U.S. patent application number 11/821271 was filed with the patent office on 2008-08-21 for methods for delivering dna to muscle cells using recombinant adeno-associated virus vectors.
This patent application is currently assigned to Genzyme Corporation. Invention is credited to Barry J. Byrne, Paul D. Kessler, Gary J. Kurtzman, Gregory M. Podsakoff.
Application Number | 20080199442 11/821271 |
Document ID | / |
Family ID | 24353506 |
Filed Date | 2008-08-21 |
United States Patent
Application |
20080199442 |
Kind Code |
A1 |
Podsakoff; Gregory M. ; et
al. |
August 21, 2008 |
Methods for delivering DNA to muscle cells using recombinant
adeno-associated virus vectors
Abstract
The use of recombinant adeno-associated virus (AAV) virions for
delivery of DNA molecules to muscle cells and tissue is disclosed.
The invention allows for the direct, in vivo injection of
recombinant AAV virions into muscle tissue, e.g., by intramuscular
injection, as well as for the in vitro transduction of muscle cells
which can subsequently be introduced into a subject for treatment.
The invention provides for sustained, high-level expression of the
delivered gene and for in vivo secretion of the therapeutic protein
from transduced muscle cells such that systemic delivery is
achieved.
Inventors: |
Podsakoff; Gregory M.;
(Fullerton, CA) ; Kessler; Paul D.; (Baltimore,
MD) ; Byrne; Barry J.; (Baltimore, MD) ;
Kurtzman; Gary J.; (Menlo Park, CA) |
Correspondence
Address: |
ROBINS & PASTERNAK
1731 EMBARCADERO ROAD, SUITE 230
PALO ALTO
CA
94303
US
|
Assignee: |
Genzyme Corporation
Cambridge
MA
Johns Hopkins University
Baltimore
MD
|
Family ID: |
24353506 |
Appl. No.: |
11/821271 |
Filed: |
June 22, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10092454 |
Mar 5, 2002 |
7238674 |
|
|
11821271 |
|
|
|
|
09755734 |
Jan 4, 2001 |
6391858 |
|
|
10092454 |
|
|
|
|
09309042 |
May 10, 1999 |
6211163 |
|
|
09755734 |
|
|
|
|
09226989 |
Jan 7, 1999 |
|
|
|
09309042 |
|
|
|
|
08588355 |
Jan 18, 1996 |
5858351 |
|
|
09226989 |
|
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/235.1; 435/320.1; 435/325; 435/6.13; 514/44R |
Current CPC
Class: |
C12Y 302/01023 20130101;
A61K 38/1816 20130101; C12N 2840/44 20130101; A61K 38/47 20130101;
A61K 48/00 20130101; C12N 15/86 20130101; C12N 9/2471 20130101;
C12N 2830/42 20130101; C07K 14/505 20130101; C12N 2750/14143
20130101; A01K 2217/05 20130101; C12Y 302/0102 20130101; A61P 43/00
20180101 |
Class at
Publication: |
424/93.21 ;
514/44; 435/6; 435/325; 435/235.1; 435/320.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 31/711 20060101 A61K031/711; C12Q 1/68 20060101
C12Q001/68; C12N 15/64 20060101 C12N015/64; C12N 7/01 20060101
C12N007/01; C12N 5/06 20060101 C12N005/06 |
Claims
1. A method of delivering a selected gene to a muscle cell or
tissue, said method comprising: (a) providing a recombinant
adeno-associated virus (AAV) virion which comprises an AAV vector,
said AAV vector comprising said selected gene operably linked to
control elements capable of directing the in vivo transcription and
translation of said selected gene; and (b) introducing said
recombinant AAV virion into said muscle cell or tissue.
2. The method of claim 1, wherein said muscle cell or tissue is
derived from skeletal muscle.
3. The method of claim 1, wherein said muscle cell or tissue is
derived from smooth muscle.
4. The method of claim 1, wherein said muscle cell or tissue is
derived from cardiac muscle.
5. The method of claim 1, wherein said muscle cell is a skeletal
myoblast.
6. The method of claim 1, wherein said muscle cell is a skeletal
myocyte.
7. The method of claim 1, wherein said muscle cell is a
cardiomyocyte.
8. The method of claim 1, wherein said recombinant AAV virion is
introduced into said muscle cell in vivo.
9. The method of claim 1, wherein said recombinant AAV virion is
introduced into said muscle cell in vitro.
10. The method of claim 1, wherein said selected gene encodes a
therapeutic protein.
11. The method of claim 10, wherein said protein is
erythropoietin.
12. A muscle cell or tissue transduced with a recombinant AAV
virion which comprises an AAV vector, said AAV vector comprising a
selected gene operably linked to control elements capable of
directing the in vivo transcription and translation of said
selected gene.
13. The muscle cell of claim 12, wherein said cell is a skeletal
myoblast.
14. The muscle cell of claim 12, wherein said cell is a skeletal
myocyte.
15. The muscle cell of claim 12, wherein said cell is a
cardiomyocyte.
16. The muscle cell of claim 12, wherein said selected gene encodes
erythropoietin.
17. A method of treating an acquired or inherited disease in a
mammalian subject comprising introducing into a muscle cell or
tissue of said subject a therapeutically effective amount of a
pharmaceutical composition which comprises (a) a pharmaceutically
acceptable excipient; and (b) recombinant AAV virions, wherein said
recombinant AAV virions comprise an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject, wherein said
introducing is done in vivo.
18. A method of treating an acquired or inherited disease in a
mammalian subject comprising: (a) introducing a recombinant AAV
virion into a muscle cell or tissue in vitro to produce a
transduced muscle cell, wherein said recombinant AAV virion
comprises an AAV vector, said AAV vector comprising a selected gene
operably linked to control elements capable of directing the
transcription and translation of said selected gene when present in
said subject; and (b) administering to said subject a
therapeutically effective amount of a composition comprising a
pharmaceutically acceptable excipient and the transduced muscle
cells from step (a).
19. A method for delivering a therapeutically effective amount of a
protein systemically to a mammalian subject comprising introducing
into a muscle cell or tissue of said subject a pharmaceutical
composition which comprises (a) a pharmaceutically acceptable
excipient; and (b) recombinant AAV virions, wherein said
recombinant AAV virions comprise an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject, wherein said
introducing is done in vivo.
20. A method for delivering a therapeutically effective amount of a
protein systemically to a mammalian subject comprising: (a)
introducing a recombinant AAV virion into a muscle cell or tissue
in vitro to produce a transduced muscle cell, wherein said
recombinant AAV virion comprises an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject; and (b) administering
to said subject a therapeutically effective amount of a composition
comprising a pharmaceutically acceptable excipient and the
transduced muscle cells from step (a).
21. An adeno-associated virus (AAV) vector comprising a gene
encoding human erythropoietin operably linked to control elements
capable of directing the in vivo transcription and translation of
said gene.
22. A recombinant adeno-associated virus (AAV) virion which
comprises the AAV vector of claim 19.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 10/092,454, filed Mar. 5, 2002, which
is a continuation application of U.S. patent application Ser. No.
09/755,734, filed Jan. 4, 2001, now U.S. Pat. No. 6,391,858, which
is a continuation application of U.S. patent application Ser. No.
09/309,042, filed May 10, 1999, now U.S. Pat. No. 6,211,163, which
is a continuation of U.S. patent application Ser. No. 09/226,989,
filed Jan. 7, 1999, now abandoned, which is a continuation of U.S.
patent application Ser. No. 08/588,355, filed Jan. 18, 1996, now
U.S. Pat. No. 5,858,351, from which applications priority is
claimed pursuant to 35 U.S.C. .sctn.120, and which applications are
incorporated herein by reference in their entireties.
TECHNICAL FIELD
[0002] The present invention relates generally to DNA delivery
methods. More particularly, the invention relates to the use of
recombinant adeno-associated virus (AAV) virions for delivery of a
selected gene to muscle cells and tissue. The method provides for
sustained, high-level expression of the delivered gene.
BACKGROUND OF THE INVENTION
[0003] Gene delivery is a promising method for the treatment of
acquired and inherited diseases. Muscle tissue is an appealing gene
delivery target because it is readily accessible,
well-differentiated and nondividing. Barr and Leiden (1991) Science
254:1507-1509. These properties are important in the selection of
appropriate delivery strategies to achieve maximal gene
transfer.
[0004] Several experimenters have demonstrated the ability to
deliver genes to muscle cells with the subsequent systemic
appearance of proteins encoded by the delivered genes. See, e.g.,
Wolff et al. (1990) Science 247:1465-1468; Acsadi et al. (1991)
Nature 352:815-818; Barr and Leiden (1991) Science 254:1507-1509;
Dhawan et al. (1991) Science 254:1509-1512; Wolff et al. (1992)
Human Mol. Genet. 1:363-369; Eyal et al. (1993) Proc. Natl. Acad.
Sci. USA 90:4523-4527; Davis et al. (1993) Hum. Gene Therapy
4:151-159.
[0005] Genes have been delivered to muscle by direct injection of
plasmid DNA, such as described by Wolff et al. (1990) Science
247:1465-1468; Acsadi et al. (1991) Nature 352:815-818; Barr and
Leiden (1991) Science 254:1507-1509. However, this mode of
administration generally results in sustained but low levels of
expression. Low but sustained expression levels may be effective in
certain situations, such as for providing immunity.
[0006] Viral based systems have also been used for gene delivery to
muscle. For example, human adenoviruses are double-stranded DNA
viruses which enter cells by receptor-mediated endocytosis. These
viruses have been considered well suited for gene transfer because
they are easy to grow and manipulate and they exhibit a broad host
range in vivo and in vitro. Adenoviruses are able to infect
quiescent as well as replicating target cells and persist
extrachromosomally, rather than integrating into the host
genome.
[0007] Despite these advantages, adenovirus vectors suffer from
several drawbacks which make them ineffective for long term gene
therapy. In particular, adenovirus vectors express viral proteins
that may elicit an immune response which may decrease the life of
the transduced cell. This immune reaction may preclude subsequent
treatments because of humoral and/or T cell responses. Furthermore,
the adult muscle cell may lack the receptor which recognizes
adenovirus vectors, precluding efficient transduction of this cell
type using such vectors. Thus, attempts to use adenoviral vectors
for the delivery of genes to muscle cells has resulted in poor
and/or transitory expression. See, e.g., Quantin et al. (1992)
Proc. Natl. Acad. Sci. USA 89:2581-2584; Acsadi et al. (1994) Hum.
Mol. Genetics 3:579-584; Acsadi et al. (1994) Gene Therapy
1:338-340; Dai et al. (1995) Proc. Natl. Acad. Sci. USA
92:1401-1405; Descamps et al. (1995) Gene Therapy 2:411-417;
Gilgenkrantz et al. (1995) Hum. Gene Therapy 6:1265-1274.
[0008] Gene therapy methods based upon surgical transplantation of
myoblasts has also been attempted. See, e.g., International
Publication no. WO 95/13376; Dhawan et al. (1991) Science
254:1509-1512; Wolff et al. (1992) Human Mol. Genet. 1:363-369; Dai
et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hamamori
et al. (1994) Hum. Gene Therapy 5:1349-1356; Hamamori et al. (1995)
J. Cdin. Invest. 95:1808-1813; Blau and Springer (1995) New Eng. J.
Med. 333:1204-1207; Leiden, J. M. (1995) New Eng. J. Med.
333:871-872; Mendell et al. (1995) New Eng. J. Med. 333:832-838;
and Blau and Springer (1995) New Eng. J. Med. 333:1554-1556.
However, such methods require substantial tissue culture
manipulation and surgical expertise, and, at best, show
inconclusive efficacy in clinical trials. Thus, a simple and
effective method of gene delivery to muscle, resulting in long-term
expression of the delivered gene, would be desirable.
[0009] Recombinant vectors based on adeno-associated viruses (AAV)
have been used for DNA delivery. AAV is a helper-dependent DNA
parvovirus which belongs to the genus Dependovirus. AAV requires
infection with an unrelated helper virus, such as adenovirus, a
herpesvirus or vaccinia, in order for a productive infection to
occur. The helper virus supplies accessory functions that are
necessary for most steps in AAV replication. In the absence of such
infection, AAV establishes a latent state by insertion of its
genome into a host cell chromosome. Subsequent infection by a
helper virus rescues the integrated copy which can then replicate
to produce infectious viral progeny. AAV has a wide host range and
is able to replicate in cells from any species so long as there is
also a successful infection of such cells with a suitable helper
virus. Thus, for example, human AAV will replicate in canine cells
coinfected with a canine adenovirus. AAV has not been associated
with any human or animal disease and does not appear to alter the
biological properties of the host cell upon integration. For a
review of AAV, see, e.g., Berns and Bohenzky (1987) Advances in
Virus Research (Academic Press, Inc.) 32:243-307.
[0010] The AAV genome is composed of a linear, single-stranded DNA
molecule which contains approximately 4681 bases (Berns and
Bohenzky, supra). The genome includes inverted terminal repeats
(ITRs) at each end which function in cis as origins of DNA
replication and as packaging signals for the virus. The internal
nonrepeated portion of the genome includes two large open reading
frames, known as the AAV rep and cap regions, respectively. These
regions code for the viral proteins involved in replication and
packaging of the virion. For a detailed description of the AAV
genome, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol.
and Immunol. 158:97-129.
[0011] The construction of recombinant AAV (rAAV) virions has been
described. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941;
International Publication Numbers WO 92/01070 (published 23 Jan.
1992) and WO 93/03769 (published 4 Mar. 1993); Lebkowski et al.
(1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990)
Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J.
(1992) Current opinion in Biotechnology 3:533-539; Muzyczka, N.
(1992) Current Topics in Microbiol. and Immunol. 158:97-129; and
Kotin, R. M. (1994) Human Gene Therapy 5:793-801.
[0012] Recombinant AAV virion production generally involves
cotransfection of a host cell with an AAV vector plasmid and a
helper construct which provides AAV helper functions to complement
functions missing from the AAV vector plasmid. In this manner, the
host cell is capable of expressing the AAV proteins necessary for
AAV replication and packaging. The AAV vector plasmid will include
the DNA of interest flanked by AAV ITRs which provide for AAV
replication and packaging functions. AAV helper functions can be
provided via an AAV helper plasmid that includes the AAV rep and/or
cap coding regions but which lacks the AAV ITRs. Accordingly, the
helper plasmid can neither replicate nor package itself. The host
cell is then infected with a helper virus to provide accessory
functions, or with a vector which includes the necessary accessory
functions. The helper virus transactivates the AAV promoters
present on the helper plasmid that direct the transcription and
translation of AAV rep and cap regions. Upon subsequent culture of
the host cells, recombinant AAV virions harboring the DNA of
interest, are produced.
[0013] Recombinant AAV virions have been shown to exhibit tropism
for respiratory epithelial cells (Flotte et al. (1992) Am. J.
Respir. Cell Mol. Biol. 7:349-356; Flotte et al. (1993) J. Biol.
Chem. 268:3781-3790; Flotte et al. (1993) Proc. Natl. Acad. Sci.
USA 90:10613-10617) and neurons of the central nervous system
(Kaplitt et al. (1994) Nature Genetics 8:148-154). These cell types
are well-differentiated, slowly-dividing or postmitotic. Flotte et
al. (1993) Proc. Natl. Acad. Sci. USA 90:10613-10617; Kaplitt et
al. (1994) Nature Genetics 8:148-154. The ability of AAV vectors to
transduce nonproliferating cells (Podsakoff et al. (1994) J. Virol.
68:5656-5666; Russell et al. (1994) Proc. Natl. Acad. sci. USA
91:8915-8919; Flotte et al. (1994) Am. J. Respir. Cell Mol. Biol.
11:517-521) along with the attributes of being inherently defective
and nonpathogenic, place AAV in a unique position among gene
therapy viral vectors.
[0014] Despite these advantages, the use of recombinant AAV virions
to deliver genes to muscle cells in vivo has not heretofore been
disclosed.
SUMMARY OF THE INVENTION
[0015] Accordingly, the present invention is based on the
surprising and unexpected discovery that recombinant AAV (rAAV)
virions provide for efficient delivery of genes and sustained
production of therapeutic proteins in various muscle cell types.
The invention allows for in vivo secretion of the therapeutic
protein from transduced muscle cells such that systemic delivery is
achieved. These results are seen with both in vivo and in vitro
modes of DNA delivery. Hence, rAAV virions allow delivery of DNA
directly to muscle tissue. The ability to deliver and express genes
in muscle cells, as well as to provide for secretion of the
produced protein from transduced cells, allows the use of gene
therapy approaches to treat and/or prevent a wide variety of
disorders.
[0016] Furthermore, the ability to deliver DNA to muscle cells by
intramuscular administration in vivo provides a more efficient and
convenient method of gene transfer.
[0017] Thus, in one embodiment, the invention relates to a method
of delivering a selected gene to a muscle cell or tissue. The
method comprises:
[0018] (a) providing a recombinant AAV virion which comprises an
AAV vector, the AAV vector comprising the selected gene operably
linked to control elements capable of directing the in vivo
transcription and translation of the selected gene; and
[0019] (b) introducing the recombinant AAV virion into the muscle
cell or tissue.
[0020] In particularly preferred embodiments, the selected gene
encodes a therapeutic protein, such as erythropoietin.
[0021] In another embodiment, the invention is directed to a muscle
cell or tissue transduced with a recombinant AAV virion which
comprises an AAV vector, the AAV vector comprising a selected gene
operably linked to control elements capable of directing the in
vivo transcription and translation of the selected gene.
[0022] In still further embodiments, the invention is directed to a
method of treating an acquired or inherited disease in a mammalian
subject comprising introducing into a muscle cell or tissue of the
subject, in vivo, a therapeutically effective amount of a
pharmaceutical composition which comprises (a) a pharmaceutically
acceptable excipient; and (b) recombinant AAV virions. The
recombinant AAV virions comprise an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject.
[0023] In yet another embodiment, the invention is directed to a
method of treating an acquired or inherited disease in a mammalian
subject comprising:
[0024] (a) introducing a recombinant AAV virion into a muscle cell
or tissue in vitro to produce a transduced muscle cell. The
recombinant AAV virion comprises an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject; and
[0025] (b) administering to the subject a therapeutically effective
amount of a composition comprising a pharmaceutically acceptable
excipient and the transduced muscle cells from step (a).
[0026] In a further embodiment, the invention relates to a method
for delivering a therapeutically effective amount of a protein
systemically to a mammalian subject comprising introducing into a
muscle cell or tissue of the subject a pharmaceutical composition
which comprises (a) a pharmaceutically acceptable excipient; and
(b) recombinant AAV virions, wherein the recombinant AAV virions
comprise an AAV vector, the AAV vector comprising a selected gene
operably linked to control elements capable of directing the
transcription and translation of the selected gene when present in
the subject, wherein the introducing is done in vivo.
[0027] In another embodiment, the invention is directed to a method
for delivering a therapeutically effective amount of a protein
systemically to a mammalian subject comprising:
[0028] (a) introducing a recombinant AAV virion into a muscle cell
or tissue in vitro to produce a transduced muscle cell, wherein the
recombinant AAV virion comprises an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject; and
[0029] (b) administering to the subject a therapeutically effective
amount of a composition comprising a pharmaceutically acceptable
excipient and the transduced muscle cells from step (a).
[0030] In other embodiments, the invention is directed to an AAV
vector comprising a gene encoding human erythropoietin (hEPO)
operably linked to control elements capable of directing the in
vivo transcription and translation of the gene, as well as a
recombinant AAV (rAAV) virion comprising the vector.
[0031] These and other embodiments of the subject invention will
readily occur to those of ordinary skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0032] FIG. 1 shows the dose-response of rAAV-LacZ expression in
Balb/c mice tibialis anterior muscle in vivo, as described in
Example 1. Adult Balb/c mice were injected intramuscularly (IM)
with various doses of rAAV-LacZ vector. At 2 and 8 weeks post
injection, tissue was harvested for analysis of beta-galactosidase
(.beta.-gal). B-gal expression was analyzed by measurement of
relative light units (RLU) emitted from muscle homogenates detected
by a luminometer using the Galacto-Light.TM. reagent detection
kit.
[0033] FIG. 2 shows the time course of expression of rAAV-LacZ
vector in Balb/c mice tibialis anterior muscle in vivo as described
in Example 2. Adult Balb/c mice were injected with 8.times.10.sup.9
vector genomes of rAAV-LacZ IM and muscle was harvested and
assessed for total .beta.-gal expression representing various time
points post-injection. B-gal expression was analyzed as described
above.
[0034] FIG. 3 shows the secretion of human erythropoietin (hEPO)
from transduced myotubes and myoblasts, as described in Example 3.
Myotubes (differentiated cells) or myoblasts (actively dividing
cells) were transduced with rAAV-hEPO at a ratio of approximately
10.sup.5vector particles per target cell. Subsequently 24-hour
levels of hEPO were analyzed in supernatants at various time
points. Baseline levels of hEPO, prior to transduction, were below
the level of detection in both cell populations; the values at each
point represent replicate values +/- standard deviation.
[0035] FIG. 4 shows sustained expression of hEPO resulting in
elevated hematocrit in Balb/c mice, in vivo, as described in
Example 4. Animals were injected IM in their hindlimbs
percutaneously with 6.5.times.10.sup.11 vector genomes, and serum
levels of hEPO and measurements of hematocrit (HCT) were analyzed.
Each point is a replicate value, with error bars indicating
standard deviation.
[0036] FIG. 5 shows dose-response curves for rAAV-hEPO in Balb/c
mice IM at 20 and 41 days post-injection, as described in Example
4. These data indicate that there is a linear dose response of
serum hEPO levels at both time points. Each point is a replicate
value (n=4), with error bars indicating standard deviation.
[0037] FIG. 6 depicts an in vivo comparison of circulating hEPO
levels obtained with IM rAAV-hEPO vector versus IM pAAV-hEPO
plasmid at days 20 and 41 post-injection, as described in Example
4. Either 3.times.10.sup.11 single-stranded vector genomes or
1.4.times.10.sup.13 double-stranded plasmid molecules present in
100 .mu.g of plasmid DNA were injected IM in Balb/c mice. On days
20 and 41, serum hEPO levels were measured by the R and D Systems
kit. Human EPO levels were below the level of detection (2.5 mU/mL)
on day 41 in the plasmid-injected mice.
[0038] FIG. 7 shows an in vivo comparison of circulating hEPO
levels in IM versus IV-administered rAAV-hEPO vector, as described
in Example 5. Balb/c mice were injected with 3.times.10.sup.11
vector genomes IM or IV and serum levels of hEPO were measured by
the R and D Systems kit at days 20 and 41.
DETAILED DESCRIPTION OF THE INVENTION
[0039] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of virology,
microbiology, molecular biology and recombinant DNA techniques
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Sambrook, et al. Molecular Cloning: A
Laboratory Manual (Current Edition); DNA Cloning: A Practical
Approach, vol. I & II (D. Glover, ed.); Oligonucleotide
Synthesis (N. Gait, ed., Current Edition); Nucleic Acid
Hybridization (B. Hames & S. Higgins, eds., Current Edition);
Transcription and Translation (B. Hames & S. Higgins, eds.,
Current Edition); CRC Handbook of Parvoviruses, vol. I & II (P.
Tijssen, ed.); Fundamental Virology, 2nd Edition, vol. I & II
(B. N. Fields and D. M. Knipe, eds.)
[0040] All publications, patents and patent applications cited
herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
[0041] As used in this specification and the appended claims, the
singular forms "a," "an" and "the" include plural references unless
the content clearly dictates otherwise.
A. Definitions
[0042] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0043] The phrase "delivering a gene" or "transferring a gene"
refers to methods or systems for reliably inserting foreign DNA
into host cells, such as into muscle cells. Such methods can result
in transient or long term expression of nonintegrated transferred
DNA, extrachromosomal replication and expression of transferred
replicons (e.g., episomes), or integration of transferred genetic
material into the genomic DNA of recipients. Gene transfer provides
a unique approach for the treatment of acquired and inherited
diseases. A number of systems have been developed for gene transfer
into mammalian cells. See, e.g., U.S. Pat. No. 5,399,346.
[0044] The term "therapeutic protein" refers to a protein which is
defective or missing from the subject in question, thus resulting
in a disease state or disorder in the subject, or to a protein
which confers a benefit to the subject in question, such as an
antiviral, antibacterial or antitumor function. A therapeutic
protein can also be one which modifies any one of a wide variety of
biological functions, such as endocrine, immunological and
metabolic functions. Representative therapeutic proteins are
discussed more fully below.
[0045] By "vector" is meant any genetic element, such as a plasmid,
phage, transposon, cosmid, chromosome, virus, virion, etc., which
is capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors.
[0046] By "AAV vector" is meant a vector derived from an
adeno-associated virus serotype, including without limitation,
AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. AAV vectors can have
one or more of the AAV wild-type genes deleted in whole or part,
preferably the rep and/or cap genes (described below), but retain
functional flanking ITR sequences (also described below).
Functional ITR sequences are necessary for the rescue, replication
and packaging of the AAV virion. Thus, an AAV vector is defined
herein to include at least those sequences required in cis for
replication and packaging (e.g., functional ITRs) of the virus. The
ITRs need not be the wild-type nucleotide sequences, and may be
altered, e.g., by the insertion, deletion or substitution of
nucleotides, so long as the sequences provide for functional
rescue, replication and packaging.
[0047] By "recombinant virus" is meant a virus that has been
genetically altered, e.g., by the addition or insertion of a
heterologous nucleic acid construct into the particle.
[0048] By "AAV virion" is meant a complete virus particle, such as
a wild-type (wt) AAV virus particle (comprising a linear,
single-stranded AAV nucleic acid genome associated with an AAV
capsid protein coat). In this regard, single-stranded AAV nucleic
acid molecules of either complementary sense, e.g., "sense" or
"antisense" strands, can be packaged into any one AAV virion and
both strands are equally infectious.
[0049] A "recombinant AAV virion," or "rAAV virion" is defined
herein as an infectious, replication-defective virus composed of an
AAV protein shell, encapsidating a DNA molecule of interest which
is flanked on both sides by AAV ITRs. An rAAV virion is produced in
a suitable host cell which has had an AAV vector, AAV helper
functions and accessory functions introduced therein In this
manner, the host cell is rendered capable of encoding AAV
polypeptides that are required for packaging the AAV vector
(containing a recombinant nucleotide sequence of interest) into
recombinant virion particles for subsequent gene delivery.
[0050] The term "transfection" is used to refer to the uptake of
foreign DNA by a mammalian cell. A cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are known in the art. See, e.g.,
Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989)
Molecular Cloning, a laboratory manual, Cold Spring Harbor
Laboratories, New York, Davis et al. (1986) Basic Methods in
Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197.
Such techniques can be used to introduce one or more exogenous DNA
moieties, such as a plasmid vector and other nucleic acid
molecules, into suitable host cells. The term refers to both stable
and transient uptake of the genetic material.
[0051] The term "transduction" denotes the delivery of a DNA
molecule to a recipient cell either in vivo or in vitro, via a
replication-defective viral vector, such as via a recombinant AAV
virion.
[0052] By "muscle cell" or "muscle tissue" is meant a cell or group
of cells derived from muscle, including but not limited to cells
and tissue derived from skeletal muscle; smooth muscle, e.g., from
the digestive tract, urinary bladder and blood vessels; and cardiac
muscle. The term captures muscle cells both in vitro and in vivo.
Thus, for example, an isolated cardiomyocyte would constitute a
"muscle cell" for purposes of the present invention, as would a
muscle cell as it exists in muscle tissue present in a subject in
vivo. The term also encompasses both differentiated and
nondifferentiated muscle cells, such as myocytes such as myotubes,
myoblasts, both dividing and differentiated, cardiomyocytes and
cardiomyoblasts.
[0053] The term "heterologous" as it relates to nucleic acid
sequences such as gene sequences and control sequences, denotes
sequences that are not normally joined together, and/or are not
normally associated with a particular cell. Thus, a "heterologous"
region of a nucleic acid construct or a vector is a segment of
nucleic acid within or attached to another nucleic acid molecule
that is not found in association with the other molecule in nature.
For example, a heterologous region of a nucleic acid construct
could include a coding sequence flanked by sequences not found in
association with the coding sequence in nature. Another example of
a heterologous coding sequence is a construct where the coding
sequence itself is not found in nature (e.g., synthetic sequences
having codons different from the native gene). Similarly, a cell
transformed with a construct which is not normally present in the
cell would be considered heterologous for purposes of this
invention. Allelic variation or naturally occurring mutational
events do not give rise to heterologous DNA, as used herein.
[0054] By "DNA" is meant a polymeric form of deoxyribonucleotides
(adenine, guanine, thymine, or cytosine) in double-stranded or
single-stranded form, either relaxed and supercoiled. This term
refers only to the primary and secondary structure of the molecule,
and does not limit it to any particular tertiary forms. Thus, this
term includes single- and double-stranded DNA found, inter alia, in
linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure of
particular DNA molecules, sequences may be described herein
according to the normal convention of giving only the sequence in
the 5' to 3' direction along the nontranscribed strand of DNA
(i.e., the strand having the sequence homologous to the mRNA). The
term captures molecules that include the four bases adenine,
guanine, thymine, or cytosine, as well as molecules that include
base analogues which are known in the art.
[0055] A "gene" or "coding sequence" or a sequence which "encodes"
a particular protein, is a nucleic acid molecule which is
transcribed (in the case of DNA) and translated (in the case of
mRNA) into a polypeptide in vitro or in vivo when placed under the
control of appropriate regulatory sequences. The boundaries of the
gene are determined by a start codon at the 5' (amino) terminus and
a translation stop codon at the 3' (carboxy) terminus. A gene can
include, but is not limited to, cDNA from prokaryotic or eukaryotic
mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and
even synthetic DNA sequences. A transcription termination sequence
will usually be located 3' to the gene sequence.
[0056] The term "control elements" refers collectively to promoter
regions, polyadenylation signals, transcription termination
sequences, upstream regulatory domains, origins of replication,
internal ribosome entry sites ("IRES"), enhancers, and the like,
which collectively provide for the replication, transcription and
translation of a coding sequence in a recipient cell. Not all of
these control elements need always be present so long as the
selected coding sequence is capable of being replicated,
transcribed and translated in an appropriate host cell.
[0057] The term "promoter region" is used herein in its ordinary
sense to refer to a nucleotide region comprising a DNA regulatory
sequence, wherein the regulatory sequence is derived from a gene
which is capable of binding RNA polymerase and initiating
transcription of a downstream (3'-direction) coding sequence.
[0058] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control elements operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control elements need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0059] For the purpose of describing the relative position of
nucleotide sequences in a particular nucleic acid molecule
throughout the instant application, such as when a particular
nucleotide sequence is described as being situated "upstream,"
"downstream," "3'," or "5'" relative to another sequence, it is to
be understood that it is the position of the sequences in the
"sense" or "coding" strand of a DNA molecule that is being referred
to as is conventional in the art. "Homology" refers to the percent
of identity between two polynucleotide or two polypeptide moieties.
The correspondence between the sequence from one moiety to another
can be determined by techniques known in the art. For example,
homology can be determined by a direct comparison of the sequence
information between two polypeptide molecules by aligning the
sequence information and using readily available computer programs.
Alternatively, homology can be determined by hybridization of
polynucleotides under conditions which form stable duplexes between
homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. Two DNA, or two polypeptide sequences are
"substantially homologous" to each other when at least about 80%,
preferably at least about 90%, and most preferably at least about
95% of the nucleotides or amino acids match over a defined length
of the molecules, as determined using the methods above.
[0060] By "mammalian subject" is meant any member of the class
Mammalia including, without limitation, humans and nonhuman
primates such as chimpanzees and other apes and monkey species;
farm animals such as cattle, sheep, pigs, goats and horses;
domestic mammals such as dogs and cats; laboratory animals
including rodents such as mice, rats and guinea pigs, and the like.
The term does not denote a particular age or sex. Thus, adult and
newborn subjects, as well as fetuses, whether male or female, are
intended to be covered.
B. General Methods
[0061] The present invention provides for the successful transfer
of a selected gene to a muscle cell using recombinant AAV virions.
The method allows for the direct, in vivo injection of recombinant
AAV virions into muscle tissue, e.g., by intramuscular injection,
as well as for the in vitro transduction of muscle cells which can
subsequently be introduced into a subject for treatment. The
invention also provides for secretion of the produced protein in
vivo, from transduced muscle cells, such that systemic delivery can
be achieved.
[0062] Differentiated muscle cells and tissue provide a desirable
target for gene therapy since they are readily accessible and
nondividing. However, the present invention also finds use with
nondifferentiated muscle cells, such as myoblasts, which can be
transduced in vitro, and subsequently introduced into a
subject.
[0063] Since muscle has ready access to the circulatory system, a
protein produced and secreted by muscle cells and tissue in vivo
will enter the bloodstream for systemic delivery. Furthermore,
since sustained, therapeutic levels of protein secretion from
muscle is achieved in vivo using the present invention, repetitive
exogenous delivery is avoided or reduced in frequency such that
therapy can be accomplished using only one or few injections. Thus,
the present invention provides significant advantages over prior
gene delivery methods.
[0064] The recombinant AAV virions of the present invention,
including the DNA of interest, can be produced using standard
methodology, known to those of skill in the art. The methods
generally involve the steps of (1) introducing an AAV expression
vector into a host cell; (2) introducing an AAV helper construct
into the host cell, where the helper construct includes AAV coding
regions capable of being expressed in the host cell to complement
AAV helper functions missing from the AAV vector; (3) introducing
one or more helper viruses and/or accessory function vectors into
the host cell, wherein the helper virus and/or accessory function
vectors provide accessory functions capable of supporting efficient
recombinant AAV ("rAAV") virion production in the host cell; and
(4) culturing the host cell to produce rAAV virions. The AAV
expression vector, AAV helper construct and the helper virus or
accessory function vector(s) can be introduced into the host cell,
either simultaneously or serially, using standard transfection
techniques.
1. AAV Expression Vectors
[0065] AAV expression vectors are constructed using known
techniques to at least provide as operatively linked components in
the direction of transcription, control elements including a
transcriptional initiation region, the DNA of interest and a
transcriptional termination region. The control elements are
selected to be functional in a mammalian muscle cell. The resulting
construct which contains the operatively linked components is
bounded (5' and 3') with functional AAV ITR sequences.
[0066] The nucleotide sequences of AAV ITR regions are known. See,
e.g., Kotin, R. M. (1994) Human Gene Therapy 5:793-801; Berns, K.
I. "Parvoviridae and their Replication" in Fundamental Virology,
2nd Edition, (B. N. Fields and D. M. Knipe, eds.) for the AAV-2
sequence. AAV ITRs used in the vectors of the invention need not
have a wild-type nucleotide sequence, and may be altered, e.g., by
the insertion, deletion or substitution of nucleotides.
Additionally, AAV ITRs may be derived from any of several AAV
serotypes, including without limitation, AAV-1, AAV-2, AAV-3,
AAV-4, AAV-5, AAVX7, etc. Furthermore, 5' and 3' ITRs which flank a
selected nucleotide sequence in an AAV expression vector need not
necessarily be identical or derived from the same AAV serotype or
isolate, so long as they function as intended, i.e., to allow for
excision and rescue of the sequence of interest from a host cell
genome or vector, and to allow integration of the DNA molecule into
the recipient cell genome when AAV Rep gene products are present in
the cell.
[0067] Suitable DNA molecules for use in AAV vectors will be less
than about 5 kilobases (kb) in size and will include, for example,
a gene that encodes a protein that is defective or missing from a
recipient subject or a gene that encodes a protein having a desired
biological or therapeutic effect (e.g., an antibacterial, antiviral
or antitumor function).
[0068] Suitable DNA molecules include, but are not limited to,
those encoding for proteins used for the treatment of endocrine,
metabolic, hematologic, cardiovascular, neurologic,
musculoskeletal, urologic, pulmonary and immune disorders,
including such disorders as inflammatory diseases, autoimmune,
chronic and infectious diseases, such as AIDS, cancer,
hypercholestemia, insulin disorders such as diabetes, growth
disorders, various blood disorders including various anemias,
thalassemias and hemophilia; genetic defects such as cystic
fibrosis, Gaucher's Disease, Hurler's Disease, adenosine deaminase
(ADA) deficiency, emphysema, or the like.
[0069] To exemplify the invention, the gene encoding
.erythropoietin (EPO) has been used. EPO is a hormone which
controls the formation of red blood cells in the bone marrow. The
sequence of this gene, as well as methods of obtaining the same,
have been described in, e.g., U.S. Pat. No. 4,954,437, incorporated
herein by reference in its entirety, as well as in Jacobs et al.
(1985) Nature 313:806-810; Lin et al. (1985) Proc. Natl. Acad. Sci.
USA 82:7580; International Publication Number WO 85/02610; and
European Patent Publication Number 232,034 B1. The recombinant AAV
virions described herein which include a gene encoding EPO, or
encoding an analog or derivative thereof having the same function,
are particularly useful in the treatment of blood disorders
characterized by defective red blood cell formation, such as in the
treatment of anemia. Increased red blood cell production due to the
introduction of the EPO gene can be readily determined by an
appropriate indicator, such as by comparing hematocrit measurements
pre- and post-treatment. As described above, the EPO gene is
flanked by AAV ITRs.
[0070] The selected nucleotide sequence, such as EPO or another
gene of interest, is operably linked to control elements that
direct the transcription or expression thereof in the subject in
vivo. Such control elements can comprise control sequences normally
associated with the selected gene. Alternatively, heterologous
control sequences can be employed. Useful heterologous control
sequences generally include those derived from sequences encoding
mammalian or viral genes. Examples include, but are not limited to,
the SV40 early promoter, mouse mammary tumor virus LTR promoter;
adenovirus major late promoter (Ad MLP); a herpes simplex virus
(HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV
immediate early promoter region (CMVIE), a rous sarcoma virus (RSV)
promoter, synthetic promoters, hybrid promoters, and the like. In
addition, sequences derived from nonviral genes, such as the murine
metallothionein gene, will also find use herein. Such promoter
sequences are commercially available from, e.g., Stratagene.(San
Diego, Calif.).
[0071] For purposes of the present invention, control elements,
such as muscle-specific and inducible promoters, enhancers and the
like, will be of particular use. Such control elements include, but
are not limited to, those derived from the actin and myosin gene
families, such as from the myoD gene family (Weintraub et al.
(1991) Science 251:761-766); the myocyte-specific enhancer binding
factor MEF-2 (Cserjesi and Olson (1991) Mol. Cell Biol.
11:4854-4862); control elements derived from the human skeletal
actin gene (Muscat et al. (1987) Mol. Cell Biol. 7:4089-4099) and
the cardiac actin gene; muscle creatine kinase sequence elements
(Johnson et al. (1989) Mol. Cell Biol. 9:3393-3399) and the murine
creatine kinase enhancer (mCK) element; control elements derived
from the skeletal fast-twitch troponin C gene, the slow-twitch
cardiac troponin C gene and the slow-twitch troponin I gene;
hypoxia-inducible nuclear factors (Semenza et al. (1991) Proc.
Natl. Acad. Sci. USA 88:5680-5684; Semenza et al. J. Biol. Chem.
269:23757-23763); steroid-inducible elements and promoters, such as
the glucocorticoid response element (GRE) (Mader and White (1993)
Proc. Natl. Acad. Sci. USA 90:5603-5607); the fusion consensus
element for RU486 induction; and elements that provide for
tetracycline regulated gene expression (Dhawan et al. (1995) Somat.
Cell. Mol. Genet. 21:233-240; Shockett et al. (1995) Proc. Natl.
Acad. Sci. USA 92:6522-6526.
[0072] These and other regulatory elements can be tested for
potential in vivo efficacy using the in vitro myoblast model, which
mimics quiescent in vivo muscle physiology, described in the
examples below.
[0073] The AAV expression vector which harbors the DNA molecule of
interest bounded by AAV ITRs, can be constructed by directly
inserting the selected sequence(s) into an AAV genome which has had
the major AAV open reading frames ("ORFs") excised therefrom. Other
portions of the AAV genome can also be deleted, so long as a
sufficient portion of the ITRs remain to allow for replication and
packaging functions. Such constructs can be designed using
techniques well known in the art. See, e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941; International Publication Nos. WO 92/01070
(published 23 Jan. 1992) and WO 93/03769 (published 4 Mar. 1993);
Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et
al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press);
Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539;
Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol.
158:97-129; Kotin, R. M. (1994) Human Gene Therapy 5:793-801;
Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al.
(1994) J. Exp. Med. 179:1867-1875.
[0074] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al., supra. For example, ligations can be accomplished
in 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 33 ug/ml BSA,
10 mM-50 mM NaCl, and either 40 uM ATP, 0.01-0.02 (Weiss) units T4
DNA ligase at 0.degree. C. (for "sticky end" ligation) or 1 mM ATP,
0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for "blunt
end" ligation). Intermolecular "sticky end" ligations are usually
performed at 30-100 .mu.g/ml total DNA concentrations (5-100 nM
total end concentration). AAV vectors which contain ITRs have been
described in, e.g., U.S. Pat. No. 5,139,941. In particular, several
AAV vectors are described therein which are available from the
American Type Culture Collection ("ATCC") under Accession Numbers
53222, 53223, 53224, 53225 and 53226.
[0075] Additionally, chimeric genes can be produced synthetically
to include AAV ITR sequences arranged 5' and 3' of one or more
selected nucleic acid sequences. Preferred codons for expression of
the chimeric gene sequence in mammalian muscle cells can be used.
The complete chimeric sequence is assembled from overlapping
oligonucleotides prepared by standard methods. See, e.g., Edge,
Nature (1981) 292:756; Nambair et al. Science (1984) 223:1299; Jay
et al. J. Biol. Chem. (1984) 259:6311.
[0076] In order to produce rAAV virions, an AAV expression vector
is introduced into a suitable host cell using known techniques,
such as by transfection. A number of transfection techniques are
generally known in the art. See, e.g., Graham et al. (1973)
Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a
laboratory manual, Cold Spring Harbor Laboratories, New York, Davis
et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu
et al. (1981) Gene 13:197. Particularly suitable transfection
methods include calcium phosphate co-precipitation (Graham et al.
(1973) Virol. 52:456-467), direct micro-injection into cultured
cells (Capecchi, M. R. (1980) Cell 22:479-488), electroporation
(Shigekawa et al. (1988) BioTechniques 6:742-751), liposome
mediated gene transfer (Mannino et al. (1988) BioTechniques
6:682-690), lipid-mediated transduction (Felgner et al. (1987)
Proc. Natl. Acad. Sci. USA 84:7413-7417), and nucleic acid delivery
using high-velocity microprojectiles (Klein et al. (1987) Nature
327:70-73).
[0077] For the purposes of the invention, suitable host cells for
producing rAAV virions include microorganisms, yeast cells, insect
cells, and mammalian cells, that can be, or have been, used as
recipients of a heterologous DNA molecule. The term includes the
progeny of the original cell which has been transfected. Thus, a
"host cell" as used herein generally refers to a cell which has
been transfected with an exogenous DNA sequence. Cells from the
stable human cell line, 293 (readily available through, e.g., the
American Type Culture Collection under Accession Number ATCC
CRL1573) are preferred in the practice of the present invention.
Particularly, the human cell line 293 is a human embryonic kidney
cell line that has been transformed with adenovirus type-5 DNA
fragments (Graham et al. (1977) J. Gen. Virol. 36:59), and
expresses the adenoviral E1a and E1b genes (Aiello et al. (1979)
Virology 94:460). The 293 cell line is readily transfected, and
provides a particularly convenient platform in which to produce
rAAV virions.
2. AAV Helper Functions
[0078] Host cells containing the above-described AAV expression
vectors must be rendered capable of providing AAV helper functions
in order to replicate and encapsidate the nucleotide sequences
flanked by the AAV ITRs to produce rAAV virions. AAV helper
functions are generally AAV-derived coding sequences which can be
expressed to provide AAV gene products that, in turn, function in
trans for productive AAV replication. AAV helper functions are used
herein to complement necessary AAV functions that are missing from
the AAV expression vectors. Thus, AAV helper functions include one,
or both of the major AAV ORFs, namely the rep and cap coding
regions, or functional homologues thereof.
[0079] By "AAV rep coding region" is meant the art-recognized
region of the AAV genome which encodes the replication proteins Rep
78, Rep 68, Rep 52 and Rep 40. These Rep expression products have
been shown to possess many functions, including recognition,
binding and nicking of the AAV origin of DNA replication, DNA
helicase activity and modulation of transcription from AAV (or
other heterologous) promoters. The Rep expression products are
collectively required for replicating the AAV genome. For a
description of the AAV rep coding region, see, e.g., Muzyczka, N.
(1992) Current Topics in Microbiol. and Immunol. 158:97-129; and
Kotin, R. M. (1994) Human Gene Therapy 5:793-801. Suitable
homologues of the AAV rep coding region include the human
herpesvirus 6 (HHV-6) rep gene which is also known to mediate AAV-2
DNA replication (Thomson et al. (1994) Virology 204:304-311).
[0080] By "AAV cap coding region" is meant the art-recognized
region of the AAV genome which encodes the capsid proteins VP1,
VP2, and VP3, or functional homologues thereof. These Cap
expression products supply the packaging functions which are
collectively required for packaging the viral genome. For a
description of the AAV cap coding region, see, e.g., Muzyczka, N.
and Kotin, R. M. (supra).
[0081] AAV helper functions are introduced into the host cell by
transfecting the host cell with an AAV helper construct either
prior to, or concurrently with, the transfection of the AAV
expression vector. AAV helper constructs are thus used to provide
at least transient expression of AAV rep and/or cap genes to
complement missing AAV functions that are necessary for productive
AAV infection. AAV helper constructs lack AAV ITRs and can neither
replicate nor package themselves. These constructs can be in the
form of a plasmid, phage, transposon, cosmid, virus, or virion. A
number of AAV helper constructs have been described, such as the
commonly used plasmids pAAV/Ad and pIM29+45 which encode both Rep
and Cap expression products. See, e.g., Samulski et al. (1989) J.
Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol.
65:2936-2945. A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No.
5,139,941.
[0082] Both AAV expression vectors and AAV helper constructs can be
constructed to contain one or more optional selectable markers.
Suitable markers include genes which confer antibiotic resistance
or sensitivity to, impart color to, or change the antigenic
characteristics of those cells which have been transfected with a
nucleic acid construct containing the selectable marker when the
cells are grown in an appropriate selective medium. Several
selectable marker genes that are useful in the practice of the
invention include the hygromycin B resistance gene (encoding
Aminoglycoside phosphotranferase (APH)) that allows selection in
mammalian cells by conferring resistance to G418 (available from
Sigma, St. Louis, Mo.). Other suitable markers are known to those
of skill in the art.
3. AAV Accessory Functions
[0083] The host cell (or packaging cell) must also be rendered
capable of providing non AAV derived functions, or "accessory
functions," in order to produce rAAV virions. Accessory functions
are non AAV derived viral and/or cellular functions upon which AAV
is dependent for its replication. Thus, accessory functions include
at least those non AAV proteins and RNAs that are required in AAV
replication, including those involved in activation of AAV gene
transcription, stage specific AAV mRNA splicing, AAV DNA
replication, synthesis of Cap expression products and AAV capsid
assembly. Viral-based accessory functions can be derived from any
of the known helper viruses.
[0084] Particularly, accessory functions can be introduced into and
then expressed in host cells using methods known to those of skill
in the art. Commonly, accessory functions are provided by infection
of the host cells with an unrelated helper virus. A number of
suitable helper viruses are known, including adenoviruses;
herpesviruses such as herpes simplex virus types 1 and 2; and
vaccinia viruses. Nonviral accessory functions will also find use
herein, such as those provided by cell synchronization using any of
various known agents. See, e.g., Buller et al. (1981) J. Virol.
40:241-247; McPherson et al. (1985) Virology 147:217-222;
Schlehofer et al. (1986) Virology 152:110-117.
[0085] Alternatively, accessory functions can be provided using an
accessory function vector. Accessory function vectors include
nucleotide sequences that provide one or more accessory functions.
An accessory function vector is capable of being introduced into a
suitable host cell in order to support efficient AAV virion
production in the host cell. Accessory function vectors can be in
the form of a plasmid, phage, transposon or cosmid. Accessory
vectors can also be in the form of one or more linearized DNA or
RNA fragments which, when associated with the appropriate control
elements and enzymes, can be transcribed or expressed in a host
cell to provide accessory functions.
[0086] Nucleic acid sequences providing the accessory functions can
be obtained from natural sources, such as from the genome of an
adenovirus particle, or constructed using recombinant or synthetic
methods known in the art. In this regard, adenovirus-derived
accessory functions have been widely studied, and a number of
adenovirus genes involved in accessory functions have been
identified and partially characterized. See, e.g., Carter, B. J.
(1990) "Adeno-Associated Virus Helper Functions," in CRC Handbook
of Parvoviruses, vol. I (P. Tijssen, ed.), and Muzyczka, N. (1992)
Curr. Topics. Microbiol. and Immun. 158:97-129. Specifically, early
adenoviral gene regions E1a, E2a, E4, VAI RNA and, possibly, E1b
are thought to participate in the accessory process. Janik et al.
(1981) Proc. Natl. Acad. Sci. USA 78:1925-1929. Herpesvirus-derived
accessory functions have been described. See, e.g., Young et al.
(1979) Prog. Med. Virol. 25:113. Vaccinia virus-derived accessory
functions have also been described. See, e.g., Carter, B. J.
(1990), supra., Schlehofer et al. (1986) Virology 152:110-117.
[0087] As a consequence of the infection of the host cell with a
helper virus, or transfection of the host cell with an accessory
function vector, accessory functions are expressed which
transactivate the AAV helper construct to produce AAV Rep and/or
Cap proteins. The Rep expression products excise the recombinant
DNA (including the DNA of interest) from the AAV expression vector.
The Rep proteins also serve to duplicate the AAV genome. The
expressed Cap proteins assemble into capsids, and the recombinant
AAV genome is packaged into the capsids. Thus, productive AAV
replication ensues, and the DNA is packaged into rAAV virions.
[0088] Following recombinant AAV replication, rAAV virions can be
purified from the host cell using a variety of conventional
purification methods, such as CsCl gradients. Further, if infection
is employed to express the accessory functions, residual helper
virus can be inactivated, using known methods. For example,
adenovirus can be inactivated by heating to temperatures of
approximately 60.degree. C. for, e.g., 20 minutes or more. This
treatment effectively inactivates only the helper virus since AAV
is extremely heat stable while the helper adenovirus is heat
labile.
[0089] The resulting rAAV virions are then ready for use for DNA
delivery, such as in gene therapy applications, for the production
of transgenic animals, in vaccination, and particularly for the
delivery of genes to a variety of muscle cell types.
4. In vitro and In vivo Delivery of rAAV Virions
[0090] Generally, rAAV virions are introduced into a muscle cell
using either in vivo or in vitro transduction techniques. If
transduced in vitro, the desired recipient muscle cell will be
removed from the subject, transduced with rAAV virions and
reintroduced into the subject. Alternatively, syngeneic or
xenogeneic muscle cells can be used where those cells will not
generate an inappropriate immune response in the subject.
[0091] Suitable methods for the delivery and introduction of
transduced cells into a subject have been described. For example,
cells can be transduced in vitro by combining recombinant AAV
virions with muscle cells e.g., in appropriate media, and screening
for those cells harboring the DNA of interest using conventional
techniques such as Southern blots and/or PCR, or by using
selectable markers. Transduced cells can then be formulated into
pharmaceutical compositions, described more fully below, and the
composition introduced into the subject by various techniques, such
as by intramuscular, intravenous, subcutaneous and intraperitoneal
injection, or by injection into smooth and cardiac muscle, using
e.g., a catheter.
[0092] For in vivo delivery, the rAAV virions will be formulated
into pharmaceutical compositions and will generally be administered
parenterally, e.g., by intramuscular injection directly into
skeletal or cardiac muscle.
[0093] Pharmaceutical compositions will comprise sufficient genetic
material to produce a therapeutically effective amount of the
protein of interest, i.e., an amount sufficient to reduce or
ameliorate symptoms of the disease state in question or an amount
sufficient to confer the desired benefit. The pharmaceutical
compositions will also contain a pharmaceutically acceptable
excipient. Such excipients include any pharmaceutical agent that
does not itself induce the production of antibodies harmful to the
individual receiving the composition, and which may be administered
without undue toxicity. Pharmaceutically acceptable excipients
include, but are not limited to, liquids such as water, saline,
glycerol and ethanol. Pharmaceutically acceptable salts can be
included therein, for example, mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. Additionally, auxiliary
substances, such as wetting or emulsifying agents, pH buffering
substances, and the like, may be present in such vehicles. A
thorough discussion of pharmaceutically acceptable excipients is
available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co.,
N.J. 1991).
[0094] Appropriate doses will depend on the mammal being treated
(e.g., human or nonhuman primate or other mammal), age and general
condition of the subject to be treated, the severity of the
condition being treated, the particular therapeutic protein in
question, its mode of administration, among other factors. An
appropriate effective amount can be readily determined by one of
skill in the art.
[0095] Thus, a "therapeutically effective amount" will fall in a
relatively broad range that can be determined through clinical
trials. For example, for in vivo injection, i.e., injection
directly to skeletal or cardiac muscle, a therapeutically effective
dose will be on the order of from about 10.sup.6 to 10.sup.15 of
the rAAV virions, more preferably 10.sup.8 to 10.sup.12 rAAV
virions. For in vitro transduction, an effective amount of rAAV
virions to be delivered to muscle cells will be on the order of
10.sup.8 to 10.sup.13 of the rAAV virions. The amount of transduced
cells in the pharmaceutical compositions will be from about
10.sup.4 to 10.sup.10 muscle cells, more preferably 10.sup.5 to
10.sup.8 muscle cells. When the transduced cells are introduced to
vascular smooth muscle, a lower dose may be appropriate. Other
effective dosages can be readily established by one of ordinary
skill in the art through routine trials establishing dose response
curves.
[0096] Dosage treatment may be a single dose schedule or a multiple
dose schedule. Moreover, the subject may be administered as many
doses as appropriate. One of skill in the art can readily determine
an appropriate number of doses.
C. Experimental
[0097] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0098] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
Materials and Methods
Vector Constructs
[0099] A. Construction of p1909adhlacZ.
[0100] Plasmid p1909adhlacZ was used as the helper construct in the
following examples and was constructed from plasmid pWadhlacZ.
Plasmid pWadhlacZ was constructed by partially digesting plasmid
pUC119 (GeneBank Reference Name: U07649, GeneBank Accession Number:
U07649) with AflIII and BspHI, blunt-end modifying with the klenow
enzyme, and then ligating to form a circular 1732 bp plasmid
containing the bacterial origin and the amp gene only (the
polylinker and F1 origin was removed). The blunted and ligated
AflIII and BspHI junction forms a unique NspI site. The 1732 bp
plasmid was cut with NspI, blunt-end modified with T4 polymerase,
and a 20 bp HinDIII-HinCII fragment (blunt-end modified with the
klenow enzyme) obtained from the pUC119 polylinker was ligated into
the blunted NspI site of the plasmid. The HinDIII site from the
blunted polylinker was regenerated, and then positioned adjacent to
the bacterial origin of replication. The resulting plasmid was then
cut at the unique PstI/Sse8387I site, and an
Sse8387I-PvuII-Sse8387I oligonucleotide (5'-GGCAGCTGCCTGCA-3') was
ligated in. The remaining unique BspHI site was cut, blunt-end
modified with klenow enzyme, and an oligonucleotide containing an
AscI linker (5'-GAAGGCGCGCCTTC-3') was ligated therein, eliminating
the BspHI site. The resulting plasmid was called pWee.
[0101] In order to create the pWadhlacZ construct, a CMVlacZ
expression cassette (comprising a nucleotide sequence flanked 5'
and 3' by AAV ITRs, containing the following elements: a CMV
promoter, the hGH 1st intron, an adhlacz fragment and an SV40 early
polyadenylation site) was inserted into the unique PvuII site of
pWee using multiple steps such that the CMV promoter was arranged
proximal to the bacterial amp gene of pWee.
[0102] More particularly, a CMVlacZ expression cassette was derived
from the plasmid psub201CMV, which was constructed as follows. An
oligonucleotide encoding the restriction enzyme sites:
NotI-MluI-SnaBI-AgeI-BstBI-BssHII-NcoI-HpaI-BspEI-PmlI-RsrII-NotI
[0103] and having the following nucleotide sequence: 540
-CGGCCGCACGCGTACGTACCGGTTCGAAGCGCGCACGGCCGACCATGGTAAC
TCCGGACACGTGCGGACCGCGGCCGC-3' (SEQ ID No.:______) was synthesized
and cloned into the blunt-end modified KasI-EarI site (partial) of
pUC119 to provide a 2757 bp vector fragment. A 653 bp SpeI-SacII
fragment containing a nucleotide sequence encoding a CMV immediate
early promoter was cloned into the SnaBI site of the 2757 bp vector
fragment. Further, a 269 bp PCR-produced BstBI-BstBI fragment
containing a nucleotide sequence encoding the hGH 1st intron which
was derived using the following primers:
5'AAAATTCGAACCTGGGGAGAAACCAGAG-3' (SEQ ID NO.:______) and
[0104] 3'aaaattcgaacaggtaagcgcccctTTG-5' (SEQ ID NO.:______), was
cloned into the BstBI site of the 2757 bp vector fragment, and a
135 bp HpaI-BamHI (blunt-end modified) fragment containing the SV40
early polyadenylation site from the pCMV-.beta. plasmid (CLONETECH)
was cloned into the HpaI site of the subject vector fragment. The
resulting construct was then cut with NotI to provide a first CMV
expression cassette.
[0105] Plasmid pW1909adhlacZ was constructed as follows. A 4723 bp
SpeI-EcoRV fragment containing the AAV rep and cap encoding region
was obtained from the plasmid pGN1909 (ATCC Accession Number
69871). The pGN1909 plasmid is a high efficiency AAV helper plasmid
having AAV rep and cap genes with an AAV p5 promoter region that is
arranged in the construct to be downstream from its normal position
(in the wild type AAV genome) relative to the rep coding region.
The 4723 bp fragment was blunt-end modified, and AscI linkers
(5'-GAAGGCGCGCCTTC-3') were ligated to the blunted ends. The
resultant fragment was then ligated into the unique AscI site of
pWadhlacZ and oriented such that the AAV coding sequences were
arranged proximal to the bacterial origin of replication in the
construct.
[0106] Plasmid pW1909adhlacZ includes the bacterial
beta-galactosidase (.beta.-gal) gene under the transcriptional
control of the cytomegalovirus immediate early promoter
(CMVIE).
B. Construction of pW1909EPO.
[0107] Plasmid pW1909adhlacZ was modified to express human
erythropoietin (EPO) by replacing the adhlacz gene with a 718 be
PpuMI-NcoI fragment of human EPO cDNA and by cloning a 2181 bp
ClaI-EcoRI lacZ spacer fragment (noncoding) into the PmlI site of
the vector.
Viruses and Cell Lines
[0108] Adenovirus type 2 (Ad2), available from the American Type
Culture Collection, ATCC, Catalogue Number VR846, was used as
helper virus to encapsidate vectors.
[0109] The human 293 cell line (Graham et al. (1977) J. Gen. Virol.
36:59-72, available from the ATCC under Accession no. CRL1573),
which has adenovirus E1a and E1b genes stably integrated in its
genome, was cultured in complete Dulbecco's modified Eagle's media
(DMEM; Bio-Whittaker, Walkersville, Md.) containing 4.5 g/l
glucose, 10% heat-inactivated fetal bovine serum (FBS; Hyclone,
Logan, Utah), 2 mM glutamine, and 50 units/ml penicillin and 50
.mu.g/ml streptomycin.
[0110] The C2C12 murine myoblast cell line, available from the
ATCC, Catalogue Number CRL1772, was cultured in complete DME.
[0111] The above cell lines were incubated at 37.degree. C. in 5%
CO2, and were routinely tested and found free of mycoplasma
contamination.
[0112] Cardiomyocytes were prepared by a modification of
established methods. In particular, primary rat myocardial cell
isolation was done by modifying established protocols by Nag and
Chen (1981) Tissue Cell 13:515-523 and Dlugaz et al. (1984) J. Cell
Biol. 99:2268-2278. Briefly hearts from newborn rat pups (one or
two litters) were dissected and washed in media. Digestion media
consisted of modified Jolicks MEM containing 10 mM HEPES, 10 mM
pyruvate, 5 mM L-glutamine, 1 mM Nicotinamide, 0.4 mM L-ascorbate,
1 mM adenosine, 1 mM d-ribose, 1 mM MgCl.sub.2, 1 mM taurine, 2 mM
DL-carnitine, and 2 mM KHCO.sub.3. The hearts were minced in
digestion media with 0.5 mg/ml collagenase (Worthington) and 100 mM
CaCd.sub.2. The tissue was treated with successive digestions of 15
minutes at 37.degree. C. The cells from the first digestion were
discarded and the next six digestions reactions were pooled. Cells
were preplated for 1 hour to remove fibroblasts, then plated in
PC-1 (Ventrex)/DME-Hams F12 media.
Production of Recombinant AAV Virions
[0113] Recombinant AAV virions were produced in human 293 cells as
follows. Subconfluent 293 cells were cotransfected by standard
calcium phosphate precipitation with either vector/helper plasmid
constructs pW1909adhLacZ or pW1909EPO. Cells were infected with Ad2
at a multiplicity of infection (MOI) of 2, and incubated at
37.degree. C. in 5% CO.sub.2 for 70 hours prior to harvest. Cells
were lysed in Tris buffer (100 mM Tris, 150 mM NaCl, pH 8.0),
freeze-thawed three times, then crude-cell lysate was layered onto
a cesium chloride cushion for isopyknic gradient centrifugation.
Recombinant AAV vectors were extracted from the resulting gradient
by isolating the bands with average density of approximately 1.38
g/ml, resuspending in Hepes buffered saline (HBS) containing 50 mM
Hepes, 150 mM NaCl, pH 7.4, and heat-inactivating the preparation
at 56.degree. C. for 1 hour.
Assay of rAAV by Dot-Blot Hybridization
[0114] Recombinant AAV virions were DNase I digested, proteinase K
treated, phenol-chloroform extracted, and DNA precipitated with
sodium acetate-glycogen (final concentrations=0.3 M sodium acetate
and 160 .mu.g/ml, respectively). DNA samples were denatured (200
.mu.l of 2.times. alkaline solution (0.8 M NaOH, 20 mM EDTA) added
to DNA sample) for 10 minutes, then added to appropriate wells in a
dot-blot apparatus, and blotted to wet Zeta Probe membrane
(BioRad), by applying suction until wells were empty. Then, 400
.mu.l of 1.times. alkaline solution was added; after 5 minutes,
wells were emptied by suction. The membrane was rinsed in 2.times.
SSC (Sambrook et al., supra) for 1 min, drained, air dried on
filter paper, then baked in vacuum at 80.degree. C. for 30 min. The
membrane was then prehybridized for 30 min at 65.degree. C. with 10
ml hybridization buffer (7% SDS, 0.25 M Sodium Phosphate, pH 7.2, 1
mM EDTA). Buffer was replaced with 10 ml fresh solution, freshly
boiled probe added, and hybridized overnight at 65.degree. C. The
membrane was washed twice with 25 ml of wash-1 buffer (5% SDS, 40
mM sodium phosphate, pH 7.2, 1 mM EDTA) for 20 min at 65.degree. C.
and twice with wash-2 buffer (1% SDS, 40 mM sodium phosphate, pH
7.2, 1 mM EDTA). The membrane was wrapped in plastic film, exposed
to radiographic film, and appropriate dots excised from the
membrane to determine radioactivity by scintillation counting, and
quantitated by comparison with standards. Titers of rAAV vector
were routinely in the range of approximately 10.sup.13 vector
genomes/ml.
Assay for Contaminating Helper Adenovirus
[0115] Contaminating infectious adenovirus was assayed as follows.
Samples from the purified rAAV virion stocks were added to 50%
confluent 293 cells (cultured in 12 well dishes at 1.times.10.sup.5
cells/well), and the cultures were passaged for 30 days (e.g., the
cultures were split 1 to 5, every 3 days) or until the culture
exhibited 100% cytopathic effect (CPE) due to adenovirus infection.
Cultures were examined daily for CPE, and the day upon which each
experimental culture showed 100% CPE was noted. Reference 293 cell
cultures infected with a range of known amounts of adenovirus
type-2 (from 0 to 1.times.10.sup.7 plaque forming units
(pfu)/culture) were also prepared and treated in the same manner. A
standard curve was then prepared from the data obtained from the
reference cultures, where the adenovirus pfu number was plotted
against the day of 100% CPE. The titer of infectious adenovirus
type-2 in each experimental culture was then readily obtained as
determined from the standard curve. The limit of detection of the
assay was 100 pfu/ml. The presence of wild-type AAV contamination,
analyzed by dot-blot hybridization, was approximately 7 logs lower
than vector concentration.
In Vitro Transduction
[0116] In vitro transduction was performed by adding purified
recombinant AAV virions to 293 or C2C12 cells in complete media,
incubating for a designated period of time, usually a minimum of 24
hours, prior to the determination of transduction efficiency, by
.beta.-gal, or human EPO (hEPO) assays. Histochemical detection of
the presence of .beta.-gal was done by a previously reported
technique (Sanes et al. (1986) EMBO J 5:3133-3142).
[0117] The hEPO assay was performed by an enzyme-linked
immunosorbance assay (ELISA) using the human erythropoietin
Quantikine IVD kit from R and D Systems (Minneapolis, Minn.)
according to manufacturer's recommendations.
[0118] C2C12 myoblasts were transduced either while actively
dividing, or as a differentiated cell culture. Differentiation was
induced by placing subconfluent myoblasts in DMEM containing 2%
horse serum and standard concentrations of glutamine and
penicillin-streptomycin for an interval of four days prior to
transduction. Verification of differentiation was by microscopic
analysis to determine the presence of multinucleated myotubes in
culture.
Methods of in vivo Transduction of Murine Skeletal Muscle
[0119] In vivo transduction was performed by intramuscular (IM)
injection of recombinant AAV virions into the skeletal muscle of
adult Balb/c mice (Jackson Laboratories, Bar Harbor, Me., Simonsen
Laboratories, Gilroy, Calif., or Harlan Laboratories) under either
Metofane (Pitman-Moore, Mundelein, Ill.) or ketamine-xylazine
anesthesia. For the rAAV-LacZ dose-response and time-course, the
head of the tibialis anterior muscle was isolated under anesthesia,
and injected 2 mm deep with a micro-capillary tube to administer
10-20 .mu.l of rAAV in saline. For the rAAV-EPO dose-response and
time-course, different doses of the vector diluted in HBS were
injected percutaneously into 3 sites in each hindlimb, 100 .mu.l
total vector per hindlimb, for a total of 200 .mu.l of vector
IM/animal. Animals were warmed prior to returning them to their
cages.
Analysis of In Vivo Transduction
[0120] For analysis of gene delivery with rAAV-LacZ, muscle was
harvested at various time points post-injection, cryofixed, and
stained for .beta.-gal or for Galacto-Light.TM. (Tropix, Bedford,
Mass.) according to manufacturer's recommendations. B-gal stained
tibialis anterior cross-sections were photomicrographed, and scored
as positive or negative to quantify the percentage of
cross-sectional muscle fiber transduced. For Galacto-Light.TM.
assay, the muscle was homogenized and mixed with substrate
containing buffer to produce a luminescent product, which was
quantified by luminometer.
[0121] For analysis of gene delivery with rAAV-hEPO in Balb/c mice,
vector was administered either IM as described above, or
intravenously (IV) in PBS in a total volume of 50 .mu.l via the
lateral tail vein. At various time points after administration,
blood was obtained from the orbital venous plexus under anesthesia.
Red cell counts were done with hemocytometer, hematocrit was
determined by centrifugation of blood in micro-capillary tubes, and
hemoglobin concentration was analyzed by cyanmethemoglobin assay
(DMA, Arlington, Tex.) according to manufacturer's specifications
and compared with a standard (Stanbio Laboratory, San Antonio,
Tex.) analyzed at 570 nm on a spectrophotometer. Reticulocytes were
analyzed by either new methylene blue stain, or by FACS analysis of
thiazole orange stained peripheral blood samples (Retic-count,
Becton-Dickinson, Mountain View, Calif.); the results of data
obtained by either of these methods were similar. Peripheral
leukocyte count and differential were performed by modified
Wright-Giemsa stain (Sigma Diagnostics, St. Louis, Mo.) according
to the manufacturer's recommendations.
Intramyocardial Injections
[0122] For the cardiac muscle studies, animals were anesthetized
with Metofane followed by a subxyphoid incision to expose the
diaphragmatic surface of the heart. Apical cardiac injections were
performed with a glass micropipette. Recombinant virion was diluted
in normal saline and injected in volume of 20-50 .mu.l.
Histochemical Analysis of Cardiac Muscle
[0123] For 5-Bromo-4-chloro-3-indolyl B-D-galactoside histochemical
determination, frozen sections (6 .mu.m) were fixed in 0.5%
glutaraldehyde and stained for .beta.-gal activity as described
(Sanes et al. (1986) "Use of Recombinant Retrovirus to Study
Post-Implanatation Cell Lineage in Mouse Embryos," EMBO J
5:3133-3142).
Histopathology
[0124] Paraffin sections (5 .mu.m) were stained with
hematoxylin/eosin. Sections were examined for infiltrating
mononuclear cells.
EXAMPLE 1
Dose-Response of rAAV-LacZ Vector in Balb/c Mice
[0125] To determine the effective dose range for the rAAV-LacZ
vector in vivo, vector was injected into the tibialis anterior
muscle of 6-8 week old healthy Balb/c mice, and transduction
assessed by .beta.-gal activity measured by Galacto-Light.TM.
relative light units (RLU). Two weeks post-injection, the range of
RLU is from approximately 0.2.times.10.sup.7 RLU/muscle with
8.times.10.sup.8 vector genomes to approximately 1.1.times.10.sup.9
RLU/muscle with 3.6.times.10.sup.11 injected vector genomes (FIG.
1). The levels of expression of .beta.-gal measured by RLU
correspond to the percentage of .beta.-gal positive muscle fibers
on cross-sectional analysis. For example, 0.2.times.10.sup.7 RLU
corresponds to approximately 1% .beta.-gal positive muscle fibers;
1.1.times.10.sup.9 RLU corresponds to approximately 60% .beta.-gal
positive muscle fibers. Expression of a gene delivered by a rAAV
vector was approximately 10,000-fold greater than the same gene
delivered by plasmid DNA. A comparison was made at two weeks
post-injection of rAAV-LacZ vector, 8.times.10.sup.8
single-stranded genomes, with plasmid (containing the same gene
sequence as the vector), 2.4.times.10.sup.13 double-stranded
plasmid genomes in 100 .mu.g DNA, a high dose of plasmid DNA IM.
Results revealed comparable expression between vector and plasmid,
however vector input DNA was approximately 4 logs less. These
results demonstrate the dose-dependent expression of .beta.-gal by
rAAV-LacZ and the greatly increased expression of rAAV vector
versus plasmid.
EXAMPLE 2
Time Course of rAAV-LacZ Vector Expression In Vivo
[0126] Animals were followed after injection to determine the
persistence of vector expression. For these experiments, animals
were injected in the tibialis anterior muscle with 8.times.10.sup.9
vector genome equivalents of rAAV-LacZ in 20 .mu.l volume. Muscle
was harvested at selected time points from 2 to 12 weeks and
analyzed for total .beta.-gal expression by Galacto-Light.TM.
luminescence. As can be seen, the level of .beta.-gal production
increased over the time interval from 2 to 12 weeks post-injection
(FIG. 2). These results demonstrate that rAAV-LacZ expression in
muscle persisted for an interval of at least 12 weeks in vivo.
EXAMPLE 3
Comparison of Secretion of Erythropoietin from Myotubes or
Myoblasts
[0127] Myotubes (differentiated C2C12 cells) or myoblasts (dividing
C2C12 cells) were transduced in culture with the rAAV-hEPO vector
to determine the feasibility of in vivo polypeptide secretion.
Erythropoietin (EPO) was chosen because it has been shown to be
secreted by muscle (Descamps et al. (1995) Gene Therapy 2:411-417;
Hamamori et al. (1994) Hum. Gene Therapy 5:1349-1356; Hamamori et
al. (1995) J. Clin. Invest. 95:1808-1813) and it has well defined
biological effects. A comparison of the secretion of EPO from
myotubes or myoblasts revealed that secretion of the hormone was
observed in both populations. Additionally, the levels of 24 hour
EPO secretion increased in the myotubes over the first seven days
post-transduction (FIG. 3). These data demonstrate that gene
transfer of rAAV-hEPO into either myotubes or myoblasts results in
protein secretion.
EXAMPLE 4
Systemic Delivery of Human Erythropoietin In Vivo by Intramuscular
Administration of rAAV-hEPO
[0128] Recombinant AAV virions encoding hEPO were administered to
adult healthy Balb/c mice in vivo to determine if hEPO was produced
and was biologically active. An initial experiment revealed that
high levels of hEPO and elevated hematocrits were maintained for
>100 days in mice injected IM with 6.5.times.10.sup.11 vector
genomes (FIG. 4). A range of doses of rAAV-hEPO was then injected
into the hindlimbs of mice, and the resulting serum hEPO levels
were analyzed. A well-defined dose-response at both 20 and 41 days
post-injection is revealed in FIG. 5, with the levels of hEPO
dependent upon input vector dose. Expression of a gene delivered by
rAAV-hEPO vector was approximately 6000-fold greater than the same
gene delivered by plasmid DNA (FIG. 6). A comparison of the
expression of IM rAAV-hEPO (3.times.10.sup.11 single-stranded
vector genomes) with IM pAAV-hEPO (1.4.times.10.sup.13
double-stranded genomes in 100 .mu.g DNA) was performed. At 20 days
post-injection, vector-injected animals had serum levels of
445.1.+-.98.1 mU/ml while the plasmid-injected animals had levels
of 7.7.+-.10 mU/ml. At 41 days post-injection, the vector levels
were 724.6.+-.112 mU/ml, while the plasmid levels were below the
levels of detection. The animals receiving rAAV-hEPO exhibited
approximately 60-fold more circulating hEPO with 100-fold less
input genomes at 20 days post-injection, or approximately 6000-fold
greater secretion per genome. At 41 days post-injection, this
difference was even greater, since the plasmic expression was below
the level of detection.
EXAMPLE 5
A Comparison of hEPO Secretion from rAAV-hEPO
Administered by IM or IV Routes
[0129] A comparison of the circulating levels of hEPO resulting
from IM and IV routes of administration was analyzed to determine
which method of gene delivery results in higher levels of systemic
hEPO. At 20 days post-injection, the IM route resulted in levels of
hEPO of 445.1.+-.98.1 mU/ml while the IV route produced 6.5.+-.3.0
mU/ml (FIG. 7). At 41 days post-injection, the EPO level for the IM
route was 724.6.+-.112 compared with 13.0.+-.2.0 mU/ml, or
approximately 60-fold more efficacious. These data demonstrate that
the IM route of injection resulted in higher systemic levels of
hEPO.
EXAMPLE 6
Expression of rAAV-LacZ in Terminally
Differentiated Adult Rat Cardiomyocytes
[0130] The ability of recombinant AAV vectors to transduce
terminally differentiated adult cardiomyocytes was established in
vivo. Cardiomyocytes were harvested by coronary perfusion with
collagenase of adult rat hearts (Fischer 344, Harlan Sprague
Dawley, Indianapolis, Ind.). Cardiomyocytes were grown on
laminin-coated glass coverslips and exposed to the rAAV-LacZ vector
for 4 hours. After 72 hours, the cells were stained for .beta.-gal
activity. AAV expression was detected by blue staining of the
binucleated cells. These studies demonstrate the ability of
recombinant AAV virions to transduce terminally differentiated
cells. The transduction efficiency in vitro was 30% of adult cells
at a multiplicity of infection of 10.sup.4 vector genomes per
cell.
EXAMPLE 7
Stability of LacZ Expression In Vivo
[0131] Adult Fischer rats were used to analyze expression of
transgenes in vivo. Incremental doses of rAAV-LacZ were injected
into the left ventricular apex of the rat heart accessed using
either the subxyphoid or lateral thoracotomy approaches. At varying
times post-injection, the hearts were harvested and examined for
.beta.-gal production. Greater than 50% transduction of
cardiomyocytes was observed in the region of injection at each time
point examined. There was no inflammatory cell infiltrate noted
during the course of analysis. B-gal staining was observed to
persist in cardiac muscle for at least two months following gene
transfer.
[0132] Accordingly, novel methods for transferring genes to muscle
cells have been described. Although preferred embodiments of the
subject invention have been described in some detail, it is
understood that obvious variations can be made without departing
from the spirit and the scope of the invention as defined by the
appended claims.
Deposits of Strains Useful in Practicing the Invention
[0133] A deposit of biologically pure cultures of the following
strain was made with the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md., under the provisions of the
Budapest Treaty. The accession number indicated was assigned after
successful viability testing, and the requisite fees were paid.
Access to said cultures will be available during pendency of the
patent application to one determined by the Commissioner to be
entitled thereto under 37 CFR 1.14 and 35 USC 122. All restriction
on availability of said cultures to the public will be irrevocably
removed upon the granting of a patent based upon the application.
Moreover, the designated deposits will be maintained for a period
of thirty (30) years from the date of deposit, or for five (5)
years after the last request for the deposit; or for the
enforceable life of the U.S. patent, whichever is longer. Should a
culture become nonviable or be inadvertently destroyed, or, in the
case of plasmid-containing strains, lose its plasmid, it will be
replaced with a viable culture(s) of the same taxonomic
description.
[0134] This deposit is provided merely as a convenience to those of
skill in the art, and is not an admission that a deposit is
required. A license may be required to make, use, or sell the
deposited materials, and no such license is hereby granted.
TABLE-US-00001 Strain Deposit Date ATCC No. pGN1909 Jul. 20, 1995
69871
Sequence CWU 1
1
* * * * *