U.S. patent application number 11/787428 was filed with the patent office on 2008-08-21 for kgf polypeptide compositions.
This patent application is currently assigned to Novartis Vaccines and Diagnostics, Inc.. Invention is credited to Kenneth Crawford, Denis J. Gospodarowicz, W. Michael Kavanaugh.
Application Number | 20080200378 11/787428 |
Document ID | / |
Family ID | 23217561 |
Filed Date | 2008-08-21 |
United States Patent
Application |
20080200378 |
Kind Code |
A1 |
Gospodarowicz; Denis J. ; et
al. |
August 21, 2008 |
KGF polypeptide compositions
Abstract
Compositions comprising keratinocyte growth factor (KGF)
polypeptides and methods of using the same are described. The KGF
polypeptides of the present invention display enhanced bioactivity
relative to full-length KGF.sub.163. Accordingly, the KGF
polypeptides of the present invention may be used in compositions
in lesser amounts than would be necessary using KGF.sub.163.
Inventors: |
Gospodarowicz; Denis J.;
(Lafayette, CA) ; Kavanaugh; W. Michael; (Mill
Valley, CA) ; Crawford; Kenneth; (Alameda,
CA) |
Correspondence
Address: |
NOVARTIS VACCINES AND DIAGNOSTICS INC.
INTELLECTUAL PROPERTY R338, P.O. BOX 8097
Emeryville
CA
94662-8097
US
|
Assignee: |
Novartis Vaccines and Diagnostics,
Inc.
|
Family ID: |
23217561 |
Appl. No.: |
11/787428 |
Filed: |
April 16, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10227185 |
Aug 21, 2002 |
7265089 |
|
|
11787428 |
|
|
|
|
60313881 |
Aug 21, 2001 |
|
|
|
Current U.S.
Class: |
514/9.2 ;
435/375 |
Current CPC
Class: |
A61P 1/00 20180101; A61P
43/00 20180101; A61P 17/02 20180101; A61P 27/02 20180101; A61P 1/04
20180101; A61K 38/1825 20130101; C07K 14/50 20130101; A61P 17/00
20180101 |
Class at
Publication: |
514/12 ;
435/375 |
International
Class: |
A61K 38/16 20060101
A61K038/16; C12N 5/02 20060101 C12N005/02 |
Claims
1. A composition comprising: (a) a therapeutically effective amount
of a KGF polypeptide, wherein said KGF polypeptide is selected from
the group consisting of: (i) KGF.sub.des1-22 consisting of the
contiguous amino acid sequence depicted at amino acid residues
23-163, inclusive, of SEQ ID NO:26; (ii) a biologically active
analog of (i), wherein said biologically active analog consists of
the contiguous amino acid sequence depicted at amino acid residues
23-163, inclusive, of SEQ ID NO:26 with up to 7 amino acid
substitutions; and (iii) the polypeptide of (i) or (ii), consisting
of the amino acid sequence of (i) or (ii), respectively, and an
additional N-terminal methionine, wherein said KGF polypeptide
exhibits an increase in bioactivity relative to mature,
full-length, KGF (KGF.sub.163) as determined by the Balb/MK
bioactivity assay and specifically stimulates epithelial cell
proliferation, and further wherein the therapeutically effective
amount is 75% or less of the amount on a per molecule basis of
KGF.sub.163 needed to elicit an equivalent therapeutic response;
and (b) a pharmaceutically acceptable excipient.
2. The composition of claim 1, wherein said KGF polypeptide is
KGF.sub.des1-22 consisting of the contiguous amino acid sequence
depicted at amino acid residues 23-163, inclusive, of SEQ ID
NO:26.
3. The composition of claim 1, wherein the therapeutically
effective amount is 10% to 50% of the amount on a per molecule
basis of the amount of KGF.sub.163 needed to elicit an equivalent
therapeutic response.
4. The composition of claim 1, wherein the therapeutically
effective amount is 10% to 25% of the amount on a per molecule
basis of the amount of KGF.sub.163 needed to elicit an equivalent
therapeutic response.
5. The composition of claim 1, wherein the therapeutically
effective amount is 10% to 20% of the amount on a per molecule
basis of the amount of KGF.sub.163 needed to elicit an equivalent
therapeutic response.
6. A method of stimulating epithelial cell proliferation comprising
contacting epithelial cells with a composition according to claim
1.
7. The method of claim 6, wherein said biologically active analog
consists of the contiguous amino acid sequence depicted at amino
acid residues 23-163, inclusive, of SEQ ID NO:26 with the
N-terminal arginine residue substituted with an alanine
residue.
8. The method of claim 6, wherein said KGF polypeptide is
KGF.sub.des1-22 consisting of the contiguous amino acid sequence
depicted at amino acid residues 23-163, inclusive, of SEQ ID
NO:26.
9. The method of claim 6, wherein the therapeutically effective
amount is 10% to 50% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
10. The method of claim 6, wherein the therapeutically effective
amount is 10% to 25% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
11. The method of claim 6, wherein the therapeutically effective
amount is 10% to 20% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
12. The method of claim 6, wherein said contacting is done in
vitro.
13. The method of claim 6, wherein said contacting is done in
vivo.
14. A method of treating wounds comprising applying a KGF
polypeptide composition according to claim 1 to an area of a wound
to be treated and allowing the wound to heal.
15. The method of claim 14, wherein said KGF polypeptide is
KGF.sub.des1-22 consisting of the contiguous amino acid sequence
depicted at amino acid residues 23-163, inclusive, of SEQ ID
NO:26.
16. The method of claim 14, wherein the therapeutically effective
amount is 10% to 50% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
17. The method of claim 14, wherein the therapeutically effective
amount is 10% to 25% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
18. The method of claim 14, wherein the therapeutically effective
amount is 10% to 20% of the amount on a per molecule basis of the
amount of KGF.sub.163 needed to elicit an equivalent therapeutic
response.
19. The method of claim 14, wherein said contacting is done in
vitro.
20. The method of claim 14, wherein said contacting is done in
vivo.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation application of U.S.
patent application Ser. No. 10/227,185, filed Aug. 21, 2002 from
which priority is claimed pursuant to 35 U.S.C. .sctn.120 and
claims the benefit of provisional patent application Ser. No.
60/313,881, filed Aug. 21, 2001, pursuant to 35 USC
.sctn.119(e)(1), which applications are incorporated herein by
reference in their entireties.
TECHNICAL FIELD
[0002] The present invention relates generally to polypeptide
growth factors. Specifically, the invention relates to compositions
comprising keratinocyte growth factor polypeptides and methods of
using the same.
BACKGROUND OF THE INVENTION
[0003] Keratinocyte growth factor (KGF) belongs to the family of
fibroblast growth factors ("FGFs"), the prototypes of which are
represented by basic FGF and acidic FGF. KGF is also known as
FGF-7. KGF, like FGFs, binds heparin and is generally capable of
stimulating the proliferation and differentiation of a variety of
cell types derived from the primary or secondary mesoderm as well
as from neuroectoderm. For example, KGF, like FGFs, has the ability
to induce the differentiation and proliferation of ventral as well
as dorsal mesoderm in early blastulae. See, e.g., Gospodarowicz et.
al. Cell. Biol. Rev. (1991) 25:307-314; and Basilico et al. Adv.
Cancer Res. (1992) 59:115-165.
[0004] Like other FGFs, KGF is a heparin-binding protein, but
unlike other FGFs, it has a unique target cell specificity.
Particularly, KGF is similar to other FGFs in its ability to
stimulate epithelial cell proliferation, but is dissimilar to other
FGFs in its inability to stimulate endothelial cells or fibroblast
proliferation. See, e.g., Finch, et. al. Science (1989) 245:
752-755. Mature, full-length KGF, designated herein as KGF.sub.163,
is a polypeptide with 163 amino acid residues, and possesses a
potential N-glycosylation site that extends from amino acid residue
14 to 16 at the N-terminus. Finch, et. al. Science (1989) 245:
752-755.
[0005] Ron et al. J. Biol. Chem. (1993) 268:2984-2988 found that
when KGF.sub.163 was expressed in a prokaryotic expression system,
a recombinant KGF ("rKGF") polypeptide could be obtained that
possessed mitogenic activity. When the rKGF molecule was truncated
by deletion of 3, 8, 27, 38, and 48 amino acid residues from the
N-terminus of the mature KGF.sub.163 polypeptide, biological
activity of the resulting molecules varied. With deletion of 3 and
8 amino acid residues, respectively, the mitogenic activity of the
resulting molecules did not appear to be affected as compared to
full-length rKGF. Deletion of 27 amino acid residues, however,
resulted in molecules that displayed 10-20 fold reduced mitogenic
activity. Deletion of 38 and 48 amino acid residues, respectively,
resulted in complete loss of mitogenic activity and heparin-binding
ability. Ron et al., however, failed to produce any truncated rKGF
fragments that possessed increased mitogenic activity as compared
to the full-length rKGF molecule.
[0006] U.S. Pat. Nos. 5,677,278, 5,773,586, 5,843,883, 5,863,767
and 6,074,848, all to Gospodarowicz et al., describe KGF molecules.
One particular molecule, with an N-terminal deletion of 23 amino
acid residues, termed KGF.sub.des1-23, demonstrates enhanced
mitogenic activity as compared to mature, full-length recombinant
KGF.sub.163.
[0007] Osslund et al. Protein Sci. (1998) 7:1681-1690 reports
various N-terminal truncated KGF molecules and certain measurements
of their mitogenic activity. Similarly, International Publications
WO 96/11951 and WO 96/11949 describe KGF molecules with various
N-terminal truncations and amino acid substitutions.
DISCLOSURE OF THE INVENTION
[0008] The present invention is based on the discovery that various
N-terminally truncated KGF polypeptides, and analogs thereof,
display enhanced biological activity on a per molecule basis
relative to native, full-length KGF.sub.163. Thus, compositions
containing these molecules have increased potency for the treatment
of conditions where epithelialization is required, such as for the
treatment of wounds, burns, ophthalmic disorders, gastrointestinal
diseases and any disorder where stimulation of epithelial cell
proliferation or regeneration is desired. These molecules can be
delivered alone or in combination with other mitogenic agents, such
as other growth factors, including for example, any of the other
FGFs, as well as platelet derived growth factor (PDGF), epidermal
growth factor (EGF), insulin-like growth factor (IGF), insulin-like
growth factor binding proteins (IGFBPs), and the like.
[0009] Moreover, these KGF molecules can be conjugated to toxin
molecules in order to target these toxins to epithelial cells in
order to treat hyperproliferative diseases.
[0010] Accordingly, in one embodiment, the subject invention is
directed to a method of stimulating epithelial cell proliferation.
The method comprises contacting epithelial cells with a composition
comprising:
[0011] (a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is selected from the group consisting
of: [0012] (i) KGF.sub.des1-15 consisting of the contiguous amino
acid sequence depicted at amino acid residues 16-163, inclusive, of
FIG. 1; [0013] (ii) KGF.sub.des1-18 consisting of the contiguous
amino acid sequence depicted at amino acid residues 19-163,
inclusive, of FIG. 1; [0014] (iii) KGF.sub.des1-19 consisting of
the contiguous amino acid sequence depicted at amino acid residues
20-163, inclusive, of FIG. 1; [0015] (iv) KGF.sub.des1-20
consisting of the contiguous amino acid sequence depicted at amino
acid residues 21-163, inclusive, of FIG. 1; [0016] (v)
KGF.sub.des1-21 consisting of the contiguous amino acid sequence
depicted at amino acid residues 22-163, inclusive, of FIG. 1;
[0017] (vi) KGF.sub.des1-22 consisting of the contiguous amino acid
sequence depicted at amino acid residues 23-163, inclusive, of FIG.
1; [0018] (vii) KGF.sub.des1-24 consisting of the contiguous amino
acid sequence depicted at amino acid residues 25-163, inclusive, of
FIG. 1; [0019] (viii) KGF.sub.des1-25 consisting of the contiguous
amino acid sequence depicted at amino acid residues 26-163,
inclusive, of FIG. 1; [0020] (ix) a biologically active analog of
(i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), wherein the
biologically active analog consists of the same number of amino
acids as (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii),
respectively, and has at least 70% sequence homology thereto,
[0021] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 75% or less of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0022] (b) a pharmaceutically acceptable excipient.
[0023] In certain embodiments, the biologically active analog has
at least 80% or 90% sequence homology to (i), (ii), (iii), (iv),
(v), (vi), (vii), (viii) or (ix).
[0024] In another embodiment, the invention is directed to a method
as described above wherein the KGF polypeptide is KGF.sub.des1-22
consisting of the contiguous amino acid sequence depicted at amino
acid residues 23-163, inclusive, of FIG. 1, or a biologically
active analog thereof wherein the biologically active analog
consists of 141 amino acids and has at least 70% sequence homology
thereto, and wherein the therapeutically effective amount is 50% or
less of the amount on a per molecule basis of KGF.sub.163 needed to
elicit an equivalent therapeutic response.
[0025] In yet further embodiments, the invention is directed to a
method as described above wherein the KGF polypeptide is
KGF.sub.des1-24 consisting of the contiguous amino acid sequence
depicted at amino acid residues 25-163, inclusive, of FIG. 1, or a
biologically active analog thereof wherein the biologically active
analog consists of 139 amino acids and has at least 70% sequence
homology thereto, and wherein the therapeutically effective amount
is 50% or less of the amount on a per molecule basis of KGF.sub.163
needed to elicit an equivalent therapeutic response.
[0026] In a further embodiment, the invention is directed to a
method of stimulating epithelial cell proliferation which comprises
contacting epithelial cells with a composition comprising:
[0027] a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is (i) KGF.sub.des1-22 consisting of
the contiguous amino acid sequence depicted at amino acid residues
23-163, inclusive, of FIG. 1, or (ii) a biologically active analog
of (i) which consists of the same number of amino acids as (i) and
has at least 70% sequence homology thereto,
[0028] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 10% to 75% of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0029] (b) a pharmaceutically acceptable excipient.
[0030] In certain embodiments, the biologically active analog has
at least 80% or 90% sequence homology to (i) or (ii).
[0031] In other embodiments, the biologically active analog
consists of the contiguous amino acid sequence depicted at amino
acid residues 23-163, inclusive, of FIG. 1 with the N-terminal
arginine residue substituted with an alanine residue.
[0032] In still further embodiments, the therapeutically effective
amount is 10% to 20%, or 10% to 25%, or 10% to 50% of the amount on
a per molecule basis, or any percentage within these ranges, of the
amount of full-length KGF needed to elicit an equivalent
therapeutic response.
[0033] In another embodiment, the invention is directed to a method
of stimulating epithelial cell proliferation comprising contacting
epithelial cells with a composition comprising:
[0034] a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is (i) KGF.sub.des1-24 consisting of
the contiguous amino acid sequence depicted at amino acid residues
25-163, inclusive, of FIG. 1, or (ii) a biologically active analog
of (i) which consists of the same number of amino acids as (i) and
has at least 70% sequence homology thereto,
[0035] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 5% to 75% of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0036] (b) a pharmaceutically acceptable excipient.
[0037] In certain embodiments of the method described above, the
biologically active analog has at least 80% or at least 90%
sequence homology to (i) or (ii).
[0038] In additional embodiments, the therapeutically effective
amount is 5% to 10%, 10% to 20%, 10% to 25%, or 10% to 50%, or any
percentage within these ranges, of the amount on a per molecule
basis of the amount of full-length KGF needed to elicit an
equivalent therapeutic response.
[0039] In all of the methods described above, epithelial cells may
be contacted with the KGF polypeptides in vitro or in vivo.
[0040] In another embodiment, the invention is directed to a method
of treating wounds comprising applying a KGF polypeptide
composition to an area of a wound to be treated and allowing the
wound to heal. The composition comprises:
[0041] (a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is selected from the group consisting
of: [0042] (i) KGF.sub.des1-15 consisting of the contiguous amino
acid sequence depicted at amino acid residues 16-163, inclusive, of
FIG. 1; [0043] (ii) KGF.sub.des1-18 consisting of the contiguous
amino acid sequence depicted at amino acid residues 19-163,
inclusive, of FIG. 1; [0044] (iii) KGF.sub.des1-19 consisting of
the contiguous amino acid sequence depicted at amino acid residues
20-163, inclusive, of FIG. 1; [0045] (iv) KGF.sub.des1-20
consisting of the contiguous amino acid sequence depicted at amino
acid residues 21-163, inclusive, of FIG. 1; [0046] (v)
KGF.sub.des1-21 consisting of the contiguous amino acid sequence
depicted at amino acid residues 22-163, inclusive, of FIG. 1;
[0047] (vi) KGF.sub.des1-22 consisting of the contiguous amino acid
sequence depicted at amino acid residues 23-163, inclusive, of FIG.
1; [0048] (vii) KGF.sub.des1-24 consisting of the contiguous amino
acid sequence depicted at amino acid residues 25-163, inclusive, of
FIG. 1; [0049] (viii) KGF.sub.des1-25 consisting of the contiguous
amino acid sequence depicted at amino acid residues 26-163,
inclusive, of FIG. 1; [0050] (ix) a biologically active analog of
(i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), wherein the
biologically active analog consists of the same number of amino
acids as (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii),
respectively, and has at least 70% sequence homology thereto,
[0051] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 75% or less of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0052] (b) a pharmaceutically acceptable excipient.
[0053] In certain embodiments of the above method, the biologically
active analog has at least 80% or 90% sequence homology to (i),
(ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix).
[0054] In additional embodiments of the above method, the KGF
polypeptide is KGF.sub.des1-22 consisting of the contiguous amino
acid sequence depicted at amino acid residues 23-163, inclusive, of
FIG. 1, or a biologically active analog thereof wherein the
biologically active analog consists of 141 amino acids and has at
least 70% sequence homology thereto, and wherein the
therapeutically effective amount is 50% or less of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response.
[0055] In other embodiments of the above method, the KGF
polypeptide is KGF.sub.des1-24 consisting of the contiguous amino
acid sequence depicted at amino acid residues 25-163, inclusive, of
FIG. 1, or a biologically active analog thereof wherein the
biologically active analog consists of 139 amino acids and has at
least 70% sequence homology thereto, and wherein the
therapeutically effective amount is 50% or less of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response.
[0056] In still further embodiments, the invention is directed to a
method of treating wounds comprising applying a KGF polypeptide
composition to an area of a wound to be treated and allowing the
wound to heal, said composition comprising:
[0057] a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is (i) KGF.sub.des1-22 consisting of
the contiguous amino acid sequence depicted at amino acid residues
23-163, inclusive, of FIG. 1, or (ii) a biologically active analog
of (i) which consists of the same number of amino acids as (i) and
has at least 70% sequence homology thereto,
[0058] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 10% to 75% of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0059] (b) a pharmaceutically acceptable excipient.
[0060] In certain embodiments, the biologically active analog has
at least 80% sequence homology or at least 90% sequence homology to
(i) or (ii).
[0061] In additional embodiments of the method above, the
biologically active analog consists of the contiguous amino acid
sequence depicted at amino acid residues 23-163, inclusive, of FIG.
1 with the N-terminal arginine residue substituted with an alanine
residue.
[0062] In still further embodiments, the therapeutically effective
amount for use in the methods above is 10% to 20%, or 10% to 25%,
or 10% to 50% of the amount on a per molecule basis, or any
percentage within these ranges, of the amount of full-length KGF
needed to elicit an equivalent therapeutic response.
[0063] In additional embodiments, the invention is directed to a
method of treating wounds comprising applying a KGF polypeptide
composition to an area of a wound to be treated and allowing the
wound to heal, said composition comprising:
[0064] a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is (i) KGF.sub.des1-24 consisting of
the contiguous amino acid sequence depicted at amino acid residues
25-163, inclusive, of FIG. 1, or a biologically active analog of
(i) which consists of the same number of amino acids as (i) and has
at least 70% sequence homology thereto,
[0065] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 5% to 75% of the amount on a
per molecule basis of KGF.sub.63 needed to elicit an equivalent
therapeutic response; and
[0066] (b) a pharmaceutically acceptable excipient.
[0067] In certain embodiments of the above method, the biologically
active analog has at least 80% sequence homology or at least 90%
sequence homology to (i) or (ii).
[0068] In still further embodiments, the therapeutically effective
amount for use in the method above is 5% to 10%, or 10% to 20%, or
10% to 25%, or 10% to 50% of the amount on a per molecule basis, or
any percentage within these ranges, of the amount of full-length
KGF needed to elicit an equivalent therapeutic response.
[0069] In the above methods, the composition may be contacted with
the wound in vitro or in vivo.
[0070] In yet further embodiments, the invention is directed to a
composition comprising:
[0071] (a) a therapeutically effective amount of a KGF polypeptide,
wherein the KGF polypeptide is selected from the group consisting
of: [0072] (i) KGF.sub.des1-15 consisting of the contiguous amino
acid sequence depicted at amino acid residues 16-163, inclusive, of
FIG. 1; [0073] (ii) KGF.sub.des1-18 consisting of the contiguous
amino acid sequence depicted at amino acid residues 19-163,
inclusive, of FIG. 1; [0074] (iii) KGF.sub.des1-19 consisting of
the contiguous amino acid sequence depicted at amino acid residues
20-163, inclusive, of FIG. 1; [0075] (iv) KGF.sub.des1-20
consisting of the contiguous amino acid sequence depicted at amino
acid residues 21-163, inclusive, of FIG. 1; [0076] (v)
KGF.sub.des1-21 consisting of the contiguous amino acid sequence
depicted at amino acid residues 22-163, inclusive, of FIG. 1;
[0077] (vi) KGF.sub.des1-22 consisting of the contiguous amino acid
sequence depicted at amino acid residues 23-163, inclusive, of FIG.
1; [0078] (vii) KGF.sub.des1-24 consisting of the contiguous amino
acid sequence depicted at amino acid residues 25-163, inclusive, of
FIG. 1; [0079] (viii) KGF.sub.des1-25 consisting of the contiguous
amino acid sequence depicted at amino acid residues 26-163,
inclusive, of FIG. 1; [0080] (ix) a biologically active analog of
(i), (ii), (iii), (iv), (v), (vi), (vii) or (viii), wherein said
biologically active analog consists of the same number of amino
acids as (i), (ii), (iii), (iv), (v), (vi), (vii) or (viii),
respectively, and has at least 70% sequence homology thereto; and
[0081] (x) an analog of (i), (ii), (iii), (iv), (v), (vi), (vii),
(viii) or (ix), consisting of the amino acid sequence of (i), (ii),
(iii), (iv), (v), (vi), (vii), (viii) or (ix), respectively, and an
additional N-terminal methionine,
[0082] wherein the KGF polypeptide exhibits an increase in
bioactivity relative to mature, full-length, KGF (KGF.sub.163) as
determined by the Balb/MK bioactivity assay and specifically
stimulates epithelial cell proliferation, and further wherein the
therapeutically effective amount is 75% or less of the amount on a
per molecule basis of KGF.sub.163 needed to elicit an equivalent
therapeutic response; and
[0083] (b) a pharmaceutically acceptable excipient.
[0084] In certain embodiments, the biologically active analog has
at least 80% sequence homology or at least 90% sequence homology to
(i), (ii), (iii), (iv), (v), (vi), (vii), (viii) or (ix).
[0085] These and other aspects of the present invention will become
evident upon reference to the following detailed description and
attached figures. In addition, various references are set forth
herein which describe in more detail certain procedures or
compositions, and are therefore incorporated by reference in their
entirety.
BRIEF DESCRIPTION OF THE FIGURES
[0086] FIG. 1 (SEQ ID NOS:25 and 26) depicts the DNA sequence and
corresponding amino acid sequence for mature, full-length KGF
(KGF.sub.163).
[0087] FIGS. 2A and 2B show a comparison of the biological activity
of various N-terminally truncated KGF polypeptides. FIG. 2A
compares activity of KGF.sub.des1-22 (.diamond-solid.),
KGF.sub.des1-23 (.box-solid.), KGF.sub.des1-24 (.tangle-solidup.)
KGF.sub.des1-26 (X) and KGF.sub.des1-30 (double X), while FIG. 2B
shows a comparison of KGF.sub.des1-23 (.box-solid.),
KGF.sub.des1-26 (X) and KGF.sub.des1-30 (double X) with acidic FGF
(aFGF, .diamond-solid., middle line) and full-length KGF (FL-KGF,
(.diamond-solid., second to the top line).
[0088] FIG. 3 shows the results of experiments where various
truncated KGF molecules were tested on vascular endothelial cells
derived from either the bovine aortic arch (adult bovine aortic
endothelial cells (ABAE), left side of figure) or from the bovine
adrenal gland capillaries (adrenal cortex-derived capillary
endothelial cells (ACE), right side of figure). The histograms show
the final cell density of cultures exposed to saturating
concentrations of the various KGF polypeptides, or basic FGF
(bFGF), after seven days in culture.
[0089] FIG. 4 shows the amount of soluble KGF.sub.des1-24
(.tangle-solidup.) and KGF.sub.des1-15 ( ), determined by SDS-PAGE
as a function of time of incubation at 37.degree. C.
[0090] FIG. 5 shows the amount of soluble KGF.sub.des1-23
(.box-solid.) and native KGF (FL, .diamond-solid.) determined by
SDS-PAGE as a function of time of incubation at 37.degree. C.
[0091] FIG. 6 depicts the results of the thermal and acid stability
test described in the examples. FL-KGF represents KGF.sub.163.
T-KGF represents KGF.sub.des1-23. The histograms represent the
final cell density of the cultures after seven days when exposed to
either saturating concentrations of KGF.sub.des1-23 or
KGF.sub.163.
[0092] FIG. 7 shows the effect of increasing concentrations of
native KGF (FL, .diamond-solid.) and KGF.sub.des1-18 ( ),
KGF.sub.des1-23 (.box-solid.) and KGF.sub.des1-25
(.tangle-solidup.) on the proliferation of Balb/Mk cells when added
only once.
[0093] FIG. 8 (SEQ ID NOS:27 and 28) shows the DNA sequence and
corresponding amino acid sequence for KGF.sub.des1-22, with the
N-terminal arginine residue substituted with an alanine
residue.
DETAILED DESCRIPTION OF THE INVENTION
[0094] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of protein chemistry,
biochemistry, recombinant DNA techniques and pharmacology, within
the skill of the art. Such techniques are explained fully in the
literature. See, e.g., T. E. Creighton, Proteins: Structures and
Molecular Properties (W.H. Freeman and Company, 1993); A. L.
Lehninger, Biochemistry (Worth Publishers, Inc., current addition);
Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd
Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan
eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990).
[0095] All publications, patents and patent applications cited
herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
[0096] The following amino acid abbreviations are used throughout
the text:
[0097] Alanine: Ala (A) Arginine: Arg (R)
[0098] Asparagine: Asn (N) Aspartic acid: Asp (D)
[0099] Cysteine: Cys (C) Glutamine: Gln (O)
[0100] Glutamic acid: Glu (E) Glycine: Gly (G)
[0101] Histidine: H is (H) Isoleucine: Ile (I)
[0102] Leucine: Leu (L) Lysine: Lys (K)
[0103] Methionine: Met (M) Phenylalanine: Phe (F)
[0104] Proline: Pro (P) Serine: Ser (S)
[0105] Threonine: Thr (T) Tryptophan: Trp (W)
[0106] Tyrosine: Tyr (Y) Valine: Val (V)
I. DEFINITIONS
[0107] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0108] The terms "polypeptide" and "protein" refer to a polymer of
amino acid residues and are not limited to a minimum length of the
product. The terms also include, unless otherwise indicated,
modifications of the polypeptide that do not change the sequence of
amino acids, for example, glycosylated, acetylated and
phosphorylated forms. A polypeptide or protein, for purposes of the
present invention, may be synthetically or recombinantly produced,
as well as isolated from natural sources.
[0109] As used herein, the term "keratinocyte growth factor" or
"KGF" refers to a member of a group of the FGF family of proteins
which is capable of binding to FGFR-2, lacks significant activity
on fibroblasts, is uniquely specific for epithelial cells and is
particularly active on keratinocytes. KGF, analogs and fragments
thereof (defined below) may be synthetically or recombinantly
produced. Moreover, KGF may be isolated from natural sources, such
as from any of several tissues of any mammalian source, for example
from human tissues.
[0110] "Mature, full-length KGF," "long form of KGF," "FL-KGF,"
"native KGF" or "KGF.sub.163" as used herein all refer to the
mature polypeptide that contains 163 amino acid residues, as shown
in FIG. 1.
[0111] As used herein, the term "KGF fragment" refers to a
polypeptide derived from KGF.sub.163 that does not include the
entire sequence of KGF.sub.163. Such a fragment may be a truncated
version of the full-length molecule, as well as an internally
deleted polypeptide. A KGF fragment may have KGF bioactivity as
determined by the Balb/MK bioactivity assay, described in Example 4
herein. The Balb/MK cell line (Weissman, B. E. and Aaronson, S. A.
Cell (1983) 32:599-606) is a clonal Balb/c mouse keratinocyte cell
line. These cells are dependent for their growth upon an exogenous
source of an epithelial cell mitogen even in medium containing
serum. Thus, activity of the KGF fragments and analogs is measured
by determining the ED.sub.50 value using Balb/Mk cells, said value
defined by the concentration of KGF fragment that causes half
maximal stimulation of cell proliferation. Additionally, the KGF
fragments of the invention specifically stimulate epithelial cell
proliferation.
[0112] To determine target cell specificity, DNA synthesis
stimulation, expressed as the ratio of stimulated synthesis over
background incorporation of thymidine in the absence of added test
sample, is compared to analogous stimulation observed in cells
other than keratinocytes under the same assay conditions. The
activity of the KGF fragments and analogs can also be tested on
endothelial cells, such as adult bovine aortic endothelial cells
(ABAE) or adrenal cortex-derived capillary endothelial cells (ACE),
as described in Example 5 herein. A KGF polypeptide or analog that
"specifically stimulates epithelial cell proliferation" may be a
molecule that, at saturating concentrations, (i) in the Balb/Mk
assay described in Example 4 herein, can stimulate the final cell
number per well after 7 days in culture to a level at least 4-fold
higher than the cell number achieved in wells receiving no KGF; and
(ii) in the ABAE or ACE assay described in Example 5 herein, does
not significantly stimulate the final cell number per well after 7
days in culture to a level higher than the cell number achieved in
wells receiving no KGF.
[0113] U.S. Pat. No. 5,731,170, incorporated by reference herein in
its entirety, reports that certain molecules display KGF mitogenic
activity with marked specificity for keratinocytes as opposed to
fibroblasts.
[0114] The fragments of the present invention will display enhanced
activity on a per molecule basis relative to KGF.sub.163, such as
anywhere from 10% or more activity, such as 15%, 20%, 25%, 50%,
100% or more, to as much as 10-fold or more activity, or any amount
between the specified ranges. Hence, the KGF fragments of the
present invention may be used in compositions in lesser amounts
than would be necessary using KGF.sub.163. The inventors herein
recognize that truncations produce molecules of lower molecular
weight than full-length KGF. As shown below in the Examples, these
species are more active when compared on a per molecule basis
(i.e., when activity is adjusted for the molecular weight).
Particular KGF fragments are described in detail below.
[0115] The term "analog" refers to derivatives of the reference
molecule. The analog may retain biological activity, as described
above. In general, the term "analog" refers to compounds having a
native polypeptide sequence and structure with one or more amino
acid additions, substitutions (generally conservative in nature)
and/or deletions, relative to the native molecule, so long as the
modifications do not destroy activity. Preferably, the analog has
at least the same biological activity as the parent molecule, and
may even display enhanced activity over the parent molecule.
Methods for making polypeptide analogs are known in the art and are
described further below.
[0116] Particularly preferred analogs include substitutions that
are conservative in nature, i.e., those substitutions that take
place within a family of amino acids that are related in their side
chains. Specifically, amino acids are generally divided into four
families: (1) acidic--aspartate and glutamate; (2) basic--lysine,
arginine, histidine; (3) non-polar--alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan; and (4)
uncharged polar--glycine, asparagine, glutamine, cysteine, serine,
threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are
sometimes classified as aromatic amino acids. For example, it is
reasonably predictable that an isolated replacement of leucine with
isoleucine or valine, an aspartate with a glutamate, a threonine
with a serine, or a similar conservative replacement of an amino
acid with a structurally related amino acid, will not have a major
effect on the biological activity. For example, the polypeptide of
interest may include up to about 1-70 conservative or
non-conservative amino acid substitutions, such as 1, 2, 3, 4,
5-50, 15-25, 5-10, or any integer between 1-70, so long as the
desired function of the molecule remains intact. One of skill in
the art may readily determine regions of the molecule of interest
that can be modified with a reasonable likelihood of retaining
biological activity as defined herein.
[0117] For example, none of the critical determinants involved in
signaling appear to be located within the first 30 N-terminal amino
acids of KGF (Plotnikov, et. al. Cell (2000) 101:413-424).
Additionally, the NH.sub.2 terminal domain of KGF does not appear
to be involved in its cell specificity. Amino acid residues 91-110,
numbered relative to the amino acid sequence set forth in FIG. 1
appear to confer receptor binding specificity to KGF
(Reich-Slotsky, et al. J. Biol. Chem. (1995) 270:29813-29818).
Thus, analogs and fragments which retain the region spanning at
least amino acids 91-110 are preferred. Moreover, if amino acid
substitutions are made in this region, they should be conservative
in nature. Fragments which retain portions of the N-terminal
sequence, e.g., fragments with deletions that do not extend to, for
example, amino acid 35, numbered relative to FIG. 1, are more
tolerable to amino acid additions, deletions and substitutions.
Preferred deletions include deletions of the first 22, 23 and 24
amino acids, as described further below. One of skill in the art
can readily determine other regions that will tolerate change based
on the known structure of KGF (see, e.g., Osslund et al. Protein
Sci. (1998) 7:1681-1690), as well as the known structure/function
relationships between KGF and related molecules such as acidic FGF,
basic FGF and kaposi FGF (see, e.g., Gospodarowicz et al., J. Cell.
Physiol. (1990) 142:325-333).
[0118] By "purified" and "isolated" is meant, when referring to a
polypeptide or polynucleotide, that the indicated molecule is
present in the substantial absence of other biological
macromolecules of the same type. The term "purified" as used herein
preferably means at least 75% by weight, more preferably at least
85% by weight, more preferably still at least 95% by weight, and
most preferably at least 98% by weight, of biological
macromolecules of the same type are present in the sample. An
"isolated polynucleotide which encodes a particular polypeptide"
refers to a nucleic acid molecule which is substantially free of
other nucleic acid molecules that do not encode the subject
polypeptide; however, the molecule may include some additional
bases or moieties which do not deleteriously affect the basic
characteristics of the composition.
[0119] By a "recombinant polypeptide" is intended a polypeptide
which has been prepared by recombinant DNA techniques as described
herein. In general, the gene coding for the desired polypeptide is
cloned and then expressed in transformed organisms, as described
further below. The host organism expresses the foreign gene to
produce the polypeptide under expression conditions. Alternatively,
the promoter controlling expression of an endogenous polypeptide
can be altered to render a recombinant polypeptide. It is
particularly advantageous to produce polypeptides recombinantly as
recombinant production generally allows for higher yields from less
starting material, and renders a far purer product. Thus, the
polypeptides of the invention can be produced in the absence of
other molecules normally present in cells. For example, human
polypeptide compositions free of any trace of human protein
contaminants can be readily obtained because the only human protein
produced by a recombinant non-human host cell is the recombinant
human polypeptide. Potential viral agents from natural sources and
viral components pathogenic to humans are also avoided.
[0120] The term "polynucleotide" or "nucleic acid molecule" as used
herein refers to a polymeric form of nucleotides of any length,
either ribonucleotides or deoxyribonucleotides. This term refers
only to the primary structure of the molecule and thus includes
double- and single-stranded DNA and RNA. It also includes known
types of modifications, for example, labels which are known in the
art, methylation, "caps", substitution of one or more of the
naturally occurring nucleotides with an analog, internucleotide
modifications such as, for example, those with uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoamidates,
carbamates, etc.) and with charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), those containing
pendant moieties, such as, for example proteins (including for
e.g., nucleases, toxins, antibodies, signal peptides,
poly-L-lysine, etc.), those with intercalators (e.g., acridine,
psoralen, etc.), those containing chelates (e.g., metals,
radioactive metals, boron, oxidative metals, etc.), those
containing alkylators, those with modified linkages (e.g., alpha
anomeric nucleic acids, etc.), as well as unmodified forms of the
polynucleotide.
[0121] The terms "recombinant DNA molecule," or "recombinant
polynucleotide" are used herein to refer to a polynucleotide of
genomic, cDNA, semisynthetic, or synthetic origin which, by virtue
of its origin or manipulation: (1) is not associated with all or a
portion of a polynucleotide with which it is associated in nature,
(2) is linked to a polynucleotide other than that to which it is
linked in nature, or (3) does not occur in nature. Thus, the term
encompasses "synthetically derived" nucleic acid molecules.
[0122] A "coding sequence" is a nucleic acid molecule which is
translated into a polypeptide, usually via mRNA, when placed under
the control of appropriate regulatory sequences. The boundaries of
the coding sequence may be determined by a translation start codon
at the 5'-terminus and a translation stop codon at the 3'-terminus.
A coding sequence can include, but is not limited to, cDNA, and
recombinant nucleotide sequences.
[0123] "Control sequences" refer to nucleic acid sequences which
are necessary to effect the expression of coding sequences to which
they are ligated. The nature of such control sequences differs
depending upon the host organism; in prokaryotes, such control
sequences generally include promoter, ribosomal binding site, and
transcription termination sequence; in eukaryotes, generally, such
control sequences include promoters and transcription termination
sequences. The term "control sequences" is intended to include, at
a minimum, all components necessary for expression of a coding
sequence, and may also include additional components, for example,
leader sequences and fusion partner sequences.
[0124] A control element, such as a promoter, "directs the
transcription" of a coding sequence in a cell when RNA polymerase
will bind the promoter and transcribe the coding sequence into
mRNA, which is then translated into the polypeptide encoded by the
coding sequence.
[0125] "Operably linked" refers to a juxtaposition wherein the
components so described are in a relationship permitting them to
function in their intended manner. A control sequence "operably
linked" to a coding sequence is ligated in such a way that
expression of the coding sequence is achieved under conditions
compatible with the control sequences. The control elements need
not be contiguous with the coding sequence, so long as they
function to direct the expression thereof. Thus, for example,
intervening untranslated yet transcribed sequences can be present
between a promoter and the coding sequence and the promoter can
still be considered "operably linked" to the coding sequence.
[0126] As used herein, the term "expression cassette" refers to a
molecule comprising at least one coding sequence operably linked to
a control sequence which includes all nucleotide sequences required
for the transcription of cloned copies of the coding sequence and
the translation of the mRNAs in an appropriate host cell. Such
expression cassettes can be used to express eukaryotic genes in a
variety of hosts such as bacteria, blue-green algae, plant cells,
yeast cells, insect cells and animal cells. Under the invention,
expression cassettes can include, but are not limited to, cloning
vectors, specifically designed plasmids, viruses or virus
particles. The cassettes may further include an origin of
replication for autonomous replication in host cells, selectable
markers, various restriction sites, a potential for high copy
number and strong promoters.
[0127] By "vector" is meant any genetic element, such as a plasmid,
phage, transposon, cosmid, chromosome, virus etc., which is capable
of replication when associated with the proper control elements and
which can transfer gene sequences between cells. Thus, the term
includes cloning and expression vehicles, as well as viral
vectors.
[0128] A cell has been "transformed" by an exogenous polynucleotide
when the polynucleotide has been introduced inside the cell
membrane. The exogenous polynucleotide may or may not be integrated
(covalently linked) into chromosomal DNA making up the genome of
the cell. In procaryotes and yeasts, for example, the exogenous DNA
may be maintained on an episomal element, such as a plasmid. With
respect to eucaryotic cells, a stably transformed cell is one in
which the exogenous DNA has become integrated into the chromosome
so that it is inherited by daughter cells through chromosome
replication. This stability is demonstrated by the ability of the
eucaryotic cell to establish cell lines or clones comprised of a
population of daughter cells containing the exogenous DNA.
[0129] A "host cell" is a cell which has been transformed, or is
capable of transformation, by an exogenous nucleic acid
molecule.
[0130] "Homology" refers to the percent similarity between two
polynucleotide or two polypeptide moieties. Two DNA, or two
polypeptide sequences are "substantially homologous" to each other
when the sequences exhibit at least about 50%, preferably at least
about 70% to 75%, more preferably at least about 80%-85%,
preferably at least about 90%, and most preferably at least about
95%-98% sequence homology, or any percent homology between the
specified ranges, over a defined length of the molecules. As used
herein, substantially homologous also refers to sequences showing
complete identity to the specified DNA or polypeptide sequence.
[0131] In general, "identity" refers to an exact
nucleotide-to-nucleotide or amino acid-to-amino acid correspondence
of two polynucleotides or polypeptide sequences, respectively.
Percent identity can be determined by a direct comparison of the
sequence information between two molecules by aligning the
sequences, counting the exact number of matches between the two
aligned sequences, dividing by the length of the shorter sequence,
and multiplying the result by 100.
[0132] Preferably, naturally or non-naturally occurring protein
variants have amino acid sequences which are at least 70%, 80%,
85%, 90% or 95% or more homologous to the particular KGF fragment
derived from FIG. 1. More preferably, the molecules are 98% or 99%
homologous. Percent homology is determined using the Smith-Waterman
homology search algorithm using an affine gap search with a gap
open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix
of 62. The Smith-Waterman homology search algorithm is taught in
Smith and Waterman, Adv. Appl. Math. 2:482-489 (1981).
[0133] Alternatively, homology can be determined by hybridization
of polynucleotides under conditions which form stable duplexes
between homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. DNA sequences that are substantially homologous
can be identified in a Southern hybridization experiment under, for
example, stringent conditions, as defined for that particular
system. Defining appropriate hybridization conditions is within the
skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning,
supra; Nucleic Acid Hybridization, supra.
[0134] The terms "effective amount" or "pharmaceutically effective
amount" refer to a nontoxic but sufficient amount of the agent to
provide the desired biological result. That result can be reduction
and/or alleviation of the signs, symptoms, or causes of a disease,
or any other desired alteration of a biological system. For
example, an effective amount of a KGF fragment for use with the
present methods is an amount sufficient to stimulate epithelial
cell stimulation or proliferation, and preferably an amount
sufficient to cause increased healing of wounds and/or burns, and
other disorders where epithelial cell proliferation is desired.
Such amounts are described below. An appropriate "effective" amount
in any individual case may be determined by one of ordinary skill
in the art using routine experimentation.
[0135] By "pharmaceutically acceptable" or "pharmacologically
acceptable" is meant a material which is not biologically or
otherwise undesirable, i.e., the material may be administered to an
individual without causing any undesirable biological effects or
interacting in a deleterious manner with any of the components of
the composition in which it is contained.
[0136] By "physiological pH" or a "pH in the physiological range"
is meant a pH in the range of approximately 7.0 to 8.0 inclusive.
Preferred physiological pH is in the range of approximately 7.2 to
7.6 inclusive.
[0137] As used herein, the term "subject" encompasses mammals and
non-mammals. Examples of mammals include, but are not limited to,
any member of the Mammalia class: humans, non-human primates such
as chimpanzees, and other apes and monkey species; farm animals
such as cattle, horses, sheep, goats, swine; domestic animals such
as rabbits, dogs, and cats; laboratory animals including rodents,
such as rats, mice and guinea pigs, and the like. Examples of
non-mammals include, but are not limited to, birds, fish and the
like. The term does not denote a particular age or gender.
II. MODES OF CARRYING OUT THE INVENTION
[0138] Before describing the present invention in detail, it is to
be understood that this invention is not limited to particular
formulations or process parameters as such may, of course, vary. It
is also to be understood that the terminology used herein is for
the purpose of describing particular embodiments of the invention
only, and is not intended to be limiting.
[0139] Although a number of compositions and methods similar or
equivalent to those described herein can be used in the practice of
the present invention, the preferred materials and methods are
described herein.
[0140] The present invention is based on the discovery that certain
KGF polypeptide fragments and analogs of these fragments, which
retain only a portion of the full-length sequence, show enhanced
bioactivity relative to the full-length sequence. Thus, smaller
amounts of the polypeptide may be used in compositions than would
be necessary with the full-length molecule. In certain instances,
there is less occurrence of non-specific side-effects when
compositions including the molecules described herein are
administered.
[0141] The present invention particularly relates to compositions
comprising KGF fragments which exhibit an increase in bioactivity
relative to KGF.sub.163 as determined by the Balb/MK bioactivity
assay specified herein and which specifically stimulate epithelial
cell proliferation. Particularly, activity of the KGF fragments and
analogs is measured by determining the ED.sub.50 value using
Balb/Mk cells, said value defined by the concentration of KGF
fragment that causes half maximal stimulation of cell
proliferation. The cells are cultured for 7 days, as described
below in the examples. The bioactivity of the KGF fragments herein
is preferably at least about 1.2 to 1.5-fold, preferably, about
2-fold and, more preferably, about 2- to 10-fold greater or more
than that of the full-length KGF protein, when compared in the cell
proliferation assay, and may be as much as 10- to 100-fold greater
or more than full-length KGF, as determined using stimulation of
DNA synthesis in Balb/Mk cells maintained in a chemically defined
medium, as described herein and in PCT Patent Application, No. WO
90/08771. Due to the enhanced activity level, the polypeptides of
the subject invention allow the use of 90% or less, such as 5%-90%,
or 10%-50%, or any number therebetween, on a per molecule basis
(i.e., adjusted for the molecular weight) of the amount of
KGF.sub.163 that would be necessary in corresponding compositions
to achieve the same biological results.
[0142] Particular polypeptides for use herein include but are not
limited to the following:
[0143] KGF.sub.des1-15 consisting of the contiguous amino acid
sequence depicted at amino acid residues 16-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-15 consisting of the contiguous amino
acid sequence depicted at amino acid residues 16-163, inclusive, of
FIG. 1 and having an additional N-terminal methionine;
[0144] KGF.sub.des1-18 consisting of the contiguous amino acid
sequence depicted at amino acid residues 19-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-18 consisting of the contiguous amino
acid sequence depicted at amino acid residues 19-163, inclusive, of
FIG. 1 and having an additional N-terminal methionine;
[0145] KGF.sub.des1-19 consisting of the contiguous amino acid
sequence depicted at amino acid residues 20-163, inclusive, of FIG.
1; an analog KGF.sub.des1-19 consisting of the contiguous amino
acid sequence depicted at amino acid residues 20-163, inclusive, of
FIG. 1 with an additional N-terminal methionine;
[0146] KGF.sub.des1-20 consisting of the contiguous amino acid
sequence depicted at amino acid residues 21-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-20 consisting of the contiguous amino
acid sequence depicted at amino acid residues 21-163, inclusive, of
FIG. 1 with an additional N-terminal methionine;
[0147] KGF.sub.des1-21 consisting of the contiguous amino acid
sequence depicted at amino acid residues 22-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-21 consisting of the contiguous amino
acid sequence depicted at amino acid residues 22-163, inclusive, of
FIG. 1 with an additional N-terminal methionine;
[0148] KGF.sub.des1-22 consisting of the contiguous amino acid
sequence depicted at amino acid residues 23-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-22 consisting of the contiguous amino
acid sequence depicted at amino acid residues 23-163, inclusive, of
FIG. 1 with an additional N-terminal methionine; an analog of
KGF.sub.des1-22 consisting of the contiguous amino acid sequence
depicted at amino acid residues 23-163, inclusive, of FIG. 1 with
the N-terminal arginine residue substituted with an alanine
residue;
[0149] KGF.sub.des1-24 consisting of the contiguous amino acid
sequence depicted at amino acid residues 25-163, inclusive, of FIG.
1; an analog of KGF.sub.des1-24 consisting of the contiguous amino
acid sequence depicted at amino acid residues 25-163, inclusive, of
FIG. 1 with an additional N-terminal methionine; and
[0150] KGF.sub.des1-25 consisting of the contiguous amino acid
sequence depicted at amino acid residues 26-163, inclusive, of FIG.
1; and an analog of KGF.sub.des1-25 consisting of the contiguous
amino acid sequence depicted at amino acid residues 26-163,
inclusive, of FIG. 1 with an additional N-terminal methionine.
[0151] Also contemplated for use in the subject compositions are
biologically active analogs of the above-specified fragments,
wherein the biologically active analogs consist of the same number
of amino acids as the above fragments and have at least about 50%,
preferably at least about 70%, preferably at least about 75%,
preferably at least about 80%, preferably at least about 85%,
preferably at least about 90%, preferably at least about 95%, and
preferably at least about 98% sequence homology thereto, as
determined as described above. For example, the biologically active
analog may be an analog of KGF.sub.des-15 that consists of 148
amino acids and has at least 70% sequence homology thereto; an
analog of KGF.sub.des-15 that consists of 145 amino acids and has
at least 70% sequence homology thereto; an analog of KGF.sub.des-19
that consists of 144 amino acids and has at least 70% sequence
homology thereto; an analog of KGF.sub.des-20 that consists of 143
amino acids and has at least 70% sequence homology thereto; an
analog of KGF.sub.des-21 that consists of 142 amino acids and has
at least 70% sequence homology thereto; an analog of KGF.sub.des-22
that consists of 141 amino acids and has at least 70% sequence
homology thereto; an analog of KGF.sub.des-24 that consists of 139
amino acids and has at least 70% sequence homology thereto; and an
analog of KGF.sub.des-25 that consists of 138 amino acids and has
at least 70% sequence homology thereto.
[0152] The amount of KGF polypeptide for use in the subject
compositions relative to KGF.sub.163 will vary depending on the
particular fragment of interest. In general, compositions will
comprise about 90%, or less, even 75%, or less, 50%, or less, 35%,
or less, 25%, or less, or 10% or less, on a per molecule basis
(i.e., adjusted for molecular weight), of the amount of KGF.sub.163
in a corresponding composition that would be necessary to achieve
the desired result, such as to promote epithelial cell division
and/or proliferation. Thus, for example, the compositions described
herein may include 5%-90%, or 10%-90%, or 10%-75%, or 10%-50%, or
10%-25%, or 10%-20% on a per molecule basis, of the amount of
KGF.sub.163 in a corresponding composition that would be necessary
to achieve the desired result. It is to be understood that
particular percentages between these ranges are also contemplated
herein.
[0153] Particularly, if the KGF fragment is KGF.sub.des1-15,
KGF.sub.des1-18, KGF.sub.des1-19, KGF.sub.des1-20, KGF.sub.des1-21,
KGF.sub.des1-22, KGF.sub.des1-24, KGF.sub.des1-25, or polypeptides
derived from these molecules, the amount may be 75%, or less, such
as 10% to 75%. If the KGF fragment is KGF.sub.des1-22 or
KGF.sub.des1-24, or polypeptides derived from these molecules, the
amount used may 50%, or less, or even 25%, or 20%, or less, such as
5% to 50%. For KGF.sub.des1-24 and polypeptides derived therefrom,
for example, the amount may be 10%, or less, such as 2% to 10% of
the amount required of KGF.sub.163 to achieve an equivalent
therapeutic response. Appropriate amounts are discussed in detail
below.
[0154] In a preferred embodiment of the present invention, the KGF
fragments of the present invention are produced by recombinant
technology, particularly in the case of large-scale commercial
production. Recombinant DNA molecules and expression vectors
encoding the polypeptides of the present invention can be made and
the genes expressed by conventional gene expression technology
using methods well-known in the art, as discussed in more detail
below. Analogs of particular KGF fragments may also be made
recombinantly, for example, by site-directed mutagenesis. Thus, all
references to embodiments of the present invention as they relate
to particular KGF fragments apply equally to analogs of the
fragments.
[0155] In one embodiment of the present invention, the KGF fragment
can be made by isolating native, mature KGF from cells producing
the same, such as M426 human embryonic fibroblasts (Aaronson, S. A.
and Todaro, G. J. Virology (1968) 36:254-261), using techniques
described in, e.g., U.S. Pat. No. 5,731,170. N-terminal amino acid
residues can then be deleted from the recovered molecule. Such
deletion can be performed by any conventional techniques known in
the art.
[0156] Alternatively, polypeptides for use in the subject
compositions can be synthesized chemically, by any of several
techniques that are known to those skilled in the peptide art. See,
e.g., J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis
(Pierce Chemical Co., Rockford, Ill. 1984) and G. Barany and R. B.
Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E.
Gross and J. Meienhofer, Vol. 2, (Academic Press, New York, 1980),
pp. 3-254, for solid phase peptide synthesis techniques; and M.
Bodansky, Principles of Peptide Synthesis, (Springer-Verlag, Berlin
1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis,
Synthesis, Biology, Vol. 1, for classical solution synthesis. The
polypeptides of the present invention can also be chemically
prepared by the method of simultaneous multiple peptide synthesis.
See, e.g., Houghten Proc. Natl. Acad. Sci. USA (1985) 82:5131-5135;
U.S. Pat. No. 4,631,211.
[0157] In an alternative embodiment, the KGF fragments can be made
by isolating the coding sequence of native KGF.sub.163, deleting
the codons that encode the amino acid residues to be deleted,
inserting the modified coding sequence into an expression vector,
transforming host cells with the expression vector to produce the
recombinant KGF fragments and analogs, and isolating the
recombinant KGF fragment using conventional purification
techniques.
[0158] In a further embodiment of the present invention, the coding
sequence of the KGF fragment can be obtained by conventional
techniques, including the isolation of the coding sequence of
KGF.sub.163 from a cDNA library known to contain such, and deleting
therefrom the sequence encoding the portion of amino acid residues
to be deleted. Deletion of the coding sequence of the N-terminal
amino acids can be accomplished in vivo or in vitro. The former can
be achieved, for example, by expression of the KGF.sub.163 coding
sequence in an appropriate expression system. The latter can be
achieved by known PCR techniques using primers that exclude the
N-terminal sequences.
[0159] Preferably, polypeptides for use in the present compositions
are produced recombinantly, by expression of a polynucleotide
encoding the same. Methods for the recombinant production of KGF
fragments are well known. See, e.g., U.S. Pat. Nos. 5,677,278,
5,773,586, 5,843,883, 5,863,767 and 6,074,848, all to Gospodarowicz
et al.; International Publications WO 96/11951 and WO 96/11949; and
Osslund et al. Protein Sci. (1998) 7:1681-1690.
[0160] In particular, the molecules for use with the present
invention can be made using standard techniques of molecular
biology. For example, polynucleotide sequences coding for the
above-described molecules can be obtained using recombinant
methods, such as by screening cDNA and genomic libraries from cells
expressing the gene, or by deriving the gene from a vector known to
include the same. Furthermore, the desired gene can be isolated
directly from cells and tissues containing the same, using standard
techniques, such as phenol extraction and PCR of cDNA or genomic
DNA. See, e.g., Sambrook et al., supra, for a description of
techniques used to obtain and isolate DNA. The gene of interest can
also be produced synthetically, rather than cloned. The molecules
can be designed with appropriate codons for the particular
sequence. The complete sequence is then assembled from overlapping
oligonucleotides prepared by standard methods and assembled into a
complete coding sequence. See, e.g., Edge (1981) Nature 292:756;
Nambair et al. (1984) Science 223:1299; and Jay et al. (1984) J.
Biol. Chem. 259:6311.
[0161] Thus, particular nucleotide sequences can be obtained from
vectors harboring the desired sequences or synthesized completely
or in part using various oligonucleotide synthesis techniques known
in the art, such as site-directed mutagenesis and polymerase chain
reaction (PCR) techniques where appropriate. See, e.g., Sambrook,
supra. In particular, one method of obtaining nucleotide sequences
encoding the desired sequences is by annealing complementary sets
of overlapping synthetic oligonucleotides produced in a
conventional, automated polynucleotide synthesizer, followed by
ligation with an appropriate DNA ligase and amplification of the
ligated nucleotide sequence via PCR. See, e.g., Jayaraman et al.
(1991) Proc. Natl. Acad. Sci. USA 88:4084-4088. Additionally,
oligonucleotide directed synthesis (Jones et al. (1986) Nature
54:75-82), oligonucleotide directed mutagenesis of pre-existing
nucleotide regions (Riechmann et al. (1988) Nature 332:323-327 and
Verhoeyen et al. (1988) Science 239:1534-1536), and enzymatic
filling-in of gapped oligonucleotides using T.sub.4 DNA polymerase
(Queen et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033) can
be used under the invention to provide molecules having altered or
enhanced receptor-binding capabilities, and/or reduced
immunogenicity.
[0162] Once coding sequences have been prepared or isolated, such
sequences can be cloned into any suitable vector or replicon.
Numerous cloning vectors are known to those of skill in the art,
and the selection of an appropriate cloning vector is a matter of
choice. Suitable vectors include, but are not limited to, plasmids,
phages, transposons, cosmids, chromosomes or viruses which are
capable of replication when associated with the proper control
elements.
[0163] The coding sequence is then placed under the control of
suitable control elements, depending on the system to be used for
expression. Thus, the coding sequence can be placed under the
control of a promoter, ribosome binding site (for bacterial
expression) and, optionally, an operator, so that the DNA sequence
of interest is transcribed into RNA by a suitable transformant. The
coding sequence may or may not contain a sequence coding for a
signal peptide or leader sequence which can later be removed by the
host in post-translational processing. See, e.g., U.S. Pat. Nos.
4,431,739; 4,425,437; 4,338,397. If a signal sequence is present,
it can either be the native sequence or it may be a heterologous
signal sequence.
[0164] In addition to control sequences, it may be desirable to add
regulatory sequences which allow for regulation of the expression
of the sequences relative to the growth of the host cell.
Regulatory sequences are known to those of skill in the art, and
examples include those which cause the expression of a gene to be
turned on or off in response to a chemical or physical stimulus,
including the presence of a regulatory compound. Other types of
regulatory elements may also be present in the vector. For example,
enhancer elements may be used herein to increase expression levels
of the constructs. Examples include the SV40 early gene enhancer
(Dijkema et al. (1985) EMBO J. 4:761), the enhancer/promoter
derived from the long terminal repeat (LTR) of the Rous Sarcoma
Virus (Gorman et al. (1982) Proc. Natl. Acad. Sci. USA 79:6777) and
elements derived from human CMV (Boshart et al. (1985) Cell
41:521), such as elements included in the CMV intron A sequence
(U.S. Pat. No. 5,688,688). The expression cassette may further
include an origin of replication for autonomous replication in a
suitable host cell, one or more selectable markers, one or more
restriction sites, a potential for high copy number and a strong
promoter.
[0165] An expression vector is constructed so that the particular
coding sequence is located in the vector with the appropriate
regulatory sequences, the positioning and orientation of the coding
sequence with respect to the control sequences being such that the
coding sequence is transcribed under the "control" of the control
sequences (i.e., RNA polymerase which binds to the DNA molecule at
the control sequences transcribes the coding sequence).
Modification of the sequences encoding the molecule of interest may
be desirable to achieve this end. For example, in some cases it may
be necessary to modify the sequence so that it can be attached to
the control sequences in the appropriate orientation; i.e., to
maintain the reading frame. The control sequences and other
regulatory sequences may be ligated to the coding sequence prior to
insertion into a vector. Alternatively, the coding sequence can be
cloned directly into an expression vector which already contains
the control sequences and an appropriate restriction site.
[0166] As explained above, it may also be desirable to produce
mutants or analogs of the reference KGF fragment. Mutants or
analogs may be prepared by the deletion of a portion of the
sequence encoding the KGF fragment, by insertion of a sequence,
and/or by substitution of one or more nucleotides within the
sequence. Techniques for modifying nucleotide sequences, such as
site-directed mutagenesis, and the like, are well known to those
skilled in the art. See, e.g., Sambrook et al., supra; Kunkel, T.
A. (1985) Proc. Natl. Acad. Sci. USA 4 (1985) 82:448; Geisselsoder
et al. (1987) BioTechniques 5:786; Zoller and Smith (1983) Methods
Enzymol. 100:468; Dalbie-McFarland et al. (1982) Proc. Natl. Acad.
Sci. USA 79:6409.
[0167] The molecules can be expressed in a wide variety of systems,
including insect, mammalian, bacterial, viral and yeast expression
systems, all well known in the art. For example, insect cell
expression systems, such as baculovirus systems, are known to those
of skill in the art and described in, e.g., Summers and Smith,
Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
Materials and methods for baculovirus/insect cell expression
systems are commercially available in kit form from, inter alia,
Invitrogen, San Diego Calif. ("MaxBac" kit). Similarly, bacterial
and mammalian cell expression systems are well known in the art and
described in, e.g., Sambrook et al., supra. Yeast expression
systems are also known in the art and described in, e.g., Yeast
Genetic Engineering (Barr et al., eds., 1989) Butterworths,
London.
[0168] A number of appropriate host cells for use with the above
systems are also known. For example, mammalian cell lines are known
in the art and include immortalized cell lines available from the
American Type Culture Collection (ATCC), such as, but not limited
to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster
kidney (BHK) cells, monkey kidney cells (COS), human embryonic
kidney cells, human hepatocellular carcinoma cells (e.g., Hep G2),
Madin-Darby bovine kidney ("MDBK") cells, as well as others.
Similarly, bacterial hosts such as E. coli, Bacillus subtilis, and
Streptococcus spp., will find use with the present expression
constructs. Yeast hosts useful in the present invention include
inter alia, Saccharomyces cerevisiae, Candida albicans, Candida
maltosa, Hansenula polymorpha, Kluyveromyces fragilis,
Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris,
Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for
use with baculovirus expression vectors include, inter alia, Aedes
aegypti, Autographa californica, Bombyx mori, Drosophila
melanogaster, Spodoptera frugiperda, and Trichoplusia ni.
[0169] Intracellular expression of the truncated KGF polypeptides
and analogs thereof in yeast is particularly desirable. Such
systems avoid problems which may arise with purification from
bacteria, such as E. coli, including the presence of large amounts
of DNA, endotoxins, and protein contaminants. Moreover, naturally
occurring yeast enzymes efficiently cleave the N-terminal
methionine which may be present when the molecules are
recombinantly produced and there is no need to overexpress the
enzyme when a yeast system is used. Additionally, although KGF is a
naturally secreted protein, when native and truncated KGF, and
analogs thereof, are produced internally in yeast without
secretion, they are soluble, properly folded and active.
[0170] Nucleic acid molecules comprising nucleotide sequences of
interest can be stably integrated into a host cell genome or
maintained on a stable episomal element in a suitable host cell
using various gene delivery techniques well known in the art. See,
e.g., U.S. Pat. No. 5,399,346.
[0171] Depending on the expression system and host selected, the
molecules are produced by growing host cells transformed by an
expression vector described above under conditions whereby the
protein is expressed. The expressed protein is then isolated from
the host cells and purified. If the expression system secretes the
protein into growth media, the product can be purified directly
from the media. If it is not secreted, it can be isolated from cell
lysates. The selection of the appropriate growth conditions and
recovery methods are within the skill of the art.
[0172] The KGF fragments are then formulated into pharmaceutical
compositions, described further below, for delivery to a subject.
Alternatively, polynucleotides encoding the polypeptide of interest
may be delivered directly to the subject and expressed in vivo. A
number of viral based systems have been developed for direct gene
transfer into mammalian cells. In this regard, retroviruses provide
a convenient platform for gene delivery systems. A selected
nucleotide sequence encoding the desired polypeptide can be
inserted into a vector and packaged in retroviral particles using
techniques known in the art. The recombinant virus can then be
isolated and delivered to a subject. A number of suitable
retroviral systems have been described (U.S. Pat. No. 5,219,740;
Miller and Rosman (1989) BioTechniques 7:980-990; Miller, A. D.
(1990) Human Gene Therapy 1:5-14; Scarpa et al. (1991) Virology
180:849-852; Burns et al. (1993) Proc. Natl. Acad. Sci. USA
90:8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet.
Develop. 3:102-109.
[0173] A number of suitable adenovirus vectors have also been
described. Unlike retroviruses which integrate into the host
genome, adenoviruses persist extrachromosomally thus minimizing the
risks associated with insertional mutagenesis (Haj-Ahmad and Graham
(1986) J. Virol. 57:267-274; Bett et al. (1993) J. Virol.
67:5911-5921; Mittereder et al. (1994) Human Gene Therapy
5:717-729; Seth et al. (1994) J. Virol. 68:933-940; Barr et al.
(1994) Gene Therapy 1:51-58; Berkner, K. L. (1988) BioTechniques
6:616-629; and Rich et al. (1993) Human Gene Therapy 4:461-476).
Various adeno-associated virus (AAV) vector systems have been
developed recently for gene delivery. Such systems can include
control sequences, such as promoter and polyadenylation sites, as
well as selectable markers or reporter genes, enhancer sequences,
and other control elements which allow for the induction of
transcription. AAV vectors can be readily constructed using
techniques well known in the art. See, e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941; International Publication Nos. WO 92/01070
(published 23 Jan. 1992) and WO 93/03769 (published 4 Mar. 1993);
Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et
al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press);
Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539;
Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol.
158:97-129; Kotin, R. M. (1994) Human Gene Therapy 5:793-801;
Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al.
(1994) J. Exp. Med. 179:1867-1875.
[0174] Additional viral vectors which will find use for delivering
the nucleic acid molecules encoding the molecules of the present
invention by gene transfer include those derived from the pox
family of viruses, such as vaccinia virus and avian poxvirus. See,
e.g., International Publication Nos. WO 91/12882; WO 89/03429; and
WO 92/03545.
[0175] Molecular conjugate vectors, such as the adenovirus chimeric
vectors described in Michael et al. (1993) J. Biol. Chem.
268:6866-6869 and Wagner et al. (1992) Proc. Natl. Acad. Sci. USA
89:6099-6103, can also be used for gene delivery under the
invention.
[0176] Members of the Alphavirus genus, such as but not limited to
vectors derived from the Sindbis and Semliki Forest viruses, will
also find use as viral vectors for delivering the gene of interest.
For a description of Sinbus-virus derived vectors useful for the
practice of the instant methods, see, Dubensky et al., J. Virol.
(1996) 70:508-519; and International Publication Nos. WO 95/07995
and WO 96/17072.
[0177] The gene of interest can also be delivered without a viral
vector. For example, the gene can be packaged in liposomes prior to
delivery to the subject or to cells derived therefrom, with or
without the accompanying antigen. Lipid encapsulation is generally
accomplished using liposomes which are able to stably bind or
entrap and retain nucleic acid. For a review of the use of
liposomes as carriers for delivery of nucleic acids, see, Hug and
Sleight, Biochim. Biophys. Acta. (1991) 1097:1-17; Straubinger et
al., in Methods of Enzymology (1983), Vol. 101, pp. 512-527.
[0178] The KGF fragments of the present invention can be used for
identification of receptor recognition sites as well as for the
design of peptide agonists or antagonists. Moreover, in view of the
unique specificity of KGF for keratinocytes, its inability to
induce the proliferation of vascular endothelial cells or
fibroblasts, and its lack of cytotoxicity, the truncated molecules
and analogs thereof are a preferred agent of choice for wound
healing applications, particularly where there is a desire to
promote re-epithelialization of the skin. The truncated KGF
molecules are also particularly useful in corneal epithelial
repair. Other uses of the molecules include applications that
utilize the specificity for epithelial cells found in the
gastrointestinal tract.
[0179] The fragments of the present invention may be conjugated to
other molecules suitable for its intended use. For example, the KGF
polypeptides can be conjugated to a toxin molecule, such as ricin
A, diphtheria toxin, or saporin for destruction of its target cell,
i.e., epithelial cells, particularly, keratinocytes. Such KGF toxin
conjugates suitable for use herein can be produced by methods known
in the art, for example, U.S. Pat. Nos. 4,771,128, 4,808,705, and
4,894,443 and International Publication No. WO 92/04918.
[0180] The compositions of the invention comprise the molecules
described above, together with one or more pharmaceutically
acceptable excipients or vehicles, and optionally other therapeutic
and/or prophylactic ingredients. Such excipients include liquids
such as water, saline, glycerol, polyethyleneglycol, hyaluronic
acid, ethanol, etc. Suitable excipients for nonliquid formulations
are also known to those of skill in the art. Pharmaceutically
acceptable salts can be used in the compositions of the present
invention and include, for example, mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. A thorough discussion of
pharmaceutically acceptable excipients and salts is available in
Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.:
Mack Publishing Company, 1990).
[0181] Additionally, auxiliary substances, such as wetting or
emulsifying agents, biological buffering substances, surfactants,
and the like, may be present in such vehicles. A biological buffer
can be virtually any solution which is pharmacologically acceptable
and which provides the formulation with the desired pH, i.e., a pH
in the physiologically acceptable range. Examples of buffer
solutions include saline, phosphate buffered saline, Tris buffered
saline, Hank's buffered saline, and the like.
[0182] Particularly preferred compositions are those which are
applied topically, such as ointments, pastes, powders, dressings,
creams and plasters. Such topical compositions may also include
topical anesthetics, such as but not limited to, benzocaine,
lidocaine, dibucaine, dyclonine hydrochloride, pramoxine
hydrochloride, proparacaine hydrochloride, tetracaine, benoxinate
hydrochloride, butamben picrate, clove oil and eugenol, as well as
combinations and derivatives of the above. Ophthalmic compositions
for direct delivery for the eye are also of particular use with the
KGF fragments of the invention. See, e.g., Remington's
Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing
Company, 1990) for a discussion of various topical and ophthalmic
compositions.
[0183] As explained above, once formulated, the compositions of the
invention are generally administered topically or ophthalmically.
However, other modes of administration include parenteral
administration, for example, intravenously, intra-arterially,
intra-articularly (e.g., into the knee), subcutaneously,
intradermally, intramuscularly, transdermally, intranasally,
mucosally, and by aerosol administration. For example, the
composition can be administered by inhalation, e.g., as a nasal or
mouth spray or aerosol. The compositions may also be delivered in
situ, e.g., by implantation.
[0184] A pharmaceutically or therapeutically effective amount of
the composition will be delivered to the subject. The precise
effective amount will vary from subject to subject and will depend
upon the species, age, the subject's size and health, the nature
and extent of the condition being treated, recommendations of the
treating physician, and the therapeutics or combination of
therapeutics selected for administration. Thus, the effective
amount for a given situation can be determined by routine
experimentation. For purposes of the present invention, generally a
therapeutic amount if administered topically will be in the range
of about 0.1 .mu.g/cm.sup.2 of wound to approximately 500
.mu.g/cm.sup.2 of wound, preferably about 1 .mu.g/cm.sup.2 of wound
to approximately 100 .mu.g/cm.sup.2 of wound, more preferably about
1-10 .mu.g/cm.sup.2 of wound to approximately 50 .mu.g/cm.sup.2, or
any integer between these values, such as 21, 22, 23, 24 . . . 30,
31, 32, 33, 34 . . . 40, 41, 43 . . . 50 . . . 60 . . . , and so
on. For parenteral administration, typical doses will be in the
range of about 0.01 .mu.g/kg body weight/day to about 100
.mu.g/kg/day, more preferably about 0.1 .mu.g/kg/day to about 80
.mu.g/kg/day, more preferably 1 .mu.g/kg/day to about 40
.mu.g/kg/day in one or more doses. Typically, if polynucleotides
are delivered, the doses will be at least an order of magnitude
lower. The subject may be administered as many doses as is required
to reduce and/or alleviate the signs, symptoms, or causes of the
disorder in question, or bring about any other desired alteration
of a biological system. In any event, the amount of KGF fragment
present in the subject composition is an amount less than the
amount of KGF.sub.163 necessary in order to obtain an equivalent
response. This amount is readily determined by comparing the
bioactivity of the fragment in question to that of KGF.sub.163, as
described above.
III. EXPERIMENTAL
[0185] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0186] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
[0187] Enzymes were purchased from commercial sources, and used
according to the manufacturers' directions. Radionucleotides and
nitrocellulose filters were also purchased from commercial
sources.
[0188] In the cloning of DNA fragments, except where noted, all DNA
manipulations were done according to standard procedures. See,
Sambrook et al., supra. Restriction enzymes, T.sub.4 DNA ligase,
DNA polymerase I, Klenow fragment, and other biological reagents
were purchased from commercial suppliers and used according to the
manufacturers' directions. Double-stranded DNA fragments were
separated on agarose gels.
EXAMPLE 1
Construction of truncated KGF Yeast Vectors for Intracellular Yeast
Expression
[0189] This example describes a procedure for construction of yeast
expression vectors for intracellular expression of the various
truncated KGF molecules for use with the subject invention.
[0190] The expression vectors included the particular truncated KGF
coding sequence under the control of the ADH2/GAPDH promoter, a
hybrid yeast promoter. In particular, for each different
truncation, two oligos were used (see below), a top strand and a
bottom strand. The oligos were annealed and then placed in a
ligation reaction. The ligation reactions included the plasmid
pSI3, cut at Nco and Sal sites, a Kpn/Sal fragment, encoding a
truncated KGF and one of the annealed oligo pairs. The oligo pairs
encoded the amino terminus of the particular truncated KGF protein
desired and were designed to link the Nco site of the vector to the
Kpn site of the KGF encoding fragment. Plasmid pSI3 is a derivative
of pYASI1, which was deposited with the ATCC, Manassas, Va., on
Feb. 27, 1985, and assigned ATCC Accession No. 20745. The
construction of pYASI1 is described in U.S. Pat. No. 4,751,180,
incorporated herein by reference in its entirety.
[0191] The various oligos for the completed truncated KGFs were as
follows. The "X" in the oligo sequences represents a 5' phosphate
group.
TABLE-US-00001 KGF.sub.des1-15: (SEQ ID NO:1) 5'
XCATGAGCAGCCCTGAGCGACACACAAGAAGTTATGATTACATGGAA
GGAGGGGATATAAGAGTGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:2)
5' XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTAATCATAACTTCTTGTGTGTCGCTCAGGGCTGCT 3' KGE.sub.des1-18: (SEQ
ID NO:3) 5' XCATGGAGCGACACACAAGAAGTTATGATTACATGGAAGGAGGGGAT
ATAAGAGTGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:4) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTAATCATAACTTCTTGTGTGTCGCTC 3' KGF.sub.des1-19 : (SEQ ID NO:5)
5' XCATGCGACACACAAGAAGTTATGATTACATGGAAGGAGGGGATATA
AGAGTGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:6) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTAATCATAACTTCTTGTGTGTCG 3' KGF.sub.des1-20: (SEQ ID NO:7) 5'
XCATGCACACAAGAAGTTATGATTACATGGAAGGAGGGGATATAAGA
GTGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:8) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTAATCATAACTTCTTGTGTG 3' KGF.sub.des1-21: (SEQ ID NO:9) 5'
XCATGACCAGAAGTTATGATTACATGGAAGGAGGGGATATAAGAGTG
AGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:10) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTAATCATACTTCTGGT 3' KGF.sub.des1-22: (SEQ ID NO:11) 5'
XCATGAGAAGTTATGATTACATGGAAGGAGGGGATATAAGAGTGAGA
AGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:12) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT CCATGTAATCATAACTTCT
3' KGF.sub.des1-24: (SEQ ID NO:13) 5'
XCATGTATGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTC
TTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:14) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT CCATGTAATCATA 3'
KGF.sub.des1-25: (SEQ ID NO:15) 5'
XCATGGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTCTTC TGTCGAACACAGTGGTAC
3' (SEQ ID NO:16) 5'
XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT CCATGTAATC 3'
KGF.sub.des1-26: (SEQ ID NO:17) 5'
XCATGTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTCTTCTGT CGAACACAGTGGTAC 3'
(SEQ ID NO:18) 5' XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCCTCCTT
CCATGTA 3' KGF.sub.des1-30 : (SEQ ID NO:19) 5'
XCATGGGGGATATAAGAGTGAGAAGACTCTTCTGTCGAACACAGTGG TAC 3' (SEQ ID
NO:20) 5' XCACTGTGTTCGACAGAAGAGTCTTCTCACTCTTATATCCCC 3'
KGF.sub.des1-35: (SEQ ID NO:21) 5'
XCATGAGAAGACTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:22) 5'
XCACTGTGTTCGACAGAAGAGTCTTCT 3' KGF.sub.des1-37: (SEQ ID NO:23) 5'
XCATGCTCTTCTGTCGAACACAGTGGTAC 3' (SEQ ID NO:24) 5'
XCACTGTGTTCGACAGAAGAG 3'
[0192] Additionally, expression vectors encoding mature,
full-length KGF (KGF.sub.163) and a truncated KGF molecule with a
deletion of the first 23 N-terminal amino acids, KG.sub.des1-23,
were produced. See, e.g., U.S. Pat. No. 5,677,278, incorporated
herein by reference in its entirety. An analog of KGF.sub.des1-22,
with an alanine residue at the N-terminus instead of the naturally
occurring arginine, was also produced.
EXAMPLE 2
Intracellular Expression of Truncated KGF Molecules by Yeast
Cells
[0193] The expression vectors described above were used to
transform Saccharomyces cerevisae cells by lithium acetate
transfection, using standard methods. See, e.g., "Guide to Yeast
Genetics & Molecular Biology," Methods in Enzymology, Vol. 194
(Academic Press, 1991). Transformants were selected on
uracil-deficient media having 2% glucose. Transformants were
incubated overnight in 5 ml of leucine-deficient media with 5%
glucose at 30.degree. C. in a shaking apparatus. The culture for
production of the recombinant truncated molecules was a 20 ml
culture, seeded with the overnight culture in YEP medium with 2%
glucose for approximately 72 hours.
EXAMPLE 3
Purification of the Truncated Recombinant KGF Molecules
[0194] The cultures from above were centrifuged to form a yeast
cell paste and cells were lysed in 10 mM MgCl.sub.2, 50 mM Tris, pH
8.0, 0.1 M dithiothrietol (DTT), using standard techniques. The
cell lysate was generated as a batch, using glass beads in a
Dynomill DKL-Pilot. Lysate generation was complete when cell
breakage was >95%. The homogenate was cooled to 4-8.degree. C.
by using a suitable heat exchanger. Debris was then removed by
centrifugating the lysate at 15,000 g for thirty minutes at
4.degree. C. The NaCl concentration of the supernatant was adjusted
to 0.5 M NaCl and recombinant, truncated KGF was purified from the
supernatant as follows.
[0195] A. Heparin Sepharose.TM. Affinity Chromatography
[0196] Supernatant obtained as described above was immediately
applied to a Heparin Sepharose (HS) resin column. The lysed product
was allowed to run for approximately 30 minutes at 4.degree. C.
through a 30 ml bed of HS resin. The column was equilibrated in a
buffer containing 0.5 M NaCl, 0.1 M DTT and 10 mM Tris-HCl at pH
7.3. Once the cell lysate was loaded, the column was washed
extensively with the equilibration buffer until the absorbance at
280 nm returned to baseline. Protein was eluted from the HS column
with an increasing step-wise NaCl gradient. The NaCl concentrations
were 1 M and 2 M NaCl, in 10 mM Tris-HCl at pH 7.3, 0.1 M DTT. The
flow rate of the column during elution was approximately 90 ml/hr
and 4 ml size fractions were collected.
[0197] The fractions were tested for KGF bioactivity utilizing
Balb/Mk cells. The assay is described below. The fractions with the
highest bioactivity were eluted with 1 M NaCl and were pooled.
Before the pooled fractions were loaded onto the next column, the
fractions were dialyzed overnight against 0.2 M NaCl, 10 mM
Tris-HCl at pH 7.3.
[0198] B. Mono S Cation Exchange Chromatography
[0199] The pooled fractions eluted from the HS column were loaded
with a Super loop onto a Mono S column linked to a fast high
pressure liquid chromatography (FPLC) system (Pharmacia,
Piscataway, N.J.). The Mono S cation exchange column was
equilibrated with 10 mM Tris at pH 7.3. When the pooled fractions
were loaded, the column was washed extensively at a flow rate of 1
ml/min. with the equilibration buffer until the absorbance returned
to baseline. Then, protein was eluted from the column with a linear
NaCl gradient, 0.2 M to 1 M NaCl in 10 mM Tris, at pH 7.3 at a flow
rate of 1 ml/min., and 1 ml fractions were collected.
[0200] A major protein peak eluted at about 0.6 M NaCl. Fractions
across the protein peak were assayed for bioactivity and active
fractions were pooled and subjected to SDS-PAGE analysis. The
protein concentration of the pooled fractions was determined by
Bradford assay according to instructions accompanying the protein
assay kit from BioRad (Richmond, Calif., USA).
EXAMPLE 4
KGF Bioactivity Assay Utilizing Balb/Mk Cells
[0201] KGF bioactivity was assessed by the ability of the pooled
0.6 M NaCl fractions to promote growth of Balb/Mk cells. In
particular, stock cultures of Balb/Mk cells were grown and
maintained in low calcium Dulbecco's modified Eagle medium (DMEM)
supplemented with 10% fetal bovine serum, 0.25 .mu.g/ml fungizone,
and 10 ng/ml acidic FGF (aFGF). The cells were incubated at
37.degree. C. in a 10% CO.sub.2 atmosphere with 99% humidity. For
the bioactivity assay, the cells were seeded in 12-well plates at a
density of 5.times.10.sup.3 cells per well in 1 ml of medium as
described above for the stock cultures (except that the seeding
medium contained no aFGF), and as described in Gospodarowicz et al.
J. Cell. Physiol. (1990) 142: 325-333.
[0202] Ten microliter aliquots of the desired column fractions were
diluted into 1 ml of 0.2% (w/v) gelatin in phosphate buffered
saline (PBS). Ten microliters of this dilution were added to
Balb/Mk cells seeded in 12-well cluster plates containing 22 mm
wells, at 5.times.10.sup.3 cells per well, and a 10 .mu.l aliquot
of either the diluted column fractions or medium containing 10 ng
aFGF were added to the cells every other day.
[0203] After seven days in culture, the cells were trypsinized and
the final cell density was determined using a Coulter.TM. counter
(Coulter Electronics, Hialeah, Fla., USA). The cells were released
from the plates by replacing the culture medium with a solution
containing 0.9% NaCl, 0.01 M sodium phosphate (pH 7.4), 0.25%
trypsin, and 0.02% EDTA (STV). The cells were incubated in this
solution for 5-10 minutes at 37.degree. C. and then the stock
culture medium was added to the cells. The cells were then counted
using a Coulter.TM. counter. The final cell density was graphed as
a function of column fraction protein concentration. The protein
concentration was graphed on a log scale.
[0204] The ED.sub.50 was calculated by (a), dividing in half the
difference between the lowest and highest cell density value of the
curve; and (b), determining from the graph what protein
concentration corresponds to that cell density number obtained in
(a).
[0205] Results of a typical bioassay for KGF.sub.des1-22,
KGF.sub.des1-23, KGF.sub.des1-24, KGF.sub.des1-26 and
KGF.sub.des1-30 are shown in FIG. 2A. A similar comparison was done
with KGF.sub.des1-23, KGF.sub.des1-26, KGF.sub.des1-30, acidic FGF
(aFGF) and full-length KGF (FL-KGF) and results are shown in FIG.
2B. When the ED.sub.50 of the different truncated forms was
normalized to that of native KGF taken as 100% (Table 1)
KGF.sub.des1-22, KGF.sub.des1-23 and KGF.sub.des1-24 had
significant increases in their biological activity. In particular,
KGF.sub.des1-22 was approximately 6-fold more active, while
KGF.sub.des1-23 and KGF.sub.des1-24 were 10-fold more active than
native KGF.sub.163. Even when compared on a per molecule basis and
adjusted for molecular weight, these species displayed greatly
enhanced activity relative to KGF.sub.163. Deletion beyond
KGF.sub.des1-24 to KGF.sub.des1-26 rendered the truncated forms of
KGF with comparable activity to the native form, and deletions
beyond KGF.sub.des1-26 led to a reduction in biological
activity.
[0206] It should be noted that KGF.sub.des1-35 which retained only
2-3% of the biological activity of the native form, was as active
as aFGF when tested on Balb/Mk cells. Since this form is more
homologous to aFGF than any of the other truncations, the question
was raised as to whether this truncated form of KGF might have lost
the target cell specificity peculiar to KGF. As explained above,
KGF only stimulates cells of epithelial origin in contrast to other
forms of FGF which have a wide range of target cells, and
endothelial cells in particular. However, this apparently does not
occur since when tested on either adrenal cortex-derived capillary
endothelial cells (ACE) or adult bovine aortic endothelial cells
(ABAE) cells (see below), in the presence or absence of heparin,
KGF.sub.des1-35, as well as other shorter truncations, were
inactive (FIG. 3).
TABLE-US-00002 TABLE 1 Mitogenic Activity of KGF Polypeptides
Average % Average % Relative Activity Relative Activity (per unit
MW of (on a per KGF Polypeptide weight basis)* KGF.sub.xxx**
molecule basis) Full Length (KGF.sub.163) 100 18882 100
KGF.sub.des1-15 154 17229 141 KGF.sub.des1-18 166 16958 149
KGF.sub.des1-19 100 16829 89 KGF.sub.des1-20 187 16673 165
KGF.sub.des1-21 200 16536 175 KGF.sub.des1-22 600 16435 522
KGF.sub.des1-23 1000 16278 862 KGF.sub.des1-24 1000 16191 857
KGF.sub.des1-25 150 16028 127 KGF.sub.des1-26 100 15913 84
KGF.sub.des1-30 28.5 15433 23 KGF.sub.des1-35 3 14892 2 *ED.sub.50
of (KGF.sub.xxx / KGF.sub.163) .times. 100 **Molecular weight (MW)
was calculated using the Vector NTI program (Dec. 22, 1999),
Infomax, Inc.
[0207] The activity of an analog of KGF.sub.des1-22, with an
alanine substituted for the naturally occurring N-terminal
arginine, expressed in E. coli, was compared to an E.
coli-expressed KGF.sub.des1-23. The analog was tested multiple
times and showed an ED.sub.50 similar to that of E. coli-expressed
KGF.sub.des1-23.
EXAMPLE 5
KGF Bioactivity on ABAE or ACE Cells
[0208] KGF can be characterized by its lack of activity on vascular
endothelial cells derived from large vessels (adult bovine aortic
endothelial cells, ABAE) or capillary cells (adrenal cortex-derived
capillary endothelial cells, ACE) as compared with other forms of
FGF, such as basic FGF (bFGF) or acidic FGF (aFGF). To analyze
whether the various truncated forms of FGF retained this cell
specificity, their biological activity on endothelial cells was
tested.
[0209] Stock cultures of ABAE and ACE cells were grown and
maintained in Dulbecco's modified Eagle medium supplemented with
10% bovine serum, 0.25 .mu.g/ml fungizone, and 2 ng/ml bFGF. The
cells were incubated at 37.degree. C. with a 10% CO.sub.2
concentration and 99% humidity.
[0210] In the mitogenic assay, either 5.times.10.sup.3 ABAE or ACE
cells were plated per well in 12-well plates in stock culture
medium, as described in Gospodarowicz et. al. Proc. Natl. Acad. USA
(1976) 73:4120-4124; Gospodarowicz et. al. J. Cell. Physiol. (1976)
127:121-136; and Gospodarowicz et. al. Proc. Natl. Acad. USA (1989)
86:7311-7315.
[0211] Saturating concentrations of KGF.sub.163, as well as the
various truncated variants of KGF and basic FGF were added every
other day. After 7 days in culture, cells were trypsinized as
described for the Balb/MK cell cultures and the final cell density
was determined using a Coulter counter.
[0212] As shown in FIG. 3, all of the tested N-terminally truncated
KGF polypeptides lacked activity on both ABAE and ACE as compared
with bFGF. The truncations were based, in part, on structure
alignment with acidic FGF. The results confirm that the potency of
native KGF can be changed to that of acidic FGF without changing
cell specificity. Acidic FGF is a known mitogen for Balb/Mk cells
and its potency is 10-fold less than that of KGF. This reflects its
lower binding affinity for the KGF receptor. Removal of the first
30 to 35 amino acids of native KGF leads to the strong decrease in
biological activity shown by those truncated analogs (28.5 and 3%
that of native KGF). At the same time, the degree of homology
between acidic FGF and KGF increases when cell structural
determinants for interacting with the FGF receptor are kept. Thus,
KGF analogs with longer deletions behave more like acidic FGF.
Surprisingly, even with the longest deletion, the target cell
specificity typical of KGF is kept and the analogs, in contrast
with acidic FGF or basic FGF, are not mitogenic for vascular
endothelial cells.
EXAMPLE 6
Thermal Stability Studies
[0213] The ability of native KGF and various N-terminally truncated
KGF polypeptides to withstand elevated temperatures was examined.
Samples containing 0.1 mg/ml protein were prepared in Ca.sup.++
Mg.sup.++-free PBS and 1001 of each sample was aliquoted into 1 ml
plastic vials. The vials were sealed and placed in a 37.degree. C.
incubator. At predetermined time intervals, vials were withdrawn
and analyzed for the loss of soluble proteins.
[0214] 30 .mu.l aliquots were analyzed by SDS-PAGE electrophoresis.
SDS-PAGE was performed on an electrophoresis system (Novex, San
Diego, Calif., U.S.A.) using Tris-glycine precast gels (5% to 20%
acrylamide, according to the method of Laemmli Nature (1970)
227:680-685). Samples were mixed with reducing or non-reducing SDS
sample buffer without heating before loading.
[0215] The proteins were detected by Coomassie blue staining. The
stained gels were scanned by densitometry using a BioRad Model GS
700 Imaging densitometer (Richmond, Calif., USA). The amount of
soluble protein was determined by integrating the stained-band area
and plotting the result as a function of time of incubation at
37.degree. C. The half-life for the loss of soluble monomeric
protein was then estimated from these kinetic curves.
[0216] The biological activity of the samples at various time
intervals was also determined using the Balb/Mk cell proliferation
assay as described above. The half-life for biological activity of
the various samples was determined by plotting the ED.sub.50 of the
samples as a function of time of incubation at 37.degree. C.
[0217] In particular, the thermal stability and oligomer formation
of native KGF (KGF.sub.163) verses KGF.sub.des1-23 was assessed by
incubating the KGF polypeptides (184 .mu.g/ml native KGF and 138
.mu.g/ml KGF.sub.des1-23, diluted in PBS) for periods ranging from
0 to 8 days at 37.degree. C. Aliquots were taken daily and their
potency assessed on Balb/Mk cells, while oligomer formation was
assessed by SDS-PAGE. When analyzed by SDS-PAGE, native KGF formed
dimers readily. Dimerization was far less evident for
KGF.sub.des1-23. Also striking was the decrease in staining as a
function of time for the monomeric form of native KGF. Again, this
was far less evident for KGF.sub.des1-23.
[0218] The cell proliferation assay indicated that under these
conditions, the biological half-life of native KGF was 2 days while
that of KGF.sub.des1-23 was 7 days.
[0219] Thermal stability studies also indicated that
KGF.sub.des1-15 KGF.sub.des1-18 KGF.sub.des1-19) KGF.sub.des1-20,
KGF.sub.des1-21, KGF.sub.des1-22, KGF.sub.des1-24, KGF.sub.des1-25
KGF.sub.des1-26 KGF.sub.des1-30 and KGF.sub.des1-35 were more
stable than the full-length KGF, although by varying degrees. A
typical stability study which lasted 24 days with samples taken
every 3 days is shown in FIG. 4. In this study, KGF.sub.des1-24 and
KGF.sub.des1-15 (100 .mu.g/ml) were diluted in PBS and incubated at
37.degree. C. Samples were analyzed under non-reducing conditions
by SDS-PAGE. Gels were then stained and scanned by
densitometry.
[0220] Extension of the thermal stability studies from 9 days to 24
days permitted a more accurately defined half-life solution of
KGF.sub.des1-23 versus native KGF. As shown in FIG. 5, the
half-life of native KGF was 7 days versus 17 days for
KGF.sub.des1-23.
[0221] These results, taken together, indicate that the difference
in biological activity between native KGF and the truncated
molecules might be caused, in part, by differing thermal
stability.
EXAMPLE 7
Acid Stability at pH 2.1
[0222] To follow the formation of oligomer as a function of time,
native KGF and KGF.sub.des1-23 samples, maintained for various time
intervals at 37.degree. C., were analyzed by reverse phase HPLC.
100 .mu.l samples were diluted to 1 ml in 0.1% trifluoroacetic acid
(TFA) in water, pH 2.1. The sample was then applied to a Vydac
C.sub.4 column (0.46 cm.times.25 cm, 5 .mu.m particle size, 300
A.sup.o pore size) equilibrated in 0.1% (v/v) TFA. Protein was
eluted with a linear 115 min multilinear acetonitrile gradient in
(20-100%). The absorbance peaks were analyzed for their protein
content by integrating their surface area. The amount of monomeric
protein was plotted as a function of time. The half-life for the
monomeric protein was then estimated as described above. To
determine the formation of oligomers, samples were also analyzed
under non-reducing conditions by SDS-PAGE. Biological activity of
the various protein peaks was also determined using the Balb/Mk
cell proliferation assay as described above.
[0223] In particular, native KGF (28 .mu.g/ml) and KGF.sub.des1-23
(36 .mu.g/ml) were diluted in PBS and incubated for periods of time
ranging from 0 to 9 days at 37.degree. C. and aliquots were
analyzed daily by reverse phase high pressure liquid chromatography
(RP-HPLC) under acid conditions (pH 2.1). A single peak of UV
absorbance was observed which eluted at 60 minutes for both native
and KGF.sub.des1-23. The intensity of the peak decreased as a
function of time. However, the decrease was far more pronounced for
native KGF than KGF.sub.des1-23, so that by day 9, integration of
both peaks indicated that the amount of native KGF was one-third
that of KGF.sub.des1-23. The decrease in mass of native KGF was
associated with a drastic decrease in biological activity. By day
7, native KGF had become inactive. In contrast, KGF.sub.des1-23
still retained 50% of its original biological activity (FIG.
6).
EXAMPLE 8
Comparison of the Bioactivity of Native KGF versus KGF.sub.des1-23
When Added Only Once Versus Every Other Day
[0224] In the cell proliferation assay described above, increasing
concentrations of native KGF and KGF.sub.des1-23 were added every
other day. If stability is the mechanism for enhanced activity,
there should still be the same difference in dose response when
native KGF or truncated KGF polypeptides are added once, rather
than every other day, even though overall cell proliferation is
less. To test this hypothesis, varying concentrations of
KGF.sub.des1-18 KGF.sub.des1-23 and KGF.sub.des1-25 were added only
once, in the concentrations shown in FIG. 7. As shown in FIG. 7 and
Table 2, the same difference in biological activity was observed
with KGF.sub.des1-23. In particular, KGF.sub.des1-23 was 13-fold
more active than native KGF when added once, versus 10-fold more
active when added every other day. Additionally, both the
KGF.sub.des1-18 and KGF.sub.des1-25 polypeptides showed an increase
in activity over native KGF. This confirms that increased stability
is one of the mechanisms which contributes to increased
potency.
TABLE-US-00003 TABLE 2 Comparison of the Biological Activity of
Native Versus Truncated KGFs Added Either Once or Every Other Day
Average % Activity KGF Polypeptide Added Once Added Every Other Day
Full Length 100 100 KGF.sub.des1-18 173 150 KGF.sub.des1-23 1320
1000 KGF.sub.des1-25 173 160
EXAMPLE 9
Is Protease Contamination Responsible for the Rapid Disappearance
of Native KGF
[0225] To rule out the possibility that protease contamination of
the native KGF preparation, absent from the KGF.sub.des1-23
preparation, was responsible for the rapid disappearance of native
KGF, the following experiment was done. Native KGF and
KGF.sub.des1-23 (100 .mu.g/ml) were diluted in PBS and incubated at
37.degree. C. either alone or mixed at an equal ratio (v/v).
Samples were taken on day 3, 6, 9 and 12 and analyzed by SDS-PAGE,
as described above. After staining, the gels were scanned by
densitometry. If the native KGF disappeared and KGF.sub.des1-23 did
not, protease contamination would be ruled out.
[0226] Native KGF disappeared by day 6. However, KGF.sub.des1-23
could still be seen after 12 days, eliminating the possibility of
protease contamination as a reason for the disappearance of native
KGF. Surprising however, was the difference in the band-staining
intensity when KGF.sub.des1-23 was incubated alone versus incubated
in combination with native KGF. The staining intensity of the
KGF.sub.des1-23 band was far greater when incubated alone than when
mixed with the native KGF. It is possible that when KGF.sub.des1-23
is incubated with native KGF, complexes form and KGF.sub.des1-23 is
taken out of solution.
[0227] When the biological activity of native KGF versus
KGF.sub.des1-23 was analyzed, a 10-fold increase in potency was
observed which correlated with greater thermal stability of the
truncated form versus the native form. Thus, increased stability
could in part explain the increased potency. This however does not
appear to be the only mechanism contributing to increased activity.
Without being bound by a particular theory, the lack of activity of
native KGF may be due to precipitation out of solution. When
various truncations above were analyzed for stability and
biological activity, they showed increased stability and biological
activity as compared to the native form. However, there was little
correlation between increased stability and increased biological
activity. For example, KGF.sub.des1-15 and KGF.sub.des1-24 had
comparable thermal stability but KGF.sub.des1-24 was 10-fold more
potent than native KGF while KGF.sub.des1-15 was 1.5-fold more
active. Therefore other mechanisms likely exist which contribute to
the increased potency of the most potent molecules,
KGF.sub.des1-22, KGF.sub.des1-23, and KGF.sub.des1-24. It is also
remarkable that the domain conferring maximum increase in potency
is limited, consisting of three residues. These three residues may
therefore provide optimum conformation of KGF in its interaction
with the receptor.
[0228] Truncation confirms that the potency of native KGF can be
changed to that of aFGF without changing cell specificity. Acidic
FGF is a known mitogen for Balb/Mk cells and it is 10-fold less
active than KGF. This is due to its lower binding affinity for the
KGF receptor. Removal of the first 30 to 35 amino acids led to a
strong decrease in biological activity of the truncated
polypeptides (28.5% and 3%, respectively, of native KGF). At the
same time, the longer deletions increase the degree of homology
between aFGF and KGF and increase cell structural determinants for
interacting with the FGF receptor. Thus, the longer the deletions,
the more like aFGF the truncated KGF polypeptides behave.
Surprisingly, even the longest deletion retained the target cell
specificity typical of KGF, i.e., for cells of epithelial origin,
and the shortest polypeptides, in contrast with aFGF or bFGF, were
not mitogenic for vascular endothelial cells. These findings, that
the NH.sub.2 terminal domain of KGF does not seem to be involved in
its cell specificity, at least as far as the first 35 residues are
concerned, are in contrast with earlier reports (see, e.g.,
International Publication No. WO 90/08771).
EXAMPLE 10
In Vivo Efficacy of N-Terminally Truncated KGF Polypeptides
[0229] Full-length KGF (KGF.sub.163) and an N-terminally truncated
molecule, KGF.sub.des1-23, were tested in a rat model of healing of
a surgical colonic anastamosis. In particular, KGF formulations,
containing 5 mg/ml KGF.sub.163 or 1 mg/ml KGF.sub.des1-23 were
administered intraperitoneally to rats. Colonic crypt depth (in
.mu.m), a measure of cellular proliferation related to healing, and
busting pressure in mm mercury, a measure of strength of the healed
wound, were measured on days 2, 4 and 7 for rats given KGF.sub.163
and on days 2, 4 and 6 for rats given the truncated molecule.
Results are shown in Tables 3 and 4.
[0230] In particular, 1 mg/ml of the truncated molecule was as
effective or more effective than 5 mg/ml of full-length KGF in
promoting wound healing. Smaller doses of the truncated molecule
were also effective. Based on these results, it is likely that
other N-terminally truncated KGFs, particularly KGF.sub.des1-22 and
KGF.sub.des1-24, are also as effective, if not more effective, for
wound healing using smaller doses than that required using
KGF.sub.163.
TABLE-US-00004 TABLE 3 Colonic Crypt Depth in .mu.m, Expressed as
Percent of Vehicle Control Full Length Truncated Day Measured KGF,
5 mg/kg KGF, 1 mg/kg 2 127 176 4 125 129 7 (6 of KGF.sub.des1-23)
154 138
TABLE-US-00005 TABLE 4 Bursting Pressure in mm Hg, Expressed as
Percent of Vehicle Control Full Length Truncated Day Measured KGF,
5 mg/kg KGF, 1 mg/kg 2 134 163 4 149 151 7 (6 of KGF.sub.des1-23)
119 148
[0231] Thus, novel KGF compositions and methods for using the same
are disclosed. Although preferred embodiments of the subject
invention have been described in some detail, it is understood that
obvious variations can be made without departing from the spirit
and the scope of the invention as defined by the appended claims.
Sequence CWU 1
1
28194DNAArtificial SequenceDescription of Artificial Sequence Oligo
1 for KGF-des1-15 1catgagcagc cctgagcgac acacaagaag ttatgattac
atggaaggag gggatataag 60agtgagaaga ctcttctgtc gaacacagtg gtac
94286DNAArtificial SequenceDescription of Artificial Sequence Oligo
2 for KGF-des1-15 2cactgtgttc gacagaagag tcttctcact cttatatccc
ctccttccat gtaatcataa 60cttcttgtgt gtcgctcagg gctgct
86385DNAArtificial SequenceDescription of Artificial Sequence Oligo
1 for KGF-des1-18 3catggagcga cacacaagaa gttatgatta catggaagga
ggggatataa gagtgagaag 60actcttctgt cgaacacagt ggtac
85477DNAArtificial SequenceDescription of Artificial Sequence Oligo
2 for KGF-des1-18 4cactgtgttc gacagaagag tcttctcact cttatatccc
ctccttccat gtaatcataa 60cttcttgtgt gtcgctc 77582DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-19
5catgcgacac acaagaagtt atgattacat ggaaggaggg gatataagag tgagaagact
60cttctgtcga acacagtggt ac 82674DNAArtificial SequenceDescription
of Artificial Sequence Oligo 2 for KGF-des1-19 6cactgtgttc
gacagaagag tcttctcact cttatatccc ctccttccat gtaatcataa 60cttcttgtgt
gtcg 74779DNAArtificial SequenceDescription of Artificial Sequence
Oligo 1 for KGF-des1-20 7catgcacaca agaagttatg attacatgga
aggaggggat ataagagtga gaagactctt 60ctgtcgaaca cagtggtac
79871DNAArtificial SequenceDescription of Artificial Sequence Oligo
2 for KGF-des1-20 8cactgtgttc gacagaagag tcttctcact cttatatccc
ctccttccat gtaatcataa 60cttcttgtgt g 71976DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-21
9catgaccaga agttatgatt acatggaagg aggggatata agagtgagaa gactcttctg
60tcgaacacag tggtac 761068DNAArtificial SequenceDescription of
Artificial Sequence Oligo 2 for KGF-des1-21 10cactgtgttc gacagaagag
tcttctcact cttatatccc ctccttccat gtaatcataa 60cttctggt
681173DNAArtificial SequenceDescription of Artificial Sequence
Oligo 1 for KGF-des1-22 11catgagaagt tatgattaca tggaaggagg
ggatataaga gtgagaagac tcttctgtcg 60aacacagtgg tac
731265DNAArtificial SequenceDescription of Artificial Sequence
Oligo 2 for KGF-des1-22 12cactgtgttc gacagaagag tcttctcact
cttatatccc ctccttccat gtaatcataa 60cttct 651367DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-24
13catgtatgat tacatggaag gaggggatat aagagtgaga agactcttct gtcgaacaca
60gtggtac 671459DNAArtificial SequenceDescription of Artificial
Sequence Oligo 2 for KGF-des1-24 14cactgtgttc gacagaagag tcttctcact
cttatatccc ctccttccat gtaatcata 591564DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-25
15catggattac atggaaggag gggatataag agtgagaaga ctcttctgtc gaacacagtg
60gtac 641656DNAArtificial SequenceDescription of Artificial
Sequence Oligo 2 for KGF-des1-25 16cactgtgttc gacagaagag tcttctcact
cttatatccc ctccttccat gtaatc 561761DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-26
17catgtacatg gaaggagggg atataagagt gagaagactc ttctgtcgaa cacagtggta
60c 611853DNAArtificial SequenceDescription of Artificial Sequence
Oligo 2 for KGF-des1-26 18cactgtgttc gacagaagag tcttctcact
cttatatccc ctccttccat gta 531949DNAArtificial SequenceDescription
of Artificial Sequence Oligo 1 for KGF-des1-30 19catgggggat
ataagagtga gaagactctt ctgtcgaaca cagtggtac 492041DNAArtificial
SequenceDescription of Artificial Sequence Oligo 2 for KGF-des1-30
20cactgtgttc gacagaagag tcttctcact cttatatccc c 412134DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-35
21catgagaaga ctcttctgtc gaacacagtg gtac 342226DNAArtificial
SequenceDescription of Artificial Sequence Oligo 2 for KGF-des1-35
22cactgtgttc gacagaagag tcttct 262328DNAArtificial
SequenceDescription of Artificial Sequence Oligo 1 for KGF-des1-37
23catgctcttc tgtcgaacac agtggtac 282420DNAArtificial
SequenceDescription of Artificial Sequence Oligo 2 for KGF-des1-37
24cactgtgttc gacagaagag 2025489DNAArtificial SequenceDescription of
Artificial Sequence DNA encoding KGF-163 25tgc aat gac atg act cca
gag caa atg gct aca aat gtg aac tgt tcc 48Cys Asn Asp Met Thr Pro
Glu Gln Met Ala Thr Asn Val Asn Cys Ser 1 5 10 15agc cct gag cga
cac aca aga agt tat gat tac atg gaa gga ggg gat 96Ser Pro Glu Arg
His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly Asp 20 25 30ata aga gtg
aga aga ctc ttc tgt cga aca cag tgg tac ctg agg atc 144Ile Arg Val
Arg Arg Leu Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile 35 40 45gat aaa
aga ggc aaa gta aaa ggg acc caa gag atg aag aat aat tac 192Asp Lys
Arg Gly Lys Val Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr 50 55 60aat
atc atg gaa atc agg aca gtg gca gtt gga att gtg gca atc aaa 240Asn
Ile Met Glu Ile Arg Thr Val Ala Val Gly Ile Val Ala Ile Lys 65 70
75 80ggg gtg gaa agt gaa ttc tat ctt gca atg aac aag gaa gga aaa
ctc 288Gly Val Glu Ser Glu Phe Tyr Leu Ala Met Asn Lys Glu Gly Lys
Leu 85 90 95tat gca aag aaa gaa tgc aat gaa gat tgt aac ttc aaa gaa
cta att 336Tyr Ala Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu
Leu Ile 100 105 110ctg gaa aac cat tac aac aca tat gca tca gct aaa
tgg aca cac aac 384Leu Glu Asn His Tyr Asn Thr Tyr Ala Ser Ala Lys
Trp Thr His Asn 115 120 125gga ggg gaa atg ttt gtt gcc tta aat caa
aag ggg att cct gta aga 432Gly Gly Glu Met Phe Val Ala Leu Asn Gln
Lys Gly Ile Pro Val Arg 130 135 140gga aaa aaa acg aag aaa gaa caa
aaa aca gcc cac ttt ctt cct atg 480Gly Lys Lys Thr Lys Lys Glu Gln
Lys Thr Ala His Phe Leu Pro Met145 150 155 160gca ata act 489Ala
Ile Thr26163PRTArtificial SequenceDescription of Artificial
Sequence DNA encoding KGF-163 26Cys Asn Asp Met Thr Pro Glu Gln Met
Ala Thr Asn Val Asn Cys Ser 1 5 10 15Ser Pro Glu Arg His Thr Arg
Ser Tyr Asp Tyr Met Glu Gly Gly Asp 20 25 30Ile Arg Val Arg Arg Leu
Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile 35 40 45Asp Lys Arg Gly Lys
Val Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr 50 55 60Asn Ile Met Glu
Ile Arg Thr Val Ala Val Gly Ile Val Ala Ile Lys 65 70 75 80Gly Val
Glu Ser Glu Phe Tyr Leu Ala Met Asn Lys Glu Gly Lys Leu 85 90 95Tyr
Ala Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu Leu Ile 100 105
110Leu Glu Asn His Tyr Asn Thr Tyr Ala Ser Ala Lys Trp Thr His Asn
115 120 125Gly Gly Glu Met Phe Val Ala Leu Asn Gln Lys Gly Ile Pro
Val Arg 130 135 140Gly Lys Lys Thr Lys Lys Glu Gln Lys Thr Ala His
Phe Leu Pro Met145 150 155 160Ala Ile Thr27423DNAArtificial
SequenceDescription of Artificial Sequence DNA encoding KGF-des1-22
(with the N-terminal arginine residue substituted with an alanine
residue) 27gct agt tat gat tac atg gaa gga ggg gat ata aga gtg aga
aga ctc 48Ala Ser Tyr Asp Tyr Met Glu Gly Gly Asp Ile Arg Val Arg
Arg Leu 1 5 10 15ttc tgt cga aca cag tgg tac ctg agg atc gat aaa
aga ggc aaa gta 96Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile Asp Lys
Arg Gly Lys Val 20 25 30aaa ggg acc caa gag atg aag aat aat tac aat
atc atg gaa atc agg 144Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr Asn
Ile Met Glu Ile Arg 35 40 45aca gtg gca gtt gga att gtg gca atc aaa
ggg gtg gaa agt gaa ttc 192Thr Val Ala Val Gly Ile Val Ala Ile Lys
Gly Val Glu Ser Glu Phe 50 55 60tat ctt gca atg aac aag gaa gga aaa
ctc tat gca aag aaa gaa tgc 240Tyr Leu Ala Met Asn Lys Glu Gly Lys
Leu Tyr Ala Lys Lys Glu Cys 65 70 75 80aat gaa gat tgt aac ttc aaa
gaa cta att ctg gaa aac cat tac aac 288Asn Glu Asp Cys Asn Phe Lys
Glu Leu Ile Leu Glu Asn His Tyr Asn 85 90 95aca tat gca tca gct aaa
tgg aca cac aac gga ggg gaa atg ttt gtt 336Thr Tyr Ala Ser Ala Lys
Trp Thr His Asn Gly Gly Glu Met Phe Val 100 105 110gcc tta aat caa
aag ggg att cct gta aga gga aaa aaa acg aag aaa 384Ala Leu Asn Gln
Lys Gly Ile Pro Val Arg Gly Lys Lys Thr Lys Lys 115 120 125gaa caa
aaa aca gcc cac ttt ctt cct atg gca ata act 423Glu Gln Lys Thr Ala
His Phe Leu Pro Met Ala Ile Thr 130 135 14028141PRTArtificial
SequenceDescription of Artificial Sequence DNA encoding KGF-des1-22
(with the N-terminal arginine residue substituted with an alanine
residue) 28Ala Ser Tyr Asp Tyr Met Glu Gly Gly Asp Ile Arg Val Arg
Arg Leu 1 5 10 15Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile Asp Lys
Arg Gly Lys Val 20 25 30Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr Asn
Ile Met Glu Ile Arg 35 40 45Thr Val Ala Val Gly Ile Val Ala Ile Lys
Gly Val Glu Ser Glu Phe 50 55 60Tyr Leu Ala Met Asn Lys Glu Gly Lys
Leu Tyr Ala Lys Lys Glu Cys 65 70 75 80Asn Glu Asp Cys Asn Phe Lys
Glu Leu Ile Leu Glu Asn His Tyr Asn 85 90 95Thr Tyr Ala Ser Ala Lys
Trp Thr His Asn Gly Gly Glu Met Phe Val 100 105 110Ala Leu Asn Gln
Lys Gly Ile Pro Val Arg Gly Lys Lys Thr Lys Lys 115 120 125Glu Gln
Lys Thr Ala His Phe Leu Pro Met Ala Ile Thr 130 135 140
* * * * *