U.S. patent application number 11/879143 was filed with the patent office on 2008-07-10 for microorganisms and processes for enhanced production of pantothenate.
This patent application is currently assigned to BASF Aktiengesellschaft. Invention is credited to Theron Hermann, Thomas A. Patterson, Janice G. Pero, R. Rogers Yocum.
Application Number | 20080166777 11/879143 |
Document ID | / |
Family ID | 27401561 |
Filed Date | 2008-07-10 |
United States Patent
Application |
20080166777 |
Kind Code |
A1 |
Yocum; R. Rogers ; et
al. |
July 10, 2008 |
Microorganisms and processes for enhanced production of
pantothenate
Abstract
The present invention features improved methods for the enhanced
production of pantoate and pantothenate utilizing microorganisms
having modified pantothenate biosynthetic enzyme activities and
having modified methylenetetrahydrofolate (MTF) biosynthetic enzyme
activities. In particular, the invention features methods for
enhancing production of desired products by increasing levels of a
key intermediate, ketopantoate by enzymes that contribute to its
synthesis. Recombinant microorganisms and conditions for culturing
same are also are featured. Also featured are compositions produced
by such microorganisms.
Inventors: |
Yocum; R. Rogers;
(Lexington, MA) ; Patterson; Thomas A.; (North
Attleboro, MA) ; Pero; Janice G.; (Lexington, MA)
; Hermann; Theron; (Kinnelon, NJ) |
Correspondence
Address: |
LAHIVE & COCKFIELD, LLP
ONE POST OFFICE SQUARE
BOSTON
MA
02109-2127
US
|
Assignee: |
BASF Aktiengesellschaft
Ludwigshafen
DE
|
Family ID: |
27401561 |
Appl. No.: |
11/879143 |
Filed: |
July 16, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10466641 |
Jul 18, 2003 |
7244593 |
|
|
PCT/US02/00925 |
Jan 18, 2002 |
|
|
|
11879143 |
|
|
|
|
60263053 |
Jan 19, 2001 |
|
|
|
60262995 |
Jan 19, 2001 |
|
|
|
60347638 |
Jan 11, 2002 |
|
|
|
Current U.S.
Class: |
435/129 ;
435/252.3; 435/252.31; 562/555 |
Current CPC
Class: |
C12Y 401/01011 20130101;
C12Y 201/02011 20130101; C12N 9/88 20130101; C12N 9/1022 20130101;
C12P 13/02 20130101; C12N 9/1014 20130101; C12N 9/0006 20130101;
C12Y 603/02001 20130101; C12N 9/93 20130101 |
Class at
Publication: |
435/129 ;
562/555; 435/252.3; 435/252.31 |
International
Class: |
C12P 13/02 20060101
C12P013/02; C07C 261/00 20060101 C07C261/00; C12N 1/20 20060101
C12N001/20 |
Claims
1. A process for the enhanced production of pantothenate,
comprising culturing a microorganism having a deregulated
methylenetetrahydrofolate (MTF) biosynthetic pathway, under
conditions such that pantothenate production is enhanced.
2. A process for the enhanced production of pantothenate,
comprising culturing a microorganism having (i) a deregulated
pantothenate biosynthetic pathway, and (ii) a deregulated
methylenetetrahydrofolate (MTF) biosynthetic pathway, under
conditions such that pantothenate production is enhanced.
3. The process of claim 2, wherein said microorganism has at least
two pantothenate biosynthetic enzymes deregulated.
4. The process of claim 2, wherein said microorganism has at least
three pantothenate biosynthetic enzymes deregulated.
4. The process of claim 2, wherein said microorganism has at least
four pantothenate biosynthetic enzymes deregulated.
6. The process of claim 5, wherein said microorganism has a
deregulated ketopantoate hydroxymethyltransferase, a deregulated
ketopantoate reductase, a deregulated pantothenate synthetase and a
deregulated aspartate-.alpha.-decarboxylase.
7. The process of any one of claims 1 to 6, wherein said
microorganism further has a deregulated isoleucine-valine (ilv)
biosynthetic pathway.
8. The process of claim 7, wherein said microorganism has at least
two isoleucine-valine (ilv) biosynthetic enzymes deregulated.
9. The process of claim 7, wherein said microorganism has at least
three isoleucine-valine (ilv) biosynthetic enzymes deregulated.
10. The process of claim 9, wherein said microorganism has a
deregulated acetohydroxyacid acid synthetase, a deregulated
acetohydroxyacid isomeroreductase, and a deregulated dihydroxyacid
dehydratase.
11. The process of any one of claims 1 to 10, wherein the
microorganism has at least one MTF biosynthetic enzyme
deregulated.
12. The process of claim 11, wherein the microorganism has a
deregulated glyA gene.
13. The process of claim 11, wherein the microorganism has a
deregulated serA gene.
14. The process of claim 11, wherein the microorganism has a
deregulated glyA gene and a deregulated serA gene.
15. A process for the enhanced production pantothenate, comprising
culturing a microorganism having a deregulated pantothenate
biosynthetic pathway, a deregulated isoleucine-valine (ilv)
biosynthetic pathway, and a deregulated methylenetetrahydrofolate
(MTF) biosynthetic pathway deregulated, such that production of
pantothenate is enhanced.
16. A process for the production pantothenate, comprising culturing
a microorganism having a deregulated pantothenate biosynthetic
pathway, a deregulated isoleucine-valine (ilv) biosynthetic
pathway, and a deregulated methylenetetrahydrofolate (MTF)
biosynthetic pathway deregulated, such that at least 50 g/L
pantothenate is produced after 36 hours of culturing the
microorganism.
17. The process of claim 16, comprising culturing the microorganism
such that at least 60 g/L pantothenate is produced after 36 hours
of culturing the microorganism.
18. The process of claim 16, comprising culturing the microorganism
such that at least 70 g/L pantothenate is produced after 36 hours
of culturing the microorganism.
19. A process for the production pantothenate, comprising culturing
a microorganism having a deregulated pantothenate biosynthetic
pathway, a deregulated isoleucine-valine (ilv) biosynthetic
pathway, and a deregulated methylenetetrahydrofolate (MTF)
biosynthetic pathway deregulated, such that at least 60 g/L
pantothenate is produced after 48 hours of culturing the
microorganism.
20. The process of claim 19, comprising culturing the microorganism
such that at least 70 g/L pantothenate is produced after 48 hours
of culturing the microorganism.
21. The process of claim 19, comprising culturing the microorganism
such that at least 80 g/L pantothenate is produced after 48 hours
of culturing the microorganism.
22. The process of any one of the preceding claims, wherein
pantothenate production is further enhanced by regulating
pantothenate kinase activity.
23. The process of claim 22, wherein pantothenate kinase activity
is decreased.
24. The process of claim 23, wherein CoaA is deleted and CoaX is
downregulated.
25. The process of claim 23, wherein CoaX is deleted and CoaA is
downregulated.
26. The process of claim 23, wherein CoaX and CoaA are
downregulated.
27. The process of any one of the above claims, wherein said
microorganism is cultured under conditions of excess serene.
28. A process for producing pantothenate comprising culturing a
microorganism having a deregulated pantothenate biosynthetic
pathway under conditions of excess serine, such that pantothenate
in produced.
29. The process of any one of the above claims, wherein said
microorganism has the pantothenate biosynthetic pathway deregulated
such that pantothenate production is independent of .beta.-alanine
feed.
30. The process of any one of the above claims wherein the
microorganism is a Gram positive microorganism.
31. The process of any one of the above claims wherein the
microorganism belongs to the genus Bacillus.
32. The process of any one of the above claims, wherein the
microorganism is Bacillus subtilis.
33. A product synthesized according to the process of any one of
the above claims.
34. A composition comprising pantothenate produced according to the
process of any one of the above claims.
35. A recombinant microorganism for the enhanced production of
pantothenate, said microorganism having a deregulated pantothenate
biosynthetic pathway, and a deregulated methylenetetrahydrofolate
(MTF) biosynthetic pathway.
36. A recombinant microorganism for the enhanced production of
pantothenate, said microorganism having a deregulated pantothenate
biosynthetic pathway, a deregulated methylenetetrahydrofolate (MTF)
biosynthetic pathway, and a deregulated isoleucine-valine (ilv)
pathway.
37. The microorganism of claim 35 or 36, further having reduced
pantothenate kinase activity.
38. The microorganism of any one of claims 35-37 which is a Gram
positive microorganism.
39. The microorganism of any one of claims 35-37 belonging to the
genus Bacillus.
40. The microorganism of any one of claims 35-37 which is Bacillus
subtilis.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of prior-filed
provisional Patent Application Ser. No. 60/______, entitled
"Microorganisms and Processes for Enhanced Production of
Pantothenate", filed Jan. 11, 2002 (pending), to prior-filed
provisional Patent Application Ser. No. 60/263,053, filed Jan. 19,
2001 (pending), and to prior-filed provisional Patent Application
Ser. No. 60/262,995, filed Jan. 19, 2001 (pending). The present
invention is also related to U.S. patent application Ser. No.
09/667,569, filed Sep. 21, 2000 (pending), which is a
continuation-in-part of U.S. patent application Ser. No.
09/400,494, filed Sep. 21, 1999 (abandoned). U.S. patent
application Ser. No. 09/667,569 also claims the benefit of
prior-filed provisional Patent Application Ser. No. 60/210,072,
filed Jun. 7, 2000 (expired), provisional Patent Application Ser.
No. 60/221,836, filed Jul. 28, 2000 (expired), and provisional
Patent Application Ser. No. 60/227,860, filed Aug. 24, 2000
(expired). The entire content of each of the above-referenced
applications is incorporated herein by this reference.
BACKGROUND OF THE INVENTION
[0002] Pantothenate, also known as pantothenic acid or vitamin B5,
is a member of the B complex of vitamins and is a nutritional
requirement for mammals, including livestock and humans (e.g., from
food sources, as a water soluble vitamin supplement or as a feed
additive). In cells, pantothenate is used primarily for the
biosynthesis of coenzyme A (CoA) and acyl carrier protein (ACP).
These coenzymes function in the metabolism of acyl moieties which
form thioesters with the sulfhydryl group of the
4'-phosphopantetheine portion of these molecules. These coenzymes
are essential in all cells, participating in over 100 different
intermediary reactions in cellular metabolism.
[0003] The conventional means of synthesizing pantothenate (in
particular, the bioactive D isomer) is via chemical synthesis from
bulk chemicals, a process which is hampered by excessive substrate
cost as well as the requirement for optical resolution of racemic
intermediates. Accordingly, researchers have recently looked to
bacterial or microbial systems that produce enzymes useful in
pantothenate biosynthesis processes (as bacteria are themselves
capable of synthesizing pantothenate). In particular, bioconversion
processes have been evaluated as a means of favoring production of
the preferred isomer of pantothenic acid. Moreover, methods of
direct microbial synthesis have recently been examined as a means
of facilitating D-pantothenate production.
[0004] There is still, however, significant need for improved
pantothenate production processes, in particular, for microbial
processes optimized to produce higher yields of desired
product.
SUMMARY OF THE INVENTION
[0005] The present invention relates to improved processes (e.g.,
microbial syntheses) for the production of pantothenate.
Pantothenate production processes have been described in related
applications which feature, for example, microbes engineered to
overexpress key enzymes of the pantothenate biosynthetic pathway
and the isoleucine-valine biosynthetic pathway (see e.g., FIG. 1).
Strains have been engineered that are capable of producing >50
g/l of pantothenate in standard fermentation processes (see e.g.,
International Public. No. WO 01/21772 and U.S. Patent Application
No. 60/262,995). In particular, increasing the expression of the
panB, panC, panD and panE1 genes and increasing the expression of
the ilvBNC and ilvD genes results in strains that convert glucose
(pyruvate) to commercially attractive quantities of
pantothenate.
[0006] In order to enhance production levels of for example,
pantothenate, various improvements on the above-described methods
have now been developed. For example, U.S. patent application Ser.
No. 09/667,569 describes production strains having modified (e.g.,
deleted or decreased-activity) pantothenate kinase enzymes. In such
strains, the pantothenate levels are effectively increased by
decreasing utilization of pantothenate for coenzyme A ("CoA")
synthesis. U.S. Patent Application Ser. No. 60/262,995 further
describes improved pantothenate-productions strains that have been
engineered to minimize utilization of various pantothenate
biosynthetic enzymes and/or isoleucine-valine biosynthetic enzymes
and/or their respective substrates from being used to produce an
alternative product identified as HMBPA.
[0007] The present invention features methods to further enhance
pantothenate production by modulating a biosynthetic pathway that
supplies a substrate for the pantothenate biosynthetic pathway,
namely the methylenetetrahydrofolate ("MTF") biosynthetic pathway.
In particular, it has been discovered that increasing levels of MTF
by modification of the MTF biosynthetic pathway results in enhanced
levels of the key pantothenate biosynthetic pathway intermediate,
ketopantoate. Enhanced ketopantoate levels, in turn, result in
significantly enhanced pantothenate production levels in
appropriately engineered strains. In essence, the present inventors
have identified a limiting step in the production of
panto-compounds (e.g., pantothenate) by strains engineered to
overexpress, for example, the panB, panC, panD, panE1, ilvBNC and
ilvD genes, and describe herein a means for overcoming this
limitation by modification of the MTF biosynthetic pathway.
[0008] At least three effective means of modifying the MTF
biosynthetic pathway are described herein. In one aspect, it has
been demonstrated that increasing serine levels in the culture
medium of pantothenate-producing microorganisms results in enhanced
panto-compound production. It has also been demonstrated that
increasing the synthesis or activity of 3-phosphoglycerate
dehydrogenase (the serA gene product), or the synthesis or activity
of serine hydroxymethyl transferase (the glyA gene product),
thereby enhancing serine and methylenetetrahydrofolate biosynthesis
in appropriately engineered microorganisms, increases
panto-compound production.
[0009] Accordingly, in one aspect the invention features processes
for the enhanced production of pantoate and pantothenate that
involve culturing microorganisms having modified pantothenate
biosynthetic enzyme activities and having modified
methylenetetrahydrofolate (MTF) biosynthetic enzyme activities
under conditions such that pantothenate production is enhanced. In
another aspect the invention features processes for the enhanced
production of pantoate and pantothenate that involve culturing
microorganisms having modified pantothenate biosynthetic enzyme
activities, having modified isoleucine-valine (ilv) biosynthetic
enzymes, and having modified methylenetetrahydrofolate (MTF)
biosynthetic enzyme activities under conditions such that
pantothenate production is enhanced. In particular, the invention
features methods for enhancing production of desired products
(e.g., pantoate and/or pantothenate) by increasing the levels of a
key intermediate, ketopantoate, by enzymes that contribute to its
synthesis. Preferred methods result in production of pantothenate
at levels greater than 50, 60, 70 or more g/L after 36 hours of
culturing the microorganisms, or such that at least 60, 70, 80, 90
or more g/L pantothenate is produced after 36 hours of culturing
the microorganisms. Recombinant microorganisms and conditions for
culturing same are also are featured. Also featured are
compositions produced by such microorganisms.
[0010] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1 is a schematic representation of the pantothenate and
isoleucine-valine (ilv) biosynthetic pathways. Pantothenate
biosynthetic enzymes are depicted in bold and their corresponding
genes indicated in italics. Isoleucine-valine (ilv) biosynthetic
enzymes are depicted in bold italics and their corresponding genes
indicated in italics.
[0012] FIG. 2 is a schematic representation of the
methylenetetrahydrofolate ("MTF") biosynthetic pathway in E. coli
(and presumably in B. subtilis).
[0013] FIG. 3 is a schematic representation of the construction of
the plasmid pAN665.
[0014] FIG. 4 is a schematic representation of the construction of
the plasmid pAN670.
[0015] FIG. 5 is a schematic representation of the plasmid
pAN004.
[0016] FIG. 6 is a schematic representation of the plasmid
pAN396.
[0017] FIG. 7 is a schematic representation of the plasmid
pAN393.
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention is directed to improved methods for
producing panto-compounds (e.g., ketopantoate, pantoate and/or
pantothenate) and strains engineered for use in said improved
methods. Strains capable of producing >50 g/l of pantothenate
can be constructed as taught in International Patent Application
Serial No. WO 01/21772 and in U.S. Patent Application Ser. No.
60/262,995. By increasing the expression of the panB, panC, panD
and panE1 genes and by increasing the expression of the ilvBNC and
ilvD genes, one can design strains (e.g., Bacillus strains) that
convert glucose (pyruvate) to commercially attractive quantities of
pantothenate.
[0019] However, it has now been discovered that in strains
engineered to express high levels of the panB gene product,
ketopantoate hydroxymethyltransferase (e.g., PA824, described in
U.S. patent application Ser. No. 09/667,569 and PA668-24, described
in U.S. Patent Application Ser. No. 60/262,995), a limiting step
for further increases in the production of pantothenate is still
the conversion of .alpha.-ketoisovalerate (.alpha.-KIV) to
ketopantoate. Methods to increase the synthesis of .alpha.-KIV were
described previously in International Patent Application Serial No.
WO 01/21772 and U.S. Patent Application Ser. No. 60/262,995. Here
we disclose that even further increases in pantothenate production
can be achieved by engineering designed to increase the levels of
MTF, or the rate of MTF synthesis.
[0020] Accordingly, the present invention features modulating the
methylenetetrahydrofolate ("MTF") biosynthetic pathway. In
particular, increasing MTF levels in panto-compound producing
microbes is an effective means of enhancing ketopantoate
production, and in turn results in enhanced pantoate and/or
pantothenate production in appropriately-engineered recombinant
microorganisms.
[0021] Ketopantoate hydroxymethylenetransferase catalyzes the
production of ketopantoate from .alpha.-ketoisivalerate
(".alpha.-KIV") and MTF (see e.g., FIG. 1). In particular, the
enzyme catalyzes the transfer of a hydroxymethyl group from MTF to
.alpha.-KIV to yield ketopantoate. Both .alpha.-KIV and MTF are
substrates for this reaction, and their syntheses can be increased
in order to improve production of ketopantoate. The pathway for MTF
biosynthesis in E. coli (and presumably also Bacillus subtilis) is
outlined in FIG. 2. MTF is synthesized from tetrahydrofolate and
serine in a reaction catalyzed by the glyA gene that encodes serine
hydroxymethyl transferase. For improved MTF synthesis the cells
need increased quantities of both substrates and the product of the
glyA gene.
[0022] In one embodiment, the invention features processes for the
enhanced production of pantothenate that involve culturing a
microorganism having (i) a deregulated pantothenate biosynthetic
pathway (e.g., having one, two, three or four pantothenate
biosynthetic enzymes deregulated) and (ii) a deregulated
methylenetethrhydrofolate (MTF) biosynthetic pathway (e.g., having
at least one or two MTF biosynthetic enzymes deregulated), under
conditions such that pantothenate production is enhanced. Exemplary
pantothenate biosynthetic enzymes include ketopantoate
hydroxymethyltransferase, ketopantoate reductase, pantothenate
synthetase and aspartate-.alpha.-decarboxylase. Exemplary MTF
biosynthetic enzymes include the serA gene product and the glyA
gene product.
[0023] In another embodiment, the invention features processes for
the enhanced production of pantothenate that involve culturing a
microorganism having (i) a deregulated pantothenate biosynthetic
pathway (e.g., having one, two, three or four pantothenate
biosynthetic enzymes deregulated), (ii) a deregulated
isoleucine-valine (ilv) biosynthetic pathway (e.g., having one, two
or three ilv biosynthetic enzymes deregulated), and (iii) a
deregulated MTF biosynthetic pathway (e.g., having at least one or
two MTF biosynthetic enzymes deregulated), under conditions such
that pantothenate production is enhanced. Exemplary ilv
biosynthetic enzymes include acetohydroxyacid acid synthetase,
acetohydroxyacid isomeroreductase, and dihydroxyacid
dehydratase.
[0024] In another embodiment, the invention features processes for
the production of pantothenate that involve culturing a
microorganism having a deregulated pantothenate biosynthetic
pathway, a deregulated ilv biosynthetic pathway, and a deregulated
MTF biosynthetic pathway, deregulated such that at least 50 g/L
pantothenate is produced after 36 hours of culturing the
microorganism, preferably such that at least 60 g/L pantothenate is
produced after 36 hours of culturing the microorganism, and more
preferably such that at least 70 g/L pantothenate is produced after
36 hours of culturing the microorganism.
[0025] In another embodiment, the invention features processes for
the production of pantothenate that involve culturing a
microorganism having a deregulated pantothenate biosynthetic
pathway, a deregulated ilv biosynthetic pathway, and a deregulated
MTF biosynthetic pathway, deregulated such that at least 60 g/L
pantothenate is produced after 48 hours of culturing the
microorganism, preferably such that at least 70 g/L pantothenate is
produced after 48 hours of culturing the microorganism, and more
preferably such that at least 80 g/L pantothenate is produced after
48 hours of culturing the microorganism.
[0026] The invention further features methods as described above,
wherein pantothenate production is further enhanced by regulating
pantothenate kinase activity (e.g., wherein pantothenate kinase
activity is decreased). In one embodiment, CoaA is deleted and CoaX
is downregulated. In another embodiment, CoaX is deleted and CoaA
is downregulated. In yet another embodiment, CoaX and CoaA are
downregulated. The invention further features methods as described
above, wherein the microorganisms are cultured under conditions of
excess serine. The invention further features methods as described
above, wherein the microorganisms have the pantothenate
biosynthetic pathway deregulated such that pantothenate production
is independent of .beta.-alanine feed.
[0027] Products synthesized according to the processes of the
invention are also featured, as are compositions that include
pantothenate produced according to said processes. Recombinant
microorganisms for use in the processes of the invention are also
featured. In one embodiment, the invention features a recombinant
microorganism for the enhanced production of pantothenate having a
deregulated pantothenate biosynthetic pathway and a deregulated MTF
biosynthetic pathway. In another embodiment, the invention features
a recombinant microorganism for the enhanced production of
pantothenate having a deregulated pantothenate biosynthetic
pathway, a deregulated MTF biosynthetic pathway and a deregulated
ilv pathway. Microorganisms can further have reduced pantothenate
kinase activity. Preferred microorganisms belong to the genus
Bacillus, for example Bacillus subtilis.
[0028] As described above, certain aspects of the invention feature
processes for the enhanced production of panto-compounds (e.g.,
pantoate and/or pantothenate) that involve culturing microorganisms
having at least a deregulated pantothenate biosynthetic pathway.
The term "pantothenate biosynthetic pathway" includes the
biosynthetic pathway involving pantothenate biosynthetic enzymes
(e.g., polypeptides encoded by biosynthetic enzyme-encoding genes),
compounds (e.g., substrates, intermediates or products), cofactors
and the like utilized in the formation or synthesis of
pantothenate. The term "pantothenate biosynthetic pathway" includes
the biosynthetic pathway leading to the synthesis of pantothenate
in microorganisms (e.g., in vivo) as well as the biosynthetic
pathway leading to the synthesis of pantothenate in vitro.
[0029] As used herein, a microorganism "having a deregulated
pantothenate biosynthetic pathway" includes a microorganism having
at least one pantothenate biosynthetic enzyme deregulated (e.g.,
overexpressed) (both terms as defined herein) such that
pantothenate production is enhanced (e.g., as compared to
pantothenate production in said microorganism prior to deregulation
of said biosynthetic enzyme or as compared to a wild-type
microorganism). The term "pantothenate" includes the free acid form
of pantothenate, also referred to as "pantothenic acid" as well as
any salt thereof (e.g., derived by replacing the acidic hydrogen of
pantothenate or pantothenic acid with a cation, for example,
calcium, sodium, potassium, ammonium, magnesium), also referred to
as a "pantothenate salt". The term "pantothenate" also includes
alcohol derivatives of pantothenate. Preferred pantothenate salts
are calcium pantothenate or sodium pantothenate. A preferred
alcohol derivative is pantothenol. Pantothenate salts and/or
alcohols of the present invention include salts and/or alcohols
prepared via conventional methods from the free acids described
herein. In another embodiment, a pantothenate salt is synthesized
directly by a microorganism of the present invention. A
pantothenate salt of the present invention can likewise be
converted to a free acid form of pantothenate or pantothenic acid
by conventional methodology. The term "pantothenate" is also
abbreviated as "pan" herein.
[0030] Preferably, a microorganism "having a deregulated
pantothenate biosynthetic pathway" includes a microorganism having
at least one pantothenate biosynthetic enzyme deregulated (e.g.,
overexpressed) such that pantothenate production is 1 g/L or
greater. More preferably, a microorganism "having a deregulated
pantothenate biosynthetic pathway" includes a microorganism having
at least one pantothenate biosynthetic enzyme deregulated (e.g.,
overexpressed) such that pantothenate production is 2 g/L or
greater. Even more preferably, a microorganism "having a
deregulated pantothenate biosynthetic pathway" includes a
microorganism having at least one pantothenate biosynthetic enzyme
deregulated (e.g., overexpressed) such that pantothenate production
is 10 g/L, 20 g/L, 30 g/L, 40 g/L, 50 g/L, or greater.
[0031] The term "pantothenate biosynthetic enzyme" includes any
enzyme utilized in the formation of a compound (e.g., intermediate
or product) of the pantothenate biosynthetic pathway. For example,
synthesis of pantoate from .alpha.-ketoisovalerate (.alpha.-KIV)
proceeds via the intermediate, ketopantoate. Formation of
ketopantoate is catalyzed by the pantothenate biosynthetic enzyme
PanB or ketopantoate hydroxymethyltransferase (the panB gene
product). Formation of pantoate is catalyzed by the pantothenate
biosynthetic enzyme PanE1 or ketopantoate reductase (the panE1 gene
product). Synthesis of .beta.-alanine from aspartate is catalyzed
by the pantothenate biosynthetic enzyme PanD or
aspartate-.alpha.-decarboxylase (the panD gene product). Formation
of pantothenate from pantoate and .beta.-alanine (e.g.,
condensation) is catalyzed by the pantothenate biosynthetic enzyme
PanC or pantothenate synthetase (the panC gene product).
Pantothenate biosynthetic enzymes may also perform an alternative
function as enzymes in the HMBPA biosynthetic pathway described
herein.
[0032] Accordingly, in one embodiment, the invention features a
process for the enhanced production of pantothenate that includes
culturing a microorganism having at least one pantothenate
biosynthetic enzyme deregulated (e.g., deregulated such that
pantothenate production is enhanced), said enzyme being selected,
for example, from the group consisting of PanB (or ketopantoate
hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD
(or aspartate-.alpha.-decarboxylase), PanE1 (or ketopantoate
reductase). In another embodiment, the invention features a process
for the enhanced production of pantothenate that includes culturing
a microorganism having at least two pantothenate biosynthetic
enzymes deregulated, said enzymes being selected, for example, from
the group consisting of PanB (or ketopantoate
hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD
(or aspartate-.alpha.-decarboxylase), and PanE1 (or ketopantoate
reductase). In another embodiment, the invention features a process
for the enhanced production of pantothenate that includes culturing
a microorganism having at least three pantothenate biosynthetic
enzymes deregulated, said enzymes being selected, for example, from
the group consisting of PanB (or ketopantoate
hydroxymethyltransferase), PanC (or pantothenate synthetase), PanD
(or aspartate-.alpha.-decarboxylase), and PanE1 (or ketopantoate
reductase). In another embodiment, the invention features a process
for the enhanced production of pantothenate that includes culturing
a microorganism having at least four pantothenate biosynthetic
enzymes deregulated, for example, a microorganism having PanB (or
ketopantoate hydroxymethyltransferase), PanC (or pantothenate
synthetase), PanD (or aspartate-.alpha.-decarboxylase), and PanE1
(or ketopantoate reductase) deregulated.
[0033] In another aspect, the invention features processes for the
enhanced production of pantothenate that involve culturing
microorganisms having a deregulated isoleucine-valine biosynthetic
pathway. The term "isoleucine-valine biosynthetic pathway" includes
the biosynthetic pathway involving isoleucine-valine biosynthetic
enzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding
genes), compounds (e.g., substrates, intermediates or products),
cofactors and the like utilized in the formation or synthesis of
conversion of pyruvate to valine or isoleucine. The term
"isoleucine-valine biosynthetic pathway" includes the biosynthetic
pathway leading to the synthesis of valine or isoleucine in
microorganisms (e.g., in vivo) as well as the biosynthetic pathway
leading to the synthesis of valine or isoleucine in vitro.
[0034] As used herein, a microorganism "having a deregulated
isoleucine-valine (ilv) pathway" includes a microorganism having at
least one isoleucine-valine (ilv) biosynthetic enzyme deregulated
(e.g., overexpressed) (both terms as defined herein) such that
isoleucine and/or valine and/or the valine precursor,
.alpha.-ketoisovaerate (.alpha.-KIV) production is enhanced (e.g.,
as compared to isoleucine and/or valine and/or .alpha.-KIV
production in said microorganism prior to deregulation of said
biosynthetic enzyme or as compared to a wild-type microorganism).
FIG. 1 includes a schematic representation of the isoleucine-valine
biosynthetic pathway. Isoleucine-valine biosynthetic enzymes are
depicted in bold italics and their corresponding genes indicated in
italics. The term "isoleucine-valine biosynthetic enzyme" includes
any enzyme utilized in the formation of a compound (e.g.,
intermediate or product) of the isoleucine-valine biosynthetic
pathway. According to FIG. 1, synthesis of valine from pyruvate
proceeds via the intermediates, acetolactate,
.alpha.,.beta.-dihydroxyisovalerate (.alpha.,.beta.-DHIV) and
.alpha.-ketoisovalerate (.alpha.-KIV). Formation of acetolactate
from pyruvate is catalyzed by the isoleucine-valine biosynthetic
enzyme acetohydroxyacid synthetase (the ilvBN gene products, or
alternatively, the alsS gene product). Formation of
.alpha.,.beta.-DHIV from acetolactate is catalyzed by the
isoleucine-valine biosynthetic enzyme acetohydroxyacid
isomeroreductase (the ilvC gene product). Synthesis of .alpha.-KIV
from .alpha.,.beta.-DHIV is catalyzed by the isoleucine-valine
biosynthetic enzyme dihydroxyacid dehydratase (the ilvD gene
product). Moreover, valine and isoleucine can be interconverted
with their respective .alpha.-keto compounds by branched chain
amino acid transaminases. Isoleucine-valine biosynthetic enzymes
may also perform an alternative function as enzymes in the HMBPA
biosynthetic pathway described herein.
[0035] Accordingly, in one embodiment, the invention features a
process for the enhanced production of pantothenate that includes
culturing a microorganism having at least one isoleucine-valine
(ilv) biosynthetic enzyme deregulated (e.g. deregulated such that
valine and/or isoleucine and/or .alpha.-KIV production is
enhanced), said enzyme being selected, for example, from the group
consisting of IlvBN, AlsS (or acetohydroxyacid synthetase), IlvC
(or acetohydroxyacid isomeroreductase) and IlvD (or dihydroxyacid
dehydratase). In another embodiment, the invention features a
process for the enhanced production of pantothenate that includes
culturing a microorganism having at least two isoleucine-valine
(ilv) biosynthetic enzymes deregulated, said enzyme being selected,
for example, from the group consisting of IvBN, AlsS (or
acetohydroxyacid synthetase), IlvC (or acetohydroxyacid
isomeroreductase) and IlvD (or dihydroxyacid dehydratase). In
another embodiment, the invention features a process for the
enhanced production of pantothenate that includes culturing a
microorganism having at least three isoleucine-valine (ilv)
biosynthetic enzymes deregulated, for example, said microorganism
having IlvBN or AlsS (or acetohydroxyacid synthetase), IlvC (or
acetohydroxyacid isomeroreductase) and IlvD (or dihydroxyacid
dehydratase) deregulated.
[0036] As mentioned herein, enzymes of the pantothenate
biosynthetic pathway and/or the isoleucine-valine (ilv) pathway
have been discovered to have an alternative activity in the
synthesis of [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid
("HMBPA") or the [R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic
acid ("HMBPA") biosynthetic pathway. The term
"[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid ("HMBPA")
biosynthetic pathway" includes the alternative biosynthetic pathway
involving biosynthetic enzymes and compounds (e.g., substrates and
the like) traditionally associated with the pantothenate
biosynthetic pathway and/or isoleucine-valine (ilv) biosynthetic
pathway utilized in the formation or synthesis of HMBPA. The term
"HMBPA biosynthetic pathway" includes the biosynthetic pathway
leading to the synthesis of HMBPA in microorganisms (e.g., in vivo)
as well as the biosynthetic pathway leading to the synthesis of
HMBPA in vitro.
[0037] The term "HMBPA biosynthetic enzyme" includes any enzyme
utilized in the formation of a compound (e.g., intermediate or
product) of the HMBPA biosynthetic pathway. For example, synthesis
of 2-hydroxyisovaleric acid (.alpha.-HIV) from
.alpha.-ketoisovalerate (.alpha.-KIV) is catalyzed by the panE1 or
panE2 gene product (PanE1 is alternatively referred to herein as
ketopantoate reductase) and/or is catalyzed by the ilvC gene
product (alternatively referred to herein as acetohydroxyacid
isomeroreductase). Formation of HMBPA from .beta.-alanine and
.alpha.-HIV is catalyzed by the panC gene product (alternatively
referred to herein as pantothenate synthetase).
[0038] The term "[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionic
acid ("HMBPA")" includes the free acid form of HMBPA, also referred
to as "[R]-3-(2-hydroxy-3-methyl-butyrylamino)-propionate" as well
as any salt thereof (e.g., derived by replacing the acidic hydrogen
of 3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or
3-(2-hydroxy-3-methyl-butyrylamino)-propionate with a cation, for
example, calcium, sodium, potassium, ammonium, magnesium), also
referred to as a "3-(2-hydroxy-3-methyl-butyrylamino)-propionic
acid salt" or "HMBPA salt". Preferred HMBPA salts are calcium HMBPA
or sodium HMBPA. HMBPA salts of the present invention include salts
prepared via conventional methods from the free acids described
herein. An HMBPA salt of the present invention can likewise be
converted to a free acid form of
3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid or
3-(2-hydroxy-3-methyl-butyrylamino)-propionate by conventional
methodology.
[0039] In preferred embodiments, the invention features processes
for the enhanced production of panto-compounds (e.g., pantoate
and/or pantothenate) that involve culturing a microorganism having
a deregulated methylenetetrahydrofolate (MTF) biosynthetic pathway.
The term "methylenetetrahydrofolate (MTF) biosynthetic pathway"
refers to the biosynthetic pathway involving MTF biosynthetic
enzymes (e.g., polypeptides encoded by biosynthetic enzyme-encoding
genes), compounds (e.g., substrates, intermediates or products),
cofactors and the like utilized in the formation or synthesis of
the PanB substrate, MTF. The term "methylenetetrahydrofolate (MTF)
biosynthetic pathway" refers to the biosynthetic pathway leading to
the synthesis of MTF in vivo (e.g., the pathway in E. coli, as
depicted in FIG. 2) as well as the biosynthetic pathway leading to
the synthesis of MTF in vitro. The term "methylenetetrahydrofolate
(MTF) biosynthetic enzyme" includes any enzyme utilized in the
formation of a compound (e.g., intermediate or product) of the
methylenetetrahydrofolate (MTF) biosynthetic pathway.
[0040] The present invention is based, at least in part, on the
discovery that deregulation of certain MTF biosynthetic enzymes
results in enhanced production of MTF. A MTF biosynthetic enzyme,
the deregulation of which results in enhanced MTF production, is
termed a "MTF biosynthesis-enhancing enzyme". Exemplary "MTF
biosynthesis-enhancing enzymes" are the serA gene product
(3-phosphoglycerate dehydrogenase) and the glyA gene product
(serine hydroxymethyl transferase). A microorganism "having a
deregulated methylenetetrahydrofolate (MTF) biosynthetic pathway",
is a microorganism having at least one MTF biosynthesis-enhancing
enzyme deregulated (e.g., overexpressed) such that MTF production
or biosynthesis is enhanced (e.g., as compared to MTF production in
said microorganism prior to deregulation of said biosynthetic
enzyme or as compared to a wild-type microorganism).
[0041] In one embodiment, the invention features a process for the
enhanced production of panto-compounds (e.g., pantoate and/or
pantothenate) that includes culturing a microorganism having a
deregulated "methylenetetrahydrofolate (MTF) biosynthetic pathway",
as defined herein. In another embodiment, the invention features a
process for the enhanced production of panto-compounds (e.g.,
pantoate and/or pantothenate) that includes culturing a
microorganism having a deregulated MTF biosynthesis-enhancing
enzyme. In preferred embodiments, the invention features processes
for the enhanced production of panto-compounds (e.g. pantoate
and/or pantothenate) that includes culturing a microorganism having
a deregulated glyA gene product (serine hydroxymethyl transferase)
and/or a deregulated serA gene product (3-phosphoglycerate
dehydrogenase).
[0042] Yet another aspect of the present invention features
processes for the enhanced production of pantothenate that include
culturing microorganisms under culture conditions selected to favor
pantothenate production, for example, by culturing microorganisms
with excess serine (a glyA substrate) in the medium. The term
"excess serine" includes serine levels increased or higher that
those routinely utilized for culturing the microorganism in
question. For example, culturing the Bacillus microorganisms
described in the instant Examples is routinely done in the presence
of about 0-2.5 g/L serine. Accordingly, excess serine levels can
include levels of greater than 2.5 g/L serine, for example, between
about 2.5 and 10 g/L serine. Excess serine levels can include
levels of greater than 5 g/L serine, for example, between about 5
and 10 g/L serine.
[0043] Yet another aspect of the present invention features
culturing the microorganisms described herein under conditions such
that pantothenate production is further increased, for example, by
increasing pantothenate and/or isoleucine-valine (ilv) biosynthetic
pathway precursors and/or intermediates as defined herein (e.g.,
culturing microorganisms in the presence of excess .beta.-alanine,
valine and/or .alpha.-KIV) or, alternatively, further modifying
said microorganisms such that they are capable of producing
significant levels of .beta.-alanine in the absence of a
.beta.-alanine feed (i.e., .beta.-alanine independent
microorganisms, as described in U.S. patent application Ser. No.
09/09/667,569).
[0044] Yet another aspect of the invention features further
regulating pantothenate kinase activity in pantothenate-producing
strains such that pantothenate production is enhanced. Pantothenate
kinase is a key enzyme catalyzing the formation of Coenzyme A (CoA)
from pantothenate (see e.g., U.S. patent application Ser. No.
09/09/667,569). Regulation of pantothenate kinase (e.g., decreasing
the activity or level of pantothenate kinase) reduces the
production of CoA, favoring pantothenate accumulation. In one
embodiment, pantothenate kinase activity is decreased by deleting
CoaA and downregulating CoaX activity (CoaA and CoaX are both
capable of catalyzing the first step in CoA biosynthesis in certain
microorganisms). In another embodiment, pantothenate kinase
activity is decreased by deleting CoaX and downregulating CoaA. In
yet another embodiment, pantothenate kinase activity is decreased
by downregulating CoaA and CoaX activities.
[0045] Various aspects of the invention are described in further
detail in the following subsections.
[0046] I. Targeting Genes Encoding Various Pantothenate and/or
Isoleucine-Valine (ilv) and/or Methylenetetrahydtofolate (MTF)
Biosynthetic Enzymes
[0047] In one embodiment, the present invention features modifying
or increasing the level of various biosynthetic enzymes of the
pantothenate and/or isoleucine-valine (ilv) and/or
methylenetetrahydtofolate (MTF) biosynthetic pathways. In
particular, the invention features modifying various enzymatic
activities associated with said pathways by modifying or altering
the genes encoding said biosynthetic enzymes.
[0048] The term "gene", as used herein, includes a nucleic acid
molecule (e.g., a DNA molecule or segment thereof) that, in an
organism, can be separated from another gene or other genes, by
intergenic DNA (i.e., intervening or spacer DNA which naturally
flanks the gene and/or separates genes in the chromosomal DNA of
the organism). Alternatively, a gene may slightly overlap another
gene (e.g., the 3' end of a first gene overlapping the 5' end of a
second gene), the overlapping genes separated from other genes by
intergenic DNA. A gene may direct synthesis of an enzyme or other
protein molecule (e.g., may comprise coding sequences, for example,
a contiguous open reading frame (ORF) which encodes a protein) or
may itself be functional in the organism. A gene in an organism,
may be clustered in an operon, as defined herein, said operon being
separated from other genes and/or operons by the intergenic. DNA.
An "isolated gene", as used herein, includes a gene which is
essentially free of sequences which naturally flank the gene in the
chromosomal DNA of the organism from which the gene is derived
(i.e., is free of adjacent coding sequences that encode a second or
distinct protein, adjacent structural sequences or the like) and
optionally includes 5' and 3' regulatory sequences, for example
promoter sequences and/or terminator sequences. In one embodiment,
an isolated gene includes predominantly coding sequences for a
protein e.g., sequences which encode Bacillus proteins). In another
embodiment, an isolated gene includes coding sequences for a
protein (e.g., for a Bacillus protein) and adjacent 5' and/or
3'-regulatory sequences from the chromosomal DNA of the organism
from which the gene is derived (e.g., adjacent 5' and/or 3'
Bacillus regulatory sequences). Preferably, an isolated gene
contains less than about 10 kb, 5 kb, 2 kb, 1 kb, 0.5 kb, 0.2 kb,
0.1 kb, 50 bp, 25 bp or 10 bp of nucleotide sequences which
naturally flank the gene in the chromosomal DNA of the organism
from which the gene is derived.
[0049] The term "operon" includes at least two adjacent genes or
ORFs, optionally overlapping in sequence at either the 5' or 3' end
of at least one gene or ORF. The term "operon" includes a
coordinated unit of gene expression that contains a promoter and
possibly a regulatory element associated with one or more adjacent
genes or ORFs (e.g., structural genes encoding enzymes, for
example, biosynthetic enzymes). Expression of the genes (e.g.,
structural genes) can be coordinately regulated, for example, by
regulatory proteins binding to the regulatory element or by
anti-termination of transcription. The genes of an operon (e.g.,
structural genes) can be transcribed to give a single mRNA that
encodes all of the proteins.
[0050] A "gene having a mutation" or "mutant gene" as used herein,
includes a gene having a nucleotide sequence which includes at
least one alteration (e.g., substitution, insertion, deletion) such
that the polypeptide or protein encoded by said mutant exhibits an
activity that differs from the polypeptide or protein encoded by
the wild-type nucleic acid molecule or gene. In one embodiment, a
gene having a mutation or mutant gene encodes a polypeptide or
protein having an increased activity as compared to the polypeptide
or protein encoded by the wild-type gene, for example, when assayed
under similar conditions (e.g., assayed in microorganisms cultured
at the same temperature). As used herein, an "increased activity"
or "increased enzymatic activity" is one that is at least 5%
greater than that of the polypeptide or protein encoded by the
wild-type nucleic acid molecule or gene, preferably at least 5-10%
greater, more preferably at least 10-25% greater and even more
preferably at least 25-50%, 50-75% or 75-100% greater than that of
the polypeptide or protein encoded by the wild-type nucleic acid
molecule or gene. Ranges intermediate to the above-recited values,
e.g. 75-85%, 85-90%, 90-95%, are also intended to be encompassed by
the present invention. As used herein, an "increased activity" or
"increased enzymatic activity" can also include an activity that is
at least 1.25-fold greater than the activity of the polypeptide or
protein encoded by the wild-type gene, preferably at least 1.5-fold
greater, more preferably at least 2-fold greater and even more
preferably at least 3-fold, 4-fold, 5-fold, 10-fold, 20-fold,
50-fold, 100-fold greater than the activity of the polypeptide or
protein encoded by the wild-type gene.
[0051] In another embodiment, a gene having a mutation or mutant
gene encodes a polypeptide or protein having a reduced activity as
compared to the polypeptide or protein encoded by the wild-type
gene, for example, when assayed under similar conditions (e.g.,
assayed in microorganisms cultured at the same temperature). A
mutant gene also can encode no polypeptide or have a reduced level
of production of the wild-type polypeptide. As used herein, a
"reduced activity" or "reduced enzymatic activity" is one that is
at least 5% less than that of the polypeptide or protein encoded by
the wild-type nucleic acid molecule or gene, preferably at least
5-10% less, more preferably at least 10-25% less and even more
preferably at least 25-50%, 50-75% or 75-100% less than that of the
polypeptide or protein encoded by the wild-type nucleic acid
molecule or gene. Ranges intermediate to the above-recited values,
e.g., 75-85%, 85-90%, 90-95%, "reduced activity" or "reduced
enzymatic activity" can also include an activity that has been
deleted or "knocked out" (e.g., approximately 100% less activity
than that of the polypeptide or protein encoded by the wild-type
nucleic acid molecule or gene).
[0052] Activity can be determined according to any well accepted
assay for measuring activity of a particular protein of interest.
Activity can be measured or assayed directly, for example,
measuring an activity of a protein in a crude cell extract or
isolated or purified from a cell or microorganism. Alternatively,
an activity can be measured or assayed within a cell or
microorganism or in an extracellular medium. For example, assaying
for a mutant gene (i.e., said mutant encoding a reduced enzymatic
activity) can be accomplished by expressing the mutated gene in a
microorganism, for example, a mutant microorganism in which the
enzyme is a temperature-sensitive, and assaying the mutant gene for
the ability to complement a temperature sensitive (Ts) mutant for
enzymatic activity. A mutant gene that encodes an "increased
enzymatic activity" can be one that complements the Ts mutant more
effectively than, for example, a corresponding wild-type gene. A
mutant gene that encodes a "reduced enzymatic activity" is one that
complements the Ts mutant less effectively than, for example, a
corresponding wild-type gene.
[0053] It will be appreciated by the skilled artisan that even a
single substitution in a nucleic acid or gene sequence (e.g., a
base substitution that encodes an amino acid change in the
corresponding amino acid sequence) can dramatically affect the
activity of an encoded polypeptide or protein as compared to the
corresponding wild-type polypeptide or protein. A mutant gene
(e.g., encoding a mutant polypeptide or protein), as defined
herein, is readily distinguishable from a nucleic acid or gene
encoding a protein homologue in that a mutant gene encodes a
protein or polypeptide having an altered activity, optionally
observable as a different or distinct phenotype in a microorganism
expressing said mutant gene or producing said mutant protein or
polypeptide (i.e., a mutant microorganism) as compared to a
corresponding microorganism expressing the wild-type gene. By
contrast, a protein homologue can have an identical or
substantially similar activity, optionally phenotypically
indiscernible when produced in a microorganism, as compared to a
corresponding microorganism expressing the wild-type gene.
Accordingly it is not, for example, the degree of sequence identity
between nucleic acid molecules, genes, protein or polypeptides that
serves to distinguish between homologues and mutants, rather it is
the activity of the encoded protein or polypeptide that
distinguishes between homologues and mutants: homologues having,
for example, low (e.g., 30-50% sequence identity) sequence identity
yet having substantially equivalent functional activities, and
mutants, for example sharing 99% sequence identity yet having
dramatically different or altered functional activities.
[0054] It will also be appreciated by the skilled artisan that
nucleic acid molecules, genes, protein or polypeptides for use in
the instant invention can be derived from any microorganisms having
a MTF biosynthetic pathway, an ilv biosynthetic pathway or a
pantothenate biosynthetic pathway. Such nucleic acid molecules,
genes, protein or polypeptides can be identified by the skilled
artisan using known techniques such as homology screening, sequence
comparison and the like, and can be modified by the skilled artisan
in such a way that expression or production of these nucleic acid
molecules, genes, protein or polypeptides occurs in a recombinant
microorganism (e.g., by using appropriate promoters, ribosomal
binding sites, expression or integration vectors, modifying the
sequence of the genes such that the transcription is increased
(taking into account the preferable codon usage), etc., according
to techniques described herein and those known in the art).
[0055] In one embodiment, the genes of the present invention are
derived from a Gram positive microorganism organism (e.g., a
microorganism which retains basic dye, for example, crystal violet,
due to the presence of a Gram-positive wall surrounding the
microorganism). The term "derived from" (e.g., "derived from" a
Gram positive microorganism) refers to a gene which is naturally
found in the microorganism (e.g., is naturally found in a Gram
positive microorganism). In a preferred embodiment, the genes of
the present invention are derived from a microorganism belonging to
a genus selected from the group consisting of Bacillus,
Cornyebacterium (e.g., Cornyebacterium glutamicum), Lactobacillus,
Lactococci and Streptomyces. In a more preferred embodiment, the
genes of the present invention are derived from a microorganism is
of the genus Bacillus. In another preferred embodiment, the genes
of the present invention are derived from a microorganism selected
from the group consisting of Bacillus subtilis, Bacillus
lentimorbus, Bacillus lentus, Bacillus firmus, Bacillus
pantothenticus, Bacillus amyloliquefaciens, Bacillus cereus,
Bacillus circulans, Bacillus coagulans, Bacillus licheniformis,
Bacillus megaterium, Bacillus pumilus, Bacillus thuringiensis,
Bacillus halodurans, and other Group 1 Bacillus species, for
example, as characterized by 16S rRNA type. In another preferred
embodiment, the gene is derived from Bacillus brevis or Bacillus
stearothermophilus. In another preferred embodiment, the genes of
the present invention are derived from a microorganism selected
from the group consisting of Bacillus licheniformis, Bacillus
amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus. In a
particularly preferred embodiment, the gene is derived from
Bacillus subtilis (e.g., is Bacillus subtilis-derived). The term
"derived from Bacillus subtilis" or "Bacillus subtilis-derived"
includes a gene which is naturally found in the microorganism
Bacillus subtilis. Included within the scope of the present
invention are Bacillus-derived genes (e.g., B. subtilis-derived
genes), for example, Bacillus or B. subtilis coax genes, serA
genes, glyA genes, coaA genes, pan genes and/or ilv genes.
[0056] In another embodiment, the genes of the present invention
are derived from a Gram negative (excludes basic dye)
microorganism. In a preferred embodiment, the genes of the present
invention are derived from a microorganism belonging to a genus
selected from the group consisting of Salmonella (e.g., Salmonella
typhimurium), Escherichia, Klebsiella, Serratia, and Proteus. In a
more preferred embodiment, the genes of the present invention are
derived from a microorganism of the genus Escherichia. In an even
more preferred embodiment, the genes of the present invention are
derived from Escherichia coli. In another embodiment, the genes of
the present invention are derived from Saccharomyces (e.g.,
Saccharomyces cerevisiae).
[0057] II. Recombinant Nucleic Acid Molecules and Vectors
[0058] The present invention further features recombinant nucleic
acid molecules (e.g., recombinant DNA molecules) that include genes
described herein (e.g., isolated genes), preferably Bacillus genes,
more preferably Bacillus subtilis genes, even more preferably
Bacillus subtilis pantothenate biosynthetic genes and/or
isoleucine-valine (ilv) biosynthetic genes and/or
methylenetetrahydtofolate (MTF) biosynthetic genes. The term
"recombinant nucleic acid molecule" includes a nucleic acid
molecule (e.g., a DNA molecule) that has been altered, modified or
engineered such that it differs in nucleotide sequence from the
native or natural nucleic acid molecule from which the recombinant
nucleic acid molecule was derived (e.g., by addition, deletion or
substitution of one or more nucleotides). Preferably, a recombinant
nucleic acid molecule (e.g., a recombinant DNA molecule) includes
an isolated gene of the present invention operably linked to
regulatory sequences. The phrase "operably linked to regulatory
sequence(s)" means that the nucleotide sequence of the gene of
interest is linked to the regulatory sequence(s) in a manner which
allows for expression (e.g., enhanced, increased, constitutive,
basal, attenuated, decreased or repressed expression) of the gene,
preferably expression of a gene product encoded by the gene (e.g.,
when the recombinant nucleic acid molecule is included in a
recombinant vector, as defined herein, and is introduced into a
microorganism).
[0059] The term "regulatory sequence" includes nucleic acid
sequences which affect (e.g., modulate or regulate) expression of
other nucleic acid sequences (i.e., genes). In one embodiment, a
regulatory sequence is included in a recombinant nucleic acid
molecule in a similar or identical position and/or orientation
relative to a particular gene of interest as is observed for the
regulatory sequence and gene of interest as it appears in nature,
e.g., in a native position and/or orientation. For example, a gene
of interest can be included in a recombinant nucleic acid molecule
operably linked to a regulatory sequence which accompanies or is
adjacent to the gene of interest in the natural organism (e.g.,
operably linked to "native" regulatory sequences (e.g., to the
"native" promoter). Alternatively, a gene of interest can be
included in a recombinant nucleic acid molecule operably linked to
a regulatory sequence which accompanies or is adjacent to another
(e.g., a different) gene in the natural organism. Alternatively, a
gene of interest can be included in a recombinant nucleic acid
molecule operably linked to a regulatory sequence from another
organism. For example, regulatory sequences from other microbes
(e.g., other bacterial regulatory sequences, bacteriophage
regulatory sequences and the like) can be operably linked to a
particular gene of interest.
[0060] In one embodiment, a regulatory sequence is a non-native or
non-naturally-occurring sequence (e.g., a sequence which has been
modified, mutated, substituted, derivatized, deleted including
sequences which are chemically synthesized). Preferred regulatory
sequences include promoters, enhancers, termination signals,
anti-termination signals and other expression control elements
(e.g., sequences to which repressors or inducers bind and/or
binding sites for transcriptional and/or translational regulatory
proteins, for example, in the transcribed mRNA). Such regulatory
sequences are described, for example, in Sambrook, J., Fritsh, E.
F., and Maniatis, T. Molecular Cloning: a Laboratory Manual. 2nd,
ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989. Regulatory sequences include
those which direct constitutive expression of a nucleotide sequence
in a microorganism (e.g., constitutive promoters and strong
constitutive promoters), those which direct inducible expression of
a nucleotide sequence in a microorganism (e.g. inducible promoters,
for example, xylose inducible promoters) and those which attenuate
or repress expression of a nucleotide sequence in a microorganism
(e.g., attenuation signals or repressor sequences). It is also
within the scope of the present invention to regulate expression of
a gene of interest by removing or deleting regulatory sequences.
For example, sequences involved in the negative regulation of
transcription can be removed such that expression of a gene of
interest is enhanced.
[0061] In one embodiment, a recombinant nucleic acid molecule of
the present invention includes a nucleic acid sequence or gene that
encodes at least one bacterial gene product (e.g., a pantothenate
biosynthetic enzyme, an isoleucine-valine biosynthetic enzyme
and/or a methylenetetrahydtofolate (MTF) biosynthetic enzyme)
operably linked to a promoter or promoter sequence. Preferred
promoters of the present invention include Bacillus promoters
and/or bacteriophage promoters (e.g., bacteriophage which infect
Bacillus). In one embodiment, a promoter is a Bacillus promoter,
preferably a strong Bacillus promoter (e.g., a promoter associated
with a biochemical housekeeping gene in Bacillus or a promoter
associated with a glycolytic pathway gene in Bacillus). In another
embodiment, a promoter is a bacteriophage promoter. In a preferred
embodiment, the promoter is from the bacteriophage SP01. In a
particularly preferred embodiment, a promoter is selected from the
group consisting of P.sub.15, P.sub.26 or P.sub.veg, having for
example, the following respective sequences:
GCTATTGACGACAGCTATGGTTCACTGTCCACCAACCAAAACTGTGCTCAGT
ACCGCCAATATTTCTCCCTTGAGGGGTACAAAGAGGTGTCCCTAGAAGAGAT
CCACGCTGTGTAAAAATTTTACAAAAAGGTATTGACTTTCCCTACAGGGTGT
GTAATAATTTAATTACAGGCGGGGGCAACCCCGCCTGT (SEQ ID NO:1),
GCCTACCTAGCTTCCAAGAAAGATATCCTAACAGCACAAGAGCGGAAAGAT
GTTTTGTTCTACATCCAGAACAACCTCTGCTAAAATTCCTGAAAAATTTTGCA
AAAAGTTGTTGACTTTATCTACAAGGTGTGGTATAATAATCTTAACAACAGC AGGACGC (SEQ
ID NO:2), and GAGGAATCATAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAAC
GTTGATATAATTTAAAATTTTATTTGACAAAAATGGGCTCGTTGTACAATA
AATGTAGTGAGGTGGATGCAATG (SEQ ID NO:3). Additional preferred
promoters include tef (the translational elongation factor (TEF)
promoter) and pyc (the pyruvate carboxylase (PYC) promoter), which
promote high level expression in Bacillus (e.g., Bacillus
subtilis). Additional preferred promoters, for example, for use in
Gram positive microorganisms include, but are not limited to, amy
and SPO2 promoters. Additional preferred promoters, for example,
for use in Gram negative microorganisms include, but are not
limited to, cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacIQ,
T7, T5, T3, gal, trc, ara, SP6, .lamda.-PR or .lamda.-PL.
[0062] In another embodiment, a recombinant nucleic acid molecule
of the present invention includes a terminator sequence or
terminator sequences (e.g., transcription terminator sequences).
The term "terminator sequences" includes regulatory sequences that
serve to terminate transcription of mRNA. Terminator sequences (or
tandem transcription terminators) can further serve to stabilize
mRNA (e.g., by adding structure to mRNA), for examples against
nucleases.
[0063] In yet another embodiment, a recombinant nucleic acid
molecule of the present invention includes sequences that allow for
detection of the vector containing said sequences (i.e., detectable
and/or selectable markers), for example, genes that encode
antibiotic resistance sequences or that overcome auxotrophic
mutations, for example, trpC, drug markers, fluorescent markers,
and/or colorimetric markers (e.g., lacZ/.beta.-galactosidase). In
yet another embodiment, a recombinant nucleic acid molecule of the
present invention includes an artificial ribosome binding site
(RBS) or a sequence that gets transcribed into an artificial RBS.
The term "artificial ribosome binding site (RBS)" includes a site
within an mRNA molecule (e.g., coded within DNA) to which a
ribosome binds (e.g., to initiate translation) which differs from a
native RBS (e.g., a RBS found in a naturally-occurring gene) by at
least one nucleotide. Preferred artificial RBSs include about 5-6,
7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19-20, 21-22, 23-24, 25-26,
27-28, 29-30 or more nucleotides of which about 1-2, 3-4, 5-6, 7-8,
9-10, 11-12, 13-15 or more differ from the native RBS (e.g., the
native RBS of a gene of interest, for example, the native panB RBS
TAAACATGAGGAGGAGAAAACATG (SEQ ID NO:4) or the native panD RBS
ATTCGAGAAATGGAGAGAATATAATATG (SEQ ID NO:5)). Preferably,
nucleotides that differ are substituted such that they are
identical to one or more nucleotides of an ideal RBS when optimally
aligned for comparisons. Ideal RBSs include, but are not limited
to, AGAAAGGAGGTGA (SEQ ID NO:6), TTAAGAAAGGAGGTGANNNNATG (SEQ ID
NO:7), TTAGAAAGGAGGTGANNNNNATG (SEQ ID NO:8),
AGAAAGGAGGTGANNNNNNNATG (SEQ ID NO:9), and AGAAAGGAGGTGANNNNNNATG
(SEQ ID NO:10). Artificial RBSs can be used to replace the
naturally-occurring or native RBSs associated with a particular
gene. Artificial RBSs preferably increase translation of a
particular gene. Preferred artificial RBSs (e.g., RBSs for
increasing the translation of panB, for example, of B. subtilis
panB) include CCCTCTAGAAGGAGGAGAAAACATG (SEQ ID NO:11) and
CCCTCTAGAGGAGGAGAAAACATG (SEQ ID NO:12). Preferred artificial RBSs
(e.g., RBSs for increasing the translation of panD, for example, of
B. subtilis panD) include TTAGAAAGGAGGATTAAATATG (SEQ ID NO:13),
TTAGAAAGGAGGTTTAATTAATG (SEQ ID NO:14), TTAGAAAGGAGGTGATTTAAATG
(SEQ ID NO:15), TTAGAAAGGAGGTGTTTAAAATG (SEQ ID NO:16),
ATTCGAGAAAGGAGG TGAATATAATATG (SEQ ID NO:17),
ATTCGAGAAAGGAGGTGAATAATAATG (SEQ ID NO:18), and
ATTCGTAGAAAGGAGGTGAATTAATATG (SEQ ID NO:19).
[0064] The present invention further features vectors (e.g.,
recombinant vectors) that include nucleic acid molecules (e.g.,
genes or recombinant nucleic acid molecules comprising said genes)
as described herein. The term "recombinant vector" includes a
vector (e.g., plasmid, phage, phasmid, virus, cosmid or other
purified nucleic acid vector) that has been altered, modified or
engineered such that it contains greater, fewer or different
nucleic acid sequences than those included in the native or natural
nucleic acid molecule from which the recombinant vector was
derived. Preferably, the recombinant vector includes a biosynthetic
enzyme-encoding gene or recombinant nucleic acid molecule including
said gene, operably linked to regulatory sequences, for example,
promoter sequences, terminator sequences and/or artificial ribosome
binding sites (RBSs), as defined herein. In another embodiment, a
recombinant vector of the present invention includes sequences that
enhance replication in bacteria (e.g., replication-enhancing
sequences). In one embodiment, replication-enhancing sequences
function in E. coli. In another embodiment, replication-enhancing
sequences are derived from pBR322.
[0065] In yet another embodiment, a recombinant vector of the
present invention includes antibiotic resistance sequences. The
term "antibiotic resistance sequences" includes sequences which
promote or confer resistance to antibiotics on the host organism
(e.g., Bacillus). In one embodiment, the antibiotic resistance
sequences are selected from the group consisting of cat
(chloramphenicol resistance) sequences, tet (tetracycline
resistance) sequences, erg (erythromycin resistance) sequences, neo
(neomycin resistance) sequences, kan (kanamycin resistance)
sequences and spec (spectinomycin resistance) sequences.
Recombinant vectors of the present invention can further include
homologous recombination sequences (e.g., sequences designed to
allow recombination of the gene of interest into the chromosome of
the host organism). For example, bpi; vpr; or amyE sequences can be
used as homology targets for recombination into the host
chromosome. It will further be appreciated by one of skill in the
art that the design of a vector can be tailored depending on such
factors as the choice of microorganism to be genetically
engineered, the level of expression of gene product desired and the
like.
[0066] IV Recombinant Microorganisms
[0067] The present invention further features microorganisms, i.e.,
recombinant microorganisms, that include vectors or genes (e.g.,
wild-type and/or mutated genes) as described herein. As used
herein, the term "recombinant microorganism" includes a
microorganism (e.g., bacteria, yeast cell, fungal cell, etc.) that
has been genetically altered, modified or engineered (e.g.,
genetically engineered) such that it exhibits an altered, modified
or different genotype and/or phenotype (e.g., when the genetic
modification affects coding nucleic acid sequences of the
microorganism) as compared to the naturally-occurring microorganism
from which it was derived.
[0068] In one embodiment, a recombinant microorganism of the
present invention is a Gram positive organism (e.g., a
microorganism which retains basic dye, for example, crystal violet,
due to the presence of a Gram-positive wall surrounding the
microorganism). In a preferred embodiment, the recombinant
microorganism is a microorganism belonging to a genus selected from
the group consisting of Bacillus, Cornyebacterium (e.g.,
Cornyebacterium glutamicum), Lactobacillus, Lactococci and
Streptomyces. In a more preferred embodiment, the recombinant
microorganism is of the genus Bacillus. In another preferred
embodiment, the recombinant microorganism is selected from the
group consisting of Bacillus subtilis, Bacillus lentimorbus,
Bacillus lentus, Bacillus firmus, Bacillus pantothenticus, Bacillus
amyloliquefaciens, Bacillus cereus, Bacillus circulans, Bacillus
coagulans, Bacillus licheniformis, Bacillus megaterium, Bacillus
pumilus, Bacillus thuringiensis, Bacillus halodurans, and other
Group 1 Bacillus species, for example, as characterized by 16S rRNA
type. In another preferred embodiment, the recombinant
microorganism is Bacillus brevis or Bacillus stearothermophilus. In
another preferred embodiment, the recombinant microorganism is
selected from the group consisting of Bacillus licheniformis,
Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus
pumilus.
[0069] In another embodiment, the recombinant microorganism is a
Gram negative (excludes basic dye) organism. In a preferred
embodiment, the recombinant microorganism is a microorganism
belonging to a genus selected from the group consisting of
Salmonella (e.g., Salmonella typhimurium), Escherichia, Klebsiella,
Serratia, and Proteus. In a more preferred embodiment, the
recombinant microorganism is of the genus Escherichia. In an even
more preferred embodiment, the recombinant microorganism is
Escherichia coli. In another embodiment, the recombinant
microorganism is Saccharomyces (e.g., Saccharomyces
cerevisiae).
[0070] A preferred "recombinant" microorganism of the present
invention is a microorganism having a deregulated pantothenate
biosynthesis pathway or enzyme, a deregulated isoleucine-valine
(ilv) biosynthetic pathway or enzyme and/or a modified or
deregulated methylenetetrahydtofolate (MTF) biosynthetic pathway or
enzyme. The term "deregulated" or "deregulation" includes the
alteration or modification of at least one gene in a microorganism
that encodes an enzyme in a biosynthetic pathway, such that the
level or activity of the biosynthetic enzyme in the microorganism
is altered or modified. Preferably, at least one gene that encodes
an enzyme in a biosynthetic pathway is altered or modified such
that the gene product is enhanced or increased. The phrase
"deregulated pathway" can also include a biosynthetic pathway in
which more than one gene that encodes an enzyme in a biosynthetic
pathway is altered or modified such that the level or activity of
more than one biosynthetic enzyme is altered or modified. The
ability to "deregulate" a pathway (e.g., to simultaneously
deregulate more than one gene in a given biosynthetic pathway) in a
microorganism in some cases arises from the particular phenomenon
of microorganisms in which more than one enzyme (e.g., two or three
biosynthetic enzymes) are encoded by genes occurring adjacent to
one another on a contiguous piece of genetic material termed an
"operon" (defined herein). Due to the coordinated regulation of
genes included in an operon, alteration or modification of the
single promoter and/or regulatory element can result in alteration
or modification of the expression of each gene product encoded by
the operon. Alteration or modification of the regulatory element
can include, but is not limited to removing the endogenous promoter
and/or regulatory element(s), adding strong promoters, inducible
promoters or multiple promoters or removing regulatory sequences
such that expression of the gene products is modified, modifying
the chromosomal location of the operon, altering nucleic acid
sequences adjacent to the operon or within the operon such as a
ribosome binding site, increasing the copy number of the operon,
modifying proteins (e.g., regulatory proteins, suppressors,
enhancers, transcriptional activators and the like) involved in
transcription of the operon and/or translation of the gene products
of the operon, or any other conventional means of deregulating
expression of genes routine in the art (including but not limited
to use of antisense nucleic acid molecules, for example, to block
expression of repressor proteins). Deregulation can also involve
altering the coding region of one or more genes to yield, for
example, an enzyme that is feedback resistant or has a higher or
lower specific activity.
[0071] In another preferred embodiment, a recombinant microorganism
is designed or engineered such that at least one pantothenate
biosynthetic enzyme, at least one isoleucine-valine biosynthetic
enzyme, and/or at least one MTF biosynthetic enzyme is
overexpressed. The term "overexpressed" or "overexpression"
includes expression of a gene product (e.g., a biosynthetic enzyme)
at a level greater than that expressed prior to manipulation of the
microorganism or in a comparable microorganism which has not been
manipulated. In one embodiment, the microorganism can be
genetically designed or engineered to overexpress a level of gene
product greater than that expressed in a comparable microorganism
which has not been engineered.
[0072] Genetic engineering can include, but is not limited to,
altering or modifying regulatory sequences or sites associated with
expression of a particular gene (e.g., by adding strong promoters,
inducible promoters or multiple promoters or by removing regulatory
sequences such that expression is constitutive), modifying the
chromosomal location of a particular gene, altering nucleic acid
sequences adjacent to a particular gene such as a ribosome binding
site, increasing the copy number of a particular gene, modifying
proteins (e.g., regulatory proteins, suppressors, enhancers,
transcriptional activators and the like) involved in transcription
of a particular gene and/or translation of a particular gene
product, or any other conventional means of deregulating expression
of a particular gene routine in the art (including but not limited
to use of antisense nucleic acid molecules, for example, to block
expression of repressor proteins). Genetic engineering can also
include deletion of a gene, for example, to block a pathway or to
remove a repressor.
[0073] In another embodiment, the microorganism can be physically
or environmentally manipulated to overexpress a level of gene
product greater than that expressed prior to manipulation of the
microorganism or in a comparable microorganism which has not been
manipulated. For example, a microorganism can be treated with or
cultured in the presence of an agent known or suspected to increase
transcription of a particular gene and/or translation of a
particular gene product such that transcription and/or translation
are enhanced or increased. Alternatively, a microorganism can be
cultured at a temperature selected to increase transcription of a
particular gene and/or translation of a particular gene product
such that transcription and/or translation are enhanced or
increased.
[0074] V. Culturing and Fermenting Recombinant Microorganisms
[0075] The term "culturing" includes maintaining and/or growing a
living microorganism of the present invention (e.g., maintaining
and/or growing a culture or strain). In one embodiment, a
microorganism of the invention is cultured in liquid media. In
another embodiment, a microorganism of the invention is cultured in
solid media or semi-solid media. In a preferred embodiment, a
microorganism of the invention is cultured in media (e.g., a
sterile, liquid medium) comprising nutrients essential or
beneficial to the maintenance and/or growth of the microorganism
(e.g., carbon sources or carbon substrate, for example
carbohydrate, hydrocarbons, oils, fats, fatty acids, organic acids,
and alcohols; nitrogen sources, for example, peptone, yeast
extracts, meat extracts, malt extracts, soy meal, soy flour, soy
grits, urea, ammonium sulfate, ammonium chloride, ammonium nitrate
and ammonium phosphate; phosphorus sources, for example, phosphoric
acid, sodium and potassium salts thereof; trace elements, for
example, magnesium, iron, manganese, calcium, copper, zinc, boron,
molybdenum, and/or cobalt salts; as well as growth factors such as
amino acids, vitamins, growth promoters and the like).
[0076] Preferably, microorganisms of the present invention are
cultured under controlled pH. The term "controlled pH" includes any
pH which results in production of the desired product (e.g.,
pantoate and/or pantothenate). In one embodiment microorganisms are
cultured at a pH of about 7. In another embodiment, microorganisms
are cultured at a pH of between 6.0 and 8.5. The desired pH may be
maintained by any number of methods known to those skilled in the
art.
[0077] Also preferably, microorganisms of the present invention are
cultured under controlled aeration. The term "controlled aeration"
includes sufficient aeration (e.g., oxygen) to result in production
of the desired product (e.g., pantoate and/or pantothenate). In one
embodiment, aeration is controlled by regulating oxygen levels in
the culture, for example, by regulating the amount of oxygen
dissolved in culture media. Preferably, aeration of the culture is
controlled by agitating the culture. Agitation may be provided by a
propeller or similar mechanical agitation equipment, by revolving
or shaking the culture vessel (e.g., tube or flask) or by various
pumping equipment. Aeration may be further controlled by the
passage of sterile air or oxygen through the medium (e.g., through
the fermentation mixture). Also preferably, microorganisms of the
present invention are cultured without excess foaming (e.g., via
addition of antifoaming agents).
[0078] Moreover, microorganisms of the present invention can be
cultured under controlled temperatures. The term "controlled
temperature" includes any temperature which results in production
of the desired product (e.g., pantoate and/or pantothenate). In one
embodiment, controlled temperatures include temperatures between
15.degree. C. and 95.degree. C. In another embodiment, controlled
temperatures include temperatures between 15.degree. C. and
70.degree. C. Preferred temperatures are between 20.degree. C. and
55.degree. C., more preferably between 30.degree. C. and 50.degree.
C.
[0079] Microorganisms can be cultured (e.g., maintained and/or
grown) in liquid media and preferably are cultured, either
continuously or intermittently, by conventional culturing methods
such as standing culture, test tube culture, shaking culture (e.g.,
rotary shaking culture, shake flask culture, etc.), aeration
spinner culture, or fermentation. In a preferred embodiment, the
microorganisms are cultured in shake flasks. In a more preferred
embodiment, the microorganisms are cultured in a fermentor (e.g. a
fermentation process). Fermentation processes of the present
invention include, but are not limited to, batch, fed-batch and
continuous processes or methods of fermentation. The phrase "batch,
process" or "batch fermentation" refers to a system in which the
composition of media, nutrients, supplemental additives and the
like is set at the beginning of the fermentation and not subject to
alteration during the fermentation, however, attempts may be made
to control such factors as pH and oxygen concentration to prevent
excess media acidification and/or microorganism death. The phrase
"fed-batch process" or "fed-batch" fermentation refers to a batch
fermentation with the exception that one or more substrates or
supplements are added (e.g., added in increments or continuously)
as the fermentation progresses. The phrase "continuous process" or
"continuous fermentation" refers to a system in which a defined
fermentation media is added continuously to a fermentor and an
equal amount of used or "conditioned" media is simultaneously
removed, preferably for recovery of the desired product (e.g.,
pantoate and/or pantothenate). A variety of such processes have
been developed and are well-known in the art.
[0080] The phrase "culturing under conditions such that a desired
compound is produced" includes maintaining and/or growing
microorganisms under conditions (e.g., temperature, pressure, pH,
duration, etc.) appropriate or sufficient to obtain production of
the desired compound or to obtain desired yields of the particular
compound being produced. For example, culturing is continued for a
time sufficient to produce the desired amount of a compound (e.g.,
pantoate and/or pantothenate). Preferably, culturing is continued
for a time sufficient to substantially reach suitable production of
the compound (e.g., a time sufficient to reach a suitable
concentration of pantoate and/or pantothenate or suitable ratio of
pantoate and/or pantothenate:HMBPA). In one embodiment, culturing
is continued for about 12 to 24 hours. In another embodiment,
culturing is continued for about 24 to 36 hours, 36 to 48 hours, 48
to 72 hours, 72 to 96 hours, 96 to 120 hours, 120 to 144 hours, or
greater than 144 hours. In yet another embodiment, microorganisms
are cultured under conditions such that at least about 5 to 10 g/L
of compound are produced in about 36 hours, at least about 10 to 20
g/L compound are produced in about 48 hours, or at least about 20
to 30 g/L compound in about 72 hours. In yet another embodiment,
microorganisms are cultured under conditions such that at least
about 5 to 20 g/L of compound are produced in about 36 hours, at
least about 20 to 30 g/L compound are produced in about 48 hours,
or at least about 30 to 50 or 60 g/L compound in about 72 hours. In
yet another embodiment, microorganisms are cultured under
conditions such that at least about 40 to 60 g/L of compound are
produced in about 36 hours, or at least about 60 to 90 g/L compound
are produced in about 48 hours. It will be appreciated by the
skilled artisan that values above the upper limits of the ranges
recited may be obtainable by the processes described herein, for
example, in a particular fermentation run or with a particular
engineered strain.
[0081] Preferably, a production method of the present invention
results in production of a level of pantothenate that is "enhanced
as compared to an appropriate control". The term "appropriate
control", as defined herein, includes any control recognized by the
skilled artisan as being appropriate for determining enhanced,
increased, or elevated levels of desired product. For example,
where the process features culturing a microorganism having a
deregulated pantothenate biosynthetic pathway and said
microorganism further has a deregulated MTF biosynthetic pathway
(i.e., has been engineered such that at least one MTF biosynthetic
enzyme is deregulated, for example, overexpressed) an appropriate
control includes a culture of the microorganism before or absent
manipulation of the MTF enzyme or pathway (i.e., having only the
pantothenate biosynthetic pathway deregulated). Likewise, where the
process features culturing a microorganism having a deregulated
pantothenate biosynthetic pathway and a deregulated ilv
biosynthetic pathway and said microorganism further has a
deregulated MTF biosynthetic pathway (i.e., has been engineered
such that at least one MTF biosynthetic enzyme is deregulated, for
example, overexpressed) an appropriate control includes a culture
of the microorganism before or absent manipulation of the MTF
enzyme or pathway (i.e., having only the pantothenate biosynthetic
pathway and ilv biosynthetic pathway deregulated). Comparison need
not be performed in each process practiced according to the present
invention. For example, a skilled artisan can determine appropriate
controls empirically from performing a series of reactions (e.g.,
test tube cultures, shake flask cultures, fermentations), for
example, under the same or similar conditions. Having appreciated a
routine production level, for example, by a particular strain, the
artisan is able to recognize levels that are enhanced, increased or
elevated over such levels. In other words, comparison to an
appropriate control includes comparison to a predetermined values
(e.g., a predetermined control).
[0082] Thus, in an embodiment wherein an appropriately engineered
strain produces 40 g/L pantothenate in 36 hours (prior to
manipulation such that pantothenate production is enhanced),
production of 50, 60, 70 or more g/L pantothenate (after
manipulation, for example, manipulation such that at least one MTF
biosynthetic enzyme is overexpressed) exemplifies enhanced
production. Likewise, in an embodiment wherein an appropriately
engineered strain produces 50 g/L pantothenate in 48 hours (prior
to manipulation such that pantothenate production is enhanced),
production of 60, 70, 80, 90 or more g/L pantothenate (after
manipulation, for example, manipulation such that at least one MTF
biosynthetic enzyme is overexpressed) exemplifies enhanced
production.
[0083] The methodology of the present invention can further include
a step of recovering a desired compound (e.g., pantoate and.or
pantothenate). The term "recovering" a desired compound includes
extracting, harvesting, isolating or purifying the compound from
culture media. Recovering the compound can be performed according
to any conventional isolation or purification methodology known in
the art including, but not limited to, treatment with a
conventional resin (e.g., anion or cation exchange resin, non-ionic
adsorption resin, etc.), treatment with a conventional adsorbent
(e.g., activated charcoal silicic acid, silica gel, cellulose,
alumina, etc.), alteration of pH, solvent extraction (e.g., with a
conventional solvent such as an alcohol, ethyl acetate, hexane and
the like), dialysis, filtration, concentration, crystallization,
recrystallization, pH adjustment, lyophilization and the like. For
example, a compound can be recovered from culture media by first
removing the microorganisms from the culture. Media are then passed
through or over a cation exchange resin to remove cations and then
through or over an anion exchange resin to remove inorganic anions
and organic acids having stronger acidities than the compound of
interest. The resulting compound can subsequently be converted to a
salt (e.g., a calcium salt) as described herein.
[0084] Preferably, a desired compound of the present invention is
"extracted", "isolated" or "purified" such that the resulting
preparation is substantially free of other media components (e.g.,
free of media components and/or fermentation byproducts). The
language "substantially free of other media components" includes
preparations of the desired compound in which the compound is
separated from media components or fermentation byproducts of the
culture from which it is produced. In one embodiment, the
preparation has greater than about 80% (by dry weight) of the
desired compound (e.g., less than about 20% of other media
components or fermentation byproducts), more preferably greater
than about 90% of the desired compound (e.g., less than about 10%
of other media components or fermentation byproducts), still more
preferably greater than about 95% of the desired compound (e.g.,
less than about 5% of other media components or fermentation
byproducts), and most preferably greater than about 98-99% desired
compound (e.g., less than about 1-2% other media components or
fermentation byproducts). When the desired compound has been
derivatized to a salt, the compound is preferably further free of
chemical contaminants associated with the formation of the salt.
When the desired compound has been derivatized to an alcohol, the
compound is preferably further free of chemical contaminants
associated with the formation of the alcohol.
[0085] In an alternative embodiment, the desired compound is not
purified from the microorganism, for example, when the
microorganism is biologically non-hazardous (e.g., safe). For
example, the entire culture (or culture supernatant) can be used as
a source of product (e.g., crude product). In one embodiment, the
culture (or culture supernatant) is used without modification. In
another embodiment, the culture (or culture supernatant) is
concentrated. In yet another embodiment, the culture (or culture
supernatant) is dried or lyophilized.
[0086] In yet another embodiment, the desired compound is partially
purified. The term "partially purified" includes media preparations
that have had at least some processing, for example, treatment
(e.g., batch treatment) with a commercial resin. In preferred
embodiments, the "partially purified" preparation has greater than
about 30% (by dry weight) of the desired compound, preferably
greater than about 40% of the desired compound, more preferably
greater than about 50% of the desired compound, still more
preferably greater than about 60% of the desired compound, and most
preferably greater than about 70% desired compound. "Partially
purified" preparations also preferably have 80% or less (by dry
weight) of the desired compound (i.e., are less pure than
"extracted", "isolated" or "purified" preparations, as defined
herein).
[0087] Depending on the biosynthetic enzyme or combination of
biosynthetic enzymes manipulated, it may be desirable or necessary
to provide (e.g., feed) microorganisms of the present invention at
least one biosynthetic precursor such that the desired compound or
compounds are produced. The term "biosynthetic precursor" or
"precursor" includes an agent or compound which, when provided to,
brought into contact with, or included in the culture medium of a
microorganism, serves to enhance or increase biosynthesis of the
desired product. In one embodiment, the biosynthetic precursor or
precursor is aspartate. In another embodiment, the biosynthetic
precursor or precursor is .beta.-alanine. The amount of aspartate
or .beta.-alanine added is preferably an amount that results in a
concentration in the culture medium sufficient to enhance
productivity of the microorganism (e.g., a concentration sufficient
to enhance production of pantoate and/or pantothenate).
Biosynthetic precursors of the present invention can be added in
the form of a concentrated solution or suspension (e.g., in a
suitable solvent such as water or buffer) or in the form of a solid
(e.g., in the form of a powder). Moreover, biosynthetic precursors
of the present invention can be added as a single aliquot,
continuously or intermittently over a given period of time. The
term "excess .beta.-alanine" includes .beta.-alanine levels
increased or higher that those routinely utilized for culturing the
microorganism in question. For example, culturing the Bacillus
microorganisms described in the instant Examples is routinely done
in the presence of about 0-0.01 g/L .beta.-alanine. Accordingly,
excess .beta.-alanine levels can include levels of about 0.01-1,
preferably about 1-20 g/L.
[0088] In yet another embodiment, the biosynthetic precursor is
valine. In yet another embodiment, the biosynthetic precursor is
.alpha.-ketoisovalerate. Preferably, valine or
.alpha.-ketoisovalerate is added in an amount that results in a
concentration in the medium sufficient for production of the
desired product (e.g., pantoate and/or pantothenate) to occur. The
term "excess .alpha.-KIV" includes .alpha.-KIV levels increased or
higher that those routinely utilized for culturing the
microorganism in question. For example, culturing the Bacillus
microorganisms described in the instant Examples is routinely done
in the presence of about 0-0.01 g/L .alpha.-KIV. Accordingly,
excess .alpha.-KIV levels can include levels of about 0.01-1,
preferably about 1-20 g/L .alpha.-KIV. The term "excess valine"
includes valine levels increased or higher that those routinely
utilized for culturing the microorganism in question. For example,
culturing the Bacillus microorganisms described in the instant
Examples is routinely done in the presence of about 0-0.5 g/L
valine. Accordingly, excess valine levels can include levels of
about 0.5-5 g/L, preferably about 5-20 g/L valine.
[0089] In yet another embodiment, the biosynthetic precursor is
serine. Preferably, serine is added in an amount that results in a
concentration in the medium sufficient for production of the
desired product (e.g., pantoate and/or pantothenate) to occur.
Excess serine (as defined herein) can also be added according to
the production processes described herein, for example, for the
enhanced production of pantothenate. The skilled artisan will
appreciate that extreme excesses of biosynthetic precursors can
result in microorganism toxicity. Biosynthetic precursors are also
referred to herein as "supplemental biosynthetic substrates".
[0090] Another aspect of the present invention includes
biotransformation processes which feature the recombinant
microorganisms described herein. The term "biotransformation
process", also referred to herein as "bioconversion processes",
includes biological processes which results in the production
(e.g., transformation or conversion) of appropriate substrates
and/or intermediate compounds into a desired product.
[0091] The microorganism(s) and/or enzymes used in the
biotransformation reactions are in a form allowing them to perform
their intended function (e.g., producing a desired compound). The
microorganisms can be whole cells, or can be only those portions of
the cells necessary to obtain the desired end result. The
microorganisms can be suspended (e.g., in an appropriate solution
such as buffered solutions or media), rinsed (e.g., rinsed free of
media from culturing the microorganism), acetone-dried, immobilized
(e.g., with polyacrylamide gel or k-carrageenan or on synthetic
supports, for example, beads, matrices and the like), fixed,
cross-linked or permeabilized (e.g., have permeabilized membranes
and/or walls such that compounds, for example, substrates,
intermediates or products can more easily pass through said
membrane or wall).
[0092] This invention is further illustrated by the following
examples which should not be construed as limiting. The contents of
all references, patents and published patent applications cited
throughout this application are incorporated herein by
reference.
EXAMPLES
Example I
Panto-Compound Production Strains
[0093] In developing Bacillus strains for the production of
pantothenate, various genetic manipulations are made to genes and
enzymes involved in the pantothenate biosynthetic pathway and the
isoleucine-valine (ilv) pathway (FIG. 1) as described in U.S.
patent application Ser. No. 09/400,494 and U.S. patent application
Ser. No. 09/667,569. For example, strains having a deregulated
panBCD operon and/or having deregulated panE1 exhibit enhanced
pantothenate production (when cultured in the presence of
.beta.-alanine and .alpha.-ketoisovalerate (.alpha.-KIV)). Strains
further deregulated for ilvBNC and ilvD exhibit enhanced
pantothenate production in the presence of only .beta.-alanine.
Moreover, it is possible to achieve .beta.-alanine independence by
further deregulating panD.
[0094] An exemplary pantothenate production strain is PA824, a
tryptophan prototroph, Spec and Tet resistant, deregulated for
panBCD at the panBCD locus, deregulated for panE1 at the panE1
locus (two genes in the B. subtilis genome are homologous to E.
coli panE, panE1 and panE2, the former encoding the major
ketopantoate reductase involved in pantothenate production, while
panE2 does not contribute to pantothenate synthesis (U.S. patent
application Ser. No. 09/400,494), deregulated for ilvD at the ilvD
locus, overexpressing an ilvBNC cassette at the amyE locus, and
overexpressing panD at the bpr locus. PA824 routinely yields
approximately 40-50 g/L pantothenate, when cultured for 48 hours in
14 L fermentor vessels according to standard fermentation
procedures (see e.g., provisional Patent Application Ser. No.
60/263,053 or provisional Patent Application Ser. No. 60/262,995,
incorporated by reference herein). Briefly, batch media (4.5 L)
containing trace elements is inoculated with shake flask cultures
of PA824. The fermentations are controlled for temperature (e.g.,
43.degree. C.), dissolved O.sub.2, and pH, and are run as a glucose
limited fed batch process. After the initial batched glucose is
consumed, glucose concentrations are maintained between about 0 and
1 g/L by continuous feeding of fresh FEED media pH is set at 7.2,
monitored, and maintained by feeding either a NH.sub.3- or a
H.sub.3PO.sub.4-solution. The dissolved oxygen concentration
[pO.sub.2] is maintained at about 10-30% by regulation of the
agitation and aeration rate. Foaming is controlled by addition of
an appropriate antifoam agent. The pantothenate titer in the
fermentation broth is determined (by HPLC analysis) after removal
of the cells by centrifugation.
[0095] A second exemplary strain is PA668. PA668 is a derivative of
PA824 that contains extra copies of P.sub.26 panB amplified at the
vpr and/or panB locus. PA668 was constructed using a panB
expression vector (pAN636) which allows for selection of multiple
copies using chloramphenicol. Briefly, a pAN636 NotI restriction
fragment (excluding vector sequences) was ligated and then used to
transform PA824 with selection on plates containing 5 .mu.g/ml
chloramphenicol. Transformants resistant to 30 .mu.g/ml
chloramphenicol were isolated and screened for pantothenate
production in 48 hour test tube cultures. The isolates produce
about 10 percent more pantothenate than PA824. In 10-L
fermentations, a first strain, PA668-2A, produces pantothenate in
amounts comparable to PA824 cultured under similar conditions
(e.g., .about.45-50 g/L at 36 hours). After 36 hours, when
pantothenate production routinely begins to slow with PA824,
PA668-2A continues to produce significant levels of pantothenate
(e.g., .about.60-65 g/l pantothenate at 48 hours). A second strain,
PA668-24, produces pantothenate at an even faster rate, reaching
60-70 g/L after 48 hours.
[0096] A third production strain, PA721B-39, was engineered to
further include an amplifiable P.sub.26 panBpanD cassette as
follows. First, a single expression cassette was constructed that
is capable of integrating both panB and panD at the bpr locus.
Combining both genes into one expression cassette simplifies the
resulting strain by eliminating an antibiotic resistance marker.
The P.sub.26 panBpanD expression cassette was constructed to
include each of two different panD ribosome binding sites (the RBSs
having previously been synthesized and tested in International
Public. No. WO 01/21772 and U.S. Patent Application No.
60/262,995). The cassette further included the synthetic panB gene
ribosome binding site (RBS1), but the design permits future
alteration of the panB RBS by simple oligonucleotide cassette
substitution. In the first step of construction, the panB gene was
joined to the two panD gene cassettes as illustrated in FIG. 3 for
the construction of pAN665. Next, the resulting panBpanD cassettes
were transferred to B. subtilis expression vector pOTP61 as
illustrated in FIG. 4. A summary of the essential features of each
plasmid (pAN670 and pAN674) constructed is presented in Table
1.
TABLE-US-00001 TABLE 1 Plasmids containing various B. subtilis
panBpanD gene expression cassettes. Plasmid panD RBS Vector Host
strain pAN665 Standard pASK-1BA3 E. coli pAN670 '' pOTP61 B.
subtilis pAN669 ND-C2 pASK-1BA3 E. coli pAN674 '' pOTP61 B.
subtilis
[0097] These new plasmids combine production of extra PanB and PanD
from a single vector and were predicted to produce increased levels
of PanB relative to the pane expression vector (pAN636) present in
PA668. The strategy to install the P26 panBpanD vectors in
pantothenate production strains took advantage of genetic linkage
between bpr and panE1. A derivative of PA824 was first constructed
that is cured of the resident panD expression cassette by
transforming the strain with chromosomal DNA isolated from PA930
(panE1::cat) and selecting for resistance to chloramphenicol. The
resulting transformants were screened for sensitivity to
tetracycline, and two Tet-sensitive isolates named PA715 were
saved. This strain is the host strain for testing the P26 panBpanD
vectors (see below). In order to restore the P26 panE1 cassette in
PA715, each vector was first transformed into a strain (PA328) that
contains P26 panE1 but does not contain a cassette integrated at
the bpr locus. PA328 does contain the P26 panBCD locus although it
is not engineered for overproduction of .alpha.-KIV. Transformants
of PA328 resistant to tetracycline were obtained using the
appropriate NotI restriction fragments from the two vectors and the
resulting strains were named PA710 and PA714.
[0098] The next step was to transfer the cassettes into PA715 so
they could be evaluated in the PA824 strain background. This was
accomplished by isolating chromosomal DNA from strains PA710 and
PA714 and using each of the two DNAs separately to transform PA715,
with selection for resistance to tetracycline.
Tetracycline-resistant transformants were screened for sensitivity
to chloramphenicol; this identifies the desired transformants that
have also acquired the P26 panE1 gene from the donor DNA by linkage
with the P26 panBpanD cassettes at the bpr locus.
Chloramphenicol-sensitive isolates derived from transformations in
which PA710 or PA714 chromosomal DNA was used as the donor were
obtained. The isolates that produced the highest pantothenate
titers in test tube culture assays were saved. These strains were
named PA717 and PA721, respectively. Duplicate test tube cultures
of the new strains, as well as PA824 and PA715, were grown in
SVY+10 g/L aspartate at 43.degree. C. for 48 hours and then assayed
for pantothenate, HMBPA, and .beta.-alanine. In addition, extracts
from each of the strains were run on a SDS-PAGE gel. The results of
the test tube culture assays are presented in Table 2.
TABLE-US-00002 TABLE 2 Production of pantothenate by strains PA717
and PA721 grown in SVY plus 10 g/l aspartate. panBD [pan] [HMBPA]
[.beta.-ala] Strain cassette (g/L) (g/L) (g/L) PA824 -- 4.9 0.94
2.5 '' 4.6 0.79 2.3 PA715 NONE 1.7 <0.1 0.5 '' '' 1.7 <0.1
0.4 PA717-24 pAN670 4.8 0.34 1.3 '' '' 4.9 0.40 1.3 PA721-35 pAN674
5.7 0.50 1.4 '' '' 5.3 0.40 1.3 PA721-39 pAN674 4.1 0.38 2.0 '' ''
4.6 0.40 2.2
[0099] As expected, each of the new strains produced more
pantothenate and .beta.-alanine than PA715. Two of the strains
(PA717-24 and PA721-39) produced about as much pantothenate as
PA824 while PA721-35 produced more pantothenate than PA824. All
three of the new strains produced less HMBPA than PA824. The
protein gel analysis showed that the three new strains produce more
PanB than any of the control strains.
[0100] Strains PA717-24, PA721-35, and PA721-39 were also evaluated
in shake flask cultures in a soy flour based medium. As shown in
Table 3, these strains with the amplifiable P.sub.26 panBpanD
cassette produced pantothenate and HMBPA at levels similar to the
levels seen with PA668-2 and PA668-24 which both contain separate
amplifiable P.sub.26 panB and P.sub.26 panD cassettes.
TABLE-US-00003 TABLE 3 Shake Flask Experiment 48 Hours HMBPA PAN
Medium Strain (g/l) (g/l) Soy flour + PA668-2 1.2 6.8 Glucose
PA668-24 1.6 5.2 PA717-24 2.0 5.9 PA721-35 2.6 7.0 PA721-39 2.5 8.6
Soy flour + PA668-2 0.0 9.0 Maltose PA668-24 0.4 10.4 PA717-24 0.7
8.6 PA721-35 1.0 9.2 PA721-39 0.4 9.1 Conditions: 40 ml medium/200
ml baffled shake flask, 4X Bioshield covers, 300 rpm. 2.5% inoculum
(1.0 ml). Soy Medium: 20 g/l Cargill 200/20 soy flour, 8 g/l
(NH4)2SO4, 5 g/l glutamate, 1x PSTE, 0.1M phosphate pH 7.2 and 0.3M
MOPS pH 7.2. 60 g/l glucose or maltose w/10 mM Mg and 1.4 mM Ca.
Average of duplicate flasks.
[0101] In addition to producing pantothenate (as well as other
panto-compounds depicted in FIG. 1 and described herein), it has
been demonstrated that certain stains engineered for producing
commercial quantities of desired panto-compound also produce a
by-product identified as
3-(2-hydroxy-3-methyl-butyrylamino)-propionic acid (HMBPA) (also
referred to herein as ".beta.-alanine 2-(R)-hydroxyisolvalerate",
".beta.-alanine 2-hydroxyisolvalerate",
".beta.-alanyl-.alpha.-hydroxyisovalarate" and/or "fantothenate").
(The term "fantothenate" is also abbreviated as "fan" herein).
[0102] HMBPA is the condensation product of
[R]-.alpha.-hydroxyisovaleric acid (.alpha.-HIV) and
.beta.-alanine, catalyzed by the PanC enzyme. .alpha.-HIV is
generated by reduction of .alpha.-KIV, a reaction that is catalyzed
by the .alpha.-keto reductases PanE (e.g., PanE1 and/or PanE2)
and/or IlvC. Thus it has been proposed that there exist at least
two pathways in microorganisms that compete for .alpha.-KIV, the
substrate for the biosynthetic enzyme PanB, namely the pantothenate
biosynthetic pathway and the HMBPA biosynthetic pathway. (A third
and fourth pathway competing for .alpha.-KIV are those resulting in
the production of valine or leucine from .alpha.-KIV, see e.g.,
FIG. 1). At least the pantothenate biosynthetic pathway and the
HMBPA biosynthetic pathway further produce competitive substrates
for the enzyme PanC, namely .alpha.-HIV and pantoate. Production of
HMBPA can have significant effects on pantothenate production. For
example, the HMBPA pathway can compete with the pantothenate
pathway for precursors (.alpha.-KIV and .beta.-alanine) and for
some of the enzymes (PanC, PanD, PanE1, and/or IlvC). In addition,
because the structure of HMBPA is similar to that of pantothenate,
it may have the undesirable property of negatively regulating one
or more steps in the pantothenate pathway. Based on the
identification of HMBPA, U.S. Provisional Patent Application Ser.
No. 60/262,995 teaches that production of pantothenate can be
improved or optimized by any means which favor use of substrates
(.alpha.-KIV and .beta.-alanine) and/or enzymes (PanC, PanD, PanE1,
and/or IlvC) in pantothenate biosynthetic processes as compared to
HMBPA biosynthetic processes.
Example II
Increasing Pantothenate Production by Increasing Serine
Availability
[0103] At least one method for optimizing pantothenate production
involves regulating the availability of serine in the microorganism
cultures. In particular, it can be demonstrated that increasing the
availability of serine leads to increased pantothenate production
(e.g., relative to HMBPA production), whereas decreasing the
availability of serine leads to decreased pantothenate production
relative to HMBPA production. This method is based on the
understanding that the compound, methylenetetrahydrofolate (MTF),
which is derived from serine, donates a hydroxymethyl group to
.alpha.-KIV during the pantothenate biosynthetic reaction to yield
ketopantoate (see e.g., FIGS. 1 and 2). Thus, regulating serine
levels is one means of effectively regulating ketopantoate levels
and, in turn, regulating pantoate and/or pantothenate production in
appropriately engineered microorganisms. To demonstrate this
regulation, PA824 was grown in test tube cultures of SVY glucose
plus 5 g/L .beta.-alanine and .+-.5 g/L serine for 48 hours and
43.degree. C.
TABLE-US-00004 TABLE 4 Production of pantothenate and HMBPA by
PA824 with and without the addition of serine serine added [pan]
[HMBPA] at 5 g/L OD.sub.600 g/L g/L - 16.3 4.9 0.84 - 14.0 4.5 0.80
+ 13.1 6.4 0.56 + 12.9 6.0 0.62
[0104] As demonstrated by the data presented in Table 4, addition
of serine increases the level of production of pantothenate (while
conversely decreasing HMBPA production).
Example III
Engineering Bacterial Cells with Increased Amounts of Serine
Hydroxylmethyl Transferase, the glyA Gene Product
[0105] As an alternative to feeding serine, another method of
increasing serine levels and/or serine utilization levels (and
accordingly, methylenetetrahydrofolate levels) in order to regulate
pantothenate production levels is to increase synthesis or the
activity of 3-phosphoglycerate dehydrogenase or of serine
hydroxymethyl transferase (the serA and glyA gene products,
respectively), thereby increasing serine and
methylenetetrahydrofolate biosynthesis in appropriately engineered
microorganisms.
[0106] Expression of the glyA gene was increased by transforming B.
subtilis cells with an expression cassette containing the B.
subtilis glyA gene cloned downstream of a strong, constitutive
promoter. To construct the expression cassette the primers RY417
and RY418 depicted in Table 5 were used to amplify the glyA gene by
PCR from chromosomal DNA isolated from B. subtilis PY79.
TABLE-US-00005 TABLE 5 Primers used in the amplification of B.
subtilis glyA and serA RY405 CCCTCTAGAGGAGGAGAAAACATGTTTCGAG SEQ ID
NO:20 TATTGGTCTCAGACAAAATG RY406 CCCGGATCCAATTATGGCAGATCAATGAGCT
SEQ ID NO:21 TCACAGACACAA RY417 GGATCTAGAGGAGGTGTAAACATGAAACATT SEQ
ID NO:22 TACCTGCGCAAGACGAA RY418 CGGGGATCCCCCATCAACAATTACACACTTC
SEQ ID NO:23 TATTGATTCTAC
[0107] RY417 contains the RBS2 synthetic ribosome binding site just
downstream from an XbaI site. The amplified DNA was then cut with
XbaI and BamHI and cloned between the XbaI and BamHI sites in
vector pAN004 (FIG. 5) to yield plasmid pAN396 (FIG. 6; SEQ ID
NO:24). The pAN004 vector contains the phage SP01 P.sub.26 promoter
immediately upstream of the XbaI cloning site to drive expression
of the cloned glyA gene. Just downstream of the expression
cassette, pAN396 contains a cat gene that functions in B. subtilis.
To transform B. subtilis, the NotI DNA fragment containing the
P.sub.26 glyA cassette and cat gene was isolated from pAN396,
self-ligated, and transformed into competent cells of B. subtilis
PY79. Several chloramphenicol resistant transformants were selected
and named PA1007 and PA1008. Chromosomal DNA was isolated from each
of these strains and used to transform competent cells of PA721B-39
and PA824 to yield strains PA1011 and PA1014, respectively. SDS
polyacrylamide gel electrophoresis of cell extracts of selected
isolates of PA1011 and PA1014 confirmed that these strains
contained increased amounts of the glyA gene product as compared to
their parent strains PA721B-39 (described in Example I) and PA824
(described in International Public. No. WO 01/21772). To test the
effect of increasing glyA expression on pantothenate production,
PA1011 and PA1014 were grown in test tube cultures of SVY glucose
plus 5 g/L .beta.-alanine at 43.degree. C. for 48 hours. As shown
by the data presented in Table 6, PA1014 produced more pantothenate
(4.5 g/L) than its parent strain PA824 (3.2 g/L). Similarly, PA1011
produced on average more pantothenate (4.35 g/L) than its parent
strain PA721B-39 (4.05 g/L).
TABLE-US-00006 TABLE 6 Production of pantothenate and HMBPA by
PA1011 and PA1014 compared to PA721B-39 and PA824. Pantothenate
HMBPA Strain OD.sub.600 g/L g/L PA1014 #1 14 4.5 0.27 PA1014 #2 15
4.5 0.31 PA824 16 3.1 0.31 PA824 15 3.3 0.28 PA1011 #1 17 4.5 0.24
PA1011 #2 12 4.2 0.27 PA721B-39 18 4.0 0.22 PA721B-39 16 4.1
0.25
Example IV
Engineering bacterial cells with increased amounts of
3-phosphoglycerate dehydrogenase, the serA gene product
[0108] The product of the serA gene, 3-phosphoglycerate
dehydrogenase, is the first committed enzyme in the pathway to
serine biosynthesis (see FIG. 2). Since serine is one of the
substrates for the synthesis of MTF, we engineered the
overexpression of the serA gene to increase serine levels in the
cell. In a manner similar to that described above for the glyA gene
in Example III, expression of the serA gene was increased by
transforming B. subtilis cells with an expression cassette
containing the B. subtilis serA gene cloned downstream of a strong,
constitutive promoter. To construct the expression cassette the
primers RY405 and RY406 depicted in Table 5 were used to amplify
the serA gene by PCR from chromosomal DNA isolated from B. subtilis
PY79. The amplified DNA was then cut with XbaI and BamHI and cloned
between the XbaI and BamHI sites in vector pAN004 (FIG. 5) to yield
plasmid pAN393 (FIG. 7; SEQ ID NO:25). To transform B. subtilis,
the NotI DNA fragment containing the P.sub.26 serA cassette and cat
gene was isolated from pAN393, self-ligated, and transformed into
competent cells of B. subtilis PY79. Several chloramphenicol
resistant transformants were selected and named PA1004 and PA1005.
Chromosomal DNA was isolated from each of these strains and used to
transform competent cells of PA721B-39 and PA824 to yield strains
PA1010 and PA1013, respectively. SDS polyacrylamide gel
electrophoresis of cell extracts of selected isolates of PA1010 and
PA1013 confirmed that these strains contained increased amounts of
the serA gene product as compared to their parent strains PA721B-39
and PA824.
[0109] To test the effect of increasing serA expression on
pantothenate production, PA1010 and PA1013 were grown in test tube
cultures of SVY glucose plus 5 g/L .beta.-alanine at 43-C for 48
hours. As shown by the data presented in Table 7, PA1010 produced
on average more pantothenate (4.7 g/L) than its parent stain
PA721B-39 (4.1 g/L). Similarly, PA1013 produced on average more
pantothenate (4.1 g/L) than its parent strain PA824 (3.1 g/L).
TABLE-US-00007 TABLE 7 Production of pantothenate and HMBPA by
PA1010 and PA1013 compared to PA721B-39 and PA824. Pantothenate
HMBPA Strain OD.sub.600 g/L g/L PA1010 #3 16 4.8 0.23 PA1010 #5 15
4.5 0.26 PA1010 #6 22 4.7 0.24 PA721B-39 18 4.0 0.22 PA721B-39 16
4.1 0.25 PA1013 #2 14 3.3 0.25 PA1013 #4 14 4.2 0.28 PA1013 #5 16
5.5 0.37 PA1013 #8 13 3.6 0.24 PA824 17 3.0 0.27 PA824 16 3.1
0.29
Example V
Shake Flask and Fermentor Experiments with Strains with Increased
Expression of serA and glyA
[0110] Based on performance in test tubes, two strains with an
amplifiable serA cassette and two strains with an amplifiable glyA
cassette were selected, one each from two parents, PA824 and
PA721B-39. The four strains were grown beside the parents in shake
flasks (Table 8). In Soy flour MOPS Glucose (SMG) medium, all of
the 4 strains produced more pantothenate than their parent strains.
In Soy flour MOPS Maltose (SMM) medium one out of the four strains
appeared superior to the parent strain.
[0111] The serA overexpressing strain and the glyA overexpressing
strain from each parent were run simultaneously in 10-liter Chemap
bench fermentors. The glyA overexpressing strain derived from
PA824, PA1014-3, that had given the highest pantothenate titer in
SMM, also performed the best in fermentors (Table 9). Strain
PA1014-3 produced 71 g/l pantothenate in 36 hours in the culture
supernatant and 86 g/l pantothenate in 48 hours in the culture
supernatant compared to the parent PA824 which produced 41 g/l and
46 g/l pantothenate, respectively. The sea strain, PA1012-4, also
produced significantly more pantothenate than the PA824 control in
the culture supernatant, 52 g/l and 60 g/l at 36 and 48 hours,
respectively. These results clearly demonstrate the effectiveness
of increasing both glyA and serA.
[0112] The serA overexpressing and glyA overexpressing derivatives
of PA721B-39 were clearly improved over their parent strain as
well. Both produced about 80 g/l pantothenate (82 g/l and 79 g/l,
respectively) in the culture supernatants in 48 hours. The effect
of the increased PanB levels in the PA721B-39 derivatives versus
the PA824 derivatives manifests itself in the reduction of HMBPA.
PA721B-39 and its derivatives produce less HMBPA after 48 hours
than PA824 or even PA668-24. Increasing GlyA also appears to lower
the flow of carbon to HMBPA.
TABLE-US-00008 TABLE 8 Shake flask evaluation of pantothenate
production strains overexpressing ser A or gly A. Carbon Added
HMBPA Pantothenate source Strain cassette (g/l) (g/l) Glucose PA824
3.5 4.0 PA1012-4 serA 3.0 4.6 PA1014-3 gly A 2.5 4.7 PA721B-39 0.9
5.0 PA1010-6 serA 1.9 9.6 PA1011-2 gly A 1.7 10.0 Maltose PA824 1.2
10.4 PA1012-4 serA 0.8 9.8 PA1014-3 gly A 1.1 16.1 PA721B-39 0.6
11.6 PA1010-6 serA 0.5 10.2 PA1011-2 gly A 0 10.3 All data are the
average of duplicate shake flasks after 48 hours. Conditions: 40 ml
medium/200 ml baffled shake flask, 4X Bioshield covers, 300 rpm,
2.5% inoculum and 43.degree. C. Medium: 20 g/l Cargill 200/20 soy
flour, 1 x PSTE, 8 g/l (NH4)2SO4 and 5 g/l glutamate. Buffer: 0.1M
phosphate pH 12 and 0.3M MOPS pH 7.2. Carbon Source (Sterilized
separately as 20 x stock): 60 g/l glucose or maltose w/10 mM Mg and
1.4 mM Ca.
TABLE-US-00009 TABLE 9 10 liter fermentor evaluations of
pantothenate production strains overexpressing serA or glyA. HMBPA
Pantothenate (g/l) (g/l) Added 36 48 36 48 run Strain Parent
cassette hrs hrs hrs hrs P285 PA824 18 25 41 46 P284 PA1012-4 PA824
serA 20 21 52 60 P286 PA1014-3 PA824 glyA 14 16 71 86 P259
PA721B-39 4 5 34 42 P287 PA1010-6 PA721B-39 serA 4 5 65 82 P289
PA1011-2 PA721B-39 glyA 2 3 56 79 P275 PA668-24 PA824 3 9 55 72 The
medium used is PFM-222. It is the same as medium PFM-155 described
in U.S. Ser. No. 60/262,995 (filed Jan. 19, 2001) except for the
following changes: (1) In the Batch Material: There is no Amberex
1003. Cargill 200/20 (soy flour) 40 g/L has been changed to Cargill
20-80 (soy grits) 50 g/L, MgSO.sub.47.cndot.H.sub.2O is replaced
with MgCl.sub.2.cndot.7H.sub.20, 1 g/L, and SM-1000X is replaced
with PSTE-1000X (PSTE-1000X = MnCl.sub.2.cndot.4H.sub.2O, 2.0 g/L;
ZnSO.sub.4.cndot.7H.sub.2O, 1.5 g/L; CoCl.sub.2.cndot.6H.sub.2O,
2.0 g/L; CuSO.sub.4.cndot.5H.sub.2O, 0.25 g/L;
Na.sub.2MoO.sub.4.cndot.2H.sub.2O, 0.75 g/L). In the Feed Material:
SM-1000X is replaced with PSTE-1000X
[0113] Increasing pantothenate production can also be achieved by
combining overexpression of serA and glyA in a single strain,
and/or by introducing a mutation that leads to feedback resistant
serA or glyA, or both.
EQUIVALENTS
[0114] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
251194DNAArtificial SequenceDescription of Artificial
Sequencepromoter sequence 1gctattgacg acagctatgg ttcactgtcc
accaaccaaa actgtgctca gtaccgccaa 60tatttctccc ttgaggggta caaagaggtg
tccctagaag agatccacgc tgtgtaaaaa 120ttttacaaaa aggtattgac
tttccctaca gggtgtgtaa taatttaatt acaggcgggg 180gcaaccccgc ctgt
1942163DNAArtificial SequenceDescription of Artificial
Sequencepromoter sequence 2gcctacctag cttccaagaa agatatccta
acagcacaag agcggaaaga tgttttgttc 60tacatccaga acaacctctg ctaaaattcc
tgaaaaattt tgcaaaaagt tgttgacttt 120atctacaagg tgtggtataa
taatcttaac aacagcagga cgc 1633127DNAArtificial SequenceDescription
of Artificial Sequencepromoter sequence 3gaggaatcat agaattttgt
caaaataatt ttattgacaa cgtcttatta acgttgatat 60aatttaaatt ttatttgaca
aaaatgggct cgtgttgtac aataaatgta gtgaggtgga 120tgcaatg
127424DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 4taaacatgag gaggagaaaa catg
24528DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 5attcgagaaa tggagagaat ataatatg
28613DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 6agaaaggagg tga 13723DNAArtificial
SequenceDescription of Artificial Sequenceribosome binding site
7ttaagaaagg aggtgannnn atg 23823DNAArtificial SequenceDescription
of Artificial Sequenceribosome binding site 8ttagaaagga ggtgannnnn
atg 23923DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 9agaaaggagg tgannnnnnn atg
231022DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 10agaaaggagg tgannnnnna tg
221125DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 11ccctctagaa ggaggagaaa acatg
251224DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 12ccctctagag gaggagaaaa catg
241323DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 13ttagaaagga ggatttaaat atg
231423DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 14ttagaaagga ggtttaatta atg
231523DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 15ttagaaagga ggtgatttaa atg
231623DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 16ttagaaagga ggtgtttaaa atg
231728DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 17attcgagaaa ggaggtgaat ataatatg
281827DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 18attcgagaaa ggaggtgaat aataatg
271928DNAArtificial SequenceDescription of Artificial
Sequenceribosome binding site 19attcgtagaa aggaggtgaa ttaatatg
282051DNAArtificial Sequence5' PCR primer for serA gene
20ccctctagag gaggagaaaa catgtttcga gtattggtct cagacaaaat g
512143DNAArtificial Sequence3' PCR primer for serA gene
21cccggatcca attatggcag atcaatgagc ttcacagaca caa
432248DNAArtificial Sequence5' PCR primer for glyA gene
22ggatctagag gaggtgtaaa catgaaacat ttacctgcgc aagacgaa
482343DNAArtificial Sequence3' PCR primer for glyA gene
23cggggatccc ccatcaacaa ttacacactt ctattgattc tac
43247926DNAArtificial SequenceserA overexpression plasmid
24gaattttgcg gccgcttcga aagctgtaat ataaaaacct tcttcaacta acggggcagg
60ttagtgacat tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa
120gccagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat
cctgcatgat 180aaccatcaca aacagaatga tgtacctgta aagatagcgg
taaatatatt gaattacctt 240tattaatgaa ttttcctgct gtaataatgg
gtagaaggta attactatta ttattgatat 300ttaagttaaa cccagtaaat
gaagtccatg gaataataga aagagaaaaa gcattttcag 360gtataggtgt
tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt
420ataaatcata aaactctttg aagtcattct ttacaggagt ccaaatacca
gagaatgttt 480tagatacacc atcaaaaatt gtataaagtg gctctaactt
atcccaataa cctaactctc 540cgtcgctatt gtaaccagtt ctaaaagctg
tatttgagtt tatcaccctt gtcactaaga 600aaataaatgc agggtaaaat
ttatatcctt cttgttttat gtttcggtat aaaacactaa 660tatcaatttc
tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct
720cttttctctt ccaattgtct aaatcaattt tattaaagtt catttgatat
gcctcctaaa 780tttttatcta aagtgaattt aggaggctta cttgtctgct
ttcttcatta gaatcaatcc 840ttttttaaaa gtcaatatta ctgtaacata
aatatatatt ttaaaaatat cccactttat 900ccaattttcg tttgttgaac
taatgggtgc tttagttgaa gaataaagac cacattaaaa 960aatgtggtct
tttgtgtttt tttaaaggat ttgagcgtag cgaaaaatcc ttttctttct
1020tatcttgata ataagggtaa ctattgaatt cggtaccaag agtttgtaga
aacgcaaaaa 1080ggccatccgt caggatggcc ttctgcttaa tttgatgcct
ggcagtttat ggcgggcgtc 1140ctgcccgcca ccctccgggc cgttgcttcg
caacgttcaa atccgctccc ggcggatttg 1200tcctactcag gagagcgttc
accgacaaac aacagataaa acgaaaggcc cagtctttcg 1260actgagcctt
tcgttttatt tgatgcctgg cagttcccta ctctcgcatg gggagacccc
1320acactaccat cggcgctacg gcgtttcact tctgagttcg gcatggggtc
aggtgggacc 1380accgcgctac tgccgccagg caaattctgt tttatcagac
cgcttctgcg ttctgattta 1440atctgtatca ggctgaaaat cttctctcat
ccgccaaaac aggatccaat tatggcagat 1500caatgagctt cacagacaca
atatcaggga catttgttag ttctttcaca attttatctt 1560ccagatgtct
gtcaaaggaa agcatcatga tggcttctcc gcctttttcc ttacggccaa
1620cctgcatagt tgcaatgtta atatcattat ctccgagaat acgtcctact
cggccgatga 1680cacctgttgt atcttgatgc tggatataca ccaagtgacc
agtcggataa aaatcaatat 1740taaatccatt gatctcgaca attcgttctc
cgaaatgagg aatatacgta gccgttacag 1800taaaggtgct gcggtctcct
gtcactttta cgctgatgca gttatcgtat ccagattcag 1860aagaggaaat
tttttcactg aagctaatgc cgcgttcttt tgcgacaccc ccggcattga
1920cctcattaac agtagagtct acgcgcggtt ttaaaaagcc tgacagaagg
gcttttgtaa 1980tgaacgatgt ttcaagttta gcaattgtgc cttcatattg
aatggcaaca tcctgtactg 2040gttctttcat gcactgtgat acaaggctgc
caatttttcc tgcaatttga tggtaaggct 2100taattttagc aaattcatct
tttgtcatgg caggcaggtt gatagctgac atgacaggca 2160ggccttttgc
gaactgcaga acttcttctg acacttgggc ggcgacattg agctgtgctt
2220ctttcgttga tgctcccaag tgaggagtgg caatgactaa tggatgatca
acaagtttgt 2280tgtcaactgg cggttcgact tcgaaaacgt caagcgctgc
tcccgcaaca tgcccgtttt 2340ccaaagcttc gagaagtgct gcttcatcga
taattccgcc tcgcgcacag ttaattaagc 2400gaacgccttt tttcgttttt
gcaatcgttt ctttattcaa taagcctttt gtttcttttg 2460ttaaaggcgt
gtgaacggta atgatatccg cactttcaag cacttcttca aatgtacggc
2520tgtttacgcc gatttttttc gctctttctt ccgttaagaa aggatcaaaa
acgtgcacag 2580tcataccgaa cgctcctcga cgctgtgcaa tttcacttcc
gattcggcct aatcctacaa 2640taccaagcgt ttttccataa agctctgaac
cgacataagc tgtgcggttc cactctctgg 2700atttcactga gatattagcc
tgcggaatgt gtctcattaa agaagagatc attgcaaatg 2760tatgctcagc
tgtcgaaatg gtgttgccgt tcggagcatt gatcacgatt accccgtgtt
2820tcgtagcctc atcaatatcg atattatcga caccgacacc ggctcttccg
acaattttta 2880aagaagtcat tttgttgaaa aggtcttctg ttacttttgt
cgcgcttcgc accaaaagag 2940catcaaaagt atgtaattca tcttctgcat
ctgctacgtt tttttgaacg atttcaataa 3000agtctgattc aataagtggc
tgtaaaccgt cgttgctcat tttgtctgag accaatactc 3060gaaacatgtt
ttctcctcct ctagagcgtc ctgctgttgt taagattatt ataccacacc
3120ttgtagataa agtcaacaac tttttgcaaa atttttcagg aattttagca
gaggttgttc 3180tggatgtaga acaaaacatc tttccgctct tgtgctgtta
ggatatcttt cttggaagct 3240aggtaggcct cgagttatgg cagttggtta
aaaggaaaca aaaagaccgt tttcacacaa 3300aacggtcttt ttcgatttct
ttttacagtc acagccactt ttgcaaaaac cggacagctt 3360catgccttat
aactgctgtt tcggtcgaca agcttcgcga agcggccgca aaattcactg
3420gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact
taatcgcctt 3480gcagcacatc cccctttcgc cagctggcgt aatagcgaag
aggcccgcac cgatcgccct 3540tcccaacagt tgcgcagcct gaatggcgaa
tggcgcctga tgcggtattt tctccttacg 3600catctgtgcg gtatttcaca
ccgcatatgg tgcactctca gtacaatctg ctctgatgcc 3660gcatagttaa
gccagccccg acacccgcca acacccgctg actatgcttg taaaccgttt
3720tgtgaaaaaa tttttaaaat aaaaaagggg acctctaggg tccccaatta
attagtaata 3780taatctatta aaggtcattc aaaaggtcat ccaccggatc
agcttagtaa agccctcgct 3840agattttaat gcggatgttg cgattacttc
gccaactatt gcgataacaa gaaaaagcca 3900gcctttcatg atatatctcc
caatttgtgt agggcttatt atgcacgctt aaaaataata 3960aaagcagact
tgacctgata gtttggctgt gagcaattat gtgcttagtg catctaacgc
4020ttgagttaag ccgcgccgcg aagcggcgtc ggcttgaacg aattgttaga
cattatttgc 4080cgactacctt ggtgatctcg cctttcacgt agtggacaaa
ttcttccaac tgatctgcgc 4140gcgaggccaa gcgatcttct tcttgtccaa
gataagcctg tctagcttca agtatgacgg 4200gctgatactg ggccggcagg
cgctccattg cccagtcggc agcgacatcc ttcggcgcga 4260ttttgccggt
tactgcgctg taccaaatgc gggacaacgt aagcactaca tttcgctcat
4320cgccagccca gtcgggcggc gagttccata gcgttaaggt ttcatttagc
gcctcaaata 4380gatcctgttc aggaaccgga tcaaagagtt cctccgccgc
tggacctacc aaggcaacgc 4440tatgttctct tgcttttgtc agcaagatag
ccagatcaat gtcgatcgtg gctggctcga 4500agatacctgc aagaatgtca
ttgcgctgcc attctccaaa ttgcagttcg cgcttagctg 4560gataacgcca
cggaatgatg tcgtcgtgca caacaatggt gacttctaca gcgcggagaa
4620tctcgctctc tccaggggaa gccgaagttt ccaaaaggtc gttgatcaaa
gctcgccgcg 4680ttgtttcatc aagccttacg gtcaccgtaa ccagcaaatc
aatatcactg tgtggcttca 4740ggccgccatc cactgcggag ccgtacaaat
gtacggccag caacgtcggt tcgagatggc 4800gctcgatgac gccaactacc
tctgatagtt gagtcgatac ttcggcgatc accgcttccc 4860tcatgatgtt
taactttgtt ttagggcgac tgccctgctg cgtaacatcg ttgctgctcc
4920ataacatcaa acatcgaccc acggcgtaac gcgcttgctg cttggatgcc
cgaggcatag 4980actgtacccc aaaaaaacag tcataacaag ccatgaaaac
cgccactgcg ccgttaccac 5040cgctgcgttc ggtcaaggtt ctggaccagt
tgcgtgagcg catacgctac ttgcattaca 5100gcttacgaac cgaacaggct
tatgtccact gggttcgtgc cttcatccgt ttccacggtg 5160tgcgtcaccc
ggcaaccttg ggcagcagcg aagtcgaggc atttctgtcc tggctggcga
5220acgagcgcaa ggtttcggtc tccacgcatc gtcaggcatt ggcggccttg
ctgttcttct 5280acggcaaggt gctgtgcacg gatctgccct ggcttcagga
gatcggaaga cctcggccgt 5340cgcggcgctt gccggtggtg ctgaccccgg
atgaagtggt tcgcatcctc ggttttctgg 5400aaggcgagca tcgtttgttc
gcccagcttc tgtatggaac gggcatgcgg atcagtgagg 5460gtttgcaact
gcgggtcaag gatctggatt tcgatcacgg cacgatcatc gtgcgggagg
5520gcaagggctc caaggatcgg gccttgatgt tacccgagag cttggcaccc
agcctgcgcg 5580agcaggggaa ttgatccggt ggatgacctt ttgaatgacc
tttaatagat tatattacta 5640attaattggg gaccctagag gtcccctttt
ttattttaaa aattttttca caaaacggtt 5700tacaagcata acgggttttg
ctgcccgcaa acgggctgtt ctggtgttgc tagtttgtta 5760tcagaatcgc
agatccggct tcaggtttgc cggctgaaag cgctatttct tccagaattg
5820ccatgatttt ttccccacgg gaggcgtcac tggctcccgt gttgtcggca
gctttgattc 5880gataagcagc atcgcctgtt tcaggctgtc tatgtgtgac
tgttgagctg taacaagttg 5940tctcaggtgt tcaatttcat gttctagttg
ctttgtttta ctggtttcac ctgttctatt 6000aggtgttaca tgctgttcat
ctgttacatt gtcgatctgt tcatggtgaa cagctttaaa 6060tgcaccaaaa
actcgtaaaa gctctgatgt atctatcttt tttacaccgt tttcatctgt
6120gcatatggac agttttccct ttgatatcta acggtgaaca gttgttctac
ttttgtttgt 6180tagtcttgat gcttcactga tagatacaag agccataaga
acctcagatc cttccgtatt 6240tagccagtat gttctctagt gtggttcgtt
gtttttgcgt gagccatgag aacgaaccat 6300tgagatcatg cttactttgc
atgtcactca aaaattttgc ctcaaaactg gtgagctgaa 6360tttttgcagt
taaagcatcg tgtagtgttt ttcttagtcc gttacgtagg taggaatctg
6420atgtaatggt tgttggtatt ttgtcaccat tcatttttat ctggttgttc
tcaagttcgg 6480ttacgagatc catttgtcta tctagttcaa cttggaaaat
caacgtatca gtcgggcggc 6540ctcgcttatc aaccaccaat ttcatattgc
tgtaagtgtt taaatcttta cttattggtt 6600tcaaaaccca ttggttaagc
cttttaaact catggtagtt attttcaagc attaacatga 6660acttaaattc
atcaaggcta atctctatat ttgccttgtg agttttcttt tgtgttagtt
6720cttttaataa ccactcataa atcctcatag agtatttgtt ttcaaaagac
ttaacatgtt 6780ccagattata ttttatgaat ttttttaact ggaaaagata
aggcaatatc tcttcactaa 6840aaactaattc taatttttcg cttgagaact
tggcatagtt tgtccactgg aaaatctcaa 6900agcctttaac caaaggattc
ctgatttcca cagttctcgt catcagctct ctggttgctt 6960tagctaatac
accataagca ttttccctac tgatgttcat catctgagcg tattggttat
7020aagtgaacga taccgtccgt tctttccttg tagggttttc aatcgtgggg
ttgagtagtg 7080ccacacagca taaaattagc ttggtttcat gctccgttaa
gtcatagcga ctaatcgcta 7140gttcatttgc tttgaaaaca actaattcag
acatacatct caattggtct aggtgatttt 7200aatcactata ccaattgaga
tgggctagtc aatgataatt actagtcctt ttcctttgag 7260ttgtgggtat
ctgtaaattc tgctagacct ttgctggaaa acttgtaaat tctgctagac
7320cctctgtaaa ttccgctaga cctttgtgtg ttttttttgt ttatattcaa
gtggttataa 7380tttatagaat aaagaaagaa taaaaaaaga taaaaagaat
agatcccagc cctgtgtata 7440actcactact ttagtcagtt ccgcagtatt
acaaaaggat gtcgcaaacg ctgtttgctc 7500ctctacaaaa cagaccttaa
aaccctaaag gcttaagtag caccctcgca agctcgggca 7560aatcgctgaa
tattcctttt gtctccgacc atcaggcacc tgagtcgctg tctttttcgt
7620gacattcagt tcgctgcgct cacggctctg gcagtgaatg ggggtaaatg
gcactacagg 7680cgccttttat ggattcatgc aaggaaacta cccataatac
aagaaaagcc cgtcacgggc 7740ttctcagggc gttttatggc gggtctgcta
tgtggtgcta tctgactttt tgctgttcag 7800cagttcctgc cctctgattt
tccagtctga ccacttcgga ttatcccgtg acaggtcatt 7860cagactggct
aatgcaccca gtaaggcagc ggtatcatca acaggcttac ccgtcttact 7920gtcaac
7926257701DNAArtificial SequenceglyA overexpression plasmid
25gaattttgcg gccgcttcga aagctgtaat ataaaaacct tcttcaacta acggggcagg
60ttagtgacat tagaaaaccg actgtaaaaa gtacagtcgg cattatctca tattataaaa
120gccagtcatt aggcctatct gacaattcct gaatagagtt cataaacaat
cctgcatgat 180aaccatcaca aacagaatga tgtacctgta aagatagcgg
taaatatatt gaattacctt 240tattaatgaa ttttcctgct gtaataatgg
gtagaaggta attactatta ttattgatat 300ttaagttaaa cccagtaaat
gaagtccatg gaataataga aagagaaaaa gcattttcag 360gtataggtgt
tttgggaaac aatttccccg aaccattata tttctctaca tcagaaaggt
420ataaatcata aaactctttg aagtcattct ttacaggagt ccaaatacca
gagaatgttt 480tagatacacc atcaaaaatt gtataaagtg gctctaactt
atcccaataa cctaactctc 540cgtcgctatt gtaaccagtt ctaaaagctg
tatttgagtt tatcaccctt gtcactaaga 600aaataaatgc agggtaaaat
ttatatcctt cttgttttat gtttcggtat aaaacactaa 660tatcaatttc
tgtggttata ctaaaagtcg tttgttggtt caaataatga ttaaatatct
720cttttctctt ccaattgtct aaatcaattt tattaaagtt catttgatat
gcctcctaaa 780tttttatcta aagtgaattt aggaggctta cttgtctgct
ttcttcatta gaatcaatcc 840ttttttaaaa gtcaatatta ctgtaacata
aatatatatt ttaaaaatat cccactttat 900ccaattttcg tttgttgaac
taatgggtgc tttagttgaa gaataaagac cacattaaaa 960aatgtggtct
tttgtgtttt tttaaaggat ttgagcgtag cgaaaaatcc ttttctttct
1020tatcttgata ataagggtaa ctattgaatt cggtaccaag agtttgtaga
aacgcaaaaa 1080ggccatccgt caggatggcc ttctgcttaa tttgatgcct
ggcagtttat ggcgggcgtc 1140ctgcccgcca ccctccgggc cgttgcttcg
caacgttcaa atccgctccc ggcggatttg 1200tcctactcag gagagcgttc
accgacaaac aacagataaa acgaaaggcc cagtctttcg 1260actgagcctt
tcgttttatt tgatgcctgg cagttcccta ctctcgcatg gggagacccc
1320acactaccat cggcgctacg gcgtttcact tctgagttcg gcatggggtc
aggtgggacc 1380accgcgctac tgccgccagg caaattctgt tttatcagac
cgcttctgcg ttctgattta 1440atctgtatca ggctgaaaat cttctctcat
ccgccaaaac aggatccccc atcaacaatt 1500acacacttct attgattcta
caaaaaaaga cattgagttt caagaacatc gtcaaaaaac 1560ccgccgggca
taagcccaag cgggttttag gatcttaata atctaattct ttatataaag
1620gaaatttatc agtcagagca gctacacgct gtcttgcttc ttcaagtttt
ccttcatctt 1680cgtggttttt caatgcaagc gcaatgatag caccgacttc
ttctaatgcg tctccgtcaa 1740aaccgcggct ggttacagca gctgtaccaa
gacggatgcc gcttgttacg aaaggttttt 1800caggatcata tggaatcgcg
tttttgttag acgtaatacc aatttcatca agtacatgct 1860ccgcaacctt
accagtcagt ccgagcgaac gaaggtcaac aaggataagg tggttgtctg
1920ttccgcctga aacgagctgg atgccctctt tcgttaaggc ttcagccaga
cgtttcgcgt 1980ttgaaatgac gttttgtgca tatgttttga aatcgtcctg
caatacttca ccgaatgaaa 2040cagcttttgc ggcaataacg tgcatcagag
ggccgccttg aattccaggg aagatcgatt 2100tatcaatttt cttgccaaac
tcttcacggc aaaggatcat accgccgcga ggaccgcgaa 2160gtgttttatg
tgttgttgtt gtaacgaaat cagcgtaagg aaccgggttt ggatgaaggc
2220ctgccgcaac aagtcctgcg atatgtgcca tatccaccat gaagtaagcg
ccgacttcat 2280cagcaatttc acggaatttc ttaaagtcga ttgtacgagg
atacgcactt gctcctgcta 2340cgataagctt cggtttatga gcgagggctt
tttcacgcac gtcatcgtaa tcaatatatt 2400gagtttcttt atctacgccg
tactcaacaa agttatattg aacaccgctg aagttgactg 2460ggcttccgtg
tgttaaatgg ccgccgtggg agaggttcat cccaagtaca gtatcgcctt
2520gctccaaaat cgtgaagtac actgccatgt ttgcttgtgc gcctgaatga
ggctgaacgt 2580ttacatgctc cgctccaaag atttccttcg cgcggtcacg
ggcgatatct tcaacgacat 2640cgacgtgctc gcatccgccg tagtagcgtt
tgcccggata tccttctgcg tacttatttg 2700tcaaaacaga tccttgtgct
tccataaccg cttcacttac aaagttctca gaagcaatca 2760attcgatctt
agtctgttgg cgttcacgct catttttaat ggcgttaaac acttgttcgt
2820cttgcgcagg taaatgtttc atgtttacac ctcctctaga gcgtcctgct
gttgttaaga 2880ttattatacc acaccttgta gataaagtca acaacttttt
gcaaaatttt tcaggaattt 2940tagcagaggt tgttctggat gtagaacaaa
acatctttcc gctcttgtgc tgttaggata 3000tctttcttgg aagctaggta
ggcctcgagt tatggcagtt ggttaaaagg aaacaaaaag 3060accgttttca
cacaaaacgg tctttttcga tttcttttta cagtcacagc cacttttgca
3120aaaaccggac agcttcatgc cttataactg ctgtttcggt cgacaagctt
cgcgaagcgg 3180ccgcaaaatt cactggccgt cgttttacaa cgtcgtgact
gggaaaaccc tggcgttacc 3240caacttaatc gccttgcagc acatccccct
ttcgccagct ggcgtaatag cgaagaggcc 3300cgcaccgatc gcccttccca
acagttgcgc agcctgaatg gcgaatggcg cctgatgcgg 3360tattttctcc
ttacgcatct gtgcggtatt tcacaccgca tatggtgcac tctcagtaca
3420atctgctctg atgccgcata gttaagccag ccccgacacc cgccaacacc
cgctgactat 3480gcttgtaaac
cgttttgtga aaaaattttt aaaataaaaa aggggacctc tagggtcccc
3540aattaattag taatataatc tattaaaggt cattcaaaag gtcatccacc
ggatcagctt 3600agtaaagccc tcgctagatt ttaatgcgga tgttgcgatt
acttcgccaa ctattgcgat 3660aacaagaaaa agccagcctt tcatgatata
tctcccaatt tgtgtagggc ttattatgca 3720cgcttaaaaa taataaaagc
agacttgacc tgatagtttg gctgtgagca attatgtgct 3780tagtgcatct
aacgcttgag ttaagccgcg ccgcgaagcg gcgtcggctt gaacgaattg
3840ttagacatta tttgccgact accttggtga tctcgccttt cacgtagtgg
acaaattctt 3900ccaactgatc tgcgcgcgag gccaagcgat cttcttcttg
tccaagataa gcctgtctag 3960cttcaagtat gacgggctga tactgggccg
gcaggcgctc cattgcccag tcggcagcga 4020catccttcgg cgcgattttg
ccggttactg cgctgtacca aatgcgggac aacgtaagca 4080ctacatttcg
ctcatcgcca gcccagtcgg gcggcgagtt ccatagcgtt aaggtttcat
4140ttagcgcctc aaatagatcc tgttcaggaa ccggatcaaa gagttcctcc
gccgctggac 4200ctaccaaggc aacgctatgt tctcttgctt ttgtcagcaa
gatagccaga tcaatgtcga 4260tcgtggctgg ctcgaagata cctgcaagaa
tgtcattgcg ctgccattct ccaaattgca 4320gttcgcgctt agctggataa
cgccacggaa tgatgtcgtc gtgcacaaca atggtgactt 4380ctacagcgcg
gagaatctcg ctctctccag gggaagccga agtttccaaa aggtcgttga
4440tcaaagctcg ccgcgttgtt tcatcaagcc ttacggtcac cgtaaccagc
aaatcaatat 4500cactgtgtgg cttcaggccg ccatccactg cggagccgta
caaatgtacg gccagcaacg 4560tcggttcgag atggcgctcg atgacgccaa
ctacctctga tagttgagtc gatacttcgg 4620cgatcaccgc ttccctcatg
atgtttaact ttgttttagg gcgactgccc tgctgcgtaa 4680catcgttgct
gctccataac atcaaacatc gacccacggc gtaacgcgct tgctgcttgg
4740atgcccgagg catagactgt accccaaaaa aacagtcata acaagccatg
aaaaccgcca 4800ctgcgccgtt accaccgctg cgttcggtca aggttctgga
ccagttgcgt gagcgcatac 4860gctacttgca ttacagctta cgaaccgaac
aggcttatgt ccactgggtt cgtgccttca 4920tccgtttcca cggtgtgcgt
cacccggcaa ccttgggcag cagcgaagtc gaggcatttc 4980tgtcctggct
ggcgaacgag cgcaaggttt cggtctccac gcatcgtcag gcattggcgg
5040ccttgctgtt cttctacggc aaggtgctgt gcacggatct gccctggctt
caggagatcg 5100gaagacctcg gccgtcgcgg cgcttgccgg tggtgctgac
cccggatgaa gtggttcgca 5160tcctcggttt tctggaaggc gagcatcgtt
tgttcgccca gcttctgtat ggaacgggca 5220tgcggatcag tgagggtttg
caactgcggg tcaaggatct ggatttcgat cacggcacga 5280tcatcgtgcg
ggagggcaag ggctccaagg atcgggcctt gatgttaccc gagagcttgg
5340cacccagcct gcgcgagcag gggaattgat ccggtggatg accttttgaa
tgacctttaa 5400tagattatat tactaattaa ttggggaccc tagaggtccc
cttttttatt ttaaaaattt 5460tttcacaaaa cggtttacaa gcataacggg
ttttgctgcc cgcaaacggg ctgttctggt 5520gttgctagtt tgttatcaga
atcgcagatc cggcttcagg tttgccggct gaaagcgcta 5580tttcttccag
aattgccatg attttttccc cacgggaggc gtcactggct cccgtgttgt
5640cggcagcttt gattcgataa gcagcatcgc ctgtttcagg ctgtctatgt
gtgactgttg 5700agctgtaaca agttgtctca ggtgttcaat ttcatgttct
agttgctttg ttttactggt 5760ttcacctgtt ctattaggtg ttacatgctg
ttcatctgtt acattgtcga tctgttcatg 5820gtgaacagct ttaaatgcac
caaaaactcg taaaagctct gatgtatcta tcttttttac 5880accgttttca
tctgtgcata tggacagttt tccctttgat atctaacggt gaacagttgt
5940tctacttttg tttgttagtc ttgatgcttc actgatagat acaagagcca
taagaacctc 6000agatccttcc gtatttagcc agtatgttct ctagtgtggt
tcgttgtttt tgcgtgagcc 6060atgagaacga accattgaga tcatgcttac
tttgcatgtc actcaaaaat tttgcctcaa 6120aactggtgag ctgaattttt
gcagttaaag catcgtgtag tgtttttctt agtccgttac 6180gtaggtagga
atctgatgta atggttgttg gtattttgtc accattcatt tttatctggt
6240tgttctcaag ttcggttacg agatccattt gtctatctag ttcaacttgg
aaaatcaacg 6300tatcagtcgg gcggcctcgc ttatcaacca ccaatttcat
attgctgtaa gtgtttaaat 6360ctttacttat tggtttcaaa acccattggt
taagcctttt aaactcatgg tagttatttt 6420caagcattaa catgaactta
aattcatcaa ggctaatctc tatatttgcc ttgtgagttt 6480tcttttgtgt
tagttctttt aataaccact cataaatcct catagagtat ttgttttcaa
6540aagacttaac atgttccaga ttatatttta tgaatttttt taactggaaa
agataaggca 6600atatctcttc actaaaaact aattctaatt tttcgcttga
gaacttggca tagtttgtcc 6660actggaaaat ctcaaagcct ttaaccaaag
gattcctgat ttccacagtt ctcgtcatca 6720gctctctggt tgctttagct
aatacaccat aagcattttc cctactgatg ttcatcatct 6780gagcgtattg
gttataagtg aacgataccg tccgttcttt ccttgtaggg ttttcaatcg
6840tggggttgag tagtgccaca cagcataaaa ttagcttggt ttcatgctcc
gttaagtcat 6900agcgactaat cgctagttca tttgctttga aaacaactaa
ttcagacata catctcaatt 6960ggtctaggtg attttaatca ctataccaat
tgagatgggc tagtcaatga taattactag 7020tccttttcct ttgagttgtg
ggtatctgta aattctgcta gacctttgct ggaaaacttg 7080taaattctgc
tagaccctct gtaaattccg ctagaccttt gtgtgttttt tttgtttata
7140ttcaagtggt tataatttat agaataaaga aagaataaaa aaagataaaa
agaatagatc 7200ccagccctgt gtataactca ctactttagt cagttccgca
gtattacaaa aggatgtcgc 7260aaacgctgtt tgctcctcta caaaacagac
cttaaaaccc taaaggctta agtagcaccc 7320tcgcaagctc gggcaaatcg
ctgaatattc cttttgtctc cgaccatcag gcacctgagt 7380cgctgtcttt
ttcgtgacat tcagttcgct gcgctcacgg ctctggcagt gaatgggggt
7440aaatggcact acaggcgcct tttatggatt catgcaagga aactacccat
aatacaagaa 7500aagcccgtca cgggcttctc agggcgtttt atggcgggtc
tgctatgtgg tgctatctga 7560ctttttgctg ttcagcagtt cctgccctct
gattttccag tctgaccact tcggattatc 7620ccgtgacagg tcattcagac
tggctaatgc acccagtaag gcagcggtat catcaacagg 7680cttacccgtc
ttactgtcaa c 7701
* * * * *