U.S. patent application number 11/701107 was filed with the patent office on 2008-07-24 for polynucleotides encoding e38n interferon gamma polypeptides.
This patent application is currently assigned to Maxygen Holdings Ltd., a Cayman Corporation. Invention is credited to Jensen Anne Dam, Hansen Christian Karsten, Andersen Kim Vilbour.
Application Number | 20080176323 11/701107 |
Document ID | / |
Family ID | 27221366 |
Filed Date | 2008-07-24 |
United States Patent
Application |
20080176323 |
Kind Code |
A1 |
Dam; Jensen Anne ; et
al. |
July 24, 2008 |
Polynucleotides encoding E38N interferon gamma polypeptides
Abstract
A conjugate exhibiting interferon gamma activity and comprising
at least one first non-polypeptide moiety covalently linked to an
IFG polypeptide, the polypeptide comprising an amino acid sequence
that differs from that of a parent IFNG polypeptide in at least one
introduced and/or at least one removed amino acid residue
comprising an attachment group for the non-polypeptide moiety. The
conjugate may be used for treatment of various diseases.
Inventors: |
Dam; Jensen Anne;
(Copenhagen, DK) ; Vilbour; Andersen Kim;
(Broenshoei, DK) ; Karsten; Hansen Christian;
(Vedback, DK) |
Correspondence
Address: |
MAXYGEN, INC.;INTELLECTUAL PROPERTY DEPARTMENT
515 GALVESTON DRIVE
REDWOOD CITY
CA
94063
US
|
Assignee: |
Maxygen Holdings Ltd., a Cayman
Corporation
|
Family ID: |
27221366 |
Appl. No.: |
11/701107 |
Filed: |
February 1, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10369495 |
Feb 19, 2003 |
7232562 |
|
|
11701107 |
|
|
|
|
10130084 |
Sep 4, 2002 |
7230081 |
|
|
PCT/DK00/00631 |
Nov 13, 2000 |
|
|
|
10369495 |
|
|
|
|
60166293 |
Nov 18, 1999 |
|
|
|
Current U.S.
Class: |
435/358 ;
435/320.1; 435/325; 536/23.52 |
Current CPC
Class: |
A61P 29/00 20180101;
A61K 47/60 20170801; A61P 11/00 20180101 |
Class at
Publication: |
435/358 ;
536/23.52; 435/320.1; 435/325 |
International
Class: |
C12N 5/10 20060101
C12N005/10; C07H 21/04 20060101 C07H021/04; C12N 15/00 20060101
C12N015/00; C12N 5/00 20060101 C12N005/00 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 12, 1999 |
DK |
1999 01631 |
Mar 17, 2000 |
DK |
2000 00447 |
Claims
1-35. (canceled)
36. A polynucleotide encoding an E38N interferon gamma (IFNG)
polypeptide variant exhibiting IFNG receptor binding activity, said
encoded E38N IFNG polypeptide variant having an amino acid sequence
which (i) varies by 1 to 15 amino acid residue differences from the
wild-type human IFNG polypeptide sequence shown in SEQ ID NO: 2 or
from a C-terminally truncated fragment thereof wherein said
fragment is C-terminally truncated by deletion of the last 1 to 15
amino acid residues relative to SEQ ID NO: 2; and (ii) is
characterized by the substitution E38N.
37. The polynucleotide of claim 36, wherein the 1 to 15 amino acid
residue differences in the encoded E38N IFNG polypeptide variant
comprises the substitution S40T.
38. The polynucleotide of claim 36, wherein the encoded E38N IFNG
polypeptide variant has an amino acid sequence that varies by 1 to
8 amino acid residue differences from the wild-type human IFNG
sequence shown in SEQ ID NO: 2 or from said C-terminally truncated
fragment thereof.
39. The polynucleotide of claim 38, wherein the encoded E38N IFNG
polypeptide variant sequence varies by 1 to 5 amino acid residue
differences from the wild-type human IFNG sequence shown in SEQ ID
NO: 2 or from said C-terminally truncated fragment thereof.
40. The polynucleotide of claim 36, wherein the encoded E38N IFNG
polypeptide variant is C-terminally truncated by 11 amino acid
residues.
41. The polynucleotide of claim 36, wherein the encoded E38N IFNG
polypeptide variant has a glycosylation site.
42. The polynucleotide of claim 41, wherein the encoded E38N IFNG
polypeptide variant has glycosylation sites at residues N25, N38
and N97.
43. The polynucleotide of claim 36, wherein the encoded E38N IFNG
polypeptide variant differs by 2-5 amino acid substitutions
relative to the wild-type human IFNG sequence shown in SEQ ID NO: 2
or said C-terminally truncated fragment thereof.
44. The polynucleotide of claim 43, wherein the encoded E38N IFNG
polypeptide variant wherein said 2-5 substitutions comprise the
substitution S40T.
45. The polynucleotide of claim 44, wherein the encoded E38N IFNG
polypeptide variant is also C-terminally truncated by 11 amino acid
residues.
46. The polynucleotide of claim 45, wherein the encoded E38N IFNG
polypeptide variant has a glycosylation site.
47. The polynucleotide of claim 46, wherein the encoded E38N IFNG
polypeptide variant has glycosylation sites at N25, N38 and
N97.
48. The polynucleotide of claim 36, wherein the encoded E38N IFNG
polypeptide variant comprises an introduced cysteine residue,
wherein the introduced cysteine residue is introduced at a residue
position that corresponds to a residue position in wild-type human
IFNG of SEQ ID NO: 2 that has at least 25% of its side chain
surface exposed to solvent.
49. The polynucleotide of claim 48, wherein an introduced cysteine
residue of said encoded E38N IFNG polypeptide variant is introduced
by substitution at a residue position selected from the group
consisting of P3C, K6C, N10C, K13C, N16C, D21C, N25C, G26C, G31C,
K34C, K37C, E38C, E39C, K55C, K58C, N59C, D62C, Q64C, S65C, K68C,
E71C, E75C, N83C, S84C, K86C, K87C, K94C, N97C, S99C, T101C, D102C,
L103C and N104C, relative to the residue positions of wild-type
human IFNG of SEQ ID NO: 2.
50. The polynucleotide of claim 49, wherein the introduced cysteine
residue of said encoded E38N IFNG polypeptide variant is introduced
by substitution at a residue position selected from the group
consisting of N25C and N97C.
51. The polynucleotide of claim 49, wherein the introduced cysteine
residue of said encoded E38N IFNG polypeptide variant is an N16C
substitution.
52. The polynucleotide of claim 49, wherein the introduced cysteine
residue of said encoded E38N IFNG polypeptide variant is an N59C
substitution.
53. An expression vector comprising the polynucleotide of claim
36.
54. A host cell transformed with the expression vector of claim
53.
55. The host cell of claim 54 wherein the host cell is a
transformed CHO cell.
Description
[0001] The present application is a division of U.S. Ser. No.
10/369,495, filed Feb. 19, 2003, now U.S. Pat. No. 7,232,562, which
is a continuation of U.S. Ser. No. 10/130,084, filed Sep. 4, 2002,
now U.S. Pat. No. 7,230,081, which is a 371 of PCT/DK00/00631,
filed Nov. 13, 2000, which claims the benefit of 60/166,293, filed
Nov. 18, 1999; and which PCT application claims priority to Denmark
Patent Applications: No. 2000 00447, filed Mar. 17, 2000; and No.
1999 01631, filed Nov. 12, 1999.
FIELD OF THE INVENTION
[0002] The present invention relates to conjugates with
interferon-gamma-like activity, methods for their preparation,
pharmaceutical compositions comprising the molecules and their use
in the treatment of diseases.
BACKGROUND OF THE INVENTION
[0003] Interferon-gamma (IFNG) is a cytokine produced by
T-lymphocytes and natural killer cells and exists as a homodimer of
two noncovalently bound polypeptide subunits. The mature form of
each dimer comprises 143 amino acid residues (shown in SEQ ID NO
2), the precursor form thereof including signal sequence of 166
amino acid residues (shown in SEQ ID NO 1).
[0004] Each subunit has two potential N-glycosylation sites
(Aggarwal et al., Human Cytokines, Blackwell Scientific
Publications, 1992) at positions 25 and 97. Depending on the degree
of glycosylation the molecular weight of IFNG in dimer form is
34-50 kDa (Farrar et al., Ann. Rev. Immunol, 1993, 11:571-611).
[0005] The primary sequence of wildtype human IFNG (huIFNG) was
reported by Gray et al. (Nature 298:859-863, 1982), Taya et al.
(EMBO J. 1:953-958, 1982), Devos et al. (Nucleic Acids Res.
10:2487-2501, 1982) and Rinderknecht et al. (J. Biol. Chem.
259:6790-6797, 1984), and in EP 77670, EP 89676 and EP 110044. The
3D structure of huIFNG was reported by Ealick et al. (Science
252:698-702, 1991).
[0006] Various naturally-occurring or mutated forms of the IFNG
subunit polypeptides have been reported, including one comprising a
Cys-Tyr-Cys N-terminal amino acid sequence (positions (-3)-(-1)
relative to SEQ ID NO 2), one comprising an N-terminal methionine
(position -1 relative to SEQ ID NO 2), and various C-terminally
truncated forms comprising 127-134 amino acid residues. It is known
that 1-15 amino acid residues may be deleted from the C-terminus
without abolishing IFNG activity of the molecule. Furthermore,
heterogeneity of the huIFNG C-terminus was described by Pan et al.
(Eur. J. Biochem. 166:145-149, 1987).
[0007] HuIFNG muteins were reported by Slodowski et al. (Eur. J.
Biochem. 202:1133-1140, 1991), Luk et al. (J. Biol. Chem.
265:13314-13319, 1990), Seelig et al., (Biochemistry 27:1981-1987,
1988), Trousdale et al. (Invest. Opthalmol. Vis. Sci. 26:1244-1251,
1985), and in EP 146354. A natural huIFNG variant was reported by
Nishi et al. (J. Biochem. 97:153-159, 1985).
[0008] U.S. Pat. No. 6,046,034 discloses thermostable recombinant
huIFNG (rhuIFNG) variants having incorporated up to 4 pairs of
cysteine residues to enable disulphide bridge formation and thus
stabilization of the IFNG variant in homodimer form.
[0009] WO 92/08737 discloses IFNG variants comprising an added
methionine in the N-terminal end of the full (residues 1-143) or
partial (residues 1-132) amino acid sequence of wildtype human
IFNG. EP 219 781 discloses partial huIFNG sequences comprising
amino acid residues 3-124 (of SEQ ID NO 2). U.S. Pat. No. 4,832,959
discloses partial huIFNG sequences comprising residues 1-127, 5-146
and 5-127 of an amino acid sequence that compared to SEQ ID NO 2
has three additional N-terminal amino acid residues (CYC). U.S.
Pat. No. 5,004,689 discloses a DNA sequence encoding huIFNG without
the 3 N-terminal amino acid residues CYC and its expression in E.
coli. EP 446582 discloses E. coli produced rhuIFNG free of an
N-terminal methionine. U.S. Pat. No. 6,120,762 discloses a peptide
fragment of huIFNG comprising residues 95-134 thereof (relative to
SEQ ID NO 2).
[0010] High level expression of rhuIFNG was reported by Wang et al.
(Sci. Sin. B 24:1076-1084, 1994).
[0011] Glycosylation variation in rhuIFNG has been reported by
Curling et al. (Biochem. J. 272:333-337, 1990) and Hooker et al.,
(J. of Interferon and Cytokine Research, 1998, 18: 287-295).
[0012] Polymer-modification of rhuIFNG was reported by Kita et al.
(Drug Des. Deliv. 6:157-167, 1990), and in EP 236987 and U.S. Pat.
No. 5,109,120.
[0013] WO 92/22310 discloses asialoglycoprotein conjugate
derivatives of interferons, inter alia huIFNG.
[0014] IFNG fusion proteins have been described. For instance, EP
237019 discloses a single chain polypeptide having region
exhibiting interferon D activity and one region exhibiting IFNG
activity.
[0015] EP 158 198 discloses a single chain polypeptide having a
region exhibiting IFNG activity and a region exhibiting IL-2
activity. Several references described single chain dimeric IFNG
proteins, e.g. Landar et al. (J. Mol. Biol., 2000,
299:169-179).
[0016] WO 99/02710 discloses single chain polypeptides, one example
among many being IFNG.
[0017] WO 99/03887 discloses PEGylated variants of polypeptides
belonging to the growth hormone superfamily, wherein a
non-essential amino acid residue located in a specified region of
the polypeptide has been replaced by a cysteine residue. IFNG is
mentioned as one example of a member of the growth hormone super
family, but modification thereof is not discussed in any
detail.
[0018] IFNG has been suggested for treatment of interstitial lung
diseases (also known as Interstitial Pulmonary Fibrosis (IPF)
(Ziesche et al. (N. Engl. J. Med. 341:1264-1269, 1999 and Chest
110:Suppl:25S, 1996) and EP 795332) for which purpose IFNG can be
used in combination with prednisolone. In addition to IPF,
granulomatous diseases (Bolinger et al, Clinical Pharmacy, 1992,
11:834-850), certain mycobacterial infections (N. Engl. J. Med.
330:1348-1355, 1994), kidney cancer (J. Urol. 152:841-845, 1994),
osteopetrosis (N. Engl. J. Med. 332:1594-1599, 1995), scleroderma
(J. Rheumatol. 23:654-658, 1996), hepatitis B
(Hepatogastroenterology 45:2282-2294, 1998), hepatitis C (Int.
Hepatol. Communic. 6:264-273, 1997), septic shock (Nature Medicine
3:678-681, 1997), and rheumatoid arthritis may be treated with
IFNG.
[0019] As a pharmaceutical compound rhuIFNG is used with a certain
success, above all, against some viral infections and tumors.
rhuIFNG is usually applicable via parenteral, preferably via
subcutaneous, injection. Maximum serum concentrations have been
found after seven hours, half life in plasma is 30 minutes after iv
administration. For this reason efficient treatment with rhuIFNG
involves frequent injections. The main adverse effects consist of
fever, chills, sweating, headache, myalgia and drowsiness. These
effects are associated with injecting rhuIFNG and are observed
within the first hours after injection. Rare side effects are local
pain and erythema, elevation of liver enzymes, reversible granulo-
and thrombopenia and cardiotoxicity.
[0020] It is desirable to provide novel molecules with
IFNG-activity which have improved properties in terms of
pharmacokinetics, homogeneity, immunogenicity and other adverse
side-effects as compared with huIFNG or rhuIFNG.
BRIEF DISCLOSURE OF THE INVENTION
[0021] This application discloses improved IFNG-like molecules
providing one or more of the aforementioned desired benefits. In a
first aspect the invention relates to a conjugate exhibiting IFNG
activity and comprising at least one first non-polypeptide moiety
covalently attached to an IFNG polypeptide, the polypeptide
comprising an amino acid sequence that differs from that of a
parent IFNG polypeptide in at least one introduced and/or at least
one removed amino acid residue comprising an attachment group for
the non-polypeptide moiety. The conjugates have extended in vivo
half-life as compared to huIFNG and rhuIFNG and optionally causes a
reduced immune response as compared to rhuIFNG. Optionally, the
class of molecules also has further improved properties in terms of
producibility of homogenous molecules, improved stability towards
proteolysis and/or increased bioavailability.
[0022] Consequently, the conjugate of the invention offers a number
of advantages over the currently available IFNG compounds,
including longer duration between injections or other forms of
administration, fewer side effects, and/or increased efficiency due
to reduction in antibodies. Moreover, higher doses of active
protein and thus a more effective therapeutic response may be
obtained by use of a conjugate of the invention.
[0023] In a further aspect the invention relates to a conjugate
exhibiting IFNG activity comprising at least one N-terminally
PEGylated IFNG polypeptide. The IFNG polypeptide may be huIFNG or
any of the IFNG polypeptides described herein.
[0024] In still further aspects the invention relates to means and
methods for preparing a conjugate of the invention, including
nucleotide sequences and expression vectors as well as methods for
preparing the polypeptide or the conjugate.
[0025] In yet further aspects the invention relates to a
therapeutic composition comprising a conjugate of the invention, to
a conjugate or composition of the invention for use in therapy, to
the use of a conjugate or composition in therapy or for the
manufacture of a medicament for treatment of diseases.
[0026] Finally, the invention relates to the use of specified IFNG
conjugates for the manufacture of a medicament, a pharmaceutical
composition or a kit-of-parts for the treatment of interstitial
lung diseases, cancer, infections and/or inflammatory diseases, and
in the case of interstitial lung diseases, optionally, furthermore
in combination with glucocorticoids.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0027] In the context of the present application and invention the
following definitions apply:
[0028] The tem "conjugate" (or interchangeably "conjugated
polypeptide") is intended to indicate a heterogeneous (in the sense
of composite or chimeric) molecule formed by the covalent
attachment of one or more polypeptide(s) to one or more
non-polypeptide moieties. The term covalent attachment means that
the polypeptide and the non-polypeptide moiety are either directly
covalently joined to one another, or else are indirectly covalently
joined to one another through an intervening moiety or moieties,
such as a bridge, spacer, or linkage moiety or moieties.
Preferably, the conjugate is soluble at relevant concentrations and
conditions, i.e. soluble in physiological fluids such as blood.
Examples of conjugated polypeptides of the invention include
glycosylated and/or PEGylated polypeptides. The tem "non-conjugated
polypeptide" may be used about the polypeptide part of the
conjugate.
[0029] The term "non-polypeptide moiety" is intended to indicate a
molecule that is capable of conjugating to an attachment group of
the IFNG polypeptide. Preferred examples of such molecule include
polymer molecules, lipophilic compounds, sugar moieties or organic
derivatizing agents. When used in the context of a conjugate of the
invention it will be understood that the non-polypeptide moiety is
linked to the polypeptide part of the conjugate through an
attachment group of the polypeptide.
[0030] The tem "polymer molecule" is defined as a molecule formed
by covalent linkage of two or more monomers, wherein none of the
monomers is an amino acid residue, except where the polymer is
human albumin or another abundant plasma protein. The term
"polymer" may be used interchangeably with the term "polymer
molecule". The term "sugar moiety" is intended to indicate a
carbohydrate molecule attached by in vivo or in vitro
glycosylation, such as N- or O-glycosylation. Except where the
number of non-polypeptide moieties, such as polymer molecule(s), in
the conjugate is expressly indicated every reference to "a
non-polypeptide moiety" contained in a conjugate or otherwise used
in the present invention shall be a reference to one or more
non-polypeptide moieties in the conjugate.
[0031] The term "attachment group" is intended to indicate an amino
acid residue group capable of coupling to the relevant
non-polypeptide moiety such as a polymer molecule or a sugar
moiety. Useful attachment groups and their matching non-polypeptide
moieties are apparent from the table below.
TABLE-US-00001 Conjugation Attachment Examples of non- method/
group Amino acid polypeptide moiety Activated PEG Reference
--NH.sub.2 N-terminal, Lys Polymer, e.g. PEG mPEG-SPA Shearwater
Inc. Tresylated Delgado et al, mPEG critical reviews in Therapeutic
Drug Carrier Systems 9(3, 4): 249-304 (1992) --COOH C-term, Asp,
Glu Polymer, e.g. PEG mPEG-Hz Shearwater Inc Sugar moiety In vitro
coupling --SH Cys Polymer, e.g. PEG, PEG- Shearwater Inc
vinylsulphone Delgado et al, PEG-maleimide critical reviews in
Therapeutic Sugar moiety In vitro coupling Drug Carrier Systems
9(3, 4): 249-304 (1992) --OH Ser, Thr, OH--, Sugar moiety In vivo
O-linked Lys glycosylation --CONH.sub.2 Asn as part of an Sugar
moiety In vivo N-glycosylation site glycosylation Aromatic Phe,
Tyr, Trp Sugar moiety In vitro coupling residue --CONH.sub.2 Gln
Sugar moiety In vitro coupling Yan and Wold, Biochemistry, 1984,
Jul. 31; 23(16): 3759-65 Aldehyde Oxidized Polymer, e.g. PEG,
PEGylation Andresz et al., Ketone carbohydrate PEG-hydrazide 1978,
Makromol. Chem. 179: 301; WO 92/16555, WO 00/23114 Guanidino Arg
Sugar moiety In vitro coupling Lundblad and Noyes, Chimical
Reagents for Protein Modification, CRC Press Inc. Boca Raton, FI
Imidazole ring His Sugar moiety In vitro coupling As for
guanidine
For in vivo N-glycosylation, the term "attachment group" is used in
an unconventional way to indicate the amino acid residues
constituting an N-glycosylation site (with the sequence
N-X'-S/T/C--X'', wherein X' is any amino acid residue except
proline, X'' any amino acid residue that may or may not be
identical to X' and that preferably is different from proline, N is
asparagine and S/T/C is either serine, threonine or cysteine,
preferably serine or threonine, and most preferably threonine).
Although the asparagine residue of the N-glycosylation site is the
one to which the sugar moiety is attached during glycosylation,
such attachment cannot be achieved unless the other amino acid
residues of the N-glycosylation site is present. Accordingly, when
the non-polypeptide moiety is a sugar moiety and the conjugation is
to be achieved by N-glycosylation, the term "amino acid residue
comprising an attachment group for the non-polypeptide moiety" as
used in connection with alterations of the amino acid sequence of
the parent polypeptide is to be understood as one, two or all of
the amino acid residues constituting an N-glycosylation site is/are
to be altered in such a manner that either a functional
N-glycosylation site is introduced into the amino acid sequence or
removed from said sequence.
[0032] In the present application, amino acid names and atom names
(e.g. CA, CB, CD, CG, SG, NZ, N, O, C, etc) are used as defined by
the Protein DataBank (PDB) (see the pdb.org website) which are
based on the IUPAC nomenclature (IUPAC Nomenclature and Symbolism
for Amino Acids and Peptides (residue names, atom names etc.), Eur.
J. Biochem., 138, 9-37 (1984) together with their corrections in
Eur. J. Biochem., 152, 1 (1985). CA is sometimes referred to as
C.alpha., CB as C.beta.. The term "amino acid residue" is intended
to indicate an amino acid residue contained in the group consisting
of alanine (Ala or A), cysteine (Cys or C), aspartic acid (Asp or
D), glutamic acid (Glu or E), phenylalanine (Phe or F), glycine
(Gly or G), histidine (His or H), isoleucine (Ile or I), lysine
(Lys or K), leucine (Leu or L), methionine (Met or M), asparagine
(Asn or N), proline (Pro or P), glutamine (Gln or Q), arginine (Arg
or R), serine (Ser or S), threonine (Thr or T), valine (Val or V),
tryptophan (Trp or W), and tyrosine (Tyr or Y) residues. The
numbering of amino acid residues in this document is from the
N-terminus of huIFNG without signal peptide (i.e. SEQ ID NO 2). The
terminology used for identifying amino acid positions/substitutions
is illustrated as follows: N25 (indicates residue position #25 is
occupied by asparagine in the amino acid sequence shown in SEQ ID
NO 2). N25C (indicates that the Asp residue of position 25 has been
replaced with a Cys residue). Multiple substitutions are indicated
with a "+", e.g. Q1N+P3T/S means an amino acid sequence which
comprises a substitution of the Gln residue in position 1 with an
Asn residue and a substitution of the Pro residue in position 3
with a Thr or Ser residue, preferably a Thr residue.
[0033] The term "nucleotide sequence" is intended to indicate a
consecutive stretch of two or more nucleotide molecules. The
nucleotide sequence may be of genomic, cDNA, RNA, semisynthetic,
synthetic origin, or any combinations thereof.
[0034] The term "polymerase chain reaction" or "PCR" generally
refers to a method for amplification of a desired nucleotide
sequence in vitro, as described, for example, in U.S. Pat. No.
4,683,195. In general, the PCR method involves repeated cycles of
primer extension synthesis, using oligonucleotide primers capable
of hybridising preferentially to a template nucleic acid.
[0035] "Cell", "host cell", "cell line" and "cell culture" are used
interchangeably herein and all such terms should be understood to
include progeny resulting from growth or culturing of a cell.
"Transformation" and "transfection" are used interchangeably to
refer to the process of introducing DNA into a cell.
[0036] "Operably linked" refers to the covalent joining of two or
more nucleotide sequences, by means of enzymatic ligation or
otherwise, in a configuration relative to one another such that the
normal function of the sequences can be performed. For example, the
nucleotide sequence encoding a presequence or secretory leader is
operably linked to a nucleotide sequence for a polypeptide if it is
expressed as a preprotein that participates in the secretion of the
polypeptide: a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence; a
ribosome binding site is operably linked to a coding sequence if it
is positioned so as to facilitate translation. Generally, "operably
linked" means that the nucleotide sequences being linked are
contiguous and, in the case of a secretory leader, contiguous and
in reading phase. Linking is accomplished by ligation at convenient
restriction sites. If such sites do not exist, then synthetic
oligonucleotide adaptors or linkers are used, in conjunction with
standard recombinant DNA methods.
[0037] The term "introduce" is primarily intended to mean
substitution of an existing amino acid residue, but may also mean
insertion of an additional amino acid residue. The term "remove" is
primarily intended to mean substitution of the amino acid residue
to be removed for another amino acid residue, but may also mean
deletion (without substitution) of the amino acid residue to be
removed.
[0038] The term "amino acid residue comprising an attachment group
for the non-polypeptide moiety" is intended to indicate that the
amino acid residue is one to which the non-polypeptide moiety binds
(in the case of an introduced amino acid residue) or would have
bound (in the case of a removed amino acid residue).
[0039] The term "one difference" or "differs" as used about the
amino acid sequence of an IFNG polypeptide described herein is
intended to allow for additional differences being present.
Accordingly, in addition to the specified amino acid difference,
other amino acid residues than those specified may be mutated.
[0040] The term "functional in vivo half-life" is used in its
normal meaning, i.e. the time in which 50% of conjugate molecules
circulate in the plasma or bloodstream prior to being cleared (also
termed "serum half-life"), or the time in which 50% of a given
functionality of the conjugate is retained. The polypeptide or
conjugate is normally cleared by the action of one or more of the
reticuloendothelial systems (RES), kidney, spleen or liver, or by
specific or unspecific proteolysis. Normally, clearance depends on
size (relative to the cutoff for glomerular filtration), charge,
attached carbohydrate chains, and the presence of cellular
receptors for the protein. The functionality to be retained is
normally selected from antiviral, antiproliferative,
immunomodulatory or IFNG receptor binding activity. The functional
in vivo half-life may be determined by any suitable method known in
the art as further discussed in the Methods section
hereinafter.
[0041] The term "increased functional in vivo half-life" is used to
indicate that the functional in vivo half-life of the conjugate is
statistically significant increased relative to that of a reference
molecule, such as huIFNG, optionally in glycosylated form, e.g.
non-conjugated huIFNG or rhuIFNG as determined under comparable
conditions.
[0042] The term "immunogenicity" as used in connection with a given
substance is intended to indicate the ability of the substance to
induce a response from the human immune system. The immune response
may be a cell or antibody mediated response (see, e.g., Roitt:
Essential Immunology (8.sup.th Edition, Blackwell) for further
definition of immunogenicity).
[0043] The term "reduced immunogenicity" is intended to indicate
that the conjugate of the present invention gives rise to a
measurably lower immune response than a reference molecule, such as
huIFNG or rhuIFNG as determined under comparable conditions.
[0044] The term "exhibiting IFNG activity" is intended to indicate
that the polypeptide has one or more of the functions of native
IFNG, in particular huIFNG or rhuIFNG, including the capability to
bind to an IFNG receptor and cause transduction of the signal
transduced upon huIFNG-binding of its receptor as determined in
vitro or in vivo (i.e. in vitro or in vivo bioactivity). The IFNG
receptor has been described by Aguet et al. (Cell 55:273-280, 1988)
and Calderon et al. (Proc. Natl. Acad. Sci. USA 85:4837-4841,
1988). The "IFNG polypeptide" is a polypeptide exhibiting IFNG
activity, and is used herein about the polypeptide in monomer or
dimeric form, as appropriate. For instance, when specific
substitutions are indicated these are normally indicated relative
to the IFNG polypeptide monomer. When reference is made to the IFNG
part of a conjugate of the invention this is normally in dimeric
form (and thus, e.g., comprises two IFNG polypeptide monomers
modified as described). The dimeric form of the IFNG polypeptides
may be provided by the normal association of two monomers or be in
the form of a single chain dimeric IFNG polypeptide.
[0045] The IFNG polypeptide described herein may have an in vivo or
in vitro bioactivity of the same magnitude as huIFNG or rhuIFNG or
lower or higher, e.g. an in vivo or in vitro bioactivity of 1-100%
of that of huIFNG or rhuIFNG, as measured under the same
conditions, e.g. 1-25% or 1-50% or 25-100% or 50-100% of that of
huIFNG or rhuIFNG.
[0046] The term "parent IFNG" is intended to indicate the molecule
to be modified in accordance with the present invention. Normally,
the parent IFNG is encoded by a nucleotide sequence, which is
modified in accordance with the present invention so as to encode
the polypeptide part of a conjugate of the invention. The parent
IFNG is normally huIFNG or rhuIFNG or a variant or fragment
thereof. A "variant" is a polypeptide, which differs in one or more
amino acid residues from its parent polypeptide, normally in 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues.
A fragment is a part of the full-length huIFNG sequence exhibiting
IFNG activity, e.g. a C-terminally or N-terminally truncated
version thereof.
[0047] The term "functional site" is intended to indicate one or
more amino acid residues which is/are essential for or otherwise
involved in the function or performance of IFNG. Such amino acid
residues are "located at" the functional site. The functional site
may be determined by methods known in the art and is preferably
identified by analysis of a structure of the polypeptide complexed
to a relevant receptor, such as the IFNG receptor.
Conjugate of the Invention
[0048] As stated above, in a first aspect the invention relates to
conjugate exhibiting IFNG activity and comprising at least one
first non-polypeptide moiety covalently attached to an IFNG
polypeptide, the polypeptide comprising an amino acid sequence that
differs from that of a parent IFNG polypeptide in at least one
introduced and/or at least one removed amino acid residue
comprising an attachment group for the non-polypeptide moiety.
[0049] By removing or introducing an amino acid residue comprising
an attachment group for the non-polypeptide moiety it is possible
to specifically adapt the polypeptide so as to make the molecule
more susceptible to conjugation to the non-polypeptide moiety of
choice, to optimize the conjugation pattern (e.g. to ensure an
optimal distribution of non-polypeptide moieties on the surface of
the IFNG polypeptide) and thereby obtain a new conjugate molecule,
which exhibits IFNG activity and in addition one or more improved
properties as compared to huIFNG or rhuIFNG based molecules
available today. For instance, by introduction of attachment
groups, the IFNG polypeptide is boosted or otherwise altered in the
content of the specific amino acid residues to which the relevant
non-polypeptide moiety binds, whereby a more efficient, specific
and/or extensive conjugation is achieved. By removal of one or more
attachment groups it is possible to avoid conjugation to the
non-polypeptide moiety in parts of the polypeptide in which such
conjugation is disadvantageous, e.g. to an amino acid residue
located at or near a functional site of the polypeptide (since
conjugation at such a site may result in inactivation or reduced
IFNG activity of the resulting conjugate due to impaired receptor
recognition). Further, it may be advantageous to remove an
attachment group located closely to another attachment group in
order to avoid heterogeneous conjugation to such groups. In
preferred embodiments more than one amino acid residue of the IFNG
polypeptide is altered, e.g. the alteration embraces removal as
well as introduction of amino acid residues comprising attachment
sites for the non-polypeptide moiety of choice. This embodiment is
considered of particular interest in that it is possible to
specifically design the IFNG polypeptide so as to obtain an optimal
conjugation to the non-polypeptide moiety.
[0050] In addition to the removal and/or introduction of amino acid
residues the polypeptide may comprise other substitutions that are
not related to introduction and/or removal of amino acid residues
comprising an attachment group for the non-polypeptide moiety.
[0051] Wile the parent polypeptide to be modified by the present
invention can be any polypeptide with IFNG activity, and thus be
derived from any origin, e.g. a non-human mammalian origin, it is
preferred that the parent polypeptide is huIFNG with the amino acid
sequence shown in SEQ ID NO 2 or a variant or fragment thereof.
Examples of variants of hIFNG are described in the background of
the invention above, and include, e.g. huIFNG with the N-terminal
addition CYC and the cysteine modified variants described in U.S.
Pat. No. 6,046,034. Specific examples of fragments are those
disclosed in the Background of the Invention section above and
include huIFNG C-terminally truncated with 1-15 amino acid
residues, e.g. with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
or 15 amino acid residues, and/or N-terminally truncated with 1-3
amino acid residues.
[0052] It will be understood that when the parent IFNG polypeptide
is a variant or fragment of huIFNG, the modified IFNG polypeptide
prepared from such parent comprises the mutations or truncations of
the parent.
[0053] Also, the parent IFNG polypeptide can be a hybrid molecule
between an IFNG polypeptide monomer and another homologous
polypeptide optionally containing one or more additional
substitutions introduced into the hybrid molecule. Such hybrids are
described in the Background of the Invention section above. Such a
hybrid molecule may contain an amino acid sequence, which differs
in more than 15 such as more than 10 amino acid residues from the
amino acid sequence shown in SEQ ID NO 2. In order to be useful in
the present invention the hybrid molecule exhibits IFNG
activity.
[0054] Non-human parent IFNG's can be modified analogously to what
is described herein. e.g. by modifying a corresponding position of
the non-human parent IFNG (e.g. as determined from an alignment of
the amino acid sequence or 3D structure of said IFNG with huIFNG)
to the position described herein.
[0055] It will be understood that the amino acid residue comprising
an attachment group for a non-polypeptide moiety, either it be
removed or introduced, is selected on the basis of the nature of
the non-polypeptide moiety part of choice and, in most instances,
on the basis of the conjugation method to be used. For instance,
when the non-polypeptide moiety is a polymer molecule such as a
polyethylene glycol or polyalkylene oxide derived molecule amino
acid residues capable of functioning as an attachment group may be
selected from the group consisting of cysteine, lysine aspartic
acid, glutamic acid and arginine. When the non-polypeptide moiety
is a sugar moiety the attachment group is, e.g. an in vivo
glycosylation site, preferably an N-glycosylation site.
[0056] Whenever an attachment group for a non-polypeptide moiety is
to be introduced into or removed from the IFNG polypeptide in
accordance with the present invention, the position of the
polypeptide to be modified is conveniently selected as follows:
[0057] The position is preferably located at the surface of the
IFNG polypeptide, and more preferably occupied by an amino acid
residue that has more than 25% of its side chain exposed to the
solvent, preferably more than 50% of its side chain exposed to the
solvent, as determined on the basis of a 3D structure or model of
IFNG in its dimeric form, the structure or model optionally further
comprising one or two IFNG receptor molecules. Such positions (e.g.
representing more than 25% or more than 50% surface exposure in
model without or with receptor molecules) are listed in the
Materials and Methods section herein.
[0058] Also of interest is to modify any of the 23 C-terminal amino
acid residues of the parent IFNG (by introduction and/or removal of
amino acid residues comprising an attachment group for the
non-polypeptide moiety) since such residues are believed to be
located at the surface of the IFNG polypeptide.
[0059] Furthermore, in the IFNG polypeptide part of a conjugate of
the invention attachment groups located at the receptor-binding
site of IFNG has preferably been removed, preferably by
substitution of the amino acid residue comprising such group. Amino
acid residues of the IFNG receptor-binding site are identified in
the Materials and Methods section below. In the case of a single
chain IFNG polypeptide it may be sufficient to remove attachment
groups in the receptor-binding site of only one of the monomers and
thereby obtain a single chain IFNG polypeptide conjugate with one
active and one inactive receptor-binding site.
[0060] In order to determine an optimal distribution of attachment
groups, the distance between amino acid residues located at the
surface of the IFNG polypeptide is calculated on the basis of a 3D
structure of the IFNG dimeric polypeptide. More specifically, the
distance between the CB's of the amino acid residues comprising
such attachment groups, or the distance between the functional
group (NZ for lysine, CG for aspartic acid, CD for glutamic acid,
SG for cysteine) of one and the CB of another amino acid residue
comprising an attachment group are determined. In case of glycine,
CA is used instead of CB. In the IFNG polypeptide part of a
conjugate of the invention, any of said distances is preferably
more than 8 .ANG., in particular more than 10 .ANG. in order to
avoid or reduce heterogeneous conjugation.
[0061] Also, the amino acid sequence of the IFNG polypeptide may
differ from that of a parent IFNG polypeptide in that one or more
amino acid residues constituting part of an epitope has been
removed, preferably by substitution to an amino acid residue
comprising an attachment group for the non-polypeptide moiety, so
as to destroyed or inactivate the epitope. Epitopes of huIFNG or
rhuIFNG may be identified by use of methods known in the art, also
known as epitope mapping, see, e.g. Romagnoli et al., Biol Chem,
1999, 380(5):553-9, DeLisser H M, Methods Mol Biol, 1999, 96:11-20,
Van de Water et al., Clin Immunol Immunopathol, 1997, 85(3):229-35,
Saint-Remy J M, Toxicology, 1997, 119(1):77-81, and Lane D P and
Stephen C W, Curr Opin Immunol, 1993, 5(2):268-71. One method is to
establish a phage display library expressing random oligopeptides
of e.g. 9 amino acid residues. IgG1 antibodies from specific
antisera towards huIFNG or rhuIFNG are purified by
immunoprecipitation and the reactive phages are identified by
immunoblotting. By sequencing the DNA of the purified reactive
phages, the sequence of the oligopeptide can be determined followed
by localization of the sequence on the 3D-structure of the IFNG.
The thereby identified region on the structure constitutes an
epitope that then can be selected as a target region for
introduction of an attachment group for the non-polypeptide
moiety.
[0062] In order to avoid too much disruption of the structure and
function of the parent IFNG molecule the total number of amino acid
residues to be altered in accordance with the present invention (as
compared to the amino acid sequence shown in SEQ ID NO 2) typically
does not exceed 15. Preferably, the IFNG polypeptide comprises an
amino acid sequence, which differs in 1-15 amino acid residues from
the amino acid sequence shown in SEQ ID NO 2, such as in 1-8 or 2-8
amino acid residues, e.g. in 1-5 or 2-5 amino acid residue from the
amino acid sequence shown in SEQ ID NO 2. Thus, normally the IFNG
polypeptide comprises an amino acid sequence which differs from the
mature part of the amino acid sequence shown in SEQ ID NO 2 in 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid
residues. Preferably, the above numbers represent either the total
number of introduced or the total number of removed amino acid
residues comprising an attachment group for the relevant
non-polypeptide moiety/ies, or the total number of introduced and
removed amino acid residues comprising such group.
[0063] The exact number of attachment groups available for
conjugation and present in the IFNG polypeptide in dimeric form is
dependent on the effect desired to be achieved by the conjugation.
The effect to be obtained is, e.g. dependent on the nature and
degree of conjugation (e.g. the identity of the non-polypeptide
moiety, the number of non-polypeptide moieties desirable or
possible to conjugate to the polypeptide, where they should be
conjugated or where conjugation should be avoided, etc.).
[0064] The IFNG polypeptide part of a conjugate of the invention
may be in truncated form (e.g. truncated in 1-15 C-terminal amino
acid residues as described further above in connection with the
parent IFNG polypeptide, or truncated in 1-3 N-terminal amino acid
residues.
[0065] Functional in vivo half-life is e.g. dependent on the
molecular weight of the conjugate and the number of attachment
groups needed for providing increased half-life thus depends on the
molecular weight of the non-polypeptide moiety in question. In one
embodiment, the conjugate of the invention has a molecular weight
of at least 67 kDa, in particular at least 70 kDa as measured by
SDS-PAGE according to Laemmli, U. K., Nature Vol 227 (1970), p
680-85. IFNG has a Mw in the range of about 34-50 kDa, and
therefore additional about 20-40 kDa is required to obtain the
desired effect. This may be, e.g., be provided by 2-410 kDa PEG
molecules or as otherwise described herein.
[0066] In the conjugate of the invention it is preferred that at
least about 50% of all conjugatable attachment groups, such as at
least 80% and preferably all of such groups are occupied by the
relevant non-polypeptide moiety. Accordingly, in a preferred
embodiment the conjugate of the invention comprises, e.g., 1-10
non-polypeptide moieties, such as 2-8 or 3-6.
[0067] As mentioned above under physiological conditions IFNG
exists as a dimeric polypeptide. In accordance with the invention
the IFNG polypeptide part of a conjugate of the invention is
normally in homodimeric form (e.g. prepared by association of two
IFNG polypeptide molecules prepared as described herein). However,
if desired the IFNG polypeptide part of a conjugate of the
invention may be provided in single chain form, wherein two IFNG
polypeptide monomers are linked via a peptide bond or a peptide
linker. Providing the IFNG polypeptide in single chain form has the
advantage that the two constituent IFNG polypeptides may be
different which can be advantageous, e.g., to enable asymmetric
mutagenesis of the polypeptides. For instance, PEGylation sites can
be removed from the receptor-binding site from one of the monomers,
but retained in the other. Thereby, after PEGylation one monomer
has an intact receptor-binding site, whereas the other may be fully
PEGylated (and thus provide significantly increased molecular
weight.
[0068] Preferably, the conjugate of the invention has one or more
of the following improved properties: 1) Increased functional in
vivo half-life as compared to huIFNG or rhuIFNG, e.g. an increase
of about at least 5-fold, such as at least 10-fold or even higher.
2) Reduced immunogenicity as compared to huIFNG or rhuIFNG, e.g. a
reduction of at least 25%, such as at least 50%, and more
preferably at least 75%.
Conjugate of the Invention Wherein the Non-Polypeptide Moiety is a
Sugar Moiety
[0069] In a preferred embodiment of a conjugate of the invention
the first non-polypeptide moiety is a sugar moiety, e.g. an
O-linked or N-linked sugar moiety, and the IFNG polypeptide
comprises at least one removed and/or at least one introduced in
vivo glycosylation site.
[0070] For instance, an in vivo glycosylation site is introduced
into a position of the parent IFNG polypeptide occupied by an amino
acid residue exposed to the surface of the polypeptide, preferably
with more than 25% of the side chain exposed to the solvent, in
particular more than 50% exposed to the solvent (these positions
are identified in the Methods section herein). The N-glycosylation
site is introduced in such a way that the N-residue of said site is
located in said position. Analogously, an O-glycosylation site is
introduced so that the S or T residue making up such site is
located in said position. Furthermore, in order to ensure efficient
glycosylation it is preferred that the in vivo glycosylation site,
in particular the N residue of the N-glycosylation site or the S or
T residue of the O-glycosylation site, is located within the 118
N-terminal amino acid residues of the IFNG polypeptide, more
preferably within the 93 N-terminal amino acid residues. Still more
preferably, the in vivo glycosylation site is introduced into a
position wherein only one mutation is required to create the site
(i.e. where any other amino acid residues required for creating a
functional glycosylation site is already present in the
molecule).
[0071] For instance, substitutions that lead to introduction of an
additional N-glycosylation site at positions exposed at the surface
of the IFNG polypeptide and occupied by amino acid residues having
more than 25% of the side chain exposed to the surface (in a
structure with receptor molecule) include: Q1N+P3S/T, P3N+V5S/T,
K6N+A8S/T, E9N+L11 S/T, K12S/T, K13N+F15S/T, Y14N+N16S/T, G18S/T,
G18N, G18N+S20T, H19N+D21S/T, D21N+A23 S/T, G26N+L28S/T,
G31N+L33S/T, K34N+W36S/T, K37S/T, K37N+E39S/T, E38N, E38N+S40T,
E39N+D41S/T, S40N+R42S/T, K55N+F57S/T, K58N+F60S/T, K61S/T,
K61N+D63S/T, D62N+Q64S/T, D63N, D63N+S65T, Q64N+166S/T,
S65N+Q67S/T, Q67N, Q67N+S69T, K68N+V70S/T, E71N+173 S/T,
T72N+K74S/T, K74N+D76S/T, E75N+M77S/T, K80S/T, V79N+F81S/T,
K80N+F82S/T, N85S/T, S84N+K86S/T, K87S/T, K86N+K88S/T, K87N+R89S/T,
D90N+F92S/T, E93N+L95S/T, K94N, K94N+T96S, S99N, S99N+T101S,
T101N+L103S/T, D102N+N104S/T, L103N+V105S/T, Q106S/T, E119N,
E119N+S121T, P122N+A124S/T, A123N+K125S/T, A124N, A124N+T126S,
K125N+G127S/T, T126N+K128S/T, G127N+R129S/T, K128N+K130S/T,
R129N+R131S/T, K130N, K130N+S132T, R131N+Q133S/T, S132N+M134S/T,
Q133N+L135S/T, M134N+F136S/T, L135N+R137S/T, F136N+G138S/T,
R137N+R139S/T, G138N+R140S/T, R139N+A141S/T, R140N and R140N+S142T,
the substitution being indicated relative to huIFNG with the amino
acid sequence shown in SEQ ID NO 2. S/T indicates a substitution to
a serine or threonine residue, preferably a threonine residue.
[0072] Substitutions that lead to introduction of an additional
N-glycosylation site at positions exposed at the surface of the
IFNG polypeptide having more than 50% of the side chain exposed to
the surface (in a structure with receptor molecule) include:
P3N+V5S/T, K6N+A8S/T, K12S/T, K13N+F15S/T, G18S/T, D21N+A23 S/T,
G26N+L28S/T, G31N+L33S/T, K34N+W36S/T, K37N+E39S/T, E38N,
E38N+S40S/T, E39N+D41S/T, K55N+F57S/T, K58N+F60S/T, K61S/T,
D62N+Q64S/T, Q64N+166S/T, S65N+Q67S/T, K68N+V70S/T, E71N+173S/T,
E75N+M77S/T, N85S/T, S84N+K86S/T, K86N+K88S/T, K87N+R89S/T, K94N,
K94N+T96S, S99N, S99N+T101S, T101N+L103S/T, D102N+N104S/T,
L103N+V105S/T, Q106S/T, P122N+A124S/T, A123N+K125S/T, A124N,
A124N+T126S, K125N+G127S/T, T126N+K128S/T, G127N+R129S/T,
K128N+K1301S/T, R129N+R1311S/T, K130N, K130N+S132T, R131N+Q133S/T,
S132N+M134S/T, Q133N+L135S/T, M134N+F136S/T, L135N+R137S/T,
F136N+G138S/T, R137N+R139S/T, G138N+R140S/T, R139N+A141S/T, R140N
and R140N+S142T, the substitution being indicated relative to
huIFNG with the amino acid sequence shown in SEQ ID NO 2.
[0073] Substitutions where only one amino acid mutation is required
to introduce an N-glycosylation site include K12S/T, G18S/T, G18N,
K37S/T, E38N, M45N, 149N, K61 S/T, D63N, Q67N, V70N, K80S/T, F82N,
N85S/T, K87S/T, K94N, S99N, Q106S/T, E119N, A124N, K130N and R140N,
in particular K12S/T, G18N, G18S/T, K37S/T, E38N, K61S/T, D63N,
Q67N, K80S/T, N85S/T, K94N, S99N, Q106S/T, A124N, K130N, and R140N
(positions with more than 25% of its site chain exposed to the
surface (in a structure without receptor molecule), or more
preferably G18N, E38N, D63N, Q67N, K94N, S99N, A124N, K130N and
R140N (with more than 50% of its side chain exposed to the surface
in a structure without receptor molecule).
[0074] From the above lists of substitutions, it is preferable to
select substitutions located within the 118 N-terminal amino acid
residues, in particular within the 93 N-terminal amino acid
residues.
[0075] As indicated above, in addition to one or more introduced
glycosylation sites, existing glycosylation sites may have been
removed from the IFNG polypeptide. For instance, any of the above
listed substitutions to introduce a glycosylation site may be
combined with a substitution to remove any of the two natural
N-glycosylation sites of huIFNG. For instance, the IFNG polypeptide
may comprise a substitution of N25 and/or N97, e.g. one of the
substitutions N25K/C/D/E and/or N97K/C/D/E, if the conjugate of the
invention comprises a non-polypeptide polypeptide having the
relevant of K, C, D, E as an attachment group.
[0076] The IFNG polypeptide part of a conjugate of the invention
may contain a single in vivo glycosylation site pr monomer.
However, in order to become of a sufficient size to increase
functional in vivo half-life it is often desirable that the
polypeptide comprises more than one in vivo glycosylation site, in
particular 2-7 in vivo glycosylation sites, such as 2, 3, 4, 5, 6
or 7 in vivo glycosylation sites. Thus, the IFNG polypeptide may
comprise one additional glycosylation site pr monomer, or may
comprise two, three, four, five, six, seven or more introduced in
vivo glycosylation sites, preferably introduced by one or more
substitutions described in any of the above lists.
[0077] Removal and/or introduction of in vitro glycosylation sites
may be achieved as described in the subsequent sections on
modification of the IFNG polypeptide to introduce and/or remove
polymer attachment sites.
[0078] Any of the glycosylated IFNG polypeptides disclosed in the
present section having introduced and/or removed at least one
glycosylation site might further be conjugated to a second
non-polypeptide moiety. For instance, the second non-polypeptide
moiety is a polymer molecule, such as PEG, or any other
non-polypeptide moiety. For this purpose the conjugation may be
achieved by use of attachment groups already present in the IFNG
polypeptide or attachment groups may have been introduced and/or
removed, in particular such that a total of 1-6, in particular 3-4
or 1, 2, 3, 4, 5, or 6 attachment groups are available for
conjugation. Preferably, in a conjugate of the invention wherein
the IFNG polypeptide comprises two glycosylation sites, the number
and molecular weight of the non-polypeptide moiety is chosen so as
that the total molecular weight added by the non-polypeptide moiety
is in the range of 20-40 kDa, in particular about 20 kDa or 30
kDa.
[0079] In particular, the glycosylated IFNG polypeptide may be
conjugated to a polymer having cysteine as an attachment group. For
this purpose one or more cysteine residues are inserted into the
IFNG polypeptide, e.g. as described in the section entitled
"Conjugate of the invention, wherein the non-polypeptide moiety is
a molecule that has cysteine as an attachment group".
[0080] Alternatively or additionally, the glycosylated IFNG
polypeptide may be conjugated to a polymer having lysine as an
attachment group. For this purpose one or more lysine residues of
the parent polypeptide may have been removed, e.g. by any of the
substitutions mentioned in the section entitled "Conjugate of the
invention, wherein the non-polypeptide moiety is a molecule which
has lysine as an attachment group". Alternatively or additionally,
a lysine residue may have been introduced, e.g. by any of the
substitutions mentioned in said section.
[0081] As an alternative to polymer conjugation via a cysteine or
lysine group, the conjugation may be achieved via an acid group as
described in the section entitled "Conjugation of the invention
wherein the non-polypeptide moiety binds to an acid group", or via
any other suitable group.
Conjugate of the Invention, Wherein the First Non-Polypeptide
Moiety is a Polymer
[0082] In an alternative embodiment the first non-polypeptide
moiety is a polymer, e.g. any of those described in the section
entitled "Conjugation to a polymer molecule", in particular a
linear or branched PEG molecule, e.g. having cysteine, lysine,
aspartic acid and glutamic acid as an attachment group.
Introduction and/or removal of attachment groups for such polymer
is illustrated in the following sections. The IFNG polypeptide part
of a conjugate according to this embodiment may be a glycosylated
polypeptide, e.g. using one or both of the natural N-glycosylation
sites of huIFNG or an introduced glycosylation site as described in
the immediately preceding section.
Conjugate of the Invention, Wherein the Non-Polypeptide Moiety is a
Molecule which has Cysteine as an Attachment Group
[0083] In a preferred embodiment the first non-polypeptide moiety
is a polymer which has cysteine as an attachment group and at least
one cysteine residue is introduced into a position of the IFNG
polypeptide that in wildtype human IFNG is occupied by a surface
exposed amino acid residue. Preferably, the cysteine residue is
introduced in accordance with the general consideration for
introducing and/or removing attachment groups for the
non-polypeptide moiety given in the section entitled "Conjugate of
the Invention". For instance, the IFNG polypeptide may comprise at
least one substitution selected from the group consisting of P3C,
K6C, N10C, K13C, N16C, D21C, N25C, G26C, G31C, K34C, K37C, E38C,
E39C, K55C, K58C, N59C, D62C, Q64C, S65C, K68C, E71C, E75C, N83C,
S84C, 86C, K87C, K94C, N97C, S99C, T101C, D102C, L103C and N104C
(introduction of a cysteine residue in a position that is occupied
by an amino acid residue having more than 50% of its side chain
exposed to the surface in a structure with receptor). The
substitutions N25C and N97C are of particular interest, and
especially N25C+N97C, when the IFNG polypeptide is expressed in a
non-glycosylating host cell, such as E. coli, since N25 and N97
constitute part of an inherent glycosylation site of huIFNG.
[0084] Also or alternatively, the IFNG polypeptide according to
this embodiment may comprise at least one cysteine residue
introduced in a position occupied by any of the amino acid residues
121-143 of huIFNG.
[0085] Preferably, the IFNG polypeptide of the conjugate according
to this aspect comprises a total of 1-8, such as 2-6 Cys residues,
e.g. 1-3 Cys residues per monomer.
[0086] The conjugation between the polypeptide and the polymer may
be achieved in any suitable manner, e.g. as described in the
section entitled "Conjugation to a polymer molecule", e.g. in using
a one step method or in the stepwise manner referred to in said
section. When the conjugate comprises two or more first
non-polypeptide moieties, normally each of these has a molecular
weight of 5 or 10 kDa. A suitable polymer is VS-PEG.
Conjugate of the Invention, Wherein the Non-Polypeptide Moiety is a
Molecule which has Lysine as an Attachment Group
[0087] In accordance with this embodiment the non-polypeptide is a
polymer having lysine as an attachment group and the IFNG
polypeptide is modified in that at least one lysine residue is
removed, the lysine residue being selected from the group
consisting of K6, K12, K13, K34, K37, K43, K55, K58, K61, K68, K74,
K80, K86, K87, K88, K94, K108, K125, K128 and K130, the numbering
being made relative to SEQ ID NO 2. More preferably, at least one
lysine residue selected from the group consisting of K12, K34, K37,
K108, K128 and K130 be removed. Thereby, conjugation of this/these
residues can be avoided. The lysine residue(s) may be replaced with
any other amino acid residue, but is preferably replaced by an
arginine or a glutamine.
[0088] Furthermore, the IFNG polypeptide may be modified to have
introduced one or more lysine residues, in particular in a position
of huIFNG occupied by a surface exposed amino acid residue.
Preferably, the lysine residue is introduced in accordance with the
general consideration for introducing and/or removing attachment
groups for the non-polypeptide moiety given in the section entitled
"Conjugate of the Invention", in particular in a position which is
occupied by an amino acid residue having at least 25%, such as at
least 50% of its side chain exposed to the surface (such positions
being identified in the Materials and Methods section herein).
Also, at least one lysine residue may be introduced by substitution
of any of the amino acid residues 121-143 of SEQ ID NO 2.
Alternatively, the IFNG polypeptide may comprise a lysine in at
least one position selected from the group consisting of D2, E7,
E9, H19, D21, D24, N25, E38, E39, D41, R42, D62, D63, E71, E75,
D76, R89, D90, D91, E93, N97, R107, H111, E112, E119, R129, R131,
R137, R139 and R140 of SEQ ID NO 2 (positions occupied by an N, R,
D, E or H residue in huIFNG).
[0089] In accordance with this embodiment, the IFNG polypeptide
comprises a substitution in one or more of the above positions, in
particular in 1-15, such as 1-8 or 2-8, preferably 1-5 or 2-5
positions (removal and/or introduction of lysine residues) per
monomer. For instances, the IFNG polypeptide may comprise a
substitution in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15
of the above positions. The substitutions N25K and N97K are of
particular interest, and especially N25K+N97K, when the IFNG
polypeptide is expressed in a non-glycosylating host cell, such as
E. coli, since N25 and N97 constitute part of an inherent
glycosylation site of huIFNG.
[0090] For instance, the IFNG polypeptide of the conjugate
according to this embodiment may comprise at least one of the above
substitutions for introduction of a lysine residue in combination
with at least one substitution removing a lysine residue as defined
above (preferably a substitution to R or Q). For instance, the IFNG
polypeptide comprises at least one of the following substitutions
N25K and N97K in combination with at least one of the substitutions
K128R, K128Q, K130R and K130Q. Even more specifically, the IFNG
polypeptide comprises the substitution N25K+K128R, N25K+K130R,
N25K+K128R+K130R, N97K+K128R, N97K+K130R, N97K+K128R+K130R,
N25K+N97K+K128R+K130R, N25K+N97K+K128R and N25K+N97K+K130R.
[0091] While the non-polypeptide moiety of the conjugate according
to this aspect of the invention may be any molecule which, when
using the given conjugation method has lysine as an attachment
group (such as a sugar moiety, a lipophilic group or an organic
derivatizing agent), it is preferred that the non-polypeptide
moiety is a polymer molecule. The polymer molecule may be any of
the molecules mentioned in the section entitled "Conjugation to a
polymer molecule", but is preferably selected from the group
consisting of linear or branched polyethylene glycol or
polyalkylene oxide. Most preferably, the polymer molecule is
SS-PEG, NPC-PEG, aldehyde-PEG, mPEG-SPA, mPEG-SCM or nPEG-BTC from
Shearwater Polymers Inc., SC-PEG from Enzon Inc., tresylated mPEG
as described in U.S. Pat. No. 5,880,255 or
oxycarbonyl-oxy-N-dicarboxylmide-PEG (U.S. Pat. No. 5,122,614).
Normally, for conjugation to a lysine residue the non-polypeptide
moiety has a Mw of about 5 or 10 kDa.
Conjugate of the Invention Wherein the Non-Polypeptide Moiety Binds
to an Acid Group
[0092] In a still further embodiment the non-polypeptide moiety of
the conjugate of the invention is a molecule which has an acid
group as the attachment group, and the IFNG polypeptide comprises
an amino acid sequence that differs from the amino acid sequence
shown in SEQ ID NO 2 in that at least one surface exposed amino
acid residue has been substituted with an aspartic acid residue or
a glutamic acid residue, preferably in accordance with the general
considerations given in the section entitled "Conjugate of the
Invention". Alternatively, the Asp or Glu residue may be introduced
in a position of the parent IFNG polypeptide occupied by K, R, Q or
N. For instance, N25, N97, K125, K128, R129, K130 and/or R131, more
preferably N25 and/or N97, most preferably N25+N97, may be
substituted with an Asp or Glu residue.
[0093] Analogously to what has been described in the previous
sections one or more Asp or Glu residues may be removed, e.g. from
the receptor binding site, in case the non-polypeptide moiety is
one that binds to those residues.
[0094] While the non-polypeptide moiety of the conjugate according
to this aspect of the invention, which has an acid group as an
attachment group, can be any non-polypeptide moiety with such
property, it is presently preferred that the non-polypeptide moiety
is a polymer molecule or an organic derivatizing agent, in
particular a polymer molecule, and the conjugate is prepared, e.g.,
as described by Sakane and Pardridge, Pharmaceutical Research, Vol.
14, No. 8, 1997, pp 1085-1091.
Non-Polypeptide Moiety of the Conjugate of the Invention
[0095] As indicated further above the non-polypeptide moiety of the
conjugate of the invention is preferably selected from the group
consisting of a polymer molecule, a lipophilic compound, a sugar
moiety (e.g. by way of in vivo glycosylation) and an organic
derivatizing agent. All of these agents may confer desirable
properties to the polypeptide part of the conjugate, in particular
increased functional in vivo half-life and/or a reduced
immunogenicity. The polypeptide part of the conjugate is normally
conjugated to only one type of non-polypeptide moiety, but may also
be conjugated to two or more different types of non-polypeptide
moieties, e.g. to a polymer molecule and a sugar moiety, to a
lipophilic group and a sugar moiety, to an organic derivating agent
and a sugar moiety, to a lipophilic group and a polymer molecule,
etc. The conjugation to two or more different non-polypeptide
moieties may be done simultaneous or sequentially.
Methods of Preparing a Conjugate of the Invention
[0096] In the following sections "Conjugation to a lipophilic
compound", "Conjugation to a polymer molecule", "Conjugation to a
sugar moiety" and "Conjugation to an organic derivatizing agent"
conjugation to specific types of non-polypeptide moieties is
described.
Conjugation to a Lipophilic Compound
[0097] The polypeptide and the lipophilic compound may be
conjugated to each other, either directly or by use of a linker.
The lipophilic compound may be a natural compound such as a
saturated or unsaturated fatty acid, a fatty acid diketone, a
terpene, a prostaglandin, a vitamine, a carotenoide or steroide, or
a synthetic compound such as a carbon acid, an alcohol, an amine
and sulphonic acid with one or more alkyl-, aryl-, alkenyl- or
other multiple unsaturated compounds. The conjugation between the
polypeptide and the lipophilic compound, optionally through a
linker may be done according to methods known in the art, e.g. as
described by Bodanszky in Peptide Synthesis, John Wiley, New York,
1976 and in WO 96/12505.
Conjugation to a Polymer Molecule
[0098] The polymer molecule to be coupled to the polypeptide may be
any suitable polymer molecule, such as a natural or synthetic
homo-polymer or heteropolymer, typically with a molecular weight in
the range of 300-100,000 Da, such as 300-20,000 Da, more preferably
in the range of 500-10,000 Da, even more preferably in the range of
500-5000 Da.
[0099] Examples of homo-polymers include a polyol (i.e. poly-OH), a
polyamine (i.e. poly-NH.sub.2) and a polycarboxylic acid (i.e.
poly-COOH). A hetero-polymer is a polymer, which comprises one or
more different coupling groups, such as, e.g., a hydroxyl group and
an amine group.
[0100] Examples of suitable polymer molecules include polymer
molecules selected from the group consisting of polyalkylene oxide
(PAO), including polyalkylene glycol (PAG), such as polyethylene
glycol (PEG) and polypropylene glycol (PPG), branched PEGs,
poly-vinyl alcohol (PVA), poly-carboxylate, poly-(vinylpyrolidone),
polyethylene-co-maleic acid anhydride, polystyrene-co-malic acid
anhydride, dextran including carboxymethyl-dextran, or any other
biopolymer suitable for reducing immunogenicity and/or increasing
functional in vivo half-life and/or serum half-life. Another
example of a polymer molecule is human albumin or another abundant
plasma protein. Generally, polyalkylene glycol-derived polymers are
biocompatible, non-toxic, non-antigenic, non-immunogenic, have
various water solubility properties, and are easily excreted from
living organisms.
[0101] PEG is the preferred polymer molecule to be used, since it
has only few reactive groups capable of cross-linking compared,
e.g., to polysaccharides such as dextran, and the like. In
particular, monofunctional PEG, e.g. monomethoxypolyethylene glycol
(mPEG), is of interest since its coupling chemistry is relatively
simple (only one reactive group is available for conjugating with
attachment groups on the polypeptide). Consequently, the risk of
cross-linking is eliminated, the resulting polypeptide conjugates
are more homogeneous and the reaction of the polymer molecules with
the polypeptide is easier to control.
[0102] To effect covalent attachment of the polymer molecule(s) to
the polypeptide, the hydroxyl end groups of the polymer molecule
must be provided in activated form, i.e. with reactive functional
groups (examples of which include primary amino groups, hydrazide
(HZ), thiol, succinate (SUC), succinimidyl succinate (SS),
succinimidyl succinamide (SSA), succinimidyl proprionate (SPA),
succinimidy carboxymethylate (SCM), benzotriazole carbonate (BTC),
N-hydroxysuccinimide (NHS), aldehyde, nitrophenylcarbonate (NPC),
and tresylate (TRES)). Suitably activated polymer molecules are
commercially available, e.g. from Shearwater Polymers, Inc.,
Huntsville, Ala., USA. Alternatively, the polymer molecules can be
activated by conventional methods known in the art, e.g. as
disclosed in WO 90/13540. Specific examples of activated linear or
branched polymer molecules for use in the present invention are
described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs
(Functionalized Biocompatible Polymers for Research and
pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated
herein by reference). Specific examples of activated PEG polymers
include the following linear PEGs: NHS-PEG (e.g. SPA-PEG, SSPA-PEG,
SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM-PEG), and
NOR-PEG), BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG,
TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG, and branched PEGs such as
PEG2-NHS and those disclosed in U.S. Pat. No. 5,932,462 and U.S.
Pat. No. 5,643,575, both of which references are incorporated
herein by reference. Furthermore, the following publications,
incorporated herein by reference, disclose useful polymer molecules
and/or PEGylation chemistries: U.S. Pat. No. 5,824,778, U.S. Pat.
No. 5,476,653, WO 97/32607, EP 229,108, EP 402,378, U.S. Pat. No.
4,902,502, U.S. Pat. No. 5,281,698, U.S. Pat. No. 5,122,614, U.S.
Pat. No. 5,219,564, WO 92/16555, WO 94/04193, WO 94/14758, WO
94/17039, WO 94/18247, WO 94/28024, WO 95/00162, WO 95/11924, WO
95/13090, WO 95/33490, WO 96/00080, WO 97/18832, WO 98/41562, WO
98/48837, WO 99/32134, WO 99/32139, WO 99/32140, WO 96/40791, WO
98/32466, WO 95/06058, EP 439 508, WO 97/03106, WO 96/21469, WO
95/13312, EP 921 131, U.S. Pat. No. 5,736,625, WO 98/05363, EP 809
996, U.S. Pat. No. 5,629,384, WO 96/41813, WO 96/07670, U.S. Pat.
No. 5,473,034, U.S. Pat. No. 5,516,673, EP 605 963, U.S. Pat. No.
5,382,657, EP 510 356, EP 400 472, EP 183 503 and EP 154 316.
[0103] The conjugation of the polypeptide and the activated polymer
molecules is conducted by use of any conventional method, e.g. as
described in the following references (which also describe suitable
methods for activation of polymer molecules): Harris and Zalipsky,
eds., Poly(ethylene glycol) Chemistry and Biological Applications,
AZC, Washington; R. F. Taylor, (1991), "Protein immobilisation.
Fundamental and applications", Marcel Dekker, N.Y.; S. S. Wong,
(1992), "Chemistry of Protein Conjugation and Crosslinking", CRC
Press, Boca Raton; G. T. Hermanson et al., (1993), "Immobilized
Affinity Ligand Techniques", Academic Press, N.Y.). The skilled
person will be aware that the activation method and/or conjugation
chemistry to be used depends on the attachment group(s) of the IFNG
polypeptide as well as the functional groups of the polymer (e.g.
being amino, hydroxyl, carboxyl, aldehyde or sulfydryl). The
PEGylation may be directed towards conjugation to all available
attachment groups on the polypeptide (i.e. such attachment groups
that are exposed at the surface of the polypeptide) or may be
directed towards specific attachment groups, e.g. the N-terminal
amino group (U.S. Pat. No. 5,985,265). Furthermore, the conjugation
may be achieved in one step or in a stepwise manner (e.g. as
described in WO 99/55377).
[0104] It will be understood that the PEGylation is designed so as
to produce the optimal molecule with respect to the number of PEG
molecules attached, the size and form (e.g. whether they are linear
or branched) of such molecules, and where in the polypeptide such
molecules are attached. For instance, the molecular weight of the
polymer to be used may be chosen on the basis of the desired effect
to be achieved. For instance, if the primary purpose of the
conjugation is to achieve a conjugate having a high molecular
weight (e.g. to reduce renal clearance) it is usually desirable to
conjugate as few high Mw polymer molecules as possible to obtain
the desired molecular weight. When a high degree of epitope
shielding is desirable this may be obtained by use of a
sufficiently high number of low molecular weight polymer (e.g. with
a molecular weight of about 5,000 Da) to effectively shield all or
most epitopes of the polypeptide. For instance, 2-8, such as 3-6
such polymers may be used.
[0105] In connection with conjugation to only a single attachment
group on the protein (as described in U.S. Pat. No. 5,985,265), it
may be advantageous that the polymer molecule, which may be linear
or branched, has a high molecular weight, e.g. about 20 kDa.
[0106] Normally, the polymer conjugation is performed under
conditions aiming at reacting all available polymer attachment
groups with polymer molecules. Typically, the molar ratio of
activated polymer molecules to polypeptide is 1000-1, in particular
200-1, preferably 100-1, such as 10-1 or 5-1 in order to obtain
optimal reaction. However, also equimolar ratios may be used.
[0107] It is also contemplated according to the invention to couple
the polymer molecules to the polypeptide through a linker. Suitable
linkers are well known to the skilled person. A preferred example
is cyanuric chloride (Abuchowski et al., (1977), J. Biol. Chem.,
252, 3578-3581; U.S. Pat. No. 4,179,337; Shafer et al., (1986), J.
Polym. Sci. Polym. Chem. Ed., 24, 375-378.
[0108] Subsequent to the conjugation residual activated polymer
molecules are blocked according to methods known in the art, e.g.
by addition of primary amine to the reaction mixture, and the
resulting inactivated polymer molecules removed by a suitable
method.
Coupling to a Sugar Moiety
[0109] The coupling of a sugar moiety may take place in vivo or in
vitro. In order to achieve in vivo glycosylation of a polypeptide
with IFNG activity, which have been modified so as to introduce one
or more in vivo glycosylation sites (see the section "Conjugates of
the invention wherein the non-polypeptide moiety is a sugar
moiety"), the nucleotide sequence encoding the polypeptide part of
the conjugate must be inserted in a glycosylating, eukaryotic
expression host. The expression host cell may be selected from
fungal (filamentous fungal or yeast), insect or animal cells or
from transgenic plant cells. Furthermore, the glycosylation may be
achieved in the human body when using a nucleotide sequence
encoding the polypeptide part of a conjugate of the invention or a
polypeptide of the invention in gene therapy. In one embodiment the
host cell is a mammalian cell, such as an CHO cell, BHK or HEK
cell, e.g. HEK293, or an insect cell, such as an SF9 cell, or a
yeast cell, e.g. Saccharomyces cerevisiae, Pichia pastoris or any
other suitable glycosylating host, e.g. as described further below.
Optionally, sugar moieties attached to the IFNG polypeptide by in
vivo glycosylation are further modified by use of
glycosyltransferases, e.g. using the GlycoAdvance.TM. technology
marketed by Neose, Horsham, Pa., USA. Thereby, it is possible to,
e.g., increase the sialyation of the glycosylated IFNG polypeptide
following expression and in vivo glycosylation by CHO cells.
[0110] Covalent in vitro coupling of glycosides to amino acid
residues of IFNG may be used to modify or increase the number or
profile of carbohydrate substituents. Depending on the coupling
mode used, the sugar(s) may be attached to a) arginine and
histidine, b) free carboxyl groups, c) free sulfhydryl groups such
as those of cysteine, d) free hydroxyl groups such as those of
serine, threonine, tyrosine or hydroxyproline, e) aromatic residues
such as those of phenylalanine or tryptophan or f) the amide group
of glutamine. These amino acid residues constitute examples of
attachment groups for a sugar moiety, which may be introduced
and/or removed in the IFNG polypeptide of the conjugate of the
invention. Suitable methods of in vitro coupling are described, for
example in WO 87/05330 and in Aplin et al., CRC Crit Rev. Biochem.,
pp. 259-306, 1981. The in vitro coupling of sugar moieties or PEG
to protein- and peptide-bound Gln-residues can also be carried out
by transglutaminases (TGases), e.g. as described by Sato et al.,
1996 Biochemistry 35, 13072-13080 or in EP 725145.
Coupling to an Organic Derivatizing Agent
[0111] Covalent modification of the IFNG polypeptide may be
performed by reacting (an) attachment group(s) of the polypeptide
with an organic derivatizing agent. Suitable derivatizing agents
and methods are well known in the art. For example, cysteinyl
residues most commonly are reacted with (t-haloacetates (and
corresponding amines), such as chloroacetic acid or
chloroacetamide, to give carboxymethyl or carboxyamidomethyl
derivatives. Cysteinyl residues also are derivatized by reaction
with bromotrifluoroacetone,
.alpha.-bromo-.beta.-(4-imidozoyl)propionic acid, chloroacetyl
phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl
2-pyridyl disulfide, p-chloromercuribenzoate,
2-chloromercuri-4-nitrophenol, or
chloro-7-nitrobenzo-2-oxa-1,3-diazole. Histidyl residues are
derivatized by reaction with diethylpyrocarbonate at pH 5.5-7.0
because this agent is relatively specific for the histidyl side
chain. Para-bromophenacyl bromide also is useful; the reaction is
preferably performed in 0.1 M sodium cacodylate at pH 6.0. Lysinyl
and amino terminal residues are reacted with succinic or other
carboxylic acid anhydrides. Derivatization with these agents has
the effect of reversing the charge of the lysinyl residues. Other
suitable reagents for derivatizing .alpha.-amino-containing
residues include imidoesters such as methyl picolinimidate;
pyridoxal phosphate; pyridoxal; chloroborohydride;
trinitrobenzenesulfonic acid; O-methylisourea; 2,4-pentanedione;
and transaminase-catalyzed reaction with glyoxylate. Arginyl
residues are modified by reaction with one or several conventional
reagents, among them phenylglyoxal, 2,3-butanedione,
1,2-cyclohexanedione, and ninhydrin. Derivatization of arginine
residues requires that the reaction be performed in alkaline
conditions because of the high pKa of the guanidine functional
group. Furthermore, these reagents may react with the groups of
lysine as well as the arginine guanidino group. Carboxyl side
groups (aspartyl or glutamyl) are selectively modified by reaction
with carbodiimides (R--N.dbd.C.dbd.N--R'), where R and R' are
different alkyl groups, such as
1-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or
1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore,
aspartyl and glutamyl residues are converted to asparaginyl and
glutaminyl residues by reaction with ammonium ions.
Blocking of Functional Site
[0112] It has been reported that excessive polymer conjugation can
lead to a loss of activity of the polypeptide to which the polymer
is conjugated. This problem can be eliminated, e.g., by removal of
attachment groups located at the functional site or by blocking the
functional site prior to conjugation. These latter strategies
constitute further embodiments of the invention (the first strategy
being exemplified further above, e.g. by removal of lysine residues
which may be located close to the functional site). More
specifically, according to the second strategy the conjugation
between the polypeptide and the non-polypeptide moiety is conducted
under conditions where the functional site of the IFNG polypeptide
is blocked by a helper molecule capable of binding to the
functional site of the polypeptide. Preferably, the helper molecule
is one, which specifically recognizes a functional site of the
polypeptide, such as a receptor. Alternatively, the helper molecule
may be an antibody, in particular a monoclonal antibody recognizing
the polypeptide exhibiting IFNG activity. In particular, the helper
molecule may be a neutralizing monoclonal antibody.
[0113] The polypeptide is allowed to interact with the helper
molecule before effecting conjugation. This ensures that the
functional site of the polypeptide is shielded or protected and
consequently unavailable for derivatization by the non-polypeptide
moiety such, as a polymer. Following its elution from the helper
molecule, the conjugate between the non-polypeptide moiety and the
polypeptide can be recovered with at least a partially preserved
functional site.
[0114] The subsequent conjugation of the polypeptide having a
blocked functional site to a polymer, a lipophilic compound, a
sugar moiety, an organic derivatizing agent or any other compound
is conducted in the normal way, e.g. as described in the sections
above entitled "Conjugation to . . . ".
[0115] In a further embodiment the helper molecule is first
covalently linked to a solid phase such as column packing
materials, for instance Sephadex or agarose beads, or a surface,
e.g. reaction vessel. Subsequently, the polypeptide is loaded onto
the column material carrying the helper molecule and conjugation
carried out according to methods known in the art, e.g. as
described in the sections above entitled "Conjugation to . . . ".
This procedure allows the polypeptide conjugate to be separated
from the helper molecule by elution. The polypeptide conjugate is
eluated by conventional techniques under physico-chemical
conditions that do not lead to a substantive degradation of the
polypeptide conjugate. The fluid phase containing the polypeptide
conjugate is separated from the solid phase to which the helper
molecule remains covalently linked. The separation can be achieved
in other ways: For instance, the helper molecule may be derivatized
with a second molecule (e.g. biotin) that can be recognized by a
specific binder (e.g. streptavidin). The specific binder may be
linked to a solid phase thereby allowing the separation of the
polypeptide conjugate from the helper molecule-second molecule
complex through passage over a second helper-solid phase column
which will retain, upon subsequent elution, the helper
molecule-second molecule complex, but not the polypeptide
conjugate. The polypeptide conjugate may be released from the
helper molecule in any appropriate fashion. De-protection may be
achieved by providing conditions in which the helper molecule
dissociates from the functional site of the IFNG to which it is
bound. For instance, a complex between an antibody to which a
polymer is conjugated and an anti-idiotypic antibody can be
dissociated by adjusting the pH to an acid or alkaline pH.
Conjugation of a Tagged Polypeptide
[0116] In an alternative embodiment the IFNG polypeptide is
expressed, as a fusion protein, with a tag, i.e. an amino acid
sequence or peptide stretch made up of typically 1-30, such as 1-20
amino acid residues. Besides allowing for fast and easy
purification, the tag is a convenient tool for achieving
conjugation between the tagged IFNG polypeptide and the
non-polypeptide moiety. In particular, the tag may be used for
achieving conjugation in microtiter plates or other carriers, such
as paramagnetic beads, to which the tagged polypeptide can be
immobilised via the tag. The conjugation to the tagged IFNG
polypeptide in, e.g., microtiter plates has the advantage that the
tagged polypeptide can be immobilised in the microtiter plates
directly from the culture broth (in principle without any
purification) and subjected to conjugation. Thereby, the total
number of process steps (from expression to conjugation) can be
reduced. Furthermore, the tag may function as a spacer molecule
ensuring an improved accessibility to the immobilised polypeptide
to be conjugated. The conjugation using a tagged polypeptide may be
to any of the non-polypeptide moieties disclosed herein, e.g. to a
polymer molecule such as PEG.
[0117] The identity of the specific tag to be used is not critical
as long as the tag is capable of being expressed with the
polypeptide and is capable of being immobilised on a suitable
surface or carrier material. A number of suitable tags are
commercially available, e.g. from Unizyme Laboratories, Denmark.
For instance, the tag may any of the following sequences:
TABLE-US-00002 His-His-His-His-His-His
Met-Lys-His-His-His-His-His-His
Met-Lys-His-His-Ala-His-His-Gln-His-His
Met-Lys-His-Gln-His-Gln-His-Gln-His-Gln-His-Gln- His-Gln
(all available from Unizyme Laboratories, Denmark) or any of the
following: EQKLI SEEDL (a C-terminal tag described in Mol. Cell.
Biol. 5:3610-16, 1985) DYKDDDDK (a C- or N-terminal tag)
YPYDVPDYA
[0118] Antibodies against the above tags are commercially
available, e.g. from ADI, Aves Lab and Research Diagnostics.
[0119] A convenient method for using a tagged polypeptide for
PEGylation is given in the Materials and Methods section below.
[0120] The subsequent cleavage of the tag from the polypeptide may
be achieved by use of commercially available enzymes.
Polypeptides of the Invention
[0121] In a further aspect the invention relates to generally novel
IFNG polypeptides as disclosed herein. The novel polypeptides are
important intermediate compounds for the preparation of a conjugate
of the invention. In addition, the polypeptides themselves may have
interesting properties.
[0122] For instance, the novel IFNG polypeptide comprises at least
one substitution to K, R, D, E, C, S, T or N of a surface exposed
amino acid residue as described in much further detail in the
preceding part of the application.
Methods of Preparing an IFNG Polypeptide
[0123] The IFNG polypeptide, optionally in glycosylated form, may
be produced by any suitable method known in the art. Such methods
include constructing a nucleotide sequence encoding the polypeptide
and expressing the sequence in a suitable transformed or
transfected host. However, polypeptides of the invention may be
produced, albeit less efficiently, by chemical synthesis or a
combination of chemical synthesis or a combination of chemical
synthesis and recombinant DNA technology.
[0124] The nucleotide sequence of the invention encoding an IFNG
polypeptide (in monomer or single chain form) may be constructed by
isolating or synthesizing a nucleotide sequence encoding the parent
IFNG, such as huIFNG with the amino acid sequence SEQ ID NO 2, and
then changing the nucleotide sequence so as to effect introduction
(i.e. insertion or substitution) or deletion (i.e. removal or
substitution) of the relevant amino acid residue(s).
[0125] The nucleotide sequence is conveniently modified by
site-directed mutagenesis in accordance with well-known methods,
see, e.g., Mark et al., "Site-specific Mutagenesis of the Human
Fibroblast Interferon Gene", Proc. Natl. Acad. Sci. USA, 81, pp.
5662-66 (1984); and U.S. Pat. No. 4,588,585.
[0126] Alternatively, the nucleotide sequence is prepared by
chemical synthesis, e.g. by using an oligonucleotide synthesizer,
wherein oligonucleotides are designed based on the amino acid
sequence of the desired polypeptide, and preferably selecting those
codons that are favored in the host cell in which the recombinant
polypeptide will be produced. For example, several small
oligonucleotides coding for portions of the desired polypeptide may
be synthesized and assembled by PCR, ligation or ligation chain
reaction (LCR). The individual oligonucleotides typically contain
5' or 3' overhangs for complementary assembly.
[0127] Once assembled (by synthesis, site-directed mutagenesis or
another method), the nucleotide sequence encoding the polypeptide
is inserted into a recombinant vector and operably linked to
control sequences necessary for expression of the IFNG in the
desired transformed host cell.
[0128] It should of course be understood that not all vectors and
expression control sequences function equally well to express the
nucleotide sequence encoding an IFNG polypeptide described herein.
Neither will all hosts function equally well with the same
expression system. However, one of skill in the art may make a
selection among these vectors, expression control sequences and
hosts without undue experimentation. For example, in selecting a
vector, the host must be considered because the vector must
replicate in it or be able to integrate into the chromosome. The
vector's copy number, the ability to control that copy number, and
the expression of any other proteins encoded by the vector, such as
antibiotic markers, should also be considered. In selecting an
expression control sequence, a variety of factors should also be
considered. These include, for example, the relative strength of
the sequence, its controllability, and its compatibility with the
nucleotide sequence encoding the polypeptide, particularly as
regards potential secondary structures. Hosts should be selected by
consideration of their compatibility with the chosen vector, the
toxicity of the product coded for by the nucleotide sequence, their
secretion characteristics, their ability to fold the polypeptide
correctly, their fermentation or culture requirements, and the ease
of purification of the products coded for by the nucleotide
sequence.
[0129] The recombinant vector may be an autonomously replicating
vector, i.e. a vector which exists as an extrachromosomal entity,
the replication of which is independent of chromosomal replication,
e.g. a plasmid. Alternatively, the vector is one which, when
introduced into a host cell, is integrated into the host cell
genome and replicated together with the chromosome(s) into which it
has been integrated.
[0130] The vector is preferably an expression vector, in which the
nucleotide sequence encoding the IFNG polypeptide is operably
linked to additional segments required for transcription of the
nucleotide sequence. The vector is typically derived from plasmid
or viral DNA. A number of suitable expression vectors for
expression in the host cells mentioned herein are commercially
available or described in the literature. Useful expression vectors
for eukaryotic hosts, include, for example, vectors comprising
expression control sequences from SV40, bovine papilloma virus,
adenovirus and cytomegalovirus. Specific vectors are, e.g.,
pCDNA3.1(+)\Hyg (Invitrogen, Carlsbad, Calif., USA) and pCI-neo
(Stratagene, La Jola, Calif., USA). Useful expression vectors for
bacterial hosts include known bacterial plasmids, such as plasmids
from E. coli, including pBR322, pET3a and pET12a (both from Novagen
Inc., WI, USA), wider host range plasmids, such as RP4, phage DNAs,
e.g., the numerous derivatives of phage lambda, e.g., NM989, and
other DNA phages, such as M13 and filamentous single stranded DNA
phages. Useful expression vectors for yeast cells include the 2.mu.
plasmid and derivatives thereof, the POT1 vector (U.S. Pat. No.
4,931,373), the pJSO37 vector described in (Okkels, Ann. New York
Acad. Sci. 782, 202-207, 1996) and pPICZ A, B or C (Invitrogen).
Useful vectors for insect cells include pVL941, pBG311 (Cate et
al., "Isolation of the Bovine and Human Genes for Mullerian
Inhibiting Substance And Expression of the Human Gene In Animal
Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both
available from Invitrogen).
[0131] Other vectors for use in this invention include those that
allow the nucleotide sequence encoding the IFNG polypeptide to be
amplified in copy number. Such amplifiable vectors are well known
in the art. They include, for example, vectors able to be amplified
by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461,
Kaufman and Sharp, "Construction Of A Modular Dihydrafolate
Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient
Expression", Mol. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine
synthetase ("GS") amplification (see, e.g., U.S. Pat. No. 5,122,464
and EP 338,841).
[0132] The recombinant vector may further comprise a DNA sequence
enabling the vector to replicate in the host cell in question. An
example of such a sequence (when the host cell is a mammalian cell)
is the SV40 origin of replication. When the host cell is a yeast
cell, suitable sequences enabling the vector to replicate are the
yeast plasmid 2.mu. replication genes REP 1-3 and origin of
replication.
[0133] The vector may also comprise a selectable marker, e.g. a
gene the product of which complements a defect in the host cell,
such as the gene coding for dihydrofolate reductase (DHFR) or the
Schizosaccharomyces pombe TPI gene (described by P. R. Russell,
Gene 40, 1985, pp. 125-130), or one which confers resistance to a
drug, e.g. ampicillin, kanamycin, tetracyclin, chloramphenicol,
neomycin, hygromycin or methotrexate. For filamentous fungi,
selectable markers include amdS, pyrG, arcB, niaD, sC.
[0134] The term "control sequences" is defined herein to include
all components, which are necessary or advantageous for the
expression of the IFNG polypeptide. Each control sequence may be
native or foreign to the nucleic acid sequence encoding the
polypeptide. Such control sequences include, but are not limited
to, a leader, polyadenylation sequence, propeptide sequence,
promoter, enhancer or upstream activating sequence, signal peptide
sequence, and transcription terminator. At a minimum, the control
sequences include a promoter.
[0135] A wide variety of expression control sequences may be used
in the present invention. Such useful expression control sequences
include the expression control sequences associated with structural
genes of the foregoing expression vectors as well as any sequence
known to control the expression of genes of prokaryotic or
eukaryotic cells or their viruses, and various combinations
thereof.
[0136] Examples of suitable control sequences for directing
transcription in mammalian cells include the early and late
promoters of SV40 and adenovirus, e.g. the adenovirus 2 major late
promoter, the MT-1 (metallothionein gene) promoter, the human
cytomegalovirus immediate-early gene promoter (CMV), the human
elongation factor 1.alpha. (EF-1.alpha.) promoter, the Drosophila
minimal heat shock protein 70 promoter, the Rous Sarcoma Virus
(RSV) promoter, the human ubiquitin C (UbC) promoter, the human
growth hormone terminator, SV40 or adenovirus E1b region
polyadenylation signals and the Kozak consensus sequence (Kozak, M.
J Mol Biol 1987 Aug. 20; 196(4):947-50).
[0137] In order to improve expression in mammalian cells a
synthetic intron may be inserted in the 5' untranslated region of
the nucleotide sequence encoding the IFNG polypeptide. An example
of a synthetic intron is the synthetic intron from the plasmid
pCI-Neo (available from Promega Corporation, WI, USA).
[0138] Examples of suitable control sequences for directing
transcription in insect cells include the polyhedrin promoter, the
P10 promoter, the Autographa californica polyhedrosis virus basic
protein promoter, the baculovirus immediate early gene 1 promoter
and the baculovirus 39K delayed-early gene promoter, and the SV40
polyadenylation sequence.
[0139] Examples of suitable control sequences for use in yeast host
cells include the promoters of the yeast .alpha.-mating system, the
yeast triose phosphate isomerase (TPI) promoter, promoters from
yeast glycolytic genes or alcohol dehydrogenase genes, the ADH2-4c
promoter and the inducible GAL promoter.
[0140] Examples of suitable control sequences for use in
filamentous fungal host cells include the ADH3 promoter and
terminator, a promoter derived from the genes encoding Aspergillus
oryzae TAKA amylase triose phosphate isomerase or alkaline
protease, an A. niger .alpha.-amylase, A. niger or A. nidulans
glucoamylase, A. nidulans acetamidase, Rhizomucor miehei aspartic
proteinase or lipase, the TPI1 terminator and the ADH3
terminator.
[0141] Examples of suitable control sequences for use in bacterial
host cells include promoters of the lac system, the trp system, the
TAC or TRC system and the major promoter regions of phage
lambda.
[0142] The nucleotide sequence of the invention, whether prepared
by site-directed mutagenesis, synthesis or other methods, may or
may not also include a nucleotide sequence that encode a signal
peptide. The signal peptide is present when the polypeptide is to
be secreted from the cells in which it is expressed. Such signal
peptide, if present, should be one recognized by the cell chosen
for expression of the polypeptide. The signal peptide may be
homologous (e.g. be that normally associated with huIFNG) or
heterologous (i.e. originating from another source than huIFNG) to
the polypeptide or may be homologous or heterologous to the host
cell, i.e. be a signal peptide normally expressed from the host
cell or one which is not normally expressed from the host cell.
Accordingly, the signal peptide may be prokaryotic, e.g. derived
from a bacterium such as E. coli, or eukaryotic, e.g. derived from
a mammalian, or insect or yeast cell.
[0143] The presence or absence of a signal peptide will, e.g.,
depend on the expression host cell used for the production of the
polypeptide, the protein to be expressed (whether it is an
intracellular or intracellular protein) and whether it is desirable
to obtain secretion. For use in filamentous fungi, the signal
peptide may conveniently be derived from a gene encoding an
Aspergillus sp. amylase or glucoamylase, a gene encoding a
Rhizomucor miehei lipase or protease or a Humicola lanuginosa
lipase. The signal peptide is preferably derived from a gene
encoding A. oryzae TAKA amylase, A. niger neutral .alpha.-amylase,
A. niger acid-stable amylase, or A. niger glucoamylase. For use in
insect cells, the signal peptide may conveniently be derived from
an insect gene (cf. WO 90/05783), such as the lepidopteran Manduca
sexta adipokinetic hormone precursor, (cf. U.S. Pat. No.
5,023,328), the honeybee melittin (Invitrogen), ecdysteroid
UDPglucosyltransferase (egt) (Murphy et al., Protein Expression and
Purification 4, 349-357 (1993) or human pancreatic lipase (hpl)
(Methods in Enzymology 284, pp. 262-272, 1997).
[0144] A preferred signal peptide for use in mammalian cells is
that of huIFNG or the murine Ig kappa light chain signal peptide
(Coloma, M (1992) J. 1 mm. Methods 152:89-104). For use in yeast
cells suitable signal peptides have been found to be the
.alpha.-factor signal peptide from S. cereviciae. (cf. U.S. Pat.
No. 4,870,008), the signal peptide of mouse salivary amylase (cf.
0. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), a modified
carboxypeptidase signal peptide (cf. L. A. Valls et al., Cell 48,
1987, pp. 887-897), the yeast BAR1 signal peptide (cf. WO
87/02670), and the yeast aspartic protease 3 (YAP3) signal peptide
(cf. M. Egel-Mitani et al., Yeast 6, 1990, pp. 127-137).
[0145] Any suitable host may be used to produce the IFNG
polypeptide, including bacteria, fungi (including yeasts), plant,
insect, mammal, or other appropriate animal cells or cell lines, as
well as transgenic animals or plants. Examples of bacterial host
cells include grampositive bacteria such as strains of Bacillus,
e.g. B. brevis or B. subtilis, Pseudomonas or Streptomyces, or
gramnegative bacteria, such as strains of E. coli. The introduction
of a vector into a bacterial host cell may, for instance, be
effected by protoplast transformation (see, e.g., Chang and Cohen,
1979, Molecular General Genetics 168: 111-115), using competent
cells (see, e.g., Young and Spizizen, 1961, Journal of Bacteriology
81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of
Molecular Biology 56: 209-221), electroporation (see, e.g.,
Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or
conjugation (see, e.g., Koehler and Thorne, 1987, Journal of
Bacteriology 169: 5771-5278).
[0146] Examples of suitable filamentous fungal host cells include
strains of Aspergillus, e.g. A. oryzae, A. niger; or A. nidulans,
Fusarium or Trichoderma. Fungal cells may be transformed by a
process involving protoplast formation, transformation of the
protoplasts, and regeneration of the cell wall in a manner known
per se. Suitable procedures for transformation of Aspergillus host
cells are described in EP 238 023 and U.S. Pat. No. 5,679,543.
Suitable methods for transforming Fusarium species are described by
Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. Yeast may
be transformed using the procedures described by Becker and
Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to
Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume
194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983,
Journal of Bacteriology 153: 163; and Hinnen et al., 1978,
Proceedings of the National Academy of Sciences USA 75: 1920.
[0147] Examples of suitable yeast host cells include strains of
Saccharomyces, e.g. S. cerevisiae, Schizosaccharomyces,
Kluyveromyces, Pichia, such as P. pastoris or P. methanolica,
Hansenula, such as H. Polymorpha or Yarrowia. Methods for
transforming yeast cells with heterologous DNA and producing
heterologous polypeptides therefrom are disclosed by Clontech
Laboratories, Inc, Palo Alto, Calif., USA (in the product protocol
for the Yeastmaker.TM. Yeast Tranformation System Kit), and by
Reeves et al., FEMS Microbiology Letters 99 (1992) 193-198,
Manivasakam and Schiestl, Nucleic Acids Research, 1993, Vol. 21,
No. 18, pp. 4414-4415 and Ganeva et al., FEMS Microbiology Letters
121 (1994) 159-164.
[0148] Examples of suitable insect host cells include a Lepidoptora
cell line, such as Spodoptera frugiperda (Sf9 or Sf21) or
Trichoplusioa ni cells (High Five) (U.S. Pat. No. 5,077,214).
Transformation of insect cells and production of heterologous
polypeptides therein may be performed as described by
Invitrogen.
[0149] Examples of suitable mammalian host cells include Chinese
hamster ovary (CHO) cell lines, (e.g. CHO-K1; ATCC CCL-61), Green
Monkey cell lines (COS) (e.g. COS 1 (ATCC CRL-1650), COS 7 (ATCC
CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell
lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g.
HEK 293 (ATCC CRL-1573)), as well as plant cells in tissue culture.
Additional suitable cell lines are known in the art and available
from public depositories such as the American Type Culture
Collection, Rockville, Md. Also, the mammalian cell, such as a CHO
cell, may be modified to express sialyltransferase, e.g.
1,6-sialyltransferase, e.g. as described in U.S. Pat. No.
5,047,335, in order to provide improved glycosylation of the IFNG
polypeptide.
[0150] Methods for introducing exogenous DNA into mammalian host
cells include calcium phosphate-mediated transfection,
electroporation, DEAE-dextran mediated transfection,
liposome-mediated transfection, viral vectors and the transfection
method described by Life Technologies Ltd, Paisley, UK using
Lipofectamin 2000. These methods are well known in the art and e.g.
described by Ausbel et al. (eds.), 1996, Current Protocols in
Molecular Biology, John Wiley & Sons, New York, USA. The
cultivation of mammalian cells are conducted according to
established methods, e.g. as disclosed in (Animal Cell
Biotechnology, Methods and Protocols, Edited by Nigel Jenkins,
1999, Human Press Inc, Totowa, N.J., USA and Harrison M A and Rae I
F, General Techniques of Cell Culture, Cambridge University Press
1997).
[0151] In order to produce a glycosylated polypeptide a eukaryotic
host cell, e.g. of the type mentioned above, is preferably
used.
[0152] In the production methods of the present invention, the
cells are cultivated in a nutrient medium suitable for production
of the polypeptide using methods known in the art. For example, the
cell may be cultivated by shake flask cultivation, small-scale or
large-scale fermentation (including continuous, batch, fed-batch,
or solid state fermentations) in laboratory or industrial
fermenters performed in a suitable medium and under conditions
allowing the polypeptide to be expressed and/or isolated. The
cultivation takes place in a suitable nutrient medium comprising
carbon and nitrogen sources and inorganic salts, using procedures
known in the art. Suitable media are available from commercial
suppliers or may be prepared according to published compositions
(e.g., in catalogues of the American Type Culture Collection). If
the polypeptide is secreted into the nutrient medium, the
polypeptide can be recovered directly from the medium. If the
polypeptide is not secreted, it can be recovered from cell
lysates.
[0153] The resulting polypeptide may be recovered by methods known
in the art. For example, the polypeptide may be recovered from the
nutrient medium by conventional procedures including, but not
limited to, centrifugation, filtration, extraction, spray drying,
evaporation, or precipitation.
[0154] The polypeptides may be purified by a variety of procedures
known in the art including, but not limited to, chromatography
(e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and
size exclusion), electrophoretic procedures (e.g., preparative
isoelectric focusing), differential solubility (e.g., ammonium
sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein
Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers,
New York, 1989). Specific methods for purifying polypeptides
exhibiting IFNG activity are disclosed in EP 110044 and unexamined
Japanese patent application No. 186995/84.
[0155] The biological activity of the IFNG polypeptide can be
assayed by any suitable method known in the art. Such assays
include antibody neutralization of antiviral activity, induction of
protein kinase, oligoadenylate 2,5-A synthetase or
phosphodiesterase activities, as described in EP 41313 B1. Such
assays also include immunomodulatory assays (see, e.g., U.S. Pat.
No. 4,753,795), growth inhibition assays, and measurement of
binding to cells that express interferon receptors. Specific assays
are described in the Materials and Methods section herein.
[0156] Furthermore, the invention relates to improved methods of
treating, in particular, interstitial lung diseases, but also
granulomatous diseases, cancer, infections, bone disorders (e.g. a
bone metabolism disorder so as malignant osteopetrosis) and
autoimmune diseases such as rheumatoid arthritis, the key
advantages being less frequent and/or less intrusive administration
of more efficient therapy, and optionally a lower risk of immune
reactions with the therapeutically active compound(s).
[0157] The conjugate of the invention is preferably administered in
a composition including a pharmaceutically acceptable carrier or
excipient. "Pharmaceutically acceptable" means a carrier or
excipient that does not cause any untoward effects in patients to
whom it is administered. Such pharmaceutically acceptable carriers
and excipients are well known in the art (Remington's
Pharmaceutical Sciences, 18th edition, A. R. Gennaro, Ed., Mack
Publishing Company [1990]; Pharmaceutical Formulation Development
of Peptides and Proteins, S. Frokjaer and L. Hovgaard, Eds., Taylor
& Francis [2000]; and Handbook of Pharmaceutical Excipients,
3rd edition, A. Kibbe, Ed., Pharmaceutical Press [2000]).
[0158] The conjugate of the invention can be used "as is" and/or in
a salt form thereof. Suitable salts include, but are not limited
to, salts with alkali metals or alkaline earth metals, such as
sodium, potassium, calcium and magnesium, as well as e.g. zinc
salts. These salts or complexes may by present as a crystalline
and/or amorphous structure.
[0159] The conjugate of the invention is administered at a dose
approximately paralleling that employed in therapy with known
commercial preparations of IFNG such as Actimmune or as specified
in EP 795332. The exact dose to be administered depends on the
circumstances. Normally, the dose should be capable of preventing
or lessening the severity or spread of the condition or indication
being treated. It will be apparent to those of skill in the art
that an effective amount of conjugate or composition of the
invention depends, inter alia, upon the disease, the dose, the
administration schedule, whether the polypeptide or conjugate or
composition is administered alone or in conjunction with other
therapeutic agents, the serum half-life of the compositions, and
the general health of the patient.
[0160] The invention also relates to the use of a) a conjugate
comprising at least one non-polypeptide moiety covalently attached
to an IFNG polypeptide, the IFNG polypeptide being selected from
the group consisting of huIFNG, rhuIFNG or an IFNG polypeptide as
described herein (i.e. the conjugate being a conjugate of the
invention) or b) a pharmaceutical composition of the invention, for
the manufacture of a medicament, a pharmaceutical composition or a
kit-of-parts for the treatment of interstitial lung diseases,
cancer, infections, bone disorders (e.g. a bone metabolism disorder
so as malignant osteopetrosis) and/or inflammatory diseases, in
particular interstitial lung diseases, most particularly idiopathic
pulmonary fibrosis. A glucocorticoid such as prednisolone may also
be included. The preferred dosing is 1-4, more preferably 2-3,
micrograms/kg patient weight of the polypeptide component per dose.
The preferred dosing is 100-350, more preferably 100-150 micrograms
glucocorticoid/kg patient weight per dose.
[0161] Also disclosed are improved means of delivering the
molecules or preparations, optionally additionally comprising
glucocorticoids.
[0162] The invention also relates to a kit of parts suitable for
the treatment of interstitial lung diseases comprising a first
pharmaceutical composition comprising the active components a) or
b) mentioned above and a second pharmaceutical composition
comprising at least one glucocorticoid, each optionally together
with a pharmaceutically acceptable carrier and/or excipient.
[0163] The conjugate of the invention can be formulated into
pharmaceutical compositions by well-known methods. Suitable
formulations are described by Remington's Pharmaceutical Sciences
by E. W. Martin and U.S. Pat. No. 5,183,746.
[0164] The pharmaceutical composition may be formulated in a
variety of forms, including liquid, gel, lyophilized, powder,
compressed solid, or any other suitable form. The preferred form
will depend upon the particular indication being treated and will
be apparent to one of skill in the art.
[0165] The pharmaceutical composition may be administered orally,
subcutaneously, intravenously, intracerebrally, intranasally,
transdermally, intraperitoneally, intramuscularly, intrapulmonary,
vaginally, rectally, intraocularly, or in any other acceptable
manner, e.g. using PowderJect or ProLease technology. The
formulations can be administered continuously by infusion, although
bolus injection is acceptable, using techniques well known in the
art, such as pumps or implantation. In some instances the
formulations may be directly applied as a solution or spray. The
preferred mode of administration will depend upon the particular
indication being treated and will be apparent to one of skill in
the art.
[0166] The pharmaceutical composition of the invention may be
administered in conjunction with other therapeutic agents. These
agents may be incorporated as part of the same pharmaceutical
composition or may be administered separately from the polypeptide
or conjugate of the invention, either concurrently or in accordance
with any other acceptable treatment schedule. In addition, the
polypeptide, conjugate or pharmaceutical composition of the
invention may be used as an adjunct to other therapies. In
particular, combinations with glucocorticoids as described in EP
795332 are considered.
Parenterals
[0167] An example of a pharmaceutical composition is a solution
designed for parenteral administration. Although in many cases
pharmaceutical solution formulations are provided in liquid form,
appropriate for immediate use, such parenteral formulations may
also be provided in frozen or in lyophilized form. In the former
case, the composition must be thawed prior to use. The latter form
is often used to enhance the stability of the active compound
contained in the composition under a wider variety of storage
conditions, as it is recognized by those skilled in the art that
lyophilized preparations are generally more stable than their
liquid counterparts. Such lyophilized preparations are
reconstituted prior to use by the addition of one or more suitable
pharmaceutically acceptable diluents such as sterile water for
injection or sterile physiological saline solution.
[0168] In case of parenterals, they are prepared for storage as
lyophilized formulations or aqueous solutions by mixing, as
appropriate, the polypeptide having the desired degree of purity
with one or more pharmaceutically acceptable carriers, excipients
or stabilizers typically employed in the art (all of which are
termed "excipients"), for example buffering agents, stabilizing
agents, preservatives, isotonifiers, non-ionic detergents,
antioxidants and/or other miscellaneous additives.
[0169] Buffering agents help to maintain the pH in the range which
approximates physiological conditions. They are typically present
at a concentration ranging from about 2 mM to about 50 mM Suitable
buffering agents for use with the present invention include both
organic and inorganic acids and salts thereof such as citrate
buffers (e.g., monosodium citrate-disodium citrate mixture, citric
acid-trisodium citrate mixture, citric acid-monosodium citrate
mixture, etc.), succinate buffers (e.g., succinic acid-monosodium
succinate mixture, succinic acid-sodium hydroxide mixture, succinic
acid-disodium succinate mixture, etc.), tartrate buffers (e.g.,
tartaric acid-sodium tartrate mixture, tartaric acid-potassium
tartrate mixture, tartaric acid-sodium hydroxide mixture, etc.),
fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture,
fumaric acid-disodium fumarate mixture, monosodium
fumarate-disodium fumarate mixture, etc.), gluconate buffers (e.g.,
gluconic acid-sodium glyconate mixture, gluconic acid-sodium
hydroxide mixture, gluconic acid-potassium glyuconate mixture,
etc.), oxalate buffer (e.g., oxalic acid-sodium oxalate mixture,
oxalic acid-sodium hydroxide mixture, oxalic acid-potassium oxalate
mixture, etc.), lactate buffers (e.g., lactic acid-sodium lactate
mixture, lactic acid-sodium hydroxide mixture, lactic
acid-potassium lactate mixture, etc.) and acetate buffers (e.g.,
acetic acid-sodium acetate mixture, acetic acid-sodium hydroxide
mixture, etc.). Additional possibilities are phosphate buffers,
histidine buffers and trimethylamine salts such as Tris.
[0170] Preservatives are added to retard microbial growth, and are
typically added in amounts of about 0.2%-1% (w/v). Suitable
preservatives for use with the present invention include phenol,
benzyl alcohol, meta-cresol, methyl paraben, propyl paraben,
octadecyldimethylbenzyl ammonium chloride, benzalkonium halides
(e.g. benzalkonium chloride, bromide or iodide), hexamethonium
chloride, alkyl parabens such as methyl or propyl paraben,
catechol, resorcinol, cyclohexanol and 3-pentanol.
[0171] Isotonicifiers are added to ensure isotonicity of liquid
compositions and include polyhydric sugar alcohols, preferably
trihydric or higher sugar alcohols, such as glycerin, erythritol,
arabitol, xylitol, sorbitol and mannitol. Polyhydric alcohols can
be present in an amount between 0.1% and 25% by weight, typically
1% to 5%, taking into account the relative amounts of the other
ingredients.
[0172] Stabilizers refer to a broad category of excipients which
can range in function from a bulking agent to an additive which
solubilizes the therapeutic agent or helps to prevent denaturation
or adherence to the container wall. Typical stabilizers can be
polyhydric sugar alcohols (enumerated above); amino acids such as
arginine, lysine, glycine, glutamine, asparagine, histidine,
alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid,
threonine, etc., organic sugars or sugar alcohols, such as lactose,
trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol,
myoinisitol, galactitol, glycerol and the like, including cyclitols
such as inositol; polyethylene glycol; amino acid polymers;
sulfur-containing reducing agents, such as urea, glutathione,
thioctic acid, sodium thioglycolate, thioglycerol,
.alpha.-monothioglycerol and sodium thiosulfate; low molecular
weight polypeptides (i.e. <10 residues); proteins such as human
serum albumin, bovine serum albumin, gelatin or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; monosaccharides
such as xylose, mannose, fructose and glucose; disaccharides such
as lactose, maltose and sucrose; trisaccharides such as raffinose,
and polysaccharides such as dextran. Stabilizers are typically
present in the range of from 0.1 to 10,000 parts by weight based on
the active protein weight.
[0173] Non-ionic surfactants or detergents (also known as "wetting
agents") may be present to help solubilize the therapeutic agent as
well as to protect the therapeutic polypeptide against
agitation-induced aggregation, which also permits the formulation
to be exposed to shear surface stress without causing denaturation
of the polypeptide. Suitable non-ionic surfactants include
polysorbates (20, 80, etc.), polyoxamers (184, 188 etc.),
Pluronic.RTM. polyols, polyoxyethylene sorbitan monoethers
(Tween.RTM.-20, Tween.RTM.-80, etc.).
[0174] Additional miscellaneous excipients include bulking agents
or fillers (e.g. starch), chelating agents (e.g. EDTA),
antioxidants (e.g., ascorbic acid, methionine, vitamin E) and
cosolvents. The active ingredient may also be entrapped in
microcapsules prepared, for example, by coacervation techniques or
by interfacial polymerization, for example hydroxymethylcellulose,
gelatin or poly-(methylmethacylate) microcapsules, in colloidal
drug delivery systems (for example liposomes, albumin microspheres,
microemulsions, nanoparticles and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's
Pharmaceutical Sciences, supra.
[0175] Parenteral formulations to be used for in vivo
administration must be sterile. This is readily accomplished, for
example, by filtration through sterile filtration membranes.
Sustained Release Preparations
[0176] Suitable examples of sustained-release preparations include
semi-permeable matrices of solid hydrophobic polymers containing
the conjugate, the matrices having a suitable form such as a film
or microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate) or poly(vinylalcohol)),
polylactides, copolymers of L-glutamic acid and ethyl-L-glutamate,
non-degradable ethylene-vinyl acetate, degradable lactic
acid-glycolic acid copolymers such as the ProLease.RTM. technology
or Lupron Depot.RTM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for long periods such as up to or over 100 days,
certain hydrogels release proteins for shorter time periods. When
encapsulated polypeptides remain in the body for a long time, they
may denature or aggregate as a result of exposure to moisture at
37.degree. C., resulting in a loss of biological activity and
possible changes in immunogenicity. Rational strategies can be
devised for stabilization depending on the mechanism involved. For
example, if the aggregation mechanism is discovered to be
intermolecular S--S bond formation through thio-disulfide
interchange, stabilization may be achieved by modifying sulfhydryl
residues, lyophilizing from acidic solutions, controlling moisture
content, using appropriate additives, and developing specific
polymer matrix compositions.
Oral Administration
[0177] For oral administration, the pharmaceutical composition may
be in solid or liquid form, e.g. in the form of a capsule, tablet,
suspension, emulsion or solution. The pharmaceutical composition is
preferably made in the form of a dosage unit containing a given
amount of the active ingredient. A suitable daily dose for a human
or other mammal may vary widely depending on the condition of the
patient and other factors, but can be determined by persons skilled
in the art using routine methods.
[0178] Solid dosage forms for oral administration may include
capsules, tablets, suppositories, powders and granules. In such
solid dosage forms, the active compound may be admixed with at
least one inert diluent such as sucrose, lactose, or starch. Such
dosage forms may also comprise, as is normal practice, additional
substances, e.g. lubricating agents such as magnesium stearate. In
the case of capsules, tablets and pills, the dosage forms may also
comprise buffering agents. Tablets and pills can additionally be
prepared with enteric coatings.
[0179] The conjugates may be admixed with adjuvants such as
lactose, sucrose, starch powder, cellulose esters of alkanoic
acids, stearic acid, talc, magnesium stearate, magnesium oxide,
sodium and calcium salts of phosphoric and sulphuric acids, acacia,
gelatin, sodium alginate, polyvinyl-pyrrolidine, and/or polyvinyl
alcohol, and tableted or encapsulated for conventional
administration. Alternatively, they may be dissolved in saline,
water, polyethylene glycol, propylene glycol, ethanol, oils (such
as corn oil, peanut oil, cottonseed oil or sesame oil), tragacanth
gum, and/or various buffers. Other adjuvants and modes of
administration are well known in the pharmaceutical art. The
carrier or diluent may include time delay material, such as
glyceryl monostearate or glyceryl distearate alone or with a wax,
or other materials well known in the art.
[0180] The pharmaceutical compositions may be subjected to
conventional pharmaceutical operations such as sterilization and/or
may contain conventional adjuvants such as preservatives,
stabilizers, wetting agents, emulsifiers, buffers, fillers, etc.,
e.g. as disclosed elsewhere herein.
[0181] Liquid dosage forms for oral administration may include
pharmaceutically acceptable emulsions, solutions, suspensions,
syrups and elixirs containing inert diluents commonly used in the
art, such as water. Such compositions may also comprise adjuvants
such as wetting agents, sweeteners, flavoring agents and perfuming
agents.
Topical Administration
[0182] Formulations suitable for topical administration include
liquid or semi-liquid preparations suitable for penetration through
the skin (e.g., liniments, lotions, ointments, creams, or pastes)
and drops suitable for administration to the eye, ear, or nose.
Pulmonary Delivery
[0183] Formulations suitable for use with a nebulizer, either jet
or ultrasonic, will typically comprise the polypeptide or conjugate
dissolved in water at a concentration of, e.g., about 0.01 to 25 mg
of conjugate per mL of solution, preferably about 0.1 to 10 mg/mL.
The formulation may also include a buffer and a simple sugar (e.g.,
for protein stabilization and regulation of osmotic pressure),
and/or human serum albumin ranging in concentration from 0.1 to 10
mg/ml. Examples of buffers that may be used are sodium acetate,
citrate and glycine. Preferably, the buffer will have a composition
and molarity suitable to adjust the solution to a pH in the range
of 3 to 9. Generally, buffer molarities of from 1 mM to 50 mM are
suitable for this purpose. Examples of sugars which can be utilized
are lactose, maltose, mannitol, sorbitol, trehalose, and xylose,
usually in amounts ranging from 1% to 10% by weight of the
formulation.
[0184] The nebulizer formulation may also contain a surfactant to
reduce or prevent surface induced aggregation of the protein caused
by atomization of the solution in forming the aerosol. Various
conventional surfactants can be employed, such as polyoxyethylene
fatty acid esters and alcohols, and polyoxyethylene sorbitan fatty
acid esters. Amounts will generally range between 0.001% and 4% by
weight of the formulation. An especially preferred surfactant for
purposes of this invention is polyoxyethylene sorbitan
monooleate.
[0185] Specific formulations and methods of generating suitable
dispersions of liquid particles of the invention are described in
WO 94/20069, U.S. Pat. No. 5,915,378, U.S. Pat. No. 5,960,792, U.S.
Pat. No. 5,957,124, U.S. Pat. No. 5,934,272, U.S. Pat. No.
5,915,378, U.S. Pat. No. 5,855,564, U.S. Pat. No. 5,826,570 and
U.S. Pat. No. 5,522,385 which are hereby incorporated by
reference.
[0186] Formulations for use with a metered dose inhaler device will
generally comprise a finely divided powder. This powder may be
produced by lyophilizing and then milling a liquid conjugate
formulation and may also contain a stabilizer such as human serum
albumin (HSA). Typically, more than 0.5% (w/w) HSA is added.
Additionally, one or more sugars or sugar alcohols may be added to
the preparation if necessary. Examples include lactose maltose,
mannitol, sorbitol, sorbitose, trehalose, xylitol, and xylose. The
amount added to the formulation can range from about 0.01 to 200%
(w/w), preferably from approximately 1 to 50%, of the conjugate
present. Such formulations are then lyophilized and milled to the
desired particle size.
[0187] The properly sized particles are then suspended in a
propellant with the aid of a surfactant. The propellant may be any
conventional material employed for this purpose, such as a
chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon,
or a hydrocarbon, including trichlorofluoromethane,
dichlorodifluoromethane, dichlorotetrafluoroethanol, and
1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable
surfactants include sorbitan trioleate and soya lecithin. Oleic
acid may also be useful as a surfactant. This mixture is then
loaded into the delivery device. An example of a commercially
available metered dose inhaler suitable for use in the present
invention is the Ventolin metered dose inhaler, manufactured by
Glaxo Inc., Research Triangle Park, N.C.
[0188] Formulations for powder inhalers will comprise a finely
divided dry powder containing conjugate and may also include a
bulking agent, such as lactose, sorbitol, sucrose, or mannitol in
amounts which facilitate dispersal of the powder from the device,
e.g., 50% to 90% by weight of the formulation. The particles of the
powder shall have aerodynamic properties in the lung corresponding
to particles with a density of about 1 g/cm.sup.2 having a median
diameter less than 10 micrometers, preferably between 0.5 and 5
micrometers, most preferably of between 1.5 and 3.5 micrometers. An
example of a powder inhaler suitable for use in accordance with the
teachings herein is the Spinhaler powder inhaler, manufactured by
Fisons Corp., Bedford, Mass.
[0189] The powders for these devices may be generated and/or
delivered by methods disclosed in U.S. Pat. No. 5,997,848, U.S.
Pat. No. 5,993,783, U.S. Pat. No. 5,985,248, U.S. Pat. No.
5,976,574, U.S. Pat. No. 5,922,354, U.S. Pat. No. 5,785,049 and
U.S. Pat. No. 5,654,007.
[0190] Mechanical devices designed for pulmonary delivery of
therapeutic products, include but are not limited to nebulizers,
metered dose inhalers, and powder inhalers, all of which are
familiar to those of skill in the art. Specific examples of
commercially available devices suitable for the practice of this
invention are the Ultravent nebulizer, manufactured by
Mallinckrodt, Inc., St. Louis, Mo.; the Acorn II nebulizer,
manufactured by Marquest Medical Products, Englewood, Colo.; the
Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research
Triangle Park, N.C.; the Spinhaler powder inhaler, manufactured by
Fisons Corp., Bedford, Mass.; the "standing cloud" device of Inhale
Therapeutic Systems, Inc., San Carlos, Calif.; the AIR inhaler
manufactured by Alkermes, Cambridge, Mass.; and the AERx pulmonary
drug delivery system manufactured by Aradigm Corporation, Hayward,
Calif.
[0191] The invention provides compositions and methods for treating
bacterial and viral infections, cancers or tumors, interstitial
pulmonary diseases such as idiopathic pulmonary fibrosis,
granulomatous diseases, bone disorders (e.g. a bone metabolism
disorder so as malignant osteopetrosis) and autoimmune diseases
such rheumatoid arthritis.
[0192] In a further aspect the invention relates to a method of
treating a mammal having circulating antibodies against huIFNG or
rhuIFNG, which method comprises administering a compound which has
the bioactivity of IFNG and which does not react with said
antibodies. The compound is preferably a conjugate as described
herein and the mammal is preferably a human being. The mammals to
be treated may suffer from any of the diseases listed above for
which IFNG is a useful treatment. Furthermore, the invention
relates to a method of making a pharmaceutical product for use in
treatment of mammals having circulating antibodies against huIFNG
or rhuIFNG, wherein a compound which has the bioactivity of IFNG
and which does not react with such is formulated into an injectable
or otherwise suitable formulation. The term "circulating
antibodies" is intended to indicate autoantibodies formed in a
mammal in response to having been treated with any of the
commercially available IFNG preparations.
[0193] Also contemplated is use of a nucleotide sequence encoding
an IFNG polypeptide of the invention in gene therapy applications.
In particular, it may be of interest to use a nucleotide sequence
encoding an IFNG polypeptide described in the section above
entitled "Glycosylated Polypeptides of the Invention modified to
incorporate additional glycosylation sites". The glycosylation of
the polypeptide is thus achieved during the course of the gene
therapy, i.e. after expression of the nucleotide sequence in the
human body.
[0194] Gene therapy applications contemplated include treatment of
those diseases in which the polypeptide is expected to provide an
effective therapy.
[0195] Local delivery of IFNG using gene therapy may provide the
therapeutic agent to the target area while avoiding potential
toxicity problems associated with non-specific administration.
[0196] Both in vitro and in vivo gene therapy methodologies are
contemplated.
[0197] Several methods for transferring potentially therapeutic
genes to defined cell populations are known. For further reference
see, e.g., Mulligan, "The Basic Science Of Gene Therapy", Science,
260, pp. 926-31 (1993). These methods include:
[0198] Direct gene transfer, e.g., as disclosed by Wolff et al.,
"Direct Gene transfer Into Mouse Muscle In vivo", Science 247, pp.
1465-68 (1990);
[0199] Liposome-mediated DNA transfer, e.g., as disclosed by Caplen
et al., "Liposome-mediated CFTR Gene Transfer to the Nasal
Epithelium Of Patients With Cystic Fibrosis" Nature Med., 3, pp.
39-46 (1995); Crystal, "The Gene As A Drug", Nature Med., 1, pp.
15-17 (1995); Gao and Huang, "A Novel Cationic Liposome Reagent For
Efficient Transfection of Mammalian Cells", Biochem. Biophys Res.
Comm., 179, pp. 280-85 (1991);
[0200] Retrovirus-mediated DNA transfer, e.g., as disclosed by Kay
et al., "In vivo Gene Therapy of Hemophilia B: Sustained Partial
Correction In Factor IX-Deficient Dogs", Science, 262, pp. 117-19
(1993); Anderson, "Human Gene Therapy", Science, 256, pp. 808-13
(1992);
[0201] DNA Virus-mediated DNA transfer. Such DNA viruses include
adenoviruses (preferably Ad-2 or Ad-5 based vectors), herpes
viruses (preferably herpes simplex virus based vectors), and
parvoviruses (preferably "defective" or non-autonomous parvovirus
based vectors, more preferably adeno-associated virus based
vectors, most preferably AAV-2 based vectors). See, e.g., Ali et
al., "The Use Of DNA Viruses as Vectors for Gene Therapy", Gene
Therapy, 1, pp. 367-84 (1994); U.S. Pat. No. 4,797,368, and U.S.
Pat. No. 5,139,941.
[0202] The invention is further described in the following
examples. The examples should not, in any manner, be understood as
limiting the generality of the present specification and
claims.
Materials and Methods
Assays
Interferon Assay Outline
[0203] It has previously been published that IFNG interacts with
and activates IFNG receptors on HeLa cells. Consequently,
transcription is activated at promoters containing an Interferon
Stimulated Response Element (ISRE). It is thus possible to screen
for agonists of interferon receptors by use of an ISRE coupled
luciferase reporter gene (ISRE-luc) placed in HeLa cells.
Primary Assay
[0204] HeLa cells are co-transfected with ISRE-Luc and pcDNA
3.1/hygro and foci (cell clones) are created by selection in DMEM
media containing Hygromycin B. Cell clones are screened for
luciferase activity in the presence or absence of IFNG. Those
clones showing the highest ratio of stimulated to unstimulated
luciferase activity are used in further assays.
[0205] To screen muteins, 15,000 cells/well are seeded in 96 well
culture plates and incubated overnight in DMEM media. The next day
muteins as well as a known standard are added to the cells in
various concentrations. The plates are incubated for 6 hours at
37.degree. C. in a 5% CO.sub.2 air atmosphere LucLite substrate
(Packard Bioscience, Groningen The Netherlands) is subsequently
added to each well. Plates are sealed and luminescence measured on
a TopCount luminometer (Packard) in SPC (single photon counting)
mode. Each individual plate contains wells incubated with IFNG as a
stimulated control and other wells containing normal media as an
unstimulated control. The ratio between stimulated and unstimulated
luciferase activity serves as an internal standard for both mutein
activity and experiment-to-experiment variation.
Functional In Vivo Half-Life of IFNG Conjugate
[0206] Measurement of biological half-life can be carried out in
number of ways described in the literature. One method described by
Rutenfranz et al. (J. Interferon Res. 1990, vol. 10, p. 337-341)
who used intravenous and intramuscular injection of IFNG in 8 weeks
old C57BL/6 mice. The biological half-life was measured by a
biological assay determining the IFNG titer in murine serum, using
Hep-2 cells and vesicular stomatitis virus (VVS). As an
alternative, they also used ELISA to detect the IFNG level in
serum.
[0207] As an alternative, radioactive labelled IFNG can be used to
study the subcutaneous absorption and local distribution of IFNG.
Croos and Roberts (J. Pharm., 1993, vol 45, p. 606-609) have done
studies of .sup.125IFNG in anaesthetized female Spraque-Dawley
rats. After administration subcutaneous administration, blood and
tissue samples were collected and the amount of IFNG was determined
by gamma-counting.
PEGylation of IFNG
[0208] PEGylated rhuIFNG may be prepared as described in Example 2
of U.S. Pat. No. 5,109,120. Analogously, modified IFNG polypeptides
described herein, e.g. carrying the mutation N25K may be PEGylated.
The resulting PEG-IFNG-N25K conjugate has an additional
PEG-molecule attached as compared with the conjugate of
rhuIFNG.
Preparation of Pharmaceutical Composition
[0209] A pharmaceutical composition, e.g. for treatment of
interstitial pulmonary diseases may be prepared by formulating the
relevant purified conjugate of the invention in injectable
compositions according to procedures well known to the man skilled
in the art in such a way that each vial comprises conjugate in an
amount comprising 50, 100, 200, 300, 400 or 500 micrograms of,
e.g., rhuIFNG or IFNG-N25K.
Identification of Surface Exposed Amino Acid Residues
Structures
[0210] Experimental 3D structures of huIFNG determined by X-ray
crystallography have been reported by: Ealick et. al. Science
252:698-702 (1991) reporting on the C-alpha trace of an IFNG
homodimer. Walter et al. Nature 376:230-235 (1995) reporting on the
structure of an IFNG homodimer in complex with two molecules of a
soluble form of the IFNG receptor. The coordinates of this
structure have never been made publicly available. Thiel et. al.
Structure 8:927-936 (2000) reporting on the structure of an IFNG
homodimer in complex with two molecules of a soluble form of the
IFNG receptor having a third molecule of the receptor in the
structure not making interactions with the IFNG homodimer.
Methods
Accessible Surface Area (ASA)
[0211] The computer program Access (B. Lee and F. M. Richards, J.
Mol. Biol. 55: 379-400 (1971)) version 2 (Copyright (c) 1983 Yale
University) was used to compute the accessible surface area (ASA)
of the individual atoms in the structure. This method typically
uses a probe-size of 1.4 .ANG. and defines the Accessible Surface
Area (ASA) as the area formed by the centre of the probe. Prior to
this calculation all water molecules, hydrogen atoms and other
atoms not directly related to the protein are removed from the
coordinate set.
Fractional ASA of Side Chain
[0212] The fractional ASA of the side chain atoms is computed by
division of the sum of the ASA of the atoms in the side chain with
a value representing the ASA of the side chain atoms of that
residue type in an extended ALA-x-ALA tripeptide. See Hubbard,
Campbell & Thornton (1991) J. Mol. Biol.: 220, 507-530. For
this example the CA atom is regarded as a part of the side chain of
Glycine residues but not for the remaining residues. The following
table are used as standard 100% ASA for the side chain:
TABLE-US-00003 Ala 69.23 .ANG..sup.2 Arg 200.35 .ANG..sup.2 Asn
106.25 .ANG..sup.2 Asp 102.06 .ANG..sup.2 Cys 96.69 .ANG..sup.2 Gln
140.58 .ANG..sup.2 Glu 134.61 .ANG..sup.2 Gly 32.28 .ANG..sup.2 His
147.00 .ANG..sup.2 Ile 137.91 .ANG..sup.2 Leu 140.76 .ANG..sup.2
Lys 162.50 .ANG..sup.2 Met 156.08 .ANG..sup.2 Phe 163.90
.ANG..sup.2 Pro 119.65 .ANG..sup.2 Ser 78.16 .ANG..sup.2 Thr 101.67
.ANG..sup.2 Trp 210.89 .ANG..sup.2 Tyr 176.61 .ANG..sup.2 Val
114.14 .ANG..sup.2
Residues not detected in the structure are defined as having 100%
exposure as they are thought to reside in flexible regions.
Determining Distances Between Atoms:
[0213] The distance between atoms was determined using molecular
graphics software e.g. InsightII v. 98.0, MSI INC.
Determination of Receptor Binding Site:
[0214] The receptor-binding site is defined as comprising of all
residues having their accessible surface area changed upon receptor
binding. This is determined by at least two ASA calculations; one
on the isolated ligand(s) in the ligand(s)/receptor(s) complex and
one on the complete ligand(s)/receptor(s) complex.
Results
[0215] The X-ray structure used was of an IFNG homo-dimer in
complex with two molecules of a soluble form of the IFNG receptor
having a third molecule of the IFNG receptor in the structure not
making interactions with the IFNG homodimer reported by Thiel et.
al. Structure 8:927-936 (2000). The structure consists of the IFNG
homodimer wherein the two molecules are labeled A and B. For
construction purposes there is an additional methionine placed
before the IFNG sequence labeled M0 and the sequence is
C-terminally truncated with ten residues (Q133 being the last
residue in the constructed molecules). The M0 is removed from the
structure in all the calculations of this example. The structure of
the two IFNG monomers has very weak electron density after residue
120 and residues were only modeled until residue T126. Therefore,
residues S121-T126 were removed from the structure prior to the
calculations in this example. The two receptor fragments labeled C
and D make direct interactions with the IFNG homodimer and a third
receptor molecule labeled E makes no contact with the IFNG
homodimer and are not included in these calculations.
Surface Exposure:
[0216] Performing fractional ASA calculations on the homodimer of
molecules A and B excluding M0 and S121-T126 in both molecules
resulted in the following residues having more than 25% of their
side chain exposed to the surface in at least one of the monomers:
.quadrature.1, D2, P3, K6, E9, N10, K12, K13, Y14, N16, G18, H19,
S20, D21, A23, D24, N25, G26, T27, G31, K34, N35, K37, E38, E39,
S40, K55, K58, N59, K61, D62, D63, Q64, S65, Q67, K68, E71, T72,
K74, E75, N78, V79, K80, N83, S84, N85, K86, K87, D90, E93, K94,
N97, S99, T101, D102, L103, N104, H111, Q115, A118 and E119.
[0217] The following residues had more than 50% of their side chain
exposed to the surface in at least one of the monomers: Q1, D2, P3,
K6, E9, N10, K13, N16, G18, H19, S20, D21, A23, D24, N25, G26, T27,
G31, K34, K37, E38, E39, K55, K58, N59, D62, Q64, S65, K68, E71,
E75, N83, S84, K86, K87, K94, N97, S99, T101, D102, L103, N104,
Q115, A118, E119.
[0218] Performing fractional ASA calculations on the homodimer of
molecules A and B excluding M0 and S121-T126 in both molecules and
including the receptor molecules C and D resulted in the following
residues had more than 25% of their side chain exposed to the
surface in at least one of the monomers: Q1, D2, P3, K6, E9, N10,
K13, Y14, N16, G18, H19, D21, N25, G26, G31, K34, N35, K37, E38,
E39, S40, K55, K58, N59, K61, D62, D63, Q64, S65, Q67, K68, E71,
T72, K74, E75, N78, V79, K80, N83, S84, N85, K86, K87, D90, E93,
K94, N97, S99, T101, D102, L103, N104, E119. The following residues
had more than 50% of their side chain exposed to the surface in at
least one of the monomers: P3, K6, N10, K13, N16, D21, N25, G26,
G31, K34, K37, E38, E39, K55, K58, N59, D62, Q64, S65, K68, E71,
E75, N83, S84, K86, K87, K94, N97, S99, T101, D102, L103 and
N104.
[0219] All of the above positions are targets for modification in
accordance with the present invention.
[0220] Comparing the two lists results in K12, S20, A23, D24, T27,
H111, Q 15 and A118 being removed from the more than 25% side chain
ASA list upon receptor binding, and Q1, D2, E9, G18, H19, S20, A23,
D24, T27, Q115, A118 and E119 being removed from the more than 50%
side chain ASA list upon receptor binding.
[0221] Residues not determined in the structure are treated as
fully surface exposed, i.e. residues S121, P122, A123, A124, K125,
T126, G127, K128, R129, K130, R131, S132, Q133, M134, L135, F136,
R137, G138, R139, R140, A141, S142, Q143. These residues also
constitute separate targets for introduction of attachment groups
in accordance with the present invention (or may be viewed as
belonging to the group of surface exposed amino acid residues, e.g.
having more than 25% or more than 50% exposed side chains).
Receptor Binding Site:
[0222] Performing ASA calculations as described above results in
the following residues of the IFNG molecule having reduced ASA in
at least one of the monomers in the complex as compared to the
calculation on the isolated dimer: Q1, D2, Y4, V5, E9, K12, G18,
H19, S20, D21, V22, A23, D24, N25, G26, T27, L30, K34, K37, K108,
H111, E112, I114, Q115, A118, E119.
EXAMPLES
Example 1
Design of an Expression Cassette for Expression of IFNG in Yeast
and CHO Cells
[0223] The DNA sequence, GenBank accession number X13274,
encompassing a full length cDNA encoding mature huIFNG without its
native signal peptide, was modified in order to facilitate high
expression in yeast cells. First, a MATa signal peptide was
introduced instead of the IFNG signalpeptide in order to facilitate
secretion into yeast media. Secondly, the codons of the huIFNG
nucleotide sequence were modified by making a bias in the codon
usage towards the codons frequently used in yeast. Subsequently,
certain nucleotides in the sequence were substituted with others in
order to introduce recognition sites for DNA restriction
endonucleases. Primers were designed such that the gene could be
synthesised The primers were assembled to the synthetic gene by one
step PCR using Platinum Pfx-polymerase kit (Life Technologies) and
standard three step PCR cycling parameters. The assembled gene was
amplified by PCR using the same conditions and has the sequence
shown in SEQ ID NO 3.
[0224] The synthesised gene was cloned into pJSO37-lip Okkels, J.
S. (1996) Rec. DNA Biotech. III., vol 782, 202-207) between the
HindIII site at the 5' end and the XbaI at the 3', resulting in
pIGY-1.
[0225] In order to make a single-chain construct containing
covalently linked monomeric IFNG polypeptides, the following three
constructs were made:
[0226] I) A construct containing two mature full-length huIFNG
polypeptides, linked through a 19mer linker peptide modelled after
the human IgA1 hinge regions (Lunn C A et al., J. Biol. Chem., 267,
17920-17924, 1992). This was done by PCR, using the following
primers
TABLE-US-00004 ADJ002 (SEQ ID NO 4) 5'-GGTTTGATATCGATGGCCAA-3'
ADJ003 (SEQ ID NO 5) 5'-GCGGCCCTCTAGATTACT-3' ADJ004 (SEQ ID NO 6)
5'-CATCTCCGTCCACTCCGACTCCATAGCATGCAAGATCCATATGTGAA AGAA-3' ADJ007
(SEQ ID NO 7) 5'ATCTTGCATGCTATGGAGTCGGAGTGGACGGAGATGGAGTTGGCGGAG
TAGAAGGAACCGCTGTTTTAGCAGCTGGAGACAATT-3'
[0227] The PCR fragments were cloned in pIGY-1 between ClaI at the
5 end and XbaI at the 3' end assembling the two monomers in SphI
(introduced in the linker region). This construct was called
pIGY-2.
[0228] II) A construct containing two monomeric mature full-length
huIFNG polypeptides without linker. For this, the following primers
were used for PCR.
TABLE-US-00005 ADJ002 (SEQ ID NO 8) 5'-GGTTTGATATCGATGGCCAA-3'
ADJ003 (SEQ ID NO 9) 5'-GCGGCCCTCTAGATTACT-3' ADJ006 (SEQ ID NO 10)
5'-TTTAGAGGTAGAAGAGCTTCTCAGCAAGATCCATATGTGAAAGAAG CT-3' ADJ009 (SEQ
ID NO 11) 5'-AGCTTCTTTCACATATGGATCTTGCTGAGAAGCTCTTCTACGTCTAA
A-3'
[0229] The PCR fragment was assembled by two-step PCR and cloned
between ClaI, at the 5' end, and XbaI at the 3' end in pIGY-1 and
named pIGY-3
[0230] III) A construct containing two C-terminally truncated (the
last 11 amino acids) monomeric IFNG polypeptides covalently linked
through the 19-mer peptide linker mentioned above. The following
primers were used:
TABLE-US-00006 ADJ001 (SEQ ID NO 12)
5'-TGCTCTAGACATCTGAGATCGTTTTCTCTTTCC-3' ADJ002 (SEQ ID NO 13)
5'-GGTTTGATATCGATGGCCAA-3' ADJ004 (SEQ ID NO 14)
5'-CATCTCCGTCCACTCCGACTCCATAGCATGCAAGATCCATATGTGAA AGAA-3' ADJ005
(SEQ ID NO 15) 5'ATCTTGCATGCTATGGAGTCGGAGTGGACGGAGATGGAGTTGGCGGAG
TAGAAGGAACCGGCATCTGAGATCTTTTTCTCC-3'
[0231] The PCR fragments were cloned in pIGY-1 between ClaI at the
5' end and XbaI at the 3' end assembling the two monomers in SphI
(introduced in the linker region). This construct was called
pIGY-4
Constructs for Expression in CHO-Cell
[0232] To express IFNG in CHO cells, the following oligonucleotide
is synthesized to enable cloning of IFNG including it's signal
peptide, into pcDNA3.1/hygro (Invitrogen).
TABLE-US-00007 ADJ012 (SEQ ID NO 16)
5'-CGCGGATCCATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTG
CATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAAGATCCATATGTGAAAG AAGCT-3'
[0233] To clone IFNG in this expression vector, PCR amplification
using ADJ012 and ADJ003 and pIGY-1 as template produces a 450 bp
fragment that can be cloned in between BamHI at the 5' end and XbaI
at the 3' end of pcDNA3.1/hygro, giving rise to pIGY-5.
[0234] To introduce glycosylation sites in IFNG, oligonucleotides
were designed in such a way that PCR generated changes could be
introduced in the expression plasmid (pIGY-5) by classical two-step
PCR followed by cloning the PCR fragment between BamHI at the 5'
end and XbaI at the 3' end.
[0235] Therefore, two vector primers were designed to be used with
specific mutation primers:
TABLE-US-00008 ADJ013 5'-GATGGCTGGCAACTAGAAG-3' (SEQ ID NO 17)
(antisense downstream vector primer) ADJ014
5'-TGTACGGTGGGAGGTCTAT-3' (SEQ ID NO 18) (sense upstream vector
primer)
[0236] For the different muteins the following primers were
designed.
TABLE-US-00009 K12T. ADJ015 (SEQ ID NO 19)
5'-AGCATTAAAATACTTCGTCAAGTTTTCAGC-3' ADJ016 (SEQ ID NO 20)
5'-GCTGAAAACTTGACGAAGTATTTTAATGCT-3' G18T ADJ017 (SEQ ID NO 21)
5'-CACATCAGAATGAGTAGCATTAAAATA-3' ADJ018 (SEQ ID NO 22)
5'-TATTTTAATGCTACTCATTCTGATGTG-3' E38N ADJ019 (SEQ ID NO 23)
5'-CATAATTTTTCGATCGGATTCGTTTTTCCAATTCTT-3' ADJ020 (SEQ ID NO 24)
5'AAGAATTGGAAAAACGAATCCGATCGAAAAATTATG-3' K61T ADJ021 (SEQ ID NO
25) 5'-AATAGACTGATCGTCTGTAAAGTTTTTAAA-3' ADJ022 (SEQ ID NO 26)
5'-TTTAAAAACTTTACAGACGATCAGTCTATT-3' N85T ADJ023 (SEQ ID NO 27)
5'-TCTTTTCTTTTTAGTACTATTGAAAAACTT-3' ADJ024 (SEQ ID NO 28)
5'-AAGTTTTTCAATAGTACTAAAAAGAAAAGA-3' K94N ADJ025 (SEQ ID NO 29)
5'-ATAATTAGTCAAATTTTCGAAGTCATG-3' ADJ026 (SEQ ID NO 30)
5'-GATGACTTCGAAAATTTGACTAATTAT-3' S99N ADJ027 (SEQ ID NO 31)
5'-AATCAAGTCAGTAACGTTATAATTAGTCAA-3' ADJ028 (SEQ ID NO 32)
5'-TTGACTAATTATAACGTTACTGACTTGAAT-3' Q106T ADJ029 (SEQ ID NO 33)
5'-ATGAATAGCTTTACTAGTCACATTCAAGTC-3' ADJ030 (SEQ ID NO 34)
5'-GACTTGAATGTGACTAGTAAAGCTATTCAT-3'
[0237] After two step PCR and digestion with BamHI and XbaI each of
these primer pairs are expected to result in a 447 bp fragment that
can be cloned in pIGY-5.
Expression of Interferon .gamma. in CHO Cells
[0238] The above-mentioned construct are going to be transfected
into the CHO K1 cell line (ATCC#CCL-61) by use of Lipofectamine
2000 (Life Technologies, USA) as transfection agent. 24 hours later
the culture medium is going to be harvested and assayed for
interferon .gamma. activity and concentration.
Sequence CWU 1
1
341166PRTHomo sapiens 1Met Lys Tyr Thr Ser Tyr Ile Leu Ala Phe Gln
Leu Cys Ile Val Leu 1 5 10 15Gly Ser Leu Gly Cys Tyr Cys Gln Asp
Pro Tyr Val Lys Glu Ala Glu 20 25 30Asn Leu Lys Lys Tyr Phe Asn Ala
Gly His Ser Asp Val Ala Asp Asn 35 40 45Gly Thr Leu Phe Leu Gly Ile
Leu Lys Asn Trp Lys Glu Glu Ser Asp 50 55 60Arg Lys Ile Met Gln Ser
Gln Ile Val Ser Phe Tyr Phe Lys Leu Phe 65 70 75 80Lys Asn Phe Lys
Asp Asp Gln Ser Ile Gln Lys Ser Val Glu Thr Ile 85 90 95Lys Glu Asp
Met Asn Val Lys Phe Phe Asn Ser Asn Lys Lys Lys Arg 100 105 110Asp
Asp Phe Glu Lys Leu Thr Asn Tyr Ser Val Thr Asp Leu Asn Val 115 120
125Gln Arg Lys Ala Ile His Glu Leu Ile Gln Val Met Ala Glu Leu Ser
130 135 140Pro Ala Ala Lys Thr Gly Lys Arg Lys Arg Ser Gln Met Leu
Phe Arg145 150 155 160Gly Arg Arg Ala Ser Gln 1652143PRTHomo
sapiens 2Gln Asp Pro Tyr Val Lys Glu Ala Glu Asn Leu Lys Lys Tyr
Phe Asn 1 5 10 15Ala Gly His Ser Asp Val Ala Asp Asn Gly Thr Leu
Phe Leu Gly Ile 20 25 30Leu Lys Asn Trp Lys Glu Glu Ser Asp Arg Lys
Ile Met Gln Ser Gln 35 40 45Ile Val Ser Phe Tyr Phe Lys Leu Phe Lys
Asn Phe Lys Asp Asp Gln 50 55 60Ser Ile Gln Lys Ser Val Glu Thr Ile
Lys Glu Asp Met Asn Val Lys 65 70 75 80Phe Phe Asn Ser Asn Lys Lys
Lys Arg Asp Asp Phe Glu Lys Leu Thr 85 90 95Asn Tyr Ser Val Thr Asp
Leu Asn Val Gln Arg Lys Ala Ile His Glu 100 105 110Leu Ile Gln Val
Met Ala Glu Leu Ser Pro Ala Ala Lys Thr Gly Lys 115 120 125Arg Lys
Arg Ser Gln Met Leu Phe Arg Gly Arg Arg Ala Ser Gln 130 135
1403375DNAArtificial SequenceDescription of Artificial Sequence
Expression cassette for expression of interferon gamma in yeast and
CHO cells 3tctgatgtgg ctgataatgg aactttgttc ttaggcattt tgaagaattg
gaaagaagaa 60tctgatagaa aaattatgca gtctcaaatt gtgtcttttt acttcaaatt
gtttaaaaac 120tttaaagatg atcagtctat tcaaaagtct gtggaaacta
ttaaggaaga tatgaatgtg 180aagtttttca attctaacaa aaagaaaaga
gatgacttcg aaaagttgac taattattct 240gtgactgact tgaatgtgca
aagaaaagct attcatgaat tgatccaagt gatggctgaa 300ttgtctccag
ctgctaaaac aggaaagaga aaaagatctc agatgttgtt tagaggtaga
360agagcttctc agtaa 375420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer 4ggtttgatat cgatggccaa
20518DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 5gcggccctct agattact 18651DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
6catctccgtc cactccgact ccatagcatg caagatccat atgtgaaaga a
51784DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 7atcttgcatg ctatggagtc ggagtggacg gagatggagt
tggcggagta gaaggaaccg 60ctgttttagc agctggagac aatt
84820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 8ggtttgatat cgatggccaa 20918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
9gcggccctct agattact 181048DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer 10tttagaggta gaagagcttc
tcagcaagat ccatatgtga aagaagct 481148DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
11agcttctttc acatatggat cttgctgaga agctcttcta cgtctaaa
481233DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 12tgctctagac atctgagatc gttttctctt tcc
331320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 13ggtttgatat cgatggccaa 201451DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
14catctccgtc cactccgact ccatagcatg caagatccat atgtgaaaga a
511581DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 15atcttgcatg ctatggagtc ggagtggacg gagatggagt
tggcggagta gaaggaaccg 60gcatctgaga tctttttctc c
8116102DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 16cgcggatcca tgaaatatac aagttatatc ttggcttttc
agctctgcat cgttttgggt 60tctcttggct gttactgcca agatccatat gtgaaagaag
ct 1021719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 17gatggctggc aactagaag 191819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic PCR primer
18tgtacggtgg gaggtctat 191930DNAArtificial SequenceDescription of
Artificial Sequence Synthetic PCR primer 19agcattaaaa tacttcgtca
agttttcagc 302030DNAArtificial SequenceDescription of Artificial
Sequence Synthetic PCR primer 20gctgaaaact tgacgaagta ttttaatgct
302127DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 21cacatcagaa tgagtagcat taaaata
272227DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 22tattttaatg ctactcattc tgatgtg
272336DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 23cataattttt cgatcggatt cgtttttcca attctt
362436DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 24aagaattgga aaaacgaatc cgatcgaaaa attatg
362530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 25aatagactga tcgtctgtaa agtttttaaa
302630DNAArtificial SequenceDescription of Artificial Sequence
Snythetic PCR primer 26tttaaaaact ttacagacga tcagtctatt
302730DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 27tcttttcttt ttagtactat tgaaaaactt
302830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 28aagtttttca atagtactaa aaagaaaaga
302927DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 29ataattagtc aaattttcga agtcatg
273027DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 30gatgacttcg aaaatttgac taattat
273130DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 31aatcaagtca gtaacgttat aattagtcaa
303230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 32ttgactaatt ataacgttac tgacttgaat
303330DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 33atgaatagct ttactagtca cattcaagtc
303430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic PCR primer 34gacttgaatg tgactagtaa agctattcat 30
* * * * *