U.S. patent application number 11/592716 was filed with the patent office on 2008-08-07 for determination of genotype of an amplification product at multiple allelic sites.
This patent application is currently assigned to Applera Corporation. Invention is credited to Federico Goodsaid, Kenneth J. Livak.
Application Number | 20080187913 11/592716 |
Document ID | / |
Family ID | 21788757 |
Filed Date | 2008-08-07 |
United States Patent
Application |
20080187913 |
Kind Code |
A1 |
Livak; Kenneth J. ; et
al. |
August 7, 2008 |
Determination of genotype of an amplification product at multiple
allelic sites
Abstract
A method is provided for genotyping a target sequence at least
two allelic sites by a 5' nuclease amplification reaction. In one
embodiment, the method includes performing a nucleic acid
amplification on a target sequence having at least two different
allelic sites using a nucleic acid polymerase having 5'-3' nuclease
activity and a primer capable of hybridizing to the target sequence
in the presence of two or more sets of allelic oligonucleotide
probes wherein: each set of allelic oligonucleotide probes is for
detecting a different allelic site of the target sequence, each set
of allelic oligonucleotide probes includes two or more probes which
are complementary to different allelic variants at the allelic site
being detected by the set of probes, the allelic site being 5'
relative to a sequence to which the primer hybridizes to the target
sequence, and at least all but one of the allelic oligonucleotide
probes include a different fluorescer than the other probes and a
quencher positioned on the probe to quench the fluorescence of the
fluorescer; detecting a fluorescence spectrum of the amplification;
calculating a fluorescence contribution of each fluorescer to the
fluorescence spectrum; and determining a presence or absence of the
different allelic variants at the two or more different allelic
sites based on the fluorescence contribution of each fluorescer to
the combined fluorescence spectrum.
Inventors: |
Livak; Kenneth J.; (San
Jose, CA) ; Goodsaid; Federico; (San Jose,
CA) |
Correspondence
Address: |
KALOW & SPRINGUT LLP
488 MADISON AVENUE, 19TH FLOOR
NEW YORK
NY
10022
US
|
Assignee: |
Applera Corporation
Foster City
CA
|
Family ID: |
21788757 |
Appl. No.: |
11/592716 |
Filed: |
November 3, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10455150 |
Jun 4, 2003 |
7132239 |
|
|
11592716 |
|
|
|
|
09326828 |
Jun 3, 1999 |
|
|
|
10455150 |
|
|
|
|
09018595 |
Feb 4, 1998 |
|
|
|
09326828 |
|
|
|
|
Current U.S.
Class: |
435/6.16 |
Current CPC
Class: |
C12Q 1/6818 20130101;
C12Q 1/6858 20130101; C12Q 1/6818 20130101; C12Q 1/6858 20130101;
C12Q 2531/119 20130101; C12Q 2537/143 20130101; C12Q 2563/107
20130101; C12Q 2537/143 20130101; C12Q 2561/101 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1-107. (canceled)
108. A method for determining which allelic sites are present in a
sample of DNA, the method comprising: amplifying the sample of DNA
in the presence of: i) a polymerase having 5' nuclease activity;
ii) a forward primer and a reverse primer that hybridize to the
sample of DNA, and iii) four oligonucleotide probes that differ
from each other by at least one nucleotide base, such that the
first and second oligonucleotide probes compete to hybridize to a
first allelic site and the third and fourth oligonucleotide probes
compete to hybridize to a second allelic site; wherein all of the
oligonucleotide probes comprise a different fluorescer, and a
quencher that quenches the fluorescence of the fluorescer; and
determining the presence or absence of the first and second allelic
sites by detecting a fluorescence spectrum of the amplification
reaction resulting from 5' nuclease digestion of the
oligonucleotide probes that hybridized to the sample DNA.
109. The method according to claim 108, wherein the amplification
reaction is performed in the presence of a passive internal
standard.
110. The method according to claim 109, wherein the passive
internal standard is ROX.
111. The method according to claim 108, wherein all the
oligonucleotide probes include the same quencher.
112. The method according to claim 108, wherein the amplification
reaction is performed in a reaction mixture which includes about
7-9% glycerol, 0.04-0.06% gelatin, 0.005-0.015% TWEEN 20, 25-75 mM
tris buffer, pH 8.0, 4-6 mM MgCl.sub.2, 175-225 uM dATP, 175-225 uM
dCTP, 175-225 uM deaza dGTP, 350-450 uM dUTP, 0.045-0.055 U/uL of
Taq DNA polymerase, 0.5-0.015 U/uL AmpErase UNG, and 57-63 nM of a
Passive Reference.
113. The method according to claim 108, wherein the one or more
sets of forward and reverse primers define amplicons between about
50 and 150 bases in length.
114. The method according to claim 108, wherein the % GC of all the
probes are at least about 20% and less than about 80%.
115. The method according to claim 108, wherein none of the probes
have four or more contiguous guanines.
116. The method according to claim 108, wherein all of the probes
have a melting point temperature that is about 3-5.degree. C.
greater than an annealing temperature used in the amplification and
the primers have a melting point temperature of about 2-4.degree.
C. less than the annealing temperature.
117. The method according to claim 116, wherein the annealing
temperature is about 60-64.degree. C.
118. The method according to claim 116, wherein all of the probes
have a melting point temperature of about 65-67.degree. C.
119. The method according to claim 116, wherein all of the primers
have a melting point temperature of about 58-60.degree. C.
120. The method according to claim 108, wherein all of the probes
have a melting point temperature about 5-10.degree. C. greater than
the melting point temperature of all of the primers.
121. The method according to claim 108, wherein at least one of the
probes hybridizes to itself to form a hairpin.
122. The method according to claim 108, wherein the fluorescer on
at least one of the probes emits a stronger fluorescence signal
when hybridized to a sequence than when not hybridized to a
sequence and in a non-hairpin, single stranded form.
123. The method according to claim 108, wherein at least one of the
fluorescers is an energy transfer dye.
124. A kit for identifying in a single 5' nuclease assay which
alleles at multiple different allelic sites are present in a sample
of DNA, the kit comprising: a first set of oligonucleotide probes
comprising first and second oligonucleotide probes for detecting
which alleles are present at a first allelic site by single 5'
nuclease assay, the first and second oligonucleotide probes being
designed to distinguish between at least two alleles at the first
allelic site, which differ from each other by at least one base
position, wherein the first set of oligonucleotide probes is
digestible by a 5' to 3' nuclease, and does not self-hybridize; a
second set of oligonucleotide probes comprising third and fourth
oligonucleotide probes for detecting which alleles are present at a
second, different allelic site by the single 5' nuclease assay, the
third and fourth oligonucleotide probes being designed to
distinguish between at least two alleles at the second allelic
site, which differ from each other by at least one base position,
wherein the second set of oligonucleotide probes is digestible by a
5' to 3' nuclease, and does not self-hybridize; and a first primer
that is capable of hybridizing to a sequence in the first allelic
site 3' relative to where the probes of the first set hybridize to
the first allelic site and a second primer that is capable of
hybridizing to a sequence in the second allelic site 3' relative to
where the probes of the second set hybridize to the second allelic
site; wherein all of the oligonucleotide probes comprise a
different fluorescer and all of the oligonucleotide probes comprise
a quencher that quenches the fluorescence of the fluorescer such
that the first and second sets of oligonucleotide probes can be
used to determine which alleles are present at the first and second
allelic sites in the single 5' nuclease assay.
125. A kit according to claim 124, wherein all of the probes
comprise a same quencher, and each quencher and each fluorescer are
at opposite ends of each probe.
126. A kit according to claim 124, wherein all of the probes have a
melting point temperature that is about 3-5.degree. C. greater than
an annealing temperature used in the amplification, and the
primers' melting point temperatures are about 2-4.degree. C. less
than the annealing temperature.
127. A kit according to claim 124, wherein all of the primers have
a melting point temperature of about 58-60.degree. C.
128. A kit according to claim 124, wherein all of the probes have a
melting point temperature about 7.degree. C. greater than the
melting point temperature of all of the primers.
129. A kit according to claim 124, wherein the % GC of all the
probes are at least about 20% and less than about 80%.
130. A kit according to claim 124, wherein none of the probes have
four or more contiguous guanines.
131. A kit according to claim 124, wherein all of the probes have a
melting point temperature about 65-67.degree. C.
132. A kit according to claim 125, wherein the different
fluorescers on the oligonucleotide probes are capable of being
excited at the same wavelength.
133. A kit according to claim 125, wherein the oligonucleotide
probes are in a non-hairpin, single stranded form when not
hybridized to a sequence.
134. A kit for identifying in a single 5' nuclease assay which
alleles are present in a sample of DNA, the kit comprising: first
and second oligonucleotide probes for detecting which alleles are
present at a first allelic site, wherein the first and second
oligonucleotide probes: i) are digestible by a 5' to 3' nuclease;
ii) do not self hybridize; and iii) differ from each other by at
least one nucleotide base; third and fourth oligonucleotide probes
for detecting which alleles are present at a second allelic site,
wherein the third and fourth oligonucleotide probes: i) are
digestible by a 5' to 3' nuclease; ii) do not self hybridize; and
iii) differ from each other by at least one nucleotide base; a
first primer that is capable of hybridizing to a sequence of the
first allelic site 3' relative to where the first or second probes
hybridize to the first allelic site; and a second primer that is
capable of hybridizing to a sequence of the second allelic site 3'
relative to where the third or fourth probes hybridize to the
second allelic site; wherein all of the oligonucleotide probes
comprise a different fluorescer and all of the oligonucleotide
probes comprise a quencher that quenches the fluorescence of the
fluorescer such that the probes can be used to determine which
alleles are present at the first and second allelic sites in the
single 5' nuclease assay.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The invention relates generally to an assay for detecting an
amplification product and more specifically to an assay for
detecting the genotype of the amplification product at two or more
different allelic sites.
[0003] 2. Description of Related Art
[0004] Nucleic acid sequence analysis is becoming increasingly
important in many research, medical, and industrial fields, e.g.
Caskey, Science 236: 1223-1228 (1987); Landegren et al, Science,
242: 229-237 (1988); and Arnheim et al. Ann. Rev. Biochem., 61:
131-156 (1992). The development of several nucleic acid
amplification schemes has played a critical role in this trend,
e.g. polymerase chain reaction (PCR), Innis et al, editors, PCR
Protocols (Academic Press, New York, 1990); McPherson et al,
editors, PCR: A Practical Approach (IRL Press, Oxford, 1991);
ligation-based amplification techniques, Barany, PCR Methods and
Applications 1: 5-16 (1991); and the like.
[0005] PCR in particular has become a research tool of major
importance with applications in cloning, analysis of genetic
expression, DNA sequencing, genetic mapping, drug discovery, and
the like, e.g. Arnheim et al (cited above); Gilliland et al, Proc.
Natl. Acad. Sci., 87: 2725-2729 (1990); Bevan et al, PCR Methods
and Applications, 1: 222-228 (1992); Green et al, PCR Methods and
Applications, 1: 77-90 (1991); Blackwell et al, Science, 250:
1104-1110 (1990).
[0006] A wide variety of instrumentation has been developed for
carrying out nucleic acid amplifications, particularly PCR, e.g.
Johnson et al, U.S. Pat. No. 5,038,852 (computer controlled thermal
cycler); Wittwer et al, Nucleic Acids Research, 17: 4353-4357
(1989) (capillary tube PCR); Hallsby, U.S. Pat. No. 5,187,084
(air-based temperature control); Garner et al, Biotechniques, 14:
112-115 (1993) (high-throughput PCR in 864-well plates); Wilding et
al, International application No. PCT/US93/04039 (PCR in
micro-machined structures); Schnipelsky et al, European Patent
Application No. 90301061.9 (Publ. No. 0381501 A2) (disposable,
single use PCR device), and the like. Important design goals
fundamental to PCR instrument development have included fine
temperature control, minimization of sample-to-sample variability
in multi-sample thermal cycling, automation of pre- and post-PCR
processing steps, high speed cycling, minimization of sample
volumes, real time measurement of amplification products,
minimization of cross-contamination, or sample carryover, and the
like.
[0007] In particular, the design of instruments that permit PCR to
be carried out in closed reaction chambers and monitored in real
time is highly desirable. Closed reaction chambers are desirable
for preventing cross-contamination, e.g. Higuchi et al,
Biotechnology, 10: 413-417 (1992) and 11: 1026-1030 (1993); and
Holland et al, PNAS (USA), 88: 7276-7280 (1991). Clearly, the
successful realization of such a design goal would be especially
desirable in the analysis of diagnostic samples, where a high
frequency of false positives and false negatives would severely
reduce the value of the PCR-based procedure.
[0008] Real time monitoring of a PCR permits far more accurate
quantitation of starting target DNA concentrations in
multiple-target amplifications, as the relative values of
close-concentrations can be resolved by taking into account the
history of the relative concentration values during the PCR. Real
time monitoring also permits the efficiency of the PCR to be
evaluated, which can indicate whether PCR inhibitors are present in
a sample.
[0009] Holland, et al. and others have proposed fluorescence-based
approaches to provide measurements of amplification products during
a PCR. Holland et al, PNAS (USA), 88: 7276-7280 (1991). Such
approaches have either employed intercalating dyes (such as
ethidiurn bromide) to indicate the amount of double stranded DNA
present (Higuchi et al, Biotechnology 10:413-417 (1992), Higuchi et
al, Biotechnology 11:1026-1030 (1993), U.S. Pat. No. 5,210,015) or
they have employed oligonucleotide probes that are cleaved during
amplification by 5' nuclease activity of the polymerase to release
a fluorescent product whose concentration is a function of the
amount of double stranded DNA present, commonly referred to as a 5'
nuclease assay. An example of a 5' nuclease assay is the assay used
in the Taqman.TM. LS-50 PCR Detection system (Perkin-Elmer).
[0010] In general, 5' nuclease assays employ oligonucleotide probes
labeled with at least one fluorescer and at least one quencher.
Prior to cleavage of the probe, the at least one fluorescer excites
the quencher(s) rather than producing a detectable fluorescence
emission. The oligonucleotide probe hybridizes to a target
oligonucleotide sequence for amplification in PCR or similar
amplification reactions. The 5'.fwdarw.3' nuclease activity of the
polymerase used to catalyze the amplification of the target
sequence serves to cleave the probe, thereby causing at least one
fluorescer to be spatially separated from the one or more quenchers
so that the signal from the fluorescer is no longer quenched. A
change in fluorescence of the fluorescer and/or a change in
fluorescence of the quencher due to the oligonucleotide probe being
digested is used to indicate the amplification of the target
oligonucleotide sequence.
[0011] In 5' nuclease assays, it is often desirable to analyze a
sample containing multiple different targets using a different
spectrally resolvable species for each target. Such simultaneous
detection of multiple targets in a single sample has a number of
advantages over serial analysis of each of the targets. Because the
sample is analyzed once, fewer steps are required for sample
processing and only a single measurement is required. As a result,
higher sample throughput and improved user convenience is achieved.
In addition, by detecting multiple targets in a single sample,
internal calibration is facilitated. An example of a process using
simultaneous multispecies spectral detection is multicolor DNA
sequencing where four spectrally resolvable fluorescent dyes are
simultaneously detected.
[0012] One potential application for 5' nuclease assays is in the
area of screening for polymorphisms. Current diagnostic techniques
for the detection of known nucleotide differences include:
hybridization with allele-specific oligonucleotides (ASO) (Ikuta,
et al., Nucleic Acids Research 15: 797-811 (1987); Nickerson, et
al., PNAS (USA) 87: 8923-8927 (1990); Saiki, et al., PNAS (USA) 86:
6230-6234 (1989); Verdaan-de Vries, et al., Gene 50: 313-320
(1980); Wallace, et al., Nucleic Acids Research 9: 879-894 (1981);
Zhang, Nucleic Acids Research 19: 3929-3933 (1991));
allele-specific PCR (Gibbs, et al., Nucleic Acids Research 17:
2437-2448 (1989); Newton, et al., Nucleic Acids Research 17:
2503-2516 (1989)); solid-phase minisequencing (Syvanen, et al.,
American Journal of Human Genetics 1993; 52: 46-59 (1993));
oligonucleotide ligation assay (OLA) (Grossman, et al., Nucleic
Acids Research 22: 4527-4534 (1994); Landegren, et al., Science
241: 1077-1080 (1988)); and allele-specific ligase chain reaction
(LCR) (Abravaya, et al., Nucleic Acids Research 1995; 23: 675-682;
Barany, et al., PNAS (USA) 88: 189-193 (1991); Wu, et al., Genomics
4:560-569 (1989)). Genomic DNA is analyzed with these methods by
the amplification of a specific DNA segment followed by detection
analysis to determine which allele is present.
[0013] Lee, et al. has reported using PCR in combination with Taq
polymerase to distinguish between different alleles at a single
allelic site of the human cystic fibrosis gene. Lee, et al., Nucl.
Acids Res. 21:3761-3766 (1993). Livak, et al. has reported
distinguishing between alleles in the -23 A/T diallelic
polymorphism of the human insulin gene where each allelic site was
analyzed in a separate amplification reaction. Livak, et al.,
Nature Genetics, 9:341-342 (1995). Neither Lee, et al. nor Lival,
et al. teach how to distinguish between alleles variants at two or
more allelic sites in a single amplification reaction. A need
currently exists for a method and instrumentation for
distinguishing between multiple sets of substantially homologous
sequences, such as allelic variants, in a single amplification
reaction. The invention described herein provides such methods and
instrumentation.
SUMMARY OF THE INVENTION
[0014] The present invention relates to a method for identifying
which members of a first set of two or more substantially
homologous sequences are present in a sample of DNA and which
members of a second, different set of two or more substantially
homologous sequences are also present in the sample of DNA.
According to the method, the members of the first and second sets
present in the sample are identified in a single reaction.
[0015] In one embodiment, the method includes the steps of:
[0016] performing a nucleic acid amplification on a sample of DNA
which includes a first set of substantially homologous sequences
and a second, different set of substantially homologous sequences
using a nucleic acid polymerase having 5'-3' nuclease activity and
one or more primers capable of hybridizing to the sample of DNA in
the presence of two or more sets of oligonucleotide probes and
amplifying the sets of substantially homologous sequences wherein:
[0017] each set of substantially homologous sequences includes two
or more members which each differ from each other at least one base
position, [0018] each set of oligonucleotide probes is for
detecting the members of one of the sets of substantially
homologous sequences, [0019] each set of oligonucleotide probes
includes two or more probes which are complementary to different
members of a set of substantially homologous sequences, the member
being 5' relative to a sequence of the sample DNA to which the
primer hybridizes, and [0020] at least all but one of the
oligonucleotide probes include a different fluorescer than the
other probes and a quencher positioned on the probe to quench the
fluorescence of the fluorescer;
[0021] digesting those allelic oligonucleotide probes which
hybridize to the target sequence during the amplification by the
nuclease activity of the polymerase;
[0022] detecting a fluorescence spectrum of the amplification;
[0023] calculating a fluorescence contribution of each fluorescer
to the fluorescence spectrum; and
[0024] determining a presence or absence of the different members
of substantially homologous sequences based on the fluorescence
contribution of each fluorescer to the fluorescence spectrum.
[0025] The present invention also relates to a method for
determining a presence or absence of the different allelic variants
at the two or more different allelic sites by a 5' nuclease
amplification reaction. In one embodiment, the method includes the
steps of:
[0026] performing a nucleic acid amplification on a sample of DNA
having at least two different allelic sites using a nucleic acid
polymerase having 5'-3' nuclease activity and at least one primer
capable of hybridizing to the sample of DNA and amplifying the at
least two different allelic sites in the presence of two or more
sets of allelic oligonucleotide probes wherein: [0027] each set of
allelic oligonucleotide probes is for detecting a different allelic
site, [0028] each set of allelic oligonucleotide probes includes
two or more probes which are complementary to different allelic
variants at the allelic site being detected by the set of probes,
the allelic site being 5' relative to a sequence of the sample DNA
to which the primer hybridizes, and [0029] at least all but one of
the allelic oligonucleotide probes include a different fluorescer
than the other probes and a quencher positioned on the probe to
quench the fluorescence of the fluorescer;
[0030] digesting those allelic oligonucleotide probes which
hybridize to the sample of DNA during the amplification by the
nuclease activity of the polymerase;
[0031] detecting a fluorescence spectrum of the amplification;
[0032] calculating a fluorescence contribution of each fluorescer
to the fluorescence spectrum; and
[0033] determining a presence or absence of the different allelic
variants at the two or more different allelic sites based on the
fluorescence contribution of each fluorescer to the fluorescence
spectrum.
[0034] A method is also provided for genotyping a sample of DNA at
least two allelic sites by a 5' nuclease amplification reaction. In
one embodiment, the method includes the steps of:
[0035] performing a nucleic acid amplification on a sample of DNA
having at least two different allelic sites using a nucleic acid
polymerase having 5'-3' nuclease activity and at least one primer
capable of hybridizing to the sample of DNA and amplifying the at
least two different allelic sites in the presence of two or more
sets of allelic oligonucleotide probes wherein: [0036] each set of
allelic oligonucleotide probes is for detecting a different allelic
site, [0037] each set of allelic oligonucleotide probes includes
two or more probes which are complementary to different allelic
variants at the allelic site being detected by the set of probes,
the allelic site being 5' relative to a sequence of the sample DNA
to which the primer hybridizes, and [0038] at least all but one of
the allelic oligonucleotide probes include a different fluorescer
than the other probes and a quencher positioned on the probe to
quench the fluorescence of the fluorescer;
[0039] digesting those allelic oligonucleotide probes which
hybridize to the target sequence during the amplification by the
nuclease activity of the polymerase;
[0040] detecting a fluorescence spectrum of the amplification;
[0041] calculating a fluorescence contribution of each fluorescer
to the fluorescence spectrum; and
[0042] determining a genotype of the sample of DNA at the at least
two different allelic sites based on the fluorescence contribution
of the different fluorescers to the fluorescence spectrum.
[0043] The present invention also relates to a fluorescence
spectrum which is used to genotype a sample of DNA at least two
allelic sites. The spectrum is derived by performing one of the
above methods.
[0044] The present invention also relates to a fluorescence
signature for genotyping a sample of DNA at least two allelic
sites. The signature includes fluorescence signal contributions of
at least three fluorescers to a fluorescence spectrum derived by
performing one of the above methods.
[0045] The present invention also relates to a library of
fluorescence signatures for a series of controls, i.e., sequences
having known allelic variants at least two allelic sites. The
library of fluorescence signatures can be used to determine which
allelic variants are present in a sample of DNA whose genotype is
being determined.
[0046] The present invention also relates to a method for
determining a fluorescence signature of a sample of DNA. According
to one embodiment, fluorescence contributions of at least three
fluorescers to a fluorescence spectrum taken from a nucleic acid
amplification are calculated and normalized relative to an internal
standard, the normalized fluorescence contributions corresponding
to a fluorescence signature for the sample of DNA for the at least
two different allelic sites.
[0047] The present invention also relates to a method for
genotyping a sample of DNA by comparing the fluorescence signature
of the DNA sample to control sequences having known genotypes.
[0048] The present invention also relates to a processor and
related instrument for genotyping a sample of DNA at least two
allelic sites by a 5' nuclease assay. In one embodiment, the
processor includes logic for taking fluorescence spectra of control
samples and at least one unknown sample which have undergone a 5'
nuclease assay in the presence of allelic probes for the at least
two allelic sites and fluorescence spectra of at least three
fluorescers used in the 5' nuclease assay and using these spectra
to calculate normalized fluorescence contributions of the at least
three fluorescers to the unknown and control fluorescence spectra;
and logic for determining a genotype of the at least one unknown
sample at two or more different allelic sites based on a comparison
of the normalized fluorescence contributions of the at least three
fluorescers to the spectrum of the unknown sample and normalized
fluorescence contributions to the spectra of the control
samples.
[0049] The present invention also relates to a kit for determining
which members of at least two different sets of substantially
homologous sequences are present in a sample of DNA. According to
one embodiment, the kit includes two or more sets of
oligonucleotide probes wherein: [0050] each set of oligonucleotide
probes is for detecting a different set of substantially homologous
sequences, [0051] each set of oligonucleotide probes includes two
or more probes which are complementary to different members of a
set of substantially homologous sequences, and [0052] at least all
but one of the allelic oligonucleotide probes include a different
fluorescer than the other probes and a quencher positioned on the
probe to quench the fluorescence of the fluorescer.
[0053] The present invention also relates to a kit for genotyping a
sample of DNA at least two allelic sites. In one embodiment, the
kit includes two or more sets of allelic oligonucleotide probes
wherein: [0054] each set of allelic oligonucleotide probes is for
detecting a different allelic site, [0055] each set of allelic
oligonucleotide probes includes two or more probes which are
complementary to different allelic variants at the allelic site
being detected by the set of probes, and [0056] at least all but
one of the allelic oligonucleotide probes include a different
fluorescer than the other probes and a quencher positioned on the
probe to quench the fluorescence of the fluorescer. Optionally, the
allelic probes are complementary to allelic sites on a target
sequence which are separated by between about 50 and 150 bases,
more preferably less than 100 bases. The allelic probes optionally
have a % GC of at least about 20% and less than about 80%. All of
the allelic probes optionally have less than four contiguous
guanines. In one embodiment, none of the allelic probes have a
guanine at the 5' end.
[0057] In one variation of the above kit embodiments, the probes
have a melting point temperature (T.sub.m) that is about
3-5.degree. C. greater than the annealing temperature used in the
amplification reaction. In another variation, the probes have
melting point temperatures about 65-70.degree. C., more preferably
about 65-67.degree. C.
[0058] In one variation of the above kit embodiments, the kit also
includes one or more amplification primers. In one variation, the
probe melting point temperature (T.sub.m) is about 5-10.degree. C.
greater than the primer's T.sub.m, and preferably about 7.degree.
C. greater. In another variation, the primers have a melting point
temperature (T.sub.m) of about 55-65.degree. C., preferably about
58-63.degree. C., more preferably about 58-60.degree. C. The primer
preferably has two or less guanines or cytosines among the five
nucleotides at a 3' end of the primer.
BRIEF DESCRIPTION OF THE FIGURES
[0059] FIGS. 1A-1D illustrate the steps of a 5' nuclease assay.
[0060] FIG. 1A illustrates the polymerization of forward and
reverse primers.
[0061] FIG. 1B illustrates strand displacement of the
fluorescer-quencher probe by the 5'3' nuclease activity of a
nucleic acid polymerase.
[0062] FIG. 1C illustrates cleavage of the fluorescer by the
polymerase.
[0063] FIG. 1D illustrates completion of the amplification of the
target sequence.
[0064] FIG. 2 illustrates how the 5' nuclease assay can be used to
identify the genotype of a target sequence at a single allelic
site.
[0065] FIG. 3 shows fluorescence spectra observed in an allelic
discrimination experiment such as the one illustrated in FIG.
2.
[0066] FIGS. 4A-4D illustrates how fluorescer-quencher probes for
two or more different allelic sites and a 5' nuclease assay can be
used to genotype a target sequence at the two or more different
allelic sites.
[0067] FIG. 4A illustrates a nucleic acid amplification reaction
being performed on a target sequence having two allelic sites using
a nucleic acid polymerase having 5'-3' nuclease activity and a
primer capable of hybridizing to the target sequence.
[0068] FIG. 4B illustrates the nucleic acid polymerase extending
the forward and reverse primers.
[0069] FIG. 4C illustrates extension of the primers continuing and
the polymerase performing strand displacement.
[0070] FIG. 4D illustrates the fluorescers and quenchers attached
to the digested allelic probes being displaced from the target
sequence.
[0071] FIGS. 5A-5C illustrates how fluorescer-quencher probes for
two or more different allelic sites and a .about.5' nuclease assay
can be used to genotype a sample of DNA at two or more different
allelic sites using a different primer for each allelic site.
[0072] FIG. 5A illustrates a nucleic acid amplification reaction
being performed on a DNA sequence using a nucleic acid polymerase
having 5'-3' nuclease activity and two primers capable of
hybridizing to different DNA sequences.
[0073] FIG. 5B illustrates the nucleic acid polymerase extending
the primers and releasing fluorescers for the different allelic
sites.
[0074] FIG. 5C illustrates the fluorescers and quenchers attached
to the digested allelic probes being displaced from the DNA.
[0075] FIGS. 6A and 6B illustrate the impact of having longer or
shorter distances between the primer and probe.
[0076] FIG. 6A illustrates the sequence of a double stranded
amplicon with inner and outer primers for amplification of the
double stranded amplicon.
[0077] FIG. 6B illustrates amplification curves comparing the
fluorescence signal generated when different combinations of
primers and probes are used.
[0078] FIG. 7 illustrates that a probe with more Cs than Gs
performs better in the 5' nuclease assay.
[0079] FIGS. 8A and 8B illustrate sequences for Amelogenin X and
Amelogenin Y respectively from which an amplicon, primers and probe
are to be determined.
[0080] FIG. 9 illustrates a comparison of a portion of Amelogenin X
to a portion of Amelogenin Y where the symbol | between the
sequences indicates that the two sequences have the same nucleotide
at the particular base position and the symbol -- between the
sequences indicates that the two sequences have a different
nucleotide at the particlar base position.
[0081] FIG. 10 illustrates a portion of Amelogenin X (bases 50-750)
with the allelic site to be identified by the 5' nuclease assay
illustrated in bold.
[0082] FIG. 11 illustrates bases 251-500 of Amelogenin X
illustrated in FIG. 10 along with its complementary (antisense)
strand.
[0083] FIG. 12 illustrates the Amelogenin X amplicon selected by
this process.
[0084] FIG. 13 illustrates the normalized relative contributions of
FAM, TET, JOE, and TAMRA to spectra derived from performing the
above-described 5' nuclease assay on apoE alleles .epsilon.2,
.epsilon.3, and .epsilon.4 and on a sample with no template
(NT).
[0085] FIG. 14 illustrates a plot of allele value versus well for
the ApoE genotyped samples.
[0086] FIG. 15 illustrates a scatter plot diagram of .epsilon.3
versus .epsilon.4 for the data shown in FIG. 14.
DEFINITIONS
[0087] As used in this application, the term "oligonucleotide"
includes linear oligomers of natural or modified monomers or
linkages, including deoxyribonucleosides, ribonucleosides, and the
like; capable of specifically binding to other oligonucleotide
sequences by way of a regular pattern of monomer-to-monomer
interactions, such as Watson-Crick type of basepairing, or the
like. Usually monomers are linked by phosphodiester bonds or
analogs thereof to form oligonucleotides ranging in size from a few
monomeric units, e.g., 3-4, to several tens of monomeric units.
Whenever an oligonucleotide is represented by a sequence of
letters, such as "ATGCCTG", it will be understood that the
nucleotides are in 5'.fwdarw.3' order from left to right and that
"A" denotes deoxyadenosine, "C" denotes deoxycytidine, "G" denotes
deoxyguanosine, and "T" denotes thymidine, unless otherwise noted.
Analogs of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoranilidate, phosphoramidate, and the
like.
[0088] "Target oligonucleotide sequence" refers to the sequence
which is amplified according to the present invention in order to
determine its genotype. The target oligonucleotide sequence is also
referred to as the amplicon of the 5' nuclease assay.
[0089] "Oligonucleotide probe" refers to the oligonucleotide
sequence containing at least one fluorescer and at least one
quencher which is digested by the 5' endonuclease activity of the
polymerase in order to detect any amplified target oligonucleotide
sequences. In general, the oligonucleotide probes used in the
invention will have a sufficient number of phosphodiester linkages
adjacent to its 5' end so that the 5'.fwdarw.3' nuclease activity
employed can efficiently degrade the bound probe to separate the
fluorescers and quenchers.
[0090] "Perfectly matched" in reference to a duplex means that the
oligonucleotide strands making-up the duplex form a double-stranded
structure with one other such that every nucleotide in each strand
undergoes Watson-Crick basepairing with a nucleotide in the other
strand. The term also comprehends the pairing of nucleoside
analogs, such as deoxyinosine, nucleosides with 2-aminopurine
bases, and the like, that may be employed. Conversely, a "mismatch"
in a duplex between a target oligonucleotide sequence and an
oligonucleotide probe or primer means that a pair of nucleotides in
the duplex fails to undergo Watson-Crick bonding.
[0091] "Substantially homologous sequences" refers to two or more
sequences (or subregions of a sequence) which are homologous except
for differences at one or more base positions. Two allelic variants
which differ by only one nucleotide is an example of a set of
substantially homologous sequences. The substantially homologous
sequences are preferably at least 90% homologous.
[0092] As used in the application, "nucleoside" includes the
natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms,
e.g., as described in Kornberg and Baker, DNA Replication, 2nd Ed.
(Freeman, San Francisco, 1992). "Analogs" in reference to
nucleosides includes synthetic nucleosides having modified base
moieties and/or modified sugar moieties, e.g., described by Scheit,
Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman,
Chemical Reviews, 90: 543-584 (1990), or the like, with the only
proviso that they are capable of specific hybridization. Such
analogs include synthetic nucleosides designed to enhance binding
properties, reduce degeneracy, increase specificity, and the
like.
DETAILED DESCRIPTION
[0093] The present invention relates to a 5' nuclease assay in
which a first set of fluorescer-quencher probes is used to identify
which members of a first set of two or more substantially
homologous sequences are present in a sample of DNA and a second
set of fluorescer-quencher probes is used in the same reaction to
identify which members of a second set of two or more substantially
homologous sequences are also present in the sample of DNA. The 5'
nuclease assay is performed in a single reaction containing both
the first and second sets of probes. The assay enables one to
determine which members of first set of substantially homologous
sequences are present in the sample while simultaneously enabling
one to determine which members of second set of substantially
homologous sequences are present in the sample.
[0094] One application of the 5' nuclease assay is determining the
genotype of a sample of genomic DNA at the two or more different
allelic sites. The two or more different allelic sites may be on a
single strand of DNA or may be on different strands of DNA. The two
or more different allelic sites may be amplified by a single
amplification primer, for example when the allelic sites are on the
same strand of DNA and adjacent each other, or by multiple
different amplification primers.
[0095] The present invention also relates to a 5' nuclease assay
adapted to determine the allelic genotype of a sample of DNA at
multiple allelic sites, devices and kits for performing the assay,
and the fluorescence spectrum and fluorescence signature produced
by performing the assay. The present invention also relates to
devices, logic and software used to analyze the fluorescence
spectrum and fluorescence signature produced by performing the
assay.
[0096] As will be explained herein in greater detail, performance
of the assay of the present invention produces a fluorescence
spectrum which is characteristic of a sample of DNA which includes
a particular combination of members of the multiple sets of the two
or more substantially homologous sequences in the sample of DNA.
For example, when used to determine the genotype of a sample of DNA
at two or more allelic sites, performance of the assay produces a
fluorescence spectrum which is characteristic of a sample of DNA
having that genotype which has been subjected to the assay, i.e.,
using the particular temperatures, primers and probes used to
perform the assay. By calculating a contribution of the different
fluorophores (fluorescers and quenchers) used in assay to the
fluorescence spectrum, a fluorescence signature can be produced
which is characteristic of a sample of DNA. The fluorescence
signature of a given unknown sample can then be compared to that of
samples having the various different known combinations of members
in order to determine which members of the two or more sets are
present in the sample. For example, when genotyping an unknown
sample, the fluorescence signature produced as a result of
performing the assay can be compared to the fluorescence signatures
of the various known genotypes in order to determine the genotype
of the unknown sample.
[0097] 1. 5'Nuclease Assay for Measuring Amplification Products
[0098] The present invention utilizes a variation of a 5' nuclease
assay in order to determine the presence of members of two
different sets of substantially homologous sequences in a sample of
DNA. In general, a 5' nuclease assay involves the digestion of an
oligonucleotide probe containing a fluorescer and quencher during a
nucleic acid amplification reaction to evidence the amplification
of a particular member.
[0099] FIGS. 1A-1D illustrate the steps of a 5' nuclease assay. In
the assay, a nucleic acid amplification reaction is performed on a
target sequence (double stranded sequence 10) using a nucleic acid
polymerase (not shown) having 5'-3' nuclease activity and a primer
(forward and reverse primers 12, 14) capable of hybridizing to the
target sequence 10 in the presence of an oligonucleotide probe 16
which is capable of hybridizing to the target sequence downstream
relative to one of the primers. As illustrated in FIG. 1A, the
oligonucleotide probe 16 includes a fluorescer (F) and quencher
(O). The binding site of the oligonucleotide probe 16 is located
downstream (3') relative to the binding site for the forward primer
14 used to amplify the target sequence 10. The oligonucleotide
probe 16 is preferably constructed such that the polymerase can not
extend the 3' end of the probe. This may be accomplished by
attaching the fluorescer or quencher to the terminal 3' carbon of
the oligonucleotide probe by a linking moiety.
[0100] As illustrated in FIG. 1B, the nucleic acid polymerase (not
shown) extends the forward and reverse primers 12, 14. Preferably,
PCR is carried out using a Taq DNA polymerase, e.g., AMPLITAQ.TM.
or AMPLITAQ.TM. Gold (Perkin-Elmer, Norwalk, Conn.), or an
equivalent thermostable DNA polymerase.
[0101] During extension of the primer, the polymerase encounters
the probe hybridized to the target sequence and performs strand
displacement by digesting the probe. As illustrated in FIG. 1C,
digestion of the probe results in release of the fluorescer (or
quencher) from the probe. This causes the fluorescer and quencher
on the probe to become spatially separated from each other, thereby
creating a change in fluorescence in the sample to indicate the
extension of the primer 12 and hence the amplification of the
target sequence 10. As illustrated in FIG. 1D, both the fluorescer
and quencher are ultimately displaced from the target sequence.
[0102] Detailed descriptions of nucleic acid amplification
reactions employing fluorescer-quencher probes can be found in many
publications, including, for example, Holland, et al., PNAS (USA)
88:7276-7280 (1992); Holland, et al., Clinical Chemistry,
38:462-463 (1992); Lee, et al., Nucleic Acid Research, 21:
3761-3766 (1993), Livak, et al., PCR Methods and Applications,
4:357-362 (1995) and U.S. application Ser. No. 08/559,405 which is
incorporated herein by reference.
[0103] As used herein, the fluorescer can be any molecule capable
of generating a fluorescence signal. The quencher molecule can be
any molecule capable of absorbing the fluorescence energy of the
excited fluorescer, thereby quenching the fluorescence signal that
would otherwise be released from the excited fluorescer. In order
for a quencher molecule to quench an excited fluorescer, the
quencher must generally be within a minimum quenching distance of
the excited fluorescer at some time prior to the fluorescer
releasing the stored fluorescence energy.
[0104] A variety of different fluorescer-quencher probes have been
developed for use in this method. Initially, probes were developed
where the fluorescer and quencher were always in close proximity
with each other on the probe so that the quencher efficiently
quenched the fluorescer. The design of fluorogenic probes has since
been simplified by the discovery that probes with a reporter dye on
the 5' end and a quencher dye on the 3' end exhibit adequate
quenching for performance in the 5' nuclease assay. Livak, et al.,
PCR Methods and Applications 4: 357-362 (1995). For example, probes
have been developed where the fluorescer and quencher are
positioned such that they exist in at least one single-stranded
conformation when unhybridized where the quencher molecule quenches
the fluorescence of the fluorescer and exist in at least one
conformation when hybridized to a target oligonucleotide sequence
where the fluorescence of the fluorescer is unquenched. See
application Ser. No. 08/559,405 (incorporated herein by reference).
As a result, the fluorescer and quencher need not be positioned at
a specific distance within a probe in order to achieve effective
quenching to be detected. This facilitates the design and synthesis
of these probes.
[0105] Probes have also been developed where the probe hybridizes
to itself to form a loop such that the quencher molecule is brought
into proximity with the fluorescer in the absence of a
complementary nucleic acid sequence to prevent the formation of the
hairpin structure. WO 90/03446; European Patent Application No. 0
601 889 A2.
[0106] Any of the above fluorescer-quencher probes can be used in
conjunction with the present invention.
[0107] It might be expected that probes described in Livak, et al.,
WO 90/03446, or European Patent Application No. 0 601 889 A2 where
the distance between the fluorescer and quencher is increased would
compromise the ability of a probe to discriminate against
mismatches. However, it has been demonstrated that even probes with
a reporter at the 5' end and a quencher at the 3' end can be used
to distinguish alleles. Livak, et al., Nature Genetics, 9:341-342
(1995).
[0108] FIG. 2 illustrates how a 5' nuclease assay can be used to
identify the genotype of a target sequence at a single allelic
site. As illustrated in the figure, probes specific for allele A
and allele B are included in the PCR assay. The probes can be
distinguished by labeling each with a different fluorescent
reporter dye, illustrated in the figure as FAM
(6-carboxy-fluorescein) and TET
(6-carboxy-4,7,2',7'-tetrachloro-fluorescein). A mismatch between
the probe and target sequence greatly reduces the efficiency of
probe hybridization and cleavage.
[0109] FIG. 3 shows fluorescence spectra observed in an allelic
discrimination experiment such as the one illustrated in FIG. 2. In
this figure, each of the three possible genotypes (homozygote for
allele A; homozygote for allele B; heterozygote for alleles A and
B) has a spectrum distinct from each other and from the spectrum of
unreacted probe (no DNA). By comparing these spectra to that of an
unknown sample, the genotype of the unknown sample can be
determined. For example, a substantial increase in the FAM or TET
fluorescent signal indicates homozygosity for the allele that is
complementary to the probe containing the fluorescer whose signal
increased. An increase in both FAM and TET signals indicates
heterozygosity.
[0110] The fluorescence spectra of FAM and TET have significant
overlap. As can be seen from FIG. 3, it is difficult to distinguish
between a spectrum having a strong FAM signal (1/1 homozygote), a
spectrum having a strong TET signal (2/2 homozygote), and a
spectrum having a moderate FAM and TET signals (heterozygote). The
use of additional allelic probes having additional fluorescers in
the same assay would further complicate the differentiation of
fluorescence spectra derived from different genotypic samples. As
will be described herein, Applicants provide an assay for
determining the genotype of a target sequence at multiple allelic
sites using at least four allelic probes having a total of at least
three different fluorescers by determining a fluorescence signature
for each sample based on the fluorescence spectra produced via the
5' nuclease assay.
[0111] 2. 5' Nuclease Assay for Genotyping Amplification Products
at Multiple Allelic Sites
[0112] The present invention relates to an adaption of a 5'
nuclease assay, such as the assay illustrated in FIGS. 1A-1D, to
determine the presence of members of two different sets of
substantially homologous sequences in a sample of DNA in a single
assay. While the present invention will now be described with
regard to the detection of a multiple allelic genotype of a sample
of genomic DNA, it is noted that the invention is not intended to
be limited to this particular application but rather is intended to
be applicable generically to the identification of members of
multiple sets of two or more substantially homologous sequences in
a sample of DNA.
[0113] FIGS. 4A-4D and 5A-5D illustrate how fluorescer-quencher
probes for two or more different allelic sites and the 5' nuclease
assay can be used to genotype a sample of DNA at the two or more
different allelic sites. It is noted that DNA for only a single
genotype is illustrated in FIGS. 4A-4D and 5A-5D. It should be
noted that if a sample of DNA contains DNA for more than one
genotype, i.e., a heterozygote, different groups of probes will
hybridize to the DNA for each genotype.
[0114] FIGS. 4A-4D illustrate performance of the 5' nuclease assay
where the two or more different allelic sites are sufficiently near
each other on the same strand of DNA such that it is possible to
amplify both allelic sites with a single primer. FIGS. 5A-5D
illustrate the performance of the 5' nuclease assay where the two
or more different allelic sites are amplified using different
primers.
[0115] As illustrated in FIG. 4A, a nucleic acid amplification
reaction is performed on a target sequence (double stranded
sequence 40) using a nucleic acid polymerase (not shown) having
5'-3' nuclease activity and a primer (forward and reverse primers
42, 44) capable of hybridizing to the target sequence 40. The
amplification reaction is performed in the presence of a first set
of allelic probes 46A, 46B for a first allelic site 47 and a second
set of allelic probes 48A, 48B for a second allelic site 49. Each
set of allelic probes includes at least two probes which differ
from each other by at least one nucleotide.
[0116] All of the allelic probes are complementary to allelic sites
on the target sequence which are downstream (3') relative to the
sequence to which one of the primers is complementary. As
illustrated in FIG. 4A, all but one of the allelic probes includes
a different fluorescer (F.sub.1, F.sub.2, F.sub.3) and a quencher
(Q). The allelic probe 48B which does not include a fluorescer
optionally can include a fluorescer. The fluorescer on allelic
probe 48B should be different than the other fluorescers (i.e.,
F.sub.4).
[0117] As illustrated in FIG. 4A, one of the probes from the first
set (46A) hybridizes to the first allelic site 47 and one of the
probes from the second set (48A) hybridizes to the second allelic
site 49. While only one probe from each set is shown to hybridize
to a particular allelic site, it should be noted that other probes
of the set can also hybridize to the site. In this regard, the
different allelic probes of each set compete to hybridize to the
allelic site. The allelic probe which perfectly matches the allelic
site will be thermodynamically favored for hybridizing to the
allelic site over probes in the set which include a mismatch. In
addition, it has been found that cleavage of the allelic probe by
the polymerase is more efficient for perfectly matched allelic
probes than for allelic probes with a mismatch.
[0118] As illustrated in FIG. 4B, the nucleic acid polymerase (not
shown) extends the forward and reverse primers 42, 44. Preferably,
PCR is carried out using a Taq DNA polymerase, e.g., AMPLITAQ.TM.
or AMPLITAQ.TM. Gold (Perkin-Elmer, Norwalk, Conn.), or an
equivalent thermostable DNA polymerase.
[0119] During extension of the primers 42, 44, the polymerase
encounters whichever allelic probe is hybridized to the first
allelic site (illustrated as probe 46A) and performs strand
displacement by beginning to digest that probe. As illustrated in
FIG. 4B, digestion of that probe results in the release of the
fluorescer (shown as F.sub.1) attached to that digested allelic
probe.
[0120] As illustrated in FIG. 4C, extension of the primers
continues and the polymerase encounters whichever allelic probe is
hybridized to the second allelic site (illustrated as probe 48A)
and performs strand displacement by digesting that probe. As
illustrated in FIG. 4C, digestion of that probe results in the
release of the fluorescer (shown as F.sub.3) attached to that
digested allelic probe.
[0121] As illustrated in FIG. 4D, both the fluorescers and
quenchers attached to the digested allelic probes are ultimately
displaced from the target sequence.
[0122] A fluorescence spectrum of the sample is taken after at
least one amplification cycle which reflects the relative number of
the different fluorescers and quenchers which have been
released.
[0123] FIGS. 5A-5C illustrate the performance of the 5' nuclease
assay where the two or more different allelic sites are amplified
using different primers. As illustrated in FIG. 5A, a nucleic acid
amplification reaction is performed on a two separate sequences
(double stranded sequences 50, 51) using a nucleic acid polymerase
(not shown) having 5'-3' nuclease activity and primers (forward 52,
53 and reverse primers 54, 55) capable of hybridizing to each
target sequence 50, 51. It is noted that if the two or more
different allelic sites were positioned on the same strand, the
amplification could also be performed using a single pair of
primers, as illustrated in FIGS. 4A-4D, or using multiple
primers.
[0124] The amplification reaction is performed in the presence of a
first set of allelic probes 56A, 56B for a first allelic site 57
and a second set of allelic probes 58A, 58B for a second allelic
site 59. Each set of allelic probes includes at least two probes
which differ from each other by at least one nucleotide.
[0125] All of the allelic probes are complementary to allelic sites
on the target sequence which are downstream (3') relative to the
sequence to which one of the primers is complementary. As
illustrated in FIG. 5A, all but one of the allelic probes includes
a different fluorescer (F.sub.1, F.sub.2, F.sub.3) and a quencher
(Q). The allelic probe 58B which does not include a fluorescer
optionally can include a fluorescer. The fluorescer on allelic
probe 58B should be different than the other fluorescers (i.e.,
F.sub.4).
[0126] As illustrated in FIG. 5A, one of the probes from the first
set (56A) hybridizes to the first allelic site 57 and one of the
probes from the second set (58A) hybridizes to the second allelic
site 59. While only one probe from each set is shown to hybridize
to a particular allelic site, it should be noted that other probes
of the set can also hybridize to the site.
[0127] As illustrated in FIG. 5B, the nucleic acid polymerase (not
shown) extends the forward and reverse primers 52, 53, 54, and 55.
Preferably, PCR is carried out using a Taq DNA polymerase, e.g.,
AMPLITAQ.TM. or AMPLITAQ.TM. Gold (Perkin-Elmer, Norwalk, Conn.),
or an equivalent thermostable DNA polymerase.
[0128] During extension of the primers, the polymerase encounters
whichever allelic probe is hybridized to the first allelic site
(illustrated as probe 56A) and performs strand displacement by
beginning to digest that probe. The polymerase also encounters
whichever allelic probe is hybridized to the second allelic site
(illustrated as probe 58A) and performs strand displacement by
beginning to digest that probe. As illustrated in FIG. 5B,
digestion of that probe results in the release of fluorescers
(shown as F.sub.1, F.sub.3) attached to the digested allelic
probes.
[0129] As illustrated in FIG. 5C, both the fluorescers and
quenchers attached to the digested allelic probes are ultimately
displaced from the sequence being amplified.
[0130] A fluorescence spectrum of the sample is taken after at
least one amplification cycle which reflects the relative number of
the different fluorescers and quenchers which have been
released.
[0131] A number of factors contribute to the assay's ability to
discriminate between perfectly matched allelic probes and probes
with only a single mismatch, even a single mismatch within a probe
that is 20-30 nucleotides long. A mismatch has a disruptive effect
on hybridization which make perfectly matching probes
thermodynamically favored over mismatched probes. For example, a
mismatched probe will have a lower melting temperature (T.sub.m)
than a perfectly matched probe. Multiple mismatches have an even
greater disruptive effect on hybridization than single mismatches.
As a result, multiple mismatch probes are even less
thermodynamically favored than perfectly matched probes.
[0132] Proper choice of an annealing/extension temperature in the
PCR will favor hybridization of an exact-match probe over a
mismatched probe. The thermal window defining this choice is
bracketed by the thermal transitions for the binding of a probe to
its homologous or heterologous targets. By raising or lowering the
annealing temperature, discrimination against a mismatch can be
increased or reduced respectively.
[0133] One of the features of the 5' nuclease assay which enables
its use for distinguishing between different substantially
homologous sequences at multiple different sites (such as
identifying different alleles at multiple allelic sites) is the
inefficient cleavage of probes when there is even a single mismatch
within a probe that is 20-30 nucleotides long.
[0134] It is also important to note that the assay is performed
under competitive conditions. Multiple probes to the same allelic
site are present in the same reaction vessel. Part of the
discrimination against a mismatch is that the probe that is
perfectly matched functions to prevent the mismatched probe from
binding because of the perfectly matched probe's stable
hybridization to the sequence being amplified.
[0135] The 5' end of the allelic probe must also be displaced
before it is cleaved. The 5' nuclease activity of Taq DNA
polymerase is believed to recognize a forked structure with a
displaced 5' strand of 1-3 nucleotides. Landegren, et al., Science
241: 1077-1080 (1988). Once probe displacement starts, complete
dissociation will be significantly faster with a less
thermodynamically stable mismatched probe than it will be with a
perfectly matched probe. As a result, cleavage of a mismatched
probe by a polymerase is significantly less efficient than is
cleave of a perfectly matched allelic probe.
[0136] A key advantage of the present invention for determining the
genotype of a sample of DNA at multiple allelic sites is that it
does not rely on the 5' nuclease assay working with 100% efficiency
to distinguish between substantially homologous sequences such as
alleles, i.e., where only perfectly matched allelic probes are
cleaved and no mismatched allelic probes are cleaved. Rather, the
present invention assumes that a certain degree of inefficiency
occurs and relies on that degree of inefficiency to be highly
consistent sample to sample. By generating a fluorescence spectrum
and a fluorescence signature for each genotype which uniquely
reflects the assay's inherent inefficiency for that genotype given
the particular conditions, probes and primers used, the genotype of
unknown sequences can be determined
[0137] 3. Generating an Allelic Fluorescence Signature from a 5'
Nuclease Assay
[0138] An important aspect of the present invention is the
processing of a fluorescence spectrum generated by performing the
5' nuclease assay in order to determine which members of the sets
of substantially homologous sequences are present, for example, in
order to determine the genotype of a genomic sample of DNA. As
illustrated in FIGS. 4A-4D and 5A-5D, the fluorescence signal
generated by the fluorescers and quenchers present in the reaction
mixture will change as the DNA sample is amplified and several of
the allelic probes are digested. The fluorescence signal from the
reaction mixture will include contributions from the different
fluorescers (F.sub.1, F.sub.2 and F.sub.3), the quencher, as well
as from an internal standard. In order to determine which allelic
probes were digested and what genotype is present, it is necessary
to unravel the different contributions of the allelic probes and
their fluorescent components to that spectrum.
[0139] The first step in the analysis of a fluorescence signal
derived from a 5' nuclease reaction is the creation of a reference
library of spectra of the fluorescers and quenchers on the allelic
probes used in the 5' nuclease assay. These spectra are expressed
as normalized 1.times.n matrixes of fluorescence intensity values
where n represents fluorescence measurements at a series of n
wavelengths, n preferably being 32 values. The matrixes are
normalized by setting the largest value in the matrix to 1. The
reference library of spectra and their associated 1.times.n
matrixes can be stored in a database or taken at the time of
analysis.
[0140] A 5' nuclease assay is then performed on a series of samples
including samples containing genomic DNA whose genotype is known
("Control"); samples containing genomic DNA whose genotype is
unknown ("Unknowns"); and samples containing no template ("NT").
Fluorescence spectra are taken of the control and unknown samples
and expressed as 1.times.n matrixes of fluorescence intensity
values where n represents fluorescence measurements at a series of
n wavelengths, n preferably being 32 values. The matrixes may
optionally be normalized by setting the largest value in the matrix
to 1.
[0141] The 1.times.n matrixes representing the fluorescent spectra
of the control and unknown spectra are then analyzed to determine
the relative fluorescent contributions of the fluorescent species
present in the 5' nuclease assay using the 1.times.n matrix
representations of the reference library spectra. Determination of
the relative fluorescent contributions of the different fluorescent
species can be performed by the multicomponent analysis method
described in application Ser. No. 08/659,115 entitled
"MULTICOMPONENT ANALYSIS METHOD INCLUDING THE DETERMINATION OF A
STATISTICAL CONFIDENCE INTERVAL" which is incorporated herein by
reference.
[0142] Once the relative fluorescent contributions of the different
fluorescent species are determined, the contributions of the
different fluorescent species are normalized using a passive
fluorescent internal standard. The internal standard is passive in
the sense that its fluorescence does not significantly change
during a nucleic acid amplification reaction. The use of an
internal standard in nucleic acid amplification reactions and for
normalizing fluorescence spectra is described in application Ser.
No. 08/657,989 entitled "PASSIVE INTERNAL REFERENCES FOR THE
DETECTION OF NUCLEIC ACID AMPLIFICATION PRODUCTS" which is
incorporated herein by reference.
[0143] The normalized contributions of the different fluorescent
species to the control and unknown's fluorescence spectra
correspond to their "fluorescence signatures." The term
"fluorescence signature" is used herein to describe the relative
contributions of the different fluorescent species to the spectra
produced by performance of the 5' nuclease assay because the
relative contributions can be used to distinguish the spectra of
the different controls from each other and can also be used to
identify the genotype of an unknown sample of DNA based on a
comparison of the relative contributions to the spectrum for the
unknown to the relative contributions to the spectra for the
different controls. It is noted that the fluorescence signature is
not only dependent on which members of the sets of substantially
homologous sequences present in the sample (e.g., which allelic
variants are present) but is also dependent on a series of assay
dependent variables including the given 5' nuclease assay
conditions (time, temperature), the probes, primers and polymerase
used, the relative hybridization competition between the probes and
the algorithm used to calculate the contribution of the different
fluorescent species. As an example of the present invention, the
determination of fluorescence signatures for ApoE genotyping is
described below.
[0144] 4. Determining Genotype at Multiple Allelic Sites from
Fluorescence Signature
[0145] Once fluorescence signatures of the controls, unknowns, and
NT are determined, the fluorescence signature of each unknown is
compared to the fluorescence signatures of each of the controls and
the NT in order to genotype each unknown. If the amplification
reaction was successful, the fluorescence signature of the unknown
should match the fluorescence signature of a single control or a
50-50 mixture of two controls for a heterozygote. If the
amplification reaction was unsuccessful, the fluorescence signature
of the unknown will not match any of the controls and should match
the NT signature. As an example of the present invention, the
determination of ApoE genotypes from fluorescence signatures is
described below.
[0146] 5. Kit for Performing Fluorescer-Quencher Probe Assay to
Determining Genotype of Amplified Product at Multiple Allelic
Sites
[0147] The present invention also relates to a kit for determining
which members of at least two different sets of substantially
homologous sequences are present in a sample of DNA. As an example,
the kit may be for determining the genotype of a sample of genomic
DNA at least two different allelic sites using a 5' nuclease assay.
The kit may also be for differentiating between two or more sets of
two or more substantially homologous sequences where the
substantially homologous sequences are not related to each other as
allelic variants, for example, sequences from different strains of
microorganisms.
[0148] According to one embodiment, the kit includes at least two
sets of probes where each set of probes is for distinguishing
between two or more substantially homologous sequences, the two or
more substantially homologous sequences differing from each other
by at least one nucleotide, and each probe in the set perfectly
matching one of two or more substantially homologous sequences. The
kit may optionally also include additional sets of probes,
amplification primers and/or a polymerase for use in the assay.
Combined, the probes of the two or more sets include at least three
different fluorescers. One probe may optionally not include a
fluorescer or include a fluorescer which is present in a different
set. The at least two sets of probes should be selected so as to
produce distinguishable fluorescence signatures for the different
genotypes being detected.
[0149] In another embodiment, the kit includes at least a first set
of allelic probes for genotyping a first allelic site and second
set of allelic probes for genotyping a second allelic site. The kit
may optionally also include additional sets of allelic probes,
amplification primers and or a polymerase for use in the assay.
Each set of probes includes at least two probes which are capable
of hybridizing to the allelic site but differ from each other by at
least one nucleotide. Combined, the allelic probes of the two or
more sets include at least three different fluorescers. One probe
may optionally not include a fluorescer or include a fluorescer
which is present in a different set. The at least two sets of
probes should be selected so as to produce distinguishable
fluorescence signatures for the different genotypes being
detected.
[0150] The kit may also include sample DNA which can serve as a
control in the assay. For example, the sample DNA can include
specific members of the substantially homologous sequences. In one
embodiment, the sample DNA has a known genotype at first and second
allelic sites. The kit may also include a fluorescent material for
use as a passive internal standard. Optionally, the kit may also
include buffer or other reagents for performing the 5' nuclease
assay.
[0151] 6. Guidelines for Performing a 5' Nuclease Assay
[0152] The following guidelines have been developed for performing
a 5' nuclease assay such as the assay used in the present invention
to detect the genotype of a sample of DNA at an allelic site. Using
a native sequence which includes one of the homologous sequences to
be identified, the guidelines assist one of ordinary skill in the
selection of the primer sequences, probe sequences and the section
of sequence to be amplified (the amplicon) in the assay.
[0153] A. Primer and Probe Design Guidelines
[0154] I. Amplicon Length and Primer--Probe Separation
[0155] The operation of the 5' nuclease assay has been found to
improve as the length of the sequence being amplified decreases.
Consistent and predictable results have been routinely obtained for
amplicons as short as 50 bp and as long as 150 bp. Longer amplicons
may also yield acceptable results but will not necessarily provide
the predictable and reproducible performance which the optimization
strategy described herein provides. Forward and reverse primers
should be designed to be positioned as close as possible to each
allelic oligonucleotide probe. As the distance between the primers
and allelic probes or the overall amplicon length increase,
performance of the assay decreases and the reaction becomes more
difficult to optimize.
[0156] The impact of having longer or shorter distances between the
primer and probe is illustrated in FIGS. 6A and 6B. FIG. 6A
illustrates the sequence of a double stranded amplicon 62. Also
illustrated are sequences for inner 64, 64' and outer 66, 66'
primers (sequences in arrows) for amplification of the double
stranded amplicon 62. Also illustrated are sequences for
oligonucleotide probes 68, 68' (small case) for use in the
fluorescence-based detection method. FIG. 6B illustrates
amplification curves (1) where two inner primers (64, 64') are
used; (2) where inner and outer primers (64, 66') are used; (3)
where inner and outer primers (64', 66) are used; and (4) where two
outer primers (64, 64') are used. As can be seen from FIG. 6B, the
highest yield (.DELTA.R.sub.n) is achieved when the amplicon is the
shortest (1). The yield decreases when the length of the amplicon
is increased [(1) vs. (4)]. Amplicons of intermediate length are
shown in FIG. 6B to yield intermediate results.
[0157] II. Primer and Probe Selection Based on Amplicon
Sequence
[0158] Several factors influence the selection of the primer and
probe sequences to use for a given amplicon. For example, the % GC
(percentage of bases in a sequence which are either G or C) should
be at least about 20% and less than about of 80%. This acceptable %
GC range is quite broad. The reason for this flexibility is that
primers and probes which meet the tight T.sub.m ranges defined
below can be designed within this broad range of % GC.
[0159] The primers should be selected to hybridize to a region
which is conserved between different sources of DNA. If the primer
selected hybridizes to a polymorphic region, the primer will or
will not amplify DNA in the sample depending on the source of the
sample. By selecting a primer which hybridizes to a non-polymorphic
region, the primer should be able to amplify most samples.
[0160] The primers and probes should have less than four contiguous
guanines (G). The requirement for no more than 3 contiguous Gs
stems from the reduced yield of reactions in which these structures
are found. This reduced yield is due to the relatively stable
secondary structure created when 4 or more contiguous Gs are
found.
[0161] III. Probe Selection Based on Amplicon Sequence
[0162] In addition to the guidelines of Section II for selecting
the amplicon, the following additional guidelines should preferably
followed when selecting the probe sequence.
[0163] In one embodiment, the probe melting point temperature
(T.sub.m) is about 3-5.degree. C. greater than the annealing
temperature used in the amplification reaction and the primer
melting point temperature (T.sub.m) is about 24.degree. C. less
than the annealing temperature. In one embodiment, the annealing
temperature is about 60-64.degree. C. and is more preferably about
62.degree. C. When the annealing temperature is about 62.degree.
C., the probe melting point temperature is preferably about
65-67.degree. C. and the primer melting point temperature is
preferably about 58-60.degree. C.
[0164] In another embodiment, the probe melting point temperature
(T.sub.m) is preferably about 5-10.degree. C. greater than the
primer's T.sub.m, more preferably about 7.degree. C. greater.
[0165] In another embodiment, the probe has a melting point
temperature (T.sub.m) of about 65-70.degree. C., more preferably
about 65-67.degree. C. In this embodiment, the primers preferably
have a melting point temperature (T.sub.m) of about 55-65.degree.
C., more preferably about 58-63.degree. C., most preferably about
58-60.degree. C.
[0166] When selecting which strand of a double stranded target to
make the probe complementary to, it is preferred to choose the
strand where the resulting probe has more Cs than Gs. This
requirement is based on the observation that a probe with more Cs
than Gs yields probes which perform better in the 5' nuclease
assay, as illustrated in the result shown in FIG. 7.
[0167] The probe sequence should not have a guanine (G) at the 5'
end. This is because a G adjacent to the fluorescer quenches the
fluorescer fluorescence somewhat even after cleavage.
[0168] IV. Primer Selection Based on Amplicon Sequence
[0169] In addition to the guidelines of Section III above for
selecting the amplicon and probe, the following additional
guidelines should preferably be followed when selecting the primer
sequences.
[0170] The primers should be selected after the probe preferences
are applied and potential probe sequences are selected. When more
than one allelic site is to be amplified by a single primer, as
illustrated in FIGS. 4A-4D, the primers are preferably chosen to
bracket the probe within the shortest possible amplicon length. The
primer sequence is preferably selected to be as close as possible
to the probes without overlapping the probes. Amplicons are
preferably less than 150 bp in length and more preferably are less
than about 100 bp in length. Short amplicons are preferred because
shorter sequences increase the probability that the PCR
amplification will work. Thus, the robustness of the PCR
amplification is most important to the generation of signal from
fluorogenic probes. Under the same reaction conditions, shorter
amplicons will amplify more efficiently than longer amplicons. The
advantage of selecting shorter amplicons is illustrated in FIGS. 6A
and 6B with regard to the finding that the use of two inner primers
provide the greatest fluorescence yield (.DELTA.R.sub.n).
[0171] As also discussed above with regard to FIGS. 6A and 6B, the
forward and reverse primers should be as close as possible to the
probe without overlapping the probe. The primers preferably have a
melting point temperature about 24.degree. C. below the annealing
temperature used in the amplification. For example, when a
preferred annealing temperature of 620 is used, the melting point
temperature of the primers is preferably about 58-60.degree. C.
[0172] The five nucleotides at the 3' end of the forward and
reverse primers should have only one or two guanines (G) or
cytosines (C).
[0173] The primers should also preferably be chosen with relatively
unstable 3' ends in order to reduce non-specific priming. Such
primers typically have no more than 2 guanines (G) and cytosines
(C) total among the last five 3' end nucleotides. Primers which are
less likely to hybridize transiently at their 3' ends are also less
likely to be non-specifically extended by DNA polymerase.
[0174] How the above guidelines are employed to select the probe
and primers to use in the fluorescence monitored amplification
reaction will now be illustrated with regard to FIGS. 8-12.
[0175] FIGS. 8A and 8B illustrate sequences for Amelogenin X [SEQ.
I.D. NO. 1] and Amelogenin Y [SEQ. I.D. NO. 2] respectively from
which an amplicon, primers and probe are to be determined FIG. 9
illustrates a comparison of a portion of Amelogenin X to a portion
of Amelogenin Y where the symbol | between the sequences indicates
that the two sequences have the same nucleotide at a particular
base position and the symbol -- between the sequences indicates
that the two sequences have a different nucleotide at the
particular base position.
[0176] FIG. 10 illustrates a portion of Amelogenin X (bases 50-750)
with the allelic site to be identified by the 5' nuclease assay
illustrated in a bold. FIG. 11 illustrates a bases 251-500 of
Amelogenin X illustrated in FIG. 10 along with its complementary
(antisense) strand. [SEQ. I.D. NO. 3]. The allelic site to be
identified by the 5' nuclease assay is indicated in bold.
[0177] A probe complementary to the allelic site of Amelogenin X to
be detected is then selected. The probe should be selected to be
complementary to either the sense or antisense strand based on
which probe has more C's than G's. The length of the probe should
be adjusted so that the probe has the desired melting point
temperature, preferably between about 65-67.degree. C. A variety of
computer programs exist for calculating the melting point
temperature of the probe. The following probe is an example of a
suitable probe for this allelic site of Amelogenin X based on this
selection process: CCAGCAACCAATGATGCCCGTT [SEQ. I.D. NO. 4].
[0178] The forward primer to be used in the assay is then selected
by searching for primers complementary to a region of Amelogenin X
which is closest to the allelic site and uninterrupted by
polymorphisms between Amelogenin X and Amelogenin Y. The reverse
primer to be used in the assay is then selected by searching for
suitable primers which are also uninterrupted by polymorphisms
between Amelogenin X and Amelogenin Y. FIG. 12 illustrates the
Amelogenin X amplicon selected by this process with the forward and
reverse promoters indicated by the arrows. The allelic site is
indicated in shadow. The striked-out sequences are sequences where
polymorphisms between Amelogenin X and Amelogenin Y are
present.
[0179] The Amelogenin Y probe is then selected to have a melting
point temperature within the same range as Amelogenin X, preferably
between about 65-67.degree. C. as stated above. The following probe
is an example of a suitable probe for this allelic site of
Amelogenin Y based on this selection process:
CCAGCAAGCACTGATGCCTGTTC [SEQ. I.D. NO. 5].
[0180] B. Conditions For Running 5' Nuclease Assay
[0181] The probe and primer design constraints outlined above
provide reproducible physicochemical parameters for the target
amplicons. Amplifications for all amplicons selected through this
process can be run under the same reaction mixture formulation and
thermocycler parameters. Table 1 provides ranges for a preferred
reaction mixture formulation as well as a specific example of a
reaction mixture formulation that is preferably used in the assay.
The reaction mixture formulations outlined in Table 1 has been
found to be stable over 90 days at 2-8.degree. C. Reagents in the
TaqMan PCR Core Reagent Kit (Part No. N8080228) and 20% Glycerol
(Part No. 402929) sold by Applied Biosystems--Perkin Elmer are
preferably used to prepare the reaction mixture.
[0182] Glycerol is used in the reaction mixture to help melt GC
base pairs. Gelatin and TWEEN 20 are used to stabilize ROX
fluorescence which otherwise decreases over time.
[0183] AMPLITAQ.TM. Gold is used as the polymerase as part of a hot
start method because AMPLITAQ.TM. Gold does not operate until
activated by incubation at 95.degree. C. By using the hot start
method, improved specificity, sensitivity and product yield is
achieved. The hot start method and its advantages are described in
Birch, et al., Nature, 381: 445-446 (1996).
[0184] AmpErase UNG.TM. is used in combination with AMPLITAQ.TM.
Gold. AmpErase UNG.TM. recognizes U in DNA and takes U out of the
amplicons, leaving a phosphate backbone. When the reaction
temperature is raised to 95.degree. C. for AMPLITAQ.TM. Gold, the
phosphate backbone where the U's have been removed falls apart.
This serves to prevent amplification of contaminating amplicons
from previous amplifications.
[0185] The relatively high (5 mM) final concentration of MgCl.sub.2
in the reaction mixture follows a strategy of requiring all generic
reagents to be present in excess for this reaction. An inherent
property of 5' nuclease assays is that for a signal to be generated
the probe must be hybridized to the extension complex during the
PCR. Using a high concentration of Mg.sup.+2 shifts the
hybridization equilibrium toward the probe being hybridized. The
result is that the probe hybridization is much more stable and the
reactions more robust and reproducible.
TABLE-US-00001 TABLE 1 2X Reaction Mix Volume Reagent (ml)*
Concentration Range glycerol 8.00 16% 14-18% 2% gelatin 2.50 0.1%
0.08-0.12% tween 20 0.01 0.02% 0.01-0.03% tris 1.0 M, pH 8.0 5.00
100 mM 50-150 mM Mg Cl2 1 M 0.50 10 mM 9-11 mM dATP 0.1 M 0.20 400
uM 350-450 uM dCTP 0.1 M 0.20 400 uM 350-450 uM deaza dGTP 10 mM
2.00 400 uM 350-450 uM dUTP 0.1 M 0.40 800 uM 700-900 uM AmpliTaq
Gold 5 U/uL 1.0 0.10 U/uL .09-.11 U/UL AmpErase UNG 1 U/uL 1.0 0.02
U/uL .01-.03 U/uL Passive Reference 30 uM 0.20 120 nM 114-126 nM
milliQ water 28.99 TOTAL 50 ml *For a 50 mL aliquot
[0186] Table 2 outlines the preferred Thermal Cycle Parameter
Settings for these amplification reactions. More than one type of
target quantitation test may be run in a 96-well plate, since all
tests share the same thermocycler parameter settings.
TABLE-US-00002 TABLE 2 TIMES AND TEMPERATURES INITIAL STEPS EACH OF
40 CYCLES HOLD HOLD MELT ANNEAL/EXTEND 2 min 10 min. 15 sec. 1 min.
@ 50.degree. C. @ 95.degree. C. @ 95.degree. C. @ 62.degree. C.
[0187] C. Optimization of Primer and Probe Concentrations
[0188] Only primer and probe concentration optimizations are
required for tests run with primers, probes, reaction mixture and
thermocycler parameters as outlined here. The purpose of the primer
concentration optimizations is to obtain an effective T.sub.m that
results in optimum PCR and maximum end point values. The purpose of
the probe concentration optimizations is to reach the minimum probe
concentrations required for optimum 5' nuclease performance and
maximum fluorescent signal. After the primer and probe
concentrations have been determined, the concentration for each
primer is independently optimized to determine the minimum primer
concentration which yields maximum end point values. The
concentration for each probe is optimized for each target to
determine the minimum probe concentration that yields the best
yield and C.sub.T.
[0189] A template with the target sequence is required for the
optimization. This template may be genomic DNA or cDNA generated
from a reverse transcription reaction, or a plasmid which contains
the target sequence.
[0190] D. Determination of Primer and Probe Concentrations
[0191] In order to determine the concentrations of the probes and
primers, measure the absorbance at 260 nm of a 1:100 dilution of
each oligonucleotide in TE buffer. Then calculate the
oligonucleotide concentration in .mu.M using the method shown below
in Table 3.
TABLE-US-00003 TABLE 3 Example of an extinction coefficient
calculation for a FAM-labeled probe. Extinction Extinction
Coefficient Chromophore Coefficient Number Contribution A 15,200 1
15,200 C 7,050 6 42,300 G 12,010 5 60,050 T 8,400 6 50,400 FAM
20,958 1 20,958 TAMRA 31,980 1 31,980 TET 16,255 0 -- TOTAL -- --
220,888 Absorbance = extinction coefficient .times. path length
.times. concentration/100. In this case, 0.13 = 221,000 M.sup.-1
cm.sup.-1 .times. 0.3 cm .times. C/100, or C = 196 .mu.M.
[0192] E. Optimization of Primer Concentrations
[0193] Primer concentrations may be optimized at the 62.degree. C.
elongation temperature defined above. The forward and reverse
primers are cooptimized by running the wells defined by the
3.times.3 matrix shown in Table 4 at a 100 nM probe concentration.
A minimum of 4 replicate wells is run for each of the 9 conditions
defined by this matrix. The primer concentration ranges (50-900 nM)
in this matrix correspond to an effective T.sub.m range of
+/-2.degree. C. around the nominal T.sub.m for these primers.
[0194] Table 5 shows the matrix to use in the optimization of
primer concentrations. This matrix should be run with the reaction
mixture whose composition is described in Table 1 and the Thermal
Cycle Parameter Settings outlined in Table 2. A probe concentration
of 100 nM may be used for the primer concentration optimization
associated with this matrix. The best combination of primer
concentrations will be the one resulting in the lowest threshold
cycle (C.sub.T) and highest end point (R.sub.n) values.
TABLE-US-00004 TABLE 4 Forward Reverse Primer (nM) Primer (nM) 50
300 900 50 50/50 50/300 50/900 300 300/50 300/300 300/900 900
900/50 900/300 900/900
[0195] F. Optimization of Probe Concentrations
[0196] Probe concentrations are optimized at the 62.degree. C.
elongation temperature and optimum forward and reverse primer
concentrations defined above. When a single probe is used, its
concentration is optimized by running wells at 25 nM intervals
between 25 and 225 nM. The purpose of this optimization is to
choose the minimum probe concentration yielding the maximum
R.sub.n, and minimum C.sub.t. A minimum of 4 replicate wells are
run for each of the 9 conditions defined by this matrix. Probe
concentrations need to be shown not to be limiting. In a
quantitative application the signal-to-noise is optimized at a
maximum.
[0197] Table 5 shows the matrix to use in the optimization of probe
concentrations. This matrix should be run with the reaction mixture
from Table 1 the Thermal Cycle Parameter Settings from Table 2, and
the optimum forward and reverse primer concentrations from the
primer concentration optimization matrix.
TABLE-US-00005 TABLE 5 Allele 1 Allele 2 Probe (nM) Probe (nM) 50
150 250 50 50/50 50/150 50/250 150 150/50 150/150 150/250 250
250/50 250/150 250/250
[0198] 7. Synthesis of Allelic Probes
[0199] Oligonucleotide probes for use in the 5' nuclease assay of
the present invention can be synthesized by a number of approaches,
e.g., Ozaki et al., Nucleic Acids Research, 20: 5205-5214 (1992);
Agrawal et al., Nucleic Acids Research, 18: 5419-5423 (1990); or
the like. The oligonucleotide probes of the invention are
conveniently synthesized on an, automated DNA synthesizer, e.g., an
Applied Biosystems, Inc. (Foster City, Calif.) model 392 or 394
DNA/RNA Synthesizer, using standard chemistries, such as
phosphoramidite chemistry, e.g., disclosed in the following
references: Beaucage and lyer, Tetrahedron, 48: 2223-2311 (1992);
Molko et al., U.S. Pat. No. 4,980,460; Koster et al., U.S. Pat. No.
4,725,677; Caruthers et al., U.S. Pat. Nos. 4,415,732; 4,458,066;
and 4,973,679; and the like. Alternative chemistries, e.g.,
resulting in non-natural backbone groups, such as phosphorothioate,
phosphoramidate, and the like, may also be employed provided that
the hybridization efficiencies of the resulting oligonucleotides
and/or cleavage efficiency of the nuclease employed are not
adversely affected.
[0200] Preferably, the oligonucleotide probe is in the range of
15-60 nucleotides in length. More preferably, the oligonucleotide
probe is in the range of 18-30 nucleotides in length. The precise
sequence and length of an oligonucleotide probe of the invention
depends in part on the nature of the target oligonucleotide
sequence to which it binds. The binding location and length may be
varied to achieve appropriate annealing and melting properties for
a particular embodiment. Guidance for making such design choices
can be found in many of the above-cited references describing the
5' nuclease assays.
[0201] Preferably, the 3' terminal nucleotide of the
oligonucleotide probe is blocked or rendered incapable of extension
by a nucleic acid polymerase. Such blocking is conveniently carried
out by the attachment of a reporter or quencher molecule to the
terminal 3' carbon of the oligonucleotide probe by a linking
moiety.
[0202] 8. Selection of Fluorescer and Quencher Dyes
[0203] Preferably, the fluorescers are fluorescent organic dyes
derivatized for attachment to the terminal 3' carbon or terminal 5'
carbon of the probe via a linking moiety. Preferably, quencher
molecules are also organic dyes, which may or may not be
fluorescent, depending on the embodiment of the invention. For
example, in a preferred embodiment of the invention, the quencher
molecule is fluorescent. Generally whether the quencher molecule is
fluorescent or simply releases the transferred energy from the
fluorescer by non-radiative decay, the absorption band of the
quencher should substantially overlap the fluorescent emission band
of the fluorescer. Non-fluorescent quencher molecules that absorb
energy from excited fluorescers, but which do not release the
energy radiatively, are referred to in the application as
chromogenic molecules.
[0204] There is a great deal of practical guidance available in the
literature for selecting appropriate fluorescer-quencher pairs for
particular probes, as exemplified by the following references:
Clegg (cited above), Wu et al. (cited above); Pesce et al.,
editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971);
White et al., Fluorescence Analysis: A Practical Approach (Marcel
Dekker, New York, 1970); and the like. The literature also includes
references providing exhaustive lists of fluorescent and
chromogenic molecules and their relevant optical properties for
choosing reporter-quencher pairs, e.g., Berlman, Handbook of
Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic
Press, New York, 1971); Griffiths, Colour and Constitution of
Organic Molecules (Academic Press, New York, 1976); Bishop, editor,
Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of
Fluorescent Probes and Research Chemicals (Molecular Probes,
Eugene, 1992) Pringsheim, Fluorescence and Phosphorescence
(Interscience Publishers, New York, 1949); and the like. Further,
there is extensive guidance in the literature for derivatizing
reporter and quencher molecules for covalent attachment via common
reactive groups that can be added to an oligonucleotide, as
exemplified by the following references: Haugland (cited above);
Ullman et al., U.S. Pat. No. 3,996,345; Khanna et al., U.S. Pat.
No. 4,351,760; and the like.
[0205] Exemplary fluorescer-quencher pairs may be selected from
xanthene dyes, including fluoresceins, and rhodamine dyes. Many
suitable forms of these compounds are widely available commercially
with substituents on their phenyl moieties which can be used as the
site for bonding or as the bonding functionality for attachment to
an oligonucleotide. Several particular classes of dyes that may be
used are the energy transfer fluorescent dyes described in "ENERGY
TRANSFER DYES WITH ENHANCED FLUORESCENCE," application Ser. No.
08/726,462; "ENERGY TRANSFER DYES WITH ENHANCED FLUORESCENCE,"
application Ser. No. 08/642,330; and 4,7-dichlororhodamine dyes
described in U.S. application Ser. No. 08/672,196; entitled:
"4,7-DICHLORORHODAMINE DYES" which are incorporated herein by
reference. Another group of fluorescent compounds are the
naphthylamines, having an amino group in the alpha or beta
position. Included among such naphthylamino compounds are
1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene
sulfonate and 2-.rho.-touidinyl-6-naphthalene sulfonate. Other dyes
include 3-phenyl-7-isocyanatocoumarin, acridines, such as
9-isothiocyanatoacridine and acridine orange;
N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles, stilbenes,
pyrenes, and the like.
[0206] Preferably, fluorescer and quencher molecules are selected
from fluorescein and rhodamine dyes. These dyes and appropriate
linking methodologies for attachment to oligonucleotides are
described in many references, e.g., Khanna et al. (cited above);
Marshall, Histochemical J., 7: 299-303 (1975); Menchen et al., U.S.
Pat. No. 5,188,934; Menchen et al., European Patent Application
87310256.0; and Bergot et al., International Application
PCT/US900/05565. The latter four documents are hereby incorporated
by reference.
[0207] There are many linking moieties and methodologies for
attaching fluorescer or quencher molecules to the 5' or 3' termini
of oligonucleotides, as exemplified by the following references:
Eckstein, editor, Oligonucleotides and Analogues: A Practical
Approach (IRL Press, Oxford, 1991); Zuckerman et al., Nucleic Acids
Research, 15: 5305-5321 (1987) (3' thiol group on oligonucleotide);
Sharma et al., Nucleic Acids Research, 19: 3019 (1991) (3'
sulfhydryl); Giusti et al., PCR Methods and Applications, 2:
223-227 (1993) and Fung et al., U.S. Pat. No. 4,757,141 (5'
phosphoamino group via Aminolink.TM. II available from Applied
Biosystems, Foster City, Calif.) Stabinsky, U.S. Pat. No. 4,739,044
(3' aminoalkylphosphoryl group); Agrawal et al., Tetrahedron
Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate
linkages); Sproat et al., Nucleic Acids Research, 15: 4837 (1987)
(5' mercapto group); Nelson et al., Nucleic Acids Research, 17:
7187-7194 (1989) (3' amino group); and the like.
[0208] Preferably, commercially available linking moieties are
employed that can be attached to an oligonucleotide during
synthesis, e.g., available from Clontech Laboratories (Palo Alto,
Calif.).
[0209] Rhodamine and fluorescein dyes are also conveniently
attached to the 5' hydroxyl of an oligonucleotide at the conclusion
of solid phase synthesis by way of dyes derivatized with a
phosphoramidite moiety, e.g., Woo et al., U.S. Pat. No. 5,231,191;
and Hobbs, Jr., U.S. Pat. No. 4,997,928.
[0210] 9. Determining Fluorescence Signatures For ApoE Allelic
Controls
[0211] Apolipoprotein (apo) E plays a central role in lipoprotein
metabolism by mediating interactions between lipoproteins and
liporeceptors. Three common variants of apoE have been identified
by isoelectric focusing and have been designated E2, E3 and E4.
Genetic variation in apoE affects serum cholesterol levels,
propensity to coronary artery disease, and propensity to develop
late onset Alzheimer's disease.
[0212] The common protein variants E2, E3, and E4 are encoded by
three alleles of the apoE gene termed .epsilon.2, .epsilon.3, and
.epsilon.4. These alleles are illustrated in Table 6. As
illustrated, the apoE alleles differ by single base substitutions
in two codons, 112 and 158. Thus, genotyping of apoE requires
determination of base identity at two distinct allelic sites in the
apoE gene.
TABLE-US-00006 TABLE 6 Codon 112 Codon 158 .epsilon.2 T T
.epsilon.3 T C .epsilon.4 CGC CGC E2 Arg Arg E3 Cys Arg E4 Cys
Cys
[0213] The two allelic sites are close enough so they can be
amplified as a single apoE amplicon. However, the sites are too far
apart to be assayed by a single probe. Gel methods such as
sequencing or restriction digests of PCR products can assay both
polymorphic sites in a single reaction product, but they require
the use of labor intensive gels. The non-gel methods described to
date assay each polymorphic site separately so that two reactions
are required to determine an individuals apoE genotype.
[0214] Using the 5' nuclease assay according to the present
invention, it is possible to determine the genotype at both allelic
sites in a single reaction. This approach is much faster than
previous approaches to genotyping genes having two or more allelic
sites, such as the apoE gene.
[0215] The probes used in the 5' nuclease assay to distinguish the
various apoE alleles are:
TABLE-US-00007 Codon 112 [SEQ. ID. No. 6] CGGCCGCACACGTCCTCCp
AE112T1 [SEQ. ID. No. 7] TET-CGGCCGCGCACGTCCTCCTC-TAMRA
AE112CT2
TABLE-US-00008 Codon 158 [SEQ. ID. No. 8]
FAM-CACTGCCAGGCACTTCTGCA-TAMRA AE158TF1 [SEQ. ID. No. 9]
JOE-CACTGCCAGGCGCTTCTGCAG-TAMRA AE158CJ2
The bolded base is complementary to the polymorphic T or C at each
codon.
[0216] At codon 112, AE112T1 hybridizes to the .epsilon.2 and
.epsilon.3 alleles which each include A at codon 112. Since AE112T1
does not include a fluorescer, samples of .epsilon.2 and .epsilon.3
do not produce a signal for the 112 codon allele.
[0217] At codon 112, AE112T2 hybridizes to the .epsilon.4 allele
which include G at codon 112. Since AE112T2 includes TET as the
fluorescer, samples of .epsilon.4 produce a TET signal for the 112
codon allele.
[0218] At codon 158, AE158TF1 hybridizes to the .epsilon.2 allele
which includes
[0219] A at codon 158. Since AE158TF1 includes FAM as the
fluorescer, samples of .epsilon.2 produce a FAM signal for the 158
codon allele.
[0220] At codon 158, AE158CJ2 hybridizes to the .epsilon.3 and
.epsilon.4 alleles which include G at codon 158. Since AE158CJ2
includes JOE as the fluorescer, samples of .epsilon.3 and
.epsilon.4 produce a JOE signal for the 158 codon allele. Table 7
summarizes the fluorescence signals that would be expected for the
various apoE alleles. As can be seen from Table 7, a distinctive
spectrum can be expected for each allelic variant, thus allowing
discrimination of the alleles and detection of heterozygote
combinations.
TABLE-US-00009 TABLE 7 FAM TET JOE .epsilon.2 X .epsilon.3 X
.epsilon.4 X X
[0221] Codons 112 and 158 were amplified as part of a 273 base
amplicon using the following primers:
TABLE-US-00010 [SEQ. ID. No. 10] ApoE-F1 ACGCGGGCACGGCTGTC (forward
primer); [SEQ. ID. No. 11] ApoE-R1 GTCGCGGATGGCGCTGA (reverse
primer).
[0222] The specific reaction mixture shown in Table 1 and the
reaction conditions shown in Table 2 were used to perform the
amplification of the apoE alleles.
[0223] After amplification, the fluorescence of each reaction was
measured on an ABI Prism 7200 or 7700. The software on the
instrument uses a reference library of the pure dye spectra as well
as logic for determining the fluorescence contribution of the
different fluorophores to the spectrum by multicomponenting
analysis. Present in the reaction are the 3 fluorescers (TET, FAM,
and JOE), the quencher (TAMRA), and a passive internal reference
(ROX). Once the relative contributions of FAM, TET, JOE, and TAMRA
are determined, the ROX signal is used to normalize the other
signals by dividing the FAM, TET, JOE, and TAMRA signals by the ROX
signal. FIG. 13 illustrates the normalized relative contributions
of FAM, TET, JOE, and TAMRA to spectra derived from performing the
above-described 5' nuclease assay on apoE alleles .epsilon.2,
.epsilon.3, and .epsilon.4 and on a sample with no template (NT).
These are the fluorescence signatures for the different
alleles.
[0224] As can be seen from fluorescence signatures shown in FIG.
13, the determination of the relative contributions of FAM, TET,
JOE, and TAMRA to the fluorescence signal can result in some
seemingly illogical results which prevent the fluorescence data
from being read directly in order to determine a genotype of an
unknown. For example, the JOE signal is shown to be negative for
samples with the .epsilon.2, allele and with no template (NT).
Further, the .epsilon.3 allele has a stronger TET signal than a JOE
signal despite the fact that one would expect the .epsilon.3 allele
to only have a JOE signal. These results are due to variations in
the extinction coefficients of the different fluorescers,
competition between allelic probes, and imprecisions in the
multicomponenting analysis logic. Instead of being used to
determine genotypes directly, the normalized relative fluorescence
contributions shown in FIG. 13 are used as fluorescence signatures
which can be compared to signatures derived from unknown samples in
order to identify the genotypes of the unknown samples.
[0225] 10. Genotyping ApoE Unknowns
[0226] A plate was run containing 3 NT controls, 3 .epsilon.2
controls, 3 .epsilon.3 controls, 3 .epsilon.4 controls, and 84
unknowns samples according to the assay described in Section 9.
Each unknown reaction contained 50 ng genomic DNA from one of 84
human individuals. Reaction volume was 25 .mu.l. After performing
the 5' nuclease assay and measuring the fluorescence, normalized
fluorescence signatures were determined for the each sample. By
comparing to the NT controls to the fluorescence of the unknown
samples, three unknowns were determined to have not undergone
significant amplification. Further analysis of these samples was
discontinued.
[0227] The average of the fluorescence signatures of the series of
control samples and NT samples were used to construct a 4.times.4
matrix as shown below.
[ NT 2 3 4 ] = [ FAM n TET n JOE n TMR n ] .times. [ FAM n , NT TET
n , NT JOE n , NT TMR n , NT FAM n , 2 TET n , 2 JOE n , 2 TMR n ,
2 FAM n , 3 TET n , 3 JOE n , 3 TMR n , 3 FAM n , 4 TET n , 4 JOE n
, 4 TMR n , 4 ] - 1 ##EQU00001##
This matrix was then used to calculate NT, .epsilon.2, .epsilon.3,
and .epsilon.4 values for each unknown.
[0228] FIG. 14 illustrates a plot of allele value versus well for
the 84 genotyped samples. This plot is obtained by removing the NT
contribution to the spectra and then renormalizing the signature
without NT. This enables one to have 1, 0.5, or 0 allele values
where each allele has an allele value of 0.5. It can be seen that
the allele values cluster around 0.0, 0.5, and 1.0 as would be
expected. The most common genotype is an .epsilon.3 homozygote.
These individuals have an .epsilon.3 value of approximately 1.0 and
.epsilon.2 and .epsilon.4 values of approximately 0.
[0229] Another way of viewing the data shown in FIG. 14 is as a
scatter plot diagram of .epsilon.3 value versus .epsilon.4 value
shown in FIG. 15. Because of the normalization, any individual
which has a value of 0 for both .epsilon.3 and .epsilon.4 must be
an .epsilon.2 homozygote.
[0230] As shown in FIGS. 14 and 15, the 84 samples where found to
have the following ApoE genotypes:
TABLE-US-00011 1 .epsilon.2 homozygote 57 .epsilon.3 homozygote 3
.epsilon.4 homozygote 9 .epsilon.2/.epsilon.3 heterozygote 11
.epsilon.3/.epsilon.4 heterozygote 3 non amplification
These results demonstrate the ability of the assay to determine
apoE genotypes for a series of samples rapidly and accurately. This
assay can be used as a diagnostic tool for assessing the risk for
coronary artery disease and/or late-onset Alzheimer's disease.
[0231] While the present invention is disclosed by reference to the
preferred embodiments and examples detailed above, it is to be
understood that these examples are intended in an illustrative
rather than limiting sense, as it is contemplated that
modifications will readily occur to those skilled in the art, which
modifications will be within the spirit of the invention and the
scope of the appended claims.
Sequence CWU 1
1
* * * * *