U.S. patent application number 11/449167 was filed with the patent office on 2008-07-10 for culturing human cells and tissues in an n-glycolylneuraminic acid-free environment.
This patent application is currently assigned to The Regents of the University of California. Invention is credited to Anna Maria Hedlund, Dzung Nguyen, Ajit Varki.
Application Number | 20080166805 11/449167 |
Document ID | / |
Family ID | 37499122 |
Filed Date | 2008-07-10 |
United States Patent
Application |
20080166805 |
Kind Code |
A1 |
Varki; Ajit ; et
al. |
July 10, 2008 |
Culturing human cells and tissues in an N-glycolylneuraminic
acid-free environment
Abstract
This application is in the field of sialic acid chemistry,
metabolism, antigenicity, and the production of transgenic
non-human mammals with altered sialic acid production. More
particularly, this application relates to N-glycolylneuraminic acid
(Neu5Gc) being an immunogen in humans, and the production of
Neu5Gc-free mammalian products for laboratory and human use.
Inventors: |
Varki; Ajit; (La Jolla,
CA) ; Hedlund; Anna Maria; (San Diego, CA) ;
Nguyen; Dzung; (San Diego, CA) |
Correspondence
Address: |
BUCHANAN, INGERSOLL & ROONEY LLP
P.O. BOX 1404
ALEXANDRIA
VA
22313-1404
US
|
Assignee: |
The Regents of the University of
California
Oakland
CA
|
Family ID: |
37499122 |
Appl. No.: |
11/449167 |
Filed: |
June 8, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60688867 |
Jun 8, 2005 |
|
|
|
Current U.S.
Class: |
435/372 ;
435/366 |
Current CPC
Class: |
A01K 2227/105 20130101;
A01K 67/0275 20130101; A01K 2267/03 20130101; C12N 2800/30
20130101; A01K 2267/01 20130101; C12Y 114/18002 20130101; C12N
5/0018 20130101; A01K 2217/075 20130101; A01K 67/0276 20130101;
A61K 8/983 20130101; C12N 9/0071 20130101; A01K 2267/02 20130101;
C12N 15/8509 20130101 |
Class at
Publication: |
435/372 ;
435/366 |
International
Class: |
C12N 5/06 20060101
C12N005/06 |
Goverment Interests
GOVERNMENT INTERESTS
[0002] This invention was made with government support from the
National Institutes of Health under grant number R01-CA38701.
Claims
1. A method for preparing a culture of human cells devoid of
N-glycolylneuraminic acid (Neu5Gc) comprising the steps of:
preselecting the human cells to be cultured; placing the human
cells in a culture medium comprising serum selected from the group
consisting of: animal-free serum replacement, mammalian-free serum,
human serum, heat-inactivated human serum, and Neu5Gc deficient
animal serum; and allowing the human cells to grow in the culture
medium to a desired density.
2. The method of claim 1, wherein the human cells are selected from
the group consisting of human embryonic stem cells, embryoid
bodies, carcinoma cells and differentiated progenitor cells.
3. The method of claim 1, wherein the cultured cells after growing
to a desired density comprise less than 1% Neu5Gc by weight when
compared to total sialic acids.
4. The method of claim 1, wherein the culture medium comprises
animal free serum replacement.
5. The method of claim 1, wherein the culture medium comprises
human serum.
6. The method of claim 1, wherein the cells are not grown on a
non-human feeder layer.
7. The method of claim 1, wherein the cells are human embryonic
stem cells, and wherein the medium comprises human serum as the
only serum source, and wherein the human embryonic stem cells are
cultured on a human cell feeder layer, and wherein the human
embryonic stem cells have never before been exposed to animal
products.
8. The method of claim 1, wherein the cells are embryoid bodies,
and wherein the medium comprises human serum as the only serum
source.
9. The method of claim 1, wherein the cells and the medium after
the cells have grown to the desired density contain low levels of
anti-Neu5Gc antibodies.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of priority to
Provisional Application U.S. Ser. No. 60/688,867, which was filed
on Jun. 8, 2005.
TECHNICAL FIELD
[0003] This application is in the field of sialic acid chemistry,
metabolism, antigenicity, and the production of transgenic
non-human mammals with altered sialic acid production. More
particularly, this application relates to N-glycolylneuraminic acid
(Neu5Gc) being an immunogen in humans, and the production of
Neu5Gc-free mammalian products for laboratory and human use.
BACKGROUND OF THE INVENTION
[0004] All cells are covered with a dense and complex array of
sugar chains. Sialic acids (Sias) are a family of nine-carbon
sugars that are typically present at the outermost units of these
chains. By virtue of their terminal position, sialic acids act as
binding sites for many exogenous and endogenous receptors such as
the Influenza viruses and the Siglic family of endogenous proteins.
Such sugars are thus useful drug targets for the prevention and
treatment of infection. They are also involved in various
biological and pathological processes such as neuronal plasticity
and cancer metastasis. In many of these instances, the precise
structures of the sialic acid and the residues it is attached to
play critical roles. Thus, studying sialic acid functions is of
great biological importance. In addition, sialic acids can be taken
up from certain dietary sources (red meat and dairy products), and
may also be associated with certain disease states, such as cancer
and heart disease.
[0005] Cytidine monophosphate-N-acetylneuraminic acid hydroxylase
(CMAH) converts the sialic acid N-acetylneuraminic acid (Neu5Ac) to
N-glycolylneuraminic acid (Neu5Gc.) In non-human mammals, Neu5Gc is
recognized by a number of endogenous binding proteins, as well as
by pathogenic organisms such as bacteria and viruses. Humans are
unable to produce endogenous Neu5Gc because of an evolutionary
inactivating mutation in their CMAH gene. Specifically, this
mutation involves a frame-shifting exon deletion of 92 base pairs
in the 5' region that gives rise to a truncated protein that lacks
the amino acid residues that are necessary for enzymatic activity
(Schlenzka, W., et al., FEBS Lett. (1996) 385: 197-200.) This
mutation occurred sometime after the divergence of humans from
their last common ancestor, so humans are the only known animals
missing a functional CMAH gene (Chou, H-H, et al., Proc. Nat. Acad.
Sci. (2002), 99(18): 11736-11741.) Although the cause for this
mutation is unknown, it may have been caused by negative selection
of individuals that were CMAH+, because of the recognition of
Neu5Gc by pathogens.
[0006] Neu5Gc is known to be immunogenic in humans (Noguchi A., et
al., J. Biochem. Tokyo (1995), 117(1): 59-62.) Such immunogenicity
is believed to play a role in the immune response observed in
humans that come into contact with mammalian products, such as
cosmetics, food, mammalian cells and cell products, as well as
therapeutic agents derived from non-human mammals or exposed to
non-human mammalian products. Attempts have been undertaken to try
to diminish the Neu5Gc content of recombinantly produced human
glycoproteins in cell lines by altering the cell lines using RNAi
to suppress expression of the CMAH gene (Chenu S., et al., Biochim.
Biophys. Acta. (2003), 1622(2): 133-144.)
[0007] However, there remains a need to produce biological products
for human use that lack Neu5Gc, such as the production of human
cells or tissues in the absence of Neu5Gc medium, and by using
transgenic non-human mammals lacking a fully functional CMAH gene
to produce Neu5Gc products for human use.
SUMMARY OF THE INVENTION
[0008] This application is in the field of sialic acid chemistry,
metabolism antigenicity, and the production of transgenic non-human
mammals with altered sialic acid production. More particularly,
this application relates to the problem of N-glycolylneuraminic
acid (Neu5Gc) being an immunogen in humans, and the production of
Neu5Gc-free mammalian products for laboratory and human use.
[0009] In one aspect, the present invention relates to a method for
preparing a culture of human cells devoid of N-glycolylneuraminic
acid (Neu5Gc) comprising the steps of: preselecting the human cells
to be cultured; placing the human cells in a culture medium
comprising serum selected from the group consisting of: animal-free
serum replacement, mammalian-free serum, human serum,
heat-inactivated human serum; and allowing the human cells to grow
in the culture medium to a desired density.
[0010] Such cells can be selected from human embryonic stem cells,
embryoid bodies, carcinoma cells and differentiated progenitor
cells, as well as any other human cells that are easily cultured in
the laboratory. Usually, the cells when grown to the desired
density will contain 1% or less Neu5Gc when compared to the total
sialic acid content.
[0011] The culture medium, while containing all the normal
nutrients required for the growth of human cells in culture, will
also optionally contain animal free serum replacement, and/or human
serum. In addition, to avoid exposure to Neu5Gc antibodies, the
cells may be grown on a non-human feeder layer.
[0012] In one embodiment, the cells are human embryonic stem cells,
and the medium comprises human serum as the only serum source, and
the human embryonic stem cells are cultured on a human cell feeder
layer, wherein the human embryonic stem cells have never before
been exposed to animal products.
[0013] In another embodiment, the cells may form embryoid bodies,
and wherein the medium comprises human serum as the only serum
source.
[0014] Under the right growth conditions, it is desired that the
cells and the medium after the cells have grown to the desired
density contain low levels of anti-Neu5Gc antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 depicts the incorporation of free Neu5Gc in human
epithelial cells. Caco-2 cells were fed or not fed for 3 days with
Neu5Gc, ManNGc or Neu5Ac, each at 3 mM final concentration. The
cells were harvested and fractionated, and the Sia content of the
different fractions of cells was analyzed by
1,2-diamino-4,5-methylenedioxybenzene (DMB) derivatization and
liquid chromatography analysis. FIG. 1(A) depicts the DMB-high
pressure liquid chromatography (HPLC) profiles of Sia released from
membrane fractions. Peaks indicated by an asterisk (*) correspond
to Neu5Gc7Ac, Neu5,7Ac.sub.2, Neu5,8,9Ac.sub.3, Neu5Gc7,9Ac.sub.2,
and Neu5,7,9Ac.sub.3, from left to right. Mass spectrometry (MS)
and MS/MS data for the peaks corresponding to DMB-Neu5Gc and
DMB-Neu5Ac from the membrane bound Sia of ManNGc and Neu5Gc-fed
Caco-2 cells were also obtained (not shown.) FIG. 1 (B) depicts the
proportion of Neu5Gc (expressed as percent of total Sia) in the
different fractions of Caco-2 cells. TH=total homogenate; HMW=high
molecular weigh fraction; and LMW=cytosolic low molecular weight
fraction.
[0016] FIG. 2 depicts free Neu5Gc taken up and incorporated into
other types of human cells. Human fibroblast and neuroblastoma
cells were fed or not fed for 3 days with 3 mM Neu5Gc or Neu5Ac,
and the cells were then harvested and fractionated, and the Sia
content in the different fractions of cells was analyzed by DMB
derivatization followed by HPLC. The proportion of Neu5Gc
(expressed as percent of total Sia) of the different fractions from
(A) human fibroblasts or (B) human neuroblastomas is shown.
TH=total homogenate; HMW=high molecular weight fraction; and
LMW=cytosolic low molecular weight fraction.
[0017] FIG. 3 depicts that the uptake of free Neu5Gc is not
specific for human cells. Human and chimpanzee EBV-transformed
lymphoblasts were fed or not fed for 3 days with 3 mM Neu5Gc or
Neu5Ac, and the cells were then harvested and fractionated, and the
Sia content in the different fractions of cells was analyzed by DMB
derivatization followed by HPLC. The proportion of Neu5Gc
(expressed as percent of total Sia) of the different fractions from
(A) human fibroblasts and (B) chimpanzee lymphoblasts is shown.
TH=total homogenate; HMW=high molecular weight fraction; and
LMW=cytosolic low molecular weight fraction.
[0018] FIG. 4 depicts that free Neu5Ac can compete with free Neu5Gc
for incorporation into cells. Caco-2 cells grown in human serum
were fed or not fed for 3 days with 3 mM Neu5Gc with or without
addition in the media of Neu5Ac at 3 mM or 15 mM final
concentration. The cells were then harvested and fractionated. The
Sia content in the different fractions of cells was analyzed by DMB
derivatization followed by HPLC. The proportion of Neu5Gc
(expressed as percent of total Sia) of (A) the total homogenate
fraction and (B) the membrane fraction is shown.
[0019] FIG. 5 depicts the uptake of free. Neu5Gc by cells occurs
via endocytic processes. Caco-2 cells grown in human serum were fed
or not fed for 3 days with 3 mM Neu5Gc in the presence or absence
of various inhibitors of endocytic pathways. The cells were then
harvested and fractionated, and the Sia content in the different
fractions of cells was analyzed by DMB derivatization followed by
HPLC. The proportion of Neu5Gc (expressed as percent of total Sia)
of (A) the total homogenate fraction and (B) the membrane fraction
is shown.
[0020] FIG. 6 depicts that the lysosomal sialic acid transporter is
involved in the metabolic incorporation of free Neu5Gc. Wild-type
(WT) and lysosomal sialic acid transporter mutant human fibroblasts
(GM08496 and GM05520) grown in human serum were fed or not fed for
3 days with 3 mM Neu5Gc, ManNGc or Neu5Ac. The cells were then
harvested and fractionated, and the Sia content in the different
fractions of cells was analyze by DMB derivatization followed by
HPLC. The proportion of Neu5Gc (expressed as percent of total Sia)
in the membrane fraction is shown.
[0021] FIG. 7 depicts that both the lysosomal sialidase and the
sialic acid transporter are required for metabolic incorporation of
glycosidically-bound Neu5Gc from serum glycoconjugates. Wild type
(WT) fibroblasts, lysosomal sialidase mutant fibroblasts (GM01718)
and Sia transporter mutant fibroblasts (GM05520) were incubated
with 10% fetal calf serum (FCS) plus 20% horse serum (which are
both rich sources of glycosidically-bound Neu5Gc) for 3 days. Cells
were then released from the flasks, fixed and analyzed for binding
of a chicken anti-Neu5Gc antibody using a fluorescent labeled
anti-chicken antibody, with and without permeabilization by flow
cytometry. Neu5Gc-specific MFI is the median fluorescence intensity
(MFI) of the labeled anti-chicken antibody staining with the
background MFI subtracted out. At least 5000 cells were counted for
each staining. FIG. 7(A) depicts the Neu5Gc-specific MFI observed
in all three different cell types. FIG. 7(B) depicts the percent
surface Neu5Gc that was calculated by dividing the
non-permeabilized Neu5Gc-specific MFI by the permeabilized
Neu5Gc-specific MFI.
[0022] FIG. 8 depicts proposed pathways for the uptake and
incorporation of Neu5Gc in human cells as published in Bardor, M.,
et al., J. Biol. Chem. (2005), 280(6): 4228-4237.) The proposed
model is based on the data presented in this study and upon prior
literature. The open diamond represents a Neu5Gc molecule; the
shaded oval represents glypropteins; the open bullet represents the
sialic acid transporter; and the double zigzags represent ceramide.
The thickness of the arrows also suggests the relative importance
of various pathways in delivering Neu5Gc into the cell.
ST=sialyltransferase and TGN=trans-golgi network.
[0023] FIG. 9 depicts the detection of Neu5Gc on human embryonic
stem cells (HESC) cultured under conventional conditions. Enhanced
green fluorescent protein (EGFP) transfected HESCs were grown on a
murine feeder layer in a medium contaning 20% KNOCKOUT.TM.
(Neu5Gc-rich) serum replacement (Invitrogen Inc., Carlsbad, Calif.,
and described in WO 98/30679.) a. HESCs were released with 2 mM
EDTA and studies were conducted by flow cytometry using a primary
affinity-purified polyclonal chicken antibody specific for Neu5Gc,
followed by a secondary fluorescent labeled anti-chicken IgY
antibody. The gray shaded plot represents the secondary antibody
only; the thick line represents both primary and secondary
antibody; and the thin line represents cells incubated with the
primary antibody in the presence of 1% chimpanzee serum that
contains Neu5Gc. b. HESCs were isolated by fluorescent-activated
cell sorting (FACS) using the intrinsic EGFP fluorescence. Embryoid
bodies (EBs) were derived by removing the feeder layer and growing
the HESCs in reduced serum medium for 5 days. Both types of cells
(HESCs and EBs) were fractionated into membrane and cytosolic
components. Sias were released and analyzed by DMB derivatization
and HPLC. A peak corresponding to Neu5Gc is seen in all
fractions.
[0024] FIG. 10 depicts that HESCs stably expressing EGFP can remain
undifferentiated when Neu5Gc-deficient normal human serum (NHS) is
substituted for animal-derived culture medium components.
[0025] FIG. 11 depicts the effect of growth in normal human serum
(NHS) or animal-derived culture medium (Regular) on Neu5Gc content
of HESCs and embryoid bodies (EBs).
[0026] FIG. 12 depicts the binding of "natural" antibodies from
sera of normal human donors to HESCs. HESCs were grown in regular
medium or in NHS for 5 days. The cells were released with 2 mM EDTA
and then exposed to serum from a human with a high level of
anti-Neu5Gc antibodies (thick line) or from another individual with
a low level of such antibodies (thin line) for 55 min., then
stained with a secondary goat anti-human IgG conjugated to Alexa
594 dye (Molecular Probes, Eugene, Oreg.), and studied by flow
cytometry, with gating on the EGFP-positive HESCs. The gray shaded
plot shows the result with the secondary antibody alone.
Immunoglobulin deposition was markedly reduced when cells were
first grown in NHS-containing medium for 5 days (although
non-specific background levels were increased.) The somewhat higher
background seen when HESCs were grown in NHS-containing medium
could be due to a non-specific IgG absorption, but it had no major
consequences, such as complement deposition.
[0027] FIG. 13 depicts binding of complement C3b from human sera to
EGFP+HESCs. HESCs were grown in regular medium or in NHS-containing
medium for 5 days and harvested with 2 mM EDTA. The cells were then
exposed to a normal human serum from an individual with a high
level of anti-Neu5Gc antibodies for 15 min. at 37.degree. C., and
also to the serum from an individual with a low level of
anti-Neu5Gc antibodies. Deposited C3b was detected using a goat
anti-human C3b, then stained with a goat anti-human C3b conjugated
to Alexa 594 and studied by flow cytometry. a. Control cells that
where not exposed to any human sera showed very little (1%)
positive staining for C3b. b. After exposure to the high level of
anti-Neu5Gc antibodies serum, the double fluorescence plot shows
that 37% of the EGFP+HESCs grown in regular medium showed positive
staining for human C3b. c. In contrast, only 13% of the EGFP+HESCs
exposed to the low level of anti-Neu5Gc antibodies serum were
positive for C3b.
[0028] FIG. 14 depicts the targeting construct for inactivation of
the CMAH enzyme in the mouse and final targeted Cmah allele. A 10
kb genomic DNA region spanning the Cmah gene that includes the 92
base pairs corresponding to exon 6 of the murine Cmah was used to
generate the targeting construct pFlox-Ex-SL for elimination of
CMAH enzyme activity by disabling this 92 base pair region that
encodes the active site of the CMAH enzyme.
[0029] FIG. 15 depicts that CMAH null mice (Cmah -/-) are deficient
in Neu5Gc expression in their tissues, milk and plasma.
Immunohistochemistry of numerous CMAH null tissues using a chicken
anti-Neu5Gc and a secondary horseradish peroxidase (HRP) conjugated
anti-chicken antibody showed no appreciable staining (data not
shown.) Sialic acids were released by 2M acetic acid and
derivatized with DM) and analyzed by DMB-HPL). As shown, Neu5Gc was
only found in tissues from wild type mice. The absence of Neu5Gc
was confirmed using mass spectrometry (data not shown.)
[0030] FIG. 16 depicts a comparison of the deduced amino-acid
sequence of the A. rubens CMP-Neu5Ac hydroxylase with several
mammalian sequences. The sequences were aligned with CLUSTLAW and
subsequently shaded with GENEDOC. Residues identical in at least
five of the six sequences are shaded grey, while homologous
residues present in at least five of the six sequences are printed
white on dark grey. The hamster sequence is incomplete at the N-
and C-termini. Box 1 indicates the binding site of the Rieske
iron-sulfur center. Included in Box 1 are the critical Cys, His,
Cys and His residues at positions 63 and 65 (at the beginning of
Box 1) and positions 84 and 87 at the end of Box 1. These are the
liganding residues of the Rieske [2Fe2S]-cluster. Boxes 2 and 5 are
the postulated binding sites of a mononuclear iron center. Box 3 is
the postulated CMP-Neu5Ac binding site. Box 4 is the postulated
site of interaction with cytochrome b5. Underlined amino acids
indicate the postulated transmembrane domain of the A. rubens
hydroxylase. The GenBank accession numbers of the sequences
depicted are: mouse, D21826; hamster, AJ242835; pig, Y15010;
chimpanzee, AF074481; and macque, AB013814. (Martensen, I., et al.,
Eur. J. Biochem. (2001) 268(19):5157-5166.)
[0031] FIG. 17 depicts the amino acid sequence of the human CMAH
enzyme (UniProtKB/Swiss-Prot accession number Q9Y471. As shown,
boxes 2 to 5 that align with the sequences shown in FIG. 16 are
identified. Also, as expected, the approximately 92 amino acids
that include the Box 1 Rieske iron-sulfur center are missing.
(Chou, H.-H., et al., Proc. Natl. Acad. Sci. USA (2002)
99:11736-11741.) Note that the same region is highly conserved in
all other species (see above.)
DETAILED DESCRIPTION OF THE INVENTION
[0032] This application is in the field of sialic acid chemistry,
metabolism, antigenicity, and the production of transgenic
non-human mammals with altered sialic acid production. More
particularly, this application relates to N-glycolylneuraminic acid
(Neu5Gc) being an immunogen in humans, and the production of
Neu5Gc-free mammalian products for laboratory and human use.
[0033] The three related problems that are addressed by the present
invention are: 1) there is a need for Neu5Gc-free animal cell
lines, which can be used to produce Neu5Gc biotherapeutic products;
2) there is a need for the production of human cells and tissues
for human use, as well as the maintenance of human organs for
transplation, under Neu5Gc-free conditions; and 3) there is a need
for the production of transgenic Neu5Gc null mammals from which
non-human animal products can be derived for human use.
Sialic Acid Chemistry and Metabolism
[0034] Sialic acid (Sia) is a generic name for a family of acidic
nine carbon sugars typically found as the outermost units of glycan
chains on the vertebrate cellular glycocalyx and on secreted
glycoproteins. Their location and widespread occurrence on all
vertebrate cells allow them to be involved in processes such as
ligand-receptor interactions, cell-cell recognition, cell-pathogen
binding, inflammatory processes, immune responses and tumor
metastases.
[0035] There are more than 50 kinds of Sias known in nature. Most
are derived via biosynthetic modification of a Sia called
N-acetylneuraminic acid (Neu5Ac). The addition of a single oxygen
atom to the N-acetyl group of Neu5Ac gives rise to a very common
variation called N-glycolylneuraminic acid (Neu5Gc). The surfaces
of most primate cell types studied to date are dominated by these
two major Sias.
[0036] Neu5Gc is perhaps the most widely expressed sialic acid in
non-human mammalian cells. While humans are genetically deficient
in producing Neu5Gc, small amounts are present in human cells. A
dietary origin was suggested by human volunteer studies, and by
observing that free Neu5Gc is metabolically incorporated into
cultured human cells by unknown mechanisms. Research has shown that
the incorporation of Neu5Gc may predominantly originate from
dietary sources (Tangvoranuntakul, P. et al. Proc. Natl. Acad. Sci.
(USA) (2003) 100:12045-12050.)
[0037] Red meat from sources such as beef, pork and lamb are
particularly rich in Neu5Gc and are likely the primary sources of
Neu5Gc in the human diet. Also, dairy products contain Neu5Gc,
although at somewhat lower levels than in red meat.
[0038] In order for a Sia molecule to get attached to
glycoconjugates, it must first be activated by conversion to the
sugar nucleotide derivative, cytidine-monophosphate-Sia (CMP-Sia).
Thus, Sias are converted to CMP-Sias in the nucleus, which then
return to the cytosol in order to be transported into the Golgi
apparatus, where they serve as high-energy donors for attaching
Sias to newly synthesized glycoconjugates on their way to the cell
surface. The biosynthetic transformation of Neu5Ac to Neu5Gc occurs
at this sugar nucleotide level, wherein the CMP-Neu5Ac hydroxylase
(CMAH) catalyzes the transfer of an oxygen atom to CMP-Neu5Ac,
generating CMP-Neu5Gc. CMP-Neu5Gc can then be transported into the
Golgi apparatus and used, in the same manner as CMP-Neu5Ac, to add
Neu5Gc to newly synthesized glycoconjugates. Indeed, these two
nucleotide sugars appear to be used interchangeably by the Golgi
CMP-Sia transporter and by the mammalian sialyltransferases, which
transfer Sia residues to cell surface and secreted glycoconjugates.
Neu5Ac or Neu5Gc molecules that are released from glycoconjugates
during lysosomal degradation processes can also be exported back
into the cytosolic compartment by a specific transporter. There,
they are both available as substrates for conversion to their
respective CMP-Sia forms. Again, there appears to be no major
difference in their conversion by CMP-Sia synthases. In this
manner, Neu5Gc can be "recycled" for repeated use in Golgi
sialation reactions.
[0039] It has been demonstrated that free Neu5Gc uptake occurs in a
variety of mammalian cells and tissues, such as secretory cells,
cancer cells, and blood vessels. Inhibitors of certain non-clathrin
mediated (i.e. receptor independent) endocytic pathways reduce
Neu5Gc accumulation. Studies with human mutant cells show that the
lysosomal sialic acid transporter is required for metabolic
incorporation of free Neu5Gc. Incorporation of glycosidically-bound
Neu5Gc from exogenous glycoconjugates (relevant to human gut
epithelial exposure to dietary Neu5Gc) requires the transporter, as
well as the lysosomal sialidase, which presumably acts to release
free Neu5Gc. Thus, exogenous Neu5Gc reaches lysosomes via
pinocytic/endocytic pathways, and is exported in free form into the
cytosol, becoming available for activation and transfer to
glycoconjugates. In contrast, N-glycolylmannosamine (ManNGc)
apparently traverses the plasma membrane by passive diffusion and
becomes available for conversion to Neu5Gc in the cytosol. This
mechanism can also explain the metabolic incorporation of
chemically synthesized unnatural sialic acids.
Sialic Acid Genetics and Immunogenicity
[0040] Most normal healthy humans have a certain amount of
circulating anti-Neu5Gc antibodies, likely because of the fact that
most humans ingest food sources derived from non-human mammals
containing high levels of Neu5Gc. Thus, xenogenic (i.e., non-human)
culture methodologies may compromise implantation/transplantation
success, due to uptake and expression of Neu5Gc on the surface of
any tissue developed from human cells exposed to Neu5Gc-containing
products. This problem might also affect recombinant soluble
biotherapeutic products.
[0041] Although Neu5Gc is a major Sia in most mammalian cells, it
was long thought to be absent from healthy human tissues (Traving,
C., et al. (1998) Cell. Mol. Life. Sci. 54: 1330-1349.) Indeed,
humans are genetically unable to synthesize Neu5Gc, due to an exon
deletion/frame shift mutation in the human CMAH gene (Varki, A.
(2002) Yearb. Phys. Anthropol. 44:54-69; Chou, H. H., et al. (1998)
Proc. Ntl. Acad. Sci. USA 95:11751-11756; and Irie, A., et al.
(1998) J. Biol. Chem. 273: 15866-15871.). It has been estimated
that this mutation occurred in the hominid lineage--2.5 to 3
million years ago (Chou, H. H. et al. (2002) Proc. Natl. Acad. Sci.
USA 99:11736-11741.) One dramatic consequence of this
human-specific genetic defect appears to have been the sudden
unmasking of the CD33-related Siglecs during human evolution, since
the ancestral condition of these molecules was to recognize Neu5Gc
(Sonnengurg, J. L., et al. (2004) Glycobiology 14:339-346.)
[0042] Despite the absence of any known alternative pathway for the
synthesis of Neu5Gc in humans, various groups have used antibodies
to study the expression of Neu5Gc in human tumors, particularly in
various carcinomas (Hirabayashy, Y. et al. (1987) Jpn. J. Cancer
Res. 78:251-260; Miyoshi, I. et al. (1986) Mol. Immunol.
23:631-638; Marquina, G. et al. (1996) Cancer Res. 56:5165-5171;
Carr, A. et al. (2000) Hybridoma 19:241-247; Devine, P. L., et al.
(1991) Cancer Res. 51:5826-5836; Kawachi S. et al. (1988) Int.
Arch. Allergy Appl. Immunol. 85:381-383; and Higashi, H. et al.
(1998) Jpn. J. Cancer Res. 79:952:956.) Recent studies have
reexplored these findings, confirming prior reports of Neu5Gc
expression in human cancers and extending the finding to normal
human tissues, including detecting small amounts of Neu5Gc in
epithelial and endothelial cells of normal humans. Definitive
confirmation resulted from releasing and purifying sialic acids
from such tissues utilizing a fluorescent derivatized form of
Neu5Gc by HPLC and mass spectrometry analysis (Tangvoranuntakal,
P., et al. (2003) Proc. Natl. Acad. Sci. USA 100:12045-12050.)
Moreover, it was shown that exogenously added free Neu5Gc is
incorporated into cultured human carcinoma cells in vitro. In
addition, oral ingestion studies of Neu5Gc in human volunteers were
carried out, providing evidence that the Neu5Gc found in human
tissues originates from dietary sources, particularly from red meat
and milk products.
[0043] Because of the immunogenicity of Neu5Gc in humans, the
production of animal products that lack Neu5Gc is, in some ways,
half the story. Such animal products if they are to be acceptable
for human use must also lack anti-Neu5Gc antibodies which would be
carried over to human hosts receiving such animal products.
Accordingly, it is desirable to limit the amount of anti-Neu5Gc
antibodies in such products. In one instance, it is desirable to
limit the amount of anti-Neu5Gc antibodies to within 10% (i.e., a
"low" level of antibodies) of the level found in control systems
that were prepared in the absence of a source of Neu5Gc. These
experiments are described in greater detail elsewhere herein.
Neu5Gc Null Mammals
[0044] The mammals that are used in the practice of the invention
are those animals generally regarded as useful for the production
of mammalian products for human use, such as cosmetics, food
stuffs, milk, mammalian cells and cell products, and therapeutic
substances. Such mammals include, for example, ovine such as lamb,
bovine such as beef cattle and milk cows, piscine and porcine, as
well as rodents, such as mice and rats.
[0045] In one embodiment, the invention is a method to produce
Neu5Gc-free transgenic mammals and products therefrom comprising
mutating the CMAH gene such that it produces CMAH with less or no
activity, and thereby reducing or eliminating Neu5Gc from the
biological material of the non-human mammals. As detailed in FIGS.
16 and 17, the sequences associated with activity (depicted in the
boxes) are well characterized and highly conserved. Accordingly,
the CMAH gene can easily be mutated, for example, by frame-shift
mutation or the cre-lox system for deletion mutation, in addition
to "knock-in" methods which would eliminate activity, particularly
if located in box 1. The biological material derived from such
mammals can be virtually any non-human organic material which would
otherwise contain Neu5Gc, such as a food stuffs (for example, red
meat or a dairy product) or a mammalian derived clinical sample
used in human therapy, such as implanted cells or recombinantly
produced therapeutic proteins. The clinical sample may be from any
non-human mammalian source, such as ovine, bovine, piscine and
porcine. Non-human clinical samples can be from any body fluid or
tissue, such as serum, muscle tissue and milk, etc. The Neu5Gc-free
mammals may be used to produce products for any use by humans, such
as cultured human cells produced in laboratories, and
cosmetics.
[0046] The same methodology used to knock out CMAH in mice is
easily adapted for disruption of CMAH gene expression in
domesticated animals, because of the high level of homology between
CMAH genes in all mammals. For mice, a frameshift mutation, similar
to the one found in the human CMAH, was introduced using the
cre-lox recombination system. While normal wild-type mice express
equal levels of Neu5Gc and Neu5Ac in their muscle tissue, and
approximately 5% Neu5Gc in their milk, the transgenic mice exhibit
no evidence of Neu5Gc expression in tissues or milk Since the mice
are otherwise viable and fertile (as are humans), we can predict
that other CMAH null animals will also be the same.
[0047] The use of Neu5Gc-free products is useful in several
commercial settings. First, since consumption of Neu5Gc may pose a
significant risk to human health, meat from Neu5Gc-free animals
provides a safer alternative source of red meat. Second, as
described in greater detail below, Neu5Gc-free serum can replace
normal animal serum, which is currently used to culture human cells
in laboratories. Third, the use of Neu5Gc-free bovine products in
cosmetics reduces the risk of immune responses against such
products.
Culturing Human Cells in Neu5Gc-Free Medium
[0048] Considering that most humans also have antibodies to Neu5Gc,
incorporation of Neu5Gc is hypothesized to be one of the factors
contributing to the health risks associated with high consumption
of red meat (such as heart disease and certain types of cancers).
In addition, the presence of Neu5Gc in human cells that are
cultured in animal products for use in human therapeutic agents is
also a potential source of allergenicity. More particularly, when
human cells are cultured in serum from animals, they can take up
and incorporate Neu5Gc, potentially resulting in immunological
rejection if such cells are used for therapy (e.g., transplantation
of human embryonic stem cell-derived grafts.) It has now been
demonstrated that targeted disruption of the CMAH gene in mice
completely abolished the expression of Neu5Gc in all tissues as
well as in their secretions. Similar disruption of the CMAH gene in
domesticated livestock (cows, pigs, goats, etc.) may provide a
source of Neu5Gc-free animal products, which are commonly used as
research materials (e.g., serum and cell extracts), as well as in
cosmetics.
[0049] As described above, by targeting one single gene, CMAH,
Neu5Gc can be eliminated from all mammalian tissues and secretions,
including serum, muscle tissue and milk. Since Neu5Gc is
immunogenic to humans, eliminating CMAH from domesticated animals
would provide a source of non-immunogenic Neu5Gc-free products for
human cell culture, tissue culture, and even organ preservation.
For example, a CMAH null cow will not uptake and incorporate Neu5Gc
from ingested meat, milk etc. Accordingly, this invention provides
a way of preparing transgenic animals whose serum and other
products can be used to produce cell cultures and tissues that will
reduce the risk of developing potentially autoreactive antibodies
after implantation of such cells and tissues into humans. The
absence of Neu5Gc in mammalian serum products used for human cell
tissue culture would also provide more human-like growth
conditions.
[0050] HESCs can potentially generate every body cell type, making
them excellent candidates for cell and tissue replacement
therapies. HESCs are typically cultured with animal-derived "serum
replacements" on murine feeder layers. Both of these are sources of
the non-human sialic acid Neu5Gc, against which many humans have
circulating antibodies. Both HESC and derived embryoid bodies
metabolically incorporate significant amounts of Neu5Gc under
standard conditions. Exposure to human sera with anti-Neu5Gc
antibodies results in binding of immunoglobulin and deposition of
complement, which leads to cell killing in vivo. Levels of Neu5Gc
on HESCs and embryoid bodies dropped after culture in
heat-inactivated anti-Neu5Gc-antibody-negative human serum,
reducing binding of antibodies and complement from high titer sera,
while allowing maintenance of the undifferentiated state. Absent
the availability of Neu5Gc-free mammalian products, complete
elimination of Neu5Gc would likely require using human serum with
human feeder layers, ideally starting with fresh HESCs that have
never been exposed to animal products.
[0051] The pluripotent abilities of HESCs have potential for
treating many diseases by transplantation of HESC-derived tissues.
While safety is a major issue regarding infection or
tuinorigenicity, the possibility of rejection is also of concern.
Current culture methods useing animal products also carry the risk
of infection by non-human pathogens. HESC lines are traditionally
cultured on mitotically-inactivated mouse embryonic fibroblasts
(so-called "feeder layers"), and in a media containing fetal calf
serum. To avoid animal serum, certain proprietary serum
replacements are sometimes used. However, these also contain animal
products. When HESCs are removed from the feeder layer and grown in
suspension, they differentiate into aggregates called embryoid
bodies (EB). EBs are formed by precursors of several cell lineages
and can be induced to differentiate into many cell types. Although
the feeder layer is no longer necessary, EBs must still be
maintained in "serum replacement" medium, which likewise may
contain Neu5Gc positive animal products.
[0052] Production of Transgenic Non-Human Animals.
[0053] The production of transgenic non-human animals is now a
common method used in the laboratory to alter the metabolism of
various animals for use as models of particular disease states. For
instance, there are insulin free mice, immunologically deficient
animals of many species and the like. Accordingly, such methods are
commonly practice by those of skill in the art and could easily be
adapted to the teachings herein to produce any animal models
without undue experimentation. This is especially true since the
critical sequences of the HESC gene associated with its active site
are well characterized and highly conserved.
[0054] In one embodiment, the present invention provides knockout
non-human mammals lacking a functional CMAH. "Knock-out" refers to
partial or complete suppression of the expression of a protein
encoded by an endogenous DNA sequence in a cell. The "knock-out"
can be affected by targeted deletion of the whole or part of a gene
encoding a protein in an embryonic stem cell. As a result, the
deletion may prevent or reduce the expression of the protein in any
cell in the whole animal in which it is normally expressed. For
example, a "CMAH knock-out animal" refers to an animal in which the
expression CMAH has been reduced or suppressed by the introduction
of a recombinant nucleic acid molecule that lacks at least a
portion of the genomic DNA sequence encoding CMAH.
[0055] "Transgenic animal" refers to an animal to which exogenous
DNA has been introduced while the animal is still in its embryonic
stage. In most cases, the transgenic approach aims at specific
modifications of the genome, e.g., by introducing whole
transcriptional units into the genome, or by up- or down-regulating
preexisting cellular genes. The targeted character of certain of
these procedures sets transgenic technologies apart from
experimental methods in which random mutations are conferred to the
germline, such as administration of chemical mutagens or treatment
with ionizing solution.
[0056] The term "knockout mammal" and the like, refers to a
transgenic mammal wherein a given gene has been suppressed by
recombination with a targeting vector. It is to be emphasized that
the term is intended to include all progeny generations. Thus, the
founder animal and all F1, F2, F3, and so on, progeny thereof are
included.
[0057] The term "chimera," "mosaic," "chimeric mammal" and the
like, refers to a transgenic mammal with a knockout in some of its
genome-containing cells.
[0058] The term "heterozygote," "heterozygotic mammal" and the
like, refers to a transgenic mammal with a disruption on one of a
chromosome pair in all of its genomecontaining cells.
[0059] The term "homozygote," "homozygotic mammal" and the like,
refers to a transgenic mammal with a disruption on both members of
a chromosome pair in all of its genome-containing cells.
[0060] A "non-human mammal" of the invention includes mammals such
as rodents, primates, sheeps, dogs (ovine such as lamb, bovine such
as beef cattle and milk cows, piscine and porcine.)
[0061] Although the invention uses a typical non-human rodent
animal (e.g., rats and mice), other mammals can similarly be
genetically modified using the methods and compositions of the
invention.
[0062] A "mutation" is a detectable change in the genetic material
in the animal, which is transmitted to the animal's progeny. A
mutation is usually a change in one or more deoxyribonucleotides,
the modification being obtained by, for example, adding, deleting,
inverting, or substituting nucleotides.
[0063] Typically, the genome of the transgenic non-human animal
comprises one or more deletions in one or more exons of the genes
as depicted in the boxes in FIG. 16.
[0064] In principle, knockout animals may have one or both copies
of the gene sequence of interest disrupted. In the latter case, in
which a homozygous disruption is present, the mutation is termed a
"null" mutation. In the case where only one copy of the nucleic
acid sequence of interest is disrupted, the knockout animal is
termed a "heterozygous knockout animal". The knockout animals of
the invention are typically homozygous for the disruption of both
CMAH genes being targeted.
[0065] It is important to note that it is not necessary to disrupt
a gene to generate a transgenic organism lacking functional
expression. The invention includes the use of antisense molecules
that are transformed into a cell, such that production of an OAT
polypeptide is inhibited. Such an antisense molecule is
incorporated into a germ cell as described more fully herein
operably linked to a promoter such that the antisense construct is
expressed in all cells of a transgenic organism.
[0066] Techniques for obtaining the transgenic animals of the
invention are well known in the art. The techniques for introducing
foreign DNA sequences into the mammalian germ line were originally
developed in mice. One route of introducing foreign DNA into a germ
line entails the direct microinjection of linear DNA molecules into
a pronucleus of a fertilized one-cell egg. Microinjected eggs are
subsequently transferred into the oviducts of pseudopregnant foster
mothers and allowed to develop. About 25% of the progeny mice
inherit one or more copies of the micro-injected DNA. Currently,
the most frequently used techniques for generating chimeric and
transgenic animals are based on genetically altered embryonic stem
cells or embryonic germ cells. Techniques suitable for obtaining
transgenic animals have been amply described. A suitable technique
for obtaining completely ES cell derived transgenic non-human
animals is described in WO 98/06834.
[0067] Knockout animals of the invention can be obtained by
standard gene targeting methods as described above, typically by
using ES cells. Thus, the invention relates to a method for
producing a knockout non-human mammal comprising (i) providing an
embryonic stem (ES) cell from the relevant animal species
comprising an intact CMAH gene; (ii) providing a targeting vector
capable of disrupting the intact CMAH gene; (iii) introducing the
targeting vector into the ES cells under conditions where the
intact CMAH undergoes homologous recombination with the targeting
vector to produce a mutant CMAH gene; (iv) introducing the ES cells
carrying a disrupted CMAH gene into a blastocyst; (v) implanting
the blastocyst into the uterus, of pseudopregnant female; (vi)
delivering animals from said females, identifying a mutant animal
that carries the mutant allele and (vii) selecting for knockout
animals and breeding them.
[0068] A "targeting vector" is a vector comprising sequences that
can be inserted into the gene to be disrupted, e.g., by homologous
recombination. The targeting vector generally has a 5' flanking
region and a 3' flanking region homologous to segments of the gene
of interest, surrounding a foreign DNA sequence to be inserted into
the gene. For example, the foreign DNA sequence may encode a
selectable marker, such as an antibiotics resistance gene. Examples
for suitable selectable markers are the neomycin resistance gene
(NEO) and the hygromycin P-phosphotransferase gene. The 5' flanking
region and the 3' flanking region are homologous to regions within
the gene surrounding the portion of the gene to be replaced with
the unrelated DNA sequence. DNA comprising the targeting vector and
the native gene of interest are contacted under conditions that
favor homologous recombination. For example, the targeting vector
and native gene sequence of interest can be used to transform
embryonic stem (ES) cells, in which they can subsequently undergo
homologous recombination.
[0069] Thus, a targeting vector refers to a nucleic acid that can
be used to decrease or suppress expression of a protein encoded by
endogenous DNA sequences in a cell. In a simple example, the
knockout construct is comprised of a CMAH polynucleotide with a
deletion in a critical portion of the polynucleotide (e.g., the 5'
terminus of the CMAH gene) so that a functional CMAH cannot be
expressed therefrom. Alternatively, a number of termination codons
can be added to the native polynucleotide to cause early
termination of the protein or an intron junction can be
inactivated. In a typical knockout construct, some portion of the
polynucleotide is replaced with a selectable marker (such as the
neo gene) so that the polynucleotide can be represented as follows:
CMAH 5'/neo/CMAH 3', where CMAH 5' and CMAH 3', refer to genomic or
cDNA sequences which are, respectively, upstream and downstream
relative to a portion of the CMAH polynucleotide and where neo
refers to a neomycin resistance gene.
[0070] Proper homologous recombination can be confirmed by Southern
blot analysis of restriction endonuclease digested DNA using, as a
probe, a non-disrupted region of the gene. Since the native gene
will exhibit a restriction pattern different from that of the
disrupted gene, the presence of a disrupted gene can be determined
from the size of the restriction fragments that hybridize to the
probe.
[0071] In an animal obtained by the methods above, the extent of
the contribution of the ES cells that contain the disrupted CMAH
gene to the somatic tissues of the transgenic animal can be
determined visually by choosing animal strains for the source of
the ES cells and blastocyst that have different coat colors.
[0072] The transgenic animals can contain a transgene, such as
reporter gene, under the control of a CMAH promoter or fragment
thereof. Methods for obtaining transgenic and knockout non-human
animals are known in the art. Knock out mice are generated by
homologous integration of a "targeting vector" construct into a
mouse embryonic stem cell chromosome which encodes a gene to be
knocked out. In one embodiment, gene targeting, which is a method
of using homologous recombination to modify an animal's genome, can
be used to introduce changes into cultured embryonic stem cells. By
targeting a CMAH gene of interest in ES cells, these changes can be
introduced into the germlines of animals to generate chimeras. The
gene targeting procedure is accomplished by introducing into tissue
culture cells a DNA targeting vector that includes a segment
homologous to a target CMAH locus, and which also includes an
intended sequence modification to the CMAH genomic sequence (e.g.,
insertion, deletion, point mutation.) The treated cells are then
screened for accurate targeting to identify and isolate those which
have been properly targeted.
[0073] Generally, the embryonic stem cells (ES cells) used to
produce the knockout animals will be of the same species as the
knockout animal to be generated. Thus for example, mouse embryonic
stem cells will usually be used for generation of knockout
mice.
[0074] Embryonic stem cells are generated and maintained using
methods well known to the skilled artisan such as those described
by Doetschman et al. (1985), J. Embryol. Exp. Mol. Biol. 87:27-45.
Any line of ES cells can be used, however, the line chosen is
typically selected for the ability of the cells to integrate into
and become part of the germ line of a developing embryo so as to
create germ line transmission of the knockout construct. Thus, any
ES cell line that is believed to have this capability is suitable
for use herein. One mouse strain that is typically used for
production of ES cells, is the 129J strain. Another ES cell line is
murine cell line D3 (American Type Culture Collection, catalog no.
CKL 1934). Still another ES cell line is the WW6 cell line (Ioffe
et al. (1995) Proc. Nat. Acad. Sci. 92:7357-7361.) The cells are
cultured and prepared for knockout construct insertion using
methods well known to the skilled artisan, such as those set forth
in: Teratocarcinomas and Embryonic Stem Cells: A Practical
Approach, E. J. Robertson, ed. IRL Press, Washington, D.C. ([1987];
Bradley et al. (1986) Current Topics in Devel. Biol. 20:357-371;
and Hogan et al., Manipulating the Mouse Embryo: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y. (1986).
[0075] A targeting vector construct refers to a uniquely configured
fragment of nucleic acid which is introduced into a stem cell line
and allowed to recombine with the genome at the chromosomal locus
of the gene of interest to be mutated. Thus, a given knock out
construct is specific for a given gene to be targeted for
disruption. Nonetheless, many common elements exist among these
constructs and these elements are well known in the art. A typical
targeting vector contains nucleic acid fragments of not less than
about 0.5 kb nor more than about 10.0 kb from both the 5' and the
3' ends of the genomic locus which encodes the gene to be mutated.
These two fragments are separated by an intervening fragment of
nucleic acid which encodes a positive selectable marker, such as
the neomycin resistance gene (neo). The resulting nucleic acid
fragment, consisting of a nucleic acid from the extreme 5' end of
the genomic locus linked to a nucleic acid encoding a positive
selectable marker which is in turn linked to a nucleic acid from
the extreme 3' end of the genomic locus of interest, omits most of
the coding sequence for CMAH or other gene of interest to be
knocked out. When the resulting construct recombines homologously
with the chromosome at this locus, it results in the loss of the
omitted coding sequence, otherwise known as the structural gene,
from the genomic locus. A stem cell in which such a homologous
recombination event has taken place can be selected for by virtue
of the stable integration into the genome of the nucleic acid of
the gene encoding the positive selectable marker and subsequent
selection for cells expressing this marker gene in the presence of
an appropriate drug (neomycin in this example).
[0076] Variations on this basic technique also exist and are well
known in the art. For example, a "knock-in" construct refers to the
same basic arrangement of a nucleic acid encoding a 5' genomic
locus fragment linked to nucleic acid encoding a positive
selectable marker which in turn is linked to a nucleic acid
encoding a 3' genomic locus fragment, but which differs in that
none of the coding sequence is omitted and thus the 5' and the 3'
genomic fragments used were initially contiguous before being
disrupted by the introduction of the nucleic acid encoding the
positive selectable marker gene. This "knock-in" type of construct
is thus very useful for the construction of mutant transgenic
animals when only a limited region of the genomic locus of the gene
to be mutated, such as a single exon, is available for cloning and
genetic manipulation. Alternatively, the "knock-in" construct can
be used to specifically eliminate a single functional domain of the
targeted gene, resulting in a transgenic animal which expresses a
polypeptide of the targeted gene which is defective in one
function, while retaining the unction of other domains of the
encoded polypeptide. This type of "knock-in" mutant frequently has
the characteristic of a so-called "dominant negative" mutant
because, especially in the case of proteins which homomultimerize,
it can specifically block the action of (or "poison") the
polypeptide product of the wild-type gene from which it was
derived. In a variation of the knock-in technique, a marker gene is
integrated at the genomic locus of interest such that expression of
the marker gene comes under the control of the transcriptional
regulatory elements of the targeted gene. One skilled in the art
will be familiar with useful markers and the means for detecting
their presence in a given cell.
[0077] As mentioned above, the homologous recombination of the
above described "knock out" and "knock in" constructs is sometimes
rare and such a construct can insert nonhomologously into a random
region of the genome where it has no effect on the gene which has
been targeted for deletion, and where it can potentially recombine
so as to disrupt another gene which was otherwise not intended to
be altered. Such non-homologous recombination events can be
selected against by modifying the above-mentioned targeting vectors
so that they are flanked by negative selectable markers at either
end (particularly through the use of two allelic variants of the
thymidine kinase gene, the polypeptide product of which can be
selected against in expressing cell lines in an appropriate tissue
culture medium well known in the art, i.e. one containing a drug
such as 5-bromodeoxyuridine.) Non-homologous recombination between
the resulting targeting vector comprising the negative selectable
marker and the genome will usually result in the stable integration
of one or both of these negative selectable marker genes and hence
cells which have undergone nonhomologous recombination can be
selected against by growth in the appropriate selective media (e.g.
media containing a drug such as 5-bromodeoxyuridine for example.)
Simultaneous selection for the positive selectable marker and
against the negative selectable marker will result in a vast
enriclunent for clones in which the knock out construct has
recombined homologously at the locus of the gene intended to be
mutated. The presence of the predicted chromosomal alteration at
the targeted gene locus in the resulting knock out stem cell line
can be confirmed by means of Southern blot analytical techniques
which are well known to those familiar in the art. Alternatively,
PCR can be used.
[0078] Each targeting vector to be inserted into the cell is
linearized. Linearization is accomplished by digesting the DNA with
a suitable restriction endonuelease selected to cut only within the
vector sequence and not the 5' or 3' homologous regions or the
selectable marker region.
[0079] For insertion, the targeting vector is added to the ES cells
under appropriate conditions for the insertion method chosen, as is
known to the skilled artisan. For example, if the ES cells are to
be electroporated, the ES cells and targeting vector are exposed to
an electric pulse using an electroporation machine and following
the manufacturer's guidelines for use. After electroporation, the
ES cells are typically allowed to recover under suitable incubation
conditions. The cells are then screened for the presence of the
targeting vector as explained herein. Where more than one construct
is to be introduced into the ES cell, each targeting vector can be
introduced simultaneously or one at a time.
[0080] After suitable ES cells containing the knockout construct in
the proper location have been identified by the selection
techniques outlined above, the cells can be inserted into an
embryo. Insertion may be accomplished in a variety of ways known to
the skilled artisan, however the typical method is by
microinjection. For microinjection, about 10-30 cells are collected
into a micropipet and injected into embryos that are at the proper
stage of development to permit integration of the foreign ES cell
containing the recombination construct into the developing embryo.
For instance, the transformed ES cells can be microinjected into
blastocytes. The suitable stage of development for the embryo used
for insertion of ES cells is very species dependent, however for
mice it is about 3.5 days. The embryos are obtained by perfusing
the uterus of pregnant females. Suitable methods for accomplishing
this are known to the skilled artisan.
[0081] While any embryo of the right stage of development is
suitable for use, typical embryos are male. In mice, the typical
embryos also have genes coding for a coat color that is different
from the coat color encoded by the ES cell genes. In this way, the
offspring can be screened easily for the presence of the knockout
construct by looking for mosaic coat color (indicating that the ES
cell was incorporated into the developing embryo.) Thus, for
example, if the ES cell line carries the genes for white fur, the
embryo selected will carry genes for black or brown fur.
[0082] After the ES cell has been introduced into the embryo, the
embryo may be implanted into the uterus of a pseudopregnant foster
mother for gestation. While any foster mother may be used, the
foster mother is typically selected for her ability to breed and
reproduce well, and for her ability to care for the young. Such
foster mothers are typically prepared by mating with vasectomized
males of the same species. The stage of the pseudopregnant foster
mother is important for successful implantation, and it is species
dependent. For mice, this stage is about 2-3 days
pseudopregnant.
[0083] Offspring that are born to the foster mother may be screened
initially for mosaic coat color where the coat color selection
strategy (as described above, and in the examples) has been
employed. In addition, or as an alternative, DNA from tail tissue
of the offspring may be screened for the presence of the knockout
construct using Southern blots and/or PCR as described above.
Offspring that appear to be mosaics may then be crossed to each
other, if they are believed to carry the knockout construct in
their germ line, in order to generate homozygous knockout animals.
Homozygotes may be identified by Southern blotting of equivalent
amounts of genomic DNA from mice that are the product of this
cross, as well as mice that are known heterozygotes and wild type
mice.
[0084] Other means of identifying and characterizing the knockout
offspring are available. For example, Northern blots can be used to
probe the mRNA for the presence or absence of transcripts encoding
either the gene knocked out, the marker gene, or both. In addition,
Western blots can be used to assess the level of expression of the
CMAH gene knocked out in various tissues of the offspring by
probing the Western blot with an antibody against the particular
CMAH protein, or an antibody against the marker gene product (i.e.,
the presence of Neu5GC using an antibody as identified in PCT
application no. PCT/US2004/022415.) Finally, in situ analysis (such
as fixing the cells and labeling with antibody) and/or FACS
(fluorescence activated cell sorting) analysis of various cells
from the offspring can be conducted using suitable antibodies to
look for the presence or absence of the knockout construct gene
product.
[0085] Yet other methods of making knock-out or disruption
transgenic animals are also generally known. See, for example,
Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1986). Recombinase dependent
knockouts can also be generated, e.g. by homologous recombination
to insert target sequences, such that tissue specific and/or
temporal control of inactivation of an OAT gene can be controlled
by recombinase sequences.
[0086] Animals containing more than one knockout construct and/or
more than one transgene expression construct are prepared in any of
several ways. A typical manner of preparation is to generate a
series of mammals, each containing one of the desired transgenic
phenotypes. Such animals are bred together through a series of
crosses, backcrosses and selections, to ultimately generate a
single animal containing all desired knockout constructs and/or
expression constructs, where the animal is otherwise congenic
(genetically identical) to the wild type except for the presence of
the knockout construct(s) and/or transgene(s).
[0087] In another aspect, a transgenic animal can be obtained by
introducing into a single stage embryo a targeting vector. The
zygote is the best target for micro-injection. In the mouse, the
male pronucleus reaches the size of approximately 20 micrometers in
diameter which allows reproducible injection of 1-2 pL of DNA
solution. The use of zygotes as a target for gene transfer has an
advantage in that in most cases the injected DNA will be
incorporated into the host gene before the first cleavage (Brinster
et al. (1985) Proc. Nat. Acad. Sci. 82:4438-4442.) As a
consequence, all cells of the transgenic animal will carry the
incorporated nucleic acids of the targeting vector. This will in
general also be reflected in the efficient transmission to
offspring of the founder since 50% of the germ cells will harbor
the transgene.
[0088] Normally, fertilized embryos are incubated in suitable media
until the pronuclei appear. At about this time, the nucleotide
sequence comprising the transgene is introduced into the female or
male pronucleus. In some species such as mice, the male pronucleus
is typically used. Typically the exogenous genetic material be
added to the male DNA complement of the zygote prior to its being
processed by the ovum nucleus or the zygote female pronucleus. It
is thought that the ovum nucleus or female pronucleus release
molecules which may affect the male DNA complement, perhaps by
replacing the protamines of the male DNA with histones, thereby
facilitating the combination of the female and male DNA complements
to form the diploid zygote.
[0089] Thus, the exogenous genetic material is typically added to
the male complement of DNA or any other complement of DNA prior to
its being affected by the female pronucleus. For example, the
exogenous genetic material is added to the early male pronucleus,
as soon as possible after the formation of the male pronucleus,
which is when the male and female pronuclei are well separated and
both are located close to the cell membrane. Alternatively, the
exogenous genetic material could be added to the nucleus of the
sperm after it has been induced to undergo decondensation. Sperm
containing the exogenous genetic material can then be added to the
ovum or the decondensed sperm could be added to the ovum with the
transgene constructs being added as soon as possible
thereafter.
[0090] Introduction of the a exogenous nucleic acid (e.g., a
targeting vector) into the embryo may be accomplished by any means
known in the art such as, for example, microinjection,
electroporation, or lipofection. Following introduction of the
exogenous nucleic acid into the embryo, the embryo may be incubated
in vitro for varying amounts of time, or reimplanted into the
surrogate host, or both. In vitro incubation to maturity is within
the scope of this invention. One common method in to incubate the
embryos in vitro for about 1-7 days, depending on the species, and
then reimplant them into the surrogate host.
[0091] For the purposes of this invention a zygote is essentially
the formation of a diploid cell which is capable of developing into
a complete organism. Generally, the zygote will be comprised of an
egg containing a nucleus formed, either naturally or artificially,
by the fusion of two haploid nuclei from a gamete or gametes. Thus,
the gamete nuclei must be ones which are naturally compatible,
i.e., ones which result in a viable zygote capable of undergoing
differentiation and developing into a functioning organism.
Generally, a euploid zygote is used. If an aneuploid zygote is
obtained, then the number of chromosomes should not vary by more
than one with respect to the euploid number of the organism from
which either gamete originated.
[0092] In addition to similar biological considerations, physical
ones also govern the amount (e.g., volume) of exogenous genetic
material which can be added to the nucleus of the zygote or to the
genetic material which forms a part of the zygote nucleus. If no
genetic material is removed, then the amount of exogenous genetic
material which can be added is limited by the amount which will be
absorbed without being physically disruptive. Generally, the volume
of exogenous genetic material inserted will not exceed about 10
picoliters. The physical effects of addition must not be so great
as to physically destroy the viability of the zygote. The
biological limit of the number and variety of DNA will vary
depending upon the particular zygote and functions of the exogenous
genetic material and will be readily apparent to one skilled in the
air, because the genetic material, including the exogenous genetic
material, of the resulting zygote must be biologically capable of
initiating and maintaining the differentiation and development of
the zygote into a functional organism.
[0093] The number of copies of a transgene (e.g., the exogenous
genetic material or targeting vector constructs) which are added to
the zygote is dependent upon the total amount of exogenous genetic
material added and will be the amount which enables the genetic
transformation to occur. Theoretically only one copy is required;
however, generally, numerous copies are utilized, for example,
1,000-20,000 copies of a targeting vector construct, in order to
insure that one copy is functional.
[0094] Reimplantation is accomplished using standard methods.
Usually, the surrogate host is anesthetized, and the embryos are
inserted into the oviduct. The number of embryos implanted into a
particular host will vary by species, but will usually be
comparable to the number of off spring the species naturally
produces.
[0095] Transgenic offspring of the surrogate host may be screened
for the presence and/or expression of an exogenous polynucleotide
(e.g, that of a targeting vector) by any suitable method as
described herein. Alternative or additional methods include
biochemical assays such as enzyme and/or immunological assays,
histological stains for particular marker or enzyme activities,
flow cytometric analysis, and the like.
[0096] Progeny of the transgenic animals may be obtained by mating
the transgenic animal with a suitable partner, or by in vitro
fertilization of eggs and/or sperm obtained from the transgenic
animal. Where mating with a partner is to be performed, the partner
may or may not be transgenic and/or a knockout; where it is
transgenic, it may contain the same or a different knockout, or
both. Alternatively, the partner may be a parental line. Where in
vitro fertilization is used, the fertilized embryo may be implanted
into a surrogate host or incubated in hitro, or both. Using either
method, the progeny may be evaluated using methods described above,
or other appropriate methods.
[0097] Retroviral infection can also be used to introduce a
targeting vector into a non-human animal. The developing non-human
embryo can be cultured in vitro to the blastocyst stage. During
this time, the blastomeres can be targets for retroviral infection
(Jaenich, R. (1976) Proc. Nat. Acad. Sci. 73:1260-1264.) Efficient
infection of the blastomeres is obtained by enzymatic treatment to
remove the zona pellucida (Manipulating the Mouse Embryo, Hogan
eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
1986.) The viral vector system used to introduce the targeting
vector is typically a replication-defective retrovirus carrying the
exogenous nucleic acid (Jahner et al. (1985) Proc. Nat. Acad. Sci.
82:6927-6931; Van der Putten et al. (1985) Proc. Nat. Acad. Sci.
82:6148-6152.) Transfection is easily and efficiently obtained by
culturing the blastomeres on a monolayer of virus-producing cells
(Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388).
Alternatively, infection can be performed at a later stage. Virus
or virus-producing cells can be injected into the blastocoele
(Jahner et al. (1982) Nature 298:623-628). Most of the founders
will be mosaic for the targeting vector (e.g., the exogenous
nucleic acids) since incorporation occurs only in a subset of the
cells which formed the transgenic non-human animal. Further, the
founder may contain various retroviral insertions of the transgene
at different positions in the genome which generally will segregate
in the offspring. In addition, it is also possible to introduce
transgenes into the germ line by intrauterine retroviral infection
of the midgestation embryo (Jahner et al. (1982), supra.)
[0098] The cre-lox system, an approach based on the ability of
transgenic mice, carrying the bacteriophage Cre gene, to promote
recombination between, for example, 34 bp repeats termed loxP
sites, allows ablation of a given gene in a tissue specific and a
developmentally regulated manner (Orban, et al. (1992) Proc. Nat.
Acad. Sci. 89:6861-6865.) LoxP sites can be placed flanking an exon
of any given gene. Thus, transgenic mice carrying the Cre gene
under the control of a selected promoter can be crossed with
transgenic mice carrying a transgene flanked by loxP sites to
generate doubly transgenic mice. The pioneering work in developing
this system was carried out by Orban et al. (1992) Proc. Nat. Acad.
Sci. 89:6861-6865. In one embodiment, the invention uses this
technology to target specific tissues in mice (e.g., expressing
CMAH), in a developmentally regulated fashion in order to produce a
mouse lacking Neu5Gc. This same method can easily be adapted for
other mammalian species.
[0099] Gene targeting producing gene knock-outs allows one to
assess in vivo function of a gene which has been altered and used
to replace a normal copy and to generate knockout animals with
utility as food. The modifications include insertion of mutant stop
codons, the deletion of DNA sequences, or the inclusion of
recombination elements (lox p sites) recognized by enzymes such as
Cre recombinase. The Cre-lox system as used in one embodiment of
the present invention allows for the ablation of a given gene or
the ablation of a certain portion of the gene sequence. The Cre-lox
system was used to generate CMAH knockout mice exhibiting reduced
Neu5GC.
[0100] In another aspect, the invention relates to the use of a
CMAH knockout animal, in particular an animal used for food stuff
to generate food, food products, pharmaceuticals, and biologics for
use.
[0101] In a further embodiment, the invention relates to cells and
tissues that carry mutations in CMAH. The cells can be primary
cells or established cell lines obtained from the transgenic
animals of the invention according to routine methods, i.e. by
isolating and disintegrating tissue.
[0102] Such cells and tissues derived from the animals of the
invention, in which the activity of CMAH has been reduced or
abolished, are useful in in vitro methods relating to the study of
sialic acid moieties, binding and diseases and disorders related
thereto.
[0103] Cells and cell lines derived from the knockout animals are
further useful in screening systems. The invention demonstrates
that knockout of CMAH results specific decreases of Neu5Gc. No
obvious morphological defects were noted in CMAH knockout mice.
Other Sources for Neu5Gc-Free Cells and Biological Medium.
[0104] In addition to producing Neu5Gc-free non-human mammalian
products utilizing transgenic techniques, many general cell culture
techniques can be used instead. As used herein, the term "devoid of
Neu5Gc" intends that the ratio of Neu5Gc to total sialic acids is
less than 5%, and even less than 1%. For example, the
immunogenicity of Neu5Gc can be exploited by utilizing anti-Neu5Gc
antibodies in an affinity column to remove any Neu5Gc present in
the products. Alternately, human cells of many varieties, tissues,
embryoid bodies, neural lineage cells, carcinoma cells, skin cells,
and organs (collectively referred to herein as "cells") can be
cultured and preserved in Neu5Gc-environments, so long as they are
free of Neu5Gc which can be incorporated therein and are relatively
free of anti-Neu5Gc antibodies, which would then be potentially
passed on to their human recipients. In another embodiment, serum
replacements are now available to culture cells and tissues that
lack animal products altogether. Human ortholgs and recombinant
proteins lacking Neu5Gc are also suitable for incorporation into
cell growth medium.
[0105] Besides HESCs, other cell types that are within the scope of
the present invention include, for example, islet cells,
endothelium, liver cells, kidney cells, cardiac cells, fibroblasts,
etc. Most notably, however, progenitor cells and pluripotent cells
that are not yet completely differentiated are of great use to
scientific studies as potential sources for therapeutic treatments
involving cellular implantation. In addition, the methods described
herein can be used to preserve human organs prior to transplation
under conditions that avoid passing on anti-Neu5Gc antibodies or
incorporation of additional Neu5Gc.
[0106] In most instances, cells are cultured on animal feeder
layers, most commonly mouse fibroblasts. However, for reasons
discussed elsewhere herein, these feeder layers only serve as
additional sources for undesirable Neu5Gc, which can then be
incorporated into the cells being cultured. Accordingly, in an
attempt to be overcautious, it may be necessary to completely
eliminate Neu5Gc by using human serum in the culture medium with
human feeder layers, ideally starting with fresh HESCs that have
never before been exposed to non-human mammals.
[0107] Both the lysosomal sialidase and the lysosomal sialic acid
transporter are required for incorporation of glycoprotein-bound
NeuGc into human cells. Inhibitors of such enzymes and transporter
systems are known. By incorporating these inhibitors, Neu5Gc uptake
in cell and tissue cultures, as well as organs being preserved for
transplantation can be eliminated.
EXAMPLES
Example I
Mechanism of Uptake and Incorporation of Neu5Gc into Human
Cells
Experimental Procedures
[0108] Materials--Neu5Gc and Neu5Ac were purchased from Inalco Spa
(Milano, Italy) and Pfanstiehl Laboratories, Inc. (Waukegan, Ill.)
1,2-diamino-4,5-methylene dioxybenzene (DMB), chlorpromazine,
gemstein, nystatin, amiloride, and saponin were purschased from
Sigma-Aldrich (St Louis, Mo.) Premium Human Serum type AB was
purchased from Irvine Scientific (Santa Ana, Calif.) Neu5Ac
aldolase was purchased from ICN (Costa Mesa, Calif.) All the
reagents used were HPLC grade.
[0109] Cell Lines--Caco-2 cells (human epithelial cells isolated
from a primary colon carcinoma), normal human skin fibroblasts
(CCD-919-SK) and chinese hamster ovary (CHO-K1) cells were
purchased from ATCC (Manassas, Va.) Mutant human skin fibroblasts
(GM05520, GM08496 and GM01718) were obtained from the Coriell
Institute for Medical Research (Camden, N.J.) Chimpanzee Fred and
human LB EBV-transformed lymphoblasts were a gift from Dr. Peter
Parham, Stanford University, CA.
[0110] Cell Culture--Caco-2 cells were propagated in alpha-MEM
containing GLUTAMAX.TM. (Invitrogen, San Diego, Calif.) and a
mixture of ribonucleosides and deoxyribonucleosides
(Gibco/Invitrogen, San Diego, Calif.) supplemented with 20% FCS.
All the fibroblast cell lines and CHO-K1 cells were cultured in the
same media supplemented respectively with 15% non-heat inactivated
FCS or 10% heat inactivated FCS. Chimpanzee Fred and human LB
EBV-transformed lymphoblasts were cultured in RPMI-1640
(Gibco/Invitrogen, San Diego, Calif.) supplemented with 10% heat
inactivated FCS or 15% human serum. All of the cultures were
maintained at 37.degree. C., 5% CO.sub.2 atmosphere. In order to
deplete any remaining Neu5Gc from FCS, the cells were split and
cultured prior to Neu5Gc feeding experiments for at least 4 days in
alpha-MEM supplemented with an adequate percentage of
heat-inactivated premium human serum instead of FCS. The cells were
then maintained under the same conditions during the whole feeding
experiment. The human serum was heat inactivated at 56.degree. C.
for 30 min. before use.
[0111] Preparation of ManNGc from Neu5Gc--ManNGc was prepared by
incubating 73 .mu.moles of Neu5Gc with 624 U Lactate dehydrogenase,
30 .mu.moles NADH and 10 U Neu5Ac Aldolase, EC 4.1.3.3, in 15 ml of
100 mM potassium phosphate buffer, pH 7.2. The incubation was
carried out at 37.degree. C. for 16 h. The ManNGc was separated
from any unreacted Neu5Gc by passing the product serially over
AG50WX-2 and AGIX-8 (Bio-Rad, Richmond, Calif.) ion-exchange
resins. The run-through and 5 column volumes of water washes were
collected and concentrated by freeze-drying. The reaction yield
(91-98%) was followed by the disappearance of Neu5Gc, using DMB
derivatization of the reaction mixture and analysis by HPLC (as
described elsewhere herein.)
[0112] Preparation and Purification of Sia from Bovine Submaxillary
Mucin--A mixture of standard Sias were prepared from bovine
submaxillary mucin. Total mucins were extracted from frozen
submaxillary glands using known methods. Sias then were released
with mild acid, collected by dialysis (1000 daltons
molecular-weight-cut-off) and purified on ion exchange columns
under conditions determined to minimize loss of O-acetylation.
[0113] Neu5Gc and ManNGc Feeding Experiment--Neu5Ac, Neu5Gc or
ManNGc were dried, dissolved in the appropriate media supplemented
with heat-inactivated human serum, sterilized using a Spin-X.RTM.
(Corning Inc., Corning, N.Y.) and then added to the cells. The pH
of the media containing Sia was adjusted to neutrality using
sterilized 1M NaOH before starting the feeding experiment. Cells
were cultured in the presence of up to 3 mM free Sia or ManNGc for
1 or 3 days at 37.degree. C. At the end of the feeding, cells were
washed with cold PBS, harvested either by scraping or with 2 mM
EDTA for fibroblasts, and washed again with cold PBS prior to
fractionation.
[0114] Fractionation of the Labeled Cells--Washed cell pellets were
sonicated into 500 .mu.L of 20 mM sodium phosphate buffer or 20 mM
Tris-HCl, pH 7.5, using 4.times.15 second pulses of a sonicator
cell disrupter, model Some Dismembrator (Fisher Scientific,
Hampton, N.J.) at a probe setting of 3. The sonicate was
centrifuged at 75.times.g for 15 min., and the pellet obtained
consisted primarily of nuclei and unbroken cells. The pellet
contained <5% of the incorporated sialic acid as determined
using a radioactive tracer (data not shown.) The supernatant was
therefore considered as the "total homogenate" fraction. A portion
(20%) of the "total homogenate" fraction was taken for protein
quantification and Sia analysis by DMB derivatization and HPLC
analysis (as discussed below.) The remainder was centrifuged at
100,000.times.g for 1 h. The resulting pellet, called the
"membrane" fraction, was then resuspended by sonication (15 sec.)
in 200 .mu.l of sodium acetate buffer, pH 5.5. The 100,000.times.g
supernatant, called the "soluble" fraction was adjusted to 90%
ethanol using absolute ice-cold ethanol, and placed overnight at
-20.degree. C. The flocculant precipitate, which represents the
"soluble protein" fraction, was washed 3 times with 90% ice-cold
ethanol and then resuspended in 200 .mu.l of water. The supernatant
fluid representing the cytosolic low molecular weight (LMW)
fraction was dried and brought up in 100 .mu.L with water prior to
Sia analysis. All the Sias in these fractions were released with
mild acid hydrolysis if necessary and then analyzed by HPLC after
DMB derivatization. Protein quantification was performed on the
total homogenate, membrane and soluble protein fractions by using
the BCA protein assay kit from Pierce (Rockford, Ill.) In some
experiments, the resulting data obtained for the Sia bound to the
membrane fraction and to the soluble proteins were pooled and
presented here as a High Molecular Weight (HMW) fraction.
[0115] Sialic Acid Release, DMB Derivatization and HPLC
Analysis--The bound Sias from the total homogenate, membrane and
soluble protein fractions were released using 2M acetic acid
hydrolysis, 3 h. at 80.degree. C. The released Sias, or free Sias,
contained in the soluble LMW fraction were passed through a
Microcon.RTM. YM-10 filter (Millipore, Bedford, Mass.) prior to DMB
derivatization, which was done according to Hara et al., 1989.
DMB-Sia derivatives from the different fractions were then analyzed
by HPLC using a C18 column (Microsorb Mv-TM 100 A, Varian, Palo
Alto, Calif.) Isocratic elution was achieved using 7% methanol, 8%
acetonitrile in water during 50 min. at 0.9 ml/min flow. The eluant
was monitored by fluorescence.
[0116] Quantification of Sias--For all HPLC chromatograms, the
quantification of Sias was done by comparison with known quantities
of DMB derivatized Neu5Gc and Neu5Ac used as standards and then
reported in terms of pmoles of Sia. For total homogenate, membrane
and cytosolic protein fractions, this number was expressed per mg
of protein. Due to minor sample-to-sample variations in amounts and
recoveries, the data in the Figures is presented as percent of
Neu5Gc over total Sias, rather than as absolute amounts.
[0117] MS and MS/MS Analysis of DUB Derivatives--In some
experiments, the nature of the DMB derivatives of Sias was
confirmed by mass spectrometry on a Finnigan MAT HPLC (Thermo,
Waltham, Mass.) with online mass spectrometry system using a model
LCQ-Mass. Spectrometer System A. A Varian C18 column was used and
eluted in the isocratic mode with 8% acetonitrile, 7% methanol,
0.1% formic acid in water at 0.9 ml/min over 50 min. The eluant was
simultaneously monitored by UV absorbance at 373 nm and by
electrospray ionization (ESI) mass spectrometry. The ESI settings
used were capillary temperature of 210.degree. C., capillary
voltage at 31 V and the lens offset voltage at 0 V. Spectra were
acquired by scanning from m/z 150-2000 in the positive ion mode. In
some instances, MS/MS was acquired by selecting the parent mass and
using a 20% normalized collision energy. Data analysis was
performed using the XCALIBUR data analysis program from the
instrument manufacturer.
[0118] Endocytosis Inhibition Experiments--Caco-2 or normal
fibroblast cells were split and cultured in alpha-MEM media
supplemented respectively with 20% or 15% human serum for 4 days
before starting the endocytosis drug inhibition experiments in
order to deplete any Neu5Gc derived from FCS. Cells were then
pre-treated for 2 h. with the specific inhibitors under the same
culture conditions. Fresh media containing the same amount of
inhibitor and 3 mM of Neu5Gc was then added to the cells, which
were incubated for 16 h or 3 days and finally harvested and
fractionated as described above. Based on known methods,
chlorpromazine, genistein, nystatin and amiloride were used at
final concentrations of 6.about.Lg/mL, 200 ltM, 25 pg/mL and 3 mM,
respectively.
[0119] Western Blot Analysis--Membrane proteins extracted from
Neu5Gc-fed, ManNGc-fed or non-fed human wild-type (WT) and mutant
fibroblasts were separated by SDS-PAGE electrophoresis using an 8%
polyacrylamide gel. The separated proteins were transferred onto a
nitrocellulose membrane, which was blocked overnight with tris
buffered saline containing 0.1% of Tween-20 (TBS-T.)
Immunodetection was then performed using an anti-Neu5Gc antibody
(1:10,000 in TBS-T, 3 h., room temperature (RT).) Binding of the
anti-Neu5Gc antibody was detected using a secondary horse radish
peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody
diluted at 1:30,000 in TBS-T for 45 min. at room temperature (RT)
(Jackson ImmunoResearch Laboratories, West Grove, Pa.) Final
development of the blots was performed using Supersignal West Pico
ECL reagent (Pierce, Rockford, Ill.) and X-GMAT Kodak (Rochester,
N.Y.) films.
[0120] Flow Cytometry--Human WT and mutant fibroblasts grown in
media with 10% FCS+20% horse serum for 3 days were lightly
trypsinized (0.04% trypsin, 0.53 mM EDTA for 5 min.) to release
cells from the flasks. The cells were washed with PBS and then
fixed overnight with 1% paraformaldehyde in PBS. Fixed cells were
permeabilized or not with 0.1% saponin in PBS at RT for 20 min.
Chicken anti-Neu5Gc antibody was added to cells at a 1:200 dilution
in PBS and incubated at RT for 30 min. Cells were then washed with
PBS and resuspended in FITC-conjugated goat anti-chicken IgY (1
.mu.g/100 .mu.l) (Southern Biotechnology Associates, Birmingham,
Ala.) and allowed to incubate for 30 min. at RT. Labeled cells were
washed with PBS and resuspended in 500 .mu.l PBS for analysis of
FITC fluorescence on a FACS Calibur (BD Bioseiences, San Jose,
Calif.)
[0121] Fluorescence Microscopy--Human WT and mutant fibroblasts
were grown on poly-D-lysine-coated glass chamber slides (Nalge
Nunc. International, Naperville, Ill.) with media containing 10%
FCS+20% horse serum for 4 days. Cells were fixed onto slides using
1% paraformaldehyde in PBS for 30 min. at RT before permeabilizing
with 0.1% saponin for 20 min. at RT. Chicken anti-Neu5Gc antibody
was then added at 1:50 dilution in PBS along with 1 .mu.g of mouse
anti-LAMP-1 (clone H4A3, BD Pharmingen, San Diego, Calif.) and
incubated at RT for 1 h. Bound antibodies were then detected with
FITC-goat anti-chicken IgY and Cascade Blue (Invitrogen, San Diego,
Calif.)-goat anti-mouse IgG (each at 1 l..mu.g/100 .mu.l) at RT for
1 h. Cells were washed with PBS and covered with Gel/Mount
(Biomedia, Foster City, Calif.) before fluorescence imaging with a
Zeiss (Carl Zeiss, Germany) microscope at 400.times. magnification
with emission filters at 400 and 520 nm for Cascade Blue and FITC,
respectively.
Results
[0122] Free Neu5Gc can be taken up by human epithelial cells from
an exogenous source and incorporated into different subcellular
fractions. Evidence was presented suggesting that the small amounts
of Neu5Gc found in some human tissues originated from dietary
sources and showed that human Caco-2 cells (human epithelial cells
from a primary colon carcinoma) in culture could metabolically
incorporate free Neu5Gc, as determined by a Western blot of a total
homogenate using and anti-Neu5Gc antibody. Increasing incorporation
of Neu5Gc was found in the total homogenate fraction of the cells
over time, with the highest level reached after incubation with 3
mM Neu5Gc for 3 days. Moreover, western blotting with an
anti-Neu15Gc antibody demonstrated metabolic incorporation of
Neu5Gc into glycoproteins of these cells.
[0123] The partitioning of the exogenous Neu5Gc into different
subcellular fractions of these cells has also been analyzed. Prior
to feeding, Caco-2 cells were split and cultured in human serum
instead of FCS in order to eliminate traces of Neu5Gc in the cells.
Culture was continued for 3 days in the presence of 3 mM Neu5Gc
using 3 mM ManNGc and Neu5Ac as positive controls. Indeed, it was
shown that Neu5Ac and ManNGc can be incorporated into cells and
that ManNGc or its peracetylated form can be metabolized into
Neu5Gc. After the 3 day feeding, the cells were harvested and the
Neu5Gc content of the different subcellular fractions were analyzed
by DMB derivatization, HPLC, MS and MS/MS analysis. As shown in
FIG. 1A, the DMB-HPLC profiles of Sias released from the membranes
of Caco-2 cells fed with 3 mM ManNGc or Neu5Gc presented two peaks
which correspond to Neu5Gc and Neu5Ac, by comparison with the
retention times of standards. Cells that were not fed or fed with
Neu5Ac had only one peak corresponding to Neu5Ac. These results
were confirmed by LC-MS and MS/MS analysis. DMB-Neu5Gc and
DMB-Neu5Ac adducts gave signals at m/z 442/424 and 426/408
respectively, representing molecular ions of DMB-derivatized Neu5Gc
and Neu5Ac and their dehydrated forms. LC-MS and MS/MS data
obtained on DMB-derivatized Sias released from the membranes of
Caco-2 cells non-fed or fed with Neu5Ac gave only a single ion at
m/z 426 which can be broken down to 408 by MS/MS, confirming the
presence of Neu5Ac and the absence of Neu5Gc. The same analysis on
Neu5Gc or ManNGc fed Caco-2 cell membrane Sias gave ions at m/z
442/426, which are respectively dehydrated to 424/408 in MS/MS
analysis.
[0124] These analyses confirmed the presence of Neu5Gc associated
specifically within the glycoconjugates of the membranes of Caco-2
cells fed with ManNGc or Neu5Gc. All other sub-cellular fractions
were also studied using the same DMB-HPLC approach. Due to
sample-to-sample variations in amounts and recoveries, data is
presented in this and subsequent figures as percent of Neu5Gc over
total Sias, rather than as absolute amounts. FIG. 1B summarizes the
results showing that the total homogenate (TH), high molecular
weight fraction (HMW is the combination of membrane and soluble
protein fractions) and cytosolic low molecular weight (LMW)
fraction contain 58, 46 and 70% Neu5Gc, respectively. In the
experiment presented here, the % of Neu5Gc in the membrane fraction
of cells fed with Neu5Gc was lower compared to the one obtained for
cells fed with ManNGc. This was not always the case, as was
observed in other feeding experiments that free Neu5Gc can be as
efficient as ManNGc and sometimes even better. The relative
percentages obtained for the other fractions (total homogenate, LMW
and soluble protein) were similar in several repeated ManNGc and
Neu5Gc feeding experiments.
[0125] The uptake mechanism of free Neu5Gc is not specific for
human epithelial cells. The above experiments showed that free
Neu5Gc can be taken up by human epithelial carcinoma cells from the
media, and incorporated into different subcellular fractions such
as membrane-bound glycoconjugates, soluble proteins, and low
molecular weight compounds present in the cytosol. To see if this
is a specialized mechanism inhuman carcinoma cells, similar Neu5Gc
feeding experiments were done on other human cell types such as
normal skin fibroblasts and neuroblastomas. It was found that
fibroblast cells can also take up free Neu5Gc from the media,
albeit in a less efficient manner. As presented in FIG. 2A, 28%,
39% and 41% Neu5Gc are present in the TH, HMW and cytosolic LMW
fractions of the human normal fibroblasts after Neu5Gc feeding.
Lower levels (4%, 19%, 12% Neu5Gc) were already present in the same
fractions when fibroblast cells were not incubated in presence of 3
mM Neu5Gc. This Neu5Gc is assumed to be derived from Neu5Gc on FCS
glycoproteins used for cell culture, prior to feeding experiments
Human neuroblastoma cells also incorporate Neu5Gc with an
efficiency comparable to the Caco-2 cells (FIG. 2B.) These data
indicate that the uptake mechanism of Neu5Gc can also occur in
other human cell types, with varying efficiencies.
[0126] The uptake mechanism of free Neu5Gc is also not specific for
human cells. To determine if the uptake mechanism of free Neu5Gc is
specific for human cells, Neu5Gc feeding of human and chimpanzee
lymphoblasts was compared. Humans are evolutionarily most closely
related to the chimpanzee, whose proteins are .about.99% identical
to those of humans. Of course, great apes such as chimpanzees are
able to express Neu5Gc in large amounts because they have an active
form of the CMP-Neu5Ac hydroxylase. Prior to the feeding
experiment, both cell types were split and cultured in human serum
instead of FCS for a couple of weeks. As expected, the Neu5Gc
content of chimpanzee lymphoblasts could not be eliminated
completely because of the endogenous production of Neu5Gc. After a
3 day feeding of 3 mM Neu5Gc or Neu5Ac, the cells were harvested,
fractionated and the Neu5Gc content of the different subcellular
fractions were analyzed. As shown in FIG. 3A, the human cells fed
with 3 mM Neu5Gc contained 67% Neu5Gc in the TH fraction, 51% in
the HMW fraction and 80% in the LMW cytosolic fraction. In
contrast, the same cells had almost no detectable Neu5Gc when they
were non-fed or fed with Neu5Ac (FIG. 3A.) With chimpanzee cells,
we measured baseline levels at 57% Neu5Gc in the TH fraction, 66%
in the HMW fraction and 70% in the LMW fraction of non-fed cells
(FIG. 3B), representing the endogenous production of Neu5Gc by
these cells. When the chimpanzee lymphoblasts were fed with 3 mM
Neu5Ac, the percentages of Neu5Gc present in the different
fractions changed only minimally (FIG. 3B), presumably because of
biosynthetic transformation of Neu5Ac to Neu5Gc occurring at the
sugar nucleotide level. When the chimpanzee lymphoblasts were fed
with 3 mM Neu5Gc, an increase above the baseline levels was
observed to 70% for the TH fraction, 72% for the HMW fraction and
84% for the LMW fraction (FIG. 3B). Similar experiments have been
done with Chinese hamster ovary (CHO-K1) cells and with epithelial
cells isolated from a spontaneous tumor from a CMAI-I gene knock
out mouse. These experiments gave similar results. However, since
non-human cells often have large endogenous amounts of Neu5Gc, the
consequences are more dramatic in human cells.
[0127] Free Neu5Ac and Neu5Gc are taken up and incorporated by the
same pathways. From these data, it appears that Neu5Ac and Neu5Gc
can be taken up by many kinds of cells from an exogenous source and
incorporated into endogenous glycoconjugates. It has previously
been demonstrated that Neu5Gc and Neu5Ac are used interchangeably
by essentially all of the steps leading to their final
incorporation into glycoconjugates. Higa, H. H. et al. ((1985) J.
Biol. Chem. 260:8838-8849) showed that CMP-Sia synthetases from
calf brain and from bovine and equine submaxillary glands both
converted Neu5Ac and Neu5Gc to their CMP derivatives efficiently.
They also studied six mammalian sialyltransferases purified from
porcine, rat, and bovine tissues and concluded that CMP-NeuAc and
CMP-NeuGc were equally good donor substrates for all the enzymes.
Schauer, R. et al. ((1980) Hoppe-Seyler's Z. Physiol. Chem.
361:641-648) showed that the frog liver CMP-Sia synthetases had
very similar Km values for Neu5Ac and Neu5Gc. It has also
previously been shown that CMP-Neu5Gc and CMP-Neu5Ac could be taken
up by Golgi vesicles and incorporated into endogenous glycoproteins
at an approximately equal rate. Similar observations were made by
Lepers, A. et al. ((1989) FEBS Lett. 250:245-250) in rat and mouse
liver Golgi. Thus, by doing competition experiments in Caco-2 and
human normal fibroblast cells, it can be determined whether Neu5Gc
and Neu5Ac are taken up and incorporated via the same pathways.
Both cell lines gave similar results, and only the results for
Caco-2 cells are presented in FIG. 4. Feeding was done for 3 days
with 3 mM Neu5Gc in the absence or presence (3 mM or 15 mM) of
Neu5Ac in the media. The baseline incorporation of 56% Neu5Gc in
the TH was reduced to 48% in the presence of 3 mM Neu5Ac and
further decreased to 35% in the presence of added 15 mM Neu15Ac
(FIG. 4A). The percentage of Neu5Gc was even more affected in the
membrane-bound fraction, reducing from 41% to 29.9% with 3 mM
Neu5Ac, and almost to zero in the presence of 15 mM Neu5Ac (FIG.
4B). Since a 5-fold excess of Neu5Ac was enough to abolish the
incorporation of Neu5Gc into the membrane fraction of the cells, it
is concluded that both molecules likely use the same pathways to
enter into human cells and become available for metabolic
incorporation. It is of course possible that there are minor
differences in utilization of Neu5Gc and Neu5Ac by various enzymes
and transporters in the pathways.
[0128] Free Neu5Gc enters into cells via pathways of endocytosis.
Negatively charged hydrophilic molecules like sialic acids usually
do not cross membranes. To understand how free Neu5Gc enters into
cells, the hypothesis that it does so via endocytic pathways was
explored. Thus, Neu5Gc feeding experiments on Caco-2 cells were
done in the presence of drugs that are known to inhibit various
endocytic pathways common to most cell types. Based on known
studies in the field, it was decided to use chlorpromazine for
blocking the clathrin dependent pathway and nystatin and genistein
for the clathrin independent pathways (with an additional specific
action of nystatin on caveolar uptake.) Amiloride was used as an
inhibitor of fluid phase pinocytosis. All of these drugs were used
at concentrations based on prior studies. As before, the Caco-2
cells were incubated in an appropriate media containing human serum
instead of FCS and pre-treated with the drug for 2 hours, followed
by the addition of 3 mM of Neu5Gc for 16 h. or 3 days. As shown in
FIG. 5A, incorporation of Neu5Gc in the TH fraction in the presence
of chlorpromazine and nystatin (.about.65% in both cases) was about
the same as for the non-treated Caco-2 cells. In contrast, Neu5Gc
incorporation into cells was decreased in the presence of genistein
(51%) and much further by amiloride (35.4% Neu5Gc.) Analysis of
incorporation into membrane-bound glycoconjugates gave similar
results. While there was no obvious difference in the Neu5Gc
incorporation for cells cultured without (45%) or with
chlorpromazine (50%) or with nystatin (44%), genistein and
amiloride caused marked reduction of incorporation to 34% and 10%
respectively. These results indicate that exogenous fine Neu5Gc
enters cells via clathrin-independent endocytic pathways with a
major contribution from fluid phase pinocytosis.
[0129] The lysosomal sialic acid transporter is required for export
of free NeuGe from the lysosome to tile Cytosol. Free Neu5Gc
molecules entering the cell via endocytic pathways would still be
restricted from passively diffusing out of endosomes into the
cytosol. It was hypothesized that they would eventually reach the
lysosome where they would have the opportunity to utilize the
previously known lysosomal sialic acid transporter (58-60) to reach
the cytosol. To test this hypothesis, fibroblasts from a patient
(GM05520) with a severe infantile form of sialic acid storage
disease (ISSD), a disease that is caused by a genetic defect in
this transporter, were used. As shown in FIG. 6, the precent of
Neu5Gc incorporation into membrane-bound glyconconjugates was
reduced from 37% in normal wild-type (WT) fibroblasts to 5% in
these mutant cells. As a control, the metabolic conversion of
ManNGc into Neu5Gc in these cells was also studied, which
presumably occurs following passive diffusion through the plasma
membrane, and does not require the lysosomal sialic acid
transporter. As predicted, it was found that there was essentially
no difference in between normal (19% Neu5Gc) versus mutant
fibroblasts (18% Neu5Gc) following feeding with 3 mM ManNGc.
Another similar mutant human fibroblast cell line (GM08496) was
studied, with a partial inhibition of function of the lysosomal
sialic acid transporter. This cell line was isolated from a patient
suffering from Salla disease, a milder adult form of sialic acid
storage disease. Neu5Gc feeding of these cells resulted in 16%
Neu5Gc in membrane-bound glycoconjugates in comparison to the 37%
seen in normal WT fibroblasts. Again, feeding with ManNGc gave no
obvious change from the control (17% Neu5Gc.) To further confirm
that there was a difference in incorporation into glycoproteins, a
Western blot analysis was carried out of proteins, extracted from
the membranes of wild-type and GM05520 mutant human fibroblasts
using an anti-Neu5Gc antibody, with or without prior Neu5Gc or
ManNGc feeding. The mutant fibroblasts could not incorporate Neu5Gc
into glycoproteins, but could in fact convert it from ManNGc (data
not shown.) Taken together, the data confirm the hypothesis that
the lysosomal sialic acid transporter plays a crucial role in
delivering free sialic acids that enter into cells via endocytosis
to the cytosol for activation and incorporation into
glycoconjugates.
[0130] Both the lysosomal sialidase and the lysosomal sialic acid
transporter are required for incorporation of glycoprotein-bound
NeuGc into Human cells. Several studies have shown that when human
cells are transferred from conventional media containing FCS into
serum-free media or human serum, the small amounts of endogenous
Neu5Gc in these cells gradually disappear. It has always been
assumed that this is because FCS contains many glycoproteins with
attached Neu5Gc. However, the pathway by which these
glycosidically-bound Neu5Gc molecules enter the cell and eventually
become incorporated into endogenous glycoproteins has never been
defined. This question is also of direct relevance to human gut
epithelial cells, which would be exposed to glycoprotein-bound
Neu5Gc of dietary origin (red meat, milk products for example.)
Based on the above findings, it is reasonable to hypothesize that
the Neu5Gc carrying serum glycoproteins enter the cell via fluid
phase pinocytosis, eventually reaching the lysosome where they are
exposed to the lysosomal sialidase. The resulting free Neu5Gc in
the lysosome would then have the opportunity to use the lysosomal
sialic acid transporter to reach the cytosol in order to be
salvaged and eventually converted to CMP-Neu5Gc.
[0131] To test this hypothesis, the GM05520 mutant human
fibroblasts, which are completely deficient in the lysosomal sialic
acid transporter, as well as GM01718 mutant human fibroblasts,
which have less than 1% lysosomal sialidase activity compared to
normal fibroblasts, were used. For these studies, it was important
to differentiate between cell surface and internal Neu5Gc. Thus,
instead of subcellular fractionation, the method of flow cytometry
was utilized, using affinity purified Neu5Gc-specific chicken
antibody. As shown in FIG. 7A, after 3 days of feeding with 10%
FCS+20% horse serum (both rich sources of glycoprotein-bound
Neu5Gc), the total surface expression of Neu5Gc was significantly
lower in both mutant fibroblasts compared to WT fibroblasts.
Permeabilization of cells revealed similar levels of total Neu5Gc
glycoconjugates (FIG. 7A), but the majority in the two mutants was
internal (FIG. 7B). To confirm trapping of Neu5Gc glycoconjugates
in lysosomes, fluorescence microscopy analysis was performed of
permeabilized fibroblasts, co-labelling cells with a known marker
for lysosomes, LAMP-1. An even distribution of Neu5Gc staining on
WT normal fibroblasts with little co-localization with lysosomes
was found. Oh the other hand, both the lysosomal sialidase and the
transporter mutants demonstrated significant accumulation of Neu5Gc
glycoconjugates in the lysosomes.
[0132] The results with the sialidase-deficient fibroblasts confirm
the hypothesis that this enzyme must act to release free Neu5Gc
from glycoproteins and to make it available for metabolic
incorporation. The acclunulation of Neu5Gc glycoconjugates in the
lysosomal transporter mutant was unexpected. A likely explanation
is that accumulation of free Sia at a high concentration in the
lysosomes inhibits the action of the lysosomal sialidase, resulting
in accumulation of glycosidically-bound Neu5Gc. The residual levels
of Neu5Gc detected on the surface of both mutant cells might be
explained by direct incorporation of gangliosides and GPI-anchored
proteins bearing Neu5Gc from the serum. Taken together, these data
indicate that bound Neu5Gc molecules that enter into human cells
via pinocytosis are released by the lysosomal sialidase and are
then transported by the lysosomal sialic acid transporter to the
cytosol, where they are available for activation and incorporated
into glycoconjugates (FIG. 8.) Of course, depending on the type of
glycoprotein involved, bound Neu5Gc could also be delivered to
lysosomes via other pathways of endocytosis, e.g.,
receptor-mediated endocytosis via clathrin-coated vesicles.
[0133] It has long been assumed that free sialic acids could not be
efficiently incorporated into cells because of their negative
charge and hydrophilic nature. Thus, neutral ManNAc has
traditionally been used as a precursor to feed cells for conversion
into Neu5Ac. The same concept has been applied to various unnatural
mannosamine derivatives, and the addition of O-acetyl esters to the
hydroxyl groups of mannosamine derivatives has been used to enhance
delivery across the plasma membrane. In fact, one early study
suggested that radioactive sialic acids could be incorporated into
cells, and more recent work of others has shown "efficient" uptake
of a variety of kinds of sialic acids into cells. However, the
kinetics of incorporation showed no evidence of saturation even at
>10 mM concentrations, suggesting that the uptake was not due to
a high efficiency cell surface transporter for sialic acids.
Studies using a natural sialic acid (Neu5Gc) gave similar
results.
[0134] It has been shown that sialic acids from the medium can be
taken up into cells via non-clathrin-mediated mechanisms, mostly
amiloride-sensitive fluid-phase pinocytosis. The content of the
resulting pinocytotic vesicles and endosomes would eventually be
delivered to the lysosome, where the previously described sialic
acid transporter then delivers the molecules into the cytosol. It
has also been shown that the incorporation of glycosidically-bound
Neu5Gc from exogenous glycoproteins occurs by similar delivery to
the lysosome, and release by the lysosomal sialidase, followed by
export into the cytosol (FIGS. 7 and 8.) Once activated to
CMP-Neu5Gc, molecules from both sources (free and originally bound)
would be indistinguishable from those that were endogenously
synthesized by the cells.
[0135] Most recently, it has been shown that human embryonic stem
cells can incorporate Neu5Gc from medium glycoconjugates, making
them targets for the naturally occurring antibodies that circulate
in most humans. Preliminary data also suggest that these antibodies
could also be related to diseases in intact humans. Thus, the
mechanism by which Neu5Gc is incorporated into human cells is of
potentially great importance. Further studies of this process are
also relevant both to the ongoing attempts by various groups to
incorporate different kinds of unnatural sialic acids into cultured
cells, and also to efforts to understand how exogenous dietary
Neu5Gc gain entry into normal human tissues. In this regard, it is
of note that Neu5Gc accumulation appears to be enhanced in
naturally occurring tumors, and in fetal tissues. It is suggested
that this may be explained by the fact that fluid phase
macropinocytosis is enhanced by growth factors, which are expected
to be very prominent in these two situations.
[0136] Finally, the studies described herein demonstrate, perhaps
for the first time, that an extracellular small molecule that
cannot cross the plasma membrane is delivered efficiently to the
cytosol utilizing fluid pinocytosis and a specific lysosomal
transporter. This approach could thus potentially be generalized to
any small molecule that has a specific lysosomal transporter, but
not a plasma membrane transporter. For example, one could envisage
that the neutral sugars GlcNAc and GalNAc, which do not have a high
efficiency plasma membrane transporter, could nevertheless be
delivered to the cytosol via the lysosomal GlcNAc/GalNAc
transporter. The prediction is that adding millimolar
concentrations of these sugars into the medium would result in
significant delivery to the cytosol.
Example II
Human Embryonic Stem Cells Express an Immunogenic Nonhuman Sialic
Acid
[0137] The HI ES cell line (WiCell Research Institute, Inc.,
Madison, Wis.) cells were cultured on mitotically inactivated
(mitomycin C treated) mouse embryonic fibroblasts (MEF, Specialty
Media, Phillipsbuurg, N.J.) in DMEMJF12 Glutamax (Gibco), 20%
"knockout" serum replacement (Gibco) or pooled human blood-type AB
serum (Pel-Freeze, Rogers, Ark.), 0.1 in M non-essential aminoacids
(Gibco), 0.1 mM betamercaptoethanol (Gibco), and 4 ng/mL
.beta.FGF-2 (R&D Systems, Minneapolis, Minn.). For EB culture,
HI ES cells were grown in suspension for 7-10 days, using the same
medium without FGF-2 and 10% serum. Cells were changed to a new
dish every day to eliminate eventual fibroblast contamination.
[0138] HESC Transfection--HI HESC were stably transfected to
express green fluorescent protein (GFP) by CAG-EGFP SIN lentivirus
infection. The SIN lentiviral vector expressing EGFP under control
of the CAG promoter was derived from a multiply attenuated HIV
vector system, but included a U3 deletion and introduction of a
cPPT element. Vectors were produced by triple transduction of HEK
293 cells (Graham et al., J. Gen Virol (1977), 36(1):59-74)
followed by ultracentrifugation and titration. Undifferentiated
cells were exposed to the virus at a titer of 0.5.times.10.sup.10
gtu/mL for 1 hour followed by a 2 day recovery period. EGFP was
detected by native fluorescence at day 3 after transduction. Cells
expressing EGFP were FACS sorted for uniform EGFP expression. No
loss in EGFP expression was observed during propagation or EB
differentiation and up to 10 months after transduction. The EGFP
positive cells derived from these colonies are thus polyclonal in
origin. The GFP positive ES cells maintain a similar phenotype to
the wild type cells (SSEA-4, SSEA-3 and Oct4-positive.)
[0139] Oct4 antibody (1:500) was from Santa Cruz (Santa Cruz,
Calif.), the other marker antibodies (SSEA-3, TRA-1-60, alkaline
phosphatase and nestin) were from Chemicon (Temecula, Calif.;
dilution 1:100), and the secondary Cy3 antibody from Sigma (San
Louis, Mo.; dilution 1:250). Alkaline Phosphatase (AP) activity was
measured using the Vector Red Alkaline Phosphatase substrate kit I
from Vector laboratories (Burlingame, Calif.)
[0140] Human sera--Sera from several healthy human donors were
obtained after written consent and Institutional Review Board
approval, and anonymously numbered before further use. Anti-Neu5Gc
antibody levels in several serum samples were determined using
known methods. Two specific sera, corresponding to the lowest and
highest extremes of the range, were selected for the experiments.
Another serum with a high level of anti-Neu5Gc antibodies was also
studied with identical results to those presented in the
figures.
[0141] Determination of Neu5Gc content--Sias from HESC, feeder
layer cells, EB or culture medium were released by mild acid,
derivatized with 1,2-diamino-4,5-methylene dioxybenzene (DMB) and
analyzed by HPLC to determine the percentage of Neu5Gc in total
Sias.
[0142] Flow cytometry--Cells were harvested into 2 mM EDTA in
phosphate buffer (PBS) and washed with PBS. 1.times.10.sup.5 cells
were incubated with a chicken anti-Neu5Gc (1.5 .mu.g/100 .mu.L) and
stained with a donkey anti-chicken IgY conjugated to Cy5 (Jackson,
West Grove, Pa.; dilution 1:100 in PBS.) Neu5Gc-specific antibody
binding was partially blocked by co-incubation with 1% chimpanzee
serum, which (unlike human serum) is rich in Neu5Gc.
[0143] For human serum antibody deposition studies, HESC were
harvested and exposed to individual human sera. Human IgGs
deposited on the cells were stained with an anti-human IgG
conjugated to Alexa 594 (Molecular Probes, Carlsbad, Calif.;
dilution 1:100 in PBS.) For C3b deposition, HESC were exposed to
human serum, then incubated with a goat anti-human C3b (Fitzgerald,
Concord, Mass.; dilution 1:100 in PBS) and finally stained with an
anti-goat I-G conjugated to Alexa 594 as above.
[0144] Cytoioxicity assays--A standard procedure for testing
antibody, complement-mediated cytotoxicity after exposure to human
sera, was followed. HESCs were harvested and resuspended into
GVB.sup.2+ buffer (Sigma) alone (control) or GBV.sup.2+ containing
25% human serum. Cells were incubated for 2 h. at 37.degree. C. and
gently shaken. Dead cells were stained with propidium iodide (5
.mu.g/mL) and analyzed by FACS. For cytotoxicity assays on the
plate, cells were exposed to serum-free HESC culture medium
containing 25% of the test human sera. After 30 minutes at
37.degree. C., they were harvested and stained with propidium
iodide.
[0145] Statistical analysis--Sia content from at least two
experiments run in duplicate was analyzed using the T test in
Microsoft Excel. Data are expressed as mean .+-.standard
deviation.
[0146] Presence of Neu5Gc on HESC grown under standard
conditions--Neu5Gc on HESC was detected using an affinity-purified
chicken polyclonal monospecific anti-Neu5Gc antibody. HESC stably
expressing EGFP were gated for EGFP-positivity to separate them
from contaminating feeder layer fibroblasts. The antibody stained
HESCs growing in standard conditions, and binding was partially
blocked by Neu5Gc-containing glycoproteins from chimpanzee serum
(FIG. 9a.) Blocking was incomplete, likely because not all possible
epitopes recognized by the polyclonal antibody are present in
chimpanzee serum.
[0147] To chemically analyze the Sia content of HESCs, they were
separated from the feeder layer fibroblasts by FACS sorting using
their EGFP signal. Feeder-layer-free EB derived from HESC were also
examined without sorting. Both the membrane and cytosolic fractions
from HESC and EB had a peak corresponding to Neu5Gc (FIG. 9b),
whose identity was confirmed by electrospray mass spectrometry
(data not shown). HESC membranes contained 17.88.+-.1.47 pmoles
Sia/.mu.g protein with 9.31.+-.3.70 pmoles Sia/.mu.g protein in the
cytosolic fraction. The percentage of total Sias present as Neu5Gc
varied from 6-10.5% in the membranes and from 2.5-9% in the
cytosolic fraction. EB membranes had 16.59.+-.3.88 pmoles Sia/.mu.g
protein with 9.13.+-.0.10 pmoles Sia/.mu.g protein in the cytosolic
fraction. The percentage of total Sias present as Neu5Gc in EB
varied from 5-17% for the membranes and 6.5-11% for the cytosolic
fraction.
[0148] Identifying potential sources of Neu5Gc in HESC--Since human
cells are unable to synthesize Neu5Gc, the Neu5Gc detected likely
originated from elsewhere, eventually being metabolically
incorporated by the HESC. As expected for other mammals, Neu5Gc
represented 20% of total Sias in the mouse feeder layer
(0.92.+-.0.13 mmoles/million cells.) However, uptake from feeder
cells cannot explain all the Neu5Gc found in HESC, since removal of
the layer to obtain EB did not eliminate it. It was shown that
human cells can take up Neu5Gc from the medium and metabolically
incorporate it into membrane glycoconjugates. The "serum
replacement" containing medium used to support HESC growth was
found to contain 35.93 nmoles Neu5Gc/mL, representing 54% of total
Sias. The commercial "knockout" serum replacement used for
preparing this medium is the major source of Neu5Gc, since it
contains 129 nmoles/mL. In contrast, medium without any additives
is poor in Neu5Ge (0.008 nmoles/mL.)
[0149] Neu5Gc content of HESC is reduced by growth in
heat-inactivated human serum with low anti-Neu5Gc
antibodies--Culture in heat-inactivated pooled normal human serum
could markedly reduce Neu5Gc in human colon carcinoma cells,
apparently due to metabolic replacement by Neu5Ac in the human
serum. HESC was therefore incubated in medium containing heat
inactivated human serum instead of the standard serum replacement
(an approach already suggested by others for different reasons.)
First, a lot of pooled human serum was screened and defined in
which natural anti-Neu5Gc antibodies were very low (hereafter
called NHS.) In case any residual antibodies were active, heat
inactivation was used to eliminate complement. HESC incubated in
such NHS remained undifferentiated on the feeder layer, expressing
typical levels of markers of non-differentiation (alkaline
phosphatase, Oct-4, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 and lack
of all differentiation markers tested (FIG. 10.) After feeder layer
removal, these HESC were able to develop into normal EB.
[0150] Neu5Gc incorporation into HESC membranes dropped after 3
days (from .about.4 pmoles/.mu.g protein to 0.34.+-.0.06
pmoles/.mu.g protein) and down to 0.13.+-.0.01 pmoles/.mu.g protein
after one week (-1% of total Sia as Neu5Gc, see FIG. 11.) The
required presence of the mouse feeder layer apparently prevented
complete elimination of Neu5Gc from HESC. After growing for 3 days
in human serum, some HESC were differentiated into EB either in 10%
commercial serum-replacement, or in 10% NHS, without a feeder
layer. After one week in serum-replacement, the amount of Neu5Gc on
the EB membranes increased (from 0.34.+-.0.06 to 0.40.+-.0.10
pmoles/.mu.g protein.) In contrast, continued incubation in NHS
further reduced Neu5Gc levels to 0.047.+-.0.06 pmoles/.mu.g
protein.
[0151] Natural human anti-Ncu5Gc antibodies bind to HESC and cause
complement deposition--Healthy humans have variable levels of
"natural" circulating anti-Neu5Gc antibodies. It was determined
whether such antibodies could recognize Neu5Gc-containing epitopes
on HESC grown under standard conditions. Cells exposed to a
high-level anti-Neu5Gc antibody-containing human serum (Hi-GcAbHS)
showed human IgG binding (FIG. 12a shows only the EGFP+HESC.) In
contrast, staining of cells exposed to a low-level antiNeu5Gc
antibody-containing human serum (Lo-GcAbHS) was similar to that of
nonexposed controls. Antibody deposition was related to the amount
of Neu5Gc on the HESC, since cells growing in NHS did not show any
IgG binding when exposed to the same HiGcAbHS (FIG. 12b.)
[0152] Cell surface antibody deposition can activate the classical
complement pathway, eventually leading to killing or phagocytosis.
It was determined whether complement C3b deposition occurred
following exposure to Hi-GcAbHS. As before, the data was gated for
EGFP+HESC. When HESC were grown under the standard conditions, 37%
were positive for C3b (FIG. 13c; compare to 0% background in FIG.
13a.) Only 22% of the cells were positive after exposure to
Lo-GcAbHS, with actual levels on individual cells being much lower
(FIG. 13b.) (Note that the Y-axis is a log scale.) When HESCs were
grown for 5 days in NHS-containing medium, C3b-positivity after
exposure to Hi-GcAbHS dropped to 13% (FIG. 13c.) These data are
consistent with deposition of anti-human IgG under the same
conditions (FIG. 12) and also with the significant reduction in
Neu5Gc on the HESC after incubation in human serum-containing
medium (FIG. 11.)
[0153] Such binding of antibody and complement to HESC would target
them for death in vivo, via recognition by macrophages and NK
cells. Regardless, attempts were made to directly determine
antibody:complement-mediated cytolysis on HESCs in vitro. The
standard single cell suspension required for such analyses caused
extensive cell death even under control conditions (without serum.)
Exposure to Hi-GcAbHS caused increased death above background
levels seen with NHS, from 40% to 60-70%. In contrast, the
percentage of dead HESCs after exposure to Lo-GcAbHS was similar to
that of the control. When the assay was performed directly on the
culture dish for shorter time, more HESCs remained alive. Cell
death with Hi-GcAbHS was higher than that of the control (14% vs.
10%), whereas the death rate after exposure to Lo-GcAbHS remained
unchanged.
[0154] HESCs and EB can incorporate the non-human Sia Neu5Gc from
the murine feeder layer and/or the medium, leading to an immune
response mediated by "natural" anti-Neu5Gc antibodies present in
most humans. In effect, HESCs appear like animal cells to the human
immune system. Pooled, heat-inactivated human serum selected for
low titers of anti-Neu5Gc antibodies could be substituted for the
traditional animal serum or serum replacement, supporting the
undifferentiated growth of HESCs. This approach markedly reduced
the immune response, by reducing the Neu5Gc content on the
HESCs.
[0155] Most existing HESC lines have been grown or derived with
mouse feeder layer. Standard culture conditions also include animal
serum, or a serum replacement. It is shown here that the commercial
"serum replacement" is also a rich source of Neu5Gc, and both HESCs
and EB are able to incorporate it. The composition of this serum
replacement is described in PCT WO 98/30679, and includes proteins
like transferrin, which are likely to be from animal sources and
therefore, would carry Neu5Gc. Human orthologs or recombinant
proteins synthesized in bacteria could be used instead.
[0156] Many efforts have been recently made to eliminate these
animal-derived components. The use of a feeder-free system, such as
Matrigel or other components of the extracellular matrices, have
been explored. However, feeder-free conditions seem to facilitate
in vitro evolution of HESCs, selecting for aneuploid cells.
Moreover, many of the medium and matrix components are still from
animal sources and contamination with Neu5Gc can be expected.
[0157] Human feeders of different origins have also been tried.
Richards et al. first reported successful derivation and culture of
some HESC lines in the complete absence of non-human components,
using feeder layers from human tissues with human serum and
supplements, further demonstrating the ability to develop
teratomas, i.e., confirming the maintenance of pluripotentiality.
It was also noted that human serum did not cause any change in the
undifferentiated state of the HESCs. Others have also tried similar
xeno-free techniques on hematopoietic stem cells by growing them on
human stromal cells and using medium containing human AB serum. Of
course, the use of an "all-human" environment carries a different
set of risks (unexpected contamination with novel or newly emerging
pathogens).
[0158] There are also potential implications for the incorporation
of Neu5Gc with regard to general HESC biology. Many characteristic
markers of HESC(SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) are
glycolipids or glycoproteins, many of which can carry Sias. SSEA-4,
which is highly expressed even in long-term cultures of HESCs, is
the sialylated form of the globo-series glycolipid SSEA-3 (Gb5.)
TRA-1-60 is a sialylated keratan sulfate protein and the TRA-1-81
epitope became accessible only after sialidase treatment. Neural
lineage cells derived from EB express the polysialylated form of
NCAM, as well as the antigen A2B5, which corresponds to
polysialylated gangliosides. Since Sias are involved in
self-recognition events, the presence of Neu5Gc instead of Neu5Ac
could lead to unexpected impairments of cell function and tissue
development.
[0159] Another possible solution is growth in heat-inactivated
serum from the actual patient who is going to receive the therapy.
Similar alternatives have been suggested for hematopoietic stem
cells. Even if the patient serum contains anti-Neu5Gc antibodies,
heat inactivation could prevent complement activation, until such
time as the pre-existing Neu5Gc in the HESCs is metabolically
eliminated by the Neu5Ac in the serum. An added advantage to this
approach is that it would screen for allogeneic cytotoxic
antibodies in the recipient's serum.
Example III
Elimination of N-glycolylneuraminic Acid Hydroxylase in a Mouse
Model
Material and Methods
[0160] Generation of targeting construct pFlox-Ex-SL for
elimination of CMAH expression. A 10 kb genomic DNA region spanning
the CMAH gene that includes the 92 bp corresponding to exon 6 of
the murine CMAH was isolated from a BAC clone by digesting the
clone with EcoRI with subsequent Southern Blotting using a
radiolabeled probe corresponding to exon 6. The 10 kb piece was
subcloned into pBluescript II KS+, generating the construct pBS-35.
Mapping of the restriction sites of the 10 kb piece was performed
by digesting pBS-35 with various restriction enzymes. A 535 bp
piece containing exon 6 was isolated from pBS-35 by digesting with
NheI and XbaI, and cloned into the BamHI site in the pFlox vector.
A 1150 bp intronic region directly upstream of the 535 bp piece was
isolated by digesting with NheI and subcloning into the pBluescript
II KS+vector. This was then used for PCR using forward primer
CGGCTCGAGTGAGCTACATGAGAT and reverse primer
GGGCTCGAGTAATCACCAAGCAAA, thereby adding XhoI restriction site the
ends of the 1150 bp piece. The PCR product was subcloned into
pBluescript II KS+vector, which was then digested with XhoI and
cloned into the Xho site in the pFlox-Exon vector, creating the
pFlox-Ex-S vector. Next, a 4850 bp piece directly downstream of the
535 bp piece was excise from pBS-35' by digesting with XbaI and
NheI and cloned into the XbaI site in pFlox-Ex-S vector, generating
the final targeting construct, pFlox-Ex-SL.
[0161] Generation of CMAH null mice. pFlox-Ex-SL plasmid DNA was
purified by a standard cesium chloride method and linearized by
digestion with restriction enzyme Not I. The solution containing
digested plasmid DNA is then subjected to sequential phenol, 1:1
phenol:chloroform, and chloroform extraction. The aqueous phase
containing the linearized DNA is then subjected to sodium acetate
precipitation. The resulting DNA pellet is washed 2 times in
ice-cold 70% ethanol, air dried, and resuspended in TE. The
generation of the transgenic mice was performed by the UCSD
Transgenic Mouse Core. In brief, the linearized transgenic
constructs were electroporated into embryonic stem cells (ES cells)
isolated from the 129/SvJ mouse strain. The ES cells then underwent
drug selection, subclone isolation, and growth of isolated clones.
Each clone was grown in triplicate plates, one that was kept by the
Core as a master plate that was frozen at -80.degree. C. and two
that were returned to investigators for the identification of
homologous recombinants. DNA was purified from each clone and
subjected to screening by PCR and Southern Blot analysis as
described below. Homologous recombinants were thawed, expanded, and
reconfirmed by PCR and Southern Blot analysis. For the generation
of the CMAH null mouse, homologous recombinant clones were
subjected to transfection with Cre-recombinase expression vector,
underwent gancyclovir drug selection against the presence of
thymidine kinase (TK), subclone isolation, and growth of isolated
clones. The desired type of recombination was then identified by
PCR analysis. Karyotyping was then performed and two of the best
clones were selected for blastocyst injection. Chimeric mice were
then generated and bred to C57B1/6 females to allow germline
transmission of the transgene.
[0162] PCR genotyping analysis of CMAH null mice. To genotype the
mice, DNA isolated from toe clips were used for PCR analysis. Toe
clips performed to mark the identity of the mice were collected and
digested in 20 ul of buffer containing 50 mM Tris, pH 8.0, 20 mM
NaCl, 1 mM EDTA, 1% SDS, and 250 ug/ml Proteinase K at 55.degree.
C. until the soft tissue dissolved. The sample was then diluted
with 180 ul of water and boiled to inactivate the enzyme. For
genotyping of CMAH null mice, PCR primers UpExon6
(CCAGGAGGAGTTACCCTGAA), Exon6#2 (TCAATCAATTGCATGGGTCT), and DwExon6
(CGAGGACAGCCCAGAGACTA) were designed based on the published murine
CMAH sequence. Analysis was performed using the following PCR
cycle: 94.degree. C. for 5 min; 40 cycles of 94.degree. C. for 30
sec, 53.degree. C. for 30 sec, and 72.degree. C. for 1 min; and
72.degree. C. for 5 min. A PCR product of 305 bp is generated from
the deletion allele while a product of 490 bp is generated from the
wild-type allele.
[0163] Southern blot analysis of the CMAH null mice. To genotype
the mice, DNA isolated from tail clips were analyzed by PCR. Tail
clips were digested overnight at 55.degree. C. in buffer containing
10 mM Tris-HCl, pH 8.0+1 mM EDTA (TE), 1% SDS, 140 mM NaCl, and 0.3
mg/ml Proteinase K. A solution of TE, 5.3M NaCl, and chloroform was
the added. The genomic DNA in the upper aqueous phase was subjected
to ethanol precipitation and resuspended in TE.
[0164] DMB-HPLC analysis of Neu5Gc content in cells and tissues.
Cells or tissues were homogenized and subjected to acid hydrolysis
using 2M acetic acid at 80.degree. C. for 3 h to release sialic
acids from cellular glycoconjugates. After centrifugation at 20,000
g, the supernatant was filtered through a Microcon 10 unit, dried
down, and reconstituted in water. Aliquots were derivatized with
1,2-diamino-4,5-methylene dioxybenzene (DMB) and analyzed by HPLC
(DMB-HPLC). To remove O-acetyl esters, samples were incubated with
0.1 M NaOH for 30 min at room temperature to remove base-labile
O-acetyl esters.
[0165] Immunohistochemistry using the anti-Neu5Gc antibody. Tissues
were collected from autopsies or unused pathological material
frozen in OCT compound and archived at -70.degree. C. Frozen tissue
sections were air-dried for 30 min, fixed in 10% buffered formalin
for 30 min, endogenous peroxidase activity quenched and
non-specific binding sites blocked with 5% (Neu5Gc free) human
serum in PBS for 30 min. Sections were then incubated with the
anti-Neu5Gc antibody in 5% human serum/PBS at a 1:200 dilution at
RT for 2 h. After washing, HRP-conjugated donkey anti-chicken IgY
antibody in 5% human serum/PBS at a 1:100 dilution was applied for
1 hr. Control sections were incubated with secondary reagent only
or a control chicken IgY antibody. Specific binding was detected
using the Nova Red substrate kit.
Results
[0166] Generation of CMAH null mice--To investigate physiological
functions of Neu5Gc in vivo, mice were generated that were
deficient in CMP-N-acetylneuraminic acid hydroxylase (CMAH)
activity. The original goal was to produce CMAH conditional mutant
mice using the Cre/loxP system. Thus, a targeting vector,
pFlox-Ex-SL, was first prepared in which exon 6 of CMAH and the
TK/Neo cassette, are flanked by loxP sites (FIG. 14). The targeting
vector was electroporated into ES cells and 1, out of 245 clones
was identified as a homologous recombinant by Southern blot and PCR
analysis. This clone was transfected with a Cre-recombinase
expression vector and 0 out of 150 clones had undergone type II
recombination that would only delete the TK/Neo cassette. Due to
subsequent difficulties obtaining type II recombinants, we chose to
select only two type I recombinants (where both the exon 6 and the
TK/Neo cassette were deleted) for blastocyst injection into C57BL/6
females. Chimeric mice were bred and one clone achieved germline
transmission.
[0167] Mice deficient in CMAH were viable and fertile and showed no
gross morphological or histological abnormalities in many organs
studied, and their growth was equivalent to that of wild-type
littermates (data not shown). Transmission of the null allele
occurred at the expected Mendelian frequency in pups resulting from
heterozygous breeding as depicted below in Table 1:
TABLE-US-00001 TABLE 1 Genotypes of litters from intercrosses of
CMAH heterozygous mice No. (%) of pups with genotype Wild type
(+/+) 12 (20) Heterozygous (+/-) 38 (63) Homozygous (-/-) 10
(17)
[0168] CMAH null mice are deficient in Neu5Gc expression. To verify
that CMAH null mice were deficient in CMAH expression, the mice
were analyzed for Neu5Gc expression by immunohistochemistry using a
chicken antibody specific for Neu5Gc, and biochemically, by
derivatization with 1,2-diamino-4,5-methylene dioxybenzene (DMB)
and HPLC analysis. Using the anti-Neu5Gc antibody, there was no
staining in any tissues except for the mucinous secretions of the
small intestine and colon. To confirm the lack of Neu5Gc in these
tissues as well as those not stained positive, various tissues were
homogenized and the sialic acids in glycopeptides and lipid
extracts were released by acid and purified by ion exchange
chromatography, derivatized with DMB and analyzed by HPLC
(DMB-HPLC). No Neu5Gc was detectable in tissues staining negative
with the anti-Neu5Gc antibody (data not shown), nor could we find
evidence for presence of Neu5Gc in the intestine or the colon (FIG.
15). Thus, it is concluded that the staining of the mucin-rich
regions of the intestine was non-specific. Furthermore, no Neu5Gc
could be detected in the plasma or the milk of the CMAH null mouse
(FIG. 15.)
[0169] The examples set forth above are provided to give those of
ordinary skill in the art with a complete disclosure and
description of how to make and use the preferred embodiments of the
invention, and are not intended to limit the scope of what the
inventors regard as their invention. Modifications of the
above-described modes for carrying out the invention that are
obvious to persons of skill in the art are intended to be within
the scope of the following claims. All publications, patents, and
patent applications cited in this specification are incorporated
herein by reference as if each such publication, patent or patent
application were specifically and individually indicated to be
incorporated herein by reference.
Sequence CWU 1
1
61486PRTHomo sapiens 1Met Asp Glu Asn Asn Gly Leu Leu Leu Leu Glu
Leu Asn Pro Pro Asn1 5 10 15Pro Trp Asp Leu Gln Pro Arg Ser Pro Glu
Glu Leu Ala Phe Gly Glu20 25 30Val Gln Ile Thr Tyr Leu Thr His Ala
Cys Met Asp Leu Lys Leu Gly35 40 45Asp Lys Arg Met Val Phe Asp Pro
Trp Leu Ile Gly Pro Ala Phe Ala50 55 60Arg Gly Trp Trp Leu Leu His
Glu Pro Pro Ser Asp Trp Leu Glu Arg65 70 75 80Leu Cys Gln Ala Asp
Leu Ile Tyr Ile Ser His Leu His Ser Asp His85 90 95Leu Ser Tyr Pro
Thr Leu Lys Lys Leu Ala Gly Arg Arg Pro Asp Ile100 105 110Pro Ile
Tyr Val Gly Asn Thr Glu Arg Pro Val Phe Trp Asn Leu Asn115 120
125Gln Ser Gly Val Gln Leu Thr Asn Ile Asn Val Val Pro Phe Gly
Ile130 135 140Trp Gln Gln Val Asp Lys Asn Leu Arg Phe Met Ile Leu
Met Asp Gly145 150 155 160Val His Pro Glu Met Asp Thr Cys Ile Ile
Val Glu Tyr Lys Gly His165 170 175Lys Ile Leu Asn Ile Val Asp Cys
Thr Arg Pro Asn Gly Gly Arg Leu180 185 190Pro Met Lys Val Ala Leu
Met Met Ser Asp Phe Ala Gly Gly Ala Ser195 200 205Gly Phe Pro Met
Thr Phe Ser Gly Gly Lys Phe Thr Glu Glu Trp Lys210 215 220Ala Gln
Phe Ile Lys Thr Glu Arg Lys Lys Leu Leu Asn Tyr Lys Ala225 230 235
240Arg Leu Val Lys Asn Leu Gln Pro Arg Ile Tyr Cys Pro Phe Ala
Gly245 250 255Tyr Phe Val Glu Ser His Pro Ser Asp Lys Tyr Ile Lys
Glu Thr Asn260 265 270Thr Lys Asn Asp Pro Asn Glu Leu Asn Asn Leu
Ile Lys Lys Asn Ser275 280 285Asp Val Ile Thr Trp Thr Pro Arg Pro
Gly Ala Thr Leu Asp Leu Gly290 295 300Arg Met Leu Lys Asp Arg Thr
Asp Ser Lys Gly Ile Ile Glu Pro Pro305 310 315 320Glu Gly Thr Lys
Ile Tyr Lys Asp Ser Trp Asp Phe Glu Pro Tyr Leu325 330 335Glu Ile
Leu Asn Ala Ala Leu Gly Asp Glu Ile Phe Leu His Ser Ser340 345
350Trp Ile Lys Glu Tyr Phe Thr Trp Ala Gly Phe Lys Asp Tyr Asn
Leu355 360 365Val Val Arg Met Ile Glu Thr Asp Glu Asp Phe Asn Pro
Phe Pro Gly370 375 380Gly Tyr Asp Tyr Leu Val Asp Phe Leu Asp Leu
Ser Phe Pro Lys Glu385 390 395 400Arg Pro Gln Arg Glu His Pro Tyr
Glu Glu Ile His Ser Arg Val Asp405 410 415Val Ile Arg His Val Val
Lys Asn Gly Leu Leu Trp Asp Glu Leu Tyr420 425 430Ile Gly Phe Gln
Thr Arg Leu Gln Arg Asp Pro Asp Ile Tyr His His435 440 445Leu Phe
Trp Asn His Phe Gln Ile Lys Leu Pro Leu Thr Pro Pro Asn450 455
460Trp Lys Ser Phe Leu Met Cys Cys Glu Gln Asn Gly Pro Val Ile
Leu465 470 475 480Gln Glu Cys Lys Thr Thr485224DNAArtificial
SequenceOligonucleotide Forward Primer 2cggctcgagt gagctacatg agat
24324DNAArtificial SequenceOligonucleotide Reverse Primer
3gggctcgagt aatcaccaag caaa 24420DNAArtificial
SequenceOligonucleotide Primer 4ccaggaggag ttaccctgaa
20520DNAArtificial SequenceOligonucleotide Primer 5tcaatcaatt
gcatgggtct 20620DNAArtificial SequenceOligonucleotide Primer
6cgaggacagc ccagagacta 20
* * * * *