U.S. patent application number 11/817668 was filed with the patent office on 2008-06-26 for anti-angiogenic compounds.
Invention is credited to Curt W. Bradshaw, Venkata Ramana Doppalapudi, Jing-Yu Lai, John Rizzo.
Application Number | 20080152660 11/817668 |
Document ID | / |
Family ID | 36941895 |
Filed Date | 2008-06-26 |
United States Patent
Application |
20080152660 |
Kind Code |
A1 |
Bradshaw; Curt W. ; et
al. |
June 26, 2008 |
Anti-Angiogenic Compounds
Abstract
The present invention provides AA targeting compounds which
comprise AA targeting agent-linker conjugates which are linked to a
combining site of an antibody. Various uses of the compounds are
provided, including methods to treat disorders connected to
abnormal angiogenesis.
Inventors: |
Bradshaw; Curt W.; (San
Diego, CA) ; Doppalapudi; Venkata Ramana; (San Diego,
CA) ; Lai; Jing-Yu; (San Diego, CA) ; Rizzo;
John; (Oceanside, CA) |
Correspondence
Address: |
PERKINS COIE LLP
POST OFFICE BOX 1208
SEATTLE
WA
98111-1208
US
|
Family ID: |
36941895 |
Appl. No.: |
11/817668 |
Filed: |
March 3, 2006 |
PCT Filed: |
March 3, 2006 |
PCT NO: |
PCT/US06/07865 |
371 Date: |
September 17, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60658654 |
Mar 3, 2005 |
|
|
|
60677089 |
May 2, 2005 |
|
|
|
Current U.S.
Class: |
424/178.1 ;
514/13.3; 530/327; 530/328 |
Current CPC
Class: |
A61P 9/10 20180101; C07K
2319/30 20130101; A61P 35/00 20180101; A61P 9/00 20180101; A61P
17/06 20180101; C07K 7/02 20130101; A61P 19/02 20180101; A61P 27/02
20180101; A61K 38/00 20130101; A61P 9/12 20180101; A61P 13/12
20180101; A61P 31/04 20180101; C07K 7/06 20130101; A61P 29/00
20180101; A61P 3/10 20180101; C07K 16/40 20130101 |
Class at
Publication: |
424/178.1 ;
530/328; 530/327; 514/15 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 7/00 20060101 C07K007/00; A61K 38/08 20060101
A61K038/08 |
Claims
1. A compound having the formula: L-[AA targeting agent] wherein:
[AA targeting agent] is a peptide selected from the group
consisting of: TABLE-US-00015 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NH(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L is a linker moiety having the
formula --X--Y-Z, wherein: X is attached to the amino end, the
carboxy end, a Glu side chain, a Lys side chain, or a Thr side
chain of the AA targeting agent, is substituted or unsubstituted,
and is selected from R.sub.22--P--R.sup.23-- or
--R.sup.22--P--R.sup.21--P'--R.sub.23--, wherein: P and P' are each
independently a polymer selected from the group consisting of
polyoxyalkylene oxides such as polyethylene oxide,
polyethyloxazoline, poly-N-vinyl pyrrolidone, polyvinyl alcohol,
polyhydroxyethyl acrylate, polyhydroxy ethylmethacrylate and
polyacrylamide, polyamines having amine groups on either the
polymer backbone or the polymer sidechains, such as polylysine,
polyornithine, polyarginine, and polyhistidine, nonpeptide
polyamines such as polyaminostyrene, polyaminoacrylate,
poly(N-methyl aminoacrylate), poly(N-ethylaminoacrylate),
poly(N,N-dimethyl aminoacrylate), poly(N,N-diethylaminoacrylate),
poly(aminomethacrylate), poly(N-methyl amino-methacrylate),
poly(N-ethyl aminomethacrylate), poly(N,N-dimethyl
aminomethacrylate), poly(N,N-diethyl aminomethacrylate),
poly(ethyleneimine), polymers of quaternary amines, such as
poly(N,N,N-trimethylaminoacrylate chloride),
poly(methyacrylamidopropyltrimethyl ammonium chloride),
proteoglycans such as chondroitin sulfate-A (4-sulfate) chondroitin
sulfate-C (6-sulfate) and chondroitin sulfate-B, polypeptides such
as polyserine, polythreonine, polyglutamine, natural or synthetic
polysaccharides such as chitosan, hydroxy ethyl cellulose, and
lipids; R.sup.21, R.sup.22, and R.sup.23 are each independently a
covalent bond, --O--, --S--, NR.sup.b--, substituted or
unsubstituted straight or branched chain C.sub.1-10 alkylene,
substituted or unsubstituted straight or branched chain C.sub.1-10
heteroalkylene, substituted or unsubstituted straight or branched
chain C.sub.2-10 alkenylene, or substituted or unsubstituted
C.sub.2-10 heteroalkenylene; R.sup.b, at each occurrence, is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl;
R.sup.21, R.sup.22, and R.sup.23 are selected such that the
backbone length of X remains about 200 atoms or less; Y is a
recognition group comprising at least a ring structure; and Z is a
reactive group that is capable of forming a covalent bond with an
amino acid side chain in a combining site of an antibody.
2. The compound according to claim 1, wherein the backbone length
of X is 1-50 atoms.
3. The compound according to claim 1, wherein the backbone length
of X is 1-25 atoms.
4. The compound according to claim 1 wherein the backbone length of
X is 1-10 atoms.
5. The compound according to claim 1, wherein Y has the optionally
substituted formula ##STR00259## wherein a, b, c, d, and e are
independently carbon or nitrogen; f is carbon, nitrogen, oxygen, or
sulfur; Y is attached to X and Z independently at any two ring
positions of sufficient valence; and no more than four of a, b, c,
d, e, or f are simultaneously nitrogen.
6. The compound according to claim 1, wherein Z is substituted
alkyl, substituted cycloalkyl, substituted aryl, substituted
arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
7. A compound having the formula: L-[AA targeting agent] wherein:
[AA targeting agent] is a peptide selected from the group
consisting of: TABLE-US-00016 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L is a linker moiety having the
formula --X--Y-Z-, wherein: X is attached to the amino end, the
carboxy end, a Glu side chain, a Lys side chain, or a Thr side
chain of the AA targeting agent, is substituted or unsubstituted
and is selected from
--R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23--, --R.sup.22-aryl- R.sup.23--, or
--R.sup.22-heterocyclyl-R.sup.23--, wherein: R.sup.22 and R.sup.23
are independently a covalent bond, --O--, --S--, --NR.sup.b--,
substituted or unsubstituted straight or branched chain C.sub.1-50
alkylene, substituted or unsubstituted straight or branched chain
C.sub.1-50 heteroalkylene, substituted or unsubstituted straight or
branched chain C.sub.2-50 alkenylene, or substituted or
unsubstituted C.sub.2-50 heteroalkenylene; R.sup.b, at each
occurrence, is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl; t=2-50; and the size of R.sup.22 and R.sup.23
are such that the backbone length of X remains about 200 atoms or
less; Y is a recognition group comprising at least a ring
structure; and Z is a reactive group that is capable of forming a
covalent bond with an amino acid side chain in a combining site of
an antibody.
8. The compound according to claim 7, wherein: R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v--; R.sup.23
is --O--, --S--, --NR.sup.b--, substituted or unsubstituted
straight or branched chain C.sub.1-50 alkylene, substituted or
unsubstituted straight or branched chain C.sub.1-50 heteroalkylene,
substituted or unsubstituted straight or branched chain C.sub.2-50
alkenylene, or substituted or unsubstituted C.sub.2-50
heteroalkenylene; u and v are independently 0-20; and the size of
R.sup.22 and R.sup.23 are such that the backbone length of X
remains about 200 atoms or less.
9. The compound according to claim 8, wherein R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.0-2,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--.
10. The compound according to claim 8, wherein R.sup.22 is
--(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--.
11. The compound according to claim 8, wherein R.sup.23 is a
substituted or unsubstituted, straight or branched chain C.sub.1-50
alkylene or a substituted or unsubstituted, straight or branched
chain C.sub.1-50 heteroalkylene.
12. The compound according to claim 8, wherein R.sup.23 is a
substituted or unsubstituted, straight or branched chain C.sub.1-50
heteroalkylene.
13. The compound according to claim 8, wherein R.sup.23 has the
structure: ##STR00260## wherein p is 2-45; w is 1-20; r is 1-20; s
is 0-20; and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl.
14. The compound according to claim 13, wherein X has the
structure: ##STR00261## wherein the values of u, v, t, w, and p are
selected such that the backbone length of X is 1-100 atoms.
15. The compound according to claim 14, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is
atoms is 1-50.
16. The compound according to claim 14, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is 1-15
atoms.
17. The compound according to claim 13, wherein X has the
structure: ##STR00262## wherein the values of u, v, t, r, and s are
selected such that the backbone length of X is 1-100 atoms.
18. The compound according to claim 17, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-50
atoms.
19. The compound according to claim 17, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-15
atoms.
20. The compound according to claim 13, wherein X has the
structure: ##STR00263## wherein the values of u, v, t, w, and p are
selected such that the backbone length of X is 1-100 atoms.
21. The compound according to claim 20, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is 1-50
atoms.
22. The compound according to claim 20, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is 1-15
atoms.
23. The compound according to claim 13, wherein X has the
structure: ##STR00264## wherein the values of u, v, t, r, and s are
selected such that the backbone length of X is 1-100 atoms.
24. The compound according to claim 23, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-50
atoms.
25. The compound according to claim 23, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-15
atoms.
26. The compound according to claim 13, wherein X has the
structure: ##STR00265## wherein the values of u, v, t, w, and p are
selected such that the backbone length of X is 1-100 atoms.
27. The compound according to claim 26, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is 1-50
atoms.
28. The compound according to claim 26, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is 1-15
atoms.
29. The compound according to claim 13, wherein X has the
structure: ##STR00266## wherein the values of u, v, t, r, and s are
selected such that the backbone length of X is 1-100 atoms.
30. The compound according to claim 29, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-50
atoms.
31. The compound according to claim 29, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is 1-15
atoms.
32. The compound according to claim 13, wherein the ring structure
Y has the optionally substituted structure: ##STR00267## wherein a,
b, c, d, and e are independently carbon or nitrogen; f is carbon,
nitrogen, oxygen, or sulfur; Y is attached to X and Z independently
at any two ring positions of sufficient valence; and no more than
four of a, b, c, d, e, or f are simultaneously nitrogen.
33. The compound according to claim 32, wherein a, b, c, d, and e
in the ring structure are each carbon.
34. The compound according to claim 33, wherein the ring structure
Y is phenyl.
35. The compound according to claim 16, wherein the ring structure
Y is phenyl.
36. The compound according to claim 19, wherein the ring structure
Y is phenyl.
37. The compound according to claim 22, wherein the ring structure
Y is phenyl.
38. The compound according to claim 25, wherein the ring structure
Y is phenyl.
39. The compound according to claim 28, wherein the ring structure
Y is phenyl.
40. The compound according to claim 13, wherein Z is substituted
alkyl, substituted cycloalkyl, substituted aryl, substituted
arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
41. The compound according to claim 40, wherein the at least one
substituent is selected from the group consisting of substituted
1,3-diketones or acyl beta-lactams.
42. The compound according to claim 40, wherein Z is selected from
the group consisting of alkyl substituted 1,3 diketones or alkyl
substituted acyl beta lactams.
43. The compound according to claim 42, wherein Z has the
structure: ##STR00268## wherein q=0-5.
44. The compound according to claim 35, wherein Z has the
structure: ##STR00269## wherein q=0-5.
45. The compound according to claim 36, wherein Z has the
structure: ##STR00270## wherein q=0-5.
46. The compound according to claim 37, wherein Z has the
structure: ##STR00271## wherein q=0-5.
47. The compound according to claim 38, wherein Z has the
structure: ##STR00272## wherein q=0-5.
48. The compound according to claim 39, wherein Z has the
structure: ##STR00273## wherein q=0-5.
49. A compound having the formula L--[AA targeting agent] wherein:
[AA targeting agent] is a peptide selected from the group
consisting of: TABLE-US-00017 (SEQ ID NO:1)
R.sup.2-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.1-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.1-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; and
(SEQ ID NO:12) R.sup.1-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate; and
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6Hs,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L is a linker moiety selected
from the group consisting of: ##STR00274## wherein Rb, at each
occurrence, is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl; u=0-5; v=0-5; t=1-6; w=1-5; p=1-5; and q=0-5;
and the left side of L is connected to the amino terminus, the
carboxy terminus, a Thr side chain, or a Lys side chain of the [AA
targeting agent].
50. The compound of claim 49, wherein u is 0; v is 0; t is 1, 2, 3,
4, 5, or 6; w is 1 or 2; s is 1 or 2; and q is 2 or 3.
51. A compound having the structure: ##STR00275## wherein: v=0;
t=1-6; w=1; p=3; q=2; R.sup.b is hydrogen; and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:1);
wherein R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
52. A compound having the structure: ##STR00276## wherein: v=0;
t=1-6; w=1; p=3; q=2; R.sup.b is hydrogen; and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:10);
wherein R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
53. A compound having the structure: ##STR00277## wherein: v=0;
t=1-6; w=1; p=3; q=2; R.sup.b is hydrogen; and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup-
.3 (SEQ ID NO:12); wherein R.sup.3 is COOH, C(O)NH.sub.2,
C(O)NH(CH.sub.3), C(O)NHCH.sub.2CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.3, C(O)NHCH(CH.sub.3)CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
54. A compound having the structure: ##STR00278## wherein: v=0;
t=1-6; w=1; p=3; q=2; R.sup.b is hydrogen; and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:8);
wherein R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
55. A compound having the formula: L-[AA targeting agent] wherein:
[AA targeting agent] is a peptide selected from the group
consisting of: TABLE-US-00018 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate; and
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L is a linker moiety having the
formula --X--Y-Z-, wherein: X is: ##STR00279## wherein v and w are
selected such that the backbone length of X is 6-12 atoms; Y is a
recognition group comprising at least a ring structure; and Z is a
reactive group that is capable of forming a covalent bond with an
amino acid side chain in a combining site of an antibody.
56. The compound according to claim 55, wherein the ring structure
Y has the optionally substituted structure: ##STR00280## wherein a,
b, c, d, and e are independently carbon or nitrogen; f is carbon,
nitrogen, oxygen, or sulfur; Y is attached to X and Z independently
at any two ring positions of sufficient valence; and no more than
four of a, b, c, d, e, or f are simultaneously nitrogen.
57. The compound according to claim 56, wherein a, b, c, d, and e
in the ring structure are each carbon.
58. The compound according to claim 56, wherein the ring structure
Y is phenyl.
59. The compound according to claim 58, wherein Z is substituted
alkyl, substituted cycloalkyl, substituted aryl, substituted
arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
60. The compound according to claim 58, wherein the at least one
substituent is selected from the group consisting of substituted
1,3-diketones or acyl beta-lactams.
61. The compound according to claim 58, wherein Z is selected from
the group consisting of alkyl substituted 1,3 diketones or alkyl
substituted acyl beta lactams.
62. The compound according to claim 58, wherein Z has the
structure: ##STR00281## wherein q-O-5.
63. A compound having the structure: ##STR00282## wherein: v=1 or
2; w=1 or 2; q=2 or 3; R.sup.b is hydrogen; and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:10);
wherein R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
64. A compound having the formula: Antibody[-L'-[AA targeting
agent]] or 2 wherein: [AA targeting agent] is a peptide selected
from the group consisting of: TABLE-US-00019 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate; and
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L' is a linker moiety having the
formula --X--Y-Z'-, wherein: X is attached to the amino end, the
carboxy end, a Glu side chain, a Lys side chain, or a Thr side
chain of the AA targeting agent, is substituted or unsubstituted,
and is selected from --R.sup.22--P--R.sup.23-- or
--R.sup.22--P--R.sup.21--P'--R.sup.23 wherein: P and P' are each
independently a polymer selected from the group of polyoxyalkylene
oxides such as polyethylene oxide, polyethyloxazoline, poly-N-vinyl
pyrrolidone, polyvinyl alcohol, polyhydroxyethyl acrylate,
polyhydroxy ethylmethacrylate and polyacrylamide, polyamines having
amine groups on either the polymer backbone or the polymer
sidechains, such as polylysine, polyornithine, polyarginine, and
polyhistidine, nonpeptide polyamines such as polyaminostyrene,
polyaminoacrylate, poly(N-methyl aminoacrylate),
poly(N-ethylaminoacrylate), poly(N,N-dimethyl aminoacrylate),
poly(N,N-diethylaminoacrylate), poly(aminomethacrylate),
poly(N-methyl amino-methacrylate), poly(N-ethyl aminomethacrylate),
poly(N,N-dimethyl aminomethacrylate), poly(N,N-diethyl
aminomethacrylate), poly(ethyleneimine), polymers of quaternary
amines, such as poly(N,N,N-trimethylaminoacrylate chloride),
poly(methyacrylamidopropyltrimethyl ammonium chloride),
proteoglycans such as chondroitin sulfate-A (4-sulfate) chondroitin
sulfate-C (6-sulfate) and chondroitin sulfate-B, polypeptides such
as polyserine, polythreonine, polyglutamine, natural or synthetic
polysaccharides such as chitosan, hydroxy ethyl cellulose, and
lipids; R.sup.21, R.sup.22, and R.sup.23 are each independently a
covalent bond, --O--, --S--, --NR.sup.b, substituted or
unsubstituted straight or branched chain C.sub.1-10 alkylene,
substituted or unsubstituted straight or branched chain C.sub.1-10
heteroalkylene, substituted or unsubstituted straight or branched
chain C.sub.2-10 alkenylene, or substituted or unsubstituted
C.sub.2-10 heteroalkenylene; R.sup.b, at each occurrence, is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl; and
R.sup.21, R.sup.22, and R.sup.23 are selected such that the
backbone length of X remains about 200 atoms or less Y is a
recognition group comprising at least a ring structure; and Z' is
an attachment moiety comprising a covalent link to an amino acid
side in a combining site of an antibody.
65. The compound according to claim 64, wherein the backbone length
of X is 1-50 atoms.
66. The compound according to claim 64, wherein the backbone length
of X is 1-25 atoms.
67. The compound according to claim 64, wherein the backbone length
of X is 1-10 atoms.
68. The compound according to claim 64, wherein Y has the
optionally substituted structure: ##STR00283## wherein a, b, c, d,
and e are independently carbon or nitrogen; f is carbon, nitrogen,
oxygen, or sulfur; Y is attached to X and Z independently at any
two ring positions of sufficient valence; and no more than four of
a, b, c, d, e, or f are simultaneously nitrogen.
69. The compound according to claim 64, wherein Z' is substituted
alkyl, substituted cycloalkyl, substituted aryl, substituted
arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
70. A compound having the formula: Antibody[-L'-[AA targeting
agent]].sub.1 or 2 wherein: [AA targeting agent] is a peptide
selected from the group consisting of: TABLE-US-00020 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sup.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate; and
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L' is a linker moiety having the
formula --X--Y-Z'-, wherein: X is attached to the amino end, the
carboxy end, a Glu side chain, a Lys side chain, or a Thr side
chain of the AA targeting agent, AA targeting agent, is substituted
or unsubstituted and is selected from
R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23--, --R.sup.22-aryl- R.sup.23--, or
--R.sup.2-heterocyclyl-R.sup.23--, wherein: R.sup.22 and R.sup.23
are independently a covalent bond, --O--, --S--, --NR.sup.b--,
substituted or unsubstituted straight or branched chain C.sub.1-50
alkylene, substituted or unsubstituted straight or branched chain
C.sub.1-50 heteroalkylene, substituted or unsubstituted straight or
branched chain C.sub.2-50 alkenylene, or substituted or
unsubstituted C.sub.2-50 heteroalkenylene; R.sup.b, at each
occurrence, is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl; t=2-50; and the size of R.sup.22 and R.sup.23
are such that the backbone length of X remains about 200 atoms or
less; Y is an optionally present recognition group comprising at
least a ring structure; and Z' is an attachment moiety comprising a
covalent link to an amino acid side in a combining site of an
antibody.
71. The compound according to claim 70, wherein: R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v--; R.sup.23
is --O--, --S--, --NR.sup.b--, substituted or unsubstituted
straight or branched chain C.sub.1-50 alkylene, substituted or
unsubstituted straight or branched chain C.sub.1-50 heteroalkylene,
substituted or unsubstituted straight or branched chain C.sub.2-50
alkenylene, or substituted or unsubstituted C.sub.2-50
heteroalkenylene; u and v are independently 0-20; and the size of
R.sup.22 and R.sup.23 are such that the backbone length of X
remains about 200 atoms or less.
72. The compound according to claim 71, wherein R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--.alpha.--(CH.sub.2).sub.u--
-C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--.
73. The compound according to claim 71, wherein R.sup.22 is
--(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--.
74. The compound according to claim 71, wherein R.sup.23 is a
substituted or unsubstituted, straight or branched chain C.sub.1-50
alkylene or a substituted or unsubstituted, straight or branched
chain C.sub.1-50 heteroalkylene.
75. The compound according to claim 71, wherein R.sup.23 is a
substituted or unsubstituted, straight or branched chain C.sub.1-50
heteroalkylene.
76. The compound according to claim 71, wherein R.sup.23 has the
structure: ##STR00284## wherein p is 2-45; w is 1-20; r is 1-20; s
is 0-20; and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl.
77. The compound according to claim 76, wherein X has the
structure: ##STR00285## wherein the values of u, v, t, w, and p are
selected such that the backbone length of X is less than 100
atoms.
78. The compound according to claim 77, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 50 atoms.
79. The compound according to claim 77, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 15 atoms.
80. The compound according to claim 76, wherein X has the structure
##STR00286## wherein the values of u, v, t, r, and s are selected
such that the backbone length of X is less than 100 atoms.
81. The compound according to claim 80, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 50 atoms.
82. The compound according to claim 80, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 15 atoms.
83. The compound according to claim 76, wherein X has the
structure: ##STR00287## wherein the values of u, v, t, w, and p are
selected such that the backbone length of X is less than 100
atoms.
84. The compound according to claim 83, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 50 atoms.
85. The compound according to claim 83, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 15 atoms.
86. The compound according to claim 76, wherein X has the
structure: ##STR00288## wherein the values of u, v, t, r, and s are
selected such that the backbone length of X is less than 100
atoms.
87. The compound according to claim 86, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 50 atoms.
88. The compound according to claim 86, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 15 atoms.
89. The compound according to claim 76, wherein X has the
structure: ##STR00289## wherein the values of u, V, t, w, and p are
selected such that the backbone length of X is less than 100
atoms.
90. The compound according to claim 89, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 50 atoms.
91. The compound according to claim 89, wherein the values of u, v,
t, w, and p are selected such that the backbone length of X is less
than 15 atoms.
92. The compound according to claim 76, wherein X has the structure
##STR00290## wherein the values of u, v, t, r, and s are selected
such that the backbone length of X is less than 100 atoms.
93. The compound according to claim 92, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 50 atoms.
94. The compound according to claim 92, wherein the values of u, v,
t, r, and s are selected such that the backbone length of X is less
than 15 atoms.
95. The compound according to claim 76, wherein the ring structure
Y has the optionally substituted structure: ##STR00291## wherein a,
b, c, d, and e are independently carbon or nitrogen; f is carbon,
nitrogen, oxygen, or sulfur; Y is attached to X and Z'
independently at any two ring positions of sufficient valence; and
no more than four of a, b, c, d, e, or f are simultaneously
nitrogen.
96. The compound according to claim 95, wherein a, b, c, d, and e
in the ring structure are each carbon.
97. The compound according to claim 95, wherein the ring structure
Y is phenyl.
98. The compound according to claim 79, wherein the ring structure
Y is phenyl.
99. The compound according to claim 82, wherein the ring structure
Y is phenyl.
100. The compound according to claim 85, wherein the ring structure
Y is phenyl.
101. The compound according to claim 88, wherein the ring structure
Y is phenyl.
102. The compound according to claim 91, wherein the ring structure
Y is phenyl.
103. The compound according to claim 76, wherein Z' is substituted
alkyl, substituted cycloalkyl, substituted aryl, substituted
arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
104. The compound according to claim 103, wherein Z' is selected
from the group consisting of substituted 1,3-diketones or acyl
beta-lactams.
105. The compound according to claim 103, wherein Z' is selected
from the group consisting of alkyl substituted 1,3 diketones or
alkyl substituted acyl beta lactams.
106. The compound according to claim 104, wherein Z' has the
structure: ##STR00292## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
107. The compound according to claim 98, wherein Z' has the
structure: ##STR00293## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
108. The compound according to claim 99, wherein Z' has the
structure: ##STR00294## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
109. The compound according to claim 100, wherein Z' has the
structure: ##STR00295## wherein q=0-5.
110. The compound according to claim 101, wherein Z' has the
structure: ##STR00296## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
111. The compound according to claim 102, wherein Z' has the
structure: ##STR00297## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
112. The compound according to claim 106, wherein said antibody is
a full length antibody, Fab, Fab', F(ab').sub.2, Fv, dsF.sub.v,
scF.sub.v, V.sub.H, diabody, or minibody comprising V.sub.H and
V.sub.L domains from h38c2.
113. The compound according to claim 112, wherein said antibody is
a full length antibody.
114. The compound according to claim 106, wherein said antibody is
h38c2 IgG1.
115. The compound according to claim 106, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
116. The compound according to claim 107, wherein said antibody is
h38c2 IgG1.
117. The compound according to claim 107, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
118. The compound according to claim 108, wherein said antibody is
h38c2 IgG1.
119. The compound according to claim 108, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
120. The compound according to claim 109, wherein said antibody is
h38c2 IgG1.
121. The compound according to claim 109, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
122. The compound according to claim 110, wherein said antibody is
h38c2 IgG1.
123. The compound according to claim 110, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
124. The compound according to claim 111, wherein said antibody is
h38c2 IgG1.
125. The compound according to claim 111, wherein said antibody
comprises V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4.
126. A compound having the structure selected from the group:
##STR00298## wherein: v=0-5; t=1-6; w=1-5; p=1-5; and q=0-5;
R.sup.b at each occurrence is independently hydrogen; Antibody-N-
is a covalent bond to a side chain in a combining site of an
antibody, said Antibody further comprising V.sub.H and V.sub.L
domains from h38c2 and a constant domain selected from the group
consisting of IgG1, IgG2, IgG3, and IgG4; and
AA.sub.1-AA.sub.2-AA.sub.n is a peptide selected from the group
consisting of: TABLE-US-00021 (SEQ ID NO:1)
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:8)
Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:10)
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; and (SEQ ID
NO:12) Pro-(3,4-Dimethoxy-Phe)-Val(D-alloIle)-Thr-Nva-
Ile-Arg-Pro-R.sup.3;
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
127. The compound of claim 106, wherein u is 0; v is 0; t is 1, 2,
3, 4, 5, or 6; w is 1 or 2; p is 1 or 2; and s is 3.
128. The compound of claim 107, wherein Antibody is h38c2 IgG1.
129. A compound having the structure: ##STR00299## wherein: v=0;
t=1-6; w=1; p=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:1),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
130. A compound having the structure: ##STR00300## wherein: v=0;
t=1-6; w=1; p=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1 and
AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:10),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
131. A compound having the structure: ##STR00301## wherein: v=0;
t=1-6; w=1; p=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3
(SEQ ID NO:12), wherein R.sup.3 is COOH, C(O)NH.sub.2,
C(O)NH(CH.sub.3), C(O)NHCH.sub.2CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.3, C(O)NHCH(CH.sub.3)CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
132. A compound having the structure: ##STR00302## wherein: v=0;
t=1-6; w=1; p=3; and q-2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:8),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
133. A compound having the structure selected from the group:
##STR00303## wherein: v=0-5; t=1-6; r=1-5; s=1-5; and q=0-5;
R.sup.b are each hydrogen; Antibody-N- is a covalent bond to a side
chain in a combining site of an antibody, said Antibody further
comprising V.sub.H and V.sub.L domains from h38c2 and a constant
domain selected from the group consisting of IgG1, IgG2, IgG3, and
IgG4; and AA.sub.1-AA.sub.2-AA.sub.n is a peptide selected from the
group consisting of: TABLE-US-00022 (SEQ ID NO:1)
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:8)
Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:10)
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; and (SEQ ID
NO:12) Pro-(3,4-Dimethoxy-Phe)-Val(D-alloIle)-Thr-Nva-
Ile-Arg-Pro-R.sup.3;
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
134. The compound of claim 133, wherein v is 0; t is 1, 2, 3, 4, 5,
or 6; r is 1 or 2; s is 3; and q is 2.
135. The compound of claim 133, wherein Antibody is h38c2 IgG1.
136. A compound having the structure: ##STR00304## wherein: v=0;
t=1-6; r=1-2; s=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:1),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
137. A compound having the structure: ##STR00305## wherein: v=0;
t=1-6; r=1-2; s=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:10),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
138. A compound having the structure: ##STR00306## wherein: v=0;
t=1-6; r=1-2; s=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3
(SEQ ID NO:12), wherein: R.sup.3 is COOH, C(O)NH.sub.2,
C(O)NH(CH.sub.3), C(O)NHCH.sub.2CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.3, C(O)NHCH(CH.sub.3)CH.sub.3,
C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
139. A compound having the structure: ##STR00307## wherein: v=0;
t=1-6; r=1-2; s=3; and q=2; R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:8),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
140. A compound having the formula: Antibody[-L'-[AA targeting
agent]].sub.1 or 2 wherein: [AA targeting agent] is a peptide
selected from the group consisting of: TABLE-US-00023 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5OMe, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NHC(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an amino
protecting group, a lipid fatty acid group or a carbohydrate; and
R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L' is a linker moiety having the
formula --X--Y-Z'-, wherein: X has the structure: ##STR00308##
wherein v and w are selected such that the backbone length of X is
6-12 atoms; Y is a recognition group comprising at least a ring
structure; and Z' is an attachment moiety comprising a covalent
link to an amino acid side in a combining site of an antibody.
141. The compound according to claim 140, wherein the ring
structure Y has the optionally substituted structure ##STR00309##
wherein a, b, c, d, and e are independently carbon or nitrogen; f
is carbon, nitrogen, oxygen, or sulfur; Y is attached to X and Z
independently at any two ring positions of sufficient valence; and
no more than four of a, b, c, d, e, or f are simultaneously
nitrogen.
142. The compound according to claim 141, wherein a, b, c, d, and e
in the ring structure are each carbon.
143. The compound according to claim 141, wherein the ring
structure Y is phenyl.
144. The compound according to claim 143, wherein Z' is a
substituted alkyl, substituted cycloalkyl, substituted aryl,
substituted arylalkyl, substituted heterocyclyl, or substituted
heterocyclylalkyl, wherein at least one substituent is a
1,3-diketone moiety, an acyl beta-lactam, an active ester, an
alpha-haloketone, an aldehyde, a maleimide, a lactone, an
anhydride, an alpha-haloacetamide, an amine, a hydrazide, or an
epoxide.
145. The compound according to claim 144, wherein the at least one
substituent is selected from the group consisting of substituted
1,3-diketones or acyl beta-lactams.
146. The compound according to claim 141, wherein Z' is selected
from the group consisting of alkyl substituted 1,3 diketones or
alkyl substituted acyl beta lactams.
147. The compound according to claim 141, wherein Z' has the
structure: ##STR00310## wherein q=0-5 and Antibody-N- is a covalent
bond to a side chain in a combining site of an antibody.
148. A compound having the structure: ##STR00311## wherein: v=1 or
2; w=1 or 2; q--2 or 3; and R.sup.b is hydrogen; Antibody-N- is a
covalent bond to a side chain in a combining site of h38c2 IgG1;
and AA.sub.1-AA.sub.2-AA.sub.n is the peptide
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID NO:10),
wherein: R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, or a carboxy protecting group.
149. A compound having the structure: ##STR00312## wherein Antibody
is an antibody comprising the V.sub.H and V.sub.L domains from
h38c2 and a constant domain selected from the group consisting of
IgG1, IgG2, IgG3, and IgG4.
150. The compound of claim 149, wherein Antibody is h38c2 IgG1.
151. A compound having the structure: ##STR00313## wherein Antibody
is an antibody comprising the V.sub.H and V.sub.L domains from
h38c2 and a constant domain selected from the group consisting of
IgG1, IgG2, IgG3, and IgG4.
152. The compound of claim 151, wherein Antibody is h38c2 IgG1.
153. A compound having the structure: ##STR00314## wherein Antibody
is an antibody comprising the V.sub.H and V.sub.L domains from
h38c2 and a constant domain selected from the group consisting of
IgG1, IgG2, IgG3, and IgG4.
154. The compound of claim 153, wherein Antibody is h38c2 IgG1.
155. A compound having the structure: ##STR00315## wherein Antibody
is an antibody comprising the V.sub.H and V.sub.L domains from
h38c2 and a constant domain selected from the group consisting of
IgG1, IgG2, IgG3, and IgG4.
156. The compound of claim 155, wherein Antibody is h38c2 IgG1.
157. A pharmaceutical composition comprising a therapeutically
effective amount of the compound of claim 148.
158. A pharmaceutical composition comprising a therapeutically
effective amount of the compound of claim 150.
159. A pharmaceutical composition comprising a therapeutically
effective amount of the compound of claim 152.
160. A pharmaceutical composition comprising a therapeutically
effective amount of the compound of claim 154.
161. A pharmaceutical composition comprising a therapeutically
effective amount of the compound of claim 156.
162. The pharmaceutical composition of claim 157, further
comprising a therapeutically effective amount of one or more
chemotherapeutic agent.
163. The pharmaceutical composition of claim 162, wherein the
chemotherapeutic agent is a compound selected from the group
consisting of 5-Fluorouracil, irinotecan, oxilaplatin, bevacizumab,
and cetuximab.
164. The pharmaceutical composition of claim 158, further
comprising a therapeutically effective amount of one or more
chemotherapeutic agent.
165. The pharmaceutical composition of claim 164, wherein the
chemotherapeutic agent is a compound selected from the group
consisting of 5-Fluorouracil, irinotecan, oxilaplatin, bevacizumab,
and cetuximab.
166. The pharmaceutical composition of claim 159, further
comprising a therapeutically effective amount of one or more
chemotherapeutic agent.
167. The pharmaceutical composition of claim 166, wherein the
chemotherapeutic agent is a compound selected from the group
consisting of 5-Fluorouracil, irinotecan, oxilaplatin, bevacizumab,
and cetuximab.
168. The pharmaceutical composition of claim 160, further
comprising a therapeutically effective amount of one or more
chemotherapeutic agent.
169. The pharmaceutical composition of claim 168, wherein the
chemotherapeutic agent is a compound selected from the group
consisting of 5-Fluorouracil, irinotecan, oxilaplatin, bevacizumab,
and cetuximab.
170. A method of producing an AA targeting compound, comprising
covalently linking a compound of claim 51 with h38c2 IgG1.
171. A method of producing an AA targeting compound, comprising
covalently linking a compound of claim 52 with h38c2 IgG1
172. A method of producing an AA targeting compound, comprising
covalently linking a compound of claim 63 with h38c2 IgG1.
173. A method of inhibiting or reducing angiogenesis, comprising
administering to a cell an effective amount of the compound of
claim 1.
174. A method for treating or preventing a disease or symptom
associated with an angiogenic disorder, comprising administering to
the subject a therapeutically effective amount of the compound of
claim 1.
175. A method of treating an angiogenesis-dependent condition in a
mammal, comprising administering to said mammal: a
therapeutically-effective amount of an AA targeting compound; in a
combination treatment regimen including chemotherapy.
Description
RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional
Application No. 60/658,654, filed Mar. 3, 2005, and U.S.
Provisional Application No. 60/677,089, filed May 2, 2005, the
disclosures of both of which are incorporated by reference herein
in their entirety, including drawings and sequence listings.
FIELD OF THE DISCLOSURE
[0002] The present invention relates to novel compounds that
possess anti-angiogenic activity and methods of making and using
these compounds.
BACKGROUND
[0003] Angiogenesis is the fundamental process by which new blood
vessels are formed and is essential to a variety of normal body
activities such as reproduction, development and wound repair.
Although angiogenesis is a highly regulated process under normal
conditions, many diseases (characterized as "angiogenic diseases")
are caused or exacerbated by unregulated angiogenesis. For example,
ocular neovascularization has been implicated as the most common
cause of blindness. In certain existing conditions such as
arthritis, newly formed capillary blood vessels invade the joints
and destroy cartilage. In diabetes, new capillaries formed in the
retina invade the vitreous, bleed, and cause blindness. Growth and
metastasis of solid tumors are also angiogenesis-dependent (J.
Folkman, Cancer Res., 46:467-473 (1986), J. Folkman, J. Natl.
Cancer Inst., 82:4-6 (1989)). It has been shown, for example, that
tumors which enlarge to greater than 2 mm obtain their own blood
supply by inducing the growth of new capillary blood vessels. Once
these new blood vessels become embedded in the tumor, they provide
a means for tumor cells to enter the circulation and metastasize to
distant sites such as the liver, lungs, and bones (N. Weidner, et.
al., N. Engl. J. Med., 324:1-8 (1991)).
[0004] Thrombospondin-1 (TSP-1) is an extracellular matrix protein
secreted in response to activation of platelets by thrombin.
Various studies have demonstrated that certain peptide analogs of
TSP-1 possess antiangiogenesic activity. See, e.g., WO 01/38397, WO
01/38347, WO 99/61476, U.S. Patent Application Pub. No.
2003/0045477, U.S. Patent Application Pub. No. 2002/0183242, U.S.
Pat. No. 6,774,211, U.S. Pat. No. 6,716,963, U.S. Pat. No.
6,753,408, and U.S. Pat. No. 5,932,545. However, it is desirable to
prepare antiangiogenic compounds having improved profiles of
activity.
BRIEF SUMMARY
[0005] The present invention provides thrombospondin receptor
targeting compounds (AA targeting compounds) with unique
specificity and biological properties which are useful in many
applications. The thrombospondin targeting compounds of the
invention are formed by covalently linking a thrombospondin
targeting agent to a combining site of an antibody. Pharmaceutical
compositions comprising targeting compounds of the invention and a
pharmaceutically acceptable carrier are also provided.
[0006] A first aspect of the invention is an AA targeting
agent-linker conjugate having Formula I:
L--[AA targeting agent] (I)
wherein: [AA targeting agent] is a peptide selected from the group
consisting of:
TABLE-US-00001 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
[0007] R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
[0008] R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NH(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
[0009] R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L is a linker moiety having the
formula --X--Y-Z, wherein: [0010] X is a biologically compatible
polymer or block copolymer attached to one of the residues that
comprises an AA targeting agent; [0011] Y is an optionally present
recognition group comprising at least a ring structure; and Z is a
reactive group that is capable of covalently linking to a side
chain in a combining site of an antibody; and pharmaceutically
acceptable salts, stereoisomers, tautomers, solvates, and prodrugs
thereof.
[0012] In some embodiments of compounds of Formula I, X is:
--R.sup.22--P--R.sup.23-- or
--R.sup.22--P--R.sup.21--P'--R.sup.23--
wherein: [0013] P and P' are independently selected from the group
consisting of polyoxyalkylene oxides such as polyethylene oxide,
polyethyloxazoline, poly-N-vinyl pyrrolidone, polyvinyl alcohol,
polyhydroxyethyl acrylate, polyhydroxy ethylmethacrylate and
polyacrylamide, polyamines having amine groups on either the
polymer backbone or the polymer sidechains, such as polylysine,
polyornithine, polyarginine, and polyhistidine, nonpeptide
polyamines such as polyaminostyrene, polyaminoacrylate,
poly(N-methyl aminoacrylate), poly(N-ethylaminoacrylate),
poly(N,N-dimethyl aminoacrylate), poly(N,N-diethylaminoacrylate),
poly(aminomethacrylate), poly(N-methyl amino-methacrylate),
poly(N-ethyl aminomethacrylate), poly(N,N-dimethyl
aminomethacrylate), poly(N,N-diethyl aminomethacrylate),
poly(ethyleneimine), polymers of quaternary amines, such as
poly(N,N,N-trimethylaminoacrylate chloride),
poly(methyacrylamidopropyltrimethyl ammonium chloride),
proteoglycans such as chondroitin sulfate-A (4-sulfate) chondroitin
sulfate-C (6-sulfate) and chondroitin sulfate-B, polypeptides such
as polyserine, polythreonine, polyglutamine, natural or synthetic
polysaccharides such as chitosan, hydroxy ethyl cellulose, and
lipids; [0014] R.sup.21, R.sup.22, and R.sup.23 are each
independently a covalent bond, --O--, --S--, --NR.sup.b--,
substituted or unsubstituted straight or branched chain C.sub.1-50
alkylene, or substituted or unsubstituted straight or branched
chain C.sub.1-50 heteroalkylene; [0015] R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl; and [0016] R.sup.21,
R.sup.22, and R.sup.23 are selected such that the backbone length
of X remains about 200 atoms or less.
[0017] In some embodiments of compounds of Formula I, X is attached
to an amino acid residue in [AA targeting agent], and is an
optionally substituted
--R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23--, --R.sup.22-aryl-R.sup.23--, or
--R.sup.22-heterocyclyl-R.sup.23--, wherein t is 0 to 50.
[0018] In some embodiments of compounds of Formula I, R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v--, wherein
u and v are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19 or 20.
[0019] In some embodiments of compounds of Formula I, R.sup.21 and
R.sup.23 are independently --(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--C(O)--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.r--C(S)--NR.sup.b--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r,C(O)--NR.sup.b--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r--NR.sup.b(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--O--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--S(O).sub.0-2--(CH.sub.2).sub.s,
--(CH.sub.2).sub.n--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.s--, or
--(CH.sub.2).sub.r--P(O)(OR.sup.b)--O--(CH.sub.2).sub.s--, wherein
r, s, and v are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19 or 20.
[0020] In some embodiments of Formula I, if t>1 or if X is
--R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23, --R.sup.22-aryl-R.sup.23--, or
--R.sup.22-heterocyclyl-R.sup.23--, Y is present. FIGS. 1A and 1B
illustrate two embodiments according to Formula I that employ
Ac-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro (SEQ ID NO:1,
wherein R.sup.1 is Ac and R.sup.3 is absent) and
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-NHEt (SEQ ID NO:1,
wherein R.sup.1 is absent and R.sup.3 is NHEt), respectively, as
targeting agents. FIG. 2 illustrates other embodiments according to
Formula I that employ
Ac-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-NHEt (SEQ ID NO:3,
wherein R.sup.1 is Ac and R.sup.3 is NHEt) as a targeting
agent.
[0021] Another aspect of the invention, illustrated in Formula II,
is an AA targeting compound comprising an AA targeting agent
covalently linked to a combining site of an Antibody via an
intervening linker L'. The Antibody portion of an AA targeting
compound can include whole (full length) antibody, unique antibody
fragments, or any other forms of an antibody as this term is used
herein. In one embodiment, the Antibody is a humanized version of a
murine aldolase antibody comprising a constant region from a human
IgG, IgA, IgM, IgD, or IgE antibody. In another embodiment, the
Antibody is a chimeric antibody comprising the variable region from
a murine aldolase antibody and a constant region from a human IgG,
IgA, IgM, IgD, or IgE antibody. In a further embodiment, the
Antibody is a fully human version of a murine aldolase antibody
comprising a polypeptide sequence from natural or native human IgG,
IgA, IgM, IgD, or IgE antibody
Antibody-L'-[AA targeting agent] (II)
wherein: [AA targeting agent] is a peptide selected from the group
consisting of:
TABLE-US-00002 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
[0022] R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
[0023] R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NH(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
[0024] R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate; and L' is a linker moiety having the
formula --X--Y-Z', wherein: [0025] X is a biologically compatible
polymer or block copolymer attached to one of the residues that
comprises an AA targeting agent; [0026] Y is an optionally present
recognition group comprising at least a ring structure; and [0027]
Z is a group that is covalently linked to a side chain in a
combining site of an antibody; and pharmaceutically acceptable
salts, stereoisomers, tautomers, solvates, and prodrugs
thereof.
[0028] In some embodiments of compounds of Formula II, X is:
--R.sup.22--P--R.sup.23-- or
--R.sup.22--P--R.sup.21--P'--R.sup.23--
wherein: [0029] P and P' are independently selected from the group
consisting of polyoxyalkylene oxides such as polyethylene oxide,
polyethyloxazoline, poly-N-vinyl pyrrolidone, polyvinyl alcohol,
polyhydroxyethyl acrylate, polyhydroxy ethylmethacrylate and
polyacrylamide, polyamines having amine groups on either the
polymer backbone or the polymer side chains, such as polylysine,
polyornithine, polyarginine, and polyhistidine, nonpeptide
polyamines such as polyaminostyrene, polyaminoacrylate,
poly(N-methyl aminoacrylate), poly(N-ethylaminoacrylate),
poly(N,N-dimethyl aminoacrylate), poly(N,N-diethylaminoacrylate),
poly(aminomethacrylate), poly(N-methyl amino-methacrylate),
poly(N-ethyl aminomethacrylate), poly(N,N-dimethyl
aminomethacrylate), poly(N,N-diethyl aminomethacrylate),
poly(ethyleneimine), polymers of quaternary amines, such as
poly(N,N,N-trimethylaminoacrylate chloride),
poly(methyacrylamidopropyltrimethyl ammonium chloride),
proteoglycans such as chondroitin sulfate-A (4-sulfate) chondroitin
sulfate-C (6-sulfate) and chondroitin sulfate-B, polypeptides such
as polyserine, polythreonine, polyglutamine, natural or synthetic
polysaccharides such as chitosan, hydroxy ethyl cellulose, and
lipids; [0030] R.sup.21, R.sup.22, and R.sup.23 are each
independently a covalent bond, --O--, --S--, --NR.sup.b--,
substituted or unsubstituted straight or branched chain C.sub.1-50
alkylene, or substituted or unsubstituted straight or branched
chain C.sub.1-50 heteroalkylene; [0031] R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl; and [0032] R.sup.21,
R.sup.22, and R.sup.23 are selected such that the backbone length
of X remains about 200 atoms or less.
[0033] In some embodiments of compounds of Formula II, X is
attached to an amino acid residue in [AA targeting agent], and is
an optionally substituted
--R.sup.22--[CH.sub.2--CH.sub.2--O].sup.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23--, --R.sup.22-aryl-R.sup.23--, or
--R.sup.22-heterocyclyl-R.sup.23--, wherein t is 0 to 50.
[0034] In some embodiments of compounds of Formula II, R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.n--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v-- wherein u
and v are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19 or 20.
[0035] In some embodiments of compounds of Formula II, R.sup.21 and
R.sup.23 are independently --(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r,C(O)--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r,C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.r--C(S)--NR.sup.b--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r,C(O)--NR.sup.b(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--NR.sup.b(CH.sub.2).sub.v--,
--(CH.sub.2).sub.r--O--(CH.sub.2).sub.s,
--(CH.sub.2).sub.r--S(O).sub.0-2--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.s--, or
--(CH.sub.2).sub.r--P(O)(OR.sup.b)--O--(CH.sub.2).sub.s--, wherein
r, s, and v are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19 or 20.
[0036] Exemplary compounds in accordance with Formula II, wherein
Antibody is the humanized aldolase antibody h38c2 IgG1,
include:
##STR00001## ##STR00002##
[0037] Another aspect of the invention, illustrated in Formula III,
is an AA targeting compound in which two AA targeting agents, which
may be the same or different, are each covalently linked to a
combining site of an antibody. The Antibody portion of an AA
targeting compound can include whole (full length) antibody, unique
antibody fragments, or any other forms of an antibody as this term
is used herein. In one embodiment, the Antibody is a humanized
version of a murine aldolase antibody comprising a constant region
from a human IgG, IgA, IgM, IgD, or IgE antibody. In another
embodiment, the Antibody is a chimeric antibody comprising the
variable region from a murine aldolase antibody and a constant
region from a human IgG, IgA, IgM, IgD, or IgE antibody. In a
further embodiment, the Antibody is a fully human version of a
murine aldolase antibody comprising a polypeptide sequence from
natural or native human IgG, IgA, IgM, IgD, or IgE antibody.
Antibody[-L'-[AA targeting agent]].sub.2 (III)
wherein: [AA targeting agent], Antibody, and L' are as defined
according to Formula II. FIG. 3 illustrates embodiments according
to Formula III that employ
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-NHEt (SEQ ID NO:1,
wherein R.sup.1 is absent and R.sup.3 is NHEt) as a targeting
agent. FIG. 4 illustrates other embodiments according to Formula
III that employ Ac-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro (SEQ
ID NO:1) as a targeting agent. FIG. 5 illustrates other embodiments
according to Formula III that employ
Ac-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-NHEt (SEQ ID NO:3)
as a targeting agent.
[0038] Also provided are methods of delivering or administering AA
targeting compounds of the invention and methods of treatment using
AA targeting compounds of the invention. For example, methods of
treating (including preventing) a disease or condition associated
with abnormal angiogenesis in a subject include administering a
therapeutically effective amount of an AA targeting compound of the
invention to the subject. Diseases and conditions that may be
treated include cancer, arthritis, hypertension, kidney disease,
psoriasis, angiogenesis of the eye associated with ocular disorder,
infection or surgical intervention, macular degeneration, diabetic
retinopathy, and the like.
[0039] Another aspect of the invention includes methods of using AA
targeting compounds of the invention for diagnostic purposes. For
example, the AA targeting compounds can be used for the diagnosis
of a disease or condition associated with abnormal angiogenesis,
including cancer, arthritis, psoriasis, angiogenesis of the eye
associated with an ocular disorder, infection or surgical
intervention, macular degeneration, diabetic retinopathy, and the
like.
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] FIGS. 1A and B illustrate embodiments according to Formula
I.
[0041] FIG. 2 illustrate additional embodiments according to
Formula I.
[0042] FIG. 3 illustrates embodiments according to Formula III.
Aldolase Ab-N-represents a covalent bond to a side of an amino acid
in a combining site of an antibody.
[0043] FIG. 4 illustrates additional embodiments according to
Formula III. Aldolase Ab-N-represents a covalent bond to a side of
an amino acid in a combining site of an antibody.
[0044] FIG. 5 illustrates additional embodiments according to
Formula III. Antibody-N- represents a covalent bond to a side of an
amino acid in a combining site of an antibody.
[0045] FIG. 6A and FIG. 6B illustrate the solid phase synthesis of
targeting agent-linker conjugates of the present invention.
[0046] FIG. 7A illustrates the amino acid sequence alignment of the
variable domains of m38c2, h38c2, and human germlines. Framework
regions (FR) and complementarity determining regions (CDR) are
defined according to Kabat et al. Asterisks mark differences
between m38c2 and h38c2 or between h38c2 and the human germlines.
FIG. 7B illustrates the amino acid sequence of the light and heavy
chains of h38c2 IgG1.
[0047] FIG. 8 shows various structures that may serve as linker
reactive groups. Structures A-C form reversible covalent bonds with
surface accessible reactive nucleophilic groups (e.g., lysine or
cysteine side chain) of a combining site of an antibody. R'.sub.1,
R'.sub.2, R'.sub.3, and R.sub.4 in structures A-C represent
substituents which include, for example, C, H, N, O, P, S, halogen
(F, Cl, Br, I) or a salt thereof. X is N, C, or any other
heteroatom. These substituents may also include a group such as an
alkyl, alkenyl, alkynyl, oxoalkyl, oxoalkenyl, oxoalkynyl,
aminoalkyl, aminoalkenyl, aminoalkynyl, sulfoalkyl, sulfoalkenyl,
or sulfoalkynyl group, phosphoalkyl, phosphoalkenyl, phosphoalkynyl
group. R'.sub.2 and R'.sub.3 could be cyclic as exemplified in
structures B and C while X could be a heteroatom. For example,
structure A could form an irreversible covalent bond with a
reactive nucleophile if X is N and if R'.sub.1, and R.sub.3 form
part of a cyclic structure. Structures D-G may form nonreversible
covalent bonds with reactive nucleophilic groups in a combining
site of an antibody. In these structures, R''.sub.1, and R''.sub.2
represent C, O, N, halide or leaving groups such as mesyl or
tosyl.
[0048] FIG. 9 shows various electrophiles that are suitable for
reactive modification with a reactive amino acid side chain in a
combining site of an antibody and thus may serve as linker reactive
groups. Key: (A) acyl beta-lactam; (B) simple diketone; (C)
succinimide active ester; (D) maleimide; (E) haloacetamide with
linker; (F) haloketone; (G) cyclohexyl diketone; and (H) aldehyde.
The squiggle line indicates the point of attachment to the rest of
the linker or targeting agent. X refers to a halogen.
[0049] FIG. 10 shows the addition of a nucleophilic ("nu") side
chain in an antibody combining site to compounds A-G in FIG. 8.
Antibody-Nu- refers to a covalent bond to an amino acid side chain
bearing a nucleophile in a combining site of an antibody.
[0050] FIG. 11 shows the addition of a nucleophilic side chain in
an antibody combining to compounds A-H in FIG. 9. Antibody-Nu-
refers to a covalent bond to an amino acid side chain bearing a
nucleophile in a combining site of an antibody.
[0051] FIG. 12 shows a synthesis of:
##STR00003##
[0052] FIG. 13 shows a synthesis of:
##STR00004##
[0053] FIG. 14 shows a synthesis of:
##STR00005##
[0054] FIG. 15 shows a synthesis of:
##STR00006##
[0055] FIG. 16 shows a synthesis of:
##STR00007##
[0056] FIG. 17 shows a synthesis of:
##STR00008##
[0057] FIG. 18 shows a synthesis of:
##STR00009##
[0058] FIG. 19 shows a synthesis of:
##STR00010##
[0059] FIG. 20 shows a synthesis of:
##STR00011##
[0060] FIG. 21 shows syntheses of:
##STR00012##
[0061] FIG. 22 shows a synthesis of:
##STR00013##
[0062] FIG. 23 shows a synthesis of:
##STR00014##
[0063] FIG. 24 shows a synthesis of:
##STR00015##
[0064] FIG. 25 shows a synthesis of:
##STR00016##
[0065] FIG. 26 shows a synthesis of:
##STR00017##
[0066] FIG. 27 shows a synthesis of:
##STR00018##
[0067] FIG. 28 shows a synthesis of:
##STR00019##
DETAILED DESCRIPTION
Definitions
[0068] The following abbreviations, terms and phrases are used
herein as defined below.
TABLE-US-00003 TABLE 1 Amino acid abbreviations One letter Three
letter Amino acid abbreviation abbreviation Alanine A Ala Arginine
R Arg Asparagine N Asn Aspartic acid D Asp Cysteine C Cys Glutamic
acid E Glu Glutamine Q Gln Glycine G Gly Histidine H His Isoleucine
I Ile Leucine L Leu Lysine K Lys Methionine M Met Phenylalanine F
Phe Proline P Pro Serine S Ser Threonine T Thr Tryptophan W Trp
Tyrosine Y Tyr Valine V Val Norleucine -- Nle Norvaline -- Nva
Sarcosine -- Sar
[0069] Every amino-bearing side chain of a targeting agent can be
terminated by R.sub.1 or R.sub.2 as defined herein. Every
COOH/COO.sup.--- bearing side chain of a targeting agent can be
terminated by R.sub.3 as defined herein.
[0070] Sarcosine refers to N-methyl glycine.
[0071] Norvaline refers to:
##STR00020##
[0072] 3-(4-thiazolyl)-L-Alanine or 3-(4-thiazolyl)-L-Ala refers
to:
##STR00021##
[0073] 3,4-Dimethoxy-Phenylalanine or 3,4-Dimethoxy-Phe refers
to:
##STR00022##
[0074] 4-Cyanophenylalanine or 4-Cyano-Phe refers to:
##STR00023##
[0075] D-alloisoleucine or D-alloIle or D-aIle refers to:
##STR00024##
[0076] .alpha.-ally-glycine or .alpha.-ally-Gly refers to:
##STR00025##
[0077] Cycloleucine or Cyclo-Leu refers to:
##STR00026##
[0078] 2-furyl-alanine or 2-furyl-Ala refers to:
##STR00027##
[0079] Unless indicated otherwise by a "D" prefix, e.g., D-Ala or
N-Me-D-Ile, the stereochemistry of the alpha-carbon of the amino
acids and aminoacyl residues in peptides described in this
specification and the appended claims is the natural or "L"
configuration. The Cahn-Ingold-Prelog "R" and "S" designations are
used to specify the stereochemistry of chiral centers in certain
acyl substituents at the N-terminus of the peptides. The
designation "R,S" is meant to indicate a racemic mixture of the two
enantiomeric forms. This nomenclature follows that described in R.
S. Cahn, et al., Angew. Chem. Int. Ed. Engl., 5:385-415 (1966).
[0080] "Polypeptide," "peptide," and "protein" are used
interchangeably to refer to a polymer of amino acid residues. As
used herein, these terms apply to amino acid polymers in which one
or more amino acid residues is an artificial chemical analog of a
corresponding naturally occurring amino acid. These terms also
apply to naturally occurring amino acid polymers. Amino acids can
be in the L or D form as long as the binding function of the
peptide is maintained. Peptides may be cyclic, having an
intramolecular bond between two non-adjacent amino acids within the
peptide, e.g., backbone to backbone, side-chain to backbone and
side-chain to side-chain cyclization. Cyclic peptides can be
prepared by methods well know in the art. See e.g., U.S. Pat. No.
6,013,625.
[0081] All peptide sequences are written according to the generally
accepted convention whereby the alpha-N-terminal amino acid residue
is on the left and the alpha-C-terminal amino acid residue is on
the right. As used herein, the term "N-terminus" refers to the free
alpha-amino group of an amino acid in a peptide, and the term
"C-terminus" refers to the free .alpha.-carboxylic acid terminus of
an amino acid in a peptide. A peptide which is N-terminated with a
group refers to a peptide bearing a group on the alpha-amino
nitrogen of the N-terminal amino acid residue. An amino acid which
is N-terminated with a group refers to an amino acid bearing a
group on the alpha-amino nitrogen.
[0082] In general, "substituted" refers to a group as defined below
in which one or more bonds to a hydrogen atom contained therein are
replaced by a bond to non-hydrogen or non-carbon atoms such as, but
not limited to, a halogen atom such as F, Cl, Br, and I; an oxygen
atom in groups such as hydroxyl groups, alkoxy groups, aryloxy
groups, and ester groups; a sulfur atom in groups such as thiol
groups, alkyl and aryl sulfide groups, sulfone groups, sulfonyl
groups, and sulfoxide groups; a nitrogen atom in groups such as
amines, amides, alkylamines, dialkylamines, arylamines,
alkylarylamines, diarylamines, N-oxides, imides, and enamines; a
silicon atom in groups such as in trialkylsilyl groups,
dialkylarylsilyl groups, alkyldiarylsilyl groups, and triarylsilyl
groups; and other heteroatoms in various other groups. Substituted
alkyl groups and also substituted cycloalkyl groups and others also
include groups in which one or more bonds to a carbon(s) or
hydrogen(s) atom is replaced by a bond to a heteroatom such as
oxygen in carbonyl, carboxyl, and ester groups; nitrogen in groups
such as imines, oximes, hydrazones, and nitriles. As employed
herein, a group which is "optionally substituted" may be
substituted or unsubstituted. Thus, e.g., "optionally substituted
alkyl" refers to both substituted alkyl groups and unsubstituted
alkyl groups.
[0083] The phrase "unsubstituted alkyl" refers to alkyl groups that
do not contain heteroatoms. Thus, the phrase includes straight
chain alkyl groups such as methyl, ethyl, propyl, butyl, pentyl,
hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl and the like.
The phrase also includes branched chain isomers of straight chain
alkyl groups, including but not limited to, the following which are
provided by way of example: --CH(CH.sub.3).sub.2,
--CH(CH.sub.3)(CH.sub.2CH.sub.3), --CH(CH.sub.2CH.sub.3).sub.2,
--C(CH.sub.3).sub.3, --C(CH.sub.2CH.sub.3).sub.3,
--CH.sub.2CH(CH.sub.3).sub.2,
--CH.sub.2CH(CH.sub.3)(CH.sub.2CH.sub.3),
--CH.sub.2CH(CH.sub.2CH.sub.3).sub.2, --CH.sub.2C(CH.sub.3).sub.3,
--CH.sub.2C(CH.sub.2CH.sub.3).sub.3,
--CH(CH.sub.3)CH(CH.sub.3)(CH.sub.2CH.sub.3),
--CH.sub.2CH.sub.2CH(CH.sub.3).sub.2,
--CH.sub.2CH.sub.2CH(CH.sub.3)(CH.sub.2CH.sub.3),
--CH.sub.2CH.sub.2CH(CH.sub.2CH.sub.3).sub.2,
--CH.sub.2CH.sub.2C(CH.sub.3).sub.3,
--CH.sub.2CH.sub.2C(CH.sub.2CH.sub.3).sub.3,
--CH(CH.sub.3)CH.sub.2CH(CH.sub.3).sub.2,
--CH(CH.sub.3)CH(CH.sub.3)CH(CH.sub.3).sub.2,
--CH(CH.sub.2CH.sub.3)CH(CH.sub.3)CH(CH.sub.3)(CH.sub.2CH.sub.3),
and others. The phrase does not include cycloalkyl groups. Thus,
the phrase unsubstituted alkyl groups includes primary alkyl
groups, secondary alkyl groups, and tertiary alkyl groups.
Unsubstituted alkyl groups may be bonded to one or more carbon
atom(s), oxygen atom(s), nitrogen atom(s), and/or sulfur atom(s) in
the parent compound. Possible unsubstituted alkyl groups include
straight and branched chain alkyl groups having 1 to 20 carbon
atoms. Alternatively, such unsubstituted alkyl groups have from 1
to 10 carbon atoms or are lower alkyl groups having from 1 to about
6 carbon atoms. Other unsubstituted alkyl groups include straight
and branched chain alkyl groups having from 1 to 3 carbon atoms and
include methyl, ethyl, propyl, and --CH(CH.sub.3).sub.2.
[0084] The phrase "substituted alkyl" refers to an alkyl group in
which one or more bonds to a carbon(s) or hydrogen(s) are replaced
by a bond to non-hydrogen and non-carbon atoms such as, but not
limited to, a halogen atom in halides such as F, Cl, Br, and I; an
oxygen atom in groups such as hydroxyl groups, alkoxy groups,
aryloxy groups, and ester groups; a sulfur atom in groups such as
thiol groups, alkyl and aryl sulfide groups, sulfone groups,
sulfonyl groups, and sulfoxide groups; a nitrogen atom in groups
such as amines, amides, alkylamines, dialkylamines, arylamines,
alkylarylamines, diarylamines, N-oxides, imides, and enamines; a
silicon atom in groups such as in trialkylsilyl groups,
dialkylarylsilyl groups, alkyldiarylsilyl groups, and triarylsilyl
groups; and other heteroatoms in various other groups. Substituted
alkyl groups also include groups in which one or more bonds to a
carbon(s) or hydrogen(s) atom is replaced by a bond to a heteroatom
such as oxygen in carbonyl, carboxyl, and ester groups; nitrogen in
groups such as imines, oximes, hydrazones, and nitriles.
Substituted alkyl groups include, among others, alkyl groups in
which one or more bonds to a carbon or hydrogen atom is/are
replaced by one or more bonds to fluorine atoms. One example of a
substituted alkyl group is the trifluoromethyl group and other
alkyl groups that contain the trifluoromethyl group. Other alkyl
groups include those in which one or more bonds to a carbon or
hydrogen atom is replaced by a bond to an oxygen atom such that the
substituted alkyl group contains a hydroxyl, alkoxy, aryloxy group,
or heterocyclyloxy group. Still other alkyl groups include alkyl
groups that have an amine, alkylamine, dialkylamine, arylamine,
(alkyl)(aryl)amine, diarylamine, heterocyclylamine,
(alkyl)(heterocyclyl)amine, (aryl)(heterocyclyl)amine, or
diheterocyclylamine group.
[0085] The phrase "unsubstituted alkylene" refers to a divalent
unsubstituted alkyl group as defined above. Thus methylene,
ethylene, and propylene are each examples of unsubstituted
alkylenes. The phrase "substituted alkylene" refers to a divalent
substituted alkyl group as defined above. Substituted or
unsubstituted lower alkylene groups have from 1 to about 6
carbons.
[0086] The phrase "unsubstituted cycloalkyl" refers to cyclic alkyl
groups such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,
cycloheptyl, and cyclooctyl and such rings substituted with
straight and branched chain alkyl groups as defined above. The
phrase also includes polycyclic alkyl groups such as, but not
limited to, adamantyl norbornyl, and bicyclo[2.2.2]octyl and the
like, as well as such rings substituted with straight and branched
chain alkyl groups as defined above. Thus, the phrase would include
methylcylcohexyl groups among others. The phrase does not include
cyclic alkyl groups containing heteroatoms. Unsubstituted
cycloalkyl groups may be bonded to one or more carbon atom(s),
oxygen atom(s), nitrogen atom(s), and/or sulfur atom(s) in the
parent compound. In some embodiments unsubstituted cycloalkyl
groups have from 3 to 20 carbon atoms. In other embodiments, such
unsubstituted alkyl groups have from 3 to 8 carbon atoms while in
others, such groups have from 3 to 7 carbon atoms.
[0087] The phrase "substituted cycloalkyl" has the same meaning
with respect to unsubstituted cycloalkyl groups that substituted
alkyl groups have with respect to unsubstituted alkyl groups. Thus,
the phrase includes, but is not limited to, oxocyclohexyl,
chlorocyclohexyl, hydroxycyclopentyl, and chloromethylcyclohexyl
groups.
[0088] The phrase "unsubstituted aryl" refers to aryl groups that
do not contain heteroatoms. Thus the phrase includes, but is not
limited to, groups such as phenyl, biphenyl, anthracenyl, and
naphthenyl by way of example. Although the phrase "unsubstituted
aryl" includes groups containing condensed rings such as
naphthalene, it does not include aryl groups that have other groups
such as alkyl or halo groups bonded to one of the ring members, as
aryl groups such as tolyl are considered herein to be substituted
aryl groups as described below. Typically, an unsubstituted aryl
may be a lower aryl, having from 6 to about 10 carbon atoms. One
unsubstituted aryl group is phenyl. Unsubstituted aryl groups may
be bonded to one or more carbon atom(s), oxygen atom(s), nitrogen
atom(s), and/or sulfur atom(s) in the parent compound, however.
[0089] The phrase "substituted aryl group" has the same meaning
with respect to unsubstituted aryl groups that substituted alkyl
groups have with respect to unsubstituted alkyl groups. However, a
substituted aryl group also includes aryl groups in which one of
the aromatic carbons is bonded to one of the non-carbon or
non-hydrogen atoms described above and also includes aryl groups in
which one or more aromatic carbons of the aryl group is bonded to a
substituted and/or unsubstituted alkyl, alkenyl, or alkynyl group
as defined herein. This includes bonding arrangements in which two
carbon atoms of an aryl group are bonded to two atoms of an alkyl,
alkenyl, or alkynyl group to define a fused ring system (e.g.,
dihydronaphthyl or tetrahydronaphthyl). Thus, the phrase
"substituted aryl" includes, but is not limited to tolyl and
hydroxyphenyl among others.
[0090] The phrase "unsubstituted alkenyl" refers to straight and
branched chain and cyclic groups such as those described with
respect to unsubstituted alkyl groups as defined above, except that
at least one double bond exists between two carbon atoms. Examples
include, but are not limited to vinyl, --CH.dbd.C(H)(CH.sub.3),
--CH.dbd.C(CH.sub.3).sub.2, --C(CH.sub.3).dbd.C(H).sub.2,
--C(CH.sub.3).dbd.C(H)(CH.sub.3),
--C(CH.sub.2CH.sub.3).dbd.CH.sub.2, cyclohexenyl, cyclopentenyl,
cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl among
others. Lower unsubstituted alkenyl groups have from 1 to about 6
carbons.
[0091] The phrase "substituted alkenyl" has the same meaning with
respect to unsubstituted alkenyl groups that substituted alkyl
groups have with respect to unsubstituted alkyl groups. A
substituted alkenyl group includes alkenyl groups in which a
non-carbon or non-hydrogen atom is bonded to a carbon double bonded
to another carbon and those in which one of the non-carbon or
non-hydrogen atoms is bonded to a carbon not involved in a double
bond to another carbon. For example, --CH.dbd.CH--OCH.sub.3 and
--CH.dbd.CH--CH.sub.2--OH are both substituted alkenyls.
Oxoalkenyls wherein a CH.sub.2 group is replaced by a carbonyl,
such as --CH.dbd.CH--C(O)--CH.sub.3, are also substituted
alkenyls.
[0092] The phrase "unsubstituted alkenylene" refers to a divalent
unsubstituted alkenyl group as defined above. For example,
--CH.dbd.CH-- is an exemplary unsubstituted alkenylene. The phrase
"substituted alkenylene" refers to a divalent substituted alkenyl
group as defined above.
[0093] The phrase "unsubstituted alkynyl" refers to straight and
branched chain groups such as those described with respect to
unsubstituted alkyl groups as defined above, except that at least
one triple bond exists between two carbon atoms. Examples include,
but are not limited to, --C.ident.C(H), --C.ident.C(CH.sub.3),
--C.ident.C(CH.sub.2CH.sub.3), --C(H.sub.2)C.ident.C(H),
--C(H).sub.2C.ident.C(CH.sub.3), and
--C(H).sub.2C.ident.C(CH.sub.2CH.sub.3) among others. Unsubstituted
lower alkynyl groups have from 1 to about 6 carbons.
[0094] The phrase "substituted alkynyl" has the same meaning with
respect to unsubstituted alkynyl groups that substituted alkyl
groups have with respect to unsubstituted alkyl groups. A
substituted alkynyl group includes alkynyl groups in which a
non-carbon or non-hydrogen atom is bonded to a carbon triple bonded
to another carbon and those in which a non-carbon or non-hydrogen
atom is bonded to a carbon not involved in a triple bond to another
carbon. Examples include, but are not limited to, oxoalkynyls
wherein a CH.sub.2 group is replaced by a carbonyl, such as
--C(O)--CH.ident.CH--CH.sub.3 and
--C(O)--CH.sub.2--CH.ident.CH.
[0095] The phrase "unsubstituted alkynylene" refers to a divalent
unsubstituted alkynyl group as defined above. A-C.ident.C-- is an
example of an unsubstituted alkynylene. The phrase "substituted
alkynylene" refers to a divalent substituted alkynyl group as
defined above.
[0096] The phrase "unsubstituted aralkyl" refers to unsubstituted
alkyl groups as defined above in which a hydrogen or carbon bond of
the unsubstituted alkyl group is replaced with a bond to an aryl
group as defined above. For example, methyl (--CH.sub.3) is an
unsubstituted alkyl group. If a hydrogen atom of the methyl group
is replaced by a bond to a phenyl group, such as if the carbon of
the methyl were bonded to a carbon of benzene, then the compound is
an unsubstituted aralkyl group (i.e., a benzyl group). Thus, the
phrase includes, but is not limited to, groups such as benzyl,
diphenylmethyl, and 1-phenylethyl
(--CH(C.sub.6H.sub.5)(CH.sub.3)).
[0097] The phrase "substituted aralkyl" has the same meaning with
respect to unsubstituted aralkyl groups that substituted aryl
groups have with respect to unsubstituted aryl groups. However,
substituted aralkyls also include groups in which a carbon or
hydrogen bond of the alkyl part of the group is replaced by a bond
to a non-carbon or a non-hydrogen atom. Examples of substituted
aralkyl groups include, but are not limited to,
--CH.sub.2C(.dbd.O)(C.sub.6Hs), and --CH.sub.2(2-methylphenyl).
[0098] The phrase "unsubstituted aralkenyl" refers to unsubstituted
alkenyl groups as defined above in which a hydrogen or carbon bond
of the unsubstituted alkenyl group is replaced with a bond to an
aryl group as defined above. For example, vinyl is an unsubstituted
alkenyl group. If a hydrogen atom of the vinyl group is replaced by
a bond to a phenyl group, such as if a carbon of the vinyl were
bonded to a carbon of benzene, then the compound is an
unsubstituted aralkenyl group (i.e., a styryl group). Thus, the
phrase includes, but is not limited to, groups such as styryl,
diphenylvinyl, and 1-phenylethenyl
(--C(C.sub.6H.sub.5)(CH.sub.2)).
[0099] The phrase "substituted aralkenyl" has the same meaning with
respect to unsubstituted aralkenyl groups that substituted aryl
groups have with respect to unsubstituted aryl groups. A
substituted aralkenyl group also includes groups in which a carbon
or hydrogen bond of the alkenyl part of the group is replaced by a
bond to a non-carbon or a non-hydrogen atom. Examples of
substituted aralkenyl groups include, but are not limited to,
--CH.dbd.C(Cl)(C.sub.6H.sub.5), and
--CH.dbd.CH(2-methylphenyl).
[0100] The phrase "unsubstituted aralkynyl" refers to unsubstituted
alkynyl groups as defined above in which a hydrogen or carbon bond
of the unsubstituted alkynyl group is replaced with a bond to an
aryl group as defined above. For example, acetylene is an
unsubstituted alkynyl group. If a hydrogen atom of the acetylene
group is replaced by a bond to a phenyl group, such as if a carbon
of the acetylene were bonded to a carbon of benzene, then the
compound is an unsubstituted aralkynyl group. Thus, the phrase
includes, but is not limited to, groups such as --C.ident.-phenyl
and --CH.sub.2--C.ident.C-phenyl.
[0101] The phrase "substituted aralkynyl" has the same meaning with
respect to unsubstituted aralkynyl groups that substituted aryl
groups have with respect to unsubstituted aryl groups. However, a
substituted aralkynyl group also includes groups in which a carbon
or hydrogen bond of the alkynyl part of the group is replaced by a
bond to a non-carbon or a non-hydrogen atom. Examples of
substituted aralkynyl groups include, but are not limited to,
--C.ident.C--C(Br)(C.sub.6H.sub.5) and
--C.ident.C(2-methylphenyl).
[0102] The phrase "unsubstituted heteroalkyl" refers to
unsubstituted alkyl groups as defined above in which the carbon
chain is interrupted by one or more heteroatoms chosen from N, O,
and S. Unsubstituted heteroalkyls containing N may have NH or N
(unsubstituted alkyl) in the carbon chain. For example,
unsubstituted heteroalkyls include alkoxy, alkoxyalkyl,
alkoxyalkoxy, thioether, alkylaminoalkyl, aminoalkyloxy, and other
such groups. Typically, unsubstituted heteroalkyl groups contain
1-5 heteroatoms, and particularly 1-3 heteroatoms. In some
embodiments unsubstituted heteroalkyls include, for example,
alkoxyalkoxyalkoxy groups such as ethyloxyethyloxyethyloxy.
[0103] The phrase "substituted heteroalkyl" has the same meaning
with respect to unsubstituted heteroalkyl groups that substituted
alkyl groups have with respect to unsubstituted alkyl groups.
[0104] The phrase "unsubstituted heteroalkylene" refers to a
divalent unsubstituted heteroalkyl group as defined above. For
example, --CH.sub.2--O--CH.sub.2-- and
--CH.sub.2--NH--CH.sub.2CH.sub.2-- are both exemplary unsubstituted
heteroalkylenes. The phrase "substituted heteroalkylene" refers to
a divalent substituted heteroalkyl group As defined above.
[0105] The phrase "unsubstituted heteroalkenyl" refers to
unsubstituted alkene groups as defined above in which the carbon
chain is interrupted by one or more heteroatoms chosen from N, O,
and S. Unsubstituted heteroalkenyls containing N may have NH or N
(unsubstituted alkyl or alkene) in the carbon chain. The phrase
"substituted heteroalkenyl" has the same meaning with respect to
unsubstituted heteroalkenyl groups that substituted heteroalkyl
groups have with respect to unsubstituted heteroalkyl groups.
[0106] The phrase "unsubstituted heteroalkenylene" refers to a
divalent unsubstituted heteroalkenyl group as defined above. Thus
--CH.sub.2--O--CH.dbd.CH-- is an example of an unsubstituted
heteroalkenylene. The phrase "substituted heteroalkenylene" refers
to a divalent substituted heteroalkenyl group as defined above.
[0107] The phrase "unsubstituted heteroalkynyl" refers to
unsubstituted alkynyl groups as defined above in which the carbon
chain is interrupted by one or more heteroatoms chosen from N, O,
and S. Unsubstituted heteroalkynyls containing N may have NH or N
(unsubstituted alkyl, alkene, or alkyne) in the carbon chain. The
phrase "substituted heteroalkynyl" has the same meaning with
respect to unsubstituted heteroalkynyl groups that substituted
heteroalkyl groups have with respect to unsubstituted heteroalkyl
groups.
[0108] The phrase "unsubstituted heteroalkynylene" refers to a
divalent unsubstituted heteroalkynyl group as defined above. Thus
--CH.sub.2--O--CH.sub.2--C.ident.C-- is an example of an
unsubstituted heteroalkynylene. The phrase "substituted
heteroalkynylene" refers to a divalent substituted heteroalkynyl
group as defined above.
[0109] The phrase "unsubstituted heterocyclyl" refers to both
aromatic and nonaromatic ring compounds including monocyclic,
bicyclic, and polycyclic ring compounds such as, but not limited
to, quinuclidyl, containing 3 or more ring members of which one or
more is a heteroatom such as, but not limited to, N, O, and S.
Although the phrase "unsubstituted heterocyclyl" includes condensed
heterocyclic rings such as benzimidazolyl, it does not include
heterocyclyl groups that have other groups such as alkyl or halo
groups bonded to one of the ring members as compounds such as
2-methylbenzimidazolyl are substituted heterocyclyl groups.
Examples of heterocyclyl groups include, but are not limited to:
unsaturated 3 to 8 membered rings containing 1 to 4 nitrogen atoms
such as, but not limited to pyrrolyl, pyrrolinyl, imidazolyl,
pyrazolyl, pyridyl, dihydropyridyl, pyrimidyl, pyrazinyl,
pyridazinyl, triazolyl (e.g., 4H-1,2,4-triazolyl,
1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl etc.), tetrazolyl, (e.g.,
1H-tetrazolyl, 2H tetrazolyl, etc.); saturated 3 to 8 membered
rings containing 1 to 4 nitrogen atoms such as, but not limited to,
pyrrolidinyl, imidazolidinyl, piperidinyl, piperazinyl; condensed
unsaturated heterocyclic groups containing 1 to 4 nitrogen atoms
such as, but not limited to, indolyl, isoindolyl, indolinyl,
indolizinyl, benzimidazolyl, quinolyl, isoquinolyl, indazolyl,
benzotriazolyl; unsaturated 3 to 8 membered rings containing 1 to 2
oxygen atoms and 1 to 3 nitrogen atoms such as, but not limited to,
oxazolyl, isoxazolyl, oxadiazolyl (e.g., 1,2,4-oxadiazolyl,
1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, etc.); saturated 3 to 8
membered rings containing 1 to 2 oxygen atoms and 1 to 3 nitrogen
atoms such as, but not limited to, morpholinyl; unsaturated
condensed heterocyclic groups containing 1 to 2 oxygen atoms and 1
to 3 nitrogen atoms, for example, benzoxazolyl, benzoxadiazolyl,
benzoxazinyl (e.g., 2H-1,4-benzoxazinyl, etc.); unsaturated 3 to 8
membered rings containing 1 to 3 sulfur atoms and 1 to 3 nitrogen
atoms such as, but not limited to, thiazolyl, isothiazolyl,
thiadiazolyl (e.g., 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl,
1,3,4-thiadiazolyl, 1,2,5-thiadiazolyl, etc.); saturated 3 to 8
membered rings containing 1 to 2 sulfur atoms and 1 to 3 nitrogen
atoms such as, but not limited to, thiazolodinyl; saturated and
unsaturated 3 to 8 membered rings containing 1 to 2 sulfur atoms
such as, but not limited to, thienyl, dihydrodithiinyl,
dihydrodithionyl, tetrahydrothiophene, tetrahydrothiopyran;
unsaturated condensed heterocyclic rings containing 1 to 2 sulfur
atoms and 1 to 3 nitrogen atoms such as, but not limited to,
benzothiazolyl, benzothiadiazolyl, benzothiazinyl (e.g.,
2H-1,4-benzothiazinyl, etc.), dihydrobenzothiazinyl (e.g.,
2H-3,4-dihydrobenzothiazinyl, etc.), unsaturated 3 to 8 membered
rings containing oxygen atoms such as, but not limited to furyl;
unsaturated condensed heterocyclic rings containing 1 to 2 oxygen
atoms such as benzodioxolyl (e.g., 1,3-benzodioxoyl, etc.);
unsaturated 3 to 8 membered rings containing an oxygen atom and 1
to 2 sulfur atoms such as, but not limited to, dihydrooxathiinyl;
saturated 3 to 8 membered rings containing 1 to 3 oxygen atoms and
1 to 2 sulfur atoms such as 1,4-oxathiane; unsaturated condensed
rings containing 1 to 2 sulfur atoms such as benzothienyl,
benzodithiinyl; and unsaturated condensed heterocyclic rings
containing an oxygen atom and 1 to 3 oxygen atoms such as
benzoxathiinyl. Heterocyclyl group also include those described
above in which one or more S atoms in the ring is double-bonded to
one or two oxygen atoms (sulfoxides and sulfones). For example,
heterocyclyl groups include tetrahydrothiophene,
tetrahydrothiophene oxide, and tetrahydrothiophene 1,1-dioxide. In
some embodiments heterocyclyl groups contain 5 or 6 ring members.
In other embodiments heterocyclyl groups include morpholine,
piperazine, piperidine, pyrrolidine, imidazole, pyrazole,
1,2,3-triazole, 1,2,4-triazole, tetrazole, thiomorpholine,
thiomorpholine in which the S atom of the thiomorpholine is bonded
to one or more O atoms, pyrrole, homopiperazine, oxazolidin-2-one,
pyrrolidin-2-one, oxazole, quinuclidine, thiazole, isoxazole,
furan, and tetrahydrofuran.
[0110] The phrase "substituted heterocyclyl" refers to an
unsubstituted heterocyclyl group as defined above in which one of
the ring members is bonded to a non-hydrogen atom such as described
above with respect to substituted alkyl groups and substituted aryl
groups. Examples include, but are not limited to,
2-methylbenzimidazolyl, 5-methylbenzimidazolyl,
5-chlorobenzthiazolyl, 1-methyl piperazinyl, and
2-chloropyridyl.
[0111] The phrase "unsubstituted heteroaryl" refers to
unsubstituted aromatic heterocyclyl groups as defined above. Thus,
unsubstituted heteroaryl groups include but are not limited to
furyl, imidazolyl, oxazolyl, isoxazolyl, pyridinyl, benzimidazolyl,
and benzothiazolyl. The phrase "substituted heteroaryl" refers to
substituted aromatic heterocyclyl groups as defined above.
[0112] The phrase "unsubstituted heterocyclylalkyl" refers to
unsubstituted alkyl groups as defined above in which a hydrogen or
carbon bond of the unsubstituted alkyl group is replaced with a
bond to a heterocyclyl group as defined above. For example, methyl
(--CH.sub.3) is an unsubstituted alkyl group. If a hydrogen atom of
the methyl group is replaced by a bond to a heterocyclyl group,
such as if the carbon of the methyl were bonded to carbon 2 of
pyridine (one of the carbons bonded to the N of the pyridine) or
carbons 3 or 4 of the pyridine, then the compound is an
unsubstituted heterocyclylalkyl group.
[0113] The phrase "substituted heterocyclylalkyl" has the same
meaning with respect to unsubstituted heterocyclylalkyl groups that
substituted aralkyl groups have with respect to unsubstituted
aralkyl groups. A substituted heterocyclylalkyl group also includes
groups in which a non-hydrogen atom is bonded to a heteroatom in
the heterocyclyl group of the heterocyclylalkyl group such as, but
not limited to, a nitrogen atom in the piperidine ring of a
piperidinylalkyl group.
[0114] The phrase "unsubstituted heterocyclylalkenyl" refers to
unsubstituted alkenyl groups as defined above in which a hydrogen
or carbon bond of the unsubstituted alkenyl group is replaced with
a bond to a heterocyclyl group as defined above. For example, vinyl
is an unsubstituted alkenyl group. If a hydrogen atom of the vinyl
group is replaced by a bond to a heterocyclyl group, such as if the
carbon of the vinyl were bonded to carbon 2 of pyridine or carbons
3 or 4 of the pyridine, then the compound is an unsubstituted
heterocyclylalkenyl group.
[0115] The phrase "substituted heterocyclylalkenyl" has the same
meaning with respect to unsubstituted heterocyclylalkenyl groups
that substituted aralkenyl groups have with respect to
unsubstituted aralkenyl groups. However, a substituted
heterocyclylalkenyl group also includes groups in which a
non-hydrogen atom is bonded to a heteroatom in the heterocyclyl
group of the heterocyclylalkenyl group such as, but not limited to,
a nitrogen atom in the piperidine ring of a piperidinylalkenyl
group.
[0116] The phrase "unsubstituted heterocyclylalkynyl" refers to
unsubstituted alkynyl groups as defined above in which a hydrogen
or carbon bond of the unsubstituted alkynyl group is replaced with
a bond to a heterocyclyl group as defined above. For example,
acetylene is an unsubstituted alkynyl group. If a hydrogen atom of
the acetylene group is replaced by a bond to a heterocyclyl group,
such as if the carbon of the acetylene were bonded to carbon 2 of
pyridine or carbons 3 or 4 of the pyridine, then the compound is an
unsubstituted heterocyclylalkynyl group.
[0117] The phrase "substituted heterocyclylalkynyl" has the same
meaning with respect to unsubstituted heterocyclylalkynyl groups
that substituted aralkynyl groups have with respect to
unsubstituted aralkynyl groups. A substituted heterocyclylalkynyl
group also includes groups in which a non-hydrogen atom is bonded
to a heteroatom in the heterocyclyl group of the
heterocyclylalkynyl group such as, but not limited to, a nitrogen
atom in the piperidine ring of a piperidinylalkynyl group.
[0118] The phrase "unsubstituted alkoxy" refers to a hydroxyl group
(--OH) in which the bond to the hydrogen atom is replaced by a bond
to a carbon atom of an otherwise unsubstituted alkyl group as
defined above.
[0119] The phrase "substituted alkoxy" refers to a hydroxyl group
(--OH) in which the bond to the hydrogen atom is replaced by a bond
to a carbon atom of an otherwise substituted alkyl group as defined
above.
[0120] A "pharmaceutically acceptable salt" includes a salt with an
inorganic base, organic base, inorganic acid, organic acid, or
basic or acidic amino acid. Salts of inorganic bases include, for
example, alkali metals such as sodium or potassium; alkaline earth
metals such as calcium and magnesium or aluminum; and ammonia.
Salts of organic bases include, for example, trimethylamine,
triethylamine, pyridine, picoline, ethanolamine, diethanolamine,
and triethanolamine. Salts of inorganic acids include for example,
hydrochloric acid, hydroboric acid, nitric acid, sulfuric acid, and
phosphoric acid. Salts of organic acids include for example, formic
acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid,
tartaric acid, maleic acid, citric acid, succinic acid, malic acid,
methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic
acid. Salts of basic amino acids include, for example, arginine,
lysine and ornithine. Acidic amino acids include, for example,
aspartic acid and glutamic acid.
[0121] "Tautomers" refers to isomeric forms of a compound that are
in equilibrium with each other. The concentrations of the isomeric
forms will depend on the environment the compound is found in and
may be different depending upon, for example, whether the compound
is a solid or is in an organic or aqueous solution. For example, in
aqueous solution, ketones are typically in equilibrium with their
enol forms. Thus, ketones and their enols are referred to as
tautomers of each other. As readily understood by one skilled in
the art, a wide variety of functional groups and other structures
may exhibit tautomerism, and all tautomers of compounds of Formulas
I, II, and III are within the scope of the present invention.
[0122] The compounds according to the invention may be solvated,
especially hydrated. Hydration may occur during manufacturing of
the compounds or compositions comprising the compounds, or the
hydration may occur over time due to the hygroscopic nature of the
compounds.
[0123] Certain embodiments are derivatives referred to as prodrugs.
The expression "prodrug" denotes a derivative of a pharmaceutically
or therapeutically active drug, e.g., esters and amides, wherein
the derivative has an enhanced characteristic such as, for example,
enhanced delivery and therapeutic value as compared to the drug and
can be transformed into the drug by an enzymatic or chemical
process. See, for example, R. E. Notari, Methods Enzymol.
112:309-323 (1985); N. Bodor, Drugs of the Future 6:165-182 (1981);
H. Bundgaard, Chapter 1 in Design of Prodrugs (H. Bundgaard, ed.),
Elsevier, New York (1985); and A. G. Gilman et al., Goodman And
Gilman's The Pharmacological Basis of Therapeutics, 8.sup.th ed.,
McGraw-Hill (1990). Thus, the prodrug may be designed to alter the
metabolic stability or transport characteristics of a drug, mask
side effects or toxicity of a drug, improve the flavor of a drug,
or to alter other characteristics or properties of a drug.
[0124] Compounds of the present invention include enriched or
resolved optical isomers at any or all asymmetric atoms as are
apparent from the depictions. Both racemic and diastereomeric
mixtures, as well as the individual optical isomers can be isolated
or synthesized so as to be substantially free of their enantiomeric
or diastereomeric partners. All such stereoisomers are within the
scope of the invention.
[0125] The term "carboxy protecting group" as used herein refers to
a carboxylic acid protecting ester group employed to block or
protect the carboxylic acid functionality while the reactions
involving other functional sites of the compound are carried out.
Carboxy protecting groups are disclosed in, for example, Greene,
Protective Groups in Organic Synthesis, pp. 152-186, John Wiley
& Sons, New York (1981), which is hereby incorporated herein by
reference. In addition, a carboxy protecting group can be used as a
prodrug, whereby the carboxy protecting group can be readily
cleaved in vivo by, for example, enzymatic hydrolysis to release
the biologically active parent. T. Higuchi and V. Stella provide a
discussion of the prodrug concept in "Pro-drugs as Novel Delivery
Systems", Vol. 14 of the A.C.S. Symposium Series, American Chemical
Society (1975), which is hereby incorporated herein by reference.
Such carboxy protecting groups are well known to those skilled in
the art, having been extensively used in the protection of carboxyl
groups in the penicillin and cephalosporin fields, as described in
U.S. Pat. Nos. 3,840,556 and 3,719,667, S. Kukolja, J. Am. Chem.
Soc. 93:6267-6269 (1971), and G. E. Gutowski, Tetrahedron Lett.
21:1779-1782 (1970), the disclosures of which are hereby
incorporated herein by reference. Examples of esters useful as
prodrugs for compounds containing carboxyl groups can be found, for
example, at pp. 14-21 in Bioreversible Carriers in Drug Design:
Theory and Application (E. B. Roche, ed.), Pergamon Press, New York
(1987), which is hereby incorporated herein by reference.
Representative carboxy protecting groups are C.sub.1 to C.sub.8
alkyl (e.g., methyl, ethyl or tertiary butyl and the like);
haloalkyl; alkenyl; cycloalkyl and substituted derivatives thereof
such as cyclohexyl, cyclopentyl and the like; cycloalkylalkyl and
substituted derivatives thereof such as cyclohexylmethyl,
cyclopentylmethyl and the like; arylalkyl, for example, phenethyl
or benzyl and substituted derivatives thereof such as alkoxybenzyl
or nitrobenzyl groups and the like; arylalkenyl, for example,
phenylethenyl and the like; aryl and substituted derivatives
thereof, for example, 5-indanyl and the like; dialkylaminoalkyl
(e.g., dimethylaminoethyl and the like); alkanoyloxyalkyl groups
such as acetoxymethyl, butyryloxymethyl, valeryloxymethyl,
isobutyryloxymethyl, isovaleryloxymethyl, 1-(propionyloxy)-1-ethyl,
1-(pivaloyloxyl)-1-ethyl, 1-methyl-1-(propionyloxy)-1-ethyl,
pivaloyloxymethyl, propionyloxymethyl and the like;
cycloalkanoyloxyalkyl groups such as cyclopropylcarbonyloxymethyl,
cyclobutylcarbonyloxymethyl, cyclopentylcarbonyloxymethyl,
cyclohexylcarbonyloxymethyl and the like; aroyloxyalkyl, such as
benzoyloxymethyl, benzoyloxyethyl and the like;
arylalkylcarbonyloxyalkyl, such as benzylcarbonyloxymethyl,
2-benzylcarbonyloxyethyl and the like; alkoxycarbonylalkyl, such as
methoxycarbonylmethyl, cyclohexyloxycarbonylmethyl,
1-methoxycarbonyl-1-ethyl, and the like; alkoxycarbonyloxyalkyl,
such as methoxycarbonyloxymethyl, t-butyloxycarbonyloxymethyl,
1-ethoxycarbonyloxy-1-ethyl, 1-cyclohexyloxycarbonyloxy-1-ethyl and
the like; alkoxycarbonylaminoalkyl, such as
t-butyloxycarbonylaminomethyl and the like;
alkylaminocarbonylaminoalkyl, such as
methylaminocarbonylaminomethyl and the like; alkanoylaminoalkyl,
such as acetylaminomethyl and the like;
heterocycliccarbonyloxyalkyl, such as
4-methylpiperazinylcarbonyloxymethyl and the like;
dialkylaminocarbonylalkyl, such as dimethylaminocarbonylmethyl,
diethylaminocarbonylmethyl and the like;
(5-(alkyl)-2-oxo-1,3-dioxolen-4-yl)alkyl, such as
(5-t-butyl-2-oxo-1,3-dioxolen-4-yl)methyl and the like; and
(5-phenyl-2-oxo-1,3-dioxolen-4-yl)alkyl, such as
(5-phenyl-2-oxo-1,3-dioxolen-4-yl)methyl and the like.
[0126] The term "N-protecting group" or "N-protected" as used
herein refers to those groups intended to protect the N-terminus of
an amino acid or peptide or to protect an amino group against
undesirable reactions during synthetic procedures. Commonly used
N-protecting groups are disclosed in, for example, Greene,
Protective Groups in Organic Synthesis, John Wiley & Sons, New
York (1981), which is hereby incorporated by reference. For
example, N-protecting groups can comprise acyl groups such as
formyl, acetyl, propionyl, pivaloyl, t-butylacetyl, 2-chloroacetyl,
2-bromoacetyl, trifluoroacetyl, trichloroacetyl, phthalyl,
o-nitrophenoxyacetyl, a-chlorobutyryl, benzoyl, 4-chlorobenzoyl,
4-bromobenzoyl, 4-nitrobenzoyl, and the like; sulfonyl groups such
as benzenesulfonyl, p-toluenesulfonyl and the like; carbamate
forming groups such as benzyloxycarbonyl,
p-chlorobenzyloxycarbonyl, p-methoxybenzyloxycarbonyl,
p-nitrobenzyloxycarbonyl, 2-nitrobenzyloxycarbonyl,
p-bromobenzyloxycarbonyl, 3,4-dimethoxybenzyloxycarbonyl,
3,5-dimethoxybenzyloxycarbonyl, 2,4-dimethoxybenzyloxycarbonyl,
4-methoxybenzyloxycarbonyl, 2-nitro-4,5-dimethoxybenzyloxycarbonyl,
3,4,5-trimethoxybenzyloxycarbonyl,
1-(p-biphenylyl)-1-methylethoxycarbonyl, .alpha.,.alpha.-di
methyl-3,5-dimethoxybenzyloxycarbonyl, benzhydryloxycarbonyl,
t-butyloxycarbonyl, diisopropylmethoxycarbonyl,
isopropyloxycarbonyl, ethoxycarbonyl, methoxycarbonyl,
allyloxycarbonyl, 2,2,2,-trichloroethoxycarbonyl, phenoxycarbonyl,
4-nitrophenoxycarbonyl, fluorenyl-9-methoxycarbonyl,
cyclopentyloxycarbonyl, adamantyloxycarbonyl,
cyclohexyloxycarbonyl, phenylthiocarbonyl and the like; alkyl
groups such as benzyl, triphenylmethyl, benzyloxymethyl and the
like; and silyl groups such as trimethylsilyl and the like. In some
embodiments N-protecting groups are formyl, acetyl, benzoyl,
pivaloyl, t-butylacetyl, phenylsulfonyl, benzyl,
9-fluorenylmethyloxycarbonyl (Fmoc), t-butyloxycarbonyl (Boc), and
benzyloxycarbonyl (Cbz).
[0127] As used herein, "halo," "halogen" or "halide" refers to F,
Cl, Br or I.
[0128] As used herein, the abbreviations for any protective groups,
amino acids or other compounds, are, unless indicated otherwise, in
accord with their common usage, recognized abbreviations, or the
IUPAC-IUB Commission on Biochemical Nomenclature, Biochem.
11:942-944 (1972).
[0129] As used herein, "substantially pure" means sufficiently
homogeneous to appear free of readily detectable impurities as
determined by standard methods of analysis, such as thin layer
chromatography (TLC), gel electrophoresis, and high performance
liquid chromatography (HPLC), used by those of skill in the art to
assess such purity, or sufficiently pure such that further
purification would not detectably alter the physical and chemical
properties, such as enzymatic and biological activities, of the
substance. Substantially pure includes compositions in which the AA
targeting agent or AA targeting compound forms the major component
of the composition, such as constituting about 50%, about 60%,
about 70%, about 80%, about 90%, or about 95% or more of the
substances in the composition. Methods for purification of
compounds to produce substantially chemically pure compounds are
known to those of skill in the art. A substantially chemically pure
compound may, however, be a mixture of stereoisomers. In such
instances, further purification may increase the specific activity
of the compound. However, AA targeting agents need not always be
provided in a specific purified state. Partially purified
compositions will have utility in certain embodiments and depending
on the desired use. For example, purification methods that may
yield a greater total recovery of AA-targeting agent may produce a
lower degree of relative purification.
[0130] As used herein, "biological activity" refers to the in vivo
activities of a compound, composition, or other mixture, or
physiological responses that result upon in vivo administration of
a compound, composition or other mixture. Biological activity thus
encompasses therapeutic effects, diagnostic effects and
pharmaceutical activity of such compounds, compositions, and
mixtures. The term "biologically active" or "functional" when used
as a modifier of invention AA targeting agent containing
polypeptides or compositions thereof refers to a polypeptide that
exhibits at least one activity that is characteristic of or similar
to an AA targeting agent.
[0131] As used herein, "pharmacokinetics" refers to the
concentration of an administered compound in the serum over time.
Pharmacodynamics refers to the concentration of an administered
compound in target and nontarget tissues over time and the effects
on the target tissue (e.g., efficacy) and the non-target tissue
(e.g., toxicity). Improvements in, for example, pharmacokinetics or
pharmacodynamics can be designed for a particular targeting agent
or biological agent, such as by using labile linkages or by
modifying the chemical nature of any linker (e.g., changing
solubility, charge, and the like).
[0132] As employed herein, the phrases "an effective amount" and
"therapeutically effective amount" refer to an amount of an AA
targeting agent or compound comprising an AA targeting agent that
is useful or able to support an observable change in the level of
one or more biological activity characteristic of an AA targeting
agent, or a dose sufficient to impart a beneficial effect, e.g., an
amelioration of a symptom on the recipient thereof. The specific
therapeutically effective dose level for any particular subject
will depend upon a variety of factors including the symptom or
disorder being treated, the severity of the symptom or disorder,
the activity of the specific compound, the route of administration,
the rate of clearance of the compound, the duration of treatment,
the drugs used in combination or coincident with the compound, the
age, body weight, sex, diet, and general health of the subject, and
like, as well as other factors well known in the medical arts and
sciences. A therapeutically effective amount can be an amount of AA
targeting compound sufficient to produce a measurable inhibition of
angiogenesis in the tissue being treated, i.e., an
angiogenesis-inhibiting amount. Inhibition of angiogenesis can be
measured in situ by immunohistochemistry, or by other methods known
to one skilled in the art. Various general considerations taken
into account in determining the "therapeutically effective amount"
are known to those of skill in the art and are described, e.g., in
Gilman, A. G., et al., Goodman And Gilman's The Pharmacological
Basis of Therapeutics, 8.sup.th ed., McGraw-Hill (1990); and
Remington's Pharmaceutical Sciences, 17.sup.th ed., Mack Publishing
Co., Easton, Pa. (1990).
[0133] In one aspect, the present invention provides various
targeting compounds in which AA targeting agents are covalently
linked to a combining site of an antibody.
[0134] In another aspect, the present invention includes methods of
altering at least one physical or biological characteristic of an
AA targeting agent. The methods include covalently linking an AA
targeting agent to a combining site of an antibody, either directly
or though a linker. Characteristics of an AA targeting agent that
may be modified include, but are not limited to, binding affinity,
susceptibility to degradation (e.g., by proteases),
pharmacokinetics, pharmacodynamics, immunogenicity, solubility,
lipophilicity, hydrophilicity, hydrophobicity, stability (either
more or less stable, as well as planned degradation), rigidity,
flexibility, modulation of antibody binding, and the like. Also,
the biological potency of a particular AA targeting agent may be
increased by the addition of the effector function(s) provided by
the antibody. For example, an antibody provides effector functions
such as complement mediated effector functions. Without wishing to
be bound by any theory, the antibody portion of an AA targeting
compound may generally extend the half-life of a smaller sized AA
targeting agent in vivo. Thus, in one aspect, the invention
provides a method for increasing the effective circulating
half-life of an AA targeting agent.
[0135] In another aspect, the present invention provides methods
for modulating the binding activity of an antibody by covalently
attaching an AA targeting agent to a combining site of the
antibody. Although not wishing to be bound by any theory,
substantially reduced antibody binding to an antigen may result
from the linked AA targeting agent(s) sterically hindering the
antigen from contacting the antibody combining site. Alternatively,
substantially reduced antigen binding may result if the amino acid
side chain of the antibody combining site modified by covalent
linkage is important for binding to the antigen. By contrast,
substantially increased antibody binding to an antigen may result
when a linked AA targeting agent(s) does not sterically hinder the
antigen from contacting the antibody combining site and/or when the
amino acid side chain of the antibody combining site modified by
covalent linkage is not important for binding to the antigen.
[0136] In another aspect, the present invention includes methods of
modifying a combining site of an antibody to generate binding
specificity for the thrombospondin binding cognate. Such methods
include covalently linking a reactive amino acid side chain in a
combining site of the antibody to a chemical moiety on a linker of
an AA targeting agent-linker compound as described herein where an
AA targeting agent is based upon a thrombospondin peptide. The
chemical moiety of the linker is sufficiently distanced from the AA
targeting agent so that an AA targeting agent can bind its cognate
when an AA targeting agent-linker compound is covalently linked to
an antibody combining site. Typically, the antibody will not be
considered specific for the target molecule. In certain
embodiments, an antibody prior to covalent linking would have an
affinity for the thrombospondin binding cognate of less than about
1.times.10.sup.-5 moles/liter. However, after the antibody is
covalently linked to the AA targeting agent-linker compound, the
modified antibody preferably has an affinity for the target
molecule of at least about 1.times.10.sup.-6 moles/liter,
alternatively, at least about 1.times.10.sup.-7 moles/liter,
alternatively, at least 1.times.10.sup.-8 moles/liter,
alternatively at least 1.times.10.sup.-9 moles/liter, or
alternatively, at least about 1.times.10.sup.-10 moles/liter.
AA Targeting Agents
[0137] An AA targeting agent is a peptide selected from the group
consisting of:
TABLE-US-00004 (SEQ ID NO:1)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:2)
R.sup.2-Pro-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:3)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro-R.sup.3; (SEQ
ID NO:4)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:5)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Gln-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:6)
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-(.alpha.-Ally-Gly)-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:7)
R.sup.1-Sar-Phe-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:8)
R.sup.2-Lys-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:9)
R.sup.2-Glu-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:10)
R.sup.2-Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ
ID NO:11) R.sup.2-Pro-(4-Cyano-Phe)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:12)
R.sup.2-Pro-(3,4-Dimethoxy-Phe)-Val-(D-alloIle)-Thr-
Nva-Ile-Arg-ProR.sup.3; (SEQ ID NO:13)
R.sup.2-Pro-(3-(4-thiazolyl)-L-Ala)-Val-(D-alloIle)-
Thr-Nva-Ile-Arg-Pro-R.sup.3; (SEQ ID NO:14)
R.sup.2-Pro-(2-furyl-Ala)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:15)
R.sup.2-Pro-(Cyclo-Leu)-Val-(D-alloIle)-Thr-Nva-Ile-
Arg-Pro-R.sup.3; (SEQ ID NO:16)
R.sup.2-Gly-Val-(D-Ile)-Thr-Arg-Ile-Arg-R.sup.3; and (SEQ ID NO:17)
R.sup.1-Sar-Gly-Val-(D-Ile)-Thr-Nva-Ile-Arg-Pro-R.sup.3;
[0138] R.sup.1 is NH(CH.sub.3), N(CH.sub.3)C(O)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.3,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)CH(CH.sub.3)CH.sub.2CH.sub.3,
N(CH.sub.3)C(O)C.sub.6H.sub.5,
N(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a
carbohydrate;
[0139] R.sup.2 is NH.sub.2, NHC(O)CH.sub.3, NHC(O)CH.sub.2CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.3, NHC(O)CH(CH.sub.3)CH.sub.3,
NHC(O)CH.sub.2CH.sub.2CH.sub.2CH.sub.3,
NHC(O)CH(CH.sub.3)CH.sub.2CH.sub.3, NHC(O)C.sub.6H.sub.5,
NH(CH.sub.3)C(O)CH.sub.2CH.sub.2(CH.sub.2CH.sub.2O).sub.1-5Me, an
amino protecting group, a lipid fatty acid group or a carbohydrate;
and [0140] R.sup.3 is COOH, C(O)NH.sub.2, C(O)NH(CH.sub.3),
C(O)NHCH.sub.2CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.3, C(O)NHCH.sub.2CH.sub.2CH.sub.2CH.sub.3,
C(O)NHCH(CH.sub.3)CH.sub.2CH.sub.3, C(O)NHC.sub.6H.sub.5,
C(O)NHCH.sub.2CH.sub.2OCH.sub.3,C(O)NHOCH.sub.3,
C(O)NHOCH.sub.2CH.sub.3, a carboxy protecting group, a lipid fatty
acid group or a carbohydrate.
[0141] An AA targeting compound can be prepared using techniques
well known in the art. Typically, synthesis of the peptidyl AA
targeting agent is the first step and is carried out as described
herein. The targeting agent is then derivatized for linkage to a
connecting component (the linker), which is then combined with the
antibody. One of skill in the art will readily appreciate that the
specific synthetic steps used depend upon the exact nature of the
three components. Thus, AA targeting agent-linker conjugates and AA
targeting compounds described herein can be readily
synthesized.
[0142] AA targeting agent peptides may be synthesized by many
techniques that are known to those skilled in the art. For solid
phase peptide synthesis, a summary of exemplary techniques may be
found in Chemical Approaches to the Synthesis of Peptides and
Proteins (Williams et al., eds.), CRC Press, Boca Raton, Fla.
(1997).
[0143] Typically, the desired peptidic AA targeting agent is
synthesized sequentially on solid phase according to procedures
well known in the art. See, e.g., U.S. Patent Application No.
2003/0045477). The linker may be attached to the peptide in part or
in full on the solid phase, or may be added using solution phase
techniques after the removal of the peptide from the resin (see
FIGS. 6A and 6B). For example, an N-protected amino and carboxylic
acid-containing linking moiety may be attached to a resin such as
4-hydroxymethyl-phenoxymethyl-poly(styrene-1% divinylbenzene). The
N-protecting group may be removed by the appropriate acid (e.g.,
TFA for Boc) or base (e.g., piperidine for Fmoc), and the peptide
sequence developed in the normal C-terminus to N-terminus fashion
(see FIG. 6A). Alternatively, the peptide sequence may be
synthesized first and the linker added to the N-terminal amino acid
residue last (see FIG. 6B). Yet another method entails deprotecting
an appropriate side chain during synthesis and derivatizing with a
suitably reactive linker. For example, a lysine side chain may be
deprotected and reacted with a linker having an active ester.
Alternatively, an amino acid derivative with a suitably protected
linker moiety already attached to the side chain (see FIG. 6B) or,
in some cases, the alpha-amino nitrogen, may be added as part of
the growing peptide sequence.
[0144] At the end of the solid phase synthesis, the targeting
agent-linker conjugate is removed from the resin and deprotected,
either in succession or in a single operation. Removal of the
targeting agent-linker conjugate and deprotection can be
accomplished in a single operation by treating the resin-bound
peptide-linker conjugate with a cleavage reagent, for example,
trifluoroacetic acid containing scavengers such as thianisole,
water, or ethanedithiol. After deprotection and release of the
targeting agent, further derivatization of the targeting agent
peptide may be carried out.
[0145] The fully deprotected targeting agent-linker conjugate is
purified by a sequence of chromatographic steps employing any or
all of the following types: ion exchange on a weakly basic resin in
the acetate form; hydrophobic adsorption chromatography on
underivatized polystyrene-divinylbenzene (e.g., AMBERLITE XAD);
silica gel adsorption chromatography; ion exchange chromatography
on carboxymethylcellulose; partition chromatography, e.g., on
SEPHADEX G-25, LH-20 or countercurrent distribution; high
performance liquid chromatography (HPLC), especially reverse-phase
HPLC on octyl- or octadecylsilyl-silica bonded phase column
packing.
Antibodies
[0146] "Antibody" as used herein includes polypeptide molecules
comprising heavy and/or light chains which have immunoreactive
activity. Antibodies include immunoglobulins which are the product
of B cells and variants thereof, as well as the T cell receptor
(TcR) which is the product of T cells and variants thereof. An
immunoglobulin is a protein comprising one or more polypeptides
substantially encoded by the immunoglobulin kappa and lambda,
alpha, gamma, delta, epsilon and mu constant region genes, as well
as myriad immunoglobulin variable region genes. Light chains are
classified as either kappa or lambda. Heavy chains are classified
as gamma, mu, alpha, delta, or epsilon, which in turn define the
immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively.
Subclasses of heavy chains are also known. For example, IgG heavy
chains in humans can be any of IgG1, IgG2, IgG3, and IgG4
subclasses.
[0147] A typical immunoglobulin structural unit is known to
comprise a tetramer. Each tetramer is composed of two identical
pairs of polypeptide chains, each pair having one "light" (about 25
kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each
chain defines a variable region of about 100 to 110 or more amino
acids primarily responsible for antigen recognition. The terms
variable light chain (V.sub.L) and variable heavy chain (V.sub.H)
refer to these light and heavy chains respectively. The amino acids
of an antibody may be naturally or nonnaturally occurring.
[0148] Antibodies that contain two combining sites are bivalent in
that they have two complementarity or antigen recognition sites. A
typical natural bivalent antibody is an IgG. Although vertebrate
antibodies generally comprise two heavy chains and two light
chains, heavy chain only antibodies are also known. See Muyldermans
et al., TRENDS in Biochem. Sci. 26(4):230-235 (1991). Such
antibodies are bivalent and are formed by the pairing of heavy
chains. Antibodies may also be multi-valent, as in the case of
dimeric forms of IgA and the pentameric IgM molecule. Antibodies
also include hybrid antibodies wherein the antibody chains are
separately homologous with referenced mammalian antibody chains.
One pair of heavy and light chain has a combining site specific to
one antigen and the other pair of heavy and light chains has a
combining site specific to a different antigen. Such antibodies are
referred to as bi-specific because they are able to bind two
different antigens at the same time. Antibodies may also be
univalent, such as, for example, in the case of Fab or Fab'
fragments.
[0149] Antibodies exist as full length intact antibodies or as a
number of well-characterized fragments produced by digestion with
various peptidases or chemicals. Thus, for example, pepsin digests
an antibody below the disulfide linkages in the hinge region to
produce F(ab').sub.2, a dimer of Fab which itself is a light chain
joined to V.sub.H--CH.sub.1 by a disulfide bond. F(ab').sub.2 may
be reduced under mild conditions to break the disulfide linkage in
the hinge region, thereby converting the F(ab').sub.2 dimer into a
Fab' monomer. The Fab' monomer is essentially a Fab fragment with
part of the hinge region (see, e.g., Fundamental Immunology (W. E.
Paul, ed.), Raven Press, N.Y. (1993) for a more detailed
description of other antibody fragments). As another example,
partial digestion with papain can yield a monovalent Fab/c
fragment. See M. J. Glennie et al., Nature 295:712-714 (1982).
While various antibody fragments are defined in terms of the
digestion of an intact antibody, one of skill in the art will
appreciate that any of a variety of antibody fragments may be
synthesized de novo either chemically or by utilizing recombinant
DNA methodology. Thus, the term antibody as used herein also
includes antibody fragments produced by the modification of whole
antibodies, synthesized de novo, or obtained from recombinant DNA
methodologies. One skilled in the art will recognize that there are
circumstances in which it is advantageous to use antibody fragments
rather than whole antibodies. For example, the smaller size of the
antibody fragments allows for rapid clearance and may lead to
improved access to solid tumors.
[0150] Recombinant antibodies may be conventional full length
antibodies, hybrid antibodies, heavy chain antibodies, antibody
fragments known from proteolytic digestion, antibody fragments such
as Fv or single chain Fv (scFv), single domain fragments such as
V.sub.H or V.sub.L, diabodies, domain deleted antibodies,
minibodies, and the like. An Fv antibody is about 50 kD in size and
comprises the variable regions of the light and heavy chain. The
light and heavy chains may be expressed in bacteria where they
assemble into an Fv fragment. Alternatively, the two chains can be
engineered to form an interchain disulfide bond to give a dsFv. A
single chain Fv ("scFv") is a single polypeptide comprising V.sub.H
and V.sub.L sequence domains linked by an intervening linker
sequence, such that when the polypeptide folds the resulting
tertiary structure mimics the structure of the antigen binding
site. See J. S. Huston et al., Proc. Nat. Acad. Sci. U.S.A.
85:5879-5883 (1988). One skilled in the art will recognize that
depending on the particular expression method and/or antibody
molecule desired, appropriate processing of the recombinant
antibodies may be performed to obtain a desired reconstituted or
reassembled antibody. See, e.g., Vallejo and Rinas, Biomed
Central., available at world wide web URL
microbialcellfactories.com/content/3/1/11.
[0151] Single domain antibodies are the smallest functional binding
units of antibodies (approximately 13 kD in size), corresponding to
the variable regions of either the heavy V.sub.H or light V.sub.L
chains. See U.S. Pat. No. 6,696,245, WO04/058821, WO04/003019 and
WO03/002609. Single domain antibodies are well expressed in
bacteria, yeast, and other lower eukaryotic expression systems.
Domain deleted antibodies have a domain, such as CH.sub.2, deleted
relative to the full length antibody. In many cases such domain
deleted antibodies, particularly CH.sub.2 deleted antibodies, offer
improved clearance relative to their full length counterparts.
Diabodies are formed by the association of a first fusion protein
comprising two V.sub.H domains with a second fusion protein
comprising two V.sub.L domains. Diabodies, like full length
antibodies, are bivalent and may be bi-specific. Minibodies are
fusion proteins comprising a V.sub.H, V.sub.L, or scFv linked to
CH.sub.3, either directly or via an intervening IgG hinge. See T.
Olafsen et al., Protein Eng. Des. Sel. 17:315-323 (2004).
Minibodies, like domain deleted antibodies, are engineered to
preserve the binding specificity of full-length antibodies but with
improved clearance due to their smaller molecular weight.
[0152] The T cell receptor (TcR) is a disulfide linked heterodimer
composed of two chains. The two chains are generally
disulfide-bonded just outside the T cell plasma membrane in a short
extended stretch of amino acids resembling the antibody hinge
region. Each TcR chain is composed of one antibody-like variable
domain and one constant domain. The full TcR has a molecular mass
of about 95 kD, with the individual chains varying in size from 35
to 47 kD. Also encompassed within the meaning of TcR are portions
of the receptor, such as, for example, the variable region, which
can be produced as a soluble protein using methods well known in
the art. For example, U.S. Pat. No. 6,080,840 and A. E. Slanetz and
A. L. Bothwell, Eur. J. Immunol. 21:179-183 (1991) describe a
soluble T cell receptor prepared by splicing the extracellular
domains of a TcR to the glycosyl phosphatidylinositol (GPI)
membrane anchor sequences of Thy-1. The molecule is expressed in
the absence of CD3 on the cell surface, and can be cleaved from the
membrane by treatment with phosphatidylinositol specific
phospholipase C(PI-PLC). The soluble TcR also may be prepared by
coupling the TcR variable domains to an antibody heavy chain
CH.sub.2 or CH.sub.3 domain, essentially as described in U.S. Pat.
No. 5,216,132 and G. S. Basi et al., S. Immunol. Methods
155:175-191 (1992), or as soluble TcR single chains, as described
by E. V. Shusta et al., Nat. Biotechnol. 18:754-759 (2000) or P. D.
Holler et al., Proc. Natl. Acad. Sci. U.S.A. 97:5387-5392 (2000).
Certain embodiments of the invention use TcR "antibodies" as a
soluble antibody. The combining site of the TcR can be identified
by reference to CDR regions and other framework residues using the
same methods discussed above for antibodies.
[0153] The combining site refers to the part of an antibody
molecule that participates in antigen binding. The antigen binding
site is formed by amino acid residues of the N-terminal variable
("V") regions of the heavy ("H") and light ("L") chains. The
antibody variable regions comprise three highly divergent stretches
referred to as "hypervariable regions" or "complementarity
determining regions" (CDRs), which are interposed between more
conserved flanking stretches known as "framework regions" (FRs).
The three hypervariable regions of a light chain (LCDR1, LCDR2, and
LCDR3) and the three hypervariable regions of a heavy chain (HCDR1,
HCDR2, and HCDR3) are disposed relative to each other in three
dimensional space to form an antigen binding surface or pocket. In
heavy-chain antibodies or V.sub.H domains, the antigen binding site
is formed by the three hypervariable regions of the heavy chains.
In V.sub.L domains, the antigen binding site is formed by the three
hypervariable regions of the light chain.
[0154] The identity of the amino acid residues in a particular
antibody that make up a combining site can be determined using
methods well known in the art. For example, antibody CDRs may be
identified as the hypervariable regions originally defined by Kabat
et al. See E. A. Kabat et al., Sequences of Proteins of
Immunological Interest, 5.sup.th ed., Public Health Service, NIH,
Washington D.C. (1992). The positions of the CDRs may also be
identified as the structural loop structures originally described
by Chothia and others. See, e.g., C. Chothia and A. M. Lesk, J.
Mol. Biol. 196:901-917 (1987); C. Chothia et al., Nature
342:877-883 (1989); and A. Tramontano et al., J. Mol. Biol.
215:175-182 (1990). Other methods include the "AbM definition,"
which is a compromise between Kabat and Chothia and is derived
using Oxford Molecular's AbM antibody modeling software (now
Accelrys), or the "contact definition" of CDRs set forth in R. M.
MacCallum et al., J. Mol. Biol. 262:732-745 (1996). Table 2
identifies CDRs based upon various known definitions:
TABLE-US-00005 TABLE 2 CDR definitions CDR Kabat AbM Chothia
Contact L1 L24-L34 L24-L34 L24-L34 L30-L36 L2 L50-L56 L50-L56
L50-L56 L46-L55 L3 L89-L97 L89-L97 L89-L97 L89-L96 H1 (Kabat
H31-H35B H26-H35B H26-H32..H34 H30-H35B numbering) H1 (Chothia
H31-H35 H26-H35 H26-H32 H30-H35 numbering) H2 H50-H56 H50-H58
H52-H56 H47-H58 H3 H95-H102 H95-H102 H95-H102 H93-H101
General guidelines by which one may identify the CDRs in an
antibody from sequence alone are as follows:
[0155] LCDR1:
Start-Approximately residue 24. Residue before is always a Cys.
Residue after is always a Trp, typically followed by Tyr-Gln, but
also followed by Leu-Gln, Phe-Ghn, or Tyr-Leu. Length is 10 to 17
residues.
[0156] LCDR2:
Start-16 residues after the end of L1. Sequence before is generally
Ile-Tyr, but also may be Val-Tyr, Ile-Lys, or Ile-Phe. Length is
generally 7 residues.
[0157] LCDR3:
Start-33 residues after end of L2. Residue before is a Cys.
Sequence after is Phe-Gly-X-Gly. Length is 7 to 11 residues.
[0158] HCDR1:
Start-approximately residue 26, four residues after a Cys under
Chothia/AbM definitions; start is 5 residues later under Kabat
definition. Sequence before is Cys-X--X--X. Residue after is a Trp,
typically followed by Val, but also followed by Ile or Ala. Length
is 10 to 12 residues under AbM definition; Chothia definition
excludes the last 4 residues.
[0159] HCDR2:
Start-15 residues after the end of Kabat/AbM definition of CDR-H1.
Sequence before is typically Leu-Glu-Trp-Ile-Gly, but a number of
variations are possible. Sequence after is
Lys/Arg-Leu/Ile/Val/Phe/Thr/Ala-Thr/Ser/Ile/Ala. Length is 16 to 19
residues under Kabat definition; AbM definition excludes the last 7
residues.
[0160] HCDR3:
Start-33 residues after end of CDR-H2 (two residues after a Cys).
Sequence before is Cys-X--X (typically Cys-Ala-Arg). Sequence after
is Trp-Gly-X-Gly. Length is 3 to 25 residues.
[0161] The identity of the amino acid residues in a particular
antibody that are outside the CDRs, but nonetheless make up part of
the combining site by having a side chain that is part of the
lining of the combining site (i.e., that is available to linkage
through the combining site), can be determined using methods well
known in the art, such as molecular modeling and X-ray
crystallography. See, e.g., L. Riechmann et al., Nature 332:323-327
(1988).
[0162] As discussed, antibodies that can be used in preparing
antibody-based AA targeting compounds require a reactive side chain
in the antibody combining site. A reactive side chain may be
present naturally or may be placed in an antibody by mutation. The
reactive residue of the antibody combining site may be associated
with the antibody, such as when the residue is encoded by nucleic
acid present in the lymphoid cell first identified to make the
antibody. Alternatively, the amino acid residue may arise by
purposely mutating the DNA so as to encode the particular residue
(see, e.g., WO 01/22922 to Meares et al.). The reactive residue may
be a non-natural residue arising, for example, by biosynthetic
incorporation using a unique codon, tRNA, and aminoacyl-tRNA as
discussed herein. In another approach, the amino acid residue or
its reactive functional groups (e.g., a nucleophilic amino group or
sulfhydryl group) may be attached to an amino acid residue in the
antibody combining site. Thus, covalent linkage with the antibody
occurring "through an amino acid residue in a combining site of an
antibody" as used herein means that linkage can be directly to an
amino acid residue of an antibody combining site or through a
chemical moiety that is linked to a side chain of an amino acid
residue of an antibody combining site.
[0163] Catalytic antibodies are one source of antibodies with
combining sites that comprise one or more reactive amino acid side
chains. Such antibodies include aldolase antibodies, beta lactamase
antibodies, esterase antibodies, amidase antibodies, and the
like.
[0164] One embodiment comprises an aldolase antibody such as the
mouse monoclonal antibody mAb 38C2 or nab 33F12, as well as
suitably humanized and chimeric versions of such antibodies. Mouse
mAb 38C2 has a reactive lysine near to but outside HCDR3, and is
the prototype of a new class of catalytic antibodies that were
generated by reactive immunization and mechanistically mimic
natural aldolase enzymes. See C. F. Barbas 3.sup.rd et al., Science
278:2085-2092 (1997)). Other aldolase catalytic antibodies that may
be used include the antibodies produced by the hybridoma 85A2,
having ATCC accession number PTA-1015; hybridoma 85C7, having ATCC
accession number PTA-1014; hybridoma 92F9, having ATCC accession
number PTA-1017; hybridoma 93F3, having ATCC accession number
PTA-823; hybridoma 84G3, having ATCC accession number PTA-824;
hybridoma 84G11, having ATCC accession number PTA-1018; hybridoma
84H9, having ATCC accession number PTA-1019; hybridoma 85H6, having
ATCC accession number PTA-825; hybridoma 90G8, having ATCC
accession number PTA-1016. Through a reactive lysine, these
antibodies catalyze aldol and retro-aldol reactions using the
enamine mechanism of natural aldolases. See, e.g., J. Wagner et
al., Science 270:1797-1800 (1995); C. F. Barbas 3d et al., Science
278:2085-2092 (1997); G. Zhong et al., Angew. Chem. Int. Ed. Engl.
38:3738-3741 (1999); A. Karlstrom et al., Proc. Natl. Acad. Sci.
U.S.A., 97:3878-3883 (2000). Aldolase antibodies and methods of
generating aldolase antibodies are disclosed in U.S. Pat. Nos.
6,210,938, 6,368,839, 6,326,176, 6,589,766, 5,985,626, and
5,733,757.
[0165] AA targeting compounds may also be formed by linking an AA
targeting agent to a reactive cysteine, such as those found in the
combining sites of thioesterase and esterase catalytic antibodies.
Suitable thioesterase catalytic antibodies are described by K. D.
Janda et al., Proc. Natl. Acad. Sci. U.S.A. 91:2532-2536 (1994).
Suitable esterase antibodies are described by P. Wirsching et al.,
Science 270:1775-1782 (1995). Reactive amino acid-containing
antibodies may be prepared by means well known in the art,
including mutating an antibody combining site residue to encode for
the reactive amino acid or chemically derivatizing an amino acid
side chain in an antibody combining site with a linker that
contains the reactive group.
[0166] Antibodies suitable for use herein may be obtained by
conventional immunization, reactive immunization in vivo, or by
reactive selection in vitro, such as with phage display. Antibodies
may also be obtained by hybridoma or cell fusion methods or in
vitro host cells expression system. Antibodies may be produced in
humans or in other animal species. Antibodies from one species of
animal may be modified to reflect another species of animal. For
example, human chimeric antibodies are those in which at least one
region of the antibody is from a human immunoglobulin. A human
chimeric antibody is typically understood to have variable region
amino acid sequences homologous to a non-human animal, e.g., a
rodent, with the constant region having amino acid sequence
homologous to a human immunoglobulin In contrast, a humanized
antibody uses CDR sequences from a non-human antibody with most or
all of the variable framework region sequence and all the constant
region sequence from a human immunoglobulin. Chimeric and humanized
antibodies may be prepared by methods well known in the art
including CDR grafting approaches (see, e.g., N. Hardman et al.,
Int. J. Cancer 44:424-433 (1989); C. Queen et al., Proc. Natl.
Acad. Sci. U.S.A. 86:10029-10033 (1989)), chain shuffling
strategies (see, e.g., Rader et al., Proc. Natl. Acad. Sci. U.S.A.
95:8910-8915 (1998), genetic engineering molecular modeling
strategies (see, e.g., M. A. Roguska et al., Proc. Natl. Acad. Sci.
U.S.A. 91:969-973 (1994)), and the like.
[0167] Methods for humanizing non-human antibodies have been
described in the art. Preferably, a humanized antibody has one or
more amino acid residues introduced into it from a source which is
nonhuman. These non-human amino acid residues are often referred to
as "import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the methods of Winter and colleagues (see, e.g., P. T.
Jones et al., Nature 321:522-525 (1986); L. Riechmann et al.,
Nature 332:323-327 (1988); M. Verhoeyen et al., Science
239:1534-1536 (1988)) by substituting hypervariable region
sequences for the corresponding sequences of a human antibody.
Accordingly, such "humanized" antibodies are chimeric antibodies
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some hypervariable region residues and possibly
some framework (FR) residues are substituted by residues from
analogous sites in rodent antibodies.
[0168] The choice of human variable domains, both light and heavy,
to be used in making humanized antibodies is very important to
reduce antigenicity and human anti-mouse antibody (HAMA) response
when the antibody is intended for human therapeutic use. According
to the so-called "best-fit" method, the human variable domain
utilized for humanization is selected from a library of known
domains based on a high degree of homology with the rodent variable
region of interest (M. J. Sims et al., J. Immunol., 151:2296-2308
(1993); M. Chothia and A. M. Lesk, J. Mol. Biol. 196:901-917
(1987)). Another method uses a framework region derived from the
consensus sequence of all human antibodies of a particular subgroup
of light or heavy chains. The same framework may be used for
several different humanized antibodies (see, e.g., P. Carter et
al., Proc. Natl. Acad. Sci. U.S.A. 89:4285-4289 (1992); L. G.
Presta et al., J. Immunol., 151:2623-2632 (1993)).
[0169] It is further important that antibodies be humanized with
retention of high linking affinity for the Z group. To achieve this
goal, according to one method, humanized antibodies are prepared by
analysis of the parental sequences and various conceptual humanized
products using three-dimensional models of the parental and
humanized sequences. Three-dimensional immunoglobulin models are
commonly available and are familiar to those skilled in the art.
Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence with respect
to linking to the Z group. In this way, FR residues can be selected
and combined from the recipient and import sequences so that the
desired antibody characteristic, such as increased affinity for the
target antigen(s), is achieved.
[0170] Various forms of humanized murine aldolase antibodies are
contemplated. One embodiment uses the humanized aldolase catalytic
antibody h38c2 IgG1 or h38c2 Fab with human constant domains
C.sub..kappa. and C.sub..gamma.11. C. Rader et al., J. Mol. Bio.
332:889-899 (2003) discloses the gene sequences and vectors that
may be used to produce h38c2 Fab and h38c2 IgG1. Human germline
V.sub.k gene DPK-9 (SEQ ID NO:36) and human J.sub.k gene JK4 (SEQ
ID NO:38) were used as frameworks for the humanization of the kappa
light chain variable domain of m38c2, and human germline gene DP-47
(SEQ ID NO:37) and human J.sub.H gene JH4 (SEQ ID NO:39) were used
as frameworks for the humanization of the heavy chain variable
domain of m38c2. FIG. 7A illustrates a sequence alignment between
the variable light and heavy chains in m38c2 (SEQ ID NOs: 32 and
33, respectively), h38c2 (SEQ ID NOs: 34 and 35, respectively), and
human germlines. h38c2 may utilize IgG1, IgG2, IgG3, or IgG4
constant domains, including any of the allotypes thereof. FIG. 7B
illustrates one embodiment of h38c2 IgG1 using the Glm(f) allotype.
The light and heavy chain amino acid sequences of this h38c2 IgG1
are set forth in SEQ ID NOs:40 and 41, respectively. In certain
embodiments of AA targeting compounds of formula II or III wherein
Antibody is h38c2 IgG1 with the G1m(f) allotype, Z binds to the
side chain of the lysine residue at position 99 of SEQ ID NO:41.
This residue is denoted by bold print in FIG. 7B. Another
embodiment uses a chimeric antibody comprising the variable domains
(V.sub.L and V.sub.H) of h38c2 and the constant domains from an
IgG1, IgG2, IgG3, or IgG4.
[0171] Various forms of humanized aldolase antibody fragments are
also contemplated. One embodiment uses h38c2 F(ab').sub.2. h38c2
F(ab').sub.2 may be produced by the proteolytic digestion of h38c2
IgG1. Another embodiment uses an h38c2 scFv comprising the V.sub.L
and V.sub.H domains from h38c2 which are optionally connected by
the intervening linker (Gly.sub.4Ser).sub.3.
[0172] As an alternative to humanization, human antibodies can be
generated. For example, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization (or
reactive immunization in the case of catalytic antibodies) of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene in chimeric and germ-line
immunoglobulin gene array into such germ-line mutant mice will
result in the production of human antibodies upon antigen
challenge. See, e.g., B. D. Cohen et al, Clin. Cancer Res.
11:2063-2073 (2005); J. L. Teeling et al., Blood 104:1793-1800
(2004); N. Lonberg et al., Nature 368:856-859 (1994); A. Jakobovits
et al., Proc. Natl. Acad. Sci. U.S.A. 90:2551-2555 (1993); A.
Jakobovits et al., Nature 362:255-258 (1993); M. Bruggemann et al.,
Year Immunol. 7:33-40 (1993); L. D. Taylor, et al. Nucleic Acids
Res. 20:6287-6295 (1992); M. Bruggemann et al., Proc. Natl. Acad.
Sci. U.S.A. 86:6709-6713 (1989)); and WO 97/17852.
[0173] Alternatively, phage display technology (see, e.g., J.
McCafferty et al., Nature 348:552-553 (1990); H. J. de Haard et
al., J Biol Chem 274, 18218-18230 (1999); and A. Kanppik et al., J
Mol Biol, 296, 57-86 (2000)) can be used to produce human
antibodies and antibody fragments in vitro using immunoglobulin
variable (V) domain gene repertoires from unimmunized donors.
According to this technique, antibody V domain genes are cloned
in-frame into either a major or minor coat protein gene of a
filamentous bacteriophage, such as M13 or fd, and displayed as
functional antibody fragments on the surface of the phage particle.
Because the filamentous particle contains a single-stranded DNA
copy of the phage genome, selections based on the functional
properties of the antibody also result in selection of the gene
encoding the antibody exhibiting those properties. Thus, the phage
mimics some of the properties of the B-cell. Phage display can be
performed in a variety of formats, and is reviewed in, e.g., K. S.
Johnson and D. J. Chiswell, Curr. Opin. Struct. Biol. 3:564-571
(1993). Several sources of V-gene segments can be used for phage
display. T. Clackson et al., Nature, 352:624-628 (1991) isolated a
diverse array of anti-oxazolone antibodies from a small random
combinatorial library of V genes derived from the spleens of
immunized mice. A repertoire of V genes from unimmunized human
donors can be constructed and antibodies to a diverse array of
antigens (including self-antigens) can be isolated essentially
following the techniques described by J. D. Marks et al., J. Mol.
Biol. 222:581-597 (1991) or A. D. Griffiths et al., EMBO J.
12:725-734 (1993). See also U.S. Pat. Nos. 5,565,332 and 5,573,905;
and L. S. Jespers et al., Biotechnology 12:899-903 (1994).
[0174] As indicated above, human antibodies may also be generated
by in vitro activated B cells. See, e.g., U.S. Pat. Nos. 5,567,610
and 5,229,275; and C. A. K. Borrebaeck et al., Proc. Natl. Acad.
Sci. U.S.A. 85:3995-3999 (1988).
[0175] Amino acid sequence modification(s) of the antibodies
described herein are contemplated. For example, it may be desirable
to improve the binding affinity and/or other biological properties
of the antibody. Amino acid sequence variants of an antibody are
prepared by introducing appropriate nucleotide changes into the
antibody nucleic acid, or by peptide synthesis. Such modifications
include, for example, deletions from, insertions into, and/or
substitutions of residues within the amino acid sequences of the
antibody. Any combination of deletion, insertion, and substitution
is made to arrive at the final construct, provided that the final
construct possesses the desired characteristics. The amino acid
changes also may alter post-translational processes of the
antibody, such as changing the number or position of glycosylation
sites.
[0176] A useful method for identification of certain residues or
regions of an antibody that are preferred locations for mutagenesis
is called "alanine scanning mutagenesis," as described in B. C.
Cunningham and J. A. Wells, Science 244:1081-1085 (1989). Here, a
residue or group of target residues are identified (e.g., charged
residues such as Arg, Asp, His, Lys, and Glu) and replaced by a
neutral or negatively charged amino acid (most preferably Ala or
Polyalanine) to affect the interaction of the amino acids with the
Z group of the linker. Those amino acid locations demonstrating
functional sensitivity to the substitutions are then refined by
introducing further or other variants at, or for, the sites of
substitution. Thus, while the site for introducing an amino acid
sequence variation is predetermined, the nature of the mutation per
se need not be predetermined. For example, to analyze the
performance of a mutation at a given site, alanine scanning or
random mutagenesis is conducted at the target codon or region and
the expressed antibody variants are screened for the ability to
form a covalent bond with Z.
[0177] Amino acid sequence insertions include amino- and/or
carboxyl-terminal fusions ranging in length from one residue to
polypeptides containing a hundred or more residues, as well as
intrasequence insertions of single or multiple amino acid residues.
Examples of terminal insertions include an antibody with an
N-terminal methionyl residue or the antibody fused to a cytotoxic
polypeptide. Other insertional variants of an antibody molecule
include the fusion to the N- or C-terminus of an anti-antibody to
an enzyme or a polypeptide which increases the serum half-life of
the antibody.
[0178] Another type of variant is an amino acid substitution
variant. These variants have at least one amino acid residue in an
antibody molecule replaced by a different residue. The sites of
greatest interest for substitutional mutagenesis include the
hypervariable regions, but FR alterations are also contemplated.
Conservative substitutions are shown in Table 3 below under the
heading of "preferred substitutions." If such substitutions result
in a change in biological activity, then more substantial changes,
denominated "exemplary substitutions" as further described below in
reference to amino acid classes, may be introduced and the products
screened.
[0179] Substantial modifications in the biological properties of
the antibody are accomplished by selecting substitutions that
differ significantly in their effect on maintaining (a) the
structure of the polypeptide backbone in the area of the
substitution, for example, as a sheet or helical conformation, (b)
the charge or hydrophobicity of the molecule at the target site, or
(c) the bulk of the side chain. Naturally occurring residues are
divided into groups based on common side-chain properties:
[0180] (1) hydrophobic: Nle, Met, Ala, Val, Leu, Ile;
[0181] (2) neutral hydrophilic: Cys, Ser, Thr;
[0182] (3) acidic: Asp, Glu;
[0183] (4) basic: Asn, Gln, H is, Lys, Arg;
[0184] (5) residues that influence chain orientation: Gly, Pro;
and
[0185] (6) aromatic: Trp, Tyr, Phe.
[0186] Non-conservative substitutions will entail exchanging a
member of one of these classes for a member of another class.
[0187] Any cysteine residue not involved in maintaining the proper
conformation of the antibody may be substituted, generally with
serine, to improve the oxidative stability of the molecule and
prevent aberrant crosslinking. Conversely, cysteine bond(s) may be
added to the antibody to improve its stability (particularly where
the antibody is an antibody fragment such as an Fv fragment).
[0188] One type of substitutional variant involves substituting one
or more hypervariable region residues of a parent antibody (e.g., a
humanized or human antibody). Generally, the resulting variant(s)
selected for further development will have improved biological
properties relative to the parent antibody from which they are
generated. A convenient way for generating such substitutional
variants involves affinity maturation using phage display. Briefly,
several hypervariable region sites (e.g., 6-7 sites) are mutated to
generate all possible amino substitutions at each site. The
antibody variants thus generated are displayed in a monovalent
fashion from filamentous phage particles as fusions to the gene III
product of M13 packaged within each particle. The phage-displayed
variants are then screened for their biological activity (e.g.,
binding affinity) as herein disclosed. In order to identify
candidate hypervariable region sites for modification, alanine
scanning mutagenesis can be performed to identify hypervariable
region residues contributing significantly to antigen binding.
Alternatively, or additionally, it may be beneficial to analyze a
structure of the antibody conjugate complex to identify contact
points between the antibody and the Z group. Such contact residues
and neighboring residues are candidates for substitution according
to the techniques elaborated herein. Once such variants are
generated, the panel of variants is subjected to screening as
described herein and antibodies with superior properties in one or
more relevant assays may be selected for further development.
[0189] Another type of amino acid variant of the antibody alters
the original glycosylation pattern of the antibody by deleting one
or more carbohydrate moieties found in the antibody and/or adding
one or more glycosylation sites that are not present in the
antibody.
[0190] Glycosylation of antibodies is typically either N-linked or
O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tripeptide
sequences Asn-X''-Ser and Asn-X''-Thr, where X'' is any amino acid
except proline, are generally the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tripeptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-acetylgalactosamine, galactose, or xylose to a
hydroxyamino acid, most commonly serine or threonine, although
5-hydroxyproline or 5-hydroxylysine may also be used.
[0191] Addition of glycosylation sites to the antibody is
conveniently accomplished by altering the amino acid sequence such
that it contains one or more of the above-described tripeptide
sequences (for N-linked glycosylation sites). The alteration may
also be made by the addition of or substitution by one or more
serine or threonine residues to the sequence of the original
antibody (for O-linked glycosylation sites).
[0192] It may be desirable to modify an antibody with respect to
effector function, for example to enhance antigen-dependent
cell-mediated cytotoxicity (ADCC) and/or complement dependent
cytotoxicity (CDC) of the antibody. This may be achieved by
introducing one or more amino acid substitutions in an Fc region of
the antibody. Alternatively, an antibody can be engineered which
has dual Fc regions and may thereby have enhanced complement lysis
and ADCC capabilities. See G. T. Stevenson et al., Anticancer Drug
Des. 3:219-230 (1989).
[0193] To increase the serum half life of an antibody, one may
incorporate a salvage receptor binding epitope into the antibody
(especially an antibody fragment) as described in U.S. Pat. No.
5,739,277, for example. As used herein, the term "salvage receptor
binding epitope" refers to an epitope of the Fc region of an IgG
molecule (e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, or IgG.sub.4) that
is responsible for increasing the in vivo serum half-life of the
IgG molecule.
TABLE-US-00006 TABLE 3 Amino acid substitutions Original Preferred
Residue Exemplary Substitutions Substitutions Ala (A) Val; Leu; Ile
Val Arg I Lys; Gln; Asn Lys Asn (N) Gln; His; Asp; Lys; Arg Gln Asp
(D) Glu; Asn Glu CI(C) Ser; Ala Ser Gln (Q) Asn; Glu Asn Glu (E)
Asp; Gln Asp Gly (G) Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I)
Leu; Val; Met; Ala; Phe; Nle Leu Leu (L) Nle; Ile; Val; Met; Ala;
Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F)
Leu; Val; Ile; Ala; Tyr Tyr Pro (P) Ala Ala Ser (S) Thr Thr Thr (T)
Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V)
Ile; Leu; Met; Phe; Ala; Nle Leu
[0194] Various techniques have been developed for the production of
whole antibodies and antibody fragments. Traditionally, antibody
fragments were derived via proteolytic digestion of intact
antibodies (see, e.g., K. Morimoto and K. Inouye, J. Biochem.
Biophys. Methods 24:107-117 (1992); M. Brennan et al., Science
229:81-83 (1985)). However, these fragments can now be produced
directly by recombinant host cells. Fab, Fv, V.sub.H, V.sub.L, and
scfv antibody fragments can all be expressed in and secreted from
E. coli as is detailed below, thus allowing the facile production
of large amounts of these fragments. Antibody fragments can be
isolated from the antibody phage libraries discussed above.
Alternatively, Fab'-SH fragments can be directly recovered from E.
coli and chemically coupled to form F(ab').sub.2 fragments (P.
Carter et al., Biotechnology 10:163-167 (1992)). According to
another approach, F(ab').sub.2 fragments can be isolated directly
from recombinant host cell culture.
[0195] A variety of expression vector/host systems may be utilized
to express antibodies. These systems include but are not limited to
microorganisms such as bacteria transformed with recombinant
bacteriophage, plasmid or cosmid DNA expression vectors; yeast
transformed with yeast expression vectors; insect cell systems
infected with virus expression vectors (e.g., baculovirus); plant
cell systems transfected with virus expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed with bacterial expression vectors (e.g., Ti or pBR322
plasmid); or animal cell systems.
[0196] Mammalian cells that are useful in recombinant antibody
expression include but are not limited to VERO cells, HeLa cells,
Chinese hamster ovary (CHO) cell lines, COS cells (such as COS-7),
W138, BHK, HepG2, 3T3, RIN, MDCK, A549, PC12, K562 and 293 cells,
as well as hybridoma cell lines as described herein. Mammalian
cells are preferred for preparation of those antibodies that are
typically glycosylated and require proper refolding for activity.
Preferred mammalian cells include CHO cells, hybridoma cells, and
myeloid cells.
[0197] Some exemplary protocols for the recombinant expression of
antibodies are described herein below.
[0198] The term "expression vector" or "vector" refers to a
plasmid, phage, virus or vector, for expressing a polypeptide from
a DNA (RNA) sequence. An expression vector may comprise a
transcriptional unit comprising (1) one or more regulatory
sequences controlling gene expression, for example, promoters or
enhancers, (2) one or more sequences that encode one or more
polypeptides, and (3) appropriate transcription initiation and
termination sequences. Expression vectors intended for use in yeast
or eukaryotic expression systems preferably include a leader
sequence enabling extracellular secretion of translated protein by
a host cell. Alternatively, where an antibody polypeptide(s) is
expressed without a leader or transport sequence, it may include an
amino terminal methionine residue. This residue may or may not be
subsequently cleaved from the expressed recombinant protein to
provide a final antibody product.
[0199] Antibodies, specifically antibody fragments, may be
expressed in prokaryotic systems such as E. coli. In another
example, the DNA sequence encoding the specific binding agent
peptide can be amplified by PCR and cloned into an appropriate
vector, such as for example pGEX-3.times.(Pharmacia). The pGEX
vector is designed to produce a fusion protein comprising
glutathione-5-transferase (GST), encoded by the vector, and a
peptide encoded by a DNA fragment inserted into the vector's
cloning site. The primers for PCR can be generated to include for
example, an appropriate cleavage site. The pGEX-3.times. antibody
peptide construct is transformed into E. coli XL-1 Blue cells
(Stratagene, La Jolla Calif.), and individual transformants are
isolated and grown. The expressed peptide fusion protein may then
be cleaved from the GST portion of the fusion protein.
[0200] Expression of polynucleotides encoding antibodies using the
recombinant systems described above may result in production of
antibodies or fragments thereof that must be "re-folded" (to
properly create various disulphide bridges) in order to be
biologically active.
[0201] Antibodies, specifically antibody fragments, made in
bacterial cells may be produced as an insoluble inclusion body in
the bacteria. Such antibodies can be purified as follows. Host
cells can be sacrificed by centrifugation; washed in 0.15 M NaCl,
10 mM Tris, pH 8, 1 mM EDTA; and treated with 0.1 mg/ml lysozyme
(Sigma, St. Louis, Mo.) for 15 minutes at room temperature. The
lysate can be cleared by sonication, and cell debris can be
pelleted by centrifugation for 10 minutes at 12,000.times.g. The
antibody containing pellet can be resuspended in 50 mM Tris, pH 8,
and 10 mM EDTA, layered over 50% glycerol, and centrifuged for 30
min. at 6000.times.g. The pellet can be resuspended in standard
phosphate buffered saline solution (PBS) free of Mg and Ca ions.
The antibody can be further purified by fractionating the
resuspended pellet in a denaturing SDS polyacrylamide gel (Sambrook
et al., supra). The gel can be soaked in 0.4 M KCl to visualize the
protein, which can be excised and electroeluted in gel-running
buffer lacking SDS.
[0202] Mammalian host systems for the expression of antibodies are
well known to those of skill in the art. Host cell strains can be
chosen for a particular ability to process the expressed protein or
produce certain post-translation modifications that will be useful
in providing protein activity. Such modifications of the
polypeptide include, but are not limited to, acetylation,
carboxylation, glycosylation, phosphorylation, lipidation and
acylation. Different host cells such as CHO, HeLa, MDCK, 293, W138,
as well as hybridoma cell lines, and the like have specific
cellular machinery and characteristic mechanisms for such
post-translational activities and can be chosen to ensure the
correct modification and processing of the introduced, foreign
protein.
[0203] A number of selection systems can be used to recover the
cells that have been transformed for recombinant antibody
production. Such selection systems include, but are not limited to,
HSV thymidine kinase, hypoxanthine-guanine
phosphoribosyltransferase and adenine phosphoribosyltransferase
genes, in tk-, hgprt- or aprt-cells, respectively. Also,
anti-metabolite resistance can be used as the basis of selection
for DHFR which confers resistance to methotrexate; gpt which
confers resistance to mycophenolic acid; neo which confers
resistance to the aminoglycoside G418 and confers resistance to
chlorsulfuron; and hygro which that confers resistance to
hygromycin. Additional selectable genes that may be useful include
trpB, which allows cells to utilize indole in place of tryptophan,
or hisD, which allows cells to utilize histinol in place of
histidine. Markers that give a visual indication for identification
of transformants include anthocyanins, beta.-glucuronidase and its
substrate, GUS, and luciferase and its substrate, luciferin.
[0204] In some cases, antibodies produced using procedures
described above may need to be "refolded" and oxidized into a
proper tertiary structure and allowed to generate disulfide
linkages in order to be biologically active. Refolding can be
accomplished using a number of procedures well known in the art.
Such methods include, for example, exposing the solubilized
polypeptide agent to a pH usually above 7 in the presence of a
chaotropic agent. The selection of chaotrope is similar to the
choices used for inclusion body solubilization. However a chaotrope
is typically used at a lower concentration. An exemplary chaotropic
agent is guanidine. In most cases, the refolding/oxidation solution
will also contain a reducing agent plus its oxidized form in a
specific ratio to generate a particular redox potential which
allows for disulfide shuffling to occur for the formation of
cysteine bridges. Some commonly used redox couples include
cysteine/cystamine, glutathione/dithiobisGSH, cupric chloride,
dithiothreitol DTT/dithiane DTT, and 2-mercaptoethanol
(bME)/dithio-bME. In many instances, a co-solvent may be used to
increase the efficiency of the refolding. Commonly used cosolvents
include glycerol, polyethylene glycol of various molecular weights,
and arginine.
Linkers and Linked Compounds
[0205] An AA targeting agent may be covalently linked to a
combining site in an antibody either directly or via a linker. An
appropriate linker can be chosen to provide sufficient distance
between the targeting agent and the antibody The general design of
an embodiment of a linker for use in preparing AA targeting
compounds is represented by the formula: --X--Y-Z, wherein X is a
connecting chain, Y is a recognition group and Z is a reactive
group. The linker may be linear or branched, and optionally
includes one or more carbocyclic or heterocyclic groups. Linker
length may be viewed in terms of the number of linear atoms, with
cyclic moieties such as aromatic rings and the like to be counted
by taking the shortest route around the ring. In some embodiments,
the linker has a linear stretch of between 5-15 atoms, in other
embodiments 15-30 atoms, in still other embodiments 30-50 atoms, in
still other embodiments 50-100 atoms, and in still other
embodiments 100-200 atoms. Other linker considerations include the
effect on physical or pharmacokinetic properties of the resulting
AA targeting compound or AA targeting agent-linker, such as
solubility, lipophilicity, hydrophilicity, hydrophobicity,
stability (more or less stable as well as planned degradation),
rigidity, flexibility, immunogenicity, modulation of antibody
binding, the ability to be incorporated into a micelle or liposome,
and the like.
[0206] The connecting chain X of the linker includes any atom from
the group C, H, N, O, P, S, halogen (F, Cl, Br, I), or a salt
thereof. X also may include a group such as an alkyl, alkenyl,
alkynyl, oxoalkyl, oxoalkenyl, oxoalkynyl, aminoalkyl,
aminoalkenyl, aminoalkynyl, sulfoalkyl, sulfoalkenyl, sulfoalkynyl,
phosphoalkyl, phosphoalkenyl, or phosphoalkynyl group. In some
embodiments, X may include one or more ring structures. In some
embodiments, the linker is a repeating polymer such as polyethylene
glycol comprising 2-100 units.
[0207] The recognition group Y of the linker is optional, and if
present is located between the reactive group and the connecting
chain. In some embodiments, Y is located from 1-20 atoms from Z.
Although not wishing to be bound by any theory, it is believed that
the recognition group acts to properly position the reactive group
into the antibody combining site so that it may react with a
reactive amino acid side chain. Exemplary recognition groups
include carbocyclic and heterocyclic rings, preferably having five
or six atoms. However, larger ring structures also may be used. In
some embodiments, an AA targeting agent is linked directly to Y
without the use of an intervening linker.
[0208] Z is capable of forming a covalent bond with a reactive side
chain in an antibody combining site. In some embodiments, Z
includes one or more C.dbd.O groups arranged to form a diketone, an
acyl beta-lactam, an active ester, a haloketone, a cyclohexyl
diketone group, an aldehyde, a maleimide, an activated alkene, an
activated alkyne or, in general, a molecule comprising a leaving
group susceptible to nucleophilic or electrophilic displacement.
Other groups may include a lactone, an anhydride, an
alpha-haloacetamide, an imine, a hydrazide, or an epoxide.
Exemplary linker electrophilic reactive groups that can covalently
bond to a reactive nucleophilic group (e.g., a lysine or cysteine
side chain) in a combining site of antibody include acyl
beta-lactam, simple diketone, succinimide active ester, maleimide,
haloacetamide with linker, haloketone, cyclohexyl diketone,
aldehyde, amidine, guanidine, imine, eneamine, phosphate,
phosphonate, epoxide, aziridine, thioepoxide, a masked or protected
diketone (a ketal for example), lactam, sulfonate, and the like,
masked C.dbd.O groups such as imines, ketals, acetals, and any
other known electrophilic group. In certain embodiments, the
reactive group includes one or more C.dbd.O groups arranged to form
an acyl beta-lactam, simple diketone, succinimide active ester,
maleimide, haloacetamide with linker, haloketone, cyclohexyl
diketone, or aldehyde.
[0209] The linker reactive group or similar such reactive group is
chosen for use with a reactive residue in a particular combining
site. For example, a chemical moiety for modification by an
aldolase antibody may be a ketone, diketone, beta lactam, active
ester haloketone, lactone, anhydride, maleimide,
alpha-haloacetamide, cyclohexyl diketone, epoxide, aldehyde,
amidine, guanidine, imine, eneamine, phosphate, phosphonate,
epoxide, aziridine, thioepoxide, masked or protected diketone
(ketal for example), lactam, haloketone, aldehyde, and the
like.
[0210] A linker reactive group chemical moiety suitable for
covalent modification by a reactive sulfhydryl group in an antibody
may be a disulfide, aryl halide, maleimide, alpha-haloacetamide,
isocyanate, epoxide, thioester, active ester, amidine, guanidine,
imine, eneamine, phosphate, phosphonate, epoxide, aziridine,
thioepoxide, masked or protected diketone (ketal for example),
lactam, haloketone, aldehyde, and the like.
[0211] One of skill in the art will readily appreciate that
reactive amino acid side chains in antibody combining sites may
possess an electrophilic group that reacts with a nucleophilic
group on an AA targeting agent or its linker, whereas in other
embodiments a reactive nucleophilic group in an amino acid side
chain reacts with an electrophilic group in an AA targeting agent
or linker.
[0212] An AA targeting compound may be prepared by several
approaches. In one approach, an AA targeting agent-linker compound
is synthesized with a linker that includes one or more reactive
groups designed for covalent reaction with a side chain of an amino
acid in a combining site of an antibody. The targeting agent-linker
compound and antibody are combined under conditions where the
linker reactive group forms a covalent bond with the amino acid
side chain.
[0213] In another approach, linking can be achieved by synthesizing
an antibody-linker compound comprising an antibody and a linker
wherein the linker includes one or more reactive groups designed
for covalent reaction with an appropriate chemical moiety of an AA
targeting agent. An AA targeting agent may need to be modified to
provide the appropriate moiety for reaction with the linker
reactive group. The antibody-linker and AA targeting agent are
combined under conditions where the linker reactive group
covalently links to the targeting and/or biological agent.
[0214] A further approach for forming an antibody-AA targeting
compound uses a dual linker design. In certain embodiments, an AA
targeting agent-linker compound is synthesized which comprises an
AA targeting agent and a linker with a reactive group. An
antibody-linker compound is synthesized which comprises an antibody
and a linker with a chemical group susceptible to reactivity with
the reactive group of the AA targeting agent-linker of the first
step. These two linker containing compounds are then combined under
conditions whereby the linkers covalently link, forming the
antibody-AA-targeting compound.
[0215] Exemplary functional groups that can be involved in the
linkage include, for example, esters, amides, ethers, phosphates,
amino, keto, amidine, guanidine, imines, eneamines, phosphates,
phosphonates, epoxides, aziridines, thioepoxides, masked or
protected diketones (ketals for example), lactams, haloketones,
aldehydes, thiocarbamate, thioamide, thioester, sulfide, disulfide,
phosphoramide, sulfonamide, urea, thioruea, carbamate, carbonate,
hydroxamide, and the like.
[0216] The linker includes any atom from the group C, H, N, O, P,
S, halogen (F, Cl, Br, I), or a salt thereof. The linker also may
include a group such as an alkyl, alkenyl, alkynyl, oxoalkyl,
oxoalkenyl, oxoalkynyl, aminoalkyl, aminoalkenyl, aminoalkynyl,
sulfoalkyl, sulfoalkenyl, sulfoalkynyl group, phosphoalkyl,
phosphoalkenyl, or phosphoalkynyl group. The linker also may
include one or more ring structures. As used herein, a "ring
structure" includes saturated, unsaturated, and aromatic
carbocyclic rings and saturated, unsaturated, and aromatic
heterocyclic rings. The ring structures may be mono-, bi-, or
polycyclic, and include fused or unfused rings. Further, the ring
structures are optionally substituted with functional groups well
known in the art, including but not limited to halogen, oxo, --OH,
--CHO, --COOH, --NO.sub.2, --CN, --NH.sub.2, --C(O)NH.sub.2,
C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl, C.sub.1-6
oxoalkyl, oxoalkenyl, oxoalkynyl, aminoalkyl, aminoalkenyl,
aminoalkynyl, sulfoalkyl, sulfoalkenyl, sulfoalkynyl, phosphoalkyl,
phosphoalkenyl, or phosphoalkynyl group. Combinations of the above
groups and rings may also be present in the linkers of AA targeting
compounds.
[0217] One aspect of the invention is an AA targeting agent-linker
conjugate having Formula I:
L--[AA targeting agent] (I)
wherein [AA targeting agent] is an AA targeting agent peptide.
[0218] The linker moiety L in compounds of Formula I may be
attached to the amino terminus, carboxy terminus or any amino acid
side chain of an AA targeting agent. In certain embodiments, L is
linked to the carboxy terminus of an AA targeting agent. In certain
other embodiments, L is linked to the amino terminus of an AA
targeting agent. In still other embodiments, L is linked to either
a nucleophilic or electrophilic side chain. For the case of linking
to an electrophilic side chain, L should possess a nucleophilic
group susceptible to covalent reaction with the electrophilic side
chain. Exemplary electrophilic side chains are Asp and Glu.
Exemplary nucleophilic side chains are Cys, Lys, Ser, Thr, and Tyr.
For the case of linking to a nucleophilic side chain, L should
comprise an electrophilic group susceptible to covalent reaction
with the nucleophilic side chain. In another embodiment, a
nucleophilic amino acid is added to either the carboxy terminus or
the amino terminus of an AA targeting agent and the linker L is
covalently attached to the side chain of this additional amino
acid. In certain embodiments, Lys is added to the amino terminus of
an AA targeting agent. In certain other embodiments, Lys is added
to the carboxy terminus of an AA targeting agent.
[0219] Thus, in those embodiments comprising
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3 (SEQ ID
NO:1) based AA targeting agents, exemplary compounds of Formula I
formed by linking to either i) the side chains of D, E, C, K, S, T,
and Y or ii) the amino or carboxy termini, include:
TABLE-US-00007
Sar(L)-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro-R.sup.3
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr(L)-Nva-Ile-Arg- Pro-R.sup.3
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-INva-Ile-Arg-Pro(L)
[0220] Similarly, in those embodiments comprising
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3 (SEQ ID
NO:4) based AA targeting agents, exemplary compounds of Formula I
formed by linking to either i) the side chains of D, E, C, K, S, T,
and Y or ii) the amino or carboxy termini, include:
TABLE-US-00008
Sar(L)-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro-R.sup.3
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr(L)-Lys-Ile-Arg- Pro-R.sup.3
R.sup.1-Sar-Gly-Val-(D-alIoIle)-Thr-Lys(L)-Ile-Arg- Pro-R.sup.3
R.sup.1-Sar-Gly-Val-(D-alloIle)-Thr-Lys-Ile-Arg-Pro(L)
[0221] In compounds of Formula I, L is a linker moiety having the
formula --X--Y-Z, wherein: [0222] X is a biologically compatible
polymer or block copolymer attached to one of the residues that
comprises an AA targeting agent; [0223] Y is an optionally present
recognition group comprising at least a ring structure; and [0224]
Z is a reactive group that is capable of covalently linking to a
side chain in a combining site of an antibody.
[0225] In some embodiments of compounds in Formula I, X is:
--R.sup.22--P--R.sup.23-- or
--R.sup.22--P--R.sup.21--P'--R.sup.23--
wherein: [0226] P and P' are independently selected from the group
consisting of polyoxyalkylene oxides such as polyethylene oxide,
polyethyloxazoline, poly-N-vinyl pyrrolidone, polyvinyl alcohol,
polyhydroxyethyl acrylate, polyhydroxy ethylmethacrylate and
polyacrylamide, polyamines having anine groups on either the
polymer backbone or the polymer sidechains, such as polylysine,
polyornithine, polyarginine, and polyhistidine, nonpeptide
polyamines such as polyaminostyrene, polyaminoacrylate,
poly(N-methyl aminoacrylate), poly(N-ethylaminoacrylate),
poly(N,N-dimethyl aminoacrylate), poly(N,N-diethylaminoacrylate),
poly(aminomethacrylate), poly(N-methyl amino-methacrylate),
poly(N-ethyl aminomethacrylate), poly(N,N-dimethyl
aminomethacrylate), poly(N,N-diethyl aminomethacrylate),
poly(ethyleneimine), polymers of quaternary amines, such as
poly(N,N,N-trimethylaminoacrylate chloride),
poly(methyacrylamidopropyltrimethyl ammonium chloride),
proteoglycans such as chondroitin sulfate-A (4-sulfate) chondroitin
sulfate-C (6-sulfate) and chondroitin sulfate-B, polypeptides such
as polyserine, polythreonine, polyglutamine, natural or synthetic
polysaccharides such as chitosan, hydroxy ethyl cellulose, and
lipids; [0227] R.sup.21, R.sup.22, and R.sup.23 are each
independently a covalent bond, --O--, --S--, --NR.sup.b--,
substituted or unsubstituted straight or branched chain C.sub.1-50
alkylene, or substituted or unsubstituted straight or branched
chain C.sub.1-50 heteroalkylene; [0228] R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl; and [0229] R.sup.21,
R.sup.22, and R.sup.23 are selected such that the backbone length
of X remains about 200 atoms or less.
[0230] In some embodiments of compounds of Formula I, R.sup.22 is
--(CH.sub.2).sub.v--, --(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sup.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v--, wherein
u and v are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
[0231] In yet other embodiments of compounds of Formula I, R.sup.22
is --(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u, --NR.sup.b--(CH.sub.2).sub.v. In still other
embodiments, R.sup.12 is
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--.
[0232] In some embodiments of compounds of Formula I, R.sup.21 and
R.sup.23 are each independently --(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--C(O)--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.r--C(S)--NR.sup.b--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r,C(O)--NR.sup.b(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--NR.sup.b--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--O--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r--S(O).sub.0-2--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.s--, or
--(CH.sub.2).sub.r--P(O)(OR.sup.b)--O--(CH.sub.2).sub.s-- wherein
r, s, and v are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
[0233] In yet other embodiments, R.sup.21 and R.sup.23 are each
independently --(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--C(O)--(CH.sub.2).sub.s--,
(CH.sub.2).sub.r,C(O)--O--(CH.sub.2).sub.s--,
--(CH.sub.2).sub.r--C(O)--NR.sup.b--(CH.sub.2).sub.s--, or
--(CH.sub.2).sub.r--NR.sup.b--(CH.sub.2).sub.s, and
--(CH.sub.2).sub.r,C(O)--NR.sup.b(CH.sub.2).sub.s.
[0234] In still other embodiments, R.sup.21 and R.sup.23 each
independently have the structure:
##STR00028##
wherein p is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, or 45; w, r, and s are
each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19 or 20; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl.
[0235] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00029##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl.
[0236] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00030##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl.
[0237] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00031##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl.
[0238] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00032##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl.
[0239] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00033##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl.
[0240] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00034##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl.
[0241] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00035##
wherein H.sup.1 and H.sup.1' at each occurrence are independently
N, O, S, or CH.sub.2; r and s are each independently 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20; t and t'
are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46,
47, 48, 49 or 50; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl.
[0242] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00036##
wherein v and w are each independently 1, 2, 3, 4, or 5 and R.sup.b
is hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain of
these embodiments, v is 1, 2 or 3, w is 1, 2, or 3, and R.sup.b is
hydrogen.
[0243] In certain embodiments of Formula I, L is a linker moiety
having the formula --X--Y-Z, wherein: [0244] X is attached to one
of the residues that comprises an AA targeting agent, and is an
optionally substituted
--R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
--R.sup.22-cycloalkyl- R.sup.23--, --R.sup.22-aryl-R.sup.23--, or
R.sup.22-heterocyclyl-R.sup.23--, wherein; [0245] R.sup.22 and
R.sup.23 are each independently a covalent bond, --O--, --S--,
--NR.sup.b--, substituted or unsubstituted straight or branched
chain C.sub.1-50 alkylene, substituted or unsubstituted straight or
branched chain C.sub.1-50 heteroalkylene, substituted or
unsubstituted straight or branched chain C.sub.2-50 alkenylene, or
substituted or unsubstituted C.sub.2-50 heteroalkenylene; [0246]
R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl; [0247] t is
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40, 41, 32, 43, 44, 45, 46, 47, 48, 49 or 50; and
the size of R.sup.22 and R.sup.23 are such that the backbone length
of X remains about 200 atoms or less; [0248] Y is an optionally
present recognition group comprising at least a ring structure; and
[0249] Z is a reactive group that is capable of covalently linking
to a side chain in a combining site of an antibody. In some
embodiments of compounds of Formula I, if t>1 or if --X is
--R.sup.22-cycloalkyl- R.sup.23, --R.sup.22-aryl-R.sup.23-- or
--R.sup.22-heterocyclyl-R.sup.23--, Y is present.
[0250] In some embodiments of compounds of Formula I, X is:
--R.sup.22--[CH.sub.2--CH.sub.2--O].sub.t--R.sup.23--,
wherein: [0251] R.sup.22 is --(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(O)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--C(S)--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--NR.sup.b--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--O--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--(CH.sub.2).sub.v--,
--(CH.sub.2).sub.u--S(O).sub.0-2--NR.sup.b--(CH.sub.2).sub.v--, or
--(CH.sub.2).sub.u--P(O)(OR.sup.b)--O--(CH.sub.2).sub.v--; [0252] u
and v are each independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19 or 20 and t is 0 to 50. [0253]
R.sup.23 has the structure:
##STR00037##
[0253] wherein: p is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 32, 43, 44, or 45; w and r
are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19 or 20; s is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20; and [0254] R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl; and the values of t, u, w, p,
v, r and s are such that the backbone length of X remains about 200
atoms or less.
[0255] In certain embodiments of compounds of Formula I, X has the
formula:
##STR00038##
wherein the values of v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0256] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00039##
wherein the values of v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0257] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00040##
wherein the values of u, v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0258] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00041##
wherein the values of u, v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0259] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00042##
wherein the values of u, v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0260] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00043##
wherein the values of u, v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0261] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00044##
wherein the values of u, v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0262] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00045##
wherein the values of u, v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0263] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00046##
wherein the values of u, v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0264] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00047##
wherein the values of u, v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0265] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00048##
wherein the values of u, v, t, w, and p are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0266] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00049##
wherein the values of u, v, t, r, and s are selected such that the
backbone length of X is less than 200 atoms, alternatively is less
than 100 atoms, alternatively, is less than 75 atoms, alternatively
is less than 50 atoms, alternatively is less than 25 atoms, or
alternatively is less than 15 atoms.
[0267] In compounds having Formula I wherein L has the formula
--X--Y-Z, the ring structure of Y includes saturated, unsaturated,
and aromatic carbocyclic rings and saturated, unsaturated, and
aromatic heterocyclic rings. The ring structure(s) may be mono-,
bi-, or polycyclic, and include fused or unfused rings. Further,
the ring structure(s) is optionally substituted with functional
groups well known in the art including, but not limited to halogen,
oxo, --OH, --CHO, --COOH, --NO.sub.2, --CN, --NH.sub.2, amidine,
guanidine, hydroxylamine, --C(O)NH.sub.2, secondary and tertiary
amides, sulfonamides, substituted or unsubstituted alkyl,
substituted or unsubstituted alkenyl, substituted or unsubstituted
alkynyl, oxoalkyl, oxoalkenyl, oxoalkynyl, aminoalkyl,
aminoalkenyl, aminoalkynyl, sulfoalkyl, sulfoalkenyl, sulfoalkynyl,
phosphoalkyl, phosphoalkenyl, and phosphoalkynyl groups.
[0268] In some embodiments of compounds having Formula I, the ring
structure of Y has the optionally substituted structure:
##STR00050##
wherein a, b, c, d, and e are each independently carbon or
nitrogen; f is carbon, nitrogen, oxygen, or sulfur; Y is attached
to X and Z independently at any two ring positions of sufficient
valence; and no more than four of a, b, c, d, e, or f are
simultaneously nitrogen.
[0269] Any open valences remaining on atoms constituting the ring
structure may be filled by hydrogen or other substituents, or by
the covalent attachments to X and Z. For example, if b is carbon,
its valence may be filled by hydrogen, a substituent such as
halogen, a covalent attachment to X, or a covalent attachment to Z.
In some embodiments, a, b, c, d, and e are each carbon, while in
others, a, c, d and f are each carbon. In other embodiments, at
least one of a, b, c, d, or e is nitrogen, and in still others, f
is oxygen or sulfur. In yet another embodiment, the ring structure
of Y is unsubstituted. In certain embodiments, Y is phenyl.
[0270] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00051##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; and R.sup.b is hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain other embodiments, v is 1, 2 or 3
and w is 1, 2, or 3. In still other embodiments, v is 1 or 2 and w
is 1 or 2.
[0271] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00052##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; and t
and t' are each independently 0, 1, 2, 3, 4, or 5. In certain of
these embodiments, H.sup.1 and H.sup.1' are each independently O or
CH.sub.2; r and s are each independently 1 or 2; and t and t' are
each independently 0 or 1.
[0272] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00053##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; t and t'
are each independently 0, 1, 2, 3, 4, or 5, and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain of these embodiments, H.sup.1 and
H.sup.1' are each independently O or CH.sub.2; r and s are each
independently 1 or 2; and t and t' are each independently 0 or
1.
[0273] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00054##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; t and t'
are each independently 0, 1, 2, 3, 4, or 5, and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain of these embodiments, H.sup.1 and
H.sup.1' are each independently O or CH.sub.2; r and s are each
independently 1 or 2; and t and t' are each independently 0 or
1.
[0274] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00055##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; t and t'
are each independently 0, 1, 2, 3, 4, or 5, and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain of these embodiments, H.sup.1 and
H.sup.1' are each independently O or CH.sub.2; r and s are each
independently 1 or 2; and t and t' are each independently 0 or
1.
[0275] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00056##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; t and t'
are each independently 0, 1, 2, 3, 4, or 5, and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain of these embodiments, H.sup.1 and
H.sup.1' are each independently O or CH.sub.2; r and s are each
independently 1 or 2; and t and t' are each independently 0 or
1.
[0276] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00057##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; t and t'
are each independently 0, 1, 2, 3, 4, or 5, and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain of
these embodiments, H.sup.1 and H.sup.1' are each independently O or
CH.sub.2; r and s are each independently 1 or 2; and t and t' are
each independently 0 or 1.
[0277] In certain embodiments of compounds of Formula I, X has the
structure:
##STR00058##
wherein H.sup.1 and H.sup.1' are each independently N, O, S, or
CH.sub.2; r and s are each independently 1, 2, 3, 4, or 5; and t
and t' are each independently 0, 1, 2, 3, 4, or 5. In certain of
these embodiments, H.sup.1 and H.sup.1' are each independently O or
CH.sub.2; r and s are each independently 1 or 2; and t and t' are
each independently 0 or 1. In certain of these embodiments of
compounds of Formula I, X--Y has the structure:
##STR00059##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5, and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1, 2, or 3, w is 1; and p is 1 or 2.
[0278] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00060##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-Co 6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s
is 3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; and s
is 1 or 2.
[0279] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00061##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; w is
1; and p is 3. In some embodiments, u is 0or 1; v is 0; t is 1 or
2; w is 1; and p is 1 or 2.
[0280] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00062##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, u is 0 or 1; v is 0; t is 1, 2, or 3; r is 1; and s is
1 or 2.
[0281] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00063##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; w is
1; and p is 3. In some embodiments, u is 0or 1; v is 0; t is 1 or
2; w is 1; and p is 1 or 2.
[0282] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00064##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, u is 0 or 1; v is 0; t is 1, 2, or 3, r is 1; and s is
1 or 2.
[0283] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00065##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; w is
1; and p is 3. In some embodiments, u is 0or 1; v is 0; t is 1 or
2; w is 1; and p is 1 or 2.
[0284] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00066##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is O; v is 0; t is 1, 2, 3, 4, 5, or 6; r is
1 or 2; and s is 3. In some embodiments, u is 0 or 1; v is O; t is
1, 2, or 3, r is 1; and s is 1 or 2.
[0285] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00067##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; w is
1; and p is 3. In some embodiments, u is 0 or 1; v is 0; t is 1 or
2; w is 1; and p is 1 or 2.
[0286] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00068##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is
1 or 2; and s is 3. In some embodiments, u is 0 or 1; v is 0; t is
1,2, or 3, r is 1; and s is 1 or 2.
[0287] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00069##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; w is
1; and p is 3. In some embodiments, u is 0or 1; v is 0; t is 1 or
2; w is 1; and p is 1 or 2.
[0288] In certain embodiments of compounds of Formula I, X--Y has
the structure:
##STR00070##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiment, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, u is 0 or 1; v is 0; t is 1,2, or 3, r is 1; and s is
1 or 2.
[0289] In compounds having Formula I wherein L has the formula
--X--Y-Z, the reactive group Z contains a moiety capable of forming
a covalent linkage with an amino acid in a combining site of an
antibody. For example, Z may be substituted alkyl, substituted
cycloalkyl, substituted aryl, substituted arylalkyl, substituted
heterocyclyl, or substituted heterocyclylalkyl, wherein at least
one substituent is a 1,3-diketone moiety, an acyl beta-lactam, an
active ester, an alpha-haloketone, an aldehyde, a maleimide, a
lactone, an anhydride, an alpha-haloacetamide, an amine, a
hydrazide, or an epoxide. In some such embodiments, Z is
substituted alkyl.
[0290] Z may be a group that forms a reversible or irreversible
covalent bond. In some embodiments, reversible covalent bonds may
be formed using diketone Z groups such as those shown in FIG. 8.
Thus, structures A-C may form reversible covalent bonds with
reactive nucleophilic groups (e.g. lysine or cysteine side chain)
in a combining site of an antibody. R'.sub.1, R'.sub.2, R'.sub.3,
and R.sub.4 in structures A-C of FIG. 8 represent substituents
which can be C, H, N, O, P, S, halogen (F, Cl, Br, I) or a salt
thereof. These substituents also may include a group such as an
alkyl, alkenyl, alkynyl, oxoalkyl, oxoalkenyl, oxoalkynyl,
aminoalkyl, aminoalkenyl, aminoalkynyl, sulfoalkyl, sulfoalkenyl,
or sulfoalkynyl group, phosphoalkyl, phosphoalkenyl, phosphoalkynyl
group. R'.sub.2 and R'.sub.3 also could from a ring structure as
exemplified in structures B and C. X in FIG. 8 could be a
heteroatom. Other Z groups that form reversible covalent bonds
include the amidine, imine, and other reactive groups encompassed
by structure G of FIG. 8. FIG. 9 includes the structures of other
linker reactive groups that form reversible covalent bonds, e.g.,
structures B, G, H, and, where X is not a leaving group, E and
F.
[0291] Z reactive groups that form an irreversible covalent bond
with a combining site of an antibody include structures D-G in FIG.
8 (e.g., when G is an imidate) and structures A, C and D of FIG. 9.
When X is a leaving group, structures E and F of FIG. 9 may also
form irreversible covalent bonds. Such structures are useful for
irreversibly attaching a targeting agent-linker to a reactive
nucleophilic group to a combining site of an antibody.
[0292] In other such embodiments, Z is a 1,3-diketone moiety. In
still other such embodiments, Z is alkyl substituted by a
1,3-diketone moiety. In certain embodiments, Z has the
structure:
##STR00071##
wherein q=0-5. In certain other embodiments, Z has the
structure:
##STR00072##
[0293] One linker for use in AA targeting compounds and for
preparing AA targeting agent-linker compounds includes a
1,3-diketone reactive group as Z. In certain embodiments of Formula
I, L has the structure:
##STR00073##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0294] In certain embodiments of Formula I, L has the
structure:
##STR00074##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0295] In certain embodiments of Formula I, L has the
structure:
##STR00075##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0296] In certain embodiments of Formula I, L has the
structure:
##STR00076##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0297] In certain embodiments of Formula I, L has the
structure:
##STR00077##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0298] In certain embodiments of Formula I, L has the
structure:
##STR00078##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0299] In certain embodiments of Formula I, L has the
structure:
##STR00079##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, u is o or 1; v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 1 or 2.
[0300] In certain embodiments of Formula I, L has the
structure:
##STR00080##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, v is 0; t is 1 or 2; w is 1; p is 1 or
2; and q is 1 or 2.
[0301] In certain embodiments of Formula I, L has the
structure:
##STR00081##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3,4, or 5; q iso, 1,2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
some embodiments, v is 0; t is 1 or 2; w is 1; p is 1 or 2; and q
is 2 or 3.
[0302] In certain embodiments of Formula I, L has the
structure:
##STR00082##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q iso, 1, 2, 3, 4, or 5; and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, u is 0 or 1; v
is 0; t is 1 or 2; w is 1; p is 1 or 2; and q is 1 or 2.
[0303] In certain embodiments of Formula I, L has the
structure:
##STR00083##
In certain of these embodiments u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, u is 0 or 1; v
is 0; t is 1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0304] In certain embodiments of Formula I, L has the
structure:
##STR00084##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is
0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is
0, 1, 2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1,2,
or 3, r is 1; s is 1 or 2; and q is 2 or 3.
[0305] In certain embodiments of Formula I, L has the
structure:
##STR00085##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 1 or 2.
[0306] In certain embodiments of Formula I, L has the
structure:
##STR00086##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 1 or 2.
[0307] In certain embodiments of Formula I, L has the
structure:
##STR00087##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q iso, 1,2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q iso, 1,2, or 3. In some
embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p is 1 or 2;
and q is 2 or 3.
[0308] In certain embodiments of Formula I, L has the
structure:
##STR00088##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2,3,4, or 5; s
is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, u is 0 or 1; v
is 0; t is 1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0309] In certain embodiments of Formula I, L has the
structure:
##STR00089##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2,3,4, or 5; s
is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is
0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is
0, 1, 2, or 3. In some embodiments, u is o or 1; v is 0; t is 1,2,
or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0310] In certain embodiments of Formula I, L has the
structure:
##STR00090##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is
0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is
0, 1, 2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1, 2,
or 3, r is 1; s is 1 or 2; and q is 2 or 3.
[0311] In certain embodiments of Formula I, L has the
structure:
##STR00091##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2,3,4, or 5; p
is 1, 2,3,4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
some embodiments, u is 0or 1; v is 0; t is 1 or 2; w is 1; p is 1
or 2; and q is 1 or 2.
[0312] In certain embodiments of Formula I, L has the
structure:
##STR00092##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v iso; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q iso, 1,2, or
3. In some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p
is 1 or 2; and q is 1 or 2.
[0313] In certain embodiments of Formula I, L has the
structure:
##STR00093##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p is 1
or 2; and q is 2 or 3.
[0314] In certain embodiments of Formula I, L has the
structure:
##STR00094##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is o;
v is o; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0,
1, 2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1, 2, or
3, r is 1; s is 1 or 2; and q is 1 or 2.
[0315] In certain embodiments of Formula I, L has the
structure:
##STR00095##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v iso; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q iso,
1,2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 1 or 2.
[0316] In certain embodiments of Formula I, L has the
structure:
##STR00096##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q iso, 1,2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or 3.
In some embodiments, u is 0 or 1; v is 0; t is 1,2, or 3, r is 1; s
is 1 or 2; and q is 2 or 3.
[0317] In certain embodiments of Formula I, L has the
structure:
##STR00097##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2,3,4, or 5; p
is 1, 2,3,4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is O; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
still some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p
is 1 or 2; and q is 1 or 2.
[0318] In certain embodiments of Formula I, L has the
structure:
##STR00098##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 1 or 2.
[0319] In certain embodiments of Formula I, L has the
structure:
##STR00099##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p is 1
or 2; and q is 2 or 3.
[0320] In certain embodiments of Formula I, L has the
structure:
##STR00100##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0,
1, 2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 1 or 2.
[0321] In certain embodiments of Formula I, L has the
structure:
##STR00101##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0,
1, 2, or 3. In some embodiments, u is 0 or 1; v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 1 or 2.
[0322] In certain embodiments of Formula I, L has the
structure:
##STR00102##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q iso, 1,2, or 3. In
some embodiments, u is 0 or 1; v is 0; t is 1,2, or 3, r is 1; s is
1 or 2; and q is 2 or 3.
[0323] In certain embodiments of Formula I, L has the
structure:
##STR00103##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In still other embodiments, u is 0 or 1; v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0324] In certain embodiments of Formula I, L has the
structure:
##STR00104##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b at
each occurrence is independently hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0;
v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2,
or 3. In some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 1 or 2.
[0325] In certain embodiments of Formula I, L has the
structure:
##STR00105##
In certain of these embodiments, u is 0, 1, 2, 3, 4, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5;
p is 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b at each
occurrence is independently hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, u is 0; v is 0; t is
1, 2, 3, 4, 5, or 6; w is 1; p is 3; and q is 0, 1, 2, or 3. In
some embodiments, u is 0 or 1; v is 0; t is 1 or 2; w is 1; p is 1
or 2; and q is 2 or 3.
[0326] In certain embodiments of Formula I, L has the
structure:
##STR00106##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, u is 0 or 1; v
is 0; t is 1, 2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0327] In certain embodiments of Formula I, L has the
structure:
##STR00107##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, u is 0 or 1; v
is 0; t is 1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0328] In certain embodiments of Formula I, L has the
structure:
##STR00108##
In certain of these embodiments, u is 0, 1, 2, 3, 5, or 5; v is 0,
1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5;
s is 0, 1, 2, 3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b is
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, u is 0; v is 0; t is 1, 2, 3,4,5, or 6; r is 1 or 2; s
is 3; and q iso, 1,2, or 3. In some embodiments, u is 0 or 1; v is
0; t is 1,2, or 3, r is 1; s is 1 or 2; and q is 2 or 3.
[0329] As used herein, "AA.sub.1-AA.sub.2-AA.sub.n" refers to an AA
targeting agent wherein "AA.sub.1" is the first amino acid in the
AA targeting agent sequence, as measured from the N-terminus,
"AA.sub.2" is the second amino acid in the AA targeting agent
sequence, as measured from the N-terminus, and "AA.sub.n" is the
n.sup.th amino acid in the AA targeting agent sequence, as measured
from the N-terminus.
[0330] Certain embodiments in accordance with Formula I have the
structure:
##STR00109##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
1, 2, or 3; w is 1, 2, or 3; and q is 0, 1, 2, or 3. In some
embodiments, v is 1 or 2; w is 1 or 2; and q is 1 or 2.
[0331] Certain embodiments in accordance with Formula I have the
structure:
##STR00110##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
1,2, or 3; w is 1,2, or 3; and q is 0, 1, 2, 3. In some
embodiments, v is 1 or 2; w is 1 or 2; and q is 2 or 3.
[0332] Certain embodiments in accordance with Formula I have the
structure:
##STR00111##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
1, 2, or 3; w is 1, 2, or 3; and q is 0, 1, 2, 3. In some
embodiments, v is 1 or 2; w is 1 or 2; and q is 2 or 3.
[0333] Certain embodiments in accordance with Formula I have the
structure:
##STR00112##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0334] Certain embodiments in accordance with Formula I have the
structure:
##STR00113##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0335] Certain embodiments in accordance with Formula I have the
structure:
##STR00114##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1, 2, 3, 4, 5, or 6; w
is 1, 2,3,4, or 5; p is 1, 2,3,4, or 5; and q iso, 1,2, or 3. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; and
p is 3, and in some embodiments, v is 0; t is 1 or 2; w is 1; p is
1 or 2; and q is 2 or 3.
[0336] Certain embodiments in accordance with Formula I have the
structure:
##STR00115##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q iso, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0337] Certain embodiments in accordance with Formula I have the
structure:
##STR00116##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0338] Certain embodiments in accordance with Formula I have the
structure:
##STR00117##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0339] Certain embodiments in accordance with Formula I have the
structure:
##STR00118##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0340] Certain embodiments in accordance with Formula I have the
structure:
##STR00119##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0341] Certain embodiments in accordance with Formula I have the
structure:
##STR00120##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0342] Certain embodiments in accordance with Formula I have the
structure:
##STR00121##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0343] Certain embodiments in accordance with Formula I have the
structure:
##STR00122##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0344] Certain embodiments in accordance with Formula I have the
structure:
##STR00123##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0345] Certain embodiments in accordance with Formula I have the
structure:
##STR00124##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is o; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0346] Certain embodiments in accordance with Formula I have the
structure:
##STR00125##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0347] Certain embodiments in accordance with Formula I have the
structure:
##STR00126##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0348] Certain embodiments in accordance with Formula I have the
structure:
##STR00127##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, v is O; t is
1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0349] Certain embodiments in accordance with Formula I have the
structure:
##STR00128##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q iso, 1,2, or 3. In some embodiments, v is o; t is 1,
2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0350] Certain embodiments in accordance with Formula I have the
structure:
##STR00129##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3;
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0351] Certain embodiments in accordance with Formula I have the
structure:
##STR00130##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0352] Certain embodiments in accordance with Formula I have the
structure:
##STR00131##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is o; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0353] Certain embodiments in accordance with Formula I have the
structure:
##STR00132##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0354] Certain embodiments in accordance with Formula I have the
structure:
##STR00133##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is
1, 2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0355] Certain embodiments in accordance with Formula I have the
structure:
##STR00134##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1,
2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0356] Certain embodiments in accordance with Formula I have the
structure:
##STR00135##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3;
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1, 2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0357] Certain embodiments in accordance with Formula I have the
structure:
##STR00136##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0358] Certain embodiments in accordance with Formula I have the
structure:
##STR00137##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0359] Certain embodiments in accordance with Formula I have the
structure:
##STR00138##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0360] Certain embodiments in accordance with Formula I have the
structure:
##STR00139##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0361] Certain embodiments in accordance with Formula I have the
structure:
##STR00140##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q iso, 1,2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0362] Certain embodiments in accordance with Formula I have the
structure:
##STR00141##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
##STR00142##
[0363] as used herein refers to an AA targeting agent wherein
"AA.sub.1" is the first amino acid in an AA targeting agent
sequence as measured from the N-terminus, "AA.sub.2" is the second
amino acid in an AA targeting agent sequence as measured from the
N-terminus, and "AA.sub.n" is the n.sup.th amino acid in an AA
targeting agent sequence as measured from the N-terminus. The
targeting agent further comprises a Lys residue at arbitrary
position m+1 as measured from the N-terminus. It will be
appreciated that in addition to linking to a Lys side chain in the
body of an AA targeting agent, it is also possible to link to a Lys
side chain on the N-terminus or C-terminus of an AA targeting
agent.
[0364] Certain embodiments in accordance with Formula I have the
structure:
##STR00143##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0365] Certain embodiments in accordance with Formula I have the
structure:
##STR00144##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0366] Certain embodiments in accordance with Formula I have the
structure:
##STR00145##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is o; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0367] Certain embodiments in accordance with Formula I have the
structure:
##STR00146##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0368] Certain embodiments in accordance with Formula I have the
structure:
##STR00147##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0369] Certain embodiments in accordance with Formula I have the
structure:
##STR00148##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0370] Certain embodiments in accordance with Formula I have the
structure:
##STR00149##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is o; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0371] Certain embodiments in accordance with Formula I have the
structure:
##STR00150##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0372] Certain embodiments in accordance with Formula I have the
structure:
##STR00151##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0373] Certain embodiments in accordance with Formula I have the
structure:
##STR00152##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0374] Certain embodiments in accordance with Formula I have the
structure:
##STR00153##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0375] Certain embodiments in accordance with Formula I have the
structure:
##STR00154##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0376] Certain embodiments in accordance with Formula I have the
structure:
##STR00155##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0377] Certain embodiments in accordance with Formula I have the
structure:
##STR00156##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiment v iso; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3;
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w
is 1; p is 1 or 2; and q is 1 or 2.
[0378] Certain embodiments in accordance with Formula I have the
structure:
##STR00157##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0379] Certain embodiments in accordance with Formula I have the
structure:
##STR00158##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is
1, 2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0380] Certain embodiments in accordance with Formula I have the
structure:
##STR00159##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is
1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0381] Certain embodiments in accordance with Formula I have the
structure:
##STR00160##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3;
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0382] The administration of an AA targeting compound to an
immunocompetent individual may result in the production of
antibodies against the conjugate. Such antibodies may be directed
to the variable region, including the antibody idiotype, as well as
to the targeting agent or any linker used to conjugate the
targeting agent to the antibody. Reducing the immunogenicity of an
AA targeting compound can be accomplished by methods well known in
the art, such as by attaching long chain polyethylene glycol
(PEG)-based spacers and the like to the AA targeting compound. Long
chain PEG and other polymers are known for their ability to mask
foreign epitopes, resulting in the reduced immunogenicity of
therapeutic proteins that display foreign epitopes (N. V. Katre, J.
Immunol. 144:209-213 (1990); G. E. Francis et al., Int. J. Hematol.
68:1-18 (1998). Alternatively, or in addition, the individual
administered the antibody-AA targeting agent conjugate may be
administered an immunosuppressant such as cyclosporin A, anti-CD3
antibody, and the like.
[0383] In one embodiment, an AA targeting compound is as shown by
Formula II, and includes stereoisomers, tautomers, solvates,
prodrugs, and pharmaceutically acceptable salts thereof.
Antibody-L'-[AA targeting agent] (II)
[0384] In compounds of Formula II, [AA targeting agent] is defined
as in Formula I. L is a linker moiety linking an antibody to the
targeting agent and having the formula --X--Y-Z-. In compounds of
Formula II, X and Y are defined as in Formula I, and Antibody is an
antibody as defined herein. FIGS. 10 and 11, respectively,
illustrate the addition mechanism of a reactive, nucleophilic side
chain in a combining site of an antibody to the Z moieties
illustrated in FIGS. 8 and 9.
[0385] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00161##
[0386] wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0387] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00162##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0388] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00163##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0389] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00164##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0390] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00165##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0391] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00166##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0392] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00167##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0393] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00168##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0394] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z-Antibody has the structure:
##STR00169##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0395] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00170##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0396] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00171##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0397] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00172##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0398] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00173##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0399] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00174##
wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0400] In certain embodiments, wherein Antibody is an aldolase
catalytic antibody, Z'-Antibody has the structure:
##STR00175##
[0401] wherein HN-Antibody refers to an arbitrary side chain in the
combining site of an antibody bearing an amino group.
[0402] In compounds having Formula II, Z' is an attachment moiety
comprising a covalent bond and 0-20 carbon atoms to which the
Antibody is attached. This is shown below for the case where the
linker has a diketone moiety as the reactive group and linkage
occurs with the side chain amino group of a lysine residue in the
antibody combining site. The Antibody is shown schematically as
bivalent with a reactive amino acid side chain for each combining
site indicated.
##STR00176##
[0403] Another embodiment shown below is for the case where the
linker has a beta lactam moiety as the reactive group and linkage
occurs with the side chain amino group of a lysine residue in the
antibody combining site. The Antibody is shown schematically as
bivalent with a reactive amino acid side chain for each combining
site indicated.
##STR00177##
[0404] Certain embodiments in accordance with Formula II have the
structure:
##STR00178##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 2 or 3.
[0405] Certain embodiments in accordance with Formula II have the
structure:
##STR00179##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0406] Certain embodiments in accordance with Formula II have the
structure:
##STR00180##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; and p is 1, 2, 3, 4, or 5;
and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
0; t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some
embodiments, v is o; t is 1 or 2; w is 1; and p is 1 or 2.
[0407] Certain embodiments in accordance with Formula II have the
structure:
##STR00181##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
1, 2, or 3; w is 1, 2, or 3; and q is 0, 1, 2, 3. In some
embodiments, v is 1 or 2; w is 1 or 2; and q is 1 or 2.
[0408] Certain embodiments in accordance with Formula II have the
structure:
##STR00182##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; q is 0, 1, 2, or 3; and R.sup.b is hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
1, 2, or 3; w is 1, 2, or 3; and q is 0, 1, 2, 3. some embodiments,
v is 1 or 2; w is 1 or 2; and q is 2 or 3.
[0409] Certain embodiments in accordance with Formula II have the
structure:
##STR00183##
In certain of these embodiments, v is 1, 2, 3, 4, or 5; w is 1, 2,
3, 4, or 5; and R.sup.b is hydrogen, substituted or unsubstituted
C.sub.1-10 alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, v is 1, 2, or 3; and
w is 1, 2, or 3. In some embodiments, v is 1 or 2 and w is 1 or
2.
[0410] Certain embodiments in accordance with Formula II have the
structure:
##STR00184##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0411] Certain embodiments in accordance with Formula II have the
structure:
##STR00185##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted Cl alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0; t is 1, 2, 3,
4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or 3. In some
embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or 2; and q is
2 or 3.
[0412] Certain embodiments in accordance with Formula II have the
structure:
##STR00186##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
and s is 3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1;
and s is 1 or 2.
[0413] Certain embodiments in accordance with Formula II have the
structure:
##STR00187##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0414] Certain embodiments in accordance with Formula II have the
structure:
##STR00188##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0415] Certain embodiments in accordance with Formula II have the
structure:
##STR00189##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0416] Certain embodiments in accordance with Formula II have the
structure:
##STR00190##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0417] Certain embodiments in accordance with Formula II have the
structure:
##STR00191##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0418] Certain embodiments in accordance with Formula II have the
structure:
##STR00192##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
and s is 3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1;
and s is 1 or 2.
[0419] Certain embodiments in accordance with Formula II have the
structure:
##STR00193##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0420] Certain embodiments in accordance with Formula II have the
structure:
##STR00194##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0421] Certain embodiments in accordance with Formula II have the
structure:
##STR00195##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence are independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0422] Certain embodiments in accordance with Formula II have the
structure:
##STR00196##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3 and q is 0, 1, 2, or 3. In some embodiments, v is O; t is
1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0423] Certain embodiments in accordance with Formula II have the
structure:
##STR00197##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3
and q is 0, 1, 2, or 3. In some embodiments, v is O; t is 1, 2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0424] Certain embodiments in accordance with Formula II have the
structure:
##STR00198##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, v is 0; t is 1,2, or 3, r is 1; and s is 1 or 2.
[0425] Certain embodiments in accordance with Formula II have the
structure:
##STR00199##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0426] Certain embodiments in accordance with Formula II have the
structure:
##STR00200##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0427] Certain embodiments in accordance with Formula II have the
structure:
##STR00201##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0428] Certain embodiments in accordance with Formula II have the
structure:
##STR00202##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0429] Certain embodiments in accordance with Formula II have the
structure:
##STR00203##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted Cl alkyl, substituted or unsubstituted C.sub.3-7
cycloalkyl-C.sub.0-6 alkyl, or substituted or unsubstituted
aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0; t is 1, 2, 3,
4, 5, or 6; r is 1 or 2; s is 3 and q is 0, 1, 2, or 3. In some
embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or 2; and q is
2 or 3.
[0430] Certain embodiments in accordance with Formula II have the
structure:
##STR00204##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
and s is 3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1;
and s is 1 or 2.
[0431] Certain embodiments in accordance with Formula II have the
structure:
##STR00205##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0432] Certain embodiments in accordance with Formula II have the
structure:
##STR00206##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0433] Certain embodiments in accordance with Formula II have the
structure:
##STR00207##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0434] Certain embodiments in accordance with Formula II have the
structure:
##STR00208##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3 and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1,
2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0435] Certain embodiments in accordance with Formula II have the
structure:
##STR00209##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0436] Certain embodiments in accordance with Formula II have the
structure:
##STR00210##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, v is 0; t is 1,2, or 3, r is 1; and s is 1 or 2.
[0437] Certain embodiments in accordance with Formula II have the
structure:
##STR00211##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0438] Certain embodiments in accordance with Formula II have the
structure:
##STR00212##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0439] Certain embodiments in accordance with Formula II have the
structure:
##STR00213##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0440] Certain embodiments in accordance with Formula II have the
structure:
##STR00214##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is o; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0441] Certain embodiments in accordance with Formula II have the
structure:
##STR00215##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1,2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0442] Certain embodiments in accordance with Formula II have the
structure:
##STR00216##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
and s is 3. In some embodiments, v is 0; t is 1,2, or 3, r is 1;
and s is 1 or 2.
[0443] Certain embodiments in accordance with Formula II have the
structure:
##STR00217##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q is 0, 1, 2, or 3. In some embodiments, v is o; t is 1 or
2; w is 1; p is 1 or 2; and q is 1 or 2.
[0444] Certain embodiments in accordance with Formula II have the
structure:
##STR00218##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0445] Certain embodiments in accordance with Formula II have the
structure:
##STR00219##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is 0; t is 1 or 2; w is 1; and p is 1 or 2.
[0446] Certain embodiments in accordance with Formula II have the
structure:
##STR00220##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-40 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 1 or 2.
[0447] Certain embodiments in accordance with Formula II have the
structure:
##STR00221##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b is hydrogen, substituted or
unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3; and q is 0, 1, 2, or
3. In some embodiments, v is 0; t is 1, 2, or 3, r is 1; s is 1 or
2; and q is 2 or 3.
[0448] Certain embodiments in accordance with Formula II have the
structure:
##STR00222##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b is hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
and s is 3. In some embodiments, v is 0; t is 1,2, or 3, r is 1;
and s is 1 or 2.
[0449] Certain embodiments in accordance with Formula II have the
structure:
##STR00223##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is
3; and q iso, 1,2, or 3. In some embodiments, v is 0; t is 1 or 2;
w is 1; p is 1 or 2; and q is 1 or 2.
[0450] Certain embodiments in accordance with Formula II have the
structure:
##STR00224##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; q
is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; w is 1; p is 3; and
q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1 or 2; w is
1; p is 1 or 2; and q is 2 or 3.
[0451] Certain embodiments in accordance with Formula II have the
structure:
##STR00225##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; w is 1, 2, 3, 4, or 5; p is 1, 2, 3, 4, or 5; and
R.sup.b at each occurrence is independently hydrogen, substituted
or unsubstituted C.sub.1-10 alkyl, substituted or unsubstituted
C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted or
unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is 0;
t is 1, 2, 3, 4, 5, or 6; w is 1; and p is 3. In some embodiments,
v is o; t is 1 or 2; w is 1; and p is 1 or 2.
[0452] Certain embodiments in accordance with Formula II have the
structure:
##STR00226##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, 3, 4, or 5; and R.sup.b at each occurrence is
independently hydrogen, substituted or unsubstituted C.sub.1-10
alkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6
alkyl, or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In
certain embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2;
s is 3; and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is
1,2, or 3, r is 1; s is 1 or 2; and q is 1 or 2.
[0453] Certain embodiments in accordance with Formula II have the
structure:
##STR00227##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
q is 0, 1, 2, or 3; and R.sup.b at each occurrence is independently
hydrogen, substituted or unsubstituted C.sub.1-10 alkyl,
substituted or unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl,
or substituted or unsubstituted aryl-C.sub.0-6 alkyl. In certain
embodiments, v is 0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; s is 3;
and q is 0, 1, 2, or 3. In some embodiments, v is 0; t is 1,2, or
3, r is 1; s is 1 or 2; and q is 2 or 3.
[0454] Certain embodiments in accordance with Formula II have the
structure:
##STR00228##
In certain of these embodiments, v is 0, 1, 2, 3, 4, or 5; t is 1,
2, 3, 4, 5, or 6; r is 1, 2, 3, 4, or 5; s is 0, 1, 2, 3, 4, or 5;
and R.sup.b at each occurrence is independently hydrogen,
substituted or unsubstituted C.sub.1-10 alkyl, substituted or
unsubstituted C.sub.3-7 cycloalkyl-C.sub.0-6 alkyl, or substituted
or unsubstituted aryl-C.sub.0-6 alkyl. In certain embodiments, v is
0; t is 1, 2, 3, 4, 5, or 6; r is 1 or 2; and s is 3. In some
embodiments, v is 0; t is 1,2, or 3, r is 1; and s is 1 or 2.
[0455] Alternatively, the linker may have an amine or hydrazide as
the reactive group and the Antibody may be engineered to have a
diketone moiety. An unnatural diketone-containing amino acid may be
readily incorporated into an antibody combining site using
techniques well known in the art; proteins containing unnatural
amino acids have been produced in yeast and bacteria. See, e.g., J.
W. Chin et al., Science 301:964-966 (2003); L. Wang et al., Science
292:498-500 (2001); J. W. Chin et al., J. Am. Chem. Soc.
124:9026-9027 (2002); L. Wang, et al., J. Am. Chem. Soc.
124:1836-1837 (2002); J. W. Chin and P. G. Schultz, Chembiochem.
3:1135-1137 (2002); J. W. Chin et al., Proc. Natl. Acad. Sci.
U.S.A. 99:11020-11024 (2002); L. Wang and P. G. Schultz, Chem.
Commun. (1):1-11 (2002); Z. Zhang et al., Angew. Chem. Int. Ed.
Engl. 41:2840-2842 (2002); L. Wang, Proc. Natl. Acad. Sci. U.S.A.
100:56-61 (2003). Thus, for example, to insert an unnatural amino
acid containing a diketone moiety into the yeast Saccharomyces
cerevisiae requires the addition of new components to the protein
biosynthetic machinery including a unique codon, tRNA, and
aminoacyl-tRNA synthetase (aa RS). For example, the amber
suppressor tyrosyl-tRNA synthetase (TyrRS)-tRNA.sub.CUA pair from
E. coli may be used as reported for eukaryotes in J. W. Chin et
al., Science 301:964-966 (2003). The amber codon is used to code
for the unnatural amino acid of interest. Libraries of mutant TyrRS
and tRNA.sub.CUA may then be produced and selected for those
aaRS-tRNA.sub.CUA pairs in which the TyrRS charges the tRNA.sub.CUA
with the unnatural amino acid of interest, e.g., the
diketone-containing amino acid. Subsequently, antibodies
incorporating the diketone-containing amino acid may be produced by
cloning and expressing a gene containing the amber codon at one or
more antibody combining sites.
[0456] In some embodiments of compounds of Formula II, the Antibody
is a full length antibody. In other embodiments, the Antibody is
Fab, Fab' F(ab').sub.2, Fv, V.sub.H, V.sub.L, or scFv. In certain
embodiments, the Antibody is a human antibody, humanized antibody
or chimeric human antibody. In certain embodiments, the Antibody is
a catalytic antibody. In one embodiment, the Antibody is a
humanized version of a murine 38c2 comprising a constant region
from a human IgG, IgA, IgM, IgD, or IgE antibody. In another
embodiment, Antibody is a chimeric antibody comprising the variable
region from murine 38c2 and a constant region from a human IgG,
IgA, IgM, IgD, or IgE antibody.
[0457] In some cases, two or more AA targeting agents may be linked
to a single full length bivalent Antibody. This is shown below as
Formula III:
Antibody[-L'-[AA targeting agent]].sub.2 (III)
Also provided are stereoisomers, tautomers, solvates, prodrugs, and
pharmaceutically acceptable salts thereof.
[0458] In compounds of Formula III, [AA targeting agent], L' and
Antibody are each defined as in Formula II.
[0459] Targeting compounds such as those of Formula II may also be
readily synthesized by covalently linking a targeting agent-linker
compound as described herein to a combining site of a multivalent
antibody. For example, an AA targeting-agent linker conjugate,
where the linker includes a diketone reactive moiety, can be
incubated with 0.5 equivalents of an aldolase antibody, such as
h38C2 IgG1 to produce an AA targeting compound. Alternatively, an
AA targeting compound such as those of Formula III may be produced
by covalently linking an AA targeting agent-linker compound as
described herein to each combining site of a bivalent antibody.
Methods of Use for AA Targeting Compounds
[0460] One aspect of the invention provides methods for modulating
thrombospondin activity in vivo comprising administering an
effective amount of an AA targeting compound as described herein to
a subject. There are further provided methods for treating abnormal
angiogenesis or an angiogenesis-mediated condition in a subject.
Such methods include administering to the subject a therapeutically
effective amount of an AA targeting compound as described herein.
As used herein, an angiogenesis-mediated condition is a condition
that is caused by abnormal angiogenesis activity or one in which
compounds that modulate angiogenesis activity have therapeutic use.
Diseases and conditions that may be treated include cancer,
arthritis, psoriasis, angiogenesis of the eye associated with
infection or surgical intervention, macular degeneration or
diabetic retinopathy. In particular, methods of treating cancer
include carcinomas of the breast, colon, rectum, lung, oropharynx,
hypopharynx, esophagus, stomach, pancreas, liver, gallbladder and
bile ducts, small intestine, urinary tract, female genital tract,
male, genital tract, endocrine glands, and skin; hemangiomas;
melanomas; sarcomas; tumors of the brain, nerves, eyes, and
meninges; leukemia; or lymphoma.
Pharmaceutical Compositions and Methods of Administration
[0461] Another aspect of the invention provides pharmaceutical
compositions of the AA targeting compounds. The AA targeting
compounds can be mixed with pharmaceutically-acceptable carriers to
form a pharmaceutical composition for administration to a cell or
subject, either alone, or in combination with one or more other
modalities of therapy.
[0462] A pharmaceutical composition is generally formulated to be
compatible with its intended route of administration. Those skilled
in the art will know that the choice of the pharmaceutical medium
and the appropriate preparation of the composition will depend on
the intended use and mode of administration. Examples of routes of
administration include parenteral (e.g. intravenous, intramuscular,
intramedullary, intradermal, subcutaneous), oral (e.g. inhalation,
ingestion), intranasal, transdermal (e.g. topical), transmucosal,
and rectal administration. Administration routes of AA targeting
compounds may also include intrathecal, direct intraventricular and
intraperitoneal delivery. The AA targeting compounds may be
administered through any of the parenteral routes either by direct
injection of the formulation or by infusion of a mixture of the
targeting AA compound formulation with an infusion matrix such as
normal saline, D5W, lactated Ringers solution or other commonly
used infusion media.
[0463] The AA targeting compounds may be administered using
techniques well known to those in the art. Preferably, agents are
formulated and administered systemically. Techniques for
formulation and administration may be found in "Remington's
Pharmaceutical Sciences," 18.sup.th Ed., 1990, Mack Publishing Co.,
Easton, Pa. For injection, AA targeting compounds may be formulated
in aqueous solutions, emulsions or suspensions. AA targeting
compounds are preferably formulated in aqueous solutions containing
physiologically compatible buffers such as citrate, acetate,
histidine or phosphate. Where necessary, such formulations may also
contain various tonicity adjusting agents, solubilizing agents
and/or stabilizing agents (e.g. salts such as sodium chloride or
sugars such as sucrose, mannitol, and trehalose, or proteins such
as albumin or amino acids such as glycine and histidine or
surfactants such as polysorbates (Tweens) or cosolvents such as
ethanol, polyethylene glycol and propylene glycol.
[0464] The pharmaceutical composition may contain formulation
materials for modifying, maintaining or preserving, for example,
the pH, osmolarity, viscosity, clarity, color, isotonicity, odor,
sterility, stability, rate of dissolution or release, adsorption or
penetration of the composition. Suitable formulation materials
include, but are not limited to, amino acids (such as glycine,
glutamine, asparagine, arginine or lysine); antimicrobials;
antioxidants (such as ascorbic acid, sodium sulfite or sodium
hydrogen-sulfite); buffers (such as borate, bicarbonate, Tris-HCl,
citrates, phosphates, other organic acids, chelating agents [such
as ethylenediamine tetraacetic acid (EDTA)]; solvents (such as
glycerin, propylene glycol or polyethylene glycol); sugar alcohols
(such as mannitol or sorbitol); suspending agents; surfactants or
wetting agents (such as pluronics, PEG, sorbitan esters,
polysorbates such as polysorbate 20, polysorbate 80, triton,
tromethamine, lecithin, cholesterol, tyloxapal); stability
enhancing agents (sucrose or sorbitol); tonicity enhancing agents
(such as alkali metal halides (preferably sodium or potassium
chloride, mannitol sorbitol); delivery vehicles; diluents;
excipients and/or pharmaceutical adjuvants. (Remington's
Pharmaceutical Sciences, 18th Edition, A. R. Gennaro, ed., Mack
Publishing Company, 1990).
[0465] When parenteral administration is contemplated, the
therapeutic compositions may be in the form of a pyrogen-free,
parenterally acceptable aqueous solution comprising an AA targeting
compound in a pharmaceutically acceptable vehicle. One vehicle for
parenteral injection is sterile distilled water in which an AA
targeting compound is formulated as a sterile, isotonic solution.
Yet another formulation can involve the formulation an AA targeting
compound with an agent, such as injectable microspheres,
bio-degradable particles, polymeric compounds (polylactic acid,
polyglycolic acid), beads, or liposomes, that provides for the
controlled or sustained release of the product which may then be
delivered via a depot injection. Hyaluronic acid may also be used,
and this may have the effect of promoting sustained duration in the
circulation. Other suitable means for the introduction of the
desired molecule include implantable drug delivery devices.
[0466] In another aspect, pharmaceutical formulations suitable for
parenteral administration may be formulated in aqueous solutions,
preferably in physiologically compatible buffers such as Hanks'
solution, Ringer's solution, or a physiologically buffered saline.
Aqueous injection suspensions may contain substances that increase
the viscosity of the suspension, such as sodium carboxymethyl
cellulose, sorbitol, or dextran. Suitable lipophilic solvents or
vehicles include fatty oils, such as sesame oil, or synthetic fatty
acid esters, such as ethyl oleate, triglycerides, or liposomes.
Non-lipid polycationic amino polymers may also be used for
delivery. Optionally, the suspension may also contain suitable
stabilizers or agents to increase the solubility of the compounds
and allow for the preparation of highly concentrated solutions.
[0467] The pharmaceutical composition to be used for in vivo
administration typically must be sterile. This may be accomplished
by filtration through sterile filtration membranes. Where the
composition is lyophilized, sterilization using this method may be
conducted either prior to or following lyophilization and
reconstitution. The composition for parenteral administration may
be stored in lyophilized form or in solution. In addition,
parenteral compositions generally are placed into a container
having a sterile access port, for example, an intravenous solution
bag or vial having a stopper pierceable by a hypodermic injection
needle.
[0468] Once the pharmaceutical composition has been formulated, it
may be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or a dehydrated or lyophilized powder. Such
formulations may be stored either in a ready-to-use form or in a
form (e.g., lyophilized) requiring reconstitution prior to
administration.
[0469] One embodiment is directed to kits for producing a
single-dose administration unit. The kits may each contain both a
first container having an AA targeting compound and a second
container having an aqueous formulation. Also included within the
scope of this invention are kits containing single and
multi-chambered pre-filled syringes.
[0470] In treating mammals, including humans, having a disorder
with an angiogenic component to the disorder, a therapeutically
effective amount of an AA targeting compound or a pharmaceutically
acceptable derivative is administered. The frequency of dosing will
depend upon the pharmacokinetic parameters of the AA targeting
compound in the formulation used. Typically, a composition is
administered until a dosage is reached that achieves the desired
effect. The composition may therefore be administered as a single
dose, or as multiple doses (at the same or different
concentrations/dosages) over time, or as a continuous infusion.
Routes and frequency of administration of a composition as well as
dosage may vary from individual to individual and may be readily
established using standard techniques. Further refinement of the
appropriate dosage is routinely made. Appropriate dosages may be
developed by one skilled in the art through the use of appropriate
dose-response data.
[0471] An appropriate dosage and treatment regimen provides the
active compound(s) in an amount sufficient to provide therapeutic
and/or prophylactic benefit. Such a response can be monitored by
establishing an improved clinical outcome (e.g. reduced number of
blood vessels in a target area, decreased tumor size or volume, in
treated patients as compared to non-treated patients. Typically, a
suitable dose is an amount of a compound that, when administered as
described herein, is capable of promoting an anti-angiogenesis
response, and/or is at least 10-50% above the basal or untreated
level.
[0472] In some embodiments, the most effective mode of
administration and dosage regimen for the invention compositions
depends upon the severity and course of the disease, the patient's
health and response to treatment, and the judgment of the treating
physician. Accordingly, the dosages of the invention compositions
should be titrated to the individual patient. An effective dose of
the compounds is in the range of from about 0.1 ug to about 40 mg
per kilogram per day. An AA targeting compound may be administered
as a daily intravenous infusion from about 0.1 mg/kg body weight to
about 15 mg/kg body weight. Accordingly, one embodiment provides a
dose of about 0.5 mg/kg body weight. Another embodiment provides a
dose of about 0.75 mg/kg body weight. Another embodiment provides a
dose of about 1.0 mg/kg body weight. Another embodiment provides a
dose of about 2.5 mg/kg body weight. Another embodiment provides a
dose of about 5 mg/kg body weight. Another embodiment provides a
dose of about 10.0 mg/kg body weight. Another embodiment provides a
dose of about 15.0 mg/kg body weight. Doses of an AA targeting
compound or a pharmaceutically acceptable derivative should be
administered in intervals of from about once per day to 2 times per
week, or alternatively, from about once every week to once per
month. In one embodiment, a dose is administered to achieve peak
plasma concentrations of an AA targeting compound or a
pharmaceutically acceptable derivative thereof from about 0.002
mg/ml to 30 mg/ml. This may be achieved by the sterile injection of
a solution of the administered ingredients in an appropriate
formulation (any suitable formulation solutions known to those
skilled in the art of chemistry may be used). Desirable blood
levels may be maintained by a continuous infusion of an AA
targeting compound as ascertained by plasma levels measured by a
validated analytical methodology.
[0473] One method for administering an AA targeting compound to an
individual comprises administering an AA targeting agent-linker
conjugate to the individual and allowing it to form a covalent
compound with a combining site of an appropriate antibody in vivo.
The antibody portion of an AA targeting compound that forms in vivo
may be administered to the individual before, at the same time, or
after administration of the targeting agent-linker conjugate. As
already discussed, an AA targeting agent may include a
linker/reactive moiety, or the antibody combining site may be
suitably modified to covalently link to the targeting agent.
Alternatively, or in addition, an antibody may be present in the
circulation of the individual following immunization with an
appropriate immunogen. For example, catalytic antibodies may be
generated by immunizing with a reactive intermediate of the
substrate conjugated to a carrier protein. See R. A. Lerner and C.
F. Barbas 3.sup.rd, Acta Chem. Scand. 50:672-678 (1996). In
particular, aldolase catalytic antibodies may be generated by
administering with keyhole limpet hemocyanin linked to a diketone
moiety as described by P. Wirsching et al., Science 270:1775-1782
(1995) (commenting on J. Wagner et al., Science 270:1797-1800
(1995)).
[0474] The invention also provides a method of visualizing or
localizing a thrombospondin receptor or anti-angiogenesis target
(i.e. AA-targeting agent receptor) in tissues and cells. In one
embodiment, biopsied tissues may be examined for presence of
AA-targeting agent receptor. In another embodiment,
neovascularization in a subject may be imaged by administering to
the subject an AA targeting agent or compound including a
detectable label. As used herein, the term "detectable label"
refers to any molecule which can be administered in vivo and
subsequently detected. Exemplary detectable labels include
radiolabels and fluorescent molecules. Exemplary radionuclides
include indium-111, technetium-99, carbon-11, and carbon-13.
Fluorescent molecules include, without limitation, fluorescein,
allophycocyanin, phycoerythrin, rhodamine, and Texas red.
Combination Therapies
[0475] The vasculature within a tumor generally undergoes active
angiogenesis, resulting in the continual formation of new blood
vessels to support the growing tumor. Such angiogenic blood vessels
are distinguishable from mature vasculature in that angiogenic
vasculature expresses unique endothelial cell surface markers,
including the .alpha.sub.v.beta.sub.3 integrin. (Brooks, Cell
79:1157-1164 (1994); WO 95/14714, Int. Filing Date Nov. 22, 1994)
and receptors for angiogenic growth factors (Mustonen and Alitalo,
J. Cell Biol. 129:895-898 (1995); Lappi, Semin. Cancer Biol.
6:279-288 (1995)).
[0476] The invention also includes administration of one or more AA
targeting agents in combination with one or more oncology
therapeutics, each being administered according to a regimen
suitable for that therapeutic. The components of the combination
therapy may be administered concurrently or non-concurrently. As
used herein, the terms "concurrently administered" and "concurrent
administration" encompass substantially simultaneous administration
of one or more AA targeting compounds and one other oncology
therapeutic.
[0477] As used herein, the term, "non-concurrent" administration
encompasses administering one or more AA targeting compounds at
different times, in any order, whether overlapping or not. This
includes, but is not limited to, sequential treatment (such as
pretreatment, post-treatment, or overlapping treatment) with the
components of the combination, as well as regimens in which the
drugs are alternated, or wherein one component is administered
long-term and the other(s) are administered intermittently.
Components may be administered in the same or in separate
compositions, and by the same or different routes of
administration.
[0478] Suitable oncology therapeutics and combinations that may be
used in combination with an AA targeting compounds are listed in
Tables 4-6.
TABLE-US-00009 TABLE 4 Approved oncology drugs and indications
Generic Trade Name Indication Company Aldesleukin Proleukin
Proleukin is indicated for the treatment of Chiron Corp adults with
metastatic renal cell carcinoma (metastatic RCC) and for the
treatment of adults with metastatic melanoma. Alemtuzumab Campath
Campath is indicated for the treatment of B- Millennium and cell
chronic lymphocytic leukemia (B-CLL) ILEX Partners, in patients who
have been treated with LP alkylating agents and who have failed
fludarabine therapy. Alitretinoin Panretin Topical treatment of
cutaneous lesions in Ligand patients with AIDS-related Kaposi's
Pharmaceuticals sarcoma. Allopurinol Zyloprim Patients with
leukemia, lymphoma and solid GlaxoSmithKline tumor malignancies who
are receiving cancer therapy which causes elevations of serum and
urinary uric acid levels and who cannot tolerate oral therapy.
Palonosetron Aloxi For the treatment of nausea MGI Pharmaceuticals
Altretamine Hexalen Single agent palliative treatment of patients
US Bioscience with persistent or recurrent ovarian cancer following
first-line therapy with a cisplatin and/or alkylating agent based
combination. Amifostine Ethyol To reduce the cumulative renal
toxicity US Bioscience associated with repeated administration of
cisplatin in patients with advanced ovarian cancer Amifostine
Ethyol Reduces platinum toxicity in non-small cell US Bioscience
lung cancer Amifostine Ethyol To reduce post-radiation xerostomia
for US Bioscience head and neck cancer where the radiation port
includes a substantial portion of the parotid glands. Anastrozole
Arimidex Adjuvant treatment of postmenopausal AstraZeneca women
with hormone receptor positive early breast cancer Anastrozole
Arimidex Treatment of advanced breast cancer in AstraZeneca
postmenopausal women with disease Pharmaceuticals progression
following tamoxifen therapy. Anastrozole Arimidex For first-line
treatment of postmenopausal AstraZeneca women with hormone receptor
positive or Pharmaceuticals hormone receptor unknown locally
advanced or metastatic breast cancer. Nelarabine Arranon For the
treatement of T cell acute GlaxoSmithKline lymphoblatic leukemia
Arsenic Trisenox Second line treatment of relapsed or Cell
Therapeutic trioxide refractory APL following ATRA plus an
anthracycline. Asparaginase Elspar ELSPAR is indicated in the
therapy of Merck & Co, Inc patients with acute lymphocytic
leukemia. This agent is useful primarily in combination with other
chemotherapeutic agents in the induction of remissions of the
disease in pediatric patients. Bevacizumab Avastin For the
treatment of metastatic colorectal Genentech cancer Bexarotene
Targretin For the treatment by oral capsule of Ligand capsules
cutaneous manifestations of cutaneous T-cell Pharmaceuticals
lymphoma in patients who are refractory to at least one prior
systemic therapy. Bexarotene gel Targretin For the topical
treatment of cutaneous Ligand manifestations of cutaneous T-cell
Pharmaceuticals lymphoma in patients who are refractory to at least
one prior systemic therapy. Bleomycin Blenoxane Palliative agent
for the management of the Bristol-Myers following neoplasms: Squibb
Squamous Cell Carcinoma (head and neck including mouth, tongue,
tonsil, nasopharynx, oropharynx, sinus, palate, lip, buccal mucosa,
gingivae, epiglottis, skin, larynx, penis, cervix, and vulva.
Lymphomas (Hodgkin's Disease, non- Hodgkin's lymphoma). Testicular
Carcinoma (Embryonal cell, choriocarcinoma, and teratocarcinoma).
Bleomycin Blenoxane Sclerosing agent for the treatment of
Bristol-Myers malignant pleural effusion (MPE) and Squibb
prevention of recurrent pleural effusions. Busulfan Busulfex Use in
combination with cyclophoshamide Orphan Medical, intravenous as
conditioning regimen prior to allogeneic Inc. hematopoietic
progenitor cell transplantation for chronic myelogenous leukemia.
Busulfan oral Myleran Palliative therapy for Chronic Myelogenous
GlaxoSmithKline Leukemia - Calusterone Methosarb Synthetic androgen
for the treatment of Pharmacia & androgen sensitive cancers
Upjohn Company Capecitabine Xeloda Treatment of metastatic breast
cancer Roche resistant to both paclitaxel and an anthracycline
containing chemotherapy regimen or resistant to paclitaxel and for
whom further anthracycline therapy may be contraindicated, e.g.,
patients who have received cumulative doses of 400 mg/m2 of
doxorubicin or doxorubicin equivalents Capecitabine Xeloda Initial
therapy of patients with metastatic Roche colorectal carcinoma when
treatment with fluoropyrimidine therapy alone is preferred.
Combination chemotherapy has shown a survival benefit compared to
5-FU/LV alone. A survival benefit over 5_FU/LV has not been
demonstrated with Xeloda monotherapy. Capecitabine Xeloda Treatment
in combination with docetaxel of Roche patients with metastatic
breast cancer after failure of prior anthracycline containing
chemotherapy Carboplatin Paraplatin Palliative treatment of
patients with ovarian Bristol-Myers carcinoma recurrent after prior
Squibb chemotherapy, including patients who have been previously
treated with cisplatin. Carboplatin Paraplatin Initial chemotherapy
of advanced ovarian Bristol-Myers carcinoma in combination with
other Squibb approved chemotherapeutic agents. Carmustine BCNU,
Palliative therapy as a single agent or in Bristol-Myers BiCNU
established combination therapy with other Squibb approved
chemotherapeutic agents in the following: Brain tumors
(glioblastoma, brainstem glioma, medulloblastoma, astrocytoma,
ependymoma, and metastatic brain tumors); Multiple myeloma;
Hodgkin's Disease; and Non-Hodgkin's lymphomas. Carmustine Giladel
For use in addition to surgery to prolong Guilford with Wafer
survival in patients with recurrent Pharmaceuticals Polifeprosan
glioblastoma multiforme who qualify for Inc. 20 Implant surgery.
Celecoxib Celebrex Reduction of polyp number in patients with
Searle the rare genetic disorder of familial adenomatous polyposis.
Cetuximab Erbitux For the treatement of EGFR expressing metastatic
colorectal cancer Chlorambucil Leukeran Chronic Lymphocytic
Leukemia - palliative GlaxoSmithKline therapy Chlorambucil Leukeran
Treatment for CLL or indolent NHL. GlaxoSmithKline Cinacalchet
Sensipar For the treatment of secondary Amgen hypparathyroidism
Cisplatin Platinol Metastatic testicular-in established
Bristol-Myers combination therapy with other approved Squibb
chemotherapeutic agents in patients with metastatic testicular
tumors whoc have already received appropriate surgical and/or
radiotherapeutic procedures. An established combination therapy
consists of Platinol, Blenoxane and Velbam. Cisplatin Platinol
Metastatic ovarian tumors - in established Bristol-Myers
combination therapy with other approved Squibb chemotherapeutic
agents: Ovarian-in established combination therapy with other
approved chemotherapeutic agents in patients with metastatic
ovarian tumors who have already received appropriate surgical
and/or radiotherapeutic procedures. An established combination
consists of Platinol and Adriamycin. Platinol, as a single agent,
is indicated as secondary therapy in patients with metastatic
ovarian tumors refractory to standard chemotherapy who have not
previously received Platinol therapy. Cisplatin Platinol
Transitional cell bladder cancer which is no Bristol-Myers longer
amenable to local treatments such as Squibb surgery and/or
radiotherapy. Cladribine Leustatin, 2- Treatment of active hairy
cell leukemia. R.W. Johnson CdA Pharmaceutical Research Institute
Clofarabine Clolar Treatment for acute lymphblastic leukemia
Genzyme Cyclophosphamide Cytoxan, Treatment for ovary, breast,
bladder and Bristol-Myers Neosar CLL. Squibb Cytarabine Cytosar-U
Treatment for AML Pharmacia & Upjohn Company Cytarabine DepoCyt
Intrathecal therapy of lymphomatous Skye Liposomal meningitis
Pharmaceuticals Dacarbazine DTIC-Dome Treatment for melanoma and
Hodgkins Bayer lymphoma Dactinomycin, Cosmegan Treatment for
pediatric leukemias Merck actinomycin D Darbepoetin Aranesp
Treatment of anemia associated with chronic Amgen, Inc. alfa renal
failure. Darbepoetin Aranesp Aranesp is indicated for the treatment
of Amgen, Inc. alfa anemia in patients with non-myeloid
malignancies where anemia is due to the effect of concomitantly
administered chemotherapy. Daunorubicin DanuoXome First line
cytotoxic therapy for advanced, Nexstar, Inc. liposomal HIV related
Kaposi's sarcoma. Daunorubicin, Daunorubicin
Leukemia/myelogenous/monocytic/erythoid Bedford Labs' daunomycin of
adults/remission induction in acute lymphocytic leukemia of
children and adults. Daunorubicin, Cerubidine In combination with
approved anticancer Wyeth Ayerst daunomycin drugs for induction of
remission in adult ALL. Danileukin Ontak Treatment of patients with
persistent or Seragen, Inc. diftitox recurrent cutaneous T-cell
lymphoma whose malignant cells express the CD25 component of the
IL-2 receptor Dexrazoxane Zinecard Prevention of cardiomyopathy
associated Pharmacia & with doxorubicin administration Upjohn
Company Dexrazoxane Zinecard Used for reducing the incidence and
severity Pharmacia & of cardiomyopathy associated with Upjohn
Company doxorubicin administration in women with metastatic breast
cancer who have received a cumulative doxorubicin dose of 300 mg/m2
and who will continue to receive doxorubicin therapy to maintain
tumor control. Docetaxel Taxotere Treatment of patients with
locally advanced Aventis or metastatic breast cancer who have
Pharmaceutical progressed during anthracycline-based therapy or
have relapsed during anthracycline-based adjuvant therapy.
Docetaxel Taxotere For the treatment of locally advanced or Aventis
metastatic breast cancer which has Pharmaceutical progressed during
anthracycline-based treatment or relapsed during anthracycline-
based adjuvant therapy. Docetaxel Taxotera For locally advanced or
metastatic non-small Aventis cell lung cancer after failure of
prior Pharmaceutical platinum-based chemotherapy. Docetaxel
Taxotere Aventis Pharmaceutical Docetaxel Taxotere Used in
combination with cisplatin for the Aventis treatment of patients
with unresectable, Pharmaceutical locally advanced or metastatic
non-small cell lung cancer who have not previously
received chemotherapy for this condition. Doxorubicin Adriamycin
Antibiotic, antitumor agent. Pharmacia & PFS Injection Upjohn
Company intravenous injection Doxorubicin Doxil Treatment of
AIDS-related Kaposi's Sequus liposomal sarcoma in patients with
disease that has Pharmaceuticals, progressed on prior combination
Inc. chemotherapy or in patients who are intolerant to such
therapy. Doxorubicin Doxil Treatment of metastatic carcinoma of the
Sequus liposomal ovary in patient with disease that is
Pharmaceuticals, refractory to both paclitaxel and platinum Inc.
based regimens Dromostanolone Dromostanolone Sythetic androgen for
use in androgen Eli Lilly Propionate sensitve cancers Elliott's B
Elliott's B Diluent for the intrathecal administration of Orphan
Medical, Solution Solution methotrexate sodium and cytarabine for
the Inc. prevention or treatment of meningeal leukemia or
lymphocytic lymphoma. Epoetin Epogen EPOGEN is indicated for the
treatment of Amgen, Inc. alfa/beta anemia. Erlotinib Tarceva For
the treatment of advanced metatstaic OSI non-small cell lung cancer
Pharmaceuticals Estramustine Emcyt Palliation of prostate cancer
Pharmacia & Upjohn Company Etoposide Etopophos Management of
refractory testicular tumors, Bristol-Myers phosphate in
combination with other approved Squibb chemotherapeutic agents.
Etoposide Etopophos Management of small cell lung cancer, first-
Bristol-Myers phosphate line, in combination with other approved
Squibb chemotherapeutic agents. Etoposide Etopophos Management of
refractory testicular tumors Bristol-Myers phosphate and small cell
lung cancer. Squibb Etoposide, VP- Vepesid Refractory testicular
tumors-in combination Bristol-Myers 16 therapy with other approved
Squibb chemotherapeutic agents in patients with refractory
testicular tumors who have already received appropriate surgical,
chemotherapeutic and radiotherapeutic therapy. etoposide, VP-
VePesid In combination with other approved Bristol-Myers 16
chemotherapeutic agents as first line Squibb treatment in patients
with small cell lung cancer. Etoposide, VP- Vepesid In combination
with other approved Bristol-Myers 16 chemotherapeutic agents as
first line Squibb treatment in patients with small cell lung
cancer. Exemestane Aromasin Treatment of advance breast cancer in
Pharmacia & postmenopausal women whose disease has Upjohn
Company progressed following tamoxifen therapy. Filgrastim Neupogen
NEUPOGEN is indicated for reducing the Amgen, Inc. time to
neutrophil recovery and the duration of fever, following induction
or consolidation hemotherapy treatment of adults with AML.
Floxuridine FUDR An analog for 5-flurouracil. FUDR has been Roche
(intraarterial) approved in the directed treatment of liver
metastases using hepatic arterial infusion. Fludarabine Fludara
Palliative treatment of patients with B-cell Berlex lymphocytic
leukemia (CLL) who have not Laboratories Inc. responded or have
progressed during treatment with at least one standard alkylating
agent containing regimen. Fluorouracil, Adrucil Prolong survival in
combination with ICN Puerto Rico 5-FU leucovorin Fulvestrant
Faslodex the treatment of hormone receptor-positive IPR metastatic
breast cancer in postmenopausal women with disease progression
following antiestrogen therapy Gemcitabine Gemzar Treatment of
patients with locally advanced Eli Lilly (nonresectable stage II or
III) or metastatic (stage IV) adenocarcinoma of the pancreas.
Indicated for first-line treatment and for patients previously
treated with a 5- fluorouracil-containing regimen. Gemcitabine
Gemzar For use in combination with cisplatin for the Eli Lilly
first-line treatment of patients with inoperable, locally advanced
(Stage IIIA or IIIB) or metastatic (Stage IV) non-small cell lung
cancer. Gemtuzumab Mylotarg Treatment of CD33 positive acute
myeloid Wyeth Ayerst ozogamicin leukemia in patients in first
relapse who are 60 years of age or older and who are not considered
candidates for cytotoxic chemotherapy. Goserelin Zoladex Palliative
treatment of advanced breast AstraZeneca acetate implant cancer in
pre- and perimenopausal women. Pharmaceuticals Goserelin Zoladex
Used for treatement of prostate cancer AstraZeneca acetate
Pharmaceuticals Hydroxyurea Hydrea Decrease need for transfusions
in sickle cell Bristol-Myers anemia Squibb Ibritumomab Zevalin
Treatment of patients with relapsed or IDEC tiuxetan refractory
low-grade, follicular, or Pharmaceuticals transformed B-cell
non-Hodgkin's Corp. lymphoma, including patients with Rituximab
refractory follicular non- Hodgkin's lymphoma. Idarubicin Idamycin
For use in combination with other approved Adria antileukemic drugs
for the treatment of acute Laboratories myeloid leukemia (AML) in
adults. Idarubicin Idamycin In combination with other approved
Pharmacia & antileukemic drugs for the treatment of acute
Upjohn Company non-lymphocytic leukemia in adults. Ifosfamide IFEX
Third line chemotherapy of germ cell Bristol-Myers testicular
cancer when used in combination Squibb with certain other approved
antineoplastic agents. Imatinib Gleevec Initial therapy of chronic
myelogenous Novartis mesylate leukemia Imatrinib Gleevac Treatment
of metastatic or unresectable Novartis mesylate malignant
gastrointestinal stromal tumors Imatinib Gleevec Initial treatment
of newly diagnosed Ph+ Novartis mesylate chronic myelogenous
leukemia (CML). Interferon alfa- Roferon-A Treatment of chronic
Hoffmann-La 2a hepatitis C, hairy cell leukemia and AIDS- Roche
Inc. related Kaposi's sarcoma in adult patients and for chronic
phase, Philadelphia chromosome (Ph) positive chronic myelogenous
leukemia (CML) patients who are minimally pretreated (within 1 year
of diagnosis). Interferon alfa- Intron A Interferon alfa-2b,
recombinant for injection Schering Corp. 2b is indicated as
adjuvant to surgical treatment in patients 18 years of age or older
with malignant melanoma who are free of disease but at high risk
for systemic recurrence within 56 days of surgery. Interferon
alfa-2b, recombinant for Injection is indicated for the initial
treatment of clinically aggressive follicular Non- Hodgkin's
Lymphoma in conjunction with anthracycline-containing combination
chemotherapy in patients 18 years of age or older. Interferon
alfa-2b, recombinant for Injection is indicated for intralesional
treatment of selected patients 18 years of age or older with
condylomata acuminata involving external surfaces of the genital
and perianal areas. Interferon alfa-2b, recombinant for Injection
is indicated for the treatment of patients 18 years of age or older
with hairy cell leukemia. Interferon alfa-2b, recombinant for
Injection is indicated for the treatment of selected patients 18
years of age or older with AIDS- Related Kaposi's Sarcoma. The
likelihood of response to INTRON A therapy is greater in patients
who are without systemic symptoms, who have limited lymphadenopathy
and who have a relatively intact immune system as indicated by
total CD4 count. Irinotecan Camptosar Treatment of patients with
metastatic Pharmacia & carcinoma of the colon or rectum whose
Upjohn Company disease has recurred or progressed following
5-FU-based therapy. Letrozole Femara First-line treatment of
postmenopausal Novartis women with hormone receptor positive or
hormone receptor unknown locally advanced or metastatic breast
cancer. Letrozole Femara Used for treatment of post-menopausal
Novartis women with early stage breast cancer Leucovorin
Wellcovorin, Leucovorin calcium is indicated fro use in Immunex
Leucovorin combination with 5-fluorouracil to prolong Corporation
survival in the palliative treatment of patients with advanced
colorectal cancer. Leucovorin Leucovorin In combination with
fluorouracil to prolong Lederle survival in the palliative
treatment of laboratories patients with advanced colorectal cancer.
Levamisole Ergamisol Adjuvant treatment in combination with 5-
Janssen Research fluorouracil after surgical resection in
Foundation patients with Dukes' Stage C colon cancer. Lomustine,
CeeNu An alkylating agent used for the treatment of Bristol-Myers
CCNU brain cancer and NHL. Squibb Meclorethamine, Mustargen A
nitrogen mustard used in the treatment of Merck nitrogen lymphoma.
mustard Megestrol Megace A synthetic progesterone used for the
Bristol-Myers acetate treatment of estrogen sensitive cancers.
Squibb Melphalan, L- Alkeran Systemic administration for palliative
GlaxoSmithKline PAM treatment of patients with multiple myeloma for
whom oral therapy is not appropriate. Mercaptopurine, Purinethol
Purinethol is indicated for remission GlaxoSmithKline 6-MP
induction and maintenance therapy of acute lymphatic leukemia.
Mesna Mesnex Prevention of ifosfamide-induced Asta Medica
hemorrhagic cystitis Methotrexate Methotrexate Is used to treat
cancer of the breast, head and Laderle neck, lung, blood, bone, and
lymph, and Laboratories tumors in the uterus. Methoxsalen Uvadex
For the use of UVADEX with the UVAR Therakos Photopheresis System
in the palliative treatment of the skin manifestations of cutaneous
T-cell lymphoma (CTCL) that is unresponsive to other forms of
treatment. Mitromycin C Mitozytrex Therapy of disseminated
adenocarcinoma of Supergen the stomach or pancreas in proven
combinations with other approved chemotherapeutic agents and as
palliative treatment when other modalities have failed. Mitotane
Lysodren Used for the treatment of adrenal cancers. Bristol-Myers
Squibb Mitoxantrone Novantrone For use in combination with
corticosteroids Immunex as initial chemotherapy for the treatment
of Corporation patients with pain related to advanced
hormone-refractory prostate cancer. Mitoxantrone Novantrone For use
with other approved drugs in the Laderle initial therapy for acute
nonlymphocytic Laboratories leukemia (ANLL) in adults. Nandrolone
Durabolin- It is indicated as a treatment for palliation of Organon
phenpropionate 509 inoperable metastatic breast cancer in
postmenopausal women. Nofetumomab Verluma Verluma is a monoclonal
antibody Fab Boehringer fragment linked to .sup.99mTc. Verluma
identifies Ingelheim advanced-stage disease in patients with Pharma
KG small-cell lung cancer (SCLC). (formerly Dr. Karl Thomae GmbH)
Oprelvekin Neumega Neumega is indicated for the prevention of
Genetics severe thrombocytopenia and the reduction Institute, Inc.
of the need for platelet transfusions following myelosuppressive
chemotherapy in adult patients with nonmyeloid malignancies who are
at high risk of severe thrombocytopenia.
Oxaliplatin Eloxatin Used) in combination with infusional 5- Sanofi
FU/LV, is indicated for the treatment of Synthelabo patient with
metastatic carcinoma of the colon or rectum whose disease has
recurred or progressed during or within 6 months of completion of
first line therapy with the combination of bolus 5-FU/LV and
irinotecan. Paclitaxel Paxene Treatment of advanced AIDS-related
Baker Norton Kaposi's sarcoma after failure of first line or
Pharmaceuticals, subsequent systemic chemotherapy Inc. Paclitaxel
Taxol Treatment of patients with metastatic Bristol-Myers carcinoma
of the ovary after failure of first- Squibb line or subsequent
chemotherapy. Treatment of breast cancer after failure of
combination chemotherapy for metastatic disease or relapse within 6
months of adjuvant chemotherapy. Prior therapy should have included
an anthracycline unless clinically contraindicated. New dosing
regimen for patients who have failed initial or subsequent
chemotherapy for metastatic carcinoma of the ovary Second line
therapy for AIDS related Kaposi's sarcoma. For first-line therapy
for the treatment of advanced carcinoma of the ovary in combination
with cisplatin. For use in combination with cisplatin, for the
first-line treatment of non-small cell lung cancer in patients who
are not candidates for potentially curative surgery and/or
radiation therapy. For the adjuvant treatment of node-positive
breast cancer administered sequentially to standard
doxorubicin-containing combination therapy. First line ovarian
cancer with 3 hour infusion. Pamidronate Aredia Treatment of
osteolytic bone metastases of Novartis breast cancer in conjunction
with standard antineoplastic therapy. Pegademase Adagen Enzyme
replacement therapy for patients Enzon (Pegademase with severe
combined immunodeficiency asa Bovine) result of adenosine deaminase
deficiency. Pegaspargase Oncaspar PEG asparginase used in the
treatment of Enzon, Inc. ALL. Pegfilgrastim Neulasta Neulasta is
indicated to decrease the Amgen, Inc. incidence of infection, as
manifested by febrile neutropenia, in patients with non- myeloid
malignancies receiving myelosuppressive anti-cancer drugs
associated with a clinically signifficant incidence of febrile
neutropenia. Pemetrexed Alimta Treatment of malignant pleural Eli
Lilly mesothelioma Pentostatin Nipent Single agent treatment for
adult patients with Parke-Davis alpha interferon refractory hairy
cell Pharmaceutical leukemia. Co. Pipobroman Vercyte Used in the
treatment of CRC. Abbott Labs Plicamycin, Mithracin Used in the
treatment of testicular cancer. Pfizer Labs mithramycin Porfimer
Photofrin For use in photodynamic therapy (PDT) for QLT sodium
palliation of patients with completely Phototherapeutics
obstructing esophageal cancer, or patients Inc. with partially
obstructing esophageal cancer who cannot be satisfactorily treated
with ND-YAG laser therapy. For use in photodynamic therapy for
treatment of microinvasive endobronchial nonsmall cell lung cancer
in patients for whom surgery and radiotherapy are not indicated.
For use in photodynamic therapy (PDT) for reduction of obstruction
and palliation of symptoms in patients with completely or partially
obstructing endobroncial nonsmall cell lung cancer (NSCLC).
Procarbazine Matulane One component of the MOPP regime. Sigma Tau
Pharms Rasburicase Elitek ELITEK is indicated for the initial
Sanofi- management of plasma uric acid levels in Synthelabo, Inc.
pediatric patients with leukemia, lymphoma, and solid tumor
malignancies who are receiving anti-cancer therapy expected to
result in tumor lysis and subsequent elevation of plasma uric acid.
Rituximab Rituxan Used in the treatment NHL. Genentech, Inc.
Sargramostim Prokine GM-CSF used in the treatment of NHL, Immunex
Corp. Hodgkins Leukemia and acute lymphoblastic leukemia. Sorafenib
Nexavar Treatment of RCC Bayer/Onyx Streptozocin Zanosar
Antineoplastic agent. Pharmacia & Upjohn Company Talc Slerosol
For the prevention of the recurrence of Bryan malignant pleural
effusion in symptomatic patients. Tamoxifen Nolvadex As a single
agent to delay breast cancer AstraZeneca recurrence following total
mastectomy and Pharmaceuticals axillary dissection in
postmenopausal women with breast cancer (T1-3, N1, M0). For use in
premenopausal women with metastatic breast cancer as an alternative
to oophorectomy or ovarian irradiation. For use in women with
axillary node- negative breast cancer adjuvant therapy. Metastatic
breast cancer in men. Temozolomide Temodar For treatment of adult
patients with Scherine refractory anaplastic astrocytoma, i.e.,
patients at first relapse with disease progression on a nitrosourea
and procarbazine containing regimen Teniposide, Vumon In
combination with other approved Bristol-Myers VM-26 anticancer
agents for induction therapy in Squibb patients with refractory
childhood acute lymphoblastic leukemia (all). Testolactone Teslac
Used in the treatment of breast cancer. Bristol-Myers Squibb
Thioguanine, Thioguanine Antimetabolite used in the treatment of
GlaxoSmithKline 6-TG AML, CML, CLL. Thiotepa Thioplex Thiotepa is a
cytotoxic agent of the Immunex polyfunctional type, related
chemically and Corporation pharmacologically to nitrogen mustard.
Thiotepa has been tried with varying results in the palliation of a
wide variety of neoplastic diseases. However, the most consistent
results have been seen in the following tumors: 1. Adenocarcinoma
of the breast. 2. Adenocarcinoma of the ovary. 3. For controlling
intracavitary effusions secondary to diffuse or localized
neoplastic diseases of various serosal cavities. 4. For the
treatment of superficial papillary carcinoma of the urinary
bladder. While now largely superseded by other treatments, thiotepa
has been effective against other lymphomas, such as lymphosarcoma
and Hodgkin's disease. Topotecan Hycamtin Treatment of patients
with metastatic GlaxoSmithKline carcinoma of the ovary after
failure of initial or subsequent chemotherapy. Treatment of small
cell lung cancer sensitive disease after failure of first-line
chemotherapy. Toremifene Fareston Treatment of advanced breast
cancer in Chiron Corp. postmenopausal women. Tositumomab Bexxar
Accel. Approv. (clinical benefit not Corixa established) Treatment
of patients with Corporation CD20 positive, follicular,
non-Hodgkin's lymphoma, with and without transformation, whose
disease is refractory to Rituximab and has relapsed following
chemotherapy Trastuzumab Herceptin HERCEPTIN as a single agent is
indicated Genentech, Inc. for the treatment of patients with
metastatic breast cancer whose tumors overexpress the HER2 protein
and who have received one or more chemotherapy regimens for their
metastatic disease. Herceptin in combination with paclitaxel is
indicated for treatment of patients with metastatic breast cancer
whose tumors. overexpress the HER-2 protein and had not received
chemotherapy for their metastatic disease Tretinoin, Vesanoid
Induction of remission in patients with acute Roche ATRA
promyelocytic leukemia (APL) who are refractory to or unable to
tolerate anthracycline based cytotoxic chemotherapeutic regimens.
Uracil Mustard Uracil Used in the treatment of CML, NHL and Roberts
Labs Mustard CLL. Capsules Valrubicin Valstar For intravesical
therapy of BCG-refractory Anthra .fwdarw. carcinoma in situ (CIS)
of the urinary Medeva bladder in patients for whom immediate
cystectomy would be associated with unacceptable morbidity or
mortality. Vinblastine Velban Vinca alkyloid used in the treatment
of Eli Lilly many types of cancer. Vincristine Oncovin Vinca
alkyloid used in the treatment of Eli Lilly many types of cancer.
Vinorelbine Navelbine Single agent or in combination with cisplatin
GlaxoSmithKline for the first-line treatment of ambulatory patients
with unresectable, advanced non- small cell lung cancer (NSCLC).
Vinorelbine Navelbine Navelbine is indicated as a single agent or
in GlaxoSmithKline combination with cisplatin for the first-line
treatment of ambulatory patients with unreseactable, advanced
non-small cell lung cancer (NSCLC). In patients with Stage IV
NSCLC, Navelbine is indicated as a single agent or in combination
with cisplatin. In Stage III NSCLC, Navelbine is indicated in
combination with cisplatin. Zoledronate Zometa Used in the
treatment of patients with Novartis multiple myeloma and patients
with documented bone metastases from solid tumors, in conjunction
with standard antineoplastic therapy. Prostate cancer should have
progressed after treatment with at least one hormonal therapy
TABLE-US-00010 TABLE 5 Advanced antiangiogenic compounds in the
clinic Clinical Product Mechanism of Action Phase Marketing Co.
Sorafenib Inhibits VEGFR2, VEGFR3, Raf Kinase and Pre- Bayer/Onyx
PDGFRa registration Sutent Inhibits VEGFR1, VEGFR2, VEGFR3, Pre-
Pfizer PDGFR, CSF-1, Fit-3, and C-Kit registration Thalomid
Antiangiogenic compound of unknown III Celgene mechanism of action
Revlimid Antiangiogenic compound of unknown III Celgene mechanism
of action Vatalanib Inhibits VEGFR1, VEGFR2, VEGFR3, III
Novartis/Schering PDGFR, and C-Kit ZD-6474 Inhibits VEGFR2, and
EGFR III AstraZeneca Neovastat Liquid extract derived from Shark
cartilage that III AEterna blocks VEGFR2 and inhibits MMP-1, MMP-9
and MMP-12 GSK-786024 Inihibits VEGFR1, VEGFR2 and VEGFR3 II
GlaxoSmithKline AEE-788 Inhibits EGFR, HER2 and VEGFR II Novartis
AG-13736 Inihibits VEGFR1, VEGFR2 and PDGF II Pfizer AMG706
Inhibits VEGFR1, VEGFR2, VEGFR3, II Amgen PDGFR, Ret, and C-Kit
AZD-2171 Inhibits VEGFR1, VEGFR2, VEGFR3, and II AstraZeneca EGFR
BIBF-1120 Inhibits VEGFR, FGFR, and PDGFR II Boehringer Ingelheim
CP-547,632 Inhibits VEGFR1 and VEGFR2 II Pfizer/OSI Pharma
Midostaurin Inhibits FLT3 Kinase, VEGFR2, and various II Novartis
PKC kinases SU-6668 Inhibits VEGFR1, PDGF and FGFR II Pfizer/Taiho
CDP-791 Inhibits VEFR2 II UCB/Imclone Systems PI-88 Inhibits
heparinase, binds to VEGF, FGF1, II Progen FGF2 and stimulates the
release of TFP1 PCK-3145 Binds to laminin receptor and VEGFR2, and
II Procyon Biopharma downregulates MMP9 expression Atiprimod
Inhibits IL6 and VEGF secretion II Callisto Pharmaceuticals A6
Eight amino acid, uPA derived peptide that II Angstrom inhibits the
activity of uPAR Pharmaceuticals Angiostatin Peptidic angiostatin
inhibitor that is a fragment II Alchemgen of the clotting factor
plasminogen Therapeutics Cilengitide Cyclic Peptide that is an
alpha-v integrin II Merck antagonist Enodstatin Peptidic
angiogenesis inhibitor based Collagen II Alchemgen XVIII fragment
Therapeutics rPF4 Recombinant form of Platlet Factor 4 II Repligen
Clinical Partners Vitakin Antibody antagonist of alpha-v-beta-3
ingrins II MedImmune Volociximab Antibody antagonist of
alpha-v-beta-3 ingrins II Biogen Idec/Protein Design Labs
2-methoxyestradiol Estrogen metabolite that inhibits HIF1a II
EntreMed translation AP-23573 Inhibits mTOR II Ariad
Pharmaceuticals Cancertinib TKI that inhibits EGFR II Pfizer
Actimid Thalomid derivative II Celgene Combretastatin A4 Tubulin
destabilizing agent II Oxigene prodrug Endo Tag 1
Antineovasculature agent, formation of II Medigene paclitaxel
encapsulated in positively charged liposomes Enzastaurin Protein
kinase C-beta inhibitor II Eli Lilly Ceflatonin Induces apoptosis
II ChemGenex Pharmaceuticals Silipide A complex of silybin and
phosphatidiylcholine II Indena INGN-241 Gene therapy based upon the
mda-7 gene II Introgen Therapeutics coding for IL-24 OSI-461
Inhibits cGMP phospodiesterase II OSI Pharmaceuticals Patupilone A
non-taxane microtubule stabilizing agent II Novartis Squalamine
Blocks multiple angiogenic cofactors II Genaera Tacedinaline
Cystostatic histone deacetylation inhibitor II Pfizer UCN-01
Inhibitor of serine-threonine kinases, including II NCI protein
kinase C UK-356202 Urokinase-like plasminogen activator II
Pfizer
TABLE-US-00011 TABLE 6 Combination therapies for use in oncology
ABVD Doxorubcin, Bleomycin, Vinblastine, and Dacarbazine AC
Doxorubicin and Cyclophosphamide BEP Bleomycin, Etoposide and
Cisplatin CAF Cyclosphosphamide, Doxorubicin and 5-Fluorouracil
(5FU) CAV Cyclophosphamide, Doxorubicin, Vincristine
Carboplatin-Etoposide Carboplatin and Etoposide ChlVPP
Chlorambucil, Vinblastine, Procarbazine, and Prednisolone CHOP
Cyclophosphamide, Doxorubicin, Vincristine, and Prednisolone CHOP-R
Cyclophosphamide, Doxorubicin, Vincristine, Prednisolone, and
Rituximab CMF Cyclophosphamide, Methotrexate and 5FU CVAMP
Cyclophosphamide, Doxorubicin, Vincristine, and Methyl-prednisolone
De Gramont 5FU and leucovorin DHAP Dexamethasone, Cytarabine, and
Cisplatin DAHP-R Dexamethasone, Cytarabine, Cisplatin and Rituximab
Doxorubicin- Doxorubicin and Ifostamide Ifostamide EC Epirubicin
and Cyclophosphamide ECF Epirubicin, Cyclophosphamide, and 5FU ECMF
Epirubicin, Cyclophosphamide, Methotrexate, and 5FU EEX Epirubicin,
Oxaliplatin, and Capecitabine ECX Epirubicin, Cisplatin, and
Capecitabine ESHAP Etoposide, Methyl-prednisolone, Cytarabine and
Cisplatin FEC 5FU, Epirubicin, and Cyclophosphamide Gemcarbo
Gemcitabine and Carboplatin Gemcitabine-Cisplatin Gemcitabine and
Cisplatin Irinotecan-De Gramont Irinotecan, 5FU and Leucovorin MIC
Mitomycin, Ifosamide and Cisplatine MM Methotrexate and
Mitoxantrone MMM Methotrexate, Mitomycin and Mitoxantrone MVP
Mitomycin, Vinblastine and Cisplatin FOLFOX 5FU, Oxilaplatin and
Leucovorin FOLFIRI 5FU, Leucovorin and Irinotecan
Paclitaxel-Carboplatin Paclitaxel and Carboplatin PmitCebo
Prednisolone, Mitoxantrone, Cyclophosphamide, Etoposide, Bleomycin
and Vincristine VAD Vincristine, Doxorubicin, and Dexamethasone
VAPEC-B Vincristine, Doxorubicin, Prednisolone, Etoposide,
Cyclosphosphamide, and Bleomycin Vinorelabine-Cisplatin
Vinorelabine and Cisplatin
[0479] BAMVEC Migration Assay
[0480] Endothelial cell migration is performed as described in P.
J. Polverini et al., Methods Enzymol. 198:440-450 (1991). The
BAMVECs (bovine adrenal microvascular endothelial cells, VEC
Technologies, Rensselaer, N.Y.) are starved overnight in EBM
(endothelial basal medium) containing 0.1% BSA. Cell are washed
with HBSS and treated with Cellstripper.TM. (Mediatech, Herndon,
Va.) for 10 minutes, then harvested with trypsin and resuspended in
EBM with 0.1% BSA at a concentration of 1.5.times.10.sup.6 cells
per mL. Next, cells are added to the bottom of a modified Boyden
chamber (Nucleopore Corp). The chamber is assembled, inverted, and
the cells are allowed to adhere for 90 minutes. The test compounds
are added to the top part of the wells and incubated 3-4 hours.
Membranes are recovered, fixed, stained, and the cells migrated
through the filter. The cells are counted at (100.times.) using 10
fields. 0.25% FBS (fetal bovine serum) (Tissue Culture Biologicals,
Tulare, Calif.) is used for a positive control, and 0.1% BSA is
used for a negative control. Background migration is subtracted and
the data presented is a percentage of FBS-induced migration (%
maximal migration).
[0481] Matrigel Plug Assay
[0482] 500 .mu.l of growth factor reduced Matrigel (BD Bioscience),
containing 100 ng/ml bFGF (R&D systems), is prepared on ice and
injected in the left chest area of nude mouse anesthetized with
isofluorane (5 mice per group). The test compounds are dosed i.v.,
at 30 mg/kg twice a week. After one week, the plugs are extracted
and photographed. Five plugs of the same group are aligned together
and snap-frozen in one OTC compound block. Five 5 .mu.m sections in
different depths are obtained from each block using a Leica CM1850
Cryostat. The slides are immediately fixed in cold acetone for 2
minutes and air dried. CD31 immunohistochemical staining of blood
vessels is carried out by using an Anti-Rat IG HRP detection kit
(BD Pharmingen) and using the methods provided in the
manufacturer's instruction manual. The primary CD31 antibody used
is Rat IgG2a, Clone MEC13.3 (BD Pharmingen, cat# 550274,). The CD31
antibody is diluted 1: 30-50. The CD31 positive area of every plug
is photographed using a Qimaging Micropublisher 5.0 RTV camera
coupled with a Nikon Eclipse 80i microscope (20.times.). ImagePro
5.1 software is used to quantify the CD31 positive area using a
common macro throughout the experiment. The total CD31 positive
area of five sections of each plug is calculated.
[0483] The versatility of the invention is illustrated by the
following Examples, which illustrate typical embodiments of the
invention and are not limiting of the claims or specification in
any way.
EXAMPLES
Example 1
Synthesis of
TABLE-US-00012 [0484] (SEQ ID NO:1)
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro
[0485] Solid phase peptide synthesis of the modified peptide on a
100.mu. mole scale is performed using manual solid-phase synthesis,
a Symphony Peptide Synthesizer and Fmoc protected Rink Amide MBHA.
The following protected amino acids are sequentially added to
resin: Fmoc-Pro-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Ile-OH, Fmoc-Nva-OH,
Fmoc-Thr(tBu)--OH, Fmoc-(D-alloIle)-OH, Fmoc-Val-OH, Fmoc-Gly-OH,
and Fmoc-Sar-OH. They are dissolved in N,N-dimethylformamide (DMF)
and, according to the sequence, activated using
O-benzotriazol-1-yl-N, N, N.sup.1, N.sup.1-tetramethyl-uronium
hexafluorophosphate (HBTU) and Diisopropylethylamine (DIEA).
Removal of the Fmoc protecting group is achieved using a solution
of 20% (V/V) piperidine in N,N-dimethylformamide (DMF) for 20
minutes. Between every coupling, the resin is washed 3 times with
N,N-dimethylformamide (DMF) and 3 times with isopropanol. The
peptide is cleaved from the resin using 85% TFA/5% TIS/5%
thioanisole and 5% phenol, followed by precipitation by dry-ice
cold Et.sub.20. The product is purified by a reverse phase HPLC
using a C.sub.18 column.
Example 2
Synthesis of
TABLE-US-00013 [0486] (SEQ ID NO:3)
Sar-Gly-Val-(D-alloIle)-Thr-Nva-Lys-Arg-Pro
[0487] Solid phase peptide synthesis of the modified peptide on a
100 .mu.mole scale is performed using manual solid-phase synthesis,
a Symphony Peptide Synthesizer and Fmoc protected Rink Amide MBHA.
The following protected amino acids are sequentially added to
resin: Fmoc-Pro-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Lys(Boc)-OH,
Fmoc-Nva-OH, Fmoc-Thr(tBu)-OH, Fmoc-(D-allo-Ile)-OH, Fmoc-Val-OH,
Fmoc-Gly-OH, and Fmoc-Sar-OH. They are dissolved in
N,N-dimethylformamide (DMF) and, according to the sequence,
activated using O-benzotriazol-1-yl-N,N, N.sup.1,
N.sup.1-tetramethyl-uronium hexafluorophosphate (HBTU) and
Diisopropylethylamine (DIEA). Removal of the Fmoc protecting group
is achieved using a solution of 20% (V/V) piperidine in
N,N-dimethylformamide (DMF) for 20 minutes. Between every coupling,
the resin is washed 3 times with N,N-dimethylformamide (DMF) and 3
times with isopropanol. The peptide is cleaved from the resin using
85% TFA/5% TIS/5% thioanisole and 5% phenol, followed by
precipitation by dry-ice cold Et.sub.20. The product is purified by
a reverse phase HPLC using a C.sub.18 column.
Example 3
Synthesis of
TABLE-US-00014 [0488] (SEQ ID NO:10)
Pro-Gly-Val-(D-alloIle)-Thr-Nva-Ile-Arg-Pro
[0489] Solid phase peptide synthesis of the modified peptide on a
100 .mu.mole scale is performed using manual solid-phase synthesis,
a Symphony Peptide Synthesizer and Fmoc protected Rink Amide MBHA.
The following protected amino acids are sequentially added to
resin: Fmoc-Pro-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Ile-OH, Fmoc-Nva-OH,
Fmoc-Thr(tBu)--OH, Fmoc-(D-allo-Ile)-OH, Fmoc-Val-OH, Fmoc-Gly-OH,
and Fmoc-Pro-OH. They are dissolved in N,N-dimethylformamide (DMF)
and, according to the sequence, activated using
O-benzotriazol-1-yl-N,N, N.sup.1, N.sup.1-tetramethyl-uronium
hexafluorophosphate (HBTU) and Diisopropylethylamine (DIEA).
Removal of the Fmoc protecting group is achieved using a solution
of 20% (V/V) piperidine in N,N-dimethylformamide (DMF) for 20
minutes. Between every coupling, the resin is washed 3 times with
N,N-dimethylformamide (DMF) and 3 times with isopropanol. The
peptide is cleaved from the resin using 85% TFA/5% TIS/5%
thioanisole and 5% phenol, followed by precipitation by dry-ice
cold Et.sub.20. The product is purified by a reverse phase HPLC
using a C.sub.18 column.
Example 4
Synthesis of
##STR00229##
[0490] is provided in FIG. 12.
Example 5
Synthesis of
##STR00230##
[0491] is provided in FIG. 13.
Example 6
Synthesis of
##STR00231##
[0492] is provided in FIG. 14.
Example 7
Synthesis of
##STR00232##
[0493] is provided in FIG. 15.
Example 8
Synthesis of
##STR00233##
[0494] is provided in FIG. 16.
Example 9
Synthesis of
##STR00234##
[0495] is provided in FIG. 17.
Example 10
Synthesis of
##STR00235##
[0496] is provided in FIG. 18.
Example 11
Synthesis of
##STR00236##
[0497] is provided in FIG. 19.
Example 12
Synthesis of
##STR00237##
[0498] is provided in FIG. 20.
Example 13
Synthesis of
##STR00238##
[0499] is provided in FIG. 21.
Example 14
Synthesis of
##STR00239##
[0500] is provided in FIG. 22.
Example 15
Synthesis of
##STR00240##
[0501] is provided in FIG. 23.
Example 16
Synthesis of
##STR00241##
[0502] is provided in FIG. 24.
Example 17
Synthesis of
##STR00242##
[0503] is provided in FIG. 25. While this EXAMPLE uses the compound
of EXAMPLE 12, it could also sufficiently employ the compounds of
EXAMPLE 13. Further, while this EXAMPLE shows linking to the
N-terminus, the free acid on the left side of the compounds of
EXAMPLES 12 and 13 may also be linked to any nucleophilic side
chain on a peptide, such as the C, K, S, T or Y side chains. As is
also shown in this EXAMPLE, the Fmoc protected amino group on the
right side of the compounds of EXAMPLES 12 and 13 is used to link
to the recognition group, Y, via an amide bond.
Example 18
Synthesis of
##STR00243##
[0504] is provided in FIG. 26. While this EXAMPLE uses the compound
of EXAMPLE 15, it could also sufficiently employ the compounds of
EXAMPLES 14 and 16. Further, while this EXAMPLE shows linking to
the N-terminus, the free acid on the left side of the compounds of
EXAMPLES 14-16 may also be linked to any nucleophilic side chain on
a peptide, such as the C, K, S, T or Y side chains. As is also
shown in this EXAMPLE, the free acid on the right side of the
compounds of EXAMPLES 14-16 is used to link to the antibody
recognition group, Y, via an amide bond.
Example 19
Synthesis of
3-{2-[2-(2-{2-[2-(2-tert-Butoxycarbonyl-ethoxy)-ethoxy]-ethoxy}-ethoxy)-et-
hoxy]ethoxy}-propionic acid tert-butyl ester
##STR00244##
[0506] The title compound was prepared using a reported method (O.
Seitz and H. Kunz, J. Org. Chem. 62:813-826 (1997)). A small piece
of sodium metal was added to a solution of tetra(ethylene glycol)
(47.5 g, 244 mmol) in THF (200 ml) and stirred until the sodium was
dissolved completely. .sup.tButyl acrylate (94 g, 730 mmol) was
then added and stirring continued for 2 days at RT. Another batch
of .sup.tButyl acrylate (94 g, 730 mmol) was added and stirring
continued for another 2 days. The reaction mixture was neutralized
with a few drops of 1N HCl and concentrated under reduced pressure.
The residue was suspended in water and extracted with ethyl acetate
(3.times.150 ml). Combined organic layers were washed with brine
and dried over sodium sulfate. Evaporation of volatiles over
reduced pressure provided the crude product as colorless liquid
which was purified using a silica gel column (42 g, 51%).
Example 20
Synthesis of
[0507]
3-{2-[2-(2-{2-[2-(2-Carboxy-ethoxy)-ethoxy]-ethoxy}-ethoxy)-ethoxy]-
-ethoxy}-propionic acid
##STR00245##
[0508] A solution of
3-{2-[2-(2-{2-[2-(2-tert-Butoxycarbonyl-ethoxy)-ethoxy]-ethoxy}-ethoxy)-e-
thoxy]-ethoxy}-propionic acid tert-butyl ester (6 g, 18.6 mmol) in
anisole (20 ml) was cooled in an ice bath and trifluoroacetic acid
(65 g) was added. After 3 hrs at RT volatiles were removed under
reduced pressure and the residue was partitioned between ethyl
acetate (50 ml) and 5% sodium bicarbonate solution. The aqueous
layer was acidified with 1 N HCl, saturated with NaCl and then
extracted with ethyl acetate (3.times.50 ml). Combined organic
layers were washed with brine and dried over sodium sulfate.
Removal of volatiles under the reduced pressure provided the
product as colorless liquid which solidified upon refrigeration
(3.8 g, 82%).
Example 21
Synthesis of
3-(2-{2-[2-(2-{2-[2-(4-{2-[2-(2-Methyl-[1,3]dioxolan-2-ylmethyl)-[1,3]diox-
olan-2-yl]-ethyl}-phenylcarbamoyl)-ethoxy]-ethoxy}-ethoxy)-ethoxy]-ethoxy}-
-ethoxy)-propionic acid
##STR00246##
[0510] Compound from EXAMPLE 20 (0.6 g, 1.8 mmol) was dissolved in
dichloromethane (10 ml) and
4-{2-[2-(2-Methyl-[1,3]dioxolan-2-ylmethyl)-[1,3]dioxolan-2-yl]-ethyl}-ph-
enylamine (0.3 g, 1.4 mmol) followed by EDCI (0.28 g, 1.8 mmol) was
added at RT. After 1 hr at RT the RM was washed with water and
dried over sodium sulfate. Evaporation of volatiles and
purification over silica gel column with 1 to 15% methanol in
dichloromethane provided title compound as gum (0.47 g, 32%).
Example 22
Synthesis of
4-{2-[2-(2-Methyl-[1,3]dioxolan-2-ylmethyl)-[1,3]dioxolan-2-yl]-ethyl}-phe-
nylamine
##STR00247##
[0512] A clean oven dried flask was charged with the
6-(4-nitro-phenyl)-hexane-2,4-dione (3.7 g, 15.72 mmol), dry
CH.sub.2Cl.sub.2 (20 ml) followed by bisTMS ethylene glycol (38.5
ml, 157.3 ml) were added to the flask and the resulting solution
was cooled to -5.degree. C. with stirring under argon. TMSOTf (300
.mu.l) was added to the reaction mixture and the solution was
stirred at -5.degree. C. for 6 h. Reaction was quenched with
pyridine (10 ml) and poured into sat. NaHCO.sub.3. The mixture was
extracted with EtOAc and the organic layer was washed with water,
brine, dried (Na.sub.2SO.sub.4) and concentrated to give a yellow
solid. The solid was triturated with hexanes to give a free flowing
pale yellow solid (3.5 g, 72%) which was dissolved in EtOAc (50 ml)
and hydrogenated on a Parr shaker starting with 50 psi of hydrogen
pressure. After two hours the reaction was filtered through a pad
of celite, the celite was washed thoroughly with
CH.sub.2Cl.sub.2/MeOH and combined organics were concentrated to
give title compound (1.46 g, 100%) as an oil that solidifies upon
standing.
Example 23
Synthesis of
Synthesis of 4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyric acid
2,5-dioxo pyrrolidin-1-yl ester (10)
##STR00248##
[0513] Step 1: 6-(4-Nitro-phenyl)-hexane-2,4-dione (11)
[0514] To a reaction vessel (heat and vacuum dried and equipped
with a magnetic spin bar) was added tetrahydrofuran and lithium
diisopropylamide (2M heptane/ethylbenzene/tetrahydrofuran; 69.4 mL,
138.9 mmol). The solution cooled to -78.degree. C.
Pentane-2,4-dione (7.13 mL, 69.4 mmol) was added dropwise and the
solution stirred 30 minutes at -78.degree. C. 4-nitrobenzyl bromide
(15.0 g, 69.4 mmol) was added in one portion. The solution was
removed from the dry-ice/acetone bath, allowed to warm to room
temperature and stirred 16 hours. The solution was cooled to
approximately 0.degree. C. and the reaction quenched with 1M HCl.
Tetrahydrofuran was removed under reduced pressure. The crude
material was taken up into dichloromethane and washed with 1M HCl
and brine. The aqueous layers were again washed with
dichloromethane. The combined dichloromethane layers were dried
(Na.sub.2SO.sub.4) and removed under reduced pressure. Gradient
flash column chromatography (FCC) was performed using 5% to 15%
ethyl acetate/hexanes to afford title compound (8.5 g, 52%; yellow
solid). .sup.1H NMR (CDCl.sub.3): .delta. 8.14 (d, J=9.0 Hz, 2H),
.delta. 7.43 (d, J=8.4 Hz, 2H), .delta. 5.45 (s, 1H), .delta. 3.06
(t, J=7.5 Hz, 2H), .delta. 2.64 (t, J=7.8 Hz, 2H), .delta. 2.04 (s,
3H).
Step 2: 4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyric acid
(12)
[0515] 200 mL tetrahydrofuran, 6-(4-nitro-phenyl)-hexane-2,4-dione
(8.0 g, 34.0 mmol) and dihydro-pyran-2,6-dione (3.88 g, 34.0 mmol)
were added to a reaction vessel. The reaction vessel was purged
three times with argon. Approximately 200 mg palladium (10 wt % on
activated carbon) was added. The reaction vessel was purged again
with argon and excess hydrogen introduced via a balloon. Solution
stirred 16 hours at room temperature. Hydrogen removed under
reduced pressure and catalyst removed by filtration through celite.
Tetrahydrofuran removed under reduced pressure to afford title
compound (10.5 g, 97%, yellow solid).
Step 3: 4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyric acid
2,5-dioxo pyrrolidin-1-yl ester (10)
[0516] To a reaction vessel (heat and vacuum dried and equipped
with a magnetic spin bar) was added
4-[4-(3,5-dioxo-hexyl)-phenylcarbamoyl]-butyric acid (10.53 g, 33.0
mmol), N-hydroxysuccinimide (3.8 g, 33.0 mmol) and
1-[3-(dimethylamino) propyl]-3-ethylcarbodiimide hydrochloride (6.3
g, 33.0 mmol) and dichloromethane (250 mL). The solution was
stirred under nitrogen at room temperature for 16 hours then washed
with 10% citric acid, brine and dried (Na.sub.2SO.sub.4).
Dichloromethane was removed under reduced pressure. FCC with 70%
ethyl acetate/hexanes gave title compound (7.4 g, yellow solid,
54%). .sup.1H NMR (CDCl.sub.3): .delta. 7.87 (s, 1H), .delta. 7.43
(d, J=8.4 Hz, 2H), .delta. 7.12 (d, J=8.4 Hz, 2H), .delta. 5.46 (s,
1H), 62.89 (t(& m), J=8.1 Hz(for the t), 7H), 62.73 (t, J=6.0
Hz, 2H), 62.56 (t, J=7.2 Hz, 2H), .delta. 2.47 (t, J=6.9 Hz, 2H),
.delta. 2.21 (p, J=6.6 Hz, 2H), .delta. 2.04 (s, 3H).
Example 24
Synthesis of
Synthesis of
3-{2-[2-(2-{4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyrylamino}-ethoxy)-
-ethoxy]-ethoxy}-propionic acid 2,5-dioxo-pyrrolidin-1-yl ester,
(20)
##STR00249##
[0517] Step 1: 3-{2-[2-(2-Hydroxy-ethoxy)-ethoxy]-ethoxy}-propionic
acid tert-butyl ester
[0518] Na metal (catalytic) was added to a stirring solution of
acrylic acid tert-butyl ester (6.7 mL, 46 mmol), and
2-[2-(2-hydroxy-ethoxy)-ethoxy]-ethanol (20.7 g, 138 mmol) in THF
(100 mL) at 0.degree. C. and the mixture was stirred overnight.
Solvent was removed and the remaining oil dissolved in EtOAc (100
mL). The organic layer was washed with water (3.times.50 mL), and
dried over Na.sub.2SO.sub.4 and the solvent removed in vacuo to
give an oil which corresponds to the title compound that would be
used as is for the next step. (M+1)=279.
Step 2:
3-{2-[2-(2-Tosylsulfonyloxy-ethoxy)-ethoxy]-ethoxy}-propionic acid
tert-butyl ester
[0519] Tosyl chloride (22.3 g, 117 mmol) was added in portions to a
stirring solution of
3-{2-[2-(2-hydroxy-ethoxy)-ethoxy]-ethoxy}-propionic acid
tert-butyl ester (16.3 g, 58.6 mmol) and pyridine 60 mL in (240 mL)
and the mixture was stirred overnight. The reaction was quenched
with water (300 mL) and the organic layer was separated. The
aqueous layer was extracted with CH.sub.2Cl.sub.2 (2.times.100 mL).
The combined organic layer was washed with HCl (1N, 100 mL), water
(100 mL), and dried over Na.sub.2SO.sub.4 and the solvent was
removed in vacuo to give an oil which corresponds to the title
compound that would be used as is for the next step. (M+1)=433.
Step 3: 3-{2-[2-(2-Amino-ethoxy)-ethoxy]-ethoxy}-propionic acid
tert-butyl ester
[0520] NaN.sub.3 (35 g, 538 mmol) was added to a stirring solution
of 3-{2-[2-(2-tosylsulfonyloxy-ethoxy)-ethoxy]-ethoxy}-propionic
acid tert-butyl ester (20 g, 46 mmol) in DMF (150 mL) and the
reaction was stirred overnight. Reaction was diluted with water
(200 mL) and extracted with EtOAc (4.times.100 mL). The organic
layer was washed with water (100 mL) and brine (100 mL) and dried
over Na.sub.2SO.sub.4. The solvent was removed in vacuo to give an
oil. Column chromatography EtOAc/Hex (1:4) gave an oil which
corresponds to the
3-{2-[2-(2-azido-ethoxy)-ethoxy]-ethoxy}-propionic acid tert-butyl
ester, (M+1)=304. This oil was hydrogenated using Pd (5% on carbon)
in EtOAc under hydrogen (1 atm.) over 3 days. The catalyst was
removed by filtration and solvent removed in vacuo to give an oil
corresponding to the title compound, (M+1)=278.
Step 4:
3-{2-[2-(2-{4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyrylamino}--
ethoxy)-ethoxy]-ethoxy}-propionic acid tert-butyl ester
[0521] A solution of
4-[4-(3,5-dioxo-hexyl)-phenylcarbamoyl]-butyric acid
2,5-dioxo-pyrrolidin-1-yl ester (1.5 g, 3.6 mmol),
3-{2-[2-(2-amino-ethoxy)-ethoxy]-ethoxy}-propionic acid tert-butyl
ester (1.0 g, 3.6 mmol) and DIEA (1.3 .mu.L, 7.2 mmol) in
CH.sub.2Cl.sub.2 (10 mL) was stirred at rt overnight. The solvent
was removed in vacuo and the residual oil purified using column
chromatography EtOAc/MeOH (95:5) to give the title compound as a
transparent oil, (M+1)=579.
Step 5:
3-{2-[2-(2-{4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyrylamino}--
ethoxy)-ethoxy]-ethoxy}-propionic acid 2,5-dioxo-pyrrolidin-1-yl
ester
[0522]
3-{2-[2-(2-{4-[4-(3,5-Dioxo-hexyl)-phenylcarbamoyl]-butyrylamino}-e-
thoxy)-ethoxy]-ethoxy}-propionic acid tert-butyl ester (400 mg,
0.692 mmol) was dissolved in TFA/CH.sub.2Cl.sub.2 (1:1, 3 mL) and
the mixture stirred overnight. The solvent was removed to give an
oil as the acid intermediate. This oil was dissolved in
CH.sub.2Cl.sub.2 (4 mL) containing DIEA (569 .mu.L, 3.09 mmol),
N-hydroxysuccinimide (119 mg, 1.03 mmol) and EDC (197 mg, 1.0 mmol)
and the mixture stirred over the night. The solvent was removed and
the residual oil was purified using column chromatography
EtOAc/MeOH (95:5) to give an oil as the title compound,
(M+1)=620.
Example 25
Synthesis of AA targeting compound
[0523] Compound of EXAMPLES 17 or 18 can be linked to antibody 38C2
by the following procedure: One mL antibody 38C2 in phosphate
buffered saline (10 mg/mL) is added to 12 .mu.L of a 10 mg/mL stock
solution of AA targeting agent and the resulting mixture maintained
at room temperature for 2 hours prior to use.
Example 26
Synthesis of
##STR00250##
[0524] is provided in FIG. 27. While this EXAMPLE uses the compound
of EXAMPLE 12, it could also sufficiently employ the compounds of
EXAMPLE 13.
Example 27
[0525] C. Rader, et al., J. Mol. Biol. 332:889-899 (2003) details
one method of making h38c2. The following details the results,
materials and methods in this reference.
[0526] Humanization Human V.sub..kappa. gene DPK-9 and human
J.sub..kappa. gene J.sub..kappa.4 were used as frameworks for the
humanization of the kappa light chain variable domain, and human
V.sub.H gene DP-47 and human J.sub.H gene J.sub.H4 are used as
frameworks for the humanization of the heavy chain variable domain
of m38C2. All complementarity determining region (CDR) residues as
defined by Kabat et al., as well as defined framework residues in
both light chain and heavy chain variable domain, were grafted from
m38C2 onto the human framework. The selection of grafted framework
residues may be based on the crystal structure of mouse mAb 33F12
Fab (PDB 1AXT). mAb 33F12 Fab shares a 92% sequence homology with
m38c2 in the variable domains and identical CDR lengths.
Furthermore, both 33F12 and m38C2 have similar catalytic activity.
Framework residues consisted of five residues in the light chain
and seven residues in the heavy chain (FIG. 7A) and encompassed the
residues that are likely to participate directly or indirectly in
the catalytic activity of m38C2. These include the reactive lysine
of m38C2, Lys.sup.H93, which is positioned in framework region 3
(FR3) of the heavy chain. Six residues, Ser.sup.H35, Val.sup.H37,
Trp.sup.H47, Trp.sup.H93, and Phe.sup.L98, which are conserved
between mouse mAbs 33F12 and 38C2, are within a 5-.ANG. radius of
the .epsilon. amino group of Lys.sup.H93. These residues were also
conserved in the humanization. Lys.sup.H93 lies at the bottom of a
highly hydrophobic substrate binding sites of mouse mAbs 33F12 and
38C2. In addition to CDR residues, a number of framework residues
line this pocket. Among these, LeuL.sup.37, Gln.sup.L42,
Ser.sup.L43, Val.sup.L85, Phe.sup.L87, Val.sup.H5, Ser.sup.H40,
Glu.sup.H42, Gly.sup.H88Ile.sup.189, and Thr.sup.H94 Were grafted
onto the human framework.
[0527] Expression By fusing the humanized variable domains to human
constant domains C.sub..kappa. and C.sub..gamma.11, h38C2 was
initially generated as Fab expressed in E. coli. Next, h38c2 IgG
was formed from h38c2 Fab using the PIGG vector engineered for
human IgG1 expression in mammalian cells. Supernatants from
transiently transfected human 293T cells were subjected to affinity
chromatography on recombinant protein A, yielding approximately 1
mg/L h38C2 IgG1. Purity was established by SDS-PAGE followed by
Coomassie blue staining.
[0528] .beta.-Diketone Compounds--
##STR00251##
The enaminone formed by the covalent addition of a .beta.-diketone
with m38c2 has a characteristic UV absorbance at
.lamda..sub.max=318 .mu.m. Like m38C2 IgG, h38C2 IgG showed the
characteristic enaminone absorbance after incubation with
.beta.-diketone. As a negative control, recombinant human
anti-HIV-1 gp120 mAb b12 with the same IgG1 isotype as h38C2 but
without reactive lysine, did not reveal enaminone absorbance after
incubation with .beta.-diketone 2. For a quantitative comparison of
the binding of .beta.-diketones to m38C2 and h38C2, the authors
used a competition ELISA. The antibodies were incubated with
increasing concentrations of .beta.-diketones 2 and 3 and assayed
against immobilized BSA-conjugated O-diketone 1. The apparent
equilibrium dissociation constants were 38 .mu.M (m38C2) and 7.6
.mu.M (h38C2) for .beta.-diketone 2 and 0.43 .mu.M (m38C2) and 1.0
.mu.M (h38C2) for .beta.-diketone 3, revealing similar
.beta.-diketone binding properties for mouse and humanized antibody
(FIG. 6).
[0529] Molecular modeling--A molecular model of h38C2 Fab was
constructed by homology modeling using the crystal structure of a
related aldolase antibody, mouse 33F12 Fab (Protein Data Bank ID:
1AXT), as a template. The crystal structure of mouse 33F12 Fab was
previously determined at a resolution of 2.15 .ANG...sup.4
Alignment of mouse 33F12 and 38C2 amino acid sequences using the
HOMOLOGY module within INSIGHT II software (Accelrys) confirmed
that both sequences are highly homologous. They differ from each
other by 19 out of 226 amino acids in the two variable domains, and
their CDRs share the same lengths. In addition to the high sequence
homology, both structures exhibit considerable structural
similarity, as observed by a low-resolution crystal structure of
38C2. Residues in the model were mutated to conform to the h38C2
amino acid sequence and sidechains were placed based on standard
rotamers. This model was then minimized with the DISCOVER module in
INSIGHT II using 100 steps each of steepest descent minimization
followed by conjugate gradient minimization.
[0530] Construction of h38C2 Fab--The sequences of the variable
light and heavy chain domains of m38C2 (SEQ ID NOs:32 and 33,
respectively) as well as the sequences of human germline sequences
DPK-9 (SEQ ID NO:36), JK4 (SEQ ID NO:38), DP-47 (SEQ ID NO:37), and
JH4 (SEQ ID NO:39) (V BASE; http://vbase.mrc-cpe.cam.ac.uk/) were
used to design overlapping oligonucleotides for the synthetic
assembly of humanized V.sub..kappa. and V.sub.H, respectively.
N-glycosylation sites with the sequence NXS/T as well as internal
restriction sites HindIII, Xbal, SacI, ApaI, and SfiI were avoided.
PCR was carried out by using the Expand High Fidelity PCR System
(Roche Molecular Systems). The humanized V.sub..kappa.
oligonucleotides were: L flank sense (Rader, C., Ritter, G.,
Nathan, S., Elia, M., Gout, I., Junbluth, A. A., J. Biol. Chem.
275: 13668-13676 (2000)); h38C2L1 (sense;
5'-GAGCTCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGTGACCGCG
TCACCATCACTTG-3') (SEQ ID NO:18); h38C2L2 (antisense;
5'-ATTCAGATATGGGCTGCCATAAGTGTGCAGGAGGCTCTGACTGGAGCGGCAAGT
GATGGTGACGCGGTC-3') (SEQ ID NO:19); h38C2L3 (sense;
5'-TATGGCAGCCCATATCTGAATTGGTATCTCCAGAAACCAGGCCAGTCTCCTAAGC
TCCTGATCTAT-3') (SEQ ID NO:20); h38C2L4 (antisense;
5'-CTGAAACGTGATGGGACACCACTGAAACGATTGGACACTTTATAGATCAGGAGC
TTAGGAGACTG-3') (SEQ ID NO:21); h38C2L5 (sense;
5'-AGTGGTGTCCCATCACGTTTCAGTGGCAGTGGTTCTGGCACAGATTTCACTCTCA
CCATCAGCAGTCTGCAACCTGAAGATTTTGCAGTG-3') (SEQ ID NO:22); h38C2L6
(antisense;
5'-GATCTCCACCTTGGTCCCTCCGCCGAAAGTATAAGGGAGGTGGGTGCCCTGACTA
CAGAAGTACACTGCAAAATCTTCAGGTTGCAG-3') (SEQ ID NO:23); L antisense
flank (C. Rader et al., J. Biol. Chem. 275:13668-13676 (2000)). The
humanized V.sub.H oligonucleotides were: H flank sense (C. Rader et
al., J. Biol. Chem. 275:13668-13676 (2000)); h38C2H1 (sense;
5'-GAGGTGCAGCTGGTGGAGTCTGGCGGTGGCTTGGTACAGCCTGGCGGTTCCCTGC
GCCTCTCCTGTGCAGCCTCTGGCT-3') (SEQ ID NO:24); h38C.sub.2H.sub.2
(antisense;
5'-CTCCAGGCCCTTCTCTGGAGACTGGCGGACCCAGCTCATCCAATAGTTGCTAAAG
GTGAAGCCAGAGGCTGCACAGGAGAG-3') (SEQ ID NO:25); h38C.sub.2H.sub.3
(sense; 5'-TCTCCAGAGAAGGGCCTGGAGTGGGTCTCAGAGATTCGTCTGCGCAGTGACAAC
TACGCCACGCACTATGCAGAGTCTGTC-3') (SEQ ID NO:26); h38C.sub.2H.sub.4
(antisense;
5'-CAGATACAGCGTGTTCTTGGAATTGTCACGGGAGATGGTGAAGCGGCCCTTGAC
AGACTCTGCATAGTGCGTG-3') (SEQ ID NO:27); h38C.sub.2H.sub.5 (sense;
5'-CAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGCGCGCCGAGGACAC
GGGCATTTATTACTGTAAAACG-3') (SEQ ID NO:28); h38C.sub.2H.sub.6
(antisense;
5'-TGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGTAGCTGAAACTGTAGAAGTA
CGTTTTACAGTAATAAATGCCCGTG-3') (SEQ ID NO:29); H flank antisense (C.
Rader et al., J. Biol. Chem. 275:13668-13676 (2000)). Following
assembly, humanized V, and V.sub.H were fused to human
C.sub..kappa. and C.sub..gamma.11, respectively, and the resulting
light chain and heavy chain fragment were fused and SfiI-cloned
into phagemid vector pComb3X as described (C. Rader et al, J. Biol.
Chem. 275:13668-13676 (2000); C. F. Barbas 3.sup.rd et al., Phage
Display: A laboratory manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor N.Y. (2001)). To enrich for clones with the correct
h38C2 sequence, Fab were displayed on phage and selected by one
round of panning against the immobilized .beta.-diketone 1 (JW)
conjugated to BSA. Soluble Fab were produced from single clones and
tested for binding to immobilized JW-BSA by ELISA using donkey
anti-human F(ab').sub.2 polyclonal antibodies conjugated to
horseradish peroxidase (Jackson ImnunoResearch Laboratories) as
secondary antibody. Light chain and heavy chain encoding sequences
of positive clones were analyzed by DNA sequencing using the
primers OMPSEQ and PELSEQ (C. F. Barbas 3.sup.rd et al., Phage
Display: A laboratory manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor N.Y., (2001)), respectively, to confirm the assembled
V, and V.sub.H sequences of h38C2.
[0531] Construction, production, and purification of h38C2
IgG1--The recently described vector PIGG (C. Rader et al, FASEB J.,
16:2000-2002 (2002)) was used for mammalian expression of h38C2
IgG1. The mammalian expression vector PIGG-h38c2 is illustrated in
FIG. 23. The 9 kb vector comprises heavy chain .gamma.1 and light
chain-K expression cassettes driven by a bidirectional CM promoter
construct. Using primers PIGG-h38C2H (sense;
5'-GAGGAGGAGGAGGAGGAGCTCACTCCGAGGTGCAGCTGGTGGAGTCTG-3') (SEQ ID
NO:30) and GBACK (C. F. Barbas 3.sup.rd et al, Phage Display: A
laboratory manual, Cold Spring Harbor Laboratory, Cold Spring
Harbor N.Y. (2001)), the V.sub.H coding sequence from h38C2 Fab in
phagemid vector pComb3X was amplified, digested with SacI and ApaI,
and cloned into the appropriately digested vector PIGG. Using
primers PIGG-h38C2L (sense:
5'-GAGGAGGAGGAGGAGAAGCTTGTTGCTCTGGATCTCTGGTGCCTACGGGGAGCT
CCAGATGACCCAGTCTCC-3') (SEQ ID NO:31) and LEADB (C. F. Barbas
3.sup.rd et al, Phage Display: A laboratory manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor N.Y. (2001)) the light chain
coding sequence from h38C2 Fab in phagemid vector pComb3X was
amplified, digested with HindIII and Xbal, and cloned into the
appropriately digested vector PIGG that already contained the h38C2
heavy chain. Intermediate and final PIGG vector constructs were
amplified in E. coli strain SURE (Stratagene) and prepared with the
QIAGEN Plasmid Maxi Kit. h38C2 IgG1 were produced from the prepared
final PIGG vector construct by transient transfection of human 293T
cells using Lipofectamine 2000 (Invitrogen). Transfected cells were
maintained in GIBCO 10% ultra-low IgG (<0.1%) FCS (Invitrogen)
in RPMI 1640 (Hyclone) for 2 weeks. During this time, the medium
was collected and replaced three times. The collected medium was
subjected to affinity chromatography on a recombinant Protein A
HiTrap column (Amersham Biosciences). This purification step
yielded 2.45 mg h38C2 IgG1 from 2,300 mL collected medium as
determined by measuring the optical density at 280 nm using an
Eppendorf BioPhotometer. Following dialysis against PBS in a
Slide-A-Lyzer 10K dialysis cassette (Pierce), the antibody was
concentrated to 760 .mu.g/mL using an Ultrafree-15 Centrifugal
Filter Device (UFV2BTK40; Millipore), and sterile filtered through
a 0.2-.mu.m Acrodisc 13MM S-200 Syringe Filter (Pall). The final
yield was 2.13 mg (87%). Purified h38C2 IgG1 was confirmed by
nonreducing SDS-PAGE followed by Coomassie Blue staining.
[0532] Enaminone formation--Antibody (h38C2 IgG1 or b12 IgG1) was
added to .beta.-diketone 2 to a final concentration of 25 .mu.M
antibody binding site and 125 .mu.M .beta.-diketone. This mixture
was incubated at room temperature for 10 minutes before a UV
spectrum was acquired on a SpectraMax Plus 384 UV plate reader
(Molecular Devices) using SOFTmax Pro software (version 3.1.2).
[0533] Binding assays--Unless noted otherwise, all solutions were
phosphate buffered saline (pH 7.4). A 2.times. solution of either
.beta.-diketone 2 or 3 (50 .mu.L) was added to 50 .mu.L of the
antibody (either h38C2 or m38C2) and allowed to incubate at
37.degree. C. for 1 hr. Solutions were mixed by pipetting. Final
concentrations of antibody were 0.4 to 8 nM antibody binding site,
and final concentrations of .beta.-diketones 2 and 3 were 10.sup.-9
to 10.sup.-2 M and 10.sup.-10 to 10.sup.-4M, respectively. Each
well of a Costar 3690 96-well plate (Corning) was coated with 100
ng of the BSA conjugate of .beta.-diketone 1 in TBS. Wells were
then blocked with 3% (w/v) BSA in TBS. Then, 50 .mu.L of the
antibody/.beta.-diketone mixture was added, followed by 50 .mu.L of
a 1:1,000 dilution of either goat anti-human Fc IgG polyclonal
antibodies (Pierce) or rabbit anti-mouse Fc IgG polyclonal
antibodies (Jackson ImmunoResearch Laboratories) conjugated to
horseradish peroxidase. This was followed by 50 .mu.L ABTS
substrate solution. Between each addition, the plate was covered,
incubated at 37.degree. C. for 1 hr, and then washed five times
with deionized H.sub.2O. The absorbance at 405 .mu.m was monitored
as described above until the reaction with no .beta.-diketone
reached an appropriate value (0.5<A405<1.0). For each well,
the fractional inhibition of ELISA signal (v.sub.i) was calculated
using equation i:
v.sub.i=(A.sub.o-A.sub.i)/(A.sub.o) (i)
where A.sub.o is the ELISA absorbance obtained in the absence of
.beta.-diketone and A.sub.i is the absorbance obtained in the
presence of .beta.-diketone. For monovalent binding proteins, the
fraction of antibody bound to soluble .beta.-diketone (f) is equal
to v.sub.i. However, the IgG antibody is bivalent, and the ELISA
signal is inhibited only by the presence of doubly liganded
antibody and not by monovalent binding. Therefore, the Stevens
correction for a bivalent antibody was used:
f.sub.i=(v.sub.i).sup.1/2 (ii)
The following relationship was used to determine the apparent
equilibrium dissociation constant (modified from [ref. 37]):
f.sub.i=f.sub.min+(f.sub.max-f.sub.min)(1+K.sub.D/a.sub.0).sup.-1
(iii)
where a.sub.0 corresponds to the total .beta.-diketone
concentration, K.sub.D is the equilibrium dissociation constant,
and f.sub.min and f.sub.max represent the experimentally determined
values when the antibody binding sites are unoccupied or saturated,
respectively. Because this equation is only valid when the K.sub.D
values are at least 10.times. higher than the antibody
concentration, it was verified that the K.sub.D values determined
from equation iii met this criterion. Data were fit using a
nonlinear least-squares fitting procedure of KaleidaGraph (version
3.0.5, Abelbeck software) with K.sub.D, f.sub.max, and f.sub.min as
the adjustable parameters and normalized using equation iv:
f.sub.norm=(f.sub.i-f.sub.min)/(f.sub.max-f.sub.min) (iv)
Example 28
[0534] The BAMVEC cell migration assay and Matrigel plug
angiogenesis assay were performed on the following compounds
according the protocols detailed above. Compounds and their
corresponding assay results are presented. Antibody is h38c2
IgG1.
##STR00252## ##STR00253## ##STR00254## ##STR00255## ##STR00256##
##STR00257##
Example 29
Synthesis of
##STR00258##
[0535] is provided in FIG. 28.
[0536] The invention thus has been disclosed broadly and
illustrated in reference to representative embodiments described
above. Those skilled in the art will recognize that various
modifications can be made to the present invention without
departing from the spirit and scope thereof. All publications,
patent applications, and issued patents, are herein incorporated by
reference to the same extent as if each individual publication,
patent application or issued patent were specifically and
individually indicated to be incorporated by reference in its
entirety. Definitions that are contained in text incorporated by
reference are excluded to the extent that they contradict
definitions in this disclosure.
Sequence CWU 1
1
41111PRTArtificialPeptide analog of thrombospondin-1 1Xaa Xaa Gly
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 10211PRTArtificialPeptide analog
of thrombospondin-1 2Xaa Pro Phe Val Xaa Thr Xaa Ile Arg Pro Xaa1 5
10311PRTArtificialPeptide analog of thrombospondin-1 3Xaa Xaa Gly
Val Xaa Thr Xaa Lys Arg Pro Xaa1 5 10411PRTArtificialPeptide analog
of thrombospondin-1 4Xaa Xaa Gly Val Xaa Thr Lys Ile Arg Pro Xaa1 5
10511PRTArtificialPeptide analog of thrombospondin-1 5Xaa Xaa Gly
Val Xaa Thr Gln Ile Arg Pro Xaa1 5 10611PRTArtificialPeptide analog
of thrombospondin-1 6Xaa Xaa Gly Val Xaa Thr Xaa Ile Arg Pro Xaa1 5
10711PRTArtificialPeptide analog of thrombospondin-1 7Xaa Xaa Phe
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 10811PRTArtificialPeptide analog
of thrombospondin-1 8Xaa Lys Gly Val Xaa Thr Xaa Ile Arg Pro Xaa1 5
10911PRTArtificialPeptide analog of thrombospondin-1 9Xaa Glu Gly
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 101011PRTArtificialPeptide
analog of thrombospondin-1 10Xaa Pro Gly Val Xaa Thr Xaa Ile Arg
Pro Xaa1 5 101111PRTArtificialPeptide analog of thrombospondin-1
11Xaa Pro Xaa Val Xaa Thr Xaa Ile Arg Pro Xaa1 5
101211PRTArtificialPeptide analog of thrombospondin-1 12Xaa Pro Xaa
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 101311PRTArtificialPeptide
analog of thrombospondin-1 13Xaa Pro Xaa Val Xaa Thr Xaa Ile Arg
Pro Xaa1 5 101411PRTArtificialPeptide analog of thrombospondin-1
14Xaa Pro Xaa Val Xaa Thr Xaa Ile Arg Pro Xaa1 5
101511PRTArtificialPeptide analog of thrombospondin-1 15Xaa Pro Xaa
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 10169PRTArtificialPeptide analog
of thrombospondin-1 16Xaa Gly Val Xaa Thr Arg Ile Arg Xaa1
51711PRTArtificialPeptide analog of thrombospondin-1 17Xaa Xaa Gly
Val Xaa Thr Xaa Ile Arg Pro Xaa1 5 101868DNAArtificialPCR primer
for generating humanized Vk 18gagctccaga tgacccagtc tccatcctcc
ctgtctgcat ctgtaggtga ccgcgtcacc 60atcacttg 681969DNAArtificialPCR
primer for generating humanized Vk 19attcagatat gggctgccat
aagtgtgcag gaggctctga ctggagcggc aagtgatggt 60gacgcggtc
692066DNAArtificialPCR primer for generating humanized Vk
20tatggcagcc catatctgaa ttggtatctc cagaaaccag gccagtctcc taagctcctg
60atctat 662165DNAArtificialPCR primer for generating humanized Vk
21ctgaaacgtg atgggacacc actgaaacga ttggacactt tatagatcag gagcttagga
60gactg 652290DNAArtificialPCR primer for generating humanized Vk
22agtggtgtcc catcacgttt cagtggcagt ggttctggca cagatttcac tctcaccatc
60agcagtctgc aacctgaaga ttttgcagtg 902387DNAArtificialPCR primer
for generating humanized Vk 23gatctccacc ttggtccctc cgccgaaagt
ataagggagg tgggtgccct gactacagaa 60gtacactgca aaatcttcag gttgcag
872479DNAArtificialPCR primer for generating humanized VH
24gaggtgcagc tggtggagtc tggcggtggc ttggtacagc ctggcggttc cctgcgcctc
60tcctgtgcag cctctggct 792581DNAArtificialPCR primer for generating
humanized VH 25ctccaggccc ttctctggag actggcggac ccagctcatc
caatagttgc taaaggtgaa 60gccagaggct gcacaggaga g
812681DNAArtificialPCR primer for generating humanized VH
26tctccagaga agggcctgga gtgggtctca gagattcgtc tgcgcagtga caactacgcc
60acgcactatg cagagtctgt c 812773DNAArtificialPCR primer for
generating humanized VH 27cagatacagc gtgttcttgg aattgtcacg
ggagatggtg aagcggccct tgacagactc 60tgcatagtgc gtg
732876DNAArtificialPCR primer for generating humanized VH
28caattccaag aacacgctgt atctgcaaat gaacagcctg cgcgccgagg acacgggcat
60ttattactgt aaaacg 762979DNAArtificialPCR primer for generating
humanized VH 29tgaggagacg gtgaccaggg tgccctggcc ccagtagctg
aaactgtaga agtacgtttt 60acagtaataa atgcccgtg 793048DNAArtificialPCR
primer for amplifying h38C2 VH coding sequence 30gaggaggagg
aggaggagct cactccgagg tgcagctggt ggagtctg 483172DNAArtificialPCR
primer for amplifying h38C2 VL coding sequence 31gaggaggagg
aggagaagct tgttgctctg gatctctggt gcctacgggg agctccagat 60gacccagtct
cc 7232112PRTMus musculusMISC_FEATURE(1)..(23)Framework region 1
32Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Arg Leu Gly1
5 10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His
Thr 20 25 30Tyr Gly Ser Pro Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly
Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser
Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Arg Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Leu Gly Val
Tyr Phe Cys Ser Gln Gly 85 90 95Thr His Leu Pro Tyr Thr Phe Gly Gly
Gly Thr Lys Leu Glu Ile Lys 100 105 11033118PRTMus
musculusMISC_FEATURE(1)..(30)Framework region 1 33Glu Val Lys Leu
Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Thr Met Lys
Leu Ser Cys Glu Ile Ser Gly Leu Thr Phe Arg Asn Tyr 20 25 30Trp Met
Ser Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40 45Ala
Glu Ile Arg Leu Arg Ser Asp Asn Tyr Ala Thr His Tyr Ala Glu 50 55
60Ser Val Lys Gly Lys Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Arg65
70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Gly Ile
Tyr 85 90 95Tyr Cys Lys Thr Tyr Phe Tyr Ser Phe Ser Tyr Trp Gly Gln
Gly Thr 100 105 110Leu Val Thr Val Ser Ala 11534112PRTHomo
sapiensMISC_FEATURE(1)..(23)Framework region 1 34Glu Leu Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ser Ser Gln Ser Leu Leu His Thr 20 25 30Tyr Gly
Ser Pro Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro
Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55
60Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile65
70 75 80Ser Ser Leu Gln Pro Glu Asp Phe Ala Val Tyr Phe Cys Ser Gln
Gly 85 90 95Thr His Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu
Ile Lys 100 105 11035118PRTHomo
sapiensMISC_FEATURE(1)..(30)Framework region 1 35Glu Val Gln Leu
Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30Trp Met
Ser Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40 45Ser
Glu Ile Arg Leu Arg Ser Asp Asn Tyr Ala Thr His Tyr Ala Glu 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65
70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Gly Ile
Tyr 85 90 95Tyr Cys Lys Thr Tyr Phe Tyr Ser Phe Ser Tyr Trp Gly Gln
Gly Thr 100 105 110Leu Val Thr Val Ser Ser 1153695PRTHomo
sapiensMISC_FEATURE(1)..(23)Framework region 1 36Asp Ile Gln Met
Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val
Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr 20 25 30Leu Asn
Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr
Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro
85 90 953798PRTHomo sapiensMISC_FEATURE(1)..(30)Framework region 1
37Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser
Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala
Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr Cys 85 90 95Ala Lys3812PRTHomo
sapiensMISC_FEATURE(1)..(2)Complementarity determining region 3
38Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys1 5 103915PRTHomo
sapiensMISC_FEATURE(1)..(4)Complementarity determining region 3
39Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser1 5 10
1540219PRTHomo sapiens 40Glu Leu Gln Met Thr Gln Ser Pro Ser Ser
Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ser
Ser Gln Ser Leu Leu His Thr 20 25 30Tyr Gly Ser Pro Tyr Leu Asn Trp
Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys
Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60Ser Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile65 70 75 80Ser Ser Leu Gln
Pro Glu Asp Phe Ala Val Tyr Phe Cys Ser Gln Gly 85 90 95Thr His Leu
Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 110Arg
Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 115 120
125Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
130 135 140Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala
Leu Gln145 150 155 160Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln
Asp Ser Lys Asp Ser 165 170 175Thr Tyr Ser Leu Ser Ser Thr Leu Thr
Leu Ser Lys Ala Asp Tyr Glu 180 185 190Lys His Lys Val Tyr Ala Cys
Glu Val Thr His Gln Gly Leu Ser Ser 195 200 205Pro Val Thr Lys Ser
Phe Asn Arg Gly Glu Cys 210 21541448PRTHomo sapiens 41Glu Val Gln
Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30Trp
Met Ser Trp Val Arg Gln Ser Pro Glu Lys Gly Leu Glu Trp Val 35 40
45Ser Glu Ile Arg Leu Arg Ser Asp Asn Tyr Ala Thr His Tyr Ala Glu
50 55 60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn
Thr65 70 75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr
Gly Ile Tyr 85 90 95Tyr Cys Lys Thr Tyr Phe Tyr Ser Phe Ser Tyr Trp
Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser Ala Ser Thr Lys
Gly Pro Ser Val Phe Pro 115 120 125Leu Ala Pro Ser Ser Lys Ser Thr
Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140Cys Leu Val Lys Asp Tyr
Phe Pro Glu Pro Val Thr Val Ser Trp Asn145 150 155 160Ser Gly Ala
Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175Ser
Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185
190Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser
195 200 205Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp
Lys Thr 210 215 220His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu
Gly Gly Pro Ser225 230 235 240Val Phe Leu Phe Pro Pro Lys Pro Lys
Asp Thr Leu Met Ile Ser Arg 245 250 255Thr Pro Glu Val Thr Cys Val
Val Val Asp Val Ser His Glu Asp Pro 260 265 270Glu Val Lys Phe Asn
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275 280 285Lys Thr Lys
Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 290 295 300Ser
Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr305 310
315 320Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
Thr 325 330 335Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val
Tyr Thr Leu 340 345 350Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln
Val Ser Leu Thr Cys 355 360 365Leu Val Lys Gly Phe Tyr Pro Ser Asp
Ile Ala Val Glu Trp Glu Ser 370 375 380Asn Gly Gln Pro Glu Asn Asn
Tyr Lys Thr Thr Pro Pro Val Leu Asp385 390 395 400Ser Asp Gly Ser
Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405 410 415Arg Trp
Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 420 425
430Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys
435 440 445
* * * * *
References