U.S. patent application number 11/836770 was filed with the patent office on 2008-09-04 for parallel methods for insertional mutagenesis.
Invention is credited to Michael Paul Strathmann.
Application Number | 20080214403 11/836770 |
Document ID | / |
Family ID | 26803092 |
Filed Date | 2008-09-04 |
United States Patent
Application |
20080214403 |
Kind Code |
A1 |
Strathmann; Michael Paul |
September 4, 2008 |
Parallel Methods For Insertional Mutagenesis
Abstract
The present invention provides parallel methods for identifying
the locations of insertion elements that are distributed at
different sites in the genome among a collection of cells.
Inventors: |
Strathmann; Michael Paul;
(Seattle, WA) |
Correspondence
Address: |
MICHAEL STRATHMANN
1205 8TH AVE W
SEATTLE
WA
98119
US
|
Family ID: |
26803092 |
Appl. No.: |
11/836770 |
Filed: |
August 9, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10209676 |
Jul 30, 2002 |
7272507 |
|
|
11836770 |
|
|
|
|
09427834 |
Oct 26, 1999 |
6480791 |
|
|
10209676 |
|
|
|
|
60105914 |
Oct 28, 1998 |
|
|
|
Current U.S.
Class: |
506/3 |
Current CPC
Class: |
C12Q 1/6869 20130101;
C12Q 1/6869 20130101; C12Q 2531/113 20130101; C12Q 2537/143
20130101; C12Q 1/6876 20130101; C12N 15/1082 20130101 |
Class at
Publication: |
506/3 |
International
Class: |
C40B 20/02 20060101
C40B020/02 |
Claims
1. A parallel method for producing cells containing located
insertion elements, comprising; a) producing cells comprising
insertion elements integrated into a plurality of locations; b)
preparing a library of polynucleotide clones comprising
sample-tagged junctions from the insertion elements; c) carrying
out a mapping reaction on the library to generate tagged reaction
products; and d) identifying the locations of the insertion
elements by associating the reaction products with an array of tag
complements to deconvolute maps of the junctions.
2. The method of claim 1, wherein the library comprises a pool of
the polynucleotide clones.
3. The method of claim 1, wherein the insertion elements comprise
sample tags.
4. The method of claim 1, wherein the sample-tagged junctions
comprise genomic tags.
5. The method of claim 1, wherein the sample-tagged junctions
comprise adapter tags.
6. The method of claim 1, further comprising maintaining separate
clonal populations of cells wherein each clonal population
comprises a subset of the insertion elements, and identifying the
subset in each clonal population.
7. The method of claim 6, wherein the cells comprise the
sample-tagged junctions and the step of identifying the subset
comprises pooling the clonal populations to generate a plurality of
subpools, amplifying polynucleotides from each subpool to generate
tagged amplicons, and hybridizing the amplicons to an array of the
tag complements.
8. The method of claim 6, wherein the locations comprise sequences
from the junctions, and the step of identifying the subset
comprises pooling the clonal populations to generate a plurality of
subpools; amplifying polynucleotides from each subpool to generate
amplicons comprising the junctions; and hybridizing the amplicons
to an array comprising polynucleotides that are complementary to
the junction sequences.
9. The method of claim 1, further comprising before step (c)
hybridizing the clones to the tag complements to generate an array
comprising tagged clones.
10. The method of claim 9, wherein the mapping reaction is an array
sequencing reaction.
11. The method of claim 1, wherein the step of associating (d)
comprises hybridizing the tagged reaction products to tag
complements.
12. The method of claim 11, further comprising separating the
tagged reaction products by size and collecting fractions of the
separated products before the hybridization step.
13. The method of claim 1, wherein the mapping reaction comprises a
sequencing method.
14. A parallel method for producing cells containing located
insertion elements, comprising; a) producing a collection of cells
comprising insertion elements integrated into a plurality of
locations; b) preparing a pool of polynucleotides comprising a
plurality of junctions from the insertion elements; and d)
identifying sequences from the junctions by sequencing the
polynucleotides in parallel to locate the insertion elements.
15. The method of claim 14, wherein the polynucleotides comprise
sample tags.
16. The method of claim 14, wherein the junctions comprise sample
tags and the sequences from the junctions comprise sequences from
the sample tags.
17. The method of claim 16, wherein the sample tags are adapter
tags.
18. The method of claim 16, wherein the sample tags are genomic
tags.
19. The method of claim 16, wherein the collection of cells
comprises a plurality of separate, clonal populations of cells, and
further comprising identifying at least one clonal population that
contains at least one of the located insertion elements by
associating at least one of the sample tags with the clonal
population.
20. The method of claim 19, wherein the step of associating
comprises amplifying the sample tags to produce tagged amplicons,
and hybridizing the amplicons to an array comprising tag
complements.
Description
1. RELATED APPLICATION DATA
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/209,676, filed Jul. 30, 2002, which is a
continuation-in-part of application Ser. No. 09/427,834 filed Oct.
26, 1999, now issued as U.S. Pat. No. 6,480,791, which claims
benefit of U.S. Provisional Patent Application Ser. No. 60/105,914,
filed Oct. 28, 1998.
2. FIELD OF THE INVENTION
[0002] The present invention is related to the field of molecular
biology, and provides parallel methods for nucleic acid sequencing,
physical mapping and mapping insertion elements.
3. BACKGROUND
[0003] There are two methods in common use to sequence DNA: the
chemical degradation method, e.g., Maxam et al., (1977) and the
chain-termination method, e.g., Sanger et al., (1977). Efforts to
improve DNA sequencing efficiency have resulted in numerous
improvements in the chain-termination method. Automation of many
steps in the process has produced significant improvements in
sequencing throughput. Nevertheless, each template still is
sequenced one at a time.
[0004] Attempts have been made to introduce some parallel
processing steps into the sequencing method. For example Church
(1990) and Church et al. (1992) teach a strategy in which multiple
templates are fragmented in a single tube by either the
chain-termination or chemical-degradation sequencing methods. The
fragments are separated on a gel and transferred to a solid
membrane. Each template carries a unique tag and the fragments are
visualized by hybridization with a unique oligonucleotide probe
specific to each tag. The pattern of the fragments that hybridize
to one specific oligonucleotide probe represent the sequence
information from one template. Removal of the first oligonucleotide
probe followed by hybridization of a second oligonucleotide probe
reveals the sequence pattern from a different template. This method
is limited by the requirement to maintain the pattern of fragments
in order to extract the sequence information. Therefore, only one
sequence can be read at a time; that is, this step in the method is
sequential rather than parallel. There are inherent time
constraints produced by this sequential step. In addition, the
number of times any membrane can be "stripped" and reprobed is
limited. For these reasons, the application of the method is
limited in practice to collections of fewer than 50 templates.
[0005] Other methods are described in the art which attempt to
introduce parallelism into different stages of the sequencing
protocol. Van Ness et al. (1997) describe the use of mass tags that
can be detected by mass spectrometry. Different tags are attached
to the 5'-end of a sequencing primer. Each tagged primer is used to
sequence a different template by the chain-termination method. The
different reactions are pooled and fractionated by size (i.e.
sequencing products are collected from the end of a capillary
electrophoresis device). The tags present in each fraction are
assayed by mass spectrometry. This information is deconvoluted to
reproduce the "sequence ladders" of the different templates. The
method is limited by the number of different tags that can be
synthesized. More importantly, the method is not parallel until the
sequencing reactions are pooled.
[0006] A variation of the Van Ness method is described by Wong
(1999). He replaces the chemical tags attached to the 5'-end of a
primer with nucleic acid tags. Again, individual sequencing
reactions are pooled and fractionated by size. Instead of detection
by mass spectrometry, the tags in each fraction are designed to be
amplified and labeled in vitro (i.e. PCR) followed by hybridization
to an array of oligonucleotides. Individual locations in the array
will hybridize to different tags. A positive hybridization signal
indicates the tag is present in the fraction. This information is
deconvoluted to reveal the sequence ladders of the different
templates. The possible number of different tags attached to the
sequencing primer is far greater with Wong's method than the Van
Ness method. However, Wong still describes a method that is not
parallel until the sequencing reactions are pooled. Consequently,
much of the labor associated with traditional sequencing protocols
still is present in Wong's method. DNA must be prepared from
individual clones, and separate sequencing reactions must be
performed on each template. In a second embodiment, Wong attempts
to introduce some parallelism into these steps. He attaches the
tags to several different sequencing primers. The different primers
hybridize to different vectors. Instead of sequencing one clone at
a time, he makes separate libraries in each vector, pools one clone
from each library and sequences them with the pooled primers. The
sequencing products from different pools are then combined and
fractionated by size. Each clone still requires its own uniquely
tagged primer, but fewer sequencing reactions are needed. In
theory, this same strategy can be applied to the Van Ness mass-tag
method, as described by Schmidt et al. (1999). Presumably, the
strategy will work for very small pools of primers, but as the
collection of primers and vectors increases, mispriming events and
failed sequences will predominate. In addition, single clones still
are handled one at a time so considerable resources must be
dedicated simply to producing, cataloging and storing the
sequencing templates.
[0007] Rabani (1996 and 1997) describes a sequencing method that
employs the same tagged sequencing vectors used by Church (1990). A
pool of templates with substantially different tags is sequenced
with one primer as described in the Church patent. A label is
incorporated into either the primer or the chain-terminator. The
sequencing products are fractionated by size and immediately
hybridized to an array of oligonucleotides (analogous to the array
in Wong's method). Detection of the label at a particular location
in the array indicates the presence of that tag in the fraction.
The sequence ladders are deconvoluted as above. Though parallel at
each step, in practice only a small number of samples can be
pooled. A small amount of labeled material is available in each
fraction for hybridization to the array. This material will
determine the rate of hybridization and limits of detection. A very
sensitive oligonucleotide array can detect about 0.1 femtomoles of
a complementary polynucleotide, see Lockhart et al. (1996).
Assuming each tag is present in about 1000 bands of a sequencing
ladder, then at least 0.1 picomoles of any tagged clone must be
present in the pool before sequencing. A typical sequencing
reaction uses about 0.5 picomoles DNA. This calculation suggests a
starting pool of about five clones may be sequenced according to
Rabani's method.
[0008] Thus, there is a need in the art for a highly parallel
sequencing method that is not limited by any sequential
"bottlenecks" described above. The sequencing method would result
in significant improvements in sequencing throughput and
substantial reductions in the cost of sequencing.
[0009] To sequence very large genomes, the DNA first must be broken
down into smaller, more manageable clones. The determination of the
overlap relationships of these smaller clones is needed to simplify
the reconstruction of the entire sequence. The method most
frequently used is "Sequence Tagged Site" (STS) content mapping.
This method involves finding many small regions of single copy DNA
(i.e., STS's) and determining which clones contain the same STS's.
Two clones that contain the same STS must overlap. Detection of the
STS is achieved by amplifying pools of clones with the polymerase
chain reaction. This mapping process is very expensive and time
consuming.
[0010] Ultimately, the physical mapping and sequencing of organisms
is designed to hasten the discovery of gene function. A general
step in this process is to observe the phenotype of the null
mutant. Through "reverse genetics" it is possible to "knockout" the
function of a cloned gene to produce the null phenotype. Usually,
gene knockouts are produced one at a time at great expense by
introducing foreign DNA into the gene. Even efforts to apply
reverse genetics to many cloned genes simply scale up the serial
one-by-one approach.
[0011] For these reasons, there is a need in the art for a method
that introduces massive parallelism into the processes of
sequencing, physical mapping and the production of gene knockouts.
The present invention provides these and other advantages, as
described in greater detail below.
4. BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1a is a drawing of a preferred embodiment of a sample
tag joined to a sample polynucleotide.
[0013] FIG. 1b is a drawing of a preferred embodiment of sequencing
primers and amplification primers for preparing and analyzing
sequencing reaction products that are pooled prior to
fractionation.
[0014] FIG. 2 is a drawing of a preferred embodiment of an
insertion element comprising a sample tag and a preferred
embodiment of a method to rescue junctions.
[0015] FIG. 3 is a preferred embodiment of a vector for sequencing
or constructing physical maps from both ends of a sample
polynucleotide.
[0016] FIG. 4 is a flow chart of a preferred method for
sequencing.
[0017] FIG. 5 is a flow chart of a preferred method for
constructing physical maps.
[0018] FIG. 6 is a flow chart of a preferred method for producing
cells containing located insertion elements.
[0019] FIG. 7a is a photograph of an autoradiogram of multiplexed
sequencing reactions separated on a denaturing polyacrylamide
gel.
[0020] FIG. 7b is a photograph of an autoradiogram that served as a
template for fractionating multiplexed sequencing reactions.
[0021] FIG. 8 are the readout from a multiplex sequencing
experiment.
5. SUMMARY
[0022] It is an object of the invention to provide massively
parallel methods for generating nucleic acid sequence information
from a collection of polynucleotides. More specifically, the method
employs Sanger or Maxam and Gilbert nucleic acid sequencing
reactions carried out on a collection of sample polynucleotides
cloned into sample-tagged vectors so that a sample tag preferably
is joined to one sample polynucleotide. The sample tags are used to
deconvolute the sequence information derived from the different
sample polynucleotides. Deconvolution is achieved through
hybridization of size-separated products from the sequencing
reaction to an array of tag complements.
[0023] It is another object of the invention to provide a kit for
carrying out the disclosed massively parallel sequencing methods.
The kit preferably contains a library of sample-tagged cloning
vectors in which the target nucleic acid whose sequence is sought
may be cloned, enzymes for cloning the target into the cloning
vectors, reagents for carrying out the sequencing reactions,
reagents for amplifying the sample tags, an array of tag
complements, and instructions for carrying out the method.
[0024] It is a further object of the invention to provide methods
and kits for carrying out the disclosed methods of physical mapping
and generating gene knockouts. These methods and kits are based
upon the reagents and principles analogous to those used for the
massively parallel sequencing methods, as described below.
6. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
6.1 DEFINITIONS
[0025] A "sequence element" or "element" as used herein in
reference to a polynucleotide is a number of contiguous bases or
base pairs in the polynucleotide, up to and including the complete
polynucleotide. When referring to a sequence element with a
particular property, the sequence element consists of the bases or
base pairs that contribute to the property or are defined by the
property.
[0026] The term "sample" as used herein refers to a polynucleotide
or that element of a polynucleotide which will be analyzed for some
property according to the method of this invention. For example, a
sample polynucleotide may be joined to other sequence elements to
form a larger polynucleotide in order to practice the invention.
The element of the larger polynucleotide that is homologous to the
sample polynucleotide is the "sample element" or "sample sequence
element".
[0027] A "sample tag" refers to a sequence element used to identify
or distinguish different sample polynucleotides, sequence elements
or clones present as members of a collection. In general, an
individual sample tag is joined to an individual polynucleotide
resulting in a collection of "sample-tagged" polynucleotides
comprising distinct sample tags. A sample-tagged polynucleotide may
comprise one or more distinct sample tags, which are used to
distinguish different segments of the polynucleotide. For example,
sample tags may be present at the 5' and 3' ends of the
polynucleotide, or different tags may be distributed at multiple
sites in the polynucleotide. The same sample polynucleotide may be
associated with more than one sample tag, but to be informative,
one sample tag must be associated with only one sample
polynucleotide in a collection. It is these informative
associations that constitute sample-tagged clones. Methods for
designing sample tags are well known in the art as exemplified by,
e.g., Brenner (1997b). In some embodiments of the invention, the
sample tags may comprise individual synthetic oligonucleotides each
of which has been ligated into a vector, to provide a library or
collection of vectors with distinct sample tags or the
oligonucleotides are ligated directly to the polynucleotides to be
analyzed. In other embodiments, the sample tag may comprise part of
the sample sequence element.
[0028] "Tagged" as used herein in reference to a polynucleotide
means the polynucleotide is derived in one or more steps from a
sample-tagged polynucleotide by for example enzymatic, chemical or
mechanical means, and the polynucleotide comprises a tag. The "tag"
is a sequence element that corresponds to a sample tag and can be
used to identify or distinguish the sample tag. Note a sequence
element is itself a tag if it is derived from a tag and can be used
to identify or distinguish the tag. In many embodiments, the tag
and the sample tag are identical. In certain embodiments, the tag
comprises the sample tag but contains additional sequence elements.
The additional sequence elements may be necessary for example to
permit increased hybridization temperatures or to impose structural
constraints on the tag. In other embodiments, the sample tag
comprises the tag but contains additional sequence elements. For
example, two different sample tags that share the same tag may be
distinguished by preferential PCR amplification of the tag with
primers that are specific to only one tag. Subsequent removal of
the priming sequences produces identical tags that can be used to
distinguish the different sample tags. During amplification or
another step in the invention, the tag could lose all sequence
identity with the sample tag. Nevertheless, as long as there exists
an identifiable correspondence between the two, information
associated with the tag can be related to the sample tag which in
turn can be related to the sample polynucleotide. The number of
distinct tags required to characterize a collection of
sample-tagged polynucleotides will vary. In some embodiments, a
one-to-one relationship exists between the tag and the sample tag.
In other embodiments, the tags will identify information in
addition to the sample identity, for example the terminating
nucleotide, the restriction site, etc. Consequently, more distinct
tags than distinct sample tags may be used. Finally as outlined
above, the same tag may be used to identify more than one sample
tag.
[0029] A "tag complement" as used herein refers to a molecule that
will substantially hybridize to only one tag, or a set of
distinguishable tags, among a collection of tags under the
appropriate conditions. Different tags that hybridize to the same
tag complement may be distinguished for example by different
fluorophores, by their ability to hybridize to a second
oligonucleotide, etc. Some degree of cross-hybridization by
otherwise distinguishable tags can be tolerated, provided the
signal arising from hybridization between a tag A and its tag
complement A' is discernable from the cross-hybridization signal
arising from hybridization between a different tag B and the tag
complement A'. In embodiments where the tag complement is a
polynucleotide or sequence element, preferably the tag is perfectly
matched to the tag complement. In embodiments where specific
hybridization results in a triplex, the tag may be selected to be
either double stranded or single stranded. Thus, where triplexes
are formed, the term "complement" is meant to encompass either a
double stranded complement of a single stranded tag or a single
stranded complement of a double stranded tag. Tag complements need
not be polynucleotides. For example, RNA and single-stranded DNA
are known to adopt sequence dependent conformations and will
specifically bind to polypeptides and other molecules (Gold et al.,
1993 & 1995).
[0030] The terms "oligonucleotide" or "polynucleotide" as used
herein include linear oligomers of natural or modified monomers or
linkages, including deoxyribonucleosides, ribonucleosides,
1-anomeric forms thereof, peptide nucleic acids (PNAs), and the
like, capable of specifically binding under the appropriate
conditions to a target polynucleotide by way of a regular pattern
of monomer-to-monomer interactions, such as Watson-Crick type of
base pairing, base stacking, Hoogsteen or reverse Hoogsteen types
of base pairing, or the like. Usually monomers are linked by
phosphodiester bonds or analogs thereof to form "oligonucleotides"
ranging in size from a few monomeric units, e.g., 3-4, to several
tens of monomeric units, and "polynucleotides" are larger. However
the usage of the terms "oligonucleotides" and "polynucleotides" in
the art overlaps and varies. The terms are used interchangeably
herein. Whenever a polynucleotide is represented by a sequence of
letters, such as "ATGCCTG," it will be understood that the
nucleotides are in 5'.fwdarw.3' order from left to right and that
"A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, unless otherwise noted.
Analogs of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoranilidate, phosphoramidate, and the
like. It is clear to those skilled in the art when polynucleotides
having natural or non-natural nucleotides may be employed.
Polynucleotides or oligonucleotides can be single-stranded or
double-stranded.
[0031] As used herein, the term "polypeptide" is intended to
include compounds composed of amino acid residues linked by amide
bonds. Although "protein" is often used in reference to relatively
large polypeptides, and "peptide" is often used in reference to
small polypeptides, usage of these terms in the art overlaps and
varies. The term "polypeptide" as used herein thus refers
interchangeably to peptides, polypeptides and proteins, unless
otherwise noted or clear from the context. The term "polypeptide"
is further intended to encompass polypeptide analogues, polypeptide
derivatives and peptidomimetics that mimic the chemical structure
of a polypeptide composed of naturally-occurring amino acids. Thus
a "polypeptide" encoded in a polynucleotide is meant to include the
polypeptide determined by the genetic code and these synthetic
mimics. Examples of polypeptide analogues include polypeptides
comprising one or more non-natural amino acids. Examples of
polypeptide derivatives include polypeptides in which an amino acid
side chain, the polypeptide backbone, or the amino- or
carboxy-terminus has been derivatized (e.g., peptidic compounds
with methylated amide linkages). Examples of peptidomimetics
include peptidic compounds in which the polypeptide backbone is
substituted with one or more benzodiazepine molecules (see e.g.,
James, et al., 1993), "inverso" polypeptides in which all L-amino
acids are substituted with the corresponding D-amino acids,
"retro-inverso" polypeptides (see e.g., Sisto et al., 1985) in
which the sequence of amino acids is reversed ("retro") and all
L-amino acids are replaced with D-amino acids ("inverso") and other
isosteres, such as polypeptide back-bone (i.e., amide bond)
mimetics, including modifications of the amide nitrogen, the
.alpha.-carbon, amide carbonyl, complete replacement of the amide
bond, extensions, deletions or backbone crosslinks. Several peptide
backbone modifications are known, including .psi.[CH.sub.2S].psi.,
.psi.[CH.sub.2NH], .psi.[CSNH.sub.2], .psi.[NHCO],
.psi.[COCH.sub.2], and .psi.[(E) or (Z) CH.dbd.CH]. In the
nomenclature used above, .psi. indicates the absence of an amide
bond. The structure that replaces the amide group is specified
within the brackets. Other possible modifications include an
N-alkyl (or aryl) substitution (.psi.[CONR]), backbone crosslinking
to construct lactams and other cyclic structures, and other
derivatives including C-terminal hydroxymethyl derivatives,
O-modified derivatives and N-terminally modified derivatives
including substituted amides such as alkylamides and
hydrazides.
[0032] "Perfectly matched" or "perfectly complementary" in
reference to a duplex means that the poly- or oligonucleotide
strands making up the duplex form a double stranded structure with
one another such that every nucleotide in each strand undergoes
Watson-Crick base pairing with a nucleotide in the other strand.
The term also comprehends the pairing of nucleoside analogs, such
as deoxyinosine, nucleosides with 2-aminopurine bases, and the
like, that may be employed. In reference to a triplex, the term
means that the triplex consists of a perfectly matched duplex and a
third strand in which every nucleotide undergoes Hoogsteen or
reverse Hoogsteen association with a base pair of the perfectly
matched duplex. Conversely, a "mismatch" in a duplex between a tag
and an oligonucleotide means that a pair or triplet of nucleotides
in the duplex or triplex fails to undergo Watson-Crick and/or
Hoogsteen and/or reverse Hoogsteen bonding.
[0033] As used herein, "nucleoside" and "nucleotide" include the
natural nucleosides and nucleotides, including 2'-deoxy and
2'-hydroxyl forms, e.g., as described in Kornberg et al. (1992).
"Natural nucleotide" as used herein refers to the four common
natural deoxynucleotides A, C, G, and T. "Analogs" in reference to
nucleosides includes synthetic nucleosides having modified base
moieties and/or modified sugar moieties, e.g., described by Scheit
(1980); Uhlman et al. (1990), or the like, with the only proviso
that they are capable of specific hybridization. Such analogs
include synthetic nucleosides designed to enhance binding
properties, reduce complexity of probes, increase specificity, and
the like.
[0034] As used herein, "nucleic acid sequencing reaction" refers to
a reaction that carried out on a polynucleotide clone will produce
a collection of polynucleotides of differing chain length from
which the sequence of the original nucleic acid can be determined.
The term encompasses, e.g., methods commonly referred to as "Sanger
Sequencing," which uses dideoxy chain terminators to produce the
collection of polynucleotides of differing length and variants such
as "Thermal Cycle Sequencing", "Solid Phase Sequencing,"
exonuclease methods, and methods that use chemical cleavage to
produce the collection of polynucleotides of differing length, such
as Maxam-Gilbert and phosphothioate sequencing. These methods are
well known in the art and are described in, e.g., Ausubel, et al.
(1997); Gish et al. (1988); Sorge et al. (1989); Li et al. (1993);
Porter et al. (1997). The term also includes methods based on
termination of RNA polymerase (Axelrod et al., 1978).
[0035] A "sequencing method" is a broad term that encompasses any
reaction carried out on a polynucleotide to determine some sequence
from the polynucleotide. The term encompasses nucleic acid
sequencing reactions, sequencing by hybridization (Southern, 1997;
Drmanac et al., 1993; Khrapko et al., 1996; Fodor et al., 1999),
step-wise sequencing (e.g. Cheeseman, 1994; Rosenthal, 1993;
Brenner, 1998a), etc.
[0036] A "sequence ladder" refers to a pattern of fragments from
one clone resulting from the size separation and visualization of
reaction products produced by a "nucleic acid sequencing reaction."
Typically, size separation is accomplished by denaturing gel
electrophoresis. The nucleic acid sequence is ascertained by
interpreting the "sequence ladder" to determine the identity of the
3' terminal nucleotides of reaction products that differ in length
by one nucleotide. Generating and interpreting "sequence ladders"
is well within the skill in the art, and is described in, e.g.,
Ausubel et al. (1997). A "band" in a sequence ladder refers to the
clonal population of reaction products that terminate at the same
base and so migrate together through the separation medium. A band
will have width due to dispersion and diffusion, so it is possible
to speak of a part or portion of a band, which means a collection
of the clonal population that has migrated more closely together
than some other collection.
[0037] A "primer" is a molecule that binds to a polynucleotide and
enables a polymerase to begin synthesis of the daughter strand. For
example, a primer can be a short oligonucleotide, a tRNA e.g. Panet
et al., 1975) or a polypeptide (e.g. Guggenheimer et al., 1984). A
"primer binding site" is the sequence element to which the primer
binds.
[0038] A "sequencing primer" is an oligonucleotide that is
hybridized to a polynucleotide clone to prime a nucleic acid
sequencing reaction. The sequencing primer is prepared separately,
usually on a DNA synthesizer and then combined with the
polynucleotide. A "sequencing primer binding site" is the sequence
element to which the sequencing primer hybridizes. The sequencing
primer binding sites in two different polynucleotides are
considered to be the same when the same sequencing primer will
efficiently prime the nucleic acid sequencing reaction for both
polynucleotides. Of course, mispriming frequently occurs during
sequencing reactions, but these artifactual priming sites are minor
components of the sequencing reaction products. One skilled in the
art will readily understand the difference between mispriming and
efficient priming at the sequencing primer binding site.
[0039] "Deconvoluting" means separating data derived from a
plurality of different polynucleotides into component parts,
wherein each component represents data derived from one of the
polynucleotides comprising the plurality.
[0040] An "array" refers to a solid support that provides a
plurality of spatially addressable locations, referred to herein as
features, at which molecules may be bound. The number of different
kinds of molecules bound at one feature is small relative to the
total number of different kinds of molecules in the array. In many
embodiments, only one kind of molecule e.g. oligonucleotide) is
bound at each feature. Similarly, "to array" a collection of
molecules means to form an array of the molecules.
[0041] "Spatially addressable" means that the location of a
molecule bound to the array can be recorded and tracked throughout
any of the procedures carried out according to the method of the
invention.
[0042] A "particulate array" is an array wherein the solid support
comprises particles. A particle may comprise one or more features.
The particles may be fixed relative to one another or their
relative positions may vary with time (e.g. particles in solution).
A particle may possess a detectable property (e.g., a transponder)
in which case the spatial address of a molecule bound to the array
may be determined for example by passing the particle through a
detector that identifies both the particle and the molecule (see
for example Mandecki (1997) and Mandecki (2002)).
[0043] A "contig" means a group of clones that represent
overlapping regions of a genome.
[0044] A "contig map" means a map depicting the relative order of a
linked library of small overlapping clones representing a complete
chromosomal segment.
[0045] A "library" refers to a collection of polynucleotides. A
particular library might include, for example, clones of all of the
DNA sequences expressed in a certain kind of cell, or in a certain
organ of the body, or a collection of man-made polynucleotides, or
a collection of polynucleotides comprising combinations of
naturally-occurring and man-made sequences. Polynucleotides in the
library may be spatially separated, for example one clone per well
of a microtiter plate, or the library may comprise a pool of
polynucleotides or clones. When a reaction is performed on a
spatially separated library, the same reaction by definition must
be performed separately on every member of the library. When a
reaction is performed on a pooled library, the reaction need only
be performed once.
[0046] "Physical mapping" broadly refers to determining the
locations of two or more landmarks in a polynucleotide segment. The
term is meant to distinguish genetic mapping methods, which rely on
a determination of recombination frequencies to estimate distance
between two or more landmarks, from the methods of the present
invention, which determine the actual linear distance between
landmarks. Similarly, a "physical map" is the product of physical
mapping.
[0047] "Landmark" broadly refers to any distinguishable feature in
a polynucleotide other than an unmodified nucleotide. Landmarks
include, by way of example, restriction sites, single nucleotide
polymorphisms, short sequence elements recognized by nucleic acid
binding molecules, DNase hypersensitive sites, methylation sites,
transposon, etc. This definition is meant to distinguish physical
mapping from "sequencing", which refers to determining the linear
order of nucleotides in a polynucleotide.
[0048] "Fingerprinting" refers to the use of physical mapping data
to determine which nucleic acid fragments have a specific sequence
(fingerprint) in common and therefore overlap.
[0049] "Cloning" as used herein in reference to a polynucleotide
refers to any method used to replicate a polynucleotide segment.
The term encompasses cloning in vivo, which makes use of a cloning
vector to carry inserts of the polynucleotide segment of interest,
and what I refer to as cloning in vitro in which one or both
strands of a polynucleotide segment of interest is replicated
without the use of a vector. Cloning in vitro encompasses, for
example, replication of a polynucleotide segment using PCR, linear
amplification using a primer that recognizes a portion of the
polynucleotide segment in conjunction with an enzyme capable of
replicating the polynucleotide, in-vitro transcription, rolling
circle replication, etc. Similarly, a "clone" in reference to a
polynucleotide means a polynucleotide that has been replicated to
produce a population of polynucleotides or sequence elements that
share identical or substantially identical sequence. Substantial
identity encompasses variations in the sequence of a polynucleotide
that sometimes are introduced during PCR or other replication
methods. This notion of substantial identity is well understood by
those skilled in the art and it applies whenever the identity of
polynucleotides is at issue.
[0050] "Hybridization" as used herein refers to a sequence
dependent binding interaction between at least one strand of a
polynucleotide and another molecule. From the context, it is
obvious to one skilled in the art whether a double-stranded
polynucleotide must be denatured before the binding event. For
example, the term includes Watson-Crick type base pairing,
Hoogsteen and reverse Hoogsteen bonding, binding of an aptamer to
its cognate molecule, etc. "Cross-hybridization" occurs when two
distinct polynucleotides can bind to the same molecule or two
distinct molecules can bind to the same polynucleotide. In general,
cross-hybridization depends on the collection of polynucleotides
(or molecules) since two polynucleotides (or molecules) cannot
cross-hybridize if they are not in the same collection.
Hybridization and cross-hybridization also may be used in reference
to sequence elements. For example, two distinct polynucleotides may
contain identical sample tags. The polynucleotides cross-hybridize
to the tag complement whereas the tags, being identical, do not
cross hybridize.
[0051] A "common sequence" or "common sequence element" refers to a
sequence or sequence element that is or is intended to be present
in every member of a collection of polynucleotides.
[0052] The term "distinct" as used herein in reference to
polynucleotides or sequence elements means that the sequences of
the polynucleotides or sequence elements are not identical,
[0053] A "pool" is a group of different molecules or objects that
is combined together so that they are not isolated from one another
and any operation performed on one member of the pool is by
necessity performed on many members of the pool. For example, a
pool of polynucleotides in solution is simply a plurality of
different polynucleotides or clones mixed together in one solution;
or each clone may be attached to a solid support, for example an
array or a bead, in which case the pool consists of the clones
combined together in one solution (e.g. the same fluid container).
Similarly, "to pool" means to form a pool.
[0054] An "aliquot" is a subdivision of a sample such that the
composition of the aliquot is essentially identical to the
composition of the sample.
[0055] The term "to derive" as used herein in reference to
polynucleotides means to generate one polynucleotide from another
by any process, for example enzymatic, chemical or mechanical. The
generated polynucleotide is "derived" from the other
polynucleotide.
[0056] The term "amplify" in reference to a polynucleotide means to
use any method to produce multiple copies of a polynucleotide
segment, called the "amplicon", by replicating a sequence element
from the polynucleotide or by deriving a second polynucleotide from
the first polynucleotide and replicating a sequence element from
the second polynucleotide. The copies of the amplicon may exist as
separate polynucleotides or one polynucleotide may comprise several
copies of the amplicon. A polynucleotide may be amplified by, for
example a polymerase chain reaction, in vitro transcription,
rolling-circle replication, in vivo replication, etc. Frequently,
the term "amplify" is used in reference to a sequence element in
the amplicon. For example, one may refer to amplifying the tag in a
polynucleotide by which is meant amplifying the polynucleotide to
produce an amplicon comprising the tag sequence element. The
precise usage of amplify is clear from the context to one skilled
in the art.
[0057] The term "cleave" as used herein in reference to a
polynucleotide means to perform a process that produces a smaller
fragment of the polynucleotide. If the polynucleotide is
double-stranded, only one of the strands may contribute to the
smaller fragment. For example, physical shearing, endonucleases,
exonucleases, polymerases, recombinases, topoisomerases, etc. will
cleave a polynucleotide under the appropriate conditions. A
"cleavage reaction" is the process by which a polynucleotide is
cleaved.
[0058] A "mapping reaction" as used herein refers to any reaction
that can be carried out on a polynucleotide clone to generate a
physical map or a nucleotide sequence of the clone. Similarly, a
"map" is a physical map or a nucleotide sequence.
[0059] The term "associating" as used herein in reference to a
tagged polynucleotide with a property and a tag complement means
determining that the polynucleotide hybridizes to the tag
complement. In many embodiments, associating simply means
hybridizing a polynucleotide with a known property to a tag
complement and detecting the hybridization. In other embodiments,
associating means detecting a property of a polynucleotide that is
already hybridized to a tag complement. In both cases, the result
is information that the polynucleotide has a certain property and
in addition hybridizes to the tag complement. The properties of a
polynucleotide can include for example the length, terminal base,
terminal landmark or other properties according to this
invention.
[0060] A "junction" as used herein in reference to insertion
elements is the DNA that flanks one side of the insertion
element.
[0061] A "clonal population" as used herein in reference to cells
is a collection of cells that are substantially identical and
originated from a single, isolated cell.
[0062] An "array sequencing reaction" is any method that is used to
determine sequences from a plurality of polynucleotides in an
array, for example methods described by Brenner (1997c and 1998a),
Brenner et al. (1998a), Cheeseman (1994), Drmanac et al. (1993),
Pastinen et al. (1997), Dubiley et al. (1997), Graber et al.
(1999), etc.
[0063] A "bioactive" compound is any compound, either man-made or
natural, that has an observable effect on a cell or organism. The
observable effect is the "biological activity" of the compound.
[0064] A "daughter cell" as used herein in reference to a first
cell is any descendent cell resulting from replication of the DNA
of the first cell. The DNA of the daughter cell may not be
identical to the first cell. For example, the daughter cell may
result from mating two different cells (or organisms); additional
DNA (for example transgenic DNA) or deletions may be present in the
daughter cell; or the genome of the daughter cell may result from
targeted homologous recombination, etc.
6.2 Massively-Parallel Sequencing Methods
[0065] A collection of sample-tagged clones is prepared by joining
a set of sample polynucleotides with a set of sample tags so that
many of the sample tags (i.e., preferably, at least approximately
35% of the total) are associated with unique sample
polynucleotides. A preferred sample tag, as shown in FIG. 1a,
comprises a distinct sequence element 12 flanked on both sides by
common regions 10 & 14 shared by the other clones. The sample
sequence element 16 comprises the sample polynucleotide that is
joined to the sample tag. A nucleic acid sequencing reaction is
performed on the pooled collection of sample-tagged clones (i.e.,
Sanger chain-termination method, Maxam & Gilbert chemical
cleavage method, etc.) Typically, four separate reactions are
performed, which correspond to the four (A, T, G, C) nucleotides.
The Sanger method employs the sequencing primer 18, which
hybridizes to the sequencing primer binding site in common region
10. In this example, only one sequencing primer binding site is
needed for the sequencing reaction to be performed on the pool of
sample-tagged clones. Of course, different collections of clones
with different common regions comprising different sequencing
primer binding sites may be pooled and more than one primer may be
utilized, but preferably there will be many more sample-tagged
clones than sequencing primer binding sites utilized in the
sequencing reaction. One or a limited number of primer binding
sites means only a small number of sequencing primers are required
for the sequencing reaction, which produces efficient priming and
limits spurious priming artifacts.
[0066] The products of the sequencing reactions are separated by
size and four sets of fractions are collected. Any method of
separation may be used that sufficiently resolves the sequencing
fragments (i.e. single nucleotide resolution) and permits
collection of the fragments in a state compatible with subsequent
analysis (i.e. amplification and/or hybridization, see below).
Representative methods include polyacrylamide gel electrophoresis,
capillary electrophoresis, chromatography, etc. These methods are
well known in the art and are described in, e.g. Ausubel et al.
(1997), Landers (1996), and Thayer et al. (1996). Fractions may be
collected, for example, by running the sequencing reactions off the
bottom of a gel or column, or each lane of a gel may be sectioned
in the direction normal to the direction of electrophoresis (i.e.,
transversely) and nucleic acid eluted from the sections. Ideally,
each fraction corresponds to chain lengths that differ by one
nucleotide and any one band is completely contained in only one
fraction. Different clones however will display slight variations
in band migrations, so fractions may contain only part of a band.
Each fraction of terminated DNA fragments is made double-stranded
using primer 20 in FIG. 1a, which hybridizes to common region 14.
The fractions are amplified to produce tagged amplicons comprising
distinct sequence element 12. A preferred method of amplification
is PCR with primer 18 and primer 20. Other methods of amplification
are applicable as described below. The four sets of amplicons can
be marked with four different labels (e.g., four different
fluorophores), where each label corresponds to one of the
terminating nucleotides.
[0067] The amplicons are separately hybridized to an array of tag
complements wherein for example each feature consists of
oligonucleotides complementary to only one distinct sequence
element 12. Alternatively, groups of four fractions that are marked
with different labels and correspond to the same size (i.e. the
same distance or time of migration), are pooled and hybridized to
the array. For each tag, the hybridization patterns and fraction
numbers will identify the sequence of nucleotides in the
polynucleotide joined to that tag. That is, the sequencing ladder
for the sample-tagged polynucleotide can be reconstructed from the
hybridization data and fraction numbers for the associated tag. The
resolution of the sequencing ladders will improve with more
fractions per band (i.e. smaller fraction size), but the tradeoff
is that more hybridizations are needed to reconstruct the ladders
Obviously, hybridization conditions and tag sequences must be
chosen to minimize cross-hybridization between different tags.
Methods for designing sample tags are well known, see for example,
Brenner (1997b). In this way, an array of oligos can be used to
deconvolute sequences of the sample-tagged polynucleotides.
[0068] A slight variation of the above technique will permit the
four sequencing reactions to be run together in one lane. Thus,
problems associated with lane-to-lane variation during gel
electrophoresis are eliminated. The sequencing primer 18 can
tolerate additional sequences at its 5'-end without influencing
priming. Consider four different sequences of identical length (40,
42, 44 and 46) added to the 5'-end of primer 18 to make sequencing
primers 30A, 30B, 30C and 30D as shown in FIG. 1b. The additional
sequences are long enough so that their complements can act as
primer binding sites for primers 50, 52, 54 and 56. Preferably the
melting temperatures of these four primers are similar. Now, the
four chain-terminating reactions are performed with the four
different sequencing primers (i.e., ddATP reaction is primed by
30A, ddGTP is primed by 30B, etc.) The four reactions are pooled,
separated by size and fractionated. Each fraction can be PCR
amplified using five primers: 20, 50, 52, 54, and 56. Primers 50,
52, 54 and 56 are attached to different labels (i.e., different
fluorophores). In this way, the tag is labeled according to the
dideoxy terminator. Alternatively, each fraction can be amplified
in four separate reactions with four primer pairs: 20+50, 20+52,
20+54, and 20+56, in which case the label need not be attached to
the oligo. If RNA polymerase is used to amplify the tags, then
sequences 40, 42, 44 and 46 may encode four separate RNA polymerase
promoters (e.g., T3, T7, SP6 & E. coli RNA polymerase).
Alternatively, the four sequencing primers (30A, 30B, 30C and 30D)
may comprise a single promoter located 5-prime to regions 40, 42,
44 and 46. In the latter case, the tags may be visualized after
hybridization to the array in a subsequent hybridization with
labeled oligonucleotides 50, 52, 54 and 56, wherein the
oligonucleotides preferably comprise different labels. If PCR is
used to amplify the tags, it is advantageous to attach a biotin (or
analogous) group to primer 20 (or the primers opposite primer 20)
so the complementary (and in some cases unlabeled) strand can be
easily removed before hybridization to the array. Other methods
that preferentially degrade one strand can also be employed (e.g.,
5'-phosphate plus lambda exonuclease, see Ausubel, 1997). Not all
sequences of equal length will work equally well for the sequence
elements 40, 42, 44 and 46. Preferably, the sequencing primers 30A,
30B, 30C and 30D have minimal secondary structure so their
contribution to the mobility of the reaction products during
separation is based essentially entirely on length, that is the
different primers contribute equally to mobility.
[0069] An analogous strategy can be employed to permit pooling of
nucleic acid sequencing products generated by the Maxam-Gilbert
method (and other chemical cleavage methods). In this case,
sequence elements that correspond to 40, 42, 44 and 46 are ligated
as adapters to the sample-tagged polynucleotides before or after
the reactions, but prior to pooling and separation. That is, the
adapter comprising sequence 40 is ligated to polynucleotides
subjected to the "A+G" reaction, the adapter comprising sequence 42
is ligated to polynucleotides subjected to the "G" reaction,
etc.
[0070] Clearly, many different nucleic acid sequencing reactions
can be used to practice this invention. The Sanger and
Maxam-Gilbert methods are outlined above, but several variations
are well known in the art.
[0071] By including polynucleotides of known sequence attached to
known sample tags as internal controls in the pool of sample-tagged
polynucleotides, it is possible to determine the fraction number of
any fraction based on the known sequence information of the
controls. That is, the control sequence patterns and signal
intensities can be used to calibrate the hybridization patterns
from the array to facilitate reconstruction of the unknown
sequencing ladders. Any variation in signal intensities from one
hybridization to the next can be calculated and corrected by
referring to the control sequence patterns. If 10 known fragments
are included in the pool, then each fraction will show only one of
4.sup.10.apprxeq.one million possible hybridization patterns at the
corresponding 10 locations on the array. In practice, this number
is much greater because the hybridization signals will not have
simple binary contributions from each base, but will display
variable intensity depending on the amount of each band in the
fraction.
[0072] Denaturing polyacrylamide gels separate DNA principally by
size. There are well known exceptions to this rule (e.g.,
compressions) that can affect DNA migration. In addition, there is
a very slight dependence of mobility on the terminal 3'-base.
Therefore, sequencing bands corresponding to equivalent sizes need
not be perfectly superimposed. The problem of reconstructing the
DNA ladder from the band intensities in each fraction becomes a
problem of reconstructing a wave from sampled intervals along that
wave (picture the readout from an ABI sequencer and this problem
becomes clear). Obviously, the more fractions that one collects,
the more information one has to reconstruct the parent wave. This
is simply a problem in information theory, well known in the art,
see for example Stockham et al. (1993), Allison et al. (1998),
Fujiwara et al. (1982), Johnson et al. (1994), and Press et al.
(1988). By calibrating the fractionation apparatus and/or using
internal standards, the appropriate sampling frequency is
determined. The hybridization data provides information about the
"amplitude" of each peak. By optimizing the gel conditions and
stressing uniform band intensities and uniform spacing, it may be
possible to obtain unambiguous sequence data with fewer fractions
than bases. Very few template preparations and sequencing reactions
are needed to obtain enormous amounts of sequence information so
even elaborate protocols (e.g., cesium banding, formamide gels,
etc.) and a variety of nucleotide analogs (e.g. 7-deaza-dGTP and
dITP) can be used to produce optimally fractionated sequencing
products.
[0073] An important aspect of the method, is the ability to
construct the clone libraries in a pool of sample tagged vectors
(alternatively, the sample tags can be added as adapters and the
clones ligated into the same vector, see Sagner et al., 1998). This
approach greatly reduces the effort involved in library
construction, but comes at a cost of lost information per pool. For
example, consider a library that consists of 500,000 different
sample tags. The effort would be enormous to make 500,000 separate
libraries and then to pick a single clone from each library.
Instead, one library is constructed and about 500,000 transformants
are pooled (a very trivial operation). Similarly, the library may
be constructed entirely in vitro, and 500,000 clones may be
selected by amplifying in vitro a proper dilution of the library so
that the amplicons comprise about 500,000 clones. However assuming
a normal distribution, only a fraction (1/e=0.37) of the sample
tags is expected to be present only once in the library (i.e.
attached to only one sample polynucleotide). 37% of the sample tags
are expected to be absent from the collection and the remainder
will be present two or more times (that is, two or more different
polynucleotide clones will contain the same sample tag). Therefore,
63% of the original sample tags will provide no or garbled
information. Those original sample tags providing garbled
information are readily recognized because more than a single base
is identified at each position during the deconvolution step. This
loss is well worth the savings in effort. Certain strategies can be
used to increase the information content, such as using 5 million
original sample tags and selecting only 500,000 clones, but if the
maximum size of the array is 500,000 (close to the current
Affymetrix array size), then either 10 arrays must be used per
hybridization to extract about 90% of the information, or the
subset of tags must be determined first and a new array synthesized
that contains the 450,000 unique sample tags. It may be possible to
enrich for unique clones by sequentially hybridizing to the array
plasmid DNA from smaller subsets of transformants (say 50,000). In
this way, a tag complement in the array becomes saturated and
cannot hybridize to other plasmids that are present in subsequent
pools. Plasmid DNA can be eluted from the array, transformed back
into E. coli (or amplified in some other way) and sequenced. Of
course, if smaller numbers of clones are to be sequenced, it is
feasible to construct separate libraries for each tag and pool one
member from each library before performing the sequencing reaction,
or even separately perform the sequencing reaction on one member
from each library and then pool the reaction products.
[0074] Another important aspect of the invention is the ability to
amplify the DNA in the fractions. The current limit of detection on
an Affymetrix chip is 0.5 .mu.M probe (see Lockhart et al., 1996).
Assuming a 200 .mu.l hybridization volume, this equals
(0.5.times.10.sup.-12M).times.(200.times.10.sup.-6
L).times.(6.times.10.sup.23 molecules/mole)=6.times.10.sup.7
molecules. Assuming 1 .mu.g of 3 kb plasmid pool is sequenced, then
(10.sup.-6 g/(3000.times.625M.W.)).times.(6.times.10.sup.23
molecules/mole)=3.2.times.10.sup.11 molecules are divided among
500,000 different plasmids and 1000 different bands. Therefore
(3.2.times.10.sup.11)/(500,000.times.1000)=640 molecules of any one
tag are expected to be present in any one band. In this case, an
amplification factor of 6.times.10.sup.7/640-100,000 is required.
There are multiple strategies for converting the terminated
sequencing fragments into a form compatible with in vitro
amplification. A number of well-known methods exist for converting
single-stranded DNA into a double-stranded form. For example,
random priming can be performed with a mixture of oligonucleotides
that are identical except for several random bases near the
3'-ends. This method is well known in the art; see, e.g., Telenius
et al. (1992) and Cheung et al. (1996). PCR then can be performed
with primer 18 and a second oligonucleotide primer that is
identical to the region shared by the random primers. Other forms
of in vitro amplification are possible, such as linear
amplification with RNA polymerase (assuming the double-stranded
fragment contains a promoter), etc. Variations on this strategy
include the ligation of short double-stranded molecules (adapters)
to randomly primed sequencing fragments. The second primer is
designed to anneal to the adapter sequence (see section 6.7).
[0075] Other strategies for amplifying the tag sequences may
require removal of any unusual bases at the 3'-ends of the
sequencing fragments (e.g., dideoxynucleotides). This step can be
performed by limited digestion of the fragments with a
3'-exonuclease (e.g., Exonuclease I, T4 DNA Polymerase, etc.). Now,
the linear fragments can be tailed with terminal transferase or
even joined to another single-stranded fragment of known sequence
through the action of T4 RNA ligase. In both cases, the known
sequence (i.e., polyA or the second fragment) can serve as a second
priming site for PCR or other form of amplification. Alternatively,
the digested sequencing fragments can be circularized with T4 RNA
ligase. Inverse PCR can be performed on this circular substrate
(Innis et al., 1990). The circles can also be amplified by a
rolling-circle type amplification with a strand-displacing
polymerase as disclosed in Lizardi et al. (1998) and Zhang et al.
(1998).
[0076] It is possible in some embodiments to perform the nucleic
acid amplification step after the sequencing fragments are
hybridized to the oligonucleotide array. Adams et al. (1997)
describe a method in which both PCR primers are attached to a solid
substrate. Amplification occurs in a fashion similar to traditional
PCR only the replicated molecules remain attached to the substrate.
In this case, each feature (spot) in the array will contain one
oligonucleotide that hybridizes to a particular tag and one common
primer (e.g., primer 18, FIG. 1a). Note, the sequencing fragments
are not complementary to the common primer until the complementary
strand is synthesized.
[0077] A more preferred method of "in-situ" amplification is the
rolling-circle type process mentioned above. In this case, the
sequencing fragments can be converted to a circular form before
hybridization to the array. The oligonucleotides in the array
complementary to the tags will prime the rolling-circle
replication. A second common primer can be provided in solution.
Other variations of rolling circle amplification may be used. For
example, consider a tag complement-sequencing fragment duplex. The
sequence upstream of the tag, including the sequencing primer, will
be present as a 5'-single-stranded extension of the duplex. A
second oligonucleotide can hybridize to the overhang. T4 DNA ligase
can join the tag complement to this second oligonucleotide. The
second oligonucleotide can then serve as a primer for rolling
circle amplification. In this case, the circular substrate is a
common molecule that is amplified wherever in the array
hybridization of the sequencing fragments has occurred. For a
discussion of rolling circle amplification see Lizardi et al.
(1998) and Zhang et al. (1998).
[0078] The preferred sample tag shown in FIG. 1a is joined to the
sample polynucleotide in vitro (i.e. it is an "adapter tag"). In
certain instances, the sample tag may be a "genomic tag" that
comprises a sequence element from the sample polynucleotide. For
example, consider an array made by separately PCR-amplifying
individual clones from a library (for example, cDNA clones) and
spotting the clones on a glass slide (see for example Brown et al.,
1998). All the clones are amplified with the same two vector
primers. The PCR amplicons may be pooled and sequenced as follows.
In this example, the pool of cDNA clones is sequenced with one of
the PCR primers by the "Sanger" method. The reaction products are
separated and fractionated as described above. Now, the
fractionated products are amplified in vitro to generate amplicons
comprising sequences from the cDNA (see section 6.7.1.2). These
amplicons are hybridized to the spotted array to reconstruct the
sequence ladders from individual clones as described above. Note,
the cDNA clones comprise the tag complement sequences. Arrays of
the cDNA clones constructed by other methods also are suitable (see
section 6.8 below). Of course, the common sequences shared by all
the clones should be removed from the amplicons prior to
hybridization (or removed from the cDNA clones prior to spotting)
to minimize cross-hybridization. This step is trivial if a
restriction site separates the sample sequence elements from the
common elements (i.e., the cDNA clones were ligated into a cloning
vector at a restriction site). This method of sequencing with
genomic tags is preferred when a library cannot be easily remade or
"retrofit" with the adapter tags shown in FIG. 1a.
6.3 Massively-Parallel Physical Mapping Methods
[0079] The sequencing method described above is a parallel method
for fragmenting a polynucleotide at its bases, determining the size
of each fragment and thereby determining the linear order of the
bases. However, a polynucleotide can be fragmented at features
other than single bases. These features, or landmarks, include for
example restriction sites, DNA hypersensitive sites, recognition
sites for DNA binding proteins, methylation sites or indeed any
region of DNA that can be preferentially nicked or cut or otherwise
used to define the length of a polynucleotide fragment. For
example, the lac repressor binding site can be used as a landmark
for directly cutting the DNA with a lac repressor coupled to
EDTA-Fe (Shin et al., 1991). This site can be used in an
Achilles-heal type cleavage reaction (e.g. Koob et al., 1990), or
the lac repressor can be used to prevent an exonuclease from
degrading the polynucleotide beyond the site (see Johnson et al.,
1990).
[0080] In a manner analogous to the parallel sequencing method, it
is possible to determine the locations of landmarks in a
polynucleotide. In essence, a nucleic acid sequencing reaction is a
partial "cleavage" reaction of a polynucleotide clone at its
nucleotides. The construction of a physical map involves the
partial "cleavage" of a polynucleotide clone at its landmarks. The
use of sample tags, fractionation and array hybridization to
reconstruct the pattern or "ladder" of landmarks from many
different polynucleotides is identical in many respects to the
sequencing method.
[0081] A preferred landmark is the restriction site. Indeed, the
classic notion of physical mapping is restriction mapping. Larger
"contigs" are constructed from polynucleotides by comparing their
distribution of restriction sites to look for overlaps e.g. Kohara
et al., 1987). The physical map of an entire genome may be
constructed by determining the restriction maps of subclones in a
massively parallel manner according to the method of this
invention. The use of restriction sites is representative and may
be substituted by other landmarks.
[0082] To construct the physical (restriction) map of a genome,
genomic DNA is fragmented and subcloned to form a library. Of
course, the method is applicable to any portion of a genome from
which nucleic acid can be prepared, such as, e.g., a chromosome or
a portion thereof. It is within the skill of the art to isolate a
portion of a genome by, e.g., flow cytometry and to prepare a
library of genomic DNA from it. In fact, genomic DNA libraries
derived from single human chromosomes have been constructed by,
e.g., the United States governments National Laboratories, and such
libraries are readily available. See, e.g., Birren et al. (1996)
and Kim et al. (1994).
[0083] The library is constructed de novo in sample-tagged vectors
or an existing library can be "retrofit" with sample tags (e.g.
Frengen et al., 1999) so that many of the sample tags (i.e.,
preferably at least 35% of the total) have a unique correspondence
to only one sample polynucleotide. That is, a sample tag is joined
to only one sample polynucleotide (though one sample polynucleotide
can be joined to more than one sample tag). The clones are pooled
and cut to completion with a restriction enzyme that cuts in the
vector. Typically, this enzyme will be a "rare cutter," that is, it
cuts infrequently (e.g., recognizes an 8 base-pair (or longer)
sequence). A partial digestion is performed on the pooled clones
with another restriction enzyme. The digestion products are
separated by size (e.g., by gel electrophoresis, chromatography,
etc.), and fractions are collected. Each fraction includes a narrow
size distribution of fragments. The fractions can be hybridized
directly to an array of tag complements, or preferably tagged
amplicons may be amplified from the fractionated DNA before
hybridization (e.g., using PCR, RNA polymerase, etc. as described
supra). In a preferred embodiment, the sample tags are flanked by
sequences common to all the clones as in FIG. 1a. The tags can be
labeled (e.g., using fluorescent dyes or other methods known in the
art) before or after electrophoresis or during amplification using
standard techniques (see above and Kohara et al., 1987). As
described above, certain in-situ amplification protocols may be
appropriate.
[0084] The restriction digest pattern can be reconstructed for any
clone by observing the fractions that contain the tag or tagged
amplicon that corresponds to the clone. This process can be
repeated with several different restriction enzymes. The resulting
partial digest patterns provide a "fingerprint" of every clone in
the pool. Identical fingerprint patterns in a region indicate two
clones overlap as disclosed in Kohara et al. (1987). Note any
polynucleotide cleaved with a restriction enzyme will produce at
least two fragments, but only the tagged fragment will be
visualized.
[0085] In this way, a physical map can be constructed from a pooled
sample-tagged genomic library without the need to isolate
individual clones. However for many uses, individual clones need to
be isolated. If only a few clones are needed, these clones can be
isolated from the original pool using traditional colony
hybridization techniques e.g. Ausubel et al., 1997). Since a unique
sample tag is associated with the clone, the probe would consist of
a labeled oligonucleotide that is complementary to the sample tag
of interest, assuming the sequence of the sample tag is known. If
the sample tag sequence is not known, one could obtain some genomic
sequence from every clone using the same array and the sequencing
method described above
[0086] Every clone can be isolated by spatially separating
individual clones in the original pool. These clones are then
repooled in a systematic way. For example, one million clones can
be grouped in three dimensions yielding 300 subpools
(100.times.100.times.100). The work to pick and pool one million
clones is not trivial. As described above, it may be cost effective
to optimize the number of informative sample tags; i.e. each tag is
associated with only one genomic fragment (of course, it also is
possible to construct a different library in each sample-tagged
vector and pool one clone from each library). Since the informative
sample tags are present only once in the original pool, each of
these sample tags should be present in only three of the subpools
(representing the x, y & z dimensions of the 3-dimensional
grouping). The population of tags in any one subpool can be
determined by amplifying the sample tags in the subpool (e.g. by
PCR) followed by hybridization to the array of tag complements.
Consequently, each sample tag is given a spatial address which
corresponds to the clone that contains the sample tag. This
approach to pooling is described in, e.g., Yoshida et al.
(1993).
[0087] Genomic clones can be spatially arrayed using flow
cytometry. A reporter gene (e.g., Green Fluorescent Protein as
disclosed by Chalfie et al., 1996) can be included in the cloning
vector so that transformed (or transfected) cells can be
distinguished and separated from "empty" cells. Cells are given
sufficient time for phenotypic expression after transformation, and
then they are subjected to "cell sorting" (see Galbraith et al.,
1999).
[0088] It is possible to combine pools after the partial digest,
and before size separation. This technique is similar to the
sequencing method above in which four sequencing primers with
different 5' sequences are used to identify the four terminating
nucleotides. In the above physical mapping method, the overhang
produced by the "rare-cutter" is ligated to an adapter that differs
in sequence for each enzyme used to perform the partial digests.
These sequences will serve as priming sites for amplification of
the tags after fractionation. The primers can be attached to
different labels (e.g., fluorophores) so that more information can
be recovered per hybridization. As with the sequencing methods
described supra, the inclusion of known fragments attached to known
sample tags (i.e., sample-tagged size markers) will uniquely
identify each fraction and allow precise molecular weight
determination and calibration of signal intensities from one array
to another.
6.4 Massively-Parallel Methods for Locating Insertion Elements
[0089] The methods described above exploit sample-tags to determine
either sequence or physical map information from sample
polynucleotides. Particularly with respect to adapter tags, the
relationship between a specific sample tag and the sample
polynucleotide is not important, i.e., a different sample tag
joined to the sample polynucleotide would still suffice to practice
the inventions. Nevertheless, a "byproduct" of the methods is the
determination of which sample tag is joined to which sample
polynucleotide. For example, consider a collection of sample tags
and a collection of sequenced sample polynucleotide clones. The two
collections are randomly joined to produce sample-tagged clones as
described above. The goal is to determine the identity of the
sample-tag joined to any particular sample polynucleotide. One need
only sequence the sample-tagged polynucleotides as described above
to obtain the desired information. Of course, this example is meant
to be illustrative. A more practical use is to randomly join a
collection of sample tags to chromosomal DNA and determine which
tag is coupled to which chromosomal region. When the act of joining
is performed in vivo, the sequencing and physical mapping methods
can be used to determine the locations of sample-tagged insertion
elements.
[0090] In a preferred embodiment, a collection of sample-tagged
insertion elements is prepared as shown in FIG. 2, wherein the
sample tag comprises a distinct sequence element 106 flanked on
both sides by common elements 104 and 108. The insertion elements
are easily constructed, for example by ligating a pool of sample
tags into the insertion element "backbone". This backbone may
reside in a vector that is lost after integration of the insertion
element into the genome (e.g. a suicide vector). The insertion
element is capable of random integration (or near-random
integration) into the genome (for example, retroviral vectors for
mammalian cells, Tn10 vectors for E. coli, P element vectors for
Drosophila, transfected DNA of any kind in mammalian cells, etc.,
see Kleckner et al., 1991; Dellaporta, 1999; Hamilton et al., 1994;
Sands, 1998). The method may be practiced using any type of cell or
cell line capable of integrating foreign DNA into the genome, such
as Saccharomyces cerevisiae, Escherichia coli, Bacillus subtilis,
mammalian cell lines, plant cell lines, Drosophila embryos, zebra
fish cell lines, etc. Several transposons have been shown to
function in distantly related organisms (Sherman et al., 1998;
Rubin et al., 1999), suggesting this mode of integration may be
generalized to virtually any cell. In a preferred embodiment, the
method may be practiced with cells from which a multicellular
organism can be regenerated such as embryonic stem cells (Stewart,
1993), fetal stem cells (Campbell, 1996), plant cells
(Azpiroz-Leehan, 1997), etc.
[0091] A collection of cell clones is generated by randomly
inserting the sample-tagged insertion elements into the genome so
that usually any one cell (or organism) preferably will have
undergone only one integration event (note: the analysis is
identical for multiple integration events) and preferably about 36%
or more of the sample-tagged insertion elements have inserted at
only one location in the genome (about 36% is easily obtained by
choosing about the same number of cell clones as unique sample
tags). These cells can be spatially separated. For example,
mammalian cells can be infected with a collection of sample-tagged
retroviral vectors. Each vector may contain a reporter gene (e.g.,
GFP). The transfected cells (that is, the cells that express the
reporter gene) can be spatially separated from each other and from
uninfected cells by flow cytometry and cell sorting (see Galbraith
et al., 1999), or by other means. Though this example is directed
towards random integration events, the method is equally applicable
to "targeted" integration events. For example, insertion elements
have been described that target the integration events to genes by
providing selectable markers that lack promoters, or must be
properly spliced to function, etc (e.g. Sedivy et al., 1989;
Friedrich et al., 1991; Skarnes et al., 1995; Ruley et al., 1997;
Sands et al. 1998).
[0092] The relationship between the sample tag and the cell clone
that contains the sample tag can be easily determined. The cell
clones in the collection can be pooled according to some standard
scheme such as a 3-dimensional grouping (e.g., one million clones
can be ordered into 100+100+100=300 subpools where each tag is
present in 3 subpools. These subpools represent the x, y & z
coordinates of the 3-dimensional group, see above) The sample tags
present in any subpool are determined, for example by PCR
amplifying genomic DNA from the subpool with primers 114 and 116 in
FIG. 2 to generate tagged amplicons comprising the distinct element
106 (or using any other amplification method known in the art),
labeling the amplicons and hybridizing to an array of tag
complements wherein for example each feature consists of
oligonucleotides complementary to only one distinct sequence
element 106. A sample tag that is present only once in the
collection (that is, it resides in only one cell clone) will be
present in only three subpools (in this example). The three
subpools will uniquely define the address of the cell clone that
contains the sample tag.
[0093] Working with a large collection of cell clones can be very
laborious. One can increase the number of informative insertion
elements among the collection of cell clones by choosing fewer cell
clones than sample tags. For example, a collection of ten million
sample-tagged insertion elements may be randomly integrated into
cells as above, but only one million cell clones are isolated for
subsequent analysis. About 90% of the sample tags will be present
in only one cell clone. The sample tags absent from the collection
of cell clones are easily determined by amplifying the sample tags
from a pool of the cells and hybridizing the amplicons to an array
(or arrays) comprising all ten million tag complements. If
necessary, new arrays can be synthesized with only the informative
tag complements for any subsequent analysis.
[0094] 6.4.1 Locating Insertion Elements by Sequencing
[0095] The position in the genome of any sample-tagged insertion
element can be determined "en masse." DNA is prepared from the
pooled collection of cell clones. Inverse PCR (see Ochman et al,
1988; Silver et al., 1991) is performed on the DNA as shown in FIG.
2. The DNA is treated with a restriction enzyme that cuts at site
100. The restriction products are circularized with DNA ligase and
PCR amplified with the primers 112 and 114, which hybridize to
common elements 102 and 104 in the insertion element. In this
example, the amplicons comprise the sample tag and one insertion
element junction 110. The resulting pool of PCR products is simply
a pool of sample-tagged polynucleotide clones that can be sequenced
using the massively-parallel sequencing method described above, for
example using primer 114 as a sequencing primer and amplifying the
fractionated sequencing products with primers 114 and 116.
[0096] The method of Inverse PCR described above involves cutting
the genomic DNA with a restriction enzyme prior to circularization.
Consequently, the amplicon derived from any particular cell clone
will be a polynucleotide clone (i.e. all the polynucleotides will
be the same length and essentially identical). This polynucleotide
clone is correctly termed sample-tagged. However, Inverse PCR could
equally be performed with randomly sheared DNA. In this case, the
amplicon will not be a polynucleotide clone, but will consist of
polynucleotides of various sizes comprising the same sample tag.
These tagged polynucleotides will all contain the insertion element
junction, so it is more appropriate to refer to a sample-tagged
junction than a sample-tagged amplicon. In both cases, the junction
sequence generated by the parallel sequencing method will be the
same.
[0097] The sequence of the insertion element junctions can be used
to locate the sites of integration within the genome. Very little
sequence information is needed assuming the organism has been
completely sequenced. Algorithms for comparing nucleotide sequences
are well known in the art (see, e.g., Pearson, 1990; Altschul et
al., 1990; Suhai, 1997).
[0098] It will be obvious to those skilled in the art that methods
other than Inverse PCR can be utilized to amplify the sample-tagged
junctions. For example, one could use Panhandle PCR (Dieffenbach et
al., 1995), Vectorette PCR (Arnold et al., 1991), etc. or even more
traditional plasmid rescue protocols (see below) provided the
insertion element contains the proper functional elements (e.g.
selectable marker and origin of replication).
[0099] It is also obvious that other parallel sequencing methods
can be used to sequence the sample-tagged junctions. For example,
Brenner describes methods for attaching tagged polynucleotides to a
solid support by hybridization to arrays or beads comprising tag
complements (see Brenner 1997a, Brenner et al., 1998b). The
molecules can then be subjected to step-wise sequencing reactions
(see for example Brenner et al, 1998a; Brenner, 1998a; Albrecht et
al., 1997; Cheeseman, 1994, etc.) in which each "step" generates
reaction products from the arrayed polynucleotides. The reaction
products are labeled according to a single base (or small number of
bases). By visualizing the reaction product at each address in the
array, a single or small number of bases can be determined.
Repetition of the process produces more sequence information from
each tagged polynucleotide in the array. Drmanac et al. (1993)
describe a method for sequencing by hybridization with short
oligonucleotide probes. In this case, a hybridization reaction can
be performed with the tagged polynucleotides attached to the array.
The reaction products are short labeled oligonucleotides hybridized
to those tagged polynucleotides containing complementary sequence.
By repeating the hybridization reaction with different
oligonucleotides and noting the addresses of the labeled reaction
products, a sequence "profile" can be constructed for the tagged
polynucleotides. Usually this profile will consist of several
sequence contigs for each tagged polynucleotide (corresponding to
the oligonucleotide sequences). Enough contigs will provide the
locations of the insertion elements (at least to within several
hundred base pairs or so).
[0100] 6.4.2 Locating Insertion Elements by Restriction Mapping
[0101] The location of insertion elements can also be determined by
partial restriction enzyme analysis. In this case, the
sample-tagged junctions are isolated from the DNA of pooled cell
clones by a method that recovers genomic DNA fragments larger than
about 1 kb and more preferably larger than about 5 kb. In vitro
amplification methods such as those described above can be used
with the proper modifications for amplifying large fragments, such
as Inverse PCR with "long-range PCR" conditions (Ohler et al.,
1992; Barnes, 1994). A preferred method of amplifying the junctions
is plasmid rescue in vivo (see for example Hamilton et al., 1994).
Plasmid rescue entails cutting the genomic DNA with a restriction
enzyme (or randomly shearing the DNA), circularizing the products
and transforming the DNA into a host such as E. coli. The insertion
elements must be designed to carry a selectable marker and a
plasmid origin of replication (or some other element to ensure
propagation in the host). Clearly, any method capable of recovering
large junction fragments is applicable. For example, the insertion
element may include a bacteriophage packaging signal (a pac site)
for efficient in-vitro packaging of the genomic DNA (or the site,
for example the lambda cos sequence, can be ligated as an adapter
to the genomic DNA) followed by "infection" of the host. The
insertion element may comprise for example a YAC vector (Burke et
al, 1987) and telomeres can be ligated to the genomic DNA followed
by transformation into S. cerevisiae. The genomic fragments
comprising the sample-tagged junctions can be enriched in vitro
prior to amplification. Taidi-Laskowski et al. (1988) and Rigas et
al. (1986) describe methods for enriching for particular
polynucleotides in a library by recA-mediated DNA capture. Gossen
et al. (1997) describe a method for selecting DNA fragments that
bind the lac repressor prior to plasmid rescue (note: this method
requires the insertion elements contain the lac operator). Indeed,
the Gossen method is easily generalized to any molecule that
recognizes and binds to a particular DNA sequence element. Clearly,
any appropriate method of enrichment and/or amplification can be
used, regardless of the complexity because it need only be
performed once or a small number of times to rescue the
sample-tagged junctions from the entire collection of cell
clones.
[0102] The sample-tagged junctions are analyzed by the method
described above for physical mapping. In a preferred embodiment,
the landmarks are restriction sites. The resulting restriction maps
are compared to the restriction map of the genomic DNA from the
organism to determine overlaps between the junctions and the
genomic DNA. (Note: this analysis can be performed without
knowledge of the complete genomic sequence; only the sequence of
the relevant restriction enzyme sites throughout the genome is
required. This information can be determined by the physical
mapping procedure described above). It also is worth noting that
this strategy and the physical mapping method can be performed with
much larger tags than is practical with the sequencing
strategy.
[0103] The tag complements used above for positioning insertion
elements by sequencing or physical mapping are preferably
synthesized as short oligonucleotides as described below for
example by the method of Fodor et al. (1995) or Montgomery (1998).
In this case, the sequence of the sample tags must be known. The
arrays may also be constructed by amplifying sample-tags directly
from the cell clones and "spotting" the amplicons on a slide or
synthesizing the arrays by in-situ amplification of randomly
distributed sample tags as described below in section 6.8. In the
latter two examples, the sequence of the sample tags need not be
known. Note if spotting is used to construct the arrays, then each
tag complement (derived from an amplified sample tag) can have an
address in the array that corresponds to the address of the cell
clone (see for example Hensel et al., 1995). As a result, the
sequence or physical map associated with each sample tag is already
associated with a cell clone (by virtue of the address of the tag
complement), so the analysis with subpools described above is not
necessary. Of course, this latter spotting method is only
informative when a cell clone contains only one sample-tagged
insertion element.
[0104] In some cases, the application of both strategies outlined
above (sequencing and physical mapping) may be used to determine
precisely the position of insertion elements. For example, a genome
with many repetitive elements may be refractory to analysis by
sequencing alone. Integration events that occur in repetitive
elements will not always yield single copy sequence (that is,
sequence that occurs only once in the haploid genome). However,
restriction mapping can provide positional information that covers
many thousands of base pairs. This information will usually place
the insertion element at a single location in the genome. The
sequence information then can be used to locate the exact position
of the insertion element to single base resolution.
[0105] By application of the methods described above, the location
in the genome of sample-tagged insertion elements can be determined
as well as the spatial locations of the cell clones (or organisms)
that contain the sample tags. The insertion elements that integrate
within coding regions will often disrupt proper gene function.
These integration events are gene knockouts. By application of the
methods to totipotent cell lines (such as embryonic stem cells),
multicellular organisms carrying the knockouts can be constructed.
If a particular gene is not "hit" by an insertion element, it is
possible to use insertion elements in surrounding regions to delete
the gene. For instance, FRT sites can be incorporated into the
insertion element to facilitated site-specific recombination (via
FLP recombinase) between two insertion elements. If the two
insertion elements do not already exist in the same cell, they can
be crossed together by mating (assuming the cells or organisms are
capable of mating). One product of the recombination event is a
deletion of the DNA between the two vectors (see Golic, 1991 &
1994; Golic et al., 1996; Xu et al., 1993; Kilby et al., 1993). In
this way, other types of chromosomal deletions can be
generated.
[0106] 6.4.3 Locating Insertion Elements with "Genomic" Tags
[0107] Alternative methods are available for determining the
genomic position of the insertion element. These alternatives do
not require a sample tag to be present in the insertion element.
The sample tag is provided by the genomic DNA. These methods can be
particularly useful when it is prohibitively difficult to
incorporate exogenous DNA into the genome. For example in
Drosophila melanogaster, an appropriate mating protocol can be used
to generate many offspring that have undergone independent
germ-line transposition events of an endogenous P element (see
Hamilton et al., 1994). However, the introduction of an in-vitro
modified P element into the genome can be very time consuming and
costly. Consequently, an alternative to the use of sample-tagged P
elements is beneficial.
[0108] In one embodiment, a collection of cells (or organisms) with
insertion elements is prepared. The collection is grouped into
subpools according to a standard scheme, for example 3-dimensional
pooling as described above. From each subpool, insertion element
junctions are rescued by Inverse PCR or by another standard method
(as described above). The amplified junctions are labeled and
hybridized to an array of tag complements. In this case, the tag
complements are prepared from the genomic sequence. For example,
short single-copy sequences that are randomly distributed
throughout the genome may be synthesized in arrays according to the
methods of Fodor et al. (1995) or Montgomery (1998), or the
sequences may be derived from ESTs (expressed sequence tags, see
Adams et al., 1991) or the junction sequences themselves (see below
in section 6.4.3.1). Hybridization to the array reveals the spatial
address of the cell clone (or clones) that contains an insertion
element in the genome near the genomic tag (that is, which cell
contains a junction comprising the genomic tag). Depending on the
number of polynucleotide clones in the collection and the length of
rescued DNA, multiple clones may hybridize to the same tag
complement (i.e., the insertion elements integrated near the same
genomic tag). In this case, the spatial address is ambiguous. It is
possible to minimize these ambiguities by analyzing the collection
pooled according to a second scheme different from the first as
described in Barillot et al. (1991). A preferred pooling scheme
will provide unambiguous spatial addresses for the clones without
the need for further analysis of subpools. Other pooling schemes
employ two or more separate steps to determine addresses (see for
example, Hamilton et al., 1991), where subsequent steps require
analysis of fewer subpools. While these other schemes require
analysis of fewer subpools to determine the address of a single
cell clone, the work cannot be performed efficiently in parallel.
These step wise pooling strategies are more appropriate for
positioning one or a small number of insertion elements at a
time.
[0109] Clearly, the above analysis provides more information than
simply the spatial addresses of the "genomic-tagged" cell clones.
For example, if the genomic sequence is known, then the locations
of the genomic tags are known. Consequently, the approximate
positions of the genomic-tagged junctions are known. If the
absolute positions of the genomic tags in the genome are not known
(for example, the tag complements could be derived from unmapped
cDNA sequences), one still knows the approximate "relative"
locations of the insertion elements.
[0110] 6.4.3.1 Refining the Locations of Genomic-Tagged Insertion
Elements by Parallel Sequencing
[0111] One method to obtain more precise positional information
(absolute or relative) is simply to sequence the junctions in
parallel. A subset of the original collection of cell clones is
pooled and the insertion element junctions are amplified as
described above. This subset is chosen so that many of the genomic
tags (preferably more than about half) are present in only one cell
clone. These amplicons are joined to sample tags and sequenced
according to the method of this invention (or any other tag-based
parallel sequencing method as described above). Preferably, the
entire genome has already been sequenced so any sequence from a
junction will immediately position it and reveal the associated
genomic tag (regardless of whether or not the genomic tag is
actually sequenced along with the junction).
[0112] Preferably, the order of events is reversed; the junctions
are sequenced first and then the genomic tags are chosen, the array
of tag complements is synthesized, and the spatial addresses are
determined. If desired, junctions from the entire collection of
cell clones can be prepared as one pool, joined to sequence tags
and sequenced. Different subpools of the sequence-tagged junctions
can be sequenced until nearly all of the junctions are analyzed.
For example, consider a collection of 100,000 cell clones. The
100,000 junctions are cloned into a pool of about 300,000 different
sequence-tagged vectors. About 300,000 clones are pooled and
sequenced in parallel with an array of 300,000 tag complements.
Approximately 100,000 clones in the pool are sequence-tagged and so
yield sequence data (that is, about 36% (1/e) of the sequence tags
are associated with only one junction). Those 100,000 clones will
yield sequence information from about 64,000 different junctions.
Repeating the process on a different pool of 300,000 clones will
yield the sequence from about 64% of the remaining junctions
(approaching 90,000 sequenced junctions). Tag complements are
designed from the sequence information and a new array is
synthesized. Now the collection of cell clones is repooled in a
3-dimensional array with 47 sub-pools per dimension. The junctions
are amplified from each subpool and separately hybridized to the
array to determine cell clone addresses. This order of events
permits one to locate the insertion elements with genomic tags
without first having any genomic sequence information. Of course,
the locations are relative but can later be placed in their
absolute chromosomal locations for example by completely sequencing
the genome.
[0113] Restriction maps for genomic DNA flanking the insertion
elements can be quickly constructed by rescuing large fragments
comprising the junctions in sample-tagged vectors using an
appropriate protocol such as plasmid rescue as described above. The
analysis of these sample-tagged junctions is identical to the
methods described in Section 6.3. The resulting restriction maps
can be easily aligned with the genomic tags described in the
previous paragraph if the genomic sequence is known. Alternatively,
the sequence of the junctions can be obtained directly from these
large sequence-tagged clones (or smaller subclones comprising the
junctions and sample tags can be generated and sequenced), so the
same sample tag is used for both sequencing and physical mapping.
In this way, any rearrangements in genomic DNA flanking the
insertion elements can be quickly ascertained.
[0114] 6.4.3.2 Refining the Locations of Genomic-Tagged Insertion
Elements by Physical Mapping
[0115] An alternative method to more precisely locate the
"genomic-tagged" junctions is to employ a fractionation approach
similar to the physical mapping method described in section 6.3.
Inverse PCR, plasmid rescue and other methods can rely on cleavage
of genomic DNA at well defined locations. Restriction enzymes are
usually employed though other methods exist for cutting DNA at
defined sites. See Szybalski (1997) for a review of some other
methods. The distance between the cleavage site and the integration
event determines the length of the rescued DNA fragment.
Consequently, if the distance between the genomic tag and the
cleavage site is known, then knowledge of the size of the rescued
DNA will more precisely position the site of the insertion element.
Preferably, the genome is sequenced before performing this analysis
to simplify the choice of genomic tags near cleavage sites.
[0116] The size of the rescued DNA is readily determined.
Genomic-tagged junctions are prepared from the cell clones and
separated by size (for example by gel electrophoresis or
chromatography). Fractions are collected and the junctions in each
fraction are amplified and labeled with the same (or nearby)
primers that first were used to amplify the DNA. The genomic-tagged
amplicons in each fraction are separately hybridized to an array of
tag complements. The hybridization patterns can be deconvoluted as
described above for the physical mapping method to determine the
fragment size. Note that the genomic tags will be present in only a
small subset of fractions since only one fragment size per genomic
tag is present in the collection. Of course, inclusion of the
appropriate size standards before fractionation will increase
accuracy.
[0117] In the embodiment described above, the entire length of DNA
between the cleavage site and the insertion element is hybridized
to the array. This requirement limits the range of detectable
integration events from a particular cleavage site. If the genomic
tag is located within several hundred base pairs, more preferably
within one to twenty base pairs of the cleavage site, then it is
possible to determine the location of integration events many
thousands of base pairs from the cleavage site. Similar to the
methods above, the collection of integration events is pooled in a
standard fashion such as a 3-dimensional scheme. Genomic DNA in the
neighborhood of the insertion element is rescued from the subpools
by a method appropriate to larger DNA fragments (e.g., plasmid
rescue, see above section 6.3). The genomic DNA can be rescued so
that the cleavage site is juxtaposed to a known sequence, such as
one end of the insertion element or an adapter. Alternatively, DNA
can be rescued from the subpools, then cut at the cleavage site and
joined to a known sequence. In either case, a defined sequence is
joined to the cleavage site therefore a defined sequence is close
to the genomic tag. Now the genomic tag sequences can be amplified
by any standard method for amplifying DNA at vector-insert
junctions. Representative approaches are disclosed by Swensen
(1996); Huang (1997); Ogilvie et al. (1996); Wu et al. (1996). The
amplified genomic tags are hybridized to an array of tag
complements and the spatial addresses are determined as above.
[0118] More precise positional information can be obtained by
determining the length of the DNA fragment that separates the
cleavage site from the insertion element. Large fragments
comprising the junctions are rescued from the pooled collection of
cell clones using the same method that was previously applied to
the subpools (alternatively, the rescued DNA from all the subpools
can be combined into one pool. A defined sequence is joined to the
cleavage site (near the genomic tag as described above) and the
rescued DNA is linearized, preferably at a restriction site very
near the junction for example a site engineered into the insertion
element. The end result is a collection of linear molecules. Each
molecule has a defined sequence near the genomic tag at one end and
some insertion element sequence at the opposite end. Of course,
other DNA fragments may be generated during this process, but they
are not joined to genomic tags. Now this collection of linear
molecules can be fractionated by size. The genomic tags in each
fraction are amplified and labeled as above. Finally the genomic
tags are hybridized to an array of tag complements and the size of
each linear molecule is deconvoluted from this data.
[0119] Further resolution of the positions of vector integration
may be achieved by performing a partial restriction digest on the
collection of linear molecules. The analysis is identical to that
described in section 6.3 with the exception that tagged amplicons
are generated using a vector-insert junction amplification
protocol. Restriction mapping has the advantage that the distance
between the integration site and other, closer cleavage sites will
be known. In addition, comparison of the restriction map to the
genomic restriction map will uncover any DNA rearrangements that
may have occurred during any step of the procedure.
6.5 Sample Tags
[0120] Sample tags used in the analysis of sample polynucleotides
fall into two main classes: adapter tags and genomic tags. In
general, adapter tags are joined to the sample polynucleotides to
practice the invention. Genomic tags comprise sequence elements
that are contained in the sample polynucleotides in their natural
state prior to practicing the invention (e.g., the sample tag
comprises cDNA or genomic DNA). Of course, one skilled in the art
will recognize sample tags can be a combination of adapter and
genomic tags, indeed many genomic tags will comprise additional
sequences joined to the sample polynucleotide to practice the
invention (for example, to facilitate amplification of the genomic
tags). Genomic tags are particularly useful to position certain
insertion elements, as described above. Genomic tags may also
substitute for adapter tags in the sequencing and physical mapping
embodiments.
[0121] 6.5.1 Designing Tags
[0122] A preferred form of adapter tag is shown in FIG. 1a. A
variable, or distinct sequence element 12 is flanked on both sides
by common sequence elements 10 and 14. The distinct element is used
to identify the sample polynucleotide. The common elements, which
are shared by many sample tagged polynucleotides, are used as
priming sites to amplify the sample tag. Methods for designing the
distinct sequence elements are well known in the art. For example,
Brenner (1997b) teaches how to use a simple algorithm to choose
suitable tags.
[0123] In vitro selections can be employed to create a pool of
sample tags. Montgomery (1998) and Fodor et al. (1995) teach
methods for making arrays with oligonucleotides of any sequence.
Consider an array of 1000 or more oligonucleotides wherein each
oligonucleotide comprises a distinct element flanked on both sides
by common elements. In addition, the common elements contain the
recognition sequence for a restriction enzyme that cuts at or near
the two junctions of the distinct and common sequence elements.
Now, the distinct elements can be PCR amplified from the array by
priming at the common elements (DNA polymerases are known to
function on arrays, see Bulyk et al., 1999). A label (e.g.,
fluorescein) can be incorporated into the amplicon. The common
elements are separated from the distinct elements by cleaving the
amplicons with the restriction enzyme. An affinity moiety (e.g.,
biotin) can be included in the PCR primers to facilitate affinity
separation of the common elements (and uncleaved amplicons) from
the distinct elements. These distinct elements are hybridized to
the array. Alternatively, the common elements do not have to be
removed from the amplicons if the hybridization is to a second
array of oligonucleotides comprising only the distinct sequence
elements and not the common elements. Only those sequences that
produce strong hybridization signals in this assay are chosen as
sample tags. For example, a second array with only the chosen
sequences can be synthesized as above. The tags are amplified from
the array and joined directly to sample polynucleotides or the tags
are cloned into vectors for subsequent manipulations.
[0124] A variation of the above in vitro selection is possible. In
this example, the distinct sequence elements are randomly
synthesized on a DNA synthesizer (e.g., ABI Model 394). For
instance, all possible 20 base oligonucleotides can be synthesized
at one time by programming the synthesizer to incorporate all four
bases at each position. The mixture of random oligonucleotides is
cloned into a vector, and a random subset of 1000 or more clones is
chosen for further analysis. Now the distinct sequence elements can
be amplified by priming in the vector sequences on either side of
the distinct element. It is possible to select for optimal adapter
tags by denaturing the amplicons and selecting for rapidly
renaturing distinct sequence elements. For example, the renatured
amplicons can be treated with a single-strand specific endonuclease
(e.g., Mung Bean Nuclease or S1 nuclease) to destroy mismatched
duplexes and single-strand DNA. Surviving DNA can be reamplified
and cloned or subjected to another round of selection. Other
selections are possible. For example, the amplicons can be designed
as above where the PCR primers contain an affinity moiety (e.g.,
biotin) and the common sequence elements contain restriction enzyme
recognition sites near the junctions of the common and distinct
sequence elements. The affinity moiety is used to bind the tags to
a solid support. The restriction sites are used to ligate the
distinct sequence elements to a different vector or adapter thereby
replacing the first set of common sequences with a second set. The
distinct sequence elements are PCR amplified with a second pair of
primers specific to the second set of common sequence elements. The
resulting amplicon is hybridized to the first amplicon bound to the
solid support. Unhybridized strands are washed away and hybridized
strands are denatured and reamplified with the second pair of
primers.
[0125] The random tag selections described above yield populations
of sample tags with distinct sequence elements of unknown sequence.
These sample tags may be used to make arrays by spotting (see
Brown, 1998) or as outlined below, to make arrays wherein the tag
is a "place holder". Therefore the sequence of the sample tags need
not be determined. However, to utilize arrays made according to the
methods of Fodor et al. (1995) or Montgomery (1998), the sequence
of the tags must be determined. Of course, each tag could be
individually cloned and sequenced. A more preferred method is
simply to join the first set of tags of unknown sequence to a
second set of tags and sequence the first set in parallel according
to the method of this invention. That is, the first tags are the
sample sequence elements with respect to the second tags. By
repeating the process, one set of tags can be used to construct a
larger set of tags.
[0126] In some embodiments, sample tags may be larger than the
synthetic oligonucleotides described above. For example,
restriction mapping may be performed on sample polynucleotides that
are hundreds of kilobases in size. Consequently, large sample tags
even greater than one kilobase can be tolerated. A simple way to
construct a collection of sample-tagged vectors for cloning
sample-tagged polynucleotides is to clone into a vector a random
collection of fragments from genomic DNA (or normalized mRNA). Each
random fragment (and in some cases flanking vector DNA) serves as a
sample tag. Sample polynucleotides are cloned into the collection
of sample-tagged vectors. Arrays may be constructed by separately
PCR amplifying and spotting the random fragments in the vector.
Also commercially available arrays may be used. For example,
Affymetrix sells arrays of oligonucleotides that hybridize to yeast
(S. cerevisiae) DNA and mRNA. In this case, one tag made from yeast
sequences may hybridize to multiple different oligonucleotides in
the array.
[0127] 6.5.2 Multiple Sample Tags Per Sample Polynucleotide
[0128] In some embodiments, it is useful to join more than one
sample tag to a polynucleotide. For example, sequence information
or a restriction map may be obtained from both ends of a sample
polynucleotide. Consider a "dual tag" vector that comprises two
different tags on either side of a cloning site into which the
sample polynucleotide is inserted. Of course, a collection of these
vectors could be constructed one at a time, but this method is too
time-consuming to construct large sets of dual-tag vectors.
Individual sample tags, selected as described above, can be
synthesized as pairs in an array, for example by the method of
Fodor et al. (1995) or Montgomery, so that a cloning site separates
each pair and common sequence elements flank both sides of a pair.
The pairs of sample tags can be amplified by the common regions and
cloned into a vector to form sample-tagged vectors. Sample
polynucleotides are cloned between the pairs of sample tags at the
cloning site.
[0129] One can construct a collection of vectors with one tag as
outlined above and then randomly insert a second collection of tags
into this collection of sample-tagged vectors. However, information
about the relationship between the two tags is useful (i.e., which
tags are in the same vector). In this way, information derived from
opposite ends of the same sample polynucleotide can be related. A
simple way to relate the two set of tags is to use one set to
sequence the other set according to the method of this invention.
Naturally, the random distribution of the second set of tags means
a one-to-one relationship between tags in the two sets will not
always exist. This problem is minimized by working with two large
collections of tags and choosing a smaller collection of dual-tag
vectors. For example, the two collections of tags may each contain
10 million distinct tags. After randomly joining the two
collections, a million dual-tag vector clones can be chosen
randomly, in which case more than 80% of the dual-tag vectors will
comprise two tags that can uniquely identify each other.
[0130] Another method to obtain data from both ends of a sample
polynucleotide employs the vector design in FIG. 3. Site 70
represents the recombination site for a site-specific recombinase
(for example, a lox site where cre recombinase acts or a FRT site
where FLP recombinase acts), and the orientation of the site is
represented by the direction of the arrow. The common elements 60,
64 and 68 are present in all the sample-tagged clones, whereas the
distinct element 62 uniquely corresponds to the sample sequence
element 66. Sample tag A for analyzing one end of sample 66
comprises the following sequence elements: 60, 62, 70 and 64.
Sample tag A can be PCR amplified with primers 80 and 82. Sample
tag B for analyzing the opposite end of sample 66 comprises 60, 62,
70 and 68. Sample tag B can be PCR amplified with primers 80 and
84. The tags are identified by hybridizing the amplicons to tag
complements comprising at least part of the distinct element 62.
Notice sample tag B does not exist until the sample-tagged clones
are exposed to the site specific recombinase. After exposure to the
recombinase, the population of sample-tagged clones can contain
approximately equal amounts of the sample tag A and B forms. The
invention is practiced on this mixture, for example, the clones can
be sequenced with primer 80. Only one set of tags (either sample
tag A set or sample tag B set) is amplified at a time. In this way,
the same distinct sequence element 62 is used to obtain data from
both ends of the sample 66. The collection of sample-tagged vectors
can be constructed as outlined above for "single-tag" vectors.
[0131] Three or more sample tags can be used to analyze a sample
polynucleotide. For example, sample-tagged transposons can be used
to randomly insert multiple sample tags in vitro or in vivo (see
Strathmann et al., 1991; Craig, 1996, Smith et al., 1995).
6.6 Separating and Fractionating Tagged Reaction Products
[0132] Numerous methods exist for separating nucleic acids by size,
for example, chromatography (e.g., Bloch, 1999; Gjerde, 1999;
Thayer et al., 1996; Hearn, 1991), electrophoresis and "Time of
Flight" separations based on charge to mass ratios (e.g.,
MALDI-TOF). Different methods resolve DNA fragments in different
size ranges and will be appropriate to different embodiments of the
invention. It is clear to one skilled in the art that any method of
separation can be used which resolves fragments in the appropriate
size range and permits collecting the fragments in a form
compatible with subsequent amplification and/or hybridization to an
array.
[0133] A preferred method of separation is gel electrophoresis.
Agarose is a preferred gel matrix for separating nucleic acid
fragments that differ in size by tens to thousands of bases.
Polyacrylamide is a preferred gel matrix when single-base
resolution is required such as sequencing embodiments.
Electrophoresis may be performed in, for example, slab gels and
capillaries.
[0134] Fractionation simply entails collecting the DNA fragments in
one size range away from the DNA fragments in other size ranges.
For example, a gel containing electrophoresed DNA fragments can be
physically sliced into sections perpendicular to the direction of
electrophoresis, and the DNA fragments can be removed from each
slice by several means (e.g., .beta.-agarase digestion,
electroelution, etc. see Ausubel et al., 1997). Andersen (1998)
describes an apparatus for electroeluting and collecting separated
molecules from a gel en masse, without slicing the gel.
Alternatively, the DNA fragments can be collected as they
electrophorese through the end of the gel. The fragments may be
collected onto ionized paper or simply collected in separate
containers (see for example Beck, 1993; Richterich et al., 1993; Xu
et al., 1997; Wong, 1999; Mills, 1993; Karger, 1996; Kambara, 1996;
Israel, 1976).
[0135] Chromatography (e.g., HPLC) can be performed with
computer-controlled instruments such that eluting DNA fragments are
automatically collected in separate containers for further analysis
(Weston, 1997; Bloch, 1999).
6.7 Amplifying Tags
[0136] A critical element of the invention is the ability to
amplify tags before and/or after hybridization to the array.
[0137] 6.7.1 Amplification Prior to Hybridization
[0138] Amplification of tagged reaction products can generate
tagged amplicons with much lower sequence complexity. Consequently,
there is more material to perfectly hybridize to the tag
complements and there is much less material to cross-hybridize to
the tag complements. Both factors contribute to improving the
signal to noise ratio (i.e., sensitivity) of hybridization to the
array of tag complements. More copies of each tag will drive the
hybridization kinetics, which allows more tags to be analyzed in
each hybridization reaction. The lower complexity of material not
meant to hybridize to the array will minimize the presence of false
signals or background due to cross-hybridization.
[0139] 6.7.1.1 Adapter Tags
[0140] The adapter tags shown in FIG. 1a are easily amplified by
the preferred method of the polymerase chain reaction with primer
18 and primer 20. Other methods of in vitro amplification will also
work, for example 3SR and related methods (e.g. Gingeras et al.,
1988; Kwoh et al., 1989; Gebinoga et al., 1996), Strand
Displacement Amplification (Walker et al, 1992 & 1993) and
rolling circle amplification (Lizardi et al., 1998; Zhang et al.,
1998). Linear amplification methods can be used. For example, one
of the common regions may encode a promoter for an RNA polymerase
(e.g., T7, T3 and SP6), and in vitro transcription will amplify the
tag. A "one-sided" PCR reaction in which one primer is in excess
over the other primer ultimately will produce a linear
amplification of the tag. One could even amplify the tags with more
traditional recombinant DNA methods involving cloning the tags into
a vector and passaging the clones through a host such as E.
coli.
[0141] The in vitro methods of amplification can produce
double-stranded amplicons. To maximize hybridization to tag
complements, one strand of the amplicon may be removed prior to
hybridization to the array. For example an affinity moiety, such as
biotin, may be incorporated in one of the primers. The amplicon can
be denatured and the biotin-containing strand removed with
streptavidin coated beads (e.g. Mitchell et al., 1989). Enzymatic
methods also may be used to remove one of the strands. For example
lambda exonuclease preferentially degrades DNA with a 5'-phosphate
group. By incorporating a 5'-phosphate in only one of the primers,
only one strand of the amplicon will be degraded (see Ausubel et
al., 1997; Takagi et al., 1993).
[0142] Other modifications to the amplicon may facilitate
hybridization. The common sequence elements 10 and 14 depicted in
FIG. 1a, can be removed from the amplicons prior to hybridization
by incorporating restriction enzyme recognition sequences in the
common sequence elements. By choosing enzymes that cleave outside
their recognition sequences (e.g., BsrDI, BsmBI, etc.), it is
possible to completely separate the common sequence elements from
the distinct element 12 by cutting the amplicons with the
enzymes.
[0143] 6.7.1.2 Genomic Tags
[0144] Genomic Tags are not as easily amplified as adapter tags
because in some embodiments, common sequence elements cannot be so
readily designed to flank both sides of the distinct genomic
sequence element in the sample-tagged polynucleotide. Consider a
genomic tag consisting of a common sequence element shared by other
sample-tagged polynucleotides and an adjacent sequence element from
the sample polynucleotide. Amplifying the genomic tag is analogous
to amplifying the DNA at a vector-insert junction. Representative
approaches are disclosed by Riley et al. (1990), Lagerstrom et al.
(1991), Kere et al. (1992) and Liu et al. (1995). Inverse PCR
(Silver et al., 1991) is a simple method to provide a second common
sequence element for amplification of the genomic tag by PCR.
Double-stranded tagged reaction products are cut with a restriction
enzyme and ligated under conditions that promote circularization.
Now the first common sequence flanks both sides of the distinct
sequence element provided by the sample polynucleotide. Of course,
not all embodiments of this invention yield double-stranded
reaction productions (for example, some sequencing embodiments) so
the reaction products first must be converted to the duplex form.
Synthesis of the complementary strand can be achieved in vitro with
small random primers and a DNA polymerase (e.g., T4 DNA polymerase,
the Klenow fragment, etc.). Alternatively, T4 RNA ligase can
circularize single stranded DNA and RNA.
[0145] Another method to provide a second common sequence element
entails engineering a restriction enzyme site in the first common
sequence element. Certain restriction enzymes cleave well away from
their recognition sequence (e.g., Bpm I, Bsg I, Mme I, etc.). These
enzymes can cut up to 20 base pairs into the sample sequence
elements. The second common sequence element can be ligated as an
adapter to the cleaved reaction products. Prior to amplification,
the genomic tags can be purified from other ligation products by,
for example, denaturation, followed by hybridization to a solid
support-bound oligonucleotide that is complementary to the first
common sequence.
[0146] Vector-insert junctions are routinely amplified by providing
the second common sequence element during a random priming event. A
first oligonucleotide of known sequence (the primer oligo),
sometimes coupled to random bases at the 3'-end, is used to prime
DNA synthesis after denaturation of double-stranded DNA. If the
primer oligo initiates DNA synthesis near the vector junction
(i.e., near the first common sequence element), then the junctions
(i.e., genomic tags) can be amplified by PCR with the primer oligo
and an oligonucleotide complementary to the vector. A variation of
this strategy for amplifying short genomic tags entails tethering
the primer oligo to the first common sequence element. The local
concentration of the primer oligo becomes very high near the
genomic tag, which means the random priming event is likely to
occur very close to the tag. The tethering event can be
accomplished by first tethering the primer oligo to a second
oligonucleotide that is complementary to the first common sequence
element. The two oligonucleotides may contain a biotin moiety and
they are coupled by a streptavidin "bridge." Hybridization of the
second oligonucleotide to the first common sequence element serves
to tether the primer oligo to this region. Of course, other
functionally equivalent methods to tether two oligonucleotides can
be used to practice this embodiment.
[0147] 6.7.2 In Situ Amplification
[0148] Tagged reaction products may be amplified after
hybridization to the array. The amplicons must remain tightly
associated with the hybridized products from which they are
derived. This association may be maintained by a physical coupling
of the reaction products and amplicons (e.g., rolling circle
amplification) or diffusion of the amplicons can be restricted.
[0149] Several methods have been described for in situ
amplification. Lizardi (1998) and Zhang et al. (1998) disclose
methods employing rolling circle replication and strand
displacement. For example, consider a linear tagged reaction
product with a tag comprising a common sequence element at the
5'-end of the reaction product flanked by a distinct sequence
element. The tag complement, to which the reaction product is
hybridized, consists of an oligonucleotide complementary to the
distinct element. Another oligonucleotide, complementary to the
common element with an additional sequence element at the 3'-end,
may be hybridized to the common element, then ligated to the tag
complement. The additional 3'-overhanging sequence element can
prime rolling circle replication from a closed circular DNA
molecule provided in solution. The amplicons are covalently coupled
to the tag complement.
[0150] Obvious variations are possible, for example, the tagged
reaction product may possess the common element at the 3'-end, in
which case rolling circle replication may be primed directly from
this sequence element. In addition, Lizardi et al. (1998) describe
the use of oligonucleotides with reversed backbones capable of
hybridizing to the common sequence element while providing an
overhanging 3'-end that can prime rolling circle replication. The
reverse-backbone oligonucleotide may be hybridized to the common
element, then ligated as above to the tag complement, allowing the
rolling circle replication products to be covalently coupled to the
tag complement. The tagged reaction product itself may be
circularized prior to hybridization to the array. In this case, the
tag complement may prime rolling circle replication directly from
this circular substrate.
[0151] Adams et al. (1997) describe a method for in situ
amplification in which two primers for PCR are attached to a solid
support. Consider the tagged reaction product described above, in
which the tag consists of a common element at the 5'-end followed
by a distinct element. The array comprises oligonucleotide tag
complements, coupled to a solid support at their 5'-end in
addressable locations and a common oligonucleotide identical in
sequence to the common region, distributed throughout the array.
Assuming only the non-complementary strand of the common sequence
element is present in the hybridization reaction, the reaction
product can only hybridize at the tag complement. A subsequent
polymerization reaction will extend the tag complement into the
common sequence element. The resulting extension product can be
amplified in situ by PCR according to the method of Adams et al.
(1997).
[0152] Chetverin et al. (1997) and Church (1999) describe methods
for amplifying nucleic acids in an immobilized medium to generate
discrete "colonies" of amplicons. This method can be applied to the
present invention by adding the immobilization media to the array,
for example after hybridization of the tagged reaction products.
Church describes a method to attach the nucleic acids to the
immobilization media with a polymerization reaction that is primed
by a complementary oligonucleotide already attached to the media
(see Khrapko et al. (1996) and Kenney et al. (1998) for other
methods of attaching oligonucleotides to agarose and polyacrylamide
membranes). Amplification is performed using 3SR (Gingeras, 1988)
in which the oligonucleotides encode the promoter for an RNA
polymerase (e.g., T7). Amplification occurs exponentially in a
reaction that couples transcription, reverse transcription and
second-strand synthesis. In a preferred embodiment, the
oligonucleotide bound to the immobilization media does not encode
the promoter. A second oligonucleotide that encodes the promoter is
free to diffuse throughout the media. In this way, a "one-sided"
3SR reaction is performed on the immobilized nucleic acid. The
bound oligonucleotide hybridizes to the newly synthesized
transcripts, which limits diffusion and primes reverse
transcription, thereby producing exponential amplification.
6.8 The Array
[0153] Preferably, detection of hybridization information takes
place at spatially discrete locations where tags hybridize to their
complements. It is important that the detection of signals from
different fractions or pools be associated with tag complement
locations that can be identified throughout the procedure.
Otherwise, the sequence of signals will not be a faithful
representation of the mobility and/or spatial address of the
polynucleotide fragments corresponding to the tag and tag
complement. This requirement is met by providing a spatially
addressable array of tag complements. For some embodiments,
knowledge of the identity of a tag complement is not crucial; it is
only important that its location be identifiable from one
hybridization to another. Preferably, the regions containing tag
complements are discrete, i.e., non-overlapping with regions
containing different tag complements, so that signal detection is
more convenient. Generally, spatially addressable arrays are
constructed by attaching or synthesizing tag complements on solid
phase supports. Solid phase supports for use with the invention may
have a wide variety of forms, including microparticles, beads, and
membranes, slides, plates, micromachined chips, and the like.
Likewise, solid phase supports of the invention may comprise a wide
variety of compositions, including glass, plastic, silicon,
alkanethiolate-derivatized gold, cellulose, low cross-linked and
high cross-linked polystyrene, silica gel, polyamide, and the like.
Preferably, either a population of discrete particles is employed
such that each particle has a uniform coating, or population, of
complementary sequences of the same tag (and no other), or a single
or a few supports are employed with spatially discrete regions each
containing a uniform coating, or population, of complementary
sequences to the same tag (and no other). In the latter embodiment,
the area of the regions may vary according to particular
applications; usually, the regions range in area from several
.mu.m.sup.2, e.g., 3-5, to several hundred .mu.m.sup.2, e.g.,
100-500.
[0154] Tag complements are preferably polynucleotides, and they may
be used with the solid phase support that they are synthesized on,
or they may be separately prepared and attached to a solid phase
support for use, e.g., as disclosed by Lund et al. (1988);
Albretsen et al. (1990); Wolf et al. (1987); Ghosh et al. (1987);
or Brown et al. (1998). Preferably, tag complements are synthesized
on and used with the same solid phase support, which may comprise a
variety of forms and include a variety of linking moieties. Such
supports may comprise microparticles or arrays, or matrices, of
regions where uniform populations of tag complements are
synthesized. A wide variety of solid supports may be used with the
invention, including supports made of controlled pore glass (CPG),
highly cross-linked polystyrene, acrylic copolymers, cellulose,
nylon, dextran, latex, polyacrolein, and the like, disclosed in the
following exemplary references: Mosbach (1976); Rembaum et al.
(1977); Rembaum (1983 & 1987); and Pon (1993). Solid supports
further include commercially available nucleoside-derivatized CPG
and polystyrene beads (e.g., available from Applied Biosystems,
Foster City, Calif.); derivatized magnetic beads; polystyrene
grafted with polyethylene glycol (e.g., TentaGelO, Rapp Polymere,
Tubingen Germany); and the like. Selection of the support
characteristics, such as material, porosity, size, shape, and the
like, and the type of linking moiety employed depends on the
conditions under which the tags are used. Exemplary linking
moieties are disclosed in Pon et al. (1988); Webb (1987); Barany et
al. (1993); Damha et al. (1990); Beattie et al., (1993); Maskos et
al. (1992); and the like. When tag complements are attached or
synthesized on microparticles, populations of microparticles are
fixed to a solid phase support to form a spatially addressable
array as disclosed in Brenner (1997a, 1998b)
[0155] As mentioned above, tag complements also may be synthesized
on a single (or a few) solid phase support[s] to form an array of
features uniformly coated with tag complements. That is, within
each feature in such an array the same tag complement is
synthesized. Techniques for synthesizing such arrays are disclosed
in Fodor et al. (1995); Pease et al. (1994); Southern (1997);
Maskos et al. (1992); Southern et al. (1992); Maskos et al. (1993);
Weiler et al. (1997); Montgomery (1998); and Singh-Gasson et al.
(1999).
[0156] The invention may be implemented with microparticles or
beads uniformly coated with complements of the same tag sequence.
Microparticle supports and methods of covalently or noncovalently
linking oligonucleotides to their surfaces are well known, as
exemplified by the following references: Beaucage et al. (1992);
Gait (1984); and the references cited above. Generally, the size
and shape of a microparticle is not critical; however,
microparticles in the size range of a few, e.g., 1-2, to several
hundred, e.g., 200-1000 .mu.m diameter are preferable, as they
facilitate the construction and manipulation of large repertoires
of oligonucleotide tags with minimal reagent and sample usage.
[0157] Church (1999) discloses a method for preparing a
randomly-patterned array of polynucleotides, using in situ
amplification methods. In a preferred embodiment, the
polynucleotides are amplified in situ using the "one-sided" 3SR in
situ reaction described above.
[0158] Arrays of fixed microparticles and arrays prepared by other
means may be replicated according to the methods of Cantor et al.
(1998) or Church (1999). In this way, even an array comprising
randomly patterned tag complements of unknown sequence may be
effectively utilized in some embodiments of this invention. Of
course, a single array may be utilized many times, but there is
always a limit. The ability to replicate a randomly patterned array
relieves the experimental constraints of this limit, permitting for
example hundreds of bases to be sequenced (requiring hundreds of
hybridizations to the array of tag complements) according to the
method of this invention.
[0159] Molecules other than polynucleotides may serve as tag
complements. Gold et al. (1993 & 1995) teach methods for
selecting short polynucleotides that bind to polypeptides and small
molecules in a sequence-dependent manner. These short
polynucleotides can be utilized as tags and the molecules to which
they bind may serve as tag complements. Methods for constructing
arrays of polypeptides and small molecules are disclosed by, for
example Pirrung et al. (1995), Matson et al. (1995) and Montgomery
(1998). In addition, the spotting methods taught by Brown et al.
(1998) are readily adapted to other molecules. Methods in
combinatorial chemistry (see for example Wilson et al., 1997;
Gordon et al., 1998; Kirk et al., 1998; Still et al., 1996;
Horlbeck, 1999) can be used to construct large collections of these
molecules such that only one molecular species is attached to any
one, separate solid support (e.g., a bead). These species may be
arrayed as described above for polynucleotides. Tags that hybridize
optimally to these tag complements may be selected en masse as
described above for polynucleotide tag complements.
6.9 Detecting Hybridization to the Array
[0160] Methods for hybridizing polynucleotides to arrays of
complementary polynucleotides are well known in the art. See for
example (Lockhart et al., 1996; Wang et al., 1988; Eisen et al.,
1999; Duggan et al., 1999; Saiki et al., 1989).
[0161] Polynucleotides hybridized to the array may be visualized in
several different ways. To facilitate detection, various methods
for labeling DNA and constructing labeled oligonucleotides are
known in the art. Representative methods include Mathews et al.
(1988), Haugland (1996), Keller et al. (1993), Eckstein (1991),
Jablonski et al. (1986), Agrawal et al. (1992), Menchen et al.
(1993), Cruickshank (1992), Urdea (1992) and Lee et al. (1999).
Labels include for example radioactive isotopes, fluorescent
compounds such as fluorescein and rhodamine, chemiluminescent
compounds, quantum dots e.g. see Bruchez et al., 1998; and Chan et
al., 1998) and mass tags e.g. Xu et al., 1997; Schmidt, 1999). The
polynucleotides may be coupled to various enzymes (e.g.,
.beta.-galactosidase, horseradish peroxidase and alkaline
phosphatase) and the enzymatic activity is detected with the proper
substrate (e.g., X-gal, DAB and BCIP, see Ausubel et al., 1997).
The label can be incorporated directly into polynucleotides, e.g.
tagged amplicons, prior to hybridization to the array. The label
may also be incorporated during an extension reaction of
polynucleotides after hybridization to the array in which either
the tag complements or the hybridized polynucleotides act as
primers for polymerase (see, for example, Pastinen et al.,
1997)
[0162] Another method to visualize a tagged polynucleotide
hybridized to its tag complement is to hybridize a third labeled
polynucleotide to the tagged polynucleotide. This third
polynucleotide may be ligated to the tag complement to increase
hybridization specificity in a reaction analogous to the
"oligonucleotide ligation reaction (OLA)", see Landegren et al.
(1988). Alternatively, "oligonucleotide stacking" effects of the
third oligonucleotide can be used to increase duplex stability, see
e.g. Lane et al. (1997).
[0163] Any imaging system can be utilized that is capable of
detecting the label or labels, with a resolution appropriate to the
size of the array features. Numerous examples of imaging apparatus
are known in the art. For example, Trulson et al. (1998), Pirrung
et al. (1992), and Dorsel et al. (1999) describe imaging systems
for fluorescent labels. Commercial apparatus are available, e.g.
ScanArray 4000 (General Scanning), Biochip Imager (Hewlett
Packard), GMS 418 Array Scanner (Genetic Microsystems), GeneTAC
1000 (Genomic Solutions), Chip Reader (Virtek). Phosphorimager
systems are available for detecting radiolabels, e.g. Cyclone
(Packard Instrument company) and BAS-5000 (Fujifilm).
6.10 Applications and uses of parallel methods for genomic
Analysis
[0164] A sequenced polynucleotide can be utilized in a variety of
ways to manipulate and discover information about biological
systems, for example expression profiling, drug discovery, gene
therapy, disease diagnosis, disease treatment, characterization of
biological circuitry and so on. For some examples and methodologies
see, Hawkins et al. (1996), Hastings et al. (1996), Guegler et al.
(1997), Wachsman et al. (1997), Popoff et al. (1997), Carraway et
al. (1997), Li et al. (1997), Au-Young et al. (1998), Hillman et
al. (1998), Wei et al. (1998), Levinson et al. (1998); Gimeno et
al. (1999), Sutcliffe et al. (1999), Wei et al. (1999), Goodearl
(1999), Kleyn et al. (1999), Lee et al. (1999), and Oin (1999)
which are hereby incorporated by reference in their entirety.
[0165] One method according to the invention includes the insertion
of a nucleic acid, the sequence of which has been determined
according to methods of the invention described above, into a
vector. The double-stranded form of the nucleic acid generally is
inserted into the vector by any of a variety of standard molecular
cloning techniques (see, e.g., Sambrook et al., 1989). The nucleic
acid can be inserted into the vector in either of the two possible
orientations: transcription of this sequence yield either a "sense"
transcript (i.e., an mRNA sequence actually produced in cells
expressing the corresponding gene) or an "antisense" transcript
(the complement of an mRNA sequence actually produced).
Conveniently, the vector is cleaved with a restriction
endonuclease, and the separated nucleic acid or fragment is ligated
into the vector at the corresponding restriction endonuclease
recognition site. In one embodiment, the nucleic acid sequence
obtained according to the invention contains all coding sequences
that encode a protein or is inserted into the vector as part of a
larger nucleic acid sequence that contains all such coding
sequences.
[0166] A wide variety of suitable vectors is available, including
vectors derived from bacterial and yeast plasmids as well as from
viruses, e.g., cosmids, plasmids, phage derivatives, and phagemids.
Examples of bacterially derived vectors include: pBS, phagescript,
PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, and pNH46a,
which are commercially available from Stratagene, and pTrc99A,
pKK223-3, pKK233-3, pDR540, and pRIT5, which are commercially
available from Pharmacia. Examples of eukaryotic vectors include:
pWLneo, pSV2cat, pOG44, PXTI, which are commercially available from
Stratagene, and pSVK3, pBPV, pMSG, and pSVL, which are commercially
available from Pharmacia. However any vector capable of replicating
in a host cell can be employed. A vector generally has a selectable
marker to ensure that the vector will be maintained in host cells.
Suitable markers include, for example, those conferring resistance
to tetracycline or ampicillin (useful in prokaryotic cells) and
neomycin (useful in eukaryotic cells).
[0167] The vector can be used simply to propagate the nucleic acid
or can be specially adapted for particular functions. Examples of
the latter include probe generation vectors and expression vectors.
An expression vector allows the expression of an amino acid
sequence encoded in a nucleic acid or fragment. Typically the
latter is operatively linked to an expression control sequence
(e.g., a promoter). The term "operatively linked" is used herein to
denote a relationship in which the expression control sequence
directs the synthesis of mRNA encoding the amino acid sequence to
be expressed. This term does not imply that the expression control
sequence is necessarily linked directly to the nucleic acid or
fragment. Any promoter known or determined to direct transcription
of prokaryotic, eukaryotic, or viral genes can be employed.
Exemplary promoters include the E. coli lac or trp promoters, the
early and late SV40 promoters, the CMV immediate early promoter,
the HSV thymidine kinase promoter, and the lambda phage P.sub.R and
P.sub.L promoters.
[0168] Expression vectors also may contain an enhancer sequence,
i.e., a "cis-acting" DNA element that acts on a promoter to
increase transcription. Exemplary enhancers include those derived
from SV40, CMV, polyoma, and adenovirus. Generally, enhancers are
located upstream of and within about 100-300 bp of the promoter.
Expression vectors can also contain splice donor and acceptor
sites, polyadenylation sites, and translation initiation and
termination sequences in appropriate phase with the coding sequence
to be expressed. A signal sequence is conveniently included if it
is not already present in the coding sequence and secretion of the
encoded polypeptide (into the culture medium or periplasmic space)
is desired. In one embodiment, an expression vector contains a
nucleotide sequence that promotes amplification of the vector in a
host cell under appropriate culture conditions (e.g., culturing in
the presence of methotrexate for vectors including the
dihydrofolate reductase gene).
[0169] In one method, a vector of the invention is introduced into
a host cell. The host cell can, for example, be a prokaryote, a
lower eukaryote (e.g., a fungal cell), or a higher eukaryote (e.g.,
a mammalian cell). Exemplary prokaryotic host cells include E.
coli, Bacillus subtilis, Salmonella typhimurium, and various
species within the genera Pseudomonas, Streptomyces, and
Staphylococcus, although a wide variety of others can be employed.
Exemplary eukaryotic cells include yeast cells and higher
eukaryotic cells such as CHO, COS, or Bowes melanoma cells. The
host cell employed varies depending on the vector, and the
selection of a suitable host cell-vector system is within the level
of skill in the art. When the vector is an expression vector, the
host cell is typically a mammalian cell, an insect cell, a plant
cell, a fungal cell (e.g., a yeast), or a bacterial cell.
[0170] A variety of host-expression vector systems may be utilized
to express the gene coding sequences of the invention. Such
host-expression systems represent vehicles by which the coding
sequences of interest may be produced and subsequently purified,
but also represent cells which may, when transformed or transfected
with the appropriate nucleotide coding sequences, exhibit the gene
product of the invention in situ. These include but are not limited
to microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with recombinant bacteriophage DNA, plasmid DNA or
cosmid DNA expression vectors containing the gene product coding
sequences; yeast (e.g., Saccharomyces, Pichia) transformed with
recombinant yeast expression vectors containing the gene product
coding sequences; insect cell systems infected with recombinant
virus expression vectors (e.g., baculovirus) containing the gene
product coding sequences; plant cell systems infected with
recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid)
containing the gene product coding sequences; or mammalian cell
systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant
expression constructs containing promoters derived from the genome
of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter).
[0171] In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the
gene product being expressed. For example, when a large quantity of
such a protein is to be produced, for the generation of
pharmaceutical compositions of the protein or for raising
antibodies to the protein, vectors which direct the expression of
high levels of fusion protein products that are readily purified
may be desirable. Such vectors include, but are not limited, to the
E. coli expression vector pUR278 (Ruther et al., 1983), in which
the gene product coding sequence may be ligated individually into
the vector in frame with the lac Z coding region so that a fusion
protein is produced; pIN vectors (Inouye et al., 1985; Van Heeke et
al., 1989); and the like. pGEX vectors may also be used to express
foreign polypeptides as fusion proteins with glutathione
S-transferase (GST). In general, such fusion proteins are soluble
and can easily be purified from lysed cells by adsorption and
binding to a matrix glutathione-agarose beads followed by elution
in the presence of free glutathione. The pGEX vectors are designed
to include thrombin or factor Xa protease cleavage sites so that
the cloned target gene product can be released from the GST
moiety.
[0172] In an insect system, Autographa californica nuclear
polyhedrosis virus (AcNPV) is used as a vector to express foreign
genes. The virus grows in Spodoptera frugiperda cells. The gene
coding sequence may be cloned individually into non-essential
regions (for example the polyhedrin gene) of the virus and placed
under control of an AcNPV promoter (for example the polyhedrin
promoter). Successful insertion of the gene coding sequence will
result in inactivation of the polyhedrin gene and production of
non-occluded recombinant virus (i.e., virus lacking the
proteinaceous coat coded for by the polyhedrin gene). These
recombinant viruses are then used to infect Spodoptera frugiperda
cells in which the inserted gene is expressed. (e.g., see Smith et
al., 1983; Smith et al., U.S. Pat. No. 4,745,051).
[0173] In mammalian host cells, a number of viral-based expression
systems may be utilized. In cases where an adenovirus is used as an
expression vector, the gene coding sequence of interest may be
ligated to an adenovirus transcription/translation control complex,
e.g., the late promoter and tripartite leader sequence. This
chimeric gene may then be inserted in the adenovirus genome by in
vitro or in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing the gene
product in infected hosts. (e.g., see Logan et al., 1984). Specific
initiation signals may also be required for efficient translation
of the inserted gene product coding sequences. These signals
include the ATG initiation codon and adjacent sequences. In cases
where an entire gene, including its own initiation codon and
adjacent sequences, is inserted into the appropriate expression
vector, no additional translational control signals may be needed.
However, in cases where only a portion of the gene coding sequence
is inserted, exogenous translational control signals, including,
perhaps, the ATG initiation codon, must be provided. Furthermore,
the initiation codon must be in phase with the reading frame of the
desired coding sequence to ensure translation of the entire insert.
These exogenous translational control signals and initiation codons
can be of a variety of origins, both natural and synthetic. The
efficiency of expression may be enhanced by the inclusion of
appropriate transcription enhancer elements, transcription
terminators, etc. (see Bitter et al., 1987).
[0174] In addition, a host cell strain may be chosen which
modulates the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired. Such
modifications (e.g., glycosylation) and processing (e.g., cleavage)
of protein products may be important for the function of the
protein. Different host cells have characteristic and specific
mechanisms for the post-translational processing and modification
of proteins and gene products. Appropriate cell lines or host
systems can be chosen to ensure the correct modification and
processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for
proper processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such mammalian
host cells include but are not limited to CHO, VERO, BHK, HeLa,
COS, MDCK, 293, 3T3, W138, and in particular, T cell lines such as,
for example, Jurkat, CTLL, HT2, Dorris, D1.1, AE7, D10.G4 and
CDC25.
[0175] The vector can be introduced into the host cell by any
effective technique, such as transformation, transfection,
infection, or transduction. Convenient transfection techniques
include calcium phosphate transfection, DEAE-dextran-mediated
transfection, and electroporation. The host cell containing the
vector then can be cultured in a conventional nutrient medium,
modified as appropriate for selecting vector-containing cells,
inducing or derepressing a promoter, and/or amplifying a vector DNA
sequence. Otherwise, the culture conditions employed, such as pH
and temperature, are those suitable for the particular host cell.
Suitable culture conditions are known to, or can be readily
determined, by those skilled in the art. If desired, vector DNA can
be prepared from a host cell culture using any of a number of
standard techniques.
[0176] A host cell containing an expression vector can be cultured
under conditions that allow expression of the encoded polypeptide.
Typically, host cells are allowed to grow to an appropriate
density, and then a promoter linked to the nucleic acid to be
expressed is induced or derepressed (e.g., by temperature shift or
chemical induction) and/or a linked enhancer is activated. The host
cells are cultured for an additional period and then harvested,
typically by centrifugation. If the expressed polypeptide was
secreted into the culture medium, the polypeptide is recovered from
the culture medium. Alternatively, if the expressed polypeptide was
retained in the host cells, the cells are disrupted by physical or
chemical means, and the polypeptide is recovered from the resulting
crude extract.
[0177] The polypeptide can be purified from the culture medium or
crude extract using standard protein purification techniques.
Suitable methods include ammonium sulfate or ethanol precipitation,
acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chomatography, affinity chomatography, hydroxylapatite
chromatography, and lectin chromatography, etc., and combinations
thereof. The purification strategy also may include a protein
refolding step to provide a polypeptide having the proper
structure. High performance liquid chromatography can be employed,
typically as one of the final purification steps. Depending on the
method of production, the polypeptide can have methionine as the
initial amino acid residue and can be glycosylated or
non-glycosylated.
[0178] In an alternative embodiment, a polypeptide is expressed by
translating an mRNA corresponding to a nucleic acid whose sequence
has been determined according to the methods of the invention in a
cell-free translation system.
[0179] The amino acid sequence of a polypeptide encoded by a
nucleic acid whose sequence has been determined according to the
methods of the invention can be compared to that of previously
characterized polypeptides to identify one or more biological
functions of the polypeptide. A comparison of the nucleotide
sequence of a selected amino acid with the nucleotide sequence of
previously characterized genes can also indicate a biological
function. Biological functions of particular interest include the
ability to bind to a ligand or a receptor, the ability to form an
ion channel, the ability to couple with a GTP-binding protein, the
ability to phosphorylate or be phosphorylated by another
polypeptide, and to otherwise modulate the activity of another
molecule that plays a role in a signal transduction pathway.
[0180] The polypeptide or a fragment thereof can be employed in a
screening assay to identify compounds and/or molecules that
stimulate (agonists) or inhibit (antagonists) the biological
function of the polypeptide. In addition, if the identified
biological function includes a binding activity, the polypeptide
can be employed in an assay to detect the presence of the binding
partner in cells or tissues.
[0181] Moreover, the polypeptide can be used to generate antibodies
that stimulate or inhibit the activity of the polypeptide or that
bind the polypeptide without affecting activity. As used herein,
the term "antibody" refers to a molecule including any
binding-competent portion of an antibody, such as, for example, a
single chain antibody or a Fab fragment. The term encompasses
molecules in which such binding competent portions are covalently
attached to other polypeptide sequences, as in dual-specificity
antibodies. An antibody specific for the polypeptide can be
polyclonal or monoclonal. Polyclonal antibodies are produced by
immunizing an animal, preferably a mammal, with the polypeptide or
an immunogenic fragment thereof and collecting the antiserum. The
antiserum can be screened for the desired binding activity, and
antibodies with undesirable cross-reactivities can be removed by
contacting the antiserum with the corresponding agent(s) and
recovering the non-bound component of the antiserum. Monoclonal
antibodies can be produced by any convenient technique, including
the hybridoma technique (Kohler et al., 1975), the trioma
technique, the human B-cell hybridoma technique (Kozbor et al.,
1983), and the EBV-hybridoma technique, which produces human
monoclonal antibodies (Cole et al., 1985). Humanized antibodies can
be produced using a transgenic animal, and single chain antibodies
can be produced as described by Ladner et al. (1990). Antibodies
that specifically bind a polypeptide encoded by a nucleic acid
whose sequence has been determined according to the methods of the
invention are useful in affinity purification of the polypeptide
and for detecting the presence of and/or quantitating the amount of
a polypeptide in a sample. For instance, antibodies can be employed
in immunohistochemistry studies to determine the localization of
the polypeptide in cells of a tissue sample. In such studies, the
polypeptide-specific antibody is labeled with a detectable label,
such as, for example, an enzyme label. The label can be attached to
the polypeptide-specific antibody directly or indirectly (e.g.,
attachment to a secondary antibody specific for the
polypeptide-specific antibody). Antibody binding generally is
detected by adding a substrate for the enzyme and detecting
conversion of the substrate to a product, usually via a color
change.
[0182] In yet another embodiment of the invention, sequences
determined according to the method of the invention may be used to
design probes useful for detecting the presence of a nucleic acid
sequence complementary to the probe sequence. The detection of such
sequences can provide the basis of diagnostic tests, or
alternatively, may be useful for basic research purposes. Such
probe sequences may be synthesized using a commercially available
nucleic acid synthesizer, such as the ABI Model 394 or may be
generated from restriction fragments of the cloned library element
from which the sequence was determined, and sub-cloning the
restriction fragment into a probe vector such as, e.g., pBluescript
SK (Stratagene), pSP72 (Promega), M13mp18 (New England Biolabs) and
the like. The cloned library element from which the sequence was
determined may be recovered by a variety of methods, including
probing the library with the tag sequence corresponding to the
desired sequence, or immobilizing the tag sequence (or its
complement) on a solid support, and hybridizing the library with
the solid support to specifically recover the desired library
element. Such methods are well known in the art, see e.g. Ausubel
(1997) and Brenner (1997a). In addition, multiple probes may be
arrayed (e.g. Brown, 1998) or may be synthesized as
oligonucleotides in an array (e.g. Fodor et al., 1995) as described
above in section 6.8.
[0183] Sequences determined according to the method of the
invention also may be used to design primers for amplification of
nucleic acid molecules via methods such as, e.g., PCR. Designing
PCR primers from known sequences is well within the art. Relevant
considerations are discussed in, e.g., Dieffenbach et al. (1995)
and Innis et al. (1990). PCR, using primers designed from sequences
determined according to the method of the invention, may be used as
the basis of a diagnostic test to determine the presence of a
nucleic acid sequence in a sample, or, alternatively, simply to
provide large quantities of nucleic acid for other uses.
[0184] 6.10.1 Polynucleotide Homologs
[0185] Another method according to the invention involves
identifying polynucleotides that are homologous at the nucleotide
or encoded amino acid level to a parent polynucleotide or parent
gene sequenced by the methods described above. Homologs may be
isolated from the same species as the parent polynucleotide or from
a different species. Homologs may not occur naturally, but instead
they may be constructed from the parent polynucleotide by random or
site-directed mutagenesis as described below. By definition the
parent polynucleotide is a homolog of itself.
[0186] A highly homologous, polynucleotide preferably exhibits at
least about 80% overall similarity at the nucleotide level to the
parent polynucleotide, more preferably exhibits at least about
85-90% overall similarity, and most preferably exhibits at least
about 95% overall similarity to the parent polynucleotide. However,
because of the degeneracy of the genetic code, two polynucleotides
that encode highly homologous polypeptides may not necessarily
exhibit extensive similarity at the nucleotide level. In
particular, site directed mutagenesis can be used to produce two
polynucleotides that encode the same polypeptide, but share less
than 67% similarity at the nucleotide level.
[0187] Homologous polynucleotides, exhibiting extensive homology to
one or more domains of the parent polynucleotide can be identified
and readily isolated, without undue experimentation, by molecular
biological techniques well known in the art. Further, there can
exist homologous genes at other genetic loci within the genome that
encode proteins which have extensive homology to one or more
domains encoded by a parent gene. These genes can also be
identified via similar techniques. Still further, there can exist
alternatively spliced variants of the parent gene.
[0188] As an example, in order to clone a human gene homolog or
variants using a sequenced murine polynucleotide, the murine
polynucleotide or sequence element is labeled and used to screen a
cDNA library constructed from mRNA obtained from appropriate cells
or tissues derived from the organism (in this case, human) of
interest. The hybridization and wash conditions used should be of a
low stringency when the cDNA library is derived from a different
type of organism than the one from which the labeled sequence was
derived. Low stringency conditions are well known to those of skill
in the art, and will vary predictably depending on the specific
organisms from which the library and the labeled sequences are
derived. For guidance regarding such conditions see, for example,
Sambrook et al. (1989) and Ausubel et al. (1989).
[0189] With respect to the cloning of a human homolog, using a
murine polynucleotide, for example, various stringency conditions
which promote DNA hybridization can be used. For example,
hybridization in 6.times.SSC at about 45.degree. C., followed by
washing in 2.times.SSC at 50.degree. C. may be used. Alternatively,
the salt concentration in the wash step can range from low
stringency of about 5.times.SSC at 50.degree. C., to moderate
stringency of about 2.times.SSC at 50.degree. C., to high
stringency of about 0.2.times.SSC at 50.degree. C. In addition, the
temperature of the wash step can be increased from low stringency
conditions at room temperature, to moderately stringent conditions
at about 42.degree. C., to high stringency conditions at about
65.degree. C. Other conditions include, but are not limited to,
hybridizing at 68.degree. C. in 0.5M NaHPO.sub.4 (pH7.2)/1 mM
EDTA/7% SDS, or hybridization in 50% formamide/0.25M NaHPO.sub.4
(pH 7.2)/0.25 M NaCl/1 mM EDTA/7% SDS; followed by washing in 40 mM
NaHPO.sub.4 (pH 7.2)/1 mM EDTA/5% SDS at 50.degree. C. or in 40 mM
NaHPO.sub.4 (pH7.2) 1 mM EDTA/1% SDS at 50.degree. C. Both
temperature and salt may be varied, or alternatively, one or the
other variable may remain constant while the other is changed.
[0190] Alternatively, the labeled fragment may be used to screen a
genomic library derived from the organism of interest, again, using
appropriately stringent conditions well known to those of skill in
the art.
[0191] Further, a homologous polynucleotide may be isolated from
nucleic acid of the organism of interest by performing PCR using
two degenerate oligonucleotide primer pools designed on the basis
of amino acid sequences within the parent polynucleotide as
described by e.g. Innis et al. (1990) and Wilkie et al. (1994). The
template for the reaction may be genomic DNA or cDNA obtained by
reverse transcription of mRNA prepared from, for example, human or
non-human cell lines or tissue known or suspected to express the
polynucleotide.
[0192] The PCR product may be subcloned and sequenced to ensure
that the amplified sequences represent homologous polynucleotides.
The PCR fragment may then be used to isolate a full length cDNA
clone by a variety of methods. For example, the amplified fragment
may be labeled and used to screen a cDNA library, such as a
bacteriophage cDNA library. Alternatively, the labeled fragment may
be used to isolate genomic clones via the screening of a genomic
library.
[0193] Homologous polynucleotides of the invention further include
isolated polynucleotides which hybridize under highly stringent or
moderate stringent conditions to at least about 6, preferably about
12, more preferably about 18, consecutive nucleotides of the parent
polynucleotide. The invention also includes polynucleotides,
preferably DNA molecules, that hybridize to, and are therefore the
complements of, the parent polynucleotide. Such hybridization
conditions may be highly stringent or moderately stringent, as
described above. In instances wherein the nucleic acid molecules
are short oligonucleotides highly stringent conditions may refer,
e.g., to washing in 6.times.SSC/50 mM sodium pyrophosphate at
37.degree. C. (for 14-base oligos), 48.degree. C. (for 17-base
oligos), 55.degree. C. (for 20-base oligos), and 60.degree. C. (for
23-base oligos). These nucleic acid molecules may encode or act as
antisense molecules useful, for example, in gene regulation.
Further, such sequences may be used as part of ribozyme and/or
triple helix sequences, also useful for gene regulation. Still
further, such molecules may be used as components of diagnostic
methods whereby, for example, the presence of a particular allele
or alternatively spliced transcript responsible for a mutant
phenotype may be detected.
[0194] PCR technology may be utilized to isolate full length cDNA
sequences. For example, RNA may be isolated, following standard
procedures, from an appropriate cellular or tissue source. A
reverse transcription reaction may be performed on the RNA using an
oligonucleotide primer specific for the most 5' end of the
amplified fragment for the priming of first strand synthesis. The
resulting RNA/DNA hybrid may then be "tailed" with guanines using a
standard terminal transferase reaction, the hybrid may be digested
with RNAase H, and second strand synthesis may then be primed with
a poly-C primer. Thus, cDNA sequences upstream of the amplified
fragment may easily be isolated. For a review of cloning strategies
which may be used, see e.g., Sambrook et al. (1989) and Ausubel et
al. (1997).
[0195] 6.10.2 Expression Analysis
[0196] Quantitative and qualitative aspects of gene expression of
polynucleotides sequenced according to this invention can also be
assayed. For example, RNA from a cell type or tissue known, or
suspected, to express a gene may be isolated and tested utilizing
hybridization or PCR techniques. The isolated cells can be derived
from cell culture or from a patient. The analysis of cells taken
from culture may be a necessary step in the assessment of cells to
be used as part of a cell-based gene therapy technique or,
alternatively, to test the effect of compounds on the expression of
the gene. Such analyses may reveal both quantitative and
qualitative aspects of the expression pattern of the gene,
including activation or inactivation of gene expression and
presence of alternatively spliced transcripts.
[0197] In one embodiment of such a detection scheme, a cDNA
molecule is synthesized from an RNA molecule of interest (e.g., by
reverse transcription of the RNA molecule into cDNA). All or part
of the resulting cDNA is then used as the template for a nucleic
acid amplification reaction, such as a PCR amplification reaction,
or the like.
[0198] For detection of the amplified product, the nucleic acid
amplification may be performed using radioactively or
non-radioactively labeled nucleotides. Alternatively, enough
amplified product may be made such that the product may be
visualized by standard ethidium bromide staining or by utilizing
any other suitable nucleic acid staining method.
[0199] Such RT-PCR techniques can be utilized to detect differences
in transcript size which may be due to normal or abnormal
alternative splicing. Additionally, such techniques can be
performed using standard techniques to detect quantitative
differences between levels of full length and/or alternatively
spliced transcripts detected in normal individuals relative to
those individuals exhibiting a phenotype of interest.
[0200] In the case where detection of specific alternatively
spliced species is desired, appropriate primers and/or
hybridization probes can be used, such that, in the absence of such
sequence, no amplification would occur. Primers are chosen which
will yield fragments of differing size depending on whether a
particular exon is present or absent from the transcript being
utilized.
[0201] As an alternative to amplification techniques, standard
Northern analyses can be performed if a sufficient quantity of the
appropriate cells can be obtained. Utilizing such techniques,
quantitative as well as size related differences between
transcripts can also be detected.
[0202] Additionally, it is possible to perform such gene expression
assays "in situ", i.e., directly upon tissue sections (fixed and/or
frozen) of patient tissue obtained from biopsies or resections,
such that no nucleic acid purification is necessary. Nucleic acid
reagents such as those described in Section 6.1 may be used as
probes and/or primers for such in situ procedures (see, for
example, Nuovo, 1992).
[0203] Gene expression may also be assayed "en masse" utilizing
polynucleotide arrays (see for example Lockhardt, 1996; Schena et
al., 1995; etc.). Sequence from polynucleotides can be used to
design arrays for synthesis or to determine the identity of the
polynucleotides at any particular address in the array.
[0204] Another method to assay gene expression en masse is simply
to sequence cDNA from a cell population by the massively parallel
method described above. This technique can be coupled with a second
parallel method such as SAGE (serial analysis of gene expression,
Velculescu et al., 1995) to permit analysis of even the rarest
transcripts with a single sequencing reaction. cDNA from different
sources (for example diseased vs. normal tissue, cells with and
without drug, tissue from different developmental states, etc.) can
be compared to determine the differentially expressed genes (see
e.g. Kozian et al., 1999).
[0205] 6.10.3 Screening Assays for Compounds that Modulate the
Activity of a Gene Product
[0206] Screening assays may be designed to identify compounds
capable of interacting with, e.g., binding to, a polypeptide or
gene product that is sequenced and characterized as described
above. Methods are well known in the art, see for example Wolff
(1995), Foye et al. (1995), and Hansch et al. (1990). The following
assays are designed to identify: (i) compounds that bind to gene
products; (ii) compounds that bind to other intracellular proteins
that interact with a gene product; (iii) compounds that interfere
with the interaction of a gene product with other intracellular
proteins; and (iv) compounds that modulate the activity of a gene
(i.e., modulate the level of gene expression and/or modulate the
level of a gene product activity). Compounds may include, but are
not limited to, peptides such as, for example, soluble peptides,
and small organic or inorganic molecules. Methods for synthesizing
compounds are well known in the art. Combinatorial synthesis and
other high throughput synthesis methods as well as high throughput
screening assays have been described, see for example, Wolff
(1995), Burnbaum et al. (1999), Parce et al. (1999), Chelsky et al.
(1999); Horlbeck (1999); Devlin (1997); Venton et al. (1998); Kirk
et al. (1998); and Still et al. (1996).
[0207] Assays additionally may be utilized which identify compounds
that bind to gene regulatory sequences (e.g., promoter sequences),
see e.g., Platt (1994), which may modulate the level of gene
expression. Methods for the identification of such intracellular
proteins are described below.
[0208] Compounds identified via assays such as those described
herein may be useful, for example, in elaborating the biological
function of a gene product, and for ameliorating symptoms of
disease. It is to be noted that the invention includes methods to
identify such pharmaceutical compositions pertaining to
polynucleotides characterized according to the invention. Such
pharmaceutical compositions can be formulated, for example, as
discussed below.
[0209] 6.10.4 In Vitro Screening Assays for Compounds that Bind to
a Gene Product
[0210] In vitro systems may be designed to identify compounds
capable of interacting with, e.g., binding to, a polypeptide that
is sequenced and characterized according to this invention.
Compounds identified may be useful, for example, in modulating the
activity of wild type and/or mutant gene products, may be useful in
elaborating the biological function of the a gene product, may be
utilized in screens for identifying compounds that disrupt normal
gene product interactions, or may in themselves disrupt such
interactions.
[0211] The principle of the assays used to identify compounds that
interact with a gene product involves preparing a reaction mixture
of the gene product and the test compound under conditions and for
a time sufficient to allow the two components to interact with,
e.g., bind to, thus forming a complex, which can represent a
transient complex, which can be removed and/or detected in the
reaction mixture. These assays can be conducted in a variety of
ways. For example, one method to conduct such an assay would
involve anchoring a gene product or the test substance onto a solid
phase and detecting the gene product/test compound complexes
anchored on the solid phase at the end of the reaction. In one
embodiment of such a method, the gene product may be anchored onto
a solid surface, and the test compound, which is not anchored, may
be labeled, either directly or indirectly.
[0212] In practice, microtiter plates may conveniently be utilized
as the solid phase. The anchored component may be immobilized by
non-covalent or covalent attachments. Non-covalent attachment may
be accomplished by simply coating the solid surface with a solution
of the protein and drying. Alternatively, an immobilized antibody,
preferably a monoclonal antibody, specific for the protein to be
immobilized may be used to anchor the protein to the solid surface.
The surfaces may be prepared in advance and stored.
[0213] In order to conduct the assay, the non-immobilized component
is added to the coated surface containing the anchored component.
After the reaction is complete, unreacted components are removed
(e.g., by washing) under conditions such that any complexes formed
will remain immobilized on the solid surface. The detection of
complexes anchored on the solid surface can be accomplished in a
number of ways. Where the previously non-immobilized component is
pre-labeled, the detection of label immobilized on the surface
indicates that complexes were formed. Where the previously
non-immobilized component is not pre-labeled, an indirect label can
be used to detect complexes anchored on the surface; e.g., using a
labeled antibody specific for the previously non-immobilized
component (the antibody, in turn, may be directly labeled or
indirectly labeled with a labeled anti-Ig antibody).
[0214] Alternatively, a reaction can be conducted in a liquid
phase, the reaction products separated from unreacted components,
and complexes detected; e.g., using an immobilized antibody
specific for the gene product or the test compound to anchor any
complexes formed in solution, and a labeled antibody specific for
the other component of the possible complex to detect anchored
complexes.
[0215] 6.10.5 Rational Design of Compounds that Interact with a
Gene Product
[0216] The 3-dimensional structure of a gene product can be
determined empirically using techniques such as crystallography
(see for example, McRee, 1999; Drenth, 1999) and NMR (see for
example, Cavanagh et al., 1996; Krishna et al., 1999). In some
cases, the structure can be predicted from the primary amino acid
sequence by homology comparisons to known structures.
[0217] Knowledge of the 3-dimensional structure permits rational
design of compounds that may interact with and influence the
activity of the gene product, see for example Veerapandian (1995);
Martin (1989); Keseru et al. (1999); Weiner, D. B. et al. (1994),
and Weiner, D. B. et al. (1995).
[0218] 6.10.6 Assays for Intracellular Proteins that Interact with
a Gene Product
[0219] Any method suitable for detecting protein-protein
interactions may be employed to identify intracellular proteins
that interact with a gene product characterized according to the
method of this invention. Among the traditional methods which may
be employed are co-immunoprecipitation, crosslinking and
co-purification through gradients or chromatographic columns.
Utilizing procedures such as these allows for the isolation of
intracellular proteins which interact with gene products. Once
isolated, such an intracellular protein can be identified and can,
in turn, be used, in conjunction with standard techniques, to
identify additional proteins with which it interacts.
[0220] Additionally, methods may be employed which result in the
simultaneous identification of genes which encode the intracellular
protein interacting with the gene product. These methods include,
for example, probing expression libraries with the labeled gene
product, using the labeled protein in a manner similar to the well
known technique of antibody probing of Xgt11 libraries.
[0221] One method which detects protein interactions in vivo, the
two-hybrid system, is described in detail for illustration only and
not by way of limitation. One version of this system has been
described (Chien et al., 1991) and is commercially available from
Clontech (Palo Alto, Calif.).
[0222] Briefly, utilizing such a system, plasmids are constructed
that encode two hybrid proteins: one consists of the DNA-binding
domain of a transcription activator protein fused to the
characterized gene product and the other consists of the
transcription activator protein's activation domain fused to an
unknown protein that is encoded by a cDNA which has been recombined
into this plasmid as part of a cDNA library. The DNA-binding domain
fusion plasmid and the cDNA library are transformed into a strain
of the yeast Saccharomyces cerevisiae that contains a reporter gene
(e.g., HBS or lacZ) whose regulatory region contains the
transcription activator's binding site. Either hybrid protein alone
cannot activate transcription of the reporter gene: the DNA-binding
domain hybrid cannot because it does not provide activation
function and the activation domain hybrid cannot because it cannot
localize to the activator's binding sites. Interaction of the two
hybrid proteins reconstitutes the functional activator protein and
results in expression of the reporter gene, which is detected by an
assay for the reporter gene product.
[0223] The two-hybrid system or related methodology may be used to
screen activation domain libraries for proteins that interact with
the "bait" gene product. Total genomic or cDNA sequences are fused
to the DNA encoding an activation domain. This library and a
plasmid encoding a hybrid of the bait gene product fused to the
DNA-binding domain are cotransformed into a yeast reporter strain,
and the resulting transformants are screened for those that express
the reporter gene. Positive colonies are purified and the library
plasmids responsible for reporter gene expression are isolated. DNA
sequencing then is used to identify the proteins encoded by the
library plasmids.
[0224] For example, the bait gene product can be cloned into a
vector such that it is translationally fused to the DNA encoding
the DNA-binding domain of the GAL4 protein. A cDNA library of the
cell line from which proteins that interact with the bait gene
product are to be detected can be made using methods routinely
practiced in the art. The cDNA fragments can be inserted into a
vector such that they are translationally fused to the
transcriptional activation domain of GAL4. This library can be
co-transformed along with the bait gene-GAL4 fusion plasmid into a
yeast strain which contains a lacZ gene driven by a promoter which
contains GAL4 activation sequence. A cDNA encoded protein, fused to
GAL4 transcriptional activation domain, that interacts with the
bait gene product will reconstitute an active GAL4 protein and
thereby drive expression of the HIS3 gene. Colonies which express
HIS3 can be detected by their growth on petri dishes containing
semi-solid agar based media lacking histidine. The cDNA can then be
purified from these strains, and used to produce and isolate the
bait gene-interacting protein using techniques routinely practiced
in the art.
[0225] 6.10.7 Assays for Compounds that Interfere with the
Interaction Between a Gene Product and an Intracellular
Macromolecule
[0226] A characterized gene product of the invention may, in vivo,
interact with one or more intracellular macromolecules, such as
proteins. Such macromolecules may include, but are not limited to,
nucleic acid molecules and those proteins identified via methods
such as those described above. For purposes of this discussion,
such intracellular macromolecules are referred to herein as
"interacting partners." Compounds that disrupt interactions in this
way may be useful in regulating the activity of the gene product,
including mutant gene products. Such compounds may include, but are
not limited to molecules such as peptides, and the like, as
described above, which would be capable of gaining access to the
intracellular gene product.
[0227] The basic principle of the assay systems used to identify
compounds that interfere with the interaction between the gene
product and its intracellular interacting partner or partners
involves preparing a reaction mixture containing the gene product,
and the interacting partner under conditions and for a time
sufficient to allow the two to interact and bind, thus forming a
complex. In order to test a compound for inhibitory activity, the
reaction mixture is prepared in the presence and absence of the
test compound. The test compound may be initially included in the
reaction mixture, or may be added at a time subsequent to the
addition of the gene product and its intracellular interacting
partner. Control reaction mixtures are incubated without the test
compound or with a placebo. The formation of any complexes between
the gene product and the intracellular interacting partner is then
detected. The formation of a complex in the control reaction, but
not in the reaction mixture containing the test compound, indicates
that the compound interferes with the interaction of the gene
protein and the interacting partner. Additionally, complex
formation within reaction mixtures containing the test compound and
normal gene product may also be compared to complex formation
within reaction mixtures containing the test compound and a mutant
gene product. This comparison may be important in those cases
wherein it is desirable to identify compounds that disrupt
interactions of mutant but not normal gene products.
[0228] The assay for compounds that interfere with the interaction
of the gene product and interacting partners can be conducted in a
heterogeneous or homogeneous format. Heterogeneous assays involve
anchoring either the gene product or the binding partner onto a
solid phase and detecting complexes anchored on the solid phase at
the end of the reaction. In homogeneous assays, the entire reaction
is carried out in a liquid phase. In either approach, the order of
addition of reactants can be varied to obtain different information
about the compounds being tested. For example, test compounds that
interfere with the interaction between the gene product and the
interacting partners, e.g., by competition, can be identified by
conducting the reaction in the presence of the test substance;
i.e., by adding the test substance to the reaction mixture prior to
or simultaneously with the gene product and intracellular
interacting partner. Alternatively, test compounds that disrupt
pre-formed complexes, e.g. compounds with higher binding constants
that displace one of the components from the complex, can be tested
by adding the test compound to the reaction mixture after complexes
have been formed. The various formats are described briefly
below.
[0229] In a heterogeneous assay system, either the gene product or
the interacting partner, is anchored onto a solid surface, while
the non-anchored species is labeled, either directly or indirectly.
In practice, microtiter plates are conveniently utilized. The
anchored species may be immobilized by non-covalent or covalent
attachments. Non-covalent attachment may be accomplished simply by
coating the solid surface with a solution of the gene product or
interacting partner and drying. Alternatively, an immobilized
antibody specific for the species to be anchored may be used to
anchor the species to the solid surface. The surfaces may be
prepared in advance and stored.
[0230] To conduct the assay, the partner of the immobilized species
is exposed to the coated surface with or without the test compound.
After the reaction is complete, unreacted components are removed
(e.g., by washing) and any complexes formed will remain immobilized
on the solid surface. The detection of complexes anchored on the
solid surface can be accomplished in a number of ways. Where the
non-immobilized species is pre-labeled, the detection of label
immobilized on the surface indicates that complexes were formed.
Where the non-immobilized species is not pre-labeled, an indirect
label can be used to detect complexes anchored on the surface;
e.g., using a labeled antibody specific for the initially
non-immobilized species (the antibody, in turn, may be directly
labeled or indirectly labeled with a labeled anti-Ig antibody).
Depending upon the order of addition of reaction components, test
compounds which inhibit complex formation or which disrupt
pre-formed complexes can be detected.
[0231] Alternatively, the reaction can be conducted in a liquid
phase in the presence or absence of the test compound, the reaction
products separated from unreacted components, and complexes
detected; e.g., using an immobilized antibody specific for one of
the interacting components to anchor any complexes formed in
solution, and a labeled antibody specific for the other partner to
detect anchored complexes. Again, depending upon the order of
addition of reactants to the liquid phase, test compounds which
inhibit complex or which disrupt pre-formed complexes can be
identified.
[0232] In an alternate embodiment of the invention, a homogeneous
assay can be used. In this approach, a pre-formed complex of the
gene protein and the interacting partner is prepared in which
either the gene product or its interacting partner is labeled, but
the signal generated by the label is quenched due to complex
formation (see, e.g., Rubenstein et al. (1980) which utilizes this
approach for immunoassays). The addition of a test substance that
competes with and displaces one of the species from the pre-formed
complex will result in the generation of a signal above background.
In this way, test substances which disrupt the gene
product/intracellular interacting partner interaction can be
identified.
[0233] In a particular embodiment, the gene product can be prepared
for immobilization using recombinant DNA techniques described
above. For example, the gene product coding region can be fused to
a glutathione-S-transferase (GST) gene using a fusion vector, such
as pGEX-5X-1, in such a manner that its interacting activity is
maintained in the resulting fusion protein. The intracellular
interacting partner can be purified and used to raise a monoclonal
antibody, using methods routinely practiced in the art and
described above. This antibody can be labeled with the radioactive
isotope .sup.125I, for example, by methods routinely practiced in
the art. In a heterogeneous assay, e.g., the GST-gene product
fusion protein can be anchored to glutathione-agarose beads. The
intracellular interacting partner can then be added in the presence
or absence of the test compound in a manner that allows
interaction, e.g., binding, to occur. At the end of the reaction
period, unbound material can be washed away, and the labeled
monoclonal antibody can be added to the system and allowed to bind
to the complexed components. The interaction between the gene
product and the intracellular interacting partner can be detected
by measuring the amount of radioactivity that remains associated
with the glutathione-agarose beads. A successful inhibition of the
interaction by the test compound will result in a decrease in
measured radioactivity.
[0234] Alternatively, the GST fusion protein and the intracellular
interacting partner can be mixed together in liquid in the absence
of the solid glutathione-agarose beads. The test compound can be
added either during or after the species are allowed to interact.
This mixture can then be added to the glutathione-agarose beads and
unbound material is washed away. Again the extent of inhibition of
the gene product/interacting partner interaction can be detected by
adding the labeled antibody and measuring the radioactivity
associated with the beads.
[0235] In another embodiment of the invention, these same
techniques can be employed using peptide fragments that correspond
to the binding domains of the gene product and/or the intracellular
interacting partner, in place of one or both of the full length
proteins. Any number of methods routinely practiced in the art can
be used to identify and isolate the binding sites. These methods
include, but are not limited to, mutagenesis of the gene encoding
one of the proteins and screening for disruption of binding in a
co-immunoprecipitation assay. Compensating mutations in the gene
encoding the second species in the complex can then be selected.
Sequence analysis of the genes encoding the respective proteins
will reveal the mutations that correspond to the region of the
protein involved in interacting, e.g., binding. Alternatively, one
protein can be anchored to a solid surface using methods described
in this Section above, and allowed to interact with, e.g., bind, to
its labeled interacting partner, which has been treated with a
proteolytic enzyme, such as trypsin. After washing, a short,
labeled peptide comprising the interacting, e.g., binding, domain
may remain associated with the solid material, which can be
isolated and identified by amino acid sequencing. Also, once the
gene coding for the intracellular binding partner is obtained,
short gene segments can be engineered to express peptide fragments
of the protein, which can then be tested for binding activity and
purified or synthesized.
[0236] For example, and not by way of limitation, the gene product
can be anchored to a solid material as described, above, in this
Section by making a GST fusion protein and allowing it to bind to
glutathione agarose beads. The interactive intracellular binding
partner can be labeled with a radioactive isotope, such as
.sup.35S, and cleaved with a proteolytic enzyme such as trypsin.
Cleavage products can then be added to the anchored GST fusion
protein and allowed to bind. After washing away unbound peptides,
labeled bound material, representing the intracellular interacting
partner binding domain, can be eluted, purified, and analyzed for
amino acid sequence by well-known methods. Peptides so identified
can be produced synthetically or fused to appropriate facilitative
proteins using recombinant DNA technology.
[0237] In another embodiment, a two-hybrid screening assay could be
used to identify drugs that block the interaction between the gene
product and an interacting partner (see for example Vidal et al.,
1999). This strategy would employ a two-hybrid containing yeast
strain whose growth on synthetic complete medium lacking
L-histidine is conditional on the physical interaction between the
gene product and an interacting partner. In one example of such an
embodiment, the strain would be spread in a thin lawn on a plate
made of synthetic complete medium lacking L-histidine. Filter disks
containing test compounds would be applied to the plates. Most test
compounds would not affect the interaction between the gene product
and the interacting partner and consequently a confluent lawn of
yeast would grow around the disks impregnated with such compounds.
Test compounds that inhibit the interaction would block growth of
the yeast strain around the filter disks containing them causing
zones of growth inhibition. Those compounds could then be tested
against wild-type yeast to confirm that they are not simply
fungistatic or fungicidal. Such an embodiment can also be performed
in liquid culture, utilizing standard well known methods for
measuring cell growth in culture.
[0238] 6.10.8 Assays for Molecules that Affect the Expression of a
Gene Product
[0239] A variety of methods may be employed to influence the
expression of a gene that is sequenced and characterized according
to the methods of this invention. The influence of compounds such
as peptides and small molecules on gene expression may be assayed
by for example simple Northern analysis, hybridization of cDNA or
mRNA to oligonucleotide arrays (see e.g., Farr et al., 1998; and
Marton et al., 1998), or global monitoring of gene expression with
a reporter gene coupled to different promoters as described by
e.g., Ashby et al. (1996).
[0240] Antisense and ribozyme methods can be effective in
influencing the expression of one or a limited number of genes.
Antisense approaches involve the design of oligonucleotides (either
DNA or RNA) that are complementary to the gene mRNA. The antisense
oligonucleotides will bind to the complementary gene mRNA
transcripts and prevent translation. Perfect complementarity,
although preferred, is not required.
[0241] Oligonucleotides that are complementary to the 5' end of the
message, e.g., the 5' untranslated sequence up to and including the
AUG initiation codon, should work most efficiently at inhibiting
translation. However, sequences complementary to the 3'
untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well, see generally, Wagner
(1994). Thus, oligonucleotides complementary to either the 5'- or
3'-non-translated, non-coding regions of the gene could be used in
an antisense approach to inhibit translation of the endogenous gene
mRNA.
[0242] Oligonucleotides complementary to the 5' untranslated region
of the mRNA should include the complement of the AUG start codon.
Antisense oligonucleotides complementary to mRNA coding regions are
less efficient inhibitors of translation but could be used in
accordance with the invention. Whether designed to hybridize to the
5'-, 3'-regions or coding region of target or pathway gene mRNA,
antisense nucleic acids should be at least six nucleotides in
length, and are preferably oligonucleotides ranging from 6 to about
50 nucleotides in length. In specific aspects the oligonucleotide
is at least 10 nucleotides, at least 17 nucleotides, at least 25
nucleotides or at least 50 nucleotides.
[0243] Regardless of the choice of target sequence, it is preferred
that in vitro studies are first performed to quantitate the ability
of the antisense oligonucleotide to inhibit gene expression. It is
preferred that these studies utilize controls that distinguish
between antisense gene inhibition and nonspecific biological
effects of oligonucleotides. It is also preferred that these
studies compare levels of the target RNA or protein with that of an
internal control RNA or protein. Additionally, it is envisioned
that results obtained using the antisense oligonucleotide are
compared with those obtained using a control oligonucleotide. It is
preferred that the control oligonucleotide is of approximately the
same length as the test oligonucleotide and that the nucleotide
sequence of the oligonucleotide differs from the antisense sequence
no more than is necessary to prevent specific hybridization to the
target sequence.
[0244] The oligonucleotides can be DNA or RNA or chimeric mixtures
or derivatives or modified versions thereof, single-stranded or
double-stranded. The oligonucleotide can be modified at the base
moiety, sugar moiety, or phosphate backbone, for example, to
improve stability of the molecule, hybridization, etc. The
oligonucleotide may include other appended groups such as peptides
(e.g., for targeting host cell receptors in vivo), or agents
facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989; Lemaitre et al., 1987; Tullis, 1990) or the
blood-brain barrier (see, e.g., Pardridge et al., 1989),
hybridization-triggered cleavage agents (see, e.g., van der Krol et
al., 1988) or intercalating agents (see, e.g., Zon, 1988). To this
end, the oligonucleotide may be conjugated to another molecule,
e.g., a peptide, hybridization triggered cross-linking agent,
transport agent, hybridization-triggered cleavage agent, etc.
[0245] The antisense oligonucleotide may comprise at least one
modified base moiety which is selected from the group including but
not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N.sup.6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
[0246] The antisense oligonucleotide may also comprise at least one
modified sugar moiety selected from the group including but not
limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
[0247] In yet another embodiment, the antisense oligonucleotide
comprises at least one modified phosphate backbone selected from
the group consisting of a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or
analog thereof.
[0248] In yet another embodiment, the antisense oligonucleotide is
an alpha-anomeric oligonucleotide. An alpha-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual beta-units, the
strands run parallel to each other (Gautier et al., 1987). The
oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al.,
1987a), or a chimeric RNA-DNA analogue (Inoue et al., 1987b).
[0249] Oligonucleotides of the invention may be synthesized by
standard methods known in the art, e.g. by use of an automated DNA
synthesizer (such as are commercially available from Biosearch,
Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al.
(1988), methylphosphonate oligonucleotides can be prepared by use
of controlled pore glass polymer supports (Sarin et al., 1988),
etc.
[0250] The antisense molecules should be delivered to cells which
express the gene in vivo. A number of methods have been developed
for delivering antisense DNA or RNA to cells; e.g., antisense
molecules can be injected directly into the tissue site, or
modified antisense molecules, designed to target the desired cells
(e.g., antisense linked to peptides or antibodies that specifically
bind receptors or antigens expressed on the target cell surface)
can be administered systemically.
[0251] However, it is often difficult to achieve intracellular
concentrations of the antisense sufficient to suppress translation
of endogenous mRNAs. Therefore a preferred approach utilizes a
recombinant DNA construct in which the antisense oligonucleotide is
placed under the control of a strong promoter. The use of such a
construct to transfect target cells will result in the
transcription of sufficient amounts of single stranded RNAs that
will form complementary base pairs with the endogenous gene
transcripts and thereby prevent translation of the gene mRNA. For
example, a vector can be introduced in vivo such that it is taken
up by a cell and directs the transcription of an antisense RNA.
Such a vector can remain episomal or become chromosomally
integrated, as long as it can be transcribed to produce the desired
antisense RNA. Such vectors can be constructed by recombinant DNA
technology methods standard in the art. Vectors can be plasmid,
viral, or others known in the art, used for replication and
expression in cells. Expression of the sequence encoding the
antisense RNA can be by any promoter known in the art to act in the
appropriate cells. Such promoters can be inducible or constitutive.
Such promoters include but are not limited to: the SV40 early
promoter region (Bernoist et al., 1981), the promoter contained in
the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al.,
1980), the herpes thymidine kinase promoter (Wagner et al., 1981),
the regulatory sequences of the metallothionein gene (Brinster et
al., 1982), etc. Any type of plasmid, cosmid, YAC or viral vector
can be used to prepare the recombinant DNA construct which can be
introduced directly into the tissue site. Alternatively, viral
vectors can be used which selectively infect the desired cells.
[0252] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA (For a review see, for example Rossi,
1994). The mechanism of ribozyme action involves sequence specific
hybridization of the ribozyme molecule to complementary target RNA,
followed by a endonucleolytic cleavage. The composition of ribozyme
molecules must include one or more sequences complementary to the
target gene mRNA, and must include the well known catalytic
sequence responsible for mRNA cleavage. For this sequence, see Cech
et al. (1992). As such, within the scope of the invention are
engineered hammerhead motif ribozyme molecules that specifically
and efficiently catalyze endonucleolytic cleavage of RNA sequences
encoding target gene proteins.
[0253] Ribozyme molecules designed to catalytically cleave the gene
mRNA transcripts can also be used to prevent translation of the
gene mRNA and expression of target or pathway gene. (See, e.g.,
Cech, et al. 1990; Sarver et al., 1990). While ribozymes that
cleave mRNA at site specific recognition sequences can be used to
destroy the gene mRNAs, the use of hammerhead ribozymes is
preferred. Hammerhead ribozymes cleave mRNAs at locations dictated
by flanking regions that form complementary base pairs with the
target mRNA. The sole requirement is that the target mRNA have the
following sequence of two bases: 5'-UG-3'. The construction and
production of hammerhead ribozymes is well known in the art and is
described more fully by Haseloff et al. (1988). Preferably the
ribozyme is engineered so that the cleavage recognition site is
located near the 5' end of the gene mRNA; i.e., to increase
efficiency and minimize the intracellular accumulation of
non-functional mRNA transcripts.
[0254] The ribozymes of the present invention also include RNA
endoribonucleases (hereinafter "Cech-type ribozymes") such as the
one which occurs naturally in Tetrahymena thermophila (known as the
IVS, or L-19 IVS RNA) and which has been extensively described by
Cech and collaborators (see, e.g. Zaug et al., 1984; Zaug et al.,
1986a; Zaug et al., 1986b; Cech et al, 1991; Cech, 1986). The
Cech-type ribozymes have an eight base pair active site which
hybridizes to a target RNA sequence whereafter cleavage of the
target RNA takes place. The invention encompasses those Cech-type
ribozymes which target eight base-pair active site sequences that
are present in the gene.
[0255] As in the antisense approach, the ribozymes can be composed
of modified oligonucleotides (e.g. for improved stability,
targeting, etc.) and should be delivered to cells which express the
gene of interest in vivo. A preferred method of delivery involves
using a DNA construct "encoding" the ribozyme under the control of
a strong constitutive promoter, so that transfected cells will
produce sufficient quantities of the ribozyme to destroy endogenous
gene messages and inhibit translation. Because ribozymes unlike
antisense molecules, are catalytic, a lower intracellular
concentration is required for efficiency.
[0256] In instances wherein the antisense, ribozyme, and/or triple
helix molecules described herein are utilized to inhibit mutant
gene expression, it is possible that the technique can also
efficiently reduce or inhibit the transcription (triple helix)
and/or translation (antisense, ribozyme) of mRNA produced by normal
target gene alleles that the possibility can arise wherein the
concentration of normal target gene product present can be lower
than is necessary for a normal phenotype. In such cases, to ensure
that substantially normal levels of target gene activity are
maintained, therefore, nucleic acid molecules that encode and
express target gene polypeptides exhibiting normal target gene
activity can be introduced into cells via gene therapy methods that
do not contain sequences susceptible to whatever antisense,
ribozyme, or triple helix treatments are being utilized.
Alternatively, in instances whereby the target gene encodes an
extracellular protein, it can be preferable to co-administer normal
target gene protein in order to maintain the requisite level of
target gene activity.
[0257] Anti-sense RNA and DNA, ribozyme, and triple helix molecules
of the invention can be prepared by any method known in the art for
the synthesis of DNA and RNA molecules. These include techniques
for chemically synthesizing oligodeoxyribonucleotides and
oligoribonucleotides well known in the art such as for example
solid phase phosphoramidite chemical synthesis. Alternatively, RNA
molecules can be generated by in vitro and in vivo transcription of
DNA sequences encoding the antisense RNA molecule. Such DNA
sequences can be incorporated into a wide variety of vectors which
incorporate suitable RNA polymerase promoters such as the T7 or SP6
polymerase promoters. Alternatively, antisense cDNA constructs that
synthesize antisense RNA constitutively or inducibly, depending on
the promoter used, can be introduced stably into cell lines.
[0258] Various well-known modifications to the DNA molecules can be
introduced as a means of increasing intracellular stability and
half-life. Possible modifications include, but are not limited to,
the addition of flanking sequences of ribo- or deoxy-nucleotides to
the 5' and/or 3' ends of the molecule or the use of
phosphorothioate or 2' O-methyl rather than phosphodiesterase
linkages within the oligodeoxyribonucleotide backbone.
[0259] Endogenous gene expression can also be reduced by
specifically inactivating or "knocking out" the target and/or
pathway gene or its promoter using targeted homologous
recombination. (e.g., see Smithies et al., 1985; Thomas et al.,
1987; Thompson et al., 1989). For example, a mutant, non-functional
gene (or a completely unrelated DNA sequence) flanked by DNA
homologous to the endogenous gene (either the coding regions or
regulatory regions of the gene) can be used, with or without a
selectable marker and/or a negative selectable marker, to transfect
cells that express the gene in vivo. Insertion of the DNA
construct, via targeted homologous recombination, results in
inactivation of the gene. Such approaches are particularly suited
in the agricultural field where modifications to ES (embryonic
stem) cells can be used to generate animal offspring with an
inactive gene (e.g., see Thomas et al., 1987 and Thompson et al.,
1989). Such techniques can also be utilized to generate immune
disorder animal models. It should be noted that this approach can
be adapted for use in humans provided the recombinant DNA
constructs are directly administered or targeted to the required
site in vivo using appropriate viral vectors, e.g., herpes virus
vectors. Targeted homologous recombination also is useful to
introduce point mutations into a gene or other small modifications
that may alter the activity of a gene product. Other methods of
targeting specific changes to a gene make use of, for example small
RNA/DNA hybrids (see Cole-Strauss et al, 1996; Ye et al.,
1998).
[0260] Alternatively, endogenous gene expression can be reduced by
targeting deoxyribonucleotide sequences complementary to the
regulatory region of the gene (i.e., the gene promoter and/or
enhancers) to form triple helical structures that prevent
transcription of the gene in target cells in the body. (See
generally, Helene, C. 1991; Helene et al., 1992; and Maher,
1992).
[0261] 6.10.9 Assays for the Biological Activity of
Polypeptides
[0262] The methods described above to assay a compound for
interactions with a gene product or effects on the biological
function and/or expression of a gene product can equally be used to
assay polypeptides, polypeptide fragments (and analogs) encoded in
polynucleotides and homologs identified and characterized according
to the parallel methods of the invention. See, Hider et al. (1991),
Taylor et al. (1994), Goodman et al. (1995), Osslund (1996). In
addition, the polypeptides and analogs can be assayed for
biological (or pharmacological) activity in tissue culture or in an
organism. See for example Weissmann (1985), Jones et al. (1987),
Lin (1987), Souza (1989, 1992), Pierce et al. (1998), Stern, M. E.
(1999), Samal (1999), Bachmaier et al. (1999), and Tartaglia
(1999).
[0263] 6.10.10 In Vitro Evolution
[0264] Another embodiment of this invention involves mutagenizing a
sequenced polynucleotide and assaying the encoded polypeptide for
altered activity. A polynucleotide that encodes a gene product
isolated from a natural source can serve as a template for
subsequent modification and "improvement" of the gene product for
specific uses. Site-directed mutagenesis is well known in the art
and has long been used to modify the activity of a gene product
(see for example, Pictet, 1991; Kunkel, 1989; Chappel et al., 1993;
Chaleff, 1994; Powers et al., 1998; Gehrke et al., 1994; Yamashita
et al., 1994; Harper et al., 1990; Zukowski et al., 1990). Random
mutagenesis followed by selection or screening protocols provide
powerful methods to alter the activity of a gene product (see for
example Davis et al., 1980; Miller, 1972; Rose et al., 1990). More
recently, techniques have been developed that couple random
mutagenesis and in vitro evolution to sample a greater variety of
potentially useful mutations than can reasonably be assayed by the
more traditional techniques mentioned above (see Stemmer, 1997;
Buchholz et al., 1998; and Zhao et al., 1998).
[0265] 6.10.11 Pharmaceutical Preparations and Methods of
Administration
[0266] The nucleic acid sequences, polypeptides and other compounds
described above may have therapeutic value and may be administered
to a patient at therapeutically effective doses to treat or
ameliorate disease. A therapeutically effective dose refers to that
amount of a compound sufficient to result in amelioration of the
disease symptoms, or alternatively, to that amount of a nucleic
acid sequence sufficient to modulate the expression of a gene
product which results in the amelioration of the disease
symptoms.
[0267] 6.10.11.1 Effective Dose
[0268] Toxicity and therapeutic efficacy of compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD.sub.50 (the
dose lethal to 50% of the population) and the ED.sub.50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds
which exhibit large therapeutic indices are preferred. While
compounds that exhibit toxic side effects can be used, care should
be taken to design a delivery system that targets such compounds to
the site of affected tissue in order to minimize potential damage
to uninfected cells and, thereby, reduce side effects.
[0269] The data obtained from the cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of such compounds lies preferably within a range
of circulating concentrations that include the ED.sub.50 with
little or no toxicity. The dosage can vary within this range
depending upon the dosage form employed and the route of
administration utilized. For any compound used in the method of the
invention, the therapeutically effective dose can be estimated
initially from cell culture assays. A dose can be formulated in
animal models to achieve a circulating plasma concentration range
that includes the IC.sub.50 (i.e., the concentration of the test
compound which achieves a half-maximal inhibition of symptoms) as
determined in cell culture. Such information can be used to more
accurately determine useful doses in humans. Levels in plasma can
be measured, for example, by high performance liquid
chromatography.
[0270] 6.10.11.2 Formulations and Use
[0271] Pharmaceutical compositions for use in accordance with the
present invention can be formulated in conventional manner using
one or more physiologically acceptable carriers or excipients.
[0272] Thus, the compounds and their physiologically acceptable
salts and solvents can be formulated for administration by
inhalation or insufflation (either through the mouth or the nose)
or oral, buccal, parenteral or rectal administration.
[0273] For oral administration, the pharmaceutical compositions can
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g., pre-gelatinized maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets can be
coated by methods well known in the art. Liquid preparations for
oral administration can take the form of, for example, solutions,
syrups or suspensions, or they can be presented as a dry product
for constitution with water or other suitable vehicle before use.
Such liquid preparations can be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous
vehicles (e.g., almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate.
[0274] Preparations for oral administration can be suitably
formulated to give controlled release of the active compound. For
buccal administration the compositions can take the form of tablets
or lozenges formulated in conventional manner.
[0275] For administration by inhalation, the compounds for use
according to the present invention are conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit can be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator can
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0276] The compounds can be formulated for parenteral
administration (i.e., intravenous or intramuscular) by injection,
via, for example, bolus injection or continuous infusion.
Formulations for injection can be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions can take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and can contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents. Alternatively, the active ingredient can be in
powder form for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0277] The compounds also can be formulated in rectal compositions
such as suppositories or retention enemas, e.g., containing
conventional suppository bases such as cocoa butter or other
glycerides.
[0278] In addition to the formulations described previously, the
compounds also can be formulated as depot preparations. Such long
acting formulations can be administered by implantation (for
example subcutaneously or intramuscularly) or by intramuscular
injection. Thus, for example, the compounds can be formulated with
suitable polymeric or hydrophobic materials (for example as an
emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives, for example, as a sparingly soluble
salt.
[0279] The compositions can, if desired, be presented in a pack or
dispenser device which can contain one or more unit dosage forms
containing the active ingredient. The pack can for example comprise
metal or plastic foil, such as a blister pack. The pack or
dispenser device can be accompanied by instructions for
administration.
[0280] 6.10.12 Assays for Polymorphisms
[0281] Polymorphisms represent differences in DNA sequence between
members of the same species. Polymorphisms include for example,
single nucleotide polymorphisms (SNPs), variations in Short Tandem
Repeats (STRs), Restriction Fragment Length Polymorphisms (RFLPs),
insertions, deletions and rearrangements.
[0282] Well developed methods exist in the art for assaying
polymorphic and phenotypic differences between individuals by
genetic mapping to characterize the genetic changes that give rise
to phenotypic variation. These methods can be used, for example, to
discover mutations responsible for genetic disease, to manipulate
and breed useful traits in plants and animals, to discover elements
in genetic pathways, to diagnose propensity towards disease, to
determine and diagnose drug response, etc. (see for example, Stone
et al., 1999; Lebo et al., 1998; Giordano et al., 1998; Rothschild
et al., 1996; Blumenfeld et al., 1995; Meyer et al., 1997; Kamb,
1997; Skolnick et al., 1997). Many phenotypic traits are
multifactorial and methods are well known for using polymorphisms
to discover Quantitative Trait Loci (see for example Webb et al.,
1999; Helentjaris et al., 1995; Dupuis et al., 1999; Umari et al.,
1996; Lander et al., 1986 & 1989). STRs are highly polymorphic
genetic elements and their use in genetic mapping is well known in
the art, see for example Caskey et al. (1994) and Polymeropoulos
(1995). The utility of SNPs for genetic mapping has recently
progressed considerably due to improvements in technology, in
particular the ability to assay many different SNPs simultaneously
by using for example oligonucleotide arrays. For representative
examples see Nikiforov et al. (1999); Shuber, A. P. (1996);
Jakubowski et al. (1999); Cho et al. (1999); Brookes (1999);
Kruglyak (1999); Sapolsky et al. (1999); Xiong et al. (1999); Wang
et al. (1998).
[0283] Polymorphisms are easily discovered by sequencing DNA from
one or more individuals according to the methods described above
and comparing the sequences to discover differences in homologous
regions. Indeed, the sequencing invention can be used both as a
means to discover new polymorphisms and as a method to assay
polymorphisms for genetic mapping studies. Clearly any type of
polymorphism can be quickly assayed by sequencing the DNA (see e.g.
Santamaria et al., 1997).
[0284] To minimize the number of sequences needed to assay an
individual, DNA may be enriched for polymorphisms prior to the
sequencing reaction. For example, Ostrander et al. (1992) describe
a method to enrich for STR sequences in a genomic library. For
other examples see Kandpal et al. (1994); Karagyozov et al. (1993)
and Paetkau (1999).
[0285] The physical mapping methods described above provide another
means to discover and assay polymorphic differences between
individuals in a population. In most cases, differences in the
landmarks between individuals represent differences in the
nucleotide sequence. There are exceptions, for example differences
in methylation patterns between individuals can be assayed by
employing bisulfite-induced modifications prior to cloning the DNA
whereby cytosine is converted to uracil, but 5-methylcytosine
remains unchanged (see e.g., Frommer et al., 1992).
[0286] A preferred landmark for assaying polymorphisms is the
restriction site. For example, assuming 0.11% of nucleotides are
polymorphic between two homologous chromosomes, then for any 6-base
restriction site about 1 in 167 sites will be polymorphic (i.e. one
site will be cut by the restriction enzyme and one site cannot be
cut). If we assume a genome size of 3.times.10.sup.9 base pairs,
then we can expect about (3.times.10.sup.9/4.sup.6)/167=.about.4400
polymorphic restriction sites per assayed 6-base restriction
enzyme. Of course, once polymorphisms are discovered, they can be
assayed in a population by other methods such as those mentioned
above.
[0287] 6.10.13 Assays for Genomic Alterations within an
Individual
[0288] Changes can occur in the genome of an individual during the
course of development or during the progression of disease. The
result is variation between different populations of cells within
the individual. This variation can be assayed using the parallel
methods of this invention.
[0289] Any change at the nucleotide level can be determined simply
by sequencing the genomic DNA from different populations of cells
using the parallel methods described above. For example, the
sequence of DNA from cancerous tissue can be compared to the
sequence of DNA from nearby normal tissue. Changes in the genome
are known to occur during disease progression, and analysis at the
sequence level can help to pinpoint those changes that contribute
to the diseased state.
[0290] Genomic rearrangements can readily be assayed at a lower
resolution by observing differences in the landmarks. In
particular, changes in restriction site patterns will occur not
only as a result of single base changes, but also due to
rearrangements at both a fine and gross level. The physical mapping
methods described above typically yield information from a larger
contiguous stretch of DNA than the sequencing methods. Thus fewer
clones need to be analyzed to quickly "survey" the genomic DNA
from, for example, a diseased tissue. Rearrangements discovered in
this manner may represent changes that contribute to the diseased
state.
[0291] 6.10.14 Transgenic/Recombinant Organisms
[0292] Polynucleotides characterized according to this invention
can be expressed in transgenic (or recombinant) multicellular
organisms. Animals of any species, including, but not limited to,
mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, and
non-human primates, e.g., baboons, monkeys, and chimpanzees may be
used to generate transgenic animals. Other animal species may be
used to create transgenic animals such as Drosophila, C. elegans,
Xenopus, zebra fish, etc. Polynucleotides can also be inserted into
the genomes of a variety of plants and microorganisms to create
transgenic organisms.
[0293] Any technique known in the art may be used to introduce a
polynucleotide or its associated gene into organisms to produce the
founder lines of transgenic organisms. Such techniques include, but
are not limited to pronuclear microinjection (Wagner et al., 1989);
retrovirus mediated gene transfer into germ lines (van der Putten
et al., 1985); gene targeting in embryonic stem cells (Thompson et
al., 1989); electroporation of embryos (Lo, 1983); sperm-mediated
gene transfer (Lavitrano et al., 1989; Perry et al., 1999);
Agrobacterium tumefaciens mediated transformation (An et al., 1988;
Chee et al., 1992; Moloney et al., 1993), etc. For a review of
animal techniques, see Gordon, (1989). Other examples include
Lundquist et al. (1996), Yoder et al. (1993), and Krzyzek et al.
(1995).
[0294] The present invention provides for transgenic organisms that
carry the transgenes in all their cells, as well as organisms which
carry the transgene in some, but not all their cells, i.e.,
mosaics. The transgene may be integrated as a single transgene or
in concatamers, e.g., head-to-head tandems or head-to-tail tandems.
The transgene also may be selectively introduced into and activated
in a particular cell type by following, for example, the teaching
of Lasko et al. (1992). The regulatory sequences required for such
a cell-type specific activation will depend upon the particular
cell type of interest, and will be apparent to those of skill in
the art. When it is desired that the transgene be integrated into
the chromosomal site of the endogenous gene, gene targeting is
preferred. Briefly, when such a technique is to be utilized,
vectors containing some nucleotide sequences homologous to the
endogenous gene are designed for the purpose of integrating, via
homologous recombination with chromosomal sequences, into and
disrupting or modifying the function of the nucleotide sequence of
the endogenous gene. The transgene also may be selectively
introduced into a particular cell type, thus inactivating the
endogenous gene in only that cell type, by following, for example,
the teaching of Gu et al. (1994). The regulatory sequences required
for such a cell-type specific inactivation will depend upon the
particular cell type of interest, and will be apparent to those of
skill in the art.
[0295] Methods for the production of single-copy transgenic
organisms with chosen sites of integration are also well known to
those of skill in the art. See, for example, Bronson et al. (1996)
and Bradley et al. (1997).
[0296] Once transgenic organisms have been generated, the
expression of the recombinant gene may be assayed utilizing
standard techniques. Initial screening may be accomplished by
Southern blot analysis or PCR techniques to analyze animal tissues
to assay whether integration of the transgene has taken place. The
level of mRNA expression of the transgene in the tissues of the
transgenic animals also may be assessed using techniques which
include but are not limited to Northern blot analysis of tissue
samples obtained from the animal, in situ hybridization analysis,
and RT-PCR. Samples of the gene-expressing tissue may also be
evaluated immunocytochemically using antibodies specific for the
transgene product.
[0297] The methods described above for generating cells with
insertion elements at known locations are well suited to the
generation of transgenic organisms with insertion elements in their
genomes. For example, the methods may be practiced on mouse
embryonic stem cells from which an adult animal can be cloned.
Other animals have been cloned from cell lines derived from
embryos, see for example Campbell et al. (1996), Chen et al.
(1999), Hong et al. (1998), Baguisi et al. (1999), and Cibelli et
al. (1998).
[0298] Animals and cell lines with mapped insertion elements and
transgenic animals and cell lines made by other methods such as
those described above have the potential to model various human
diseases (e.g., Robinson et al., 1996). In this context, the
animals or cell lines can serve as tools to test pharmaceuticals
for efficacy in treating the disease (see for example Cordell,
1995; Weinshilboum et al., 1995; Leder et al., 1992; Hammer, 1996;
Groffen et al., 1996; Terhorst et al., 1996; Donehower et al.,
1996; Lazzarini, 1997). The transgenic animal model systems may be
used as a test substrate to identify drugs, pharmaceuticals,
therapies and interventions which may be effective in treating the
disease or disorder of interest. Therapeutic agents may be
administered systemically or locally. Suitable routes may include
oral, rectal, or intestinal administration; parenteral delivery,
including intramuscular, subcutaneous, intramedullary injections,
as well as intrathecal, direct intraventricular, intravenous,
intraperitoneal, intranasal, or intraocular injections, to name
just a few. The response of the animals to the treatment may be
monitored by assessing the reversal of the disease. With regard to
intervention, any treatments which reverse any aspect of the
disease should be considered as candidates for therapeutic
intervention. Dosages of test agents may be determined by deriving
dose-response curves.
[0299] The transgenic animal model systems for a disease also may
be used as test substrates to identify environmental factors,
drugs, pharmaceuticals, and chemicals which may exacerbate the
progression of the disease that the transgenic animals exhibit.
[0300] In an alternate embodiment, the transgenic animal models for
disease may be used to derive a cell line which may be used as a
test substrate in culture, to identify both agents that reduce and
agents that enhance the disease. While primary cultures derived
from the transgenic animals of the invention may be utilized, the
generation of continuous cell lines is preferred. For examples of
techniques which may be used to derive a continuous cell line from
the transgenic animals, see Small et al., 1985.
[0301] Insertion elements at known locations can serve as a
starting point for subsequent targeted modifications to the genome.
For example, the insertion element may carry a marker such as
HSV-TK for which a negative selection exists (Capecchi et al.,
1996). Targeted modifications to the DNA surrounding the insertion
element can be generated in the cell by first modifying in vitro a
subclone of the surrounding DNA (absent the insertion element)
using traditional recombinant methods, transfecting the modified
subclone into for example a cell line that carries the insertion
element, and selecting for loss of the HSV-TK marker. The end
result is the loss of the insertion element and the introduction of
the targeted modification. The insertion element may also carry a
cleavage site for a rare-cutting enzyme such as Sce I, in which
case cotransfection with a plasmid encoding Sce I endonuclease may
lead to double-strand breaks and improved rates of targeted
homologous recombination (see e.g. Dujon et al., 1999; and Smih et
al., 1995).
[0302] 6.10.15 Databases
[0303] The sequences of polynucleotides determined by the methods
described above can be stored in a database to facilitate analysis
of the information. Methods for preparing a database of sequence
information are well known in the art, see for example Bilofsky et
al. (1986), Benson et al. (1994), Doolittle (1990), and Sabatini et
al. (1999). Other databases can be created from the sequence
information such as for example a database of polymorphisms and a
polypeptide database comprising theoretical translations of
polynucleotide sequences, see e.g. Clayerie et al. (1985) and
Stulich et al. (1989).
6.11 Kits for Implementing a Method of the Invention
[0304] The invention includes kits for carrying out the various
embodiments of the invention. Preferably, kits of the invention
include a set of primers and/or adapters for carrying out the
reactions and amplifications in accordance with the invention. Kits
also may include an array of tag complements attached to a solid
phase support. Additionally, kits of the invention may include
sample tags or sample-tagged vectors. Kits also may contain
appropriate buffers for enzymatic processing, detection
chemistries, e.g. fluorescent components for labeling amplicons,
instructions for use, processing enzymes, such as ligases,
polymerases, and so on. These and other aspects of the invention
are illustrated by the following non-limiting examples.
7. EXAMPLES
7.1 Example 1
[0305] In this example, sequence information was obtained for a
subset of cloned inserts from a pool of about 110 different cloned
inserts. Sample-tagged vectors with inserts were constructed in E.
coli using standard techniques. Sample tags were created by
ligating complementary pairs of oligonucleotides into the unique
Pvu II site of the commercial vector pSP72 (Promega). Eleven
different tags are shown below:
TABLE-US-00001 Tag1 CAGCACCAGGAAGGTGGCCAGGTTGGCAGTGTA (SEQ ID NO:
1) Tag2 CCTAGCTCTCTTGAAGTCATCGGCCAGGGTGGA (SEQ ID NO: 2) Tag3
ATCAAGCTTATGGATCCCGTCGACCT (SEQ ID NO: 3) Tag4
GGTGCTCGTGTCTTTATCGTCCCTACGTCTCTT (SEQ ID NO: 4) Tag5
AATTTTGAAGTTAGCTTTGATTCCATTC (SEQ ID NO: 5) Tag6
GGCGTCCTGCTGCAGTCTGGCATTGGGGAA (SEQ ID NO: 6) Tag7
ATTGAAGATGGAGGCGTTCAACTAGCA (SEQ ID NO: 7) Tag8
GATGAACTATACAAGCTTATGTCCAGACTTCCA (SEQ ID NO: 8) Tag9
AAGGGCAGATTGGTAGGACAGGTAATG (SEQ ID NO: 9) Tag10
CCGTCGGGCATCCGCGCCTTGAG (SEQ ID NO: 10) Tag11
TACATTGTGTGAGTTGAAGTTGTATTCCAATTT (SEQ ID NO: 11)
[0306] Inserts were cloned between the Bgl II and Xba I sites of
pSP72. These inserts were derived from a complete restriction
digest of rat genomic DNA with BamH I, Bgl II and Xba I. The
relevant sequence of a Tag11 construct is shown below:
TABLE-US-00002 1 10 20 30 . . .
ATTTAGGTGACACTATAGAACTCGACCAGTACATTGTGTGAGTT SP72for>> 40 50
60 70 80 GAAGTTGTATTCCAATTTCTGAAGCTTGCATGCCTGCAGGTCGACTCTAG
<<SP72rev 90 A(SEQ ID NO: 12) . . . INSERT . . .
GATCTGCCGGTCT (SEQ ID NO: 13) . . .
[0307] The tag is shown in bold lettering. Underlined sequences
represent oligonucleotides (SP72for and SP72 rev) described
below.
[0308] For constructs containing Tag1 through Tag10, a single
random insert was cloned and grown to saturation in liquid media.
For constructs containing Tag11, about 100 random inserts were
cloned, pooled and grown to saturation in liquid media. A pool of
about 110 random inserts was made by diluting each single isolate
(i.e., constructs containing Tag1 through Tag10) into the pool of
Tag11 constructs at a ratio of 1:100. In this pool, with the
exception of Tag11, each tag is associated with a single, unique
insert. This pool of about 110 constructs was grown further, and
plasmid DNA was prepared using a Qiagen midiprep kit.
[0309] The plasmid DNA (3 .mu.g) was sequenced using a Sequenase
kit (Amersham Pharmacia Biotech) and primer SP72for
(GGTGACACTATAGAACTCGAGCAG, SEQ ID NO:14). Note this primer
sequences through the tag and into the insert. .sup.35S-dATP was
incorporated during the sequencing reaction. The labeled products
were separated in four lanes of a standard 6% polyacrylamide urea
sequencing gel in 1.times.TBE (89 mM Tris borate, pH 8.3/2 mM
EDTA). The gel was dried onto Whatman 3MM paper.
[0310] The sequencing ladder was visualized by exposing the gel to
film. The sequence of base 29 through base 90 was clearly visible
(see FIG. 7a). This result is expected since constructs containing
Tag11 made up over 90% of the pool. After base 90, a uniform
evenly-spaced ladder of over 100 bands was evident in all four
lanes. This multiplex ladder represents the superposition of the
sequencing ladders from all the clones in the pool.
[0311] The film was aligned with the dried gel. Using the multiplex
ladder as a marker, 10 adjacent sections were excised from each
lane with a razor blade so that adjacent edges were touching. Each
section contained only one marker band, which was situated in the
middle of the section (see FIG. 7b). The first four sections (one
from each lane, taken from the bottom of the sectioned region of
the gel) contained bands at the eleventh position of the multiplex
ladder, which corresponds to "base" 101 in the Tag11 construct
shown above. The 40 sections (or fractions) were separately placed
into 100 .mu.l H.sub.2O and heated to 70.degree. C. for 20 minutes.
One microliter of the eluted DNA was amplified in a 20 .mu.l
polymerase chain reaction with Taq polymerase and PCR buffer
according to the manufacturer's instructions (Promega). Briefly,
the primers SP72for (SEQ ID NO:14) and SP72rev, CAGGCATGCAAGCTTCAG
(SEQ ID NO:15) were used at 0.8 .mu.M with 0.2 mM dNTPs, 1.5 mM
MgCl2, PCR buffer and polymerase. The PCR mixture was subjected to
the following cycle parameters: 94.degree. C., 30 s; 55.degree. C.,
30 s; 72.degree. C., 30 s; 35 cycles.
[0312] The PCR mixtures were treated with phosphatase to remove
residual unincorporated nucleotides. In a 10 .mu.l reaction the
following were combined: 3 .mu.l PCR mixture, 7 .mu.l Shrimp
Alkaline Phosphatase (United States Biochemical, diluted to 0.14
units/l). The reactions were incubated at 37.degree. C. for 15
minutes and terminated at 80.degree. C. for 15 minutes. 2 .mu.l
solution of fresh primers (SP72for and SP72rev each at 2.4 .mu.M)
was added to each reaction. The resulting mixtures were heated to
100.degree. C. for 2 minutes and immediately placed on ice in
preparation for labeling with .sup.32P-dATP.
[0313] The labeling step was accomplished with Sequenase, Reaction
Buffer and Labeling Mix supplied by the manufacturer (Amersham
Pharmacia Biotech). Briefly, 3 .mu.l phosphatase-treated PCR mix
was combined with 0.60 .mu.l Reaction Buffer, 0.30 .mu.l 0.1M
dithiothreitol, 0.12 .mu.l Labeling Mix, 0.15 .mu.l .sup.32P-dATP
(3000 Ci/mmol) and 1.1 .mu.l Sequenase (diluted to 0.85
units/.mu.l). Reactions were incubated for 10 minutes at room
temperature. 4 .mu.l 0.2 mM dNTPs (in 10 mM Tris-HCl, 10 mM MgCl2,
50 mM NaCl pH 7.9) was added to each reaction followed by another
10 minute incubation at room temperature. Reactions were terminated
by the addition of 2 .mu.l 100 mM EDTA.
[0314] Identification of the specific tags in each labeled PCR
product was achieved by dot-blot hybridization. The
oligonucleotides originally used to create the tagged constructs
were employed again to make the dot-blots. However, small
oligonucleotides will not hybridize well once bound to nylon
membranes. It was necessary to "lengthen" the oligonucleotides
before application to the membrane. Using standard techniques, each
pair of complementary oligonucleotides described above was ligated
to Hinc II digested pBR322. The resulting ligation mixture was PCR
amplified with two primers: one oligonucleotide from the
complementary pair and a second common oligonucleotide,
CACTATCGACTACGCGATCA (SEQ ID NO: 16). The sequence of the common
oligonucleotide begins 320 bases upstream of the Hinc II site at
position 653 in pBR322. The resulting PCR product is simply a
fusion of the oligonucleotide tag to a 320 base fragment derived
from pBR322. The dot-blots were made with a 96-well Blotting
Apparatus and Zeta-Probe membrane according to the manufacturer's
instructions (BioRad). About 5 to 10 ng of a "lengthened"
oligonucleotide tag was applied per spot.
[0315] Each labeled PCR product from above was hybridized to a
membrane with 10 different spots. Each spot hybridizes to a
different tag (Tag1 through Tag10). The labeled PCR products were
used directly without further purification. Hybridizations were
performed in 2 ml hybridization solution (0.5 M Na.sub.2HPO.sub.4
pH 7.2, 7% SDS according to Zeta-Probe instructions) at 55.degree.
C. for 20 hours in plastic bags. Four 30-minute washes were
performed at 40.degree. C.
[0316] Autoradiography was performed on the hybridized dot-blots.
The results are shown in FIG. 8. Each construct containing Tag1
through Tag9 was sequenced separately by standard means. The
expected sequence for constructs containing Tags 1 through 9 is
shown adjacent to the autoradiograms. The hybridization signal
strength depends on the tag sequence. This variability can be
minimized by optimization of the tag sequence and hybridization
conditions. Clearly, when the signal strength is high, the
hybridization pattern corresponds faithfully to the expected
sequence. As the hybridization signal approaches background levels,
some bases become ambiguous. Tag10 failed to produce a
hybridization signal. The absence of signal was likely due to
differences between the actual Tm of this tag as compared to Tag1
through Tag9. Note the readout from the array of 10 tag complements
has been rearranged in FIG. 8 to more clearly show the sequence of
the inserts. The actual readout was strips of 10 spots
corresponding to the ten different tags.
6.2 Example 2
[0317] This example describes a strategy for simultaneously
sequencing about 37,000 different templates. A collection of about
100,000 sequence-tagged vectors is constructed from the
commercially available bacteriophage vector M13mp18. Using standard
methods, the vector M13PL1 is constructed by modifying M13mp18
between the EcoR I and Hind III sites as shown:
TABLE-US-00003 (SEQ ID NO: 17) BstXI BstXI BamHI
GAATTCCATGTTGTTGGGGCGCGCCTCCATCAACGTGGATCCAT EcoICR1 PstI
CGAGACGGTCCAGAGCTCAGTGGCGCATGCAATGCTCCAACTGCAG TagL>>>>
HindIII GTTAGCCATGGTTGCCCAAGCTT <<<TagR
[0318] A pool of 100,000 different oligonucleotides is synthesized
3'->5' on an ABI model 394 DNA synthesizer by the "split and
pool" approach described by Brenner (1997b). The sequence "TGCA" is
synthesized on 10 columns. A different 5 base sequence is added to
each of the 10 columns. The column packing material is removed from
each column, mixed together and repacked into the 10 columns. A
different 5 base sequence is synthesized on each column. The split,
synthesize and pool process is repeated three more times. The
different sequences synthesized at each step are shown in Table 1
(sequences are shown 5'->3').
TABLE-US-00004 TABLE 1 column step 5 step 4 step 3 step 2 step 1 1
CTACT CAGTC TGTAG TGACA GAGCA 2 GAACT GTGTC ACTAG AGACT CTGCA 3
GTTCT GACTC AGAAG TCACT CACCA 4 GTAGT GAGAC AGTTG TGTCT CAGGA 5
GTACA GAGTG AGTAC TGAGT CAGCT 6 GATGA GTCAG ACATC TCTGA CTCGT 7
CTTGA CACAG TGATC AGTGA GACGT 8 CAAGA CTGAG TCTTC ACAGA GTGGT 9
CATCA CTCTG TCAAC ACTGT GTCCT 10 CATGT CTCAC TCATG ACTCA GTCGA
[0319] The oligonucleotides are removed from the column,
deprotected and concentrated. M13PL1 is cut with Pst I and EcoICR
I. 100 fold molar excess of the oligonucleotides is ligated to the
cut vector. Excess oligonucleotides are removed using a Qiaquick
kit (Qiagen). The vector/oligonucleotide is "filled in" with Klenow
fragment (3'->5' exo-, New England Biolabs), the reaction
products are circularized with ligase, and transformed into highly
competent XL1-Blue (Stratagene). About 10 million transfectants are
combined to make the sample-tagged vector pool. Double-stranded
(RF1) DNA is prepared from the pool with the Qiagen Plasmid
Purification System (Qiagen).
[0320] A mouse genomic library is prepared in the pool of
sample-tagged phage vectors. Mouse DNA from strain 129/Sv is
sheared to a fragment size of 3-6 kb using the Hydroshear (Genomic
Instrumentation Services; San Carlos, Calif.; see Oefner et al.,
1998), according to the manufacturer's instructions. The sheared
DNA is ligated to an adapter made by annealing the following two
phosphorylated oligonucleotides:
TABLE-US-00005 TGAGTCACCAAC SEQ ID NO: 18 GTGACTCA
[0321] The ligation products are separated on a 1% agarose gel in
1.times.TAE and 2-3 kb fragments are cut from the gel. The
fragments are purified with a Qiaquick Column (Qiagen) according to
the manufacturer's instructions.
[0322] The fragments are ligated into the pool of sample-tagged
vectors prepared above. The resulting library is electroporated
into the strain XL1-Blue (Stratagene) and spread onto LB agar
plates. About 100,000 transfectants are pooled by eluting the phage
from the agar plates into a solution of LB. The phage titer is
increased by subsequent growth in liquid LB. 0.1 ml overnight
culture of XL 1-Blue is combined with phage at a multiplicity of
infection around 10, diluted into 10 ml LB and grown at 37.degree.
C. to saturation. Phage are separated from the cells by
centrifugation and the single-stranded phage DNA is purified with
the Qiaprep M13 System (Qiagen) according to the manufacturer's
instructions.
[0323] Ten sequencing standard templates are prepared by cloning a
random fragment of the mouse DNA into each of 10 vectors. Each
vector is identical to the sample-tagged vectors described above
except the 25 base distinct region is replaced with the following
sequences:
TABLE-US-00006 TCAATCGACTACACTCGTAACAAGA SEQ ID NO: 19
GATCAATTCGCTAATCGATCGTATA SEQ ID NO: 20 AAATAGATCGCATAAGCAGTACGTG
SEQ ID NO: 21 TCATAGGCTGACAGTCCTAGCTAGT SEQ ID NO: 22
TCGTAGACAGTACATGTCGATGAAT SEQ ID NO: 23 TAACCGATCTAGTCGATCTACGACT
SEQ ID NO: 24 GTTTCGAGCTAGCTAAGAGACTCGT SEQ ID NO: 25
CGTATTTCGACTGACTAGCCTCTAG SEQ ID NO: 26 AGTTCGATCAGCTAACTCTGAGTCA
SEQ ID NO: 27 GCTATATCGATCGTCCATTAACGTA SEQ ID NO: 28
[0324] Each fragment is separately sequenced with the primer TagR,
GGGCAACCATGGCTAACC, (SEQ ID NO:29) by standard means. The ten
standard phage are grown separately in liquid as above and equal
numbers of phage are pooled. Single-stranded DNA is prepared from
the pooled standards as above.
[0325] The pool of sample-tagged phage DNA (3 .mu.g) is combined
with the pool of standard phage DNA (0.3 ng). The combined pool is
sequenced using a Sequenase kit (Amersham Pharmacia Biotech) and
the primer TagR. Unlabeled dATP is substituted for .sup.32P-dATP in
the manufacturer's protocol since these sequencing ladders will not
be directly visualized after electrophoresis. The result is four
collections of tagged termination products corresponding to
terminal A, C, G, and T.
[0326] A size standard is made by sequencing a separate aliquot of
the phage DNA with a second primer M13gI, CTGAATCTTACCAACGCTAAC,
(SEQ ID NO:30). This primer anneals to a sequence element in gene I
far from the sample inserts, so it will produce an identical
sequencing ladder for all the phage in the pool. This time
.sup.32P-dATP is incorporated in the sequencing reaction products.
The four separate termination reactions are pooled in a 1:1:1:2
ratio (A:T:C:G). The excess "G" reaction simplifies alignment of
different lanes after electrophoresis. 1 .mu.l of this labeled size
standard is added to 3 .mu.l of each collection of tagged
termination products.
[0327] The four collections are electrophoresed at 40 V/cm in a
standard 7M urea, 0.5.times.TBE, 0.4 mm thick sequencing gel with
0.5 cm lanes. The gel is dried onto Whatman 3MM paper. The size
standard is visualized by autoradiography. The film is aligned with
the dried gel and individual bands are excised as described in
Example 1. The tagged reaction products in each gel slice
(fraction) are electroeluted into a volume of 50 .mu.l with the
Electroelutor (Amika Corp, Columbia, Md. and see Shukla, 1994).
[0328] The tagged reactions in each fraction are PCR amplified with
two oligonucleotides: TagL, ATCCATCGAGACGGTCCA (SEQ ID NO:31) and
TagR+biotin. TagR+biotin is identical in sequence to TagR and it is
conjugated to biotin at the 5' end during oligonucleotide synthesis
using the LC Biotin-ON Phosphoramidite (Clontech). 5 .mu.l from
each fraction is amplified in a 100 .mu.l reaction with Taq
polymerase (Promega) and PCR buffer according to the manufacturer's
directions. Briefly, the primers are used at 1 .mu.M with 0.2 mM
dNTPs, 1.5 mM MgCl2, PCR buffer and polymerase. The cycling
parameters are as follows: 94.degree. C., 30 s; 55.degree. C., 30
s; 72.degree. C., 30 s; 40 cycles. Prior to hybridization to the
arrays, the PCR samples are denatured at 96.degree. C. for 5 min
and cooled on ice for 5 min.
[0329] Arrays of the 100,000 oligonucleotides (single-stranded) are
synthesized with parallel light-directed chemistry (Affymetrix,
Santa Clara, Calif. has a custom array service). For details see
Fodor et al. (1991 & 1995); Pease et al. (1994). Current
technology allows fabrication of about 320,000 distinct
oligonucleotides on a 1.28 cm.times.1.28 cm array; each
oligonucleotide is present at about 10.sup.7 copies in a 20
.mu.m.times.25 .mu.m "spot" (Wang et al., 1998). The
oligonucleotides are identical in sequence to the combinations
allowed in Table I (read 5' to 3'). An additional 10
oligonucleotides are synthesized that correspond in sequence to the
10 standard sample tags.
[0330] The arrays are hybridized with 6.times.SSPET (0.9M NaCl, 60
mM NaH2PO4 pH 7.4, 6 mM EDTA, 0.005% Triton X-100) for 5 minutes.
100 .mu.l of 2.times. hybridization buffer (2.times.=6M
tetramethylammonium chloride, 20 mM Tris-HCl pH 7.8, 2 mM EDTA,
0.02% TritonX-100 with 200 .mu.g/ml sonicated herring sperm DNA
(Promega)) is added to each denatured PCR sample from above for a
final volume of 200 .mu.l. Each sample (fraction) is hybridized to
one array for 15 hours at 44.degree. C. in a hybridization chamber
(Affymetrix) on a rotisserie at 40 rpm. The arrays are washed three
times with 1.times.SSPET and 10 times with 6.times.SSPET at
22.degree. C. The hybridized biotinylated amplicons are then
stained at room temperature with staining solution (streptavidin
R-phycoerythrin (2 .mu.g/ml, from Molecular Probes) and acetylated
bovine serum albumin (0.5 mg/ml) in 6.times.SSPET) for 8 minutes,
followed by 10 washes with 6.times.SSPET at 22.degree. C. on a
fluidics workstation (Affymetrix). The arrays are visualized with a
confocal chip scanner (Hewlett-Packard/Affymetrix) with a 560 nm
filter.
[0331] The digitized signals from each array are compared and any
array to array hybridization variability is corrected by reference
to the 10 known standard sequences. Sequence ladders are
reconstructed from the hybridization patterns.
7.3 Example 3
[0332] This example describes a method for simultaneously
generating about 37,000 restriction maps.
[0333] A pool of about 100,000 sample-tagged fosmid vectors is
prepared by PCR amplifying the sample tags from the pool of phage
vectors in Example 2 and cloning the collection into the fosmid
vector pFOS1 (Kim, U. J. et al, Nucl. Acids Res. 20:1083-85
(1992)). DNA from the phage pool is amplified with two primers,
TagR and CAACGTGGATCCATCGAGA (SEQ ID NO:32), in a PCR reaction
using Pfu polymerase (Stratagene) according to the manufacturer's
instructions. The resulting amplicons comprise TagR, the variable
sequences and TagL plus the BamH I site shown above. The amplicons
are cut with BamH I and pFOS1 is cut with BamH I and Srf I. The
vector and sample tags are joined by ligation and transformed into
the bacterial strain pop2136 (Kim et al., 1992) by electroporation.
Note both restriction sites are restored in the vector after
ligation to the sample tags. About 10 million transformants are
pooled and plasmid DNA is prepared with the Qiagen Plasmid
Purification System (Qiagen). The plasmid DNA is prepared for
cloning genomic DNA as described by Kim, et al. (1992). The plasmid
pool is linearized with Aat II, dephosphorylated with Alkaline
Phosphatase and then digested with BamH I. Similarly, the ten
standard sample tags described in Example 2 are separately cloned
into pFOS1 and plasmid DNA is prepared for cloning as above.
[0334] A library is constructed in the pool of sample-tagged fosmid
vectors. High molecular weight mouse DNA is partially digested with
Mbo I to an average size of 40 kb, treated with alkaline
phosphatase, and ligated to the vector DNA prepared above as
described by Kim, et al. (1992). The ligation mixture is packaged
into lambda phage heads using the Gigapack III XL packaging extract
(Stratagene). The packaged clones are transfected into strain
DH5.alpha.-MCR (Gibco BRL). About 100,000 clones are pooled and
grown as a liquid culture in LB media. Plasmid DNA is purified from
the pool with the Qiagen Large Construct Kit (Qiagen) according to
the manufacturers instructions. Similarly, a random genomic
fragment is cloned into each standard sample-tagged vector, the 10
standards are grown, plasmid DNA is purified as above and equal
amounts of each standard are combined to make a standard pool.
[0335] The pool of sample-tagged DNA is combined with the pool of
standards (10,000:1 mass ratio). The pooled DNA is linearized with
Srf I and divided into four aliquots. A different double-stranded
adapter is ligated to DNA in each aliquot. Excess adapters and
salts are removed from the ligation reactions by electrodialysis
with the electroelutor (Amika Corp., Columbia, Md.). The adapter
sequences are shown below:
TABLE-US-00007 5'-GCTCATTGCGGTAGCATACC Adap1 SEQ ID NO: 33
CATCGTATGG-5' SEQ ID NO: 34 5'-GCGTGGCCTACTACGATTGT Adap2 SEQ ID
NO: 35 GATGCTAACT-5' SEQ ID NO: 36 5'-GACGTAGCGAACTAGGGCAG Adap3
SEQ ID NO: 37 TGATCCCGTC-5' SEQ ID NO: 38 5'-GCAAGCAGCCTACGCATTAT
Adap4 SEQ ID NO: 39 ATGCGTAATA-5' SEQ ID NO: 40
[0336] Each aliquot is subjected to partial restriction analysis
with a different enzyme (EcoR I, Xba I, Nsi I or Bgl II). The
partial digestion reaction conditions are first calibrated as
follows. One of the ten standard clones is digested with Not I and
end-labeled with .sup.32P-dGTP by standard means (see Ausubel et
al., 1997). The labeled standard is digested with different
concentrations of each enzyme. 10 .mu.g of the
sample-tagged/standard DNA pool is linearized with Srf I, combined
with about 10 ng of the end-labeled standard and incubated with the
different enzyme concentrations at 37.degree. C. for 15 minutes.
The products are analyzed by agarose gel electrophoresis and
visualized by autoradiography. The enzyme concentration is chosen
that produces the most uniform distribution of fragments from the
labeled standard. Now the appropriate enzyme concentration is used
to partially digest the four pools of sample-tagged clones with
adapters.
[0337] The four partial digests are pooled and run in a single lane
of a 32 cm, 0.8% agarose gel. The separated products are collected
during electrophoresis onto anion exchange paper (NA-45, Schleicher
& Schuell) using the GATC 1500 Direct Blotting Electrophoresis
System (GATC GmbH; Konstanz, Germany) as described (Beck, 1993).
The paper is pulled along the bottom edge of the gel during
electrophoresis at a constant speed of 10 cm/hr, and the voltage is
adjusted so the largest fragments elute from the bottom of the gel
after 6 hours. The 10 standard clones are analyzed separately to
determine their partial digest patterns with the four enzymes.
[0338] After electrophoresis, the blotting paper is sectioned at 2
mm intervals. Each section contains the DNA fragments that eluted
from the bottom of the gel during a fixed time interval (1.2 min).
Each section is washed in TE buffer (10 mM Tris pH 8.0, 1 mM EDTA),
transferred to 50 ml elution buffer (2.5 M NaCl, 0.05 M arginine)
and heated to 70.degree. C. for 1 hour. The eluted DNA is dialyzed
against water with a Spectra/Por Microdialyzer (Fisher
Scientific).
[0339] Each sample (fraction) is PCR amplified in a 100 .mu.l
reaction with a mixture of five primers: TagL, JOE-Adap1,
5-FAM-Adap2, TAMRA-Adap3 and ROX-Adap4, where JOE, 5-FAM, TAMRA and
ROX (PE Biosystems) are fluorescent labels attached to the 5' ends
of Adap1, etc. Amplification parameters are the same as Example
2.
[0340] Each labeled amplicon is separately hybridized to the array
of oligonucleotides described in Example 2. Array preparation and
hybridization conditions are identical to those described above.
The arrays are scanned with the ChipReader (Virtek) and signals
from the four different fluorophores are digitized and analyzed.
Variabilty in array to array hybridization signals are corrected by
reference to the standards. The order and size of the tagged
fragments (i.e. the restriction maps) are reconstructed from the
hybridization patterns with reference to the standards.
7.4 Example 4
[0341] This example describes a method for simultaneously
positioning about 17,600 insertion elements. The insertion elements
are essentially randomly inserted into the genome of Escherichia
coli with the use of a transposon vector.
[0342] pNK2859 is a plasmid that carries a mini-Tn10 and a mutant
transposase between two EcoR I restriction sites. The mini-Tn10
consists of two 70 bp inverted repeats flanking a BamH I fragment
that carries the kanR gene (kanamycin resistance) from Tn903
(Kleckner et al., 1991). The mutant transposase eliminates the
insertion site bias of the native protein.
[0343] The plasmid pIS1 is made by inserting the following sequence
at the BamH I site upstream of the kan.sup.R gene in pNK2859:
TABLE-US-00008 Inverted repeat . . . GGATCCGCGGCCGCACGTGACTAGCATG
NotI GCCCGGGCGATCC(SEQ ID NO: 41) . . . kan.sup.R . . . SrfI
pIS1 is cut with EcoR I. The fragment comprising the mini-Tn10 and
transposase is ligated into the single EcoR I site in the lambda
"suicide" vector P.sub.am80.lamda. (Kleckner et al., 1991) to make
P.sub.am80.lamda.IS1.
[0344] A pool of about 100,000 sample-tagged insertion element
vectors is constructed by PCR amplifying the sample tags from the
pool of phage vectors in Example 2 and cloning the collection
between the Not I and Srf I sites in pIS1. DNA from the phage pool
is amplified with two primers (TagR and
GTCAGCGGCCGCATCCATCGAGACGGTCCA SEQ ID NO:42) in a PCR reaction
using Pfu polymerase (Stratagene) according to the manufacturer's
instructions. The resulting amplicons comprise TagR, the variable
sequences and TagL plus a Not I site. The amplicons are cut with
Not I and P.sub.am80.lamda.IS1 is cut with Not I and Srf I. The
sample tags and vector are ligated together and packaged in vitro
with the Gigapack III Gold Packaging Extract (Stratagene). The
packaged vectors are plated on E. coli strain C600. About 10
million phage are pooled and amplified on C600. The sample tagged
mini-Tn10 elements are inserted into the chromosome of strain
MG1655 (Blattner et al., 1997) according to the method described by
Kleckner et al. (1991). Briefly, cells are infected with an equal
number of phage, washed, grown for 1 hour in LB and plated on LB
plates plus 2.5 mM sodium pyrophosphate and 30 .mu.g/ml kanamycin.
The plates are incubated overnight at 37.degree. C. Each colony
usually contains a sample-tagged mini-Tn10 inserted into the
chromosome at a single, essentially random site.
[0345] 21,952 individual colonies are picked into separate wells of
28 grid plates. Each grid plate contains 784 wells in a 28.times.28
square grid pattern, and each well holds about 50 .mu.l of liquid
culture. The colonies are pooled in a simple 3-dimensional pattern.
A 784-pin tool is used to transfer a few microliters from each well
in a plate. The first 28 pools (i.e. the z-dimension) are made by
pooling cells from all the wells in a single plate. The x and y
dimensions are made by using a pad cut with 28 "troughs". Each
trough runs the length of a grid plate and is filled with LB. When
the 784-pin tool is placed on the pad, 28 pins reside in each
trough. Using the 784-pin tool, a few microliters from each well of
the 28 plates are transferred to the 28 troughs, representing the x
dimension (i.e. the columns). A second trough pad is oriented so
the troughs are perpendicular to the first pad's orientation.
Without changing the orientation of the plates, all the wells are
transferred a second time to make the y-dimension (i.e. the rows).
The result is 28+28+28=84 pools and each well is present in only 3
pools.
[0346] DNA is prepared from overnight cultures of each pool. The
sample tags are amplified from each pool by PCR with primers TagL
and TagR, and hybridized to arrays of 100,000 tag complements as
described in Example 2. The address of the cells containing each
sample-tagged insertion element is determined from the
hybridization patterns. About 80% (17,600) of the clones will
contain sample tags with unique addresses, that is the sample tags
are present in only one cell clone.
[0347] To determine the chromosomal locations of the insertion
elements, the sample-tagged junctions first are rescued from the
chromosomal DNA. A single pool is made from the 21,952 separate
bacterial clones. DNA is isolated from an overnight culture and the
junctions are rescued by "Panhandle PCR" as described in detail by
Jones (1995). Five primers are used in the method as shown
below:
TABLE-US-00009 AATTGGAATCAATAAAGCCCTGCG Adprimer SEQ ID NO: 43
ACGACTGTGCTGGTCATTAAAC Primer1 SEQ ID NO: 44 TGATGAATGTTCCGTTGCG
Primer2 SEQ ID NO: 45 CGTATTCAGGCTGACCCTG Primer3 SEQ ID NO: 46
CGCTGCCCGGATTACA Primer4 SEQ ID NO: 47
The 5 primers hybridize to the mini-Tn10 at sequences upstream of
the sample tags and inverted repeat. The DNA from the single pool
is cut to completion with Tsp509 I and then treated with alkaline
phosphatase. Adprimer is phosphorylated in vitro with T4 kinase and
then ligated to the cut pool DNA. The ligation mixture is denatured
and then extended with Taq polymerase under conditions which allow
the ligated Adprimer to "loop back" and prime DNA synthesis into
the mini-Tn10 element. The resulting products are subjected to
"nested PCR", first with Primer1 and Primer2 and the second
amplification is with Primer3 and Primer4. The end result is a pool
of sample-tagged junctions with sequence elements in the following
order: Primer4, sample tag, inverted repeat, junction, Adprimer and
cPrimer3, where cPrimer3 is the complement of Primer3.
[0348] Excess primers and salts are removed from the pool of
sample-tagged junctions by electrodialysis with the electroelutor
(Amika Corp., Columbia, Md.).
[0349] A set of ten sequencing standards is made by PCR amplifying
the pool of standards described in Example 2 with two primers,
M13uni (TGTAAAACGACGGCCAGTG SEQ ID NO:48) and M13 rev
(CAGGAAACAGCTATGACCATGA SEQ ID NO:49). The pool of standards is
combined with the pool of sample-tagged junctions (1:2200 mass
ratio).
[0350] The pooled PCR products are sequenced with TagR using the T7
Sequenase PCR Product Sequencing Kit (Amersham Pharmacia Biotech)
according to the manufacturer's instructions with the exception
that unlabeled dATP is substituted for .sup.32P-dATP. The reaction
products are processed in parallel and the sequences of the
sample-tagged junctions are determined as described in Example 2.
Now the sequence of each sample-tagged junction is known therefore
the location of the insertion element is known by comparison to the
complete sequence of E. coli (Blattner et al., 1997). About 12
bases of sequence are required to uniquely identify the location of
an insertion element in E. coli. Greater than 95% of the insertion
elements will be situated 12 base pairs or more from a Tsp509 I
site, so about 16,700 of the rescued sample-tagged junctions will
contain enough genomic sequence to pinpoint their locations. The
cells containing any sample-tagged insertion element can be easily
recovered by reference to the well address of the sample tag.
[0351] The present invention is not to be limited in scope by the
exemplified embodiments which are intended as illustrations of
single aspects of the invention, and methods which are functionally
equivalent are within the scope of the invention. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description and the accompanying Figures and Drawings.
Such modifications are intended to fall within the scope of the
appended claims.
8. REFERENCES
[0352] The following documents are hereby incorporated by reference
in their entirety. [0353] Adams, C. P. et al., U.S. Pat. No.
5,641,658 (1997) [0354] Adams, M. D. et al., Science, 252:1651-6
(1991) [0355] Agrawal, S., et al., PCT Pat. Pub. No. WO 92/08728
(1992) [0356] Albrecht, G. et al., PCT Pat. Pub. No. WO 97/46704
(1997) [0357] Albretsen, C. et al., Anal. Biochem., 189: 40-50
(1990) [0358] Allison, D. B. et al., U.S. Pat. No. 5,748,491 (1998)
[0359] Altschul, S. F. et al., J. Mol. Biol. 215:403-10 (1990)
[0360] An, G. et al., in Plant Molecular Biology Manual A3, Kluwer
Academic, Dordrecht, pp. 1-19 (1988) [0361] Andersen, P., U.S. Pat.
No. 5,840,169 (1998) [0362] Arnold, C. et al., PCR Methods Appl.,
1:39-42 (1991) [0363] Ashby, M. et al., U.S. Pat. No. 5,569,588
(1996) [0364] Ausubel, F. M. et al., Current Protocols in Molecular
Biology, John Wiley, New York (1997) [0365] Au-Young, J. et al.,
U.S. Pat. No. 5,734,038 (1998) [0366] Axelrod, V. D. et al.,
Nucleic Acids Res., 5:3549-63 (1978) [0367] Azpiroz-Leehan, R. et
al., Trends Genet., 13:152-6 (1997) [0368] Bachmaier, K. et al.,
U.S. Pat. No. 5,962,636 (1999) [0369] Baguisi, A. et al., Nat.
Biotechnol. 17:456-61 (1999) [0370] Barany, G. et al., U.S. Pat.
No. 5,235,028 (1993) [0371] Barillot, E. et al., Nucleic Acids
Research, 19: 6241-7 (1991) [0372] Barnes, W. M., Proc. Natl. Acad.
Sci. USA, 91:2216-20 (1994) [0373] Beattie, et al., Clinical
Chemistry, 39: 719-22 (1993) [0374] Beck, S., Methods Mol. Biol.,
23:219-23 (1993) [0375] Beaucage, et al., Tetrahedron, 48: 2223-311
(1992) [0376] Benson, D. A. et al., Nucleic Acids Res., 22:3441-4
(1994) [0377] Bernoist, C. et al., Nature, 290:304-10 (1981) [0378]
Bilofsky, H. S. et al., Nucleic Acids Res., 14:1-4 (1986) [0379]
Birren, B. W. et al., Genomics, 34:97-106 (1996) [0380] Bitter, G.
A. et al., Methods Enzymol., 153:516-44 (1987) [0381] Blattner, F.
R. et al., Science, 277:1453-74 (1997) [0382] Bloch, W., U.S. Pat.
No. 5,856,192 (1999) [0383] Blumenfeld, A. et al., U.S. Pat. No.
5,387,506 (1995) [0384] Bradley, A. et al., U.S. Pat. No. 5,614,396
(1997) [0385] Brenner, S., U.S. Pat. No. 5,604,097 (1997a) [0386]
Brenner, S., U.S. Pat. No. 5,635,400 (1997b) [0387] Brenner, S.,
U.S. Pat. No. 5,695,934 (1997c) [0388] Brenner, S. et al, U.S. Pat.
No. 5,714,330 (1998a) [0389] Brenner, S., U.S. Pat. No. 5,763,175
(1998a) [0390] Brenner, S., U.S. Pat. No. 5,780,231 (1998b) [0391]
Brenner, S. et al, U.S. Pat. No. 5,846,719 (1998b) [0392] Brinster,
R. L. et al., Nature, 296:39-42 (1982) [0393] Bronson, S. K. et
al., Proc. Natl. Acad. Sci. USA 93:9067-72 (1996) [0394] Brookes,
A. J., Gene, 234:177-86 (1999) [0395] Brown, P. O. et al., U.S.
Pat. No. 5,807,522 (1998) [0396] Bruchez, M. Jr. et al, Science,
281:2013-6 (1998) [0397] Buchholz, F. et al., Nat. Biotechnol.,
16:657-62 (1998) [0398] Bulyk, M. L. et al., Nat. Biotechnol.,
17:573-7 (1999) [0399] Burke, D. T. et al, Science, 236:806-12
(1987) [0400] Burnbaum, J. J., et al., U.S. Pat. No. 5,876,946
(1999) [0401] Campbell, K. H. et al., Nature, 380:64-6 (1996)
[0402] Cantor, C. R. et al., U.S. Pat. No. 5,795,714 (1998) [0403]
Capecchi, M. R. et al., U.S. Pat. No. 5,487,992 (1996) [0404]
Carraway, K. L. et al., U.S. Pat. No. 5,624,816 (1997) [0405]
Caskey, C. J. et al., U.S. Pat. No. 5,364,759 (1994) [0406]
Cavanagh, J. et al., Protein Nmr Spectroscopy: Principles and
Practice, Academic Press, New York (1996) [0407] Chalfie, M. et
al., U.S. Pat. No. 5,491,084 (1996) [0408] Chan, W. C. W. et al.,
Science, 281:2016-8 (1998) [0409] Cech, T. R., Cell, 47:207-16
(1986) [0410] Cech, T. R. et al., PCT Pat. Pub. No. WO 90/11364
(1990) [0411] Cech, T. R. et al., U.S. Pat. No. 4,987,071 (1991)
[0412] Cech, T. R. et al., U.S. Pat. No. 5,093,246 (1992) [0413]
Chaleff, D. T., U.S. Pat. No. 5,310,882 (1994) [0414] Chappel, S.
C. et al., U.S. Pat. No. 5,260,421 (1993) [0415] Cheeseman, P. C.,
U.S. Pat. No. 5,302,509 (1994) [0416] Chelsky, D., et al., U.S.
Pat. No. 5,856,083 (1999) [0417] Chee, P. P. et al., U.S. Pat. No.
5,169,770 (1992) [0418] Chen, L. R. et al., Theriogenology,
52:195-212 (1999) [0419] Chetverin, A. et al., U.S. Pat. No.
5,616,478 (1997) [0420] Cheung, V. G. et al., Proc. Natl. Acad.
Sci. USA, 93:14676-9 (1996) [0421] Chien, et al., Proc. Natl. Acad.
Sci. USA, 88:9578-82 (1991) [0422] Cho, R. J. et al., Nat. Genet.,
23:203-7 (1999) [0423] Church, G. M., U.S. Pat. No. 4,942,124
(1990) [0424] Church, G. M. et al., U.S. Pat. No. 5,149,625 (1992)
[0425] Church, G. M., PCT Pat. Pub. No. WO 99/19341 (1999) [0426]
Cibelli, J. B. et al., Science, 280:1256-58 (1998) [0427] Clayerie,
J. M. et al., Biochimie, 67:437-43 (1985) [0428] Cole, S. P. et
al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss,
Inc., pp. 77-96 (1985) [0429] Cole-Strauss, A. et al., Science,
273:1386-9 (1996) [0430] Cordell, B., U.S. Pat. No. 5,387,742
(1995) [0431] Craig, N. L., Curr. Top. Microbiol. Immunol.
204:27-48 (1996) [0432] Cruickshank, K., U.S. Pat. No. 5,091,519
(1992) [0433] Damha, M. J. et al., Nucleic Acids Research, 18:
3813-21 (1990) [0434] Davis, R. W. et al., Advanced Bacterial
Genetics, CSHL Press, Cold Spring Harbor, N.Y. (1980) [0435]
Dellaporta, S. L., PCT Pat. Pub. No. WO 99/14373 (1999) [0436]
Devlin, J. P., High Throughput Screening, Marcel Dekker, New York
(1997) [0437] Dieffenbach, C. et al., PCR Primer: A Laboratory
Manual, CSHL Press, Cold Spring Harbor, N.Y. (1995) [0438]
Donehower, L. A. et al., U.S. Pat. No. 5,569,824 (1996) [0439]
Doolittle, R. F., Methods Enzymol., 183: 99-110 (1990) [0440]
Dorsel, A. et al., U.S. Pat. No. 5,945,679 (1999) [0441] Drenth,
J., Principles of Protein X-Ray Crystallography, Springer Verlag,
Germany (1999) [0442] Drmanac, R. T. et al., U.S. Pat. No.
5,202,231 (1993) [0443] Dubiley, S. et al., Nucleic Acids Res.,
25:2259-65 (1997) [0444] Duggan, D. J. et al., Nat. Genet., 21(1
Suppl): 10-4 (1999) [0445] Dujon, B. et al., U.S. Pat. No.
5,962,327 (1999) [0446] Dupuis, J. et al., Genetics, 151:373-86
(1999) [0447] Eckstein, F., Oligonucleotides and Analogues: A
Practical Approach, IRL Press, Oxford (1991). [0448] Eisen, M. B.
et al., Methods Enzymol., 303:179-205 (1999) [0449] Farr, S. B. et
al., U.S. Pat. No. 5,811,231 (1998) [0450] Fodor, S. P. A. et al.,
Science 251:767-73 (1991) [0451] Fodor, S. P. A. et al., U.S. Pat.
No. 5,445,934 (1995) [0452] Fodor, S. P. A. et al., U.S. Pat. No.
5,871,928 (1999) [0453] Foye, W. O. et al., Principles of Medicinal
Chemistry, Lippincott, Williams & Wilkins, Philadelphia (1995)
[0454] Frengen, E. et al., Genomics, 58:250-3 (1999) [0455]
Friedrich, G. et al., Genes Dev., 5:1513-23 (1991) [0456] Frommer,
M. et al., Proc. Natl. Acad. Sci. USA, 89:1827-31 (1992) [0457]
Fujiwara, T. et al., U.S. Pat. No. 4,329,591 (1982) [0458] Gait, M.
J., Oligonucleotide Synthesis: A Practical Approach, IRL Press,
Oxford (1984) [0459] Galbraith, D. W. et al., Methods Cell Biol.,
58:315-41 (1999) [0460] Gautier, C. et al., Nucleic Acids Res.
15:6625-41 (1987) [0461] Gebinoga, M. et al., Eur. J. Biochem.,
235:256-61 (1996) [0462] Gehrke, L. et al., U.S. Pat. No. 5,286,847
(1994) [0463] Ghosh, S. S. et al., Nucleic Acids Res., 15: 5353-72
(1987) [0464] Gimeno, C. J. et al., U.S. Pat. No. 5,948,639 (1999)
[0465] Gingeras, T. R. et al., PCT Pat. Pub. No. WO 88/10315 (1988)
[0466] Giordano, A. et al., U.S. Pat. No. 5,807,681 (1998) [0467]
Gish, et al., Science, 240: 1520-1522 (1988) [0468] Gjerde, D. T.
et al., PCT Pat. Pub. No. WO 99/19514 (1999) [0469] Gold, L. et al.
U.S. Pat. No. 5,270,163 (1993) [0470] Gold, L. et al. U.S. Pat. No.
5,475,096 (1995) [0471] Golic, K. G., Science, 252:958-61 (1991)
[0472] Golic, K. G., Genetics, 137:551-63 (1994) [0473] Golic, K.
G. et al., Genetics, 144:1693-711 (1996) [0474] Goodearl, A. D. J.,
U.S. Pat. No. 5,882,893 (1999) [0475] Goodman, M. et al., in
Burger's Medicinal Chemistry and Drug Discovery, Fifth Edition,
Vol. 1, John Wiley, New York, pp. 803-861 (1995) [0476] Gordon, E.
M. et al., Combinatorial Chemistry and Molecular Diversity in Drug
Discovery, John Wiley, New York (1998) [0477] Gordon, J. W., Int.
Rev. Cytol., 115:171-229 (1989) [0478] Gossen, J. A. et al., U.S.
Pat. No. 5,602,300 (1997) [0479] Graber, J. H. et al., Genet Anal.,
14:215-9 (1999) [0480] Groffen, J. et al., U.S. Pat. No. 5,491,283
(1996) [0481] Gu, H. et al., Science 265:103-6 (1994) [0482]
Guegler, K. J. et al., U.S. Pat. No. (1997) [0483] Guggenheimer, R.
A. et al., J. Biol. Chem., 259:7807-14 (1984) [0484] Hamilton, B.
A., et al., Proc. Natl. Acad. Sci. USA, 88:2731-5 (1991) [0485]
Hamilton, B. A., et al., Methods Cell Biol., 44:81-94 (1994) [0486]
Hammer, R. E., U.S. Pat. No. 5,489,742 (1996) [0487] Hansch, C. et
al., Comprehensive Medicinal Chemistry, Pergamon Press, Oxford
(1990) [0488] Harper, J. W. et al., U.S. Pat. No. 4,900,673 (1990)
[0489] Haseloff, J. et al., Nature, 334:585-91 (1988) [0490]
Hastings, G. A. et al., U.S. Pat. No. 5,501,969 (1996) [0491]
Haugland, R. P., Handbook of Fluorescent Probes and Research
Chemicals, 7.sup.th Ed., Molecular Probes Inc., Eugene, Oreg.
(1996) [0492] Hawkins, P. R. et al., U.S. Pat. No. 5,587,306 (1996)
[0493] Hearn, M. T. W., HPLC of Proteins, Peptides, and
Polynucleotides, VCH Publishers, New York (1991) [0494] Helene, C.,
Anticancer Drug Des., 6:569-84 (1991) [0495] Helene, C. et al.,
Ann. N.Y. Acad. Sci., 660:27-36 (1992) [0496] Helentjaris, T. et
al, U.S. Pat. No. 5,385,835 (1995) [0497] Hensel, M. et al.,
Science, 269:400-3 (1995) [0498] Hider, R. C. et al., Polypeptide
and Protein Drugs: Production, Characterization, and Formulation,
Ellis Horwood, New York (1991) [0499] Hillman, J. L. et al., U.S.
Pat. No. 5,843,727 (1998) [0500] Hong, Y. et al., Proc. Natl. Acad.
Sci. USA, 95:3679-84 (1998) [0501] Horlbeck, E. G., U.S. Pat. No.
5,880,972 (1999) [0502] Huang, S. H., Methods Mol. Biol., 69:89-96
(1997) [0503] Innis, M. et al., PCR Protocols: A Guide to Methods
and Applications, Academic Press, San Diego, Calif. (1990) [0504]
Inoue, H. et al., Nucleic Acids Res. 15:6131-48 (1987a) [0505]
Inoue, H. et al., FEBS Lett. 215:327-30 (1987b) [0506] Inouye, S.
et al., Nucleic Acids Res. 13:3101-9 (1985) [0507] Israel, L. et
al., U.S. Pat. No. 3,956,099 (1976) [0508] Jablonski, E. et al.,
Nucl. Acids. Res. 14:6115-28 (1986) [0509] Jakubowski, J. et al.,
Genetics 153:743-52 (1999) [0510] James, G. L. et al., Science,
260:1937-42 (1993) [0511] Johnson, D. F. et al., Gene., 94:9-14
(1990) [0512] Johnson, M. L. et al., Methods Enzymol., 240:51-68
(1994) [0513] Jones, D. H., in PCR Primer, CSHL Press, Cold Spring
Harbor, N.Y., pp. 411-20 (1995) [0514] Jones, T. et al., U.S. Pat.
No. 4,699,897 (1987) [0515] Kamb, A. U.S. Pat. No. 5,683,880 (1997)
[0516] Kambara, H., U.S. Pat. No. 5,541,420 (1996) [0517] Kandpal,
R. P. et al., Proc. Natl. Acad. Sci. USA, 91:88-92 (1994) [0518]
Karagyozov, L. et al., Nucleic Acids Res., 21:3911-2 (1993) [0519]
Karger, B. L. et al., U.S. Pat. No. 5,571,398 (1996) [0520] Keller
G. H. et al., DNA Probes, 2nd Ed., Stockton Press, New York, (1993)
[0521] Kenney, M. et al., Biotechniques, 25:516-21 (1998) [0522]
Kere, J. et al., Genomics, 14:241-8 (1992) [0523] Keseru, G. M. et
al., Molecular Mechanics and Conformational Analysis in Drug
Design, Blackwell Science, Boston (1999) [0524] Khrapko, K. R., et
al., U.S. Pat. No. 5,552,270 (1996) [0525] Kilby, N. J. et al.,
Trends Genet., 9:413-421 (1993) [0526] Kim, U. J. et al., Genomics,
22:336-9 (1994) [0527] Kirk, G. L. et al., U.S. Pat. No. 5,798,035
(1998) [0528] Kleckner, N. et al., Methods Enzymol., 204:139-80
(1991) [0529] Kleyn, P. W. et al., U.S. Pat. No. 5,876,919 (1999)
[0530] Kohara, Y. et al., Cell, 50:495-508 (1987) [0531] Kohler, G.
et al., Nature 256:495-7 (1975) [0532] Koob, M. et al., Science,
250:271-3 (1990) [0533] Kornberg, A. et al., DNA Replication, 2nd
Ed., Freeman, San Francisco (1992) [0534] Kozbor, D. et al.,
Immunology Today 4:72 (1983) [0535] Kozian, D. H. et al., Trends
Biotechnol., 17:73-8 (1999) [0536] Krishna, N. R. et al.,
Biological Magnetic Resonance--Vol. 16: Modern Techniques in
Protein NMR, Kluwer Academic Publishers, Netherlands (1999) [0537]
Krol et al., BioTechniques 6:958-76 (1988) [0538] Kruglyak, L.,
Nat. Genet., 22:139-44 (1999) [0539] Krzyzek, R. A. et al., U.S.
Pat. No. 5,384,253 (1995) [0540] Kunkel, T. A., U.S. Pat. No.
4,873,192 (1989) [0541] Kwoh, D. Y. et al., Proc. Natl. Acad. Sci.
USA, 86:1173-7 (1989) [0542] Ladner, R. C. et al., U.S. Pat. No.
4,946,778 (1990) [0543] Lagerstrom, M. et al., PCR Methods Applic.,
1: 111-9 (1991) [0544] Landegren, U. et al., Science, 241:1077-80
(1988) [0545] Lander, E. S. et al., Cold Spring Harb. Symp. Quant.
Biol., 51 Pt. 1:49-62 (1986) [0546] Lander, E. S. et al., Genetics,
121:185-99 (1989) [0547] Landers, J. P., Handbook of Capillary
Electrophoresis, CRC Press, Boca Raton, Fla. (1996) [0548] Lane, M.
J. et al., Nucleic Acids Res., 25:611-7 (1997) [0549] Lasko, M. et
al., Proc. Natl. Acad. Sci. USA, 89:6232-6 (1992) [0550] Lavitrano,
M. et al., Cell, 57:717-23 (1989) [0551] Lazzarini, R. A., U.S.
Pat. No. 5,602,299 (1997) [0552] Leder, P. et al., U.S. Pat. No.
5,175,383 (1992) [0553] Lee, F. et al., U.S. Pat. No. 5,908,609
(1999) [0554] Lee, L. G. et al., U.S. Pat. No. 5,945,526 (1999)
[0555] Lebo, R. V. et al., U.S. Pat. No. 5,723,593 (1998) [0556]
Lemaitre, M. et al., Proc. Natl. Acad. Sci. USA, 84:648-52 (1987)
[0557] Letsinger, R. L. et al., Proc. Natl. Acad. Sci. USA,
86:6553-6 (1989) [0558] Levinson, D. A. et al., U.S. Pat. No.
5,846,780 (1998) [0559] Li, C. et al., Nucleic Acids Res.,
21:1239-44 (1993) [0560] Li, H. et al., U.S. Pat. No. 5,650,295
(1997) [0561] Lin, F.-K., U.S. Pat. No. 4,703,008 (1987) [0562]
Liu, Y. G. et al., Genomics, 25:674-81 (1995) [0563] Lizardi, P. M.
et al., Nature Genetics, 19:225-32 (1998) [0564] Lizardi, P. M.,
U.S. Pat. No. 5,854,033 (1998) [0565] Lo, C. W., Mol. Cell. Biol.
3:1803-14 (1983) [0566] Lockhart, D. J. et al. Nature Biotechnology
14:1675-80 (1996) [0567] Logan, et al., Proc. Natl. Acad. Sci. USA,
81:3655-9 (1984) [0568] Lund, V. et al., Nucleic Acids Res.,
16:10861-80 (1988) [0569] Lundquist, R. C. et al., U.S. Pat. No.
5,508,468 (1996) [0570] Maher, L. J., Bioassays, 14:807-15 (1992)
[0571] Mandecki, W., U.S. Pat. No. 5,641,634 (1997) [0572]
Mandecki, W., U.S. Pat. No. 6,361,950 (2002) [0573] Martin, Y. C.,
Modern Drug Research, vol. 12, Marcel Dekker, New York, pp. 161-216
(1989) [0574] Marton, M. J. et al., Nat. Med., 4:1293-301 (1998)
[0575] Maskos U. et al., Nucleic Acids Research, 20: 1679-1684
(1992) [0576] Maskos, U. et al., Nucleic Acids Res., 21: 4663-9
(1993) [0577] Matthews, J. A. et al., Anal. Biochem., 169:1-25
(1988) [0578] Matson, R. S. et al., U.S. Pat. No. 5,429,807 (1995)
[0579] Maxam et al., Proc. Natl. Acad. Sci. USA, 74:560-4 (1977)
[0580] McRee, D. E., Practical Protein Crystallography, Academic
Press, New York (1999) [0581] Menchen, S. M. et al., U.S. Pat. No.
5,188,934 (1993) [0582] Meyer, U. A. et al., Annu. Rev. Pharmacol.
Toxicol., 37:269-96 (1997)
[0583] Miller, J. H., Experiments in Molecular Genetics, CSHL
Press, Cold Spring Harbor, N.Y. (1972) [0584] Mills, R. L., U.S.
Pat. No. 5,221,518 (1993) [0585] Mitchell, L. G. et al., Anal.
Biochem., 178:239-42 (1989) [0586] Moloney, M. M. et al., U.S. Pat.
No. 5,188,958 (1993) [0587] Montgomery, D. D., PCT Pat. Pub. No. WO
98/01221 (1998) [0588] Mosbach, K., Methods in Enzymology, Vol. 44,
Academic Press, New York (1976) [0589] Nikiforov, T. et al., U.S.
Pat. No. 5,952,174 (1999) [0590] Nuovo, G. J., PCR In situ
Hybridization: Protocols And Applications, Raven Press, New York
(1992) [0591] Ochman, H. et al., Genetics, 120:621-3 (1988) [0592]
Oefner, P. J. et al., U.S. Pat. No. 5,846,832 (1998) [0593]
Ogilvie, D. J. et al., Methods Mol. Biol., 54:131-138 (1996) [0594]
Ohler, L. D. et al., PCR Methods Appl., 2:51-9 (1992) [0595] Oin,
X.-O., U.S. Pat. No. 5,869,040 (1999) [0596] Osslund, T. D., U.S.
Pat. No. 5,581,476 (1996) [0597] Ostrander, E. A. et al., Proc.
Natl. Acad. Sci. USA, 89:3419-23 (1992) [0598] Paetkau, D.,
Biotechniques, 26:690-7 (1999) [0599] Panet, A., et al, Proc. Natl.
Acad. Sci. USA., 72:2535-9 (1975) [0600] Parce, J. W. et al., U.S.
Pat. No. 5,942,443 (1999) [0601] Pardridge, W. M. et al., PCT Pat.
Pub. No. WO 89/10134 (1989) [0602] Pastinen, T. et al., Genome
Res., 7:606-14 (1997) [0603] Pearson, W. R., Methods Enzymol.,
183:63-99 (1990) [0604] Pease, A. C. et al., Proc. Natl. Acad. Sci.
USA, 91: 5022-6 (1994) [0605] Perry, A. C. et al., Science,
284:1180-3 (1999) [0606] Pictet, R., in Molecular Recognition
Mechanisms, VCH Publishers, New York, pp. 219-35 (1991) [0607]
Pierce, G. F. et al., U.S. Pat. No. 5,824,643 (1998) [0608]
Pirrung, M. C. et al., U.S. Pat. No. 5,143,854 (1992) [0609]
Pirrung, M. C. et al., U.S. Pat. No. 5,405,783 (1995) [0610] Platt,
K. A., J. Biol. Chem., 269:28558-62 (1994) [0611] Polymeropoulos,
M. H. U.S. Pat. No. 5,378,602 (1995) [0612] Pon, R. T. et al.,
Biotechniques, 6:768-75 (1988) [0613] Pon, R. T., Methods Mol.
Biol., 20:465-96 (1993) [0614] Popoff, M. Y. et al., U.S. Pat. No.
5,618,666 (1997) [0615] Porter, K. W. et al., Nucleic Acids Res.,
25:1611-7 (1997) [0616] Powers, D. B. et al., U.S. Pat. No.
5,795,761 (1998) [0617] Press, W. H. et al., in Numerical Recipes
in C, Cambridge University Press, pp. 398-470 (1988) [0618] Rabani,
E. M., PCT Pat. Pub. No. WO 96/36737 (1996) [0619] Rabani, E. M.,
PCT Pat. Pub. No. WO 97/07245 (1997) [0620] Rembaum, A. et al.,
U.S. Pat. No. 4,046,720 (1977) [0621] Rembaum, A., U.S. Pat. No.
4,413,070 (1983) [0622] Rembaum, A., U.S. Pat. No. 4,678,814 (1987)
[0623] Richterich, P. et al., Methods Enzymol., 218:187-222 (1993)
[0624] Rigas, B. et al., Proc. Natl. Acad. Sci. USA, 83:9591-5
(1986) [0625] Riley, J. H. et al., Nucleic Acids Res., 18:2887-90
(1990) [0626] Robinson, M. O. et al., U.S. Pat. No. 5,489,743
(1996) [0627] Rose, M. D. et al., Methods in Yeast Genetics, CSHL
Press, Cold Spring Harbor, N.Y. (1990) [0628] Rosenthal, A., PCT
Pat. Pub. No. WO 93/21340 (1993) [0629] Rossi, J., Current Biology,
4:469-71 (1994) [0630] Rothschild, M. F. et al., U.S. Pat. No.
5,550,024 (1996) [0631] Rubenstein, K. E. et al., U.S. Pat. No.
4,190,496 (1980) [0632] Rubin, E. J. et al., Proc. Natl. Acad. Sci.
USA, 96:1645-50 (1999) [0633] Ruley, H. E. et al., U.S. Pat. No.
5,627,058 (1997) [0634] Ruther U. et al., EMBO J., 2:1791-4 (1983)
[0635] Sabatini, C. E. et al., U.S. Pat. No. 5,624,803 (1999)
[0636] Sagner, G. et al., U.S. Pat. No. 5,714,318 (1998) [0637]
Saiki, R. K. et al., Proc. Natl. Acad. Sci. USA, 86:6230-4 (1989)
[0638] Sambrook et al., Molecular Cloning: A Laboratory Manual,
CSHL Press, New York (1989) [0639] Samal, B. B., U.S. Pat. No.
5,874,399 (1999) [0640] Sands, A. et al., PCT Pat. Pub. No. WO
98/14614 (1998) [0641] Sanger, F. et al., Proc. Natl. Acad. Sci.
USA, 74:5463-7 (1977) [0642] Santamaria, P. et al., U.S. Pat. No.
5,629,149 (1997) [0643] Sapolsky, R. J. et al., Genet. Anal.,
14:187-92 (1999) [0644] Sarin, P. S. et al., Proc. Natl. Acad. Sci.
USA, 85:7448-51 (1988) [0645] Sarver, N. et al., Science,
247:1222-5 (1990) [0646] Schena, M. et al, Science, 270:467-70
(1995) [0647] Schmidt, G. et al., PCT Pat. Pub. No. WO 99/02726
(1999) [0648] Scheit, Nucleotide Analogs, John Wiley, New York
(1980) [0649] Sedivy, J. M. et al., Proc. Natl. Acad. Sci. USA,
86:227-31 (1989) [0650] Sherman, A. et al., Nat. Biotechnol.,
16:1050-3 (1998) [0651] Shin, J. A. et al., Nucleic Acids Res.,
19:5233-6 (1991) [0652] Shuber, A. P., U.S. Pat. No. 5,589,330
(1996) [0653] Shukla, A. K., U.S. Pat. No. 5,340,449 (1994) [0654]
Silver, J. et al., U.S. Pat. No. 4,994,370 (1991) [0655]
Singh-Gasson, S. et al., Nature Biotechnology, 17: 974-78 (1999)
[0656] Sisto A. et al., U.S. Pat. No. 4,522,752 (1985) [0657]
Skarnes, W. C. et al., Proc. Natl. Acad. Sci. USA, 92:6592-6 (1995)
[0658] Skolnick, M. H. et al., U.S. Pat. No. 5,624,819 (1997)
[0659] Small, J. A. et al., Mol. Cell. Biol. 5:642-648 (1985)
[0660] Smih, F. et al., Nucleic Acids Res. 23:5012-19 (1995) [0661]
Smith, G. E. et al., Mol. Cell. Biol., 3:2156-65 (1983) [0662]
Smith, G. E. et al., U.S. Pat. No. 4,745,051 (1988) [0663] Smith,
V. et al., Proc. Natl. Acad. Sci. USA, 92:6479-83 (1995) [0664]
Smithies, O. et al., Nature, 317:230-4 (1985) [0665] Sorge, J. et
al, Proc. Natl. Acad. Sci. USA, 86:9208-12 (1989) [0666] Southern,
E. et al., Genomics, 13: 1008-17 (1992) [0667] Southern, E., U.S.
Pat. No. 5,700,637 (1997) [0668] Souza, L. M., U.S. Pat. No.
4,810,643 (1989) [0669] Souza, L. M., U.S. Pat. No. 5,104,806
(1992) [0670] Stein, C. A. et al., Nucleic Acids Res. 16:3209-21
(1988) [0671] Stemmer, W. P. C., U.S. Pat. No. 5,605,793 (1997)
[0672] Stern, M. E. et al., U.S. Pat. No. 5,863,892 (1999) [0673]
Stewart, C. L., Methods Enzymol., 225:823-55 (1993) [0674] Still,
W. C. et al., U.S. Pat. No. 5,565,324 (1996) [0675] Stockham, T. G.
et al., U.S. Pat. No. 5,273,632 (1993) [0676] Stone, E. M. et al.,
U.S. Pat. No. 5,916,778 (1999) [0677] Strathmann, M. et al., Proc.
Natl. Acad. Sci. USA, 88:1247-50 (1991) [0678] Stulich, R. et al.,
Comput. Appl. Biosci., 5:15-8 (1989) [0679] Suhai, S., Theoretical
and Computational Methods in Genome Research., Plenum, New York
(1997) [0680] Sutcliffe, J. G. et al., U.S. Pat. No. 5,968,817
(1999) [0681] Swensen, J., Biotechniques, 20: 486-491 (1996) [0682]
Szybalski, W., Curr. Opin. Biotechnol., 8: 75-81 (1997) [0683]
Taidi-Laskowski, B. et al., Nucleic Acids Res., 16:8157-69 (1988)
[0684] Takagi, S. et al., Biotechniques, 14:218-21 (1993) [0685]
Tartaglia, L. A. U.S. Pat. No. 5,861,485 (1999) [0686] Taylor, M.
D. et al., Peptide-Based Drug Design: Controlling Transport and
Metabolism, American Chemical Society, Washington, D.C. (1994)
Telenius, H. et al., Genomics, 13:718-25 (1992) [0687] Terhorst, C.
P. et al., U.S. Pat. No. 5,530,179 (1996) [0688] Thayer, J. R. et
al., Methods Enzymol., 271:147-74 (1996) [0689] Thomas, K. R. et
al., Cell, 51:503-12 (1987) [0690] Thompson, S. et al., Cell,
56:313-21 (1989) [0691] Trulson, M. et al, U.S. Pat. No. 5,834,758
(1998) [0692] Tullis, R. H., U.S. Pat. No. 4,904,582 (1990) [0693]
Uhlman et al., Chemical Reviews, 90: 543-84 (1990) [0694] Umari, P.
et al., Genetics, 143:1831-42 (1996) [0695] Urdea, M. S., U.S. Pat.
No. 5,124,246 (1992) [0696] van der Krol, A. R. et al.,
Biotechniques, 6:958-76 (1988) [0697] van der Putten, H. et al.,
Proc. Natl. Acad. Sci. USA, 82:6148-52 (1985) [0698] Van Heeke, G.
et al., J. Biol. Chem. 264:5503-9 (1989) [0699] VanNess, J. et al.,
PCT Pat. Pub. No. WO 97/27331 (1997) [0700] Veerapandian, B., in
Burger's Medicinal Chemistry and Drug Discovery, Vol. 1, John
Wiley, New York, pp. 303-48 (1995) [0701] Velculescu, V. E. et al.,
Science, 270:484-7 (1995) [0702] Venton, D. L. et al., U.S. Pat.
No. 5,814,460 (1998) [0703] Vidal, M. et al., Trends Biotechnol.,
17:374-81 (1999) [0704] Walker, G. T. et al., Nucleic Acids Res.,
20:1691-6 (1992) [0705] Walker, G. T., U.S. Pat. No. 5,270,184
(1993) [0706] Wagner, M. J. et al., Proc. Natl. Acad. Sci. USA,
78:1441-5 (1981) [0707] Wagner, R., Nature 372:333-5 (1994) [0708]
Wagner, T. E. et al, U.S. Pat. No. 4,873,191 (1989) [0709] Wang, D.
G. et al., Science, 280:1077-82 (1998) [0710] Wachsman, W. et al.,
U.S. Pat. No. 5,616,475 (1997) Webb, D. M., U.S. Pat. No. 5,948,953
(1999) [0711] Webb, T. R. et al., U.S. Pat. No. 4,659,774 (1987)
[0712] Wei, Y.-F. et al., U.S. Pat. No. 5,723,311 (1998) [0713]
Wei, Y.-F. et al., U.S. Pat. No. 5,858,705 (1999) [0714] Weiler, J.
et al., Nucleic Acids Res., 25:2792-9 (1997) [0715] Weiner, D. B.
et al., Biological Approaches to Rational Drug Design, CRC Press,
Boca Raton, Fla. (1994) [0716] Weiner, D. B. et al., Chemical and
Structural Approaches to Rational Drug Design, CRC Press, Boca
Raton, Fla. (1995) [0717] Weinshilboum, R. M. et al., U.S. Pat. No.
5,470,737 (1995) [0718] Weissmann, C., U.S. Pat. No. 4,530,901
(1985) [0719] Weston, A. et al., HPLC and CE: Principles and
Practice, Academic Press, San Diego, Calif. (1997) [0720] Wilkie,
T. M. et al., Methods Enzymol., 237:327-44 (1994) [0721] Wilson, S.
R. et al., Combinatorial Chemistry: Synthesis and Application, John
Wiley, New York (1997) [0722] Wolf, S. F. et al., Nucleic Acids
Res., 15: 2911-26 (1987) [0723] Wolff, M. E., Burger's Medicinal
Chemistry and Drug Discovery, Fifth Edition, John Wiley, New York
(1995) [0724] Wong, W. H., U.S. Pat. No. 5,935,793 (1999) [0725] Wu
C. et al., Nucleic Acids Research, 24:2614-5 (1996) [0726] Xiong,
M. et al., Am. J. Hum. Genet., 64:629-40 (1999) [0727] Xu, L. et
al., Anal. Chem., 69:3595-602 (1997) [0728] Xu, T. et al.,
Development, 117:1223-37 (1993) [0729] Yamamoto, T. et al., Cell,
22:787-97 (1980) [0730] Yamashita, T. et al., U.S. Pat. No.
5,332,668 (1994) [0731] Ye, S. et al., Mol. Med. Today, 4:431-7
(1998) [0732] Yoder, J. I. et al., U.S. Pat. No. 5,225,341 (1993)
[0733] Yoshida, Y. et al., Nucleic Acids Res., 21:3553-62 (1993)
[0734] Zaug, A. J. et al., Science, 224:574-8 (1984) [0735] Zaug,
A. J. et al., Science, 231:470-5 (1986a) [0736] Zaug, A. J. et al.,
Nature, 324:429-33 (1986b) [0737] Zhang, D. Y. et al., Gene, 211:
277-85 (1998) [0738] Zhao, H. et al., Nat. Biotechnol., 16:258-61
(1998) [0739] Zon, G., Pharm. Res. 5:539-49 (1988) [0740] Zukowski,
M. M. et al., U.S. Pat. No. 4,914,031 (1990)
Sequence CWU 1
1
49133DNAArtificial SequenceSynthetic Tag 1cagcaccagg aaggtggcca
ggttggcagt gta 33233DNAArtificial SequenceSynthetic Tag 2cctagctctc
ttgaagtcat cggccagggt gga 33326DNAArtificial SequenceSynthetic Tag
3atcaagctta tggatcccgt cgacct 26433DNAArtificial SequenceSynthetic
Tag 4ggtgctcgtg tctttatcgt ccctacgtct ctt 33528DNAArtificial
SequenceSynthetic Tag 5aattttgaag ttagctttga ttccattc
28630DNAArtificial SequenceSynthetic Tag 6ggcgtcctgc tgcagtctgg
cattggggaa 30727DNAArtificial SequenceSynthetic Tag 7attgaagatg
gaggcgttca actagca 27833DNAArtificial SequenceSynthetic Tag
8gatgaactat acaagcttat gtccagactt cca 33927DNAArtificial
SequenceSynthetic Tag 9aagggcagat tggtaggaca ggtaatg
271023DNAArtificial SequenceSynthetic Tag 10ccgtcgggca tccgcgcctt
gag 231133DNAArtificial SequenceSynthetic Tag 11tacattgtgt
gagttgaagt tgtattccaa ttt 331295DNAArtificial SequenceSample tag
12atttaggtga cactatagaa ctcgaccagt acattgtgtg agttgaagtt gtattccaat
60ttctgaagct tgcatgcctg caggtcgact ctaga 951313DNAArtificial
SequenceVector polylinker 13gatctgccgg tct 131424DNAArtificial
SequencePrimer 14ggtgacacta tagaactcga gcag 241518DNAArtificial
SequencePrimer 15caggcatgca agcttcag 181620DNAArtificial
SequencePrimer 16cactatcgac tacgcgatca 2017113DNAArtificial
SequenceVector polylinker 17gaattccatg ttgttggggc gcgcctccat
caacgtggat ccatcgagac ggtccagagc 60tcagtggcgc atgcaatgct ccaactgcag
gttagccatg gttgcccaag ctt 1131812DNAArtificial SequenceAdapter
18tgagtcacca ac 121925DNAArtificial SequenceSynthetic Tag
19tcaatcgact acactcgtaa caaga 252025DNAArtificial SequenceSynthetic
Tag 20gatcaattcg ctaatcgatc gtata 252125DNAArtificial
SequenceSynthetic Tag 21aaatagatcg cataagcagt acgtg
252225DNAArtificial SequenceSynthetic Tag 22tcataggctg acagtcctag
ctagt 252325DNAArtificial SequenceSynthetic Tag 23tcgtagacag
tacatgtcga tgaat 252425DNAArtificial SequenceSynthetic Tag
24taaccgatct agtcgatcta cgact 252525DNAArtificial SequenceSynthetic
Tag 25gtttcgagct agctaagaga ctcgt 252625DNAArtificial
SequenceSynthetic Tag 26cgtatttcga ctgactagcc tctag
252725DNAArtificial SequenceSynthetic Tag 27agttcgatca gctaactctg
agtca 252825DNAArtificial SequenceSynthetic Tag 28gctatatcga
tcgtccatta acgta 252918DNAArtificial SequencePrimer 29gggcaaccat
ggctaacc 183021DNAArtificial SequencePrimer 30ctgaatctta ccaacgctaa
c 213118DNAArtificial SequencePrimer 31atccatcgag acggtcca
183219DNAArtificial SequencePrimer 32caacgtggat ccatcgaga
193320DNAArtificial SequenceAdapter 33gctcattgcg gtagcatacc
203410DNAArtificial SequenceAdapter 34ggtatgctac
103520DNAArtificial SequenceAdapter 35gcgtggccta ctacgattgt
203610DNAArtificial SequenceAdapter 36tcaatcgtag
103720DNAArtificial SequenceAdapter 37gacgtagcga actagggcag
203810DNAArtificial SequenceAdapter 38ctgccctagt
103920DNAArtificial SequenceAdapter 39gcaagcagcc tacgcattat
204010DNAArtificial SequencePolylinker 40ataatgcgta
104141DNAArtificial SequencePolylinker 41ggatccgcgg ccgcacgtga
ctagcatggc ccgggcgatc c 414230DNAArtificial SequencePrimer
42gtcagcggcc gcatccatcg agacggtcca 304324DNAArtificial
SequencePrimer 43aattggaatc aataaagccc tgcg 244422DNAArtificial
SequencePrimer 44acgactgtgc tggtcattaa ac 224519DNAArtificial
SequencePrimer 45tgatgaatgt tccgttgcg 194619DNAArtificial
SequencePrimer 46cgtattcagg ctgaccctg 194716DNAArtificial
SequencePrimer 47cgctgcccgg attaca 164819DNAArtificial
SequencePrimer 48tgtaaaacga cggccagtg 194922DNAArtificial
SequencePrimer 49caggaaacag ctatgaccat ga 22
* * * * *