U.S. patent application number 12/064422 was filed with the patent office on 2008-09-11 for process for the preparation of glycosylated interferon beta.
This patent application is currently assigned to ARES TRADING S.A.. Invention is credited to Alain Bernard, Paul Ducommun, Dina Fischer, Mara Rossi.
Application Number | 20080219952 12/064422 |
Document ID | / |
Family ID | 35788670 |
Filed Date | 2008-09-11 |
United States Patent
Application |
20080219952 |
Kind Code |
A1 |
Fischer; Dina ; et
al. |
September 11, 2008 |
Process For the Preparation of Glycosylated Interferon Beta
Abstract
The present invention relates to a process for the production of
interferon beta, and to an interferon beta composition having a
unique glycosylation pattern.
Inventors: |
Fischer; Dina; (Rehovot,
IL) ; Bernard; Alain; (Ville-la-Grand, FR) ;
Ducommun; Paul; (Lausanne, CH) ; Rossi; Mara;
(Rome, IT) |
Correspondence
Address: |
SALIWANCHIK LLOYD & SALIWANCHIK;A PROFESSIONAL ASSOCIATION
PO BOX 142950
GAINESVILLE
FL
32614-2950
US
|
Assignee: |
ARES TRADING S.A.
Aubonne
CH
|
Family ID: |
35788670 |
Appl. No.: |
12/064422 |
Filed: |
August 26, 2005 |
PCT Filed: |
August 26, 2005 |
PCT NO: |
PCT/EP2005/054220 |
371 Date: |
February 21, 2008 |
Current U.S.
Class: |
424/85.6 ;
435/320.1; 435/325; 435/358; 435/69.51; 530/351; 530/395; 530/413;
536/23.52 |
Current CPC
Class: |
A61P 25/28 20180101;
C12N 2510/02 20130101; C07K 14/565 20130101; C12N 15/00 20130101;
A61P 35/00 20180101; A61P 31/12 20180101; C12N 2500/90 20130101;
C12N 2500/92 20130101; C12N 2500/32 20130101; C12N 5/0037 20130101;
A61K 38/215 20130101; C12N 5/06 20130101; C12N 2500/12 20130101;
C12N 2500/99 20130101; C12N 5/0031 20130101; A61P 25/00
20180101 |
Class at
Publication: |
424/85.6 ;
435/69.51; 530/413; 530/351; 530/395; 536/23.52; 435/320.1;
435/325; 435/358 |
International
Class: |
A61K 38/21 20060101
A61K038/21; C12P 21/04 20060101 C12P021/04; C07K 1/00 20060101
C07K001/00; C12N 15/00 20060101 C12N015/00; A61P 25/00 20060101
A61P025/00; C12N 5/06 20060101 C12N005/06; C12N 15/11 20060101
C12N015/11; C07K 14/00 20060101 C07K014/00 |
Claims
1-32. (canceled)
33. A process for the manufacturing of glycosylated recombinant
human interferon beta, comprising a step of culturing a human
interferon beta producing cell in a serum-free medium, the
serum-free medium comprising: a) about 10 to about 30 mM HEPES; b)
about 0.5 to about 3 mM Proline; and c) about 5500 to about 7000
mg/L sodium chloride.
34. The process according to claim 33, the serum-free medium
further comprising about 10 to about 20 mg/L Phenol Red.
35. The process according to claim 33, said method comprising a
growth phase I, a growth phase II and a production phase, wherein
growth phase I is carried out at about 37.degree. C., growth phase
II is carried out at about 35.degree. C., and the production phase
is carried out at about 33.degree. C.
36. The process according to claim 35, wherein the process is a
perfusion process with a dilution rate ranging from about 1 to
about 10.
37. The process according to claim 36, wherein the dilution rate is
increased within the first two to three weeks of cell culture from
an initial value of about 1 to 2 per day to a value of about 7 to
10 per day.
38. The process according to claim 33, further comprising: a)
subjecting the medium containing human interferon beta to affinity
chromatography and eluting said human interferon beta; b)
subjecting the human interferon beta containing eluate to cation
exchange chromatography and eluting said human interferon beta; and
c) subjecting the eluate of the cation exchange chromatography to
hydrophobic chromatography by RP-HPLC and eluting said human
interferon beta.
39. The process according to claim 38, comprising, before step (a),
clarifying of the medium by filtration.
40. The process according to claim 39, further comprising the steps
of: d) performing ultrafiltration and dialysis; e) subjecting the
dialysate to size exclusion chromatography; and f) subjecting the
eluate of the size exclusion chromatography to microfiltration.
41. The process according to claim 38, wherein step (a) is carried
out on Blue Sepharose and step (b) is carried out on Carboxymethyl
Sepharose.
42. The process according to claim 33, wherein said human
interferon beta producing cell comprises: a) a human interferon
beta coding sequence functionally linked to a SV40 T Ag early
polyadenylation region, wherein the nucleic acid does not comprise
the human interferon beta polyadenylation signal; b) a human
interferon beta coding sequence functionally linked to a SV40 T Ag
early polyadenylation region, wherein the nucleic acid does not
comprise the human interferon beta polyadenylation signal and
wherein said nucleic acid does not comprise the human interferon
beta 3' UTR; c) a nucleic acid comprising a SV40 promoter/enhancer
functionally linked to a human interferon beta coding sequence,
wherein the human interferon beta coding sequence is functionally
linked to the SV40 T Ag early polyadenylation region and the
nucleic acid does not comprise the human interferon beta
polyadenylation signal or the human interferon beta 3' UTR; d) a
nucleic acid according to a), b) or c), wherein said nucleic acid
further comprises a mouse DHFR gene; e) a nucleic acid according to
d), wherein said mouse DHFR gene is functionally linked to a SV40 T
Ag polyA-containing early polyadenylation region; or f) a nucleic
acid according to e), further comprising a SV40 promoter/enhancer
functionally linked to the mouse DHFR gene.
43. A process for the purification of recombinant human interferon
beta from a fluid, comprising the steps of: a) subjecting the fluid
to affinity chromatography; b) subjecting the eluate of the
affinity chromatography to cation exchange chromatography; and c)
subjecting the eluate of the cation exchange chromatography to
hydrophobic chromatography by RP-HPLC.
44. The process according to claim 43, comprising, before step (a),
clarifying the fluid by filtration.
45. The process according to claim 44, further comprising the steps
of: d) performing ultrafiltration and dialysis to form a dialysate;
e) subjecting the dialysate to size exclusion chromatography; and
f) subjecting the eluate of the size exclusion chromatography to
microfiltration.
46. The process according to claim 43, wherein step (a) is carried
out on Blue Sepharose and step (b) is carried out on Carboxymethyl
Sepharose.
47. The process according to claim 43, further comprising the step
of formulating the purified interferon beta into a pharmaceutical
composition, optionally together with a pharmaceutically acceptable
carrier.
48. A glycosylated recombinant interferon beta composition,
obtainable by a process according to claim 33.
49. The interferon beta composition according to claim 48,
comprising an oligosaccharide structure comprising two or three
fucose saccharides.
50. The interferon beta composition according to claim 48, wherein
said oligosaccharide structure comprises a disialyl biantennary
trifucosylated glycan
(Neu.sub.2Ac.Hex5.HexNAc.sub.4.Fuc.sub.3).
51. The interferon beta composition according to claim 48,
comprising one or more of the following oligosaccharide structures:
a) a non sialylated biantennary structure
(Hex.sub.5.HexNAc.sub.4.Fuc); b) a disialylated triantennary
structure or disialylated biantennary with N-acetyl lactosamine
repeat structures (NeuAc2.Hex6.HexNAc5.Fuc); c) a trisialylated
triantennary structure (NeuAc.sub.3.Hex6.HexNAc.sub.5.Fuc); d) a
trisialylated triantennary structure with N-acetyl lactosamine
repeat structures or trisialylated tetrantennary
(NeuAc.sub.3.Hex.sub.7.HexNAc.sub.6.Fuc); or e) a mono sialylated
and disialylated biantennary structure with two fucose units
(NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2,NeuAc.sub.2.Hex.sub.5.HexNAc.sub.-
4.Fuc.sub.2).
52. The interferon beta composition according to claim 48,
characterized by a sialylation profile comprising about 1 to about
5% of unsialylated N-glycans, about 5 to about 25% of
mono-sialylated glycans, about 55 to about 75% of di-sialylated
N-glycans, and about 10 to about 25% of tri-sialylated
N-glycans.
53. A method of treating a disease selected from multiple
sclerosis, viral diseases or cancer comprising the administration
of a composition comprising the interferon .beta. according to
claim 48 to an individual with said disease.
54. The method according to claim 53, wherein said multiple
sclerosis is selected from the group consisting of relapsing,
non-relapsing and early onset multiple sclerosis.
55. An article of manufacture comprising packaging material and a
therapeutically effective amount of an isolated, purified
recombinant interferon beta according to claim 48, wherein said
packaging material comprises a label or package insert indicating
that said recombinant human interferon beta can be administered to
a human for treatment thereof.
56. A composition of matter comprising: a) a nucleic acid
comprising: i) a human interferon beta coding sequence functionally
linked to a SV40 T Ag early polyadenylation region, wherein the
nucleic acid does not comprise the human interferon beta
polyadenylation signal; ii) a human interferon beta coding sequence
functionally linked to a SV40 T Ag early polyadenylation region,
wherein the nucleic acid does not comprise the human interferon
beta polyadenylation signal and wherein said nucleic acid does not
comprise the human interferon beta 3' UTR; iii) a nucleic acid
comprising a SV40 promoter/enhancer functionally linked to a human
interferon beta coding sequence, wherein the human interferon beta
coding sequence is functionally linked to the SV40 T Ag early
polyadenylation region and the nucleic acid does not comprise the
human interferon beta polyadenylation signal or the interferon beta
3' UTR; iv) a nucleic acid according to i), ii) or iii), wherein
said nucleic acid further comprises a mouse DHFR gene; v) a nucleic
acid according to iv), wherein said mouse DHFR gene is functionally
linked to a SV40 T Ag polyA-containing early polyadenylation
region; or vi) a nucleic acid according to v), further comprising a
SV40 promoter/enhancer functionally linked to the mouse DHFR gene;
b) an expression vector comprising: i) a human interferon beta
coding sequence functionally linked to a SV40 T Ag early
polyadenylation region, wherein the nucleic acid does not comprise
the human interferon beta polyadenylation signal; ii) a human
interferon beta coding sequence functionally linked to a SV40 T Ag
early polyadenylation region, wherein the nucleic acid does not
comprise the human interferon beta polyadenylation signal and
wherein said nucleic acid does not comprise the human interferon
beta 3' UTR; iii) a nucleic acid comprising a SV40
promoter/enhancer functionally linked to a human interferon beta
coding sequence, wherein the human interferon beta coding sequence
is functionally linked to the SV40 T Ag early polyadenylation
region and the nucleic acid does not comprise the human interferon
beta polyadenylation signal or the human interferon beta 3' UTR;
iv) a nucleic acid according to i), ii) or iii), wherein said
nucleic acid further comprises a mouse DHFR gene; v) a nucleic acid
according to iv), wherein said mouse DHFR gene is functionally
linked to a SV40 T Ag polyA-containing early polyadenylation
region; or vi) a nucleic acid according to v), further comprising a
SV40 promoter/enhancer functionally linked to the mouse DHFR gene;
or c) an isolated host cell comprising an expression vector
comprising: i) a human interferon beta coding sequence functionally
linked to a SV40 T Ag early polyadenylation region, wherein the
nucleic acid does not comprise the human interferon beta
polyadenylation signal; ii) a human interferon beta coding sequence
functionally linked to a SV40 T Ag early polyadenylation region,
wherein the nucleic acid does not comprise the human interferon
beta polyadenylation signal and wherein said nucleic acid does not
comprise the human interferon beta 3' UTR; iii) a nucleic acid
comprising a SV40 promoter/enhancer functionally linked to a human
interferon beta coding sequence, wherein the human interferon beta
coding sequence is functionally linked to the SV40 T Ag early
polyadenylation region and the nucleic acid does not comprise the
human interferon beta polyadenylation signal or the human
interferon beta 3' UTR; iv) a nucleic acid according to i), ii) or
iii), wherein said nucleic acid further comprises a mouse DHFR
gene; v) a nucleic acid according to iv), wherein said mouse DHFR
gene is functionally linked to a SV40 T Ag polyA-containing early
polyadenylation region; or vi) a nucleic acid according to v),
further comprising a SV40 promoter/enhancer functionally linked to
the mouse DHFR gene.
57. The composition of matter according to claim 56, wherein said
host cell is a Chinese Hamster Ovary (CHO) cell.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to processes for producing
recombinant human interferon beta under serum-free culture
conditions, processes of purifying recombinant human interferon
beta and to an interferon beta protein having a unique
glycosylation pattern.
BACKGROUND OF THE INVENTION
[0002] Proteins have become commercially important as drugs that
are also generally called "biologicals". One of the greatest
challenges is the development of cost effective and efficient
processes for the production of recombinant proteins on a
commercial scale.
[0003] The biotech industry makes an extensive use of mammalian
cells for the manufacturing of recombinant glycoproteins for human
therapy.
[0004] Suitable cells that are widely used for production of
polypeptides turned out to be Chinese Hamster Ovary (CHO)
cells.
[0005] CHO cells were first cultured by Puck (1958) from a biopsy
of an ovary from a female Chinese hamster. From these original
cells a number of sub-lines were prepared with various
characteristics. One of these CHO cell lines, CHO-K1, is
proline-requiring and is diploid for the dihydrofolate reductase
(DHFR) gene. Another cell line derived from this cell line is a
DHFR deficient CHO cell line (CHO DUK B11) (PNAS 77, 1980,
4216-4220), which is characterized by the loss of DHFR function as
a consequence of a mutation in one DHFR gene and the subsequent
loss of the other gene.
[0006] Further cells that are frequently used for the production of
proteins intended for administration to humans are human cell lines
such as the human fibrosarcoma cell line HT1080 or the human
embryonic kidney cell line 293, a human embryonic
retinoblast-derived cell line such as e.g. PER.C6, an amniotic cell
derived-cell line or a neuronal-derived cell line.
[0007] Cells from a suitable cell line are stably transfected with
an expression vector comprising the coding sequence of the protein
of interest to be produced, together with regulatory sequences such
as promoters, enhancers, or polyA signals that ensure stable and
correct expression of the protein of interest. Further genes
usually present on expression vectors are marker genes such as e.g.
positive selections markers (e.g. neo gene) that select the stably
transfected cells from the untransfected and transiently
transfected cells. Amplifiable genes such as the DHFR gene are used
for amplification of the coding sequences.
[0008] Once a clone expressing the protein of interest has been
established, a manufacturing process starting from this clone must
be established allowing for production in high amounts and such a
quality as is required for proteins destined for human
administration.
[0009] Such manufacturing processes are generally carried out in
bioreactors. There are different modes of operation. Today,
fed-batch and perfusion cultures are the two dominant modes of
industrial operation for the mammalian cell culture processes that
require large amount of proteins (Hu and Aunins 1997). Whatever the
production technology of choice is, development efforts aim at
obtaining production processes that warrant high volumetric
productivity, batch-to-batch consistency, homogenous product
quality at low costs.
[0010] The decision between fed-batch or perfusion production mode
is mainly dictated by the biology of the clone and the property of
the product, and is done on a case-by-case basis during the course
of the development of a new drug product (Kadouri and Spier
1997).
[0011] When the selection is a perfusion process, one of the
culture systems of choice is stationary packed-bed bioreactor in
which cells are immobilized onto solid carriers. This system is
easy to operate and with appropriate carriers and culture
conditions very high cell density (of .about.10.sup.7-10.sup.8
cellml.sup.-1) can be achieved.
[0012] A consequence of this high cell density is the need for an
intensive medium perfusion rate (feed and harvest) that should be
used in order to keep the cells viable and productive. It appears
that the perfusion rate is one of the central parameters of such a
process: it drives the volumetric protein productivity, the protein
product quality and has a very strong impact on the overall
economics of the process.
[0013] For the cell culture process, in the past culture media were
supplemented with serum, which serves as a universal nutrient for
the growth and maintenance of all mammalian cell lines that produce
biologically active products. Serum contains hormones, growth
factors, carrier proteins, attachment and spreading factors,
nutrients, trace elements, etc. Culture media usually contained up
to about 10% of animal serum, such as fetal bovine serum (FBS),
also called fetal calf serum (FCS).
[0014] Although widely used, serum has many limitations. It
contains high levels of numerous proteins interfering with the
limited quantities of the desired protein of interest produced by
the cells. These proteins derived from the serum must be separated
from the product during downstream processing such as purification
of the protein of interest, which complicates the process and
increases the cost.
[0015] The advent of BSE (Bovine Spongiform Encephalopathy), a
transmissible neurodegenerative disease of cattle with a long
latency or incubation period, has raised regulatory concerns about
using animal-derived sera in the production of biologically active
products.
[0016] There is therefore a great demand for the development of
alternative cell culture media free from animal sources that
support cell growth and maintain cells during the production of
biologically active products.
[0017] Generally, cell culture media comprise many components of
different categories, such as amino acids, vitamins, salts, fatty
acids, and further compounds: [0018] Amino acids: For instance,
U.S. Pat. No. 6,048,728 (Inlow et al.) discloses that the following
amino acids may be used in a cell culture medium: Alanine,
Arginine, Aspartic Acid, Cysteine, Glutamic Acid, Glutamin,
Glycine, Histidine, Isoleucine, Leucine, Lysine, Methionine,
Phenyalanine, Proline, Serine, Tryptophan, Tyrosine, Threonine, and
Valine. [0019] Vitamins: US 2003/0096414 (Ciccarone et al.) or U.S.
Pat. No. 5,811,299 (Renner et al.) for example describe that the
following vitamins may be used in a cell culture medium: Biotin,
Pantothenate, Choline Chloride, Folic Acid, Myo-Inositol,
Niacinamide, Pyridoxine, Riboflavin, Vitamin B12, Thiamine,
Putrescine. [0020] Salts: For instance, U.S. Pat. No. 6,399,381
(Blum et al.) discloses a medium comprising CaCl.sub.2, KCl,
MgCl.sub.2, NaCl, Sodium Phosphate Monobasic, Sodium Phosphate
Dibasic, Sodium Selenite, CuSO.sub.4, ZnCl.sub.2. Another example
for a document disclosing the inorganic salts that may be used in a
culture medium is US 2003/0153042 (Arnold et al.), describing a
medium comprising CaCl.sub.2, KCl, MgCl.sub.2, NaCl, Sodium
Phosphate Monobasic, Sodium Phosphate Dibasic,
CuCl.sub.2.2H.sub.20, ZnCl.sub.2. [0021] Fatty acids: Fatty acids
that are known to be used in media are Arachidonic Acid, Linoleic
Acid, Oleic Acid, Lauric Acid, Myristic Acid, as well as
Methyl-beta-Cyclodextrin, see e.g. U.S. Pat. No. 5,045,468
(Darfler). It should be noted that cyclodextrin is not a lipid per
se, but has the ability to form a complex with lipids and is thus
used to solubilize lipids in the cell culture medium. [0022]
Further components, in particular used in the frame of serum-free
cell culture media, are compounds such as glucose, glutamine,
Na-pyruvate, insulin or ethanolamine (e.g. EP 274 445), or a
protective agent such as Pluronic F68. Pluronic.RTM. F68 (also
known as Poloxamer 188) is a block copolymer of ethylene oxide (EO)
and propylene oxide (PO).
[0023] Standard "basic media" are also known to the person skilled
in the art. These media already contain several of the medium
components mentioned above. Examples of such media that are widely
applied are Dulbecco's Modified Eagle's Medium (DMEM), Roswell Park
Memorial Institute Medium (RPMI), or Ham's medium.
[0024] After production of the protein of interest in the
bioreactor, the protein of interest needs to be purified from the
cell culture harvest. The cell culture harvest may e.g. be cell
extracts for intracellular proteins, or cell culture supernatant
for secreted proteins.
[0025] While many methods are now available for large-scale
preparation of proteins, crude products, such as cell culture
harvest, contain not only the desired product but also impurities
which are difficult to separate from the desired product.
[0026] The health authorities request high standards of purity for
proteins intended for human administration. As a further
difficulty, many purification methods may contain steps requiring
application of low or high pH, high salt concentrations or other
extreme conditions that may jeopardize the biological activity of a
given protein. Thus, for any protein it is a challenge to establish
a purification process allowing for sufficient purity while
retaining the biological activity of the protein.
[0027] Ion exchange chromatographic systems have been used widely
for separation of proteins primarily on the basis of differences in
charge. In ion exchange chromatography, charged patches on the
surface of the solute are attracted by opposite charges attached to
a chromatography matrix, provided the ionic strength of the
surrounding buffer is low. Elution is generally achieved by
increasing the ionic strength (i.e. conductivity) of the buffer to
compete with the solute for the charged sites of the ion exchange
matrix. Changing the pH and thereby altering the charge of the
solute is another way to achieve elution of the solute. The change
in conductivity or pH may be gradual (gradient elution) or stepwise
(step elution). Resins that may be used in ion exchange
chromatography may contain different functional groups:
diethylaminoethyl (DEAE) or diethyl-(2-hydroxy-propyl)aminoethyl
(QAE) have chloride as counter ion, while carboxymethyl (CM) and
sulphopropyl (SP) have sodium as counter ion, for example.
[0028] Chromatographic systems having a hydrophobic stationary
phase offer an alternative basis for separations and have also been
widely employed in the purification of proteins. Included in this
category are hydrophobic interaction chromatography (HIC) and
reversed phase liquid chromatography (RPLC). The physicochemical
basis for separation by HIC and RPLC is the hydrophobic effect,
proteins are separated on a hydrophobic stationary phase based on
differences in hydrophobicity.
[0029] Reverse phase chromatography is a protein purification
method closely related to HIC, as both are based upon interactions
between solvent-accessible non-polar groups on the surface of
biomolecules and hydrophobic ligands of the matrix. However,
ligands used in reverse phase chromatography are more highly
substituted with hydrophobic ligands than HIC ligands. While the
degree of substitution of HIC adsorbents may be in the range of
10-50 .mu.moles/mL of matrix of C2-C8 aryl ligands, several hundred
.mu.moles/mL of matrix of C4-C8 alkyl ligands are usually used for
reverse phase chromatography adsorbents.
[0030] The Source 30RPC column is a polymeric reverse phase matrix.
It is based on rigid, monosized 30 micron diameter
polystyrene/divinyl benzene beads. Its characteristics can be
summarized as follows: Exceptionally wide pH range (1-12), high
selectivity, high chemical resistance, high capacity and high
resolution at high flow rates.
[0031] Size-exculsion chromatography (SEC), also called
gel-permeation chromatography (GPC), uses porous particles to
separate molecules of different sizes. It is generally used to
separate biological molecules and to determine molecular weights
and molecular weight distributions of polymers. Molecules that are
smaller than the pore size can enter the particles and therefore
have a longer path and longer transit time than larger molecules
that cannot enter the particles. All molecules larger than the pore
size are not retained and elute together. Molecules that can enter
the pores will have an average residence time in the particles that
depends on the molecules size and shape. Different molecules
therefore have different total transit times through the
column.
[0032] Blue Sepharose is a chromatography resin based on a
dye-ligand affinity matrix. The ligand, Cibacron Blue F3G-A, is
covalently coupled to Sepharose.TM. through chlorotriazine ring
(Clonis et al., 1987).
[0033] Blue Sepharose has been used for the purification of
interferon beta (Mory et al., 1981).
[0034] interferon beta (interferon-.beta. or IFN-.beta.) is a
naturally occurring soluble glycoprotein belonging to the class of
cytokines. interferons (IFNs) have a wide range of biological
activities, such as anti-viral, anti-proliferative and
immunomodulatory properties.
[0035] The three major interferons are referred to as IFN-alpha,
IFN-beta and IFN-gamma. These interferons were initially classified
according to their cells of origin (leukocytes, fibroblasts or
T-cells). However, it became clear that several types might be
produced by one cell. Hence leukocyte interferon is now called
IFN-alpha, fibroblast interferon is IFN-beta and T-cell interferon
is IFN-gamma. There is also a fourth type of interferon,
lymphoblastoid IFN, produced in the "Namalwa" cell line (derived
from Burkitt's lymphoma), which seems to produce a mixture of both
leukocyte and fibroblast IFN.
[0036] Human fibroblast interferon (IFN-beta) has antiviral
activity and is also known to inhibit proliferation of cells. It is
a polypeptide of about 20,000 Da induced by viruses and
double-stranded RNAs. From the nucleotide sequence of the gene for
fibroblast interferon, cloned by recombinant DNA technology,
Derynck et al., 1980 deduced the complete amino acid sequence of
the protein, which is 166 amino acid long.
[0037] interferon-.beta. has also been cloned. U.S. Pat. No.
5,326,859 describes the DNA sequence of human IFN-.beta. and a
plasmid for its recombinant expression in bacteria such as E. coli.
European Patent No. 0 287 075 describes a CHO (Chinese Hamster
Ovary) cell line, transfected with the interferon-.beta. coding
sequence and capable of producing recombinant interferon-.beta..
The protein is described as being glycosylated with a biantennary
(two branched) oligosaccharide, featuring a single fucose
moiety.
[0038] Interferon beta has been expressed in several cell lines,
such as CHO cells, BHK 21 (baby hamster kidney cells) and LTK
(mouse L-thymidine kinase negative) cells (Reiser and Hauser,
1987). DHFR negative CHO cells have also been used for the
expression of interferon beta (Innis and McCormick, 1982),
(Chernajovsky et al., 1984).
[0039] interferons are known to be glycosylated, often with
different glycoforms. For example, the saccharide structure of
IFN-.beta. was shown to include a bi-antennary structure, featuring
a single fucose saccharide and terminal galactose sialylation
(Conradt et al., 1987). Glycosylation was shown to also be
important for solubility, since the IFN-.beta. precipitated after
deglycosylation with glycopeptidase F. In addition, IFN-.beta.
produced by E. coli showed folding problems, due to lack of
glycosylation in the bacterial expression system.
[0040] European Patent No. 0 529 300 describes a recombinant
interferon-.beta. having a specific glycosylation pattern, namely
glycosylation with carbohydrate structures that feature one fucose
per oligosaccharide unit. These carbohydrate structures are
biantennary, triantennary and tetraantennary (two, three and four
branched, respectively) oligosaccharides.
[0041] PCT Application No. WO 99/15193 also describes glycosylation
of recombinant interferon-.beta. featuring biantennary,
triantennary and tetraantennary oligosaccharides. The constituent
monosaccharides included mannose, fucose, N-acetylglucosamine,
galactose and sialic acid.
[0042] Various studies have demonstrated the importance of
glycosylation for stability. For example, non-glycosylated forms of
recombinant interferon-.beta. were shown to have significantly
lower stability and also lower biological activity (Runkel et al.,
1998).
[0043] Other studies have shown that recombinant and natural human
interferon-.beta. proteins have different glycosylation patterns
(Kagawa et al., 1988).
[0044] interferon beta is used as a therapeutic protein drug, a
so-called biological, in a number of diseases, such as e.g.
multiple sclerosis, cancer, or viral diseases such as e.g. SARS or
hepatitis C virus infections.
[0045] Therefore, there is a need for processes for the efficient
production and purification of interferon beta, and of cells
expressing interferon beta in high amounts.
SUMMARY OF THE PRESENT INVENTION
[0046] The present invention is based on the development of a
process for producing recombinant human interferon beta in a serum
free medium.
[0047] Therefore, in a first aspect, the invention relates to a
process for the manufacturing of glycosylated recombinant,
preferably human interferon-.beta., comprising a step of culturing
an interferon-.beta. producing cell in a serum-free medium, the
serum-free medium comprising: [0048] about 10 to about 30 mM HEPES,
preferably 20 mM of HEPES; [0049] about 0.5 to about 3 mM Proline,
preferably about 1 mM of Proline; and [0050] about 5500 to about
7000 mg/L sodium chloride, preferably about 6100 mg/L sodium
chloride.
[0051] The present invention is further based on the development of
a process for purifying recombinant interferon beta from a fluid,
in particular from the cell culture harvest derived from cells
producing interferon beta.
[0052] Therefore, in a second aspect, the invention relates to a
process for the purification of recombinant human interferon from a
fluid, comprising the steps of: [0053] Subjecting the fluid to
affinity chromatography; [0054] Subjecting the eluate of the
affinity chromatography to cation exchange chromatography; [0055]
Subjecting the eluate of the cation exchange chromatography to
hydrophobic chromatography by RP-HPLC.
[0056] Analysis of the interferon beta produced by the process of
the invention revealed that it is a composition of differentially
glycosylated interferon beta, i.e. an interferon beta having a
unique glycosylation pattern or profile. Therefore, in a third
aspect, the invention relates to an interferon beta composition
comprising an oligosaccharide structure comprising two or three
fucose saccharides.
[0057] Uses of the recombinant human interferon-.beta. produced
according to the processes of the invention, in the manufacture of
a medicament for the treatment of tumors, multiple sclerosis, viral
infections, and uses of the serum-free cell culture medium of the
invention for the production of interferon beta, are further
aspects of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0058] FIG. 1 shows a flowchart of the method used for generating
an interferon beta producing cell line.
[0059] FIG. 2 shows a flowchart of the new purification process of
IFN-.beta.-1a.
[0060] FIG. 3 shows the ES-MS transformed spectra of IFN-.beta.-1a
batches wherein a schematic drawing of the oligosaccharides
structure is shown on top.
[0061] FIG. 4 shows the ES-MS transformed spectrum of IFN-.beta.-1a
obtained by the new process wherein: [0062] P=protein (IFN-.beta.);
[0063] Fuc Biant=fucosylated biantennary complex type
oligosaccharide; [0064] Fuc Triant=fucosylated triantennary complex
type oligosaccharide; [0065] Fuc Tetrant=fucosylated tetrantennary
complex type oligosaccharide; [0066] SA=sialic acid.
[0067] FIG. 5 shows oligosaccharide structures in IFN-.beta.-1a;
wherein:
[0068] FIG. 5 A shows the major oligosaccharides: [0069] I.
Disialylated biantennary (NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc)
[0070] II. Monosialyl biantennary
(NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc)
[0071] FIG. 5 B shows the minor oligosaccharides, wherein: [0072]
I. Non sialylated biantennary (Hex.sub.5.HexNAc.sub.4.Fuc) [0073]
II. Mono and Disialylated triantennary structure or disialylated
biantennary with N-acetyl lactosamine repeat structure
(NeuAc.sub.2.Hex6.HexNAc.sub.5.Fuc) [0074] III. Trisialylated
triantennary with N-acetyl lactosamine repeat structure or
Trisialylated tetrantennary structure
(NeuAc.sub.3.Hex.sub.7.HexNAc.sub.6.Fuc)
[0075] FIG. 5 C shows the minor oligosaccharides with two or three
Fucose residues: [0076] I. Monosialyl biantennary structure with
two Fucose (NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2) [0077] II.
Disialylated biantennary structure with two Fucose
(NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2) [0078] III.
Disialylated biantennary structure with three Fucose
(NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3)
[0079] FIG. 6 shows the MALDI spectrum of the new IFN-.beta.-1a
with permethylated glycans.
DETAILED DESCRIPTION OF THE INVENTION
[0080] The first aspect of the present invention is based on the
development of a process for the production of interferon beta
under serum-free cell culture conditions. In accordance with the
present invention, the process for the manufacturing of
glycosylated recombinant interferon beta comprises a step of
culturing an interferon beta producing cell in a serum-free medium,
the serum-free medium comprising: [0081] about 10 to about 30 mM
HEPES, preferably 20 mM of HEPES; [0082] about 0.5 to about 3 mM
proline, preferably about 1 mM of proline; and [0083] about 5500 to
about 7000 mg/l sodium chloride, preferably about 6100 mg/l sodium
chloride.
[0084] The serum-free medium may e.g. comprise 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20 or 21 mM of HEPES
(2-(4-(2-HYDROXYETHYL)-1-PIPERAZINYL) ETHANESULFONIC ACID) buffer.
It may also e.g. comprise 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1,
1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5,
2.6, 2.7, 2.8, 2.9, 3, 3, 1 mM of Proline.
[0085] Sodium chloride concentrations in the serum-free medium of
the invention may e.g. be about 5400, 5500, 5600, 5700, 5800, 5900,
6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000,
7100 mg/L.
[0086] In a preferred embodiment, the serum-free medium further
comprises about 10 to about 20, preferably about 15 mg/L Phenol
Red. The Phenol Red concentration may e.g. be 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21 mg/L.
[0087] In the frame of the process of the present invention, the
above-identified components may be used in any suitable known
serum-free medium. Examples of such serum-free media are listed
below:
TABLE-US-00001 Medium Manufacturer Cat. No. EX-CELL 302 JRH
14312-1000M EX-CELL 325 JRH 14335-1000M CHO-CD3 Sigma C-1490 CHO
III PFM Gibco 96-0334SA CHO-S-SFM II Gibco 12052-098 CHO-DHFR Sigma
C-8862 ProCHO 5 Cambrex BE12-766Q SFM4CHO HyClone SH30549.01 Ultra
CHO Cambrex 12-724Q HyQ PF CHO HyClone SH30220.01 HyQ SFX CHO
HyClone SH30187.01 HyQ CDM4CHO HyClone SH30558.01 IS CHO-CD Irvine
Scientific #91119 IS CHO-V Irvine Scientific #9197
[0088] The interferon beta producing cell that may be cultured in
accordance with the present invention may be any mammalian cell,
including animal or human cells, such as e.g. 3T3 cells, COS cells,
human osteosarcoma cells, MRC-5 cells, BHK cells, VERO cells, CHO
cells, CHO-S cells, HEK 293 cells, HEK 293 cells, Normal Human
fibroblast cells, Stroma cells, Hepatocytes cells and PER.C6 cells
that has been modified to express, and preferably secrete
interferon beta.
[0089] The cell to be used in the process of the invention is
preferably an interferon beta expressing CHO clone such as e.g. the
cell line described by Reiser and Hauser (1987) or the cells
described by Innis and McCormick (1982).
[0090] The term "interferon beta", as used herein, is also called
IFN beta, or IFN-.beta., and encompasses interferon beta derived
from any species and preferably human interferon beta, a 166 amino
acid glycoprotein with a molecular weight of approximately 22,500
daltons. The term "interferon beta", as used herein, also
encompasses functional derivatives, muteins, analogs, or fragments
of IFN-beta. The term "interferon beta 1 a" refers to glycosylated
interferon beta.
[0091] The activity of interferon beta may e.g. be measured using a
reference standard calibrated against the World Health Organization
natural interferon beta standard (Second International Standard for
interferon, Human Fibroblast GB 23 902 531). The unit is expressed
in international units (IU) of antiviral activity per mg of
interferon beta-1a determined in an in vitro cytopathic effect
bioassay using WISH cells and Vesicular Stomatitis virus.
TABLE-US-00002 Conversion table for MIU and mcg of IFN-beta MIU 3
12 18 24 mcg 11 44 66 88
[0092] "Variants" or "muteins", as used in the frame of the present
invention, refer to analogs of IFN-beta, in which one or more of
the amino acid residues of natural IFN-beta are replaced by
different amino acid residues, or are deleted, or one or more amino
acid residues are added to the natural sequence IFN-beta, without
diminishing considerably the activity of the resulting products as
compared with the wild type IFN-beta. These muteins are prepared by
known synthesis and/or by site-directed mutagenesis techniques, or
any other known technique suitable therefor.
[0093] The terms "variant" or "mutein" in accordance with the
present invention include proteins encoded by a nucleic acid, such
as DNA or RNA, which hybridizes to DNA or RNA encoding IFN-beta as
disclosed e.g. in U.S. Pat. No. 4,738,931 under stringent
conditions. The term "stringent conditions" refers to hybridization
and subsequent washing conditions, which those of ordinary skill in
the art conventionally refer to as "stringent". See Ausubel et al.,
Current Protocols in Molecular Biology, supra, Interscience, N.Y.,
.sctn..sctn.6.3 and 6.4 (1987, 1992). Without limitation, examples
of stringent conditions include washing conditions 12-20.degree. C.
below the calculated Tm of the hybrid under study in, e.g.,
2.times.SSC and 0.5% SDS for 5 minutes, 2.times.SSC and 0.1% SDS
for 15 minutes; 0.1.times.SSC and 0.5% SDS at 37.degree. C. for
30-60 minutes and then, a 0.1.times.SSC and 0.5% SDS at 68.degree.
C. for 30-60 minutes. Those of ordinary skill in this art
understand that stringency conditions also depend on the length of
the DNA sequences, oligonucleotide probes (such as 10-40 bases) or
mixed oligonucleotide probes. If mixed probes are used, it is
preferable to use tetramethyl ammonium chloride (TMAC) instead of
SSC. See Ausubel, supra.
[0094] Identity reflects a relationship between two or more
polypeptide sequences or two or more polynucleotide sequences,
determined by comparing the sequences. In general, identity refers
to an exact nucleotide to nucleotide or amino acid to amino acid
correspondence of the two polynucleotides or two polypeptide
sequences, respectively, over the length of the sequences being
compared.
[0095] For sequences where there is not an exact correspondence, a
"% identity" may be determined. In general, the two sequences to be
compared are aligned to give a maximum correlation between the
sequences. This may include inserting "gaps" in either one or both
sequences, to enhance the degree of alignment. A % identity may be
determined over the whole length of each of the sequences being
compared (so-called global alignment), that is particularly
suitable for sequences of the same or very similar length, or over
shorter, defined lengths (so-called local alignment), that is more
suitable for sequences of unequal length.
[0096] Methods for comparing the identity and homology of two or
more sequences are well known in the art. Thus for instance,
programs available in the Wisconsin Sequence Analysis Package,
version 9.1 (Devereux J et al., 1984), for example the programs
BESTFIT and GAP, may be used to determine the % identity between
two polynucleotides and the % identity and the % homology between
two polypeptide sequences. BESTFIT uses the "local homology"
algorithm of Smith and Waterman (1981) and finds the best single
region of similarity between two sequences. Other programs for
determining identity and/or similarity between sequences are also
known in the art, for instance the BLAST family of programs
(Altschul S F et al, 1990, Altschul S F et al, 1997, accessible
through the home page of the NCBI at www.ncbi.nim.nih.gov) and
FASTA (Pearson W R, 1990).
[0097] Any such variant or mutein preferably has a sequence of
amino acids sufficiently duplicative of that of IFN-beta, such as
to have substantially similar activity to IFN-beta. A functional
assay for evaluating whether any variant or mutein has a similar
activity as IFN-beta is e.g. the assay measuring the activity of
interferon on the cytopathic effect of vesicular stomatitis virus
in WISH cells, e.g. described by Youcefi et al., 1985. Thus, it can
be determined whether any given mutein has substantially the same
activity as IFN-beta by means of routine experimentation.
[0098] Any such variant or mutein may have at least 40% identity or
homology with the sequence of IFN-beta as disclosed e.g. in U.S.
Pat. No. 4,738,931. More preferably, it has at least 50%, at least
60%, at least 70%, at least 80% or, most preferably, at least 90%
identity or homology thereto.
[0099] Muteins of IFN-beta, which can be used in accordance with
the present invention, or nucleic acid coding therefor, include a
finite set of substantially corresponding sequences as substitution
peptides or polynucleotides which can be routinely obtained by one
of ordinary skill in the art, without undue experimentation, based
on the teachings and guidance presented herein.
[0100] Preferred changes for muteins in accordance with the present
invention are what are known as "conservative" substitutions.
Conservative amino acid substitutions of IFN-beta polypeptides may
include synonymous amino acids within a group which have
sufficiently similar physicochemical properties that substitution
between members of the group will preserve the biological function
of the molecule (Grantham, 1974). It is clear that insertions and
deletions of amino acids may also be made in the above-defined
sequences without altering their function, particularly if the
insertions or deletions only involve a few amino acids, e.g., under
thirty, and preferably under ten, and do not remove or displace
amino acids which are critical to a functional conformation, e.g.,
cysteine residues. Proteins and muteins produced by such deletions
and/or insertions come within the purview of the present
invention.
[0101] Examples for of amino acid substitutions in proteins which
can be used for obtaining muteins of IFN-beta for use in the
present invention include any known method steps, such as presented
in U.S. Pat. Nos. 4,959,314, 4,588,585 and 4,737,462, to Mark et
al; 5,116,943 to Koths et al., 4,965,195 to Namen et al; 4,879,111
to Chong et al; and 5,017,691 to Lee et al; and lysine substituted
proteins presented in U.S. Pat. No. 4,904,584 (Shaw et al).
[0102] A special kind of interferon variant has been described
recently. The so-called "consensus interferons" are non-naturally
occurring variants of IFN (U.S. Pat. No. 6,013,253). Consensus
interferons may also be produced according to the invention.
[0103] "Functional derivatives" of IFN-beta as used herein covers
derivatives which may be prepared from the functional groups which
occur as side chains on the residues or the N- or C-terminal
groups, by means known in the art, and are included in the
invention as long as they remain pharmaceutically acceptable, i.e.,
they do not destroy the biological activity of the proteins as
described above, i.e., the ability to bind the corresponding
receptor and initiate receptor signaling, and do not confer toxic
properties on compositions containing it. Derivatives may have
chemical moieties, such as carbohydrate or phosphate residues,
provided such a derivative retains the biological activity of the
protein and remains pharmaceutically acceptable.
[0104] Derivatives of interferon beta may, for example, include
polyethylene glycol side-chains, which may improve other properties
of the protein, such as the stability, half-life, bioavailability,
tolerance by the human body, or immunogenicity. To achieve this
goal, IFN-beta may be linked e.g. to Polyethlyenglycol (PEG).
PEGylation may be carried out by known methods, described in WO
92/13095, for example. In particular, PEG-IFN can be prepared in
accordance with the teaching of WO 99/55377.
[0105] A functional derivative of IFN-beta may comprise at least
one moiety attached to one or more functional groups, which occur
as one or more side chains on the amino acid residues. An
embodiment in which the moiety is a polyethylene glycol (PEG)
moiety is highly preferred. In accordance with the present
invention, several PEG moieties may also be attached to the
IFN-beta.
[0106] Other derivatives include aliphatic esters of the carboxyl
groups, amides of the carboxyl groups by reaction with ammonia or
with primary or secondary amines, N-acyl derivatives of free amino
groups of the amino acid residues formed with acyl moieties (e.g.
alkanoyl or carbocyclic aroyl groups) or O-acyl derivatives of free
hydroxyl groups (for example that of seryl or threonyl residues)
formed with acyl moieties.
[0107] A "fragment" according to the present invention refers to
any subset of IFN-beta, that is, a shorter peptide, which retains
the desired biological activity as measurable e.g. in the bioassay
described above. Fragments may readily be prepared by removing
amino acids from either end of the molecule and testing the
resultant for its properties as a receptor agonist. Proteases for
removing one amino acid at a time from either the N-terminal or the
C-terminal of a polypeptide are known, and so determining
fragments, which retain the desired biological activity, may be
determined e.g. in the test described by Youcefi et al., 1985, and
involves only routine experimentation.
[0108] The process for production of interferon beta of the
invention may be carried out at a constant temperature, or at
varying temperatures. It may e.g. be carried out at 37.degree. C.
over the whole process. It may also be carried out at a temperature
that is initially, e.g. during the growth phase, at 37.degree. C.
and then diminished to 35.degree. C., 33.degree. C. or 30.degree.
C. for the production phase.
[0109] In a preferred embodiment, the process of the invention
comprises a growth phase I, a growth phase II and a production
phase, wherein the growth phase I is carried out at about
37.degree. C., the growth phase II is carried out at about
35.degree. C., and the production phase is carried out at about
33.degree. C.
[0110] Determination of the end of the phases is well within the
knowledge of the person skilled in the art and is determined e.g.
on the basis of cell density, glucose consumption or any other
metabolic indication. Generally, growth phase I may e.g. be 10 to
12 days. Growth phase II is generally shorter and mainly serves for
adapting the cells to a lower temperature. The growth phase II may
e.g. be 1 to 2 days.
[0111] The process of the invention may be carried out as a
fed-batch or a perfusion process. In accordance with the present
invention, perfusion is preferred.
[0112] Preferably, the process is a perfusion process with a
dilution rate ranging from about 1 to about 10, preferably from
about 1.5 to about 7 per day.
[0113] The term "dilution rate", as defined herein, refers to the
dilution rate D, calculated as liter of medium per liter of total
system working volume per day (total volume=packed-bed+conditioning
tank volume). In accordance with the present invention, the
dilution rate may be in a range of e.g. 0.5, 1, 1.5, 1.6, 1.7, 1.8,
1.9, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.1, 7.2, 7.3, 7.4,
7.5, 8, 8.5, 9, 9.5, 10, 10.5.
[0114] More preferably, the dilution rate is increased within the
first two to three weeks of cell culture from an initial value of
about 1 to 2 per day to a value of about 7 to 10 per day,
particularly during the production phase.
[0115] The culturing step of the process of the invention may be
carried out in any suitable environment, such as Petri dishes,
T-flasks or roller bottles, but preferably in vessels having
greater volumes such as e.g. a bioreactor.
[0116] When the selection is a perfusion process, the system may
e.g. be a stationary packed-bed bioreactor in which cells are
immobilized onto solid carriers. This system is easy to operate and
with appropriate carriers and culture conditions very high cell
density (of .about.10.sup.7-10.sup.8 cellml.sup.-1) can be
achieved.
[0117] A solid carrier that may be used in accordance with the
present invention may e.g. be a microcarrier. Microcarriers are
small solid particles on which cells may be grown in suspension
culture. Cells are capable of adhering and propagating on the
surface of microcarriers. Typically, microcarriers consist of
beads, the diameter of which is comprised between 90 .mu.m and 300
.mu.m. Microcarriers can be made of various materials that have
proven successful for cell attachment and propagation such as,
e.g., glass, polystyrene, polyethylene, dextran, gelatin and
cellulose. In addition, the surface of microcarriers may be coated
with a material promoting cell attachment and growth such as, e.g.,
e.g., N,N-diethylaminoethyl, glass, collagen or recombinant
proteins. Both macroporous and non-porous microcarriers do exist.
Macroporous surfaces give the cells easy access to the interior of
the microcarrier after inoculation, and once inside of the
microcarrier, the cells are protected from the shear forces
generated by mechanical agitation and aeration in the
bioreactor.
[0118] A further solid carrier that may be used in accordance with
the present invention may e.g. be a disk, such as a disk composed
of polyester non-woven fiber bonded to a sheet of polypropylene
mesh (see, e.g., U.S. Pat. No. 5,266,476). Such disks are usually
treated electrostatically to facilitate suspension cells adhering
to the disks and becoming trapped in the fiber system, where they
remain throughout the cultivation process. Cell density and
productivity achieved with cells grown on disks can be up to ten
times higher than with cells growing on microcarriers.
[0119] The process for the production of glycosylated interferon
beta preferably further comprises a step of collecting the
interferon beta containing cell culture harvest.
[0120] In a preferred embodiment, the cell culture harvest is
further subjected to a purification process.
[0121] The purification process may be any process leading to
interferon beta of the required purity and may contain any
combination of purification steps based on chromatography or any
other purification technology such as fractionation with salt or
the like. The purification is preferably carried out according to
the second aspect of the present invention.
[0122] In a second aspect, the invention relates to a process for
the purification of recombinant interferon from a fluid, comprising
the steps of: [0123] a) Subjecting the fluid to affinity
chromatography; [0124] b) Subjecting the eluate of the affinity
chromatography to cation exchange chromatography; [0125] c)
Subjecting the eluate of the cation exchange chromatography to
hydrophobic chromatography by RP-HPLC.
[0126] Step (a) is preferably carried out on Blue Sepharose, e.g.
on a Blue Sepharose fast flow column. Step (b) is preferably
carried out on a caboxymethyl resin, e.g. on a CM Sepharose fast
flow.
[0127] In a preferred embodiment, the purification process of the
invention further comprises, before step (a), a step of clarifying
the fluid by microfiltration.
[0128] In yet a further preferred embodiment, the purification
process according further comprising the steps of: [0129] d)
performing ultrafiltration and dialysis, [0130] e) subjecting the
dialysate to size exclusion chromatography, [0131] f) subjecting
the eluate of the size exclusion chromatography to filtration.
[0132] Step (f) may be carried out e.g. by micro- or
nanofiltration.
[0133] Ultrafiltration is useful for removal of small molecular
weight components in the eluates resulting from previous
chromatrographic steps. Ultrafiltration e.g. allows to remove
organic solvent, TFA and salts from the previous step, to
equilibrate the interferon beta in the required buffer, or to
concentrate the molecule to the desired concentration. Such
ultrafiltration may e.g. be performed on ultrafiltration media
excluding components having molecular weights below 5 kDa.
[0134] If the protein purified according to the process of the
invention is intended for administration to humans, it is
advantageous to further include steps of virus removal. A virus
removal filtration step may e.g. be carried out between steps (d)
and (e), or after step (e). More preferably, the process comprises
two virus removal steps.
[0135] The purity that may be obtained with the purification
process according to the invention is preferably >80%, more
preferably >90% and most preferably >98%.
[0136] The process of purifying interferon beta in accordance with
the present invention preferably further comprises a step of
formulating the purified interferon beta into a pharmaceutical
composition, optionally together with a pharmaceutically acceptable
carrier.
[0137] The interferon beta to be produced or purified in accordance
with the present invention may be expressed by any cell line or
clone. However, it is preferred to use a chinese hamster ovary
(CHO) cell line, designated DUKX-B11, which lacks DHFR
(dihydrofolate reductase) activity, as the host cell for the
preparation of glycosylated interferon beta. The DNA sequence
coding human interferon-.beta. is e.g. described in U.S. Pat. No.
5,326,859.
[0138] A preferred embodiment of the present invention relates to a
method for producing recombinant human interferon-.beta. in
transfected cells capable of producing at least about 100000 IU of
recombinant human interferon-.beta. in specific cellular
productivity (IU/10.sup.6 cells/24 hours). Preferably, the cells
are capable of producing at least about 200000 IU or at least about
200000 IU or at least about 300000 IU or at least about 400000 IU
or at least about 500000 IU or at least about 600000 IU of
recombinant human interferon beta specific cellular
productivity.
[0139] Preferably the interferon beta producing cell is a CHO cell
which is transfected with a nucleic acid construct comprising at
least one promoter/enhancer element functionally linked to the
human IFN-.beta. gene. More preferably, the at least one
promoter/enhancer element comprises a SV40 promoter/enhancer. Most
preferably, the nucleic acid construct comprises at least a first
transcription unit composed of the SV40 promoter/enhancer
functionally linked to the human IFN-.beta. gene, the human
IFN-.beta. gene being functionally linked to the SV40 T Ag early
polyadenylation region. It is also highly preferred that the
nucleic acid construct further comprises at least a second
transcription unit composed of a SV40 promoter/enhancer, a mouse
DHFR gene and a SV40 T Ag polyA-containing early polyadenylation
region.
[0140] Another embodiment of the present invention relates to a
nucleic acid construct comprising at least one promoter/enhancer
element functionally linked to the human IFN-.beta. gene for being
transfected into cells, being characterized in that the transfected
cells are capable of producing at least about 100000 IU, at least
about 200000 IU or at least about 300000 IU or at least about
400000 IU or at least about 500000 IU or at least about 600000 IU
of recombinant human interferon-.beta. in specific cellular
productivity (IU/10.sup.6 cells/per 24 hours).
[0141] Preferably, at least one promoter/enhancer element comprises
a SV40 promoter/enhancer. More preferably, the nucleic acid
construct comprises at least a first transcription unit composed of
the SV40 promoter/enhancer functionally linked to the human
IFN-.beta. gene, the human IFN-.beta. gene being functionally
linked to the SV40 T Ag early polyadenylation region. Most
preferably, the nucleic acid construct further comprises at least a
second transcription unit composed of a SV40 promoter/enhancer, a
mouse DHFR gene and a SV40 T Ag polyA-containing early
polyadenylation region.
[0142] The invention further relates to an interferon beta
obtainable by a process according to the present invention.
[0143] In a further aspect, the invention relates to an interferon
beta composition having a unique glycosylation profile. Such
interferon beta is preferably produced by a process according to
the present invention.
[0144] In one embodiment, the glycosylated recombinant human
interferon-.beta. protein contains an oligosaccharide structure
having two or three fucose saccharides. In a preferred embodiment,
the oligosaccharide structure further comprises a disialyl
biantennary trifucosylated glycan
(Neu.sub.2Ac.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3).
[0145] In a further preferred embodiment, the unique glycosylation
pattern further comprises a non sialylated biantennary structure
(Hex.sub.5.HexNAc.sub.4.Fuc); disialylated triantennary structure
or disialylated biantennary with N-acetyl lactosamine repeat
structures (NeuAc2.Hex6.HexNAc5.Fuc); trisialylated triantennary
structure (NeuAc.sub.3.Hex6.HexNAc.sub.5.Fuc); trisialylated
triantennary structure with N-acetyl lactosamine repeat structures
or trisialylated tetrantennary
(NeuAc.sub.3.Hex.sub.7.HexNAc.sub.6.Fuc); mono sialylated and
disialylated biantennary structure with two fucose units
(NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2,NeuAc.sub.2.Hex.sub.5.HexNAc.sub.-
4.Fuc.sub.2).
[0146] Preferably, the unique glycosylation pattern comprises
glycans featuring a similar level of N-Acetylneuraminic
acid:N-Glycolyineuraminic acid as for natural human protein
glycosylation patterns.
[0147] In a further preferred embodiment, the interferon beta
composition of the invention is characterized by a sialylation
profile comprising about 1 to about 5% of unsialylated N-glycans,
about 5 to about 25% of mono-sialylated glycans, about 55 to about
75% of di-sialylated N-glycans, about 10 to about 25% of
tri-sialylated N-glcyans.
[0148] A further aspect of the present invention relates to the use
of interferon beta in accordance with the present invention for the
manufacture of a medicament for treatment of human disease, in
particular multiple sclerosis, cancer, or viral infections.
[0149] The multiple sclerosis may be selected from the group
consisting of relapsing, non-relapsing and early onset multiple
sclerosis.
[0150] In a further aspect, the invention relates to a method of
treating a subject in need of treatment with interferon-.beta.
according to the invention, comprising administering to the subject
recombinant human interferon-.beta. protein as described
herein.
[0151] Preferably, the treatment is for multiple sclerosis. More
specifically, the multiple sclerosis may be selected from the group
consisting of relapsing, non-relapsing and early onset multiple
sclerosis.
[0152] Alternatively, the treatment is an anti-tumor treatment.
[0153] In a further alternative, the treatment is an anti-viral
treatment.
[0154] In a further aspect of the present invention, the invention
relates to a pharmaceutical composition comprising, as an active
ingredient, an isolated, purified, recombinant human
interferon-.beta. composition as described herein and a
pharmaceutically acceptable carrier for administration of the
pharmaceutical composition. Preferably, the pharmaceutical
composition having anti-tumor or anti-viral activity, or activity
against multiple sclerosis, comprises, as an active ingredient, an
isolated, purified, recombinant human interferon-.beta. protein as
described herein and a pharmaceutically acceptable carrier for
administration of the pharmaceutical composition.
[0155] In yet a further aspect of the present invention, the
invention relates to an article of manufacture comprising packaging
material and a therapeutically effective amount of an isolated,
purified recombinant interferon-.beta. protein, wherein the
packaging material comprises a label or package insert indicating
that the recombinant human interferon-.beta. protein as described
herein can be administered to a human for treatment thereof.
[0156] The isolated, purified, recombinant human interferon-.beta.
protein or pharmaceutical composition as described herein is
preferably used for the manufacture of a medicament for treatment
of relapsing, non-relapsing and early onset multiple sclerosis.
Dosing regimens for a particular subject (patient) can easily be
determined by one of ordinary skill in the art, as these regimens
are well known in the art.
[0157] Reference is now made to the following examples, which
together with the above description, illustrate the invention in a
non limiting fashion.
[0158] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Culture of Animal Cells--A Manual of Basic Technique"
by Freshney, Wiley-Liss, N.Y. (1994), Third Edition;
"Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid
Hybridization" Hames, B. D., and Higgins S. J., eds. (1985);
"Transcription and Translation" Hames, B. D., and Higgins S. J.,
eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986);
"Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical
Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in
Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To
Methods And Applications", Academic Press, San Diego, Calif.
(1990); Marshak et al., "Strategies for Protein Purification and
Characterization--A Laboratory Course Manual" CSHL Press (1996);
all of which are incorporated by reference as if fully set forth
herein.
[0159] Having now fully described this invention, it will be
appreciated by those skilled in the art that the same can be
performed within a wide range of equivalent parameters,
concentrations and conditions without departing from the spirit and
scope of the invention and without undue experimentation.
[0160] While this invention has been described in connection with
specific embodiments thereof, it will be understood that it is
capable of further modifications. This application is intended to
cover any variations, uses or adaptations of the invention
following, in general, the principles of the invention and
including such departures from the present disclosure as come
within known or customary practice within the art to which the
invention pertains and as may be applied to the essential features
hereinbefore set forth as follows in the scope of the appended
claims.
[0161] All references cited herein, including journal articles or
abstracts, published or unpublished U.S. or foreign patent
application, issued U.S. or foreign patents or any other
references, are entirely incorporated by reference herein,
including all data, tables, figures and text presented in the cited
references. Additionally, the entire contents of the references
cited within the references cited herein are also entirely
incorporated by reference.
[0162] Reference to known method steps, conventional methods steps,
known methods or conventional methods is not any way an admission
that any aspect, description or embodiment of the present invention
is disclosed, taught or suggested in the relevant art.
[0163] The foregoing description of the specific embodiments will
so fully reveal the general nature of the invention that others
can, by applying knowledge within the skill of the art (including
the contents of the references cited herein), readily modify and/or
adapt for various application such specific embodiments, without
undue experimentation, without departing from the general concept
of the present invention. Therefore, such adaptations and
modifications are intended to be within the meaning range of
equivalents of the disclosed embodiments, based on the teaching and
guidance presented herein. It is to be understood that the
phraseology or terminology herein is for the purpose of description
and not of limitation, such that the terminology or phraseology of
the present specification is to be interpreted by the skilled
artisan in light of the teachings and guidance presented herein, in
combination with the knowledge of one of ordinary skill in the
art.
EXAMPLES
Example 1
Preparation of a Chinese Hamster Ovary (CHO) Clone Producing
IFN-Beta at High Levels
[0164] This Example describes the generation of an interferon beta
producing CHO clone.
[0165] The basic procedure, particularly with regard to the
preparation of the expression plasmid, is described in Mory et al.
(1981).
[0166] An overview over the process of generating the clone is
depicted in FIG. 1. A DNA fragment comprising the human
interferon-.beta. coding region was isolated from a human
peripheral blood cell genomic DNA library. A DHFR-deficient CHO
cell line was transfected with a recombinant plasmid containing
both the human IFN-.beta. coding sequence and the mouse DHFR gene
as a selectable and amplifiable marker. After selection in
thymidine-free medium, gene amplification with methotrexate (MTX),
and cloning, a cell producing IFN-.beta.-1a at high levels was
isolated. The cells were subjected to genotypic and phenotypic
characterization.
[0167] Construction of the Expression Plasmid Carrying the
hIFN-.beta. and the mDHFR Genes
[0168] An expression vector containing both, the genomic human
IFN-.beta. coding sequence and the mouse DHFR resistance gene was
constructed. This construction eliminated the necessity of
co-transfection of the CHO host cells with two separate plasmids,
one comprising the IFN-.beta. coding sequence and the second
comprising the mouse DHFR sequence, as known e.g. from Chemajovsky
et al., 1984.
[0169] The expression vector containing the IFN-.beta. coding
sequence was devoid of the IFN-.beta. 3'UTR and thus of the
IFN-.beta. polyadenylation region.
[0170] The expression vector of the invention therefore contained
two transcription units, a first IFN-.beta. transcription unit
composed of the SV40 promoter/enhancer, the human IFN-.beta. coding
sequence and the SV40 T Ag early polyadenylation region, and a
second DHFR transcription unit composed of the SV40
promoter/enhancer, the mouse DHFR gene and the SV40 T Ag
polyA-containing early polyadenylation region.
[0171] These transcription units were followed by sequences from
the pBR322 plasmid carrying the ColEI bacterial origin of
replication and ampicillin resistance gene.
[0172] The structure of the expression vector was verified by
restriction map analysis and by complete sequencing
(double-stranded, automated sequencing). The correct sequence of
the fragments used for its construction was confirmed in both
directions.
[0173] Description of the Host Cell
[0174] A Chinese hamster ovary (CHO) cell line, designated
DUKX-B11, which lacks DHFR (dihydrofolate reductase) activity, was
used as the host cell. The cell line was isolated from the CHO-K1
cell line, requiring proline (Kao and Puck, 1968) by mutagenesis
with ethyl methanesulfate followed by gamma irradiation. DHFR
deficient mutants were selected by exposure to high specific
activity [.sup.3H]-deoxyuridine (Urlaub and Chasin, 1980).
[0175] Full deficient mutants require glycine, hypoxanthine and
thymidine for growth. The central role of DHFR in the synthesis of
nucleic acid precursors, together with the sensitivity of
DHFR-deficient cells to analogs such as methotrexate (MTX), present
two major advantages. Firstly, transfection of such DHFR-deficient
cells with plasmids containing a DHFR gene allows the selection of
recombinant cells that grow in thymidine-free medium. Secondly,
culture of these cells in selective media containing increasing
concentrations of MTX results in amplification of the DHFR gene and
the associated DNA (Kaufman and Sharp 1982, and Sambrook, J.,
Fritsch, E. F., Molecular Cloning: A laboratory manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
[0176] Generation of the Clone
[0177] As outlined in FIG. 1, anchorage-dependent, DHFR-deficient
CHO cells were transfected by the calcium phosphate precipitation
procedure (Graham F L and Van Der E B, 1973; Busslinger, et al.,
1981) with the plasmid containing both the h-IFN-.beta. coding
sequence and the mDHFR marker gene described above. To amplify the
transfected gene, selected clones were submitted to MTX
(methotrexate) treatment. The clones were isolated after MTX
selection.
[0178] Transfection
[0179] The CHO DHFR-deficient cell line DUKX-B11 was cultured in
Ham's Nutrient Mixture F12 supplemented with 10% FBS, at 37.degree.
C., 5% CO.sub.2.
[0180] The day before transfection, the CHO DUKX-B11 cells were
seeded at 5.times.10.sup.5 cells/9 cm plate. CaPO.sub.4-DNA
co-precipitates were prepared by mixing the vector DNA, dissolved
in 0.45 ml of 10 mM Tris-HCl pH 7.9, 0.1 mM EDTA, with 0.05 ml of a
2.5M CaCl.sub.2 solution.
[0181] Next, 0.5 ml of 280 mM Na.sub.2HPO.sub.4, 50 mM HEPES pH 7.1
was added with gentle shaking and the mixture was kept for 30-40
minutes at room temperature, to allow precipitation. After adding
the CaPO.sub.4-DNA to the cells for 30 minutes, 9 ml of cell
culture medium were added and the cells returned to the incubator
for 4 hours. Thereafter, the medium was removed and the cells
osmotically shocked with 10% glycerol in medium, for 4 minutes. The
cells were then trypsinized and subcultured at 1:4 to 1:10 split
ratio in selective medium consisting of Dulbecco's Modified Eagles
Medium (DMEM) lacking thymidine but supplemented with 150 .mu.g/ml
proline and 10% dialyzed FBS. The cultures were kept at 37.degree.
C. and 8% CO.sub.2 and the selective medium was changed every 3-4
days.
[0182] Isolation of a Constitutive hIFN-13 Producing Cell Line
[0183] Interferon beta producing cells were isolated after 10-12
days by trypsinization with 3 mm trypsin-soaked paper-discs.
Forty-three clones were picked, individual clones were grown and
the cell culture supernatants tested for hIFN-.beta. production by
ELISA. Three clones producing more than 30,000 IFN-.beta.
IU/10.sup.6 cells/24 hours were selected for gene
amplification.
[0184] Each of the clones was subjected to culture with low
concentrations of MTX. The entire cell population that survived the
treatment was subjected to higher MTX concentrations. Subcloning
and clone selection were performed only after the last
amplification stage. The selected high producers (more than 400,000
IU/10.sup.6 cells/24 hours) were subjected to clone stability
studies. A relatively stable high producer clone was selected and
subcloned. From the resulting clones, a high producer stable clone
was selected.
[0185] Amplification increased production levels (specific
productivity) of IFN-.beta.-1a from 30,000 to 500,000 IU/10.sup.6
cells/24 hours, as determined by ELISA.
[0186] Northern blot analyses were performed after the initial
isolation of the clones of high IFN-.beta.-1a productivity. A
single hIFN-.beta. mRNA of about 0.9 kb, as expected from the
expression construct, was expressed (data not shown).
[0187] For the Northern blot analysis of total RNA from primary
clones, the blot was prepared as follows.
[0188] Twenty .mu.g of total RNA were separated by electrophoresis
on agarose formaldehyde gels. RNA was transferred to a nylon
membrane and hybridized to an IFN-.beta. DNA probe. Size markers
(M) are 28S and 18S rRNA, which correspond to 4700 and 1900
nucleotides, respectively (not shown).
[0189] Productivity
[0190] Cellular productivity was then tested as follows. The tissue
culture (growth) medium was DMEM (Dulbecco's Modified Eagle's
medium), supplemented with proline (150 mg/l) and 10% FBS (fetal
bovine serum) or in serum-free medium, e.g. Ex-Cell 302 from
JRH.
[0191] Cells from the interferon producing clone were seeded in
TC80 flasks (2.times.10.sup.6 cells/flask) in 30 ml growth medium
(either DMEM and FBS, or serum-free medium). When initial
confluency was reached, as determined by microscopic examination,
the growth medium was replaced with 20 ml of fresh medium and the
cultures incubated at about 32.degree. C. for 24 hours. Samples of
the culture medium were obtained from each flask. IFN-.beta.-1a
level was determined by ELISA from the culture medium with a
commercial ELISA kit (for example, the Toray ELISA kit from Toray,
Japan).
[0192] Specific cellular productivity was calculated by multiplying
the IU/ml of IFN-.beta.-1a produced per 24 hours by the volume per
TC80 flask and dividing by the total cell number (in millions) per
flask.
[0193] Results and Conclusions
[0194] The interferon beta producing cell clone was a stable cell
line, having a high production capacity for recombinant human
interferon-.beta. in the range of about 100,000 IU in specific
cellular productivity (IU/10.sup.6 cells/24 hours) and about
600,000 IU in specific cellular productivity. The mean productivity
of the new cell line was 556,000.+-.119,000 IU/10.sup.6 cells/24
hrs.
[0195] General cellular morphology was also examined by phase
contrast microscopy one to four days after seeding. Morphology was
documented with photomicrographs (not shown). The results show that
at low density (24 to 48 hrs after seeding) the cells exhibited
rounded, spindle-shaped morphology (results not shown). At
confluency, the cells form dense monolayers comprised of elongated,
spindle shaped and smaller, tightly packed, epithelial-like cells
(results not shown). The morphological characteristics exhibited by
these cells were typical of CHO cells.
[0196] DNA sequence determination of the hIFN-.beta. coding region
in cells of the clone
[0197] PCR DNA products derived from the hIFN-.beta. messenger RNA
(mRNA) were used to determine the coding region nucleotide
sequences as the mRNA sequence provides direct proof that the RNA
transcripts are processed correctly.
[0198] Procedure for DNA Sequencing
[0199] cDNA and PCR Reactions
[0200] Total cellular RNA was prepared from the cells in the
exponential stage of growth in T-flask cultures (Chomczynski and
Sacchi, 1987). Complementary DNA (cDNA) was synthesized from the
mRNA samples in a reaction which contained 2 micrograms (.mu.g) of
total RNA, 0.5 .mu.M random hexamers, 2.5 mM MgCl.sub.2,
1.times.PCR II buffer [10 mM Tris-HCl (pH 8.3), 50 mM KCl], 0.5 mM
each of dATP, dCTP, dGTP, and dTTP, 40 units of RNase Inhibitor,
and 200 units of Reverse Transcriptase in a final volume of 100
.mu.l.
[0201] The RNA template, primer and nuclease-free water were
combined and incubated at 65.degree. C. for 10 minutes and were
then placed in an ice bath. The remaining components were added and
the reaction was incubated at 42.degree. C. for 60 minutes, then
70.degree. C. for 15 minutes and was then held at 4.degree. C.
indefinitely. The RT products (cDNAs) were stored at --20.degree.
C. until further use. As a control, a reaction with all components
except the reverse transcriptase was prepared. The "no RT" control
is to exclude the unlikely possibility that the RNA preparations
had DNA contamination.
[0202] PCR amplification was done using primers SRB1 AP1 and AP2
for the cDNA templates. Sequences for these primers are as
follows:
TABLE-US-00003 SRB1 AP1: CCTCGGCCTCTGAGCTATTC (SEQ ID NO: 1) SRB1
AP2: CACAAATAAAGCATTTTTTT (SEQ ID NO: 2)
[0203] The PCR reactions consisted of the following: 4.0 .mu.l of
cDNA reaction mixture, 50 .mu.mol of each of the primer pair, and
25 .mu.l HotStarTaq.TM. Master Mix in a reaction volume of 50
.mu.l. The reactions were heated at 95.degree. C. for 15 minutes
followed by 30-35 cycles of: (a) 94.degree. C. for 30 seconds, (b)
55.degree. C. for 30 seconds, and (c) 72.degree. C. for 1 minute. A
final cycle, identical to the first 30-35, but with the 72.degree.
C. incubation time extended to 10 minutes, was then done.
[0204] The hIFN-.beta. PCR products were purified by low melting
point (LMP) agarose gel electrophoresis followed by extraction
using the QIAquick gel extraction kit (Qiagen).
[0205] Sequencing of Amplified DNA
[0206] The PCR products were sequenced directly with the Big
Dye.TM. Terminator Cycle Sequencing Ready Reaction Kit with
AmpliTaq.RTM. DNA Polymerase. All sequencing reactions were
analyzed on 5.75% Long Ranger.TM. gels on ABI373-S automated DNA
sequencers. The raw data were tracked and analyzed using ABD
Analysis software.
[0207] Results
[0208] PCR amplification resulted in the generation of the
predicted approximate 815 bp fragment. No PCR products were
observed for the "no RT" control nor for the other negative
controls.
[0209] Complete sequence data were obtained for the protein-coding
region of the hIFN-.beta. gene; all nucleotides were read on two or
more electropherograms (data not shown). When the sequences were
compared to the expression vector, no differences were found (data
not shown).
[0210] Conclusions
[0211] The sequencing data demonstrate that the hIFN-.beta. gene
integrated into cells of genome of the clone is correctly
transcribed into hIFN-.beta. mRNA.
[0212] Determination of Gene Copy Number
[0213] The gene copy number was determined by Southern blot
analysis of BamHI digests.
[0214] The specific primers used to build the probes for the gene
copy number analysis are the following:
TABLE-US-00004 (SEQ ID NO: 3) (i) 5': PR221626:
ATGACCAACAAGTGTCTCCTCC (SEQ ID NO: 4) (ii) 3': PR231217
ACTTACAGGTTACCTCCGAAAC
[0215] Procedures for Genomic DNA Preparation and Southern
Blotting
[0216] Genomic DNA was isolated from exponentially growing T-flask
cultures of the cells using a modification of the salting out
method (Martinez et al., 1998). Briefly, the cells were resuspended
in a Tris-NaCl-EDTA buffer and then lysed with a Tris-NaCl-EDTA-SDS
buffer. This suspension was treated overnight with proteinase K.
After addition of a saturated salt solution and centrifugation, the
genomic DNA was precipitated by addition of isopropanol to the
aqueous phase. Following a 70% ethanol wash, the DNA pellet was
resuspended in a TE/RNase A solution (10 mM Tris-HCl pH 8.0, 1 mM
EDTA, 20 .mu.g/ml RNaseA).
[0217] Aliquots of all the genomic DNA preparations were digested
with AflIII, BbsI, BglI, DraI, HincI, PstI, and XmnI. Standards
were prepared by digestion of the expression vector DNA sample with
the same restriction endonucleases used for the genomic samples.
The DNA was size-fractionated by electrophoresis in agarose gels
and then transferred in 10.times.SSC to nylon membranes by
capillary action. The amount of genomic DNA loaded was 0.5 .mu.g.
Blots were prepared for hybridization to a .sup.32P-labeled
hIFN-.beta. fragment that was PCR amplified from the plasmid using
the primers indicated above. Prehybridization and hybridization was
done at 65.degree. C.
[0218] Size determinations were made based on the migration of the
bands as visualized by .sup.32P on an autoradiograph. The
expression vector was used as the control.
[0219] Copy number determinations were based on relative .sup.32P
levels in the bands as quantitated on a model 445SI
Phospholmager.TM. (Molecular Dynamics; Sunnyvale, Calif.).
Autoradiographs were photographed to provide a record of the
results (data not shown).
[0220] Results
[0221] Size determinations of fragments generated for the
interferon beta producing cells of the clone were compiled for all
digests.
[0222] Enzyme digestion of the DNA extracted from the interferon
beta producing cell line resulted in the production of prominent
bands that matched those predicted from the expression vector for
the BamHI, BglI, DraI and HincI digests. A very faint band (-1.77
kb) was observed with the BglI-digested genomic DNAs, most likely a
result of incomplete digestion. These restriction enzymes flank the
hIFN-.beta. expression unit indicating that an intact, functional,
full-length unit has integrated into the genome.
[0223] In the remaining digests, differences in the banding
patterns were observed between the expression vector and the
genomic DNAs. This is not unexpected as some rearrangement must
occur when the circular vector integrates into the CHO cell
genome.
[0224] The copy number levels determined for the cells of the clone
were on average 96-105 copies per cell. For example, for one group
of cells, the average gene copy number (n=3) was 105, with an
standard deviation of 23 and a CV (%) of 22.
[0225] Determination of mRNA Size
[0226] Total RNA was isolated from exponentially growing interferon
beta producing cells and untransfected CHO DUKX cells (Chomczynski
and Sacchi, 1987). The probes used included a .sup.32P-labeled
hIFN-.beta. probe prepared as described in section "Determination
of gene copy number" and a control G3PDH cDNA probe (Clontech; Palo
Alto, Calif.).
[0227] Procedure
[0228] Total RNA, 5 .mu.g per lane, was size-fractionated by
electrophoresis in agarose gels that contained formaldehyde as a
denaturant. Samples were loaded in duplicate sets. The RNA was
transferred in 10.times.SSC to nylon membranes by capillary action.
Prehybridization and hybridization were done at 65.degree. C. in
the modified Church and Gilbert solution described in section
"Restriction endonuclease map analysis". The blots were hybridized
to a .sup.32P-labeled hIFN-.beta. probe and a control G3PDH cDNA
probe. The band sizes were estimated from an autoradiograph of the
blots.
[0229] Results and Conclusions
[0230] One major IFN-.beta. mRNA species was observed for the
cells. The mRNA size was estimated to be 0.9 kb mRNA. This size
correlates well to an mRNA starting at the SV40 transcription
initiation site and resulting in a transcript of about 800
nucleotides without considering the polyA tail.
[0231] General Conclusions and Summary
[0232] The phenotypic and genotypic studies on the interferon beta
producing cells confirmed the identity and consistency of the
cells.
[0233] The chromosomal integration of the hIFN-.beta. gene into the
CHO cells genome was demonstrated by in-situ hybridization
studies.
[0234] Comparison of restriction endonuclease mapping patterns, DNA
sequences and mRNA analyses of cells showed no evidence of gross
DNA rearrangements or point mutations of the hIFN-.beta. gene.
[0235] The hIFN-.beta. gene copy number levels were measured by
Southern blot analysis of DNA extracted from the cells of the clone
according to the present invention. The results showed that gene
copy number levels were in the same ranges for all cells,
independently of the population doubling levels.
[0236] Northern blot analysis of RNA prepared from the cells showed
a single band of approximately 0.9 kb in size.
[0237] Sequence analyses of the cDNA from the cells confirmed the
correctness of the mRNA sequence, while the genomic DNA sequences
of the 5' and 3' control regions of the hIFN-.beta. gene verified
the integration of the complete IFN-.beta. transcription unit.
[0238] In conclusion, it was demonstrated that the interferon beta
producing cells synthesized hIFN-.beta. mRNA transcripts with the
correct protein coding region sequence, indicating that the
interferon beta producing cells produce human recombinant
IFN-.beta. (IFN-.beta.-1a) with the correct primary amino acid
sequence.
[0239] For the genotypic characterization, restriction map analyses
were performed on the interferon beta producing cells. Multiple
digests were separated by agarose gel electrophoresis, transferred
to nylon membranes and hybridized to labelled probes specific for
the hIFN-.beta.. Consistent restriction fragment profiles,
indicated the integration of an intact functional hIFN-.beta.
expression unit, in all the cell banks.
[0240] The hIFN-.beta. gene copy numbers were determined by
Southern blot analysis of DNA extracted from the interferon beta
producing cells (data not shown). The results show gene copy
numbers to be about 100 copies per cell, which is about four times
higher than for the clone described in the literature (Chemajovsky
et al., 1984).
[0241] By Northern blot analysis, one mRNA of about 0.9 kb, coding
for the hIFN-.beta. gene, was identified for the cells from the
clone (data not shown).
[0242] The hIFN-.beta. cDNAs prepared from the cells' mRNAs were
sequenced and the results showed that for the cells, the
hIFN-.beta. gene sequence was 100% identical to the expected
sequences. Thus, the hIFN-.beta. gene is correctly transcribed into
mRNA.
[0243] The genomic DNA sequence of the 5' and 3' regions flanking
the hIFN-.beta. gene was determined for the cells of the clone and
found to be 100% identical to the corresponding sequences of
expression vector and the published sequence of the hIFN-.beta.
gene.
[0244] The single chromosomal integration of the hIFN-.beta. gene
was also demonstrated by fluorescent in-situ hybridization (FISH,
results not shown).
[0245] The analyses presented above also demonstrated the stability
of the production line.
[0246] It can thus be assumed that the transfected gene is stably
integrated in the interferon beta producing cells' genome.
Example 2
Process for the Production of Interferon Beta
[0247] The overall goal of this experiment was to develop a process
for producing IFN beta-1a from the clone described in example 1
under serum-free conditions.
[0248] The serum-free process was developed at 75 L bioreactor
scale with internal packed bed Fibra-Cel.RTM. carriers.
[0249] The cells were thawed and expanded over 21 days in a
commercially available serum-free medium having the following
modifications:
TABLE-US-00005 TABLE 1 Modification of serum-free medium
Ingredients Composition in % (w/w) HEPES 20 mM Proline 1 mM Phenol
Red 15 mg/L Sodium chloride 6150 mg/L
[0250] 30.times.10.sup.9 cells were seeded in the 75 L bioreactor
(high seeding).
[0251] The runs were divided into the following phases: [0252] a
growth phase I at 37.degree. C. (until working day 2 or working day
4 or when the glucose consumption rate (GCR) was .gtoreq.2.0.+-.1.0
gL.sup.-1d.sup.-1) [0253] a growth phase II at 35.degree. C. (until
working day 7 or when GCR.gtoreq.8.0.+-.0.5 gL.sup.-1d.sup.-1)
[0254] a production phase at 33.degree. C.
[0255] This temperature strategy resulted in a productivity around
6.0.times.10.sup.6 IU/ml bio per day. This productivity is about
five times higher than the productivity of the clone described in
the literature (Chemajovsky et al., 1984) in serum-containing
medium.
[0256] It was further tested whether addition of N-Actey-Cyteine
(NAC) alone or in combination with Zinc (NAC+Zn) had a beneficial
effect on productivity. Addition of NAC or NAC+Zn increased the
productivity to around 12.times.10.sup.6 IU/ml bio per day at the
end of the run.
[0257] A 66% lower seeding cell density (1.3.10.sup.9 cells) was
also tested in order to evaluate its impact on growth phase
duration, metabolism and productivity.
[0258] The metabolism and productivity were not affected by low
seeding. The only impact of low seeding was the addition of two
days to the growth phase.
[0259] In summary, the final conditions used for the production of
interferon beta were as follows:
TABLE-US-00006 Temperature Growth: Production: 37.degree. C.
35.degree. C. 33.degree. C. Dilution rate 1.6 7.2 Day.sup.-1 pH 7.0
pO.sub.2 70%
Example 3
Purification of the Interferon Protein Product
[0260] The purification process of the IFN-.beta.-1a from cell
culture supernatant included four chromatographic and four
filtration stages, as shown in FIG. 2. The purification stages were
performed in the following order: [0261] Stage I: Harvest
clarification by filtration [0262] Stage II: Affinity
chromatography on a Blue Sepharose 6 fast flow (6 FF) column;
[0263] Stage III: Ultrafiltration [0264] Stage IV: Cation exchange
chromatography using preferably a CM Sepharose FF column; [0265]
Stage V: Hydrophobic chromatography RP-HPLC; [0266] Stage VI:
Ultrafiltration and dialysis; [0267] Stage VII: Size Exclusion (SE)
chromatography; [0268] Stage VIII: Microfiltration.
[0269] The purification of the active ingredient started with dye
affinity chromatography on Blue Sepharose 6 FF (BS 6 FF), which was
the major purification stage. The amount of host cell derived
proteins as well as DNA from ruptured CHO cells was reduced by
several orders of magnitude and therefore IFN-.beta.-1a in the BS 6
FF eluate was significantly enriched. Before the eluate was loaded
on to the next column ultrafiltration was performed to reduce the
solution volume and exclude low molecular weight material.
[0270] To obtain highly purified IFN-.beta.-1a three main types of
column-based protein separations have been chosen. Ion-exchange
chromatography on CM-sepharose FF resin removes nucleic acid and
FBS/CHO derived proteins. Reverse phase HPLC reduced pyrogens,
residual host cell derived proteins and degraded forms of
IFN-.beta.-1a. A final polishing stage of gel filtration was
performed using Sephacryl S-100 HR resin. The eluate was
microfiltered (0.22 .mu.m) and stored at -70.degree. C. or
below.
[0271] All starting materials used for preparation of buffers and
cleaning solutions complied with the Ph. Eur. and/or USP or are of
analytical or reagent grade.
Example 4
Sialylation Analysis
[0272] The purified IFN-beta was subjected to analysis of the
sialylation profile by ES-MS (Electro Spray-Mass Spectrometry),
with the following results:
TABLE-US-00007 Run 1 Run 2 Non sialylated 2% 4% Mono-sialylated 10%
22% Di-sialylated 69% 59% Tri-sialylated 20% 16%
Example 5
Glycoform Analysis
[0273] In order to further analyze IFN-.beta.-1a obtained from the
new process, the glycoforms of the protein were analyzed. As
previously described, glycosylated proteins often occur as a
mixture of different glycoforms, or proteins having different
saccharide structures in their glycosylation. Various techniques
were used to analyze these glycoforms, as described in greater
detail below, including electrospray mass spectroscopy, FAB-MS,
MALDI-MS, tandem mass spectroscopy (MS/MS) and GC-MS (linkage
studies). These different techniques all showed that of the
different saccharide structures studied, one such structure was
newly present in the IFN-.beta.-1a obtained from the clone.
[0274] Glycoform Distribution Determination by Electrospray Mass
Spectroscopy
[0275] Method
IFN-.beta.-1a bulk samples of interferon beta obtained by the clone
using electrospray mass spectrometry (ES-MS). The method is e.g.
described by Fenn, et al., (1989).
[0276] MS/MS of glycans. This technique permitted rapid monitoring
of the glycoform distribution of the bulk samples at the molecular
mass level. This method is e.g. described by Domon, B. and
Costello, C E (1988).
[0277] Results
[0278] The results are presented in FIGS. 3-5. For all Figures,
schematic drawings of the various oligosaccharides are shown on top
of each peak. FIGS. 3 and 4 show the ES-MS transformed spectra of
several IFN-.beta.-1a batches from interferon beta obtained by the
new process.
[0279] In all batches tested, the major glycoforms were the
core-fucosylated disialyl (peak C) and monosialyl (peak B)
biantennary carbohydrate structures and the minor glycoforms
corresponded to the core-fucosylated non-sialylated biantennary
(peak A), the core-fucosylated triantennary trisialylated (peak E)
and 2 other core-fucosylated minor complex structures (peaks D and
F).
[0280] Minor signals at 22524 Da.+-.0.01%, attributed to disialyl
biantennary difucosylated glycans
(NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2), were detected by
ES-MS in samples of IFN-.beta.-1a derived from interferon beta
obtained by the new process. This glycoform can also be defined as
biantennary glycan with sialyl Lewis x (Le.sup.x) antenna. It
should be noted that the Lewis x (Le.sup.x) glycan, composed of
Hex. HexNAc.Fuc structure, is commonly found in glycoproteins on
the surfaces of both lymphocytes (L-selectin) and specialized
endothelial cells (Cummings, 1999; Dell and Morris, 2001).
[0281] Another minor glycoform centered at a mean molecular weight
value of 22670 Da.+-.0.01%, with average amount of 4% of all
glycoforms and attributed to a disialyl biantennary trifucosylated
glycan (Neu.sub.2Ac.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3) was detected
by ES-MS in the IFN-.beta.-1a batches from interferon beta obtained
by the new process, independently of the production scale. The
average amount of this minor glycoform is of 4%, with a SD of
0.90.
Conclusions
[0282] The glycoform pattern of IFN-.beta.-1a derived from
interferon beta obtained by the new process was analyzed by
ES-MS.
[0283] The minor signals, attributed to difucosylated glycans,
found by ES-MS in IFN-.beta.-1a from interferon beta obtained by
the new process, were detected by MALDI-MS. One additional minor
glycoform (average of 4% of total glycoforms), attributed to a
trifucosylated structure, was detected by ES-MS in the product from
interferon beta obtained by the new process as well.
[0284] Carbohydrate Analysis by FAB-MS, MALDI-MS, Tandem Mass
Spectroscopy (MS/MS) and GC-MS (Linkage Studies)
[0285] IFN-.beta.-1a bulk samples derived from interferon beta
obtained by the new process were subjected to extensive
carbohydrate characterization studies. The carbohydrate composition
of IFN-.beta.-1a was obtained using FAB-MS, MALDI-MS,
Nanospray-MS/MS analyses and linkage studies (GC-MS) of
permethylated IFN-.beta.-1a following tryptic and peptide
N-glycosidase F digestion. Glycosylation site determination was
accomplished by FAB-MS analyses of chymotryptic peptides previously
digested with trypsin and N-glycosidase F.
[0286] Method
[0287] The tryptically cleaved peptide glycopeptide mixture from
the IFN-.beta.-1a was treated with the enzyme peptide-N-glycosidase
F (e.g. as described by Tarentino et al. 1985).
[0288] After stopping the reaction (by freeze-drying), the
resulting digest was purified by C18 Sep.-pak cartridge.
Carbohydrates eluting in the 5% acetic acid fraction were
permethylated using NaOH/methyl iodide, as described e.g. by
Costello (1997).
[0289] A portion of the permethylated glycan was analyzed by
positive ion FAB-MS (obtained in low mass ranges for fragment ions
and high mass ranges for molecular ions), as described e.g. by
Barber, et al. (1981) and Taylor (1983).
[0290] MALDI-mass spectrometry was performed as e.g. described by
Hillenkamp, et al., 1991.
[0291] Nanospray-mass spectrometry was performed as described e.g.
by Wilm and Mann 1996.
[0292] The remainder of permethylated oligosaccharides were used
for linkage analysis by gas liquid chromatography/mass Spectrometry
(GC/MS)-following derivatization, as described e.g. by Gray,
1990.
[0293] Finally, in order to observe the peptide containing the Asn
80 potential glycosylation site, the tryptic peptides were digested
with peptide N-glycosidase F and purified by Sep.-pak. The propanol
fractions (20%-40%) of the Sep.-pak were sub-digested with
chymotrypsin and analysed by FAB/MS.
[0294] Results
[0295] MALDI and FAB-MS of the Permethylated Carbohydrates
[0296] The study was conducted on protein from interferon beta
obtained by the new process. A representative MALDI spectrum is
presented in FIG. 6. The corresponding list of m/z signals observed
in the permethylated spectra (MALDI-MS and FAB-MS) is presented in
Table 3.
[0297] The results of all the batches indicated the presence of a
predominant disialylated biantennary structure having the
composition of NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc, and a
monosialyl biantennary structure having the composition of
NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc. Non-fucosylated glycans were not
observed.
[0298] Minor signals possibly corresponding to the following
oligosaccharide structures were also observed in all batches:
[0299] Non sialylated biantennary structure
(Hex.sub.5.HexNAc.sub.4.Fuc) [0300] Disialylated triantennary
structure or disialylated biantennary with N-acetyl lactosamine
repeat structures (NeuAc2.Hex6.HexNAc5.Fuc) [0301] Trisialylated
triantennary structure (NeuAc.sub.3.Hex6.HexNAc.sub.5.Fuc) [0302]
Trisialylated triantennary structure with N-acetyl lactosamine
repeat structures or trisialylated tetrantennary
(NeuAc.sub.3.Hex.sub.7.HexNAc.sub.6.Fuc) [0303] Mono sialylated and
disialylated biantennary structure with two fucose units
(NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2,NeuAc.sub.2.Hex.sub.5.HexNAc.sub.-
4.Fuc.sub.2) [0304] Minor amounts of trifucosylated structures
(NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3) were also observed
in the batches derived from the interferon beta obtained by the
process according to the invention, but were absent in reference
IFN-.beta.-1a [0305] Minor amount of N-glycolylneuraminic acid as
part of the sialic acids of the glycans.
[0306] The relative abundance of N-glycolylneuraminic acid was
calculated from the peak heights of signals in the permethylated
N-linked glycan FAB and MALDI-TOF data.
[0307] As expected the IFN-.beta.-1a glycoforms contain mainly
N-Acetylneuraminic acid like most human glycoproteins.
[0308] Nanospray MS/MS
[0309] In order to further confirm the structures of the trace
amounts of N-linked multi-fucosylated oligosaccharide structures,
MS/MS analysis was carried out on the permethylated
oligosaccharides of signals at m/z 919, 1040 and 1098 which are
consistent with the triply charged ions ([M+3H].sup.3+) for
NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2,
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2 and
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3 respectively. The A
type ions observed in the MS/MS spectrum confirmed the following
structure attributions:
TABLE-US-00008 TABLE 2 MS IFN Beta Signal from new (m/z) process
Attribution by MS/MS 919 Not
NeuAc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.2 observed*
1040 +
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.2 1098
+ NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.3 *A
corresponding signal was however observed by MALDI
[0310] Linkage Analysis by GC/MS
[0311] Complex GC chromatograms were obtained for all tested
batches from interferon beta obtained by the new process with some
impurity peaks originating from the derivatizing reagents. GC
retention time comparison with a standard mixture of partially
methylated alditol acetates run under the same GC conditions
allowed provisional assignments of the sugar containing peaks.
[0312] Linkage analysis results of all samples were essentially the
same, showing the presence of 4-linked N-acetylglucosamine
(4-GlcNAc), 4,6-linked N-Acetylglucosamine (4,6-Glc-NAc),
3,6-linked Mannose (3,6-Man), 2-linked Mannose (2-Man), terminal
Galactose (t-Gal), 3-linked Galactose (3-Gal) and terminal Fucose
(t-Fuc), strongly supporting the FAB-MS data. 2,6-linked Mannose
was also observed as a minor component in all samples, indicating
the presence of some triantennary structures. The postulated major
oligosaccharides structures observed in IFN-.beta.-1a bulk samples
are presented in FIG. 5.
[0313] These data suggest that the main carbohydrate moiety is a
core fucosylated biantennary structure with one and two sialic acid
residues.
[0314] N-glycosylation Site by FAB-MS of the Chymotryptic
Digests
[0315] For all IFN-.beta.-1a batches tested a minor FAB-MS signal
was observed which was assigned to the sodiated peptide residues
80-88 (D.E.T.I.V.E.N.L.L+Na.sup.+) with Asn-80 converted to
Aspartic acid following release of the carbohydrate with peptide
N-glycosidase F. This experiment provides supporting evidence that
Asn-80 is indeed glycosylated.
[0316] FIG. 6 shows the MALDI spectrum of IFN-.beta.-1a with
permethylated glycans (list of signals in Table 3). Again, as shown
in the Table and the accompanying Figure, the IFN-.beta.-1a
obtained from the process according to the present invention
contains the trifucose structure,
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3 as previously
described.
TABLE-US-00009 TABLE 3 The list of signals in the permethylated
spectra of IFN-.beta.-1a obtained by new process following tryptic
and peptide N-glycosidase F digestion Signals m/z (G6E001) Possible
Assignment Low Mass 344.2 NeuAc.sup.+ (-methanol) 376.2 NeuAc.sup.+
406.3 NeuGc.sup.+ 432.3 Hex.cndot.HexNAc.sup.+ (-methanol) 464.3
Hex.cndot.HexNAc.sup.+ 793.5 NeuAc.cndot.Hex.cndot.HexNAc.sup.+
(-methanol) 825.5 NeuAc.cndot.Hex.cndot.HexNAc.sup.+ 855.5
NeuGc.cndot.Hex.cndot.HexNAc.sup.+ 999.5
NeuAc.cndot.Hex.cndot.HexNAc(Fuc).sup.+ High mass 2142.6 -- 2227.8
Fragment ion 2244.8 Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M +
Na].sup.+ 2387.8 Hex.sub.4.cndot.HexNAc.sub.4.cndot.Fuc.sub.3 [M +
Na].sup.+ 2417.8 Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.2 [M +
Na].sup.+ N/D NeuAc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M
+ Na].sup.+ (-Methanol) N/D
NeuAc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M + Na].sup.+
(undermethylated) 2605.8
NeuAc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M + Na].sup.+
2635.9 NeuGc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M +
Na].sup.+ 2779.9
NeuAc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.2 [M +
Na].sup.+ 2911.0
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sup.+
(A-type ion) 2952.9
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M +
Na].sup.+ (undermethylated) 2966.9
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M +
Na].sup.+ 2996.9
NeuAc.cndot.NeuGc.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc [M +
Na].sup.+ 3055.0 NeuAc.cndot.Hex.sub.6.cndot.HexNAc.sub.5.cndot.Fuc
[M + Na].sup.+ 3140.9
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.2 [M +
Na].sup.+ 3315.9
NeuAc.sub.2.cndot.Hex.sub.5.cndot.HexNAc.sub.4.cndot.Fuc.sub.3 [M +
Na].sup.+ 3416.1
NeuAc.sub.2.cndot.Hex.sub.6.cndot.HexNAc.sub.5.cndot.Fuc [M +
Na].sup.+ 3590.9
NeuAc.sub.2.cndot.Hex.sub.6.cndot.HexNAc.sub.5.cndot.Fuc.sub.2 [M +
Na].sup.+ 3779.0
NeuAc.sub.3.cndot.Hex.sub.6.cndot.HexNAc.sub.5.cndot.Fuc [M +
Na].sup.+ 3810.9
NeuAc.sub.2.cndot.NeuGc.cndot.Hex.sub.6.cndot.HexNAc.sub.5.cndot.Fu-
c [M + Na].sup.+ 3866.1
NeuAc.sub.2.cndot.Hex.sub.7.cndot.HexNAc.sub.6.cndot.Fuc [M +
Na].sup.+ 4227.9
NeuAc.sub.3.cndot.Hex.sub.7.cndot.HexNAc.sub.6.cndot.Fuc [M +
Na].sup.+
[0317] Conclusions
[0318] MALDI-MS and FAB-MS analysis of the permethylated N-glycans
of IFN-.beta.-1a bulk samples obtained by the new process showed
the following core-fucosylated carbohydrate structures
(non-fucosylated glycans were not observed):
[0319] Major Glycoforms: [0320] Monosialylated biantennary
structure (NeuAc Hex.sub.5.HexNAc.sub.4.Fuc) [0321] Disialylated
biantennary structure (NeuAc.sub.2 Hex.sub.5.HexNAc.sub.4.Fuc)
[0322] Minor Glycoforms: [0323] Non sialylated biantennary
structure (Hex.sub.5.HexNAc.sub.4.Fuc) [0324] Disialylated
triantennary structure or disialylated biantennary with N-acetyl
lactosamine repeat structures
(NeuAc.sub.2.Hex.sub.6.HexNAc.sub.5.Fuc) [0325] Trisialylated
triantennary structure (NeuAc.sub.3.Hex.sub.6.HexNAc.sub.5.Fuc)
[0326] Trisialylated triantennary with N-acetyl lactosamine repeat
structures or trisialylated tetrantennary structures
(NeuAc.sub.3.Hex.sub.7.HexNAc.sub.6.Fuc) [0327] Disialylated and
monosialylated biantennary structure with two fucose units
(NeuAc.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2, and
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2) [0328] Disialylated
biantennary structure with three fucose units
(NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3)
[0329] Nanospray MS/MS of the permethylated glycans confirmed the
detection of trace levels of
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.2 oligosaccharides in
all samples while traces of
NeuAc.sub.2.Hex.sub.5.HexNAc.sub.4.Fuc.sub.3 were observed only in
IFN-.beta.-1a from the process of the present invention.
[0330] Linkage analyses confirmed the expected monosaccharides
detected with the FAB-MS data.
[0331] Finally, in the IFN-.beta.-1a product obtained from the new
process, the detailed FAB-MS analysis of the tryptic and
chymotryptic peptides indicated the presence of N-glycan linkage at
Asn-80.
[0332] The relative abundance of N-glycolylneuraminic acid was
calculated from the peak heights of signals in the permethylated
N-linked glycan FAB and MALDI-MS data.
[0333] The N-acetylneuraminic acid:N-glycolylneuraminic acid ratio
was 31.7:1.0 in a sample and suggest that 3.1% of the sialic acid
is N-Glycolyineuraminic acid. These results are in agreement with
similar levels (5%) obtained for natural human interferon produced
by human fibroblasts. As expected the IFN-.beta.-1a glycoforms
contain mainly N-acetylneuraminic acid like most human
glycoproteins.
REFERENCES
[0334] 1. Altschul S F et al, J Mol Biol, 215, 403-410, 1990 [0335]
2. Altschul S F et al, Nucleic Acids Res., 25:389-3402, 1997 [0336]
3. Barber, M., Bordoli, R. S., Sedgwick, R. D. and Tyler A. N.
(1981) Chem. Commun., 325-327 [0337] 4. Morris, H. R., Panico, M.
and Taylor W. (1983) Biochem. Biophys. Res. Commun., 117, 299-305.
[0338] 5. Chemajovsky et al., Efficient Constitutive Production of
Human Fibroblast interferon by Hamster Cells Transformed with the
IFN-.beta. Gene Fused to an SV40 Early Promoter, DNA, vol. 3, 1984,
pp. 297-308 [0339] 6. Chomczynski, P. and Sacchi, N. Anal. Biochem.
162:156-159, 1987 [0340] 7. Clonis, Y. D., Atkinson, A., Bruton, C.
J., and Lowe, C. R. (1987). "Reactive Dyes in Protein and Enzyme
Technology." stockton Press, New York. [0341] 8. Conradt et al.,
Structure of the carbohydrate moiety of human interferon beta
secreted by a recombinant chinese hamster ovary cell line, jbc, vol
262, pp. 14600-14605, 1987. [0342] 9. Costello, C. E. (1997)
Biophys. Chem., 68, 173-188 [0343] 10. Cummings, R. D. 1999.
Structure and function of the selectin ligand PSGL-1. Braz. J. Med.
Biol. Res. 32: 519-528. [0344] 11. Dell A. and H. Morris 2001.
Glycoprotein structure determination by mass spectrometry. Science
291: 2351-2356 [0345] 12. Derynk R. et al., Nature 285, 542-547,
1980; [0346] 13. Devereux J et al, Nucleic Acids Res, 12, 387-395,
1984 [0347] 14. Domon, B. and Costello, C E (1988), Biochemistry
27, 1534-1543. [0348] 15. Fenn, J. B., Mann, M., Meng, C. K., Wong,
S. F. and Whitehouse, C. M., (1989) Science, 246, 64-70. [0349] 16.
Grantham et al., Science, Vol. 185, pp. 862-864 (1974) [0350] 17.
Graham F L and Van Der E B A J A new technique for the assay of
infectivity of human adenovirus 5 DNA. Virology 52:456-467, 1973;
Busslinger M, Moschonas N, and Flavell RA b.sup.+ Thalassemia.
Aberrant splicing results from a single point mutation in an
intron. Cell 27:289-298, 1981 [0351] 18. Gray, G. R., (1990)
Methods Enzymol. 193, 573-587. [0352] 19. Harvey D. J., (2000) J.
Mass Spectrom., 35, 1178-1190 [0353] 20. Hillenkamp, F., Karras,
M., Beavis, R. C., Chait, B. T. (1991) Anal. Chem. 63, 1193-1203.
[0354] 21. Innis M A, McCormick F. Procedures for expression,
modification, and analysis of human fibroblast interferon
(IFN-beta) genes in heterologous cells. Methods Enzymol. 1986;
119:397-403. [0355] 22. Kao, F.-T., and Puck, T. T., Genetics of
Somatic mammalian cells, VII. Induction and isolation of
nutritional mutants in chinese hamster cells Proc. Natl. Acad. Sci.
USA 60, 1275-1281, 1968 [0356] 23. Kaufman R and Sharp P.
Amplification and expression of sequences cotransfected with a
modular dihydrofolate reductase complementary DNA gene. Journal of
Molecular Biology 159:601-621, 1982 [0357] 24. Martinez G. Shaw E
M, Carillo M and Zanuy S. Protein salting-out method applied to
genomic DNA isolation from fish whole blood. Biotechniques 24(2):
238-239, 1998. [0358] 25. Mory et al. European J. Biochem. 120,
197-202 (1981) [0359] 26. Puck, J. Exp. Med. 108, 945, 1958 [0360]
27. Reiser W and Hauser H. Recombinant human interferon beta from
mammalian cell lines. Arzneimittelforschung/Drug Research 37 (I),
4, 482-485 (1987) [0361] 28. Runkel et al., Structural and
Functional Differences Between Glycosylated and Non-glycosylated
Forms of Human interferon beta (IFN-beta), Pharm. Res., vol 15,
1998, pp. 641-9. [0362] 29. Sambrook, J., Fritsch, E. F., Molecular
Cloning: A laboratory manual. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y., 1989 [0363] 30. Smith and Waterman J Mol
Biol, 147, 195-197, 1981, Advances in Applied Mathematics, 2,
482-489, 1981. [0364] 31. Tarentino, A. L., Gomez, C. M., and
Plummer, T. H. Jr (1985) Biochemistry, 24, 4665-4671. [0365] 32.
Urlaub G and Chasin L A Isolation of chinese hamster cell mutants
deficient in dihydrofolate reductase activity. Proc Natl Acad Sci
USA 77(7):4216-4220, 1980). [0366] 33. Wilm, M., Mann, M (1996),
Anal. Chem. 68, 1-8. [0367] 34. Youcefi et al., Am J Clin Pathol.
1985 June; 83(6):735-40
Sequence CWU 1
1
4120DNAArtificial sequencePrimer 1cctcggcctc tgagctattc
20220DNAartificial sequenceprimer 2cacaaataaa gcattttttt
20322DNAartificial sequenceprimer 3atgaccaaca agtgtctcct cc
22422DNAartificial sequenceprimer 4acttacaggt tacctccgaa ac 22
* * * * *
References