U.S. patent application number 11/966763 was filed with the patent office on 2008-07-31 for nanoemulsion vaccines.
This patent application is currently assigned to The Regents of the University of Michigan. Invention is credited to James R. Baker, Tarek Hamouda.
Application Number | 20080181905 11/966763 |
Document ID | / |
Family ID | 28794017 |
Filed Date | 2008-07-31 |
United States Patent
Application |
20080181905 |
Kind Code |
A1 |
Baker; James R. ; et
al. |
July 31, 2008 |
Nanoemulsion Vaccines
Abstract
The present invention provides methods and compositions for the
stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens. Accordingly, in some embodiments,
the present invention provides nanoemulsion vaccines comprising a
nanoemulsion and an inactivated pathogen or protein derived from
the pathogen. The present invention thus provides improved vaccines
against a variety of environmental and human-released
pathogens.
Inventors: |
Baker; James R.; (Ann Arbor,
MI) ; Hamouda; Tarek; (Milan, MI) |
Correspondence
Address: |
Casimir Jones, S.C.
440 Science Drive, Suite 203
Madison
WI
53711
US
|
Assignee: |
The Regents of the University of
Michigan
Ann Arbor
MI
|
Family ID: |
28794017 |
Appl. No.: |
11/966763 |
Filed: |
December 28, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10162970 |
Jun 5, 2002 |
7314624 |
|
|
11966763 |
|
|
|
|
60296048 |
Jun 5, 2001 |
|
|
|
Current U.S.
Class: |
424/184.1 |
Current CPC
Class: |
Y02A 50/469 20180101;
A01N 25/04 20130101; A61P 31/04 20180101; A61P 31/12 20180101; A61K
2039/55566 20130101; A61K 2039/521 20130101; A61K 9/1075 20130101;
A61P 31/18 20180101; Y02A 50/489 20180101; Y02A 50/30 20180101;
C12N 2760/16134 20130101; A61P 31/10 20180101; A61K 39/07 20130101;
A61P 31/16 20180101; A61K 9/0043 20130101; A61P 31/00 20180101;
Y02A 50/403 20180101; Y02A 50/394 20180101; A61P 37/00 20180101;
A61P 37/04 20180101; A61K 39/39 20130101 |
Class at
Publication: |
424/184.1 |
International
Class: |
A61K 39/00 20060101
A61K039/00; A61P 31/00 20060101 A61P031/00 |
Goverment Interests
[0002] This work was supported by MDA 972-1-007 awarded by the
United States Defense Advanced Research Project Agency. The
government has certain rights in this invention.
Claims
1. A method of inducing an immune response to an immunogen in a
subject comprising administering a combined nanoemulsion and
immunogen to said subject under conditions such that said subject
produces an immune response to said immunogen, wherein said
nanoemulsion comprises: 1. oil; 2. a solvent; 3. a surfactant; 4. a
halogen-containing compound; and 5. water;
2. The method of claim 1, wherein said administering comprises
contacting said combined nanoemulsion and immunogen to a surface of
said subject.
3. The method of claim 2, wherein said surface is a skin
surface.
4. The method of claim 1, wherein said administering comprises
parenteral delivery of said combined nanoemulsion and
immunogen.
5. The method of claim 4, wherein said parenteral delivery
comprises injection of said combined nanoemulsion and
immunogen.
6. The method of claim 5, wherein said injection comprises
intravenous injection.
7. The method of claim 5, wherein said injection comprises
intramuscular injection.
8. The method of claim 1, wherein said administering comprises
subcutaneous administration of said combined nanoemulsion and
immunogen.
9. The method of claim 1, wherein said administering comprises
intradermal administration of said combined nanoemulsion and
immunogen.
10. The method of claim 1, wherein said combined nanoemulsion and
immunogen is administered as a pharmaceutically acceptable
composition.
11. The method of claim 10, wherein said pharmaceutically
acceptable composition comprises one or more supplementary active
ingredients.
12. The method of claim 11, wherein said pharmaceutically
acceptable composition comprises an agent that enhance penetration
of the nanoemulsion and immunogen through the skin
13. The method of claim 11, wherein said pharmaceutically
acceptable composition comprises a pharmaceutically acceptable
carrier.
14. The method of claim 13, wherein said pharmaceutically
acceptable carrier is selected from the group consisting of a
liquid, cream, foam, lotion, and gel.
15. The method of claim 14, wherein said pharmaceutically
acceptable composition comprises one or more agents selected from
the group consisting of an organic solvent, emulsifier, gelling
agent, moisturizer, stabilizer, surfactant, wetting agent,
preservative, time release agent, humectant, sequestering agent,
dye, and perfume.
16. The method of claim 1, further comprising repeating step c)
administering said combined nanoemulsion and immunogen to said
subject.
17. The method of claim 1, wherein said subject exhibits a higher
titer of immunogen-specific antibodies relative to a subject not
administered said combined emulsion and immunogen.
18. The method of claim 17, wherein said immunogen-specific
antibodies comprise IgG antibodies.
19. The method of claim 17, wherein said immunogen-specific
antibodies comprise IgA antibodies.
20. The method of claim 1, wherein said subject exposed to said
combined nanoemulsion and immunogen exhibits elevated serum levels
of IFN-.gamma. compared to the levels found within a subject not
administered said combined nanoemulsion and immunogen.
Description
[0001] This application is a Continuation of U.S. patent
application Ser. No. 10/162,970, filed Jun. 5, 2002, which claims
priority to U.S. Provisional Patent Application Ser. No.
60/296,048, filed Jun. 5, 2001.
FIELD OF THE INVENTION
[0003] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens.
BACKGROUND
[0004] Immunization is a principal feature for improving the health
of people. Despite the availability of a variety of successful
vaccines against many common illnesses, infectious diseases remain
a leading cause of health problems and death. Significant problems
inherent in existing vaccines include the need for repeated
immunizations, and the ineffectiveness of the current vaccine
delivery systems for a broad spectrum of diseases.
[0005] In order to develop vaccines against pathogens that have
been recalcitrant to vaccine development, and/or to overcome the
failings of commercially available vaccines due to expense,
complexity, and underutilization, new methods of antigen
presentation must be developed which will allow for fewer
immunizations, more efficient usage, and/or fewer side effects to
the vaccine.
SUMMARY OF THE INVENTION
[0006] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens.
[0007] Accordingly, in some embodiments, the present invention
provides a composition comprising a vaccine, the vaccine comprising
an emulsion and an immunogen, the emulsion comprising an aqueous
phase, an oil phase, and a solvent. In some embodiment, the
immunogen comprises a pathogen (e.g., an inactivated pathogen). In
other embodiments, the immunogen comprises a pathogen product
(e.g., including, but not limited to, a protein, peptide,
polypeptide, nucleic acid, polysaccharide, or a membrane component
derived from the pathogen). In some embodiments, the immunogen and
the emulsion are combined in a single vessel.
[0008] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0009] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0010] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0011] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0012] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus
hepatitis C virus, hepatitis A virus, cytomegalovirus, and human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus. The present invention is not limited to a particular
bacteria. A variety of bacterial immunogens are contemplated
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
[0013] The present invention further provides a kit comprising a
vaccine, the vaccine comprising an emulsion and an immunogen, the
emulsion comprising an aqueous phase, an oil phase, and a solvent.
In some embodiments, the kit further comprises instructions for
using the kit for vaccinating a subject against the immunogen.
In some embodiment, the immunogen comprises a pathogen (e.g., an
inactivated pathogen). In other embodiments, the immunogen
comprises a pathogen product (e.g., including, but not limited to,
a protein, peptide, polypeptide, nucleic acid, polysaccharide, or
membrane component derived from the pathogen). In some embodiments,
the immunogen and the emulsion are combined in a single vessel.
[0014] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0015] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0016] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0017] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0018] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus
hepatitis C virus, hepatitis A virus, cytomegalovirus, and human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus. The present invention is not limited to a particular
bacteria. A variety of bacterial immunogens are contemplated
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
[0019] In still further embodiments, the present invention provides
a method of inducing immunity to an immunogen, comprising providing
an emulsion comprising an aqueous phase, an oil phase, and a
solvent; and an immunogen; combining the emulsion with the
immunogen to generate a vaccine composition; and administering the
vaccine composition to a subject. In some embodiments,
administering comprises contacting the vaccine composition with a
mucosal surface of the subject. For example, in some embodiments,
administering comprises intranasal administration. In some
preferred embodiments, the administering in under conditions such
that the subject is immune to the immunogen.
[0020] In some embodiment, the immunogen comprises a pathogen
(e.g., an inactivated pathogen). In other embodiments, the
immunogen comprises a pathogen product (e.g., including, but not
limited to, a protein, peptide, polypeptide, nucleic acid,
polysaccharide, or membrane component derived from the pathogen).
In some embodiments, the immunogen and the emulsion are combined in
a single vessel.
[0021] The present invention is not limited to a particular oil. A
variety of oils are contemplated, including, but not limited to,
soybean, avocado, squalene, olive, canola, corn, rapeseed,
safflower, sunflower, fish, flavor, and water insoluble vitamins.
The present invention is also not limited to a particular solvent.
A variety of solvents are contemplated including, but not limited
to, an alcohol (e.g., including, but not limited to, methanol,
ethanol, propanol, and octanol), glycerol, polyethylene glycol, and
an organic phosphate based solvent.
[0022] In some embodiments, the emulsion further comprises a
surfactant. The present invention is not limited to a particular
surfactant. A variety of surfactants are contemplated including,
but not limited to, nonionic and ionic surfactants (e.g., TRITON
X-100; TWEEN 20; and TYLOXAPOL).
[0023] In certain embodiments, the emulsion further comprises a
cationic halogen containing compound. The present invention is not
limited to a particular cationic halogen containing compound. A
variety of cationic halogen containing compounds are contemplated
including, but not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, and
tetradecyltrimethylammonium halides. The present invention is also
not limited to a particular halide. A variety of halides are
contemplated including, but not limited to, halide selected from
the group consisting of chloride, fluoride, bromide, and
iodide.
[0024] In still further embodiments, the emulsion further comprises
a quaternary ammonium containing compound. The present invention is
not limited to a particular quaternary ammonium containing
compound. A variety of quaternary ammonium containing compounds are
contemplated including, but not limited to, Alkyl dimethyl benzyl
ammonium chloride, dialkyl dimethyl ammonium chloride, n-Alkyl
dimethyl benzyl ammonium chloride, n-Alkyl dimethyl ethylbenzyl
ammonium chloride, Dialkyl dimethyl ammonium chloride, and n-Alkyl
dimethyl benzyl ammonium chloride.
[0025] In certain embodiments, the immunogen is selected from the
group consisting of virus, bacteria, fungus and pathogen products
derived from the virus, bacteria, or fungus. The present invention
is not limited to a particular virus. A variety of viral immunogens
are contemplated including, but not limited to, influenza A, herpes
simplex virus I, herpes simplex virus II, sendai, sindbis,
vaccinia, parvo, human immunodeficiency virus, hepatitis B, virus
hepatitis C virus, hepatitis A virus, cytomegalovirus, and human
papilloma virus, picornavirus, hantavirus, junin virus, and ebola
virus. The present invention is not limited to a particular
bacteria. A variety of bacterial immunogens are contemplated
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhoeae, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis. The present invention is also not limited to a
particular fungus. A variety of fungal immunogens are contemplated
including, but not limited to, Candida and Aspergillus.
DESCRIPTION OF THE FIGURES
[0026] The following figures form part of the present specification
and are included to further demonstrate certain aspects and
embodiments of the present invention. The invention may be better
understood by reference to one or more of these figures in
combination with the description of specific embodiments presented
herein.
[0027] FIG. 1 illustrates the antibacterial properties of 1% and
10% X8P. The bactericidal effect (% killing) was calculated as:
cfu ( initial ) - cfu ( post - treatment ) cfu ( initial ) .times.
100 ##EQU00001##
[0028] FIG. 2 illustrates the antiviral properties of 10% and 1%
X8P as assessed by plaque reduction assays.
[0029] FIG. 3 illustrates several particular embodiments of the
various pathogens of the present invention.
[0030] FIG. 4 illustrates several particular embodiments of the
various emulsion compositions of the invention.
[0031] FIG. 5 schematically depicts various generalized
formulations and uses of certain embodiments of the present
invention.
[0032] FIG. 6 shows serum IgG titers two weeks after a single
intranasal treatment with certain exemplary nanoemulsion vaccines
of the present invention.
[0033] FIG. 7 shows bronchial IgA influenza titers in mice
administered two intranasal doses of certain exemplary nanoemulsion
vaccines of the present invention.
[0034] FIG. 8 shows serum IgG influenza titers in mice administered
two intranasal doses of certain exemplary nanoemulsion vaccines of
the present invention.
[0035] FIG. 9 shows the log redution of pathogens by nanoemulsions
of the present invention.
[0036] FIG. 9A shows the log reduction of E. coli by various
emulsions. FIG. 9B shows the log reduction of B. globigii by
various emulsions. FIG. 9C shows the log reduction of influenza A
by various emulsions.
[0037] FIG. 10 a shows the virucidal activity of 2% nanoemulsion on
different concentrations of influenza A/AA virus. FIG. 10b shows
the time dependent virucidal activity of nanoemulsions during
incubation with influenza A/AA strain. FIG. 10c shows the detection
of viral RNA template during incubation of virus with nanoemulsion.
Compared with plaque reduction assay (FIG. 10b) RT-PCR of viral RNA
from virus/nanoemulsion formulation showed full correlation in a
time-dependant manner. Viral RNA was still present at 2 h, and was
not detectable after 3 h of incubation.
[0038] FIG. 11 shows the core body temperature of animals
vaccinated with different vaccines and 20 days later challenged
with lethal dose of influenza A Ann Arbor strain virus. *-N=3; two
animals died before day 5.
[0039] FIG. 12 shows survival curves of animals treated with
different vaccines intranasally and challenged with lethal dose of
influenza A Ann Arbor strain virus.
[0040] FIG. 13 shows that intranasal treatment of animals with
virus/nanoemulsion mixture induced high levels of anti-influenza A,
Ann Arbor strain IgG antibodies in serum. *-p<0.05 (nanoemulsion
alone vs. virus/nanoemulsion, day 20); **-p<0.01
(virus/nanoemulsion, day 20 vs. day 35).
[0041] FIG. 14 shows the detection of influenza A virus RNA in
virus/emulsion vaccinated animals. RT-PCR showed the presence of
viral template until day 6 after treatment which was not detectable
on day 7 and thereafter (FIG. 14a). Signal generated from total
lung RNA during the first 6 days after treatment was equal to 1 and
not greater than 10 pfu of virus (FIG. 14b).
[0042] FIG. 15 shows early cytokine responses in splenocytes and
serum of mice 72 hours after treatment with influenza A 100
pfu/mouse, formalin-killed virus 5.times.10.sup.5 pfu, virus
(5.times.10.sup.5 pfu)/2% nanoemulsion mixture, nanoemulsion alone.
FIG. 15a shows IFN-.quadrature. levels. FIG. 15b shows
TNF-.quadrature. levels. FIG. 15c shows IL-12 p40 levels. FIG. 15d
shows IL-4 levels. FIG. 15e shows IL-2 levels. FIG. 15f shows IL-10
levels. FIG. 15g shows IFN-.quadrature. levels on day 20 after
treatment.
[0043] FIG. 16 shows stimulation indices of splenocytes harvested
on day 20 and 35 of experiment from mice treated with
virus/nanoemulsion.
[0044] FIG. 17 shows antigen-specific activation of cytokine
production by splenocytes harvested from mice after treatment with
virus/nanoemulsion preparation. Splenocytes were harvested from
animals on two occasions: on day 20 (before challenge) and day 35
(after challenge) of experiment. FIG. 17a shows IFN-.quadrature.
levels. FIG. 17b shows IK-2 levels. FIG. 17c shows IL-4 levels.
[0045] FIG. 18 shows the percentage of T (CD3 positive cells) and
cytotoxic cells (CD8 positive cells) in splenocytes. Percentage was
calculated as follows: T-cells (%)=(CD3 cells/(CD3+CD19
cells))*100; CD8 cells (%)=(CD8 cells/(CD8+CD4 cells))*100. p-value
described the significance between the percentage of T-cells before
and after the challenge.
[0046] FIG. 19 shows survival curves of animals treated with
different preparations intranasally and challenged with lethal dose
of influenza A virus either Ann Arbor or Puerto Rico strain.
[0047] FIG. 20 shows the expansion of the influenza epitope
recognition of immunized mice before (FIG. 20a) and after (FIG.
20b) challenge with live virus.
GENERAL DESCRIPTION OF THE INVENTION
[0048] The present invention provides methods and compositions for
the stimulation of immune responses. Specifically, the present
invention provides methods and compositions for the use of
nanoemulsion compounds as mucosal adjuvants to induce immunity
against environmental pathogens. Accordingly, in some embodiments,
the present invention provides mucosal vaccines comprising a
pathogen (e.g., an inactivated pathogen) and a nanoemulsion
composition. In some embodiments, the pathogen is mixed with the
nanoemulsion prior to administration for a time period sufficient
to inactivate the pathogen. In others, purified protein components
from an pathogen are mixed with the nanoemulsion.
[0049] The present invention is not limited to any mechanism of
action. Indeed, an understanding of the mechanism is not necessary
to practice the present invention. Nonetheless, it is contemplated
that the nanoemulsion/pathogen compositions of the present
invention stimulate a mucosal immune response against the pathogen
component of the vaccine (See e.g., Richter and Kipp, Curr Top
Microbiol Immunol 240:159-76 [1999]; Ruedl and Wolf, Int. Arch.
Immunol., 108:334 [1995]; and Mor et al., Trends Micrbiol 6:449-53
[1998] for reviews of the mucosal immune system). Mucosal antigens
stimulate the Peyer's Patches (PP) of the gastrointestinal tract.
The M cells of the PP then transport antigens to the underlying
lymph tissue where they encounter B cells and initiate B cell
development. IgA is secreted by primed B cells that have been
induced to produce IgA by Th2 helper T cells. Primed B cells are
transported throughout the lymph system where they populate all
secretory tissues. IgAs are then secreted in mucosal tissues where
they serve as a first-line defense against many viral and bacterial
pathogens.
[0050] An optimal prophylactic vaccine against influenza virus
should include means to induce both Ab responses and cytotoxic T
cell responses (McMichael, Curr. Top. Microbiol. Immunol. 189:75
[1994]). Experiments conducted during the course of development of
the present invention (See e.g., Example 15) demonstrated that
nanoemulsion vaccines of the present invention fulfill both
requirements. Immunization with a single dose induced high titer of
influenza specific IgG antibodies and titer of antibodies continued
to increase after the lethal challenge. There was an early cytokine
response (day 4) after single intranasal immunization with
virus/nanoemulsion mixture with high levels of IL-12, IFN-.gamma.,
IL-2, TNF-.alpha. and IL-10 and absence of anti-inflammatory
cytokine IL-4. Since IFN-.gamma. is the major cytokine produced in
response to viral infection, kinetics of IFN-.gamma. production
over the period of 20 days after immunization were measured. There
was significant amount of IFN-.gamma. (200 pg of per milliliter of
mouse serum) one day after immunization. Over 10 days, it gradually
decreased to undetectable amounts. The immune response against
virus was highly specific since mouse splenocytes harvested 20 days
after immunization and stimulated with either congenic strain of
virus (Ann Arbor) or heterogenic strain of virus (Puerto Rico)
responded exclusively toward congenic strain of virus by production
of IFN-.gamma. and proliferation. Moreover, mice immunized with Ann
Arbor strain of virus and challenged with Puerto Rico strain did
not survive the lethal challenge. However, the mice immunized with
Ann Arbor strain and challenged with the same virus acquired the
immunity against heterogenic strain of virus (Puerto Rico strain).
The splenocytes from these animals were able to respond by profound
production of IFN-.gamma. after in vitro stimulation with Puerto
Rico virus. Furthermore, these animals were fully protected against
lethal challenge with heterogenic virus, i.e Puerto Rico
strain.
[0051] The present invention is not limited to a particular
mechanism. Indeed, an understanding of the mechanism is not
necessary to practice the present invention. Nonetheless, it is
contemplated that this observation suggests an immunodominance
effect (Sercarz et al., Anu Rev Immunol 11:729 [1993]; Perreault et
al., Immunol Today 19:69 [1998]), which has been found to regulate
cytotoxic T lymphocyte (CTL) responses to viruses (Silins et al., J
Exp Med 184:1815 [1996]; Steven et al., J Exp Med 184:1801 [1996]).
It appears that only a very small portion of epitopes, probably
less than 10%, are dominant (Tremblay et al., Transplantation 58:59
[1994]; Brochu et al., J Immunol 155:5104 [1995]). During the
process of vaccination, the presence of immunodominant epitopes
prevented recognition of nondominant determinants and therefore
animals responded exclusively toward congenic strain of virus.
However, after both vaccination and the lethal challenge with
congenic virus (Ann Arbor), animals expanded the epitope
recognition and developed the response to nondominant determinants
acquiring immune protection against heterogenic virus.
[0052] Experiments conducted during the course of the development
of the present invention strongly support the notion that as little
as a single intranasal instillation of virus/nanoemulsion mixture
works as mucosal vaccine and is able to stimulate strong and
specific immune response against influenza A virus. The vaccine was
prepared by mixing the 5.times.10.sup.5 pfu of virus with equal
volume of 4% nanoemulsion and incubated at RT for one hour prior to
mucosal vaccination of animals. Although the reduction of virus was
greater than three logs after one hour incubation of the virus with
nanoemulsion, there was an incomplete viral inactivation with about
100 pfu of intact virus remaining, based on viral plaque assay.
These finding led to an investigation of whether a small number of
intact viral particles alone could be effective in immunization of
mice. As shown in Table 28, up to 2.times.10.sup.3 pfu of virus per
mouse administrated intranasally did not result in protected
immunity since all animals challenged with lethal dose of virus
succumbed to pneumonia and died. Low doses of virus were not
effective and higher dose of intact virus caused sickness and death
within the first 3 days after intranasal treatment. These data
clearly demonstrated that, in addition to nanoemulsion and
nanoemulsion-inactivated virus, a small dose of intact virus was
useful for mucosal vaccination of experimental animals. This
conclusion was also supported by the observation that
formalin-inactivated virus mixed with nanoemulsion and
administrated intranasally to animals did not protect them from
lethal challenge with influenza A virus.
[0053] The nasally administered nanoemulsion vaccine compositions
of the present invention have several advantages over parenterally
administered vaccines. The vaccines can be easily administered when
needed (e.g., immediately before or directly after exposure to the
pathogen). When administered after exposure (e.g., after exposure
of troops to a biological weapon), immune protection occurs
specifically when needed. It is at this time that ongoing pathogen
exposure might lead to infection. The administration methods of the
present invention also avoid the need for expensive and problematic
prophylactic vaccine programs. This approach provides the
individual with specific immunity to the exact organisms exposed
to, regardless of genetic or antigenic manipulation. The methods of
the present invention are particularly valuable since they avoid
the need for actual infection to induce immunity since even an
attenuated infection can have undesired consequences. The present
invention further provides methods of using nanoemulsions as
adjuvants for parenteral administered vaccines. The present
invention thus provides a rapid, killed vaccine for a range of
naturally occurring and human administered pathological agents.
DEFINITIONS
[0054] To facilitate an understanding of the present invention, a
number of terms and phrases are defined below:
[0055] As used herein the term "microorganism" refers to
microscopic organisms and taxonomically related macroscopic
organisms within the categories of algae, bacteria, fungi
(including lichens), protozoa, viruses, and subviral agents. The
term microorganism encompasses both those organisms that are in and
of themselves pathogenic to another organism (e.g., animals,
including humans, and plants) and those organisms that produce
agents that are pathogenic to another organism, while the organism
itself is not directly pathogenic or infective to the other
organism. As used herein the term "pathogen," and grammatical
equivalents, refers to an organism, including microorganisms, that
causes disease in another organism (e.g., animals and plants) by
directly infecting the other organism, or by producing agents that
causes disease in another organism (e.g., bacteria that produce
pathogenic toxins and the like).
[0056] As used herein the term "disease" refers to a deviation from
the condition regarded as normal or average for members of a
species or group, and which is detrimental to an affected
individual under conditions that are not inimical to the majority
of individuals of that species or group (e.g., diarrhea, nausea,
fever, pain, and inflammation etc). A disease may be caused or
result from contact by microorganisms and/or pathogens.
[0057] The terms "host" or "subject," as used herein, refer to
organisms to be treated by the compositions and methods of the
present invention. Such organisms include organisms that are
exposed to, or suspected of being exposed to, one or more
pathogens. Such organisms also include organisms to be treated so
as to prevent undesired exposure to pathogens. Organisms include,
but are not limited to animals (e.g., humans, domesticated animal
species, wild animals) and plants.
[0058] As used herein, the term "inactivating," and grammatical
equivalents, means having the ability to kill, eliminate or reduce
the capacity of a pathogen to infect and/or cause a pathological
responses in a host.
[0059] As used herein, the term "fusigenic" is intended to refer to
an emulsion that is capable of fusing with the membrane of a
microbial agent (e.g., a bacterium or bacterial spore). Specific
examples of fusigenic emulsions include, but are not limited to,
W.sub.808P described in U.S. Pat. Nos. 5,618,840; 5,547,677; and
5,549,901 and NP9 described in U.S. Pat. No. 5,700,679, each of
which is herein incorporated by reference in their entireties. NP9
is a branched poly(oxy-1,2
ethaneolyl),alpha-(4-nonylphenal)-omega-hydroxy-surfactant. While
not being limited to the following, NP9 and other surfactants that
may be useful in the present invention are described in Table 1 of
U.S. Pat. No. 5,662,957, herein incorporated by reference in its
entirety.
[0060] As used herein, the term "lysogenic" refers to an emulsion
that is capable of disrupting the membrane of a microbial agent
(e.g., a bacterium or bacterial spore). In preferred embodiments of
the present invention, the presence of both a lysogenic and a
fusigenic agent in the same composition produces an enhanced
inactivating effect than either agent alone. Methods and
compositions (e.g., vaccines) using this improved antimicrobial
composition are described in detail herein.
[0061] The term "emulsion," as used herein, includes classic
oil-in-water or water in oil dispersions or droplets, as well as
other lipid structures that can form as a result of hydrophobic
forces that drive apolar residues (i.e., long hydrocarbon chains)
away from water and drive polar head groups toward water, when a
water immiscible oily phase is mixed with an aqueous phase. These
other lipid structures include, but are not limited to,
unilamellar, paucilamellar, and multilamellar lipid vesicles,
micelles, and lamellar phases. Similarly, the term "nanoemulsion,"
as used herein, refers to oil-in-water dispersions comprising small
lipid structures. For example, in preferred embodiments, the
nanoemulsions comprise an oil phase having droplets with a mean
particle size of approximately 0.1 to 5 microns, although smaller
and larger particle sizes are contemplated. The terms "emulsion"
and "nanoemulsion" are often used herein, interchangeably, to refer
to the nanoemulsions of the present invention.
[0062] As used herein, the terms "contacted" and "exposed," refers
to bringing one or more of the compositions of the present
invention into contact with a pathogen or a subject to be protected
against pathogens such that the compositions of the present
invention may inactivate the microorganism or pathogenic agents, if
present. The present invention contemplates that the disclosed
compositions are contacted to the pathogens or microbial agents in
sufficient volumes and/or concentrations to inactivate the
pathogens or microbial agents.
[0063] The term "surfactant" refers to any molecule having both a
polar head group, which energetically prefers solvation by water,
and a hydrophobic tail that is not well solvated by water. The term
"cationic surfactant" refers to a surfactant with a cationic head
group. The term "anionic surfactant" refers to a surfactant with an
anionic head group.
[0064] The terms "Hydrophile-Lipophile Balance Index Number" and
"HLB Index Number" refer to an index for correlating the chemical
structure of surfactant molecules with their surface activity. The
HLB Index Number may be calculated by a variety of empirical
formulas as described by Meyers, (Meyers, Surfactant Science and
Technology, VCH Publishers Inc., New York, pp. 231-245 [1992]),
incorporated herein by reference. As used herein, the HLB Index
Number of a surfactant is the HLB Index Number assigned to that
surfactant in McCutcheon's Volume 1: Emulsifiers and Detergents
North American Edition, 1996 (incorporated herein by reference).
The HLB Index Number ranges from 0 to about 70 or more for
commercial surfactants. Hydrophilic surfactants with high
solubility in water and solubilizing properties are at the high end
of the scale, while surfactants with low solubility in water that
are good solubilizers of water in oils are at the low end of the
scale.
[0065] As used herein, the term "germination enhancers" describe
compounds that act to enhance the germination of certain strains of
bacteria (e.g., L-amino acids [L-alanine], CaCl.sub.2, Inosine,
etc).
[0066] As used herein the term "interaction enhancers" refers to
compounds that act to enhance the interaction of an emulsion with
the cell wall of a bacteria (e.g., a Gram negative bacteria).
Contemplated interaction enhancers include, but are not limited to,
chelating agents (e.g., ethylenediaminetetraacetic acid [EDTA],
ethylenebis(oxyethylenenitrilo)tetraacetic acid [EGTA], and the
like) and certain biological agents (e.g., bovine serum abulmin
[BSA] and the like).
[0067] The terms "buffer" or "buffering agents" refer to materials,
that when added to a solution, cause the solution to resist changes
in pH.
[0068] The terms "reducing agent" and "electron donor" refer to a
material that donates electrons to a second material to reduce the
oxidation state of one or more of the second material's atoms.
[0069] The term "monovalent salt" refers to any salt in which the
metal (e.g., Na, K, or Li) has a net 1+ charge in solution (i.e.,
one more proton than electron).
[0070] The term "divalent salt" refers to any salt in which a metal
(e.g., Mg, Ca, or Sr) has a net 2+ charge in solution.
[0071] The terms "chelator" or "chelating agent" refer to any
materials having more than one atom with a lone pair of electrons
that are available to bond to a metal ion.
[0072] The term "solution" refers to an aqueous or non-aqueous
mixture.
[0073] As used herein, the term "therapeutic agent," refers to
compositions that decrease the infectivity, morbidity, or onset of
mortality in a host contacted by a pathogenic microorganism or that
prevent infectivity, morbidity, or onset of mortality in a host
contacted by a pathogenic microorganism. Such agents may
additionally comprise pharmaceutically acceptable compounds (e.g.,
adjutants, excipients, stabilizers, diluents, and the like). In
some embodiments, the therapeutic agents (e.g., vaccines) of the
present invention are administered in the form of topical
emulsions, injectable compositions, ingestible solutions, and the
like.
[0074] The terms "pharmaceutically acceptable" or
"pharmacologically acceptable," as used herein, refer to
compositions that do not substantially produce adverse allergic or
immunological reactions when administered to a host (e.g., an
animal or a human). As used herein, "pharmaceutically acceptable
carrier" includes any and all solvents, dispersion media, coatings,
wetting agents (e.g., sodium lauryl sulfate), isotonic and
absorption delaying agents, disintrigrants (e.g., potato starch or
sodium starch glycolate), and the like.
[0075] As used herein, the term "topically" refers to application
of the compositions of the present invention to the surface of the
skin and mucosal cells and tissues (e.g., alveolar, buccal,
lingual, masticatory, or nasal mucosa, and other tissues and cells
which line hollow organs or body cavities).
[0076] As used herein, the term "topically active agents" refers to
compositions of the present invention that illicit a
pharmacological response at the site of application (contact) to a
host.
[0077] As used herein, the term "systemically active drugs" is used
broadly to indicate a substance or composition that will produce a
pharmacological response at a site remote from the point of
application or entry into a subject.
[0078] As used herein, the term "adjuvant" refers to an agent that
increases the immune response to an antigen (e.g., a pathogen). A
used herein, the term "immune response" refers to a subject's
(e.g., a human or another animal) response by the immune system to
immunogens (i.e., antigens) the subject's immune system recognizes
as foreign. Immune responses include both cell-mediated immune
responses (responses mediated by antigen-specific T cells and
non-specific cells of the immune system) and humnasal immune
responses (responses mediated by antibodies present in the plasma
lymph, and tissue fluids). The term "immune response" encompasses
both the initial responses to an immunogen (e.g., a pathogen) as
well as memory responses that are a result of "acquired
immunity."
[0079] As used herein, the term "immunity" refers to protection
from disease upon exposure to a pathogen. Immunity can be innate
(immune responses that exist in the absence of exposure to an
antigen) and/or acquired (immune responses that are mediated by B
and T cells following exposure to antigen and that exhibit
specificity to the antigen).
[0080] As used herein, the term "immunogen" refers to an antigen
that is capable of eliciting an immune response in a subject. In
preferred embodiments, immunogens elicit immunity against the
immunogen (e.g., a pathogen or a pathogen product) when
administered in combination with a nanoemulsion of the present
invention.
[0081] As used herein, the term "pathogen product" refers to any
component or product derived from a pathogen including, but not
limited to, polypeptides, peptides, proteins, nucleic acids,
membrane fractions, and polysaccharides.
[0082] As used herein, the term "enhanced immunity" refers to an
increase in the level of acquired immunity to a given pathogen
following administration of a vaccine of the present invention
relative to the level of acquired immunity when a vaccine of the
present invention has not been administered.
[0083] As used herein, the term "purified" or "to purify" refers to
the removal of contaminants or undesired compounds from a sample or
composition. As used herein, the term "substantially purified"
refers to the removal of from about 70 to 90%, up to 100%, of the
contaminants or undesired compounds from a sample or
composition.
[0084] As used herein, the term "surface" is used in its broadest
sense. In one sense, the term refers to the outermost boundaries of
an organism or inanimate object (e.g., vehicles, buildings, and
food processing equipment, etc.) that are capable of being
contacted by the compositions of the present invention (e.g., for
animals: the skin, hair, and fur, etc., and for plants: the leaves,
stems, flowering parts, and fruiting bodies, etc.). In another
sense, the term also refers to the inner membranes and surfaces of
animals and plants (e.g., for animals: the digestive tract,
vascular tissues, and the like, and for plants: the vascular
tissues, etc.) capable of being contacted by compositions by any of
a number of transdermal delivery routes (e.g., injection,
ingestion, transdermal delivery, inhalation, and the like).
[0085] As used herein, the term "sample" is used in its broadest
sense. In one sense it can refer to animal cells or tissues. In
another sense, it is meant to include a specimen or culture
obtained from any source, such as biological and environmental
samples. Biological samples may be obtained from plants or animals
(including humans) and encompass fluids, solids, tissues, and
gases. Environmental samples include environmental material such as
surface matter, soil, water, and industrial samples. These examples
are not to be construed as limiting the sample types applicable to
the present invention.
DETAILED DESCRIPTION OF THE INVENTION
[0086] The present invention provides methods and compositions for
the stimulation of specific immune response. Accordingly, in some
embodiments, the present invention provides vaccines for the
stimulation of immunity against pathogens. In some embodiments, the
present invention provides nanoemulsion vaccine compositions
comprising an inactivated pathogen and a nanoemulsion. The present
invention is not limited to any particular nanoemulsion or
pathogen. Exemplary vaccine compositions and methods of
administering vaccine compositions are described in more detail
below.
I. Nanoemulsions as Anti-Pathogen Compositions
[0087] The nanoemulsion compositions utilized in some embodiments
of the present invention have demonstrated anti-pathogen effect.
For example, nanoemulsion compositions have been shown to
inactivate bacteria (both vegetative and spore forms), virus, and
fungi. In preferred embodiments of the present invention, pathogens
are inactivated by exposure to nanoemulsions before being
administered as vaccines.
[0088] A. Microbicidal and Microbistatic Activity
[0089] Nanoemulsion compositions can be used to rapidly inactivate
bacteria. In certain embodiments, the compositions are particularly
effective at inactivating Gram positive bacteria. In preferred
embodiments, the inactivation of bacteria occurs after about five
to ten minutes. Thus, bacteria may be contacted with an emulsion
and will be inactivated in a rapid and efficient manner. It is
expected that the period of time between the contacting and
inactivation may be as little as 5-10 minutes where the bacteria is
directly exposed to the emulsion. However, it is understood that
when nanoemulsions are employed in a therapeutic context and
applied systemically, the inactivation may occur over a longer
period of time including, but not limited to, 5, 10, 15, 20, 25 30,
60 minutes post application. Further, in additional embodiments,
inactivation may take two, three, four, five or six hours to
occur.
[0090] Nanoemulsions can also rapidly inactivate certain Gram
negative bacteria for use in generating the vaccines of the present
invention. In such methods, the bacteria inactivating emulsions are
premixed with a compound that increases the interaction of the
emulsion by the cell wall. The use of these enhancers in the
vaccine compositions of the present invention is discussed herein
below. It should be noted that certain emulsions (e.g., those
comprising enhancers) are effective against certain Gram positive
and negative bacteria.
[0091] In specific illustrative examples (Examples 3-4),
nanoemulsions useful in the compositions and methods of the present
invention were shown to have potent, selective biocidal activity
with minimal toxicity against vegetative bacteria. For example, X8P
was highly effective against B. cereus, B. circulars and B.
megaterium, C. perfringens, H. influenzae, N. gonorrhoeae, S.
agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and
Eltor (FIG. 26). This inactivation starts immediately on contact
and is complete within 15 to 30 minutes for most of the susceptible
microorganisms.
[0092] B. Sporicidial and Sporistatic Activity
[0093] In certain specific examples (e.g., Examples 5 and 11),
nanoemulsions have been shown to have anti-sporicidal activity.
Without being bound to any theory (an understanding of the
mechanism is not necessary to practice the present invention, and
the present invention is not limited to any particular mechanism),
it is proposed the that the sporicidal ability of these emulsions
occurs through initiation of germination without complete reversion
to the vegetative form leaving the spore susceptible to disruption
by the emulsions. The initiation of germination could be mediated
by the action of the emulsion or its components.
[0094] The results of electron microscopy studies show disruption
of the spore coat and cortex with disintegration of the core
contents following X8P treatment. Sporicidal activity appears to be
mediated by both the TRITON X-100 and tri-n-butyl phosphate
components since nanoemulsions lacking either component are
inactive in vivo. This unique action of the emulsions, which is
similar in efficiency to 1% bleach, is interesting because Bacillus
spores are generally resistant to most disinfectants including many
commonly used detergents (Russell, Clin. Micro. 3; 99 [1990]).
[0095] Certain illustrative examples of the present invention
demonstrate that mixing X8P with B. cereus spores before injecting
into mice prevents the pathological effect of B. cereus (Example
5). Further, illustrative examples of the present invention show
that X8P treatment of simulated wounds contaminated with B. cereus
spores markedly reduced the risk of infection and mortality in mice
(Example 5). The control animals, injected with X8P alone diluted
1:10, did not show any inflammatory effects, thus demonstrating
that X8P does not have cutaneous toxicity in mice. These results
suggest that immediate treatment of spores prior to or following
exposure can effectively reduce the severity of tissue damage of
the experimental cutaneous infection.
[0096] Other experiments conducted during the development of the
present invention compared the effects of X8P and other emulsions
derived from X8P to inactivate different Bacillus spores (Example
11). X8P diluted up to 1:1000 (v/v) inactivated more than 90% of B.
anthracis spores in four hours, and was also sporicidal against
three other Bacillus species through the apparent disruption of
spore coat. X8W.sub.60PC diluted 1:1000 had more sporicidal
activity against B. anthracis, B. cereus, and B. subtilis and had
an onset of action in less than 30 minutes. In mice, mixing X8P
with B. cereus before subcutaneous injection or wound irrigation
with X8P 1 hour following spore inoculation resulted in over 98%
reduction in skin lesion size. Mortality was reduced 4-fold in the
latter experiment. The present compositions are stable, easily
dispersed, non-irritant and nontoxic compared to the other
available sporicidal agents.
[0097] The bacteria-inactivating oil-in-water emulsions used in
some embodiments of the present invention can be used to inactivate
a variety of bacteria and bacterial spores upon contact. For
example, the presently disclosed emulsions can be used to
inactivate Bacillus including B. cereus, B. circulans and B.
megatetium, also including Clostridium (e.g., C. botulinum and C.
tetani). The nanoemulsions utilized in some embodiments of the
present invention may be particularly useful in inactivating
certain biological warfare agents (e.g., B. anthracis). In
addition, the formulations of the present invention also find use
in combating C. perfringens, H. influenzae, N. gonorrhoeae, S.
agalactiae, S. pneumonia, S. pyogenes and V. cholerae classical and
Eltor (FIG. 1).
[0098] C. Viricidal and Viralstatic Activity
[0099] In additional illustrative examples (e.g., Example 12) of
the present invention, it was demonstrated that the nanoemulsion
compositions of the present invention have anti-viral properties.
The effect of these emulsions on viral agents was monitored using
plaque reduction assay (PRA), cellular enzyme-linked immunosorbent
assay (ELISA), .beta.-galactosidase assay, and electron microscopy
(EM) and the cellular toxicity of lipid preparations was assessed
using a (4,5-dimethylthiazole-2-yl)-2,5 diphenyltetrazolium (MTT)
staining assay (Mosmann, J. Immunol. Methods., 65:55 [1983]).
[0100] There was a marked reduction of influenza A infectivity of
MDCK cells as measured by cellular ELISA with subsequent
confirmation by PRA. X8P and SS at a dilution of 1:10 reduced virus
infectivity over 95%. Two other emulsions showed only intermediate
effects on the virus reducing infectivity by approximately 40% at
dilution 1:10. X8P was the most potent preparation and showed
undiminished viricidal effect even at dilution 1:100. Kinetic
studies showed that 5 min incubation of virus with X8P at 1:10
dilution completely abolished its infectivity. TRITON X-100, an
active compound of X8P, at dilution 1:5000 only partially inhibited
the infectivity of virus as compared to X8P, indicating that the
nanoemulsion itself contributes to the anti-viral efficacy. To
further examine the anti-viral properties of X8P, its action on
non-enveloped viruses was investigated. The X8P treatment did not
affect the replication of lacZ adenovirus construct in 293 cells as
measured using .beta.-galactosidase assay. When examined with EM,
influenza A virus was completely disrupted after incubation with
X8P while adenovirus remained intact.
[0101] In addition, pre-incubation of virus with 10% and 1% X8P in
PBS completely eliminates herpes, sendai, sindbis and vaccinia
viruses as assessed by plaque reduction assays (FIG. 2). Time
course analyses showed the onset of inactivation to be rapid and
complete within 5 minutes of incubation with 10% X8P and within 30
minutes with 1% X8P. Adenovirus treated with different dilutions of
X8P showed no reduction in infectivity.
[0102] The efficacy of certain X8P based compositions against
various viral onslaught and their minimal toxicity to mucous
membranes demonstrate their potential as effective disinfectants
and agents for prevention of diseases resulting from infection with
enveloped viruses.
[0103] D. Fungicidal and Fungistatic Activity
[0104] Yet another property of the nanoemulsions used in some
embodiments of the present invention is that they possess
antifungal activity. Common agents of fungal infections include
various species of the genii Candida and Aspergillus, and types
thereof, as well as others. While external fungus infections can be
relatively minor, systemic fungal infections can give rise to
serious medical consequences. There is an increasing incidence of
fungal infections in humans, attributable in part to an increasing
number of patients having impaired immune systems. Fungal disease,
particularly when systemic, can be life threatening to patients
having an impaired immune system.
[0105] Experiments conducted during the development of the present
invention have shown that 1% X8P has a greater than 92% fungistatic
activity when applied to Candida albicans. Candida was grown at
37.degree. C. overnight. Cells were then washed and counted using a
hemacytometer. A known amount of cells were mixed with different
concentrations of X8P and incubated for 24 hours. The Candida was
then grown on dextrose agar, incubated overnight, and the colonies
were counted. The fungistatic effect of the X8P was determined as
follows:
Fungistatic effect ( FSE ) = 1 - # of treated cells - Initial # of
cells # of untreated cells - Initial # of cells .times. 100
##EQU00002##
[0106] It is contemplated that other nanoemulsion formulations
useful in the methods and compositions of the present invention
(e.g., described below) are also fungistatic. One of skill in the
art will be able to test additional formulations for their ability
to inactivate fungi (e.g., using methods described herein).
[0107] E. In Vivo Effects
[0108] In other illustrative examples of the present invention,
nanoemulsion formulations were shown to combat and prevent pathogen
infection in animals. Bacillus cereus infection in experimental
animals has been used previously as a model system for the study of
anthrax (See e.g., Burdon and Wende, J Infect. Diseas. 170(2):272
[1960]; Lamanna and Jones, J. Bact. 85:532 [1963]; and Burdon et
al., J Infect. Diseas. 117:307 [1967]). The disease syndrome
induced in animals experimentally infected with B. cereus is
similar to B. anthracis (Drobniewski, Clin. microbio. Rev. 6:324
[1993]; and Fritz et al., Lab. Invest. 73:691 [1995]). Experiments
conducted during the development of the present invention
demonstrated that mixing X8P with B. cereus spores before injecting
into mice prevented the pathological effect of B. cereus. Further,
it was demonstrated that X8P treatment of simulated wounds
contaminated with B. cereus spores markedly reduced the risk of
infection and mortality in mice. The control animals, which were
injected with X8P alone diluted 1:10, did not show any inflammatory
effects proving that X8P does not have cutaneous toxicity in mice.
These results suggest that immediate treatment of spores prior to
or following exposure can effectively reduce the severity of tissue
damage of the experimental cutaneous infection.
[0109] In a particular example, Guinea Pigs were employed as
experimental animals for the study of C. perfringens infection. A
1.5 cm skin wound was made, the underlying muscle was crushed and
infected with 5.times.10.sup.7 cfu of C. perfringens without any
further treatment. Another group was infected with the same number
of bacteria, then 1 hour later it was irrigated with either saline
or X8P to simulate post-exposure decontamination. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit. However, X8P irrigation of the wound infected
with C. perfringens showed marked reduction of edema, inflammatory
reaction and necrosis. As such, it was demonstrated that certain
nanoemulsion formulations are able to combat a bacterial
infection.
[0110] Further, a subcutaneous injection of 10% X8P did not cause
distress in experimental animals and resulted in no gross
histological tissue damage. All rats in the nasal toxicity study
showed weight gain over the study period. No adverse clinical signs
were noted and all tissues appeared within normal limits on gross
examination. Bacterial cultures from the stools of treated animals
were not significantly different from those of untreated
animals.
II. Nanoemulsion Vaccine Compositions
[0111] In some embodiments, the present invention provides vaccine
compositions comprising a nanoemulsion and one or more inactivated
pathogens or pathogen products. The present invention provides
vaccines for any number of pathogens. The present invention is not
limited to any particular nanoemulsion formulation. Indeed, a
variety of nanoemulsion formulations are contemplated (See e.g.,
below description and illustrative Examples and US Patent
Application 20020045667, herein incorporated by reference).
[0112] The immunogens (e.g., pathogens or pathogen products) and
nanoemulsions of the present invention may be combined in any
suitable amount utilizing a variety of delivery methods. Any
suitable pharmaceutical formulation may be utilized, including, but
not limited to, those disclosed herein. Suitable vaccine
formulation may be tested for immunogenicity using any suitable
method. For example, in some embodiments, immunogenicity is
investigated by quantitating both antibody titer and specific
T-cell responses. Nanoemulsion vaccines may also be tested in
animal models of infectious disease states. Suitable animal models,
pathogens, and assays for immunogenicity include, but are not
limited to, those described below.
[0113] A. Nanoemulsions as Immune Adjuvants
[0114] The ability of nanoemulsions to prevent infections in a
prophylactic manner when applied to either wounds, skin or mucous
membranes has been documented (Hamouda et al., J. Infect. Dis.,
180:1939 [1999]; Donovan et al., Antivir Chem Chemother., 11:41
[2000]). During the development of the present invention, in
several studies, mice were pretreated with nasally-applied
nanoemulsion before exposure to influenza virus to document the
ability of the nanoemulsions to prevent inhalation influenza
pneumonitis. Morbidity from pretreatment with nanoemulsion was
minimal and, as compared to control animals, mortality was greatly
diminished (20% with pretreatment vs. 80% in controls; Example 13).
Several of the surviving, emulsion pretreated animals were found to
have evidence of a few areas of immune reactivity and giant-cell
formation in the lung that were not present in control animals
treated with emulsion but not exposed to virus. All of the
pretreated animals had evidence of lipid uptake in lung
macrophages. The present invention is not limited to any one
mechanism. Indeed, an understanding of the mechanism is not
necessary to practice the present invention. Nonetheless, it is
contemplated that the treatment with a nanoemulsion/virus
composition resulted in the development of immunity to the
influenza virus.
[0115] Therefore, in one illustrative example (Example 13) antibody
titers to influenza virus in the serum of exposed animals were
investigated. It was found that animals receiving emulsion and
virus had high titers of virus-specific antibody (FIG. 6). This
immune response was not observed in control animals exposed to
virus without pretreatment.
[0116] Experiments were conducted to investigate whether
administration of emulsion and virus would yield protective
immunity without toxicity (Example 13). A mixture of virus
(LD.sub.80; 5.times.10.sup.4 pfu) with the nanoemulsion was
administered to animals on two occasions, two weeks apart. As
controls, animals were given either an equal amount of
formalin-killed virus, nanoemulsion alone or saline. The results of
these studies demonstrated that only the emulsion/virus mixture
elicited significant antibody response when applied to the nares of
animals. The titers were extremely high and included both serum IgG
and bronchial IgA responses that were specific for the virus (FIGS.
7 and 8). More importantly, in two repeated experiments, complete
protection from death was observed in the emulsion/virus
pretreatment group (Table 25). None of the 15 animals died from
exposure to a LD.sub.80 of virus after two administrations of
5.times.10.sup.4 pfu of virus mixed in nanoemulsion, whereas the
expected 80% of control animals died from this exposure. The same
dose of formalin killed virus applied to the nares provided no
protection from death and resulted in much lower titers of
virus-specific antibody (FIGS. 7 and 8).
[0117] Experiments were also conducted to investigate the
possibility that a small amount of residual, live virus in the
nanoemulsion was producing a subclinical infection that provided
immunity (Example 13). An additional group of animals were given
approximately 100 pfu of live virus intranasally in an attempt to
induce a low-level infection (approximately four times the amount
of live virus present after 15 minutes of treatment with
nanoemulsion). While there was a slight reduction in death rates of
these animals, suggesting a sub-clinical infection, the amount of
protection observed was significantly less than what was seen in
the emulsion treated group and none of these animals developed
virus-specific antibodies (Table 25). This documented that it was
not merely a sub-lethal viral infection mediating the immune
response but that the emulsion was specifically enhancing the
virus-specific immune response. The protective immunity was
obtained following only two applications of the emulsion/virus mix,
and appeared to increase after each application suggesting a
booster effect. Virus-specific antibody titers were maintained for
six weeks following administration of the emulsion/virus mix.
[0118] Illustrative Example 15 demonstrates the ability of
intranasaly administered influenza virus/nanoemulsion was able to
induce immunity in mice against further challenge with live
virus.
[0119] The present invention is not limited to the intranasal
administration of vaccine compounds. Parenteral methods of
administration are also contemplated. For example, illustrative
example 16 demonstrates that parenteral administration of HIV gp120
protein/nanoemulsion induced an immune response in mice. The
present invention is also not limited to the use of vaccines
comprising whole pathogens. The use of pathogen products (e.g.,
including, but not limited to, proteins, polypeptides, peptides,
nucleic acids, membrane fractions, and polysaccharides) is
contemplated. Illustrative example 16 demonstrates the generation
of an immune response against HIV gp120 protein.
[0120] B. Pathogens
[0121] The present invention is not limited to the use of any one
specific type of pathogen. Indeed, vaccines to a variety of
pathogens are within the scope of the present invention.
Accordingly, in some embodiments, the present invention provides
vaccines to bacterial pathogens in vegetative or spore forms (e.g.,
including, but not limited to, Bacillus cereus, Bacillus circulans
and Bacillus megaterium, Bacillus anthracis, Clostridium
perfringens, Vibrio cholerae, Streptococcus pyogenes, Streptococcus
agalactiae, Streptococcus pneumonia, Staphylococcus aureus,
Neisseria gonorrhea, Haemophilus influenzae, Escherichia coli,
Salmonella typhimurium, Shigella dysenteriae, Proteus mirabilis,
Pseudomonas aeruginosa, Yersinia enterocolitica, and Yersinia
pseudotuberculosis). In other embodiments, the present invention
provides vaccines to viral pathogens (e.g., including, but not
limited to, influenza A, herpes simplex virus I, herpes simplex
virus II, sendai, sindbis, vaccinia, parvovirus, human
immunodeficiency virus, hepatitis B, virus hepatitis C virus,
hepatitis A virus, cytomegalovirus, and human papilloma virus,
picornavirus, hantavirus, junin virus, and ebola virus). In still
further embodiments, the present invention provides vaccines to
fungal pathogens, including, but not limited to, Candida albicans
and parapsilosis, Aspergillus fumigatus and niger, Fusarium spp,
Trychophyton spp.
[0122] Bacteria for use in formulating the vaccines of the present
invention can be obtained from commercial sources, including, but
not limited to, American Type Culture Collection (ATCC). In some
embodiments, bacteria are passed in animals prior to being mixed
with nanoemulsions in order to enhance their pathogenicity for each
specific animal host for 5-10 passages (Sinai et al., J. Infect.
Dis., 141:193 [1980]). In some embodiments, the bacteria then are
then isolated from the host animals, expanded in culture and stored
at -80.degree. C. Just before use, the bacteria are thawed and
grown on an appropriate solid bacterial culture medium overnight.
The next day, the bacteria are collected from the agar plate and
suspended in a suitable liquid solution (e.g., Brain Heart Infusion
(BHI) broth). The concentration of bacteria is adjusted so that the
bacteria count is approximately 1.5.times.10.sup.8 colony forming
units per ml (CFU/ml), based on the McFarland standard for
bactericidal testing (Hendrichson and Krenz, 1991).
[0123] Viruses for use in formulating the vaccines of the present
invention can be obtained from commercial sources, including, but
not limited, ATCC. In some embodiments, viruses are passed in the
prospective animal model for 5-10 times to enhance pathogenicity
for each specific animal (Ginsberg and Johnson, Infect. Immun.,
13:1221 [1976]). In some embodiments, the virus is collected and
propagated in tissue culture and then purified using density
gradient concentration and ultracentrifugation (Garlinghouse et
al., Lab Anim Sci., 37:437 [1987]; and Mahy, Br. Med. Bull., 41:50
[1985]). The Plaque Forming Units (PFU) are calculated in the
appropriate tissue culture cells.
[0124] Lethal dose and/or infectious dose for each pathogen can be
calculated using any suitable method, including, but not limited
to, by administering different doses of the pathogens to the
animals by the infective route and identifying the doses which
result in the expected result of either animal sickness or death
based on previous publications (Fortier et al., Infect Immun.,
59:2922 [1991]; Jacoby, Exp Gerontol., 29:89 [1994]; and Salit et
al., Can J Microbiol., 30:1022 [1984]).
[0125] C. Nanoemulsions
[0126] The nanoemulsion vaccine compositions of the present
invention are not limited to any particular nanoemulsion. Any
number of suitable nanoemulsion compositions may be utilized in the
vaccine compositions of the present invention, including, but not
limited to, those disclosed in Hamouda et al., J. Infect Dis.,
180:1939 [1999]; Hamouda and Baker, J. Appl. Microbiol., 89:397
[2000]; and Donovan et al., Antivir. Chem. Chemother., 11:41
[2000], as well as those shown in Tables 1 and 2 and FIGS. 4 and 9.
Preferred nanoemulsions of the present invention are those that are
effective in killing or inactivating pathogens and that are
non-toxic to animals. Accordingly, preferred emulsion formulations
utilize non-toxic solvents, such as ethanol, and achieve more
effective killing at lower concentrations of emulsion. In preferred
embodiments, nanoemulsions utilized in the methods of the present
invention are stable, and do not decompose even after long storage
periods (e.g., one or more years). Additionally, preferred
emulsions maintain stability even after exposure to high
temperature and freezing. This is especially useful if they are to
be applied in extreme conditions (e.g., on a battlefield). In some
embodiments, one of the nanoemulsions described in Table 1 and or
FIG. 4 or 9 is utilized.
[0127] In some preferred embodiments, the emulsions comprise (i) an
aqueous phase; (ii) an oil phase; and at least one additional
compound. In some embodiments of the present invention, these
additional compounds are admixed into either the aqueous or oil
phases of the composition. In other embodiments, these additional
compounds are admixed into a composition of previously emulsified
oil and aqueous phases. In certain of these embodiments, one or
more additional compounds are admixed into an existing emulsion
composition immediately prior to its use. In other embodiments, one
or more additional compounds are admixed into an existing emulsion
composition prior to the compositions immediate use.
[0128] Additional compounds suitable for use in the compositions of
the present invention include but are not limited to one or more,
organic, and more particularly, organic phosphate based solvents,
surfactants and detergents, quaternary ammonium containing
compounds, cationic halogen containing compounds, germination
enhancers, interaction enhancers, and pharmaceutically acceptable
compounds. Certain exemplary embodiments of the various compounds
contemplated for use in the compositions of the present invention
are presented below.
TABLE-US-00001 TABLE 1 Nanoemulsion Formulations Water to Oil Phase
Ratio Name Oil Phase Formula (Vol/Vol) X8P 1 vol.
Tri(N-butyl)phosphate 4:1 1 vol. TRITON X-100 8 vol. Soybean oil NN
86.5 g Glycerol monooleate 3:1 60.1 ml Nonoxynol-9 24.2 g GENEROL
122 3.27 g Cetylpyridinium chloride 554 g Soybean oil W.sub.808P
86.5 g Glycerol monooleate 3.2:1 21.2 g Polysorbate 60 24.2 g
GENEROL 122 3.27 g Cetylpyddinium chloride 4 ml Peppermint oil 554
g Soybean oil SS 86.5 g Glycerol monooleate 3.2:1 21.2 g
Polysorbate 60 (1% bismuth in water) 24.2 g GENEROL 122 3.27 g
Cetylpyridinium chloride 554 g Soybean oil
TABLE-US-00002 TABLE 2 Nanoemulsion Formulations Nanoemulsion
Composition X8P 8% TRITON X-100; 8% Tributyl phosphate; 64% Soybean
oil; 20% Water W.sub.205EC 5% TWEEN 20; 8% Ethanol; 1%
Cetylpyridinium Chloride; 64% Soybean oil; 22% Water EC 1%
Cetylpyridinium Chloride; 8% Ethanol; 64% Soybean oil; 27% Water
Y3EC 3% TYLOXAPOL; 1% Cetylpyridinium Chloride; 8% Ethanol; 64%
Soybean oil; 24% Water X4E 4% TRITON X-100; 8% Ethanol; 64% Soybean
oil; 24% Water
[0129] Some embodiments of the present invention employ an oil
phase containing ethanol. For example, in some embodiments, the
emulsions of the present invention contain (i) an aqueous phase and
(ii) an oil phase containing ethanol as the organic solvent and
optionally a germination enhancer, and (iii) TYLOXAPOL as the
surfactant (preferably 2-5%, more preferably 3%). This formulation
is highly efficacious against microbes and is also non-irritating
and non-toxic to mammalian users (and can thus be contacted with
mucosal membranes).
[0130] In some other embodiments, the emulsions of the present
invention comprise a first emulsion emulsified within a second
emulsion, wherein (a) the first emulsion comprises (i) an aqueous
phase; and (ii) an oil phase comprising an oil and an organic
solvent; and (iii) a surfactant; and (b) the second emulsion
comprises (i) an aqueous phase; and (ii) an oil phase comprising an
oil and a cationic containing compound; and (iii) a surfactant.
[0131] The following description provides a number of exemplary
emulsions including formulations for compositions X8P and
X.sub.8W.sub.60PC. X8P comprises a water-in oil nanoemulsion, in
which the oil phase was made from soybean oil, tri-n-butyl
phosphate, and TRITON X-100 in 80% water. X.sub.8W.sub.60PC
comprises a mixture of equal volumes of X8P with W.sub.808P.
W.sub.808P is a liposome-like compound made of glycerol
monostearate, refined soya sterols (e.g., GENEROL sterols), TWEEN
60, soybean oil, a cationic ion halogen-containing CPC and
peppermint oil. The GENEROL family are a group of a polyethoxylated
soya sterols (Henkel Corporation, Ambler, Pa.). Emulsion
formulations are given in Table 1 for certain embodiments of the
present invention. These particular formulations may be found in
U.S. Pat. Nos. 5,700,679 (NN); 5,618,840; 5,549,901 (W.sub.808P);
and 5,547,677, herein incorporated by reference in their
entireties.
[0132] The X8W.sub.60PC emulsion is manufactured by first making
the W.sub.808P emulsion and X8P emulsions separately. A mixture of
these two emulsions is then re-emulsified to produce a fresh
emulsion composition termed X8W.sub.60PC. Methods of producing such
emulsions are described in U.S. Pat. Nos. 5,103,497 and 4,895,452
(herein incorporated by reference in their entireties). These
compounds have broad-spectrum antimicrobial activity, and are able
to inactivate vegetative bacteria through membrane disruption.
[0133] The compositions listed above are only exemplary and those
of skill in the art will be able to alter the amounts of the
components to arrive at a nanoemulsion composition suitable for the
purposes of the present invention. Those skilled in the art will
understand that the ratio of oil phase to water as well as the
individual oil carrier, surfactant CPC and organic phosphate
buffer, components of each composition may vary.
[0134] Although certain compositions comprising X8P have a water to
oil ratio of 4:1, it is understood that the X8P may be formulated
to have more or less of a water phase. For example, in some
embodiments, there is 3, 4, 5, 6, 7, 8, 9, 10, or more parts of the
water phase to each part of the oil phase. The same holds true for
the W.sub.808P formulation. Similarly, the ratio of
Tri(N-butyl)phosphate:TRITON X-100:soybean oil also may be
varied.
[0135] Although Table 1 lists specific amounts of glycerol
monooleate, polysorbate 60, GENEROL 122, cetylpyridinium chloride,
and carrier oil for W.sub.808P, these are merely exemplary. An
emulsion that has the properties of W.sub.808P may be formulated
that has different concentrations of each of these components or
indeed different components that will fulfill the same function.
For example, the emulsion may have between about 80 to about 100 g
of glycerol monooleate in the initial oil phase. In other
embodiments, the emulsion may have between about 15 to about 30 g
polysorbate 60 in the initial oil phase. In yet another embodiment
the composition may comprise between about 20 to about 30 g of a
GENEROL sterol, in the initial oil phase.
[0136] The nanoemulsions structure of the certain embodiments of
the emulsions of the present invention may play a role in their
biocidal activity as well as contributing to the non-toxicity of
these emulsions. For example, the active component in X8P,
TRITON-X100 shows less biocidal activity against virus at
concentrations equivalent to 11% X8P. Adding the oil phase to the
detergent and solvent markedly reduces the toxicity of these agents
in tissue culture at the same concentrations. While not being bound
to any theory (an understanding of the mechanism is not necessary
to practice the present invention, and the present invention is not
limited to any particular mechanism), it is suggested that the
nanoemulsion enhances the interaction of its components with the
pathogens thereby facilitating the inactivation of the pathogen and
reducing the toxicity of the individual components. It should be
noted that when all the components of X8P are combined in one
composition but are not in a nanoemulsion structure, the mixture is
not as effective as an antimicrobial as when the components are in
a nanoemulsion structure.
[0137] Numerous additional embodiments presented in classes of
formulations with like compositions are presented below. The effect
of a number of these compositions as antipathogenic materials is
provided in FIG. 9. The following compositions recite various
ratios and mixtures of active components. One skilled in the art
will appreciate that the below recited formulation are exemplary
and that additional formulations comprising similar percent ranges
of the recited components are within the scope of the present
invention.
[0138] In certain embodiments of the present invention, the
inventive formulation comprise from about 3 to 8 vol. % of
TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of
cetylpyridinium chloride (CPC), about 60 to 70 vol. % oil (e.g.,
soybean oil), about 15 to 25 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS), and in some formulations less than about 1 vol.
% of 1N NaOH. Some of these embodiments comprise PBS. It is
contemplated that the addition of 1N NaOH and/or PBS in some of
these embodiments, allows the user to advantageously control the pH
of the formulations, such that pH ranges from about 4.0 to about
10.0, and more preferably from about 7.1 to 8.5 are achieved. For
example, one embodiment of the present invention comprises about 3
vol. % of TYLOXAPOL, about 8 vol. % of ethanol, about 1 vol. % of
CPC, about 64 vol. % of soybean oil, and about 24 vol. % of
DiH.sub.2O (designated herein as Y3EC). Another similar embodiment
comprises about 3.5 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
and about 1 vol. % of CPC, about 64 vol. % of soybean oil, and
about 23.5 vol. % of DiH.sub.2O (designated herein as Y3.5EC). Yet
another embodiment comprises about 3 vol. % of TYLOXAPOL, about 8
vol. % of ethanol, about 1 vol. % of CPC, about 0.067 vol. % of 1N
NaOH, such that the pH of the formulation is about 7.1, about 64
vol. % of soybean oil, and about 23.93 vol. % of DiH.sub.2O
(designated herein as Y3EC pH 7.1). Still another embodiment
comprises about 3 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
about 1 vol. % of CPC, about 0.67 vol. % of 1N NaOH, such that the
pH of the formulation is about 8.5, and about 64 vol. % of soybean
oil, and about 23.33 vol. % of DiH.sub.2O (designated herein as
Y3EC pH 8.5). Another similar embodiment comprises about 4%
TYLOXAPOL, about 8 vol. % ethanol, about 1% CPC, and about 64 vol.
% of soybean oil, and about 23 vol. % of DiH.sub.2O (designated
herein as Y4EC). In still another embodiment the formulation
comprises about 8% TYLOXAPOL, about 8% ethanol, about 1 vol. % of
CPC, and about 64 vol. % of soybean oil, and about 19 vol. % of
DiH.sub.2O (designated herein as Y8EC). A further embodiment
comprises about 8 vol. % of TYLOXAPOL, about 8 vol. % of ethanol,
about 1 vol. % of CPC, about 64 vol. % of soybean oil, and about 19
vol. % of 1.times.PBS (designated herein as Y8EC PBS).
[0139] In some embodiments of the present invention, the inventive
formulations comprise about 8 vol. % of ethanol, and about 1 vol. %
of CPC, and about 64 vol. % of oil (e.g., soybean oil), and about
27 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS) (designated
herein as EC).
[0140] In the present invention, some embodiments comprise from
about 8 vol. % of sodium dodecyl sulfate (SDS), about 8 vol. % of
tributyl phosphate (TBP), and about 64 vol. % of oil (e.g., soybean
oil), and about 20 vol. % of aqueous phase (e.g., DiH.sub.2O or
PBS) (designated herein as S8P).
[0141] In certain embodiments of the present invention, the
inventive formulation comprise from about 1 to 2 vol. % of TRITON
X-100, from about 1 to 2 vol. % of TYLOXAPOL, from about 7 to 8
vol. % of ethanol, about 1 vol. % of cetylpyridinium chloride
(CPC), about 64 to 57.6 vol. % of oil (e.g., soybean oil), and
about 23 vol. % of aqueous phase (e.g., DiH.sub.2O or PBS).
Additionally, some of these formulations further comprise about 5
mM of L-alanine/Inosine, and about 10 mM ammonium chloride. Some of
these formulations comprise PBS. It is contemplated that the
addition of PBS in some of these embodiments, allows the user to
advantageously control the pH of the formulations. For example, one
embodiment of the present invention comprises about 2 vol. % of
TRITON X-100, about 2 vol. % of TYLOXAPOL, about 8 vol. % of
ethanol, about 1 vol. % CPC, about 64 vol. % of soybean oil, and
about 23 vol. % of aqueous phase DiH.sub.2O. In another embodiment
the formulation comprises about 1.8 vol. % of TRITON X-100, about
1.8 vol. % of TYLOXAPOL, about 7.2 vol. % of ethanol, about 0.9
vol. % of CPC, about 5 mM L-alanine/Inosine, and about 10 mM
ammonium chloride, about 57.6 vol. % of soybean oil, and the
remainder of 1.times.PBS (designated herein as 90% X2Y2EC/GE).
[0142] In alternative embodiments of the present invention, the
formulations comprise from about 5 vol. % of TWEEN 80, from about 8
vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of
oil (e.g., soybean oil), and about 22 vol. % of DiH.sub.2O
(designated herein as W.sub.805EC).
[0143] In still other embodiments of the present invention, the
formulations comprise from about 5 vol. % of TWEEN 20, from about 8
vol. % of ethanol, from about 1 vol. % of CPC, about 64 vol. % of
oil (e.g., soybean oil), and about 22 vol. % of DiH.sub.2O
(designated herein as W.sub.205EC).
[0144] In still other embodiments of the present invention, the
formulations comprise from about 2 to 8 vol. % of TRITON X-100,
about 8 vol. % of ethanol, about 1 vol. % of CPC, about 60 to 70
vol. % of oil (e.g., soybean, or olive oil), and about 15 to 25
vol. % of aqueous phase (e.g., DiH.sub.2O or PBS). For example, the
present invention contemplates formulations comprising about 2 vol.
% of TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of
soybean oil, and about 26 vol. % of DiH.sub.2O (designated herein
as X2E). In other similar embodiments, the formulations comprise
about 3 vol. % of TRITON X-100, about 8 vol. % of ethanol, about 64
vol. % of soybean oil, and about 25 vol. % of DiH.sub.2O
(designated herein as X3E). In still further embodiments, the
formulations comprise about 4 vol. % TRITON X-100, about 8 vol. %
of ethanol, about 64 vol. % of soybean oil, and about 24 vol. % of
DiH.sub.2O (designated herein as X4E). In yet other embodiments,
the formulations comprise about 5 vol. % of TRITON X-100, about 8
vol. % of ethanol, about 64 vol. % of soybean oil, and about 23
vol. % of DiH.sub.2O (designated herein as X5E). Another embodiment
of the present invention comprises about 6 vol. % of TRITON X-100,
about 8 vol. % of ethanol, about 64 vol. % of soybean oil, and
about 22 vol. % of DiH.sub.2O (designated herein as X6E). In still
further embodiments of the present invention, the formulations
comprise about 8 vol. % of TRITON X-100, about 8 vol. % of ethanol,
about 64 vol. % of soybean oil, and about 20 vol. % of DiH.sub.2O
(designated herein as X8E). In still further embodiments of the
present invention, the formulations comprise about 8 vol. % of
TRITON X-100, about 8 vol. % of ethanol, about 64 vol. % of olive
oil, and about 20 vol. % of DiH.sub.2O (designated herein as X8E
O). In yet another embodiment comprises 8 vol. % of TRITON X-100,
about 8 vol. % ethanol, about 1 vol. % CPC, about 64 vol. % of
soybean oil, and about 19 vol. % of DiH.sub.2O (designated herein
as X8EC).
[0145] In alternative embodiments of the present invention, the
formulations comprise from about 1 to 2 vol. % of TRITON X-100,
from about 1 to 2 vol. % of TYLOXAPOL, from about 6 to 8 vol. %
TBP, from about 0.5 to 1.0 vol. % of CPC, from about 60 to 70 vol.
% of oil (e.g., soybean), and about 1 to 35 vol. % of aqueous phase
(e.g., DiH.sub.2O or PBS). Additionally, certain of these
formulations may comprise from about 1 to 5 vol. % of trypticase
soy broth, from about 0.5 to 1.5 vol. % of yeast extract, about 5
mM L-alanine/Inosine, about 10 mM ammonium chloride, and from about
20-40 vol. % of liquid baby formula. In some of the embodiments
comprising liquid baby formula, the formula comprises a casein
hydrolysate (e.g., Neutramigen, or Progestimil, and the like). In
some of these embodiments, the inventive formulations further
comprise from about 0.1 to 1.0 vol. % of sodium thiosulfate, and
from about 0.1 to 1.0 vol. % of sodium citrate. Other similar
embodiments comprising these basic components employ phosphate
buffered saline (PBS) as the aqueous phase. For example, one
embodiment comprises about 2 vol. % of TRITON X-100, about 2 vol. %
TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 64 vol.
% of soybean oil, and about 23 vol. % of DiH.sub.2O (designated
herein as X2Y2EC). In still other embodiments, the inventive
formulation comprises about 2 vol. % of TRITON X-100, about 2 vol.
% TYLOXAPOL, about 8 vol. % TBP, about 1 vol. % of CPC, about 0.9
vol. % of sodium thiosulfate, about 0.1 vol. % of sodium citrate,
about 64 vol. % of soybean oil, and about 22 vol. % of DiH.sub.2O
(designated herein as X2Y2PC STS1). In another similar embodiment,
the formulations comprise about 1.7 vol. % TRITON X-100, about 1.7
vol. % TYLOXAPOL, about 6.8 vol. % TBP, about 0.85% CPC, about
29.2% NEUTRAMIGEN, about 54.4 vol. % of soybean oil, and about 4.9
vol. % of DiH.sub.2O (designated herein as 85% X2Y2PC/baby). In yet
another embodiment of the present invention, the formulations
comprise about 1.8 vol. % of TRITON X-100, about 1.8 vol. % of
TYLOXAPOL, about 7.2 vol. % of TBP, about 0.9 vol. % of CPC, about
5 mM L-alanine/Inosine, about 10 mM ammonium chloride, about 57.6
vol. % of soybean oil, and the remainder vol. % of 0.1.times.PBS
(designated herein as 90% X2Y2 PC/GE). In still another embodiment,
the formulations comprise about 1.8 vol. % of TRITON X-100, about
1.8 vol. % of TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % of
CPC, and about 3 vol. % trypticase soy broth, about 57.6 vol. % of
soybean oil, and about 27.7 vol. % of DiH.sub.2O (designated herein
as 90% X2Y2PC/TSB). In another embodiment of the present invention,
the formulations comprise about 1.8 vol. % TRITON X-100, about 1.8
vol. % TYLOXAPOL, about 7.2 vol. % TBP, about 0.9 vol. % CPC, about
1 vol. % yeast extract, about 57.6 vol. % of soybean oil, and about
29.7 vol. % of DiH.sub.2O (designated herein as 90% X2Y2PC/YE).
[0146] In some embodiments of the present invention, the inventive
formulations comprise about 3 vol. % of TYLOXAPOL, about 8 vol. %
of TBP, and about 1 vol. % of CPC, about 60 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). In a particular embodiment of the
present invention, the inventive formulations comprise about 3 vol.
% of TYLOXAPOL, about 8 vol. % of TBP, and about 1 vol. % of CPC,
about 64 vol. % of soybean, and about 24 vol. % of DiH.sub.2O
(designated herein as Y3PC).
[0147] In some embodiments of the present invention, the inventive
formulations comprise from about 4 to 8 vol. % of TRITON X-100,
from about 5 to 8 vol. % of TBP, about 30 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 0 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). Additionally, certain of these
embodiments further comprise about 1 vol. % of CPC, about 1 vol. %
of benzalkonium chloride, about 1 vol. % cetylyridinium bromide,
about 1 vol. % cetyldimethyletylammonium bromide, 500 .mu.M EDTA,
about 10 mM ammonium chloride, about 5 mM Inosine, and about 5 mM
L-alanine. For example, in certain of these embodiments, the
inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about 20
vol. % of DiH.sub.2O (designated herein as X8P). In another
embodiment of the present invention, the inventive formulations
comprise about 8 vol. % of TRITON X-100, about 8 vol. % of TBP,
about 1% of CPC, about 64 vol. % of soybean oil, and about 19 vol.
% of DiH.sub.2O (designated herein as X8PC). In still another
embodiment, the formulations comprise about 8 vol. % TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of CPC, about 50 vol. % of
soybean oil, and about 33 vol. % of DiH.sub.2O (designated herein
as ATB-X1001). In yet another embodiment, the formulations comprise
about 8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol.
% of CPC, about 50 vol. % of soybean oil, and about 32 vol. % of
DiH.sub.2O (designated herein as ATB-X002). Another embodiment of
the present invention comprises about 4 vol. % TRITON X-100, about
4 vol. % of TBP, about 0.5 vol. % of CPC, about 32 vol. % of
soybean oil, and about 59.5 vol. % of DiH.sub.2O (designated herein
as 50% X8PC). Still another related embodiment comprises about 8
vol. % of TRITON X-100, about 8 vol. % of TBP, about 0.5 vol. %
CPC, about 64 vol. % of soybean oil, and about 19.5 vol. % of
DiH.sub.2O (designated herein as X8PC.sub.1/2). In some embodiments
of the present invention, the inventive formulations comprise about
8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 2 vol. % of
CPC, about 64 vol. % of soybean oil, and about 18 vol. % of
DiH.sub.2O (designated herein as X8PC2). In other embodiments, the
inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8% of TBP, about 1% of benzalkonium chloride, about 50 vol. %
of soybean oil, and about 33 vol. % of DiH.sub.2O (designated
herein as X8P BC). In an alternative embodiment of the present
invention, the formulation comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of cetylyridinium bromide,
about 50 vol. % of soybean oil, and about 33 vol. % of DiH.sub.2O
(designated herein as X8P CPB). In another exemplary embodiment of
the present invention, the formulations comprise about 8 vol. % of
TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of
cetyldimethyletylammonium bromide, about 50 vol. % of soybean oil,
and about 33 vol. % of DiH.sub.2O (designated herein as X8P CTAB).
In still further embodiments, the present invention comprises about
8 vol. % of TRITON X-100, about 8 vol. % of TBP, about 1 vol. % of
CPC, about 500 .mu.M EDTA, about 64 vol. % of soybean oil, and
about 15.8 vol. % DiH.sub.2O (designated herein as X8PC EDTA).
Additional similar embodiments comprise 8 vol. % of TRITON X-100,
about 8 vol. % of TBP, about 1 vol. % of CPC, about 10 mM ammonium
chloride, about 5 mM Inosine, about 5 mM L-alanine, about 64 vol. %
of soybean oil, and about 19 vol. % of DiH.sub.2O or PBS
(designated herein as X8PC GE.sub.1x). In another embodiment of the
present invention, the inventive formulations further comprise
about 5 vol. % of TRITON X-100, about 5% of TBP, about 1 vol. % of
CPC, about 40 vol. % of soybean oil, and about 49 vol. % of
DiH.sub.2O (designated herein as X5P.sub.5C).
[0148] In some embodiments of the present invention, the inventive
formulations comprise about 2 vol. % TRITON X-100, about 6 vol. %
TYLOXAPOL, about 8 vol. % ethanol, about 64 vol. % of soybean oil,
and about 20 vol. % of DiH.sub.2O (designated herein as X2Y6E).
[0149] In an additional embodiment of the present invention, the
formulations comprise about 8 vol. % of TRITON X-100, and about 8
vol. % of glycerol, about 60 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 15 to 25 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Certain related embodiments further comprise
about 1 vol. % L-ascorbic acid. For example, one particular
embodiment comprises about 8 vol. % of TRITON X-100, about 8 vol. %
of glycerol, about 64 vol. % of soybean oil, and about 20 vol. % of
DiH.sub.2O (designated herein as X8G). In still another embodiment,
the inventive formulations comprise about 8 vol. % of TRITON X-100,
about 8 vol. % of glycerol, about 1 vol. % of L-ascorbic acid,
about 64 vol. % of soybean oil, and about 19 vol. % of DiH.sub.2O
(designated herein as X8GV.sub.C).
[0150] In still further embodiments, the inventive formulations
comprise about 8 vol. % of TRITON X-100, from about 0.5 to 0.8 vol.
% of TWEEN 60, from about 0.5 to 2.0 vol. % of CPC, about 8 vol. %
of TBP, about 60 to 70 vol. % of oil (e.g., soybean or olive oil),
and about 15 to 25 vol. % of aqueous phase (e.g., DiH.sub.2O or
PBS). For example, in one particular embodiment the formulations
comprise about 8 vol. % of TRITON X-100, about 0.70 vol. % of TWEEN
60, about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. %
of soybean oil, and about 18.3 vol. % of DiH.sub.2O (designated
herein as X8W60PC.sub.1). Another related embodiment comprises
about 8 vol. % of TRITON X-100, about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 18.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7X8PC). In yet other embodiments, the inventive
formulations comprise from about 8 vol. % of TRITON X-100, about
0.7 vol. % of TWEEN 60, about 0.5 vol. % of CPC, about 8 vol. % of
TBP, about 64 to 70 vol. % of soybean oil, and about 18.8 vol. % of
DiH.sub.2O (designated herein as X8W60PC.sub.2). In still other
embodiments, the present invention comprises about 8 vol. % of
TRITON X-100, about 0.71 vol. % of TWEEN 60, about 2 vol. % of CPC,
about 8 vol. % of TBP, about 64 vol. % of soybean oil, and about
17.3 vol. % of DiH.sub.2O. In another embodiment of the present
invention, the formulations comprise about 0.71 vol. % of TWEEN 60,
about 1 vol. % of CPC, about 8 vol. % of TBP, about 64 vol. % of
soybean oil, and about 25.29 vol. % of DiH.sub.2O (designated
herein as W60.sub.0.7PC).
[0151] In another embodiment of the present invention, the
inventive formulations comprise about 2 vol. % of dioctyl
sulfosuccinate, either about 8 vol. % of glycerol, or about 8 vol.
% TBP, in addition to, about 60 to 70 vol. % of oil (e.g., soybean
or olive oil), and about 20 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). For example, one embodiment of the present
invention comprises about 2 vol. % of dioctyl sulfosuccinate, about
8 vol. % of glycerol, about 64 vol. % of soybean oil, and about 26
vol. % of DiH.sub.2O (designated herein as D2G). In another related
embodiment, the inventive formulations comprise about 2 vol. % of
dioctyl sulfosuccinate, and about 8 vol. % of TBP, about 64 vol. %
of soybean oil, and about 26 vol. % of D1H.sub.2O (designated
herein as D2P).
[0152] In still other embodiments of the present invention, the
inventive formulations comprise about 8 to 10 vol. % of glycerol,
and about 1 to 10 vol. % of CPC, about 50 to 70 vol. % of oil
(e.g., soybean or olive oil), and about 15 to 30 vol. % of aqueous
phase (e.g., DiH.sub.2O or PBS). Additionally, in certain of these
embodiments, the compositions further comprise about 1 vol. % of
L-ascorbic acid. For example, one particular embodiment comprises
about 8 vol. % of glycerol, about 1 vol. % of CPC, about 64 vol. %
of soybean oil, and about 27 vol. % of DiH.sub.2O (designated
herein as GC). An additional related embodiment comprises about 10
vol. % of glycerol, about 10 vol. % of CPC, about 60 vol. % of
soybean oil, and about 20 vol. % of DiH.sub.2O (designated herein
as GC10). In still another embodiment of the present invention, the
inventive formulations comprise about 10 vol. % of glycerol, about
1 vol. % of CPC, about 1 vol. % of L-ascorbic acid, about 64 vol. %
of soybean or oil, and about 24 vol. % of DiH.sub.2O (designated
herein as GCV.sub.C).
[0153] In some embodiments of the present invention, the inventive
formulations comprise about 8 to 10 vol. % of glycerol, about 8 to
10 vol. % of SDS, about 50 to 70 vol. % of oil (e.g., soybean or
olive oil), and about 15 to 30 vol. % of aqueous phase (e.g.,
DiH.sub.2O or PBS). Additionally, in certain of these embodiments,
the compositions further comprise about 1 vol. % of lecithin, and
about 1 vol. % of p-Hydroxybenzoic acid methyl ester. Exemplary
embodiments of such formulations comprise about 8 vol. % SDS, 8
vol. % of glycerol, about 64 vol. % of soybean oil, and about 20
vol. % of DiH.sub.2O (designated herein as S8G). A related
formulation comprises about 8 vol. % of glycerol, about 8 vol. % of
SDS, about 1 vol. % of lecithin, about 1 vol. % of p-Hydroxybenzoic
acid methyl ester, about 64 vol. % of soybean oil, and about 18
vol. % of DiH.sub.2O (designated herein as S8GL1B1).
[0154] In yet another embodiment of the present invention, the
inventive formulations comprise about 4 vol. % of TWEEN 80, about 4
vol. % of TYLOXAPOL, about 1 vol. % of CPC, about 8 vol. % of
ethanol, about 64 vol. % of soybean oil, and about 19 vol. % of
DiH.sub.2O (designated herein as W.sub.804Y4EC).
[0155] In some embodiments of the present invention, the inventive
formulations comprise about 0.01 vol. % of CPC, about 0.08 vol. %
of TYLOXAPOL, about 10 vol. % of ethanol, about 70 vol. % of
soybean oil, and about 19.91 vol. % of DiH.sub.2O (designated
herein as Y.08EC.01).
[0156] In yet another embodiment of the present invention, the
inventive formulations comprise about 8 vol. % of sodium lauryl
sulfate, and about 8 vol. % of glycerol, about 64 vol. % of soybean
oil, and about 20 vol. % of DiH.sub.2O (designated herein as
SLS8G).
[0157] The specific formulations described above are simply
examples to illustrate the variety of compositions that find use in
the present invention. The present invention contemplates that many
variations of the above formulation, as well as additional
nanoemulsions, find use in the methods of the present invention. To
determine if a candidate emulsion is suitable for use with the
present invention, three criteria may be analyzed. Using the
methods and standards described herein, candidate emulsions can be
easily tested to determine if they are suitable. First, the desired
ingredients are prepared using the methods described herein, to
determine if an emulsion can be formed. If an emulsion cannot be
formed, the candidate is rejected. For example, a candidate
composition made of 4.5% sodium thiosulfate, 0.5% sodium citrate,
10% n-butanol, 64% soybean oil, and 21% DiH.sub.2O did not form an
emulsion.
[0158] Second, in preferred embodiments, the candidate emulsion
should form a stable emulsion. An emulsion is stable if it remains
in emulsion form for a sufficient period to allow its intended use.
For example, for emulsions that are to be stored, shipped, etc., it
may be desired that the composition remain in emulsion form for
months to years. Typical emulsions that are relatively unstable,
will lose their form within a day. For example, a candidate
composition made of 8% 1-butanol, 5% TWEEN 10, 1% CPC, 64% soybean
oil, and 22% DiH.sub.2O did not form a stable emulsion. The
following candidate emulsions were shown to be stable using the
methods described herein: 0.08% TRITON X-100, 0.08% Glycerol, 0.01%
Cetylpyridinium Chloride, 99% Butter, and 0.83% diH.sub.2O
(designated herein as 1% X8GC Butter); 0.8% TRITON X-100, 0.8%
Glycerol, 0.1% Cetylpyridinium Chloride, 6.4% Soybean Oil, 1.9%
diH.sub.2O, and 90% Butter (designated herein as 10% X8GC Butter);
2% W.sub.205EC, 1% Natrosol 250L NF, and 97% diH.sub.2O (designated
herein as 2% W.sub.205EC L GEL); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% 70 Viscosity Mineral Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC 70 Mineral Oil); 1%
Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% 350
Viscosity Mineral Oil, and 22% diH.sub.2O (designated herein as
W.sub.205EC 350 Mineral Oil).
[0159] Third, the candidate emulsion should have efficacy for its
intended use. For example, an anti-bacterial emulsion should kill
or disable pathogens to a detectable level. As shown herein,
certain emulsions of the present invention have efficacy against
specific microorganisms, but not against others. Using the methods
described herein, one is capable of determining the suitability of
a particular candidate emulsion against the desired microorganism.
Generally, this involves exposing the microorganism to the emulsion
for one or more time periods in a side-by-side experiment with the
appropriate control samples (e.g., a negative control such as
water) and determining if, and to what degree, the emulsion kills
or disables the microorganism. For example, a candidate composition
made of 1% ammonium chloride, 5% TWEEN 20, 8% ethanol, 64% soybean
oil, and 22% DiH.sub.2O was shown not to be an effective emulsion.
The following candidate emulsions were shown to be effective using
the methods described herein: 5% TWEEN 20, 5% Cetylpyridinium
Chloride, 10% Glycerol, 60% Soybean Oil, and 20% diH.sub.2O
(designated herein as W.sub.205GC5); 1% Cetylpyridinium Chloride,
5% TWEEN 20, 10% Glycerol, 64% Soybean Oil, and 20% diH.sub.2O
(designated herein as W.sub.205GC); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% Olive Oil, and 22% diH.sub.2O (designated
herein as W.sub.205EC Olive Oil); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Ethanol, 64% Flaxseed Oil, and 22% diH.sub.2O
(designated herein as W.sub.205EC Flaxseed Oil); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Corn Oil, and 22% diH.sub.2O
(designated herein as W.sub.205EC Corn Oil); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Coconut Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC Coconut Oil); 1%
Cetylpyridinium Chloride, 5% TWEEN 20, 8% Ethanol, 64% Cottonseed
Oil, and 22% diH.sub.2O (designated herein as W.sub.205EC
Cottonseed Oil); 8% Dextrose, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C Dextrose); 8% PEG 200, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C PEG 200); 8% Methanol, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C Methanol); 8% PEG 1000, 5% TWEEN 10, 1% Cetylpyridinium
Chloride, 64% Soybean Oil, and 22% diH.sub.2O (designated herein as
W.sub.205C PEG 1000); 2% W.sub.205EC, 2% Natrosol 250H NF, and 96%
diH.sub.2O (designated herein as 2% W.sub.205EC Natrosol 2, also
called 2% W.sub.205EC GEL); 2% W.sub.205EC, 1% Natrosol 250H NF,
and 97% diH.sub.2O (designated herein as 2% W.sub.205EC Natrosol
1); 2% W.sub.205EC, 3% Natrosol 250H NF, and 95% diH.sub.2O
(designated herein as 2% W.sub.205EC Natrosol 3); 2% W.sub.205EC,
0.5% Natrosol 250H NF, and 97.5% diH.sub.2O (designated herein as
2% W.sub.205EC Natrosol 0.5); 2% W.sub.205EC, 2% Methocel A, and
96% diH.sub.2O (designated herein as 2% W.sub.205EC Methocel A); 2%
W.sub.205EC, 2% Methocel K, and 96% diH.sub.2O (designated herein
as 2% W.sub.205EC Methocel K); 2% Natrosol, 0.1% X8PC,
0.1.times.PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, and diH.sub.2O (designated herein as 0.1% X8PC/GE+2%
Natrosol); 2% Natrosol, 0.8% TRITON X-100, 0.8% Tributyl Phosphate,
6.4% Soybean Oil, 0.1% Cetylpyridinium Chloride, 0.1.times.PBS, 5
mM L-alanine, 5 mM Inosine, 10 mM Ammonium Chloride, and diH.sub.2O
(designated herein as 10% X8PC/GE+2% Natrosol); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Lard, and 22% diH.sub.2O
(designated herein as W.sub.205EC Lard); 1% Cetylpyridinium
Chloride, 5% TWEEN 20, 8% Ethanol, 64% Mineral Oil, and 22%
diH.sub.2O (designated herein as W.sub.205EC Mineral Oil); 0.1%
Cetylpyridinium Chloride, 2% Nerolidol, 5% TWEEN 20, 10% Ethanol,
64% Soybean Oil, and 18.9% diH.sub.2O (designated herein as
W.sub.205EC.sub.0.1N); 0.1% Cetylpyridinium Chloride, 2% Farnesol,
5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 18.9% diH.sub.2O
(designated herein as W.sub.205EC.sub.0.1F); 0.1% Cetylpyridinium
Chloride, 5% TWEEN 20, 10% Ethanol, 64% Soybean Oil, and 20.9%
diH.sub.2O (designated herein as W.sub.205EC.sub.0.1); 10%
Cetylpyridinium Chloride, 8% Tributyl Phosphate, 8% TRITON X-100,
54% Soybean Oil, and 20% diH.sub.2O (designated herein as
X8PC.sub.10); 5% Cetylpyridinium Chloride, 8% TRITON X-100, 8%
Tributyl Phosphate, 59% Soybean Oil, and 20% diH.sub.2O (designated
herein as X8PC.sub.5); 0.02% Cetylpyridinium Chloride, 0.1% TWEEN
20, 10% Ethanol, 70% Soybean Oil, and 19.88% diH.sub.2O (designated
herein as W.sub.200.1EC.sub.0.02); 1% Cetylpyridinium Chloride, 5%
TWEEN 20, 8% Glycerol, 64% Mobil 1, and 22% diH.sub.2O (designated
herein as W.sub.205GC Mobil 1); 7.2% TRITON X-100, 7.2% Tributyl
Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil,
0.1.times.PBS, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, and 25.87% diH.sub.2O (designated herein as 90% X8PC/GE);
7.2% TRITON X-100, 7.2% Tributyl Phosphate, 0.9% Cetylpyridinium
Chloride, 57.6% Soybean Oil, 1% EDTA, 5 mM L-alanine, 5 mM Inosine,
10 mM Ammonium Chloride, 0.1.times.PBS, and diH.sub.2O (designated
herein as 90% X8PC/GE EDTA); and 7.2% TRITON X-100, 7.2% Tributyl
Phosphate, 0.9% Cetylpyridinium Chloride, 57.6% Soybean Oil, 1%
Sodium Thiosulfate, 5 mM L-alanine, 5 mM Inosine, 10 mM Ammonium
Chloride, 0.1.times.PBS, and diH.sub.2O (designated herein as 90%
X8PC/GE STS).
[0160] 1. Aqueous Phase
[0161] In some embodiments, the emulsion comprises an aqueous
phase. In certain preferred embodiments, the emulsion comprises
about 5 to 50, preferably 10 to 40, more preferably 15 to 30, vol.
% aqueous phase, based on the total volume of the emulsion
(although other concentrations are also contemplated). In preferred
embodiments, the aqueous phase comprises water at a pH of about 4
to 10, preferably about 6 to 8. The water is preferably deionized
(hereinafter "DiH.sub.2O"). In some embodiments, the aqueous phase
comprises phosphate buffered saline (PBS). In some preferred
embodiments, the aqueous phase is sterile and pyrogen free.
[0162] 2. Oil Phase
[0163] In some embodiments, the emulsion comprises an oil phase. In
certain preferred embodiments, the oil phase (e.g., carrier oil) of
the emulsion of the present invention comprises 30-90, preferably
60-80, and more preferably 60-70, vol. % of oil, based on the total
volume of the emulsion (although other concentrations are also
contemplated). Suitable oils include, but are not limited to,
soybean oil, avocado oil, squalene oil, squalene oil, olive oil,
canola oil, corn oil, rapeseed oil, safflower oil, sunflower oil,
fish oils, flavor oils, water insoluble vitamins and mixtures
thereof. In particularly preferred embodiments, soybean oil is
used. In preferred embodiments of the present invention, the oil
phase is preferably distributed throughout the aqueous phase as
droplets having a mean particle size in the range from about 1-2
microns, more preferably from 0.2 to 0.8, and most preferably about
0.8 microns. In other embodiments, the aqueous phase can be
distributed in the oil phase.
[0164] In some embodiments, the oil phase comprises 3-15, and
preferably 5-10 vol. % of an organic solvent, based on the total
volume of the emulsion. While the present invention is not limited
to any particular mechanism, it is contemplated that the organic
phosphate-based solvents employed in the emulsions serve to remove
or disrupt the lipids in the membranes of the pathogens. Thus, any
solvent that removes the sterols or phospholipids in the microbial
membranes finds use in the methods of the present invention.
Suitable organic solvents include, but are not limited to, organic
phosphate based solvents or alcohols. In some preferred
embodiments, non-toxic alcohols (e.g., ethanol) are used as a
solvent. The oil phase, and any additional compounds provided in
the oil phase, are preferably sterile and pyrogen free.
[0165] 3. Surfactants and Detergents
[0166] In some embodiments, the emulsions further comprises a
surfactant or detergent. In some preferred embodiments, the
emulsion comprises from about 3 to 15%, and preferably about 10% of
one or more surfactants or detergents (although other
concentrations are also contemplated). While the present invention
is not limited to any particular mechanism, it is contemplated that
surfactants, when present in the emulsions, help to stabilize the
emulsions. Both non-ionic (non-anionic) and ionic surfactants are
contemplated. Additionally, surfactants from the BRIJ family of
surfactants find use in the compositions of the present invention.
The surfactant can be provided in either the aqueous or the oil
phase. Surfactants suitable for use with the emulsions include a
variety of anionic and nonionic surfactants, as well as other
emulsifying compounds that are capable of promoting the formation
of oil-in-water emulsions. In general, emulsifying compounds are
relatively hydrophilic, and blends of emulsifying compounds can be
used to achieve the necessary qualities. In some formulations,
nonionic surfactants have advantages over ionic emulsifiers in that
they are substantially more compatible with a broad pH range and
often form more stable emulsions than do ionic (e.g., soap-type)
emulsifiers. Thus, in certain preferred embodiments, the
compositions of the present invention comprise one or more
non-ionic surfactants such as polysorbate surfactants (e.g.,
polyoxyethylene ethers), polysorbate detergents,
pheoxypolyethoxyethanols, and the like. Examples of polysorbate
detergents useful in the present invention include, but are not
limited to, TWEEN 20, TWEEN 40, TWEEN 60, TWEEN 80, etc.
[0167] TWEEN 60 (polyoxyethylenesorbitan monostearate), together
with TWEEN 20, TWEEN 40 and TWEEN 80, comprise polysorbates that
are used as emulsifiers in a number of pharmaceutical compositions.
In some embodiments of the present invention, these compounds are
also used as co-components with adjuvants. TWEEN surfactants also
appear to have virucidal effects on lipid-enveloped viruses (See
e.g., Eriksson et al., Blood Coagulation and Fibtinolysis 5 (Suppl.
3):S37-S44 [1994]).
[0168] Examples of pheoxypolyethoxyethanols, and polymers thereof,
useful in the present invention include, but are not limited to,
TRITON (e.g., X-100, X-301, X-165, X-102, X-200), and TYLOXAPOL.
TRITON X-100 is a strong non-ionic detergent and dispersing agent
widely used to extract lipids and proteins from biological
structures. It also has virucidal effect against broad spectrum of
enveloped viruses (See e.g., Maha and Igarashi, Southeast Asian J.
Trop. Med. Pub. Health 28:718 [1997]; and Portocala et al.,
Virologie 27:261 [1976]). Due to this anti-viral activity, it is
employed to inactivate viral pathogens in fresh frozen human plasma
(See e.g., Horowitz et al., Blood 79:826 [1992]).
[0169] The present invention is not limited to the surfactants
disclosed herein. Additional surfactants and detergents useful in
the compositions of the present invention may be ascertained from
reference works (e.g., including, but not limited to, McCutheon's
Volume 1: Emulsions and Detergents--North American Edition, 2000)
and commercial sources.
[0170] 4. Cationic Halogens
[0171] In some embodiments, the emulsions further comprise a
cationic halogen containing compound. In some preferred
embodiments, the emulsion comprises from about 0.5 to 1.0 wt. % or
more of a cationic halogen containing compound, based on the total
weight of the emulsion (although other concentrations are also
contemplated). In preferred embodiments, the cationic
halogen-containing compound is preferably premixed with the oil
phase; however, it should be understood that the cationic
halogen-containing compound may be provided in combination with the
emulsion composition in a distinct formulation. Suitable halogen
containing compounds may be selected from compounds comprising
chloride, fluoride, bromide and iodide ions. In preferred
embodiments, suitable cationic halogen containing compounds
include, but are not limited to, cetylpyridinium halides,
cetyltrimethylammonium halides, cetyldimethylethylammonium halides,
cetyldimethylbenzylammonium halides, cetyltributylphosphonium
halides, dodecyltrimethylammonium halides, or
tetradecyltrimethylammonium halides. In some particular
embodiments, suitable cationic halogen containing compounds
comprise, but are not limited to, cetylpyridinium chloride (CPC),
cetyltrimethylammonium chloride, cetylbenzyldimethylammonium
chloride, cetylpyridinium bromide (CPB), and cetyltrimethylammonium
bromide (CTAB), cetyidimethylethylammonium bromide,
cetyltributylphosphonium bromide, dodecyltrimethylammonium bromide,
and tetrad ecyltrimethylammonium bromide. In particularly preferred
embodiments, the cationic halogen-containing compound is CPC,
although the compositions of the present invention are not limited
to formulation with any particular cationic containing
compound.
[0172] 5. Germination Enhancers
[0173] In other embodiments of the present invention, the
nanoemulsions further comprise a germination enhancer. In some
preferred embodiments, the emulsions comprise from about 1 mM to 15
mM, and more preferably from about 5 mM to 10 mM of one or more
germination enhancing compounds (although other concentrations are
also contemplated). In preferred embodiments, the germination
enhancing compound is provided in the aqueous phase prior to
formation of the emulsion. The present invention contemplates that
when germination enhancers are added to the nanoemulsion
compositions, the sporicidal properties of the nanoemulsions are
enhanced. The present invention further contemplates that such
germination enhancers initiate sporicidal activity near neutral pH
(between pH 6-8, and preferably 7). Such neutral pH emulsions can
be obtained, for example, by diluting with phosphate buffer saline
(PBS) or by preparations of neutral emulsions. The sporicidal
activity of the nanoemulsion preferentially occurs when the spores
initiate germination.
[0174] In specific embodiments, it has been demonstrated that the
emulsions utilized in the vaccines of the present invention have
sporicidal activity. While the present invention is not limited to
any particular mechanism and an understanding of the mechanism is
not required to practice the present invention, it is believed that
the fusigenic component of the emulsions acts to initiate
germination and before reversion to the vegetative form is complete
the lysogenic component of the emulsion acts to lyse the newly
germinating spore. These components of the emulsion thus act in
concert to leave the spore susceptible to disruption by the
emulsions. The addition of germination enhancer further facilitates
the anti-sporicidal activity of the emulsions, for example, by
speeding up the rate at which the sporicidal activity occurs.
[0175] Germination of bacterial endospores and fungal spores is
associated with increased metabolism and decreased resistance to
heat and chemical reactants. For germination to occur, the spore
must sense that the environment is adequate to support vegetation
and reproduction. The amino acid L-alanine stimulates bacterial
spore germination (See e.g., Hills, J. Gen. Micro. 4:38 [1950]; and
Halvorson and Church, Bacteriol Rev. 21:112 [1957]). L-alanine and
L-proline have also been reported to initiate fungal spore
germination (Yanagita, Arch Mikrobiol 26:329 [1957]). Simple
.alpha.-amino acids, such as glycine and L-alanine, occupy a
central position in metabolism. Transamination or deamination of
.alpha.-amino acids yields the glycogenic or ketogenic
carbohydrates and the nitrogen needed for metabolism and growth.
For example, transamination or deamination of L-alanine yields
pyruvate, which is the end product of glycolytic metabolism
(Embden-Meyerhof-Pamas Pathway). Oxidation of pyruvate by pyruvate
dehydrogenase complex yields acetyl-CoA, NADH, H.sup.+, and
CO.sub.2. Acetyl-CoA is the initiator substrate for the
tricarboxylic acid cycle (Kreb's Cycle), which in turns feeds the
mitochondrial electron transport chain. Acetyl-CoA is also the
ultimate carbon source for fatty acid synthesis as well as for
sterol synthesis. Simple .alpha.-amino acids can provide the
nitrogen, CO.sub.2, glycogenic and/or ketogenic equivalents
required for germination and the metabolic activity that
follows.
[0176] In certain embodiments, suitable germination enhancing
agents of the invention include, but are not limited to,
.quadrature.-amino acids comprising glycine and the L-enantiomers
of alanine, valine, leucine, isoleucine, serine, threonine, lysine,
phenylalanine, tyrosine, and the alkyl esters thereof. Additional
information on the effects of amino acids on germination may be
found in U.S. Pat. No. 5,510,104; herein incorporated by reference
in its entirety. In some embodiments, a mixture of glucose,
fructose, asparagine, sodium chloride (NaCl), ammonium chloride
(NH.sub.4Cl), calcium chloride (CaCl.sub.2) and potassium chloride
(KCl) also may be used. In particularly preferred embodiments of
the present invention, the formulation comprises the germination
enhancers L-alanine, CaCl.sub.2, Inosine and NH.sub.4Cl. In some
embodiments, the compositions further comprise one or more common
forms of growth media (e.g., trypticase soy broth, and the like)
that additionally may or may not itself comprise germination
enhancers and buffers.
[0177] The above compounds are merely exemplary germination
enhancers and it is understood that other known germination
enhancers will find use in the nanoemulsions utilized in some
embodiments of the present invention. A candidate germination
enhancer should meet two criteria for inclusion in the compositions
of the present invention: it should be capable of being associated
with the emulsions disclosed herein and it should increase the rate
of germination of a target spore when incorporated in the emulsions
disclosed herein. One skilled in the art can determine whether a
particular agent has the desired function of acting as an
germination enhancer by applying such an agent in combination with
the nanoemulsions disclosed herein to a target and comparing the
inactivation of the target when contacted by the admixture with
inactivation of like targets by the composition of the present
invention without the agent. Any agent that increases germination,
and thereby decreases or inhibits the growth of the organisms, is
considered a suitable enhancer for use in the nanoemulsion
compositions disclosed herein.
[0178] In still other embodiments, addition of a germination
enhancer (or growth medium) to a neutral emulsion composition
produces a composition that is useful in inactivating bacterial
spores in addition to enveloped viruses, Gram negative bacteria,
and Gram positive bacteria for use in the vaccine compositions of
the present invention.
[0179] 6. Interaction Enhancers
[0180] In still other embodiments, nanoemulsions comprise one or
more compounds capable of increasing the interaction of the
compositions (i.e., "interaction enhancer") with target pathogens
(e.g., the cell wall of Gram negative bacteria such as Vibrio,
Salmonella, Shigella and Pseudomonas). In preferred embodiments,
the interaction enhancer is preferably premixed with the oil phase;
however, in other embodiments the interaction enhancer is provided
in combination with the compositions after emulsification. In
certain preferred embodiments, the interaction enhancer is a
chelating agent (e.g., ethylenediaminetetraacetic acid [EDTA] or
ethylenebis(oxyethylenenitrilo)tetraacetic acid [EGTA] in a buffer
[e.g., tris buffer]). It is understood that chelating agents are
merely exemplary interaction enhancing compounds. Indeed, other
agents that increase the interaction of the nanoemulsions used in
some embodiments of the present invention with microbial agents
and/or pathogens are contemplated. In particularly preferred
embodiments, the interaction enhancer is at a concentration of
about 50 to about 250 .mu.M. One skilled in the art will be able to
determine whether a particular agent has the desired function of
acting as an interaction enhancer by applying such an agent in
combination with the compositions of the present invention to a
target and comparing the inactivation of the target when contacted
by the admixture with inactivation of like targets by the
composition of the present invention without the agent. Any agent
that increases the interaction of an emulsion with bacteria and
thereby decreases or inhibits the growth of the bacteria, in
comparison to that parameter in its absence, is considered an
interaction enhancer.
[0181] In some embodiments, the addition of an interaction enhancer
to nanoemulsion produces a composition that is useful in
inactivating enveloped viruses, some Gram positive bacteria and
some Gram negative bacteria for use in the vaccine compositions of
the present invention.
[0182] 7. Quaternary Ammonium Compounds
[0183] In some embodiments, nanoemulsions of the present invention
include a quaternary ammonium containing compound. Exemplary
quaternary ammonium compounds include, but are not limited to,
Alkyl dimethyl benzyl ammonium chloride, didecyl dimethyl ammonium
chloride, Alkyl dimethyl benzyl and dialkyl dimethyl ammonium
chloride, N,N-Dimethyl-2-hydroxypropylammonium chloride polymer,
Didecyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl
ammonium chloride, n-Alkyl dimethyl ethylbenzyl ammonium chloride,
Dialkyl dimethyl ammonium chloride, n-Alkyl dimethyl benzyl
ammonium chloride, n-Tetradecyl dimethyl benzyl ammonium chloride
monohydrate, n-Alkyl dimethyl benzyl ammonium chloride, Dialkyl
dimethyl ammonium chloride,
Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Myristalkonium
chloride (and) Quat RNIUM 14, Alkyl bis(2-hydroxyethyl)benzyl
ammonium chloride, Alkyl demethyl benzyl ammonium chloride, Alkyl
dimethyl 3,4-dichlorobenzyl ammonium chloride, Alkyl dimethyl
benzyl ammonium chloride, Alkyl dimethyl benzyl dimethylbenzyl
ammonium, Alkyl dimethyl dimethybenzyl ammonium chloride, Alkyl
dimethyl ethyl ammonium bromide, Alkyl dimethyl ethyl ammonium
bromide, Alkyl dimethyl ethylbenzyl ammonium chloride, Alkyl
dimethyl isopropylbenzyl ammonium chloride, Alkyl trimethyl
ammonium chloride, Alkyl 1 or 3
benzyl-1-(2-hydroxethyl)-2-imidazolinium chloride, Dialkyl methyl
benzyl ammonium chloride, Dialkyl dimethyl ammonium chloride,
Didecyl dimethyl ammonium chloride,
2-(2-(p-(Diisobutyl)cresosxy)ethoxy)ethyl dimethyl benzyl ammonium
chloride, 2-(2-(p-(Diisobutyl)phenoxy)ethoxy)ethyl dimethyl benzyl
ammonium chloride, Dioctyl dimethyl ammonium chloride, Dodecyl
bis(2-hydroxyethyl)octyl hydrogen ammonium chloride, Dodecyl
dimethyl benzyl ammonium chloride, Dodecylcarbamoyl methyl dimethyl
benzyl ammonium chloride, Heptadecyl hydroxyethylimidazolinium
chloride, Hexahydro-1,3,5-tris(2-hydroxyethyl)-s-triazine, Octyl
decyl dimethyl ammonium chloride, Octyl dodecyl dimethyl ammonium
chloride, Octyphenoxyethoxyethyl dimethyl benzyl ammonium chloride,
Oxydiethylenebis(alkyl dimethyl ammonium chloride), Quaternary
ammonium compounds, dicoco alkyldimethyl, chloride, Trimethoxysilyl
quats, and Trimethyl dodecylbenzyl ammonium chloride.
[0184] 8. Production of Nanoemulsions
[0185] Nanoemulsions for use in the vaccine compositions of the
present invention can be formed using classic emulsion forming
techniques. In brief, the oil phase is mixed with the aqueous phase
under relatively high shear forces (e.g., using high hydraulic and
mechanical forces) to obtain an oil-in-water emulsion containing
oil droplets, which are approximately 0.5 to 5 microns, and
preferably 1-2 microns, in diameter. The emulsion is formed by
blending the oil phase with an aqueous phase on a volume-to-volume
basis ranging from about 1:9 to 5:1, preferably about 5:1 to 3:1,
most preferably 4:1, oil phase to aqueous phase. The oil and
aqueous phases can be blended using any apparatus capable of
producing shear forces sufficient to form an emulsion such as
French Presses or high shear mixers (e.g., FDA approved high shear
mixers are available, for example, from Admix, Inc., Manchester,
N.H.). Methods of producing such emulsions are described in U.S.
Pat. Nos. 5,103,497 and 4,895,452; herein incorporated by reference
in their entireties.
[0186] At least a portion of the emulsion may be in the form of
lipid structures including, but not limited to, unilamellar,
multilamellar, and paucliamellar lipid vesicles, micelles, and
lamellar phases. Nanoemulsion compounds can be produced in large
quantities and are stable for many months at a broad range of
temperatures. Undiluted, they tend to have the texture of a
semi-solid cream and can be applied topically by hand or mixed with
water. Diluted, they tend to have a consistency and appearance
similar to skim milk.
[0187] D. Animal Models
[0188] In some embodiments, potential nanoemulsion vaccines are
tested in animal models of infectious diseases. The use of
well-developed animal models provides a method of measuring the
effectiveness and safety of a vaccine before administration to
human subjects. Exemplary animal models of disease are shown in
Table 3. These animals are commercially available (e.g., from
Jackson Laboratories Charles River; Portage, Mich.).
[0189] Animal models of Bacillus cereus (closely related to
Bacillus anthracis) are utilized to test Anthrax vaccines of the
present invention. Both bacteria are spore forming Gram positive
rods and the disease syndrome produced by each bacteria is largely
due to toxin production and the effects of these toxins on the
infected host (Brown et al., J. Bact., 75:499 [1958]; Burdon and
Wende, J. Infect Dis., 107:224 [1960]; Burdon et al., J. Infect.
Dis., 117:307 [1967]). Bacillus cereus infection mimics the disease
syndrome caused by Bacillus anthracis. Mice are reported to rapidly
succumb to the effects of B. cereus toxin and are a useful model
for acute infection. Guinea pigs develop a skin lesion subsequent
to subcutaneous infection with B. cereus that resembles the
cutaneous form of anthrax.
[0190] Clostridium perfringens infection in both mice and guinea
pigs has been used as a model system for the in vivo testing of
antibiotic drugs (Stevens et al., Antimicrob. Agents Chemother.,
31:312 [1987]; Stevens et al., J. Infect. Dis., 155:220 [1987];
Alttemeier et al., Surgery, 28:621 [1950]; Sandusky et al.,
Surgery, 28:632 [1950]). Clostridium tetani is well known to infect
and cause disease in a variety of mammalian species. Mice, guinea
pigs, and rabbits have all been used experimentally (Willis, Topley
and Wilson's Principles of Bacteriology, Virology and Immunity.
Wilson, G., A. Miles, and M. T. Parker, eds. pages 442-475
1983).
[0191] Vibrio cholerae infection has been successfully initiated in
mice, guinea pigs, and rabbits. According to published reports it
is preferred to alter the normal intestinal bacterial flora for the
infection to be established in these experimental hosts. This is
accomplished by administration of antibiotics to suppress the
normal intestinal flora and, in some cases, withholding food from
the animals (Butterton et al., Infect. Immun., 64:4373 [1996];
Levine et al., Microbiol. Rev., 47:510 [1983]; Finkelstein et al.,
J. Infect. Dis., 114:203 [1964]; Freter, J. Exp. Med., 104:411
[1956]; and Freter, J. Infect. Dis., 97:57 [1955]).
[0192] Shigella flexnerii infection has been successfully initiated
in mice and guinea pigs. As is the case with vibrio infections, it
is preferred that the normal intestinal bacterial flora be altered
to aid in the establishment of infection in these experimental
hosts. This is accomplished by administration of antibiotics to
suppress the normal intestinal flora and, in some cases,
withholding food from the animals (Levine et al., Microbiol. Rev.,
47:510 [1983]; Freter, J. Exp. Med., 104:411 [1956]; Formal et al.,
J. Bact., 85:119 [1963]; LaBrec et al., J. Bact. 88:1503 [1964];
Takeuchi et al., Am. J. Pathol., 47:1011 [1965]).
[0193] Mice and rats have been used extensively in experimental
studies with Salmonella typhimurium and Salmonella enteriditis
(Naughton et al., J. Appl. Bact., 81:651 [1996]; Carter and
Collins, J. Exp. Med., 139:1189 [1974]; Collins, Infect. Immun.,
5:191 [1972]; Collins and Carter, Infect. Immun., 6:451
[1972]).
[0194] Mice and rats are well established experimental models for
infection with Sendai virus (Jacoby et al., Exp. Gerontol., 29:89
[1994]; Massion et al., Am. J. Respir. Cell Mol. Biol. 9:361
[1993]; Castleman et al., Am. J. Path., 129:277 [1987]; Castleman,
Am. J. Vet. Res., 44:1024 [1983]; Mims and Murphy, Am. J. Path.,
70:315 [1973]).
[0195] Sindbis virus infection of mice is usually accomplished by
intracerebral inoculation of newborn mice. Alternatively, weanling
mice are inoculated subcutaneously in the footpad (Johnson et al.,
J. Infect. Dis., 125:257 [1972]; Johnson, Am. J. Path., 46:929
[1965]).
[0196] It is preferred that animals are housed for 3-5 days to rest
from shipping and adapt to new housing environments before use in
experiments. At the start of each experiment, control animals are
sacrificed and tissue is harvested to establish baseline
parameters. Animals are anesthetized by any suitable method (e.g.,
including, but not limited to, inhalation of Isofluorane for short
procedures or ketamine/xylazine injection for longer
procedure).
TABLE-US-00003 TABLE 3 Animal Models of Infectious Diseases
Experimental Experimental Animal Route of Microorganism Animal
Species Strains Sex Age Infection Francisella mice BALB/C M 6 W
Intraperitoneal philomiraga Neisseria mice BALB/C F 6-10 W
Intraperitoneal meningitidis rats COBS/CD M/F 4 D Intranasal
Streptococcus mice BALB/C F 6 W Intranasal pneumoniae rats COBS/CD
M 6-8 W Intranasal guinea Pigs Hartley M/F 4-5 W Intranasal
Yersinia mice BALB/C F 6 W Intranasal pseudotuberculosis Influenza
virus mice BALB/C F 6 W Intranasal Sendai virus mice CD-1 F 6 W
Intranasal rats Sprague- M 6-8 W Intranasal Dawley Sindbis mice
CD-1 M/F 1-2 D Intracerebral/SC Vaccinia mice BALB/C F 2-3 W
Intradermal
[0197] E. Assays for Evaluation of Vaccines
[0198] In some embodiments, candidate nanoemulsion vaccines are
evaluated using one of several suitable model systems. For example,
cell-mediated immune responses can be evaluated in vitro. In
addition, an animal model may be used to evaluate in vivo immune
response and immunity to pathogen challenge. Any suitable animal
model may be utilized, including, but not limited to, those
disclosed in Table 3.
[0199] Before testing a nanoemulsion vaccine in an animal system,
the amount of exposure of the pathogen to a nanoemulsion sufficient
to inactivate the pathogen is investigated. It is contemplated that
pathogens such as bacterial spores require longer periods of time
for inactivation by the nanoemulsion in order to be sufficiently
neutralized to allow for immunization. The time period required for
inactivation may be investigated using any suitable method,
including, but not limited to, those described in the illustrative
examples below.
[0200] In addition, the stability of emulsion-developed vaccines is
evaluated, particularly over time and storage condition, to ensure
that vaccines are effective long-term. The ability of other
stabilizing materials (e.g., dendritic polymers) to enhance the
stability and immunogenicity of vaccines is also evaluated.
[0201] Once a given nanoemulsion/pathogen vaccine has been
formulated to result in pathogen inactivation, the ability of the
vaccine to elicit an immune response and provide immunity is
optimized. Non-limiting examples of methods for assaying vaccine
effectiveness are described in Example 14 below. For example, the
timing and dosage of the vaccine can be varied and the most
effective dosage and administration schedule determined. The level
of immune response is quantitated by measuring serum antibody
levels. In addition, in vitro assays are used to monitor
proliferation activity by measuring H.sup.3-thymidine uptake. In
addition to proliferation, Th1 and Th2 cytokine responses (e.g.,
including but not limited to, levels of include IL-2, TNF-.gamma.,
IFN-.gamma., IL-4, IL-6, IL-11, IL-12, etc.) are measured to
qualitatively evaluate the immune response.
[0202] Finally, animal models are utilized to evaluate the effect
of a nanoemulsion mucosal vaccine. Purified pathogens are mixed in
emulsions (or emulsions are contact with a pre-infected animal),
administered, and the immune response is determined. The level of
protection is then evaluated by challenging the animal with the
specific pathogen and subsequently evaluating the level of disease
symptoms. The level of immunity is measured over time to determine
the necessity and spacing of booster immunizations.
III. Therapeutics
[0203] The present invention provides nanoemulsion/pathogen
formulations suitable for use as vaccines. The compositions can be
administered in any effective pharmaceutically acceptable form to
subjects including human and animal subjects. Generally, this
entails preparing compositions that are essentially free of
pyrogens, as well as other impurities that could be harmful to
humans or animals.
[0204] Particular examples of pharmaceutically acceptable forms
include but are not limited to nasal, buccal, rectal, vaginal,
topical or nasal spray or in any other form effective to deliver
active vaccine compositions of the present invention to a given
site. In preferred embodiments, the route of administration is
designed to obtain direct contact of the compositions with the
mucosal immune system (e.g., including, but not limited to, mucus
membranes of the nasal and stomach areas). In other embodiments,
administration may be by orthotopic, intradermal, subcutaneous,
intramuscular or intraperitoneal injection. The compositions may
also be administered to subjects parenterally or intraperitonealy.
Such compositions would normally be administered as
pharmaceutically acceptable compositions. Except insofar as any
conventional pharmaceutically acceptable media or agent is
incompatible with the vaccines of the present invention, the use of
known pharmaceutically acceptable media and agents in these
particular embodiments is contemplated. In additional embodiments,
supplementary active ingredients also can be incorporated into the
compositions.
[0205] For topical applications, the pharmaceutically acceptable
carrier may take the form of a liquid, cream, foam, lotion, or gel,
and may additionally comprise organic solvents, emulsifiers,
gelling agents, moisturizers, stabilizers, surfactants, wetting
agents, preservatives, time release agents, and minor amounts of
humectants, sequestering agents, dyes, perfumes, and other
components commonly employed in pharmaceutical compositions for
topical administration.
[0206] Actual amounts of compositions and any enhancing agents in
the compositions may be varied so as to obtain amounts of emulsion
and enhancing agents at the site of treatment that are effective in
inactivating pathogens and producing immunity. Accordingly, the
selected amounts will depend on the nature and site for treatment,
the desired response, the desired duration of biocidal action and
other factors. Generally, the emulsion compositions of the
invention will comprise at least 0.001% to 100%, preferably 0.01 to
90%, of emulsion per ml of liquid composition. It is envisioned
that the formulations may comprise about 0.001%, about 0.0025%,
about 0.005%, about 0.0075%, about 0.01%, about 0.025%, about
0.05%, about 0.075%, about 0.1%, about 0.25%, about 0.5%, about
1.0%, about 2.5%, about 5%, about 7.5%, about 10%, about 12.5%,
about 15%, about 20%, about 25%, about 30%, about 35%, about 40%,
about 50%, about 55%, about 60%, about 65%, about 70%, about 75%,
about 80%, about 85%, about 90%, about 95% or about 100% of
emulsion per ml of liquid composition. It should be understood that
a range between any two figures listed above is specifically
contemplated to be encompassed within the metes and bounds of the
present invention. Some variation in dosage will necessarily occur
depending on the condition of the specific pathogen and the subject
being immunized.
[0207] The person responsible for administration will, in any
event, determine the appropriate dose for the individual subject.
Moreover, for human administration, preparations should meet
sterility, pyrogenicity, and general safety and purity standards as
required by the FDA Office of Biologics standards.
EXAMPLES
[0208] The following examples serve to illustrate certain preferred
embodiments and aspects of the present invention and are not to be
construed as limiting the scope thereof.
[0209] In the experimental disclosure which follows, the following
abbreviations apply: eq (equivalents); .mu. (micron); M (Molar);
.mu.M (micromolar); mM (millimolar); N (Normal); mol (moles); mmol
(millimoles); .mu.mol (micromoles); nmol (nanomoles); g (grams); mg
(milligrams); .mu.g (micrograms); ng (nanograms); L (liters); ml
(milliliters); .mu.l (microliters); cm (centimeters); mm
(millimeters); .mu.m (micrometers); nM (nanomolar); .degree. C.
(degrees Centigrade); and PBS (phosphate buffered saline).
Example 1
Methods of Formulating Emulsions
[0210] The emulsion is produced as follows: an oil phase is made by
blending organic solvent, oil, and surfactant and then heating the
resulting mixture at 37-90.degree. C. for up to one hour. The
emulsion is formed either with a reciprocating syringe
instrumentation or Silverson high sheer mixer. The water phase is
added to the oil phase and mixed for 1-30 minutes, preferably for 5
minutes. For emulsions containing volatile ingredients, the
volatile ingredients are added along with the aqueous phase.
[0211] In one example, the emulsion was formed as follows: an oil
phase was made by blending tri-butyl phosphate, soybean oil, and a
surfactant (e.g., TRITON X-100) and then heating the resulting
mixture at 86.degree. C. for one hour. An emulsion was then
produced by injecting water into the oil phase at a volume/volume
ratio of one part oil phase to four parts water. The emulsion can
be produced manually, with reciprocating syringe instrumentation,
or with batch or continuous flow instrumentation. Methods of
producing these emulsions are well known to those of skill in the
art and are described in e.g., U.S. Pat. Nos. 5,103,497; and
4,895,452, (herein incorporated by reference in their entireties).
Table 4 shows the proportions of each component, the pH, and the
size of the emulsion as measured on a Coulter LS 130 laser sizing
instrument equipped with a circulating water bath.
TABLE-US-00004 TABLE 4 Chemical Percentage Mean Mean Coulter
Components of Each Coulter Size Range of Emulsion Component pH (in
Microns) (in Microns) X8P TRITON X-100 2% Tributyl phosphate 2%
5.16 1.074 0.758-1.428 Oil (ex. Soy bean) 16% Water 80% X8P 0.1*
TRITON X-100 0.20% 5.37 0.944 0.625-1.333 Tributyl phosphate 0.20%
Oil (ex. Soy bean) 1.60% Water 98% *This emulsion was obtained by
diluting the X8P emulsion with water in a ratio of 1:9
[0212] The emulsions utilized in the present invention are highly
stable. Indeed, emulsions were produced as described above and
allowed to stand overnight at room temperature in sealed, different
sizes of polypropylene tubes, beakers or flasks. The emulsions were
then monitored for signs of separation. Emulsions that showed no
signs of separation were considered "stable." Stable emulsions were
then monitored over 1 year and were found to maintain
stability.
[0213] Emulsions were again produced as described above and allowed
to stand overnight at -20.degree. C. in sealed 50 mL polypropylene
tubes. The emulsions were then monitored for signs of separation.
Emulsions that showed no signs of separation were considered
"stable." The X8P and X8P 0.1, emulsions have been found to be
substantially unchanged after storage at room temperature for at
least 24 months.
Example 2
Characterization of an Exemplary Bacteria-Inactivating Emulsion as
an Emulsified Liposome Formed in Lipid Droplets
[0214] A bacteria inactivating emulsion, designated X8W.sub.60PC,
was formed by mixing a lipid-containing oil-in-water emulsion with
X8P. In particular, a lipid-containing oil-in-water emulsion having
glycerol monooleate (GMO) as the primary lipid and cetylpyridinium
chloride (CPC) as a positive charge producing agent (referred to
herein as GMO/CPC lipid emulsion or "W.sub.808P") and X8P were
mixed in a 1:1 (volume to volume) ratio. U.S. Pat. No. 5,547,677
(herein incorporated by reference in its entirety) describes the
GMO/CPC lipid emulsion and other related lipid emulsions that may
be combined with X8P to provide bacteria-inactivating oil-in-water
emulsions utilized in the vaccines of the present invention.
Example 3
In Vitro Bactericidal Efficacy Study I
Gram Positive Bacteria
[0215] In order to study the bactericidal efficacy of the emulsions
utilized in the vaccines of the present invention, the emulsions
were mixed with various bacteria for 10 minutes and then plated on
standard microbiological media at varying dilutions. Colony counts
were then compared to untreated cultures to determine the percent
of bacteria killed by the treatment. Table 5 summarizes the results
of the experiment.
TABLE-US-00005 TABLE 5 Inoculum % Emulsion Organism (CFU) Killing
Tested Vibrio cholerae classical 1.3 .times. 10.sup.8 100 X8P
Vibrio cholerae Eltor 5.1 .times. 10.sup.8 100 X8P Vibrio
parahemolytica 4.0 .times. 10.sup.7 98-100 X8P
[0216] In order to study the bactericidal effect of the emulsions
on various vegetative forms of Bacillus species, an emulsion at
three dilutions was mixed with four Bacillus species for 10 minutes
and then plated on microbiological medium. Colony counts were then
compared with untreated cultures to determine the percent of
bacteria killed by the treatment. Table 6 contains a summary of the
bactericidal results from several experiments with the mean
percentage kill in parenthesis.
TABLE-US-00006 TABLE 6 X8P/ Dilution B. cereus B. circulans B.
megaterium B. subtilis 1:10 99% 95-99% 99% 99% (99%) (97%) (99%)
(99%) 1:100 97-99% 74-93% 96-97% 99% (98%) (84%) (96%) (99%) 1:1000
0% 45-60% 0-32% 0-39% (0%) (52%) (16%) (20%)
Example 4
In Vitro Bactericidal Efficacy Study II
Gram Negative Bacteria
[0217] To increase the uptake of the bacteria inactivating
emulsions by the cell walls of Gram negative bacteria, thereby
enhancing the microbicidal effect of the emulsions on the resistant
Gram negative bacteria, EDTA (ethylenediamine-tetraacetic acid) was
premixed with the emulsions. The EDTA was used in low concentration
(50-25 .mu.M) and the mix was incubated with the various Gram
negative bacteria for 15 minutes. The microbicidal effect of the
mix was then measured on trypticase soy broth. The results are set
forth in Table 7 below. There was over 99% reduction of the
bacterial count using X8P in 1/100 dilutions. This reduction of
count was not due to the killing effect of EDTA alone as shown from
the control group in which 250 .mu.M of EDTA alone could not reduce
the bacterial count in 15 minutes.
TABLE-US-00007 TABLE 7 Bacteria Bacteria + Bacteria + Bacteria +
alone X8P X8P + EDTA Bacterium (CFU) (CFU) EDTA (CFU) (CFU) S.
typhimurium 1,830,000 1,370,000 40 790,000 S. dysenteriae 910,000
690,000 0 320,000
Example 5
In Vitro Bactericidal Efficacy Study III
Vegetative And Spore Forms
[0218] Bacillus cereus (B. cereus, ATCC #14579) was utilized as a
model system for Bacillus anthracis. Experiments with X8P diluted
preparations to study the bactericidal effect of the compounds of
the present invention on the vegetative form (actively growing) of
B. cereus were performed. Treatment in medium for 10 minutes at
37.degree. C. was evaluated. As summarized in Table 8, the X8P
emulsion is efficacious against the vegetative form of B. cereus. A
10 minute exposure with this preparation is sufficient for
virtually complete killing of vegetative forms of B. cereus at all
concentrations tested including dilutions as high as 1:100.
TABLE-US-00008 TABLE 8 Emulsion Undiluted 1:10 1:100 X8P >99%
>99% 59->99% Avg = >99% Avg = >99% Avg = 82% Number of
experiments = 4
[0219] The spore form of B. anthracis is one of the most likely
organisms to be used as a biological weapon. Spores are well known
to be highly resistant to most disinfectants. As describe above,
effective killing of spores usually requires the use of toxic and
irritating chemicals such as formaldehyde or sodium hypochlorite
(i.e., bleach). The same experiment was therefore performed with
the spore form of B. cereus. As shown in Table 9, treatment in both
medium for 10 minutes at 37.degree. C. was not sufficient to kill
B. cereus spores.
TABLE-US-00009 TABLE 9 Emulsion Undiluted 1:10 1:100 X8P 0%-12% 0%
0% Avg = 6% Avg = 0% Avg = 0% Number of experiments = 2
[0220] To evaluate the efficacy of the nanoemulsion compounds
utilized in the vaccines of the present invention on the spore form
of B. cereus over a period of time, X8P was incorporated into solid
agar medium at 1:100 dilution and the spores spread uniformly on
the surface and incubated for 96 hours at 37.degree. C. No growth
occurred on solid agar medium wherein X8P had been incorporated,
out to 96 hours (i.e., >99% killing, average >99% killing, 3
experiments).
[0221] In an attempt to more closely define the time at which
killing of spores by X8P occurred, the following experiment was
performed. Briefly, a spore preparation was treated with X8P at a
dilution of 1:100 and compared to an untreated control. The number
of colony forming units per milliliter (CFU/ml) was quantitated
after 0.5, 1, 2, 4, 6, and 8 hours. CFU/ml in the untreated control
increased over the first 4 hours of incubation and then reached a
plateau. Bacterial smears prepared at time zero, 1, 2, 4 and 6
hours, and stained for spore structures, revealed that by 2 hours
no spore structures remained (FIGS. 2A-2C). Thus, 100% germination
of spores occurred in the untreated control by the 2 hour time
point. In the spore preparation treated with X8P, CFU/ml showed no
increase over the first 2 hours and then declined rapidly over the
time period from 2-4 hours. The decline from baseline CFU/ml over
2-4 hours was approximately 1000-fold. Bacterial smears prepared at
the same time points and stained for spore structures revealed that
spore structures remained to the end of the experiment at 8 hours.
Hence, germination of spores did not occur in the X8P treated
culture due to either inhibition of the germination process or
because the spores were damaged and unable to germinate. In order
to determine whether the emulsions were effective in killing other
Bacillus species in addition to B. cereus, a similar experiment was
performed as described above, wherein spore preparations were
treated with emulsions and compared to an untreated control after
four hours of incubation. The following Table 10 shows the results
wherein the numbers represent the mean sporicidal activity from
several experiments.
TABLE-US-00010 TABLE 10 X8P/ Dilution B. cereus B. circulans B.
megaterium B. subtilis 1:10 82% 61% 93% 31% 1:100 91% 80% 92% 39%
1:1000 47% 73% 94% 22%
Example 6
In Vivo Bactericidal Efficacy Study
[0222] Animal studies were preformed to demonstrate the protective
and therapeutic effect of the emulsions in vivo. Bacillus cereus
infection in experimental animals has been used previously as a
model system for the study of anthrax (Burdon and Wende, 1960;
Burdon et al., 1967; Lamanna and Jones, 1963). The disease syndrome
induced in animals experimentally infected with B. cereus in some
respects similar to anthrax (Drobniewski, 1993; Fritz et al.,
1995). The emulsions were mixed with B. cereus spores before
injecting into mice.
[0223] Irrigation of Skin Wounds
[0224] A 1 cm skin wound was infected with 2.5.times.10.sup.7 B.
cereus spores then closed without any further treatment. The other
groups were infected with the same number of spores. One hour
later, the wounds were irrigated with either inventive emulsion or
saline to simulate post-exposure decontamination. By 48 hours,
there were large necrotic areas surrounding the wounds with an
average area of 4.86 cm.sup.2. In addition, 60% of the animals in
this group died as a result of the infection. Histology of these
lesions indicated total necrosis of the dermis and subdermis and
large numbers of vegetative Bacillus organisms. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit.
[0225] Irrigation of wounds infected with B. cereus spores with
emulsion showed substantial benefit, resulting in a consistent 98%
reduction in the lesion size from 4.86 cm.sup.2 to 0.06 cm.sup.2.
This reduction in lesion size was accompanied by a three-fold
reduction in mortality (60% to 20%) when compared to experimental
animals receiving either no treatment or saline irrigation.
Histology of these lesions showed no evidence of vegetative
Bacillus organisms and minimal disruption of the epidermis (Hamouda
et al., 1999).
[0226] Subcutaneous Injection
[0227] CD-1 mice were injected with emulsion diluted 1:10 in saline
as a control and did not exhibit signs of distress or inflammatory
reaction, either in gross or histological analysis. To test the
pathogenic effect of B. cereus spores in vivo and the sporicidal
effect of emulsion, a suspension of 4.times.10.sup.7 B. cereus
spores was mixed with saline or with inventive emulsion at a final
dilution of 1:10 and then immediately injected subcutaneously into
the back of CD-1 mice.
[0228] Mice that were infected subcutaneously with B. cereus spores
without emulsion developed severe edema at 6-8 hours. This was
followed by a gray, necrotic area surrounding the injection site at
18-24 hours, with severe sloughing of the skin present by 48 hours,
leaving a dry, red-colored lesion.
[0229] Simultaneous injection of spores and emulsion resulted in a
greater than 98% reduction in the size of the necrotic lesion from
1.68 cm.sup.2 to 0.02 cm.sup.2 when the spores were premixed with
inventive emulsion. This was associated with minimal edema or
inflammation (Hamouda et al., 1999).
[0230] Rabbit Cornea
[0231] The cornea of rabbits were irrigated with various
concentrations of emulsions and monitored at 24 and 48 hours. No
irritations or abnormalities were observed when compositions were
used in therapeutic amounts.
[0232] Mucous Membrane
[0233] Intranasal toxicity was preformed in mice by installation of
25 .mu.L of 4% of the nanoemulsion per nare. No clinical or
histopathological changes were observed in these mice.
[0234] Nasal toxicity testing in rats was performed by gavaging up
to 8 mL per kg of 25% nanoemulsion. The rats did not lose weight or
show signs of toxicity either clinically or histopathologically.
There were no observed changes in the gut bacterial flora as a
result of nasal administration of the emulsions.
[0235] In a particular embodiment, Bacillus cereus was passed three
times on blood agar (TSA with 5% sheep blood, REMEL). B. cereus was
scraped from the third passage plate and resuspended in trypticase
soy broth (TSB) (available from BBL). The B. cereus suspension was
divided into two tubes. An equal volume of sterile saline was added
to one tube and mixed 0.1 ml of the B. cereus suspension/saline was
injected subcutaneously into 5 CD-1 mice. An equal volume of X8P
(diluted 1:5 in sterile saline) was added to one tube and mixed,
giving a final dilution of X8P at 1:10. The B. cereus
suspension/X8P was incubated at 37.degree. C. for 10 minutes while
being mixed 0.1 ml of the B. cereus suspension/X8P was injected
subcutaneously into 5 CD-1 mice. Equal volumes of X8P (diluted 1:5
in sterile saline) and TSB were mixed, giving a final dilution of
X8P at 1:10. 0.1 ml of the X8P/TSB was injected subcutaneously into
5 CD-1 mice.
[0236] The number of colony forming units (cfu) of B. cereus in the
inocula were quantitated as follows: 10-fold serial dilutions of
the B. cereus and B. cereus/X8P suspensions were made in distilled
H.sub.20. Duplicate plates of TSA were inoculated from each
dilution (10 .mu.l per plate). The TSA plates were incubated
overnight at 37.degree. C. Colony counts were made and the number
of cfu/ml was calculated. Necrotic lesions appears to be smaller in
mice which were inoculated with B. cereus which was pretreated with
X8P. The following Table 11 shows the results of the
experiment.
TABLE-US-00011 TABLE 11 Observation Inoculum ID# (24 hours) B.
cereus 1528 necrosis at injection 3.1 .times. 10.sup.7 Site
cfu/mouse 1529 necrosis at injection site 1530 Dead 1531 Dead 1532
necrosis at injection site B. cereus 1348 necrosis at injection
site 8.0 .times. 10.sup.5 1349 no reaction cfu/mouse 1360 no
reaction (X8P treated) 1526 necrosis at injection site 1527
necrosis at injection site X8P/TSB 1326 no reaction 1400 no
reaction 1375 no reaction 1346 no reaction 1347 no reaction
[0237] Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1%
Yeast Extract (Difco) and 50 .mu.g/ml MnSO.sub.4 for induction of
spore formation. The plate was scraped and suspended in sterile 50%
ethanol and incubated at room temperature for 2 hours with
agitation in order to lyse remaining vegetative bacteria. The
suspension was centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was resuspended in diH.sub.2O,
centrifuged at 2,500.times.g for 20 minutes, and the supernatant
discarded. The spore suspension was divided. The pellet was
resuspended in TSB. 0.1 ml of the B. cereus spore suspension
diluted 1:2 with saline was injected subcutaneously into 3 CD-1
mice. Equal volumes of X8P (diluted 1:5 in sterile saline) and B.
cereus spore suspension were mixed, giving a final dilution of X8P
at 1:10 (preincubation time). 0.1 ml of the X8P/B. cereus spore
suspension was injected subcutaneously into 3 CD-1 mice. The number
of colony forming units (cfu) of B. cereus in the inoculum was
quantitated as follows. 10-fold serial dilutions of the B. cereus
and B. cereus/X8P suspensions were made in distilled H.sub.2O.
Duplicate plates of TSA were inoculated from each dilution (10
.mu.l per plate). The TSA plates were incubated overnight at
37.degree. C. Colony counts were made and the number of cfu/ml was
calculated. Necrotic lesions appeared to be smaller in mice that
were inoculated with B. cereus spores that were pretreated with
X8P. The observations from these studies are shown in Table 12.
TABLE-US-00012 TABLE 12 Inoculum Observation (24 hours) B. cereus
2/3 (66%) mice exhibited necrosis at injection site 6.4 .times.
10.sup.6 spores/mouse B. cereus 1/3 (33%) mice exhibited necrosis
at injection site 4.8 .times. 10.sup.6 spores/mouse (X8P treated)
B. cereus 3/3 (100%) mice exhibited necrosis at injection site 4.8
.times. 10.sup.6 vegetative forms/mouse Lysed B. cereus 3/3 (100%)
mice did not exhibit symptoms 4.8 .times. 10.sup.6 cfu/mouse
X8P/TSB 1/3 (33%) mice appeared to have some skin necrosis
[0238] Bacillus cereus was grown on Nutrient Agar (Difco) with 0.1%
Yeast Extract (Difco) and 50 (g/ml MnSO.sub.4 for induction of
spore formation). The plate was scraped and suspended in sterile
50% ethanol and incubated at room temperature for 2 hours with
agitation in order to lyse remaining vegetative bacteria. The
suspension was centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was resuspended in distilled
H.sub.2O, centrifuged at 2,500.times.g for 20 minutes, and the
supernatant discarded. The pellet was resuspended in TSB. The B.
cereus spore suspension was divided into three tubes. An equal
volume of sterile saline was added to one tube and mixed. 0.1 ml of
the B. cereus suspension/saline was injected subcutaneously into 10
CD-1 mice. An equal volume of X8P (diluted 1:5 in sterile saline)
was added to the second tube and mixed, giving a final dilution of
X8P at 1:10. The B. cereus spore suspension/X8P (1:10) was
incubated at 37.degree. C. for 4 hours while being mixed. 0.1 ml of
the B. cereus spore suspension/X8P (1:10) was injected
subcutaneously into 10 CD-1 mice. An equal volume of X8P (diluted
1:50 in sterile saline) was added to the third tube and mixed,
giving a final dilution of X8P at 1:100. The B. cereus spore
suspension/X8P (1:100) was incubated at 37.degree. C. for 4 hours
while being mixed. 0.1 ml of the B. cereus spore suspension/X8P
(1:100) was injected subcutaneously into 10 CD-1 mice. Equal
volumes of X8P (diluted 1:5 in sterile saline) and TSB were mixed,
giving a final dilution of X8P at 1:10. 0.1 ml of the X8PFTSB was
injected subcutaneously into 10 CD-1 mice. Equal volumes of X8P
(diluted 1:50 in sterile saline) and TSB were mixed, giving a final
dilution of X8P at 1:100. 0.1 ml of the X8P/TSB was injected
subcutaneously into 10 CD-1 mice. The observations from these
studies are shown in Table 13 and Table 14.
TABLE-US-00013 TABLE 13 Inoculum sc ID# Observation at 24 hours B.
cereus 1 2.4 cm.sup.2 skin lesion with 0.08 cm.sup.2 necrotic area
5.5 .times. 10.sup.7 2 no abnormalities observed Spores/mouse 3
Moribund with 8 cm.sup.2 skin lesion and Hind limb No treatment
paralysis group 4 3.52 cm.sup.2 skin lesion 5 1.44 cm.sup.2 skin
lesion 6 3.4 cm.sup.2 skin lesion 7 5.5 cm.sup.2 skin lesion 8 5.5
cm.sup.2 skin lesion 9 3.3 cm.sup.2 skin lesion with 0.72 cm.sup.2
necrotic area 10 2.64 cm.sup.2 skin lesion with two necrotic areas
(0.33 cm.sup.2 and 0.1 cm.sup.2) Mean lesion size in Spore group
alone 3.97 cm.sup.2 (1/10 (10%) with no abnormalities observed)
Note: Skin lesions grey in color with edema, necrotic areas
red/dry.
TABLE-US-00014 TABLE 14 Inoculum sc ID # Observation at 24 hours B.
cereus 41 no abnormalities observed 2.8 .times. 10.sup.7 42 no
abnormalities observed spores/mouse 43 1.2 cm.sup.2 white skin
lesion with grey center, in the slight edema X8P 1:10 44 0.78
cm.sup.2 white skin lesion treated group 45 0.13 cm.sup.2 white
skin lesion 46 2.2 cm.sup.2 white skin lesion 47 1.8 cm.sup.2 white
skin lesion with 0.1 cm.sup.2 brown area in center 48 1 cm.sup.2
white skin lesion with grey center 49 0.78 cm.sup.2 white skin
lesion 50 no abnormalities observed Mean lesion size in X8P 1:10
treatment group = 1.13 cm.sup.2 (3/10 (30%) with no abnormalities
observed) B. cereus 51 2.1 cm.sup.2 grey skin lesion 1.8 .times.
10.sup.7 52 0.72 cm.sup.2 grey skin lesion spores/mouse 53 1.5
cm.sup.2 grey skin lesion in the 54 1.2 cm.sup.2 grey skin lesion
X8P 1:100 55 3.15 cm.sup.2 grey skin lesion treated group 56 0.6
cm.sup.2 grey skin lesion 57 0.5 cm.sup.2 grey skin lesion 58 2.25
cm.sup.2 grey skin lesion 59 4.8 cm.sup.2 grey skin lesion with
necrotic area 1 cm diameter 60 2.7 cm.sup.2 grey skin lesion Mean
lesion size In X8P 1:100 treatment group = 1.9 cm.sup.2 (0/10 (0%)
with no abnormalities observed) X8P 1:10 alone 11 2.6 cm.sup.2
white area 12 0.15 cm.sup.2 white area 13 no abnormalities observed
14 0.15 cm.sup.2 white area 15 0.35 cm.sup.2 white area 16 no
abnormalities observed 17 0.12 cm.sup.2 white area 18 no
abnormalities observed 19 0.56 cm.sup.2 white area 20 0.3 cm.sup.2
white area Mean lesion size In X8P 1:10 alone group = 0.60 cm.sup.2
(3/10 (30%) with no abnormalities observed) X8P 1:100 alone 21-30
no abnormalities observed Mean lesion size in X8P 1:100 alone group
= 0 cm.sup.2 (10/10 (100%) with no abnormalities observed) TSB
31-40 no abnormalities observed alone Mean lesion size In the TSB
alone group = 0 cm.sup.2 (10/10 (100%) with no abnormalities
observed)
[0239] Re-isolation of B. cereus was attempted from skin lesions,
blood, liver, and spleen (Table 15). Skin lesions were cleansed
with betadine followed by 70% sterile isopropyl alcohol. An
incision was made at the margin of the lesion and swabbed. The
chest was cleansed with betadine followed by 70% sterile isopropyl
alcohol. Blood was drawn by cardiac puncture. The abdomen was
cleansed with betadine followed by 70% sterile isopropyl alcohol.
The skin and abdominal muscles were opened with separate sterile
instruments. Samples of liver and spleen were removed using
separate sterile instruments. Liver and spleen samples were passed
briefly through a flame and cut using sterile instruments. The
freshly exposed surface was used for culture. BHI agar (Difco) was
inoculated and incubated aerobically at 37.degree. C.
overnight.
TABLE-US-00015 TABLE 15 B. cereus Re-isolation Inoculum sc ID#
Necrospy From site of skin lesion B. cereus 3 24 hours skin lesion
> 300 cfu 5.5 .times. 10.sup.7 6 48 hours skin lesion > 300
cfu spores/mouse 7 48 hours skin lesion > 300 cfu in the 8 72
hours skin lesion 100 cfu Untreated group 9 72 hours skin lesion 25
cfu 10 72 hours skin lesion 100 1 96 hours skin lesion > 300 cfu
4 96 hours skin lesion > 300 cfu 5 96 hours skin lesion > 300
cfu Mean CFU In Untreated Spore group = 214* *(6/9 (67%) > 300
CFU) B. cereus 48 48 hours skin lesion 17 cfu 2.8 .times. 10.sup.7
50 48 hours skin lesion > 300 cfu spores/mouse 46 72 hours skin
lesion > 200 cfu in the 47 72 hours skin lesion 100 cfu X8P 1:10
49 72 hours skin lesion > 300 cfu treated group 41 96 hours skin
lesion > 300 cfu 42* 96 hours skin lesion 20 cfu 43 cultures not
done 44 96 hours skin lesion > 300 cfu 45 cultures not done 46
cultures not done Mean CFU in X8P 1:10 group = 192* *(318 (38%)
> 300 CFU) B. cereus 48 48 hours skin lesion 18 cfu 1.8 .times.
10.sup.7 50* 48 hours skin lesion > 300 cfu spores/mouse 52 72
hours skin lesion I cfu in the 54 72 hours re-isolation negative
X8P 1:100 56 72 hours skin lesion > 300 cfu treated group 58 96
hours skin lesion 173 cfu 59 96 hours skin lesion 4 cfu 60 96 hours
skin lesion 6 cfu Mean CFU in X8P 1:100 group = 100 *(2/8 (25%)
> 00 CFU) *Although no lesions were present in these mice,
organisms were removed from the injection site.
[0240] Pretreatment of both vegetative B. cereus and B. cereus
spores reduce their ability to cause disease symptoms when
introduced into experimental animals. This is reflected in the
smaller size of skin lesions and the generally lower numbers of B.
cereus recovered from the lesions. In addition, less frequent
re-isolation of B. cereus from blood, liver, and spleen occurs
suggesting that septicemia may be preventable.
Example 7
In Vivo Toxicity Study I
[0241] CD-1 mice were injected subcutaneously with 0.1 ml of
nanoemulsion and observed for 4 days for signs of inflammation
and/or necrosis. Dilutions of the compounds were made in sterile
saline. Tissue samples from mice were preserved in 10% neutral
buffered formalin for histopathologic examination. Samples of skin
and muscle (from mice which were injected with undiluted compounds)
sent for histological review were reported to show indications of
tissue necrosis. Tissue samples from mice which were injected with
diluted compounds were not histologically examined. Tables 16 and
17 show the results of two individual experiments.
TABLE-US-00016 TABLE 16 Compound Mouse ID # Dilution Observation
X8P 1326 Undiluted necrosis 1327 Undiluted no reaction 1328 1:10 no
reaction 1329 1:10 no reaction 1324 1:100 no reaction 1331 1:100 no
reaction Saline 1344 no reaction 1345 no reaction
TABLE-US-00017 TABLE 17 Compound Mouse ID # Dilution Observation
X8P 1376 Undiluted necrosis 1377 Undiluted minimal necrosis 1378
1:10 no reaction 1379 1:10 no reaction 1380 1:100 no reaction 1381
1:100 no reaction Saline 1394 no reaction 1395 no reaction
[0242] Guinea pigs were injected intramuscularly (in both hind
legs) with 1.0 ml of compounds of the present invention per site
and observed for 4 days for signs of inflammation and/or necrosis.
Dilutions of the compounds were made in sterile saline.
[0243] Tissue samples from guinea pigs were preserved in 10%
neutral buffered formalin for histological examination. Tissue
samples were not histologically examined.
TABLE-US-00018 TABLE 18 Compound Guinea Pig Dilution Observation
X8P 1023-1 undiluted no reaction 1023-2 1:10 no reaction 1023-3
1:100 no reaction Saline 1023-10 no reaction
[0244] The results of In Vivo Toxicity Study I show that
subcutaneous and intramuscular injection of the compounds tested
did not result in grossly observable tissue damage and did not
appear to cause distress in the experimental animals (Table
18).
Example 8
In Vivo Toxicity Study II
[0245] One group of Sprague-Dawley rats each consisting of five
males and five females were placed in individual cages and
acclimated for five days before dosing. Rats were dosed daily for
14 days. On day 0-13, for 14 consecutive days each rat in Group 1
received by gavage three milliliters of X8P, 1:100 concentration,
respectively. The three-milliliter volume was determined to be the
maximum allowable nasal dose for rats. Prior to dosing on Day 0 and
Day 7, each rat was weighed. Thereafter rats were weighed weekly
for the duration of the study. Animals were observed daily for
sickness or mortality. Animals were allowed to rest for 14 days. On
day 28 the rats were weighed and euthanized. The mean weight
results of the nasal toxicity study are shown in Table 19. Mean
weights for males and females on days 0, 7, and 14, 21 and 28 and
the mean weight gains from day 0-day 28, are also shown in Table
18. One rat died due to mechanical trauma from manipulation of the
gavage tubing during dosing on day 14. All surviving rats gained
weight over the 28 day course of the study and there was no illness
reported. Thus, although tributyl phosphate alone is known to be
toxic and irritating to mucous membranes, when incorporated into
the emulsions utilized in the vaccines of the present invention,
these characteristics are not in evidence. The X8P emulsion, 1:100
concentration, was also tested for dermal toxicity in rabbits
according to the protocols provided in 16 CFR .sctn. 1500.3. The
emulsion was not irritating to skin in the animals tested.
TABLE-US-00019 TABLE 19 Weight Dose Body Body Body Body Body Gain
Rat Volume Weight Weight Weight (g) Weight (g) Weight (g) (g) Day 0
Number Sex mL (g) Day 0 (g) Day 7 Day 14 Day 21 Day 28 Day 28 9028
m 3 332.01 356.52 388.66 429.9 394.07 62.06 9029 m 3 278.62 294.65
296.23 310.7 392.6 113.98 9030 m 3 329.02 360.67 325.26 403.43
443.16 114.14 9031 m 3 334.64 297.04 338.82 357.5 416.89 82.25 9032
m 3 339.03 394.39 347.9 331.38 357.53 18.5 MEAN 266.26 340.65
339.37 400.85 78.18 WTS 9063 F 3 302 298.08 388.66 338.41 347.98
45.98 9064 F 3 254.54 247.97 256.78 278.17 279.2 24.66 9065 F 3
225.99 253.81 273.38 290.54 308.68 82.69 9066 F 3 246.56 260.38
266.21 235.12 272.6 26.04 9067 F 3 279.39 250.97 deceased MEAN
261.69 262.24 296.25 285.56 302.11 53 WTS
Example 9
In Vitro Study with Bacillus anthracis
[0246] Experiments with X8W.sub.60PC preparations to study the
bactericidal effect of the compounds of the present invention on
the spore form of B. anthracis were performed. The sporicidal
activity of different dilutions of X.sub.8W.sub.60PC (in water) on
six different strains of B. anthracis was tested. X.sub.8W.sub.60PC
killed over 98% of seven different strains of anthrax (Del Rio, Tx;
Bison, Canada; South Africa (2 strains); Mozambique; S. Dakota; and
Ames, USAMRID) within 4 hours and is as efficient as 1-10% bleach.
Similar sporicidal activity is found with different dilutions of
X.sub.8W.sub.60PC in media (1:10, 1:100, 1:1000, and 1:5000).
X.sub.8W.sub.60PC can kill anthrax spores in as little as 30
minutes.
Example 10
Mechanisms of Action
[0247] The following example provides an insight into the proposed
mechanisms of action of several nanoemulsions. This example also
demonstrates the sporicidal activity of several nanoemulsions
utilized in the vaccines of the present invention. This mechanism
is not intended to limit the scope of the invention. An
understanding of the mechanism is not necessary to practice the
present invention, and the present invention is not limited to any
particular mechanism. The effect of a GMO/CPC lipid emulsion
("W.sub.808P") and X8P on E. coli was examined. W.sub.808P killed
the E. coli (in deionized H.sub.2O) but X8P was ineffective against
this organism. X8P treated E. coli look normal, with defined
structure and intact lipid membranes. W.sub.808P treated E. coli
have vacuoles inside and the contents have swollen so that the
defined structure of the organism is lost. Without being bound to a
particular theory (an understanding of the mechanism is not
necessary to practice the present invention, and the present
invention is not limited to any particular mechanism), this
observation suggests that W.sub.808P kills the bacteria without
lysing them and instead causes a change in the internal structure,
evident by the vacuolization and swelling. A second study was
performed with Vibrio cholerae. Despite Vibrio cholerae being
closely related to E. coli, X8P, W.sub.808P and X8W.sub.60PC all
killed this organism. Compared to the control, the W.sub.808P
treated Vibrio cholerae again shows swelling and changes in the
interior of the organism, but the cells remain intact. In contrast,
the X8P treated Vibrio cholerae are completely lysed with only
cellular debris remaining. X8W.sub.60PC showed a combination of
effects, where some of the organisms are swelled but intact and
some are lysed. This clearly suggests that X8P, W.sub.808P and
X8W.sub.60PC work by different mechanisms.
[0248] A third comparative study was performed to evaluate efficacy
of the emulsions at various concentrations. As shown in Table 20,
X8W.sub.60PC is more effective as a biocide at lower concentrations
(higher dilutions) in bacteria sensitive to either W.sub.808P or
X8P. In addition, six other bacteria that are resistant to
W.sub.808P and X8P are all susceptible to X8W.sub.60PC. This
difference in activity is also seen when comparing W.sub.808P and
X8P and X8W.sub.60PC in influenza infectivity assays. Both X8P and
X8W.sub.60PC are effective at a 1:10 and 1:100 dilutions and
additionally, X8W.sub.60PC is effective at the lowest
concentration, 1:1,000 dilution. In contrast, W.sub.808P has little
activity even at 1:10 dilution, suggesting that it is not an
effective treatment for this enveloped organism. In addition,
X8W.sub.60PC kills yeast species that are not killed by either
W.sub.808P or X8P.
TABLE-US-00020 TABLE 20 Lowest Nanoemulsion Concentration Required
to Achieve Over 90% Killing of Selected Microorganisms W.sub.808P
X8P X8W.sub.60PC Bacteria Streptococcus pyogenes No killing 10%
0.1% Streptococcus aglactiae 1%* 1% ND Streptococcus pneumonia 10%*
1% 0.1% Staphylococcus aureus No killing No killing 0.1% Neisseria
gonorrhoeae ND 1% 0.1% Haemophilus influenzae 10% 1% 0.1% Vibrio
cholerae 1% 0.1% 0.1% E. coli No killing # No killing 0.1%
Salmonella typhimurium No killing# No killing 10% Shigella
dysenteriae No killing # No killing 0.1% Proteus mirabilis No
killing # No killing 1% Pseudomonas aeruginosa No killing No
killing 10% Bacillus anthracis spores No killing @ 4 H 0.1% @ 4 H
0.1%-0.02% @ 4 H Bacillus cereus spores 10% @ 4 H 1% @ 4 H 0.1% @ 4
H Bacillus subtilis spores No killing @ 24 H No killing @ 24 H 0.1%
@ 4 H Yersinia enterocolitica ND ND 0.1% Yersinia
pseudotuberculosis ND ND 0.1% Fungi Candida albicans No Killing No
Killing 1% (ATCC 90028) Candida tropicalis No Killing No Killing 1%
Viruses Influenza A H2N2 No Killing 1% 0.1% Influenza B/Hong Kong/
ND 1% ND 5/72 Vaccinia ND 1% % Herpes simplex type I ND 1% 0.1%
Sendai ND 1% ND Sindbis ND 1% ND Adenovirus ND No Killing ND *Data
for lower concentrations not available. # No killing except in
deionized water. ND = Not determined.
Example 11
Further Evidence of the Sporicidal Activity of Nanoemulsions
Against Bacillus Species
[0249] The present Example provides the results of additional
investigations of the ability of nanoemulsions to inactivate
different Bacillus spores. The methods and results of these studies
are outlined below.
[0250] Surfactant lipid preparations: X8P, a water-in-oil
nanoemulsion, in which the oil phase was made from soybean oil,
tri-n-butyl phosphate, and TRITON X-100 in 80% water. X8W.sub.60PC
was prepared by mixing equal volumes of X8P with W.sub.808P which
is a liposome-like compound made of glycerol monostearate, refined
Soya sterols, TWEEN 60, soybean oil, a cationic ion
halogen-containing CPC and peppermint oil.
[0251] Spore preparation: For induction of spore formation,
Bacillus cereus (ATTC 14579), B. circulars (ATC 4513), B.
megaterium (ATCC 14581), and B. subtilis (ATCC 11774) were grown
for a week at 37.degree. C. on NAYEMn agar (Nutrient Agar with 0.1%
Yeast Extract and 5 mg/l MnSO.sub.4). The plates were scraped and
the bacteria/spores suspended in sterile 50% ethanol and incubated
at room temperature (27.degree. C.) for 2 hours with agitation in
order to lyse the remaining vegetative bacteria. The suspension was
centrifuged at 2,500.times.g for 20 minutes and the pellet washed
twice in cold diH.sub.2O. The spore pellet was resuspended in
trypticase soy broth (TSB) and used immediately for experiments. B.
anthracis spores, Ames and Vollum 1 B strains, were kindly supplied
by Dr. Bruce Ivins (USAMRIID, Fort Detrick, Frederick, Md.), and
prepared as previously described (Ivins et al., Vaccine 13:1779
[1995]). Four other strains of anthrax were kindly provided by Dr.
Martin Hugh-Jones (LSU, Baton Rouge, La.). These strains represent
isolates with high allelic dissimilarity from South Africa;
Mozambique; Bison, Canada; and Del Rio, Tex.
[0252] In vitro sporicidal assays: For assessment of sporicidal
activity of solid medium, trypticase Soy Agar (TSA) was autoclaved
and cooled to 55.degree. C. The X8P was added to the TSA at a 1:100
final dilution and continuously stirred while the plates were
poured. The spore preparations were serially diluted (ten-fold) and
10 .mu.l aliquots were plated in duplicate (highest inoculum was
10.sup.5 spores per plate). Plates were incubated for 48 hours
aerobically at 37.degree. C. and evaluated for growth.
[0253] For assessment of sporicidal activity in liquid medium,
spores were resuspended in TSB. 1 ml of spore suspension containing
2.times.10.sup.6 spores (final concentration 10.sup.6 spores/ml)
was mixed with 1 ml of X8P or X8W.sub.60PC (at 2.times. final
concentration in diH.sub.2O) in a test tube. The tubes were
incubated in a tube rotator at 37.degree. C. for four hours. After
treatment, the suspensions were diluted 10-fold in diH.sub.2O.
Duplicate aliquots (25 .mu.l) from each dilution were streaked on
TSA, incubated overnight at 37.degree. C., and then colonies were
counted. Sporicidal activity expressed as a percentage killing was
calculated:
cfu [ initial ] - cfu [ post - treatment ] cfu [ initial ] .times.
100. ##EQU00003##
[0254] The experiments were repeated at least 3 times and the mean
of the percentage killing was calculated.
[0255] Electron microscopy: B. cereus spores were treated with X8P
at a 1:100 final dilution in TSB using Erlenmeyer flasks in a
37.degree. C. shaker incubator. Fifty ml samples were taken at
intervals and centrifuged at 2,500.times.g for 20 minutes and the
supernatant discarded. The pellet was fixed in 4% glutaraldehyde in
0.1 M cacodylate (pH 7.3). Spore pellets were processed for
transmission electron microscopy and thin sections examined after
staining with uranyl acetate and lead citrate.
[0256] Germination inhibitors/simulators: B. cereus spores (at a
final concentration 10.sup.6 spores/ml) were suspended in TSB with
either the germination inhibitor D-alanine (at final concentration
of 1 .mu.M) or with the germination stimulator L-alanine+inosine
(at final concentration of 50 .mu.M each) (Titball and Manchee, J.
Appl Bacteriol. 62:269 [1987]; Shibata et al., Jpn J Microbiol.
20:529 [1976]) and then immediately mixed with X8P (at a final
dilution of 1:100) and incubated for variable intervals. The
mixtures were then serially diluted, plated and incubated
overnight. The next day the plates were counted and percentage
sporicidal activity was calculated.
[0257] In vivo sporicidal activity: Two animal models were
developed; in the first B. cereus spores (suspended in sterile
saline) were mixed with an equal volume of X8P at a final dilution
of 1:10. As a control, the same B. cereus spore suspension was
mixed with an equal volume of sterile saline. 100 .mu.l of the
suspensions containing 4.times.10.sup.7 spores was then immediately
injected subcutaneously into CD-1 mice.
[0258] In the second model, a simulated wound was created by making
an incision in the skin of the back of the mice. The skin was
separated from the underlying muscle by blunt dissection. The
"pocket" was inoculated with 200 .mu.l containing
2.5.times.10.sup.7 spores (in saline) and closed using wound clips.
One hour later, the clips were removed and the wound irrigated with
either 2 ml of sterile saline or with 2 ml of X8P (1:10 in sterile
saline). The wounds were then closed using wound clips. The animals
were observed for clinical signs. Gross and histopathology were
performed when the animals were euthanized 5 days later. The wound
size was calculated by the following formula:
1/2a.times.1/2b.times..pi. where a and b are two perpendicular
diameters of the wound.
[0259] In vitro sporicidal activity: To assess the sporicidal
activity of X8P, spores from four species of Bacillus genus, B.
cereus, B. circulans, B. megatetium, and B. subtilis were tested.
X8P at 1:100 dilution showed over 91% sporicidal activity against
B. cereus and B. megaterium in 4 hours. B. circulans was less
sensitive to X8P showing 80% reduction in spore count, while B.
subtilis appeared resistant to X8P in 4 hours. A comparison of the
sporicidal effect of X8P (at dilutions of 1:10 and 1:100) on B.
cereus spores was made with a 1:100 dilution of bleach (i.e.,
0.0525% sodium hypochlorite), and no significant difference was
apparent in either the rate or extent of sporicidal effect. The
other nanoemulsion, X8W.sub.60PC, was more efficient in killing the
Bacillus spores. At 1:1000 dilution, it showed 98% killing of B.
cereus spores in 4 hours (compared to 47% with 1:1000 dilution of
X8P). X8W.sub.60PC at a 1:1000 dilution resulted in 97.6% killing
of B. subtilis spores in 4 hours, in contrast to its resistance to
X8P.
[0260] B. cereus sporicidal time course: A time course was
performed to analyze the sporicidal activity of X8P diluted 1:100
and X8W.sub.60PC diluted 1:1000 against B. cereus over an eight
hour period. Incubation of X8P diluted 1:100 with B. cereus spores
resulted in a 77% reduction in the number of viable spores in one
hour and a 95% reduction after 4 hours. Again, X8W.sub.60PC diluted
1:1000 was more effective than X8P 1:100 and resulted in about 95%
reduction in count after 30 minutes.
[0261] X8P B. anthracis sporicidal activity: Following initial in
vitro experiments, X8P sporicidal activity was tested against two
virulent strains of B. anthracis (Ames and Vollum 1B). It was found
that X8P at a 1:100 final dilution incorporated into growth medium
completely inhibited the growth of 1.times.10.sup.5 B. anthracis
spores. Also, 4 hours incubation with X8P at dilutions up to 1:1000
with either the Ames or the Vollum 1 B spores resulted in over 91%
sporicidal activity when the mixtures were incubated at RT, and
over 96% sporicidal activity when the mixtures were incubated at
37.degree. C. (Table 21).
[0262] Table 21: X8P sporicidal activity against 2 different
strains of Bacillus anthracis spores as determined by colony
reduction assay (% killing). X8P at dilutions up to 1:1000
effectively killed >91% of both spore strains in 4 hours at
either 27 or 37.degree. C.; conditions that differed markedly in
the extent of spore germination. Sporicidal activity was consistent
at spore concentrations up to 1.times.10.sup.6/ml.
TABLE-US-00021 TABLE 21 Ames Ames (cont) Vollum 1 B B. anthracis
Room Temp. 37.degree. C. Room Temp. 37.degree. C. X8P 1:10 91% 96%
97% 99% X8P 1:100 93% 97% 97% 98% X8P 1:1000 93% 97% 98% 99%
[0263] X8W.sub.60PC B. anthracis sporicidal activity: Since
X8W.sub.60PC was effective at higher dilutions and against more
species of Bacillus spores than X8P, it was tested against 4
different strains of B. anthracis at dilutions up to 1:10,000 at RT
to prevent germination. X8W.sub.60PC showed peak killing between
86% and 99.9% at 1:1000 dilution (Table 22).
[0264] Table 22: X8W.sub.60PC sporicidal activity against 4
different strains of B. anthracis representing different clinical
isolates. The spores were treated with X8W.sub.60PC at different
dilutions in RT to reduce germination. There was no significant
killing at low dilutions. The maximum sporicidal effect was
observed at 1:1000 dilution.
TABLE-US-00022 TABLE 22 South Bison, Del Rio, B. anthracis Africa
Canada Mozambigue Texas X8W.sub.60PC 1:10 81.8 85.9 41.9 38
X8W.sub.60PC 1:100 84 88.9 96.5 91.3 X8W.sub.60PC 1:1000 98.4 91.1
99.9 86 X8W.sub.60PC 1:5,000 79.7 41.3 95.7 97.1 X8W.sub.60PC
1:10,000 52.4 80 ND ND
[0265] Electron microscopy examination of the spores:
Investigations were carried out using B. cereus because it is the
most closely related to B. anthracis. Transmission electron
microscopy examination of the B. cereus spores treated with X8P
diluted 1:100 in TSB for four hours revealed physical damage to the
B. cereus spores, including extensive disruption of the spore coat
and cortex with distortion and loss of density in the core.
[0266] Germination stimulation and inhibition: To investigate the
effect of initiation of germination on the sporicidal effect of X8P
on Bacillus spores, the germination inhibitors D-alanine (Titball
and Manchee, 1987, supra), and germination simulators L-alanine and
inosine (Shibata et al., 1976, supra) were incubated with the
spores and X8P for 1 hour. The sporicidal effect of X8P was delayed
in the presence of 10 mM D-alanine and accelerated in the presence
of 50 .mu.M L-alanine and 50 .mu.M inosine.
[0267] In vivo sporicidal activity: Bacillus cereus infection in
experimental animals had been previously used as a model system for
the study of anthrax and causes an illness similar to experimental
anthrax infection (Welkos et al., Infect Immun. 51:795 [1986];
Drobniewski, Clin Microbiol Rev. 6:324 [1993]; Burdon et al., J
Infect Dis. 117:307 [1967]; Fritz et al. Lab Invest. 73:691 [1995];
Welkos and Friedlander, Microb Pathog 5:127 [1988]). Two animal
models of cutaneous B. cereus disease were developed to assess the
in vivo efficacy of X8P. Because these models involve subcutaneous
administration of the nanoemulsion, in vivo toxicity testing of X8P
was performed prior to this application. CD-1 mice injected with
X8P diluted 1:10 in saline as a control did not exhibit signs of
distress or inflammatory reaction, either in gross or histological
analysis. To test the pathogenic effect of B. cereus spores in vivo
and the sporicidal effect of X8P, a suspension of 4.times.10.sup.7
B. cereus spores was mixed with saline or with X8P at a final
dilution of 1:10 and then immediately injected subcutaneously into
the backs of CD-1 mice. Mice which were infected subcutaneously
with B. cereus spores without X8P developed severe edema at 6-8
hours. This was followed by a gray, necrotic area surrounding the
injection site at 18-24 hours, with severe sloughing of the skin
present by 48 hours, leaving a dry, red-colored lesion.
Simultaneous injection of spores and X8P resulted in a greater than
98% reduction in the size of the necrotic lesion from 1.68 cm.sup.2
to 0.02 cm.sup.2 when the spores were premixed with X8P. This was
associated with minimal edema or inflammation.
[0268] In additional studies, a 1 cm skin wound was infected with
2.5.times.10.sup.7 B. cereus spores then closed without any further
treatment. The other groups were infected with the same number of
spores, then 1 hour later the wounds were irrigated with either X8P
or saline to simulate post-exposure decontamination. Irrigation of
experimentally infected wounds with saline did not result in any
apparent benefit. X8P irrigation of wounds infected with B. cereus
spores showed substantial benefit, resulting in a consistent 98%
reduction in the lesion size from 4.86 cm.sup.2 to 0.06 cm.sup.2.
This reduction in lesion size was accompanied by a four-fold
reduction in mortality (80% to 20%) when compared to experimental
animals receiving either no treatment or saline irrigation.
Example 12
Effect of Surfactant Lipid Preparations (SLPS) on Influenza a Virus
Infectivity In Vitro
[0269] The following example describes the effect of emulsions on
Influenza A virus infectivity Enveloped viruses are of great
concern as pathogens. They spread rapidly and are capable of
surviving out of a host for extended periods. Influenza A virus was
chosen because it is a well accepted model to test anti-viral
agents (Karaivanova and Spiro, Biochem J. 329(Pt 3):511 [1998];
Mammen et al., J Med Chem 38:4179 [1995]). Influenza is a
clinically important respiratory pathogen that is highly contagious
and responsible for severe pandemic disease.
[0270] The envelope glycoproteins, hemagglutinin (HA) and
neuraminidase (NA) not only determine the antigenic specificity of
influenza subtypes, but they mutate readily and, as a result, may
allow the virus to evade host defense systems. This may result in
the initiation of disease in individuals that are immune to closely
related strains. The following is a description of the methods and
composition used for determining the efficacy of SLPs in preventing
influenza A infectivity.
[0271] Surfactant lipid preparations (SLPs): The SLPs were made in
a two-step procedure. An oil phase was prepared by blending soybean
oil with reagents listed in Table 1 and heating at 86.degree. C.
for one hour (Florence, 1993). The SLPs were then formed by
injecting water or 1% bismuth in water (SS) into the oil phase at a
volume/volume ratio using a reciprocating syringe pump.
[0272] Viruses: Influenza virus A/AA/6/60 was kindly provided by
Dr. Hunein F. Maassab (School of Public Health, University of
Michigan). Influenza A virus was propagated in the allantoic
cavities of fertilized pathogen-free hen eggs (SPAFAS, Norwich,
Conn.) using standard methods (Barrett and Inglis, 1985). Virus
stock was kept in aliquots (10.sup.8 pfu/ml) of infectious
allantoic fluids at -80.degree. C. Adenoviral vector (AD.RSV
ntlacZ) was provided by Vector Core Facility (University of
Michigan Medical Center, Ann Arbor, Mich.) and was kept in aliquots
(10.sup.12 pfu/ml at -80.degree. C.). The vector is based on a
human adenoviral (serotype 5) genomic backbone deleted of the
nucleotide sequence spanning E1A and E1B and a portion of E3
region. This impairs the ability of the virus to replicate or
transform nonpermissive cells. It carries the E. coli LacZ gene,
encoding .beta.-galactosidase under control of the promoter from
the Rouse sarcoma virus long terminal repeat (RSV-LTR). The vector
also contains a nuclear targeting (designated as nt) epitope linked
to the 5' end of the LacZ gene to facilitate the detection of
protein expression (Baragi et al., 1995).
[0273] Cells: Madin Darby Canine Kidney (MDCK) cells were purchased
from the American Type Culture Collection (ATCC; Rockville, Md.)
and 293 cells (CRL 1573; transformed primary embryonic human
kidney) were obtained from the Vector Core Facility (University of
Michigan Medical Center, Ann Arbor, Mich.). The 293 cells express
the transforming gene of adenovirus 5 and therefore restore the
ability of Ad.RSV ntlacZ vector to replicate in the host cell.
[0274] Cell maintenance media: MDCK cells were maintained in
Eagle's minimal essential medium with Earle's salts, 2 mM
L-glutamine, and 1.5 g/l sodium bicarbonate (Mediatech, Inc.,
Hemdon, Va.) containing 10% fetal bovine serum (FBS; Hyclone
Laboratories, Logan, Utah). The medium was supplemented with 0.1 mM
non-essential amino acids, 1.0 mM sodium pyruvate, 100 U
penicillin/ml and streptomycin 100 .mu.g/ml (Life Technologies,
Gaithersburg, Md.). The 293 cells were maintained in Dulbecco's
modified Eagle medium (Mediatech, Inc., Herndon, Va.), containing 2
mM L-glutamine, 0.1 mM non-essential amino acids, and 1.0 mM sodium
pyruvate. It also contained 100 U penicillin/ml and streptomycin
100 .mu.g/ml (Life Technologies, Gaithersburg, Md.) and was
supplemented with 10% FBS (Hyclone Laboratories, Logan, Utah).
[0275] Virus infection media: Influenza A infection medium was the
MDCK cell maintenance medium (without FBS) supplemented with 3.0
.mu.g/ml of tolylsulfonyl phenylalanyl chloromethyl ketone
(TPCK)-treated trypsin (Worthington Biochemical Corporation,
Lakewood, N.J.). Adenovirus infection medium was 293T cell
maintenance medium with a reduced concentration of serum (2%
FBS).
[0276] Influenza A overlay medium: Overlay medium consisted of
equal amounts of 2.times. infection medium and 1.6% SEAKEM ME
agarose (FMC BioProducts, Rockland, Md.). Staining agarose overlay
medium consisted of agarose overlay medium plus 0.01% neutral red
solution (Life Technologies, Gaithersburg, Md.) without
TPCK-treated trypsin.
[0277] Plaque reduction assays (PRA): The plaque reduction assay
was performed with a modification of the method described elsewhere
(Hayden et al., 1980). MDCK cells were seeded at 1.times.10.sup.5
cells/well in 12-well FALCON plates and incubated at 37.degree.
C./5% CO.sub.2 for 3 days. Approximately 1.times.10.sup.8 pfu of
influenza A virus was incubated with surfactant lipid preparations
as described below. The influenza A virus-SLP treatments and
controls were diluted in infection medium to contain 30-100 pfu/250
.mu.l. Confluent cell monolayers were inoculated in triplicate on 3
plates and incubated at 37.degree. C./5% CO.sub.2 for 1 h. The
inoculum/medium was aspirated and 1 ml of agarose overlay
medium/well was added and plates were incubated at 37.degree. C./5%
CO.sub.2 until plaques appeared. Monolayers were stained with the
agarose overlay medium and incubation was continued at 37.degree.
C./5% CO.sub.2. Plaques were counted 6-12 h after staining. The
average plaque count from 9 wells with lipid preparation
concentration was compared with the average plaque count of
untreated virus wells.
[0278] In situ cellular enzyme-linked immunosorbent assay (ELISA):
To detect and quantitate viral proteins in MDCK cells infected with
influenza A virus, the in situ cellular ELISA was optimized.
Briefly, 2.times.10.sup.4 MDCK cells in 100 .mu.l complete medium
were added to flat-bottom 96-well microtiter plates and incubated
overnight. On the next day, the culture medium was removed and
cells were washed with serum free maintenance medium. One hundred
.mu.l of viral inoculum was added to the wells and incubated for 1
hour. The viral inoculum was removed and replaced with 100 .mu.l of
MDCK cell maintained medium plus 2% FBS. The infected MDCK cells
were incubated for an additional 24 h. Then the cells were washed
once with PBS and fixed with ice cold ethanol:acetone mixture (1:1)
and stored at -20.degree. C. On the day of the assay, the wells of
fixed cells were washed with PBS and blocked with 1% dry milk in
PBS for 30 min. at 37.degree. C. One hundred .mu.l of ferret
anti-influenza A virus polyclonal antibody at 1:1000 dilution
(kindly provided by Dr. Hunein F. Maassab, School of Public Health,
University of Michigan) was added to the wells for 1 hr at
37.degree. C. The cells were washed 4 times with washing buffer
(PBS and 0.05% TWEEN-20), and incubated with 100 .mu.l at 1:1000
dilution of goat anti-ferret peroxidase conjugated antibody
(Kirkegaard & Perry Laboratories, Gaithersburg, Mass.) for 30
min. at 37.degree. C. Cells were washed 4 times and incubated with
100 .mu.l of 1-STEP TURBO TMB-ELISA substrate (Pierce, Rockford,
Ill.) until color had developed. The reaction was stopped with 1 N
sulfuric acid and plates were read at a wavelength of 450 nm in an
ELISA microtiter reader.
[0279] .beta.-galactosidase assay: .beta.-galactosidase assay was
performed on cell extracts as described elsewhere (Lim, 1989).
Briefly, 293 cells were seeded on 96-well "U"-bottom tissue culture
plates at approximately 4.times.10.sup.4 cells/well and incubated
overnight at 37.degree. C./5% CO.sub.2 in maintenance medium. The
next day, the medium was removed and the cells were washed with 100
.mu.l Dulbecco's phosphate buffered saline (DPBS). Adenovirus stock
was diluted in infection medium to a concentration of
5.times.10.sup.7 pfu/ml and mixed with different concentrations of
X8P as described below. After treatment with X8P, virus was diluted
with infection medium to a concentration of 1.times.10.sup.4 pfu/ml
and overlaid on 293 cells. Cells were incubated at 37.degree. C./5%
CO.sub.2 for 5 days, after which the plates were centrifuged, the
medium was removed and the cells were washed three times with PBS
without Ca++ and Mg++. After the third wash, the PBS was aspirated
and 100 .mu.l of 1.times. Reporter Lysis Buffer (Promega, Madison,
Wis.) was placed in each well. To enhance cell lysis, plates were
frozen and thawed three times and the .beta.-galactosidase assay
was performed following the instruction provided by the vendor of
.beta.-galactosidase (Promega, Madison, Wis.) with some
modifications. Five microliters of cell extract was transferred to
a 96-well flat bottom plate and mixed with 45 .mu.l of 1.times.
Reporter Lysis Buffer (1:10). Subsequently 501 of 2.times. assay
buffer (120 mM Na.sub.2HPO.sub.4, 80 mM NaH.sub.2PO.sub.4, 2 mM
MgCl.sub.2, 100 mM .beta.-mercaptoethanol, 1.33 mg/ml ONPG (Sigma,
St. Louis, Mo.) were added and mixed with the cell extract. The
plates were incubated at RT until a faint yellow color developed.
At that time the reaction was stopped by adding 100 .mu.l of 1 M
sodium bicarbonate. Plates were read at a wavelength of 420 nm in
an ELISA microplate reader. The units of .beta.-galactosidase in
each cell extract was calculated by regression analysis by
reference to the levels in the standard and divided by milligrams
of protein in the cell extract sample.
[0280] Cellular toxicity and virus treatment with lipid
preparations: Prior to viral susceptibility testing, cytotoxicity
of SLPs on MDCK and 293 cells was assessed by microscope inspection
and MTT assay. The dilutions of the mixture of virus and SLPs
applied in susceptibility testing were made to be at least one
order of magnitude higher than the safe concentration of SLP
assessed. Approximately 1.times.10.sup.8 pfu of either influenza A
or adenovirus were incubated with lipid preparation at final
concentrations of 1:10, 1:100, and 1:1000 for different time
periods as indicated in results on a shaker. After incubation,
serial dilutions of the SLP/virus mixture were made in proper
infection media and overlaid on MDCK (influenza A) or 293
(adenovirus) cells to perform PRA, cellular ELISA or
.beta.-galactosidase assays as described above.
[0281] Electron microscopy: Influenza A virus was semi-purified
from allantoic fluid by passing through a 30% sucrose cushion
prepared with GTNE (glycine 200 mM, Tris-HCl 10 mM (pH 8.8), NaCl
100 mM, and EDTA 1 mM) using ultra centrifugation (Beckman rotor SW
28 Ti, at 20,000 rpm for 16 hours). Pelleted virus was
reconstituted in GTNE. Ten microliters of respective samples
(adenovirus, influenza virus, adenovirus+X8P, influenza virus+X8P)
were incubated for 15 and 60 min, then placed on parlodian coated
200 mesh copper grids for 2 min. Five .mu.l of 2%
cacodylated-buffered glutaraldehyde was then added. The fluid was
removed with filter paper after 3 min. Ten microliters of 7% uranyl
acetate was added to the grid and drawn off with filter paper after
30 sec. The grids were allowed to dry 10 min and examined on a
Philips EM400T transmission electron microscope. Micrographs were
recorded in Fuji FG film at magnifications of 200,000.times..
[0282] Susceptibility testing of influenza A to SLPS: The effect of
four surfactant lipid preparations (X8P, NN, W.sub.808P, and SS) on
influenza A infection of MDCK cells was investigated. All tested
preparations inhibited influenza A virus infection to varying
degrees. X8P and SS exhibited over 95% inhibition of influenza A
infection at a 1:10 dilution. NN and W.sub.808P showed only an
intermediate effect on influenza A virus, reducing infection by
approximately 40%. X8P's virucidal effect was undiminished even at
a 1:100 dilution. SS showed less effect at a 1:100 dilution
inhibiting influenza A infection by 55%. These two lipid
preparations at 1:1000 dilution displayed only weak inhibitory
effect on virus infectivity at the range of 22-29%.
[0283] Since X8P and SS both showed strong inhibitory effect on
virus infectivity, PRA was used to verify data obtained from
cellular ELISA. PRA confirmed the efficacy of X8P and SS. X8P
reduced the number of plaques from an average of 50.88 to 0 at a
1:10 dilution (Table 23). At dilution 1:100, X8P maintained
virucidal effectiveness. At dilution 1:100 SS reduced the number of
plaques only approximately 7% as compared with untreated virus.
TABLE-US-00023 TABLE 23 Plaque forming Plaque forming Treatment
units units Dilution of the agent: X8P SS 1:10.sup.a 0.00.sup.b
(+/-0.00).sup.c 0.00 (+/-0.00) 1:100 0.00 (+/-0.00) 1.55 (+1-0.12)
Untreated virus 50.88 (+/-1-0.25) 23.52 (+/-0.18) .sup.aVirus was
incubated with SLPs for 30 minutes. .sup.bNumber of plaques.
[0284] Kinetics of X8P action on influenza A virus: To investigate
the time requirement for X8P to act on influenza A infectivity,
virus was incubated with X8P at two dilutions (1:10, 1:100) and
four different time intervals (5, 10, 15, 30 min). Subsequently, a
plaque reduction assay was performed. As shown in Table 24, after
five min of incubation with X8P at either dilution, influenza A
virus infectivity of MDCK cells was completely abolished. There was
no significant difference between the interaction of X8P with
influenza A virus regardless of concentration or time.
TABLE-US-00024 TABLE 24 Plaque Forming Units after X8P
Treatment/Dilution Time (min) 1:10 1:100 untreated 5 0.00.sup.a
0.00 35.25 (+/-0.00).sup.b (+/-0.00) (+/-0.94) 10 0.00 0.25 39.25
(+/-0.00) (+/-0.12) (+/-1.95) 15 0.00 0.25 31.50 (+/-0.00)
(+/-0.12) (+/-1.05) 30 0.00 0.00 26.50 (+/-0.00) (+/-0.00)
(+/-0.08)
[0285] Anti-influenza A efficacy of X8P: Since TRITON X-100
detergent has anti-viral activity (Maha and Igarashi, Southeast
Asian J Trop Med Public Health 28:718 [1997]), it was investigated
whether TRITON X-100 alone or combined with individual X8P
components inhibits influenza A infectivity to the same extent as
X8P. Influenza A virus was treated with: 1) X8P, 2) the combination
of tri(n-butyl)phosphate, TRITON X-100, and soybean oil (TTO), 3)
TRITON X-100 and soybean oil (TO), or 4) TRITON X-100 (T) alone.
X8P was significantly more effective against influenza A virus at
1:10 and 1:100 dilutions (TRITON X-100 dilution of 1:500, and
1:5000) than TRITON X-100 alone or mixed with the other components
tested. At the dilution 1:1000, X8P (TRITON X-100 dilution of
1:50,000) was able to reduce influenza A infection of MDCK cells by
approximately 50% while TRITON X-100 alone at the same
concentration was completely ineffective.
[0286] X8P does not affect infectivity of non-enveloped virus: To
investigate whether X8P may affect the infectivity of non-enveloped
virus, genetically engineered adenovirus containing LacZ gene was
used, encoding .beta.-galactosidase. This adenovirus construct is
deficient in the transforming gene and therefore can replicate and
transform only permissive cells containing the transforming gene of
adenovirus 5. The 293 cells, which constitutively express
transforming gene, were employed to promote adenovirus replication
and production of .beta.-galactosidase enzyme. X8P treatment did
not affect the ability of adenovirus to replicate and express
.beta.-galactosidase activity in 293 cells. Both X8P treated and
untreated adenovirus produced approximately 0.11 units of
.beta.-galactosidase enzyme.
[0287] Action of X8P on enveloped virus: Since X8P only altered the
infectivity of enveloped viruses, the action of this nanoemulsion
on enveloped virus integrity was further investigated using
electron microscopy. After a 60 min incubation with 1:100 dilution
of X8P, the structure of adenovirus is unchanged. A few
recognizable influenza A virions were located after 15 min
incubation with X8P, however, no recognizable influenza A virions
were found after 1 h incubation. X8P's efficacy against influenza A
virus and its minimal toxicity to mucous membranes demonstrates its
potential as an effective disinfectant and agent for prevention of
diseases resulting from infection with enveloped viruses.
Example 13
The Ability of Nanoemulsion/Influenza Compositions to Induce an
Immune Response in Mice
[0288] This Example describes the ability of an exemplary
nanoemulsion composition to elicit a specific immune response in
mice.
[0289] A. The Effect of Pre-Treatment with Nanoemulsion on Immune
Response to Influenza A
[0290] Mice were pretreated with nasally-applied nanoemulsion (1.0%
8N8 and 1.0% or 0.2% 20N10) 90 minutes before exposure to influenza
virus (5.times.10.sup.5 p.f.u./ml) by nebulized aerosol. Morbidity
from pretreatment with nanoemulsion was minimal and, as compared to
control animals, mortality was greatly diminished (20% with
pretreatment vs. 80% in controls, Donovan et al., Antivir Chem
Chemother., 11:41 [2000]). Several of the surviving, emulsion
pretreated animals had evidence of immune reactivity and giant-cell
formation in the lung that were not present in control animals
treated with emulsion but not exposed to virus. All of the
pretreated animals had evidence of lipid uptake in lung
macrophages.
[0291] FIG. 6 shows serum anti-influenza titers in mice treated
with different preparations of virus. Only animals whose nares were
exposed to virus/nanoemulsion show significant IgG titers. In
animals exposed to virus without pretreatment or emulsion alone, no
immune response to influenza virus was observed. Antibody titers to
influenza virus in the serum of exposed animals was measured and
found that animals pretreated with emulsion and exposed to virus
had high titers of virus-specific antibody (FIG. 6). This immune
response was not observed in control animals exposed to virus
without pretreatment. The high titers of antibody in these animals
prompted experiments to determine whether or not the
co-administration of emulsion and virus would yield protective
immunity without toxicity.
[0292] B. The Effect of Nanoemulsion/Influenza a Virus
Co-Administration on Immune Response
[0293] X8P emulsion was pre-mixed with the virus. The final
emulsion concentration was 2% and virus concentration was
2.times.10.sup.6 pfu/ml. The emulsion/virus solution (25 .mu.l) of
the emulsion/virus solution was administered to the nares of mice
under mild anesthesia. A control group received the same viral dose
inactivated using 1:4000 dilution of formaldehyde solution
incubated for 3 days to ensure complete inactivation. Another
control group included mice that received a reduced dose of virus
(100 pfu/mouse). Additional controls received nanoemulsion alone or
saline alone.
[0294] Three weeks later, mice received a second dose of the
emulsion/virus vaccine. Representatives of the group were tested
for the development of serum antibodies and some were challenged
with a lethal dose of influenza A virus to check for any developed
immunity. Two weeks later, mice were tested for the development of
a protective immune response in their serum. Some mice were
challenged with a lethal dose of influenza virus to check for the
development of protective immunity. All the challenged mice were
observed for 14 days for signs of disease. Sera were tested for the
presence of specific antibodies against influenza virus.
[0295] The results of the experiment are shown in Table 25 and
FIGS. 7-8. None of the 15 animals died from exposure to a LD80 of
virus after two administrations of 5.times.10.sup.4 pfu of virus
mixed in nanoemulsion, whereas the expected 80% of control animals
died from this exposure. The same dose of formalin killed virus
applied to the nares provided no protection from death and resulted
in much lower titers of virus-specific antibody.
[0296] FIG. 7 shows bronchial IgA anti-influenza titers in mice
treated with different preparations of virus. Animals whose nares
were exposed to virus/nanoemulsion show significant IgA titers. In
animals exposed to killed virus or emulsion alone, a much lower IgA
titer was observed.
[0297] FIG. 8 shows serum anti-influenza titers in mice treated
with two doses of several different preparations of virus. As
compared to the animals in FIG. 6, the titers are much higher,
particularly in the virus/emulsion treated animals. This indicates
a "booster" response to the second administration. This example
demonstrates that the administration of both nanoemulsion and
killed virus is both necessary and sufficient to elicit a specific
immune response in mice.
TABLE-US-00025 TABLE 25 Mortality of Influenza Exposed Animals
Receiving Intranasal Pretreatment Mortality Death (%) No
Pre-treatment 13/15 87 (5 .times. 10.sup.4 pfu) Emulsion Alone
12/15 80 Formalin Killed Virus 10/15 75 (5 .times. 10.sup.4 pfu)
Emulsion and Virus 0/15 0 Reduced Virus alone 6/15 40 (100 pfu)
[0298] Additional experiments were performed to investigate the
possibility that a small amount of residual, live virus in the
nanoemulsion was producing a subclinical infection that provided
immunity. An additional group of animals were given approximately
100 pfu of live virus intranasally in an attempt to induce a
low-level infection (approximately four times the amount of live
virus present after 15 minutes of treatment with nanoemulsion).
While there was a reduction in death rates of these animals, the
amount of protection observed was insignificant and none of these
animals developed virus-specific antibodies (Table 25). This result
indicates that it was not merely a sub-lethal viral infection
mediating the immune response but that the emulsion was
specifically enhancing the virus-specific immune response. The
protective immunity was obtained following only two applications
(immunizations) of the emulsion/virus mix, and appeared to increase
after each application suggesting a "booster effect."
Virus-specific antibody titers were maintained for six weeks until
the end of the experiment.
Example 14
Testing of Nanoemulsion Vaccines
[0299] This Example describes experiments useful in testing
potential nanoemulsion vaccines for their safety and efficacy.
[0300] A. Pre-Exposure Prophylaxis and Induction of Immunity
[0301] Intranasal prophylaxis: 6 groups of animals (Table 26)
receive the following schedule of treatments intranasally with
15-60 minute intervals in between. Animals are monitored for any
sign of diseases. Blood, broncho-alveolar lavage fluid and nasal
washing are collected and tested for pathogen specific antibody
titer using ELISA (Fortier et al., [1991]; Jacoby et al., [1983],
and Takao et al., [1997]). Two weeks later, surviving animals are
challenged with a lethal dose of the pathogen to test for the
development of a protective immune-response. Terminally ill animals
are sacrificed humanely as soon as identified, as are all other
animals at the end of the experiment (at least two weeks after the
challenge). Blood and tissue are harvested for histopathological
examination and both the serologic and cell-mediated immune
responses are determined.
TABLE-US-00026 TABLE 26 Treatment Groups of Animal in Exposure
Trials Group Pre-treatment Treatment 1 Diluted Nanoemulsion Live
Pathogen 2 Diluted Nanoemulsion Formalin Killed Pathogen 3 Diluted
Nanoemulsion PBS 4 PBS Live Pathogen 5 PBS Formalin Killed Pathogen
6 PBS PBS
B. Evaluation of the Adjuvant Activity of the Nanoemulsion
[0302] Cell-mediated immune responses are evaluated in vitro. The
evaluation is performed on immunocompetent cells harvested from
euthanized animals obtained from the experiment described above
(section A). T-cells proliferation response is assessed after
re-stimulation with antigen. Cells are re-stimulated with whole
pathogen or pathogen constituents such as DNA, RNA or proteins
alone or mixed with nanoemulsion. Proliferation activity is
measured by H3-thymidine uptake or Cell Proliferation ELISA
chemiluminiscence. In addition to proliferation, Th1 and Th2
cytokine responses are measured to qualitatively evaluate the
immune response. These include IL-2, TNF-.gamma., IFN-.gamma.,
IL-4, IL-6, IL-11, IL-12, etc.
[0303] Proliferation and cytokine response patterns are compared
with the results obtained in Section A above. After careful
analysis of the data, nanoemulsions are modified by substituting
specific components with other oils, detergents or solvents. Other
desired adjuvants such as CpG, chemokines and dendrimers are added
to the emulsion/pathogen mix to evaluate their enhancement of
immune responses, along with potential toxicity.
C. Development of Rapid and Effective Mucosal Vaccines
[0304] This example provides a non-limiting example of methods for
testing the nanoemulsion vaccines of the present invention.
Intranasal vaccination: Animals are divided into 6 groups. Each
group receives a different intranasal challenge to evaluate the
resulting immune response:
1. Nanoemulsion alone (Negative control) 2. Pathogen alone
(Positive control). 3. Nanoemulsion/pathogen mixture, prepared
immediately prior to administration. 4. Nanoemulsion/pathogen
mixture, prepared 3 days before administration. 5. Formaldehyde
killed pathogen.
[0305] Table 27 shows the challenge protocol for vaccine studies.
All challenged animals are monitored daily for any signs of
illness. Serum is tested for pathogen specific antibody titer using
ELISA (Fortier et al., Infect. Immun., 59:2922 [1991], Jacoby et
al., Lab. Anim. Sci., 33:435 [1983], and Takao et al., J. Virol.,
71:832 [1997]). Any terminally ill animals are humanely euthanized,
with serum harvested for antibody titer and tissues collected for
histopathologic examination. Harvested spleen cell and lymph node
cell suspensions are used to determine cell-mediated immune
responses. At the end of the experiment, all remaining animals are
humanely sacrificed for similar analysis.
TABLE-US-00027 TABLE 27 Challenge Protocol for Vaccine Studies Day
Procedure 0 Start of the treatment for all groups. 14 Blood samples
are collected from all the animals. One group of animals is
sacrificed for BAL, nasal washing, organs and histopathology. One
group of animals is challenged with a lethal dose of the pathogen.
The rest of the animals receive second dose of the emulsion/vaccine
treatment. 35 Blood samples are collected from all the animals. One
group of animals is sacrificed for BAL, nasal washing, organs and
histopathology. One group of animals is challenged with a lethal
dose of the pathogen. 49 Blood samples are collected from all the
animals. The remaining animals are sacrificed for BAL, nasal
washing, organs and histopathology.
Example 15
Protection of Mice from Viral Pneumonitis after Intranasal
Immunization with Influenza a and Nanoemulsion
A. Material and Methods
Animals
[0306] Female C3H/HeNHsd (Harlan, Indianapolis, Ind.) 5-week-old,
specific-pathogen-free mice were used in all experiments.
Virus
[0307] Influenza A/Ann Arbor/6/60 virus (H.sub.2N.sub.2), mouse
adapted, F.sub.-14-95, E.sub.1, M.sub.3, E.sub.1, SE.sub.1 was
provided by Dr. Hunein Maassab (School of Public Health, University
of Michigan, Ann Arbor, Mich.). Influenza A/Puerto Rico/8/34 virus
(H1N1), mouse adapted, F.sub.8, M.sub.593, E.sub.173, SE.sub.1 was
from ATCC (Rockville, Md.). All viruses were propagated in
allantoic cavities of fertilized pathogen-free hen eggs (SPAFAS,
Norwich, Conn.) using standard methods described elsewhere
(Herlocher et al., Virus Res., 42:11 [1996]). Virus stocks were
kept in aliquots of infectious allantoic fluids at -80.degree. C.
The virus was purified on sucrose gradient 15-60% solution at
100,000 g for 90 min at 4.degree. C., as described previously
(Merton et al., Production of influenza virus in cell cultures for
vaccine preparation. In: Novel Strategies in Design and Production
of Vaccines. Edited by S. Cohen and A. Shafferman, Plenum Press,
New York, 1996. pp. 141-151). The band containing the virus was
collected, diluted in NTE buffer (100 mM NaCl, 10 mM Tris-HCl, 1 mM
EDTA, pH=7.5) and spun down at 100,000.times.g for 60 min at
4.degree. C. The virus pellet was resuspended in NTE buffer and
stored at -80.degree. C.
Inactivation of Virus with Formaldehyde
[0308] Virus inactivation was performed as previously described
(Chen et al., J. Virol. 61:7 [1987]; Novak et al., Vaccine 11:1
[1993]). Briefly, different doses (10.sup.3-10.sup.5 pfu) of virus
were incubated in formaldehyde solution (dilution 1:4000) for 3
days and subsequently administrated to animals.
Inactivation of Virus with X8P Nanoemulsion
[0309] Intact influenza A virus at various concentrations of
2.times.10.sup.4-5.times.10.sup.5 pfu was mixed with equal volume
of 4% X8P nanoemulsion (final concentration: 2%) and incubated at
37.degree. C. for 60 min.
Preparation of Nanoemulsion and Toxicity Testing
[0310] The X8P surfactant nanoemulsion was prepared in a two-step
procedure. An oil phase was prepared by blending the following
ingredients: TBP (final concentration 8%), Triton X-100 (8%) and
soybean oil (64%) and heating at 70.degree. C. for 30 minutes (See
e.g., U.S. Pat. No. 6,015,832 and U.S. Patent Application
20020045667, each of which is herein incorporated by reference).
The surfactant nanoemulsion was then formed by mixing with water
(20%) using a Silverson L4RT Mixer for 3 minutes at 10,000 rpm.
Triton X-100 was purchased from Sigma Chemicals (St. Louis, Mo.),
TBP was purchased from Aldrich (Milwaukee, Wis.), and soybean oil
was purchased from Croda Inc. (Mill Hill, Pa.). The X8P
nanoemulsion was tested for animal toxicity as previously described
(See e.g., above examples). Briefly, the mice were anaesthetized
with metofane and different concentrations of nanoemulsion (1, 2,
and 4%) at a volume of 50 .mu.l (25 .mu.l/nare) were administrated
to mice intranasally. All tested concentrations of nanoemulsion
were well tolerated after direct intranasal instillation in mice.
Based on these data, 2% X8P was chosen for the immunization
study.
Plaque and Plaque Reduction Assays
[0311] Plaque assays (PA) were performed on MDCK monolayer cells in
six-well plates as previously described (Myc et al., J. Virol.
Meth. 77:165 [1999]). Plaque reduction assays (PRA) were performed
with a modification of the method described by Hayden et al.
(Antimicrob. Agents and Chemother., 17:865 [1980]). MDCK cells were
grown in 150.times.25 mm petri dishes to 80% confluency.
Approximately 1.times.10.sup.8 pfu influenza A virus was incubated
either with nanoemulsion or PBS for 30 min at room temperature
(RT). After incubation, nanoemulsion-treated and untreated virus
were resuspended in 250 ml medium and the entire volume of viral
suspension was placed on separate cell monolayers and incubated for
1 h, following the plaque assay method as previously described (Myc
et al., supra).
Immunizations and Experimental Design
[0312] All groups of mice were treated intranasally with viral or
control solutions in a total volume of 50 .mu.l (25 .mu.l/nare) as
described in the Results section below. Briefly, each mouse was
halothane anesthetized and held inverted with the nose down until
droplets of emulsion applied to external nares were completely
inhaled. All mice were treated once on day 1 of the experiment. On
day 21, mice were challenged with LD.sub.100 either with congenic
virus (used for intranasal treatment) or heterogenic virus. After
the challenge, mice were monitored daily for clinical signs of
illness for 14 days. Clinical signs of illness were graded on a
scale of 0-3, where 0 indicated no significant clinical
abnormality; 1 indicated mild symptoms including piloerection,
hunched back and loss of movement; 2 indicated cyanosis, dyspnea,
circulatory compromise tachypnea and a rectal temperatures
<33.degree. C.; and 3 indicated death of the animal. Rectal core
body temperatures were recorded with a Model BAT-12 digital
thermometer fitted with a RET-3 type T mouse rectal probe
(Physitem, Clifton, N.J.) (Rozen et al., Meth. Mol. Biol., 132:365
[2000]). Mice with core body temperatures falling below 33.degree.
C. were judged to be terminally moribund and humanely euthanized
(Stevenson et al., J. Immunol., 157:3064 [1996]). Mice that
survived 14 days after challenge had normal body temperatures and
no clinical signs of illness.
Collection of Blood and Tissue Samples
[0313] Blood samples were obtained either from the tail vein or
from euthanized animals by cardiac puncture at different time
intervals during the course of experiment. Samples of lungs,
regional lymph nodes, spleen, and liver were collected from
euthanized animals and processed following the RT PCR or
proliferation assay protocols as described below.
RT-PCR Detection of Viral RNA
[0314] The following primers for 246 bp fragment of M gene,
conserved for A strains, were used for PCR: 5'
catggaatggctaaagacaagacc (forward; SEQ ID NO:1), and
5'aagtgcaccagcagaataactgag (reverse; SEQ ID NO:2), as described
previously (Schweiger et al., J. Clin. Microbiol., 38:1552 [2000]).
The primers were ordered from Operon Technologies, Inc. (Alameda,
Calif.). Viral RNA was isolated from tissue homogenates with the
use of Tri Reagent (MRC, Cincinnati, Ohio). Lung, mediastinal lymph
node, spleen and liver were used for RNA extraction. The cDNA
synthesis was carried out with 2.0 .mu.g of total tissue RNA using
5.0 mM MgCl.sub.2, 500 .mu.M of each dNTP, 2.5 .mu.M random hexamer
primers, 0.4 U/.mu.l of RNase inhibitor and 2.5 U/.mu.l of
Superscript II RT (Invitrogen, Rockville, Md.). Thermal cycling was
performed in a total volume of 20 .mu.l using 3 single cycles at
25.degree. C. for 12 min, at 42.degree. C. for 50 min, then
70.degree. C. for 15 min (GeneAmp PCR System 2400/Perkin Elmer).
The PCR amplification was carried out with 0.01-0.1 .mu.g of cDNA
using 0.2 .mu.M of each primer, 0.2 mM of each dNTP, 1.5 mM
MgCl.sub.2, 0.1 U/.mu.l of Taq DNA Polymerase (Roche Molecular
Biochemicals, Indianapolis, Ind.). PCR reactions in a total volume
of 20 .mu.l were incubated at 94.degree. C. for 2 min, and then 35
cycles were performed with annealing at 62.degree. C., extension at
72.degree. C. and denaturation at 94.degree. C. Post-PCR analysis
was performed on a 2% Nusive/1% agarose gel using Tris-acetate
buffer for electrophoresis and ethidium bromide for DNA staining.
Analysis was performed using a photoimaging camera and software
from BioRad (Hercules, Calif.).
Specific Anti-Virus IgG Determination
[0315] IgG-specific Ab titers were determined in ELISA. Microtiter
plates (NUNC) were pretreated with 0.5% glutaraldehyde (Sigma, St.
Louis, Mo.) in PBS for one hour at 56.degree. C. and washed 4 times
with PBS. Influenza A virus (5.times.10.sup.3 pfu/well) in PBS was
placed on the pre-treated plates and incubated either at 37.degree.
C. for two hours or overnight at 4.degree. C. The virus was
aspirated; plates were washed with PBS and fixed with
ethanol-acetone (1:1) fixative for 15 min at -20.degree. C. After
fixation, plates were washed again and blocked for 30 min with
blocking buffer (1% dry milk in PBS). Blocking buffer was removed
and plates were sealed and stored at 4.degree. C. until used. Serum
samples and positive and negative control sera were serially
diluted in dilution buffer (0.1% BSA in PBS) and incubated on virus
coated plates at 37.degree. C. for 30 min. After washing with
washing buffer (0.05% Tween 20 in PBS), biotinylated anti-mouse IgG
antibody was added and plates were incubated at 37.degree. C. for
30 min. Plates were washed again and incubated with streptavidin-AP
(Sigma, St. Louis, Mo.), following wash and incubation with AP
substrate (Sigma, St. Louis, Mo.). Plates were incubated at room
temperature until color developed. The reaction was stopped with 1N
NaOH and the plates were read on an ELISA reader at 405 nm.
Antibody titers were determined arbitrarily as the highest serum
dilution yielding absorbency three times above the background
(Kremer et al., Infection and Immunity 66:5669 [1998]).
Proliferation Assay
[0316] Mouse spleens were disrupted in PBS to obtain the single
cell suspension. Cells were washed in PBS and red blood cells were
lysed using ammonium chloride lysis buffer. Splenocytes were then
resuspended in the culture medium (RPMI 1640 supplemented with 10%
FBS, L-glutamine and penicillin/streptomycin) and seeded
1.5.times.10.sup.5 cells/250 .mu.l/well in 96-well microtiter
plate. Cells were then incubated either with the mitogen PHA-P (2.5
.mu.g/well) for 3 days (Stevenson et al., supra) or influenza A
virus at concentration of 6.times.10.sup.3 pfu/well for 6 days,
following overnight BrdU labeling. Cell proliferation was measured
using a Cell Proliferation Chemiluminescence ELISA following the
manufacturer's instruction (Roche Diagnostics, Indianapolis, Ind.).
Measurement of relative light units was performed using a standard
luminometer.
In Vitro Cytokine Production
[0317] Splenocytes were resuspended in culture medium (RPMI 1640
supplemented with 10% FBS, L-glutamine and penicillin/streptomycin)
and seeded 1.5.times.10.sup.5 cells/250 .mu.l/well in microtiter
flat-bottom plates. Cells were then incubated either with the
mitogen PHA-P (2.5 .mu.g/well) for 3 days (Stevenson et al., supra)
or influenza A virus at a concentration of 6.times.10.sup.3
pfu/well for 6 days. Supernatant was then harvested and subjected
to quantitate cytokine concentration.
Quantitation of Cytokines
[0318] IL-2, IL-4, IL-12, and IFN-.gamma. cytokine levels in serum
and splenocyte supernatants were performed using QUANTIKINE M ELISA
kits (R&D Systems, Inc.) according to manufacturers'
instructions.
Flow Cytometric Analysis
[0319] Antibodies specific to mouse molecules CD3, CD4, CD8 and
CD19 (BD PharMingen, San Diego, Calif.) directly labeled with
either PE or FITC were used in flow cytometric analysis. Single
cell suspensions of splenocytes were incubated with antibodies for
30 min on ice and washed with PBS containing 0.1% BSA. Samples were
acquired on a Coulter EPICS-XL MCL Beckman-Coulter flow cytometer
and data were analyzed using Expo32 software (Beckman-Coulter,
Miami, Fla.).
Histology
[0320] Lungs were fixed by inflation with 1 ml of 10% neutral
buffered formalin, excised en bloc and immersed in neutral buffered
formalin. After paraffin embedding, 5 .mu.m sections were cut and
stained with hematoxylin and eosin, and viewed by light
microscopy.
Statistical Methods
[0321] The means, standard deviation, standard error and
.chi..sup.2 analysis with Yate's correction were calculated. To
compare the control group to the study groups, Cox regression was
used (Cox et al., Journal of the Royal Statistical Society. Series
B, 34:187 [1972]). The difference between the study groups and the
control group was tested using the log-likelihood ratio test.
B. Results
Virucidal Activity of Nanoemulsion on Influenza A Virus
[0322] The virucidal effect of X8P nanoemulsion on influenza A
virus, Ann Arbor strain was tested prior to intranasal treatment of
animals with the virus/nanoemulsion mixture. The virus at
concentrations of 2.times.10.sup.4, 5.times.10.sup.4
2.times.10.sup.5 and 5.times.10.sup.5 pfu in 2% X8P nanoemulsion in
a total volume of 50 .quadrature.l was incubated at 37.degree. C.
for 60 min prior to inoculation of influenza-sensitive cells. The
plaque reduction quality of the nanoemulsion was assayed using MDCK
cells. As shown in FIG. 10a, nanoemulsion reduced the ability of
virus to form plaques by more than three logs. Prolonged incubation
of virus with nanoemulsion reduced number of plaque forming units
in a time dependent manner (FIG. 10b). After 3-hour incubation of
5.times.10.sup.5 pfu of virus with nanoemulsion, no pfu were
detected (FIG. 10b). RT-PCR performed on virus/nanoemulsion
preparation at the same time points showed complete correlation
with plaque reduction assay (PRA). Viral RNA was still detectable
at 2 h but none was present at 3 and 4 h (FIG. 10c).
Influenza A Virus/Nanoemulsion Mixture Protects Mice from Lethal
Challenge with Congenic Strain of Virus
[0323] Mice were treated intranasally with either 2% nanoemulsion
alone, formalin killed influenza A virus "AA" strain
(5.times.10.sup.5 pfu), formalin killed virus mixed with 2%
nanoemulsion or virus (5.times.10.sup.5 pfu) inactivated with 2%
nanoemulsion. Twenty days later all 4 experimental groups were
challenged with a lethal dose (2.times.10.sup.5 pfu) of the
congenic virus. The animals treated with influenza/nanoemulsion
mixture did not have any sings of illness; their core body
temperature was within a normal range until the term of experiment
(FIG. 11) and all animals survived the challenge. Animals treated
with nanoemulsion alone succumbed to viral pneumonitis after the
challenge and all died by day 27 (day 6 after challenge). All
animals treated with formalin-killed virus and nanoemulsion died by
day 26 (day 5 after challenge). In the group treated with
formalin-killed virus alone only one mouse survived (FIG. 12).
[0324] The experiment also examined whether viral RNA mixed with
nanoemulsion and administrated intranasally would protect mice from
the lethal challenge. Neither viral RNA (0.5 .mu.g; an equivalent
of 10.sup.5 pfu of virus) alone nor viral RNA/nanoemulsion mixture
had any protective effect on animals challenged with lethal dose of
virus.
[0325] In order to examine whether intact virus particles could
mimic the same protection effect as nanoemulsion/virus mixture, the
animals were treated with 5 doses of virus (2.times.10.sup.5,
2.times.10.sup.4, 2.times.10.sup.3, 2.times.10.sup.2, and
2.times.10.sup.1 pfu) alone or mixed with nanoemulsion (Tables 28
and 29). Within the first 14 days after treatment, all animals
treated with 2.times.10.sup.5 pfu virus succumbed to pneumonitis.
Only one mouse survived the treatment with 2.times.10.sup.4 pfu
virus. All animals in other experimental groups survived the
treatment and became healthy 14 days later. On day 21 all survived
animals were challenged with lethal dose of the virus and observed
for additional 14 days. The mice treated with 5.times.10.sup.5 pfu
of virus and nanoemulsion survived the challenge; in the group of
animals pretreated with 2.times.10.sup.5 pfu of virus and
nanoemulsion only 4 out of 7 mice survived. Animals from all other
experimental groups developed pneumonitis and all died by day
28.
Tables 28 and 29
Survival of Mice after Intranasal Treatment with Different Doses of
Influenza A Virus (Table 28) and Lethal Challenge with Congenic
Virus (Table 29)
TABLE-US-00028 [0326] TABLE 28 Intranasal treatment: Time X8P X8P
X8P 2 .times. 10.sup.5 X8P 2 .times. 10.sup.4 X8P 2 .times.
10.sup.3 X8P 2 .times. 10.sup.2 X8P 2 .times. 10.sup.1 (days) 0 5
.times. 10.sup.5 pfu 2 .times. 10.sup.5 pfu pfu 2 .times. 10.sup.4
pfu pfu 2 .times. 10.sup.3 pfu pfu 2 .times. 10.sup.2 pfu pfu 2
.times. 10.sup.1 pfu pfu 0 5 6 7 8 7 9 7 7 7 7 7 7 1 5 6 7 7 7 9 7
7 7 7 7 7 2 5 6 7 3 7 9 7 7 7 7 7 7 3 5 6 7 0 7 2 7 7 7 7 7 7 4 5 6
7 0 7 1 7 7 7 7 7 7 5 5 6 7 0 7 1 7 7 7 7 7 7 6 5 6 7 0 7 1 7 7 7 7
7 7 7 5 6 7 0 7 1 7 7 7 7 7 7 8 5 6 7 0 7 1 7 7 7 7 7 7 9 5 6 7 0 7
1 7 7 7 7 7 7 10 5 6 7 0 7 1 7 7 7 7 7 7 11 5 6 7 0 7 1 7 7 6 7 7 7
12 5 6 7 0 7 1 7 7 6 7 7 7 13 5 6 7 0 7 1 7 7 6 7 7 7 14 5 6 7 0 7
1 7 7 6 7 7 7
TABLE-US-00029 TABLE 29 Intranasal treatment: X8P X8P X8P X8P X8P
X8P X8P Time 0 5 .times. 10.sup.5 pfu 2 .times. 10.sup.5 pfu 2
.times. 10.sup.5 pfu 2 .times. 10.sup.4 2 .times. 10.sup.4 2
.times. 10.sup.3 2 .times. 10.sup.3 2 .times. 10.sup.2 2 .times.
10.sup.2 2 .times. 10.sup.1 2 .times. 10.sup.1 (days) Challenge
with 2 .times. 10.sup.5 pfu/mouse pfu pfu pfu pfu pfu pfu pfu pfu
21 5 6 7 7 1 7 7 6 7 7 7 22 5 6 7 6 1 5 7 5 5 7 7 23 5 6 7 6 1 5 6
3 2 6 7 24 5 6 7 5 1 5 6 1 1 5 4 25 5 6 6 5 1 4 0 0 0 0 0 26 1 6 6
1 1 0 0 0 0 0 0 27 0 6 4 0 1 0 0 0 0 0 0 28 0 6 4 0 1 0 0 0 0 0 0
29 0 6 4 0 0 0 0 0 0 0 0 30 0 6 4 0 0 0 0 0 0 0 0 31 0 6 4 0 0 0 0
0 0 0 0 32 0 6 4 0 0 0 0 0 0 0 0 33 0 6 4 0 0 0 0 0 0 0 0 34 0 6 4
0 0 0 0 0 0 0 0 35 0 6 4 0 0 0 0 0 0 0 0
Lung Histology of Treated Mice
[0327] Histological examination of animals treated with
nanoemulsion alone and challenged with a lethal dose of influenza A
virus Ann Arbor strain (5.times.10.sup.5 pfu) showed profound lobar
pneumonia at days 25-27 of experiment (day 5-7 post-infection).
Large areas of pulmonary tissue showed uniform consolidation caused
by a massive influx of inflammatory cells (neutrophils and
macrophages) filling the alveolar spaces and infiltrating the
interstitium. Areas of pulmonary tissue destruction as evidenced by
the intra-alveolar bleeding, presence of abscesses with central
necrosis, and by formation of empty caverns filled with traces of
cellular debris were observed. Additionally, areas of fibrosis were
found in the lungs of these mice, suggesting massive destruction of
lung tissue that became replaced by proliferating fibroblasts.
Thus, the histological picture of severe pneumonia and pulmonary
tissue damage observed in these mice is consistent with rapid
pulmonary death of animals caused by influenza infection.
[0328] Pathology of the virus-infected lungs from animals treated
with intact virus/nanoemulsion mixture was less pronounced than
pathology from the animals treated with nanoemulsion alone. In
these animals both areas of pathologically unaltered lungs and
areas with remaining pathology were found. Affected areas showed
inflammatory infiltrates in lung interstitium (alveolar septa) but
the alveolar space was free of exudates or inflammatory cells. The
interstitial infiltrates contained predominantly mononuclear cells.
The remaining lung tissue possessed well-preserved pulmonary
architecture and appeared similar to the lungs from uninfected
animals. This histological picture is consistent with less severe
infection and recovery from infection observed in these mice.
Serum Levels of Specific Anti-Influenza a Virus IgG
[0329] The levels of specific anti-influenza IgG antibodies were
examined following a single treatment with either
virus/nanoemulsion or nanoemulsion alone. The levels of IgG
antibodies were evaluated in sera of animals on day 10, 20, and 35
after initial vaccination (or treatment). On day 10, all mice
showed background levels of anti-influenza A IgG antibodies in
serum (titer 1:100). On day 20, mice that had been treated with
virus/nanoemulsion produced significantly higher antibody response
(p<0.05) as compared to control group treated with nanoemulsion
alone. On day 35, virus/nanoemulsion treated mice that survived the
challenge produced 10 times higher serum levels of IgG antibody
compared with the levels found within the same animals before the
challenge (FIG. 13).
Detection of Viral RNA in Mice Treated with Influenza a Virus and
Nanoemulsion Formulation.
[0330] The RT-PCR results from the total lung RNA indicated the
presence of influenza A virus RNA in virus/nanoemulsion vaccinated
animals until day 6 after treatment, but not on day 7 and
thereafter (FIG. 14a). Signal generated in RT-PCR reaction from 0.1
.mu.g of total RNA from mouse lung during the first 6 days after
treatment correlated to a total of less than 10 plaque forming
units (pfu) of virus (FIG. 14b).
Early Immune Status of Mice Immunized with Influenza A
Virus/Nanoemulsion Formulation
[0331] The specificity of early immune responses in mice treated
with various viral preparations was characterized by the analysis
of cytokines. The level of cytokines produced by animals was
measured both in media from cultured splenocytes and in serum of
experimental animals (FIGS. 16a and 16b). On day 4 after treatment
with virus/nanoemulsion preparation, elevated levels of IL-12,
IL-2, TNF-.alpha., and particularly IFN-.gamma., were detected
(FIG. 16a). In the control group of animals, there were no detected
levels of these cytokines. Elevated levels of IL-10 and no
detectable levels of IL-4 were observed across all experimental
groups.
[0332] Since elevated IFN-.gamma. was shown to indicate initial
immune response, IFN-.gamma. levels in serum of experimental
animals were monitory up to day 20 after initial treatment. The
levels of IFN-.gamma. in serum obtained from mice treated with
virus/nanoemulsion reached over 230 pg/ml at 24 h and gradually
decreased to undetectable levels over a period of 20 days. The
IFN-.gamma. levels of the other experimental groups were low
compared to the levels detected in the control group (FIG.
15g).
Antigen Specificity of Immune Response in Mice Treated with
Virus/Nanoemulsion.
[0333] The antigen specificity of immune responses was assessed
using splenocyte proliferation and cytokine activation assays.
Splenocytes were harvested on day 20 of the experiment from mice
treated with virus/nanoemulsion and nanoemulsion alone. Cells were
stimulated with congenic virus (AA strain used for intranasal
treatment) for 5 days. As shown in FIG. 16, influenza A/AA strain
specifically stimulated splenocytes harvested from mice treated
with congenic virus/nanoemulsion mixture while no proliferation was
detected in splenocytes harvested from any other group of animals.
The stimulation index was less than 1, indicating that during 5
days of incubation virus killed some cells in the tissue culture.
On day 35 of experiment (14 days after lethal challenge),
splenocytes harvested from animals that survived the challenge
showed greater proliferation index compared with the proliferation
response of splenocytes obtained from the same group of animals on
day 20.
[0334] Cytokine production was analyzed to characterize the nature
of the immune response and confirm antigen specificity. The
conditioned media obtained form splenocytes treated the same way as
for the proliferation assay and incubated for 72 h was used to
quantitate cytokine concentration. On day 20 splenocytes obtained
from mice treated with virus/nanoemulsion produced high levels of
IFN-.gamma. and slightly increased levels of IL-2 (FIGS. 17a and
17b). There was no detectable production of IL-4 in resting or
virus-stimulated cells (FIG. 17c). In splenocytes obtained from
animals after challenge, viral stimulation resulted in further
amplification of IFN-.gamma. and IL-2 expression, reaching
concentrations at least five fold higher than in animals before
challenge (day 20). Major differences were also detected in the
IL-4 expression. In contrast to their pre-challenge status, IL-4
was detected in non-stimulated, and over five-fold increased in
congenic virus stimulated splenocytes (FIG. 17c). No specific
activation of IFN-.gamma., or other cytokines in splenocytes
obtained from animals treated with nanoemulsion alone, viral
RNA/nanoemulsion or with formaline-killed virus/nanoemulsion was
observed.
Characteristics of Immunocompetent Cells
[0335] The ratios of T:B (CD3:CD19) and Th:Tc (CD4:CD8) cells in
spleens of experimental animals were examined. In spleens of naive
mice 32% of T cells and 39% of CD8 positive cells were detected
using immunostaining and flow cytometry analysis. Twenty one days
after intranasal vaccination the percentage of T cells remained
unchanged in groups of animals treated with virus/nanoemulsion
mixture and nanoemulsion alone while CD8 positive cells were
elevated in these groups to 48% and 44%, respectively. Fourteen
days after lethal challenge (day 35 after immunization), the only
surviving animals were in the group treated with virus/nanoemulsion
mixture. All animals had significantly (p<0.0001) elevated T
cells and slightly elevated CD8 positive cells compared with the
same group before the challenge (FIG. 18). While T cells remained
at the same level, the CD8 positive cells increased in the groups
treated with nanoemulsion alone and virus pre-incubated with
nanoemulsion.
Expansion of Epitope Recognition
[0336] 20 days after intranasal instillation of virus Ann Arbor
strain/nanoemulsion or nanaoemulsion alone, mice were challenged
with either congenic (AA) or heterogenic (Puerto Rico) strain of
virus and observed for 14 days. Animals treated with virus Ann
Arbor strain/nanoemulsion and challenged with congenic virus
survived and recovered, animals from all other groups succumbed to
pneumonia and died by day 26 of experiment (FIG. 19). The analysis
of IFN-.gamma. cytokine production in animals after the challenge
revealed that splenocytes from this group of animals responded to
in vitro stimulation with both congenic and heterogenic virus by
profound production of cytokine (FIG. 20b). The present invention
is not limited to a particular mechanism. Indeed, an understanding
of the mechanism is not necessary to practice the present
invention. Nonetheless, it is contemplated that animals that
survived the challenge with congenic virus acquired immunity also
against heterogenic virus and thereby expanded their epitope
recognition. In order to examine such possibility, animals that
survived the challenge with congenic virus were rechallenged with
heterogenic virus (Puerto Rico strain) and observed for additional
14 days. All animals survived the rechallenge with heterogenic
virus without any signs of sickness (Table 30).
[0337] In conclusion, the present example demonstrates in vivo the
adjuvanticity of nanoemulsion for influenza vaccine given
intranasally. The results establish that a single intranasal
administration of nanoemulsion mixed with virus produces the full
protection against influenza pnemonitis, resulting in survival of
all animals challenged with lethal dose of the virus. During the
course of challenge, immunized animals did not show any signs of
illness and their core body temperature was within a normal range
for 14 days. Moreover, lungs of survived animals did not show gross
pathological changes characteristic for influenza pneumonitis.
TABLE-US-00030 TABLE 30 Survival (%) of animals after vaccination,
challenge and cross challenge with influenza A virus Puerto Rico
strain Vaccination with: nanoemulsion + Time (days) nanoemulsion 2
.times. 10.sup.5 pfu of AA nanoemulsion 0 100* 100 100 1 100 100
100 2 100 100 100 3 100 100 100 4 100 100 100 5 100 100 100 6 100
100 100 7 100 100 100 8 100 100 100 9 100 100 100 10 100 100 100 11
100 100 100 12 100 100 100 13 100 100 100 14 100 100 100 15 100 100
100 16 100 100 100 17 100 100 100 18 100 100 100 19 100 100 100 20
100 100 100 1 .times. 10.sup.5 pfu Challenge with: of AA 1 .times.
10.sup.5 pfu of AA 1 .times. 10.sup.4 pfu of PR 21 100 100 100 22
100 100 100 23 100 100 100 24 0 100 100 25 0 100 100 26 0 100 100
27 0 100 20 28 0 100 0 29 0 100 0 30 0 100 0 31 0 100 0 32 0 100 0
33 0 100 0 34 0 100 0 Challenge with: 1 .times. 10.sup.4 pfu of PR
35 none available 100 none available 36 100 37 100 38 100 39 100 40
100 41 100 42 100 43 100 44 100 45 100 46 100 47 100 48 100 49 100
*number of animals used was 5-8 per group
Example 16
Immune Response to HIV gp120
[0338] This example describes the immune response of mice to
recombinant HIV-1 envelope glycoprotein (gp120). Recombinant gp120
glycoprotein at concentrations of 2 and 20 .mu.g per dose mixed
with varying concentrations of X8P nanoemulsion (final
concentration: 0.1 to 1%) in 100 .mu.l volume was administered
intranasally or intramuscularly into mice. Dose administration was
repeated within three weeks after the first immunization. Protein
in saline was placed in the nose of control animals. GP120/X8P was
also injected intramuscularly in order to determine if it could
adjunct intramuscularly administered vaccines.
[0339] Results are shown in FIGS. 21 and 22. Serum levels of
specific anti-gp120 IgG were detected six weeks after initial
immunization. Increased and comparable levels of immune responses
were detected for both routes of immunization. FIG. 21 demonstrates
that administration of X8P nanoemulsion with gp120 resulted in an
increased immune response when the gp120 was administered
intranasally. FIG. 22 demonstrates that administration of X8P
nanoemulsion with gp120 resulted in an increased immune response
when the gp120 was administered intramuscularly.
[0340] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described method and system of
the invention will be apparent to those skilled in the art without
departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention that are obvious to those skilled in relevant fields are
intended to be within the scope of the following claims.
* * * * *