U.S. patent application number 11/929295 was filed with the patent office on 2008-07-31 for nanoemulsion vaccines.
This patent application is currently assigned to The Regents of the University of Michigan. Invention is credited to James R. Baker, Anna Bielinska, Andrzej Myc.
Application Number | 20080181949 11/929295 |
Document ID | / |
Family ID | 28794017 |
Filed Date | 2008-07-31 |
United States Patent
Application |
20080181949 |
Kind Code |
A1 |
Baker; James R. ; et
al. |
July 31, 2008 |
Nanoemulsion Vaccines
Abstract
The present invention provides methods and compositions for the
stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens. Accordingly, in some embodiments,
the present invention provides nanoemulsion vaccines comprising a
nanoemulsion and an inactivated pathogen or protein derived from
the pathogen. The present invention thus provides improved vaccines
against a variety of environmental and human-released
pathogens.
Inventors: |
Baker; James R.; (Ann Arbor,
MI) ; Bielinska; Anna; (Ypsilanti, MI) ; Myc;
Andrzej; (Ann Arbor, MI) |
Correspondence
Address: |
Casimir Jones, S.C.
440 Science Drive, Suite 203
Madison
WI
53711
US
|
Assignee: |
The Regents of the University of
Michigan
Ann Arbor
MI
|
Family ID: |
28794017 |
Appl. No.: |
11/929295 |
Filed: |
October 30, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11403316 |
Apr 13, 2006 |
|
|
|
11929295 |
|
|
|
|
10162970 |
Jun 5, 2002 |
7314624 |
|
|
11403316 |
|
|
|
|
60296048 |
Jun 5, 2001 |
|
|
|
Current U.S.
Class: |
424/484 ;
424/204.1; 424/234.1; 424/274.1; 424/278.1 |
Current CPC
Class: |
A61P 31/04 20180101;
A61K 39/07 20130101; A61K 39/39 20130101; A61P 31/10 20180101; Y02A
50/30 20180101; A61K 2039/521 20130101; C12N 2760/16134 20130101;
A61P 31/18 20180101; A61P 31/12 20180101; Y02A 50/394 20180101;
Y02A 50/469 20180101; A61P 31/16 20180101; A61P 37/04 20180101;
A61K 9/1075 20130101; A61P 31/00 20180101; A01N 25/04 20130101;
A61P 37/00 20180101; A61K 2039/55566 20130101; Y02A 50/489
20180101; Y02A 50/403 20180101; A61K 9/0043 20130101 |
Class at
Publication: |
424/484 ;
424/278.1; 424/204.1; 424/234.1; 424/274.1 |
International
Class: |
A61K 9/14 20060101
A61K009/14; A61P 37/00 20060101 A61P037/00; A61K 39/00 20060101
A61K039/00 |
Goverment Interests
[0002] This work was supported, in part, by Defense Advanced
Research Project Agency contract #MDA 972-97-1-0007; and NIH
contract #U54 A157153-02. The government may have certain rights in
this invention.
Claims
1. A method of inducing an immune response to an immunogen,
comprising: a) providing: (i) a nanoemulsion; and (ii) an
immunogen; b) combining said emulsion with said immunogen; and c)
administering said combined emulsion and immunogen to a subject
under conditions such that said subject produces an immune response
to said immunogen.
2. The method of claim 1, wherein said immunogen is a pathogen.
3. The method of claim 2, wherein said pathogen comprises an
inactivated pathogen.
4. The method of claim 1, wherein said immunogen comprises a
pathogen product.
5. The method of claim 1, wherein said administering comprises
contacting said combined nanoemulsion and immunogen with a mucosal
surface of said subject.
6. The method of claim 1, wherein said administering comprises
intranasal administration.
7. The method of claim 1, wherein said nanoemulsion comprises an
aqueous phase, an oil phase, and a solvent.
8. The method of claim 1, wherein said immunogen is selected from
the group consisting of virus, bacteria, fungus and pathogen
products derived from said virus, bacteria, or fungus.
9. The method of claim 8, wherein said virus is selected from the
group consisting of influenza A virus, avian influenza virus, H5N1
influenza virus, West Nile virus, SARS virus, Marburg virus,
Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes
simplex virus I, herpes simplex virus II, sendai virus, sindbis
virus, vaccinia virus, parvovirus, human immunodeficiency virus,
hepatitis B virus, hepatitis C virus, hepatitis A virus,
cytomegalovirus, human papilloma virus, picornavirus, hantavirus,
junin virus, and ebola virus.
10. The method of claim 8, wherein said bacteria is selected from
the group consisting of Bacillus cereus, Bacillus circulans and
Bacillus megaterium, Bacillus anthracis, bacterial of the genus
Brucella, Vibrio cholera, Coxiella burnetii, Francisella
tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia
prowazekii, bacteria of the genus Salmonella, Cryptosporidium
parvum, Burkholderia pseudomallei, Clostridium perfringens,
Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus
aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia
coli, Salmonella typhimurium, Shigella dysenteriae, Proteus
mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia
enterocolitica, and Yersinia pseudotuberculosis.
11. The method of claim 1, wherein said immune response comprises
increased expression of IFN-.gamma. in said subject.
12. The method of claim 1, wherein said immune response comprises a
systemic IgG response to said immunogen.
13. The method of claim 1, wherein said immune response comprises a
mucosal IgA response to said immunogen.
14. The method of claim 1, wherein said immunity protects said
subject from displaying signs or symptoms of disease, wherein said
disease is selected from the group consisting of AIDS, smallpox and
anthrax.
15. A composition comprising a vaccine, said vaccine comprising a
nanoemulsion and an immunogen, wherein said vaccine is configured
to induce immunity to said immunogen in a subject.
16. The composition of claim 15, wherein said immunogen is selected
from the group consisting of virus, bacteria, fungus and pathogen
products derived from said virus, bacteria, or fungus.
17. The method of claim 16, wherein said virus is selected from the
group consisting of influenza A virus, avian influenza virus, H5N1
influenza virus, West Nile virus, SARS virus, Marburg virus,
Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes
simplex virus I, herpes simplex virus II, sendai virus, sindbis
virus, vaccinia virus, parvovirus, human immunodeficiency virus,
hepatitis B virus, hepatitis C virus, hepatitis A virus,
cytomegalovirus, human papilloma virus, picornavirus, hantavirus,
junin virus, and ebola virus.
18. The method of claim 16, wherein said bacteria is selected from
the group consisting of Bacillus cereus, Bacillus circulans and
Bacillus megaterium, Bacillus anthracis, bacterial of the genus
Brucella, Vibrio cholera, Coxiella burnetii, Francisella
tularensis, Chlamydia psittaci, Ricinus communis, Rickettsia
prowazekii, bacteria of the genus Salmonella, Cryptosporidium
parvum, Burkholderia pseudomallei, Clostridium perfringens,
Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus
aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia
coli, Salmonella typhimurium, Shigella dysenteriae, Proteus
mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia
enterocolitica, and Yersinia pseudotuberculosis.
19. A kit comprising a composition for inducing an immune response,
said composition comprising a nanoemulsion and an immunogen,
wherein said composition is configured to induce immunity to said
immunogen in a subject.
20. The kit of claim 19, further comprising instructions for using
said kit for vaccinating a subject against said immunogen.
Description
[0001] This application is a continuation-in-part of U.S. patent
application Ser. No. 10/162,970, filed Jun. 5, 2002, which claims
priority to U.S. Provisional Patent App. No. 60/296,048, filed Jun.
5, 2001.
FIELD OF THE INVENTION
[0003] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens.
BACKGROUND
[0004] Immunization is a principal feature for improving the health
of people. Despite the availability of a variety of successful
vaccines against many common illnesses, infectious diseases remain
a leading cause of health problems and death. Significant problems
inherent in existing vaccines include the need for repeated
immunizations, and the ineffectiveness of the current vaccine
delivery systems for a broad spectrum of diseases.
[0005] In order to develop vaccines against pathogens that have
been recalcitrant to vaccine development, and/or to overcome the
failings of commercially available vaccines due to expense,
complexity, and underutilization, new methods of antigen
presentation must be developed which will allow for fewer
immunizations, more efficient usage, and/or fewer side effects to
the vaccine.
SUMMARY OF THE INVENTION
[0006] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens.
[0007] Accordingly, in some embodiments, the present invention
provides a composition comprising a vaccine, the vaccine comprising
an emulsion and an immunogen, the emulsion comprising an aqueous
phase, an oil phase, and a solvent. In some embodiment, the
immunogen comprises a pathogen (e.g., an inactivated pathogen). In
other embodiments, the immunogen comprises a pathogen product
(e.g., including, but not limited to, a protein, peptide,
polypeptide, nucleic acid, polysaccharide, or a membrane component
derived from the pathogen). In some embodiments, the immunogen and
the emulsion are combined in a single vessel.
[0008] In some embodiments, the present invention provides a method
of inducing an immune response to an immunogen, comprising
providing a nanoemulsion; and an immunogen; combining the
nanoemulsion with the immunogen; and administering the combined
nanoemulsion and immunogen to a subject under conditions such that
the subject produces an immune response to the immunogen.
[0009] In some embodiments, inducing an immune response induces
immunity to the immunogen in the subject. In some embodiments,
inducing immunity to the immunogen induces immunity to a pathogen
from which the immunogen is derived. In some embodiments, immunity
comprises systemic immunity. In some embodiments, immunity
comprises mucosal immunity. In some embodiments, the immune
response comprises increased expression of IFN-.gamma. in the
subject. In some embodiments, the immune response comprises a
systemic IgG response to the immunogen. In some embodiments, the
immune response comprises a mucosal IgA response to the immunogen.
In some embodiments, the composition comprises between 15 and 75
.mu.g of a recombinant immunogen. The present invention is not
limited to this amount of immunogen. Indeed, a variety of doses of
immunogen are contemplated to be useful in the present invention.
For example, in some embodiments, it is expected that each dose
(e.g., of a composition comprising a NE and an immunogen (e.g.,
administered to a subject to induce an immune response (e.g., a
protective immune response (e.g., protective immunity))) comprises
0.05-5000 .mu.g of each immunogen (e.g., recombinant and/or
purified protein), in some embodiments, each dose will comprise
1-500 .mu.g, in some embodiments, each dose will comprise 350-750
.mu.g, in some embodiments, each dose will comprise 50-200 .mu.g,
in some embodiments, each dose will comprise 25-75 .mu.g of
immunogen (e.g., recombinant and/or purified protein). In some
embodiments, each dose comprises an amount of the immunogen
sufficient to generate an immune response. An effective amount of
the immunogen in a dose need not be quantified, as long as the
amount of immunogen generates an immune response in a subject when
administered to the subject. In some embodiments, when a
nanoemulsion of the present invention is utilized to inactivate a
live microorganism (e.g., virus (e.g., HIV)), it is expected that
each dose (e.g., administered to a subject to induce and immune
response)) comprises between 10 and 10.sup.9 pfu of the virus per
dose; in some embodiments, each dose comprises between 10.sup.5 and
10.sup.8 pfu of the virus per dose; in some embodiments, each dose
comprises between 10.sup.3 and 10.sup.5 pfu of the virus per dose;
in some embodiments, each dose comprises between 10.sup.2 and
10.sup.4 pfu of the virus per dose; in some embodiments, each dose
comprises 10 pfu of the virus per dose; in some embodiments, each
dose comprises 10.sup.2 pfu of the virus per dose; and in some
embodiments, each dose comprises 10.sup.4 pfu of the virus per
dose. In some embodiments, each dose comprises more than 10.sup.9
pfu of the virus per dose. In some preferred embodiments, each dose
comprises 10.sup.3 pfu of the virus per dose. In some embodiments,
when a NE of the present invention is utilized to inactivate a live
microorganism (e.g., a population of bacteria (e.g., of the genus
Bacillus (B. anthracis))), it is expected that each dose (e.g.,
administered to a subject to induce and immune response)) comprises
between 10 and 10.sup.10 bacteria per dose; in some embodiments,
each dose comprises between 10.sup.5 and 10.sup.8 bacteria per
dose; in some embodiments, each dose comprises between 10.sup.3 and
10.sup.5 bacteria per dose; in some embodiments, each dose
comprises between 10.sup.2 and 10.sup.4 bacteria per dose; in some
embodiments, each dose comprises 10 bacteria per dose; in some
embodiments, each dose comprises 10.sup.2 bacteria per dose; and in
some embodiments, each dose comprises 10.sup.4 bacteria per dose.
In some embodiments, each dose comprises more than 10.sup.10
bacteria per dose. In some embodiments, each dose comprises
10.sup.3 bacteria per dose. In some embodiments, the recombinant
immunogen is gp120 from HIV or protective antigen from B.
anthracis. However, the present invention is not limited to any
particular immunogen. For example, multiple immunogens may be used
in the present invention including, but not limited to, gp160,
gp41, Tat, Nef, lethal factor, edema factor, and protective antigen
degradation products. In some embodiments, the composition
comprises a 10% nanoemulsion solution. However, the present
invention is not limited to this amount of nanoemulsion solution.
Indeed, a variety of amounts of nanoemulsion may be utilized
including those disclosed herein. In some embodiments, immunity
protects the subject from displaying signs or symptoms of disease
caused by a bacterial or viral pathogen. The present invention is
not limited by the type of disease from which a subject is
protected. Indeed, a subject can be protected from a variety of
diseases including, but not limited to, AIDS, smallpox and anthrax.
In some embodiments, immunity protects the subject from challenge
with a subsequent exposure to live pathogen (e.g., HIV, vaccinia
virus, B. anthracis, etc.). In some embodiments, the composition
further comprises an adjuvant. The present invention is not limited
by the type of adjuvant used. Indeed, a variety of adjuvants may be
used in a composition of the present invention including, but not
limited to a CpG oligonucleotide, monophosphoryl lipid A, and other
adjuvants disclosed herein. In some embodiments, the subject is a
human.
[0010] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0011] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0012] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0013] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0014] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A virus,
avian influenza virus, H5N1 influenza virus, West Nile virus, SARS
virus, Marburg virus, Arenaviruses, Nipah virus, alphaviruses,
filoviruses, herpes simplex virus I, herpes simplex virus II,
sendai virus, sindbis virus, vaccinia virus, parvovirus, human
immunodeficiency virus, hepatitis B virus, hepatitis C virus,
hepatitis A virus, cytomegalovirus, human papilloma virus,
picornavirus, hantavirus, junin virus, and ebola virus. The present
invention is not limited to a particular bacteria. A variety of
bacterial immunogens are contemplated including, but not limited
to, Bacillus cereus, Bacillus circulans and Bacillus megaterium,
Bacillus anthracis, bacterial of the genus Brucella, Vibrio
cholera, Coxiella burnetii, Francisella tularensis, Chlamydia
psittaci, Ricinus communis, Rickettsia prowazekii, bacteria of the
genus Salmonella, Cryptosporidium parvum, Burkholderia
pseudomallei, Clostridium perfringens, Clostridium botulinum,
Vibrio cholerae, Streptococcus pyogenes, Streptococcus agalactiae,
Streptococcus pneumonia, Staphylococcus aureus, Neisseria
gonorrhea, Haemophilus influenzae, Escherichia coli, Salmonella
typhimurium, Shigella dysenteriae, Proteus mirabilis, Pseudomonas
aeruginosa, Yersinia pestis, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
[0015] The present invention further provides a kit comprising a
vaccine, the vaccine comprising an emulsion and an immunogen, the
emulsion comprising an aqueous phase, an oil phase, and a solvent.
In some embodiments, the kit further comprises instructions for
using the kit for vaccinating a subject against the immunogen.
[0016] In some embodiment, the immunogen comprises a pathogen
(e.g., an inactivated pathogen). In other embodiments, the
immunogen comprises a pathogen product (e.g., including, but not
limited to, a protein, peptide, polypeptide, nucleic acid,
polysaccharide, or membrane component derived from the pathogen).
In some embodiments, the immunogen and the emulsion are combined in
a single vessel.
[0017] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0018] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0019] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0020] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0021] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus
hepatitis C virus, hepatitis A virus, cytomegalovirus, and human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus. The present invention is not limited to a particular
bacteria. A variety of bacterial immunogens are contemplated
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
[0022] In still further embodiments, the present invention provides
a method of inducing immunity to an immunogen, comprising providing
an emulsion comprising an aqueous phase, an oil phase, and a
solvent; and an immunogen; combining the emulsion with the
immunogen to generate a vaccine composition; and administering the
vaccine composition to a subject. In some embodiments,
administering comprises contacting the vaccine composition with a
mucosal surface of the subject. For example, in some embodiments,
administering comprises intranasal administration. In some
preferred embodiments, the administering in under conditions such
that the subject is immune to the immunogen.
[0023] In some embodiment, the immunogen comprises a pathogen
(e.g., an inactivated pathogen). In other embodiments, the
immunogen comprises a pathogen product (e.g., including, but not
limited to, a protein, peptide, polypeptide, nucleic acid,
polysaccharide, or membrane component derived from the pathogen).
In some embodiments, the immunogen and the emulsion are combined in
a single vessel.
[0024] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0025] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0026] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0027] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0028] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus
hepatitis C virus, hepatitis A virus, cytomegalovirus, and human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus. The present invention is not limited to a particular
bacteria. A variety of bacterial immunogens are contemplated
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
[0029] In some embodiments, the present invention provides a method
of inducing an immune response to an immunogen in a subject
comprising providing a composition comprising a nanoemulsion and an
immunogen (e.g., a pathogen inactivated by a nanoemulsion of the
present invention, and/or a protein or peptide antigen derived from
a pathogen); and administering the composition to the subject under
conditions such that the subject generates an immune response to
the immunogen. The present invention is not limited by the
immunogen utilized. For example, in some embodiments, the immunogen
is a pathogen inactivated by a nanoemulsion of the present
invention or is an isolated, purified or recombinant protein or
peptide antigen, or derivative or variant thereof, derived from the
pathogen (e.g., vaccinia virus inactivated by a nanoemulsion, or, a
protein antigen (e.g., including, but not limited to, protective
antigen (PA), lethal factor (LF), edema factor (EF), and PA
degradation products from B anthracis or gp160, gp120, gp41, Tat or
Nef from HIV). The present invention is not limited by the nature
of the immune response generated. Indeed, a variety of immune
responses may be generated and measured in a subject administered a
composition comprising a nanoemulsion and an immunogen of the
present invention including, but not limited to, activation,
proliferation or differentiation of cells of the immune system
(e.g., B cells, T cells, dendritic cells, antigen presenting cells
(APCs), macrophages, natural killer (NK) cells, etc.); up-regulated
or down-regulated expression of markers and cytokines; stimulation
of IgA, IgM, or IgG titer; splenomegaly (e.g., increased spleen
cellularity); hyperplasia, mixed cellular infiltrates in various
organs, and other responses (e.g., of cells) of the immune system
that can be assessed with respect to immune stimulation known in
the art. In some embodiments, administering comprises contacting a
mucosal surface of the subject with the composition. The present
invention is not limited by the mucosal surface contacted. In some
preferred embodiments, the mucosal surface comprises nasal mucosa.
In some embodiments, the mucosal surface comprises vaginal mucosa.
In some embodiments, administrating comprises parenteral
administration. The present invention is not limited by the route
chosen for administration of a composition of the present
invention. In some embodiments, inducing an immune response induces
immunity to the pathogen (e.g., B. anthracis, vaccinia virus and/or
HIV) in the subject. In some embodiments, the immunity comprises
systemic immunity. In some embodiments, the immunity comprises
mucosal immunity. In some embodiments, the immune response
comprises increased expression of IFN-.gamma. in the subject. In
some embodiments, the immune response comprises a systemic IgG
response. In some embodiments, the immune response comprises a
mucosal IgA response. In some embodiments, the composition
comprises between 1 and 300 .mu.g of protein antigen (e.g., derived
from or a recombinant form) from the pathogen. However, the present
invention is not limited to this amount of protein antigen
administered. For example, in some embodiments, more than 300 .mu.g
of protein antigen is present in a dose administered to the
subject. In some embodiments, less than 1 .mu.g of protein antigen
is present in a dose administered to a subject. In some
embodiments, the a pathogen (e.g., a virus) inactivated by the
nanoemulsion is administered to the subject under conditions such
that between 10 and 10.sup.3 pfu of the inactivated pathogen is
present in a dose administered to the subject. However, the present
invention is not limited to this amount of pathogen administered.
For example, in some embodiments, more than 10.sup.3 pfu of the
inactivated pathogen (e.g., 10.sup.4 pfu, 10.sup.5 pfu, or more) is
present in a dose administered to the subject. In some embodiments,
the composition comprises a 10% nanoemulsion solution. However, the
present invention is not limited to this amount (e.g., percentage)
of nanoemulsion. For example, in some embodiments, a composition
comprises less than 10% nanoemulsion. In some embodiments, a
composition comprises more than 10% nanoemulsion. In some
embodiments, a composition of the present invention comprises any
of the nanoemulsions described herein. In some embodiments, the
nanoemulsion comprises W.sub.205EC. In some embodiments, the
nanoemulsion is X8P. In some embodiments, immunity protects the
subject from displaying signs or symptoms of disease caused by the
pathogen (e.g., vaccinia virus, B. anthracis or HIV). In some
embodiments, immunity protects the subject from challenge with a
subsequent exposure to live pathogen. In some embodiments, the
composition further comprises an adjuvant. The present invention is
not limited by the type of adjuvant utilized. In some embodiments,
the adjuvant is a CpG oligonucleotide. In some embodiments, the
adjuvant is monophosphoryl lipid A. A number of other adjuvants
that find use in the present invention are described herein. In
some embodiments, the subject is a human. In some embodiments, the
immunity protects the subject from displaying signs or symptoms of
a disease (e.g., the flu, AIDS, anthrax, smallpox, etc.). In some
embodiments, immunity reduces the risk of infection upon one or
more exposures to a pathogen.
[0030] The present invention also provides a composition for
stimulating an immune response comprising a nanoemulsion and an
immunogen (e.g., recombinant gp120), wherein the composition is
configured to induce immunity to the pathogen from which the
immunogen is derived in a subject. In some embodiments, the
nanoemulsion comprises any nanoemulsion described herein. In some
embodiments, the nanoemulsion comprises W.sub.205EC. In some
embodiments, the nanoemulsion comprises X8P. In some embodiments,
the composition provides a subject between 1 and 500 .mu.g of
immunogen (e.g., recombinant immunogen (e.g., gp120)) when
administered to the subject. In some embodiments, a dose of the
composition administered to a subject comprises between a 0.1% and
20% nanoemulsion solution. In some embodiments, a dose of the
composition administered to a subject comprises a 1% nanoemulsion
solution. In some embodiments, the immunogen is heat stable in the
nanoemulsion. In some embodiments, the composition is diluted prior
to administration to a subject. In some embodiments, the subject is
a human. In some embodiments, immunity is systemic immunity. In
some embodiments, immunity is mucosal immunity. In some
embodiments, the composition further comprises an adjuvant. In some
embodiments, the adjuvant comprises a CpG oligonucleotide. In some
embodiments, the adjuvant comprises monophosphoryl lipid A.
[0031] The present invention also provides a kit comprising a
composition for stimulating an immune response comprising a
nanoemulsion and an immunogen (e.g., recombinant gp120 or
protective antigen or pathogen inactivated by a nanoemulsion),
wherein the composition is configured to induce immunity to a
pathogen in a subject, and instructions for administering the
composition. In some embodiments, the kit comprises a nanoemulsion
in contact with an object (e.g., an applicator). In some
embodiments, the kit comprises a device for administering the
composition. The present invention is not limited by the type of
device included in the kit for administering the composition.
Indeed, many different devices may be included in the kit
including, but not limited to, a nasal applicator, a syringe, a
nasal inhaler and a nasal mister. In some embodiments, the kit
comprises a vaginal applicator, vaginal mister or other type of
device for vaginal administration (e.g., to the vaginal mucosa) of
a composition of the present invention. In some embodiments, a kit
comprises a birth control device (e.g., a condom, an IUD, sponge,
etc.) coated with a nanoemulsion composition of the present
invention. In some embodiments, a nanoemulsion composition of the
present invention is mixed in a douche or a suppository or a
lubricant (e.g., sexual lubricant). In some embodiments, the
present invention provides systems and methods (e.g., using a
nanoemulsion composition of the present invention) for large scale
administration (e.g., to a population of a city, village, town,
state or country). In preferred embodiments, such large scale
administrations are carried out in a manner that is easy to use
(e.g., nasal administration) and that is culturally sensitive
(e.g., so as not to offend those being administered a composition
of the present invention).
DESCRIPTION OF THE FIGURES
[0032] The following figures form part of the present specification
and are included to further demonstrate certain aspects and
embodiments of the present invention. The invention may be better
understood by reference to one or more of these figures in
combination with the description of specific embodiments presented
herein.
[0033] FIG. 1 illustrates the antibacterial properties of 1% and
10% X8P. The bactericidal effect (% killing) was calculated as:
cfu ( initial ) - cfu ( post - treatment ) cfu ( initial ) .times.
100 ##EQU00001##
[0034] FIG. 2 illustrates the antiviral properties of 10% and 1%
X8P as assessed by plaque reduction assays.
[0035] FIG. 3 illustrates several particular embodiments of the
various pathogens of the present invention.
[0036] FIG. 4 illustrates several particular embodiments of the
various emulsion compositions of the invention.
[0037] FIG. 5 schematically depicts various generalized
formulations and uses of certain embodiments of the present
invention.
[0038] FIG. 6 shows serum IgG titers two weeks after a single
intranasal treatment with certain exemplary nanoemulsion vaccines
of the present invention.
[0039] FIG. 7 shows bronchial IgA influenza titers in mice
administered two intranasal doses of certain exemplary nanoemulsion
vaccines of the present invention.
[0040] FIG. 8 shows serum IgG influenza titers in mice administered
two intranasal doses of certain exemplary nanoemulsion vaccines of
the present invention.
[0041] FIG. 9 shows the log reduction of pathogens by nanoemulsions
of the present invention. FIG. 9A shows the log reduction of E.
coli by various emulsions. FIG. 9B shows the log reduction of B.
globigii by various emulsions. FIG. 9C shows the log reduction of
influenza A by various emulsions.
[0042] FIG. 10A shows the virucidal activity of 2% nanoemulsion on
different concentrations of influenza A/AA virus. FIG. 10B shows
the time dependent virucidal activity of nanoemulsions during
incubation with influenza A/AA strain. FIG. 10C shows the detection
of viral RNA template during incubation of virus with nanoemulsion.
Compared with plaque reduction assay (FIG. 10B) RT-PCR of viral RNA
from virus/nanoemulsion formulation showed full correlation in a
time-dependant manner. Viral RNA was still present at 2 h, and was
not detectable after 3 h of incubation.
[0043] FIG. 11 shows the core body temperature of animals
vaccinated with different vaccines and 20 days later challenged
with lethal dose of influenza A Ann Arbor strain virus. *--N=3; two
animals died before day 5.
[0044] FIG. 12 shows survival curves of animals treated with
different vaccines intranasally and challenged with lethal dose of
influenza A Ann Arbor strain virus.
[0045] FIG. 13 shows that intranasal treatment of animals with
virus/nanoemulsion mixture induced high levels of anti-influenza A,
Ann Arbor strain IgG antibodies in serum. *--p<0.05
(nanoemulsion alone vs. virus/nanoemulsion, day 20);**--p<0.01
(virus/nanoemulsion, day 20 vs. day 35).
[0046] FIG. 14 shows the detection of influenza A virus RNA in
virus/emulsion vaccinated animals. RT-PCR showed the presence of
viral template until day 6 after treatment which was not detectable
on day 7 and thereafter (FIG. 14a). Signal generated from total
lung RNA during the first 6 days after treatment was equal to 1 and
not greater than 10 pfu of virus (FIG. 14b).
[0047] FIG. 15 shows early cytokine responses in splenocytes and
serum of mice 72 hours after treatment with influenza A 100
pfu/mouse, formalin-killed virus 5.times.10.sup.5 pfu, virus
(5.times.10.sup.5 pfu)/2% nanoemulsion mixture, nanoemulsion alone.
FIG. 15A shows IFN-.gamma. levels. FIG. 15B shows TNF-.alpha.
levels. FIG. 15C shows IL-12 p40 levels. FIG. 15D shows IL-4
levels. FIG. 15E shows IL-2 levels. FIG. 15F shows IL-10 levels.
FIG. 15G shows IFN-.gamma. levels on day 20 after treatment.
[0048] FIG. 16 shows stimulation indices of splenocytes harvested
on day 20 and 35 of experiment from mice treated with
virus/nanoemulsion.
[0049] FIG. 17 shows antigen-specific activation of cytokine
production by splenocytes harvested from mice after treatment with
virus/nanoemulsion preparation. Splenocytes were harvested from
animals on two occasions: on day 20 (before challenge) and day 35
(after challenge) of experiment. FIG. 17A shows IFN-.gamma. levels.
FIG. 17bB shows IK-2 levels. FIG. 17C shows IL-4 levels.
[0050] FIG. 18 shows the percentage of T (CD3 positive cells) and
cytotoxic cells (CD8 positive cells) in splenocytes. Percentage was
calculated as follows: T-cells (%)=(CD3 cells/(CD3+CD19
cells))*100; CD8 cells (%)=(CD8 cells/(CD8+CD4 cells))*100. p-value
described the significance between the percentage of T-cells before
and after the challenge.
[0051] FIG. 19 shows survival curves of animals treated with
different preparations intranasally and challenged with lethal dose
of influenza A virus either Ann Arbor or Puerto Rico strain.
[0052] FIG. 20 shows the expansion of the influenza epitope
recognition of immunized mice before (FIG. 20A) and after (FIG.
20B) challenge with live virus.
[0053] FIG. 21 shows that administration of X8P nanoemulsion with
gp120 resulted in an increased immune response when the gp120 was
administered intranasally.
[0054] FIG. 22 shows that administration of X8P nanoemulsion with
gp120 resulted in an increased immune response when the gp120 was
administered intramuscularly.
[0055] FIG. 23 shows development of anti-VV IgG responses after
intranasal vaccination with nanoemulsion-killed vaccines. Mice were
immunized intranasaly with primary vaccination, and boosted twice
at 5 and 9 weeks. Arrows indicate vaccine administrations. The
insert shows a comparison of serum anti-VV IgG at 12 weeks after 1
and 3 vaccinations.
[0056] FIG. 24 shows that intranasal immunization with a
composition comprising nanoemulsion(NE)-inactivated VV induces high
level of anti-VV IgA in mucosal secretions. Secretory IgA antibody
toward whole virus was measured in bronchial fluids obtained from
vaccinated animals at the conclusion of the experiment (T=16
weeks).
[0057] FIG. 25 shows neutralization of VV by sera and bronchial
secretions from vaccinated mice. (A) NT.sub.50 of neutralizing
antibodies in serum was performed using standard PRA and luciferase
inhibition assays. Results from assays were normalized and
presented as NT.sub.50 of the viral plaque reduction. Neutralizing
titer 50 "NT.sub.50o" is the serum dilution which kills 50% of
virus. (B) Neutralizing activity in bronchoalveolar lavage (BAL)
was detected using luciferase inhibition assays with individual and
pooled BAL fluids collected at the conclusion of experiment (T=16
weeks). Results were normalized and presented as NT.sub.50 of the
viral plaque reduction.
[0058] FIG. 26 shows vaccinia-specific splenocyte activation in
vitro. Individual cultures of mouse splenocytes obtained 7 weeks
after vaccination were stimulated with 10.sup.3 and 10.sup.4 pfu of
VV.
[0059] FIG. 27 shows in vitro and in vivo evaluation of complete
virus inactivation in nanoemulsion vaccine. (A) PCR analysis
revealed the absence of viral DNA in mice vaccinated with various
preparations of vaccine. Upper panel: Lane 1: DNA size marker; lane
2: no DNA ctrl; lane 3: no Taq 1 ctrl, lanes: 4, 5, 6, 7,--DNA from
lung of mice vaccinated with 10.sup.5/Fk/NE; lanes 8, 9, 10--DNA
from lung of mice vaccinated with 10.sup.5 NE, lane 11: VV-template
DNA. Arrows indicate amplified viral template, and primers. (B)
Bioluminescence imaging of mice infected intranasally with two
doses of live Vaccinia (1.times.10.sup.6 and 1.times.10.sup.5 pfu)
and with 1.times.10.sup.5/NE vaccine (1.times.10.sup.5 pfu of
nanoemulsion killed virus).
[0060] FIG. 28 shows intranasal challenge with live vaccine virus.
(A) Mice vaccinated with nanoemulsion-killed VV are protected
against challenge with 10.times.LD.sub.50 of infectious virus. (B).
The bioluminescence image of Balb/c mice challenged with
VAC.sub.WR-Luc. (C) Virus replication. Photon flux analysis in
heads and chests of vaccinated mice indicates self-limiting
replication.
[0061] FIG. 29 shows that administration of VV/NE vaccine produces
anti-VV IgG antibodies recognizing "native" viral epitopes.
[0062] FIG. 30 shows live virus challenge (10.times.LD.sub.50) of
Balb/c mice intranasally vaccinated with VV/NE, VV/Fk/NE and VV/Fk
vaccines.
[0063] FIG. 31 shows characterization of the nanoemulsion and rPA
formulation. Panel A: A number-weighted size distribution of 0.5%
NE analyzed by the dynamic light scattering (DLS). Panels B and C:
Photomicrographs of nanoemulsion alone (B) and after incubation
with 50 .mu.g/ml rPA for 1 hr at RT (C).
[0064] FIG. 32 shows that (A) mixing with NE prevents rapid
degradation of rPA protein compared to saline and (B) that
nanoemulsion droplets are stable when mixed with rPA. (A) PAGE
analysis of rPA antigen. 0.5 .mu.g of rPA protein incubated in
saline or 1% NE for 30 min at RT and analyzed using non-denaturing
10% gel. (B) Microphotographs of a 1% NE and rPA/1% NE mixture
showing the short term stability of rPA protein/NE mixture.
[0065] FIG. 33 shows time course of anti-PA IgG antibody induction
in serum. Panels A and B show the results of immunization with
vaccines containing 30 .mu.g of rPA (A) and 2.5 .mu.g of rPA (B).
Immunization with: PA/NE (filled circle), PA/NE/CpG (filled
square), PA alone (filled triangle) and PA/CpG (filled diamond).
Arrows indicate dates of immunization. The ELISA results are
presented as median absorbance values obtained with serum at
2.times.10.sup.2 dilutions. (*) indicates statistical difference
between anti-PA IgG levels in mice immunized with PA/NE/CpG vs.
PA/NE.
[0066] FIG. 34 shows final titer of anti-PA IgG in serum. Panels A
and B show the results of immunization with 30 .mu.g rPA (A) and
2.5 .mu.g rPA (B). The results are expressed as the mean log.sub.10
of end point antibody titer +/-SEM.
[0067] FIG. 35 shows the pattern of anti-PA IgG distribution in
mice immunized intranasally with various vaccine formulations. Mice
immunized with 30 .mu.g rPA are shown in Panel A and those with 2.5
.mu.g rPA are shown in Panel B. The results are expressed as the
mean log.sub.10 of end point antibody titer. Number of animals per
group in Panel A is identified in parentheses; in Panel B each
group is representative of 5 mice.
[0068] FIG. 36 shows anti-PA IgA (panel A) and IgG (panel B)
antibodies in bronchial lavage from mice after six immunizations
with 30 .mu.g PA and NE adjuvant. The levels of secretory anti-PA
IgA and anti-PA IgG antibodies in BAL are expressed as the mean
+/-SEM of a specific absorbance obtained in ELISA using diluted BAL
samples. Panel C: Western blot detection of anti-PA IgA in serum.
One thousand fold serum sample dilutions were used for Western
blots. Bar indicates anti-PA IgA binding to rPA.
[0069] FIG. 37 shows anti-PA IgG subclass antibodies in serum after
mucosal immunization. Mice were immunized with 30 .mu.g rPA in
various vaccine formulations. The results are presented as the mean
+/-SEM of Ab concentrations.
[0070] FIG. 38 shows that (A) neutralizing anti-PA Abs are present
in the serum of mice immunized with rPA and nanoemulsion adjuvant;
(B) lethal toxin neutralization by serum antibody titer generated
via nasal vaccination with rPA/NE; and (C) rPA/NE vaccinated
animals survive lethal challenge with 1000.times.LD.sub.50 of B.
anthracis Ames spores. (A) Pooled serum from mice vaccinated with
PA/NE/CpG was serially diluted and incubated with rPA. Each sample
was added to CHO-K1 cells and binding of rPA with the cell receptor
was analyzed by flow cytometry. The results represent the
percentage of the neutralized rPA, calculated from the binding
curve of free rPA with cell receptor. The control represents rPA
binding without addition of anti-PA serum. (B) Lethal toxin
cytotoxicity and neutralizing antibodies assay. (C) All immunized
guinea pigs survive lethal challenge with 1000.times.LD.sub.50 of
B. anthracis Ames spores six months after immunization with rPA/NE
vaccine.
[0071] FIG. 39 shows rPA-specific induction of splenocyte
proliferation in vitro. Splenocytes isolated from immunized animals
were stimulated with rPA (5 .mu.g/ml) for 72 hr. Values of
proliferation indexes were calculated as a ratio of the mean
absorbance in rPA-stimulated cells by the mean absorbance in the
resting splenocytes. (*) indicates no statistical difference
between these groups.
[0072] FIG. 40 shows antigen specific cytokine expression in
animals immunized with PA/NE and PA/NE/CpG. PA-stimulated cytokine
responses in splenocytes in vitro. Th1-type cytokines IFN-.gamma.
(A), IL-2 (B), TNF-.alpha. (C) and the Th2-type cytokine IL-4 (D)
production was evaluated by specific ELISA in culture supernatant
from control (resting, dotted columns) and rPA stimulated (filled
columns) cells. The results are expressed as the mean +/-SEM. (*)
indicates statistically significant differences in cytokine
concentrations between resting and stimulated cells (p
value<0.05).
[0073] FIG. 41 shows the effect of TWEEN derivatives on anti-PA IgG
immunogenicity kinetes.
[0074] FIG. 42 shows anti-PA IgG titer distribution after a single
vaccination dose.
[0075] FIG. 43 shows the kinetics of anti-PA IgG development after
intranasal immunization with rPA/NE vaccine.
[0076] FIG. 44 shows induction of (A) anti-gp120Bal IgG and (B)
anti-gp120SF 162 IgG in mice immunized with gp120BaL and gp120SF
162, respectively.
[0077] FIG. 45 shows cross-reactivity of (A) anti-gp120BaL; and (B)
anti-gp120SF162 antibodies from mice after intranasal
administration of either (A) gp120BaL-X8P; or (B)
gp120SF162-W205EC.
[0078] FIG. 46 shows secretory anti-gp120 IgA (A) in bronchial
lavage (BAL); and (B) in vaginal washes of mice nasally
administered gp120BaL and NE adjuvant (X8P).
[0079] FIG. 47 shows antigen-specific splenocyte proliferation
following intranasal administration with gp120BaL in nanoemulsion.
IFN-g secretion of activated splenocytes is shown in (A).
Splenocyte proliferation is shown in (B).
[0080] FIG. 48 shows anti-gp120 IgG from a guinea pig mucosal
immunization model.
[0081] FIG. 49 shows neutralization of HIV Virus in terms of ID50
values.
GENERAL DESCRIPTION OF THE INVENTION
[0082] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods of inducing an immune response against a
pathogen (e.g., vaccinia virus, H5N1 influenza virus, Bacillus
anthracis, HIV, etc.) in a subject (e.g., a human subject) and
compositions useful in such methods (e.g., a nanoemulsion
comprising a pathogen inactivated by the nanoemulsion, or an
immunogenic portion thereof). Compositions and methods of the
present invention find use in, among other things, clinical (e.g.
therapeutic and preventative medicine (e.g., vaccination)) and
research applications. In some embodiments, the pathogen is mixed
with the nanoemulsion prior to administration for a time period
sufficient to inactivate the pathogen. In others, protein
components (e.g., isolated or purified protein, or recombinant
protein) from a pathogen are mixed with the nanoemulsion.
[0083] Although an understanding of the mechanism is not necessary
to practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
NE treatment (e.g., neutralization of a pathogen) with a NE of the
present invention) preserves important antigenic epitopes (e.g.,
recognizable by a subject's immune system), stabilizing their
hydrophobic and hydrophilic components in the oil and water
interface of the emulsion (e.g., thereby providing one or more
immunogens (e.g., stabilized antigens) against which a subject can
mount an immune response). In other embodiments, because NE
formulations are known to penetrate the mucosa through pores, they
may carry immunogens to the submucosal location of dendritic cells
(e.g., thereby initiating and/or stimulating an immune response).
Although an understanding of the mechanism is not necessary to
practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
combining a NE and an immunogenic protein (e.g., rPA from B.
anthracis, or gp120 from HIV, etc.) stabilizes the immunogen and
provides a proper immunogenic material for generation of an immune
response.
[0084] Dendritic cells avidly phagocytose NE oil droplets and this
could provide a means to internalize immunogens (e.g., antigenic
proteins or peptide fragments thereof) for antigen presentation.
While other vaccines rely on inflammatory toxins or other immune
stimuli for adjuvant activity (See, e.g., Holmgren and Czerkinsky,
Nature Med. 2005, 11; 45-53), NEs have not been shown to be
inflammatory when placed on the skin or mucous membranes in studies
on animals and in humans. Thus, although an understanding of the
mechanism is not necessary to practice the present invention and
the present invention is not limited to any particular mechanism of
action, in some embodiments, a composition comprising a NE of the
present invention (e.g., a composition comprising NE and an
immunogen (e.g., a NE inactivated pathogen (e.g., a virus (e.g.,
VV))) may act as a "physical" adjuvant (e.g., that transports
and/or presents immunogens (e.g., Vaccina proteins) to the immune
system. In some preferred embodiments, mucosal administration of a
composition of the present invention generates mucosal (e.g., signs
of mucosal immunity (e.g., generation of IgA antibody titers) as
well as systemic immunity.
[0085] Both cellular and humoral immunity play a role in protection
against multiple pathogens and both can be induced with the NE
formulations of the present invention. For example,
vaccinia-specific antibody titers are considered important for the
estimate of protective immunity in human subjects and in animal
models of vaccination (See, e.g., Hammarlund et al, Nat. Med. 2003,
9; 1131-1137). Several studies have identified proteins important
for the elicitation of neutralizing antibodies (See, e.g., Galmiche
et al, Virology, 1999, 254; 71-80; Hooper et al, Virology, 2003,
306; 181-195). A recent trial of dilutions of the licensed smallpox
vaccine (Dryvax) in human volunteers, confirmed that pustule
formation strongly correlated with development of both specific
antibodies and induction of cytotoxic T lymphocytes (CTL) and
elevated INF-.gamma. T cell responses (See, e.g., Greenberg et al,
2005, 365; 398-409). Induction of IFN-.gamma. is suggestive of
activation of specific MHC class I-restricted CD8+ T cells. These
types of cells have been implicated in the recognition and
clearance of Vaccinia infected cells, and for maintenance of
immunity after vaccination (See, e.g., Earl et al, Nature, 2004;
482; 182-185; Hammarlund et al, Nat. Med. 2003, 9; 1131-1137;
Edghill-Smith et all, Nature Med. 2005, 11; 740-747).
[0086] Thus, in some embodiments, administration (e.g., mucosal
administration) of a composition of the present invention (e.g.,
NE-killed orthopox virus (e.g., VV)) to a subject results in the
induction of both humoral (e.g., development of specific
antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune
responses (e.g., against the orthopox virus). In some preferred
embodiments, a composition of the present invention (e.g.,
NE-killed orthopox virus (e.g., VV) or a NE and one or more
immunogens) is used as a vaccine (e.g., a smallpox vaccine, an
anthrax vaccine, an influenza vaccine, etc.).
[0087] Furthermore, in some embodiments, a composition of the
present invention (e.g., a composition comprising a NE and an
immunogen) induces (e.g., when administered to a subject) both
systemic and mucosal immunity. Thus, in some preferred embodiments,
administration of a composition of the present invention to a
subject results in protection against an exposure (e.g., a lethal
mucosal exposure) to a pathogen (e.g., a virus (e.g., an orthopox
virus (e.g., VV))). Although an understanding of the mechanism is
not necessary to practice the present invention and the present
invention is not limited to any particular mechanism of action,
mucosal administration (e.g., vaccination) provides protection
against pathogen infection (e.g., that initiates at a mucosal
surface). Although it has heretofore proven difficult to stimulate
secretory IgA responses and protection against pathogens that
invade at mucosal surfaces (See, e.g., Mestecky et al, Mucosal
Immunology. 3ed edn. (Academic Press, San Diego, 2005)), the
present invention provides compositions and methods for stimulating
mucosal immunity (e.g., a protective IgA response) from a pathogen
in a subject.
[0088] In some embodiments, the present invention provides a
composition (e.g., comprising a NE and an immunogen) to serve as a
mucosal vaccine. This material can easily be produced from purified
virus and/or protein or recombinant protein and induces both
mucosal and systemic immunity. The ability to produce this
formulation rapidly and administer it via mucosal instillation
provides a vaccine that can be used for general vaccination needs
as well as in large-scale outbreaks or emergent situations.
DEFINITIONS
[0089] To facilitate an understanding of the present invention, a
number of terms and phrases are defined below:
[0090] As used herein, the term "microorganism" refers to any
species or type of microorganism, including but not limited to,
bacteria, viruses, archaea, fungi, protozoans, mycoplasma, prions,
and parasitic organisms. The term microorganism encompasses both
those organisms that are in and of themselves pathogenic to another
organism (e.g., animals, including humans, and plants) and those
organisms that produce agents that are pathogenic to another
organism, while the organism itself is not directly pathogenic or
infective to the other organism.
[0091] As used herein the term "pathogen," and grammatical
equivalents, refers to an organism (e.g., biological agent),
including microorganisms, that causes a disease state (e.g.,
infection, pathologic condition, disease, etc.) in another organism
(e.g., animals and plants) by directly infecting the other
organism, or by producing agents that causes disease in another
organism (e.g., bacteria that produce pathogenic toxins and the
like). "Pathogens" include, but are not limited to, viruses,
bacteria, archaea, fungi, protozoans, mycoplasma, prions, and
parasitic organisms.
[0092] The terms "bacteria" and "bacterium" refer to all
prokaryotic organisms, including those within all of the phyla in
the Kingdom Procaryotae. It is intended that the term encompass all
microorganisms considered to be bacteria including Mycoplasma,
Chlamydia, Actinomyces, Streptomyces, and Rickettsia. All forms of
bacteria are included within this definition including cocci,
bacilli, spirochetes, spheroplasts, protoplasts, etc.
[0093] As used herein, the term "fungi" is used in reference to
eukaryotic organisms such as molds and yeasts, including dimorphic
fungi.
[0094] As used herein the terms "disease" and "pathologic
condition" are used interchangeably, unless indicated otherwise
herein, to describe a deviation from the condition regarded as
normal or average for members of a species or group (e.g., humans),
and which is detrimental to an affected individual under conditions
that are not inimical to the majority of individuals of that
species or group. Such a deviation can manifest as a state, signs,
and/or symptoms (e.g., diarrhea, nausea, fever, pain, blisters,
boils, rash, immune suppression, inflammation, etc.) that are
associated with any impairment of the normal state of a subject or
of any of its organs or tissues that interrupts or modifies the
performance of normal functions. A disease or pathological
condition may be caused by or result from contact with a
microorganism (e.g., a pathogen or other infective agent (e.g., a
virus or bacteria)), may be responsive to environmental factors
(e.g., malnutrition, industrial hazards, and/or climate), may be
responsive to an inherent defect of the organism (e.g., genetic
anomalies) or to combinations of these and other factors.
[0095] The terms "host" or "subject," as used herein, refer to an
individual to be treated by (e.g., administered) the compositions
and methods of the present invention. Subjects include, but are not
limited to, mammals (e.g., murines, simians, equines, bovines,
porcines, canines, felines, and the like), and most preferably
includes humans. In the context of the invention, the term
"subject" generally refers to an individual who will be
administered or who has been administered one or more compositions
of the present invention (e.g., a composition for inducing an
immune response).
[0096] As used herein, the terms "inactivating," "inactivation" and
grammatical equivalents, when used in reference to a microorganism
(e.g., a pathogen (e.g., a bacterium or a virus)), refer to the
killing, elimination, neutralization and/or reducing of the
capacity of the microorganism (e.g., a pathogen (e.g., a bacterium
or a virus)) to infect and/or cause a pathological response and/or
disease in a host. For example, in some embodiments, the present
invention provides a composition comprising nanoemulsion
(NE)-inactivated vaccinia virus (VV). Accordingly, as referred to
herein, compositions comprising "NE-inactivated VV," "NE-killed V,"
NE-neutralized V" or grammatical equivalents refer to compositions
that, when administered to a subject, are characterized by the
absence of, or significantly reduced presence of, VV replication
(e.g., over a period of time (e.g., over a period of days, weeks,
months, or longer)) within the host.
[0097] As used herein, the term "fusigenic" is intended to refer to
an emulsion that is capable of fusing with the membrane of a
microbial agent (e.g., a bacterium or bacterial spore). Specific
examples of fusigenic emulsions are described herein.
[0098] As used herein, the term "lysogenic" refers to an emulsion
(e.g., a nanoemulsion) that is capable of disrupting the membrane
of a microbial agent (e.g., a virus (e.g., viral envelope) or a
bacterium or bacterial spore). In preferred embodiments of the
present invention, the presence of a lysogenic and a fusigenic
agent in the same composition produces an enhanced inactivating
effect compared to either agent alone. Methods and compositions
(e.g., for inducing an immune response (e.g., used as a vaccine)
using this improved antimicrobial composition are described in
detail herein.
[0099] The term "emulsion," as used herein, includes classic
oil-in-water or water in oil dispersions or droplets, as well as
other lipid structures that can form as a result of hydrophobic
forces that drive apolar residues (e.g., long hydrocarbon chains)
away from water and drive polar head groups toward water, when a
water immiscible oily phase is mixed with an aqueous phase. These
other lipid structures include, but are not limited to,
unilamellar, paucilamellar, and multilamellar lipid vesicles,
micelles, and lamellar phases. Similarly, the term "nanoemulsion,"
as used herein, refers to oil-in-water dispersions comprising small
lipid structures. For example, in preferred embodiments, the
nanoemulsions comprise an oil phase having droplets with a mean
particle size of approximately 0.1 to 5 microns (e.g., 150+/-25 nm
in diameter), although smaller and larger particle sizes are
contemplated. The terms "emulsion" and "nanoemulsion" are often
used herein, interchangeably, to refer to the nanoemulsions of the
present invention.
[0100] As used herein, the terms "contact," "contacted," "expose,"
and "exposed," when used in reference to a nanoemulsion and a live
microorganism, refer to bringing one or more nanoemulsions into
contact with a microorganism (e.g., a pathogen) such that the
nanoemulsion inactivates the microorganism or pathogenic agent, if
present. The present invention is not limited by the amount or type
of nanoemulsion used for microorganism inactivation. A variety of
nanoemulsion that find use in the present invention are described
herein and elsewhere (e.g., nanoemulsions described in U.S. Pat.
Apps. 20020045667 and 20040043041, and U.S. Pat. Nos. 6,015,832,
6,506,803, 6,635,676, and 6,559,189, each of which is incorporated
herein by reference in its entirety for all purposes). Ratios and
amounts of nanoemulsion (e.g., sufficient for inactivating the
microorganism (e.g., virus inactivation)) and microorganisms (e.g.,
sufficient to provide an antigenic composition (e.g., a composition
capable of inducing an immune response)) are contemplated in the
present invention including, but not limited to, those described
herein.
[0101] The term "surfactant" refers to any molecule having both a
polar head group, which energetically prefers solvation by water,
and a hydrophobic tail that is not well solvated by water. The term
"cationic surfactant" refers to a surfactant with a cationic head
group. The term "anionic surfactant" refers to a surfactant with an
anionic head group.
[0102] The terms "Hydrophile-Lipophile Balance Index Number" and
"HLB Index Number" refer to an index for correlating the chemical
structure of surfactant molecules with their surface activity. The
HLB Index Number may be calculated by a variety of empirical
formulas as described, for example, by Meyers, (See, e.g., Meyers,
Surfactant Science and Technology, VCH Publishers Inc., New York,
pp. 231-245 (1992)), incorporated herein by reference. As used
herein where appropriate, the HLB Index Number of a surfactant is
the HLB Index Number assigned to that surfactant in McCutcheon's
Volume 1: Emulsifiers and Detergents North American Edition, 1996
(incorporated herein by reference). The HLB Index Number ranges
from 0 to about 70 or more for commercial surfactants. Hydrophilic
surfactants with high solubility in water and solubilizing
properties are at the high end of the scale, while surfactants with
low solubility in water that are good solubilizers of water in oils
are at the low end of the scale.
[0103] As used herein the term "interaction enhancers" refers to
compounds that act to enhance the interaction of an emulsion with a
microorganism (e.g., with a cell wall of a bacteria (e.g., a Gram
negative bacteria) or with a viral envelope (e.g., Vaccinia virus
envelope)). Contemplated interaction enhancers include, but are not
limited to, chelating agents (e.g., ethylenediaminetetraacetic acid
(EDTA), ethylenebis(oxyethylenenitrilo)tetraacetic acid (EGTA), and
the like) and certain biological agents (e.g., bovine serum albumin
(BSA) and the like).
[0104] The terms "buffer" or "buffering agents" refer to materials,
that when added to a solution, cause the solution to resist changes
in pH.
[0105] The terms "reducing agent" and "electron donor" refer to a
material that donates electrons to a second material to reduce the
oxidation state of one or more of the second material's atoms.
[0106] The term "monovalent salt" refers to any salt in which the
metal (e.g., Na, K, or Li) has a net 1+ charge in solution (i.e.,
one more proton than electron).
[0107] The term "divalent salt" refers to any salt in which a metal
(e.g., Mg, Ca, or Sr) has a net 2+ charge in solution.
[0108] The terms "chelator" or "chelating agent" refer to any
materials having more than one atom with a lone pair of electrons
that are available to bond to a metal ion.
[0109] The term "solution" refers to an aqueous or non-aqueous
mixture.
[0110] As used herein, the term "a composition for inducing an
immune response" refers to a composition that, once administered to
a subject (e.g., once, twice, three times or more (e.g., separated
by weeks, months or years)), stimulates, generates and/or elicits
an immune response in the subject (e.g., resulting in total or
partial immunity to a microorganism (e.g., pathogen) capable of
causing disease). In preferred embodiments of the invention, the
composition comprises a nanoemulsion and an immunogen. In further
preferred embodiments, the composition comprising a nanoemulsion
and an immunogen comprises one or more other compounds or agents
including, but not limited to, therapeutic agents, physiologically
tolerable liquids, gels, carriers, diluents, adjuvants, excipients,
salicylates, steroids, immunosuppressants, immunostimulants,
antibodies, cytokines, antibiotics, binders, fillers,
preservatives, stabilizing agents, emulsifiers, and/or buffers. An
immune response may be an innate (e.g., a non-specific) immune
response or a learned (e.g., acquired) immune response (e.g. that
decreases the infectivity, morbidity, or onset of mortality in a
subject (e.g., caused by exposure to a pathogenic microorganism) or
that prevents infectivity, morbidity, or onset of mortality in a
subject (e.g., caused by exposure to a pathogenic microorganism)).
Thus, in some preferred embodiments, a composition comprising a
nanoemulsion and an immunogen is administered to a subject as a
vaccine (e.g., to prevent or attenuate a disease (e.g., by
providing to the subject total or partial immunity against the
disease or the total or partial attenuation (e.g., suppression) of
a sign, symptom or condition of the disease.
[0111] As used herein, the term "adjuvant" refers to any substance
that can stimulate an immune response (e.g., a mucosal immune
response). Some adjuvants can cause activation of a cell of the
immune system (e.g., an adjuvant can cause an immune cell to
produce and secrete a cytokine). Examples of adjuvants that can
cause activation of a cell of the immune system include, but are
not limited to, saponins purified from the bark of the Q. saponaria
tree, such as QS21 (a glycolipid that elutes in the 21.sup.st peak
with HPLC fractionation; Aquila Biopharmaceuticals, Inc.,
Worcester, Mass.); poly(di(carboxylatophenoxy)phosphazene (PCPP
polymer; Virus Research Institute, USA); derivatives of
lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi
ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide
(MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a
glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin,
Switzerland); and Leishmania elongation factor (a purified
Leishmania protein; Corixa Corporation, Seattle, Wash.).
Traditional adjuvants are well known in the art and include, for
example, aluminum phosphate or hydroxide salts ("alum"). In some
embodiments, compositions of the present invention (e.g.,
comprising HIV or an immunogenic epitope thereof (e.g., gp120)) are
administered with one or more adjuvants (e.g., to skew the immune
response towards a Th1 or Th2 type response).
[0112] As used herein, the term "an amount effective to induce an
immune response" (e.g., of a composition for inducing an immune
response), refers to the dosage level required (e.g., when
administered to a subject) to stimulate, generate and/or elicit an
immune response in the subject. An effective amount can be
administered in one or more administrations (e.g., via the same or
different route), applications or dosages and is not intended to be
limited to a particular formulation or administration route.
[0113] As used herein, the term "under conditions such that said
subject generates an immune response" refers to any qualitative or
quantitative induction, generation, and/or stimulation of an immune
response (e.g., innate or acquired).
[0114] A used herein, the term "immune response" refers to a
response by the immune system of a subject. For example, immune
responses include, but are not limited to, a detectable alteration
(e.g., increase) in Toll receptor activation, lymphokine (e.g.,
cytokine (e.g., Th1 or Th2 type cytokines) or chemokine) expression
and/or secretion, macrophage activation, dendritic cell activation,
T cell activation (e.g., CD4+ or CD8+ T cells), NK cell activation,
and/or B cell activation (e.g., antibody generation and/or
secretion). Additional examples of immune responses include binding
of an immunogen (e.g., antigen (e.g., immunogenic polypeptide)) to
an MHC molecule and inducing a cytotoxic T lymphocyte ("CTL")
response, inducing a B cell response (e.g., antibody production),
and/or T-helper lymphocyte response, and/or a delayed type
hypersensitivity (DTH) response against the antigen from which the
immunogenic polypeptide is derived, expansion (e.g., growth of a
population of cells) of cells of the immune system (e.g., T cells,
B cells (e.g., of any stage of development (e.g., plasma cells),
and increased processing and presentation of antigen by antigen
presenting cells. An immune response may be to immunogens that the
subject's immune system recognizes as foreign (e.g., non-self
antigens from microorganisms (e.g., pathogens), or self-antigens
recognized as foreign). Thus, it is to be understood that, as used
herein, "immune response" refers to any type of immune response,
including, but not limited to, innate immune responses (e.g.,
activation of Toll receptor signaling cascade) cell-mediated immune
responses (e.g., responses mediated by T cells (e.g.,
antigen-specific T cells) and non-specific cells of the immune
system) and humoral immune responses (e.g., responses mediated by B
cells (e.g., via generation and secretion of antibodies into the
plasma, lymph, and/or tissue fluids). The term "immune response" is
meant to encompass all aspects of the capability of a subject's
immune system to respond to antigens and/or immunogens (e.g., both
the initial response to an immunogen (e.g., a pathogen) as well as
acquired (e.g., memory) responses that are a result of an adaptive
immune response).
[0115] As used herein, the term "immunity" refers to protection
from disease (e.g., preventing or attenuating (e.g., suppression)
of a sign, symptom or condition of the disease) upon exposure to a
microorganism (e.g., pathogen) capable of causing the disease.
Immunity can be innate (e.g., non-adaptive (e.g., non-acquired)
immune responses that exist in the absence of a previous exposure
to an antigen) and/or acquired (e.g., immune responses that are
mediated by B and T cells following a previous exposure to antigen
(e.g., that exhibit increased specificity and reactivity to the
antigen)).
[0116] As used herein, the term "immunogen" refers to an agent
(e.g., a microorganism (e.g., bacterium, virus or fungus) or
portion thereof (e.g., a protein antigen (e.g., gp120 or rPA)))
that is capable of eliciting an immune response in a subject. In
preferred embodiments, immunogens elicit immunity against the
immunogen (e.g., microorganism (e.g., pathogen or a pathogen
product)) when administered in combination with a nanoemulsion of
the present invention.
[0117] As used herein, the term "pathogen product" refers to any
component or product derived from a pathogen including, but not
limited to, polypeptides, peptides, proteins, nucleic acids,
membrane fractions, and polysaccharides.
[0118] As used herein, the term "enhanced immunity" refers to an
increase in the level of adaptive and/or acquired immunity in a
subject to a given immunogen (e.g., microorganism (e.g., pathogen))
following administration of a composition (e.g., composition for
inducing an immune response of the present invention) relative to
the level of adaptive and/or acquired immunity in a subject that
has not been administered the composition (e.g., composition for
inducing an immune response of the present invention).
[0119] As used herein, the terms "purified" or "to purify" refer to
the removal of contaminants or undesired compounds from a sample or
composition. As used herein, the term "substantially purified"
refers to the removal of from about 70 to 90%, up to 100%, of the
contaminants or undesired compounds from a sample or
composition.
[0120] As used herein, the terms "administration" and
"administering" refer to the act of giving a composition of the
present invention (e.g., a composition for inducing an immune
response (e.g., a composition comprising a nanoemulsion and an
immunogen)) to a subject. Exemplary routes of administration to the
human body include, but are not limited to, through the eyes
(ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs
(inhalant), oral mucosa (buccal), ear, rectal, by injection (e.g.,
intravenously, subcutaneously, intraperitoneally, etc.), topically,
and the like.
[0121] As used herein, the terms "co-administration" and
"co-administering" refer to the administration of at least two
agent(s) (e.g., a composition comprising a nanoemulsion and an
immunogen and one or more other agents--e.g., an adjuvant) or
therapies to a subject. In some embodiments, the co-administration
of two or more agents or therapies is concurrent. In other
embodiments, a first agent/therapy is administered prior to a
second agent/therapy. In some embodiments, co-administration can be
via the same or different route of administration. Those of skill
in the art understand that the formulations and/or routes of
administration of the various agents or therapies used may vary.
The appropriate dosage for co-administration can be readily
determined by one skilled in the art. In some embodiments, when
agents or therapies are co-administered, the respective agents or
therapies are administered at lower dosages than appropriate for
their administration alone. Thus, co-administration is especially
desirable in embodiments where the co-administration of the agents
or therapies lowers the requisite dosage of a potentially harmful
(e.g., toxic) agent(s), and/or when co-administration of two or
more agents results in sensitization of a subject to beneficial
effects of one of the agents via co-administration of the other
agent. In other embodiments, co-administration is preferable to
elicit an immune response in a subject to two or more different
immunogens (e.g., microorganisms (e.g., pathogens)) at or near the
same time (e.g., when a subject is unlikely to be available for
subsequent administration of a second, third, or more composition
for inducing an immune response).
[0122] As used herein, the term "topically" refers to application
of a compositions of the present invention (e.g., a composition
comprising a nanoemulsion and an immunogen) to the surface of the
skin and/or mucosal cells and tissues (e.g., alveolar, buccal,
lingual, masticatory, vaginal or nasal mucosa, and other tissues
and cells which line hollow organs or body cavities).
[0123] In some embodiments, the compositions of the present
invention are administered in the form of topical emulsions,
injectable compositions, ingestible solutions, and the like. When
the route is topical, the form may be, for example, a spray (e.g.,
a nasal spray), a cream, or other viscous solution (e.g., a
composition comprising a nanoemulsion and an immunogen in
polyethylene glycol).
[0124] The terms "pharmaceutically acceptable" or
"pharmacologically acceptable," as used herein, refer to
compositions that do not substantially produce adverse reactions
(e.g., toxic, allergic or immunological reactions) when
administered to a subject.
[0125] As used herein, the term "pharmaceutically acceptable
carrier" refers to any of the standard pharmaceutical carriers
including, but not limited to, phosphate buffered saline solution,
water, and various types of wetting agents (e.g., sodium lauryl
sulfate), any and all solvents, dispersion media, coatings, sodium
lauryl sulfate, isotonic and absorption delaying agents,
disintigrants (e.g., potato starch or sodium starch glycolate),
polyethylethe glycol, and the like. The compositions also can
include stabilizers and preservatives. Examples of carriers,
stabilizers and adjuvants have been described and are known in the
art (See e.g., Martin, Remington's Pharmaceutical Sciences, 15th
Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by
reference).
[0126] As used herein, the term "pharmaceutically acceptable salt"
refers to any salt (e.g., obtained by reaction with an acid or a
base) of a composition of the present invention that is
physiologically tolerated in the target subject. "Salts" of the
compositions of the present invention may be derived from inorganic
or organic acids and bases. Examples of acids include, but are not
limited to, hydrochloric, hydrobromic, sulfuric, nitric,
perchloric, fumaric, maleic, phosphoric, glycolic, lactic,
salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric,
methanesulfonic, ethanesulfonic, formic, benzoic, malonic,
sulfonic, naphthalene-2-sulfonic, benzenesulfonic acid, and the
like. Other acids, such as oxalic, while not in themselves
pharmaceutically acceptable, may be employed in the preparation of
salts useful as intermediates in obtaining the compositions of the
invention and their pharmaceutically acceptable acid addition
salts.
[0127] Examples of bases include, but are not limited to, alkali
metal (e.g., sodium) hydroxides, alkaline earth metal (e.g.,
magnesium) hydroxides, ammonia, and compounds of formula
NW.sub.4.sup.+, wherein W is C.sub.1-4 alkyl, and the like.
[0128] Examples of salts include, but are not limited to: acetate,
adipate, alginate, aspartate, benzoate, benzenesulfonate,
bisulfate, butyrate, citrate, camphorate, camphorsulfonate,
cyclopentanepropionate, digluconate, dodecylsulfate,
ethanesulfonate, fumarate, flucoheptanoate, glycerophosphate,
hemisulfate, heptanoate, hexanoate, chloride, bromide, iodide,
2-hydroxyethanesulfonate, lactate, maleate, methanesulfonate,
2-naphthalenesulfonate, nicotinate, oxalate, palmoate, pectinate,
persulfate, phenylpropionate, picrate, pivalate, propionate,
succinate, tartrate, thiocyanate, tosylate, undecanoate, and the
like. Other examples of salts include anions of the compounds of
the present invention compounded with a suitable cation such as
Na.sup.+, NH.sub.4.sup.+, and NW.sub.4.sup.+ (wherein W is a
C.sub.1-4 alkyl group), and the like. For therapeutic use, salts of
the compounds of the present invention are contemplated as being
pharmaceutically acceptable. However, salts of acids and bases that
are non-pharmaceutically acceptable may also find use, for example,
in the preparation or purification of a pharmaceutically acceptable
compound.
[0129] For therapeutic use, salts of the compositions of the
present invention are contemplated as being pharmaceutically
acceptable. However, salts of acids and bases that are
non-pharmaceutically acceptable may also find use, for example, in
the preparation or purification of a pharmaceutically acceptable
composition.
[0130] As used herein, the term "at risk for disease" refers to a
subject that is predisposed to experiencing a particular disease.
This predisposition may be genetic (e.g., a particular genetic
tendency to experience the disease, such as heritable disorders),
or due to other factors (e.g., environmental conditions, exposures
to detrimental compounds present in the environment, etc.). Thus,
it is not intended that the present invention be limited to any
particular risk (e.g., a subject may be "at risk for disease"
simply by being exposed to and interacting with other people), nor
is it intended that the present invention be limited to any
particular disease.
[0131] "Nasal application", as used herein, means applied through
the nose into the nasal or sinus passages or both. The application
may, for example, be done by drops, sprays, mists, coatings or
mixtures thereof applied to the nasal and sinus passages.
[0132] "Vaginal application", as used herein, means applied into or
through the vagina so as to contact vaginal mucosa. The application
may contact the urethra, cervix, fornix, uterus or other area
surrounding the vagina. The application may, for example, be done
by drops, sprays, mists, coatings, lubricants or mixtures thereof
applied to the vagina or surrounding tissue.
[0133] As used herein, the term "kit" refers to any delivery system
for delivering materials. In the context of immunogenic agents
(e.g., compositions comprising a nanoemulsion and an immunogen),
such delivery systems include systems that allow for the storage,
transport, or delivery of immunogenic agents and/or supporting
materials (e.g., written instructions for using the materials,
etc.) from one location to another. For example, kits include one
or more enclosures (e.g., boxes) containing the relevant
immunogenic agents (e.g., nanoemulsions) and/or supporting
materials. As used herein, the term "fragmented kit" refers to
delivery systems comprising two or more separate containers that
each contain a subportion of the total kit components. The
containers may be delivered to the intended recipient together or
separately. For example, a first container may contain a
composition comprising a nanoemulsion and an immunogen for a
particular use, while a second container contains a second agent
(e.g., an antibiotic or spray applicator). Indeed, any delivery
system comprising two or more separate containers that each
contains a subportion of the total kit components are included in
the term "fragmented kit." In contrast, a "combined kit" refers to
a delivery system containing all of the components of an
immunogenic agent needed for a particular use in a single container
(e.g., in a single box housing each of the desired components). The
term "kit" includes both fragmented and combined kits.
DETAILED DESCRIPTION OF THE INVENTION
[0134] The present invention provides methods and compositions for
the stimulation of specific immune response. Accordingly, in some
embodiments, the present invention provides vaccines for the
stimulation of immunity against pathogens. In some embodiments, the
present invention provides nanoemulsion vaccine compositions
comprising an inactivated pathogen and a nanoemulsion. The present
invention is not limited to any particular nanoemulsion or
pathogen. Exemplary vaccine compositions and methods of
administering vaccine compositions are described in more detail
below.
I. Nanoemulsions as Anti-Pathogen Compositions
[0135] The nanoemulsion compositions utilized in some embodiments
of the present invention have demonstrated anti-pathogen effect.
For example, nanoemulsion compositions have been shown to
inactivate bacteria (both vegetative and spore forms), virus, and
fungi. In preferred embodiments of the present invention, pathogens
are inactivated by exposure to nanoemulsions before being
administered as vaccines.
[0136] A. Microbicidal and Microbistatic Activity
[0137] Nanoemulsion compositions can be used to rapidly inactivate
bacteria. In certain embodiments, the compositions are particularly
effective at inactivating Gram positive bacteria. In preferred
embodiments, the inactivation of bacteria occurs after about five
to ten minutes. Thus, bacteria may be contacted with an emulsion
and will be inactivated in a rapid and efficient manner. It is
expected that the period of time between the contacting and
inactivation may be as little as 5-10 minutes where the bacteria is
directly exposed to the emulsion. However, it is understood that
when nanoemulsions are employed in a therapeutic context and
applied systemically, the inactivation may occur over a longer
period of time including, but not limited to, 5, 10, 15, 20, 25 30,
60 minutes post application. Further, in additional embodiments,
inactivation may take two, three, four, five or six hours to
occur.
[0138] Nanoemulsions can also rapidly inactivate certain Gram
negative bacteria for use in generating the vaccines of the present
invention. In such methods, the bacteria inactivating emulsions are
premixed with a compound that increases the interaction of the
emulsion by the cell wall. The use of these enhancers in the
vaccine compositions of the present invention is discussed herein
below. It should be noted that certain emulsions (e.g., those
comprising enhancers) are effective against certain Gram positive
and negative bacteria.
[0139] In specific illustrative examples (Examples 3-4),
nanoemulsions useful in the compositions and methods of the present
invention were shown to have potent, selective biocidal activity
with minimal toxicity against vegetative bacteria. For example, X8P
was highly effective against B. cereus, B. circulans and B.
megaterium, C. perfringens, H. influenzae, N. gonorrhoeae, S.
agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and
Eltor (FIG. 26). This inactivation starts immediately on contact
and is complete within 15 to 30 minutes for most of the susceptible
microorganisms.
[0140] B. Sporicidial and Sporistatic Activity
[0141] In certain specific examples (e.g., Examples 5 and 11),
nanoemulsions have been shown to have anti-sporicidal activity.
Without being bound to any theory (an understanding of the
mechanism is not necessary to practice the present invention, and
the present invention is not limited to any particular mechanism),
it is proposed the that the sporicidal ability of these emulsions
occurs through initiation of germination without complete reversion
to the vegetative form leaving the spore susceptible to disruption
by the emulsions. The initiation of germination could be mediated
by the action of the emulsion or its components.
[0142] The results of electron microscopy studies show disruption
of the spore coat and cortex with disintegration of the core
contents following X8P treatment. Sporicidal activity appears to be
mediated by both the TRITON X-100 and tri-n-butyl phosphate
components since nanoemulsions lacking either component are
inactive in vivo. This unique action of the emulsions, which is
similar in efficiency to 1% bleach, is interesting because Bacillus
spores are generally resistant to most disinfectants including many
commonly used detergents (Russell, Clin. Micro. 3; 99 (1990)).
[0143] Certain illustrative examples of the present invention
demonstrate that mixing X8P with B. cereus spores before injecting
into mice prevents the pathological effect of B. cereus (Example
5). Further, illustrative examples of the present invention show
that X8P treatment of simulated wounds contaminated with B. cereus
spores markedly reduced the risk of infection and mortality in mice
(Example 5). The control animals, injected with X8P alone diluted
1:10, did not show any inflammatory effects, thus demonstrating
that X8P does not have cutaneous toxicity in mice. These results
suggest that immediate treatment of spores prior to or following
exposure can effectively reduce the severity of tissue damage of
the experimental cutaneous infection.
[0144] Other experiments conducted during the development of the
present invention compared the effects of X8P and other emulsions
derived from X8P to inactivate different Bacillus spores (Example
11). X8P diluted up to 1:1000 (v/v) inactivated more than 90% of B.
anthracis spores in four hours, and was also sporicidal against
three other Bacillus species through the apparent disruption of
spore coat. X8W.sub.60PC diluted 1:1000 had more sporicidal
activity against B. anthracis, B. cereus, and B. subtilis and had
an onset of action in less than 30 minutes. In mice, mixing X8P
with B. cereus before subcutaneous injection or wound irrigation
with X8P 1 hour following spore inoculation resulted in over 98%
reduction in skin lesion size. Mortality was reduced 4-fold in the
latter experiment. The present compositions are stable, easily
dispersed, non-irritant and nontoxic compared to the other
available sporicidal agents.
[0145] The bacteria-inactivating oil-in-water emulsions used in
some embodiments of the present invention can be used to inactivate
a variety of bacteria and bacterial spores upon contact. For
example, the presently disclosed emulsions can be used to
inactivate Bacillus including B. cereus, B. circulans and B.
megatetium, also including Clostridium (e.g., C. botulinum and C.
tetani). The nanoemulsions utilized in some embodiments of the
present invention may be particularly useful in inactivating
certain biological warfare agents (e.g., B. anthracis). In
addition, the formulations of the present invention also find use
in combating C. perfringens, H. influenzae, N. gonorrhoeae, S.
agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and
Eltor (FIG. 1).
[0146] C. Viricidal and Viralstatic Activity In additional
illustrative examples (e.g., Example 12) of the present invention,
it was demonstrated that the nanoemulsion compositions of the
present invention have anti-viral properties. The effect of these
emulsions on viral agents was monitored using plaque reduction
assay (PRA), cellular enzyme-linked immunosorbent assay (ELISA),
.beta.-galactosidase assay, and electron microscopy (EM) and the
cellular toxicity of lipid preparations was assessed using a
(4,5-dimethylthiazole-2-yl)-2,5 diphenyltetrazolium (MTT) staining
assay (Mosmann, J. Immunol. Methods., 65:55 (1983)).
[0147] There was a marked reduction of influenza A infectivity of
MDCK cells as measured by cellular ELISA with subsequent
confirmation by PRA. X8P and SS at a dilution of 1:10 reduced virus
infectivity over 95%. Two other emulsions showed only intermediate
effects on the virus reducing infectivity by approximately 40% at
dilution 1:10. X8P was the most potent preparation and showed
undiminished viricidal effect even at dilution 1:100. Kinetic
studies showed that 5 min incubation of virus with X8P at. 1:10
dilution completely abolished its infectivity. TRITON X-100, an
active compound of X8P, at dilution 1:5000 only partially inhibited
the infectivity of virus as compared to X8P, indicating that the
nanoemulsion itself contributes to the anti-viral efficacy. To
further examine the anti-viral properties of X8P, its action on
non-enveloped viruses was investigated. The X8P treatment did not
affect the replication of lacZ adenovirus construct in 293 cells as
measured using .beta.-galactosidase assay. When examined with EM,
influenza A virus was completely disrupted after incubation with
X8P while adenovirus remained intact.
[0148] In addition, pre-incubation of virus with 10% and 1% X8P in
PBS completely eliminates herpes, sendai, sindbis and vaccinia
viruses as assessed by plaque reduction assays (FIG. 2). Time
course analyses showed the onset of inactivation to be rapid and
complete within 5 minutes of incubation with 10% X8P and within 30
minutes with 1% X8P. Adenovirus treated with different dilutions of
X8P showed no reduction in infectivity.
[0149] The efficacy of certain X8P based compositions against
various viral onslaught and their minimal toxicity to mucous
membranes demonstrate their potential as effective disinfectants
and agents for prevention of diseases resulting from infection with
enveloped viruses.
[0150] D. Fungicidal and Fungistatic Activity
[0151] Yet another property of the nanoemulsions used in some
embodiments of the present invention is that they possess
antifungal activity. Common agents of fungal infections include
various species of the genii Candida and Aspergillus, and types
thereof, as well as others. While external fungus infections can be
relatively minor, systemic fungal infections can give rise to
serious medical consequences. There is an increasing incidence of
fungal infections in humans, attributable in part to an increasing
number of patients having impaired immune systems. Fungal disease,
particularly when systemic, can be life threatening to patients
having an impaired immune system.
[0152] Experiments conducted during the development of the present
invention have shown that 1% X8P has a greater than 92% fungistatic
activity when applied to Candida albicans. Candida was grown at
37.degree. C. overnight. Cells were then washed and counted using a
hemacytometer. A known amount of cells were mixed with different
concentrations of X8P and incubated for 24 hours. The Candida was
then grown on dextrose agar, incubated overnight, and the colonies
were counted. The fungistatic effect of the X8P was determined as
follows:
Fungistatic effect ( FSE ) = 1 - # of treated cells - Initial # of
cells # of untreated cells - Initial # of cells .times. 100
##EQU00002##
[0153] It is contemplated that other nanoemulsion formulations
useful in the methods and compositions of the present invention
(e.g., described below) are also fungistatic. One of skill in the
art will be able to test additional formulations for their ability
to inactivate fungi (e.g., using methods described herein).
[0154] E. In Vivo Effects
[0155] In other illustrative examples of the present invention,
nanoemulsion formulations were shown to combat and prevent pathogen
infection in animals. Bacillus cereus infection in experimental
animals has been used previously as a model system for the study of
anthrax (See e.g., Burdon and Wende, J. Infect. Diseas. 170(2):272
(1960); Lamanna and Jones, J. Bact. 85:532 (1963); and Burdon et
al., J. Infect. Diseas. 117:307 (1967)). The disease syndrome
induced in animals experimentally infected with B. cereus is
similar to B. anthracis (Drobniewski, Clin. microbio. Rev. 6:324
(1993); and Fritz et al., Lab. Invest. 73:691 (1995)). Experiments
conducted during the development of the present invention
demonstrated that mixing X8P with B. cereus spores before injecting
into mice prevented the pathological effect of B. cereus. Further,
it was demonstrated that X8P treatment of simulated wounds
contaminated with B. cereus spores markedly reduced the risk of
infection and mortality in mice. The control animals, which were
injected with X8P alone diluted 1:10, did not show any inflammatory
effects proving that X8P does not have cutaneous toxicity in mice.
These results suggest that immediate treatment of spores prior to
or following exposure can effectively reduce the severity of tissue
damage of the experimental cutaneous infection.
[0156] In a particular example, Guinea Pigs were employed as
experimental animals for the study of C. perfringens infection. A
1.5 cm skin wound was made, the underlying muscle was crushed and
infected with 5.times.10.sup.7 cfu of C. perfringens without any
further treatment. Another group was infected with the same number
of bacteria, then 1 hour later it was irrigated with either saline
or X8P to simulate post-exposure decontamination. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit. However, X8P irrigation of the wound infected
with C. perfringens showed marked reduction of edema, inflammatory
reaction and necrosis. As such, it was demonstrated that certain
nanoemulsion formulations are able to combat a bacterial
infection.
[0157] Further, a subcutaneous injection of 10% X8P did not cause
distress in experimental animals and resulted in no gross
histological tissue damage. All rats in the nasal toxicity study
showed weight gain over the study period. No adverse clinical signs
were noted and all tissues appeared within normal limits on gross
examination. Bacterial cultures from the stools of treated animals
were not significantly different from those of untreated
animals.
II. Nanoemulsion Vaccine Compositions and Compositions for Inducing
Immune Responses
[0158] In some embodiments, the present invention provides
compositions for inducing immune responses comprising a
nanoemulsion and one or more immunogens (e.g., inactivated
pathogens or pathogen products). The present invention provides
immunogenic compositions capable of generating an immune response
against any number of pathogens (e.g., vaccines for any number of
pathogens). A variety of nanoemulsion that find use in the present
invention are described herein and elsewhere (e.g., nanoemulsions
described in U.S. Pat. Apps. 20020045667 and 20040043041, and U.S.
Pat. Nos. 6,015,832, 6,506,803, 6,635,676, and 6,559,189, each of
which is incorporated herein by reference in its entirety for all
purposes).
[0159] Immunogens (e.g., pathogens or pathogen products) and
nanoemulsions of the present invention may be combined in any
suitable amount utilizing a variety of delivery methods. Any
suitable pharmaceutical formulation may be utilized, including, but
not limited to, those disclosed herein. Suitable formulations may
be tested for immunogenicity using any suitable method. For
example, in some embodiments, immunogenicity is investigated by
quantitating both antibody titer and specific T-cell responses.
Nanoemulsion compositions of the present invention may also be
tested in animal models of infectious disease states. Suitable
animal models, pathogens, and assays for immunogenicity include,
but are not limited to, those described below.
[0160] A. Nanoemulsion Compositions Induce Immunity when
Administered to a Subject
[0161] The ability of nanoemulsions to prevent infections in a
prophylactic manner when applied to either wounds, skin or mucous
membranes has been documented (Hamouda et al., J. Infect. Dis.,
180:1939 (1999); Donovan et al., Antivir Chem. Chemother., 11:41
(2000)). During the development of the present invention, in
several studies, mice were pretreated with nasally-applied
nanoemulsion before exposure to influenza virus to document the
ability of the nanoemulsions to prevent inhalation influenza
pneumonitis. Morbidity from pretreatment with nanoemulsion was
minimal and, as compared to control animals, mortality was greatly
diminished (20% with pretreatment vs. 80% in controls; Example 13).
Several of the surviving, emulsion pretreated animals were found to
have evidence of a few areas of immune reactivity and giant-cell
formation in the lung that were not present in control animals
treated with emulsion but not exposed to virus. All of the
pretreated animals had evidence of lipid uptake in lung
macrophages. The present invention is not limited to any one
mechanism. Indeed, an understanding of the mechanism is not
necessary to practice the present invention. Nonetheless, it is
contemplated that the treatment with a nanoemulsion/virus
composition resulted in the development of immunity to the
influenza virus.
[0162] Therefore, in one illustrative example (Example 13) antibody
titers to influenza virus in the serum of exposed animals were
investigated. It was found that animals receiving emulsion and
virus had high titers of virus-specific antibody (FIG. 6). This
immune response was not observed in control animals exposed to
virus without pretreatment.
[0163] Experiments were conducted to investigate whether
administration of emulsion and virus would yield protective
immunity without toxicity (Example 13). A mixture of virus
(LD.sub.80; 5.times.10.sup.4 pfu) with the nanoemulsion was
administered to animals on two occasions, two weeks apart. As
controls, animals were given either an equal amount of
formalin-killed virus, nanoemulsion alone or saline. The results of
these studies demonstrated that only the emulsion/virus mixture
elicited significant antibody response when applied to the nares of
animals. The titers were extremely high and included both serum IgG
and bronchial IgA responses that were specific for the virus (FIGS.
7 and 8). More importantly, in two repeated experiments, complete
protection from death was observed in the emulsion/virus
pretreatment group (Table 25). None of the 15 animals died from
exposure to a LD.sub.80 of virus after two administrations of
5.times.10.sup.4 pfu of virus mixed in nanoemulsion, whereas the
expected 80% of control animals died from this exposure. The same
dose of formalin killed virus applied to the nares provided no
protection from death and resulted in much lower titers of
virus-specific antibody (FIGS. 7 and 8).
[0164] Experiments were also conducted to investigate the
possibility that a small amount of residual, live virus in the
nanoemulsion was producing a subclinical infection that provided
immunity (Example 13). An additional group of animals were given
approximately 100 pfu of live virus intranasally in an attempt to
induce a low-level infection (approximately four times the amount
of live virus present after 15 minutes of treatment with
nanoemulsion). While there was a slight reduction in death rates of
these animals, suggesting a sub-clinical infection, the amount of
protection observed was significantly less than what was seen in
the emulsion treated group and none of these animals developed
virus-specific antibodies (Table 25). This documented that it was
not merely a sub-lethal viral infection mediating the immune
response but that the emulsion was specifically enhancing the
virus-specific immune response. The protective immunity was
obtained following only two applications of the emulsion/virus mix,
and appeared to increase after each application suggesting a
booster effect. Virus-specific antibody titers were maintained for
six weeks following administration of the emulsion/virus mix.
[0165] Illustrative Example 15 demonstrates the ability of
intranasaly administered influenza virus/nanoemulsion was able to
induce immunity in mice against further challenge with live
virus.
[0166] The present invention is not limited to the intranasal
administration of vaccine compounds. Parenteral methods of
administration are also contemplated. For example, illustrative
example 16 demonstrates that parenteral administration of HIV gp120
protein/nanoemulsion induced an immune response in mice. The
present invention is also not limited to the use of vaccines
comprising whole pathogens. The use of pathogen products (e.g.,
including, but not limited to, proteins, polypeptides, peptides,
nucleic acids, membrane fractions, and polysaccharides) is
contemplated. Illustrative example 16 demonstrates the generation
of an immune response against HIV gp120 protein.
[0167] In some embodiments, the present invention describes the
development of immunity (e.g., immunity towards an orthopox virus
(e.g., vaccinia virus (VV))) in a subject after mucosal
administration (e.g., mucosal vaccination) of a composition
comprising nanoemulsion (NE)-inactivated orthopox virus (e.g., VV)
identified and characterized during development of the present
invention. NE was mixed with highly purified, cell culture-derived
VV, resulting in a formulation (e.g., NE-killed VV composition)
that is stable at room temperature (e.g., in some embodiments, for
more than 2 weeks, more preferably more than 3 weeks, even more
preferably more than 4 weeks, and most preferably for more than 5
weeks) and that can be used to induce an immune response against
orthopox viruses (e.g., VV) in a subject (e.g., that can be used
either alone or as an adjuvant for inducing an anti-VV immune
response).
[0168] Mucosal administration of a composition comprising NE and VV
(e.g., NE-killed VV) to a subject resulted in high-titer mucosal
and systemic antibody responses and specific Th1 cellular immunity
(See, e.g., Examples 18-24). Further, all animals were fully
protected against an inhalation challenge with 10.times.LD.sub.50
VV (See, e.g., Example 24). In the vaccinated animals, infection
was completely prevented or was of a low level and self-limiting
and infection resolved in four to five days. In contrast, all naive
animals died within this time period. Subsequent re-challenge of
immunized mice with a 100.times.LD of VV.sub.-WR validated
protective immunity. Mice administered even a single dose of a
composition comprising NE-killed VV developed significant serum
concentrations of anti-VV IgG 10 to 12 weeks after administration
(See, e.g., Example 18). This level of response is comparable to
the results obtained in Balb/c mice immunized by intramuscular
injection with live VV Wyeth at similar time point (See, e.g.,
Coulibaly et al., Virology, 2005; 341; 91-101). Thus, in some
embodiments, the present invention provides that a single
administration (e.g., mucosal administration) of a composition
comprising NE-killed VV is sufficient to induce a protective immune
response in a subject (e.g., protective immunity (e.g., mucosal and
systemic immunity)). In some embodiments, a subsequent
administration (e.g., one or more boost administrations subsequent
to a primary administration) to a subject provides the induction of
an enhanced immune response to VV in the subject. Thus, the present
invention demonstrates that administration of a composition
comprising NE-killed VV to a subject provides protective immunity
against smallpox.
[0169] In contrast, intranasal instillations of formalin-killed VV
with or without nanoemulsion produced inconsistent and low antibody
responses, which did not augment even after a third immunization
(See, e.g., Example 18). A similar pattern of neutralizing activity
was also detected in serum and bronchoalveolar lavage (BAL), with
neutralizing activity being absent in mice mucosally vaccinated
with formalin-killed virus. Neutralizing activity was not detected
in BAL of animals vaccinated with either IP or SQ injections of a
live virus.
[0170] Both cellular and humoral immunity play a role in protection
against orthopoxviruses, and both were induced with the NE
formulations (See, e.g., Examples 18-20). Vaccinia-specific
antibody titers are considered important for the estimate of
protective immunity in human subjects and in animal models of
vaccination (See, e.g., Hammarlund et al, Nat. Med. 2003, 9;
1131-1137). Several studies have identified proteins important for
the elicitation of neutralizing antibodies (See, e.g., Galmiche et
al, Virology, 1999, 254; 71-80; Hooper et al, Virology, 2003, 306;
181-195). A recent trial of dilutions of the licensed smallpox
vaccine (Dryvax) in human volunteers, confirmed that pustule
formation strongly correlated with development of both specific
antibodies and induction of cytotoxic T lymphocytes (CTL) and
elevated INF-.gamma. T cell responses (See, e.g., Greenberg et al,
2005, 365; 398-409). Induction of IFN-.gamma. is suggestive of
activation of specific MHC class I-restricted CD8+ T cells. These
types of cells have been implicated in the recognition and
clearance of Vaccinia infected cells, and for maintenance of
immunity after vaccination (See, e.g., Earl et al, Nature, 2004;
482; 182-185; Hammarlund et al, Nat. Med. 2003, 9; 1131-1137;
Edghill-Smith et all, Nature Med. 2005, 11; 740-747).
[0171] Thus, in some embodiments, administration (e.g., mucosal
administration) of a composition of the present invention (e.g.,
NE-killed orthopox virus (e.g., VV) to a subject results in the
induction of both humoral (e.g., development of specific
antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune
responses (e.g., against the orthopox virus). In some preferred
embodiments, a composition of the present invention (e.g.,
NE-killed orthopox virus (e.g., VV) is used as a smallpox
vaccine.
[0172] In some embodiments, the present invention provides methods
of inducing an immune response to bacteria of the genus Bacillus
(e.g., B. anthracis) in a subject (e.g., a human subject) and
compositions useful in such methods (e.g., a nanoemulsion
comprising bacteria or bacterial components (e.g., isolated or
recombinant proteins) of the genus Bacillus (e.g., B. anthracis)).
In preferred embodiments, methods of inducing an immune response
provided by the present invention are used for vaccination. Due to
the rate of adverse events with existing Bacillus (e.g., B.
anthracis) vaccines, the present invention provides a significant
improvement in Bacillus (e.g., B. anthracis) vaccination safety
without compromising vaccine efficacy.
[0173] For example, the present invention describes the development
of immunity (e.g., B. anthracis immunity) in a subject after
mucosal administration (e.g., mucosal vaccination) with a
composition comprising a nanoemulsion and an immunogenic protein
from B. anthracis (e.g., rPA) generated and characterized during
development of the present invention (See Examples 25-30).
Nanoemulsion (NE), a surface-active antimicrobial material, was
mixed with recombinant protective antigen (rPA), resulting in an
immunogenic composition comprising NE and rPA that is stable at
room temperature (e.g., in some embodiments, for more than 2 weeks,
more preferably more than 3 weeks, even more preferably more than 4
weeks, and most preferably for more than 5 weeks) and that can be
used to induce an immune response against B. anthracis in a subject
(e.g., that can be used either alone or as an adjuvant for inducing
an anti-B. anthracis immune response).
[0174] Mucosal administration of a composition comprising NE and
rPA to a subject resulted in high-titer mucosal and systemic
antibody responses and specific Th1 cellular immunity (See, e.g.,
Examples 27-30). Further, serum from mice immunized intranasally
with a composition comprising NE and rPA was capable of
neutralizing binding of PA to its receptor (ATR receptor) (See
Example 29). Mice administered three doses of a composition
comprising NE and rPA developed significant serum concentrations of
anti-rPA IgG after administration (See, e.g., Example 27).
Moreover, mice administered this composition generated IgA
antibodies toward rPA, indicating the presence of a mucosal immune
response.
[0175] Thus, in some embodiments, the present invention provides
that administration (e.g., mucosal administration) of a composition
comprising NE and a B. anthracis immunogen (e.g., rPA) is
sufficient to induce a protective immune response against B.
anthracis in a subject (e.g., protective immunity (e.g., mucosal
and systemic immunity)). In some embodiments, a subsequent
administration (e.g., one or more boost administrations subsequent
to a primary administration) to a subject provides the induction of
an enhanced immune response to B. anthracis in the subject. Thus,
the present invention demonstrates that administration of a
composition comprising NE and a B. anthracis immunogen (e.g., rPA)
to a subject provides protective immunity against anthrax.
[0176] In contrast, intranasal instillations of NE alone or NE with
CpG adjuvant was not able to induce an immune response against B.
anthracis (See Examples 27-30). Furthermore, administration of rPA
alone (e.g., in saline) did not induce significant IgG or IgA
antibody production in mice.
[0177] Both cellular and humoral immunity play a role in protection
against Bacillus (e.g., B. anthracis), and both were induced with
the NE formulations (See, e.g., Examples 27-30). Thus, in some
embodiments, administration (e.g., mucosal administration) of a
composition of the present invention to a subject results in the
induction of both humoral (e.g., development of specific
antibodies) and cellular (e.g., cytotoxic T lymphocyte) immune
responses (e.g., against Bacillus proteins). In some preferred
embodiments, a composition of the present invention (e.g., a
composition comprising a NE and Bacillus proteins (e.g., rPA) is
used as an anthrax vaccine.
[0178] In some embodiments, the present invention provides methods
of inducing an immune response to HIV in a subject (e.g., a human
subject) and compositions useful in such methods (e.g., a
nanoemulsion comprising HIV or HIV components (e.g., isolated or
recombinant HIV proteins). In some embodiments, methods of inducing
an immune response provided by the present invention are used for
vaccination. Due to the rate of adverse events with existing HIV
vaccines, the present invention provides a significant improvement
in HIV vaccination safety without compromising vaccine
efficacy.
[0179] For example, the present invention describes the development
of immunity (e.g., HIV immunity) in a subject after mucosal
administration (e.g., mucosal vaccination) with a composition
comprising a nanoemulsion and an immunogenic protein from HIV
(e.g., recombinant gp120) generated and characterized during
development of the present invention (See Examples 31-36).
Nanoemulsion (NE), a surface-active antimicrobial material, was
mixed with recombinant gp120 from either BaL or SF162 serotypes,
resulting in an immunogenic composition comprising NE and
recombinant gp120 that is stable at room temperature (e.g., in some
embodiments, for more than 2 weeks, more preferably more than 3
weeks, even more preferably more than 4 weeks, and most preferably
for more than 5 weeks) and that can be used to induce an immune
response against HIV in a subject (e.g., that can be used either
alone or as an adjuvant for inducing an anti-HIV immune
response).
[0180] Mucosal administration of a composition comprising NE and an
HIV immunogen (e.g., recombinant gp120) to a subject resulted in
high-titer mucosal and systemic antibody responses and generated a
Th1 type cellular immune response (See, e.g., Examples 31, 32, and
35). Further, antibodies generated against one serotype of gp120
cross-reacted with other gp120 serotypes (See, e.g., Example 33).
Moreover, mice immunized intranasally with a composition comprising
NE and recombinant gp120 generated mucosally secreted, anti-gp120
specific IgA antibodies that were detectable in both bronchial as
well as vaginal mucosal surfaces (See Example 34). Thus, mice
administered a composition of the present invention generated a
mucosal immune response to HIV. The immune response generated in
mice administered a composition comprising a NE and recombinant
gp120 was also capable of neutralizing HIV (See Example 37).
[0181] Thus, in some embodiments, the present invention provides
that administration (e.g., mucosal administration) of a composition
comprising NE and an HIV immunogen (e.g., recombinant gp120) is
sufficient to induce a protective immune response against HIV in a
subject (e.g., protective immunity (e.g., mucosal and systemic
immunity)). In some embodiments, a subsequent administration (e.g.,
one or more boost administrations subsequent to a primary
administration) to a subject provides the induction of an enhanced
immune response to HIV in the subject. Thus, the present invention
demonstrates that administration of a composition comprising NE and
an HIV immunogen (e.g., recombinant gp120) to a subject provides
protective immunity against AIDS.
[0182] Both cellular and humoral immunity play a role in protection
against HIV and both were induced with the NE formulations (See,
e.g., Examples 32-37). Thus, in some embodiments, administration
(e.g., mucosal administration) of a composition of the present
invention to a subject results in the induction of both humoral
(e.g., development of specific antibodies) and cellular (e.g.,
cytotoxic T lymphocyte) immune responses (e.g., against HIV
proteins (gp120)). In some preferred embodiments, a composition of
the present invention (e.g., a composition comprising a NE and
recombinant gp120 from one or more serotypes of HIV) is used as a
AIDS vaccine.
[0183] B. Pathogens
[0184] The present invention is not limited to the use of any one
specific type of pathogen. Indeed, compositions (e.g., comprising a
NE and an immunogen) useful for generating an immune response
(e.g., for use as a vaccine) to a variety of pathogens are within
the scope of the present invention. Accordingly, in some
embodiments, the present invention provides compositions for
generating an immune response to bacterial pathogens (e.g., in
vegetative or spore forms) including, but not limited to, Bacillus
cereus, Bacillus circulans and Bacillus megaterium, Bacillus
anthracis, bacteria of the genus Brucella, Vibrio cholera, Coxiella
burnetii, Francisella tularensis, Chlamydia psittaci, Ricinus
communis, Rickettsia prowazekii, bacterial of the genus Salmonella
(e.g., S. typhi), bacteria of the genus Shigella, Cryptosporidium
parvum, Burkholderia pseudomallei, Clostridium perfringens,
Clostridium botulinum, Vibrio cholerae, Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcus pneumonia, Staphylococcus
aureus, Neisseria gonorrhea, Haemophilus influenzae, Escherichia
coli, Salmonella typhimurium, Shigella dysenteriae, Proteus
mirabilis, Pseudomonas aeruginosa, Yersinia pestis, Yersinia
enterocolitica, and Yersinia pseudotuberculosis). In other
embodiments, the present invention provides compositions for
generating an immune response to viral pathogens including, but not
limited to, influenza A virus, avian influenza virus, H5N1
influenza virus, West Nile virus, SARS virus, Marburg virus,
Arenaviruses, Nipah virus, alphaviruses, filoviruses, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvovirus, human immunodeficiency virus, hepatitis B
virus, hepatitis C virus, hepatitis A virus, cytomegalovirus, human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus). In still further embodiments, the present invention
provides compositions for generating an immune response to fungal
pathogens, including, but not limited to, Candida albicans and
parapsilosis, Aspergillus fumigatus and niger, Fusarium spp,
Trychophyton spp.
[0185] Bacteria for use in formulating a composition for generating
an immune response of the present invention can be obtained from
commercial sources, including, but not limited to, American Type
Culture Collection (ATCC). In some embodiments, bacteria are passed
in animals prior to being mixed with nanoemulsions in order to
enhance their pathogenicity for each specific animal host for 5-10
passages (Sinai et al., J. Infect. Dis., 141:193 (1980)). In some
embodiments, the bacteria then are then isolated from the host
animals, expanded in culture and stored at -80.degree. C. Just
before use, the bacteria are thawed and grown on an appropriate
solid bacterial culture medium overnight. The next day, the
bacteria are collected from the agar plate and suspended in a
suitable liquid solution (e.g., Brain Heart Infusion (BHI) broth).
The concentration of bacteria is adjusted so that the bacteria
count is approximately 1.5.times.10.sup.8 colony forming units per
ml (CFU/ml), based on the McFarland standard for bactericidal
testing (Hendrichson and Krenz, 1991).
[0186] Viruses for use in formulating a composition for generating
an immune response of the present invention can be obtained from
commercial sources, including, but not limited to, ATCC. In some
embodiments, viruses are passed in the prospective animal model for
5-10 times to enhance pathogenicity for each specific animal
(Ginsberg and Johnson, Infect. Immun., 13:1221 (1976)). In some
embodiments, the virus is collected and propagated in tissue
culture and then purified using density gradient concentration and
ultracentrifugation (Garlinghouse et al., Lab Anim Sci., 37:437
(1987); and Mahy, Br. Med. Bull., 41:50 (1985)). The Plaque Forming
Units (PFU) are calculated in the appropriate tissue culture
cells.
[0187] Lethal dose and/or infectious dose for each pathogen can be
calculated using any suitable method, including, but not limited
to, by administering different doses of the pathogens to the
animals by the infective route and identifying the doses which
result in the expected result of either animal sickness or death
based on previous publications (Fortier et al., Infect Immun.,
59:2922 (1991); Jacoby, Exp Gerontol., 29:89 (1994); and Salit et
al., Can J Microbiol., 30:1022 (1984)).
[0188] C. Nanoemulsions
[0189] The nanoemulsion vaccine compositions of the present
invention are not limited to any particular nanoemulsion. Any
number of suitable nanoemulsion compositions may be utilized in the
vaccine compositions of the present invention, including, but not
limited to, those disclosed in Hamouda et al., J. Infect Dis.,
180:1939 (1999); Hamouda and Baker, J. Appl. Microbiol., 89:397
(2000); and Donovan et al., Antivir. Chem. Chemother., 11:41
(2000), as well as those shown in Tables 1 and 2 and FIGS. 4 and 9.
Preferred nanoemulsions of the present invention are those that are
effective in killing or inactivating pathogens and that are
non-toxic to animals. Accordingly, preferred emulsion formulations
utilize non-toxic solvents, such as ethanol, and achieve more
effective killing at lower concentrations of emulsion. In preferred
embodiments, nanoemulsions utilized in the methods of the present
invention are stable, and do not decompose even after long storage
periods (e.g., one or more years). Additionally, preferred
emulsions maintain stability even after exposure to high
temperature and freezing. This is especially useful if they are to
be applied in extreme conditions (e.g., on a battlefield). In some
embodiments, one of the nanoemulsions described in Table 1 and or
FIG. 4 or 9 is utilized.
[0190] In some preferred embodiments, the emulsions comprise (i) an
aqueous phase; (ii) an oil phase; and at least one additional
compound. In some embodiments of the present invention, these
additional compounds are admixed into either the aqueous or oil
phases of the composition. In other embodiments, these additional
compounds are admixed into a composition of previously emulsified
oil and aqueous phases. In certain of these embodiments, one or
more additional compounds are admixed into an existing emulsion
composition immediately prior to its use. In other embodiments, one
or more additional compounds are admixed into an existing emulsion
composition prior to the compositions immediate use.
[0191] Additional compounds suitable for use in the compositions of
the present invention include but are not limited to one or more,
organic, and more particularly, organic phosphate based solvents,
surfactants and detergents, quaternary ammonium containing
compounds, cationic halogen containing compounds, germination
enhancers, interaction enhancers, and pharmaceutically acceptable
compounds. Certain exemplary embodiments of the various compounds
contemplated for use in the compositions of the present invention
are presented below.
TABLE-US-00001 TABLE 1 Nanoemulsion Formulations Water to Oil Name
Oil Phase Formula Phase Ratio (Vol/Vol) X8P 1 vol.
Tri(N-butyl)phosphate 4:1 1 vol. TRITON X-100 8 vol. Soybean oil NN
86.5 g Glycerol monooleate 3:1 60.1 ml Nonoxynol-9 24.2 g GENEROL
122 3.27 g Cetylpyridinium chloride 554 g Soybean oil W.sub.808P
86.5 g Glycerol monooleate 3.2:1 21.2 g Polysorbate 60 24.2 g
GENEROL 122 3.27 g Cetylpyddinium chloride 4 ml Peppermint oil 554
g Soybean oil SS 86.5 g Glycerol monooleate 3.2:1 21.2 g
Polysorbate 60 (1% bismuth in water) 24.2 g GENEROL 122 3.27 g
Cetylpyridinium chloride 554 g Soybean oil
TABLE-US-00002 TABLE 2 Nanoemulsion Formulations Nanoemulsion
Composition X8P 8% TRITON X-100; 8% Tributyl phosphate; 64% Soybean
oil; 20% Water W.sub.205EC 5% TWEEN 20; 8% Ethanol; 1%
Cetylpyridinium Chloride; 64% Soybean oil; 22% Water EC 1%
Cetylpyridinium Chloride; 8% Ethanol; 64% Soybean oil; 27% Water
Y3EC 3% TYLOXAPOL; 1% Cetylpyridinium Chloride; 8% Ethanol; 64%
Soybean oil; 24% Water X4E 4% TRITON X-100; 8% Ethanol; 64% Soybean
oil; 24% Water
[0192] Some embodiments of the present invention employ an oil
phase containing ethanol. For example, in some embodiments, the
emulsions of the present invention contain (i) an aqueous phase and
(ii) an oil phase containing ethanol as the organic solvent and
optionally a germination enhancer, and (iii) TYLOXAPOL as the
surfactant (preferably 2-5%, more preferably 3%). This formulation
is highly efficacious against microbes and is also non-irritating
and non-toxic to mammalian users (and can thus be contacted with
mucosal membranes).
[0193] In some other embodiments, the emulsions of the present
invention comprise a first emulsion emulsified within a second
emulsion, wherein (a) the first emulsion comprises (i) an aqueous
phase; and (ii) an oil phase comprising an oil and an organic
solvent; and (iii) a surfactant; and (b) the second emulsion
comprises (i) an aqueous phase; and (ii) an oil phase comprising an
oil and a cationic containing compound; and (iii) a surfactant.
[0194] The following description provides a number of exemplary
emulsions including formulations for compositions X8P and
X.sub.8W.sub.60PC. X8P comprises a water-in oil nanoemulsion, in
which the oil phase was made from soybean oil, tri-n-butyl
phosphate, and TRITON X-100 in 80% water. X.sub.8W.sub.60PC
comprises a mixture of equal volumes of X8P with W.sub.808P.
W.sub.808P is a liposome-like compound made of glycerol
monostearate, refined soya sterols (e.g., GENEROL sterols), TWEEN
60, soybean oil, a cationic ion halogen-containing CPC and
peppermint oil. The GENEROL family are a group of a polyethoxylated
soya sterols (Henkel Corporation, Ambler, Pa.). Emulsion
formulations are given in Table 1 for certain embodiments of the
present invention. These particular formulations may be found in
U.S. Pat. Nos. 5,700,679 (NN); 5,618,840; 5,549,901 (W.sub.808P);
and 5,547,677,herein incorporated by reference in their
entireties.
[0195] The X8W.sub.60PC emulsion is manufactured by first making
the W.sub.808P emulsion and X8P emulsions separately. A mixture of
these two emulsions is then re-emulsified to produce a fresh
emulsion composition termed X8W.sub.60PC. Methods of producing such
emulsions are described in U.S. Pat. Nos. 5,103,497 and 4,895,452
(herein incorporated by reference in their entireties). These
compounds have broad-spectrum antimicrobial activity, and are able
to inactivate vegetative bacteria through membrane disruption.
[0196] The compositions listed above are only exemplary and those
of skill in the art will be able to alter the amounts of the
components to arrive at a nanoemulsion composition suitable for the
purposes of the present invention. Those skilled in the art will
understand that the ratio of oil phase to water as well as the
individual oil carrier, surfactant CPC and organic phosphate
buffer, components of each composition may vary.
[0197] Although certain compositions comprising X8P have a water to
oil ratio of 4:1, it is understood that the X8P may be formulated
to have more or less of a water phase. For example, in some
embodiments, there is 3, 4, 5, 6, 7, 8, 9, 10, or more parts of the
water phase to each part of the oil phase. The same holds true for
the W.sub.808P formulation. Similarly, the ratio of
Tri(N-butyl)phosphate:TRITON X-100:soybean oil also may be
varied.
[0198] Although Table 1 lists specific amounts of glycerol
monooleate, polysorbate 60, GENEROL 122, cetylpyridinium chloride,
and carrier oil for W.sub.808P, these are merely exemplary. An
emulsion that has the properties of W.sub.808P may be formulated
that has different concentrations of each of these components or
indeed different components that will fulfill the same function.
For example, the emulsion may have between about 80 to about 100 g
of glycerol monooleate in the initial oil phase. In other
embodiments, the emulsion may have between about 15 to about 30 g
polysorbate 60 in the initial oil phase. In yet another embodiment
the composition may comprise between about 20 to about 30 g of a
GENEROL sterol, in the initial oil phase.
[0199] The nanoemulsions structure of the certain embodiments of
the emulsions of the present invention may play a role in their
biocidal activity as well as contributing to the non-toxicity of
these emulsions. For example, the active component in X8P,
TRITON-X100 shows less biocidal activity against virus at
concentrations equivalent to 11% X8P. Adding the oil phase to the
detergent and solvent markedly reduces the toxicity of these agents
in tissue culture at the same concentrations. While not being bound
to any theory (an understanding of the mechanism is not necessary
to practice the present invention, and the present invention is not
limited to any particular mechanism), it is suggested that the
nanoemulsion enhances the interaction of its components with the
pathogens thereby facilitating the inactivation of the pathogen and
reducing the toxicity of the individual components. It should be
noted that when all the components of X8P are combined in one
composition but are not in a nanoemulsion structure, the mixture is
not as effective as an antimicrobial as when the components are in
a nanoemulsion structure.
[0200] Numerous additional embodiments presented in classes of
formulations with like compositions are presented below. The effect
of a number of these compositions as antipathogenic materials is
provided in FIG. 9. The following compositions recite various
ratios and mixtures of active components. One skilled in the art
will appreciate that the below recited formulation are exemplary
and that additional formulations comprising similar percent ranges
of the recited components are within the scope of the present
invention.
[0201] In certain embodiments of the present invention, the
inventive formulation comprise from about 3 to 8 vol. % of
TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of
cetylpyridinium chloride (CPC), about 60 to 70 vol. % oil (e.g.,
soybean oil), about 15 to 25 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS), and in some formulations less than about 1 vol.
% of 1N NaOH. Some of these embodiments comprise PBS. It is
contemplated that the addition of 1N NaOH and/or PBS in some of
these embodiments, allows the user to advantageously control the pH
of the formulations, such that pH ranges from about 4.0 to about
10.0, and more preferably from about 7.1 to 8.5 are achieved. For
example, one embodiment of the present invention comprises about 3
vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of
CPC, about 64 vol. % of soybean oil, and about 24 vol. % of
DiH.sub.2O (designated herein as Y3EC). Another similar embodiment
comprises about 3.5 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
and about 1 vol. % of CPC, about 64 vol. % of soybean oil, and
about 23.5 vol. % of DiH.sub.2O (designated herein as Y3.5EC). Yet
another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8
vol. % of ethanol, about 1 vol. % of CPC, about 0.067 vol. % of 1N
NaOH, such that the pH of the formulation is about 7.1, about 64
vol. % of soybean oil, and about 23.93 vol. % of DiH.sub.2O
(designated herein as Y3EC pH 7.1). Still another embodiment
comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
about 1 vol. % of CPC, about 0.67 vol. % of 1N NaOH, such that the
pH of the formulation is about 8.5, and about 64 vol. % of soybean
oil, and about 23.33 vol. % of DiH.sub.2O (designated herein as
Y3EC pH 8.5). Another similar embodiment comprises about 4%
TYLOXAPOL, about 8 vol. % ethanol, about 1% CPC, and about 64 vol.
% of soybean oil, and about 23 vol. % of DiH.sub.2O (designated
herein as Y4EC). In still another embodiment the formulation
comprises about 8% TYLOXAPOL, about 8% ethanol, about 1 vol. % of
CPC, and about 64 vol. % of soybean oil, and about 19 vol. % of
DiH.sub.2O (designated herein as Y8EC). A further embodiment
comprises about 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 19
vol. % of 1.times.PBS (designated herein as Y8EC PBS).
[0202] In some embodiments of the present invention, the inventive
formulations comprise about 8 vol. % of ethanol, and about 1 vol. %
of CPC, and about 64 vol. % of oil (e.g., soybean oil), and about
27 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS) (designated
herein as EC).
[0203] In the present invention, some embodiments comprise from
about 8 vol. % of sodium dodecyl sulfate (SDS), about 8 vol. % of
tributyl phosphate (TBP), and about 64 vol. % of oil (e.g., soybean
oil), and about 20 vol. % of aqueous phase (e.g., DiH.sub.2O or
PBS) (designated herein as S8P).
[0204] In certain embodiments of the present invention, the
inventive formulation comprise from about 1 to 2 vol. % of TRITON
X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 7 to 8
vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride
(CPC), about 64 to 57.6 vol. % of oil (e.g., soybean oil), and
about 23 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS).
Additionally, some of these formulations further comprise about 5
mM of L-alanine/Inosine, and about 10 mM ammonium chloride. Some of
these formulations comprise PBS. It is contemplated that the
addition of PBS in some of these embodiments, allows the user to
advantageously control the pH of the formulations. For example, one
embodiment of the present invention comprises about 2 vol. % of
TRITON X-100, about 2 vol. % of TYLOXAPOL, about 8 vol. % of
ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and
about 23 vol. % of aqueous phase DiH.sub.2O. In another embodiment
the formulation comprises about 1.8 vol. % of TRITON X-100, about
1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of ethanol, about 0.9
vol. % of CPC, about 5 mM L-alanine/Inosine, and about 10 mM
ammonium chloride, about 57.6 vol. % of soybean oil, and the
remainder of 1.times.PBS (designated herein as 90% X2Y2EC/GE).
[0205] In alternative embodiments of the present invention, the
formulations comprise from about 5 vol. % of TWEEN 80, from about 8
vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of
oil (e.g., soybean oil), and about 22 vol. % of DiH.sub.2O
(designated herein as W.sub.805EC).
[0206] In still other embodiments of the present invention, the
formulations comprise from about 5 vol. % of TWEEN 20, from about 8
vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of
oil (e.g., soybean oil), and about 22 vol. % of DiH.sub.2O
(designated herein as W.sub.205EC).
[0207] In still other embodiments of the present invention, the
formulations comprise from about 2 to 8 vol. % of TRITON X-100,
about 8 vol. % of ethanol, about 1 vol. % of CPC, about 60 to 70
vol. % of oil (e.g., soybean, or olive oil), and about 15 to 25
vol. % of aqueous phase (e.g., DiH.sub.2O or PBS). For example, the
present invention contemplates formulations comprising about 2 vol.
% of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of
soybean oil, and about 26 vol. % of DiH.sub.2O (designated herein
as X2E). In other similar embodiments, the formulations comprise
about 3 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64
vol. % of soybean oil, and about 25 vol. % of DiH.sub.2O
(designated herein as X3E). In still further embodiments, the
formulations comprise about 4 vol. % TRITON X-100, about 8 vol. %
of ethanol, about 64 vol. % of soybean oil, and about 24 vol. % of
DiH.sub.2O (designated herein as X4E). In yet other embodiments,
the formulations comprise about 5 vol. % of TRITON X-100, about 8
vol. % of ethanol, about 64 vol. % of soybean oil, and about 23
vol. % of DiH.sub.2O (designated herein as X5E). Another embodiment
of the present invention comprises about 6 vol. % of TRITON X-100,
about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and
about 22 vol. % of DiH.sub.2O (designated herein as X6E). In still
further embodiments of the present invention, the formulations
comprise about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol,
about 64 vol. % of soybean oil, and about 20 vol. % of DiH.sub.2O
(designated herein as X8E). In still further embodiments of the
present invention, the formulations comprise about 8 vol. % of
TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of olive
oil, and about 20 vol. % of DiH.sub.2O (designated herein as X8E
O). In yet another embodiment comprises 8 vol. % of TRITON X-100,
about 8 vol. % ethanol, about 1 vol. % CPC, about 64 vol. % of
soybean oil, and about 19 vol. % of DiH.sub.2O (designated herein
as X8EC).
[0208] In alternative embodiments of the present invention, the
formulations comprise from about 1 to 2 vol. % of TRITON X-100,
from about 1 to 2 vol. % of TYLOXAPOL, from about 6 to 8 vol. %
TBP, from about 0.5 to 1.0 vol. % of CPC, from about 60 to 70 vol.
% of oil (e.g., soybean), and about 1 to 35 vol. % of aqueous phase
(e.g., DiH.sub.2O or PBS). Additionally, certain of these
formulations may comprise from about 1 to 5 vol. % of trypticase
soy broth, from about 0.5 to 1.5 vol. % of yeast extract, about 5
mM L-alanine/Inosine, about 10 mM ammonium chloride, and from about
20-40 vol. % of liquid baby formula. In some of the embodiments
comprising liquid baby formula, the formula comprises a casein
hydrolysate (e.g., Neutramigen, or Progestimil, and the like). In
some of these embodiments, the inventive formulations further
comprise from about 0.1 to 1.0 vol. % of sodium thiosulfate, and
from about 0.1 to 1.0 vol. % of sodium citrate. Other similar
embodiments comprising these basic components employ phosphate
buffered saline (PBS) as the aqueous phase. For example, one
embodiment comprises about 2 vol. % of TRITON X-100, about 2 vol. %
TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 64 vol.
% of soybean oil, and about 23 vol. % of DiH.sub.2O (designated
herein as X2Y2EC). In still other embodiments, the inventive
formulation comprises about 2 vol. % of TRITON X-100, about 2 vol.
% TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 0.9
vol. % of sodium thiosulfate, about 0.1 vol. % of sodium citrate,
about 64 vol. % of soybean oil, and about 22 vol. % of DiH.sub.2O
(designated herein as X2Y2PC STS1). In another similar embodiment,
the formulations comprise about 1.7 vol. % TRITON X-100, about 1.7
vol. % TYLOXAPOL, about 6.8 vol. % TBP, about 0.85% CPC, about
29.2% NEUTRAMIGEN, about 54.4 vol. % of soybean oil, and about 4.9
vol. % of DiH.sub.2O (designated herein as 85% X2Y2PC/baby). In yet
another embodiment of the present invention, the formulations
comprise about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of
TYLOXAPOL, about 7.2 vol. % of TBP, about 0.9 vol. % of CPC, about
5 mM L-alanine/Inosine, about 10 mM ammonium chloride, about 57.6
vol. % of soybean oil, and the remainder vol. % of 0.1.times.PBS
(designated herein as 90% X2Y2 PC/GE). In still another embodiment,
the formulations comprise about 1.8 vol. % of TRITON X-100, about
1.8 vol. % of TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % of
CPC, and about 3 vol. % trypticase soy broth, about 57.6 vol. % of
soybean oil, and about 27.7 vol. % of DiH.sub.2O (designated herein
as 90% X2Y2PC/TSB). In another embodiment of the present invention,
the formulations comprise about 1.8 vol. % TRITON X-100, about 1.8
vol. % TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % CPC, about
1 vol. % yeast extract, about 57.6 vol. % of soybean oil, and about
29.7 vol. % of DiH.sub.2O (designated herein as 90% X2Y2PC/YE).
[0209] In some embodiments of the present invention, the inventive
formulations comprise about 3 vol. % of TYLOXAPOL, about 8 vol. %
of TBP, and about 1 vol. % of CPC, about 60 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). In a particular embodiment of the
present invention, the inventive formulations comprise about 3 vol.
% of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC,
about 64 vol. % of soybean, and about 24 vol. % of DiH.sub.2O
(designated herein as Y3PC).
[0210] In some embodiments of the present invention, the inventive
formulations comprise from about 4 to 8 vol. % of TRITON X-100,
from about 5 to 8 vol. % of TBP, about 30 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 0 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). Additionally, certain of these
embodiments further comprise about 1 vol. % of CPC, about 1 vol. %
of benzalkonium chloride, about 1 vol. % cetylyridinium bromide,
about 1 vol. % cetyldimethyletylammonium bromide, 500 .mu.M EDTA,
about 10 mM ammonium chloride, about 5 mM Inosine, and about 5 mM
L-alanine. For example, in certain of these embodiments, the
inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 20
vol. % of DiH.sub.2O (designated herein as X8P). In another
embodiment of the present invention, the inventive formulations
comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP,
about 1% of CPC, about 64 vol. % of soybean oil, and about 19 vol.
% of DiH.sub.2O (designated herein as X8PC). In still another
embodiment, the formulations comprise about 8 vol. % TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of CPC, about 50 vol. % of
soybean oil, and about 33 vol. % of DiH.sub.2O (designated herein
as ATB-X1001). In yet another embodiment, the formulations comprise
about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol.
% of CPC, about 50 vol. % of soybean oil, and about 32 vol. % of
DiH.sub.2O (designated herein as ATB-X002). Another embodiment of
the present invention comprises about 4 vol. % TRITON X-100, about
4 vol. % of TBP, about 0.5 vol. % of CPC, about 32 vol. % of
soybean oil, and about 59.5 vol. % of DiH.sub.2O (designated herein
as 50% X8PC). Still another related embodiment comprises about 8
vol. % of TRITON X-100, about 8 vol. % of TBP, about 0.5 vol. %
CPC, about 64 vol. % of soybean oil, and about 19.5 vol. % of
DiH.sub.2O (designated herein as X8PC.sub.1/2). In some embodiments
of the present invention, the inventive formulations comprise about
8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of
CPC, about 64 vol. % of soybean oil, and about 18 vol. % of
DiH.sub.2O (designated herein as X8PC2). In other embodiments, the
inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8% of TBP, about 1% of benzalkonium chloride, about 50 vol. %
of soybean oil, and about 33 vol. % of DiH.sub.2O (designated
herein as X8P BC). In an alternative embodiment of the present
invention, the formulation comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of cetylyridinium bromide,
about 50 vol. % of soybean oil, and about 33 vol. % of DiH.sub.2O
(designated herein as X8P CPB). In another exemplary embodiment of
the present invention, the formulations comprise about 8 vol. % of
TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of
cetyldimethylethylammonium bromide, about 50 vol. % of soybean oil,
and about 33 vol. % of DiH.sub.2O (designated herein as X8P CTAB).
In still further embodiments, the present invention comprises about
8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of
CPC, about 500 .mu.M EDTA, about 64 vol. % of soybean oil, and
about 15.8 vol. % DiH.sub.2O (designated herein as X8PC EDTA).
Additional similar embodiments comprise 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of CPC, about 10 mM ammonium
chloride, about 5 mM Inosine, about 5 mM L-alanine, about 64 vol. %
of soybean oil, and about 19 vol. % of DiH.sub.2O or PBS
(designated herein as X8PC GE.sub.1x). In another embodiment of the
present invention, the inventive formulations further comprise
about 5 vol. % of TRITON X-100, about 5% of TBP, about 1 vol. % of
CPC, about 40 vol. % of soybean oil, and about 49 vol. % of
DiH.sub.2O (designated herein as X5P.sub.5C).
[0211] In some embodiments of the present invention, the inventive
formulations comprise about 2 vol. % TRITON X-100, about 6 vol. %
TYLOXAPOL, about 8 vol. % ethanol, about 64 vol. % of soybean oil,
and about 20 vol. % of DiH.sub.2O. (designated herein as
X2Y6E).
[0212] In an additional embodiment of the present invention, the
formulations comprise about 8 vol. % of TRITON X-100, and about 8
vol. % of glycerol, about 60 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 15 to 25 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Certain related embodiments further comprise
about 1 vol. % L-ascorbic acid. For example, one particular
embodiment comprises about 8 vol. % of TRITON X-100, about 8 vol. %
of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of
DiH.sub.2O (designated herein as X8G). In still another embodiment,
the inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of glycerol, about 1 vol. % of L-ascorbic acid,
about 64 vol. % of soybean oil, and about 19 vol. % of DiH.sub.2O
(designated herein as X8GV.sub.C).
[0213] In still further embodiments, the inventive formulations
comprise about 8 vol. % of TRITON X-100, from about 0.5 to 0.8 vol.
% of TWEEN 60, from about 0.5 to 2.0 vol. % of CPC, about 8 vol. %
of TBP, about 60 to 70 vol. % of oil (e.g., soybean or olive oil),
and about 15 to 25 vol. % of aqueous phase (e.g., DiH.sub.2O or
PBS). For example, in one particular embodiment the formulations
comprise about 8 vol. % of TRITON X-100, about 0.70 vol. % of TWEEN
60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. %
of soybean oil, and about 18.3 vol. % of DiH.sub.2O (designated
herein as X8W60PC.sub.1). Another related embodiment comprises
about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 18.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7X8PC). In yet other embodiments, the inventive
formulations comprise from about 8 vol. % of TRITON X-100, about
0.7 vol. % of TWEEN 60, about 0.5 vol. % of CPC, about 8 vol. % of
TBP, about 64 to 70 vol. % of soybean oil, and about 18.8 vol. % of
DiH.sub.2O (designated herein as X8W60PC.sub.2). In still other
embodiments, the present invention comprises about 8 vol. % of
TRITON X-100, about 0.71 vol. % of TWEEN 60, about 2 vol. % of CPC,
about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about
17.3 vol. % of DiH.sub.2O. In another embodiment of the present
invention, the formulations comprise about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 25.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7PC).
[0214] In another embodiment of the present invention, the
inventive formulations comprise about 2 vol. % of dioctyl
sulfosuccinate, either about 8 vol. % of glycerol, or about 8 vol.
% TBP, in addition to, about 60 to 70 vol. % of oil (e.g., soybean
or olive oil), and about 20 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). For example, one embodiment of the present
invention comprises about 2 vol. % of dioctyl sulfosuccinate, about
8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 26
vol. % of DiH.sub.2O (designated herein as D2G). In another related
embodiment, the inventive formulations comprise about 2 vol. % of
dioctyl sulfosuccinate, and about 8 vol. % of TBP, about 64 vol. %
of soybean oil, and about 26 vol. % of DiH.sub.2O (designated
herein as D2P).
[0215] In still other embodiments of the present invention, the
inventive formulations comprise about 8 to 10 vol. % of glycerol,
and about 1 to 10 vol. % of CPC, about 50 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). Additionally, in certain of these
embodiments, the compositions further comprise about 1 vol. % of
L-ascorbic acid. For example, one particular embodiment comprises
about 8 vol. % of glycerol, about 1 vol. % of CPC, about 64 vol. %
of soybean oil, and about 27 vol. % of DiH.sub.2O (designated
herein as GC). An additional related embodiment comprises about 10
vol. % of glycerol, about 10 vol. % of CPC, about 60 vol. % of
soybean oil, and about 20 vol. % of DiH.sub.2O (designated herein
as GC10). In still another embodiment of the present invention, the
inventive formulations comprise about 10 vol. % of glycerol, about
1 vol. % of CPC, about 1 vol. % of L-ascorbic acid, about 64 vol. %
of soybean or oil, and about 24 vol. % of DiH.sub.2O (designated
herein as GCV.sub.C).
[0216] In some embodiments of the present invention, the inventive
formulations comprise about 8 to 10 vol. % of glycerol, about 8 to
10 vol. % of SDS, about 50 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 15 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Additionally, in certain of these embodiments,
the compositions further comprise about 1 vol. % of lecithin, and
about 1 vol. % of p-Hydroxybenzoic acid methyl ester. Exemplary
embodiments of such formulations comprise about 8 vol. % SDS, 8
vol. % of glycerol, about 64 vol. % of soybean oil, and about 20
vol. % of DiH.sub.2O (designated herein as S8G). A related
formulation comprises about 8 vol. % of glycerol, about 8 vol. % of
SDS, about 1 vol. % of lecithin, about 1 vol. % of p-Hydroxybenzoic
acid methyl ester, about 64 vol. % of soybean oil, and about 18
vol. % of DiH.sub.2O (designated herein as S8GL1B1).
[0217] In yet another embodiment of the present invention, the
inventive formulations comprise about 4 vol. % of TWEEN 80, about 4
vol. % of TYLOXAPOL, about 1 vol. % of CPC, about 8 vol. % of
ethanol, about 64 vol. % of soybean oil, and about 19 vol. % of
DiH.sub.2O (designated herein as W.sub.804Y4EC).
[0218] In some embodiments of the present invention, the inventive
formulations comprise about 0.01 vol. % of CPC, about 0.08 vol. %
of TYLOXAPOL, about 10 vol. % of ethanol, about 70 vol. % of
soybean oil, and about 19.91 vol. % of DiH.sub.2O (designated
herein as Y.08EC.01).
[0219] In yet another embodiment of the present invention, the
inventive formulations comprise about 8 vol. % of sodium lauryl
sulfate, and about 8 vol. % of glycerol, about 64 vol. % of soybean
oil, and about 20 vol. % of DiH.sub.2O (designated herein as
SLS8G).
[0220] The specific formulations described above are simply
examples to illustrate the variety of compositions that find use in
the present invention. The present invention contemplates that many
variations of the above formulation, as well as additional
nanoemulsions, find use in the methods of the present invention. To
determine if a candidate emulsion is suitable for use with the
present invention, three criteria may be analyzed. Using the
methods and standards described herein, candidate emulsions can be
easily tested to determine if they are suitable. First, the desired
ingredients are prepared using the methods described herein, to
determine if an emulsion can be formed. If an emulsion cannot be
formed, the candidate is rejected. For example, a candidate
composition made of 4.5% sodium thiosulfate, 0.5% sodium citrate,
10% n-butanol, 64% soybean oil, and 21% DiH.sub.2O did not form an
emulsion.
[0221] Second, in preferred embodiments, the candidate emulsion
should form a stable emulsion. An emulsion is stable if it remains
in emulsion form for a sufficient period to allow its intended use.
For example, for emulsions that are to be stored, shipped, etc., it
may be desired that the composition remain in emulsion form for
months to years. Typical emulsions that are relatively unstable,
will lose their form within a day. For example, a candidate
composition made of 8% 1-butanol, 5% TWEEN 10, 1% CPC, 64% soybean
oil, and 22% DiH.sub.2O did not form a stable emulsion. The
following candidate emulsions were shown to be stable using the
methods described herein: 0.08% TRITON X-100, 0.08% Glycerol, 0.01%
Cetylpyridinium Chloride, 99% Butter, and 0.83% diH.sub.2O
(designated herein as 1% X8GC Butter); 0.8% TRITON X-100, 0.8%
Glycerol, 0.1% Cetylpyridinium Chloride, 6.4% Soybean Oil, 1.9%
diH.sub.2O, and 90% Butter (designated herein as 10% X8GC Butter);
2% W.sub.205EC, 1% Natrosol 250L NF, and 97% diH.sub.2O (designated
herein as 2% W.sub.205EC L GEL); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% 70 Viscosity Mineral Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC 70 Mineral Oil); 1%
Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% 350
Viscosity Mineral Oil, and 22% diH.sub.2O (designated herein as
W.sub.205EC 350 Mineral Oil).
[0222] Third, the candidate emulsion should have efficacy for its
intended use. For example, an anti-bacterial emulsion should kill
or disable pathogens to a detectable level. As shown herein,
certain emulsions of the present invention have efficacy against
specific microorganisms, but not against others. Using the methods
described herein, one is capable of determining the suitability of
a particular candidate emulsion against the desired microorganism.
Generally, this involves exposing the microorganism to the emulsion
for one or more time periods in a side-by-side experiment with the
appropriate control samples (e.g., a negative control such as
water) and determining if, and to what degree, the emulsion kills
or disables the microorganism. For example, a candidate composition
made of 1% ammonium chloride, 5% TWEEN 20, 8% ethanol, 64% soybean
oil, and 22% DiH.sub.2O was shown not to be an effective emulsion.
The following candidate emulsions were shown to be effective using
the methods described herein: 5% TWEEN 20, 5% Cetylpyridinium
Chloride, 10% Glycerol, 60% Soybean Oil, and 20% diH.sub.2O
(designated herein as W.sub.205GC5); 1% Cetylpyridinium Chloride,
5% TWEEN 20, 10% Glycerol, 64% Soybean Oil, and 20% diH.sub.2O
(designated herein as W.sub.205GC); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% Olive Oil, and 22% diH.sub.2O (designated
herein as W.sub.205EC Olive Oil); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% Flaxseed Oil, and 22% diH.sub.2O
(designated herein as W.sub.205EC Flaxseed Oil); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Corn Oil, and 22% diH.sub.2O
(designated herein as W.sub.205EC Corn Oil); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Coconut Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC Coconut Oil); 1%
Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Cottonseed
Oil, and 22% diH.sub.2O (designated herein as W.sub.205EC
Cottonseed Oil); 8% Dextrose, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C Dextrose); 8% PEG 200, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C PEG 200); 8% Methanol, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C Methanol); 8% PEG 1000, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C PEG 1000); 2% W.sub.205EC, 2% Natrosol 250H NF, and 96%
diH.sub.2O (designated herein as 2% W.sub.205EC Natrosol 2, also
called 2% W.sub.205EC GEL); 2% W.sub.205EC, 1% Natrosol 250H NF,
and 97% diH.sub.2O (designated herein as 2% W.sub.205EC Natrosol
1); 2% W.sub.205EC, 3% Natrosol 250H NF, and 95% diH.sub.2O
(designated herein as 2% W.sub.205EC Natrosol 3); 2% W.sub.205EC,
0.5% Natrosol 250H NF, and 97.5% diH.sub.2O (designated herein as
2% W.sub.205EC Natrosol 0.5); 2% W.sub.205EC, 2% Methocel A, and
96% diH.sub.2O (designated herein as 2% W.sub.205EC Methocel A); 2%
W.sub.205EC, 2% Methocel K, and 96% diH.sub.2O (designated herein
as 2% W.sub.205EC Methocel K); 2% Natrosol, 0.1% X8PC,
0.1.times.PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, and diH.sub.2O (designated herein as 0.1% X8PC/GE+2%
Natrosol); 2% Natrosol, 0.8% TRITON X-100, 0.8% Tributyl Phosphate,
6.4% Soybean Oil, 0.1% Cetylpyridinium Chloride, 0.1.times.PBS, 5
mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH.sub.2O
(designated herein as 10% X8PC/GE+2% Natrosol); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Lard, and 22% diH.sub.2O
(designated herein as W.sub.205EC Lard); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Mineral Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC Mineral Oil); 0.1%
Cetylpyridinium Chloride, 2% Nerolidol, 5% TWEEN 20, 10% Ethanol,
64% Soybean Oil, and 18.9% diH.sub.2O (designated herein as
W.sub.205EC.sub.0.1N); 0.1% Cetylpyridinium Chloride, 2% Farnesol,
5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH.sub.2O
(designated herein as W.sub.205EC.sub.0.1F); 0.1% Cetylpyridinium
Chloride, 5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 20.9%
diH.sub.2O (designated herein as W.sub.205EC.sub.0.1); 10%
Cetylpyridinium Chloride, 8% Tributyl Phosphate, 8% TRITON X-100,
54% Soybean Oil, and 20% diH.sub.2O (designated herein as
X8PC.sub.10); 5% Cetylpyridinium Chloride, 8% TRITON X-100, 8%
Tributyl Phosphate, 59% Soybean Oil, and 20% diH.sub.2O (designated
herein as X8PC.sub.5); 0.02% Cetylpyridinium Chloride, 0.1% TWEEN
20, 10% Ethanol, 70% Soybean Oil, and 19.88% diH.sub.2O (designated
herein as W.sub.200.1EC.sub.0.02); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Glycerol, 64% Mobil 1, and 22% diH.sub.2O (designated
herein as W.sub.205GC Mobil 1); 7.2% TRITON X-100, 7.2% Tributyl
Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil,
0.1.times.PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, and 25.87% diH.sub.2O (designated herein as 90% X8PC/GE);
7.2% TRITON X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium
Chloride, 57.6% Soybean Oil, 1% EDTA, 5 mM L-alanine, 5 mM Inosine,
10 mM Ammonium Chloride, 0.1.times.PBS, and diH.sub.2O (designated
herein as 90% X8PC/GE EDTA); and 7.2% TRITON X-100, 7.2% Tributyl
Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1%
Sodium Thiosulfate, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, 0.1.times.PBS, and diH.sub.2O (designated herein as 90%
X8PC/GE STS).
[0223] 1. Aqueous Phase
[0224] In some embodiments, the emulsion comprises an aqueous
phase. In certain preferred embodiments, the emulsion comprises
about 5 to 50, preferably 10 to 40, more preferably 15 to 30, vol.
% aqueous phase, based on the total volume of the emulsion
(although other concentrations are also contemplated). In preferred
embodiments, the aqueous phase comprises water at a pH of about 4
to 10, preferably about 6 to 8. The water is preferably deionized
(hereinafter "DiH.sub.2O"). In some embodiments, the aqueous phase
comprises phosphate buffered saline (PBS). In some preferred
embodiments, the aqueous phase is sterile and pyrogen free.
[0225] 2. Oil Phase
[0226] In some embodiments, the emulsion comprises an oil phase. In
certain preferred embodiments, the oil phase (e.g., carrier oil) of
the emulsion of the present invention comprises 30-90, preferably
60-80, and more preferably 60-70, vol. % of oil, based on the total
volume of the emulsion (although other concentrations are also
contemplated). Suitable oils include, but are not limited to,
soybean oil, avocado oil, squalene oil, squalene oil, olive oil,
canola oil, corn oil, rapeseed oil, safflower oil, sunflower oil,
fish oils, flavor oils, water insoluble vitamins and mixtures
thereof. In particularly preferred embodiments, soybean oil is
used. In preferred embodiments of the present invention, the oil
phase is preferably distributed throughout the aqueous phase as
droplets having a mean particle size in the range from about 1-2
microns, more preferably from 0.2 to 0.8, and most preferably about
0.8 microns. In other embodiments, the aqueous phase can be
distributed in the oil phase.
[0227] In some embodiments, the oil phase comprises 3-15, and
preferably 5-10 vol. % of an organic solvent, based on the total
volume of the emulsion. While the present invention is not limited
to any particular mechanism, it is contemplated that the organic
phosphate-based solvents employed in the emulsions serve to remove
or disrupt the lipids in the membranes of the pathogens. Thus, any
solvent that removes the sterols or phospholipids in the microbial
membranes finds use in the methods of the present invention.
Suitable organic solvents include, but are not limited to, organic
phosphate based solvents or alcohols. In some preferred
embodiments, non-toxic alcohols (e.g., ethanol) are used as a
solvent. The oil phase, and any additional compounds provided in
the oil phase, are preferably sterile and pyrogen free.
[0228] 3. Surfactants and Detergents
[0229] In some embodiments, the emulsions further comprises a
surfactant or detergent. In some preferred embodiments, the
emulsion comprises from about 3 to 15%, and preferably about 10% of
one or more surfactants or detergents (although other
concentrations are also contemplated). While the present invention
is not limited to any particular mechanism, it is contemplated that
surfactants, when present in the emulsions, help to stabilize the
emulsions. Both non-ionic (non-anionic) and ionic surfactants are
contemplated. Additionally, surfactants from the BRIJ family of
surfactants find use in the compositions of the present invention.
The surfactant can be provided in either the aqueous or the oil
phase. Surfactants suitable for use with the emulsions include a
variety of anionic and nonionic surfactants, as well as other
emulsifying compounds that are capable of promoting the formation
of oil-in-water emulsions. In general, emulsifying compounds are
relatively hydrophilic, and blends of emulsifying compounds can be
used to achieve the necessary qualities. In some formulations,
nonionic surfactants have advantages over ionic emulsifiers in that
they are substantially more compatible with a broad pH range and
often form more stable emulsions than do ionic (e.g., soap-type)
emulsifiers. Thus, in certain preferred embodiments, the
compositions of the present invention comprise one or more
non-ionic surfactants such as polysorbate surfactants (e.g.,
polyoxyethylene ethers), polysorbate detergents,
pheoxypolyethoxyethanols, and the like. Examples of polysorbate
detergents useful in the present invention include, but are not
limited to, TWEEN 20, TWEEN 40, TWEEN 60, TWEEN 80, etc.
[0230] TWEEN 60 (polyoxyethylenesorbitan monostearate), together
with TWEEN 20, TWEEN 40 and TWEEN 80, comprise polysorbates that
are used as emulsifiers in a number of pharmaceutical compositions.
In some embodiments of the present invention, these compounds are
also used as co-components with adjuvants. TWEEN surfactants also
appear to have virucidal effects on lipid-enveloped viruses (See
e.g., Eriksson et al., Blood Coagulation and Fibtinolysis 5 (Suppl.
3):S37-S44 (1994)).
[0231] Examples of pheoxypolyethoxyethanols, and polymers thereof,
useful in the present invention include, but are not limited to,
TRITON (e.g., X-100, X-301, X-165, X-102, X-200), and TYLOXAPOL.
TRITON X-100 is a strong non-ionic detergent and dispersing agent
widely used to extract lipids and proteins from biological
structures. It also has virucidal effect against broad spectrum of
enveloped viruses (See e.g., Maha and Igarashi, Southeast Asian J.
Trop. Med. Pub. Health 28:718 (1997); and Portocala et al.,
Virologie 27:261 (1976)). Due to this anti-viral activity, it is
employed to inactivate viral pathogens in fresh frozen human plasma
(See e.g., Horowitz et al., Blood 79:826 (1992)).
[0232] The present invention is not limited to the surfactants
disclosed herein. Additional surfactants and detergents useful in
the compositions of the present invention may be ascertained from
reference works (e.g., including, but not limited to, McCutheon's
Volume 1: Emulsions and Detergents--North American Edition, 2000)
and commercial sources.
[0233] 4. Cationic Halogens Containing Compounds
[0234] In some embodiments, the emulsions further comprise a
cationic halogen containing compound. In some preferred
embodiments, the emulsion comprises from about 0.5 to 1.0 wt. % or
more of a cationic halogen containing compound, based on the total
weight of the emulsion (although other concentrations are also
contemplated). In preferred embodiments, the cationic
halogen-containing compound is preferably premixed with the oil
phase; however, it should be understood that the cationic
halogen-containing compound may be provided in combination with the
emulsion composition in a distinct formulation. Suitable halogen
containing compounds may be selected from compounds comprising
chloride, fluoride, bromide and iodide ions. In preferred
embodiments, suitable cationic halogen containing compounds
include, but are not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, or
tetradecyltrimethylammonium halides. In some particular
embodiments, suitable cationic halogen containing compounds
comprise, but are not limited to, cetylpyridinium chloride (CPC),
cetyltrimethylammonium chloride, cetylbenzyldimethylammonium
chloride, cetylpyridinium bromide (CPB), and cetyltrimethylammonium
bromide (CTAB), cetyldimethylethylammonium bromide,
cetyltributylphosphonium bromide, dodecyltrimethylammonium bromide,
and tetrad ecyltrimethylammonium bromide. In particularly preferred
embodiments, the cationic halogen-containing compound is CPC,
although the compositions of the present invention are not limited
to formulation with any particular cationic containing
compound.
[0235] 5. Germination Enhancers
[0236] In other embodiments of the present invention, the
nanoemulsions further comprise a germination enhancer. In some
preferred embodiments, the emulsions comprise from about 1 mM to 15
mM, and more preferably from about 5 mM to 10 mM of one or more
germination enhancing compounds (although other concentrations are
also contemplated). In preferred embodiments, the germination
enhancing compound is provided in the aqueous phase prior to
formation of the emulsion. The present invention contemplates that
when germination enhancers are added to the nanoemulsion
compositions, the sporicidal properties of the nanoemulsions are
enhanced. The present invention further contemplates that such
germination enhancers initiate sporicidal activity near neutral pH
(between pH 6-8, and preferably 7). Such neutral pH emulsions can
be obtained, for example, by diluting with phosphate buffer saline
(PBS) or by preparations of neutral emulsions. The sporicidal
activity of the nanoemulsion preferentially occurs when the spores
initiate germination.
[0237] In specific embodiments, it has been demonstrated that the
emulsions utilized in the vaccines of the present invention have
sporicidal activity. While the present invention is not limited to
any particular mechanism and an understanding of the mechanism is
not required to practice the present invention, it is believed that
the fusigenic component of the emulsions acts to initiate
germination and before reversion to the vegetative form is complete
the lysogenic component of the emulsion acts to lyse the newly
germinating spore. These components of the emulsion thus act in
concert to leave the spore susceptible to disruption by the
emulsions. The addition of germination enhancer further facilitates
the anti-sporicidal activity of the emulsions, for example, by
speeding up the rate at which the sporicidal activity occurs.
[0238] Germination of bacterial endospores and fungal spores is
associated with increased metabolism and decreased resistance to
heat and chemical reactants. For germination to occur, the spore
must sense that the environment is adequate to support vegetation
and reproduction. The amino acid L-alanine stimulates bacterial
spore germination (See e.g., Hills, J. Gen. Micro. 4:38 (1950); and
Halvorson and Church, Bacteriol Rev. 21:112 (1957)). L-alanine and
L-proline have also been reported to initiate fungal spore
germination (Yanagita, Arch Mikrobiol 26:329 (1957)). Simple
.alpha.-amino acids, such as glycine and L-alanine, occupy a
central position in metabolism. Transamination or deamination of
.alpha.-amino acids yields the glycogenic or ketogenic
carbohydrates and the nitrogen needed for metabolism and growth.
For example, transamination or deamination of L-alanine yields
pyruvate, which is the end product of glycolytic metabolism
(Embden-Meyerhof-Parnas Pathway). Oxidation of pyruvate by pyruvate
dehydrogenase complex yields acetyl-CoA, NADH, H.sup.+, and
CO.sub.2. Acetyl-CoA is the initiator substrate for the
tricarboxylic acid cycle (Kreb's Cycle), which in turns feeds the
mitochondrial electron transport chain. Acetyl-CoA is also the
ultimate carbon source for fatty acid synthesis as well as for
sterol synthesis. Simple .alpha.-amino acids can provide the
nitrogen, CO.sub.2, glycogenic and/or ketogenic equivalents
required for germination and the metabolic activity that
follows.
[0239] In certain embodiments, suitable germination enhancing
agents of the invention include, but are not limited to,
.alpha.-amino acids comprising glycine and the L-enantiomers of
alanine, valine, leucine, isoleucine, serine, threonine, lysine,
phenylalanine, tyrosine, and the alkyl esters thereof. Additional
information on the effects of amino acids on germination may be
found in U.S. Pat. No. 5,510,104; herein incorporated by reference
in its entirety. In some embodiments, a mixture of glucose,
fructose, asparagine, sodium chloride (NaCl), ammonium chloride
(NH.sub.4Cl), calcium chloride (CaCl.sub.2) and potassium chloride
(KCl) also may be used. In particularly preferred embodiments of
the present invention, the formulation comprises the germination
enhancers L-alanine, CaCl.sub.2, Inosine and NH.sub.4Cl. In some
embodiments, the compositions further comprise one or more common
forms of growth media (e.g., trypticase soy broth, and the like)
that additionally may or may not itself comprise germination
enhancers and buffers.
[0240] The above compounds are merely exemplary germination
enhancers and it is understood that other known germination
enhancers will find use in the nanoemulsions utilized in some
embodiments of the present invention. A candidate germination
enhancer should meet two criteria for inclusion in the compositions
of the present invention: it should be capable of being associated
with the emulsions disclosed herein and it should increase the rate
of germination of a target spore when incorporated in the emulsions
disclosed herein. One skilled in the art can determine whether a
particular agent has the desired function of acting as an
germination enhancer by applying such an agent in combination with
the nanoemulsions disclosed herein to a target and comparing the
inactivation of the target when contacted by the admixture with
inactivation of like targets by the composition of the present
invention without the agent. Any agent that increases germination,
and thereby decreases or inhibits the growth of the organisms, is
considered a suitable enhancer for use in the nanoemulsion
compositions disclosed herein.
[0241] In still other embodiments, addition of a germination
enhancer (or growth medium) to a neutral emulsion composition
produces a composition that is useful in inactivating bacterial
spores in addition to enveloped viruses, Gram negative bacteria,
and Gram positive bacteria for use in the vaccine compositions of
the present invention.
[0242] 6. Interaction Enhancers
[0243] In still other embodiments, nanoemulsions comprise one or
more compounds capable of increasing the interaction of the
compositions (i.e., "interaction enhancer") with target pathogens
(e.g., the cell wall of Gram negative bacteria such as Vibrio,
Salmonella, Shigella and Pseudomonas). In preferred embodiments,
the interaction enhancer is preferably premixed with the oil phase;
however, in other embodiments the interaction enhancer is provided
in combination with the compositions after emulsification. In
certain preferred embodiments, the interaction enhancer is a
chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA) or
ethylenebis(oxyethylenenitrilo)tetraacetic acid (EGTA) in a buffer
(e.g., tris buffer)). It is understood that chelating agents are
merely exemplary interaction enhancing compounds. Indeed, other
agents that increase the interaction of the nanoemulsions used in
some embodiments of the present invention with microbial agents
and/or pathogens are contemplated. In particularly preferred
embodiments, the interaction enhancer is at a concentration of
about 50 to about 250 .mu.M. One skilled in the art will be able to
determine whether a particular agent has the desired function of
acting as an interaction enhancer by applying such an agent in
combination with the compositions of the present invention to a
target and comparing the inactivation of the target when contacted
by the admixture with inactivation of like targets by the
composition of the present invention without the agent. Any agent
that increases the interaction of an emulsion with bacteria and
thereby decreases or inhibits the growth of the bacteria, in
comparison to that parameter in its absence, is considered an
interaction enhancer.
[0244] In some embodiments, the addition of an interaction enhancer
to nanoemulsion produces a composition that is useful in
inactivating enveloped viruses, some Gram positive bacteria and
some Gram negative bacteria for use in the vaccine compositions of
the present invention.
[0245] 7. Quaternary Ammonium Compounds
[0246] In some embodiments, nanoemulsions of the present invention
include a quaternary ammonium containing compound. Exemplary
quaternary ammonium compounds include, but are not limited to,
Alkyl dimethyl benzyl ammonium chloride, didecyl dimethyl ammonium
chloride, Alkyl dimethyl benzyl and dialkyl dimethyl ammonium
chloride, N,N-Dimethyl-2-hydroxypropylammonium chloride polymer,
Didecyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl
ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride,
Dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl
ammonium chloride; n-Tetradecyl dimethyl benzyl ammonium chloride
monohydrate, n-Alkyl dimethyl benzyl ammonium chloride, Dialkyl
dimethyl ammonium chloride,
Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Myristalkonium
chloride (and) Quat RNIUM 14, Alkyl bis(2-hydroxyethyl)benzyl
ammonium chloride, Alkyl demethyl benzyl ammonium chloride, Alkyl
dimethyl 3,4-dichlorobenzyl ammonium chloride, Alkyl dimethyl
benzyl ammonium chloride, Alkyl dimethyl benzyl dimethylbenzyl
ammonium, Alkyl dimethyl dimethylbenzyl ammonium chloride, Alkyl
dimethyl ethyl ammonium bromide, Alkyl dimethyl ethyl ammonium
bromide, Alkyl dimethyl ethylbenzyl ammonium chloride, Alkyl
dimethyl isopropylbenzyl ammonium chloride, Alkyl trimethyl
ammonium chloride, Alkyl 1 or 3
benzyl-1-(2-hydroxethyl)-2-imidazolinium chloride, Dialkyl methyl
benzyl ammonium chloride, Dialkyl dimethyl ammonium chloride,
Didecyl dimethyl ammonium chloride,
2-(2-(p-(Diisobutyl)cresosxy)ethoxy)ethyl dimethyl benzyl ammonium
chloride, 2-(2-(p-(Diisobutyl)phenoxy)ethoxy)ethyl dimethyl benzyl
ammonium chloride, Dioctyl dimethyl ammonium chloride, Dodecyl
bis(2-hydroxyethyl) octyl hydrogen ammonium chloride, Dodecyl
dimethyl benzyl ammonium chloride, Dodecylcarbamoyl methyl dimethyl
benzyl ammonium chloride, Heptadecyl hydroxyethylimidazolinium
chloride, Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Octyl
decyl dimethyl ammonium chloride, Octyl dodecyl dimethyl ammonium
chloride, Octyphenoxyethoxyethyl dimethyl benzyl ammonium chloride,
Oxydiethylenebis(alkyl dimethyl ammonium chloride), Quaternary
ammonium compounds, dicoco alkyldimethyl, chloride, Trimethoxysilyl
quats, and Trimethyl dodecylbenzyl ammonium chloride.
[0247] 8. Other Components
[0248] In some embodiments, a nanoemulsion comprises one or more
additional components that provide a desired property or
functionality to the nanoemulsions. These components may be
incorporated into the aqueous phase or the oil phase of the
nanoemulsions and/or may be added prior to or following
emulsification. For example, in some embodiments, the nanoemulsions
further comprise phenols (e.g., triclosan, phenyl phenol),
acidifying agents (e.g., citric acid (e.g., 1.5-6%), acetic acid,
lemon juice), alkylating agents (e.g., sodium hydroxide (e.g.,
0.3%)), buffers (e.g., citrate buffer, acetate buffer, and other
buffers useful to maintain a specific pH), and halogens (e.g.,
polyvinylpyrrolidone, sodium hypochlorite, hydrogen peroxide).
[0249] Exemplary techniques for making a nanoemulsion (e.g., used
to inactivate a pathogen and/or generation of an immunogenic
composition of the present invention) are described below.
Additionally, a number of specific, although exemplary, formulation
recipes are also set forth below.
Formulation Techniques
[0250] Nanoemulsions of the present invention can be formed using
classic emulsion forming techniques. In brief, the oil phase is
mixed with the aqueous phase under relatively high shear forces
(e.g., using high hydraulic and mechanical forces) to obtain an
oil-in-water nanoemulsion. The emulsion is formed by blending the
oil phase with an aqueous phase on a volume-to-volume basis ranging
from about 1:9 to 5:1, preferably about 5:1 to 3:1, most preferably
4:1, oil phase to aqueous phase. The oil and aqueous phases can be
blended using any apparatus capable of producing shear forces
sufficient to form an emulsion such as French Presses or high shear
mixers (e.g., FDA approved high shear mixers are available, for
example, from Admix, Inc., Manchester, N.H.). Methods of producing
such emulsions are described in U.S. Pat. Nos. 5,103,497 and
4,895,452, herein incorporated by reference in their
entireties.
[0251] In preferred embodiments, compositions used in the methods
of the present invention comprise droplets of an oily discontinuous
phase dispersed in an aqueous continuous phase, such as water. In
preferred embodiments, nanoemulsions of the present invention are
stable, and do not decompose even after long storage periods (e.g.,
greater than one or more years). Furthermore, in some embodiments,
nanoemulsions are stable (e.g., in some embodiments for greater
than 3 months, in some embodiments for greater than 6 months, in
some embodiments for greater than 12 months, in some embodiments
for greater than 18 months) after combination with an immunogen
(e.g., a pathogen). In preferred embodiments, nanoemulsions of the
present invention are non-toxic and safe when administered (e.g.,
via spraying or contacting mucosal surfaces, swallowed, inhaled,
etc.) to a subject.
[0252] In some embodiments, a portion of the emulsion may be in the
form of lipid structures including, but not limited to,
unilamellar, multilamellar, and paucliamellar lipid vesicles,
micelles, and lamellar phases.
[0253] Some embodiments of the present invention employ an oil
phase containing ethanol. For example, in some embodiments, the
emulsions of the present invention contain (i) an aqueous phase and
(ii) an oil phase containing ethanol as the organic solvent and
optionally a germination enhancer, and (iii) TYLOXAPOL as the
surfactant (preferably 2-5%, more preferably 3%). This formulation
is highly efficacious for inactivation of pathogens and is also
non-irritating and non-toxic to mammalian subjects (e.g., and thus
can be used for administration to a mucosal surface).
[0254] In some other embodiments, the emulsions of the present
invention comprise a first emulsion emulsified within a second
emulsion, wherein (a) the first emulsion comprises (i) an aqueous
phase; and (ii) an oil phase comprising an oil and an organic
solvent; and (iii) a surfactant; and (b) the second emulsion
comprises (i) an aqueous phase; and (ii) an oil phase comprising an
oil and a cationic containing compound; and (iii) a surfactant.
Exemplary Formulations
[0255] The following description provides a number of exemplary
emulsions including formulations for compositions BCTP and
X8W.sub.60PC. BCTP comprises a water-in oil nanoemulsion, in which
the oil phase was made from soybean oil, tri-n-butyl phosphate, and
TRITON X-100 in 80% water. X.sub.8W.sub.60PC comprises a mixture of
equal volumes of BCTP with W.sub.808P. W.sub.808P is a
liposome-like compound made of glycerol monostearate, refined by a
sterols (e.g., GENEROL sterols), TWEEN 60, soybean oil, a cationic
ion halogen-containing CPC and peppermint oil. The GENEROL family
are a group of a polyethoxylated soya sterols (Henkel Corporation,
Ambler, Pa.). Exemplary emulsion formulations useful in the present
invention are provided in Table 1B. These particular formulations
may be found in U.S. Pat. Nos. 5,700,679 (NN); 5,618,840; 5,549,901
(W.sub.808P); and 5,547,677, each of which is hereby incorporated
by reference in their entireties. Certain other emulsion
formulations are presented U.S. patent application Ser. No.
10/669,865, hereby incorporated by reference in its entirety.
[0256] The X.sub.8W.sub.60PC emulsion is manufactured by first
making the W.sub.808P emulsion and BCTP emulsions separately. A
mixture of these two emulsions is then re-emulsified to produce a
fresh emulsion composition termed X.sub.8W.sub.60PC. Methods of
producing such emulsions are described in U.S. Pat. Nos. 5,103,497
and 4,895,452 (each of which is herein incorporated by reference in
their entireties).
TABLE-US-00003 TABLE 1B Water to Oil Oil Phase Formula Phase Ratio
(Vol/Vol) BCTP 1 vol. Tri(N-butyl)phosphate 4:1 1 vol. TRITON X-100
8 vol. Soybean oil NN 86.5 g Glycerol monooleate 3:1 60.1 ml
Nonoxynol-9 24.2 g GENEROL 122 3.27 g Cetylpyridinium chloride 554
g Soybean oil W.sub.808P 86.5 g Glycerol monooleate 3.2:1 21.2 g
Polysorbate 60 24.2 g GENEROL 122 3.27 g Cetylpyddinium chloride 4
ml Peppermint oil 554 g Soybean oil SS 86.5 g Glycerol monooleate
3.2:1 21.2 g Polysorbate 60 (1% bismuth in water) 24.2 g GENEROL
122 3.27 g Cetylpyridinium chloride 554 g Soybean oil
[0257] The compositions listed above are only exemplary and those
of skill in the art will be able to alter the amounts of the
components to arrive at a nanoemulsion composition suitable for the
purposes of the present invention. Those skilled in the art will
understand that the ratio of oil phase to water as well as the
individual oil carrier, surfactant CPC and organic phosphate
buffer, components of each composition may vary.
[0258] Although certain compositions comprising BCTP have a water
to oil ratio of 4:1, it is understood that the BCTP may be
formulated to have more or less of a water phase. For example, in
some embodiments, there is 3, 4, 5, 6, 7, 8, 9, 10, or more parts
of the water phase to each part of the oil phase. The same holds
true for the W.sub.808P formulation. Similarly, the ratio of
Tri(N-butyl)phosphate:TRITON X-100:soybean oil also may be
varied.
[0259] Although Table 1B lists specific amounts of glycerol
monooleate, polysorbate 60, GENEROL 122, cetylpyridinium chloride,
and carrier oil for W.sub.808P, these are merely exemplary. An
emulsion that has the properties of W.sub.808P may be formulated
that has different concentrations of each of these components or
indeed different components that will fulfill the same function.
For example, the emulsion may have between about 80 to about 100 g
of glycerol monooleate in the initial oil phase. In other
embodiments, the emulsion may have between about 15 to about 30 g
polysorbate 60 in the initial oil phase. In yet another embodiment
the composition may comprise between about 20 to about 30 g of a
GENEROL sterol, in the initial oil phase.
[0260] Individual components of nanoemulsions (e.g. in an
immunogenic composition of the present invention) can function both
to inactivate a pathogen as well as to contribute to the
non-toxicity of the emulsions. For example, the active component in
BCTP, TRITON-X-100, shows less ability to inactivate a virus at
concentrations equivalent to 11% BCTP. Adding the oil phase to the
detergent and solvent markedly reduces the toxicity of these agents
in tissue culture at the same concentrations. While not being bound
to any theory (an understanding of the mechanism is not necessary
to practice the present invention, and the present invention is not
limited to any particular mechanism), it is suggested that the
nanoemulsion enhances the interaction of its components with the
pathogens thereby facilitating the inactivation of the pathogen and
reducing the toxicity of the individual components. Furthermore,
when all the components of BCTP are combined in one composition but
are not in a nanoemulsion structure, the mixture is not as
effective at inactivating a pathogen as when the components are in
a nanoemulsion structure.
[0261] Numerous additional embodiments presented in classes of
formulations with like compositions are presented below. The
following compositions recite various ratios and mixtures of active
components. One skilled in the art will appreciate that the below
recited formulation are exemplary and that additional formulations
comprising similar percent ranges of the recited components are
within the scope of the present invention.
[0262] In certain embodiments of the present invention, a
nanoemulsion comprises from about 3 to 8 vol. % of TYLOXAPOL, about
8 vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride
(CPC), about 60 to 70 vol. % oil (e.g., soybean oil), about 15 to
25 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS), and in some
formulations less than about 1 vol. % of 1N NaOH. Some of these
embodiments comprise PBS. It is contemplated that the addition of
1N NaOH and/or PBS in some of these embodiments, allows the user to
advantageously control the pH of the formulations, such that pH
ranges from about 7.0 to about 9.0, and more preferably from about
7.1 to 8.5 are achieved. For example, one embodiment of the present
invention comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of
ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and
about 24 vol. % of DiH.sub.2O (designated herein as Y3EC). Another
similar embodiment comprises about 3.5 vol. % of TYLOXAPOL, about 8
vol. % of ethanol, and about 1 vol. % of CPC, about 64 vol. % of
soybean oil, and about 23.5 vol. % of DiH.sub.2O (designated herein
as Y3.5EC). Yet another embodiment comprises about 3 vol. % of
TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of CPC, about
0.067 vol. % of 1N NaOH, such that the pH of the formulation is
about 7.1, about 64 vol. % of soybean oil, and about 23.93 vol. %
of DiH.sub.2O (designated herein as Y3EC pH 7.1). Still another
embodiment comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of
ethanol, about 1 vol. % of CPC, about 0.67 vol. % of 1N NaOH, such
that the pH of the formulation is about 8.5, and about 64 vol. % of
soybean oil, and about 23.33 vol. % of DiH.sub.2O (designated
herein as Y3EC pH 8.5). Another similar embodiment comprises about
4% TYLOXAPOL, about 8 vol. % ethanol, about 1% CPC, and about 64
vol. % of soybean oil, and about 23 vol. % of DiH.sub.2O
(designated herein as Y4EC). In still another embodiment the
formulation comprises about 8% TYLOXAPOL, about 8% ethanol, about 1
vol. % of CPC, and about 64 vol. % of soybean oil, and about 19
vol. % of DiH.sub.2O (designated herein as Y8EC). A further
embodiment comprises about 8 vol. % of TYLOXAPOL, about 8 vol. % of
ethanol, about 1 vol. % of CPC, about 64 vol. % of soybean oil, and
about 19 vol. % of 1.times.PBS (designated herein as Y8EC PBS).
[0263] In some embodiments of the present invention, a nanoemulsion
comprises about 8 vol. % of ethanol, and about 1 vol. % of CPC, and
about 64 vol. % of oil (e.g., soybean oil), and about 27 vol. % of
aqueous phase (e.g., DiH.sub.2O or PBS) (designated herein as
EC).
[0264] In some embodiments, a nanoemulsion comprises from about 8
vol. % of sodium dodecyl sulfate (SDS), about 8 vol. % of tributyl
phosphate (TBP), and about 64 vol. % of oil (e.g., soybean oil),
and about 20 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS)
(designated herein as S8P).
[0265] In some embodiments, a nanoemulsion comprises from about 1
to 2 vol. % of TRITON X-100, from about 1 to 2 vol. % of TYLOXAPOL,
from about 7 to 8 vol. % of ethanol, about 1 vol. % of
cetylpyridinium chloride (CPC), about 64 to 57.6 vol. % of oil
(e.g., soybean oil), and about 23 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Additionally, some of these formulations
further comprise about 5 mM of L-alanine/Inosine, and about 10 mM
ammonium chloride. Some of these formulations comprise PBS. It is
contemplated that the addition of PBS in some of these embodiments,
allows the user to advantageously control the pH of the
formulations. For example, one embodiment of the present invention
comprises about 2 vol. % of TRITON X-100, about 2 vol. % of
TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % CPC, about 64
vol. % of soybean oil, and about 23 vol. % of aqueous phase
DiH.sub.2O. In another embodiment the formulation comprises about
1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about
7.2 vol. % of ethanol, about 0.9 vol. % of CPC, about 5 mM
L-alanine/Inosine, and about 10 mM ammonium chloride, about 57.6
vol. % of soybean oil, and the remainder of 1.times.PBS (designated
herein as 90% X2Y2EC/GE).
[0266] In alternative embodiments, a nanoemulsion comprises from
about 5 vol. % of TWEEN 80, from about 8 vol. % of ethanol, from
about 1 vol. % of CPC, about 64 vol. % of oil (e.g., soybean oil),
and about 22 vol. % of DiH.sub.2O (designated herein as
W.sub.805EC).
[0267] In still other embodiments of the present invention, a
nanoemulsion comprises from about 5 vol. % of TWEEN 20, from about
8 vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of
oil (e.g., soybean oil), and about 22 vol. % of DiH.sub.2O
(designated herein as W.sub.205EC).
[0268] In still other embodiments of the present invention, a
nanoemulsion comprises from about 2 to 8 vol. % of TRITON X-100,
about 8 vol. % of ethanol, about 1 vol. % of CPC, about 60 to 70
vol. % of oil (e.g., soybean, or olive oil), and about 15 to 25
vol. % of aqueous phase (e.g., DiH.sub.2O or PBS). For example, the
present invention contemplates formulations comprising about 2 vol.
% of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of
soybean oil, and about 26 vol. % of DiH.sub.2O (designated herein
as X2E). In other similar embodiments, a nanoemulsion comprises
about 3 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64
vol. % of soybean oil, and about 25 vol. % of DiH.sub.2O
(designated herein as X3E). In still further embodiments, the
formulations comprise about 4 vol. % Triton of X-100, about 8 vol.
% of ethanol, about 64 vol. % of soybean oil, and about 24 vol. %
of DiH.sub.2O (designated herein as X4E). In yet other embodiments,
a nanoemulsion comprises about 5 vol. % of TRITON X-100, about 8
vol. % of ethanol, about 64 vol. % of soybean oil, and about 23
vol. % of DiH.sub.2O (designated herein as X5E). In some
embodiments, a nanoemulsion comprises about 6 vol. % of TRITON
X-100, about 8 vol. % of ethanol, about 64 vol. % of soybean oil,
and about 22 vol. % of DiH.sub.2O (designated herein as X6E). In
still further embodiments of the present invention, a nanoemulsion
comprises about 8 vol. % of TRITON X-100, about 8 vol. % of
ethanol, about 64 vol. % of soybean oil, and about 20 vol. % of
DiH.sub.2O (designated herein as X8E). In still further
embodiments, a nanoemulsion comprises about 8 vol. % of TRITON
X-100, about 8 vol. % of ethanol, about 64 vol. % of olive oil, and
about 20 vol. % of DiH.sub.2O (designated herein as X8E O). In yet
another embodiment, a nanoemulsion comprises 8 vol. % of TRITON
X-100, about 8 vol. % ethanol, about 1 vol. % CPC, about 64 vol. %
of soybean oil, and about 19 vol. % of DiH.sub.2O (designated
herein as X8EC).
[0269] In alternative embodiments of the present invention, a
nanoemulsion comprises from about 1 to 2 vol. % of TRITON X-100,
from about 1 to 2 vol. % of TYLOXAPOL, from about 6 to 8 vol. %
TBP, from about 0.5 to 1.0 vol. % of CPC, from about 60 to 70 vol.
% of oil (e.g., soybean), and about 1 to 35 vol. % of aqueous phase
(e.g., DiH.sub.2O or PBS). Additionally, certain of these
nanoemulsions may comprise from about 1 to 5 vol. % of trypticase
soy broth, from about 0.5 to 1.5 vol. % of yeast extract, about 5
mM L-alanine/Inosine, about 10 mM ammonium chloride, and from about
20-40 vol. % of liquid baby formula. In some embodiments comprising
liquid baby formula, the formula comprises a casein hydrolysate
(e.g., Neutramigen, or Progestimil, and the like). In some of these
embodiments, a nanoemulsion further comprises from about 0.1 to 1.0
vol. % of sodium thiosulfate, and from about 0.1 to 1.0 vol. % of
sodium citrate. Other similar embodiments comprising these basic
components employ phosphate buffered saline (PBS) as the aqueous
phase. For example, one embodiment comprises about 2 vol. % of
TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1
vol. % of CPC, about 64 vol. % of soybean oil, and about 23 vol. %
of DiH.sub.2O (designated herein as X2Y2EC). In still other
embodiments, the inventive formulation comprises about 2 vol. % of
TRITON X-100, about 2 vol. % TYLOXAPOL, about 8 vol. % TBP, about 1
vol. % of CPC, about 0.9 vol. % of sodium thiosulfate, about 0.1
vol. % of sodium citrate, about 64 vol. % of soybean oil, and about
22 vol. % of DiH.sub.2O (designated herein as X2Y2PC STS1). In
another similar embodiment, a nanoemulsion comprises about 1.7 vol.
% TRITON X-100, about 1.7 vol. % TYLOXAPOL, about 6.8 vol. % TBP,
about 0.85% CPC, about 29.2% NEUTRAMIGEN, about 54.4 vol. % of
soybean oil, and about 4.9 vol. % of DiH.sub.2O (designated herein
as 85% X2Y2PC/baby). In yet another embodiment of the present
invention, a nanoemulsion comprises about 1.8 vol. % of TRITON
X-100, about 1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of TBP,
about 0.9 vol. % of CPC, about 5 mM L-alanine/Inosine, about 10 mM
ammonium chloride, about 57.6 vol. % of soybean oil, and the
remainder vol. % of 0.1.times.PBS (designated herein as 90% X2Y2
PC/GE). In still another embodiment, a nanoemulsion comprises about
1.8 vol. % of TRITON X-100, about 1.8 vol. % of TYLOXAPOL, about
7.2 vol. % TBP, about 0.9 vol. % of CPC, and about 3 vol. %
trypticase soy broth, about 57.6 vol. % of soybean oil, and about
27.7 vol. % of DiH.sub.2O (designated herein as 90% X2Y2PC/TSB). In
another embodiment of the present invention, a nanoemulsion
comprises about 1.8 vol. % TRITON X-100, about 1.8 vol. %
TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % CPC, about 1 vol.
% yeast extract, about 57.6 vol. % of soybean oil, and about 29.7
vol. % of DiH.sub.2O (designated herein as 90% X2Y2PC/YE).
[0270] In some embodiments of the present invention, a nanoemulsion
comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of TBP, and
about 1 vol. % of CPC, about 60 to 70 vol. % of oil (e.g., soybean
or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). In a particular embodiment of the present
invention, a nanoemulsion comprises about 3 vol. % of TYLOXAPOL,
about 8 vol. % of TBP, and about 1 vol. % of CPC, about 64 vol. %
of soybean, and about 24 vol. % of DiH.sub.2O (designated herein as
Y3PC).
[0271] In some embodiments of the present invention, a nanoemulsion
comprises from about 4 to 8 vol. % of TRITON X-100, from about 5 to
8 vol. % of TBP, about 30 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 0 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Additionally, certain of these embodiments
further comprise about 1 vol. % of CPC, about 1 vol. % of
benzalkonium chloride, about 1 vol. % cetylyridinium bromide, about
1 vol. % cetyldimethylethylammonium bromide, 500 .mu.M EDTA, about
10 mM ammonium chloride, about 5 mM Inosine, and about 5 mM
L-alanine. For example, in a certain preferred embodiment, a
nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol.
% of TBP, about 64 vol. % of soybean oil, and about 20 vol. % of
DiH.sub.2O (designated herein as X8P). In another embodiment of the
present invention, a nanoemulsion comprises about 8 vol. % of
TRITON X-100, about 8 vol. % of TBP, about 1% of CPC, about 64 vol.
% of soybean oil, and about 19 vol. % of DiH.sub.2O (designated
herein as X8PC). In still another embodiment, a nanoemulsion
comprises about 8 vol. % TRITON X-100, about 8 vol. % of TBP, about
1 vol. % of CPC, about 50 vol. % of soybean oil, and about 33 vol.
% of DiH.sub.2O (designated herein as ATB-X1001). In yet another
embodiment, the formulations comprise about 8 vol. % of TRITON
X-100, about 8 vol. % of TBP, about 2 vol. % of CPC, about 50 vol.
% of soybean oil, and about 32 vol. % of DiH.sub.2O (designated
herein as ATB-X002). In some embodiments, a nanoemulsion comprises
about 4 vol. % TRITON X-100, about 4 vol. % of TBP, about 0.5 vol.
% of CPC, about 32 vol. % of soybean oil, and about 59.5 vol. % of
DiH.sub.2O (designated herein as 50% X8PC). In some embodiments, a
nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol.
% of TBP, about 0.5 vol. % CPC, about 64 vol. % of soybean oil, and
about 19.5 vol. % of DiH.sub.2O (designated herein as
X8PC.sub.1/2). In some embodiments of the present invention, a
nanoemulsion comprises about 8 vol. % of TRITON X-100, about 8 vol.
% of TBP, about 2 vol. % of CPC, about 64 vol. % of soybean oil,
and about 18 vol. % of DiH.sub.2O (designated herein as X8PC2). In
other embodiments, a nanoemulsion comprises about 8 vol. % of
TRITON X-100, about 8% of TBP, about 1% of benzalkonium chloride,
about 50 vol. % of soybean oil, and about 33 vol. % of DiH.sub.2O
(designated herein as X8P BC). In an alternative embodiment of the
present invention, a nanoemulsion comprises about 8 vol. % of
TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of
cetylyridinium bromide, about 50 vol. % of soybean oil, and about
33 vol. % of DiH.sub.2O (designated herein as X8P CPB). In another
exemplary embodiment of the present invention, a nanoemulsion
comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP,
about 1 vol. % of cetyldimethylethylammonium bromide, about 50 vol.
% of soybean oil, and about 33 vol. % of DiH.sub.2O (designated
herein as X8P CTAB). In still further embodiments, a nanoemulsion
comprises about 8 vol. % of TRITON X-100, about 8 vol. % of TBP,
about 1 vol. % of CPC, about 500 .mu.M EDTA, about 64 vol. % of
soybean oil, and about 15.8 vol. % DiH.sub.2O (designated herein as
X8PC EDTA). In some embodiments, a nanoemulsion comprises 8 vol. %
of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of CPC,
about 10 mM ammonium chloride, about 5 mM Inosine, about 5 mM
L-alanine, about 64 vol. % of soybean oil, and about 19 vol. % of
DiH.sub.2O or PBS (designated herein as X8PC GE.sub.1x). In another
embodiment of the present invention, a nanoemulsion comprises about
5 vol. % of TRITON X-100, about 5% of TBP, about 1 vol. % of CPC,
about 40 vol. % of soybean oil, and about 49 vol. % of DiH.sub.2O
(designated herein as X5P.sub.5C).
[0272] In some embodiments of the present invention, a nanoemulsion
comprises about 2 vol. % TRITON X-100, about 6 vol. % TYLOXAPOL,
about 8 vol. % ethanol, about 64 vol. % of soybean oil, and about
20 vol. % of DiH.sub.2O (designated herein as X2Y6E).
[0273] In an additional embodiment of the present invention, a
nanoemulsion comprises about 8 vol. % of TRITON X-100, and about 8
vol. % of glycerol, about 60 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 15 to 25 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Certain nanoemulsion compositions (e.g., used
to generate an immune response (e.g., for use as a vaccine)
comprise about 1 vol. % L-ascorbic acid. For example, one
particular embodiment comprises about 8 vol. % of TRITON X-100,
about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and
about 20 vol. % of DiH.sub.2O (designated herein as X8G). In still
another embodiment, a nanoemulsion comprises about 8 vol. % of
TRITON X-100, about 8 vol. % of glycerol, about 1 vol. % of
L-ascorbic acid, about 64 vol. % of soybean oil, and about 19 vol.
% of DiH.sub.2O (designated herein as X8GV.sub.c).
[0274] In still further embodiments, a nanoemulsion comprises about
8 vol. % of TRITON X-100, from about 0.5 to 0.8 vol. % of TWEEN 60,
from about 0.5 to 2.0 vol. % of CPC, about 8 vol. % of TBP, about
60 to 70 vol. % of oil (e.g., soybean or olive oil), and about 15
to 25 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS). For
example, in one particular embodiment a nanoemulsion comprises
about 8 vol. % of TRITON X-100, about 0.70 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 18.3 vol. % of DiH.sub.2O (designated herein
as X8W60PC.sub.1). In some embodiments, a nanoemulsion comprises
about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 18.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7X8PC). In yet other embodiments, a
nanoemulsion comprises from about 8 vol. % of TRITON X-100, about
0.7 vol. % of TWEEN 60, about 0.5 vol. % of CPC, about 8 vol. % of
TBP, about 64 to 70 vol. % of soybean oil, and about 18.8 vol. % of
DiH.sub.2O (designated herein as X8W60PC.sub.2). In still other
embodiments, a nanoemulsion comprises about 8 vol. % of TRITON
X-100, about 0.71 vol. % of TWEEN 60, about 2 vol. % of CPC, about
8 vol. % of TBP, about 64 vol. % of soybean oil, and about 17.3
vol. % of DiH.sub.2O. In another embodiment of the present
invention, a nanoemulsion comprises about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 25.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7PC).
[0275] In another embodiment of the present invention, a
nanoemulsion comprises about 2 vol. % of dioctyl sulfosuccinate,
either about 8 vol. % of glycerol, or about 8 vol. % TBP, in
addition to, about 60 to 70 vol. % of oil (e.g., soybean or olive
oil), and about 20 to 30 vol. % of aqueous phase (e.g., DiH.sub.2O
or PBS). For example, in some embodiments, a nanoemulsion comprises
about 2 vol. % of dioctyl sulfosuccinate, about 8 vol. % of
glycerol, about 64 vol. % of soybean oil, and about 26 vol. % of
D1H.sub.2O (designated herein as D2G). In another related
embodiment, a nanoemulsion comprises about 2 vol. % of dioctyl
sulfosuccinate, and about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 26 vol. % of D1H.sub.2O (designated herein
as D2P).
[0276] In still other embodiments of the present invention, a
nanoemulsion comprises about 8 to 10 vol. % of glycerol, and about
1 to 10 vol. % of CPC, about 50 to 70 vol. % of oil (e.g., soybean
or olive oil), and about 15 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Additionally, in certain of these embodiments,
a nanoemulsion further comprises about 1 vol. % of L-ascorbic acid.
For example, in some embodiments, a nanoemulsion comprises about 8
vol. % of glycerol, about 1 vol. % of CPC, about 64 vol. % of
soybean oil, and about 27 vol. % of DiH.sub.2O (designated herein
as GC). In some embodiments, a nanoemulsion comprises about 10 vol.
% of glycerol, about 10 vol. % of CPC, about 60 vol. % of soybean
oil, and about 20 vol. % of DiH.sub.2O (designated herein as GC10).
In still another embodiment of the present invention, a
nanoemulsion comprises about 10 vol. % of glycerol, about 1 vol. %
of CPC, about 1 vol. % of L-ascorbic acid, about 64 vol. % of
soybean or oil, and about 24 vol. % of DiH.sub.2O (designated
herein as GCV.sub.c).
[0277] In some embodiments of the present invention, a nanoemulsion
comprises about 8 to 10 vol. % of glycerol, about 8 to 10 vol. % of
SDS, about 50 to 70 vol. % of oil (e.g., soybean or olive oil), and
about 15 to 30 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS).
Additionally, in certain of these embodiments, a nanoemulsion
further comprise about 1 vol. % of lecithin, and about 1 vol. % of
p-Hydroxybenzoic acid methyl ester. Exemplary embodiments of such
formulations comprise about 8 vol. % SDS, 8 vol. % of glycerol,
about 64 vol. % of soybean oil, and about 20 vol. % of DiH.sub.2O
(designated herein as S8G). A related formulation comprises about 8
vol. % of glycerol, about 8 vol. % of SDS, about 1 vol. % of
lecithin, about 1 vol. % of p-Hydroxybenzoic acid methyl ester,
about 64 vol. % of soybean oil, and about 18 vol. % of DiH.sub.2O
(designated herein as S8GL1B1).
[0278] In yet another embodiment of the present invention, a
nanoemulsion comprises about 4 vol. % of TWEEN 80, about 4 vol. %
of TYLOXAPOL, about 1 vol. % of CPC, about 8 vol. % of ethanol,
about 64 vol. % of soybean oil, and about 19 vol. % of DiH.sub.2O
(designated herein as W.sub.804Y4EC).
[0279] In some embodiments of the present invention, a nanoemulsion
comprises about 0.01 vol. % of CPC, about 0.08 vol. % of TYLOXAPOL,
about 10 vol. % of ethanol, about 70 vol. % of soybean oil, and
about 19.91 vol. % of DiH.sub.2O (designated herein as
Y.08EC.01).
[0280] In yet another embodiment of the present invention, a
nanoemulsion comprises about 8 vol. % of sodium lauryl sulfate, and
about 8 vol. % of glycerol, about 64 vol. % of soybean oil, and
about 20 vol. % of DiH.sub.2O (designated herein as SLS8G).
[0281] The specific formulations described above are simply
examples to illustrate the variety of nanoemulsions that find use
(e.g., to inactivate and/or neutralize a pathogen, and for
generating an immune response in a subject (e.g., for use as a
vaccine)) in the present invention. The present invention
contemplates that many variations of the above formulations, as
well as additional nanoemulsions, find use in the methods of the
present invention. Candidate emulsions can be easily tested to
determine if they are suitable. First, the desired ingredients are
prepared using the methods described herein, to determine if an
emulsion can be formed. If an emulsion cannot be formed, the
candidate is rejected. For example, a candidate composition made of
4.5% sodium thiosulfate, 0.5% sodium citrate, 10% n-butanol, 64%
soybean oil, and 21% DiH.sub.2O does not form an emulsion.
[0282] Second, the candidate emulsion should form a stable
emulsion. An emulsion is stable if it remains in emulsion form for
a sufficient period to allow its intended use (e.g., to generate an
immune response in a subject). For example, for emulsions that are
to be stored, shipped, etc., it may be desired that the composition
remain in emulsion form for months to years. Typical emulsions that
are relatively unstable, will lose their form within a day. For
example, a candidate composition made of 8% 1-butanol, 5% Tween 10,
1% CPC, 64% soybean oil, and 22% DiH.sub.2O does not form a stable
emulsion. Nanoemulsions that have been shown to be stable include,
but are not limited to, 8 vol. % of TRITON X-100, about 8 vol. % of
TBP, about 64 vol. % of soybean oil, and about 20 vol. % of
DiH.sub.2O (designated herein as X8P); 5 vol. % of TWEEN 20, from
about 8 vol. % of ethanol, from about 1 vol. % of CPC, about 64
vol. % of oil (e.g., soybean oil), and about 22 vol. % of
DiH.sub.2O (designated herein as W.sub.205EC); 0.08% Triton X-100,
0.08% Glycerol, 0.01% Cetylpyridinium Chloride, 99% Butter, and
0.83% diH.sub.2O (designated herein as 1% X8GC Butter); 0.8% Triton
X-100, 0.8% Glycerol, 0.1% Cetylpyridinium Chloride, 6.4% Soybean
Oil, 1.9% diH.sub.2O, and 90% Butter (designated herein as 10% X8GC
Butter); 2% W.sub.205EC, 1% Natrosol 250L NF, and 97% diH.sub.2O
(designated herein as 2% W.sub.205EC L GEL); 1% Cetylpyridinium
Chloride, 5% Tween 20, 8% Ethanol, 64% 70 Viscosity Mineral Oil,
and 22% diH.sub.2O (designated herein as W.sub.205EC 70 Mineral
Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% 350
Viscosity Mineral Oil, and 22% diH.sub.2O (designated herein as
W.sub.205EC 350 Mineral Oil). In some embodiments, nanoemulsions of
the present invention are stable for over a week, over a month, or
over a year.
[0283] Third, the candidate emulsion should have efficacy for its
intended use. For example, a nanoemulsion should inactivate (e.g.,
kill or inhibit growth of) a pathogen to a desired level (e.g., 1
log, 2 log, 3 log, 4 log, . . . reduction). Using the methods
described herein, one is capable of determining the suitability of
a particular candidate emulsion against the desired pathogen.
Generally, this involves exposing the pathogen to the emulsion for
one or more time periods in a side-by-side experiment with the
appropriate control samples (e.g., a negative control such as
water) and determining if, and to what degree, the emulsion
inactivates (e.g., kills and/or neutralizes) the microorganism. For
example, a candidate composition made of 1% ammonium chloride, 5%
Tween 20, 8% ethanol, 64% soybean oil, and 22% DiH.sub.2O was shown
not to be an effective emulsion. The following candidate emulsions
were shown to be effective using the methods described herein: 5%
Tween 20, 5% Cetylpyridinium Chloride, 10% Glycerol, 60% Soybean
Oil, and 20% diH.sub.2O (designated herein as W.sub.205GC5); 1%
Cetylpyridinium Chloride, 5% Tween 20, 10% Glycerol, 64% Soybean
Oil, and 20% diH.sub.2O (designated herein as W.sub.205GC); 1%
Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Olive Oil,
and 22% diH.sub.2O (designated herein as W.sub.205EC Olive Oil); 1%
Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64% Flaxseed
Oil, and 22% diH.sub.2O (designated herein as W.sub.205EC Flaxseed
Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64%
Corn Oil, and 22% diH.sub.2O (designated herein as W.sub.205EC Corn
Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol, 64%
Coconut Oil, and 22% diH.sub.2O (designated herein as W.sub.205EC
Coconut Oil); 1% Cetylpyridinium Chloride, 5% Tween 20, 8% Ethanol,
64% Cottonseed Oil, and 22% diH.sub.2O (designated herein as
W.sub.205EC Cottonseed Oil); 8% Dextrose, 5% Tween 10, 1%
Cetylpyridinium Chloride, 64% Soybean Oil, and 22% diH.sub.2O
(designated herein as W.sub.205C Dextrose); 8% PEG 200, 5% Tween
10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22%
diH.sub.2O (designated herein as W.sub.205C PEG 200); 8% Methanol,
5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22%
diH.sub.2O (designated herein as W.sub.205C Methanol); 8% PEG 1000,
5% Tween 10, 1% Cetylpyridinium Chloride, 64% Soybean Oil, and 22%
diH.sub.2O (designated herein as W.sub.205C PEG 1000); 2%
W.sub.205EC, 2% Natrosol 250H NF, and 96% diH.sub.2O (designated
herein as 2% W.sub.205EC Natrosol 2, also called 2% W.sub.205EC
GEL); 2% W.sub.205EC, 1% Natrosol 250H NF, and 97% diH.sub.2O
(designated herein as 2% W.sub.205EC Natrosol 1); 2% W.sub.205EC,
3% Natrosol 250H NF, and 95% diH.sub.2O (designated herein as 2%
W.sub.205EC Natrosol 3); 2% W.sub.205EC, 0.5% Natrosol 250H NF, and
97.5% diH.sub.2O (designated herein as 2% W.sub.205EC Natrosol
0.5); 2% W.sub.205EC, 2% Methocel A, and 96% diH.sub.2O (designated
herein as 2% W.sub.205EC Methocel A); 2% W.sub.205EC, 2% Methocel
K, and 96% diH.sub.2O (designated herein as 2% W.sub.205EC Methocel
K); 2% Natrosol, 0.1% X8PC, 0.1.times.PBS, 5 mM L-alanine, 5 mM
Inosine, 10 mM Ammonium Chloride, and diH.sub.2O (designated herein
as 0.1% X8PC/GE+2% Natrosol); 2% Natrosol, 0.8% Triton X-100, 0.8%
Tributyl Phosphate, 6.4% Soybean Oil, 0.1% Cetylpyridinium
Chloride, 0.1.times.PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM
Ammonium Chloride, and diH.sub.2O (designated herein as 10%
X8PC/GE+2% Natrosol); 1% Cetylpyridinium Chloride, 5% Tween 20, 8%
Ethanol, 64% Lard, and 22% diH.sub.2O (designated herein as
W.sub.205EC Lard); 1% Cetylpyridinium Chloride, 5% Tween 20, 8%
Ethanol, 64% Mineral Oil, and 22% diH.sub.2O (designated herein as
W.sub.205EC Mineral Oil); 0.1% Cetylpyridinium Chloride, 2%
Nerolidol, 5% Tween 20, 10% Ethanol, 64% Soybean Oil, and 18.9%
diH.sub.2O (designated herein as W.sub.205EC.sub.0.1N); 0.1%
Cetylpyridinium Chloride, 2% Farnesol, 5% Tween 20, 10% Ethanol,
64% Soybean Oil, and 18.9% diH.sub.2O (designated herein as
W.sub.205EC.sub.0.1F); 0.1% Cetylpyridinium Chloride, 5% Tween 20,
10% Ethanol, 64% Soybean Oil, and 20.9% diH.sub.2O (designated
herein as W.sub.205EC.sub.0.1); 10% Cetylpyridinium Chloride, 8%
Tributyl Phosphate, 8% Triton X-100, 54% Soybean Oil, and 20%
diH.sub.2O (designated herein as X8PC.sub.10); 5% Cetylpyridinium
Chloride, 8% Triton X-100, 8% Tributyl Phosphate, 59% Soybean Oil,
and 20% diH.sub.2O (designated herein as X8PC.sub.5); 0.02%
Cetylpyridinium Chloride, 0.1% Tween 20, 10% Ethanol, 70% Soybean
Oil, and 19.88% diH.sub.2O (designated herein as
W.sub.200.1EC.sub.0.02); 1% Cetylpyridinium Chloride, 5% Tween 20,
8% Glycerol, 64% Mobil 1, and 22% diH.sub.2O (designated herein as
W.sub.205GC Mobil 1); 7.2% Triton X-100, 7.2% Tributyl Phosphate,
0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 0.1.times.PBS, 5
mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and 25.87%
diH.sub.2O (designated herein as 90% X8PC/GE); 7.2% Triton X-100,
7.2% Tributyl Phosphate, 0.9% Cetylpyridinium Chloride, 57.6%
Soybean Oil, 1% EDTA, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, 0.1.times.PBS, and diH.sub.2O (designated herein as 90%
X8PC/GE EDTA); and 7.2% Triton X-100, 7.2% Tributyl Phosphate, 0.9%
Cetylpyridinium Chloride, 57.6% Soybean Oil, 1% Sodium Thiosulfate,
5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride,
0.1.times.PBS, and diH.sub.2O (designated herein as 90% X8PC/GE
STS).
[0284] In preferred embodiments of the present invention, the
nanoemulsions are non-toxic (e.g., to humans, plants, or animals),
non-irritant (e.g., to humans, plants, or animals), and
non-corrosive (e.g., to humans, plants, or animals or the
environment), while possessing potency against a broad range of
microorganisms including bacteria, fungi, viruses, and spores.
While a number of the above described nanoemulsions meet these
qualifications, the following description provides a number of
preferred non-toxic, non-irritant, non-corrosive, anti-microbial
nanoemulsions of the present invention (hereinafter in this section
referred to as "non-toxic nanoemulsions").
[0285] In some embodiments the non-toxic nanoemulsions comprise
surfactant lipid preparations (SLPs) for use as broad-spectrum
antimicrobial agents that are effective against bacteria and their
spores, enveloped viruses, and fungi. In preferred embodiments,
these SLPs comprises a mixture of oils, detergents, solvents, and
cationic halogen-containing compounds in addition to several ions
that enhance their biocidal activities. These SLPs are
characterized as stable, non-irritant, and non-toxic compounds
compared to commercially available bactericidal and sporicidal
agents, which are highly irritant and/or toxic.
[0286] Ingredients for use in the non-toxic nanoemulsions include,
but are not limited to: detergents (e.g., TRITON X-100 (5-15%) or
other members of the TRITON family, TWEEN 60 (0.5-2%) or other
members of the TWEEN family, or TYLOXAPOL (1-10%)); solvents (e.g.,
tributyl phosphate (5-15%)); alcohols (e.g., ethanol (5-15%) or
glycerol (5-15%)); oils (e.g., soybean oil (40-70%)); cationic
halogen-containing compounds (e.g., cetylpyridinium chloride
(0.5-2%), cetylpyridinium bromide (0.5-2%)), or cetyldimethylethyl
ammonium bromide (0.5-2%)); quaternary ammonium compounds (e.g.,
benzalkonium chloride (0.5-2%), N-alkyldimethylbenzyl ammonium
chloride (0.5-2%)); ions (calcium chloride (1 mM-40 mM), ammonium
chloride (1 mM-20 mM), sodium chloride (5 mM-200 mM), sodium
phosphate (1 mM-20 mM)); nucleosides (e.g., inosine (50 .mu.M-20
mM)); and amino acids (e.g., L-alanine (50 .mu.M-20 mM)). Emulsions
are prepared, for example, by mixing in a high shear mixer for 3-10
minutes. The emulsions may or may not be heated before mixing at
82.degree. C. for 1 hour.
[0287] Quaternary ammonium compounds for use in the present
include, but are not limited to, N-alkyldimethyl benzyl ammonium
saccharinate; 1,3,5-Triazine-1,3,5(2H,4H,6H)-triethanol;
1-Decanaminium, N-decyl-N,N-dimethyl-, chloride (or) Didecyl
dimethyl ammonium chloride;
2-(2-(p-(Diisobutyl)cresosxy)ethoxy)ethyl dimethyl benzyl ammonium
chloride; 2-(2-(p-(Diisobutyl)phenoxy)ethoxy)ethyl dimethyl benzyl
ammonium chloride; alkyl 1 or 3
benzyl-1-(2-hydroxethyl)-2-imidazolinium chloride; alkyl
bis(2-hydroxyethyl)benzyl ammonium chloride; alkyl demethyl benzyl
ammonium chloride; alkyl dimethyl 3,4-dichlorobenzyl ammonium
chloride (100% C12); alkyl dimethyl 3,4-dichlorobenzyl ammonium
chloride (50% C14, 40% C12, 10% C16); alkyl dimethyl
3,4-dichlorobenzyl ammonium chloride (55% C14, 23% C12, 20% C16);
alkyl dimethyl benzyl ammonium chloride; alkyl dimethyl benzyl
ammonium chloride (100% C14); alkyl dimethyl benzyl ammonium
chloride (100% C16); alkyl dimethyl benzyl ammonium chloride (41%
C14, 28% C12); alkyl dimethyl benzyl ammonium chloride (47% C12,
18% C14); alkyl dimethyl benzyl ammonium chloride (55% C16, 20%
C14); alkyl dimethyl benzyl ammonium chloride (58% C14, 28% C16);
alkyl dimethyl benzyl ammonium chloride (60% C14, 25% C12); alkyl
dimethyl benzyl ammonium chloride (61% C11, 23% C14); alkyl
dimethyl benzyl ammonium chloride (61% C12, 23% C14); alkyl
dimethyl benzyl ammonium chloride (65% C12, 25% C14); alkyl
dimethyl benzyl ammonium chloride (67% C12, 24% C14); alkyl
dimethyl benzyl ammonium chloride (67% C12, 25% C14); alkyl
dimethyl benzyl ammonium chloride (90% C14, 5% C12); alkyl dimethyl
benzyl ammonium chloride (93% C14, 4% C12); alkyl dimethyl benzyl
ammonium chloride (95% C16, 5% C18); alkyl dimethyl benzyl ammonium
chloride (and) didecyl dimethyl ammonium chloride; alkyl dimethyl
benzyl ammonium chloride (as in fatty acids); alkyl dimethyl benzyl
ammonium chloride (C12-C16); alkyl dimethyl benzyl ammonium
chloride (C12-C18); alkyl dimethyl benzyl and dialkyl dimethyl
ammonium chloride; alkyl dimethyl dimethybenzyl ammonium chloride;
alkyl dimethyl ethyl ammonium bromide (90% C14, 5% C16, 5% C12);
alkyl dimethyl ethyl ammonium bromide (mixed alkyl and alkenyl
groups as in the fatty acids of soybean oil); alkyl dimethyl
ethylbenzyl ammonium chloride; alkyl dimethyl ethylbenzyl ammonium
chloride (60% C14); alkyl dimethyl isoproylbenzyl ammonium chloride
(50% C12, 30% C14, 17% C16, 3% C18); alkyl trimethyl ammonium
chloride (58% C18, 40% C16, 1% C14, 1% C12); alkyl trimethyl
ammonium chloride (90% C18, 10% C16); alkyldimethyl(ethylbenzyl)
ammonium chloride (C12-18); Di-(C.sub.8-10)-alkyl dimethyl ammonium
chlorides; dialkyl dimethyl ammonium chloride; dialkyl dimethyl
ammonium chloride; dialkyl dimethyl ammonium chloride; dialkyl
methyl benzyl ammonium chloride; didecyl dimethyl ammonium
chloride; diisodecyl dimethyl ammonium chloride; dioctyl dimethyl
ammonium chloride; dodecyl bis(2-hydroxyethyl) octyl hydrogen
ammonium chloride; dodecyl dimethyl benzyl ammonium chloride;
dodecylcarbamoyl methyl dimethyl benzyl ammonium chloride;
heptadecyl hydroxyethylimidazolinium chloride;
hexahydro-1,3,5-thris(2-hydroxyethyl)-s-triazine; myristalkonium
chloride (and) Quat RNIUM 14; N,N-Dimethyl-2-hydroxypropylammonium
chloride polymer; n-alkyl dimethyl benzyl ammonium chloride;
n-alkyl dimethyl ethylbenzyl ammonium chloride; n-tetradecyl
dimethyl benzyl ammonium chloride monohydrate; octyl decyl dimethyl
ammonium chloride; octyl dodecyl dimethyl ammonium chloride;
octyphenoxyethoxyethyl dimethyl benzyl ammonium chloride;
oxydiethylenebis (alkyl dimethyl ammonium chloride); quaternary
ammonium compounds, dicoco alkyldimethyl, chloride; trimethoxysily
propyl dimethyl octadecyl ammonium chloride; trimethoxysilyl quats,
trimethyl dodecylbenzyl ammonium chloride; n-dodecyl dimethyl
ethylbenzyl ammonium chloride; n-hexadecyl dimethyl benzyl ammonium
chloride; n-tetradecyl dimethyl benzyl ammonium chloride;
n-tetradecyl dimethyl ethylbenzyl ammonium chloride; and
n-octadecyl dimethyl benzyl ammonium chloride.
[0288] In general, the preferred non-toxic nanoemulsions are
characterized by the following: they are approximately 200-800 nm
in diameter, although both larger and smaller diameter
nanoemulsions are contemplated; the charge depends on the
ingredients; they are stable for relatively long periods of time
(e.g., up to two years), with preservation of their biocidal
activity; they are non-irritant and non-toxic compared to their
individual components due, at least in part, to their oil contents
that markedly reduce the toxicity of the detergents and the
solvents; they are effective at concentrations as low as 0.1%; they
have antimicrobial activity against most vegetative bacteria
(including Gram-positive and Gram-negative organisms), fungi, and
enveloped and nonenveloped viruses in 15 minutes (e.g., 99.99%
killing); and they have sporicidal activity in 1-4 hours (e.g.,
99.99% killing) when produced with germination enhancers.
[0289] D. Animal Models
[0290] In some embodiments, potential nanoemulsion compositions
(e.g., for generating an immune response (e.g., for use as a
vaccine) are tested in animal models of infectious diseases. The
use of well-developed animal models provides a method of measuring
the effectiveness and safety of a vaccine before administration to
human subjects. Exemplary animal models of disease are shown in
Table 3. These animals are commercially available (e.g., from
Jackson Laboratories Charles River; Portage, Mich.).
[0291] Animal models of Bacillus cereus (closely related to
Bacillus anthracis) are utilized to test Anthrax vaccines of the
present invention. Both bacteria are spore forming Gram positive
rods and the disease syndrome produced by each bacteria is largely
due to toxin production and the effects of these toxins on the
infected host (Brown et al., J. Bact., 75:499 (1958); Burdon and
Wende, J. Infect Dis., 107:224 (1960); Burdon et al., J. Infect.
Dis., 117:307 (1967)). Bacillus cereus infection mimics the disease
syndrome caused by Bacillus anthracis. Mice are reported to rapidly
succumb to the effects of B. cereus toxin and are a useful model
for acute infection. Guinea pigs develop a skin lesion subsequent
to subcutaneous infection with B. cereus that resembles the
cutaneous form of anthrax.
[0292] Clostridium perfringens infection in both mice and guinea
pigs has been used as a model system for the in vivo testing of
antibiotic drugs (Stevens et al., Antimicrob. Agents Chemother.,
31:312 (1987); Stevens et al., J. Infect. Dis., 155:220 (1987);
Alttemeier et al., Surgery, 28:621 (1950); Sandusky et al.,
Surgery, 28:632 (1950)). Clostridium tetani is well known to infect
and cause disease in a variety of mammalian species. Mice, guinea
pigs, and rabbits have all been used experimentally (Willis, Topley
and Wilson's Principles of Bacteriology, Virology and Immunity.
Wilson, G., A. Miles, and M. T. Parker, eds. pages 442-475
1983).
[0293] Vibrio cholerae infection has been successfully initiated in
mice, guinea pigs, and rabbits. According to published reports it
is preferred to alter the normal intestinal bacterial flora for the
infection to be established in these experimental hosts. This is
accomplished by administration of antibiotics to suppress the
normal intestinal flora and, in some cases, withholding food from
the animals (Butterton et al., Infect. Immun., 64:4373 (1996);
Levine et al., Microbiol. Rev., 47:510 (1983); Finkelstein et al.,
J. Infect. Dis., 114:203 (1964); Freter, J. Exp. Med., 104:411
(1956); and Freter, J. Infect. Dis., 97:57 (1955)).
[0294] Shigella flexnerii infection has been successfully initiated
in mice and guinea pigs. As is the case with vibrio infections, it
is preferred that the normal intestinal bacterial flora be altered
to aid in the establishment of infection in these experimental
hosts. This is accomplished by administration of antibiotics to
suppress the normal intestinal flora and, in some cases,
withholding food from the animals (Levine et al., Microbiol. Rev.,
47:510 (1983); Freter, J. Exp. Med., 104:411 (1956); Formal et al.,
J. Bact., 85:119 (1963); LaBrec et al., J. Bact. 88:1503 (1964);
Takeuchi et al., Am. J. Pathol., 47:1011 (1965)).
[0295] Mice and rats have been used extensively in experimental
studies with Salmonella typhimurium and Salmonella enteriditis
(Naughton et al., J. Appl. Bact., 81:651 (1996); Carter and
Collins, J. Exp. Med., 139:1189 (1974); Collins, Infect. Immun.,
5:191 (1972); Collins and Carter, Infect. Immun., 6:451
(1972)).
[0296] Mice and rats are well established experimental models for
infection with Sendai virus (Jacoby et al., Exp. Gerontol., 29:89
(1994); Massion et al., Am. J. Respir. Cell Mol. Biol. 9:361
(1993); Castleman et al., Am. J. Path., 129:277 (1987); Castleman,
Am. J. Vet. Res., 44:1024 (1983); Mims and Murphy, Am. J. Path.,
70:315 (1973)).
[0297] Sindbis virus infection of mice is usually accomplished by
intracerebral inoculation of newborn mice. Alternatively, weanling
mice are inoculated subcutaneously in the footpad (Johnson et al.,
J. Infect. Dis., 125:257 (1972); Johnson, Am. J. Path., 46:929
(1965)).
[0298] It is preferred that animals are housed for 3-5 days to rest
from shipping and adapt to new housing environments before use in
experiments. At the start of each experiment, control animals are
sacrificed and tissue is harvested to establish baseline
parameters. Animals are anesthetized by any suitable method (e.g.,
including, but not limited to, inhalation of Isofluorane for short
procedures or ketamine/xylazine injection for longer
procedure).
TABLE-US-00004 TABLE 3 Animal Models of Infectious Diseases
Experimental Experimental Animal Route of Microorganism Animal
Species Strains Sex Age Infection Francisella mice BALB/C M 6 W
Intraperitoneal philomiraga Neisseria mice BALB/C F 6-10 W
Intraperitoneal meningitidis rats COBS/CD M/F 4 D Intranasal
Streptococcus mice BALB/C F 6 W Intranasal pneumoniae rats COBS/CD
M 6-8 W Intranasal guinea Pigs Hartley M/F 4-5 W Intranasal
Yersinia mice BALB/C F 6 W Intranasal pseudotuberculosis Influenza
virus mice BALB/C F 6 W Intranasal Sendai virus mice CD-1 F 6 W
Intranasal rats Sprague- M 6-8 W Intranasal Dawley Sindbis mice
CD-1 M/F 1-2 D Intracerebral/SC Vaccinia mice BALB/C F 2-3 W
Intradermal
[0299] E. Assays for Evaluation of Vaccines
[0300] In some embodiments, candidate nanoemulsion vaccines are
evaluated using one of several suitable model systems. For example,
cell-mediated immune responses can be evaluated in vitro. In
addition, an animal model may be used to evaluate in vivo immune
response and immunity to pathogen challenge. Any suitable animal
model may be utilized, including, but not limited to, those
disclosed in Table 3.
[0301] Before testing a nanoemulsion vaccine in an animal system,
the amount of exposure of the pathogen to a nanoemulsion sufficient
to inactivate the pathogen is investigated. It is contemplated that
pathogens such as bacterial spores require longer periods of time
for inactivation by the nanoemulsion in order to be sufficiently
neutralized to allow for immunization. The time period required for
inactivation may be investigated using any suitable method,
including, but not limited to, those described in the illustrative
examples below.
[0302] In addition, the stability of emulsion-developed vaccines is
evaluated, particularly over time and storage condition, to ensure
that vaccines are effective long-term. The ability of other
stabilizing materials (e.g., dendritic polymers) to enhance the
stability and immunogenicity of vaccines is also evaluated.
[0303] Once a given nanoemulsion/pathogen vaccine has been
formulated to result in pathogen inactivation, the ability of the
vaccine to elicit an immune response and provide immunity is
optimized. Non-limiting examples of methods for assaying vaccine
effectiveness are described in Example 14 below. For example, the
timing and dosage of the vaccine can be varied and the most
effective dosage and administration schedule determined. The level
of immune response is quantitated by measuring serum antibody
levels. In addition, in vitro assays are used to monitor
proliferation activity by measuring H.sup.3-thymidine uptake. In
addition to proliferation, Th1 and Th2 cytokine responses (e.g.,
including but not limited to, levels of include IL-2, TNF-.gamma.,
IFN-.gamma., IL-4, IL-6, IL-11, IL-12, etc.) are measured to
qualitatively evaluate the immune response.
[0304] Finally, animal models are utilized to evaluate the effect
of a nanoemulsion mucosal vaccine. Purified pathogens are mixed in
emulsions (or emulsions are contact with a pre-infected animal),
administered, and the immune response is determined. The level of
protection is then evaluated by challenging the animal with the
specific pathogen and subsequently evaluating the level of disease
symptoms. The level of immunity is measured over time to determine
the necessity and spacing of booster immunizations.
III. Therapeutics and Prophylactics
[0305] Furthermore, in preferred embodiments, a composition of the
present invention induces (e.g., when administered to a subject)
both systemic and mucosal immunity. Thus, in some preferred
embodiments, administration of a composition of the present
invention to a subject results in protection against an exposure
(e.g., a mucosal exposure) to HIV. Although an understanding of the
mechanism is not necessary to practice the present invention and
the present invention is not limited to any particular mechanism of
action, mucosal administration (e.g., vaccination) provides
protection against HIV infection (e.g., that initiates at a mucosal
surface). Although it has heretofore proven difficult to stimulate
secretory IgA responses and protection against pathogens that
invade at mucosal surfaces (See, e.g., Mestecky et al, Mucosal
Immunology. 3ed edn. (Academic Press, San Diego, 2005)), the
present invention provides compositions and methods for stimulating
mucosal immunity (e.g., a protective IgA response) from a pathogen
in a subject.
[0306] In some embodiments, the present invention provides a
composition (e.g., a composition comprising a NE and immunogenic
protein antigens from HIV (e.g., gp120) to serve as a mucosal
vaccine. This material can easily be produced with NE and HIV
protein (e.g., viral-derived gp120, live-virus-vector-derived gp120
and gp160, recombinant mammalian gp120, recombinant denatured
antigens, small peptide segments of gp120 and gp41, V3 loop
peptides, and induces both mucosal and systemic immunity. The
ability to produce this formulation rapidly and administer it via
mucosal (e.g., nasal or vaginal) instillation provides a vaccine
that can be used in large-scale administrations (e.g., to a
population of a town, village, city, state or country).
[0307] In some preferred embodiments, the present invention
provides a composition for generating an immune response comprising
a NE and an immunogen (e.g., a purified, isolated or synthetic HIV
protein or derivative, variant, or analogue thereof; or, one or
more serotypes of HIV inactivated by the nanoemulsion). When
administered to a subject, a composition of the present invention
stimulates an immune response against the immunogen within the
subject. Although an understanding of the mechanism is not
necessary to practice the present invention and the present
invention is not limited to any particular mechanism of action, in
some embodiments, generation of an immune response (e.g., resulting
from administration of a composition comprising a nanoemulsion and
an immunogen) provides total or partial immunity to the subject
(e.g., from signs, symptoms or conditions of a disease (e.g.,
AIDS)). Without being bound to any specific theory, protection
and/or immunity from disease (e.g., the ability of a subject's
immune system to prevent or attenuate (e.g., suppress) a sign,
symptom or condition of disease) after exposure to an immunogenic
composition of the present invention is due to adaptive (e.g.,
acquired) immune responses (e.g., immune responses mediated by B
and T cells following exposure to a NE comprising an immunogen of
the present invention (e.g., immune responses that exhibit
increased specificity and reactivity towards HIV). Thus, in some
embodiments, the compositions and methods of the present invention
are used prophylactically or therapeutically to prevent or
attenuate a sign, symptom or condition associated with AIDS.
[0308] In some embodiments, a NE comprising an immunogen (e.g., a
recombinant HIV protein) is administered alone. In some
embodiments, a composition comprising a NE and an immunogen (e.g.,
a recombinant HIV protein) comprises one or more other agents
(e.g., a pharmaceutically acceptable carrier, adjuvant, excipient,
and the like). In some embodiments, a composition for stimulating
an immune response of the present invention is administered in a
manner to induce a humoral immune response. In some embodiments, a
composition for stimulating an immune response of the present
invention is administered in a manner to induce a cellular (e.g.,
cytotoxic T lymphocyte) immune response, rather than a humoral
response. In some embodiments, a composition comprising a NE and an
immunogen of the present invention induces both a cellular and
humoral immune response.
[0309] The present invention is not limited by the type or strain
of orthopox virus used (e.g., in a composition comprising a NE and
immunogen (e.g., orthopox virus inactivated by the nanoemulsion).
Indeed, each orthopox virus family member alone, or in combination
with another family member, may be used to generate a composition
comprising a NE and an immunogen (e.g., used to generate an immune
response) of the present invention. Orthopox virus family member
include, but are not limited to, variola virus, vaccinia virus,
cowpox, monkeypox, gergilpox, camelpox, and others. The present
invention is not limited by the strain of vaccinia virus used.
Indeed, a variety of vaccinia virus strains are contemplated to be
useful in the present invention including, but not limited to,
classical strains of vaccinia virus (e.g., EM-63, Lister, New York
City Board of Health, Elestree, and Temple of Heaven strains),
attenuated strains (e.g., Ankara), non-replicating strains,
modified strains (e.g., genetically or mechanically modified
strains (e.g., to become more or less virulent)), Copenhagen
strain, modified vaccinia Ankara, New York vaccinia virus, Vaccinia
Virus.sub.WR and Vaccinia Virus.sub.WR-Luc, or other serially
diluted strain of vaccinia virus. A composition comprising a NE and
immunogen may comprise one or more strains of vaccinia virus and/or
other type of orthopox virus. Additionally, a composition
comprising a NE and immunogen may comprise one or more strains of
vaccinia virus, and, in addition, one or more strains of a
non-vaccinia virus immunogen or immunogenic epitope thereof (e.g.,
a bacteria (e.g., B. anthracis) or immunogenic epitope thereof
(e.g., recombinant protective antigen) or a virus (e.g., West Nile
virus, Avian Influenza virus, Ebola virus, HSV, HPV, HCV, HIV,
etc.) or an immunogenic epitope thereof (e.g., gp120)).
[0310] In some embodiments, the immunogen may comprise one or more
antigens derived from a pathogen (e.g., orthopox virus). For
example, in some embodiments, the immunogen is a purified,
recombinant, synthetic, or otherwise isolated protein (e.g., added
to the NE to generate an immunogenic composition). Similarly, the
immunogenic protein may be a derivative, analogue or otherwise
modified (e.g., PEGylated) form of a protein from a pathogen.
[0311] The present invention is not limited by the type or strain
of Bacillus used or immunogenic protein derived therefrom. For
example, 89 different strains of B. anthracis have been identified,
ranging from virulent Ames and Vollum strains with biological
warfare and bioterrorism applications to benign Sterne strain used
for inoculations (See, e.g., Easterday et al., J Clin Microbiol.
2005 43(4):1995-7). The strains differ in presence and activity of
various genes, determining their virulence and production of
antigens and toxins. Any one of these or yet to be identified or
generated strains may be used in an immunogenic composition
comprising a NE of the present invention.
[0312] In some embodiments, the immunogen may comprise one or more
antigens derived from a pathogen (e.g., B. anthracis). For example,
in some embodiments, the immunogen is a purified, recombinant,
synthetic, or otherwise isolated protein (e.g., added to the NE to
generate an immunogenic composition). Similarly, the immunogenic
protein may be a derivative, variant, analogue or otherwise
modified form of a protein from a pathogen. The present invention
is not limited by the type of protein (e.g., derived from bacteria
of the genus Bacillus) used for generation of an immunogenic
composition of the present invention. Indeed, a variety of
immunogenic proteins may be used including, but not limited to,
protective antigen (PA), lethal factor (LF), edema factor (EF), PA
degradation products (See, e.g., Farchaus, J., et al., Applied
& Environmental Microbiol., 64(3):982-991 (1998)), as well as
analogues, derivatives and modified forms thereof.
[0313] For example, Bacillus proteins of the present invention may
be used in their native conformation, or more preferably, may be
modified for vaccine use. These modifications may either be
required for technical reasons relating to the method of
purification, or they may be used to biologically inactivate one or
several functional properties of the Bacillus proteins (e.g., that
would otherwise be toxic). Thus the invention encompasses
derivatives of Bacillus proteins that may be, for example, mutated
proteins (e.g., that has undergone deletion, addition or
substitution of one or more amino acids using well known techniques
for site directed mutagenesis or any other conventional
method).
[0314] Bacillus proteins (e.g., rPA) of the present invention may
be modified by chemical methods during a purification process to
render the proteins stable and monomeric. One method to prevent
oxidative aggregation of a protein is the use of chemical
modifications of the protein's thiol groups. In a first step the
disulphide bridges are reduced by treatment with a reducing agent
such as DTT, .beta.-mercaptoethanol, or gluthatione. In a second
step the resulting thiols are blocked by reaction with an
alkylating agent (e.g., the protein can be
carboxyamidated/carbamidomethylated using iodoacetamide).
[0315] Each Bacillus family member alone, or in combination with
another family member, may be used to generate a composition
comprising a NE and an immunogen (e.g., used to generate an immune
response) of the present invention. A composition comprising a NE
and immunogen may comprise one or more strains of B. anthracis.
Additionally, a composition comprising a NE and immunogen may
comprise one or more strains of B. anthracis, and, in addition, one
or more strains of a non-B. anthracis immunogen (e.g., a virus such
as West Nile virus, Avian Influenza virus, Ebola virus, HSV, HPV,
HCV, HIV, etc. or an immunogenic epitope thereof (e.g.,
gp120)).
[0316] The present invention is not limited by the type (e.g.,
serotype, group, or clade) of HIV used or immunogenic protein
derived therefrom. For example, there are currently two types of
HIV: HIV-1 and HIV-2. Both types are transmitted by sexual contact,
through blood, and from mother to child, and they appear to cause
clinically indistinguishable AIDS. However, it seems that HIV-2 is
less easily transmitted, and the period between initial infection
and illness is longer in the case of HIV-2. Worldwide, the
predominant virus is HIV-1, and generally when people refer to HIV
without specifying the type of virus they will be referring to
HIV-1. The relatively uncommon HIV-2 type is concentrated in West
Africa and is rarely found elsewhere.
[0317] Different levels of HIV classification exist. Each type is
divided into groups, and each group is divided into subtypes and
circulating recombinant forms (CRFs). The strains of HIV-1 can be
classified into three groups : the "major" group M, the "outlier"
group 0 and the "new" group N.
[0318] Within group M there are known to be at least nine
genetically distinct subtypes (or clades) of HIV-1. These are
subtypes A, B, C, D, F, G, H, J and K.
[0319] Any one of these or yet to be identified or generated
serotypes, groups, or clades may be used in an immunogenic
composition comprising a NE of the present invention.
[0320] In some embodiments, the immunogen may comprise one or more
antigens derived from a pathogen (e.g., HIV). For example, in some
embodiments, the immunogen is a purified, recombinant, synthetic,
or otherwise isolated protein (e.g., added to the NE to generate an
immunogenic composition). Similarly, the immunogenic protein may be
a derivative, analogue or otherwise modified form of a protein from
a pathogen. The present invention is not limited by the type of
protein (e.g., derived from HIV) used for generation of an
immunogenic composition of the present invention. Indeed, a variety
of immunogenic proteins may be used including, but not limited to,
gp160, gp120, gp41, Tat, and Nef; as well as analogues, derivatives
and modified forms thereof.
[0321] For example, HIV proteins of the present invention may be
used in their native conformation, or more preferably, may be
modified for vaccine use. These modifications may either be
required for technical reasons relating to the method of
purification, or they may be used to biologically inactivate one or
several functional properties of HIV protein. Thus the invention
encompasses derivatives of HIV proteins which may be, for example
mutated proteins (e.g., that has undergone deletion, addition or
substitution of one or more amino acids using well known techniques
for site directed mutagenesis or any other conventional method.
[0322] For example, a HIV protein may be mutated so that it is
biologically inactive while maintaining its immunogenic epitopes
(See, e.g., Clements, Virology 235: 48-64, 1997).
[0323] Additionally, HIV proteins of the present invention may be
modified by chemical methods during the purification process to
render the proteins stable and monomeric. One method to prevent
oxidative aggregation of a HIV protein is the use of chemical
modifications of the protein's thiol groups. In a first step the
disulphide bridges are reduced by treatment with a reducing agent
such as DTT, .beta.-mercaptoethanol, or gluthatione. In a second
step the resulting thiols are blocked by reaction with an
alkylating agent (e.g., the protein can be
carboxyamidated/carbamidomethylated using iodoacetamide).
[0324] Each HIV serotype, group or clade alone, or in combination
with another family member, may be used to generate a composition
comprising a NE and an immunogen (e.g., used to generate an immune
response) of the present invention. A composition comprising a NE
and immunogen may comprise one or more serotypes, groups or clades
of HIV. Additionally, a composition comprising a NE and immunogen
may comprise one or more serotypes, groups or clades of HIV, and,
in addition, one or more strains of a non-HIV immunogen (e.g., a
virus such as West Nile virus, Avian Influenza virus, Ebola virus,
HSV, HPV, HCV, etc. or an immunogenic epitope thereof).
[0325] The present invention is not limited by the particular
formulation of a composition comprising a NE and immunogen of the
present invention. Indeed, a composition comprising a NE and
immunogen of the present invention may comprise one or more
different agents in addition to the NE and immunogen. These agents
or cofactors include, but are not limited to, adjuvants,
surfactants, additives, buffers, solubilizers, chelators, oils,
salts, therapeutic agents, drugs, bioactive agents, antibacterials,
and antimicrobial agents (e.g., antibiotics, antivirals, etc.). In
some embodiments, a composition comprising a NE and immunogen of
the present invention comprises an agent and/or co-factor that
enhance the ability of the immunogen to induce an immune response
(e.g., an adjuvant). In some preferred embodiments, the presence of
one or more co-factors or agents reduces the amount of immunogen
required for induction of an immune response (e.g., a protective
immune response (e.g., protective immunization)). In some
embodiments, the presence of one or more co-factors or agents can
be used to skew the immune response towards a cellular (e.g., T
cell mediated) or humoral (e.g., antibody mediated) immune
response. The present invention is not limited by the type of
co-factor or agent used in a therapeutic agent of the present
invention.
[0326] Adjuvants are described in general in Vaccine Design--the
Subunit and Adjuvant Approach, edited by Powell and Newman, Plenum
Press, New York, 1995. The present invention is not limited by the
type of adjuvant utilized (e.g., for use in a composition (e.g.,
pharmaceutical composition) comprising a NE and immunogen). For
example, in some embodiments, suitable adjuvants include an
aluminium salt such as aluminium hydroxide gel (alum) or aluminium
phosphate. In some embodiments, an adjuvant may be a salt of
calcium, iron or zinc, or may be an insoluble suspension of
acylated tyrosine, or acylated sugars, cationically or anionically
derivatised polysaccharides, or polyphosphazenes.
[0327] In some embodiments, it is preferred that a composition
comprising a NE and immunogen of the present invention comprises
one or more adjuvants that induce a Th1-type response. However, in
other embodiments, it will be preferred that a composition
comprising a NE and immunogen of the present invention comprises
one or more adjuvants that induce a Th2-type response.
[0328] In general, an immune response is generated to an antigen
through the interaction of the antigen with the cells of the immune
system. Immune responses may be broadly categorized into two
categories: humoral and cell mediated immune responses (e.g.,
traditionally characterized by antibody and cellular effector
mechanisms of protection, respectively). These categories of
response have been termed Th1-type responses (cell-mediated
response), and Th2-type immune responses (humoral response).
[0329] Stimulation of an immune response can result from a direct
or indirect response of a cell or component of the immune system to
an intervention (e.g., exposure to an immunogen). Immune responses
can be measured in many ways including activation, proliferation or
differentiation of cells of the immune system (e.g., B cells, T
cells, dendritic cells, APCs, macrophages, NK cells, NKT cells
etc.); up-regulated or down-regulated expression of markers and
cytokines; stimulation of IgA, IgM, or IgG titer; splenomegaly
(including increased spleen cellularity); hyperplasia and mixed
cellular infiltrates in various organs. Other responses, cells, and
components of the immune system that can be assessed with respect
to immune stimulation are known in the art.
[0330] Although an understanding of the mechanism is not necessary
to practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
compositions and methods of the present invention induce expression
and secretion of cytokines (e.g., by macrophages, dendritic cells
and CD4+ T cells). Modulation of expression of a particular
cytokine can occur locally or systemically. It is known that
cytokine profiles can determine T cell regulatory and effector
functions in immune responses. In some embodiments, Th1-type
cytokines can be induced, and thus, the immunostimulatory
compositions of the present invention can promote a Th1 type
antigen-specific immune response including cytotoxic T-cells.
However in other embodiments, Th2-type cytokines can be induced
thereby promoting a Th2 type antigen-specific immune response.
[0331] Cytokines play a role in directing the T cell response.
Helper (CD4+) T cells orchestrate the immune response of mammals
through production of soluble factors that act on other immune
system cells, including B and other T cells. Most mature CD4+T
helper cells express one of two cytokine profiles: Th1 or Th2.
Th1-type CD4+ T cells secrete IL-2, IL-3, IFN-.gamma., GM-CSF and
high levels of TNF-.alpha.. Th2 cells express IL-3, IL-4, IL-5,
IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF-.alpha.. Th1
type cytokines promote both cell-mediated immunity, and humoral
immunity that is characterized by immunoglobulin class switching to
IgG2a in mice and IgG1 in humans. Th1 responses may also be
associated with delayed-type hypersensitivity and autoimmune
disease. Th2 type cytokines induce primarily humoral immunity and
induce class switching to IgG1 and IgE. The antibody isotypes
associated with Th1 responses generally have neutralizing and
opsonizing capabilities whereas those associated with Th2 responses
are associated more with allergic responses.
[0332] Several factors have been shown to influence skewing of an
immune response towards either a Th1 or Th2 type response. The best
characterized regulators are cytokines. IL-12 and IFN-.gamma. are
positive Th1 and negative Th2 regulators. IL-12 promotes
IFN-.gamma. production, and IFN-.gamma. provides positive feedback
for IL-12. IL-4 and IL-10 appear important for the establishment of
the Th2 cytokine profile and to down-regulate Th1 cytokine
production.
[0333] Thus, in some preferred embodiments, the present invention
provides a method of stimulating a Th1-type immune response in a
subject comprising administering to a subject a composition
comprising a NE and an immunogen. However, in other preferred
embodiments, the present invention provides a method of stimulating
a Th2-type immune response in a subject comprising administering to
a subject a composition comprising a NE and an immunogen. In
further preferred embodiments, adjuvants can be used (e.g., can be
co-administered with a composition of the present invention) to
skew an immune response toward either a Th1 or Th2 type immune
response. For example, adjuvants that induce Th2 or weak Th1
responses include, but are not limited to, alum, saponins, and
SB-As4. Adjuvants that induce Th1 responses include but are not
limited to MPL, MDP, ISCOMS, IL-12, IFN-.gamma., and SB-AS2.
[0334] Several other types of Th1-type immunogens can be used
(e.g., as an adjuvant) in compositions and methods of the present
invention. These include, but are not limited to, the following. In
some embodiments, monophosphoryl lipid A (e.g., in particular
3-de-O-acylated monophosphoryl lipid A (3.degree. D.-MPL)), is
used. 3D-MPL is a well known adjuvant manufactured by Ribi
Immunochem, Montana. Chemically it is often supplied as a mixture
of 3-de-O-acylated monophosphoryl lipid A with either 4, 5, or 6
acylated chains. In some embodiments, diphosphoryl lipid A, and
3-O-deacylated variants thereof are used. Each of these immunogens
can be purified and prepared by methods described in GB 2122204B,
hereby incorporated by reference in its entirety. Other purified
and synthetic lipopolysaccharides have been described (See, e.g.,
U.S. Pat. No. 6,005,099 and EP 0 729 473; Hilgers et al., 1986,
Int. Arch. Allergy. Immunol., 79(4):392-6; Hilgers et al., 1987,
Immunology, 60(1):141-6; and EP 0 549 074, each of which is hereby
incorporated by reference in its entirety). In some embodiments,
3D-MPL is used in the form of a particulate formulation (e.g.,
having a small particle size less than 0.2 .mu.m in diameter,
described in EP 0 689 454, hereby incorporated by reference in its
entirety).
[0335] In some embodiments, saponins are used as an immunogen
(e.g., Th1-type adjuvant) in a composition of the present
invention. Saponins are well known adjuvants (See, e.g.,
Lacaille-Dubois and Wagner (1996) Phytomedicine vol 2 pp 363-386).
Examples of saponins include Quil A (derived from the bark of the
South American tree Quillaja Saponaria Molina), and fractions
thereof (See, e.g., U.S. Pat. No. 5,057,540; Kensil, Crit. Rev Ther
Drug Carrier Syst, 1996, 12 (1-2):1-55; and EP 0 362 279, each of
which is hereby incorporated by reference in its entirety). Also
contemplated to be useful in the present invention are the
haemolytic saponins QS7, QS17, and QS21 (HPLC purified fractions of
Quil A; See, e.g., Kensil et al. (1991). J. Immunology 146,
431-437, U.S. Pat. No. 5,057,540; WO 96/33739; WO 96/11711 and EP 0
362 279, each of which is hereby incorporated by reference in its
entirety). Also contemplated to be useful are combinations of QS21
and polysorbate or cyclodextrin (See, e.g., WO 99/10008, hereby
incorporated by reference in its entirety.
[0336] In some embodiments, an immunogenic oligonucleotide
containing unmethylated CpG dinucleotides ("CpG") is used as an
adjuvant in the present invention. CpG is an abbreviation for
cytosine-guanosine dinucleotide motifs present in DNA. CpG is known
in the art as being an adjuvant when administered by both systemic
and mucosal routes (See, e.g., WO 96/02555, EP 468520, Davis et
al., J. Immunol, 1998, 160(2):870-876; McCluskie and Davis, J.
Immunol., 1998, 161(9):4463-6; and U.S. Pat. App. No. 20050238660,
each of which is hereby incorporated by reference in its entirety).
For example, in some embodiments, the immunostimulatory sequence is
Purine-Purine-C-G-pyrimidine-pyrimidine; wherein the CG motif is
not methylated.
[0337] Although an understanding of the mechanism is not necessary
to practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
the presence of one or more CpG oligonucleotides activate various
immune subsets including natural killer cells (which produce
IFN-.gamma.) and macrophages. In some embodiments, CpG
oligonucleotides are formulated into a composition of the present
invention for inducing an immune response. In some embodiments, a
free solution of CpG is co-administered together with an antigen
(e.g., present within a NE solution (See, e.g., WO 96/02555; hereby
incorporated by reference). In some embodiments, a CpG
oligonucleotide is covalently conjugated to an antigen (See, e.g.,
WO 98/16247, hereby incorporated by reference), or formulated with
a carrier such as aluminium hydroxide (See, e.g., Brazolot-Millan
et al., Proc. Natl. Acad Sci., USA, 1998, 95(26), 15553-8).
[0338] In some embodiments, adjuvants such as Complete Freunds
Adjuvant and Incomplete Freunds Adjuvant, cytokines (e.g.,
interleukins (e.g., IL-2, IFN-.gamma., IL-4, etc.), macrophage
colony stimulating factor, tumor necrosis factor, etc.), detoxified
mutants of a bacterial ADP-ribosylating toxin such as a cholera
toxin (CT), a pertussis toxin (PT), or an E. Coli heat-labile toxin
(LT), particularly LT-K63 (where lysine is substituted for the
wild-type amino acid at position 63) LT-R72 (where arginine is
substituted for the wild-type amino acid at position 72), CT-S109
(where serine is substituted for the wild-type amino acid at
position 109), and PT-K9/G129 (where lysine is substituted for the
wild-type amino acid at position 9 and glycine substituted at
position 129) (See, e.g., WO93/13202 and WO92/19265, each of which
is hereby incorporated by reference), and other immunogenic
substances (e.g., that enhance the effectiveness of a composition
of the present invention) are used with a composition comprising a
NE and immunogen of the present invention.
[0339] Additional examples of adjuvants that find use in the
present invention include poly(di(carboxylatophenoxy)phosphazene
(PCPP polymer; Virus Research Institute, USA); derivatives of
lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi
ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide
(MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a
glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin,
Switzerland); and Leishmania elongation factor (a purified
Leishmania protein; Corixa Corporation, Seattle, Wash.).
[0340] Adjuvants may be added to a composition comprising a NE and
an immunogen, or, the adjuvant may be formulated with carriers, for
example liposomes, or metallic salts (e.g., aluminium salts (e.g.,
aluminium hydroxide)) prior to combining with or co-administration
with a composition comprising a NE and an immunogen.
[0341] In some embodiments, a composition comprising a NE and an
immunogen comprises a single adjuvant. In other embodiments, a
composition comprising a NE and an immunogen comprises two or more
adjuvants (See, e.g., WO 94/00153; WO 95/17210; WO 96/33739; WO
98/56414; WO 99/12565; WO 99/11241; and WO 94/00153, each of which
is hereby incorporated by reference in its entirety).
[0342] In some embodiments, a composition comprising a NE and an
immunogen of the present invention comprises one or more
mucoadhesives (See, e.g., U.S. Pat. App. No. 20050281843, hereby
incorporated by reference in its entirety). The present invention
is not limited by the type of mucoadhesive utilized. Indeed, a
variety of mucoadhesives are contemplated to be useful in the
present invention including, but not limited to, cross-linked
derivatives of poly(acrylic acid) (e.g., carbopol and
polycarbophil), polyvinyl alcohol, polyvinyl pyrollidone,
polysaccharides (e.g., alginate and chitosan), hydroxypropyl
methylcellulose, lectins, fimbrial proteins, and
carboxymethylcellulose. Although an understanding of the mechanism
is not necessary to practice the present invention and the present
invention is not limited to any particular mechanism of action, in
some embodiments, use of a mucoadhesive (e.g., in a composition
comprising a NE and immunogen) enhances induction of an immune
response in a subject (e.g., administered a composition of the
present invention) due to an increase in duration and/or amount of
exposure to an immunogen that a subject experiences when a
mucoadhesive is used compared to the duration and/or amount of
exposure to an immunogen in the absence of using the
mucoadhesive.
[0343] In some embodiments, a composition of the present invention
may comprise sterile aqueous preparations. Acceptable vehicles and
solvents include, but are not limited to, water, Ringer's solution,
phosphate buffered saline and isotonic sodium chloride solution. In
addition, sterile, fixed oils are conventionally employed as a
solvent or suspending medium. For this purpose any bland fixed
mineral or non-mineral oil may be employed including synthetic
mono-ordi-glycerides. In addition, fatty acids such as oleic acid
find use in the preparation of injectables. Carrier formulations
suitable for mucosal, subcutaneous, intramuscular, intraperitoneal,
intravenous, or administration via other routes may be found in
Remington's Pharmaceutical Sciences, Mack Publishing Company,
Easton, Pa.
[0344] A composition comprising a NE and an immunogen of the
present invention can be used therapeutically (e.g., to enhance an
immune response) or as a prophylactic (e.g., for immunization
(e.g., to prevent signs or symptoms of disease)). A composition
comprising a NE and an immunogen of the present invention can be
administered to a subject via a number of different delivery routes
and methods.
[0345] For example, the compositions of the present invention can
be administered to a subject (e.g., mucosally (e.g., nasal mucosa,
vaginal mucosa, etc.)) by multiple methods, including, but not
limited to: being suspended in a solution and applied to a surface;
being suspended in a solution and sprayed onto a surface using a
spray applicator; being mixed with a mucoadhesive and applied
(e.g., sprayed or wiped) onto a surface (e.g., mucosal surface);
being placed on or impregnated onto a nasal and/or vaginal
applicator and applied; being applied by a controlled-release
mechanism; being applied as a liposome; or being applied on a
polymer.
[0346] In some preferred embodiments, compositions of the present
invention are administered mucosally (e.g., using standard
techniques; See, e.g., Remington: The Science and Practice of
Pharmacy, Mack Publishing Company, Easton, Pa., 19th edition, 1995
(e.g., for mucosal delivery techniques, including intranasal,
pulmonary, vaginal and rectal techniques), as well as European
Publication No. 517,565 and Illum et al., J. Controlled Rel., 1994,
29:133-141 (e.g., for techniques of intranasal administration),
each of which is hereby incorporated by reference in its entirety).
Alternatively, the compositions of the present invention may be
administered dermally or transdermally, using standard techniques
(See, e.g., Remington: The Science arid Practice of Pharmacy, Mack
Publishing Company, Easton, Pa., 19th edition, 1995). The present
invention is not limited by the route of administration.
[0347] Although an understanding of the mechanism is not necessary
to practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
mucosal vaccination is the preferred route of administration as it
has been shown that mucosal administration of antigens has a
greater efficacy of inducing protective immune responses at mucosal
surfaces (e.g., mucosal immunity), the route of entry of many
pathogens. In addition, mucosal vaccination, such as intranasal
vaccination, may induce mucosal immunity not only in the nasal
mucosa, but also in distant mucosal sites such as the genital
mucosa (See, e.g., Mestecky, Journal of Clinical Immunology,
7:265-276, 1987). More advantageously, in further preferred
embodiments, in addition to inducing mucosal immune responses,
mucosal vaccination also induces systemic immunity. In some
embodiments, non-parenteral administration (e.g., muscosal
administration of vaccines) provides an efficient and convenient
way to boost systemic immunity (e.g., induced by parenteral or
mucosal vaccination (e.g., in cases where multiple boosts are used
to sustain a vigorous systemic immunity)).
[0348] In some embodiments, a composition comprising a NE and an
immunogen of the present invention may be used to protect or treat
a subject susceptible to, or suffering from, disease by means of
administering a composition of the present invention via a mucosal
route (e.g., an oral/alimentary or nasal route). Alternative
mucosal routes include intravaginal and intra-rectal routes. In
preferred embodiments of the present invention, a nasal route of
administration is used, termed "intranasal administration" or
"intranasal vaccination" herein. Methods of intranasal vaccination
are well known in the art, including the administration of a
droplet or spray form of the vaccine into the nasopharynx of a
subject to be immunized. In some embodiments, a nebulized or
aerosolized composition comprising a NE and immunogen is provided.
Enteric formulations such as gastro resistant capsules for oral
administration, suppositories for rectal or vaginal administration
also form part of this invention. Compositions of the present
invention may also be administered via the oral route. Under these
circumstances, a composition comprising a NE and an immunogen may
comprise a pharmaceutically acceptable excipient and/or include
alkaline buffers, or enteric capsules. Formulations for nasal
delivery may include those with dextran or cyclodextran and saponin
as an adjuvant.
[0349] Compositions of the present invention may also be
administered via a vaginal route. In such cases, a composition
comprising a NE and an immunogen may comprise pharmaceutically
acceptable excipients and/or emulsifiers, polymers (e.g.,
CARBOPOL), and other known stabilizers of vaginal creams and
suppositories. In some embodiments, compositions of the present
invention are administered via a rectal route. In such cases, a
composition comprising a NE and an immunogen may comprise
excipients and/or waxes and polymers known in the art for forming
rectal suppositories.
[0350] In some embodiments, the same route of administration (e.g.,
mucosal administration) is chosen for both a priming and boosting
vaccination. In some embodiments, multiple routes of administration
are utilized (e.g., at the same time, or, alternatively,
sequentially) in order to stimulate an immune response (e.g., using
a composition comprising a NE and immunogen of the present
invention).
[0351] For example, in some embodiments, a composition comprising a
NE and an immunogen is administered to a mucosal surface of a
subject in either a priming or boosting vaccination regime.
Alternatively, in some embodiments, a composition comprising a NE
and an immunogen is administered systemically in either a priming
or boosting vaccination regime. In some embodiments, a composition
comprising a NE and an immunogen is administered to a subject in a
priming vaccination regimen via mucosal administration and a
boosting regimen via systemic administration. In some embodiments,
a composition comprising a NE and an immunogen is administered to a
subject in a priming vaccination regimen via systemic
administration and a boosting regimen via mucosal administration.
Examples of systemic routes of administration include, but are not
limited to, a parenteral, intramuscular, intradermal, transdermal,
subcutaneous, intraperitoneal or intravenous administration. A
composition comprising a NE and an immunogen may be used for both
prophylactic and therapeutic purposes.
[0352] In some embodiments, compositions of the present invention
are administered by pulmonary delivery. For example, a composition
of the present invention can be delivered to the lungs of a subject
(e.g., a human) via inhalation (e.g., thereby traversing across the
lung epithelial lining to the blood stream (See, e.g., Adjei, et
al. Pharmaceutical Research 1990; 7:565-569; Adjei, et al. Int. J.
Pharmaceutics 1990; 63:135-144; Braquet, et al. J. Cardiovascular
Pharmacology 1989 143-146; Hubbard, et al. (1989) Annals of
Internal Medicine, Vol. III, pp. 206-212; Smith, et al. J. Clin.
Invest. 1989; 84:1145-1146; Oswein, et al. "Aerosolization of
Proteins", 1990; Proceedings of Symposium on Respiratory Drug
Delivery II Keystone, Colo.; Debs, et al. J. Immunol. 1988;
140:3482-3488; and U.S. Pat. No. 5,284,656 to Platz, et al, each of
which are hereby incorporated by reference in its entirety). A
method and composition for pulmonary delivery of drugs for systemic
effect is described in U.S. Pat. No. 5,451,569 to Wong, et al.,
hereby incorporated by reference; See also U.S. Pat. No. 6,651,655
to Licalsi et al., hereby incorporated by reference in its
entirety)).
[0353] Further contemplated for use in the practice of this
invention are a wide range of mechanical devices designed for
pulmonary and/or nasal mucosal delivery of pharmaceutical agents
including, but not limited to, nebulizers, metered dose inhalers,
and powder inhalers, all of which are familiar to those skilled in
the art. Some specific examples of commercially available devices
suitable for the practice of this invention are the Ultravent
nebulizer (Mallinckrodt Inc., St. Louis, Mo.); the Acorn II
nebulizer (Marquest Medical Products, Englewood, Colo.); the
Ventolin metered dose inhaler (Glaxo Inc., Research Triangle Park,
N.C.); and the Spinhaler powder inhaler (Fisons Corp., Bedford,
Mass.). All such devices require the use of formulations suitable
for dispensing of the therapeutic agent. Typically, each
formulation is specific to the type of device employed and may
involve the use of an appropriate propellant material, in addition
to the usual diluents, adjuvants, surfactants, carriers and/or
other agents useful in therapy. Also, the use of liposomes,
microcapsules or microspheres, inclusion complexes, or other types
of carriers is contemplated.
[0354] Thus, in some embodiments, a composition comprising a NE and
an immunogen of the present invention may be used to protect and/or
treat a subject susceptible to, or suffering from, a disease by
means of administering a compositions comprising a NE and an
immunogen by mucosal, intramuscular, intraperitoneal, intradermal,
transdermal, pulmonary, intravenous, subcutaneous or other route of
administration described herein. Methods of systemic administration
of the vaccine preparations may include conventional syringes and
needles, or devices designed for ballistic delivery of solid
vaccines (See, e.g., WO 99/27961, hereby incorporated by
reference), or needleless pressure liquid jet device (See, e.g.,
U.S. Pat. No. 4,596,556; U.S. Pat. No. 5,993,412, each of which are
hereby incorporated by reference), or transdermal patches (See,
e.g., WO 97/48440; WO 98/28037, each of which are hereby
incorporated by reference). The present invention may also be used
to enhance the immunogenicity of antigens applied to the skin
(transdermal or transcutaneous delivery, See, e.g., WO 98/20734; WO
98/28037, each of which are hereby incorporated by reference).
Thus, in some embodiments, the present invention provides a
delivery device for systemic administration, pre-filled with the
vaccine composition of the present invention.
[0355] The present invention is not limited by the type of subject
administered (e.g., in order to stimulate an immune response (e.g.,
in order to generate protective immunity (e.g., mucosal and/or
systemic immunity))) a composition of the present invention.
Indeed, a wide variety of subjects are contemplated to be benefited
from administration of a composition of the present invention. In
preferred embodiments, the subject is a human. In some embodiments,
human subjects are of any age (e.g., adults, children, infants,
etc.) that have been or are likely to become exposed to a
microorganism. In some embodiments, the human subjects are subjects
that are more likely to receive a direct exposure to pathogenic
microorganisms or that are more likely to display signs and
symptoms of disease after exposure to a pathogen (e.g., immune
suppressed subjects). In some embodiments, the general public is
administered (e.g., vaccinated with) a composition of the present
invention (e.g., to prevent the occurrence or spread of disease).
For example, in some embodiments, compositions and methods of the
present invention are utilized to vaccinate a group of people
(e.g., a population of a region, city, state and/or country) for
their own health (e.g., to prevent or treat disease). In some
embodiments, the subjects are non-human mammals (e.g., pigs,
cattle, goats, horses, sheep, or other livestock; or mice, rats,
rabbits or other animal). In some embodiments, compositions and
methods of the present invention are utilized in research settings
(e.g., with research animals).
[0356] A composition of the present invention may be formulated for
administration by any route, such as mucosal, oral, topical,
parenteral or other route described herein. The compositions may be
in any one or more different forms including, but not limited to,
tablets, capsules, powders, granules, lozenges, foams, creams or
liquid preparations.
[0357] Topical formulations of the present invention may be
presented as, for instance, ointments, creams or lotions, foams,
and aerosols, and may contain appropriate conventional additives
such as preservatives, solvents (e.g., to assist penetration), and
emollients in ointments and creams.
[0358] Topical formulations may also include agents that enhance
penetration of the active ingredients through the skin. Exemplary
agents include a binary combination of N-(hydroxyethyl)pyrrolidone
and a cell-envelope disordering compound, a sugar ester in
combination with a sulfoxide or phosphine oxide, and sucrose
monooleate, decyl methyl sulfoxide, and alcohol.
[0359] Other exemplary materials that increase skin penetration
include surfactants or wetting agents including, but not limited
to, polyoxyethylene sorbitan mono-oleoate (Polysorbate 80);
sorbitan mono-oleate (Span 80); p-isooctyl polyoxyethylene-phenol
polymer (Triton WR-1330); polyoxyethylene sorbitan tri-oleate
(Tween 85); dioctyl sodium sulfosuccinate; and sodium sarcosinate
(Sarcosyl NL-97); and other pharmaceutically acceptable
surfactants.
[0360] In certain embodiments of the invention, compositions may
further comprise one or more alcohols, zinc-containing compounds,
emollients, humectants, thickening and/or gelling agents,
neutralizing agents, and surfactants. Water used in the
formulations is preferably deionized water having a neutral pH.
Additional additives in the topical formulations include, but are
not limited to, silicone fluids, dyes, fragrances, pH adjusters,
and vitamins.
[0361] Topical formulations may also contain compatible
conventional carriers, such as cream or ointment bases and ethanol
or oleyl alcohol for lotions. Such carriers may be present as from
about 1% up to about 98% of the formulation. The ointment base can
comprise one or more of petrolatum, mineral oil, ceresin, lanolin
alcohol, panthenol, glycerin, bisabolol, cocoa butter and the
like.
[0362] In some embodiments, pharmaceutical compositions of the
present invention may be formulated and used as foams.
Pharmaceutical foams include formulations such as, but not limited
to, emulsions, microemulsions, creams, jellies and liposomes. While
basically similar in nature these formulations vary in the
components and the consistency of the final product.
[0363] The compositions of the present invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions. Thus, for example, the compositions
may contain additional, compatible, pharmaceutically-active
materials such as, for example, antipruritics, astringents, local
anesthetics or anti-inflammatory agents, or may contain additional
materials useful in physically formulating various dosage forms of
the compositions of the present invention, such as dyes, flavoring
agents, preservatives, antioxidants, opacifiers, thickening agents
and stabilizers. However, such materials, when added, preferably do
not unduly interfere with the biological activities of the
components of the compositions of the present invention. The
formulations can be sterilized and, if desired, mixed with
auxiliary agents (e.g., lubricants, preservatives, stabilizers,
wetting agents, emulsifiers, salts for influencing osmotic
pressure, buffers, colorings, flavorings and/or aromatic substances
and the like) that do not deleteriously interact with the NE and
immunogen of the formulation. In some embodiments,
immunostimulatory compositions of the present invention are
administered in the form of a pharmaceutically acceptable salt.
When used the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0364] Suitable buffering agents include, but are not limited to,
acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3%
w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and
a salt (0.8-2% w/v). Suitable preservatives may include
benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9%
w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02%
w/v).
[0365] In some embodiments, a composition comprising a NE and an
immunogen is co-administered with one or more antibiotics. For
example, one or more antibiotics may be administered with, before
and/or after administration of a composition comprising a NE and an
immunogen. The present invention is not limited by the type of
antibiotic co-administered. Indeed, a variety of antibiotics may be
co-administered including, but not limited to, .beta.-lactam
antibiotics, penicillins (such as natural penicillins,
aminopenicillins, penicillinase-resistant penicillins, carboxy
penicillins, ureido penicillins), cephalosporins (first generation,
second generation, and third generation cephalosporins), and other
p-lactams (such as imipenem, monobactams,), .beta.-lactamase
inhibitors, vancomycin, aminoglycosides and spectinomycin,
tetracyclines, chloramphenicol, erythromycin, lincomycin,
clindamycin, rifampin, metronidazole, polymyxins, doxycycline,
quinolones (e.g., ciprofloxacin), sulfonamides, trimethoprim, and
quinolines.
[0366] There are an enormous amount of antimicrobial agents
currently available for use in treating bacterial, fungal and viral
infections. For a comprehensive treatise on the general classes of
such drugs and their mechanisms of action, the skilled artisan is
referred to Goodman & Gilman's "The Pharmacological Basis of
Therapeutics" Eds. Hardman et al., 9th Edition, Pub. McGraw Hill,
chapters 43 through 50, 1996, (herein incorporated by reference in
its entirety). Generally, these agents include agents that inhibit
cell wall synthesis (e.g., penicillins, cephalosporins,
cycloserine, vancomycin, bacitracin); and the imidazole antifungal
agents (e.g., miconazole, ketoconazole and clotrimazole); agents
that act directly to disrupt the cell membrane of the microorganism
(e.g., detergents such as polmyxin and colistimethate and the
antifungals nystatin and amphotericin B); agents that affect the
ribosomal subunits to inhibit protein synthesis (e.g.,
chloramphenicol, the tetracyclines, erthromycin and clindamycin);
agents that alter protein synthesis and lead to cell death (e.g.,
aminoglycosides); agents that affect nucleic acid metabolism (e.g.,
the rifamycins and the quinolones); the antimetabolites (e.g.,
trimethoprim and sulfonamides); and the nucleic acid analogues such
as zidovudine, gangcyclovir, vidarabine, and acyclovir which act to
inhibit viral enzymes essential for DNA synthesis. Various
combinations of antimicrobials may be employed.
[0367] The present invention also includes methods involving
co-administration of a composition comprising a NE and an immunogen
with one or more additional active and/or immunostimulatory agents
(e.g., a composition comprising a NE and a different immunogen, an
antibiotic, anti-oxidant, etc.). Indeed, it is a further aspect of
this invention to provide methods for enhancing prior art
immunostimulatory methods (e.g., immunization methods) and/or
pharmaceutical compositions by co-administering a composition of
the present invention. In co-administration procedures, the agents
may be administered concurrently or sequentially. In one
embodiment, the compositions described herein are administered
prior to the other active agent(s). The pharmaceutical formulations
and modes of administration may be any of those described herein.
In addition, the two or more co-administered agents may each be
administered using different modes (e.g., routes) or different
formulations. The additional agents to be co-administered (e.g.,
antibiotics, adjuvants, etc.) can be any of the well-known agents
in the art, including, but not limited to, those that are currently
in clinical use.
[0368] In some embodiments, a composition comprising a NE and
immunogen is administered to a subject via more than one route. For
example, a subject that would benefit from having a protective
immune response (e.g., immunity) towards a pathogenic microorganism
may benefit from receiving mucosal administration (e.g., nasal
administration or other mucosal routes described herein) and,
additionally, receiving one or more other routes of administration
(e.g., parenteral or pulmonary administration (e.g., via a
nebulizer, inhaler, or other methods described herein). In some
preferred embodiments, administration via mucosal route is
sufficient to induce both mucosal as well as systemic immunity
towards an immunogen or organism from which the immunogen is
derived. In other embodiments, administration via multiple routes
serves to provide both mucosal and systemic immunity. Thus,
although an understanding of the mechanism is not necessary to
practice the present invention and the present invention is not
limited to any particular mechanism of action, in some embodiments,
it is contemplated that a subject administered a composition of the
present invention via multiple routes of administration (e.g.,
immunization (e.g., mucosal as well as airway or parenteral
administration of a composition comprising a NE and immunogen of
the present invention) may have a stronger immune response to an
immunogen than a subject administered a composition via just one
route.
[0369] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compositions, increasing
convenience to the subject and a physician. Many types of release
delivery systems are available and known to those of ordinary skill
in the art. They include polymer based systems such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides. Microcapsules of the foregoing polymers containing
drugs are described in, for example, U.S. Pat. No. 5,075,109,
hereby incorporated by reference. Delivery systems also include
non-polymer systems that are: lipids including sterols such as
cholesterol, cholesterol esters and fatty acids or neutral fats
such as mono-di- and tri-glycerides; hydrogel release systems;
sylastic systems; peptide based systems; wax coatings; compressed
tablets using conventional binders and excipients; partially fused
implants; and the like. Specific examples include, but are not
limited to: (a) erosional systems in which an agent of the
invention is contained in a form within a matrix such as those
described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152,
each of which is hereby incorporated by reference and (b)
diffusional systems in which an active component permeates at a
controlled rate from a polymer such as described in U.S. Pat. Nos.
3,854,480, 5,133,974 and 5,407,686, each of which is hereby
incorporated by reference. In addition, pump-based hardware
delivery systems can be used, some of which are adapted for
implantation.
[0370] In preferred embodiments, a composition comprising a NE and
an immunogen of the present invention comprises a suitable amount
of the immunogen to induce an immune response in a subject when
administered to the subject. In preferred embodiments, the immune
response is sufficient to provide the subject protection (e.g.,
immune protection) against a subsequent exposure to the immunogen
or the microorganism (e.g., bacteria or virus) from which the
immunogen was derived. The present invention is not limited by the
amount of immunogen used. In some preferred embodiments, the amount
of immunogen (e.g., virus or bacteria neutralized by the NE, or,
recombinant protein) in a composition comprising a NE and immunogen
(e.g., for use as an immunization dose) is selected as that amount
which induces an immunoprotective response without significant,
adverse side effects. The amount will vary depending upon which
specific immunogen or combination thereof is/are employed, and can
vary from subject to subject, depending on a number of factors
including, but not limited to, the species, age and general
condition (e.g., health) of the subject, and the mode of
administration. Procedures for determining the appropriate amount
of immunogen administered to a subject to elicit an immune response
(e.g., a protective immune response (e.g., protective immunity)) in
a subject are well known to those skilled in the art.
[0371] In some embodiments, it is expected that each dose (e.g., of
a composition comprising a NE and an immunogen (e.g., administered
to a subject to induce an immune response (e.g., a protective
immune response (e.g., protective immunity))) comprises 0.05-5000
.mu.g of each immunogen (e.g., recombinant and/or purified
protein), in some embodiments, each dose will comprise 1-500 .mu.g,
in some embodiments, each dose will comprise 350-750 .mu.g, in some
embodiments, each dose will comprise 50-200 .mu.g, in some
embodiments, each dose will comprise 25-75 .mu.g of immunogen
(e.g., recombinant and/or purified protein). In some embodiments,
each dose comprises an amount of the immunogen sufficient to
generate an immune response. An effective amount of the immunogen
in a dose need not be quantified, as long as the amount of
immunogen generates an immune response in a subject when
administered to the subject. An optimal amount for a particular
administration (e.g., to induce an immune response (e.g., a
protective immune response (e.g., protective immunity))) can be
ascertained by one of skill in the art using standard studies
involving observation of antibody titers and other responses in
subjects.
[0372] In some embodiments, it is expected that each dose (e.g., of
a composition comprising a NE and an immunogen (e.g., administered
to a subject to induce and immune response)) is from 0.001 to 15%
or more (e.g., 0.001-10%, 0.5-5%, 1-3%, 2%, 6%, 10%, 15% or more)
by weight immunogen (e.g., neutralized bacteria or virus, or
recombinant and/or purified protein). In some embodiments, an
initial or prime administration dose contains more immunogen than a
subsequent boost dose
[0373] In some embodiments, when a NE of the present invention is
utilized to inactivate a live microorganism (e.g., virus (e.g.,
HIV)), it is expected that each dose (e.g., administered to a
subject to induce and immune response)) comprises between 10 and
10.sup.9 pfu of the virus per dose; in some embodiments, each dose
comprises between 10.sup.5 and 10.sup.8 pfu of the virus per dose;
in some embodiments, each dose comprises between 10.sup.3 and
10.sup.5 pfu of the virus per dose; in some embodiments, each dose
comprises between 10.sup.2 and 10.sup.4 pfu of the virus per dose;
in some embodiments, each dose comprises 10 pfu of the virus per
dose; in some embodiments, each dose comprises 10.sup.2 pfu of the
virus per dose; and in some embodiments, each dose comprises
10.sup.4 pfu of the virus per dose. In some embodiments, each dose
comprises more than 10.sup.9 pfu of the virus per dose. In some
preferred embodiments, each dose comprises 10.sup.3 pfu of the
virus per dose.
[0374] In some embodiments, when a NE of the present invention is
utilized to inactivate a live microorganism (e.g., a population of
bacteria (e.g., of the genus Bacillus (B. anthracis))), it is
expected that each dose (e.g., administered to a subject to induce
and immune response)) comprises between 10 and 10.sup.10 bacteria
per dose; in some embodiments, each dose comprises between 10.sup.5
and 10.sup.8 bacteria per dose; in some embodiments, each dose
comprises between 10.sup.3 and 10.sup.5 bacteria per dose; in some
embodiments, each dose comprises between 10.sup.2 and 10.sup.4
bacteria per dose; in some embodiments, each dose comprises 10
bacteria per dose; in some embodiments, each dose comprises
10.sup.2 bacteria per dose; and in some embodiments, each dose
comprises 10.sup.4 bacteria per dose. In some embodiments, each
dose comprises more than 10.sup.10 bacteria per dose. In some
embodiments, each dose comprises 10.sup.3 bacteria per dose.
[0375] The present invention is not limited by the amount of NE
used to inactivate live microorganisms (e.g., a virus (e.g., one or
more types of HIV)). In some embodiments, a 0.1%-5% NE solution is
used, in some embodiments, a 5%-20% NE solution is used, in some
embodiments, a 20% NE solution is used, and in some embodiments, a
NE solution greater than 20% is used order to inactivate a
pathogenic microorganism. In preferred embodiments, a 10% NE
solution is used.
[0376] Similarly, the present invention is not limited by the
duration of time a live microorganism is incubated in a NE of the
present invention in order to become inactivated. In some
embodiments, the microorganism is incubated for 1-3 hours in NE. In
some embodiments, the microorganism is incubated for 3-6 hours in
NE. In some embodiments, the microorganism is incubated for more
than 6 hours in NE. In preferred embodiments, the microorganism is
incubated for 3 hours in NE (e.g., a 10% NE solution). In some
embodiments, the incubation is carried out at 37.degree. C. In some
embodiments, the incubation is carried out at a temperature greater
than or less than 37.degree. C. The present invention is also not
limited by the amount of microorganism used for inactivation. The
amount of microorganism may depend upon a number of factors
including, but not limited to, the total amount of immunogenic
composition (e.g., NE and immunogen) desired, the concentration of
solution desired (e.g., prior to dilution for administration), the
microorganism and the NE. In some preferred embodiments, the amount
of microorganism used in an inactivation procedure is that amount
that produces the desired amount of immunogen (e.g., as described
herein) to be administered in a single dose (e.g., diluted from a
concentrated stock) to a subject.
[0377] In some embodiments, a composition comprising a NE and an
immunogen of the present invention is formulated in a concentrated
dose that can be diluted prior to administration to a subject. For
example, dilutions of a concentrated composition may be
administered to a subject such that the subject receives any one or
more of the specific dosages provided herein. In some embodiments,
dilution of a concentrated composition may be made such that a
subject is administered (e.g., in a single dose) a composition
comprising 0.5-50% of the NE and immunogen present in the
concentrated composition. In some preferred embodiments, a subject
is administered in a single dose a composition comprising 1% of the
NE and immunogen present in the concentrated composition.
Concentrated compositions are contemplated to be useful in a
setting in which large numbers of subjects may be administered a
composition of the present invention (e.g., an immunization clinic,
hospital, school, etc.). In some embodiments, a composition
comprising a NE and an immunogen of the present invention (e.g., a
concentrated composition) is stable at room temperature for more
than 1 week, in some embodiments for more than 2 weeks, in some
embodiments for more than 3 weeks, in some embodiments for more
than 4 weeks, in some embodiments for more than 5 weeks, and in
some embodiments for more than 6 weeks.
[0378] Generally, the emulsion compositions of the invention will
comprise at least 0.001% to 100%, preferably 0.01 to 90%, of
emulsion per ml of liquid composition. It is envisioned that the
formulations may comprise about 0.001%, about 0.0025%, about
0.005%, about 0.0075%, about 0.01%, about 0.025%, about 0.05%,
about 0.075%, about 0.1%, about 0.25%, about 0.5%, about 1.0%,
about 2.5%, about 5%, about 7.5%, about 10%, about 12.5%, about
15%, about 20%, about 25%, about 30%, about 35%, about 40%, about
50%, about 55%, about 60%, about 65%, about 70%, about 75%, about
80%, about 85%, about 90%, about 95% or about 100% of emulsion per
ml of liquid composition. It should be understood that a range
between any two figures listed above is specifically contemplated
to be encompassed within the metes and bounds of the present
invention. Some variation in dosage will necessarily occur
depending on the condition of the specific pathogen and the subject
being immunized.
[0379] In some embodiments, following an initial administration of
a composition of the present invention (e.g., an initial
vaccination), a subject may receive one or more boost
administrations (e.g., around 2 weeks, around 3 weeks, around 4
weeks, around 5 weeks, around 6 weeks, around 7 weeks, around 8
weeks, around 10 weeks, around 3 months, around 4 months, around 6
months, around 9 months, around 1 year, around 2 years, around 3
years, around 5 years, around 10 years) subsequent to a first,
second, third, fourth, fifth, sixth, seventh, eights, ninth, tenth,
and/or more than tenth administration. Although an understanding of
the mechanism is not necessary to practice the present invention
and the present invention is not limited to any particular
mechanism of action, in some embodiments, reintroduction of an
immunogen in a boost dose enables vigorous systemic immunity in a
subject. The boost can be with the same formulation given for the
primary immune response, or can be with a different formulation
that contains the immunogen. The dosage regimen will also, at least
in part, be determined by the need of the subject and be dependent
on the judgment of a practitioner.
[0380] Dosage units may be proportionately increased or decreased
based on several factors including, but not limited to, the weight,
age, and health status of the subject. In addition, dosage units
may be increased or decreased for subsequent administrations (e.g.,
boost administrations).
[0381] A composition comprising an immunogen of the present
invention finds use where the nature of the infectious and/or
disease causing agent (e.g., for which protective immunity is
sought to be elicited) is known, as well as where the nature of the
infectious and/or disease causing agent is unknown (e.g., in
emerging disease (e.g., of pandemic proportion (e.g., influenza or
other outbreaks of disease))). For example, the present invention
contemplates use of the compositions of the present invention in
treatment of or prevention of (e.g., via immunization with an
infectious and/or disease causing HIV or HIV-like agent neutralized
via a NE of the present invention) infections associated with an
emergent infectious and/or disease causing agent yet to be
identified (e.g., isolated and/or cultured from a diseased person
but without genetic, biochemical or other characterization of the
infectious and/or disease causing agent).
[0382] It is contemplated that the compositions and methods of the
present invention will find use in various settings, including
research settings. For example, compositions and methods of the
present invention also find use in studies of the immune system
(e.g., characterization of adaptive immune responses (e.g.,
protective immune responses (e.g., mucosal or systemic immunity))).
Uses of the compositions and methods provided by the present
invention encompass human and non-human subjects and samples from
those subjects, and also encompass research applications using
these subjects. Compositions and methods of the present invention
are also useful in studying and optimizing nanoemulsions,
immunogens, and other components and for screening for new
components. Thus, it is not intended that the present invention be
limited to any particular subject and/or application setting.
[0383] The formulations can be tested in vivo in a number of animal
models developed for the study of mucosal and other routes of
delivery. As is readily apparent, the compositions of the present
invention are useful for preventing and/or treating a wide variety
of diseases and infections caused by viruses, bacteria, parasites,
and fungi, as well as for eliciting an immune response against a
variety of antigens. Not only can the compositions be used
prophylactically or therapeutically, as described above, the
compositions can also be used in order to prepare antibodies, both
polyclonal and monoclonal (e.g., for diagnostic purposes), as well
as for immunopurification of an antigen of interest. If polyclonal
antibodies are desired, a selected mammal, (e.g., mouse, rabbit,
goat, horse, etc.) can be immunized with the compositions of the
present invention. The animal is usually boosted 2-6 weeks later
with one or more--administrations of the antigen. Polyclonal
antisera can then be obtained from the immunized animal and used
according to known procedures (See, e.g., Jurgens et al., J. Chrom.
1985, 348:363-370).
[0384] In some embodiments, the present invention provides a kit
comprising a composition comprising a NE and an immunogen. In some
embodiments, the kit further provides a device for administering
the composition. The present invention is not limited by the type
of device included in the kit. In some embodiments, the device is
configured for nasal application of the composition of the present
invention (e.g., a nasal applicator (e.g., a syringe) or nasal
inhaler or nasal mister). In some embodiments, a kit comprises a
composition comprising a NE and an immunogen in a concentrated form
(e.g., that can be diluted prior to administration to a
subject).
[0385] In some embodiments, all kit components are present within a
single container (e.g., vial or tube). In some embodiments, each
kit component is located in a single container (e.g., vial or
tube). In some embodiments, one or more kit component are located
in a single container (e.g., vial or tube) with other components of
the same kit being located in a separate container (e.g., vial or
tube). In some embodiments, a kit comprises a buffer. In some
embodiments, the kit further comprises instructions for use.
EXAMPLES
[0386] The following examples serve to illustrate certain preferred
embodiments and aspects of the present invention and are not to be
construed as limiting the scope thereof.
[0387] In the experimental disclosure which follows, the following
abbreviations apply: eq (equivalents); .mu. (micron); M (Molar);
.mu.M (micromolar); mM (millimolar); N (Normal); mol (moles); mmol
(millimoles); .mu.mol (micromoles); nmol (nanomoles); g (grams); mg
(milligrams); .mu.g (micrograms); ng (nanograms); L (liters); ml
(milliliters); .mu.l (microliters); cm (centimeters); mm
(millimeters); .mu.m (micrometers); nM (nanomolar); .degree. C.
(degrees Centigrade); and PBS (phosphate buffered saline).
Example 1
Methods of Formulating Emulsions
[0388] The emulsion is produced as follows: an oil phase is made by
blending organic solvent, oil, and surfactant and then heating the
resulting mixture at 37-90.degree. C. for up to one hour. The
emulsion is formed either with a reciprocating syringe
instrumentation or Silverson high sheer mixer. The water phase is
added to the oil phase and mixed for 1-30 minutes, preferably for 5
minutes. For emulsions containing volatile ingredients, the
volatile ingredients are added along with the aqueous phase.
[0389] In one example, the emulsion was formed as follows: an oil
phase was made by blending tri-butyl phosphate, soybean oil, and a
surfactant (e.g., TRITON X-100) and then heating the resulting
mixture at 86.degree. C. for one hour. An emulsion was then
produced by injecting water into the oil phase at a volume/volume
ratio of one part oil phase to four parts water. The emulsion can
be produced manually, with reciprocating syringe instrumentation,
or with batch or continuous flow instrumentation. Methods of
producing these emulsions are well known to those skilled in the
art and are described in e.g., U.S. Pat. Nos. 5,103,497; and
4,895,452, (herein incorporated by reference in their entireties).
Table 4 shows the proportions of each component, the pH, and the
size of the emulsion as measured on a Coulter LS 130 laser sizing
instrument equipped with a circulating water bath.
TABLE-US-00005 TABLE 4 Mean Chemical Percentage Mean Coulter
Coulter Components of Each Size Range of Emulsion Component pH (in
Microns) (in Microns) X8P TRITON X-100 2% Tributyl phosphate 2%
5.16 1.074 0.758-1.428 Oil (ex. Soy bean) 16% Water 80% X8P 0.1*
TRITON X-100 0.20% 5.37 0.944 0.625-1.333 Tributyl phosphate 0.20%
Oil (ex. Soy bean) 1.60% Water 98% *This emulsion was obtained by
diluting the X8P emulsion with water in a ratio of 1:9
[0390] The emulsions utilized in the present invention are highly
stable. Indeed, emulsions were produced as described above and
allowed to stand overnight at room temperature in sealed, different
sizes of polypropylene tubes, beakers or flasks. The emulsions were
then monitored for signs of separation. Emulsions that showed no
signs of separation were considered "stable." Stable emulsions were
then monitored over 1 year and were found to maintain
stability.
[0391] Emulsions were again produced as described above and allowed
to stand overnight at -20.degree. C. in sealed 50 mL polypropylene
tubes. The emulsions were then monitored for signs of separation.
Emulsions that showed no signs of separation were considered
"stable." The X8P and X8P 0.1, emulsions have been found to be
substantially unchanged after storage at room temperature for at
least 24 months.
Example 2
Characterization of an Exemplary Bacteria-Inactivating Emulsion as
an Emulsified Liposome Formed in Lipid Droplets
[0392] A bacteria inactivating emulsion, designated X8W.sub.60PC,
was formed by mixing a lipid-containing oil-in-water emulsion with
X8P. In particular, a lipid-containing oil-in-water emulsion having
glycerol monooleate (GMO) as the primary lipid and cetylpyridinium
chloride (CPC) as a positive charge producing agent (referred to
herein as GMO/CPC lipid emulsion or "W.sub.808P") and X8P were
mixed in a 1:1 (volume to volume) ratio. U.S. Pat. No. 5,547,677
(herein incorporated by reference in its entirety) describes the
GMO/CPC lipid emulsion and other related lipid emulsions that may
be combined with X8P to provide bacteria-inactivating oil-in-water
emulsions utilized in the vaccines of the present invention.
Example 3
In Vitro Bactericidal Efficacy Study I
Gram Positive Bacteria
[0393] In order to study the bactericidal efficacy of the emulsions
utilized in the vaccines of the present invention, the emulsions
were mixed with various bacteria for 10 minutes and then plated on
standard microbiological media at varying dilutions. Colony counts
were then compared to untreated cultures to determine the percent
of bacteria killed by the treatment. Table 5 summarizes the results
of the experiment.
TABLE-US-00006 TABLE 5 Inoculum Emulsion Organism (CFU) % Killing
Tested Vibrio cholerae classical 1.3 .times. 10.sup.8 100 X8P
Vibrio cholerae Eltor 5.1 .times. 10.sup.8 100 X8P Vibrio
parahemolytica 4.0 .times. 10.sup.7 98-100 X8P
[0394] In order to study the bactericidal effect of the emulsions
on various vegetative forms of Bacillus species, an emulsion at
three dilutions was mixed with four Bacillus species for 10 minutes
and then plated on microbiological medium. Colony counts were then
compared with untreated cultures to determine the percent of
bacteria killed by the treatment. Table 6 contains a summary of the
bactericidal results from several experiments with the mean
percentage kill in parenthesis.
TABLE-US-00007 TABLE 6 X8P/Dilution B. cereus B. circulans B.
megaterium B. subtilis 1:10 99% 95-99% 99% 99% (99%) (97%) (99%)
(99%) 1:100 97-99% 74-93% 96-97% 99% (98%) (84%) (96%) (99%) 1:1000
0% 45-60% 0-32% 0-39% (0%) (52%) (16%) (20%)
Example 4
In Vitro Bactericidal Efficacy Study II
Gram Negative Bacteria
[0395] To increase the uptake of the bacteria inactivating
emulsions by the cell walls of Gram negative bacteria, thereby
enhancing the microbicidal effect of the emulsions on the resistant
Gram negative bacteria, EDTA (ethylenediamine-tetraacetic acid) was
premixed with the emulsions. The EDTA was used in low concentration
(50-25 .mu.M) and the mix was incubated with the various Gram
negative bacteria for 15 minutes. The microbicidal effect of the
mix was then measured on trypticase soy broth. The results are set
forth in Table 7 below. There was over 99% reduction of the
bacterial count using X8P in 1/100 dilutions. This reduction of
count was not due to the killing effect of EDTA alone as shown from
the control group in which 250 .mu.M of EDTA alone could not reduce
the bacterial count in 15 minutes.
TABLE-US-00008 TABLE 7 Bacteria + Bacteria Bacteria + X8P +
Bacteria + alone X8P EDTA EDTA Bacterium (CFU) (CFU) (CFU) (CFU) S.
typhimurium 1,830,000 1,370,000 40 790,000 S. dysenteriae 910,000
690,000 0 320,000
Example 5
In Vitro Bactericidal Efficacy Study III
Vegetative and Spore Forms
[0396] Bacillus cereus (B. cereus, ATCC #14579) was utilized as a
model system for Bacillus anthracis. Experiments with X8P diluted
preparations to study the bactericidal effect of the compounds of
the present invention on the vegetative form (actively growing) of
B. cereus were performed. Treatment in medium for 10 minutes at
37.degree. C. was evaluated. As summarized in Table 8, the X8P
emulsion is efficacious against the vegetative form of B. cereus. A
10 minute exposure with this preparation is sufficient for
virtually complete killing of vegetative forms of B. cereus at all
concentrations tested including dilutions as high as 1:100.
TABLE-US-00009 TABLE 8 Emulsion Undiluted 1:10 1:100 X8P >99%
>99% 59->99% Avg => 99% Avg => 99% Avg = 82% Number of
experiments = 4
[0397] The spore form of B. anthracis is one of the most likely
organisms to be used as a biological weapon. Spores are well known
to be highly resistant to most disinfectants. As describe above,
effective killing of spores usually requires the use of toxic and
irritating chemicals such as formaldehyde or sodium hypochlorite
(i.e., bleach). The same experiment was therefore performed with
the spore form of B. cereus. As shown in Table 9, treatment in both
medium for 10 minutes at 37.degree. C. was not sufficient to kill
B. cereus spores.
TABLE-US-00010 TABLE 9 Emulsion Undiluted 1:10 1:100 X8P 0%-12% 0%
0% Avg = 6% Avg = 0% Avg = 0% Number of experiments = 2
[0398] To evaluate the efficacy of the nanoemulsion compounds
utilized in the vaccines of the present invention on the spore form
of B. cereus over a period of time, X8P was incorporated into solid
agar medium at 1:100 dilution and the spores spread uniformly on
the surface and incubated for 96 hours at 37.degree. C. No growth
occurred on solid agar medium wherein X8P had been incorporated,
out to 96 hours (i.e., >99% killing, average >99% killing, 3
experiments).
[0399] In an attempt to more closely define the time at which
killing of spores by X8P occurred, the following experiment was
performed. Briefly, a spore preparation was treated with X8P at a
dilution of 1:100 and compared to an untreated control. The number
of colony forming units per milliliter (CFU/ml) was quantitated
after 0.5, 1, 2, 4, 6, and 8 hours. CFU/ml in the untreated control
increased over the first 4 hours of incubation and then reached a
plateau. Bacterial smears prepared at time zero, 1, 2, 4 and 6
hours, and stained for spore structures, revealed that by 2 hours
no spore structures remained (FIGS. 2A-2C). Thus, 100% germination
of spores occurred in the untreated control by the 2 hour time
point. In the spore preparation treated with X8P, CFU/ml showed no
increase over the first 2 hours and then declined rapidly over the
time period from 2-4 hours. The decline from baseline CFU/ml over
2-4 hours was approximately 1000-fold. Bacterial smears prepared at
the same time points and stained for spore structures revealed that
spore structures remained to the end of the experiment at 8 hours.
Hence, germination of spores did not occur in the X8P treated
culture due to either inhibition of the germination process or
because the spores were damaged and unable to germinate. In order
to determine whether the emulsions were effective in killing other
Bacillus species in addition to B. cereus, a similar experiment was
performed as described above, wherein spore preparations were
treated with emulsions and compared to an untreated control after
four hours of incubation. The following Table 10 shows the results
wherein the numbers represent the mean sporicidal activity from
several experiments.
TABLE-US-00011 TABLE 10 X8P/ Dilution B. cereus B. circulans B.
megaterium B. subtilis 1:10 82% 61% 93% 31% 1:100 91% 80% 92% 39%
1:1000 47% 73% 94% 22%
Example 6
In Vivo Bactericidal Efficacy Study
[0400] Animal studies were preformed to demonstrate the protective
and therapeutic effect of the emulsions in vivo. Bacillus cereus
infection in experimental animals has been used previously as a
model system for the study of anthrax (Burdon and Wende, 1960;
Burdon et al., 1967; Lamanna and Jones, 1963). The disease syndrome
induced in animals experimentally infected with B. cereus in some
respects similar to anthrax (Drobniewski, 1993; Fritz et al.,
1995). The emulsions were mixed with B. cereus spores before
injecting into mice.
[0401] Irrigation of Skin Wounds
[0402] A 1 cm skin wound was infected with 2.5.times.10.sup.7 B.
cereus spores then closed without any further treatment. The other
groups were infected with the same number of spores. One hour
later, the wounds were irrigated with either inventive emulsion or
saline to simulate post-exposure decontamination. By 48 hours,
there were large necrotic areas surrounding the wounds with an
average area of 4.86 cm.sup.2. In addition, 60% of the animals in
this group died as a result of the infection. Histology of these
lesions indicated total necrosis of the dermis and subdermis and
large numbers of vegetative Bacillus organisms. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit.
[0403] Irrigation of wounds infected with B. cereus spores with
emulsion showed substantial benefit, resulting in a consistent 98%
reduction in the lesion size from 4.86 cm.sup.2 to 0.06 cm.sup.2.
This reduction in lesion size was accompanied by a three-fold
reduction in mortality (60% to 20%) when compared to experimental
animals receiving either no treatment or saline irrigation.
Histology of these lesions showed no evidence of vegetative
Bacillus organisms and minimal disruption of the epidermis (Hamouda
et al., 1999).
[0404] Subcutaneous Injection
[0405] CD-1 mice were injected with emulsion diluted 1:10 in saline
as a control and did not exhibit signs of distress or inflammatory
reaction, either in gross or histological analysis. To test the
pathogenic effect of B. cereus spores in vivo and the sporicidal
effect of emulsion, a suspension of 4.times.10.sup.7 B. cereus
spores was mixed with saline or with inventive emulsion at a final
dilution of 1:10 and then immediately injected subcutaneously into
the back of CD-1 mice.
[0406] Mice that were infected subcutaneously with B. cereus spores
without emulsion developed severe edema at 6-8 hours. This was
followed by a gray, necrotic area surrounding the injection site at
18-24 hours, with severe sloughing of the skin present by 48 hours,
leaving a dry, red-colored lesion.
[0407] Simultaneous injection of spores and emulsion resulted in a
greater than 98% reduction in the size of the necrotic lesion from
1.68 cm.sup.2 to 0.02 cm.sup.2 when the spores were premixed with
inventive emulsion. This was associated with minimal edema or
inflammation (Hamouda et al., 1999).
[0408] Rabbit Cornea
[0409] The cornea of rabbits were irrigated with various
concentrations of emulsions and monitored at 24 and 48 hours. No
irritations or abnormalities were observed when compositions were
used in therapeutic amounts.
[0410] Mucous Membrane
[0411] Intranasal toxicity was preformed in mice by installation of
25 .mu.L of 4% of the nanoemulsion per nare. No clinical or
histopathological changes were observed in these mice.
[0412] Nasal toxicity testing in rats was performed by gavaging up
to 8 mL per kg of 25% nanoemulsion. The rats did not lose weight or
show signs of toxicity either clinically or histopathologically.
There were no observed changes in the gut bacterial flora as a
result of nasal administration of the emulsions.
[0413] In a particular embodiment, Bacillus cereus was passed three
times on blood agar (TSA with 5% sheep blood, REMEL). B. cereus was
scraped from the third passage plate and resuspended in trypticase
soy broth (TSB) (available from BBL). The B. cereus suspension was
divided into two tubes. An equal volume of sterile saline was added
to one tube and mixed 0.1 ml of the B. cereus suspension/saline was
injected subcutaneously into 5 CD-1 mice. An equal volume of X8P
(diluted 1:5 in sterile saline) was added to one tube and mixed,
giving a final dilution of X8P at 1:10. The B. cereus
suspension/X8P was incubated at 37.degree. C. for 10 minutes while
being mixed 0.1 ml of the B. cereus suspension/X8P was injected
subcutaneously into 5 CD-1 mice. Equal volumes of X8P (diluted 1:5
in sterile saline) and TSB were mixed, giving a final dilution of
X8P at 1:10. 0.1 ml of the X8P/TSB was injected subcutaneously into
5 CD-1 mice.
[0414] The number of colony forming units (cfu) of B. cereus in the
inocula were quantitated as follows: 10-fold serial dilutions of
the B. cereus and B. cereus/X8P suspensions were made in distilled
H.sub.2O. Duplicate plates of TSA were inoculated from each
dilution (10 .mu.l per plate). The TSA plates were incubated
overnight at 37.degree. C. Colony counts were made and the number
of cfu/ml was calculated. Notice lesions appears to be smaller in
mice which were inoculated with B. cereus which was preteated with
X8P. The following Table 11 shows the results of the
experiment.
TABLE-US-00012 TABLE 11 Observation Inoculum ID# (24 hours) B.
cereus 1528 necrosis at injection 3.1 .times. 10.sup.7 Site
cfu/mouse 1529 necrosis at injection site 1530 Dead 1531 Dead 1532
necrosis at injection site B. cereus 1348 necrosis at injection
site 8.0 .times. 10.sup.5 1349 no reaction cfu/mouse 1360 no
reaction (X8P treated) 1526 necrosis at injection site 1527
necrosis at injection site X8P/TSB 1326 no reaction 1400 no
reaction 1375 no reaction 1346 no reaction 1347 no reaction
[0415] Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1%
Yeast Extract (Difco) and 50 .mu.g/ml MnSO.sub.4 for induction of
spore formation. The plate was scraped and suspended in sterile 50%
ethanol and incubated at room temperature for 2 hours with
agitation in order to lyse remaining vegetative bacteria. The
suspension was centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was resuspended in diH.sub.2O,
centrifuged at 2,500.times.g for 20 minutes, and the supernatant
discarded. The spore suspension was divided. The pellet was
resuspended in TSB. 0.1 ml of the B. cereus spore suspension
diluted 1:2 with saline was injected subcutaneously into 3 CD-1
mice. Equal volumes of X8P (diluted 1:5 in sterile saline) and B.
cereus spore suspension were mixed, giving a final dilution of X8P
at 1:10 (preincubation time). 0.1 ml of the X8P/B. cereus spore
suspension was injected subcutaneously into 3 CD-1 mice. The number
of colony forming units (cfu) of B. cereus in the inoculum was
quantitated as follows. 10-fold serial dilutions of the B. cereus
and B. cereus/X8P suspensions were made in distilled H.sub.2O.
Duplicate plates of TSA were inoculated from each dilution (10
.mu.l per plate). The TSA plates were incubated overnight at
37.degree. C. Colony counts were made and the number of cfu/ml was
calculated. Necrotic lesions appeared to be smaller in mice that
were inoculated with B. cereus spores that were pretreated with
X8P. The observations from these studies are shown in Table 12.
TABLE-US-00013 TABLE 12 Inoculum Observation (24 hours) B. cereus
2/3 (66%) mice exhibited necrosis at injection site 6.4 .times.
10.sup.6 spores/mouse B. cereus 1/3 (33%) mice exhibited necrosis
at injection site 4.8 .times. 10.sup.6 spores/mouse (X8P treated)
B. cereus 3/3 (100%) mice exhibited necrosis at injection site 4.8
.times. 10.sup.6 vegetative forms/mouse Lysed B. cereus 3/3 (100%)
mice did not exhibit symptoms 4.8 .times. 10.sup.6 cfu/mouse
X8P/TSB 1/3 (33%) mice appeared to have some skin necrosis
[0416] Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1%
Yeast Extract (Difco) and 50 (g/ml MnSO.sub.4 for induction of
spore formation). The plate was scraped and suspended in sterile
50% ethanol and incubated at room temperature for 2 hours with
agitation in order to lyse remaining vegetative bacteria. The
suspension was centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was resuspended in distilled
H.sub.2O, centrifuged at 2,500.times.g for 20 minutes, and the
supernatant discarded. The pellet was resuspended in TSB. The B.
cereus spore suspension was divided into three tubes. An equal
volume of sterile saline was added to one tube and mixed. 0.1 ml of
the B. cereus suspension/saline was injected subcutaneously into 10
CD-1 mice. An equal volume of X8P (diluted 1:5 in sterile saline)
was added to the second tube and mixed, giving a final dilution of
X8P at 1:10. The B. cereus spore suspension/X8P (1:10) was
incubated at 37.degree. C. for 4 hours while being mixed. 0.1 ml of
the B. cereus spore suspension/X8P (1:10) was injected
subcutaneously into 10 CD-1 mice. An equal volume of X8P (diluted
1:50 in sterile saline) was added to the third tube and mixed,
giving a final dilution of X8P at 1:100. B. cereus spore
suspension/X8P (1:100) was incubated at 37.degree. C. for 4 hours
while being mixed. 0.1 ml of the B. cereus spore suspension/X8P
(1:100) was injected subcutaneously into 10 CD-1 mice. Equal
volumes of X8P (diluted 1:5 in sterile saline) and TSB were mixed,
giving a final dilution of X8P at 1:10. 0.1 ml of the X8 PFTSB was
injected subcutaneously into 10 CD-1 mice. Equal volumes of X8P
(diluted 1:50 in sterile saline) and TSB were mixed, giving a final
dilution of X8P at 1:100. 0.1 ml of the X8P/TSB was injected
subcutaneously into 10 CD-1 mice. The observations from these
studies are shown in Table 13 and Table 14.
TABLE-US-00014 TABLE 13 Inoculum sc ID# Observation at 24 hours B.
cereus 1 2.4 cm.sup.2 skin lesion with 0.08 cm.sup.2 necrotic area
5.5 .times. 10.sup.7 2 no abnormalities observed Spores/mouse 3
Moribund with 8 cm.sup.2 skin lesion and Hind limb No treatment
paralysis group 4 3.52 cm.sup.2 skin lesion 5 1.44 cm.sup.2 skin
lesion 6 3.4 cm.sup.2 skin lesion 7 5.5 cm.sup.2 skin lesion 8 5.5
cm.sup.2 skin lesion 9 3.3 cm.sup.2 skin lesion with 0.72 cm.sup.2
necrotic area 10 2.64 cm.sup.2 skin lesion with two necrotic areas
(0.33 cm.sup.2 and 0.1 cm.sup.2) Mean lesion size in Spore group
alone 3.97 cm.sup.2 (1/10 (10%) with no abnormalities observed)
Note: Skin lesions grey in color with edema, necrotic areas
red/dry.
TABLE-US-00015 TABLE 14 Inoculum sc ID # Observation at 24 hours B.
cereus 41 no abnormalities observed 2.8 .times. 10.sup.7 42 no
abnormalities observed spores/mouse 43 1.2 cm.sup.2 white skin
lesion with grey center, in the slight edema X8P 1:10 44 0.78
cm.sup.2 white skin lesion treated group 45 0.13 cm.sup.2 white
skin lesion 46 2.2 cm.sup.2 white skin lesion 47 1.8 cm.sup.2 white
skin lesion with 0.1 cm.sup.2 brown area in center 48 1 cm.sup.2
white skin lesion with grey center 49 0.78 cm.sup.2 white skin
lesion 50 no abnormalities observed Mean lesion size in X8P 1:10
treatment group = 1.13 cm.sup.2 (3/10 (30%) with no abnormalities
observed) B. cereus 51 2.1 cm.sup.2 grey skin lesion 1.8 .times.
10.sup.7 52 0.72 cm.sup.2 grey skin lesion spores/mouse 53 1.5
cm.sup.2 grey skin lesion in the 54 1.2 cm.sup.2 grey skin lesion
X8P 1:100 55 3.15 cm.sup.2 grey skin lesion treated group 56 0.6
cm.sup.2 grey skin lesion 57 0.5 cm.sup.2 grey skin lesion 58 2.25
cm.sup.2 grey skin lesion 59 4.8 cm.sup.2 grey skin lesion with
necrotic area 1 cm diameter 60 2.7 cm.sup.2 grey skin lesion Mean
lesion size In X8P 1:100 treatment group = 1.9 cm.sup.2 (0/10 (0%)
with no abnormalities observed) X8P 1:10 alone 11 2.6 cm.sup.2
white area 12 0.15 cm.sup.2 white area 13 no abnormalities observed
14 0.15 cm.sup.2 white area 15 0.35 cm.sup.2 white area 16 no
abnormalities observed 17 0.12 cm.sup.2 white area 18 no
abnormalities observed 19 0.56 cm.sup.2 white area 20 0.3 cm.sup.2
white area Mean lesion size In X8P 1:10 alone group = 0.60 cm.sup.2
(3/10 (30%) with no abnormalities observed) X8P 1:100 alone 21-30
no abnormalities observed Mean lesion size in X8P 1:100 alone group
= 0 cm.sup.2 (10/10 (100%) with no abnormalities observed) TSB
31-40 no abnormalities observed alone Mean lesion size In the TSB
alone group = 0 cm.sup.2 (10/10 (100%) with no abnormalities
observed)
[0417] Re-isolation of B. cereus was attempted from skin lesions,
blood, liver, and spleen (Table 15). Skin lesions were cleansed
with betadine followed by 70% sterile isopropyl alcohol. An
incision was made at the margin of the lesion and swabbed. The
chest was cleansed with betadine followed by 70% sterile isopropyl
alcohol. Blood was drawn by cardiac puncture. The abdomen was
cleansed with betadine followed by 70% sterile isopropyl alcohol.
The skin and abdominal muscles were opened with separate sterile
instruments. Samples of liver and spleen were removed using
separate sterile instruments. Liver and spleen samples were passed
briefly through a flame and cut using sterile instruments. The
freshly exposed surface was used for culture. BHI agar (Difco) was
inoculated and incubated aerobically at 37.degree. C.
overnight.
TABLE-US-00016 TABLE 15 B. cereus Re-isolation Inoculum sc ID#
Necrospy From site of skin lesion B. cereus 3 24 hours skin lesion
> 300 cfu 5.5 .times. 10.sup.7 6 48 hours skin lesion > 300
cfu spores/mouse 7 48 hours skin lesion > 300 cfu in the 8 72
hours skin lesion 100 cfu Untreated group 9 72 hours skin lesion 25
cfu 10 72 hours skin lesion 100 1 96 hours skin lesion > 300 cfu
4 96 hours skin lesion > 300 cfu 5 96 hours skin lesion > 300
cfu Mean CFU In Untreated Spore group = 214* *(6/9 (67%) > 300
CFU) B. cereus 48 48 hours skin lesion 17 cfu 2.8 .times. 10.sup.7
50 48 hours skin lesion > 300 cfu spores/mouse 46 72 hours skin
lesion > 200 cfu in the 47 72 hours skin lesion 100 cfu X8P 1:10
49 72 hours skin lesion > 300 cfu treated group 41 96 hours skin
lesion > 300 cfu 42* 96 hours skin lesion 20 cfu 43 cultures not
done 44 96 hours skin lesion > 300 cfu 45 cultures not done 46
cultures not done Mean CFU in X8P 1:10 group = 192* *(318 (38%)
> 300 CFU) B. cereus 48 48 hours skin lesion 18 cfu 1.8 .times.
10.sup.7 50* 48 hours skin lesion > 300 cfu spores/mouse 52 72
hours skin lesion I cfu in the 54 72 hours re-isolation negative
X8P 1:100 56 72 hours skin lesion > 300 cfu treated group 58 96
hours skin lesion 173 cfu 59 96 hours skin lesion 4 cfu 60 96 hours
skin lesion 6 cfu Mean CFU in X8P 1:100 group = 100 *(2/8 (25%)
> 00 CFU) *Although no lesions were present in these mice,
organisms were removed from the injection site.
[0418] Pretreatment of both vegetative B. cereus and B. cereus
spores reduce their ability to cause disease symptoms when
introduced into experimental animals. This is reflected in the
smaller size of skin lesions and the generally lower numbers of B.
cereus recovered from the lesions. In addition, less frequent
re-isolation of B. cereus from blood, liver, and spleen occurs
suggesting that septicemia may be preventable.
Example 7
In Vivo Toxicity Study I
[0419] CD-1 mice were injected subcutaneously with 0.1 ml of
nanoemulsion and observed for 4 days for signs of inflammation
and/or necrosis. Dilutions of the compounds were made in sterile
saline. Tissue samples from mice were preserved in 10% neutral
buffered formalin for histopathologic examination. Samples of skin
and muscle (from mice which were injected with undiluted compounds)
sent for histological review were reported to show indications of
tissue necrosis. Tissue samples from mice which were injected with
diluted compounds were not histologically examined. Tabled 16 and
17 show the results of two individual experiments.
TABLE-US-00017 TABLE 16 Compound Mouse ID # Dilution Observation
X8P 1326 Undiluted necrosis 1327 Undiluted no reaction 1328 1:10 no
reaction 1329 1:10 no reaction 1324 1:100 no reaction 1331 1:100 no
reaction Saline 1344 no reaction 1345 no reaction
TABLE-US-00018 TABLE 17 Compound Mouse ID # Dilution Observation
X8P 1376 Undiluted necrosis 1377 Undiluted minimal necrosis 1378
1:10 no reaction 1379 1:10 no reaction 1380 1:100 no reaction 1381
1:100 no reaction Saline 1394 no reaction 1395 no reaction
[0420] Guinea pigs were intramuscularly (in both hind legs) with
1.0 ml of compounds of the present invention per site and observed
for 4 days for signs of inflammation and/or necrosis. Dilutions of
the compounds were made in sterile saline.
[0421] Tissue samples from guinea pigs were preserved in 10%
neutral buffered formalin for histological examination. Tissue
samples were not histologically examined.
TABLE-US-00019 TABLE 18 Compound Guinea Pig Dilution Observation
X8P 1023-1 undiluted no reaction 1023-2 1:10 no reaction 1023-3
1:100 no reaction Saline 1023-10 no reaction
[0422] The results of In Vivo Toxicity Study I show that
subcutaneous and intramuscular injection of the compounds tested
did not result in grossly observable tissue damage and did not
appear to cause distress in the experimental animals (Table
18).
Example 8
In Vivo Toxicity Study II
[0423] One group of Sprague-Dawley rats each consisting of five
males and five females were placed in individual cages and
acclimated for five days before dosing. Rats were dosed daily for
14 days. On day 0-13, for 14 consecutive days each rat in Group 1
received by gavage three milliliters of X8P, 1:100 concentration,
respectively. The three-milliliter volume was determined to be the
maximum allowable nasal dose for rats. Prior to dosing on Day 0 and
Day 7, each rat was weighed. Thereafter rats were weighed weekly
for the duration of the study. Animals were observed daily for
sickness or mortality. Animals were allowed to rest for 14 days. On
day 28 the rats were weighed and euthanized. The mean weight
results of the nasal toxicity study are shown in Table 19. Mean
weights for males and females on days 0, 7, and 14, 21 and 28 and
the mean weight gains from day 0-day 28, are also shown in Table
18. One rat died due to mechanical trauma from manipulation of the
gavage tubing during dosing on day 14. All surviving rats gained
weight over the 28 day course of the study and there was no illness
reported. Thus, although tributyl phosphate alone is known to be
toxic and irritating to mucous membranes, when incorporated into
the emulsions utilized in the vaccines of the present invention,
these characteristics are not in evidence. The X8P emulsion, 1:100
concentration, was also tested for dermal toxicity in rabbits
according to the protocols provided in 16 CFR .sctn. 1500.3. The
emulsion was not irritating to skin in the animals tested.
TABLE-US-00020 TABLE 19 Weight Dose Body Body Body Body Body Gain
Rat Volume Weight Weight Weight (g) Weight (g) Weight (g) (g) Day 0
Number Sex mL (g) Day 0 (g) Day 7 Day 14 Day 21 Day 28 Day 28 9028
m 3 332.01 356.52 388.66 429.9 394.07 62.06 9029 m 3 278.62 294.65
296.23 310.7 392.6 113.98 9030 m 3 329.02 360.67 325.26 403.43
443.16 114.14 9031 m 3 334.64 297.04 338.82 357.5 416.89 82.25 9032
m 3 339.03 394.39 347.9 331.38 357.53 18.5 MEAN 266.26 340.65
339.37 400.85 78.18 WTS 9063 F 3 302 298.08 388.66 338.41 347.98
45.98 9064 F 3 254.54 247.97 256.78 278.17 279.2 24.66 9065 F 3
225.99 253.81 273.38 290.54 308.68 82.69 9066 F 3 246.56 260.38
266.21 235.12 272.6 26.04 9067 F 3 279.39 250.97 deceased MEAN
261.69 262.24 296.25 285.56 302.11 53 WTS
Example 9
In Vitro Study with Bacillus anthracis
[0424] Experiments with X8W.sub.60PC preparations to study the
bactericidal effect of the compounds of the present invention on
the spore form of B. anthracis were performed. The sporicidal
activity of different dilutions of X8W.sub.60PC (in water) on six
different strains of B. anthracis was tested. X.sub.8W.sub.60PC
killed over 98% of seven different strains of anthrax (Del Rio,
Tex.; Bison, Canada; South Africa (2 strains); Mozambique; S.
Dakota; and Ames, USAMRID) within 4 hours and is as efficient as
1-10% bleach. Similar sporicidal activity is found with different
dilutions of X.sub.8W.sub.60PC in media (1:10, 1:100, 1:1000, and
1:5000). X.sub.8W.sub.60PC can kill anthrax spores in as little as
30 minutes.
Example 10
Mechanisms of Action
[0425] The following example provides an insight into the proposed
mechanisms of action of several nanoemulsions. This example also
demonstrates the sporicidal activity of several nanoemulsions
utilized in the vaccines of the present invention. This mechanism
is not intended to limit the scope of the invention. An
understanding of the mechanism is not necessary to practice the
present invention, and the present invention is not limited to any
particular mechanism. The effect of a GMO/CPC lipid emulsion
("W.sub.808P") and X8P on E. coli was examined. W.sub.808P killed
the E. coli (in deionized H.sub.2O) but X8P was ineffective against
this organism. X8P treated E. coli look normal, with defined
structure and intact lipid membranes. W.sub.808P treated E. coli
have vacuoles inside and the contents have swollen so that the
defined structure of the organism is lost. Without being bound to a
particular theory (an understanding of the mechanism is not
necessary to practice the present invention, and the present
invention is not limited to any particular mechanism), this
observation suggests that W.sub.808P kills the bacteria without
lysing them and instead causes a change in the internal structure,
evident by the vacuolization and swelling. A second study was
performed with Vibrio cholerae. Despite Vibrio cholerae being
closely related to E. coli, X8P, W.sub.808P and X8W.sub.60PC all
killed this organism. Compared to the control, the W.sub.808P
treated Vibrio cholerae again shows swelling and changes in the
interior of the organism, but the cells remain intact. In contrast,
the X8P treated Vibrio cholerae are completely lysed with only
cellular debris remaining. X8W.sub.60PC showed a combination of
effects, where some of the organisms are swelled but intact and
some are lysed. This clearly suggests that X8P, W.sub.808P and
X8W.sub.60PC work by different mechanisms.
[0426] A third comparative study was performed to evaluate efficacy
of the emulsions at various concentrations. As shown in Table 20,
X8W.sub.60PC is more effective as a biocide at lower concentrations
(higher dilutions) in bacteria sensitive to either W.sub.808P or
X8P. In addition, six other bacteria that are resistant to
W.sub.808P and X8P are all susceptible to X8W.sub.60PC. This
difference in activity is also seen when comparing W.sub.808P and
X8P and X8W.sub.60PC in influenza infectivity assays. Both X8P and
X8W.sub.60PC are effective at a 1:10 and 1:100 dilutions and
additionally, X8W60PC is effective at the lowest concentration,
1:1,000 dilution. In contrast, W.sub.808P has little activity even
at 1:10 dilution, suggesting that it is not an effective treatment
for this enveloped organism. In addition, X8W.sub.60PC kills yeast
species that are not killed by either W.sub.808P or X8P.
TABLE-US-00021 TABLE 20 Lowest Nanoemulsion Concentration Required
to Achieve Over 90% Killing of Selected Microorganisms W.sub.808P
X8P X8W.sub.60PC Bacteria Streptococcus pyogenes No killing 10%
0.1% Streptococcus aglactiae 1%* 1% ND Streptococcus pneumonia 10%*
1% 0.1% Staphylococcus aureus No killing No killing 0.1% Neisseria
gonorrhoeae ND 1% 0.1% Haemophilus influenzae 10% 1% 0.1% Vibrio
cholerae 1% 0.1% 0.1% E. coli No killing # No killing 0.1%
Salmonella typhimurium No killing# No killing 10% Shigella
dysenteriae No killing # No killing 0.1% Proteus mirabilis No
killing # No killing 1% Pseudomonas aeruginosa No killing No
killing 10% Bacillus anthracis spores No killing @ 4 H 0.1% @ 4 H
0.1%-0.02% @ 4 H Bacillus cereus spores 10% @ 4 H 1% @ 4 H 0.1% @ 4
H Bacillus subtilis spores No killing @ 24 H No killing @ 24 H 0.1%
@ 4 H Yersinia enterocolitica ND ND 0.1% Yersinia
pseudotuberculosis ND ND 0.1% Fungi Candida albicans No Killing No
Killing 1% (ATCC 90028) Candida tropicalis No Killing No Killing 1%
Viruses Influenza A H2N2 No Killing 1% 0.1% Influenza B/Hong Kong/
ND 1% ND 5/72 Vaccinia ND 1% % Herpes simplex type I ND 1% 0.1%
Sendai ND 1% ND Sindbis ND 1% ND Adenovirus ND No Killing ND *Data
for lower concentrations not available. # No killing except in
deionized water. ND = Not determined.
Example 11
Further Evidence of the Sporicidal Activity of Nanoemulsions
Against Bacillus Species
[0427] The present Example provides the results of additional
investigations of the ability of nanoemulsions to inactivate
different Bacillus spores. The methods and results of these studies
are outlined below.
[0428] Surfactant lipid preparations: X8P, a water-in-oil
nanoemulsion, in which the oil phase was made from soybean oil,
tri-n-butyl phosphate, and TRITON X-100 in 80% water. X8W.sub.60PC
was prepared by mixing equal volumes of X8P with W.sub.808P which
is a liposome-like compound made of glycerol monostearate, refined
Soya sterols, TWEEN 60, soybean oil, a cationic ion
halogen-containing CPC and peppermint oil.
[0429] Spore preparation: For induction of spore formation,
Bacillus cereus (ATTC 14579), B. circulans (ATC 4513), B.
megaterium (ATCC 14581), and B. subtilis (ATCC 11774) were grown
for a week at 37.degree. C. on NAYEMn agar (Nutrient Agar with 0.1%
Yeast Extract and 5 mg/l MnS0.sub.4). The plates were scraped and
the bacteria/spores suspended in sterile 50% ethanol and incubated
at room temperature (27.degree. C.) for 2 hours with agitation in
order to lyse the remaining vegetative bacteria. The suspension was
centrifuged at 2,500.times.g for 20 minutes and the pellet washed
twice in cold diH.sub.2O. The spore pellet was resuspended in
trypticase soy broth (TSB) and used immediately for experiments. B.
anthracis spores, Ames and Vollum 1 B strains, were kindly supplied
by Dr. Bruce Ivins (USAMRIID, Fort Detrick, Frederick, Md.), and
prepared as previously described (Ivins et al., Vaccine 13:1779
(1995)). Four other strains of anthrax were kindly provided by Dr.
Martin Hugh-Jones (LSU, Baton Rouge, La.). These strains represent
isolates with high allelic dissimilarity from South Africa;
Mozambique; Bison, Canada; and Del Rio, Tex.
[0430] In vitro sporicidal assays: For assessment of sporicidal
activity of solid medium, trypticase Soy Agar (TSA) was autoclaved
and cooled to 55.degree. C. The X8P was added to the TSA at a 1:100
final dilution and continuously stirred while the plates were
poured. The spore preparations were serially diluted (ten-fold) and
10 .mu.l aliquots were plated in duplicate (highest inoculum was
10.sup.5 spores per plate). Plates were incubated for 48 hours
aerobically at 37.degree. C. and evaluated for growth.
[0431] For assessment of sporicidal activity in liquid medium,
spores were resuspended in TSB. 1 ml of spore suspension containing
2.times.10.sup.6 spores (final concentration 10.sup.6 spores/ml)
was mixed with 1 ml of X8P or X8W.sub.60PC (at 2.times. final
concentration in diH.sub.2O) in a test tube. The tubes were
incubated in a tube rotator at 37.degree. C. for four hours. After
treatment, the suspensions were diluted 10-fold in diH.sub.2O.
Duplicate aliquots (25 .mu.l) from each dilution were streaked on
TSA, incubated overnight at 37.degree. C., and then colonies were
counted. Sporicidal activity expressed as a percentage killing was
calculated:
cfu ( initial ) - cfu ( post - treatment ) cfu ( initial ) .times.
100. ##EQU00003##
[0432] The experiments were repeated at least 3 times and the mean
of the percentage killing was calculated.
[0433] Electron microscopy: B. cereus spores were treated with X8P
at a 1:100 final dilution in TSB using Erlenmeyer flasks in a
37.degree. C. shaker incubator. Fifty ml samples were taken at
intervals and centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was fixed in 4% glutaraldehyde in
0.1 M cacodylate (pH 7.3). Spore pellets were processed for
transmission electron microscopy and thin sections examined after
staining with uranyl acetate and lead citrate.
[0434] Germination inhibitors/simulators: B. cereus spores (at a
final concentration 10.sup.6 spores/ml) were suspended in TSB with
either the germination inhibitor D-alanine (at final concentration
of 1 .mu.M) or with the germination stimulator L-alanine+inosine
(at final concentration of 50 .mu.M each) (Titball and Manchee, J.
Appl Bacteriol. 62:269 (1987); Shibata et al., Jpn J Microbiol.
20:529 (1976)) and then immediately mixed with X8P (at a final
dilution of 1:100) and incubated for variable intervals. The
mixtures were then serially diluted, plated and incubated
overnight. The next day the plates were counted and percentage
sporicidal activity was calculated.
[0435] In vivo sporicidal activity: Two animal models were
developed; in the first B. cereus spores (suspended in sterile
saline) were mixed with an equal volume of X8P at a final dilution
of 1:10. As a control, the same B. cereus spore suspension was
mixed with an equal volume of sterile saline. 100 .mu.l of the
suspensions containing 4.times.10 spores was then immediately
injected subcutaneously into CD-1 mice.
[0436] In the second model, a simulated wound was created by making
an incision in the skin of the back of the mice. The skin was
separated from the underlying muscle by blunt dissection. The
"pocket" was inoculated with 200 .mu.l containing
2.5.times.10.sup.7 spores (in saline) and closed using wound clips.
One hour later, the clips were removed and the wound irrigated with
either 2 ml of sterile saline or with 2 ml of X8P (1:10 in sterile
saline). The wounds were then closed using wound clips. The animals
were observed for clinical signs. Gross and histopathology were
performed when the animals were euthanized 5 days later. The wound
size was calculated by the following formula: 1/2 a.times.1/2
b.times..pi. where a and b are two perpendicular diameters of the
wound.
[0437] In vitro sporicidal activity: To assess the sporicidal
activity of X8P, spores from four species of Bacillus genus, B.
cereus, B. circulans, B. megatetium, and B. subtilis were tested.
X8P at 1:100 dilution showed over 91% sporicidal activity against
B. cereus and B. megaterium in 4 hours. B. circulans was less
sensitive to X8P showing 80% reduction in spore count, while B.
subtilis appeared resistant to X8P in 4 hours. A comparison of the
sporicidal effect of X8P (at dilutions of 1:10 and 1:100) on B.
cereus spores was made with a 1:100 dilution of bleach (i.e.,
0.0525% sodium hypochlorite), and no significant difference was
apparent in either the rate or extent of sporicidal effect. The
other nanoemulsion, X8W.sub.60PC, was more efficient in killing the
Bacillus spores. At 1:1000 dilution, it showed 98% killing of B.
cereus spores in 4 hours (compared to 47% with 1:1000 dilution of
X8P). X8W60PC at a 1:1000 dilution resulted in 97.6% killing of B.
subtilis spores in 4 hours, in contrast to its resistance to
X8P.
[0438] B. cereus sporicidal time course: A time course was
performed to analyze the sporicidal activity of X8P diluted 1:100
and X8W.sub.60PC diluted 1:1000 against B. cereus over an eight
hour period. Incubation of X8P diluted 1:100 with B. cereus spores
resulted in a 77% reduction in the number of viable spores in one
hour and a 95% reduction after 4 hours. Again, X8W.sub.60PC diluted
1:1000 was more effective than X8P 1:100 and resulted in about 95%
reduction in count after 30 minutes.
[0439] X8P B. anthracis sporicidal activity: Following initial in
vitro experiments, X8P sporicidal activity was tested against two
virulent strains of B. anthracis (Ames and Vollum 1B). It was found
that X8P at a 1:100 final dilution incorporated into growth medium
completely inhibited the growth of 1.times.10.sup.5 B. anthracis
spores. Also, 4 hours incubation with X8P at dilutions up to 1:1000
with either the Ames or the Vollum 1 B spores resulted in over 91%
sporicidal activity when the mixtures were incubated at RT, and
over 96% sporicidal activity when the mixtures were incubated at
37.degree. C. (Table 21).
[0440] Table 21: X8P sporicidal activity against 2 different
strains of Bacillus anthracis spores as determined by colony
reduction assay (% killing). X8P at dilutions up to 1:1000
effectively killed >91% of both spore strains in 4 hours at
either 27 or 37.degree. C.; conditions that differed markedly in
the extent of spore germination. Sporicidal activity was consistent
at spore concentrations up to 1.times.10.sup.6/ml.
TABLE-US-00022 TABLE 21 Ames Ames (cont) Vollum 1 B B. anthracis
Room Temp. 37.degree. C. Room Temp. 37.degree. C. X8P 1:10 91% 96%
97% 99% X8P 1:100 93% 97% 97% 98% X8P 1:1000 93% 97% 98% 99%
[0441] X8W.sub.60PC B. anthracis sporicidal activity: Since
X8W.sub.60PC was effective at higher dilutions and against more
species of Bacillus spores than X8P, it was tested against 4
different strains of B. anthracis at dilutions up to 1:10,000 at RT
to prevent germination. X8W.sub.60PC showed peak killing between
86% and 99.9% at 1:1000 dilution (Table 22).
[0442] Table 22: X8W.sub.60PC sporicidal activity against 4
different strains of B. anthracis representing different clinical
isolates. The spores were treated with X8W.sub.60PC at different
dilutions in RT to reduce germination. There was no significant
killing at low dilutions. The maximum sporicidal effect was
observed at 1:1000 dilution.
TABLE-US-00023 TABLE 22 South Bison, Del Rio, B. anthracis Africa
Canada Mozambigue Texas X8W.sub.60PC 1:10 81.8 85.9 41.9 38
X8W.sub.60PC 1:100 84 88.9 96.5 91.3 X8W.sub.60PC 1:1000 98.4 91.1
99.9 86 X8W.sub.60PC 1:5,000 79.7 41.3 95.7 97.1 X8W.sub.60PC
1:10,000 52.4 80 ND ND
[0443] Electron microscopy examination of the spores:
Investigations were carried out using B. cereus because it is the
most closely related to B. anthracis. Transmission electron
microscopy examination of the B. cereus spores treated with X8P
diluted 1:100 in TSB for four hours revealed physical damage to the
B. cereus spores, including extensive disruption of the spore coat
and cortex with distortion and loss of density in the core.
[0444] Germination stimulation and inhibition: To investigate the
effect of initiation of germination on the sporicidal effect of X8P
on Bacillus spores, the germination inhibitors D-alanine (Titball
and Manchee, 1987, supra), and germination simulators L-alanine and
inosine (Shibata et al., 1976, supra) were incubated with the
spores and X8P for 1 hour. The sporicidal effect of X8P was delayed
in the presence of 10 mM D-alanine and accelerated in the presence
of 50 .mu.M L-alanine and 50 .mu.M inosine.
[0445] In vivo sporicidal activity: Bacillus cereus infection in
experimental animals had been previously used as a model system for
the study of anthrax and causes an illness similar to experimental
anthrax infection (Welkos et al., Infect Immun. 51:795 (1986);
Drobniewski, Clin Microbiol Rev. 6:324 (1993); Burdon et al., J
Infect Dis. 117:307 (1967); Fritz et al. Lab Invest. 73:691 (1995);
Welkos and Friedlander, Microb Pathog 5:127 (1988)). Two animal
models of cutaneous B. cereus disease were developed to assess the
in vivo efficacy of X8P. Because these models involve subcutaneous
administration of the nanoemulsion, in vivo toxicity testing of X8P
was performed prior to this application. CD-I mice injected with
X8P diluted 1:10 in saline as a control did not exhibit signs of
distress or inflammatory reaction, either in gross or histological
analysis. To test the pathogenic effect of B. cereus spores in vivo
and the sporicidal effect of X8P, a suspension of 4.times.10.sup.7
B. cereus spores was mixed with saline or with X8P at a final
dilution of 1:10 and then immediately injected subcutaneously into
the backs of CD-1 mice. Mice which were infected subcutaneously
with B. cereus spores without X8P developed severe edema at 6-8
hours. This was followed by a gray, necrotic area surrounding the
injection site at 18-24 hours, with severe sloughing of the skin
present by 48 hours, leaving a dry, red-colored lesion.
Simultaneous injection of spores and X8P resulted in a greater than
98% reduction in the size of the necrotic lesion from 1.68 cm.sup.2
to 0.02 cm.sup.2 when the spores were premixed with X8P. This was
associated with minimal edema or inflammation.
[0446] In additional studies, a 1 cm skin wound was infected with
2.5.times.10.sup.7 B. cereus spores then closed without any further
treatment. The other groups were infected with the same number of
spores, then 1 hour later the wounds were irrigated with either X8P
or saline to simulate post-exposure decontamination. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit. X8P irrigation of wounds infected with B. cereus
spores showed substantial benefit, resulting in a consistent 98%
reduction in the lesion size from 4.86 cm to 0.06 cm.sup.2. This
reduction in lesion size was accompanied by a four-fold reduction
in mortality (80% to 20%) when compared to experimental animals
receiving either no treatment or saline irrigation.
Example 12
Effect of Surfactant Lipid Preparations (SLPS) on Influenza A Virus
Infectivity In Vitro
[0447] The following example describes the effect of emulsions on
Influenza A virus infectivity Enveloped viruses are of great
concern as pathogens. They spread rapidly and are capable of
surviving out of a host for extended periods. Influenza A virus was
chosen because it is a well accepted model to test anti-viral
agents (Karaivanova and Spiro, Biochem J. 329(Pt 3):511 (1998);
Mammen et al., J Med Chem 38:4179 (1995)). Influenza is a
clinically important respiratory pathogen that is highly contagious
and responsible for severe pandemic disease.
[0448] The envelope glycoproteins, hemagglutinin (HA) and
neuraminidase (NA) not only determine the antigenic specificity of
influenza subtypes, but they mutate readily and, as a result, may
allow the virus to evade host defense systems. This may result in
the initiation of disease in individuals that are immune to closely
related strains. The following is a description of the methods and
composition used for determining the efficacy of SLPs in preventing
influenza A infectivity.
[0449] Surfactant lipid preparations (SLPs): The SLPs were made in
a two-step procedure. An oil phase was prepared by blending soybean
oil with reagents listed in Table 1 and heating at 86.degree. C.
for one hour (Florence, 1993). The SLPs were then formed by
injecting water or 1% bismuth in water (SS) into the oil phase at a
volume/volume ratio using a reciprocating syringe pump.
[0450] Viruses: Influenza virus A/AA/6/60 was kindly provided by
Dr. Hunein F. Maassab (School of Public Health, University of
Michigan). Influenza A virus was propagated in the allantoic
cavities of fertilized pathogen-free hen eggs (SPAFAS, Norwich,
Conn.) using standard methods (Barrett and Inglis, 1985). Virus
stock was kept in aliquots (10.sup.8 pfu/ml) of infectious
allantoic fluids at -80.degree. C. Adenoviral vector (AD.RSV
ntlacZ) was provided by Vector Core Facility (University of
Michigan Medical Center, Ann Arbor, Mich.) and was kept in aliquots
(10.sup.12 pfu/ml at -80.degree. C.). The vector is based on a
human adenoviral (serotype 5) genomic backbone deleted of the
nucleotide sequence spanning E1A and E1B and a portion of E3
region. This impairs the ability of the virus to replicate or
transform nonpermissive cells. It carries the E. coli LacZ gene,
encoding .beta.-galactosidase under control of the promoter from
the Rouse sarcoma virus long terminal repeat (RSV-LTR). The vector
also contains a nuclear targeting (designated as nt) epitope linked
to the 5' end of the LacZ gene to facilitate the detection of
protein expression (Baragi et al., 1995).
[0451] Cells: Madin Darby Canine Kidney (MDCK) cells were purchased
from the American Type Culture Collection (ATCC; Rockville, Md.)
and 293 cells (CRL 1573; transformed primary embryonic human
kidney) were obtained from the Vector Core Facility (University of
Michigan Medical Center, Ann Arbor, Mich.). The 293 cells express
the transforming gene of adenovirus 5 and therefore restore the
ability of Ad.RSV ntlacZ vector to replicate in the host cell.
[0452] Cell maintenance media: MDCK cells were maintained in
Eagle's minimal essential medium with Earle's salts, 2 mM
L-glutamine, and 1.5 g/l sodium bicarbonate (Mediatech, Inc.,
Herndon, Va.) containing 10% fetal bovine serum (FBS; Hyclone
Laboratories, Logan, Utah). The medium was supplemented with 0.1 mM
non-essential amino acids, 1.0 mM sodium pyruvate, 100 U
penicillin/ml and streptomycin 100 .mu.g/ml (Life Technologies,
Gaithersburg, Md.). The 293 cells were maintained in Dulbecco's
modified Eagle medium (Mediatech, Inc., Herndon, Va.), containing 2
mM L-glutamine, 0.1 mM non-essential amino acids, and 1.0 mM sodium
pyruvate. It also contained 100 U penicillin/ml and streptomycin
100 .mu.g/ml (Life Technologies, Gaithersburg, Md.) and was
supplemented with 10% FBS (Hyclone Laboratories, Logan, Utah).
[0453] Virus infection media: Influenza A infection medium was the
MDCK cell maintenance medium (without FBS) supplemented with 3.0
.mu.g/ml of tolylsulfonyl phenylalanyl chloromethyl ketone
(TPCK)-treated trypsin (Worthington Biochemical Corporation,
Lakewood, N.J.). Adenovirus infection medium was 293T cell
maintenance medium with a reduced concentration of serum (2%
FBS).
[0454] Influenza A overlay medium: Overlay medium consisted of
equal amounts of 2.times. infection medium and 1.6% SEAKEM ME
agarose (FMC BioProducts, Rockland, Md.). Staining agarose overlay
medium consisted of agarose overlay medium plus 0.01% neutral red
solution (Life Technologies, Gaithersburg, Md.) without
TPCK-treated trypsin.
[0455] Plaque reduction assays (PRA): The plaque reduction assay
was performed with a modification of the method described elsewhere
(Hayden et al., 1980). MDCK cells were seeded at 1.times.10.sup.5
cells/well in 12-well FALCON plates and incubated at 37.degree.
C./5% CO.sub.2 for 3 days. Approximately 1.times.10.sup.8 pfu of
influenza A virus was incubated with surfactant lipid preparations
as described below. The influenza A virus-SLP treatments and
controls were diluted in infection medium to contain 30-100 pfu/250
.mu.l. Confluent cell monolayers were inoculated in triplicate on 3
plates and incubated at 37.degree. C./5% CO.sub.2 for 1 h. The
inoculum/medium was aspirated and 1 ml of agarose overlay
medium/well was added and plates were incubated at 37.degree. C./5%
CO.sub.2 until plaques appeared. Monolayers were stained with the
agarose overlay medium and incubation was continued at 37.degree.
C./5% CO.sub.2. Plaques were counted 6-12 h after staining. The
average plaque count from 9 wells with lipid preparation
concentration was compared with the average plaque count of
untreated virus wells.
[0456] In situ cellular enzyme-linked immunosorbent assay (ELISA):
To detect and quantitate viral proteins in MDCK cells infected with
influenza A virus, the in situ cellular ELISA was optimized.
Briefly, 2.times.10.sup.4 MDCK cells in 100 .mu.l complete medium
were added to flat-bottom 96-well microtiter plates and incubated
overnight. On the next day, the culture medium was removed and
cells were washed with serum free maintenance medium. One hundred
.mu.l of viral inoculum was added to the wells and incubated for 1
hour. The viral inoculum was removed and replaced with 100 .mu.l of
MDCK cell maintained medium plus 2% FBS. The infected MDCK cells
were incubated for an additional 24 h. Then the cells were washed
once with PBS and fixed with ice cold ethanol:acetone mixture (1:1)
and stored at -20.degree. C. On the day of the assay, the wells of
fixed cells were washed with PBS and blocked with 1% dry milk in
PBS for 30 min. at 37.degree. C. One hundred .mu.l of ferret
anti-influenza A virus polyclonal antibody at 1:1000 dilution
(kindly provided by Dr. Hunein F. Maassab, School of Public Health,
University of Michigan) was added to the wells for 1 hr at
37.degree. C. The cells were washed 4 times with washing buffer
(PBS and 0.05% TWEEN-20), and incubated with 100 .mu.l at 1:1000
dilution of goat anti-ferret peroxidase conjugated antibody
(Kirkegaard & Perry Laboratories, Gaithersburg, Mass.) for 30
min. at 37.degree. C. Cells were washed 4 times and incubated with
100 .mu.l of 1-STEP TURBO TMB-ELISA substrate (Pierce, Rockford,
Ill.) until color had developed. The reaction was stopped with 1 N
sulfuric acid and plates were read at a wavelength of 450 nm in an
ELISA microtiter reader.
[0457] .beta.-galactosidase assay: .beta.-galactosidase assay was
performed on cell extracts as described elsewhere (Lim, 1989).
Briefly, 293 cells were seeded on 96-well "U"-bottom tissue culture
plates at approximately 4.times.10.sup.4 cells/well and incubated
overnight at 37.degree. C./5% CO.sub.2 in maintenance medium. The
next day, the medium was removed and the cells were washed with 100
.mu.l Dulbecco's phosphate buffered saline (DPBS). Adenovirus stock
was diluted in infection medium to a concentration of
5.times.10.sup.7 pfu/ml and mixed with different concentrations of
X8P as described below. After treatment with X8P, virus was diluted
with infection medium to a concentration of 1.times.10.sup.4 pfu/ml
and overlaid on 293 cells. Cells were incubated at 37.degree. C./5%
CO.sub.2 for 5 days, after which the plates were centrifuged, the
medium was removed and the cells were washed three times with PBS
without Ca++ and Mg++. After the third wash, the PBS was aspirated
and 100 .mu.l of 1.times. Reporter Lysis Buffer (Promega, Madison,
Wis.) was placed in each well. To enhance cell lysis, plates were
frozen and thawed three times and the .beta.-galactosidase assay
was performed following the instruction provided by the vendor of
.beta.-galactosidase (Promega, Madison, Wis.) with some
modifications. Five microliters of cell extract was transferred to
a 96-well flat bottom plate and mixed with 45 .mu.l of 1.times.
Reporter Lysis Buffer (1:10). Subsequently 50 .mu.l of 2.times.
assay buffer (120 mM Na.sub.2HPO.sub.4, 80 mM NaH.sub.2PO.sub.4, 2
mM MgCl.sub.2, 100 mM .beta.-mercaptoethanol, 1.33 mg/ml ONPG
(Sigma, St. Louis, Mo.) were added and mixed with the cell extract.
The plates were incubated at RT until a faint yellow color
developed. At that time the reaction was stopped by adding 100
.mu.l of 1 M sodium bicarbonate. Plates were read at a wavelength
of 420 nm in an ELISA microplate reader. The units of
.beta.-galactosidase in each cell extract was calculated by
regression analysis by reference to the levels in the standard and
divided by milligrams of protein in the cell extract sample.
[0458] Cellular toxicity and virus treatment with lipid
preparations: Prior to viral susceptibility testing, cytotoxicity
of SLPs on MDCK and 293 cells was assessed by microscope inspection
and MTT assay. The dilutions of the mixture of virus and SLPs
applied in susceptibility testing were made to be at least one
order of magnitude higher than the safe concentration of SLP
assessed. Approximately 1.times.10.sup.8 pfu of either influenza A
or adenovirus were incubated with lipid preparation at final
concentrations of 1:10, 1:100, and 1:1000 for different time
periods as indicated in results on a shaker. After incubation,
serial dilutions of the SLP/virus mixture were made in proper
infection media and overlaid on MDCK (influenza A) or 293
(adenovirus) cells to perform PRA, cellular ELISA or
.beta.-galactosidase assays as described above.
[0459] Electron microscopy: Influenza A virus was semi-purified
from allantoic fluid by passing through a 30% sucrose cushion
prepared with GTNE (glycine 200 mM, Tris-HCl 10 mM (pH 8.8), NaCl
100 mM, and EDTA 1 mM) using ultra centrifugation (Beckman rotor SW
28 Ti, at 20,000 rpm for 16 hours). Pelleted virus was
reconstituted in GTNE. Ten microliters of respective samples
(adenovirus, influenza virus, adenovirus+X8P, influenza virus+X8P)
were incubated for 15 and 60 min, then placed on parlodian coated
200 mesh copper grids for 2 min. Five .mu.l of 2%
cacodylated-buffered glutaraldehyde was then added. The fluid was
removed with filter paper after 3 min. Ten microliters of 7% uranyl
acetate was added to the grid and drawn off with filter paper after
30 sec. The grids were allowed to dry 10 min and examined on a
Philips EM400T transmission electron microscope. Micrographs were
recorded in Fuji FG film at magnifications of 200,000.times..
[0460] Susceptibility testing of influenza A to SLPS: The effect of
four surfactant lipid preparations (X8P, NN, W.sub.808P, and SS) on
influenza A infection of MDCK cells was investigated. All tested
preparations inhibited influenza A virus infection to varying
degrees. X8P and SS exhibited over 95% inhibition of influenza A
infection at a 1:10 dilution. NN and W.sub.808P showed only an
intermediate effect on influenza A virus, reducing infection by
approximately 40%. X8P's virucidal effect was undiminished even at
a 1:100 dilution. SS showed less effect at a 1:100 dilution
inhibiting influenza A infection by 55%. These two lipid
preparations at 1:1000 dilution displayed only weak inhibitory
effect on virus infectivity at the range of 22-29%.
[0461] Since X8P and SS both showed strong inhibitory effect on
virus infectivity, PRA was used to verify data obtained from
cellular ELISA. PRA confirmed the efficacy of X8P and SS. X8P
reduced the number of plaques from an average of 50.88 to 0 at a
1:10 dilution (Table 23). At dilution 1:100, X8P maintained
virucidal effectiveness. At dilution 1:100 SS reduced the number of
plaques only approximately 7% as compared with untreated virus.
TABLE-US-00024 TABLE 23 Treatment Plaque forming Plaque forming
units units Dilution of the agent: X8P SS 1:10.sup.a 0.00.sup.b
(+/-0.00).sup.c 0.00 (+/-0.00) 1:100 0.00 (+/-0.00) 1.55 (+1-0.12)
Untreated virus 50.88 (+/-1-0.25) 23.52 (+/-0.18) .sup.aVirus was
incubated with SLPs for 30 minutes. .sup.bNumber of plaques.
[0462] Kinetics of X8P action on influenza A virus: To investigate
the time requirement for X8P to act on influenza A infectivity,
virus was incubated with X8P at two dilutions (1:10, 1:100) and
four different time intervals (5, 10, 15, 30 min). Subsequently, a
plaque reduction assay was performed. As shown in Table 24, after
five min of incubation with X8P at either dilution, influenza A
virus infectivity of MDCK cells was completely abolished. There was
no significant difference between the interaction of X8P with
influenza A virus regardless of concentration or time.
TABLE-US-00025 TABLE 24 Plaque Forming Units after X8P
Treatment/Dilution Time (min) 1:10 1:100 untreated 5 0.00.sup.a
0.00 35.25 (+/-0.00).sup.b (+/-0.00) (+/-0.94) 10 0.00 0.25 39.25
(+/-0.00) (+/-0.12) (+/-1.95) 15 0.00 0.25 31.50 (+/-0.00)
(+/-0.12) (+/-1.05) 30 0.00 0.00 26.50 (+/-0.00) (+/-0.00)
(+/-0.08)
[0463] Anti-influenza A efficacy of X8P: Since TRITON X-100
detergent has anti-viral activity (Maha and Igarashi, Southeast
Asian J Trop Med Public Health 28:718 (1997)), it was investigated
whether TRITON X-100 alone or combined with individual X8P
components inhibits influenza A infectivity to the same extent as
X8P. Influenza A virus was treated with: 1) X8P, 2) the combination
of tri(n-butyl)phosphate, TRITON X-100, and soybean oil (TTO), 3)
TRITON X-100 and soybean oil (TO), or 4) TRITON X-100 (T) alone.
X8P was significantly more effective against influenza A virus at
1:10 and 1:100 dilutions (TRITON X-100 dilution of 1:500, and
1:5000) than TRITON X-100 alone or mixed with the other components
tested. At the dilution 1:1000, X8P (TRITON X-100 dilution of
1:50,000) was able to reduce influenza A infection of MDCK cells by
approximately 50% while TRITON X-100 alone at the same
concentration was completely ineffective.
[0464] X8P does not affect infectivity of non-enveloped virus: To
investigate whether X8P may affect the infectivity of non-enveloped
virus, genetically engineered adenovirus containing LacZ gene was
used, encoding .beta.-galactosidase. This adenovirus construct is
deficient in the transforming gene and therefore can replicate and
transform only permissive cells containing the transforming gene of
adenovirus 5. The 293 cells, which constitutively express
transforming gene, were employed to promote adenovirus replication
and production of .beta.-galactosidase enzyme. X8P treatment did
not affect the ability of adenovirus to replicate and express
.beta.-galactosidase activity in 293 cells. Both X8P treated and
untreated adenovirus produced approximately 0.11 units of
.beta.-galactosidase enzyme.
[0465] Action of X8P on enveloped virus: Since X8P only altered the
infectivity of enveloped viruses, the action of this nanoemulsion
on enveloped virus integrity was further investigated using
electron microscopy. After a 60 min incubation with 1:100 dilution
of X8P, the structure of adenovirus is unchanged. A few
recognizable influenza A virions were located after 15 min
incubation with X8P, however, no recognizable influenza A virions
were found after 1 h incubation. X8P's efficacy against influenza A
virus and its minimal toxicity to mucous membranes demonstrates its
potential as an effective disinfectant and agent for prevention of
diseases resulting from infection with enveloped viruses.
Example 13
The Ability of Nanoemulsion/Influenza Compositions to Induce an
Immune Response in Mice
[0466] This Example describes the ability of an exemplary
nanoemulsion composition to elicit a specific immune response in
mice.
[0467] A. The Effect of Pre-Treatment with Nanoemulsion on Immune
Response to Influenza A
[0468] Mice were pretreated with nasally-applied nanoemulsion (1.0%
8N8 and 1.0% or 0.2% 20N10) 90 minutes before exposure to influenza
virus (5.times.10.sup.5 p.f.u./ml) by nebulized aerosol. Morbidity
from pretreatment with nanoemulsion was minimal and, as compared to
control animals, mortality was greatly diminished (20% with
pretreatment vs. 80% in controls, Donovan et al., Antivir Chem.
Chemother., 11:41 (2000)). Several of the surviving, emulsion
pretreated animals had evidence of immune reactivity and giant-cell
formation in the lung that were not present in control animals
treated with emulsion but not exposed to virus. All of the
pretreated animals had evidence of lipid uptake in lung
macrophages.
[0469] FIG. 6 shows serum anti-influenza titers in mice treated
with different preparations of virus. Only animals whose nares were
exposed to virus/nanoemulsion show significant IgG titers. In
animals exposed to virus without pretreatment or emulsion alone, no
immune response to influenza virus was observed. Antibody titers to
influenza virus in the serum of exposed animals was measured and
found that animals pretreated with emulsion and exposed to virus
had high titers of virus-specific antibody (FIG. 6). This immune
response was not observed in control animals exposed to virus
without pretreatment. The high titers of antibody in these animals
prompted experiments to determine whether or not the
co-administration of emulsion and virus would yield protective
immunity without toxicity.
[0470] B. The Effect of Nanoemulsion/Influenza A Virus
Co-Administration on Immune Response
[0471] X8P emulsion was pre-mixed with the virus. The final
emulsion concentration was 2% and virus concentration was
2.times.10.sup.6 pfu/ml. The emulsion/virus solution (25 .mu.l) of
the emulsion/virus solution was administered to the nares of mice
under mild anesthesia. A control group received the same viral dose
inactivated using 1:4000 dilution of formaldehyde solution
incubated for 3 days to ensure complete inactivation. Another
control group included mice that received a reduced dose of virus
(100 pfu/mouse). Additional controls received nanoemulsion alone or
saline alone.
[0472] Three weeks later, mice received a second dose of the
emulsion/virus vaccine. Representatives of the group were tested
for the development of serum antibodies and some were challenged
with a lethal dose of influenza A virus to check for any developed
immunity. Two weeks later, mice were tested for the development of
a protective immune response in their serum. Some mice were
challenged with a lethal dose of influenza virus to check for the
development of protective immunity. All the challenged mice were
observed for 14 days for signs of disease. Sera were tested for the
presence of specific antibodies against influenza virus.
[0473] The results of the experiment are shown in Table 25 and
FIGS. 7-8. None of the 15 animals died from exposure to a LD80 of
virus after two administrations of 5.times.10.sup.4 pfu of virus
mixed in nanoemulsion, whereas the expected 80% of control animals
died from this exposure. The same dose of formalin killed virus
applied to the nares provided no protection from death and resulted
in much lower titers of virus-specific antibody.
[0474] FIG. 7 shows bronchial IgA anti-influenza titers in mice
treated with different preparations of virus. Animals whose nares
were exposed to virus/nanoemulsion show significant IgA titers. In
animals exposed to killed virus or emulsion alone, a much lower IgA
titer was observed.
[0475] FIG. 8 shows serum anti-influenza titers in mice treated
with two doses of several different preparations of virus. As
compared to the animals in FIG. 6, the titers are much higher,
particularly in the virus/emulsion treated animals. This indicates
a "booster" response to the second administration. This example
demonstrates that the administration of both nanoemulsion and
killed virus is both necessary and sufficient to elicit a specific
immune response in mice.
TABLE-US-00026 TABLE 25 Mortality of Influenza Exposed Animals
Receiving Intranasal Pretreatment Mortality Death (%) No
Pre-treatment 13/15 87 (5 .times. 10.sup.4 pfu) Emulsion Alone
12/15 80 Formalin Killed Virus 10/15 75 (5 .times. 10.sup.4 pfu)
Emulsion and Virus 0/15 0 Reduced Virus alone 6/15 40 (100 pfu)
[0476] Additional experiments were performed to investigate the
possibility that a small amount of residual, live virus in the
nanoemulsion was producing a subclinical infection that provided
immunity. An additional group of animals were given approximately
100 pfu of live virus intranasally in an attempt to induce a
low-level infection (approximately four times the amount of live
virus present after 15 minutes of treatment with nanoemulsion).
While there was a reduction in death rates of these animals, the
amount of protection observed was insignificant and none of these
animals developed virus-specific antibodies (Table 25). This result
indicates that it was not merely a sub-lethal viral infection
mediating the immune response but that the emulsion was
specifically enhancing the virus-specific immune response. The
protective immunity was obtained following only two applications
(immunizations) of the emulsion/virus mix, and appeared to increase
after each application suggesting a "booster effect."
Virus-specific antibody titers were maintained for six weeks until
the end of the experiment.
Example 14
Testing of Nanoemulsion Vaccines
[0477] This Example describes experiments useful in testing
potential nanoemulsion vaccines for their safety and efficacy.
[0478] A. Pre-Exposure Prophylaxis and Induction of Immunity
[0479] Intranasal prophylaxis: 6 groups of animals (Table 26)
receive the following schedule of treatments intranasally with
15-60 minute intervals in between. Animals are monitored for any
sign of diseases. Blood, broncho-alveolar lavage fluid and nasal
washing are collected and tested for pathogen specific antibody
titer using ELISA (Fortier et al., (1991); Jacoby et al., (1983),
and Takao et al., (1997)). Two weeks later, surviving animals are
challenged with a lethal dose of the pathogen to test for the
development of a protective immune-response. Terminally ill animals
are sacrificed humanely as soon as identified, as are all other
animals at the end of the experiment (at least two weeks after the
challenge). Blood and tissue are harvested for histopathological
examination and both the serologic and cell-mediated immune
responses are determined.
TABLE-US-00027 TABLE 26 Treatment Groups of Animal in Exposure
Trials Group Pre-treatment Treatment 1 Diluted Nanoemulsion Live
Pathogen 2 Diluted Nanoemulsion Formalin Killed Pathogen 3 Diluted
Nanoemulsion PBS 4 PBS Live Pathogen 5 PBS Formalin Killed Pathogen
6 PBS PBS
[0480] B. Evaluation of the Adjuvant Activity of the
Nanoemulsion
[0481] Cell-mediated immune responses are evaluated in vitro. The
evaluation is performed on immunocompetent cells harvested from
euthanized animals obtained from the experiment described above
(section A). T-cells proliferation response is assessed after
re-stimulation with antigen. Cells are re-stimulated with whole
pathogen or pathogen constituents such as DNA, RNA or proteins
alone or mixed with nanoemulsion. Proliferation activity is
measured by H3-thymidine uptake or Cell Proliferation ELISA
chemiluminiscence. In addition to proliferation, Th1 and Th2
cytokine responses are measured to qualitatively evaluate the
immune response. These include IL-2, TNF-.gamma., IFN-.gamma.,
IL-4, L-6, IL-11, IL-12, etc.
[0482] Proliferation and cytokine response patterns are compared
with the results obtained in Section A above. After careful
analysis of the data, nanoemulsions are modified by substituting
specific components with other oils, detergents or solvents. Other
desired adjuvants such as CpG, chemokines and dendrimers are added
to the emulsion/pathogen mix to evaluate their enhancement of
immune responses, along with potential toxicity.
[0483] C. Development of Rapid and Effective Mucosal Vaccines
[0484] This example provides a non-limiting example of methods for
testing the nanoemulsion vaccines of the present invention.
Intranasal vaccination: Animals are divided into 6 groups. Each
group receives a different intranasal challenge to evaluate the
resulting immune response:
1. Nanoemulsion alone (Negative control) 2. Pathogen alone
(Positive control). 3. Nanoemulsion/pathogen mixture, prepared
immediately prior to administration. 4. Nanoemulsion/pathogen
mixture, prepared 3 days before administration. 5. Formaldehyde
killed pathogen.
[0485] Table 27 shows the challenge protocol for vaccine studies.
All challenged animals are monitored daily for any signs of
illness. Serum is tested for pathogen specific antibody titer using
ELISA (Fortier et al., Infect. Immun., 59:2922 (1991), Jacoby et
al., Lab. Anim. Sci., 33:435 (1983), and Takao et al., J. Virol.,
71:832 (1997)). Any terminally ill animals are humanely euthanized,
with serum harvested for antibody titer and tissues collected for
histopathologic examination. Harvested spleen cell and lymph node
cell suspensions are used to determine cell-mediated immune
responses. At the end of the experiment, all remaining animals are
humanely sacrificed for similar analysis.
TABLE-US-00028 TABLE 27 Challenge Protocol for Vaccine Studies Day
Procedure 0 Start of the treatment for all groups. 14 Blood samples
are collected from all the animals. One group of animals is
sacrificed for BAL, nasal washing, organs and histopathology. One
group of animals is challenged with a lethal dose of the pathogen.
The rest of the animals receive second dose of the emulsion/vaccine
treatment. 35 Blood samples are collected from all the animals. One
group of animals is sacrificed for BAL, nasal washing, organs and
histopathology. One group of animals is challenged with a lethal
dose of the pathogen. 49 Blood samples are collected from all the
animals. The remaining animals are sacrificed for BAL, nasal
washing, organs and histopathology.
Example 15
Protection of Mice from Viral Pneumonitis after Intranasal
Immunization with Influenza A and Nanoemulsion
A. Material and Methods
Animals
[0486] Female C3H/HeNHsd (Harlan, Indianapolis, Ind.) 5-week-old,
specific-pathogen-free mice were used in all experiments.
Virus
[0487] Influenza A/Ann Arbor/6/60 virus (H2N2), mouse adapted,
F.sub.-14-95, E.sub.1, M.sub.3, E.sub.1, SE.sub.1 was provided by
Dr. Hunein Maassab (School of Public Health, University of
Michigan, Ann Arbor, Mich.). Influenza A/Puerto Rico/8/34 virus
(H1N1), mouse adapted, F.sub.8, M.sub.593, E.sub.173, SE.sub.1 was
from ATCC (Rockville, Md.). All viruses were propagated in
allantoic cavities of fertilized pathogen-free hen eggs (SPAFAS,
Norwich, Conn.) using standard methods described elsewhere
(Herlocher et al., Virus Res., 42:11 (1996)). Virus stocks were
kept in aliquots of infectious allantoic fluids at -80.degree. C.
The virus was purified on sucrose gradient 15-60% solution at
100,000 g for 90 min at 4.degree. C., as described previously
(Merton et al., Production of influenza virus in cell cultures for
vaccine preparation. In: Novel Strategies in Design and Production
of Vaccines. Edited by S. Cohen and A. Shafferman, Plenum Press,
New York, 1996. pp. 141-151). The band containing the virus was
collected, diluted in NTE buffer (100 mM NaCl, 10 mM Tris-HCl, 1 mM
EDTA, pH=7.5) and spun down at 100,000.times.g for 60 min at
4.degree. C. The virus pellet was resuspended in NTE buffer and
stored at -80.degree. C.
Inactivation of Virus with Formaldehyde
[0488] Virus inactivation was performed as previously described
(Chen et al., J. Virol. 61:7 (1987); Novak et al., Vaccine 11:1
(1993)). Briefly, different doses (10.sup.3-10.sup.5 pfu) of virus
were incubated in formaldehyde solution (dilution 1:4000) for 3
days and subsequently administrated to animals.
Inactivation of Virus with X8P Nanoemulsion
[0489] Intact influenza A virus at various concentrations of
2.times.10.sup.4-5.times.10.sup.5 pfu was mixed with equal volume
of 4% X8P nanoemulsion (final concentration: 2%) and incubated at
37.degree. C. for 60 mm.
Preparation of Nanoemulsion and Toxicity Testing
[0490] The X8P surfactant nanoemulsion was prepared in a two-step
procedure. An oil phase was prepared by blending the following
ingredients: TBP (final concentration 8%), TRITON X-100
(4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol) (8%) and
soybean oil (64%) and heating at 70.degree. C. for 30 minutes (See
e.g., U.S. Pat. No. 6,015,832 and U.S. Patent Application
20020045667, each of which is herein incorporated by reference).
The surfactant nanoemulsion was then formed by mixing with water
(20%) using a Silverson L4RT Mixer for 3 minutes at 10,000 rpm.
TRITON X-100 was purchased from Sigma Chemicals (St. Louis, Mo.),
TBP was purchased from Aldrich (Milwaukee, Wis.), and soybean oil
was purchased from Croda Inc. (Mill Hill, Pa.). The X8P
nanoemulsion was tested for animal toxicity as previously described
(See e.g., above examples). Briefly, the mice were anaesthetized
with metofane and different concentrations of nanoemulsion (1, 2,
and 4%) at a volume of 50 .mu.l (25 .mu.l/nare) were administrated
to mice intranasally. All tested concentrations of nanoemulsion
were well tolerated after direct intranasal instillation in mice.
Based on these data, 2% X8P was chosen for the immunization
study.
Plaque and Plaque Reduction Assays
[0491] Plaque assays (PA) were performed on MDCK monolayer cells in
six-well plates as previously described (Myc et al., J. Virol.
Meth. 77:165 (1999)). Plaque reduction assays (PRA) were performed
with a modification of the method described by Hayden et al.
(Antimicrob. Agents and Chemother., 17:865 (1980)). MDCK cells were
grown in 150.times.25 mm petri dishes to 80% confluency.
Approximately 1.times.10.sup.8 pfu influenza A virus was incubated
either with nanoemulsion or PBS for 30 min at room temperature
(RT). After incubation, nanoemulsion-treated and untreated virus
were resuspended in 250 ml medium and the entire volume of viral
suspension was placed on separate cell monolayers and incubated for
1 h, following the plaque assay method as previously described (Myc
et al., supra).
Immunizations and Experimental Design
[0492] All groups of mice were treated intranasally with viral or
control solutions in a total volume of 50 .mu.l (25 .mu.l/nare) as
described in the Results section below. Briefly, each mouse was
halothane anesthetized and held inverted with the nose down until
droplets of emulsion applied to external nares were completely
inhaled. All mice were treated once on day 1 of the experiment. On
day 21, mice were challenged with LD.sub.100 either with congenic
virus (used for intranasal treatment) or heterogenic virus. After
the challenge, mice were monitored daily for clinical signs of
illness for 14 days. Clinical signs of illness were graded on a
scale of 0-3, where 0 indicated no significant clinical
abnormality; 1 indicated mild symptoms including piloerection,
hunched back and loss of movement; 2 indicated cyanosis, dyspnea,
circulatory compromise tachypnea and a rectal temperatures
<33.degree. C.; and 3 indicated death of the animal. Rectal core
body temperatures were recorded with a Model BAT-12 digital
thermometer fitted with a RET-3 type T mouse rectal probe
(Physitem, Clifton, N.J.) (Rozen et al., Meth. Mol. Biol., 132:365
(2000)). Mice with core body temperatures falling below 33.degree.
C. were judged to be terminally moribund and humanely euthanized
(Stevenson et al., J. Immunol., 157:3064 (1996)). Mice that
survived 14 days after challenge had normal body temperatures and
no clinical signs of illness.
Collection of Blood and Tissue Samples
[0493] Blood samples were obtained either from the tail vein or
from euthanized animals by cardiac puncture at different time
intervals during the course of experiment. Samples of lungs,
regional lymph nodes, spleen, and liver were collected from
euthanized animals and processed following the RT PCR or
proliferation assay protocols as described below.
RT-PCR Detection of Viral RNA
[0494] The following primers for 246 bp fragment of M gene,
conserved for A strains, were used for PCR: 5'
catggaatggctaaagacaagacc (forward; SEQ ID NO:1), and
5'aagtgcaccagcagaataactgag (reverse; SEQ ID NO:2), as described
previously (Schweiger et al., J. Clin. Microbiol., 38:1552 (2000)).
The primers were ordered from Operon Technologies, Inc. (Alameda,
Calif.). Viral RNA was isolated from tissue homogenates with the
use of Tri Reagent (MRC, Cincinnati, Ohio). Lung, mediastinal lymph
node, spleen and liver were used for RNA extraction. The cDNA
synthesis was carried out with 2.0 .mu.g of total tissue RNA using
5.0 mM MgCl.sub.2, 500 .mu.M of each dNTP, 2.5 .mu.M random hexamer
primers, 0.4 U/.mu.l of RNase inhibitor and 2.5 U/.mu.l of
Superscript II RT (Invitrogen, Rockville, Md.). Thermal cycling was
performed in a total volume of 20 .mu.l using 3 single cycles at
25.degree. C. for 12 min, at 42.degree. C. for 50 min, then
70.degree. C. for 15 min (GeneAmp PCR System 2400/Perkin Elmer).
The PCR amplification was carried out with 0.01-0.1 .mu.g of cDNA
using 0.2 .mu.M of each primer, 0.2 mM of each dNTP, 1.5 mM
MgCl.sub.2, 0.1 U/.mu.l of Taq DNA Polymerase (Roche Molecular
Biochemicals, Indianapolis, Ind.). PCR reactions in a total volume
of 20 .mu.l were incubated at 94.degree. C. for 2 min, and then 35
cycles were performed with annealing at 62.degree. C., extension at
72.degree. C. and denaturation at 94.degree. C. Post-PCR analysis
was performed on a 2% Nusive/1% agarose gel using Tris-acetate
buffer for electrophoresis and ethidium bromide for DNA staining.
Analysis was performed using a photoimaging camera and software
from BioRad (Hercules, Calif.).
Specific Anti-Virus IgG Determination
[0495] IgG-specific Ab titers were determined in ELISA. Microtiter
plates (NUNC) were pretreated with 0.5% glutaraldehyde (Sigma, St.
Louis, Mo.) in PBS for one hour at 56.degree. C. and washed 4 times
with PBS. Influenza A virus (5.times.10.sup.3 pfu/well) in PBS was
placed on the pre-treated plates and incubated either at 37.degree.
C. for two hours or overnight at 4.degree. C. The virus was
aspirated; plates were washed with PBS and fixed with
ethanol-acetone (1:1) fixative for 15 min at -20.degree. C. After
fixation, plates were washed again and blocked for 30 min with
blocking buffer (1% dry milk in PBS). Blocking buffer was removed
and plates were sealed and stored at 4.degree. C. until used. Serum
samples and positive and negative control sera were serially
diluted in dilution buffer (0.1% BSA in PBS) and incubated on virus
coated plates at 37.degree. C. for 30 min. After washing with
washing buffer (0.05% Tween 20 in PBS), biotinylated anti-mouse IgG
antibody was added and plates were incubated at 37.degree. C. for
30 min. Plates were washed again and incubated with streptavidin-AP
(Sigma, St. Louis, Mo.), following wash and incubation with AP
substrate (Sigma, St. Louis, Mo.). Plates were incubated at room
temperature until color developed. The reaction was stopped with 1N
NaOH and the plates were read on an ELISA reader at 405 nm.
Antibody titers were determined arbitrarily as the highest serum
dilution yielding absorbency three times above the background
(Kremer et al., Infection and Immunity 66:5669 (1998)).
Proliferation Assay
[0496] Mouse spleens were disrupted in PBS to obtain the single
cell suspension. Cells were washed in PBS and red blood cells were
lysed using ammonium chloride lysis buffer. Splenocytes were then
resuspended in the culture medium (RPMI 1640 supplemented with 10%
FBS, L-glutamine and penicillin/streptomycin) and seeded
1.5.times.10.sup.5 cells/250 .mu.l/well in 96-well microtiter
plate. Cells were then incubated either with the mitogen PHA-P (2.5
.mu.g/well) for 3 days (Stevenson et al., supra) or influenza A
virus at concentration of 6.times.10.sup.3 pfu/well for 6 days,
following overnight BrdU labeling. Cell proliferation was measured
using a Cell Proliferation Chemiluminescence ELISA following the
manufacturer's instruction (Roche Diagnostics, Indianapolis, Ind.).
Measurement of relative light units was performed using a standard
luminometer.
In Vitro Cytokine Production
[0497] Splenocytes were resuspended in culture medium (RPMI 1640
supplemented with 10% FBS, L-glutamine and penicillin/streptomycin)
and seeded 1.5.times.10.sup.5 cells/250 .mu.l/well in microtiter
flat-bottom plates. Cells were then incubated either with the
mitogen PHA-P (2.5 .mu.g/well) for 3 days (Stevenson et al., supra)
or influenza A virus at a concentration of 6.times.10.sup.3
pfu/well for 6 days. Supernatant was then harvested and subjected
to quantitate cytokine concentration.
Quantitation of Cytokines
[0498] IL-2, IL-4, IL-12, and IFN-.gamma. cytokine levels in serum
and splenocyte supernatants were performed using QUANTIE M ELISA
kits (R&D Systems, Inc.) according to manufacturers'
instructions.
Flow Cytometric Analysis
[0499] Antibodies specific to mouse molecules CD3, CD4, CD8 and
CD19 (BD PharMingen, San Diego, Calif.) directly labeled with
either PE or FITC were used in flow cytometric analysis. Single
cell suspensions of splenocytes were incubated with antibodies for
30 min on ice and washed with PBS containing 0.1% BSA. Samples were
acquired on a Coulter EPICS-XL MCL Beckman-Coulter flow cytometer
and data were analyzed using Expo32 software (Beckman-Coulter,
Miami, Fla.).
Histology
[0500] Lungs were fixed by inflation with 1 ml of 10% neutral
buffered formalin, excised en bloc and immersed in neutral buffered
formalin. After paraffin embedding, 5 .mu.m sections were cut and
stained with hematoxylin and eosin, and viewed by light
microscopy.
Statistical Methods
[0501] The means, standard deviation, standard error and
.chi..sup.2 analysis with Yate's correction were calculated. To
compare the control group to the study groups, Cox regression was
used (Cox et al., Journal of the Royal Statistical Society. Series
B, 34:187 (1972)). The difference between the study groups and the
control group was tested using the log-likelihood ratio test.
B. Results
Virucidal Activity of Nanoemulsion on Influenza A Virus
[0502] The virucidal effect of X8P nanoemulsion on influenza A
virus, Ann Arbor strain was tested prior to intranasal treatment of
animals with the virus/nanoemulsion mixture. The virus at
concentrations of 2.times.10.sup.4, 5.times.10.sup.4
2.times.10.sup.5 and 5.times.10.sup.5 pfu in 2% X8P nanoemulsion in
a total volume of 50 .mu.l was incubated at 37.degree. C. for 60
min prior to inoculation of influenza-sensitive cells. The plaque
reduction quality of the nanoemulsion was assayed using MDCK cells.
As shown in FIG. 10a, nanoemulsion reduced the ability of virus to
form plaques by more than three logs. Prolonged incubation of virus
with nanoemulsion reduced number of plaque forming units in a time
dependent manner (FIG. 10b). After 3-hour incubation of
5.times.10.sup.5 pfu of virus with nanoemulsion, no pfu were
detected (FIG. 10b). RT-PCR performed on virus/nanoemulsion
preparation at the same time points showed complete correlation
with plaque reduction assay (PRA). Viral RNA was still detectable
at 2 h but none was present at 3 and 4 h (FIG. 10c).
Influenza A virus/Nanoemulsion Mixture Protects Mice from Lethal
Challenge with Congenic Strain of Virus
[0503] Mice were treated intranasally with either 2% nanoemulsion
alone, formalin killed influenza A virus "AA" strain
(5.times.10.sup.5 pfu), formalin killed virus mixed with 2%
nanoemulsion or virus (5.times.10.sup.5 pfu) inactivated with 2%
nanoemulsion. Twenty days later all 4 experimental groups were
challenged with a lethal dose (2.times.10.sup.5 pfu) of the
congenic virus. The animals treated with influenza/nanoemulsion
mixture did not have any signs of illness; their core body
temperature was within a normal range until the term of experiment
(FIG. 11) and all animals survived the challenge. Animals treated
with nanoemulsion alone succumbed to viral pneumonitis after the
challenge and all died by day 27 (day 6 after challenge). All
animals treated with formalin-killed virus and nanoemulsion died by
day 26 (day 5 after challenge). In the group treated with
formalin-killed virus alone only one mouse survived (FIG. 12).
[0504] The experiment also examined whether viral RNA mixed with
nanoemulsion and administrated intranasally would protect mice from
the lethal challenge. Neither viral RNA (0.5 .mu.g; an equivalent
of 10.sup.5 pfu of virus) alone nor viral RNA/nanoemulsion mixture
had any protective effect on animals challenged with lethal dose of
virus.
[0505] In order to examine whether intact virus particles could
mimic the same protection effect as nanoemulsion/virus mixture, the
animals were treated with 5 doses of virus (2.times.10.sup.5,
2.times.10.sup.4, 2.times.10.sup.3, 2.times.10.sup.2, and
2.times.10.sup.1 pfu) alone or mixed with nanoemulsion (Tables 28
and 29). Within the first 14 days after treatment, all animals
treated with 2.times.10.sup.5 pfu virus succumbed to pneumonitis.
Only one survived the treatment with 2.times.10.sup.4 pfu virus.
All animals in other experimental groups survived the treatment and
became healthy 14 days later. On day 21 all survived animals were
challenged with lethal dose of the virus and observed for
additional 14 days. The mice treated with 5.times.10.sup.5 pfu of
virus and nanoemulsion survived the challenge; in the group of
animals pretreated with 2.times.10.sup.5 pfu of virus and
nanoemulsion only 4 out of 7 mice survived. Animals from all other
experimental groups developed pneumonitis and all died by day
28.
Tables 28 and 29 Survival of mice after interanasal treatment with
different doses of influenza A virus (Table 28) and lethal
challenge with congenic virus (Table29)
TABLE-US-00029 [0506] TABLE 28 Intranasal treatment: Time X8P X8P
X8P 2 .times. 10.sup.5 X8P 2 .times. 10.sup.4 X8P 2 .times.
10.sup.3 X8P 2 .times. 10.sup.2 X8P 2 .times. 10.sup.1 (days) 0 5
.times. 10.sup.5 pfu 2 .times. 10.sup.5 pfu pfu 2 .times. 10.sup.4
pfu pfu 2 .times. 10.sup.3 pfu pfu 2 .times. 10.sup.2 pfu pfu 2
.times. 10.sup.1 pfu pfu 0 5 6 7 8 7 9 7 7 7 7 7 7 1 5 6 7 7 7 9 7
7 7 7 7 7 2 5 6 7 3 7 9 7 7 7 7 7 7 3 5 6 7 0 7 2 7 7 7 7 7 7 4 5 6
7 0 7 1 7 7 7 7 7 7 5 5 6 7 0 7 1 7 7 7 7 7 7 6 5 6 7 0 7 1 7 7 7 7
7 7 7 5 6 7 0 7 1 7 7 7 7 7 7 8 5 6 7 0 7 1 7 7 7 7 7 7 9 5 6 7 0 7
1 7 7 7 7 7 7 10 5 6 7 0 7 1 7 7 7 7 7 7 11 5 6 7 0 7 1 7 7 6 7 7 7
12 5 6 7 0 7 1 7 7 6 7 7 7 13 5 6 7 0 7 1 7 7 6 7 7 7 14 5 6 7 0 7
1 7 7 6 7 7 7
TABLE-US-00030 TABLE 29 Intranasal treatment: X8P X8P X8P 2 .times.
10.sup.5 Time 0 5 .times. 10.sup.5 pfu 2 .times. 10.sup.5 pfu pfu
X8P 2 .times. 10.sup.4 X8P 2 .times. 10.sup.3 X8P 2 .times.
10.sup.2 X8P 2 .times. 10.sup.1 (days) Challenge with 2 .times.
10.sup.5 pfu/mouse 2 .times. 10.sup.4 pfu pfu 2 .times. 10.sup.3
pfu pfu 2 .times. 10.sup.2 pfu pfu 2 .times. 10.sup.1 pfu pfu 21 5
6 7 7 1 7 7 6 7 7 7 22 5 6 7 6 1 5 7 5 5 7 7 23 5 6 7 6 1 5 6 3 2 6
7 24 5 6 7 5 1 5 6 1 1 5 4 25 5 6 6 5 1 4 0 0 0 0 0 26 1 6 6 1 1 0
0 0 0 0 0 27 0 6 4 0 1 0 0 0 0 0 0 28 0 6 4 0 1 0 0 0 0 0 0 29 0 6
4 0 0 0 0 0 0 0 0 30 0 6 4 0 0 0 0 0 0 0 0 31 0 6 4 0 0 0 0 0 0 0 0
32 0 6 4 0 0 0 0 0 0 0 0 33 0 6 4 0 0 0 0 0 0 0 0 34 0 6 4 0 0 0 0
0 0 0 0 35 0 6 4 0 0 0 0 0 0 0 0
Lung Histology of Treated Mice
[0507] Histological examination of animals treated with
nanoemulsion alone and challenged with a lethal dose of influenza A
virus Ann Arbor strain (5.times.10.sup.5 pfu) showed profound lobar
pneumonia at days 25-27 of experiment (day 5-7 post-infection).
Large areas of pulmonary tissue showed uniform consolidation caused
by a massive influx of inflammatory cells (neutrophils and
macrophages) filling the alveolar spaces and infiltrating the
interstitium. Areas of pulmonary tissue destruction as evidenced by
the intra-alveolar bleeding, presence of abscesses with central
necrosis, and by formation of empty caverns filled with traces of
cellular debris were observed. Additionally, areas of fibrosis were
found in the lungs of these mice, suggesting massive destruction of
lung tissue that became replaced by proliferating fibroblasts.
Thus, the histological picture of severe pneumonia and pulmonary
tissue damage observed in these mice is consistent with rapid
pulmonary death of animals caused by influenza infection.
[0508] Pathology of the virus-infected lungs from animals treated
with intact virus/nanoemulsion mixture was less pronounced than
pathology from the animals treated with nanoemulsion alone. In
these animals both areas of pathologically unaltered lungs and
areas with remaining pathology were found. Affected areas showed
inflammatory infiltrates in lung interstitium (alveolar septa) but
the alveolar space was free of exudates or inflammatory cells. The
interstitial infiltrates contained predominantly mononuclear cells.
The remaining lung tissue possessed well-preserved pulmonary
architecture and appeared similar to the lungs from uninfected
animals. This histological picture is consistent with less severe
infection and recovery from infection observed in these mice.
[0509] Serum Levels of Specific Anti-Influenza A Virus IgG
[0510] The levels of specific anti-influenza IgG antibodies were
examined following a single treatment with either
virus/nanoemulsion or nanoemulsion alone. The levels of IgG
antibodies were evaluated in sera of animals on day 10, 20, and 35
after initial vaccination (or treatment). On day 10, all mice
showed background levels of anti-influenza A IgG antibodies in
serum (titer 1:100). On day 20, mice that had been treated with
virus/nanoemulsion produced significantly higher antibody response
(p<0.05) as compared to control group treated with nanoemulsion
alone. On day 35, virus/nanoemulsion treated mice that survived the
challenge produced 10 times higher serum levels of IgG antibody
compared with the levels found within the same animals before the
challenge (FIG. 13).
Detection of Viral RNA in Mice Treated with Influenza A Virus and
Nanoemulsion Formulation.
[0511] The RT-PCR results from the total lung RNA indicated the
presence of influenza A virus RNA in virus/nanoemulsion vaccinated
animals until day 6 after treatment, but not on day 7 and
thereafter (FIG. 14a). Signal generated in RT-PCR reaction from 0.1
.mu.g of total RNA from mouse lung during the first 6 days after
treatment correlated to a total of less than 10 plaque forming
units (pfu) of virus (FIG. 14b).
Early Immune Status of Mice Immunized with Influenza A
Virus/Nanoemulsion Formulation
[0512] The specificity of early immune responses in mice treated
with various viral preparations was characterized by the analysis
of cytokines. The level of cytokines produced by animals was
measured both in media from cultured splenocytes and in serum of
experimental animals (FIGS. 16a and 16b). On day 4 after treatment
with virus/nanoemulsion preparation, elevated levels of IL-12,
IL-2, TNF-.alpha., and particularly IFN-.gamma., were detected
(FIG. 16a). In the control group of animals, there were no detected
levels of these cytokines. Elevated levels of IL-10 and no
detectable levels of IL-4 were observed across all experimental
groups.
[0513] Since elevated IFN-.gamma. was shown to indicate initial
immune response, IFN-.gamma. levels in serum of experimental
animals were monitory up to day 20 after initial treatment. The
levels of IFN-.gamma. in serum obtained from mice treated with
virus/nanoemulsion reached over 230 pg/ml at 24 h and gradually
decreased to undetectable levels over a period of 20 days. The
IFN-.gamma. levels of the other experimental groups were low
compared to the levels detected in the control group (FIG.
15g).
Antigen Specificity of Immune Response in Mice Treated with
Virus/Nanoemulsion.
[0514] The antigen specificity of immune responses was assessed
using splenocyte proliferation and cytokine activation assays.
Splenocytes were harvested on day 20 of the experiment from mice
treated with virus/nanoemulsion and nanoemulsion alone. Cells were
stimulated with congenic virus (AA strain used for intranasal
treatment) for 5 days. As shown in FIG. 16, influenza A/AA strain
specifically stimulated splenocytes harvested from mice treated
with congenic virus/nanoemulsion mixture while no proliferation was
detected in splenocytes harvested from any other group of animals.
The stimulation index was less than 1, indicating that during 5
days of incubation virus killed some cells in the tissue culture.
On day 35 of experiment (14 days after lethal challenge),
splenocytes harvested from animals that survived the challenge
showed greater proliferation index compared with the proliferation
response of splenocytes obtained from the same group of animals on
day 20.
[0515] Cytokine production was analyzed to characterize the nature
of the immune response and confirm antigen specificity. The
conditioned media obtained form splenocytes treated the same way as
for the proliferation assay and incubated for 72 h was used to
quantitate cytokine concentration. On day 20 splenocytes obtained
from mice treated with virus/nanoemulsion produced high levels of
IFN-.gamma. and slightly increased levels of IL-2 (FIGS. 17a and
17b). There was no detectable production of IL-4 in resting or
virus-stimulated cells (FIG. 17c). In splenocytes obtained from
animals after challenge, viral stimulation resulted in further
amplification of IFN-.gamma. and IL-2 expression, reaching
concentrations at least five fold higher than in animals before
challenge (day 20). Major differences were also detected in the
IL-4 expression. In contrast to their pre-challenge status, IL-4
was detected in non-stimulated, and over five-fold increased in
congenic virus stimulated splenocytes (FIG. 17c). No specific
activation of IFN-.gamma., or other cytokines in splenocytes
obtained from animals treated with nanoemulsion alone, viral
RNA/nanoemulsion or with formaline-killed virus/nanoemulsion was
observed.
Characteristics of Immunocompetent Cells
[0516] The ratios of T:B (CD3:CD19) and Th:Tc (CD4:CD8) cells in
spleens of experimental animals were examined. In spleens of naive
mice 32% of T cells and 39% of CD8 positive cells were detected
using immunostaining and flow cytometry analysis. Twenty one days
after intranasal vaccination the percentage of T cells remained
unchanged in groups of animals treated with virus/nanoemulsion
mixture and nanoemulsion alone while CD8 positive cells were
elevated in these groups to 48% and 44%, respectively. Fourteen
days after lethal challenge (day 35 after immunization), the only
surviving animals were in the group treated with virus/nanoemulsion
mixture. All animals had significantly (p<0.0001) elevated T
cells and slightly elevated CD8 positive cells compared with the
same group before the challenge (FIG. 18). While T cells remained
at the same level, the CD8 positive cells increased in the groups
treated with nanoemulsion alone and virus pre-incubated with
nanoemulsion.
Expansion of Epitope Recognition
[0517] 20 days after intranasal instillation of virus Ann Arbor
strain/nanoemulsion or nanoemulsion alone, mice were challenged
with either congenic (AA) or heterogenic (Puerto Rico) strain of
virus and observed for 14 days. Animals treated with virus Ann
Arbor strain/nanoemulsion and challenged with congenic virus
survived and recovered, animals from all other groups succumbed to
pneumonia and died by day 26 of experiment (FIG. 19). The analysis
of IFN-.gamma. cytokine production in animals after the challenge
revealed that splenocytes from this group of animals responded to
in vitro stimulation with both congenic and heterogenic virus by
profound production of cytokine (FIG. 20b). The present invention
is not limited to a particular mechanism. Indeed, an understanding
of the mechanism is not necessary to practice the present
invention. Nonetheless, it is contemplated that animals that
survived the challenge with congenic virus acquired immunity also
against heterogenic virus and thereby expanded their epitope
recognition. In order to examine such possibility, animals that
survived the challenge with congenic virus were rechallenged with
heterogenic virus (Puerto Rico strain) and observed for additional
14 days. All animals survived the rechallenge with heterogenic
virus without any signs of sickness (Table 30).
[0518] In conclusion, the present example demonstrates in vivo the
adjuvanticity of nanoemulsion for influenza vaccine given
intranasally. The results establish that a single intranasal
administration of nanoemulsion mixed with virus produces the full
protection against influenza pnemonitis, resulting in survival of
all animals challenged with lethal dose of the virus. During the
course of challenge, immunized animals did not show any signs of
illness and their core body temperature was within a normal range
for 14 days. Moreover, lungs of survived animals did not show gross
pathological changes characteristic for influenza pneumonitis.
TABLE-US-00031 TABLE 30 Survival (%) of animals after vaccination,
challenge and cross challenge with influenza A virus Puerto Rico
strain Vaccination with: nanoemulsion + Time (days) nanoemulsion 2
.times. 10.sup.5 pfu of AA nanoemulsion 0 100* 100 100 1 100 100
100 2 100 100 100 3 100 100 100 4 100 100 100 5 100 100 100 6 100
100 100 7 100 100 100 8 100 100 100 9 100 100 100 10 100 100 100 11
100 100 100 12 100 100 100 13 100 100 100 14 100 100 100 15 100 100
100 16 100 100 100 17 100 100 100 18 100 100 100 19 100 100 100 20
100 100 100 1 .times. 10.sup.5 pfu Challenge with: of AA 1 .times.
10.sup.5 pfu of AA 1 .times. 10.sup.4 pfu of PR 21 100 100 100 22
100 100 100 23 100 100 100 24 0 100 100 25 0 100 100 26 0 100 100
27 0 100 20 28 0 100 0 29 0 100 0 30 0 100 0 31 0 100 0 32 0 100 0
33 0 100 0 34 0 100 0 Challenge with: 1 .times. 10.sup.4 pfu of PR
35 none available 100 none available 36 100 37 100 38 100 39 100 40
100 41 100 42 100 43 100 44 100 45 100 46 100 47 100 48 100 49 100
*number of animals used was 5-8 per group
Example 16
Immune Response to HIV gp120
[0519] This example describes the immune response of mice to
recombinant HIV-1 envelope glycoprotein (gp120). Recombinant gp120
glycoprotein at concentrations of 2 and 20 .mu.g per dose mixed
with varying concentrations of X8P nanoemulsion (final
concentration: 0.1 to 1%) in 100 .mu.l volume was administered
intranasally or intramuscularly into mice. Dose administration was
repeated within three weeks after the first immunization. Protein
in saline was placed in the nose of control animals. GP120/X8P was
also injected intramuscularly in order to determine if it could
adjunct intramuscularly administered vaccines.
[0520] Results are shown in FIGS. 21 and 22. Serum levels of
specific anti-gp120 IgG were detected six weeks after initial
immunization. Increased and comparable levels of immune responses
were detected for both routes of immunization. FIG. 21 demonstrates
that administration of X8P nanoemulsion with gp120 resulted in an
increased immune response when the gp120 was administered
intranasally. FIG. 22 demonstrates that administration of X8P
nanoemulsion with gp120 resulted in an increased immune response
when the gp120 was administered intramuscularly.
Example 17
Compositions and Methods for Generating an Immune Response to an
Orthopox Virus in a Subject
[0521] Animals. Pathogen-free, 5 to 6-week-old, female Balb/c mice
were purchased from Charles River Laboratories. Vaccination groups
were housed separately, five animals to a cage, in accordance with
the American Association for Accreditation of Laboratory Animal
Care standards. All procedures involving mice were performed
according to the University Committee on Use and Care of Animals
(UCUCA) at the University of Michigan.
[0522] Viruses. Two exemplary vaccinia viruses (VV) were used
during the development of the present invention, VV.sub.WR and
VV.sub.WR-Luc. VV.sub.WR (NIH TC-adapted) was obtained from the
American Type Culture Collection (ATCC). Recombinant VV.sub.WR-Luc
expresses firefly luciferase from the p7.5 early/late promoter and
has been described (See, e.g., Luker et al., Virology. 2005,
341(2):284-300). VV.sub.WR-Luc is not attenuated in vitro or in
vivo because the virus was constructed with a method that does not
require deletion of any viral genes (See, e.g., Blasco and Moss
(1995). Gene 158(2), 157-162; Luker et al., Virology. 2005,
341(2):284-300).
[0523] Stocks of all viruses were generated using the method of
Lorenzo et al (See, e.g., Lorenzo et al., Methods Mol. Biol. 2004;
269:15-30) with some modification. Virus was propagated on Vero
cells infected at a multiplicity of infection of 0.5. Cells were
harvested at 48 to 72 h and virus was isolated from culture
supernatants and cells lysates. Cell lysates were obtained by
rapidly freeze-thawing the cell pellet followed by homogenization
in Dounce homogenizer in 1 mM Tris pH 9.0. Cell debris was removed
by centrifugation at 2000 rpm. The purified virus stocks were
obtained from clarified supernatants by layering on 4% to 40%
sucrose gradients which were centrifuged for 1 hr at
25,000.times.g. Turbid bands, containing viral particles, were
collected, diluted in 1 mM Tris pH 9 and then concentrated by 1 hr
centrifugation at 25,000.times.g. Viral pellets were re-suspended
in 1 mM Tris pH 9 and stored frozen at -80.degree. C. as virus
stock. The VV.sub.WR stocks were titered on Vero cells (See, e.g.,
Myc et al., Vaccine. 21:3801-3814).
[0524] Nanoemulsion (NE). NE (W.sub.205EC) was obtained from
NanoBio Corporation, Ann Arbor, Mich. Nanoemulsions are
manufactured by emulsification of cetyl pyridum chloride 1%, Tween
20 5% and Ethanol 8% in water with soybean oil (64%) using a high
speed emulsifier. Resultant droplets have a mean particle size of
150+/-25 nm in diameter. W.sub.205EC has been formulated with
surfactants and food substances considered "Generally Recognized as
Safe" (GRAS) by the FDA. W.sub.205EC can be economically
manufactured under Good Manufacturing Practices (GMP) and is stable
for at least 18 months at 40.degree. C.
[0525] Preparation of the Ne-Based Vaccine. Vaccinia Virus (VV)
Neutralization Data Generated during the development of the present
invention indicated that 1 hr incubation with 10% NE or 0.1%
formalin was sufficient for inactivation of the virus (e.g., six
log VV titer reduction). On the basis of these results several
formulations (e.g., compositions) for inducing an immune response
(e.g., vaccine formulations) were produced for animal immunization.
The compositions (e.g., for stimulating an immune response) were
prepared as follow: To assure complete virus neutralization (e.g.,
virus inactivation) for the NE-killed VV, samples containing
1.times.10.sup.3 pfu to 5.times.10.sup.5 pfu per dose of VV were
incubated for 3 hrs at 37.degree. C. in 10% W.sub.205EC NE, and
were subsequently diluted to 1% NE for intranasal instillation. For
the vaccine formulations containing formalin-killed virus, the
formalin (Sigma) inactivation of VV was performed at RT for 3 hrs
in 0.1% formalin. Formalin-killed virus was diluted in either
saline or 1% NE to 10.sup.3 or 10.sup.5 pfu per dose to reduce the
formalin to nontoxic concentrations for intranasal immunization.
For every formulation in each experiment, virus inactivation by
either NE or formalin was confirmed using a plaque reduction assay.
Additionally, PCR-detection assays of viral DNA in lungs of treated
animals were performed as described below to confirm the absence of
live, replicating virus.
[0526] Immunization. Samples of pre-immune serum were collected
from mice prior to initial immunization. All animals were
anesthetized with Isoflurene and vaccinated (e.g., with 10-15 .mu.l
of vaccine formulation per nare) using a pipette tip. Emulsion was
administered slowly to minimize the swallowing of material. After
vaccination, animals were observed for adverse reactions. Specific
anti-VV antibody response was measured in blood samples 3 weeks
after the initial (e.g., prime) administration (e.g., immunization)
and one to two weeks after second and third administrations (e.g.,
immunizations) when additional administrations were performed.
[0527] Bioluminescence imaging. Bioluminescence imaging was
performed with a cryogenically-cooled CCD camera (IVIS) as
described elsewhere (See, e.g., Luker et al., (2002). J Virol
76(23), 12149-12161; Cook and Griffin, (2003). J Virol 77(9),
5333-5338). Data for photon flux were quantified by
region-of-interest (ROI) analysis of the head and chest of infected
mice. Background photon flux from an uninfected mouse injected with
luciferin was subtracted from all measurements.
[0528] Collection of blood, bronchial alveolar lavage (BAL) and
splenocytes. Blood samples were obtained from the saphenous vein at
various time points during the course of trials conducted during
the development of the present invention. Final samples were
obtained by cardiac puncture from euthanized, premorbid mice. Serum
was obtained from blood by centrifugation at 1500.times.g for 5
minutes after the blood coagulated for 30-60 minutes at room
temperature. Serum samples were stored at -20.degree. C. until
used.
[0529] BAL fluid was obtained from mice euthanized by Isoflurane
inhalation. After the trachea was dissected, a 22 gauge catheter
(Angiocath, B-D) attached to a 1 ml syringe was inserted into the
trachea. The lungs were infused with 0.5 ml of PBS containing 10
.mu.M DTT and 0.5 mg/ml aprotinin. Approximately 0.4-0.5 ml of
aspirate was recovered with a syringe. This procedure was repeated
twice. BAL samples were stored at -20.degree. C.
[0530] Murine splenocytes were mechanically isolated to obtain
single-cell suspension in PBS. Red blood cells (RBC) were removed
by lysis with ACK buffer (150 mM NH.sub.4Cl, 10 mM KHCO.sub.3, 0.1
mM Na.sub.2EDTA), and the remaining cells washed twice in PBS. For
antigen-specific proliferation or cytokine expression assays,
splenocytes (2-4.times.10.sup.6/ml) were resuspended in RPMI 1640
medium supplemented with 5% FBS, 200 nM L-glutamine, and
penicillin/streptomycin (100 U/ml and 100 .mu.g/ml).
[0531] PCR detection of viral DNA. Forward primer (SEQ ID NO. 3:
5'-ATG ACA CGA TTG CCA ATA C 3') and reverse primer (SEQ ID NO. 4:
5'-CTA GAC TTT GTT TTC TG 3) were used (See, e.g., Ropp et al., J.
Clin. Microbiol., 1995: 2069-2076). These primers are for conserved
regions of the HA gene of all orthopox viruses (e.g., VV) and were
synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa).
DNA was isolated from lung tissue homogenates with Trireagent per
the manufacturer's protocol (MRC, Cincinnati, Ohio). PCR
amplification was performed with 1/g of total DNA using 0.5 .mu.M
of each primer, 0.2 mM of each dNTP, 2.5 mM of MgCl.sub.2, and 0.1
U/.mu.l of Taq DNA Polymerase (Roche Molecular Biochemicals,
Indianapolis, Ind.). PCR reactions were carried out in a total
volume of 20 .mu.l, incubated at 94.degree. C. for 1 min, followed
by 25 cycles with annealing at 55.degree. C., extension at
72.degree. C. and denaturation at 94.degree. C. PCR product
analysis was performed using electrophoresis on 1% agarose gel in
Tris-borate buffer for electrophoresis and ethidium bromide for DNA
staining. Analysis was performed using a photoimaging camera and
software from BioRad (Hercules, Calif.). DNA isolated from purified
VV served as a positive control.
[0532] Vaccinia virus challenge. Immunized mice were challenged
with live VV to evaluate the effectiveness of the vaccine. Serum
samples were collected two days before challenge with live,
infective VV. Animals were weighed on the day of the challenge. For
viral challenge, an aliquot of purified VV.sub.WR that was tittered
and then frozen was thawed and diluted in saline. Mice were
anesthetized by inhalation of isoflurane and administered (e.g.,
inoculated/immunized) by intranasal route with a 20 .mu.l
suspension of 2.times.10.sup.6 or 2.times.10.sup.7 pfu of VV (i.e.,
NE inactivated VV prepared as described above). These doses of VV
correspond to 10.times. and 100.times. of the 50% lethal dose
(LD.sub.50), respectively. Weight and body temperature were
measured daily for 3 weeks following challenge. Mice that
demonstrated a 30% loss in initial body weight were euthanized.
[0533] Specific anti-virus IgA and IgG determination. 96-well flat
bottom polystyrene plates (Corning, Inc.) were coated with a 1:1000
dilution of infected cell lysate containing at least
5.times.10.sup.4 pfu/100 ul of VV in PBS by overnight incubation at
4.degree. C. Plates were fixed with 50% acetone/ethanol mixture
followed by washing with PBS containing 0.001% Tween 20. Plates
were then blocked for 1 h at 37.degree. C. with 1% nonfat dry milk
in PBS with 0.2% Tween 20). Mouse sera or BAL fluid were serially
diluted in blocking buffer and added to wells, and the plates
incubated for 2 hr at 37.degree. C. and then washed. Anti-mouse IgG
or anti-mouse IgA alkaline phosphatase-conjugated antibody diluted
1:2,000 in blocking buffer was added, and the plates were incubated
for 1 h at 37.degree. C. with alkaline phosphatase substrate, SIGMA
FAST (Sigma, St. Louis, Mo.). The reaction was stopped with 1N NaOH
and the plates read on an ELISA reader (Spectra Max 340, Molecular
Devices, Sunnyvale, Calif.) at 405 nm with the reference wavelength
at 650 nm. The endpoint titer and antibody concentration was
calculated as the serum dilution resulting in an absorbance greater
than 2 standard deviations above the absorbance in control wells
(e.g., not incubated with mouse serum). IgG antibody concentration
was calculated according to the logarithmic transformation of the
linear portion of the standard curve generated with the
AP-conjugated anti-IgG antibody and multiplied by the serum
dilution factor. The serum concentration was presented as a mean
value +/-standard error (sem). Serum from the naive mice was used
as a control for non-specific absorbance.
[0534] Neutralizing antibodies. Neutralizing antibodies were
determined with a standard plaque reduction assay (PRA) (See, e.g.,
Newman et al., J. Chem. Microbiol. 2003, 3154-3157) and the
inhibition of luciferase activity using recombinant VV.sub.WR-Luc.
The PRA was conducted by mixing 10 .mu.l of heat-inactivated mouse
serum in serial, two-fold dilutions with 10 .mu.l of serum-free
RPMI medium containing 200 pfu of VV. Sera were incubated 6 hr at
37.degree. C. and subsequently placed in 0.5 ml of serum-free
medium an overlaid on Vero cell monolayer. After 1 hr incubation,
virus/serum inocula were removed and a fresh medium was placed on
the cell monolayers. After 48 to 72 hrs, cells were fixed and
stained with 0.1% crystal blue. Plaques were counted by two
independent observers and the neutralization titer calculated using
non-immune serum as a control.
[0535] For the assessment of neutralization titer with
VV.sub.WR-Luc, 10 .mu.l of heat-inactivated mouse serum in serial,
two-fold dilutions were mixed with 10 .mu.l of serum-free RPMI
medium containing 2.times.10.sup.3 pfu of virus. As in the PRA
based neutralization assay, samples were incubated for 6 hr at
37.degree. C., resuspended in 100 .mu.l of serum-free RPMI and
incubated for 1 hr with Vero cells in 24 well plates. After 24-36
hrs, infected cells were lysed and virus-dependent luciferase
activity was assessed by the addition of luciferin substrate (10
.mu.l/well, Promega, Madison, Wis.) to the lysate. Light emission
was measured in a luminometer (LB96P; EG & G/Berthold,
Gaithersburg, Md.) and adjusted for protein content. Neutralization
titer was calculated from inhibition of luciferase expression using
non-immune sera and virus in PBS as positive and negative controls,
respectively. Correlations between PRA and luciferase inhibition
activity were made for each sample.
[0536] Vaccinia specific cytokine expression in splenocytes.
Splenocytes were harvested from mechanically disrupted spleens and
were suspended at 3.times.10.sup.6 cells/ml in RPMI 1640
supplemented with 5% FBS, L-glutamine and penicillin/streptomycin.
Cells were incubated with VV at either 1.times.10.sup.3 pfu or
1.times.10.sup.4 pfu per well for 3 days and then the supernatant
harvested and analyzed for cytokine production. PHA-P (1 .mu.g per
well) was incubated with the cells as a positive control.
IFN-.gamma. concentrations in splenocyte supernatants were
determined using QUANTIKINE M ELISA kits (R&D Systems Inc.,
Minneapolis, Minn.) according to the manufacturer's directions.
[0537] Assay for determining anti-VV IgG antibody activity in mice
administered NE-killed VV versus formalin killed VV. Anti-VV IgG
antibody activity was measured using ELISA. NUNC-PolySorp 96 well
plates were coated with 1.times.10.sup.5 pfu/well of VV and
incubated overnight at 4.degree. C. After virus was removed the
wells were treated with 1:1 mixture of ethyl alcohol and acetone
(EtOH:acetone) or with 2% formalin solution (Formalin) in PBS for 2
hours at 4.degree. C. Plates were washed 2.times. with PBS and
blocked for 1 h at 37.degree. C. with 1% nonfat dry milk in PBS
containing 0.2% Tween 20. Pooled sera from mice vaccinated with
VV/NE, VV/Fk/NE, VV/Fk and sera from mice which survived sub-lethal
infection with live VV (live) were serially diluted in blocking
buffer and added to EtOH:acetone and formalin fixed wells, and the
plates were incubated for 2 hr at 37.degree. C. and washed.
Anti-mouse IgG alkaline phosphatase-conjugated antibody diluted
1:2,000 in blocking buffer, was added, and the plates were
incubated for 1 h at 37.degree. C. with alkaline phosphatase
substrate, SIGMAFAST (Sigma, St. Louis, Mo.). The reaction was
stopped with 1N NaOH and the plates were read on an ELISA reader
(Spectra Max 340, Molecular Devices, Sunnyvale, Calif.) at 405 nm
with the reference wavelength at 650 nm. The OD values at 405 nm at
IgG titers were compared between EtOH:acetone and formalin fixed VV
antigens. The activity of specific anti-VV antibodies are presented
as ratio of anti-VV titers on EtOH:acetone/formalin at the same
OD405 value (See FIG. 7).
Example 18
Nasal Immunization with Nanoemulsion-Inactivated Vaccinia Virus
Results in the Induction Specific Systemic IgG Response
[0538] Experiments were designed to evaluate if compositions of the
present invention (e.g., NE-killed VV) could produce protective
immunity similar to that seen in humans vaccinated by scarification
with live, replicating VV (See, e.g., Hammarlund et al., Nat. Med.
2003, 9; 1131-1137). Mice were nasally immunized with a total of 25
.mu.l containing either 10.sup.5 pfu or 10.sup.3 pfu of Vaccinia
virus in 1% nanoemulsion (denoted 10.sup.5/NE and 10.sup.3/NE),
10.sup.3 pfu or 10.sup.5 pfu of formalin-killed virus mixed with 1%
nanoemulsion (10.sup.5/Fk/NE and 10.sup.3/Fk/NE), or either
10.sup.3 pfu or 10.sup.5 pfu of formalin-killed virus in saline
(10.sup.5/Fk and 10.sup.3/Fk). Antibody responses were
characterized three weeks after initial vaccine administration (See
FIG. 23). Immune responses were boosted with subsequent
administrations (See FIG. 23).
[0539] Anti-VV IgG responses were detected in serum from mice
vaccinated with a prime and single boost of either 10.sup.5/NE or
10.sup.5/Fk/NE (T=7 weeks after initial immunization). Mean anti-VV
IgG concentrations were 1.5 .mu.g/ml and 1 .mu.g/ml, respectively.
After a second booster immunization, at T=9 weeks, anti-VV antibody
concentrations increased in all groups to varying degrees (FIG.
23), while at the conclusion of the experiment (T=16 weeks), the
NE-killed virus administration of 10.sup.3/NE and 10.sup.5/NE,
resulted in 45 .mu.g/ml and 80 .mu.g/ml VV-specific IgG,
respectively. Mice immunized with 10.sup.5/Fk/NE did not show
increased antibody concentrations above 20 .mu.g/ml, despite boost
administration. Animals immunized with lower concentrations
(10.sup.3) of VV, whether NE or formalin inactivated, consistently
produced lower levels of anti-VV antibodies that did not
significantly boost after a the third vaccination.
[0540] Thus, in some embodiments, the present invention provides
that an efficient IgG response results from a threshold level of
antigenic viral proteins (e.g., present with or without an
adjuvant). All animals administered a single dose of 10.sup.5/NE
had a significant (.about.4 .mu.g/ml) concentration of serum
anti-VV IgG 10 to 12 weeks after vaccination. However, no
detectable levels of anti-VV IgG were observed before the booster
immunization. Thus, in some embodiments, a single administration of
NE-killed VV is sufficient to initiate immune responses (e.g.,
mucosal or systemic immune responses). In further embodiments,
immune responses (e.g., mucosal or systemic immune responses) are
enhanced by subsequent administration (e.g., booster
administrations) (See FIG. 23). No specific anti-VV antibodies were
detected in control mice.
[0541] Additionally, administration of NE-killed VV produced
anti-VV IgG antibodies capable of recognizing "native" viral
epitopes. Briefly, sera from mice administered (e.g., vaccinated
with) NE-killed VV recognize both formalin-crosslinked (non-native)
and alcohol-fixed, not crosslinked (more "native") viral protein
epitopes. The sera have high reactivity to the native epitopes
(e.g., similar to sera from mice exposed to live virus) (See FIG.
29). In contrast, sera from animals administered (e.g., vaccinated
with) formalin-killed virus alone or mixed with NE, do not have
increased specific reactivity toward native vaccine virus protein
antigens (See FIG. 29).
Example 19
Subjects Administered Nanoemulsion-Killed Vaccinia Virus Possess
Mucosal Immunity to Vaccinia Virus
[0542] VV-specific secretory IgA antibodies were identified and
characterized in bronchial lavages (BAL) to demonstrate mucosal
humoral immunity. Anti-VV IgA (See FIG. 24) was detected in BAL
from animals administered either 10.sup.3/NE or 10.sup.5/NE.
Animals administered formulations containing formalin-killed virus
alone, or mixed with saline or nanoemulsion, did not produce a
measurable mucosal response, despite detectable levels of serum
anti-VV IgG (See FIG. 24). Thus, the present invention provides
that a composition comprising NE-killed VV generates mucosal
immunity in a subject (e.g., as demonstrated by the presence of
VV-specific secretory IgA antibodies in the BAL of the subject)
whereas compositions that do not contain NE-killed VV (e.g.,
formalin-killed VV) are not capable of generating mucosal immunity
to VV.
Example 20
Serum and Bronchial Alveolar Lavage (BAL) from Subjects
Administered Nanoemulsion-Inactivated Vaccinia Virus Possess
Virus-Neutralizing Antibodies
[0543] The biological relevance of the anti-VV antibody responses
observed in Example 18 was further characterized using virus
neutralization assays. Neutralizing activity was detected in the
serum of mice after a single administration of NE-killed VV (See
FIG. 25A). Additionally, significant titers of neutralizing
antibodies were detected in the serum of mice after two
administrations with either 10.sup.5/NE or 10.sup.3/NE, and
10.sup.5/Fk/NE (week seven, See FIG. 25A). The mean 50% inhibition
titer (NT.sub.50) for each of these groups was .gtoreq.20.
Subsequent administrations produced at least a ten fold increase in
neutralizing titers, but only in mice immunized with 10.sup.3/NE or
10.sup.5/NE (NT.sub.50=180 and NT.sub.50=500, respectively). In
contrast, animals vaccinated with either 10.sup.3/Fk/NE,
10.sup.3/Fk or 10.sup.5/Fk minimum virus neutralizing activity
detected only in the highest serum dilution (See FIG. 25). In
addition, subsequent immunization with either 10.sup.3/Fk/NE,
10.sup.5/Fk/NE, 10.sup.3/Fk or 10.sup.5/Fk brought only a slight
increase in the NT.sub.50. Vaccination with 10.sup.3/NE resulted in
the highest titer of neutralizing antibodies while producing lower
levels of serum IgG comparable with 10.sup.5/Fk/NE vaccine (See
FIG. 25A)
[0544] Significant neutralizing activity was also detected in BAL
fluids from mice vaccinated with either 10.sup.3/NE or 10.sup.5/NE,
and was present in lower amounts in BAL from mice immunized with
either 10.sup.3/Fk or 10.sup.5/Fk/NE (See FIG. 25B). However,
neutralization activity was absent in BAL of mice immunized with
formalin-killed virus diluted in saline. No neutralizing activity
was detected in the control, untreated animals. Thus, the present
invention provides that despite inactivation (e.g. complete
neutralization) of VV, nanoemulsions comprising inactivated VV of
the present invention retain important immunogenic epitopes (e.g.,
recognized and responded to by the immune system (e.g., humoral
immune system) of a subject).
Example 21
Comparison of Response to Native VV.sub.-WR and VV.sub.-WR-LUC
[0545] VV.sub.-WR-Luc has identical surface proteins as the native
strain, but expresses luciferase protein during infection. This
allows for mortality assessment and monitoring of viral infection
in challenged animals with imaging techniques. Comparison of
antibodies in VV.sub.-WR immunized animals versus both viral
strains either in ELISA, Western blot or virus neutralization
assays showed no difference between VV.sub.-WR and
VV.sub.-WR-Luc.
Example 22
Administration of NE-Killed VV Generates VV Specific Cellular
Immune Responses
[0546] VV-specific cellular immune responses in animals were
demonstrated by VV-specific IFN-.gamma. expression in splenocytes
in vitro from animals immunized with either 10.sup.3/NE or
10.sup.5/NE. In contrast, VV-specific IFN-.gamma. production was
not observed in splenocytes from animals immunized with
formaline-killed virus either with or without nanoemulsion (See
FIG. 26).
Example 23
Presence of Replicating VV in Immunized Animals
[0547] Live, infective VV is not present within subjects
administered NE-killed VV. Two different methods were used to
determine if any virus survived inactivation and replicated in
animals after immunization. PCR amplification of 10 .mu.g of lung
DNA isolated from animals immunized with all of the vaccine
formulations at 4 and 5 days after immunization did not result in
detectable viral DNA by PCR (See FIG. 27A). A PCR control reaction
containing 1 ng of purified VV DNA mixed with 1 .mu.l control lung
DNA resulted in amplification of product of the expected size
(>950 bp, See FIG. 27A). Evidence of replicating virus in the
VV/NE preparations was also tested in live mice using recombinant
VV.sub.WR-Luc virus. Naive mice infected with 10.sup.5/NE showed no
evidence of virus amplification in image analysis (See FIG.
27B).
Example 24
Subjects Administered NE-Killed VV are Protected Against Challenge
with Live, Infectious VV
[0548] Mice administered (e.g., vaccinated) with three doses of
10.sup.5/NE and control animals (treated with saline or 1% NE) were
challenged with LD.sub.10 (2.times.10.sup.6 pfu) of live
VV.sub.-WR-LUC. Body weight, and temperature were measured two
times a day and animals were imaged for VV.sub.-WR-Luc luminescence
once a day. All animals vaccinated with VV/NE vaccine survived
challenge (See FIG. 28A). Imaging studies demonstrated that two of
five VV/NE immunized mice exhibited minimally detectable virus
replication, while the other three had more progressive replication
that resolved within six days after administration. None of these
animals had clinical evidence of infection (See FIG. 28B). In
contrast, all non-vaccinated control animals became ill and died or
were humanely euthanized within 4 to 7 days of virus challenge.
These animals had massive virus replication with spreading
throughout the nasopharyngeal passage, lung and abdomen (See FIG.
28C). The presence of self-limiting infection in some immunized
mice correlated with the levels of neutralizing antibodies in the
individual animals. Subsequent challenge with LD.sub.100
(2.times.10.sup.7 pfu) of the VV-WR also resulted in survival of
all animals previously administered (e.g., vaccinated with)
105/NE.
[0549] Additionally, live virus challenge (10.times.LD.sub.50) was
performed on Balb/c mice intranasally vaccinated with VV/NE,
VV/Fk/NE and VV/Fk vaccines (See FIG. 30). Briefly, groups of
vaccinated and control mice were intranasally infected with
2.times.10.sup.6 pfu of live vaccinia virus. Animals were monitored
daily for 21 days and body temperature, weight and time of death
were recorded. All (100%) of mice vaccinated with
nanoemulsion-killed virus (VV/NE) survived viral challenge. Mice
vaccinated with formalin-killed virus mixed with NE (VV/Fk/NE) and
with formalin-killed virus (VV/Fk) had 40% and 20% survival rates,
respectively. Vaccination with NE-based vaccine (VV/Fk/NE) also
extended mean time till death (TTD) from 5 days to 7 days. None of
control animals survived challenge.
Example 25
Compositions and Methods for Generating an Immune Response Toward
Bacteria of the Genus Bacillus in a Subject
[0550] Animals. Five to six week old, pathogen-free female BALB/c
mice purchased from Charles River Laboratories were used for
experiments.
[0551] Reagents. Recombinant B. anthracis protective antigen (rPA)
was purchased from List Biological Laboratories, Inc. (Campbell,
Calif.). The 26-mer oligonucleotide 5'-TGCATGACGTTCCGTTCGTG-3' (SEQ
ID NO.:5), containing three non-methylated CpG repeats, was
synthesized by Integrated DNA Technologies (IDT, Coralville, Iowa).
Cell culture media and serum were purchased from GIBCO (Grand
Island, N.Y.) and HyClone (Logan, Utah), respectively. PHA-P, BSA,
DTT and other chemicals used in buffers were purchased from
Sigma-Aldrich Corporation (St. Louis, Mo.). The alkaline
phosphatase (AP)-conjugated antibodies, goat anti-mouse IgG (whole
molecule, #A-3562) and goat anti-mouse IgA (.alpha. chain specific,
#A-4937) were purchased from Sigma (St. Louis, Mo.).
[0552] Preparation of the Nanoemulsion (NE). the NE Nanoemulsion
Used in these Studies was prepared by a two-step procedure
according to U.S. Pat. No. 6,015,832 issued to NanoBio Corporation
(Ann Arbor, Mich.), herein incorporated by reference in its
entirety. Briefly, an oil phase was obtained by blending tributyl
phosphate (final concentration 8%), Triton X-100 (final
concentration 8%) and soybean oil (final concentration 64%), and
heating at 70.degree. C. for 30 min. The nanoemulsion was formed by
mixing the oil phase with water (20% volume) in a Silverstone Mixer
L4RT for 3 min at 10,000 rpm. To prepare an antigen and
nanoemulsion mix for the immunization experiments, a 10% solution
of the nanoemulsion in saline was combined with the appropriate rPA
solution to obtain a 1% final concentration of the emulsion. All
samples were prepared 30 min to 1 hr before use, by vigorous mixing
for 20 seconds using a vortex.
[0553] Nanoemulsion size analysis. Nanoemulsion size was analyzed
by dynamic light scattering (DLS), using a
Zeta-Potentiometer/Particle Sizer, NICOMP 380 ZLS (PSS NICOMP
Particle Sizing Systems, Santa Barbara, Calif.).
[0554] Microscopy. The photomicrographs were taken with an Olympus
IX70 microscope with an IXFLA inverted reflected fluorescence
observation attachment. The images were processed using the SPOT
imaging programs.
[0555] PAGE analysis of the recombinant PA. Western blotting and
silver staining was performed using Invitrogen systems. Typically,
0.5 .mu.g rPA protein was analyzed on 10% Nu PAGE Novex Bis-Tris
gel (cat #NP0301BOX) using X Cell SureLock Mini-Cell platform for
electrophoresis. Size of rPA protein was determined with molecular
weight marker Mark12 (Invitrogen, cat#LC5677). The silver stain
procedure followed the Invitrogen SilverXpress (cat #LC6100)
method.
[0556] Immunization and experimental design. Mice were vaccinated
intranasally with 50 .mu.l of preparations containing 2.5 .mu.g rPA
or 30 .mu.g rPA in combinations of 1% NE with or without 10 .mu.g
of the CpG oligonucleotide (PA/NE/CpG and PA/NE, respectively), a
physiological solution of NaCl as a control (PA only), or with rPA
and CpG (PA/CpG). For intranasal immunization, all animals were
anaesthetized with Isoflurane, and held in an inverted position
until droplets, delivered with a pipette tip at 25 .mu.l per nare,
were inhaled completely. Animals were immunized three and six times
during a period of 16 or 22 weeks respectively.
[0557] Collection of blood, bronchial alveolar lavage (BAL) and
splenocytes. Blood samples were obtained either from the saphenous
vein, at various time points during the course of the trials, or by
cardiac puncture from euthanized premorbid mice. Serum was obtained
by separation of blood (coagulated 30-60 min, RT) by centrifugation
at 1500 g for 5 min. Serum samples were stored at -20.degree. C.
until needed.
[0558] BAL fluid was obtained from mice sacrificed humanly by
Isoflurane inhalation. After the trachea was dissected, a 22GA
catheter (Angiocath, B-D) attached to a 1 ml syringe was inserted
into the trachea. The lung was injected with 0.5 ml of PBS
containing 10 .mu.M DTT and 0.5 mg/ml aprotinin (protease
inhibitors). Approximately 0.4-0.5 ml of aspirate was recovered
with a syringe. This procedure was repeated twice with 0.5 ml of
the same solution, and BAL samples were stored at -20.degree. C.
for further study.
[0559] Murine splenocytes were mechanically isolated from the
spleens to obtain single cell suspension in PBS. The red blood
cells (RBC) were removed by lysis with ACK buffer (150 mM
NH.sub.4Cl, 10 mM KHCO.sub.3, 0.1 mM Na.sub.2EDTA) and the
remaining cells were washed twice in PBS. For antigen-specific
proliferation or cytokine expression assays, splenocytes
(4.times.10.sup.6/ml) were resuspended in RPMI 1640 medium,
supplemented with FBS, L-glutamine, and penicillin/streptomycin,
according to the manufacturer's specification.
[0560] Determination of specific anti-PA IgG and IgA. The
PA-specific IgG and IgA levels were determined by ELISA. Microtiter
plates (NUNC) were coated with 5 .mu.g/ml (100 .mu.l) of rPA in the
coating buffer (50 mM sodium carbonate, 50 mM sodium bicarbonate,
pH 9.6) and incubated either at 37.degree. C. for 2 hrs or
overnight at 4.degree. C. After the protein solution was removed,
plates were blocked for 30 min with PBS containing 1% dry milk. The
blocking solution was aspirated and plates were used for immediate
antibody detection, or stored sealed at 4.degree. C. until needed.
Serum and BAL samples were serially diluted in 0.1% BSA in PBS, and
100 .mu.l/well aliquots were incubated in rPA coated plates for 1
hr at 37.degree. C. Plates were washed three times with PBS-0.05%
TWEEN 20, followed by 60 min incubation with either anti-mouse IgG
or anti-mouse IgA alkaline phosphatase-conjugated antibodies (AP),
than washed three times and incubated with alkaline phosphatase
substrate Sigma Fast (Sigma, St. Louis, Mo.). The colorimetric
reaction was stopped with 1 N NaOH according to the manufacturer's
protocol and readouts were performed using Spectra Max 340 ELISA
reader (Molecular Devices, Sunnyvale, Calif.) at 405 nm and the
reference wavelength of 690 nm. The end-point titers were
determined as the reciprocal of the highest dilution that had an
absorbance of three times above negative control.
[0561] Evaluation of the PA-specific IgG subclass response. For
determination of IgG subclass antibodies, 1:200 and 1:1000
dilutions of serum were analyzed by ELISA using a series of
subclass-specific alkaline phosphatase conjugated rabbit
antibodies. Anti-mouse IgG (H&L, 610-4502), anti-mouse IgG1
(.gamma.1 chain, 610-4540), anti-mouse IgG2a (.gamma.2a chain,
610-4541), anti-mouse IgG2b (.gamma.2b chain, 610-4542), and
anti-mouse IgG3 (.gamma.3 chain, 610-4543) were purchased from
Rockland, Inc. (Gilbertsville, Pa.). Spectrophotometric analysis
was performed as described above.
[0562] Antigen neutralization assay. PA-specific inhibitory
activity was determined by the ability of immunized animals' serum
to prevent PA binding to cell surface PA-binding receptors. CHO-K1
cells, which abundantly express PA-binding receptors, were cultured
in F12-K medium, supplemented with 10% FBS and
penicillin-streptomycin, until 90% confluent (See, e.g., Escuyer
and Collier, Infect Immun 1991; 59:3381-3386). Pooled sera from
mice vaccinated with rPA/NE/CpG were diluted 1:100, 1:1000 1:10000
and 1:50000 in 100 .mu.l of 10 .mu.M rPA in PBS/0.1% BSA buffer,
and incubated together with rPA for 30 min at RT. For receptor
binding, 1.times.10.sup.6 CHO-K1 cells were incubated with 10 .mu.M
rPA alone or with rPA protein preincubated with increasing
dilutions of serum in PBS buffer, supplemented with 1 mM CaCl.sub.2
and 1 mM MgCl.sub.2. After 30 min at RT, cells were washed three
times with ice cold PBS (1 mM Ca 2.sup.+, 1 mM Mg.sup.2+, 0.1%
BSA). Cellular receptor-bound PA was detected by incubation with a
1:200 dilution of polyclonal anti-PA antiserum from a single mouse,
and subsequently with FITC-conjugated anti-mouse IgG antibody for
flow cytometric analysis. Controls consisted of CHO-K1 cells
without rPA, incubated with or without anti-PA serum, and incubated
with an isotype control antibody. The concentration of PA bound
with anti-PA antibody was calculated from a receptor binding curve
obtained with 1 .mu.M, 10 .mu.M, and 100 .mu.M solutions of
rPA.
[0563] Western blot detection of immunoglobulins in serum and BAL.
Western blots were used to detect specific anti-PA antibodies in
either serum or BAL. Samples of 0.5 .mu.g of rPA per well were
separated by PAGE as described above. Following electrophoresis,
proteins were transferred to a PVDF membrane according to the
manufacturer's protocol (Invitrogen Western Transfer Protocol) at
25 V for 90 min. The PVDF membrane was allowed to dry overnight and
then soaked in methanol for 30 seconds. Following a PBST buffer
(PBS and 0.1% TWEEN) wash, the membrane was blocked with 5% dry
milk in buffer for one hour at RT. After another PBST wash,
membranes were cut into strips to be used for anti-PA antibody
detection. Separate strips were incubated for one hour at a 1:2000
dilution of serum in PBST buffer. After a PBST wash, the membrane
strips were incubated with a 1:2000 dilution of goat anti-mouse IgA
alkaline phosphatase-conjugated antibodies in PBST. After a final
wash the PVDF blots were developed in a BCIP/NBT-Blue Liquid
Substrate System for Membranes (Sigma, cat#B-3804). After the
membrane was developed, the membrane was washed in milli-Q
water.
[0564] Proliferation assay. The proliferation of mouse splenocytes
was measured by an assay of 5-bromo-2-deoxyuridine (BrdU)
incorporation using a commercially available labeling and detection
kit (Cell Proliferation ELISA, Roche Molecular Biochemicals,
Mannheim, Germany). In brief, the cells were incubated in the
presence of rPA (5 .mu.g/ml) or PHA-P mitogen (2 .mu.g/ml) for 48
hrs and then pulsed with BrdU for 24 hr. Cell proliferation was
measured according to manufacturer's instructions using a Spectra
Max 340 ELISA Reader (Molecular Devices, Sunnyvale, Calif.) at 370
nm and reference wavelength of 492 nm.
[0565] Analysis of cytokine expression in vitro. Mouse splenocytes
were seeded at 2.times.10.sup.6 cells/0.5 ml (RPMI 1640, 2% FBS)
and incubated with rPA (5 .mu.g/ml) or PHA-P mitogen (2 .mu.g/ml)
for 72 hrs. Cell culture supernatants were harvested and analyzed
for the presence of cytokines. IL-2, IL-4, IFN-.gamma. and
TNF-.alpha. cytokine assays were performed using QUANTIKINE ELISA
kits (R&D Systems, Inc., Minneapolis, Minn.) according to the
manufacturer's instructions.
Example 26
Characterization of the Recombinant PA (rPA) and Nanoemulsion (NE)
Adjuvant Mix
[0566] Data obtained from the NICOMP 380 Particle Sizer and from
microscopic observation indicated that nanoemulsion (NE) used for
immunizations comprise narrowly distributed vesicles with an
average diameter of 500 nm (See FIGS. 31A and 31B). Addition of the
rPA protein in saline solution did not have an effect on the size
distribution or on the stability of the nanoemulsion (See FIG.
31C). Incubation of rPA with nanoemulsion did not appear to affect
antigen structure. It appeared as a single discrete band on a
non-denaturing PAGE representing an intact full length protein with
a molecular weight of 83 kD (See FIG. 32). Importantly, NE appeared
to improve the stability of rPA, which showed progressive
degradation when incubated in a buffer solution (See FIG. 32A; and
See, e.g., Gupta et al., FEBS Lett 2003; 554(3):505-5 10; Gupta et
al., Biochem Biophys Res Commun 2003; 311:229-232).
[0567] Additionally, microphotographs of the 1% NE and rPA/1% NE
mixture indicate that addition of protein into NE does not cause
coalescing of the emulsion droplets (See FIG. 32B). Additional
measurement using particle sizer indicated no change in the
droplets size in the presence of rPA protein.
Example 27
Serum Anti-PA Antibody Titers in Animals Immunized Intranasally
with an rPA Vaccine
[0568] The serum antibody responses in a six dose schedule of
intranasal vaccination with 30%g of rPA administered over the
course of 22 weeks was characterized during the development of the
present invention. Recombinant PA was used either alone in saline
(PA only), mixed with 1% nanoemulsion (PA/NE), mixed with 1%
nanoemulsion and 10 .mu.g CpG ODN (PA/NE/CpG), or with 10 .mu.g CpG
ODN in saline (PA/CpG). The CpG ODN was added to the nanoemulsion
preparations because non-methylated CpG sequences are considered a
potent inducer of innate immune responses (See, e.g., McCluskie et
al., Vaccine. 2001; 19:2657-2660). CpG ODNs may also contribute to
specific mucosal immunity for anthrax, since the bacilli and spores
contain CpG-rich DNA. Nanoemulsion adjuvant alone lacks toxicity
and does not result in the induction of immune response in
experimental animals (See, e.g., Myc et al., Vaccine 2003;
21:3801-3814)
[0569] Initially, mice were immunized every three weeks. No IgG
responses were detected in any group of animals after the prime and
first boost vaccinations, when measured at three and five weeks
after initiation of the trial. After a third vaccination, four out
of five mice immunized with PA/NE/CpG, and one animal immunized
with PA/NE became seropositive for anti-PA IgG. In contrast, no
antibody responses were detected in mice immunized either with PA
alone (in NaCl) or with PA/CpG. The difference between mean anti-PA
IgG levels in the PA/NE and PA/NE/CpG groups disappeared after the
fourth vaccination. In both groups, all animals were highly
seropositive and displayed similar high levels of anti-PA IgG
antibodies during the remainder of the experiment (See FIG. 33A).
In animals vaccinated with PA alone and PA/CpG, a single positive
responder was detected in each group of animals only after a sixth
vaccination at 21 weeks (See FIG. 33A).
[0570] Induction of specific immune responses with lower doses of
rPA in adjuvant were also evaluated. Mice were vaccinated with 2.5
.mu.g of rPA, used either alone in saline (PA only), mixed with 1%
nanoemulsion (PA/NE), mixed with 1% nanoemulsion and 10 .mu.g CpG
ODN (PA/NE/CpG), or with 10 .mu.g CpG ODN in saline (PA/CpG),
administered in three doses over a 16-week trial. There was no
detectable anti-PA IgG in serum after two vaccinations. Mice from
the PA/NE and PA/NE/CpG groups became PA-seropositive after three
doses, while none of the animals from the PA only or the PA/CpG
group developed immune responses. The presence of CpG ODN in
addition to NE seemed to enhance the anti-PA response in the low
dose PA vaccination (See FIG. 33B). The specific anti-PA IgG
antibody levels in serum at 16 weeks were higher for the 30 .mu.g
than for the 2.5 .mu.g dose of rPA. At the end of experiments, the
mean serum anti-PA IgG titer in animals vaccinated with either 30
.mu.g PA/NE or PA/NE/CpG reached 2.5.times.10.sup.5, while it was
two orders of magnitude lower for the 2.5 .mu.g dose of rPA protein
in the same adjuvant formulations (See FIGS. 34A and 34B). The
pattern of immune responses indicated that nanoemulsion is critical
(e.g., as an adjuvant) for the development of systemic humoral
responses after intranasal vaccination. Addition of CpG ODN
resulted in a more consistent distribution of anti-PA IgG levels in
animals but generally did not increase final antibody titers (See
FIGS. 35A and 35B).
[0571] Mucosal immunization with rPA and nanoemulsion adjuvant
resulted in a pattern of IgG subclass responses characterized by
high levels of serum IgG1, and an order of magnitude lower levels
of IgG2a and IgG2b, with almost no detectable IgG3 (See FIG. 36).
Examining the pattern of IgG2 and IgG3 subclass antibodies revealed
that PA-specific IgG2a and IgG2b are significantly higher in
animals immunized with PA/NE and PA/NE/CpG, than in single positive
responders from groups immunized with PA alone or PA/CpG. Levels of
IgG3 antibodies were very low and similar for all groups of
animals.
[0572] Anti-PA IgG titer distributions were characterized after
single doses of rPA/NE with various TWEEN derivatives. First, the
effect of TWEEN derivatives on immunogenicity kinetics was analyzed
(See FIG. 41). For example, NEs W.sub.205EC, W.sub.205S201EC,
W.sub.605EC and W.sub.805EC were all tested for the ability to
generate anti-PA titers. Anti-PA IgG titers in PA/W.sub.805EC
reached >10.sup.4 titers at three weeks after a single
vaccination. Furthermore, animals vaccinated with PA in 20% TWEEN
80 (6 .mu.l) NE display elevated IgG titers with a tight
distribution after just one dose (See. FIG. 42).
[0573] Additionally, the kinetics of anti-PA IgG development in
guinea pigs intranasaly immunized with a rPA/NE vaccine was
characterized (See FIG. 43). Female Hartley guinea pigs were
intranasaly vaccinated with two doses (prime and at 4 weeks) of
various doses of rPA (10, 50 and 100 .mu.g) mixed with 1%
W.sub.205EC NE (100 .mu.l). The anti-PA IgG levels in serum were
measured at 3 weeks (after single vaccination) and at 2 to 3 week
intervals after booster vaccination over a six month period.
Example 28
Administration of a Composition Comprising rPA and Nanoemulsion
Induces PA-Specific Secretory IgA Antibodies
[0574] Nasal immunization is considered the a reliable route for
the induction of mucosal immunity and for protection of the mucosal
membrane against pathogen infection (See, e.g., McGhee et al.,
Mucosal vaccines: an overview. In: Orgra et al., editors. Mucosal
Immunology. San Diego, Academic Press, 1999: 741-757; Davis,
Advanced Drug Delivery Reviews 2001; 51:21-42; Zuercher, Viral
Immunology 2003; 16:279-289). Analysis of bronchial lavage samples
(BAL) obtained from vaccinated animals demonstrated significant
levels of PA-specific secretory IgA antibodies only in BALs from
animals vaccinated with PA/NE and PA/NE/CpG (See FIG. 37A). Similar
results were obtained for the secretory anti-PA IgG antibodies
present in BAL (See FIG. 37B). Thus, the present invention
demonstrates that significant mucosal responses to PA (e.g.,
characterized by secretion of both IgA and IgG antibodies) are only
induced with a composition (e.g., a vaccine) comprising rPA and NE
(e.g., as an adjuvant).
[0575] ELISA results were confirmed and expanded by detection of
anti-PA IgA using Western blot. Only one of the animals vaccinated
intranasally with PA alone and none with PA/CpG had detectable
levels of BAL secretory anti-PA IgA. The inclusion of CpG ODNs into
the vaccine did not increase IgA levels in BAL. Animals with a high
titer of the secretory IgA in BAL also displayed substantial levels
of anti-PA IgA in serum, as shown by Western blot (See FIG. 37C).
Control animals immunized with intramuscular injections of the same
rPA and nanoemulsion adjuvant formulations did not develop anti-PA
IgA antibodies in mucosal secretions or serum, despite robust
immune response characterized by significant levels of anti-PA IgG
antibodies in serum. Thus, the present invention also demonstrates
that a composition comprising rPA and NE can induce mucosal
immunity against PA antigen (e.g., as evidenced by significant
levels of anti-PA IgA antibodies in mucosal secretions) if
administered intranasally.
Example 29
PA Neutralizing Antibodies in Serum and Protection from Lethal Dose
Challenge
[0576] It was next determined whether serum from mice immunized
intranasally with PA/NE/CpG had the ability to neutralize PA and
prevent its binding to the anthrax toxin receptor (ATR) (See, e.g.,
Bradley et al., Nature 2001; 414:225-229). Pre-incubation of rPA
with serial dilutions of serum from immunized animals resulted in a
significant lowering of the binding of PA with the ATR receptor in
a concentration-dependent manner (See FIG. 38). Inhibition of
receptor binding indicated considerable concentrations of
PA-neutralizing antibodies in the serum. For example, at 1:10,000
to 1:100 dilutions, levels of anti-PA antibodies in the serum were
capable of neutralizing (e.g., inhibiting the binding of PA to the
ATR receptor) between 50% and 80% of the rPA in the 10 .mu.M
solution used for the assay (See FIG. 38).
[0577] Additionally, lethal toxin (LT) cytotoxicity and
neutralization antibody assays were performed (See FIG. 38B).
Specifically, the cytotoxic concentration range of LT was
established using a RAW264.7 mouse macrophage cell line. Briefly,
triplicates of 20,000-30,000 cells/well in 96 well plates were
incubated with increasing concentrations of PA and LF, each ranging
from 0.1 mg/ml to 1 mg/ml for four hours at 37.degree. C. PA or LF
alone was not cytotoxic to cells in the entire range of
concentrations. The cell viability was determined using XTT assay.
Neutralizing antibody assay was performed using serial dilutions of
pooled sera incubated for 30 minutes with LT (consisting of 0.5
mg/ml PA and 0.3 mg/ml LT in PBS). The antibody-toxin mixtures were
then added to RAW264.7 and incubated for 4 to 6 hours at 37.degree.
C. Cell viability was assessed with XTT assay as above. The serum
dilution resulting in 50% protection against LT cytotoxicity
(neutralizing concentration NC.sub.50) was calculated from the cell
viability curves (See FIG. 38B).
[0578] Furthermore, the ability of guinea pigs nasally immunized
with rPA/NE to survive challenge with 1000.times.LD.sub.50 of B.
anthracis Ames spores six months after immunization was determined.
As shown in FIG. 38C, all immunized guinea pigs survived lethal
challenge, whereas control (not-immunized) animals died within 96
hours after injection.
Example 30
Generation of Specific Cellular Immune Responses in Mice Immunized
with a Composition Comprising rPA and Nanoemulsion
[0579] Most studies on anthrax immunity concentrate on the humoral
responses and protection against lethal challenge with the pathogen
(See, e.g., Reuveny et al., Infect Immun 2001; 69:2888-2893;
McBride et al., Vaccine 1998; 16:801-817). Data collected during
the development of the present invention also included an
assessment of the antigen specificity and type of cellular immune
response induced by mucosal administration of a composition
comprising rPA and nanoemulsion (e.g., used as an adjuvant).
Antigen-specific cellular responses were measured using a
proliferation assay (See FIG. 39) and by analyzing cytokine
secretion from splenocytes stimulated in vitro with rPA (See FIG.
40). Splenocytes were harvested from animals 22 weeks after initial
mucosal immunizations. Cells were either incubated alone or with 5
.mu.g/ml of rPA protein. rPA protein only stimulated proliferation
of splenocytes obtained from mice immunized with the PA/NE and
PA/NE/CpG vaccines (See FIG. 39). There was no statistical
difference in the proliferation index between these two groups.
[0580] In contrast, no antigen-specific proliferation was detected
in splenocytes from animals immunized with rPA alone or rPA with
CpG ODNs. Control non-stimulated (resting) cells secreted low
levels of detectable cytokines, but the PA-activated spleen cells
showed marked expression of INF-.gamma., TNF-.alpha.; and IL-2, but
a lack of IL-4 secretion. This suggested that immunization with
PA/NE and PA/NE/CpG yielded Th1-type responses (See FIGS. 40A, 40B,
40C and 40D). As a control, splenocyte cultures were incubated with
PHA, known in the art to induce significant proliferation and
secretion of both Th1 and Th2 cytokines. Thus, the present
invention demonstrates that nasal administration of a composition
comprising rPA and NE (e.g., used as an adjuvant) induces systemic
immunity against PA antigen (e.g., as evidenced by expansion of
splenocytes (e.g., B cells, T cells, and antigen presenting cells)
when challenged in vitro with rPA), and further, that the immune
response generated is skewed toward a Th1-type response.
Example 31
Compositions and Methods for Generating an Immune Response Toward
HIV in a Subject
[0581] Animals. Five to six week old, pathogen-free female BALB/c
mice and female Hartley guinea pigs were used (Charles River
Laboratories). Mice and guinea pigs were housed in accordance with
the American Association for Accreditation of Laboratory Animal
Care standards. Mice were housed five to a cage. Guinea pigs were
housed one per cage. All procedures involving animals were
performed according to the University Committee on Use and Care of
Animals (UCUCA) at the University of Michigan.
[0582] Reagents. Recombinant HIV gp120 BAL and SF162 proteins and
V3 loop peptide produced in yeast were obtained from Dr. David
Markovitz (University of Michigan). The 20-mer oligonucleotide
5'-TGC ATG ACG TTC CGT TCG TG-3' (SEQ ID NO.:6), containing three
non-methylated CpG repeats, was purchased from Integrated DNA
Technologies (IDT, Coralville, Iowa). Cell culture media and serum
were purchased from GIBCO (Grand Island, N.Y.) and HyClone (Logan,
Utah), respectively. MPL A PHA-P, BSA, DTT and other chemicals used
in buffers were purchased from Sigma-Aldrich Corporation (St.
Louis, Mo.). Alkaline phosphatase (AP)-conjugated antibodies, goat
anti-mouse IgG (whole molecule, #A-3562) and goat anti-mouse IgA
(.alpha. chain specific, #A-4937) were purchased from Sigma (St.
Louis, Mo.).
[0583] Preparation of the Nanoemulsion. Nanoemulsion (Ne) Used in
these Studies was Prepared by a two-step procedure described (See,
U.S. Pat. No. 6,015,832, to NanoBio Corporation, Ann Arbor, Mich.,
hereby incorporated by reference in its entirety for all purposes.
Antigen/nanoemulsion mix was prepared by combining a 10% solution
of NE in saline with gp120 protein solution to obtain a 0.1%, 0.5%
and 1% final concentration of the adjuvant. All samples were
prepared 30 min to 1 hr before use, by vigorous mixing for 20
seconds using a vortex.
[0584] Mice immunization and experimental design. Mice were
vaccinated intranasally using a prime-boost regiment with
preparations containing 20 .mu.g gp120 of BaL or SF162 serotypes
mixed with various concentrations of NE (from 0.1% to 2%). The
effect of co-administration of CpG oligonucleotide or
monophosphoryl lipid A (MPLA) were tested by adding 10 .mu.g and 5
.mu.g, respectively, to the antigen/nanoemulsion mix. gp120 in a
physiological solution of NaCl (gp120/saline) was used as a
control. For intranasal immunization, all animals were
anaesthetized with Isoflurane, and held in an inverted position
until droplets, delivered with a pipette tip at 25 .mu.l per nare,
were inhaled completely. Serum samples were collected from test
bleeds on weeks 0, 3, 6, and 8 postimmunization.
[0585] Guinea pig immunizations. Three guinea pigs were inoculated
intranasally with 100 .mu.l of gp120 BaL (50 .mu.g) mixed with 1%
nanoemulsion in a prime-boost regiment. Serum samples were
collected from test bleeds on weeks 0, 2, 6, and 8 postimmunization
for the determination of anti-gp120 IgG, IgA and neutralizing
antibody levels.
[0586] Collection of blood, bronchial alveolar lavage (BAL) and
splenocytes. Blood samples were obtained either from the saphenous
vein at various time points during the course of the trials, or by
cardiac puncture from euthanized premorbid mice. Serum was obtained
(coagulated 30-60 min, RT) by blood centrifugation at 1500 g for 5
min. Serum samples were heat inactived (56.degree. C., 1 h) and
stored at -20.degree. C. until analyzed.
[0587] Mice BAL fluid was obtained from animals sacrificed humanely
by inhalation of Isoflurane. The lung was injected with 0.5 ml of
PBS with 10 .mu.M DTT and 0.5 mg/ml aprotinin. The procedure was
repeated twice with 0.5 ml of the same solution and resulted in
approximately 1 ml of fluid. BAL samples were stored at -20.degree.
C. for further study.
[0588] Murine splenocytes were mechanically isolated from the
spleens to obtain single cell suspension in PBS. The red blood
cells (RBC) were removed by lysis with ACK buffer (150 mM
NH.sub.4Cl, 10 mM KHCO.sub.3, 0.1 mM Na.sub.2EDTA) and the
remaining cells washed twice in PBS. For antigen-specific
proliferation or cytokine expression assays, splenocytes
(2-3.times.10.sup.6/ml) were resuspended in RPMI 1640 medium,
supplemented with FBS, L-glutamine, and penicillin/streptomycin,
according to the manufacturer's specification.
[0589] Determination of specific anti-gp120 IgG and IgA.
gp120-specific IgG and IgA levels were determined by ELISA.
High-protein-binding-capacity microtiter plates (MaxiSorp; Nalge
Nunc International, Rochester, N.Y.) were coated with 3-5 .mu.g/ml
(100 .mu.l) of gp120 in PBS. Serum and BAL samples were serially
diluted in 0.1% BSA in PBS, and 100 .mu.l/well aliquots were
incubated in gp120 coated plates for 1 hr at 37.degree. C. followed
by three washes. Primary antibody detection with either anti-mouse
IgG, anti guinea-pig IgG or anti-mouse IgA alkaline
phosphatase-conjugated antibodies (AP) was performed by reaction
with alkaline phosphatase substrate SIGMA FAST (Sigma, St. Louis,
Mo.) according to the manufacturer's protocol. Readouts were
performed using a Spectra Max 340 ELISA reader (Molecular Devices,
Sunnyvale, Calif.) at 405 nm and reference wavelength of 690 nm.
Endpoint antibody titers were defined as the last reciprocal serial
serum dilution at which the absorption at 405 nm was greater than
two times absorbance above negative control.
[0590] HIV-1 single-round neutralization assay. Neutralization was
measured as a function of the reduction in luciferase reporter gene
expression after a single round of virus infection in TZM-b1 cells
as described previously (See, e.g., Montefiori et al 2004). TZM-b1
cells are engineered to express CD4 and CCR5 and contain integrated
reporter genes for firefly luciferase and E. coli
.beta.-galactosidase under control of an HIV-1 LTR. Primary HIV-1
isolates (TCID.sub.50, 100 to 200) were incubated in triplicate
with serial dilutions of sera for 1 hour at 37.degree. C.
Subsequently, virus/serum mixtures were added to the 96-well
flat-bottom culture plate containing adherent TZM-b1 cells.
Controls comprised cells plus virus (virus control), and cells only
(background control). Bioluminescence was measured after 48 h using
BRIGHT GLO substrate solution as described by the supplier
(Promega, Madison, Wis.). Neutralization titers are the dilutions
at which relative light units (RLU) were reduced by 50% compared to
those of virus control wells after subtraction of background
RLUs.
[0591] PAGE analysis of the recombinant gp120. Western blots and
silver stained gels were performed using Invitrogen systems.
Typically, 0.5 .mu.g gp120 protein was analyzed on 10% Nu PAGE
Novex Bis-Tris gel (cat #NP0301BOX) using X Cell SURELOCK Mini-Cell
platform for electrophoresis. Silver staining (Invitrogen
SilverXpress, cat #LC6100) was used for the visualization of
proteins.
[0592] Western blot detection of immunoglobulins in serum. Western
blots were used to detect specific anti-gp120 antibodies in serum.
Samples of 0.5 .mu.g of gp120 per well were separated by PAGE as
described above. Following electrophoresis, the proteins were
transferred to a PVDF membrane according to the Invitrogen Western
Transfer Protocol at 25 V for 90 min. The PVDF membrane was allowed
to dry overnight and then soaked in methanol for 30 seconds.
Following a PBST buffer (PBS and 0.1% TWEEN) wash, the membrane was
blocked with 5% dry milk in buffer for one hour at RT. After
another PBST wash, membranes were cut into strips to be used for
anti-gp120 antibody detection. Separate strips were incubated for
one hour at a 1:2000 dilution of serum in PBST buffer. After a PBST
wash, the membrane strips were incubated with a 1:2000 dilution of
goat anti-guinea pig IgG alkaline phosphatase-conjugated antibodies
in PBST. After a final wash the PVDF blots were developed in a
BCIP/NBT-Blue Liquid Substrate System for Membranes (Sigma,
cat#B-3804).
[0593] Proliferation assay. The proliferation of mouse splenocytes
was measured by an assay of 5-bromo-2-deoxyuridine (BrdU)
incorporation using a commercially available labeling and detection
kit (Cell Proliferation ELISA, Roche Molecular Biochemicals,
Mannheim, Germany). In brief, cells were incubated in the presence
of gp120 BaL (5 .mu.g/ml) or as control PHA-P mitogen (2 .mu.g/ml)
for 48 hrs and then pulsed with BrdU for 24 hr. Cell proliferation
was measured according to the manufacturer's instructions using
Spectra Max 340 ELISA Reader (Molecular Devices, Sunnyvale, Calif.)
at 370 nm and reference wavelength of 492 nm.
[0594] Analysis of cytokine expression in vitro. Mouse splenocytes
were seeded at 2-4.times.10.sup.6 cells/0.5 ml (RPMI 1640, 2% FBS)
and incubated with gp120 BaL or V3 loop peptide (20 nM, gift from
dr. Steven King)) or PHA-P mitogen (2 .mu.g/ml) for 72 hrs. Cell
culture supernatants were harvested and analyzed for the presence
of cytokines. IFN-.gamma. cytokine assays were performed using
QUANTIKINE ELISA kits (R&D Systems, Inc., Minneapolis, Minn.)
according to the manufacturer's instructions.
[0595] Statistical Analysis. Statistical analysis of results was
preformed using ANOVA, and Student's T-test for the determination
of p values.
Example 32
Development of Humoral Immune Responses in Mice Administered
Recombinant gp120 and Nanoemulsion Adjuvant
[0596] Mice were intranasally administered either gp120Bal or
gp120SF162 as described in Example 1, above. Induction of
anti-gp120BaL IgG in Balb/c mice immunized with gp120BaL mixed with
0.1%, 0.5% and 1% nanoemulsion (X8P) is shown in FIG. 44A. Levels
of anti-gp120 antibodies were measured at 6 weeks (after two doses)
and 12 weeks (after three doses) and are presented as log 10 of the
average reciprocal titers (+/-sem) in serum of individual animals.
FIG. 44B shows induction of anti-gp120SF162 IgG in mice immunized
with two doses of gp120 SF162 in 1% NE (W.sub.205EC) alone or with
addition of CpG or MPL A. Anti-gp120 SF162 IgG concentrations at 7
weeks after primary immunization were calculated according to
standard curve and are presented as a mean value of the individual
sera +/-sem.
Example 33
Antibodies Generated Against One Serotype of gp120 Cross-React with
Other gp120 Serotypes
[0597] Cross-reactivity of anti-gp120 antibodies after intranasal
administration of a nanoemulsion based-compound of the present
invention is shown in FIGS. 45A and 45B. Serum IgG from mice
vaccinated with either (A) gp120BaL-X8P or (B) gp120SF162-W205EC
reacts with both a homologous and with a heterologous serotype of
antigen used in ELISA. The antibody determination was performed as
in (FIG. 44A) for gp120BaL/NE (X8P) administration and as in (FIG.
44B) for gp120SF162/NE (W205EC) administration.
Example 34
Nasal Administration of gp120/Nanoemulsion Generates Anti-gp120
Specific IgA Antibodies Detectable in Bronchial and Vaginal Mucosal
Surfaces
[0598] Detectable levels of anti-gp120 specific, secretory IgA
antibodies were detected (A) in bronchial lavage (BAL) and (B) in
the vaginal washes of mice administered gp120BaL and NE adjuvant
(X8P) (See FIGS. 46A and 46B, respectively). Anti-gp120 IgA
concentration in BAL was calculated using a standard curve and is
presented as a mean of individual lavages +/-sem. Presence of
anti-gp120 IgA in vaginal washes is shown as a mean absorption (OD
405 nm, +/-sem) of individual samples. Statistically significant
difference was observed between gp120/saline and all gp120/NE
groups (p<0.05).
Example 35
Antigen-Specific Splenocytes Proliferate Following Intranasal
Administration of gp120BaL in Nanoemulsion
[0599] Antigen-specific splenocyte proliferation was observed
following intranasal administration of gp120BaL in nanoemulsion
(See FIG. 47). Splenocytes from mice administered gp120BaL in
nanoemulsion or controls were activated with 2 mg/ml of homologous
and heterologous gp120 (BaL and SF162, respectively) and with 20 mM
of the V3 loop peptide. Released IFN-.gamma. was determined by
ELISA with concentration presented as a mean of individual samples
+/-sem.
[0600] Splenocytes from animals were stimulated in vitro with 2
.mu.g/ml of homologous recombinant gp120BaL. Cell proliferation was
normalized to controls and presented as mean +/-sem of individual
proliferation indexes (See FIG. 47B). The differences between the
gp120/saline group and the gp120/nanoemulsion groups were all
statistically significant (p<0.05).
Example 36
Guinea Pig Mucosal Immunization Model
[0601] Hartly guinea pigs were vaccinated in a prime-boost schedule
with 50 .mu.g gp120SF162 in 1% nanoemulsion (W205EC). Serum IgG
antibody responses toward SF162 and BaL serotypes were generated
and measured at six weeks. Anti-gp120 IgG are presented as
absorption values (OD 405 nm, +/-sem) obtained in ELISA using 1:200
dilution of serum (See, FIG. 48).
Example 37
Neutralization of HIV Virus in Terms of ID 50 Values
[0602] Guinea pigs were nasally administered SF-162/W205 EC.
Neutralization of the laboratory amplified strains and the primary
isolates of HIV was performed in M7-Luc cells (See, e.g.,
Montefiori et al 2004). ID50 values represent the serum dilution at
which relative luminescence units (RLU) were reduced 50% compared
to virus control (See FIG. 49). Pre-immune sera were used to
evaluate non-specific antiviral activity.
[0603] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described compositions and
methods of the invention will be apparent to those skilled in the
art without departing from the scope and spirit of the invention.
Although the invention has been described in connection with
specific preferred embodiments, it should be understood that the
invention as claimed should not be unduly limited to such specific
embodiments. Indeed, various modifications of the described modes
for carrying out the invention that are obvious to those skilled in
the relevant fields are intended to be within the scope of the
present invention.
* * * * *