Alpha-Amylase Variant With Altered Properties

Abstract

The present invention relates to variants of parent alpha-amylases, which variant has alpha-amylase activity and exhibits an alteration in at least one of the following properties relative to said parent alpha-amylase: substrate specificity, substrate binding substrate cleavage patterns thermal stability, pH/activity profile, pH/stability profile, stability towards oxidation, specific activity, and altered pl, in particular higher pl.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. Ser. No. 10/399,161 filed Apr. 11, 2003 which is a 35 U.S.C. 371 national application of PCT/DK01/00668 filed Oct. 12, 2001 (the international application was published under POT Article 21(2) in English), which claims priority or the benefit under 35 U.S.C. 119 of Danish application nos. PA 2000 01533, filed Oct. 13, 2000, and PA 2001 01442, filed Oct. 2, 2001 and U.S. provisional application Nos. 60/242,692, filed Oct. 23, 2000, and 60/326,752, filed Oct. 3, 2001, the contents of which are fully incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates to variants (mutants) of parent alpha-amylases, in particular of Bacillus origin, which variant has alpha-amylase activity and exhibits an alteration in at least one of the following properties relative to said parent alpha-amylase: substrate specificity, substrate binding, substrate cleavage pattern, thermal stability, pH/activity profile, pH/stability profile, stability towards oxidation, specific activity, and pl, in particular higher pl.

BACKGROUND OF THE INVENTION

[0003] Alpha-Amylases (alpha-1,4-glucan-4-glucanohydrolases, E.C. 3.2.1.1) constitute a group of enzymes, which catalyze hydrolysis of starch and other linear and branched 1,4-glucosidic oligo- and polysaccharides.

[0004] The object of the invention is to provide an improved alpha-amylase, in particular suitable for detergent use.

BRIEF DISCLOSURE OF THE INVENTION

[0005] The object of the present invention is to provide an alpha-amylases which variants in comparison to the corresponding parent alpha-amylase, i.e., un-mutated alpha-amylase, has alpha-amylase activity and exhibits an alteration in at least one of the following properties relative to said parent alpha-amylase: substrate specificity, substrate binding, substrate cleavage pattern, thermal stability, pH/activity profile, pH/stability profile, stability towards oxidation, Ca.sup.2 + dependency, specific activity, and pi.

Nomenclature

[0006] In the present description and claims, the conventional one-letter and three-letter codes for amino acid residues are used. For ease of reference, alpha-amylase variants of the invention are described by use of the following nomenclature:

[0007] Original amino acid(s): position(s); substituted amino acid(s)

[0008] According to this nomenclature, for instance the substitution of alanine for asparagine in position 30 is shown as.

[0009] Ala30Asn or A30N

[0010] a deletion of alanine in the same position is shown as:

[0011] Ala30* or A30*

[0012] and insertion of an additional amino acid residue, such as lysine, is shown as:

[0013] Ala30AlaLys or A30AK

[0014] A deletion of a consecutive stretch of amino acid residues, such as amino acid residues 30-33, is indicated as (30-33)* or .DELTA.(A30-N33).

[0015] Where a specific alpha-amylase contains a "deletion" in comparison with other alpha-amylases and an insertion is made in such a position this is indicated as:

[0016] *36Asp or *36D

[0017] for insertion of an aspartic acid in position 36.

[0018] Multiple mutations are separated by plus signs, i.e.:

[0019] Ala30Asp+Glu34Ser or A30N+E34S

[0020] representing mutations in positions 30 and 34 substituting alanine and glutamic acid for asparagine and serine, respectively.

[0021] When one or more alternative amino acid residues may be inserted in a given position it 20;3 is indicated as

[0022] A30N,E or

[0023] A30N or A30E

[0024] Furthermore, when a position suitable for modification is identified herein without any specific modification being suggested, it is to be understood that any amino acid residue may be substituted for the amino acid residue present in the position. Thus, for instance, when a modification of an alanine in position 30 is mentioned, but not specified, it is to be understood that the alanine may be deleted or substituted for any other amino acid, i.e., any one of:

[0025] R,N,D,A,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V.

[0026] Further, "A30X" means any one of the following substitutions:

[0027] A30R, A30N, A30D, A30C, A30Q, A30E, A30G, A30H, A30I, A30L, A30K, A30M, A30F, A30P, A30S, A30T, A30W, A30Y, or A30V: or in short: A30R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T.W,Y,V.

BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG. 1 is an alignment of the amino acid sequences of five parent alpha-amylases.

[0029] The numbers on the extreme left designate the respective amino acid sequences as follows:

[0030] 1: SEQ ID NO: 6 (Bacillus licheniformis alpha-amylase)

[0031] 2: SEQ ID NO: 8 (KSM-AP1378 alpha-amylase)

[0032] 3: SEQ ID NO: 2 (KSM-K36 alpha-amylase)

[0033] 4: SEQ ID NO: 4 (KSM-K38 alpha-amylase)

DETAILED DISCLOSURE OF THE INVENTION

[0034] The object of the present invention is to provide an alpha-amylases, in particular of Bacillus origin, which variants has alpha-amylase activity and exhibits an alteration in at least one of the following properties relative to said parent alpha-amylase; substrate specificity, substrate binding, substrate cleavage pattern, thermal stability, pH/activity profile, pH/stability profile, stability towards oxidation, specific activity, and altered pl, in particular higher pl.

Parent Alpha-Amylases

[0035] Contemplated alpha-amylases include the alpha-amylases shown in SEQ ID NO: 2 or SEQ ID NO: 4 of Bacillus origin and alpha-amylase having at least 70% identity thereto, The SEQ ID NO: 1 shows the DNA sequence encoding KSM-K36 and SEQ ID NO: 3 show the DNA sequence encoding KSM-K38. These two alpha-amylases are disclosed in EP 1,022,334 (hereby incorporated by reference).

[0036] The KSM-K38 alpha-amylase has about 67% identity with the KSM-AP1378 alpha-amylase disclosed in WO 97100324); 64% identity with the #707 alpha-amylase derived from Bacillus sp.#707 disclosed by Tsukamoto et al,. Biochemical and Biophyical Research Communications, 151 (1988), pp. 25-31; and about 63% identity with the Bacillus licheniformis alpha-amylase described in EP 0252666 (ATCC 27811).

[0037] Other alpha-amylases within the scope of the present invention include alpha-amylases i) which displays at least 70%, such as at least 75%, or at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% homology with at least one of said amino acid sequences shown in SEQ ID NOS: 2 or 4, and/or ii) is encoded by a DNA sequence which hybridizes to the DNA sequences encoding the above-specified alpha-amylases which are apparent from SEQ ID NOS: 1 or 3.

[0038] In connection with property i), the homology may be determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (described above). Thus, Gap GCGv8 may be used with the following default parameters, GAP creation penalty of 5.0 and GAP extension penalty of 0.3, default scoring matrix. GAP uses the method of Needleman/Wunsch/Sellers to make alignments.

[0039] Aternatively, the software Clustal X obtainable from EMBL (ftp.embl-heidelberg.de) may be used for multiple alignments with a gap creation penalty of 30, a gap extension penalty of 1 without gap penalty.

[0040] A structural alignment between the KSM-K36 or KSM-K38 alpha-amylases (SEQ ID NO: 2 and 4) and other alpha-amylase may be used to identify equivalent corresponding positions in other alpha-amylases. One method of obtaining said structural alignment is to use the Pile Up programme from the GCG package using default values of gap penalties, i.e., a gap creation penalty of 3.0 and gap extension penalty of 0.1. Other structural alignment methods include the hydrophobic cluster analysis (Gaboriaud et al., (1987), FEBS LETTERS 224, pp. 149-155) and reverse threading (Huber, T; Torda, AE, PROTEIN SCIENCE Vol. 7, No. 1 pp. 142-149 (1998). An alignment of the KSM-K36, KSM-K38, KSM-AP1378 and the Bacillus licheniformis alpha-amylase is shown in FIG. 1.

Hybridisation

[0041] The oligonucleotide probe used in the characterisation of the KSM-K36 or KSM-K38 alpha-amylases in accordance with property ii) above may suitably be prepared on the An basis of the full or partial nucleotide or amino acid sequence of the alpha-amylase in question. Suitable conditions for testing hybridisation involve pre-soaking in 5.times.SSC and prehybridizing for 1 hour at .about.40.degree. C. in a solution of 20% formamide. 5.times.Denhardt's solution. 50 mM sodium phosphate, pH 6.8, and 50 mg of denatured sonicated calf thymus DNA, followed by hybridisation in the same solution supplemented with 100 mM ATP for 18 hours at 40.degree. C., followed by three times washing of the filter in 2.times.SSC, 0.2% SDS at 40.degree. C. for 30 minutes (low stringency), preferred at 50.degree. C. (medium stringency), more preferably at 65.degree. C. (high stringency), even more preferably at 75.degree. C. (very high stringency). More details about the hybridisation method can be found in Sambrook et al., Molecular_Cloning; A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989.

[0042] In the present context, "derived from" is intended not only to indicate an alpha-amylase produced or producible by a strain of the organism in question, but also an alpha-amylase encoded by a DNA sequence isolated from such strain and produced in a host organism transformed with said DNA sequence, Finally, the term is intended to indicate an alpha-amylase, which is encoded by a DNA sequence of synthetic and/or cDNA origin and which has the identifying characteristics of the alpha-amylase in question. The term is also intended to indicate that the parent alpha-amylase may be a variant of a naturally occurring alpha-amylase, i.e., a variant, which is the result of a modification (insertion, substitution., deletion) of one or more amino acid residues of the naturally occurring alpha-amylase.

Altered Properties

[0043] The following discusses the relationship between mutations, which are present in variants of the invention, and desirable alterations in properties (relative to those a parent KSM-K36 or KSM-K38 alpha-amylases), which may result therefrom.

[0044] As mentioned above the invention relates to alpha-amylase variants with altered properties.

[0045] In an aspect the invention relates to variant with altered properties as mentioned above, in the first aspect a variant of a parent KSM-K36 or KSM-K38 alpha-amylase, comprising an alteration at one or more positions (using SEQ ID NO: 2 or 4 for the amino acid numbering) selected from the group of:

2,9,14,15,16,26,27,48,49,51,52,53,54,58,73,88,94,96,103,104,107,108,111,1- 14,128,130,133, 138,140,142,144,148,149,156,161,165,166,168,171,173,1774.178,179,180,181,- 183,184,187,188, 190,194,197,198,199,200,201,202,203,204,205,207,209,210,211,212,214,221,2- 22,224,228, 230,233,234,237,239,241,242,252,253,254.255,260,264,265,267,275,278.277,2- 80,281,286, 290,293,301,305,314,315,318,329,333,340,341,356,375,376,377,380,383,384,3- 86,389,399,403, 404,405,406,427,441,444,453,454,472,479,480 wherein

[0046] (a) the alteration(s) are independently

[0047] (i) an insertion of an amino acid downstream of the amino acid which occupies the position,

[0048] (ii) a deletion of the amino acid which occupies the position, or

[0049] (iii) a substitution of the amino acid which occupies the position with a different amino acid,

[0050] (b) the variant has alpha-amylase activity and (c) each position corresponds to a position of the amino acidc sequence of the parent alpha-amylase having the amino acid sequence of the KSM-K36 alpha-amylases shown in SEQ ID NO: 2.

[0051] In the KSM-38 alpha-amylase the target positions are:

2,9,14,15,16,26,27,48,49,51,52,53,54,58,73,88,94,96,103,104,107,108,111,1- 14,128,130,133, 138,140,142,144,148,149,156,161,165,166,168,171,173,174,178,179,180,181,1- 83.184,187,188, 190,194,197,198,199,200,201,202,203,204,205,207,209,210,211,212,214,221,2- 22,224,228, 230,233,234,237,239,241,242,252,253,254,255,260,264,265,267,275,276,277,2- 80,231,286, 290,293,301,305,314,315,318,329,333,340,341,356,375,376,377,380,383,384,3- 86,389,399,403, 404,405,406,427,441,444,453,454,472,479,480.

[0052] In a preferred embodiment of the invention the variant comprise one or more of the following substitutions (using SEQ ID NO: 2 for the numbering):

G2P,A; M9l,L,F; H14Y; L15M,I,F,T; E16P; H26Y,Q,R,N; D27N,S,T; G48A,V,S,T; N49X; Q51X; A52X; D53E,Q,R; V54X; A58V,L,I,F; V73L,I,F; E84Q; G88X; D94X; N96Q; M103l,L,F; N104D; M/L107G,A,V,T,S; G108A; F111G,A,V,l,L,T, A114D,l,L,M,V,R; T125S; D128T,E; S130T,C; Y133F,H; W138F,Y, G140H,R,K,D,N; D142H,R,K,N; S144P; N148S; A149l; R156H,K,D,N; N161X; W165R; D166E; R168P; E171L,I,F; H173RK, L; I173L; L174I,F; A178N,Q,R,K,H; N179G,A,T,S; T180N,Q,R,K,H; N181X; N183X; W184R,K; D187N,S,T; E188P,T,I,S; N190F: D194X, L197X; G198X; S199X, N200X; I201L,M,F,Y; D202X; F203L,I,F,M; S204X,H205X; E207Y,R; Q209V,L,I,F,M; E210X; E211Q; L212I,F; D214N,R,K,H; D221N: E222Q,T, D224N,Q; Y228F; L230I,F; I233A,V,L,F; K234N,Q; P237X; W39X; T241L,I,F,M; S242P,R; A52T; D253G,A,V,N; Q254K; D255N,Q,E,P; G260A; K264Q,S,T; D265N,Y; V267L,I,F,M; D275N,T; E276K; M277T,l,L,F; E280N,T,Q,S; M281H,l,L,F; V286X, preferably V286Y,L,I,F; Y290X; Y293H,F; S301G,A,D,K,E,R; R305A,K,Q,E,H,D,N; E314K,Q,R,S,T,H,N; A315K,R,S; I318L,M,F; T329S; E333Q; A340R,K,N,D,Q,E; D341P,T,S,Q,N; G356Q,E,S,T,A; S375P; A376S; K377L,I,F,M; M380l,L,F; E383P,Q; L384I,F; D386N,Q,R,K,l,L, Q389K,R; Y399A,D,H; W403X; D404N; I405L,F; V406l,L,F,A,D; N427X; H441K,N,D,Q,E; R442Q; Q444E,K,R; A445V; Q448A; H453R,K,Q,N; A454S,T,P; G472R, N479Q,K,R; Q480K,R.

[0053] In another preferred embodiment of the invention the variant comprise one or more of the following substitutions (using SEQ ID NO: 4 for the numbering):

G2P,A; M9I,L,F; H14Y; L15M,I,F,T; E16P; H26Y,Q,R,N; O27N,S,T; G48A,V,S,T; N49X; O51X; A52X; D53E,Q,R; V54X; A58V,L,I,F; V73L,I,F; E84Q; G88X; D94X; N96Q; M103I,L,F;, N104D; M/L107G,A,V,T,S,I,L,F; G108A; F111G,A,V,I,L,T; A114D,l,W,M,V,R; T125S; D128T,E; S130T,C; Y133F,H; W138F,Y; G140H,R,K,D,N; D142H,R,K,N; S144P; N148S; A149I; R156H,K,D,N; N161X; W165R; O166E; R168P; E171L,I,F; H173R,K,L; I173L; I174L,F; A178N,Q,R,K,H; N179G,A,T,S; T180N,Q,R,K,H: N181X; N183X; W184R,K; D187N,S,T; E188P,T,l,S; N190F; O194X; L197X; G198X; S199X; N200X: I201L,M,F,Y; D202X; F203L,I,F,M; S204X; H205X; E207Y,R; O209V,L,I,F,M; D210X; D210E; E211Q; L212I,F; D214N,R,K,H; D221N; E222Q,T; D224N,Q; Y228F; L230I,F; I233A,V,L,F; K234N,Q; P237X; W239X; T241L,I,F,M; S242P,R; A252T; 253G,A,V,N; O254K; D255N,Q,E,P; G260A; K264Q,S, T; D265N,Y; V267L,I,F,M; O275N,T; E276K; M277T,I,W,F; E280N,T,Q,S; M281H,I,L,F; V286X, preferably V286Y,L,I,F; Y290X; Y293H,F; S301G,A,D,K,E,R; R305A,K,Q,E,H,D,N; E314K,Q,R,S,T,H,N A315K,R,S M311L,I,F; T329S; E333Q; A340R,K,N,D,Q,E; D341P,T,S,Q,N; G356Q,E,S,T,A; S375P; A376S; K377L,F,M; M380I,L,F; E383P,Q; L384I,F; D386N,Q,R,K,l,L; Q389K,R; Y399A,D,H; W403X; D404N; V405L,F,I; V406l,L,F,A,D; N427X; N441K,D,Q,E,H; R442Q; Q444E,K,R; A445V; Q448A, N453R,K,Q,H; G454A,S,T,P; G472R, N479Q,K,R; Q480K,R.

[0054] Within the scope of the invention are vanants of other parent alpha-amylases (as defined herein) with one or more corresponding mutations.

[0055] In an embodiment of the invention a variant of the invention may comprise the following combination of substitutions;

[0056] N49l+L/M107A;

[0057] N49L+L/M107A;

[0058] G48A+N49l+L/M107A;

[0059] G48A+N49L+L/M107A

[0060] E188S,T,P+N190F+1201F+K264S;

[0061] G48A+N49l+L/M107A+E188S,T,P+N190F+I201F+K264S;

[0062] N190F+I201F;

[0063] N190F+K264S; I201F+K264S;

[0064] G140H+D142H+R156H,Y(+S144P);

[0065] G140K+D142D+R156H,Y(+S144P);

[0066] L197M+G198Y+S199A;

[0067] L15T+E188S+Q209V+A376S+G472R;

[0068] G48A+N491+L/M107A+G140H+D142H+R156H,Y+E188P+N190F+I201F+K264S(+S144- P);

[0069] N49T+L/M107A+G140H+D142H+R156H,Y+E188P+N190F+I201F+K264S(+S144P), "/" before number indicate that KSM-K36 and KSM-K38 has different amino acid on the actual position. For instance L/M107A means that in KSM-K36 the mutation is L107A and in KSM-K38 the substitution is M107A.

Altered pl

[0070] Important positions and mutations with respect to achieving altered pl, in particular a higher pl, in particular at high pH (i.e., pH 8-10.5) include any of the positions and mutations listed in the in "Altered Properties" section. It should be noted that when the alpha-amylase of the invention is for detergent use a high pl is desirable--for instance a pi in the range from 7-10.

Stability

[0071] Important positions and mutations with respect to achieving altered stability, in particular improved stability (i.e., higher or lower) at especially high pH (i.e., pH 8-10.5) include any of the positions and mutations listed in the in "Altered Properties" section.

Oxidation Stability

[0072] Variants of the invention may have altered oxidation stability, in particular higher oxidation stability, in comparison to the parent alpha-amylase.

[0073] In an embodiment such an alpha-amylase variant has one or more of Methionine amino acid residues exchanged with any amino acid residue except for Cys and Met. Thus, according to the invention the amino acid residues to replace the Methionine amino acid residue are the followings Ala, Arg, Asn, Asp, GIn, Glu, Gly, His, Ile, Leu, Lys, Phe, Pro, Ser, Thr, Trp, Tyr, and Val.

[0074] A preferred embodiment of the alpha-amylase of the invention is characterized by the fact that one or more of the Methionine amino acid residues is (are) exchanged with a Phe, Leu, Thr, Ala, GWy, Ser, Ile, or Val amino acid residue, preferably a Leu, Ile, Phe amino acid residue. In this embodiment a very satisfactory activity level and stability in the presence of oxidizing agents is obtained. Specifically this means that one or more of the Methionines in the following position may be replaced or deleted using any suitable technique known in the art, including especially site directed mutagenesis and gene shuffling. Target Methionine positions, using the SEQ ID NO: 2 numbering (KSM-K36), are one or more of M7, M8, M103, N277, M281, M304, M383, M428, M438.

[0075] Target Methionine positions, using the SEQ ID NO: 4 numbering (KSM-K38), are one or more of M7, M8, M103, M107, M197, M277, M281, M304, M318, M383, M428, M438.

[0076] In a preferred embodiment of the mutant alpha-amylase of the invention is characterized by the fact that the Methionine amino acid residue at position M107 and/or M277 and/or M281 and/or M318 and/or M383 and/or M428 is(are) exchanged with any of amino acid residue expect for Cys and Met, preferably with a Phe, Leu, Thr, Ala, Gly, Ser, Ile, or Asp. Also other parent alpha-amylases, as defined above, may have one or more Methionines substituted or deleted in particular in corresponding positions.

Specific Activity

[0077] Important positions and mutations with respect to obtaining variants exhibiting altered specific activity, in particular increased or decreased specific activity, especially at temperatures from 10-60.degree. C., preferably 20-50.degree. C. especially 30-40.degree. C., include any of the below positions and substitutions. The amino acid residues of particular importance are those involved in substrate binding. Primary target positions, using the SEQ ID NO: 2 numbering (KSM-K36), are one or more of G48, N49, Q51, A52, D53, V54, L107, G108, W165, D166, L197, G198, S199, K234, K264.

[0078] Primary target positions, using the SEQ ID NO: 4 numbering (KSM-K38), are one or more of G48, N49, Q51, A52, D53, V54, M107, G108, W165, D166, L197, G198, S199, K234, K264.

[0079] Preferred specific mutations/substitutions are the ones listed above in the section "Altered Properties" for the positions in question,

Altered pH Profile

[0080] Important positions and mutations with respect to obtaining variants with altered pH profile, in particular improved activity at especially low pH (i.e., pH 4-6) include mutations of amino residues located close to the active site residues, i.e., D229, E261, D328. Primary target positions, using the SEQ ID NO: 2 numbering (KSM-K36), are one or more of N104, E333 Primary target positions, using the SEQ ID NO: 4 numbering (KSM-K38), are one or more of N104, E333.

Preferred specific mutations/substitutions are the ones listed above in the section "Altered properties" for the positions in question.

Altered Alpha-Amylase Activity

[0081] A variant of the invention may have altered alpha-amylase activity, in particular increased alpha-amylase activity, in comparison to the parent alpha-amylase using the Phadebas.RTM. assay described below in the "Materials & Methods" section.

[0082] In a preferred embodiment of the invention an alpha-amylase substituted in a position corresponding to position 286 using the SEQ ID NO: 2 for the numbering has increased alpha-amylase activity. Preferred substitutions are V286Y,L,I,F.

[0083] In Bacillus sp. (SEQ ID NO: 2) the following substitution are result in increased activity: V286X (i.e., V286A,R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y), preferred are V286Y,L,I,F.

[0084] In Bacillus sp. (SEQ ID NO: 4) the following substitution are result in increased activity: A286X (i.e., V286R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V), preferred are A286Y,L,I,F.

Other Mutations

[0085] Other preferred mutations to increase the stability of a particular protein include substitutions to a similar amino acid having a larger side chain, in order to fill out internal holds in the globular structure. Examples of these include glycine to alanine, alanine to valine, valine to isoleucine or leucine, alanine to serine, serine to threonine, asparagine to glutamine, asparatate to glutamate, phenyl to tyrosine or tryptophane, tyrosine to tryptophane, asparagine or asparatate to histidine, histidine to tyrosine and lysine to arginine substitutions, but are not limited to these examples only. Preferred mutations are Q84E, N96D, N121D, N393H, N444H.

[0086] Examples of larger mutations in SEQ 2 include; A315S/V and V101I. Examples of larger mutations in SEQ 4 include; V101I, A132V, D210E, A315S/V, V408I, S416T and A447V. Also other parent alpha-amylases, as defined above, may have one or more amino acid substituted into a larger amino acid, in particular in corresponding positions.

[0087] Other preferred mutations include substitutions of glycine residues to decrease the flexibility of the protein backbone, Examples of glycine substitutions in SEQ 2 and 4 includes: 19, 36, 48, 55, 57, 65, 71, 82, 88, 99, 108, 131, 140, 145, 162, 191, 198, 216, 227, 260, 268, 299, 300, 310, 332, 356, 357, 364. 368, 397, 410, 415, 423, 431, 433, 432, 441, 447, 454, 457, 464, 466, 468, 474, 475 and in particular G464A/S/N, Also other parent alpha-amylases, as defined above, may have one or more glycines substituted or deleted in particular in corresponding positions.

[0088] Other preferred mutations include introduction of proline residues in positions where possible with respect to limitations in the dihedral angles of the protein backbone and in the secondary structure. Examples of substitutions into proline in SEQ 2 include: W13, E16, Q51, L61, A109, G131, W182, D187, I233, I307, S334, W338, D341, W342, A379, S417. Examples of substitutions into proline in SEQ 4 include; W13, E16, Q51, L61, A109, G131, S144, W182, D187, I233, I307, S334, W338, D341,W342, A379, S417. Also other parent alpha-amylases, as defined above, may be stabilised by introduction of a proline, in particular in corresponding positions.

[0089] Important positions and mutations with respect to obtaining variants with improved stability at low pH are Aspargine substitutions. Preferred mutations include substitution or deletion of one or more Aspargine (Asn). Target Aspargines in SEQ ID NO: 2 (KSM-36) are N4, N17, N23, N34, N49, N68, N93, N96, N104, N121, N124, N147, N148, N161, N172, N179, N181, N183, N190, N192, N200, N278, N289, N291, N306, N326, N360, N371, N373, N393, N421, N430, N455, N463, N473, N482, which may be substituted with any other amino acid, or deleted, in particular N190F.

[0090] Target Aspargines in SEQ ID NO: 4 (KSM-38) are N17, N23, N49, N68, N93, N96, N104, N121, N124, N147, N148, N161, N172, N179, N181, N183, N190, N192, N200, N250, N278, N289, N291, N306, N326, N360, N371, N373, N393, 421, N430, N444, N455, N456, N463, N473, N482, which may be substituted with any other amino acid, or deleted, in particular N190F.

[0091] Also other parent alpha-amylases, as defined above, may have one or more Aspargines substituted or deleted in particular in corresponding positions.

Methods for Preparing Alpha-Amylase Variants of the Invention

[0092] Several methods for introducing mutations into genes are known in the art. After a brief discussion of the cloning of alpha-amylase-encoding DNA sequences, methods for generating mutations at specific sites within the alpha-amylase-encoding sequence will be discussed.

Cloning a DNA Sequence Encoding an Alpha-Amylase

[0093] The DNA sequence encoding a parent alpha-amylase may be isolated from any cell or microorganism producing the alpha-amylase in question, using various methods well known in the art. First, a genomic DNA and/or cDNA library should be constructed using chromosomal DNA or messenger RNA from the organism that produces the alpha-amylase to be studied. Then, if the amino acid sequence of the alpha-amylase is known, homologous, labeled oligonucleotide probes may be synthesized and used to identify alpha-amylase-encoding clones from a genomic library prepared from the organism in question. Alternatively, a labeled oligonucleotide probe containing sequences homologous to a known alpha-amylase gene could be used as a probe to identify alpha-amylase-encoding clones, using hybridization and washing conditions of lower stringency.

[0094] Yet another method for identifying alpha-amylase-encoding clones would involve inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming alpha-amylase-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar containing a substrate for alpha-amylase, thereby allowing clones expressing the alpha-amyiase to be identified.

[0095] Alternatively, the DNA sequence encoding the enzyme may be prepared synthetically by established standard methods, e.g., the phosphoroamidite method described by S. L. Beaucage and M. H. Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-1869, or the method described by Matthes et al., The EMBO J. 3, 1984, pp. 801-805. In the phosphoroamidite method, oligonucleotides are synthesized, e.g., in an automatic DNA synthesizer, purified, annealed, ligated and cloned in appropriate vectors.

[0096] Finally, the DNA sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate, the fragments corresponding to various parts of the entire DNA sequence), in accordance with standard techniques. The DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in U.S. Pat. No. 4,683,202 or R. K. Saiki et al., Science 239, 1988, pp. 487-491.

Site-Directed Mutaenesis

[0097] Once an alpha-amylase-encoding DNA sequence has been isolated, and desirable sites for mutation identified, mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis. In a specific method, a single-stranded gap of DNA, bridging the alpha-amylase-encoding sequence, is created in a vector carrying the alpha-amylase gene. Then the synthetic nucteotide, bearing the desired mutation, is annealed to a homologous portion of the single-stranded DNA. The remaining gap is then filled in with DNA polymerase I (Klenow fragment) and the construct is ligated using T4 ligase. A specific example of this method is described in Morinaga et al., (1984, Biotechnology 2:646-639). U.S. Pat. No. 4,760,025 discloses the introduction of oligonucleotides encoding multiple mutations by performing minor alterations of the cassette. However, an even greater variety of mutations can be introduced at any one time by the Morinaga method, because a multitude of oligonucleotides, of various lengths, can be introduced.

[0098] Another method for introducing mutations into alpha-amylase-encoding DNA sequences is described in Nelson and Long, Analyticla Biochemistry 180, 1989, pp. 147-151. It involves the 3-step generation of a PCR fragment containing the desired mutation introduced by using a chemically synthesized DNA strand as one of the primers in the PCR reactions. From the PCR-generated fragment, a DNA fragment carrying the mutation may be isolated by cleavage with restriction endonucleases and reinserted into an expression plasmid.

Random Mutagenesis

[0099] Random mutagenesis is suitably performed either as localised or region-specific random mutagenesis in at least three parts of the gene translating to the amino acid sequence shown in question, or within the whole gene.

[0100] The random mutagenesis of a DNA sequence encoding a parent alpha-amylase may be conveniently performed by use of any method known in the art.

[0101] In relation to the above, a further aspect of the present invention relates to a method for generating a variant of a parent alpha-amylase, e.g. wherein the variant exhibits altered or increased thermal stability relative to the parent, the method comprising:

[0102] (a) subjecting a DNA sequence encoding the parent alpha-amylase to random mutagenesis,

[0103] (b) expressing the mutated DNA sequence obtained in step (a) in a host cell, and

[0104] (c) screening for host cells expressing an alpha-amylase variant which has an altered property (e.g., pH-stability) relative to the parent alpha-amylase.

[0105] Step (a) of the above method of the invention is preferably performed using doped primers.

[0106] For instance, the random mutagenesis may be performed by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the random mutagenesis may be performed by use of any combination of these mutagenizing agents. The mutagenizing agent may, e.g., be one that induces transitions, transversions, inversions, scrambling, deletions, and/or insertions.

[0107] Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultravolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisuiphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the DNA sequence encoding the parent enzyme to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions for the mutagenesis to take place and selecting for mutated DNA having the desired properties.

[0108] When the mutagenesis is performed by the use of an oligonucleotide, the oligonucleotide may be doped or spiked with the three non-parent nucleotides during the synthesis of the oligonucleotide at the positions, which are to be changed. The doping or spiking may be done so that codons for unwanted amino acids are avoided. The doped or spiked oligonucleotide can be incorporated into the DNA encoding the alpha-amylase enzyme by any published technique, using e.g. PCR, LCR or any DNA polymerase and ligase as deemed appropriate.

[0109] Preferably, the doping is carried out using "constant random doping", in which the percentage of wild-type and mutation in each position is predefined. Furthermore, the doping may be directed toward a preference for the introduction of certain nucleotides, and thereby a preference for the introduction of one or more specific amino acid residues. The doping may be made, e.g., so as to allow for the introduction of 90% wild type and 10% mutations in each position. An additional consideration in the choice of a doping scheme is based on genetic as well as protein-structural constraints. The doping scheme may be made using the DOPE program (see "Material and Methods" section), which, inter alia, ensures that introduction of stop codons is avoided.

[0110] When PCR-generated mutagenesis is used, either a chemically treated or non-treated gene encoding a parent alpha-amylase is subjected to PCR under conditions that increase the mis-incorporation of nucleotides (Deshler 1992; Leung et at., Technique, Vol. 1, 1989, pp. 11-15).

[0111] A mutator strain of E. coil (Fowler et al., Molec. Gen. Genet., 133, 1974, pp. 179-191), S. cereviseae or any other microbial organism may be used for the random mutagenesis of the DNA encoding the alpha-amylase by, e.g., transforming a plasmid containing the parent glycosylase into the mutator strain, growing the mutator strain with the plasmid and isolating the mutated plasmid from the mutator strain. The mutated plasmid may be subsequently transformed into the expression organism.

[0112] The DNA sequence to be mutagenized may be conveniently present in a genomic or cDNA library prepared from an organism expressing the parent alpha-amylase. Alternatively, the DNA sequence may be present on a suitable vector such as a plasmid or a bacteriophage, which as such may be incubated with or otherwise exposed to the mutagenising agent. The DNA to be mutagenized may also be present in a host cell either by being integrated in the genome of said cell or by being present on a vector harboured in the cell. Finally, the DNA to be mutagenized may be in isolated form. It will be understood that the DNA sequence to be subjected to random mutagenesis is preferably a cDNA or a genomic DNA sequence.

[0113] In some cases it may be convenient to amplify the mutated DNA sequence prior to performing the expression step b) or the screening step c). Such amplification may be performed in accordance with methods known in the art, the presently preferred method being PCR-generated amplification using oligonucleotide primers prepared on the basis of the DNA or amino acid sequence of the parent enzyme.

[0114] Subsequent to the incubation with or exposure to the mutagenising agent, the mutated DNA is expressed by culturing a suitable host cell carrying the DNA sequence under conditions allowing expression to take place. The host cell used for this purpose may be one which has been transformed with the mutated DNA sequence, optionally present on a vector, or one which was carred the DNA sequence encoding the parent enzyme during the mutagenesis treatment Examples of suitable host cells are the following: gram positive bacteria such as Bacillus subtilis, Bacillus lichenifomnais, Bacillus lentus, Bacillus brevis, Bacllus stearothermophiltus, Bacillus alkalophilus, Bactius amyloliquefaclens, Bacillus coaguaans, Bacillus circulans, Bacilus lautus, Bacillus megaterium, Bacillus thuritigiensis, Streptomyces lividans or Sieptomyces murinus; and gram-negative bacteria such as E. coli or Pseudomnonas.

[0115] The mutated DNA sequence may further comprise a DNA sequence encoding functions permitting expression of the mutated DNA sequence.

Localized Random Mutaenesis

[0116] The random mutagenesis may be advantageously localized to a part of the parent alpha-amylase in question. This may, e.g., be advantageous when certain regions of the enzyme have been identified to be of particular importance for a given property of the enzyme, and when modified are expected to result in a variant having improved properties. Such regions may normally be identified when the tertiary structure of the parent enzyme has been elucidated and related to the function of the enzyme.

[0117] The localized, or region-specific, random mutagenesis is conveniently performed by use of PCR generated mutagenesis techniques as described above or any other suitable technique known in the al. Alternatively, the DNA sequence encoding the part of the DNA sequence to be modified may be isolated, e.g., by insertion into a suitable vector, and said part may be subsequently subjected to mutagenesis by use of any of the mutagenesis methods discussed above.

Alternative Methods of Providing Alpha-Amylase Variants

[0118] Alternative methods for providing variants of the invention include gene-shuffling method known in the art including the methods, e.g., described in WO 95/22625 (from Affymax Technologies N.V.) and WO 96/00343 (from Novo Nordisk AMS).

Expression of Alpha-Amylase Variants

Expression Vectors

[0119] According to the invention, a DNA sequence encoding the variant produced by methods described above, or by any alternative methods known in the art, can be expressed, in enzyme form, using an expression vector which typically includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and, optionally, a repressor gene or various activator genes.

[0120] The recombinant expression vector carrying the DNA sequence encoding an alpha-amylase variant of the invention may be any vector, which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, a bacteriophage or an extrachomosomal element, minichromosome or an artificial chromosome, Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.

Promoters

[0121] In the vector, the DNA sequence should be operably connected to a suitable promoter sequence. The promoter may be any DNA sequence, which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the DNA sequence encoding an alpha-amylase variant of the invention, especially in a bacterial host, are the promoter of the lac operon of E.coli, the Streptomyces coelicolor agarase gene dagA promoters, the promoters of the Bacillus licheniformis alpha-amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens alpha-amylase (amyQ), the promoters of the Bacillus subtilis xylA and xylb genes etc. For transcription in a fungal host, examples of useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger glucoamylase, Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase.

Transcription Terminators

[0122] The expression vector of the invention may also comprise a suitable transcription terminator and, in eukarotes, polyadenylation sequences operably connected to the DNA sequence encoding the alpha-amylase variant of the invention. Termination and polyadenylation sequences may suitably be derived from the same sources as the promoter.

Replication Sequences

[0123] The vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids PUC19, pACYC177, pUB110, pE194, pAMB1 and plJ702.

Selectable Markers

[0124] The vector may also comprise a selectable marker, e.g., a gene the product of which complements a defect in the host cell, such as the dal genes from B. subtitis or B. licheniformis, or one which confers antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracyclin resistance. Furthermore, the vector may comprise Aspergillus selection markers such as amdS, argB, niaD and sC, a marker giving rise to hygromycin resistance, or the selection may be accomplished by co-transformation, e.g., as described in WO 91/17243.

Secretion Sequences

[0125] While intracellular expression may be advantageous in some respects, e.g., when using certain bacteria as host cells it is generally preferred that the expression is extracellular. In general, the Bacillus alpha-amylases mentioned herein comprise a preregion permitting aft secretion of the expressed protease into the culture medium. If desirable, this preregion may be replaced by a different preregion or signal sequence, conveniently accomplished by substitution of the DNA sequences encoding the respective preregions.

Host Cells

[0126] The procedures used to ligate the DNA construct of the invention encoding an alpha-amylase variant. the promoter, terminator and other elements, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et at., Molecular Cloning; A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989).

[0127] The cell of the invention, either comprising a DNA construct or an expression vector of the invention as defined above, is advantageously used as a host cell in the recombinant production of an alpha-amylase variant of the invention. The cell may be transformed with the DNA construct of the invention encoding the variant, conveniently by integrating the DNA construct (in one or more copies) in the host chromosome. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g., by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described above in connection with the different types of host cells.

[0128] The cell of the invention may be a cell of a higher organism such as a mammal or an insect, but is preferably a microbial cell, e.g., a bacterial or a fungal (including yeast) cell.

[0129] Examples of suitable bacteria are Gram-positive bacteria such as Bacillus subtillis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thuringiensis, or Streptomyces lividans or Streptomyces murinus, or gramnegative bacteria such as E.coli or pseudomonas. The transformation of the bacteria may, for instance, be effected by protoplast transformation or by using competent cells in a manner known per se.

[0130] The yeast organism may favorably be selected from a species of Saccharomyces or Schizosaccharomyces, e.g. Saccharomyces cerevisiae. The filamentous fungus may advantageously belong to a species of Aspergillis, e.g., Aspergillus oryzae or Aspergillus niger. Fungal cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se. A suitable procedure for transformation of Aspergillus host cells is described in EP 238 023.

Method of Producing an Alpha-Amylase Variant of the Invention

[0131] In a yet further aspect, the present invention relates to a method of producing an alpha-amylase variant of the invention, which method comprises cultivating a host cell as described above under conditions conducive to the production of the variant and recovering the variant from the cells and/or culture medium.

[0132] The medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in question and obtaining expression of the alpha-amylase variant of the invention. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g., as described in catalogues of the American Type Culture Collection).

[0133] The alpha-amylase variant secreted from the host cells may conveniently be recovered from the culture medium by well-known procedures, including separating the cells from the medium by centrifugation or filtration, and precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, followed by the use of chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.

Industrial Applications

[0134] Owing to their activity at alkaline pH values, the alpha-amylase variants of the invention are well suited for use in a variety of industrial processes, in particular the enzyme finds potential applications as a component in detergents, e.g., laundry, dishwashing and hard surface cleaning detergent compositions, but it may also be useful for desizing of textiles, fabrics and garments, beer making or brewing, in pulp and paper production, and further in the production of sweeteners and ethanol (see for instance U.S. Pat. No. 5,231,017--hereby incorporated by reference), such as fuel, drinking and industrial ethanol, from starch or whole grains.

Starch Conversion

[0135] Conventional starch-conversion processes, such as liquefaction and saccharification processes are described, e.g., in U.S. Pat. No. 3,912,590 and EP patent publications Nos. 252,730 and 63,909, hereby incorporated by reference.

[0136] A "traditional" starch conversion process degrading starch to lower molecular weight carbohydrate components such as sugars or fat replacers includes a debranching step.

Starch to Sugar Conversion

[0137] In the case of converting starch into a sugar the starch is depolymerized. A such depolymerization process consists of a

Pre-treatment step and two or three consecutive process steps, viz. a liquefaction process, a saccharification process and dependent on the desired end product optionally an isomerization process.

Pre-Treatment of Native Starch

[0138] Native starch consists of microscopic granules, which are insoluble in water at room temperature. When an aqueous starch slurry is heated, the granules swell and eventually burst, dispersing the starch molecules into the solution, During this "gelatinization" process there is a dramatic increase in viscosity. As the solids level is 30-40% in a typically industrial process, the starch has to be thinned or "liquefied" so that it can be handled, This reduction in viscosity is today mostly obtained by enzymatic degradation.

Liquefaction

[0139] During the liquefaction step, the long chained starch is degraded into branched and linear shorter units (maltodextrins)

by an alpha-amylase. The liquefaction process is carried out at 105-110.degree. C. for 5 to 10 minutes followed by 1-2 hours at 95.degree. C. The pH lies between 5.5 and 6.2. In order to ensure optimal enzyme stability under these conditions, 1 mM of calcium is added (40 ppm free calcium ions). After this treatment the liquefied starch will have a "dextrose equivalent" (DE) of 10-15.

Saccharification

[0140] After the liquefaction process the maltodextrins are converted into dextrose by addition of a glucoamylase (e.g., AMG.TM.) and a debranching enzyme, such as an isoamylase (U.S. Pat. No. 4,335,208) or a pullulanase (eag., Promozyme.TM.) (U.S. Pat. No. 4,560,651). Before this step the pH is reduced to a value below 4.5, maintaining the high temperature (above 95.degree. C.) to inactivate the liquefying alpha-amylase to reduce the formation of short

oligosaccharide called "panose precursors" which cannot be hydrolyzed properly by the debranching enzyme.

[0141] An The temperature is lowered to 60.degree. C. and glucoamylase and debranching enzyme are added. The saccharification process proceeds for 24-72 hours.

[0142] Normally, when denaturing the .alpha.-amylase after the liquefaction step about 0.2-0.5% of the saccharification product is the branched trisaccharide 6.sup.2-alpha-glucosyl maltose (panose) which cannot be degraded by a pullulanase. If active amylase from the liquefaction step is present during saccharification (i.e., no denaturing), this level can be as high as 1-2%, which is highly undesirable as it lowers the saccharification yield significantly.

Isomerization

[0143] When the desired final sugar product is e.g., high fructose syrup the dextrose syrup may be converted into fructose. After the saccharification process the pH is increased to a value in the range of 6-8, preferably pH 7.5, and the calcium is removed by ion exchange. The dextrose syrup is then converted into high fructose syrup using, e.g., an immmobilized glucoseisomerase (such as Sweetzyme.TM. IT).

Ethanol Production

[0144] In general alcohol production (ethanol) from whole grain can be separated into 4 main steps

[0145] Milling

[0146] Liquefaction

[0147] Saccharification

[0148] Fermentation

Milling

[0149] The grain is milled in order to open up the structure and allowing for further processing. Two processes are used wet or dry milling. In dry milling the whole kernel is milled and used in the remaining part of the process. Wet milling gives a very good separation of germ and meal (starch granules and protein) and is with a few exceptions applied at locations where there is a parallel production of syrups.

Liquefaction

[0150] In the liquefaction process the starch granules are solubilized by hydrolysis to maltodextrins mostly of a DP higher than 4. The hydrolysis may be carried out by acid treatment or enzymatically by alpha-amylase. Acid hydrolysis is used on a limited basis. The raw material can be milled whole grain or a side stream from starch processing.

[0151] Enzymatic liquefaction is typically carried out as a three-step hot slurry process. The slurry is heated to between 60-95 C, preferably 80-85 C, and the enzyme(s) is (are) added. Then the slurry is jet-cooked at between 95-140 C preferably 105-125 C, cooled to 60-95 C and more enzyme(s) is (are) added to obtain the final hydrolysis. The liquefaction process is carried out at pH 4.5-6.5, typically at a pH between 5 and 6. Milled and liquefied grain is also known as mash.

Saccharification

[0152] To produce low molecular sugars DP.sub.1-3 that can be metabolized by yeast, the maltodextrin from the liquefaction must be further hydrolyzed. The hydrolysis is typically done enzymatically by glucoamylases, alternatively alpha-glucosidases or acid alpha-amylases can be used. A full saccharification step may last up to 72 hours, however, a is common only to do a pre-saccharification of typically 40-90 minutes and then complete saccharification during fermentation (SSF). Saccharification is typically carried out at temperatures from 30-65 C, typically around 60 C, and at pH 4.5.

Fermentation

[0153] Yeast typically from Saccharomyces spp. is added to the mash and the fermentation is ongoing for 24-96 hours, such as typically 35-60 hours. The temperature is between 26-34 C, typically at about 32 C, and the pH is from pH 3-6, preferably around pH 4-5.

[0154] Note that the most widely used process is a simultaneous saccharification and fermentation (SSF) process where there is no holding stage for the saccharification, meaning that yeast and enzyme is added together. When doing SSF it is common to introduce a pre-saccharification step at a temperature above 50 C, just prior to the fermentation.

Distillation

[0155] Following the fermentation the mash is distilled to extract the ethanol.

[0156] The ethanol obtained according to the process of the invention may be used as, e.g. fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol.

By-Products

[0157] Left over from the fermentation is the grain, which is typically used for animal feed either in liquid form or dried.

[0158] Further details on how to carry out liquefaction, saccharification, fermentation, distillation, and recovering of ethanol are well known to the skilled person.

[0159] According to the process of the invention the saccharification and fermentation may be carried out simultaneously or separately.

Pulp and Paper Production

[0160] The alkaline alpha-amylase of the invention may also be used in the production of lignocellulosic materials, such as pulp, paper and cardboard, from starch reinforced waste paper and cardboard, especially where re-pulping occurs at pH above 7 and where amylases facilitate the disintegration of the waste material through degradation of the reinforcing starch, The alpha-amylase of the invention is especially useful in a process for producing a papermaking pulp from starch-coated printed-paper. The process may be performed as described in WO 95/14807, comprising the following steps.

[0161] a) disintegrating the paper to produce a pulp,

[0162] b) treating with a starch-degrading enzyme before during or after step a), and

[0163] c) separating ink particles from the pulp after steps a) and b).

[0164] The alpha-amylases of the invention may also be very useful in modifying starch where enzymatically modified starch is used in papermaking together with alkaline fillers such as calcium carbonate, kaolin and clays. With the alkaline alpha-amylases of the invention it becomes possible to modify the starch in the presence of the filler thus allowing for a simpler integrated process.

Desizing of Textiles, Fabrics and Garments

[0165] An alpha-amylase of the invention may also be very useful in textile, fabric or garment desizing. In the textile processing industry, alpha-amylases are traditionally used as auxiliaries in the desizing process to facilitate the removal of starch-containing size, which has served as a protective coating on weft yarns during weaving. Complete removal of the size coating after weaving is important to ensure optimum results in the subsequent processes, in which the fabric is scoured, bleached and dyed. Enzymatic starch breakdown is preferred because it does not involve any harmful effect on the fiber material. In order to reduce processing cost and increase mill throughput, the desizing processing is sometimes combined with the scouring and bleaching steps. In such cases, non-enzymatic auxiliaries such as alkali or oxidation agents are typically used to break down the starch, because traditional alpha-amylases are not very compatible with high pH levels and bleaching agents. The non-enzymatic breakdown of the starch size does lead to some fiber damage because of the rather aggressive chemicals used. Accordingly, it would be desirable to use the alpha-amylases of the invention as they have an improved performance in alkaline solutions. The alpha-amylases may be used alone or in combination with a cellulase when desizing cellulose-containing fabric or textile.

Desizing and bleaching processes are well known in the art. For instance, such processes are described in WO 95/21247, U.S. Pat. No. 4,643,736, EP 119,920 hereby in corporate by reference.

[0166] Commercially available products for desizing include Aquazyme.RTM. and Aquazyme.RTM. Ultra from Novo Nordisk A/S.

Beer Making

[0167] The alpha-amylases of the invention may also be very useful in a beer-making process; the alpha-amylases will typically be added during the mashing process.

Detergent Compositions

[0168] The alpha-amylase of the invention may be added to and thus become a component of a detergent composition.

[0169] The detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition, or be formulated as a detergent composition for use in general household hard surface cleaning operations, or be formulated for hand or machine dishwashing operations.

[0170] In a specific aspect, the invention provides a detergent additive comprising the enzyme of the invention. The detergent additive as well as the detergent composition may comprise one or more other enzymes such as a protease, a lipase, a cutinase, an amylase, a carbohydrase, a cellulase, a pectinase, a mannanase, an arabinase, a galactanase, a xylanase, an oxidase, e.g., a laccase, a pectate lyase, and/or a peroxidase.

[0171] In general the properties of the chosen enzyme(s) should be compatible with the selected detergent, (i.e., pH-optimum, compatibility with other enzymatic and non-enzymatic ingredients, etc.), and the enzyme(s) should be present in effective amounts.

[0172] Proteases; Suitable proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included. The protease may be a serine protease or a metallo protease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279). Examples of trypsin-like pro-teases are trypsin (e.g., of porcine or bovine origin) and the Fusarium protease described in WO 89/06270 and WO 94/25583.

[0173] Examples of useful proteases are the variants described in WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially the variants with substitutions in one or more of the following positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170, 194, 206, 218, 222, 224, 235 and 274.

[0174] Preferred commercially available protease enzymes include Alcalase.RTM., Savinase.RTM., Primase.RTM., Duralase.RTM., Esperase.RTM., and Kannase.RTM. (Novo Nordisk A/S), Maxatase.RTM., Maxacal, Maxapem.RTM., Properase.RTM., Purafect.RTM., Purafect OxP.RTM., FN2.RTM., and FN3.RTM. (Genencor international Inco.)

[0175] Lipases; Suitable lipases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful lipases include lipases from Humicola (synonym Thermomyces), e.g., from H. lanuginosa (T. lanuginosus) as described in EP 258 068 and EP 305 216 or from H. insolens as described in WO 96/13580, a Pseudomonas lipase, e.g., from P. alcaligenes or P. pseudoaicaligenes (EP 218 272), P. cepacia (ER 331 376), P. stutzeri (GB 1,372,034), P. fluorescens, Pseudomonas sp. strain SD 705 (WO 95/06720 and WO 96/27002), P. wisconsinensis (WO 96/12012), a Bacillus lipase, e.g., from B. subtilis (Dadois et al. (1993), Biochemica et Biophysica Acta, 1131, 253-360), B. stearothermophilus (JP 64/744992) or B. pumilus (WO 91/16422).

Other examples are lipase variants such as those described in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381, WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 and WO 97/07202.

[0176] Preferred commercially available lipase enzymes include Lipolase.TM. and Lipolase Ultra.TM. (Novo Nordisk A/S).

[0177] Amylases: Suitable amylases (alpha and/or beta) include those of bacterial or is fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, alpha-amylases obtained from Bacillus, e.g., a special strain of B. licheniformis, described in more detail in GB 1,296,839. Examples of useful alpha-amylases are the variants described in WO 94/02597, WO 94/18314. WO 96/23873, and WO 97/43424, especially the variants with substitutions in one or more of the following positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188, 190, 197, 202, 208, 209, 243, 264, 304, 305 ,391, 408, and 444.

[0178] Commercially available amylases are Duramyl.TM., Termamyl.TM., Natalase.TM., Fungamyl.TM. and BAN.TM. (Novo Nordisk A/S), Rapidase.TM. and Purastar.TM. (from Genencor International Inc.).

[0179] Cellulases: Suitable celiulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomnonas, Humicola, Fusarnum Thielavia, Acremonium, e.g., the fungal cellulases produced from Humicola insolens, Mycetiophthora thermophila and Fusarium oxysporum disclosed in U.S. Pat. No. 4,435,307, U.S. Pat. No. 5,648,263, U.S. Pat. No. 5,691,178, U.S. Pat. No. 5,776,757 and WO 89/09259.

[0180] Especially suitable cellulaases are the alkaline or neutral cellulases having colour care benefits. Examples of such cellu-lases are cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940. Other examples are cellulase variants such as those described in WO 94/07998, EP 0 531 315, U.S. Pat. No. 5,457,046, U.S. Pat. No. 5,686,593. U.S. Pat. No. 5,763,254. WO 95/24471, WO 98/12307 and PCT/DK98/00299.

[0181] Commercially available cellulases include Celluzyme.RTM., and Carezyme.RTM. (Novo Nordisk A/S), Clazinase.RTM., and Puradax HA.RTM. (Genencor lnternational Inc.), and KAC-500(B).RTM. (Kao Corporation).

[0182] Peroxidases/Oxidases, Suitable peroxidases/oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included, Examples of useful peroxidases include peroxidases from Coprinus, e.g., from C. cinereus, and variants thereof as those described in WO 93124618, WO 95/10602, and WO 98/15257.

[0183] Commercially available peroxidases include Guardzyme.RTM. (Novo Nordisk A/S).

[0184] Pectate lyase. Many pectate lyases have been described in the art, see e.g. WO 99/27083 (Novozymes A/S) or WO 99127084 (Novozymes A/S), both of which are incorporated herein by reference in their totality.

[0185] The detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more enzymes, or by adding a combined additive comprising all of these enzymes. A detergent additive of the invention, i.e., a separate additive or a combined additive, can be formulated, e.g., granulate, a liquid, a slurry, etc. Preferred detergent additive formulations are granulates, in particular non-dusting granulates, liquids, in particular stabilized liquids, or slurries.

[0186] Non-dusting granulates may be produced, e.g., as disclosed in U.S. Pat. Nos. 4,106,991 and 4,661,452 and may optionally be coated by methods known in the art. Examples of waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000, ethoxylated nonyl-phenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591. Liquid enzyme preparations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods, Protected enzymes may be prepared according to the method disclosed in ER 238,216.

[0187] The detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid. A liquid detergent may be aqueous, typically containing up to 70% water and 0-30% organic solvent, or non-aqueous.

[0188] The detergent composition comprises one or more surfactants, which may be non-ionic including semi-polar and/or anionic and/or cationic and/or zwitterionic. The surfactants are typically present at a level of from 0.1% to 60% by weight.

[0189] When included therein the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesuifonate, alpha-olefinsulfonate, alkyl sulfate (fatty alcohol sulfate), alcohol ethoxysuifate, secondary aikanesulfonate, alpha-sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid or soap.

[0190] When included therein the detergent will usually contain from about 0.2% to about 40% of a non-ionic surfactant such as alcohol ethoxylate, nonyl-phenol ethoxylate, alkylpolyglycoside, alkyldimethylamine-oxide, ethoxylated fatty acid monoethanol-amide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N-alkyl derivatives of glucosamine ("glucamides").

[0191] The detergent may contain 0-65% of a detergent builder or complexing agent such as zeolite, diphosphate, tripho-sphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetri-aminepen-taacetic acid, alkyl- or alkenyisuccinic acid, soluble silicates or layered silicates (e.g. SKS-6 from Hoechst).

[0192] The detergent may comprise one or more polymers. Examples are carboxymethylcellulose, poly(vinyl-pyrrolidone), poly (ethylene glycol), polytvinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacrylates, maleiciacrylic acid copolymers and lauryl methacrylate/acrylic acid co-polymers.

[0193] The detergent may contain a bleaching system, which may comprise a H.sub.2O.sub.2 source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine or nonanoyloxyben-zenesul-fonate. Alternatively, the bleaching system may comprise peroxyacids of e.g., the amide, imide, or sulfone type.

[0194] The enzyme(s) of the detergent composition of the invention may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid, and the composition may be formulated as described in, e.g., WO 92/19709 and WO 92/19708.

[0195] The detergent may also contain other conventional detergent ingredients such as e.g. fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil re-deposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.

[0196] It is at present contemplated that in the detergent compositions any enzyme, in particular the enzyme of the invention, may be added in an amount corresponding to 0.01-100 mg of enzyme protein per liter of wash liquor, preferably 0.05-5 mg of enzyme protein per liter of wash liquor, in particular 0.1-1 mg of enzyme protein per liter of wash liquor.

[0197] The enzyme of the invention may additionally be incorporated in the detergent formulations disclosed in WO 97/07202, which is hereby incorporated as reference

Dishwash Detergent Compositions

[0198] The enzyme of the invention mat also be used in dish wash detergent compositions, including the following:

TABLE-US-00001 1) POWDER AUTOMATIC DISHWASHING COMPOSITION Nonionic surfactant 0.4-2.5% Sodium metasilicate 0-20% Sodium disilicate 3-20% Sodium triphosphate 20-40% Sodium carbonate 0-20% Sodium perforate 2-9% Tetraacetyl ethylene diamine 1-4% (TAED) Sodium sulphate 5-33% Enzymes 0.0001-0.1% 2) POWDER AUTOMATIC DISHWASHING COMPOSITION Nonionic surfactant 1-2% (e.g. alcohol ethoxylate) Sodium disilicate 2-30% Sodium carbonate 10-50% Sodium phosphonate 0-5% Trisodium citrate dihydrate 9-30% Nitrilotrisodium acetate (NTA) 0-20% Sodium perborate monohydrate 5-10% Tetraacetyl ethylene diamine 1-2% (TAED) Polyacrylate polymer (e.g. maleic 6-25% acid/acrylic acid copolymer) Enzymes 0.0001-0.1% Perfume 0.1-0.5% Water 5-10 3) POWDER AUTOMATIC DISHWASHING COMPOSITION Nonionic surfactant 0.5-2.0% Sodium disilicate 25-40% Sodium citrate 30-55% Sodium carbonate 0-29% Sodium bicarbonate 0-20% Sodium perborate monohydrate 0-15% Tetraacetyl ethylene diamine 0-6% (TAED) Maleic acid/acrylic 0-5% acid copolymer Clay 1-3% Polyamino acids 0-20% Sodium polyacrylate 0-8% Enzymes 0.0001-0.1% 4) POWDER AUTOMATIC DISHWASHING COMPOSITION Nonionic surfactant 1-2% Zeolite MAP 15-42% Sodium disilicate 30-34% Sodium citrate 0-12% Sodium carbonate 0-20% Sodium perborate monohydrate 7-15% Tetraacetyl ethylene 0-3% diamine (TAED) Polymer 0-4% Maleic acid/acrylic acid 0-5% copolymer Organic phosphonate 0-4% Clay 1-2% Enzymes 0.0001-0.1% Sodium sulphate Balance 5) POWDER AUTOMATIC DISHWASHING COMPOSITION Nonionic surfactant 1-7% Sodium disilicate 18-30% Trisodium citrate 10-24% Sodium carbonate 12-20% Monopersulphate 15-21% (2 KHSO.sub.5.cndot.KHSO.sub.4.cndot.K.sub.2SO.sub.4) Bleach stabilizer 0.1-2% Maleic acid/acrylic acid 0-8% copolymer Diethylene triamine 0-2.5% pentaacetate, pentasodium salt Enzymes 0.0001-0.1% Sodium sulphate, water Balance 6) POWDER AND LIQUID DISHWASHING COMPOSITION WITH CLEANINGSURFACTANT SYSTEM Nonionic surfactant 0-1.5% Octadecyl dimethylamine 0-5% N-oxide dihydrate 80:20 wt. C18/C16 blend of 0-4% octadecyl dimethylamine N-oxide dihydrate and hexadecyldimethyl amine N-oxide dihydrate 70:30 wt. C18/C16 blend of 0-5% octadecyl bis (hydroxyethyl)amine N-oxide anhydrous and hexadecyl bis (hydroxyethyl)amine N-oxide anhydrous C.sub.12-C.sub.15 alkyl ethoxysulfate with 0-10% an average degree of ethoxylation of 3 C.sub.12-C.sub.15 alkyl ethoxysulfate with 0-5% an average degree of ethoxylation of 3 C.sub.13-C.sub.15 ethoxylated alcohol with 0-5% an average degree of ethoxylation of 12 A blend of C.sub.12-C.sub.15 ethoxylated 0-6.5% alcohols with an average degree of ethoxylation of 9 A blend of C.sub.13-C.sub.15 ethoxylated 0-4% alcohols with an average degree of ethoxylation of 30 Sodium disilicate 0-33% Sodium tripolyphosphate 0-46% Sodium citrate 0-28% Citric acid 0-29% Sodium carbonate 0-20% Sodium perborate monohydrate 0-11.5% Tetraacetyl ethylene diamine 0-4% (TAED) Maleic acid/acrylic acid 0-7.5% copolymer Sodium sulphate 0-12.5% Enzymes 0.0001-0.1% 7) NON-AQUEOUS LIQUID AUTOMATIC DISHWASHING COMPOSITION Liquid nonionic surfactant 2.0-10.0% (e.g. alcohol ethoxylates) Alkali metal silicate 3.0-15.0% Alkali metal phosphate 20.0-40.0% Liquid carrier selected from 25.0-45.0% higher glycols, polyglycols, polyoxides, glycolethers Stabilizer (e.g. a partial 0.5-7.0% ester of phosphoric acid and aC.sub.16-C.sub.18 alkanol) Foam suppressor (e.g. silicone) 0-1.5% Enzymes 0.0001-0.1% 8) NON-AQUEOUS LIQUID DISHWASHING COMPOSITION Liquid nonionic surfactant 2.0-10.0% (e.g. alcohol ethoxylates) Sodium silicate 3.0-15.0% Alkali metal carbonate 7.0-20.0% Sodium citrate 0.0-1.5% Stabilizing system (e.g. 0.5-7.0% mixtures of finely divided silicone and low molecular weight dialkyl polyglycolethers) Low molecule weight 5.0-15.0% polyacrylate polymer Clay gel thickener 0.0-10.0% (e.g. bentonite) Hydroxypropyl cellulose 0.0-0.6% polymer Enzymes 0.0001-0.1% Liquid carrier selected from Balance higher lycols, polyglycols, polyoxides and glycol ethers 9) THIXOTROPIC LIQUID AUTOMATIC DISHWASHING COMPOSITION C.sub.12-C.sub.14 fatty acid 0-0.5% Block co-polymer surfactant 1.5-15.0% Sodium citrate 0-12% Sodium tripolyphosphate 0-15% Sodium carbonate 0-8% Aluminium tristearate 0-0.1% Sodium cumene sulphonate 0-1.7% Polyacrylate thickener 1.32-2.5% Sodium polyacrylate 2.4-6.0% Boric acid 0-4.0% Sodium formate 0-0.45% Calcium formate 0-0.2% Sodium n-decydiphenyl oxide 0-4.0% disulphonate Monoethanol amine (MEA) 0-1.86% Sodium hydroxide (50%) 1.9-9.3% 1,2-Propanediol 0-9.4% Enzymes 0.0001-0.1% Suds suppressor, dye, Balance perfumes, water 10) LIQUID AUTOMATIC DISHWASHING COMPOSITION Alcohol ethoxylate 0-20% Fatty acid ester sulphonate 0-30% Sodium dodecyl sulphate 0-20% Alkyl polyglycoside 0-21% Oleic acid 0-10% Sodium disilicate monohydrate 18-33% Sodium citrate dihydrate 18-33% Sodium stearate 0-2.5% Sodium perborate monohydrate 0-13% Tetraacetyl ethylene diamine 0-8% (TAED) Maleic acid/acrylic acid 4-8% copolymer Enzymes 0.0001-0.1% 11) LIQUID AUTOMATIC DISHWASHING COMPOSITION CONTAINING PROTECTEDBLEACH PARTICLES Sodium silicate 5-10% Tetrapotassium pyrophosphate 15-25% Sodium triphosphate 0-2% Potassium carbonate 4-8% Protected bleach particles, 5-10% e.g. chlorine Polymeric thickener 0.7-1.5% Potassium hydroxide 0-2% Enzymes 0.0001-0.1% Water Balance

[0199] 11) Automatic dishwashing compositions as described in 1), 2), 3), 4), 6) and 10), wherein perborate is replaced by percarbonate.

[0200] 12) Automatic dishwashing compositions as described in 1)-6) which additionally contain a m manganese catalyst. The manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 39, 1994, pp. 637-639.

Uses

[0201] The present invention is also directed to methods for using an alpha-amylase variant of the invention in detergents, in particular laundry detergent compositions and dishwashing detergent compositions, hard surface cleaning compositions, and in composition for desizing of textiles, fabrics or garments, for production of pulp and paper, beer making, ethanol production and starch conversion processes as described above.

[0202] The present invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

Materials & Methods

Enzymes:

[0203] KSM-K36: SEQ ID NO: 2 disclosed in EP 1,022,334 deposited as FERM BP 6945.

[0204] KSM-K38; SEQ ID NO: 4, disclosed in EP 1,022,334, deposited as FERM BP-6946. Bacillus subtilis SHA273; Protease and amylase deleted Bacillis subtilis strain (disclosed in WO 95/10603).

Detergent:

[0205] Model detergent; A/P (Asia/Pacific) Model Detergent has the following composition; 20% STPP (sodium tripolyphosphate), 25% Na.sub.2SO.sub.4, 15% Na.sub.2CO.sub.3, 20% LAS (linear alkylbenzene sulfonate, Nansa 80S), 5% C.sub.12-C.sub.15 alcohol ethoxylate (Dobanol 25-7), 5% Na.sub.2Si.sub.2O.sub.5, 0.3% NaCl.

[0206] Omo.TM. Muti Acao (Brazil),

[0207] Omo.TM. concentrated powder (EU) (Unilever)

[0208] Ariel Futur.TM. liquid (EU) (Procter and Gamble)

[0209] Commercial detergents containing alpha-amylase was inactivated by microwaves before wash.

Plasmids

[0210] pTVB110 is a plasmid replicating in Bacillus subtilis by the use of origin of replication from pUB110 (Gryczan, T. J. (1978), J. Bact. 134:318-329). The plasmid further encodes the cat gene, conferring resistance towards chlorampenicol, obtained from plasmid pC194 (Horinouchi, S. and Weisblum, B. (1982), J. Bact. 150; 815-825). The plasmid harbors a truncated version of the Bacillus licheniformis alpha-amylase gene, amyL, such that the amyL promoter, signal sequence and transcription terminator are present, but the plasmid does not provide an amy-plus phenotype (halo formation on starch containing agar).

The alpha-amylase genes homologous to the KSM-K36 (SEQ ID NO: 1) and KSM-K38 (SEQ ID NO: 3) were cloned into the Pst1-Sal1 sites of pTVB110. The coding amylase gene was obtained by PCR reaction using purified genomic DNA from the Bacillus KSM-K36 strain as template and the DAX-8N (SEQ ID NO: 9) and DAX-8C (SEQ ID NO: 10) primers.

Methods:

General Molecular Biology Methods:

[0211] Unless otherwise mentioned the DNA manipulations and transformations were performed using standard methods of molecular biology (Sambrook et al. (1989); Ausubel et al. (1995); Harwood and Cutting (1990).

Filter Screening-Assays

[0212] The assay can be used to screening of alpha-amylase variants having an improved stability at high pH compared to the parent enzyme and alpha-amylase variants having an improved stability at high pH and medium temperatures compared to the parent enzyme depending of the screening temperature setting.

High pH Filter Assay

[0213] Bacillus libraries are plated on a sandwich of cellulose acetate (OE 67, Schleicher & Schuell, Dassel, Germany)--and nitrocellulose filters (Protran-Ba 85, Schleicher & Schuell, Dassel, Germany) on TY agar plates with 10 micro g/ml kanamycin at 37.degree. C. for at least 21 hours. The cellulose acetate layer is located on the TY agar plate.

[0214] Each filter sandwich is specifically marked with a needle after plating, but before incubation in order to be able to localize positive variants on the filter and the nitrocellulose filter with bound variants is transferred to a container with glycin-NaOH buffer, pH 8.6-10.6 and incubated at room temperature (can be altered from 10.degree.-60.degree. C.) for 15 min. The cellulose acetate filters with colonies are stored on the TY-plates at room temperature until use. After incubation, residual activity is detected on plates containing 1% agarose, 0.2% starch in glycin-NaOH buffer, pH 8.6-10.6. The assay plates with nitrocellulose filters are marked the same way as the filter sandwich and incubated for 2 hours, at room temperature. After removal of the filters the assay plates are stained with 10% Lugol solution. Starch degrading variants are detected as white spots on dark blue background and then identified on the storage plates. Positive variants are rescreened twice under the same conditions as the first screen.

Low Calcium Filter Assay

[0215] The Bacillus library are plated on a sandwich of cellulose acetate (CE 67, Schleicher & Schuell, Dassel, Germany)--and nitrocellulose filters (Protran-Ba 85, Schleicher & Schuell, Dassel, Germany) on TY agar plates with a relevant antibiotic, e.g., kanamycin or chloramphenicol, at 37.degree. C. for at least 21 hours. The cellulose acetate layer is located on the TY agar plate.

[0216] Each filter sandwich is specifically marked with a needle after plating, but before incubation in order to be able to localize positive variants on the filter and the nitrocellulose filter with bound variants is transferred to a container with carbonate/bicarbonate buffer pH 8.5-10 and with different EDTA concentrations (0.001 mM-100 mM). The filters are incubated at room temperature for 1 hour, The cellulose acetate filters with colonies are stored on the TY-plates at room temperature until use. After incubation, residual activity is detected on plates containing 1% agarose, 0.2% starch in carbonate/bicarbonate buffer pH 8.5-10. The assay plates with nitrocellulose filters are marked the same way as the filter sandwich and incubated for 2 hours at room temperature. After removal of the filters the assay plates are stained with 10% Lugol solution. Starch degrading variants are detected as white spots on dark blue background and then identified on the storage plates. Positive variants are rescreened twice under the same conditions as the first screen.

Determination of Isoelectric Point

[0217] The pl is determined by isoelectric focusing (ex: Pharmacia, Ampholine, pH 3.5-9.3).

Fermentation of Alpha-Amylases and Variants

[0218] Fermentation may be performed by methods well known in the art or as follows.

[0219] A B. subtilis strain harboring the relevant expression plasmid is streaked on a LB-agar plate with a relevant antibiotic, and grown overnight at 37.degree. C. The colonies are transferred to 100 ml BPX media supplemented with a relevant antibiotic (for instance 10 mg/l chloroamphinicol) in a 500 ml shaking flask.

Composition of BPX Medium:

TABLE-US-00002 [0220] Potato starch 100 g/l Barley flour 50 g/l BAN 5000 SKB 0.1 g/l Sodium caseinate 10 g/l Soy Bean Meal 20 g/l Na.sub.2HPO.sub.4, 12 H.sub.2O 9 g/l Pluronic .TM. 0.1 g/l

[0221] The culture is shaken at 37.degree. C. at 270 rpm for 4 to 5 days.

[0222] Cells and cell debris are removed from the fermentation broth by centrifugation at 4500 rpm in 20-25 minutes. Afterwards the supernatant is filtered to obtain a completely clear solution. The filtrate is concentrated and washed on an UF-filter (10000 cut off membrane) and the buffer is changed to 20 mM Acetate pH 5.5. The UF-filtrate is applied on a S-sepharose F.F. and elution is carried out by step elution with 0.2 M NaCl in the same buffer. The eluate is dialysed against 10 mM Tris, pH 9.0 and applied on a Q-sepharose F.F. and eluted with a linear gradient from 0-0.3 M NaCl over 6 column volumes. The fractions, which contain the activity (measured by the Phadebas assay) are pooled, pH was adjusted to pH 7.5 and remaining color was removed by a treatment with 0.5% W/vol. active coal in 5 minutes.

Stability Determination

[0223] The amylase stability is measured using the method as follows: The enzyme is incubated under the relevant conditions. Samples are taken at various time points, e.g., after 0, 5, 10, 15 and 30 minutes and diluted 25 times (same dilution for all taken samples) in assay buffer (0.1 M 50 mM Britton buffer pH 7.3) and the activity is measured using the Phadebas assay (Pharmacia) under standard conditions pH 7.3, 37.degree. C.,

[0224] The activity measured before incubation (0 minutes) is used as reference (100%). The decline in percent is calculated as a function of the incubation time. The table shows the residual activity after, e.g., 30 minutes of incubation.

Measurement of the Calcium- and pH-Dependent Stability

[0225] Normally industrial liquefaction processes runs using pH 6.0-6.2 as liquefaction pH and an addition of 40 ppm free calcium in order to improve the stability at 95.degree. C.-105.degree. C. Some of the herein proposed substitutions have been made in order to improve the stability at

[0226] 1. lower pH than pH 6.2 and/or

[0227] 2. at free calcium levels lower than 40 ppm free calcium.

[0228] Two different methods can be used to measure the alterations in stability obtained by the different substitutions in the alpha-amylase in question:

[0229] Method 1. One assay which measures the stability at reduced pH, pH 5.0, in the presence of 5 ppm free calcium.

10 micro g of the variant are incubated under the following conditions' A 0.1 M acetate solution, pH adjusted to pH 5.0, containing 5 ppm calcium and 5% w/w common corn starch (free of calcium). Incubation is made in a water bath at 95.degree. C. for 30 minutes.

[0230] Method 2. One assay, which measure the stability in the absence of free calcium and where the pH is maintained at pH 6.0. This assay measures the decrease in calcium sensitivity:

10 micro g of the variant were incubated under the following conditions: A 0.1 M acetate solution, pH adjusted to pH 6.0, containing 5% w/w common corn starch (free of calcium). Incubation was made in a water bath at 95.degree. C. for 30 minutes.

Assays for Alpha-Amylase Activity

1. Phadebas Assay

[0231] Alpha-amylase activity is determined by a method employing Phadebas.RTM. tablets as substrate. Phadebas tablets (Phadebas.RTM. Amylase Test, supplied by Pharmacia Diagnostic) contain a cross-linked insoluble blue-colored starch polymer, which has been mixed with bovine serum albumin and a buffer substance and tabletted.

[0232] For every single measurement one tablet is suspended in a tube containing 5 ml 50 mM Britton-Robinson buffer (50 mM acetic acid, 50 mM phosphoric acid, 50 mM boric acid, 0.1 mM CaCl.sub.2, pH adjusted to the value of interest with NaOH), The test is performed in a water bath at the temperature of interest. The alpha-amylase to be tested is diluted in x ml of 50 mM Britton-Robinson buffer. 1 ml of this alpha-amylase solution is added to the 5 ml 50 mM Brtton-Robinson buffer. The starch is hydrolyzed by the alpha-amylase giving soluble blue fragments. The absorbance of the resulting blue solution, measured spectrophotometrically at 620 nm, is a function of the alpha-amylase activity,

[0233] It is important that the measured 620 nm absorbance after 10 or 15 minutes of incubation (testing time) is in the range of 0.2 to 2.0 absorbance units at 620 nm. In this absorbance range there is linearity between activity and absorbance (Lambert-Beer law). The dilution of the enzyme must therefore be adjusted to fit this criterion. Under a specified set of conditions (temp., pH, reaction time, buffer conditions) 1 mg of a given alpha-amylase will hydrolze a certain amount of substrate and a blue colour will be produced. The colour intensity is measured at 620 nm. The measured absorbance is directly proportional to the specific activity (activity/mg of pure alpha-amylase protein) of the alpha-amylase in question under the given set of conditions.

2. Alternative Method

[0234] Alpha-amylase activity is determined by a method employing the PNP-G7 substrate. PNP-G7 which is a abbreviation for p-nitrophenyl-apha,D-maltoheptaoside is a blocked oligosaccharide which can be cleaved by an endo-amylase. Following the cleavage, the alpha-Glucosidase included in the kit digest the substrate to liberate a free PNP molecule which has a yellow colour and thus can be measured by visible spectophometry at .lamda.=405 nm. (400-420 nm.). Kits containing PNP-G7 substrate and alpha-Glucosidase is manufactured by Boehringer-Mannheim (cat. No. 1054635).

[0235] To prepare the substrate one bottle of substrate (BM 1442309) is added to 5 ml buffer (BM1442309). To prepare the alpha-glucosidase one bottle of alpha-Glucosidase (BM 1462309) is added to 45 ml buffer (BM 1442309). The working solution is made by mixing 5 ml alpha-Glucosidase solution with 0.5 ml substrate.

[0236] The assay is performed by transforming 20 micro I enzyme solution to a 96 well microtitre plate and incubating at 25.degree. C. 200 micro I working solution, 25.degree. C. is added. The solution is mixed and pre-incubated 1 minute and absorption is measured every 15 seconds over 3 minutes at OD 405 nm.

[0237] The slope of the time dependent absorption-curve is directly proportional to the specific activity (activity per mg enzyme) of the alpha-amylase in question under the given set of conditions.

Specific Activity Determination

[0238] The specific activity is determined as activity/mg enzyme using one of the methods described above. The manufactures instructions are followed (see also below under * Assay for alpha-amylase activity).

Oxidation Stability Determination

[0239] Raw fittered culture broths with different vatiants of the invention are diluted to an amylase activity of 100 KNU/ml (defined above) in 50 mM of a Britton-Robinson buffer at pH 9.0 and incubated at 40.degree. C. Subsequently H.sub.2O.sub.2 is added to a concentration of 200 mM, and the pH value is re-adjusted to 9.0. The activity is now measured after 15 seconds and after 5, 15, and 30 minutes. The absorbance of the resulting blue solution, measured spectrophotometrically at 620 nm, is a function of the alpha-amylase activity.

Washing Performance

[0240] Washing performance is evaluated by washing soiled test swatches for 15 and 30 minutes at 25.degree. C. and 40.degree. C., respectively; at a pH in the range from 9-10.5; water hardness in the range from 6 to 15 dH. Ca:Mg ratio of from 2:1 to 4:1, in different detergent solutions (see above as described above in the Materials section) dosed from 3 to 5 g/l dependent on the detergent with the alpha-amylase variant in question.

[0241] The recombinant alpha-amylase variant is added to the detergent solutions at concentrations of for instance 0.01-5 mg/l. The test swatches aree soiled with orange rice starch (CS-28 swatches available from CFT, Center for Test Material, Holland).

[0242] After washing, the swatches are evaluated by measuring the remission at 460 nm using an Elrepho Remission Spectrophotometer. The results are expressed as .DELTA.R=remission of the swatch washed with the alpha-amylase minus the remission of a swatch washed at the same conditions without the alpha-amylase.

General Method for Random Mutagenesis by use of the DOPE Program

[0243] The random mutagenesis may be carried out as follows:

[0244] 1. Select regions of interest for modification in the parent enzyme

[0245] 2. Decide on mutation sites and non-mutated sites in the selected region

[0246] 3. Decide on which kind of mutations should be carried out. e.g. with respect to the desired stability and/or performance of the variant to be constructed

[0247] 4. Select structurally reasonable mutations.

[0248] 5. Adjust the residues selected by step 3 with regard to step 4.

[0249] 6. Analyze by use of a suitable dope algorithm the nucleotide distribution.

[0250] 7. If necessary, adjust the wanted residues to genetic code realism (e.g., taking into account constraints resulting from the genetic code (e.g. in order to avoid introduction of stop codons))(the skilled person will be aware that some codon combinations cannot be used in practice and will need to be adapted)

[0251] 8.Make primers

[0252] 9. Perform random mutagenesis by use of the primers

[0253] 10. Select resulting .alpha.-amylase variants by screening for the desired improved properties.

[0254] Suitable dope algorithms for use in step 6 are well known in the art. One algorithm is described by Tomandl, D. et al., Journal of Computer-Aided Molecular Design. 11 (1997), pp. 29-38). Another algorithm, DOPE, is described in the following:

The Dope Program

[0255] The "DOPE" program is a computer algorithm useful to optimize the nucleotide composition of a codon triplet in such a way that it encodes an amino acid distribution which resembles most the wanted amino acid distribution. In order to assess which of the possible distributions is the most similar to the wanted amino acid distribution, a scoring function is needed, In the "Dope" program the following function was found to be suited,

s .ident. i = 1 N ( x i y i y i y i ( 1 - x i ) 1 - y i ( 1 - y i ) 1 - y i ) w i , ##EQU00001##

where the x.sub.i's are the obtained amounts of amino acids and groups of amino acids as calculated by the program, y.sub.i's are the wanted amounts of amino acids and groups of amino acids as defined by the user of the program (e.g. specify which of the 20 amino acids or stop codons are wanted to be introduced, e.g. with a certain percentage (e.g. 90% Ala, 3% Ile, 7% Val), and w.sub.i's are assigned weight factors as defined by the user of the program (e.g., depending on the importance of having a specific amino acid residue inserted into the position in question). N is 21 plus the number of amino acid groups as defined by the user of the program. For purposes of this function 0.degree. is defined as being 1.

[0256] A Monte-Cano algorithm (one example being the one described by Valleau, J. P. & Whittington, S. G. (1977) A guide to Mont Carlo for statistical mechanics: 1 Highways. In "Stastistical Mechanics, Part A" Equlibrium Techniqeues ed. B.J. Berne, New York: Plenum) is used for finding the maximum value of this function. In each iteration the following steps are performed:

[0257] 1. A new random nucteotide composition is chosen for each base, where the absolute difference between the current and the new composition is smaller than or equal to d for each of the four nucleotides G,A,T,C in all three positions of the codon (see below for definition of d).

[0258] 2. The scores of the new composition and the current composition are compared by the use of the function s as described above. If the new score is higher or equal to the score of the current composition, the new composition is kept and the current composition is changed to the new one. If the new score is smaller, the probability of keeping the new composition is exp(1000(new_score-current_score)).

[0259] A cycle normally consists of 1000 iterations as described above in which d is decreasing linearly from 1 to 0. One hundred or more cycles are performed in an optimization process. The nucleotide composition resulting in the highest score is finally presented.

EXAMPLES

Example 1

Construction of Stabilised Amylase Variants

[0260] Stabilising amino acid substitutions can be introduced by the mega-primer-PCR method described by Sarkar and Sommer, 1990, BioTechniques 8: 404-407, using a mutagenesis primer and two specific primers binding upstreams and down-streams, respectively of both the point of mutation and the restriction sites to be used for cloning.

[0261] To introduce the substitutions: E84Q, N96D, A315S, A445V, G464N, N121D and N393H the following mutagenesis primers could be used:

TABLE-US-00003 Pdmer Amrk7b2-E84Q: (SEQ ID NO:11) ctaaggcacagcttcaacgagctattgggtcc Primer Amrk752-N96D: (SEQ ID NO:12) ccttaaatctaatgatatcgatgtatacggagatg Primer Amrk752-A315S: (SEQ ID NO:13) ttataatttttaccggtcttcacaacaaggtgga Primer Amrk752-A445V: (SEQ ID NO:14) gtaggacgtcagaatgtaggacaaacatggac Prime Amrk752-G464N: (SEQ ID NO:15) ccgttacaattaataacgatggatggggcgaattc Primer Amrk230-N121D: (SEQ ID NO:16) gcaagctgttcaagtagatccaacgaatcgttgg Primer Amrk230-N390H: (SEQ ID NO:17) gcttgatgcacgtcaagattacgcatatggcacg -where the mutated codon is highlighted.

[0262] The amylase variant Amrk752 can be constructed by simultaneous introduction of the first five substitutions into SEQ 4 while Amrk230 can be constructed by introducing the last to substitutions into SEQ 4.

[0263] In a similar manner can Amrk299 be constructed on the basis of SEQ 4 by introducing the substitutions: T125S, S144P, I173L, D210E, N393H, V408I, R442Q. N444H, Q448A and G464S.

[0264] Wild type and variant amylases could be expressed in B.subtilis strains deficient of background amylase and protease activity and following be purified by conventional purifications methods.

Example 2

Activity at Alkaline pH

[0265] The relative activity of the amylases at alkaline pH was measured on culture broth, and the activity at pH 8 was defined to be 100% for comparison of the results in the table below. The Phadebas amylase assay system manufactured by Pharmacia AB was used in pH 10 buffer at 50.degree. C. and with 15 min reaction time.

TABLE-US-00004 Amylase pH 8 pH 10 SEQ 4 100% 6% Amrk230 100% 94% Amrk299 100% 19% Amrk752 100% 49%

Sequence CWU 1

1

1711650DNABacillus sp.CDS(65)..(1567)sig_peptide(65)..(128)mat_peptide(128)..() 1cttgaatcat tatttaaagc tggttatgat atatgtaagc gttatcatta aaaggaggta 60tttg atg aaa aga tgg gta gta gca atg ctg gca gtg tta ttt tta ttt 109 Met Lys Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe -20 -15 -10cct tcg gta gta gtt gca gat ggc ttg aat gga acg atg atg cag tat 157Pro Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr -5 -1 1 5 10tat gag tgg cat cta gag aat gat ggg caa cac tgg aat cgg ttg cat 205Tyr Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His 15 20 25gat gat gcc gaa gct tta agt aat gcg ggt att aca gct att tgg ata 253Asp Asp Ala Glu Ala Leu Ser Asn Ala Gly Ile Thr Ala Ile Trp Ile 30 35 40ccc cca gcc tac aaa gga aat agt cag gct gat gtt ggg tat ggt gca 301Pro Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala 45 50 55tac gac ctt tat gat tta ggg gag ttt aat caa aaa ggt acc gtt cga 349Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg 60 65 70acg aaa tac ggg aca aag gct cag ctt gag cga gct ata ggg tcc cta 397Thr Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu75 80 85 90aag tcg aat gat atc aat gtt tat ggg gat gtc gta atg aat cat aaa 445Lys Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys 95 100 105tta gga gct gat ttc acg gag gca gtg caa gct gtt caa gta aat cct 493Leu Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro 110 115 120tcg aac cgt tgg cag gat att tca ggt gtc tac acg att gat gca tgg 541Ser Asn Arg Trp Gln Asp Ile Ser Gly Val Tyr Thr Ile Asp Ala Trp 125 130 135acg gga ttt gac ttt cca ggg cgc aac aat gcc tat tcc gat ttt aaa 589Thr Gly Phe Asp Phe Pro Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys 140 145 150tgg aga tgg ttc cat ttt aat ggc gtt gac tgg gat caa cgc tat caa 637Trp Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr Gln155 160 165 170gaa aac cat ctt ttt cgc ttt gca aat acg aac tgg aac tgg cga gtg 685Glu Asn His Leu Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg Val 175 180 185gat gaa gag aat ggt aat tat gac tat tta tta gga tcg aac att gac 733Asp Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp 190 195 200ttt agc cac cca gag gtt caa gag gaa tta aag gat tgg ggg agc tgg 781Phe Ser His Pro Glu Val Gln Glu Glu Leu Lys Asp Trp Gly Ser Trp 205 210 215ttt acg gat gag cta gat tta gat ggg tat cga ttg gat gct att aag 829Phe Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys 220 225 230cat att cca ttc tgg tat acg tca gat tgg gtt agg cat cag cga agt 877His Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg Ser235 240 245 250gaa gca gac caa gat tta ttt gtc gta ggg gag tat tgg aag gat gac 925Glu Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp 255 260 265gta ggt gct ctc gaa ttt tat tta gat gaa atg aat tgg gag atg tct 973Val Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser 270 275 280cta ttc gat gtt ccg ctc aat tat aat ttt tac cgg gct tca aag caa 1021Leu Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Lys Gln 285 290 295ggc gga agc tat gat atg cgt aat att tta cga gga tct tta gta gaa 1069Gly Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu 300 305 310gca cat ccg att cat gca gtt acg ttt gtt gat aat cat gat act cag 1117Ala His Pro Ile His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln315 320 325 330cca gga gag tca tta gaa tca tgg gtc gct gat tgg ttt aag cca ctt 1165Pro Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu 335 340 345gct tat gcg aca atc ttg acg cgt gaa ggt ggt tat cca aat gta ttt 1213Ala Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe 350 355 360tac ggt gac tac tat ggg att cct aac gat aac att tca gct aag aag 1261Tyr Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys Lys 365 370 375gat atg att gat gag ttg ctt gat gca cgt caa aat tac gca tat ggc 1309Asp Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr Gly 380 385 390aca caa cat gac tat ttt gat cat tgg gat atc gtt gga tgg aca aga 1357Thr Gln His Asp Tyr Phe Asp His Trp Asp Ile Val Gly Trp Thr Arg395 400 405 410gaa ggt aca tcc tca cgt cct aat tcg ggt ctt gct act att atg tcc 1405Glu Gly Thr Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser 415 420 425aat ggt cct gga gga tca aaa tgg atg tac gta gga cag caa cat gca 1453Asn Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Gln Gln His Ala 430 435 440gga caa acg tgg aca gat tta act ggc aat cac gcg gcg tcg gtt acg 1501Gly Gln Thr Trp Thr Asp Leu Thr Gly Asn His Ala Ala Ser Val Thr 445 450 455att aat ggt gat ggc tgg ggc gaa ttc ttt aca aat gga gga tct gta 1549Ile Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val 460 465 470tcc gtg tat gtg aac caa taataaaaag ccttgagaag ggattcctcc 1597Ser Val Tyr Val Asn Gln475 480ctaactcaag gctttcttta tgtcgtttag ctcaacgctt ctacgaagct tta 16502501PRTBacillus sp. 2Met Lys Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe Pro -20 -15 -10Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr Tyr-5 -1 1 5 10Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His Asp 15 20 25Asp Ala Glu Ala Leu Ser Asn Ala Gly Ile Thr Ala Ile Trp Ile Pro 30 35 40Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr 45 50 55Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr60 65 70 75Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu Lys 80 85 90Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys Leu 95 100 105Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro Ser 110 115 120Asn Arg Trp Gln Asp Ile Ser Gly Val Tyr Thr Ile Asp Ala Trp Thr 125 130 135Gly Phe Asp Phe Pro Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys Trp140 145 150 155Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr Gln Glu 160 165 170Asn His Leu Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg Val Asp 175 180 185Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp Phe 190 195 200Ser His Pro Glu Val Gln Glu Glu Leu Lys Asp Trp Gly Ser Trp Phe 205 210 215Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys His220 225 230 235Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg Ser Glu 240 245 250Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp Val 255 260 265Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser Leu 270 275 280Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Lys Gln Gly 285 290 295Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu Ala300 305 310 315His Pro Ile His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln Pro 320 325 330Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu Ala 335 340 345Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe Tyr 350 355 360Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys Lys Asp 365 370 375Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr Gly Thr380 385 390 395Gln His Asp Tyr Phe Asp His Trp Asp Ile Val Gly Trp Thr Arg Glu 400 405 410Gly Thr Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asn 415 420 425Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Gln Gln His Ala Gly 430 435 440Gln Thr Trp Thr Asp Leu Thr Gly Asn His Ala Ala Ser Val Thr Ile 445 450 455Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val Ser460 465 470 475Val Tyr Val Asn Gln 48031745DNABacillusCDS(190)..(1692)sig_peptide(190)..(253)mat_peptide(253- )..() 3aactaagtaa catcgattca ggataaaagt atgcgaaacg atgcgcaaaa ctgcgcaact 60actagcactc ttcagggact aaaccacctt ttttccaaaa atgacatcat ataaacaaat 120ttgtctacca atcactattt aaagctgttt atgatatatg taagcgttat cattaaaagg 180aggtatttg atg aga aga tgg gta gta gca atg ttg gca gtg tta ttt tta 231 Met Arg Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu -20 -15 -10ttt cct tcg gta gta gtt gca gat gga ttg aac ggt acg atg atg cag 279Phe Pro Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln -5 -1 1 5tat tat gag tgg cat ttg gaa aac gac ggg cag cat tgg aat cgg ttg 327Tyr Tyr Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu10 15 20 25cac gat gat gcc gca gct ttg agt gat gct ggt att aca gct att tgg 375His Asp Asp Ala Ala Ala Leu Ser Asp Ala Gly Ile Thr Ala Ile Trp 30 35 40att ccg cca gcc tac aaa ggt aat agt cag gcg gat gtt ggg tac ggt 423Ile Pro Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly 45 50 55gca tac gat ctt tat gat tta gga gag ttc aat caa aag ggt act gtt 471Ala Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val 60 65 70cga acg aaa tac gga act aag gca cag ctt gaa cga gct att ggg tcc 519Arg Thr Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser 75 80 85ctt aaa tct aat gat atc aat gta tac gga gat gtc gtg atg aat cat 567Leu Lys Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His90 95 100 105aaa atg gga gct gat ttt acg gag gca gtg caa gct gtt caa gta aat 615Lys Met Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn 110 115 120cca acg aat cgt tgg cag gat att tca ggt gcc tac acg att gat gcg 663Pro Thr Asn Arg Trp Gln Asp Ile Ser Gly Ala Tyr Thr Ile Asp Ala 125 130 135tgg acg ggt ttc gac ttt tca ggg cgt aac aac gcc tat tca gat ttt 711Trp Thr Gly Phe Asp Phe Ser Gly Arg Asn Asn Ala Tyr Ser Asp Phe 140 145 150aag tgg aga tgg ttc cat ttt aat ggt gtt gac tgg gat cag cgc tat 759Lys Trp Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr 155 160 165caa gaa aat cat att ttc cgc ttt gca aat acg aac tgg aac tgg cga 807Gln Glu Asn His Ile Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg170 175 180 185gtg gat gaa gag aac ggt aat tat gat tac ctg tta gga tcg aat atc 855Val Asp Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile 190 195 200gac ttt agt cat cca gaa gta caa gat gag ttg aag gat tgg ggt agc 903Asp Phe Ser His Pro Glu Val Gln Asp Glu Leu Lys Asp Trp Gly Ser 205 210 215tgg ttt acc gat gag tta gat ttg gat ggt tat cgt tta gat gct att 951Trp Phe Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile 220 225 230aaa cat att cca ttc tgg tat aca tct gat tgg gtt cgg cat cag cgc 999Lys His Ile Pro Phe Trp Tyr Thr Ser Asp Trp Val Arg His Gln Arg 235 240 245aac gaa gca gat caa gat tta ttt gtc gta ggg gaa tat tgg aag gat 1047Asn Glu Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp250 255 260 265gac gta ggt gct ctc gaa ttt tat tta gat gaa atg aat tgg gag atg 1095Asp Val Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met 270 275 280tct cta ttc gat gtt cca ctt aat tat aat ttt tac cgg gct tca caa 1143Ser Leu Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Gln 285 290 295caa ggt gga agc tat gat atg cgt aat att tta cga gga tct tta gta 1191Gln Gly Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val 300 305 310gaa gcg cat ccg atg cat gca gtt acg ttt gtt gat aat cat gat act 1239Glu Ala His Pro Met His Ala Val Thr Phe Val Asp Asn His Asp Thr 315 320 325cag cca ggg gag tca tta gag tca tgg gtt gct gat tgg ttt aag cca 1287Gln Pro Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro330 335 340 345ctt gct tat gcg aca att ttg acg cgt gaa ggt ggt tat cca aat gta 1335Leu Ala Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val 350 355 360ttt tac ggt gat tac tat ggg att cct aac gat aac att tca gct aaa 1383Phe Tyr Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys 365 370 375aaa gat atg att gat gag ctg ctt gat gca cgt caa aat tac gca tat 1431Lys Asp Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr 380 385 390ggc acg cag cat gac tat ttt gat cat tgg gat gtt gta gga tgg act 1479Gly Thr Gln His Asp Tyr Phe Asp His Trp Asp Val Val Gly Trp Thr 395 400 405agg gaa gga tct tcc tcc aga cct aat tca ggc ctt gcg act att atg 1527Arg Glu Gly Ser Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met410 415 420 425tcg aat gga cct ggt ggt tcc aag tgg atg tat gta gga cgt cag aat 1575Ser Asn Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Arg Gln Asn 430 435 440gca gga caa aca tgg aca gat tta act ggt aat aac gga gcg tcc gtt 1623Ala Gly Gln Thr Trp Thr Asp Leu Thr Gly Asn Asn Gly Ala Ser Val 445 450 455aca att aat ggc gat gga tgg ggc gaa ttc ttt acg aat gga gga tct 1671Thr Ile Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser 460 465 470gta tcc gtg tac gtg aac caa taacaaaaag ccttgagaag ggattcctcc 1722Val Ser Val Tyr Val Asn Gln 475 480ctaactcaag gctttcttta tgt 17454501PRTBacillus 4Met Arg Arg Trp Val Val Ala Met Leu Ala Val Leu Phe Leu Phe Pro -20 -15 -10Ser Val Val Val Ala Asp Gly Leu Asn Gly Thr Met Met Gln Tyr Tyr-5 -1 1 5 10Glu Trp His Leu Glu Asn Asp Gly Gln His Trp Asn Arg Leu His Asp 15 20 25Asp Ala Ala Ala Leu Ser Asp Ala Gly Ile Thr Ala Ile Trp Ile Pro 30 35 40Pro Ala Tyr Lys Gly Asn Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr 45 50 55Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr60 65 70 75Lys Tyr Gly Thr Lys Ala Gln Leu Glu Arg Ala Ile Gly Ser Leu Lys 80 85 90Ser Asn Asp Ile Asn Val Tyr Gly Asp Val Val Met Asn His Lys Met 95 100 105Gly Ala Asp Phe Thr Glu Ala Val Gln Ala Val Gln Val Asn Pro Thr 110 115 120Asn Arg Trp Gln Asp Ile Ser Gly Ala Tyr Thr Ile Asp Ala Trp Thr 125 130 135Gly Phe Asp Phe Ser Gly Arg Asn Asn Ala Tyr Ser Asp Phe Lys Trp140 145 150 155Arg Trp Phe His Phe Asn Gly Val Asp Trp Asp Gln Arg Tyr Gln Glu 160 165 170Asn His Ile Phe Arg Phe Ala Asn Thr Asn Trp Asn Trp Arg Val Asp 175 180 185Glu Glu Asn Gly Asn Tyr Asp Tyr Leu Leu Gly Ser Asn Ile Asp Phe 190 195 200Ser His Pro Glu Val Gln Asp Glu Leu Lys Asp Trp Gly Ser Trp Phe 205 210 215Thr Asp Glu Leu Asp Leu Asp Gly Tyr Arg Leu Asp Ala Ile Lys His220 225 230 235Ile Pro Phe Trp Tyr Thr Ser

Asp Trp Val Arg His Gln Arg Asn Glu 240 245 250Ala Asp Gln Asp Leu Phe Val Val Gly Glu Tyr Trp Lys Asp Asp Val 255 260 265Gly Ala Leu Glu Phe Tyr Leu Asp Glu Met Asn Trp Glu Met Ser Leu 270 275 280Phe Asp Val Pro Leu Asn Tyr Asn Phe Tyr Arg Ala Ser Gln Gln Gly 285 290 295Gly Ser Tyr Asp Met Arg Asn Ile Leu Arg Gly Ser Leu Val Glu Ala300 305 310 315His Pro Met His Ala Val Thr Phe Val Asp Asn His Asp Thr Gln Pro 320 325 330Gly Glu Ser Leu Glu Ser Trp Val Ala Asp Trp Phe Lys Pro Leu Ala 335 340 345Tyr Ala Thr Ile Leu Thr Arg Glu Gly Gly Tyr Pro Asn Val Phe Tyr 350 355 360Gly Asp Tyr Tyr Gly Ile Pro Asn Asp Asn Ile Ser Ala Lys Lys Asp 365 370 375Met Ile Asp Glu Leu Leu Asp Ala Arg Gln Asn Tyr Ala Tyr Gly Thr380 385 390 395Gln His Asp Tyr Phe Asp His Trp Asp Val Val Gly Trp Thr Arg Glu 400 405 410Gly Ser Ser Ser Arg Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asn 415 420 425Gly Pro Gly Gly Ser Lys Trp Met Tyr Val Gly Arg Gln Asn Ala Gly 430 435 440Gln Thr Trp Thr Asp Leu Thr Gly Asn Asn Gly Ala Ser Val Thr Ile 445 450 455Asn Gly Asp Gly Trp Gly Glu Phe Phe Thr Asn Gly Gly Ser Val Ser460 465 470 475Val Tyr Val Asn Gln 48051920DNABacillus licheniformisCDS(421)..(1872) 5cggaagattg gaagtacaaa aataagcaaa agattgtcaa tcatgtcatg agccatgcgg 60gagacggaaa aatcgtctta atgcacgata tttatgcaac gttcgcagat gctgctgaag 120agattattaa aaagctgaaa gcaaaaggct atcaattggt aactgtatct cagcttgaag 180aagtgaagaa gcagagaggc tattgaataa atgagtagaa gcgccatatc ggcgcttttc 240ttttggaaga aaatataggg aaaatggtac ttgttaaaaa ttcggaatat ttatacaaca 300tcatatgttt cacattgaaa ggggaggaga atcatgaaac aacaaaaacg gctttacgcc 360cgattgctga cgctgttatt tgcgctcatc ttcttgctgc ctcattctgc agcagcggcg 420gca aat ctt aat ggg acg ctg atg cag tat ttt gaa tgg tac atg ccc 468Ala Asn Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro1 5 10 15aat gac ggc caa cat tgg agg cgt ttg caa aac gac tcg gca tat ttg 516Asn Asp Gly Gln His Trp Arg Arg Leu Gln Asn Asp Ser Ala Tyr Leu 20 25 30gct gaa cac ggt att act gcc gtc tgg att ccc ccg gca tat aag gga 564Ala Glu His Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly 35 40 45acg agc caa gcg gat gtg ggc tac ggt gct tac gac ctt tat gat tta 612Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60ggg gag ttt cat caa aaa ggg acg gtt cgg aca aag tac ggc aca aaa 660Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys65 70 75 80gga gag ctg caa tct gcg atc aaa agt ctt cat tcc cgc gac att aac 708Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn 85 90 95gtt tac ggg gat gtg gtc atc aac cac aaa ggc ggc gct gat gcg acc 756Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr 100 105 110gaa gat gta acc gcg gtt gaa gtc gat ccc gct gac cgc aac cgc gta 804Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val 115 120 125att tca gga gaa cac cta att aaa gcc tgg aca cat ttt cat ttt ccg 852Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His Phe Pro 130 135 140ggg cgc ggc agc aca tac agc gat ttt aaa tgg cat tgg tac cat ttt 900Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe145 150 155 160gac gga acc gat tgg gac gag tcc cga aag ctg aac cgc atc tat aag 948Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys 165 170 175 ttt caa gga aag gct tgg gat tgg gaa gtt tcc aat gaa aac ggc aac 996Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn 180 185 190tat gat tat ttg atg tat gcc gac atc gat tat gac cat cct gat gtc 1044Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val 195 200 205gca gca gaa att aag aga tgg ggc act tgg tat gcc aat gaa ctg caa 1092Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln 210 215 220ttg gac ggt ttc cgt ctt gat gct gtc aaa cac att aaa ttt tct ttt 1140Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe225 230 235 240ttg cgg gat tgg gtt aat cat gtc agg gaa aaa acg ggg aag gaa atg 1188Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met 245 250 255ttt acg gta gct gaa tat tgg cag aat gac ttg ggc gcg ctg gaa aac 1236Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn 260 265 270tat ttg aac aaa aca aat ttt aat cat tca gtg ttt gac gtg ccg ctt 1284Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu 275 280 285cat tat cag ttc cat gct gca tcg aca cag gga ggc ggc tat gat atg 1332His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met 290 295 300agg aaa ttg ctg aac ggt acg gtc gtt tcc aag cat ccg ttg aaa tcg 1380Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser305 310 315 320gtt aca ttt gtc gat aac cat gat aca cag ccg ggg caa tcg ctt gag 1428Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu 325 330 335tcg act gtc caa aca tgg ttt aag ccg ctt gct tac gct ttt att ctc 1476Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu 340 345 350aca agg gaa tct gga tac cct cag gtt ttc tac ggg gat atg tac ggg 1524Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly 355 360 365acg aaa gga gac tcc cag cgc gaa att cct gcc ttg aaa cac aaa att 1572Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His Lys Ile 370 375 380gaa ccg atc tta aaa gcg aga aaa cag tat gcg tac gga gca cag cat 1620Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His385 390 395 400gat tat ttc gac cac cat gac att gtc ggc tgg aca agg gaa ggc gac 1668Asp Tyr Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp 405 410 415agc tcg gtt gca aat tca ggt ttg gcg gca tta ata aca gac gga ccc 1716Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro 420 425 430ggt ggg gca aag cga atg tat gtc ggc cgg caa aac gcc ggt gag aca 1764Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr 435 440 445tgg cat gac att acc gga aac cgt tcg gag ccg gtt gtc atc aat tcg 1812Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser 450 455 460gaa ggc tgg gga gag ttt cac gta aac ggc ggg tcg gtt tca att tat 1860Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr465 470 475 480gtt caa aga tag aagagcagag aggacggatt tcctgaagga aatccgtttt 1912Val Gln Argtttatttt 19206483PRTBacillus licheniformis 6Ala Asn Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro1 5 10 15Asn Asp Gly Gln His Trp Arg Arg Leu Gln Asn Asp Ser Ala Tyr Leu 20 25 30Ala Glu His Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly 35 40 45Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys65 70 75 80Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn 85 90 95Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr 100 105 110Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val 115 120 125Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His Phe Pro 130 135 140Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe145 150 155 160Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys 165 170 175Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn 180 185 190Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val 195 200 205Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln 210 215 220Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe225 230 235 240Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met 245 250 255Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn 260 265 270Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu 275 280 285His Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met 290 295 300Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser305 310 315 320Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu 325 330 335Ser Thr Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu 340 345 350Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly 355 360 365Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His Lys Ile 370 375 380Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His385 390 395 400Asp Tyr Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp 405 410 415Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro 420 425 430Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr 435 440 445Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser 450 455 460Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr465 470 475 480Val Gln Arg71776DNABacillus sp.CDS(145)..(1692)sig_peptide(145)..(238)mat_peptide(238)..() 7atataaattt gaaatgaaca cctatgaaaa tatggtagcg attgcgcgac gagaaaaaac 60ttgggagtta ggaagtgata ttaaaggatt ttttttgact tgttgtgaaa acgcttgcat 120aaattgaagg agagggtgct tttt atg aaa ctt cat aac cgt ata att agc 171 Met Lys Leu His Asn Arg Ile Ile Ser -30 -25gta cta tta aca cta ttg tta gct gta gct gtt ttg ttt cca tat atg 219Val Leu Leu Thr Leu Leu Leu Ala Val Ala Val Leu Phe Pro Tyr Met -20 -15 -10acg gaa cca gca caa gcc cat cat aat ggg acg aat ggg acc atg atg 267Thr Glu Pro Ala Gln Ala His His Asn Gly Thr Asn Gly Thr Met Met -5 -1 1 5 10cag tat ttt gaa tgg cat ttg cca aat gac ggg aac cac tgg aac agg 315Gln Tyr Phe Glu Trp His Leu Pro Asn Asp Gly Asn His Trp Asn Arg 15 20 25tta cga gat gac gca gct aac tta aag agt aaa ggg att acc gct gtt 363Leu Arg Asp Asp Ala Ala Asn Leu Lys Ser Lys Gly Ile Thr Ala Val 30 35 40tgg att cct cct gca tgg aag ggg act tcg caa aat gat gtt ggg tat 411Trp Ile Pro Pro Ala Trp Lys Gly Thr Ser Gln Asn Asp Val Gly Tyr 45 50 55ggt gcc tat gat ttg tac gat ctt ggt gag ttt aac caa aag gga acc 459Gly Ala Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr 60 65 70gtc cgt aca aaa tat ggc aca agg agt cag ttg caa ggt gcc gtg aca 507Val Arg Thr Lys Tyr Gly Thr Arg Ser Gln Leu Gln Gly Ala Val Thr75 80 85 90tct ttg aaa aat aac ggg att caa gtt tat ggg gat gtc gtg atg aat 555Ser Leu Lys Asn Asn Gly Ile Gln Val Tyr Gly Asp Val Val Met Asn 95 100 105cat aaa ggt gga gca gac ggg aca gag atg gta aat gcg gtg gaa gtg 603His Lys Gly Gly Ala Asp Gly Thr Glu Met Val Asn Ala Val Glu Val 110 115 120aac cga agc aac cga aac caa gaa ata tca ggt gaa tac acc att gaa 651Asn Arg Ser Asn Arg Asn Gln Glu Ile Ser Gly Glu Tyr Thr Ile Glu 125 130 135gca tgg acg aaa ttt gat ttc cct gga aga gga aat acc cat tcc aac 699Ala Trp Thr Lys Phe Asp Phe Pro Gly Arg Gly Asn Thr His Ser Asn 140 145 150ttt aaa tgg cgc tgg tat cat ttt gat ggg aca gat tgg gat cag tca 747Phe Lys Trp Arg Trp Tyr His Phe Asp Gly Thr Asp Trp Asp Gln Ser155 160 165 170cgt cag ctt cag aac aaa ata tat aaa ttc aga ggt acc gga aag gca 795Arg Gln Leu Gln Asn Lys Ile Tyr Lys Phe Arg Gly Thr Gly Lys Ala 175 180 185tgg gac tgg gaa gta gat ata gag aac ggc aac tat gat tac ctt atg 843Trp Asp Trp Glu Val Asp Ile Glu Asn Gly Asn Tyr Asp Tyr Leu Met 190 195 200tat gca gac att gat atg gat cat cca gaa gta atc aat gaa ctt aga 891Tyr Ala Asp Ile Asp Met Asp His Pro Glu Val Ile Asn Glu Leu Arg 205 210 215aat tgg gga gtt tgg tat aca aat aca ctt aat cta gat gga ttt aga 939Asn Trp Gly Val Trp Tyr Thr Asn Thr Leu Asn Leu Asp Gly Phe Arg 220 225 230atc gat gct gtg aaa cat att aaa tac agc tat acg aga gat tgg cta 987Ile Asp Ala Val Lys His Ile Lys Tyr Ser Tyr Thr Arg Asp Trp Leu235 240 245 250aca cat gtg cgt aac acc aca ggt aaa cca atg ttt gca gtt gca gaa 1035Thr His Val Arg Asn Thr Thr Gly Lys Pro Met Phe Ala Val Ala Glu 255 260 265ttt tgg aaa aat gac ctt gct gca atc gaa aac tat tta aat aaa aca 1083Phe Trp Lys Asn Asp Leu Ala Ala Ile Glu Asn Tyr Leu Asn Lys Thr 270 275 280agt tgg aat cac tcc gtg ttc gat gtt cct ctt cat tat aat ttg tac 1131Ser Trp Asn His Ser Val Phe Asp Val Pro Leu His Tyr Asn Leu Tyr 285 290 295aat gca tct aat agt ggt ggc tat ttt gat atg aga aat att tta aat 1179Asn Ala Ser Asn Ser Gly Gly Tyr Phe Asp Met Arg Asn Ile Leu Asn 300 305 310ggt tct gtc gta caa aaa cac cct ata cat gca gtc aca ttt gtt gat 1227Gly Ser Val Val Gln Lys His Pro Ile His Ala Val Thr Phe Val Asp315 320 325 330aac cat gac tct cag cca gga gaa gca ttg gaa tcc ttt gtt caa tcg 1275Asn His Asp Ser Gln Pro Gly Glu Ala Leu Glu Ser Phe Val Gln Ser 335 340 345tgg ttc aaa cca ctg gca tat gca ttg att ctg aca agg gag caa ggt 1323Trp Phe Lys Pro Leu Ala Tyr Ala Leu Ile Leu Thr Arg Glu Gln Gly 350 355 360tac cct tcc gta ttt tac ggt gat tac tac ggt ata cca act cat ggt 1371Tyr Pro Ser Val Phe Tyr Gly Asp Tyr Tyr Gly Ile Pro Thr His Gly 365 370 375gtt cct tcg atg aaa tct aaa att gat cca ctt ctg cag gca cgt caa 1419Val Pro Ser Met Lys Ser Lys Ile Asp Pro Leu Leu Gln Ala Arg Gln 380 385 390acg tat gcc tac gga acc caa cat gat tat ttt gat cat cat gat att 1467Thr Tyr Ala Tyr Gly Thr Gln His Asp Tyr Phe Asp His His Asp Ile395 400 405 410atc ggc tgg acg aga gaa ggg gac agc tcc cac cca aat tca gga ctt 1515Ile Gly Trp Thr Arg Glu Gly Asp Ser Ser His Pro Asn Ser Gly Leu 415 420 425gca act att atg tcc gat ggg cca ggg ggt aat aaa tgg atg tat gtc 1563Ala Thr Ile Met Ser Asp Gly Pro Gly Gly Asn Lys Trp Met Tyr Val 430 435 440ggg aaa cat aaa gct ggc caa gta tgg aga gat atc acc gga aat agg 1611Gly Lys His Lys Ala Gly Gln Val Trp Arg Asp Ile Thr Gly Asn Arg 445 450 455tct ggt acc gtc acc att aat gca gat ggt tgg ggg aat ttc act gta 1659Ser Gly Thr Val Thr Ile Asn Ala Asp Gly Trp Gly Asn Phe Thr Val 460 465 470aac gga ggg gca gtt tcg gtt tgg gtg aag caa taaataagga acaagaggcg 1712Asn Gly Gly Ala Val Ser Val Trp Val Lys

Gln475 480 485aaaattactt tcctacatgc agagctttcc gatcactcat acacccaata taaattggaa 1772gctt 17768516PRTBacillus sp. 8Met Lys Leu His Asn Arg Ile Ile Ser Val Leu Leu Thr Leu Leu Leu -30 -25 -20Ala Val Ala Val Leu Phe Pro Tyr Met Thr Glu Pro Ala Gln Ala His-15 -10 -5 -1 1His Asn Gly Thr Asn Gly Thr Met Met Gln Tyr Phe Glu Trp His Leu 5 10 15Pro Asn Asp Gly Asn His Trp Asn Arg Leu Arg Asp Asp Ala Ala Asn 20 25 30Leu Lys Ser Lys Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Trp Lys 35 40 45Gly Thr Ser Gln Asn Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp50 55 60 65Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr 70 75 80Arg Ser Gln Leu Gln Gly Ala Val Thr Ser Leu Lys Asn Asn Gly Ile 85 90 95Gln Val Tyr Gly Asp Val Val Met Asn His Lys Gly Gly Ala Asp Gly 100 105 110Thr Glu Met Val Asn Ala Val Glu Val Asn Arg Ser Asn Arg Asn Gln 115 120 125Glu Ile Ser Gly Glu Tyr Thr Ile Glu Ala Trp Thr Lys Phe Asp Phe130 135 140 145Pro Gly Arg Gly Asn Thr His Ser Asn Phe Lys Trp Arg Trp Tyr His 150 155 160Phe Asp Gly Thr Asp Trp Asp Gln Ser Arg Gln Leu Gln Asn Lys Ile 165 170 175Tyr Lys Phe Arg Gly Thr Gly Lys Ala Trp Asp Trp Glu Val Asp Ile 180 185 190Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Met Asp 195 200 205His Pro Glu Val Ile Asn Glu Leu Arg Asn Trp Gly Val Trp Tyr Thr210 215 220 225Asn Thr Leu Asn Leu Asp Gly Phe Arg Ile Asp Ala Val Lys His Ile 230 235 240Lys Tyr Ser Tyr Thr Arg Asp Trp Leu Thr His Val Arg Asn Thr Thr 245 250 255Gly Lys Pro Met Phe Ala Val Ala Glu Phe Trp Lys Asn Asp Leu Ala 260 265 270Ala Ile Glu Asn Tyr Leu Asn Lys Thr Ser Trp Asn His Ser Val Phe 275 280 285Asp Val Pro Leu His Tyr Asn Leu Tyr Asn Ala Ser Asn Ser Gly Gly290 295 300 305Tyr Phe Asp Met Arg Asn Ile Leu Asn Gly Ser Val Val Gln Lys His 310 315 320Pro Ile His Ala Val Thr Phe Val Asp Asn His Asp Ser Gln Pro Gly 325 330 335Glu Ala Leu Glu Ser Phe Val Gln Ser Trp Phe Lys Pro Leu Ala Tyr 340 345 350Ala Leu Ile Leu Thr Arg Glu Gln Gly Tyr Pro Ser Val Phe Tyr Gly 355 360 365Asp Tyr Tyr Gly Ile Pro Thr His Gly Val Pro Ser Met Lys Ser Lys370 375 380 385Ile Asp Pro Leu Leu Gln Ala Arg Gln Thr Tyr Ala Tyr Gly Thr Gln 390 395 400His Asp Tyr Phe Asp His His Asp Ile Ile Gly Trp Thr Arg Glu Gly 405 410 415Asp Ser Ser His Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asp Gly 420 425 430Pro Gly Gly Asn Lys Trp Met Tyr Val Gly Lys His Lys Ala Gly Gln 435 440 445Val Trp Arg Asp Ile Thr Gly Asn Arg Ser Gly Thr Val Thr Ile Asn450 455 460 465Ala Asp Gly Trp Gly Asn Phe Thr Val Asn Gly Gly Ala Val Ser Val 470 475 480Trp Val Lys Gln 485940DNAArtificial sequencePrimer DAX-8N 9gctgcggccg ctgcagatgg mttgaayggw acgatgatgc 401043DNAArtificial sequencePrimer DAX-8C 10ggccgtcgac ttattggttc acrtacacgg atacagatcc tcc 431132DNAArtificial sequencePrimer Amrk752-E84Q 11ctaaggcaca gcttcaacga gctattgggt cc 321235DNAArtificial sequencePrimer Amrk752-N96D 12ccttaaatct aatgatatcg atgtatacgg agatg 351334DNAArtificial sequencePrimer Amrk752-A315S 13ttataatttt taccggtctt cacaacaagg tgga 341432DNAArtificial sequencePrimer Amrk752-A445V 14gtaggacgtc agaatgtagg acaaacatgg ac 321535DNAArtificial sequencePrimer Amrk752-G464N 15ccgttacaat taataacgat ggatggggcg aattc 351634DNAArtificial sequencePrimer Amrk230-N121D 16gcaagctgtt caagtagatc caacgaatcg ttgg 341734DNAArtificial sequencePrimer Amrk230-N390H 17gcttgatgca cgtcaagatt acgcatatgg cacg 34

Claims

1. A variant of a parent alpha-amylase, comprising an alteration at one or more positions selected from the group of: 2,9,14,15,16,26,27,48,49,51,52,53,54,58,73,88,94,96,103,104,107,108,111,1- 14,128,130, 133,138,140,142,144,148,149,156,161,165,166,168,171,173,174,178,179,180,1- 81,183,184,187, 188,190,194,197,198,199,200,201,202,203,204,205,207,209,210,211,212,214,2- 21,222,224, 228,230,233,234,237,239,241,242,252,253,254,255,260,264,265,267,275,276,2- 77,280,281, 286,290,293,301,305,314,315,318,329,333,340,341,356,375,376,377,380,383,3- 84,386,389,399, 403,404,405,406,427,441,444,453,454,472,479,480 wherein (a) the ateration(s) are independently (i) an insertion of an amino acid downstream of the amino acid which occupies the position, (ii) a deletion of the amino acid which occupies the position, or (iii) a substitution of the amino acid which occupies the position with a different amino acid, (b) the variant has alpha-amylase activity, and (c) each position corresponds to a position of the amino acid sequence of the parent alpha-amylase having the amino acid sequence of the KSM-36 alpha-amylases shown in SEQ ID NO: 2.

2. The variant of claim 1, which variant has one or more of the following mutations: G2P,A; M9I,L,F; H14Y; L15M,I,F,T, E16P; H26Y,Q,R,N; D27N,S,T; G48A,V,S,T; N49X; Q51X; A52X; D53E,Q,R; V54X; A58V,L,I,F; V73L,I,F; E84Q; G88X; D94X; N96Q; M103I,L,F; N104D; M//L107G,A,V,T,S,I,L,F; G108A, F111G,A,V,I,L,T; A114D,I,L,M,V,R; T125S; D128T,E; S130T,C; Y133F,H; W138F,Y; G140H,R,K,D,N; D142H,R,K,N; S144P; N148S; A149I; R156H,K,D,N; N161X; W165R; D166E; R168P; E171L,I,F; H173R,K,L; I173L; L174I,F; A178N,Q,R,K,H; N179G,A,T,S; T180N,Q,R,K,H; N181X; N183X; W184R,K; D187N,S,T, E188P,T,I,S; N190F, D194X; L197X; G198X; S199X; N200X; I201L,M,F,Y, D202X; F203L,I,F,M; S204X; H205X; E207Y,R; Q209V,L,I,F,M; E210X; E211Q; L212I,F; D214N,R,K,H; D221N; E222Q,T; D224N,Q; Y228F; L230I,F; I233A,V,L,F; K234N,Q; P237X; W239X; T241L,I,F,M; S242P,R; A252T; D253G,A,V,A,N Q254K; D255N,Q,E,P; G260A; K264Q,S,T; D265N,Y; V267L,I,F,M; D275N,T; E276K; M277T,I,L,F; E280N,T,Q,S; M281H,I,L,F; V286X, preferably V286Y,L,I,F; Y290X; Y293H,F; S301G,A,D,K,E,R; R305A,K,Q,E,H,D,N; E314K,Q,R,S,T,H,N; A315K,R,S; p318L,M,F; T329S; E333Q; A340R,K,N,D,Q,E; D341P,T,S,Q,N; G356Q,E,S,T,A; S375P; A376S; K377L,I,F,M; M380I,L,F; E383P,Q; L384I,F; D386N,Q,R,K,I,L; Q389K,R; Y399A,D,H; W403X, D404N; I405L,F; V406I,L,F,A,D; N427X; H441K,N,D,Q,E; R442Q; Q444E,K,R; A445V; Q448A; H453R,K,Q,N; A54S,T,P; G472R, N479Q,K,R, Q480K,R.

3. The variant of claims 1 or 2, wherein the variant has the flowing mutations: N49I+L/M107A; N49L+L/M 107A; G48A+N49L+L/M107A; G48A+N49L+L/M107A: E188S,T, P+N190F+I201F+K264S; G48A+N49I+L/M107A+E188S,T,P+N190F+I201F+K264S; N190F+I201F;N190F+K264S; I201F+K264S; G140H+D142H+R156H,Y(+S144P); G140K+D142D+R156H,Y(+S144P); L197M+G198Y+S199A; L15T+E188S+Q209V+A376S+G472R; G48A+N49I+L/M107A+G140H+D142H+R156H,Y+E188P+N190F+I201F+K264S(+S144P); N49T+L/M107A+G140H+D142H+R156H,Y+E188P+N190F+I201F+K264S(+S144P).

4. The variant according to any of claims 1-3, wherein the parent alpha-amylase has an amino acid sequence which has a degree of identity to SEQ ID NO: 2 of at least 60%, preferably 70%, more preferably at least 80%, even more preferably at least about 90%, even more preferably at least 95%, even more preferably at least 97%, and even more preferably at least 99%.

5. The variant of any of claims 1-4, wherein the parent alpha-amylase is encoded by a nucleic acid sequence, which hydndizes under medium, preferred high stringency conditions, with the nucleic acid sequence of SEQ ID NO: 1 or 3.

6. The variant of claims 1-5, wherein the parent alpha-amylase is KSM-K38 shown in SEQ ID NO:4.

7. The variant of claims 1-6, which variant has altered pl, in particular a higher pi than the parent alpha-amylase.

8. A DNA construct comprising a DNA sequence encoding an alpha-amylase variant according to any one of claims 1 to 7.

9. A recombinant expression vector which carries a DNA construct according to claim 8.

10. A cell which is transformed with a DNA construct according to claim 8 or a vector according to claim 9.

11. A cell according to claim 10, which s a microorganism, preferably a bacterum or a fungus, in particular a gram-positive bacterium, such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus or Bacillus thuringiensis.

12. A detergent additive comprising an alpha-amylase variant according to any one of claims 1-7, optionally in the form of a non-dusting granulate, stabilised liquid or protected enzyme.

13. A detergent additive according to claim 12, which contains 0.02-200 mg of enzyme protein/g of the additive.

14. A detergent additive according to claims 12 or 13, which additionally comprises another enzyme such as a protease, a lipase, a peroxidase, a pectate lyase, an amylase, or another amylolytic enzyme, such as maltogenic alpha-amylase or glucoamylase, mannanase, CGTase, and/or a cellulase.

15. A detergent composition comprising an alpha-amylase variant according to any of claims 1-7.

16. A detergent composition according to claim 15, which additionally comprises another enzyme such as a protease, a lipase, a peroxidase, a pectate lyase another amylolytic enzyme, glucoamylase, CGTase, mannanase, maltogenic amylase, and/or a cellulase.

17. A manual or automatic dishwashing detergent composition comprising an alpha-amylase variant according to any of claims 1-7.

18. A dishwashing detergent composition according to claim 17, which additionally comprises another enzyme such as a protease, a lipase, a peroxidase, a pectate lyase, an amylase, or another amylolytic enzyme, such as glucoamylase, CGTase, mannanase, maltogenic amylase and/or a cellulase.

19. A manual or automatic laundry washing composition comprising an alpha-amylase variant according to any of claims 1-7.

20. A laundry washing composition according to claim 19, which additionally comprises another enzyme such as a protease, a lipase, a peroxidase, a pectate lyase, an amylase, and/or another amylolytic enzyme, such as glucoamylase, CGTase, mannanase, maltogenic anmylase and/or a celtutase.