U.S. patent application number 11/516024 was filed with the patent office on 2008-09-11 for nogo receptor-mediated blockade of axonal growth.
This patent application is currently assigned to Yale University. Invention is credited to Stephen M. Strittmatter.
Application Number | 20080219984 11/516024 |
Document ID | / |
Family ID | 25519870 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080219984 |
Kind Code |
A1 |
Strittmatter; Stephen M. |
September 11, 2008 |
Nogo receptor-mediated blockade of axonal growth
Abstract
Disclosed are NgR proteins and biologically active Nogo (ligand)
protein fragments. Also disclosed are compositions and methods for
modulating the expression or activity of the Nogo and NgR protein.
Also disclosed are peptides which block Nogo-mediated inhibition of
axonal extension. The compositions and methods of the invention are
useful in the treatment of cranial or cerebral trauma, spinal cord
injury, stroke or a demyelinating disease.
Inventors: |
Strittmatter; Stephen M.;
(Guilford, CT) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX, P.L.L.C.
1100 NEW YORK AVE., N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Yale University
|
Family ID: |
25519870 |
Appl. No.: |
11/516024 |
Filed: |
September 6, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09972599 |
Oct 6, 2001 |
7119165 |
|
|
11516024 |
|
|
|
|
09758140 |
Jan 12, 2001 |
|
|
|
09972599 |
|
|
|
|
PCT/US01/01041 |
Jan 12, 2001 |
|
|
|
09972599 |
|
|
|
|
60175707 |
Jan 12, 2000 |
|
|
|
60207366 |
May 26, 2000 |
|
|
|
60236378 |
Sep 29, 2000 |
|
|
|
Current U.S.
Class: |
424/139.1 ;
435/368; 435/69.1; 435/7.21; 514/1.1; 530/387.1; 530/387.3;
530/388.1; 536/23.1 |
Current CPC
Class: |
C07K 2319/00 20130101;
G01N 33/50 20130101; A61K 38/00 20130101; C07K 2317/76 20130101;
A61P 25/02 20180101; C07K 14/47 20130101; A61P 25/28 20180101; A61P
37/00 20180101; A61P 9/00 20180101; A61P 25/06 20180101; C07K 16/28
20130101; C07K 14/705 20130101; A61P 25/00 20180101; A61P 25/14
20180101; A61P 43/00 20180101; A01K 2217/05 20130101; C07K 16/18
20130101; C07K 14/70571 20130101; A61P 29/00 20180101; C07K 16/286
20130101; A61P 25/04 20180101; A61K 2039/505 20130101 |
Class at
Publication: |
424/139.1 ;
536/23.1; 435/368; 435/69.1; 530/387.1; 530/388.1; 530/387.3;
514/12; 435/7.21 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07H 21/04 20060101 C07H021/04; C12N 15/64 20060101
C12N015/64; C12N 5/08 20060101 C12N005/08; G01N 33/53 20060101
G01N033/53; C12P 21/00 20060101 C12P021/00; C07K 16/18 20060101
C07K016/18; A61K 38/16 20060101 A61K038/16 |
Goverment Interests
U.S. GOVERNMENT SUPPORT
[0002] This invention was partially made with government support
under National Institute of Health Grant RO1-NS 33020, RO1-NS39962
and RO1-NS42304.
Claims
1-43. (canceled)
44. An isolated polynucleotide comprising a first nucleic acid
encoding a fragment of the polypeptide of SEQ ID NO:2, or a variant
thereof, wherein said polypeptide inhibits NOGO-receptor-mediated
neurite outgrowth inhibition.
45. The polynucleotide of claim 44, wherein said polypeptide is
selected from the group consisting of (a) amino acids 27 to 309 of
SEQ ID NO:2, (b) amino acids 27-445 of SEQ ID NO:2, (c) amino acids
1 to 348 of SEQ ID NO:2, and (d) amino acids 1-309 of SEQ ID
NO:2.
46. The polynucleotide of claim 45, further comprising a second
nucleic acid encoding a heterologous polypeptide fused to said
polypeptide.
47. A vector comprising the polynucleotide of claim 44.
48. The vector of claim 47, wherein said polynucleotide is operably
linked to one or more expression control elements.
49. An isolated host cell comprising the polynucleotide of claim
44.
50. The host cell of claim 49, wherein said polynucleotide is
operably linked to one or more expression control elements.
51. A method for producing a polypeptide comprising culturing the
host cell of claim 49 under conditions suitable for expression of
the polypeptide and recovering the polypeptide from the culture
medium.
52. An isolated antibody which specifically binds to a polypeptide
encoded by the polynucleotide of claim 45 or antigen-binding
fragment of said antibody wherein said antibody or antibody
fragment inhibits NOGO-receptor-mediated neurite outgrowth
inhibition.
53. The antibody of claim 52, wherein said antibody or antigen
binding fragment thereof is selected from the group consisting of a
polyclonal antibody, a monoclonal antibody, a human antibody, a
humanized antibody, a chimeric antibody, an Fab fragment, an Fab'
fragment and an F(ab')2 fragment.
54. A method of producing the antibody of claim 52 comprising (a)
immunizing a mammalian subject with a NgR polypeptide; and (b)
recovering said antibody.
55. A method of inhibiting CNS myelin-mediated neurite outgrowth
inhibition or promoting axonal regeneration comprising contacting a
neuron with a Nogo receptor (NgR) antagonist selected from the
group consisting of: (a) an isolated NgR polypeptide; and (b) an
antibody or antigen binding fragment thereof that binds a NgR
polypeptide; wherein said NgR antagonist inhibits CNS
myelin-induced neurite outgrowth inhibition or promotes axonal
regeneration.
56. The method of claim 55, wherein said neuron is a mammalian
cell.
57. The method of claim 56, wherein said mammalian cell is a human
cell.
58. A method of promoting neurite outgrowth or axonal regeneration
in a mammal comprising administering to a mammal in need thereof an
effective amount of a Nogo receptor (NgR) antagonist, wherein said
NgR antagonist is selected from the group consisting of: (a) an
isolated NgR polypeptide; and (b) an antibody or antigen binding
fragment thereof that binds a NgR polypeptide; wherein said NgR
antagonist inhibits CNS myelin-induced neurite outgrowth inhibition
or promotes axonal regeneration.
59. A method of treating a central nervous system disease, disorder
or injury in a mammal, comprising administering to a mammal in need
thereof an effective amount of a NgR antagonist selected from the
group consisting of: (a) an isolated NgR polypeptide; and (b) an
antibody or antigen binding fragment thereof that binds a NgR
polypeptide; wherein said NgR antagonist inhibits CNS
myelin-induced neurite outgrowth inhibition or promotes axonal
regeneration.
60. The method of claim 59, wherein said central nervous system
disease, disorder or injury is selected from the group consisting
of cranial or cerebral trauma, spinal cord injury, stroke, multiple
sclerosis, monophasic demyelination, encephalomyelitis, multifocal
leukoencephalopathy, panencephalitis, Marchiafava-Bignami disease,
pontine myelinolysis, adrenoleukodystrophy, Pelizaeus-Merzbacher
disease, Spongy degeneration, Alexander's disease, Canavan's
disease, metachromatic leukodystrophy, and Krabbe's disease.
61. A method for identifying a molecule that decreases
Nogo-dependent inhibition of axonal growth, the method comprising:
(a) providing a Nogo polypeptide and a NgR polypeptide; (b)
contacting the NgR polypeptide with a candidate molecule; and (c)
detecting a decrease in binding of the Nogo polypeptide to the NgR
in the presence of the candidate molecule, as compared to the
binding of the Nogo polypeptide to the NgR in the absence of the
candidate molecule, and wherein said Nogo-dependent inhibition of
axonal growth is decreased in the presence of said candidate
molecule.
62. A method of identifying an agent which modulates Nogo receptor
protein expression comprising the steps of: (a) providing a cell
expressing a Nogo receptor protein; (b) contacting the cell with a
candidate agent; and (c) detecting an increase or decrease in the
level of Nogo receptor protein expression in the presence of the
candidate agent relative to the level of Nogo receptor protein
expression in the absence of the candidate agent.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 09/972,599, filed Oct. 6, 2001, which is a continuation-in-part
of U.S. application Ser. No. 09/758,140, filed Jan. 12, 2001, which
claims benefit under 35 U.S.C. .sctn. 119(e) to U.S. Provisional
Application No. 60/175,707 filed Jan. 12, 2000; U.S. Provisional
Application No. 60/207,366 filed May 26, 2000; and U.S. Provisional
Application No. 60/236,378 filed Sep. 29, 2000 which are herein
incorporated by reference in their entireties. U.S. application
Ser. No. 09/972,599 is also a continuation-in-part of international
application PCT/US01/01041, filed Jan. 12, 2001.
FIELD OF THE INVENTION
[0003] The invention relates to neurology and molecular biology.
More particularly, the invention relates to CNS neurons and axonal
growth
BACKGROUND OF THE INVENTION
[0004] Axons and dendrites of neurons are long cellular extensions
from neurons. At the distal tip of an extending axon or neurite is
a specialized region, known as the growth cone. Growth cones are
responsible for sensing the local environment and moving toward the
neuron's target cell. Growth cones are hand shaped, with several
long filopodia that differentially adhere to surfaces in the
embryo. Growth cones can be sensitive to several guidance cues, for
example, surface adhesiveness, growth factors, neurotransmitters
and electric fields. The guidance of growth at the cone depends on
various classes of adhesion molecules, intercellular signals, as
well as factors which stimulate and inhibit growth cones. The
growth cone located at the end of a growing neurite advances at
various rates, but typically at the speed of one to two millimeters
per day. The cone consists of a broad and flat expansion, with
numerous long microspikes or filopodia that extend like spikes.
These filopodia are continually active. While some filopodia
retract back into the growth cone, others continue to elongate
through the substratum. The elongations between different filopodia
form lamellipodia.
[0005] The growth cone can explore the area that is ahead of it and
on either side with its lamellipodia and filopodia. When an
elongation comes in contact with a surface that is unfavorable, it
withdraws. When an elongation comes into contact with a favorable
surface, it continues to extend and can manipulate the growth cone
moving in that direction. Hence, the growth cone can be guided by
small variations in surface properties of the substrata. When the
growth cone reaches an appropriate target cell a synaptic
connection is created.
[0006] Damaged neurons do not regenerate in the central nervous
system (CNS) following injury due to trauma and disease. The
absence of axon regeneration following injury can be attributed to
the presence of axon growth inhibitors. These inhibitors are
predominantly associated with myelin and constitute an important
barrier to regeneration. Axon growth inhibitors are present in
CNS-derived myelin and the plasma membrane of oligodendrocytes,
which synthesize myelin in the CNS (Schwab et al., (1993) Ann. Rev.
Neurosci. 16, 565-595).
[0007] CNS myelin is an elaborate extension of the oligodendrocyte
cell membrane. A single oligodendrocyte myelinates as many as
thirty different CNS axonal segments. Oligodendrocyte membrane
extensions wrap around the axons in a concentric fashion to form
the myelin sheath. Tightly compacted mature myelin consists of
parallel layers of bimolecular lipids opposed to layers of hydrated
protein. Active myelin synthesis starts in utero and continues for
the first two years of human life. Slower synthesis continues
through childhood and adolescence while turnover of mature myelin
continues at a slower rate throughout adult life. Both developing
and mature forms of myelin are susceptible to injury from disease
or physical trauma resulting in degradation of the myelin
surrounding axons.
[0008] Myelin-associated inhibitors appear to be a primary
contributor to the failure of CNS axon regeneration in vivo after
an interruption of axonal continuity, while other non-myelin
associated axon growth inhibitors in the CNS may play a lesser
role. These inhibitors block axonal regeneration following neuronal
injury due to trauma, stroke, or viral infection.
[0009] Numerous myelin-derived axon growth inhibitors have been
characterized (see, for review, David et al., (1999) WO9953945;
Bandman et al., (1999) U.S. Pat. No. 5,858,708; Schwab, (1996)
Neurochem. Res. 21, 755-761). Several components of CNS white
matter, NI35, NI250 (Nogo) and Myelin-associated glycoprotein
(MAG), which have inhibitory activity for axonal extension, have
been also been described (Schwab et al., (1990) WO9005191; Schwab
et al., (1997) U.S. Pat. No. 5,684,133). In particular, Nogo is a
250 kDa myelin-associated axon growth inhibitor which has been
cloned and characterized (Nagase et al., (1998) DNA Res. 5,
355-364; Schwab, (1990) Exp. Neurol. 109, 2-5). The Nogo cDNA was
first identified through random analysis of brain cDNA and had no
suggested function (Nagase et al., (1998) DNA Res. 5, 355-364).
[0010] Schwab and colleagues published the sequence of six peptides
randomly derived from a proteolytic digest of presumed bovine NI250
(Nogo) protein (Spillmann et al., (1998) J. Biol. Chem. 273,
19283-19293). A probable full-length cDNA sequence for this protein
was recently deposited in the GenBank. This 4.1 kilobase human cDNA
clone, KIAA0886, is derived from the Kazusa DNA Research Institute
effort to sequence random high molecular weight brain-derived cDNA
(Nagase et al., (1998) DNA Res. 31, 355-364). This novel cDNA clone
encodes a 135 kDa protein that includes all six of the peptide
sequences derived from bovine Nogo.
[0011] The human Nogo-A sequence shares high homology over its
carboxyl third with the Reticulon (Rtn) protein family. Rtn1 has
also been termed neuro-endocrine specific protein (NSP) because it
is expressed exclusively in neuro-endocrine cells (Van de Velde et
al., (1994) J. Cell. Sci. 107, 2403-2416). All Rtn proteins share a
200 amino acid residue region of sequence similarity at the
carboxyl terminus of the protein (Van de Velde et al., (1994) J.
Cell. Sci. 107, 2403-2416; Roebroek et al., (1996) Genomics 32,
191-199; Roebroek et al., (1998) Genomics 51, 98-106; Moreira et
al., (1999) Genomics 58, 73-81; Morris et al., (1991) Biochim.
Biophys. Acta 1450, 68-76). Related sequences have been recognized
in the fly and worm genomes (Moreira et al., (1999) Genomics 58,
73-81). This region is approximately 70% identical across the Rtn
family. Amino terminal regions are not related to one another and
are derived from various alternative RNA splicing events.
[0012] From analysis of sequences deposited in the GenBank and by
homology with published Rtn1 isoforms, three forms of the Nogo
protein are predicted (Nogo-A, Nogo-B, Nogo-C). Nogo-B of 37 kDa
might possibly correspond to NI35, and explain the antigenic
relatedness of the NI35 and NI250 (Nogo-A) axon outgrowth
inhibiting activity. Nogo-C-Myc exhibits an electrophoretic
mobility of 25. kDa by SDS-PAGE and has been described previously
as Rtn4 and vp2015. The ability of Nogo-A. protein to inhibit
axonal regeneration has been recognized only recently (GrandPre et
al., (2000) Nature 403, 439-444; Chen et al., (2000) Nature 403,
434-439; Prinjha et al., (2000) Nature 403, 483-484).
[0013] The absence of re-extension of axons across lesions in the
CNS following injury has been attributed as a cause of the
permanent deleterious effects associated with trauma, stroke and
demyelinating disorders. Modulation of N1250 has been described as
a means for treatment of regeneration for neurons damaged by
trauma, infarction and degenerative disorders of the CNS (Schwab et
al., (1994) WO9417831; Tatagiba et al., (1997) Neurosurgery 40,
541-546) as well as malignant tumors in the CNS such as
glioblastoma (Schwab et al., (1993) U.S. Pat. No. 5,250,414; Schwab
et al., (2000) U.S. Pat. No. 6,025,333).
[0014] Antibodies which recognize N1250 have been reported to be
useful in the diagnosis and treatment of nerve damage resulting
from trauma, infarction and degenerative disorders of the CNS
(Schnell & Schwab, (1990) Nature 343, 269-272; Schwab et al.,
(1997) U.S. Pat. No. 5,684,133). In axons which become myelinated,
there is a correlation with the development of myelin and the
appearance of Nogo. After Nogo is blocked by antibodies, neurons
can again extend across lesions caused by nerve damage (Varga et
al., (1995) Proc. Natl. Acad. Sci. USA 92, 10959-10963).
[0015] The mechanism of action whereby Nogo inhibits axonal growth
has not yet been elucidated. Identification and characterization of
this mechanism of action and the biochemical pathways associated
with the effects of Nogo would be useful in treatment of disease
states associated with axonal injury and axonal demyelination.
SUMMARY OF THE INVENTION
[0016] The present invention is based on the discovery of Nogo
receptor proteins and biologically active Nogo protein (ligand)
fragments. The invention provides an isolated nucleic acid molecule
selected from the group consisting of an isolated nucleic acid
molecule that encodes the amino acid sequence of SEQ ID NO: 2, 4,
8, 10, 12, 14, 16, 18 or 20; an isolated nucleic acid molecule that
encodes a fragment of at least six, e.g., ten, fifteen, twenty,
twenty-five, thirty, forty, fifty, sixty or seventy amino acids of
SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 or 20; an isolated nucleic
acid molecule which hybridizes to a nucleic acid molecule
comprising the complement of SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17
or 19 under high stringency conditions; and an isolated nucleic
acid molecule with at least seventy-five, e.g., eighty,
eighty-five, ninety or ninety-five percent amino acid sequence
identity to SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17 or 19. In a
preferred embodiment, the invention includes an isolated nucleic
acid molecule comprising nucleotides 166 to 1584 of SEQ ID NO: 1 or
nucleotides 178 to 1596 of SEQ ID NO: 3.
[0017] The present invention further includes the nucleic acid
molecules operably linked to one or more expression control
elements, including vectors comprising the isolated nucleic acid
molecules. The invention further includes host cells transformed to
contain the nucleic acid molecules of the invention and methods for
producing a protein comprising the step of culturing a host cell
transformed with a nucleic acid molecule of the invention under
conditions in which the protein is expressed.
[0018] The present invention includes an isolated polypeptide
selected from the group consisting of an isolated polypeptide
comprising the amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12,
14, 16, 18 or 20; an isolated polypeptide comprising a fragment of
at least six, e.g., ten, fifteen, twenty, twenty-five, thirty,
forty, fifty, sixty or seventy amino acids of SEQ ID NO: 2, 4, 8,
10, 12, 14, 16, 18 or 20; an isolated polypeptide comprising the
amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 or 20
comprising at least one, e.g., five, ten, fifteen or twenty
conservative amino acid substitutions; an isolated polypeptide
comprising the amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12,
14, 16, 18 or 20 comprising one, e.g., five, ten, fifteen or twenty
naturally occurring amino acid sequence substitutions; and an
isolated polypeptide with at least seventy-five, e.g., eighty,
eighty-five, ninety or ninety-five percent amino acid sequence
identity to SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 or 20. The
invention also includes chimeric polypeptides comprising the amino
acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 or 20.
[0019] The invention further provides antibodies that bind to a
Nogo protein and antibodies which bind to a Nogo receptor protein.
The antibodies can be monoclonal or polyclonal antibodies. In
addition, the antibody may be humanized. The invention also
includes antibody fragments which display antigen binding
activity.
[0020] The invention includes a method of identifying an agent
which modulates Nogo protein or Nogo receptor protein expression
comprising the steps of providing a cell expressing a Nogo protein
or Nogo receptor protein; contacting the cell with a candidate
agent; and detecting an increase or decrease in the level of Nogo
protein or Nogo receptor protein expression in the presence of the
candidate agent relative to the level of Nogo protein or Nogo
receptor protein expression in the absence of the candidate
agent.
[0021] The invention also includes a method of identifying an agent
which modulates at least one activity of a Nogo protein or Nogo
receptor protein comprising the steps of providing a cell
expressing a Nogo protein or Nogo receptor protein; contacting the
cell with a candidate agent; and detecting an increase or decrease
in the level of Nogo protein or Nogo receptor protein activity in
the presence of the candidate agent relative to the level of Nogo
protein or Nogo receptor protein activity in the absence of the
candidate agent. In one embodiment of the invention, the activity
is growth cone movement. In another embodiment, the agent is
selected from the group consisting of a Nogo protein fragment,
anti-Nogo antibody and anti-Nogo receptor antibody.
[0022] The invention further includes a method of identifying a
binding partner for a Nogo receptor protein comprising the steps of
providing a Nogo receptor protein; contacting the Nogo receptor
with a candidate binding partner; and detecting binding of the
candidate binding partner to the Nogo receptor protein. In one
embodiment, the binding partner is selected from the group
consisting of a Nogo protein fragment, an anti-Nogo antibody, an
anti-Nogo receptor antibody fragment; and a humanized anti-Nogo
receptor antibody.
[0023] The invention encompasses a method of treating a central
nervous system disorder in a mammal comprising the step of
administering an effective amount of an agent which modulates the
expression of a Nogo protein or Nogo receptor protein. In some
embodiments of the invention the expression is decreased, while in
other embodiments, it is increased.
[0024] The invention further encompasses a method of treating a
central nervous system disorder in a mammal comprising the step of
administering an effective amount of an agent which modulates the
activity of a Nogo protein or Nogo receptor protein. The activity
may be either increased or decreased. If the activity is decreased,
the agent can be e.g., a polypeptide comprising the amino acid
sequence of SEQ ID NO: 8, 10, 12, 18 or 20; a full length Nogo
receptor protein; a Nogo receptor protein fragment; a soluble Nogo
receptor protein fragment; or an anti-Nogo receptor antibody or
active fragment thereof. If the activity is increased the agent is
a polypeptide selected from the group consisting of SEQ ID NO: 14
and 16.
[0025] A soluble Nogo receptor protein can comprise a fragment of
at least six, e.g., ten, fifteen, twenty, twenty-five, thirty,
forty, fifty, sixty or seventy amino acids of SEQ ID NO: 2 or 4;
the amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18
or 20; the amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14,
16, 18 or 20 comprising at least one, e.g., five, ten, fifteen or
twenty conservative amino acid substitutions; the amino acid
sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 or 20 comprising
one, e.g., five, ten, fifteen or twenty naturally occurring amino
acid sequence substitutions.
[0026] In some embodiments, the central nervous system disorder is
a result of cranial or cerebral trauma, spinal cord injury, stroke
or a demyelinating disease. Examples of demyelinating diseases are
multiple sclerosis, monophasic demyelination, encephalomyelitis,
multifocal leukoencephalopathy, panencephalitis,
Marchiafava-Bignami disease, pontine myelinolysis,
adrenoleukodystrophy, Pelizaeus-Merzbacher disease, Spongy
degeneration, Alexander's disease, Canavan's disease, metachromatic
leukodystrophy and Krabbe's disease.
[0027] The invention further encompasses an isolated peptide that
specifically binds to a Nogo receptor protein. The specific binding
of the peptide to the Nogo receptor protein preferably has at least
one of the following effects: inhibition of binding of a Nogo
protein to the Nogo receptor protein, blockade of Nogo-mediated
inhibition of axonal growth, modulation of Nogo protein expression,
or modulation of Nogo receptor protein expression. In some
embodiments, the isolated peptide comprises the amino acid sequence
of SEQ ID NO: 8, 10, 12, 14, 16, 18 or 20, or one of the foregoing
with one or more, e.g., five, ten, fifteen or twenty consecutive
amino acid substitutions or naturally occurring amino acid
substitutions.
[0028] Genes encoding murine and human receptors for Nogo (NgR)
have been discovered. Various domains in the NgR polypeptide have
been identified, and certain of their functions have been
discovered. In addition, important aspects of the interaction of
specific regions of the Nogo polypeptide (ligand) with NgR have
been discovered. Based on these and other discoveries, the
invention features molecules and methods useful for decreasing
Nogo-dependent inhibition of axonal growth in CNS neurons.
[0029] The invention includes a NgR-derived polypeptide that
contains amino acid residues 27-309 of SEQ ID NO:2 (human NgR
NTLRRCT domain), while containing fewer than 115 consecutive amino
acids from amino acids 310-445 of SEQ ID NO:2 (human NgR CTS
domain). The NgR NTLRRCT domain optionally includes up to 20
conservative amino acid substitutions. In some embodiments, the
encoded polypeptide contains fewer than 50 consecutive amino acids
from amino acids from the NgR CTS domain. While the polypeptide may
include a functional GPI domain, a functional GPI domain may be
absent, e.g., when a soluble polypeptide is desired. The invention
also includes a nucleic acid encoding a NgR-derived polypeptide; a
vector, e.g., operably linked to an expression control sequence,
containing the nucleic acid; and a transformed host cell containing
the vector. The invention also includes a method of producing a
NgR-derived polypeptide. The method includes introducing a nucleic
acid encoding the above-described polypeptide into a host cell,
culturing the host cell under conditions suitable for expression of
said polypeptide, and recovering the polypeptide.
[0030] The invention also includes an antibody that binds to an
epitope in the CTS domain of NgR. The antibody can be polyclonal or
monoclonal.
[0031] The invention also includes a method of inhibiting binding
of a Nogo polypeptide to a NgR. The method includes contacting the
Nogo polypeptide with an effective amount of the above-described
NgR-derived polypeptide.
[0032] The invention also includes a method of inhibiting binding
of a Nogo polypeptide to a NgR, comprising contacting the NgR with
an antibody that binds to the amino acid sequence consisting of SEQ
ID NO:2 (NgR polypeptide).
[0033] The invention also includes a method of decreasing
inhibition of axonal growth by a CNS neuron. The method includes
contacting the neuron with an effective amount of: (a) an
above-described NgR-derived polypeptide; or (b) an antibody that
binds to the amino acid sequence set forth as SEQ ID NO:2 (NgR). In
some embodiments of the invention, the antibody binds to an epitope
within the amino acid sequence consisting of amino acids 310-445 of
SEQ ID NO:2 (CTS domain of NgR).
[0034] The invention also includes a method of treating a central
nervous system disease, disorder or injury, e.g., spinal cord
injury. The method includes administering to a mammal, e.g., a
human, an effective amount of: (a) an agent that inhibits binding
of a Nogo polypeptide to a NgR; or (b) an agent that inhibits
NgR-dependent signal transduction in a central nervous system
neuron. Exemplary agents for inhibiting binding of a Nogo
polypeptide to a NgR include: (a) an above-described NgR-derived
polypeptide; and (b) an antibody that binds to the NgR polypeptide
(SEQ ID NO:2). In some embodiments, the antibody binds to an
epitope within the CTS domain of NgR (amino acids 310-445 of SEQ ID
NO:2).
[0035] The invention also includes a method for identifying a
molecule that inhibits binding of a Nogo polypeptide to a NgR. The
method includes: (a) providing a NgR polypeptide; (b) contacting
the NgR polypeptide with a candidate molecule; and (c) detecting a
decrease in binding of the Nogo polypeptide to the NgR in the
presence of the candidate molecule, as compared to the binding of
the Nogo polypeptide to the NgR in the presence of the candidate
molecule.
[0036] The method also includes pharmaceutical compositions. In
some embodiments the composition contains an above-described
NgR-derived polypeptide and a pharmaceutically acceptable carrier.
In other embodiments, the composition contains an antibody that
binds to an epitope in the NgR CTS domain, and a pharmaceutically
acceptable carrier.
[0037] The invention also includes a polypeptide that contains the
amino acid sequence IYKGVIQAI or EELV, or both, with the
polypeptide containing a total of 40 amino acids or fewer ("Nogo
ligand-derived polypeptide"). In some embodiments, the Nogo
ligand-derived polypeptide includes amino acid residues 2 to 34 of
SEQ ID NO:21. In some embodiments, the Nogo ligand-derived
polypeptide includes a heterologous amino acid sequence not present
in NogoA, wherein the heterologous amino acid sequence contains at
least five amino acid residues. The invention also includes a
nucleic acid encoding a Nogo ligand-derived polypeptide; a vector,
e.g., operably linked to an expression control sequence, containing
the nucleic acid; and a transformed host cell containing the
vector.
[0038] The invention also includes an antibody that binds to an
above-described Nogo ligand-derived polypeptide. The antibody can
be polyclonal or monoclonal.
[0039] The invention also includes a composition that contains an
above-described NgR-derived polypeptide and a pharmaceutically
acceptable carrier or an antibody that binds to an epitope in the
NgR CTS domain, and a pharmaceutically acceptable carrier.
[0040] The invention also includes an alternative method of
inhibiting binding of a Nogo polypeptide to a NgR. The alternative
method includes contacting the Nogo polypeptide with an effective
amount of an above-described Nogo ligand-derived polypeptide.
[0041] The invention also includes an alternative method of
decreasing inhibition of axonal growth by a CNS neuron. The
alternative method includes contacting the neuron with an effective
amount of an above-described Nogo ligand-derived polypeptide.
[0042] The invention also includes an alternative method of
treating a central nervous system disease, disorder or injury,
e.g., a spinal cord injury. The alternative method includes
administering to a mammal, e.g., a human, an effective amount of an
above-described Nogo ligand-derived polypeptide.
[0043] The invention also includes a method of identifying a
molecule that decreases Nogo-dependent inhibition of axonal growth.
The method includes: (a) providing a polypeptide containing a
target sequence consisting of IYKGVIQAI or EELV, or both; (b)
contacting the polypeptide with a candidate molecule; and (c)
detecting binding of the candidate molecule to a target sequence in
the polypeptide.
[0044] The invention also includes embodiments wherein SEQ ID NO:4
(murine NgR) is substituted for SEQ ID NO:2 (human NgR). Those of
skill in the art will recognize where the human sequence is
preferable over the murine sequence and visa versa.
DESCRIPTION OF THE FIGURES
[0045] FIG. 1-Comparison of Nogo domains
[0046] (a) is a schematic diagram which summarizes features of the
Nogo proteins utilized in this study. (b) is a photograph of
NIH-3T3 fibroblasts cultured on surfaces coated with Amino-Nogo,
GST-Nogo-66 or no protein and stained for filamentous actin (scale
bar, 40 .mu.m). (c) is a photograph of chick E12 dorsal root
ganglions cultured on surfaces coated with Amino-Nogo, GST-Nogo-66
or no protein (substrate-bound) or with 100 nM Nogo protein
(soluble) (scale bar, 40 .mu.m). (d) is a photograph of a gel and
an immunoblot where purified Amino-Nogo-Myc-His protein was
subjected to SDS-PAGE and stained with Commassie Brilliant Blue
(CBB) or immunoblotted with anti-Myc antibodies (Myc) (molecular
weight markers of 200, 116, 97, 65 & 45 kDa are at left). (e)
is a graph displaying experimental data where the percentage of 3T3
fibroblasts with an area greater than 1200 .mu.m.sup.2 (spread) was
measured from experiments as in (b) on Nogo-coated surfaces (black)
or with soluble 100 nM Nogo preparations (blue) (AM, Amino-Nogo;
AM+Myc, Amino-Nogo preincubated with anti-Myc antibody; AM+Myc+Mo,
AM+Myc preincubated with anti-mouse IgG antibody; Myc+Mo, anti-Myc
antibody plus anti-murine IgG antibody). (f) is a graph displaying
experimental data where the percentage of spread COS-7 cells was
determined after culture on Nogo-coated surfaces or with soluble
100 nM Nogo preparations. (g) is a graph displaying experimental
data where the effects of purified preparations of GST-Nogo-66 or
Amino-Nogo on growth cone morphology was assessed in E12 dorsal
root ganglion cultures at the indicated concentrations after thirty
minutes. This demonstrates that GST-Nogo-66 is two orders of
magnitude more potent than Amino-Nogo in this assay. (h) is a graph
displaying experimental data where the neurite outgrowth per cell
in E13 dorsal root ganglion cultures was quantitated from
experiments as in (c) on Nogo-coated surfaces or with soluble 100
nM Nogo preparations. (i) is a graph displaying experimental data
where the effects of Nogo preparations on neurite outgrowth in
cerebellar granule neurons was measured.
[0047] FIG. 2-Nogo fragments antagonize Nogo and CNS myelin
action
[0048] (a) is a photograph of chick E12 dorsal root ganglion
explants that were cultured and growth cone collapse assessed as
described in FIG. 4. Cultures were exposed to the following
preparations for thirty minutes before fixation and staining with
rhodamine-phalloidin: buffer only (Control); 15 nM GST-Nogo); 1
.mu.M each of Pep1, Pep2 and Pep3 (Pep); 15 nM GST-Nogo plus 1
.mu.M each of Pep1, Pep2 and Pep3 (Nogo+Pep). Note that growth cone
collapse by Nogo is blocked by peptide addition. Pep1, residues
1-25 of the extracellular domain; Pep2, 11-35; and Pep3, 21-45. (b)
is a graph quantifying the results from growth cone collapse assays
as in (a). Individual peptides were included at 4 .mu.M, and the
peptide 1-3 mixture was 1 .mu.M of each peptide. CNS myelin was
prepared as described and the indicated total myelin protein
concentrations were included in the cultures. All results are the
means .+-.s.e.m. calculated from four to seven determinations.
Those values significantly different from the corresponding values
with the same concentration of Nogo or myelin but without peptide
are indicated (asterisk, p<0.05, Student's two-tailed t
test).
[0049] FIG. 3-Nogo antagonist Pep2-b 41
[0050] (a) is a graph displaying the results of chick E12 dorsal
root ganglion growth cone collapse assays. These assays were
performed and quantified as in GrandPre et al., (2000) Nature 403,
439-444. Assays were conducted with no addition (Control), 15 nM
GST-Nogo or 15 nM GST-Nogo plus 1 .mu.M Pep2-41 (Nogo+Pep). The
values are means .+-.s.e.m. calculated from four determinations.
(b) is a graph displaying the results of binding experiments where
binding of 10 nM AP-Nogo to chick E12 dorsal root ganglion neurons
was measured as described in FIG. 4 with the addition of the
indicated concentrations of Pep2-41.
[0051] FIG. 4-Nogo Pep2-41 prevents both Nogo & CNS myelin
inhibition of neurite outgrowth
[0052] This figure is a graph which displays the results of
outgrowth assays where neurons were cultured in the presence of the
indicated concentrations of Pep2-41, purified GST-Nogo
(GST-Nogo-66) protein and crude CNS myelin protein. Chick E13
dorsal root ganglion neurons were cultured under standard
conditions. For outgrowth assays, neurons were cultured in the
presence of the indicated concentrations of Pep2-41, purified
GST-Nogo (GST-Nogo-66) protein and crude CNS myelin protein. This
demonstrates that Pep2-41 can reverse the inhibition of neurite
outgrowth by either GST-Nogo or total CNS myelin.
[0053] FIG. 5-Ligand binding assay for axonal Nogo receptors
[0054] (a) is a photograph of a gel and an immunoblot where the
His-AP-Nogo (66 amino acid) protein was expressed in HEK293T cells,
and purified from conditioned medium on a Nickel-containing resin
via the His tag. Purified protein was subjected to SDS-PAGE and
stained for total protein with CBB or immunoblotted with anti-Nogo
antibodies (anti-Nogo). Molecular weight markers of 200, 116, 97,
65 and 45 kDa are shown at left, and the migration of AP-Nogo at
right. (b) is a photograph of dissociated chick E12 dorsal root
ganglion neurons that were incubated with 10 nM AP-Nogo or 10 nM
AP-Nogo+160 nM GST-Nogo for sixty minutes at 23.degree. C. The
cells were washed, fixed and incubated at 60.degree. C. in order to
inactivate endogenous AP. Bound AP-Nogo was detected by incubation
with nitro blue tetrazolium. Note the intense neuronal staining by
AP-Nogo that is displaced by unlabeled ligand. (c) is a graph
displaying experimental data where the potency of AP-Nogo and
GST-Nogo in E12 chick dorsal root ganglion growth cone collapse
assays was assessed as described in the Example section. The EC50
of AP-Nogo was determined to be 1 nM or less. The means .+-.s.e.m.
calculated from five to eight determinations are illustrated. (d)
is a graph displaying experimental data where the binding of 10 nM
AP-Nogo to chick E12 dorsal root ganglion neurons was assessed
alone, or in the presence of 100 nM GST-Nogo or in the presence of
4 .mu.M Pep2, which was quantified from experiments as in (b) by
the method described in the Example section. The means .+-.s.e.m.
calculated from eight determinations are shown. (e) is a graph
displaying experimental data where AP-Nogo binding to dorsal root
ganglion neurons was measured as a function of AP-Nogo
concentration. This is one of six experiments with similar results.
(f) is a graph summarizing the data from (e) replotted for
Scatchard analysis. The apparent Kd for AP-Nogo binding to E12
chick dorsal root ganglion neurons is 3 nM.
[0055] FIG. 6-Nogo binding to COS-7 expressing the Nogo
receptor
[0056] This figure is a photograph of COS-7 cells that were
transfected with an expression vector encoding the murine NgR. Two
days after transfection, binding of AP-Nogo or AP was assessed as
described in the Example section for dorsal root ganglion neurons.
Note the selective binding of AP-Nogo to NgR expressing cells.
Binding is greatly reduced in the presence of excess Nogo peptide
not fused to AP.
[0057] FIG. 7-Structure of the Nogo receptor
[0058] This schematic diagram illustrates the major structural
features of the NgR.
[0059] FIG. 8-Distribution of NgR mRNA.
[0060] This figure is a photograph of Northern blot of NgR mRNA for
polyA+ RNA samples from the indicated murine tissues on the left
and for total RNA samples from various rat brain regions on the
right. The migration of RNA size markers is shown at left.
[0061] FIG. 9-Nogo-66 Receptor Immunohistology
[0062] (a) is a photograph of an immunoblot where membrane
fractions (10 .mu.g protein) from the indicated cells or chick
tissues were analyzed by anti-Nogo-66 receptor immunoblot
(molecular weight markers in kDa are at right). (b) is a photograph
of COS-7 cells expressing Myc-Nogo-66 receptor or chick E5 spinal
cord explants (eight days in vitro) stained with anti-Nogo-66
receptor, anti-Myc or the oligodendrocyte-specific O4 antibody. The
bottom three panels show double label immunohistochemistry of the
same field (scale bar, 40 .mu.m for the top three panels and 80
.mu.m for the bottom three panels). (c) is a photograph of
paraformaldehyde-fixed vibratome sections of adult brain or spinal
cord stained with the anti-Nogo-66 receptor preparation. This
demonstrates staining of axonal profiles (arrows) in both the pons
and spinal cord. Staining is dramatically reduced in the presence
of 10 .mu.g/ml GST-Nogo-66 receptor antigen.
[0063] FIG. 10-Nogo-66 Receptor mediates growth cone collapse by
Nogo-66
[0064] (a) is a photograph of chick E12 DRG explants exposed to
Nogo-66 following pre-treatment with PI-PLC or buffer. Staining of
F-actin in axons is illustrated (scale bar, 40 .mu.m). (b) is a
graph summarizing the experimental results of binding of 3 nM AP or
AP-Nogo to chick E12 dorsal root ganglion dissociated neurons.
Where indicated the cultures were pre-treated with PI-PLC or 150 nM
GST-Nogo-66 was included in the incubation with AP-Nogo. (c) is a
graph summarizing growth cone collapse measurements from
experiments as in (a). Chick E12 DRG cultures were treated with or
without PI-PLC prior to exposure to 30 nM GST-Nogo-66 or 100 pM
Sema3A. (d) is a photograph of E7 retinal ganglion cell explants
infected with a control virus (HSV-PlexinA1) or with
HSV-Myc-Nogo-66 receptor and then incubated with or without
Nogo-66. Phalloidin staining of axonal growth cones is illustrated
(scale bar, 25 .mu.m). (e) is a graph quantitating growth cone
collapse in uninfected, or viral infected E7 retinal neurons as in
(d).
[0065] FIG. 11-Structure-function analysis of Nogo-66 receptor
[0066] (a) is a schematic diagram of different Nogo-66 receptor
deletion mutants. These mutants were assessed for level of
expression by immunoblot and for AP-Nogo binding. Note that the
leucine rich repeats and the leucine rich repeat carboxy terminal
are required for Nogo binding but the remainder of the protein is
not. The second protein was tested after purification and
immobilization.
[0067] (b) is a diagram of the predicted three dimensional
structure for the first seven leucine rich repeats of the Nogo-66
receptor. This is derived from computer modeling based on the
predicted structure of the related leucine rich repeats of the
leutropin receptor (Jiang et al., (1995) Structure 3, 1341-1353).
Modeling is performed by Swiss-Model at The Expert Protein Analysis
System (ExPASy) proteomics server of the Swiss Institute of
Bioinformatics (SIB) (www.expasy.ch/spdbv). Those regions with beta
sheet and alpha helix secondary structure are also indicated.
[0068] FIG. 12-Soluble NgR blocks Nogo-66
[0069] Chick E13 DRG neurons cultured under standard conditions. In
growth cone collapse assays, conditioned medium from HEK 293T cells
secreting the 1-348 amino acid ectodomain fragment of the murine
NgR or control conditioned medium was added together with 100 nM
Nogo-66. In the bottom left panel, the data in the graph
demonstrates that Nogo-induced collapse is blocked by the soluble
receptor fragment. For outgrowth assays, neurons were cultured in
the presence of control or NgR ectodomain conditioned medium
together with Nogo-66 protein (50 nM) or central nervous system
myelin (15 .mu.g total protein/ml). The top four panels show
photographs demonstrating that central nervous system myelin
inhibits outgrowth and that this is blocked by the presence the NgR
ectodomain protein. Outgrowth is quantitated in the graph in the
bottom right panel.
[0070] FIG. 13-Regions in the luminal/extracellular domain of Nogo
necessary for NgR binding
[0071] (a) graphically depicts the amino acid sequences of peptides
derived from the luminal/extracelluar domain of Nogo that were
recombinantly attached to DNA encoding alkaline phosphatase (AP)
and expressed to make AP fusion proteins. (b) shows the binding of
the above AP fusion proteins to COS-7 cells expressing NgR.
Conditioned medium from 293T cells expressing the AP fusion
proteins or AP alone was applied to COS-7 cells transfected with
mouse NgR (mNgR). Binding was visualized after application of
substrates NBT and BCIP. Scale bar, 100 um.
[0072] FIG. 14-Residues 1-40 of the luminal/extracellular domain of
Nogo bind NgR
[0073] (a) shows the binding of the fusion protein containing AP
and the 140 peptide described in FIG. 5a [hereinafter "140-AP"] to
COS-7 cells expressing mouse NgR. Scale bar, 100 um. (b)
graphically depicts the binding of 140-AP to COS-7 cells expressing
mNgR as measured as a function of 140-AP concentration. (c)
graphically depicts data derived from the above 140-AP binding
assay replotted as bound/free v. bound. The Kd of 140-AP binding to
mNgR in this assay is 8 nM.
[0074] FIG. 15-Growth Cone Collapsing Activity AP-fused
Peptides
[0075] (a) shows E12 chick DRG growth cone morphology following 30
minute exposure to 140-AP and AP-Nogo-66 fusion proteins. Scale
bar, 25 um. (b) graphically depicts the quantification of growth
cone collapse in E12 chick DRG cultures after exposure to condition
medium containing 20 nM AP fusion proteins comprising AP fused to
the following peptides as described in FIG. 13a: 1-66, 1-40, 1-35
and 640. As a control, condition medium containing no AP fusion
protein was used.
[0076] FIG. 16-Peptide 140 neutralizes Nogo-66 inhibitory
activity
[0077] (a) shows E12 chick DRG growth cone morphology after
treatment with a synthetic peptide encoding amino acids #
1055-1094, acetylated at the C-terminus and amidated at the
N-terminus of the human NogoA protein [hereinafter, "peptide 140"],
the luminal/extracellular space encoded by SEQ ID NO:22. The
cultures were pretreated with 1 uM peptide 140 or buffer followed
by a 30 minute exposure to 30 nM GST-Nogo-66 or 12.5 nM TPA. The
amino acid sequence of peptide 140 corresponds to a sequence within
the luminal/extracellular region of the hNogo protein. Scale bar 25
um. Growth cones were visualized by rhodamine-phalloidin staining.
(b)-(d) graphically depicts the amount of E12 chick DRG growth cone
collapse after the cells have been pretreated with 1 uM peptide
140, or buffer before a 30 minute exposure to various
concentrations of GST-Nogo-66, TPA or Sema3A. (e) graphically
depicts, as compared to a control, the percentage of neurite
outgrowth in dissociated E12 chick DRG cultures grown for 5-7 hours
in the presence of substrate coated with GST-Nogo-66 or phosphate
buffered saline (PBS) following treatment with peptide 140, a
scrambled version of peptide 140 (i.e.,
acetyl-SYVKEYAPIFAGKSRGEIKYQSIEIHEAQVRSDELVQSLN-amide) or
buffer.
[0078] FIG. 17-Peptide 140 partially blocks CNS myelin inhibitory
activity
[0079] (a) shows dissociated E12 chick DRG cultures grown on bound
substrate coating (CNS myelin or PBS) following treatment with 1 uM
peptide 140, a scrambled version of peptide 140 or buffer. Scale
bar 75 um. (b) graphically depicts the percentage of E12 chick DRG
growth cone collapse in explant cultures pretreated with peptide
140 or buffer and then exposed to CNS myelin or PBS for 30 minutes
before fixation. (c) graphically depicts the percentage of neurite
outgrowth for E12 chick dissociated DRG neurite outgrowth grown for
5-7 hours on bound substrate coating (CNS myelin or PBS) following
application of peptide 140, scrambled peptide 140 or buffer.
[0080] FIG. 18. Nopo binding to NgR Deletion Mutants: LRRNT, LRR1-8
and LRRCT required for binding
[0081] (A) WTNgR (wt) and the NgR deletion mutants used in this
study are illustrated. NgR mutants include deletions to the amino
terminus (.DELTA.NT), LRR domains 1 and 2 (.DELTA.1-2), LRR domains
3 and 4 (A34), LRR domains 5 and 6 (A5-6), LRR domains 7 and 8
(A7-8), the LRR carboxy terminus (.DELTA.LRRCT), the NgR carboxy
terminus (.DELTA.CT) and the complete LRR domain (LRR-). (B) COS-7
cells transfected with NgR deletion mutant plasmids were stained
for anti-myc immunoreactivity or tested for AP-Nogo binding. All
NgR mutant proteins were expressed in COS-7 cells as shown by myc
immunoreactivity. Only wtNgR and NgR.DELTA.CT-transfected COS-7
cells bound to AP-Nogo. Scale bar, 100 .mu.m.
[0082] FIG. 19. Expression of HSVNgR proteins in retinal ganglion
cell neurites (A) HSV plasmids encoding myc epitope-tagged
wild-type NgR (mycNgR), L1NgR, and myc-tagged NgR.DELTA.CT were
transfected into HEK293T cells and protein expression in cell
lysates was analyzed by SDS-PAGE and immunoblotting with anti-myc
and anti-NgR antibodies. All three proteins were expressed at the
predicted molecular weight as demonstrated by anti-NgR
immunoblotting. L1NgR encodes residues 1451 of mouse NgR fused to
the transmembrane and cytoplasmic tail of mouse L1, but lacks a myc
tag. (B) Anti-myc immunostaining of infected retinal explants
demonstrates expression of mycNgRACT in RGC neurites double stained
with phalloidin. Myc-staining was negative in a phalloidin-stained
neurite that was infected with HSVL1NgR.
[0083] FIG. 20. NGRL1 mediates growth cone collapse in response to
GST-hNogo-A(1055-1120) but NgR.DELTA.CT does not
[0084] (A) E7 chick retinal explants were infected with recombinant
viral preparations of PlexinA1 (PlexA1), wild-type NgR (wtNgR),
NgRL1 chimeric receptor (NgRL1), or NgR carboxy terminal deletion
mutant (NgR.DELTA.CT). Explants were treated with
GST-hNogo-A(1055-1120) for 30 min, and stained with
rhodamine-phalloidin. Cells infected with PlexA 1 virus or
NgR.DELTA.CT virus are insensitive to treatment with
GST-hNogo-A(1055-1120), whereas wtNgR or NgRL1-infected cells
collapse in response to GST-hNogo-A(1055-1120). (B) Dose curve of
RGC response to varying amounts of GST-hNogo-A(1055-1120) following
infection with NgR viral preparations.
[0085] FIG. 21. GSTNgRCT does not constitutively inhibit neurite
outgrowth
[0086] Neurite outgrowth of dissociated E13 DRGs plated on
GST-hNogo-A(1055-1120) substrates in the presence of 100 nM
GSTNgRCT or PBS as a control. GSTNgRCT does not inhibit neurite
outgrowth on control PBS spots or modify the response of E13 DRGs
to GST-hNogo-A(1055-1120) inhibition.
[0087] FIG. 22. Analysis of NgR subcellular localization.
[0088] Cell lysates from HEK293T cells transfected with HSVwtNgR or
HSVNgRL1 plasmids were fractionated on OptiPrep flotation
gradients. Fractions were separated by SDS-PAGE and analyzed by
immunoblotting blots with anti-NgR, anti-TfR, or anti-caveolin
antibodies. As predicted, wtNgR is found almost exclusively in the
caveolin-rich detergent insoluble fraction (A), whereas L1NgR is
localized to multiple membrane fractions with a much smaller
proportion in the caveolin-rich detergent insoluble fraction
compared to wtNgR (B).
[0089] FIG. 23. mNgR binds to mNpR
[0090] COS-7 cells were transfected with wtNgR or NgR deletion
mutant plasmids and tested for AP-NgR binding. wtNgR and
NgR.DELTA.CT-transfected COS-7 cells bind to AP-NgR whereas other
NgR deletion mutants do not. Scale bar, 100 .mu.m.
[0091] FIG. 24. The soluble ectodomain of mNgR blocks inhibition of
outgrowth by soluble hNogo-A(1055-1120) and CNS myelin
[0092] Chick E13 DRG neurons were cultured under standard
conditions. In growth cone collapse assays, conditioned medium from
HEK293T cells secreting the 1-348 as ectodomain fragment of the
mNgR or control conditioned medium was added together with 100 nM
GST-hNogo-A(1055-1120). In the bottom left panel, note that
hNogo-A(1055-1120)-induced collapse is blocked by the soluble
receptor fragment. For outgrowth assays, neurons were cultured in
the presence of control or mNgR ectodomain conditioned medium
together with GST-hNogo-A(1055-1120) protein (50 nM) or CNS myelin
(15 .mu.g total protein/ml). The top four panels show that CNS
myelin inhibits outgrowth and that this is blocked by the presence
the mNgR ectodomain protein.
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0093] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present
invention, the preferred methods and materials are described.
[0094] As used herein, the term "axon" refers to a long cellular
protrusion from a neuron, whereby efferent (outgoing) action
potentials are conducted from the cell body towards target
cells.
[0095] As used herein, the term "axonal growth" refers to an
extension of the long process or axon, originating at the cell body
and preceded by the growth cone.
[0096] As used herein, the term "central nervous system disease,
disorder or injury" refers to any state associated with abnormal
function of the central nervous system (CNS). The term includes,
but is not limited to, altered CNS function resulting from physical
trauma to cerebral or spinal chord tissue, viral infection,
autoimmune mechanism, genetic mutation and neurodegenerative
diseases or disorders.
[0097] As used herein, the term "chimeric protein" refers to any
polypeptide which is not completely homologous at the amino acid
level to its wild-type sequence or is encoded by a nucleic acid
which is derived from splicing two distinct sources of nucleic
acids. The term includes, but is not limited to, fusion proteins
and proteins designed to contain one or more amino acid
substitutions which distinguishes their amino acid sequence from
the wild type sequence.
[0098] As used herein, the term "demyelinating disease" refers to a
pathological disorder characterized by the degradation of the
myelin sheath of the oligodendrocyte cell membrane.
[0099] As used herein, the term "growth cone" refers to a
specialized region at the tip of a growing neurite that is
responsible for sensing the local environment and moving the axon
toward its appropriate synaptic target cell.
[0100] As used herein, the term "growth cone movement" refers to
the extension or collapse of the growth cone toward a neuron's
target cell.
[0101] As used herein, the term "neurite" refers to a process
growing out of a neuron. As it is sometimes difficult to
distinguish a dendrite from an axon in culture, the term neurite is
used for both.
[0102] As used herein, the term "oligodendrocyte" refers to a
neuroglial cell of the CNS whose function is to myelinate CNS
axons.
[0103] As used herein, the term "polypeptide" refers to a peptide
which on hydrolysis yields more than two amino acids, called
tripeptides, tetrapeptides, etc. according to the number of amino
acids contained in the polypeptide. The term "polypeptide" is used
synonymously with the term "protein" and "peptide" throughout the
specification.
II. Specific Embodiments
A. NgR Protein and Peptide Agents for the NgR Protein
[0104] The present invention provides isolated protein, allelic
variants of the protein, and conservative amino acid substitutions
of the protein. As used herein, the protein or polypeptide refers
to a NgR protein that has the human amino acid sequence depicted in
SEQ ID NO: 2 or the murine amino acid sequence depicted in SEQ ID
NO: 4. The protein or polypeptide also refers to the peptides
identified as NgR peptide agents that have the amino acid sequences
depicted in SEQ ID NO: 8, 10, 12, 14, 16, 18 and 20. The invention
also includes naturally occurring allelic variants and proteins
that have a slightly different amino acid sequence than that
specifically recited above. Allelic variants, though possessing a
slightly different amino acid sequence than those recited above,
will still have the same or similar biological functions associated
with the human and murine NgR proteins and the NgR peptide agents
depicted in SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 and 20.
[0105] As used herein, the family of proteins related to the NgR
proteins refers to proteins that have been isolated from organisms
in addition to humans and mice. The methods used to identify and
isolate other members of the family of proteins related to the NgR
proteins are described below.
[0106] The NgR proteins and peptide agents of the present invention
are preferably in isolated form. As used herein, a protein or
ligand is said to be isolated when physical, mechanical or chemical
methods are employed to remove the protein from cellular
constituents that are normally associated with the protein. A
skilled artisan can readily employ standard purification methods to
obtain an isolated protein or ligand.
[0107] The proteins of the present invention further include
conservative variants of the proteins and ligands herein described.
As used herein, a conservative variant refers to alterations in the
amino acid sequence that do not adversely affect the biological
functions of the protein. A substitution, insertion or deletion is
said to adversely affect the protein when the altered sequence
prevents or disrupts a biological function associated with the
protein. For example, the overall charge, structure or
hydrophobic-hydrophilic properties of the protein can be altered
without adversely affecting a biological activity. Accordingly, the
amino acid sequence can be altered, for example to render the
peptide more hydrophobic or hydrophilic, without adversely
affecting the biological activities of the protein.
[0108] The allelic variants, the conservative substitution
variants, and the members of the protein family, will have an amino
acid sequence having at least seventy-five percent amino acid
sequence identity with the human and murine sequences set forth in
SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 and 20, more preferably at
least eighty percent, even more preferably at least ninety percent,
and most preferably at least ninety-five percent. Identity or
homology with respect to such sequences is defined herein as the
percentage of amino acid residues in the candidate sequence that
are identical with the known peptides, after aligning the sequences
and introducing gaps, if necessary, to achieve the maximum percent
homology, and not considering any conservative substitutions as
part of the sequence identity. N-terminal, C-terminal or internal
extensions, deletions, or insertions into the peptide sequence
shall not be construed as affecting homology.
[0109] Thus, the proteins and peptides of the present invention
include molecules comprising the amino acid sequence of SEQ ID NO:
2, 4, 8, 10, 12, 14, 16, 18 and 20; fragments thereof having a
consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25,
30, 35 or more amino acid residues of the NgR proteins and peptide
agents; amino acid sequence variants of such sequences wherein at
least one amino acid residue has been inserted N- or C-terminal to,
or within, the disclosed sequence; amino acid sequence variants of
the disclosed sequences, or their fragments as defined above, that
have been substituted by another residue. Contemplated variants
further include those containing predetermined mutations by, e.g.,
homologous recombination, site-directed or PCR mutagenesis, and the
corresponding proteins of other animal species, including but not
limited to rabbit, rat, porcine, bovine, ovine, equine and
non-human primate species, the alleles or other naturally occurring
variants of the family of proteins; and derivatives wherein the
protein has been covalently modified by substitution, chemical,
enzymatic, or other appropriate means with a moiety other than a
naturally occurring amino acid (for example, a detectable moiety
such as an enzyme or radioisotope).
[0110] As described below, members of the family of proteins can be
used: (1) to identify agents which modulate at least one activity
of the protein, (2) in methods of identifying binding partners for
the protein, (3) as an antigen to raise polyclonal or monoclonal
antibodies, and 4) as a therapeutic agent.
B. Nucleic Acid Molecules
[0111] The present invention further provides nucleic acid
molecules that encode the proteins and peptides comprising the
amino acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 and
20 and the related proteins herein described, preferably in
isolated form. As used herein, "nucleic acid" includes genomic DNA,
cDNA, mRNA and antisense molecules, as well as nucleic acids based
on alternative backbones or including alternative bases whether
derived from natural sources or synthesized.
[0112] Homology or identity is determined by BLAST (Basic Local
Alignment Search Tool) analysis using the algorithm employed by the
programs blastp, blastn, blastx, tblastn and tblastx (Karlin et
al., (1990) Proc. Natl. Acad. Sci. USA 87, 2264-2268 and Altschul,
(1993) J. Mol. Evol. 36, 290-300, fully incorporated by reference)
which are tailored for sequence similarity searching. The approach
used by the BLAST program is to first consider similar segments
between a query sequence and a database sequence, then to evaluate
the statistical significance of all matches that are identified and
finally to summarize only those matches which satisfy a preselected
threshold of significance. For a discussion of basic issues in
similarity searching of sequence databases see Altschul et al.,
(1994) Nature Genetics 6, 119-129 which is fully incorporated by
reference. The search parameters for histogram, descriptions,
alignments, expect (i.e., the statistical significance threshold
for reporting matches against database sequences), cutoff, matrix
and filter are at the default settings. The default scoring matrix
used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix
(Henikoff et al., (1992) Proc. Natl. Acad. Sci. USA 89,
10915-10919, fully incorporated by reference). Four blastn
parameters were adjusted as follows: Q=10 (gap creation penalty);
R=10 (gap extension penalty); wink-1 (generates word hits at every
wink.sup.th position along the query); and gapw=16 (sets the window
width within which gapped alignments are generated). The equivalent
Blastp parameter settings were Q=9; R=2; wink=1; and gapw=32. A
Bestfit comparison between sequences, available in the GCG package
version 10.0, uses DNA parameters GAP=50 (gap creation penalty) and
LEN=3 (gap extension penalty) and the equivalent settings in
protein comparisons are GAP=8 and LEN=2.
[0113] As used herein, "high stringency conditions" means
hybridization at 42.degree. C. in the presence of 50% formamide,
followed by a first wash at 65.degree. C. with 2.times.SSC
containing 1% sodium SDS, followed by a second wash at 65.degree.
C. with 0.1.times.SSC.
[0114] As used herein, a nucleic acid molecule is said to be
"isolated" when the nucleic acid molecule is substantially
separated from contaminant nucleic acid encoding other polypeptides
from the source of nucleic acid.
[0115] The present invention further provides fragments of the
encoding nucleic acid molecule. As used herein, a fragment of an
encoding nucleic acid molecule refers to a portion of the entire
protein encoding sequence. The size of the fragment will be
determined by the intended use. For example, if the fragment is
chosen so as to encode an active portion of the protein, the
fragment will need to be large enough to encode the functional
region(s) of the protein. If the fragment is to be used as a
nucleic acid probe or PCR primer, then the fragment length is
chosen so as to obtain a relatively small number of false positives
during probing/priming.
[0116] Fragments of the encoding nucleic acid molecules of the
present invention (i.e., synthetic oligonucleotides) that are used
as probes or specific primers for the polymerase chain reaction
(PCR) or to synthesize gene sequences encoding proteins of the
invention can easily be synthesized by chemical techniques, for
example, the phosphotriester method of Matteucci et al., (1981) J.
Am. Chem. Soc.103, 3185-3191 or using automated synthesis methods.
In addition, larger DNA segments can readily be prepared by well
known methods, such as synthesis of a group of oligonucleotides
that define various modular segments of the gene, followed by
ligation of oligonucleotides to build the complete modified
gene.
[0117] The encoding nucleic acid molecules of the present invention
may further be modified so as to contain a detectable label for
diagnostic and probe purposes. A variety of such labels are known
in the art and can readily be employed with the encoding molecules
herein described. Suitable labels include, but are not limited to,
biotin, radiolabeled nucleotides and the like. A skilled artisan
can employ any of the art known labels to obtain a labeled encoding
nucleic acid molecule.
[0118] Modifications to the primary structure by deletion,
addition, or alteration of the amino acids incorporated into the
protein sequence during translation can be made without destroying
the activity of the protein. Such substitutions or other
alterations result in proteins having an amino acid sequence
encoded by a nucleic acid falling within the contemplated scope of
the present invention.
[0119] The NgR domain designations used herein are defined as
follows:
TABLE-US-00001 TABLE 1 Example NgR domains Domain hNgR (SEQ ID: 2)
mNgR (SEQ ID NO: 4) Signal Seq. 1-26 1-26 LRRNT 27-56 27-56 LRR1
57-81 57-81 LRR2 82-105 82-105 LRR3 106-130 106-130 LRR4 131-154
131-154 LRR5 155-178 155-178 LRR6 179-202 179-202 LRR7 203-226
203-226 LRR8 227-250 227-250 LRRCT 260-309 260-309 CTS (CT
Signaling) 310-445 310-445 GPI 446-473 456-473
[0120] In some embodiments of the invention, the above domains are
modified. Modification can be in a manner that preserves domain
functionality. Modification can include addition, deletion, or
substitution of certain amino acids. Exemplary modifications
include conservative amino acid substitutions. Preferably such
substitutions number 20 or fewer per 100 residues. More preferably,
such substitutions number 10 or fewer per 100 residues. Further
exemplary modifications include addition of flanking sequences of
up to five amino acids at the N terminus and/or C terminus of one
or more domains.
[0121] According to this invention, the signal sequence and GPI
domains of the NgRs of this invention can be replaced by signal
sequences and GPI domains of other proteins. In one embodiment of
this invention, the signal sequence domain consists of #1-26 of the
hNgR or #1-26 of the mNgR. The GPI domain function have been shown
to anchor the proteins to lipid rafts (e.g., Tansey et al., Neuron
25:611-623 (2000)). GPI domains are known in the art, e.g., Gaudiz,
et al., J. Biol. Chem. 273(40):26202-26209 (1998). According to one
embodiment of the invention, the GPI domain consists of #446-473
amino acid residues of hNgR or #456-473 amino acid residues of
mNgR. Biologically active variants of the GPI domain include
polypeptides comprising amino acid sequences that anchor proteins
to lipid rafts.
[0122] The LRRNT domain is a leucine rich repeat domain that is
typically flanking the N-terminal side of the LRR1-8 domain.
[0123] Leucine rich domains are also known in the art, e.g., Kobe,
B. et al., TIBS 19(10):415-421 (1994). In one embodiment of this
invention, the LRR1 domain, LRR2 domain, LRR3 domain, LRR4 domain,
LRR5 domain, LRR6 domain, the LRR7 domain and the LRR8 domain
(collectively, also known as LRR1-8 herein) consists of the amino
acid residues as recited in Table 1. The LR1-8 shares sequence
identity with several other leucine rich proteins. According to one
embodiment of this invention, a LRR domain of NgR is replaced with
a LRR domain of another protein.
[0124] The LRRCT domain is a leucine rich repeat domain that is
typically flanking the C-terminal side of the LRR1-8 domain.
According to one embodiment of the invention, the LRRCT domain
consists of #-260-309 residues of hNgR or mNgR. According to one
embodiment of the invention, the LRRCT domain consists of #-260-305
residues of hNgR or mNgR.
[0125] A polypeptide comprising a LRRNT domain, a LRR1-8 domain and
a LRRCT domain (collectively, also referred to as a NTLRRCT domain
(SEQ ID NO:55) herein) of NgR is contemplated. Biologically active
variants of NTLRRCT include polypeptides comprising the NTLRRCT
domain that can bind Nogo and/or can bind to NgR. According, A CTS
domain is an amino acid sequence within a NgR between the LRRCT and
the GPI domain. According to one embodiment, the CTS domain can be
described by the residues recited above. A CTS domain according to
this invention is involved in signalling a neuron in response to a
Nogo ligand binding to the NgR. A "portion of a CTS domain" is 20
or more consecutive amino acids of a CTS domain. A portion of a CTS
domain can also be selected from the group consisting of 30 or
more, 40 or more, and 50 or more consecutive amino acids of a CTS
domain. According to one embodiment of this invention, a NgR family
member is manipulated so that the CTS region or a portion thereof
is deleted, mutated or blocked with another agent so that it is not
functional. In one embodiment, the CTS domain consists of #310-445
amino acid residue of hNgR or mNgR, or #306-442 of hNgR (SEQ ID
NO:53). According to another embodiment, amino acid sequences that
have a sequence identity to #310-445 amino acid residue of hNgR or
mNgR, or #306-442 of hNgR in the range of 85% or more, 90% or more,
95% or more, 99% or more sequence identity are contemplated.
C. Isolation of Other Related Nucleic Acid Molecules
[0126] As described above, the identification of the human nucleic
acid molecule having SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17 and 19
allows a skilled artisan to isolate nucleic acid molecules that
encode other members of the NgR protein family in addition to the
sequences herein described. Further, the presently disclosed
nucleic acid molecules allow a skilled artisan to isolate nucleic
acid molecules that encode other members of the family of NgR
proteins and peptide agents.
[0127] Essentially, a skilled artisan can readily use the amino
acid sequence of SEQ ID NO: 2, 4, 8, 10, 12, 14, 16, 18 and 20 or
an immunogenic fragment thereof to generate antibody probes to
screen expression libraries prepared from appropriate cells.
Typically, polyclonal antiserum from mammals such as rabbits
immunized with the purified protein (as described below) or
monoclonal antibodies can be used to probe a mammalian cDNA or
genomic expression library, such as lambda gtll library, to obtain
the appropriate coding sequence for other members of the protein
family. The cloned cDNA sequence can be expressed as a fusion
protein, expressed directly using its own control sequences, or
expressed by constructions using control sequences appropriate to
the particular host used for expression of the enzyme.
[0128] Alternatively, a portion of a coding sequence herein
described can be synthesized and used as a probe to retrieve DNA
encoding a member of the protein family from any mammalian
organism. Oligomers containing e.g., approximately 18-20
nucleotides (encoding about a six to seven amino acid stretch) can
be prepared and used to screen genomic DNA or cDNA libraries to
obtain hybridization under stringent conditions or conditions of
sufficient stringency to eliminate an undue level of false
positives.
[0129] Additionally, pairs of oligonucleotide primers can be
prepared for use in a polymerase chain reaction (PCR) to
selectively clone an encoding nucleic acid molecule. A PCR
denature/anneal/extend cycle for using such PCR primers is well
known in the art and can readily be adapted for use in isolating
other encoding nucleic acid molecules.
D. Recombinant DNA Molecules Containing a Nucleic Acid Molecule
[0130] The present invention further provides recombinant DNA
molecules (rDNA) that contain a coding sequence. As used herein, a
rDNA molecule is a DNA molecule that has been subjected to
molecular manipulation. Methods for generating rDNA molecules are
well known in the art, for example, see Sambrook et al., (1989)
Molecular Cloning--A Laboratory Manual, Cold Spring Harbor
Laboratory Press. In the preferred rDNA molecules, a coding DNA
sequence is operably linked to expression control sequences and
vector sequences.
[0131] The choice of vector and expression control sequences to
which one of the protein family encoding sequences of the present
invention is operably linked depends directly, as is well known in
the art, on the functional properties desired (e.g., protein
expression, and the host cell to be transformed). A vector of the
present invention may be at least capable of directing the
replication or insertion into the host chromosome, and preferably
also expression, of the structural gene included in the rDNA
molecule.
[0132] Expression control elements that are used for regulating the
expression of an operably linked protein encoding sequence are
known in the art and include, but are not limited to, inducible
promoters, constitutive promoters, secretion signals, and other
regulatory elements. Preferably, the inducible promoter is readily
controlled, such as being responsive to a nutrient in the host
cell's medium.
[0133] In one embodiment, the vector containing a coding nucleic
acid molecule will include a prokaryotic replicon, i.e., a DNA
sequence having the ability to direct autonomous replication and
maintenance of the recombinant DNA molecule extra-chromosomally in
a prokaryotic host cell, such as a bacterial host cell, transformed
therewith. Such replicons are well known in the art. In addition,
vectors that include a prokaryotic replicon may also include a gene
whose expression confers a detectable marker such as a drug
resistance. Typical of bacterial drug resistance genes are those
that confer resistance to ampicillin or tetracycline.
[0134] Vectors that include a prokaryotic replicon can further
include a prokaryotic or bacteriophage promoter capable of
directing the expression (transcription and translation) of the
coding gene sequences in a bacterial host cell, such as E. coli. A
promoter is an expression control element formed by a DNA sequence
that permits binding of RNA polymerase and transcription to occur.
Promoter sequences compatible with bacterial hosts are typically
provided in plasmid vectors containing convenient restriction sites
for insertion of a DNA segment of the present invention. Examples
of such vector plasmids are pUC8, pUC9, pBR322 and pBR329 (Biorad
Laboratories), pPL and pKK223 (Pharmacia). Any suitable prokaryotic
host can be used to express a recombinant DNA molecule encoding a
protein of the invention.
[0135] Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells, can also be used
to form a rDNA molecules that contains a coding sequence.
Eukaryotic cell expression vectors are well known in the art and
are available from several commercial sources. Typically, such
vectors are provided containing convenient restriction sites for
insertion of the desired DNA segment. Examples of such vectors are
pSVL and pKSV-10 (Pharmacia), pBPV-1, pML2d (International
Biotechnologies), pTDT1 (ATCC 31255) and the like eukaryotic
expression vectors.
[0136] Eukaryotic cell expression vectors used to construct the
rDNA molecules of the present invention may further include a
selectable marker that is effective in an eukaryotic cell,
preferably a drug resistance selection marker. A preferred drug
resistance marker is the gene whose expression results in neomycin
resistance, i.e., the neomycin phosphotransferase (neo) gene.
(Southern et al., (1982) J. Mol. Anal. Genet. 1, 327-341).
Alternatively, the selectable marker can be present on a separate
plasmid, the two vectors introduced by co-transfection of the host
cell, and transfectants selected by culturing in the appropriate
drug for the selectable marker.
E. Host Cells Containing an Exogenously Supplied Coding Nucleic
Acid Molecule
[0137] The present invention further provides host cells
transformed with a nucleic acid molecule that encodes a protein of
the present invention. The host cell can be either prokaryotic or
eukaryotic. Eukaryotic cells useful for expression of a protein of
the invention are not limited, so long as the cell line is
compatible with cell culture methods and compatible with the
propagation of the expression vector and expression of the gene
product. Preferred eukaryotic host cells include, but are not
limited to, yeast, insect and mammalian cells, preferably
vertebrate cells such as those from a mouse, rat, monkey or human
cell line. Examples of useful eukaryotic host cells include Chinese
hamster ovary (CHO) cells available from the ATCC as CCL61, NIH
Swiss mouse embryo cells NIH-3T3 available from the ATCC as
CRL1658, baby hamster kidney cells (BHK), and the like eukaryotic
tissue culture cell lines.
[0138] Transformation of appropriate cell hosts with a rDNA
molecule of the present invention is accomplished by well known
methods that typically depend on the type of vector used and host
system employed. With regard to transformation of prokaryotic host
cells, electroporation and salt treatment methods can be employed
(see, for example, Sambrook et al., (1989) Molecular Cloning--A
Laboratory Manual, Cold Spring Harbor Laboratory Press; Cohen et
al., (1972) Proc. Natl. Acad. Sci. USA 69, 2110-2114). With regard
to transformation of vertebrate cells with vectors containing rDNA,
electroporation, cationic lipid or salt treatment methods can be
employed (see, for example, Graham et al., (1973) Virology 52,
456-467; Wigler et al., (1979) Proc. Natl. Acad. Sci. USA 76,
1373-1376).
[0139] Successfully transformed cells, i.e., cells that contain a
rDNA molecule of the present invention, can be identified by well
known techniques including the selection for a selectable marker.
For example, cells resulting from the introduction of an rDNA of
the present invention can be cloned to produce single colonies.
Cells from those colonies can be harvested, lysed and their DNA
content examined for the presence of the rDNA using a method such
as that described by Southern, (1975) J. Mol. Biol. 98, 503-517 or
the proteins produced from the cell assayed via an immunological
method.
F. Production of Recombinant Proteins using a rDNA Molecule
[0140] The present invention further provides methods for producing
a protein of the invention using nucleic acid molecules herein
described. In general terms, the production of a recombinant form
of a protein typically involves the following steps:
[0141] First, a nucleic acid molecule is obtained that encodes a
protein of the invention, such as the nucleic acid molecule
depicted in SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17 and 19 or
nucleotides 166-1584 of SEQ ID NO: 1 and nucleotides 178-1596 of
SEQ ID NO: 3. If the encoding sequence is uninterrupted by introns,
it is directly suitable for expression in any host.
[0142] The nucleic acid molecule is then preferably placed in
operable linkage with suitable control sequences, as described
above, to form an expression unit containing the protein open
reading frame. The expression unit is used to transform a suitable
host and the transformed host is cultured under conditions that
allow the production of the recombinant protein. Optionally the
recombinant protein is isolated from the medium or from the cells;
recovery and purification of the protein may not be necessary in
some instances where some impurities may be tolerated.
[0143] Each of the foregoing steps can be done in a variety of
ways. For example, the desired coding sequences may be obtained
from genomic fragments and used directly in appropriate hosts. The
construction of expression vectors that are operable in a variety
of hosts is accomplished using appropriate replicons and control
sequences, as set forth above. The control sequences, expression
vectors, and transformation methods are dependent on the type of
host cell used to express the gene and were discussed in detail
earlier. Suitable restriction sites can, if not normally available,
be added to the ends of the coding sequence so as to provide an
excisable gene to insert into these vectors. A skilled artisan can
readily adapt any host/expression system known in the art for use
with the nucleic acid molecules of the invention to produce
recombinant protein.
G. Methods to Identify Binding Partners
[0144] The present invention provides methods for use in isolating
and identifying binding partners of proteins of the invention. In
some embodiments, a protein of the invention is mixed with a
potential binding partner or an extract or fraction of a cell under
conditions that allow the association of potential binding partners
with the protein of the invention. After mixing, peptides,
polypeptides, proteins or other molecules that have become
associated with a protein of the invention are separated from the
mixture. The binding partner bound to the protein of the invention
can then be removed and further analyzed. To identify and isolate a
binding partner, the entire protein, for instance the entire NgR
protein of either SEQ ID NO: 2 or 4 or the entire Nogo protein of
SEQ ID NO: 6 can be used. Alternatively, a fragment of the protein
can be used.
[0145] As used herein, a cellular extract refers to a preparation
or fraction which is made from a lysed or disrupted cell. The
preferred source of cellular extracts will be cells derived from
human brain or spinal cord tissue, for instance, human cerebral
tissue. Alternatively, cellular extracts may be prepared from any
source of neuronal tissue or available neuronal cell lines,
particularly oligodendrocyte derived cell lines.
[0146] A variety of methods can be used to obtain an extract of a
cell. Cells can be disrupted using either physical or chemical
disruption methods. Examples of physical disruption methods
include, but are not limited to, sonication and mechanical
shearing. Examples of chemical lysis methods include, but are not
limited to, detergent lysis and enzyme lysis. A skilled artisan can
readily adapt methods for preparing cellular extracts in order to
obtain extracts for use in the present methods.
[0147] Once an extract of a cell is prepared, the extract is mixed
with the protein of the invention under conditions in which
association of the protein with the binding partner can occur. A
variety of conditions can be used, the most preferred being
conditions that closely resemble conditions found in the cytoplasm
of a human cell. Features such as osmolarity, pH, temperature, and
the concentration of cellular extract used, can be varied to
optimize the association of the protein with the binding
partner.
[0148] After mixing under appropriate conditions, the bound complex
is separated from the mixture. A variety of techniques can be
utilized to separate the mixture. For example, antibodies specific
to a protein of the invention can be used to immunoprecipitate the
binding partner complex. Alternatively, standard chemical
separation techniques such as chromatography and density-sediment
centrifugation can be used.
[0149] After removal of non-associated cellular constituents found
in the extract, the binding partner can be dissociated from the
complex using conventional methods. For example, dissociation can
be accomplished by altering the salt concentration or pH of the
mixture.
[0150] To aid in separating associated binding partner pairs from
the mixed extract, the protein of the invention can be immobilized
on a solid support. For example, the protein can be attached to a
nitrocellulose matrix or acrylic beads. Attachment of the protein
to a solid support aids in separating peptide-binding partner pairs
from other constituents found in the extract. The identified
binding partners can be either a single protein or a complex made
up of two or more proteins. Alternatively, binding partners may be
identified using the Alkaline Phosphatase fusion assay according to
the procedures of Flanagan & Vanderhaeghen, (1998) Annu. Rev.
Neurosci. 21, 309-345 or Takahashi et al., (1999) Cell 99, 59-69;
the Far-Western assay according to the procedures of Takayama et
al., (1997) Methods Mol. Biol. 69, 171-184 or Sauder et al., J.
Gen. Virol. (1996) 77, 991-996 or identified through the use of
epitope tagged proteins or GST fusion proteins.
[0151] Alternatively, the nucleic acid molecules of the invention
can be used in a yeast two-hybrid system. The yeast two-hybrid
system has been used to identify other protein partner pairs and
can readily be adapted to employ the nucleic acid molecules herein
described (see Stratagene Hybrizap.RTM. two-hybrid system).
H. Methods to Identify Agents that Modulate Expression
[0152] The present invention provides methods for identifying
agents that modulate the expression of a nucleic acid encoding the
Nogo receptor protein. The present invention also provides methods
for identifying agents that modulate the expression of a nucleic
acid encoding the Nogo protein. Such assays may utilize any
available means of monitoring for changes in the expression level
of the nucleic acids of the invention. As used herein, an agent is
said to modulate the expression of a nucleic acid of the invention,
for instance a nucleic acid encoding the protein having the
sequence of SEQ ID NO: 2, 4 or 6, if it is capable of up- or
down-regulating expression of the nucleic acid in a cell.
[0153] In one assay format, cell lines that contain reporter gene
fusions between the open reading frame defined by nucleotides
166-1584 of SEQ ID NO: 1, or nucleotides 178-1596 of SEQ ID NO: 3,
or nucleotides 135-3713 of SEQ ID NO: 5, and any assayable fusion
partner may be prepared. Numerous assayable fusion partners are
known and readily available, including the firefly luciferase gene
and the gene encoding chloramphenicol acetyltransferase (Alam et
al., (1990) Anal. Biochem. 188, 245-254). Cell lines containing the
reporter gene fusions are then exposed to the agent to be tested
under appropriate conditions and time. Differential expression of
the reporter gene between samples exposed to the agent and control
samples identifies agents which modulate the expression of a
nucleic acid encoding the protein having the sequence of SEQ ID NO:
2, 4 or 6.
[0154] Additional assay formats may be used to monitor the ability
of the agent to modulate the expression of a nucleic acid encoding
a Nogo receptor protein of the invention such as the protein having
the amino acid sequence of SEQ ID NO: 2 or 4 or a Nogo protein
having the amino acid sequence of SEQ ID NO: 6. For instance, mRNA
expression may be monitored directly by hybridization to the
nucleic acids of the invention. Cell lines are exposed to the agent
to be tested under appropriate conditions and time and total RNA or
mRNA is isolated by standard procedures such those disclosed in
Sambrook et al., (1989) Molecular Cloning--A Laboratory Manual,
Cold Spring Harbor Laboratory Press.
[0155] Probes to detect differences in RNA expression levels
between cells exposed to the agent and control cells may be
prepared from the nucleic acids of the invention. It is preferable,
but not necessary, to design probes which hybridize only with
target nucleic acids under conditions of high stringency. Only
highly complementary nucleic acid hybrids form under conditions of
high stringency. Accordingly, the stringency of the assay
conditions determines the amount of complementarity which should
exist between two nucleic acid strands in order to form a hybrid.
Stringency should be chosen to maximize the difference in stability
between the probe:target hybrid and potential probe:non-target
hybrids.
[0156] Probes may be designed from the nucleic acids of the
invention through methods known in the art. For instance, the G+C
content of the probe and the probe length can affect probe binding
to its target sequence. Methods to optimize probe specificity are
commonly available in Sambrook et al., (1989) Molecular Cloning--A
Laboratory Manual, Cold Spring Harbor Laboratory Press or Ausubel
et al., (1995) Current Protocols in Molecular Biology, Greene
Publishing.
[0157] Hybridization conditions are modified using known methods,
such as those described by Sambrook et al., (1989) and Ausubel et
al., (1995) as required for each probe. Hybridization of total
cellular RNA or RNA enriched for polyA+ RNA can be accomplished in
any available format. For instance, total cellular RNA or RNA
enriched for polyA+ RNA can be affixed to a solid support and the
solid support exposed to at least one probe comprising at least
one, or part of one of the sequences of the invention under
conditions in which the probe will specifically hybridize.
Alternatively, nucleic acid fragments comprising at least one, or
part of one of the sequences of the invention can be affixed to a
solid support, such as a silicon based wafer or a porous glass
wafer. The wafer can then be exposed to total cellular RNA or
polyA+ RNA from a sample under conditions in which the affixed
sequences will specifically hybridize. Such wafers and
hybridization methods are widely available, for example, those
disclosed by Beattie, (1995) WO9511755. By examining for the
ability of a given probe to specifically hybridize to a RNA sample
from an untreated cell population and from a cell population
exposed to the agent, agents which up or down regulate the
expression of a nucleic acid encoding the Nogo receptor protein
having the sequence of SEQ ID NO: 2 or 4 are identified.
[0158] Hybridization for qualitative and quantitative analysis of
mRNA may also be carried out by using a RNase Protection Assay
(i.e., RPA, see Ma et al., Methods (1996) 10, 273-238). Briefly, an
expression vehicle comprising cDNA encoding the gene product and a
phage specific DNA dependent RNA polymerase promoter (e.g., T7, T3
or SP6 RNA polymerase) is linearized at the 3' end of the cDNA
molecule, downstream from the phage promoter, wherein such a
linearized molecule is subsequently used as a template for
synthesis of a labeled antisense transcript of the cDNA by in vitro
transcription. The labeled transcript is then hybridized to a
mixture of isolated RNA (i.e., total or fractionated mRNA) by
incubation at 45.degree. C. overnight in a buffer comprising 80%
formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA. The
resulting hybrids are then digested in a buffer comprising 40 pg/ml
ribonuclease A and 2 .mu.g/ml ribonuclease. After deactivation and
extraction of extraneous proteins, the samples are loaded onto
urea-polyacrylamide gels for analysis.
[0159] In another assay format, agents which effect the expression
of the instant gene products, cells or cell lines would first be
identified which express said gene products physiologically. Cells
and cell lines so identified would be expected to comprise the
necessary cellular machinery such that the fidelity of modulation
of the transcriptional apparatus is maintained with regard to
exogenous contact of agent with appropriate surface transduction
mechanisms and the cytosolic cascades. Further, such cells or cell
lines would be transduced or transfected with an expression vehicle
(e.g., a plasmid or viral vector) construct comprising an operable
non-translated 5'-promoter containing end of the structural gene
encoding the instant gene products fused to one or more antigenic
fragments, which are peculiar to the instant gene products, wherein
said fragments are under the transcriptional control of said
promoter and are expressed as polypeptides whose molecular weight
can be distinguished from the naturally occurring polypeptides or
may further comprise an immunologically distinct tag. Such a
process is well known in the art (see, Sambrook et al., (1989)
Molecular Cloning--A Laboratory Manual, Cold Spring Harbor
Laboratory Press).
[0160] Cells or cell lines transduced or transfected as outlined
above would then be contacted with agents under appropriate
conditions; for example, the agent comprises a pharmaceutically
acceptable excipient and is contacted with cells in an aqueous
physiological buffer such as phosphate buffered saline (PBS) at
physiological pH, Eagles balanced salt solution (BSS) at
physiological pH, PBS or BSS comprising serum or conditioned media
comprising PBS or BSS and serum incubated at 37.degree. C. Said
conditions may be modulated as deemed necessary by one of skill in
the art. Subsequent to contacting the cells with the agent, said
cells will be disrupted and the polypeptides of the disruptate are
fractionated such that a polypeptide fraction is pooled and
contacted with an antibody to be further processed by immunological
assay (e.g., ELISA, immunoprecipitation or Western blot). The pool
of proteins isolated from the "agent contacted" sample will be
compared with a control sample where only the excipient is
contacted with the cells and an increase or decrease in the
immunologically generated signal from the "agent contacted" sample
compared to the control will be used to distinguish the
effectiveness of the agent.
I. Methods to Identify Agents that Modulate Activity
[0161] The present invention provides methods for identifying
agents that modulate at least one activity of a NgR protein. The
invention also provides methods for identifying agents that
modulate at least one activity of a Nogo protein. Such methods or
assays may utilize any means of monitoring or detecting the desired
activity.
[0162] In one format, the specific activity of a NgR protein or
Nogo protein, normalized to a standard unit, between a cell
population that has been exposed to the agent to be tested compared
to an un-exposed control cell population may be assayed. Cell lines
or populations are exposed to the agent to be tested under
appropriate conditions and time. Cellular lysates may be prepared
from the exposed cell line or population and a control, unexposed
cell line or population. The cellular lysates are then analyzed
with the probe.
[0163] Antibody probes can be prepared by immunizing suitable
mammalian hosts utilizing appropriate immunization protocols using
the NgR protein, Nogo protein, NgR peptide agents or immunogenic
fragments of any of the foregoing. To enhance immunogenicity, these
proteins or fragments can be conjugated to suitable carriers.
Methods for preparing immunogenic conjugates with carriers such as
BSA, KLH or other carrier proteins are well known in the art. In
some circumstances, direct conjugation using, for example,
carbodiimide reagents may be effective; in other instances linking
reagents such as those supplied by Pierce Chemical Co. may be
desirable to provide accessibility to the hapten. The hapten
peptides can be extended at either the amino or carboxy terminus
with a cysteine residue or interspersed with cysteine residues, for
example, to facilitate linking to a carrier. Administration of the
immunogens is conducted generally by injection over a suitable time
period and with use of suitable adjuvants, as is generally
understood in the art. During the immunization schedule, titers of
antibodies are taken to determine adequacy of antibody
formation.
[0164] While the polyclonal antisera produced in this way may be
satisfactory for some applications, for pharmaceutical
compositions, use of monoclonal preparations is preferred.
Immortalized cell lines which secrete the desired monoclonal
antibodies may be prepared using standard methods, see e.g., Kohler
& Milstein, (1992) Biotechnology 24, 524-526 or modifications
which effect immortalization of lymphocytes or spleen cells, as is
generally known. The immortalized cell lines secreting the desired
antibodies can be screened by immunoassay in which the antigen is
the peptide hapten, polypeptide or protein. When the appropriate
immortalized cell culture secreting the desired antibody is
identified, the cells can be cultured either in vitro or by
production in ascites fluid.
[0165] The desired monoclonal antibodies may be recovered from the
culture supernatant or from the ascites supernatant. The intact
anti-Nogo or anti-NgR antibodies or fragments thereof can be used
as e.g., antagonists of binding between Nogo (ligand) and a NgR.
Use of immunologically reactive fragments, such as the Fab, Fab' of
F(ab')2 fragments is often preferable, especially in a therapeutic
context, as these fragments are generally less immunogenic than the
whole immunoglobulin.
[0166] The antibodies or fragments may also be produced, using
current technology, by recombinant means. Antibody regions that
bind specifically to the desired regions of the protein can also be
produced in the context of chimeras with multiple species origin,
for instance, humanized antibodies.
[0167] The antibody can therefore be a humanized antibody or human
a antibody, see. e.g., in U.S. Pat. No. 5,585,089 or Riechmann et
al., (1988) Nature 332, 323-327.
[0168] Agents that are assayed in the above method can be randomly
selected or rationally selected or designed. As used herein, an
agent is said to be randomly selected when the agent is chosen
randomly without considering the specific sequences involved in the
association of the a protein of the invention alone or with its
associated substrates, binding partners, etc. An example of
randomly selected agents is the use a chemical library or a peptide
combinatorial library, or a growth broth of an organism.
[0169] As used herein, an agent is said to be rationally selected
or designed when the agent is chosen on a non-random basis which
takes into account the sequence of the target site or its
conformation in connection with the agent's action. Agents can be
rationally selected or rationally designed by utilizing the peptide
sequences that make up these sites. For example, a rationally
selected peptide agent can be a peptide whose amino acid sequence
is identical to the binding domain (SEQ ID NO: 20) of Nogo which
interacts with the NgR. Alternatively, it can be a fragment of the
binding domain, e.g., SEQ ID NO: 8, 10, 12, 14, 16 and 18.
[0170] The agents of the present invention can be, as examples,
peptides, antibodies, antibody fragments, small molecules, vitamin
derivatives, as well as carbohydrates. Peptide agents of the
invention can be prepared using standard solid phase (or solution
phase) peptide synthesis methods, as is known in the art. In
addition, the DNA encoding these peptides may be synthesized using
commercially available oligonucleotide synthesis instrumentation
and produced recombinantly using standard recombinant production
systems. The production using solid phase peptide synthesis is
necessitated if non-gene-encoded amino acids are to be
included.
[0171] Another class of agents of the present invention are
antibodies or fragments thereof that bind to a Nogo protein or NgR
protein. Antibody agents can be obtained by immunization of
suitable mammalian subjects with peptides, containing as antigenic
regions, those portions of the protein intended to be targeted by
the antibodies.
J. High Throughput Assays
[0172] The power of high throughput screening is utilized to the
search for new compounds which are capable of interacting with the
NgR protein. For general information on high-throughput screening
(e.g., Devlin, (1998) High Throughput Screening, Marcel Dekker;
U.S. Pat. No. 5,763,263). High throughput assays utilize one or
more different assay techniques.
[0173] Immunodiagnostics and Immunoassays. These are a group of
techniques used for the measurement of specific biochemical
substances, commonly at low concentrations in complex mixtures such
as biological fluids, that depend upon the specificity and high
affinity shown by suitably prepared and selected antibodies for
their complementary antigens. A substance to be measures must, of
necessity, be antigenic either an immunogenic macromolecule or a
haptenic small molecule. To each sample a known, limited amount of
specific antibody is added and the fraction of the antigen
combining with it, often expressed as the bound:free ratio, is
estimated, using as indicator a form of the antigen labeled with
radioisotope (radioimmunoassay), fluorescent molecule
(fluoroimmunoassay), stable free radical (spin immunoassay), enzyme
(enzyme immunoassay), or other readily distinguishable label.
[0174] Antibodies can be labeled in various ways, including:
enzyme-linked immunosorbent assay (ELISA); radioimmuno-assay (RIA);
fluorescent immunoassay (FIA); chemiluminescent immunoassay (CLIA);
and labeling the antibody with colloidal gold particles
(immuNogold).
[0175] Common assay formats include the sandwich assay, competitive
or competition assay, latex agglutination assay, homogeneous assay,
microtitre plate format and the microparticle-based assay.
[0176] Enzyme-linked immunosorbent assay (ELISA). ELISA is an
immunochemical technique that avoids the hazards of radiochemicals
and the expense of fluorescence detection systems. Instead, the
assay uses enzymes as indicators. ELISA is a form of quantitative
immunoassay based on the use of antibodies (or antigens) that are
linked to an insoluble carrier surface, which is then used to
"capture" the relevant antigen (or antibody) in the test solution.
The antigen-antibody complex is then detected by measuring the
activity of an appropriate enzyme that had previously been
covalently attached to the antigen (or antibody).
[0177] For information on ELISA techniques, see, for example,
Crowther, (1995) ELISA--Theory and Practice (Methods in Molecular
Biology), Humana Press; Challacombe & Kemeny, (1998) ELISA and
Other Solid Phase Immunoassays--Theoretical and Practical Aspects,
John Wiley; Kemeny, (1991) A Practical Guide to ELISA, Pergamon
Press; Ishikawa, (1991) Ultrasensitive and Rapid Enzyme Immunoassay
(Laboratory Techniques in Biochemistry and Molecular Biology)
Elsevier.
[0178] Colorimetric Assays for Enzymes. Colorimetry is any method
of quantitative chemical analysis in which the concentration or
amount of a compound is determined by comparing the color produced
by the reaction of a reagent with both standard and test amounts of
the compound, e.g., using a colorimeter or a spectrophotometer.
[0179] Standard colorimetric assays of beta-galactosidase enzymatic
activity are well known to those skilled in the art (see, for
example, Norton et al., (1985) Mol. Cell. Biol. 5, 281-290). A
calorimetric assay can be performed on whole cell lysates using
O-nitrophenyl-beta-D-galactopyranoside (ONPG, Sigma) as the
substrate in a standard calorimetric beta-galactosidase assay
(Sambrook et al., (1989) Molecular Cloning--A Laboratory Manual,
Cold Spring Harbor Laboratory Press. Automated calorimetric assays
are also available for the detection of beta-galactosidase activity
(see e.g., U.S. Pat. No. 5,733,720).
[0180] Immunofluorescence Assays. Immunofluorescence or
immunofluorescence microscopy is a technique in which an antigen or
antibody is made fluorescent by conjugation to a fluorescent dye
and then allowed to react with the complementary antibody or
antigen in a tissue section or smear. The location of the antigen
or antibody can then be determined by observing the fluorescence by
microscopy under ultraviolet light.
[0181] For general information on immunofluorescent techniques,
see, for example, Knapp et al., (1978) Immunofluorescence and
Related Staining Techniques, Elsevier; Allan, (1999) Protein
Localization by Fluorescent Microscopy--A Practical Approach (The
Practical Approach Series) Oxford University Press; Caul, (1993)
Immunofluorescence Antigen Detection Techniques in Diagnostic
Microbiology, Cambridge University Press. For detailed explanations
of immunofluorescent techniques applicable to the present
invention, see U.S. Pat. No. 5,912,176; U.S. Pat. No. 5,869,264;
U.S. Pat. No. 5,866,319; and U.S. Pat. No. 5,861,259.
K. Uses for Agents that Modulate Activity
[0182] As provided in the Examples, the Nogo and NgR proteins and
nucleic acids, such as the proteins having the amino acid sequence
of SEQ ID NO: 2, 4 or 6, are expressed in myelin derived from axon
and dendrites. Agents that modulate or up- or down-regulate the
expression of the Nogo or NgR protein or agents such as agonists or
antagonists of at least one activity of the Nogo or NgR protein may
be used to modulate biological and pathologic processes associated
with the protein's function and activity. The invention is
particularly useful in the treatment of human subjects.
Pathological processes refer to a category of biological processes
which produce a deleterious effect. For example, expression of a
protein of the invention may be associated with inhibition of
axonal regeneration following cranial, cerebral or spinal trauma,
stroke or a demyelinating disease. Such demyelinating diseases
include, but are not limited to, multiple sclerosis, monophasic
demyelination, encephalomyelitis, multifocal leukoencephalopathy,
panencephalitis, Marchiafava-Bignami disease, pontine myelinolysis,
adrenoleukodystrophy, Pelizaeus-Merzbacher disease, Spongy
degeneration, Alexander's disease, Canavan's disease, metachromatic
leukodystrophy and Krabbe's disease. As used herein, an agent is
said to modulate a pathological process when the agent reduces the
degree or severity of the process. For instance, a demyelinating
disease may be prevented or disease progression modulated by the
administration of agents which reduce, promote or modulate in some
way the expression or at least one activity of a protein of the
invention.
[0183] In one example, administration of the Nogo peptide agents
depicted in SEQ ID NO: 8, 10, 12, 14, 16, 18 and 20 can be used to
treat a demyelinating disease associated with Nogo or the NgR
protein. In another example, cells which express the peptide agents
of the invention may be transplanted to a site spinal cord injury
to facilitate axonal growth throughout the injured site. Such
transplanted cells would provide a means for restoring spinal cord
function following injury or trauma.
[0184] In yet another example, administration of soluble NgR
protein that binds to Nogo can be used to treat a demyelinating
disease associated with Nogo or the NgR protein. This agent can be
used to prevent the binding of Nogo to cell bound NgR and act as an
antagonist of Nogo. Soluble receptors have been used to bind
cytokines or other ligands to regulate their function (Thomson,
(1998) Cytokine Handbook, Academic Press). A soluble receptor
occurs in solution, or outside of the membrane. Soluble receptors
may occur because the segment of the molecule which spans or
associates with the membrane is absent. This segment is commonly
referred to in the art as the transmembrane domain of the gene, or
membrane binding segment of the protein. Thus, in some embodiments
of the invention, a soluble receptor includes a fragment or an
analog of a membrane bound receptor. Preferably, the fragment
contains at least six, e.g., ten, fifteen, twenty, twenty-five,
thirty, forty, fifty, sixty, or seventy amino acids, provided it
retains its desired activity.
[0185] In other embodiments of the invention, the structure of the
segment that associates with the membrane is modified (e.g., DNA
sequence polymorphism or mutation in the gene) so the receptor is
not tethered to the membrane, or the receptor is inserted, but is
not retained within the membrane. Thus, a soluble receptor, in
contrast to the corresponding membrane bound form, differs in one
or more segments of the gene or receptor protein that are important
to its association with the membrane.
[0186] The agents of the present invention can be provided alone,
or in combination, or in sequential combination with other agents
that modulate a particular pathological process. For example, an
agent of the present invention can be administered in combination
with anti-inflammatory agents following stroke as a means for
blocking further neuronal damage and inhibition of axonal
regeneration. As used herein, two agents are said to be
administered in combination when the two agents are administered
simultaneously or are administered independently in a fashion such
that the agents will act at the same time.
[0187] The agents of the present invention can be administered via
parenteral, subcutaneous, intravenous, intramuscular,
intraperitoneal, transdermal, or buccal routes. For example, an
agent may be administered locally to a site of injury via
microinfusion. Typical sites include, but are not limited to,
damaged areas of the spinal cord resulting from injury or damaged
sites in the brain resulting from a stroke. Alternatively, or
concurrently, administration may be by the oral route. The dosage
administered will be dependent upon the age, health, and weight of
the recipient, kind of concurrent treatment, if any, frequency of
treatment, and the nature of the effect desired.
[0188] The present invention further provides compositions
containing one or more agents which modulate expression or at least
one activity of a protein of the invention. While individual needs
vary, determination of optimal ranges of effective amounts of each
component is within the skill of the art. Typical dosages comprise
1 pg/kg to 100 mg/kg body weight. The preferred dosages for
systemic administration comprise 100 ng/kg to 100 mg/kg body
weight. The preferred dosages for direct administration to a site
via microinfusion comprise 1 ng/kg to 1 .mu.g/kg body weight.
[0189] In addition to the pharmacologically active agent, the
compositions of the present invention may contain suitable
pharmaceutically acceptable carriers comprising excipients and
auxiliaries which facilitate processing of the active compounds
into preparations which can be used pharmaceutically for delivery
to the site of action. Suitable formulations for parenteral
administration include aqueous solutions of the active compounds in
water-soluble form, for example, water-soluble salts. In addition,
suspensions of the active compounds as appropriate oily injection
suspensions may be administered. Suitable lipophilic solvents or
vehicles include fatty oils, for example, sesame oil, or synthetic
fatty acid esters, for example, ethyl oleate or triglycerides.
Aqueous injection suspensions may contain substances which increase
the viscosity of the suspension include, for example, sodium
carboxymethyl cellulose, sorbitol and dextran. Optionally, the
suspension may also contain stabilizers. Liposomes can also be used
to encapsulate the agent for delivery into the cell.
[0190] The pharmaceutical formulation for systemic administration
according to the invention may be formulated for enteral,
parenteral or topical administration. Indeed, all three types of
formulations may be used simultaneously to achieve systemic
administration of the active ingredient. Suitable formulations for
oral administration include hard or soft gelatin capsules, pills,
tablets, including coated tablets, elixirs, suspensions, syrups or
inhalations and controlled release forms thereof.
[0191] In practicing the methods of this invention, the agents of
this invention may be used alone or in combination, or in
combination with other therapeutic or diagnostic agents. In certain
preferred embodiments, the compounds of this invention may be
co-administered along with other compounds typically prescribed for
these conditions according to generally accepted medical practice,
such as anti-inflammatory agents, anticoagulants, antithrombotics,
including platelet aggregation inhibitors, tissue plasminogen
activators, urokinase, prourokinase, streptokinase, aspirin and
heparin. The compounds of this invention can be utilized in vivo,
ordinarily in mammals, such as humans, sheep, horses, cattle, pigs,
dogs, cats, rats and mice, or in vitro.
L. Peptide Mimetics.
[0192] This invention also includes peptide mimetics which mimic
the three-dimensional structure of Nogo and block Nogo binding at
the NgR. Such peptide mimetics may have significant advantages over
naturally-occurring peptides, including, for example: more
economical production, greater chemical stability, enhanced
pharmacological properties (half-life, absorption, potency,
efficacy, etc.), altered specificity (e.g., a broad-spectrum of
biological activities), reduced antigenicity, and others.
[0193] In one form, mimetics are peptide-containing molecules that
mimic elements of protein secondary structure. (see, for example,
Johnson et al., (1993) Peptide Turn Mimetics, in Biotechnology and
Pharmacy, Pezzuto et al., (editors) Chapman and Hall). The
underlying rationale behind the use of peptide mimetics is that the
peptide backbone of proteins exists chiefly to orient amino acid
side chains in such a way as to facilitate molecular interactions,
such as those of antibody and antigen. A peptide mimetic is
expected to permit molecular interactions similar to the natural
molecule.
[0194] In another form, peptide analogs are commonly used in the
pharmaceutical industry as non-peptide drugs with properties
analogous to those of the template peptide. These types of
non-peptide compounds are also referred to as "peptide mimetics" or
"peptidomimetics" (Fauchere, (1986) Adv. Drug Res. 15, 29-69; Veber
& Freidinger, (1985) Trends Neurosci. 8, 392-396; Evans et al.,
(1987) J. Med. Chem. 30, 1229-1239, which are incorporated herein
by reference) and are usually developed with the aid of
computerized molecular modeling.
[0195] Peptide mimetics that are structurally similar to
therapeutically useful peptides may be used to produce an
equivalent therapeutic or prophylactic effect. Generally, peptide
mimetics are structurally similar to a paradigm polypeptide (i.e.,
a polypeptide that has a biochemical property or pharmacological
activity), such as the extracellular domain of Nogo, but have one
or more peptide linkages optionally replaced by a linkage selected
from the group consisting of: --CH.sub.2NH--, --CH.sub.2S--,
--CH.sub.2--CH.sub.2--, --CH.dbd.CH-- (cis and trans), --COCH2-,
--CH(OH)CH2- and --CH2SO--, by methods known in the art and further
described in the following references; Weinstein, (1983) Chemistry
and Biochemistry of Amino Acids, Peptides and Proteins, Marcel
Dekker; Morley, (1980) Trends Pharmacol. Sci. 1, 463-468 (general
review); Hudson et al., (1979) Int. J. Pept. Protein Res. 14,
177-185 (--CH2NH--, CH2CH2-); Spatola et al., (1986) Life Sci. 38,
1243-1249 (--CH2-S); Hann, (1982) J. Chem. Soc. Perkin Trans. 1,
307-314 (--CH--CH--, cis and trans); Almquist et al., (1980) J.
Med. Chem. 23, 1392-1398 (--COCH2-); Jennings-White et al., (1982)
Tetrahedron Lett. 23, 2533 (--COCH2-); Holladay et al., (1983)
Tetrahedron Lett. 24, 4401-4404 (--C(OH)CH2-); and Hruby, (1982)
Life Sci. 31, 189-199 (--CH2S--); each of which is incorporated
herein by reference.
[0196] Labeling of peptide mimetics usually involves covalent
attachment of one or more labels, directly or through a spacer
(e.g., an amide group), to non-interfering position(s) on the
peptide mimetic that are predicted by quantitative
structure-activity data and molecular modeling. Such
non-interfering positions generally are positions that do not form
direct contacts with the macromolecule(s) (e.g., are not contact
points in Nogo-NgR complexes) to which the peptide mimetic binds to
produce the therapeutic effect. Derivitization (e.g., labeling) of
peptide mimetics should not substantially interfere with the
desired biological or pharmacological activity of the peptide
mimetic.
[0197] Nogo peptide mimetics can be constructed by structure-based
drug design through replacement of amino acids by organic moieties
(see, for example, Hughes, (1980) Philos. Trans. R. Soc. Lond. 290,
387-394; Hodgson, (1991) Biotechnol. 9, 19-21; Suckling, (1991)
Sci. Prog. 75, 323-359).
[0198] The use of peptide mimetics can be enhanced through the use
of combinatorial chemistry to create drug libraries. The design of
peptide mimetics can be aided by identifying amino acid mutations
that increase or decrease binding of Nogo at the NgR. Approaches
that can be used include the yeast two hybrid method (see Chien et
al., (1991) Proc. Natl. Acad. Sci. USA 88, 9578-9582) and using the
phage display method. The two hybrid method detects protein-protein
interactions in yeast (Fields et al., (1989) Nature 340, 245-246).
The phage display method detects the interaction between an
immobilized protein and a protein that is expressed on the surface
of phages such as lambda and M13 (Amberg et al., (1993) Strategies
6, 24; Hogrefe et al., (1993) Gene 128, 119-126). These methods
allow positive and negative selection for protein-protein
interactions and the identification of the sequences that determine
these interactions.
[0199] For general information on peptide synthesis and peptide
mimetics, see, for example; Jones, (1992) Amino Acid and Peptide
Synthesis, Oxford University Press; Jung, (1997) Combinatorial
Peptide and Nonpeptide Libraries: A Handbook, John Wiley; Bodanszky
et al., (1993) Peptide Chemistry--A Practical Textbook, Springer
Verlag.
M. Transgenic Animals
[0200] The term "animal" as used herein includes all vertebrate
animals, except humans. It also includes an individual animal in
all stages of development, including embryonic and fetal stages. A
"transgenic animal" is an animal containing one or more cells
bearing genetic information received, directly or indirectly, by
deliberate genetic manipulation at a subcellular level, such as by
microinjection or infection with recombinant virus. This introduced
DNA molecule may be integrated within a chromosome, or it may be
extra-chromosomally replicating DNA. The term "germ cell-line
transgenic animal" refers to a transgenic animal in which the
genetic information was introduced into a germ line cell, thereby
conferring the ability to transfer the information to offspring. If
such offspring in fact possess some or all of that information,
then they, too, are transgenic animals. Transgenic animals
containing mutant, knock-out, modified genes or gene constructs to
over-express or conditionally express a polypeptide encoded by the
cDNA sequences of SEQ ID NO: 1 or 3 or related sequences are
encompassed in the invention.
[0201] The information may be foreign to the species of animal to
which the recipient belongs, foreign only to the particular
individual recipient, or genetic information already possessed by
the recipient. In the last case, the introduced gene may be
differently expressed compared to the native endogenous gene. The
genes may be obtained by isolating them from genomic sources, by
preparation of cDNA from isolated RNA templates, by directed
synthesis, or by some combination thereof.
[0202] To be expressed, a coding sequence should be operably linked
to a regulatory region. Regulatory regions, such as promoters, may
be used to increase, decrease, regulate or designate to certain
tissues or to certain stages of development the expression of a
gene. The promoter need not be a naturally occurring promoter. The
"transgenic non-human animals" of the invention are produced by
introducing "transgenes" into the germline of the non-human animal.
The methods enabling the introduction of DNA into cells are
generally available and well-known in the art. Different methods of
introducing transgenes could be used. Generally, the zygote is the
best target for microinjection. In the mouse, the male pronucleus
reaches the size of approximately twenty microns in diameter, which
allows reproducible injection of one to two picoliters of DNA
solution. The use of zygotes as a target for gene transfer has a
major advantage. In most cases, the injected DNA will be
incorporated into the host gene before the first cleavage (Brinster
et al., (1985) Proc. Natl. Acad. Sci. USA 82, 4438-4442).
Consequently, nearly all cells of the transgenic non-human animal
will carry the incorporated transgene. Generally, this will also
result in the efficient transmission of the transgene to offspring
of the founder since 50% of the germ cells will harbor the
transgene. Microinjection of zygotes is a preferred method for
incorporating transgenes in practicing the invention.
[0203] Retroviral infection can also be used to introduce a
transgene into a non-human animal. The developing non-human embryo
can be cultured in vitro to the blastocyst stage. During this time,
blastomeres may be targets for retroviral infection. Efficient
infection of the blastomeres is obtained by enzymatic treatment to
remove the zona pellucida. The viral vector system used to
introduce the transgene is typically a replication-defective
retrovirus carrying the transgene (Jahner et al., (1985) Proc.
Natl. Acad. Sci. USA 82, 6927-6931; Van der Putten et al., (1985)
Proc. Natl. Acad. Sci. USA 82, 6148-6152). Transfection is easily
and efficiently obtained by culturing the blastomeres on a
monolayer of virus-producing cells (Van der Putten et al., (1985)
Proc. Natl. Acad. Sci. USA 82, 6148-6152; Stewart et al., (1987)
EMBO J. 6, 383-388). Alternatively, infection can be performed at a
later stage. Virus or virus-producing cells can be injected into
the blastocoele (Jahner et al., (1982) Nature 298, 623-628). Most
of the founder animals will be mosaic for the transgene since
incorporation occurs only in a subset of the cells which formed the
transgenic non-human animal. Furthermore, the founder animal may
contain retroviral insertions of the transgene at a variety of
positions in the genome; these generally segregate in the
offspring. In addition, it is also possible to introduce transgenes
into the germ line, albeit with low efficiency, by intrauterine
retroviral infection of the midgestation embryo (Jahner et al.,
(1982) Nature 298, 623-628).
[0204] A third type of target cell for transgene introduction is
the embryonal stem cell (ES). ES cells are obtained from
pre-implantation embryos cultured in vitro (Evans et al., (1981)
Nature 292, 154-156; Bradley et al., (1984) Nature 309, 255-256;
Gossler et al., (1986) Proc. Natl. Acad. Sci. USA 83, 9065-9069).
Transgenes can be efficiently introduced into ES cells by DNA
transfection or by retrovirus-mediated transduction. The resulting
transformed ES cells can thereafter be combined with blastocysts
from a non-human animal. The ES cells colonize the embryo and
contribute to the germ line of the resulting chimeric animal.
[0205] The methods for evaluating the presence of the introduced
DNA as well as its expression are readily available and well-known
in the art. Such methods include, but are not limited to DNA
(Southern) hybridization to detect the exogenous DNA, polymerase
chain reaction (PCR), polyacrylamide gel electrophoresis (PAGE) and
Western blots to detect DNA, RNA and protein. The methods include
immunological and histochemical techniques to detect expression of
a NgR gene.
[0206] As used herein, a "transgene" is a DNA sequence introduced
into the germline of a non-human animal by way of human
intervention such as by way of the Examples described below. The
nucleic acid sequence of the transgene, in this case a form of SEQ
ID NO: 1 or 3, may be integrated either at a locus of a genome
where that particular nucleic acid sequence is not otherwise
normally found or at the normal locus for the transgene. The
transgene may consist of nucleic acid sequences derived from the
genome of the same species or of a different species than the
species of the target animal. For example, axonal regeneration in
mice lacking Nogo can be compared with that in mice lacking MAG or
both MAG and Nogo. To determine if the effect of the anti-Nogo
antibody is due to Nogo blockade, antibody effects can be studied
in animals lacking Nogo expression.
[0207] As discussed above, a nucleic acid of the invention can be
transfected into a host cell using a vector. Preferred vectors are
plasmids and viral vectors, such as retroviruses. Viral vectors may
be used to produce a transgenic animal according to the invention.
Preferably, the viral vectors are replication defective, that is,
they are unable to replicate autonomously in the target cell. In
general, the genome of the replication defective viral vectors
which are used within the scope of the present invention lack at
least one region which is necessary for the replication of the
virus in the infected cell. These regions can either be eliminated
(in whole or in part), or be rendered non-functional by any
technique known to a person skilled in the art. These techniques
include the total removal, substitution (by other sequences, in
particular by the inserted nucleic acid), partial deletion or
addition of one or more bases to an essential (for replication)
region. Such techniques may be performed in vitro (on the isolated
DNA) or in situ, using the techniques of genetic manipulation or by
treatment with mutagenic agents.
[0208] Preferably, the replication defective virus retains the
sequences of its genome which are necessary for encapsidating the
viral particles. The retroviruses are integrating viruses which
infect dividing cells. The retrovirus genome includes two LTRs, an
encapsidation sequence and three coding regions (gag, pol and env).
The construction of recombinant retroviral vectors has been
described (see, for example, Bernstein et al., (1985) Genet. Eng.
7, 235; McCormick, (1985) Biotechnol. 3, 689-691). In recombinant
retroviral vectors, the gag, pol and env genes are generally
deleted, in whole or in part, and replaced with a heterologous
nucleotide sequence of interest. These vectors can be constructed
from different types of retrovirus, such as, HIV, MoMuLV (murine
Moloney leukemia virus), MSV (murine Moloney sarcoma virus), HaSV
(Harvey sarcoma virus); SNV (spleen necrosis virus); RSV (Rous
sarcoma virus) and Friend virus.
[0209] In general, in order to construct recombinant retroviruses
containing a nucleotide sequence, a plasmid is constructed which
contains the LTRs, the encapsidation sequence and the coding
sequence. This construct is used to transfect a packaging cell
line, which cell line is able to supply in trans the retroviral
functions which are deficient in the plasmid. In general, the
packaging cell lines are thus able to express the gag, pol and env
genes. Such packaging cell lines have been described in the prior
art, in particular the cell line PA317 (U.S. Pat. No. 4,861,719);
the PsiCRIP cell line (WO9002806) and the GP+envAm-12 cell line
(WO8907150). In addition, the recombinant retroviral vectors can
contain modifications within the LTRs for suppressing
transcriptional activity as well as extensive encapsidation
sequences which may include a part of the gag gene (Bender et al.,
(1987) J. Virol. 61, 1639-1646). Recombinant retroviral vectors are
purified by standard techniques known to those having ordinary
skill in the art.
[0210] In one aspect the nucleic acid encodes antisense RNA
molecules. In this embodiment, the nucleic acid is operably linked
to suitable regulatory regions (discussed above) enabling
expression of the nucleotide sequence, and is introduced into a
cell utilizing, preferably, recombinant vector constructs, which
will express the antisense nucleic acid once the vector is
introduced into the cell. Examples of suitable vectors includes
plasmids, adenoviruses, adeno-associated viruses (see, for example,
U.S. Pat. No. 4,797,368, U.S. Pat. No. 5,139,941), retroviruses
(see above), and herpes viruses. For delivery of a therapeutic gene
the vector is preferably an adeno-associated virus.
[0211] Adenoviruses are eukaryotic DNA viruses that can be modified
to efficiently deliver a nucleic acid of the invention to a variety
of cell types. Various serotypes of adenovirus exist. Of these
serotypes, preference is given, within the scope of the present
invention, to using type two or type five human adenoviruses (Ad 2
or Ad 5) or adenoviruses of animal origin (see WO9426914). Those
adenoviruses of animal origin which can be used within the scope of
the present invention include adenoviruses of canine, bovine,
murine, ovine, porcine, avian, and simian origin.
[0212] The replication defective recombinant adenoviruses according
to the invention can be prepared by any technique known to the
person skilled in the art. In particular, they can be prepared by
homologous recombination between an adenovirus and a plasmid which
carries, inter alia, the DNA sequence of interest. The homologous
recombination is effected following cotransfection of the said
adenovirus and plasmid into an appropriate cell line. The cell line
which is employed should preferably (i) be transformable by the
said elements, and (ii) contain the sequences which are able to
complement the part of the genome of the replication defective
adenovirus, preferably in integrated form in order to avoid the
risks of recombination. Recombinant adenoviruses are recovered and
purified using standard molecular biological techniques, which are
well known to one of ordinary skill in the art.
[0213] A number of recombinant or transgenic mice have been
produced, including those which express an activated oncogene
sequence (U.S. Pat. No. 4,736,866); express Simian SV 40 T-antigen
(U.S. Pat. No. 5,728,915); lack the expression of interferon
regulatory factor 1 (IRF-1) (U.S. Pat. No. 5,731,490); exhibit
dopaminergic dysfunction (U.S. Pat. No. 5,723,719); express at
least one human gene which participates in blood pressure control
(U.S. Pat. No. 5,731,489); display greater similarity to the
conditions existing in naturally occurring Alzheimer's disease
(U.S. Pat. No. 5,720,936); have a reduced capacity to mediate
cellular adhesion (U.S. Pat. No. 5,602,307); possess a bovine
growth hormone gene (Clutter et al., (1996) Genetics 143,
1753-1760) or are capable of generating a fully human antibody
response (Zou et al., (1993) Science 262, 1271-1274).
[0214] While mice and rats remain the animals of choice for most
transgenic experimentation, in some instances it is preferable or
even necessary to use alternative animal species. Transgenic
procedures have been successfully utilized in a variety of
non-murine animals, including sheep, goats, chickens, hamsters,
rabbits, cows and guinea pigs (see Aigner et al., (1999) Biochem.
Biophys. Res. Commun. 257, 843-850; Castro et al., (1999) Genet.
Anal. 15, 179-187; Brink et al., (2000) Theriogenology 53, 139-148;
Colman, (1999) Genet. Anal. 15, 167-173; Eyestone, (1999)
Theriogenology 51, 509-517; Baguisi et al., (1999) Nat. Biotechnol.
17, 456-461; Prather et al., (1999) Theriogenology 51, 487-498;
Pain et al., (1999) Cells Tissues Organs 165, 212-219; Fernandez et
al., (1999) Indian J. Exp. Biol. 37, 1085-1092; U.S. Pat. No.
5,908,969; U.S. Pat. No. 5,792,902; U.S. Pat. No. 5,892,070; U.S.
Pat. No. 6,025,540).
N. Diagnostic Methods
[0215] One means of diagnosing a demyelinating disease using the
nucleic acid molecules or proteins of the invention involves
obtaining a tissue sample from living subjects. Obtaining tissue
samples from living sources is problematic for tissues such as
those of the central nervous system. In patients suffering from a
demyelinating disease, tissue samples for diagnostic methods may be
obtained by less invasive procedures. For example, samples may be
obtained from whole blood and serum.
[0216] The use of molecular biological tools has become routine in
forensic technology. For example, nucleic acid probes may be used
to determine the expression of a nucleic acid molecule comprising
all or at least part of the sequences of SEQ ID NO: 1 in forensic
pathology specimens. Further, nucleic acid assays may be carried
out by any means of conducting a transcriptional profiling
analysis. In addition to nucleic acid analysis, forensic methods of
the invention may target the protein encoded by SEQ ID NO: 1 to
determine up- or down-regulation of the genes (Shiverick et al.,
(1975) Biochim. Biophys. Acta 393, 124-133).
[0217] Methods of the invention may involve treatment of tissues
with collagenases or other proteases to make the tissue amenable to
cell lysis (Semenov et al., (1987) Biull. Eksp. Biol. Med. 104,
113-116). Further, it is possible to obtain biopsy samples from
different regions of the brain for analysis.
[0218] Assays to detect nucleic acid or protein molecules of the
invention may be in any available format. Typical assays for
nucleic acid molecules include hybridization or PCR based formats.
Typical assays for the detection of proteins, polypeptides or
peptides of the invention include the use of antibody probes in any
available format such as in situ binding assays, etc. See Harlow
& Lane, (1988) Antibodies--A Laboratory Manual, Cold Spring
Harbor Laboratory Press. In preferred embodiments, assays are
carried out with appropriate controls.
[0219] A Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the compounds
of the present invention and practice the claimed methods. The
following working examples therefore, specifically point out
preferred embodiments of the present invention, and are not to be
construed as limiting in any way the remainder of the
disclosure.
TABLE-US-00002 Key for Sequence Listing SEQ ID NO: Description SEQ
ID NO: 1 human NgR nucleotide sequence SEQ ID NO: 2 human NgR amino
acid sequence SEQ ID NO: 3 mouse NgR nucleotide sequence SEQ ID NO:
4 mouse NgR amino acid sequence SEQ ID NO: 5 human NogoA nucleotide
sequence SEQ ID NO: 6 human NogoA amino acid sequence SEQ ID NO: 7
a nucleotide sequence coding for amino acid residues #1054-1078 of
a human NogoA SEQ ID NO: 8 amino acid residues #1064-1088 of human
NogoA SEQ ID NO: 9 a nucleotide sequence coding for amino acid
residues #1064-1088 of a human NogoA SEQ ID NO: 10 amino acid
residues #1064-1088 of human NogoA SEQ ID NO: 11 a nucleotide
sequence coding for amino acid residues #1064-1088 of a human NogoA
SEQ ID NO: 12 amino acid residues #1064-1088 of a human NogoA SEQ
ID NO: 13 a nucleotide sequence coding for amino acid residues
#1084-1108 of a human NogoA SEQ ID NO: 14 amino acid residues
#1084-1108 of a human NogoA SEQ ID NO: 15 a nucleotide sequence
coding for amino acid residues #1095-1119 of a human NogoA SEQ ID
NO: 16 amino acid residues #1095-1119 of a human NogoA SEQ ID NO:
17 a nucleotide sequence coding for amino acid residues #1055-1094
of a human NogoA SEQ ID NO: 18 amino acid residues #1055-1094 of a
human NogoA SEQ ID NO: 19 a nucleotide sequence coding for amino
acid residues #1054-1119 of a human NogoA SEQ ID NO: 20 amino acid
residues #1054-1119 of a human NogoA SEQ ID NO: 21 a nucleotide
sequence coding for amino acid residues #1055-1120 of a human NogoA
SEQ ID NO: 22 amino acid residues #1055-1120 of a human NogoA SEQ
ID NO: 23 a nucleotide sequence coding for amino acid residues
#1055-1079 of a human NogoA SEQ ID NO: 24 amino acid residues
#1055-1079 of a human NogoA SEQ ID NO: 25 a nucleotide sequence
coding for amino acid residues #1055-1084 of a human NogoA SEQ ID
NO: 26 amino acid residues #1055-1084 of a human NogoA SEQ ID NO:
27 a nucleotide sequence coding for amino acid residues #1055-1089
of a human NogoA SEQ ID NO: 28 amino acid residues #1055-1089 of a
human NogoA SEQ ID NO: 29 a nucleotide sequence coding for amino
acid residues #1060-1094 of a human NogoA SEQ ID NO: 30 amino acid
residues #1060-1094 of a human NogoA SEQ ID NO: 31 a nucleotide
sequence coding for amino acid residues #1065-1094 of a human NogoA
SEQ ID NO: 32 amino acid residues #1065-1094 of a human NogoA SEQ
ID NO: 33 a nucleotide sequence coding for amino acid residues
#1070-1084 of a human NogoA SEQ ID NO: 34 amino acid residues
#1070-1084 of a human NogoA SEQ ID NO: 35 a nucleotide sequence
coding for amino acid residues #1085-1109 of a human NogoA SEQ ID
NO: 36 amino acid residues #1085-1109 of a human NogoA SEQ ID NO:
37 .DELTA.LRR-NT5' primer SEQ ID NO: 38 NgR3X primer SEQ ID NO: 39
MycNgR305 primer SEQ ID NO: 40 MycNgR primer SEQ ID NO: 41 2NgRt313
primer SEQ ID NO: 42 TM/GPI5' primer SEQ ID NO: 43 DEL LRR1 primer
SEQ ID NO: 44 DEL LRR2 primer SEQ ID NO: 45 DEL LRR3 primer SEQ ID
NO: 46 DEL LRR4 primer SEQ ID NO: 47 DEL LRR5 primer SEQ ID NO: 48
DEL LRR6 primer SEQ ID NO: 49 DEL LRR7 primer SEQ ID NO: 50 DEL
LRR8 primer SEQ ID NO: 51 3DLRR CT primer SEQ ID NO: 52 5 DLRRCT
primer SEQ ID NO: 53 amino acid residues #306-442 of a human NgR
SEQ ID NO: 54 amino acid residues #306-473 of a human NgR SEQ ID
NO: 55 amino acid residues #27-309 of a human NgR SEQ ID NO: 56
synthetic peptide SEQ ID NO: 57 synthetic peptide
EXAMPLES
Example 1
Identification of Nogo as a Member of the Reticulon Family of
Proteins
[0220] Adult mammalian axon regeneration is generally successful in
the periphery but dismally poor in the CNS. However, many classes
of CNS axons can extend for long distances in peripheral nerve
grafts (Benfy & Aguayo (1982) Nature 296, 150-152). Comparison
of CNS and peripheral nervous system (PNS) myelin has revealed that
CNS white matter is selectively inhibitory for axonal outgrowth
(Schwab & Thoenen (1985) J. Neurosci. 5, 2415-2423). Several
components of CNS white matter, NI35, NI250 (Nogo) and MAG, with
inhibitory activity for axon extension have been described (Wang et
al., (1999) Transduction of inhibitory signals by the axonal growth
cone, in Neurobiology of Spinal Cord Injury, Kalb &
Strittmatter (editors) Humana Press; Caroni & Schwab, (1988) J.
Cell Biol. 106, 1281-1288; Spillmann et al., (1998) J. Biol. Chem.
73, 19283-19293; McKerracher et al., (1994) Neuron 13, 805-811;
Mukhopadhyay et al., (1994) Neuron 13, 757-767.) The IN-1 antibody
raised against NI35 and N1250 (Nogo) has been reported to allow
moderate degrees of axonal regeneration and functional recovery
after spinal cord injury (Bregman et al., (1995) Nature 378,
498-501; Thallmair et al., (1998) Nature Neurosci. 1, 24-31). The
present invention identifies Nogo as a member of the Reticulon
protein family.
[0221] Nogo is expressed by oligodendrocytes but not by Schwann
cells, and associates primarily with the endoplasmic reticulum. The
66 amino acid lumenal-extracellular domain of Nogo (SEQ ID NO: 20)
inhibits axonal extension and collapses dorsal root ganglion growth
cones. Other Reticulon proteins are not expressed by
oligodendrocytes, and the 66 amino acid lumenal-extracellular
domain from other Reticulon proteins does not inhibit axonal
regeneration. These data provide a molecular basis to assess the
contribution of Nogo to the failure of axonal regeneration in the
adult CNS.
[0222] For expression and protein purification of recombinant
Nogo-A, the full length sequence (KIAA0886) was generously provided
by the Kazusa DNA Research Institute. The full length coding
sequence was amplified by the polymerase chain reaction (PCR) and
ligated into the pcDNA3.1-MycHis vector (Invitrogen) to generate a
plasmid encoding Nogo-A fused at the carboxyl terminus to the Myc
epitope (Nogo-A-Myc). Alternatively, the coding sequence was
amplified using primers that encode an in-frame Myc epitope
immediately amino terminal to the first residue and a stop codon at
the carboxyl terminus (Myc-Nogo-A). The Nogo-C-MycHis and
Rtn1C-MycHis expression vectors were derived in the same fashion
except that an adult rat brain cDNA library was used as template
for a PCR reaction with primers was based on the Nogo-C or Rtn1C
sequences (Van de Velde et al., (1994) J. Cell. Sci. 107,
2403-2416). These plasmids were transfected into COS-7 or HEK293T
by the Lipofectamine (Gibco-BRL) or the FuGENE 6 (Boerhinger
Mannheim) method.
[0223] A portion of Nogo-A encoding the 66 amino acid
lumenal-extracellular fragment of Nogo-A was amplified by PCR and
ligated into the pGEX-2T plasmid to yield a prokaryotic expression
vector for the GST-Nogo fusion protein. Similar regions of Rtn1,
Rtn2 and Rtn3 were amplified by nested PCR using an adult rat brain
cDNA library as template and ligated to pGEX-2T. E. coli
transformed with these plasmids were induced with IPTG. Soluble,
native GST fusion proteins were purified using a glutathione-resin
and contained approximately 75% GST and 25% full length GST-Nogo or
GST-Rtn protein. The majority of the GST-Nogo protein was not
extractable from under non-denaturing conditions, but an 8 M urea
extract dialyzed against PBS contained over 98% pure GST-Nogo.
[0224] Myc immunoreactivity is detectable with an apparent size in
the 225 kDa range under reducing conditions (data not shown). Thus,
the cDNA directs the expression of a protein with appropriate
electrophoretic mobility and the amino acid sequence to be Nogo
which was termed human Nogo-A (hNogo-A).
[0225] The conserved carboxyl tail of the Rtn family proteins
contains two hydrophobic domains separated by a 66 amino acid
residue hydrophilic segment. None of the sequences contain a signal
peptide. The predicted topology for these proteins is for the amino
and carboxyl termini to reside in the cytosol, and for the
conserved region to associate with the lipid bilayer. For Rtn1-A,
there is experimental evidence demonstrating that the polypeptide
behaves as an integral membrane protein, and that the hydrophobic
segments of the conserved domain are responsible for this behavior
(Van de Velde et al., (1994) J. Cell. Sci. 107, 2403-2416).
Myc-tagged Nogo is also associated with particulate fractions and
is extracted by detergent but not high ionic strength (data not
shown).
[0226] When overexpressed in kidney cells, the Rtn1 protein is
localized primarily to endoplasmic reticulum (ER) in a finely
granulated pattern, hence the Reticulon name (Van de Velde et al.,
(1994) J. Cell. Sci. 107, 2403-2416). There is a di-lysine ER
retention motif at the carboxyl terminus of Nogo and most Rtn
proteins (Van de Velde et al., (1994) J. Cell. Sci. 107, 2403-2416;
Jackson et al., (1991) EMBO J. 9, 3153-3162). In neurons, Rtn1 is
expressed throughout processes and is concentrated in growth cones
(Senden et al., (1996) Eur. J. Cell. Biol. 69, 197-213). Its
localization in transfected kidney cells has led to the suggestion
that Rtn1 might regulate protein sorting or other aspects of ER
function (Van de Velde et al., (1994) J. Cell. Sci. 107,
2403-2416). Both the A and C splice forms of Nogo exhibit a
reticular distribution when expressed in COS-7 cells, similar to
that of Rtn1-C.
Example 2
Polyclonal Antibodies against Nogo
[0227] The predicted intra-membrane topology of the two hydrophobic
domains of Nogo indicates that the 66 amino acid residues between
these segments is localized to the lumenal/extracellular face of
the membrane. To explore this further, an antiserum directed
against the 66 amino acid domain was generated.
[0228] For antibody production and immunohistology, anti-Myc
immunoblots and immunohistology with the 9E10 antibody were
obtained as described in Takahashi et al., (1998) Nature Neurosci.,
1, 487-493 & Takahashi et al., (1999) Cell, 99, 59-69. The
GST-Nogo fusion protein was employed as an immunogen to generate an
anti-Nogo rabbit antiserum. Antibody was affinity-purified and
utilized at 3 .mu.g/ml for immunohistology and 1 .mu.g/ml for
immunoblots. To assess the specificity of the antiserum, staining
was conducted in the presence of GST-Nogo protein at 0.1 mg/ml. For
live cell staining, cells were incubated in primary antibody
dilutions at 4.degree. C. for one hour in Hanks balanced salt
solution with 0.05% BSA and 20 mM Na-Hepes (pH 7.3). After
fixation, bound antibody was detected by incubation with
fluorescently labeled secondary antibodies.
[0229] The antibody detects a low level of surface expression of
this epitope, while the Myc epitope at the carboxyl terminus of
expressed Nogo is not detected unless cells are permeabalized. This
surface staining was attributed to a minority of Nogo protein
associated with the plasma membrane rather than the ER membrane.
This data supports a topographic model wherein the amino and
carboxyl termini of the protein reside in the cytoplasm and 66
amino acid of the protein protrude on the lumenal-extracellular
side of the ER or plasma membrane.
Example 3
Nogo Expression in the Central Nervous System
[0230] If Nogo is a major contributor to the axon outgrowth
inhibitory characteristics of CNS myelin as compared to PNS myelin
(Caroni & Schwab, (1988) J. Cell Biol. 106, 1281-1288;
Spillmann et al., (1998) J. Biol. Chem. 73, 19283-19293; Bregman et
al., (1995) Nature 378, 498-501), then Nogo should be expressed in
adult CNS myelin but not PNS myelin. Northern blot analysis of Nogo
expression was performed using probes derived from the 5'
Nogo-A/B-specific region and from the 3' Nogo common region of the
cDNA. A single band of about 4.1 kilobase was detected with the 5'
probe in adult rat optic nerve total RNA samples, but not sciatic
nerve samples. The results indicate that the Nogo-A clone is a full
length cDNA, and are consistent with a role for Nogo as a
CNS-myelin-specific axon outgrowth inhibitor. Northern blot
analysis with a 3' probe reveals that optic nerve expresses high
levels of the Nogo-A mRNA and much lower levels of Nogo-B and
Nogo-C. Whole brain expresses both Nogo-A and Nogo-C, but a number
of peripheral tissues (including sciatic nerve) express little or
no Nogo. Nogo-C/Rtn4-C expression has been demonstrated in skeletal
muscle and adipocytes, as well as in brain (Morris et al., (1991)
Biochim. Biophys. Acta 1450, 68-76). Within the Rtn family, optic
nerve expression appears to be selective for Nogo, with no
detectable expression of Rtn 1 or Rtn 3. Rtn 2 has not been
examined.
[0231] In situ hybridization reveals Nogo mRNA in cells with the
morphology of oligodendrocytes in adult rat optic nerve and
pyramidal tract. Within the brain, Nogo expression is also detected
in certain neuronal populations. In contrast to Nogo, Rtn1 and Rtn3
are not expressed in optic nerve but mRNA is detected in certain
neuronal populations. Nogo protein localization was analyzed in
spinal cord cultures treated with PDGF and low serum to induce
oligodendrocyte differentiation, using the anti-Nogo antibody and
the oligodendrocyte-specific O4 monoclonal antibody. In living
cells, both the lumenal-extracellular 66 amino acid loop of Nogo
and the O4 antigen are detected on the surface of oligodendrocytes.
Approximately half of O4-positive cells in these cultures exhibit
Nogo surface staining.
Example 4
Nogo-Mediated Growth Cone Collapse
[0232] For all experiments involving cell culture, the following
methods were employed. The culture of embryonic chick E10 and E12
dorsal root ganglion explants and dissociated neurons utilized
methods described for E7 dorsal root ganglion cultures (Takahashi
et al., (1998) Nature Neurosci. 1, 487-493; Takahashi et al.,
(1999) Cell 99, 59-69; Goshima et al., (1995) Nature 376, 509-514;
Jin & Strittmatter, (1997) J. Neurosci. 7, 6256-6263).
NGF-differentiated PC12 cells were cultured as described
(Strittmatter et al., (1994) J. Neurosci. 14, 2327-2338). Embryonic
spinal cord explants (rat E10 or chick E5) were cultured for 7-14
days in the presence of PDGF-AA to induce differentiation of some
cells into mature oligodendrocytes (Vartanian et al., (1999) Proc.
Natl. Acad. Sci. USA 96, 731-735). The procedure for growth cone
collapse assays is identical to that for analysis of Sema3A-induced
growth cone collapse (Takahashi et al., (1998) Nature Neurosci. 1,
487-493; Takahashi et al., (1999) Cell 99, 59-69; Goshima et al.,
(1995) Nature 376, 509-514; Jin & Strittmatter, (1997) J.
Neurosci. 17, 6256-6263). The method for analysis of total neurite
outgrowth has also been described (Goshima et al., (1995) Nature
376, 509-514; Jin & Strittmatter, (1997) J. Neurosci. 17,
6256-6263; Strittmatter et al., (1994) J. Neurosci. 14, 2327-2338).
In outgrowth assays, proteins and peptides were added one hour
after plating to minimize any effect on the total number of
adherent cells. To test the effect of substrate-bound GST or
GST-Nogo, the protein solutions were dried on poly-L-lysine coated
glass, washed and then coated with laminin. For E12 cultures, the
neuronal identity of cells was verified by staining with
anti-neurofilament antibodies (2H3, Developmental Studies Hybridoma
Bank) and neurites were traced by observation of
rhodamine-phalloidin staining of F-actin in processes.
[0233] The expression of recombinant Nogo in HEK293T cells allows a
rigorous test of whether this protein has axon outgrowth inhibiting
effects. Washed membrane fractions from vector- or
hNogo-A-Myc-transfected HEK293T cells were added to chick E12
dorsal root ganglion explant cultures. Growth cone morphology was
assessed after a thirty minute incubation at 37.degree. C. by
fixation and rhodamine-phalloidin staining.
[0234] The control HEK membranes have no detectable effect on
growth cone morphology. The Nogo-A-containing membrane fractions
induced collapse of a majority of dorsal root ganglion growth
cones. This growth cone collapse indicates an axon outgrowth
inhibiting activity, and Nogo inhibition of axon extension is also
demonstrable (see below). The Nogo-C form also exhibits collapse
activity, indicating that the shared carboxyl terminus of the
protein including the hydrophobic segments and the 66 amino acid
lumenal-extracellular domain contains functionally important
residues. Additional inhibitory activity in the amino terminal
region of Nogo-A is not excluded by these studies. The sensitivity
of more immature explant cultures from E10 chick embryos or from
E15 rat embryos (data not shown) is substantially less. The
developmental regulation of sensitivity is consistent with
experiments using partially purified Nogo (Bandtlow et al., (1997)
Eur. J. Neurosci. 9, 2743-2752).
[0235] Within the growth cone collapsing Nogo-C protein, the
hydrophilic 66 lumenal-extracellular domain seems more likely to
interact with the surface of dorsal root ganglion neurons than do
the membrane-embedded hydrophobic domains. To test this hypothesis,
the 66 amino acid region of hNogo was expressed in and purified
from E. coli. A majority of the GST-Nogo fusion protein accumulates
in inclusion bodies, but can be recovered by urea extraction. This
restricted region of Nogo possesses potent (EC50=50 nM) growth cone
collapsing activity for chick E12 dorsal root ganglion neurons
(data not shown). The urea-extracted protein preparation is likely
to present only a small fraction of the Nogo sequence in an active
conformation. Therefore, 10% of GST-Nogo that is soluble in E. coli
was purified using a glutathione-Sepharose resin. This preparation
is even more potent than the urea-extracted protein as a collapsing
factor, acutely altering growth cone morphology at concentrations
as low as 1 nM.
[0236] The nanomolar potency is on a par with most known
physiologic regulators of axon guidance. Axon outgrowth from dorsal
root ganglion neurons and NGF-differentiated PC12 cells is also
blocked by this soluble GST-Nogo protein in nM concentrations (data
not shown). When GST-Nogo is bound to substrate surfaces, axonal
outgrowth from dorsal root ganglion neurons or PC12 cells is
reduced to undetectable levels. These are selective effects on axon
outgrowth rather than cell survival since GST-Nogo does not reduce
the number of neurofilament-positive adherent cells (137.+-.24% of
GST-treated cultures) nor significantly alter the number of
apoptotic nuclei identified by DAPI staining (4.0.+-.1.7% in
control cultures and 5.2.+-.1.1% in GST-Nogo-treated
specimens).
[0237] Oligodendrocytes appear to express Nogo selectively amongst
the Rtn proteins. To explore the selectivity of Nogo s role in the
inhibition of axonal regeneration, the axon outgrowth inhibiting
activity of other Rtn proteins was considered. The predicted
lumenal-extracellular 66 amino acid fragments of Rtn1, Rtn2 and
Rtn3 were expressed as GST fusion proteins and purified in native
form. At concentrations in which the Nogo fragment collapses a
majority of E12 dorsal root ganglion growth cones, the other Rtn
proteins do not alter growth cone morphology (data not shown).
Thus, the axon regeneration inhibiting activity is specific for
Nogo in the Rtn family.
Example 5
NgR Peptide Agents
[0238] To further define the active domain of Nogo, 25 amino acid
residue peptides corresponding to segments of the 66 amino acid
sequence were synthesized. The peptide corresponding to residues
31-55 of the extracellular fragment of Nogo exhibits growth cone
collapsing (FIG. 2) and outgrowth inhibiting (data not shown)
activities at concentrations of 4 .mu.M. While this sequence may
provide the core of the inhibitory domain, the 66 amino acid
fragment is clearly required for full potency. Interestingly, this
is the region within the 66 amino acid domain sharing the least
similarity to other Rtn proteins, consistent with the other family
members being inactive as axon regeneration inhibitors. Indeed, the
Rtn1 31-55 amino acid lumenal-extracellular peptide exerts no
growth cone collapse activity (data not shown).
[0239] The aforementioned experimental data identifies Nogo as an
oligodendrocyte-specific member of the Rtn family and demonstrates
that a discrete domain of Nogo can inhibit axon outgrowth. Other
Rtn proteins do not possess this activity. The expression of Nogo
in oligodendrocytes but not Schwann cells therefore contributes to
the failure of axonal regeneration in the adult mammalian CNS as
compared to the adult PNS. The relative contribution of Nogo as
compared to other CNS myelin components to the non-permissive
nature of CNS white matter can now be characterized at a molecular
level.
[0240] While the current experimental data is consistent with a
role for Nogo in blocking adult CNS axonal regeneration after
pathologic injury, this may also be related to the physiologic role
of Nogo in non-pathologic states. Based on localization studies,
other Rtn proteins are thought to play a role in ER function (Van
de Velde et al., (1994) J. Cell. Sci. 107, 2403-2416). A majority
of Nogo is distributed in a reticular pattern in COS-7 cells and
only a minority seems to be accessible at the cell surface.
Example 6
Inhibition of Nogo Activity
[0241] The previous examples have shown that a 66 amino acid region
near the carboxyl terminus of Nogo inhibits axon outgrowth and is
expressed at the cell surface. Shorter twenty-five amino acid
segments of this domain are either inert as outgrowth inhibitors or
of much lower potency (GrandPre et al., (2000) Nature 403,
439-444). The 31-55 region from this 66 amino acid segment has weak
growth cone collapse and axon outgrowth inhibiting activity. To
block Nogo action in vivo, a competitive antagonist of Nogo which
binds to the same receptor site but does not exert a biological
effect in its own right would be highly desirable. Various
fragments of the 66 amino acid region were tested as blockers of
Nogo-mediated axon growth inhibition. Two assays have been used for
this purpose. The first is the growth cone collapse assay and the
second is a binding assay.
[0242] In the growth cone collapse assay, the response to Nogo was
measured in the presence of various potential antagonistic
peptides. Three of the twenty-five amino acid peptides (1-25, 11-35
and 21-45) from the 66 amino acid region possess blocking activity
at .mu.M concentrations (FIG. 2). The combination of all three
peptides does not alter growth cone morphology under basal
conditions but totally prevents collapse by 15 mM GST-Nogo. The
same mixture of peptides is also capable of blocking low dose CNS
myelin induced growth cone collapse. This blockade supports the
hypothesis that Nogo is a primary inhibitory component of CNS
myelin. Furthermore, the blockade has properties expected for
competitive antagonism, being ineffective at high doses of CNS
myelin.
[0243] To develop an antagonist with higher specificity and
potency, a longer fragment of Nogo has been tested. Preferentially,
such a peptide itself has no axon outgrowth inhibiting activity on
its own while competitively blocking Nogo action. The 2-41 fragment
of Nogo is acetylated at the carboxy terminus and amidated at the
amino terminous and is the highest potency blocker of Nogo defined
to date. Pep2-41 abolishes GST-Nogo-induced growth cone collapse
and possesses an apparent Ki of 150 nM in the binding assay (FIG.
3). The 241 fragment also blocks the ability of both purified
Nogo-66 protein and crude CNS myelin to inhibit neurite outgrowth
in cultured neurons (FIG. 4).
Example 7
Identification of the NgR
[0244] A Nogo binding assay was developed which utilizes a method
widely used in examining semaphorin and ephrin axonal guidance
function (Flanagan & Vanderhaeghen, (1998) Annu. Rev. Neurosci.
21, 309-345; Takahashi et al., (1999) Cell 99, 59-69). It involves
fusing a secreted placental alkaline phosphatase (AP) moiety to the
ligand in question to provide a biologically active receptor
binding agent which can be detected with an extremely sensitive
colorimetric assay. For Nogo, an expression vector was created
encoding a signal peptide, a His6 tag for purification, AP and the
66 amino acid active domain of Nogo. The fusion protein can be
purified from the conditioned medium of transfected cells in
milligram amounts (FIG. 5). This protein is biologically active as
a growth cone collapsing agent, with an EC50 of 1 nM. AP-Nogo is
actually slightly more potent than GST-Nogo perhaps because the
protein is synthesized in eukaryotic rather than a prokaryotic
cell. Initial studies have revealed saturable, high affinity sites
on axons. Binding is blocked by GST-Nogo and by the antagonistic 25
amino acid peptides, consistent with competitive binding to a
neuronal receptor site. Since the apparent Kd (3 nM) for these
sites in close to the EC50 of AP-Nogo in the collapse assay, the
sites are likely to be physiologically relevant NgRs.
[0245] This assay was utilized for expression cloning of a NgR.
Pools of a mouse adult brain cDNA expression library representing
250,000 independent clones were transfected into non-neuronal COS-7
cells. Non-transfected COS-7 cells do not bind AP-Nogo, but
transfection with two pools of 5,000 clones exhibited a few cells
with strong AP-Nogo binding. Single cDNA clones encoding a Nogo
biding site were isolated by sib-selection from each of the two
positive pools. The two independently isolated clones are identical
to one another except for a 100 bp extension of the 5' untranslated
region in one clone. Transfection of these clones into COS-7 cells
yields a binding site with an affinity for AP-Nogo identical to
that observed in E13 dorsal root ganglion neurons; the Kd for
binding is about 3 nM (FIG. 6). AP alone does not bind with any
detectable affinity to these transfected cells, indicating that the
affinity is due to the 66 amino acid derived from Nogo.
Furthermore, GST-Nogo displaces AP-Nogo from these sites.
[0246] This cDNA encodes a novel 473 amino acid protein. There is
no reported cDNA with significant homology in GenBank. The
predicted protein contains a signal peptide followed by eight
leucine-rich repeat regions, a unique domain and a predicted GPI
anchorage site (FIG. 7). A human homologue of the murine cDNA was
identified that shares 89% amino acid identity. The existence of
this cDNA was predicted from the murine cDNA structure and analysis
of human genomic sequence deposited in Gentank as part of the Human
Sequencing Project. The exons of the human cDNA are distributed
over 35 kilobases and the cDNA was not previously recognized in the
genomic sequence. The protein structure is consistent with a cell
surface protein capable of binding Nogo. The GPI-linked nature of
the protein suggests that there may be a second receptor subunit
that spans the plasma membrane and mediates Nogo signal
transduction.
Example 8
Tissue distribution of NgR
[0247] The distribution of the mRNA for this NgR is consistent with
a role for the protein in regulating axonal regeneration and
plasticity in the adult CNS. Northern analysis shows a single band
of 2.3 kilobases in the adult brain, indicating that the isolated
NgR clone is full length (FIG. 8). Low levels of this mRNA are
observed in heart and kidney but not in other peripheral tissues.
In the brain, expression is widespread and those areas richest in
gray matter express the highest levels of the mRNA.
Example 9
Biological effects of different Nogo domains
[0248] Assays of Nogo-A function have included growth cone
collapse, neurite outgrowth, and fibroblast spreading with
substrate-bound and soluble protein preparations (Caroni &
Schwab, (1988) J. Cell Biol. 106, 1281-1288; GrandPre et al.,
(2000) Nature 403, 439-444; Chen et al., (2000) Nature 403,
434-439; Prinjha et al., (2000) Nature 403, 483-484). In assays of
3T3 fibroblast morphology, substrate-bound Nogo-66 does not inhibit
spreading (FIGS. 1b,e). Since NI250 preparations and full length
Nogo-A are non-permissive for 3T3 spreading, it was necessary to
consider whether different domains of Nogo might subserve this in
vitro activity. To facilitate a comparison of different Nogo-A
domains, the acidic amino terminal 1040 amino acid fragment
(Amino-Nogo) was expressed as a Myc-his tagged protein in HEK293T
cells (FIG. 1d). The Nogo protein is present in cytosolic
fractions. Surfaces coated with purified Amino-Nogo protein fail to
support 3T3 fibroblast spreading (FIGS. 1b,e). Similar results were
observed for a kidney-derived cell line, COS-7 (FIG. 1f).
Therefore, the amino terminal domain appears to account for the
effects of full-length Nogo-A on fibroblasts. The Nogo-66 domain is
specific for neurons; it does not affect non-neuronal cells.
[0249] Dorsal root ganglion cultures were also exposed to
Amino-Nogo protein (FIGS. 1c,g-i). As for 3T3 fibroblasts, the
fibroblast-like cells in the dorsal root ganglion culture do not
spread on this substrate. Furthermore, axonal outgrowth is reduced
to low levels on Amino-Nogo coated surfaces. Thus, while the
Nogo-66 effects are neural-specific, the inhibitory action of the
Amino-Nogo domain is more generalized. When presented in soluble
form at 100 nM, the Nogo-66 polypeptide collapses chick E12 dorsal
root ganglion growth cones and nearly abolishes axonal extension,
as described previously (GrandPre et al., (2000) Nature 403,
439-444). In marked contrast, the soluble Amino-Nogo protein
appears inactive, and does not significantly modulate dorsal root
ganglion growth cone morphology or dorsal root ganglion axonal
extension or non-neuronal cell spreading (FIGS. 1c,g-i).
[0250] In the experiments of Walsh and colleague (Prinjha et al.,
(2000) Nature 403, 483-484), cerebellar granule neurons were
studied and soluble Amino-Nogo was presented as an Fc fusion
protein, presumably in dimeric form. Therefore, it was necessary to
consider whether these differences might explain the inactivity of
soluble Amino-Nogo. Mouse P4 cerebellar granule neurons respond to
Nogo preparations is a fashion indistinguishable from chick E13
dorsal root ganglion neurons (FIG. 1i). Amino-Nogo dimerized with
anti-Myc antibody inhibits 3T3 and COS-7 spreading (FIGS. 1e,f) and
tends to reduce cerebellar axon outgrowth (FIG. 1i). When further
aggregated by the addition of anti-Mouse IgG antibody, Amino-Nogo
significantly reduces both dorsal root ganglion and cerebellar axon
outgrowth (FIGS. 1h,i). While the Amino-Nogo protein is quite
acidic, electrostatic charge alone does not account for its
inhibitory effects since poly-Asp does not alter cell spreading or
axonal outgrowth (FIGS. 1e,f,h). Thus, the Nogo-66 domain is a
potent and neuron-specific inhibitor, while the intracellular
Amino-Nogo domain inhibits multiple cell types and appears to
function only in an aggregated state.
Example 10
Localization of NgR
[0251] To further characterize the expression of the Nogo-66
receptor protein an antiserum to a GST-NgR fusion protein was
developed. This antiserum detects an 85 kDa protein selectively in
Nogo-66 receptor-expressing HEK293T cells (FIG. 9a), and
specifically stains COS-7 cells expressing Nogo-66 receptor (FIG.
9b). Immunohistologic staining of chick embryonic spinal cord
cultures localizes the protein to axons, consistent with mediation
of Nogo-66-induced axon outgrowth inhibition. Nogo-66 receptor
expression is not found in the 04-positive oligodendrocytes that
express Nogo-66. Immunoreactive 85 kDa protein is expressed in
Nogo-66-responsive neuronal preparations from chick E13 dorsal root
ganglion, but to a much lesser degree in weakly responsive tissue
from chick E7 dorsal root ganglion and chick E7 retina (FIG. 9a).
Overall, the pattern of Nogo-66 expression is consistent with the
protein mediating Nogo-66 axon inhibition.
[0252] This antibody is also effective in localizing the Nogo-66
receptor protein in tissue sections (FIG. 9c). While it is clear
from in situ hybridization studies that the protein is expressed in
multiple classes of neurons, immunohistology reveals the protein at
high levels in CNS white matter in profiles consistent with axons.
Protein is detectable at lower levels in neuronal soma and
neuropil. This provides further support for the proposed function
of this protein in mediating interactions with
oligodendrocytes.
Example 11
NgR mediates Nogo-66 Responses
[0253] The Nogo-66 receptor protein is necessary for Nogo-66 action
and not simply a binding site with a function unrelated to
inhibition of axonal outgrowth. A first prediction is that
phophoinositol specific-Phospholipase C(PI-PLC) treatment to remove
glycophosphatidylinositol (GPI)-linked proteins from the neuronal
surface will render neurons insensitive to Nogo-66. This prediction
holds true for chick E13 dorsal root ganglion neurons; PI-PLC
treatment abolishes both AP-Nogo binding and GST-Nogo-66-induced
growth cone collapse (FIG. 10a-c). As a control, Sema3A responses
in the parallel cultures are not altered by PI-PLC treatment. Of
course, PI-PLC treatment is expected to remove a number of proteins
from the axonal surface so this result leaves open the possibility
that other GPI-linked proteins are mediating the Nogo-66 response
in untreated cultures.
[0254] To demonstrate that the Nogo-66 receptor is capable of
mediating Nogo-66 inhibition of axon outgrowth, the protein was
expressed in neurons lacking a Nogo-66 response. Both dorsal root
ganglion and retinal neurons from E7 chick embryos were examined.
The Nogo responses in the dorsal root ganglion neurons from this
developmental stage are weak but slight responses can be detected
in some cultures (data not shown). E7 retinal ganglion cell growth
cones are uniformly insensitive to Nogo-66-induced growth cone
collapse (FIG. 10e), do not bind AP-Nogo (data not shown) and do
not exhibit 85 kDa anti-Nogo-66 receptor immunoreactive protein
(FIG. 9a). Expression of NgR in these neurons by infection with
recombinant HSV preparations renders the retinal ganglion cell
axonal growth cones sensitive to Nogo-66-induced collapse.
Infection with a control PlexinA1-expressing control HSV
preparation does not alter Nogo responses. Taken together, these
data indicate that the NgR identified here participates in Nogo-66
inhibition of axon regeneration.
Example 12
Structural analysis of Nogo-66 Receptor
[0255] The Nogo-66 receptor structure was examined to determine
which regions mediate Nogo-66 binding. The protein is simply
divided into the leucine rich repeat and the non-leucine rich
repeat region. Deletion analysis clearly shows that the leucine
rich repeats are required for Nogo-66 binding but the remainder of
the protein is not necessary (FIG. 11). Within the leucine rich
repeat domain, two domains have been separately deleted. This is
predicted to maintain the overall leucine rich repeat domain
structure, and a similar approach has been utilized for the
leutropin receptor. It is apparent that the Nogo-66 binding
requires all eight leucine rich repeats, and suggests that a
significant segment of the planar surface created by the linear
beta sheets of the leucine rich repeats. The leucine rich
repeat-amino terminous and leucine rich repeat-carboxy terminus
conserved cysteine rich regions at each end of the leucine rich
repeats are also required for Nogo-66 binding, presumably these are
necessary to generate appropriate leucine rich repeat
conformation.
Example 13
Blockade of Nogo by soluble NgR Ectodomain Protein
[0256] One method for blocking a signal transduction cascade
initiated by Nogo-66 binding to the NgR is to provide excess
soluble ectodomain of the receptor. A secreted fragment of the NgR
protein has been produced in HEK293T cells. The cDNA encoding amino
acid residues 1-348 of the murine NgR were ligated into a
eukaryotic expression vector and that DNA was transfected into
HEK293T cells. Conditioned medium from these cells contains high
levels of this NgR fragment (NgR-ecto), as demonstrated by
immunoblots with an anti-NgR antibody. The conditioned medium
contains approximately 1 mg of NgR-ecto protein per liter. In the
AP-Nogo binding assay to COS-7 cells expressing full length NgR or
to dorsal root ganglion neurons, the addition of NgR-ecto
conditioned medium reduces the binding of 0.5 nM AP-Nogo-66 by 80%.
Complex formation between soluble NgR-ecto and Nogo-66 prevents
binding to cell surface receptors.
[0257] For some receptor systems, such soluble receptor ligand
complexes can block signaling by creating an ineffective
interaction. For example, the soluble ectodomain of Trk serves to
block neurotrophin signaling and has been extensively used for this
purpose (Shelton et al., (1995) J. Neurosci. 15, 477-491).
Alternatively, the Nogo-66/NgR-ecto soluble complex may bind to and
stimulate the presumed second transmembrane NgR subunit. There is
precedence for this type of effect from studies of GDNF family
receptors (Cacalano et al., (1998) Neuron 21, 53-62). The
Nogo-66/NgR-ecto complex does not cause growth cone collapse in
those neurons (chick E7 retinal ganglion cells) which lack the
Nogo-66 receptor but containing other components of the Nogo
signaling pathway. This indicates that NgR-ecto functions as a
blocker of Nogo-66 signaling.
[0258] In direct tests, the NgR-ecto protein protects axons from
the inhibitory effects of Nogo-66. NgR-ecto prevents
Nogo-66-induced growth cone collapse and blocks Nogo-66-induced
inhibition of neurite outgrowth from chick E13 DRG neurons (FIG.
12). Furthermore, the presence of NgR-ecto protein blocks the
ability of CNS myelin to inhibit axonal outgrowth in vitro (FIG.
12). These data demonstrate that a NgR-ecto protein can promote
axonal regeneration in vivo.
Example 14
Regions in the luminal/extracellular domain of Nogo Necessary for
NgR binding
[0259] Portions of the luminal/extracellular domain of Nogo were
tested to determine the amino acid sequences responsible for
conveying inhibitory activity. To accomplish this, five 25 residue
peptides, consisting of overlapping segments of the
luminal/extracellular sequence fused to AP were constructed for
testing in binding, growth cone collapse and neurite outgrowth
assays.
[0260] To generate AP-fusion proteins, PCR from cDNA of human
Nogo-A was used to obtain inserts encoding residues #1055-1094,
1055-1089, 1055-1084, 1055-1079, 1060-1094, 1065-1094 or 1070-1094
of hNogoA (designated 1-40, 1-35, 1-30, 1-25, 6-40, 11-40, 16-40 in
FIG. 5a). See FIG. 13a for the amino acid sequence of each. The
inserts were excised and subcloned into the mammalian expression
vector pcAP-6. Approximately 60 hours after constructs were
transfected into 293T cells, conditioned medium was collected. The
concentration of soluble AP-fused proteins within the conditioned
medium or the presence of AP-fusion proteins within the conditioned
medium from these cells was verified by measuring AP activity with
the substrate p-nitro-phenyl phosphate, pNPP, or by western,
respectively.
[0261] To determine if AP-fused deletion mutants of Nogo-66 bind
mouse NgR ("mNgR"), COS-7 cells were transfected with a plasmid
encoding the mouse NgR sequence ligated into pcDNA3.1. 48 hours
after transfection, cells were washed with HBH (Hanks balanced salt
solution containing 20 mM sodium Hepes, pH 7.05, and 1 mg ml.sup.-1
bovine serum albumin) and then incubated with condition medium
containing one of the AP-fusion proteins described above for 2
hours at 37.degree. C. Cells were then washed, fixed, and left in
HBH at 67.degree. C. for 14-16 h to inactivate endogenous AP.
AP-fusion protein binding to NgR expressing COS-7 cells was
detected with the substrates NBT and BCIP (FIG. 13b).
[0262] Using this assay, AP fused Nogo-66 has been shown to bind
COS7 cells expressing NgR with a Kd of approximately 7 nM. Equally
high affinity binding to NgR expressing cells, but not to
non-transfected cells, was obtained with an AP-fusion protein
consisting of residues 1-40 of the Nogo-66 sequence (designated
140-AP in FIG. 14a).
[0263] FIG. 14b graphically depicts the binding of 140-AP to COS-7
cells expressing mNgR as measured as a function of 140-AP
concentration. A plot of the bound/free versus free 140-AP
indicates that the Kd of 140-AP binding to mNgR in this assay is 8
nM. See FIG. 14c.
[0264] AP-fusion proteins 1-35 and 6-40 also demonstrated binding
to mNgR transfected cells (FIG. 13b). Application of AP to these
cells does not result in any detectable binding indicating that
binding is the result of the Nogo-66 derived residues that were
tested. Subsequent experiments (data not shown) have demonstrated
that peptides having residues 1-35 and 1-34 bind strongly and
almost equivalently to mNgR, whereas peptides having residues 1-33
bound mNgR approximately 50% less compared to the strong binders.
Peptides having residues 1-31 and 1-30 exhibited almost no binding
to NgR. Further, peptides having residues 240 of the
hNogoA(#1055-1120) bound mNgR well whereas peptides having residues
1040 had no binding and peptides having 640 had intermediate
binding. Taken together, the data indicates that there are two
regions of the hNogoA(#1055-1120) sequence that contain residues
necessary for binding:residues 2-10 and 31-34, i.e., sequences
IYKGVIQAI (SEQ ID NO:56) and EELV (SEQ ID NO:57).
Example 15
Activity of Fragments of the Luminal/Extracellular Domain of
Nogo
[0265] Tests were conducted to determine if the NgR binding
observed with various fragments of the luminal/extracellular domain
of Nogo was correlated with inhibitory activity. E12 chick DRG
growth cone collapse and neurite outgrowth assays that have been
described previously were used to determine the inhibitory activity
of the fragments.
[0266] Briefly, for growth cone collapse, DRG explants were plated
on plastic chamber slides precoated with 100 .mu.ml.sup.-1
poly-L-lysine and 10 .mu.g m.sup.-1 laminin. Cultures were grown
14-16 h prior to treatment.
[0267] For neurite outgrowth assays, plastic chamber slides were
coated with 100 .mu.g ml.sup.-1 poly-L-lysine, washed, and dried. 3
.mu.l drops of PBS containing GST-Nogo-66 were spotted and dried.
Slides were then rinsed and coated with 10 .mu.g ml fs24.sup.-1
laminin before addition of dissociated E12 chick DRGs. AP-fusion
proteins were added at the time of cell plating. Cultures were
grown for 5-7 h after which neurite outgrowth was assessed.
[0268] Out of the AP fusion proteins that bind NgR, only the AP
fusion proteins containing residues #1085-1109 of hNogoA were
active in these assays (data not shown) thus indicating that
residues within this region are critical to the inhibitory activity
of the luminal/extracellular domain of Nogo. However, the activity
of the AP fusion protein containing residues #1085-1109 of hNogoA
was considerably less than the larger #1055-1120 fragment. These
findings indicate that regions outside of residues #1085-1109, but
within residues #1055-1120 of hNogoA may be crucial for high
affinity binding of the residues #1055-1120 of hNogoA to NgR.
[0269] To determine the activity of AP-fusion proteins of Example
14, conditioned medium containing AP-fusion proteins were added to
cultures at a final concentration of 20 nM. FIGS. 15a and b show
that AP fused to residues #1055-1120 of NogoA is a potent
growth-cone-collapsing agent (designated AP-Ng-66 in FIG. 15a and
1-66 in FIG. 15b). Other AP-fusion proteins containing residues
#1055-1094, 1055-1089 or 1060-1094 (designated as 1-40, 1-35 or
6-40, respectively in FIG. 15b) did not induce growth cone collapse
in this assay.
[0270] Although these fusion proteins bind to COS7 cells expressing
NgR with high affinity, they fail to induce significant growth cone
collapse in E12 chick DRG explant cultures. These peptides exhibit
a desirable characteristic for blockers of Nogo activity--i.e.,
they themselves do not have inhibitory activity. The fusion of AP
with residues #1055-1094 of hNogoA is a good example of a fusion
protein that binds with high affinity to COS7 cells expressing NgR,
but fails to mediate growth cone collapse. Taken together, these
data suggest that high affinity binding to NgR can be dissociated
from activation of an inhibitory signal through NgR.
Example 16
Synthetic Peptide 140 is an Antagonist Against Nogo-66 Activity
[0271] (a) Growth Cone Collapse
[0272] For further testing, a synthetic peptide containing amino
acid residues #1055-1094 of hNgR, acetylated at the carboxy
terminus and amidated at the amino terminus was used [hereinafter
"Peptide 140"]. As was shown with the AP-fused version of this
peptide, application of Peptide 140 does not induce significant
growth cone collapse in E12 chick DRG explant cultures. Antagonist
of Nogo-66 inhibitory activity may act by competing for, and
thereby blocking NgR binding sites. To determine the antagonistic
activity of Peptide 140, the above synthetic form of the peptide
was added to E12 chick DRG explant cultures approximately 10 min
before application of various concentrations of GST-NogoA (residues
#1055-1120), TPA or Sema3A. 30 min later, cultures were fixed and
growth cone collapse was assessed following staining with
rhodamine-phalloidin. See FIG. 16a.
[0273] In this assay, Peptide 140 significantly blocks growth cone
collapse induced by residues #1055-1120 fused to GST. Importantly,
when Peptide 140 is applied to these cultures in conjunction with
other growth cone collapsing agents, TPA or Sema3A, there is no
significant reduction in collapse. These findings indicate that the
antagonistic activity of Peptide 140 is selective for Nogo
inhibitory activity. See FIG. 16b-d.
[0274] (b) Neurite Outgrowth Activity
[0275] Peptide 140 was tested for its ability to neutralize neurite
outgrowth inhibition caused by the addition of GST fused to
residues # 1055-1120 of hNogoA (designated Nogo-66 in FIG. 16e).
Plastic chamber slides were coated with 100 .mu.g ml.sup.-1
poly-L-lysine, washed, and dried. 3 .mu.l drops of PBS containing
GST-hNogoA(residues #1055-1120) were spotted and dried. Slides were
then rinsed and coated with 10 .mu.g ml fs24' laminin before
addition of dissociated E12 chick DRGs. Peptide 140 was added at
the time of cell plating. Cultures were grown for 5-7 h after which
neurite outgrowth was assessed.
[0276] While GST-hNogoA(residues #1055-1120) dramatically reduces
growth in these cultures, application of Peptide 140 alone has no
observable effect on neurite outgrowth from these cells. See FIG.
16e. However, when cells are grown in the presence of both Peptide
140 and GST-hNogoA(residues #1055-1120), extensive outgrowth is
observed. Importantly, challenging GST-hNogoA(residues
#1055-1120)-induced activity with a scrambled version of Peptide
140 [acetyl-SYVKEYAPIFAGKSRGEIKYQSIEIHEAQVRSDELVQSLN-amide] does
not result in blockade of outgrowth inhibition. Taken together,
these studies suggest that Peptide 140 can be used as a functional
antagonist of inhibitory activity of the luminal/extracellular
domain of Nogo. See FIG. 16e.
Example 17
Peptide 140 Can Neutralize the Inhibitory Activity of CNS Myelin at
Low Concentrations, but Not High Concentrations of CNS Myelin
[0277] Inhibitory molecules associated with CNS myelin include MAG,
chondroitin sulfate proteoglycans, and Nogo. Currently, the
relative contribution of each of these molecules to the
non-permissiveness of CNS myelin is largely unknown. To this end,
standard in vitro assays were used to determine whether Peptide 140
can neutralize the inhibitory activity of CNS myelin (FIG. 17).
[0278] To determine the antagonistic activity of Peptide 140
against CNS myelin, the above synthetic peptide was added
approximately 10 min before application of CNS myelin. 30 min
later, cultures were fixed and growth cone collapse was assessed
following staining with rhodamine-phalloidin. For neurite outgrowth
assays, plastic chamber slide were coated with 100 .mu.g ml.sup.-1
poly-L-lysine, washed, and dried. 3 .mu.l drops of PBS containing
CNS myelin were spotted and dried. Slides were then rinsed and
coated with 10 .mu.g ml fs24.sup.-1 laminin before addition of
dissociated E12 chick DRGs. Peptide 140, or the scrambled version
of Peptide 140, was added at the time of cell plating. Cultures
were grown for 5-7 h after which neurite outgrowth was
assessed.
[0279] When applied to E12 chick DRG explant cultures, purified CNS
myelin potently mediates growth cone collapse. The addition of both
Peptide 140 and CNS myelin to these cultures reveals that at higher
concentrations of myelin, the peptide had no effect on inhibitory
activity. This result was not necessarily unexpected given that CNS
myelin is known to contain inhibitory molecules other than Nogo.
However, at the lowest myelin concentrations tested, Peptide 140
reduces myelin induced growth cone collapse to control levels.
These data suggest that Nogo may be the only active inhibitor at
low concentrations of myelin (and may therefore be the most potent
inhibitor present in CNS myelin).
[0280] In addition to mediating growth cone collapse, CNS myelin
dramatically reduces neurite outgrowth when applied to dissociated
E12 chick DRG cultures. Addition of Peptide 140 to these cultures
results in a partial neutralization of this inhibitory activity
when CNS myelin is presented as a bound inhibitor (FIG. 17). For
example, neurite outgrowth on a 20 ng spot of myelin increases from
35% to 65% (as compared with control outgrowth) following treatment
with Peptide 140. Maximal activity of Peptide 140 is obtained at
approximately 250 nM and is progressively lost with higher
dilutions of the peptide. The scrambled version of Peptide 140 is
ineffective at blocking CNS myelin induced neurite outgrowth
inhibition. Taken together, these data suggest that Nogo is an
important contributor to the inhibitory activity of CNS myelin.
Further, much of the activity of Nogo-A may be attributable to the
Nogo-66 inhibitory domain.
[0281] Peptide 140 significantly reduces myelin induced growth cone
collapse and can partially restore neurite outgrowth in cultures
grown on bound CNS myelin. Thus, Nogo can be a potent inhibitory
molecule in CNS myelin.
[0282] There has been reports that neutralization of Nogo activity
with the monoclonal antibody IN-1, raised against a myelin fraction
enriched in Nogo-A, can partially block the inhibitory activity of
CNS myelin both in vitro and in vivo. However, interpretation of
the results of these studies is complicated by the presence of two
inhibitory domains in Nogo-A (at residues #1055-1120 and the
N-terminus of hNogoA) and a lack of information regarding the
epitope of Nogo-A recognized by the IN-1 antibody. Further, using
IN-1 to probe a Western blot of proteins extracted from spinal cord
reveals binding to Nogo-A but also to a number of other
unidentified protein species indicating that the antibody is not
highly selective for Nogo-A. In contrast, a peptides derived from
the luminal/extracellular domain of Nogo according to this
invention selectively block hNogoA activity.
Example 18
NgR LRR Domains are Required for Binding to Nogo
[0283] To define residues critical for binding to Nogo-66
[hereinafter, hNogo-A(1055-1120)], mouse NgR (hereinafter mNgR)
deletion mutants were generated and tested for their ability to
bind hNogo-A(1055-1120). The amino acid sequence of mNgR contains a
signal sequence, an amino-terminal region (NT), eight leucine-rich
repeat (LRR) domains (LRR 1-8), a LRR carboxy-terminal domain
(LRRCT), a unique carboxy terminal domain (CT), and a GPI anchor
domain. A series of mNgR mutant proteins with specific regions
deleted was created using PCR-based site-directed mutagenesis (FIG.
1A).
[0284] The mNgR (WTNgR) and mNgR deletion mutants were ligated into
the vector pSecTag2Hygro (Invitrogen, Buringame, Calif.). The
vector adds to each of the proteins a secretion signal, a
C-terminal polyhistidine (6.times.His) tag, and a C-terminal
epitope recognized by the anti-His (C-term) antibody. wtNgR encodes
residues 1 to 473 of mNgR (Fournier et al., Nature 409:341-346,
2001).
[0285] The Ng.sub..DELTA.RNT construct encodes residues 58 to 473
of mNgR. The NgR.sub..DELTA.NT construct was made by using the
primers .sub..DELTA.LRR-NT5
(5'-tgggatccgaacaaaaactcatctcagaagaggatctgtctagccagcgaatcttcctgcatggc-3')
and NgR3X (5'-ttctcgaggtcagcagggcccaagcactgtcc-3') to amplify a
sequence from the wtNgR-pSecTag2Hygro plasmid. The amplified
sequence was ligated into the XhoI/BamHI of pSecTag2.
[0286] The NgLRR-- construct encodes residues 306 to 473 of mNgR.
The NgLRR construct was made by using the primers, MycNgR305
(5'-tgggatccgaacaaaaactcatctcagaagaggatctgctagagggctgtgctgtggcttca-3')
and NgR3X (above) to amplify a sequence from the from the
wtNgR-pSecTag2Hygro plasmid. The amplified sequence was ligated
into the XhoI/BamHI of pSecTag2.
[0287] The NgR.sub..DELTA.CT construct encodes residues 26 to 305
and 443 to 473 of mNgR, thereby including the LRR and GPI regions
of mNgR. Primers MycNgR
(tgggatccgaacaaaaactcatctcagaagaggatctgccatgccctggtgcttgtgtgtgct)
and 2NgRt313 (ttgcggccgctgaagccacagcacagccctctag) were used to
amplify a sequence from the wtNgR-pSecTag2Hygro plasmid. Primers
TM/GPI5 (5'-ttgcggccgctgagggttcaggggctctgcctgct-3') and NgR3X
(above) were used to amplify a sequence from the
wtNgR-pSecTag2Hygro plasmid. The amplified sequences were ligated
together at the NotI site and then ligated into the BamHI/XhoI
sites of pSecTag2.
[0288] The mNgR LLR deletions and NgRALRRCT deletion mutants were
generated using ExSite.TM. PCR-based site-directed mutagenesis kit
(Stratagene, La Jolla, Calif.). Generally, the primers described
below were used to amplify a sequence from the wtNgR pSecTag2
plasmid. The ends of the amplified products were ligated together.
The resulting constructs were transfected into COS-7 cells.
[0289] The NgR.sub..DELTA.1-2 construct encodes residues 1 to 56
and residues 106 to 473 of mNgR. The primers used for making the
NgR.sub..DELTA.1-2 construct were DEL LRR (5'PO.sub.4)
(5'-ggctgggatgccagtgggcacagc-3') and DEL LRR2
(5'-ctcctggagcaactagatcttagt-3'). The NgRA3-4 construct encodes
residues 1 to 105 and residues 155 to 473 of mNgR. The primers used
for making the NgRA3-4 constructs were DEL LRR3 (5'PO.sub.4)
(5'-ggtcagaccagtgaaggcagcagc-3') and DEL LRR4
(5'-gctctgcagtacctctacctacaa-3'). The NgRA5-6 construct encodes
residues 1 to 153 and residues 203 to 473 of mNgR. The primers used
for making the NgRA5-6 construct were DEL LRR5 (5'PO.sub.4)
(5'-tgctagtccacggaataggccggg-3') and DEL LRR6 (5'PO.sub.4)
(5'-agtcttgaccgcctcctcttgcac-3'). The NgRA7-8 construct encodes
residues 1 to 202 and residues 251 to 473 of mNgR. The primers used
to make the NgRA7-8 construct were DEL LRR7 (5'PO.sub.4)
(5'-gtgcaggccacggaaagcgtgctc-3') and DEL LRR8
(5'-tctctgcagtacctgcgactcaat-3'). The NgRALRRCT construct encodes
residues 1 to 259 and residues 311 to 473 of mNgR. The primers used
to make the NgRALRRCT construct were 3DLRR CT
(5'-gtggcttcaggacccttccgtcccatc-3') and 5 DLRRCT (5' PO.sub.4)
(5'-gtcattgagtcgcaggtactgcagagacct-3'). Expression of the mNgR
mutants in COS-7 cells was verified by SDS-PAGE and immunoblotting
(data not shown).
[0290] A vector encoding AP-hNogo-A(1055-1120) was constructed as
described in Fournier et al., supra). The vector encoding AP-NgR
was made by ligating the mNgR coding sequence from residues 27-451
in frame with the signal sequence-6.times.His-placental alkaline
phosphatase (AP) sequence of the vector known as pAP-6 (Nakamura et
al., Neuron 2: 1093-1100, 1988).
[0291] AP-hNogo-A(1055-1120) was prepared by transfecting the
expression plasmid into HEK293T cells and, after four days,
collecting the conditioned medium and purifying the secreted
AP-hNogo-A(155-1120) protein by Ni2+ affinity chromatography as
described (Nakamura et al., supra).
[0292] To determine whether mNgR or mNgR deletion mutants bound to
hNogo-A(1055-1120), wtNgR or mNgR deletion mutants were transfected
into COS-7 cells. Forty-eight hours after the transfection, the
transfected COS-7 cells were washed with hanks balanced salt
solution containing 20 mM sodium HEPES, pH 7.05, and 1 mg/ml bovine
serum albumin (BSA) [hereinafter "HBH"]. Cells were then incubated
for 2 hours at 23.degree. C. with a conditioned medium enriched
with purified AP-hNogo-A(1055-1120) diluted in HBH. AP-fusion
protein was detected as previously described for AP-Sema3A
(Takahashi et al., Nature Neurosci. 1:487-493, 1998).
[0293] wtNgR and NgR.DELTA.CT transfected COS-7 cells bound to
AP-hNogo-A(1055-1120), but the other deletion mutants did not (FIG.
18B). The AP-hNogo-A(1055-1120) binding pattern indicates that
multiple residues within the NgR LRR region are required for
AP-Nogo binding. Because the NgR.DELTA.1-2, NgRA3-4, NgRA5-6, and
NgRA7-8 deletions remove entire LRR domains it is unlikely that the
entire tertiary structure of mNgR is disrupted.
Example 19
The Effect of NgRCT on mediating NgR-dependent Inhibition
[0294] Because the mouse NgRCT domain was determined to be
dispensable for hNogo-A(1055-1120) binding, the ability of
NgR.DELTA.CT to mediate Nogo-dependent inhibition was examined.
HSVNgR constructs transfected into HEK293T cells mediated the
expression of mNgR proteins of the predicted molecular weight, as
determined by SDS-PAGE and anti-Myc and anti-NgR immunoblotting
(FIG. 19A). Day E7 chick retinal ganglion cells (RGCs) were grown
for 12 hr, then further incubated for 24 hr with HSVNgR
preparations. Explants were fixed with 4% paraformaldehyde with 0.1
M PO.sub.4 and 20% sucrose and stained with phalloidin or with
anti-myc antibodies. HSVNgR protein expression was detected in
axons of infected (RGC) cultures (FIG. 19B).
[0295] Growth cone collapse in response to GST-hNogo-A(1055-1120)
was investigated in infected RGC cultures. Retinal explants
infected with recombinant viral preparations of PlexinA1 (PlexA1),
wild-type NgR (wtNgR), NgRL1 chimeric receptor in which the GPI
domain has been replaced by the transmembrane region and
cytoplasmic tail from the mouse adhesion protein L1(NgRLI), or NgR
carboxy terminal deletion mutant (NGRACT) for 12 hr. Following
infection, the cells were treated for 30 min with 0, 50, 250, or
500 nM GST-hNogo-A(1055-1120) (GrandPre et al., Nature 403:
439-444, 2000), fixed with 4% paraformaldehyde with 0.1 M PO.sub.4
and 20% sucrose, and stained with phalloidin. As shown in FIG. 20,
cells infected with the control PlexA1 virus did not respond to
GST-hNogo-A(1055-1120), whereas cells infected with wtNgR underwent
growth cone collapse in response to GST-hNogo-A(1055-1120). Cells
infected with NgR.DELTA.CT were insensitive to
GST-hNogo-A(1055-1120). The CT region of NgR is therefore required
for effective NgR inhibitory signaling.
Example 20
The Effect of the CT Domain Alone on NgR Inhibitory Signaling
[0296] As NgR is a GPI linked protein tethered to the plasma
membrane, it is likely that a second protein exists in a NgR
signaling complex that is responsible for transducing Nogo signals
within the cell. One possibility is that the CT domain of NgR may
bind to a transducing component and initiate an intracellular
signaling cascade upon ligand binding. This possibility would be
consistent with the signaling incompetence of NgR.DELTA.CT. If so,
it is also possible that the NgR CT region may be capable of
constitutive inhibitory activity. To test this possibility, a
GSTNgRCT fusion protein was produced by PCR amplifying the CT
region of NgR (amino acids 310-450) and ligating the fragment into
the BamHI/EcoRI site of pGEX2T. The fusion protein was expressed
and tested in a neurite outgrowth assay. E13 chick dorsal root
ganglion (DRG) cells were dissociated and plated in the presence or
absence of 100 nM soluble GSTNgRCT and assayed for neurite
outgrowth lengths. In this assay, GST-hNogo-A(1055-1120) has been
shown to inhibit neurite outgrowth (Fournier et al., supra).
Soluble GSTNgRCT did not alter neurite outgrowth lengths, nor did
it attenuate or enhance the response of dissociated E13 DRGs to
GST-hNogo-A(1055-1120) substrates (FIG. 21).
Example 21
The NgR GPI Domain is Not Required for NgR Signaling
[0297] To test the possibility that the GPI anchor has a role in
mediating inhibitory Nogo signaling, a chimeric NgR molecule was
constructed and assessed for its ability to correctly localize
within the cell. HSVL1NgR contains a HSVNgR fusion in which the NgR
GPI domain is replaced with the transmembrane domain of L1. HEK293T
cells were cultured in 6-mm dishes and transfected with HSVwtNgR or
HSVL1NgR. After 48 hr, cells were rinsed with PBS and lysed on ice
with 375 .mu.l precooled buffer containing 50 mM Tris-HCl (pH 7.4),
150 mM NaCl, 5 mM EDTA, and 0.1% Triton X-100, (hereinafter
"TNEX"), and 10 mM NaF and a protease inhibitor cocktail (Roche
Diagnostics, Mannheim, Germany). Cells were homogenized by passing
the ice-cold lysates through a 27 G needle 10 times. Extracts were
adjusted to 35% OptiPrep (Gibco BRL) by adding 525 .mu.l of 60%
OptiPrep/0.1% Triton X-100, then placed in an ultracentrifuge tube
and overlayed with 8.75 ml of 30% OptiPrep in TNEX and 1 ml of
TNEX. After centrifugation (4 hr, 200,000.times.g, 4.degree. C.),
seven fractions were collected, precipitated with trichloroacetic
acid, washed with acetone, air dried, and resuspended in Laemlli
sample buffer. Fractions were analyzed by 8% SDS-PAGE and
immunoblotting with the NgR antibody (Fournier et al., supra).
Transferrin receptor (TfR) was detected with an anti-TfR monoclonal
antibody; caveolin was detected with anti-caveolin rabbit
polyclonal antibody.
[0298] As expected for a GPI-anchored protein, wtNgR localized
mainly to caveolin-rich lipid raft fractions (FIG. 22). A much
smaller proportion of the chimeric L1NGR was localized to the lipid
raft fraction. Expression of the wild-type HSVNgR or HSVNgRL1
chimeric protein in HEK293T cells results in an altered
distribution of HSVNgRL1.
Example 22
mNgR Binds mNgR
[0299] NgR was tested for the ability to self-associate. For this
study, mNgR [hereinafter, wtNgR or WT] and mNgR deletion mutants
(see FIG. 18A) were transfected into COS-7 cells. Forty-eight hours
after the transfection, the transfected COS-7 cells were washed
with HBH. Cells were then incubated for 2 hours at 23.degree. C.
with a conditioned medium containing AP-hNogo-A(1055-1120) fusion
protein diluted in HBH. AP-fusion protein was detected as
previously described for AP-Sema3A (Takahashi et al., Nature
Neurosci. 1:487-493, 1998). Similar to the AP-Nogo binding profile,
AP-NgR bound to wtNgR and NgR.DELTA.CT (FIG. 23). Nogo treatment
had little, if any, effect on the NgR-NgR interaction (data not
shown). Other NgR deletion mutants did not bind AP-NgR. The same
NgR domains are required for GST-hNogo-A(1055-1120) binding and NgR
oligomerization
Example 23
Soluble NgR Antagonizes Nogo and Myelin-Dependent Inhibition
[0300] Although the role of the GPI anchor may be to regulate NgR
cellular compartmentalization, another possible role for the GPI
linkage is to provide a NgR cleavage site. Cleaving NgR could serve
to affect hNogo-A(1055-1120) signaling by rendering a neuron
insensitive to hNogo-A(1055-1120) and by releasing soluble NgR that
could then act on adjacent cells to modulate hNogo-A(1055-1120)
signaling. To determine if soluble mNgR modulates
hNogo-A(1055-1120)-dependent inhibition, a soluble mNgR was
generated by inserting a truncated cDNA encoding mNgR residues
1-348 in frame with a myc-His carboxy tag into pcDNA3.1. The
resulting plasmid expressing mNgREcto was transfected into HEK293T
cells, and conditioned media containing mNgREcto protein was
collected. To test the effect of mNgREcto on Nogo signaling, E13
dissociated DRGs were plated in the presence of hNogo-A(1055-1120)
or myelin. The inhibitors were presented in either soluble or
substrate-bound forms. For neurite outgrowth assays on
hNogo-A(1055-1120) or myelin substrates, Permanox chamber slides
were coated with 100.mu., fs24 g ml.sup.-1 poly-L-Lysine, washed,
and then 3-.mu.l drops of phosphate-buffered saline (hereinafter
"PBS") containing 0, 10, 50, or 150 ng of GST-hNogo-A(1055-1120) or
myelin were spotted and dried. GST-hNogo-A(1055-1120) and myelin
were prepared as previously described (GrandPre et al., supra;
Fournier et al., J. Cell Biol. 149:411-421, 2000). After three PBS
washes, slides were coated with 10 .mu.g ml.sup.-1 laminin. Laminin
was then aspirated and dissociated E13 chick DRG neurons were
added. After 6-8 hr of outgrowth, cultures were fixed and neurite
outgrowth lengths were assessed. For blockade experiments with
NgREcto, spots were incubated with HEK293T cell conditioned media
or NgREcto-transfected-HEK293T cell conditioned media following for
1 hr following the laminin coating step and before the addition of
dissociated neurons. As shown in FIG. 24, following blockage with
NgREcto, neurite outgrowth inhibition by Nogo or myelin substrates
was partially reversed. Thus, soluble fragments of NgR might serve
physiologically or pharmacologically to reduce
GST-hNogo-A(1055-1120) inhibition of axonal regeneration.
[0301] To test the signaling capability of NgRLI, recombinant
HSVL1NgR preparations were produced and used to infect E7 RGCs.
Infected RGCs were treated with GST-hNogo-A(1055-1120) and growth
cone collapse was assessed (FIG. 20). At high concentrations of
GST-hNogo-A(1055-1120), NgRL1 transduces Nogo signals as
efficiently as wtNgR. However, at 50 nM GST-hNogo-A(1055-1120),
wtNgR is capable of signaling whereas NgRLI infected RGCs are not
responsive to GST-hNogo-A(1055-1120). This indicates that NgRLI is
capable of mediating inhibitory signals in response to Nogo,
however less efficiently than wtNgR. When transfected HEK293T cells
were treated with GST-hNogo-A(1055-1120), the membrane
fractionation profile of wtNgR and L1Ngr remained the same (data
not shown) suggesting that Nogo does not modulate NgR localization
to lipid raft compartments in HEK293T cells. It is however possible
that ligand binding to NgR modifies signaling within the
compartment as is the case for ephrins (Davy et al., Genes Dev.,
13:3125-3135, 1999) or recruits unknown signaling partners to a
lipid raft complex. Because the intracellular signals induced by
Nogo have not been elucidated, it remains to be determined if
ligand binding effects signaling events at caveolar
microdomains.
[0302] Throughout the specification, the word "comprise," or
variations such as "comprises" or "comprising," will be understood
to imply the inclusion of a stated integer or group of integers but
not the exclusion of any other integer or group of integers.
[0303] Although the present invention has been described in detail
with reference to examples above, it is understood that various
modifications can be made without departing from the spirit of the
invention. Therefore, it will be appreciated that the scope of this
invention is encompassed by the embodiments of the inventions
recited herein and the specification rather than the specific
examples which are exemplified below. All cited patents and
publications referred to in this application are herein
incorporated by reference in their entirety. The results of part of
the experiments disclosed herein have been published (GrandPre et
al., (2000) Nature 403, 439-444) after the filing date of U.S.
Provisional Application 60/175,707 from which this application
claims priority, this publication herein incorporated by reference
in its entirety.
Sequence CWU 1
1
5711719DNAHomo sapiensCDS(166)..(1584)Predicted human Nogo receptor
gene 1agcccagcca gagccgggcg gagcggagcg cgccgagcct cgtcccgcgg
ccgggccggg 60gccgggccgt agcggcggcg cctggatgcg gacccggccg cggggagacg
ggcgcccgcc 120ccgaaacgac tttcagtccc cgacgcgccc cgcccaaccc ctacg atg
aag agg gcg 177 Met Lys Arg Ala 1tcc gct gga ggg agc cgg ctg ctg
gca tgg gtg ctg tgg ctg cag gcc 225Ser Ala Gly Gly Ser Arg Leu Leu
Ala Trp Val Leu Trp Leu Gln Ala 5 10 15 20tgg cag gtg gca gcc cca
tgc cca ggt gcc tgc gta tgc tac aat gag 273Trp Gln Val Ala Ala Pro
Cys Pro Gly Ala Cys Val Cys Tyr Asn Glu 25 30 35ccc aag gtg acg aca
agc tgc ccc cag cag ggc ctg cag gct gtg ccc 321Pro Lys Val Thr Thr
Ser Cys Pro Gln Gln Gly Leu Gln Ala Val Pro 40 45 50gtg ggc atc cct
gct gcc agc cag cgc atc ttc ctg cac ggc aac cgc 369Val Gly Ile Pro
Ala Ala Ser Gln Arg Ile Phe Leu His Gly Asn Arg 55 60 65atc tcg cat
gtg cca gct gcc agc ttc cgt gcc tgc cgc aac ctc acc 417Ile Ser His
Val Pro Ala Ala Ser Phe Arg Ala Cys Arg Asn Leu Thr 70 75 80atc ctg
tgg ctg cac tcg aat gtg ctg gcc cga att gat gcg gct gcc 465Ile Leu
Trp Leu His Ser Asn Val Leu Ala Arg Ile Asp Ala Ala Ala 85 90 95
100ttc act ggc ctg gcc ctc ctg gag cag ctg gac ctc agc gat aat gca
513Phe Thr Gly Leu Ala Leu Leu Glu Gln Leu Asp Leu Ser Asp Asn Ala
105 110 115cag ctc cgg tct gtg gac cct gcc aca ttc cac ggc ctg ggc
cgc cta 561Gln Leu Arg Ser Val Asp Pro Ala Thr Phe His Gly Leu Gly
Arg Leu 120 125 130cac acg ctg cac ctg gac cgc tgc ggc ctg cag gag
ctg ggc ccg ggg 609His Thr Leu His Leu Asp Arg Cys Gly Leu Gln Glu
Leu Gly Pro Gly 135 140 145ctg ttc cgc ggc ctg gct gcc ctg cag tac
ctc tac ctg cag gac aac 657Leu Phe Arg Gly Leu Ala Ala Leu Gln Tyr
Leu Tyr Leu Gln Asp Asn 150 155 160gcg ctg cag gca ctg cct gat gac
acc ttc cgc gac ctg ggc aac ctc 705Ala Leu Gln Ala Leu Pro Asp Asp
Thr Phe Arg Asp Leu Gly Asn Leu165 170 175 180aca cac ctc ttc ctg
cac ggc aac cgc atc tcc agc gtg ccc gag cgc 753Thr His Leu Phe Leu
His Gly Asn Arg Ile Ser Ser Val Pro Glu Arg 185 190 195gcc ttc cgt
ggg ctg cac agc ctc gac cgt ctc cta ctg cac cag aac 801Ala Phe Arg
Gly Leu His Ser Leu Asp Arg Leu Leu Leu His Gln Asn 200 205 210cgc
gtg gcc cat gtg cac ccg cat gcc ttc cgt gac ctt ggc cgc ctc 849Arg
Val Ala His Val His Pro His Ala Phe Arg Asp Leu Gly Arg Leu 215 220
225atg aca ctc tat ctg ttt gcc aac aat cta tca gcg ctg ccc act gag
897Met Thr Leu Tyr Leu Phe Ala Asn Asn Leu Ser Ala Leu Pro Thr Glu
230 235 240gcc ctg gcc ccc ctg cgt gcc ctg cag tac ctg agg ctc aac
gac aac 945Ala Leu Ala Pro Leu Arg Ala Leu Gln Tyr Leu Arg Leu Asn
Asp Asn245 250 255 260ccc tgg gtg tgt gac tgc cgg gca cgc cca ctc
tgg gcc tgg ctg cag 993Pro Trp Val Cys Asp Cys Arg Ala Arg Pro Leu
Trp Ala Trp Leu Gln 265 270 275aag ttc cgc ggc tcc tcc tcc gag gtg
ccc tgc agc ctc ccg caa cgc 1041Lys Phe Arg Gly Ser Ser Ser Glu Val
Pro Cys Ser Leu Pro Gln Arg 280 285 290ctg gct ggc cgt gac ctc aaa
cgc cta gct gcc aat gac ctg cag ggc 1089Leu Ala Gly Arg Asp Leu Lys
Arg Leu Ala Ala Asn Asp Leu Gln Gly 295 300 305tgc gct gtg gcc acc
ggc cct tac cat ccc atc tgg acc ggc agg gcc 1137Cys Ala Val Ala Thr
Gly Pro Tyr His Pro Ile Trp Thr Gly Arg Ala 310 315 320acc gat gag
gag ccg ctg ggg ctt ccc aag tgc tgc cag cca gat gcc 1185Thr Asp Glu
Glu Pro Leu Gly Leu Pro Lys Cys Cys Gln Pro Asp Ala325 330 335
340gct gac aag gcc tca gta ctg gag cct gga aga cca gct tcg gca ggc
1233Ala Asp Lys Ala Ser Val Leu Glu Pro Gly Arg Pro Ala Ser Ala Gly
345 350 355aat gcg ctg aag gga cgc gtg ccg ccc ggt gac agc ccg ccg
ggc aac 1281Asn Ala Leu Lys Gly Arg Val Pro Pro Gly Asp Ser Pro Pro
Gly Asn 360 365 370ggc tct ggc cca cgg cac atc aat gac tca ccc ttt
ggg act ctg cct 1329Gly Ser Gly Pro Arg His Ile Asn Asp Ser Pro Phe
Gly Thr Leu Pro 375 380 385ggc tct gct gag ccc ccg ctc act gca gtg
cgg ccc gag ggc tcc gag 1377Gly Ser Ala Glu Pro Pro Leu Thr Ala Val
Arg Pro Glu Gly Ser Glu 390 395 400cca cca ggg ttc ccc acc tcg ggc
cct cgc cgg agg cca ggc tgt tca 1425Pro Pro Gly Phe Pro Thr Ser Gly
Pro Arg Arg Arg Pro Gly Cys Ser405 410 415 420cgc aag aac cgc acc
cgc agc cac tgc cgt ctg ggc cag gca ggc agc 1473Arg Lys Asn Arg Thr
Arg Ser His Cys Arg Leu Gly Gln Ala Gly Ser 425 430 435ggg ggt ggc
ggg act ggt gac tca gaa ggc tca ggt gcc cta ccc agc 1521Gly Gly Gly
Gly Thr Gly Asp Ser Glu Gly Ser Gly Ala Leu Pro Ser 440 445 450ctc
acc tgc agc ctc acc ccc ctg ggc ctg gcg ctg gtg ctg tgg aca 1569Leu
Thr Cys Ser Leu Thr Pro Leu Gly Leu Ala Leu Val Leu Trp Thr 455 460
465gtg ctt ggg ccc tgc tgacccccag cggacacaag agcgtgctca gcagccaggt
1624Val Leu Gly Pro Cys 470gtgtgtacat acggggtctc tctccacgcc
gccaagccag ccgggcggcc gacccgtggg 1684gcaggccagg ccaggtcctc
cctgatggac gcctg 17192473PRTHomo sapiens 2Met Lys Arg Ala Ser Ala
Gly Gly Ser Arg Leu Leu Ala Trp Val Leu 1 5 10 15Trp Leu Gln Ala
Trp Gln Val Ala Ala Pro Cys Pro Gly Ala Cys Val 20 25 30Cys Tyr Asn
Glu Pro Lys Val Thr Thr Ser Cys Pro Gln Gln Gly Leu 35 40 45Gln Ala
Val Pro Val Gly Ile Pro Ala Ala Ser Gln Arg Ile Phe Leu 50 55 60His
Gly Asn Arg Ile Ser His Val Pro Ala Ala Ser Phe Arg Ala Cys 65 70
75 80Arg Asn Leu Thr Ile Leu Trp Leu His Ser Asn Val Leu Ala Arg
Ile 85 90 95Asp Ala Ala Ala Phe Thr Gly Leu Ala Leu Leu Glu Gln Leu
Asp Leu 100 105 110Ser Asp Asn Ala Gln Leu Arg Ser Val Asp Pro Ala
Thr Phe His Gly 115 120 125Leu Gly Arg Leu His Thr Leu His Leu Asp
Arg Cys Gly Leu Gln Glu 130 135 140Leu Gly Pro Gly Leu Phe Arg Gly
Leu Ala Ala Leu Gln Tyr Leu Tyr145 150 155 160Leu Gln Asp Asn Ala
Leu Gln Ala Leu Pro Asp Asp Thr Phe Arg Asp 165 170 175Leu Gly Asn
Leu Thr His Leu Phe Leu His Gly Asn Arg Ile Ser Ser 180 185 190Val
Pro Glu Arg Ala Phe Arg Gly Leu His Ser Leu Asp Arg Leu Leu 195 200
205Leu His Gln Asn Arg Val Ala His Val His Pro His Ala Phe Arg Asp
210 215 220Leu Gly Arg Leu Met Thr Leu Tyr Leu Phe Ala Asn Asn Leu
Ser Ala225 230 235 240Leu Pro Thr Glu Ala Leu Ala Pro Leu Arg Ala
Leu Gln Tyr Leu Arg 245 250 255Leu Asn Asp Asn Pro Trp Val Cys Asp
Cys Arg Ala Arg Pro Leu Trp 260 265 270Ala Trp Leu Gln Lys Phe Arg
Gly Ser Ser Ser Glu Val Pro Cys Ser 275 280 285Leu Pro Gln Arg Leu
Ala Gly Arg Asp Leu Lys Arg Leu Ala Ala Asn 290 295 300Asp Leu Gln
Gly Cys Ala Val Ala Thr Gly Pro Tyr His Pro Ile Trp305 310 315
320Thr Gly Arg Ala Thr Asp Glu Glu Pro Leu Gly Leu Pro Lys Cys Cys
325 330 335Gln Pro Asp Ala Ala Asp Lys Ala Ser Val Leu Glu Pro Gly
Arg Pro 340 345 350Ala Ser Ala Gly Asn Ala Leu Lys Gly Arg Val Pro
Pro Gly Asp Ser 355 360 365Pro Pro Gly Asn Gly Ser Gly Pro Arg His
Ile Asn Asp Ser Pro Phe 370 375 380Gly Thr Leu Pro Gly Ser Ala Glu
Pro Pro Leu Thr Ala Val Arg Pro385 390 395 400Glu Gly Ser Glu Pro
Pro Gly Phe Pro Thr Ser Gly Pro Arg Arg Arg 405 410 415Pro Gly Cys
Ser Arg Lys Asn Arg Thr Arg Ser His Cys Arg Leu Gly 420 425 430Gln
Ala Gly Ser Gly Gly Gly Gly Thr Gly Asp Ser Glu Gly Ser Gly 435 440
445Ala Leu Pro Ser Leu Thr Cys Ser Leu Thr Pro Leu Gly Leu Ala Leu
450 455 460Val Leu Trp Thr Val Leu Gly Pro Cys465 47031866DNAMus
musculusCDS(178)..(1596)Mouse Nogo receptor cDNA 3agccgcagcc
cgcgagccca gcccggcccg gtagagcgga gcgccggagc ctcgtcccgc 60ggccgggccg
ggaccgggcc ggagcagcgg cgcctggatg cggacccggc cgcgcgcaga
120cgggcgcccg ccccgaagcc gcttccagtg cccgacgcgc cccgctcgac cccgaag
177atg aag agg gcg tcc tcc gga gga agc agg ctg ctg gca tgg gtg tta
225Met Lys Arg Ala Ser Ser Gly Gly Ser Arg Leu Leu Ala Trp Val Leu
1 5 10 15tgg cta cag gcc tgg agg gta gca aca cca tgc cct ggt gct
tgt gtg 273Trp Leu Gln Ala Trp Arg Val Ala Thr Pro Cys Pro Gly Ala
Cys Val 20 25 30tgc tac aat gag ccc aag gta aca aca agc tgc ccc cag
cag ggt ctg 321Cys Tyr Asn Glu Pro Lys Val Thr Thr Ser Cys Pro Gln
Gln Gly Leu 35 40 45cag gct gtg ccc act ggc atc cca gcc tct agc cag
cga atc ttc ctg 369Gln Ala Val Pro Thr Gly Ile Pro Ala Ser Ser Gln
Arg Ile Phe Leu 50 55 60cat ggc aac cga atc tct cac gtg cca gct gcg
agc ttc cag tca tgc 417His Gly Asn Arg Ile Ser His Val Pro Ala Ala
Ser Phe Gln Ser Cys 65 70 75 80cga aat ctc act atc ctg tgg ctg cac
tct aat gcg ctg gct cgg atc 465Arg Asn Leu Thr Ile Leu Trp Leu His
Ser Asn Ala Leu Ala Arg Ile 85 90 95gat gct gct gcc ttc act ggt ctg
acc ctc ctg gag caa cta gat ctt 513Asp Ala Ala Ala Phe Thr Gly Leu
Thr Leu Leu Glu Gln Leu Asp Leu 100 105 110agt gat aat gca cag ctt
cat gtc gtg gac cct acc acg ttc cac ggc 561Ser Asp Asn Ala Gln Leu
His Val Val Asp Pro Thr Thr Phe His Gly 115 120 125ctg ggc cac ctg
cac aca ctg cac cta gac cga tgt ggc ctg cgg gag 609Leu Gly His Leu
His Thr Leu His Leu Asp Arg Cys Gly Leu Arg Glu 130 135 140ctg ggt
ccc ggc cta ttc cgt gga cta gca gct ctg cag tac ctc tac 657Leu Gly
Pro Gly Leu Phe Arg Gly Leu Ala Ala Leu Gln Tyr Leu Tyr145 150 155
160cta caa gac aac aat ctg cag gca ctc cct gac aac acc ttt cga gac
705Leu Gln Asp Asn Asn Leu Gln Ala Leu Pro Asp Asn Thr Phe Arg Asp
165 170 175ctg ggc aac ctc acg cat ctc ttt ctg cat ggc aac cgt atc
ccc agt 753Leu Gly Asn Leu Thr His Leu Phe Leu His Gly Asn Arg Ile
Pro Ser 180 185 190gtg cct gag cac gct ttc cgt ggc ctg cac agt ctt
gac cgc ctc ctc 801Val Pro Glu His Ala Phe Arg Gly Leu His Ser Leu
Asp Arg Leu Leu 195 200 205ttg cac cag aac cat gtg gct cgt gtg cac
cca cat gcc ttc cgg gac 849Leu His Gln Asn His Val Ala Arg Val His
Pro His Ala Phe Arg Asp 210 215 220ctt ggc cgc ctc atg acc ctc tac
ctg ttt gcc aac aac ctc tcc atg 897Leu Gly Arg Leu Met Thr Leu Tyr
Leu Phe Ala Asn Asn Leu Ser Met225 230 235 240ctg cct gca gag gtc
cta atg ccc ctg agg tct ctg cag tac ctg cga 945Leu Pro Ala Glu Val
Leu Met Pro Leu Arg Ser Leu Gln Tyr Leu Arg 245 250 255ctc aat gac
aac ccc tgg gtg tgt gac tgc cgg gca cgt cca ctc tgg 993Leu Asn Asp
Asn Pro Trp Val Cys Asp Cys Arg Ala Arg Pro Leu Trp 260 265 270gcc
tgg ctg cag aag ttc cga ggt tcc tca tca gag gtg ccc tgc aac 1041Ala
Trp Leu Gln Lys Phe Arg Gly Ser Ser Ser Glu Val Pro Cys Asn 275 280
285ctg ccc caa cgc ctg gca gac cgt gat ctt aag cgc ctc gct gcc agt
1089Leu Pro Gln Arg Leu Ala Asp Arg Asp Leu Lys Arg Leu Ala Ala Ser
290 295 300gac cta gag ggc tgt gct gtg gct tca gga ccc ttc cgt ccc
atc cag 1137Asp Leu Glu Gly Cys Ala Val Ala Ser Gly Pro Phe Arg Pro
Ile Gln305 310 315 320acc agt cag ctc act gat gag gag ctg ctg agc
ctc ccc aag tgc tgc 1185Thr Ser Gln Leu Thr Asp Glu Glu Leu Leu Ser
Leu Pro Lys Cys Cys 325 330 335cag cca gat gct gca gac aaa gcc tca
gta ctg gaa ccc ggg agg cca 1233Gln Pro Asp Ala Ala Asp Lys Ala Ser
Val Leu Glu Pro Gly Arg Pro 340 345 350gct tct gcc gga aac gcc ctc
aag gga cgt gtg cct ccc ggt gac act 1281Ala Ser Ala Gly Asn Ala Leu
Lys Gly Arg Val Pro Pro Gly Asp Thr 355 360 365cca cca ggc aat ggc
tca ggc cct cgg cac atc aat gac tct cca ttt 1329Pro Pro Gly Asn Gly
Ser Gly Pro Arg His Ile Asn Asp Ser Pro Phe 370 375 380gga act ttg
ccc agc tct gca gag ccc cca ctg act gcc ctg cgg cct 1377Gly Thr Leu
Pro Ser Ser Ala Glu Pro Pro Leu Thr Ala Leu Arg Pro385 390 395
400ggg ggt tcc gag cca cca gga ctt ccc acc act ggt ccc cgc agg agg
1425Gly Gly Ser Glu Pro Pro Gly Leu Pro Thr Thr Gly Pro Arg Arg Arg
405 410 415cca ggt tgt tcc cgg aag aat cgc acc cgc agc cac tgc cgt
ctg ggc 1473Pro Gly Cys Ser Arg Lys Asn Arg Thr Arg Ser His Cys Arg
Leu Gly 420 425 430cag gcg gga agt ggg gcc agt gga aca ggg gac gca
gag ggt tca ggg 1521Gln Ala Gly Ser Gly Ala Ser Gly Thr Gly Asp Ala
Glu Gly Ser Gly 435 440 445gct ctg cct gct ctg gcc tgc agc ctt gct
cct ctg ggc ctt gca ctg 1569Ala Leu Pro Ala Leu Ala Cys Ser Leu Ala
Pro Leu Gly Leu Ala Leu 450 455 460gta ctt tgg aca gtg ctt ggg ccc
tgc tgaccagcca ccagccacca 1616Val Leu Trp Thr Val Leu Gly Pro
Cys465 470ggtgtgtgta catatggggt ctccctccac gccgccagcc agagccaggg
acaggctctg 1676aggggcaggc caggccctcc ctgacagatg cctccccacc
agcccacccc catctccacc 1736ccatcatgtt tacagggttc cgggggtggc
ggttggttca caaccccaac ttccacccgg 1796atcgcggcat atagacatat
gaaatttatt ttacttgcgt aaaatatcgg atgacgtgga 1856ataaacagct
18664473PRTMus musculus 4Met Lys Arg Ala Ser Ser Gly Gly Ser Arg
Leu Leu Ala Trp Val Leu 1 5 10 15Trp Leu Gln Ala Trp Arg Val Ala
Thr Pro Cys Pro Gly Ala Cys Val 20 25 30Cys Tyr Asn Glu Pro Lys Val
Thr Thr Ser Cys Pro Gln Gln Gly Leu 35 40 45Gln Ala Val Pro Thr Gly
Ile Pro Ala Ser Ser Gln Arg Ile Phe Leu 50 55 60His Gly Asn Arg Ile
Ser His Val Pro Ala Ala Ser Phe Gln Ser Cys 65 70 75 80Arg Asn Leu
Thr Ile Leu Trp Leu His Ser Asn Ala Leu Ala Arg Ile 85 90 95Asp Ala
Ala Ala Phe Thr Gly Leu Thr Leu Leu Glu Gln Leu Asp Leu 100 105
110Ser Asp Asn Ala Gln Leu His Val Val Asp Pro Thr Thr Phe His Gly
115 120 125Leu Gly His Leu His Thr Leu His Leu Asp Arg Cys Gly Leu
Arg Glu 130 135 140Leu Gly Pro Gly Leu Phe Arg Gly Leu Ala Ala Leu
Gln Tyr Leu Tyr145 150 155 160Leu Gln Asp Asn Asn Leu Gln Ala Leu
Pro Asp Asn Thr Phe Arg Asp 165 170 175Leu Gly Asn Leu Thr His Leu
Phe Leu His Gly Asn Arg Ile Pro Ser 180 185 190Val Pro Glu His Ala
Phe Arg Gly Leu His Ser Leu Asp Arg Leu Leu 195 200 205Leu His Gln
Asn His Val Ala Arg Val His Pro His Ala Phe Arg Asp 210 215 220Leu
Gly Arg Leu Met Thr Leu Tyr Leu Phe Ala Asn Asn Leu Ser Met225 230
235 240Leu Pro Ala Glu Val Leu Met Pro Leu Arg Ser Leu Gln Tyr Leu
Arg 245 250 255Leu Asn Asp Asn Pro Trp Val Cys Asp Cys Arg Ala Arg
Pro Leu Trp 260 265 270Ala Trp Leu Gln Lys Phe Arg Gly Ser Ser Ser
Glu Val Pro Cys Asn 275 280 285Leu Pro Gln Arg Leu Ala Asp Arg Asp
Leu Lys Arg Leu Ala Ala Ser 290 295 300Asp Leu Glu Gly Cys Ala Val
Ala Ser Gly Pro Phe Arg Pro Ile Gln305
310 315 320Thr Ser Gln Leu Thr Asp Glu Glu Leu Leu Ser Leu Pro Lys
Cys Cys 325 330 335Gln Pro Asp Ala Ala Asp Lys Ala Ser Val Leu Glu
Pro Gly Arg Pro 340 345 350Ala Ser Ala Gly Asn Ala Leu Lys Gly Arg
Val Pro Pro Gly Asp Thr 355 360 365Pro Pro Gly Asn Gly Ser Gly Pro
Arg His Ile Asn Asp Ser Pro Phe 370 375 380Gly Thr Leu Pro Ser Ser
Ala Glu Pro Pro Leu Thr Ala Leu Arg Pro385 390 395 400Gly Gly Ser
Glu Pro Pro Gly Leu Pro Thr Thr Gly Pro Arg Arg Arg 405 410 415Pro
Gly Cys Ser Arg Lys Asn Arg Thr Arg Ser His Cys Arg Leu Gly 420 425
430Gln Ala Gly Ser Gly Ala Ser Gly Thr Gly Asp Ala Glu Gly Ser Gly
435 440 445Ala Leu Pro Ala Leu Ala Cys Ser Leu Ala Pro Leu Gly Leu
Ala Leu 450 455 460Val Leu Trp Thr Val Leu Gly Pro Cys465
47054053DNAHomo sapiensCDS(135)..(3710)Human DNA encoding for Nogo
protein (KIAA0886, GenBank Accession No. AB020693) 5caccacagta
ggtccctcgg ctcagtcggc ccagcccctc tcagtcctcc ccaaccccca 60caaccgcccg
cggctctgag acgcggcccc ggcggcggcg gcagcagctg cagcatcatc
120tccaccctcc agcc atg gaa gac ctg gac cag tct cct ctg gtc tcg tcc
170 Met Glu Asp Leu Asp Gln Ser Pro Leu Val Ser Ser 1 5 10tcg gac
agc cca ccc cgg ccg cag ccc gcg ttc aag tac cag ttc gtg 218Ser Asp
Ser Pro Pro Arg Pro Gln Pro Ala Phe Lys Tyr Gln Phe Val 15 20 25agg
gag ccc gag gac gag gag gaa gaa gag gag gag gaa gag gag gac 266Arg
Glu Pro Glu Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp 30 35
40gag gac gaa gac ctg gag gag ctg gag gtg ctg gag agg aag ccc gcc
314Glu Asp Glu Asp Leu Glu Glu Leu Glu Val Leu Glu Arg Lys Pro Ala
45 50 55 60gcc ggg ctg tcc gcg gcc cca gtg ccc acc gcc cct gcc gcc
ggc gcg 362Ala Gly Leu Ser Ala Ala Pro Val Pro Thr Ala Pro Ala Ala
Gly Ala 65 70 75ccc ctg atg gac ttc gga aat gac ttc gtg ccg ccg gcg
ccc cgg gga 410Pro Leu Met Asp Phe Gly Asn Asp Phe Val Pro Pro Ala
Pro Arg Gly 80 85 90ccc ctg ccg gcc gct ccc ccc gtc gcc ccg gag cgg
cag ccg tct tgg 458Pro Leu Pro Ala Ala Pro Pro Val Ala Pro Glu Arg
Gln Pro Ser Trp 95 100 105gac ccg agc ccg gtg tcg tcg acc gtg ccc
gcg cca tcc ccg ctg tct 506Asp Pro Ser Pro Val Ser Ser Thr Val Pro
Ala Pro Ser Pro Leu Ser 110 115 120gct gcc gca gtc tcg ccc tcc aag
ctc cct gag gac gac gag cct ccg 554Ala Ala Ala Val Ser Pro Ser Lys
Leu Pro Glu Asp Asp Glu Pro Pro125 130 135 140gcc cgg cct ccc cct
cct ccc ccg gcc agc gtg agc ccc cag gca gag 602Ala Arg Pro Pro Pro
Pro Pro Pro Ala Ser Val Ser Pro Gln Ala Glu 145 150 155ccc gtg tgg
acc ccg cca gcc ccg gct ccc gcc gcg ccc ccc tcc acc 650Pro Val Trp
Thr Pro Pro Ala Pro Ala Pro Ala Ala Pro Pro Ser Thr 160 165 170ccg
gcc gcg ccc aag cgc agg ggc tcc tcg ggc tca gtg gat gag acc 698Pro
Ala Ala Pro Lys Arg Arg Gly Ser Ser Gly Ser Val Asp Glu Thr 175 180
185ctt ttt gct ctt cct gct gca tct gag cct gtg ata cgc tcc tct gca
746Leu Phe Ala Leu Pro Ala Ala Ser Glu Pro Val Ile Arg Ser Ser Ala
190 195 200gaa aat atg gac ttg aag gag cag cca ggt aac act att tcg
gct ggt 794Glu Asn Met Asp Leu Lys Glu Gln Pro Gly Asn Thr Ile Ser
Ala Gly205 210 215 220caa gag gat ttc cca tct gtc ctg ctt gaa act
gct gct tct ctt cct 842Gln Glu Asp Phe Pro Ser Val Leu Leu Glu Thr
Ala Ala Ser Leu Pro 225 230 235tct ctg tct cct ctc tca gcc gct tct
ttc aaa gaa cat gaa tac ctt 890Ser Leu Ser Pro Leu Ser Ala Ala Ser
Phe Lys Glu His Glu Tyr Leu 240 245 250ggt aat ttg tca aca gta tta
ccc act gaa gga aca ctt caa gaa aat 938Gly Asn Leu Ser Thr Val Leu
Pro Thr Glu Gly Thr Leu Gln Glu Asn 255 260 265gtc agt gaa gct tct
aaa gag gtc tca gag aag gca aaa act cta ctc 986Val Ser Glu Ala Ser
Lys Glu Val Ser Glu Lys Ala Lys Thr Leu Leu 270 275 280ata gat aga
gat tta aca gag ttt tca gaa tta gaa tac tca gaa atg 1034Ile Asp Arg
Asp Leu Thr Glu Phe Ser Glu Leu Glu Tyr Ser Glu Met285 290 295
300gga tca tcg ttc agt gtc tct cca aaa gca gaa tct gcc gta ata gta
1082Gly Ser Ser Phe Ser Val Ser Pro Lys Ala Glu Ser Ala Val Ile Val
305 310 315gca aat cct agg gaa gaa ata atc gtg aaa aat aaa gat gaa
gaa gag 1130Ala Asn Pro Arg Glu Glu Ile Ile Val Lys Asn Lys Asp Glu
Glu Glu 320 325 330aag tta gtt agt aat aac atc ctt cat aat caa caa
gag tta cct aca 1178Lys Leu Val Ser Asn Asn Ile Leu His Asn Gln Gln
Glu Leu Pro Thr 335 340 345gct ctt act aaa ttg gtt aaa gag gat gaa
gtt gtg tct tca gaa aaa 1226Ala Leu Thr Lys Leu Val Lys Glu Asp Glu
Val Val Ser Ser Glu Lys 350 355 360gca aaa gac agt ttt aat gaa aag
aga gtt gca gtg gaa gct cct atg 1274Ala Lys Asp Ser Phe Asn Glu Lys
Arg Val Ala Val Glu Ala Pro Met365 370 375 380agg gag gaa tat gca
gac ttc aaa cca ttt gag cga gta tgg gaa gtg 1322Arg Glu Glu Tyr Ala
Asp Phe Lys Pro Phe Glu Arg Val Trp Glu Val 385 390 395aaa gat agt
aag gaa gat agt gat atg ttg gct gct gga ggt aaa atc 1370Lys Asp Ser
Lys Glu Asp Ser Asp Met Leu Ala Ala Gly Gly Lys Ile 400 405 410gag
agc aac ttg gaa agt aaa gtg gat aaa aaa tgt ttt gca gat agc 1418Glu
Ser Asn Leu Glu Ser Lys Val Asp Lys Lys Cys Phe Ala Asp Ser 415 420
425ctt gag caa act aat cac gaa aaa gat agt gag agt agt aat gat gat
1466Leu Glu Gln Thr Asn His Glu Lys Asp Ser Glu Ser Ser Asn Asp Asp
430 435 440act tct ttc ccc agt acg cca gaa ggt ata aag gat cgt tca
gga gca 1514Thr Ser Phe Pro Ser Thr Pro Glu Gly Ile Lys Asp Arg Ser
Gly Ala445 450 455 460tat atc aca tgt gct ccc ttt aac cca gca gca
act gag agc att gca 1562Tyr Ile Thr Cys Ala Pro Phe Asn Pro Ala Ala
Thr Glu Ser Ile Ala 465 470 475aca aac att ttt cct ttg tta gga gat
cct act tca gaa aat aag acc 1610Thr Asn Ile Phe Pro Leu Leu Gly Asp
Pro Thr Ser Glu Asn Lys Thr 480 485 490gat gaa aaa aaa ata gaa gaa
aag aag gcc caa ata gta aca gag aag 1658Asp Glu Lys Lys Ile Glu Glu
Lys Lys Ala Gln Ile Val Thr Glu Lys 495 500 505aat act agc acc aaa
aca tca aac cct ttt ctt gta gca gca cag gat 1706Asn Thr Ser Thr Lys
Thr Ser Asn Pro Phe Leu Val Ala Ala Gln Asp 510 515 520tct gag aca
gat tat gtc aca aca gat aat tta aca aag gtg act gag 1754Ser Glu Thr
Asp Tyr Val Thr Thr Asp Asn Leu Thr Lys Val Thr Glu525 530 535
540gaa gtc gtg gca aac atg cct gaa ggc ctg act cca gat tta gta cag
1802Glu Val Val Ala Asn Met Pro Glu Gly Leu Thr Pro Asp Leu Val Gln
545 550 555gaa gca tgt gaa agt gaa ttg aat gaa gtt act ggt aca aag
att gct 1850Glu Ala Cys Glu Ser Glu Leu Asn Glu Val Thr Gly Thr Lys
Ile Ala 560 565 570tat gaa aca aaa atg gac ttg gtt caa aca tca gaa
gtt atg caa gag 1898Tyr Glu Thr Lys Met Asp Leu Val Gln Thr Ser Glu
Val Met Gln Glu 575 580 585tca ctc tat cct gca gca cag ctt tgc cca
tca ttt gaa gag tca gaa 1946Ser Leu Tyr Pro Ala Ala Gln Leu Cys Pro
Ser Phe Glu Glu Ser Glu 590 595 600gct act cct tca cca gtt ttg cct
gac att gtt atg gaa gca cca ttg 1994Ala Thr Pro Ser Pro Val Leu Pro
Asp Ile Val Met Glu Ala Pro Leu605 610 615 620aat tct gca gtt cct
agt gct ggt gct tcc gtg ata cag ccc agc tca 2042Asn Ser Ala Val Pro
Ser Ala Gly Ala Ser Val Ile Gln Pro Ser Ser 625 630 635tca cca tta
gaa gct tct tca gtt aat tat gaa agc ata aaa cat gag 2090Ser Pro Leu
Glu Ala Ser Ser Val Asn Tyr Glu Ser Ile Lys His Glu 640 645 650cct
gaa aac ccc cca cca tat gaa gag gcc atg agt gta tca cta aaa 2138Pro
Glu Asn Pro Pro Pro Tyr Glu Glu Ala Met Ser Val Ser Leu Lys 655 660
665aaa gta tca gga ata aag gaa gaa att aaa gag cct gaa aat att aat
2186Lys Val Ser Gly Ile Lys Glu Glu Ile Lys Glu Pro Glu Asn Ile Asn
670 675 680gca gct ctt caa gaa aca gaa gct cct tat ata tct att gca
tgt gat 2234Ala Ala Leu Gln Glu Thr Glu Ala Pro Tyr Ile Ser Ile Ala
Cys Asp685 690 695 700tta att aaa gaa aca aag ctt tct gct gaa cca
gct ccg gat ttc tct 2282Leu Ile Lys Glu Thr Lys Leu Ser Ala Glu Pro
Ala Pro Asp Phe Ser 705 710 715gat tat tca gaa atg gca aaa gtt gaa
cag cca gtg cct gat cat tct 2330Asp Tyr Ser Glu Met Ala Lys Val Glu
Gln Pro Val Pro Asp His Ser 720 725 730gag cta gtt gaa gat tcc tca
cct gat tct gaa cca gtt gac tta ttt 2378Glu Leu Val Glu Asp Ser Ser
Pro Asp Ser Glu Pro Val Asp Leu Phe 735 740 745agt gat gat tca ata
cct gac gtt cca caa aaa caa gat gaa act gtg 2426Ser Asp Asp Ser Ile
Pro Asp Val Pro Gln Lys Gln Asp Glu Thr Val 750 755 760atg ctt gtg
aaa gaa agt ctc act gag act tca ttt gag tca atg ata 2474Met Leu Val
Lys Glu Ser Leu Thr Glu Thr Ser Phe Glu Ser Met Ile765 770 775
780gaa tat gaa aat aag gaa aaa ctc agt gct ttg cca cct gag gga gga
2522Glu Tyr Glu Asn Lys Glu Lys Leu Ser Ala Leu Pro Pro Glu Gly Gly
785 790 795aag cca tat ttg gaa tct ttt aag ctc agt tta gat aac aca
aaa gat 2570Lys Pro Tyr Leu Glu Ser Phe Lys Leu Ser Leu Asp Asn Thr
Lys Asp 800 805 810acc ctg tta cct gat gaa gtt tca aca ttg agc aaa
aag gag aaa att 2618Thr Leu Leu Pro Asp Glu Val Ser Thr Leu Ser Lys
Lys Glu Lys Ile 815 820 825cct ttg cag atg gag gag ctc agt act gca
gtt tat tca aat gat gac 2666Pro Leu Gln Met Glu Glu Leu Ser Thr Ala
Val Tyr Ser Asn Asp Asp 830 835 840tta ttt att tct aag gaa gca cag
ata aga gaa act gaa acg ttt tca 2714Leu Phe Ile Ser Lys Glu Ala Gln
Ile Arg Glu Thr Glu Thr Phe Ser845 850 855 860gat tca tct cca att
gaa att ata gat gag ttc cct aca ttg atc agt 2762Asp Ser Ser Pro Ile
Glu Ile Ile Asp Glu Phe Pro Thr Leu Ile Ser 865 870 875tct aaa act
gat tca ttt tct aaa tta gcc agg gaa tat act gac cta 2810Ser Lys Thr
Asp Ser Phe Ser Lys Leu Ala Arg Glu Tyr Thr Asp Leu 880 885 890gaa
gta tcc cac aaa agt gaa att gct aat gcc ccg gat gga gct ggg 2858Glu
Val Ser His Lys Ser Glu Ile Ala Asn Ala Pro Asp Gly Ala Gly 895 900
905tca ttg cct tgc aca gaa ttg ccc cat gac ctt tct ttg aag aac ata
2906Ser Leu Pro Cys Thr Glu Leu Pro His Asp Leu Ser Leu Lys Asn Ile
910 915 920caa ccc aaa gtt gaa gag aaa atc agt ttc tca gat gac ttt
tct aaa 2954Gln Pro Lys Val Glu Glu Lys Ile Ser Phe Ser Asp Asp Phe
Ser Lys925 930 935 940aat ggg tct gct aca tca aag gtg ctc tta ttg
cct cca gat gtt tct 3002Asn Gly Ser Ala Thr Ser Lys Val Leu Leu Leu
Pro Pro Asp Val Ser 945 950 955gct ttg gcc act caa gca gag ata gag
agc ata gtt aaa ccc aaa gtt 3050Ala Leu Ala Thr Gln Ala Glu Ile Glu
Ser Ile Val Lys Pro Lys Val 960 965 970ctt gtg aaa gaa gct gag aaa
aaa ctt cct tcc gat aca gaa aaa gag 3098Leu Val Lys Glu Ala Glu Lys
Lys Leu Pro Ser Asp Thr Glu Lys Glu 975 980 985gac aga tca cca tct
gct ata ttt tca gca gag ctg agt aaa act tca 3146Asp Arg Ser Pro Ser
Ala Ile Phe Ser Ala Glu Leu Ser Lys Thr Ser 990 995 1000gtt gtt gac
ctc ctg tac tgg aga gac att aag aag act gga gtg gtg 3194Val Val Asp
Leu Leu Tyr Trp Arg Asp Ile Lys Lys Thr Gly Val Val1005 1010 1015
1020ttt ggt gcc agc cta ttc ctg ctg ctt tca ttg aca gta ttc agc att
3242Phe Gly Ala Ser Leu Phe Leu Leu Leu Ser Leu Thr Val Phe Ser Ile
1025 1030 1035gtg agc gta aca gcc tac att gcc ttg gcc ctg ctc tct
gtg acc atc 3290Val Ser Val Thr Ala Tyr Ile Ala Leu Ala Leu Leu Ser
Val Thr Ile 1040 1045 1050agc ttt agg ata tac aag ggt gtg atc caa
gct atc cag aaa tca gat 3338Ser Phe Arg Ile Tyr Lys Gly Val Ile Gln
Ala Ile Gln Lys Ser Asp 1055 1060 1065gaa ggc cac cca ttc agg gca
tat ctg gaa tct gaa gtt gct ata tct 3386Glu Gly His Pro Phe Arg Ala
Tyr Leu Glu Ser Glu Val Ala Ile Ser 1070 1075 1080gag gag ttg gtt
cag aag tac agt aat tct gct ctt ggt cat gtg aac 3434Glu Glu Leu Val
Gln Lys Tyr Ser Asn Ser Ala Leu Gly His Val Asn1085 1090 1095
1100tgc acg ata aag gaa ctc agg cgc ctc ttc tta gtt gat gat tta gtt
3482Cys Thr Ile Lys Glu Leu Arg Arg Leu Phe Leu Val Asp Asp Leu Val
1105 1110 1115gat tct ctg aag ttt gca gtg ttg atg tgg gta ttt acc
tat gtt ggt 3530Asp Ser Leu Lys Phe Ala Val Leu Met Trp Val Phe Thr
Tyr Val Gly 1120 1125 1130gcc ttg ttt aat ggt ctg aca cta ctg att
ttg gct ctc att tca ctc 3578Ala Leu Phe Asn Gly Leu Thr Leu Leu Ile
Leu Ala Leu Ile Ser Leu 1135 1140 1145ttc agt gtt cct gtt att tat
gaa cgg cat cag gca cag ata gat cat 3626Phe Ser Val Pro Val Ile Tyr
Glu Arg His Gln Ala Gln Ile Asp His 1150 1155 1160tat cta gga ctt
gca aat aag aat gtt aaa gat gct atg gct aaa atc 3674Tyr Leu Gly Leu
Ala Asn Lys Asn Val Lys Asp Ala Met Ala Lys Ile1165 1170 1175
1180caa gca aaa atc cct gga ttg aag cgc aaa gct gaa tgaaaacgcc
3720Gln Ala Lys Ile Pro Gly Leu Lys Arg Lys Ala Glu 1185
1190caaaataatt agtaggagtt catctttaaa ggggatattc atttgattat
acgggggagg 3780gtcagggaag aacgaacctt gacgttgcag tgcagtttca
cagatcgttg ttagatcttt 3840atttttagcc atgcactgtt gtgaggaaaa
attacctgtc ttgactgcca tgtgttcatc 3900atcttaagta ttgtaagctg
ctatgtatgg atttaaaccg taatcatatc tttttcctat 3960ctgaggcact
ggtggaataa aaaacctgta tattttactt tgttgcagat agtcttgccg
4020catcttggca agttgcagag atggtggagc tag 405361192PRTHomo sapiens
6Met Glu Asp Leu Asp Gln Ser Pro Leu Val Ser Ser Ser Asp Ser Pro 1
5 10 15Pro Arg Pro Gln Pro Ala Phe Lys Tyr Gln Phe Val Arg Glu Pro
Glu 20 25 30Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Glu Asp
Glu Asp 35 40 45Leu Glu Glu Leu Glu Val Leu Glu Arg Lys Pro Ala Ala
Gly Leu Ser 50 55 60Ala Ala Pro Val Pro Thr Ala Pro Ala Ala Gly Ala
Pro Leu Met Asp 65 70 75 80Phe Gly Asn Asp Phe Val Pro Pro Ala Pro
Arg Gly Pro Leu Pro Ala 85 90 95Ala Pro Pro Val Ala Pro Glu Arg Gln
Pro Ser Trp Asp Pro Ser Pro 100 105 110Val Ser Ser Thr Val Pro Ala
Pro Ser Pro Leu Ser Ala Ala Ala Val 115 120 125Ser Pro Ser Lys Leu
Pro Glu Asp Asp Glu Pro Pro Ala Arg Pro Pro 130 135 140Pro Pro Pro
Pro Ala Ser Val Ser Pro Gln Ala Glu Pro Val Trp Thr145 150 155
160Pro Pro Ala Pro Ala Pro Ala Ala Pro Pro Ser Thr Pro Ala Ala Pro
165 170 175Lys Arg Arg Gly Ser Ser Gly Ser Val Asp Glu Thr Leu Phe
Ala Leu 180 185 190Pro Ala Ala Ser Glu Pro Val Ile Arg Ser Ser Ala
Glu Asn Met Asp 195 200 205Leu Lys Glu Gln Pro Gly Asn Thr Ile Ser
Ala Gly Gln Glu Asp Phe 210 215 220Pro Ser Val Leu Leu Glu Thr Ala
Ala Ser Leu Pro Ser Leu Ser Pro225 230 235 240Leu Ser Ala Ala Ser
Phe Lys Glu His Glu Tyr Leu Gly Asn Leu Ser 245 250 255Thr Val Leu
Pro Thr Glu Gly Thr Leu Gln Glu Asn Val Ser Glu Ala 260 265 270Ser
Lys Glu Val Ser Glu Lys Ala Lys Thr Leu Leu Ile Asp Arg Asp 275 280
285Leu Thr Glu Phe Ser Glu Leu Glu Tyr Ser Glu Met Gly Ser Ser Phe
290
295 300Ser Val Ser Pro Lys Ala Glu Ser Ala Val Ile Val Ala Asn Pro
Arg305 310 315 320Glu Glu Ile Ile Val Lys Asn Lys Asp Glu Glu Glu
Lys Leu Val Ser 325 330 335Asn Asn Ile Leu His Asn Gln Gln Glu Leu
Pro Thr Ala Leu Thr Lys 340 345 350Leu Val Lys Glu Asp Glu Val Val
Ser Ser Glu Lys Ala Lys Asp Ser 355 360 365Phe Asn Glu Lys Arg Val
Ala Val Glu Ala Pro Met Arg Glu Glu Tyr 370 375 380Ala Asp Phe Lys
Pro Phe Glu Arg Val Trp Glu Val Lys Asp Ser Lys385 390 395 400Glu
Asp Ser Asp Met Leu Ala Ala Gly Gly Lys Ile Glu Ser Asn Leu 405 410
415Glu Ser Lys Val Asp Lys Lys Cys Phe Ala Asp Ser Leu Glu Gln Thr
420 425 430Asn His Glu Lys Asp Ser Glu Ser Ser Asn Asp Asp Thr Ser
Phe Pro 435 440 445Ser Thr Pro Glu Gly Ile Lys Asp Arg Ser Gly Ala
Tyr Ile Thr Cys 450 455 460Ala Pro Phe Asn Pro Ala Ala Thr Glu Ser
Ile Ala Thr Asn Ile Phe465 470 475 480Pro Leu Leu Gly Asp Pro Thr
Ser Glu Asn Lys Thr Asp Glu Lys Lys 485 490 495Ile Glu Glu Lys Lys
Ala Gln Ile Val Thr Glu Lys Asn Thr Ser Thr 500 505 510Lys Thr Ser
Asn Pro Phe Leu Val Ala Ala Gln Asp Ser Glu Thr Asp 515 520 525Tyr
Val Thr Thr Asp Asn Leu Thr Lys Val Thr Glu Glu Val Val Ala 530 535
540Asn Met Pro Glu Gly Leu Thr Pro Asp Leu Val Gln Glu Ala Cys
Glu545 550 555 560Ser Glu Leu Asn Glu Val Thr Gly Thr Lys Ile Ala
Tyr Glu Thr Lys 565 570 575Met Asp Leu Val Gln Thr Ser Glu Val Met
Gln Glu Ser Leu Tyr Pro 580 585 590Ala Ala Gln Leu Cys Pro Ser Phe
Glu Glu Ser Glu Ala Thr Pro Ser 595 600 605Pro Val Leu Pro Asp Ile
Val Met Glu Ala Pro Leu Asn Ser Ala Val 610 615 620Pro Ser Ala Gly
Ala Ser Val Ile Gln Pro Ser Ser Ser Pro Leu Glu625 630 635 640Ala
Ser Ser Val Asn Tyr Glu Ser Ile Lys His Glu Pro Glu Asn Pro 645 650
655Pro Pro Tyr Glu Glu Ala Met Ser Val Ser Leu Lys Lys Val Ser Gly
660 665 670Ile Lys Glu Glu Ile Lys Glu Pro Glu Asn Ile Asn Ala Ala
Leu Gln 675 680 685Glu Thr Glu Ala Pro Tyr Ile Ser Ile Ala Cys Asp
Leu Ile Lys Glu 690 695 700Thr Lys Leu Ser Ala Glu Pro Ala Pro Asp
Phe Ser Asp Tyr Ser Glu705 710 715 720Met Ala Lys Val Glu Gln Pro
Val Pro Asp His Ser Glu Leu Val Glu 725 730 735Asp Ser Ser Pro Asp
Ser Glu Pro Val Asp Leu Phe Ser Asp Asp Ser 740 745 750Ile Pro Asp
Val Pro Gln Lys Gln Asp Glu Thr Val Met Leu Val Lys 755 760 765Glu
Ser Leu Thr Glu Thr Ser Phe Glu Ser Met Ile Glu Tyr Glu Asn 770 775
780Lys Glu Lys Leu Ser Ala Leu Pro Pro Glu Gly Gly Lys Pro Tyr
Leu785 790 795 800Glu Ser Phe Lys Leu Ser Leu Asp Asn Thr Lys Asp
Thr Leu Leu Pro 805 810 815Asp Glu Val Ser Thr Leu Ser Lys Lys Glu
Lys Ile Pro Leu Gln Met 820 825 830Glu Glu Leu Ser Thr Ala Val Tyr
Ser Asn Asp Asp Leu Phe Ile Ser 835 840 845Lys Glu Ala Gln Ile Arg
Glu Thr Glu Thr Phe Ser Asp Ser Ser Pro 850 855 860Ile Glu Ile Ile
Asp Glu Phe Pro Thr Leu Ile Ser Ser Lys Thr Asp865 870 875 880Ser
Phe Ser Lys Leu Ala Arg Glu Tyr Thr Asp Leu Glu Val Ser His 885 890
895Lys Ser Glu Ile Ala Asn Ala Pro Asp Gly Ala Gly Ser Leu Pro Cys
900 905 910Thr Glu Leu Pro His Asp Leu Ser Leu Lys Asn Ile Gln Pro
Lys Val 915 920 925Glu Glu Lys Ile Ser Phe Ser Asp Asp Phe Ser Lys
Asn Gly Ser Ala 930 935 940Thr Ser Lys Val Leu Leu Leu Pro Pro Asp
Val Ser Ala Leu Ala Thr945 950 955 960Gln Ala Glu Ile Glu Ser Ile
Val Lys Pro Lys Val Leu Val Lys Glu 965 970 975Ala Glu Lys Lys Leu
Pro Ser Asp Thr Glu Lys Glu Asp Arg Ser Pro 980 985 990Ser Ala Ile
Phe Ser Ala Glu Leu Ser Lys Thr Ser Val Val Asp Leu 995 1000
1005Leu Tyr Trp Arg Asp Ile Lys Lys Thr Gly Val Val Phe Gly Ala Ser
1010 1015 1020Leu Phe Leu Leu Leu Ser Leu Thr Val Phe Ser Ile Val
Ser Val Thr1025 1030 1035 1040Ala Tyr Ile Ala Leu Ala Leu Leu Ser
Val Thr Ile Ser Phe Arg Ile 1045 1050 1055Tyr Lys Gly Val Ile Gln
Ala Ile Gln Lys Ser Asp Glu Gly His Pro 1060 1065 1070Phe Arg Ala
Tyr Leu Glu Ser Glu Val Ala Ile Ser Glu Glu Leu Val 1075 1080
1085Gln Lys Tyr Ser Asn Ser Ala Leu Gly His Val Asn Cys Thr Ile Lys
1090 1095 1100Glu Leu Arg Arg Leu Phe Leu Val Asp Asp Leu Val Asp
Ser Leu Lys1105 1110 1115 1120Phe Ala Val Leu Met Trp Val Phe Thr
Tyr Val Gly Ala Leu Phe Asn 1125 1130 1135Gly Leu Thr Leu Leu Ile
Leu Ala Leu Ile Ser Leu Phe Ser Val Pro 1140 1145 1150Val Ile Tyr
Glu Arg His Gln Ala Gln Ile Asp His Tyr Leu Gly Leu 1155 1160
1165Ala Asn Lys Asn Val Lys Asp Ala Met Ala Lys Ile Gln Ala Lys Ile
1170 1175 1180Pro Gly Leu Lys Arg Lys Ala Glu1185
1190775DNAArtificial SequenceDescription of Artificial Sequence
cDNA encoding receptor binding inhibitor Pep 1 7tttaggatat
acaagggtgt gatccaagct atccagaaat cagatgaagg ccacccattc 60agggcatatc
tggaa 75825PRTArtificial SequenceDescription of Artificial Sequence
Pep1- Nogo protein inhibitor 8Phe Arg Ile Tyr Lys Gly Val Ile Gln
Ala Ile Gln Lys Ser Asp Glu 1 5 10 15Gly His Pro Phe Arg Ala Tyr
Leu Glu 20 25975DNAArtificial SequenceDescription of Artificial
Sequence cDNA encoding receptor binding inhibitor Pep2 9atccagaaat
cagatgaagg ccacccattc agggcatatc tggaatctga agttgctata 60tctgaggagt
tggtt 751025PRTArtificial SequenceDescription of Artificial
Sequence Pep2- Nogo protein inhibitor 10Ile Gln Lys Ser Asp Glu Gly
His Pro Phe Arg Ala Tyr Leu Glu Ser 1 5 10 15Glu Val Ala Ile Ser
Glu Glu Leu Val 20 251175DNAArtificial SequenceDescription of
Artificial Sequence cDNA encoding receptor binding inhibitor Pep3
11agggcatatc tggaatctga agttgctata tctgaggagt tggttcagaa gtacagtaat
60tctgctcttg gtcat 751225PRTArtificial SequenceDescription of
Artificial Sequence Pep3- Nogo protein inhibitor 12Arg Ala Tyr Leu
Glu Ser Glu Val Ala Ile Ser Glu Glu Leu Val Gln 1 5 10 15Lys Tyr
Ser Asn Ser Ala Leu Gly His 20 251375DNAArtificial
SequenceDescription of Artificial Sequence cDNA encoding receptor
binding inhibitor Pep4 13tctgaggagt tggttcagaa gtacagtaat
tctgctcttg gtcatgtgaa ctgcacgata 60aaggaactca ggcgc
751425PRTArtificial SequenceDescription of Artificial Sequence
Pep4- Nogo protein inhibitor 14Ser Glu Glu Leu Val Gln Lys Tyr Ser
Asn Ser Ala Leu Gly His Val 1 5 10 15Asn Cys Thr Ile Lys Glu Leu
Arg Arg 20 251575DNAArtificial SequenceDescription of Artificial
Sequence cDNA encoding receptor binding inhibitor Pep5 15gctcttggtc
atgtgaactg cacgataaag gaactcaggc gcctcttctt agttgatgat 60ttagttgatt
ctctg 751625PRTArtificial SequenceDescription of Artificial
Sequence Pep5- Nogo protein inhibitor 16Ala Leu Gly His Val Asn Cys
Thr Ile Lys Glu Leu Arg Arg Leu Phe 1 5 10 15Leu Val Asp Asp Leu
Val Asp Ser Leu 20 2517120DNAArtificial SequenceDescription of
Artificial Sequence cDNA encoding receptor binding inhibitor
Pep2-41 17aggatataca agggtgtgat ccaagctatc cagaaatcag atgaaggcca
cccattcagg 60gcatatctgg aatctgaagt tgctatatct gaggagttgg ttcagaagta
cagtaattct 1201840PRTArtificial SequenceDescription of Artificial
Sequence Pep2-41- Nogo protein inhibitor 18Arg Ile Tyr Lys Gly Val
Ile Gln Ala Ile Gln Lys Ser Asp Glu Gly 1 5 10 15His Pro Phe Arg
Ala Tyr Leu Glu Ser Glu Val Ala Ile Ser Glu Glu 20 25 30Leu Val Gln
Lys Tyr Ser Asn Ser 35 4019198DNAHomo sapiensCDS(1)..(198)Full
receptor binding region of Nogo gene 19ttt agg ata tac aag ggt gtg
atc caa gct atc cag aaa tca gat gaa 48Phe Arg Ile Tyr Lys Gly Val
Ile Gln Ala Ile Gln Lys Ser Asp Glu 1 5 10 15ggc cac cca ttc agg
gca tat ctg gaa tct gaa gtt gct ata tct gag 96Gly His Pro Phe Arg
Ala Tyr Leu Glu Ser Glu Val Ala Ile Ser Glu 20 25 30gag ttg gtt cag
aag tac agt aat tct gct ctt ggt cat gtg aac tgc 144Glu Leu Val Gln
Lys Tyr Ser Asn Ser Ala Leu Gly His Val Asn Cys 35 40 45acg ata aag
gaa ctc agg cgc ctc ttc tta gtt gat gat tta gtt gat 192Thr Ile Lys
Glu Leu Arg Arg Leu Phe Leu Val Asp Asp Leu Val Asp 50 55 60tct ctg
198Ser Leu 652066PRTHomo sapiens 20Phe Arg Ile Tyr Lys Gly Val Ile
Gln Ala Ile Gln Lys Ser Asp Glu 1 5 10 15Gly His Pro Phe Arg Ala
Tyr Leu Glu Ser Glu Val Ala Ile Ser Glu 20 25 30Glu Leu Val Gln Lys
Tyr Ser Asn Ser Ala Leu Gly His Val Asn Cys 35 40 45Thr Ile Lys Glu
Leu Arg Arg Leu Phe Leu Val Asp Asp Leu Val Asp 50 55 60Ser Leu
6521198DNAHomo sapiensNucleotide sequence encoding amino acids
1055- 1120 of human NogoA 21aggatataca agggtgtgat ccaagctatc
cagaaatcag atgaaggcca cccattcagg 60gcatatctgg aatctgaagt tgctatatct
gaggagttgg ttcagaagta cagtaattct 120gctcttggtc atgtgaactg
cacgataaag gaactcaggc gcctcttctt agttgatgat 180ttagttgatt ctctgaag
1982266PRTHomo sapiens 22Arg Ile Tyr Lys Gly Val Ile Gln Ala Ile
Gln Lys Ser Asp Glu Gly 1 5 10 15His Pro Phe Arg Ala Tyr Leu Glu
Ser Glu Val Ala Ile Ser Glu Glu 20 25 30Leu Val Gln Lys Tyr Ser Asn
Ser Ala Leu Gly His Val Asn Cys Thr 35 40 45Ile Lys Glu Leu Arg Arg
Leu Phe Leu Val Asp Asp Leu Val Asp Ser 50 55 60Leu Lys
652375DNAHomo sapiensNucleotide sequence encoding amino acids 1055-
1079 of human NogoA 23aggatataca agggtgtgat ccaagctatc cagaaatcag
atgaaggcca cccattcagg 60gcatatctgg aatct 752425PRTHomo sapiens
24Arg Ile Tyr Lys Gly Val Ile Gln Ala Ile Gln Lys Ser Asp Glu Gly 1
5 10 15His Pro Phe Arg Ala Tyr Leu Glu Ser 20 252590DNAHomo
sapiensNucleotide sequence encoding amino acids 1055- 1084 of human
NogoA 25aggatataca agggtgtgat ccaagctatc cagaaatcag atgaaggcca
cccattcagg 60gcatatctgg aatctgaagt tgctatatct 902631PRTHomo sapiens
26Arg Ile Tyr Lys Gly Val Ile Gln Ala Ile Gln Lys Ser Asp Glu Gly 1
5 10 15His Pro Phe Arg Ala Tyr Leu Glu Ser Glu Ser Val Ala Ile Ser
20 25 3027105DNAHomo sapiensNucleotide sequence encoding amino
acids 1055- 1089 of human NogoA 27aggatataca agggtgtgat ccaagctatc
cagaaatcag atgaaggcca cccattcagg 60gcatatctgg aatctgaagt tgctatatct
gaggagttgg ttcag 1052836PRTHomo sapiens 28Arg Ile Tyr Lys Gly Val
Ile Gln Ala Ile Gln Lys Ser Asp Glu Gly 1 5 10 15His Pro Phe Arg
Ala Tyr Leu Glu Ser Glu Ser Val Ala Ile Ser Glu 20 25 30Glu Leu Val
Gln 3529105DNAHomo sapiensNucleotide sequence encoding amino acids
1060- 1094 of human NogoA 29gtgatccaag ctatccagaa atcagatgaa
ggccacccat tcagggcata tctggaatct 60gaagttgcta tatctgagga gttggttcag
aagtacagta attct 1053036PRTHomo sapiens 30Val Ile Gln Ala Ile Gln
Lys Ser Asp Glu Gly His Pro Phe Arg Ala 1 5 10 15Tyr Leu Glu Ser
Glu Ser Val Ala Ile Ser Glu Glu Leu Val Gln Lys 20 25 30Tyr Ser Asn
Ser 353190DNAHomo sapiensNucleotide sequence encoding amino acids
1065- 1094 of human NogoA 31cagaaatcag atgaaggcca cccattcagg
gcatatctgg aatctgaagt tgctatatct 60gaggagttgg ttcagaagta cagtaattct
903231PRTHomo sapiens 32Gln Lys Ser Asp Glu Gly His Pro Phe Arg Ala
Tyr Leu Glu Ser Glu 1 5 10 15Ser Val Ala Ile Ser Glu Glu Leu Val
Gln Lys Tyr Ser Asn Ser 20 25 303375DNAHomo sapiensNucleotide
sequence encoding amino acids 1070- 1094 of human NogoA
33ggccacccat tcagggcata tctggaatct gaagttgcta tatctgagga gttggttcag
60aagtacagta attct 753426PRTHomo sapiens 34Gly His Pro Phe Arg Ala
Tyr Leu Glu Ser Glu Ser Val Ala Ile Ser 1 5 10 15Glu Glu Leu Val
Gln Lys Tyr Ser Asn Ser 20 253575DNAHomo sapiensNucleotide sequence
encoding amino acids 1085- 1109 of human NogA 35gaggagttgg
ttcagaagta cagtaattct gctcttggtc atgtgaactg cacgataaag 60gaactcaggc
gcctc 753625PRTHomo sapiens 36Glu Glu Leu Val Gln Lys Tyr Ser Asn
Ser Ala Leu Gly His Val Asn 1 5 10 15Cys Thr Ile Lys Glu Leu Arg
Arg Leu 20 253765DNAArtificial SequenceDescription of Artificial
Sequence Primer 37tgggatccga acaaaaactc atctcagaag aggatctgtc
tagccagcga atcttcctgc 60atggc 653832DNAArtificial
SequenceDescription of Artificial Sequence Primer 38ttctcgaggt
cagcagggcc caagcactgt cc 323962DNAArtificial SequenceDescription of
Artificial Sequence Primer 39tgggatccga acaaaaactc atctcagaag
aggatctgct agagggctgt gctgtggctt 60ca 624063DNAArtificial
SequenceDescription of Artificial Sequence Primer 40tgggatccga
acaaaaactc atctcagaag aggatctgcc atgccctggt gcttgtgtgt 60gct
634134DNAArtificial SequenceDescription of Artificial Sequence
Primer 41ttgcggccgc tgaagccaca gcacagccct ctag 344235DNAArtificial
SequenceDescription of Artificial Sequence Primer 42ttgcggccgc
tgagggttca ggggctctgc ctgct 354324DNAArtificial SequenceDescription
of Artificial Sequence Primer 43ggctgggatg ccagtgggca cagc
244424DNAArtificial SequenceDescription of Artificial Sequence
Primer 44ctcctggagc aactagatct tagt 244524DNAArtificial
SequenceDescription of Artificial Sequence Primer 45ggtcagacca
gtgaaggcag cagc 244624DNAArtificial SequenceDescription of
Artificial Sequence Primer 46gctctgcagt acctctacct acaa
244724DNAArtificial SequenceDescription of Artificial Sequence
Primer 47tgctagtcca cggaataggc cggg 244824DNAArtificial
SequenceDescription of Artificial Sequence Primer 48agtcttgacc
gcctcctctt gcac 244924DNAArtificial SequenceDescription of
Artificial Sequence Primer 49gtgcaggcca cggaaagcgt gctc
245024DNAArtificial SequenceDescription of Artificial Sequence
Primer 50tctctgcagt acctgcgact caat 245127DNAArtificial
SequenceDescription of Artificial Sequence Primer 51gtggcttcag
gacccttccg
tcccatc 275230DNAArtificial SequenceDescription of Artificial
Sequence Primer 52gtcattgagt cgcaggtact gcagagacct 3053137PRTHomo
sapiensResidues 306-442 of human NogoR1 53Leu Gln Gly Cys Ala Val
Ala Thr Gly Pro Tyr His Pro Ile Trp Thr 1 5 10 15Gly Arg Ala Thr
Asp Glu Glu Pro Leu Gly Leu Pro Lys Cys Cys Gln 20 25 30Pro Asp Ala
Ala Asp Lys Ala Ser Val Leu Glu Pro Gly Arg Pro Ala 35 40 45Ser Ala
Gly Asn Ala Leu Lys Gly Arg Val Pro Pro Gly Asp Ser Pro 50 55 60Pro
Gly Asn Gly Ser Gly Pro Arg His Ile Asn Asp Ser Pro Phe Gly 65 70
75 80Thr Leu Pro Gly Ser Ala Glu Pro Pro Leu Thr Ala Val Arg Pro
Glu 85 90 95Gly Ser Glu Pro Pro Gly Phe Pro Thr Ser Gly Pro Arg Arg
Arg Pro 100 105 110Gly Cys Ser Arg Lys Asn Arg Thr Arg Ser His Cys
Arg Leu Gly Gln 115 120 125Ala Gly Ser Gly Gly Gly Gly Thr Gly 130
13554168PRTHomo sapiensResidues 306-473 of human NogoR1 54Leu Gln
Gly Cys Ala Val Ala Thr Gly Pro Tyr His Pro Ile Trp Thr 1 5 10
15Gly Arg Ala Thr Asp Glu Glu Pro Leu Gly Leu Pro Lys Cys Cys Gln
20 25 30Pro Asp Ala Ala Asp Lys Ala Ser Val Leu Glu Pro Gly Arg Pro
Ala 35 40 45Ser Ala Gly Asn Ala Leu Lys Gly Arg Val Pro Pro Gly Asp
Ser Pro 50 55 60Pro Gly Asn Gly Ser Gly Pro Arg His Ile Asn Asp Ser
Pro Phe Gly 65 70 75 80Thr Leu Pro Gly Ser Ala Glu Pro Pro Leu Thr
Ala Val Arg Pro Glu 85 90 95Gly Ser Glu Pro Pro Gly Phe Pro Thr Ser
Gly Pro Arg Arg Arg Pro 100 105 110Gly Cys Ser Arg Lys Asn Arg Thr
Arg Ser His Cys Arg Leu Gly Gln 115 120 125Ala Gly Ser Gly Gly Gly
Gly Thr Gly Asp Ser Glu Gly Ser Gly Ala 130 135 140Leu Pro Ser Leu
Thr Cys Ser Leu Thr Pro Leu Gly Leu Ala Leu Val145 150 155 160Leu
Trp Thr Val Leu Gly Pro Cys 16555283PRTHomo sapiensResidues 27-309
of human NogoR1 55Cys Pro Gly Ala Cys Val Cys Tyr Asn Glu Pro Lys
Val Thr Thr Ser 1 5 10 15Cys Pro Gln Gln Gly Leu Gln Ala Val Pro
Val Gly Ile Pro Ala Ala 20 25 30Ser Gln Arg Ile Phe Leu His Gly Asn
Arg Ile Ser His Val Pro Ala 35 40 45Ala Ser Phe Arg Ala Cys Arg Asn
Leu Thr Ile Leu Trp Leu His Ser 50 55 60Asn Val Leu Ala Arg Ile Asp
Ala Ala Ala Phe Thr Gly Leu Ala Leu 65 70 75 80Leu Glu Gln Leu Asp
Leu Ser Asp Asn Ala Gln Leu Arg Ser Val Asp 85 90 95Pro Ala Thr Phe
His Gly Leu Gly Arg Leu His Thr Leu His Leu Asp 100 105 110Arg Cys
Gly Leu Gln Glu Leu Gly Pro Gly Leu Phe Arg Gly Leu Ala 115 120
125Ala Leu Gln Tyr Leu Tyr Leu Gln Asp Asn Ala Leu Gln Ala Leu Pro
130 135 140Asp Asp Thr Phe Arg Asp Leu Gly Asn Leu Thr His Leu Phe
Leu His145 150 155 160Gly Asn Arg Ile Ser Ser Val Pro Glu Arg Ala
Phe Arg Gly Leu His 165 170 175Ser Leu Asp Arg Leu Leu Leu His Gln
Asn Arg Val Ala His Val His 180 185 190Pro His Ala Phe Arg Asp Leu
Gly Arg Leu Met Thr Leu Tyr Leu Phe 195 200 205Ala Asn Asn Leu Ser
Ala Leu Pro Thr Glu Ala Leu Ala Pro Leu Arg 210 215 220Ala Leu Gln
Tyr Leu Arg Leu Asn Asp Asn Pro Trp Val Cys Asp Cys225 230 235
240Arg Ala Arg Pro Leu Trp Ala Trp Leu Gln Lys Phe Arg Gly Ser Ser
245 250 255Ser Glu Val Pro Cys Ser Leu Pro Gln Arg Leu Ala Gly Arg
Asp Leu 260 265 270Lys Arg Leu Ala Ala Asn Asp Leu Gln Gly Cys 275
280569PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 56Ile Tyr Lys Gly Val Ile Gln Ala Ile 1
5574PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 57Glu Glu Leu Val 1
* * * * *