ ID NO:199) or a T nucleotide
(to code for cysteine; SEQ ID NO:200). A FRET cassette to be used
with all of the probe sets was also synthesized (SEQ ID NO:201,
FIG. 113). In this Example and in the following Examples, all
oligonucleotides were synthesized using standard phosphoramidite
chemistries. Primary probe oligonucleotides were unlabeled. The
FRET cassettes were labeled by the incorporation of Cy3
phosphoramidite and fluorescein phosphoramidite (Glen Research).
While designed for 5' terminal use, the Cy3 phosphoramidite has an
additional monomethoxy trityl (MMT) group on the dye that can be
removed to allow further synthetic chain extension, resulting in an
internal label with the dye bridging a gap in the sugar-phosphate
backbone of the oligonucleotide (as diagrammed in the panels of
FIG. 113). While a nucleotide may be omitted at this position to
accommodate the dye, we have determined it is not necessary, and no
nucleotides were omitted from the FRET cassettes used in these
examples. Amine or phosphate modifications, where indicated, were
used on the 3' ends of the primary probes and the FRET cassettes to
prevent their use as invasive oligonucleotides. 2'-O-methyl bases
in the secondary target oligonucleotides are indicated by
underlining and were also used to minimize enzyme recognition of 3'
ends. In addition, reactions having synthetic target DNAs were used
as positive controls to verify the activity of the reaction
components. The control targets are illustrated in FIGS. 113 A-D.
The 112 arg, 112 cys, 158 arg, and 158 cys control oligonucleotides
are SEQ ID NOS:191-194, respectively.
Genomic DNA sample AG09714 was purchased from Coriell. This sample
was quantitated via Pico Green and diluted with Tris with 0.1 mM
EDTA to a concentration of approximately 100 ng/.mu.l. This sample
(9714 in FIG. 114A) was used to test for the 112 mutation. Samples
39634, 32435 and 31071 were purchased as whole blood from Lampire
Biological Labs., Inc. Samples 511, 537, 538 and 539 were whole
blood samples donated by the Blood Center of Southeast Wisconsin
(Milwaukee, Wis.). Genomic DNA was prepared via the PUREGENE Blood
Kit (Gentra) according to the manufacturer's instructions. Samples
39634 and 32435 were used to test for the 112 mutation, and sample
31071, 511, 537, 538 and 539 were used to test for the 158
mutation. One .mu.l of genomic DNA was used per reaction, with 9
.mu.l of water, for a final volume of 10 .mu.l. Although
determination of the full genotype for any one sample generally
requires analysis of both loci, the samples listed above were
selected to show representative signals from, and thus the
functioning of, each probe set. Complete genotyping requires each
sample to be tested with both probe sets.
[1122] The experiment comprised testing each genomic DNA for the
indicated alleles, along with reactions having no target DNA to
allow measurement of any background signal not attributable to the
presence of a target sequence. Reactions testing the 112 locus were
done in quadruplicate, reactions testing the 158 locus were done in
triplicate.
[1123] Reaction components were prepared as batch mixes for
dispensing to the individual test reactions. Batches of INVADER mix
for each allele were prepared, comprising for each planned
reaction: 4 .mu.l of 16% PEG 8000/50 mM MOPS pH 7.5 and 1 .mu.l of
1 .mu.M INVADER oligonucleotide (either the 112 or the 158).
Batches of CLEAVASE enzyme/Mg.sup.2+/probe mix for each allele were
prepared, comprising for each planned reaction: 2 .mu.l of 75 mM
MgCl.sub.2, 1 .mu.l of 10 .mu.M FRET cassette, 1 .mu.l 10 .mu.M
probe oligonucleotide (any one of the 112 or the 158 T or C probe
oligonucleotides), and 1 .mu.l of 200 ng/.mu.l Afu FEN-1
enzyme.
[1124] For each reaction, 5 .mu.l of INVADER reaction mix were
aliquoted into each well of a 96-well Low Profile Polypropylene
Microplate (MJ Research,). Ten .mu.l of each control DNA or genomic
sample (approximately 100 ng-190 ng) were added and mixed by
pipetting up and down. The no-target controls received 1 .mu.g of
yeast tRNA instead of target DNA. The reactions comprising the
synthetic targets as positive controls included either 150 or 100
zeptomoles (zmoles) of the 112 or 158 synthetic targets,
respectively, and 1 .mu.g of yeast tRNA. Each reaction was overlaid
with 20 .mu.l of clear CHILLOUT liquid wax, and incubated at
95.degree. C. for 5 minutes. The reaction temperature was then
lowered to 63.degree. C., 5 .mu.l of the appropriate CLEAVASE
enzyme/Mg.sup.2/Probe reaction mix was added to each reaction and
mixed by pipetting up and down 3-5 times, and the reactions were
further incubated for 4 hours at 63.degree. C., and were read
directly on a CYTOFLUOR Series 4000 Fluorescence Multi-well Plate
Reader, (PerSeptive Biosystems), using the following settings:
Excitation (wavelength/bandwidth): 485/20 nm; Emission
(wavelength/bandwidth): 530/25 nm; Gain: 37. The net averaged
fluorescence signal was calculated by subtracting the averaged
no-target signal (background) from the corresponding averaged
target DNA reaction signal and the data were plotted using Excel
spreadsheet software (Microsoft).
[1125] Results for the ApoE 112 and ApoE 158 loci are shown
graphically in FIGS. 114A and 114B, respectively, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the "C" probe, while the dark bars represent
the net averaged signal from the "T" probe. The reactions having
synthetic targets are indicated as Syn C and Syn T for the C and T
controls, respectively. At both loci, the samples that are
homozygous for either the C or T allele are easily identified by
having a strong signal from only one probe or the other, while the
heterozygous samples, are easily identified by having strong
signals from both the C and T probes.
Example 55
Detection of Mutations in the Human Hemochromatosis (HFE) Gene
[1126] The human hemochromatosis (HFE gene) gene is located in the
MHC region of chromosome 6, and was initially named HLA-H. It was
later renamed the HFE gene, in accordance with the WHO Nomenclature
Committee for Factors of the HLA System. Two different, single-base
variations in the HFE gene are responsible for the vast majority of
the cases of hereditary hemochromatosis, or iron overload disease.
The most common variant, termed C282Y, is caused by a change from
the wild type (WT) adenine (A) to the mutant (MT) guanine (G) at
codon 282 that causes an amino acid change from a cysteine to a
tyrosine residue. The second variation commonly detected in
individuals suffering from iron overload disorder is termed H63D,
and is caused by a WT cytosine (C) to a MT guanine (G) change at
codon 63 that causes an amino acid change from a histidine to an
aspartic acid residue in the expressed protein.
[1127] INVADER and probe oligonucleotide sets were designed as
described above to detect both the WT and MT alleles for both the
C282Y and H63D sites and are shown in FIGS. 115 A-D. Detection of
the C282 polymorphism used one INVADER oligonucleotide (SEQ ID
NO:202), one probe specific for each variant of the allele (WT and
MT, SEQ ID NOS:208 and 209, respectively) and a first FRET cassette
(SEQ ID NO:210). Oligonucleotides for the H63 locus included an
INVADER oligonucleotide (SEQ ID NO:203), one probe specific for
each variant of the allele (WT and MT, SEQ ID NOS:211 and 212,
respectively), and a second FRET cassette (SEQ ID NO:213). In
addition, reactions having synthetic target DNAs were used as
positive controls to verify the activity of the reaction
components. The control targets are illustrated in FIGS. 115 A-D.
The C282 WT, C282 MT, H63 WT and H63 MT control oligonucleotides
are SEQ ID NOS: 204-207, respectively. Human genomic DNA samples
14640, 14641, 14646, 14690, and 14691 were purchased from Coriell
Cell Repositories (Catalog #s NA14640, NA14641, NA1446, NA14690,
and NA14691).
[1128] Reactions were performed and analyzed as described in
Example 54. The reactions comprising the synthetic targets as
positive controls included 100 zmoles of the synthetic target and 1
.mu.g of yeast tRNA.
[1129] Results are shown graphically in FIG. 116, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
signal from the wild-type probe, while the dark bars represent the
net signal from the mutant probe. The left half of the graph
indicates samples tested for the C282Y polymorphism, while the
right half of the graph indicates samples tested for the H63D
polymorphism. No target controls are indicated as "NT" and the
synthetic targets are indicated as SynWT and SynMT for wild-type
and mutant controls, respectively. At both loci, the samples that
are homozygous for either WT or MT are easily identified by having
a strong signal from only one probe or the other, while the
heterozygous samples, are easily identified by having strong
signals from both the WT and MT probes.
Example 56
Detection of Mutations in the Human MTHFR
[1130] Human 5,10-methylene-tetrahydrofolate reductase (MTHFR) is a
major enzyme in the folate-dependent regulation of methionine and
homocysteine concentrations. The wild-type protein plays a critical
role in the conversion of homocysteine to methionine. A particular
variation in the MTHFR protein, termed C677T and caused by a C to T
transition in the MTHFR gene, has been correlated with myriad
diseases and defects, including cardiovascular and neurological
disorders. This Example describes an assay for the detection of the
WT and MT alleles for the MTHFR 677 SNP.
[1131] INVADER and probe oligonucleotide sets were designed as
described above to detect both the WT and MT allele for the MTHFR
677 site (INVADER, WT probe, MT probe, and FRET cassette are SEQ ID
NOS:216, 217, 218 and 225, respectively). Positive control targets
were synthesized for the WT and MT alleles at the 677 site (SEQ ID
NOS:214 and 215, respectively); oligonucleotides are shown in FIGS.
117A and 117B.
[1132] Human genomic DNA samples 01532 and 01560 were purchased
from Coriell. These samples had been characterized by "PCR" at
Coriell for the MTHFR genotype. They were also characterized in
house by PCR/RFLP analysis for genotype confirmation. Human genomic
sample 32435 was purchased as whole blood from Lampire Biological
Labs., Inc. (Coopersberg, Pa.), and genomic DNA was prepared via
the Gentra PUREGENE Blood Kit (Minneapolis, Minn.) according to the
manufacturer's instructions. Samples were quantitated via PicoGreen
(Molecular Probes, Eugene Oreg.) and diluted with TE to a
concentration of approximately 10 ng/.mu.l. 100 ng (10 .mu.l) of
each sample was used in each reaction.
Triplicate reactions were performed and analyzed as described in
Example 54, except the INVADER mixes contained 1 .mu.l of 0.5 .mu.M
INVADER oligonucleotide for each reaction. The reactions comprising
the synthetic targets as positive controls included 50 zmoles of
the synthetic target and 1 .mu.g of yeast tRNA. Reactions
simulating a heterozygous sample included 50 zmoles of each control
target.
[1133] Results are shown graphically in FIG. 118, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the wild-type probe, while the dark bars
represent the net averaged signal from the mutant probe. The
synthetic targets are indicated as SynWT and SynMT for wild-type
and mutant controls, respectively and SynHET for a mixture of the
two to simulate a heterozygous sample. At both loci, the samples
that are homozygous for either WT or MT are easily identified by
having a strong signal from only one probe or the other, while the
heterozygous samples are easily identified by having strong signals
from both the WT and MT probes.
Example 57
Detection of Mutations in the Human Prothrombin (Factor II)
Gene
[1134] The prothrombin A20210G mutation has been determined to be a
risk factor for thromboembolism. The mutation occurs in the 3'
untranslated region of the prothrombin gene, replacing the WT
adenine (A) at position 20210 with the MT guanine (G). This Example
describes an assay for the detection of the WT and MT alleles of
the prothrombin A20210G mutation INVADER and probe oligonucleotide
sets were designed as described above to detect both the WT and MT
alleles at the prothrombin 20210 site (INVADER, WT probe, MT probe
and FRET cassette are SEQ ID NOS: 222-225, respectively). Positive
control targets were synthesized for the WT and MT alleles at the
20210 site (SEQ ID NOS:220 and 221, respectively); oligonucleotides
are shown in FIGS. 119A and 119B.
[1135] Three patient samples of human genomic DNA were donated by
the Blood Center of Southeast Wisconsin, identified as 2196, 2263
and 2265. These samples were purified at the Blood Center via
QIAGEN BioRobot 9600 (QIAGEN # 900200), quantitated by Pico Green
(Molecular Probes) and were found to be at a concentration of 30-50
ng/ul.
[1136] Duplicate reactions were performed and analyzed as described
in Example 54, except the INVADER mixes contained 1 .mu.l of 0.5
.mu.M INVADER oligonucleotide for each reaction, and the mix was
diluted with 1 volume of dH.sub.2O (i.e., 5 .mu.l per reaction) so
that the INVADER mix was dispensed 10 .mu.l aliquots, while the DNA
was dispensed in 5 .mu.l aliquots, adding 150-250 ng of genomic DNA
per reaction. Each no target control reaction received 1 .mu.g of
yeast tRNA, and the reactions comprising the synthetic targets as
positive controls included 300 zmoles of WT control or 50 zmoles of
MT control and 1 .mu.g of yeast tRNA.
[1137] Results are shown graphically in FIG. 120, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the wild-type probe, while the dark bars
represent the net averaged signal from the mutant probe. Synthetic
targets are indicated as SynWT and SynMT for wild-type and mutant
controls, respectively. Samples that are homozygous for the WT are
easily identified by having a strong signal from only the WT probe,
while the heterozygous sample is easily identified by having strong
signals from both the WT and MT probes.
Example 58
Detection of the HR-2 Mutation in the Human Factor V Gene
[1138] This Example describes an assay for the deteciton of the R-2
polymorphism in the human factor V gene. The R-2 polymorphism in
the human factor V gene is located in exon 13 of the factor V gene,
and is the result of an A to G transition at base 4070, replacing
the wild-type amino acid histidine with the mutant arginine in the
mature protein. The R-2 polymorphism is one of a set of mutations
termed collectively HR-2. The HR-2 haplotype is defined by 6
nucleotide base substitutions in exons 13 and 16 of the factor V
gene, and is associated with an increased functional resistance to
activated protein C both in normal subjects and in thrombophilic
patients. When present as a compound heterozygote in conjunction
with the Leiden mutation (see Example 60, below), clinical symptoms
are comparable to those seen in patients homozygous for the Leiden
mutation.
[1139] Within about a 600-base pair region surrounding the R2
allele, four sub-regions of DNA, each encompassing the sequence of
the WT INVADER probe set, (approximately 22 bases in length),
contain sequence similar to that immediately surrounding the R2
allele. These repeated sequences can be detected by an INVADER and
probe oligonucleotide set designed for the wild-type R-2 sequence.
Because of the repeated sequence, reactions with this INVADER/probe
set yield very high signal, even with genomic samples containing
R-2 mutants, thus greatly increasing the risk of misinterpreting
the data. In the example of an R-2 heterozygote, the signal
generated by the R-2 mutant would be extremely low compared to the
wild-type signal. It is thus possible that one might err and
interpret the data as wild-type, not as heterozygous. The same
would hold true even for a homozygous mutant R-2 sample. Therefore,
instead of having an INVADER/probe set to detect the WT R-2 allele,
an INVADER/probe set was developed to detect sequences in the
single copy .alpha.-actin gene, thus providing an internal reaction
control, as well as an internal signal intensity control. Since the
.alpha.-actin gene is single copy, the signal levels generated in
the detection of this sequence will be comparable to that generated
in the detection of the R-2 mutant allele, and the probability of
incorrect data interpretation due to WT signal overwhelming that
generated by the MT is no longer an issue.
[1140] In the previous examples, each sample was assayed in two
different reactions, one reaction tested for the presence of
wild-type sequence and one reaction tested for the presence of
mutant sequence. In this example, each sample is tested with both
the .alpha.-actin internal control and the MT R-2 INVADER/probe
sets. INVADER and probe oligonucleotide sets were designed as
described above to detect both the MT R-2 and .alpha.-actin control
sequence (MT R-2 INVADER and probe, and the FRET cassette are SEQ
ID NOS:228, 229 and 230, respectively; .alpha.-actin INVADER and
probe are SEQ ID NOS: 231 and 232, respectively). Positive control
targets were synthesized for the Mutant R-2 allele and the
.alpha.-actin gene (SEQ ID NOS:226 and 227, respectively);
oligonucleotides are shown in FIGS. 121A and B.
[1141] Human genomic DNA sample 39021 was obtained from Sigma
(Catalog #D6537) and uncharacterized human genomic sample 15506 was
obtained from Coriell (Catalog #NA15506, Camden, N.J. 08103)
Samples were diluted to 10 ng/.mu.l with Tris-EDTA, pH 8.0. Ten
.mu.l (100 ng) was used per reaction. No target controls received 1
.mu.g of yeast tRNA instead of human genomic DNA. Reactions were
performed and analyzed as described in Example 54, except the
INVADER mixes contained 0.5 .mu.l each of 2 .mu.M R-2 INVADER
oligonucleotide and 2.0 .mu.M .alpha.-actin INVADER
oligonucleotide. The probe master mixes contained 1 .mu.l of either
the 10 .mu.M R-2 probe or 1 .mu.l of 10 .mu.M .alpha.-actin probe,
2 .mu.l of 75 mM MgCl.sub.2, 1 .mu.l of 10 .mu.M FRET cassette and
1 .mu.l 200 ng/.mu.l Afu FEN-1 enzyme per reaction. The reactions
comprising the synthetic targets as positive controls included 100
zmoles of the synthetic target and 1 .mu.g of yeast tRNA. The
SynHET and SynMT reactions contained mixtures of synthetic targets
at 2:1 and 1:1 of the .alpha.-actin:R-2 mutant targets,
respectively.
[1142] Reactions were read directly on a CYTOFLUOR Multi-well Plate
Reader Series 4000 (PerSeptive Biosystems) using the following
parameters: Excitation wavelength/bandwidth 485 nm/20 nm, Emission
wavelength/bandwidth 530 nm/25 nm, gain 36.
[1143] Results are shown graphically in FIG. 122, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
signal from the internal control probe, while the dark bars
represent the net signal from the R-2 mutant probe. Synthetic
targets are indicated as SynIC and SynMT for internal control and
mutant R-2 controls, respectively and SynHET for a mixture of the
two to simulate a sample that is heterozygous at the R-2 allele.
The sample that does not have the MT R-2 allele is easily
identified by having a strong signal from only the IC probe, while
that which is heterozygous at the R-2 allele is identified by
having signals from both the IC and the MT R-2 probes, but at a
ratio near 2:1. A sample homozygous for the mutation at the R-2
allele (not shown) would show nearly equal signal from each probe,
as shown with the SynMT control.
Example 59
Detection of Single Nucleotide Polymorphisms in the Human
TNF-.alpha. Gene
[1144] The human cytokine tumor necrosis factor .alpha.
(TNF-.alpha.) gene has been shown to be a major factor in graft
rejection; the more TNF-.alpha. present in the system, the greater
the rejection response to transplanted tissue. The mutation
detected in this example is located in the promoter region of the
TNF-.alpha. gene at position -308 (minus 308). The WT guanine (G)
is replaced with a MT adenine (A). This result of this promoter
mutation is the enhancement of transcription of TNF-.alpha. by 6 to
7 fold. This Example describes an assay for the detection of the
-308 mutation in the promoter of the human TNF-.alpha. gene.
INVADER and probe oligonucleotide sets were designed as described
above to detect both the WT and MT alleles at the -308 site
(INVADER, WT probe, and MT probe are SEQ ID NOS:235, 236 and 237,
respectively; FRET cassette is SEQ ID NO:225). Positive control
targets were synthesized for the WT and MT alleles at the -308 site
(SEQ ID NOS:233 and 234, respectively); oligonucleotides are shown
in FIGS. 123A and 123B.
[1145] Purified human genomic DNA samples (M2, M3 and M4) were
donated by the Mayo Clinic (Rochester Minn.).
Triplicate reactions were performed as described in Example 54,
except they were stopped after the four hour incubation at
63.degree. C. by the addition 100 .mu.l of 100 mM EDTA. Reactions
comprising the synthetic targets as positive controls included 100
zmoles of the synthetic target and 1 .mu.g of yeast tRNA. No target
controls received 1 .mu.g of yeast tRNA instead of human genomic
DNA. 100 .mu.l of each stopped reaction was transferred to a Nunc
96 well Maxisorb plate (VWR Scientific) and read on a CYTOFLUOR
Multi-well Plate Reader Series 4000 (PerSeptive Biosystems) using
the following parameters: Excitation wavelength/bandwidth 485 nm/20
nm, Emission wavelength/bandwidth 530 nm/25 nm; gain 65.
[1146] Results are shown graphically in FIG. 124, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the wild-type probe, while the dark bars
represent the net averaged signal from the mutant probe. The
synthetic targets are indicated as SynWT and SynMT for wild-type
and mutant controls, respectively and SynHET for a mixture of the
two to simulate a heterozygous sample. The samples that are
homozygous for either WT or MT are easily identified by having a
strong signal from only one probe or the other, while the
heterozygous sample is easily identified by having signals from
both the WT and MT probes.
Example 60
Detection of the Factor V Leiden Mutation
[1147] The "Leiden" mutation in blood coagulation factor V results
from a cytosine "C" to a thymidine "T" base change in exon 1 of the
factor V gene. The mutant protein has glutamine at amino acid
position 506, instead of the wild-type arginine. This substitution
prevents activated protein C from cleaving and inactivating factor
V. The active form of the protein therefore remains abundant in the
blood stream and continues to promote coagulation. This Example
describes an assay for the detection of the Leiden mutation of the
human factor V gene.
INVADER and probe oligonucleotide sets were designed as described
above to detect both the WT and MT alleles at the 506 site
(INVADER, WT probe, and MT probe are SEQ ID NOS:240, 241 and 242,
respectively; the FRET cassette is SEQ ID NO:225). Positive control
targets were synthesized for the WT and MT alleles at the 506 site
(SEQ ID NOS:238 and 239, respectively); oligonucleotides are shown
in FIGS. 125A and 125B.
[1148] Whole blood samples were obtained from the Midwest
Hemostasis Center (Muncie, Ind.). Samples were characterized for
the Factor V Leiden genotype by the Midwest Hemostasis Center via
methods involving PCR. Buffy coats were isolated as previously
described, and genomic DNA was purified using the QIAamp 96 DNA
Blood Kit (Qiagen, Valencia) according to the manufacturer's
instructions, except that the samples were eluted in 200 .mu.l of
elution buffer. The purified DNA samples were quantitated by Pico
Green (Molecular Probes) and were then diluted with TE to a
concentration of 15-60 ng per .mu.l. Single reactions were
performed as described in Example 54. The no-target control
reaction received 1 .mu.g of yeast tRNA instead of DNA, and the
reactions comprising the synthetic targets as positive controls
included 200 zmoles of the synthetic target and 1 .mu.g of yeast
tRNA.
[1149] After the 4 hour incubation at 63.degree. C., reactions were
read directly on a CYTOFLUOR Multi-well Plate Reader Series 4000
(PerSeptive Biosystems) using the following parameters: Excitation
wavelength/bandwidth 485 nm/20 nm, Emission wavelength/bandwidth
530 nm/25 nm, gain 65.
[1150] Results are shown graphically in FIG. 126, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the wild-type probe, while the dark bars
represent the net averaged signal from the mutant probe. The
synthetic targets are indicated as SynWT and SynMT for wild-type
and mutant controls, respectively and SynHET for a mixture of the
two to simulate a heterozygous sample. The samples that are
homozygous for either WT or MT are easily identified by having a
strong signal from only one probe or the other, while the
heterozygous samples are easily identified by having signals from
both the WT and MT probes.
Example 61
Detection of Methicillin-Resistant Staphalococcus aureus
[1151] Staphylococcus aureus is recognized as one of the major
causes of infections in humans occurring both in the hospital and
in the community at large. One of the most serious concerns in
treating any bacterial infection is the increasing resistance to
antibiotics. The growing incidence of methicillin-resistant S.
aureus (MRSA) infections worldwide has underscored the importance
of both early detection of the infective agent, and defining a
resistance profile such that proper treatment can be given. The
primary mechanism for resistance to methicillin involves the
production of a protein called PBP2a, encoded by the mecA gene. The
mecA gene is not native to Staphalococcus aureus, but is of
extra-species origin. The mecA gene is, however, indicative of
methicillin resistance and is used as a marker for the detection of
resistant bacteria. To identify methicillin resistant S. aureus via
nucleic acid techniques, both the mecA gene and at least one
species specific gene must be targeted. A particular
species-specific gene, the nuclease or nuc gene is used in the
following example. This Example describes an assay for the
detection of MRSA.
[1152] INVADER and probe oligonucleotide sets were designed as
described above to detect both the mecA gene and the nuc gene (meA
INVADER and probe, are SEQ ID NOS:243 and 244, respectively; nuc
INVADER and probe are SEQ ID NOS:246 and 247, respectively; the
FRET cassette for both INVADER/probe sets is SEQ ID NO:245);
oligonucleotides are shown in FIGS. 127A and 127B. The mecA and nuc
target sequences shown are SEQ ID NOS:252 and 253, respectively.
Samples of methicillin-resistant Staphalococcus aureus were
purchased from American Type Culture Collection (ATCC, Catalog
#33591). Samples of methicillin sensitive Staphalococcus aureus
(MSSA) were obtained from Gene Trak, Inc. (GT#2431), and samples of
Staphalococcus haemolyticus were obtained from ATCC (ATCC#29970).
The bacterial samples were streaked onto standard blood agar plates
and grown at 37.degree. C. for 14-18 hours. DNA samples from MRSA,
MSSA, and S. haemolyticus were prepared as follows. A single colony
was suspended in 50 .mu.l of 10 mM TRIS pH 7.5 in a 1.5 ml
microfuge tube. The sample was incubated at 65.degree. C. for 5
minutes, and then micro-waved on the highest setting for 4 minutes.
Ten .mu.l of this preparation was used in each reaction.
[1153] Positive controls were created by polymerase chain reaction.
A 533 base-pair DNA fragment of the mecA sequence and a 467 base
pair DNA fragment of the nuc gene sequence were amplified and
isolated as follows. PCR primer sequences used for mecA gene
amplification were 5'-AAA ATC GAT GGT AAA GGT TGG C-3'' (SEQ ID
NO:248) and 5'-AGT TCT GCA GTA CCG GAT TTG C-3' (SEQ ID NO:249).
PCR primer sequences used for nuc gene sequence amplification were
5'-TCGCTACTAGTTGCTTAGTG-3' (SEQ ID NO:250) and
5'-GTAAACATAAGCAACTTTAG-3' (SEQ ID NO:251). MRSA and MSSA target
DNA was isolated as described above. PCR reactions were done using
the AMPLITAQ DNA Polymerase Kit with GENEAMP (PE Corporation
Catalog #N.sub.808-0152). Separate reactions were done for the mecA
and nuc sequences, and were performed in a 100 .mu.l final volume
containing the following components: 10 .mu.l of 10.times.PCR
buffer, 2.5 .mu.l of 110 M upstream primer and downstream primer, 2
.mu.l of 10 mM dNTP mix, 1.0 .mu.l AMPLITAQ DNA polymerase, 2 .mu.l
(10-50 ng) of bacterial DNA (the MRSA or the MSSA), and 80 .mu.l of
water for a final volume of 100 .mu.l. Reactions were covered with
approximately 50 .mu.l of CHILLOUT liquid wax (MJ Research) and
cycled as follows: the mecA reactions were denatured at 97.degree.
C. for 3 minutes. Reactions were then cycled at 97.degree. C. for 1
minute, 52.degree. C. for 30 seconds, 72.degree. C. for 1 minute.
This was repeated 5 times. After the final 72.degree. C. 1 minute
incubation, reactions were again heated to 94.degree. C. for 30
seconds, 52.degree. C. for 30 seconds and 72.degree. C. for 1
minute, for 30 cycles. mecA reactions were then incubated at
72.degree. C. for 7 minutes, then held at 4.degree. C. until
purification.
[1154] The nuc amplification reactions were denatured at 97.degree.
C. for 3 minutes. Reactions were then cycled at 97.degree. C. for 1
minute, 48.degree. C. for 30 seconds, 72.degree. C. for 1 minute.
This was repeated for 5 cycles. After the final 72.degree. C., 1
minute incubation, reactions were heated to 94.degree. C. for 30
seconds, 48.degree. C. for 30 seconds and 72.degree. C. for 1
minute. This was repeated for 30 cycles. Reactions were then
incubated at 72.degree. C. for 7 minutes, and finally cooled to
4.degree. C. and held until purification.
[1155] After amplification, reactions were run on a 1% agarose gel
in 1% TBE buffer with 50-2000 base-pair markers (Novagen, Cat#
69278-3); bands were visualized via ethidium bromide staining
followed by ultraviolet illumination. The appropriately sized bands
were excised from the gel and purified by the QIAquick Gel
Extraction Kit (QiagenCat# 28704) according to the manufacturer's
protocol. Each column was eluted twice with 50 .mu.l of elution
buffer. The concentration of the purified PCR synthetic target DNA
was determined by OD.sub.260, and diluted to a stock concentration
of 50 fmoles per microliter. Positive controls were used at a
concentration of 10 amole per reaction with a 10 .mu.l addition.
Control reactions with no target were also performed, using human
genomic DNA at 10 ng/.mu.l in place of a bacterial sample. All
samples were added in a volume of 10 .mu.l.
[1156] INVADER reactions were performed in MJ 96 well Low Profile
Polypropylene Microplates (MJ Research MLL-9601) in duplicate in a
final volume of 15 .mu.l. An INVADER reaction master mix was
prepared and contained (per reaction) 1.5 .mu.l water, 2.5 .mu.l
100 mM MOPS, 5 .mu.l of 20% PEG (8000MW), 0.5 .mu.l of 1 .mu.M nuc
INVADER oligonucleotide and 0.5 .mu.l of mecA INVADER
oligonucleotide. Five .mu.l of the INVADER master mix were added to
each sample and control well. 10 .mu.l of the target bacterial DNA
samples, prepared as described above, or 10 .mu.l (10 amoles) of
positive control target, or 10 .mu.l (10 ng of human genomic DNA)
of the no target control sample were added to each well. Samples
were overlaid with 15 .mu.l clear Chill-out wax (MJ Research,) and
incubated at 95.degree. C. for 5 minutes in an MJ Research
Thermocycler with Hot Bonnet. Two different probe master mixes were
prepared, one containing the mecA probe oligonucleotide, one
containing the nuc probe oligonucleotide. The probe master mixes
contained (per reaction) 2 .mu.l of 93.75 mM MgCl.sub.2, 1 .mu.l of
10 .mu.M FRET oligonucleotide, 1 .mu.l of either 10 .mu.M mecA
probe oligonucleotide or 10 .mu.M nuc probe oligonucleotide, 11 of
100 ng/.mu.l Afu FEN-1 enzyme (Third Wave Technologies, Cat #
96004D). The temperature was cooled to 64.degree. C. and 5 .mu.l of
the appropriate probe master mix (such that each control or sample
reaction is tested with both the mecA and the nuc probe) was added
below the Chill-out wax layer to each well and mixed by pipetting
up and down 5 times. The plate was covered with MICROSEAL `A` Film
(MJ Research,) and incubated at 64.degree. C. for 30 minutes. After
the 30 minute incubation, reactions were cooled to room
temperature, placed on a Perkin Elmer MICROAMP base (cat#
N801-0531) and read on a CYTOFLUOR Multi-well Plate Reader Series
4000 (PerSeptive Biosystems) using the following parameters:
Excitation wavelength/bandwidth 485 nm/20 nm, Emission
wavelength/bandwidth 530 nm/25 nm, gain 40, 30 reads per well,
temperature 25.degree. C.
[1157] Results are shown graphically in FIG. 128, with target DNAs
indicated on the horizontal axis and the fluorescence units
indicated on the vertical axis. The white bars represent the net
averaged signal from the mecA probe, while the dark bars represent
the net averaged signal from the nuc probe.
Example 62
One step LAMP+Invader Assays
[1158] As indicated in the Detailed Description of the Invention,
the Invader assay can be used to detect synthetic DNA produced
using loop-mediated isothermal amplification ("LAMP") methods (as
described, e.g., in U.S. Pat. No. 6,410,278). It is reported that
LAMP is able to amplify up to 500 bp segments of a target nucleic
acid, however, 200-300 bp is considered as the effective range. If
the primers are well designed and conditions are optimal, the
sensitivity of LAMP is about 10 copies of target, and DNA target
can be generally be amplified 10.sup.9-10.sup.10 times in 1 hour at
a constant temperature.
[1159] We conducted experiments to determine whether conditions
could be found that would allow the LAMP amplification and Invader
assay detection reactions to be conducted in a single "all in one"
reaction mixture.
[1160] The basic lay-out of primers configured to amplify a
synthetic DNA from a target nucleic acid using LAMP is shown in
FIG. 131A and a diagram of loop formation and amplification is
shown in FIG. 131B. Designs for LAMP primers and Invader assay
oligonucleotides to detect Factor II and Factor V alleles are shown
in FIG. 132. The primer locations are shown boxed, and the binding
sites for the oligonucleotides configured to form an invasive
cleavage structure are shown underlined: the Invader assay probe
binding site is indicated by dotted underline, and the Invader
oligonucleotide binding site is indicated by double underline. The
LAMP primers were designed using PrimerExplorer, a web-based design
software from Eiken Genome Site
(primerexplorer.jp/elamp3.0.0/index.html). LAMP reaction buffer
components typically include 20 mM Tris-HCl, pH 8.0, 10 mM KCl, 8
mM MgSO.sub.4, 10 mM (NH.sub.4).sub.2SO.sub.4, 0.1% Tween 20
detergent, 0.8 M betaine, and 1.4 mM dNTPs. Amplification is
typically uses Bacillus stearothermophilus (Bst) polymerase, large
fragment, and are typically run from 15 to 60 min at 60-65.degree.
C. for amplification, followed by 10 min at 80.degree. C. for
inactivation of the Bst polymerase. In 2-step reactions, the LAMP
products were then detected using the Invader assay, run for 1 or 5
minutes. The Invader assays were configured to use a primary
reaction recognizing the target nucleic acid, and a secondary
reaction comprising a FRET cassette, as described, e.g., in
Examples 54-61.
[1161] Both designs were initially tested in the absence of Invader
assay reagents and both were able to produce synthetic DNA by LAMP
from 2.5 ng of genomic DNA starting material in 1 hour at
63.degree. C. reaction in the first attempt (see FIG. 133).
[1162] Experiments with different reaction buffers were conducted
to determine whether buffer conditions could be found that would
allow the LAMP assay and the Invader assay steps to be run in the
same reaction mixture.
[1163] FIG. 134 shows the results of testing the one-step (all
components together at the start of the reaction) LAMP+Invader
assay combination in either LAMP buffer or Invader Plus buffer.
[1164] LAMP buffer v1 contained 20 mM Tris-HCl, pH 8.0, 10 mM KCl,
8 mM MgSO4, 10 mM (NH4)2SO4, 0.1% Tween 20 detergent, 0.8 M
betaine, and 1.4 mM dNTPs.
[1165] LAMP buffer v2 has the same components, but has reduced
concentrations of KCl, MgSO.sub.4, and (NH.sub.4).sub.2SO.sub.4.
LAMP buffer v2 contained 20 mM Tris-HCl, pH 8.0, 5 mM KCl, 7.5 mM
MgSO.sub.4, 5 mM NH.sub.4).sub.2SO.sub.4, 0.1% Tween 20 detergent,
0.8 M betaine, and 1.4 mM dNTPs.
[1166] Invader Plus buffer contained 10 mM MOPS, pH 7.5, 7.5 mM
MgSO.sub.4, and 0.025 mM dNTPs.
[1167] The results shown in FIG. 134 show that the highest signals
in this test were achieved in Lamp buffer v2. Additional reaction
conditions were tested, as indicated in FIG. 135. Factor II
LAMP-Invader reactions were used in the detection of 4.5 ng of
genomic DNA (60 min LAMP (63.degree. C., 10 min 80.degree. C., 30
min Invader (63.degree. C.). These results indicate that, of these
different buffers tested, the combined LAMP+Invader assay favored
0.75.times.LAMP reaction buffer v1.
[1168] Additional tests, not shown, showed that the Klenow large
fragment (exo.sup.-) DNA polymerase used at 37.degree. C. was not
able to replace Bst DNA polymerase in the LAMP-Invader reaction,
and that LAMP amplified product did not accumulate when the Klenow
polymerase was used. Additional tests also showed that using Ave
FEN-1 inhibited LAMP amplification in the LAMP-Invader reactions,
when used in place of Afu FEN-1 in the reaction conditions
described above.
[1169] These data show that LAMP primers designed using the
PrimerExplorer design software were able to generate LAMP amplicons
that were detectable using the Factor II and V Invader Plus
reactions. While not limiting the methods of the invention to any
particular configuration, when the `target` region between the sets
of LAMP primers is to be detected using the Invader assay, it
appears to be important to ensure that the LAMP primers do not
significantly overlap with the Invader assay oligonucleotide
footprint.
[1170] These data also show that the LAMP amplification and Invader
reaction components can be compatible in an all-in-one reaction.
The Factor II LAMP+Invader reaction successfully detected 4.5 ng of
genomic DNA.
Example 63
LAMP+Invader Assay detection of mrsA59 of C. trachomatis
[1171] Designs for LAMP primers and Invader assay oligonucleotides
to detect mrsA59 are shown in FIG. 136. The primer locations are
indicated, and the binding sites for the oligonucleotides
configured to form an invasive cleavage structure are shown
underlined: the Invader assay probe binding site is indicated by
dotted underline, and the Invader oligonucleotide binding site is
indicated by double underline. One step LAMP+Invader assays were
run as described above, in 0.75.times.LAMP buffer v1, with a 60
minute LAMP reaction, followed by heat killing the polymerase, then
a 30 or 60 min incubation to run the Invader assay component of the
combined reaction.
[1172] The results are shown in FIG. 137. These data show that the
unified reactions were able to detect 500 copies of sample DNA.
LAMP amplification was confirmed by spiking completed reactions
into separate brief Invader assay reaction (left panel of FIG. 138)
and by agarose gel electrophoresis (right panel of FIG. 138).
Example 63
LAMP+Invader Assay detection of pmpA765 of C. trachomatis
[1173] Designs for LAMP primers and Invader assay oligonucleotides
to detect pmpA765 are shown in FIG. 139. The LAMP oligonucleotides
were designed by using PrimerExplorer to produce a 239 bp amplicon.
The primer locations are indicated, and the binding sites for the
oligonucleotides configured to form an invasive cleavage structure
are shown underlined: the Invader assay probe binding site is
indicated by dotted underline, and the Invader oligonucleotide
binding site is indicated by double underline. The PrimerExplorer
software was only able to generate one loop primer (F loop) due to
the constraints of the Invader assay footprint and the loop size.
The second loop primer (B loop) was manually designed.
[1174] LAMP+Invader assays were run as described above, with and
without loop primers, in 0.75.times.LAMP buffer v1, with a 60
minute LAMP reaction, followed by heat killing the polymerase, then
a 30 or 60 min incubation to run the Invader assay component of the
combined reaction. The LAMP-Invader assay reactions (without or
with loop primers) showed minimal net signal generation for targets
ranging from 100 to 130,000 copies of CT-D sample DNA targets (FIG.
140). Experiments spiking the LAMP-Invader reaction products into
Invader reactions, however, confirmed LAMP amplification, showing
saturated signal generation with DNA target down to 100 copies
(FIG. 141, left panel), and agarose gel analysis confirmed LAMP
amplified products starting at 100 copies level, but not with 10
copies (FIG. 141, right panel). The spike-in and agarose gel
analyses confirmed that the LAMP amplification was successful, but
the Invader assay detection in the same reaction was only able to
generate minimal signal.
[1175] The buffers for the all-in-one LAMP+Invader Assay reactions
were studied by a titration of Invader Plus buffer against LAMP
buffer in ratios of 100:0, 75:25, 50:50, 25:75 and 0:100, with the
dNTPs constant at 1.4 mM. For these titrations, InvaderPlus buffer
contained 10 mM MOPS, pH 7.5, 7.5 mM MgSO.sub.4, and 1.4 mM dNTPs,
while the LAMP buffer contained 20 mM Tris-HCl, pH 8.0, 10 mM KCl,
8 mM MgSO.sub.4, 10 mM (NH.sub.4).sub.2SO.sub.4, 0.1% Tween 20
detergent, 0.8 M betaine, and 1.4 mM dNTPs.
[1176] Both the mrsA59 and pmpA765 assays were tested using the
one-step procedure (all reactants mixed at the start of the
reaction) and using reactions comprising a 60 min LAMP incubation,
and a heat kill of the polymerase followed by a 30 or 60 min
Invader assay incubation. The data from these tests showed that the
pmpA765 reaction design could readily detect 10 to 45 copies of
target DNA when the Invader Plus buffer was used, but that the
reaction sensitivity decreased with the increasing proportion of
LAMP buffer. In contrast, the mrsA50 reaction design performed best
in the LAMP assay buffer, and the reaction sensitivity decreased
with the increasing proportion of Invader Plus buffer.
[1177] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described methods and systems
of the invention will be apparent to those skilled in the art
without departing from the scope and spirit of the invention.
Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the
invention as claimed should not be unduly limited to such specific
embodiments. Indeed, various modifications of the described modes
for carrying out the invention which are obvious to those skilled
in the relevant fields are intended to be within the scope of the
following claims.
Sequence CWU 1
1
26912506DNAArtificial SequenceSynthetic 1atgaggggga tgctgcccct
ctttgagccc aagggccggg tcctcctggt ggacggccac 60cacctggcct accgcacctt
ccacgccctg aagggcctca ccaccagccg gggggagccg 120gtgcaggcgg
tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac
180gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc
ctacgggggg 240tacaaggcgg gccgggcccc cacgccggag gactttcccc
ggcaactcgc cctcatcaag 300gagctggtgg acctcctggg gctggcgcgc
ctcgaggtcc cgggctacga ggcggacgac 360gtcctggcca gcctggccaa
gaaggcggaa aaggagggct acgaggtccg catcctcacc 420gccgacaaag
acctttacca gctcctttcc gaccgcatcc acgtcctcca ccccgagggg
480tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga
ccagtgggcc 540gactaccggg ccctgaccgg ggacgagtcc gacaaccttc
ccggggtcaa gggcatcggg 600gagaagacgg cgaggaagct tctggaggag
tgggggagcc tggaagccct cctcaagaac 660ctggaccggc tgaagcccgc
catccgggag aagatcctgg cccacatgga cgatctgaag 720ctctcctggg
acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa
780aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga
gtttggcagc 840ctcctccacg agttcggcct tctggaaagc cccaaggccc
tggaggaggc cccctggccc 900ccgccggaag gggccttcgt gggctttgtg
ctttcccgca aggagcccat gtgggccgat 960cttctggccc tggccgccgc
cagggggggc cgggtccacc gggcccccga gccttataaa 1020gccctcaggg
acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc
1080ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc
ctacctcctg 1140gacccttcca acaccacccc cgagggggtg gcccggcgct
acggcgggga gtggacggag 1200gaggcggggg agcgggccgc cctttccgag
aggctcttcg ccaacctgtg ggggaggctt 1260gagggggagg agaggctcct
ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320ctggcccaca
tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc
1380ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct
ggccggccac 1440cccttcaacc tcaactcccg ggaccagctg gaaagggtcc
tctttgacga gctagggctt 1500cccgccatcg gcaagacgga gaagaccggc
aagcgctcca ccagcgccgc cgtcctggag 1560gccctccgcg aggcccaccc
catcgtggag aagatcctgc agtaccggga gctcaccaag 1620ctgaagagca
cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc
1680cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc
cgatcccaac 1740ctccagaaca tccccgtccg caccccgctt gggcagagga
tccgccgggc cttcatcgcc 1800gaggaggggt ggctattggt ggccctggac
tatagccaga tagagctcag ggtgctggcc 1860cacctctccg gcgacgagaa
cctgatccgg gtcttccagg aggggcggga catccacacg 1920gagaccgcca
gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgccgg
1980gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg
cctctcccag 2040gagctagcca tcccttacga ggaggcccag gccttcattg
agcgctactt tcagagcttc 2100cccaaggtgc gggcctggat tgagaagacc
ctggaggagg gcaggaggcg ggggtacgtg 2160gagaccctct tcggccgccg
ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220cgggaggcgg
ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc
2280atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc
caggatgctc 2340cttcaggtcc acgacgagct ggtcctcgag gccccaaaag
agagggcgga ggccgtggcc 2400cggctggcca aggaggtcat ggagggggtg
tatcccctgg ccgtgcccct ggaggtggag 2460gtggggatag gggaggactg
gctctccgcc aaggagtgat accacc 250622496DNAArtificial
SequenceSynthetic 2atggcgatgc ttcccctctt tgagcccaaa ggccgcgtgc
tcctggtgga cggccaccac 60ctggcctacc gcaccttctt tgccctcaag ggcctcacca
ccagccgcgg cgaacccgtt 120caggcggtct acggcttcgc caaaagcctc
ctcaaggccc tgaaggagga cggggacgtg 180gtggtggtgg tctttgacgc
caaggccccc tccttccgcc acgaggccta cgaggcctac 240aaggcgggcc
gggcccccac cccggaggac tttccccggc agctggccct catcaaggag
300ttggtggacc tcctaggcct tgtgcggctg gaggttcccg gctttgaggc
ggacgacgtg 360ctggccaccc tggccaagcg ggcggaaaag gaggggtacg
aggtgcgcat cctcactgcc 420gaccgcgacc tctaccagct cctttcggag
cgcatcgcca tcctccaccc tgaggggtac 480ctgatcaccc cggcgtggct
ttacgagaag tacggcctgc gcccggagca gtgggtggac 540taccgggccc
tggcggggga cccctcggat aacatccccg gggtgaaggg catcggggag
600aagaccgccc agaggctcat ccgcgagtgg gggagcctgg aaaacctctt
ccagcacctg 660gaccaggtga agccctcctt gcgggagaag ctccaggcgg
gcatggaggc cctggccctt 720tcccggaagc tttcccaggt gcacactgac
ctgcccctgg aggtggactt cgggaggcgc 780cgcacaccca acctggaggg
tctgcgggct tttttggagc ggttggagtt tggaagcctc 840ctccacgagt
tcggcctcct ggaggggccg aaggcggcag aggaggcccc ctggccccct
900ccggaagggg cttttttggg cttttccttt tcccgtcccg agcccatgtg
ggccgagctt 960ctggccctgg ctggggcgtg ggaggggcgc ctccatcggg
cacaagaccc ccttaggggc 1020ctgagggacc ttaagggggt gcggggaatc
ctggccaagg acctggcggt tttggccctg 1080cgggagggcc tggacctctt
cccagaggac gaccccatgc tcctggccta ccttctggac 1140ccctccaaca
ccacccctga gggggtggcc cggcgttacg ggggggagtg gacggaggat
1200gcgggggaga gggccctcct ggccgagcgc ctcttccaga ccctaaagga
gcgccttaag 1260ggagaagaac gcctgctttg gctttacgag gaggtggaga
agccgctttc ccgggtgttg 1320gcccggatgg aggccacggg ggtccggctg
gacgtggcct acctccaggc cctctccctg 1380gaggtggagg cggaggtgcg
ccagctggag gaggaggtct tccgcctggc cggccacccc 1440ttcaacctca
actcccgcga ccagctggag cgggtgctct ttgacgagct gggcctgcct
1500gccatcggca agacggagaa gacggggaaa cgctccacca gcgctgccgt
gctggaggcc 1560ctgcgagagg cccaccccat cgtggaccgc atcctgcagt
accgggagct caccaagctc 1620aagaacacct acatagaccc cctgcccgcc
ctggtccacc ccaagaccgg ccggctccac 1680acccgcttca accagacggc
caccgccacg ggcaggcttt ccagctccga ccccaacctg 1740cagaacatcc
ccgtgcgcac ccctctgggc cagcgcatcc gccgagcctt cgtggccgag
1800gagggctggg tgctggtggt cttggactac agccagattg agcttcgggt
cctggcccac 1860ctctccgggg acgagaacct gatccgggtc tttcaggagg
ggagggacat ccacacccag 1920accgccagct ggatgttcgg cgtttccccc
gaaggggtag accctctgat gcgccgggcg 1980gccaagacca tcaacttcgg
ggtgctctac ggcatgtccg cccaccgcct ctccggggag 2040ctttccatcc
cctacgagga ggcggtggcc ttcattgagc gctacttcca gagctacccc
2100aaggtgcggg cctggattga ggggaccctc gaggagggcc gccggcgggg
gtatgtggag 2160accctcttcg gccgccggcg ctatgtgccc gacctcaacg
cccgggtgaa gagcgtgcgc 2220gaggcggcgg agcgcatggc cttcaacatg
ccggtccagg gcaccgccgc cgacctcatg 2280aagctggcca tggtgcggct
tttcccccgg cttcaggaac tgggggcgag gatgcttttg 2340caggtgcacg
acgagctggt cctcgaggcc cccaaggacc gggcggagag ggtagccgct
2400ttggccaagg aggtcatgga gggggtctgg cccctgcagg tgcccctgga
ggtggaggtg 2460ggcctggggg aggactggct ctccgccaag gagtag
249632504DNAArtificial SequenceSynthetic 3atggaggcga tgcttccgct
ctttgaaccc aaaggccggg tcctcctggt ggacggccac 60cacctggcct accgcacctt
cttcgccctg aagggcctca ccacgagccg gggcgaaccg 120gtgcaggcgg
tctacggctt cgccaagagc ctcctcaagg ccctgaagga ggacgggtac
180aaggccgtct tcgtggtctt tgacgccaag gccccctcct tccgccacga
ggcctacgag 240gcctacaagg cggggagggc cccgaccccc gaggacttcc
cccggcagct cgccctcatc 300aaggagctgg tggacctcct ggggtttacc
cgcctcgagg tccccggcta cgaggcggac 360gacgttctcg ccaccctggc
caagaaggcg gaaaaggagg ggtacgaggt gcgcatcctc 420accgccgacc
gcgacctcta ccaactcgtc tccgaccgcg tcgccgtcct ccaccccgag
480ggccacctca tcaccccgga gtggctttgg gagaagtacg gcctcaggcc
ggagcagtgg 540gtggacttcc gcgccctcgt gggggacccc tccgacaacc
tccccggggt caagggcatc 600ggggagaaga ccgccctcaa gctcctcaag
gagtggggaa gcctggaaaa cctcctcaag 660aacctggacc gggtaaagcc
agaaaacgtc cgggagaaga tcaaggccca cctggaagac 720ctcaggctct
ccttggagct ctcccgggtg cgcaccgacc tccccctgga ggtggacctc
780gcccaggggc gggagcccga ccgggagggg cttagggcct tcctggagag
gctggagttc 840ggcagcctcc tccacgagtt cggcctcctg gaggcccccg
cccccctgga ggaggccccc 900tggcccccgc cggaaggggc cttcgtgggc
ttcgtcctct cccgccccga gcccatgtgg 960gcggagctta aagccctggc
cgcctgcagg gacggccggg tgcaccgggc agcagacccc 1020ttggcggggc
taaaggacct caaggaggtc cggggcctcc tcgccaagga cctcgccgtc
1080ttggcctcga gggaggggct agacctcgtg cccggggacg accccatgct
cctcgcctac 1140ctcctggacc cctccaacac cacccccgag ggggtggcgc
ggcgctacgg gggggagtgg 1200acggaggacg ccgcccaccg ggccctcctc
tcggagaggc tccatcggaa cctccttaag 1260cgcctcgagg gggaggagaa
gctcctttgg ctctaccacg aggtggaaaa gcccctctcc 1320cgggtcctgg
cccacatgga ggccaccggg gtacggctgg acgtggccta ccttcaggcc
1380ctttccctgg agcttgcgga ggagatccgc cgcctcgagg aggaggtctt
ccgcttggcg 1440ggccacccct tcaacctcaa ctcccgggac cagctggaaa
gggtgctctt tgacgagctt 1500aggcttcccg ccttggggaa gacgcaaaag
acaggcaagc gctccaccag cgccgcggtg 1560ctggaggccc tacgggaggc
ccaccccatc gtggagaaga tcctccagca ccgggagctc 1620accaagctca
agaacaccta cgtggacccc ctcccaagcc tcgtccaccc gaggacgggc
1680cgcctccaca cccgcttcaa ccagacggcc acggccacgg ggaggcttag
tagctccgac 1740cccaacctgc agaacatccc cgtccgcacc cccttgggcc
agaggatccg ccgggccttc 1800gtggccgagg cgggttgggc gttggtggcc
ctggactata gccagataga gctccgcgtc 1860ctcgcccacc tctccgggga
cgaaaacctg atcagggtct tccaggaggg gaaggacatc 1920cacacccaga
ccgcaagctg gatgttcggc gtccccccgg aggccgtgga ccccctgatg
1980cgccgggcgg ccaagacggt gaacttcggc gtcctctacg gcatgtccgc
ccataggctc 2040tcccaggagc ttgccatccc ctacgaggag gcggtggcct
ttatagaggc tacttccaaa 2100gcttccccaa ggtgcgggcc tggatagaaa
agaccctgga ggaggggagg aagcggggct 2160acgtggaaac cctcttcgga
agaaggcgct acgtgcccga cctcaacgcc cgggtgaaga 2220gcgtcaggga
ggccgcggag cgcatggcct tcaacatgcc cgtccagggc accgccgccg
2280acctcatgaa gctcgccatg gtgaagctct tcccccgcct ccgggagatg
ggggcccgca 2340tgctcctcca ggtccacgac gagctcctcc tggaggcccc
ccaagcgcgg gccgaggagg 2400tggcggcttt ggccaaggag gccatggaga
aggcctatcc cctcgccgtg cccctggagg 2460tggaggtggg gatgggggag
gactggcttt ccgccaaggg ttag 25044832PRTArtificial SequenceSynthetic
4Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu1 5
10 15Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys
Gly20 25 30Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly
Phe Ala35 40 45Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala
Val Ile Val50 55 60Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu
Ala Tyr Gly Gly65 70 75 80Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu
Asp Phe Pro Arg Gln Leu85 90 95Ala Leu Ile Lys Glu Leu Val Asp Leu
Leu Gly Leu Ala Arg Leu Glu100 105 110Val Pro Gly Tyr Glu Ala Asp
Asp Val Leu Ala Ser Leu Ala Lys Lys115 120 125Ala Glu Lys Glu Gly
Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp130 135 140Leu Tyr Gln
Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly145 150 155
160Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg
Pro165 170 175Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu
Ser Asp Asn180 185 190Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr
Ala Arg Lys Leu Leu195 200 205Glu Glu Trp Gly Ser Leu Glu Ala Leu
Leu Lys Asn Leu Asp Arg Leu210 215 220Lys Pro Ala Ile Arg Glu Lys
Ile Leu Ala His Met Asp Asp Leu Lys225 230 235 240Leu Ser Trp Asp
Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val245 250 255Asp Phe
Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe260 265
270Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu
Leu275 280 285Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro
Pro Glu Gly290 295 300Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu
Pro Met Trp Ala Asp305 310 315 320Leu Leu Ala Leu Ala Ala Ala Arg
Gly Gly Arg Val His Arg Ala Pro325 330 335Glu Pro Tyr Lys Ala Leu
Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu340 345 350Ala Lys Asp Leu
Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro355 360 365Pro Gly
Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn370 375
380Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr
Glu385 390 395 400Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu
Phe Ala Asn Leu405 410 415Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu
Leu Trp Leu Tyr Arg Glu420 425 430Val Glu Arg Pro Leu Ser Ala Val
Leu Ala His Met Glu Ala Thr Gly435 440 445Val Arg Leu Asp Val Ala
Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala450 455 460Glu Glu Ile Ala
Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His465 470 475 480Pro
Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp485 490
495Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys
Arg500 505 510Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala
His Pro Ile515 520 525Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr
Lys Leu Lys Ser Thr530 535 540Tyr Ile Asp Pro Leu Pro Asp Leu Ile
His Pro Arg Thr Gly Arg Leu545 550 555 560His Thr Arg Phe Asn Gln
Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser565 570 575Ser Asp Pro Asn
Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln580 585 590Arg Ile
Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala595 600
605Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser
Gly610 615 620Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp
Ile His Thr625 630 635 640Glu Thr Ala Ser Trp Met Phe Gly Val Pro
Arg Glu Ala Val Asp Pro645 650 655Leu Met Arg Arg Ala Ala Lys Thr
Ile Asn Phe Gly Val Leu Tyr Gly660 665 670Met Ser Ala His Arg Leu
Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu675 680 685Ala Gln Ala Phe
Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg690 695 700Ala Trp
Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val705 710 715
720Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala
Arg725 730 735Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe
Asn Met Pro740 745 750Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu
Ala Met Val Lys Leu755 760 765Phe Pro Arg Leu Glu Glu Met Gly Ala
Arg Met Leu Leu Gln Val His770 775 780Asp Glu Leu Val Leu Glu Ala
Pro Lys Glu Arg Ala Glu Ala Val Ala785 790 795 800Arg Leu Ala Lys
Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro805 810 815Leu Glu
Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu820 825
8305831PRTArtificial SequenceSynthetic 5Met Ala Met Leu Pro Leu Phe
Glu Pro Lys Gly Arg Val Leu Leu Val1 5 10 15Asp Gly His His Leu Ala
Tyr Arg Thr Phe Phe Ala Leu Lys Gly Leu20 25 30Thr Thr Ser Arg Gly
Glu Pro Val Gln Ala Val Tyr Gly Phe Ala Lys35 40 45Ser Leu Leu Lys
Ala Leu Lys Glu Asp Gly Asp Val Val Val Val Val50 55 60Phe Asp Ala
Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Glu Ala Tyr65 70 75 80Lys
Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu Ala85 90
95Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Val Arg Leu Glu
Val100 105 110Pro Gly Phe Glu Ala Asp Asp Val Leu Ala Thr Leu Ala
Lys Arg Ala115 120 125Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr
Ala Asp Arg Asp Leu130 135 140Tyr Gln Leu Leu Ser Glu Arg Ile Ala
Ile Leu His Pro Glu Gly Tyr145 150 155 160Leu Ile Thr Pro Ala Trp
Leu Tyr Glu Lys Tyr Gly Leu Arg Pro Glu165 170 175Gln Trp Val Asp
Tyr Arg Ala Leu Ala Gly Asp Pro Ser Asp Asn Ile180 185 190Pro Gly
Val Lys Gly Ile Gly Glu Lys Thr Ala Gln Arg Leu Ile Arg195 200
205Glu Trp Gly Ser Leu Glu Asn Leu Phe Gln His Leu Asp Gln Val
Lys210 215 220Pro Ser Leu Arg Glu Lys Leu Gln Ala Gly Met Glu Ala
Leu Ala Leu225 230 235 240Ser Arg Lys Leu Ser Gln Val His Thr Asp
Leu Pro Leu Glu Val Asp245 250 255Phe Gly Arg Arg Arg Thr Pro Asn
Leu Glu Gly Leu Arg Ala Phe Leu260 265 270Glu Arg Leu Glu Phe Gly
Ser Leu Leu His Glu Phe Gly Leu Leu Glu275 280 285Gly Pro Lys Ala
Ala Glu Glu Ala Pro Trp Pro Pro Pro Glu Gly Ala290 295 300Phe Leu
Gly Phe Ser Phe Ser Arg Pro Glu Pro Met Trp Ala Glu Leu305 310 315
320Leu Ala Leu Ala Gly Ala Trp Glu Gly Arg Leu His Arg Ala Gln
Asp325 330 335Pro Leu Arg Gly Leu Arg Asp Leu Lys Gly Val Arg Gly
Ile Leu Ala340 345 350Lys Asp Leu Ala Val Leu Ala Leu Arg Glu Gly
Leu Asp Leu Phe Pro355 360 365Glu Asp Asp Pro Met Leu Leu Ala Tyr
Leu Leu Asp Pro Ser Asn Thr370 375 380Thr Pro Glu Gly Val Ala Arg
Arg Tyr Gly Gly Glu Trp Thr Glu Asp385 390 395 400Ala Gly Glu Arg
Ala Leu Leu Ala Glu Arg Leu Phe Gln Thr Leu Lys405 410 415Glu Arg
Leu Lys Gly Glu Glu Arg Leu Leu Trp Leu Tyr Glu Glu Val420 425
430Glu Lys Pro Leu Ser Arg Val Leu Ala Arg Met Glu Ala Thr Gly
Val435 440 445Arg Leu Asp Val Ala Tyr Leu Gln Ala Leu Ser Leu Glu
Val Glu Ala450 455
460Glu Val Arg Gln Leu Glu Glu Glu Val Phe Arg Leu Ala Gly His
Pro465 470 475 480Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val
Leu Phe Asp Glu485 490 495Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu
Lys Thr Gly Lys Arg Ser500 505 510Thr Ser Ala Ala Val Leu Glu Ala
Leu Arg Glu Ala His Pro Ile Val515 520 525Asp Arg Ile Leu Gln Tyr
Arg Glu Leu Thr Lys Leu Lys Asn Thr Tyr530 535 540Ile Asp Pro Leu
Pro Ala Leu Val His Pro Lys Thr Gly Arg Leu His545 550 555 560Thr
Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser Ser565 570
575Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln
Arg580 585 590Ile Arg Arg Ala Phe Val Ala Glu Glu Gly Trp Val Leu
Val Val Leu595 600 605Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala
His Leu Ser Gly Asp610 615 620Glu Asn Leu Ile Arg Val Phe Gln Glu
Gly Arg Asp Ile His Thr Gln625 630 635 640Thr Ala Ser Trp Met Phe
Gly Val Ser Pro Glu Gly Val Asp Pro Leu645 650 655Met Arg Arg Ala
Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly Met660 665 670Ser Ala
His Arg Leu Ser Gly Glu Leu Ser Ile Pro Tyr Glu Glu Ala675 680
685Val Ala Phe Ile Glu Arg Tyr Phe Gln Ser Tyr Pro Lys Val Arg
Ala690 695 700Trp Ile Glu Gly Thr Leu Glu Glu Gly Arg Arg Arg Gly
Tyr Val Glu705 710 715 720Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro
Asp Leu Asn Ala Arg Val725 730 735Lys Ser Val Arg Glu Ala Ala Glu
Arg Met Ala Phe Asn Met Pro Val740 745 750Gln Gly Thr Ala Ala Asp
Leu Met Lys Leu Ala Met Val Arg Leu Phe755 760 765Pro Arg Leu Gln
Glu Leu Gly Ala Arg Met Leu Leu Gln Val His Asp770 775 780Glu Leu
Val Leu Glu Ala Pro Lys Asp Arg Ala Glu Arg Val Ala Ala785 790 795
800Leu Ala Lys Glu Val Met Glu Gly Val Trp Pro Leu Gln Val Pro
Leu805 810 815Glu Val Glu Val Gly Leu Gly Glu Asp Trp Leu Ser Ala
Lys Glu820 825 8306834PRTArtificial SequenceSynthetic 6Met Glu Ala
Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu1 5 10 15Val Asp
Gly His His Leu Ala Tyr Arg Thr Phe Phe Ala Leu Lys Gly20 25 30Leu
Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala35 40
45Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Tyr Lys Ala Val Phe50
55 60Val Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr
Glu65 70 75 80Ala Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe
Pro Arg Gln85 90 95Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly
Phe Thr Arg Leu100 105 110Glu Val Pro Gly Tyr Glu Ala Asp Asp Val
Leu Ala Thr Leu Ala Lys115 120 125Lys Ala Glu Lys Glu Gly Tyr Glu
Val Arg Ile Leu Thr Ala Asp Arg130 135 140Asp Leu Tyr Gln Leu Val
Ser Asp Arg Val Ala Val Leu His Pro Glu145 150 155 160Gly His Leu
Ile Thr Pro Glu Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175Pro
Glu Gln Trp Val Asp Phe Arg Ala Leu Val Gly Asp Pro Ser Asp180 185
190Asn Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Leu Lys
Leu195 200 205Leu Lys Glu Trp Gly Ser Leu Glu Asn Leu Leu Lys Asn
Leu Asp Arg210 215 220Val Lys Pro Glu Asn Val Arg Glu Lys Ile Lys
Ala His Leu Glu Asp225 230 235 240Leu Arg Leu Ser Leu Glu Leu Ser
Arg Val Arg Thr Asp Leu Pro Leu245 250 255Glu Val Asp Leu Ala Gln
Gly Arg Glu Pro Asp Arg Glu Gly Leu Arg260 265 270Ala Phe Leu Glu
Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly275 280 285Leu Leu
Glu Ala Pro Ala Pro Leu Glu Glu Ala Pro Trp Pro Pro Pro290 295
300Glu Gly Ala Phe Val Gly Phe Val Leu Ser Arg Pro Glu Pro Met
Trp305 310 315 320Ala Glu Leu Lys Ala Leu Ala Ala Cys Arg Asp Gly
Arg Val His Arg325 330 335Ala Ala Asp Pro Leu Ala Gly Leu Lys Asp
Leu Lys Glu Val Arg Gly340 345 350Leu Leu Ala Lys Asp Leu Ala Val
Leu Ala Ser Arg Glu Gly Leu Asp355 360 365Leu Val Pro Gly Asp Asp
Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro370 375 380Ser Asn Thr Thr
Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp385 390 395 400Thr
Glu Asp Ala Ala His Arg Ala Leu Leu Ser Glu Arg Leu His Arg405 410
415Asn Leu Leu Lys Arg Leu Glu Gly Glu Glu Lys Leu Leu Trp Leu
Tyr420 425 430His Glu Val Glu Lys Pro Leu Ser Arg Val Leu Ala His
Met Glu Ala435 440 445Thr Gly Val Arg Leu Asp Val Ala Tyr Leu Gln
Ala Leu Ser Leu Glu450 455 460Leu Ala Glu Glu Ile Arg Arg Leu Glu
Glu Glu Val Phe Arg Leu Ala465 470 475 480Gly His Pro Phe Asn Leu
Asn Ser Arg Asp Gln Leu Glu Arg Val Leu485 490 495Phe Asp Glu Leu
Arg Leu Pro Ala Leu Gly Lys Thr Gln Lys Thr Gly500 505 510Lys Arg
Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His515 520
525Pro Ile Val Glu Lys Ile Leu Gln His Arg Glu Leu Thr Lys Leu
Lys530 535 540Asn Thr Tyr Val Asp Pro Leu Pro Ser Leu Val His Pro
Arg Thr Gly545 550 555 560Arg Leu His Thr Arg Phe Asn Gln Thr Ala
Thr Ala Thr Gly Arg Leu565 570 575Ser Ser Ser Asp Pro Asn Leu Gln
Asn Ile Pro Val Arg Thr Pro Leu580 585 590Gly Gln Arg Ile Arg Arg
Ala Phe Val Ala Glu Ala Gly Trp Ala Leu595 600 605Val Ala Leu Asp
Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu610 615 620Ser Gly
Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Lys Asp Ile625 630 635
640His Thr Gln Thr Ala Ser Trp Met Phe Gly Val Pro Pro Glu Ala
Val645 650 655Asp Pro Leu Met Arg Arg Ala Ala Lys Thr Val Asn Phe
Gly Val Leu660 665 670Tyr Gly Met Ser Ala His Arg Leu Ser Gln Glu
Leu Ala Ile Pro Tyr675 680 685Glu Glu Ala Val Ala Phe Ile Glu Arg
Tyr Phe Gln Ser Phe Pro Lys690 695 700Val Arg Ala Trp Ile Glu Lys
Thr Leu Glu Glu Gly Arg Lys Arg Gly705 710 715 720Tyr Val Glu Thr
Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Asn725 730 735Ala Arg
Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn740 745
750Met Pro Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met
Val755 760 765Lys Leu Phe Pro Arg Leu Arg Glu Met Gly Ala Arg Met
Leu Leu Gln770 775 780Val His Asp Glu Leu Leu Leu Glu Ala Pro Gln
Ala Arg Ala Glu Glu785 790 795 800Val Ala Ala Leu Ala Lys Glu Ala
Met Glu Lys Ala Tyr Pro Leu Ala805 810 815Val Pro Leu Glu Val Glu
Val Gly Met Gly Glu Asp Trp Leu Ser Ala820 825 830Lys
Gly72502DNAArtificial SequenceSynthetic 7atgnnggcga tgcttcccct
ctttgagccc aaaggccggg tcctcctggt ggacggccac 60cacctggcct accgcacctt
cttcgccctg aagggcctca ccaccagccg gggcgaaccg 120gtgcaggcgg
tctacggctt cgccaagagc ctcctcaagg ccctgaagga ggacggggac
180nnggcggtgn tcgtggtctt tgacgccaag gccccctcct tccgccacga
ggcctacgag 240gcctacaagg cgggccgggc ccccaccccg gaggactttc
cccggcagct cgccctcatc 300aaggagctgg tggacctcct ggggcttgcg
cgcctcgagg tccccggcta cgaggcggac 360gacgtnctgg ccaccctggc
caagaaggcg gaaaaggagg ggtacgaggt gcgcatcctc 420accgccgacc
gcgacctcta ccagctcctt tccgaccgca tcgccgtcct ccaccccgag
480gggtacctca tcaccccggc gtggctttgg gagaagtacg gcctgaggcc
ggagcagtgg 540gtggactacc gggccctggc gggggacccc tccgacaacc
tccccggggt caagggcatc 600ggggagaaga ccgcccngaa gctcctcnag
gagtggggga gcctggaaaa cctcctcaag 660aacctggacc gggtgaagcc
cgccntccgg gagaagatcc aggcccacat ggangacctg 720angctctcct
gggagctntc ccaggtgcgc accgacctgc ccctggaggt ggacttcgcc
780aagnggcggg agcccgaccg ggaggggctt agggcctttc tggagaggct
ggagtttggc 840agcctcctcc acgagttcgg cctcctggag ggccccaagg
ccctggagga ggccccctgg 900cccccgccgg aaggggcctt cgtgggcttt
gtcctttccc gccccgagcc catgtgggcc 960gagcttctgg ccctggccgc
cgccagggag ggccgggtcc accgggcacc agaccccttt 1020angggcctna
gggacctnaa ggaggtgcgg ggnctcctcg ccaaggacct ggccgttttg
1080gccctgaggg agggcctnga cctcntgccc ggggacgacc ccatgctcct
cgcctacctc 1140ctggacccct ccaacaccac ccccgagggg gtggcccggc
gctacggggg ggagtggacg 1200gaggangcgg gggagcgggc cctcctntcc
gagaggctct tccngaacct nnngcagcgc 1260cttgaggggg aggagaggct
cctttggctt taccaggagg tggagaagcc cctttcccgg 1320gtcctggccc
acatggaggc cacgggggtn cggctggacg tggcctacct ccaggccctn
1380tccctggagg tggcggagga gatccgccgc ctcgaggagg aggtcttccg
cctggccggc 1440caccccttca acctcaactc ccgggaccag ctggaaaggg
tgctctttga cgagctnggg 1500cttcccgcca tcggcaagac ggagaagacn
ggcaagcgct ccaccagcgc cgccgtgctg 1560gaggccctnc gngaggccca
ccccatcgtg gagaagatcc tgcagtaccg ggagctcacc 1620aagctcaaga
acacctacat ngaccccctg ccngncctcg tccaccccag gacgggccgc
1680ctccacaccc gcttcaacca gacggccacg gccacgggca ggcttagtag
ctccgacccc 1740aacctgcaga acatccccgt ccgcaccccn ctgggccaga
ggatccgccg ggccttcgtg 1800gccgaggagg gntgggtgtt ggtggccctg
gactatagcc agatagagct ccgggtcctg 1860gcccacctct ccggggacga
gaacctgatc cgggtcttcc aggaggggag ggacatccac 1920acccagaccg
ccagctggat gttcggcgtc cccccggagg ccgtggaccc cctgatgcgc
1980cgggcggcca agaccatcaa cttcggggtc ctctacggca tgtccgccca
ccgcctctcc 2040caggagcttg ccatccccta cgaggaggcg gtggccttca
ttgagcgcta cttccagagc 2100ttccccaagg tgcgggcctg gattgagaag
accctggagg agggcaggag gcgggggtac 2160gtggagaccc tcttcggccg
ccggcgctac gtgcccgacc tcaacgcccg ggtgaagagc 2220gtgcgggagg
cggcggagcg catggccttc aacatgcccg tccagggcac cgccgccgac
2280ctcatgaagc tggccatggt gaagctcttc ccccggctnc aggaaatggg
ggccaggatg 2340ctcctncagg tccacgacga gctggtcctc gaggccccca
aagagcgggc ggaggnggtg 2400gccgctttgg ccaaggaggt catggagggg
gtctatcccc tggccgtgcc cctggaggtg 2460gaggtgggga tgggggagga
ctggctctcc gccaaggagt ag 25028833PRTArtificial SequenceSynthetic
8Met Xaa Ala Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu1 5
10 15Val Asp Gly His His Leu Ala Tyr Arg Thr Phe Phe Ala Leu Lys
Gly20 25 30Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly
Phe Ala35 40 45Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala
Val Xaa Val50 55 60Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu
Ala Tyr Glu Ala65 70 75 80Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu
Asp Phe Pro Arg Gln Leu85 90 95Ala Leu Ile Lys Glu Leu Val Asp Leu
Leu Gly Leu Xaa Arg Leu Glu100 105 110Val Pro Gly Tyr Glu Ala Asp
Asp Val Leu Ala Thr Leu Ala Lys Lys115 120 125Ala Glu Lys Glu Gly
Tyr Glu Val Arg Ile Leu Thr Ala Asp Arg Asp130 135 140Leu Tyr Gln
Leu Leu Ser Asp Arg Ile Ala Val Leu His Pro Glu Gly145 150 155
160Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg
Pro165 170 175Glu Gln Trp Val Asp Tyr Arg Ala Leu Xaa Gly Asp Pro
Ser Asp Asn180 185 190Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr
Ala Xaa Lys Leu Leu195 200 205Xaa Glu Trp Gly Ser Leu Glu Asn Leu
Leu Lys Asn Leu Asp Arg Val210 215 220Lys Pro Xaa Xaa Arg Glu Lys
Ile Xaa Ala His Met Glu Asp Leu Xaa225 230 235 240Leu Ser Xaa Xaa
Leu Ser Xaa Val Arg Thr Asp Leu Pro Leu Glu Val245 250 255Asp Phe
Ala Xaa Arg Arg Glu Pro Asp Arg Glu Gly Leu Arg Ala Phe260 265
270Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu
Leu275 280 285Glu Xaa Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro
Pro Glu Gly290 295 300Ala Phe Val Gly Phe Val Leu Ser Arg Pro Glu
Pro Met Trp Ala Glu305 310 315 320Leu Leu Ala Leu Ala Ala Ala Arg
Xaa Gly Arg Val His Arg Ala Xaa325 330 335Asp Pro Leu Xaa Gly Leu
Arg Asp Leu Lys Glu Val Arg Gly Leu Leu340 345 350Ala Lys Asp Leu
Ala Val Leu Ala Leu Arg Glu Gly Leu Asp Leu Xaa355 360 365Pro Gly
Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn370 375
380Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr
Glu385 390 395 400Asp Ala Gly Glu Arg Ala Leu Leu Ser Glu Arg Leu
Phe Xaa Asn Leu405 410 415Xaa Xaa Arg Leu Glu Gly Glu Glu Arg Leu
Leu Trp Leu Tyr Xaa Glu420 425 430Val Glu Lys Pro Leu Ser Arg Val
Leu Ala His Met Glu Ala Thr Gly435 440 445Val Arg Leu Asp Val Ala
Tyr Leu Gln Ala Leu Ser Leu Glu Val Ala450 455 460Glu Glu Ile Arg
Arg Leu Glu Glu Glu Val Phe Arg Leu Ala Gly His465 470 475 480Pro
Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp485 490
495Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys
Arg500 505 510Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala
His Pro Ile515 520 525Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr
Lys Leu Lys Asn Thr530 535 540Tyr Ile Asp Pro Leu Pro Xaa Leu Val
His Pro Arg Thr Gly Arg Leu545 550 555 560His Thr Arg Phe Asn Gln
Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser565 570 575Ser Asp Pro Asn
Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln580 585 590Arg Ile
Arg Arg Ala Phe Val Ala Glu Glu Gly Trp Xaa Leu Val Ala595 600
605Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser
Gly610 615 620Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp
Ile His Thr625 630 635 640Gln Thr Ala Ser Trp Met Phe Gly Val Pro
Pro Glu Ala Val Asp Pro645 650 655Leu Met Arg Arg Ala Ala Lys Thr
Ile Asn Phe Gly Val Leu Tyr Gly660 665 670Met Ser Ala His Arg Leu
Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu675 680 685Ala Val Ala Phe
Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg690 695 700Ala Trp
Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val705 710 715
720Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Asn Ala
Arg725 730 735Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe
Asn Met Pro740 745 750Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu
Ala Met Val Lys Leu755 760 765Phe Pro Arg Leu Xaa Glu Met Gly Ala
Arg Met Leu Leu Gln Val His770 775 780Asp Glu Leu Val Leu Glu Ala
Pro Lys Xaa Arg Ala Glu Xaa Val Ala785 790 795 800Ala Leu Ala Lys
Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro805 810 815Leu Glu
Val Glu Val Gly Xaa Gly Glu Asp Trp Leu Ser Ala Lys Glu820 825
830Xaa91647DNAArtificial SequenceSynthetic 9atgaattcgg ggatgctgcc
cctctttgag cccaagggcc gggtcctcct ggtggacggc 60caccacctgg cctaccgcac
cttccacgcc ctgaagggcc tcaccaccag ccggggggag 120ccggtgcagg
cggtctacgg cttcgccaag agcctcctca aggccctcaa ggaggacggg
180gacgcggtga tcgtggtctt tgacgccaag gccccctcct tccgccacga
ggcctacggg 240gggtacaagg cgggccgggc ccccacgccg gaggactttc
cccggcaact cgccctcatc 300aaggagctgg tggacctcct ggggctggcg
cgcctcgagg tcccgggcta cgaggcggac 360gacgtcctgg ccagcctggc
caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc 420accgccgaca
aagaccttta ccagctcctt tccgaccgca tccacgtcct ccaccccgag
480gggtacctca tcaccccggc ctggctttgg gaaaagtacg gcctgaggcc
cgaccagtgg 540gccgactacc gggccctgac cggggacgag tccgacaacc
ttcccggggt caagggcatc 600ggggagaaga cggcgaggaa gcttctggag
gagtggggga gcctggaagc cctcctcaag 660aacctggacc ggctgaagcc
cgccatccgg gagaagatcc tggcccacat ggacgatctg 720aagctctcct
gggacctggc caaggtgcgc accgacctgc ccctggaggt ggacttcgcc
780aaaaggcggg agcccgaccg ggagaggctt agggcctttc tggagaggct
tgagtttggc 840agcctcctcc acgagttcgg
ccttctggaa agccccaagg ccctggagga ggccccctgg 900cccccgccgg
aaggggcctt cgtgggcttt gtgctttccc gcaaggagcc catgtgggcc
960gatcttctgg ccctggccgc cgccaggggg ggccgggtcc accgggcccc
cgagccttat 1020aaagccctca gggacctgaa ggaggcgcgg gggcttctcg
ccaaagacct gagcgttctg 1080gccctgaggg aaggccttgg cctcccgccc
ggcgacgacc ccatgctcct cgcctacctc 1140ctggaccctt ccaacaccac
ccccgagggg gtggcccggc gctacggcgg ggagtggacg 1200gaggaggcgg
gggagcgggc cgccctttcc gagaggctct tcgccaacct gtgggggagg
1260cttgaggggg aggagaggct cctttggctt taccgggagg tggagaggcc
cctttccgct 1320gtcctggccc acatggaggc cacgggggtg cgcctggacg
tggcctatct cagggccttg 1380tccctggagg tggccgggga gatcgcccgc
ctcgaggccg aggtcttccg cctggccggc 1440caccccttca acctcaactc
ccgggaccag ctggaaaggg tcctctttga cgagctaggg 1500cttcccgcca
tcggcaagac ggagaagacc ggcaagcgct ccaccagcgc cgccgtcctg
1560gaggccctcc gcgaggccca ccccatcgtg gagaagatcc tgcaggcatg
caagcttggc 1620actggccgtc gttttacaac gtcgtga
1647102088DNAArtificial SequenceSynthetic 10atgaattcgg ggatgctgcc
cctctttgag cccaagggcc gggtcctcct ggtggacggc 60caccacctgg cctaccgcac
cttccacgcc ctgaagggcc tcaccaccag ccggggggag 120ccggtgcagg
cggtctacgg cttcgccaag agcctcctca aggccctcaa ggaggacggg
180gacgcggtga tcgtggtctt tgacgccaag gccccctcct tccgccacga
ggcctacggg 240gggtacaagg cgggccgggc ccccacgccg gaggactttc
cccggcaact cgccctcatc 300aaggagctgg tggacctcct ggggctggcg
cgcctcgagg tcccgggcta cgaggcggac 360gacgtcctgg ccagcctggc
caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc 420accgccgaca
aagaccttta ccagctcctt tccgaccgca tccacgtcct ccaccccgag
480gggtacctca tcaccccggc ctggctttgg gaaaagtacg gcctgaggcc
cgaccagtgg 540gccgactacc gggccctgac cggggacgag tccgacaacc
ttcccggggt caagggcatc 600ggggagaaga cggcgaggaa gcttctggag
gagtggggga gcctggaagc cctcctcaag 660aacctggacc ggctgaagcc
cgccatccgg gagaagatcc tggcccacat ggacgatctg 720aagctctcct
gggacctggc caaggtgcgc accgacctgc ccctggaggt ggacttcgcc
780aaaaggcggg agcccgaccg ggagaggctt agggcctttc tggagaggct
tgagtttggc 840agcctcctcc acgagttcgg ccttctggaa agccccaagg
ccctggagga ggccccctgg 900cccccgccgg aaggggcctt cgtgggcttt
gtgctttccc gcaaggagcc catgtgggcc 960gatcttctgg ccctggccgc
cgccaggggg ggccgggtcc accgggcccc cgagccttat 1020aaagccctca
gggacctgaa ggaggcgcgg gggcttctcg ccaaagacct gagcgttctg
1080gccctgaggg aaggccttgg cctcccgccc ggcgacgacc ccatgctcct
cgcctacctc 1140ctggaccctt ccaacaccac ccccgagggg gtggcccggc
gctacggcgg ggagtggacg 1200gaggaggcgg gggagcgggc cgccctttcc
gagaggctct tcgccaacct gtgggggagg 1260cttgaggggg aggagaggct
cctttggctt taccgggagg tggagaggcc cctttccgct 1320gtcctggccc
acatggaggc cacgggggtg cgcctggacg tggcctatct cagggccttg
1380tccctggagg tggccgggga gatcgcccgc ctcgaggccg aggtcttccg
cctggccggc 1440caccccttca acctcaactc ccgggaccag ctggaaaggg
tcctctttga cgagctaggg 1500cttcccgcca tcggcaagac ggagaagacc
ggcaagcgct ccaccagcgc cgccgtcctg 1560gaggccctcc gcgaggccca
ccccatcgtg gagaagatcc tgcagtaccg ggagctcacc 1620aagctgaaga
gcacctacat tgaccccttg ccggacctca tccaccccag gacgggccgc
1680ctccacaccc gcttcaacca gacggccacg gccacgggca ggctaagtag
ctccgatccc 1740aacctccaga acatccccgt ccgcaccccg cttgggcaga
ggatccgccg ggccttcatc 1800gccgaggagg ggtggctatt ggtggccctg
gactatagcc agatagagct cagggtgctg 1860gcccacctct ccggcgacga
gaacctgatc cgggtcttcc aggaggggcg ggacatccac 1920acggagaccg
ccagctggat gttcggcgtc ccccgggagg ccgtggaccc cctgatgcgc
1980cgggcggcca agaccatcaa cttcggggtc ctctacggca tgtcggccca
ccgcctctcc 2040caggagctag ctagccatcc cttacgagga ggcccaggcc ttcattga
208811962DNAArtificial SequenceSynthetic 11atgaattcgg ggatgctgcc
cctctttgag cccaagggcc gggtcctcct ggtggacggc 60caccacctgg cctaccgcac
cttccacgcc ctgaagggcc tcaccaccag ccggggggag 120ccggtgcagg
cggtctacgg cttcgccaag agcctcctca aggccctcaa ggaggacggg
180gacgcggtga tcgtggtctt tgacgccaag gccccctcct tccgccacga
ggcctacggg 240gggtacaagg cgggccgggc ccccacgccg gaggactttc
cccggcaact cgccctcatc 300aaggagctgg tggacctcct ggggctggcg
cgcctcgagg tcccgggcta cgaggcggac 360gacgtcctgg ccagcctggc
caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc 420accgccgaca
aagaccttta ccagcttctt tccgaccgca tccacgtcct ccaccccgag
480gggtacctca tcaccccggc ctggctttgg gaaaagtacg gcctgaggcc
cgaccagtgg 540gccgactacc gggccctgac cggggacgag tccgacaacc
ttcccggggt caagggcatc 600ggggagaaga cggcgaggaa gcttctggag
gagtggggga gcctggaagc cctcctcaag 660aacctggacc ggctgaagcc
cgccatccgg gagaagatcc tggcccacat ggacgatctg 720aagctctcct
gggacctggc caaggtgcgc accgacctgc ccctggaggt ggacttcgcc
780aaaaggcggg agcccgaccg ggagaggctt agggcctttc tggagaggct
tgagtttggc 840agcctcctcc acgagttcgg ccttctggaa agccccaagt
catggagggg gtgtatcccc 900tggccgtgcc cctggaggtg gaggtgggga
taggggagga ctggctctcc gccaaggagt 960ga 962121600DNAArtificial
SequenceSynthetic 12atggaattcg gggatgctgc ccctctttga gcccaagggc
cgggtcctcc tggtggacgg 60ccaccacctg gcctaccgca ccttccacgc cctgaagggc
ctcaccacca gccgggggga 120gccggtgcag gcggtctacg gcttcgccaa
gagcctcctc aaggccctca aggaggacgg 180ggacgcggtg atcgtggtct
ttgacgccaa ggccccctcc ttccgccacg aggcctacgg 240ggggtacaag
gcgggccggg cccccacgcc ggaggacttt ccccggcaac tcgccctcat
300caaggagctg gtggacctcc tggggctggc gcgcctcgag gtcccgggct
acgaggcgga 360cgacgtcctg gccagcctgg ccaagaaggc ggaaaaggag
ggctacgagg tccgcatcct 420caccgccgac aaagaccttt accagctcct
ttccgaccgc atccacgtcc tccaccccga 480ggggtacctc atcaccccgg
cctggctttg ggaaaagtac ggcctgaggc ccgaccagtg 540ggccgactac
cgggccctga ccggggacga gtccgacaac cttcccgggg tcaagggcat
600cggggagaag acggcgagga agcttctgga ggagtggggg agcctggaag
ccctcctcaa 660gaacctggac cggctgaagc ccgccatccg ggagaagatc
ctggcccaca tggacgatct 720gaagctctcc tgggacctgg ccaaggtgcg
caccgacctg cccctggagg tggacttcgc 780caaaaggcgg gagcccgacc
gggagaggct tagggccttt ctggagaggc ttgagtttgg 840cagcctcctc
cacgagttcg gccttctgga aagccccaag atccgccggg ccttcatcgc
900cgaggagggg tggctattgg tggccctgga ctatagccag atagagctca
gggtgctggc 960ccacctctcc ggcgacgaga acctgatccg ggtcttccag
gaggggcggg acatccacac 1020ggagaccgcc agctggatgt tcggcgtccc
ccgggaggcc gtggaccccc tgatgcgccg 1080ggcggccaag accatcaact
tcggggtcct ctacggcatg tcggcccacc gcctctccca 1140ggagctagcc
atcccttacg aggaggccca ggccttcatt gagcgctact ttcagagctt
1200ccccaaggtg cgggcctgga ttgagaagac cctggaggag ggcaggaggc
gggggtacgt 1260ggagaccctc ttcggccgcc gccgctacgt gccagaccta
gaggcccggg tgaagagcgt 1320gcgggaggcg gccgagcgca tggccttcaa
catgcccgtc cggggcaccg ccgccgacct 1380catgaagctg gctatggtga
agctcttccc caggctggag gaaatggggg ccaggatgct 1440ccttcaggtc
cacgacgagc tggtcctcga ggccccaaaa gagagggcgg aggccgtggc
1500ccggctggcc aaggaggtca tggagggggt gtatcccctg gccgtgcccc
tggaggtgga 1560ggtggggata ggggaggact ggctctccgc caaggagtga
16001336DNAArtificial SequenceSynthetic 13cacgaattcg gggatgctgc
ccctctttga gcccaa 361434DNAArtificial SequenceSynthetic
14gtgagatcta tcactccttg gcggagagcc agtc 341591DNAArtificial
SequenceSynthetic 15taatacgact cactataggg agaccggaat tcgagctcgc
ccgggcgagc tcgaattccg 60tgtattctat agtgtcacct aaatcgaatt c
911620DNAArtificial SequenceSynthetic 16taatacgact cactataggg
201727DNAArtificial SequenceSynthetic 17gaattcgatt taggtgacac
tatagaa 271831DNAArtificial SequenceSynthetic 18gtaatcatgg
tcatagctgg tagcttgcta c 311942DNAArtificial SequenceSynthetic
19ggatcctcta gagtcgacct gcaggcatgc ctaccttggt ag
422030DNAArtificial SequenceSynthetic 20ggatcctcta gagtcgacct
gcaggcatgc 30212502DNAArtificial SequenceSynthetic 21atgaattcgg
ggatgctgcc cctctttgag cccaagggcc gggtcctcct ggtggacggc 60caccacctgg
cctaccgcac cttccacgcc ctgaagggcc tcaccaccag ccggggggag
120ccggtgcagg cggtctacgg cttcgccaag agcctcctca aggccctcaa
ggaggacggg 180gacgcggtga tcgtggtctt tgacgccaag gccccctcct
tccgccacga ggcctacggg 240gggtacaagg cgggccgggc ccccacgccg
gaggactttc cccggcaact cgccctcatc 300aaggagctgg tggacctcct
ggggctggcg cgcctcgagg tcccgggcta cgaggcggac 360gacgtcctgg
ccagcctggc caagaaggcg gaaaaggagg gctacgaggt ccgcatcctc
420accgccgaca aagaccttta ccagctcctt tccgaccgca tccacgtcct
ccaccccgag 480gggtacctca tcaccccggc ctggctttgg gaaaagtacg
gcctgaggcc cgaccagtgg 540gccgactacc gggccctgac cggggacgag
tccgacaacc ttcccggggt caagggcatc 600ggggagaaga cggcgaggaa
gcttctggag gagtggggga gcctggaagc cctcctcaag 660aacctggacc
ggctgaagcc cgccatccgg gagaagatcc tggcccacat ggacgatctg
720aagctctcct gggacctggc caaggtgcgc accgacctgc ccctggaggt
ggacttcgcc 780aaaaggcggg agcccgaccg ggagaggctt agggcctttc
tggagaggct tgagtttggc 840agcctcctcc acgagttcgg ccttctggaa
agccccaagg ccctggagga ggccccctgg 900cccccgccgg aaggggcctt
cgtgggcttt gtgctttccc gcaaggagcc catgtgggcc 960gatcttctgg
ccctggccgc cgccaggggg ggccgggtcc accgggcccc cgagccttat
1020aaagccctca gggacctgaa ggaggcgcgg gggcttctcg ccaaagacct
gagcgttctg 1080gccctgaggg aaggccttgg cctcccgccc ggcgacgacc
ccatgctcct cgcctacctc 1140ctggaccctt ccaacaccac ccccgagggg
gtggcccggc gctacggcgg ggagtggacg 1200gaggaggcgg gggagcgggc
cgccctttcc gagaggctct tcgccaacct gtgggggagg 1260cttgaggggg
aggagaggct cctttggctt taccgggagg tggagaggcc cctttccgct
1320gtcctggccc acatggaggc cacgggggtg cgcctggacg tggcctatct
cagggccttg 1380tccctggagg tggccgggga gatcgcccgc ctcgaggccg
aggtcttccg cctggccggc 1440caccccttca acctcaactc ccgggaccag
ctggaaaggg tcctctttga cgagctaggg 1500cttcccgcca tcggcaagac
ggagaagacc ggcaagcgct ccaccagcgc cgccgtcctg 1560gaggccctcc
gcgaggccca ccccatcgtg gagaagatcc tgcagtaccg ggagctcacc
1620aagctgaaga gcacctacat tgaccccttg ccggacctca tccaccccag
gacgggccgc 1680ctccacaccc gcttcaacca gacggccacg gccacgggca
ggctaagtag ctccgatccc 1740aacctccaga acatccccgt ccgcaccccg
cttgggcaga ggatccgccg ggccttcatc 1800gccgaggagg ggtggctatt
ggtggccctg gactatagcc agatagagct cagggtgctg 1860gcccacctct
ccggcgacga gaacctgatc cgggtcttcc aggaggggcg ggacatccac
1920acggagaccg ccagctggat gttcggcgtc ccccgggagg ccgtggaccc
cctgatgcgc 1980cgggcggcca agaccatcaa cttcggggtc ctctacggca
tgtcggccca ccgcctctcc 2040caggagctag ccatccctta cgaggaggcc
caggccttca ttgagcgcta ctttcagagc 2100ttccccaagg tgcgggcctg
gattgagaag accctggagg agggcaggag gcgggggtac 2160gtggagaccc
tcttcggccg ccgccgctac gtgccagacc tagaggcccg ggtgaagagc
2220gtgcgggagg cggccgagcg catggccttc aacatgcccg tccggggcac
cgccgccgac 2280ctcatgaagc tggctatggt gaagctcttc cccaggctgg
aggaaatggg ggccaggatg 2340ctccttcagg tccacgacga gctggtcctc
gaggccccaa aagagagggc ggaggccgtg 2400gcccggctgg ccaaggaggt
catggagggg gtgtatcccc tggccgtgcc cctggaggtg 2460gaggtgggga
taggggagga ctggctctcc gccaaggagt ga 25022219DNAArtificial
SequenceSynthetic 22gatttaggtg acactatag 192350DNAArtificial
SequenceSynthetic 23acacaggtac cacatggtac aagaggcaag agagacgaca
cagcagaaac 502415PRTArtificial SequenceSynthetic 24Met Ala Ser Met
Thr Gly Gly Gln Gln Met Gly Arg Ile Asn Ser1 5 10
1525969DNAArtificial SequenceSynthetic 25atggctagca tgactggtgg
acagcaaatg ggtcggatca attcggggat gctgcccctc 60tttgagccca agggccgggt
cctcctggtg gacggccacc acctggccta ccgcaccttc 120cacgccctga
agggcctcac caccagccgg ggggagccgg tgcaggcggt ctacggcttc
180gccaagagcc tcctcaaggc cctcaaggag gacggggacg cggtgatcgt
ggtctttgac 240gccaaggccc cctccttccg ccacgaggcc tacggggggt
acaaggcggg ccgggccccc 300acgccggagg actttccccg gcaactcgcc
ctcatcaagg agctggtgga cctcctgggg 360ctggcgcgcc tcgaggtccc
gggctacgag gcggacgacg tcctggccag cctggccaag 420aaggcggaaa
aggagggcta cgaggtccgc atcctcaccg ccgacaaaga cctttaccag
480cttctttccg accgcatcca cgtcctccac cccgaggggt acctcatcac
cccggcctgg 540ctttgggaaa agtacggcct gaggcccgac cagtgggccg
actaccgggc cctgaccggg 600gacgagtccg acaaccttcc cggggtcaag
ggcatcgggg agaagacggc gaggaagctt 660ctggaggagt gggggagcct
ggaagccctc ctcaagaacc tggaccggct gaagcccgcc 720atccgggaga
agatcctggc ccacatggac gatctgaagc tctcctggga cctggccaag
780gtgcgcaccg acctgcccct ggaggtggac ttcgccaaaa ggcgggagcc
cgaccgggag 840aggcttaggg cctttctgga gaggcttgag tttggcagcc
tcctccacga gttcggcctt 900ctggaaagcc ccaagtcatg gagggggtgt
atcccctggc cgtgcccctg gaggtggagg 960tggggatag 96926948DNAArtificial
SequenceSynthetic 26atggctagca tgactggtgg acagcaaatg ggtcggatca
attcggggat gctgcccctc 60tttgagccca agggccgggt cctcctggtg gacggccacc
acctggccta ccgcaccttc 120cacgccctga agggcctcac caccagccgg
ggggagccgg tgcaggcggt ctacggcttc 180gccaagagcc tcctcaaggc
cctcaaggag gacggggacg cggtgatcgt ggtctttgac 240gccaaggccc
cctccttccg ccacgaggcc tacggggggt acaaggcggg ccgggccccc
300acgccggagg actttccccg gcaactcgcc ctcatcaagg agctggtgga
cctcctgggg 360ctggcgcgcc tcgaggtccc gggctacgag gcggacgacg
tcctggccag cctggccaag 420aaggcggaaa aggagggcta cgaggtccgc
atcctcaccg ccgacaaaga cctttaccag 480cttctttccg accgcatcca
cgtcctccac cccgaggggt acctcatcac cccggcctgg 540ctttgggaaa
agtacggcct gaggcccgac cagtgggccg actaccgggc cctgaccggg
600gacgagtccg acaaccttcc cggggtcaag ggcatcgggg agaagacggc
gaggaagctt 660ctggaggagt gggggagcct ggaagccctc ctcaagaacc
tggaccggct gaagcccgcc 720atccgggaga agatcctggc ccacatggac
gatctgaagc tctcctggga cctggccaag 780gtgcgcaccg acctgcccct
ggaggtggac ttcgccaaaa ggcgggagcc cgaccgggag 840aggcttaggg
cctttctgga gaggcttgag tttggcagcc tcctccacga gttcggcctt
900ctggaaagcc ccaaggccgc actcgagcac caccaccacc accactga
94827206DNAArtificial SequenceSynthetic 27cgccagggtt ttcccagtca
cgacgttgta aaacgacggc cagtgaattg taatacgact 60cactataggg cgaattcgag
ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat 120gcaagcttga
gtattctata gtgtcaccta aatagcttgg cgtaatcatg gtcatagctg
180tttcctgtgt gaaattgtta tccgct 2062821DNAArtificial
SequenceSynthetic 28aacagctatg accatgatta c 212960DNAArtificial
SequenceSynthetic 29gttctctgct ctctggtcgc tgtctcgctt gtgaaacaag
cgagacagcg tggtctctcg 603015DNAArtificial SequenceSynthetic
30cgagagacca cgctg 153152DNAArtificial SequenceSynthetic
31cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg tc
523226DNAArtificial SequenceSynthetic 32agaaaggaag ggaagaaagc
gaaagg 263321DNAArtificial SequenceSynthetic 33gacggggaaa
gccggcgaac g 213420DNAArtificial SequenceSynthetic 34gaaagccggc
gaacgtggcg 203521DNAArtificial SequenceSynthetic 35ggcgaacgtg
gcgagaaagg a 213642DNAArtificial SequenceSynthetic 36cctttcgctt
tcttcccttc ctttctcgcc acgttcgccg gc 423742DNAArtificial
SequenceSynthetic 37cctttcgctc tcttcccttc ctttctcgcc acgttcgccg gc
423827DNAArtificial SequenceSynthetic 38agaaaggaag ggaagaaagc
gaaaggt 273924DNAArtificial SequenceSynthetic 39gccggcgaac
gtggcgagaa agga 244020DNAArtificial SequenceSynthetic 40ggtttttctt
tgaggtttag 204119DNAArtificial SequenceSynthetic 41gcgacactcc
accatagat 194219DNAArtificial SequenceSynthetic 42ctgtcttcac
gcagaaagc 194319DNAArtificial SequenceSynthetic 43gcacggtcta
cgagacctc 194420DNAArtificial SequenceSynthetic 44taatacgact
cactataggg 2045337RNAArtificial SequenceSynthetic 45gggaaagcuu
gcaugccugc aggucgacuc uagaggaucu acuagucaua uggauucugu 60cuucacgcag
aaagcgucug gccauggcgu uaguaugagu gucgugcagc cuccaggacc
120cccccucccg ggagaggcau aguggucugc ggaaccggug aguacaccgg
aauugccagg 180acgaccgggu ccuuucuugg auaaacccgc ucaaugccug
gagauuuggg cgugcccccg 240caagacugcu agccgaguag uguugggucg
cgaaaggccu ugugguacug ccugauaggg 300ugccugcgag ugccccggga
ggucucguag accgugc 3374619DNAArtificial SequenceSynthetic
46ccggtcgtcc tggcaatcc 194724DNAArtificial SequenceSynthetic
47gtttatccaa gaaaggaccc ggtc 244830DNAArtificial SequenceSynthetic
48cagggtgaag ggaagaagaa agcgaaaggt 304930DNAArtificial
SequenceSynthetic 49cagggggaag ggaagaagaa agcgaaaggt
305022DNAArtificial SequenceSynthetic 50ttcttttcac cagcgagacg gg
225122DNAArtificial SequenceSynthetic 51attgggcgcc agggtggttt tt
225253DNAArtificial SequenceSynthetic 52cccgtctcgc tggtgaaaag
aaaaaccacc ctggcgccca atacgcaaac cgc 535331DNAArtificial
SequenceSynthetic 53gaattcgatt taggtgacac tatagaatac a
315442DNAArtificial SequenceSynthetic 54cctttcgctt tcttcccttc
ctttctcgcc acgttcgccg gc 425524DNAArtificial SequenceSynthetic
55gccggcgaac gtggcgagaa agga 245626DNAArtificial SequenceSynthetic
56cagaaggaag ggaagaaagc gaaagg 265726DNAArtificial
SequenceSynthetic 57cagggggaag ggaagaaagc gaaagg
265826DNAArtificial SequenceSynthetic 58cagggtacag ggaagaaagc
gaaagg 265942DNAArtificial SequenceSynthetic 59gggaaagtcc
tcggagccgc gcgggacgag cgtgggggcc cg 4260963DNAArtificial
SequenceSynthetic 60atg gct agc atg act ggt gga cag caa atg ggt cgg
atc aat tcg ggg 48Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg
Ile Asn Ser Gly1 5 10 15atg ctg ccc ctc ttt gag ccc aag ggc cgg gtc
ctc ctg gtg gac ggc 96Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val
Leu Leu Val Asp Gly20 25 30cac cac ctg gcc tac cgc acc ttc cac gcc
ctg aag ggc ctc acc acc 144His His Leu Ala Tyr Arg Thr Phe His Ala
Leu Lys Gly Leu Thr Thr35 40 45agc cgg ggg gag ccg gtg cag gcg gtc
tac ggc ttc gcc aag agc ctc 192Ser Arg Gly Glu Pro Val Gln Ala Val
Tyr Gly Phe Ala Lys Ser Leu50 55 60ctc aag gcc ctc aag gag gac ggg
gac gcg gtg atc gtg gtc ttt gac 240Leu Lys Ala Leu Lys Glu Asp Gly
Asp Ala Val Ile Val Val Phe Asp65 70 75 80gcc aag gcc ccc tcc ttc
cgc cac gag gcc tac ggg ggg tac aag gcg 288Ala Lys Ala Pro Ser Phe
Arg His Glu Ala Tyr Gly Gly Tyr Lys Ala85 90 95ggc cgg gcc ccc acg
ctc gtc ccg cgc ggc tcc gag gac ttt ccc cgg 336Gly Arg Ala Pro Thr
Leu Val Pro Arg Gly Ser Glu Asp Phe Pro Arg100 105 110caa ctc gcc
ctc atc aag gag ctg gtg gac ctc ctg ggg ctg gcg cgc 384Gln Leu Ala
Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg115 120 125ctc
gag gtc ccg ggc tac gag gcg gac gac gtc ctg gcc agc ctg gcc 432Leu
Glu Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala130 135
140aag aag gcg gaa aag gag ggc tac gag gtc cgc atc ctc acc gcc gac
480Lys Lys Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala
Asp145 150 155 160aaa gac ctt tac cag ctc ctt tcc gac cgc atc cac
gtc ctc cac ccc 528Lys Asp Leu Tyr Gln Leu Leu Ser Asp Arg Ile His
Val Leu His Pro165 170 175gag ggg tac ctc atc acc ccg gcc tgg ctt
tgg gaa aag tac ggc ctg 576Glu Gly Tyr Leu Ile Thr Pro Ala Trp Leu
Trp Glu Lys Tyr Gly Leu180 185 190agg ccc gac cag tgg gcc gac tac
cgg gcc ctg acc ggg gac gag tcc 624Arg Pro Asp Gln Trp Ala Asp Tyr
Arg Ala Leu Thr Gly Asp Glu Ser195 200 205gac aac ctt ccc ggg gtc
aag ggc atc ggg gag aag acg gcg agg aag 672Asp Asn Leu Pro Gly Val
Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys210 215 220ctt ctg gag gag
tgg ggg agc ctg gaa gcc ctc ctc aag aac ctg gac 720Leu Leu Glu Glu
Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp225 230 235 240cgg
ctg aag ccc gcc atc cgg gag aag atc ctg gcc cac atg gac gat 768Arg
Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp245 250
255ctg aag ctc tcc tgg gac ctg gcc aag gtg cgc acc gac ctg ccc ctg
816Leu Lys Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro
Leu260 265 270gag gtg gac ttc gcc aaa agg cgg gag ccc gac cgg gag
agg ctt agg 864Glu Val Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu
Arg Leu Arg275 280 285gcc ttt ctg gag agg ctt gag ttt ggc agc ctc
ctc cac gag ttc ggc 912Ala Phe Leu Glu Arg Leu Glu Phe Gly Ser Leu
Leu His Glu Phe Gly290 295 300ctt ctg gaa agc ccc aag gcc gca ctc
gag cac cac cac cac cac cac 960Leu Leu Glu Ser Pro Lys Ala Ala Leu
Glu His His His His His His305 310 315 320tga 96361320PRTArtificial
SequenceSynthetic Construct 61Met Ala Ser Met Thr Gly Gly Gln Gln
Met Gly Arg Ile Asn Ser Gly1 5 10 15Met Leu Pro Leu Phe Glu Pro Lys
Gly Arg Val Leu Leu Val Asp Gly20 25 30His His Leu Ala Tyr Arg Thr
Phe His Ala Leu Lys Gly Leu Thr Thr35 40 45Ser Arg Gly Glu Pro Val
Gln Ala Val Tyr Gly Phe Ala Lys Ser Leu50 55 60Leu Lys Ala Leu Lys
Glu Asp Gly Asp Ala Val Ile Val Val Phe Asp65 70 75 80Ala Lys Ala
Pro Ser Phe Arg His Glu Ala Tyr Gly Gly Tyr Lys Ala85 90 95Gly Arg
Ala Pro Thr Leu Val Pro Arg Gly Ser Glu Asp Phe Pro Arg100 105
110Gln Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala
Arg115 120 125Leu Glu Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala
Ser Leu Ala130 135 140Lys Lys Ala Glu Lys Glu Gly Tyr Glu Val Arg
Ile Leu Thr Ala Asp145 150 155 160Lys Asp Leu Tyr Gln Leu Leu Ser
Asp Arg Ile His Val Leu His Pro165 170 175Glu Gly Tyr Leu Ile Thr
Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu180 185 190Arg Pro Asp Gln
Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser195 200 205Asp Asn
Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys210 215
220Leu Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu
Asp225 230 235 240Arg Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala
His Met Asp Asp245 250 255Leu Lys Leu Ser Trp Asp Leu Ala Lys Val
Arg Thr Asp Leu Pro Leu260 265 270Glu Val Asp Phe Ala Lys Arg Arg
Glu Pro Asp Arg Glu Arg Leu Arg275 280 285Ala Phe Leu Glu Arg Leu
Glu Phe Gly Ser Leu Leu His Glu Phe Gly290 295 300Leu Leu Glu Ser
Pro Lys Ala Ala Leu Glu His His His His His His305 310 315
3206220DNAArtificial SequenceSynthetic 62cgatctcctc ggccacctcc
206320DNAArtificial SequenceSynthetic 63ggcggtgccc tggacgggca
206420DNAArtificial SequenceSynthetic 64ccagctcgtt gtggacctga
20652505DNAArtificial SequenceSynthetic 65atg aat tcg ggg atg ctg
ccc ctc ttt gag ccc aag ggc cgg gtc ctc 48Met Asn Ser Gly Met Leu
Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15ctg gtg gac ggc cac
cac ctg gcc tac cgc acc ttc cac gcc ctg aag 96Leu Val Asp Gly His
His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30ggc ctc acc acc
agc cgg ggg gag ccg gtg cag gcg gtc tac ggc ttc 144Gly Leu Thr Thr
Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40 45gcc aag agc
ctc ctc aag gcc ctc aag gag gac ggg gac gcg gtg atc 192Ala Lys Ser
Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50 55 60gtg gtc
ttt gac gcc aag gcc ccc tcc ttc cgc cac gag gcc tac ggg 240Val Val
Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly65 70 75
80ggg tac aag gcg ggc cgg gcc ccc acg ccg gag gac ttt ccc cgg caa
288Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg
Gln85 90 95ctc gcc ctc atc aag gag ctg gtg gac ctc ctg ggg ctg gcg
cgc ctc 336Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala
Arg Leu100 105 110gag gtc ccg ggc tac gag gcg gac gac gtc ctg gcc
agc ctg gcc aag 384Glu Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala
Ser Leu Ala Lys115 120 125aag gcg gaa aag gag ggc tac gag gtc cgc
atc ctc acc gcc gac aaa 432Lys Ala Glu Lys Glu Gly Tyr Glu Val Arg
Ile Leu Thr Ala Asp Lys130 135 140gac ctt tac cag ctc ctt tcc gac
cgc atc cac gtc ctc cac ccc gag 480Asp Leu Tyr Gln Leu Leu Ser Asp
Arg Ile His Val Leu His Pro Glu145 150 155 160ggg tac ctc atc acc
ccg gcc tgg ctt tgg gaa aag tac ggc ctg agg 528Gly Tyr Leu Ile Thr
Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175ccc gac cag
tgg gcc gac tac cgg gcc ctg acc ggg gac gag tcc gac 576Pro Asp Gln
Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185 190aac
ctt ccc ggg gtc aag ggc atc ggg gag aag acg gcg agg aag ctt 624Asn
Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu195 200
205ctg gag gag tgg ggg agc ctg gaa gcc ctc ctc aag aac ctg gac cgg
672Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp
Arg210 215 220ctg aag ccc gcc atc cgg gag aag atc ctg gcc cac atg
gac gat ctg 720Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met
Asp Asp Leu225 230 235 240aag ctc tcc tgg gac ctg gcc aag gtg cgc
acc gac ctg ccc ctg gag 768Lys Leu Ser Trp Asp Leu Ala Lys Val Arg
Thr Asp Leu Pro Leu Glu245 250 255gtg gac ttc gcc aaa agg cgg gag
ccc gac cgg gag agg ctt agg gcc 816Val Asp Phe Ala Lys Arg Arg Glu
Pro Asp Arg Glu Arg Leu Arg Ala260 265 270ttt ctg gag agg ctt gag
ttt ggc agc ctc ctc cac gag ttc ggc ctt 864Phe Leu Glu Arg Leu Glu
Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285ctg gaa agc ccc
aag gcc ctg gag gag gcc ccc tgg ccc ccg ccg gaa 912Leu Glu Ser Pro
Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295 300ggg gcc
ttc gtg ggc ttt gtg ctt tcc cgc aag gag ccc atg tgg gcc 960Gly Ala
Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala305 310 315
320gat ctt ctg gcc ctg gcc gcc gcc agg ggg ggc cgg gtc cac cgg gcc
1008Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg
Ala325 330 335ccc gag cct tat aaa gcc ctc agg gac ctg aag gag gcg
cgg ggg ctt 1056Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala
Arg Gly Leu340 345 350ctc gcc aaa gac ctg agc gtt ctg gcc ctg agg
gaa ggc ctt ggc ctc 1104Leu Ala Lys Asp Leu Ser Val Leu Ala Leu Arg
Glu Gly Leu Gly Leu355 360 365ccg ccc ggc gac gac ccc atg ctc ctc
gcc tac ctc ctg gac cct tcc 1152Pro Pro Gly Asp Asp Pro Met Leu Leu
Ala Tyr Leu Leu Asp Pro Ser370 375 380aac acc acc ccc gag ggg gtg
gcc cgg cgc tac ggc ggg gag tgg acg 1200Asn Thr Thr Pro Glu Gly Val
Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390 395 400gag gag gcg ggg
gag cgg gcc gcc ctt tcc gag agg ctc ttc gcc aac 1248Glu Glu Ala Gly
Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn405 410 415ctg tgg
ggg agg ctt gag ggg gag gag agg ctc ctt tgg ctt tac cgg 1296Leu Trp
Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg420 425
430gag gtg gag agg ccc ctt tcc gct gtc ctg gcc cac atg gag gcc acg
1344Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala
Thr435 440 445ggg gtg cgc ctg gac gtg gcc tat ctc agg gcc ttg tcc
ctg gag gtg 1392Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser
Leu Glu Val450 455 460gcc gag gag atc gcc cgc ctc gag gcc gag gtc
ttc cgc ctg gcc ggc 1440Ala Glu Glu Ile Ala Arg Leu Glu Ala Glu Val
Phe Arg Leu Ala Gly465 470 475 480cac ccc ttc aac ctc aac tcc cgg
gac cag ctg gaa agg gtc ctc ttt 1488His Pro Phe Asn Leu Asn Ser Arg
Asp Gln Leu Glu Arg Val Leu Phe485 490 495gac gag cta ggg ctt ccc
gcc atc ggc aag acg gag aag acc ggc aag 1536Asp Glu Leu Gly Leu Pro
Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505 510cgc tcc acc agc
gcc gcc gtc ctg gag gcc ctc cgc gag gcc cac ccc 1584Arg Ser Thr Ser
Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro515 520 525atc gtg
gag aag atc ctg cag tac cgg gag ctc acc aag ctg aag agc 1632Ile Val
Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser530 535
540acc tac att gac ccc ttg ccg gac ctc atc cac ccc agg acg ggc cgc
1680Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly
Arg545 550 555 560ctc cac acc cgc ttc aac cag acg gcc acg gcc acg
ggc agg cta agt 1728Leu His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr
Gly Arg Leu Ser565 570 575agc tcc gat ccc aac ctc cag aac atc ccc
gtc cgc acc ccg ctt ggg 1776Ser Ser Asp Pro Asn Leu Gln Asn Ile Pro
Val Arg Thr Pro Leu Gly580 585 590cag agg atc cgc cgg gcc ttc atc
gcc gag gag ggg tgg cta ttg gtg 1824Gln Arg Ile Arg Arg Ala Phe Ile
Ala Glu Glu Gly Trp Leu Leu Val595 600 605gcc ctg gac tat agc cag
ata gag ctc agg gtg ctg gcc cac ctc tcc 1872Ala Leu Asp Tyr Ser Gln
Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615 620ggc gac gag aac
ctg atc cgg gtc ttc cag gag ggg cgg gac atc cac 1920Gly Asp Glu Asn
Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His625 630 635 640acg
gag acc gcc agc tgg atg ttc ggc gtc ccc cgg gag gcc gtg gac 1968Thr
Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp645 650
655ccc ctg atg cgc cgg gcg gcc aag acc atc aac ttc ggg gtc ctc tac
2016Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu
Tyr660 665 670ggc atg tcg gcc cac cgc ctc tcc cag gag cta gcc atc
cct tac gag 2064Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile
Pro Tyr Glu675 680 685gag gcc cag gcc ttc att gag cgc tac ttt cag
agc ttc ccc aag gtg 2112Glu Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln
Ser Phe Pro Lys Val690 695 700cgg gcc tgg att gag aag acc ctg gag
gag ggc agg agg cgg ggg tac 2160Arg Ala Trp Ile Glu Lys Thr Leu Glu
Glu Gly Arg Arg Arg Gly Tyr705 710 715 720gtg gag acc ctc ttc ggc
cgc cgc cgc tac gtg cca gac cta gag gcc 2208Val Glu Thr Leu Phe Gly
Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725 730 735cgg gtg aag agc
gtg cgg gag gcg gcc gag cgc atg gcc ttc aac atg 2256Arg Val Lys Ser
Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met740 745 750ccc gtc
cag ggc acc gcc gcc gac ctc atg aag ctg gct atg gtg aag 2304Pro Val
Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys755 760
765ctc ttc ccc agg ctg gag gaa atg ggg gcc agg atg ctc ctt cag gtc
2352Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln
Val770 775 780cac aac gag ctg gtc ctc gag gcc cca aaa gag agg gcg
gag gcc gtg 2400His Asn Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala
Glu Ala Val785 790 795 800gcc cgg ctg gcc aag gag gtc atg gag ggg
gtg tat ccc ctg gcc gtg 2448Ala Arg Leu Ala Lys Glu Val Met Glu Gly
Val Tyr Pro Leu Ala Val805 810 815ccc ctg gag gtg gag gtg ggg ata
ggg gag gac tgg ctc tcc gcc aag 2496Pro Leu Glu Val Glu Val Gly Ile
Gly Glu Asp Trp Leu Ser Ala Lys820 825 830gag tgatag
2505Glu66833PRTArtificial SequenceSynthetic Construct 66Met Asn Ser
Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15Leu Val
Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30Gly
Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40
45Ala Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50
55 60Val Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr
Gly65 70 75 80Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe
Pro Arg Gln85 90 95Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly
Leu Ala Arg Leu100 105 110Glu Val Pro Gly Tyr Glu Ala Asp Asp Val
Leu Ala Ser Leu Ala Lys115 120 125Lys Ala Glu Lys Glu Gly Tyr Glu
Val Arg Ile Leu Thr Ala Asp Lys130 135 140Asp Leu Tyr Gln Leu Leu
Ser Asp Arg Ile His Val Leu His Pro Glu145 150 155 160Gly Tyr Leu
Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175Pro
Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185
190Asn Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys
Leu195 200 205Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn
Leu Asp Arg210 215 220Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala
His Met Asp Asp Leu225 230 235 240Lys Leu Ser Trp Asp Leu Ala Lys
Val Arg Thr Asp Leu Pro Leu Glu245 250 255Val Asp Phe Ala Lys Arg
Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala260 265 270Phe Leu Glu Arg
Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285Leu Glu
Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295
300Gly Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp
Ala305 310 315 320Asp Leu Leu Ala Leu Ala Ala Ala Arg
Gly Gly Arg Val His Arg Ala325 330 335Pro Glu Pro Tyr Lys Ala Leu
Arg Asp Leu Lys Glu Ala Arg Gly Leu340 345 350Leu Ala Lys Asp Leu
Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu355 360 365Pro Pro Gly
Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser370 375 380Asn
Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390
395 400Glu Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala
Asn405 410 415Leu Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp
Leu Tyr Arg420 425 430Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala
His Met Glu Ala Thr435 440 445Gly Val Arg Leu Asp Val Ala Tyr Leu
Arg Ala Leu Ser Leu Glu Val450 455 460Ala Glu Glu Ile Ala Arg Leu
Glu Ala Glu Val Phe Arg Leu Ala Gly465 470 475 480His Pro Phe Asn
Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe485 490 495Asp Glu
Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505
510Arg Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His
Pro515 520 525Ile Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys
Leu Lys Ser530 535 540Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His
Pro Arg Thr Gly Arg545 550 555 560Leu His Thr Arg Phe Asn Gln Thr
Ala Thr Ala Thr Gly Arg Leu Ser565 570 575Ser Ser Asp Pro Asn Leu
Gln Asn Ile Pro Val Arg Thr Pro Leu Gly580 585 590Gln Arg Ile Arg
Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val595 600 605Ala Leu
Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615
620Gly Asp Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile
His625 630 635 640Thr Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg
Glu Ala Val Asp645 650 655Pro Leu Met Arg Arg Ala Ala Lys Thr Ile
Asn Phe Gly Val Leu Tyr660 665 670Gly Met Ser Ala His Arg Leu Ser
Gln Glu Leu Ala Ile Pro Tyr Glu675 680 685Glu Ala Gln Ala Phe Ile
Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val690 695 700Arg Ala Trp Ile
Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr705 710 715 720Val
Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725 730
735Arg Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn
Met740 745 750Pro Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala
Met Val Lys755 760 765Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg
Met Leu Leu Gln Val770 775 780His Asn Glu Leu Val Leu Glu Ala Pro
Lys Glu Arg Ala Glu Ala Val785 790 795 800Ala Arg Leu Ala Lys Glu
Val Met Glu Gly Val Tyr Pro Leu Ala Val805 810 815Pro Leu Glu Val
Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys820 825
830Glu6720DNAArtificial SequenceSynthetic 67tggctatagr ccagggccac
20682505DNAArtificial SequenceSynthetic 68atg aat tcg ggg atg ctg
ccc ctc ttt gag ccc aag ggc cgg gtc ctc 48Met Asn Ser Gly Met Leu
Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15ctg gtg gac ggc cac
cac ctg gcc tac cgc acc ttc cac gcc ctg aag 96Leu Val Asp Gly His
His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30ggc ctc acc acc
agc cgg ggg gag ccg gtg cag gcg gtc tac ggc ttc 144Gly Leu Thr Thr
Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40 45gcc aag agc
ctc ctc aag gcc ctc aag gag gac ggg gac gcg gtg atc 192Ala Lys Ser
Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50 55 60gtg gtc
ttt gac gcc aag gcc ccc tcc ttc cgc cac gag gcc tac ggg 240Val Val
Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly65 70 75
80ggg tac aag gcg ggc cgg gcc ccc acg ccg gag gac ttt ccc cgg caa
288Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg
Gln85 90 95ctc gcc ctc atc aag gag ctg gtg gac ctc ctg ggg ctg gcg
cgc ctc 336Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala
Arg Leu100 105 110gag gtc ccg ggc tac gag gcg gac gac gtc ctg gcc
agc ctg gcc aag 384Glu Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala
Ser Leu Ala Lys115 120 125aag gcg gaa aag gag ggc tac gag gtc cgc
atc ctc acc gcc gac aaa 432Lys Ala Glu Lys Glu Gly Tyr Glu Val Arg
Ile Leu Thr Ala Asp Lys130 135 140gac ctt tac cag ctc ctt tcc gac
cgc atc cac gtc ctc cac ccc gag 480Asp Leu Tyr Gln Leu Leu Ser Asp
Arg Ile His Val Leu His Pro Glu145 150 155 160ggg tac ctc atc acc
ccg gcc tgg ctt tgg gaa aag tac ggc ctg agg 528Gly Tyr Leu Ile Thr
Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175ccc gac cag
tgg gcc gac tac cgg gcc ctg acc ggg gac gag tcc gac 576Pro Asp Gln
Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185 190aac
ctt ccc ggg gtc aag ggc atc ggg gag aag acg gcg agg aag ctt 624Asn
Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu195 200
205ctg gag gag tgg ggg agc ctg gaa gcc ctc ctc aag aac ctg gac cgg
672Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp
Arg210 215 220ctg aag ccc gcc atc cgg gag aag atc ctg gcc cac atg
gac gat ctg 720Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met
Asp Asp Leu225 230 235 240aag ctc tcc tgg gac ctg gcc aag gtg cgc
acc gac ctg ccc ctg gag 768Lys Leu Ser Trp Asp Leu Ala Lys Val Arg
Thr Asp Leu Pro Leu Glu245 250 255gtg gac ttc gcc aaa agg cgg gag
ccc gac cgg gag agg ctt agg gcc 816Val Asp Phe Ala Lys Arg Arg Glu
Pro Asp Arg Glu Arg Leu Arg Ala260 265 270ttt ctg gag agg ctt gag
ttt ggc agc ctc ctc cac gag ttc ggc ctt 864Phe Leu Glu Arg Leu Glu
Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285ctg gaa agc ccc
aag gcc ctg gag gag gcc ccc tgg ccc ccg ccg gaa 912Leu Glu Ser Pro
Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295 300ggg gcc
ttc gtg ggc ttt gtg ctt tcc cgc aag gag ccc atg tgg gcc 960Gly Ala
Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala305 310 315
320gat ctt ctg gcc ctg gcc gcc gcc agg ggg ggc cgg gtc cac cgg gcc
1008Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg
Ala325 330 335ccc gag cct tat aaa gcc ctc agg gac ctg aag gag gcg
cgg ggg ctt 1056Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala
Arg Gly Leu340 345 350ctc gcc aaa gac ctg agc gtt ctg gcc ctg agg
gaa ggc ctt ggc ctc 1104Leu Ala Lys Asp Leu Ser Val Leu Ala Leu Arg
Glu Gly Leu Gly Leu355 360 365ccg ccc ggc gac gac ccc atg ctc ctc
gcc tac ctc ctg gac cct tcc 1152Pro Pro Gly Asp Asp Pro Met Leu Leu
Ala Tyr Leu Leu Asp Pro Ser370 375 380aac acc acc ccc gag ggg gtg
gcc cgg cgc tac ggc ggg gag tgg acg 1200Asn Thr Thr Pro Glu Gly Val
Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390 395 400gag gag gcg ggg
gag cgg gcc gcc ctt tcc gag agg ctc ttc gcc aac 1248Glu Glu Ala Gly
Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn405 410 415ctg tgg
ggg agg ctt gag ggg gag gag agg ctc ctt tgg ctt tac cgg 1296Leu Trp
Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg420 425
430gag gtg gag agg ccc ctt tcc gct gtc ctg gcc cac atg gag gcc acg
1344Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala
Thr435 440 445ggg gtg cgc ctg gac gtg gcc tat ctc agg gcc ttg tcc
ctg gag gtg 1392Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser
Leu Glu Val450 455 460gcc ggg gag atc gcc cgc ctc gag gcc gag gtc
ttc cgc ctg gcc ggc 1440Ala Gly Glu Ile Ala Arg Leu Glu Ala Glu Val
Phe Arg Leu Ala Gly465 470 475 480cac ccc ttc aac ctc aac tcc cgg
gac cag ctg gaa agg gtc ctc ttt 1488His Pro Phe Asn Leu Asn Ser Arg
Asp Gln Leu Glu Arg Val Leu Phe485 490 495gac gag cta ggg ctt ccc
gcc atc ggc aag acg gag aag acc ggc aag 1536Asp Glu Leu Gly Leu Pro
Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505 510cgc tcc acc agc
gcc gcc gtc ctg gag gcc ctc cgc gag gcc cac ccc 1584Arg Ser Thr Ser
Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro515 520 525atc gtg
gag aag atc ctg cag tac cgg gag ctc acc aag ctg aag agc 1632Ile Val
Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser530 535
540acc tac att gac ccc ttg ccg gac ctc atc cac ccc agg acg ggc cgc
1680Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly
Arg545 550 555 560ctc cac acc cgc ttc aac cag acg gcc acg gcc acg
ggc agg cta agt 1728Leu His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr
Gly Arg Leu Ser565 570 575agc tcc gat ccc aac ctc cag aac atc ccc
gtc cgc acc ccg ctt ggg 1776Ser Ser Asp Pro Asn Leu Gln Asn Ile Pro
Val Arg Thr Pro Leu Gly580 585 590cag agg atc cgc cgg gcc ttc atc
gcc gag gag ggg tgg cta ttg gtg 1824Gln Arg Ile Arg Arg Ala Phe Ile
Ala Glu Glu Gly Trp Leu Leu Val595 600 605gcc ctg gcc tat agc cag
ata gag ctc agg gtg ctg gcc cac ctc tcc 1872Ala Leu Ala Tyr Ser Gln
Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615 620ggc gac gag aac
ctg atc cgg gtc ttc cag gag ggg cgg gac atc cac 1920Gly Asp Glu Asn
Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His625 630 635 640acg
gag acc gcc agc tgg atg ttc ggc gtc ccc cgg gag gcc gtg gac 1968Thr
Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp645 650
655ccc ctg atg cgc cgg gcg gcc aag acc atc aac ttc ggg gtc ctc tac
2016Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu
Tyr660 665 670ggc atg tcg gcc cac cgc ctc tcc cag gag cta gcc atc
cct tac gag 2064Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile
Pro Tyr Glu675 680 685gag gcc cag gcc ttc att gag cgc tac ttt cag
agc ttc ccc aag gtg 2112Glu Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln
Ser Phe Pro Lys Val690 695 700cgg gcc tgg att gag aag acc ctg gag
gag ggc agg agg cgg ggg tac 2160Arg Ala Trp Ile Glu Lys Thr Leu Glu
Glu Gly Arg Arg Arg Gly Tyr705 710 715 720gtg gag acc ctc ttc ggc
cgc cgc cgc tac gtg cca gac cta gag gcc 2208Val Glu Thr Leu Phe Gly
Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725 730 735cgg gtg aag agc
gtg cgg gag gcg gcc gag cgc atg gcc ttc aac atg 2256Arg Val Lys Ser
Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met740 745 750ccc gtc
cag ggc acc gcc gcc gac ctc atg aag ctg gct atg gtg aag 2304Pro Val
Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys755 760
765ctc ttc ccc agg ctg gag gaa atg ggg gcc agg atg ctc ctt cag gtc
2352Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln
Val770 775 780cac gac gag ctg gtc ctc gag gcc cca aaa gag agg gcg
gag gcc gtg 2400His Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala
Glu Ala Val785 790 795 800gcc cgg ctg gcc aag gag gtc atg gag ggg
gtg tat ccc ctg gcc gtg 2448Ala Arg Leu Ala Lys Glu Val Met Glu Gly
Val Tyr Pro Leu Ala Val805 810 815ccc ctg gag gtg gag gtg ggg ata
ggg gag gac tgg ctc tcc gcc aag 2496Pro Leu Glu Val Glu Val Gly Ile
Gly Glu Asp Trp Leu Ser Ala Lys820 825 830gag tgatag
2505Glu69833PRTArtificial SequenceSynthetic Construct 69Met Asn Ser
Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15Leu Val
Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30Gly
Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40
45Ala Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50
55 60Val Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr
Gly65 70 75 80Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe
Pro Arg Gln85 90 95Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly
Leu Ala Arg Leu100 105 110Glu Val Pro Gly Tyr Glu Ala Asp Asp Val
Leu Ala Ser Leu Ala Lys115 120 125Lys Ala Glu Lys Glu Gly Tyr Glu
Val Arg Ile Leu Thr Ala Asp Lys130 135 140Asp Leu Tyr Gln Leu Leu
Ser Asp Arg Ile His Val Leu His Pro Glu145 150 155 160Gly Tyr Leu
Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175Pro
Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185
190Asn Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys
Leu195 200 205Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn
Leu Asp Arg210 215 220Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala
His Met Asp Asp Leu225 230 235 240Lys Leu Ser Trp Asp Leu Ala Lys
Val Arg Thr Asp Leu Pro Leu Glu245 250 255Val Asp Phe Ala Lys Arg
Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala260 265 270Phe Leu Glu Arg
Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285Leu Glu
Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295
300Gly Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp
Ala305 310 315 320Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg
Val His Arg Ala325 330 335Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu
Lys Glu Ala Arg Gly Leu340 345 350Leu Ala Lys Asp Leu Ser Val Leu
Ala Leu Arg Glu Gly Leu Gly Leu355 360 365Pro Pro Gly Asp Asp Pro
Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser370 375 380Asn Thr Thr Pro
Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390 395 400Glu
Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn405 410
415Leu Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr
Arg420 425 430Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met
Glu Ala Thr435 440 445Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala
Leu Ser Leu Glu Val450 455 460Ala Gly Glu Ile Ala Arg Leu Glu Ala
Glu Val Phe Arg Leu Ala Gly465 470 475 480His Pro Phe Asn Leu Asn
Ser Arg Asp Gln Leu Glu Arg Val Leu Phe485 490 495Asp Glu Leu Gly
Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505 510Arg Ser
Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro515 520
525Ile Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys
Ser530 535 540Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg
Thr Gly Arg545 550 555 560Leu His Thr Arg Phe Asn Gln Thr Ala Thr
Ala Thr Gly Arg Leu Ser565 570 575Ser Ser Asp Pro Asn Leu Gln Asn
Ile Pro Val Arg Thr Pro Leu Gly580 585 590Gln Arg Ile Arg Arg Ala
Phe Ile Ala Glu Glu Gly Trp Leu Leu Val595 600 605Ala Leu Ala Tyr
Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615 620Gly Asp
Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His625 630 635
640Thr Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val
Asp645 650 655Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly
Val Leu Tyr660 665 670Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu
Ala Ile Pro Tyr Glu675 680 685Glu Ala Gln Ala Phe Ile Glu Arg Tyr
Phe Gln Ser Phe Pro Lys Val690 695 700Arg Ala Trp Ile Glu Lys Thr
Leu Glu Glu Gly Arg Arg Arg Gly Tyr705 710 715 720Val Glu Thr Leu
Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725
730 735Arg Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn
Met740 745 750Pro Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala
Met Val Lys755 760 765Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg
Met Leu Leu Gln Val770 775 780His Asp Glu Leu Val Leu Glu Ala Pro
Lys Glu Arg Ala Glu Ala Val785 790 795 800Ala Arg Leu Ala Lys Glu
Val Met Glu Gly Val Tyr Pro Leu Ala Val805 810 815Pro Leu Glu Val
Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys820 825
830Glu702505DNAArtificial SequenceSynthetic 70atg aat tcg ggg atg
ctg ccc ctc ttt gag ccc aag ggc cgg gtc ctc 48Met Asn Ser Gly Met
Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15ctg gtg gac ggc
cac cac ctg gcc tac cgc acc ttc cac gcc ctg aag 96Leu Val Asp Gly
His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30ggc ctc acc
acc agc cgg ggg gag ccg gtg cag gcg gtc tac ggc ttc 144Gly Leu Thr
Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40 45gcc aag
agc ctc ctc aag gcc ctc aag gag gac ggg gac gcg gtg atc 192Ala Lys
Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50 55 60gtg
gtc ttt gac gcc aag gcc ccc tcc ttc cgc cac gag gcc tac ggg 240Val
Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly65 70 75
80ggg tac aag gcg ggc cgg gcc ccc acg ccg gag gac ttt ccc cgg caa
288Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg
Gln85 90 95ctc gcc ctc atc aag gag ctg gtg gac ctc ctg ggg ctg gcg
cgc ctc 336Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala
Arg Leu100 105 110gag gtc ccg ggc tac gag gcg gac gac gtc ctg gcc
agc ctg gcc aag 384Glu Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala
Ser Leu Ala Lys115 120 125aag gcg gaa aag gag ggc tac gag gtc cgc
atc ctc acc gcc gac aaa 432Lys Ala Glu Lys Glu Gly Tyr Glu Val Arg
Ile Leu Thr Ala Asp Lys130 135 140gac ctt tac cag ctc ctt tcc gac
cgc atc cac gtc ctc cac ccc gag 480Asp Leu Tyr Gln Leu Leu Ser Asp
Arg Ile His Val Leu His Pro Glu145 150 155 160ggg tac ctc atc acc
ccg gcc tgg ctt tgg gaa aag tac ggc ctg agg 528Gly Tyr Leu Ile Thr
Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175ccc gac cag
tgg gcc gac tac cgg gcc ctg acc ggg gac gag tcc gac 576Pro Asp Gln
Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185 190aac
ctt ccc ggg gtc aag ggc atc ggg gag aag acg gcg agg aag ctt 624Asn
Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu195 200
205ctg gag gag tgg ggg agc ctg gaa gcc ctc ctc aag aac ctg gac cgg
672Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp
Arg210 215 220ctg aag ccc gcc atc cgg gag aag atc ctg gcc cac atg
gac gat ctg 720Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met
Asp Asp Leu225 230 235 240aag ctc tcc tgg gac ctg gcc aag gtg cgc
acc gac ctg ccc ctg gag 768Lys Leu Ser Trp Asp Leu Ala Lys Val Arg
Thr Asp Leu Pro Leu Glu245 250 255gtg gac ttc gcc aaa agg cgg gag
ccc gac cgg gag agg ctt agg gcc 816Val Asp Phe Ala Lys Arg Arg Glu
Pro Asp Arg Glu Arg Leu Arg Ala260 265 270ttt ctg gag agg ctt gag
ttt ggc agc ctc ctc cac gag ttc ggc ctt 864Phe Leu Glu Arg Leu Glu
Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285ctg gaa agc ccc
aag gcc ctg gag gag gcc ccc tgg ccc ccg ccg gaa 912Leu Glu Ser Pro
Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295 300ggg gcc
ttc gtg ggc ttt gtg ctt tcc cgc aag gag ccc atg tgg gcc 960Gly Ala
Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala305 310 315
320gat ctt ctg gcc ctg gcc gcc gcc agg ggg ggc cgg gtc cac cgg gcc
1008Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg
Ala325 330 335ccc gag cct tat aaa gcc ctc agg gac ctg aag gag gcg
cgg ggg ctt 1056Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala
Arg Gly Leu340 345 350ctc gcc aaa gac ctg agc gtt ctg gcc ctg agg
gaa ggc ctt ggc ctc 1104Leu Ala Lys Asp Leu Ser Val Leu Ala Leu Arg
Glu Gly Leu Gly Leu355 360 365ccg ccc ggc gac gac ccc atg ctc ctc
gcc tac ctc ctg gac cct tcc 1152Pro Pro Gly Asp Asp Pro Met Leu Leu
Ala Tyr Leu Leu Asp Pro Ser370 375 380aac acc acc ccc gag ggg gtg
gcc cgg cgc tac ggc ggg gag tgg acg 1200Asn Thr Thr Pro Glu Gly Val
Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390 395 400gag gag gcg ggg
gag cgg gcc gcc ctt tcc gag agg ctc ttc gcc aac 1248Glu Glu Ala Gly
Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn405 410 415ctg tgg
ggg agg ctt gag ggg gag gag agg ctc ctt tgg ctt tac cgg 1296Leu Trp
Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg420 425
430gag gtg gag agg ccc ctt tcc gct gtc ctg gcc cac atg gag gcc acg
1344Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala
Thr435 440 445ggg gtg cgc ctg gac gtg gcc tat ctc agg gcc ttg tcc
ctg gag gtg 1392Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser
Leu Glu Val450 455 460gcc ggg gag atc gcc cgc ctc gag gcc gag gtc
ttc cgc ctg gcc ggc 1440Ala Gly Glu Ile Ala Arg Leu Glu Ala Glu Val
Phe Arg Leu Ala Gly465 470 475 480cac ccc ttc aac ctc aac tcc cgg
gac cag ctg gaa agg gtc ctc ttt 1488His Pro Phe Asn Leu Asn Ser Arg
Asp Gln Leu Glu Arg Val Leu Phe485 490 495gac gag cta ggg ctt ccc
gcc atc ggc aag acg gag aag acc ggc aag 1536Asp Glu Leu Gly Leu Pro
Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505 510cgc tcc acc agc
gcc gcc gtc ctg gag gcc ctc cgc gag gcc cac ccc 1584Arg Ser Thr Ser
Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro515 520 525atc gtg
gag aag atc ctg cag tac cgg gag ctc acc aag ctg aag agc 1632Ile Val
Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser530 535
540acc tac att gac ccc ttg ccg gac ctc atc cac ccc agg acg ggc cgc
1680Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly
Arg545 550 555 560ctc cac acc cgc ttc aac cag acg gcc acg gcc acg
ggc agg cta agt 1728Leu His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr
Gly Arg Leu Ser565 570 575agc tcc gat ccc aac ctc cag aac atc ccc
gtc cgc acc ccg ctt ggg 1776Ser Ser Asp Pro Asn Leu Gln Asn Ile Pro
Val Arg Thr Pro Leu Gly580 585 590cag agg atc cgc cgg gcc ttc atc
gcc gag gag ggg tgg cta ttg gtg 1824Gln Arg Ile Arg Arg Ala Phe Ile
Ala Glu Glu Gly Trp Leu Leu Val595 600 605gcc ctg gtc tat agc cag
ata gag ctc agg gtg ctg gcc cac ctc tcc 1872Ala Leu Val Tyr Ser Gln
Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615 620ggc gac gag aac
ctg atc cgg gtc ttc cag gag ggg cgg gac atc cac 1920Gly Asp Glu Asn
Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His625 630 635 640acg
gag acc gcc agc tgg atg ttc ggc gtc ccc cgg gag gcc gtg gac 1968Thr
Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp645 650
655ccc ctg atg cgc cgg gcg gcc aag acc atc aac ttc ggg gtc ctc tac
2016Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu
Tyr660 665 670ggc atg tcg gcc cac cgc ctc tcc cag gag cta gcc atc
cct tac gag 2064Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile
Pro Tyr Glu675 680 685gag gcc cag gcc ttc att gag cgc tac ttt cag
agc ttc ccc aag gtg 2112Glu Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln
Ser Phe Pro Lys Val690 695 700cgg gcc tgg att gag aag acc ctg gag
gag ggc agg agg cgg ggg tac 2160Arg Ala Trp Ile Glu Lys Thr Leu Glu
Glu Gly Arg Arg Arg Gly Tyr705 710 715 720gtg gag acc ctc ttc ggc
cgc cgc cgc tac gtg cca gac cta gag gcc 2208Val Glu Thr Leu Phe Gly
Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725 730 735cgg gtg aag agc
gtg cgg gag gcg gcc gag cgc atg gcc ttc aac atg 2256Arg Val Lys Ser
Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met740 745 750ccc gtc
cag ggc acc gcc gcc gac ctc atg aag ctg gct atg gtg aag 2304Pro Val
Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys755 760
765ctc ttc ccc agg ctg gag gaa atg ggg gcc agg atg ctc ctt cag gtc
2352Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln
Val770 775 780cac gac gag ctg gtc ctc gag gcc cca aaa gag agg gcg
gag gcc gtg 2400His Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala
Glu Ala Val785 790 795 800gcc cgg ctg gcc aag gag gtc atg gag ggg
gtg tat ccc ctg gcc gtg 2448Ala Arg Leu Ala Lys Glu Val Met Glu Gly
Val Tyr Pro Leu Ala Val805 810 815ccc ctg gag gtg gag gtg ggg ata
ggg gag gac tgg ctc tcc gcc aag 2496Pro Leu Glu Val Glu Val Gly Ile
Gly Glu Asp Trp Leu Ser Ala Lys820 825 830gag tgatag
2505Glu71833PRTArtificial SequenceSynthetic Construct 71Met Asn Ser
Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu1 5 10 15Leu Val
Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys20 25 30Gly
Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe35 40
45Ala Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile50
55 60Val Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr
Gly65 70 75 80Gly Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe
Pro Arg Gln85 90 95Leu Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly
Leu Ala Arg Leu100 105 110Glu Val Pro Gly Tyr Glu Ala Asp Asp Val
Leu Ala Ser Leu Ala Lys115 120 125Lys Ala Glu Lys Glu Gly Tyr Glu
Val Arg Ile Leu Thr Ala Asp Lys130 135 140Asp Leu Tyr Gln Leu Leu
Ser Asp Arg Ile His Val Leu His Pro Glu145 150 155 160Gly Tyr Leu
Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg165 170 175Pro
Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp180 185
190Asn Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys
Leu195 200 205Leu Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn
Leu Asp Arg210 215 220Leu Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala
His Met Asp Asp Leu225 230 235 240Lys Leu Ser Trp Asp Leu Ala Lys
Val Arg Thr Asp Leu Pro Leu Glu245 250 255Val Asp Phe Ala Lys Arg
Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala260 265 270Phe Leu Glu Arg
Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu275 280 285Leu Glu
Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Pro Glu290 295
300Gly Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp
Ala305 310 315 320Asp Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg
Val His Arg Ala325 330 335Pro Glu Pro Tyr Lys Ala Leu Arg Asp Leu
Lys Glu Ala Arg Gly Leu340 345 350Leu Ala Lys Asp Leu Ser Val Leu
Ala Leu Arg Glu Gly Leu Gly Leu355 360 365Pro Pro Gly Asp Asp Pro
Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser370 375 380Asn Thr Thr Pro
Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr385 390 395 400Glu
Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn405 410
415Leu Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr
Arg420 425 430Glu Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met
Glu Ala Thr435 440 445Gly Val Arg Leu Asp Val Ala Tyr Leu Arg Ala
Leu Ser Leu Glu Val450 455 460Ala Gly Glu Ile Ala Arg Leu Glu Ala
Glu Val Phe Arg Leu Ala Gly465 470 475 480His Pro Phe Asn Leu Asn
Ser Arg Asp Gln Leu Glu Arg Val Leu Phe485 490 495Asp Glu Leu Gly
Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys500 505 510Arg Ser
Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro515 520
525Ile Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys
Ser530 535 540Thr Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg
Thr Gly Arg545 550 555 560Leu His Thr Arg Phe Asn Gln Thr Ala Thr
Ala Thr Gly Arg Leu Ser565 570 575Ser Ser Asp Pro Asn Leu Gln Asn
Ile Pro Val Arg Thr Pro Leu Gly580 585 590Gln Arg Ile Arg Arg Ala
Phe Ile Ala Glu Glu Gly Trp Leu Leu Val595 600 605Ala Leu Val Tyr
Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser610 615 620Gly Asp
Glu Asn Leu Ile Arg Val Phe Gln Glu Gly Arg Asp Ile His625 630 635
640Thr Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val
Asp645 650 655Pro Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly
Val Leu Tyr660 665 670Gly Met Ser Ala His Arg Leu Ser Gln Glu Leu
Ala Ile Pro Tyr Glu675 680 685Glu Ala Gln Ala Phe Ile Glu Arg Tyr
Phe Gln Ser Phe Pro Lys Val690 695 700Arg Ala Trp Ile Glu Lys Thr
Leu Glu Glu Gly Arg Arg Arg Gly Tyr705 710 715 720Val Glu Thr Leu
Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala725 730 735Arg Val
Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met740 745
750Pro Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val
Lys755 760 765Leu Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu
Leu Gln Val770 775 780His Asp Glu Leu Val Leu Glu Ala Pro Lys Glu
Arg Ala Glu Ala Val785 790 795 800Ala Arg Leu Ala Lys Glu Val Met
Glu Gly Val Tyr Pro Leu Ala Val805 810 815Pro Leu Glu Val Glu Val
Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys820 825
830Glu7225DNAArtificial SequenceSynthetic 72gggataccat gggagtgcag
tttgg 257327DNAArtificial SequenceSynthetic 73ggtaaatttt tctcgtcgac
atcccac 2774981DNAArtificial SequenceSynthetic 74atg gga gtg cag
ttt ggt gat ttt att cca aaa aat att atc tcc ttt 48Met Gly Val Gln
Phe Gly Asp Phe Ile Pro Lys Asn Ile Ile Ser Phe1 5 10 15gaa gat tta
aaa ggg aaa aaa gta gct att gat gga atg aat gca tta 96Glu Asp Leu
Lys Gly Lys Lys Val Ala Ile Asp Gly Met Asn Ala Leu20 25 30tat cag
ttt tta aca tct ata cgt ttg aga gat ggt tct cca ttg aga 144Tyr Gln
Phe Leu Thr Ser Ile Arg Leu Arg Asp Gly Ser Pro Leu Arg35 40 45aat
aga aaa gga gag ata acc tca gca tat aac gga gtt ttt tat aaa 192Asn
Arg Lys Gly Glu Ile Thr Ser Ala Tyr Asn Gly Val Phe Tyr Lys50 55
60acc ata cat ttg tta gag aat gat ata act cca atc tgg gtt ttt gat
240Thr Ile His Leu Leu Glu Asn Asp Ile Thr Pro Ile Trp Val Phe
Asp65 70 75 80ggt gag cca cca aag tta aag gag aaa aca agg aaa gtt
agg aga gag 288Gly Glu Pro Pro Lys Leu Lys Glu Lys Thr Arg Lys Val
Arg Arg Glu85 90 95atg aaa gag aaa gct gaa ctt aag atg aaa gag gca
att aaa aag gag 336Met Lys Glu Lys Ala Glu Leu Lys Met Lys Glu Ala
Ile Lys Lys Glu100 105 110gat ttt gaa gaa gct gct aag tat gca aag
agg gtt agc tat cta act 384Asp Phe Glu Glu Ala Ala Lys Tyr Ala Lys
Arg Val Ser Tyr Leu Thr115 120 125ccg aaa atg gtt gaa aac tgc aaa
tat ttg tta agt ttg atg ggc att 432Pro Lys Met Val Glu Asn Cys Lys
Tyr Leu Leu Ser Leu Met Gly Ile130 135 140ccg tat gtt gaa gct ccc
tct gag gga gag gca caa gca agc tat atg 480Pro Tyr Val Glu Ala Pro
Ser Glu Gly Glu Ala Gln Ala Ser Tyr Met145 150 155 160gca aag aag
gga gat gtt tgg gca gtt gta agt caa gat tat gat gcc 528Ala Lys Lys
Gly Asp Val Trp Ala Val
Val Ser Gln Asp Tyr Asp Ala165 170 175ttg tta tat gga gct ccg aga
gtt gtt aga aat tta aca act aca aag 576Leu Leu Tyr Gly Ala Pro Arg
Val Val Arg Asn Leu Thr Thr Thr Lys180 185 190gag atg cca gaa ctt
att gaa tta aat gag gtt tta gag gat tta aga 624Glu Met Pro Glu Leu
Ile Glu Leu Asn Glu Val Leu Glu Asp Leu Arg195 200 205att tct ttg
gat gat ttg ata gat ata gcc ata ttt atg gga act gac 672Ile Ser Leu
Asp Asp Leu Ile Asp Ile Ala Ile Phe Met Gly Thr Asp210 215 220tat
aat cca gga gga gtt aaa gga ata gga ttt aaa agg gct tat gaa 720Tyr
Asn Pro Gly Gly Val Lys Gly Ile Gly Phe Lys Arg Ala Tyr Glu225 230
235 240ttg gtt aga agt ggt gta gct aag gat gtt ttg aaa aaa gag gtt
gaa 768Leu Val Arg Ser Gly Val Ala Lys Asp Val Leu Lys Lys Glu Val
Glu245 250 255tac tac gat gag att aag agg ata ttt aaa gag cca aag
gtt acc gat 816Tyr Tyr Asp Glu Ile Lys Arg Ile Phe Lys Glu Pro Lys
Val Thr Asp260 265 270aac tat tca tta agc cta aaa ttg cca gat aaa
gag gga att ata aaa 864Asn Tyr Ser Leu Ser Leu Lys Leu Pro Asp Lys
Glu Gly Ile Ile Lys275 280 285ttc tta gtt gat gaa aat gac ttt aat
tat gat agg gtt aaa aag cat 912Phe Leu Val Asp Glu Asn Asp Phe Asn
Tyr Asp Arg Val Lys Lys His290 295 300gtt gat aaa ctc tat aac tta
att gca aac aaa act aag caa aaa aca 960Val Asp Lys Leu Tyr Asn Leu
Ile Ala Asn Lys Thr Lys Gln Lys Thr305 310 315 320tta gat gca tgg
ttt aaa taa 981Leu Asp Ala Trp Phe Lys32575326PRTArtificial
SequenceSynthetic Construct 75Met Gly Val Gln Phe Gly Asp Phe Ile
Pro Lys Asn Ile Ile Ser Phe1 5 10 15Glu Asp Leu Lys Gly Lys Lys Val
Ala Ile Asp Gly Met Asn Ala Leu20 25 30Tyr Gln Phe Leu Thr Ser Ile
Arg Leu Arg Asp Gly Ser Pro Leu Arg35 40 45Asn Arg Lys Gly Glu Ile
Thr Ser Ala Tyr Asn Gly Val Phe Tyr Lys50 55 60Thr Ile His Leu Leu
Glu Asn Asp Ile Thr Pro Ile Trp Val Phe Asp65 70 75 80Gly Glu Pro
Pro Lys Leu Lys Glu Lys Thr Arg Lys Val Arg Arg Glu85 90 95Met Lys
Glu Lys Ala Glu Leu Lys Met Lys Glu Ala Ile Lys Lys Glu100 105
110Asp Phe Glu Glu Ala Ala Lys Tyr Ala Lys Arg Val Ser Tyr Leu
Thr115 120 125Pro Lys Met Val Glu Asn Cys Lys Tyr Leu Leu Ser Leu
Met Gly Ile130 135 140Pro Tyr Val Glu Ala Pro Ser Glu Gly Glu Ala
Gln Ala Ser Tyr Met145 150 155 160Ala Lys Lys Gly Asp Val Trp Ala
Val Val Ser Gln Asp Tyr Asp Ala165 170 175Leu Leu Tyr Gly Ala Pro
Arg Val Val Arg Asn Leu Thr Thr Thr Lys180 185 190Glu Met Pro Glu
Leu Ile Glu Leu Asn Glu Val Leu Glu Asp Leu Arg195 200 205Ile Ser
Leu Asp Asp Leu Ile Asp Ile Ala Ile Phe Met Gly Thr Asp210 215
220Tyr Asn Pro Gly Gly Val Lys Gly Ile Gly Phe Lys Arg Ala Tyr
Glu225 230 235 240Leu Val Arg Ser Gly Val Ala Lys Asp Val Leu Lys
Lys Glu Val Glu245 250 255Tyr Tyr Asp Glu Ile Lys Arg Ile Phe Lys
Glu Pro Lys Val Thr Asp260 265 270Asn Tyr Ser Leu Ser Leu Lys Leu
Pro Asp Lys Glu Gly Ile Ile Lys275 280 285Phe Leu Val Asp Glu Asn
Asp Phe Asn Tyr Asp Arg Val Lys Lys His290 295 300Val Asp Lys Leu
Tyr Asn Leu Ile Ala Asn Lys Thr Lys Gln Lys Thr305 310 315 320Leu
Asp Ala Trp Phe Lys3257621DNAArtificial SequenceSynthetic
76gaggtgatac catgggtgtc c 217720DNAArtificial SequenceSynthetic
77gaaactctgc agcgcgtcag 20781023DNAArtificial SequenceSynthetic
78atg ggt gtc cca att ggt gag att ata cca aga aaa gaa att gag tta
48Met Gly Val Pro Ile Gly Glu Ile Ile Pro Arg Lys Glu Ile Glu Leu1
5 10 15gaa aac cta tac ggg aaa aaa atc gca atc gac gct ctt aat gca
atc 96Glu Asn Leu Tyr Gly Lys Lys Ile Ala Ile Asp Ala Leu Asn Ala
Ile20 25 30tac caa ttt ttg tcc aca ata aga cag aaa gat gga act cca
ctt atg 144Tyr Gln Phe Leu Ser Thr Ile Arg Gln Lys Asp Gly Thr Pro
Leu Met35 40 45gat tca aag ggt aga ata acc tcc cac cta agc ggg ctc
ttt tac agg 192Asp Ser Lys Gly Arg Ile Thr Ser His Leu Ser Gly Leu
Phe Tyr Arg50 55 60aca ata aac cta atg gag gct gga ata aaa cct gtg
tat gtt ttt gat 240Thr Ile Asn Leu Met Glu Ala Gly Ile Lys Pro Val
Tyr Val Phe Asp65 70 75 80gga gaa cct cca gaa ttc aaa aag aaa gag
ctc gaa aaa aga aga gaa 288Gly Glu Pro Pro Glu Phe Lys Lys Lys Glu
Leu Glu Lys Arg Arg Glu85 90 95gcg aga gag gaa gct gaa gaa aag tgg
aga gaa gca ctt gaa aaa gga 336Ala Arg Glu Glu Ala Glu Glu Lys Trp
Arg Glu Ala Leu Glu Lys Gly100 105 110gag ata gag gaa gca aga aaa
tat gcc caa aga gca acc agg gta aat 384Glu Ile Glu Glu Ala Arg Lys
Tyr Ala Gln Arg Ala Thr Arg Val Asn115 120 125gaa atg ctc atc gag
gat gca aaa aaa ctc tta gag ctt atg gga att 432Glu Met Leu Ile Glu
Asp Ala Lys Lys Leu Leu Glu Leu Met Gly Ile130 135 140cct ata gtt
caa gca cct agc gag gga gag gcc caa gct gca tat atg 480Pro Ile Val
Gln Ala Pro Ser Glu Gly Glu Ala Gln Ala Ala Tyr Met145 150 155
160gcc gca aag ggg agc gtg tat gca tcg gct agt caa gat tac gat tcc
528Ala Ala Lys Gly Ser Val Tyr Ala Ser Ala Ser Gln Asp Tyr Asp
Ser165 170 175cta ctt ttt gga gct cca aga ctt gtt aga aac tta aca
ata aca gga 576Leu Leu Phe Gly Ala Pro Arg Leu Val Arg Asn Leu Thr
Ile Thr Gly180 185 190aaa aga aag ttg cct ggg aaa aat gtc tac gtc
gag ata aag ccc gag 624Lys Arg Lys Leu Pro Gly Lys Asn Val Tyr Val
Glu Ile Lys Pro Glu195 200 205ttg ata att ttg gag gaa gta ctc aag
gaa tta aag cta aca aga gaa 672Leu Ile Ile Leu Glu Glu Val Leu Lys
Glu Leu Lys Leu Thr Arg Glu210 215 220aag ctc att gaa cta gca atc
ctc gtt gga aca gac tac aac cca gga 720Lys Leu Ile Glu Leu Ala Ile
Leu Val Gly Thr Asp Tyr Asn Pro Gly225 230 235 240gga ata aag ggc
ata ggc ctt aaa aaa gct tta gag att gtt aga cac 768Gly Ile Lys Gly
Ile Gly Leu Lys Lys Ala Leu Glu Ile Val Arg His245 250 255tca aaa
gat ccg cta gca aag ttc caa aag caa agc gat gtg gat tta 816Ser Lys
Asp Pro Leu Ala Lys Phe Gln Lys Gln Ser Asp Val Asp Leu260 265
270tat gca ata aaa gag ttc ttc cta aac cca cca gtc aca gat aac tac
864Tyr Ala Ile Lys Glu Phe Phe Leu Asn Pro Pro Val Thr Asp Asn
Tyr275 280 285aat tta gtg tgg aga gat ccc gac gaa gag gga ata cta
aag ttc tta 912Asn Leu Val Trp Arg Asp Pro Asp Glu Glu Gly Ile Leu
Lys Phe Leu290 295 300tgt gac gag cat gac ttt agt gag gaa aga gta
aag aat gga tta gag 960Cys Asp Glu His Asp Phe Ser Glu Glu Arg Val
Lys Asn Gly Leu Glu305 310 315 320agg ctt aag aag gca atc aaa agt
gga aaa caa tca acc ctt gaa agt 1008Arg Leu Lys Lys Ala Ile Lys Ser
Gly Lys Gln Ser Thr Leu Glu Ser325 330 335tgg ttc aag aga taa
1023Trp Phe Lys Arg34079340PRTArtificial SequenceSynthetic
Construct 79Met Gly Val Pro Ile Gly Glu Ile Ile Pro Arg Lys Glu Ile
Glu Leu1 5 10 15Glu Asn Leu Tyr Gly Lys Lys Ile Ala Ile Asp Ala Leu
Asn Ala Ile20 25 30Tyr Gln Phe Leu Ser Thr Ile Arg Gln Lys Asp Gly
Thr Pro Leu Met35 40 45Asp Ser Lys Gly Arg Ile Thr Ser His Leu Ser
Gly Leu Phe Tyr Arg50 55 60Thr Ile Asn Leu Met Glu Ala Gly Ile Lys
Pro Val Tyr Val Phe Asp65 70 75 80Gly Glu Pro Pro Glu Phe Lys Lys
Lys Glu Leu Glu Lys Arg Arg Glu85 90 95Ala Arg Glu Glu Ala Glu Glu
Lys Trp Arg Glu Ala Leu Glu Lys Gly100 105 110Glu Ile Glu Glu Ala
Arg Lys Tyr Ala Gln Arg Ala Thr Arg Val Asn115 120 125Glu Met Leu
Ile Glu Asp Ala Lys Lys Leu Leu Glu Leu Met Gly Ile130 135 140Pro
Ile Val Gln Ala Pro Ser Glu Gly Glu Ala Gln Ala Ala Tyr Met145 150
155 160Ala Ala Lys Gly Ser Val Tyr Ala Ser Ala Ser Gln Asp Tyr Asp
Ser165 170 175Leu Leu Phe Gly Ala Pro Arg Leu Val Arg Asn Leu Thr
Ile Thr Gly180 185 190Lys Arg Lys Leu Pro Gly Lys Asn Val Tyr Val
Glu Ile Lys Pro Glu195 200 205Leu Ile Ile Leu Glu Glu Val Leu Lys
Glu Leu Lys Leu Thr Arg Glu210 215 220Lys Leu Ile Glu Leu Ala Ile
Leu Val Gly Thr Asp Tyr Asn Pro Gly225 230 235 240Gly Ile Lys Gly
Ile Gly Leu Lys Lys Ala Leu Glu Ile Val Arg His245 250 255Ser Lys
Asp Pro Leu Ala Lys Phe Gln Lys Gln Ser Asp Val Asp Leu260 265
270Tyr Ala Ile Lys Glu Phe Phe Leu Asn Pro Pro Val Thr Asp Asn
Tyr275 280 285Asn Leu Val Trp Arg Asp Pro Asp Glu Glu Gly Ile Leu
Lys Phe Leu290 295 300Cys Asp Glu His Asp Phe Ser Glu Glu Arg Val
Lys Asn Gly Leu Glu305 310 315 320Arg Leu Lys Lys Ala Ile Lys Ser
Gly Lys Gln Ser Thr Leu Glu Ser325 330 335Trp Phe Lys
Arg3408025DNAArtificial SequenceSynthetic 80gataccatgg gtgtcccaat
tggtg 258137DNAArtificial SequenceSynthetic 81tcgacgtcga cttatctctt
gaaccaactt tcaaggg 378220DNAArtificial SequenceSynthetic
82agcgagggag aggcccaagc 208321DNAArtificial SequenceSynthetic
83gcctatgccc tttattcctc c 218433DNAArtificial SequenceSynthetic
84tggtcgctgt ctcgctgaaa gcgagacagc gtg 338530DNAArtificial
SequenceSynthetic 85tgctctctgg tcgctgtctg aaagacagcg
308626DNAArtificial SequenceSynthetic 86agaaaggaag ggaagaaagc
gaaagg 268727DNAArtificial SequenceSynthetic 87agaaaggaag
ggaagaaagc gaaaggc 278824DNAArtificial SequenceSynthetic
88gccggcgaac gtggcgagaa aggc 248927DNAArtificial SequenceSynthetic
89agaaaggaag ggaagaaagc gaaaggc 279030DNAArtificial
SequenceSynthetic 90aaaattcctt tctctttgcc ctttgcttcc
309126DNAArtificial SequenceSynthetic 91ggaaagccgg cgaacgtggc
gagaaa 269224DNAArtificial SequenceSynthetic 92ggaaagccgg
cgaacgtggc gaga 249327DNAArtificial SequenceSynthetic 93agaaaggaag
ggaagaaagc gaaaggt 279423DNAArtificial SequenceSynthetic
94ttccagagcc taatttgcca gta 239523DNAArtificial SequenceSynthetic
95ttccagagcc taatttgcca gta 239625DNAArtificial SequenceSynthetic
96cttaccaacg ctaacgagcg tcttg 259743DNAArtificial SequenceSynthetic
97cccgtctcgc tggtgaaaag aaaaaccacc ctggcgccca ata
439823DNAArtificial SequenceSynthetic 98tattgggcgc catggtggtt ttt
239923DNAArtificial SequenceSynthetic 99tattgggcgn cagggnggtt ttt
2310023DNAArtificial SequenceSynthetic 100tattgggcgn catggnggtt ttt
2310123DNAArtificial SequenceSynthetic 101tattgggcgc cagggnggtt ttt
2310223DNAArtificial SequenceSynthetic 102tattgggcgc catggnggtt ttt
2310356DNAArtificial SequenceSynthetic 103ctgaatataa acttgtggta
gttggagctg gtgccgtagg caagagtgcc ttgacg 5610456DNAArtificial
SequenceSynthetic 104ctgaatataa acttgtggta gttggagctg gtgacgtagg
caagagtgcc ttgacg 5610523DNAArtificial SequenceSynthetic
105gctcaaggca ctcttgccta cga 231068DNAArtificial SequenceSynthetic
106ttcaccag 810727DNAArtificial SequenceSynthetic 107ctccaactac
cacaagttta tattcag 2710814DNAArtificial SequenceSynthetic
108cgagagacca cgct 1410914DNAArtificial SequenceSynthetic
109cgagagacca cgct 1411014DNAArtificial SequenceSynthetic
110cgagagacca cgct 1411115DNAArtificial SequenceSynthetic
111cgagagacca cgctg 1511230DNAArtificial SequenceSynthetic
112gtaatcttac caacgctaac gagcgtcttg 3011331DNAArtificial
SequenceSynthetic 113cctaatttgc cagttacaaa ataaacagcc c
311148DNAArtificial SequenceSynthetic 114ttccagag
811544DNAArtificial SequenceSynthetic 115ttttccagag cctaatgaaa
ttaggctctg gaaagacgct cgtg 4411614DNAArtificial SequenceSynthetic
116aacgagcgtc tttg 1411714DNAArtificial SequenceSynthetic
117aacgagcgtc attg 1411850DNAArtificial SequenceSynthetic
118ttttttttta attaggctct ggaaagacgc tcgtgaaacg agcgtctttg
5011917DNAArtificial SequenceSynthetic 119ttttccagag cctaatg
1712013DNAArtificial SequenceSynthetic 120ccggtcgtcc tgg
1312125DNAArtificial SequenceSynthetic 121caattccggt gtactcaccg
gttcc 2512216DNAArtificial SequenceSynthetic 122ccggtcgtcc tggcaa
1612347DNAArtificial SequenceSynthetic 123tgttttgacc tccatagaag
accctatagt gagtcgtatt aatttcg 4712423DNAArtificial
SequenceSynthetic 124cgaaattaat acgactcact ata 2312530DNAArtificial
SequenceSynthetic 125cgaaattaat acgactcact atacccagaa
3012616DNAArtificial SequenceSynthetic 126cgaaattaat acgact
1612713DNAArtificial SequenceSynthetic 127cgaaattaat acg
1312812DNAArtificial SequenceSynthetic 128cgaaattaat ac
1212925DNAArtificial SequenceSynthetic 129cactataggg tcttctatgg
aggtc 2513028DNAArtificial SequenceSynthetic 130actcactata
gggtcttcta tggaggtc 2813129DNAArtificial SequenceSynthetic
131gactcactat agggtcttct atggaggtc 2913230DNAArtificial
SequenceSynthetic 132cgaaattaat acgcagtatg ttagcaaacg
3013330DNAArtificial SequenceSynthetic 133gaactggcat gattaagact
ccttattacc 3013429DNAArtificial SequenceSynthetic 134gaactggcat
gattaagact ccttattaa 29135326PRTArtificial SequenceSynthetic 135Met
Gly Val Gln Phe Gly Asp Phe Ile Pro Lys Asn Ile Ile Ser Phe1 5 10
15Glu Asp Leu Lys Gly Lys Lys Val Ala Ile Asp Gly Met Asn Ala Leu20
25 30Tyr Gln Phe Leu Thr Ser Ile Arg Leu Arg Asp Gly Ser Pro Leu
Arg35 40 45Asn Arg Lys Gly Glu Ile Thr Ser Ala Tyr Asn Gly Val Phe
Tyr Lys50 55 60Thr Ile His Leu Leu Glu Asn Asp Ile Thr Pro Ile Trp
Val Phe Asp65 70 75 80Gly Glu Pro Pro Lys Leu Lys Glu Lys Thr Arg
Lys Val Arg Arg Glu85 90 95Met Lys Glu Lys Ala Glu Leu Lys Met Lys
Glu Ala Ile Lys Lys Glu100 105 110Asp Phe Glu Glu Ala Ala Lys Tyr
Ala Lys Arg Val Ser Tyr Leu Thr115 120 125Pro Lys Met Val Glu Asn
Cys Lys Tyr Leu Leu Ser Leu Met Gly Ile130 135 140Pro Tyr Val Glu
Ala Pro Ser Glu Gly Glu Ala Gln
Ala Ser Tyr Met145 150 155 160Ala Lys Lys Gly Asp Val Trp Ala Val
Val Ser Gln Asp Tyr Asp Ala165 170 175Leu Leu Tyr Gly Ala Pro Arg
Val Val Arg Asn Leu Thr Thr Thr Lys180 185 190Glu Met Pro Glu Leu
Ile Glu Leu Asn Glu Val Leu Glu Asp Leu Arg195 200 205Ile Ser Leu
Asp Asp Leu Ile Asp Ile Ala Ile Phe Met Gly Thr Asp210 215 220Tyr
Asn Pro Gly Gly Val Lys Gly Ile Gly Phe Lys Arg Ala Tyr Glu225 230
235 240Leu Val Arg Ser Gly Val Ala Lys Asp Val Leu Lys Lys Glu Val
Glu245 250 255Tyr Tyr Asp Glu Ile Lys Arg Ile Phe Lys Glu Pro Lys
Val Thr Asp260 265 270Asn Tyr Ser Leu Ser Leu Lys Leu Pro Asp Lys
Glu Gly Ile Ile Lys275 280 285Phe Leu Val Asp Glu Asn Asp Phe Asn
Tyr Asp Arg Val Lys Lys His290 295 300Val Asp Lys Leu Tyr Asn Leu
Ile Ala Asn Lys Thr Lys Gln Lys Thr305 310 315 320Leu Asp Ala Trp
Phe Lys325136340PRTArtificial SequenceSynthetic 136Met Gly Val Pro
Ile Gly Glu Ile Ile Pro Arg Lys Glu Ile Glu Leu1 5 10 15Glu Asn Leu
Tyr Gly Lys Lys Ile Ala Ile Asp Ala Leu Asn Ala Ile20 25 30Tyr Gln
Phe Leu Ser Thr Ile Arg Gln Lys Asp Gly Thr Pro Leu Met35 40 45Asp
Ser Lys Gly Arg Ile Thr Ser His Leu Ser Gly Leu Phe Tyr Arg50 55
60Thr Ile Asn Leu Met Glu Ala Gly Ile Lys Pro Val Tyr Val Phe Asp65
70 75 80Gly Glu Pro Pro Glu Phe Lys Lys Lys Glu Leu Glu Lys Arg Arg
Glu85 90 95Ala Arg Glu Glu Ala Glu Glu Lys Trp Arg Glu Ala Leu Glu
Lys Gly100 105 110Glu Ile Glu Glu Ala Arg Lys Tyr Ala Gln Arg Ala
Thr Arg Val Asn115 120 125Glu Met Leu Ile Glu Asp Ala Lys Lys Leu
Leu Glu Leu Met Gly Ile130 135 140Pro Ile Val Gln Ala Pro Ser Glu
Gly Glu Ala Gln Ala Ala Tyr Met145 150 155 160Ala Ala Lys Gly Ser
Val Tyr Ala Ser Ala Ser Gln Asp Tyr Asp Ser165 170 175Leu Leu Phe
Gly Ala Pro Arg Leu Val Arg Asn Leu Thr Ile Thr Gly180 185 190Lys
Arg Lys Leu Pro Gly Lys Asn Val Tyr Val Glu Ile Lys Pro Glu195 200
205Leu Ile Ile Leu Glu Glu Val Leu Lys Glu Leu Lys Leu Thr Arg
Glu210 215 220Lys Leu Ile Glu Leu Ala Ile Leu Val Gly Thr Asp Tyr
Asn Pro Gly225 230 235 240Gly Ile Lys Gly Ile Gly Leu Lys Lys Ala
Leu Glu Ile Val Arg His245 250 255Ser Lys Asp Pro Leu Ala Lys Phe
Gln Lys Gln Ser Asp Val Asp Leu260 265 270Tyr Ala Ile Lys Glu Phe
Phe Leu Asn Pro Pro Val Thr Asp Asn Tyr275 280 285Asn Leu Val Trp
Arg Asp Pro Asp Glu Glu Gly Ile Leu Lys Phe Leu290 295 300Cys Asp
Glu His Asp Phe Ser Glu Glu Arg Val Lys Asn Gly Leu Glu305 310 315
320Arg Leu Lys Lys Ala Ile Lys Ser Gly Lys Gln Ser Thr Leu Glu
Ser325 330 335Trp Phe Lys Arg340137380PRTArtificial
SequenceSynthetic 137Met Gly Ile Gln Gly Leu Ala Lys Leu Ile Ala
Asp Val Ala Pro Ser1 5 10 15Ala Ile Arg Glu Asn Asp Ile Lys Ser Tyr
Phe Gly Arg Lys Val Ala20 25 30Ile Asp Ala Ser Met Ser Ile Tyr Gln
Phe Leu Ile Ala Val Arg Gln35 40 45Gly Gly Asp Val Leu Gln Asn Glu
Glu Gly Glu Thr Thr Ser His Leu50 55 60Met Gly Met Phe Tyr Arg Thr
Ile Arg Met Met Glu Asn Gly Ile Lys65 70 75 80Pro Val Tyr Val Phe
Asp Gly Lys Pro Pro Gln Leu Lys Ser Gly Glu85 90 95Leu Ala Lys Arg
Ser Glu Arg Arg Ala Glu Ala Glu Lys Gln Leu Gln100 105 110Gln Ala
Gln Ala Ala Gly Ala Glu Gln Glu Val Glu Lys Phe Thr Lys115 120
125Arg Leu Val Lys Val Thr Lys Gln His Asn Asp Glu Cys Lys His
Leu130 135 140Leu Ser Leu Met Gly Ile Pro Tyr Leu Asp Ala Pro Ser
Glu Ala Glu145 150 155 160Ala Ser Cys Ala Ala Leu Val Lys Ala Gly
Lys Val Tyr Ala Ala Ala165 170 175Thr Glu Asp Met Asp Cys Leu Thr
Phe Gly Ser Pro Val Leu Met Arg180 185 190His Leu Thr Ala Ser Glu
Ala Lys Lys Leu Pro Ile Gln Glu Phe His195 200 205Leu Ser Arg Ile
Leu Gln Glu Leu Gly Leu Asn Gln Glu Gln Phe Val210 215 220Asp Leu
Cys Ile Leu Leu Gly Ser Asp Tyr Cys Glu Ser Ile Arg Gly225 230 235
240Ile Gly Pro Lys Arg Ala Val Asp Leu Ile Gln Lys His Lys Ser
Ile245 250 255Glu Glu Ile Val Arg Arg Leu Asp Pro Asn Lys Tyr Pro
Val Pro Glu260 265 270Asn Trp Leu His Lys Glu Ala His Gln Leu Phe
Leu Glu Pro Glu Val275 280 285Leu Asp Pro Glu Ser Val Glu Leu Lys
Trp Ser Glu Pro Asn Glu Glu290 295 300Glu Leu Ile Lys Phe Met Cys
Gly Glu Lys Gln Phe Ser Glu Glu Arg305 310 315 320Ile Arg Ser Gly
Val Lys Arg Leu Ser Lys Ser Arg Gln Gly Ser Thr325 330 335Gln Gly
Arg Leu Asp Asp Phe Phe Lys Val Thr Gly Ser Leu Ser Ser340 345
350Ala Lys Arg Lys Glu Pro Glu Pro Lys Gly Ser Thr Lys Lys Lys
Ala355 360 365Lys Thr Gly Ala Ala Gly Lys Phe Lys Arg Gly Lys370
375 380138378PRTArtificial SequenceSynthetic 138Met Gly Ile His Gly
Leu Ala Lys Leu Ile Ala Asp Val Ala Pro Ser1 5 10 15Ala Ile Arg Glu
Asn Asp Ile Lys Ser Tyr Phe Gly Arg Lys Val Ala20 25 30Ile Asp Ala
Ser Met Ser Ile Tyr Gln Phe Leu Ile Ala Val Arg Gln35 40 45Gly Gly
Asp Val Leu Gln Asn Glu Glu Gly Glu Thr Thr Ser Leu Met50 55 60Gly
Met Phe Tyr Arg Thr Ile Arg Met Glu Asn Gly Ile Lys Pro Val65 70 75
80Tyr Val Phe Asp Gly Lys Pro Pro Gln Leu Lys Ser Gly Glu Leu Ala85
90 95Lys Arg Ser Glu Arg Arg Ala Glu Ala Glu Lys Gln Leu Gln Gln
Ala100 105 110Gln Glu Ala Gly Met Glu Glu Glu Val Glu Lys Phe Thr
Lys Arg Leu115 120 125Val Lys Val Thr Lys Gln His Asn Asp Glu Cys
Lys His Leu Leu Ser130 135 140Leu Met Gly Ile Pro Tyr Leu Asp Ala
Pro Ser Glu Ala Glu Ala Ser145 150 155 160Cys Ala Ala Leu Ala Lys
Ala Gly Lys Val Tyr Ala Ala Ala Thr Glu165 170 175Asp Met Asp Cys
Leu Thr Phe Gly Ser Pro Val Leu Met Arg His Leu180 185 190Thr Ala
Ser Glu Ala Lys Lys Leu Pro Ile Gln Glu Phe His Leu Ser195 200
205Arg Val Leu Gln Glu Leu Gly Leu Asn Gln Glu Gln Phe Val Asp
Leu210 215 220Cys Ile Leu Leu Gly Ser Asp Tyr Cys Glu Ser Ile Arg
Gly Ile Gly225 230 235 240Ala Lys Arg Ala Val Asp Leu Ile Gln Lys
His Lys Ser Ile Glu Glu245 250 255Ile Val Arg Arg Leu Asp Pro Ser
Lys Tyr Pro Val Pro Glu Asn Trp260 265 270Leu His Lys Glu Ala Gln
Gln Leu Phe Leu Glu Pro Glu Val Val Asp275 280 285Pro Glu Ser Val
Glu Leu Lys Trp Ser Glu Pro Asn Glu Glu Glu Leu290 295 300Val Lys
Phe Met Cys Gly Glu Lys Gln Phe Ser Glu Glu Arg Ile Arg305 310 315
320Ser Gly Val Lys Arg Leu Ser Lys Ser Arg Gln Gly Ser Thr Gln
Gly325 330 335Arg Leu Asp Asp Phe Phe Lys Val Thr Gly Ser Leu Ser
Ser Ala Lys340 345 350Arg Lys Glu Pro Glu Pro Lys Gly Pro Ala Lys
Lys Lys Ala Lys Thr355 360 365Gly Gly Ala Gly Lys Phe Arg Arg Gly
Lys370 375139382PRTArtificial SequenceSynthetic 139Met Gly Ile Lys
Gly Leu Asn Ala Ile Ile Ser Glu His Val Pro Ser1 5 10 15Ala Ile Arg
Lys Ser Asp Ile Lys Ser Phe Phe Gly Arg Lys Val Ala20 25 30Ile Asp
Ala Ser Met Ser Leu Tyr Gln Phe Leu Ile Ala Val Arg Gln35 40 45Gln
Asp Gly Gly Gln Leu Thr Asn Glu Ala Gly Glu Thr Thr Ser His50 55
60Leu Met Gly Met Phe Tyr Arg Thr Leu Arg Met Ile Asp Asn Gly Ile65
70 75 80Lys Pro Cys Tyr Val Phe Asp Gly Lys Pro Pro Asp Leu Lys Ser
His85 90 95Glu Leu Thr Lys Arg Ser Ser Arg Arg Val Glu Thr Glu Lys
Lys Leu100 105 110Ala Glu Ala Thr Thr Glu Leu Glu Lys Met Lys Gln
Glu Arg Arg Leu115 120 125Val Lys Val Ser Lys Glu His Asn Glu Glu
Ala Gln Lys Leu Leu Gly130 135 140Leu Met Gly Ile Pro Tyr Ile Ile
Ala Pro Thr Glu Ala Glu Ala Gln145 150 155 160Cys Ala Glu Leu Ala
Lys Lys Gly Lys Val Tyr Ala Ala Ala Ser Glu165 170 175Asp Met Asp
Thr Leu Cys Tyr Arg Thr Pro Phe Leu Leu Arg His Leu180 185 190Thr
Phe Ser Glu Ala Lys Lys Glu Pro Ile His Glu Ile Asp Thr Glu195 200
205Leu Val Leu Arg Gly Leu Asp Leu Thr Ile Glu Gln Phe Val Asp
Leu210 215 220Cys Ile Met Leu Gly Cys Asp Tyr Cys Glu Ser Ile Arg
Gly Val Gly225 230 235 240Pro Val Thr Ala Leu Lys Leu Ile Lys Thr
His Gly Ser Ile Glu Lys245 250 255Ile Val Glu Phe Ile Glu Ser Gly
Glu Ser Asn Asn Thr Lys Trp Lys260 265 270Ile Pro Glu Asp Trp Pro
Tyr Lys Gln Ala Arg Met Leu Phe Leu Asp275 280 285Pro Glu Val Ile
Asp Gly Asn Glu Ile Asn Leu Lys Trp Ser Pro Pro290 295 300Lys Glu
Lys Glu Leu Ile Glu Tyr Leu Cys Asp Asp Lys Lys Phe Ser305 310 315
320Glu Glu Arg Val Lys Ser Gly Ile Ser Arg Leu Lys Lys Gly Leu
Lys325 330 335Ser Gly Ile Gln Gly Arg Leu Asp Gly Phe Phe Gln Val
Val Pro Lys340 345 350Thr Lys Glu Gln Leu Ala Ala Ala Ala Lys Arg
Ala Gln Glu Asn Lys355 360 365Lys Leu Asn Lys Asn Lys Asn Lys Val
Thr Lys Gly Arg Arg370 375 380140387PRTArtificial SequenceSynthetic
140Met Gly Val His Ser Phe Trp Asp Ile Ala Gly Pro Thr Ala Arg Pro1
5 10 15Val Arg Leu Glu Ser Leu Glu Asp Lys Arg Met Ala Val Asp Ala
Ser20 25 30Ile Trp Ile Tyr Gln Phe Leu Lys Ala Val Arg Asp Gln Glu
Gly Asn35 40 45Ala Val Lys Asn Ser His Ile Thr Gly Phe Phe Arg Arg
Ile Cys Lys50 55 60Leu Leu Tyr Phe Gly Ile Arg Pro Val Phe Val Phe
Asp Gly Gly Val65 70 75 80Pro Val Leu Lys Arg Glu Thr Ile Arg Gln
Arg Lys Glu Arg Arg Gln85 90 95Gly Lys Arg Glu Ser Ala Lys Ser Thr
Ala Arg Lys Leu Leu Ala Leu100 105 110Gln Leu Gln Asn Gly Ser Asn
Asp Asn Glu Val Thr Met Asp Met Ile115 120 125Lys Glu Val Gln Glu
Leu Leu Ser Arg Phe Gly Ile Pro Tyr Ile Thr130 135 140Ala Pro Met
Glu Ala Glu Ala Gln Cys Ala Glu Leu Leu Gln Leu Asn145 150 155
160Leu Val Asp Gly Ile Ile Thr Asp Asp Ser Asp Val Phe Leu Phe
Gly165 170 175Gly Thr Lys Ile Tyr Lys Asn Met Phe His Glu Lys Asn
Tyr Val Glu180 185 190Phe Tyr Asp Ala Glu Ser Ile Leu Lys Leu Leu
Gly Leu Asp Arg Lys195 200 205Asn Met Ile Glu Leu Ala Gln Leu Leu
Gly Ser Asp Tyr Thr Asn Gly210 215 220Leu Lys Gly Met Gly Pro Val
Ser Ser Ile Glu Val Ile Ala Glu Phe225 230 235 240Gly Asn Leu Lys
Asn Phe Lys Asp Trp Tyr Asn Asn Gly Gln Phe Asp245 250 255Lys Arg
Lys Gln Glu Thr Glu Asn Lys Phe Glu Lys Asp Leu Arg Lys260 265
270Lys Leu Val Asn Asn Glu Ile Ile Leu Asp Asp Asp Phe Pro Ser
Val275 280 285Met Val Tyr Asp Ala Tyr Met Arg Pro Glu Val Asp His
Asp Thr Thr290 295 300Pro Phe Val Trp Gly Val Pro Asp Leu Asp Met
Leu Arg Ser Phe Met305 310 315 320Lys Thr Gln Leu Gly Trp Pro His
Glu Lys Ser Asp Glu Ile Leu Ile325 330 335Pro Leu Ile Arg Asp Val
Asn Lys Arg Lys Lys Lys Gly Lys Gln Lys340 345 350Arg Ile Asn Glu
Phe Phe Pro Arg Glu Tyr Ile Ser Gly Asp Lys Lys355 360 365Leu Asn
Thr Ser Lys Arg Ile Ser Thr Ala Thr Gly Lys Leu Lys Lys370 375
380Arg Lys Met385141488PRTArtificial SequenceSynthetic 141Met Gly
Val Ser Gly Leu Trp Asn Ile Leu Glu Pro Val Lys Arg Pro1 5 10 15Val
Lys Leu Glu Thr Leu Val Asn Lys Arg Leu Ala Ile Asp Ala Ser20 25
30Ile Trp Ile Tyr Gln Phe Leu Lys Ala Val Arg Asp Lys Glu Gly Asn35
40 45Gln Leu Lys Ser Ser His Val Val Gly Phe Phe Arg Arg Ile Cys
Lys50 55 60Leu Leu Phe Phe Gly Ile Lys Pro Val Phe Val Phe Asp Gly
Gly Ala65 70 75 80Pro Ser Leu Lys Arg Gln Thr Ile Gln Lys Arg Gln
Ala Arg Arg Leu85 90 95Asp Arg Glu Glu Asn Ala Thr Val Thr Ala Asn
Lys Leu Leu Ala Leu100 105 110Gln Met Arg His Gln Ala Met Leu Leu
Lys Arg Asp Ala Asp Glu Val115 120 125Thr Gln Val Met Ile Lys Glu
Cys Gln Glu Leu Leu Arg Leu Phe Gly130 135 140Leu Pro Tyr Ile Val
Ala Pro Gln Glu Ala Glu Ala Gln Cys Ser Lys145 150 155 160Leu Leu
Glu Leu Lys Leu Val Asp Gly Ile Val Thr Asp Asp Ser Asp165 170
175Val Phe Leu Phe Gly Gly Thr Arg Val Tyr Arg Asn Met Phe Asn
Gln180 185 190Asn Lys Phe Val Glu Leu Tyr Leu Met Asp Asp Met Lys
Arg Glu Phe195 200 205Asn Val Asn Gln Met Asp Leu Ile Lys Leu Ala
His Leu Leu Gly Ser210 215 220Asp Tyr Thr Met Gly Leu Ser Arg Val
Gly Pro Val Leu Ala Leu Glu225 230 235 240Ile Leu His Glu Phe Pro
Gly Asp Thr Gly Leu Phe Glu Phe Lys Lys245 250 255Trp Phe Gln Arg
Leu Ser Thr Gly His Ala Ser Lys Asn Asp Val Asn260 265 270Thr Pro
Val Lys Lys Arg Ile Asn Lys Leu Val Gly Lys Ile Ile Leu275 280
285Pro Ser Glu Phe Pro Asn Pro Leu Val Asp Glu Ala Tyr Leu His
Pro290 295 300Ala Val Asp Asp Ser Lys Gln Ser Phe Gln Trp Gly Ile
Pro Asp Leu305 310 315 320Asp Glu Leu Arg Gln Phe Leu Met Ala Thr
Val Gly Trp Ser Lys Gln325 330 335Arg Thr Asn Glu Val Leu Leu Pro
Val Ile Gln Asp Met His Lys Lys340 345 350Gln Phe Val Gly Thr Gln
Ser Asn Leu Thr Gln Phe Phe Glu Gly Gly355 360 365Asn Thr Asn Val
Tyr Ala Pro Arg Val Ala Tyr His Phe Lys Ser Lys370 375 380Arg Leu
Glu Asn Ala Leu Ser Ser Phe Lys Asn Gln Ile Ser Asn Gln385 390 395
400Ser Pro Met Ser Glu Glu Ile Gln Ala Asp Ala Asp Ala Phe Gly
Glu405 410 415Ser Lys Gly Ser Asp Glu Leu Gln Ser Arg Ile Leu Arg
Arg Lys Lys420 425 430Met Met Ala Ser Lys Asn Ser Ser Asp Ser Asp
Ser Asp Ser Glu Asp435 440 445Asn Phe Leu Ala Ser Leu Thr Pro Lys
Thr Asn Ser Ser Ser Ile Ser450 455 460Ile Glu Asn Leu Pro Arg Lys
Thr Lys Leu Ser Thr Ser Leu Leu Lys465 470 475 480Lys Pro Ser Lys
Arg Arg Arg Lys485142550PRTArtificial SequenceSynthetic 142Met Gly
Val Gln Gly Leu Trp Lys Leu Leu Glu Cys Ser Gly Arg Gln1 5 10 15Val
Ser Pro Glu Ala Leu Glu Gly Lys Ile Leu Ala Val Asp Ile Ser20 25
30Ile Trp Leu Asn Gln Ala Leu Lys Gly Val Arg Asp Arg His Gly Asn35
40 45Ser Ile Glu Asn Pro His Leu Leu Thr Leu Phe His Arg Leu Cys
Lys50 55 60Leu Leu Phe Phe Arg Ile Arg Pro Ile Phe Val Phe Asp Gly
Asp Ala65 70 75 80Pro Leu Leu Lys Lys Gln Thr Leu Val Lys
Arg Arg Gln Arg Lys Asp85 90 95Leu Ala Ser Ser Asp Ser Arg Lys Thr
Thr Glu Lys Leu Leu Lys Thr100 105 110Phe Leu Lys Arg Gln Ala Ile
Lys Thr Glu Arg Ile Ala Ala Thr Val115 120 125Thr Gly Gln Met Phe
Leu Glu Ser Gln Glu Leu Leu Arg Leu Phe Gly130 135 140Ile Pro Tyr
Ile Gln Ala Pro Met Glu Ala Glu Ala Gln Cys Ala Ile145 150 155
160Leu Asp Leu Thr Asp Gln Thr Ser Gly Thr Ile Thr Asp Asp Ser
Asp165 170 175Ile Trp Leu Phe Gly Ala Arg His Val Tyr Arg Asn Phe
Phe Asn Lys180 185 190Asn Lys Phe Val Glu Tyr Tyr Gln Tyr Val Asp
Phe His Asn Gln Leu195 200 205Gly Leu Asp Arg Asn Lys Leu Ile Asn
Leu Ala Tyr Leu Leu Gly Ser210 215 220Asp Tyr Thr Glu Gly Ile Pro
Thr Val Gly Cys Val Thr Ala Met Glu225 230 235 240Ile Leu Asn Glu
Phe Pro Gly His Gly Leu Glu Pro Leu Leu Lys Phe245 250 255Ser Glu
Trp Trp His Glu Ala Gln Lys Asn Pro Lys Ile Arg Pro Asn260 265
270Pro His Asp Thr Lys Val Lys Lys Lys Leu Arg Thr Leu Gln Leu
Thr275 280 285Pro Gly Phe Pro Asn Pro Ala Val Ala Glu Ala Tyr Leu
Lys Pro Val290 295 300Val Asp Asp Ser Lys Gly Ser Phe Leu Trp Gly
Lys Pro Asp Leu Asp305 310 315 320Lys Ile Arg Glu Phe Cys Gln Arg
Tyr Phe Gly Trp Asn Arg Thr Lys325 330 335Thr Asp Glu Ser Leu Phe
Pro Val Leu Lys Gln Leu Asp Ala Gln Gln340 345 350Thr Gln Leu Arg
Ile Asp Ser Phe Phe Arg Leu Ala Gln Gln Glu Lys355 360 365Glu Asp
Ala Lys Arg Ile Lys Ser Gln Arg Leu Asn Arg Ala Val Thr370 375
380Cys Met Leu Arg Lys Glu Lys Glu Ala Ala Ala Ser Glu Ile Glu
Ala385 390 395 400Val Ser Val Ala Met Glu Lys Glu Phe Glu Leu Leu
Asp Lys Ala Lys405 410 415Arg Lys Thr Gln Lys Arg Gly Ile Thr Asn
Thr Leu Glu Glu Ser Ser420 425 430Ser Leu Lys Arg Lys Arg Leu Ser
Asp Ser Lys Arg Lys Asn Thr Cys435 440 445Gly Gly Phe Leu Gly Glu
Thr Cys Leu Ser Glu Ser Ser Asp Gly Ser450 455 460Ser Ser Glu His
Ala Glu Ser Ser Ser Leu Met Asn Val Gln Arg Arg465 470 475 480Thr
Ala Ala Lys Glu Pro Lys Thr Ser Ala Ser Asp Ser Gln Asn Ser485 490
495Val Lys Glu Ala Pro Val Lys Asn Gly Gly Ala Thr Thr Ser Ser
Ser500 505 510Ser Asp Ser Asp Asp Asp Gly Gly Lys Glu Lys Met Val
Leu Val Thr515 520 525Ala Arg Ser Val Phe Gly Lys Lys Arg Arg Lys
Leu Arg Arg Ala Arg530 535 540Gly Arg Lys Arg Lys Thr545
550143543PRTArtificial SequenceSynthetic 143Met Gly Val Gln Gly Leu
Trp Lys Leu Leu Glu Cys Ser Gly His Arg1 5 10 15Val Ser Pro Glu Ala
Leu Glu Gly Lys Val Leu Ala Val Asp Ile Ser20 25 30Ile Trp Leu Asn
Gln Ala Leu Lys Gly Val Arg Asp Ser His Gly Asn35 40 45Val Ile Glu
Asn Ala His Leu Leu Thr Leu Phe His Arg Leu Cys Lys50 55 60Leu Leu
Phe Phe Arg Ile Arg Pro Ile Phe Val Phe Asp Gly Asp Ala65 70 75
80Pro Leu Leu Lys Lys Gln Thr Leu Ala Lys Arg Arg Gln Arg Lys Asp85
90 95Ser Ala Ser Ile Asp Ser Arg Lys Thr Thr Glu Lys Leu Leu Lys
Thr100 105 110Phe Leu Lys Arg Gln Ala Leu Lys Thr Asp Arg Ile Ala
Ala Ser Val115 120 125Thr Gly Gln Met Phe Leu Glu Ser Gln Glu Leu
Leu Arg Leu Phe Gly130 135 140Val Pro Tyr Ile Gln Ala Pro Met Glu
Ala Glu Ala Gln Cys Ala Val145 150 155 160Leu Asp Leu Ser Asp Gln
Thr Ser Gly Thr Ile Thr Asp Asp Ser Asp165 170 175Ile Trp Leu Phe
Gly Ala Arg His Val Tyr Lys Asn Phe Phe Asn Lys180 185 190Asn Lys
Phe Val Glu Tyr Tyr Gln Tyr Val Asp Phe Tyr Ser Gln Leu195 200
205Gly Leu Asp Arg Asn Lys Leu Ile Asn Leu Ala Tyr Leu Leu Gly
Ser210 215 220Asp Tyr Thr Glu Gly Ile Pro Thr Val Gly Cys Val Thr
Ala Met Glu225 230 235 240Ile Leu Asn Glu Phe Pro Gly Arg Gly Leu
Asp Pro Leu Leu Lys Phe245 250 255Ser Glu Trp Trp His Glu Ala Gln
Asn Asn Lys Lys Val Ala Glu Asn260 265 270Pro Tyr Asp Thr Lys Val
Lys Lys Lys Leu Arg Lys Leu Gln Leu Thr275 280 285Pro Gly Phe Pro
Asn Pro Ala Val Ala Asp Ala Tyr Leu Arg Pro Val290 295 300Val Asp
Asp Ser Arg Gly Ser Phe Leu Trp Gly Lys Pro Asp Val Asp305 310 315
320Lys Ile Arg Glu Phe Cys Gln Arg Tyr Phe Gly Trp Asn Arg Met
Lys325 330 335Thr Asp Glu Ser Leu Tyr Pro Val Leu Lys His Leu Asn
Ala His Gln340 345 350Thr Gln Leu Arg Ile Asp Ser Phe Phe Arg Leu
Ala Gln Gln Glu Lys355 360 365Gln Asp Ala Lys Leu Ile Lys Ser His
Arg Leu Ser Arg Ala Val Thr370 375 380Cys Met Leu Arg Lys Glu Arg
Glu Glu Lys Ala Pro Glu Leu Thr Lys385 390 395 400Val Thr Glu Ala
Met Glu Lys Glu Phe Glu Leu Leu Asp Asp Ala Lys405 410 415Gly Lys
Thr Gln Lys Arg Glu Leu Pro Tyr Lys Lys Glu Thr Ser Val420 425
430Pro Lys Arg Arg Arg Pro Ser Gly Asn Gly Gly Phe Leu Gly Asp
Pro435 440 445Tyr Cys Ser Glu Ser Pro Gln Glu Ser Ser Cys Glu Asp
Gly Glu Gly450 455 460Ser Ser Val Met Ser Ala Arg Gln Arg Ser Ala
Ala Glu Ser Ser Lys465 470 475 480Ile Gly Cys Ser Asp Val Pro Asp
Leu Val Arg Asp Ser Pro His Gly485 490 495Arg Gln Gly Cys Val Ser
Thr Ser Ser Ser Asp Ser Glu Asp Gly Glu500 505 510Asp Lys Ala Lys
Thr Val Leu Val Thr Ala Arg Pro Val Phe Gly Lys515 520 525Lys Arg
Arg Lys Leu Lys Ser Met Lys Arg Arg Lys Lys Lys Thr530 535
540144527PRTArtificial SequenceSynthetic 144Met Gly Val Gln Gly Leu
Trp Lys Leu Leu Glu Cys Ser Gly Arg Pro1 5 10 15Ile Asn Pro Gly Thr
Leu Glu Gly Lys Ile Leu Ala Val Asp Ile Ser20 25 30Ile Trp Leu Asn
Gln Ala Val Lys Gly Ala Arg Asp Arg Gln Gly Asn35 40 45Ala Ile Gln
Asn Ala His Leu Leu Thr Leu Phe His Arg Leu Cys Lys50 55 60Leu Leu
Phe Phe Arg Ile Arg Pro Ile Phe Val Phe Asp Gly Glu Ala65 70 75
80Pro Leu Leu Lys Arg Gln Thr Leu Ala Lys Arg Arg Gln Arg Thr Asp85
90 95Lys Ala Ser Asn Asp Ala Arg Lys Thr Asn Glu Lys Leu Leu Arg
Thr100 105 110Phe Leu Lys Arg Gln Ala Ile Lys Ala Glu Arg Ile Ala
Ala Thr Val115 120 125Thr Gly Gln Met Cys Leu Glu Ser Gln Glu Leu
Leu Gln Leu Phe Gly130 135 140Ile Pro Tyr Ile Val Ala Pro Met Glu
Ala Glu Ala Gln Cys Ala Ile145 150 155 160Leu Asp Leu Thr Asp Gln
Thr Ser Gly Thr Ile Thr Asp Asp Ser Asp165 170 175Ile Trp Leu Phe
Gly Ala Arg His Val Tyr Lys Asn Phe Phe Ser Gln180 185 190Asn Lys
His Val Glu Tyr Tyr Gln Tyr Ala Asp Ile His Asn Gln Leu195 200
205Gly Leu Asp Arg Ser Lys Leu Ile Asn Leu Ala Tyr Leu Leu Gly
Ser210 215 220Asp Tyr Thr Glu Gly Ile Pro Thr Val Gly Tyr Val Ser
Ala Met Glu225 230 235 240Ile Leu Asn Glu Phe Pro Gly Gln Gly Leu
Glu Pro Leu Val Lys Phe245 250 255Lys Glu Trp Trp Ser Glu Ala Gln
Lys Asp Lys Lys Met Arg Pro Asn260 265 270Pro Asn Asp Thr Lys Val
Lys Lys Lys Leu Arg Leu Leu Asp Leu Gln275 280 285Gln Ser Phe Pro
Asn Pro Ala Val Ala Ser Ala Tyr Leu Lys Pro Val290 295 300Val Asp
Glu Ser Lys Ser Ala Phe Ser Trp Gly Arg Pro Asp Leu Glu305 310 315
320Gln Ile Arg Glu Phe Cys Glu Ser Arg Phe Gly Trp Tyr Arg Leu
Lys325 330 335Thr Asp Glu Val Leu Leu Pro Val Leu Lys Gln Leu Asn
Ala Gln Gln340 345 350Thr Gln Leu Arg Ile Asp Ser Phe Phe Arg Leu
Glu Gln His Glu Ala355 360 365Ala Gly Leu Lys Ser Gln Arg Leu Arg
Arg Ala Val Thr Cys Met Lys370 375 380Arg Lys Glu Arg Asp Val Glu
Ala Glu Glu Val Glu Ala Ala Val Ala385 390 395 400Val Met Glu Arg
Glu Cys Thr Asn Gln Arg Lys Gly Gln Lys Thr Asn405 410 415Thr Lys
Ser Gln Gly Thr Lys Arg Arg Lys Pro Thr Glu Cys Ser Gln420 425
430Glu Asp Gln Asp Pro Gly Gly Gly Phe Ile Gly Ile Glu Leu Lys
Thr435 440 445Leu Ser Ser Lys Ala Tyr Ser Ser Asp Gly Ser Ser Ser
Asp Ala Glu450 455 460Asp Leu Pro Ser Gly Leu Ile Asp Lys Gln Ser
Gln Ser Gly Ile Val465 470 475 480Gly Arg Gln Lys Ala Ser Asn Lys
Val Glu Ser Ser Ser Ser Ser Asp485 490 495Asp Glu Asp Arg Thr Val
Met Val Thr Ala Lys Pro Val Phe Gln Gly500 505 510Lys Lys Thr Lys
Ser Lys Thr Met Lys Glu Thr Val Lys Arg Lys515 520
525145434PRTArtificial SequenceSynthetic 145Met Thr Ile Asn Gly Ile
Trp Glu Trp Ala Asn His Val Val Arg Lys1 5 10 15Val Pro Asn Glu Thr
Met Arg Asp Lys Thr Leu Ser Ile Asp Gly His20 25 30Ile Trp Leu Tyr
Glu Ser Leu Lys Gly Cys Glu Ala His His Gln Gln35 40 45Thr Pro Asn
Ser Tyr Leu Val Thr Phe Phe Thr Arg Ile Gln Arg Leu50 55 60Leu Glu
Leu Lys Ile Ile Pro Ile Val Val Phe Asp Asn Ile Asn Ala65 70 75
80Ser Ser Ser Ala His Glu Ser Lys Asp Gln Asn Glu Phe Val Pro Arg85
90 95Lys Arg Arg Ser Phe Gly Asp Ser Pro Phe Thr Asn Leu Val Asp
His100 105 110Val Tyr Lys Thr Asn Ala Leu Leu Thr Glu Leu Gly Ile
Lys Val Ile115 120 125Ile Ala Pro Gly Asp Gly Glu Ala Gln Cys Ala
Arg Leu Glu Asp Leu130 135 140Gly Val Thr Ser Gly Cys Ile Thr Thr
Asp Phe Asp Tyr Phe Leu Phe145 150 155 160Gly Gly Lys Asn Leu Tyr
Arg Phe Asp Phe Thr Ala Gly Thr Ser Ser165 170 175Thr Ala Cys Leu
His Asp Ile Met His Leu Ser Leu Gly Arg Met Phe180 185 190Met Glu
Lys Lys Val Ser Arg Pro His Leu Ile Ser Thr Ala Ile Leu195 200
205Leu Gly Cys Asp Tyr Phe Gln Arg Gly Val Gln Asn Ile Gly Ile
Val210 215 220Ser Val Phe Asp Ile Leu Gly Glu Phe Gly Asp Asp Gly
Asn Glu Glu225 230 235 240Ile Asp Pro His Val Ile Leu Asp Arg Phe
Ala Ser Tyr Val Arg Glu245 250 255Glu Ile Pro Ala Arg Ser Glu Asp
Thr Gln Arg Lys Leu Arg Leu Arg260 265 270Arg Lys Lys Tyr Asn Phe
Pro Val Gly Phe Pro Asn Cys Asp Ala Val275 280 285His Asn Ala Ile
Thr Met Tyr Leu Arg Pro Pro Val Ser Ser Glu Ile290 295 300Pro Lys
Ile Ile Pro Arg Ala Ala Asn Phe Gln Gln Val Ala Glu Ile305 310 315
320Met Met Lys Glu Cys Gly Trp Pro Ala Thr Arg Thr Gln Lys Glu
Leu325 330 335Ala Leu Ser Ile Arg Arg Lys Val His Leu Thr Thr Thr
Val Ala Gln340 345 350Thr Arg Ile Pro Asp Phe Phe Ala Ala Thr Lys
Ser Lys Asn Phe Thr355 360 365Pro Ile Val Glu Pro Cys Glu Ser Leu
Glu Asp Tyr Ile Ser Ala Asn370 375 380Asn Thr Trp Met Arg Lys Arg
Lys Arg Ser Glu Ser Pro Gln Ile Leu385 390 395 400Gln His His Ala
Lys Arg Gln Val Pro Asp Arg Lys Arg Ser Val Lys405 410 415Ile Arg
Ala Phe Lys Pro Tyr Pro Thr Asp Val Ile Glu Leu Gly Asp420 425
430Ser Asp14633DNAArtificial SequenceSynthetic 146tactgactca
ctatagggtc ttctatggag gtc 3314742DNAArtificial SequenceSynthetic
147ttttttttta attaggctct ggaagacgct gaaagcgtct tg
4214838DNAArtificial SequenceSynthetic 148ttttttttta attaggctct
ggaagacgga acgtcttg 3814934DNAArtificial SequenceSynthetic
149ttttttttta attaggctct ggaagagaat cttg 3415032DNAArtificial
SequenceSynthetic 150ttttttttta attaggctct ggaaggaact tg
3215125DNAArtificial SequenceSynthetic 151ttttttttta attaggctct
ggaag 2515226DNAArtificial SequenceSynthetic 152attagaaagg
aagggaagaa agcgaa 2615330DNAArtificial SequenceSynthetic
153acggggaaag ccggcgaacg tggcgagaaa 3015430DNAArtificial
SequenceSynthetic 154tgacggggaa agccggcgaa cgtggcgaga
3015530DNAArtificial SequenceSynthetic 155cttgacgggg aaagccggcg
aacgtggcga 3015630DNAArtificial SequenceSynthetic 156gcttgacggg
gaaagccggc gaacgtggcg 3015718DNAArtificial SequenceSynthetic
157agaaaggaag ggaagaaa 1815845DNAArtificial SequenceSynthetic
158tggaggtcaa aacatcgata agtcgaagaa aggaagggaa gaaat
4515914DNAArtificial SequenceSynthetic 159tgttttgacc tcca
1416030DNAArtificial SequenceSynthetic 160acacagtgtc ctcccgctcc
tcctgagcaa 3016118DNAArtificial SequenceSynthetic 161tttccctcct
cctcttcc 1816254DNAArtificial SequenceSynthetic 162atgaggaaga
ggaggagggt gctcaggagg agcgggagga cactgtgtct gtca
5416353DNAArtificial SequenceSynthetic 163ttcgctttct tcccttcctt
tctcgccacg ttcgccggct ttccccgtca agc 531641011DNAArtificial
SequenceSynthetic 164atgggtgcgg atattggtga cctctttgag agggaagagg
tcgagcttga gtacttctca 60ggaaagaaaa ttgccgttga tgctttcaac acgctatacc
agttcatctc gataataagg 120cagcctgacg gtacgccgtt aaaggactca
cagggcagaa tcacctctca cctttccgga 180atcctataca gagtctccaa
catggtcgag gtgggaatca ggccggtgtt tgtattcgac 240ggagagccac
cggagttcaa gaaggctgaa attgaggaga ggaaaaagag aagggctgag
300gcagaggaga tgtggattgc ggctttgcag gcaggagata aggacgcgaa
aaagtatgct 360caggctgcag ggagggttga cgagtacatt gttgactccg
caaagacgct tttaagttac 420atggggattc cctttgtcga tgccccgtct
gaaggagagg cgcaggctgc ttacatggca 480gcaaaaggcg atgtggagta
cacaggaagc caggattacg attctctgct cttcggaagc 540ccgagactcg
ccagaaatct cgcaataacg ggaaaaagga agcttcccgg caaaaatgtc
600tatgtggatg taaagccgga gataataatt ctggaaagca acctcaaaag
gctgggtttg 660acgagggagc agctcatcga catagcgatt ctggtcggga
cggactacaa tgagggtgtg 720aagggtgtcg gcgtcaagaa ggctttgaac
tacatcaaga cctacggaga tattttcagg 780gcactcaagg ctctgaaagt
aaatattgac cacgtagagg agataaggaa tttcttcctg 840aatcctcctg
tgactgacga ctacagaata gagttcaggg agcctgactt tgagaaggcc
900atcgagttcc tgtgcgagga gcacgacttc agcagggaga gggtcgagaa
ggccttggag 960aagctcaaag ctctgaagtc aacccaggcc acgcttgaga
ggtggttctg a 1011165336PRTArtificial SequenceSynthetic 165Met Gly
Ala Asp Ile Gly Asp Leu Phe Glu Arg Glu Glu Val Glu Leu1 5 10 15Glu
Tyr Phe Ser Gly Lys Lys Ile Ala Val Asp Ala Phe Asn Thr Leu20 25
30Tyr Gln Phe Ile Ser Ile Ile Arg Gln Pro Asp Gly Thr Pro Leu Lys35
40 45Asp Ser Gln Gly Arg Ile Thr Ser His Leu Ser Gly Ile Leu Tyr
Arg50 55 60Val Ser Asn Met Val Glu Val Gly Ile Arg Pro Val Phe Val
Phe Asp65 70 75 80Gly Glu Pro Pro Glu Phe Lys Lys Ala Glu Ile Glu
Glu Arg Lys Lys85 90 95Arg Arg Ala Glu Ala Glu Glu Met Trp Ile Ala
Ala Leu Gln Ala Gly100 105 110Asp Lys Asp Ala Lys Lys Tyr Ala Gln
Ala Ala Gly Arg Val Asp Glu115 120 125Tyr Ile Val Asp Ser Ala Lys
Thr Leu Leu Ser Tyr Met Gly Ile Pro130 135 140Phe Val Asp Ala Pro
Ser Glu Gly Glu Ala Gln Ala Ala Tyr Met Ala145 150 155 160Ala Lys
Gly Asp Val Glu Tyr Thr Gly
Ser Gln Asp Tyr Asp Ser Leu165 170 175Leu Phe Gly Ser Pro Arg Leu
Ala Arg Asn Leu Ala Ile Thr Gly Lys180 185 190Arg Lys Leu Pro Gly
Lys Asn Val Tyr Val Asp Val Lys Pro Glu Ile195 200 205Ile Ile Leu
Glu Ser Asn Leu Lys Arg Leu Gly Leu Thr Arg Glu Gln210 215 220Leu
Ile Asp Ile Ala Ile Leu Val Gly Thr Asp Tyr Asn Glu Gly Val225 230
235 240Lys Gly Val Gly Val Lys Lys Ala Leu Asn Tyr Ile Lys Thr Tyr
Gly245 250 255Asp Ile Phe Arg Ala Leu Lys Ala Leu Lys Val Asn Ile
Asp His Val260 265 270Glu Glu Ile Arg Asn Phe Phe Leu Asn Pro Pro
Val Thr Asp Asp Tyr275 280 285Arg Ile Glu Phe Arg Glu Pro Asp Phe
Glu Lys Ala Ile Glu Phe Leu290 295 300Cys Glu Glu His Asp Phe Ser
Arg Glu Arg Val Glu Lys Ala Leu Glu305 310 315 320Lys Leu Lys Ala
Leu Lys Ser Thr Gln Ala Thr Leu Glu Arg Trp Phe325 330
33516626DNAArtificial SequenceSynthetic 166ccgtcaacat ttaccatggg
tgcgga 2616731DNAArtificial SequenceSynthetic 167ccgccacctc
gtagtcgaca tccttttcgt g 3116820DNAArtificial SequenceSynthetic
168ggcgaccaca cccgtcctgt 2016920DNAArtificial SequenceSynthetic
169ccacgatgcg tccggcgtag 2017029DNAArtificial SequenceSynthetic
170aacgaggcgc acccacccaa ggcacagcn 2917126DNAArtificial
SequenceSynthetic 171acgggtcaat gtccatgccc caaaga
2617228DNAArtificial SequenceSynthetic 172gtctgagatg aaagtgcgcc
tcgttaan 2817326DNAArtificial SequenceSynthetic 173tcttcgcaca
tttcatctca gacgga 2617422DNAArtificial SequenceSynthetic
174gctgtgcctt gggtgggtgc gn 2217529DNAArtificial SequenceSynthetic
175aacgaggcgc acccacccaa ggcacagcn 2917626DNAArtificial
SequenceSynthetic 176acgggtcaat gtccatgccc caaaga
2617728DNAArtificial SequenceSynthetic 177gtctgagatg aaagtgcgcc
tcgttaan 2817823DNAArtificial SequenceSynthetic 178tcttcgcaca
tttcatctca gac 2317918DNAArtificial SequenceSynthetic 179gctgtgcctt
gggtgggn 1818020DNAArtificial SequenceSynthetic 180gctgtgcctt
gggtgggtgn 2018122DNAArtificial SequenceSynthetic 181gctgtgcctt
gggtgggtgc gn 2218223DNAArtificial SequenceSynthetic 182gctgtgcctt
gggtgggtgc gcn 2318342DNAArtificial SequenceSynthetic 183gtctgagatg
aaagtgctcc cgcacccacc caaggcacag cn 4218418DNAArtificial
SequenceSynthetic 184gctgtgcctt gggtgggn 1818529DNAArtificial
SequenceSynthetic 185aacgaggcgc acccacccaa ggcacagcn
2918621DNAArtificial SequenceSynthetic 186gctgtgcctt gggtgggtgc g
2118721DNAArtificial SequenceSynthetic 187gctgtgcctt gggtgggtgc n
2118821DNAArtificial SequenceSynthetic 188gctgtgcctt gggtgggtgc n
2118921DNAArtificial SequenceSynthetic 189gctgtgcctt gggtgggtgc n
2119026DNAArtificial SequenceSynthetic 190tcttcgcaca tttcatctca
gacgga 2619154DNAArtificial SequenceSynthetic 191ctgggcgcgg
acatggagga cgtgcgcggc cgcctggtgc agtaccgcgg cgag
5419254DNAArtificial SequenceSynthetic 192ctgggcgcgg acatggagga
cgtgtgcggc cgcctggtgc agtaccgcgg cgag 5419356DNAArtificial
SequenceSynthetic 193cgcgatgccg atgacctgca gaagcgcctg gcagtgtacc
aggccggggc ccgcga 5619456DNAArtificial SequenceSynthetic
194cgcgatgccg atgacctgca gaagtgcctg gcagtgtacc aggccggggc ccgcga
5619523DNAArtificial Sequencecggtactgcaccaggcggccgct 195cggtactgca
ccaggcggcc gct 2319625DNAArtificial SequenceSynthetic 196ccccggcctg
gtacactgcc aggct 2519727DNAArtificial SequenceSynthetic
197aacgaggcgc acgcacgtcc tccatgt 2719827DNAArtificial
SequenceSynthetic 198gaacgaggcg cacacacgtc ctcctgt
2719928DNAArtificial SequenceSynthetic 199aacgaggcgc acgcttctgc
aggtcatc 2820027DNAArtificial SequenceSynthetic 200aacgaggcgc
acacttctgc ggtcatc 2720139DNAArtificial SequenceSynthetic
201cctcgtctcg gttttccgag acgagggtgc gcctcgttc 3920228DNAArtificial
SequenceSynthetic 202cccctgggga agagcagaga tatacgtc
2820324DNAArtificial SequenceSynthetic 203gggctccaca cggcgactct
catt 2420439DNAArtificial SequenceSynthetic 204ggtgctccac
ctggcacgta tatctctgct cttccccag 3920539DNAArtificial
SequenceSynthetic 205ggtgctccac ctggtacgta tatctctgct cttccccag
3920646DNAArtificial SequenceSynthetic 206agctgttcgt gttctatgat
catgagagtc gccgtgtgga gccccg 4620746DNAArtificial SequenceSynthetic
207agctgttcgt gttctatgat gatgagagtc gccgtgtgga gccccg
4620829DNAArtificial SequenceSynthetic 208aacgaacgcg caggccaggt
ggagcattt 2920927DNAArtificial SequenceSynthetic 209aacgaacgcg
cagaccaggt ggagcac 2721040DNAArtificial SequenceSynthetic
210ctccgtctcg gttttccgag acggagctgc gcgttcguuu 4021135DNAArtificial
SequenceSynthetic 211aagcacgcag cacgatcata gaacacgaac agttt
3521235DNAArtificial SequenceSynthetic 212aagcacgcag caccatcata
gaacacgaac agttt 3521340DNAArtificial SequenceSynthetic
213acgcgtctcg gttttccgag acgcgtgtgc tgcgtgcuuu 4021450DNAArtificial
SequenceSynthetic 214gaaggtgtct gcgggagccg atttcatcat cacgcagctt
ttctttgagg 5021550DNAArtificial SequenceSynthetic 215gaaggtgtct
gcgggagtcg atttcatcat cacgcagctt ttctttgagg 5021630DNAArtificial
SequenceSynthetic 216caaagaaaag ctgcgtgatg atgaaatcgc
3021726DNAArtificial SequenceSynthetic 217aacgaggcgc acgctcccgc
agacac 2621827DNAArtificial SequenceSynthetic 218aacgaggcgc
acactcccgc agacacc 2721939DNAArtificial SequenceSynthetic
219cctcgtctcg gttttccgag acgagggtgc gcctcgttt 3922051DNAArtificial
SequenceSynthetic 220actgggagca ttgaggctcg ctgagagtca cttttattgg
gaaccatagt t 5122151DNAArtificial SequenceSynthetic 221actgggagca
ttgaggcttg ctgagagtca cttttattgg gaaccatagt t 5122230DNAArtificial
SequenceSynthetic 222tatggttccc aataaaagtg actctcagct
3022328DNAArtificial SequenceSynthetic 223aacgaggcgc acgagcctca
atgctccc 2822428DNAArtificial SequenceSynthetic 224aacgaggcgc
acaagcctca atgctccc 2822539DNAArtificial SequenceSynthetic
225cctcgtctcg gttttccgag acgagggtgc gcctcgttt 3922652DNAArtificial
SequenceSynthetic 226tgaagtctag agaaagggtt gtacggctga ggtctggaga
aatgggcatc tg 5222746DNAArtificial SequenceSynthetic 227tttgaaatgt
cacagggttc ctaacagcca ctcttccctg gatggg 4622828DNAArtificial
SequenceSynthetic 228agatgcccat ttctccagac ctcagccc
2822936DNAArtificial SequenceSynthetic 229aagcacgcag cacgtacaac
cctttctcta gacaaa 3623040DNAArtificial SequenceSynthetic
230ctccgtctcg gttttccgag acggaggtgc tgcgtgcuuu 4023125DNAArtificial
SequenceSynthetic 231ccatccaggg aagagtggcc tgttt
2523229DNAArtificial SequenceSynthetic 232aagcacgcag cacaggaacc
ctgtgacat 2923346DNAArtificial SequenceSynthetic 233taggttttga
ggggcatggg gacggggttc agcctccagg gtccta 4623446DNAArtificial
SequenceSynthetic 234taggttttga ggggcatgag gacggggttc agcctccagg
gtccta 4623525DNAArtificial SequenceSynthetic 235gaccctggag
gctgaacccc gtcca 2523628DNAArtificial SequenceSynthetic
236aacgaggcgc acccatcggg gtcaaaac 2823728DNAArtificial
SequenceSynthetic 237aacgaggcgc actcatgccc ctcaaaac
2823856DNAArtificial SequenceSynthetic 238aaggacaaaa tacctgtatt
cctcgcctgt ccagggatct gctcttacag attaga 5623956DNAArtificial
SequenceSynthetic 239aaggacaaaa tacctgtatt ccttgcctgt ccagggatct
gctcttacag attaga 5624030DNAArtificial SequenceSynthetic
240taatctgtaa gagcagatcc ctggacagcc 3024133DNAArtificial
SequenceSynthetic 241aacgaggcgc acgaggaata caggtatttt gtc
3324233DNAArtificial SequenceSynthetic 242aacgaggcgc acaaggaata
caggtatttt gtc 3324324DNAArtificial SequenceSynthetic 243ggtaaaggtt
ggcaaaaaga taac 2424427DNAArtificial SequenceSynthetic
244gcgccgaggt cttggggtgg ttacaag 2724537DNAArtificial
SequenceSynthetic 245tctcgtctcg gttttccgag actgagacct cggcgcg
3724629DNAArtificial SequenceSynthetic 246cacttgcttc aggaccatat
ttctctctc 2924733DNAArtificial SequenceSynthetic 247cgcgccgagg
acaccttttt tagggtgctt tgt 3324822DNAArtificial SequenceSynthetic
248aaaatcgatg gtaaaggttg gc 2224922DNAArtificial SequenceSynthetic
249agttctgcag taccggattt gc 2225020DNAArtificial SequenceSynthetic
250tcgctactag ttgcttagtg 2025120DNAArtificial SequenceSynthetic
251gtaaacataa gcaactttag 2025241DNAArtificial SequenceSynthetic
252cttgtaacca ccccaagatt atctttttgc caacctttac c
4125351DNAArtificial SequenceSynthetic 253acaaagcacc ctaaaaaagg
tgtagagaga aatatggtcc tgaagcaagt g 5125446RNAArtificial
SequenceSynthetic 254gaauacucaa gcuugcaugc cugcaggucg acucuagagg
aucccc 46255141DNAArtificial SequenceSynthetic 255ttgacaatta
atcatcggct cgtataatgt gtggaattgt gagcggataa caatttcaca 60caggaaacag
cgatgaattc gagctcggta cccggggatc ctctagagtc gacctgcagg
120catgcaagct tggcactggc c 141256144DNAArtificial SequenceSynthetic
256agatctcgat cccgcgaaat taatacgact cactataggg agaccacaac
ggtttccctc 60tagaaataat tttgtttaac tttaagaagg agatatacat atggctagca
tgactggtgg 120acagcaaatg ggtcggatcc ggct 14425771DNAArtificial
SequenceSynthetic 257taatacgact cactataggg agaccggaat tcgaattccg
tgtattctat agtgtcacct 60aaatcgaatt c 7125827DNAArtificial
SequenceSynthetic 258nagaaaggaa gggaagaaag cgaaagg
2725913DNAArtificial SequenceSynthetic 259aacgaggcgc acg
1326013DNAArtificial SequenceSynthetic 260aacgaggcgc aca
1326114DNAArtificial SequenceSynthetic 261aacgaacgcg cagg
1426214DNAArtificial SequenceSynthetic 262aacgaacgcg caga
1426314DNAArtificial SequenceSynthetic 263aagcacgcag cacg
1426414DNAArtificial SequenceSynthetic 264aagcacgcag cacc
1426514DNAArtificial SequenceSynthetic 265aagcacgcag caca
1426613DNAArtificial SequenceSynthetic 266aacgaggcgc acc
1326713DNAArtificial SequenceSynthetic 267aacgaggcgc act
1326810DNAArtificial SequenceSynthetic 268gcgccgaggt
1026911DNAArtificial SequenceSynthetic 269cgcgccgagg a 11
* * * * *