U.S. patent application number 12/024821 was filed with the patent office on 2008-07-24 for agents which regulate, inhibit, or modulate the activity and/or expression of connective tissue growth factor (ctgf) as a unique means to both lower intraocular pressure and treat glaucomatous retinopathies/optic neuropathies.
This patent application is currently assigned to ALCON RESEARCH, LTD.. Invention is credited to Abbot F. Clark, Debra L. Fleenor, Nasreen Jacobson, Iok-Hou Pang, Allan Shepard.
Application Number | 20080176964 12/024821 |
Document ID | / |
Family ID | 29401375 |
Filed Date | 2008-07-24 |
United States Patent
Application |
20080176964 |
Kind Code |
A1 |
Fleenor; Debra L. ; et
al. |
July 24, 2008 |
AGENTS WHICH REGULATE, INHIBIT, OR MODULATE THE ACTIVITY AND/OR
EXPRESSION OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF) AS A UNIQUE
MEANS TO BOTH LOWER INTRAOCULAR PRESSURE AND TREAT GLAUCOMATOUS
RETINOPATHIES/OPTIC NEUROPATHIES
Abstract
The present invention provides a method for lowering intraocular
pressure and providing neuroprotection to a patient in need thereof
by administering a therapeutically effective amount of at least one
non-nucleotide or non-protein agent that inhibits expression and/or
signaling of connective tissue growth factor (CTGF).
Inventors: |
Fleenor; Debra L.; (Crowley,
TX) ; Shepard; Allan; (Fort Worth, TX) ;
Jacobson; Nasreen; (Fort Worth, TX) ; Pang;
Iok-Hou; (Grand Prairie, TX) ; Clark; Abbot F.;
(Arlington, TX) |
Correspondence
Address: |
ALCON
IP LEGAL, TB4-8, 6201 SOUTH FREEWAY
FORT WORTH
TX
76134
US
|
Assignee: |
ALCON RESEARCH, LTD.
Fort Worth
TX
|
Family ID: |
29401375 |
Appl. No.: |
12/024821 |
Filed: |
February 1, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10510585 |
Oct 8, 2004 |
7351407 |
|
|
PCT/US03/12521 |
Apr 18, 2003 |
|
|
|
12024821 |
|
|
|
|
60376606 |
Apr 30, 2002 |
|
|
|
Current U.S.
Class: |
514/789 |
Current CPC
Class: |
A61P 9/12 20180101; A61K
31/519 20130101; A61K 31/427 20130101; A61K 31/426 20130101; A61K
31/202 20130101; A61K 31/52 20130101; A61P 43/00 20180101; A61P
27/06 20180101; A61P 27/02 20180101; A61K 31/4439 20130101 |
Class at
Publication: |
514/789 |
International
Class: |
A61K 45/00 20060101
A61K045/00; A61P 27/02 20060101 A61P027/02 |
Claims
1. A composition for lowering intraocular pressure and providing
neuroprotection in a patient in need thereof, said composition
comprising at least one agent that inhibits the expression,
signaling, or biological functions of connective tissue growth
factor (CTGF) and a pharmaceutically acceptable carrier.
2. A composition according to claim 1, wherein the total
concentration of said CTGF inhibitor in said composition is from
0.01% to 2%.
3. A composition according to claim 1, wherein said CTGF inhibitor
is a CDK inhibitor.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a Continuation (CON) of co-pending U.S.
application Ser. No. 10/510,585, filed Oct. 8, 2004, priority of
which is claimed under 35 U.S.C. .sctn.120, the contents of which
are incorporated herein by reference. This application also claims
priority from and incorporates by reference commonly owned PCT
application Serial No. PCT/US03/12521, filed Apr. 18, 2003, and
provisional application Ser. No. 60/376,606, filed Apr. 30,
2002.
TECHNICAL FIELD OF THE INVENTION
[0002] The present invention relates to the field of ocular
conditions involving neurodegeneration and/or elevated intraocular
pressure. More specifically, the invention provides compositions
that lower intraocular pressure and provide ocular
neuroprotection.
BACKGROUND OF THE INVENTION
[0003] There are a number of ocular conditions that are caused by,
or aggravated by, damage to the optic nerve head, degeneration of
ocular tissues, and/or elevated intraocular pressure. For example,
"glaucomas" are a group of debilitating eye diseases that are a
leading cause of irreversible blindness in the United States and
other developed nations. Primary Open Angle Glaucoma ("POAG") is
the most common form of glaucoma. The disease is characterized by
the degeneration of the trabecular meshwork, leading to obstruction
of the normal ability of aqueous humor to leave the eye without
closure of the space (e.g., the "angle") between the iris and
cornea (Vaughan et al., (1992)). A characteristic of such
obstruction in this disease is an increased intraocular pressure
("IOP"), resulting in progressive visual loss and blindness if not
treated appropriately and in a timely fashion. The disease is
estimated to affect between 0.4% and 3.3% of all adults over 40
years old (Leske et al. (1986); Bengtsson, B. (1989); Strong, N. P.
(1992)). Moreover, the prevalence of the disease rises with age to
over 6% of those 75 years or older (Strong, N. P. (1992)).
[0004] Glaucoma affects three separate tissues in the eye. The
elevated IOP associated with POAG is due to morphological and
biochemical changes in the trabecular meshwork (TM), a tissue
located at the angle between the cornea and iris. Most of the
nutritive aqueous humor exits the anterior segment of the eye
through the TM. The progressive loss of TM cells and the build-up
of extracellular debris in the TM of glaucomatous eyes leads to
increased resistance to aqueous outflow, thereby raising IOP.
Elevated IOP, as well as other factors such as ischemia, cause
degenerative changes in the optic nerve head (ONH) leading to
progressive "cupping" of the ONH and loss of retinal ganglion cells
and axons. The detailed molecular mechanisms responsible for
glaucomatous damage to the TM, ONH, and the retinal ganglion cells
are unknown.
[0005] Twenty years ago, the interplay of ocular hypertension,
ischemia and mechanical distortion of the optic nerve head were
heavily debated as the major factors causing progression of visual
field loss in glaucoma. Since then, other factors including
excitotoxicity, nitric oxide, absence of vital neurotrophic
factors, abnormal glial/neuronal interplay and genomics have been
implicated in the degenerative disease process. The consideration
of genomics deserves some discussion insofar as it may ultimately
define the mechanism of cell death, and provide for discrimination
of the various forms of glaucoma. Within the past 8 years, over 15
different glaucoma genes have been mapped and 7 glaucoma genes
identified. This includes six mapped genes (GLC1A-GLC1F) and two
identified genes (MYOC and OPTN) for primary open angle glaucoma,
two mapped genes (GLC3A-GLC3B) and one identified gene for
congentical glaucoma (CYP1B1), two mapped genes for pigmentary
dispersion/pigmentary glaucoma, and a number of genes for
developmental or syndromic forms of glaucoma (FOXC1, PITX2, LMX1B,
PAX6).
[0006] Thus, each form of glaucoma may have a unique pathology and
accordingly a different therapeutic approach to the management of
the disease may be required. For example, a drug that effects the
expression of enzymes that degrade the extracellular matrix of the
optic nerve head would not likely prevent RGC death caused by
excitotoxicity or neurotrophic factor deficit. In glaucoma, RGC
death occurs by a process called apoptosis (programmed cell death).
It has been speculated that different types of insults that can
cause death may do so by converging on a few common pathways.
Targeting downstream at a common pathway is a strategy that may
broaden the utility of a drug and increase the probability that it
may have utility in the management of different forms of the
disease. However, drugs that effect multiple metabolic pathways are
more likely to produce undesirable side-effects. With the advent of
gene-based diagnostic kits to identify specific forms of glaucoma,
selective neuroprotective agents can be tested with the aim of
reducing the degree of variation about the measured response.
[0007] Current glaucoma therapy is directed to lowering IOP, a
major risk factor for the development and progression of glaucoma.
These therapies lower IOP, but they do not directly address the
pathogenic mechanisms, and the disease continues to progress. Thus,
what is needed is a therapeutic method for lowering IOP and/or
providing neuroprotection to the optic nerve head and/or to retinal
ganglion cells via pathogenic pathways.
SUMMARY OF THE INVENTION
[0008] The present invention overcomes these and other drawbacks of
the prior art by providing a method for lowering intraocular
pressure and providing neuroprotection to a patient in need thereof
by administering a therapeutically effective amount of a
composition including at least one non-nucleotide or non-protein
agent that inhibits expression and/or signaling of connective
tissue growth factor (CTGF), and a pharmaceutically acceptable
carrier. In another aspect, the invention provides a method for
lowering intraocular pressure by administering to a patient a
therapeutically effective amount of an agent that inhibits
expression and/or signaling of CTGF. Preferably, the compositions
for use in the method of the invention will lower intraocular
pressure that is elevated due to an increased expression of CTGF or
of a product of CTGF signaling.
[0009] In preferred embodiments, the composition of the invention
may be administered by topical application, intracamerally or via
an implant. Typically, the total concentration of the CTGF
inhibitor in the composition of the invention will be from 0.01% to
2%. Generally, the treatment method of the invention will be most
useful for a patient suffering from glaucoma, for example
normal-tension glaucoma, or ocular hypertension.
[0010] The invention further provides a method for preventing the
visual field loss associated with POAG by administering to a
patient in need thereof a composition including a non-nucleotide or
non-protein agent that modulates the expression and/or signaling of
CTGF such that intraocular pressure is controlled and protection is
provided to retinal ganglion cells or to the optic nerve head.
[0011] In another embodiment, the present invention provides a
composition for lowering intraocular pressure and providing
neuroprotection in a patient in need thereof. Generally, the
composition of the invention includes at least one agent that
inhibits the expression and/or signaling of connective tissue
growth factor (CTGF) and a pharmaceutically acceptable carrier. The
total concentration of CTGF in the composition of the invention
will preferably be from 0.01% to 2%.
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0013] FIG. 1. CTGF gene expression is elevated in glaucomatous vs.
normal TM tissues. To verify the results of the microarray and cDNA
subtraction, CTGF mRNA expression was determined by QPCR analysis
of normal vs. glaucoma TM tissue cDNA. The numbers below each
sample refer to the cDNA identification number assigned to each
sample. Human donor tissue and total RNA were obtained as described
(Wang et al. 2001). "Ave." represents the mean of normal or
glaucoma TM levels.
[0014] FIG. 2. CTGF gene expression is elevated in glaucomatous vs.
normal TM cell lines. To verify the results of the microarray and
cDNA subtraction, CTGF mRNA expression was determined by QPCR
analysis of normal vs. glaucoma TM cell line cDNA. The numbers
below each sample refer to the cell line identification number.
Human TM cell lines and total RNA were obtained as described
(Shepard et al. 2001). "NTM pool" and "GTM pool" refer to
amplification levels from pooled NTM or GTM cDNA.
[0015] FIG. 3. Effect of GSK-3 inhibition on CTGF gene expression
in glaucomatous TM cells. To determine the effects of GSK-3
inhibition on CTGF gene expression, we measured the effects of the
known GSK-3 inhibitor SB-216763 (Coghlan et al. 2000) on both basal
and TGF.beta.2-stimulated CTGF mRNA expression in a glaucomatous TM
cell line (SGTM2697) using QPCR analysis.
[0016] FIG. 4. Effect of CDK2 inhibition on CTGF gene expression in
glaucomatous TM cells. To determine the effects of CDK inhibition
on CTGF gene expression, we measured the effects of the known CDK2
inhibitor GW-8510 (Davis et al. 2001) on both basal and
TGF.beta.2-stimulated CTGF mRNA expression in a glaucomatous TM
cell line (SGTM2697) using QPCR analysis.
DETAILED DESCRIPTION OF THE PRESENT INVENTION
[0017] Glaucoma is a heterogeneous group of optic neuropathies that
share certain clinical features. The loss of vision in glaucoma is
due to the selective death of retinal ganglion cells in the neural
retina that is clinically diagnosed by characteristic changes in
the visual field, nerve fiber layer defects, and a progressive
cupping of the ONH. One of the main risk factors for the
development of glaucoma is the presence of ocular hypertension
(elevated intraocular pressure, IOP). IOP also appears to be
involved in the pathogenesis of normal tension glaucoma where
patients have what is often considered to be normal IOP. The
elevated IOP associated with glaucoma is due to elevated aqueous
humor outflow resistance in the trabecular meshwork (TM), a small
specialized tissue located in the iris-corneal angle of the ocular
anterior chamber. Glaucomatous changes to the TM include a loss in
TM cells and the deposition and accumulation of extracellular
debris including plaque-like material. In addition, there also are
changes that occur in the glaucomatous optic nerve head. In
glaucomatous eyes, there are morphological and mobility changes in
ONH glial cells. In response to elevated IOP and/or transient
ischemic insults, there is a change in the composition of the ONH
extracellular matrix and alterations in the glial cell and retinal
ganglion cell axon morphologies.
[0018] Glaucomatous changes to the TM differ from fibrosis, which
is associated with a wound healing response and generally involves
inflammation and the subsequent proliferation of myofibroblasts.
Tissue injury is recognized by the inflammatory system, which
initiates a wound repair process by stimulating fibroblasts and
angiogenesis. Dead or dying tissues/cells are replaced by scar
tissue consisting initially of fibrin, which is subsequently
replaced by excessive amounts of extracellular matrix material,
particularly collagen.
[0019] CTGF is a secreted cytokine which is known to increase
extracellular matrix (ECM) production, primarily via increased
deposition of collagen I and of fibronectin. Overexpression of CTGF
has previously been implicated as a major causative factor in
conditions such as scleroderma, fibroproliferative diseases,
scarring, etc. in which there is an overaccumulation of ECM
components. An overaccumulation of extracellular matrix materials
in the region of the trabecular meshwork (TM) is also a hallmark of
many forms of glaucoma; such increases are believed to lead to
increased resistance to aqueous outflow, and therefore elevated
intraocular pressures. The present inventors have discovered the
presence of CTGF gene products in isolated tissues and cell lines
established from human TM. Thus, it is believed that CTGF plays a
role in ECM production by the TM. Agents which down-regulate CTGF
gene expression, protein production, or down-stream effects of CTGF
activation, represent a novel means for lowering IOP.
[0020] CTGF expression can be induced by a wide variety of factors
including: TGF-.beta., VEGF, thrombin, advanced glycation
end-products (AGE), mechanical stress, and lysophosphatidic acid
(LPA), among others. The specific inducers of CTGF and the
signaling pathways can vary depending on the specific cell type
being stimulated. There are reports of TGF-.beta. induction of CTGF
involving Smads, PLC, PKC, and tyrosine kinases in some cell types
while RhoA, PKA, and the cytoskeleton appear to be involved in
other cell types. Mechanical stress of fibroblasts induces CTGF
expression via involvement of protein kinases and tyrosine
phosphatases.
[0021] The mechanism of action of CTGF is not well understood. CTGF
appears to bind to PDGF receptors, integrins, and LDL
receptor-related proteins (LRP), each of which may act as a
signaling cell surface receptor for CTGF. In some cell types, CTGF
signaling through PDGF receptors appears to involve MAPK and PI3K.
CTGF signaling in chondrocytes involves ERK signaling for cell
proliferation and p38MAPK signaling for cellular differentiation.
The specific cell surface receptors and signaling pathways used by
CTGF appear to be dependent on the specific cell type being
studied.
[0022] U.S. Pat. No. 5,585,270 describes polynucleotides encoding
CTGF. CTGF is said to have mitogenic activity, or the ability to
stimulate target cells to proliferate. It is also said to have
chemotactic activity, that is, the chemically induced movement of
cells as a result of interaction with particular molecules. The
protein is believed to play a role in the normal development,
growth and repair of human tissue. The patent also describes a
method for accelerating wound healing in a subject by applying to
the wound an effective amount of a composition containing purified
CTGF. The polypeptide is said to be useful in cases where there is
impaired healing of skin wounds or there is a need to augment the
normal healing mechanisms, e.g., burns. The patent contains no
discussion of glaucoma or eye disorders.
[0023] U.S. Pat. No. 6,069,006, whose specification is a
continuation-in-part of U.S. Pat. No. 5,585,270 discussed above,
describes CTGF regulatory nucleic acid sequences. This patent
further describes methods for treating fibrotic diseases and for
identifying agents for treatment of fibrotic diseases. No specific
agents, other than CTGF nucleic acid sequences or polypeptides are
described. Neuroprotection of ocular tissues is not described.
[0024] U.S. Pat. No. 6,358,741 describes a number of nucleic acid
sequences derived from CTGF that are said to be useful for
inhibiting the expression of CTGF in a cell. This patent does not
discuss glaucoma, neuroprotection of ocular tissues or non-nucleic
acid or non-polypeptide sequences for inhibiting CTGF
expression.
[0025] CTGF appears to accrue in high concentrations in the
cytoplasm of stellate reactive astrocytes of the central nervous
system. It has been implicated as a causative agent in mechanisms
associated with reactive astrocytosis such as gliosis (glial
overgrowth) and glial scar formation, i.e., in processes known to
hinder neural repair and growth (Schwab et al. 2000; Schwab et al.
2001). It is believed that such processes also participate in the
loss of retinal neurons and/or the inability to repair optic nerve
axons associated with glaucoma. The present inventors have
discovered that downregulation of CTGF provides a means for
protection of both the retina and the optic nerve/nerve head.
[0026] Thus, in one aspect, the present invention provides a method
for lowering IOP and providing neuroprotection to retinal ganglion
cells by administering a composition including a non-nucleotide or
non-peptidyl CTGF inhibitor. It is further contemplated that the
composition could include a compound that inhibits an agent which
upregulates CTGF. For example, hydrogen peroxide (H2O2) has been
shown to be an inducer of CTGF gene expression. TGF-.beta.,
dexamethasone and serotonin have also been found to induce CTGF
expression (Park et al. 2001).
[0027] The therapeutic agent for the treatment of glaucoma will
preferably be a small drug-like molecule, which affects one or more
aspects of the CTGF pathway. Preferred therapeutic agents are those
that are: (1) inhibitors of CTGF; (2) inhibitors of agents acting
downstream of CTGF action (i.e., inhibitors of CTGF signaling)
and/or (3) inhibitors of agents that upregulate CTGF gene or
protein expression.
[0028] The inventors have tested several different compound classes
in a CTGF QPCR assay for inhibition of basal and TGF.beta.2-induced
CTGF gene expression in cultured human normal or glaucomatous TM
cells. Small molecule inhibitors were targeted at the inhibition of
GSK-3, CDK, NAALADase, Protein Kinase C, MEK, p38MAPK, ROCK, VEGF,
geranylgeranyl transferase and AGE. Small molecule agonists of
PPAR, 5-HT, and P2X7 were also tested for activity. Compounds which
target extracellular signal-regulated kinase 1 or 2 (ERK1 or ERK2)
may also play a role in basal or TGF.beta.2-induced CTGF gene
expression. There is significant cross-reactivity of many of the
GSK-3 and CDK inhibitors and it is possible that compounds that
inhibit other targets such as the ERK's, Protein Kinase C, or STAT
families may prove valuable in the inhibition of basal or
TGF.beta.2-stimulated CTGF in TM cells.
[0029] Two general compound classes have been found to inhibit both
basal and TGF.beta.2-induced CTGF expression in human TM cells:
GSK-3 and CDK inhibitors. Glycogen synthase kinase (GSK-3) is a
serine/threonine protein kinase that is present as two cellular
forms, GSK-3.alpha. and GSK-3.beta., derived from two genes.
GSK-3.alpha. and GSK-3.beta. are 95% identical and their
differential inhibition by small molecule antagonists cannot be
readily distinguished. GSK-3 is the rate limiting enzyme in
glycogen synthesis but has many cellular targets of phosphorylation
including glycogen synthase, .beta.-catenin, eIF2B, and tau
(reviewed in (Cohen et al. 2001) and (Woodgett 2001)). The direct
involvement of GSK-3 in CTGF expression and signaling is unexampled
in the literature.
[0030] Cyclin-dependent kinases (CDKs) have multiple cellular
functions including the regulation of cell division cycle,
apoptosis, transcription, neuronal function, and differentiation.
Several known ATP-competitive inhibitors of CDK have been
identified (Knockaert et al. 2002). CDK inhibition is being pursued
for use in the treatment of cancer, Alzheimer's, ALS, stroke,
cardiovascular disease and others. CTGF has been shown to be a
downstream mediator of TGF.beta. in fibroblast proliferation by
upregulation of cyclin A-cdk2 (Kothapalli 2000).
[0031] Within the GSK-3 class of compounds, one compound, SB-216763
(Coghlan et al. 2000), was found to inhibit both basal and
TGF.beta.2-induced CTGF levels in normal and glaucomatous (FIG. 3)
human TM cells. SB-216763 is a maleimide derivative with an IC50 of
34 nM against GSK-3.alpha. and GSK-3.beta. in the presence of 0.01
mM ATP and a Ki of 9 nM (Coghlan et al. 2000). Other compounds in
the GSK-3 class of inhibitors tested and found to inhibit basal
and, in some cases, TGF.beta.2-induced CTGF gene expression in TM
cells included the paullones such as alsterpaullone,
9-cyanopaullone and kenpaullone (Zaharevitz et al. 1999; Leost et
al. 2000; Bain, et al. 2003).
[0032] Within the CDK class of compounds, a relatively selective
CDK2 inhibitor, GW-8510 (Davis et al. 2001), was found to inhibit
both basal and TGF.beta.2-induced CTGF levels in normal and
glaucomatous (FIG. 4) human TM cells. GW-8510 is a potent and
relatively select inhibitor of CDK2 with an IC50 of 10 nM. GW-8510
also inhibits CDK1 and CDK4 but with lower IC50 values (110 and 130
nM) (Davis, et al. 2001). Other CDK class inhibitors tested and
shown to have inhibitory activity included purvalanol A and
roscovitine (Hardcastle, et al. 2002).
[0033] Other classes of compounds tested in the CTGF QPCR assay and
found to inhibit basal and, in some cases, TGF.beta.2-induced CTGF
gene expression in TM cells included PPAR agonists such as
troglitazone, ciglitazone (Willson et al. 2000) and 15(S)HETE.
[0034] The agents of this invention, can be incorporated into
various types of ophthalmic formulations for delivery to the eye
(e.g., topically, intracamerally, or via an implant). The agents
are preferably incorporated into topical ophthalmic formulations
for delivery to the eye. The agents may be combined with
ophthalmologically acceptable preservatives, surfactants, viscosity
enhancers, penetration enhancers, buffers, sodium chloride, and
water to form an aqueous, sterile ophthalmic suspension or
solution. Ophthalmic solution formulations may be prepared by
dissolving an agent in a physiologically acceptable isotonic
aqueous buffer. Further, the ophthalmic solution may include an
ophthalmologically acceptable surfactant to assist in dissolving
the agent. Furthermore, the ophthalmic solution may contain an
agent to increase viscosity, such as, hydroxymethylcellulose,
hydroxyethylcellulose, hydroxypropylmethylcellulose,
methylcellulose, polyvinylpyrrolidone, or the like, to improve the
retention of the formulation in the conjunctival sac. Gelling
agents can also be used, including, but not limited to, gellan and
xanthan gum. In order to prepare sterile ophthalmic ointment
formulations, the active ingredient is combined with a preservative
in an appropriate vehicle, such as, mineral oil, liquid lanolin, or
white petrolatum. Sterile ophthalmic gel formulations may be
prepared by suspending the agent in a hydrophilic base prepared
from the combination of, for example, carbopol-974, or the like,
according to the published formulations for analogous ophthalmic
preparations; preservatives and tonicity agents can be
incorporated.
[0035] The agents are preferably formulated as topical ophthalmic
suspensions or solutions, with a pH of about 4 to 8. The
establishment of a specific dosage regimen for each individual is
left to the discretion of the clinicians. The agents will normally
be contained in these formulations in an amount 0.01% to 5% by
weight, but preferably in an amount of 0.05% to 2% and most
preferably in an amount 0.1 to 1.0% by weight. The dosage form may
be a solution, suspension microemulsion. Thus, for topical
presentation 1 to 2 drops of these formulations would be delivered
to the surface of the eye 1 to 4 times per day according to the
discretion of a skilled clinician.
[0036] The agents can also be used in combination with other agents
for treating glaucoma, such as, but not limited to,
.beta.-blockers, prostaglandin analogs, carbonic anhydrase
inhibitors, .alpha.2 agonists, miotics, and neuroprotectants.
[0037] The agent may be delivered directly to the eye (for example:
topical ocular drops or ointments; slow release devices in the
cul-de-sac or implanted adjacent to the sclera or within the eye;
periocular, conjunctival, sub-Tenons, intracameral or intravitreal
injections) or parenterally (for example: orally; intravenous,
subcutaneous or intramuscular injections; dermal delivery; etc.)
using techniques well known by those skilled in the art. The
following are examples of possible formulations embodied by this
invention.
TABLE-US-00001 (a) Topical Ocular Formulation Wt. % CTGF Inhibitor
0.01-0.05 HPMC 0.5 Benalkonium chloride 0.01 Sodium chloride 0.8
Edetate disodium 0.01 NaOH/HCl q.s. pH 7.4 Purified water q.s. 100
mL
[0038] It is further contemplated that the compounds of the
invention could be formulated in intraocular insert devices.
[0039] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
Expression of CTGF in Glaucomatous TM vs Non-Glaucomatous TM
Microarray Screen
[0040] The mRNA transcript for CTGF was identified as being
elevated in glaucomatous TM cells vs. normal TM cells by a
GeneFilter.RTM. (Research Genetics) screen.
[0041] Five hundred .eta.g of total RNA (TRIzol Reagent;
Invitrogen) was isolated from pooled (6 each) normal or
glaucomatous TM cell lines as described (Shepard et al., IOVS 2001,
42:3173) and reverse-transcribed separately in the presence of 300
units of Superscript II RNase H- reverse transcriptase
(Invitrogen), 100 .mu.Ci [.alpha.-33P]dCTP (10 mCi/ml, 3,000
Ci/mmol; Amersham), 0.33 mM dATP, dGTP, dCTP (Promega), 3.3 mM DTT,
1.times.First Strand Buffer (Invitrogen), and 2 .mu.g oligo-dT at
37.degree. C. for 90 min. The radiolabeled cDNA was subsequently
purified with Chroma-Spin 100 Columns (Clontech) according to the
manufacturer's instructions. A single Genefilter.RTM. (GF211;
Research Genetics) spotted with .apprxeq.4,000 known genes was used
for hybridization with radiolabeled probe according to the
manufacturer's instructions. The membrane was first pre-treated by
boiling in 0.5% SDS for 5 min. Prehybridization of the membrane was
performed for 30 min at 42.degree. C. in roller bottles containing
5 ml MicroHyb (Research Genetics) with 5 ug poly-dA (Research
Genetics) and 5 .mu.g boiled Cot1 DNA (Invitrogen) as blocking
reagents. The entire radiolabeled probe was boiled and added to the
prehybridization mixture for 16 h at 42.degree. C. Following
hybridization, the membranes were washed twice in 2.times.SSC/1%
SDS for 20 min and then once in 0.5.times.SSC/1% SDS for 15 min.
The membrane was placed on wet Whatmann 3MM paper and wrapped in
SaranWrap. Images were acquired on a Storm Phosphorimager
(Molecular Dynamics) using maximum resolution. Once the image was
acquired the blot was immediately stripped in boiling 0.5% SDS and
subjected to another hybridization with the opposite probe, e.g.
normal TM followed by glaucomatous TM. Images from duplicate
probings were analyzed using Pathways (Research Genetics) and MS
Excel (Microsoft) software. Of the 4300 genes on the GF211
GeneFilter.RTM., CTGF (GenBank accession #AA598794) was one of 7
genes that showed a GTM:NTM ratio >2-fold.
cDNA Subtraction Screen
[0042] CTGF was identified independently in a custom PCR-Select.TM.
cDNA Subtraction screen (Clontech) used to screen for mRNA
transcripts that are differentially expressed in glaucomatous vs.
normal TM cells.
[0043] Seven hundred .mu.g of total RNA (TRIzol Reagent;
Invitrogen) was isolated from pooled (7 each) normal or
glaucomatous TM cell lines as described (Shepard et al. 2001).
Tester (glaucomatous) and driver (normal) poly A+ RNA was isolated
by two rounds of poly A+ selection on oligo-dT latex beads using a
Nucleotrap mRNA Midi kit (Clontech). All subsequent PCR-Select.TM.
cDNA Subtraction steps were performed according to Clontech kit
(catalog # K1804-1) methodology.
[0044] Differential screening of the resulting cDNA subtraction
libraries was performed essentially according to instructions in
the PCR-Select.TM. Differential Screening Kit (Clontech catalog #
K1808-1). A select number of differentially expressed cDNA clones
were also confirmed by virtual Northern analysis. A list of all the
candidate differentially expressed clones identified with
subtracted TM cell cDNA library probe was generated by Clontech.
The transcript for CTGF (GenBank accession # XM.sub.--037055.1) was
in this list and was enriched in the glaucomatous cDNA library.
EXAMPLE 2
RNA Isolation and First Strand cDNA Preparation
[0045] Total RNA was isolated from TM cells using Trizol.RTM.
reagent according to the manufacturer's instructions (Life
Technologies). First strand cDNA was generated from lug of total
RNA using random hexamers and TaqMan.RTM. Reverse Transcription
reagents according to the manufacturer's instructions (PE
Biosystems, Foster City, Calif.). The 100 ul reaction was
subsequently diluted 20-fold to achieve an effective cDNA
concentration of 0.5 ng/ul.
Quantitative PCR
[0046] Differential expression of CTGF was verified by quantitative
real-time RT-PCR (QPCR) using an ABI Prism.RTM. 7700 Sequence
Detection System (Applied Biosystems). Essentially as described
(Shepard et al., IOVS 2001, 42:3173). Primers for CTGF
amplification were designed using Primer Express software (Applied
Biosystems) and anneal to adjacent exons of Genbank accession #
NM.sub.--001901.1 (CAGCTCTGACATTCTGATTCGAA, nts 1667-1689 and
TGCCACAAGCTGTCCAGTCT, nts 1723-1742) and generate a 76-bp amplicon.
Amplification of CTGF was normalized to 18S ribosomal RNA
expression using primers designed to the 18S rRNA gene (GenBank
accession #X03205 GTCCCTGCCCTTTGTACACAC, nts 1680-1700 and
CGATCCGAGGGCCTCACTA, nts 1730-1749) which generates a 69-bp
amplicon. The SYBR.RTM. Green I double-stranded DNA binding dye
chemistry (Applied Biosystems) was used to amplify CTGF or 18S
cDNA. Specificity of the CTGF and 18S primer pairs was assessed
from the PCR product by a combination of DNA sequencing, agarose
gel analysis and dissociation curve analysis using the ABI Prism
770 SDS Dissociation Curve software (Applied Biosystems). CTGF or
18S rRNA reactions consisted of 1.times.SYBR Green PCR Master Mix
(Applied Biosystems), 50 nM primer concentrations and 2.5 ng cDNA
in a final volume of 50 ul. Thermal cycling conditions consisted of
50.degree. C., 2 min, 95.degree. C. 10 min followed by 40 cycles at
95.degree. C., 15 sec, 60.degree. C., 1 min. Quantification of
relative RNA concentrations was done using the relative standard
curve method as described in PE Biosystems User Bulletin #2
(http://docs.appliedbiosystems.com/pebiodocs/04303859.pdf). Data
analysis was performed with SDS software version 1.9.1 (Applied
Biosystems) and MS Excel 97 (Microsoft). Plasmid DNA containing
target sequence for CTGF or 18S was used for generating the
standard curve. QPCR data are presented as mean .+-.SD.
[0047] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents which are both chemically and structurally related may be
substituted for the agents described herein to achieve similar
results. All such substitutions and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[0048] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
[0049] U.S. Patents
[0050] U.S. Pat. No. 6,069,006
[0051] U.S. Pat. No. 6,358,741
[0052] Other Publications
[0053] Bain et al., "The specificities of protein kinase
inhibitors: an update" Biochem J 371(Pt 1):199-204 (2003).
[0054] Coghlan et al., "Selective small molecule inhibitors of
glycogen synthase kinase-3 modulate glycogen metabolism and gene
transcription" Chem Biol 7(10):793-803 (2000).
[0055] Cohen et al., "The renaissance of GSK3" Nat Rev Mol Cell
Biol 2(10):769-776 (2001).
[0056] Davis et al., "Prevention of chemotherapy-induced alopecia
in rats by CDK inhibitors" Science 291(5501):134-137 (2001).
[0057] Hardcastle et al., "Designing inhibitors of cyclin-dependent
kinases" Annu Rev Pharmacol Toxicol 42:325-348 (2002).
[0058] Knockaert et al., "Pharmacological inhibitors of
cyclin-dependent kinases" Trends Pharmacol Sci 23(9):417-425
(2002).
[0059] Kothapalli et al., "CTGF modulates cell cycle progression in
cAMP-arrested NRK fibroblasts" J Cell Physiol 182(1):119-126
(2000).
[0060] Leost, et al., "Paullones are potent inhibitors of glycogen
synthase kinase-3beta and cyclin-dependent kinase 5/p25" Eur J
Biochem 267(19):5983-5994 (2000).
[0061] Park et al., "Hydrogen Peroxide is a Novel Inducer of
Connective Tissue Growth Factor," Biochem. Biophys. Res. Commun.
284(4):966-971 (2001).
[0062] Schwab et al., "Connective Tissue Growth Factor is Expressed
by a Subset of Reactive Astrocytes in Human Cerebral Infarction,"
Neuropathol. Appl. Neurobiol. 26(5):434-440 (2000).
[0063] Schwab et al, "Differential Cellular Accumulation of
Connective Tissue Growth Factor Defines a Subset of Reactive
Astrocytes, Invading Fibroblasts, and Endothelial Cells Following
Central Nervous System Injury in Rats and Humans," J. Neurotrauma
18(4):377-388 (2001).
[0064] Shepard et al., IOVS 42:3173 (2001).
[0065] Wang et al., Mol. Vis. 7:89-94 (2001).
[0066] Willson et al., "The PPARs: from orphan receptors to drug
discovery" J Med Chem 43(4):527-550 (2000).
[0067] Woodgett, J. R., "Judging a protein by more than its name:
GSK-3" Sci STKE 2001(100):RE12 (2001).
[0068] Zaharevitz et al., "Discovery and initial characterization
of the paullones, a novel class of small-molecule inhibitors of
cyclin-dependent kinases" Cancer Res 59(11):2566-2569 (1999).
Sequence CWU 1
1
4123DNAArtificial SequenceSynthetic Primer 1cagctctgac attctgattc
gaa 23220DNAArtificial SequenceSynthetic Primer 2tgccacaagc
tgtccagtct 20321DNAArtificial SequenceSynethic Primer 3gtccctgccc
tttgtacaca c 21419DNAArtificial SequenceSynthetic Primer
4cgatccgagg gcctcacta 19
* * * * *
References